U.S. patent application number 11/809970 was filed with the patent office on 2008-05-08 for mutants of clostridium difficile toxin b and methods of use.
Invention is credited to Jimmy D. Ballard, Lea M. Spyres.
Application Number | 20080107673 11/809970 |
Document ID | / |
Family ID | 32312426 |
Filed Date | 2008-05-08 |
United States Patent
Application |
20080107673 |
Kind Code |
A1 |
Ballard; Jimmy D. ; et
al. |
May 8, 2008 |
Mutants of clostridium difficile toxin B and methods of use
Abstract
An active, or passive vaccine utilizing purified non-toxic
mutant TcdB toxins from Clostridium difficile for humans and
animals against infections caused by C. difficile and/or C.
sordellii. Persons most potentially affected by C. difficile
infections include hospitalized patients, infants, and elderly
persons. The TcdB toxin mutant of the vaccine preferably lacks the
toxicity of a native C. difficile TcdB toxin. A serum comprising
antibodies raised to the TcdB toxin mutant is also available for
treating humans or animals against C. difficile infections. The
serum may be used in a method for conferring passive immunity
against C. difficile. Antibodies to the TcdB toxin mutant may be
used in diagnostic tests or in treatments to clear TcdB toxin from
bodily fluids. The mutant TcdB toxin may be produced by recombinant
methods using cDNA encoding the toxin, the cDNA contained for
example in a plasmid or host cell.
Inventors: |
Ballard; Jimmy D.; (Norman,
OK) ; Spyres; Lea M.; (Smithville, TX) |
Correspondence
Address: |
DUNLAP CODDING & ROGERS, P.C.
PO BOX 16370
OKLAHOMA CITY
OK
73113
US
|
Family ID: |
32312426 |
Appl. No.: |
11/809970 |
Filed: |
June 4, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10463957 |
Jun 17, 2003 |
7226597 |
|
|
11809970 |
|
|
|
|
60389685 |
Jun 17, 2002 |
|
|
|
Current U.S.
Class: |
424/190.1 ;
435/252.3; 435/320.1; 435/331; 435/69.3; 436/501; 436/547; 514/2.4;
514/21.2; 530/350; 530/387.3; 530/387.9; 536/23.7 |
Current CPC
Class: |
A61K 38/00 20130101;
A61P 43/00 20180101; G01N 33/56911 20130101; A61K 39/00 20130101;
C07K 14/33 20130101 |
Class at
Publication: |
424/190.1 ;
530/350; 514/12; 530/387.9; 436/547; 435/331; 530/387.3; 436/501;
536/23.7; 435/320.1; 435/252.3; 435/69.3 |
International
Class: |
A61K 39/08 20060101
A61K039/08; C07K 14/00 20060101 C07K014/00; C07K 16/18 20060101
C07K016/18; C12N 5/06 20060101 C12N005/06; C12N 15/11 20060101
C12N015/11; C12N 1/20 20060101 C12N001/20; A61P 43/00 20060101
A61P043/00; C12P 21/04 20060101 C12P021/04; C12N 15/00 20060101
C12N015/00; G01N 33/00 20060101 G01N033/00; G01N 33/53 20060101
G01N033/53; A61K 38/00 20060101 A61K038/00 |
Claims
1. An isolated mutant of Clostridium difficile TcdB toxin
polypeptide comprising: a modified Clostridium difficile TcdB toxin
having SEQ ID NO: 3, SEQ ID NO: 5, (SEQ ID NO: 7, or SEQ ID NO: 9,
wherein the mutant is effective in inhibiting or modulating the
cytotoxic effect of C difficile TcdB toxin and C sordellii TcsL
toxin.
2. A composition comprising the mutant of claim 1 disposed within a
pharmaceutically-acceptable carrier.
3. A method of inhibiting, modulating or treating a Clostridium
difficile and/or a Clostridium sordellii infection or the symptoms
or toxin thereof in a subject, comprising administering an
effective amount of the mutant composition of claim 1 to the
subject, wherein the mutant is non-cytotoxic.
4. The method of claim 3 wherein the subject is a human.
5. The method of claim 3 wherein the subject is an animal.
6. The method of claim 3 wherein the method comprises administering
at least two mutants.
7. A vaccine composition comprising at least one mutant of claim 1
and a pharmaceutically effective carrier, and wherein the mutant is
non-toxic.
8. The vaccine composition of claim 7 further comprising an
adjuvant.
9. The vaccine composition of claim 7 further comprising mote than
one mutant of claim 1.
10. A vaccine composition comprising the mutant of claim 1 or an
immunogenic fragment thereof which is effective in generating an
antibody which is effective against Clostridium difficile TcdB
toxin.
11. A method of immunizing a human or animal against a Clostridium
difficile infection comprising treating the human or animal with an
immunogenic amount of the vaccine of claim 10.
12. An antibody raised against the mutant of claim 1 wherein the
antibody binds to Clostridium difficile TcdB toxin.
13. The antibody of claim 12 wherein the antibody also binds to
Clostridium sordellii TcsL toxin.
14. A method of making an antibody against Clostridium difficile
TcdB toxin comprising: immunizing an animal with an immunogenic
amount of the mutant of claim 1, wherein the mutant is
non-cytotoxic; and obtaining the antibody from the animal.
15. The method of claim 14 wherein the antibody is also effective
against Clostridium sordellii TcsL toxin.
16. A serum comprising the antibody made by the method of claim
14.
17. A method of making a hybridoma which secretes an antibody
against Clostridium dfficile TcdB toxin, comprising: fusing a
lymphocyte from an animal immunized with a mutant of claim 1 with
cells capable of replicating indefinitely in cell culture to
produce the hybridoma, wherein the mutant is non-cytotoxic; and
isolating the hybridoma.
18. A hybridoma produced by the method of claim 17, which hybridoma
secretes an antibody against Clostridium difficile TcdB toxin.
19. A method of making a monoclonal antibody that recognizes
Clostridium difficile TcdB toxin, comprising isolating the antibody
produced by the hybridoma of claim 18.
20. The method of claim 19 wherein the monoclonal antibody also
recognizes Clostridium sordellii TcsL toxin.
21. The antibody produced by the method of claim 20 wherein the
antibody is humanized.
22. An immunoassay for Clostridium difficile TcdB toxin,
comprising: contacting a sample to be tested for a Clostridium
difficile TcdB toxin or a portion thereof with an antibody of claim
12 to form an antibody-TcdB toxin complex; and detecting the
antibody-TcdB toxin complex to determine the presence or absence of
the Clostridium difficile TcdB toxin in the sample.
23. The immunoassay of claim 22 wherein the immunoassay is also
effective in detecting Clostridium sordellii TcsL toxin.
24. A polynucleotide which encodes the mutant of Clostridium
difficile TcdB toxin polypeptide as defined in claim 1.
25. A vector containing the polynucleotide of claim 24.
26. The vector of claim 25 wherein the polynucleotide is
operatively associated with an expression control sequence.
27. A host cell containing the vector of claim 25.
28. A process for producing a mutant of Clostridium difficile TcdB
toxin polypeptide, comprising: culturing the host cell of claim 27
thereby expressing the mutant, and wherein the mutant is
non-cytotoxic; and purifying the mutant from the cultured host
cell.
29. The mutant of Clostridium difficile TcdB toxin produced by the
process of claim 28.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S. Ser. No.
10/463,957, filed Jun. 17, 2003, now U.S. Pat. No. 7,226,597, which
claims benefit of U.S. Provisional No. 60/389,685, filed Jun. 17,
2002, each of which is explicitly incorporated herein by reference
in its entirety.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] Not Applicable.
BACKGROUND
[0003] Intracellular bacterial toxins enter cells, modify targets,
and in many cases ultimately destroy the targeted cells thereby
contributing to the disease process. Currently, there are no
techniques for blocking intracellular virulence factors once they
have entered the cytosol of cells. Further, no techniques exist
which utilize inactive mutants derived from a toxin in order to
inhibit the wild-type toxin at the intracellular cite.
[0004] Clostridium difficile is the leading cause of hospital
acquired diarrhea and pseudomembranous colitis, a multifactorial
disease involving steps in colonization, adherence, inflammation
and cellular intoxication. TcdA and TcdB are two large clostridial
toxins (LCTs) produced by C. difficile and are involved in
development of pseudomembranous colitis. TcdB, (SEQ ID NO: 1), the
focus of this study, glucosylates isoforms of small GTPases Rho,
Rac and Cdc42 within the effector binding region at residues
Threonine-37 (Rho) or Threonine-35 (Rac and Cdc42). The
physiological impact of TcdB's activity includes disruption of
tight junctions, increased epithelial permeability, as well as
actin condensation and cell death.
[0005] TcdB can be divided into enzymatic, translocation and
receptor binding domains, although detailed analysis of these
regions has not been carried out to date. The first 546 amino acids
of TcdB contain the enzymatic region, which is followed by a
putative translocation and receptor-binding domain. Enzymatic
activity appears to require the amino-terminal 546 residues since
amino or carboxy terminal deletions of this fragment decrease
activity. Within the enzymatic region, tryptophan 102 has been
shown to be essential for UDP-glucose binding. A conserved DXD
motif within LCTs is essential for LCT glucosyltransferase
activity. Other studies, involving analysis of chimeras of the TcdB
and TcsL enzymatic domain suggest residues 364 to 516 confer
substrate specificity.
[0006] Steps in cell entry by TcdB have been broadly defined, yet
events subsequent to entry are not well understood. For example,
while we have a profile of the time-course for TcdB cell entry,
very little is known about post-entry events that lead to
glucosylation. Steps between membrane translocation and substrate
interaction are not understood in TcdB intoxication. In fact almost
no information exists in this regard for any intracellular toxin.
In the cytosol, TcdB is capable of glucosylating multiple
substrates, but whether inactivation of Rho, Rac and Cdc42 in
combination is necessary for complete intoxication, or if other
substrates are targeted, is not known. It has been found that
overexpression of Rho isoforms protects cells from TcdB, suggesting
inactivation of all substrates may not be necessary for cellular
intoxication. Interestingly, Rho has also been shown to regulate
the suppression of apoptosis, so it is not entirely clear whether
overexpression of Rho is protective at the substrate inactivation
level or prevents events downstream of glucosylation. Additionally,
while some TcdB-intoxicating events, such as depolymerization of
actin, can be attributed to inactivation of Rho, other processes
like apoptosis may be linked to activities other than substrate
inactivation. Given TcdB's large size (.about.270 kD), and broad
impact on cell physiology, it is possible the toxin may possess yet
undefined activities in addition to glucosylation.
[0007] It would be desirable to have a vaccine or therapeutic
composition for inhibiting or preventing action of the C difficile
TcdB toxin.
SUMMARY OF THE INVENTION
[0008] The invention herein contemplates, in one embodiment, a
mutant of native C. difficile TcdB toxin polypeptide wherein the
mutant is substituted at position 395, such that the cysteine at
position 395 in the native TcdB toxin has been replaced with
another amino acid, for example, a tryptophan residue and wherein
the mutant is not cytotoxic (non-toxic). The invention further
comprises fragments of the TcdB toxin, which are effective in
inhibiting TcdB toxin or are effective as a vaccine, and are
non-toxic. The invention further contemplates a vaccine generally
applicable to the prevention or treatment of C. difficile disease.
Additionally, the present invention contemplates a method of
inhibiting, modulating, or treating a C. difficile or a C. sordelii
infection in a subject. Further, the present invention contemplates
a monoclonal antibody raised against the C. difficile TcdB toxin
mutant. In addition, the present invention contemplates a method of
making an antibody against C. difficile TcdB toxin comprising
immunizing an animal with an immunogenic amount of the C. difficile
TcdB toxin mutant. These and other embodiments of the invention
will be described further below.
DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1. shows chromatography gels of LFnTcdB deletion and
site-directed mutants. Panel A: Overview of deletion and site
directed mutants. Deletion mutants were generated by PCR, cloned
in-frame with lfn in pET15b, expressed in E. coli BL-21, and
subsequently purified by Ni.sup.2+ affinity chromatography.
Site-directed mutants were generated by the Quick-change method,
using complementary mutation encoding oligonucleotides, and pLMS200
as template. Panel B: DS-PAGE analysis of his-tagged fusions. Lane
1, Molecular Weight Marker; Lane 2, TcdB.sup.W102A; Lane 3,
TcdB.sup.C395W; Lane 4, TcdB.sup.C395S; Lane 5, TcdB.sup.35-556;
Lane 6, TcdB.sup.1-70; Lane 7, TcdB.sup.1-420; Lane 8,
TcdB.sup.1-500; Lane 9, TcdB.sup.1-556; Lane 10, Molecular Weight
Marker.
[0010] FIG. 2. is a gel depicting glucosylation activity of
deletion and site-directed mutants on RhoA, Rac1 and Cdc42. Each
mutant and TcdB was tested for glucosylation activity on
recombinant substrates GST-RhoA, GST-Rac1 and GST-Cdc42, using
[.sup.14C]UDP-Glucose as cosubstrate. Following a 2 h incubation,
the reaction mix was resolved by SDS-PAGE and exposed to film for
48 h. Lane 1, TcdB; Lane 2, TcdB.sup.W102A; Lane 3, TcdB.sup.C395W;
Lane 4, TcdB.sup.C395S; Lane 5, TcdB.sup.1-556; Lane 6,
TcdB.sup.1-500; Lane 7, TcdB.sup.1-420; Lane 8, TcdB.sup.1-170;
Lane 9, TcdB.sup.35-556.
[0011] FIG. 3. shows inhibition of TcdB cytopathic effects by TcdB
mutants. HeLa cells were cotreated with TcdB and each TcdB fusion
plus PA. The cells were followed for 7 h and cytopathic effects
were determined by visualization. Panel I is a micrograph depicting
CHO cells treated with competitive inhibitors; A, PBS alone; B,
TcdB alone; C, PA,LFn plus TcdB; D, PA,TcdB.sup.1-170 plus TcdB; E,
PA,TcdB.sup.1-420 plus TcdB; F, PA,TcdB.sup.1-500 plus TcdB; G,
PA,TcdB.sup.33-556 plus TcdB; H, PA, TcdB.sup.C39W, plus TcdB; I,
PA, TcdB.sup.W102A plus TcdB; Panel II is a summary of inhibitors
capable of blocking TcdB cytopathic effects;
.box-solid.=TcdB.sup.1-420; .quadrature.=TcdB.sup.W102A;
=TcdB.sup.C395W; .box-solid.=TcdB.sup.33-556;=TcdB.sup.1-500.
[0012] FIG. 4. is a graphical representation depicting sustained
inhibition by supplemental treatments with inhibitor. HeLa cells
were cotreated with TcdB and TcdB.sup.1-500 plus PA. During the
course of the assay TcdB.sup.1-500 and PA were added to the cells
at 1 h intervals for 12 h. The cells were then followed for 30 h
and visualized for cytopathic effects. Open circles=TcdB; open
diamonds =PA,TcdB.sup.1-500; closed circles=TcdB.sup.1-500, plus
TcdB.
[0013] FIG. 5. is a graphical representation depicting the
protection of CHO cells expressing TcdB.sup.1-556.
GeneSwitch-CHOpGene/TcdB.sup.1-556 cells were induced with
mifepristone in the presence or absence of TcdB.sup.1-500 plus PA.
Cells were then observed for rounding and cytopathic effects at the
indicated time-points. Open Circles=Uninduced Control; Closed
Circles=Mifepristone-induced, PA,TcdB.sup.1-500; Open
Squares=Mifepristone-induced control.
[0014] FIG. 6. is a chart demonstrating the inhibitory effects
following inhibitor treatments prior to or following treatment with
TcdB. In a 96-well plate, HeLa cells were treated with
TcdB.sup.1-500 plus PA at time points prior to or following
treatment with TcdB. Cells were amended with inhibitor every 30'
and observed for cytopathic effects at 8 h following toxin
treatment.
[0015] FIG. 7. is a graphical representation depicting
TcdB.sup.1-500 inhibition of TcsL cytopathic effects. HeLa cells
were treated with TcdB.sup.1-500 plus PA for 30 min prior to
treatment with TcsL. To enhance TcsL cytopathic activity, cells
were treated with the toxin using an acid pulse where cells were
subjected to TcsL in acid medium (pH 4.0) for 10 min. followed by
replacement with neutral medium (pH 7.4) and TcdB.sup.1-500 plus
PA. The cells were amended with inhibitor every 30' for 12 h, then
followed for 18 h to determine cytopathic effects. Open
circles=TcsL; closed circles=PA,TcdB.sup.1-500 plus TcsL.
[0016] FIG. 8. Differential glucosylation of extracts from cells
treated with TcdB plus inhibitor. HeLa cells were plated in T-25
flasks and grown until semiconfluent, then treated with PA,
TcdB.sup.1-500 and TcdB was added to the cells. Three hours after
TcdB treatment, cell extracts were collected and subjected to a
TcdB glucosylation using [.sup.14C]UDP-Glucose as cosubstrate. The
reactions were subsequently resolved by SDS-PAGE and exposed to
film for 48 h. Lane 1=untreated HeLa cells; Lane 2=TcdB-treated
cells; Lane 3=TcdB plus inhibitor treated cells.
DETAILED DESCRIPTION OF THE INVENTION
[0017] The invention contemplated herein comprises, in a preferred
embodiment, non-cytotoxic C. difficile TcdB toxin derivatives and
deletions (mutants) which are deficient in at least one specific
function required for toxicity and which are effective
intracellular inhibitors of native TcdB toxin or are effective in
producing immunity against TcdB toxin. The present invention
demonstrates that enzymatically inactive fragments of the TcdB
enzymatic domain are effective intracellular inhibitors of native
TcdB. The present invention comprises purified derivatives
(mutants) of C. difficile TcdB toxin which are deficient in
glucosyltransferase and glucosylhydrolase activity. The mutants are
considered to be useful as a vaccine for both humans and
animals.
[0018] Examples of animals which may be treated are cattle,
chickens, turkeys, ostriches, emu, ducks, horses, donkeys, mules,
pigs, sheep, goats antelope, buffalo, llamas, cats, lions, tigers,
dogs, bears, guinea pigs, hamsters, chinchillas, mink, ferrets,
rodents, parrots, parakeets, peacocks, seals, sea lions, orcas,
monkeys, chimpanzees, baboons, orangutans, gorillas, reptiles, and
other zoo and livestock animals.
[0019] The term "mutant", where used herein, refers to a fragment,
point deletion, point substitution, or a deletion of multiple
residues of the TcdB protein sequence, and may be encoded by a
nucleotide sequence intentionally made variant from a native
sequence. The present invention also contemplates nucleotide
sequences which encode the mutants.
[0020] The mutants of the present invention preferably have at
least one substituted amino acid in the enzymatic domain of the
TcdB toxin which includes amino acid position 395 of the sequence
of the native TcdB toxin as shown in SEQ ID NO: 1.
[0021] As noted above, the novel mutants contemplated herein
comprise at least one amino acid substitution or deletion of the
native C. difficile TcdB toxin. For example, the amino acid at
position 395 (also referred to herein as the "critical position")
of the amino acid sequence of the native C. difficile TcdB toxin
(SEQ ID NO: 1) may be substituted with a different amino acid in
the same position.
[0022] In particular, the invention comprises mutants wherein the
native cysteine at position 395 has been substituted with a
tryptophan residue at position 395. However, any amino acid residue
which would provide a mutant effective in inhibiting TcdB toxin,
and which is not cytotoxic, may be substituted for the cysteine
residue at position 395. Examples of other amino acids which may be
used to substitute the cysteine residue include alanine, valine,
leucine, isoleucine, proline, methionine, phenylalanine, glycine,
threonine, tyrosine, asparagine, aspartic acid, glutamine, glutamic
acid, lysine, arginine, and histidine. Mutants which are cytotoxic,
e.g., a serine-substitute, also comprise the invention,
particularly when they are used in a diagnostic assay as described
below. Mutants comprising deletions of portions of the enzymatic
domain include, for example, a modified C. difficile TcdB toxin
having a deletion of amino acid positions 501-556 (SEQ ID NO: 3),
421-556 (SEQ ID NO: 5), 171-556 (SEQ ID NO: 7), or 1-34 (SEQ ID NO:
9) are also contemplated. An especially preferred embodiment
comprises a mutant having at least one substitution in the
enzymatic domain. The mutants of the present invention preferably
have deficient glucosyltransferase and glucosylhydrolase activity
compared to the native C. difficile TcdB toxin, and are non-toxic,
and in an especially preferred embodiment are antigenic, whereby
vaccines produced from them induce anti-TcdB toxin antibodies in
vivo as explained in more detail below.
[0023] As noted above, it is an object of the present invention to
provide novel vaccines comprising the TcdB toxin mutants described
herein, or antigenic fragments thereof, which when administered to
animals or humans, are capable of inducing production of protective
antibodies directed against C. difficile TcdB toxin, thereby
providing prophylaxis against infection by C. difficile disease
states resulting from such infection, and/or from the TcdB toxin
itself. It is a particular aim of the present invention to provide
such a vaccine that is relatively safe and simple to produce.
Antibodies and antisera raised against the mutants are also capable
of use in therapy for at least some, if not all, disease states, in
which TcdB toxin is involved.
[0024] In further aspects of the present invention there is
provided recombinant DNA which encode any proteins, fragments, or
amino acid sequences thereof described or claimed herein. Such
recombinant DNA is conveniently provided by PCR amplification of
the DNA encoding for the desired sequence, using primers targeted
at respective ends of the double stranded sequence of which it
forms one half, using methods well known to those of ordinary skill
in the art.
[0025] In a further aspect of the present invention there are
provided antisera raised to the mutants, or antigenic fragments
thereof, of the invention and antibodies derived therefrom.
Furthermore, the present invention provides monoclonal antibodies
against the mutants, or antigenic fragments thereof, of the
invention and hybridoma cells for production thereof as described
in more detail below.
[0026] The present invention further contemplates TcdB toxin
mutants which have additional substitutions which are merely
conservative substitutions of amino acids. By "conservative
substitution" is meant the substitution of an amino acid by another
one of the same class; the classes according to Table I.
TABLE-US-00001 TABLE I Table I. Classes of amino acids suitable for
conservative substitution. CLASS AMINO ACID Nonpolar: Ala, Val,
Leu, Ile, Pro, Met, Phe, Trp Uncharged polar: Gly, Ser, Thr, Cys,
Tyr, Asn, Gln Acidic: Asp, Glu Basic: Lys, Arg, His
[0027] As is well known to those skilled in the art, altering any
given non-critical amino acid of a protein by conservative
substitution may not significantly alter the activity of that
protein because the side-chain of the amino acid which is inserted
into the sequence may be able to form similar bonds and contacts as
the side chain of the amino acid which has been substituted
for.
[0028] Non-conservative substitutions (outside the classes of Table
I) are possible provided that these do not excessively affect the
immunogenicity of the polypeptide and/or reduce its effectiveness
in inhibiting TcdB toxin.
[0029] The polypeptides of the invention may be prepared
synthetically, or more suitable, they are obtained using
recombinant DNA technology. Thus, the invention further provides a
nucleic acid which encodes any of the mutants of TcdB toxin which
have at least one substitution and/or deletion as described
herein.
[0030] Such nucleic acids may be incorporated into an expression
vector, such as a plasmid, under the control of a promoter as
understood in the art. The vector may include other structures as
conventional in the art, such as signal sequences, leader sequences
and enhancers, and can be used to transform a host cell, for
example a prokaryotic cell such as E coli or a eukaryotic cell.
Transformed cells can then be cultured and polypeptide of the
invention recovered therefrom, either from the cells or from the
culture medium, depending upon whether the desired product is
secreted from the cell or not.
[0031] As used herein, the terms "complementary" or
"complementarity" are used in reference to polynucleotides (i.e., a
sequence of nucleotides) related by the base-pairing rules. For
example, for the sequence "A-G-T," is complementary to the sequence
"T-C-A." Complementary may be "partial," in which only some of the
nucleic acids' bases are matched according to the base pairing
rules. Or, there may be "complete" or "total" complementary between
the nucleic acids. The degree of complementary between nucleic acid
strands has significant effects on the efficiency and strength of
hybridization between nucleic acid strands. This is of particular
importance in amplification reactions, as well as detection methods
which depend upon binding between nucleic acids.
[0032] Nucleic acids of the present invention also include DNA
sequences which hybridize to the DNA sequences which encode the
mutant polypeptides described herein, or their complementary
sequences, under conditions of high or low stringency and which
encode proteins having activity against TcdB toxin and/or which
preferably can stimulate antibodies against native TcdB toxin.
[0033] Hybridization and washing conditions are well known and
exemplified in Sambrook, J., Fritsch, E. F. and Maniatis, T.
Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor (1989), particularly
Chapter 11 and Table 11.1 therein (expressly entirely incorporated
herein by reference). The conditions of temperature and ionic
strength determine the "stringency" of the hybridization.
[0034] In one embodiment, high stringency conditions are
prehybridization and hybridization at 68.degree. C., washing twice
with 0.1.times.SSC, 0.1% SDS for 20 minutes at 22.degree. C. and
twice with 0.1.times.SSC, 0.1% SDS for 20 minutes at 50.degree. C.
Hybridization is preferably overnight.
[0035] In one example, low stringency conditions comprise
conditions equivalent to binding or hybridization at 42.degree. C.
in a solution consisting of 5.times.SSPE (43.8 g/l NaCl, 6.9 g/l
NaH.sub.2PO.sub.4.H.sub.2O and 1.85 g/l EDTA, pH adjusted to 7.4
with NaOH), 0.1% SDS, 5.times.Denhardt's reagent
[50.times.Denhardt's contains per 500 ml: 5 g Ficoll (Type 400,
Pharmacia), 5 g BSA (Fraction V; sigma) and 100 .mu.g/ml denatured
salmon sperm DNA] followed by washing in a solution comprising 5x
SSPE, 0.1% SDS at 42.degree. C. when a probe of about 500
nucleotides in length is employed.
[0036] In another embodiment, low stringency conditions are
prehybridization and hybridization at 68.degree. C., washing twice
with 2.times.SSC, 0.1% SDS for 5 minutes at 22.degree. C., and
twice with 0.2.times.SSC, 0.1% SDS for 5 minutes at 22.degree. C.
Hybridization is preferably overnight.
[0037] In an alternative embodiment, very low to very high
stringency conditions are defined as prehybridization and
hybridization at 42.degree. C. in 5.times.SSPE, 0.3% SDS, 200 ug/ml
sheared and denatured salmon sperm DNA, and either 25% formamide
for very low and low stringencies, 35% formamide for medium and
medium-high stringencies, or 50% formamide for high and very high
stringencies, following standard Souther blotting procedures.
[0038] The carrier material is then washed three times each for 15
minutes using 2.times.SSC, 0.2% SDS preferably at least 45.degree.
C. (very low stringency), more preferably at least at 50.degree. C.
(low stringency), more preferably at least at 55.degree. C. (medium
stringency), more preferably at least at 60.degree. C. (medium-high
stringency), even more preferably at least at 65.degree. C. (high
stringency), and most preferably at least at 70.degree. C. (very
high stringency).
[0039] It is well known in the art that numerous equivalent
conditions may be employed to comprise low stringency conditions;
factors such as the length and nature (e.g., DNA, RNA, base
composition) of the probe and nature of the target (e.g., DNA, RNA,
base composition, present in solution or immobilized, etc.) And the
concentration of the salts and other components (e.g., the presence
or absence of formamide, dextran sulfate, polyethylene glycol) are
considered and the hybridization solution may be varied to generate
conditions of low stringency hybridization different form, but
equivalent to, the above listed conditions. In addition, conditions
which promote hybridization under conditions of high stringency
(e.g., increasing the temperature of the hybridization and/or wash
steps, the use of formamide in the hybridization solution, etc.)
are also know in the art.
[0040] When used in reference to a double-stranded nucleic acid
sequence such as a cDNA or genomic clone, the term "substantially
homologous" refers to any probe which can hybridize to either or
both strands of the double-stranded nucleic acid sequence under
conditions of low stringency as described above.
[0041] When used in reference to a single-stranded nucleic acid
sequence, the term "substantially homologous" refers to any probe
which can hybridize (i.e., it is the complement of) the
single-stranded nucleic acid sequence under conditions of low
stringency as described above.
[0042] As used herein, the term "hybridization" is used in
reference to the pairing of complementary nucleic acids.
Hybridization and the strength of hybridization (e.e., the strength
of the association between the nucleic acids) is impacted by such
factors as the degree of complementary between the nucleic acids,
stringency of the conditions involved, the Tm (melting temperature)
of the formed hybrid, and the G:C ration within the nucleic acids.
As used herein the term "stringency" is used in reference to the
conditions of temperature, ionic strength, and the presence of
other compounds such as organic solvents, under which nucleic acid
hybridizations are conducted.
[0043] As used herein, the terms "cell," "cell line," and "cell
culture" are used interchangeably and all such designations include
progeny. The words "transformants" or "transformed cells" include
the primary transformed cell and cultures derived from that cell
without regard to the number of transfers. All progeny may not be
precisely identical in DNA content, due to deliberate or
inadvertent mutations. Mutant progeny that have the same
functionality as screened for in the originally transformed cell
are included in the definition of transformants.
[0044] As used herein, the term "vector" is used in reference to
nucleic acid molecules that transfer DNA segment(s) from one cell
to another. The term "vehicle" is sometimes used interchangeably
with "vector".
[0045] The terms "recombinant DNA vector" as used herein refers to
DNA sequences containing a desired coding sequence and appropriate
DNA sequences necessary for the expression of the operably linked
coding sequence in a particular host organism. DNA sequences
necessary for expression in prokaryotes include a promoter,
optionally and operator sequence, a ribosome binding site and
possibly other sequences. Eukaryotic cells are known to utilize
promoters, polyadenylation signals and enhancers. It is not
intended that the term be limited to any particular type of vector.
Rather, it is intended that the term encompass vectors that remain
autonomous within host cells (e.g., plasmids), as well as vectors
that result in the integration of foreign (e.g., recombinant
nucleic acid sequences) into the genome of the host cell.
[0046] The term "expression vector" and "recombinant expression
vector" as used herein refers to a recombinant DNA molecule
containing a desired coding sequence and appropriate nucleic acid
sequences necessary for the expression of the operably linked
coding sequence in a particular host organism. Nucleic acid
sequences necessary for expression in prokaryotes usually include a
promoter, an operator (optional), and a ribosome binding site,
often along with other sequences. Eukaryotic cells are known to
utilize promoters, enhancers, and termination and polyadenylation
signals. It is contemplated that the present invention encompasses
expression vectors that are integrated into host cell genomes, as
well as vectors that remain unintegrated into the host genome.
[0047] The terms "in operable combination," "in operable order,"
and "operably linked," as used herein refer to the linkage of
nucleic acid sequences in such a manner that a nucleic acid
molecule capable of directing the transcription of a given gene
and/or the synthesis of a desired protein molecule is produced. The
term also refers to the linkage of amino acid sequences in such a
manner so that a functional protein is produced.
[0048] The mutants described herein may be expressed in either
prokaryotic or eukaryotic host cells. Nucleic acids encoding the
mutants may be introduced into bacterial host cells by a number of
means including transformation or transfection of bacterial cells
made competent for transformation by treatment with calcium
chloride or by electroporation. If the mutants are to be expressed
in eukaryotic host cells, nucleic acid encoding the protein or
toxin of interest may be introduced into eukaryotic host cells by a
number of means including calcium phosphate co-precipitation,
spheroplast fusion, electroporation, microinjection, lipofection,
protoplast fusion, and retroviral infection, for example. When the
eukaryotic host cell is a yeast cell, transformation may be
affected by treatment of the host cells with lithium acetate or by
electroporation, for example.
[0049] In a preferred version of the invention, the mutant is
characterized as having 50% or less of the glucosyltransferase and
glucoslyhydrolase activity of wild type TcdB toxin, as measured by
assays described herein. In a more preferred version of the
invention, the mutant is characterized as having 30% or less of the
glucosyltransferase and glucosylhydrolase activity of wild type
TcdB toxin, as measured by assays described herein. In a more
preferred version of the invention, the mutant has less than 20% of
the glucosyltransferase and glucosylhydrolase activity of wild type
TcdB toxin as measured by assays described herein. In a more
preferred version of the invention, the mutant has less than 10% of
the glucoslytransferase and glucosylhydrolase activity of wild-type
TcdB toxin, as measured by assays described herein. More
preferably, the mutant has less than 5% of the glucosyltransferase
and glucosylhydrolase activity of the wild-type TcdB toxin, as
measured by assays described herein. Even more preferably, the
mutant has less than 0% of the glucosyltransferase and
glucosylhydrolase activity of wild-type TcdB toxin, as measured by
assays described herein. More particularly, the invention as
contemplated herein is a mutant (mutein) of C. difficile TcdB toxin
polypeptide which comprises: (a) a polypeptide having a
substitution at position 395 of the amino acid sequence of native
C. difficile TcdB toxin, wherein the cysteine at position 395 has
been replaced with tryptophan (SEQ ID NO: 11) or with another amino
acid; or (b) a modified C. difficile TcdB toxin having a deletion
of amino acid positions 501-556 (SEQ ID NO: 3), 421-556 (SEQ ID NO:
5), 171-556 (SEQ ID NO: 7), or 1-34 (SEQ ID NO: 9), and wherein the
mutant of (a) or (b) is effective in inhibiting or modulating the
cytotoxic effect of C. difficile TcdB toxin or is effective as a
vaccine against C. difficile and wherein the mutant is not
cytotoxic.
[0050] While the invention will now be described in connection with
certain preferred embodiments in the following examples so that
aspects thereof may be more fully understood and appreciated, it is
not intended to limit the invention to these particular
embodiments. On the contrary, it is intended to cover all
alternatives, modifications and equivalents as may be included
within the scope of the invention as defined by the appended
claims. Thus, the following examples, which include preferred
embodiments will serve to illustrate the practice of this
invention, it being understood that the particulars shown are by
way of example and for purposes of illustrative discussion of
preferred embodiments of the present invention only and are
presented in the cause of providing what is believed to be the most
useful and readily understood description of formulation procedures
as well as of the principles and conceptual aspects of the
invention.
EXAMPLES
[0051] During analysis of the TcdB enzymatic domain a set of
mutants were identifiable which were unable to modify substrate,
yet were capable of blocking TcdB cytopathic effects. Herein are
described generation and analyses of these mutants and the
demonstration that these proteins are potent intracellular
inhibitors of TcdB and block glucosylation of a previously
undescribed target. These mutants show, for the first time, that a
toxin derivative can be used to effectively block the activity of
the native toxin within the cell. This inhibitory activity also
suggests a new paradigm for a therapeutic approach to treat
toxin-based diseases.
Enzymatic and Cytopathic Activity of Mutants
[0052] As summarized in FIG. 1, 4 deletion and 3 site-directed
mutants in the TcdB enzymatic domain were constructed, cloned and
isolated from E. coli. The nomenclature for each of these mutants
is summarized in panel A of FIG. 1. One site-directed mutant,
TcdB.sup.W102A wherein the tryptophan at position 102 is
substituted with alanine has been previously characterized and
served as a control in cytotoxicity and enzymatic assays [Busch,
2000]. Experiments conducted in the present work suggested
TcdB.sup.1-556 (SEQ ID NO: 1) could be inactivated by
n-ethylmaleimide (data not shown), indicating a role for the sole
cysteine (position 395) in enzymatic activity, thus site-directed
mutants TcdB.sup.C395S, TcdB.sup.C395W were produced.
Amino-terminal and carboxy-terminal deletions were also generated
in an attempt to further identify inactive mutants. Since these
mutants lacked receptor binding and translocation domains, the
fragments were fused to the cell entry proteins of anthrax lethal
toxin. This anthrax toxin derivative consists of anthrax protective
antigen (PA), and a truncated form of anthrax lethal toxin (LFn),
to which heterologous fusions are made. PA-LFn has been used by
several groups for the cytosolic delivery of a variety of proteins,
and we previously used this system to deliver TcdB.sup.1-556 to
cultured mammalian cells [Spyres, 2001]. Using this delivery
system, the fusions were tested for cytopathic activity and only
TcdB.sup.1-556 and TcdB.sup.C395S were cytotoxic (data not
shown).
[0053] To determine if lack of cytotoxicity was due to attenuation
of enzymatic activity, mutants were tested for glucosylation of
RhoA, Rac1 or Cdc42. As shown in FIG. 2, only TcdB.sup.1-556, and
TcdB.sup.C395S glucosylated substrate. In line with earlier reports
carboxy-terminal deletions and TcdB.sup.W102A were unable to
glucosylate substrate. The remainder of the site-directed and
deletion mutants were also deficient in glucosylation. Furthermore,
this loss of activity was maintained across all of the shared
substrates since these same mutants were attenuated in
glucosylation of RhoA, Rac1 and Cdc42.
[0054] Each mutant was also analyzed for glucosylhydrolase activity
using radiolabeled UDP-glucose in the absence of substrate. Fusions
were incubated with [.sup.14C]UDP-glucose and the liberated sugar
was separated by anion-exchange chromatography. As shown in Table
1, even with extended (16 h) incubation glucosylhydrolase activity
was significantly reduced for all enzymatically inactive mutants.
Without wishing to be constrained by theory, the absence of
substrate modification by these mutants could be accounted for, at
least in part, by defective hydrolase activity.
TcdB Mutants as Inhibitors of Native Toxin
[0055] Since the inactive mutants could be effectively delivered to
the cytosol of cells via the PA, LFn system, we were presented with
the unique opportunity to examine the effects these mutants might
have when administered in combination with wild-type TcdB. Thus,
HeLa cells were treated with TcdB in the presence or absence of PA
plus each attenuated mutant. As shown in FIG. 3(I), PA-delivered
TcdB.sup.1-500, TcdB.sup.1-420, TcdB.sup.W102A, TcdB.sup.C395W, or
TcdB.sup.35-556, attenuated TcdB cytopathic effects suggesting the
mutants had an antagonistic impact on TcdB intoxication. The
inhibitor effects were dependent on the presence of inactive
enzymatic domain mutants since PA-LFn alone did not inhibit
TcdB.
[0056] It was clear from the results in FIG. 3(II), that
approximately 7 h after delivery of inhibitory fragments to the
TcdB treated cells that the protective effect began to decrease.
This observation suggested that the inhibitory effect of the
enzymatically inactive mutants has a limited lifetime. To address
this possibility, the initial competition was set-up as before and
the inhibitor (TcdB.sup.1-500) was added to the cells at 1 h time
intervals during the course of the assay. As shown in FIG. 4, using
this approach greater than 50% of the cells demonstrated no
cytopathic effects and appeared to be protected from the wild-type
toxin during the course of the assay (>30 h). Hence, continued
administration maintained the protective effect against TcdB.
Continued addition of the inhibitor after 12 h, did not improve or
change the inhibition of TcdB, suggesting TcdB had lost activity or
that the accumulated inhibitor was in sufficient excess so that its
protective effect was extended.
Inactive Mutants Protect CHO Cells Expressing TcdB.sup.1-556
[0057] The fact that the TcdB inhibitors lack native translocation
and receptor binding domains suggested that inhibition occurred
within the cytosol. However, inhibition at the cell surface could
not be formally excluded since cell surfacing-interacting regions
of TcdB have not been fully elucidated. To determine if inhibition
of TcdB was occurring within the cytosol, a CHO cell line capable
of inducible expression of TcdB.sup.1-556 was generated. A tightly
regulated expression system, pSwitch, was selected which allows
expression only in the presence of the hormone mifepristone.
GeneSwitch-CHOpGene/TcdB.sup.1-556 cells showed early toxic
effects, such as rounding, at around 4 h following addition of
mifepristone and were no longer viable by 24 h. To test the
inhibitor on these cells, mifepristone was added to the cells and
inhibitor was added 2 h later and subsequently added every 30 min
for an additional 3 h. As shown in FIG. 5, mifepristone treated
GeneSwitch-CHOpGene/TcdB.sup.1-556 cells were protected from the
effects of TcdB.sup.1-556 when the inhibitor was added at 2 h
following induction. The inhibitor clearly slows the cytopathic
activity of these cells following induction. Cells eventually show
cytopathic effects similar to that control since the cell continues
to express TcdB.sup.1-556. These results demonstrate that the
inhibitor is capable of blocking TcdB intoxication at a site within
the cell.
TcdB-Inhibitors as Tools to Dissect the Time-Course of
Posttranslocation Events
[0058] In earlier studies we reported on the time-course of entry
by TcdB, based on results from lysosomotropic inhibitor assays
[Qa'Dan, 2000]. The inhibitors now provided a reagent to determine
the time-course of events occurring after translocation into the
cytosol. At a given time-point, if intoxication events have been
initiated, then addition of the inhibitor should no longer have an
effect. In this experiment cells were pretreated with the inhibitor
or treated with the inhibitor at time-points following TcdB
treatment. As shown in FIG. 6, protection occurs in cells when the
inhibitor is added as early as 40 min before treatment with TcdB.
Protection also occurs when the inhibitor is added up 40 min after
treatment with TcdB. Only when the inhibitor is added over 40 min
prior to treatment with TcdB or over 40 min after treatment with
TcdB is there a noticeable cytopathic effect. Given that cell entry
takes approximately 20 min, these results suggested intoxication
events require at least a 40 min time period after translocation to
initiate cytotoxic effects.
Inhibition of Intoxication by C. sordellii Lethal Toxin (TcsL)
[0059] A variety of events, including substrate related and
substrate unrelated, could occur during the 40 min
posttranslocation time-period. If the inhibitor blocked processes
unrelated to substrate interaction, we suspected the mutant might
block another highly related LCT, which does not share similar
substrate targets with TcdB. An ideal candidate for this experiment
was TcsL, which is closely related to TcdB, yet modifies a
different set of Ras proteins including Ras, and Ra1. TcsL does
share Rac as a common substrate with TcdB. We tested the TcdB
inhibitor's ability to block TcsL intoxicaion. In recent work we
reported that acid pH enhances TcsL entry [Qa'Dan, 2001], so the
initial treatment with TcsL was carried out by providing an
extracellular acid pulse to TcsL. In this assay cells were
pretreated with the inhibitor, then acid-pulse treated with TcsL,
and subsequently treated with additional inhibitor during the
time-course of the assay. As can be seen in FIG. 7, TcdB.sup.1-500
was also able to block the activity of TcsL. Similar to results
with TcdB, the inhibitor was capable of reducing TcsL's cytopathic
effects by almost 50%. These results suggested the TcdB inhibitor
was blocking LCT intoxication events that might not be related to
substrate targeting or that blocking a single target was sufficient
to prevent toxic effects.
Effects of Inhibitor on Substrate Glucosylation in Cultured
Cells
[0060] The results from the TcsL inhibition assay suggested the
inhibitor prevented toxin-specific activities that might not be
related to targeting Rho, Rac and Cdc42. For this reason it was
important to determine if the inhibitor prevented glucosylation of
these substrates during TcdB intoxication. Thus, a set of
differential glucosylation reactions were carried out that involved
examining extracts from cells treated with TcdB, or treated with
TcdB plus the inhibitor, for a decrease in substrate that could be
glucosylated. As shown in FIG. 8 using a minimal intoxicating dose
of TcdB, cells showed a relatively equal amount of Rho substrate
that could be glucosylated from both TcdB-treated and
TcdB-plus-inhibitor treated cells. While there did not appear to be
a difference in targeting of Rho, Rac or Cdc42 there was a change
in the ability to glucosylate a second protein that migrated at a
size larger than the Rho proteins. The larger protein was below the
level of detection in extracts from TcdB treated cells yet this
protein was glucosylated in extracts from cells treated with TcdB
plus the inhibitor. These results further suggest the inhibitor
prevents an LCT activity other than glucosylation of Rho, Rac and
Cdc42.
[0061] Attenuated mutants of TcdB inhibit wild-type toxin at an
intracellular site. To our knowledge this is the first example of
an approach that blocks the activity of an intracellular bacterial
toxin within the cytosol of intoxicated cells. This inhibitory
effect also suggests some yet undefined aspects of TcdB. Clearly,
while unable to modify substrate, the mutants carry out functions
within the cytosol, which allow inhibition. The exact mode of
inhibition is not clear; however, the preliminary evidence
indicates the inhibitor prevents glucosylation of a substrate other
than Rho, Rac or Cdc42. This is a feasible possibility since some
of the inhibitors do not encompass the region of TcdB reported to
interact with Rho, Rac and Cdc42. Work by Hofmann et al. [Hofmann,
1998] using chimeric derivatives between the enzymatic domains of
TcsL and TcdB, suggested residues 365-516 conferred substrate
specificity. Our deletion analysis shows residues 1-420 are able to
inhibit TcdB intoxication, while the 1-170 deletion has no
inhibitory effect. Finally, the mutants also inhibit TcsL, which
shares only one substrate, Rac, with TcdB. If inhibition were due
to Rho, Rac and Cdc42 interaction then the inhibitor should be less
effective on TcsL, but it is not. The amino terminal domains of
these two proteins are homologous (78% homology) and could share
activities, and yet undefined common substrates.
Experimental Procedures
Tissue Culture, Bacterial Strains and Chemical Reagents
[0062] Human cervical adenocarcinoma cells American Type Culture
Collection (ATCC) Manassas, Va CCL-2 (HeLa) were grown in
supplemented RPMI 1640 (RP-10) [Starnbach, 1994] with 10% fetal
bovine serum at 37.degree. C. in a humid atmosphere with 7%
CO.sub.2. Clostridium difficile strain VPI 10463, and Clostridium
sordellii strain 9714 were obtained from ATCC and used as a source
of culture supernatant, genomic DNA, TcdB and TcsL. All reagents
were of molecular biology grade and were purchased from Sigma
Chemical Co., St. Louis, Mo. unless otherwise noted.
Construction of Recombinant LFn-TcdB Fusions
[0063] The region encoding for the enzymatic domain of TcdB i.e.,
TcdB nucleotides 1-1668 (SEQ ID NO:2)) was genetically fused to
lfn, cloned expressed and purified in E. coli as previously
described [Spyres, 2001]. Using a similar approach, four other
fusions of LFnTcdB were also constructed. Briefly, fragments
encoding regions TcdB.sup.1-500(SEQ ID NO: 3 encoded by nucleotides
1-1500 (SEQ ID NO: 4)), TcdB.sup.1-420 (SEQ ID NO: 5 encoded by
nucleotides 1-1260 (SEQ ID NO: 6)), TcdB.sup.1-170 (SEQ ID NO: 7
encoded by nucleotides 1-510 (SEQ ID NO: 8)), and TcDB.sup.35-556
(SEQ IDNO: 9 encoded by nucleotides 103-1668 (SEQ ID NO: 10)), were
PCR amplified and cloned into the BamHI site of pABII [Spyres,
2001] to make the plasmids pLMS201, pLMS202, pLMS204, and pLMS301
respectively. Plasmids were transformed into E. coli XL1-blue
(Stratagene) and candidate clones were sequenced, then transformed
into E. coli BL-21 Star (Invitrogen) for expression.
[0064] Site-directed mutants were generated using Pfu Turbo DNA
polymerase and the QuickChange mutagenesis approach (Stratagene).
Oligonucleotides for generation of TcdB1-556.sup.C395S (SEQ ID NO:
11, where Xaa at position 395 is serine) were
GTTTACTATTAAATTGCTAGAATATGAGTCTTTCACAG (sense) (SEQ ID NO: 13),
CTGTGAAGACTCATATTCTAGCAATTTAATAGTAAAAC (antisense) (SEQ ID NO: 14);
TcdB1-556.sup.C395W (SEQ ID NO: 11, where Xaa at position 395 is
tryptophan) GTTTTACTATTAAATTGCTACCTATGAGTCTTTCACAG (sense) (SEQ ID
NO: 15), CTGTGAAAGACTCATATTGGAGCAATTTAATAGTAAAAC (antisense) (SEQ
ID NO: 16); TcdB1-556.sup.W102A (SEQ ID NO: 12)
AAAAATTTACATTTTGTTGCTATTGGAGGTCAA (sense) (SEQ ID NO: 17),
TTGACCTCCAATAGCAACAAAATGTAAATTTTT (antisense) (SEQ ID NO: 18).
Mutants were selected in E. coli XL1-blue and confirmed by
sequencing, followed by transformation into E. coli BL-21 Star for
expression.
Purification of Recombinant Proteins and TcdB
[0065] Expression of LFnTcdB fusions was induced with 0.2 mM
iso-propyl-.beta.-D-thiogalactopyranoside in log phase (OD.sub.600
0.8) cultures at 16.degree. C. Cells were harvested by
centrifugation at 8700.times.g, resuspended in binding buffer (5 mM
imidazole, 500 mM NaCl, 20 mM Tris-HCl, pH7.9) supplemented with a
protease inhibitor cocktail containing
4-(2-aminoethyl)benzenesulfonyl fluoride, phosphoramidon, pepstatin
A, bestatin, and E-64 and lysed by sonication. LFnTcdB fusion
proteins were isolated using nickel 900 cartridges following the
manufacturer's instructions (Novagen). As a second purification
step, proteins were fractionated on a high-resolution anion
exchange (mono-Q) column (Amersham Pharmacia). Recombinant PA was
isolated from E. coli BL-21, harboring the plasmid, pSRB/ET-15b-PA
(a generous gift from Steven Blanke), as previously described
[Whilhite, 1998]. TcdB and TcsL were purified as previously
described [Qa'Dan, 2000]. Recombinant clones of RhoA, Rac1, and
Cdc42 (a generous gift of Alan Hall) were expressed and purified as
previously described [Spyres, 2001].
Glucosylhydrolase/Glucosylation Assays
[0066] Glucosylation reactions were carried out as previously
described [Spyres, 2001]. Glucosylhydrolase assays were carried out
in a reaction mix containing 50 mM
n-2hydroxyethylpiperazine-N'-2-ethane sulfonic acid, 100 mM KCl, 1
mM MnCl.sub.2, 1 mM MgCl.sub.2, 100 .mu.g/ml BSA, 0.2 mM GDP, 40
.mu.M [.sup.14C]UDP-glucose (303Ci/mol; ICN Pharmaceuticals), 100
.mu.M UDP-glucose and 3 pmol of TcdB or 10 pmol of each fusion
protein. The assay was allowed to incubated overnight at 37.degree.
C. and similar to a previously described protocol [Ciesla, 1998],
the cleaved glucose was separated using AG1-X2 anion exchange resin
and counted in a liquid scintillation counter.
Assay for Cytopathic Effects and Inhibitor Assays
[0067] To determine the cytopathic activity of each fusion and
site-directed mutant, HeLa cells were plated in 96 well microtiter
plates (3.times.10.sup.4 cells/well) and allowed to incubate
overnight. The following day the cells were treated with 30 pmol of
each fusion plus 8.5 pmol of PA and observed for 48 h for signs of
cytopathic effects. For inhibition assays, HeLa cells were plated
as before and treated with 4 pmol of the appropriate LFnTcdB fusion
plus 8.5 pmol of PA in a final volume of 100 .mu.l. At the same
point the cells were cotreated with 80 fmol of TcdB and observed
for cytopathic effects. In a second competition assay, 30 pmol of
TcdB.sup.1-500 plus 8.5 pmol of PA were added to cells in a final
volume of 100 .mu.l and allowed to incubate 30 min, at which point
20 fmol of TcdB was added to the cells. Following the initial
treatment, 30 pmol of TcdB.sup.1-500 and 8.5 pmol of PA were added
every 30 min for the first 90 min and every hour thereafter up to
12 h. The cells were observed for cytopathic effects for an
additional 18 h. Similar competition assays were carried out using
2 pmol of TcsL. For inhibition assays with TcsL, cells were
subjected to a brief acid-pulse, which enhances cytotoxic activity
for this toxin. For TcsL competition, cells were pretreated with
TcdB.sup.1-500 and PA for 30 min at which point cells were treated
with TcsL via an acid pulse as previously described [Qa'Dan, 2001].
The cells were then amended with 30 pmol of TcdB.sup.1-500, 8.5
pmol of PA every 30 min up to 12 h and followed for 16 h. For
differential glucosylation assays, HeLa cells semi-confluent
(1.times.10.sup.6) were first treated with 325 pmol of PA and 300
pmol of TcdB.sup.1-500 followed by treatment with 50 fmol of TcdB
in a final volume of 10 ml. Following 3 h of treatment cells were
washed 3 times in ice-cold PBS, scraped and extracts were prepared
as previously described [Spyres, 2001]. Using each extract as
target substrate, glucosylation reactions were identical to those
previously described with changes only to reaction volume (30
.mu.l) and amount of substrate (80 .mu.g).
Generation of TcdB-Expressing CHO Cells
[0068] A DNA sequence coding for the enzymatic domain of TcdB
(amino acids 1 to 556) placed downstream and in-frame with a Kozak
sequence (GNNATGG) was cloned between the HindIII and EcoRI sites
of plasmid pGene/V5-His version B (Invitrogen) multiple cloning
site. The recombinant plasmid was linearized with SapI and
introduced into GeneSwitch-CHO cells (Invitrogen) by lipofection
according to the protocol supplied with the LipofectAMINE PLUS
Reagent Kit (Gibco Life Technologies). Stably transfected cells
were selected for on selective growth medium consisting of complete
F-12 (HAM) medium plus zeocin (300 .mu.g/ml) and hygromycin (100
.mu.g/ml) by feeding the cells with selective medium every 3 to 4
days until foci could be seen. Antibiotic resistant cells were
treated with trypsin (0.25%) solution for 3 min, diluted with 5
volumes of complete F-12 (HAM) medium and harvested by
centrifugation at 250.times.g for 5 min. Cells were then
resuspended in complete F-12 (HAM) medium, and diluted to a final
cell density of five cells per ml. One hundred microliters of cell
suspension was used to seed the wells of two 96-well plates. Only
wells containing single foci were subcultured on selective medium
in 12 and 24-well plates. Expression of TcdB was induced in the
different cell lineages of transfected CHO cells by the addition of
mifepristone (10.sup.-8 M), to the selective medium.
GeneSwitch-CHOpGene/TcdB1-556 a lineage of transfected cells
showing nearly 100% rounding in 24 h in the presence of
mifepristone was identified and chosen for the experiments reported
herein.
Statistical Analysis
[0069] Results were analyzed using the statistical software
component of Excel 2001. Sample variations are reported as standard
deviation from the mean, and significance was confirmed by
student's T-test (p<0.05).
Utility
[0070] Since the preferred embodiments of the mutants contemplated
herein are inactive, and therefore are not lethal, but are
effective in binding to native TcdB toxin, they will make excellent
therapeutics or vaccines against C. difficile toxins or infections
in their pure and partially pure forms. The mutant toxin may be
therapeutically administered to inhibit active TcdB in subjects
having existing C. difficile infections or circulating TcdB toxin,
for example, for treating or inhibiting diarrhea or
pseudomembranous colitis.
[0071] The administration of a human vaccine comprising one or more
of the mutants described herein is applicable to the prevention or
treatment of a C. difficile infection in a human or animal. The
vaccine may be administered by epicutaneous injection, subcutaneous
injection, intramuscular injection, interdermal injection
(injection by infusion), sustained-release repository,
aerosolization, parenteral delivery, inoculation into an egg, and
the like, by known techniques in the art. Although this approach is
generally satisfactory, other routes of administration, such as
i.v. (into the blood stream) may also be used in a manner known to
those of ordinary skill in the art. In addition, the vaccine can be
given together with adjuvants and/or immuno-modulators to boost the
activity of the vaccine and the subject's response, the subject
being a human or animal as described elsewhere herein.
[0072] The amount of protein in each therapeutic or vaccine dose
can be selected as an amount which induces an antitoxin or
immunoprotective response without significant, adverse side
effects. Such amount in a vaccine will vary depending upon which
specific immunogen is employed, how it is presented, and the size
of the subject treated. Generally, it is expected that each
therapeutic or immunogenic dose of the protein will comprise
0.1-1000 .mu.g/kg of weight of the subject, preferably 0.2-100
.mu.g/kg, and most preferably 1-10 .mu.g/kg. An optimal amount for
a particular vaccine can be ascertained by standard studies
involving observation of appropriate immune responses in subjects.
Following an initial vaccination, subjects may receive one or
several booster immunization adequately spaced. Therapeutic doses
for inhibiting TcdB toxin may also be from 10 .mu.g-1 mg/kg, for
example.
[0073] Accordingly in one aspect, the invention provides a method
of treatment comprising administering an effective amount of a
vaccine of the present invention to a subject. The vaccine
formulations of the present invention may be used for both
prophylactic and therapeutic purposes. The vaccine compositions of
the present invention can be formulated according to known methods
of preparing pharmaceutically useful compositions, whereby these
materials are combined in a mixture with a pharmaceutically
acceptable carrier vehicle. Suitable vehicles and their formulation
are described, for example, in Remingtons' Pharmaceutical Sciences,
(Mack Publishing Co., 1980).
[0074] The TcdB toxin mutants can be administered in combination
with a pharmaceutical carrier compatible with the protein and the
subject. Suitable pharmacological carriers include, for example,
physiological saline (0.85%), phosphate-buffered saline (PBS), Tris
hydroxymethyl aminomethane (TRIS), Tris-buffered saline, and the
like. The protein may also be incorporated into a carrier which is
biocompatible and can incorporate the protein and provide for its
controlled release or delivery, for example, a sustained release
polymer such as a hydrogel, acrylate, polylactide,
polycaprolactone, polyglycolide, or copolymer thereof. An example
of a solid matrix for implantation into the subject and sustained
release of the protein antigen into the body is a metabolizable
matrix, as known in the art.
[0075] Adjuvants may be included in the vaccine to enhance the
immune response in the subject. Such adjuvants include, for
example, aluminum hydroxide, aluminum phosphate, Freund's
Incomplete Adjuvant (FCA), liposomes, ISCOM, and the like. The
vaccine may also include additives such as buffers and
preservatives to maintain isotonicity, physiological pH and
stability. Parenteral and intravenous formulations of the vaccine
may include an emulsifying and/or suspending agent, together with
pharmaceutically-acceptable diluents to control the delivery and
the dose amount of the vaccine.
[0076] Factors bearing on the therapeutic or vaccine dosage
include, for example, the age and weight of the subject. The range
of a given dose is about 25-5000 .mu.g of the purified mutant
receptor protein per ml, preferably about 100-1000 .mu.g/ml
preferably given in about 0.1-5 ml doses. The vaccine or
therapeutic should be administered to the subject in an amount
effective to ensure that the subject will develop an immunity to
protect against a C. difficle infection or a therapeutic response
against a current C. difficile infection. For example, a vaccine
for immunizing an about 5-lb. piglet against C. difficile would
contain about 100-5000 .mu.g protein per ml, preferably given in
1-5 ml doses. The immunizing dose would then be followed by a
booster given at about 21-28 days after the first injection.
Preferably, the vaccine is formulated with an amount of the TcdB
toxin mutant effective for immunizing a susceptible subject against
an infection by more than one strain C. difficile.
[0077] The present invention further contemplates a monoclonal
antibody raised against the C. difficile TcdB toxin mutant. The
monoclonal antibody may be prepared by a method comprising
immunizing a suitable animal or animal cell with an immunogenic C.
difficile TcdB toxin mutant to obtain cells for producing an
antibody to said mutant, fusing cells producing the antibody with
cells of a suitable cell line, and selecting and cloning the
resulting cells producing said antibody, or immortalizing an
unfused cell line producing said antibody, e.g. by viral
transformation, followed by growing the cells in a suitable medium
to produce said antibody and harvesting the antibody from the
growth medium in a manner well known to those of ordinary skill in
the art. The recovery of the polyclonal or monoclonal antibodies
may be preformed by conventional procedures well known in the art,
for example as described in Kohler and Milstein, Nature 256, 1975,
p. 495.
[0078] In a further aspect, the invention relates to a diagnostic
agent which comprises a monoclonal antibody as defined above.
Although in some cases when the diagnostic agent is to be employed
in an agglutination assay in which solid particles to which the
antibody is coupled agglutinate in the presence of a C. difficile
toxin in the sample subjected to testing, no labeling of the
monoclonal antibody is necessary, it is preferred for most purposes
to provide the antibody with a label in order to detect bound
antibody. In a double antibody ("sandwich") assay, at least one of
the antibodies may be provided with a label. Substances useful as
labels in the present context may be selected from enzymes,
fluorescers, radioactive isotopes and complexing agents such as
biotin. In a preferred embodiment, the diagnostic agent comprises
at least one antibody covalently or non-covalently bonded coupled
to a solid support. This may be used in a double antibody assay in
which case the antibody coupled to the solid support is not
labeled. The solid support may be selected from a plastic, e.g.
latex, polystyrene, polyvinylchloride, nylon, polyvinylidene
difluoride, cellulose, e.g. nitrocellulose and magnetic carrier
particles such as iron particle coated with polystyrene.
[0079] The monoclonal antibody of the invention may be used in a
method of determining the presence of C. difficile TcdB toxin in a
sample, such as blood, plasma, or serum, the method comprising
incubating the sample with a monoclonal antibody as described above
and detecting the presence of bound toxin resulting from said
incubation. The antibody may be provided with a label as explained
above and/or may be bound to a solid support as exemplified
above.
[0080] In a preferred embodiment of the method, a sample desired to
be tested for the presence of C. difficile is incubated with a
first monoclonal antibody coupled to a solid support and
subsequently with a second monoclonal or polyclonal antibody
provided with a label. In an alternative embodiment (a so-called
competitive binding assay), the sample may be incubated with a
monoclonal antibody coupled to a solid support and simultaneously
or subsequently with a labeled C. difficile TcdB toxin competing
for binding sites on the antibody with any toxin present in the
sample. The sample subjected to the present method may be any
sample suspected of containing a C. difficile TcdB toxin. Thus, the
sample may be selected from bacterial suspensions, bacterial
extracts, culture supernatants, animal body fluids (e.g. serum,
colostrum or nasal mucous) and intermediate or final vaccine
products.
[0081] Apart from the diagnostic use of the monoclonal antibody of
the invention, it is contemplated to utilize a well-known ability
of certain monoclonal antibodies to inhibit or block the activity
of biologically active antigens by incorporating the monoclonal
antibody in a composition for the passive immunization of a subject
against diseases caused by C difficile producing a TcdB toxin,
which comprises a monoclonal antibody as described above and a
suitable carrier or vehicle. The composition may be prepared by
combining a therapeutically effective amount of the antibody or
fragment thereof with a suitable carrier or vehicle. Examples of
suitable carriers and vehicles may be the ones discussed above in
connection with the vaccine of the invention. It is contemplated
that a C. difficile-specific antibody may be used for prophylactic
or therapeutic treatment of a subject having a C. difficile
infection or a subject which may potentially incur a C. dfficile
infection.
[0082] A further use of the monoclonal antibody of the invention is
in a method of isolating a C. difficile TcdB toxin, the method
comprising adsorbing a biological material containing said toxin to
a matrix comprising an immobilized monoclonal antibody as described
above, eluting said toxin from said matrix and recovering said
toxin from the eluate. The matrix may be composed of any suitable
material usually employed for affinity chromatographic purposes
such as agarose, dextran, controlled pore glass, DEAE cellulose,
optionally activated by means of CNBr, divinylsulphone, etc. in a
manner known per se.
[0083] In a still further aspect, the present invention relates to
a method of determining the presence of antibodies against C.
difficile TcdB toxin in a sample, the method comprising incubating
the sample with C. difficile TcdB toxin and detecting the presence
of bound antibody resulting from incubation. A diagnostic agent
comprising the TcdB toxin used in this method may otherwise exhibit
any of the features described above for diagnostic agents
comprising the monoclonal antibody and be used in similar detection
methods although these will detect bound antibody rather than bound
TcdB toxin as such. The diagnostic agent may be useful, for
instance as a reference standard or to detect anti-toxin antibodies
in body fluids, e.g. serum, colostrum or nasal mucous, from
subjects exposed to the toxin or C. difficile.
[0084] The monoclonal antibody of the invention may be used in a
method of determining the presence of a C. difficile toxin, in a
sample, the method comprising incubating the sample with a
monoclonal antibody and detecting the presence of bound toxin
resulting from said incubation.
[0085] The present invention further contemplates a nucleic acid
sequence encoding a C. difficile TcdB toxin mutant wherein the
nucleic acid sequence is a cDNA similar to a cDNA which encodes
native C. difficile TcdB toxin, but differs therefrom only in
having instead a substituted codon which encodes the substituted
amino acid or amino acids in the mutant TcdB toxin, as defined
herein, and wherein the substituted codon is any codon known to
encode the substitute amino acid residue. The mutant TcdB toxin
described herein may be produced by well-known recombinant methods
using cDNA encoding the mutant TcdB toxin, the cDNA having been
transfected into a host cell in a plasmid or other vector.
[0086] In particular, the present invention contemplates any
antigenic Clostridium difficile TcdB toxin mutant wherein the TcdB
toxin mutant lacks the toxicity of a native C. difficile TcdB
toxin.
[0087] As noted above, the invention contemplates a vaccine for use
in immunizing a human or an animal against an infection by
Clostridium difficile, the vaccine comprising a purified non-toxic
C. difficile TcdB toxin mutant.
[0088] Alternatively, the present invention contemplates a method
for immunizing a subject against an infection by Clostridium
difficile by administering an effective quantity of a vaccine
comprising at least one purified non-toxic C. difficile TcdB toxin
mutant as defined elsewhere herein. In this method, the vaccine may
be administered by epicutaneous injection, subcutaneous injection,
intramuscular injection, interdermal injection, intravenous
injection, sustained-release repository, aerosolization, parenteral
delivery, or inoculation into an egg. In one embodiment of the
method, the vaccine induces an effective antibody titer to prevent
or eliminate the infection without administration of a booster of
the vaccine.
[0089] The present invention further contemplates a serum for
treating a subject with an existing a Clostridium difficile
infection comprising antibodies against a C. difficile TcdB toxin
wherein the antibodies are raised against a C. difficile TcdB toxin
mutant as defined elsewhere herein.
[0090] The present invention further contemplates an antibody
against a Clostridium difficile TcdB toxin wherein said antibody is
raised against a C. difficile TcdB toxin mutant as defined
elsewhere herein.
[0091] The present invention further contemplates a method of
treating a human or animal having, or disposed to having, a
Clostridium difficile infection, comprising administering to the
subject a therapeutically effective amount of an antibody against
to an TcdB toxin of C. difficile, the antibody raised against a C.
dfficile TcdB toxin mutant as defined elsewhere herein. The method
for a Clostridium difficile infection may comprise administering a
serum comprising the antibodies effective against C. difficile TcdB
toxin.
[0092] The present invention further contemplates a method of
making a hybridoma which secretes an antibody against C. difficile
TcdB toxin, the method comprising fusing a lymphocyte from an
animal immunized with a C. difficile TcdB toxin mutant with cells
capable of replicating indefinitely in cell culture to produce the
hybridoma and further isolating the hybridoma. The hybridoma may
further secrete an antibody against C. difficile TcdB toxin.
[0093] Additionally, the present invention further contemplates an
immunoassay for C. difficile TcdB toxin in which a sample is
contacting a sample which may contain a C. difficile TcdB toxin or
a portion thereof with an antibody raised against a C. difficile
TcdB toxin mutant to form an antibody-TcdB toxin complex and
further detecting the antibody-TcdB toxin complex to determine the
presence of the C. difficile TcdB toxin.
[0094] The present invention further contemplates a polynucleotide
which encodes a mutant of C. difficile TcdB toxin polypeptide as
defined herein. In addition, the present invention further
contemplates a vector containing a polynucleotide which encodes a
mutant of C. difficile TcdB toxin polypeptide as defined herein.
The present invention further contemplates a host cell containing a
vector containing a polynucleotide which encodes a mutant of C.
difficile TcdB toxin polypeptide as defined herein. The present
invention further contemplates a process for producing a mutant of
C. difficile TcdB toxin polypeptide by culturing the host cell
described herein thereby expressing the mutant and purifying the
mutant from the cultured host cell. The present invention further
contemplates a non-toxic mutant of C. difficile TcdB toxin
comprising a substitution in the cysteine residue of the native
form of the toxin.
[0095] The present invention is not to be limited in scope by the
specific embodiments described herein, since such embodiments are
intended as but single illustrations of one aspect of the invention
and any functionally equivalent embodiments are within the scope of
this invention. Indeed, various modifications of the invention in
addition to those shown and described herein will become apparent
to those skilled in the art from the foregoing description and
accompanying drawings.
Sequence CWU 1
1
181556PRTClostridium difficile 1Met Ser Leu Val Asn Arg Lys Gln Leu
Glu Lys Met Ala Asn Val Arg1 5 10 15Phe Arg Thr Gln Glu Asp Glu Tyr
Val Ala Ile Leu Asp Ala Leu Glu 20 25 30Glu Tyr His Asn Met Ser Glu
Asn Thr Val Val Glu Lys Tyr Leu Lys35 40 45Leu Lys Asp Ile Asn Ser
Leu Thr Asp Ile Tyr Ile Asp Thr Tyr Lys50 55 60Lys Ser Gly Arg Asn
Lys Ala Leu Lys Lys Phe Lys Glu Tyr Leu Val65 70 75 80Thr Glu Val
Leu Glu Leu Lys Asn Asn Asn Leu Thr Pro Val Glu Lys 85 90 95Asn Leu
His Phe Val Trp Ile Gly Gly Gln Ile Asn Asp Thr Ala Ile 100 105
110Asn Tyr Ile Asn Gln Trp Lys Asp Val Asn Ser Asp Tyr Asn Val
Asn115 120 125Val Phe Tyr Asp Ser Asn Ala Phe Leu Ile Asn Thr Leu
Lys Lys Thr130 135 140Val Val Glu Ser Ala Ile Asn Asp Thr Leu Glu
Ser Phe Arg Glu Asn145 150 155 160Leu Asn Asp Pro Arg Phe Asp Tyr
Asn Lys Phe Phe Arg Lys Arg Met 165 170 175Glu Ile Ile Tyr Asp Lys
Gln Lys Asn Phe Ile Asn Tyr Tyr Lys Ala 180 185 190Gln Arg Glu Glu
Asn Pro Glu Leu Ile Ile Asp Asp Ile Val Lys Thr195 200 205Tyr Leu
Ser Asn Glu Tyr Ser Lys Glu Ile Asp Glu Leu Asn Thr Tyr210 215
220Ile Glu Glu Ser Leu Asn Lys Ile Thr Gln Asn Ser Gly Asn Asp
Val225 230 235 240Arg Asn Phe Glu Glu Phe Lys Asn Gly Glu Ser Phe
Asn Leu Tyr Glu 245 250 255Gln Glu Leu Val Glu Arg Trp Asn Leu Ala
Ala Ala Ser Asp Ile Leu 260 265 270Arg Ile Ser Ala Leu Lys Glu Ile
Gly Gly Met Tyr Leu Asp Val Asp275 280 285Met Leu Pro Gly Ile Gln
Pro Asp Leu Phe Glu Ser Ile Glu Lys Pro290 295 300Ser Ser Val Thr
Val Asp Phe Trp Glu Met Thr Lys Leu Glu Ala Ile305 310 315 320Met
Lys Tyr Lys Glu Tyr Ile Pro Glu Tyr Thr Ser Glu His Phe Asp 325 330
335Met Leu Asp Glu Glu Val Gln Ser Ser Phe Glu Ser Val Leu Ala Ser
340 345 350Lys Ser Asp Lys Ser Glu Ile Phe Ser Ser Leu Gly Asp Met
Glu Ala355 360 365Ser Pro Leu Glu Val Lys Ile Ala Phe Asn Ser Lys
Gly Ile Ile Asn370 375 380Gln Gly Leu Ile Ser Val Lys Asp Ser Tyr
Cys Ser Asn Leu Ile Val385 390 395 400Lys Gln Ile Glu Asn Arg Tyr
Lys Ile Leu Asn Asn Ser Leu Asn Pro 405 410 415Ala Ile Ser Glu Asp
Asn Asp Phe Asn Thr Thr Thr Asn Thr Phe Ile 420 425 430Asp Ser Ile
Met Ala Glu Ala Asn Ala Asp Asn Gly Arg Phe Met Met435 440 445Glu
Leu Gly Lys Tyr Leu Arg Val Gly Phe Phe Pro Asp Val Lys Thr450 455
460Thr Ile Asn Leu Ser Gly Pro Glu Ala Tyr Ala Ala Ala Tyr Gln
Asp465 470 475 480Leu Leu Met Phe Lys Glu Gly Ser Met Asn Ile His
Leu Ile Glu Ala 485 490 495Asp Leu Arg Asn Phe Glu Ile Ser Lys Thr
Asn Ile Ser Gln Ser Thr 500 505 510Glu Gln Glu Met Ala Ser Leu Trp
Ser Phe Asp Asp Ala Arg Ala Lys515 520 525Ala Gln Phe Glu Glu Tyr
Lys Arg Asn Tyr Phe Glu Gly Ser Leu Gly530 535 540Glu Asp Asp Asn
Leu Asp Phe Ser Gln Asn Ile Val545 550 55521668DNAClostridium
difficile 2atgagtttag ttaatagaaa acagttagaa aaaatggcaa atgtaagatt
tcgtactcaa 60gaagatgaat atgttgcaat attggatgct ttagaagaat atcataatat
gtcagagaat 120actgtagtcg aaaaatattt aaaattaaaa gatataaata
gtttaacaga tatttatata 180gatacatata aaaaatctgg tagaaataaa
gccttaaaaa aatttaagga atatctagtt 240acagaagtat tagagctaaa
gaataataat ttaactccag ttgagaaaaa tttacatttt 300gtttggattg
gaggtcaaat aaatgacact gctattaatt atataaatca atggaaagat
360gtaaatagtg attataatgt taatgttttt tatgatagta atgcattttt
gataaacaca 420ttgaaaaaaa ctgtagtaga atcagcaata aatgatacac
ttgaatcatt tagagaaaac 480ttaaatgacc ctagatttga ctataataaa
ttcttcagaa aacgtatgga aataatttat 540gataaacaga aaaatttcat
aaactactat aaagctcaaa gagaagaaaa tcctgaactt 600ataattgatg
atattgtaaa gacatatctt tcaaatgagt attcaaagga gatagatgaa
660cttaatacct atattgaaga atccttaaat aaaattacac agaatagtgg
aaatgatgtt 720agaaactttg aagaatttaa aaatggagag tcattcaact
tatatgaaca agagttggta 780gaaaggtgga atttagctgc tgcttctgac
atattaagaa tatctgcatt aaaagaaatt 840ggtggtatgt atttagatgt
tgatatgtta ccaggaatac aaccagactt atttgagtct 900atagagaaac
ctagttcagt aacagtggat ttttgggaaa tgacaaagtt agaagctata
960atgaaataca aagaatatat accagaatat acctcagaac attttgacat
gttagacgaa 1020gaagttcaaa gtagttttga atctgttcta gcttctaagt
cagataaatc agaaatattc 1080tcatcacttg gtgatatgga ggcatcacca
ctagaagtta aaattgcatt taatagtaag 1140ggtattataa atcaagggct
aatttctgtg aaagactcat attgtagcaa tttaatagta 1200aaacaaatcg
agaatagata taaaatattg aataatagtt taaatccagc tattagcgag
1260gataatgatt ttaatactac aacgaatacc tttattgata gtataatggc
tgaagctaat 1320gcagataatg gtagatttat gatggaacta ggaaagtatt
taagagttgg tttcttccca 1380gatgttaaaa ctactattaa cttaagtggc
cctgaagcat atgcggcagc ttatcaagat 1440ttattaatgt ttaaagaagg
cagtatgaat atccatttga tagaagctga tttaagaaac 1500tttgaaatct
ctaaaactaa tatttctcaa tcaactgaac aagaaatggc tagcttatgg
1560tcatttgacg atgcaagagc taaagctcaa tttgaagaat ataaaaggaa
ttattttgaa 1620ggttctcttg gtgaagatga taatcttgat ttttctcaaa atatagta
16683500PRTClostridium difficile 3Met Ser Leu Val Asn Arg Lys Gln
Leu Glu Lys Met Ala Asn Val Arg1 5 10 15Phe Arg Thr Gln Glu Asp Glu
Tyr Val Ala Ile Leu Asp Ala Leu Glu 20 25 30Glu Tyr His Asn Met Ser
Glu Asn Thr Val Val Glu Lys Tyr Leu Lys35 40 45Leu Lys Asp Ile Asn
Ser Leu Thr Asp Ile Tyr Ile Asp Thr Tyr Lys50 55 60Lys Ser Gly Arg
Asn Lys Ala Leu Lys Lys Phe Lys Glu Tyr Leu Val65 70 75 80Thr Glu
Val Leu Glu Leu Lys Asn Asn Asn Leu Thr Pro Val Glu Lys 85 90 95Asn
Leu His Phe Val Trp Ile Gly Gly Gln Ile Asn Asp Thr Ala Ile 100 105
110Asn Tyr Ile Asn Gln Trp Lys Asp Val Asn Ser Asp Tyr Asn Val
Asn115 120 125Val Phe Tyr Asp Ser Asn Ala Phe Leu Ile Asn Thr Leu
Lys Lys Thr130 135 140Val Val Glu Ser Ala Ile Asn Asp Thr Leu Glu
Ser Phe Arg Glu Asn145 150 155 160Leu Asn Asp Pro Arg Phe Asp Tyr
Asn Lys Phe Phe Arg Lys Arg Met 165 170 175Glu Ile Ile Tyr Asp Lys
Gln Lys Asn Phe Ile Asn Tyr Tyr Lys Ala 180 185 190Gln Arg Glu Glu
Asn Pro Glu Leu Ile Ile Asp Asp Ile Val Lys Thr195 200 205Tyr Leu
Ser Asn Glu Tyr Ser Lys Glu Ile Asp Glu Leu Asn Thr Tyr210 215
220Ile Glu Glu Ser Leu Asn Lys Ile Thr Gln Asn Ser Gly Asn Asp
Val225 230 235 240Arg Asn Phe Glu Glu Phe Lys Asn Gly Glu Ser Phe
Asn Leu Tyr Glu 245 250 255Gln Glu Leu Val Glu Arg Trp Asn Leu Ala
Ala Ala Ser Asp Ile Leu 260 265 270Arg Ile Ser Ala Leu Lys Glu Ile
Gly Gly Met Tyr Leu Asp Val Asp275 280 285Met Leu Pro Gly Ile Gln
Pro Asp Leu Phe Glu Ser Ile Glu Lys Pro290 295 300Ser Ser Val Thr
Val Asp Phe Trp Glu Met Thr Lys Leu Glu Ala Ile305 310 315 320Met
Lys Tyr Lys Glu Tyr Ile Pro Glu Tyr Thr Ser Glu His Phe Asp 325 330
335Met Leu Asp Glu Glu Val Gln Ser Ser Phe Glu Ser Val Leu Ala Ser
340 345 350Lys Ser Asp Lys Ser Glu Ile Phe Ser Ser Leu Gly Asp Met
Glu Ala355 360 365Ser Pro Leu Glu Val Lys Ile Ala Phe Asn Ser Lys
Gly Ile Ile Asn370 375 380Gln Gly Leu Ile Ser Val Lys Asp Ser Tyr
Cys Ser Asn Leu Ile Val385 390 395 400Lys Gln Ile Glu Asn Arg Tyr
Lys Ile Leu Asn Asn Ser Leu Asn Pro 405 410 415Ala Ile Ser Glu Asp
Asn Asp Phe Asn Thr Thr Thr Asn Thr Phe Ile 420 425 430Asp Ser Ile
Met Ala Glu Ala Asn Ala Asp Asn Gly Arg Phe Met Met435 440 445Glu
Leu Gly Lys Tyr Leu Arg Val Gly Phe Phe Pro Asp Val Lys Thr450 455
460Thr Ile Asn Leu Ser Gly Pro Glu Ala Tyr Ala Ala Ala Tyr Gln
Asp465 470 475 480Leu Leu Met Phe Lys Glu Gly Ser Met Asn Ile His
Leu Ile Glu Ala 485 490 495Asp Leu Arg Asn 50041500DNAClostridium
difficile 4atgagtttag ttaatagaaa acagttagaa aaaatggcaa atgtaagatt
tcgtactcaa 60gaagatgaat atgttgcaat attggatgct ttagaagaat atcataatat
gtcagagaat 120actgtagtcg aaaaatattt aaaattaaaa gatataaata
gtttaacaga tatttatata 180gatacatata aaaaatctgg tagaaataaa
gccttaaaaa aatttaagga atatctagtt 240acagaagtat tagagctaaa
gaataataat ttaactccag ttgagaaaaa tttacatttt 300gtttggattg
gaggtcaaat aaatgacact gctattaatt atataaatca atggaaagat
360gtaaatagtg attataatgt taatgttttt tatgatagta atgcattttt
gataaacaca 420ttgaaaaaaa ctgtagtaga atcagcaata aatgatacac
ttgaatcatt tagagaaaac 480ttaaatgacc ctagatttga ctataataaa
ttcttcagaa aacgtatgga aataatttat 540gataaacaga aaaatttcat
aaactactat aaagctcaaa gagaagaaaa tcctgaactt 600ataattgatg
atattgtaaa gacatatctt tcaaatgagt attcaaagga gatagatgaa
660cttaatacct atattgaaga atccttaaat aaaattacac agaatagtgg
aaatgatgtt 720agaaactttg aagaatttaa aaatggagag tcattcaact
tatatgaaca agagttggta 780gaaaggtgga atttagctgc tgcttctgac
atattaagaa tatctgcatt aaaagaaatt 840ggtggtatgt atttagatgt
tgatatgtta ccaggaatac aaccagactt atttgagtct 900atagagaaac
ctagttcagt aacagtggat ttttgggaaa tgacaaagtt agaagctata
960atgaaataca aagaatatat accagaatat acctcagaac attttgacat
gttagacgaa 1020gaagttcaaa gtagttttga atctgttcta gcttctaagt
cagataaatc agaaatattc 1080tcatcacttg gtgatatgga ggcatcacca
ctagaagtta aaattgcatt taatagtaag 1140ggtattataa atcaagggct
aatttctgtg aaagactcat attgtagcaa tttaatagta 1200aaacaaatcg
agaatagata taaaatattg aataatagtt taaatccagc tattagcgag
1260gataatgatt ttaatactac aacgaatacc tttattgata gtataatggc
tgaagctaat 1320gcagataatg gtagatttat gatggaacta ggaaagtatt
taagagttgg tttcttccca 1380gatgttaaaa ctactattaa cttaagtggc
cctgaagcat atgcggcagc ttatcaagat 1440ttattaatgt ttaaagaagg
cagtatgaat atccatttga tagaagctga tttaagaaac 15005420PRTClostridium
difficile 5Met Ser Leu Val Asn Arg Lys Gln Leu Glu Lys Met Ala Asn
Val Arg1 5 10 15Phe Arg Thr Gln Glu Asp Glu Tyr Val Ala Ile Leu Asp
Ala Leu Glu 20 25 30Glu Tyr His Asn Met Ser Glu Asn Thr Val Val Glu
Lys Tyr Leu Lys35 40 45Leu Lys Asp Ile Asn Ser Leu Thr Asp Ile Tyr
Ile Asp Thr Tyr Lys50 55 60Lys Ser Gly Arg Asn Lys Ala Leu Lys Lys
Phe Lys Glu Tyr Leu Val65 70 75 80Thr Glu Val Leu Glu Leu Lys Asn
Asn Asn Leu Thr Pro Val Glu Lys 85 90 95Asn Leu His Phe Val Trp Ile
Gly Gly Gln Ile Asn Asp Thr Ala Ile 100 105 110Asn Tyr Ile Asn Gln
Trp Lys Asp Val Asn Ser Asp Tyr Asn Val Asn115 120 125Val Phe Tyr
Asp Ser Asn Ala Phe Leu Ile Asn Thr Leu Lys Lys Thr130 135 140Val
Val Glu Ser Ala Ile Asn Asp Thr Leu Glu Ser Phe Arg Glu Asn145 150
155 160Leu Asn Asp Pro Arg Phe Asp Tyr Asn Lys Phe Phe Arg Lys Arg
Met 165 170 175Glu Ile Ile Tyr Asp Lys Gln Lys Asn Phe Ile Asn Tyr
Tyr Lys Ala 180 185 190Gln Arg Glu Glu Asn Pro Glu Leu Ile Ile Asp
Asp Ile Val Lys Thr195 200 205Tyr Leu Ser Asn Glu Tyr Ser Lys Glu
Ile Asp Glu Leu Asn Thr Tyr210 215 220Ile Glu Glu Ser Leu Asn Lys
Ile Thr Gln Asn Ser Gly Asn Asp Val225 230 235 240Arg Asn Phe Glu
Glu Phe Lys Asn Gly Glu Ser Phe Asn Leu Tyr Glu 245 250 255Gln Glu
Leu Val Glu Arg Trp Asn Leu Ala Ala Ala Ser Asp Ile Leu 260 265
270Arg Ile Ser Ala Leu Lys Glu Ile Gly Gly Met Tyr Leu Asp Val
Asp275 280 285Met Leu Pro Gly Ile Gln Pro Asp Leu Phe Glu Ser Ile
Glu Lys Pro290 295 300Ser Ser Val Thr Val Asp Phe Trp Glu Met Thr
Lys Leu Glu Ala Ile305 310 315 320Met Lys Tyr Lys Glu Tyr Ile Pro
Glu Tyr Thr Ser Glu His Phe Asp 325 330 335Met Leu Asp Glu Glu Val
Gln Ser Ser Phe Glu Ser Val Leu Ala Ser 340 345 350Lys Ser Asp Lys
Ser Glu Ile Phe Ser Ser Leu Gly Asp Met Glu Ala355 360 365Ser Pro
Leu Glu Val Lys Ile Ala Phe Asn Ser Lys Gly Ile Ile Asn370 375
380Gln Gly Leu Ile Ser Val Lys Asp Ser Tyr Cys Ser Asn Leu Ile
Val385 390 395 400Lys Gln Ile Glu Asn Arg Tyr Lys Ile Leu Asn Asn
Ser Leu Asn Pro 405 410 415Ala Ile Ser Glu 42061260DNAClostridium
difficile 6atgagtttag ttaatagaaa acagttagaa aaaatggcaa atgtaagatt
tcgtactcaa 60gaagatgaat atgttgcaat attggatgct ttagaagaat atcataatat
gtcagagaat 120actgtagtcg aaaaatattt aaaattaaaa gatataaata
gtttaacaga tatttatata 180gatacatata aaaaatctgg tagaaataaa
gccttaaaaa aatttaagga atatctagtt 240acagaagtat tagagctaaa
gaataataat ttaactccag ttgagaaaaa tttacatttt 300gtttggattg
gaggtcaaat aaatgacact gctattaatt atataaatca atggaaagat
360gtaaatagtg attataatgt taatgttttt tatgatagta atgcattttt
gataaacaca 420ttgaaaaaaa ctgtagtaga atcagcaata aatgatacac
ttgaatcatt tagagaaaac 480ttaaatgacc ctagatttga ctataataaa
ttcttcagaa aacgtatgga aataatttat 540gataaacaga aaaatttcat
aaactactat aaagctcaaa gagaagaaaa tcctgaactt 600ataattgatg
atattgtaaa gacatatctt tcaaatgagt attcaaagga gatagatgaa
660cttaatacct atattgaaga atccttaaat aaaattacac agaatagtgg
aaatgatgtt 720agaaactttg aagaatttaa aaatggagag tcattcaact
tatatgaaca agagttggta 780gaaaggtgga atttagctgc tgcttctgac
atattaagaa tatctgcatt aaaagaaatt 840ggtggtatgt atttagatgt
tgatatgtta ccaggaatac aaccagactt atttgagtct 900atagagaaac
ctagttcagt aacagtggat ttttgggaaa tgacaaagtt agaagctata
960atgaaataca aagaatatat accagaatat acctcagaac attttgacat
gttagacgaa 1020gaagttcaaa gtagttttga atctgttcta gcttctaagt
cagataaatc agaaatattc 1080tcatcacttg gtgatatgga ggcatcacca
ctagaagtta aaattgcatt taatagtaag 1140ggtattataa atcaagggct
aatttctgtg aaagactcat attgtagcaa tttaatagta 1200aaacaaatcg
agaatagata taaaatattg aataatagtt taaatccagc tattagcgag
12607170PRTClostridium difficile 7Met Ser Leu Val Asn Arg Lys Gln
Leu Glu Lys Met Ala Asn Val Arg1 5 10 15Phe Arg Thr Gln Glu Asp Glu
Tyr Val Ala Ile Leu Asp Ala Leu Glu 20 25 30Glu Tyr His Asn Met Ser
Glu Asn Thr Val Val Glu Lys Tyr Leu Lys35 40 45Leu Lys Asp Ile Asn
Ser Leu Thr Asp Ile Tyr Ile Asp Thr Tyr Lys50 55 60Lys Ser Gly Arg
Asn Lys Ala Leu Lys Lys Phe Lys Glu Tyr Leu Val65 70 75 80Thr Glu
Val Leu Glu Leu Lys Asn Asn Asn Leu Thr Pro Val Glu Lys 85 90 95Asn
Leu His Phe Val Trp Ile Gly Gly Gln Ile Asn Asp Thr Ala Ile 100 105
110Asn Tyr Ile Asn Gln Trp Lys Asp Val Asn Ser Asp Tyr Asn Val
Asn115 120 125Val Phe Tyr Asp Ser Asn Ala Phe Leu Ile Asn Thr Leu
Lys Lys Thr130 135 140Val Val Glu Ser Ala Ile Asn Asp Thr Leu Glu
Ser Phe Arg Glu Asn145 150 155 160Leu Asn Asp Pro Arg Phe Asp Tyr
Asn Lys 165 1708510DNAClostridium difficile 8atgagtttag ttaatagaaa
acagttagaa aaaatggcaa atgtaagatt tcgtactcaa 60gaagatgaat atgttgcaat
attggatgct ttagaagaat atcataatat gtcagagaat 120actgtagtcg
aaaaatattt aaaattaaaa gatataaata gtttaacaga tatttatata
180gatacatata aaaaatctgg tagaaataaa gccttaaaaa aatttaagga
atatctagtt 240acagaagtat tagagctaaa gaataataat ttaactccag
ttgagaaaaa tttacatttt 300gtttggattg gaggtcaaat aaatgacact
gctattaatt atataaatca atggaaagat 360gtaaatagtg attataatgt
taatgttttt tatgatagta atgcattttt gataaacaca 420ttgaaaaaaa
ctgtagtaga atcagcaata aatgatacac ttgaatcatt tagagaaaac
480ttaaatgacc ctagatttga ctataataaa 5109522PRTClostridium difficile
9His Asn Met Ser Glu Asn Thr Val Val Glu Lys Tyr Leu Lys Leu Lys1 5
10 15Asp Ile Asn Ser Leu Thr Asp Thr Tyr Ile Asp Thr Tyr Lys Lys
Ser 20 25 30Gly Arg Asn Lys Ala Leu Lys Lys Phe Lys Glu Tyr Leu Val
Ile Glu35 40 45Ile Leu
Glu Leu Glu Asn Ser Asn Leu Thr Pro Val Glu Lys Asn Leu50 55 60His
Phe Ile Trp Ile Gly Gly Gln Ile Asn Asp Thr Ala Ile Asn Tyr65 70 75
80Ile Asn Gln Trp Lys Asp Val Asn Ser Asp Tyr Asn Val Asn Val Phe
85 90 95Tyr Asp Ser Asn Ala Phe Leu Ile Asn Thr Leu Lys Lys Thr Ile
Ile 100 105 110Glu Ser Ala Ser Asn Asp Thr Leu Glu Ser Phe Arg Glu
Asn Leu Asn115 120 125Asp Pro Glu Phe Asn His Thr Ala Phe Phe Arg
Lys Arg Met Gln Ile130 135 140Ile Tyr Asp Lys Gln Gln Asn Phe Ile
Asn Tyr Tyr Lys Ala Gln Lys145 150 155 160Glu Glu Asn Pro Asp Leu
Ile Ile Asp Asp Ile Val Lys Thr Tyr Leu 165 170 175Ser Asn Glu Tyr
Ser Lys Asp Ile Asp Glu Leu Asn Ala Tyr Ile Glu 180 185 190Glu Ser
Leu Asn Lys Val Thr Glu Asn Ser Gly Asn Asp Val Arg Asn195 200
205Phe Glu Glu Phe Lys Thr Gly Glu Val Phe Asn Leu Tyr Glu Gln
Glu210 215 220Leu Val Glu Arg Trp Asn Leu Ala Gly Ala Ser Asp Ile
Leu Arg Val225 230 235 240Ala Ile Leu Lys Asn Ile Gly Gly Val Tyr
Leu Asp Val Asp Met Leu 245 250 255Pro Gly Ile His Pro Asp Leu Phe
Lys Asp Ile Asn Lys Pro Asp Ser 260 265 270Val Lys Thr Ala Val Asp
Trp Glu Glu Met Gln Leu Glu Ala Ile Met275 280 285Lys His Lys Glu
Tyr Ile Pro Glu Tyr Thr Ser Lys His Phe Asp Thr290 295 300Leu Asp
Glu Glu Val Gln Ser Ser Phe Glu Ser Val Leu Ala Ser Lys305 310 315
320Ser Asp Lys Ser Glu Ile Phe Leu Pro Leu Gly Asp Ile Glu Val Ser
325 330 335Pro Leu Glu Val Lys Ile Ala Phe Ala Lys Gly Ser Ile Ile
Asn Gln 340 345 350Ala Leu Ile Ser Ala Lys Asp Ser Tyr Cys Ser Asp
Leu Leu Ile Lys355 360 365Gln Ile Gln Asn Arg Tyr Lys Ile Leu Asn
Asp Thr Leu Gly Pro Ile370 375 380Ile Ser Gln Gly Asn Asp Phe Asn
Thr Thr Met Asn Asn Phe Gly Glu385 390 395 400Ser Leu Gly Ala Ile
Ala Asn Glu Glu Asn Ile Ser Phe Ile Ala Lys 405 410 415Ile Gly Ser
Tyr Leu Arg Val Gly Phe Tyr Pro Glu Ala Asn Thr Thr 420 425 430Val
Thr Leu Ser Gly Pro Thr Ile Tyr Ala Gly Ala Tyr Lys Asp Leu435 440
445Leu Thr Phe Lys Glu Met Ser Ile Asp Thr Ser Ile Leu Ser Ser
Glu450 455 460Leu Arg Asn Phe Glu Phe Pro Lys Val Asn Ile Ser Gln
Ala Thr Glu465 470 475 480Gln Glu Lys Asn Ser Leu Trp Gln Phe Asn
Glu Glu Arg Ala Lys Ile 485 490 495Gln Phe Glu Glu Tyr Lys Lys Asn
Tyr Phe Glu Gly Ala Leu Gly Glu 500 505 510Asp Asp Asn Leu Asp Phe
Ser Gln Asn Thr515 520101566DNAClostridium difficile 10cataatatgt
cagagaatac tgtagtcgaa aaatatttaa aattaaaaga tataaatagt 60ttaacagata
tttatataga tacatataaa aaatctggta gaaataaagc cttaaaaaaa
120tttaaggaat atctagttac agaagtatta gagctaaaga ataataattt
aactccagtt 180gagaaaaatt tacattttgt ttggattgga ggtcaaataa
atgacactgc tattaattat 240ataaatcaat ggaaagatgt aaatagtgat
tataatgtta atgtttttta tgatagtaat 300gcatttttga taaacacatt
gaaaaaaact gtagtagaat cagcaataaa tgatacactt 360gaatcattta
gagaaaactt aaatgaccct agatttgact ataataaatt cttcagaaaa
420cgtatggaaa taatttatga taaacagaaa aatttcataa actactataa
agctcaaaga 480gaagaaaatc ctgaacttat aattgatgat attgtaaaga
catatctttc aaatgagtat 540tcaaaggaga tagatgaact taatacctat
attgaagaat ccttaaataa aattacacag 600aatagtggaa atgatgttag
aaactttgaa gaatttaaaa atggagagtc attcaactta 660tatgaacaag
agttggtaga aaggtggaat ttagctgctg cttctgacat attaagaata
720tctgcattaa aagaaattgg tggtatgtat ttagatgttg atatgttacc
aggaatacaa 780ccagacttat ttgagtctat agagaaacct agttcagtaa
cagtggattt ttgggaaatg 840acaaagttag aagctataat gaaatacaaa
gaatatatac cagaatatac ctcagaacat 900tttgacatgt tagacgaaga
agttcaaagt agttttgaat ctgttctagc ttctaagtca 960gataaatcag
aaatattctc atcacttggt gatatggagg catcaccact agaagttaaa
1020attgcattta atagtaaggg tattataaat caagggctaa tttctgtgaa
agactcatat 1080tgtagcaatt taatagtaaa acaaatcgag aatagatata
aaatattgaa taatagttta 1140aatccagcta ttagcgagga taatgatttt
aatactacaa cgaatacctt tattgatagt 1200ataatggctg aagctaatgc
agataatggt agatttatga tggaactagg aaagtattta 1260agagttggtt
tcttcccaga tgttaaaact actattaact taagtggccc tgaagcatat
1320gcggcagctt atcaagattt attaatgttt aaagaaggca gtatgaatat
ccatttgata 1380gaagctgatt taagaaactt tgaaatctct aaaactaata
tttctcaatc aactgaacaa 1440gaaatggcta gcttatggtc atttgacgat
gcaagagcta aagctcaatt tgaagaatat 1500aaaaggaatt attttgaagg
ttctcttggt gaagatgata atcttgattt ttctcaaaat 1560atagta
156611556PRTArtificial sequenceCompletely synthesized 11Met Ser Leu
Val Asn Arg Lys Gln Leu Glu Lys Met Ala Asn Val Arg1 5 10 15Phe Arg
Thr Gln Glu Asp Glu Tyr Val Ala Ile Leu Asp Ala Leu Glu 20 25 30Glu
Tyr His Asn Met Ser Glu Asn Thr Val Val Glu Lys Tyr Leu Lys35 40
45Leu Lys Asp Ile Asn Ser Leu Thr Asp Ile Tyr Ile Asp Thr Tyr Lys50
55 60Lys Ser Gly Arg Asn Lys Ala Leu Lys Lys Phe Lys Glu Tyr Leu
Val65 70 75 80Thr Glu Val Leu Glu Leu Lys Asn Asn Asn Leu Thr Pro
Val Glu Lys 85 90 95Asn Leu His Phe Val Trp Ile Gly Gly Gln Ile Asn
Asp Thr Ala Ile 100 105 110Asn Tyr Ile Asn Gln Trp Lys Asp Val Asn
Ser Asp Tyr Asn Val Asn115 120 125Val Phe Tyr Asp Ser Asn Ala Phe
Leu Ile Asn Thr Leu Lys Lys Thr130 135 140Val Val Glu Ser Ala Ile
Asn Asp Thr Leu Glu Ser Phe Arg Glu Asn145 150 155 160Leu Asn Asp
Pro Arg Phe Asp Tyr Asn Lys Phe Phe Arg Lys Arg Met 165 170 175Glu
Ile Ile Tyr Asp Lys Gln Lys Asn Phe Ile Asn Tyr Tyr Lys Ala 180 185
190Gln Arg Glu Glu Asn Pro Glu Leu Ile Ile Asp Asp Ile Val Lys
Thr195 200 205Tyr Leu Ser Asn Glu Tyr Ser Lys Glu Ile Asp Glu Leu
Asn Thr Tyr210 215 220Ile Glu Glu Ser Leu Asn Lys Ile Thr Gln Asn
Ser Gly Asn Asp Val225 230 235 240Arg Asn Phe Glu Glu Phe Lys Asn
Gly Glu Ser Phe Asn Leu Tyr Glu 245 250 255Gln Glu Leu Val Glu Arg
Trp Asn Leu Ala Ala Ala Ser Asp Ile Leu 260 265 270Arg Ile Ser Ala
Leu Lys Glu Ile Gly Gly Met Tyr Leu Asp Val Asp275 280 285Met Leu
Pro Gly Ile Gln Pro Asp Leu Phe Glu Ser Ile Glu Lys Pro290 295
300Ser Ser Val Thr Val Asp Phe Trp Glu Met Thr Lys Leu Glu Ala
Ile305 310 315 320Met Lys Tyr Lys Glu Tyr Ile Pro Glu Tyr Thr Ser
Glu His Phe Asp 325 330 335Met Leu Asp Glu Glu Val Gln Ser Ser Phe
Glu Ser Val Leu Ala Ser 340 345 350Lys Ser Asp Lys Ser Glu Ile Phe
Ser Ser Leu Gly Asp Met Glu Ala355 360 365Ser Pro Leu Glu Val Lys
Ile Ala Phe Asn Ser Lys Gly Ile Ile Asn370 375 380Gln Gly Leu Ile
Ser Val Lys Asp Ser Tyr Xaa Ser Asn Leu Ile Val385 390 395 400Lys
Gln Ile Glu Asn Arg Tyr Lys Ile Leu Asn Asn Ser Leu Asn Pro 405 410
415Ala Ile Ser Glu Asp Asn Asp Phe Asn Thr Thr Thr Asn Thr Phe Ile
420 425 430Asp Ser Ile Met Ala Glu Ala Asn Ala Asp Asn Gly Arg Phe
Met Met435 440 445Glu Leu Gly Lys Tyr Leu Arg Val Gly Phe Phe Pro
Asp Val Lys Thr450 455 460Thr Ile Asn Leu Ser Gly Pro Glu Ala Tyr
Ala Ala Ala Tyr Gln Asp465 470 475 480Leu Leu Met Phe Lys Glu Gly
Ser Met Asn Ile His Leu Ile Glu Ala 485 490 495Asp Leu Arg Asn Phe
Glu Ile Ser Lys Thr Asn Ile Ser Gln Ser Thr 500 505 510Glu Gln Glu
Met Ala Ser Leu Trp Ser Phe Asp Asp Ala Arg Ala Lys515 520 525Ala
Gln Phe Glu Glu Tyr Lys Arg Asn Tyr Phe Glu Gly Ser Leu Gly530 535
540Glu Asp Asp Asn Leu Asp Phe Ser Gln Asn Ile Val545 550
55512556PRTClostridium difficile 12Met Ser Leu Val Asn Arg Lys Gln
Leu Glu Lys Met Ala Asn Val Arg1 5 10 15Phe Arg Thr Gln Glu Asp Glu
Tyr Val Ala Ile Leu Asp Ala Leu Glu 20 25 30Glu Tyr His Asn Met Ser
Glu Asn Thr Val Val Glu Lys Tyr Leu Lys35 40 45Leu Lys Asp Ile Asn
Ser Leu Thr Asp Ile Tyr Ile Asp Thr Tyr Lys50 55 60Lys Ser Gly Arg
Asn Lys Ala Leu Lys Lys Phe Lys Glu Tyr Leu Val65 70 75 80Thr Glu
Val Leu Glu Leu Lys Asn Asn Asn Leu Thr Pro Val Glu Lys 85 90 95Asn
Leu His Phe Val Ala Ile Gly Gly Gln Ile Asn Asp Thr Ala Ile 100 105
110Asn Tyr Ile Asn Gln Trp Lys Asp Val Asn Ser Asp Tyr Asn Val
Asn115 120 125Val Phe Tyr Asp Ser Asn Ala Phe Leu Ile Asn Thr Leu
Lys Lys Thr130 135 140Val Val Glu Ser Ala Ile Asn Asp Thr Leu Glu
Ser Phe Arg Glu Asn145 150 155 160Leu Asn Asp Pro Arg Phe Asp Tyr
Asn Lys Phe Phe Arg Lys Arg Met 165 170 175Glu Ile Ile Tyr Asp Lys
Gln Lys Asn Phe Ile Asn Tyr Tyr Lys Ala 180 185 190Gln Arg Glu Glu
Asn Pro Glu Leu Ile Ile Asp Asp Ile Val Lys Thr195 200 205Tyr Leu
Ser Asn Glu Tyr Ser Lys Glu Ile Asp Glu Leu Asn Thr Tyr210 215
220Ile Glu Glu Ser Leu Asn Lys Ile Thr Gln Asn Ser Gly Asn Asp
Val225 230 235 240Arg Asn Phe Glu Glu Phe Lys Asn Gly Glu Ser Phe
Asn Leu Tyr Glu 245 250 255Gln Glu Leu Val Glu Arg Trp Asn Leu Ala
Ala Ala Ser Asp Ile Leu 260 265 270Arg Ile Ser Ala Leu Lys Glu Ile
Gly Gly Met Tyr Leu Asp Val Asp275 280 285Met Leu Pro Gly Ile Gln
Pro Asp Leu Phe Glu Ser Ile Glu Lys Pro290 295 300Ser Ser Val Thr
Val Asp Phe Trp Glu Met Thr Lys Leu Glu Ala Ile305 310 315 320Met
Lys Tyr Lys Glu Tyr Ile Pro Glu Tyr Thr Ser Glu His Phe Asp 325 330
335Met Leu Asp Glu Glu Val Gln Ser Ser Phe Glu Ser Val Leu Ala Ser
340 345 350Lys Ser Asp Lys Ser Glu Ile Phe Ser Ser Leu Gly Asp Met
Glu Ala355 360 365Ser Pro Leu Glu Val Lys Ile Ala Phe Asn Ser Lys
Gly Ile Ile Asn370 375 380Gln Gly Leu Ile Ser Val Lys Asp Ser Tyr
Cys Ser Asn Leu Ile Val385 390 395 400Lys Gln Ile Glu Asn Arg Tyr
Lys Ile Leu Asn Asn Ser Leu Asn Pro 405 410 415Ala Ile Ser Glu Asp
Asn Asp Phe Asn Thr Thr Thr Asn Thr Phe Ile 420 425 430Asp Ser Ile
Met Ala Glu Ala Asn Ala Asp Asn Gly Arg Phe Met Met435 440 445Glu
Leu Gly Lys Tyr Leu Arg Val Gly Phe Phe Pro Asp Val Lys Thr450 455
460Thr Ile Asn Leu Ser Gly Pro Glu Ala Tyr Ala Ala Ala Tyr Gln
Asp465 470 475 480Leu Leu Met Phe Lys Glu Gly Ser Met Asn Ile His
Leu Ile Glu Ala 485 490 495Asp Leu Arg Asn Phe Glu Ile Ser Lys Thr
Asn Ile Ser Gln Ser Thr 500 505 510Glu Gln Glu Met Ala Ser Leu Trp
Ser Phe Asp Asp Ala Arg Ala Lys515 520 525Ala Gln Phe Glu Glu Tyr
Lys Arg Asn Tyr Phe Glu Gly Ser Leu Gly530 535 540Glu Asp Asp Asn
Leu Asp Phe Ser Gln Asn Ile Val545 550 5551338DNAArtificial
sequenceCompletely synthesized 13gtttactatt aaattgctag aatatgagtc
tttcacag 381438DNAArtificial sequenceCompletely synthesized
14ctgtgaagac tcatattcta gcaatttaat agtaaaac 381538DNAArtificial
sequenceCompletely synthesized 15gttttactat taaattgcta cctatgagtc
tttcacag 381639DNAArtificial sequenceCompletely synthesized
16ctgtgaaaga ctcatattgg agcaatttaa tagtaaaac 391733DNAArtificial
sequenceCompletely synthesized 17aaaaatttac attttgttgc tattggaggt
caa 331833DNAArtificial sequenceCompletely synthesized 18ttgacctcca
atagcaacaa aatgtaaatt ttt 33
* * * * *