Novel Method of Diagnosing, Monitoring, Staging, Imaging and Treating Breast Cancer

Abstract

The present invention provides new markers and methods for detecting, diagnosing, monitoring, staging, prognosticating, imaging and treating breast cancer.

Description

INTRODUCTION

[0001] This patent application is a continuation of U.S. patent application Ser. No. 09/721,183, filed Nov. 22, 2000, which claims the benefit of priority from U.S. Provisional Application Ser. No. 60/166,973, filed Nov. 23, 1999, teachings of each of which are hereby incorporated by reference in their entirety.

FIELD OF THE INVENTION

[0002] This invention relates, in part, to newly identified breast cancer specific genes and assays for detecting, diagnosing, monitoring, staging, prognosticating, imaging and treating cancers, particularly breast cancer.

BACKGROUND OF THE INVENTION

[0003] It is estimated that one out of every nine women in America will develop breast cancer sometime during her life based on a lifespan of 85 years. Annually, over 180,000 women in the United States are diagnosed with breast cancer and approximately 46,000 die from this disease. Every woman is at risk for breast cancer. However, a woman's chances of developing breast cancer increase as she grows older; 80 percent of all cancers are found in women over the age of 50. There are also several risk factors that can increase a woman's chances of developing breast cancer. These include a family history of breast cancer, having no children or the first child after the age of 30, and an early start of menstruation. However, more than 70 percent of women who develop breast cancer have no known risk factors. Less than 10 percent of breast cancer cases are thought to be related to the BRCA1 gene discovered in 1994. Researchers are now investigating the role of other factors such as nutrition, alcohol, exercise, smoking, and oral contraceptives in development of this gynecologic cancer. Mammograms, or special x-rays of the breast, can detect more than 90 percent of all cancers.

[0004] Procedures used for detecting, diagnosing, monitoring, staging, and prognosticating breast cancer are of critical importance to the outcome of the patient. Patients diagnosed early generally have a much greater five-year survival rate as compared to the survival rate for patients diagnosed with distant metastasized breast cancer. New diagnostic methods which are more sensitive and specific for detecting early breast cancer are clearly needed.

[0005] Breast cancer patients are closely monitored following initial therapy and during adjuvant therapy to determine response to therapy and to detect persistent or recurrent disease or metastasis. Thus, there is also clearly a need for cancer markers which are more sensitive and specific in detecting breast cancer recurrence.

[0006] Another important step in managing breast cancer is to determine the stage of the patient's disease. Stage determination has potential prognostic value and provides criteria for designing optimal therapy. Generally, pathological staging of cancer is preferable over clinical staging because the former gives a more accurate prognosis. However, clinical staging would be preferred were it at least as accurate as pathological staging because it does not depend on an invasive procedure to obtain tissue for pathological evaluation. Staging of cancer would be improved by detecting new markers in cells, tissues or bodily fluids which could differentiate between different stages of invasion.

[0007] New breast cancer specific genes, referred to herein as BCSGs, have now been identified for use in diagnosing, monitoring, staging, imaging and treating cancers, and in particular breast cancer. Accordingly, the present invention relates to new methods for detecting, diagnosing, monitoring, staging, prognosticating, in vivo imaging and treating cancer via a BCSG. BCSG refers, among other things, to native proteins expressed by the genes comprising the polynucleotide sequences of BCSG-1 or Gene ID 332369 (SEQ ID NO: 1), BCSG-2 or Gene ID 480489 (SEQ ID NO:2 or 18), BCSG-3 or Gene ID 274731 (SEQ ID NO:3 or 20), BCSG-4 or Gene ID 173388 (SEQ ID NO:4) or BCSG-5 or Clone ID 3040232, Gene ID 411152 (SEQ ID NO:5). Exemplary proteins expressed by genes BCSG-2 and BCSG-3 are depicted herein as SEQ ID NO:19 and SEQ ID NO:21. By "BCSG" it is also meant herein variant polynucleotides which, due to degeneracy in genetic coding, comprise variations in nucleotide sequence as compared to SEQ ID NO: 1, 2, 3, 4, 5, 18 or 20 but which still encode the same proteins. In the alternative, what is meant by BCSG as used herein, means the native mRNAs encoded by the genes comprising BCSG-1 or Gene ID 332369 (SEQ ID NO: 1), BCSG-2 or Gene ID 480489 (SEQ ID NO:2 or 18), BCSG-3 or Gene ID 274731 (SEQ ID NO:3 or 20), BCSG-4 or Gene ID 173388 (SEQ ID NO:4) or BCSG-5 or Clone ID 3040232, Gene ID 411152 (SEQ ID NO:5) or it can refer to the actual genes comprising BCSG-1 or Gene ID 332369 (SEQ ID NO: 1), BCSG-2 or Gene ID 480489 (SEQ ID NO:2 or 18), BCSG-3 or Gene ID 274731 (SEQ ID NO:3 or 20), BCSG-4 or Gene ID 173388 (SEQ ID NO:4) or BCSG-5 or Clone ID 3040232, Gene ID 411152 (SEQ ID NO:5), or levels of polynucleotides which are capable of hybridizing under stringent conditions to the antisense sequences of SEQ ID NO: 1, 2, 3, 4, 5, 18 or 20.

[0008] Other objects, features, advantages and aspects of the present invention will become apparent to those of skill in the art from the following description. It should be understood, however, that the following description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only. Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following description and from reading the other parts of the present disclosure.

SUMMARY OF THE INVENTION

[0009] Toward these ends, and others, it is an object of the present invention to provide BCSGs comprising a polynucleotide of SEQ ID NO:1, 2, 3, 4, 5, 18 or 20 or a variant thereof, a protein expressed by a polynucleotide of SEQ ID NO:1, 2, 3, 4, 5, 18 or 20 or variant thereof which expresses the protein; or a polynucleotide which is capable of hybridizing under stringent conditions to the antisense sequence of SEQ ID NO: 1, 2, 3, 4, 5, 18 or 20.

[0010] Further provided is a method for diagnosing the presence of breast cancer by analyzing for changes in levels of BCSG in cells, tissues or bodily fluids compared with levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein a change in levels of BCSG in the patient versus the normal human control is associated with breast cancer.

[0011] Further provided is a method of diagnosing metastatic breast cancer in a patient having breast cancer which is not known to have metastasized by identifying a human patient suspected of having breast cancer that has metastasized; analyzing a sample of cells, tissues, or bodily fluid from such patient for BCSG; comparing the BCSG levels in such cells, tissues, or bodily fluid with levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in BCSG levels in the patient versus the normal human control is associated with breast cancer which has metastasized.

[0012] Also provided by the invention is a method of staging breast cancer in a human by identifying a human patient having breast cancer; analyzing a sample of cells, tissues, or bodily fluid from such patient for BCSG; comparing BCSG levels in such cells, tissues, or bodily fluid with levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in BCSG levels in the patient versus the normal human control is associated with a cancer which is progressing and a decrease in the levels of BCSG is associated with a cancer which is regressing or in remission.

[0013] Further provided is a method of monitoring breast cancer in a human patient for the onset of metastasis. The method comprises identifying a human patient having breast cancer that is not known to have metastasized; periodically analyzing cells, tissues, or bodily fluid from such patient for BCSG; comparing the BCSG levels in such cells, tissue, or bodily fluid with levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in BCSG levels in the patient versus the normal human control is associated with a cancer which has metastasized.

[0014] Further provided is a method of monitoring the change in stage of cancer in a human patient having breast cancer by looking at levels of BCSG in the human patient. The method comprises identifying a human patient having breast cancer; periodically analyzing cells, tissues, or bodily fluid from such patient for BCSG; comparing the BCSG levels in such cells, tissue, or bodily fluid with levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in BCSG levels in the patient versus the normal human control is associated with breast cancer which is progressing and a decrease in the levels of BCSG is associated with breast cancer which is regressing or in remission.

[0015] Further provided are methods of designing new therapeutic agents targeted to BCSGs for use in imaging and treating cancer. For example, in one embodiment, therapeutic agents such as antibodies targeted against a BCSG or fragments of such antibodies can be used to treat, detect or image localization of a BCSG in a patient for the purpose of detecting or diagnosing a disease or condition. In this embodiment, an increase in the amount of labeled antibody detected as compared to normal tissue would be indicative of tumor metastases or growth. Such antibodies can be polyclonal, monoclonal, or omniclonal or prepared by molecular biology techniques. The term "antibody", as used herein and throughout the instant specification is also meant to include aptamers and single-stranded oligonucleotides such as those derived from an in vitro evolution protocol referred to as SELEX and well known to those skilled in the art. Antibodies can be labeled with a variety of detectable labels including, but not limited to, radioisotopes and paramagnetic metals. Therapeutics agents such as small molecule and antibodies or fragments thereof which decrease the concentration and/or activity of a BCSG can also be used in the treatment of diseases characterized by overexpression of BCSG. In these applications, the antibody can be used without or with derivatization to a cytotoxic agent such as a radioisotope, enzyme, toxin, drug or a prodrug.

[0016] Other objects, features, advantages and aspects of the present invention will become apparent to those of skill in the art from the following description. It should be understood, however, that the following description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only. Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following description and from reading the other parts of the present disclosure.

DESCRIPTION OF THE INVENTION

[0017] The present invention relates to diagnostic assays and methods, both quantitative and qualitative for detecting, diagnosing, monitoring, staging, prognosticating, in vivo imaging and treating breast cancer by comparing levels of breast cancer specific genes (BCSGs) with levels of BCSGs in a normal human control. BCSG refers, among other things, to native proteins expressed by the genes comprising the polynucleotide sequences of BCSG-1 or Gene ID 332369 (SEQ ID NO: 1), BCSG-2 or Gene ID 480489 (SEQ ID NO:2 or 18), BCSG-3 or Gene ID 274731 (SEQ ID NO:3 or 20), BCSG-4 or Gene ID 173388 (SEQ ID NO:4) or BCSG-5 or Clone ID 3040232, Gene ID 411152 (SEQ ID NO:5). Exemplary proteins expressed by genes BCSG-2 and BCSG-3 are depicted herein as SEQ ID NO:19 and SEQ ID NO:21. The genes encoding these proteins (SEQ ID NO:18 and 20) as well as the proteins (SEQ ID NO:19 and 21) have been disclosed in GenBank as Accession No. AF016492.1 (SEQ ID NO:18), AAC27891.1 (SEQ ID NO:19), AF183819 (SEQ ID NO:20) and AAF23614.1 (SEQ ID NO:21). By "BCSG" it is also meant herein variant polynucleotides which, due to degeneracy in genetic coding, comprise variations in nucleotide sequence as compared to SEQ ID NO: 1, 2, 3, 4, 5, 18 or 20 but which still encode the same proteins. The native protein being detected may be whole, a breakdown product, a complex of molecules or chemically modified. In the alternative, what is meant by BCSG as used herein, means the native mRNAs encoded by the genes comprising BCSG-1 or Gene ID 3323C9 (SEQ ID NO: 1), BCSG-2 or Gene ID 480489 (SEQ ID NO:2 or 18), BCSG-3 or Gene ID 274731 (SEQ ID NO:3 or 20), BCSG-4 or Gene ID 173388 (SEQ ID NO:4) or BCSG-5 or Clone ID 3040232, Gene ID 411152 (SEQ ID NO:5) or it can refer to the actual genes comprising BCSG-1 or Gene ID 332369 (SEQ ID NO: 1), BCSG-2 or Gene ID 480489 (SEQ ID NO:2 or 18), BCSG-3 or Gene ID 274731 (SEQ ID NO:3 or 20), BCSG-4 or Gene ID 173388 (SEQ ID NO:4) or BCSG-5 or Clone ID 3040232, Gene ID 411152 (SEQ ID NO:5) or levels of polynucleotides which are capable of hybridizing under stringent conditions to the antisense sequences of SEQ ID NO: 1, 2, 3, 4, 5, 18 or 20. Such levels are preferably measured in at least one of, cells, tissues and/or bodily fluids, including determination of normal and abnormal levels. Thus, for instance, a diagnostic assay in accordance with the invention for diagnosing over-expression of a BCSG protein compared to normal control bodily fluids, cells, or tissue samples can be used to diagnose the presence of cancers, and in particular breast cancer. BCSGs may be measured alone in the methods of the invention, or, more preferably, in combination with other diagnostic markers for breast cancer including other BCSGs as described herein. Other breast cancer markers, in addition to BCSGs, useful in the present invention are known to those of skill in the art.

Diagnostic Assays

[0018] The present invention provides methods for diagnosing the presence of cancer, and in particular breast cancer, by analyzing for changes in levels of BCSG in cells, tissues or bodily fluids from a human patient compared with levels of BCSG in cells, tissues or bodily fluids of preferably the same type from a normal human control, wherein an increase in levels of BCSG in the patient versus the normal human control is associated with the presence of cancer.

[0019] Without limiting the instant invention, typically, for a quantitative diagnostic assay a positive result indicating the patient being tested has breast cancer is one in which cells, tissues, or bodily fluid levels of a cancer marker, such as BCSG, are at least two times higher, and most preferably are at least five times higher, than in preferably the same cells, tissues, or bodily fluid of a normal human control.

[0020] The present invention also provides a method of diagnosing metastatic cancer, and in particular metastatic breast cancer, in a patient having breast cancer which has not yet metastasized. In the method of the present invention, a human cancer patient suspected of having breast cancer which may have metastasized (but which was not previously known to have metastasized) is identified. This is accomplished by a variety of means known to those of skill in the art.

[0021] In the present invention, determining the presence of BCSG in cells, tissues, or bodily fluid, is particularly useful for discriminating between cancers which have not metastasized and cancers which have metastasized. Existing techniques have difficulty discriminating between breast cancer which has metastasized and breast cancer which has not metastasized. However, proper treatment selection is often dependent upon such knowledge.

[0022] In the present invention, one of the cancer marker levels measured in cells, tissues, or bodily fluid of a human patient is BCSG. Levels in the human patient are compared with levels of BCSG in preferably the same cells, tissue, or bodily fluid type of a normal human control. That is, if the cancer marker being observed is BCSG in serum, this level is preferably compared with the level of BCSG in serum of a normal human control. An increase in BCSG in the human patient versus the normal human control is associated with a cancer which has metastasized.

[0023] Without limiting the instant invention, typically, for a quantitative diagnostic assay a positive result indicating the cancer in the patient being tested or monitored has metastasized is one in which cells, tissues, or bodily fluid levels of a cancer marker, such as BCSG, are at least two times higher, and more preferably are at least five times higher, than in preferably the same cells, tissues, or bodily fluid of a normal human control.

[0024] Normal human control as used herein includes a human patient without cancer and/or non cancerous samples from the patient; in the methods for diagnosing metastasis or monitoring for metastasis, normal human control preferably includes samples from a human patient that is determined by reliable methods to have breast cancer which has not metastasized, such as samples from the same patient prior to metastasis.

Staging

[0025] The invention also provides a method of staging cancers in a human patient.

[0026] The method comprises identifying a human patient having breast cancer and analyzing a sample of cells, tissues, or bodily fluid from such patient for BCSG. The measured BCSG levels are then compared to levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in BCSG levels in the human patient versus the normal human control is associated with breast cancer which is progressing and a decrease in the levels of BCSG is associated with breast cancer which is regressing or in remission.

Monitoring

[0027] Further provided is a method of monitoring breast cancer in a human patient for the onset of metastasis. The method comprises identifying a human patient having breast cancer that is not known to have metastasized; periodically analyzing cells, tissues, or bodily fluid from such patient for BCSG; and comparing the BCSG levels in such cells, tissue, or bodily fluid with levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in BCSG levels in the patient versus the normal human control is associated with breast cancer which has metastasized.

[0028] Further provided by this invention is a method of monitoring the change in stage of breast cancer. The method comprises identifying a human patient having breast cancer; periodically analyzing cells, tissues, or bodily fluid from such patient for BCSG; and comparing the BCSG levels in such cells, tissue, or bodily fluid with levels of BCSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in BCSG levels in the patient versus the normal human control is associated with breast cancer which is progressing in stage and a decrease in the levels of BCSG is associated with breast cancer which is regressing in stage or in remission.

[0029] Monitoring such patients for onset of metastasis is periodic and preferably done on a quarterly basis. However, this may be performed more or less frequently depending on the cancer, the particular patient, and the stage of the cancer.

Prognostic Testing and Clinical Trial Monitoring

[0030] The methods described herein can further be utilized as prognostic assays to identify subjects having or at risk of developing a disease or disorder associated with increased levels of BCSG. The present invention provides a method in which a test sample is obtained from a human patient and BCSG is detected. The presence of higher BCSG levels as compared to normal human controls is diagnostic for the human patient being at risk for developing cancer, particularly breast cancer.

[0031] The effectiveness of therapeutic agents to decrease expression or activity of the BCSGs of the invention can also be monitored by analyzing levels of expression of the BCSGs in a human patient in clinical trials or in in vitro screening assays such as in human cells. In this way, the gene expression pattern can serve as a marker, indicative of the physiological response of the human patient, or cells as the case may be, to the agent being tested.

Detection of Genetic Lesions or Mutations

[0032] The methods of the present invention can also be used to detect genetic lesions or mutations in BCSG, thereby determining if a human with the genetic lesion is at risk for breast cancer or has breast cancer. Genetic lesions can be detected, for example, by ascertaining the existence of a deletion and/or addition and/or substitution of one or more nucleotides from the BCSGs of this invention, a chromosomal rearrangement of BCSG, aberrant modification of BCSG (such as of the methylation pattern of the genomic DNA), the presence of a non-wild type splicing pattern of a mRNA transcript of BCSG, allelic loss of BCSG, and/or inappropriate post-translational modification of BCSG protein. Methods to detect such lesions in the BCSG of this invention are known to those of skill in the art.

Assay Techniques

[0033] Assay techniques that can be used to determine levels of gene expression, such as BCSG of the present invention, in a sample derived from a human are well-known to those of skill in the art. Such assay methods include radioimmunoassays, reverse transcriptase PCR (RT-PCR) assays, immunohistochemistry assays, in situ hybridization assays, competitive-binding assays, Western Blot analyses, ELISA assays and proteomic approaches, two-dimensional gel electrophoresis (2D electrophoresis) and non-gel based approaches such as mass spectrometry or protein interaction profiling. Among these, ELISAs are frequently preferred to diagnose a gene's expressed protein in biological fluids.

[0034] An ELISA assay initially comprises preparing an antibody, if not readily available from a commercial source, specific to BCSG, preferably a monoclonal antibody. In addition a reporter antibody generally is prepared which binds specifically to BCSG. The reporter antibody is attached to a detectable reagent such as a radioactive, fluorescent or enzymatic reagent, for example horseradish peroxidase enzyme or alkaline phosphatase.

[0035] To carry out the ELISA, antibody specific to BCSG is incubated on a solid support, e.g., a polystyrene dish, that binds the antibody. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the sample to be analyzed is incubated in the dish, during which time BCSG binds to the specific antibody attached to the polystyrene dish. Unbound sample is washed out with buffer. A reporter antibody specifically directed to BCSG and linked to a detectable reagent such as horseradish peroxidase is placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to BCSG. Unattached reporter antibody is then washed out. Reagents for peroxidase activity, including a calorimetric substrate are then added to the dish. Immobilized peroxidase, linked to BCSG antibodies, produces a colored reaction product. The amount of color developed in a given time period is proportional to the amount of BCSG protein present in the sample. Quantitative results typically are obtained by reference to a standard curve.

[0036] A competition assay can also be employed wherein antibodies specific to BCSG are attached to a solid support and labeled BCSG and a sample derived from the patient or human control are passed over the solid support. The amount of label detected which is attached to the solid support can be correlated to a quantity of BCSG in the sample.

[0037] Using all or a portion of a nucleic acid sequence of a BCSG of the present invention as a hybridization probe, nucleic acid methods can also be used to detect BCSG mRNA as a marker for cancer, and in particular breast cancer. Polymerase chain reaction (PCR) and other nucleic acid methods, such as ligase chain reaction (LCR) and nucleic acid sequence based amplification (NASABA), can be used to detect malignant cells for diagnosis and monitoring of various malignancies. For example, reverse-transcriptase PCR (RT-PCR) is a powerful technique which can be used to detect the presence of a specific mRNA population in a complex mixture of thousands of other mRNA species. In RT-PCR, an mRNA species is first reverse transcribed to complementary DNA (cDNA) with use of the enzyme reverse transcriptase; the cDNA is then amplified as in a standard PCR reaction. RT-PCR can thus reveal by amplification the presence of a single species of mRNA. Accordingly, if the mRNA is highly specific for the cell that produces it, RT-PCR can be used to identify the presence of a specific type of cell.

[0038] Hybridization to clones or oligonucleotides arrayed on a solid support (i.e., gridding) can be used to both detect the expression of and quantitate the level of expression of that gene. In this approach, a cDNA encoding a BCSG gene is fixed to a substrate. The substrate may be of any suitable type including but not limited to glass, nitrocellulose, nylon or plastic. At least a portion of the DNA encoding the BCSG gene is attached to the substrate and then incubated with the analyte, which may be RNA or a complementary DNA (cDNA) copy of the RNA, isolated from the tissue of interest. Hybridization between the substrate bound DNA and the analyte can be detected and quantitated by several means including but not limited to radioactive labeling or fluorescence labeling of the analyte or a secondary molecule designed to detect the hybrid. Quantitation of the level of gene expression can be done by comparison of the intensity of the signal from the analyte compared with that determined from known standards. The standards can be obtained by in vitro transcription of the target gene, quantitating the yield, and then using that material to generate a standard curve.

[0039] Of the proteomic approaches, 2D electrophoresis is a technique well known to those in the art. Isolation of individual proteins from a sample such as serum is accomplished using sequential separation of proteins by different characteristics usually on polyacrylamide gels. First, proteins are separated by size using an electric current. The current acts uniformly on all proteins, so smaller proteins move farther on the gel than larger proteins. The second dimension applies a current perpendicular to the first and separates proteins not on the basis of size but on the specific electric charge carried by each protein. Since no two proteins with different sequences are identical on the basis of both size and charge, the result of a 2D separation is a square gel in which each protein occupies a unique spot. Analysis of the spots with chemical or antibody probes, or subsequent protein microsequencing can reveal the relative abundance of a given protein and the identity of the proteins in the sample.

[0040] The above tests can be carried out on samples derived from a variety cells, bodily fluids and/or tissue extracts (homogenates or solubilized tissue) obtained from the patient including tissue biopsy and autopsy material. Bodily fluids useful in the present invention include blood, urine, saliva, or any other bodily secretion or derivative thereof. Blood can include whole blood, plasma, serum, or any derivative of blood.

In Vivo Targeting of BCSGs/Breast Cancer Therapy

[0041] Identification of BCSGs is also useful in the rational design of new therapeutics for imaging and treating cancers, and in particular breast cancer. For example, in one embodiment, antibodies which specifically bind to BCSGs can be raised and used in vivo in patients suspected of suffering from cancer. Antibodies which specifically bind a BCSG can be injected into a patient suspected of having cancer for diagnostic and/or therapeutic purposes. The preparation and use of antibodies for in vivo diagnosis is well known in the art. For example, antibody-chelators labeled with Indium-111 have been described for use in the radioimmunoscintographic imaging of carcinoembryonic antigen expressing tumors (Sumerdon et al. Nucl. Med. Biol. 1990 17:247-254). In particular, these antibody-chelators have been used in detecting tumors in patients suspected of having recurrent colorectal cancer (Griffin et al. J. Clin. One. 1991 9:631-640). Antibodies with paramagnetic ions as labels for use in magnetic resonance imaging have also been described (Lauffer, R. B. Magnetic Resonance in Medicine 1991 22:339-342). Antibodies directed against BCSGs can be used in a similar manner. Labeled antibodies which specifically bind a BCSG can be injected into patients suspected of having breast cancer for the purpose of diagnosing or staging of the disease status of the patient. The label used will be selected in accordance with the imaging modality to be used. For example, radioactive labels such as Indium-111, Technetium-99m or Iodine-131 can be used for planar scans or single photon emission computed tomography (SPECT). Positron emitting labels such as Fluorine-19 can be used in positron emission tomography. Paramagnetic ions such as Gadlinium (III) or Manganese (II) can be used in magnetic resonance imaging (MRI). Localization of the label permits determination of the spread of the cancer. The amount of label within an organ or tissue also allows determination of the presence or absence of cancer in that organ or tissue.

[0042] For patients diagnosed with cancer, and in particular breast cancer, injection of an antibody which specifically binds a BCSG can also have a therapeutic benefit. The antibody may exert its therapeutic effect alone. Alternatively, the antibody can be conjugated to a cytotoxic agent such as a drug, toxin or radionuclide to enhance its therapeutic effect. Drug monoclonal antibodies have been described in the art for example by Garnett and Baldwin, Cancer Research 1986 46:2407-2412. The use of toxins conjugated to monoclonal antibodies for the therapy of various cancers has also been described by Pastan et al. Cell 1986 47:641-648. Yttrium-90 labeled monoclonal antibodies have been described for maximization of dose delivered to the tumor while limiting toxicity to normal tissues (Goodwin and Meares Cancer Supplement 1997 80:2675-2680). Other cytotoxic radionuclides including, but not limited to Copper-67, Iodine-131 and Rhenium-186 can also be used for labeling of antibodies against BCSG.

[0043] Antibodies which can be used in these in vivo methods include polyclonal, monoclonal and omniclonal antibodies and antibodies prepared via molecular biology techniques. Antibody fragments and aptamers and single-stranded oligonucleotides such as those derived from an in vitro evolution protocol referred to as SELEX and well known to those skilled in the art can also be used.

Screening Assays

[0044] The present invention also provides methods for identifying modulators which bind to BCSG protein or have a modulatory effect on the expression or activity of BCSG protein. Modulators which decrease the expression or activity of BCSG protein are believed to be useful in treating breast cancer. Such screening assays are known to those of skill in the art and include, without limitation, cell-based assays and cell free assays.

[0045] Small molecules predicted via computer imaging to specifically bind to regions of BCSG can also be designed, synthesized and tested for use in the imaging and treatment of breast cancer. Further, libraries of molecules can be screened for potential anticancer agents by assessing the ability of the molecule to bind to the BCSGs identified herein. Molecules identified in the library as being capable of binding to BCSG are key candidates for further evaluation for use in the treatment of breast cancer. In a preferred embodiment, these molecules will downregulate expression and/or activity of BCSG in cells.

Adoptive Immunotherapy and Vaccines

[0046] Adoptive immunotherapy of cancer refers to a therapeutic approach in which immune cells with an antitumor reactivity are administered to a tumor-bearing host, with the aim that the cells mediate either directly or indirectly, the regression of an established tumor. Transfusion of lymphocytes, particularly T lymphocytes, falls into this category and investigators at the National Cancer Institute (NCI) have used autologous reinfusion of peripheral blood lymphocytes or tumor-infiltrating lymphocytes (TIL), T cell cultures from biopsies of subcutaneous lymph nodules, to treat several human cancers (Rosenberg, S. A., U.S. Pat. No. 4,690,914, issued Sep. 1, 1987; Rosenberg, S. A., et al., 1988, N. England J. Med. 319:1676-1680).

[0047] The present invention relates to compositions and methods of adoptive immunotherapy for the prevention and/or treatment of primary and metastatic breast cancer in humans using macrophages sensitized to the antigenic BCSG molecules, with or without non-covalent complexes of heat shock protein (hsp). Antigenicity or immunogenicity of the BCSG is readily confirmed by the ability of the BCSG protein or a fragment thereof to raise antibodies or educate naive effector cells, which in turn lyse target cells expressing the antigen (or epitope).

[0048] Cancer cells are, by definition, abnormal and contain proteins which should be recognized by the immune system as foreign since they are not present in normal tissues. However, the immune system often seems to ignore this abnormality and fails to attack tumors. The foreign BCSG proteins that are produced by the cancer cells can be used to reveal their presence. The BCSG is broken into short fragments, called tumor antigens, which are displayed on the surface of the cell. These tumor antigens are held or presented on the cell surface by molecules called MHC, of which there are two types: class I and II. Tumor antigens in association with MHC class I molecules are recognized by cytotoxic T cells while antigen-MHC class II complexes are recognized by a second subset of T cells called helper cells. These cells secrete cytokines which slow or stop tumor growth and help another type of white blood cell, B cells, to make antibodies against the tumor cells.

[0049] In adoptive immunotherapy, T cells or other antigen presenting cells (APCs) are stimulated outside the body (ex vivo), using the tumor specific BCSG antigen. The stimulated cells are then reinfused into the patient where they attack the cancerous cells. Research has shown that using both cytotoxic and helper T cells is far more effective than using either subset alone. Additionally, the BCSG antigen may be complexed with heat shock proteins to stimulate the APCs as described in U.S. Pat. No. 5,985,270.

[0050] The APCs can be selected from among those antigen presenting cells known in the art including, but not limited to, macrophages, dendritic cells, B lymphocytes, and a combination thereof, and are preferably macrophages. In a preferred use, wherein cells are autologous to the individual, autologous immune cells such as lymphocytes, macrophages or other APCs are used to circumvent the issue of whom to select as the donor of the immune cells for adoptive transfer. Another problem circumvented by use of autologous immune cells is graft versus host disease which can be fatal if unsuccessfully treated.

[0051] In adoptive immunotherapy with gene therapy, DNA of the BCSG can be introduced into effector cells similarly as in conventional gene therapy. This can enhance the cytotoxicity of the effector cells to tumor cells as they have been manipulated to produce the antigenic protein resulting in improvement of the adoptive immunotherapy.

[0052] BCSG antigens of this invention are also useful as components of breast cancer vaccines. The vaccine comprises an immunogenically stimulatory amount of an BCSG antigen. Immunogenically stimulatory amount refers to that amount of antigen that is able to invoke the desired immune response in the recipient for the amelioration, or treatment of breast cancer. Effective amounts may be determined empirically by standard procedures well known to those skilled in the art.

[0053] The BCSG antigen may be provided in any one of a number of vaccine formulations which are designed to induce the desired type of immune response, e.g., antibody and/or cell mediated. Such formulations are known in the art and include, but are not limited to, formulations such as those described in U.S. Pat. No. 5,585,103. Vaccine formulations of the present invention used to stimulate immune responses can also include pharmaceutically acceptable adjuvants.

EXAMPLES

[0054] The present invention is further described by the following examples. These examples are provided solely to illustrate the invention by reference to specific embodiments. These exemplifications, while illustrating certain specific aspects of the invention, do not portray the limitations or circumscribe the scope of the disclosed invention.

Example 1

Identification of BCSGs via CLASP

[0055] Identification of BCSGs (Breast Cancer Specific Genes) was carried out by a systematic analysis of data in the LIFESEQ Gold (LSGold) database available from Incyte Pharmaceuticals, Palo Alto, Calif. using the data mining Cancer Leads Automatic Search Package (CLASP) developed by diaDexus LLC, Santa Clara Calif.

[0056] The CLASP performs the following steps:

[0057] (1) Selection of highly expressed organ specific genes based on the abundance level of the corresponding EST in the targeted organ versus all the other organs.

[0058] (2) Analysis of the expression level of each highly expressed organ specific gene in normal, tumor tissue, disease tissue and tissue libraries associated with tumor or disease.

[0059] (3) Selection of the candidates wherein component ESTs are exclusively or more frequently found in tumor libraries.

The CLASP allows the identification of highly expressed organ and cancer specific genes. A final manual in depth evaluation is then performed to finalize the Organ Cancer Specific Genes (OCSGs) selection. Table 1 provides the BCSGs of the present invention identified using CLASP.

TABLE-US-00001 TABLE 1 BCSGs BCSG SEQ ID NO: LSGold Clone ID LSGold Gene ID BCSG-1 1 none 332369 BCSG-2 2 or 18 none 480489 BCSG-3 3 or 20 none 274731 BCSG-4 4 none 173388 BCSG-5 5 3040232 411152

Example 2

Determination of mRNA Expression of BCSG-5

[0060] The mRNA expression level of BCSG, BCSG-5 (SEQ ID NO:5, Clone ID 3040232, Gene ID 411152), also referred to as MAM009, in different tissues was analyzed using Real-Time quantitative PCR. The results presented here for BCSG-5 support the usage of CLASP as a tool for identifying cancer diagnostic markers.

[0061] These experiments were carried out using standard techniques, which are well known and routine to those of skill in the art, except where otherwise described in detail. Routine molecular biology techniques were carried out as described in standard laboratory manuals, such as Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).

[0062] Real-Time quantitative PCR with fluorescent Taqman probes is a quantitation detection system utilizing the 5'-3' nuclease activity of Taq DNA polymerase. The method uses an internal fluorescent oligonucleotide probe (Taqman) labeled with a 5' reporter dye and a downstream, 3' quencher dye. During PCR, the 5'-3' nuclease activity of Taq DNA polymerase releases the reporter, whose fluorescence can then be detected by the laser detector of the Model 7700 Sequence Detection System (PE Applied Biosystems, Foster City, Calif., USA).

[0063] Amplification of an endogenous control is used to standardize the amount of sample RNA added to the reaction and normalize for Reverse Transcriptase (RT) efficiency. Either cyclophilin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or 18S ribosomal RNA (rRNA) was used as this endogenous control. To calculate relative quantitation between all the samples studied, the target RNA levels for one sample were used as the basis for comparative results (calibrator). Quantitation relative to the "calibrator" can be obtained using the standard curve method or the comparative method (User Bulletin #2: ABI PRISM 7700 Sequence Detection System).

[0064] The tissue distribution, and the level of the target gene were determined for every sample in normal and cancer tissue. Total RNA was extracted from normal tissues, cancer tissues, and from cancers and the corresponding matched adjacent tissues. Subsequently, first strand cDNA was prepared with reverse transcriptase and the polymerase chain reaction was done using primers and Taqman probe specific to each target gene. The results were analyzed using the ABI PRISM 7700 Sequence Detector. The absolute numbers are relative levels of expression of the target gene in a particular tissue compared to the calibrator tissue.

[0065] Primers used for expression analysis include:

TABLE-US-00002 BCSG-5 forward: ACCCCATTTAGCCTGCCAT (SEQ ID NO: 6) BCSG-5 reverse: ATGGGAGTATCTCATCTGCTCTCA (SEQ ID NO: 7) Q-PCR probe: TGTTTGTTCATTCTTCAATTCCAAGGCTTT (SEQ ID NO: 8)

[0066] The absolute numbers depicted in Table 2 are relative levels of expression of BCSG-5 in 12 normal different tissues. All the values are compared to normal testis (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals.

TABLE-US-00003 TABLE 2 Relative Levels of BCSG-5 Expression in Pooled Samples Tissue NORMAL Brain 0.00 Heart 0.00 Kidney 0.00 Liver 0.00 Lung 0.00 Mammary gland 106.15 Muscle 0.00 Prostate 0.00 Small Intestine 0.00 Testis 1.00 Thymus 0.00 Uterus 0.00

The relative levels of expression in Table 2 show that BCSG-5 mRNA expression is detected in the pool of normal mammary gland and in testis but not in the other 10 normal tissue pools analyzed. The level of expression in mammary gland is more than 100 fold higher than in testis. These results demonstrate that BCSG-5 mRNA expression is highly specific for mammary gland tissue and is also found in testis. Expression in a male specific tissue is not relevant in detecting cancer in female specific tissues.

[0067] The absolute numbers in Table 2 were obtained analyzing pools of samples of a particular tissue from different individuals. They can not be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 3.

[0068] The absolute numbers depicted in Table 3 are relative levels of expression of BCSG-5 in 78 pairs of matching samples. All the values are compared to normal testis (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual. In addition, 2 unmatched cancer samples (from ovary) and 2 unmatched normal samples (from ovary) were also tested.

TABLE-US-00004 TABLE 3 Relative Levels of BCSG-5 Expression in Individual Samples Matching Sample Normal ID Tissue Cancer Adjacent Normal MamS621 Mammary Gland 1 60.37 0.00 MamS516 Mammary Gland 2 1.97 1.09 MamS079 Mammary Gland 3 2.31 2.74 Mam517 Mammary Gland 4 3.42 2.71 Mam59X Mammary Gland 5 0.47 9.56 MamS127 Mammary Gland 6 0.00 2.22 MamB011X Mammary Gland 7 2.52 25.28 Mam522 Mammary Gland 8 109.66 2.67 Mam51DN Mammary Gland 9 11.71 169.77 Mam19DN Mammary Gland 10 369.64 28.24 MamS123 Mammary Gland 11 0.10 1.21 MamS997 Mammary Gland 12 8.80 2.29 Mam162X Mammary Gland 13 7.67 1.08 Mam220 Mammary Gland 14 11.50 53.60 Mam699F Mammary Gland 15 0.52 3.48 Mam42DN Mammary Gland 16 1.39 3.54 Mam76DN Mammary Gland 17 300.03 84.71 MamS854 Mammary Gland 18 2.77 2.64 MamS967 Mammary Gland 19 892.68 4.46 Mam986 Mammary Gland 20 14.40 19.27 MamS699 Mammary Gland 21 2.24 1.43 Mam355 Mammary Gland 22 223.37 0.00 MamA06X Mammary Gland 23 1220.50 2.26 MamS570 Mammary Gland 24 0.00 120.39 MamS918 Mammary Gland 25 181.43 60.30 End12XA Endometrium 1 0.00 0.00 End28XA Endometrium 2 0.00 0.00 End3AX Endometrium 3 0.00 0.00 End4XA Endometrium 4 0.00 0.00 End5XA Endometrium 5 0.00 0.00 End10479 Endometrium 6 0.00 0.00 End65RA Endometrium 7 0.00 0.00 End68X Endometrium 8 0.00 0.00 CvxNKS18 Cervix 1 0.00 0.00 CvxNKS54 Cervix 2 0.00 0.00 CvxNK23 Cervix 3 0.00 0.00 CvxNK24 Cervix 4 0.00 0.00 CvxKS52 Cervix 5 0.00 0.00 CvxKS83 Cervix 6 0.00 0.00 Utr141XO Uterus 1 0.00 0.00 Utr135XO Uterus 2 0.00 0.00 Utr23XU Uterus 3 0.00 0.00 Utr85XU Uterus 4 0.00 0.00 LngC20X Lung 1 0.00 0.00 LngSQ56 Lung 2 0.00 0.00 Lng90X Lung 3 0.00 0.00 LngAC11 Lung 4 0.00 0.00 Pro101XB Prostate 1 0.00 0.00 Pro23B Prostate 2 0.00 0.00 Skn448S Skin 1 0.00 0.00 Skn784S Skin 2 0.00 0.00 ClnSG45 Colon 1 0.00 0.00 ClnTX01 Colon 2 0.00 0.00 ClnAS46 Colon 3 0.00 0.00 ClnAS67 Colon 4 0.00 0.00 BldTR17 Bladder 1 0.00 0.00 Bld66X Bladder 2 0.00 0.00 Kid11XD Kidney 1 0.00 0.00 Kid5XD Kidney 2 0.00 0.00 Kid109XD Kidney 3 0.00 0.00 Liv532L Liver 1 0.00 0.00 Liv175L Liver 2 0.00 0.00 Liv187L Liver 3 0.00 0.00 OvrG010 Ovary 1 0.00 0.00 Ovr1005O Ovary 2 0.00 Ovr1028 Ovary 3 0.00 Ovr103X Ovary 4 0.00 0.00 Ovr18GA Ovary 5 0.00 Ovr206I Ovary 6 0.00 Pan92X Pancreas 1 0.00 0.00 PanC044 Pancreas 2 0.00 0.00 SmIH89 Small Intestine 1 0.00 0.00 SmI21XA Small Intestine 2 0.00 0.00 Sto15S Stomach 1 0.00 0.00 StoAC44 Stomach 2 0.00 0.00 Sto288S Stomach 3 0.00 0.00 Sto531S Stomach 4 0.00 0.00 Thr644T Thyroid 1 0.00 0.00 Thr145T Thyroid 2 0.00 0.00 Thr939T Thyroid 3 0.00 0.00 Tst39X Testis 1 0.00 0.00 Tst663T Testis 2 0.00 0.00 0.00 = Negative

[0069] Among 160 samples in Table 3 representing 17 different tissues significant expression is seen only in mammary gland tissues. These results confirm the tissue specificity results obtained with normal samples shown in Table 2. Table 2 and Table 3 represent a combined total of 172 samples in 21 human tissue types. One hundred and twenty samples representing 20 different tissue types excluding mammary gland had no detectable level of BCSG-5 mRNA. Other than mammary gland, BCSG-5 is detected only in one tissue type (testis) and then only in the pooled tissue sample (Table 2) but not in the matched testis cancer samples (Table 3; testis 1 and 2).

[0070] Comparisons of the level of mRNA expression in breast cancer samples and the normal adjacent tissue from the same individuals are shown in Table 3. BCSG-5 is expressed at higher levels in 12 of 25 (48%) cancer samples (mammary gland 1, 2, 8, 10, 12, 13, 17, 19, 21, 22, 23 and 25) compared to normal adjacent tissue.

[0071] Altogether, the high level of tissue specificity, plus the mRNA overexpression in 48% of the mammary gland matching samples tested are indicative of BCSG-5, and more generally BCSGs selected by CLASP, being good diagnostic markers for breast cancer.

Example 3

Determination of mRNA Expression of BCSG-1

[0072] The mRNA expression level of BCSG, BCSG-1 (SEQ ID NO:1, Gene ID 332369), also referred to as MAM014 were also determined in accordance with methods as set forth in Example 2.

[0073] Real-Time quantitative PCR was done using the following primers:

TABLE-US-00005 BCSG-1 forward: 5'GCCCATTAGCACCCAGATAAT3' (SEQ ID NO: 9) BCSG-2 reverse: 5'GCCAACCCTTCACCTAAGAAA3' (SEQ ID NO: 10) Q-PCR probe 5'CTTCCCACTGTACAAAGATTTTCCAGGATG3' (SEQ ID NO: 11)

[0074] The absolute numbers depicted in Table 4 are relative levels of expression of BCSG-1 in 37 normal samples from 25 different tissues. All the values are compared to normal kidney (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals; except for the blood samples that they are normal samples from a single individual.

TABLE-US-00006 TABLE 4 Relative Levels of BCSG-1 Expression in Pooled Samples Tissue NORMAL Adrenal Gland 1.09 Bladder 0.05 Brain 24.00 Cervix 3.84 Colon 0.00 Endometrium 10.41 Esophagus 0.18 Heart 0.01 Kidney 1.00 Liver 0.02 Lung 4.35 Mammary 1.19 Muscle 0.09 Ovary 23.51 Pancreas 0.86 Prostate 7.75 Rectum 0.33 Small Intestine 0.85 Spleen 17.51 Stomach 2.42 Testis 111.04 Thymus 9.95 Trachea 6.43 Uterus 0.68 Blood 1 34.42 Blood 2 0.00 Blood 3 21.19 Blood 4 25.19 Blood 5 51.09 Blood 6 1144.10 Blood 7 59.10 Blood 8 60.13 Blood 9 37.53 Blood 10 0.00 Blood 11 15.30 Blood 12 0.00 Blood 13 0.00

[0075] The relative levels of expression in Table 4 show that BCSG-1 mRNA expression is detected in the pool of normal mammary gland as well as in the other normal tissue analyzed.

[0076] The absolute numbers in Table 5 were obtained analyzing pools of samples of a particular tissue from different individuals, except for the blood samples. They can not be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 5.

[0077] The absolute numbers depicted in Table 5 are relative levels of expression of BCSG-1 in 77 pairs of matching samples. All the values are compared to normal kidney (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual. In addition, 3 unmatched cancer samples (from ovary) and 3 unmatched normal samples (from ovary) were also tested.

TABLE-US-00007 TABLE 5 Relative Levels of BCSG-1 Expression in Individual Samples Matching Sample Normal ID Tissue Cancer Adjacent Normal MamS621 Mammary Gland 1 7.48 0.00 MamS516 Mammary Gland 2 0.90 0.00 Mam173M Mammary Gland 3 3.96 0.00 Mam497M Mammary Gland 4 9.71 0.00 MamS079 Mammary Gland 5 1.72 0.00 Mam517 Mammary Gland 6 8.88 3.35 Mam726M Mammary Gland 7 3.04 0.00 Mam59X Mammary Gland 8 7.01 15.73 MamS127 Mammary Gland 9 24.59 0.00 MamB011X Mammary Gland 10 8.43 1.14 MamS22 Mammary Gland 11 14.55 0.00 Mam15DN Mammary Gland 12 4.16 0.00 Mam51DN Mammary Gland 13 32.90 3.11 Mam976M Mammary Gland 14 6.17 0.00 Mam543M Mammary Gland 15 34.42 0.32 Mam245M Mammary Gland 16 10.82 0.00 MamS123 Mammary Gland 17 0.37 0.00 MamS997 Mammary Gland 18 0.56 0.00 Mam162X Mammary Gland 19 6.09 0.52 Mam220 Mammary Gland 20 2.08 0.58 Mam699F Mammary Gland 21 6.75 6.36 Mam42DN Mammary Gland 22 10.16 0.00 Mam76DN Mammary Gland 23 31.23 4.68 MamS854 Mammary Gland 24 6.11 0.00 MamS967 Mammary Gland 25 86.22 0.00 Mam986 Mammary Gland 26 13.36 9.00 MamS699 Mammary Gland 27 4.52 0.00 Mam355 Mammary Gland 28 107.38 0.00 MamA06X Mammary Gland 29 43.26 0.00 MamS570 Mammary Gland 30 68.36 64.22 MamS918 Mammary Gland 31 2.49 0.86 Bld66X Bladder 0.00 3.24 ClnTX01 Colon 1 0.55 0.00 ClnAS43 Colon 2 1.11 0.00 ClnAS49 Colon 3 0.69 0.60 ClnRS45 Colon 4 0.00 0.00 CvxNK24 Cervix 1 2.53 0.69 CvxNKS54 Cervix 2 1.71 0.54 CvxNK23 Cervix 3 0.34 0.00 CvxNKS81 Cervix 4 0.00 0.00 End5XA Endometrium 1 1.16 2.85 End8911 Endometrium 2 2.62 1.65 End8963 Endometrium 3 6.50 0.00 End28XA Endometrium 4 1.75 1.33 End65RA Endometrium 5 0.45 0.00 End12XA Endometrium 6 34.80 3.55 End3AX Endometrium 7 0.00 0.00 Kid11XD Kidney 1 0.94 1.42 Kid124D Kidney 2 1.35 0.00 Liv532L Liver 1 0.33 0.00 Liv390L Liver 2 0.66 0.00 LngSQ56 Lung 1 0.00 0.00 Lng223L Lung 2 0.20 0.00 LngLC71 Lung 3 7.67 8.20 LngAC90 Lung 4 11.70 0.98 Lng75XC Lung 5 0.00 0.00 OvrA082 Ovary 1 21.33 42.96 OvrA082 Ovary 2 52.68 186.62 Ovr103X Ovary 3 44.88 17.67 Ovr1005O Ovary 4 6.89 Ovr1028 Ovary 5 0.44 Ovr1040O Ovary 6 0.80 Ovr18GA Ovary 7 6.63 Ovr206I Ovary 8 1.46 Ovr20GA Ovary 9 5.96 Pan92X Pancreas 1 0.00 0.00 Pan77X Pancreas 2 0.24 0.00 Pro23B Prostate 1 0.80 0.00 Pro13XB Prostate 2 0.05 17.75 Skn448S Skin 1 0.00 0.00 Skn784S Skin 2 0.13 0.11 SmIntH89 Small Intestine 1 0.00 0.00 Sto264S Stomach 1 0.80 1.15 Sto15S Stomach 2 0.23 2.29 Sto27S Stomach 3 1.07 1.35 Thr644T Thyroid 1 0.00 0.00 Thr143T Thyroid 2 0.58 0.00 Tst663T Testis 1 5.46 1.80 Tst647T Testis 2 1.27 5.68 Utr23XU Uterus 1 9.38 1.17 Utr85XU Uterus 2 4.36 2.17 Utr141XO Uterus 3 0.00 0.00 Utr135XO Uterus 4 7.53 10.10 0.00 = Negative

[0078] Table 5 represents 160 samples in 17 different tissues. Table 4 and Table 5 represent a combined total of 197 samples in 27 human tissue types. Comparisons of the level of mRNA expression in breast cancer samples and the normal adjacent tissue from the same individuals are shown in Table 5. BCSG-1 is expressed at higher levels in 27 of 30 (90%) cancer samples (mammary gland 1-7, 9-20, 22-25, 27-29, and 31) compared to normal adjacent tissue.

Example 4

Determination of mRNA Expression of BCSG-2

[0079] The mRNA expression level of BCSG, BCSG-2 (SEQ ID NO:2 or 18, Gene ID 480489), also referred to as MAM013 were also determined in accordance with methods as set forth in Example 2.

[0080] Real-Time quantitative PCR was done using the following primers:

TABLE-US-00008 BCSG-2 forward: 5'CCTGGAGTTTTCAATTTCCTCA3' (SEQ ID NO: 12) BCSG-2 reverse: 5'CCCCAGAGAAAACACCACAA3' (SEQ ID NO: 13) Q-PCR probe 5'ACTCCTCCATTTCCTTAGGTAGGGGTTTG3' (SEQ ID NO: 14)

[0081] The absolute numbers depicted in Table 6 are relative levels of expression of BCSG-2 in 37 normal samples from 25 different tissues. All the values are compared to normal liver (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals, except for the blood samples that they are normal samples from a single individual.

TABLE-US-00009 TABLE 6 Relative Levels of BCSG-2 Expression in Pooled Samples Tissue NORMAL Adrenal Gland 0.00 Bladder 0.00 Brain 0.00 Cervix 0.00 Colon 0.00 Endometrium 0.33 Esophagus 0.00 Heart 0.02 Kidney 0.28 Liver 1.00 Lung 0.07 Mammary 20.39 Muscle 0.00 Ovary 0.00 Pancreas 0.05 Prostate 0.26 Rectum 0.00 Small Intestine 0.00 Spleen 0.00 Stomach 0.12 Testis 1.55 Thymus 0.55 Trachea 1.23 Uterus 0.00 Blood 1 0.00 Blood 2 0.00 Blood 3 0.00 Blood 4 0.00 Blood 5 6.17 Blood 6 0.00 Blood 7 0.00 Blood 8 0.00 Blood 9 16.97 Blood 10 0.00 Blood 11 77.98 Blood 12 0.00 Blood 13 0.00

[0082] The relative levels of expression in Table 6 show that BCSG-2 mRNA expression is detected in the pool of normal mammary gland. The level of expression is higher than in the other tissues with the exception of two blood samples.

[0083] The absolute numbers in Table 6 were obtained analyzing pools of samples of a particular tissue from different individuals, except for the blood samples. They can not be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 7.

[0084] The absolute numbers depicted in Table 7 are relative levels of expression of BCSG-2 in 76 pairs of matching samples. All the values are compared to normal liver (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual. In addition, 3 unmatched cancer samples (from ovary) and 3 unmatched normal samples (from ovary) were also tested.

TABLE-US-00010 TABLE 7 Relative Levels of BCSG-2 Expression in Individual Samples Matching Sample Normal ID Tissue Cancer Adjacent Normal MamS621 Mammary Gland 1 0.00 0.00 Mam173M Mammary Gland 2 7.21 0.00 Mam497M Mammary Gland 3 1634.92 31.12 MamS079 Mammary Gland 4 42.56 1.39 Mam517 Mammary Gland 5 2.42 4.21 Mam726M Mammary Gland 6 0.00 6.75 Mam59X Mammary Gland 7 0.00 16.11 MamS127 Mammary Gland 8 5.31 0.00 MamB011X Mammary Gland 9 0.87 182.28 Mam522 Mammary Gland 10 480.47 0.18 Mam19DN Mammary Gland 11 4.79 0.22 Mam51DN Mammary Gland 12 19.49 72.76 Mam976M Mammary Gland 13 62.25 0.00 Mam543M Mammary Gland 14 103.97 0.00 Mam245M Mammary Gland 15 49.01 615.24 MamS123 Mammary Gland 16 0.42 1.27 MamS997 Mammary Gland 17 0.24 0.66 Mam162X Mammary Gland 18 0.45 1.39 Mam220 Mammary Gland 19 0.00 0.00 Mam699F Mammary Gland 20 0.00 12.38 Mam42DN Mammary Gland 21 44.48 11.47 Mam76DN Mammary Gland 22 9.32 26.26 MamS854 Mammary Gland 23 6.50 103.61 MamS967 Mammary Gland 24 3.36 5.13 Mam986 Mammary Gland 25 7.67 65.12 MamS699 Mammary Gland 26 1.68 11.63 Mam355 Mammary Gland 27 1.32 0.00 MamA06X Mammary Gland 28 1.73 0.26 MamS570 Mammary Gland 29 0.00 194.69 MamS918 Mammary Gland 30 0.07 0.13 Bld66X Bladder 0.00 0.00 ClnTX01 Colon 1 0.00 0.00 ClnAS43 Colon 2 0.00 0.00 ClnAS49 Colon 3 0.00 0.00 ClnRS45 Colon 4 0.00 0.01 CvxNK24 Cervix 1 0.00 0.00 CvxNKS54 Cervix 2 0.00 0.00 CvxNK23 Cervix 3 0.02 0.00 CvxNKS81 Cervix 4 0.00 0.00 End5XA Endometrium 1 0.00 0.00 End8911 Endometrium 2 0.00 0.00 End8963 Endometrium 3 0.00 0.00 End28XA Endometrium 4 0.05 0.00 End65RA Endometrium 5 0.00 0.00 End12XA Endometrium 6 0.23 0.00 End3AX Endometrium 7 0.00 0.05 Kid11XD Kidney 1 0.04 0.00 Kid124D Kidney 2 0.37 0.00 Liv532L Liver 1 0.00 2.02 Liv390L Liver 2 0.08 0.56 Lng223L Lung 1 0.00 0.00 LngLC71 Lung 2 0.00 0.00 LngSQ56 Lung 3 0.00 0.00 LngAC90 Lung 4 0.00 0.00 Lng75XC Lung 5 0.00 0.00 OvrA082 Ovary 1 0.00 0.00 OvrA082 Ovary 2 0.00 0.00 Ovr103X Ovary 3 0.07 0.00 Ovr1005O Ovary 4 1.09 Ovr1028 Ovary 5 0.00 Ovr1040O Ovary 6 0.00 Ovr18GA Ovary 7 0.00 Ovr206I Ovary 8 0.00 Ovr20GA Ovary 9 0.00 Pan92X Pancreas 1 0.00 0.00 Pan77X Pancreas 2 1.91 1.11 Pro23B Prostate 1 0.01 0.00 Pro13XB Prostate 2 0.00 0.00 Skn448S Skin 1 0.00 0.00 Skn784S Skin 2 0.00 0.00 SmIntH89 Small Intestine 1 0.00 0.02 Sto264S Stomach 1 0.00 0.00 Sto15S Stomach 2 0.04 0.00 Sto27S Stomach 3 0.00 0.00 Thr644T Thyroid 1 0.00 0.12 Thr143T Thyroid 2 0.03 3.73 Tst663T Testis 1 0.09 0.00 Tst647T Testis 2 0.55 0.00 Utr23XU Uterus 1 0.00 0.00 Utr85XU Uterus 2 0.00 2.85 Utr141XO Uterus 3 0.04 0.00 Utr135XO Uterus 4 0.17 0.12 0.00 = Negative

[0085] Table 7 represents 158 samples in 17 different tissues. Table 6 and Table 7 represent a combined total of 195 samples in 25 human tissue types. Comparisons of the level of mRNA expression in breast cancer samples and the normal adjacent tissue from the same individuals are shown in Table 7. BCSG-2 is expressed at higher levels in 11 of 30 (37%) cancer samples (mammary gland 2-4, 8, 10, 11, 13, 14, 21, 27, 28) compared to normal adjacent tissue.

Example 5

Determination of mRNA Expression of BCSG-3

[0086] The mRNA expression level of BCSG, BCSG-3 (SEQ ID NO:3 or 20, Gene ID 274731), also referred to as MAM017 were also determined in accordance with methods as set forth in Example 2.

[0087] Real-Time quantitative PCR was done using the following primers:

TABLE-US-00011 BCSG-3 forward: 5'GAGCACTTCCTTTTGGTTTTTC3' (SEQ ID NO: 15) BCSG-3 reverse: 5'GCCCTAGCATATTCCAGAAGTTC3' (SEQ ID NO: 16) Q-PCR probe 5'TAGACAGTGGGCTCACATGTTCCTG (SEQ ID NO: 17) ATAGTG3'

[0088] The absolute numbers depicted in Table 8 are relative levels of expression of BCSG-3 in 36 normal samples from 25 different tissues. All the values are compared to normal prostate (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals, except for the blood samples that they are normal samples from a single individual.

TABLE-US-00012 TABLE 8 Relative Levels of BCSG-3 Expression in Pooled Samples Tissue NORMAL Adrenal Gland 0.16 Bladder 0.02 Brain 0.12 Cervix 1.41 Colon 0.01 Endometrium 3.77 Esophagus 0.03 Heart 0.02 Kidney 0.07 Liver 0.00 Lung 0.59 Mammary 7.67 Muscle 0.08 Ovary 0.94 Pancreas 0.14 Prostate 1.00 Rectum 0.13 Small Intestine 0.05 Spleen 0.89 Stomach 0.17 Testis 0.20 Thymus 0.56 Trachea 0.39 Uterus 1.22 Blood 1 1.91 Blood 2 1.76 Blood 3 0.76 Blood 4 0.18 Blood 5 1.41 Blood 6 1.54 Blood 7 0.48 Blood 8 1.92 Blood 9 1.63 Blood 10 1.65 Blood 11 1.83 Blood 12 0.37

[0089] The relative levels of expression in Table 8 show that BCSG-3 mRNA expression is detected in the pool of normal mammary gland with the highest expression value.

[0090] The absolute numbers in Table 8 were obtained analyzing pools of samples of a particular tissue from different individuals, except for the blood samples. They can not be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 9.

[0091] The absolute numbers depicted in Table 9 are relative levels of expression of BCSG-3 in 68 pairs of matching samples. All the values are compared to normal prostate (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual. In addition, 1 unmatched cancer sample (from ovary) and 1 unmatched normal sample (from ovary) were also tested.

TABLE-US-00013 TABLE 9 Relative Levels of BCSG-3 Expression in Individual Samples Matching Sample Normal ID Tissue Cancer Adjacent Normal Mam497M Mammary Gland 1 3.22 1.11 Mam173M Mammary Gland 2 1.39 17.75 Mam726M Mammary Gland 3 7.62 1.31 MamS516 Mammary Gland 4 11.08 0.10 MamS621 Mammary Gland 5 18.25 0.05 MamS079 Mammary Gland 6 0.78 0.24 Mam19DN Mammary Gland 7 71.01 1.39 Mam522 Mammary Gland 8 3.35 0.16 MamS127 Mammary Gland 9 48.00 0.48 Mam162X Mammary Gland 10 0.18 0.65 MamS123 Mammary Gland 11 49.69 0.00 MamS997 Mammary Gland 12 141.53 0.48 Mam543M Mammary Gland 13 34.66 0.10 Mam976M Mammary Gland 14 0.37 0.10 Mam74DN Mammary Gland 15 35.14 4.36 MamS918 Mammary Gland 16 16.74 5.58 MamS854 Mammary Gland 17 1.11 1.58 Mam986 Mammary Gland 18 0.58 1.14 MamS967 Mammary Gland 19 121.94 2.97 Mam355 Mammary Gland 20 11.35 0.06 MamA06X Mammary Gland 21 7.65 0.13 Bld32XK Bladder 1 0.17 0.02 Bld66X Bladder 2 0.17 0.13 BldTR17 Bladder 3 6.21 0.00 Bld46XK Bladder 4 0.06 0.00 BldTR14 Bladder 5 0.79 0.19 ClnB56 Colon 1 0.12 0.10 ClnDC63 Colon 2 0.21 1.09 CvxKS52 Cervix 1 10.74 2.21 CvxNK24 Cervix 2 6.96 4.63 CvxKS83 Cervix 3 2.29 2.23 CvxNK23 Cervix 4 0.22 1.54 End10479 Endometrium 1 4.68 5.13 End12XA Endometrium 2 1.68 2.00 End5XA Endometrium 3 0.38 0.40 End65RA Endometrium 4 0.49 0.38 End28XA Endometrium 5 4.32 2.94 End3AX Endometrium 6 0.21 0.21 Kid6XD Kidney 1 0.06 0.16 Kid710K Kidney 2 0.03 0.10 Liv175L Liver 1 1.24 0.09 Liv187L Liver 2 0.07 0.06 Liv15XA Liver 3 0.02 0.01 Lng47XQ Lung 1 0.15 0.06 LngAC88 Lung 2 1.78 0.95 LngAC90 Lung 3 0.46 0.00 LngSQ80 Lung 4 1.91 0.35 Ovr103X Ovary 1 25.63 2.52 OvrA084 Ovary 2 7.70 3.19 OvrG010 Ovary 3 0.62 3.40 OvrG021 Ovary 4 0.09 0.45 Ovr1118 Ovary 5 0.13 Ovr32RA Ovary 6 2.81 Pan77X Pancreas 1 0.56 0.19 Pan82XP Pancreas 2 0.62 0.73 Pro109XB Prostate 1 0.00 0.10 Pro125XB Prostate 2 0.05 0.01 Skn248S Skin 1 0.94 0.02 Skn287S Skin 2 0.36 0.05 SmIntH89 Small Intestine 1 0.12 0.04 SmInt21XA Small Intestine 2 0.29 0.01 Sto115S Stomach 1 1.17 0.44 Sto15S Stomach 2 0.15 0.18 StoMT54 Stomach 3 0.12 0.18 Thr590D Thyroid 3.46 3.33 Tst647T Testis 1.06 0.24 Utr141XO Uterus 1 2.86 0.51 Utr23XU Uterus 2 0.60 0.13 Utr85XU Uterus 3 12.21 1.43 Utr135XO Uterus 4 2.98 3.93 0.00 = Negative

[0092] Table 9 represents 138 samples in 17 different tissues. Table 8 and Table 9 represent a combined total of 174 samples in 26 human tissue types.

[0093] Comparisons of the level of mRNA expression in breast cancer samples and the normal adjacent tissue from the same individuals are shown in Table 8. BSCG-3 is expressed at higher levels in 17 of 21 (81%) cancer samples (mammary gland 1, 3-6, 7-9, 11-16, 19-21) compared to normal adjacent tissue.

Sequence CWU 1

1

2111078DNAHomo sapien 1ggatgataca agagccaaga agggacattt gagttgtgtc gcttagatag gaaagggatc 60cagggaaaat caacagtaag tgaggatgag cagcgtctct tggttttcat tgaggataga 120gtaagagatt gagtttagat tgcaacagaa ggaattagtt tagataccag gaagaacttc 180ctagcctgaa gatttgtcat agtgtctgct ttctagatat ctgggaaaga tttgataata 240gttgtttgtg aatagaaagg aggatatgat gtttttattg gccattttgc gggactcttc 300gacttcttgc tgctgtctct tgaggataca ttccaattcc atcctggcga gatccaagtg 360cttacgtact gtctccttag ctgccttaga gtaaacgatc atcagttcaa tggaccaaaa 420tcaccttcag ccatgtggtt tcttcatcat catggatttc ttttggttga caaacattct 480ggctctcaga tgcaaaaagt cacactggga aatgaactgt aagtggtgaa attagttttg 540gtatttaatt taaaactaca ttttagtttt tctcttctct tctatgttgc aatgaatgta 600aagtatttgg gatccagtgc ttataaacct ttccttcctt tgtgcacaga atgtaactag 660caagcccatt agcacccaga taattctatc atgttagttt cccatcctgg aaaatctttg 720tacagtggga agttccccga tgtgtttttc tttcttaggt gaagggttgg ctatatcact 780ttattgaatt ttgcattcct tagactttta aaatatacta atgtattcta gtcttactct 840aaagaccttt gatgttaaag gaatccttca tttatttcat attccctatc tcatagggcc 900acaattattt taatacagag atgattttca aaatatttta acaactggta caggacagat 960gccagccact cagaagggat gcctgctgta aacaagcagt atgtatggtt gtaccaatgc 1020ctattggctg aacattatgc tactttcaga tattaaaatg gtgttccttt gaatcgtg 107821713DNAHomo sapien 2atcgcattgc accaggatga ctctgaaatg gacttcagtt cttctgctga tacatctcca 60gttgttactt tagctctggg agttgtggaa aagtgctggt gtgggccgca gaatacagcc 120attggatgaa tatgaagaca atcctgaaag agcttgttca gagaggtcat gaggtgactg 180tactggcatc ttcagcttcc attctttttg atcccaatga tgcatccact cttaaatttg 240aagtttatcc tacatcttta actaaaactg aatttgagaa tatcatcatg caacaggtta 300agagatggtc agacattcga aaagatagct tttggttata tttttcacaa gaacaagaaa 360tcctgtggga attatatgac atatttagaa acttctgtaa agatgtagtt tcaaataaga 420aagttatgaa aaaactacaa gagtcaagat ttgacatcgt ttttgcagat gctgtttttc 480cctgtggtga gctgctggct gcgctactta acatacggtt tgtgtacagt ctccgcttta 540ctcctggcta cacaattgaa aggcacagtg gaggactgat tttccctcct tcctacatac 600ctattgttat gtcaaaatta agtgatcaaa tgactttcat ggagagggta aaaaatatga 660tctatgtgct ttattttgac ttttggttcc aaatgtctga tatgaagaag tgggatcagt 720tttacagtga agttttagga agacccacta ccttatttga gacaatggga aaagctgaca 780tatggcttat gcgaaactcc tggagttttc aatttcctca tccattctta ccaaacgttg 840attttgttgg aggattccac tggcaaacct gccaaacccc tacctaagga aatggaggag 900tttgtacaga gctctggaga aaatggtgtt gtggtgtttt ctctggggtc agtgataagt 960aacatgacag cagaaagggc caatgtaatt gcaacagccc ttgccaagat cccacaaaag 1020gttctgtgga gatttgatgg gaataaacca gatgccttag gtctcaatac tcggctgtat 1080aagtggatac cccagaatga ccttctaggt catccaaaaa ccagagcttt tataactcat 1140ggtggagcca atggcatcta tgaggcaatc taccatggga tccctatggt gggcattcca 1200ttgttttggg atcaacctga taacattgct cacatgaagg ccaagggagc agctgttaga 1260ttggacttca acacaatgtc gagtacagac ctgctgaatg cactgaagac agtaattaat 1320gatcctttat ataaagagaa tattatgaaa ttatcaagaa ttcaacatga tcaaccagta 1380aagcccctgg atcgagcagt cttctggatt gaatttgtca tgccccacaa aggagccaaa 1440caccttcgag ttgcagccca tgacctcacc tggttccagt accactcttt ggatgtgatt 1500gggtttctgc tggcctgtgt ggcaactgtg atatttatca tcacaaagtt ttgtctgttt 1560tgtttctgga agtttgctag aaaagggaag aagggaaaaa gagattagtt atgtctgaca 1620tttgaagctg gaaaaccaga tagataggac aacttcagtt tattccagca agaaagaaaa 1680gattgttatg caagatttct ttcttcctgt gac 171332327DNAHomo sapienmisc_feature(924)..(924)n is a, c, g, or t 3gatggatgca tctcaaaatg tatagccaga cttgagaggt gacaattaaa gatctaaaaa 60agagaggaga ttcccccaaa caacaatatt taattttctt agtaaaaaga ataacagaat 120gcatcgtggc aatccttaag caacattatc tatgtggact gcttaaatca gcaaaacacc 180agaagtttgg ttaacttggg caatatgaca agtattactt tttgggcaaa actactcatt 240aagcaatttc tctagtgtgt cggacacaaa taggttcttt atttttggca tgtatgcctt 300tttattttca ttcaattttt tttttttctc agacagacat agtagtaacg actagcattg 360gaaaatacat atcactattc ttggaatatt tatggtcagt ctacttttta gtagaatatt 420tttggatagc gttgacacga tagatcttat tccatacttc tttattattg ataattttat 480tttcattttt tgctttcatt attatacata ttttggtgga gaagaggttg ggcttttttg 540aaagagacaa aaatttatta taacactaaa cactcctttt ttgacatatt aaagccttta 600ttccatctct caagatatat tataaaattt atttttttaa tttaagattt ctgaattatt 660ttatcttaaa ttgtgatttt aaacgagcta ttatggtacg gaactttttt taatgaggaa 720tttcatgatg atttaggaat tttctctctt ggaaaaggct tcccctgtga tgaaaatgat 780gtgccagcta aaattgtgtg ccatttaaaa actgaaaata ttttaaaatt atttgtctat 840attctaaatt gagctttgga tcaaacttta ggccaggacc agctcatgcg ttctcattct 900tccttttctc actctttctc tcancactca cctctgtatt cattctgttg tttgggatag 960aaaaatcata aagagccaac ccatctcaga acgttgtgga ttgagagaga cactacatga 1020ctccaagtat atgagaaaag gacagagctc taattgataa ctctgtagtt caaaaggaaa 1080agagtatgcc caattctctc tacatgacat attgagattt tttttaatca acttttaaga 1140tagtgatgtt ctgttctaaa ctgttctgtt ttagtgaagg tagattttta taaaacaagc 1200atggggattc ttttctaagg taatattaat gagaagggaa aaaagtatct ttaacagctc 1260tttgttgaag cctgtggtag cacattatgt ttataattgc acatgtgcac ataatctatt 1320atgatccaat gcaaatacag ctccaaaaat attaaatgta tatatatttt aaaatgcctg 1380aggaaataca tttttcttaa taaactgaag agtctcagta tggctattaa aataattatt 1440agcctcctgt tgtgtggctg caaaacatca caaagtgacc ggtcttgaga cctgtgaact 1500gctgccctgt ttagtaaata aaattaatgc atttctagag ggggaatatc tgccatccag 1560tggtggaaat gtggagtaaa gaagctggtg gtctgcttct gtgctgtatg ccagcctttt 1620gccttaagtt gagaggaggt caactttagc tactgtcttt ggtttgagag ccatggcnnn 1680nnnnnnnnnn nnnnnnnnnn nnnngtcgtc tttggtgagc cagtaaggtg aaagcttgct 1740gactgtccaa ggcacaagag aaaattgagg aattgaaatg caacctgagt atcaaactaa 1800atattctaat caaaggtagg tactgttagg tggaattcta tcagcaggca actgcaaatg 1860agaagaagat agaaggacgc ccgtcgggac tttggagggc agtgttattt tcccaaagaa 1920agacggccaa gggcagaggc atggattctt tgcagagcac ttccttttgg tttttcagta 1980ctgtttcata gacagtgggc tcacatgttc ctgatagtgc tgcagttgct tagaaagcat 2040cccagttatt gcagtaatta gaacttctgg aatatgctag ggcagaagta tgtcaagtat 2100gtcacatgaa gaaaatgtga aattcaagag taatccacac gtgagaaact agacaatgta 2160cattcatgtg ttctcttgaa aggaaaggga gagctgtaag cttcactctg tcctacaccg 2220gagaaaagca ggaataactt taccgtggaa ataatgttta gcttttatgc agagaaaatt 2280gtccttccta gagcatagag tcccaaaact caattctggt tttcccc 23274639DNAHomo sapien 4ccagaaccga gtttaggtcc aggttctcgt tctggcaaat ctttctcctt accttcttcc 60tccacccctc cacctatgcc atgttttccc ttagccactc cccagctcgg tggaggaaag 120gcaggcctaa ctaggtaccg tcttcccgac tttgctcaat gatagctggg tgggtctagc 180tgggttccag ccacttgtaa tgtgggacat ctctcacccc aactttgtag gtggagcaac 240tgctacagag gtaaatatga ttaactttac attccatctt tcgtctgctc ccaaacttaa 300cagcaggtaa tctgcttcta gcaagtggtg aaggtaagag aagcatctgt ataggaggca 360agagatctga gtccttttga aggcctatcc tctgctctgt atctcaatta ctgttcttca 420tttcaattat tcttacctac tattcagttc ccttgatctt ttcttcttgg gggctgtctt 480agggtcaggg agattgcaga agcaccagaa ctaggagcag ccctgagaca tggggagttg 540gagctgaagg aggaatggca ggatgaagaa ttccctaggt gaggacgtgt gagggtggct 600gggagaaggg aggggtggtc acgaatggac ggaggggat 6395779DNAHomo sapien 5gtatacattc tttattaatc attttgcttc caaccccatt tagcctgcca ttgaaatgca 60aaagtctgtt ccaaataaag ccttggaatt gaagaatgaa caaacattga gagcagatga 120gatactccca tcagaatcca aacaaaagga ctatgaagaa agttcttggg attctgagag 180tctctgtgag actgtttcac agaaggatgt gtgtttaccc aaggctacac atcaaaaaga 240aatagataaa ataaatggaa aattagaagg gtctcctgtt aaagatggtc ttctgaaggc 300taactgcgga atgaaagttt ctattccaac taaagcctta gaattgatgg acatgcaaac 360tttcaaagca gagcctcccg agaagccatc tgccttcgag cctgccattg aaatgcaaaa 420gtctgttcca aataaagcct tggaattgaa gaatgaacaa acattgagag cagatcagat 480gttcccttca gaatcaaaac aaaagaaggt tgaagaaaat tcttgggatt ctgagagtct 540ccgtgagact gtttcacaga aggatgtgtg tgtacccaag gctacacatc aaaaagaaat 600ggataaaata agtggaaaat tagaagattc aactagccta tcaaaaatct tggatacagt 660tcattcttgt gaaagagcaa gggaacttca aaaagatcac tgtgaacaac gtacaggaaa 720aatggaacaa atgaaaaaga agttttgtgt actgaaaaag aaactgtcag aagcaaaaa 779619DNAArtificial SequenceSynthetic 6accccattta gcctgccat 19724DNAArtificial SequenceSynthetic 7atgggagtat ctcatctgct ctca 24830DNAArtificial SequenceSynthetic 8tgtttgttca ttcttcaatt ccaaggcttt 30921DNAArtificial SequenceSynthetic 9gcccattagc acccagataa t 211021DNAArtificial SequenceSynthetic 10gccaaccctt cacctaagaa a 211130DNAArtificial SequenceSynthetic 11cttcccactg tacaaagatt ttccaggatg 301222DNAArtificial SequenceSynthetic 12cctggagttt tcaatttcct ca 221320DNAArtificial SequenceSynthetic 13ccccagagaa aacaccacaa 201429DNAArtificial SequenceSynthetic 14actcctccat ttccttaggt aggggtttg 291522DNAArtificial SequenceSynthetic 15gagcacttcc ttttggtttt tc 221623DNAArtificial SequenceSynthetic 16gccctagcat attccagaag ttc 231731DNAArtificial SequenceSynthetic 17tagacagtgg gctcacatgt tcctgatagt g 31181722DNAHomo sapien 18tgcaccagga tgactctgaa atggacttca gttcttctgc tgatacatct cagttgttac 60tttagctctg ggagttgtgg aaaagtgctg gtgtgggccg cagaatacag ccattggatg 120aatatgaaga caatcctgaa agagcttgtt cagagaggtc atgaggtgac tgtactggca 180tcttcagctt ccattctttt tgatcccaat gatgcatcca ctcttaaatt tgaagtttat 240cctacatctt taactaaaac tgaatttgag aatatcatca tgcaacaggt taagagatgg 300tcagacattc gaaaagatag cttttggtta tatttttcac aagaacaaga aatcctgtgg 360gaattatatg acatatttag aaacttctgt aaagatgtag tttcaaataa gaaagttatg 420aaaaaactac aagagtcaag atttgacatc gtttttgcag atgctgtttt tccctgtggt 480gagctgctgg ctgcgctact taacatacgg tttgtgtaca gtctccgctt tactcctggc 540tacacaattg aaaggcacag tggaggactg attttccctc cttcctacat acctattgtt 600atgtcaaaat taagtgatca aatgactttc atggagaggg taaaaaatat gatctatgtg 660ctttattttg acttttggtt ccaaatgtct gatatgaaga agtgggatca gttttacagt 720gaagttttag gaagacccac taccttattt gagacaatgg gaaaagctga catatggctt 780atgcgaaact cctggagttt tcaatttcct catccattct taccaaacgt tgattttgtt 840ggaggattcc actgcaaacc tgccaaaccc ctacctaagg aaatggagga gtttgtacag 900agctctggag aaaatggtgt tgtggtgttt tctctggggt cagtgataag taacatgaca 960gcagaaaggg ccaatgtaat tgcaacagcc cttgccaaga tcccacaaaa ggttctgtgg 1020agatttgacg ggaataaacc agatgcctta ggtctcaata ctcggctgta caagtggata 1080ccccagaatg accttctagg tcatccaaaa accagagctt ttataactca tggtggagcc 1140aatggcatct atgaggcaat ctaccatggg atccctatgg tgggcattcc attgtttttt 1200gatcaacctg ataacattgc tcacatgaag gccaagggag cagctgttag attggacttc 1260aacacaatgt cgagtacaga cctgctgaat gcactgaaga cagtaattaa tgatccttta 1320tataaagaga atattatgaa attatcaaga attcaacatg atcaaccagt aaagcccctg 1380gatcgagcag tcttctggat tgaatttgtc atgccccaca aaggagccaa acaccttcga 1440gttgcagccc atgacctcac ctggttccag taccactctt tggatgtgat tgggtttctg 1500ctggcctgtg tggcaactgt gatatttatc atcacaaagt tttgtctgtt ttgtttctgg 1560aagtttgcta gaaaagggaa gaagggaaaa agagattagt tatgtctgac atttgaagct 1620ggaaaaccag atagatagga caacttcagt ttattccagc aagaaagaaa agattgttat 1680gcaagatttc tttcttcctg tgacaaaaaa aaaaaaaaaa aa 172219529PRTHomo sapien 19Met Thr Leu Lys Trp Thr Ser Val Leu Leu Leu Ile His Leu Ser Cys1 5 10 15Tyr Phe Ser Ser Gly Ser Cys Gly Lys Val Leu Val Trp Ala Ala Glu20 25 30Tyr Ser His Trp Met Asn Met Lys Thr Ile Leu Lys Glu Leu Val Gln35 40 45Arg Gly His Glu Val Thr Val Leu Ala Ser Ser Ala Ser Ile Leu Phe50 55 60Asp Pro Asn Asp Ala Ser Thr Leu Lys Phe Glu Val Tyr Pro Thr Ser65 70 75 80Leu Thr Lys Thr Glu Phe Glu Asn Ile Ile Met Gln Gln Val Lys Arg85 90 95Trp Ser Asp Ile Arg Lys Asp Ser Phe Trp Leu Tyr Phe Ser Gln Glu100 105 110Gln Glu Ile Leu Trp Glu Leu Tyr Asp Ile Phe Arg Asn Phe Cys Lys115 120 125Asp Val Val Ser Asn Lys Lys Val Met Lys Lys Leu Gln Glu Ser Arg130 135 140Phe Asp Ile Val Phe Ala Asp Ala Val Phe Pro Cys Gly Glu Leu Leu145 150 155 160Ala Ala Leu Leu Asn Ile Arg Phe Val Tyr Ser Leu Arg Phe Thr Pro165 170 175Gly Tyr Thr Ile Glu Arg His Ser Gly Gly Leu Ile Phe Pro Pro Ser180 185 190Tyr Ile Pro Ile Val Met Ser Lys Leu Ser Asp Gln Met Thr Phe Met195 200 205Glu Arg Val Lys Asn Met Ile Tyr Val Leu Tyr Phe Asp Phe Trp Phe210 215 220Gln Met Ser Asp Met Lys Lys Trp Asp Gln Phe Tyr Ser Glu Val Leu225 230 235 240Gly Arg Pro Thr Thr Leu Phe Glu Thr Met Gly Lys Ala Asp Ile Trp245 250 255Leu Met Arg Asn Ser Trp Ser Phe Gln Phe Pro His Pro Phe Leu Pro260 265 270Asn Val Asp Phe Val Gly Gly Phe His Cys Lys Pro Ala Lys Pro Leu275 280 285Pro Lys Glu Met Glu Glu Phe Val Gln Ser Ser Gly Glu Asn Gly Val290 295 300Val Val Phe Ser Leu Gly Ser Val Ile Ser Asn Met Thr Ala Glu Arg305 310 315 320Ala Asn Val Ile Ala Thr Ala Leu Ala Lys Ile Pro Gln Lys Val Leu325 330 335Trp Arg Phe Asp Gly Asn Lys Pro Asp Ala Leu Gly Leu Asn Thr Arg340 345 350Leu Tyr Lys Trp Ile Pro Gln Asn Asp Leu Leu Gly His Pro Lys Thr355 360 365Arg Ala Phe Ile Thr His Gly Gly Ala Asn Gly Ile Tyr Glu Ala Ile370 375 380Tyr His Gly Ile Pro Met Val Gly Ile Pro Leu Phe Phe Asp Gln Pro385 390 395 400Asp Asn Ile Ala His Met Lys Ala Lys Gly Ala Ala Val Arg Leu Asp405 410 415Phe Asn Thr Met Ser Ser Thr Asp Leu Leu Asn Ala Leu Lys Thr Val420 425 430Ile Asn Asp Pro Leu Tyr Lys Glu Asn Ile Met Lys Leu Ser Arg Ile435 440 445Gln His Asp Gln Pro Val Lys Pro Leu Asp Arg Ala Val Phe Trp Ile450 455 460Glu Phe Val Met Pro His Lys Gly Ala Lys His Leu Arg Val Ala Ala465 470 475 480His Asp Leu Thr Trp Phe Gln Tyr His Ser Leu Asp Val Ile Gly Phe485 490 495Leu Leu Ala Cys Val Ala Thr Val Ile Phe Ile Ile Thr Lys Phe Cys500 505 510Leu Phe Cys Phe Trp Lys Phe Ala Arg Lys Gly Lys Lys Gly Lys Arg515 520 525Asp2010006DNAHomo sapien 20ttcctccgcg aaggctcctt tgatattaat agtgttggtg tcttgaaact gacgtaatgc 60gcggagactg aggtcctgac aagcgataac atttctgata aagacccgat cttactgcaa 120tctctagcgt cctctttttt ggtgctgctg gtttctccag acctcgcgtc ctctcgattg 180ctctctcgcc ttcctatttc tttttttttt ttttaaacaa aaaacaacac cccctcccct 240ctcccacccg gcaccgggca catccttgct ctatttcctt tctctttctc tctctctctc 300tctctttttt aataagggtg ggggagggaa agggggggga ggcaggaaag acctttttct 360ctcccccccg caataatcca agatcaactc tgcaaacaac agaagacggt tcatggcttt 420ggccgccgcg ccaccatctt tcgggctgcc gagggtgttc ttgacgatta atcaacagat 480gtacagatca gctctcaaaa tgtcttctgt gtcttctgag cgtcttctaa gacaattgca 540ttagcctcct gctagttgac taatagaatt aataattgta aaaagcactc taaagccaca 600tgccttatga agtcaatgct gggtatgatt ttacaaatat ggtccggaaa aagaaccccc 660ctctgagaaa cgttgcaagt gaaggcgagg gccagatcct ggagcctata ggtacagaaa 720gcaaggtatc tggaaagaac aaagaattct ctgcagatca gatgtcagaa aatacggatc 780agagtgatgc tgcagaacta aatcataagg aggaacatag cttgcatgtt caagatccat 840cttctagcag taagaaggac ttgaaaagcg cagttctgag tgagaaggct ggcttcaatt 900atgaaagccc cagtaaggga ggaaactttc cctcctttcc gcatgatgag gtgacagaca 960gaaatatgtt ggctttctca tttccagctg ctgggggagt ctgtgagccc ttgaagtctc 1020cgcaaagagc agaggcagat gaccctcaag atatggcctg caccccctca ggggactcac 1080tggagacaaa ggaagatcag aagatgtcac caaaggctac agaggaaaca gggcaagcac 1140agagtggtca agccaattgt caaggtttga gcccagtttc agtggcctca aaaaacccac 1200aagtgccttc agatgggggt gtaagactga ataaatccaa aactgactta ctggtgaatg 1260acaacccaga cccggcacct ctgtctccag agcttcagga ctttaaatgc aatatctgtg 1320gatatggtta ctacggcaac gaccccacag atctgattaa gcacttccga aagtatcact 1380taggactgca taaccgcacc aggcaagatg ctgagctgga cagcaaaatc ttggcccttc 1440ataacatggt gcagttcagc cattccaaag acttccagaa ggtcaaccgt tctgtgtttt 1500ctggtgtgct gcaggacatc aattcttcaa ggcctgtttt actaaatggg acctatgatg 1560tgcaggtgac ttcaggtgga acattcattg gcattggacg gaaaacacca gattgccaag 1620ggaacaccaa gtatttccgc tgtaaattct gcaatttcac ttatatgggc aactcatcca 1680ccgaattaga acaacatttt cttcagactc acccaaacaa aataaaagct tctctcccct 1740cctctgaggt tgcaaaacct tcagagaaaa actctaacaa gtccatccct gcacttcaat 1800ccagtgattc tggagacttg ggaaaatggc aggacaagat aacagtcaaa gcaggagatg 1860acactcctgt tgggtactca gtgcccataa agcccctcga ttcctctaga caaaaggtac 1920agaggccacc agttactact ggtgtaaatt ttgtagtttc agctgtgagt catctagctc 1980acttaaactg ctagaacatt atggcaagca gcacggagca gtgcagtcag gcggccttaa 2040tccagagtta aatgataagc tttccagggg ctctgtcatt aatcagaatg atctagccaa 2100aagttcagaa ggagagacaa tgaccaagac agacaagagc tcgagtgggg ctaaaaagaa 2160ggacttctcc agcaagggag ccgaggataa tatggtaacg agctataatt gtcagttctg 2220tgacttccga tattccaaaa gccatggccc tgatgtaatt gtagtggggc cacttctccg 2280tcattatcaa cagctccata acattcacaa gtgtaccatt aaacactgtc cattctgtcc 2340cagaggactt tgcagcccag aaaagcacct tggagaaatt acttatccgt ttgcttgtag 2400aaaaagtaat tgttcccact gtgcactctt gcttctgcac

ttgtctcctg gggcggctgg 2460aagctcgcga gtcaaacatc agtgccatca gtgttcattc accacccctg acgtagatgt 2520actcctcttt cactatgaaa gtgtgcatga gtcccaagca tcggatgtca aacaagaagc 2580aaatcacctg caaggatcgg atgggcagca gtctgtcaag gaaagcaaag aacactcatg 2640taccaaatgt gattttatta cccaagtgga agaagagatt tcccgacact acaggagagc 2700acacagctgc tacaaatgcc gtcagtgcag ttttacagct gccgatactc agtcactact 2760ggagcacttc aacactgttc actgccagga acaggacatc actacagcca acggcgaaga 2820ggacggtcat gccatatcca ccatcaaaga ggagcccaaa attgacttca gggtctacaa 2880tctgctaact ccagactcta aaatgggaga gccagtttct gagagtgtgg tgaagagaga 2940gaagctggaa gagaaggacg ggctcaaaga gaaagtttgg accgagagtt ccagtgatga 3000ccttcgcaat gtgacttgga gaggggcaga catcctgcgg gggagtccgt catacaccca 3060agcaagcctg gggctgctga cgcctgtgtc tggcacccaa gagcagacaa agactctaag 3120ggatagtccc aatgtggagg ccgcccatct ggcgcgacct atttatggct tggctgtgga 3180aaccaaggga ttcctgcagg gggcgccagc tggcggagag aagtctgggg ccctccccca 3240gcagtatcct gcatcgggag aaaacaagtc caaggatgaa tcccagtccc tgttacggag 3300gcgtagaggc tccggtgttt tttgtgccaa ttgcctgacc acaaagacct ctctctggcg 3360aaagaatgca aatggcggat atgtatgcaa cgcgtgtggc ctctaccaga agcttcactc 3420gactcccagg cctttaaaca tcattaaaca aaacaacggt gagcagatta ttaggaggag 3480aacaagaaag cgccttaacc cagaggcact tcaggctgag cagctcaaca aacagcagag 3540gggcagcaat gaggagcaag tcaatggaag cccgttagag aggaggtcag aagatcatct 3600aactgaaagt caccagagag aaattccact ccccagccta agtaaatacg aagcccaggg 3660ttcattgact aaaagccatt ctgctcagca gccagtcctg gtcagccaaa ctctggatat 3720tcacaaaagg atgcaacctt tgcacattca gataaaaagt cctcaggaaa gtactggaga 3780tccaggaaat agttcatccg tatctgaagg gaaaggaagt tctgagagag gcagtcctat 3840agaaaagtac atgagacctg cgaaacaccc aaattattca ccaccaggca gccctattga 3900aaagtaccag tacccacttt ttggacttcc cttttacata atgacttcca gagtgaagct 3960gattggctgc ggttctggag taaatataag ctctccgttc ctgggaatcc gcactacttg 4020agtcacgtgc ctggcctacc aaatccttgc caaaactatg tgccttatcc caccttcaat 4080ctgcctcctc atttttcagc tgttggatca gacaatgaca ttcctctaga tttggcgatc 4140aagcattcca gacctgggcc aactgcaaac ggtgcctcca aggagaaaac gaaggcacca 4200ccaaatgtaa aaaatgaagg tcccttgaat gtagtaaaaa cagagaaagt tgatagaagt 4260actcaagatg aactttcaac aaaatgtgtg cactgtggca ttgtctttct ggatgaagtg 4320atgtatgctt tgcatatgag ttgccatggt gacagtggac ctttccagtg cagcatatgc 4380cagcatcttt gcacggacaa atatgacttc acaacacata tccagagggg cctgcatagg 4440aacaatgcac aagtggaaaa aaatggaaaa cctaaagagt aaaaccttag cacttagcac 4500aattaaatag aaataggttt tcttgatggg aattcaatag cttgtaatgt cttatgaaga 4560cctattaaaa aaatacttca tagagcctgc cttatccaac atgaaattcc cttcttttgt 4620tattctttct tttgatgagt aggttaccaa gattaaaaag tgagataaat ggtcaatgag 4680aaagaatgga agatggtaaa caatcacttt ttaaaacctg ttaagtcaaa accatcttgg 4740ctaatatgta ctggggaaat aatccataag agatatcacc agactagaat taatatattt 4800ataaagaaag agaccaaaac tgtctagaat ttgaaagggt ttacatatta ttatactaaa 4860gcagtactgg actggccatt ggaccatttg ttccaaaacc cataaattgt tgcctaaatt 4920tataatgatc atgaaaccct aggcagagga ggagaaattg aaggtccagg gcaatgaaag 4980aaaaatggcg ccctctcaat ttagtcttct ctcattggcc atgtttcaga ttttgaccta 5040gaaatgcgag ctgtggttag gcttggttag agtgcagcaa gcaacatgac agatggtggc 5100acgctgtttt tacccagccc tgcctgtaca tacacatgca caccctctct gatatttttg 5160tcctttagat gttcaaatac tcagtagtcc ttttgtttgc ggtttagatt cattttgtcc 5220acacatgtac ccattttaaa aaacaatgtc ctcgatgctt ctgtagtgat ttcattttag 5280ccaggtattt ctttcttgtg tgtgatgaac cagtatggat ttgcttttct aagcctcctg 5340ttggttacta atctcacttg gcacattata actaaaggaa tcccctcaat tcaaaagcat 5400agatggatac aaatgtcaga ccgtgggttt aatttgttta gaacacatgg catttcttca 5460caaggtaacc tgctgtattt atttattttc ttttggttaa atataatttc caaactttgt 5520ggtcaggcag cgtctaaggt tacgttacca cagactgaca gttggtatat gtaccagcca 5580atcccttcat taaatgtata cagatttagt taagtagcat taaataggat tcttagaagt 5640atgtcctcat agaactttta atacttaagg ctttgtaaaa actatccatg aagggaaagc 5700tcctcagcat aactgctcag ggaaataggg ctaaataact gaacattaaa taattggtta 5760aaggtgctgt tagtcgagcc tcaatgcttg ctacaaggat gtatgtacaa ggactgactt 5820taataatttg cattatattg tcccaaccag tagtttattt tttgccacgg agatgtagaa 5880gatattacaa gctactggat gcactgtcag attaacttat ttcattaaag aagttgggag 5940aacaaatagg aaaaaaaaac ttatttttct agtaaatatt aatgtattac atttcaaata 6000atggtgcctg acatattgaa taattatttt ctacagtgta cgtatgcaac aaagatattc 6060catcatgcat tagagtcagt tctggctctg cctagctgtt tacatttgca aatgtagcaa 6120acaaggtaat gaagcaacta tttctattgc agtagatatc cttttgtgtg tgtgtgtgtg 6180cattaaagtt gtaaacggta acatgaaaca aatgaaagtt cttgctataa tggtatggaa 6240aacaagaagg aaatgaaaat atttttatgc ctacttagga aaaaaagggt agcacttatt 6300cattccaagt actttttttt ttttaatttt taagctctta actcacattg ttatgcttaa 6360gatgataaac atatatcctc tttttattgc tttgtctatg tttcatatga aacatttcag 6420aaattatttt gataagtgtt gctggaatct gcaacgctga tttttttttg cattctgtag 6480tcgcatttgc actccatttt tacattaatt cgcagttgct ttgtatcatt gttttgtttg 6540ggttttgttt ctttttcaca gtgccgggtc ttcgtttctt aaagttggat ggcaggtaga 6600gttcaaccag ttcgtgactg ttgtagcgaa tgaagttaaa aaaatgtctt tctgatgttg 6660tgttgtcatt ttcatttttg catttttttg tttgcatatt aaaaaaagag aaaagagaaa 6720gcaagagaca gaaatcagga ctaagtcctc tgcttcagtt tcattgttaa cgggccttat 6780tctgatctca cctgtcgcgt agctctaata ttcacataaa ctgaaataaa gaagtggaat 6840gaggagcttt gacattcaaa ttatgtgatg taatttatct tccttaggaa ttttgatgga 6900tgcatctcaa aatgtatagc cagacttgag aggtgacaat taaagatcta aaaaagagag 6960gagattcccc caaacaacaa tatttaattt tcttagtaaa aagaataaca gaatgcatcg 7020tggcaatcct taagcaacat tatctatgtg gactgcttaa atcagcaaaa caccagaagt 7080ttggttaact tgggcaatat gacaagtatt actttttggg caaaactact cattaagcaa 7140tttctctagt gtgtcggaca caaataggtt ctttattttt ggcatgtatg cctttttatt 7200ttcattcaat tttttttttt tctcagacag acatagtagt atcaactagc attggaaaat 7260acatatcact attcttggaa tatttatggt cagtctactt tttagtaaaa tatttttgga 7320tagcgttgac acgatagatc ttattccata cttctttatt attgataatt ttattttcat 7380tttttgcttt cattattata catattttgg tggagaagag gttgggcttt tttgaaagag 7440acaaaaattt attataacac taaacactcc ttttttgaca tattaaagcc tttattccat 7500ctctcaagat atattataaa atttattttt ttaatttaag atttctgaat tattttatct 7560taaattgtga ttttaaacga gctattatgg tacggaactt tttttaatga ggaatttcat 7620gatgatttag gaattttctc tcttggaaaa ggcttcccct gtgatgaaaa tgatgtgcca 7680gctaaaattg tgtgccattt aaaaactgaa aatattttaa aattatttgt ctatattcta 7740aattgagctt tggatcaaac tttaggccag gaccagctca tgcgttctca ttcttccttt 7800tctcactctt tctctcatca ctcacctctg tattcattct gttgtttggg atagaaaaat 7860cataaagagc caacccatct cagaacgttg tggattgaga gagacactac atgactccaa 7920gtatatgaga aaaggacaga gctctaattg ataactctgt agttcaaaag gaaagagtat 7980gcccaattct ctctacatga catattgaga ttttttttaa tcaactttta agatagtgat 8040gttctgttct aaactgttct gttttagtga aggtagattt ttataaaaca agcatgggga 8100ttcttttcta aggtaatatt aatgagaagg gaaaaaagta tctttaacag ctctttgttg 8160aagcctgtgg tagcacatta tgtttataat tgcacatgtg cacataatct attatgatcc 8220aatgcaaata cagctccaaa aatattaaat gtatatatat tttaaaatgc ctgaggaaat 8280acatttttct taataaactg aagagtctca gtatggctat taaaataatt attagcctcc 8340tgttgtgtgg ctgcaaaaca tcacaaagtg accggtcttg agacctgtga actgctgccc 8400tgtttagtaa ataaaattaa tgcatttcta gagggggaat atctgccatc cagtggtgga 8460aatgtggagt aaagaagctg gtggtctgct tctgtgctgt atgccagcct tttgccttaa 8520gttgagagga ggtcaacttt agctactgtc tttggtttga gagccatggc aaaaaaaaaa 8580aaagaaaaaa agatcaagtc gtctttggtg agccagtaag gtgaaagctt gctgactgtc 8640caaggcacaa gagaaaattg aggaattgaa atgcaacctg agtatcaaac taaatattct 8700aatcaaaggt aggtactgtt aggtggaatt ctatcagcag gcaactgcaa atgagaagaa 8760gatagaagga cgcccgtcgg gactttggag ggcattgtta ttttcccaaa gaaagacggc 8820caagggcaga ggcatggatt ctttgcagag cacttccttt tggtttttca gtactgtttc 8880atagacagtg ggctcacatg ttcctgatag tgctgcagtt gcttagaaag catcccagtt 8940aattgcagta attagaactt ctggaatatg ctagggcaga agtatgtcaa gtatgtcaca 9000tgaagaaaat gtgaaattca agagtaatcc acacgtgaga aactagacaa tgtacattca 9060tgtgttctct tgaaaggaaa gggagagctg taagcttcac tctgtcctac accggagaaa 9120agcaggaata actttaccgt ggaaataatg tttagctttt atcagagaaa attgtccttc 9180tagagcatag agtcccaaaa ctcaattctg gttttcccct gttttttttt tttttttttt 9240tcccaacata tgaactgcag catatcactt tttctttttg tgcctcaggt tcctcacctg 9300taaaattgaa aaatatatgt attaataata ttattaataa taataatggt aatgtagtac 9360ttgtttgtaa agcactttga gatccttggt tgaaaggcac cataggagtg ccaagtatta 9420ttatgtggcc aagggggtta tttaaactgt cagttcccaa aggccaggaa aggttggggt 9480catttttctt aaagacgagc tgtaaatatc aactaggcag ccaatagtgt tgactatgaa 9540gatgcaaaac tattactagg ctgataaaat catagtttct taatggctac caataaggca 9600aatatcacaa taataaacgc caaattcctt agggcggact atttgacaac cacatggaaa 9660actttggggg aggcatgagg ggggaacatc tcaaaatgcc aatgtaaaat ttaacttaca 9720gcaatattca ccagcagaaa atgtctttca tatggaatga tttcatgttg ctaagaaaaa 9780gaattcaatt tgtagtcctg atttgaatac tagaatgttg gctataatag ttctgttctt 9840acaacacatg aaattttttc gttttatttt attttgtttt catagtgcat gttcatttct 9900actcacaaac atgttcttgg tgtatttctt atgcaaacaa tcttcaggca gcaaagatgt 9960ctgttacatc taaacttgaa taataaagtt ttccaccagt tacaca 10006211281PRTHomo sapien 21Met Val Arg Lys Lys Asn Pro Pro Leu Arg Asn Val Ala Ser Glu Gly1 5 10 15Glu Gly Gln Ile Leu Glu Pro Ile Gly Thr Glu Ser Lys Val Ser Gly20 25 30Lys Asn Lys Glu Phe Ser Ala Asp Gln Met Ser Glu Asn Thr Asp Gln35 40 45Ser Asp Ala Ala Glu Leu Asn His Lys Glu Glu His Ser Leu His Val50 55 60Gln Asp Pro Ser Ser Ser Ser Lys Lys Asp Leu Lys Ser Ala Val Leu65 70 75 80Ser Glu Lys Ala Gly Phe Asn Tyr Glu Ser Pro Ser Lys Gly Gly Asn85 90 95Phe Pro Ser Phe Pro His Asp Glu Val Thr Asp Arg Asn Met Leu Ala100 105 110Phe Ser Phe Pro Ala Ala Gly Gly Val Cys Glu Pro Leu Lys Ser Pro115 120 125Gln Arg Ala Glu Ala Asp Asp Pro Gln Asp Met Ala Cys Thr Pro Ser130 135 140Gly Asp Ser Leu Glu Thr Lys Glu Asp Gln Lys Met Ser Pro Lys Ala145 150 155 160Thr Glu Glu Thr Gly Gln Ala Gln Ser Gly Gln Ala Asn Cys Gln Gly165 170 175Leu Ser Pro Val Ser Val Ala Ser Lys Asn Pro Gln Val Pro Ser Asp180 185 190Gly Gly Val Arg Leu Asn Lys Ser Lys Thr Asp Leu Leu Val Asn Asp195 200 205Asn Pro Asp Pro Ala Pro Leu Ser Pro Glu Leu Gln Asp Phe Lys Cys210 215 220Asn Ile Cys Gly Tyr Gly Tyr Tyr Gly Asn Asp Pro Thr Asp Leu Ile225 230 235 240Lys His Phe Arg Lys Tyr His Leu Gly Leu His Asn Arg Thr Arg Gln245 250 255Asp Ala Glu Leu Asp Ser Lys Ile Leu Ala Leu His Asn Met Val Gln260 265 270Phe Ser His Ser Lys Asp Phe Gln Lys Val Asn Arg Ser Val Phe Ser275 280 285Gly Val Leu Gln Asp Ile Asn Ser Ser Arg Pro Val Leu Leu Asn Gly290 295 300Thr Tyr Asp Val Gln Val Thr Ser Gly Gly Thr Phe Ile Gly Ile Gly305 310 315 320Arg Lys Thr Pro Asp Cys Gln Gly Asn Thr Lys Tyr Phe Arg Cys Lys325 330 335Phe Cys Asn Phe Thr Tyr Met Gly Asn Ser Ser Thr Glu Leu Glu Gln340 345 350His Phe Leu Gln Thr His Pro Asn Lys Ile Lys Ala Ser Leu Pro Ser355 360 365Ser Glu Val Ala Lys Pro Ser Glu Lys Asn Ser Asn Lys Ser Ile Pro370 375 380Ala Leu Gln Ser Ser Asp Ser Gly Asp Leu Gly Lys Trp Gln Asp Lys385 390 395 400Ile Thr Val Lys Ala Gly Asp Asp Thr Pro Val Gly Tyr Ser Val Pro405 410 415Ile Lys Pro Leu Asp Ser Ser Arg Gln Asn Gly Thr Glu Ala Thr Ser420 425 430Tyr Tyr Trp Cys Lys Phe Cys Ser Phe Ser Cys Glu Ser Ser Ser Ser435 440 445Leu Lys Leu Leu Glu His Tyr Gly Lys Gln His Gly Ala Val Gln Ser450 455 460Gly Gly Leu Asn Pro Glu Leu Asn Asp Lys Leu Ser Arg Gly Ser Val465 470 475 480Ile Asn Gln Asn Asp Leu Ala Lys Ser Ser Glu Gly Glu Thr Met Thr485 490 495Lys Thr Asp Lys Ser Ser Ser Gly Ala Lys Lys Lys Asp Phe Ser Ser500 505 510Lys Gly Ala Glu Asp Asn Met Val Thr Ser Tyr Asn Cys Gln Phe Cys515 520 525Asp Phe Arg Tyr Ser Lys Ser His Gly Pro Asp Val Ile Val Val Gly530 535 540Pro Leu Leu Arg His Tyr Gln Gln Leu His Asn Ile His Lys Cys Thr545 550 555 560Ile Lys His Cys Pro Phe Cys Pro Arg Gly Leu Cys Ser Pro Glu Lys565 570 575His Leu Gly Glu Ile Thr Tyr Pro Phe Ala Cys Arg Lys Ser Asn Cys580 585 590Ser His Cys Ala Leu Leu Leu Leu His Leu Ser Pro Gly Ala Ala Gly595 600 605Ser Ser Arg Val Lys His Gln Cys His Gln Cys Ser Phe Thr Thr Pro610 615 620Asp Val Asp Val Leu Leu Phe His Tyr Glu Ser Val His Glu Ser Gln625 630 635 640Ala Ser Asp Val Lys Gln Glu Ala Asn His Leu Gln Gly Ser Asp Gly645 650 655Gln Gln Ser Val Lys Glu Ser Lys Glu His Ser Cys Thr Lys Cys Asp660 665 670Phe Ile Thr Gln Val Glu Glu Glu Ile Ser Arg His Tyr Arg Arg Ala675 680 685His Ser Cys Tyr Lys Cys Arg Gln Cys Ser Phe Thr Ala Ala Asp Thr690 695 700Gln Ser Leu Leu Glu His Phe Asn Thr Val His Cys Gln Glu Gln Asp705 710 715 720Ile Thr Thr Ala Asn Gly Glu Glu Asp Gly His Ala Ile Ser Thr Ile725 730 735Lys Glu Glu Pro Lys Ile Asp Phe Arg Val Tyr Asn Leu Leu Thr Pro740 745 750Asp Ser Lys Met Gly Glu Pro Val Ser Glu Ser Val Val Lys Arg Glu755 760 765Lys Leu Glu Glu Lys Asp Gly Leu Lys Glu Lys Val Trp Thr Glu Ser770 775 780Ser Ser Asp Asp Leu Arg Asn Val Thr Trp Arg Gly Ala Asp Ile Leu785 790 795 800Arg Gly Ser Pro Ser Tyr Thr Gln Ala Ser Leu Gly Leu Leu Thr Pro805 810 815Val Ser Gly Thr Gln Glu Gln Thr Lys Thr Leu Arg Asp Ser Pro Asn820 825 830Val Glu Ala Ala His Leu Ala Arg Pro Ile Tyr Gly Leu Ala Val Glu835 840 845Thr Lys Gly Phe Leu Gln Gly Ala Pro Ala Gly Gly Glu Lys Ser Gly850 855 860Ala Leu Pro Gln Gln Tyr Pro Ala Ser Gly Glu Asn Lys Ser Lys Asp865 870 875 880Glu Ser Gln Ser Leu Leu Arg Arg Arg Arg Gly Ser Gly Val Phe Cys885 890 895Ala Asn Cys Leu Thr Thr Lys Thr Ser Leu Trp Arg Lys Asn Ala Asn900 905 910Gly Gly Tyr Val Cys Asn Ala Cys Gly Leu Tyr Gln Lys Leu His Ser915 920 925Thr Pro Arg Pro Leu Asn Ile Ile Lys Gln Asn Asn Gly Glu Gln Ile930 935 940Ile Arg Arg Arg Thr Arg Lys Arg Leu Asn Pro Glu Ala Leu Gln Ala945 950 955 960Glu Gln Leu Asn Lys Gln Gln Arg Gly Ser Asn Glu Glu Gln Val Asn965 970 975Gly Ser Pro Leu Glu Arg Arg Ser Glu Asp His Leu Thr Glu Ser His980 985 990Gln Arg Glu Ile Pro Leu Pro Ser Leu Ser Lys Tyr Glu Ala Gln Gly995 1000 1005Ser Leu Thr Lys Ser His Ser Ala Gln Gln Pro Val Leu Val Ser1010 1015 1020Gln Thr Leu Asp Ile His Lys Arg Met Gln Pro Leu His Ile Gln1025 1030 1035Ile Lys Ser Pro Gln Glu Ser Thr Gly Asp Pro Gly Asn Ser Ser1040 1045 1050Ser Val Ser Glu Gly Lys Gly Ser Ser Glu Arg Gly Ser Pro Ile1055 1060 1065Glu Lys Tyr Met Arg Pro Ala Lys His Pro Asn Tyr Ser Pro Pro1070 1075 1080Gly Ser Pro Ile Glu Lys Tyr Gln Tyr Pro Leu Phe Gly Leu Pro1085 1090 1095Phe Val His Asn Asp Phe Gln Ser Glu Ala Asp Trp Leu Arg Phe1100 1105 1110Trp Ser Lys Tyr Lys Leu Ser Val Pro Gly Asn Pro His Tyr Leu1115 1120 1125Ser His Val Pro Gly Leu Pro Asn Pro Cys Gln Asn Tyr Val Pro1130 1135 1140Tyr Pro Thr Phe Asn Leu Pro Pro His Phe Ser Ala Val Gly Ser1145 1150 1155Asp Asn Asp Ile Pro Leu Asp Leu Ala Ile Lys His Ser Arg Pro1160 1165 1170Gly Pro Thr Ala Asn Gly Ala Ser Lys Glu Lys Thr Lys Ala Pro1175 1180 1185Pro Asn Val Lys Asn Glu Gly Pro Leu Asn Val Val Lys Thr Glu1190 1195 1200Lys Val Asp Arg Ser Thr Gln Asp Glu Leu Ser Thr Lys Cys Val1205 1210 1215His Cys Gly Ile Val Phe Leu Asp Glu Val Met Tyr Ala Leu His1220 1225 1230Met Ser Cys His Gly Asp Ser Gly Pro Phe Gln Cys Ser Ile Cys1235 1240 1245Gln His Leu Cys Thr Asp Lys Tyr Asp Phe Thr Thr His Ile Gln1250 1255 1260Arg Gly Leu His Arg Asn Asn Ala Gln Val Glu Lys Asn Gly Lys1265 1270 1275Pro Lys Glu1280

Claims

1. A BCSG comprising: (a) a polynucleotide of SEQ ID NO:1, 2, 3, 4, 5, 18 or 20 or a variant thereof; (b) a protein expressed by a polynucleotide of SEQ ID NO:1, 2, 3, 4, 5, 18 or 20 or a variant thereof; or (c) a polynucleotide which is capable of hybridizing under stringent conditions to the antisense sequence of SEQ ID NO: 1, 2, 3, 4, 5, 18 or 20.

2. The BCSG of claim 1 comprising a protein of SEQ ID NO:19 or 21.

3. A method for diagnosing the presence of breast cancer in a patient comprising: (a) determining levels of a BCSG of claim 1 in cells, tissues or bodily fluids in a patient; and (b) comparing the determined BCSG levels with levels of BCSG in cells, tissues or bodily fluids from a normal human control, wherein a change in determined levels of BCSG in said patient versus normal human control is associated with the presence of breast cancer.

4. A method of diagnosing metastases of breast cancer in a patient comprising: (a) identifying a patient having breast cancer that is not known to have metastasized; (b) determining levels of a BCSG of claim 1 in cells, tissues, or bodily fluid from said patient; and (c) comparing the determined BCSG levels with levels of BCSG in cells, tissue, or bodily fluid of a normal human control, wherein an increase in determined BCSG levels in the patient versus the normal human control is associated with breast cancer which has metastasized.

5. A method of staging breast cancer in a patient having breast cancer comprising: (a) identifying a patient having breast cancer; (b) determining levels of a BCSG of claim 1 in a sample of cells, tissue, or bodily fluid from said patient; and (c) comparing determined BCSG levels with levels of BCSG in cells, tissues, or bodily fluid of a normal human control, wherein an increase in determined BCSG levels in said patient versus the normal human control is associated with breast cancer which is progressing and a decrease in the determined BCSG levels is associated with breast cancer which is regressing or in remission.

6. A method of monitoring breast cancer in a patient for the onset of metastasis comprising: (a) identifying a patient having breast cancer that is not known to have metastasized; (b) periodically determining levels of a BCSG of claim 1 in samples of cells, tissues, or bodily fluid from said patient; and (c) comparing the periodically determined BCSG levels with levels of BCSG in cells, tissues, or bodily fluid of a normal human control, wherein an increase in any one of the periodically determined BCSG levels in the patient versus the normal human control is associated with breast cancer which has metastasized.

7. A method of monitoring a change in stage of breast cancer in a patient comprising: (a) identifying a patient having breast cancer; (b) periodically determining levels of a BCSG of claim 1 in cells, tissues, or bodily fluid from said patient; and (c) comparing the periodically determined BCSG levels with levels of BCSG in cells, tissues, or bodily fluid of a normal human control, wherein an increase in any one of the periodically determined BCSG levels in the patient versus the normal human control is associated with breast cancer which is progressing in stage and a decrease is associated with breast cancer which is regressing in stage or in remission.

8. A method of identifying potential therapeutic agents for use in imaging and treating breast cancer comprising screening molecules for an ability to bind to a BCSG of claim 1 wherein the ability of a molecule to bind to BCSG is indicative of the molecule being useful in imaging and treating breast cancer.

9. An antibody which specifically binds a BCSG of claim 1.

10. A method of imaging breast cancer in a patient comprising administering to the patient the antibody of claim 9.

11. The method of claim 10 wherein said antibody is labeled with paramagnetic ions or a radioisotope.

12. A method of treating breast cancer in a patient comprising administering to the patient the antibody of claim 9.

13. The method of claim 12 wherein the antibody is conjugated to a cytotoxic agent.

14. A method of treating breast cancer in a patient comprising administering to the patient a molecule which downregulates expression or activity of a BCSG of claim 1.

15. A method of inducing an immune response against a target cell expressing a BCSG of claim 1 comprising delivering to a human patient an immunogenically stimulatory amount of a BCSG protein of claim 1 so that an immune response is mounted against the target cell.

16. A vaccine for treating breast cancer comprising a BCSG of claim 1.