U.S. patent application number 11/868081 was filed with the patent office on 2008-05-15 for maize microrna sequences.
Invention is credited to Milo Aukerman, Hajime Sakai, James Tisdall, Jeanne M. Wilson.
Application Number | 20080115240 11/868081 |
Document ID | / |
Family ID | 39156850 |
Filed Date | 2008-05-15 |
United States Patent
Application |
20080115240 |
Kind Code |
A1 |
Aukerman; Milo ; et
al. |
May 15, 2008 |
MAIZE MICRORNA SEQUENCES
Abstract
Methods and compositions useful in target sequence suppression
and target sequence validation are described. Polynucleotide
constructs useful for gene silencing, as well as cells, plants and
seeds comprising the polynucleotides and a method for using
microRNAs to silence a target sequence are also described.
Inventors: |
Aukerman; Milo; (Newark,
DE) ; Tisdall; James; (Philadelphia, PA) ;
Sakai; Hajime; (Newark, DE) ; Wilson; Jeanne M.;
(Philadelphia, PA) |
Correspondence
Address: |
E I DU PONT DE NEMOURS AND COMPANY;LEGAL PATENT RECORDS CENTER
BARLEY MILL PLAZA 25/1122B, 4417 LANCASTER PIKE
WILMINGTON
DE
19805
US
|
Family ID: |
39156850 |
Appl. No.: |
11/868081 |
Filed: |
October 5, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60849672 |
Oct 5, 2006 |
|
|
|
Current U.S.
Class: |
800/278 ;
536/23.6 |
Current CPC
Class: |
C12N 2310/14 20130101;
C12N 2310/111 20130101; C12N 2310/53 20130101; C12N 15/113
20130101; C12N 15/8218 20130101 |
Class at
Publication: |
800/278 ;
536/23.6 |
International
Class: |
A01H 1/00 20060101
A01H001/00; C07H 21/04 20060101 C07H021/04 |
Claims
1. An isolated polynucleotide comprising: a microRNA selected from
the group consisting of SEQ ID NOs:1-2652 and SEQ ID
NOs:7959-8114.
2. The full-length complement of the microRNA of claim 1, or a
nucleotide sequence capable of hybridizing to the microRNA of claim
1, wherein said nucleotide sequence comprises at least 21
nucleotides.
3. An isolated polynucleotide useful for altering plant gene
expression comprising SEQ ID NO:7597 or SEQ ID NO:8427 wherein said
isolated polynucleotide comprises at least one functional domain
having at least 21(x) contiguous nucleotides and x is an integer
from 1 to 2652, further wherein said nucleotides start at
nucleotide 1 or any nucleotide 21(x)+1.
4. A functional subdomain of the isolated polynucleotide of claim
3, wherein said functional subdomain comprises at least one
microRNA.
5. An isolated polynucleotide comprising a microRNA containing
sequence selected from the group consisting of SEQ ID NOs:5305-7956
and SEQ ID NOs:8271-8426.
6. A recombinant DNA construct comprising the isolated
polynucleotide of claim 1, 2, 3, 4, or 5 operably linked to at
least one regulatory sequence.
7. A plant, plant tissue, or a plant cell comprising in its genome
the recombinant DNA construct of claim 6.
8. Transgenic seeds, transgenic seed by-products, or transgenic
progeny plants obtained from the plant of claim 7.
9. A method for altering expression of a stably introduced
nucleotide sequence in a plant comprising: a) making a DNA
expression construct comprising a stably introduced nucleotide
sequence and at least one sequence capable of hybridizing to the
isolated polynucleotide of claim 1; b) transforming a plant with
the DNA expression construct of part (a); and c) selecting a
transformed plant which comprises the DNA expression construct of
part (a) in its genome and which has altered expression of the
stably introduced nucleotide sequence when compared to a plant
transformed with a modified version of the DNA expression construct
of part (a) wherein the modified construct lacks the sequence
capable of hybridizing to the isolated polynucleotide of claim 1.
Description
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/849,672, filed Oct. 5, 2006, the disclosure of
which is hereby incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] The field of the present invention relates generally to
plant molecular biology. More specifically it relates to constructs
and methods to suppress the expression of targeted genes.
BACKGROUND
[0003] MicroRNAs (miRNAs) were first identified only a few years
ago, but already it is clear that they play an important role in
regulating gene activity. These 20-22 nucleotide noncoding RNAs
have the ability to hybridize via basepairing with specific target
mRNAs and downregulate the expression of these transcripts, by
mediating either RNA cleavage or translational repression. Recent
studies have indicated that miRNAs have important functions during
development. In plants, they have been shown to control a variety
of developmental processes including flowering time, leaf
morphology, organ polarity, floral morphology, and root development
(reviewed by Mallory and Vaucheret (2006) Nat Genet. 38: S31-36).
Given the established regulatory role of miRNAs, it is likely that
they are also involved in the control of some of the major crop
traits such drought tolerance and disease resistance.
[0004] Plant miRNAs are processed from longer precursor transcripts
termed pre-miRNA that range in length from 50 to 500 nucleotides,
and these precursors have the ability to form stable hairpin
structures (reviewed by Bartel (2004) Cell 116: 281-297). Many
miRNA hairpin precursors originate as longer transcripts of 1-2 kb
or longer, termed pri-miRNA, that are polyadenylated and capped.
This fact coupled with the detection of numerous pri-miRNAs in
Expressed Sequence Tags (ESTs) libraries indicates that RNA
polymerase II is the enzyme responsible for miRNA gene
transcription. Transgenic experiments indicate that it is the
structure rather than the sequence of the pre-miRNA that directs
their correct processing and that the rest of the pri-miRNA is not
required for the production of miRNAs. While pri-miRNAs are
processed to pre-miRNAs by Drosha in the nucleus and Dicer cleaves
pre-miRNAs in the cytoplasm in metazoans, miRNA maturation in
plants differs from the pathway in animals because plants lack a
Drosha homolog. Instead, the RNase III enzyme DICER-LIKE 1 (DCL1),
which is homologous to animal Dicer, may possess Drosha function in
addition to its known function in hairpin processing (Kurihara and
Watanabe (2004) Proc Natl Acad Sci 101: 12753-12758).
[0005] Through the cloning efforts of several labs, at least 30
miRNA families have been identified in Arabidopsis (reviewed by
Meyers et al. (2006) Curr Opin Biotech 17; 1-8). Many of these
miRNA sequences are represented by more than one locus, bringing
the total number up to approximately 100. Because the particular
miRNAs found by one lab are not generally overlapping with those
found by another independent lab, it is assumed that the search for
the entire set of miRNAs expressed by a given plant genome, the
"miRNome," is not yet complete. One reason for this might be that
many miRNAs are expressed only under very specific conditions, and
thus may have been missed by standard cloning efforts. A recent
study by Sunkar and Zhu (2004, Plant Cell 16: 2001-2019) suggests
that, indeed, miRNA discovery may be facilitated by choosing
"non-standard" growth conditions for library construction. Sunkar
and Zhu identified novel miRNAs in a library consisting of a
variety of stress-induced tissues. They proceeded to demonstrate
induction of some of these miRNAs by drought, cold and other
stresses, suggesting a role for miRNAs in stress response. It is
likely, then, that efforts to fully characterize the plant miRNome
will require examination of the small RNA profile in many different
tissues and under many different conditions.
[0006] A complementary approach to standard miRNA cloning is
computational prediction of miRNAs using available genomic and/or
EST sequences, and several labs have reported finding novel
Arabidopsis miRNAs in this manner (reviewed by Bonnet et al. (2006)
New Phytol 171:451-468). Using these computational approaches,
which rely in part on the observation that known miRNAs reside in
hairpin precursors, hundreds of plant miRNAs have been predicted.
However only a small fraction have been experimentally verified by
Northern blot analysis. In addition, most of these computational
methods rely on comparisons between two representative genomes
(e.g. Arabidopsis and rice) in order to find conserved intergenic
regions, and thus are not suitable for identifying species-specific
miRNAs, which may represent a substantial fraction of the miRNome
of any given organism.
[0007] Computational methods have also facilitated the prediction
of miRNA targets, and in general plant miRNAs share a high degree
of complementarity with their targets (reviewed by Bonnet et al.
(2006) New Phytol 171:451-468). The predicted mRNA targets of plant
miRNAs encode a wide variety of proteins. Many of these proteins
are transcription factors and are thus likely to be important for
development. However, there are also many enzymes that are
putatively targeted, and these potentially have roles in such
processes as mitochondrial metabolism, oxidative stress response,
proteasome function, and lignification. It is likely that this list
of processes regulated by miRNA will get longer as additional
miRNAs are identified, and that eventually miRNAs will be
implicated in processes critical to crop improvement. For example,
a recently identified miRNA targeting genes in the sulfur
assimilation pathway was identified, and shown to be induced under
conditions of sulfate starvation (Jones-Rhoades and Bartel (2004)
Mol Cell 14: 787-799). This particular miRNA, then, is a candidate
gene for increasing sulfur assimilation efficiency. It is tempting
to speculate that the pathways for assimilating other compounds
such as water and nitrate may also be under miRNA control.
[0008] Much of the work on identification of novel miRNAs has been
carried out in the model system Arabidopsis, and thus miRNomes of
crop plants such as maize, rice and soybean are less fully
understood. There is also no complete genome sequence available for
crops such as maize and soybeans, further hampering miRNome
analysis. Many Arabidopsis miRNAs have homologs in these other
species, however there are also miRNAs that appear to be specific
to Arabidopsis. Likewise, it is expected that there will be
nonconserved miRNAs specific to the aforementioned crop species. A
significant fraction of the non-conserved miRNAs could be part of
the regulatory networks associated with species-specific growth
conditions or developmental processes. As such, it is crucial to
carry out miRNA cloning in crop species such as maize, to
complement the bioinformatic approaches currently being used, and
ultimately to more fully characterize the miRNomes of crop
species.
BRIEF DESCRIPTION OF THE TABLES
Table 1: The table of putative miRNAs consists of 2808 rows of 6
columns, which are
[0009] 1: ID: a unique ID number, which represents the SEQ ID NO
for the corresponding microRNA (miRNA) in that row [0010] 2: miRNA:
the 21 nucleotide maize microRNA sequence [0011] 3: TARGETSEQ: the
exact complement of the miRNA that corresponds to one potential
site for cleavage on the target mRNA [0012] 4: BACKBONE: the
genomic DNA sequence that forms a hairpin structure incorporating
the miRNA sequence [0013] 5: FOLD: secondary structure information
for the backbone sequences based on context free grammar of nested
parentheses, where a "(" represents a nucleotide that hybridizes
with a down stream nucleotide denoted by a ")", and a "."
represents an unpaired nucleotide the resulting structure displays
the hairpin structure formed by the backbone [0014] 6: TARGET:
public ID(s) of possible genomic targets of the miRNA, databases
that were searched included rice genes from the TIGR Version 4 rice
datasets all.cds and all_small_genes.cds; and the TIGR maize gene
index file ZMGI.101205.
Table 4: The table of small RNA expression data for maize microRNAs
of the present invention and public domain Zea mays microRNAs
consists of 2702 rows of 18 columns, which are
[0014] [0015] 1: ID: a unique ID number, which represents the SEQ
ID NO for the corresponding putative microRNA (miRNA) in that row,
or the public domain Zea mays names associated with the miRNA
sequence in that row [0016] 2: MIRNACORE: the .about.21 nucleotide
maize microRNA sequence, also referred to as the "query sequence"
[0017] 3. CALL B73_LEAF: the detectability assessment applied to
the miRNA in that row based on its corresponding expression
profiling measurements in RNA samples derived from B73 leaf tissue.
"PASSED," "ENRICHED" or "HIGHLY ENRICHED" were applied only if the
array data for that miRNA met the specificity, reproducibility and
signal strength criteria in Table 3. "ENRICHED" was applied to
miRNAs showing between 5-fold and 10-fold more perfectly sequence
matched (0MM) probe signal intensity in B73 leaf samples than in
other samples in the same experiment. "HIGHLY ENRICHED" was applied
to miRNAs showing 10-fold more 0MM-probe signal intensity in B73
leaf samples than in other samples in the same experiment. Sample
B73 Leaf and all other samples are described in Table 2 [0018] 4.
0MM B73_LEAF: the normalized fluorescence intensity score of the
perfectly sequence matched probe of the miRNA in that row as
measured in expression profiling of genotype B73 leaf RNA. [0019]
5. CALL B73_EAR: the detectability assessment applied to the miRNA
in that row based on its corresponding expression profiling
measurements in RNA samples derived from B73 ear tissue. [0020] 6.
0MM B73_EAR: the normalized fluorescence intensity score of the
perfectly sequence matched probe of the miRNA in that row as
measured in expression profiling of genotype B73 ear RNA. [0021] 7.
CALL B73_SEEDLING: the detectability assessment applied to the
miRNA in that row based on its corresponding expression profiling
measurements in RNA samples derived from B73 seedling tissue.
[0022] 8. 0MM B73_SEEDLING: the normalized fluorescence intensity
score of the perfectly sequence matched probe of the miRNA in that
row as measured in expression profiling of genotype B73 seedling
RNA. [0023] 9. CALL 3245_Normal_N: the detectability assessment
applied to the miRNA in that row based on its corresponding
expression profiling measurements in RNA samples derived from 3245
leaf tissue grown in fields with normal levels of nitrogen. [0024]
10. 0MM 3245_Normal_N: the normalized fluorescence intensity score
of the perfectly sequence matched probe of the miRNA in that row as
measured in expression profiling of RNA from leaves of genotype
3245 plants grown in fields with normal levels of nitrogen. [0025]
11. CALL 3245_Low_N: the detectability assessment applied to the
miRNA in that row based on its corresponding expression profiling
measurements in RNA samples derived from 3245 leaf tissue grown in
fields with low levels of nitrogen. [0026] 12. 0MM 3245_Low_N: the
normalized fluorescence intensity score of the perfectly sequence
matched probe of the miRNA in that row as measured in expression
profiling of RNA from leaves of genotype 3245 plants grown in
fields with low levels of nitrogen. [0027] 13. CALL 33B50_Low_N:
the detectability assessment applied to the miRNA in that row based
on its corresponding expression profiling measurements in RNA
samples derived from 33B50 leaf tissue grown in fields with low
levels of nitrogen. [0028] 14. 0MM 33B50_Low_N: the normalized
fluorescence intensity score of the perfectly sequence matched
probe of the miRNA in that row as measured in expression profiling
of RNA from leaves of genotype 33B50 plants grown in fields with
low levels of nitrogen. [0029] 15. CALL B73_Low_N: the
detectability assessment applied to the miRNA in that row based on
its corresponding expression profiling measurements in RNA samples
derived from B73 leaf tissue grown with minimal nitrogen
supplementation. [0030] 16. 0MM B73_Low_N: the normalized
fluorescence intensity score of the perfectly sequence matched
probe of the miRNA in that row as measured in expression profiling
of RNA from leaves of genotype B73 plants grown with minimal
nitrogen supplementation. [0031] 17: TARGETSEQ: the exact
complement of the miRNA that corresponds to one potential site for
cleavage on the target mRNA [0032] 18: TARGET: public ID(s) of
possible genomic targets of the putative miRNA, databases that were
searched included rice genes from the TIGR Version 4 rice datasets
all.cds and all_small_genes.cds; and the TIGR maize gene index file
ZMGI.101205.
BRIEF DESCRIPTION OF THE SEQUENCE LISTING
[0033] A Sequence Listing and Table are provided herewith on
Compact Disk. The contents of the Compact Disk containing the
Sequence Listing and Table are hereby incorporated by reference in
compliance with 37 CFR 1.52(e). The Compact Disks are submitted in
triplicate and are identical to one another. The disks are labeled
"Copy 1--Sequence Listing and Table", "Copy 2--Sequence Listing and
Table", and CRF. The disks contain the following files: BB1593 US
PRV Sequence Listing having the following size: 1,471,000 bytes and
BB1593 US PRV Table having the following size: 4,430,000 bytes
which were created Oct. 5, 2006.
[0034] SEQ ID NOs: 1-2652 represent individual 21 nucleotide
microRNA sequences from maize. The individual microRNAs are shown
in Table 1 as the "miRNAcore" column (column 2), the SEQ ID NO for
each sequence is shown in column 1 (ID) of Table 1.
[0035] SEQ ID NOs: 2653-5304 represent the complement of SEQ ID
NOs:1-2652, also shown as "targetseq" in column 3 of Table 1.
[0036] SEQ ID NOs:5305-7956 represent the "backbone" hairpin
sequence that surrounds the miRNAs in SEQ ID NOs:1-2652,
respectively, in the maize genome. This information can also be
found in column 4 of Table 1.
[0037] SEQ ID NO:7957 is a sequential concatenation of all 21
nucleotide miRNAs found in SEQ ID NOs:1-2652
(21.times.2652=55,692). It is believed that this representative
example is one of many different forms that are useful for altering
plant gene expression. Other examples would include different
ordering of the individual miRNA sequences, duplication of certain
miRNA sequences, elimination of certain miRNA sequences, and
altered spacing in between the miRNA sequences.
[0038] SEQ ID NO:7958 is a 21 nucleotide sequence complementary to
the Arabidopsis fatty acid desaturase 2 (FAD2) gene.
[0039] SEQ ID NOs: 7959-8114 represent individual 21 nucleotide
microRNA sequences from maize. The individual microRNAs are shown
in Table 1 as the "miRNAcore" column (column 2), the SEQ ID NO for
each sequence is shown in column 1 (ID) of Table 1.
[0040] SEQ ID NOs: 8115-8270 represent the complement of SEQ ID
NOs:7959-8114, also shown as "targetseq" in column 3 of Table
1.
[0041] SEQ ID NOs:8271-8426 represent the "backbone" hairpin
sequence that surrounds the miRNAs in SEQ ID NOs:7959-8114,
respectively, in the maize genome. This information can also be
found in column 4 of Table 1.
[0042] SEQ ID NO:8427 is a sequential concatenation of all 21
nucleotide miRNAs found in SEQ ID NOs:7959-8114
(21.times.156=3,276). It is believed that this representative
example is one of many different forms that are useful for altering
plant gene expression. Other examples would include different
ordering of the individual miRNA sequences, duplication of certain
miRNA sequences, elimination of certain miRNA sequences, and
altered spacing in between the miRNA sequences.
[0043] SEQ ID NOs:8428-8429 are RNA adaptors sequences.
SUMMARY OF THE INVENTION
[0044] The present invention relates, inter alia, to an isolated
polynucleotide comprising: a microRNA selected from the group
consisting of SEQ ID NOs:1-2652 and SEQ ID NOs:7959-8114.
[0045] In a second embodiment, the invention relates to a
full-length complement of the microRNA selected from the group
consisting of SEQ ID NOs:1-2652 and SEQ ID NOs:7959-8114 or a
nucleotide sequence capable of hybridizing to these aforemention
microRNAs. wherein the hybridizable nucleotide sequence comprises
at least 21 nucleotides.
[0046] In a third embodiment, the invention relates to an isolated
polynucleotide useful for altering plant gene expression comprising
SEQ ID NO:7957 or SEQ ID NO:8427 wherein said isolated
polynucleotide comprises at least one functional domain having at
least 21(x) contiguous nucleotides and x is an integer from 1 to
2652, further wherein said nucleotides start at nucleotide 1 or any
nucleotide 21(x)+1.
[0047] In a fourth embodiment, the invention relates to a
functional subdomain of such isolated polynucleotides, wherein said
functional subdomain comprises at least one microRNA.
[0048] In a fifth embodiment, the invention relates to an isolated
polynucleotide comprising a microRNA containing sequence selected
from the group consisting of SEQ ID NOs: 5305-7956 and SEQ ID
NOs:8271-8426.
[0049] In a sixth embodiment, the invention relates to a DNA
expression construct comprising any of the isolated polynucleotides
discussed herein operably linked to at least one regulatory
sequence.
[0050] In a seventh embodiment, the invention relates to a plant
comprising in its genome the DNA expression constructs discussed
herein. Such plants can be selected from the group consisting of
corn, rice, sorghum, sunflower, millet, soybean, canola, wheat,
barley, oat, beans, and nuts.
[0051] In an eighth embodiment, the invention relates to transgenic
seeds obtained from a plant comprising in its genome the DNA
expression constructs discussed herein. Also within the scope of
the invention are transformed plant tissue or a plant cell
comprising in its genome the DNA expression constructs discussed
herein.
[0052] In an ninth embodiment, the invention relates to by-products
obtained from such transgenic seeds or to progeny plants obtained
from such transgenic seeds.
[0053] In a tenth embodiment, the invention relates to a method for
altering expression of a stably introduced nucleotide sequence in a
plant comprising: [0054] a) making a DNA expression construct
comprising a stably introduced nucleotide sequence and at least one
sequence capable of hybridizing to the isolated polynucleotide of
the invention; [0055] b) transforming a plant with the DNA
expression construct of part (a); and [0056] c) selecting a
transformed plant which comprises the DNA expression construct of
part (a) in its genome and which has altered expression of the
stably introduced nucleotide sequence when compared to a plant
transformed with a modified version of the DNA expression construct
of part (a) wherein the modified construct lacks the sequence
capable of hybridizing to the isolated polynucleotide of the
invention.
DETAILED DESCRIPTION
[0057] Information pertinent to this application can be found in
U.S. patent application Ser. Nos. 10/963,238 and 10/963,394, filed
Oct. 12, 2004. The entire contents of the above applications are
herein incorporated by reference.
[0058] Other references that may be useful in understanding the
invention include U.S. patent application Ser. No. 10/883,374,
filed Jul. 1, 2004; U.S. patent application Ser. No. 10/913,288,
filed Aug. 6, 2004; and U.S. patent application Ser. No.
11/334,776, filed Jan. 6, 2006.
[0059] Recently discovered small RNAs play an important role in
controlling gene expression. Regulation of many developmental
processes including flowering is controlled by small RNAs. It is
now possible to engineer changes in gene expression of plant genes
by using transgenic constructs which produce small RNAs in the
plant.
[0060] The invention provides methods and compositions useful for
suppressing targeted sequences. The compositions can be employed in
any type of plant cell, and in other cells which comprise the
appropriate processing components (e.g., RNA interference
components), including invertebrate and vertebrate animal cells.
The compositions and methods are based on an endogenous miRNA
silencing process discovered in Arabidopsis, a similar strategy can
be used to extend the number of compositions and the organisms in
which the methods are used. The methods can be adapted to work in
any eukaryotic cell system. Additionally, the compositions and
methods described herein can be used in individual cells, cells or
tissue in culture, or in vivo in organisms, or in organs or other
portions of organisms.
[0061] The compositions selectively suppress the target sequence by
encoding a miRNA having substantial complementarity to a region of
the target sequence. The miRNA is provided in a nucleic acid
construct which, when transcribed into RNA, is predicted to form a
hairpin structure which is processed by the cell to generate the
miRNA, which then suppresses expression of the target sequence.
[0062] Nucleic acid sequences are disclosed that encode miRNAs from
maize. Backbone hairpins containing the individual miRNA sequences
are also disclosed. Constructs are described for transgenic
expression of miRNAs and their backbones. Alternatively, constructs
are described wherein backbone sequences and miRNA sequences are
exchanged thereby altering the expression pattern of the miRNA, and
its subsequent specific target sequence in the transgenic host. Any
miRNA can be exchanged with any other backbone to create a new
miRNA/backbone hybrid.
[0063] A method for suppressing a target sequence is provided. The
method employs any of the constructs above, in which a miRNA is
designed to identify a region of the target sequence, and inserted
into the construct. Upon introduction into a cell, the miRNA
produced suppresses expression of the targeted sequence. The target
sequence can be an endogenous plant sequence, or a heterologous
transgene in the plant.
[0064] There can also be mentioned as the target gene, for example,
a gene from a plant pathogen, such as a pathogenic virus, nematode,
insect, or mold or fungus.
[0065] Another aspect of the invention concerns a plant, cell, and
seed comprising the construct and/or the miRNA. Typically, the cell
will be a cell from a plant, but other prokaryotic or eukaryotic
cells are also contemplated, including but not limited to viral,
bacterial, yeast, insect, nematode, or animal cells. Plant cells
include cells from monocots and dicots. The invention also provides
plants and seeds comprising the construct and/or the miRNA.
[0066] "Plant" includes reference to whole plants, plant organs,
plant tissues, seeds and plant cells and progeny of same. Plant
cells include, without limitation, cells from seeds, suspension
cultures, embryos, meristematic regions, callus tissue, leaves,
roots, shoots, gametophytes, sporophytes, pollen, and
microspores.
[0067] The term "plant parts" includes differentiated and
undifferentiated tissues including, but not limited to the
following: roots, stems, shoots, leaves, pollen, seeds, tumor
tissue and various forms of cells and culture (e.g., single cells,
protoplasts, embryos and callus tissue). The plant tissue may be in
plant or in a plant organ, tissue or cell culture.
[0068] The term "plant organ" refers to plant tissue or group of
tissues that constitute a morphologically and functionally distinct
part of a plant.
[0069] The term "genome" refers to the following: (1) the entire
complement of genetic material (genes and non-coding sequences)
present in each cell of an organism, or virus or organelle; (2) a
complete set of chromosomes inherited as a (haploid) unit from one
parent.
[0070] "Progeny" comprises any subsequent generation of a plant.
Progeny will inherit, and stably segregate, genes and transgenes
from its parent plant(s).
[0071] Units, prefixes, and symbols may be denoted in their Si
accepted form. Unless otherwise indicated, nucleic acids are
written left to right in 5' to 3' orientation; amino acid sequences
are written left to right in amino to carboxyl orientation,
respectively. Numeric ranges recited within the specification are
inclusive of the numbers defining the range and include each
integer within the defined range. Amino acids may be referred to
herein by either commonly known three letter symbols or by the
one-letter symbols recommended by the IUPAC-IUB Biochemical
Nomenclature Commission. Nucleotides, likewise, may be referred to
by their commonly accepted single-letter codes. Unless otherwise
provided for, software, electrical, and electronics terms as used
herein are as defined in The New IEEE Standard Dictionary of
Electrical and Electronics Terms (5.sup.th edition, 1993). The
terms defined below are more fully defined by reference to the
specification as a whole.
[0072] The terms "recombinant construct", "expression construct",
"chimeric construct", "construct", and "recombinant DNA construct"
are used interchangeably herein. A recombinant construct comprises
an artificial combination of nucleic acid fragments, e.g.,
regulatory and coding sequences that are not found together in
nature. For example, a chimeric construct may comprise regulatory
sequences and coding sequences that are derived from different
sources, or regulatory sequences and coding sequences derived from
the same source, but arranged in a manner different than that found
in nature. Such a construct may be used by itself or may be used in
conjunction with a vector. If a vector is used, then the choice of
vector is dependent upon the method that will be used to transform
host cells as is well known to those skilled in the art. For
example, a plasmid vector can be used. The skilled artisan is well
aware of the genetic elements that must be present on the vector in
order to successfully transform, select and propagate host cells
comprising any of the isolated nucleic acid fragments of the
invention. The skilled artisan will also recognize that different
independent transformation events will result in different levels
and patterns of expression (Jones et al., EMBO J. 4:2411-2418
(1985); De Almeida et al., Mol. Gen. Genetics 218:78-86 (1989)),
and thus that multiple events must be screened in order to obtain
lines displaying the desired expression level and pattern. Such
screening may be accomplished by Southern analysis of DNA, Northern
analysis of mRNA expression, immunoblotting analysis of protein
expression, or phenotypic analysis, among others.
[0073] This construct may comprise any combination of
deoxyribonucleotides, ribonucleotides, and/or modified nucleotides.
The construct may be transcribed to form an RNA, wherein the RNA
may be capable of forming a double-stranded RNA and/or hairpin
structure. This construct may be expressed in the cell, or isolated
or synthetically produced. The construct may further comprise a
promoter, or other sequences which facilitate manipulation or
expression of the construct.
[0074] As used here "suppression" or "silencing" or "inhibition"
are used interchangeably to denote the down-regulation of the
expression of a product of a target sequence relative to its normal
expression level in a wild type organism. Suppression includes
expression that is decreased by about 10%, 15%, 20%, 25%, 30%, 35%,
40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%
relative to the wild type expression level.
[0075] As used herein, "encodes" or "encoding" refers to a DNA
sequence which can be processed to generate an RNA and/or
polypeptide.
[0076] As used herein, "expression" or "expressing" refers to
production of a functional product, such as, the generation of an
RNA transcript from an introduced construct, an endogenous DNA
sequence, or a stably incorporated heterologous DNA sequence. The
term may also refer to a polypeptide produced from an mRNA
generated from any of the above DNA precursors. Thus, expression of
a nucleic acid fragment may refer to transcription of the nucleic
acid fragment (e.g., transcription resulting in mRNA or other
functional RNA) and/or translation of RNA into a precursor or
mature protein (polypeptide).
[0077] As used herein, "heterologous" with respect to a sequence
means a sequence that originates from a foreign species, or, if
from the same species, is substantially modified from its native
form in composition and/or genomic locus by deliberate human
intervention. For example, with respect to a nucleic acid, it can
be a nucleic acid that originates from a foreign species, or is
synthetically designed, or, if from the same species, is
substantially modified from its native form in composition and/or
genomic locus by deliberate human intervention. A heterologous
protein may originate from a foreign species or, if from the same
species, is substantially modified from its original form by
deliberate human intervention.
[0078] The term "host cell" refers to a cell which contains or into
which is introduced a nucleic acid construct and supports the
replication and/or expression of the construct. Host cells may be
prokaryotic cells such as E. coli, or eukaryotic cells such as
fungi, yeast, insect, amphibian, nematode, or mammalian cells.
Alternatively, the host cells are monocotyledonous or
dicotyledonous plant cells. An example of a monocotyledonous host
cell is a maize host cell.
[0079] The term "introduced" means providing a nucleic acid (e.g.,
expression construct) or protein into a cell. Introduced includes
reference to the incorporation of a nucleic acid into a eukaryotic
or prokaryotic cell where the nucleic acid may be incorporated into
the genome of the cell, and includes reference to the transient
provision of a nucleic acid or protein to the cell. Introduced
includes reference to stable or transient transformation methods,
as well as sexually crossing. Thus, "introduced" in the context of
inserting a nucleic acid fragment (e.g., a recombinant DNA
construct/expression construct) into ac ell, means "transfection"
or "transformation" or "transduction" and includes reference to the
incorporation of a nucleic acid fragment into a eukaryotic or
prokaryotic cell where the nucleic acid fragment may be
incorporated into the genome of the cell (e.g., chromosome,
plasmid, plastid or mitochondrial DNA), converted into an
autonomous replicon, or transiently expressed (e.g., transfected
mRNA).
[0080] The term "genome" as it applies to a plant cells encompasses
not only chromosomal DNA found within the nucleus, but organelle
DNA found within subcellular components (e.g., mitochondrial,
plastid) of the cell.
[0081] The term "isolated" refers to material, such as a nucleic
acid or a protein, which is: (1) substantially or essentially free
from components which normally accompany or interact with the
material as found in its naturally occurring environment or (2) if
the material is in its natural environment, the material has been
altered by deliberate human intervention to a composition and/or
placed at a locus in the cell other than the locus native to the
material.
[0082] As used herein, microRNA or "miRNA" refers to an
oligoribonucleic acid, which regulates expression of a
polynucleotide comprising the target sequence. A "mature miRNA"
refers to the miRNA generated from the processing of a miRNA
precursor. A "miRNA template" is an oligonucleotide region, or
regions, in a nucleic acid construct which encodes the miRNA. The
"backside" region of a miRNA is a portion of a polynucleotide
construct which is substantially complementary to the miRNA
template and is predicted to base pair with the miRNA template. The
miRNA template and backside may form a double-stranded
polynucleotide, including a hairpin structure.
[0083] As used herein, "domain" or "functional domain" refer to
nucleic acid sequence(s) that are capable of eliciting a biological
response in plants. The present invention concerns miRNAs composed
of at least 21 nucleotide sequences acting either individually, or
in concert with other miRNA sequences, therefore a domain could
refer to either individual miRNAs or groups of miRNAs. Also, miRNA
sequences associated with their backbone sequences could be
considered domains useful for processing the miRNA into its active
form. As used herein, "subdomains" or "functional subdomains" refer
to subsequences of domains that are capable of eliciting a
biological response in plants. A miRNA could be considered a
subdomain of a backbone sequence. "Contiguous" sequences or domains
refer to sequences that are sequentially linked without added
nucleotides intervening between the domains. An example of a
contiguous domain string is found in SEQ ID NO:7957 which
represents SEQ ID NOs: 1-2652 as a continuous string that can be
thought of as 2652 miRNA sequences linked together in a sequential
concatenation.
[0084] As used herein, the phrases "target sequence" and "sequence
of interest" are used interchangeably. Target sequence is used to
mean the nucleic acid sequence that is selected for alteration
(e.g., suppression) of expression, and is not limited to
polynucleotides encoding polypeptides. The target sequence
comprises a sequence that is substantially or fully complementary
to the miRNA. The target sequence includes, but is not limited to,
RNA, DNA, or a polynucleotide comprising the target sequence. As
discussed in Bartel and Bartel (2003) Plant Phys. 132:709-719, most
microRNA sequences are 20-22 nucleotides with anywhere from 0-3
mismatches when compared to their target sequences.
[0085] It is understood that microRNA sequences, such as the 21
nucleotide sequences of the present invention, may still be
functional as shorter (20 nucleotide) or longer (22 nucleotide)
sequences. In addition, some nucleotide substitutions, particularly
at the last two nucleotides of the 3' end of the microRNA sequence,
may be useful in retaining at least some microRNA function.
[0086] As used herein, "nucleic acid" means a polynucleotide and
includes single or double-stranded polymer of deoxyribonucleotide
or ribonucleotide bases. Nucleic acids may also include fragments
and modified nucleotides. Thus, the terms "polynucleotide",
"nucleic acid sequence", "nucleotide sequence" or "nucleic acid
fragment" are used interchangeably and is a polymer of RNA or DNA
that is single- or double-stranded, optionally containing
synthetic, non-natural or altered nucleotide bases. Nucleotides
(usually found in their 5'-monophosphate form) are referred to by
their single letter designation as follows: "A" for adenylate or
deoxyadenylate (for RNA or DNA, respectively), "C" for cytidylate
or deosycytidylate, "G" for guanylate or deoxyguanylate, "U" for
uridlate, "T" for deosythymidylate, "R" for purines (A or G), "Y"
for pyrimidiens (Cor T), "K" for G or T, "H" for A or C or T, "I"
for inosine, and "N" for any nucleotide.
[0087] By "nucleic acid library" is meant a collection of isolated
DNA or RNA molecules which comprise and substantially represent the
entire transcribed fraction of a genome of a specified organism or
of a tissue from that organism. Construction of exemplary nucleic
acid libraries, such as genomic and cDNA libraries, is taught in
standard molecular biology references such as Berger and Kimmel,
Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol.
152, Academic Press, Inc., San Diego, Calif. (Berger); Sambrook et
al., Molecular Cloning--A Laboratory Manual, 2nd ed., Vol. 1-3
(1989); and Current Protocols in Molecular Biology, F. M. Ausubel
et al., Eds., Current Protocols, a joint venture between Greene
Publishing Associates, Inc. and John Wiley & Sons, Inc.
(1994).
[0088] As used herein "operably linked" includes reference to a
functional linkage of at least two sequences. Operably linked
includes linkage between a promoter and a second sequence, wherein
the promoter sequence initiates and mediates transcription of the
DNA sequence corresponding to the second sequence.
[0089] As used herein, "plant" includes plants and plant parts
including but not limited to plant cells, plant tissue such as
leaves, stems, roots, flowers, and seeds.
[0090] As used herein, "polypeptide" means proteins, protein
fragments, modified proteins, amino acid sequences and synthetic
amino acid sequences. The polypeptide can be glycosylated or
not.
[0091] As used herein, "promoter" refers to a nucleic acid
fragment, e.g., a region of DNA, that is involved in recognition
and binding of an RNA polymerase and other proteins to initiate
transcription. In other words, this nucleic acid fragment is
capable of controlling transcription of another nucleic acid
fragment.
[0092] The term "selectively hybridizes" includes reference to
hybridization, under stringent hybridization conditions, of a
nucleic acid sequence to a specified nucleic acid target sequence
to a detectably greater degree (e.g., at least 2-fold over
background) than its hybridization to non-target nucleic acid
sequences and to the substantial exclusion of non-target nucleic
acids. Selectively hybridizing sequences typically have about at
least 80% sequence identity, or 90% sequence identity, up to and
including 100% sequence identity (i.e., fully complementary) with
each other.
[0093] The term "stringent conditions" or "stringent hybridization
conditions" includes reference to conditions under which a probe
will selectively hybridize to its target sequence. Stringent
conditions are sequence-dependent and will be different in
different circumstances. By controlling the stringency of the
hybridization and/or washing conditions, target sequences can be
identified which are 100% complementary to the probe (homologous
probing). Alternatively, stringency conditions can be adjusted to
allow some mismatching in sequences so that lower degrees of
similarity are detected (heterologous probing). Generally, a probe
is less than about 1000 nucleotides in length, optionally less than
500 nucleotides in length.
[0094] Typically, stringent conditions will be those in which the
salt concentration is less than about 1.5 M Na ion, typically about
0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to
8.3 and the temperature is at least about 30.degree. C. for short
probes (e.g., 10 to 50 nucleotides) and at least about 60.degree.
C. for long probes (e.g., greater than 50 nucleotides). Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide. Exemplary low stringency conditions
include hybridization with a buffer solution of 30 to 35%
formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37.degree.
C., and a wash in 1.times. to 2.times.SSC (20.times.SSC=3.0 M
NaCl/0.3 M trisodium citrate) at 50 to 55.degree. C. Exemplary
moderate stringency conditions include hybridization in 40 to 45%
formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.5.times. to 1.times.SSC at 55 to 60.degree. C. Exemplary high
stringency conditions include hybridization in 50% formamide, 1 M
NaCl, 1% SDS at 37.degree. C., and a wash in 0.1.times.SSC at 60 to
65.degree. C.
[0095] Specificity is typically the function of post-hybridization
washes, the critical factors being the ionic strength and
temperature of the final wash solution. For DNA-DNA hybrids, the
T.sub.m can be approximated from the equation of Meinkoth and Wahl,
Anal. Biochem., 138:267-284 (1984): T.sub.m=81.5.degree. C.+16.6
(log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of
monovalent cations, % GC is the percentage of guanosine and
cytosine nucleotides in the DNA, % form is the percentage of
formamide in the hybridization solution, and L is the length of the
hybrid in base pairs. The T.sub.m is the temperature (under defined
ionic strength and pH) at which 50% of a complementary target
sequence hybridizes to a perfectly matched probe. T.sub.m is
reduced by about 1.degree. C. for each 1% of mismatching; thus,
T.sub.m, hybridization and/or wash conditions can be adjusted to
hybridize to sequences of the desired identity. For example, if
sequences with >90% identity are sought, the T.sub.m can be
decreased 10.degree. C. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the thermal melting
point (T.sub.m) for the specific sequence and its complement at a
defined ionic strength and pH. However, severely stringent
conditions can utilize a hybridization and/or wash at 1, 2, 3, or
4.degree. C. lower than the thermal melting point (T.sub.m);
moderately stringent conditions can utilize a hybridization and/or
wash at 6, 7, 8, 9, or 10.degree. C. lower than the thermal melting
point (T.sub.m); low stringency conditions can utilize a
hybridization and/or wash at 11, 12, 13, 14, 15, or 20.degree. C.
lower than the thermal melting point (T.sub.m). Using the equation,
hybridization and wash compositions, and desired T.sub.m, those of
ordinary skill will understand that variations in the stringency of
hybridization and/or wash solutions are inherently described. If
the desired degree of mismatching results in a T.sub.m of less than
45.degree. C. (aqueous solution) or 32.degree. C. (formamide
solution) it is preferred to increase the SSC concentration so that
a higher temperature can be used. An extensive guide to the
hybridization of nucleic acids is found in Tijssen, Laboratory
Techniques in Biochemistry and Molecular Biology--Hybridization
with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles
of hybridization and the strategy of nucleic acid probe assays",
Elsevier, New York (1993); and Current Protocols in Molecular
Biology, Chapter 2, Ausubel et al., Eds., Greene Publishing and
Wiley-Interscience, New York (1995). Hybridization and/or wash
conditions can be applied for at least 10, 30, 60, 90, 120, or 240
minutes.
[0096] The terms "reliable detection" and "reliably detected" are
defined herein to mean the reproducible detection of measurable,
sequence-specific signal intensity above background noise.
[0097] As used herein, "transgenic" refers to a plant or a cell
which comprises within its genome a heterologous polynucleotide.
Preferably, the heterologous polynucleotide is stably integrated
within the genome such that the polynucleotide is passed on, or
heritable, to successive generations. The heterologous
polynucleotide may be integrated into the genome alone or as part
of an expression construct. Transgenic is used herein to include
any cell, cell line, callus, tissue, plant part or plant, the
genotype of which has been altered by the presence of heterologous
nucleic acid including those transgenics initially so altered as
well as those created by sexual crosses or asexual propagation from
the initial transgenic. The term "transgenic" as used herein does
not encompass the alteration of the genome (chromosomal or
extra-chromosomal) by conventional plant breeding methods or by
naturally occurring events such as random cross-fertilization,
non-recombinant viral infection, non-recombinant bacterial
transformation, non-recombinant transposition, or spontaneous
mutation.
[0098] As used herein, "vector" refers to a small nucleic acid
molecule (plasmid, virus, bacteriophage, artificial or cut DNA
molecule) that can be used to deliver a polynucleotide of the
invention into a host cell. Vectors are capable of being replicated
and contain cloning sites for introduction of a foreign
polynucleotide, Thus, expression vectors permit transcription of a
nucleic acid inserted therein.
[0099] Polynucleotide sequences may have substantial identity,
substantial homology, or substantial complementarity to the
selected region of the target gene. As used herein "substantial
identity" and "substantial homology" indicate sequences that have
sequence identity or homology to each other. Generally, sequences
that are substantially identical or substantially homologous will
have about 75%, 80%, 85%, 90%, 95%, or 100% sequence identity
wherein the percent sequence identity is based on the entire
sequence and is determined by GAP alignment using default
parameters (GCG, GAP version 10, Accelrys, San Diego, Calif.). GAP
uses the algorithm of Needleman and Wunsch (J. Mol. Biol.
48:443-453, 1970) to find the alignment of two complete sequences
that maximizes the number of matches and minimizes the number of
sequence gaps. Sequences which have 100% identity are identical.
"Substantial complementarity" refers to sequences that are
complementary to each other, and are able to base pair with each
other. In describing complementary sequences, if all the
nucleotides in the first sequence will base pair to the second
sequence, these sequences are fully or completely
complementary.
[0100] The present invention relates, inter alia, to an isolated
polynucleotide comprising: a microRNA selected from the group
consisting of SEQ ID NOs:1-2652 and SEQ ID NOs:7959-8114.
[0101] In a second embodiment, the invention relates to a
full-length complement of the microRNA of selected from the group
consisting of SEQ ID NOs:1-2652 and SEQ ID NOs:7959-8114, or a
nucleotide sequence capable of hybridizing to these aforemention
microRNAs. wherein the hybridizable nucleotide sequence comprises
at least 21 nucleotides.
[0102] In a third embodiment, the invention relates to an isolated
polynucleotide useful for altering plant gene expression comprising
SEQ ID NO:7957 or SEQ ID NO:8427 wherein said isolated
polynucleotide comprises at least one functional domain having at
least 21(x) contiguous nucleotides and x is an integer from 1 to
2652, further wherein said nucleotides start at nucleotide 1 or any
nucleotide 21(x)+1.
[0103] In a fourth embodiment, the invention relates to a
functional subdomain of such isolated polynucleotides, wherein said
functional subdomain comprises at least one microRNA.
[0104] In a fifth embodiment, the invention relates to an isolated
polynucleotide comprising: a microRNA containing sequence selected
from the group consisting of SEQ ID NOs:5305-7956 and SEQ ID
NOs:8271-8426.
[0105] Computational identification of miRNAs was accomplished from
size selected small RNA libraries from leaf, drought-stressed leaf,
seed, and various other tissues.
[0106] In some embodiments, the miRNA template, (i.e. the
polynucleotide encoding the miRNA), and thereby the miRNA, may
comprise some mismatches relative to the target sequence. In some
embodiments the miRNA template has >1 nucleotide mismatch as
compared to the target sequence, for example, the miRNA template
can have 1, 2, 3, 4, 5, or more mismatches as compared to the
target sequence. This degree of mismatch may also be described by
determining the percent identity of the miRNA template to the
complement of the target sequence. For example, the miRNA template
may have a percent identity including about at least 70%, 75%, 77%,
78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to
the complement of the target sequence.
[0107] In some embodiments, the miRNA template, (i.e. the
polynucleotide encoding the miRNA) and thereby the miRNA, may
comprise some mismatches relative to the miRNA backside. In some
embodiments the miRNA template has .gtoreq.1 nucleotide mismatch as
compared to the miRNA backside, for example, the miRNA template can
have 1, 2, 3, 4, 5, or more mismatches as compared to the miRNA
backside. This degree of mismatch may also be described by
determining the percent identity of the miRNA template to the
complement of the miRNA backside. For example, the miRNA template
may have a percent identity including about at least 70%, 75%, 77%,
78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to
the complement of the miRNA backside.
[0108] In some embodiments, the target sequence is selected from a
plant pathogen. Plants or cells comprising a miRNA directed to the
target sequence of the pathogen are expected to have decreased
sensitivity and/or increased resistance to the pathogen. In some
embodiments, the miRNA is encoded by a nucleic acid construct
further comprising an operably linked promoter. In some
embodiments, the promoter is a pathogen-inducible promoter.
[0109] In another embodiment, there is provided a nucleic acid
construct for suppressing a target sequence. The nucleic acid
construct encodes a miRNA substantially complementary to the
target. In some embodiments, the nucleic acid construct further
comprises a promoter operably linked to the polynucleotide encoding
the miRNA. In some embodiments, the nucleic acid construct lacking
a promoter is designed and introduced in such a way that it becomes
operably linked to a promoter upon integration in the host genome.
In some embodiments, the nucleic acid construct is integrated using
recombination, including site-specific recombination. See, for
example, WO 99/25821, herein incorporated by reference. In some
embodiments, the nucleic acid construct is an RNA. In some
embodiments, the nucleic acid construct comprises at least one
recombination site, including site-specific recombination sites. In
some embodiments the nucleic acid construct comprises at least one
recombination site in order to facilitate integration,
modification, or cloning of the construct. In some embodiments the
nucleic acid construct comprises two site-specific recombination
sites flanking the miRNA precursor. In some embodiments the
site-specific recombination sites include FRT sites, lox sites, or
att sites, including attB, attL, attP or attR sites. See, for
example, WO 99/25821, and U.S. Pat. Nos. 5,888,732, 6,143,557,
6,171,861, 6,270,969, and 6,277,608, herein incorporated by
reference.
[0110] In a sixth embodiment, the invention relates to a DNA
expression construct comprising any of the isolated polynucleotides
discussed herein operably linked to at least one regulatory
sequence.
[0111] In a seventh embodiment, the invention relates to a plant
comprising in its genome the DNA expression constructs discussed
herein. Such plants can be selected from the group consisting of
corn, rice, sorghum, sunflower, millet, soybean, canola, wheat,
barley, oat, beans, and nuts.
[0112] In a eighth embodiment, the invention relates to transgenic
seeds obtained from a plant comprising in its genome the DNA
expression constructs discussed herein. Also within the scope of
the invention are transformed plant tissue or a plant cell
comprising in its genome the DNA expression constructs discussed
herein.
[0113] In an ninth embodiment, the invention relates to by-products
and progeny plants obtained from such transgenic seeds.
[0114] In another embodiment, the nucleic acid construct comprises
an isolated polynucleotide comprising a polynucleotide which
encodes a modified plant miRNA precursor, the modified precursor
comprising a first and a second oligonucleotide, wherein at least
one of the first or the second oligonucleotides is heterologous to
the precursor, wherein the first oligonucleotide is substantially
complementary to the second oligonucleotide, and the second
oligonucleotide comprises a miRNA substantially complementary to
the target sequence, wherein the precursor is capable of forming a
hairpin.
[0115] In some embodiments there are provided cells, plants, and
seeds comprising the introduced polynucleotides, and/or produced by
the methods of the invention. The cells include prokaryotic and
eukaryotic cells, including but not limited to bacteria, yeast,
fungi, viral, invertebrate, vertebrate, and plant cells. Plants,
plant cells, and seeds of the invention include gynosperms,
monocots and dicots, including but not limited to, for example,
rice, wheat, oats, barley, millet, sorghum, soy, sunflower,
safflower, canola, alfalfa, cotton, Arabidopsis, and tobacco.
[0116] As used herein, "by-products" refer to any product,
fraction, or material produced from the processing of the seed.
Corn kernels (seeds) are subjected to both wet and dry milling. The
goal of both processes is to separate the germ, the endosperm, and
the pericarp (hull). Wet milling separates the chemical
constituents of corn into starch, protein, oil, and fiber
fractions.
[0117] The present invention concerns methods and compositions
useful in suppression of a target sequence and/or validation of
function. The invention also relates to a method for using microRNA
(miRNA) mediated RNA interference (RNAi) to silence or suppress a
target sequence to evaluate function, or to validate a target
sequence for phenotypic effect and/or trait development.
Specifically, the invention relates to constructs comprising small
nucleic acid molecules, miRNAs, capable of inducing silencing, and
methods of using these miRNAs to selectively silence target
sequences.
[0118] RNA interference refers to the process of sequence-specific
post-transcriptional gene silencing in animals mediated by short
interfering RNAs (siRNAs) (Fire et al., Nature 391:806 1998). The
corresponding process in plants is commonly referred to as
post-transcriptional gene silencing (PTGS) or RNA silencing and is
also referred to as quelling in fungi. The process of
post-transcriptional gene silencing is thought to be an
evolutionarily-conserved cellular defense mechanism used to prevent
the expression of foreign genes and is commonly shared by diverse
flora and phyla (Fire et al., Trends Genet. 15:358 1999). Such
protection from foreign gene expression may have evolved in
response to the production of double-stranded RNAs (dsRNAs) derived
from viral infection or from the random integration of transposon
elements into a host genome via a cellular response that
specifically destroys homologous single-stranded RNA of viral
genomic RNA. The presence of dsRNA in cells triggers the RNAi
response through a mechanism that has yet to be fully
characterized.
[0119] The presence of long dsRNAs in cells stimulates the activity
of a ribonuclease III enzyme referred to as "dicer". Dicer is
involved in the processing of the dsRNA into short pieces of dsRNA
known as short interfering RNAs (siRNAs) (Berstein et al., Nature
409:363 2001) and/or pre miRNAs into miRNAs. Short interfering RNAs
derived from dicer activity are typically about 21 to about 23
nucleotides in length and comprise about 19 base pair duplexes
(Elbashir et al., Genes Dev. 15:188 2001). Dicer has also been
implicated in the excision of 21- and 22-nucleotide small temporal
RNAs (stRNAs) from precursor RNA of conserved structure that are
implicated in translational control (Hutvagner et al., 2001,
Science 293:834). The RNAi response also features an endonuclease
complex, commonly referred to as an RNA-induced silencing complex
(RISC), which mediates cleavage of single-stranded RNA having
sequence complementarity to the antisense strand of the siRNA
duplex. Cleavage of the target RNA takes place in the middle of the
region complementary to the antisense strand of the siRNA duplex
(Elbashir et al., Genes Dev. 15:188 2001). In addition, RNA
interference can also involve small RNA (e.g., microRNA, or miRNA)
mediated gene silencing, presumably through cellular mechanisms
that regulate chromatin structure and thereby prevent transcription
of target gene sequences (see, e.g., Allshire, Science
297:1818-1819 2002; Volpe et al., Science 297:1833-1837 2002;
Jenuwein, Science 297:2215-2218 2002; and Hall et al., Science
297:2232-2237 2002). As such, miRNA molecules of the invention can
be used to mediate gene silencing via interaction with RNA
transcripts or alternately by interaction with particular gene
sequences, wherein such interaction results in gene silencing
either at the transcriptional or post-transcriptional level.
[0120] RNAi has been studied in a variety of systems. Fire et al.
(Nature 391:806 1998) were the first to observe RNAi in C. elegans.
Wianny and Goetz (Nature Cell Biol. 2:70 1999) describe RNAi
mediated by dsRNA in mouse embryos. Hammond et al. (Nature 404:293
2000) describe RNAi in Drosophila cells transfected with dsRNA.
Elbashir et al., (Nature 411:494 2001) describe RNAi induced by
introduction of duplexes of synthetic 21-nucleotide RNAs in
cultured mammalian cells including human embryonic kidney and HeLa
cells.
[0121] Small RNAs play an important role in controlling gene
expression. Regulation of many developmental processes, including
flowering, is controlled by small RNAs. It is now possible to
engineer changes in gene expression of plant genes by using
transgenic constructs which produce small RNAs in the plant.
[0122] Small RNAs appear to function by base-pairing to
complementary RNA or DNA target sequences. When bound to RNA, small
RNAs trigger either RNA cleavage or translational inhibition of the
target sequence. When bound to DNA target sequences, it is thought
that small RNAs can mediate DNA methylation of the target sequence.
The consequence of these events, regardless of the specific
mechanism, is that gene expression is inhibited.
[0123] MicroRNAs (miRNAs) are noncoding RNAs of about 19 to about
24 nucleotides (nt) in length that have been identified in both
animals and plants (Lagos-Quintana et al., Science 294:853-858
2001, Lagos-Quintana et al., Curr. Biol. 12:735-739 2002; Lau et
al., Science 294:858-862 2001; Lee and Ambros, Science 294:862-864
2001; Llave et al., Plant Cell 14:1605-1619 2002; Mourelatos et
al., Genes. Dev. 16:720-728 2002; Park et al., Curr. Biol.
12:1484-1495 2002; Reinhart et al., Genes. Dev. 16:1616-1626 2002).
They are processed from longer precursor transcripts that range in
size from approximately 70 to 200 nt, and these precursor
transcripts have the ability to form stable hairpin structures. In
animals, the enzyme involved in processing miRNA precursors is
called Dicer, an RNAse III-like protein (Grishok et al., Cell
106:23-34 2001; Hutvagner et al., Science 293:834-838 2001; Ketting
et al., Genes. Dev. 15:2654-2659 2001). Plants also have a
Dicer-like enzyme, DCL1 (previously named CARPEL FACTORY/SHORT
INTEGUMENTS1/SUSPENSOR1), and recent evidence indicates that it,
like Dicer, is involved in processing the hairpin precursors to
generate mature miRNAs (Park et al., Curr. Biol. 12:1484-1495 2002;
Reinhart et al., Genes. Dev. 16:1616-1626 2002). Furthermore, it is
becoming clear from recent work that at least some miRNA hairpin
precursors originate as longer polyadenylated transcripts, and
several different miRNAs and associated hairpins can be present in
a single transcript (Lagos-Quintana et al., Science 294:853-858
2001; Lee et al., EMBO J. 21:4663-4670 2002). Recent work has also
examined the selection of the miRNA strand from the dsRNA product
arising from processing of the hairpin by DICER (Schwartz et al.,
2003, Cell 115:199-208). It appears that the stability (i.e. G:C
vs. A:U content, and/or mismatches) of the two ends of the
processed dsRNA affects the strand selection, with the low
stability end being easier to unwind by a helicase activity. The 5'
end strand at the low stability end is incorporated into the RISC
complex, while the other strand is degraded.
[0124] In animals, there is direct evidence indicating a role for
specific miRNAs in development. The lin-4 and let-7 miRNAs in C.
elegans have been found to control temporal development, based on
the phenotypes generated when the genes producing the lin-4 and
let-7 miRNAs are mutated (Lee et al., Cell 75:843-854 1993;
Reinhart et al., Nature 403-901-906 2000). In addition, both miRNAs
display a temporal expression pattern consistent with their roles
in developmental timing. Other animal miRNAs display
developmentally regulated patterns of expression, both temporal and
tissue-specific (Lagos-Quintana et al., Science 294:853-853 2001,
Lagos-Quintana et al., Curr. Biol. 12:735-739 2002; Lau et al.,
Science 294:858-862 2001; Lee and Ambros, Science 294:862-864
2001), leading to the hypothesis that miRNAs may, in many cases, be
involved in the regulation of important developmental processes.
Likewise, in plants, the differential expression patterns of many
miRNAs suggests a role in development (Llave et al., Plant Cell
14:1605-1619 2002; Park et al., Curr. Biol. 12:1484-1495 2002;
Reinhart et al., Genes. Dev. 16:1616-1626 2002). However, a
developmental role for miRNAs has not been directly proven in
plants, because to date there has been no report of a developmental
phenotype associated with a specific plant miRNA.
[0125] MicroRNAs appear to regulate target genes by binding to
complementary sequences located in the transcripts produced by
these genes. In the case of lin-4 and let-7, the target sites are
located in the 3' UTRs of the target mRNAs (Lee et al., Cell
75:843-854 1993; Wightman et al., Cell 75:855-862 1993; Reinhart et
al., Nature 403:901-906 2000; Slack et al., Mol. Cell. 5:659-669
2000), and there are several mismatches between the lin-4 and let-7
miRNAs and their target sites. Binding of the lin-4 or let-7 miRNA
appears to cause downregulation of steady-state levels of the
protein encoded by the target mRNA without affecting the transcript
itself (Olsen and Ambros, Dev. Biol. 216:671-680 1999). On the
other hand, recent evidence suggests that miRNAs can, in some
cases, cause specific RNA cleavage of the target transcript within
the target site, and this cleavage step appears to require 100%
complementarity between the miRNA and the target transcript
(Hutvagner and Zamore, Science 297:2056-2060 2002; Llave et al.,
Plant Cell 14:1605-1619 2002). It seems likely that miRNAs can
enter at least two pathways of target gene regulation: Protein
downregulation when target complementarity is <100%, and RNA
cleavage when target complementarity is 100%. MicroRNAs entering
the RNA cleavage pathway are analogous to the 21-25 nt short
interfering RNAs (siRNAs) generated during RNA interference (RNAi)
in animals and posttranscriptional gene silencing (PTGS) in plants
(Hamilton and Baulcombe 1999; Hammond et al., 2000; Zamore et al.,
2000; Elbashir et al., 2001), and likely are incorporated into an
RNA-induced silencing complex (RISC) that is similar or identical
to that seen for RNAi.
[0126] Identifying the targets of miRNAs with bioinformatics has
not been successful in animals, and this is probably due to the
fact that animal miRNAs have a low degree of complementarity with
their targets. On the other hand, bioinformatic approaches have
been successfully used to predict targets for plant miRNAs (Llave
et al., Plant Cell 14:1605-1619 2002; Park et al., Curr. Biol.
12:1484-1495 2002; Rhoades et al., Cell 110:513-520 2002), and thus
it appears that plant miRNAs have higher overall complementarity
with their putative targets than do animal miRNAs. Most of these
predicted target transcripts of plant miRNAs encode members of
transcription factor families implicated in plant developmental
patterning or cell differentiation. Nonetheless, biological
function has not been directly demonstrated for any plant miRNA.
Although Llave et al. (Science 297:2053-2056 2002) have shown that
a transcript for a SCARECROW-like transcription factor is a target
of the Arabidopsis miRNA mir171, these studies were performed in a
heterologous species and no plant phenotype associated with mir171
was reported.
[0127] The methods provided can be practiced in any organism in
which a method of transformation is available, and for which there
is at least some sequence information for the target sequence, or
for a region flanking the target sequence of interest. It is also
understood that two or more sequences could be targeted by
sequential transformation, co-transformation with more than one
targeting vector, or the construction of a DNA construct comprising
more than one miRNA sequence. The methods of the invention may also
be implemented by a combinatorial nucleic acid library construction
in order to generate a library of miRNAs directed to random target
sequences. The library of miRNAs could be used for high-throughput
screening for gene function validation.
[0128] General categories of sequences of interest include, for
example, those genes involved in regulation or information, such as
zinc fingers, transcription factors, homeotic genes, or cell cycle
and cell death modulators, those involved in communication, such as
kinases, and those involved in housekeeping, such as heat shock
proteins.
[0129] Target sequences further include coding regions and
non-coding regions such as promoters, enhancers, terminators,
introns and the like, which may be modified in order to alter the
expression of a gene of interest. For example, an intron sequence
can be added to the 5' region to increase the amount of mature
message that accumulates (see for example Buchman and Berg, Mol.
Cell. Biol. 8:4395-4405 (1988); and Callis et al., Genes Dev.
1:1183-1200 (1987)).
[0130] The target sequence may be an endogenous sequence, or may be
an introduced heterologous sequence, or transgene. For example, the
methods may be used to alter the regulation or expression of a
transgene, or to remove a transgene or other introduced sequence
such as an introduced site-specific recombination site. The target
sequence may also be a sequence from a pathogen, for example, the
target sequence may be from a plant pathogen such as a virus, a
mold or fungus, an insect, or a nematode. A miRNA could be
expressed in a plant which, upon infection or infestation, would
target the pathogen and confer some degree of resistance to the
plant.
[0131] In plants, other categories of target sequences include
genes affecting agronomic traits, insect resistance, disease
resistance, herbicide resistance, sterility, grain characteristics,
and commercial products. Genes of interest also included those
involved in oil, starch, carbohydrate, or nutrient metabolism as
well as those affecting, for example, kernel size, sucrose loading,
and the like. The quality of grain is reflected in traits such as
levels and types of oils, saturated and unsaturated, quality and
quantity of essential amino acids, and levels of cellulose. For
example, genes of the phytic acid biosynthetic pathway could be
suppressed to generate a high available phosphorous phenotype. See,
for example, phytic acid biosynthetic enzymes including inositol
polyphosphate kinase-2 polynucleotides, disclosed in WO 02/059324,
inositol 1,3,4-trisphosphate 5/6-kinase polynucleotides, disclosed
in WO 03/027243, and myo-inositol 1-phosphate synthase and other
phytate biosynthetic polynucleotides, disclosed in WO 99/05298, all
of which are herein incorporated by reference. Genes in the
lignification pathway could be suppressed to enhance digestibility
or energy availability. Genes affecting cell cycle or cell death
could be suppressed to affect growth or stress response. Genes
affecting DNA repair and/or recombination could be suppressed to
increase genetic variability. Genes affecting flowering time could
be suppressed, as well as genes affecting fertility. Any target
sequence could be suppressed in order to evaluate or confirm its
role in a particular trait or phenotype, or to dissect a molecular,
regulatory, biochemical, or proteomic pathway or network.
[0132] A number of promoters can be used, these promoters can be
selected based on the desired outcome. It is recognized that
different applications will be enhanced by the use of different
promoters in plant expression cassettes to modulate the timing,
location and/or level of expression of the miRNA. Such plant
expression cassettes may also contain, if desired, a promoter
regulatory region (e.g., one conferring inducible, constitutive,
environmentally- or developmentally-regulated, or cell- or
tissue-specific/selective expression), a transcription initiation
start site, a ribosome binding site, an RNA processing signal, a
transcription termination site, and/or a polyadenylation
signal.
[0133] Constitutive, tissue-preferred or inducible promoters can be
employed. Examples of constitutive promoters include the
cauliflower mosaic virus (CaMV) 35S transcription initiation
region, the 1'- or 2'-promoter derived from T-DNA of Agrobacterium
tumefaciens, the ubiquitin 1 promoter, the Smas promoter, the
cinnamyl alcohol dehydrogenase promoter (U.S. Pat. No. 5,683,439),
the Nos promoter, the pEmu promoter, the rubisco promoter, the
GRP1-8 promoter and other transcription initiation regions from
various plant genes known to those of skill. If low level
expression is desired, weak promoter(s) may be used. Weak
constitutive promoters include, for example, the core promoter of
the Rsyn7 promoter (WO 99/43838 and U.S. Pat. No. 6,072,050), the
core 35S CaMV promoter, and the like. Other constitutive promoters
include, for example, U.S. Pat. Nos. 5,608,149; 5,608,144;
5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; and
5,608,142. See also, U.S. Pat. No. 6,177,611, herein incorporated
by reference.
[0134] Examples of inducible promoters are the Adh1 promoter which
is inducible by hypoxia or cold stress, the Hsp70 promoter which is
inducible by heat stress, the PPDK promoter and the pepcarboxylase
promoter which are both inducible by light. Also useful are
promoters which are chemically inducible, such as the In2-2
promoter which is safener induced (U.S. Pat. No. 5,364,780), the
ERE promoter which is estrogen induced, and the Axig1 promoter
which is auxin induced and tapetum specific but also active in
callus (PCT US01/22169).
[0135] Examples of promoters under developmental control include
promoters that initiate transcription preferentially in certain
tissues, such as leaves, roots, fruit, seeds, or flowers. An
exemplary promoter is the anther specific promoter 5126 (U.S. Pat.
Nos. 5,689,049 and 5,689,051). Examples of seed-preferred promoters
include, but are not limited to, 27 kD gamma zein promoter and waxy
promoter, Boronat, A. et al. (1986) Plant Sci. 47:95-102; Reina, M.
et al. Nucl. Acids Res. 18(21):6426; and Kloesgen, R. B. et al.
(1986) Mol. Gen. Genet. 203:237-244. Promoters that express in the
embryo, pericarp, and endosperm are disclosed in U.S. Pat. No.
6,225,529 and PCT publication WO 00/12733. The disclosures each of
these are incorporated herein by reference in their entirety.
[0136] In some embodiments it will be beneficial to express the
gene from an inducible promoter, particularly from a
pathogen-inducible promoter. Such promoters include those from
pathogenesis-related proteins (PR proteins), which are induced
following infection by a pathogen; e.g., PR proteins, SAR proteins,
beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi et
al. (1983) Neth. J. Plant Pathol. 89:245-254; Uknes et al. (1992)
Plant Cell 4:645-656; and Van Loon (1985) Plant Mol. Virol.
4:111-116. See also WO 99/43819, herein incorporated by
reference.
[0137] Of interest are promoters that are expressed locally at or
near the site of pathogen infection. See, for example, Marineau et
al. (1987) Plant Mol. Biol. 9:335-342; Matton et al. (1989)
Molecular Plant-Microbe Interactions 2:325-331; Somsisch et al.
(1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch et al.
(1988) Mol. Gen. Genet. 2:93-98; and Yang (1996) Proc. Natl. Acad.
Sci. USA 93:14972-14977. See also, Chen et al. (1996) Plant J.
10:955-966; Zhang et al. (1994) Proc. Natl. Acad. Sci. USA
91:2507-2511; Warner et al. (1993) Plant J. 3:191-201; Siebertz et
al. (1989) Plant Cell 1:961-968; U.S. Pat. No. 5,750,386
(nematode-inducible); and the references cited therein. Of
particular interest is the inducible promoter for the maize PRms
gene, whose expression is induced by the pathogen Fusarium
moniliforme (see, for example, Cordero et al. (1992) Physiol. Mol.
Plant. Path. 41:189-200).
[0138] Additionally, as pathogens find entry into plants through
wounds or insect damage, a wound-inducible promoter may be used in
the constructions of the polynucleotides. Such wound-inducible
promoters include potato proteinase inhibitor (pin II) gene (Ryan
(1990) Ann. Rev. Phytopath. 28:425-449; Duan et al. (1996) Nature
Biotech. 14:494-498); wun1 and wun2, U.S. Pat. No. 5,428,148; win1
and win2 (Stanford et al. (1989) Mol. Gen. Genet. 215:200-208);
systemin (McGurl et al. (1992) Science 225:1570-1573); WIP1
(Rohmeier et al. (1993) Plant Mol. Biol. 22:783-792; Eckelkamp et
al. (1993) FEBS Lett. 323:73-76); MPI gene (Corderok et al. (1994)
Plant J. 6(2):141-150); and the like, herein incorporated by
reference.
[0139] Chemical-regulated promoters can be used to modulate the
expression of a gene in a plant through the application of an
exogenous chemical regulator. Depending upon the objective, the
promoter may be a chemical-inducible promoter, where application of
the chemical induces gene expression, or a chemical-repressible
promoter, where application of the chemical represses gene
expression. Chemical-inducible promoters are known in the art and
include, but are not limited to, the maize In2-2 promoter, which is
activated by benzenesulfonamide herbicide safeners, the maize GST
promoter, which is activated by hydrophobic electrophilic compounds
that are used as pre-emergent herbicides, and the tobacco PR-1a
promoter, which is activated by salicylic acid. Other
chemical-regulated promoters of interest include steroid-responsive
promoters (see, for example, the glucocorticoid-inducible promoter
in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425
and McNellis et al. (1998) Plant J. 14(2):247-257) and
tetracycline-inducible and tetracycline-repressible promoters (see,
for example, Gatz et al. (1991) Mol. Gen. Genet. 227:229-237, and
U.S. Pat. Nos. 5,814,618 and 5,789,156), herein incorporated by
reference.
[0140] Tissue-preferred promoters can be utilized to target
enhanced expression of a sequence of interest within a particular
plant tissue. Tissue-preferred promoters include Yamamoto et al.
(1997) Plant J. 12(2):255-265; Kawamata et al. (1997) Plant Cell
Physiol. 38(7):792-803; Hansen et al. (1997) Mol. Gen. Genet.
254(3):337-343; Russell et al. (1997) Transgenic Res. 6(2):157-168;
Rinehart et al. (1996) Plant Physiol. 112(3):1331-1341; Van Camp et
al. (1996) Plant Physiol. 112(2):525-535; Canevascini et al. (1996)
Plant Physiol. 112(2):513-524; Yamamoto et al. (1994) Plant Cell
Physiol. 35(5):773-778; Lam (1994) Results Probl. Cell Differ.
20:181-196; Orozco et al. (1993) Plant Mol. Biol. 23(6):1129-1138;
Matsuoka et al. (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590;
and Guevara-Garcia et al. (1993) Plant J. 4(3):495-505. Such
promoters can be modified, if necessary, for weak expression.
[0141] Leaf-preferred promoters are known in the art. See, for
example, Yamamoto et al. (1997) Plant J. 12(2):255-265; Kwon et al.
(1994) Plant Physiol. 105:357-67; Yamamoto et al. (1994) Plant Cell
Physiol. 35(5):773-778; Gotor et al. (1993) Plant J. 3:509-18;
Orozco et al. (1993) Plant Mol. Biol. 23(6):1129-1138; and Matsuoka
et al. (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590. In
addition, the promoters of cab and rubisco can also be used. See,
for example, Simpson et al. (1958) EMBO J. 4:2723-2729 and Timko et
al. (1988) Nature 318:57-58.
[0142] Root-preferred promoters are known and can be selected from
the many available from the literature or isolated de novo from
various compatible species. See, for example, Hire et al. (1992)
Plant Mol. Biol. 20(2):207-218 (soybean root-specific glutamine
synthetase gene); Keller and Baumgartner (1991) Plant Cell
3(10):1051-1061 (root-specific control element in the GRP 1.8 gene
of French bean); Sanger et al. (1990) Plant Mol. Biol.
14(3):433-443 (root-specific promoter of the mannopine synthase
(MAS) gene of Agrobacterium tumefaciens); and Miao et al. (1991)
Plant Cell 3(1):11-22 (full-length cDNA clone encoding cytosolic
glutamine synthetase (GS), which is expressed in roots and root
nodules of soybean). See also Bogusz et al. (1990) Plant Cell
2(7):633-641, where two root-specific promoters isolated from
hemoglobin genes from the nitrogen-fixing nonlegume Parasponia
andersonii and the related non-nitrogen-fixing nonlegume Trema
tomentosa are described. The promoters of these genes were linked
to a .beta.-glucuronidase reporter gene and introduced into both
the nonlegume Nicotiana tabacum and the legume Lotus corniculatus,
and in both instances root-specific promoter activity was
preserved. Leach and Aoyagi (1991) describe their analysis of the
promoters of the highly expressed roIC and roID root-inducing genes
of Agrobacterium rhizogenes (see Plant Science (Limerick)
79(1):69-76). They concluded that enhancer and tissue-preferred DNA
determinants are dissociated in those promoters. Teeri et al.
(1989) used gene fusion to lacZ to show that the Agrobacterium
T-DNA gene encoding octopine synthase is especially active in the
epidermis of the root tip and that the TR2' gene is root specific
in the intact plant and stimulated by wounding in leaf tissue, an
especially desirable combination of characteristics for use with an
insecticidal or larvicidal gene (see EMBO J. 8(2):343-350). The
TR1' gene, fused to nptII (neomycin phosphotransferase II) showed
similar characteristics. Additional root-preferred promoters
include the VfENOD-GRP3 gene promoter (Kuster et al. (1995) Plant
Mol. Biol. 29(4):759-772); and roIB promoter (Capana et al. (1994)
Plant Mol. Biol. 25(4):681-691. See also U.S. Pat. Nos. 5,837,876;
5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732; and
5,023,179. The phaseolin gene (Murai et al. (1983) Science
23:476-482 and Sengopta-Gopalen et al. (1988) PNAS
82:3320-3324.
[0143] Transformation protocols as well as protocols for
introducing nucleotide sequences into plants may vary depending on
the type of plant or plant cell, i.e., monocot or dicot, targeted
for transformation. Suitable methods of introducing the DNA
construct include microinjection (Crossway et al. (1986)
Biotechniques 4:320-334; and U.S. Pat. No. 6,300,543), sexual
crossing, electroporation (Riggs et al. (1986) Proc. Natl. Acad.
Sci. USA 83:5602-5606), Agrobacterium-mediated transformation
(Townsend et al., U.S. Pat. No. 5,563,055; and U.S. Pat. No.
5,981,840), direct gene transfer (Paszkowski et al. (1984) EMBO J.
3:2717-2722), and ballistic particle acceleration (see, for
example, Sanford et al., U.S. Pat. No. 4,945,050; Tomes et al.,
U.S. Pat. No. 5,879,918; Tomes et al., U.S. Pat. No. 5,886,244;
Bidney et al., U.S. Pat. No. 5,932,782; Tomes et al. (1995) "Direct
DNA Transfer into Intact Plant Cells via Microprojectile
Bombardment," in Plant Cell, Tissue, and Organ Culture: Fundamental
Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); and
McCabe et al. (1988) Biotechnology 6:923-926). Also see Weissinger
et al. (1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987)
Particulate Science and Technology 5:27-37 (onion); Christou et al.
(1988) Plant Physiol. 87:671-674 (soybean); Finer and McMullen
(1991) In Vitro Cell Dev. Biol. 27P:175-182 (soybean); Singh et al.
(1998) Theor. Appl. Genet. 96:319-324 (soybean); Datta et al.
(1990) Biotechnology 8:736-740 (rice); Klein et al. (1988) Proc.
Natl. Acad. Sci. USA 85:4305-4309 (maize); Klein et al. (1988)
Biotechnology 6:559-563 (maize); Tomes, U.S. Pat. No. 5,240,855;
Buising et al., U.S. Pat. Nos. 5,322,783 and 5,324,646; Klein et
al. (1988) Plant Physiol. 91:440-444 (maize); Fromm et al. (1990)
Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren et al.
(1984) Nature (London) 311:763-764; Bowen et al., U.S. Pat. No.
5,736,369 (cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci.
USA 84:5345-5349 (Liliaceae); De Wet et al. (1985) in The
Experimental Manipulation of Ovule Tissues, ed. Chapman et al.
(Longman, New York), pp. 197-209 (pollen); Kaeppler et al. (1990)
Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor.
Appl. Genet. 84:560-566 (whisker-mediated transformation);
D'Halluin et al. (1992) Plant Cell 4:1495-1505 (electroporation);
Li et al. (1993) Plant Cell Reports 12:250-255 and Christou and
Ford (1995) Annals of Botany 75:407-413 (rice); Osjoda et al.
(1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium
tumefaciens); and U.S. Pat. No. 5,736,369 (meristem
transformation), all of which are herein incorporated by
reference.
[0144] The nucleotide constructs may be introduced into plants by
contacting plants with a virus or viral nucleic acids. Generally,
such methods involve incorporating a nucleotide construct of the
invention within a viral DNA or RNA molecule. Further, it is
recognized that useful promoters encompass promoters utilized for
transcription by viral RNA polymerases. Methods for introducing
nucleotide constructs into plants and expressing a protein encoded
therein, involving viral DNA or RNA molecules, are known in the
art. See, for example, U.S. Pat. Nos. 5,889,191, 5,889,190,
5,866,785, 5,589,367 and 5,316,931; herein incorporated by
reference.
[0145] In some embodiments, transient expression may be desired. In
those cases, standard transient transformation techniques may be
used. Such methods include, but are not limited to viral
transformation methods, and microinjection of DNA or RNA, as well
other methods well known in the art.
[0146] The cells from the plants that have stably incorporated the
nucleotide sequence may be grown into plants in accordance with
conventional ways. See, for example, McCormick et al. (1986) Plant
Cell Reports 5:81-84. These plants may then be grown, and either
pollinated with the same transformed strain or different strains,
and the resulting hybrid having constitutive expression of the
desired phenotypic characteristic imparted by the nucleotide
sequence of interest and/or the genetic markers contained within
the target site or transfer cassette. Two or more generations may
be grown to ensure that expression of the desired phenotypic
characteristic is stably maintained and inherited and then seeds
harvested to ensure expression of the desired phenotypic
characteristic has been achieved.
[0147] In a tenth embodiment, the invention relates to a method for
altering expression of a stably introduced nucleotide sequence in a
plant comprising: [0148] a) making a DNA expression construct
comprising a stably introduced nucleotide sequence and at least one
sequence capable of hybridizing to the isolated polynucleotide of
the invention; [0149] b) transforming a plant with the DNA
expression construct of part (a); and [0150] c) selecting a
transformed plant which comprises the DNA expression construct of
part (a) in its genome and which has altered expression of the
stably introduced nucleotide sequence when compared to a plant
transformed with a modified version of the DNA expression construct
of part (a) wherein the modified construct lacks the sequence
capable of hybridizing to the isolated polynucleotide of the
invention.
[0151] Initial identification and selection of cells and/or plants
comprising the DNA constructs may be facilitated by the use of
marker genes. Gene targeting can be performed without selection if
there is a sensitive method for identifying recombinants, for
example if the targeted gene modification can be easily detected by
PCR analysis, or if it results in a certain phenotype. However, in
most cases, identification of gene targeting events will be
facilitated by the use of markers. Useful markers include positive
and negative selectable markers as well as markers that facilitate
screening, such as visual markers. Selectable markers include genes
carrying resistance to an antibiotic such as spectinomycin (e.g.
the aada gene, Svab et al. 1990 Plant Mol. Biol. 14:197),
streptomycin (e.g., aada, or SPT, Svab et al. 1990 Plant Mol. Biol.
14:197; Jones et al. 1987 Mol. Gen. Genet. 210:86), kanamycin
(e.g., nptII, Fraley et al. 1983 PNAS 80:4803), hygromycin (e.g.,
HPT, Vanden Elzen et al. 1985 Plant Mol. Biol. 5:299), gentamycin
(Hayford et al. 1988 Plant Physiol. 86:1216), phleomycin, zeocin,
or bleomycin (Hille et al. 1986 Plant Mol. Biol. 7:171), or
resistance to a herbicide such as phosphinothricin (bar gene), or
sulfonylurea (acetolactate synthase (ALS)) (Charest et al. (1990)
Plant Cell Rep. 8:643), genes that fulfill a growth requirement on
an incomplete media such as HIS3, LEU2, URA3, LYS2, and TRP1 genes
in yeast, and other such genes known in the art. Negative
selectable markers include cytosine deaminase (codA) (Stougaard
1993 Plant J. 3:755-761), tms2 (DePicker et al. 1988 Plant Cell
Rep. 7:63-66), nitrate reductase (Nussame et al. 1991 Plant J.
1:267-274), SU1 (O'Keefe et al. 1994 Plant Physiol. 105:473-482),
aux-2 from the Ti plasmid of Agrobacterium, and thymidine kinase.
Screenable markers include fluorescent proteins such as green
fluorescent protein (GFP) (Chalfie et al., 1994 Science 263:802;
U.S. Pat. No. 6,146,826; U.S. Pat. No. 5,491,084; and WO 97/41228),
reporter enzymes such as .beta.-glucuronidase (GUS) (Jefferson R.
A. 1987 Plant Mol. Biol. Rep. 5:387; U.S. Pat. No. 5,599,670; and
U.S. Pat. No. 5,432,081), .beta.-galactosidase (lacZ), alkaline
phosphatase (AP), glutathione S-transferase (GST) and luciferase
(U.S. Pat. No. 5,674,713; and Ow et al. 1986 Science
234(4778):856-859), visual markers like anthocyanins such as CRC
(Ludwig et al. (1990) Science 247(4841):449-450) R gene family
(e.g. Lc, P, S), A, C, R-nj, body and/or eye color genes in
Drosophila, coat color genes in mammalian systems, and others known
in the art.
[0152] One or more markers may be used in order to select and
screen for gene targeting events. One common strategy for gene
disruption involves using a target modifying polynucleotide in
which the target is disrupted by a promoterless selectable marker.
Since the selectable marker lacks a promoter, random integration
events are unlikely to lead to transcription of the gene. Gene
targeting events will put the selectable marker under control of
the promoter for the target gene. Gene targeting events are
identified by selection for expression of the selectable marker.
Another common strategy utilizes a positive-negative selection
scheme. This scheme utilizes two selectable markers, one that
confers resistance (R+) coupled with one that confers a sensitivity
(S+), each with a promoter. When this polynucleotide is randomly
inserted, the resulting phenotype is R+/S+. When a gene targeting
event is generated, the two markers are uncoupled and the resulting
phenotype is R+/S-. Examples of using positive-negative selection
are found in Thykj.ae butted.r et al. (1997) Plant Mol. Biol.
35:523-530; and WO 01/66717, which are herein incorporated by
reference.
EXAMPLES
[0153] The following are non-limiting examples intended to
illustrate the invention. Although the present invention has been
described in some detail by way of illustration and example for
purposes of clarity of understanding, it will be obvious that
certain changes and modifications may be practiced within the scope
of the appended claims.
Example 1
Transformation of Plants
[0154] Described in this example are methods one may use for
introduction of a polynucleotide or polypeptide into a plant
cell.
A. Maize Particle-Mediated DNA Delivery
[0155] A DNA construct can be introduced into maize cells capable
of growth on suitable maize culture medium. Such competent cells
can be from maize suspension culture, callus culture on solid
medium, freshly isolated immature embryos or meristem cells.
Immature embryos of the Hi-II genotype can be used as the target
cells. Ears are harvested at approximately 10 days
post-pollination, and 1.2-1.5 mm immature embryos are isolated from
the kernels, and placed scutellum-side down on maize culture
medium.
[0156] The immature embryos are bombarded from 18-72 hours after
being harvested from the ear. Between 6 and 18 hours prior to
bombardment, the immature embryos are placed on medium with
additional osmoticum (MS basal medium, Musashige and Skoog, 1962,
Physiol. Plant 15:473-497, with 0.25 M sorbitol). The embryos on
the high-osmotic medium are used as the bombardment target, and are
left on this medium for an additional 18 hours after
bombardment.
[0157] For particle bombardment, plasmid DNA (described above) is
precipitated onto 1.8 mm tungsten particles using standard
CaCl2-spermidine chemistry (see, for example, Klein et al., 1987,
Nature 327:70-73). Each plate is bombarded once at 600 PSI, using a
DuPont Helium Gun (Lowe et al., 1995, Bio/Technol 13:677-682). For
typical media formulations used for maize immature embryo
isolation, callus initiation, callus proliferation and regeneration
of plants, see Armstrong, C., 1994, In "The Maize Handbook", M.
Freeling and V. Walbot, eds. Springer Verlag, NY, pp 663-671.
[0158] Within 1-7 days after particle bombardment, the embryos are
moved onto N6-based culture medium containing 3 mg/l of the
selective agent bialaphos. Embryos, and later callus, are
transferred to fresh selection plates every 2 weeks. The calli
developing from the immature embryos are screened for the desired
phenotype. After 6-8 weeks, transformed calli are recovered.
B. Soybean Transformation
[0159] Soybean embryogenic suspension cultures are maintained in 35
ml liquid media SB196 or SB172 in 250 ml Erlenmeyer flasks on a
rotary shaker, 150 rpm, 26 C with cool white fluorescent lights on
16:8 hr day/night photoperiod at light intensity of 30-35 uE/m2s.
Cultures are subcultured every two weeks by inoculating
approximately 35 mg of tissue into 35 ml of fresh liquid media.
Alternatively, cultures are initiated and maintained in 6-well
Costar plates.
[0160] SB 172 media is prepared as follows: (per liter), 1 bottle
Murashige and Skoog Medium (Duchefa # M 0240), 1 ml B5 vitamins
1000.times. stock, 1 ml 2,4-D stock (Gibco 11215-019), 60 g
sucrose, 2 g MES, 0.667 g L-Asparagine anhydrous (GibcoBRL
11013-026), pH 5.7. SB 196 media is prepared as follows: (per
liter) 10 ml MS FeEDTA, 10 ml MS Sulfate, 10 ml FN-Lite Halides, 10
ml FN-Lite P,B,Mo, 1 ml B5 vitamins 1000.times. stock, 1 ml 2,4-D,
(Gibco 11215-019), 2.83 g KNO3, 0.463 g (NH4).sub.2SO4, 2 g MES, 1
g Asparagine Anhydrous, Powder (Gibco 11013-026), 10 g Sucrose, pH
5.8. 2,4-D stock concentration 10 mg/ml is prepared as follows:
2,4-D is solubilized in 0.1 N NaOH, filter-sterilized, and stored
at -20.degree. C. B5 vitamins 1000.times. stock is prepared as
follows: (per 100 ml)-store aliquots at -20.degree. C., 10 g
myo-inositol, 100 mg nicotinic acid, 100 mg pyridoxine HCl, 1 g
thiamin.
[0161] Soybean embryogenic suspension cultures are transformed with
various plasmids by the method of particle gun bombardment (Klein
et al., 1987 Nature 327:70. To prepare tissue for bombardment,
approximately two flasks of suspension culture tissue that has had
approximately 1 to 2 weeks to recover since its most recent
subculture is placed in a sterile 60.times.20 mm petri dish
containing 1 sterile filter paper in the bottom to help absorb
moisture. Tissue (i.e. suspension clusters approximately 3-5 mm in
size) is spread evenly across each petri plate. Residual liquid is
removed from the tissue with a pipette, or allowed to evaporate to
remove excess moisture prior to bombardment. Per experiment, 4-6
plates of tissue are bombarded. Each plate is made from two
flasks.
[0162] To prepare gold particles for bombardment, 30 mg gold is
washed in ethanol, centrifuged and resuspended in 0.5 ml of sterile
water. For each plasmid combination (treatments) to be used for
bombardment, a separate micro-centrifuge tube is prepared, starting
with 50 .mu.l of the gold particles prepared above. Into each tube,
the following are also added; 5 .mu.l of plasmid DNA (at 1
.mu.g/.mu.l), 50 .mu.l CaCl2, and 20 .mu.l 0.1 M spermidine. This
mixture is agitated on a vortex shaker for 3 minutes, and then
centrifuged using a microcentrifuge set at 14,000 RPM for 10
seconds. The supernatant is decanted and the gold particles with
attached, precipitated DNA are washed twice with 400 .mu.l aliquots
of ethanol (with a brief centrifugation as above between each
washing). The final volume of 100% ethanol per each tube is
adjusted to 40 .mu.l, and this particle/DNA suspension is kept on
ice until being used for bombardment.
[0163] Immediately before applying the particle/DNA suspension, the
tube is briefly dipped into a sonicator bath to disperse the
particles, and then 5 .mu.L of DNA prep is pipetted onto each
flying disk and allowed to dry. The flying disk is then placed into
the DuPont Biolistics PDS1000/HE. Using the DuPont Biolistic
PDS1000/HE instrument for particle-mediated DNA delivery into
soybean suspension clusters, the following settings are used. The
membrane rupture pressure is 1100 psi. The chamber is evacuated to
a vacuum of 27-28 inches of mercury. The tissue is placed
approximately 3.5 inches from the retaining/stopping screen (3rd
shelf from the bottom). Each plate is bombarded twice, and the
tissue clusters are rearranged using a sterile spatula between
shots.
[0164] Following bombardment, the tissue is re-suspended in liquid
culture medium, each plate being divided between 2 flasks with
fresh SB196 or SB172 media and cultured as described above. Four to
seven days post-bombardment, the medium is replaced with fresh
medium containing a selection agent. The selection media is
refreshed weekly for 4 weeks and once again at 6 weeks. Weekly
replacement after 4 weeks may be necessary if cell density and
media turbidity is high.
[0165] Four to eight weeks post-bombardment, green, transformed
tissue may be observed growing from untransformed, necrotic
embryogenic clusters. Isolated, green tissue is removed and
inoculated into 6-well microtiter plates with liquid medium to
generate clonally-propagated, transformed embryogenic suspension
cultures.
[0166] Each embryogenic cluster is placed into one well of a Costar
6-well plate with 5 mls fresh SB196 media with selection agent.
Cultures are maintained for 2-6 weeks with fresh media changes
every 2 weeks. When enough tissue is available, a portion of
surviving transformed clones are subcultured to a second 6-well
plate as a back-up to protect against contamination.
[0167] To promote in vitro maturation, transformed embryogenic
clusters are removed from liquid SB196 and placed on solid agar
media, SB 166, for 2 weeks. Tissue clumps of 2-4 mm size are plated
at a tissue density of 10 to 15 clusters per plate. Plates are
incubated in diffuse, low light (<10 .mu.E) at 26+/-1.degree. C.
After two weeks, clusters are subcultured to SB 103 media for 3-4
weeks.
[0168] SB 166 is prepared as follows: (per liter), 1 pkg. MS salts
(Gibco/BRL --Cat# 11117-017), 1 ml B5 vitamins 1000.times. stock,
60 g maltose, 750 mg MgCl2 hexahydrate, 5 g activated charcoal, pH
5.7, 2 g gelrite. SB 103 media is prepared as follows: (per liter),
1 pkg. MS salts (Gibco/BRL--Cat# 11117-017), 1 ml B5 vitamins
1000.times. stock, 60 g maltose, 750 mg MgCl2 hexahydrate, pH 5.7,
2 g gelrite. After 5-6 week maturation, individual embryos are
desiccated by placing embryos into a 100.times.15 petri dish with a
1 cm2 portion of the SB103 media to create a chamber with enough
humidity to promote partial desiccation, but not death.
[0169] Approximately 25 embryos are desiccated per plate. Plates
are sealed with several layers of parafilm and again are placed in
a lower light condition. The duration of the desiccation step is
best determined empirically, and depends on size and quantity of
embryos placed per plate. For example, small embryos or few
embryos/plate require a shorter drying period, while large embryos
or many embryos/plate require a longer drying period. It is best to
check on the embryos after about 3 days, but proper desiccation
will most likely take 5 to 7 days. Embryos will decrease in size
during this process.
[0170] Desiccated embryos are planted in SB 71-1 or MSO medium
where they are left to germinate under the same culture conditions
described for the suspension cultures. When the plantlets have two
fully-expanded trifoliate leaves, germinated and rooted embryos are
transferred to sterile soil and watered with MS fertilizer. Plants
are grown to maturity for seed collection and analysis. Healthy,
fertile transgenic plants are grown in the greenhouse.
[0171] SB 71-1 is prepared as follows: 1 bottle Gamborg's B5 salts
w/sucrose (Gibco/BRL--Cat# 21153-036), 10 g sucrose, 750 mg MgCl2
hexahydrate, pH 5.7, 2 g gelrite. MSO media is prepared as follows:
1 pkg Murashige and Skoog salts (Gibco 11117-066), 1 ml B5 vitamins
1000.times. stock, 30 g sucrose, pH 5.8, 2 g Gelrite.
C. Transformation of Maize Using Agrobacterium
[0172] Agrobacterium-mediated transformation of maize is performed
essentially as described by Zhao et al., in Meth. Mol. Biol.
318:315-323 (2006) (see also Zhao et al., Mol. Breed. 8:323-333
(2001) and U.S. Pat. No. 5,981,840 issued Nov. 9, 1999,
incorporated herein by reference). The transformation process
involves bacterium inoculation, co-cultivation, resting, selection
and plant regeneration.
1. Immature Embryo Preparation:
[0173] Immature maize embryos are dissected from caryopses and
placed in a 2 mL microtube containing 2 mL PHI-A medium.
2. Agrobacterium Infection and Co-Cultivation of Immature
Embryos:
2.1 Infection Step:
[0174] PHI-A medium of (1) is removed with 1 mL micropipettor, and
1 mL of Agrobacterium suspension is added. The tube is gently
inverted to mix. The mixture is incubated for 5 min at room
temperature. 2.2 Co-culture Step:
[0175] The Agrobacterium suspension is removed from the infection
step with a 1 mL micropipettor. Using a sterile spatula the embryos
are scraped from the tube and transferred to a plate of PHI-B
medium in a 100.times.15 mm Petri dish. The embryos are oriented
with the embryonic axis down on the surface of the medium. Plates
with the embryos are cultured at 20.degree. C., in darkness, for
three days. L-Cysteine can be used in the co-cultivation phase.
With the standard binary vector, the co-cultivation medium supplied
with 100-400 mg/L L-cysteine is critical for recovering stable
transgenic events.
3. Selection of Putative Transgenic Events:
[0176] To each plate of PHI-D medium in a 100.times.15 mm Petri
dish, 10 embryos are transferred, maintaining orientation and the
dishes are sealed with parafilm. The plates are incubated in
darkness at 28.degree. C. Actively growing putative events, as pale
yellow embryonic tissue, are expected to be visible in six to eight
weeks. Embryos that produce no events may be brown and necrotic,
and little friable tissue growth is evident. Putative transgenic
embryonic tissue is subcultured to fresh PHI-D plates at two-three
week intervals, depending on growth rate. The events are
recorded.
4. Regeneration of T0 Plants:
[0177] Embryonic tissue propagated on PHI-D medium is subcultured
to PHI-E medium (somatic embryo maturation medium), in 100.times.25
mm Petri dishes and incubated at 28.degree. C., in darkness, until
somatic embryos mature, for about ten to eighteen days. Individual,
matured somatic embryos with well-defined scutellum and coleoptile
are transferred to PHI-F embryo germination medium and incubated at
28.degree. C. in the light (about 80 .mu.E from cool white or
equivalent fluorescent lamps). In seven to ten days, regenerated
plants, about 10 cm tall, are potted in horticultural mix and
hardened-off using standard horticultural methods.
Media for Plant Transformation:
[0178] 1. PHI-A: 4 g/L CHU basal salts, 1.0 mL/L 1000.times.
Eriksson's vitamin mix, 0.5 mg/L thiamin HCl, 1.5 mg/L 2,4-D, 0.69
g/L L-proline, 68.5 g/L sucrose, 36 g/L glucose, pH 5.2. Add 100
.mu.M acetosyringone (filter-sterilized). [0179] 2. PHI-B: PHI-A
without glucose, increase 2,4-D to 2 mg/L, reduce sucrose to 30 g/L
and supplemented with 0.85 mg/L silver nitrate (filter-sterilized),
3.0 g/L Gelrite.RTM., 100 .mu.M acetosyringone (filter-sterilized),
pH 5.8. [0180] 3. PHI-C: PHI-B without Gelrite.RTM. and
acetosyringonee, reduce 2,4-D to 1.5 mg/L and supplemented with 8.0
g/L agar, 0.5 g/L 2-[N-morpholino]ethane-sulfonic acid (MES)
buffer, 100 mg/L carbenicillin (filter-sterilized). [0181] 4.
PHI-D: PHI-C supplemented with 3 mg/L bialaphos
(filter-sterilized). [0182] 5. PHI-E: 4.3 g/L of Murashige and
Skoog (MS) salts, (Gibco, BRL 11117-074), 0.5 mg/L nicotinic acid,
0.1 mg/L thiamine HCl, 0.5 mg/L pyridoxine HCl, 2.0 mg/L glycine,
0.1 g/L myo-inositol, 0.5 mg/L zeatin (Sigma, Cat. No. Z-0164), 1
mg/L indole acetic acid (IAA), 26.4 .mu.g/L abscisic acid (ABA), 60
g/L sucrose, 3 mg/L bialaphos (filter-sterilized), 100 mg/L
carbenicillin (filter-sterilized), 8 g/L agar, pH 5.6. [0183] 6.
PHI-F: PHI-E without zeatin, IAA, ABA; reduce sucrose to 40 g/L;
replacing agar with 1.5 g/L Gelrite.RTM.; pH 5.6.
[0184] Plants can be regenerated from the transgenic callus by
first transferring clusters of tissue to N6 medium supplemented
with 0.2 mg per liter of 2,4-D. After two weeks the tissue can be
transferred to regeneration medium (Fromm et al., Bio/Technology
8:833-839 (1990)).
[0185] Transgenic T0 plants can be regenerated and their phenotype
determined. T1 seed can be collected.
[0186] Furthermore, a recombinant DNA construct containing a
validated Arabidopsis gene can be introduced into a maize inbred
line either by direct transformation or introgression from a
separately transformed line.
[0187] Transgenic plants, either inbred or hybrid, can undergo more
vigorous field-based experiments to study expression effects.
Example 2
Isolation of Small RNAs for MPSS or 454 Sequencing
[0188] RNA samples were extracted using Trizol reagent
(Invitrogen), from the following tissues: drought-stressed maize
leaves, well-watered maize leaves, unfertilized maize ovules, early
stage maize kernels (2 days after pollination), mixed later stages
maize kernels (7, 14 and 21 days after pollination). Total RNA was
fractionated on 15% polyacrylamide TBE/urea gels, and a 21-nt RNA
marker was also included in a separate lane. Following
electrophoresis, the gels were stained with ethidium bromide, and
the region of the gel corresponding to 20-22 nucleotides was
excised. The small RNA fraction was eluted overnight, ethanol
precipitated, and then ligated sequentially to 5' and 3' RNA
adaptors, using T4 RNA ligase (5' RNA adaptor
GGUCUUAGUCGCAUCCUGUAGAUGGAUC and 3' RNA adaptor
pAUGCACACUGAUGCUGACACCUGCidT where p=phosphate; idT=inverted
deoxythymidine; SEQ ID NOs:8428 and 8429, respectively). The
products of each ligation were gel purified on 10% denaturing
polyacrylamide gels, to remove unligated adaptors. RT-PCR was then
carried out on the final ligation product, using primers
complementary to the 5' and 3' adaptor sequences. Amplified cDNAs
corresponding to small RNAs were sequenced using one of three
methods: concatamerization followed by standard dideoxy sequencing
(Elbashir et al., 2001 Genes & Dev. 15: 188-200), Massively
Parallel Signature Sequencing (MPSS.TM.) tag sequencing (Solexa) or
454.TM. sequencing (454 Life Sciences), or small RNA sequencing by
SBS (Sequencing-By-Synthesis; Illumina.TM. Inc. San Diego,
Calif.).
Example 3
Identification of Maize miRNA Sequences
[0189] Experimental data are analyzed by a program called "mirna",
referred to as "the program". The program is written in the Perl
programming language. It runs mainly from a CGI web interface, but
also can be run from the command line.
[0190] For any particular combination of Zea mays genomic data and
experimental results, experimental sequence data from MPSS or 454
sequencing is located in a maize genomic database; those which show
a match between experimental sequence and genomic sequences are
called "tags". A mixture of proprietary and public genomic data are
assembled into a set of contigs. Any non-contiguous genomic
sequence or unassembled genomic sequence is searched separately. In
addition, data derived from B73 and M017 cultivars are kept
separate. All subsequent analysis is performed only on tags
identified by matching sequences from the small RNA MPSS or 454
experiments to sequences located in the genomic databases.
[0191] A selectable series of screens is applied to these tags to
determine computationally which tags are likely to represent
miRNAs. Each screen can be selected or skipped by the user running
the analysis. The screens include: removing tags found in repeat
regions; removing tags that match known RNA; combining tags that
have significant overlap in the genomic data; removing tags that
match published known miRNAs; removing tags that appear near each
other in clusters; removing tags that have a low PPM
(parts-per-million, a measure of frequency) value in the
experimental data; removing tags that do not have an easily
identifiable base-pairing sequence nearby in the genome; and
testing the region of the genome surrounding the tag for good RNA
folding characteristics.
[0192] The RNA folding tests are performed by first employing a
publicly available RNA folding algorithm (Vienna RNA Package) on a
500 bp region of the genome containing the tag. Regions that do not
fold according to the default parameters (including a Gibbs free
energy of -30.DELTA.G; Hofacker et al. 1994 Monatsh.Chem. 125:
167-188) are removed from further consideration. A selectable
series of tests are employed with adjustable parameters to identify
those tags whose folds appear to be miRNA precursors. These
parameters include several restrictions on the size and number of
mismatched basepairs in the putative fold; the size and
conformation of the hairpin region of the fold; matching
characteristics of certain bases commonly found in miRNAs; and the
folding characteristics of the region adjacent to the miRNA
precursor.
[0193] The set of tags which pass these computational screens are
then examined in several graphic displays that represent the fold,
the putative miRNA, and the detailed results of the folding tests
and other experimental results. This examination may result in a
tag being rejected by an expert that had passed the computational
screens. Additional computational screens that are suggested by
these expert examinations may then be incorporated into the
program.
[0194] The biological validity of the miRNA sequences is further
tested by using WU-BLAST (Gish, Washington University at St. Louis;
Altschul et al 1990 J Mol Biol 215:403-410) analysis to identify
the putative genomic targets. Given the incomplete nature of the
maize genome tags are not rejected on the basis of this target
examination. However, computational identification of a target
increases the likelihood that the miRNA sequence is biologically
active. A combination of rice and maize genomic data are used in
the identification of putative targets.
Example 4
Maize miRNA Sequences
[0195] The protocol outlined in Example 3 was employed on maize RNA
isolated from the following maize tissues: drought-stressed maize
leaves, well-watered maize leaves, unfertilized maize ovules, early
stage maize kernels (2 days after pollination), mixed later stages
maize kernels (7, 14 and 21 days after pollination).
[0196] Analysis yielded 2808 maize microRNA sequences (see Table 1
showing SEQ ID NOs:1-2652 found in U.S. Provisional Application No.
60/849,672, filed Oct. 5, 2006, and 156 additional microRNA
sequences added herein SEQ ID NOs:7959-8114).
[0197] Known miRNA sequences were excluded from this list. Many of
the known miRNA sequences were found to be abundantly represented
in the sequenced libraries and were identified by the protocol
outlined in this application. Known miRNA sequences were not
limited to maize, even though the starting RNAs were all from
maize. Therefore, it is expected that the 2808 miRNA sequences from
maize disclosed in this application is a population enriched for
maize-specific and lower abundance miRNA species. It should be
noted that "lower abundance" is a relative term and the absolute
amount of any given microRNA sequence in any given tissue or
developmental state may be widely variable.
Example 5
Expression Analysis of Maize miRNAs
[0198] Expression analysis can be used to provide further evidence
that a given small RNA sequence corresponds to a miRNA. The ability
to detect a miRNA by Northern blotting and hybridization is a
standard criterion used by researchers to validate candidate miRNAs
(Ambros et al., 2003). Alternatively, RT-PCR protocols have been
developed that allow detection of small RNAs that are of lower
abundance (Shi and Chiang, 2005; Chen et al., 2005). We will use
one or both of these procedures to validate selected candidate
miRNAs from our list. In addition, most if not all of the miRNA
candidates we are disclosing will be included as features on a
microarray chip, which will allow hybridization to small RNA
fractions of a variety of tissues and treatments. Expression
profiling of miRNAs by microarray analysis is a rapidly evolving
and robust technology that should allow further validation of
candidate miRNAs, as well as provide information on tissue
specificity and/or conditional expression of particular miRNAs.
[0199] Particular miRNA candidates may have clearly recognizable
target transcripts based on bioinformatic analysis, which provides
an opportunity for further validation of the miRNAs. Modified
RACE-PCR on putative targets of selected miRNA candidates will be
used to identify RISC cleavage products with a 5' terminus located
at the center of the putative target site of the miRNA (Llave et
al., 2002). This result would strongly suggest that a given
candidate miRNA enters into a RISC complex, and thus functions as
would be expected for a bona fide miRNA.
[0200] Functional studies will be initiated on selected miRNAs with
expression patterns and/or targets of agronomic interest, for
example drought-induced or kernel-specific miRNAs. To determine the
in planta function of selected miRNAs, the miRNA can be
overexpressed by fusing a sequence (either cDNA or genomic)
encompassing the hairpin precursor of the miRNA, plus a minimal
amount of flanking sequence, to a constitutive promoter (e.g. the
maize Ubiquitin promoter) and creating transgenic maize lines with
this construct. Depending on the agronomic trait being studied,
phenotyping can be carried out on independent T0 individuals
overexpressing the miRNA. In addition, the effects of miRNA
overexpression on the relevant target genes can be assessed by
Northern blot and/or RT-PCR, to confirm that a predicted target is
in fact a bona fide target. An independent demonstration that a
given miRNA controls the expression of a given target gene is to
mutate the target site present within the target gene (without
changing amino acid sequence), and retransform the
"miRNA-resistant" version of the target gene. This approach allows
one to assess the phenotype conferred by loss of miRNA regulation,
which in the majority of cases cannot be assessed by direct
knockout of the miRNA (due to genetic redundancy and/or lack of an
available knockout line).
Example 6
Validation of Small RNAs by Expression Profiling
[0201] Because the number of disclosed candidate miRNAs number in
the thousands, validation must be performed using high-throughput
procedures. Microarray technology is useful for this purpose. The
flexibility and reliability of microarrays is well documented
(Davison et al. (2006), Methods in Enzymology 411: 14-34; Axtell
and Bartel (2005), Plant Cell 17: 1658-1673), as is their
suitability for assaying the expression of many different tissues
and conditions. The specific protocols for small RNA hybridization
to microarrays have been available for the past couple of years.
Microarrays are constructed to represent the candidate miRNAs, as
well as known miRNAs already in the literature. Hybridization is
carried out with labeled small RNA fractions purified from a
variety of maize tissues, including different organs such as roots,
leaves and flowers, and including environmental variables such as
drought/pathogen stress and low nutrients. Statistical analysis of
hybridization data allows one to identify candidate miRNAs
displaying significant expression, and in this manner validate
endogenous expression. This profiling approach also provides
initial clues regarding the in vivo function of particular miRNAs,
especially if their expression is tissue-specific or
environmentally regulated. Further validation would involve
Northern blot analysis and/or qRT-PCR on promising candidates (see
Example 8).
[0202] Small RNA expression is analyzed by hybridization to a
custom-designed plant miRNA expression array. Arrays are
synthesized by Agilent technologies in the 2-pack 11,000 feature
format. Known miRNA and candidate miRNA sequences from multiple
species are represented by a series of specially designed reporter
oligos. Reporters containing 0, 1 or 2 mismatches to the target
sequence are designed in both the sense and antisense orientations.
In addition, a duplexed reporter is added that contained two tandem
copies of the antisense target sequence. Antisense duplexed and
0-mismatch reporters are used to detect miRNA expression. Antisense
1- and 2-mismatch reporters provide information on reporter
specificity. Sense reporter data aids in differentiating miRNAs
from small-interfering RNAs.
[0203] Total RNA is prepared using Trizol reagent (Invitrogen) and
enriched for small RNAs (<200 nt) using glass fiber filters
(miRvana small RNA isolation kit, Ambion). Small RNA samples are
directly labeled with Cy-5 (Label IT miRNA labeling kit, Mirus
Bio). Four micrograms of labeled RNA is hybridized to the custom
arrays at 50.degree. C. Hybridization, washing, scanning and
feature extraction protocols follow the Agilent One-Color
Microarray-Based Gene Expression Analysis protocols. To ensure
reproducibility and reliability, samples are analyzed in
triplicate. Data are analyzed using Rosetta Resolver, Spotfire
DecisionSite, and customized spot-calling and error calculation
programs.
[0204] Small RNAs are determined to be expressed if, for all three
samples, the antisense duplex and O-mismatch reporters register
intensities more than two standard deviations above background, but
other reporters register signals at or below background intensity.
These sequences are moved forward for additional validation by
other techniques such as small RNA Northern blotting (Plant Cell.
2003;15(11): 2730-2741), in-gel miRNA detection (miR-tect-IT miRNA
labeling and detection kit, USB Corporation), custom Taqman miRNA
assays (Applied Biosystems), and poly-adenylation assisted
RT-PCR.
Example 7
Validation of Small RNAs by Expression Profiling
Tissue Source and RNA Extractions
[0205] Table 2 lists the genotypes, growth conditions and
developmental stages of tissues harvested for expression
profiling.
TABLE-US-00001 TABLE 2 Growth and harvest conditions for profiled
samples Sample Experimental Name Tissue Genotype Stage Growth
condition Condition B73 Leaf Leaf B73 VT pot grown; screen Tissue
survey house: Newark, DE Ear Immature ear B73 VT pot grown; screen
Tissue survey house: Newark, DE B73 Aerial B73 V4 germination paper
in Tissue survey Seedling seedling water; growth chamber (28 C., 14
hours light, 10 hours dark) 3245 Leaf 3245 V18 field grown:
Johnston, IA Normal Normal nitrogen Nitrogen 3245 Low Leaf 3245 V18
field grown: Johnston, IA Low nitrogen Nitrogen 33B50 Leaf 33B50
V18 field grown: Johnston, IA Normal Normal nitrogen Nitrogen B73
Low Leaf B73 V18 pot grown, greenhouse Low Nitrogen Nitrogen
[0206] Harvested tissues were immediately frozen in liquid nitrogen
and stored at -80 C. Tissues were homogenized to powder form while
kept frozen. Total RNA was isolated from 2-5 grams of homogenized
tissue by organic extraction using the manufacturer's protocol for
Trizol.TM. Reagent (Invitrogen; Carlsbad, Calif.) or the E.Z.N.A.
DNA/RNA Isolation System.TM. (Omega Bio-Tek; Doraville, Ga.). A
fraction enriched for RNA molecules under 200 nucleotides in length
was isolated from 100 micrograms total RNA using the mirVana.TM.
miRNA Isolation Kit (Ambion; Austin Tex.), protocol IV.A: Isolation
of small RNAs from total RNA samples. The total RNA and small RNA
samples were analyzed on an RNA 6000 Nano Chip and Small RNA Chip
(2100 Bioanalyzer, Agilent Technologies) respectively to determine
the quality and concentration of the sample.
Array Design
[0207] Custom gene expression microarrays were manufactured by
Agilent Technologies in the 4.times.44 k format. Each sixty
nucleotide probe encoded two tandem bait sequences separated by a
three nucleotide spacer and followed by 15 nucleotides of Agilent's
generic spacer sequence. Guanine residues preceded each bait
sequence. The overall probe design followed the format:
5'-G[BAIT].sub.21nt ATAG[BAIT].sub.21nt GCGTTCCGTATGTGG-3'.
[0208] Three probes were designed for each small RNA assayed:
perfectly sequence matched probes (0MM) used bait sequences
antisense to the query sequence; single mismatch probes (1 MM) used
antisense query sequences with a substitution at the tenth position
from the 5' end of the sense query sequence as bait; double
mismatch probes (2MM) used antisense query sequences with
substitutions at the seventh and fifteenth positions from the 5'
end of the sense query sequence as bait. Substitutions were made by
replacing A with T, T with A, G with C, and C with G.
Small RNA Labeling
[0209] Prior to labeling, an aliquot of a spike-in control cocktail
was added to 5 micrograms of each small RNA sample. Direct labeling
of the RNA was achieved by incubating four micrograms of each
sample with 4 microliters of the LabelIT Cy3 Reagent according to
the LabelIT miRNA Labeling Kit protocol (Mirus Bio Corporation;
Madison Wis.). The samples were subsequently quantitated with a
spectrophotometer to measure concentration and Cy3 incorporation
rates.
Array Hybridization
[0210] Each sample was hybridized to a custom Agilent
oligonucleotide array overnight at 50 C in a rotating hybridization
oven. The microarray slides were hybridized and washed according to
Agilent Technologies One-Color Microarray-Based Gene Expression
Analysis Protocol and immediately scanned with Agilent's DNA
Microarray Scanner at two laser settings (100% and 10% PMT).
Data Analysis
[0211] The images were visually inspected for image artifacts and
feature intensities were extracted, filtered, and normalized with
Agilent's Feature Extraction Software (version 9.5.3.1). Further
quality control and downstream analysis was performed using data
analysis tools in Rosetta's Resolver Database (NBIC Rosetta
Resolver System).
[0212] Samples were assayed as biological duplicates or
triplicates. Feature intensity data was combined and normalized
among replicates and within experiments using a least squares
method with weighted regression of error. A brief description of
the statistical methods for analysis of the miRNA microarray data,
were previously reported (Luck, (2001) Proceedings of SPIE
4266:153-157). The analysis is based on the vector space
representations of fluorescence intensities for microarrays and
miRNAs. The first stage of the analysis involves the normalization
of microarray intensities to adjust for variations in instrumental
response between replicates. The normalization parameters are
estimated by applying weighted regression to characterize the
covariance between replicates. The normalized intensities for the
replicates are averaged to obtain an intensity for each miRNA probe
for a given tissue. Intensities for replicates are correlated,
consequently the miRNA vectors are distributed about a mean line
with dimensionality equal to the number of replicates. The noise in
the intensity measurements is estimated by analyzing the squared
deviations of the replicate vectors from the mean line. A variance
function is obtained by weighted quadratic regression of the
squared deviations versus mean intensity. An empirical confidence
interval can then be associated with each value of averaged
intensity. The confidence interval characterizes the overall noise
including biological and instrumental contributions. The confidence
intervals are used to estimate the significance level of observed
deviations from the mean and identify outlier vectors among the
replicates. Similarly the significance level for differences
between means is used to identify those miRNAs that show
significant changes in hybridization due to mismatched probes. The
t distribution was used to estimate p-values for the difference
statistics with the degrees of freedom equal to the number of
replicates.
[0213] The reproducibility of each normalized signal was determined
by ANOVA or t-test calculations among the biological replicates of
each sample. Sequences with replicate P-values above 0.05 were
considered to be sufficiently reproducible.
[0214] A t-test was performed comparing the normalized signal for
each probe to the background signal in that sample. A query
sequence with a 0MM-background P-value less than 0.05 was
considered to be expressed significantly above background.
[0215] Two calculations were used to ensure the specificity of the
0MM signal for each query sequence. Again using the t-test, the 0MM
normalized signal was compared pair-wise with the normalized signal
for each of the query sequence's mismatch probes. Because P-values
only indicate the significance of the difference between signals,
but not which signal is greater, each 0MM signal was also required
to be larger than both its cognate 1 MM and 2MM signals. Any query
sequence whose 0MM signal was larger than both of its cognate
mismatch signals and whose 0MM-1 MM and 0MM-2MM P-values were both
less than 0.05 was considered to be show appropriate signal
specificity. These criteria are summarized in Table 3.
TABLE-US-00002 TABLE 3 Criteria used to determine the reliable
detection of query sequences. Value Criteria 0 MM replicate P-value
>0.05 0 MM-background P-value <0.05 0 MM-1 MM P-value
<0.05 0 MM-2 MM P-value <0.05 0 MM-1 MM >0 0 MM-2 MM
>0
[0216] Detection criteria were applied to each sample
independently. Query sequences meeting all the criteria outlined
above were considered to have been reliably detected by the
expression array and were marked as "passed," "enriched," or
"highly enriched" in Table 4. A query sequence was designated as
"enriched" in a given sample if it met all reliable detection
criteria and its 0MM signal intensity in that sample was between
5-fold and 10-fold above the 0MM intensity for any other sample in
the same experiment. "Highly enriched" sequences met all reliable
detection criteria and displayed 0MM signal intensity at least
10-fold above the 0MM intensity of any other sample in the same
experiment. In the two experiments that contained only a single
sample ("33B50 Normal Nitrogen" and "B73 Low Nitrogen") query
sequences were analyzed only for meeting reliable detection
criteria--no calls as to enrichment were made. 0MM intensity scores
in arbitrary and reliable detection assessments are listed by
sample for each query sequence in Table 4.
[0217] Expression profile results for the first 2652 maize
microRNAs from Table 1 are summarized in Table 4.
Detection of Public Domain Zea mays miRNAs
[0218] Public domain Zea mays miRNAs were included among the query
sequences for use as detection standards. Due to sequence
redundancy among miRNA family members, the 116 maize miRNAs
published at the time of array design were fully represented by 50
unique mature miRNA sequences (Griffiths-Jones, et al. Nuc Acids
Res (2006) 34:D140-D144. Release 9.0; Zhang, et al. FEBS Lett.
(2006) 580:3753-62; Sunkar, et al. The Plant Cell (2005)
17:1397-1411; Johnson, et al. Nuc Acids Res (2007) 35:D829-D833).
Using the reliable detection criteria outline in Table 3, 88% of
public domain miRNA sequences were detected in at least one
sample.
[0219] Of the six public domain miRNA sequences that failed to meet
reliable detection criteria in any sample, only miR437 and miR444
failed to surpass background noise. As miR437 expression has not
been assayed in maize and miR444 expression in maize is known to be
weak compared to its expression in rice, low signal strength for
these sequences could be expected (Sunkar, et al. The Plant Cell
(2005) 17:1397-1411). That only 4% of public domain miRNAs
sequences failed to surpass background signal indicated an
excellent signal to noise ratio within these datasets. MiR168a/b,
miR390 and miR395a/b/c surpassed background but failed to show
significant difference between 0MM and 1 MM signals. Although the
0MM signal was above background and distinct from its cognate
mismatches, 2MM signal for miR171 g was consistently higher than
its 0MM signal. For the four miRNA sequences lacking signal
resolution, it was impossible to conclude whether the query
sequence was absent and the 0MM signal indicated
cross-hybridization or whether the query sequence was present in
addition to a second sequence that specifically hybridized to the
mismatch probe.
[0220] Many public domain miRNAs have detectable basal expression
in nearly all tissues. (Johnson, et al. Nuc Acids Res (2007)
35:D829-D833). Consistent with this, 46% of public domain miRNAs
were reliably detected in all samples tested. Within the tissue
comparison experiment, 78% or more of the public domain miRNAs are
present in any sample. Near-ubiquitous basal expression also
accounts for so few public domain miRNAs being scored as "enriched"
or "highly enriched" in a single tissue or experimental condition.
The reliable detection of public domain miRNAs is summarized in
Table 5.
TABLE-US-00003 TABLE 5 Summary of the reliable detection of public
domain miRNAs. Pass all Simple Highly Sample criteria Pass Enriched
Enriched MAXIMUM 100% (50) POSSIBLE B73 Leaf 84% (42) 84% (42) 0%
(0) 0% (0) B73 Ear 78% (39) 76% (38) 2% (1) 0% (0) B73 Seedling 82%
(41) 82% (41) 0% (0) 0% (0) All tissues in survey 74% (37) One or
more tissues 88% (44) 3245 Normal 70% (35) 70% (35) 0% (0) 0% (0)
Nitrogen 3245 Low Nitrogen 62% (31) 62% (31) 0% (0) 0% (0) Both
samples 62% (31) 33B50 Normal 56% (28) Nitrogen B73 Low Nitrogen
78% (39) All samples 46% (23) One or more 88% (44) samples
Detection of Candidate miRNA Sequences
[0221] The reliable detection criteria described in Table 3 were
also applied to data from probes representing the 2652 candidate
miRNAs disclosed in this application (see Table 6). Only 136 or
5.1% of these candidates were reliably detected in all seven
samples. Because they were cloned or sequenced from small RNA
libraries, the most abundant and widely expressed miRNAs would have
been among the earliest to be detected and published. Accordingly,
it is reasonable that the proportion of candidate miRNAs
ubiquitously detected was much smaller than that for public domain
miRNAs. In absolute terms, the full validation of 136 miRNAs would
approximately double the known cadre of maize miRNAs.
[0222] Since the most abundant miRNAs are expected to have been
discovered and published in early RNA library searches, candidates
showing extremely robust 0MM intensity scores across all or most
samples should be treated with caution. Because the direct labeling
technique conjugates a fluorescent molecule to each guanine
residue, longer sequences are generally brighter than short
sequences. The size fractionation kit used in sample preparation
enriched for small RNAs from 0-200 nucleotides. Accordingly,
candidates with 0MM intensity scores above 20,000 in most samples
may be artifacts caused by RNA species much larger than 21
nucleotides in length.
[0223] Forty-one candidate sequences, or 1.5%, were reliably
detected as enriched or highly enriched in particular samples.
Strong tissue- or condition-specific detection patterns suggest
these candidates may be especially useful in targeted gene
silencing.
[0224] B73 was one of the maize strains used in the MPSS deep
sequencing experiments that yielded the 2652 candidate miRNAs. The
tissue survey samples used in the array analysis were also from B73
plants, as was an unpaired low nitrogen sample. Public domain and
candidate miRNAs met reliable detection standards at higher rates
in B73 samples than in other genotypes. Because public domain
miRNAs showed differing pass rates between B73 and other genotypes,
some of the discrepancy may be attributed to differences in growth
conditions or sample handling. Nonetheless, candidate miRNAs showed
a much greater disparity in reliable detection between B73 and
other genotypes, raising the possibility that miRNAs can be
differentially expressed in distinct genetic backgrounds.
TABLE-US-00004 TABLE 6 Summary of the reliable detection of
candidate miRNAs. Pass all Simple Sample criteria Pass Enriched
Highly Enriched MAXIMUM 100.0% (2652) POSSIBLE B73 Leaf 31.7% (841)
31.1% (824) 0.1% (3) 0.5% (14) B73 Ear 62.0% (1645) 61.3% (1626)
0.8% (20) 0.2% (6) B73 Seedling 42.2% (1120) 42.2% (1118) 0.1% (2)
0.0% (1) All tissues in survey 27.6% (731) One or more tissues
64.9% (1722) 3245 Normal 12.9% (343) 12.9% (342) 0.0% (0) 0.0% (1)
Nitrogen 3245 Low Nitrogen 9.4% (250) 9.4% (250) 0.0% (0) 0.0% (0)
Both samples 9.2% (243) 33B50 Normal 8.1% (216) Nitrogen B73 Low
Nitrogen 20.4% (540) All samples above 5.1% (136) One or more 65.6%
(1739) samples
Example 8
Validation of Small RNAs by Poly-Adenylation Assisted RT-PCR
[0225] The miRNA expression array and analysis procedures described
in Example 7 can be used to evaluate candidate miRNA detectability
and expression levels in additional samples, including but not
limited to: additional profiling of developmentally staged organs
or tissues; tissues from mutant strains defective in miRNA and
small RNA biogenesis; tissues from plants exposed to biotic stress
such as pathogens, pests, or weed pressure; tissues from plants
exposed to abiotic stresses such as drought, heat, or cold; and
tissues from plants subjected to nutrient stress such as low
nitrogen.
[0226] Candidates can be prioritized for individual
characterization based on the number of samples in which they were
reliably detected, the utility potential of putative targets, and
temporal, spatial and conditional expression patterns. Well known
characterization methods include, but are not limited to,
quantitative RT-PCR, Northern blotting, in situ hybridization,
reporter silencing assays, and modified 5' RACE on putative
targets.
[0227] As an example, small RNAs are analyzed using a modified
version of the Shi & Chiang protocol that allows for the
amplification of RNA fragments that do not have native poly(A)
tails (Biotechniques. 2005; 39(4):519-25). DNA is removed from
total RNA samples prepared with Trizol reagent (Invitrogen) by
digestion with recombinant DNasel (Ambion). Following ethanol
precipitation of the RNA, the material is poly-adenylated using E.
coli Poly(A) polymerase (Poly(A) Tailing Kit, Ambion).
[0228] First-strand DNA synthesis is accomplished with
SuperScriptIII reverse transcriptase and supplied poly(T) primers
(GeneRacer Kit, Invitrogen). Subsequent amplification by end-point
PCR uses low annealing temperatures (56.degree. C.) and short
extension times (30 seconds). The GeneRacer 3' Primer (GeneRacer
Kit, Invitrogen) is used as reverse primer and a sense, DNA version
of the small RNA of interest is used as a forward primer. The
presence of the diagnostic .about.81 mer PCR product is assessed by
visualizing PCR products with ethidium bromide on 10% acrylamide
TBE gels (Criterion gels, BioRad).
Example 9
Selective Regulation of Transgenes with MicroRNAs
[0229] Because each candidate miRNA has the potential to recognize
and negatively regulate a complementary sequence (i.e. "target
site"), it is believed that target sites for these candidate miRNAs
will serve as useful cis-acting regulatory sequences in transgenic
constructs (Parizotto et al. (2004) Genes Dev 18: 2237-2242). This
is especially true when the miRNA displays a precise
tissue-specific or conditional pattern of expression. For example,
to express a particular gene of interest in the shoot but not in
the root, the target site of a root-specific miRNA is fused to the
coding sequence of said gene of interest. In this manner, even if
the gene of interest is driven by a constitutive promoter, the
transcript should only accumulate in the shoot and not in the root,
because the endogenous root-specific miRNA will recognize the
attached target site and silence the gene's expression in the
root.
[0230] To test this idea, miRNAs displaying tissue-specific
expression are identified (see Example 7). Ideally, biologically
relevant targets can be found bioinformatically and validated by
the RACE cleavage assay; however, a sequence that is perfectly
complementary to the miRNA should also suffice. The sequence
designated as target site is fused to the 5' or 3' end of a
suitable reporter gene that is driven by a constitutive promoter,
and transgenic plants are generated. A pattern of expression that
is the opposite of the tissue-specific miRNA pattern is taken as
evidence that the target site is working as a cis regulatory
element. This type of cis regulation allows further refinement of
transgene expression patterns, such that "leaky" promoters (e.g.
with small amounts of gene expression in undesirable tissues or
conditions) are fine tuned and true tissue-specificity is
achieved.
[0231] One example of a miRNA that has a stage-specific pattern of
expression is miR172. In young Arabidopsis seedlings, miR172 is
undetectable, whereas in more mature seedlings it is at higher
levels, and this higher expression persists after the transition to
flowering (Aukerman and Sakai (2003) Plant Cell 15:2730-41).
Addition of the miR172 target site to a heterologous gene in a
transgenic construct should therefore allow the transgene to be
turned on in early seedling development, and then downregulated
later on. To test this concept, the target sequence for miR172 is
fused to the 3' end of the coding sequence for coral reef yellow
fluorescent protein (ZS-yellow, Clonetech). As a negative control,
a mutated version of the miR172 target site is separately fused to
ZS-yellow, and both gene cassettes are separately placed under the
control of the constitutive 35S promoter in a standard binary
vector. These constructs are transformed into Arabidopsis (ecotype
Col-0), and also into the rdr6 mutant if the levels of transgene
silencing (independent of miRNA regulation) are too high. The
expected result is that levels of ZS-yellow will be high in young
transgenic seedlings containing the ZS-yellow/wild-type target
site, and much lower as the plants mature. On the other hand,
transgenic plants containing the ZS-yellow/mutated target site
should not display this stage-specific downregulation.
[0232] To extend this analysis to maize, a target site for one of
the maize miRNAs in this application's sequence listing, (SEQ ID
NO:116; 5'-TTAGATGACCATCAGCAAAC-3') is useful. This particular
miRNA is expressed at high levels in maize endosperm, and at much
lower levels in other tissues. The target gene is EB158863, and the
target site has two mismatches with the miRNA at the 3' end of the
miRNA. The target site is fused to the 3' end of ZS-yellow, and
this construct is placed under the control of the maize ubiquitin
promoter. The expression construct is inserted into a suitable
vector for maize transformation. A negative control construct
containing a mutated version of the target site is also be made.
Both constructs are transformed into maize embryogenic callus, and
transgenic plants are selected. The expected result is that the
levels of ZS-yellow will be high in most parts of the plants that
contain the ZS-yellow/wild-type target site, but much lower in the
endosperm. On the other hand, transgenic plants containing the
ZS-yellow/mutated target site should not display this
endosperm-preferred downregulation.
[0233] A reciprocal result is also possible in these types of
experiments. The enriched/highly enriched calls shown in Example 7
were based on condition specificity or enhancement. Therefore the
summaries were weighted for detection versus no detection. It is
just as likely that particular microRNAs are depleted in a specific
tissue rather than being enhanced in a specific tissue. This would
allow target genes to be generally repressed and then expressed in
a limited fashion in those tissues where the particular microRNA is
under-expressed.
[0234] In both experiments described above, a pattern of expression
that is the opposite of the tissue-specific miRNA pattern will be
taken as evidence that the target site under study is working as a
cis regulatory element. Utilizing these novel cis elements in
combination with a wide variety of promoter elements allows for
expression of transgenes in very specific patterns or stages during
plant growth and development. For example, this type of cis
regulation by miRNA targets would allow further refinement of
transgene expression patterns, such that "leaky" promoters (e.g.
with small amounts of gene expression in undesirable tissues or
conditions) could be fine tuned and true tissue-specificity could
be achieved. It is also envisioned that multiple miRNA targets
could be incorporated in concert on a single expressed transgene.
Multiple miRNA targets with different patterns of regulation and
control could impart novel modes of regulation on transgene
expression.
Example 10
Transgene Abundance May Affect Regulation by MicroRNAs
[0235] To test the potential for combinatorial control of
transgenes by multiple miRNAs, the following experiment was
performed. The ZS-yellow coding region was separately fused to
either a target sequence for AtmiR827 at the 5' end, or to a target
sequence for AtmiR397 at the 3' end ("single site constructs"). In
a third construct, both target sequences were fused to ZS-yellow
coding sequence, in the same positions as the single site
constructs, thus creating a "double site construct." Previous data
showed that AtmiR827 was specifically expressed in hydathodes,
based upon analyses of AtmiR827 promoter-GUS histochemical assays.
Therefore, a single site transgene construct containing the target
site for AtmiR827 would be under the control of the endogenous
miRNA, and might be expected to give rise to reduced expression of
the transgene in hydathodes, when compared to a "no site" control
construct. Likewise, microarray analysis had suggested that
AtmiR397 was preferentially expressed in the root, and therefore a
construct containing the target site for AtmiR397 might be expected
to give rise to reduced expression of the transgene in the root,
when compared to a "no site" control. The double site construct
might be expected to behave as the sum of both single site
constructs, giving rise to reduced expression in both the hydathode
and root.
[0236] All three modified ZS-yellow sequences were separately
placed under the control of the constitutive 35S promoter, and an
unmodified ZS-yellow sequence was also separately fused to 35S as
the "no site" control, in the binary vector pBC (Promega; Madison,
Wis.). Both single site constructs, the double site construct, and
the "no site" control construct were transformed into Arabidopsis
using "floral dip" transformation (Clough and Bent (1998) Plant J
16:735-43) and T1 seeds were identified that expressed YFP from the
ZS-yellow transgene. The T1 seeds were germinated on agar plates,
and monitored for YFP expression starting at 5 days after
germination. There were no observed differences in the expression
pattern between the four constructs. More specifically, there was
no observed reduction of YFP expression in the hydathodes in plants
containing ZS-yellow fused to the target site for AtmiR827, nor was
there a reduction of YFP expression in the roots of plants
containing ZS-yellow fused to the target site for AtmiR397, when
compared to ZS-yellow alone. Plants containing both sites fused to
ZS-yellow likewise showed no effect relative to ZS-yellow alone. It
is possible that the levels of endogenous AtmiR827 and AtmiR397 are
too low relative to the levels of target-linked ZS-yellow to have
achieved the desired downregulation in the relevant tissues. Both
miRNAs are in general not very abundant, compared to commonly
studied miRNAs like miR171 or miR156; whereas the target gene
sequences in this experiment were driven by a strong viral promoter
(35S). It should be noted that the only group that has reported
transgene downregulation mediated by an endogenous miRNA (Parizotto
et al. (2004) Genes Dev 18: 2237-2242) utilized miR171, a highly
abundant miRNA, to downregulate a 35S-driven transgene containing
the cognate target site.
Example 11
Selective Regulation of Transgenes with MicroRNAs of Comparable
Abundance
[0237] YFP transcripts incorporating AtmiR827 and Atmir397 target
sites may not have exhibited altered expression due to the
extremely low abundance of those miRNAs in planta, especially when
compared to the high levels of YFP mRNA likely produced by the 35S
promoter. Therefore, target sites from more abundant miRNAs might
circumvent this potential problem. To this end, the ZS-yellow
coding region can be separately fused to either a target sequence
for AtmiR171 at the 5' end, or to a target sequence for AtmiR156 at
the 3' end ("single site constructs"). In a third construct, both
target sequences will be fused to ZS-yellow coding sequence, in the
same positions as the single site constructs, thus creating a
"double site" construct. Both AtmiR171 and AtmiR156 are relatively
abundant microRNAs, and are expressed in a variety of tissues. In
the gynoecium, AtmiR171 is expressed in the carpel valves but
absent from the replum, style and stigma; this pattern is
reciprocal to that seen for a reporter construct ("sensor
construct") containing the AtmiR171 target site (Parizotto et al.
(2004) Genes Dev 18: 2237-2242). In contrast, AtmiR156 expression
in the gynoecium is limited to the style (Rebecca Schwab, 2006,
thesis from University of Tubingen), and thus the single site
construct containing an AtmiR156 target site fused to ZS-yellow
should have YFP expression in all parts of the gynoecium except the
style. The double site construct with ZS-yellow would be expected
to give rise to YFP expression only in the areas where both miRNAs
are absent, i.e. the replum and stigma. One would expect the double
site construct to behave as the sum of both single site constructs,
with regards to YFP expression in the gynoecium.
Example 12
Trans-Acting miRNA Silencing
[0238] One can envision using tissue- or stage-specific miRNAs to
silence a gene of interest only in a particular tissue or
development stage of the organism, utilizing an artificial
transacting siRNA (ta-siRNA) construct. The objective in this case
is to generate artificial ta-siRNAs in a tissue- or stage-specific
manner, by using a miRNA target corresponding to a tissue- or
stage-specific miRNA as the trigger sequence ("trigger" refers to
the target sequence that initiates production of the downstream
ta-siRNAs). For example, if it were desired to silence a gene in
the seeds of plants, one would choose as a trigger sequence the
target sequence of a miRNA present only in the seeds. Such
constructs are generated as follows:
[0239] A chimeric polynucleotide is constructed in which the target
site for a tissue- or stage-specific miRNA is used as a trigger
sequence and is operably linked to the 5' end of a silencer
sequence. The silencer sequence comprises a synthetic DNA fragment
containing 5 repeated copies of a 21 nucleotide segment
complementary to the Arabidopsis fatty acid desaturase 2 (FAD2)
gene with the sequence [5'-TTGCTTTCTTCAGATCTCCCA-3'; SEQ ID
NO:7958]. The trigger sequence complementary to the miRNA is
followed by 11 nucleotides such that the miRNA cleavage site is
separated by 21 nucleotides from the first of the 21 nucleotide
FAD2 segments. Sequences flanking the trigger and silencer are
derived from the TAS1c locus (Allen et al. (2005) Cell 121:207-21).
The 35S promoter and leader sequence (Odell (1985) Nature 313:
810-812) are attached to the 5' end of the chimeric construct and
the phaseolin transcriptional terminator (Barr et al. (2004)
Molecular Breeding 13: 345-356) to the 3' end. The entire chimeric
polynucleotide is inserted into the standard binary vector pBE851
(Aukerman and Sakai (2003) Plant Cell 15:2730-41) and transformed
into Arabidopsis using the method of Clough and Bent (1998) Plant
Journal 16:735-43. As a control, the exact same construct is made
but with 3 nucleotides of the miRNA target site mutated. Transgenic
plants containing the experimental construct are monitored for
silencing of the FAD2 gene using fatty acid analysis (Browse et al.
(1986) Analytical Biochemistry 152: 141-145) and compared to
control plants. Silencing may be scored as a detectable reduction
in transcript level and/or a reduction in the gene products
produced by those transcripts.
[0240] It is believed that any of the targets of microRNAs of the
present invention could be useful as the tissue- or stage-specific
trigger sequences. In addition, concatemers of miRNA sequences
(such as those found in SEQ ID NO:7957 or SEQ ID NO:8427) are also
useful as silencer sequences which would down-regulate their
endogenous targets and/or the gene products of those targets in a
pattern directed by the trigger sequence. Using different
combinations of miRNA target sequences one could conceivably alter
the expression patterns of multiple genes with a single construct.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20080115240A1)-
. An electronic copy of the "Sequence Listing" will also be
available from the USPTO upon request and payment of the fee set
forth in 37 CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20080115240A1)-
. An electronic copy of the "Sequence Listing" will also be
available from the USPTO upon request and payment of the fee set
forth in 37 CFR 1.19(b)(3).
* * * * *
References