U.S. patent application number 11/925586 was filed with the patent office on 2008-06-19 for moraxella catarrhalis outer membrane protein-106 polypeptide, gene sequence and uses thereof.
This patent application is currently assigned to Emergent Product Development Gaithersburg, Inc.. Invention is credited to Laura Plosila, Kenneth Tucker.
Application Number | 20080145916 11/925586 |
Document ID | / |
Family ID | 24577687 |
Filed Date | 2008-06-19 |
United States Patent
Application |
20080145916 |
Kind Code |
A1 |
Tucker; Kenneth ; et
al. |
June 19, 2008 |
MORAXELLA CATARRHALIS OUTER MEMBRANE PROTEIN-106 POLYPEPTIDE, GENE
SEQUENCE AND USES THEREOF
Abstract
The invention discloses the Moraxella catarrhalis outer membrane
protein-106 (OMP106) polypeptide, polypeptides derived therefrom
(OMP106-derived polypeptides), nucleotide sequences encoding said
polypeptides, and antibodies that specifically bind the OMP106
polypeptide and/or OMP106-derived polypeptides. Also disclosed are
immunogenic, prophylactic or therapeutic compositions, including
vaccines, comprising OMP106 polypeptide and/or OMP106-derived
polypeptides. The invention additionally discloses methods of
inducing immune responses to M. catarrhalis and M. catarrhalis
OMP106 polypeptides and OMP106-derived polypeptides in animals.
Inventors: |
Tucker; Kenneth;
(Germantown, MD) ; Plosila; Laura; (Cary,
NC) |
Correspondence
Address: |
FOLEY AND LARDNER LLP;SUITE 500
3000 K STREET NW
WASHINGTON
DC
20007
US
|
Assignee: |
Emergent Product Development
Gaithersburg, Inc.
|
Family ID: |
24577687 |
Appl. No.: |
11/925586 |
Filed: |
October 26, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
08642712 |
May 3, 1996 |
7341727 |
|
|
11925586 |
|
|
|
|
Current U.S.
Class: |
435/252.1 ;
530/387.9 |
Current CPC
Class: |
C07K 16/1214 20130101;
C07K 2317/734 20130101; A61P 31/04 20180101; A61K 2039/505
20130101; C07K 16/1217 20130101; C07K 16/1203 20130101; Y02A 50/30
20180101; A61K 39/00 20130101; C07K 14/212 20130101; C07K 2317/73
20130101; Y02A 50/396 20180101 |
Class at
Publication: |
435/252.1 ;
530/387.9 |
International
Class: |
C12N 1/20 20060101
C12N001/20; C07K 16/12 20060101 C07K016/12 |
Claims
1-12. (canceled)
13. An isolated antibody that specifically binds OMP106
polypeptide, which is an outer membrane polypeptide of Moraxella
catarrhalis having a molecular weight of about 180 kD as determined
in SDS polyacrylamide gel electrophoresis using rabbit skeletal
muscle myosin and E. coli .beta.-galactosidase as the 200 kD and
116.25 kD molecular weight standards, respectively.
14. An isolated antibody that specifically binds OMP106 polypeptide
or fragment thereof comprising a sequence substantially homologous
to the sequence of SEQ ID NO:1.
15. An isolated antibody according to claim 14 that specifically
binds the OMP106 polypeptide or a fragment thereof comprising the
sequence of SEQ ID NO: 1.
16. The isolated antibody of claim 13, which is a cytotoxic
antibody that mediates complement killing of Moraxella
catarrhalis.
17-28. (canceled)
29. A method of producing a non-hemagglutinating cultivar of M.
catarrhalis from a HA M. catarrhalis strain or cultivar, which
comprises serially passaging a HA M. catarrhalis strain or cultivar
in static liquid cultures.
30. The isolated antibody of claim 14, which is a cytotoxic
antibody that mediates complement killing of Moraxella catarrhalis.
Description
1. INTRODUCTION
[0001] The present invention generally relates to the outer
membrane protein-106 (OMP106) polypeptide of Moraxella catarrhalis.
The invention encompasses a purified OMP106 polypeptide and
polypeptides derived therefrom (OMP106-derived polypeptides). The
invention also encompasses antibodies, including cytotoxic
antibodies, that specifically bind the OMP106 polypeptide and/or
OMP106-derived polypeptides. The invention further encompasses
prophylactic or therapeutic compositions, including vaccines, that
comprise OMP106 polypeptide and/or OMP106-derived polypeptides. The
invention additionally provides methods of inducing immune
responses to M. catarrhalis in mammals. The invention further
provides isolated nucleotide sequences encoding the OMP106
polypeptide and OMP106-derived polypeptides, vectors having said
sequences, and host cells containing said vectors.
2. BACKGROUND OF THE INVENTION
[0002] Moraxella catarrhalis, also known as Moraxella (Branhamella)
catarrhalis or Branhamella catarrhalis and formerly known as
Neisseria catarrhalis or Micrococcus catarrhalis, is a
gram-negative bacterium frequently found in the respiratory tract
of humans. M. catarrhalis, originally thought to be a harmless
commensal organism, is now recognized as an important pathogen in
upper and lower respiratory tract infections in animals. In humans,
M. catarrhalis causes serious lower respiratory tract infections in
adults with chronic lung disease, systemic infections in
immunocompromised patients, and otitis media and sinusitis in
infants and children. See Helminen et al., 1993, Infect. Immun.
61:2003-2010; Catlin, B. W., 1990, Clin. Microbiol. Rev. 3:293-320;
and references cited therein.
2.1. Outer Membrane Proteins and Protective Antibodies
[0003] The outer surface components of Moraxella catarrhalis have
been studied in attempts to understand the pathogenic process of M.
catarrhalis infections and to develop useful therapeutic treatments
and prophylactic measures against such infections. The outer
membrane proteins (OMPs) in particular have received considerable
attention as possible virulence factors and as potential vaccine
antigens. M. catarrhalis has about 10 to 20 different OMPs with 6
to 8 of these, OMPs A to H, as the predominate species (Murphy and
Loeb, 1989, Microbial Pathogen. 6:159-174). The molecular weights
of OMPs A to H range from 97 to 20 kD, respectively. See Bartos and
Murphy, 1988, J. Infect. Dis. 158:761-765; Helminen et al., 1993,
Infect. Immun. 61:2003-2010; Murphy et al, 1993, Molecul.
Microbiol. 10: 87-97; and Sarwar et al, 1992, Infect. Immun.
60:804-809. Comparisons of protein profiles by sodium
dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) of
outer membrane preparations from 50 M. catarrhalis strains show
nearly homogeneous patterns of OMPs A to H (Bartos and Murphy,
1988, J. Infect. Dis. 158:761-765).
[0004] In addition to OMPs A to H, a high molecular weight OMP,
designated HMW-OMP, having an apparent mass of 350 to 720 kD by
SDS-PAGE has also been identified as another prominent surface
component present in many strains of M. catarrhalis. HWM-OMP upon
formic acid denaturation produces a single band of 120 to 140 kD
and, thus, appears to be an oligomeric protein (Klingman and
Murphy, 1994, Infect. Immun. 62:1150-1155). HMW-OMP appears to be
the same protein as that designated UspA by Helminen et al., (1994,
J. Infect. Dis. 170:867-872) and shown to be present in a number of
M. catarrhalis strains.
[0005] In intact bacterium or bacterially-derived outer membrane
vesicles, several of the above-identified OMPs present
surface-exposed epitopes that elicit the production of antibodies
that bind the OMPs. These antigenic OMPs include OMP E and OMP G
(Murphy and Bartos, 1989, Infect. Immun. 57:2938-2941); OMP C/D
(Sarwar et al., 1992, Infect. Immun. 60:804-809); CopB, an 80 kD
OMP, (Helminen et al., 1993, Infect. Immun. 61:2003-2010); and UspA
(Helminen et al., 1994, J. Infect. Dis. 170:867-872).
[0006] The therapeutic potential of antibodies to surfaced-exposed
epitopes of CopB and UspA has been evaluated in an animal model.
The model involved direct bolus inoculation of lungs of BALB/c
VAF/Plus mice with a controlled number of M. catarrhalis cells and
subsequent examination of the rate of pulmonary clearance of the
bacteria (Unhanand et al., 1992, J. Infect. Dis. 165:644-650).
Different clinical isolates of the M. catarrhalis exhibited
different rates of clearance that correlated with the level of
granulocyte recruitment into the infection site. Passive
immunization with a monoclonal antibody directed to a
surface-exposed epitope of either CopB or UspA increased the rate
of pulmonary clearance of M. catarrhalis (Helminen et al., 1993,
Infect. Immun. 61:2003-2010; Helminen et al., 1994, J. Infect. Dis.
170:867-872).
2.2. Bacterial/Host Cell Adherence and Hemagglutination
[0007] The adherence of bacterial pathogens to a host cell surface
promotes colonization and initiates pathogenesis. See, E. H.
Beachey, 1981, J. Infect. Dis. 143:325-345. Gram-negative bacteria
typically express surface lectins that bind to specific
oligosaccharides of glycoproteins and/or glycolipids on the host
cell surface. Such lectins are often associated with pili or
fimbriae. Bacterial adherence can also occur by non-specific
binding resulting from hydrophobic and/or charge interaction with
the host cell surface.
[0008] The mechanism of M. catarrhalis adherence to cells of the
respiratory tract remains poorly understood. The organism adheres
to cultured human oropharyngeal epithelial cells (Mbaki et al.,
1987, Tohuku J. Exp. Med. 153:111-121). A study by Rikitomi et al.
suggests that fimbriae may have a role in the adherence to such
cells as fimbriae denaturation or treatment with anti-fimbriae
antibodies reduced adherence by fimbriated strains (Rikitomi et
al., 1991, Scand. J. Infect. Dis. 23:559-567). Fimbriae mediated
binding, however, cannot be the sole basis of this adherence as the
most highly adhering strain, among the several examined, was a
non-fimbriated strain.
[0009] Hemagglutination reactions often replace the more
complicated adherence assays in classifying bacterial adhesins.
However, Rikitomi et al. found no correlation between human
oropharyngeal epithelial cell adherence and hemagglutination by M.
catarrhalis strains (Id.). That is three highly adhering strains
did not agglutinate human erythrocytes. Thus, different binding
mechanisms are involved in human oropharyngeal epithelial cell
adherence and hemagglutination.
[0010] By contrast, a recent study by Kellens et al. suggests that
hemagglutination by M. catarrhalis is correlated with host cell
adherence (Kellens et al., 1995, Infection 23:37-41). However, this
study employed an adherence assay based on bacterial binding to
porcine tracheal sections. It is unclear whether porcine tracheal
tissue can be considered homologous to human respiratory tract
tissue with respect to adherence by pathogenic strains of M.
catarrhalis.
[0011] Notwithstanding the problematic adherence assay, Kellens et
al. examined the hemagglutination activities of eighty-some
clinical isolates of M. catarrhalis (Kellens et al., 1995,
Infection 23:37-41). Nearly three-quarters of the examined strains
agglutinated human, rabbit, guinea pig, dog or rat erythrocytes,
while the remaining strains did not. The agglutination activities
for some of the hemagglutinating stains were further characterized
and shown to be calcium ion dependent and inhibited by trypsin
digestion or high-temperature treatment or addition of
D-glucosamine or D-galactosamine.
[0012] A survey of hemagglutinating and non-hemagglutinating M.
catarrhalis strains by Tucker et al. has shown that all strains
bind the glycolipid gangliotetraosylceramide but only
hemagglutinating strains bind the glycolipid globotetraosylceramide
(Tucker et al., 1994, Annual Meeting of Amer. Soc. Microbiol.,
Abstract No. D124). Moreover, M. catarrhalis hemagglutination
activity was shown to be inhibited by various monosaccharides that
comprise the carbohydrate moiety of globotetraosylceramide. These
observations led Tucker et al. to suggest that M. catarrhalis
hemagglutinates by binding to globotetraosylceramides in the cell
membranes of susceptible erythrocytes, including those of human red
blood cells. To date, no prior art has identified a molecule on the
outer surface of M. catarrhalis that is responsible for either host
cell adherence or hemagglutination.
[0013] Citation or identification of any reference in this section
or any other section of this application shall not be construed as
an indication that such reference is available as prior art to the
present invention.
3. SUMMARY OF THE INVENTION
[0014] The present invention encompasses the OMP106 polypeptide of
M. catarrhalis and OMP106-derived polypeptides and methods for
making said polypeptides. The invention also encompasses antisera
and antibodies, including cytotoxic antibodies, specific for the
OMP106 polypeptide and/or OMP106-derived polypeptides. The
invention further encompasses immunogenic, prophylactic or
therapeutic compositions, including vaccines, comprising one or
more of said polypeptides. The invention additionally encompasses
nucleotide sequences encoding said polypeptides. The invention
further encompasses immunogenic, prophylactic or therapeutic
compositions, including vaccines, comprising an attentuated or
inactivated non-hemagglutinating M. catarrhalis cultivar.
[0015] The present invention has many utilities. For example, the
OMP106 polypeptide and OMP106-derived polypeptides may be used as
ligands to detect antibodies elicited in response to M. catarrhalis
infections (e.g., in diagnosing M. catarrhalis infections). The
OMP106 polypeptide and OMP106-derived polypeptides may also be used
as immunogens for inducing M. catarrhalis-specific antibodies. Such
antibodies are useful in immunoassays to detect M. catarrhalis in
biological specimens. The cytotoxic antibodies of the invention are
useful in passive immunizations against M. catarrhalis infections.
The OMP106 polypeptide and OMP106-derived polypeptides may further
be used as active ingredients in vaccines against M. catarrhalis
infections.
[0016] The invention is based on the surprising discovery that
hemagglutinating M. catarrhalis strains and cultivars have an outer
membrane protein, OMP106 polypeptide, which is about 180 kD to
about 230 kD in molecular weight, and that non-hemagglutinating M.
catarrhalis strains and cultivars either do not have OMP106
polypeptide or have inappropriately-modified OMP106 polypeptide
which is inactive in hemagglutination and not silver-stainable. The
invention is further based on the discovery that polyclonal
antiserum induced by OMP106 polypeptide isolated from a
hemagglutinating M. catarrhalis strain has cytotoxic activity
against a different hemagglutinating M. catarrhalis strain but not
against a non-hemagglutinating M. catarrhalis strain.
3.1. Definitions and Abbreviations
[0017] anti-OMP106=anti-OMP106 polypeptide antibody or antiserum
[0018] ATCC=American Type Culture Collection [0019] blebs=naturally
occurring outer membrane vesicles of M. catarrhalis [0020]
Gb.sub.4=GalNAc.beta.1-3Gal.alpha.1-4Gal.beta.1-4Glc1-1Ceramide
[0021] HA=hemagglutinating [0022] immuno-reactive=capable of
provoking a cellular or humoral immune response [0023]
kD=kilodaltons [0024] M. catarrhalis=Mc; Moraxella catarrhalis;
Moraxella (Branhamella) catarrhalis; Branhamella catarrhalis;
Neisseria catarrhalis; or Micrococcus catarrhalis [0025]
NHA=non-hemagglutinating [0026] OG=n-octyl g-D-glucopyranoside or
octyl glucoside [0027] OMP106=the outer membrane protein-106
polypeptide of Moraxella catarrhalis, having a molecular weight of
about 180 kD to 230 kD by SDS-PAGE; extractable from blebs or
intact cells of M. catarrhalis by OG or sarkosyl detergent [0028]
OMP106-derived [0029] polypeptide fragment of the OMP106
polypeptide; variant of wild-type OMP106 polypeptide or fragment
thereof, containing one or more amino acid deletions, insertions or
substitutions; or chimeric protein comprising a heterologous
polypeptide fused to the C-terminal or N-terminal or internal
segment of a whole or a portion of the OMP106 polypeptide [0030]
OMP=outer membrane protein [0031] OMPs=outer membrane proteins
[0032] PBS=phosphate buffered saline [0033] PAG polyacrylamide gel
[0034] polypeptide=a peptide of any length, preferably one having
ten or more amino acid residues [0035] SDS=sodium dodecylsulfate
[0036] SDS-PAGE=sodium dodecylsulfate polyacrylamide gel
electrophoresis
[0037] Nucleotide or nucleic acid sequences defined herein are
represented by one-letter symbols for the bases as follows: [0038]
A (adenine) [0039] C (cytosine) [0040] G (guanine) [0041] T
(thymine) [0042] U (uracil) [0043] M (A or C) [0044] R (A or G)
[0045] W (A or T/U) [0046] S(C or G) [0047] Y (C or T/U) [0048] K
(G or T/U) [0049] V (A or C or G; not T/U) [0050] H (A or C or T/U;
not G) [0051] D (A or G or T/U; not C) [0052] B (C or G or T/U; not
A) [0053] N (A or C or G or T/U) or (unknown)
[0054] Peptide and polypeptide sequences defined herein are
represented by one-letter symbols for amino acid residues as
follows: [0055] A (alanine) [0056] R (arginine) [0057] N
(asparagine) [0058] D (aspartic acid) [0059] C (cysteine) [0060] Q
(glutamine) [0061] E (glutamic acid) [0062] G (glycine) [0063] H
(histidine) [0064] I (isoleucine) [0065] L (leucine) [0066] K
(lysine) [0067] M (methionine) [0068] F (phenylalanine) [0069] P
(proline) [0070] S (serine) [0071] T (threonine) [0072] W
(tryptophan) [0073] Y (tyrosine) [0074] V (valine) [0075] X
(unknown)
[0076] The present invention may be more fully understood by
reference to the following detailed description of the invention,
non-limiting examples of specific embodiments of the invention and
the appended figures.
4. BRIEF DESCRIPTION OF THE FIGURES
[0077] FIG. 1: Denaturing PAGE comparison of outer membrane protein
profiles of M. catarrhalis blebs or octyl glucoside (OG) extracts
of whole M. catarrhalis cells. The numbers over the lanes refer to
the ATCC strain designations. A prestained SDS-PAGE standard
(BioRad catalog #161-0305) was used as molecular weight markers.
The standard consisted of the following polypeptides with their
approximate molecular weights noted in parenthesis: rabbit muscle
phosphorylase B (106 kD); bovine serum albumin (80 kD); hen egg
white ovalbumin (49.5 kD); bovine carbonic anhydrase (32.5 kD);
soybean trypsin inhibitor (27.5 kD); hen egg white lysozyme (18.5
kD). The positions of the molecular weight markers in the gel are
noted on the left side of the drawing by arrows with the molecular
weights (kD) of some of the markers above the arrows.
[0078] FIG. 2: Results from overlaying thin layer chromatograms of
glycolipids with .sup.125I-labeled outer membrane blebs. In Panels
A-C, Lane 1 contains glycolipid standards indicated on the left;
Lane 2 contains asialo-GM.sub.1; Lane 3 contains Gb.sub.3,
Gb.sub.4, and Forssman antigen; and Lane 4 contains a Folch
extraction of human erythrocytes. The chromatogram shown in Panel A
is stained with orcinol, the chromatogram shown in Panel B is
overlayed with .sup.125I-labeled blebs of ATCC strain 8176 (a
non-hemagglutinating strain), and the chromatogram shown in Panel C
is overlayed with .sup.125I-labeled blebs of ATCC strain 49143 (a
hemagglutinating strain). Only the hemagglutinating strain bound to
the Gb.sub.4 glycolipid band in the third and fourth lanes.
[0079] FIG. 3: Protein profiles by silver staining of octyl
glucoside extracts of outer membrane proteins following digestion
of the M. catarrhalis cells with the proteases indicated in the
figure. The hemagglutination activity of the cells following the
digestion is indicated below the figure in the row labeled HA. The
molecular weight markers used are as per FIG. 1.
[0080] FIG. 4: Comparison of protein profiles by silver staining of
outer membrane proteins from various ATCC strains of M.
catarrhalis. The strain designations are indicated above the lanes.
The hemagglutination activity of the strains are indicated in the
row labeled HA below the figure. Note a protein having an apparent
molecular weight greater than that of rabbit muscle phosphorylase B
(106 kD) is common to the hemagglutinating strains, but is absent
in the non-hemagglutinating strains. This polypeptide is designated
OMP106. The molecular weight markers used are as per FIG. 1.
[0081] FIG. 5: Comparison of protein profiles by silver staining of
outer membrane proteins from two M. catarrhalis ATCC 49143
cultivars: 49143 (hemagglutinating cultivar) and 49143-NHA
(non-hemagglutinating cultivar). The hemagglutination activities of
the cultivars are indicated below the figure in the row labeled HA.
Note the absence of the OMP106 polypeptide band (indicated by <)
in the non-hemagglutinating cultivar. The molecular weight markers
used are as per FIG. 1.
[0082] FIG. 6: Molecular weight estimation of OMP106 in a 6%
denaturing polyacrylamide gel using OG extracts of ATCC strain
49143 that were incubated in sample buffer at either 25.degree. C.
or 100.degree. C. prior to application to the gel. Proteins in the
gel were visualized by reductive silver staining. Note that the
OMP106 polypeptide band (indicated by the <) is seen only in the
sample incubated at 100.degree. C. A broad range SDS-PAGE standard
(BioRad catalog #161-0317) was used as molecular weight markers.
The standard consisted of the following polypeptides (approximate
molecular weights noted in parenthesis): rabbit skeletal muscle
myosin (200 kD); E. coli .beta.-galactosidase (116 kD); rabbit
muscle phosphorylase B (97.4 kD); bovine serum albumin (66.2 kD).
The positions of the molecular weight markers in the gel are noted
on the right side of the figure by arrows with the molecular
weights (kD) of the markers above the arrows.
[0083] FIG. 7: Southern blot analysis of DraI and HindIII
restriction endonuclease digests of M. catarrhalis chromosomal DNA
probed with Mc5-72. DNA of M. catarrhalis strain 49143 was digested
with DraI or HindIII. Southern analysis of the digested DNA was
carried out using Mc5-72 (SEQ ID NO:4) as the probe. The high
stringency wash was 2.times.SSC, 1% SDS at 50.degree. C. for about
20 to about 30 minutes. Lane 1 contains HindIII digest; the
hybridizing band has an approximate size of 8.0 kB. Lane 2 contains
DraI digest: the hybridizing band has an approximate size of 4.2
kB.
[0084] FIGS. 8A and 8B: Western Blots of protein extracts of M.
catarrhalis and related species using a rabbit antiserum to OMP106
as the probe (FIG. 8A), compared to the reactivity of the serum
prior to immunization of the rabbit with OMP106 (FIG. 8B). Samples
in the lanes of FIGS. 8A and 8B are as follows: Lane A, M.
catarrhalis; Lane B, Moraxella ovis; Lane C, Moraxella lacunata;
Lane D, Moraxella osloensis; Lane E, Moraxella bovis; Lane F,
Neisseria meningitidis; Lane G, Neisseria gonorrhoeae. The
molecular weight markers used are as per FIG. 1.
[0085] FIG. 9A. Western blot demonstrating that a rabbit antiserum
to the OMP106 polypeptide from M. catarrhalis ATCC 49143
cross-reacts with a polypeptide of a similar molecular weight in a
number of HA and NHA strains of M. catarrhalis (the location of the
OMP106 polypeptide is indicated by the arrow). The Western examined
octyl glucoside extracts of various M. catarrhalis strains. The
ATCC accession numbers of the strains are indicated at the top of
the lanes. The transfer and Western blot procedures used were
identical to those used to obtain the blots shown in FIG. 8.
[0086] FIG. 9B. Western blot of the same extracts as those in FIG.
9A using the pre-immune serum corresponding to that used in FIG.
9A.
5. DETAILED DESCRIPTION OF THE INVENTION
5.1. Hemagglutinating and Non-Hemagglutinating Cultivars
[0087] The invention provides an isolated or a substantially pure
OMP106 polypeptide of M. catarrhalis. The OMP106 polypeptide
comprises the whole or a subunit of a protein embedded in or
located on the outer surface of the outer membrane of
hemagglutinating (HA) strains and many nonhemagglutinating (NHA)
strains and cultivars of M. catarrhalis. OMP106 contributes
directly or indirectly to the hemagglutination phenotype of the HA
strains and cultivars. According to the invention, HA M.
catarrhalis cells agglutinate human or rabbit erythrocytes in any
standard hemagglutination assay, such as the one taught by
Soto-Hernandez et al. 1989, J. Clin. Microbiol. 27:903-908.
Although not intending to be limited to any particular mechanism of
action, it is presently envisaged that M. catarrhalis agglutinates
erythrocytes by binding to the globotetrose (Gb.sub.4) moiety of
glycolipid and glycoprotein receptors on the host cell surfaces and
that the hemagglutination activity is mediated in part by
appropriately modified OMP106 polypeptide, which has the particular
property of being susceptible to silver staining. By contrast,
unmodified or inappropriately modified OMP106 polypeptide is
neither active in mediating hemagglutination nor silver-stainable.
Moreover, OMP106 polypeptide is the only polypeptide having an
apparent molecular weight of about 180 kD to about 230 kD in
SDS-PAGE that is OG- or sarkosyl-extractable from HA or NHA M.
catarrhalis blebs or intact cells.
[0088] The hemagglutination activity of HA M. catarrhalis cells is
inhibited by globotetrose
(GalNAc.beta.1-3Gal.beta.1-4Gal.beta.1-4Glc.beta.1; Gb.sub.4) and
the monosaccharides that comprise Gb4, including
N-acetyl-D-galactosamine, D-galactose and glucose, and derivatives
thereof, such as methyl-.infin.-galactose or
methyl-.beta.-galactose. The hemagglutination activity of HA M.
catarrhalis cells is also inhibited by relatively higher
concentrations of a number of other sugars including but not
limited to D-mannose, L-fucose, D-glucose, and
N-acetyl-D-glucosamine.
[0089] The hemagglutination activity and the OMP106 polypeptide of
intact HA M. catarrhalis cells are both reduced or destroyed by
digestion of intact M. catarrhalis cells by various proteases
including, but not limited to, TLCK (N.alpha.-ptosyl-L-lysine
chloro methyl ketone [also known as
1-chloro-3-tosylamino-7-amino-L-2-heptanone])-treated chymotrypsin,
proteinase K and TPCK (N-tosyl-L-phenylalanine chloromethyl
ketone)-treated trypsin. Protease V8 digestion of intact HA M.
catarrhalis cells, however, affects neither the hemagglutination
activity nor the physical integrity of the OMP106 polypeptide of
such cells.
[0090] A non-hemagglutinating (NHA) cultivar may be derived from a
HA M. catarrhalis strain or cultivar by serial passage in static
liquid cultures (i.e., liquid cultures maintained at 35.degree. C.
without shaking). For example, a HA M. catarrhalis strain or
cultivar is grown in Mueller Hinton broth and every five days an
inoculum is taken from the surface of the static culture to
inoculate a subsequent static culture. The preferred inoculum is
any floating mat of cells at the surface of the culture. Passaging
in static cultures is maintained until a NHA cultivar is produced.
A NHA cultivar of the invention may be used to produce protective
vaccines, such as whole cell vaccines, against M. catarrhalis
infections.
[0091] By contrast, the hemagglutinating phenotype of a HA M.
catarrhalis strain or cultivar can be maintained by passaging the
strain or cultivar in shaking liquid cultures. In an embodiment, a
HA M. catarrhalis strain or cultivar is grown in Mueller Hinton
broth at 35 to 37.degree. C. with shaking at about 200 RPM and
passaged every 24 to 48 hours. The hemagglutinating phenotype of a
HA M. catarrhalis strain or cultivar also can be maintained by
passaging on solid media. For example, a HA M. catarrhalis strain
or cultivar is grown on a plate containing blood agar or Mueller
Hinton agar.
5.2. OMP106 Polypeptide
[0092] OMP106 polypeptide of the invention is the sole outer
membrane protein of a HA M. catarrhalis strain or cultivar that has
an apparent molecular weight in SDS-PAGE of about 180 kD to about
230 kD, preferably about 190 kD. According to the invention, an
outer membrane protein of M. catarrhalis is a polypeptide that is
present in M. catarrhalis blebs, or that can be extracted from M.
catarrhalis blebs or intact cells by n-octyl
.beta.-D-glucopyranoside (OG) or sarkosyl detergent in buffer
solution at room temperature. See Murphy and Loeb, 1989, Microbial
Pathogenesis 6:159-174, for a discussion of M. catarrhalis blebs,
which are naturally occurring vesicles consisting of the outer
membrane of M. catarrhalis. NHA M. catarrhalis strains or cultivars
either do not have OMP106 polypeptide, or have OMP106 polypeptide
in a form that binds anti-OMP106 antibodies (see Section 5.5.,
infra) but does not react with silver stain (i.e., using Silver
Stain Plus of BioRad [Richmond, Calif.], or the procedure described
by Gottlieb and Chauko, 1987, Anal. Biochem. 165:33). By contrast,
OMP106 polypeptide from HA M. catarrhalis strains or cultivars
binds anti-OMP106 antibodies, and reacts with silver stain.
[0093] OMP106 polypeptide may be identified in HA M. catarrhalis
blebs or intact cells by its susceptibility to degradation by
protease treatment that also abolishes or attenuates the
hemagglutination activity of the same HA strain (See Section 5.1.
above for examples of proteases that do or do not destroy
hemagglutination activity of intact M. catarrhalis cells). In other
words, digestion with a protease that destroys or reduces the
hemagglutination activity of a HA strain or cultivar will also
change, in SDS-PAGE, the abundance or the location of OMP106
polypeptide isolated from the strain or cultivar after such a
digestion as compared to that isolated from the same strain or
cultivar before the digestion.
[0094] OMP106 polypeptide may also be identified as the polypeptide
in OG or sarkosyl extract of M. catarrhalis blebs or intact cells
that has an apparent molecular weight of greater than 106 kD as
determined by denaturing gel electrophoresis in 12% PAG with SDS,
using formulations as described in Harlow and Lane (Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., Appendix I, 1988). Heat treatment of the OG or
sarkosyl extract at 100.degree. C. for 5 minutes can cause the
OMP106 polypeptide to have an apparent molecular weight of about
180 kD to about 230 kD as determined by SDS-PAGE in 6% PAG without
any reducing agents, using formulations as described in Harlow and
Lane, id. In a particular embodiment, OMP106 polypeptide in the
heat-treated OG or sarkosyl extract of M. catarrhalis strain ATCC
49143 has an apparent molecular weight of about 190 kD.
[0095] In particular embodiments, the OMP106 polypeptide is that
prepared from any of M. catarrhalis strains including, but not
limited to, ATCC 49143, ATCC 25238, ATCC 25240, ATCC 43617, ATCC
43618, ATCC 43627 and ATCC 43628. The preferred source of OMP106
polypeptide is a HA cultivar of such strains. The more preferred
source is a HA cultivar of ATCC 49143.
[0096] In a particular embodiment, OMP106 polypeptide comprises,
preferably at the amino-terminal, the amino acid sequence
IGISEADGGKGGANARGDKSIAIGDIAQALGSQSIAIGDNKIV (SEQ ID NO:1) or a
sequence substantially homologous thereto. The OMP106 polypeptide
may additionally comprise, carboxyl-distal to the above mentioned
sequence, an octapeptide having the amino acid sequence GTVLGGKK
(SEQ ID NO:2) or a sequence substantially homologous thereto. As
used herein a substantially homologous amino acid sequence is at
least 80%, preferably 100%, identical to the referenced amino acid
sequence.
[0097] According to various aspects of the invention, the
polypeptides of the invention are characterized by their apparent
molecular weights based on the polypeptides' migration in SDS-PAGE
relative to the migration of known molecular weight markers. While
any molecular weight standards known in the art may be used with
the SDS-PAGE, preferred molecular weight markers comprise at least
rabbit skeletal muscle myosin, E. coli .beta.-galactosidase and
rabbit muscle phosphorylase B. One skilled in the art will
appreciate that the polypeptides of the invention may migrate
differently in different types of gel systems (e.g., different
buffers; different concentration of gel, crosslinker or SDS). One
skilled in the art will also appreciate that the polypeptides may
have different apparent molecular weights due to different
molecular weight markers used with the SDS-PAGE. Hence, the
molecular weight characterization of the polypeptides of the
invention is intended to be directed to cover the same polypeptides
on any SDS-PAGE systems and with any molecular weight markers which
might indicate sightly different apparent molecular weights for the
polypeptides than those disclosed here.
5.3. OMP106-Derived Polypeptides
[0098] An OMP106-derived polypeptide of the invention may be a
fragment of the OMP106 polypeptide. The intact OMP106 polypeptide
may contain one or more amino acid residues that are not necessary
to its immunogenicity. It may be the case, for example, that only
the amino acid residues forming a particular epitope of the OMP106
polypeptide is necessary for immunogenic activity. Unnecessary
amino acid sequences can be removed by techniques well-known in the
art. For example, the unwanted amino acid sequences can be removed
by limited proteolytic digestion using enzymes such as trypsin,
papain, or related proteolytic enzymes or by chemical cleavage
using agents such as cyanogen bromide and followed by fractionation
of the digestion or cleavage products.
[0099] An OMP106-derived polypeptide of the invention may also be a
modified OMP106 polypeptide or fragment thereof (i.e., an OMP106
polypeptide or fragment having one or more amino acid
substitutions, insertions and/or deletions of the wild-type OMP106
sequence). Such modifications may enhance the immunogenicity of the
resultant polypeptide product or have no effect on such activity.
Modification techniques that may be used include those disclosed in
U.S. Pat. No. 4,526,716.
[0100] An OMP106-derived polypeptide may further be a chimeric
polypeptide comprising one or more heterologous polypeptides fused
to the amino-terminal or carboxyl-terminal or internal of a
complete OMP106 polypeptide or a portion of or a fragment thereof.
Useful heterologous polypeptides comprising such chimeric
polypeptide include, but are not limited to, a) pre- and/or
pro-sequences that facilitate the transport, translocation and/or
processing of the OMP106-derived polypeptide in a host cell, b)
affinity purification sequences, and c) any useful immunogenic
sequences (e.g., sequences encoding one or more epitopes of a
surface-exposed protein of a microbial pathogen).
[0101] Preferably, the OMP106-derived polypeptides of the invention
are immunologically cross-reactive with the OMP106 polypeptide,
thus being capable of eliciting in an animal an immune response to
M. catarrhalis. More preferably, the OMP106-derived polypeptides of
the invention comprise sequences forming one or more outer-surface
epitopes of the native OMP106 polypeptide of M. catarrhalis (i.e.,
the surface-exposed epitopes of OMP106 polypeptide as it exists in
intact M. catarrhalis cells). Such preferred OMP106-derived
polypeptides can be identified by their ability to specifically
bind antibodies raised to intact M. catarrhalis cells (e.g.,
antibodies elicited by formaldehyde or glutaldehyde fixed M.
catarrhalis cells; such antibodies are referred to herein as
"anti-whole cell" antibodies). For example, polypeptides or
peptides from a limited or complete protease digestion of the
OMP106 polypeptide are fractionated using standard methods and
tested for their ability to bind anti-whole cell antibodies.
Reactive polypeptides comprise preferred OMP106-derived
polypeptides. They are isolated and their amino acid sequences
determined by methods known in the art.
[0102] Also preferably, the OMP106-derived polypeptides of the
invention comprise sequences that form one or more epitopes of
native OMP106 polypeptide that mediate hemagglutination by HA M.
catarrhalis cells. Such preferred OMP106-derived polypeptides may
be identified by their ability to interfere with hemagglutination
by HA M. catarrhalis cells. For example, polypeptides from a
limited or complete protease digestion or chemical cleavage of
OMP106 polypeptide are fractionated using standard methods and
tested for the ability to interfere in hemagglutination by M.
catarrhalis cells. Once identified and isolated the amino acid
sequences of such preferred OMP106-derived polypeptides are
determined using standard sequencing methods. The determined
sequence may be used to enable production of such polypeptides by
synthetic chemical and/or genetic-engineering means.
[0103] These preferred OMP106-derived polypeptides also can be
identified by using anti-whole cell antibodies to screen bacterial
libraries expressing random fragments of M. catarrhalis genomic DNA
or cloned nucleotide sequences encoding the OMP106 polypeptide.
See, e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual,
2nd ed., Cold Spring Harbor Press, NY, Vol. 1, Chapter 12. The
reactive clones are identified and their inserts are isolated and
sequenced to determine the amino acid sequences of such preferred
OMP106-derived polypeptides.
5.4. Isolation and Purification of OMP106 Polypeptide and
OMP106-Derived Polypeptides
[0104] The invention provides isolated OMP106 polypeptides and
OMP106-derived polypeptides. As used herein, the term "isolated"
means that the product is significantly free of other biological
materials with which it is naturally associated. That is, for
example, an isolated OMP106 polypeptide composition is between
about 70% and 94% pure OMP106 polypeptide by weight. Preferably,
the OMP106 polypeptides and OMP106-derived polypeptides of the
invention are purified. As used herein, the term "purified" means
that the product is substantially free of other biological material
with which it is naturally associated. That is comprising a
purified OMP106 polypeptide composition is at least 95% pure OMP106
polypeptide by weight, preferably at least 98% pure OMP106
polypeptide by weight, and most preferably at least 99% pure OMP106
polypeptide by weight.
[0105] The OMP106 polypeptide of the invention may be isolated from
protein extracts including whole cell extract, of any M.
catarrhalis strain or cultivar. Preferably, the protein extract is
an octyl glucoside or sarkosyl extract of outer membrane vesicles
(i.e., blebs) or whole cells of M. catarrhalis including, but not
limited to, any of strains TCC 49143, ATCC 25238, ATCC 25240, ATCC
43617, ATCC 43618, TCC 43627 and ATCC 43628. The preferred source
of such extracts is a HA cultivar of such strains. The more
referred source of such extracts is a HA cultivar of ATCC 49143.
Another source of the OMP106 polypeptide is protein preparations
from gene expression systems expressing cloned sequences encoding
OMP106 polypeptide or OMP106-derived polypeptides (see Section
5.8., infra).
[0106] The OMP106 polypeptide can be isolated and purified from the
source material using any biochemical technique and approach well
known to those skilled in the art. In one approach, M. catarrhalis
outer membrane is obtained by standard techniques and outer
membrane proteins are solubilized using a solubilizing compound
such as a detergent. A preferred solubilizing solution is one
containing about 1.25% octyl glucopyranoside w/v (OG). Another
preferred solubilizing solution is one containing about 1.25%
sarkosyl. OMP106 polypeptide is in the solubilized fraction.
Cellular debris and insoluble material in the extract are separated
and removed preferably by centrifuging. The polypeptides in the
extract are concentrated, incubated in SDS-containing Laemmli gel
sample buffer at 100.degree. C. for 5 minutes and then fractionated
by electrophoresis in a 6% denaturing sodium dodecylsulfate (SDS)
polyacrylamide gel (PAG) without reducing agent. See Laemmli, 1970,
Nature 227:680-685. The band or fraction identified as OMP106
polypeptide as described above (e.g., the silver-stained
polypeptide band that is present in the OG or sarkosyl extract of a
HA but not that of a corresponding NHA cultivar or that of the HA
cultivar after digestion with a protease that abolishes
hemagglutination activity) may then be isolated directly from the
fraction or gel slice containing the OMP106 polypeptide. In a
preferred embodiment, OMP106 polypeptide has an apparent molecular
weight of 190 kD as determined by comparing its migration distance
or rate in a denaturing SDS-PAGE relative to those of rabbit
skeletal muscle myosin (200 kD) and E. coli .beta.-galactosidase
(116 kD).
[0107] Another method of purifying OMP106 polypeptide is by
affinity chromatography using anti-OMP106 antibodies, (see Section
5.5). Preferably, monoclonal anti-OMP106 antibodies are used. The
antibodies are covalently linked to agarose gels activated by
cyanogen bromide or succinamide esters (Affi-Gel, BioRad, Inc.) or
by other methods known to those skilled in the art. The protein
extract is loaded on the top of the gel as described above. The
contact is for a period of time and under standard reaction
conditions sufficient for OMP106 polypeptide to bind to the
antibody. Preferably, the solid support is a material used in a
chromatographic column. OMP106 polypeptide is then removed from the
antibody, thereby permitting the recovery OMP106 polypeptide in
isolated, or preferably, purified form.
[0108] An OMP106-derived polypeptide of the invention can be
produced by chemical and/or enzymatic cleavage or degradation of
isolated or purified OMP106 polypeptide. An OMP106-derived
polypeptide can also be chemically synthesized based on the known
amino acid sequence of OMP106 polypeptide and, in the case of a
chimeric polypeptide, those of the heterologous polypeptide by
methods well-known in the art. See, for example, Creighton, 1983,
Proteins: Structures and Molecular Principles, W.H. Freeman and
Co., NY.
[0109] An OMP106-derived polypeptide can also be produced in a gene
expression system expressing a recombinant nucleotide construct
comprising sequences encoding OMP106-derived polypeptides. The
nucleotide sequences encoding polypeptides of the invention may be
synthesized, and/or cloned, and expressed according to techniques
well known to those skilled in the art. See, for example, Sambrook,
et al., 1989, Molecular Cloning, A Laboratory Manual, Vols. 1-3,
Cold Spring Harbor Press, NY, Chapter 9.
[0110] OMP106-derived polypeptides of the invention can be
fractionated and purified by the application of standard protein
purification techniques, modified and applied in accordance with
the discoveries and teachings described herein. In particular,
preferred OMP106-polypeptides of the invention, those that form an
outer-surface epitope of the native OMP106 polypeptide may be
isolated and purified according to the affinity procedures
disclosed above for the isolation and purification of OMP106
polypeptide (e.g., affinity purification using anti-OMP106
antibodies.
[0111] If desirable, the polypeptides of the invention may be
further purified using standard protein or peptide purification
techniques including but are not limited to electrophoresis,
centrifugation, gel filtration, precipitation, dialysis,
chromatography (including ion exchange chromatography, affinity
chromatography, immunoadsorbent affinity chromatography,
reverse-phase high performance liquid chromatography, and gel
permeation high performance liquid chromatography), isoelectric
focusing, and variations and combinations thereof.
[0112] One or more of these techniques may be employed sequentially
in a procedure designed to separate molecules according to their
physical or chemical characteristics. These characteristics include
the hydrophobicity, charge, binding capability, and molecular
weight of the protein. The various fractions of materials obtained
after each technique are tested for their abilities to bind the
OMP106 receptor or ligand, to bind anti-OMP106 antibodies or to
interfere with hemagglutination by HA M. catarrhalis cells ("test"
activities). Those fractions showing such activity are then
subjected to the next technique in the sequential procedure, and
the new fractions are tested again. The process is repeated until
only one fraction having the above described "test" activities
remains and that fraction produces only a single band or entity
when subjected to polyacrylamide gel electrophoresis or
chromatography.
5.5. OMP106 Immunogens and Anti-OMP106 Antibodies
[0113] The present invention provides antibodies that specifically
bind OMP106 polypeptide or OMP106-derived polypeptides. For the
production of such antibodies, isolated or preferably, purified
preparations of OMP106 polypeptide or OMP106-derived polypeptides
are used as immunogens.
[0114] In an embodiment, the OMP106 polypeptide is separated from
other outer membrane proteins present in the OG or sarksyl extract
of outer membrane of HA M. catarrhalis cells or blebs using
SDS-PAGE (see Section 5.2. above) and the gel slice containing
OMP106 polypeptide is used as the immunogen and injected into a
rabbit to produce antisera containing polyclonal OMP106 antibodies.
The same immunogen can be used to immunize mice for the production
of hybridoma lines that produce monoclonal anti-OMP106 antibodies.
In particular embodiments, a PAG slice containing isolated or
purified OMP106 from any of strains ATCC 49143, ATCC 25238, ATCC
25240, ATCC 43617, ATCC 43618, ATCC 43627 and ATCC 43628 is used as
the immunogen. In preferred embodiments, a PAG slice containing
isolated or purified OMP106 from a HA cultivar of such strains is
used. In a more preferred embodiment, a PAG slice containing
isolated or purified OMP106 from a HA cultivar of strain ATCC 49143
is used as the immunogen.
[0115] In other embodiments, peptide fragments of OMP106
polypeptide are used as immunogens. Preferably, peptide fragments
of purified OMP106 polypeptide are used. The peptides may be
produced by protease digestion, chemical cleavage of isolated or
purified OMP106 polypeptide or chemical synthesis and then may be
isolated or purified. Such isolated or purified peptides can be
used directly as immunogens. In particular embodiments, useful
peptide fragments include but are not limited to those having the
sequence IGISEADGGKGGANARGDKSIAIGDIAQALGSQSIAIGDNKIV (SEQ ID NO:1)
or any portion thereof that is 6 or more amino acids in length. In
an another embodiment, the peptide fragment has the sequence
GTVLGGKK (SEQ ID NO:2).
[0116] Useful immunogens may also comprise such peptides or peptide
fragments conjugated to a carrier molecule, preferably a carrier
protein. Carrier proteins may be any commonly used in immunology,
include, but are not limited to, bovine serum albumin (BSA),
chicken albumin, keyhole limpet hemocyanin (KLH) and the like. For
a discussion of hapten protein conjugates, see, for example,
Hartlow, et al., Antibodies: A Laboratory Manual, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1988, or a
standard immunology textbook such as Roitt, I. et al., IMMUNOLOGY,
C. V. Mosby Co., St. Louis, Mo. (1985) or Klein, J., IMMUNOLOGY,
Blackwell Scientific Publications, Inc., Cambridge, Mass.,
(1990).
[0117] In yet another embodiment, for the production of antibodies
that specifically bind one or more outer-surface epitopes of the
native OMP106 polypeptide, intact HA M. catarrhalis cells or blebs
prepared therefrom are used as immunogen. The cells or blebs may be
fixed with agents such as formaldehyde or glutaldehyde before
immunization. See Harlow and Lane, Antibodies: A Laboratory Manual,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1988, Chapter 15. It is preferred that such anti-whole cell
antibodies be monoclonal antibodies. Hybridoma lines producing the
desired monoclonal antibodies can be identified by using purified
OMP106 polypeptide as the screening ligand. Cells or blebs of any
M. catarrhalis strain including, but not limited to, ATCC 49143,
ATCC 25238, ATCC 25240, ATCC 43617, ATCC 43618, ATCC 43627 and ATCC
43628 are used as the immunogen for inducing these antibodies.
Preferably, cells or blebs of a HA cultivar of such strains are
used as the immunogen. More preferably, cells or blebs of a HA
cultivar of strain ATCC 49143 are used as the immunogen for
inducing these antibodies.
[0118] Polyclonal antibodies produced by whole cell or bleb
immunizations contain antibodies that bind other M. catarrhalis
outer membrane proteins ("non-anti-OMP106 antibodies") and thus are
more cumbersome to use where it is known or suspected that the
sample contains other M. catarrhalis outer membrane proteins or
materials that are cross-reactive with these other outer membrane
proteins. Under such circumstances, any binding by the anti-whole
cell antibodies of a given sample or band must be verified by
coincidental binding of the same sample or band by antibodies that
specifically bind OMP106 polypeptide (e.g., anti-OMP106) and/or a
OMP106-derived polypeptide, or by competition tests using
anti-OMP106 antibodies, OMP106 polypeptide or OMP106-derived
polypeptide as the competitor (i.e., addition of anti-OMP106
antibodies, OMP106 polypeptide or OMP106-derived polypeptide to the
reaction mix lowers or abolishes sample binding by anti-whole cell
antibodies). Alternatively, such polyclonal antisera, containing
"non-anti-OMP106" antibodies, may be cleared of such antibodies by
standard approaches and methods. For example, the non-anti-OMP106
antibodies may be removed by precipitation with cells of NHA M.
catarrhalis cultivars or M. catarrhalis strains known not to have
the OMP106 polypeptide (e.g., ATCC 8176, more preferably a NHA
cultivar of ATCC 49143); or by absorption to columns comprising
such cells or outer membrane proteins of such cells.
[0119] In further embodiments, useful immunogens for eliciting
antibodies of the invention comprise mixtures of two or more of any
of the above-mentioned individual immunogens.
[0120] Immunization of mammals with the immunogens described
herein, preferably humans, rabbits, rats, mice, sheep, goats, cows
or horses, is performed following procedures well known to those
skilled in the art, for purposes of obtaining antisera containing
polyclonal antibodies or hybridoma lines secreting monoclonal
antibodies.
[0121] Monoclonal antibodies can be prepared by standard
techniques, given the teachings contained herein. Such techniques
are disclosed, for example, in U.S. Pat. No. 4,271,145 and U.S.
Pat. No. 4,196,265. Briefly, an animal is immunized with the
immunogen. Hybridomas are prepared by fusing spleen cells from the
immunized animal with myeloma cells. The fusion products are
screened for those producing antibodies that bind to the immunogen.
The positive hybridomas clones are isolated, and the monoclonal
antibodies are recovered from those clones.
[0122] Immunization regimens for production of both polyclonal and
monoclonal antibodies are well-known in the art. The immunogen may
be injected by any of a number of routes, including subcutaneous,
intravenous, intraperitoneal, intradermal, intramuscular, mucosal,
or a combination of these. The immunogen may be injected in soluble
form, aggregate form, attached to a physical carrier, or mixed with
an adjuvant, using methods and materials well-known in the art. The
antisera and antibodies may be purified using column chromatography
methods well known to those of skill in the art.
[0123] According to the present invention, OMP106 polypeptides of
M. catarrhalis strains, HA or NHA, are immuno-cross reactive. Thus,
antibodies raised to OMP106 polypeptide of one M. catarrhalis
strain or cultivar specifically bind OMP106 polypeptide and
OMP106-derived polypeptides of other M. catarrhalis strains and
cultivars. For example, polyclonal anti-OMP106 antibodies induced
by OMP106 polypeptide of strain ATCC 49143 specifically bind not
only the homologous OMP106 polypeptide (i.e., the OMP106
polypeptide of strain ATCC 49143) but also OMP106 polypeptide
and/or OMP106-derived polypeptides of other M. catarrhalis strains
including, but not limited to, ATCC 43628, ATCC 43627, ATCC 43618,
ATCC 43617, ATCC 25240 and ATCC 25238.
[0124] The antibodies of the invention, including but not limited
to anti-OMP106 antibodies, can be used to facilitate isolation and
purification of OMP106 polypeptide and OMP106-derived polypeptides.
The antibodies may also be used as probes for identifying clones in
expression libraries that have inserts encoding OMP106 polypeptide
or fragments thereof. The antibodies may also be used in
immunoassays (e.g., ELISA, RIA, Westerns) to specifically detect
and/or quantitate M. catarrhalis in biological specimens.
Anti-OMP106 antibodies of the invention specifically bind OMP106
polypeptide and do not bind proteins from related bacterial
pathogens such as Moraxella ovis, Moraxella lacunata, Moraxella
osloensis, Moraxella bovis, Neisseria meningitidis, Neisseria
gonorrhoeae. Thus anti-OMP106 antibodies can be used to diagnose M.
catarrhalis infections.
[0125] The antibodies of the invention, particularly those which
are cytotoxic, may also be used in passive immunization to prevent
or attenuate M. catarrhalis infections of animals, including
humans. (As used herein, a cytotoxic antibody is one which enhances
opsinization and/or complement killing of the bacterium bound by
the antibody) An effective concentration of polyclonal or
monoclonal antibodies raised against the immunogens of the
invention may be administered to a host to achieve such effects.
The exact concentration of the antibodies administered will vary
according to each specific antibody preparation, but may be
determined using standard techniques well known to those of
ordinary skill in the art. Administration of the antibodies may be
accomplished using a variety of techniques, including, but not
limited to those described in Section 5.6. for the delivery of
vaccines.
[0126] Prophylactic and therapeutic efficacies of the antibodies of
the invention can be determined by standard pharmaceutical
procedures in experimental animals. The data obtained from animal
studies can be used in formulating a range of dosages for use in
humans.
5.6. Vaccines
[0127] The present invention also provides therapeutic and
prophylactic vaccines against M. catarrhalis infections of animals,
including mammals, and more specifically rodents, primates, and
humans. The preferred use of the vaccines is in humans. The
vaccines can be prepared by techniques known to those skilled in
the art and would comprise, for example, the antigen in form of an
immunogen, a pharmaceutically acceptable carrier, possibly an
appropriate adjuvant, and possibly other materials traditionally
found in vaccines. An immunologically effective amount of the
immunogen to be used in the vaccine is determined by means known in
the art in view of the teachings herein.
[0128] The vaccines of the present invention comprise an
immunologically effective amount of any of the immunogens disclosed
in Section 5.5. in a pharmaceutically acceptable carrier.
[0129] According to another embodiment, the vaccines of the
invention comprise an immunologically effective amount of an
inactivated or attenuated HA M. catarrhalis cultivar or NHA M.
catarrhalis cultivar of the invention. An inactivated or attenuated
HA M. catarrhalis cultivar or NHA M. catarrhalis cultivar is
obtained using any methods known in the art including, but not
limited to, chemical treatment (e.g., formalin), heat treatment and
irradiation.
[0130] The term "immunologically effective amount" is used herein
to mean an amount sufficient to induce an immune response which can
prevent M. catarrhalis infections or attenuate the severity of any
preexisting or subsequent M. catarrhalis infections. The exact
concentration will depend upon the specific immunogen to be
administered, but may be determined by using standard techniques
well known to those skilled in the art for assaying the development
of an immune response.
[0131] Useful polypeptide immunogens include the isolated OMP106
polypeptide and OMP106-derived polypeptides. Preferred immunogens
include the purified OMP106 polypeptide and derived polypeptides or
peptides of OMP106. The combined immunogen and carrier may be an
aqueous solution, emulsion or suspension. In general, the quantity
of polypeptide immunogen will be between 0.1 and 500 micrograms per
dose. The carriers are known to those skilled in the art and
include stabilizers, diluents, and buffers. Suitable stabilizers
include carbohydrates, such as sorbitol, lactose, manitol, starch,
sucrose, dextran, and glucose and proteins, such as albumin or
casein. Suitable diluents include saline, Hanks Balanced Salts, and
Ringers solution. Suitable buffers include an alkali metal
phosphate, an alkali metal carbonate, or an alkaline earth metal
carbonate. The vaccine may also contain one or more adjuvants to
improve or enhance the immunological response. Suitable adjuvants
include, but are not limited to, peptides; aluminum hydroxide;
aluminum phosphate; aluminum oxide; a composition that consists of
a mineral oil, such as Marcol 52, or a vegetable oil and one or
more emulsifying agents, or surface active substances such as
lysolecithin, polycations, polyanions; and potentially useful human
adjuvants such as BCG and Corynebacterium parvum. The vaccine may
also contain other immunogens. Such a cocktail vaccine has the
advantage that immunity against several pathogens can be obtained
by a single administration. Examples of other immunogens are those
used in the known DPT vaccines.
[0132] The vaccines of the invention are prepared by techniques
known to those skilled in the art, given the teachings contained
herein. Generally, an immunogen is mixed with the carrier to form a
solution, suspension, or emulsion. One or more of the additives
discussed above may be in the carrier or may be added subsequently.
The vaccine preparations may be desiccated, for example, by freeze
drying for storage purposes. If so, they may be subsequently
reconstituted into liquid vaccines by the addition of an
appropriate liquid carrier.
[0133] The vaccines are administered to humans or other mammals,
including rodents and primates. They can be administered in one or
more doses. The vaccines may be administered by known routes of
administration. Many methods may be used to introduce the vaccine
formulations described here. These methods include but are not
limited to oral, intradermal, intramuscular, intraperitoneal,
intravenous, subcutaneous, and intranasal routes. The preferred
routes are intramuscular or subcutaneous injection.
[0134] The invention also provides a method for inducing an immune
response to M. catarrhalis in a mammal in order to protect the
mammal against infection and/or attenuate disease caused by M.
catarrhalis. The method comprises administering an immunologically
effective amount of the immunogens of the invention to the host
and, preferably, administering the vaccines of the invention to the
host.
5.7. Nucleic Acids Encoding OMP106 Polypeptide and OMP106-Derived
Polypeptides
[0135] The present invention also provides nucleic acids, DNA and
RNA, encoding OMP106 polypeptide and OMP106-derived polypeptides.
In one aspect, the nucleic acids of the invention may be
synthesized using methods known in the art. Specifically, a portion
of or the entire amino acid sequence of OMP106 polypeptide or an
OMP106-derived polypeptide may be determined using techniques well
known to those of skill in the art, such as via the Edman
degradation technique (see, e.g., Creighton, 1983, Proteins:
Structures and Molecular Principles, W.H. Freeman & Co., N.Y.,
pp. 34-49). The amino acid sequence obtained is used as a guide for
the synthesis of DNA encoding OMP106 polypeptide or OMP106-derived
polypeptide using conventional chemical approaches or polymerase
chain reaction (PCR) amplification of overlapping
oligonucleotides.
[0136] In another aspect, the amino acid sequence may be used as a
guide for synthesis of oligonucleotide mixtures which in turn can
be used to screen for OMP106 polypeptide coding sequences in M.
catarrhalis genomic libraries. Such libraries may be prepared by
isolating DNA from cells of any M. catarrhalis strain. Preferably
the DNA used as the source of the OMP106 polypeptide coding
sequence, for both genomic libraries and PCR amplification, is
prepared from cells of any M. catarrhalis strain including, but not
limited to, ATCC 49143, ATCC 25238, ATCC 25240, ATCC 43617, ATCC
43618, ATCC 43627 and ATCC 43628.
[0137] In the preparation of genomic libraries, DNA fragments are
generated, some of which will encode parts or the whole of M.
catarrhalis OMP106 polypeptide. The DNA may be cleaved at specific
sites using various restriction enzymes. Alternatively, one may use
DNase in the presence of manganese to fragment the DNA, or the DNA
can be physically sheared, as for example, by sonication. The DNA
fragments can then be separated according to size by standard
techniques, including but not limited to, agarose and
polyacrylamide gel electrophoresis, column chromatography and
sucrose gradient centrifugation. The DNA fragments can then be
inserted into suitable vectors, including but not limited to
plasmids, cosmids, bacteriophages lambda or T.sub.4, and yeast
artificial chromosome (YAC). (See, for example, Sambrook et al.,
1989, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Glover, D. M.
(ed.), 1985, DNA Cloning: A Practical Approach, MRL Press, Ltd.,
Oxford, U.K. Vol. I, II.) The genomic library may be screened by
nucleic acid hybridization to labeled probe (Benton and Davis,
1977, Science 196:180; Grunstein and Hogness, 1975, Proc. Natl.
Acad. Sci. U.S.A. 72:3961).
[0138] The genomic libraries may be screened with a labeled
degenerate oligonucleotide corresponding to the amino acid sequence
of any peptide of OMP106 polypeptide using optimal approaches well
known in the art. In particular embodiments, the screening probe is
a degenerate oligonucleotide that corresponds to the peptide having
the sequence IGISEADGGKGGANARGDKSIAIGDIAQALGSQSIAIGDNKIV (SEQ ID
NO:1) or a portion thereof. In another embodiment the screening
probe may be a degenerate oligonucleotide that corresponds to a
peptide having the sequence GTVLGGKK (SEQ ID NO:2). In an
additional embodiment, the oligonucleotides
GGNACNGTNCTNGGNGGNAARAAR (SEQ ID NO:3) and GGNACNGTNTTRGGNGGNAARAAR
(SEQ ID NO:7), each corresponding to OMP106 peptide GTVLGGKK (SEQ
ID NO:2), is used as the probe. In further embodiments, the
sequence
GAAGCGGACGGGGGGAAAGGCGGAGCCAATGCGCGCGGTGATAAATCCATTGCTATTGGTG
ACATTGCGCAA (SEQ ID NO:4) or any fragments thereof, or any
complement of the sequence or fragments may be used as the probe.
Any probe used preferably is 15 nucleotides or longer.
[0139] Clones in libraries with insert DNA encoding the OMP106
polypeptide or fragments thereof will hybridize to one or more of
the degenerate oligonucleotide probes. Hybridization of such
oligonucleotide probes to genomic libraries are carried out using
methods known in the art. For example, hybridization with the two
above-mentioned oligonucleotide probes may be carried out in
2.times.SSC, 1.0% SDS at 50.degree. C. and washed using the same
conditions. In a particular embodiment, ATCC 49143 DNA sequence
encoding the whole or a part of the OMP106 polypeptide is a HindIII
restriction fragment of about 8,000 bp in length or a DRAI
restriction fragment of about 4,200 bp in length.
[0140] In yet another aspect, clones of nucleotide sequences
encoding a part or the entire OMP106 polypeptide or OMP106-derived
polypeptides may also be obtained by screening M. catarrhalis
expression libraries. For example, M. catarrhalis DNA is isolated
and random fragments are prepared and ligated into an expression
vector (e.g., a bacteriophage, plasmid, phagemid or cosmid) such
that the inserted sequence in the vector is capable of being
expressed by the host cell into which the vector is then
introduced. Various screening assays can then be used to select for
the expressed OMP106 polypeptide or OMP106-derived polypeptides. In
one embodiment, the various anti-OMP106 antibodies of the invention
(see Section 5.5) can be used to identify the desired clones using
methods known in the art. See, for example, Harlow and Lane, 1988,
Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., Appendix IV. Clones or plaques
from the library are brought into contact with the antibodies to
identify those clones that bind.
[0141] In an embodiment, colonies or plaques containing DNA that
encodes OMP106 polypeptide or OMP106-derived polypeptide could be
detected using DYNA Beads according to Olsvick et al., 29th ICAAC,
Houston, Tex. 1989, incorporated herein by reference. Anti-OMP106
antibodies are crosslinked to tosylated DYNA Beads M280, and these
antibody-containing beads would then be used to adsorb to colonies
or plaques expressing OMP106 polypeptide or OMP106-derived
polypeptide. Colonies or plaques expressing OMP106 polypeptide or
OMP106-derived polypeptide is identified as any of those that bind
the beads.
[0142] Alternatively, the anti-OMP106 antibodies can be
nonspecifically immobilized to a suitable support, such as silica
or Celite.TM. resin. This material would then be used to adsorb to
bacterial colonies expressing OMP106 polypeptide or OMP106-derived
polypeptide as described in the preceding paragraph.
[0143] In another aspect, PCR amplification may be used to produce
substantially pure DNA encoding a part of or the whole of OMP106
polypeptide from M. catarrhalis genomic DNA. Oligonucleotide
primers, degenerate or otherwise, corresponding to known OMP106
polypeptide sequences can be used as primers. In particular
embodiments, an oligonucleotide, degenerate or otherwise, encoding
the peptide IGISEADGGKGGANARGDKSIAIGDIAQALGSQSIAIGDNKIV (SEQ ID
NO:1) or any portion thereof may be used as the 5' primer. For
example, a 5' primer may be the nucleotide sequence
GAAGCGGACGGGGGGAAAGGCGGAGCCAATGCGCGCGGTGATAAATCCATTGCTATTGGTG
ACATTGCGCAA (SEQ ID NO:4) or any portion thereof. Nucleotide
sequences, degenerate or otherwise, that are reverse complements of
sequence encoding GTVLGGKK (SEQ ID NO:2) may be used as the 3'
primer. For example, an oligonucleotide, degenerate or otherwise,
that has the degenerate nucleotide sequence
YTTYTTNCCNCCNAGNACNGTNCC (SEQ ID NO:6) or YTTYTTNCCNCCYAANACNGTNCC
(SEQ ID NO:8) may be used as the 3' primer in conjunction with the
various 5' primer discussed above.
[0144] PCR can be carried out, e.g., by use of a Perkin-Elmer Cetus
thermal cycler and Taq polymerase (Gene Amp.TM.). One can choose to
synthesize several different degenerate primers, for use in the PCR
reactions. It is also possible to vary the stringency of
hybridization conditions used in priming the PCR reactions, to
allow for greater or lesser degrees of nucleotide sequence
similarity between the degenerate primers and the corresponding
sequences in M. catarrhalis DNA. After successful amplification of
a segment of the sequence encoding OMP106 polypeptide, that segment
may be molecularly cloned and sequenced, and utilized as a probe to
isolate a complete genomic clone. This, in turn, will permit the
determination of the gene's complete nucleotide sequence, the
analysis of its expression, and the production of its protein
product for functional analysis, as described infra.
[0145] Once an OMP106 polypeptide coding sequence has been isolated
from one M. catarrhalis strain or cultivar, it is possible to use
the same approach to isolate OMP106 polypeptide coding sequences
from other M. catarrhalis strains and cultivars. It will be
recognized by those skilled in the art that the DNA or RNA sequence
encoding OMP106 polypeptide (or fragments thereof) of the invention
can be used to obtain other DNA or RNA sequences that hybridize
with it under conditions of moderate to high stringency, using
general techniques known in the art. Hybridization with an OMP106
sequence from one M. catarrhalis strain or cultivar under high
stringency conditions will identify the corresponding sequence from
other strains and cultivars. High stringency conditions vary with
probe length and base composition. The formula for determining such
conditions are well known in the art. See Sambrook et al., 1989,
Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press,
NY, Chapter 11. As used herein high stringency hybridization
conditions as applied to probes of greater than 300 bases in length
involve a final wash in 0.1.times.SSC/0.1% SDS at 68.degree. C. for
at least 1 hour (Ausubel, et al., Eds., 1989, Current Protocols in
Molecular Biology, Vol. I, Greene Publishing Associates, Inc. and
John Wiley & Sons, Inc., New York, at page 2.10.3). In
particular embodiments, the high stringency wash in hybridization
using a probe having the sequence of SEQ ID NO:4 or its complement
is 2.times.SSC, 1% SDS at 50.degree. C. for about 20 to about 30
minutes.
[0146] One skilled in the art would be able to identify complete
clones of OMP106 polypeptide coding sequence using approaches well
known in the art. The extent of OMP106 polypeptide coding sequence
contained in an isolated clone may be ascertained by sequencing the
cloned insert and comparing the deduced size of the polypeptide
encoded by the open reading frames (ORFs) with that of OMP106
polypeptide and/or by comparing the deduced amino acid sequence
with that of known amino acid sequence of purified OMP106
polypeptide. Where a partial clone of OMP106 polypeptide coding
sequence has been isolated, complete clones may be isolated by
using the insert of the partial clone as hybridization probe.
Alternatively, a complete OMP106 polypeptide coding sequence can be
reconstructed from overlapping partial clones by splicing their
inserts together.
[0147] Complete clones may be any that have ORFs with deduced amino
acid sequence matching that of OMP106 polypeptide or, where the
complete amino acid sequence of the latter is not available, that
of a peptide fragment of OMP106 polypeptide and having a molecular
weight corresponding to that of OMP106 polypeptide. Further,
complete clones may be identified by the ability of their inserts,
when placed in an expression vector, to produce a polypeptide that
binds antibodies specific to the amino-terminal of OMP106
polypeptide and antibodies specific to the carboxyl-terminal of
OMP106 polypeptide.
[0148] Nucleic acid sequences encoding OMP106-derived polypeptides
may be produced by methods well known in the art. In one aspect,
sequences encoding OMP106-derived polypeptides can be derived from
OMP106 polypeptide coding sequences by recombinant DNA methods in
view of the teachings disclosed herein. For example, the coding
sequence of OMP106 polypeptide may be altered creating amino acid
substitutions that will not affect the immunogenicity of the OMP106
polypeptide or which may improve its immunogenicity. Various
methods may be used, including but not limited to oligonucleotide
directed, site specific mutagenesis. These and other techniques
known in the art may be used to create single or multiple
mutations, such as replacements, insertions, deletions, and
transpositions, as described in Botstein and Shortle, 1985, Science
229:1193-1210.
[0149] Further, DNA of OMP106 polypeptide coding sequences may be
truncated by restriction enzyme or exonuclease digestions.
Heterologous coding sequence may be added to OMP106 polypeptide
coding sequence by ligation or PCR amplification. Moreover, DNA
encoding the whole or a part of an OMP-derived polypeptide may be
synthesized chemically or using PCR amplification based on the
known or deduced amino acid sequence of OMP106 polypeptide and any
desired alterations to that sequence.
[0150] The identified and isolated DNA containing OMP106
polypeptide or OMP106-derived polypeptide coding sequence can be
inserted into an appropriate cloning vector. A large number of
vector-host systems known in the art may be used. Possible vectors
include, but are not limited to, plasmids or modified viruses, but
the vector system must be compatible with the host cell used. Such
vectors include, but are not limited to, bacteriophages such as
lambda derivatives, or plasmids such as pBR322 or pUC plasmid
derivatives. The insertion into a cloning vector can, for example,
be accomplished by ligating the DNA fragment into a cloning vector
which has complementary cohesive termini. However, if the
complementary restriction sites used to fragment the DNA are not
present in the cloning vector, the ends of the DNA molecules may be
enzymatically modified. Alternatively, any site desired may be
produced by ligating nucleotide sequences (linkers) onto the DNA
termini; these ligated linkers may comprise specific chemically
synthesized oligonucleotides encoding restriction endonuclease
recognition sequences. In an alternative method, the cleaved DNA
may be modified by homopolymeric tailing. Recombinant molecules can
be introduced into host cells via transformation, transfection,
infection, electroporation, etc., so that many copies of the gene
sequence are generated.
[0151] In an alternative method, the desired DNA containing OMP106
polypeptide or OMP106-derived polypeptide coding sequence may be
identified and isolated after insertion into a suitable cloning
vector in a "shot gun" approach. Enrichment for the desired
sequence, for example, by size fractionation, can be done before
insertion into the cloning vector.
[0152] In specific embodiments, transformation of host cells with
recombinant DNA molecules that contain OMP106 polypeptide or
OMP106-derived polypeptide coding sequence enables generation of
multiple copies of such coding sequence. Thus, the coding sequence
may be obtained in large quantities by growing transformants,
isolating the recombinant DNA molecules from the transformants and,
when necessary, retrieving the inserted coding sequence from the
isolated recombinant DNA.
5.8. Recombinant Production of OMP106 Polypeptide and
OMP106-Derived Polypeptides
[0153] OMP106 polypeptide and OMP106-derived polypeptides of the
invention may be produced through genetic engineering techniques.
In this case, they are produced by an appropriate host cell that
has been transformed by DNA that codes for the polypeptide. The
nucleotide sequence encoding OMP106 polypeptide or OMP106-derived
polypeptides of the invention can be inserted into an appropriate
expression vector, i.e., a vector which contains the necessary
elements for the transcription and translation of the inserted
polypeptide-coding sequence. The nucleotide sequences encoding
OMP106 polypeptide or OMP106-derived polypeptides is inserted into
the vectors in a manner that they will be expressed under
appropriate conditions (e.g., in proper orientation and correct
reading frame and with appropriate expression sequences, including
an RNA polymerase binding sequence and a ribosomal binding
sequence).
[0154] A variety of host-vector systems may be utilized to express
the polypeptide-coding sequence. These include but are not limited
to mammalian cell systems infected with virus (e.g., vaccinia
virus, adenovirus, etc.); insect cell systems infected with virus
(e.g., baculovirus); microorganisms such as yeast containing yeast
vectors, or bacteria transformed with bacteriophage DNA, plasmid
DNA, or cosmid DNA. Preferably, the host cell is a bacterium, and
most preferably the bacterium is E. coli, B. subtilis or
Salmonella.
[0155] The expression elements of vectors vary in their strengths
and specificities. Depending on the host-vector system utilized,
any one of a number of suitable transcription and translation
elements may be used. In a specific embodiment, a chimeric protein
comprising OMP106 polypeptide or OMP106-derived polypeptide
sequence and a pre and/or pro sequence of the host cell is
expressed. In other specific embodiments, a chimeric protein
comprising OMP106 polypeptide or OMP106-derived polypeptide
sequence and an affinity purification peptide is expressed. In
further specific embodiments, a chimeric protein comprising OMP106
polypeptide or OMP106-derived polypeptide sequence and a useful
immunogenic peptide or polypeptide is expressed. In preferred
embodiments, OMP106-derived polypeptide expressed contains a
sequence forming either an outer-surface epitope or the
receptor-binding domain of native OMP106 polypeptide.
[0156] Any method known in the art for inserting DNA fragments into
a vector may be used to construct expression vectors containing a
chimeric gene consisting of appropriate
transcriptional/translational control signals and the polypeptide
coding sequences. These methods may include in vitro recombinant
DNA and synthetic techniques and in vivo recombinants (genetic
recombination). Expression of a nucleic acid sequence encoding
OMP106 polypeptide or OMP106-derived polypeptide may be regulated
by a second nucleic acid sequence so that the inserted sequence is
expressed in a host transformed with the recombinant DNA molecule.
For example, expression of the inserted sequence may be controlled
by any promoter/enhancer element known in the art. Promoters which
may be used to control expression of inserted sequences include,
but are not limited to the SV40 early promoter region (Bernoist and
Chambon, 1981, Nature 290:304-310), the promoter contained in the
3' long terminal repeat of Rous sarcoma virus (Yamamoto et al.,
1980, Cell 22:787-797), the herpes thymidine kinase promoter
(Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445),
the regulatory sequences of the metallothionein gene (Brinster et
al., 1982, Nature 296:39-42) for expression in animal cells; the
promoters of .beta.-lactamase (Villa-Kamaroff et al., 1978, Proc.
Natl. Acad. Sci. U.S.A. 75:3727-3731), tac (DeBoer et al., 1983,
Proc. Natl. Acad. Sci. U.S.A. 80:21-25), .lamda.P.sub.L, or trc for
expression in bacterial cells (see also "Useful proteins from
recombinant bacteria" in Scientific American, 1980, 242:74-94); the
nopaline synthetase promoter region or the cauliflower mosaic virus
35S RNA promoter (Gardner et al., 1981, Nucl. Acids Res. 9:2871),
and the promoter of the photosynthetic enzyme ribulose biphosphate
carboxylase (Herrera-Estrella et al., 1984, Nature 310:115-120) for
expression implant cells; promoter elements from yeast or other
fungi such as the Gal4 promoter, the ADC (alcohol dehydrogenase)
promoter, PGK (phosphoglycerol kinase) promoter, alkaline
phosphatase promoter.
[0157] Expression vectors containing OMP106 polypeptide or
OMP106-derived polypeptide coding sequences can be identified by
three general approaches: (a) nucleic acid hybridization, (b)
presence or absence of "marker" gene functions, and (c) expression
of inserted sequences. In the first approach, the presence of a
foreign gene inserted in an expression vector can be detected by
nucleic acid hybridization using probes comprising sequences that
are homologous to the inserted OMP106 polypeptide or OMP106-derived
polypeptide coding sequence. In the second approach, the
recombinant vector/host system can be identified and selected based
upon the presence or absence of certain "marker" gene functions
(e.g., thymidine kinase activity, resistance to antibiotics,
transformation phenotype, occlusion body formation in baculovirus,
etc.) caused by the insertion of foreign genes in the vector. For
example, if the OMP106 polypeptide or OMP106-derived polypeptide
coding sequence is inserted within the marker gene sequence of the
vector, recombinants containing the insert can be identified by the
absence of the marker gene function. In the third approach,
recombinant expression vectors can be identified by assaying the
foreign gene product expressed by the recombinant. Such assays can
be based, for example, on the physical or functional properties of
OMP106 polypeptide or OMP106-derived polypeptide in in vitro assay
systems, e.g., binding to an OMP106 ligand or receptor, or binding
with anti-OMP106 antibodies of the invention, or the ability of the
host cell to hemagglutinate or the ability of the cell extract to
interfere with hemagglutination by M. catarrhalis.
[0158] Once a particular recombinant DNA molecule is identified and
isolated, several methods known in the art may be used to propagate
it. Once a suitable host system and growth conditions are
established, recombinant expression vectors can be propagated and
prepared in quantity. As explained above, the expression vectors
which can be used include, but are not limited to, the following
vectors or their derivatives: human or animal viruses such as
vaccinia virus or adenovirus; insect viruses such as baculovirus;
yeast vectors; bacteriophage vectors (e.g., lambda), and plasmid
and cosmid DNA vectors, to name but a few.
[0159] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired.
Expression from certain promoters can be elevated in the presence
of certain inducers; thus, expression of the genetically engineered
OMP106 polypeptide or OMP106-derived polypeptide may be controlled.
Furthermore, different host cells have characteristic and specific
mechanisms for the translational and post-translational processing
and modification of proteins. Appropriate cell lines or host
systems can be chosen to ensure the desired modification and
processing of the foreign protein expressed.
5.9. Reagents
[0160] The polypeptides, peptides, antibodies and nucleic acids of
the invention are useful as reagents for clinical or medical
diagnosis of M. catarrhalis infections and for scientific research
on the properties of pathogenicity, virulence, and infectivity of
M. catarrhalis, as well as host defense mechanisms. For example,
DNA and RNA of the invention can be used as probes to identify the
presence of M. catarrhalis in biological specimens by hybridization
or PCR amplification. The DNA and RNA can also be used to identify
other bacteria that might encode a polypeptide related to the M.
catarrhalis OMP106.
[0161] The polypeptides and peptides of the invention may be used
to prepare polyclonal and monoclonal antibodies that can be used to
further purify compositions containing the polypeptides of the
invention by affinity chromatography. The polypeptides and peptides
can also be used in standard immunoassays to screen for the
presence of antibodies to M. catarrhalis in a sample.
[0162] It is to be understood that the application of the teachings
of the present invention to a specific problem or environment will
be within the capabilities of one having ordinary skill in the art
in light of the teachings contained herein. Examples of the
products of the present invention and processes for their
preparation and use appear in the following example.
6. EXAMPLE
Isolation and Characterization of the OMP106 Polypeptide and Gene
Encoding same from Strain ATCC 491-430R Other Strains
6.1. Material and Methods
6.1.1. Hemagglutination Assay
[0163] Hemagglutination by M. catarrhalis was tested as described
by Soto-Hernandez et al. (J. Clin. Microbiol. 27:903-908) except
5%, instead of 3%, v/v erythrocytes were used in a slide
agglutination assay. Initial hemagglutination assays were performed
using 20 .mu.g of bacterial cells (wet weight). Since M.
catarrhalis ATCC strain 49143 grown on blood agar plates at
35.degree. C. gave a strong hemagglutination reaction, it was
selected as the reference strain. Serially diluting ATCC strain
49143 in 1:2 dilutions resulted in decreasing hemagglutination
reactions. Scores of ++++ to + were based on the hemagglutination
observed by ATCC strain 49143 after serial 1:2 dilutions so that a
+ reaction resulted using 1/4 the number of cells required to
achieve a +++reaction.
6.1.2. Inhibition of Hemagglutination
[0164] M. catarrhalis ATCC 49143 cell suspension was serially
diluted 1:2, and the dilution that yielded a+hemagglutination
reaction when 7 .mu.l of Dulbecco's phosphate buffered saline and 7
.mu.l of 5% (v/v) human O.sup.+ erythrocytes was used to assay
inhibition of hemagglutination by simple sugars and sugar
derivatives. To determine if simple sugars or sugar derivatives
could inhibit hemagglutination by M. catarrhalis, 7 .mu.l of a
given sugar at 500 mM was mixed with 7 .mu.l of M. catarrhalis
cells and incubated for 5 minutes to allow the sugar to interact
with the cells. Then 7 .mu.l of 5% (v/v) human O.sup.+ erythrocytes
were added and the hemagglutination was scored after 1 minute. Each
sugar and sugar derivative was tested for the ability to inhibit
hemagglutination. Then the stock of each sugar and sugar derivative
was serially diluted 1:2, and these dilutions were assayed for
their ability to inhibit hemagglutination using the procedure
described above. In this manner, the minimal concentration of
carbohydrate required to inhibit hemagglutination was
determined.
[0165] 6.1.3. Ligand and Receptor Binding
[0166] M. catarrhalis binding to animal cell glycolipid receptors
was examined using thin layer chromatography (TLC) fractionation of
the host cell glycolipids and labeled cell overlay of the
chromatogram following the procedures described by Magnani et al.,
1982, J. Biol. Chem. 257:14365-14369. Briefly, glycolipids obtained
from Matreya Inc. (Pleasant Gap, Pa.) were resolved on high
performance thin layer chromatograph plates (HPTLC) in chloroform,
methanol, water (5:4:1) The plates were either stained with orcinol
at 100.degree. C., or were overlaid with .sup.125I-labeled M.
catarrhalis blebs prepared as previously described (Murphy and
Loeb, 1989, Microbial Pathogen. 6:159-174) at 2.times.10.sup.6
cpm/ml for 2 hours. The plates were then washed 5 times, dried and
exposed to X-ray film.
6.1.4. OG Extraction of OMPS
[0167] Strains of M. catarrhalis were each grown at 35.degree. C.
at 200 rpm in 1 liter of Mueller Hinton broth in a 4 liter flask.
Outer membrane protein (OMP) preparations were isolated by treating
50 mg of cells (wet weight) with 0.67 ml of 1.25% n-octyl
.beta.-D-glucopyranoside (i.e., octyl glucoside; OG) in phosphate
buffered saline (PBS) for 30 minutes at room temperature. Cells
were pelleted in a microcentrifuge for 5 minutes and the
supernatant was used as an octyl glucoside extract. Comparison of
protein profiles of these extracts from a number of strains of M.
catarrhalis to those of blebs (i.e., outer membrane vesicles)
isolated by differential centrifugation, which are highly enriched
for outer membrane proteins (OMPs) from M. catarrhalis (Murphy and
Loeb, 1989, Microbial Pathogen. 6:159-174) indicates the octyl
glucoside extracts contain predominately outer membrane proteins of
M. catarrhalis (FIG. 1). This indicated that octyl glycoside
extraction provided a more rapid procedure with a higher yield of
outer membrane proteins as compared to outer membrane proteins
prepared from blebs.
6.1.5. Proteolytic Digestion of OMP106
[0168] 50 mg of cells from ATCC strain 49143 in 1 ml of Dulbecco's
phosphate buffered saline were digested for 1 hour at room
temperature with the following proteases: TLCK-treated chymotrypsin
(5 mg), Proteinase K (5 mg), TPCK-treated trypsin (5 mg), or
protease V8 (100 Units). All proteases were obtained from Sigma
Chemicals (St. Louis, Mo.). Immediately following the protease
treatment, cells were washed once in PBS and resuspended in 1 ml of
PBS and the hemagglutinating activity was tested. Additionally,
protease-treated bacterial cells were extracted with octyl
glucoside so the outer membrane proteins could be resolved to
identify specific proteins that may have been digested by the
proteases.
6.1.6. Non-Hemagglutinating Cultivars
[0169] Normally, hemagglutinating M. catarrhalis cultures are grown
in shaker flasks containing Mueller Hinton Broth at 35 to
37.degree. C. at 200 rpm for 24 to 48 hours. Cells taken directly
from a blood agar plate or an agar plate of Mueller Hinton media
also express the hemagglutinating phenotype. To select for a
non-hemagglutinating (NHA) cultivar, ATCC strain 49143 was serially
passaged every 5 days in static cultures grown in Mueller Hinton
broth at 35.degree. C. With each passage, inoculum was taken only
from the surface of the broth culture. By the second passage, a
floating mat of cells had developed and this mat of cells was used
as the inoculum for subsequent cultures. Serial culturing in this
manner produced NHA cultivars of ATCC 49143 typically after three
passages.
6.1.7. Isolation of OMP106 Polypeptide
[0170] OMP106 polypeptide from outer membrane extract of M.
catarrhalis ATCC 49143 is detected (e.g., by silver staining or
anti-OMP106 antibodies) in denaturing gels only after the extract
has been incubated at 100.degree. C. for five minutes. In order to
determine if the appearance of the OMP106 band after incubation at
100.degree. C. is the result of lower molecular weight proteins
aggregating during boiling, or if the boiling allows a normally
aggregated protein to enter the gel, an unboiled octyl glucoside
outer membrane extract of ATCC 49143 was analyzed on a native
polyacrylamide gel. Specific regions of the gel including that
immediately below the sample well were excised and boiled. The
resulting samples were then resolved on a denaturing polyacrylamide
gel and stained with silver stain (Silver Stain Plus, Catalog
number 161-0449, BioRad Laboratories, Richmond, Calif.). For
N-terminal sequencing, an octyl glucoside outer membrane extract of
ATCC 49143 was mixed with PAGE sample buffer containing SDS, and
was incubated for 5 minutes in boiling water bath. The proteins
were then resolved on a 12% PAG with SDS and transferred to a PVDF
membrane by electroblotting. The region of the membrane containing
the OMP106 band was then cut out for amino-terminal sequencing.
None of the PAGE procedures used to isolate the OMP106 polypeptide
used reducing agents in the sample or gel buffers.
6.1.8. Anti-OMP106 Antiserum
[0171] Antiserum to OMP106 were prepared by resolving OMP106
polypeptide from a HA cultivar of ATCC 49143 in a denaturing sodium
dodecylsulfate polyacrylamide gel as previously described (Lammeli,
1970, Nature 227:680-685), and cutting the OMP106-containing band
out of the gel. The excised band was macerated and injected into a
rabbit to generate antiserum to OMP106 polypeptide. The antiserum
was used to inhibit hemagglutination as described in section 6.1.2.
supra, but using the antiserum in place of the carbohydrate. The
antiserum was also examined for complement-mediated cytotoxic
activity against M. catarrhalis as described in section 7.
6.1.9. Western Blots with Anti-OMP106 Antiserum
[0172] M. catarrhalis ATCC 49143, ATCC 43628, ATCC 43627, ATCC
43618, ATCC 43617, ATCC 25240, ATCC 25238, and ATCC 8176; M. ovis
ATCC 33078; M. lacunata ATCC 17967; M. bovis ATCC 10900; M.
osloensis ATCC 10973; Neisseria gonorrhoeae (clinical isolate); and
N. meningitidis ATCC 13077 were grown on chocolate agar plates for
48 hours at 35.degree. C. in 5% CO.sub.2. Cells were removed by
scraping the colonies from the agar surface using a polystyrene
inoculating loop. Cells were then solubilized by suspending 30
.mu.g of cells in 150 .mu.l of PAGE sample buffer (360 mM Tris
buffer [pH 8.8], containing 4% sodium dodecylsulfate and 20%
glycerol), and incubating the suspension at 1001.degree. C. for 5
minutes. The solubilized cells were resolved on 12% polyacrylamide
gels as per Laemmli and the separated proteins were
electrophoretically transferred to PVDF membranes at 100 V for 1.5
hours as previously described (Thebaine et al. 1979, Proc. Natl.
Acad. Sci. USA 76:4350-4354) except 0.05% sodium dodecylsulfate was
added to the transfer buffer to facilitate the movement of proteins
from the gel. The PVDF membranes were then pretreated with 25 ml of
Dulbecco's phosphate buffered saline containing 0.5% sodium casein,
0.5% bovine serum albumin and 1% goat serum. All subsequent
incubations were carried out using this pretreatment buffer.
[0173] PVDF membranes were incubated with 25 ml of a 1:500 dilution
of preimmune rabbit serum or serum from a rabbit immunized with
OMP106 polypeptide (as described above) for 1 hour at room
temperature. PVDF membranes were then washed twice with wash buffer
(20 mM Tris buffer [pH 7.5.] containing 150 mM sodium chloride and
0.05% Tween-20). PVDF membranes were incubated with 25 ml of a
1:5000 dilution of peroxidase-labeled goat anti-rabbit IgG (Jackson
ImmunoResearch Laboratories, West Grove Pa. Catalog number
111-035-003) for 30 minutes at room temperature. PVDF membranes
were then washed 4 times with wash buffer, and were developed with
3,3'diaminobenzidine tetrahydrochloride and urea peroxide as
supplied by Sigma Chemical Co. (St. Louis, Mo. catalog number
D-4418) for 4 minutes each.
6.1.10. Anti-OMP106 Immunofluorescence Staining of Cell Surface
[0174] M. catarrhalis ATCC 49143 was grown overnight at 35.degree.
C. in a shaking water bath in Mueller Hinton broth. The cells were
pelleted by centrifugation and then resuspended in an equal volume
of Dulbecco's modification of phosphate buffered saline without
calcium or magnesium (PBS/MC). 20 .mu.l of the cell suspension was
applied to each of 5 clean microscope slides. After setting for 10
seconds, the excess fluid was removed with a micropipettor, and the
slides were allowed to air dry for 1 hour. The slides were then
heat fixed over an open flame until the glass was warm to the
touch. The slides were initially treated with 40 .mu.l of 1:40
dilution of anti-OMP106 antiserum or preimmune serum from the same
animal diluted in PBS/MC, or PBS/MC for 10 minutes, then washed 5
times with PBS/MC. The slides were treated with 40 .mu.l of 5
.mu.g/ml PBS/MC of fluorescein isothiocyanate-labeled goat antibody
to rabbit IgG (Kirkegaard and Perry Laboratories, Inc,
Gaithersburg, Md. catalog number 02-15-06). The slides were
incubated in the dark for 10 minutes and were washed 5 times in
PBS/MC. Each slide was stored covered with PBS/MC under a cover
slide and was viewed with a fluorescence microscope fitted with a
489 nm filter. For each sample five fields-of-view were visually
examined to evaluate the extent of straining.
6.2. Results
6.2.1. Hemagglutination Activity
[0175] The agglutination activity of M. catarrhalis with respect to
erythrocytes is species specific with the strongest activity
observed with human erythrocytes. Rabbit erythrocytes are also
agglutinated by M. catarrhalis, but less dramatically than are
human cells. The erythrocytes from mouse, horse or sheep were not
agglutinated (see Table 1).
TABLE-US-00001 TABLE 1 Strength of hemagglutination of erythrocytes
from various species using M. catarrhalis ATCC 49143 Source of
Score for erythrocytes hemagglutination.sup.a Human ++++ Rabbit ++
Mouse - Horse - Sheep - .sup.a++++ = strongest agglutination, -
indicates no agglutination
6.2.2. OMP106 Receptors and Ligands
[0176] M. catarrhalis hemagglutination activity is due to binding
to globotetrose (Gb.sub.4). Blebs from hemagglutinating strains
bind to a glycolipid having Gb.sub.41 whereas non-hemagglutinating
strains do not bind to the same glycolipid (see FIG. 2). M.
catarrhalis hemagglutination activity is inhibited by
monosaccharide constituents of Gb.sub.4 or derivatives of such
monosaccharides, with the most potent inhibitors being N-acetyl
galactosamine and galactose (especially the alpha anomer of the
galactose) (see Table 2).
TABLE-US-00002 TABLE 2 The minimum concentration of sugars required
to inhibit hemagglutination (MIC) by M. catarrhalis Sugar MIC (mM)*
D-Glucose >167 D-Mannose 83 D-Galactose 41 L-Fucose 83
N-acetyl-D-Glucosamine >167 N-acetyl-D-Galactosamine 41
Methyl-.alpha.-Glucose >167 Methyl-.alpha.-Mannose 167
Methyl-.alpha.-Galactose 10 Methyl-.beta.-galactose 83 *Minimal
concentration of sugar required to inhibit a 1+ hemagglutination
reaction by M. catarrhalis ATCC 49143 with 5% washed human O+
erythrocytes.
[0177] Both N-acetyl galactosamine and alpha-galactose are part of
the Gb.sub.4 tetrasaccharide. The correlation between
hemagglutination and binding to Gb.sub.4, and the observation that
hemagglutination is inhibited by monosaccharides that comprise the
Gb.sub.4 receptor suggest that M. catarrhalis cells bind to the
tetrasaccharide Gb.sub.4. This tetrasaccharide is present on human
erythrocytes and tissues, and could mediate M. catarrhalis
attachment to eukaryotic membranes.
6.2.3. Identification of OMP106 Polypeptide
[0178] Proteolytic digestion of M. catarrhalis cells, and
subsequent analysis of hemagglutination by the digested cells
demonstrated that protease treatment with chymotrypsin and
proteinase K destroyed the hemagglutination activity, and treatment
with trypsin partially destroyed hemagglutination activity,
indicating the hemagglutinating activity is protein mediated.
Analysis of the OMP protein profiles of protease digested M.
catarrhalis cells showed that multiple proteins had been degraded
in each sample, so the profiles did not provide a clue as to which
protein is directly responsible for or indirectly contributed to
the hemagglutination activity (see FIG. 3).
[0179] Since protease treatment indicated a polypeptide is directly
or indirectly responsible for hemagglutination activity, we used
SDS-PAGE to compare the OMP profiles from hemagglutinating strains
with the OMP profiles from non-hemagglutinating strains (FIG. 4).
Analysis of the differences between these profiles indicated that
the hemagglutinating strains had two unique polypeptides, one with
an apparent molecular weight of 27 kD (designated OMP27) and the
other was the only protein with an apparent molecular weight of
greater than 106 kD (designated OMP106). Notably, the OMP106
polypeptide band was absent in the OMP preparations of various
protease treated cells that have reduced or no hemagglutination
activity, whereas the OMP27 band was present in the OMP preparation
of proteinase K treated cells that have no hemagglutination
activity. Additionally, the OMP106 polypeptide band was not
degraded by proteinase V8 digestion, which did not affect
hemagglutination activity of treated cells.
6.2.4. OMP Profile of NHA Cultivars
[0180] Serial culturing of NHA cultivar of ATCC 49143 in static
culture at 35.degree. C. produced a NHA cultivar (designated
49143-NHA) by the third passage of the culture. This loss of the
hemagglutination activity was repeatable. Analysis of OMP profiles
of OG outer membrane extracts of the HA and NHA cultivars showed
that the OMP106 polypeptide band was missing from the 49143-NHA
extract (FIG. 5). This suggested that OMP106 polypeptide is the M.
catarrhalis hemagglutinin (i.e., OMP106 polypeptide binds Gb.sub.4
receptor or is a subunit of a homopolymeric protein that binds
Gb.sub.4 receptor) or forms a part of the M. catarrhalis
hemagglutinin (i.e., OMP106 polypeptide is a subunit of a
heteropolymeric protein that binds Gb.sub.4 receptor).
6.2.5. OMP106 and Hemagglutination
[0181] Polyclonal antiserum raised to ATCC 49143 OMP106 polypeptide
neutralized hemagglutination by ATCC 49143, as well as that by
heterologous ATCC 43627. This further supports the conclusion that
M. catarrhalis hemagglutinating activity comprises OMP106
polypeptide, and that OMP106 polypeptide is antigenically conserved
among strains. See also FIG. 9A, which shows antibodies in the
polyclonal antiserum binding OMP106 polypeptide of heterologous M.
catarrhalis strains.
6.2.6. Outer Surface Location of OMP106
[0182] Rabbit anti-OMP106 antiserum was used in indirect
immunofluorescence staining to determine if OMP106 polypeptide is
exposed on the outer surface of M. catarrhalis cells. M.
catarrhalis cells treated with anti-OMP106 antiserum stained more
intensely and uniformly than did cells treated with preimmune serum
or PBS/MC. This indicated that in intact M. catarrhalis cells
OMP106 polypeptide was reactive with anti-OMP106 antibodies. This
result indicates that OMP106 polypeptide is exposed on the outer
surface of M. catarrhalis. This finding is consistent with OMP106
polypeptide having a role in hemagglutination and, moreover,
indicates that OMP106 polypeptide would be useful as a vaccine.
6.2.7. Properties of OMP106 Polypeptide
[0183] OMP106 polypeptide exists as a large protein complex in its
native state or aggregates when extracted with octyl glucoside.
This conclusion is supported by the finding that extracting M.
catarrhalis cells with octyl glucoside will solubilize OMP106
polypeptide, but the extracted OMP106 polypeptide does not enter
denaturing PAGs unless the extract is first incubated at
100.degree. C. (FIG. 6). Further, the OMP106 polypeptide band does
not appear to form from lower molecular weight polypeptides that
polymerize or aggregate upon heating, since OMP106 polypeptide in a
non-heat denatured sample is trapped in the sample well and enters
the resolving gel only if the sample has been first incubated at
100.degree. C. This biochemical property is very useful for
identifying OMP106 polypeptide in various gels.
[0184] Using octyl glucoside extracts of M. catarrhalis, then
incubating the extracts with sodium dodecyl sulfate at 100.degree.
C., and resolving the proteins on a denaturing polyacrylamide gel,
we have estimated the apparent molecular weight of OMP106
polypeptide from various strains of M. catarrhalis, specifically
those of ATCC 25238, ATCC 25240, ATCC 43617, ATCC 43618, ATCC 43627
and ATCC 43628, to range from about 180 kD to about 230 kD (FIG.
9A), whereas the OMP106 polypeptide of strain ATCC 49143 appears to
have an apparent weight of about 190 kD (FIG. 6).
[0185] OMP106 polypeptide of strain ATCC 49143 was extracted from
the gel slice and its N-terminal was sequenced. The sequencing
showed the N-terminal of OMP106 polypeptide from the outer membrane
of ATCC 49143 to be IGISEADGGKGGANARGDKSIAIGDIAQALGSQSIAIGDNKIV
(SEQ ID NO:1). Additionally, an internal peptide of OMP106 produced
by Lys-C digest (Fernandez et al., 1994, Anal Biochem 218:112-117)
has been isolated and its sequence determined to be GTVLGGKK (SEQ
ID NO:2).
[0186] We generated three oligonucleotide probes. Two probes
correspond to the internal peptide GTVLGGKK, one has the following
sequence GGNACNGTNCTNGGNGGNAARAAR (SEQ ID NO:3), the other has the
following sequence GGNACNGTNTTRGGNGGNAARAAR (SEQ ID NO:7). The
other probe, Mc 5-72, encoding an internal fragment (SEQ ID NO:5)
of the amino-terminal sequence of OMP106 (SEQ ID NO:1) has the
following sequence
GAAGCGGACGGGGGGAAAGGCGGAGCCAATGCGCGCGGTGATAAATCCATTGCTATTGGTG
ACATTGCGCAA (SEQ ID NO:4). Hybridization of the Mc 5-72 probe to a
complete HindIII or DraI digest of M. catarrhalis DNA in each
instance produced a single band in Southern blot analysis (FIG. 7).
The hybridizing band in the HindIII digest has an approximate size
of 8.0 kb; the hybridizing band in the DraI digest has an
approximate size of 4.2 kb (FIG. 7).
6.2.8. Conservation of OMP106 Polypeptide
[0187] Western blot analysis of outer membrane protein extracts of
a number of M. catarrhalis strains and related species of bacteria
showed that the anti-OMP106 antibodies binds to a polypeptide of
about 180 Kd to about 230 kD in many M. catarrhalis strains, both
HA and NHA strains or cultivars (FIG. 9A). The anti-OMP106
antibodies did not bind to any polypeptide in the protein extracts
of related bacteria (FIG. 8A). These results demonstrate the
following: 1) Anti-OMP106 antibodies may be used to specifically
identify and distinguish M. catarrhalis from related species of
bacteria. 2) OMP106 polypeptide may be used to generate antibodies
that have diagnostic application for identification of M.
catarrhalis. 3) Antibodies to OMP106 polypeptide of one strain
(e.g., OMP106 of ATCC 49143) may be used to identify and isolate
the corresponding OMP106 polypeptide of other M. catarrhalis
strains. Interestingly, the Western blot results show that many of
the NHA M. catarrhalis strains have OMP106 polypeptide in OG
extracts of their outer membranes. This finding and the fact that
silver staining of OMPs from OG outer membrane extracts of NHA M.
catarrhalis strains after PAGE does not reveal a band in the 180 kD
to 230 kD range indicate that OMP106 polypeptide is expressed by
most M. catarrhalis strains or cultivars but that, in order to be
active in hemagglutination (i.e., binding to receptor on mammalian
cell surfaces) or silver stainable, the OMP106 polypeptide must be
appropriately modified in some manner. Apparently only HA strains
and cultivars are capable of appropriately modifying OMP106
polypeptide so that it can mediate bacterial binding to
hemagglutinin receptor on mammalian cell surfaces.
7. EXAMPLE
Efficacy of OMP106 Vaccine: Cytotoxic Activity of Anti-OMP106
Antiserum
[0188] Complement-mediated cytotoxic activity of anti-OMP106
antibodies was examined to determine the vaccine potential of
OMP106 polypeptide. Antiserum to OMP106 polypeptide of a HA
cultivar of ATCC 49143 was prepared as described in Section 6.1.8.
supra. The activities of the pre-immune serum and the anti-OMP106
antiserum in mediating complement killing of M. catarrhalis were
examined using the "Serum Bactericidal Test" described by Zollinger
et al. (Immune Responses to Neiserria meningitis, in Manual of
Clinical Laboratory Immunology, 3rd ed., pg 347-349), except that
cells of HA and NHA M. catarrhalis strains or cultivars were used
instead of Neiserria meningitis cells.
[0189] The results show that anti-OMP106 antiserum mediated
complement-killing of a HA cultivar of heterologous M. catarrhalis
ATCC 43627 but not a NHA cultivar of M. catarrhalis ATCC 43627 or
the NHA M. catarrhalis ATCC 8176. Table 3 summarizes the complement
mediated cytotoxic activities of pre-immune serum and anti-OMP106
antiserum against a HA cultivar of ATCC 43627.
TABLE-US-00003 TABLE 3 Complement mediated cytotoxic activities of
pre- immune serum and anti-OMP106 antiserum Cytotoxic Titer.sup.1
Pre-immune Anti-OMP106 Experiment 1 16 128 Experiment 2 8 64
.sup.1The titer is in the highest dilution at which a serum can
mediate complement killing of a HA cultivar of ATCC 43627 (e.g., 16
represents a 16 fold dilution of the serum), the larger the number,
the higher the cytotoxic activity or titer.
[0190] As shown in Table 3, the anti-OMP106 antiserum has 8 fold
greater cytotoxic activity than the pre-immune serum. This finding
indicates that OMP106 polypeptide is useful as a vaccine against HA
M. catarrhalis strains and cultivars.
[0191] Although the invention is described in detail with reference
to specific embodiments thereof, it will be understood that
variations which are functionally equivalent are within the scope
of this invention. Indeed, various modifications of the invention,
in addition to those shown and described herein, will become
apparent to those skilled in the art from the foregoing description
and accompanying drawings. Such modifications are intended to fall
within the scope of the appended claims.
[0192] Various publications are cited herein, the disclosures of
which are incorporated by reference in their entireties.
Sequence CWU 1
1
* * * * *