U.S. patent application number 11/936588 was filed with the patent office on 2008-06-19 for method for efficiently detecting double-stranded nucleic acid.
This patent application is currently assigned to EIKEN KAGAKU KABUSHIKI KAISYA. Invention is credited to Yasuyoshi MORI, Norihiro TOMITA.
Application Number | 20080145854 11/936588 |
Document ID | / |
Family ID | 19023614 |
Filed Date | 2008-06-19 |
United States Patent
Application |
20080145854 |
Kind Code |
A1 |
TOMITA; Norihiro ; et
al. |
June 19, 2008 |
METHOD FOR EFFICIENTLY DETECTING DOUBLE-STRANDED NUCLEIC ACID
Abstract
This invention relates to a method for efficiently detecting
double-stranded nucleic acids. More particularly, this invention
relates to a method for reducing signals derived from an
intercalator bound to a single-stranded nucleic acid, wherein a
compound that reacts more preferentially with an intercalator bound
to a single-stranded nucleic acid than with an intercalator bound
to a double-stranded nucleic acid or a compound that is bound to a
single-stranded nucleic acid more strongly than an intercalator and
is bound to a double-stranded nucleic acid more weakly than an
intercalator is added to a mixture comprising double-stranded and
single-stranded nucleic acids both having intercalators bound
thereto, thereby reducing signals derived from an intercalator
bound to a single-stranded nucleic acid.
Inventors: |
TOMITA; Norihiro; (Tokyo,
JP) ; MORI; Yasuyoshi; (Otawara-shi, JP) |
Correspondence
Address: |
FISH & RICHARDSON P.C.
P.O. BOX 1022
MINNEAPOLIS
MN
55440-1022
US
|
Assignee: |
EIKEN KAGAKU KABUSHIKI
KAISYA
Tokyo
JP
|
Family ID: |
19023614 |
Appl. No.: |
11/936588 |
Filed: |
November 7, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10481369 |
Dec 18, 2003 |
7316901 |
|
|
PCT/JP02/05739 |
Jun 10, 2002 |
|
|
|
11936588 |
|
|
|
|
Current U.S.
Class: |
435/6.12 |
Current CPC
Class: |
C12Q 1/6816 20130101;
C12Q 1/6816 20130101; C12Q 2563/173 20130101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 18, 2001 |
JP |
2001-183716 |
Claims
1-15. (canceled)
16. A kit for detecting a product of nucleic acid amplification,
the kit comprising: an intercalator; and a compound that reacts
more preferentially with an intercalator bound to a single-stranded
nucleic acid than with an intercalator bound to a double-stranded
nucleic acid or a compound that binds to a single-stranded nucleic
acid more strongly than an intercalator and that binds to a
double-stranded nucleic acid more weakly than an intercalator.
17. The kit according to claim 16, wherein the intercalator is any
of ethidium bromide, acridine orange, TO-PRO-1.RTM. (Quinolinium,
4-[(3-methyl-2(3H)-benzothiazolylidene)methyl]-1-[3-(trimethylammonio)pro-
pyl]-, diiodide), or YO-PRO-1.RTM. (Quinolinium,
4-[(3-methyl-2(3H)-benzoxazolylidene)methyl]-1-[3-(trimethylammonio)propy-
l]-, diiodide).
18. The kit according to claim 17, wherein the compound that reacts
more preferentially with an intercalator bound to a single-stranded
nucleic acid than with an intercalator bound to a double-stranded
nucleic acid is an oxidant or a reducer.
19. The kit according to claim 18, wherein the oxidant is any of
sodium hypochlorite, hydrogen peroxide, or potassium
permanganate.
20. The kit according to claim 18, wherein the reducer is sodium
borohydride or sodium cyanoborohydride.
21. The kit according to claim 16, wherein the compound that is
bound to a single-stranded nucleic acid more strongly than an
intercalator and is bound to a double-stranded nucleic acid more
weakly than an intercalator is a second intercalator different from
said intercalator.
22. The kit according to claim 21, wherein the second intercalator
is any of methylene blue, actinomycin D, SYBR.RTM. Green 2 (CAS
Registry No. 172827-25-7), or OliGreen.RTM. (CAS Registry No.
268220-33-3).
23. The kit according to claim 16, wherein the kit comprises: a
compound that reacts more preferentially with an intercalator bound
to a single-stranded nucleic acid than with an intercalator bound
to a double-stranded nucleic acid; and a compound that binds to a
single-stranded nucleic acid more strongly than an intercalator and
that binds to a double-stranded nucleic acid more weakly than an
intercalator.
24. The kit according to claim 16, further comprising a
polymerase.
25. The kit according to claim 24, wherein the polymerase catalyzes
strand displacement-type synthesis of complementary chains.
26. The kit according to claim 25, wherein the polymerase is
selected from group consisting of Bst DNA polymerase, Bca(exo-) DNA
polymerase, the Klenow fragment of E. coli DNA polymerase I, Vent
DNA polymerase, Vent(Exo-) DNA polymerase, DeepVent DNA polymerase,
DeepVent(Exo-) DNA polymerase, .phi.29 phage DNA polymerase, MS-2
phage DNA polymerase, Z-Taq DNA polymerase, and KOD DNA
polymerase.
27. The kit according to claim 16, further comprising a melting
temperature regulator.
28. The kit according to claim 27, wherein the melting temperature
regulator is betaine, trimethylamine N-oxide, dimethyl sulfoxide,
or formamide.
29. The kit according to claim 16, further comprising a primer.
30. The kit according to claim 29, wherein the primer contains (i)
a polynucleotide sequence F2 that is complementary to F2c, (ii) a
polynucleotide sequence F3 that is complementary to F3c, (iii) a
polynucleotide sequence of R2, (iv) a polynucleotide sequence R1c
that is complementary to R1; or (v) a polynucleotide sequence of
R3, wherein F1c, F2c, and F3c are polynucleotide sequences selected
in this order from the 3' end of a target region to be amplified in
a polynucleotide chain to the 3' end of the polynucleotide chain
and wherein R1, R2, and R3 are polynucleotide sequences selected in
this order from the 5' end of the target region to the 5' end of
the polynucleotide chain.
31. The kit of claim 16, wherein the product of nucleic acid
amplification is double-stranded nucleic acid.
Description
TECHNICAL FIELD
[0001] The present invention relates to a method for detecting
nucleic acids that can detect double-stranded nucleic acids using
an intercalator with higher sensitivity.
BACKGROUND ART
[0002] The most general method for detecting the amplification
product obtained by nucleic acid amplification such as polymerase
chain reactions (PCR) is carried out by subjecting the solution
after amplification to agarose gel electrophoresis and binding a
fluorescent intercalator such as ethidium bromide thereto, and then
observing specific fluorescence. When there is no possibility of
contamination by other DNA and only the occurrence of the
amplification product is of interest, fluorescence can be observed
by adding a fluorescent intercalator to the solution after
amplification while omitting electrophoresis. A fluorescent
intercalator, however, binds to a single-stranded DNA such as a
primer and emits fluorescence. Accordingly, a significant level of
background noise can be contained in the detected fluorescent
signal.
[0003] Recently, the present inventors have succeeded in developing
a novel method for nucleic acid amplification, which does not
require the complicated temperature control that is supposedly
inevitable in PCR, i.e., the loop-mediated isothermal amplification
(LAMP) method (Notomi, T. et al., Nucleic Acids Res. 28 (12), e63
(2000), WO 00/28082). In the LAMP method, the 3' terminal region of
template polynucleotide is self-annealed, synthesis of
complementary strands is started therefrom, and a primer that is
annealed to the loop formed in the aforementioned synthesis is used
in combination therewith. This enables the amplification under
isothermal conditions, and has remarkably enhanced the simplicity
of nucleic acid amplification.
[0004] In real-time monitoring of the product of nucleic acid
amplification using a fluorescent intercalator, fluorescence
intensity significantly varies in PCR since the product of nucleic
acid amplification is repeatedly dissociated and reassociated due
to thermal denaturation as a thermal cycle proceeds. In the LAMP
method, however, fluorescence intensity does not vary since the
reaction proceeds under isothermal conditions. Thus, the LAMP
method is more suitable for real-time monitoring of the product of
nucleic acid amplification. The LAMP method, however, requires
approximately 10 times as many primers as the quantity required in
PCR. When the product of nucleic acid amplification obtained by the
LAMP method is intended to be detected using a fluorescent
intercalator, the level of background noise caused by
single-stranded primers, which are also present therein, is high.
Thus, it is difficult to detect only the amplified double-stranded
nucleic acids with high sensitivity.
[0005] An object of the present invention is to provide a process
for detecting nucleic acids that can detect double-stranded nucleic
acids using an intercalator with higher sensitivity by reducing
signals derived from an intercalator bound to single-stranded
nucleic acids.
[0006] The present inventors have conducted concentrated studies in
order to attain the above object. As a result, they have succeeded
in reducing signals derived from an intercalator bound to a
single-stranded nucleic acid with the addition of a compound that
reacts more preferentially with an intercalator bound to a
single-stranded nucleic acid than with an intercalator bound to a
double-stranded nucleic acid or a compound that is bound to a
single-stranded nucleic acid more strongly than an intercalator and
is bound to a double-stranded nucleic acid more weakly than an
intercalator to a mixture comprising double-stranded and
single-stranded nucleic acids both having intercalators bound
thereto. This has led to the completion of the present
invention.
[0007] More specifically, the present invention relates to a method
for reducing signals derived from an intercalator bound to a
single-stranded nucleic acid, wherein a compound that reacts more
preferentially with an intercalator bound to a single-stranded
nucleic acid than with an intercalator bound to a double-stranded
nucleic acid is added to a mixture comprising double-stranded and
single-stranded nucleic acids both having intercalators (e.g.,
ethidium bromide, acridine orange, TO-PRO-1, or YO-PRO-1) bound
thereto, thereby reducing signals derived from an intercalator
bound to a single-stranded nucleic acid. Examples of a compound
that reacts more preferentially with an intercalator bound to a
single-stranded nucleic acid than with an intercalator bound to a
double-stranded nucleic acid include an oxidant, such as sodium
hypochlorite, hydrogen peroxide, or potassium permanganate, and a
reducer, such as sodium borohydride or sodium cyanoborohydride.
[0008] Further, the present invention relates to a method for
reducing signals derived from an intercalator bound to a
single-stranded nucleic acid, wherein a compound that is bound to a
single-stranded nucleic acid more strongly than an intercalator and
is bound to a double-stranded nucleic acid more weakly than an
intercalator is added to a mixture comprising double-stranded and
single-stranded nucleic acids both having intercalators (e.g.,
ethidium bromide, acridine orange, TO-PRO-1, or YO-PRO-1) bound
thereto, thereby reducing signals derived from an intercalator
bound to a single-stranded nucleic acid. An example of a compound
that is bound to a single-stranded nucleic acid more strongly than
an intercalator and is bound to a double-stranded nucleic acid more
weakly than an intercalator is a second intercalator (e.g.
methylene blue, actinomycin D, SYBR Greeen 2, or OliGreen)
different from the above intercalator.
[0009] Furthermore, the present invention relates to a method for
detecting a product of nucleic acid amplification comprising the
following steps:
[0010] (a) amplifying a nucleic acid through nucleic acid
amplification;
[0011] (b) adding an intercalator to a reaction solution after the
nucleic acid amplification;
[0012] (c) reducing signals derived from an intercalator bound to a
single-stranded nucleic acid by any of the aforementioned methods;
and
[0013] (d) assaying the fluorescence intensity of a reaction
solution.
[0014] Further, the present invention relates to a method for
detecting a product of nucleic acid amplification comprising the
following steps:
[0015] (a) amplifying a nucleic acid through nucleic acid
amplification in the presence of an intercalator;
[0016] (b) reducing signals derived from an intercalator bound to a
single-stranded nucleic acid by any of the aforementioned methods;
and
[0017] (c) assaying the fluorescence intensity of a reaction
solution.
[0018] The present invention further relates to a method for
detecting a product of nucleic acid amplification comprising the
following steps:
[0019] (a) amplifying a nucleic acid through nucleic acid
amplification in the presence of an intercalator and a compound
that is bound to a single-stranded nucleic acid more strongly than
an intercalator and is bound to a double-stranded nucleic acid more
weakly than an intercalator; and
[0020] (b) assaying the fluorescence intensity of a reaction
solution.
[0021] The nucleic acid amplification can be carried out by the
following steps:
[0022] (a) selecting a first arbitrary sequence F1c, a second
arbitrary sequence F2c, and a third arbitrary sequence F3c in that
order from the 3' terminus in a target region toward the 3'
terminus on the polynucleotide chain and a fourth arbitrary
sequence R1, a fifth arbitrary sequence R2, and a sixth arbitrary
sequence R3 in that order from the 5' terminus in the target region
toward the 5' terminus of the nucleotide chain;
[0023] (b) preparing a primer containing sequence F2 which is
complementary to F2c and, on the 5' side of F2, the same sequence
as F1c; a primer containing sequence F3 which is complementary to
F3c; a primer containing the same sequence as R2 and, on the 5'
side of the sequence, sequence R1c which is complementary to R1;
and a primer containing the same sequence as R3; and
[0024] (c) synthesizing DNA in the presence of a strand
displacement-type polymerase and the primers using the nucleotide
chain as a template.
[0025] The nucleic acid amplification can be carried out by the
following steps:
[0026] (a) selecting a first arbitrary sequence F1c and a second
arbitrary sequence F2c in that order from the 3' terminus in a
target region toward the 3' terminus on the polynucleotide chain
and a third arbitrary sequence R1 and a fourth arbitrary sequence
R2 in that order from the 5' terminus in the target region toward
the 5' terminus of the nucleotide chain;
[0027] (b) preparing a primer containing sequence F2 which is
complementary to F2c and, on the 5' side of F2, the same sequence
as F1c; and a primer containing the same sequence as R2 and, on the
5' side of the sequence, sequence R1c which is complementary to R1;
and
[0028] (c) synthesizing DNA in the presence of a strand
displacement-type polymerase, the primers, and a melting
temperature regulator (such as betaine or trimethylamine N-oxide)
using the nucleotide chain as a template for amplification.
[0029] The present invention further relates to a kit for detecting
double-stranded nucleic acids comprising, as elements, an
intercalator (e.g., ethidium bromide, acridine orange, TO-PRO-1, or
YO-PRO-1) and a compound that reacts more preferentially with an
intercalator bound to a single-stranded nucleic acid than with an
intercalator bound to a double-stranded nucleic acid and/or a
compound that is bound to a single-stranded nucleic acid more
strongly than an intercalator and is bound to a double-stranded
nucleic acid more weakly than an intercalator. Examples of the
compound that reacts more preferentially with an intercalator bound
to a single-stranded nucleic acid than with an intercalator bound
to a double-stranded nucleic acid include an oxidant, such as
sodium hypochlorite, hydrogen peroxide, or potassium permanganate,
and a reducer, such as sodium borohydride or sodium
cyanoborohydride. An example of the compound that is bound to a
single-stranded nucleic acid more strongly than an intercalator and
is bound to a double-stranded nucleic acid more weakly than an
intercalator is a second intercalator (e.g. methylene blue,
actinomycin D, SYBR Greeen 2, or OliGreen) different from the
aforementioned intercalator.
DISCLOSURE OF THE INVENTION
[0030] The present invention is hereafter described in detail.
[0031] The present invention relates to a method for detecting
double-stranded nucleic acids by detecting, with higher
sensitivity, signals derived from an intercalator bound to a
double-stranded nucleic acids through the reduction of signals
derived from an intercalator bound to a single-stranded nucleic
acid with the addition of a compound that reacts more
preferentially with an intercalator bound to a single-stranded
nucleic acid than with an intercalator bound to a double-stranded
nucleic acid or a compound that is bound to a single-stranded
nucleic acid more strongly than an intercalator and is bound to a
double-stranded nucleic acid more weakly than an intercalator to a
mixture comprising double-stranded and single-stranded nucleic
acids both having intercalators bound thereto.
[0032] Accordingly, this method is particularly useful when
selectively detecting amplification products when significant
amounts of primers besides the amplified double-stranded nucleic
acids remain in the reaction system during or after the nucleic
acid amplification that utilizes primers as single-stranded nucleic
acids.
[0033] In the present invention, the term "intercalator" refers to
an intercalating agent, which is a compound that can be inserted
(intercalated) in between adjacent planes formed by DNA nucleotide
pairing. The term "signal" refers to a substance that functions as
a marker for a specific substance or condition, such as
fluorescence derived from an intercalator bound to a nucleic
acid.
1. Nucleic Acid Amplification
[0034] Specifically, the present invention is useful when detecting
an amplification product (double-stranded nucleic acid) obtained in
the nucleic acid amplification that utilizes a primer, which is a
single-stranded nucleic acid. Examples of nucleic acid
amplification include, in addition to polymerase chain reaction
(PCR), the LAMP method, the strand displacement amplification (SDA)
method (JP Patent Publication (Kokoku) No. 7-114718 B (1995)), and
the nucleic acid sequence based amplification (NASBA) method (JP
Patent No. 2650159). More particularly, since a larger amount of
primers are used in the LAMP method than in PCR, the amount of
single-stranded primers remaining after the amplification is large.
Accordingly, the method for detecting double-stranded nucleic acids
according to the present invention is very useful when detecting
amplification products obtained by the LAMP method.
[0035] In the LAMP method, a loop structure is formed at a terminus
of the nucleotide sequence to be amplified and, simultaneously with
elongation by polymerase starting therefrom, a primer hybridized in
a region within the loop dissolves the elongation product into a
single strand while elongating a nucleic acid chain by strand
displacement. Since the generated single-stranded nucleic acid has
a self-complementary region at its terminus, it forms a loop at the
terminus, and new elongation is initiated. The actual LAMP method
proceeds under isothermal conditions and, thus, the reactions
described above occur simultaneously and in parallel. The LAMP
method is characterized by a very large amount of the amplification
product in addition to a strand displacement-type reaction that
proceeds under isothermal conditions. One of the reasons for this
is that the LAMP method does not involve thermal denaturation,
which deactivates polymerase. The LAMP method is hereafter
described.
(1) LAMP Method
[0036] At the outset, a scheme of the LAMP method is shown (FIG. 1
and FIG. 2). In the LAMP method, a template polynucleotide, which
is the target of amplification, is prepared. The template
polynucleotide (DNA or RNA) can be prepared by chemical synthesis,
or, in accordance with conventional methods, from biological
materials such as tissues or cells. The template polynucleotide is
prepared so that suitable lengths of sequences (referred to as
"bilateral sequences") are present on the sides (5' side and 3'
side) in the target region for amplification (FIG. 1A). The term
"bilateral sequence" refers to a sequence comprising a region from
the 5' terminus in the target region to the 5' terminus of the
polynucleotide chain and a sequence comprising a region from the 3'
terminus in the target region to the 3' terminus of the
polynucleotide chain (a portion indicated by two-headed arrows
(.rarw. .fwdarw.) in FIG. 1A). The lengths of the bilateral
sequences are 10 to 1,000 nucleotides, and preferably 30 to 500
nucleotides on the 5' side and the 3' side in the target
region.
[0037] Predetermined regions are arbitrarily selected from the
bilateral sequences in the template polynucleotide chain (FIG. 1A)
containing the target region and the bilateral sequences.
Specifically, a first arbitrary sequence F1c, a second arbitrary
sequence F2c, and a third arbitrary sequence F3c are selected in
that order from the 3' terminus in the target region toward the 3'
terminus of the polynucleotide chain (FIG. 1B). Similarly, a fourth
arbitrary sequence R1, a fifth arbitrary sequence R2, and a sixth
arbitrary sequence R3 are selected in that order from the 5'
terminus in the target region toward the 5' terminus of the
polynucleotide chain (FIG. 1B). When selecting the arbitrary
sequence F1c and the arbitrary sequence R1, the distance between
F1c and R1 can be 0 nucleotides, i.e., contiguous. Alternatively,
it can be selected in such a manner that F1c and R1 are allowed to
partially overlap. The first to the sixth regions are respectively
and arbitrarily selected in accordance with the sequences of
prepared polynucleotide chains. Each region to be selected
comprises preferably 5 to 100 nucleotides, and more preferably 10
to 50 nucleotides. Selection of the nucleotide length facilitates
annealing of the primer described below.
[0038] Each of the arbitrary sequences is preferably selected so
that, instead of intermolecular annealing, the amplification
product obtained by the LAMP method preferentially initiates the
intramolecular annealing between sequence F1c and sequence F1 and
between sequence R1 and sequence R1c as shown in FIG. 2L, and forms
a terminal loop structure. For example, in order to preferentially
initiate the intramolecular annealing, it is important to consider
the distance between sequence F1c and sequence F2c and the distance
between sequence R1 and sequence R1c when selecting the arbitrary
sequences. More specifically, both sequences are preferably located
within a distance of 0 to 500 nucleotides, preferably 0 to 100
nucleotides, and most preferably 10 to 70 nucleotides. Numerical
values respectively represent the number of nucleotides without
containing sequences F1c and F2c and sequences R1 and R2.
[0039] Subsequently, a primer referred to as the "FA primer" is
designed and synthesized, and this is annealed to F2c. The term "FA
primer" includes sequence F2 which is complementary to region F2c
and another sequence which is the same as F1c (this may be referred
to as "F1c" for convenience). Examples thereof include those having
a structure in which the 3'-terminus of sequence F1c is linked to
the 5' side of F2 (FIG. 1C). The term "annealing" refers to the
formation of a double-strand structure of a nucleotide chain
through nucleotide pairing based on the Watson-Crick model. After
the FA primer is annealed to sequence F2c on the template
polynucleotide chain, DNA strand synthesis is initiated starting
from F2 in the FA primer (FIG. 1D). Subsequently, a primer
containing sequence F3, which is complementary to F3c (hereafter
this may be referred to as "F3 primer"), is annealed to sequence
F3c on the template polynucleotide chain (FIG. 1D). Strand
displacement-type synthesis of DNA is then carried out starting
from the annealed F3 primer (FIG. 1E). When a double-strand
structure, which has been produced through the hybridization of a
polynucleotide to a template for the synthesis of a complementary
chain, is subjected to a reaction that synthesizes, starting from a
primer, a complementary chain while separating the polynucleotide
from the template, this process is termed "strand displacement-type
synthesis of DNA." Specific examples thereof include a reaction in
which synthesis proceeds so as to displace the chain synthesized by
the FA primer with the chain synthesized by the F3 primer. In other
words, the complementary chain of the template polynucleotide chain
synthesized by the FA primer can be displaced by a chain elongated
from the F3 primer in such a manner that the complementary chain is
separated.
[0040] Two types of nucleotide chains, the following (i) and (ii),
can be obtained by the above-described synthesis.
[0041] (i) A nucleotide chain containing sequence
"(5')F3-F2-F1-target region-R1c-R2c-R3c(3')," which is
complementary to sequence "(3')F3c-F2c-F1c-target
region-R1-R2-R3(5')" in the template polynucleotide chain (FIG.
1F).
[0042] (ii) A nucleotide chain formed into a single strand by
displacement (separated), i.e., a nucleotide chain containing
"(5')F1c-F2-F1-target region-R1c-R2c-R3c(3')" having the same
sequence as F1c on its 5' terminal side (FIG. 1G).
[0043] F1 and F1c are complementary to each other in the nucleotide
chain according to (ii) above and, thus, they hybridize to each
other based on the intrachain hydrogen bonds between F1 and F1c,
thereby forming a hairpin loop (FIG. 1G). F2 is contained in this
hairpin loop.
[0044] Subsequently, a primer referred to as the "RA primer" is
annealed to sequence R2c in the nucleotide chain according to (ii)
above. In the RA primer, the 3' side of sequence R1c complementary
to sequence R1 is linked to the 5' side of sequence R2. DNA strand
synthesis is then initiated starting from the RA primer (FIG. 1H).
When the elongated DNA synthesized starting from the RA primer has
reached the end of the double-strand chain formed between F1 and
F1c, the sequence of F1c is displaced with the elongated DNA in the
same manner as the displacement shown in FIG. 1E (FIG. 1I). A
primer containing sequence R3, which is complementary to sequence
R3c (hereafter it may be referred to as the "R3 primer"), is then
annealed to R3c of the template polynucleotide chain (FIG. 1I).
Strand displacement-type synthesis of DNA is then carried out
starting from the annealed R3 primer (FIG. 2J). Two types of
nucleotide chains, i.e., the following (iii) and (iv), are
synthesized based on the above synthesis.
[0045] (iii) A nucleotide chain "(3')F1-F2c-F1c-target
region-R1-R2-R3(5')," which is complementary to sequence
"(5')F1c-F2-F1-target region-R1c-R2c-R3c(3')" (FIG. 2K).
[0046] (iv) A nucleotide chain "(3')F1-F2c-F1-target
region-R1-R2-R1c(3')" having F1 located closest to the 3' terminal
side, and R1c located closest to the 5' terminal side (FIG.
2L).
[0047] The sequence according to (iv) above forms a hairpin loop by
the intrachain hydrogen bonds between sequences F1 and F1c existing
on the 3' side and between sequences R1 and R1c on the 5' side
(FIG. 2L).
[0048] Subsequently, among the nucleotide chains according to (iv)
above, region F2 of the FA primer is annealed to F2c in the hairpin
loop portion on the 3' side (FIG. 2M). DNA strand synthesis is
initiated starting from F1 annealed by the intrachain hydrogen
bonds. In FIG. 1M, the elongation chain synthesized starting from
F1 reaches the 5' terminus by opening the hairpin loop formed by
R1-R2-R1c. In contrast, when a reaction proceeds starting from F2,
a chain, which is complementary to a chain constituted by
"F1c-target region-R1-R2-R1c," is synthesized. In this case, F1and
the chain "F1-target region-R1c-R2c-R1" synthesized starting from
F1 are displaced by the chain that is synthesized starting from F2.
This provides for double-stranded DNA having a single-strand
protrusive construction denoted as "-target sequence-R1c-R2c-R1."
The portion having a single-strand protrusive construction forms a
hairpin loop by forming intrachain hydrogen bonds between R1c and
R1 of a portion having a single-strand protrusive construction
("R1c-R2c-R1") (FIG. 2N). This construct initiates DNA strand
synthesis starting from R1 annealed by the intrachain hydrogen
bonds (FIG. 2N). Two types of nucleotide chains, the following (v)
and (vi), are obtained based on the above synthesis.
[0049] (v) Sequence "(3')R1-R2-R1c-target region-F1-F2-F1c-target
region-R1-R2c-R1c-target region-F1-F2c-F1c-target
region-R1-R2-R1c(540 )" (FIG. 2O).
[0050] (vi) A sequence having F1c located closest to the 3'
terminal side and R1 located closest to the 5' terminal side
"(3')F1c-F2-F1-target region-R1c-R2c-R1(3')" (FIG. 2P).
[0051] The nucleotide chains according to (v) and (vi) above
respectively form a hairpin loop having R2c as a loop portion and a
hairpin loop having F2 and R2c as another loop portion by
intrachain hydrogen bonds. The RA primer is annealed to the portion
R2c forming the hairpin loop in two sequences, i.e., (v) and (vi)
above, synthesis of DNA starting from the primer is initiated, and
synthesis of nucleotides chain (complementary chain with sequence
shown in (vi)) containing a target sequence proceeds. This
complementary chain is the same as the sequence shown in FIG. 2L
and, thus, the reactions according to FIGS. 2L to 2P are thereafter
repeated. In contrast, the reaction from FIG. 1A can proceed and,
thus, amplification of polynucleotide chain proceeds by repeating
this series of syntheses.
[0052] The above-described amplification is carried out using four
types of primers, i.e., the FA primer, the RA primer, the F3
primer, and the R3 primer. Alternatively, amplification under
isothermal conditions can be initiated by using only two types of
primers, the FA primer and the RA primer, without using the F3
primer and the R3 primer. In this alternative amplification, a
melting temperature (Tm) regulator, for example, betaine or
trimethylamine N-oxide (TMANO), should be present in the reaction
system.
(2) Reaction Condition
[0053] In the reaction in accordance with the LAMP method, the
ingredients below are added to a template single-stranded nucleic
acid:
[0054] (i) four types of oligonucleotides (FA, RA, outer primer F3,
and outer primer R3);
[0055] (ii) DNA polymerase for strand displacement-type synthesis
of complementary chains; and
[0056] (iii) a nucleotide serving as a substrate for DNA
polymerase.
The reaction proceeds through incubation at such a temperature that
stable nucleotide pairing between a nucleotide sequence
constituting FA or RA and a complementary nucleotide sequence
thereof can be formed, and enzyme activity can be maintained. The
incubation temperature is 50 to 75.degree. C., and preferably 55 to
70.degree. C. The incubation time is 1 minute to 10 hours, and
preferably 5 minutes to 4 hours.
[0057] In the LAMP method according to the above two embodiments,
the FA primer and the RA primer are also referred to as "inner
primers" and the F3 primer and the R3 primer are also referred to
as "outer primers."
[0058] Synthesis of nucleotide chains from the outer primer should
be initiated after synthesis of nucleotide chains from the inner
primer. A method for satisfying this condition includes the one
which sets the concentration of the inner primer higher than that
of the outer primer. More specifically, the concentration of the
inner primer can be set higher than that of the outer primer by 2-
to 50-fold, and preferably by 4- to 25-fold.
[0059] Polymerase, which catalyzes the strand displacement-type
synthesis of complementary chains (this may be referred to as
"strand displacement-type polymerase), includes Bst DNA polymerase,
Bca(exo-) DNA polymerase, the Klenow fragment of E. coli DNA
polymerase I, Vent DNA polymerase, Vent(Exo-) DNA polymerase
(exonuclease activity is removed from Vent DNA polymerase),
DeepVent DNA polymerase, DeepVent(Exo-) DNA polymerase (exonuclease
activity is removed from DeepVent DNA polymerase), .phi.29 phage
DNA polymerase, MS-2 phage DNA polymerase, Z-Taq DNA polymerase
(Takara Shuzo Co., Ltd.), and KOD DNA polymerase (Toyobo Co.,
Ltd.).
[0060] This reaction is conducted in the presence of, for example,
a buffer giving suitable pH to the enzyme reaction, salts necessary
for maintaining the catalytic activity of the enzyme or for
annealing, a protective agent for the enzyme, and, if necessary, a
regulator for melting temperature (Tm). A buffer, such as Tris-HCl
having a buffering action in the range of weakly alkaline to
neutral, is used. The pH is adjusted depending on the DNA
polymerase being used. As salts, MgCl.sub.2, KCl, NaCl,
(NH.sub.4).sub.2SO.sub.4, etc. are suitably added to maintain the
activity of the enzyme and to regulate the melting temperature (Tm)
of the nucleic acid. Bovine serum albumin or sugars can be used as
protective agents for enzymes. Further, betaine
(N,N,N-trimethylglycine), trimethylamine N-oxide (TMANO), dimethyl
sulfoxide (DMSO), or formamide is used as a regulator for melting
temperature (Tm). By the use of the regulator for melting
temperature (Tm), annealing of the oligonucleotide can be regulated
under restricted temperature conditions. In particular, betaine and
trimethylamine N-oxide (TMANO) are also effective for improving the
efficiency of strand displacement by virtue of its isostabilization
properties. By adding betaine in an amount of 0.2 to 3.0 M, and
preferably about 0.5 to 1.5 M to the reaction solution, its
promoting action on the nucleic acid amplification of the present
invention can be expected. Because these regulators for melting
temperature act to lower melting temperature, conditions giving
suitable stringency and reactivity must be empirically determined
in consideration of other reaction conditions such as concentration
of salts and reaction temperature.
2. Methods for Reducing Signals Derived from an Intercalator Bound
to a Single-Stranded Nucleic Acid
[0061] The following methods are examples of methods for reducing
signals derived from an intercalator bound to a single-stranded
nucleic acid in a mixture comprising double-stranded and
single-stranded nucleic acids both having intercalators bound
thereto.
(1) A Method in Which a Compound that Reacts More Preferentially
with an Intercalator Bound to a Single-Stranded Nucleic Acid than
with an Intercalator Bound to a Double-Stranded Nucleic Acid is
Added
(1)-1 Utilization of an Oxidant or Reducer
[0062] A compound that reacts more preferentially with an
intercalator bound to a single-stranded nucleic acid than with an
intercalator bound to a double-stranded nucleic acid is added to a
mixture comprising double-stranded and single-stranded nucleic
acids having intercalators bound thereto. This can reduce signals
derived from an intercalator bound to a single-stranded nucleic
acid. An example of a compound that reacts more preferentially with
an intercalator bound to a single-stranded nucleic acid than with
an intercalator bound to a double-stranded nucleic acid is an
oxidant or reducer. Specifically, an oxidant or reducer is further
added to a mixed solution of double-stranded and single-stranded
nucleic acids that is stained by the addition of an intercalator,
and the resultant is maintained at suitable temperature for a
suitable period of time. Thus, the intercalator bound to
single-stranded nucleic acids is preferentially oxidized or reduced
compared with the intercalator bound to double-stranded nucleic
acids. This lowers fluorescence intensity derived from the
intercalator bound to a single strand. Examples of an intercalator
include ethidium bromide, acridine orange, TO-PRO-1, and YO-PRO-1.
Examples of an oxidant include sodium hypochlorite (NaClO),
hydrogen peroxide (H.sub.2O.sub.2), and potassium permanganate
(KMnO.sub.4). Examples of a reducer include sodium borohydride
(NaBH.sub.4) and sodium cyanoborohydride (NaBH.sub.3CN).
[0063] When detecting a product of nucleic acid amplification by
this method, fluorescence intensity is generally assayed through
addition of an intercalator to the reaction solution after the
nucleic acid amplification, followed by further addition of an
oxidant or reducer. Alternatively, an intercalator is added to the
reaction solution before the nucleic acid amplification,
amplification is carried out in the presence of the intercalator,
and an oxidant or reducer is added after the reaction, thereby
assaying the fluorescence intensity.
(1)-2 Utilization of a Complex-Forming Compound
[0064] A compound that forms a complex with an intercalator can be
used as a compound that reacts more preferentially with an
intercalator bound to a single-stranded nucleic acid than with an
intercalator bound to a double-stranded nucleic acid. Specifically,
an intercalator and the complex-forming compound are added to a
mixed solution of double-stranded and single-stranded nucleic
acids, and the resultant is maintained at suitable temperature for
a suitable period of time. A weak bond between a single-stranded
nucleic acid and an intercalator is preferentially inhibited by the
complex-forming reaction compared with a bond between a
double-stranded nucleic acid and an intercalator. This lowers
fluorescence intensity derived from an intercalator bound to a
single strand. An example of a combination of an intercalator and a
complex-forming compound is that of methylene blue (an
intercalator) and Acid Orange 7 (a complex-forming compound).
[0065] When detecting a product of nucleic acid amplification by
this method, fluorescence intensity is generally assayed through
simultaneous or sequential addition of an intercalator and a
complex-forming compound to the reaction solution after the nucleic
acid amplification. Alternatively, an intercalator is added to the
reaction solution before the nucleic acid amplification,
amplification is carried out in the presence of the intercalator,
and a complex-forming compound is added after the reaction, thereby
assaying the fluorescence intensity.
[0066] Absorbance may be assayed instead of fluorescence intensity
by utilizing differences in the absorption spectrum caused by the
complex formation. That is, since the absorption spectrum of an
intercalator differs from that of the complex thereof, it is
possible to quantitatively assay only the intercalator that did not
form a complex.
(2) A Method in Which a Compound that is Bound to a Single-Stranded
Nucleic Acid More Strongly than an Intercalator and is Bound to a
Double-Stranded Nucleic Acid More Weakly than an Intercalator is
Added
[0067] A compound that is bound to a single-stranded nucleic acid
more strongly than an intercalator and is bound to a
double-stranded nucleic acid more weakly than an intercalator is
added to a mixture comprising double-stranded and single-stranded
nucleic acids both having intercalators bound thereto. This can
reduce signals derived from an intercalator bound to a
single-stranded nucleic acid. An example of a compound that is
bound to a single-stranded nucleic acid more strongly than an
intercalator and is bound to a double-stranded nucleic acid more
weakly than an intercalator is a second intercalator that is
different from the aforementioned intercalator (hereafter referred
to as a "first intercalator"). A second intercalator different from
the first intercalator that is bound to a single-stranded nucleic
acid more strongly than the first intercalator and is bound to a
double-stranded nucleic acid more weakly than the first
intercalator is added to a mixed solution of double-stranded and
single-stranded solution, which is stained by the addition of the
first intercalator, and the resultant is maintained at suitable
temperature for a suitable period of time. Thus, the first
intercalator bound to a single-stranded nucleic acid is
preferentially displaced by the second intercalator compared with
the first intercalator bound to a double-stranded nucleic acid.
This lowers fluorescence intensity derived from the first
intercalator bound to a single strand. Examples of the first
intercalator that is first added to a mixture of double-stranded
and single-stranded nucleic acids include ethidium bromide,
acridine orange, TO-PRO-1, and YO-PRO-1. Examples of the second
intercalator, which is added for the preferential displacement with
the first intercalator bound to a single-stranded nucleic acid and
is different from the first intercalator, include methylene blue,
actinomycin D, SYBR Green 2, and OliGreen.
[0068] When detecting a product of nucleic acid amplification by
this method, fluorescence intensity is generally assayed through
addition of an intercalator to the reaction solution after the
nucleic acid amplification, followed by further addition of the
second intercalator different from the aforementioned intercalator.
Alternatively, an intercalator is added to the reaction solution
before the nucleic acid amplification, amplification is carried out
in the presence of the intercalator, and the second intercalator
different from the aforementioned intercalator is added after the
reaction, thereby assaying the fluorescence intensity. Further, the
two above types of intercalators are previously added to the
reaction solution before the nucleic acid amplification,
amplification is carried out in the presence of the two types of
intercalators, and fluorescence intensity can be assayed after the
reaction.
3. Detection of Double-Stranded Nucleic Acids
[0069] In the present invention, double-stranded nucleic acids are
detected by assaying the fluorescence emitted from the intercalator
bound to nucleic acids using a fluorophotometer after the process
described in 2 above. For example, when detecting the amplification
product obtained in the reaction in 1 above, a reaction system in
which amplification was carried out without template DNA (control
system 1) or a reaction system without DNA polymerase (control
system 2) is provided as a control. The aforementioned control
system and a system in which amplification was carried out as usual
in the presence of template DNA and DNA polymerase (a test system)
are subjected to the process as described in 2 above, and
differences in fluorescence intensity between the control system
and the test system are inspected. Thus, the generation of the
amplification product in the reaction solution through the reaction
can be confirmed. More specifically, when fluorescence intensity of
the test system is greater than that of the control system 1 or 2,
it can be evaluated that the amplification product was detected in
the test system.
[0070] An example of a fluorophotometer that can be used for
assaying fluorescence intensity is the ABI PRISM 7700 sequence
detection system (PE Applied Biosystems). When assaying
fluorescence intensity, the excitation wavelength and the assay
wavelength are suitably determined in accordance with the type of
intercalator used for staining nucleic acids. In the present
invention, the reaction solution after the initiation of
amplification is subjected to the process described in 2 above, and
fluorescence intensity thereof is then assayed with the elapse of
time. Thus, transition in the conditions of the reaction product
with the elapse of the reaction time can be monitored.
4. Kit for Detecting or Monitoring Double-Stranded Nucleic
Acids
[0071] In the method for detecting or monitoring the product of
nucleic acid amplification according to 3 above, reagents necessary
for implementation can be packaged and supplied as a kit. Specific
examples include a kit comprising the following elements.
[Elements of Kit]
[0072] (1) An intercalator (for example, ethidium bromide, acridine
orange, TO-PRO-1, and YO-PRO-1);
[0073] (2) a compound that reacts more preferentially with an
intercalator bound to a single-stranded nucleic acid than with an
intercalator bound to a double-stranded nucleic acid (for example,
an oxidant such as sodium hypochlorite (NaClO), hydrogen peroxide
(H.sub.2O.sub.2), or potassium permanganate (KMnO.sub.4) and a
reducer such as sodium borohydride); and
[0074] (3) a compound that is bound to a single-stranded nucleic
acid more strongly than an intercalator and is bound to a
double-stranded nucleic acid more weakly than an intercalator (for
example, the second intercalator different from the intercalator
that was first added to a mixed solution of double-stranded and
single-stranded nucleic acids such as methylene blue, actinomycin
D, SYBR Green 2, or OliGreen).
[0075] This kit can also be used for amplifying and detecting a
target nucleic acid based on the LAMP method by adding the elements
below:
[Elements that Can be Added]
[0076] (a) when a first arbitrary sequence F1c, a second arbitrary
sequence F2c, and a third arbitrary sequence F3c are selected in
that order from the 3' terminus in the target region toward the 3'
terminus of the polynucleotide chain that constitutes a nucleic
acid to be detected and a fourth arbitrary sequence R1, a fifth
arbitrary sequence R2, and a sixth arbitrary sequence R3 are
selected in that order from the 5' terminus in the target region
toward the 5' terminus of the polynucleotide chain, a primer
containing sequence F2 which is complementary to F2c and, on the 5'
side of F2, the same sequence as F1c; a primer containing sequence
F3 which is complementary to F3c; a primer containing the same
sequence as R2 and, on the 5' side of the sequence, sequence R1c
which is complementary to R1; and a primer containing the same
sequence as R3;
[0077] (b) a polymerase catalyzing strand displacement-type
synthesis of complementary chains; and
[0078] (c) a nucleotide serving as a substrate for the synthesis of
complementary strands.
[0079] The elements of the kit can vary according to the embodiment
of the LAMP method to be employed. Specifically, a primer
containing the sequence F3 which is complementary to arbitrary
sequence F3c and a primer containing the same sequence as arbitrary
sequence R3 can be optionally omitted from the elements. In such a
case, a melting temperature regulator (for example, betaine or
trimethylamine N-oxide) is preferably added. Further, a buffer
providing suitable conditions for the enzyme reaction and reagents
necessary for detecting the reaction product of synthesis may be
optionally added. According to a preferred embodiment of the
present invention, reagents necessary for one reaction can be
supplied in the state of being fractionated into reaction
vessels.
BRIEF DESCRIPTION OF THE DRAWINGS
[0080] FIG. 1 shows a scheme of amplification by the LAMP
method.
[0081] FIG. 2 shows a scheme of amplification by the LAMP
method.
[0082] FIG. 3 shows fluorescence intensity of each reaction
solution when the LAMP reaction is carried out in the presence of
ethidium bromide, followed by the addition of a reducer or
oxidant.
[0083] FIG. 4 shows fluorescence intensity of each reaction
solution when the LAMP reaction is carried out in the presence of
acridine orange, followed by the addition of a reducer or
oxidant.
[0084] FIG. 5 shows fluorescence intensity of each reaction
solution when the LAMP reaction is carried out by adding the second
intercalator in addition to ethidium bromide.
[0085] FIG. 6 shows fluorescence intensity of each reaction
solution when the LAMP reaction is carried out by adding the second
intercalator in addition to acridine orange.
[0086] FIG. 7 shows fluorescence intensity of each reaction
solution when the LAMP reaction is carried out by adding methylene
blue as the second intercalator to YO-PRO-1.
[0087] FIG. 8 shows absorbance of each reaction solution when the
LAMP reaction is carried out by adding methylene blue and Acid
Orange 7.
[0088] This description includes part or all of the contents as
disclosed in the description of Japanese Patent Application No.
2001-183716, which is a priority document of the present
application.
BEST MODE FOR CARRYING OUT THE INVENTION
[0089] The present invention will be described in more detail with
reference to the following examples, although the technical scope
of the present invention is not limited to these examples.
EXAMPLE 1
Effect of an Oxidant or Reducer on the Detection of the LAMP
Reaction Product Using Ethidium Bromide
(1) Nucleic Acid Amplification by the LAMP Method
TABLE-US-00001 [0090] TABLE 1 Composition of reaction solution
Composition of reaction solution (in 25 .mu.L) 20 mM Tris-HCl pH
8.8 10 mM KCl 10 mM (NH.sub.4).sub.2SO.sub.4 4 mM MgSO.sub.4 0.1%
Tween 20 0.4 mM dNTP 8 U Bst DNA polymerase (NEB) 1.6 .mu.M FA
primer 1.6 .mu.M RA primer 0.4 .mu.M F3 primer 0.4 .mu.M R3
primer
[0091] To the above reaction solution, 6.times.10.sup.-20 mol of
DNA of prostate-specific antigen (PSA) as a template for the LAMP
reaction and ethidium bromide (EtBr, 0.5 .mu./ml) for detecting
amplification products were added. Amplification was then carried
out at 65.degree. C. for 30 minutes. The reaction solution to which
template DNA had been added was determined to be a positive
reaction solution, and the reaction solution without the addition
of template DNA was determined to be a negative reaction solution.
In this amplification, the following sequence (SEQ ID NO: 1)
included in the template was determined to be a polynucleotide of
interest.
TABLE-US-00002 (SEQ ID NO: 1)
5'-TGCTTGTGGCCTCTCGTGGCAGGGCAGTCTGCGGCGGTGTTCTGGTG
CACCCCCAGTGGGTCCTCACAGCTGCCCACTGCATCAGGAACAAAAGCGT
GATCTTGCTGGGTCGGCACAGCCTGTTTCATCCTGAAGACACAGGCCAGG
TATTTCAGGTCAGCCACAGCTTCACACACCC-3'
[0092] Inner primers (FA primer and RA primer) and outer primers
(F3 primer and R3 primer) in the reaction solution were designed as
follows based on the nucleotide sequence as shown in SEQ ID NO:
1.
TABLE-US-00003 [Inner primers] .cndot.FA primer (SEQ ID NO: 2)
5'-TGTTCCTGATGCAGTGGGCAGCTTTAGTCTGCGGCGGTGTTCTG-3' .cndot.RA primer
(SEQ ID NO: 3) 5'-TGCTGGGTCGGCACAGCCTGAAGCTGACCTGAAATACCTGGCCTG- 3'
[Outer primers] .cndot.F3 primer (SEQ ID NO: 4)
5'-TGCTTGTGGCCTCTCGTG-3' .cndot.R3 primer (SEQ ID NO: 5)
5'-GGGTGTGTGAAGCTGTG-3'
(2) Oxidation or Reduction
[0093] The positive and the negative reaction solutions after the
amplification were subjected to oxidation or reduction.
Specifically, oxidation was carried out by adding sodium
hypochlorite (NaClO) to the both reaction solutions to
concentrations of 2.8% and maintaining the resultant at room
temperature for 2 hours. Reduction was carried out by adding 4 mM
sodium borohydride (NaBH.sub.4) and 0.4 mM sodium hydroxide (NaOH)
to the both reaction solutions and maintaining the resultant on ice
for 10 minutes. After the reaction, the fluorescence intensity of
each reaction solution was assayed using the ABI PRISM 7700
sequence detection system (PE Applied Biosystems) at an excitation
wavelength of 488 nm and an assay wavelength of 605 nm.
[0094] The assay results are shown in FIG. 3. In the case of the
reaction solutions which were not subjected to oxidation or
reduction (EtBr in FIG. 3), the fluorescence intensity of the
positive reaction solution was 3,012, and that of the negative
reaction solution was 2,695. That is, difference in the
fluorescence intensity resulting from the occurrence of products of
double-stranded nucleic acid amplification was 317. In contrast, in
the case of the reaction solutions which were subjected to
oxidation using sodium hypochlorite (EtBr+NaClO in FIG. 3), the
fluorescence intensity of the positive reaction solution was 1,784,
and that of the negative reaction solution was 648. That is,
difference in the fluorescence intensity resulting from the
occurrence of products of double-stranded nucleic acid
amplification was as large as 1,136. In the case of the reaction
solutions which were subjected to reduction using sodium
borohydride (EtBr+NaBH.sub.4 in FIG. 3), the fluorescence intensity
of the positive reaction solution was 1,051, and that of the
negative reaction solution was 218. That is, difference in the
fluorescence intensity resulting from the occurrence of products of
double-stranded nucleic acid amplification was as large as 833.
[0095] Thus, sensitivity for detecting products of double-stranded
nucleic acid amplification using ethidium bromide can be enhanced
by oxidizing or reducing the amplification products stained with
ethidium bromide.
EXAMPLE 2
Effect of an Oxidant or Reducer on the Detection of the LAMP
Reaction Product Using Acridine Orange
[0096] The effects of an oxidant or reducer on the efficiency of
detecting the LAMP reaction product were inspected under the same
experimental conditions as used in Example 1 except that acridine
orange was added instead of ethidium bromide and the assay
wavelength was set at 575 nm in the amplification of nucleic acids
described in Example 1. The assay results are shown in FIG. 4. In
the case of the reaction solutions which were not subjected to
oxidation or reduction (AO in FIG. 4), the fluorescence intensity
of the positive reaction solution was 7,053, and that of the
negative reaction solution was 6,155. That is, difference in the
fluorescence intensity resulting from the occurrence of products of
double-stranded nucleic acid amplification was 898. In contrast, in
the case of the reaction solutions which were subjected to
oxidation using sodium hypochlorite (AO+NaClO in FIG. 4), the
fluorescence intensity of the positive reaction solution was 5,521,
and that of the negative reaction solution was 201. That is,
difference in the fluorescence intensity resulting from the
occurrence of products of double-stranded nucleic acid
amplification was as large as 5,320. In the case of the reaction
solutions which were subjected to reduction using sodium
borohydride (AO+NaBH.sub.4 in FIG. 4), the fluorescence intensity
of the positive reaction solution was 6,214, and that of the
negative reaction solution was 596. That is, difference in the
fluorescence intensity resulting from the occurrence of products of
double-stranded nucleic acid amplification was as large as
5,618.
[0097] Thus, sensitivity for detecting products of double-stranded
nucleic acid amplification using acridine orange can be enhanced by
oxidizing or reducing the amplification products stained with
acridine orange.
EXAMPLE 3
Effect of Another Intercalator on the Detection of the LAMP
Reaction Product Using Ethidium Bromide
[0098] The LAMP reaction was carried out under the same reaction
conditions as in Example 1 except that, in addition to ethidium
bromide, 20 .mu.M of methylene blue, 1 .mu.g/ml of actinomycin D,
or 100,000-fold diluted SYBR Green 2 (Molecular Probes) was added
as the second intercalator. Thus, effects of each of the
aforementioned second intercalators on the efficiency of detecting
the LAMP reaction product were inspected. The results are shown in
FIG. 5. In the case of the reaction solutions to which the second
intercalator was not added in addition to ethidium bromide (EtBr in
FIG. 5), the fluorescence intensity of the positive reaction
solution was 3,085, and that of the negative reaction solution was
2,701. That is, difference in the fluorescence intensity resulting
from the occurrence of products of double-stranded nucleic acid
amplification was 384. In contrast, in the case of the reaction
solutions to which methylene blue was added (EtBr+MB in FIG. 5),
the fluorescence intensity of the positive reaction solution was
860, and that of the negative reaction solution was 116. That is,
difference in the fluorescence intensity resulting from the
occurrence of products of double-stranded nucleic acid
amplification was as large as 744. In the case of the reaction
solutions to which actinomycin D was added (EtBr+AD in FIG. 5), the
fluorescence intensity of the positive reaction solution was 3,158,
and that of the negative reaction solution was 2,322. That is,
difference in the fluorescence intensity resulting from the
occurrence of products of double-stranded nucleic acid
amplification was as large as 836. Further, in the case of the
reaction solutions to which SYBR Green 2 was added (EtBr+SYBR-G in
FIG. 5), the fluorescence intensity of the positive reaction
solution was 2,822, and that of the negative reaction solution was
2,268. That is, difference in the fluorescence intensity resulting
from the occurrence of products of double-stranded nucleic acid
amplification was as large as 554.
[0099] Thus, sensitivity for detecting products of double-stranded
nucleic acid amplification using ethidium bromide can be enhanced
by performing the LAMP reaction in the presence of the second
intercalator together with ethidium bromide.
EXAMPLE 4
Effect of Another Intercalator on the Detection of the LAMP
Reaction Product Using Acridine Orange
[0100] The LAMP reaction was carried out under the same reaction
conditions as in Example 1 except that, in addition to acridine
orange that was added instead of ethidium bromide, 20 .mu.M of
methylene blue, 1 .mu.g/ml of actinomycin D, or 100,000-fold
diluted SYBR Green 2 (Molecular Probes) was added as the second
intercalator and the assay wavelength was set at 575 nm. Thus,
effect of each intercalator on the efficiency of detecting the LAMP
reaction product was inspected. The results are shown in FIG. 6. In
the case of the reaction solutions to which the second intercalator
was not added in addition to acridine orange (AO in FIG. 6), the
fluorescence intensity of the positive reaction solution was 7,121,
and that of the negative reaction solution was 6,195. That is,
difference in the fluorescence intensity resulting from the
occurrence of products of double-stranded nucleic acid
amplification was 926. In contrast, in the case of the reaction
solutions to which methylene blue was added (AO+MB in FIG. 6), the
fluorescence intensity of the positive reaction solution was 3,500,
and that of the negative reaction solution was 350. That is,
difference in the fluorescence intensity resulting from the
occurrence of products of double-stranded nucleic acid
amplification was as large as 3150. In the case of the reaction
solutions to which actinomycin D was added (AO+AD in FIG. 6), the
fluorescence intensity of the positive reaction solution was 7,368,
and that of the negative reaction solution was 4,762. That is,
difference in the fluorescence intensity resulting from the
occurrence of products of double-stranded nucleic acid
amplification was as large as 2,606. Further, in the case of the
reaction solutions to which SYBR Green 2 was added (AO+SYBR-G in
FIG. 6), the fluorescence intensity of the positive reaction
solution was 9,435, and that of the negative reaction solution was
4,721. That is, difference in the fluorescence intensity resulting
from the occurrence of products of double-stranded nucleic acid
amplification was as large as 4,714.
[0101] Thus, sensitivity for detecting products of double-stranded
nucleic acid amplification using acridine orange can be enhanced by
performing the LAMP reaction in the presence of the second
intercalator together with acridine orange.
EXAMPLE 5
Effect of Methylene Blue on the Detection of the LAMP Reaction
Product Using YO-PRO-1
[0102] The LAMP reaction was carried out under the same reaction
conditions as in Example 3 except that 1 .mu.g/ml of YO-PRO-1 and
10 .mu.M of methylene blue as the second intercalators were added
instead of ethidium bromide. Thus, the effect of methylene blue on
the efficiency of detecting the LAMP reaction product using
YO-PRO-1 was inspected. The fluorescence intensity was assayed
using 20 .mu.l of the reaction solution after the amplification and
a plate reader (Polarion, Tecan) at an excitation wavelength of 485
nm, at an assay wavelength of 535 nm, and at 25.degree. C. The
assay results are shown in FIG. 7.
[0103] In the case of the reaction solutions to which methylene
blue was not added (YO-PRO-1 in FIG. 7), the fluorescence intensity
of the positive reaction solution was 39,194, and that of the
negative reaction solution was 34,047. That is, difference in the
fluorescence intensity resulting from the occurrence of products of
double-stranded nucleic acid amplification was 5,147.
[0104] In contrast, in the case of the reaction solutions to which
methylene blue was added (YO-PRO-1+MB in FIG. 7), the fluorescence
intensity of the positive reaction solution was 33,596, and that of
the negative reaction solution was 13,592. That is, difference in
the fluorescence intensity resulting from the occurrence of
products of double-stranded nucleic acid amplification was as large
as 20,004.
[0105] Thus, sensitivity for detecting products of double-stranded
nucleic acid amplification using YO-PRO-1 can be enhanced by
performing the LAMP reaction in the presence of methylene blue as
the second intercalator together with YO-PRO-1.
EXAMPLE 6
Effect of a Complex-Forming Compound on the Detection of the LAMP
Reaction Product Using Methylene Blue
[0106] Methylene blue and Acid Orange 7 are mixed in an aqueous
solution. This forms a complex. Upon the formation of a complex,
the absorption spectrum of methylene blue and that of Acid Orange 7
(AdO) are varied. Thus, the formation of a complex can be confirmed
by assaying the absorption spectrum.
[0107] 500 .mu.M of methylene blue or a mixed solution of methylene
blue and AdO (500 .mu.M each; methylene blue forms a complex with
AdO) was added to the LAMP reaction solution, and the resultant was
subjected to nucleic acid amplification in the same manner as in
Example 1. The absorbance of the reaction solution after the
amplification was assayed using a Shimadzu UV-2200
spectrophotometer (using a 10-mm cell) at the assay wavelength of
680 nm. The assay results are shown in FIG. 8. In the case of the
reaction solutions to which AdO was not added (MB in FIG. 8), the
absorbance of the positive reaction solution was 0.75, and that of
the negative reaction solution was 0.71. That is, difference in the
absorbance resulting from the occurrence of products of
double-stranded nucleic acid amplification was 0.04. In contrast,
in the case of the reaction solutions to which AdO was added
(MB+AdO in FIG. 8), the absorbance of the positive reaction
solution was 0.46, and that of the negative reaction solution was
0.38. That is, difference in the absorbance resulting from the
occurrence of products of double-stranded nucleic acid
amplification was 0.08.
[0108] This indicates that AdO regulated the insertion of methylene
blue into DNA. More specifically, the insertion of methylene blue
into single-stranded DNA is weak and thus is inhibited by AdO. On
the contrary, the insertion of methylene blue into double-stranded
DNA is strong and thus cannot be inhibited by AdO. Thus, methylene
blue is considered to be released from a complex.
[0109] Therefore, a bond of an intercalator to a single-stranded
nucleic acid is preferentially inhibited by the formation of a
complex as well as by oxidation or reduction. Thus, the sensitivity
of detecting products of double-stranded nucleic acid amplification
can be enhanced.
[0110] All publications, patents, and patent applications cited
herein are incorporated herein by reference in their entirety.
INDUSTRIAL APPLICABILITY
[0111] The present invention provides a method for efficiently
detecting products of double-stranded nucleic acid amplification.
In particular, the application of the present invention to the
detection of products of nucleic acid amplification by the LAMP
method can effectively reduce background noises, which are derived
from single-stranded nucleic acid caused by the use of a larger
amount of primers compared with the case of PCR.
FREE TEXT OF SEQUENCE LISTING
[0112] SEQ ID NO: 1; synthetic DNA
[0113] SEQ ID NO: 2; synthetic DNA
[0114] SEQ ID NO: 3; synthetic DNA
[0115] SEQ ID NO: 4; synthetic DNA
[0116] SEQ ID NO: 5; synthetic DNA
Sequence CWU 1
1
51178DNAArtificial Sequencesynthetic DNA 1tgcttgtggc ctctcgtggc
agggcagtct gcggcggtgt tctggtgcac ccccagtggg 60tcctcacagc tgcccactgc
atcaggaaca aaagcgtgat cttgctgggt cggcacagcc 120tgtttcatcc
tgaagacaca ggccaggtat ttcaggtcag ccacagcttc acacaccc
178244DNAArtificial Sequenceprimer 2tgttcctgat gcagtgggca
gctttagtct gcggcggtgt tctg 44345DNAArtificial Sequenceprimer
3tgctgggtcg gcacagcctg aagctgacct gaaatacctg gcctg
45418DNAArtificial Sequenceprimer 4tgcttgtggc ctctcgtg
18517DNAArtificial Sequenceprimer 5gggtgtgtga agctgtg 17
* * * * *