U.S. patent application number 11/968343 was filed with the patent office on 2008-05-08 for therapeutic agent for inflammatory bowel disease and tnf-alfa production inhibitor.
This patent application is currently assigned to Ajinomoto Co., Inc.. Invention is credited to Masaki Hashimoto, HIDEKI MATSUMOTO, Tomohisa Okutsu, Miho Ono, Hideki Suzuki, Manabu Suzuki, Tomoko Takeda, Tetsuo Yano.
Application Number | 20080108684 11/968343 |
Document ID | / |
Family ID | 37604474 |
Filed Date | 2008-05-08 |
United States Patent
Application |
20080108684 |
Kind Code |
A1 |
MATSUMOTO; HIDEKI ; et
al. |
May 8, 2008 |
THERAPEUTIC AGENT FOR INFLAMMATORY BOWEL DISEASE AND TNF-ALFA
PRODUCTION INHIBITOR
Abstract
Disclosed is an agent for use in the treatment or prevention of
inflammatory bowel disease. Also disclosed is an agent for
inhibiting the production of TNF-.alpha.. A therapeutic or
prophylactic agent for inflammatory bowel disease comprising at
least one amino acid selected from the group consisting of lysine,
histidine, phenylalanine, methionine, tryptophan, glutamine,
glycine, cysteine, cystine and threonine, the amino acid being
administered at a dose of 0.1 to 4000 mg/kg per day; and a
TNF-.alpha. production inhibitor comprising an amino acid selected
from the group consisting of histidine, phenylalanine and
tryptophan, the amino acid being administered at a dose of 0.1 to
4000 mg/kg per day.
Inventors: |
MATSUMOTO; HIDEKI;
(Kawasaki-Shi, JP) ; Okutsu; Tomohisa;
(Kawasaki-Shi, JP) ; Takeda; Tomoko;
(Kawasaki-Shi, JP) ; Suzuki; Hideki;
(Kawasaki-Shi, JP) ; Yano; Tetsuo; (Kawasaki-Shi,
JP) ; Hashimoto; Masaki; (Kawasaki-Shi, JP) ;
Ono; Miho; (Kawasaki-Shi, JP) ; Suzuki; Manabu;
(Chuo-ku, JP) |
Correspondence
Address: |
OBLON, SPIVAK, MCCLELLAND MAIER & NEUSTADT, P.C.
1940 DUKE STREET
ALEXANDRIA
VA
22314
US
|
Assignee: |
Ajinomoto Co., Inc.
Tokyo
JP
|
Family ID: |
37604474 |
Appl. No.: |
11/968343 |
Filed: |
January 2, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/JP2006/313236 |
Jul 3, 2006 |
|
|
|
11968343 |
Jan 2, 2008 |
|
|
|
Current U.S.
Class: |
514/400 ;
514/419; 514/561; 514/562; 514/563; 514/564; 514/565; 514/566;
514/567 |
Current CPC
Class: |
A61K 31/405 20130101;
A61K 2300/00 20130101; A61K 2300/00 20130101; A61K 2300/00
20130101; A61P 37/02 20180101; A61P 25/00 20180101; A61P 31/04
20180101; A61P 37/06 20180101; A61P 35/00 20180101; A61P 19/04
20180101; A61P 17/06 20180101; Y02A 50/411 20180101; A61K 31/4172
20130101; A61P 1/00 20180101; A61K 31/198 20130101; A61P 19/10
20180101; A61P 1/16 20180101; A61K 31/4172 20130101; A61P 27/02
20180101; A61P 3/10 20180101; A61K 31/405 20130101; A61P 19/02
20180101; A61P 43/00 20180101; A61P 37/08 20180101; A61K 31/198
20130101; A61P 1/04 20180101; A61P 9/04 20180101; A61P 29/00
20180101 |
Class at
Publication: |
514/400 ;
514/419; 514/561; 514/562; 514/563; 514/564; 514/565; 514/566;
514/567 |
International
Class: |
A61K 31/4172 20060101
A61K031/4172; A61K 31/405 20060101 A61K031/405; A61K 31/198
20060101 A61K031/198 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 1, 2005 |
JP |
2005-193591 |
Claims
1. An agent for treatment or prevention of an inflammatory bowel
disease wherein it contains one or more amino acids selected from
the group consisting of lysine, histidine, phenylalanine,
methionine, tryptophan, glutamine, glycine, cysteine, cystine and
threonine, and the amino acids are administered in an amount of 0.1
to 4000 mg/kg per day.
2. The agent for treatment or prevention of the inflammatory bowel
disease of claim 1 wherein it contains one or more amino acids
selected from the group consisting of lysine, histidine,
phenylalanine, tryptophan and glutamine.
3. The agent for treatment or prevention of the inflammatory bowel
disease of claim 1 wherein it contains tryptophan.
4. The agent for treatment or prevention of the inflammatory bowel
disease of claim 3 wherein it further contains one or more amino
acids selected from the group consisting of lysine, histidine,
phenylalanine and glutamine.
5. An agent for treatment or prevention of an inflammatory bowel
disease wherein it contains 0.5 to 2% by weight of tryptophan, 3 to
9% by weight of lysine, 1.5 to 5% by weight of histidine, 4 to 10%
by weight of phenylalanine and 9 to 23% by weight of glutamine, and
the amino acids are administered in an amount of 0.1 to 4000 mg/kg
per day.
6. The agent for treatment or prevention of the inflammatory bowel
disease of claim 1 wherein the inflammatory bowel disease is
Crohn's disease.
7. The agent for treatment or prevention of the inflammatory bowel
disease of claim 1 wherein the inflammatory bowel disease is
ulcerative colitis.
8. An inhibitor of TNF-.alpha. production wherein it contains amino
acids selected from the group consisting of histidine,
phenylalanine and tryptophan, and the amino acids are administered
in an amount of 0.1 to 4000 mg/kg per day.
9. An inhibitor of TNF-.alpha. production wherein it contains 0.5
to 2% by weight of tryptophan, 3 to 9% by weight of lysine, 1.5 to
5% by weight of histidine, 4 to 10% by weight of phenylalanine and
9 to 23% by weight of glutamine, and the amino acids are
administered in an amount of 0.1 to 4000 mg/kg per day.
Description
TECHNICAL FIELD
[0001] The present invention relates to an agent for treating or
preventing an inflammatory bowel disease, comprising a particular
amino acid(s). The present invention also relates to an agent for
inhibiting TNF production, comprising a particular amino
acid(s).
BACKGROUND ART
[0002] An inflammatory bowel disease is a generic term for
enteropathy with inflammation, and mainly includes ulcerative
colitis and Crohn's disease. The ulcerative colitis is a diffuse
non-specific inflammatory disease where large bowel mucosa or
submucosa is affected and erosion or ulcer is often formed.
Clinical symptoms are mucous and bloody stools, abdominal pain,
blood stools, watery stools, fever, lack of appetite, malevolence,
emesis and the like. As agents for treating the ulcerative colitis,
salazosulfapyridine, adrenal cortex steroids, immunosuppressants,
5-aminosalicylic acid (5-ASA) and the like are used, but it can not
be said that these agents are enough to treat the ulcerative
colitis.
[0003] Crohn's disease is an idiopathic chronic enteritis of
unknown cause, and exhibits non-specific inflammatory symptoms in
intestines from a small intestine to a large intestine. Its lesions
are composed of granulomatous lesions with fibrosis and ulcer, and
it is likely that the lesions appear in all gastrointestinal area
from an oral cavity to an anus. The clinical symptoms of Crohn's
disease include abdominal pain, general malaise, diarrhea, melena,
occult blood positive, fever, weight loss, anemia, ileus symptom,
abdominal tumor, malevolence, emesis and peritonitis symptom.
Crohn's disease simultaneously causes various gastrointestinal and
parenteral symptoms, e.g., intestinal stenosis, intestinal
perforation, abdominal abscess and heavy hemorrhage which are
serious conditions, in addition to nutritional disorder, and often
requires procedures such as intestinal surgery. In Japan, a high
calorie infusion or an enteral nutrition is performed for the
purpose of improving the nutritional condition. In the high calorie
infusion, a risk of bacterial translocation is increased. Thus,
particularly for a long term, the enteral nutrition is performed.
In addition, the therapy by an agent has been attempted. In the
drug therapy, salazosulfapyridine, metronodazole, adrenal cortex
steroids, immunosuppressants, 5-aminosalicylic acid (5-ASA) and the
like are administered. Recently, an anti-TNF antibody has begun to
be administered clinically. However, it can be said that the
administration of these agents is insufficient yet for treating the
Crohn's disease.
[0004] TNF-.alpha. is an inflammatory cytokine produced by
macrophages, macrophage lineage cells (Kupper cells), neutrophils,
basophils, eosinophils, lymphocytes, NK cells, LAK cells, mast
cells, bone marrow cells, fibroblasts, astrocytes, keratinocytes
and the like, and has been recently demonstrated to be deeply
involved in pathogenesis of many diseases including Crohn's
disease. Therefore, it is believed that if the action of
TNF-.alpha. can be inhibited, it becomes possible to treat those
diseases. Currently, steroidal hormone agents and non-steroidal
anti-inflammatory agents are applied to some inflammatory diseases.
However, they have diverse action points and do not have an
inhibitory action specific for TNF-.alpha.. Thus, it is likely to
elicit harmful side effects. Particularly, the side effect of the
steroid agent has become a medical problem. Furthermore, the
treatment using an anti-TNF-.alpha. antibody and a soluble
TNF-.alpha. receptor which are peptide macromolecules gives good
clinical results in chronic rheumatoid arthritis and Crohn's
disease, but sometimes induces serious infectious diseases
including tuberculosis and sepsis, and deterioration of
demyelinating disease. Occurrence of malignant tumors has been also
reported. Additionally, the formation of a neutralization antibody
has been reported, and thus they can not be said to be
sufficient.
DISCLOSURE OF INVENTION
Problem to be Solved by the Invention
[0005] The present invention aims at providing an agent for use in
the treatment or prevention of inflammatory bowel diseases. The
present invention also aims at providing an agent for inhibiting
the production of TNF-.alpha..
Means for Solving Problem
[0006] As a result of an extensive study on inflammatory bowel
diseases and TNF-.alpha. production for accomplishing the above
objects, the present inventor has found that an excellent effect is
obtained by administering a particular amino acid(s) in a
particular amount(s), and completed the present invention.
[0007] That is, the present invention provides an agent for
treatment or prevention of an inflammatory bowel disease wherein it
contains one or more amino acids selected from the group consisting
of lysine, histidine, phenylalanine, methionine, tryptophan,
glutamine, glycine, cysteine, cystine and threonine, and the amino
acids are administered in an amount of 0.1 to 4000 mg/kg per
day.
[0008] The individual amino acid described herein includes any form
of D-type, L-type or a mixture of D and L, and preferably the
L-type is used. The individual amino acid may also be in a salt
form in addition to the free amino acid. Furthermore, the
individual amino acid may be the form of a peptide. In the case of
the peptide, the number of the amino acids is preferably 20 or
less. A dosage of the amino acid is given in terms of the free
amino acid.
[0009] The present invention provides an agent for treatment or
prevention of an inflammatory bowel disease wherein it contains 0.5
to 2% by weight of tryptophan, 3 to 9% by weight of lysine, 1.5 to
5% by weight of histidine, 4 to 10% by weight of phenylalanine and
9 to 23% by weight of glutamine, and the amino acids are
administered in an amount of 0.1 to 4000 mg/kg per day.
[0010] Furthermore, the present invention provides aninhibitor of
TNF-.alpha. production wherein it contains amino acids selected
from the group consisting of histidine, phenylalanine and
tryptophan, and the amino acids are administered in an amount of
0.1 to 4000 mg/kg per day.
[0011] Still further, the present invention provides an inhibitor
of TNF-.alpha. production wherein it contains 0.5 to 2% by weight
of tryptophan, 3 to 9% by weight of lysine, 1.5 to 5% by weight of
histidine, 4 to 10% by weight of phenylalanine and 9 to 23% by
weight of glutamine, and the amino acids are administered in an
amount of 0.1 to 4000 mg/kg per day.
BEST MODES FOR CARRYING OUT THE INVENTION
[0012] The inflammatory bowel disease to which the agent for
treatment or prevention of the present invention is applied is an
intestine-related disease, and the agent is effective for example
for ulcerative colitis and Crohn's disease.
[0013] The agent for treatment or prevention of the inflammatory
bowel disease of the present invention contains the amino acids
selected from the group consisting of lysine, histidine,
phenylalanine, methionine, tryptophan, glutamine, glycine,
cysteine, cystine and threonine. One or more amino acids may be
contained. In light of therapeutic or preventive effect, the agent
for treatment or prevention of the inflammatory bowel disease of
the present invention preferably contains the amino acids selected
from the group consisting of lysine, histidine, phenylalanine,
tryptophan and glutamine, and most preferably contains tryptophan.
One or more amino acids selected from the group consisting of
lysine, histidine, phenylalanine, and glutamine may be contained in
addition to tryptophan.
[0014] The agent for treatment or prevention of inflammatory bowel
disease of the present invention is administered in the amount of
0.1 to 4000 mg/kg of the amino acid(s) (when two or more amino
acids are contained, the amount is a total thereof) per day. In
light of therapeutic or preventive effect, the agent for treatment
or prevention of the inflammatory bowel disease of the present
invention is preferably administered in the amount of 0.1 to 1000
mg/kg and most preferably 1 to 500 mg/kg of the amino acid(s) per
day.
[0015] Furthermore, the amino acids other than the above, e.g.,
isoleucine, leucine, valine, arginine, alanine, aspartic acid,
proline, serine, tyrosine, glutamic acid, asparagine and the like
may be contained.
[0016] In another embodiment, the agent for treatment or prevention
of the inflammatory bowel disease of the present invention contains
0.5 to 2% by weight of tryptophan, 3 to 9% by weight of lysine, 1.5
to 5% by weight of histidine, 4 to 10% by weight of phenylalanine,
and 9 to 23% by weight of glutamine. In light of therapeutic or
preventive effect, the agent for treatment or prevention of the
inflammatory bowel disease of the present invention contains 0.9 to
1.5% by weight of tryptophan, 4 to 7.1% by weight of lysine, 2 to
4% by weight of histidine, 5 to 9% by weight of phenylalanine, and
11 to 20% by weight of glutamine, and most preferably contains 1.0
to 1.3% by weight of tryptophan, 4.5 to 6% by weight of lysine, 2.4
to 3.5% by weight of histidine, 6 to 8% by weight of phenylalanine,
and 13 to 17% by weight of glutamine.
[0017] The agent for treatment or prevention of inflammatory bowel
disease is administered in the amount of 0.1 to 4000 mg/kg per day
in terms of the total amount of the amino acids. In light of
therapeutic or preventive effect, the agent for treatment or
prevention of the inflammatory bowel disease is administered in the
amount of 0.1 to 1000 mg/kg and most preferably 1 to 500 mg/kg per
day in terms of the total amount of the amino acids.
[0018] Furthermore, the amino acids other than the above, e.g.,
isoleucine, leucine, methionine, threonine, valine, arginine,
alanine, aspartic acid, glycine, proline, serine, tyrosine,
cysteine, cystine, glutamic acid, asparagine and the like may be
contained.
[0019] The inhibitor of the present invention inhibits the
secretion of TNF-.alpha. from TNF-.alpha. producing cells such as
macrophages, macrophage lineage cells (Kupper cells), neutrophils,
basophils, eosinophils, lymphocytes, NK cells, LAK cells, mast
cells, bone marrow cells, fibroblasts, astrocytes, keratinocytes
and the like. Therefore the inhibitor of the present invention is
anticipated as being usable as the agent for treatment or
prevention of the diseases where the inhibition of TNF-.alpha.
production is effective, e.g., sepsis, septic shock, endotoxin
shock, oligemic shock, post-oligemic reperfusion injury,
meningitis, psoriasis, congestive heart failure, fibrosis,
hepatitis, insulin independent diabetes, graft rejection, graft
versus host disease, cancer, cachexia, arthritis (chronic
rheumatoid arthritis, rheumatoid spondylitis, osteoarthritis, other
arthritis), inflammatory bone diseases, bone resorption diseases,
Behcet's syndrome, infectious diseases (opportunistic infection due
to AIDS, cerebral malaria, infection with Mycobacterium),
autoimmune diseases (systemic lupus erythematosus, rheumatoid
diseases, allergy, multiple sclerosis, autoimmune uveitis,
nephrosis syndrome, type I diabetes (IDDM)), Crohn's disease,
ulcerative colitis, erythema nodosum, and damage of alveoli due to
radiation disorder and hyperoxia.
[0020] The inhibitor of the TNF-.alpha. production of the present
invention contains the amino acids selected from the group
consisting of histidine, phenylalanine and tryptophan. One or more
of the amino acids may be contained.
[0021] The inhibitor of the TNF-.alpha. production is administered
in the amount of 0.1 to 4000 mg/kg of the amino acid(s) (when two
or more amino acids are contained, the amount is the total thereof)
per day. In light of inhibitory effect, the inhibitor of the
TNF-.alpha. production is preferably administered in the amount of
0.1 to 1000 mg/kg and most preferably 1 to 500 mg/kg of the amino
acid(s) per day.
[0022] Furthermore, the amino acids other than the above, e.g.,
lysine, methionine, glutamine, glycine, cysteine, cystine,
threonine, isoleucine, leucine, valine, arginine, alanine, aspartic
acid, proline, serine, tyrosine, asparagine, glutamic acid and the
like may be contained.
[0023] In another embodiment, the inhibitor of the TNF-.alpha.
production of the present invention contains 0.5 to 2% by weight of
tryptophan, 3 to 9% by weight of lysine, 1.5 to 5% by weight of
histidine, 4 to 10% by weight of phenylalanine and 9 to 23% by
weight of glutamine. In light of inhibitory effect, the inhibitor
of the TNF-.alpha. production of the present invention preferably
contains 0.9 to 1.5% by weight of tryptophan, 4 to 7.1% by weight
of lysine, 2 to 4% by weight of histidine, 5 to 9% by weight of
phenylalanine and 11 to 20% by weight of glutamine, and most
preferably contains 1.0 to 1.3% by weight of tryptophan, 4.5 to 6%
by weight of lysine, 2.4 to 3.5% by weight of histidine, 6 to 8% by
weight of phenylalanine and 13 to 17% by weight of glutamine.
[0024] The inhibitor of the TNF-.alpha. production is administered
in the amount of 0.1 to 4000 mg/kg per day in terms of the total
amount of the amino acids. In light of inhibitory effect, the
inhibitor of the TNF-.alpha. production is preferably administered
in the amount of 0.1 to 1000 mg/kg and most preferably 1 to 500
mg/kg per day in terms of the total amount of the amino acids.
[0025] Furthermore, the amino acids other than the above, e.g.,
methionine, glycine, cysteine, cystine, threonine, isoleucine,
leucine, valine, arginine, alanine, aspartic acid, proline, serine,
tyrosine, asparagine, glutamic acid ant the like may be
contained.
[0026] The agent for treatment or prevention of the inflammatory
bowel disease and the inhibitor of the TNF-.alpha. production of
the present invention may be appropriate formulations, and are
prepared in the form of, for example, powders, particles, granules,
tablets, capsules and liquids.
[0027] As additives added to the powders, particles, granules,
tablets and capsules, for example, excipients (e.g., lactose,
glucose, D-mannitol, starch, crystalline cellulose, calcium
carbonate, kaolin, light silic acid anhydrate, trehalose), binders
(e.g., starch glue liquid, gelatin solution,
hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinyl
pyrrolidone, ethanol), disintegrants (e.g., starch, gelatin powder,
carboxymethylcellulose, carboxymethylcellulose calcium salt),
lubricants (e.g., magnesium stearate, talc), coating agents (e.g.,
hydroxypropylcellulose, hydroxypropylmethylcellulose,
acetylcellulose, saccharose, titanium oxide) are available.
Additionally if necessary, coloring agents, flavoring agents and
odor improving agents are added. As the additives added to oral
liquid agents, preservatives (e.g., benzoic acid, paraoxybenzoate
ester, sodium dehydroacetate), suspending agents and emulsifiers
(e.g., gum arabic, tragacanth, carboxymethylcellulose sodium salt,
methylcellulose, egg yolk, surfactant), and sweeteners and
acidifiers (e.g., trehalose, citric acid) are available.
Additionally, if necessary, coloring agents and stabilizers are
added. As solvents used therefor, purified water is mainly used,
but ethanol, glycerine and propylene glycol can also be used.
[0028] Additionally, nutritional ingredients such as dextrin,
protein sources, carbohydrate sources, vitamins, minerals and trace
elements may be contained. The protein source may be the protein
useful for nutrition supply, and may be any of the animal proteins
and plant proteins. As the animal protein, milk proteins are
preferable, and particularly low lactose milk proteins and casein
are preferable. As the plant protein, a separated soybean protein
is preferable. Two or more proteins may be combined. The protein
source may be peptides obtained by hydrolyzing the protein. As the
carbohydrate source, saccharides are preferable, monosaccharides,
disaccharides, and polysaccharides can be included, and more
specifically, glucose, fructose, mannose, galactose, sucrose, sugar
(may be purified saccharose), maltose, lactose, dextrin,
maltodextrin, starch, maize starch, soybean oligosaccharide and
sugar alcohol can be included. Two or more of these saccharides may
be combined. As the carbohydrate source, it is preferable to
contain any one of sugar, dextrin, maltodextrin and maize starch.
The vitamins include vitamin B1, vitamin B2, vitamin B6, vitamin
B12, vitamin C, vitamin A, vitamin D, vitamin E, vitamin K, vitamin
H, folic acid, pantothenic acids and nicotinic acids. Particularly,
vitamin C and vitamin E are preferable because they have a property
as an antioxidant. The minerals are not particularly limited as
long as they are generally used in this field. Specifically,
calcium, sodium, potassium, magnesium, chlorine and phosphorus in
an inorganic or organic salt form can be included. For each
inorganic or organic salt, the same salts as those which have been
already placed on the market and combined in the infusion and the
enteral nutrition can be used. The trace element is a metal element
which is a trace amount but indispensable for a living body.
Specifically, zinc, iron, manganese, copper, chromium, molybdenum,
serene, fluorine and iodine in the inorganic and organic salt form
are included. Each trace element may be combined in consideration
of a daily needed amount.
[0029] The agent for treatment or prevention of the inflammatory
bowel disease and the inhibitor of the TNF-.alpha. production of
the present invention can be prepared by standard methods of
granulating each active ingredient directly or mixing each active
ingredient with the pharmaceutically acceptable additives depending
on each formulation and granulating, or dissolving the agent in the
appropriate solvent to emulsify or suspend it, and further mixing
it with an appropriate base.
[0030] The agent for treatment or prevention of the inflammatory
bowel disease and the inhibitor of the TNF-.alpha. production of
the present invention can be administered orally or parenterally.
Contents of the above amino acids, additives and nutritional
ingredients are controlled so that the aforementioned amount to be
administered daily can be accomplished by dosing once or several
times daily. The preferable method of administration includes oral
administration, enteral administration (trans-gastric
administration, trans-duodenal administration, percutaneous
endoscopic gastrostomy (PEG) using a tube, or an enema is
preferable), and intravenous administration.
EXAMPLES
Therapeutic Effect on Inflammatory Bowel Disease
[0031] Balb/c background IL-10 deficient mice were established from
C57BL/6 background IL-10 deficient mice by back-crossing for
seventh generations. Balb/c background IL-10 deficient mice
spontaneously develop the colitis with aging and exhibit symptoms
such as diarrhea. Spleen, mesenteric lymph nodes and sacral lymph
nodes were collected from the IL-10 gene-deficient Balb/c mice
(male) which had developed the colitis detected by observing the
diarrhea symptoms. After preparing single cell suspensions, the
cells at about 1.times.10.sup.7 were injected intraperitoneally to
Scid mice which were immunodeficiency mice (hereinafter the Scid
mouse injected IP was referred to as an "experiment mouse").
Subsequently, a chow was changed to an experimental diet. As the
experimental diet, a standard chow or those obtained by mixing the
amino acids with the standard chow shown in the following Tables 1
to 5 were used. At a time point three weeks after cell transfer,
the mice were killed, the colon was collected, the intestinal
contents were washed out, and its weight was measured. A percentage
of inhibiting a weight gain of the colon was calculated by the
following formula. Percentage of inhibiting a weight gain of
colon=[1-(Colon weight in target group-Colon weight in cell
transfer group)/(Colon weight in standard chow group-Colon weight
in cell transfer group)].times.100(%)
[0032] Results are shown in the following Tables 1 to 5. An amino
acid mixture A is composed of the following amino acids (% by
weight is represented in terms of free amino acid).
L-isoleucine: 4.56% by weight
L-leucine: 6.38% by weight
L-lysine hydrochloride: 6.30% by weight
L-methionine: 4.60% by weight
L-phenylalanine: 6.18% by weight
L-threonine: 3.71% by weight
L-tryptophan: 1.07% by weight
L-valine: 4.98% by weight
L-histidine hydrochloride: 3.56% by weight
L-arginine hydrochloride: 7.99% by weight
L-alanine: 6.38% by weight
Magnesium potassium L-aspartate: 7.35% by weight
Sodium aspartate hydrate: 6.15% by weight
L-glutamine: 13.71% by weight
Glycine: 3.58% by weight
L-proline: 4.47% by weight
L-serine: 8.23% by weight and
[0033] L-tyrosine: 0.78% by weight TABLE-US-00001 TABLE 1 Normal
Control Example 1 Non- Standard Standard chow + treatment chow Gln
(5%) Colon Mean 248.6 612.5 530.5 weight SE 5.2 18.2 14.6 n 8 8 8
Rate of inhibiting 22.5 weight gain of colon (%)
[0034] TABLE-US-00002 TABLE 2 Normal Control Example 2 Example 3
Example 4 Non- Standard Standard chow + Standard chow + Standard
chow + treatment chow Lys(5%) His(5%) Cys(5%) Colon Mean 219.2
556.4 392.8 429.0 414.4 weight SE 8.3 69.3 30.8 41.1 27.4 n 7 7 7 7
7 Rate of inhibiting 48.5 37.8 42.1 weight gain of colon (%)
[0035] TABLE-US-00003 TABLE 3 Normal Control Example 5 Example 6
Example 7 Example 8 non- Standard Standard chow + Standard chow +
Standard chow + Standard chow + treatment chow Gly(5%) Trp(5%)
Met(5%) Cys(5%) Colon Mean 210.1 573.0 437.1 236.7 307.7 375.4
weight SE 6.3 29.0 32.0 22.9 25.3 12.8 n 7 7 7 7 7 7 Rate of
inhibiting 37.4 92.7 73.1 54.4 weight gain of colon (%)
[0036] TABLE-US-00004 TABLE 4 Example 9 Example 10 Example 11
Standard chow + standard chow + Standard chow + Normal Control
Amino acid Amino acid Amino acid Example 12 Example 13 Non-
Standard mixture A mixture A mixture A Standard chow + Standard
chow + treatment chow (10%) (20%) (30%) Phe(5%) Thr(5%) Colon
weight Mean 219.2 556.4 488.6 455.5 383.3 392.8 468.2 SE 8.3 69.3
16.2 22.6 29.2 30.8 13.2 n 1 7 1 1 7 7 7 Rate of 23.4 32.1 51.1
48.5 28.8 inhibiting weight gain of colon (%)
[0037] TABLE-US-00005 TABLE 5 Normal Control Example 14 Example 15
Non- Standard Standard chow + Standard chow + treatment chow
Trp(2%) Trp(5%) Colon Mean 204.8 585.0 425.6 262.1 weight SE 6.0
19.3 29.1 12.1 n 7 7 7 7 Rate of inhibiting 41.9 84.9 weight gain
of colon (%)
[0038] In the above model, cell infiltration occurs with the
colitis. Thus, the degree of the cell infiltration is reflected in
the colon weight and the therapeutic effect on the inflammatory
bowel disease can be evaluated by the colon weight (see Ikenoue Y.
et al., International Immunopharmacology, 5: 993-1006, 2005).
Inhibitory Effect on TNF-.alpha. Production
Extraction of total RNA
[0039] The experimental diet obtained by mixing the amino acids
shown in Table 6 with the standard chow was given to the experiment
mice, and after three weeks, the colon was removed. A colon sample
was homogenized with 500 .mu.L of Isogen (Nippon Gene). The
homogenate mixed with 100 .mu.L of chloroform was centrifuged at
15,000 rpm at 4.degree. C. and an aqueous layer was collected. An
equivalent amount of 2-propanol was added thereto, which was then
centrifuged at 15,000 rpm at 4.degree. C. A resulting pellet was
washed with 70% (v/v) ethanol, dried in air and dissolved in water
treated with DEPC.
Synthesis of cDNA
[0040] All reagents used were from Invitrogen. 0.5 .mu.g Of total
RNA and 0.5 .mu.g of oligo (dT) were dissolved in 12 .mu.L of
DEPC-treated water, heated at 70.degree. C. for 10 minutes, and
cooled on ice for one minute. Subsequently, 4 .mu.L of 5.times.1st
strand buffer, 1 .mu.L of 10 mM dNTP mix and 2 .mu.L of 100 mM DTT
were added thereto. The mixture was reacted at 42.degree. C. for 5
minutes. 1 .mu.L (200 U) of SuperScriptII was added, and the
mixture was reacted at 42.degree. C. for 50 minutes and 70.degree.
C. for 15 minutes.
Quantitative RT-PCR Using SYBR Green
[0041] A gene expression assay based on PCR was performed using
SYBR Green PCR Master Mix (Applied Biosystems) and ABI PRISM 7700
System. SYBR Green PCR Master Mix comprises SYBR Green and heat
resistant DNA polymerase, and detects fluorescence generated by
specifically binding SYBR Green to a double strand DNA amplified by
PCR using ABI PRISM 7700 System. Gene expression amounts of the
samples can be compared by comparing the numbers of PCR cycles at
which a significant fluorescence signal is detected for the first
time. The cDNA corresponding to 10 ng of total RNA was used as a
template of the quantitative PCR, and n=2 or more per sample of
measurements were performed. A forward primer and a reverse primer
at each 7.5 .mu.mol of each gene were added to 7.5 .mu.L of SYBR
Green PCR Master Mix (Applied Biosystems), and the total volume was
made to be 15 .mu.L with water. The PCR was performed by 40 cycles
of the reaction at 95.degree. C. for 10 seconds, 60.degree. C. for
30 seconds and 72.degree. C. for 30 seconds after reacting at
95.degree. C. for 10 minutes. The sequences of the primers used for
the quantitative RT-PCR are as follows. TABLE-US-00006 (SEQ ID
NO:1) Forward primer: CCACCACGCTCTTCTGTCTA (SEQ ID NO:2) Reverse
primer: AGGGTCTGGGCCATAGAACT
[0042] An inhibitory rate of TNF-.alpha. mRNA expression was
calculated from the following formula. Inhibitory rate of
TNF-.alpha.mRNA expression=[1-Relative amount of TNF-.alpha.mRNA
expression in target group-Relative amount of TNF-.alpha.mRNA
expression in cell transfer group)/(Relative amount of
TNF-.alpha.mRNA expression in standard chow group-Relative amount
of TNF-.alpha.mRNA expression in cell transfer
group)].times.100(%)
[0043] Additionally, the amounts of mRNA for Reg3.gamma. and
Gro.alpha. were also similarly measured. The following PCR primers
were used. TABLE-US-00007 (SEQ ID NO:3) Reg3 .gamma. forward
primer: AACAGAGGTGGATGGGAGTG (SEQ ID NO:4) Reg3 .gamma. reverse
primer: GGGTACCACAGTGATTGCCT (SEQ ID NO:5) Gro .alpha. forward
primer: GCTGGGATTCACCTCAAGAA (SEQ ID NO:6) Gro .alpha. reverse
primer: AAGGGAGCTTCAGGGTCAAG
[0044] TABLE-US-00008 TABLE 6 Inhibitory rate of TNF-.alpha. mRNA
expression Amino acid (%) 5% His 54 5% Phe 84 30% Amino acid 49
mixture 2% Trp 33 5% Trp 49
[0045] TABLE-US-00009 TABLE 7 Amino acid Inhibitory rate of
Reg3.gamma. mRNA Expression (%) 5% His 84
[0046] TABLE-US-00010 TABLE 8 Amino acid Inhibitory rate of
Gro.alpha. mRNA Expression (%) 5% His 70
[0047]
Sequence CWU 1
1
6 1 20 DNA Artificial primer 1 ccaccacgct cttctgtcta 20 2 20 DNA
Artificial primer 2 agggtctggg ccatagaact 20 3 20 DNA Artificial
primer 3 aacagaggtg gatgggagtg 20 4 20 DNA Artificial primer 4
gggtaccaca gtgattgcct 20 5 20 DNA Artificial primer 5 gctgggattc
acctcaagaa 20 6 20 DNA Artificial primer 6 aagggagctt cagggtcaag
20
* * * * *