U.S. patent application number 11/682512 was filed with the patent office on 2008-06-12 for apparatus and method for electroporation of biological samples.
Invention is credited to Sergey M. Dzekunov, John W. Holaday, Hyung J. Lee, Linhong Li, Linda Liu, Vininder Singh.
Application Number | 20080138877 11/682512 |
Document ID | / |
Family ID | 26979274 |
Filed Date | 2008-06-12 |
United States Patent
Application |
20080138877 |
Kind Code |
A1 |
Dzekunov; Sergey M. ; et
al. |
June 12, 2008 |
Apparatus and Method For Electroporation of Biological Samples
Abstract
The present invention relates to methods and apparatus for the
encapsulation of biologically-active substances in various cell
populations. More particularly, the present invention relates to a
method and apparatus for the encapsulation of biologically-active
substances in various cell populations in blood by electroporation
to achieve therapeutically desirable changes in the physical
characteristics of the various cell populations in blood.
Inventors: |
Dzekunov; Sergey M.;
(Germantown, MD) ; Lee; Hyung J.; (West Chester,
PA) ; Li; Linhong; (North Potomac, MD) ;
Singh; Vininder; (Boyds, MD) ; Liu; Linda;
(Clarksville, MD) ; Holaday; John W.; (Bethesda,
MD) |
Correspondence
Address: |
FULBRIGHT & JAWORSKI L.L.P.
600 CONGRESS AVE., SUITE 2400
AUSTIN
TX
78701
US
|
Family ID: |
26979274 |
Appl. No.: |
11/682512 |
Filed: |
March 6, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10751586 |
Jan 5, 2004 |
7186559 |
|
|
11682512 |
|
|
|
|
10225446 |
Aug 21, 2002 |
7141425 |
|
|
10751586 |
|
|
|
|
60354571 |
Feb 5, 2002 |
|
|
|
60314241 |
Aug 22, 2001 |
|
|
|
Current U.S.
Class: |
435/173.6 ;
435/285.2 |
Current CPC
Class: |
A61N 1/327 20130101;
A61N 1/0412 20130101; C12N 2740/10051 20130101; A61K 9/5068
20130101; C12N 15/87 20130101; A61K 48/0091 20130101; C12M 35/02
20130101; C12N 2840/203 20130101 |
Class at
Publication: |
435/173.6 ;
435/285.2 |
International
Class: |
C12N 13/00 20060101
C12N013/00; C12M 1/42 20060101 C12M001/42 |
Claims
1. An electroporation chamber comprising a chamber for containing a
suspension of cells to be electroporated; the chamber being at
least partially defined by opposing oppositely chargeable
electrodes; and wherein the thermal resistance of the chamber is
less than approximately 10.degree. C. per Watt.
2. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 9.5.degree. C.
per Watt.
3. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 9.degree. C.
per Watt.
4. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 8.5.degree. C.
per Watt.
5. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 9.5.degree. C.
per Watt.
6. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 8.degree. C.
per Watt.
7. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 7.5.degree. C.
per Watt.
8. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 7.degree. C.
per Watt.
9. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 6.5.degree. C.
per Watt.
10. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 6.degree. C.
per Watt.
11. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 5.5.degree. C.
per Watt.
12. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 5.degree. C.
per Watt.
13. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 4.5.degree. C.
per Watt.
14. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 4.degree. C.
per Watt.
15. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 3.5.degree. C.
per Watt
16. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 3.degree. C.
per Watt.
17. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 2.5.degree. C.
per Watt.
18. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 2.degree. C.
per Watt.
19. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is less than approximately 1.5.degree. C.
per Watt.
20. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is approximately 0.1.degree. C. per Watt
to 4.degree. C. per Watt.
21. The electroporation chamber of claim 1, wherein the thermal
resistance of the chamber is approximately 1.5.degree. C. per Watt
to 2.5.degree. C. per Watt.
22. A method of electroporating a cell comprising flowing a
suspension of cells to be electroporated into an electroporation
chamber in accordance with claim 1, and electroporating said
cells.
23. The method of claim 22, wherein the thermal resistance of the
electroporation chamber is less than approximately 9.5.degree. C.
per Watt.
24. The method of claim 23, wherein the thermal resistance of the
electroporation chamber is less than approximately 9.degree. C. per
Watt.
25. The method of claim 24, wherein the thermal resistance of the
electroporation chamber is less than approximately 8.5.degree. C.
per Watt.
26. (canceled)
27. The method of claim 25, wherein the thermal resistance of the
electroporation chamber is less than approximately 8.degree. C. per
Watt.
28. The method of claim 27, wherein the thermal resistance of the
electroporation chamber is less than approximately 7.5.degree. C.
per Watt.
29. The method of claim 28, wherein the thermal resistance of the
electroporation chamber is less than approximately 7.degree. C. per
Watt.
30. The method of claim 29, wherein the thermal resistance of the
electroporation chamber is less than approximately 6.5.degree. C.
per Watt.
31. The method of claim 30, wherein the thermal resistance of the
electroporation chamber is less than approximately 6.degree. C. per
Watt.
32. The method of claim 31, wherein the thermal resistance of the
electroporation chamber is less than approximately 5.5.degree. C.
per Watt.
33. The method of claim 32, wherein the thermal resistance of the
electroporation chamber is less than approximately 5.degree. C. per
Watt.
34. The method of claim 33, wherein the thermal resistance of the
flow chamber electroporation chamber is less than approximately
4.5.degree. C. per Watt.
35. The method of claim 34, wherein the thermal resistance of the
electroporation chamber is less than approximately 4.degree. C. per
Watt.
36. The method of claim 35, wherein the thermal resistance of the
electroporation chamber is less than approximately 3.5.degree. C.
per Watt.
37. The method of claim 36, wherein the thermal resistance of the
electroporation chamber is less than approximately 3.degree. C. per
Watt.
38. The method of claim 37, wherein the thermal resistance of the
electroporation chamber is less than approximately 2.5.degree. C.
per Watt.
39. The method of claim 38, wherein the thermal resistance of the
electroporation chamber is less than approximately 2.degree. C. per
Watt.
40. The method of claim 39, wherein the thermal resistance of the
flow chamber electro oration chamber is less than approximately
1.5.degree. C. per Watt.
41. The method of claim 40, wherein the thermal resistance of the
electroporation chamber is approximately 0.1.degree. C. per Watt to
4.degree. C. per Watt.
42. The method of claim 41, wherein the thermal resistance of the
electroporation chamber is approximately 1.5.degree. C. per Watt to
2.5.degree. C. per Watt.
43. An electroporation device comprising the electroporation
chamber of claim 1, the chamber further defined as comprising:
walls defining a flow channel having an electroporation zone
configured to receive and to transiently contain a suspension of
cells to be electroporated; an inlet flow portal in fluid
communication with the flow channel, whereby the suspension can be
introduced into the flow channel through the inlet flow portal; an
outlet flow portal in fluid communication with the flow channel,
whereby the suspension can be withdrawn from the flow channel
through the outlet portal; the walls defining the flow channel
within the electroporation zone comprising a first electrode
forming a substantial portion of a first wall of the flow channel
and a second electrode forming a substantial portion of a second
wall of the flow channel opposite the first wall, the first and
second electrodes being such that when placed in electrical
communication with a source of electrical energy an electric field
is formed therebetween through which the suspension can flow.
44.-46. (canceled)
47. The device of claim 43, wherein the first and second electrodes
are spaced from each other at least 1 mm.
48. The device of claim 43, wherein the flow chamber has a ratio of
combined electrode surface in contact with buffer to the distance
between the electrodes of approximately 1 to 100.
49. The device of claim 43, wherein the cells electroporated in the
flow channel are not substantially thermally degraded thereby.
50. An electroporation device comprising: a chamber for containing
a suspension of cells to be electroporated; the chamber being at
least partially defined by opposing oppositely chargeable
electrodes; and wherein the chamber has a ratio of combined
electrode surface in contact with buffer to the distance between
the electrodes of approximately 1 to 100.
51. The device of claim 50, wherein the ratio is approximately 1 to
90.
52. The device of claim 50, wherein the ratio is approximately 1 to
80.
53. The device of claim 50, wherein the ratio is approximately 1 to
70.
54. The device of claim 50, wherein the ratio is approximately 1 to
60.
55. The device of claim 50, wherein the ratio is approximately 1 to
50.
56. An electroporation device comprising an electroporation chamber
in accordance with claim 1, the chamber comprising: walls defining
a flow channel configured to receive and to transiently contain a
suspension of cells to be electroporated; an inlet flow portal in
fluid communication with the flow channel, whereby the suspension
can be introduced into the flow channel through the inlet flow
portal; an outlet flow portal in fluid communication with the flow
channel, whereby the suspension can be withdrawn from the flow
channel through the outlet portal; the walls defining the flow
channel comprising a first electrode forming at least a portion of
a first wall of the flow channel and a second electrode forming at
least a portion of a second wall of the flow channel opposite the
first wall, the first and second electrodes being such that when
placed in electrical communication with a source of electrical
energy an electric field is formed therebetween.
57. The device of claim 56, wherein the thermal resistance of the
flow channel is less than approximately 4.degree. C. per Watt.
58. The device of claim 56, wherein the thermal resistance of the
flow channel is approximately 0.1.degree. C. per Watt to 10.degree.
C. per Watt.
59. The device of claim 56, wherein the thermal resistance of the
flow channel is approximately 1.5.degree. C. per Watt to
2.5.degree. C. per Watt
60. The device of claim 56, wherein the first and second electrodes
are spaced from each other at least 1 mm.
61. The device of claim 56, wherein the first and second electrodes
are spaced from each other at least 3 mm.
62. The device of claim 56, wherein the flow channel has a ratio of
combined electrode surface in contact with buffer to the distance
between the electrodes of approximately 1 to 100.
63. The device of claim 56, wherein the flow channel has a ratio of
combined electrode surface in contact with buffer to the distance
between the electrodes of approximately 1 to 100 and wherein the
first and second electrodes are spaced from each other at least 1
mm.
64. The device of claim 56, wherein the flow channel has a ratio of
combined electrode surface in contact with buffer to the distance
between the electrodes of approximately 1 to 100 and wherein the
first and second electrodes are spaced from each other at least 3
mm.
65. The device of claim 56, wherein the flow channel has a ratio of
combined electrode surface in contact with buffer to the distance
between the electrodes of approximately 1 to 100 and wherein the
first and second electrodes are spaced from each other
approximately 3 mm to approximately 2 cm.
66. The device of claim 56, wherein the cells electroporated in the
flow channel are not substantially thermally degraded thereby.
67. An electroporation device comprising an electroporation chamber
in accordance with claim 1, the chamber comprising: walls defining
a flow channel configured to receive and to transiently contain a a
suspension comprising particles; an inlet flow portal in fluid
communication with the flow channel, whereby the suspension can be
introduced into the flow channel through the inlet flow portal; an
outlet flow portal in fluid communication with the flow channel,
whereby the suspension can be withdrawn from the flow channel
through the outlet flow portal; the walls defining the flow channel
comprising a first electrode plate forming a first wall of the flow
channel and a second electrode plate forming a second wall of the
flow channel opposite the first wall; wherein the area of the
electrodes contact with the suspension, and the distance between
the electrodes is chosen so that the thermal resistance of the flow
channel is less than approximately 4.degree. C. per Watt. the
paired electrodes placed in electrical communication with a source
of electrical energy, whereby an electrical field is formed between
the electrodes; whereby the suspension of the particles in the flow
channel can be subjected to an electrical field formed between the
electrodes.
68. The device of claim 67, wherein the electrode plates defining
the flow channel further comprises: a gasket formed from an
electrically non-conductive material and disposed between the first
and second electrode plates to maintain the electrode plates in
spaced-apart relation, the gasket defining a channel therein
forming opposed side walls of the flow channel.
69. The device of claim 67, wherein the gasket forms a seal with
each of the first and second electrode plates.
70. The device of claim 67, wherein the device comprises a
plurality of flow channels, and wherein the gasket comprises a
plurality of channels forming opposed side walls of each of the
plurality of channels.
71. The device of claim 67, wherein one of the inlet flow portal
and the outlet flow portal comprises a bore formed in one of the
electrode plates and in fluid communication with the flow
channel.
72. The device of claim 67, wherein the other of the inlet flow
portal and the outlet flow portal comprises a bore formed in the
one of the electrode plates and in fluid communication with the
flow channel.
73. The device of claim 67, wherein the other of the inlet flow
portal and the outlet flow portal comprises a bore formed in the
other of the electrode plates and in fluid communication with the
flow channel.
74. The device of claim 67, further comprising a cooling element
operatively associated with the flow channel to dissipate heat.
75. The device of claim 67, wherein the cooling element comprises a
thermoelectric cooling element.
76. The device of claim 67, wherein the cooling element comprises a
cooling fluid flowing in contact with the electrode.
77. The device of claim 67, wherein the cooling element comprises a
heat sink operatively associated with the electrode.
78. The device of claim 67, wherein the heat resistance of the flow
channel is less than approximately 3.degree. C. per watt.
79. The device of claim 67, wherein the heat resistance of the flow
channel is less than approximately 2.degree. C. per watt.
80. The device of claim 67, wherein the heat resistance of the flow
channel is between approximately 0.5.degree. C. per Watt and
4.degree. C. per Watt.
81. The device of claim 67, wherein the heat resistance of the flow
channel is between approximately 1.degree. C. per Watt and
3.degree. C. per Watt.
82. The device of claim 67, wherein the heat resistance of the flow
channel is between approximately 1.5.degree. C. and 2.5.degree.
C.
83. The device of claim 67, wherein the first electrode comprises
an elongated, electrically conductive structure, wherein the second
electrode comprises a tubular, electrically conductive structure;
wherein the electrodes are concentrically arranged such that the
second, tubular electrode surrounds the first electrode in
spaced-apart relation thereto; and wherein the flow channel is
disposed within an annular space defined between the first and
second electrodes.
84. The device of claim 83, wherein the electrodes form at least a
portion of the walls defining the flow channel.
85. The device of claim 83, further comprising concentric annular
spacers for maintaining the first and second electrodes in
spaced-apart, concentric relation.
86. The of claim 83, wherein the device is arranged in series with
a second, like device.
87. The of claim 83, wherein the device is arranged in parallel
with a second, like device.
88. A method of transfecting a cell comprising providing a desired
therapeutic agent, protein or peptide, or nucleic acid or an
expression vector coding for a desired protein or peptide and
introducing the therapeutic agent, protein, peptide, nucleic acid
or expression vector and the cell into an electroporation chamber
in accordance with claim 1, and subjecting them to
electroporation.
89.-103. (canceled)
104. The method of claim 88, where and the desired nucleic acid or
protein is b-cell differentiation factor, b-cell growth factor,
mitogenic cytokine, chemotactic cytokine, colony stimulating
factor, angiogenesis factor, cadherin, selectin, integrin, NCAM,
ICAM, L1, t-cell replacing factors, differentiation factor,
transcription factor, mRNA, heat shock protein, nuclear protein
complex, RNA/DNA oligomer, IFN-alpha, IFN-beta, IFN-omega, IL1,
IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL10, IL11, IL12, IL13,
IL14, IL15, IL16, IL17, IL18, leptin, myostatin, macrophage
stimulating protein, platelet-derived growth factor, TNF-alpha,
TNF-beta, NGF, CD40L, CD137L/4-1BBL, human lymphotoxin-beta,
TNF-related apoptosis-inducing ligand, monoclonal antibody,
fragments of monoclonal antibody, G-CSF, M-CSF, GM-CSF, PDGF,
IL1-alpha, IL1-beta, FGF IFN-gamma, IP-10, PF4, GRO, 9E3,
erythropoietin, endostatin, angiostatin, fibroblast growth factor,
VEGF, or soluble receptor and any fragments or combinations
thereof.
105. The method of claim 88, wherein the desired nucleic acid or
protein is erythropoietin or fragments thereof.
106. The method of claim 88, wherein the desired nucleic acid or
protein is endostatin or fragments thereof.
107. The method of claim 88, wherein the desired nucleic acid or
protein is angiostatin or fragments thereof.
108. The method of claim 88, wherein the desired nucleic acid or
protein is IL12 or fragments thereof.
109. The method of claim 88, wherein the desired nucleic acid or
protein is IL2 or fragments thereof.
110. The method of claim 88, comprising the further step of
administering the transfected cells to a patient.
111.-115. (canceled)
116. The method of claim 88, wherein the therapeutic agent is
AGM-1470 (TNP-470), MetAP-2; growth factor antagonists, antibodies
to growth factors; growth factor receptor antagonists; TIMP,
batimastat, marimastat; genistein SU5416; alphaVbeta3/5, retinoic
acid fenretinide, 11-epihydrocortisol, corteloxone,
tetrahydrocortisone and 17-hydroxyprogesterone; staurosporine, MDL
27032; 22-oxa-1 alpha, and 25-dihydroxyvitamin D3; indomethacin and
sulindac; minocycline; thalidomide and thalidomide analogs and
derivatives; 2-methoxyestradiol; tumor necrosis factor-alpha;
interferon-gamma-inducible protein 10 (IP-10); interleukin 1 and
interleukin 12; interferon alpha, beta or gamma; angiostatin
protein or plasminogen fragments; endostatin protein or collagen 18
fragments; proliferin-related protein; group B streptococcus toxin;
CM 101; CAI; troponin I; squalamine; L-NAME; thrombospondin;
wortmannin; amiloride; spironolactone; ursodeoxycholic acid;
bufalin; suramin; tecogalan sodium; linoleic acid; captopril;
irsogladine; FR-118487; triterpene acids; castanospermine; leukemia
inhibitory factor; lavendustin A; platelet factor-4; herbimycin A;
diaminoanthraquinone; taxol; aurintricarboxylic acid; DS-4152;
pentosan polysulphite; radicicol; fragments of human prolactin;
erbstatin; eponemycin; shark cartilage; protamine; Louisianin A, C
and D; PAF antagonist WEB 2086; auranofin; ascorbic ethers; or
sulfated polysaccharide D 4152.
117.-126. (canceled)
127. An electroporation device comprising an electroporation
chamber, the chamber comprising: walls defining a flow channel
configured to receive and to transiently contain a continuous flow
of a suspension of cells to be electroporated; an inlet flow portal
in fluid communication with the flow channel, whereby the
suspension can be introduced into the flow channel through the
inlet flow portal; an outlet flow portal in fluid communication
with the flow channel, whereby the suspension can be withdrawn from
the flow channel through the outlet portal; the walls defining the
flow channel comprising a first electrode forming at least a
portion of a first wall of the flow channel and a second electrode
forming at least a portion of a second wall of the flow channel
opposite the first wall, the first and second electrodes being such
that when placed in electrical communication with a source of
electrical energy an electric field is formed there between through
which the suspension can flow; and wherein said first electrode is
spaced from said second electrode by a distance greater than 3
mm.
128. The electroporation device of claim 127, wherein said first
electrode is spaced from said second electrode by a distance of
approximately 4 mm to 2 cm.
129. The electroporation device of claim 127, wherein said first
electrode is spaced from said second electrode by a distance of
approximately 5 mm to 1 cm.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 10/751,586 filed on Jan. 5, 2004, now U.S.
Pat. No. 7,186,559 issued on Mar. 6, 2007 which claims benefit of
U.S. patent application Ser. No. 10/225,446 filed on Aug. 21, 2002,
now U.S. Pat. No. 7,141,425 issued on Nov. 28, 2006 which claims
benefit of provisional patent application Ser. No. 60/354,571,
filed Feb. 5, 2002 and provisional patent application Ser. No.
60/314,241, filed Aug. 22, 2001, the entire contents of each are
incorporated herein by reference. Additionally, all patents,
published patent applications, and other references cited
throughout this specification are hereby incorporated by reference
in their entireties.
FIELD OF THE INVENTION
[0002] The present invention relates to methods and apparatus for
the introduction of biologically active substances into various
types of living cells or cell particles. More particularly, the
present invention relates to a method and apparatus for the
introduction of biologically active substances into various cell or
cell particle populations suspended in a fluid by electroporation
to achieve therapeutic results or to modify cells being used in
research to increase their experimental utility. Blood represents
one example of cells suspended in a fluid. Other examples include
cells being grown in culture outside the body, commonly known as
"cell culture" or "tissue culture."
BACKGROUND OF THE INVENTION
Red Blood Cells
[0003] In the vascular system of an adult human being, blood has a
volume of about 5 to 6 liters. Approximately one half of this
volume is occupied by cells, including red blood cells
(erythrocytes), white blood cells (leukocytes), and blood
platelets. Red blood cells comprise the majority of the cellular
components of blood. Plasma, the liquid portion of blood, is
approximately 90 percent water and 10 percent various solutes.
These solutes include plasma proteins, organic metabolites and
waste products, and inorganic compounds.
[0004] The major function of red blood cells is to transport oxygen
from the lungs to the tissues of the body, and transport carbon
dioxide from the tissues to the lungs for removal. Very little
oxygen is transported by the blood plasma because oxygen is only
sparingly soluble in aqueous solutions. Most of the oxygen carried
by the blood is transported by the hemoglobin of the erythrocytes.
Erythrocytes in mammals do not contain nuclei, mitochondria or any
other intracellular organelles, and they do not use oxygen in their
own metabolism. Red blood cells contain about 35 percent by weight
hemoglobin, which is responsible for binding and transporting
oxygen.
[0005] Hemoglobin is a protein having a molecular weight of
approximately 64,500 Daltons. It contains four polypeptide chains
and four heme prosthetic groups in which iron atoms are bound in
the ferrous state. Normal globin, the protein portion of the
hemoglobin molecule, consists of two .alpha. chains and two .beta.
chains. Each of the four chains has a characteristic tertiary
structure in which the chain is folded. The four-polypeptide chains
fit together in an approximately tetrahedral arrangement, to
constitute the characteristic quaternary structure of hemoglobin.
There is one heme group bound to each polypeptide chain, which can
reversibly bind one molecule of molecular oxygen. When hemoglobin
combines with oxygen, oxyhemoglobin is formed. When oxygen is
released, the oxyhemoglobin is reduced to deoxyhemoglobin.
[0006] Although the secondary and tertiary structure of various
hemoglobin subunits are similar, reflecting extensive homology in
amino acid composition, the variations in amino acid composition
that do exist impart marked differences in hemoglobin's oxygen
carrying properties. In addition, the quaternary structure of
hemoglobin leads to physiologically important allosteric
interactions between the subunits, a property lacking in monomeric
myoglobin, which is otherwise very similar to the -subunit of
hemoglobin.
[0007] Comparison of the oxygen-binding properties of myoglobin and
hemoglobin illustrate the allosteric properties of hemoglobin that
results from its quaternary structure and differentiate
hemoglobin's oxygen-binding properties from that of myoglobin. The
curve of oxygen-binding to hemoglobin is sigmoidal typical of
allosteric proteins in which the substrate, in this case oxygen, is
a positive homeotropic effector. When oxygen binds to the first
subunit, of deoxyhemoglobin, it increases the affinity of the
remaining subunits for oxygen. As additional oxygen is bound to the
second and third subunits, oxygen-binding is further,
incrementally, strengthened, so that at the oxygen tension in lung
alveoli, hemoglobin is fully saturated with oxygen. As
oxyhemoglobin circulates to deoxygenated tissue, oxygen is
incrementally unloaded and the affinity of hemoglobin for oxygen is
reduced. Thus at the lowest oxygen tensions found in very active
tissues the binding affinity of hemoglobin for oxygen is very low
allowing maximal delivery of oxygen to the tissue. In contrast the
oxygen-binding curve for myoglobin is hyperbolic in character
indicating the absence of allosteric interactions in this process.
When the affinity for oxygen is decreased, the sigmoidal curve is
shifted to the right. This shift of the curve is commonly known as
a "right shift".
[0008] The allosteric oxygen-binding properties of hemoglobin arise
directly from the interaction of oxygen with the iron atom of the
heme prosthetic groups and the resultant effects of these
interactions on the quaternary structure of the protein. When
oxygen binds to an iron atom of deoxyhemoglobin it pulls the iron
atom into the plane of the heme. Since the iron is also bound to
histidine F8, this residue is also pulled toward the plane of the
heme ring. The conformational change at histidine F8 is transmitted
throughout the peptide backbone resulting in a significant change
in tertiary structure of the entire subunit. Conformational changes
at the subunit surface lead to a new set of binding interactions
between adjacent subunits. The latter changes include disruption of
salt bridges and formation of new hydrogen bonds and new
hydrophobic interactions, all of which contribute to the new
quaternary structure.
[0009] The latter changes in subunit interaction are transmitted,
from the surface, to the heme binding pocket of a second deoxy
subunit and result in easier access of oxygen to the iron atom of
the second heme and thus a greater affinity of the hemoglobin
molecule for a second oxygen molecule. The tertiary configuration
of low affinity, deoxygenated hemoglobin (Hb) is known as the taut
(T) state. Conversely, the quaternary structure of the fully
oxygenated high affinity form of hemoglobin Hb(O.sub.2).sub.4 is
known as the relaxed (R) state.
[0010] Delivery of oxygen to tissues depends upon a number of
factors including, but not limited to, the volume of blood flow,
the number of red blood cells, the concentration of hemoglobin in
the red blood cells, the oxygen affinity of the hemoglobin and, in
certain species, on the molar ratio of intra-erythrocytic
hemoglobins with high and low oxygen affinity. The oxygen affinity
of hemoglobin depends on four factors as well, namely: (1) the
partial pressure of oxygen, (2) the pH, (3) the concentration of
the allosteric effector 2,3-diphosphoglycerate (DPG) in the
hemoglobin, and (4) the concentration of carbon dioxide. In the
lungs, at an oxygen partial pressure of 100 mm Hg, approximately
98% of circulating hemoglobin is saturated with oxygen. This
represents the total oxygen transport capacity of the blood. When
fully oxygenated, 100 ml of whole mammalian blood can carry about
21 ml of gaseous oxygen.
[0011] The effect of the partial pressure of oxygen and the pH on
the ability of hemoglobin to bind oxygen is best illustrated by
examination of the oxygen saturation curve of hemoglobin. An oxygen
saturation curve plots the percentage of total oxygen-binding sites
present in a unit of blood, or a sample that are occupied by oxygen
molecules when solutions of the hemoglobin are in equilibrium with
varying partial pressures of oxygen.
[0012] As stated above, the oxygen saturation curve for hemoglobin
is sigmoid. Thus, binding the first molecule of oxygen increases
the affinity of the remaining hemoglobin for binding additional
oxygen molecules. As the partial pressure of oxygen is increased, a
plateau is approached at which each of the hemoglobin molecules is
saturated and contains the upper limit of four molecules of
oxygen.
[0013] The reversible binding of oxygen by hemoglobin is
accompanied by the release of protons, according to the
equation:
##STR00001##
Thus, an increase in the pH will pull the equilibrium to the right
and cause hemoglobin to bind more oxygen at a given partial
pressure. A decrease in the pH will decrease the amount of oxygen
bound.
[0014] In the lungs, the partial pressure of oxygen in the air
spaces is approximately 90 to 100 mm Hg and the pH is also high
relative to normal blood pH (up to 7.6). Therefore, hemoglobin will
tend to become almost maximally saturated with oxygen in the lungs.
At that pressure and pH, hemoglobin is approximately 98 percent
saturated with oxygen. On the other hand, in the capillaries in the
interior of the peripheral tissues, the partial pressure of oxygen
is only about 25 to 40 mm Hg and the pH is also relatively low
(about 7.2 to 7.3). Because muscle cells use oxygen at a high rate
thereby lowering the local concentration of oxygen, the release of
some of the bound oxygen to the tissue is favored. As the blood
passes through the capillaries in the muscles, oxygen will be
released from the nearly saturated hemoglobin in the red blood
cells into the tissue. Hemoglobin will release about a third of its
bound oxygen as it passes through the muscle capillaries, so that
when it leaves the muscle, it will be only about 64 percent
saturated. In general, the hemoglobin in the venous blood leaving
the tissue cycles between about 65 and 97 percent saturation with
oxygen in its repeated circuits between the lungs and the
peripheral tissues. Thus, oxygen partial pressure and pH function
together to affect the release of oxygen by hemoglobin
[0015] A third important factor in regulating the degree of
oxygenation of hemoglobin is the allosteric effector
2,3-diphosphoglycerate (DPG). DPG is the normal physiological
effector of hemoglobin in mammalian erythrocytes. DPG regulates the
oxygen-binding affinity of hemoglobin in the red blood cells in
relationship to the oxygen partial pressure in the lungs. In
general, the higher the concentration of DPG in the cell, the lower
the affinity of hemoglobin for oxygen.
[0016] When the delivery of oxygen to the tissues is chronically
reduced, the concentration of DPG in the erythrocytes is increased
in normal individuals. For example, at high altitudes the partial
pressure of oxygen is significantly less. Correspondingly, the
partial pressure of oxygen in the tissues is less. Within a few
hours after a normal human subject moves to a higher altitude, the
DPG level in the red blood cells increases, causing more DPG to be
bound and the oxygen affinity of the hemoglobin to decrease.
Increases in the DPG level of red blood cells also occur in
patients suffering from hypoxia. This adjustment allows the
hemoglobin to release its bound oxygen more readily to the tissues
to compensate for the decreased oxygenation of hemoglobin in the
lungs.
[0017] As normally isolated from blood, hemoglobin contains a
considerable amount of DPG. When hemoglobin is "stripped" of its
DPG, it shows a much higher affinity for oxygen. When DPG is
increased, the oxygen-binding affinity of hemoglobin decreases. A
physiologic allosteric effector such as DPG is therefore essential
for the normal release of oxygen from hemoglobin in the
tissues.
[0018] While DPG is the normal physiologic effector of hemoglobin
in mammalian red blood cells, phosphorylated inositols are found to
play a similar role in the erythrocytes of some birds and reptiles.
Although IHP is unable to pass through the mammalian erythrocyte
membrane, it is capable of combining with hemoglobin of mammalian
red blood cells at the binding site of DPG to modify the allosteric
conformation of hemoglobin, the effect of which is to reduce the
affinity of hemoglobin for oxygen. For example, DPG can be replaced
by inositol hexaphosphate (IHP), which is even more potent than DPG
in reducing the oxygen affinity of hemoglobin. IHP has a 1000-fold
higher affinity to hemoglobin than DPG (R. E. Benesch et al.,
Biochemistry, Vol. 16, pages 2594-2597 (1977)) and increases the
P.sub.50 of hemoglobin up to values of 96.4 mm Hg at pH 7.4, and
37.degree. C. (J. Biol. Chem., Vol. 250, pages 7093-7098
(1975)).
[0019] The oxygen release capacity of mammalian red blood cells can
be enhanced by introducing certain allosteric effectors of
hemoglobin into erythrocytes, thereby decreasing the affinity of
hemoglobin for oxygen and improving the oxygen economy of the
blood. This phenomenon suggests various medical applications for
treating individuals who are experiencing lowered oxygenation of
their tissues due to the inadequate function of their lungs or
circulatory system.
[0020] Because of the potential medical benefits to be achieved
from the use of these modified erythrocytes, various techniques
have been developed in the prior art to enable the encapsulation of
allosteric effectors of hemoglobin in erythrocytes. Accordingly,
numerous devices have been designed to assist or simplify the
encapsulation procedure. The encapsulation methods known in the art
include osmotic pulse (swelling) and reconstitution of cells,
controlled lysis and resealing, incorporation of liposomes, and
electroporation. Current methods of electroporation make the
procedure commercially impractical on a scale suitable for
commercial use.
[0021] The following references describe the incorporation of
polyphosphates into red blood cells by the interaction of liposomes
loaded with IHP: Gersonde, et al., "Modification of the Oxygen
Affinity of Intracellular Haemoglobin by Incorporation of
Polyphosphates into Intact Red Blood Cells and Enhanced O.sub.2
Release in the Capillary System", Biblthca. Haemat., No. 46, pp.
81-92 (1980); Gersonde, et al, "Enhancement of the O.sub.2 Release
Capacity and of the Bohr-Effect of Human Red Blood Cells after
Incorporation of Inositol Hexaphosphate by Fusion with
Effector-Containing Lipid Vesicles", Origins of Cooperative Binding
of Hemoglobin, (1982); and Weiner, "Right Shifting of Hb-O.sub.2
Dissociation in Viable Red blood cells by Liposomal Technique,"
Biology of the Cell, Vol. 47, (1983).
[0022] Additionally, U.S. Pat. Nos. 4,192,869, 4,321,259, and
4,473,563 to Nicolau et al. describe a method whereby fluid-charged
lipid vesicles are fused with erythrocyte membranes, depositing
their contents into the red blood cells. In this manner, it is
possible to transport allosteric effectors such as inositol
hexaphosphate into erythrocytes, where, due to its much higher
binding constant, IHP replaces DPG at its binding site in
hemoglobin.
[0023] In accordance with the liposome technique, IHP is dissolved
in a phosphate buffer until the solution is saturated and a mixture
of lipid vesicles is suspended in the solution. The suspension is
then subjected to ultrasonic treatment or an injection process, and
then centrifuged. The upper suspension contains small lipid
vesicles containing IHP, which are then collected. Erythrocytes are
added to the collected suspension and incubated, during which time
the lipid vesicles containing IHP fuse with the cell membranes of
the erythrocytes, thereby depositing their contents into the
interior of the erythrocyte. The modified erythrocytes are then
washed and added to plasma to complete the product.
[0024] The drawbacks associated with the liposomal technique
include poor reproducibility of the IHP concentrations incorporated
in the red blood cells and significant hemolysis of the red blood
cells following treatment. Additionally, commercialization is not
practical because the procedure is tedious and complicated.
[0025] In an attempt to solve the drawbacks associated with the
liposomal technique, a method of lysing and the resealing red blood
cells was developed. This method is described in the following
publication: Nicolau, et al., "Incorporation of Allosteric
Effectors of Hemoglobin in Red Blood Cells. Physiologic Effects,"
Biblthca. Haemat., No. 51, pp. 92-107, (1985). Related U.S. Pat.
Nos. 4,752,586 and 4,652,449 to Ropars et al. also describe a
procedure of encapsulating substances having biological activity in
human or animal erythrocytes by controlled lysis and resealing of
the erythrocytes, which avoids the RBC-liposome interactions.
[0026] The technique is best characterized as a continuous flow
dialysis system which functions in a manner similar to the osmotic
pulse technique. Specifically, the primary compartment of at least
one dialysis element is continuously supplied with an aqueous
suspension of erythrocytes while the secondary compartment of the
dialysis element contains an aqueous solution, which is hypotonic
with respect to the erythrocyte suspension. The hypotonic solution
causes the erythrocytes to lyse. The erythrocyte lysate is then
contacted with the biologically active substance to be incorporated
into the erythrocyte. To reseal the membranes of the erythrocytes,
the osmotic and/or oncotic pressure of the erythrocyte lysate is
increased and the suspension of resealed erythrocytes is
recovered.
[0027] In related U.S. Pat. Nos. 4,874,690 and 5,043,261 to
Goodrich et al., a related technique involving lyophilization and
reconstitution of red blood cells is disclosed. As part of the
process of reconstituting the red blood cells, the addition of
various polyanions, including inositol hexaphosphate, is described.
Treatment of the red blood cells according to the process disclosed
results in a cell with unaffected activity. Presumably, the IHP is
incorporated into the cell during the reconstitution process,
thereby maintaining the activity of the hemoglobin.
[0028] In U.S. Pat. Nos. 4,478,824 and 4,931,276 to Franco et al.,
a second related method and apparatus is described for introducing
effective agents, including inositol hexaphosphate, into mammalian
red blood cells by effectively lysing and resealing the cells. The
procedure is described as the "osmotic pulse technique." In
practicing the osmotic pulse technique, a supply of packed red
blood cells is suspended and incubated in a solution containing a
compound, which readily diffuses into and out of the cells, the
concentration of the compound being sufficient to cause diffusion
thereof into the cells so that the contents of the cells become
hypertonic. Next, a trans-membrane ionic gradient is created by
diluting the solution containing the hypertonic cells with an
essentially isotonic aqueous medium in the presence of at least one
desired agent to be introduced, thereby causing diffusion of water
into the cells with a consequent swelling and an increase in
permeability of the outer membranes of the cells. The increase in
permeability of the membrane is maintained for a period of time
sufficient only to permit transport of at least one agent into the
cells and diffusion of the compound out of the cells. These fluxes
must be coupled because polyanionic compounds do not simply diffuse
across membranes but exchange for ions of equal charge.
[0029] Polyanions which may be used in practicing the osmotic pulse
technique include pyrophosphate, tripolyphosphate, phosphorylated
inositols, 2,3-diphosphoglycerate (DPG), adenosine triphosphate,
heparin, and polycarboxylic acids which are water-soluble, and
non-disruptive to the lipid outer bilayer membranes of red blood
cells.
[0030] The osmotic pulse technique has several shortcomings
including the fact that the technique is tedious, complicated and
unsuited to automation. For these reasons, the osmotic pulse
technique has had little commercial success.
[0031] Another method for encapsulating various biologically-active
substances in erythrocytes is electroporation. Electroporation has
been used for encapsulation of foreign molecules in different cell
types including IHP red blood cells as described in Mouneimne, et
al., "Stable rightward shifts of the oxyhemoglobin dissociation
curve induced by encapsulation of inositol hexaphosphate in red
blood cells using electroporation," FEBS, Vol. 275, No. 1, 2, pp.
117-120 (1990).
[0032] The process of electroporation involves the formation of
pores in the cell membranes, or in any vesicles, by the application
of electric field pulses across a liquid cell suspension containing
the cells or vesicles. During the poration process, cells are
suspended in a liquid media and then subjected to an electric field
pulse. The medium may be electrolyte, non-electrolyte, or a mixture
of electrolytes and non-electrolytes. The strength of the electric
field applied to the suspension and the length of the pulse (the
time that the electric field is applied to a cell suspension)
varies according to the cell type. To create a pore in a cell's
outer membrane, the electric field must be applied for such a
length of time and at such a voltage as to create a set potential
across the cell membrane for a period of time long enough to create
a pore.
[0033] Electroporation has been used effectively to incorporate
allosteric effectors of hemoglobin in erythrocytes. In the article
by Mouneimne, et al., supra, it was reported that right shifts of
the hemoglobin-oxygen dissociation curve in treated erythrocytes
having incorporated IHP can be achieved. Measurements at 24 and 48
hours after loading with IHP showed a stable P.sub.50 value
indicating that resealing of the erythrocytes was permanent.
Furthermore, it was shown that red blood cells loaded with inositol
hexaphosphate have a normal half life of eleven days. However, the
results obtained by Mouneimne and his colleagues indicate that
approximately 20% of the re-transfused cells were lost within the
first 24 hours of transfusion. U.S. Pat. Nos. 5,720,921, 6,090,617,
and 6,074,605 are incorporated herein by reference in their
entirety and all disclose an apparatus and method for flow
electroporation.
[0034] The electroporation methods disclosed in the prior art are
not suitable for processing large volumes of sample, nor use of a
high or repetitive electric charge. In addition, the stability of
the P.sub.50 right shift as well as the stability of the red blood
cells has not proved adequate for clinical use. Furthermore, the
methods are not suitable for use in a continuous or "flow"
electroporation chamber. Available electroporation chambers are
designed for static use only; namely, processing of samples by
batch. Continuous use of a "static" chamber results in over heating
of the chamber and increased cell lysis. Furthermore, the existing
technology is unable to incorporate a sufficient quantity of IHP in
a sufficient percentage of the cells being processed to
dramatically change the oxygen carrying capacity of the blood. In
addition, the prior art methods require elaborate equipment and are
not suited for loading red blood cells of a patient at the point of
care. Thus, the procedure is time consuming and not suitable for
use on a commercial scale.
[0035] What is needed is a simple, efficient and rapid method for
encapsulating biologically-active substances in erythrocytes in
sufficient volume while preserving the integrity and biologic
function of the cells. The potential therapeutic applications of
biologically altered blood cells suggests the need for simpler, and
more effective and complete methods of encapsulation of
biologically-active substances, including allosteric effectors of
hemoglobin in intact erythrocytes.
[0036] There are numerous clinical conditions that would benefit
from treatments that would increase of oxygen bound to hemoglobin.
For example to tissue, the leading cause of death in the United
States today is cardiovascular disease. The acute symptoms and
pathology of many cardiovascular diseases, including congestive
heart failure, ischemia, myocardial infarction, stroke,
intermittent claudication, and sickle cell anemia, result from an
insufficient supply of oxygen in fluids that bathe the tissues.
Likewise, the acute loss of blood following hemorrhage, traumatic
injury, or surgery results in decreased oxygen supply to vital
organs. Without oxygen, tissues at sites distal to the heart, and
even the heart itself, cannot produce enough energy to sustain
their normal functions. The result of oxygen deprivation is tissue
death and organ failure. Another area that would benefit from
treatments that would increase delivery of oxygen bound to
hemoglobin to tissue is racing animals, athletes, etc.
[0037] Another area is in treating diseases such as adult
respiratory distress syndrome because administration of blood that
is capable of increased delivery of oxygen to the peripheral
tissues will ease the pressure of loading hemoglobin in the
lungs.
[0038] Although the attention of the American public has long been
focused on the preventive measures required to alleviate heart
disease, such as exercise, appropriate dietary habits, and
moderation in alcohol consumption, deaths continue to occur at an
alarming rate. One approach to alleviate the life-threatening
consequences of cardiovascular disease is to increase oxygenation
of tissues during acute stress. The same approach is also
appropriate for persons suffering from blood loss or chronic
hypoxic disorders, such as congestive heart failure.
[0039] Another condition that could benefit from an increase in the
delivery of oxygen to the tissues is anemia. A significant portion
of hospital patients experience anemia or a low "crit" caused by an
insufficient quantity of red blood cells or hemoglobin in their
blood. This leads to inadequate oxygenation of their tissues and
subsequent complications. Typically, a physician believes that he
or she can temporarily correct this condition by transfusing the
patient with units of packed red blood cells.
[0040] Enhanced tissue oxygenation may also reduce the number of
heterologous transfusions and allow use of autologous transfusions
in more cases. The current method for treatment of anemia or
replacement of blood loss is transfusion of whole human blood. It
is estimated that three to four million patients receive
transfusions in the U.S. each year for surgical or medical needs.
In situations where there is more time or where the religious
beliefs of the patient forbid the use of heterologous blood for
transfusions, it is advantageous to completely avoid the use of
donor or heterologous blood and instead use autologous blood.
[0041] Often the amount of blood that can be drawn and stored prior
to surgery limits the use of autologous blood. Typically, a
surgical patient does not have enough time to donate a sufficient
quantity of blood prior to surgery. A surgeon would like to have
several units of blood available. As each unit requires a period of
several weeks between donations and can not be done less than two
weeks prior to surgery, it is often impossible to sequester an
adequate supply of blood. By processing autologous blood with IHP,
less blood is required and it becomes possible to completely avoid
the transfusion of heterologous blood.
[0042] As IHP-treated red blood cells transport 2-3 times as much
oxygen as untreated red blood cells, in many cases, a physician
will need to transfuse fewer units of IHP-treaded red blood cells.
This exposes the patient to less heterologous blood, decreases the
extent of exposure to viral diseases from blood donors and
minimizes immune function disturbances secondary to transfusions.
The ability to infuse more efficient red blood cells is also
advantageous when the patient's blood volume is excessive. In other
more severe cases, where oxygen transport is failing, the ability
to rapidly improve a patient's tissue oxygenation is life
saving.
[0043] Although it is evident that methods of enhancing oxygen
delivery to tissues have potential medical applications, currently
there are no methods clinically available for increasing tissue
delivery of oxygen bound to hemoglobin. Transient elevations of
oxygen deposition (6 to 12 hours) have been described in
experimental animals using either DPG or molecules that are
precursors of DPG. The natural regulation of DPG synthesis in vivo
and its relatively short biological half-life, in addition to its
lower efficiency in modulating Hb properties, however, limit the
DPG concentration and the duration of increased tissue PO.sub.2,
and thus limit its therapeutic usefulness.
[0044] What is needed is a simple, efficient and rapid method for
encapsulating biologically-active substances, such as IHP, in
erythrocytes without damaging the erythrocytes beyond their ability
to produce a clinical effect. An important requirement for any
system of introducing IHP into red blood cells is that the right
shift of the sigmoidal oxygen-binding curve be substantially stable
and the red blood cell must be substantially similar to untreated
red blood cells.
Gene Transfection
[0045] Efforts to develop human gene therapies have their roots in
the 1950s, when early successes with kidney transplantation led to
speculation that it might be possible to transplant cells from a
normal individual into a patient suffering from a genetic disease.
Soon after the discovery of the enzymatic defects in Gaucher's and
Niemann-Pick disease, scientists considered organ and bone marrow
transplantation and enzyme supplementation to treat rare genetic
disorders (Brady, R., NEJM 275:312 (1966)). By the late 1960s and
early 1970s, several investigators speculated that it also might be
possible to introduce genes into a patient's own cells, and the
cloning of the first human genes only a few years later intensified
work in the field.
[0046] Until recently, almost all of the theoretical and
experimental work on human gene therapy was centered on extremely
rare genetic diseases, and gene therapy has come to mean, to many
in the field, the modification of a patient's genes to treat a
genetic disease. However, gene therapy has far wider applications
than simply treatment of a genetic disease. Gene therapy is perhaps
more appropriately described as medical intervention in which
cells, either from the individual to be treated or another
appropriate source, are modified genetically to treat or cure any
condition, regardless of etiology, that will be ameliorated by the
long-term delivery of a therapeutic protein. Gene therapy can
therefore be thought of as an in vivo protein production and
delivery system, and almost all diseases that are currently treated
by the administration of proteins are candidates for treatment
using gene therapy.
[0047] Gene therapy can be divided into two areas: germ cell and
somatic cell gene therapy. Germ cell gene therapy refers to the
modification of sperm cells, egg cells, zygotes, or early stage
embryos. On the basis of both ethical and practical criteria, germ
cell gene therapy is inappropriate for human use. In contrast to
germ cell gene therapy, somatic cell gene therapy would affect only
the person under treatment (somatic cells are cells that are not
capable of developing into whole individuals and include all of the
body's cells with the exception of the germ cells). As such,
somatic cell gene therapy is a reasonable approach to the treatment
and cure of certain disorders in human beings.
[0048] In conventional somatic cell gene therapy system, somatic
cells (e.g., fibroblasts, hepatocytes, or endothelial cells) are
removed from the patient, cultured in vitro, transfected with the
gene(s) of therapeutic interest, characterized, and reintroduced
into the patient. The means by which these five steps are carried
out are the distinguishing features of a given gene therapy
system.
[0049] Presently-available approaches to gene therapy include the
use of infectious vectors, such as retroviral vectors, which
include the genetic material to be expressed. Such approaches have
limitations, such as the potential of generating
replication-competent viruses during vector production;
recombination between the therapeutic virus and endogenous
retroviral genomes, potentially generating infectious agents with
novel cell specificities, host ranges, or increased virulence and
cytotoxicity; independent integration into large numbers of cells,
increasing the risk of a tumorigenic insertional event; limited
cloning capacity in the retrovirus (which restricts therapeutic
applicability) and short-lived in vivo expression of the product of
interest. A better approach to providing gene products,
particularly one that avoids the risks associated with presently
available methods and provides long-term production, would be
valuable.
[0050] A method for encapsulating genetic material in various cell
populations is electroporation. Electroporation has been used for
encapsulation of foreign molecules in different cell types
including IHP red blood cells as described in Mouneimne, et al
supra. The electroporation methods disclosed in the prior art are
not suitable for processing large volumes of sample, nor use of a
high or repetitive electric charge. One of the problems with
electroporation of cells has always been the excess heat that
occurs during the electroporation process. This heat generated by
the electroporation process causes extensive damage to living
cells. In addition, the stability of the transformed cells has not
proved adequate for clinical use. Furthermore, the methods are not
suitable for use in a continuous or "flow" electroporation chamber.
Most available electroporation chambers are designed for static use
only. Namely, processing of samples by batch. Continuous use of a
"static" chamber results in over heating of the chamber and
increased cell lysis. Furthermore, the existing technology is
unable to incorporate a sufficient quantity of genetic material in
a sufficient percentage of the cells being processed. In addition,
the prior art methods require elaborate equipment and are not
suited for transforming cells of a patient at the point of care.
Thus, the procedure is time consuming and not suitable for use on a
commercial scale.
Prior Art Flow Cells
[0051] U.S. Pat. No. 5,676,646 discloses a flow electroporation
apparatus with a flow cell comprising two electrodes separated by a
non-conductive spacer, the spacer defining a flow path. The major
problem with this flow cell as well as other prior art flow cells
is that the surface area of the electrode is not sufficient to
dissipate heat as the cells are being electroporated. Thus, the
heat buildup in the prior art flow cells is very large as the cells
are being electroporated. This heat build up can cause damage to
cells and cell components and decrease the efficiency of the
electroporation process.
[0052] What is needed is a simple, efficient and rapid method for
encapsulating genetic material in cells in sufficient volume in
real-time, while preserving the integrity and biologic function of
the cells. The potential therapeutic applications of transformed
cells suggests the need for simpler, and more effective and
complete methods of encapsulation of genetic material in intact
cells. In addition, a flow cell is needed that is capable of
removing heat so that damage to living cells that are being
electroporated is kept to a minimum.
SUMMARY OF THE INVENTION
[0053] The present invention relates to a method and apparatus for
the encapsulation of biologically active substances in cell
populations. The present invention is particularly suited for cells
found in blood and other body fluids. More specifically, the
present invention provides an electroporation chamber that may form
part of an automated, self-contained, flow apparatus for
encapsulating compounds or compositions, such as inositol
hexaphosphate, in cells found in blood. More particularly, the
present invention also provides a novel flow electroporation cell
assembly that is both simple and efficient. One embodiment of the
present inventions is a flow electroporation device comprising
walls defining a flow channel configured to receive and to
transiently contain a continuous flow of a suspension comprising
particles, an inlet flow portal in fluid communication with the
flow channel, whereby the suspension can be introduced into the
flow channel through the inlet flow portal, an outlet flow portal
in fluid communication with the flow channel, whereby the
suspension can be withdrawn from the flow channel through the
outlet flow portal, the walls defining the flow channel comprising
a first electrode plate forming a first wall of the flow channel
and a second electrode plate forming a second wall of the flow
channel opposite the first wall; wherein the area of the electrodes
contact with the suspension, and the distance between the
electrodes is chosen so that the thermal resistance of the flow
channel is less than approximately 10.degree. C. per Watt,
preferably less than approximately 4.degree. C. per Watt, the
paired electrodes are placed in electrical communication with a
source of electrical energy, whereby an electrical field is formed
between the electrodes; whereby the suspension of the particles
flowing through the flow channel can be subjected to an electrical
field formed between the electrodes.
[0054] In a specific embodiment, the biologically active substances
are incorporated in red blood cells, thereby reducing the affinity
of the hemoglobin for oxygen and enhancing the delivery of oxygen
by red blood cells to tissues of a patient. The term "patient" as
used here is either a human or an animal. Encapsulation is
preferably achieved by electroporation; however, it is contemplated
that other methods of encapsulation may be used in practicing the
present invention. The method and apparatus, including the
electroporation chamber, of the present invention, is equally
suited to the encapsulation of a variety of biologically active
substances in various cell populations.
[0055] The apparatus and method of the present invention is suited
to the incorporation of a variety of biologically active substances
in cells and lipid vesicles. The method, apparatus and chamber of
the present invention may be used for introducing a compound or
biologically active substance into a vesicle whether that vesicle
is engineered or naturally occurring.
[0056] In one embodiment of the present invention, substances or
drugs can be introduced into cells or fragments of cells such as
platelets. For example, thrombus-dissolving substances such as
tissue plasminogen activator or streptokinase and the like can be
introduced into a population of platelets. These platelets loaded
with the thrombus dissolving substances can be then introduced into
a patient who is suffering from a thrombus blocking a blood vessel.
The platelet containing the thrombus dissolving substance will then
migrate to the site of the thrombus and attach itself to the
thrombus. Because the treated platelets contain active thrombus
dissolving enzymes, the thrombus is then dissolved. The thrombus
dissolving substances can be introduced into the platelets by a
variety of methods with the most preferable method being according
to the apparatus of the present invention. In another embodiment of
the present invention, substances or drugs can be introduced into
white cells for the delivery of drugs to the body as a whole or to
specific sites within the body. An example of white cells that can
be used as delivery vehicles include, but are not limited to,
dendritic cells, lymphocytes, macrophages, and the like.
[0057] The apparatus, method, and chamber of the present invention
may be used to introduce IHP into erythrocytes. The encapsulation
of inositol hexaphosphate in red blood cells by electroporation
according to the present invention results in a significant
decrease in the hemoglobin affinity for oxygen without
substantially affecting the life span, ATP levels, K+ levels, or
normal Theological competence of the cells. In addition, the Bohr
effect is not altered except to shift the O.sub.2 binding curve to
the right. Lowering the oxygen affinity of the erythrocytes
increases the capacity of erythrocytes to dissociate the bound
oxygen and thereby improves the oxygen supply to the tissues.
Enhancement of the oxygen-release capacity of erythrocytes brings
about significant physiological effects, such as a reduction in
cardiac output, an increase in the arteriovenous differences, and
improved tissue oxygenation.
[0058] The modified erythrocytes prepared in accordance with the
present invention, having improved oxygen release capacities, may
find their use in situations such as those illustrated below:
[0059] 1. Under conditions of low oxygen-partial pressure, such as
at high altitudes;
[0060] 2. When the oxygen exchange surface of the lung is reduced,
such as occurs in emphysema and adult respiratory distress
syndrome;
[0061] 3. When there is an increased resistance to oxygen diffusion
in the lung, such as occurs in pneumonia or asthma;
[0062] 4. When there is a decrease in the oxygen-transport capacity
of erythrocytes, such as occurs with erythropenia or anemia, or
when an arteriovenous shunt is used;
[0063] 5. To treat blood circulation disturbances, such as
arteriosclerosis, thromboembolic processes, organ infarct,
congestive heart failure, cardiac insufficiency or ischemia;
[0064] 6. To treat conditions of high oxygen affinity of
hemoglobin, such as hemoglobin mutations, chemical modifications of
N-terminal amino acids in the hemoglobin-chains, or enzyme defects
in erythrocytes;
[0065] 7. To accelerate detoxification processes by improving
oxygen supply;
[0066] 8. To decrease the oxygen affinity of conserved blood;
[0067] 9. To improve the efficacy of various cancer treatments;
and
[0068] 10. To enhance the athletic performance of humans or
animals.
[0069] According to the method and apparatus of the present
invention, it is possible to produce modified erythrocytes that
contribute to an improved oxygen economy of the blood. These
modified erythrocytes are obtained by incorporation of allosteric
effectors, such as IHP, by electroporation of the erythrocyte
membranes.
[0070] The incorporation of the biologically active substances into
the cells in accordance with the method of the present invention,
including the encapsulation of allosteric effectors of hemoglobin
into erythrocytes, is conducted extracorporally via an automated,
flow electroporation apparatus. Briefly, in one embodiment of the
present invention, a cell suspension is introduced into a
separation and wash stage of a flow encapsulation apparatus. It is
to be understood that cells can be washed by any suitable method
known to those of ordinary skill in the art, including but not
limited to, centrifugation, filtration, chelation, and osmotic
methods. The cells are separated from the suspension, washed and
re-suspended in a solution of the biologically active substance to
be introduced into the cell. This suspension is introduced into the
electroporation chamber and then incubated. Following
electroporation and incubation, the cells are washed and separated.
A contamination check is optionally conducted to confirm that all
unencapsulated biologically active substance has been removed.
Then, the cells are prepared for storage or reintroduction into a
patient.
[0071] In accordance with the present invention and with reference
to the preferred embodiment, blood is drawn from a patient, the
erythrocytes are separated from the drawn blood, the erythrocytes
are modified by the incorporation of allosteric effectors and the
modified erythrocytes and blood plasma is reconstituted. In this
manner, it is possible to prepare and store blood containing
IHP-modified erythrocytes.
[0072] The apparatus of the present invention provides an improved
method for the encapsulation of biologically-active substances in
cells including an apparatus which is self-contained and therefore
sterile, an apparatus which can process large volumes of cells
within a shortened time period, an apparatus having improved
contamination detection, cooling and incubation elements, an
apparatus that is entirely automated and which does not require the
active control of a technician once a sample is introduced into the
apparatus.
[0073] Another embodiment of the present invention is a preparation
of red blood cells that has a stable right shifted oxygen
dissociation curve. The phrase "stable right shifted blood" as used
herein means that the right shifted oxygenation curve remains
higher than untreated red blood cells over the same period of time.
Untreated freshly drawn red blood cells will have a P.sub.50 of
approximately 27 mm Hg. This value decreases over time as it is
stored in the blood bank at 2-8.degree. C. due to the loss of the
allosteric effector 2,3-diphosphoglycerate. After several days in
storage the P.sub.50 drops to around 22-25 mm Hg. After 1 to 2
weeks the value can drop to around 18-20 mm Hg. It is contemplated
as part of the present invention a preparation of isolated red
blood cells that have a P.sub.50 greater than approximately 30 mm
Hg. These red blood cells have a stable P.sub.50 that remains
substantially the same over the storage life of the red blood cells
or the P.sub.50 remains substantially above the P.sub.50 of
untreated blood over a period of time. Thus, one embodiment of the
present invention is an isolated preparation of red blood cells
that can be stored under normal blood bank conditions; e.g.,
2-8.degree. C., and has a substantially stable P.sub.50 of greater
than approximately 30 mm Hg, more desirably greater than
approximately 35 mm Hg, even more desirably greater than
approximately 40 mm Hg, and most desirably greater than
approximately 45 mm Hg. It should be noted that depending upon the
particular condition that is being treated, more cells with less of
an average right shift may be used or fewer cells with a greater
average right shift may be used. The present invention of treating
red blood cells by flow electroporation with IHP is capable of
achieving right shifts greater than approximately 30 mm Hg, more
desirably greater than approximately 35 mm Hg, even more desirably
greater than approximately 40 mm Hg, and most desirably greater
than approximately 45 mm Hg in at least one unit of blood in less
than 4 hours. Transfection efficiency can be measured either by the
percentage of the cells that express the product of the gene or the
secretion level of the product express by the gene.
[0074] Another aspect of the present invention is the ability to
electroporate cells with minimal cell damage. For example,
according to the present invention, red blood cells can be loaded
with IHP by flow electroporation with a minimum of 10% hemolysis.
Typically there is 3% to 5% hemolysis immediately after the
electroporation process and another 3% to 5% hemolysis in the
recovery buffer. After several hours, the rate of hemolysis drops
to near zero.
[0075] It is further contemplated as part of the present invention
that the red blood cells that have a substantially stable elevated
P.sub.50 have been treated with IHP, so that the IHP passes through
the red blood cell membrane so that it can bind allosterically to
the DPG binding site of hemoglobin. The method of introducing the
IHP into the interior of the red blood cell membrane can be by any
method that will produce a substantially stable preparation of red
blood cells with an elevated P.sub.50. For example, the red blood
cells can be treated as described herein by flow electroporation in
the presence of IHP, or the red blood cells can be exposed to hypo-
or hyperosmotic agents, or to membrane solubilizing agents to allow
a chemical such as IHP to pass through the red blood cell membrane
so that the IHP molecule can bind allosterically to the DPG binding
site, thereby replacing the natural DPG in the allosteric binding
site on the hemoglobin molecule.
[0076] In addition, the red blood cell preparation can be a
population of normal, untreated red blood cells that naturally have
an elevated P.sub.50 level. A population of normal, untreated red
blood cells that has an elevated P.sub.50 level can be isolated by
density gradient fractionation methods. (See e.g., Bourget, et al.,
Adv. Exp. Med. Biol, 1992).
[0077] Another embodiment of the present invention includes a
method of gene therapy including, but not limited to, the
introduction of ribonucleic acid preparations, such as DNA, into
live cells. The DNA preparations preferably code for a desired
protein and can optionally contain vectors that will facilitate the
introduction of the DNA into the genetic mechanisms of the cell and
thereby (1) increase the expression of the desired protein; (2)
regulate the metabolism of a cell; (3) change the phenotype of a
cell or (4) be used as a carrier inside the cell. These methods of
adding vectors to naked DNA preparations are well known to those of
ordinary skill in the art. The DNA that is introduced using the
flow electroporation apparatus of the present invention can be
naked DNA or can contain other agents to facilitate entry of the
DNA into the cell.
[0078] The present invention relates to a method and apparatus for
the encapsulation of genetic material in various cell populations.
found in blood. More specifically, the present invention provides
an electroporation chamber that may form part of an automated,
self-contained, flow apparatus for encapsulating genetic materials
in cells and, more specifically in cells found in blood. In a
specific embodiment the genetic material is incorporated in
lymphocytes, thereby altering the genetic component of the
lymphocytes and transforming the lymphocytes. Encapsulation is
preferably achieved by electroporation. The method and apparatus,
including the electroporation chamber, of the present invention is
equally suited to the encapsulation of genetic material in various
cell populations.
[0079] The apparatus and method of the present invention is suited
to the incorporation of genetic material in cells and lipid
vesicles. The method, apparatus and chamber of the present
invention may be used for introducing genetic material into a
vesicle whether that vesicle is engineered or naturally occurring.
Thus, the present invention includes a method of transfecting a
cell comprising providing a nucleic acid or an expression vector
coding for a desired protein or peptide and introducing the nucleic
acid or expression vector into the cell by flow
electroporation.
[0080] The incorporation of the genetic material into the cells in
accordance with the method of the present invention, including the
encapsulation of genetic material into lymphocytes, is conducted
extracorporally via an automated, flow electroporation apparatus.
Briefly, a cell suspension is introduced into the separation and
washbowl chamber of the flow encapsulation apparatus. The cells are
separated from the suspension, washed and re-suspended in a
solution of the genetic material to be introduced into the cell.
This suspension is introduced into the electroporation chamber and
then incubated. Following electroporation and incubation, the cells
are washed and separated. A contamination check is optionally
conducted to confirm that all unencapsulated genetic material has
been removed. Then, the cells are prepared for storage or
reintroduction into a patient. The present invention also includes
vaccine wherein an expression vector coding for an antigen is
introduced into a cell and the transfected cell is then introduced
into a human or animal. The transected cell line expresses the
antigen and the body then mounts an immune reaction against the
antigen. Optionally, the cell line can be cotransfected with an
expression vector that codes for the desired antigen and with a
cytokine that will act as an adjuvant thereby enhancing the immune
response.
[0081] In accordance with the present invention and with reference
to the preferred embodiment, blood is drawn from a patient, the
lymphocytes are separated from the drawn blood, the lymphocytes are
modified by the incorporation of genetic material and the
transformed lymphocytes and other components of the blood are
reconstituted.
[0082] Accordingly, it is an object of the present invention to
provide an automated, continuous flow electroporation
apparatus.
[0083] It is another object of the present invention to provide a
continuous flow electroporation device that produces a homogenous
population of loaded cells or vesicles.
[0084] It is another object of the present invention to provide a
sterile and nonpyrogenic method of encapsulating biologically
active substances in cells.
[0085] It is another object of the present invention to provided a
method and apparatus which results in stable resealing of cells or
vesicles following electroporation to minimize lysis of the
modified cells or vesicles after electroporation.
[0086] It is another object of the present invention to provide a
flow electroporation system of the present invention that produces
a modified cell population from which all exogenous
non-encapsulated biologically active substances have been
removed.
[0087] It is another object of the present invention to provide a
method and apparatus that allows continuous encapsulation of
biologically active substances in a population of cells or
vesicles.
[0088] It is a further object of the present invention to provide a
method and apparatus that achieves the above-defined objects,
features, and advantages in a single cycle.
[0089] It is a further object of the present invention to provide a
method and apparatus that is capable of introducing drugs and
substances into platelets.
[0090] It is another object of the present invention to provide a
continuous flow electroporation chamber.
[0091] It is another object of the present invention to provide an
improved and more efficient method of encapsulating biologically
active substances in cells than those methods currently
available.
[0092] It is another object of the invention to provide improved
combinations of electrical treatment of cells in terms of electric
field strength, duration and frequency of electrical treatment that
improve the efficiency of electroporation of various cell
types.
[0093] It is another object of the invention to provide a device
for flow electroporation that maintains a sterile path through
which cells can pass during the electroporation process, thereby
enabling use of flow electroporation in a clinical setting.
[0094] It is a further object of the present invention to provide a
composition suitable for use in the treatment of conditions and/or
disease states resulting from a lack of or decrease in
oxygenation.
[0095] Other objects, features, and advantages of the present
invention will become apparent upon reading the following detailed
description of the disclosed embodiments of the invention when
taken in conjunction with the appended drawing and the claims.
BRIEF DESCRIPTION OF THE DRAWING
[0096] FIG. 1 is a schematic of a high voltage control board
layout.
[0097] FIG. 2 is a schematic diagram of a high voltage system
diagram.
[0098] FIG. 3 is a schematic diagram system board general
layout.
[0099] FIG. 4 is a schematic diagram of a pulse modulator and
energy reduction modulator board general layout.
[0100] FIG. 5 is a pictorial representation of the Graphical User
Interface During IHP/RBC Preparation.
[0101] FIG. 6 is a schematic diagram of the Sub Main Start-up Calls
(Module 1).
[0102] FIG. 7 is a schematic diagram of the Temperature Measurement
and Control.
[0103] FIG. 8 is a schematic diagram of the CAVRO Pump
Initialization and Control.
[0104] FIG. 9 is a schematic diagram of the Analog Collect and Plot
Data.
[0105] FIG. 10 is a schematic diagram of the Modulator Pulse
Generation.
[0106] FIG. 11 is an exploded view of one embodiment of the flow
cell.
[0107] FIG. 12 is a schematic diagram of the disposable unit.
[0108] FIG. 13 is an exploded perspective view of a second
disclosed embodiment of a flow electroporation cell assembly of the
present invention.
[0109] FIG. 14 is a perspective view of another disclosed
embodiment of a flow electroporation cell assembly of the present
invention.
[0110] FIG. 15 is a perspective view of yet another disclosed
embodiment of the flow electroporation cell assembly of the present
invention.
[0111] FIG. 16 is an exploded perspective view of another disclosed
embodiment of a flow electroporation cell assembly of the present
invention with multiple channels.
[0112] FIG. 17 is a perspective view of a disclosed embodiment of a
non-planar electrode flow cell array of the present invention.
[0113] FIG. 18 is a graph showing the average right shift of the
oxygen dissociation curve for several samples of red blood cells
that have been electroporated in the presence of IHP.
[0114] FIG. 19 is a graph showing the effects of large volume
fibroblasts transfected with human erythropoietin (hEPO) gene on
the hematocrit of mice.
[0115] FIG. 20 is a graph showing electroporation mediated DNA
oligo uptake by mammalian cells.
[0116] FIG. 21 is a graph showing fluorescence difference was
observed when .beta.-actin (blue) or scrambled DNA (orange) MBs
were incorporated into Jurkat cells by electroporation.
[0117] FIG. 22 is a graph showing the efficiency of co-transfected
cells.
[0118] FIG. 23A is a scatter plot from a flow cytometry measurement
of test platelets.
[0119] FIG. 23B is a scatter plot from a flow cytometry measurement
of platelets loaded with a maker.
[0120] FIG. 24A is a graph showing collagen-stimulated
beta-Thromboglobulin release of flow electroporated platelets as
compared to controls.
[0121] FIG. 24B is a graph showing collagen-stimulated Calcein
release of flow electroporated platelets as compared to
controls.
[0122] FIG. 25 is a graph showing in vivo delivery of mIL-12 by
cells transfected with IL-12 gene.
[0123] FIG. 26 is a graph showing inhibition of angiogenesis in
implanted Matrigel by cells transfected with IL-12 gene.
[0124] FIG. 27 is an exploded perspective view of a third disclosed
embodiment of the flow electroporation cell assembly of the present
invention.
[0125] FIG. 28 is a cross-sectional side view taken along the line
A-A of the cell assembly shown in FIG. 29.
[0126] FIG. 29 is a top plan view of the cell assembly shown in
FIG. 27.
[0127] FIG. 30A is an exploded perspective view of a fourth
disclosed embodiment of the flow electroporation cell assembly of
the present invention.
[0128] FIG. 30B is a perspective view of the flow electroporation
cell assembly shown in FIG. 30A.
[0129] FIG. 30C is a side view of the flow electroporation cell
assembly shown in FIG. 30B.
[0130] FIG. 30D is a side cross-sectional view taken along the line
30D-30D shown in FIG. 30C.
[0131] FIG. 30E is an end view of the flow electroporation cell
assembly shown in FIG. 30B.
[0132] FIG. 30F is the opposite end view of the flow
electroporation cell assembly shown in FIG. 30B.
[0133] FIG. 31A is an exploded perspective view of a fifth
disclosed embodiment of the flow electroporation cell assembly of
the present invention.
[0134] FIG. 31B is a perspective view of the flow electroporation
cell assembly shown in FIG. 31A.
[0135] FIG. 32A is an exploded perspective view of a sixth
disclosed embodiment of the flow electroporation cell assembly of
the present invention.
[0136] FIG. 32B is a perspective view of the flow electroporation
cell assembly shown in FIG. 32A.
[0137] FIG. 32C is a side view of the flow electroporation cell
assembly shown in FIG. 32B.
[0138] FIG. 32D is a side cross-sectional view taken along the line
33D-33D shown in FIG. 32C.
[0139] FIG. 33 is a graph showing estimated transfection efficiency
and propidium iodine exclusion for cell viability.
[0140] FIG. 34 is a graph showing efficiency of transfection and
cell viability.
[0141] FIG. 35 is a graph showing cell viability versus electric
field strength.
[0142] FIG. 36 is a graph showing propidium iodine exclusion for
cell viability.
[0143] FIG. 37 is a graph showing efficiency of transfection and
cell viability.
[0144] FIG. 38 is a graph showing mean fluorescence intensity
versus days post-transfection.
[0145] FIG. 39 is a graph showing levels of deoxygenated hemoglobin
in various test samples.
[0146] FIG. 40 is a graph showing levels of mIL12 in the plasma of
various test mice.
[0147] FIG. 41 is a graph showing the effect of electric field on
electrotransfection of mouse embryonic stem cells.
[0148] FIG. 42 is a graph showing the effect of DNA concentration
on electrotransfection of mouse embryonic stem cell.
[0149] FIG. 43 is a graph showing the effect of glucose in the
pulsing medium on electrotransfection of the 10T1/2 cells.
[0150] FIG. 44 is a graph showing the relative mean fluorescence
intensity as a result of glucose in the pulsing medium used for
electrotransfection of the 10T1/2 cells.
[0151] FIG. 45 is a graph showing the results of the
electrotransfection of foreskin fibroblasts.
[0152] FIG. 46 is a graph showing efficiency of transfection and
cell viability for human resting lymphocytes.
[0153] FIG. 47 is a graph showing the effect of electric field on
flow electroporation mediated macromolecule uptake.
[0154] FIG. 48 is a graph showing hCD40L expression versus electric
field strength.
[0155] FIG. 49 is a graph showing mean fluorescence intensity
versus electric field strength.
[0156] FIG. 50 is a graph showing the effect of electroporation
timing on CLL cell transfection.
[0157] FIG. 51 is a graph showing the efficiency of transfection
and cell viability.
[0158] FIG. 52 is a graph showing the effect of electric field
strength on CLL-B cell transfection.
[0159] FIG. 53 is a graph showing relative mean fluorescence
intensity versus electric field strength.
[0160] FIG. 54 is a graph showing cell loading efficiency.
[0161] FIG. 55 is a graph showing cell DNA concentration effect on
cell viability.
[0162] FIG. 56 is a graph showing DNA concentration effect on
transfection efficiency.
[0163] FIG. 57 is a graph showing the effect of temperature on
transfection of CLL-B cells.
DETAILED DESCRIPTION OF THE DISCLOSED EMBODIMENTS
[0164] One embodiment of the present invention provides an
automated, self-contained, flow apparatus for encapsulating
allosteric compounds or compositions, such as inositol
hexaphosphate, in cells or fragments of cells, including, but not
limited to, red blood cells, white blood cells, platelets, stem
cells, genetically engineered stem cells, or an expanded population
of stem cells. In one embodiment, the apparatus of the present
invention combines the features of a plasmaphoresis apparatus with
those of a flow electroporation apparatus to form an automated,
self-contained flow electroporation device. The present invention
further comprises a new flow electroporation chamber that allows
use of the chamber under flow rather than static conditions. It is
contemplated that the method and apparatus, including the
electroporation chamber of the present invention, may be used to
encapsulate a variety of biologically active substances in diverse
cell populations.
[0165] In one embodiment, the present invention provides a
population of modified cells having characteristics that make the
cells particularly useful for treating conditions that demand or
benefit from an increase in the delivery of oxygen to the tissues.
In accordance with the method of the present invention, a
homogenous population of IHP loaded red blood cells can be obtained
under sterile conditions and with a reduced propensity to lyse
following encapsulation. The treated red blood cells exhibit normal
life spans in circulation. Using the present invention, red blood
cells of a patient in need of the treatment can be quickly loaded
and returned to the patient's circulation.
[0166] The method of operation of the apparatus of the present
invention is described below with reference to the preferred use of
the apparatus, i.e., the encapsulation of allosteric effectors of
hemoglobin in red blood cells. Inositol hexaphosphate is the
preferred allosteric effector to be used with the present
invention. Other sugar phosphates, such as inositol pentaphosphate,
inositol tetraphosphate, inositol triphosphate, inositol
diphosphate and diphosphatidyl inositol diphosphate, can also be
used. Other suitable allosteric effectors include polyphosphates
such as nucleotide triphosphates, nucleotide diphosphates,
nucleotide monophosphates, and alcohol phosphate esters. In case of
certain mutations of hemoglobin, e.g. "Zurich" hemoglobin, organic
anions such as polycarboxylic acids can be used as allosteric
effectors. Finally, it is possible to use inorganic anions such as
hexacyano ferrate, phosphate or chloride as allosteric
effectors.
[0167] The uses of IHP-treated red blood cells is quite extensive
including the treatment of numerous acute and chronic conditions
including, but not limited to, hospitalized patients,
cardiovascular operations, chronic anemia, anemia following major
surgery, coronary infarction and associated problems, chronic
pulmonary disease, cardiovascular patients, autologous
transfusions, as an enhancement to packed red blood cells
transfusion (hemorrhage, traumatic injury, or surgery), congestive
heart failure, myocardial infarction (heart attack), stroke,
peripheral vascular disease, intermittent claudication, circulatory
shock, hemorrhagic shock, anemia and chronic hypoxemia, respiratory
alkalemia, metabolic alkalosis, sickle cell anemia, reduced lung
capacity caused by pneumonia, surgery, pneumonia, trauma, chest
puncture, gangrene, anaerobic infections, blood vessel diseases,
such as diabetes, substitute or complement to treatment with
hyperbaric pressure chambers, intra-operative red cell salvage,
cardiac inadequacy, organ transplant, carbon monoxide, nitric
oxide, and cyanide poisoning.
[0168] Treating a human or animal for any one or more of the above
disease states is done by transfusing into the human or animal
between approximately 0.5 and 6 units (1 unit=453 ml.+-.50 ml) of
IHP-treated blood that has been prepared according to the present
invention. In certain cases, there may be a substantially complete
replacement of all the normal blood in a patient with IHP-treated
blood. The volume of IHP-treated red blood cells that is
administered to the human or animal will depend upon the indication
being treated. In addition, the volume of IHP-treated red blood
cells will also depend upon concentration of IHP-treated red blood
cells in the red blood cell suspension. It is to be understood that
the quantity of IHP red blood cells that is administered to the
patient is not critical and can vary widely and still be
effective.
[0169] IHP-treated packed red blood cells are similar to normal red
blood cells except that the IHP-treated packed red blood cells can
deliver 2 to 3 times as much oxygen to tissue per unit of blood
when compared to normal, untreated red blood cells. A physician
would therefore chose to administer a single unit of IHP-treated
packed red blood cells rather than 2 units of the normal red blood
cells. IHP-treated packed red blood cells could be prepared in
blood processing centers analogously to the present blood
processing methods, except for the inclusion of a processing step
where the IHP is encapsulated in the cells.
[0170] Red blood cells that have been loaded with inositol
hexaphosphate according to the present invention can be used to
treat a wide variety of diseases and disease states. The IHP loaded
red blood cells made according to the present invention can be
administered to a patient undergoing a heart attack thereby
increasing the oxygen delivery to the ischemic heart tissue and, at
the same time, reducing the cardiac output. The IHP-loaded red
blood cells made according to the present invention also can be
used to treat any ischemic condition including, but not limited to,
"bleeding" anemia, surgical complications, stroke, diabetes, sickle
cell disease, burns, intermittent claudication, emphysema,
hypothermia, peripheral vascular disease, congestive heart failure,
angina, transient ischemic disease, disseminated intravascular
coagulation, adult respiratory distress syndrome (ARDS) and cystic
fibrosis.
[0171] The present invention includes a method of treating a
patient in need of tissue oxygenation comprising administering to
the patient an effective amount of red blood cells containing a
quantity of IHP sufficient to cause a right shift in the oxygen
dissociation curve of the hemoglobin associated with the red blood
cells. The present invention also includes a method of treating a
patient in need of a therapeutic agent comprising administering to
the patient an effective amount of red blood cells containing the
therapeutic agent.
[0172] In one embodiment of the present invention, substances or
drugs can be introduced into cells or fragments of cells such as
platelets. For example, thrombus-dissolving substances such as
tissue plasminogen activator, urokinase or streptokinase and the
like can be introduced into a population of platelets. Tissue
plasminogen activator is sold under the trademark ACTIVASE.RTM. by
Genentech Corporation, South San Francisco, Calif. These platelets
loaded with the thrombus dissolving substances can be then
introduced into a patient who is suffering from a thrombus blocking
a blood vessel. The platelet containing the thrombus dissolving
substance will then migrate to the site of the thrombus and attach
itself to the thrombus. Because the treated platelets contain
active thrombus dissolving enzymes, the thrombus is then dissolved.
It is to be understood that other drugs can be introduced into the
platelets or other cells for delivery to damaged tissue. These
drugs include, but are not limited to, antibiotics, smooth muscle
inhibitors, antifungal agents, antibacterial agents, antiviral
agents, chemotherapeutic agents and the like. Antiangiogenic drugs
can be incorporated into the platelets. Antiangiogenic drugs
include, but are not limited to, AGM-1470 (TNP-470) or antagonists
to one of its receptors, MetAP-2; growth factor antagonists, or
antibodies to growth factors (including VEGF or bFGF); growth
factor receptor antagonists or antibodies to growth factor
receptors; inhibitors of metalloproteinases including TIMP,
batimastat (BB-94), and marimastat; tyrosine kinase inhibitors
including genistein and SU5416; integrin antagonists including
antagonists alphaVbeta3/5 or antibodies to integrins; retinoids
including retinoic acid or the synthetic retinoid fenretinide;
steroids 11.alpha.-epihydrocortisol, corteloxone,
tetrahydrocortisone and 17.alpha.-hydroxyprogesterone; protein
kinase inhibitors including staurosporine and MDL 27032; vitamin D
derivatives including 22-oxa-1 alpha, and 25-dihydroxyvitamin D3;
arachidonic acid inhibitors including indomethacin and sulindac;
tetracycline derivatives including minocycline; thalidomide and
thalidomide analogs and derivatives; 2-methoxyestradiol; tumor
necrosis factor-alpha; interferon-gamma-inducible protein 10
(IP-10); interleukin 1 and interleukin 12; interferon alpha, beta
or gamma; angiostatin protein or plasminogen fragments; endostatin
protein or collagen 18 fragments; proliferin-related protein; group
B streptococcus toxin; CM101; CAI; troponin I; squalamine; nitric
oxide synthase inhibitors including L-NAME; thrombospondin;
wortmannin; amiloride; spironolactone; ursodeoxycholic acid;
bufalin; suramin; tecogalan sodium; linoleic acid; captopril;
irsogladine; FR-118487; triterpene acids; castanospermine; leukemia
inhibitory factor; lavendustin A; platelet factor-4; herbimycin A;
diaminoanthraquinone; taxol; aurintricarboxylic acid; DS-4152;
pentosan polysulphite; radicicol; fragments of human prolactin;
erbstatin; eponemycin; shark cartilage; protamine; Louisianin A, C
and D; PAF antagonist WEB 2086; auranofin; ascorbic ethers; and
sulfated polysaccharide D 4152. The agents, including thrombus
dissolving substances, can be introduced into the platelets by a
variety of methods with the most preferable method being according
to the apparatus of the present invention as described herein.
[0173] The present invention also includes a method of treating a
patient in need of a therapeutic agent comprising administering to
the patient an effective amount of platelets containing the
therapeutic agent.
[0174] Patients that can be treated with the modified platelets
include, but are not limited to, heart attack patients, patients
suffering a stroke, and any patient that is suffering from an
embolism. The amount of thrombus dissolving substance that is
introduced into a platelet is between 0.01 .mu.g to 1 mg per
platelet. Generally speaking, one loads as much thrombus dissolving
substance as possible into a population of platelets. The method of
introducing the thrombus dissolving substance into the platelets is
similar to the method of introducing IHP into red blood cells as
described herein.
[0175] The present invention also includes methods and compositions
for delivering bioactive compounds to the body by loading red blood
cells, white blood cells and/or platelets with agents including,
but not limited to, cytokines, such as interferon, colony
stimulating factors, and interleukins; hormones, such as growth
hormone, insulin, and prolactin; antibodies, including monoclonal
antibodies and polyclonal antibodies as well as antibodies
conjugated to toxins or radioactive agents, chemotherapeutic
agents, such as doxorubicin, amphotericin, and taxol, bioactive
peptides, and antiviral agents.
[0176] Another embodiment of the present invention is the targeting
of therapeutic agents to certain locations in the body by loading a
particular cell with a therapeutic agent or agents. Examples of
this embodiment include, but are not limited to, loading of
platelets with an antiangiogenic agent that will be targeted to a
site that has been treated mechanically to remove an
atherosclerotic plaque (as in angioplasty) and loading of
leukocytes with antibiotics that migrate to a site of an
infection.
[0177] The present invention includes a method of gene therapy
including, but not limited to the introduction of deoxyribonucleic
acid and ribonucleic acid preparations into live cells. The DNA
and/or RNA preparations preferably code for a desired protein or
fragment of a protein and the DNA can optionally contain vectors
that will facilitate the introduction of the DNA into the genetic
mechanisms of the cell and thereby increase the expression of the
desired protein. These methods of adding vectors to naked DNA
preparations are well know to those of ordinary skill in the art.
The DNA that is introduced using the flow electroporation apparatus
of the present invention can be naked DNA or can contain other
agents to facilitate entry of the DNA into the cell.
[0178] The present invention can be used to introduce any genetic
material into a cell or cell fragment. The genetic material may
code for a specific protein or peptide or may be an antisense
genetic material. Examples of proteins and peptides that can be
introduced into human or animal cells by introducing a nucleic acid
or the expression vector that codes for that protein or peptide
include, but is not limited to, genes that code for b-cell
differentiation factors, b-cell growth factors, mitogenic
cytokines, chemotactic cytokines, colony stimulating factors,
angiogenesis factors, adhesion factors (cadherins, selectins,
integrins, NCAMs, ICAMs, and L1) t-cell replacing factors,
differentiation factors, transcription factors, mRNA, heat shock
proteins, nuclear protein complexes, and RNA/DNA oligomers.
Specific factors that can be introduced into a human or animal
using the flow electroporation system of the present invention
include, but are not limited to, IFN-alpha, IFN-beta, IFN-omega,
IL1, IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL10, IL11, IL12,
IL13, IL14, IL15, IL16, IL17, IL18, leptin, myostatins (growth
differentiation factors), macrophage stimulating protein and
derivatives thereof, platelet-derived growth factor, tumor necrosis
factors (TNF-alpha, TNF-beta, NGF, CD40L, CD137L/4-1BBL, human
lymphotoxin-beta, TNF-related apoptosis-inducing ligand (trail)),
monoclonal antibodies, G-CSF, M-CSF, GM-CSF, PDGF, IL1-alpha,
IL1-beta, FGF IFN-gamma, IP-10, PF4, GRO, and 9E3, erythropoietin
(EPO), endostatin and fragments thereof, angiostatin and fragments
thereof, fibroblast growth factors (FGF), VEGF, soluble receptors
and any fragments or combinations thereof.
[0179] The present invention of transfecting cells by
electroporation, preferably flow electroporation, is capable of
achieving transfection efficiencies of greater than 40%, preferable
greater than 50% and most preferably greater than 60% or 70%.
Transfection efficiency can be measured either by the percentage of
the cells that express the product of the gene or the secretion
level of the product express by the gene. The cells maintain a high
viability during and after the electroporation process. Viability
is routinely more than 50% or greater. Preferably, viability is
greater than 60%, more preferably greater than 70%, more preferably
greater than 80%, more preferably greater than 90%.
[0180] Another advantage of the present invention is the speed at
which a large population of cells can be transfected. For example,
a population of lymphocytes can be transfected by electroporation
by electroporating the sample in less than 5 hours, preferably less
than 4 hours and most preferable in less than 3 hours and most
preferably in less than 2 hours. The time of electroporation is the
time that the sample is processed by the flow electroporation
process.
Description of Flow Electroporation Device
[0181] The flow electroporation device of the present invention is,
in one embodiment, comprised of the following:
[0182] Instrument (electronics module [power box+tower]);
[0183] Computer (communicates with electronics module);
[0184] Monitor (displays graphical user interface [GUI] and enables
user interaction); and
[0185] Disposable Set (component in which flow electroporation of
cell suspension occurs.
[0186] The present invention uses flow electroporation to overcome
the practical limitations in respect to the number of cells that
can be electroporated, the time in which they can be electroporated
and the volume of solution in which they are suspended that attend
to static or batch electroporation methods. With this method, a
cell suspension is passed across parallel bar electrodes that are
contained in a flow cell that is preferably disposable. It is to be
understood that different configurations of flow cells can be used
in the present invention. For example, see below. During this
passage, the cells are subjected to electrical pulses with
predetermined characteristics. For example, the specific settings
for preparation of IHP-loaded red blood cells are: voltage, 750V;
pulse width, 650 .mu.sec; time between pulses, 100 .mu.sec; 2
biphasic pulses in a burst; time between bursts, 12 sec; flow rate,
0.05 mL/sec. The molecule of interest (e.g., IHP) then diffuses
into the cell following concentration and/or electrical gradients.
The present invention is optionally capable of subjecting the cells
to a range of electric field strengths. Generally speaking, field
strengths useful in the present invention are greater than
approximately 1 kV/cm; preferably, approximately 1 kV/cm to 3.5
kV/cm.
[0187] The process is initiated by attaching the flow cell with
solutions and cell suspensions in the containers with the necessary
fluids and samples. The flow cell snaps into place and is secured
by closing a hinged panel. Priming solution (saline) and cell
suspension are introduced by providing the required commands to the
electroporation system, which controls operation of the pump and
pinch valves. As the cells transit the flow path between
electrodes, electric pulses of the chosen voltage, duration, and
frequency are applied. Product and waste fluids are collected in
the designated containers.
[0188] The user inputs the desired voltage and other parameters
into the flow electroporation system of the present invention. As
noted above, a range of settings is optionally available. The
computer communicates to the electronics in the tower to charge the
capacitor bank to the desired voltage. Appropriate switches then
manipulate the voltage before it is delivered to the flow path to
create the electric field (the switches provide alternating pulses
or bursts to minimize electrode wear brought on by prolonged
exposure to the electric field). The voltage is delivered according
to the duration and frequency parameters set into the flow
electroporation system of the present invention by the operator.
The flow electroporation system of the present invention is now
described in detail.
Electronics Module
[0189] This section describes how the various components of the
electronics module interface with each other in one embodiment of
the present invention. Details for all the mechanical and
electrical components in the electronics module are included on
Tables 1 and 2 below.
TABLE-US-00001 TABLE 1 Mechanical Components COMPONENT
DESCRIPTION/FUNCTION MANUFACTURER PART NUMBER POWER PLASTIC PANELS
THAT HOUSE THE 24- NICHOLSON PRECISION 1SP00001100AD CABINET VOLT
POWER SYSTEM. INSTRUMENTS (NPI) ASSY TOWER PLASTIC PANELS THAT
HOUSE MOST OF NPI 1ST00001200AD CABINET THE ELECTRONICS, PUMP,
COOLER, HIGH ASSY VOLTAGE SUPPLY. SYSTEM POLYCARBONATE PIECE THAT
GUIDES NPI 1ST08101100PD BOARD GUIDE THE PHYSICAL POSITION OF THE
SYSTEM BOARD IN THE TOWER ASSY. SYSTEM POLYCARBONATE PIECE THAT
ENSURES NPI 1ST08101100PD BOARD SLIDE THE SYSTEM BOARD IS LEVEL FOR
PROPER CONNECTION. SYSTEM POLYCARBONATE FIXTURES THAT NPI
1ST08301100PD BOARD SECURE SYSTEM BOARD TO TOWER. SCREW MOUNT
MECHANICAL SWITCH THAT WHEN ACTIVATED MANUFACTURER: 1ST09001100PD
SWITCH WITH SIGNALS THE SYSTEM THAT HIGH MICRO SWITCH BRACKET
VOLTAGE PULSES MAY BE DELIVERED DISTRIBUTOR: MOUSER TO DISPOSABLE.
DRIP TRAY + CURRENT POLYCARBONATE COMPONENT THAT NPI 1ST09201100PD
MONITOR COLLECTS ANY FLUID THAT MAY DRIP BRACKET FROM THE PELTIER
COOLER, USUALLY IN THE FORM OF CONDENSATION. IT ALSO SUPPORTS THE
CURRENT MONITOR USED FOR DISPLAYING THE CURRENT DRAWN THROUGH THE
DISPOSABLE SET. ALUMINUM FRAME FOR THE INSTRUMENT. ITEM PRODUCTS
1ST10001100SA FRAME INFRARED (IR) BLACK DELRON HOUSING THAT HOLDS
NPI 1ST03201000PD HOUSING THE IR DETECTOR AS WELL AS TUBING FOR
TEMPERATURE MEASUREMENT. COMPRESSION POLYCARBONATE PANEL THAT NPI
1ST04101100PD PLATE COMPRESSES THE DISPOSABLE FLOW CELL TO PREVENT
AIR OR FLUID LEAKAGE. HEAT SINK ALUMINUM PLATE THAT PROVIDES NPI
1ST10101100PD MEANS FOR REMOVING HEAT FROM HIGH VOLTAGE SWITCHES.
COMPRESSION LATCHES USED TO LOCK COMPRESSION MCMASTER CARR
1ST08301100PD PLATE PLATE ON TO DISPOSABLE FLOW CELL. LATCHES
TABLE-US-00002 TABLE 2 Electrical Components MANUFACTURER COMPONENT
DESCRIPTION PART# THERAMED PART# HIGH VOLTAGE BIPOLAR SUPPLY
PROVIDING 125 WATTS ULTRAVOLT 1ST201100PD (HV) POWER AT A MAXIMUM
OF 1000 V. DESIGNED 1/2C24-NP125 SUPPLY WITH A FLOATING GROUND FOR
SAFETY. PINCH VALVES ACTUATE TO OCCLUDE TUBING FROM ASCO/ANGAR
1ST01201100PD AND DISPOSABLE SETS. 401139 1ST04401100PD PERISTALTIC
PUMP STEPPER MOTOR, PUSHES FLUID CAVRO 1ST04501100PD THROUGH
DISPOSABLE SET. SP-4/724439 PELTIER COOLER REMOVES HEAT FROM
DISPOSABLE SET. TB TECHNOLOGIES 1ST04801100PD WITH FAN CONTROLLED
BY TEMPERATURE SENSOR CP-2061 AND SOFTWARE. 300 A SWITCHES CONNECTS
HIGH VOLTAGE SYSTEM TO POWEREX 1ST10201100PD ELECTRODE CONTACT
POINTS. PM300DSA120 SOFTWARE CONTROLLED. 150 A SWITCHES CONNECTS
HIGH VOLTAGE SYSTEM TO POWEREX 1ST010301100PD ELECTRODE CONTACT
POINTS WHEN PM150DSA120 ENERGY REDUCTION PULSES ARE USED (SEE
GRAPHICAL USER INTERFACE [GUI] SECTION). SOFTWARE CONTROLLED.
CURRENT LIMITING 330 .OMEGA. RESISTOR THAT LIMIT THE AMOUNT VISHAY
DALE 1ST10401100PD RESISTORS OF CURRENT THAT THE HIGH VOLTAGE
71-RH50-330 SYSTEM CAN DELIVER TO THE CAPACITOR BANK. ENERGY 5
.OMEGA. BLEED OFF RESISTORS THAT CAUSE VISHAY DALE 1ST10501100PD
REDUCTION MORE RAPID DISCHARGE OF CAPACITORS 71-RH50-10K RESISTORS
DURING ENERGY REDUCTION PULSES. LOW PASS FILTER 2 UF CAPS THAT
PREVENT HIGH CORNELL DUBLIER 1ST05001100PD FREQUENCY NOISE FROM
EFFECTING SCD250K122A3Z25 HIGH VOLTAGE SWITCHES. MINI MEGA PACK
PROVIDES POWER FOR ENTIRE SYSTEM VICOR 1P0511100PD THROUGH TWO 24
VOLT POWER SUPPLIES MM2-14517 AND TWO BOOSTERS PROVIDING 8.3 AMPS
EACH. IR SENSOR INFRARED TEMP SENSOR THAT OMEGA 1ST03101100PD
MONITORS THE FLUID TEMPERATURE 0S36-01-K-80F EXITING THE FLOW CELL.
INDICATOR LIGHT ACTIVATES WHEN THE MECHANICAL DISTRIBUTOR:
1T0341100PD SWITCH IS ACTIVATED. THIS ALSO MOUSER SIGNALS THE
SYSTEM THAT HIGH 604-L53IT VOLTAGE PULSES ARE CAPABLE OF BEING
DELIVERED TO THE DISPOSABLE. HIGH VOLTAGE STORE ENERGY FOR HIGH
VOLTAGE MALLORY 1ST06101100PD CAPACITORS PULSES. EACH CAP IS RATED
FOR 350 V CGH102T350V2L AND 1000UF. CURRENT MONITOR HALL EFFECT
CURRENT SENSOR THAT F. W. BELL 1T0711100PD MEASURES DC CURRENTS
THROUGH CLN-300 INDUCTION OF CURRENT ON ITS COILS VIA THE MAGNETIC
FIELD GENERATED MEASURES UP TO 300 AMPS. TURN RATIO OF 1:2000
PROVIDING A NORMAL ANALOG OUTPUT CURRENT OF 150 MA. AC SYSTEM RELAY
PROVIDES GATE FOR AC POWER TO CRYDOM 1P0521100PD SYSTEM. CTD2425 DC
COOLER RELAY PROVIDES GATE FOR DC POWER TO CRYDOM 1P0541100PD
PELTIER COOLER. DID40 DC HIGH VOLTAGE PROVIDES GATE FOR POWER TO
HIGH CRYDOM 1P0551100PD RELAY VOLTAGE SUPPLY DID40 HIGH VOLTAGE
USES COMPUTER D/A VOLTAGE TO EMDS/ECA 1E0101100PD CONTROL BOARD
CONTROL BOTH HV SUPPLIES AND PROVIDE FOR HV ISOLATION FROM GROUND.
CAPACITOR BOARD HOLDS HIGH VOLTAGE SWITCHES, EMDS 1E0201100PD
CURRENT LIMITING RESISTORS, LOW PASS FILTERS, AND HIGH VOLTAGE
CAPS. ER BOARD CLOSES CIRCUIT WITH ENERGY EMDS/ECA 1E0301100PD
REDUCTION RESISTORS AND 150 A SWITCHES FOR RAPID DISCHARGE OF
CAPACITORS. PROVIDES OPTICAL ISOLATION FOR PULSES BETWEEN THE
COMPUTER AND THE HV MODULATOR SWITCHES. PULSE CLOSES CIRCUIT WITH
300 A SWITCHES EMDS/ECA 1E0401100PD MODULATION FOR DISCHARGE OF
CAPACITORS DURING BOARD NORMAL PULSING. PROVIDES OPTICAL ISOLATION
FOR PULSES BETWEEN THE COMPUTER AND TO HV MODULATOR SWITCHES.
SYSTEM BOARD MAIN CONTROL BOARD FOR FLOW EMDS/ECA 1E0501100PD
ELECTROPORATION DEVICE [VERSION 1.0] SYSTEM. CONTAINS CIRCUITRY FOR
CONTROLLING PINCH VALVES, WATCHDOG, HIGH VOLTAGE PULSE CREATION,
FLUID DIRECTOR CONTROL, AND HIGH VOLTAGE SIGNAL MEASUREMENT.
CONTAINS OPTICAL ISOLATION CIRCUITRY FOR HIGH VOLTAGE SUPPLY AND
FLUID DETECTOR. IF HIGH VOLTAGE DIFFERENTIAL >20 V SYSTEM WILL
BE SHUT DOWN. COMPUTER DIRECT CONNECTION TO PERISTALTIC ICS ADVENT
1C0101100PD PUMP THROUGH RS232 PORT, AND 400-H53 SYSTEM CONTROL
BOARD THROUGH KPCI3104 CABLE FROM KPCI A/D BOARD IN PCI SLOT.
MONITOR DISPLAYS GUI AND ALLOWS FOR USER DELL 1C0301100PD
INTERACTION AND CONTROL OF GUI 0532U PARAMETERS LISTED IN THE
FOLLOWING SECTIONS. DATA ACQUISITION INPUT/OUTPUT FROM COMPUTER TO
KEITHLEY 1C0501100PD CARD SYSTEM CONTROL BOARD KPCI-3104 ROCKER
SWITCH PROVIDES 24 VOLTS TO SYSTEM. MOUNTAIN SWITCH 1P0321100PD
10DS322 TOP FAN COOLS UNIT. NMB 1ST03501100PD 4715KL-05W-B30 COOLER
PLATINUM PROVIDES TEMPERATURE FEEDBACK TO OMEGA 1ST04701100PD
SENSOR COMPUTER THROUGH PELTIER COOLER. SRTD-1
[0190] FIGS. 1-4 provide layouts/diagrams of the high voltage
system, system board, and pulse modulator and energy reduction
modulator boards. The electronics module can be divided into two
parts, the power box and the tower. The module requires a 15 A
outlet to supply AC power. This power is taken in through the power
box and delivered to a 250V/10 A fuse and an illuminated rocker
switch. The "ON" illuminated position of the rocker switch permits
the passage of power to the System AC solid-state relay. A relay
acts as a gate for the power. The gate can only be opened by the
correct logic signal. The correct logic signal here is the
"watchdog" signal, which is generated by activation of the FED
Version 1.0 software. The watchdog signal was created to circumvent
potential hazards to the user from the electronics module in the
event the software may not be functioning. Without the watchdog
signal, no electronic component in the electronics module will
function.
[0191] The gated AC power is then converted into DC power and
regulated by a Mini MegaPAC. Internally, the Mini MegaPAC (Vicor
Corporation, Andover, Mass.) has two isolated 24V power supplies
and two 24V power boosters. The two boosters are attached to only
one of the 24V isolated supplies. This trio is the power supply
that supplies power to the entire system with the exception of the
high voltage power supply. The remaining isolated 24V power supply
in the Mini MegaPAC supplies power only to the high voltage power
supply in the tower. This separation is an intentional design
feature that creates a floating ground for the high voltage pulses,
which minimizes potential hazards to the user. The user would have
to touch both a point of high, voltage and the floating ground to
be harmed by the instrument.
[0192] With respect to the Mini MegaPAC, power is transferred from
the power supplies to the individual electronic components via an
umbilical cord connecting the power box to the tower. Two paths of
power from the Mini MegaPAC have additional relays. The power to
the cooler is gated by software control. Activation of the cooler
depends upon the cooler set temperature determined by the user and
the corresponding software algorithm used to regulate cooler
temperature. The power to the high voltage supply system is gated
by the micromechanical switch in the tower, which confirms proper
alignment of the disposable set on the instrument. Without a
properly attached disposable set, the high voltage system is
disabled. The high voltage system is composed of an Ultravolt
bipolar high voltage power supply, a capacitor bank, two 330 ohm
current limiting resistors, two 150 A switches, two 300 A switches,
two 5 ohm energy reduction resistors, two low pass filters, the
capacitor board, and the high voltage control board.
[0193] FIGS. 1 and 2 better illustrate the high voltage system and
the components that comprise this system. FIG. 1 is the high
voltage control board layout. This board controls and synchronizes
the two bipolar 500V voltage supplies that lie within the Ultravolt
high voltage supply. Together the control board and these supplies
can produce up to 1000V at alternating polarity. FIG. 2 is an
overview of how the pulses are generated by the capacitor bank and
manipulated by switches to produce the alternating pulses. The
energy reduction switches are also included in this figure. When
activated, the energy reduction reduces the charge generated by the
capacitors through its own set of resistors and switches. Finally,
the manipulated pulses are delivered to the disposable set through
low gauge stranded copper wires. To minimize the potential hazard
to the user, the entire high voltage system is fed by an isolated
power supply to create a floating ground, which is separate from
the common ground shared by the rest of the instrument.
[0194] The remaining electronics components are fed from the
boosted 24V power supply. The pinch valves, tower fan, and pump are
activated and initialized when the flow electroporation system of
the present invention is on (electronics module and software). This
power supply also supplies voltage to the following three printed
circuit boards: the pulse modulator board, the energy reduction
modulator board, and the system board. The system board is the
communication terminal between the computer and the instrument.
FIG. 3 displays the general layout of the system board. It is
connected to an A/D card in the computer via cable. The system
board interfaces with both the high voltage system and the main
power supply. The board maintains the isolation between these two
systems.
[0195] The system board and the computer A/D card in the computer
communicate through analog and digital signals. The system board
receives analog signals from components, processes them, and relays
the information back to the computer. Signals processed this way
are analog inputs. Analog inputs on the system board include the
high voltage, current, infrared temperature, and cooler
temperature. The transfer of analog information also flows in the
opposite direction, which is called analog output. Analog outputs
on the system board include the control voltage in the high voltage
system, +5V supply, an analog ground, and an A/D trigger. The
control voltage in the high voltage system is the signal the
computer generates to tell the high voltage system what voltage to
attain in order to give the desired output voltage. Any signals
related to the high voltage system are optically isolated
electronically to preserve the isolation of the high voltage power
supply. The A/D trigger is the signal the computer generates to
gate the pulses to the desired length.
[0196] Digital signals from the computer can be communicated to the
instrument via the system board. These signals are processed,
manipulated with logic circuitry, and delivered to the electronic
component they control. This is known as digital output. Operation
of the pinch valves, the watchdog, the cooler, biphasic or
monophasic pulses, and the level of energy reduction is under
digital output control. This transfer of digital signals can also
be sent from the system board to the computer and is known as
digital input. The remainder of the system board is logic circuitry
used to manipulate the four counter timers available on the
computer A/D card to generate the waveforms desired by the
user.
[0197] The system board also interfaces with the pulse modulator
board and the energy reduction modulator board. Both modulator
boards contain identical circuitries but are not interchangeable
due to incongruent connections between the 300 A pulse switches and
the 150 A switches. FIG. 4 displays the general layout of the pulse
modulator board and energy reduction modulator board. The system
board feeds the signal from the generated waveform to the modulator
boards. The modulator boards drive the switches to produce the
desired waveform.
[0198] The mechanical framework of the electronics module is
primarily polycarbonate, acrylic, and aluminum. Aluminum was chosen
based on it weight and ability to transfer heat. Polycarbonate was
chosen based on its high strength and easy machinability. Acrylic
was used primarily for the drip tray and the shaped base plate for
the instrument. Advantages of acrylic are that it is lightweight
and that two separate pieces of acrylic can be chemically bonded.
It is to be understood that the materials used are not critical to
the present invention. The components discussed in the text are
listed in Tables 1-5.
Computer and Monitor
[0199] The main function of the computer and monitor is to enable
the user to communicate with the electronics module. Communication
is made possible through a data acquisition card in the PCI slot of
the computer. The data acquisition card is a Keithley KPCI-3104
containing 16 single-ended analog input channels or 8 differential
analog input channels, two 8 bit digital ports programmable as
inputs or outputs, one 7 bit digital I/O programmable port, and
four programmable user counter/timers.
[0200] The system software and its subsequent versions were created
in Visual Basic as a method of communication with the Keithley
card. The software contains a Graphical User Interface (GUI)
displayed on the monitor, which facilitates the communication
between user and electronics module. Traces displaying the voltage
and current on the GUI give the user real-time updates on the
current run. In addition to communicating through the Keithley
card, a communication port (COM port) on the computer is used to
communicate with the peristaltic pump in the electronics module via
an RS232 port.
[0201] The monitor displays the GUI. The GUI presents the various
settings used for the flow electroporation process; Table 3 below
provides an overview of the GUI settings.
TABLE-US-00003 TABLE 3 GUI Settings Item Description Operational
Range High voltage This entry on the screen establishes the sum of
the voltages that are generated 0-1000 V by two high voltage
supplies connected in series. The software program commands this
voltage when the "ON" button in the pulse control section of the
GUI is depressed. The high voltage supply is returned to zero at
the completion of the indicated number of "Pulse Bursts" or the
depression of the "OFF" button. The voltage is controlled through
an isolated high voltage control board that converts a single
analog control voltage from the KPCI- 3104 into a pair of
complementary control voltages required by the high voltage
supplies. Monophasic/biphasic Determines whether the pulses in a
burst are of the same polarity or Option button mono or alternating
polarity. Internally the system always generates the pulses
biphasic choice. necessary to provide for biphasic pulses. If the
biphasic mode is chosen the biphasic pulses are passed to the high
voltage modulator switches. In monophasic mode, one modulator
switch is prevented from receiving modulator pulses. The visual
basic program controls the flow of pulses through the System
Control Board by means of a digital bit in the KPCI- 3104. First
pulse Determines polarity of first pulse in a burst. The software
controls the flow Option button Positive or of pulses through the
System Control Board by a digital bit in the KPCI- negative choice
3104. Taken in combination with the previous Monophasic/biphasic
option buttons, it is possible to generate a wide set of possible
pulse configurations. Pulse width Determine width of applied pulses
by means of a counter timer located in the User input KPCI-3104. An
integer number determines the pulse width in microseconds. 15
.mu.sec-6,000 .mu.sec This number is related to the number of
cycles of a clock that are counted for (using 10.times. multiplier)
the pulse width and the interval between pulses. The internal
system clock of KPCI-3104 operates at 20 MHz, which limits the
system to approximately 1600 microseconds for a maximum pulse width
including interval between pulses. An external clock is included on
the System Control Board, which operates at 2 MHz thus permitting a
10.times. multiplier of the total period. The time constant of
these pulses is determined primarily by two parallel banks of the 4
.times. 100 uF capacitors in series and buffer conductivity within
the disposable set. In monophasic mode the pulse width must be less
than the selected time between pulses. Time between pulses
Determines time between pulses in a burst. In monophasic mode the
time 15 .mu.sec-6,000 .mu.sec between pulse must be greater than
the selected pulse width. (using 10.times. multiplier) including
pulse width. Pulse in burst Determines number of pulses in each
burst by input of positive whole User input numbers. Limitations
are based on the number of pulses, time between pulses, and desired
pulse width. Time between bursts Determines time between each pulse
burst. This time interval is developed by User input a Visual Basic
Timer Control, which has a time resolution of approximately 200
msec-30 sec 20 milliseconds. Limitations are based on time needed
to display bursts. As a result the minimum time should be 200 msec
with a maximum of 32 sec. ER pulse delay Determines number of
pulses prior to initiating energy reduction pulses. ER User input
pulses are pulses with a shorter time constant than the normal
pulses and thus 0-10,000 (even numbers) discharge the capacitors
quickly. Note: ER also occurs after last pulse. See Safety Section
8.17. ER pulse number Determines number of pulses in each burst
that will be delivered at the User input reduced time constant. See
Safety Section 8.17. 0-1000 (even numbers) PULSE ON Enables the
high voltage power supply and controls the high voltage pulses User
clicks ON ON or OFF. Also initiates the timer and data saving
algorithms. PULSE OFF Stops the generation of the high voltage
pulses and sets the high voltage User clicks OFF supply to 0.
However, depending on the capacitance of the capacitor bank,
additional time must be allowed for the high voltage to discharge
to a safe value. Energy reduction mode is activated when OFF has
been depressed to more rapidly discharge the capacitors. See Safety
Section 8.17. Pulse width/time Multiplies the pulse width and time
between pulses valve by a factor of 10 if User input toggle button
between pulses required. This increases the range of these two
parameters. An external clock 1 o 10X multiplier at 2 MHz is
utilized instead of the 20 MHz internal clock. Set temp cooler
Establishes the Peltier cooler temperature. The Visual Basic (VB)
program User input controls this temperature through a digital port
in the KPCI-3104. Flow rate Determines the rate at which fluid
should be pumped through the system Text combo window based on the
existing tube diameter with pull down menu. 0.005-1 mL/sec Flow
direction Determines the direction that the peristaltic pump should
run, thus Option buttons determining the direction of fluid flow
through the system. CW or CCW PUMP ON/OFF Determines whether the
pump will be ON or OFF. ON or OFF - two separate buttons PRIME
START Actuates certain solenoid pinch valves that allow priming
fluid to flow User clicks on option through the flow cell. button
PRIME END Actuates certain solenoid pinch valves when the priming
process is over. User clicks on option button SAMPLE START Actuates
certain solenoid pinch valves when the blood sample is ready for
User clicks on option flow electroporation. button. OFF Closes all
the pinch valves. User clicks on option button Save data This
button is used to activate the data saving form, which allows for
data to User clicks on option be saved to a designated disk file.
Time, date, voltage, monophasic/biphasic button setting, pulse
width, time between pulses, clock frequency, IR exit temp, elapsed
time, er pulse delay, er pulse number, and up to ten sets of pulse
voltage and pulse current displays. One pulse burst is saved every
minute for up to a total of ten minutes. Temperature/voltage This
button allows the user to calibrate the cooler, voltage waveforms,
and User click on button calibration fluid outlet IR sensor. The
form is divided into two sections. The upper section is used for
the calibration of the various temperature measurement channels.
For each temperature channel, four values are required. The two-
point calibration method uses an independently measured High and
Low temperature value along with a corresponding set of digital
outputs from the system A/D converter. The digital values can be
read by means of he "Display New Temperature Count" button in the
center bottom of the form. These count values can be manually
inserted into the Temperature count window for the given condition.
VB text windows in the lower section of the form contain the
current set calibration constants for the non-temperature section
of the program. These values can be edited directly as needed. When
the "Exit and Save (Calibration Values and Display Constants)"
button is depressed all of the current calibration values are
passed on to the VB program and stored in the disk calibration
file. This form is password- protected.
[0202] The system software provides the user complete control of
all parameters influencing electroporation. The user may only
manipulate the high voltage and the set cooler temperature. All
other parameters are fixed to the optimized red blood cell (RBC)
parameters. Once the run begins, pulsing parameters will freeze and
appear dimmer. The remaining enabled controls are pushbuttons to
begin and end the pulsing, pump motion, and release of the pinch
valves. If the user enters a value for high voltage beyond the
capability of the system, the GUI will ask the user to input a
number in a given range. The voltage and current traces on the GUI
keep the user informed in real time of the waveform being delivered
to the sample. These traces also display a cumulative plot of the
peak voltages and currents over the period of the run. At the end
of the run, the user can chose to save data to a designated
location. Plots of this data can be generated to determine the
consistency of the waveform the sample was subjected to over the
period of the run.
[0203] In addition to input parameters and traces, the GUI also
displays real time information on the temperature of the cooler,
the temperature of the sample, and the time elapsed. The watchdog
is continually displayed as a redundant note to the user that the
system is powered. Although the current system lacks an internal
diagnostic system, a few simple diagnostics are implemented to
increase the awareness of the system. The system can determine if
the disposable set is attached properly and will display "Flow Cell
Attached" in red text on the GUI when it is attached. Also during
pulsing, should the sample reach a temperature that could
potentially damage the sample, the system will notify the user via
the GUI and discontinue the application of the electric field.
[0204] FIG. 8 is a photograph taken of the GUI during an RBC run.
The parameters are dimmed and the traces show the conditions the
sample is being subjected to. Table 4 below gives a general
overview of the described displays.
TABLE-US-00004 TABLE 4 GUI Displays ITEM DESCRIPTION Fluid exit The
display shown on the PC monitor shows an unsigned integer
representing the temperature, in degrees Celsius, as temperature
measured by an infrared temperature sensor located at the top of
the instrument. When a disposable is attached, the outlet tubing is
inserted in the slot on the sensor so that the passing fluid
temperature can be monitored. Degrees are displayed to 0.1 degrees
Celsius. Accuracy is approximately +/-2.degree. C. If the fluid
exit temp is between 35-40.degree. C. the user will be warned
through the GUI by displaying a "Temp is above limit" message. If
the temperature exceeds 40.degree. C. the same message will be
displayed and the high voltage pulsing will stop. If the
temperature is between 5.degree. C.-10.degree. C. the user will be
warned through the GUI by displaying a "Temp is below limit"
message. If the temperature falls below 5.degree. C. the same
message will be displayed and the high voltage pump will stop.
Timer display THIS DISPLAY SHOWS THE TIME THAT HAS ELAPSED SINCE
THE LAST TIME THE PULSE ON BUTTON WAS DEPRESSED. THE TIME IS
FORMATTED TO GIVE READINGS EVERY 0.1 SECONDS. The timer display
freezes at the current value if the system high voltage pulsing is
OFF, or the ON/OFF rocker switch on the system switched to the OFF
position. Flow cell This indicator on the GUI labeled "Flow cell
attached" signals the user that the flow cell micro-switch has been
attached activated and power is available to the high voltage power
supply whenever the ON button in the pulse parameter display
section of the GUI is pressed. When the flow cell is attached the
text will turn red. When the flow cell is not properly attached the
display will turn a green color and read "FLOW CELL NOT ATTACHED".
Color This indicator of the GUI displays the actual temperature as
measure by the platinum sensor applied to the cooling measured
plate. This display is next to the cooler set point. The actual
temperature is automatically adjusted via the system temperature
controls and Peltier cooler until it equals the set temperature.
display Watchdog This indicator on the GUI displays and alternating
alphanumeric display. This display toggles between "0" and "X". The
software employs a "WATCHDOG" that generates a square wave signal.
With the exception of the external digital logic elements, power is
only supplied to the circuitry external to the computer when the
square wave signal is detected. Should the visual basic program
crash due to power failure or other reason, the required square
wave will not be generated and power to the external circuits
including the high voltage supply will be disabled. The watchdog
enables the system to properly initialize all of the KPCI-3104
systems prior to the system being powered. Pulsing The word
"Pulsing will appear in red lettering on the GUI when high voltage
pulses are being delivered notification
Flow Electroporation System Software Description
[0205] The software program employed in the new FES is written in
Microsoft Visual Basic (VB), Version 6. The required computer
operating system is Microsoft Windows NT, with Service Pack4 (at a
minimum). With the exception of the CAVRO pump, the computer is
interfaced to the hardware electronics by means of a Keithley
instrument -3104 Data Acquisition and Control card that plugs into
a PCI slot in the computer. This interface board allows for analog
and digital input and output, as well as counter timers used for
computer-controlled pulse generation. Keithley also supplies a VB
software driver (DriverLINX). The version of this driver was
selected specifically for Windows NT. The computer should operate
at least 200 MHz with at least 64 Megabytes of RAM and must have at
least one PCI slot.
[0206] The CAVRO pump is controlled through a COM port on the
computer using a VB command syntax provided by the
manufacturer.
Program Overview
[0207] A fundamental concept of the FES is that system operations,
with the exception of an electronics AC power ON/OFF switch, are
all controlled from the GUI using mouse clicks and keyboard
entries.
[0208] Due to the high voltages often associated with
electroporation, the AC power to the electronics is placed under
the control of a watchdog system. The watchdog includes a VB module
that generates a continuous series of pulses on one bit of a
digital output port. An analog circuit that enables the AC power
for the electronics portion of the FES detects these pulses. Since
these pulses are only generated by the FES VB program, the AC power
is only enabled while the program is running. Should the computer
crash, or the program be stopped for any reason, the AC power to
the electronics is terminated.
[0209] The VB program is divided into the following five major
parts (described in greater detail below): 1) Sub Main Start Up
Calls (Module 1); 2) Temperature Measurement and Control; 3) CAVRO
Pump Initialization and Control; 4) Modular Pulse Generation; and
5) Analog and Collect Plot Data.
Sub Main Start-Up Calls
[0210] This section of the program begins the process by presetting
and computing variables, initializing the KPCI-3104 card and its
subsystems, starting the watchdog, and initializing the CAVRO
pump.
[0211] As can be seen in FIG. 6, the sub main calls up a series of
sub routines at the beginning of the program as soon as the program
is started. The first action is to compute a set of temperature
variables. To compute the temperature variables it is necessary to
download the appropriate calibration constants from a disk file.
The electronics for the system is designed with only one analog
control; consequently, the analog voltages need to be scaled for
accuracy by means of constants stored on the hard disk of each
system. By storing the constants in this manner, it is possible to
upgrade the software in many systems with only one version of the
code. It is also necessary to preset many of the variables and
conditions prior to the start of the main program.
[0212] Following this process, a generalized initialization of the
KPCI-3104 card is performed, followed by a more specific
initialization of each of the KPCI-3104 subsystems. The shorter
subsystem initializations are required any time the Keithley
subsystem is used for a different task. The KPCI-3104 card has four
different subsystems. Each subsystem is set up as a separate
control in VB so that they can be reinitialized separately when
their functions are changed. This is particularly important for the
Analog Input (AI) subsystem as it is used for collecting pulse
trace data at high speed using one set of channels and then
reconfigured to collect low speed data for temperature measurements
with another set of channels.
[0213] Two VB Timers are used in the "Start Up" portion of the
program. The first timer, Timer 2 is used to generate the pulses
needed for the watchdog signal. This timer runs continuously and
with every clock cycle, the digital output (bit(0) of Port(C)), is
cycled between a "one" and a "zero". An analog circuit located in
the "Electronics" portion of the system then detects this square
wave signal. Upon detection, a TTL level signal is sent to a
solid-state relay that controls the 110 V AC power to the
"Electronics" portion of the system. A second VB Timer is used to
delay the initialization of the CAVRO pump until after the watchdog
has completed its task.
Temperature Measurement and Control
[0214] This section of the software runs the IR and RTD
(temperature control module) temperature measurements.
Additionally, the RTD data is used to control the temperature of
the thermal cooling system. This part of the program runs
continuously; however, the control temperature may be changed
through the GUI.
[0215] The Temperature Measurement and Control system is depicted
in FIG. 7. After the various systems are initialized, VB Timer 5 is
enabled. This timer is configured to continuously cycle every five
seconds. At the end of each five-second period, it causes the IR
temperature to be measured, the cooler temperature to be measured,
it starts Timer 6 and then turns on the cooler system. The fraction
of the next five-second cycle that the cooler remains on depends
upon the difference between the "Desired Cold Temp" and the
"Measured Cooler Temp". This system operates continuously while the
main program is running.
CAVRO Pump Initialization and Control
[0216] This section enables the operator to control the CAVRO pump
from the keyboard without involving the KPCI-3104 card. A
significant aspect of this section is that the CAVRO pump can only
be initialized after the watchdog has had sufficient time to
provide power to the pump.
[0217] As shown in FIG. 6, the "Start Up Sub Main" module also
starts VB Timer 7, which is used to delay the initialization of the
CAVRO pump and the COM1 port on the computer. The delay time is
sufficient for the watchdog to permit power to the "Electronics".
This same power is supplied to the CAVRO pump. The pump requires
power to be initialized. The pump is controlled from the keyboard
using the COM1 Port.
Modulator Pulse Generation
[0218] This section of the program controls the timing of the
pulses that are sent to the high voltage modulator switches. The
switches allow the designated high voltage to be coupled to the
electroporation flow cell.
[0219] FIG. 9 consists of a flow chart for the generation of the
pulse timing and selection of pulses for the system. The
Keithley-3104 card contains four independent Counter Timers (CT).
These timers are capable of generating TTL level "Clock" pulses of
the proper width and spacing as requested from the keyboard. These
pulses are generated continuously until the counter subsystem is
reinitialized. CT (3) pulses are used to gate the pulses from CT
(0) and CT (1) in "Digital Logic". The timing of the CT (3) gating
pulse is determined in software by the number of modulator pulses
desired. The fourth and last CT Timer is used to control the timing
of an "Energy Reduction" pulse. A second set modulator switches are
used to impose a restive load to rapidly reduce the high Voltage
during a series of electroporation pulses. These switches are also
used to discharge the capacitor bank when the high voltage is not
needed.
Analog Collect and Plot Data
[0220] This section of the program addresses the synchronized
collection of high voltage/current data of the pulses applied to
the electroporation flow cell. The data is collected by the A/D
converter located on the KPCI-3104 card synchronized with the pulse
generation of the CT without interfering with their operation.
[0221] In FIG. 10, "bursts" of "modulator pulses" are used to
trigger the "analog collect" sub routine. It is important to note
that although initiation of the analog data collection of voltage
and current pulses in the "Electroporation Flow Cell" are triggered
by the modulator pulses, the two subsystems operate independently
of each other. The same AI subsystem is employed for both the
temperature and modulator pulse measurements. The sub routines
controlling each AI function set flags, which prevent interference
between the two systems. Prior to the generation of the "burst" of
modulator pulses, the AI subsystem is initialized for high-speed
data collection. Coincident with the first pulse in the "burst,"
the AI subsystem is triggered and data is collected into an array
that was established in the AI initialization process. Timer 3
causes a time delay to insure all data is collected into the buffer
prior to the plotting of the data on the GUI screen. One set of
"Plot Data" is saved in an array every minute for up to twenty
minutes. This data may be saved to hard disk if desired at the end
of the electroporation procedure.
Disposable Set
[0222] The disposable set is composed of PVC bags, PVC tubing,
connectors, silicone pump tubing, and a flow cell (see Table 5
below). All plastic components contacting blood are Medical Grade
Class VI materials.
TABLE-US-00005 TABLE 5 Components of Disposable Set CONTACTS BLOOD
DESCRIPTION MATERIAL PATH CLASSIFICATION VENDOR Electrode gasket
Platinum cured silicone Yes USP XXII Class VI Amermold Electrodes
Iron (Low Carbon Flat No NPI Stock - AISI Type C 1018)
Polycarbonate Plate Polycarbonate Yes USP XXI Class VI Medsource
Technologies Polycarbonate Polycarbonate No USP XXI Class VI
Medsource retainer Technologies Electroplating on 100 microinches
pure gold Yes AVM Plating electrode surface 14.7'' PVC Tubing PVC
Yes Baxter 7.7'' PVC Tubing PVC Yes Baxter Polycarbonate Y
Polycarbonate Yes USP Class VI Value Plastics tubing connector
Polycarbonate pump Polycarbonate Yes USP Class VI Value Plastics
tubing connector 4.7'' medical grade Silicone Yes USP Class VI New
Age Tech. silicon pump tubing- 0.104'' ID .times. 0.192'' OD 1.7''
PVC Tubing PVC Yes Baxter 15'' PVC w/ 150 mL PVC Yes Baxter
transfer Bag 16.5'' PVC w/ 150 mL PVC Yes Baxter transfer Bag
[0223] FIG. 11 illustrates an "exploded" view of the flow cell. The
flow cell (also shown in FIG. 15) consists of two low carbon steel
(99+% Iron) electrodes electroplated with approximately 100
.mu.inches of Pure Gold (99.9%). Part of the quality control
process specifies that the electrodes are straight to within 77
.mu.m over their entire length. When the electrodes are placed in
parallel, there is a maximum deviation in distance between bar
electrodes of 154 .mu.m. During the Disposable Set assembly
process, the electrodes are inserted into the electrode gasket,
which is then sandwiched between the retainer and plate. The
nominal gap between the parallel bar electrodes is 2 mm. When the
disposable set is in use, approximately 750 Volts is applied across
the electrodes, resulting in an applied electric field of
approximately 3.7 kV/cm. Control of electrode position and
straightness dictates that the field strength may vary by only 7.5%
or 0.27 kV/cm. The flow cell holds a volume of approximately 1.6
mL.
[0224] There are four bags attached to the disposable set (150 ml
Baxter Transfer Sets). The first bag is called the Prime Bag. This
bag contains saline that is pumped from the bag, around the pump,
through the flow cell, and into the waste bag. The purpose of the
prime bag is to remove air and any particulates that may be in the
tubing or flow cell. The second bag, called the Sample Bag,
contains the cell suspension plus the IHP that will be inserted
into the cell via the electroporation process. Each of these bags
is connected to PVC tubing lines that pass through designated pinch
valves.
[0225] The outlet port of the flow cell also has two bags attached,
one of which is called the waste bag. This bag holds the priming
fluid and a small volume of the sample after they have passed
through the flow cell. The last bag is called the product bag,
which holds the red blood cells that have been subject to the flow
electroporation process with the IHP molecule. Again, there are
pinch valves designated for each of these valves to prevent mixing
of bag contents.
Alternative Flow Electroporation Cell Assembly
[0226] The alternative flow electroporation cell assembly is
another embodiment of a flow cell that can be used in the present
invention. This embodiment is easy to manufacture and is relatively
inexpensive.
[0227] Referring now to the figures wherein like reference numerals
represent the same or equivalent features throughout the figures,
the present invention includes a flow electroporation cell assembly
as shown, for instance, in FIG. 13. According to the present
invention, selectively fractionated biological units such as blood
cells or platelets are introduced from an exterior source into a
flow electroporation cell assembly, where the biological units are
subjected to electroporation in the presence of a biological or
chemical vector, causing the vector to enter transiently opened
pores in the encapsulating membranes of the biological units. Once
the desired electroporation effect is achieved, the biological
units are moved exterior to the flow electroporation cell assembly
to permit further handling of the treated units and electroporation
of incoming, untreated units. A detailed description of the
structure and construction of the flow electroporation cell
assembly according to one embodiment of the present invention is
provided below.
[0228] The present invention is a flow electroporation apparatus
for electrical treatment of suspensions of particles, especially
including living cells, comprising a flow electroporation cell
assembly having one or more inlet flow portals, one or more outlet
flow portals, and one or more flow channels, the flow channels
being comprised of two or more walls, with the flow channels
further being configured to receive and transiently contain a
continuous flow of particles in suspension from the inlet flow
portals; and paired electrodes disposed in relation to the flow
channels such that each electrode forms at least one wall of the
flow channels, the electrodes further comprising placing the
electrodes in electrical communication with a source of electrical
energy, whereby suspensions of particles flowing through the
channels may be subjected to an electrical field formed between the
electrodes.
[0229] As shown in FIG. 13, a flow electroporation cell assembly
100 may be constructed of two opposing electrode plates 10.
Typically, the electrode plates 10 may be constructed of iron,
steel, copper, aluminum, or other electrically conductive metals or
metal alloys. The electrode plates 10 may further be coated with
gold, platinum, zinc, carbon, or other plating materials to enhance
their electrical conductivity. Each electrode plate 10 may be
provided with one or more electrical terminals 15 that interface
with the power supply circuitry of the overall flow electroporation
system. In alternate embodiments, one or both of the opposing
electrode plates 10 may further be provided with an interface
having a cooling element 20. The cooling element 20 may be a
thermoelectric cooling element, or may provide cooling by direct
water or other coolant contact, by ventilation through a heat sink,
or other cooling means to dissipate heat generated in the
electroporation process, which is typically an exothermic
process.
[0230] Referring still to FIG. 13, the electrode plates 10 may
typically be separated by one or more electrode gap spacers 30. The
thickness of the electrode gap spacers 30 will define and fix a gap
33 between the electrodes 10. The gap 33 between the electrodes 10
can easily be adjusted to any desired measurement simply by
changing the gap spacers 30. The thickness of one such gap 33 will
vary depending on the flow volume and field strength, but will
generally be greater than 3 mm, preferably approximately 0.01 mm to
approximately 2 cm, especially preferably approximately 0.1 mm to 1
cm. It is also preferred that the gap 33 be greater than 3 mm,
preferably about 4 mm to about 2 cm, especially about 5 mm to about
1 cm. It is also desirable that the ratio of the combined surface
area of the two electrode plates 10 in contact with buffer
contained in the cell assembly 100 to the distance between the two
electrode plates is approximately 1 to 40; preferably approximately
1 to 50, more preferably approximately 1 to 60, more preferably
approximately 1 to 70, more preferably approximately 1 to 80, more
preferably approximately 1 to 90, more preferably approximately 1
to 100. For example, if the two electrode plates 10 have a combined
surface area of approximate 5 cm.sup.2 then the distance between
the electrode plates should be approximately 0.2 cm and therefore
the ratio of the combined surface area to the distance between
electrodes should be 5 cm.sup.2*2/0.2 cm=50 cm.
[0231] The electrode gap spacers 30 are typically constructed of an
electrically insulating material, and may be fashioned from such
materials as plastic, ceramic, rubber, or other non-conductive
polymeric materials or other materials.
[0232] Also in another embodiment of the present invention as shown
in FIG. 14, a gasket 35 containing a flow channel 40 may be
positioned between the electrode plates 10, with the thickness of
the gasket 35 equal to the thickness of the electrode gap spacers
30. The gasket 35 typically forms a seal with the opposing
electrode plates 10. The gasket 35 may be constructed of silicone,
other synthetic or natural rubbers or other polymers, or other
electrically non-conductive materials. Integral within the gasket
35, one or more flow channels 40 is provided. The flow channel 40
is defined by a channel or other cutout within the gasket 35. The
size and shape of the flow channel 40 is proportional to the size
and shape of the electrode plates 10.
[0233] In one embodiment of the flow electroporation cell assembly
according to the present invention as shown in FIG. 14, the
electrode plates 10 may contain one or more portal bores 45. Each
portal bore 45 may further contain either a flow inlet portal 50 or
a flow outlet portal 55, which serve to connect to and interface
with the respective inflow/outflow transport pathways of the
overall flow electroporation system.
[0234] In one embodiment of the flow electroporation cell assembly
according to the present invention, the electrode plates 10 and
electrode gap spacers 30 may also contain one or more attachment
means to allow their secure assembly. In various embodiments of the
present invention, the attachment means 60 may include fasteners
such as screws, rivets, rods, or clips which may be employed to
secure the desired positions of the electrode plates 10 with the
gasket 35 and flow channel 40 interposed therewithin. In still
other alternate embodiments of the electroporation flow cell
assembly 100 according to the present invention, the attachment
means 60 may be secured by adhesives, other bonding techniques, or
encapsulation.
[0235] In yet another embodiment as shown in FIG. 15, the
attachment means 60 may be an attachment bore, sized and positioned
to receive bolts 65. Such bolts 65 may be directly placed through
the attachment bores 60, or may be received within plate bushings
70, and the bolts may be secured by nuts 75 that serve to secure
the flow electroporation cell assembly 100. In embodiments that
employ conductive electrode gap spacers 30, electrical insulation
of the opposing plate electrodes 10 may be achieved by the use of
insulating plate bushings 70.
[0236] In various embodiments of the flow electroporation cell
assembly according to the present invention, each flow
electroporation cell assembly 100 may contain a single flow channel
40 or a plurality of flow channels 40 oriented between the opposing
electrode plates 10, as shown in FIG. 16. When desirable, multiple
flow channels 40 may be provided to achieve more rapid, higher
volume electroporation treatment. The term electroporation region
as used herein means that portion of the flow channel 40 in which
material flowing therethrough is exposed to an electric field of
sufficient strength to affect electroporation. In accordance with
the present invention, it is desirable that the two opposed
electrode plates 10 that define at least a portion of the opposed
walls of the electroporation region of the flow channel form a
substantial portion of those opposed walls in the electroporation
region. As used herein the term substantial portion shall mean
greater than approximately 50%; preferably greater than
approximately 60%, more preferably greater than approximately 70%,
more preferably greater than approximately 80%, more preferably
greater than approximately 90%, most preferably approximately
100%.
[0237] In an alternate preferred embodiment of the present
invention as shown in FIG. 17, a non-planar electrode flow cell
array 105 may be used. In an exemplary embodiment, concentric
tubular electrodes 110 may be employed. The tubular electrodes
typically have concentric insulating spacers 115 utilized to
maintain the desired gap space 33. In such an embodiment, the space
between the electrodes could also serve as a flow channel 120, with
one or more inlet flow portals 125 and outlet flow portals 130
provided either through the outermost tubular electrode wall 135,
or through one or both ends of the tubular electrodes 110. In
various embodiments according to the present invention, such a
tubular electrode flow cell array 105 could be used singularly, or
with a plurality of similar tubular electrode flow cell arrays 105
operating in either parallel or serial function.
[0238] Preferably, the flow electroporation cell assembly 100 may
be provided as a sterile unit for disposable, single-use
applications. The components of the flow electroporation cell
assembly 100 may thus preferably be constructed of materials
capable of withstanding sterilization procedures, such as
autoclaving, irradiation, or chemical sterilization.
[0239] With reference to FIGS. 27-29, there is also disclosed an
alternate embodiment for the electroporation cell of the present
invention. As shown in FIG. 27, a flow electroporation cell
assembly 200 may be constructed of two opposing electrode plates
210. Typically, the electrode plates 210 may be constructed of
iron, steel, copper, aluminum, or other electrically conductive
metals or metal alloys. The electrode plates 210 may further be
coated with gold, platinum, zinc, carbon, or other plating
materials to enhance their electrical conductivity. Each electrode
plate 210 may be provided with one or more electrical terminals
(not shown) that interface with the power supply circuitry of the
overall flow electroporation system. In alternate embodiments, one
or both of the opposing electrode plates 210 may further be
provided with an interface having a cooling element (not shown).
The cooling element may be a thermoelectric cooling element, or may
provide cooling by direct water or other coolant contact, by
ventilation through a heat sink, or other cooling means to
dissipate heat generated in the electroporation process, which is
typically an exothermic process.
[0240] Referring still to FIG. 27, the electrode plates 210 may
typically be separated by one or more electrode gap spacers 230.
The thickness of the electrode gap spacers 230 will define and fix
a gap 233 between the electrodes 210. The gap 233 between the
electrodes 210 can easily be adjusted to any desired measurement
simply by changing the electrode gap spacer 230. The thickness of
one such gap 233 will vary depending on the flow volume and field
strength, but will typically be from approximately 4.0 mm to
approximately 2 cm, preferably 5.0 mm to 1.5 cm, most preferable
approximately 1 cm. The electrode gap spacers 230 are typically
constructed of an electrically insulating material, and may be
fashioned from such materials as plastic, ceramic, rubber, or other
non-conductive polymeric materials or other materials.
[0241] As shown in FIG. 27, a gasket 235 containing a flow channel
240 may be positioned between the electrode plates 210, with the
thickness of the gasket 235 equal to the thickness of the electrode
gap spacers 230. The gasket 235 typically forms a seal with the
opposing electrode plates 210. The gasket 235 may be constructed of
silicone, other synthetic or natural rubbers or other polymers, or
other electrically non-conductive materials. Integral within the
gasket 235, one or more flow channels 240 is provided. The flow
channel 240 is defined by a channel or other cutout within the
gasket 235 and by the upper and lower electrode plates 210, as
shown in FIG. 28.
[0242] As shown in FIGS. 27-29, the shape of the flow channel 240
is rectangular in cross-section; i.e., the height (FIG. 28) is
approximately equal to the width (FIG. 29). As explained above, the
electrode gap spacers 230 establish the distance between the
electrode plates 210, which is equal to the height of the flow
channel 240. Thus, the height and width of the flow channel 240 are
approximately 2.0 mm to approximately 2 cm, preferably
approximately 5.0 mm to 1 mm, most preferable approximately 3.0 to
5.0 mm. The length of the flow channel 240 is approximately 5 mm to
5 cm, preferably approximately 1.0 cm to 3.0 cm, most preferable
approximately 2.5 cm. The dimensions of the electroporation flow
cell shown in FIGS. 27-29 is an electrode length of approximately
0.45 cm, and electrode width of approximately 2.5 cm and an
electrode gap of approximately 0.5 cm. This produces a thermal
resistance of approximately 37.degree. C./Watt.
[0243] The height of the flow channel 240 is also such that the
biological material, such as cells, that passes through the flow
channel is not thermally degraded thereby. Not being substantially
thermally degraded, as used herein, means that cells passing
through the flow channel are subjected to a minimal amount of heat
energy such that the desired expression vector is inserted into at
least 50% of the cells passing through the flow channel, whereby
that the cells will produce the desired protein or peptide. For any
electroporation device, the passage of electrical current through
the cells and the fluid in which they are suspended will generate
heat within the cells and the fluid as the cells and fluid act as a
resistor. This heating is described by Joule's Law, a well-known
Law of Physics. The degree of heating is dependent on the geometry
of the electroporation chamber and the materials used in its
fabrication. As excessive heating of cells can be damaging,
limitation of heating during electroporation is desirable. The
degree of heating as a function of the power applied to the
electroporation chamber is referred to herein as heat resistance or
thermal resistance. In one embodiment of the flow electroporation
cell assembly according to the present invention as shown in FIG.
27, the upper electrode plate 210 may contain two or more portal
bores 245. Each portal bore 245 may further contain either a flow
inlet portal 250 or a flow outlet portal 255, which serve to
connect to and interface with the respective inflow/outflow
transport pathways of the overall flow electroporation system.
[0244] In one embodiment of the flow electroporation cell assembly
according to the present invention, the electrode plates 210 and
electrode gap spacers 230 may also contain one or more attachment
means to allow their secure assembly. In various embodiments of the
present invention, the attachment means 260 may include fasteners
such as screws, rivets, rods, or clips which may be employed to
secure the desired positions of the electrode plates 210 with the
electrode gap spacer 230 and flow channel 240 interposed
therewithin. In still other alternate embodiments of the
electroporation flow cell assembly 200 according to the present
invention, the attachment means 260 may be secured by adhesives,
other bonding techniques, or encapsulation.
[0245] In yet another embodiment as shown in FIG. 27, the
attachment means 260 may be an attachment bore, sized and
positioned to receive bolts 265. Such bolts 265 may be directly
placed through the attachment bores 260, or may be received within
plate bushings 270, and the bolts may be secured by nuts (not
shown) which serve to secure the flow electroporation cell assembly
200. Electrical insulation of the opposing plate electrodes 210 is
desired and may be achieved by the use of insulating plate bushings
270.
[0246] In various embodiments of the flow electroporation cell
assembly according to the present invention, each flow
electroporation cell assembly 200 may contain a single flow channel
240 or a plurality of flow channels (not shown) oriented between
the opposing electrode plates 210. When desirable, multiple flow
channels may be provided to achieve more rapid, higher volume
electroporation treatment.
[0247] With reference to FIGS. 30A-30F, there is also disclosed an
alternate embodiment for the electroporation cell of the present
invention. As shown in FIG. 30A, a flow electroporation cell
assembly 300 may be constructed of two opposing electrode plates
310. Typically, the electrode plates 310 may be constructed of
iron, steel, copper, aluminum, or other electrically conductive
metals or metal alloys. The electrode plates 310 may further be
coated with gold, platinum, zinc, carbon, or other plating
materials to enhance their electrical conductivity. Each electrode
plate 310 may be provided with one or more electrical terminals 320
that interface with the power supply circuitry of the overall flow
electroporation system. In alternate embodiments, one or both of
the opposing electrode plates 310 may further be provided with an
interface having a cooling element (not shown) as described
above.
[0248] Referring still to FIG. 30A, the electrode plates 310 are
separated by three electrode gap spacers 330, 332, 334. The
thickness of the electrode gap spacers 330-334 will define and fix
a gap 336 between the electrodes 310. The gap 336 between the
electrodes 310 can easily be adjusted to any desired measurement
simply by changing the electrode gap spacers 330-334. The electrode
gap spacers 330-334 are typically constructed of an electrically
insulating material, and may be fashioned from such materials as
plastic, ceramic, rubber, or other non-conductive polymeric
materials or other materials.
[0249] Each of the electrode gap spacers 330-334 defines a well
340, 342, 344, respectively. Each of the electrode gap spacers
330-334 also defines fluid inlets 350, 352, 354, respectively. The
fluid inlets 350-354 permit fluid communication with the wells
340-344, respectively. Each of the electrode gap spacers 330-334
also defines fluid outlets 360, 262 and 364. The fluid outlets
360-364 permit fluid communication with the wells 340-344,
respectively.
[0250] Interposed between the spacer 330 and the spacer 332 is a
porous membrane 370. Interposed between the spacer 332 and the
spacer 334 is another porous membrane 372. The porous membrane 570,
572 are made of a non-reactive material and has pore sizes that
permit fluid to pass therethrough, but not materials that are being
electroporated, such as cells.
[0251] Only the central sample well 342 is to contain material for
electroporation, such as a suspension of particles, such as cells
and expression vectors, while the side wells 340, 344 are filled
with buffer or some other conductive fluid. In this case the
central sample well 342 is still in electric contact with the
electrodes 320 but the cells are kept far from the electrode
surfaces, so that migration of metal from the electrodes does not
affect the cells. During electroporation, gas bubbles are also
formed at the electrode 320 surfaces. By isolating the cell
suspension in the central sample well 342 and providing buffer in
the outer wells 340, 344, the electrode bubbles remain in the outer
sample wells and do not interact with the cells in the central
sample well. Higher liquid flow rates can also be used in the outer
wells 340, 344 so that gas bubbles formed at the electrodes 310 are
more efficiently removed. Using the porous membranes 370, 372
serves the purpose to prevent mixing of buffer layers adjacent to
electrodes 310 with the bulk of cell suspension, and keeps metal
ions localized in the pores.
[0252] With reference to FIGS. 31A-31B, there is also disclosed an
alternate embodiment for a static electroporation cell of the
present invention. As shown in FIG. 31A, a static electroporation
cell assembly 400 may be constructed of two opposing electrode
plates 410. The electrode plates 410 may be constructed of iron,
steel, copper, aluminum, or other electrically conductive metals or
metal alloys. The electrode plates 410 may further be coated with
gold, platinum, zinc, carbon, or other plating materials to enhance
their electrical conductivity. Each electrode plate 410 may be
provided with one or more electrical terminals 420 that interface
with the power supply circuitry of the overall flow electroporation
system.
[0253] The electrode plates 410 are separated by an electrode gap
spacer 430. The thickness of the electrode gap spacer 430 will
define and fix a gap 432 between the electrodes 410. The gap 432
between the electrodes 410 can easily be adjusted to any desired
measurement simply by changing the electrode gap spacer 430. The
electrode gap spacer 430 is typically constructed of an
electrically insulating material, and may be fashioned from such
materials as plastic, ceramic, rubber, or other non-conductive
polymeric materials or other materials.
[0254] The electrode gap spacer 430 defines a sample channel 440
therein. The sample channel 440 is designed to contain material for
electroporation, such as a suspension of particles, such as cells
and an expression vector. The height and width of the sample
channel 440 is approximately 2.0 mm to approximately 1 cm,
preferably approximately 2.0 mm to 5 mm, most preferable
approximately 3.0 to 5.0 mm. The length of the flow channel 440 is
approximately 5 mm to 5 cm, preferably approximately 1.0 cm to 3.0
cm, most preferable approximately 1.2 cm. For the static
electroporation cell in FIGS. 31A-31B, the electrode length is
approximately 0.2 cm, the electrode width is approximately 0.45 cm
and the electrode gap is approximately 1.2 cm.
[0255] With reference to FIGS. 32A-32D, there is also disclosed an
alternate embodiment for a static electroporation cell of the
present invention. As shown in FIG. 32A, a static electroporation
cell assembly 500 may be constructed of two opposing electrode
plates 510. The electrode plates 510 may be constructed of iron,
steel, copper, aluminum, or other electrically conductive metals or
metal alloys. The electrode plates 510 may further be coated with
gold, platinum, zinc, carbon, or other plating materials to enhance
their electrical conductivity. Each electrode plate 510 may be
provided with one or more electrical terminals 520 that interface
with the power supply circuitry of the overall flow electroporation
system.
[0256] The electrode plates 510 are separated by three electrode
gap spacers 530, 532, 534. The thickness of the electrode gap
spacers 530-534 will define and fix a gap 536 between the
electrodes 510. The gap 536 between the electrodes 510 can easily
be adjusted to any desired measurement simply by changing the
electrode gap spacers 530-534. The electrode gap spacers 530-534
are typically constructed of an electrically insulating material,
and may be fashioned from such materials as plastic, ceramic,
rubber, or other non-conductive polymeric materials or other
materials.
[0257] Each of the electrode gap spacers 530-534 defines a sample
channel 540, 542, 544, respectively, therein. Interposed between
the spacer 530 and the spacer 532 is a porous membrane 570.
Interposed between the spacer 532 and the spacer 534 is another
porous membrane 572. The porous membranes 570, 572 are made of a
non-reactive material and has pore sizes that permit fluid to pass
therethrough, but not materials that are being electroporated, such
as cells.
[0258] Only the central sample channel 542 is designed to contain
material for electroporation, such as a suspension of particles,
such as cells and an expression vector, while the side wells 540,
544 are filled with buffer or some other conductive fluid. In this
case the central sample channel 542 is still in electric contact
with the electrodes 520 but the cells are kept far from the
electrode surfaces, so that migration of metal from the electrodes
does not affect the cells. During electroporation, gas bubbles are.
also formed at the electrode 520 surfaces. By isolating the cell
suspension in the central sample channel 542 and providing buffer
in the outer channels 540, 544, the electrode bubbles remain in the
outer sample channels and do not interact with the cells in the
central sample channel. Using the porous membranes 570, 572 serves
the purpose to prevent mixing of buffer layers adjacent to
electrodes 510 with the bulk of cell suspension, and keeps metal
ions localized in the pores.
[0259] Suitable materials for use in any of the apparatus
components as described herein include materials that are
biocompatible, approved for medical applications that involve
contact with internal body fluids, and should meet US PV1 or ISO
10993 standards. Further the materials will not substantially
degrade, from for instance, exposure to the solvents used in the
present invention, during at least a single use. The materials are
typically sterilizable either by radiation or ethylene oxide (EtO)
sterilization. Such suitable materials include materials that are
extrudable if, for instance, used for tubing, and/or injection
moldable if, for instance, used for hard containers. Materials
useful to form the various components of the apparatus according to
the present invention include, but are not limited to, nylon,
polypropylene, polycarbonate, acrylic, polysulphone, polyvinylidene
fluoride (PVDF), fluoroelastomers such as VITON, available from
DuPont Dow Elastomers L.L.C., thermoplastic elastomers such as
SANTOPRENE, available from Monsanto, polyurethane, polyvinyl
chloride (PVC), polytetrafluoroethylene (PTFE), polyphenylene ether
(PFE), perfluoroalkoxy copolymer (PFA) available as TEFLON PFA from
E.I. du Pont de Nemours and Company, and combinations thereof.
[0260] In many cases it is important to refer to the throughput of
electroporation process, or the amount of cell suspension processed
in certain amount of time. Since it takes certain amount of energy
to electroporate a unit of volume of cell suspension, the more
volumetric units is processed in a given time, the more energy in
the same time is consumed. Therefore, the speed, or the throughput,
of a process can be unequivocally defined as the rate of energy
consumption, or power, which is defined as the ratio of energy to
time:
P = Q t ##EQU00001##
[0261] It can be shown that big amount of heat is normally produced
as a side effect of practically every electroporation process, what
may cause irreversible damage to biologic material or live cells.
Every electric field pulse can cause unwanted warming up of cell
suspension by 20-30 degrees Celsius. To avoid or minimize this
effect, cooling is often applied to suspensions of cells being
electroporated, especially in the continuous; i.e., flow
electroporation, processes.
[0262] However, while the cooling is usually provided by bringing
cell suspension in immediate contact with metal parts which are in
their turn being cooled by Peltier elements or by flow of air or
fluid, some principal limitations to the cooling process exist. In
many cases the designers of electroporation process either neglect
or overlook the fact that thermal conductivity of metal is much
higher that the one of water (or biological buffer), what means
that transfer of heat from the flow channel to the cooling unit is
always limited by the heat conductivity of water or, equivalently,
the cell suspension itself. In such situation it is important to
choose the proper geometry of the flow channel so that heat
transfer is accomplished in the most efficient way. A
straightforward derivation of the necessary parameters of an
optimal design are shown below.
[0263] From the analysis of the heat flow equation:
Q = kA .DELTA. T .DELTA. x t ##EQU00002##
[0264] where k is thermal conductivity of water [0.0061 W K.sup.-1
cm.sup.-1] [0265] A is surface area of one electrode [0266]
.DELTA.T is the difference in temperature between the buffer and
cooler [0267] .DELTA.x is distance the heat has to travel inside
the channel (one-half of the channel width, since the temperature
of buffer is highest in the center of the channel or
electroporation chamber) one can derive an important parameter
called the thermal resistance .THETA. of the flow cell:
[0267] .THETA. = .DELTA. T t Q = .DELTA. x kA = 1 2 w kA
##EQU00003##
[0268] where w is the gap between electrodes.
[0269] This expression shows that thermal resistance is
proportional to the width of a flow channel (the distance between
electrodes) and inversely proportional to the area of an electrode.
The lower the thermal resistance is the more efficient is the
cooling, because heat has to travel a shorter distance and a larger
area of contact with metal is available for its transfer.
[0270] Thermal resistance shows how large the temperature increase
of a physical body will be if there is a continuous process of heat
production within this body at the rate P. For example, if the
thermal resistance is 10 degrees per Watt, one can state that the
average temperature of the buffer will be 50 degrees above ambient
(room temperature) if the power consumption in a continuous process
is 5 Watts.
[0271] Normally one would want the temperature increase to be below
20 degrees because the cell suspension is subjected to
electroporation at room temperature, what makes 20+20=40 degrees
Celsius--even slightly more than the maximal temperature found in
living beings. It is known that proteins denature at the
temperatures as high as 50-60 degrees, so the choice of 40 degrees
maximum for biological applications should be quite right. On the
other end, the cooler temperature cannot be lower than 0.degree.
C., or freezing will occur. Therefore, the entire practical range
of temperatures that the suspension of cells can be exposed to is 0
to 40 degrees C.
[0272] With this limitation in mind, one can calculate the maximal
power rating of any flow electroporation chamber from its
dimensions:
p max = .DELTA. T .THETA. ##EQU00004## or ##EQU00004.2## p max = 40
2 k A w .apprxeq. 1 2 A w ##EQU00004.3##
If both A and w are measured in centimeters, P.sub.max is expressed
in Watts. The value of .DELTA.T value may vary depending on the
temperature of electrodes: 0.degree. C.<.DELTA.T<40.degree.
C.
[0273] The power rating allows deciding whether the geometry of
electroporation chamber is optimal for required heat transfer. For
example, in a continuous process where cell suspension is being
electroporated at a given electric field strength and certain
volume of this suspension must be processed in a given time, one
can calculate the power consumption rate:
P=VItN/T, where
[0274] V is the magnitude of the voltage being applied to
electrodes during each pulse,
[0275] I is current flowing through the buffer during each
pulse,
[0276] t is the duration of each pulse,
[0277] N is the number of pulses applied during the process,
[0278] T is the time of the process;
[0279] For example, if 50 pulses of 1 ms duration and 500 Volts
magnitude are applied to a flow cell in a process that takes 10
minutes, and the current during each pulse is 100 Amperes, the
power consumption is:
500*100*0.001*50/600=4.2 Watts
[0280] If P (power consumption) is found to be higher than
P.sub.max (flow-cell power rating), the conditions for optimal heat
transfer are not satisfied. In this case either the process has to
be slowed down to produce less heat, or a different flow cell must
be used which has a higher ratio of electrode area to the distance
between electrodes. According to the present invention, the
dimensions of the electrodes, area of their contact with
suspension, and the distance between the electrodes is chosen to
ensure that the thermal resistance of the entire flow channel is
less than approximately 10.degree. C. per Watt; preferably less
than approximately 9.5.degree. C. per Watt, more preferably less
than approximately 9.degree. C. per Watt, more preferably less than
approximately 8.5.degree. C. per Watt, more preferably less than
approximately 8.degree. C. per Watt, more preferably less than
approximately 7.5.degree. C. per Watt, more preferably less than
approximately 7.degree. C. per Watt, more preferably less than
approximately 6.5.degree. C. per Watt, more preferably less than
approximately 6.degree. C. per Watt, more preferably less than
approximately 5.5.degree. C. per Watt, more preferably less than
approximately 5.degree. C. per Watt, more preferably less than
approximately 4.5.degree. C. per Watt, more preferably less than
approximately 4.degree. C. per Watt, more preferably less than
approximately 3.5.degree. C. per Watt, more preferably less than
approximately 3.degree. C. per Watt, more preferably less than
approximately 2.5.degree. C. per Watt, more preferably less than
approximately 2.degree. C. per Watt, more preferably less than
approximately 1.5.degree. C. per Watt. It is especially preferred
that the flow channel of the present invention has a thermal
resistance of approximately 0.1.degree. C. per Watt to
approximately 10.degree. C. per Watt; more preferably approximately
0.5.degree. C. per Watt to approximately 4.degree. C. per Watt,
more preferably approximately 1.degree. C. per Watt to
approximately 3.degree. C. per Watt, more preferably approximately
1.5.degree. C. per Watt to approximately 2.5.degree. C. per
Watt.
[0281] Thermal resistance of the flow channel can also be
calculated by measuring certain parameters as described below.
Temperature sensors, such as thermocouples, may be placed at the
inlet, such as at 50 (FIG. 14), and the outlet, such as at 55 (FIG.
14), of the flow cell so that the temperature of the suspension
going into and out of the flow cell can be measured. A steady flow
of buffer, such as PBS, is then established through the flow
channel. A preferred flow rate is approximately 0.01 to 0.1 mL/s
(generally low flow rates are preferred). In the absence of any
electric filed applied to the cell, the temperature of the buffer
at the inlet and at the outlet is measured to verify that there is
no difference. The pulsing parameters are then set on the
electronic control module. A preferred set of parameters is a field
strength of 1-2 kV/cm with a pulse width of 1-2 ms and 1-2 seconds
between pulses. Using pulses of alternating polarity is preferred
in order to avoid electrode polarization. Measurement of the
applied voltage to the electrodes, current through the flow channel
and inlet and outlet temperatures are recorded, such by digitizing
those measurements and feeding that information into a computer.
Pulsing of the flow channel is then begun while repetitive reading
of voltage, current and temperature are taken and recorded as often
as possible during and covering a period (the measurement period)
of at least 50 pulses. Thermal resistance can then be calculated
based upon the collected data as described below.
[0282] All outlet temperature readings are averaged and stored as
T.sub.out. All inlet temperature readings are averaged and stored
as T.sub.in. The difference between Tout and Tin is calculated and
stored as T. Multiply paired readings of voltage (in Volts) and
current (in Amperes) during each pulse and average them. Store the
result as P. Multiply duration of each pulse by the total number of
pulses applied during the measurement period and store the result
as D.sub.pulse. Set D.sub.exp equal to the duration of the
measurement period (make sure to use the same units for time as
with the pulse width). Then, calculate the value of heat resistance
as Q=(T*D.sub.exp)/(P*D.sub.pulse).
[0283] It is to be understood that the flow electroporation system
of the present invention can be used in conjunction with
commercially available cell separation apparati. These include, but
are not limited to, Haemonetics Cell Save.RTM. 5 autologous blood
recovery system, the Haemonetics OrthoPAT.RTM. System, the
Haemonetics MCS.RTM.+ Apheresis System, the Cobe Spectra Apheresis
System, the Trima.TM. Automated Blood Component Collection System,
the Gambro BCT System, and the Baxter Healthcare CS-3000 Plus blood
cell separator. The flow electroporation system of the present
invention can be in direct communication with these commercially
available cell separation apparati so that the cells that are
isolated can be introduced into the flow electroporation system of
the present invention and treated as desired.
Example I
Electroporation of Red Blood Cells with IHP
[0284] It has been determined that one of the most important
parameters to control is production of heat. Red blood cells are
extremely sensitive to heat and this was found to be an important
parameter in the inefficiency of prior art electroporation methods.
The following example was performed using the apparatus described
herein.
[0285] 60 mL of blood is collected from a human donor into a
collection set containing 15 to 20 m of CPDA-1 (21 CFR 640.4)
buffer 26.3 g trisodium citrate 3.27 g citric acid: 31.9 g
dextrose: 2.22 g monobasic sod phosphate: 0.275 g adenine: H.sub.2O
to 1000 mL. The volume per 100 ml of blood is 14 mL. It is to be
understood that larger volumes of blood can be treated with the
present invention. The blood is transferred to two 50 ml centrifuge
tubes and then is centrifuged for 10 minutes at 2000 g. The plasma
is collected from above the cell pellets and transferred into a
separate sterile 50 ml tubes and stored. The buffy coat is removed
from the top of the cell pellets using a plastic transfer pipette.
The cells are then resuspended in 50 ml of sterile phosphate
buffered saline by gently inverting the tubes. The resuspended
cells are centrifuged at 2000 g for 5 minutes. The supernatant is
discarded and the resuspension/centrifugation procedure is
repeated. The red blood cells are then resuspended in 45 ml of
electroporation buffer. The electroporation buffer is 35 mM Na6-IHP
(EntreMed, Rockville Md.), 60 mM KC1, and 10 mM D-glucose. The cell
suspension is centrifuged at 2000 g for 5 minutes. The volume of
the red blood cell pellet is estimated visually and approximately
1.5 times the volume of the pellet of electroporation buffer is
added to the cells. The cells are resuspended in the
electroporation buffer by gently inverting the tubes. Insert
syringe ports onto cell suspension bags (Baxter Transfer Packs,
Baxter Healthcare, Chicago Ill.) clamp tubing onto the bags with
hemostats. Transfer the cell suspensions from both tubes into the
first bag using 30 ml syringes and plastic needles. After the last
injection of cells, pull out 15 ml of suspension and dispense the
cells into a separate 50 ml tube for control. The second bag is
filled with 30 ml of electroporation buffer. With reference to FIG.
12, install a disposable set on the flow electroporation device
(described above). Matching the bag and valve numbers, the tubing
is inserted into the four pinch valves and the appropriate part of
the harness on the peristaltic pump is installed. The pump key and
compression plate is closed.
[0286] The computer software is then initialized and the hemostats
are removed from the bags. The pump is primed by clicking on the
"prime start" button on the GUI. The pump is started by clicking on
the "pump on" button on the GUI. This begins the electroporation
process. When the blood flow reaches the waste bag, the stream is
switched so the sample is collected in the product bag by clicking
the "sample start" button. The pulsing schedule with preferred
ranges is shown below in Table 6:
TABLE-US-00006 TABLE 6 Parameter Preferred value Range of values
Pulse width 650 .mu.s 200 to 900 .mu.s Interval between pulses 100
.mu.s 25 to 400 .mu.s* Pulses in burst 2 1 to 6 Time between bursts
12000 ms 1000 to 20000 Bursts/cell 2 1 to 5 *The interval between
bursts is dependent on the flow rate and the volume of the flow
cell.
[0287] When the bag containing the blood is empty, the pulsing is
stopped by clicking the "off" button on the GUI. The bag with the
treated blood is then placed into a sealable plastic overwrap (a
ZIPLOC baggie) and put into a water bath at 37.degree. C. for 45
minutes. The bag tubing is then aseptically cut and the sample is
divided into two 50 ml centrifuge tubes. 7.5 mL of the cell
suspension from each tube is transferred to a separate 50 ml tube
for testing. The remaining cell suspension is centrifuged at 2000 g
for 5 minutes. The cells are washed 3 times by centrifugation in
sterile PBS with 60 mM mannitol. It has been found that mannitol is
important in the wash buffer and stabilizes the cell membrane
better than other compounds. Other polyhydroxyl hydrocarbons can be
used in the present invention to stabilize the cell membrane. The
concentration of mannitol is preferably between 30 mM and 90 mM, a
more desirable concentration of between 40 and 80 mM with the most
desirable concentration of between 50 and 7 mM. The red blood cell
volume is estimated visually and 1.5 times the volume of the pellet
of the stored plasma is added to each tube. The red blood cells are
resuspended by inverting the tubes. The right shift of the oxygen
hemoglobin curve is measured in the treated cells and the untreated
cells using an Oximeter. Saturation of hemoglobin with oxygen
(sO.sub.2) was measured after the incubation step in both control
and electroporated red blood cell samples with a CO-Oximeter.TM.
Model 682 (Instrumentation Laboratory). Each sample was divided
into three fractions, which were equilibrated for 20 minutes at
37.degree. C. with three gas mixtures in an EQUILibrator tonometer
(RNA Medical). The gas mixtures were obtained from RNA Medical and
contained 9%, 6% and 3% oxygen, plus 5.6%, 2.8% and 1.4% CO.sub.2,
respectively, and were balanced with nitrogen. The partial pressure
of oxygen (pO2) in each fraction and the buffer pH were measured by
a model 1640 pH/BloodGas/Electrolytes device (Instrumentation
Laboratory). Viability is measured by measuring free hemoglobin.
The results of electroporation of several different samples of
blood from different donors are shown in FIG. 18. The average red
blood cell loss during the entire electroporation process was
between 6% and 10%.
Example 2
To Electroporate Non-Stimulated Lymphocyte
[0288] Primary lymphocytes were suspended in B&K buffer (125 mM
KC1, 15 mM NaCl, 1.2 mM MgCl.sub.2, 3 mM glucose, 25 mM Hepes, pH
7.4) cell concentration was set from 1.times.10.sup.7 cells/mL to
6.times.10.sup.8 cells/mL together with DNA plasmid from 50
.mu.g/mL to 1 mg/mL. DNA concentration was 50 ug/mL-1000 ug/mL.
Electroporation was performed at 2.3 kV/cm, 400 .mu.s, 4 pulses for
small volume experiments (15 .mu.l) or 2.2 kV/cm, 1.6 ms, 1 pulse
for large volume experiments (0.5 ml-2 ml) was performed under
static conditions at room temperature. Following electroporation,
cells were incubated in B&K buffer for 20 minutes at 37.degree.
C. for small volume experiments, or diluted by 10.times. volume of
culture medium (RPMI-1640+10% fetal bovine serum+1% Pen-strep+2 mM
L-glutamine) for large volume experiments. Cells were not diluted
for post pulse incubation. Cells were cultured in culture medium
for various periods (up to 72 hours) and the transfection
efficiency was analyzed.
[0289] Primary quiescence lymphocytes have been shown to be
refractory to retrovirus based gene transfer. HIV based vectors can
transduce primary lymphocytes, but the efficiency is extremely low
in the absence of HIV accessory genes. Other non-viral transfection
methods also gave very low transfection efficiency. This is the
first demonstration of high efficiency of transfection of primary
lymphocytes by a non-viral method.
Example 3
Electroporation of Stimulated Lymphocytes
[0290] Primary lymphocytes (5.times.10.sup.6 cells/mL) were
stimulated with PHA-P (up to 10 ug/mL) and 10 U/mL hr IL-2 for 48
hours in culture medium (RPMI-1640+10% Fetal bovine serum+1%
Pen-strep+2 mM L-glutamine). Large cell aggregates were collected
by incubating the cells in a 15 ml centrifuge tube for 10 min in
the incubator and re-suspended in B&K buffer with 200 .mu.g/mL
of plasmid DNA. Following electroporation under static conditions
at 1.8 kV/cm, 400 .mu.s, 4 pulses, cells were incubated for 20 min
in B&K buffer at 37.degree. C. for small volume experiments or
diluted with 10.times. volume of culture medium containing 20 U/mL
hr IL-2. Cells were cultured with culture medium containing 20 U/mL
IL-2 for various periods (up to 20 days) and the transfection
efficiency was analyzed.
[0291] This is the first demonstration of gene transfer of large
amount of (greater than 1.times.10.sup.8 cells)
stimulated-lymphocytes by a non-viral method.
Example 4
Transfection Efficiency Analysis
[0292] Seven transgenes (Ds-Red, eGFP, .beta.Gal, hEndostatin,
hEPO, hIFN.alpha., hIL-2) were tested in these experiments. As used
herein, a transgene is any gene that is transferred into a cell
that codes for a protein. Ds-Red is under the control of CMV
promoter, and is from ClonTech., eGFP is under the control of CMV
early promoter with an intron, backbone is from Promega, .beta.Gal
is under the control of CMV promoter, and is from Clontech.
hEndostatin is under the control of CMV promoter, and the backbone
is from Invitrogen (pcDNA3.1). hEPO, hIFN.alpha. and IL2 are under
the control of CMV promoter and an intron. The backbone is from
Promega. When pCMV-Ds-Red or pCMV-EGFP was used, the percentage of
the fluorescent cells was counted, by FACS or by manual counting
under phase contrast and fluorescence microscope, as the
transfection efficiency. When pCMV-pGal was used, the percentage of
stained cells (blue cells) by in-situ staining with X-gal was used
as the transfection efficiency. When pCMV-Endostatin was used, the
Endostatin concentration in the supernatant was analyzed by ELISA
kit from Cytirnmune Sciences, Inc. (College Park, Md.). For
pCMV-EPO electroporation, the erythropoietin concentration in the
supernatant was analyzed by R&D ELISA kit (Minneapolis, Minn.).
The results of the transfection efficiency analysis are summarized
in Table 7 below.
TABLE-US-00007 TABLE 7 Summary of Transgene Efficiencies Flow or
Static Efficiency (either by Transgene Cell Line Viability
Electroporation % of + or secretion level) Ds-Red resting 50%
Static 30% Lymphocytes eGFP resting 60% Static 50% Lymphocytes
stimulated 50% Static 40% Lymphocytes CHO 85% Flow 80% NIH 3T3 85%
Flow 70% 10 T 1/2 fibroblast 85% Flow 75% Huh-7 90% Flow 80% Jurkat
Cells 85% Flow 70% .beta.Gal resting lymphocytes 40% Static 15%
hEndostatin resting lymphocytes 50% Static 10 ng/million cells/24
hr stimulated 40% Static 30 ng/million lymphocytes cells/24 hr
hIFN.alpha. stimulated 40% Static 20 ng/million lymphocytes
cells/24 hr hIL-2 Jurkat cells 60% Static 2500 pg/million cells/24
hr hEPO stimulated 45% Static 200 ng/million lymphocytes cells/24
hr NIH 3T3 cells 80% 3000 ng/million cells/24 hr
Example 5
Application of the Present Invention in Ex Vivo Gene Therapy
[0293] Genes encoding therapeutic proteins can be incorporated into
a patient's autologous cells by the flow electroporation system of
the present invention. Human erythropoietin (hEPO) was used as a
marker gene to demonstrate the concept of the ex vivo gene therapy
process. Mouse NIH3T3 cells were used as gene delivery vehicles,
but in real life setting, any human primary cells can be employed
into the system, such as T lymphocytes, stem cells, fibroblast,
myoblast, and pancreatic cells.
[0294] The human erythropoietin (hEPO) gene was RT-PCR amplified
from polyA+ human kidney RNA (Clontech, Palo Alto, Calif.) using
synthetic oligonucleotides upstream primer
5'-CTCGAGATGGGGGTGCACGAATGTCCTGCC (SEQ ID NO:1) and downstream
primer 5'GTCGACTCATCTGTCCCCTGTCCTGCAGGC (SEQ ID NO:2) and cloned
into pCR2.1-TOPO (Invitrogen, Carlsbad, Calif.). Then the coding
region for hEPO was excised by EcoRI and cloned into the mammalian
expression plasmid pTM4 to construct pTM7 (CM
V-hEPO-IRES-eGFP).
[0295] Plasmid pTM7 was propagated and band purified twice by CsCl
gradient. Endotoxin level was <3 EU/mg. Purified plasmid was
re-suspended in endotoxin free H.sub.2O and stored at -20.degree.
C.
[0296] NIH3T3 mouse fibroblast was cultured according ATCC
guidelines and re-suspended in B&K pulsing buffer (125 mM KC1,
15 mM NaCl, 1.2 mM MgCl.sub.2, 25 mM Hepes, 3 mM Glucose, pH 7.4)
and transfected with pTM7 (100 .mu.g/mL) using the flow
electroporation system of the present invention: 2.1 KV/cm, 400
.mu.s, 4 pulses at 1.25 second intervals, and flowing at 0.1 mL/s.
Then, the fibroblasts were incubated in the pulsing medium for 20
minutes before injected into SCID mouse. Flow analysis revealed
that about 75% of cell population expressed eGFP.
[0297] Each SCID mouse was SQ injected with 2.times.10.sup.6 hEPO
transfected cells. Control group was injected with non-transfected
cells. Mice were bled at 5 days, 12 days, 19 days, and 26 days
post-injection. The blood was collected using a heparinized
capillary tube. The hematocrit was measured using standard
procedures. The results of this series of experiments are shown in
FIG. 19.
Example 6
Application of the Flow Electroporation System of the Present
Invention in Drug Target Discovery
[0298] Treatment of cells to effect the intracellular loading of
short nucleic acid molecules, or oligonucleotides, that are
fluorescently labeled, such labeled oligonucleotides often referred
to as molecular beacons (MB) can be used for new drug target
screening. A typical molecular beacon contains a fluorescent moiety
at one end and a moiety that can quench the fluorescence of the
fluorescent moiety attached to the other end. When the molecular
beacon oligonucleotide is unbound the quench moiety is in proximity
to the fluorescent moiety and it quench fluorescence. When the
oligonucleotide is bound to a nucleic acid having a complementary
sequence the quenching moiety is held distant from the fluorescent
moiety and cannot quench its fluorescence. When a molecular beacon
enters a live cell that express this target, the molecular beacon
may bind to mRNAs that are expressed in the cell which contain
sequences complementary to those of the molecular beacon. Such bind
will result in the molecular beacons being made fluorescent. Such
intracellular fluorescence may be detected microscopically or by
flow cytometry, thereby revealing cells that are transcribing a
particular gene. This information can be used to identify candidate
gene and proteins useful in the discovery of new drugs.
[0299] A molecular beacon specific to the human .beta.-actin mRNA
is used as an example, and a molecular beacon having a random
sequence is used as a negative control. Jurkat cells are
re-suspended in B&K medium, pH 7.4, (125 mM KC1, 15 mM NaCl, 3
mM Glucose, 25 mM Hepes, 0.5 mM MgCl.sub.2). The cells are
electroporated four times with 1 kV/cm, 400 .mu.sec/pulse with 1
second between pulses. Then, cells are incubation at 37.degree. C.
for 20 minutes. Before FACS, cells are washed twice in PBS. About 1
hour post-electroporation, cells are analyzed by flow cytometry. In
FIG. 20, electroporation mediated uptake of the molecular beacon by
mammalian cells is shown. Uptake of the molecular beacon is
concentration dependent. Uptake efficiency is over 88%, while
viability is approximately 90%. FIG. 21 shows a fluorescence
difference when .beta.-actin (blue) or scrambled DNA (orange)
molecular beacons were incorporated into Jurkat cells by
electroporation. This suggests that .beta.-actin is expressed and
positively recognized by the specific molecular beacon. Thus, an
RNA expression profile of cells being treated with a known drug can
be obtained and used as a template to screen for other unknown
drugs. Using this method, many new drugs or compounds can be
identified and replace current treatments.
Example 7
Application of the Flow Electroporation System of the Present
Invention in Viral Vector Production
[0300] Retroviruses are widely used vectors in clinic trials for
gene therapy. Retroviral vectors are generally produced using
genetically packaging cell lines. All packaging cell lines used to
date for this purpose grow as adherent cells. Recently, Chan et
al., and Pizzato et al. reported stable suspension packaging cell
lines derived from human lymphoblastic cells (Gene Ther 2001 May)
providing proof-of-principle that cells grown in suspension can be
used to produce retroviral vectors. Since cells grown in suspension
can be grown in large quantity more easily and at lower cost than
adherent cells, use of suspension cells as packing cells can reduce
the cost of production of retroviral vectors. Additionally, while
packaging cell lines have been used for retroviral vector
production, it is possible to produce retroviral vectors without
the use of packaging lines by co-transfection of cells with
multiple plasmids each carrying different genes leader for assembly
of an complete retroviral vector. Current protocols for transient
co-transfection of cells are inefficient and not adapted to the
transfection of large numbers of cells thereby severely limiting
The concentration of retroviral vector produced following
co-transfection and the total amount of retroviral vector
produced.
[0301] Cultured CHO cells were trypsinized and re-suspended in
B&K buffer pH7.4, (125 mM KC1, 15 mM NaCl, 3 mM Glucose, 25 mM
Hepes, 0.5 mM MgCl). Then plasmid 1 (pCMV-Ds-Red), and plasmid 2
(pCMV-intron-eGFP) were added in the cell suspension at 200
.mu.g/mL. The cell-DNA mixture was introduced into the flow
electroporation system. FACS was conducted 48 hours post
electroporation. As shown in FIG. 22, more than 85% of the cell
population expressed eGFP, while 44% of the cells expressed Ds-Red.
Viability of the cells was >90%. The difference between these
two transgene expressions may be due to the fact that green
fluorescence is more sensitive than red fluorescence, and that eGFP
was driven by CMV-intron, which has been shown more efficient than
CMV alone.
[0302] Current lentiviral vector production involves transient
co-transfecting cells with either 2 or 3 (preferably 3) different
plasmids. CaPO.sub.4 transfection can be used to co-transfect 2 or
more plasmids, but the low efficiency of this method makes it
impractical for clinical applications. The flow electroporation
system of the present invention provides transfection efficiency
sufficiently high and by allowing for the transfection of large
volumes of cells provides a practical method for the production of
retroviral vectors without use of packaging cell lines. More than
20 mL of cells at 200.times.10.sup.8 cells/mL can be transfected
with the flow electroporation system of the present invention (in
all, 4.times.10.sup.9 cells) in less than 1 hour.
Example 8
[0303] Platelets migrate to disrupted vascular sites because their
membrane contains receptors for proteins that are found there
(e.g., fibrin and collagen). These proteins are also found at sites
of infection and metastasis--if otherwise toxic drugs can be
inserted into platelets, the platelet can be utilized as a drug
delivery system (an "intelligent liposome").
[0304] Results are shown in Table 8 below. Efficacy is expressed as
the percentage of cells that took up fluorescent markers (calcein
or albumin+fluorescein). "Activity" was determined by measuring
biologic functions, such as secretion or aggregation (for MaxCyte's
application, any detectable level will probably suffice).
"Survival" is the circulating half-life in an animal model.
TABLE-US-00008 TABLE 8 PLATELET: LABORATORY RESULTS Efficacy
Activity Survival (% of (% of (% of Processing Rate cells with
control) control) (cells/min) Human 80+ 40-60 30-40 1 to 2 billion
platelets CALCEIN
[0305] Platelets are primarily known as components of the
haemostatic mechanisms and, in that role, traffic to sites of
vascular injury to form an aggregate with coagulation factors and
to stop vascular leakage. Targeting is accomplished via the
biological properties of the platelets themselves. Specialized
molecules on the platelet surface (receptors) specifically interact
with proteins found not only at areas of vascular damage, but also
at sites of infection, metastasis, and inflammation. The target
proteins include fibrinogen, collagen, von Willebrand Factor (vWF),
and adhesion proteins such as ICAM-1.
[0306] The concept that a biologically active agent can be inserted
into platelets with electroporation and that the agent will then
exert an effect at a target site has been demonstrated and is
documented in peer-reviewed literature. In these cited studies,
platelets were treated with static systems that accommodated a
maximum of 0.5 ml of cell suspension. The MaxCyte system permits
processing of tens or hundreds of milliliters of cell suspension
with a rapid (minutes) throughput time.
[0307] FIGS. 23A and 23B show scatter plots from a flow cytometer.
Control (FIG. 23A) was incubated in a dilute solution of the
fluorescent dye, calcein, for approximately 1 hour. The test sample
(FIG. 23B) was suspended in the same dye solution, but was run
through the electroporation device. Similar results were obtained
using fluoresceinated albumin.
Example 9
[0308] Platelets were treated in accordance with the present
invention in the presence of a marker dye, calcein, then stimulated
with increasing doses of collagen, a physiologic stimulant for
platelets. This study demonstrated that the platelets retain
biologic function, as demonstrated by the secretion of
beta-thromboglobulin, a protein contained within platelets that is
normally released upon activation. The detection of any level of
activity indicates that the platelets are viable after the
processing. On the other hand, the platelets do not release the
molecular marker (calcein) that was loaded into them. This
indicates that platelets loaded with a therapeutic agent would not
prematurely release their "cargo", but would retain it until the
loaded platelet adhered to a biologically active site and underwent
degradation over a period of days (which is the expected behavior
for platelets).
[0309] These experiments indicate that the loaded material is in
the cell cytosol and not in the granules. Observation of platelets,
loaded with the dye alexa, by confocal microscopy confirms that the
dye is located diffusely within the platelet and is not simply
adherent to the membrane.
[0310] FIGS. 24A and 24B show platelets that had been washed but
otherwise not treated (Untreated[N]}), platelets that were
incubated with the fluorescent marker calcein (calcein control) and
platelets electroporated with calcein (electroporated) were
subsequently stimulated with the physiologic stimulus, collagen. As
seen in FIG. 24A, samples responded similarly to a collagen
stimulus by releasing beta-thromboglobulin, a natural constituent
of platelets. As seen in FIG. 24B, platelets did not release the
dye when stimulated.
Example 10
[0311] Studies were performed with human platelets in a rabbit
model, in which the animals were pre-treated with an agent that
blocked macrophage activity. Platelets loaded with calcein or
albumin circulate, but with a half-life less than that of untreated
control platelets (Control 8 hours, test 2.5-3 hours). These
studies show that platelets clearly have a finite circulation.
Example 11
[0312] In another series of studies, platelets loaded with calcein
were infused into the rabbits and major organs harvested within 1
half-life. Platelets were found in multiple organs--heart,
intestine, muscle kidneys, liver and spleen. These studies
demonstrate that platelets distribute to heart, kidneys, gut, etc.,
and are not simply sequestered in liver and spleen, as is the case
with liposomes.
Example 12
[0313] Mouse cells transfected with an expression plasmid carrying
the gene for the cytokine IL-12 were evaluated for the ability of
these transfected cells to produce IL-12 after injection into a
mouse. Since IL-12 is known to inhibit angiogenesis by
up-regulating IFN alpha and IP-10 angiogenesis was measured using
MatriGel. Mouse embryonic fibroblast 10T1/2 cells were transfected
with a DNA plasmid encoding mIL-12 and injected subcutaneously into
C3H mice. Human recombinant bFGF was mixed with MatriGel and
subcutaneously injected at a remote site from the one of
transfected cells injection. In one group of mice, the transfected
cells were mixed together with bFGF and MatriGel. The amount of
hemoglobin in MatriGel was measured 6 days post injection, as an
indicator of angiogenesis. Data (FIG. 25) showed that mIL-12
transfected cells inhibited angiogenesis more than 70%. The
transfected cells secreted about 72 ng of mIL-12 (1.times.10.sup.6
cells in 24 hrs). Systemic mIL-12 level was elevated among mice
received mIL-12 transfected cells injection. No cytotoxic effect
was observed. These results suggest that the MaxCyte
system-mediated high-flow transfected cells are viable and express
functional gene product in vitro & in vivo.
[0314] Three hours post-transfection, mIL-12 modified mouse
embryonic 10T1/2 cells were subcutaneously injected into C3H mice.
Matrigel with 1 .mu.g/mL bFGF was subcutaneously injected into
dorsal thorax area, mixed or not mixed with cells. Control
represents mice injected with non-transfected cells. Cells were
injected on ventral side close to the thigh. ELISA analysis
(R&D System) revealed up to 80-100 pg/mL of mIL-12 in treated
mice plasma 2 days post-injection.
[0315] mIL-12 transfected mouse embryonic fibroblast blocked bFGF
induced angiogenesis (FIG. 26). The MatriGel plugs were removed
from the mice described in the previous figure, and homogenized in
1 ml of PBS. The hemoglobin amount was analyzed by absorption at
415 nm. Local delivery of mIL-12 transfected cells (in MatriGel)
resulted in 70% of inhibition of angiogenesis.
Example 13
[0316] Jurkat cells were resuspended in electroporation medium
together with 0.5 mg/mL FITC-Dextran (500 kD MW). Then, the
cells-Dextran mixture were flow electroporated in accordance with
the present invention at 1.2 kV/cm, 400 us pulse width at time
intervals of 2.3 sec. The flow rate was 0.1 ml/sec. Three hours
post-electroporation, FITC staining of cells was measured using
flow cytometry to estimate the loading efficiency of cells by
electroporation (Dex, +EP Propidium iodine exclusion was used to
measure cell viability post electroporation). The reported results
were the mean of three independent experiments. The results are
shown in Table 9 below.
TABLE-US-00009 TABLE 9 Flow Electroporation-Mediated Uptake of
FITC-Dex (500 kD) -EP, -Dex -EP, Dex EP + Dex Viability (%) 95 92
.+-. 2 92 .+-. 1.4 Fluorescent Cells 0.1 35 .+-. 20 90 .+-. 1.4 (%)
Mean Fluorescence 6 76 .+-. 53 185 .+-. 22 Intensity
[0317] The results of this example show that electroporation
significantly increased the percentage of cells that take up FITC
labeled Dextran and electroporation did not significantly adversely
effect the viability of these cells.
Example 14
[0318] Jurkat cells were electroporated with DNA plasmid encoding
eGFP reporter under the transcriptional control of a CMV promoter
at volumes of 1.5, 5, 10, 15, and 50 mL. Forty-eight hours
post-electroporation, flow cytometric eGFP analysis was performed.
Estimated transfection efficiency (solid triangle), and propidium
iodine exclusion for cell viability (solid circle) are shown in
FIG. 33. The results of this example show that the efficiency of
transfection and viability did not significantly change during the
flow electroporation process and that this process can be scaled up
simply by passing more cells and DNA through the device and
operating it for a longer time.
Example 15
[0319] Jurkat cells (1.2.times.10.sup.9) were resuspended in 50 mL
of B&K pulsing buffer with 80 .mu.g/mL of DNA plasmid encoding
eGFP reporter gene. The cells were electroporated using a flow cell
in accordance with the present invention. The transfected samples
were collected every 10 mL, and cultured in complete medium.
Transfection efficiency and cell viability were analyzed at 40
hours post-electroporation. The results of this example are shown
in FIG. 34. The results of this example show that the efficiency of
transfection and the viability did not significantly change during
the flow electroporation process and that this process can be
scaled up simply by passing more cells and DNA thought the device
and operating it for a longer time.
Example 16
[0320] A comparison of transfection efficiency and cell viability
between static and flow electroporation was performed. Jurkat cells
were electroporated with DNA plasmid encoding eGFP either in a
static (5) or flow (=) mode. Various electric field strengths were
applied to the electrodes ranged from 0.4 to 1.7 kV/mL. Forty-eight
hours post-electroporation, flow cytometric analysis for eGFP was
performed. Estimated transfection efficiency is shown in FIG. 35,
and propidium iodine exclusion for cell viability is shown in FIG.
36. The results of this example show that transfection efficiency
increased and plateaued with higher electric field strength. Cell
viability was maintained at greater than 80% even at high electric
field strengths.
Example 17
[0321] Jurkat cells were flow electroporated in accordance with the
present invention under the same condition with either a standard
plasmid (pTM2, CMV-eGFP), or a plasmid containing EBNAl-OriP region
(pTM22) from EBV virus. The transfected cells were analyzed by flow
cytometry for transfection efficiency, viability and transgene
expression level. Transfection efficiency and viability are shown
in FIG. 37; mean fluorescence intensity is shown in FIG. 38. The
results of this example show that DNA plasmid containing EBNAl
resulted in higher and longer term transgene expression. Expression
level of the EBNAl containing plasmid was over 500 fold higher than
that of standard plasmid.
Example 18
[0322] Various mammalian cells were flow electroporated under the
same condition as described in Example 14 above, except 1.6 kV/cm
and 1.2 kV/cm was used for 10T1/2 and Huh-7 cells, respectively.
The results of this test are shown in Table 10 below.
TABLE-US-00010 TABLE 10 Flow Electroporation-mediated Transfection
of Various Mammalian Cells Mean Fluorescence Cell Type Viability
Efficiency (eGFP+) Intensity Jurkat (10 mls) 77 .+-. 7 69 .+-. 1
163 .+-. 49 Huh-7 (10 mls) 94 .+-. 3 63 .+-. 15 930 .+-. 380 10T1/2
(1.5 mls) 97 75 605
[0323] The result of this example show that a number of different
cell lines can be efficiently electroporated using flow
electroporation.
Example 19
[0324] Mouse embryonic 10T1/2 cells electroporated with a plasmid
carrying the gene for mouse IL-12 were subcutaneously injected into
C3H mice 3 hours post-transfection. Matrigel containing 1 mg/mL
bFGF was subcutaneously injected into dorsal thorax area of mice
that had been injected with the above-transfected cells and
untransfected cells (negative control mice). Cells were injected on
the ventral side close to the thigh. ELISA analysis (R&D
System) revealed 80-100 pg/mL of mIL-12 in the plasma of the mice
that received transfected cells 2 days post-injection (FIGS. 39 and
40). The MatriGel plugs were removed from the mice and homogenized
in 1 mL of PBS. The hemoglobin present in the removed MatriGel was
analyzed by absorption at 415 nm (FIG. 39). IL-12 level in plasma
is shown in FIG. 40. Local delivery of mIL-12 transfected cells (in
MatriGel) resulted in 70% of inhibition of angiogenesis compared to
the mice that received untransfected cells.
Example 20
[0325] The effect of electric field on electrotransfection of mouse
embryonic stem cells was investigated in a static system. 10T1/2
cells were electroporated at various electric field strengths.
Pulse width was 400 .mu.s. Four pulses were provided to each sample
in the presence of 60 .mu.g/mL of DNA plasmid encoding for eGFP.
The transfected cells were analyzed by flow cytometer for
transfection efficiency and viability 1 day post-transfection. The
results of this example are shown in FIG. 41. The results of this
example show that efficient transfection of mouse embryonic stem
cells occurs at field strengths greater than approximately 1.5
kV/cm.
Example 21
[0326] The effect of DNA concentration on electrotransfection of
mouse embryonic stem cell under static conditions was investigated.
10T1/2 cells were electroporated at 2 kV/cm. Four pulses with 400
.mu.s pulse width were provided to each sample in the presence of
various concentrations of plasmid DNA encoding for eGFP. The
transfected cells were analyzed by flow cytometer for transfection
efficiency and viability 1 day post-transfection. The results of
this example are shown in FIG. 42. The results of this example show
that increasing the concentration of plasmid DNA increases the
percentage of transfected cells, but that this effect diminishes
with higher DNA concentrations.
Example 22
[0327] The effect of glucose in the pulsing medium on
electrotransfection of the 10T1/2 cells was investigated. Pulsing
buffer indicated was prepared by mixing B&K (125 mM KC1+15 mM
NaCl+1.2 mM MgCl+25 mM Hepes, pH 7.4) and glucose medium (300 mM
Glucose+1.2 mm Mg+15 mM NaCl+25 mM Hepes, pH 7.4). Cells were
electroporated under static conditions at 2.3 kV/cm, with 400 .mu.s
pulse widths. Four pulses were provided to each sample in the
presence of 60 .mu.g/mL DNA plasmids coding for eGFP. Twenty-four
hours post-transfection, the transfected cells were analyzed by
flow cytometry. The results of this example show that higher
glucose concentration decreased transfection efficiency (% of GFP
cells (FIG. 43) and mean fluorescence of each GFP cell (FIG.
44).
Example 23
[0328] Electrotransfection of foreskin fibroblasts was investigated
under static conditions. Foreskin fibroblasts were electroporated
at various electric fields, as indicated in the graph (FIG. 45).
Pulse widths of 400 .mu.s were used. Four pulses were provided to
each sample in the presence of two different DNA plasmid
concentrations. Expression of reporter gene, eGFP, was analyzed at
15 hours post transfection. The results of this example are shown
in FIG. 45. The results of this example show that efficient
transfection of these cells occurs at field strengths greater than
1.5 kV/cm and that increasing concentration of plasmid DNA results
in an increased percentage of transfected cells with no concomitant
decrease in viability.
Example 24
[0329] Resting human lymphocytes cells were transfected at 2.3
kV/cm with 400 .mu.s pulse widths under static conditions. Four
pulse were provided to each sample in the presence of 200 .mu.g/mL
DNA plasmid encoding for eGFP. Transfection efficiency was analyzed
by flow cytometer 6 hours post-electroporation. The results of this
example are shown in FIG. 46. Forty percent of the electroporated
cells showed GFP positive; whereas, the cells without
electroporation did not show any GFP fluorescence.
Example 25
[0330] The effect of electric field on flow electroporation
mediated macromolecule uptake was investigated. One na half mls of
cells was flow electroporated at various field strengths using 1.6
ms pulse widths. Flow rate were set at 0.1 mL/sec and 5.5 sec.
pulse intervals (1 pulse/cell during flow) with icy-water cooling
were used. A mini-flow cell with an electrode gap of 4 mm was used.
100 .mu.g/mL FITC-Dextran was presented during electroporation.
Cells were analyzed 24 hours after electroporation. The results of
this example are shown in FIG. 47. Use of an electric field
strength of 1.5 kV/cm resulted in loading of a high percentage of
cells and minimal loss of viability and using field strengths
greater than 1.5 kV/cm reduced loading and viability but not
substantially up to a field strength of 2.5 kV/cm.
Example 26
[0331] Caspase inhibitor effect on human CD40L transfection of
CLL-B cells was investigated. CLL-B cells (1.4.times.10.sup.8
cells/mL) were electroporated by four 400 .mu.s pulses at indicated
electric fields in the present of DNA plasmid (200 .mu.g/mL) coding
for hCD40L. Following a 20 minute incubation at 37.degree. C.,
cells were cultured in medium either with (+I) or without (-I)
caspase inhibitor (Boc-Asp-FMK, 100 .mu.M). hCD40L expression was
analyzed 24 hour post transfection by flow cytometry with
antibodies against hCD40L conjugate-labeled with Cychrome. The
results of the example are shown in FIGS. 48 and 49. This example
shows that caspase inhibitor improves hCD40L expression both the
percentage of expressed cells (FIG. 48) and the expression level of
hCD40L (FIG. 49).
Example 27
[0332] The effect of electroporation timing on CLL cell
transfection was investigated. CLL cells (2.times.10.sup.8
cells/mL) were electroporated under static conditions with DNA
plasmid encoding eGFP (200 .mu.g/mL) at various times after thawing
as indicated on the graph (FIG. 50). Transgene expression was
analyzed with flow cytometer 24 hours post-transfection. The
results of the example are shown in FIG. 50. The results of this
example show that when cells were electroporated 24 hours after
thawing, the transgene expression level dropped dramatically
comparing to cells electroporated 6 h after thawing.
Example 28
[0333] The effect of cell density on electrotransfection under
static conditions was investigated, CLL cells were pulsed at
indicated cell density by four 400 .mu.s pulses with 200 .mu.g/mL
plasmids coding for human CD40L. Cells were analyzed by flow
cytometry with antibody against hCD40L conjugated with FITC 24
hours post-transfection. The results of the example are shown in
FIG. 51. Cell density greater than 6.times.10.sup.7 cells/mL up to
5.times.10.sup.8 cells/mL resulted in the same level of hCD40L
expression. However, cell viability and hCD40L expression levels
were lower when the cell density was lower than 3.times.10.sup.7
cells/mL.
Example 29
[0334] The effect of electric field strength on CLL-B cell
transfection under static conditions was investigated. CLL-B cells
(2.times.10.sup.8 cells/mL) were pulsed at indicated electric field
(FIG. 52) with four 100 .mu.s pulses. Cells were analyzed with flow
cytometry 14 hrs post transfection. The results of the example are
shown in FIG. 52. In the electric field range of 3.3-4.3 kV/cm,
cell viability does not change greatly (64%-75%). But the
transfection efficiency in this electric field range increased from
10% to 45%.
Example 30
[0335] The pulsing pattern effect on transfection of CLL-B cells
under static conditions was investigated. CLL-B cells
(3.times.10.sup.8 cells/mL) were pulsed at the same electric energy
(1.3 J) with different electric field strengths and pulse durations
in a MaxCyte cuvette with a 1.5 mm electrode gap. Following 17
hours of culture, cells were analyzed by flow cytometry. Pulsing
conditions were four pulses with 1 kV/cm.times.1.6 ms, 1.5
kV/cm.times.800 .mu.s, 2 kV/cm.times.400 .mu.s, 3 kV/cm.times.200
.mu.s, 4.3 kV/cm.times.100 .mu.s and 6.3 kV/cm.times.50 .mu.s,
respectively with 200 .mu.g/mL of DNA coding for eGFP and hCD40L
for transgene expression or FITC-Dextran (500 kDalton) for
macromolecule loading. The results of the example are shown in
FIGS. 53 and 54. The results of this example show that viability
(FIG. 53) and FITC-Dextran loading (FIG. 54) does not depend
greatly on pulsing conditions in all ranges indicated. However, the
transgene expression peaked at around 3 kV/cm.times.200 .mu.s and
4.3 kV/cm.times.100 .mu.s as shown in FIG. 54 at this DNA
concentration level.
Example 31
[0336] The DNA concentration effect on transgene expression was
investigated under static conditions. The CLL cells were analyzed
by flow cytometry 16 hours and 40 hours post-pulsing. The results
of this example are shown in FIGS. 55 and 56. The results of this
example show that cell viability did not significantly depend on
DNA concentration when DNA concentration was >25 ug/mL. Cell
viability decreased greatly with time. There was a >2 fold
decrease in viability when analyzed at 40 hours comparing to at 16
hours (FIG. 55). Transfection efficiency increased from 0% to 56%
when DNA concentration changes from 25 .mu.g/mL to 200 .mu.g/mL.
DNA concentration higher than 200 .mu.g/mL resulted in lower
transfection efficiency.
Example 32
[0337] The effect of temperature on transfection of CLL-B cells was
investigated under static conditions. CLL-B cells were
electroporated with DNA plasmid (200 .mu.g/mL) encoding for eGFP at
the indicated temperatures (FIG. 57). Transfected cells were
analyzed by flow cytometry 15 hours after pulsing. The results of
this example are shown in FIG. 56. The results of this example show
that transfection efficiency highly depended on pulsing
temperature. Greater than seven-fold higher transfection efficiency
was observed at 23.degree. C. compared to 4.degree. C. There was no
significant difference on cell viability based on temperature (FIG.
57).
[0338] The terms and expressions which have been employed herein
are used as terms of description and not of limitation, and there
is no intention, in the use of such terms and expressions, of
excluding any equivalents of the features shown and described or
portions thereof. Having thus described the invention in detail, it
should be apparent that various modifications may be made in the
present invention without departing from the spirit and scope of
the following claims.
Sequence CWU 1
1
2130DNAArtificialSynthetic primer 1ctcgagatgg gggtgcacga atgtcctgcc
30230DNAArtificialSynthetic primer 2gtcgactcat ctgtcccctg
tcctgcaggc 30
* * * * *