U.S. patent application number 11/870715 was filed with the patent office on 2008-04-24 for rolling circle amplification of circular genomes.
Invention is credited to Christian Korfhage, Dirk Loffert.
Application Number | 20080096258 11/870715 |
Document ID | / |
Family ID | 38871966 |
Filed Date | 2008-04-24 |
United States Patent
Application |
20080096258 |
Kind Code |
A1 |
Korfhage; Christian ; et
al. |
April 24, 2008 |
ROLLING CIRCLE AMPLIFICATION OF CIRCULAR GENOMES
Abstract
Disclosed are compositions and a method for amplification of
circular genomes. The method is based on rolling circle
amplification of the circular genomes which involves strand
displacement replication by primers. The disclosed method allows
differential amplification of circular genomes of interest. In
genomic nucleic acid samples containing both a circular genome of
interest and non-target nucleic acids, such as non-target genomes,
the disclose methods and compositions can result in many-fold
differential amplification of the circular genome of interest over
non-target nucleic acids. It has been discovered that selection of
a set of primers complementary to a circular genome of interest can
result in much greater amplification of the circular genome of
interest relative to non-target nucleic acids present. Such
differential amplification of circular genomes is very useful for
obtaining useful amounts of genomes of interest from a mixed
nucleic acid sample. For example, mitochondrial genomes, which,
absent complicated and time consuming purification, are in the
presence of non-target nucleic acids (such as the host cell
genome), can be differentially amplified relative to the host cell
genome and other non-target nucleic acids using the disclosed
methods and composition.
Inventors: |
Korfhage; Christian;
(Langenfeld, DE) ; Loffert; Dirk; (Duesseldorf,
DE) |
Correspondence
Address: |
NEEDLE & ROSENBERG, P.C.
SUITE 1000
999 PEACHTREE STREET
ATLANTA
GA
30309-3915
US
|
Family ID: |
38871966 |
Appl. No.: |
11/870715 |
Filed: |
October 11, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60862678 |
Oct 24, 2006 |
|
|
|
Current U.S.
Class: |
435/91.2 |
Current CPC
Class: |
C12Q 1/6846 20130101;
C12Q 1/6846 20130101; C12Q 2531/125 20130101 |
Class at
Publication: |
435/091.2 |
International
Class: |
C12P 19/34 20060101
C12P019/34 |
Claims
1. A method of amplifying a circular genome, the method comprising,
bringing into contact a set of primers, DNA polymerase, and a
genomic nucleic acid sample, wherein the genomic nucleic acid
sample comprises a circular genome, and incubating the genomic
nucleic acid sample under conditions that promote replication of
the circular genome in the genomic nucleic acid sample, wherein
replication of the circular genome proceeds by rolling circle
replication, wherein the conditions that promote replication of the
circular genome do not involve thermal cycling, wherein the genomic
nucleic acid sample further comprises non-target nucleic acids,
wherein the circular genome is amplified at least 10 fold compared
to the non-target nucleic acids.
2. The method of claim 1, wherein the non-target nucleic acids
comprise one or more non-target genomes, wherein the circular
genome is amplified at least 10 fold compared to the non-target
genomes.
3. The method of claim 2, wherein the circular genome is amplified
at least 50 fold, 100 fold, 200 fold, 500 fold, 1000 fold, 2000
fold, or 5000 fold compared to the non-target genomes.
4. The method of claim 2, wherein the non-target genome is a
bacterial genome, viral genome, microbial genome, pathogen genome,
eukaryotic genome, plant genome, animal genome, vertebrate genome,
fish genome, avian genome, mammalian genome, rodent genome, murine
genome, human genome, host genome, a non-target circular genome, or
a combination.
5. The method of claim 1, wherein the circular genome is an
organelle genome, a mitochondrial genome, a chloroplast genome, a
plastid genome, a bacterial plasmid genome, a viral genome, a
bacterial genome, a microbial genome, a pathogen genome, or a
combination.
6. The method of claim 1, wherein the circular genome is a
naturally occurring genome.
7. The method of claim 1, wherein the circular genome is not
artificially modified.
8. The method of claim 1, wherein the circular genome is not an
artificial nucleic acid.
9. The method of claim 1, wherein the circular genome is
double-stranded or single-stranded.
10. The method of claim 1, wherein the circular genome has a length
of from about 3000 to about 300000 nucleotides, about 4000 to about
260000 nucleotides, about 5000 to about 150000 nucleotides, or
about 5500 to about 40000 nucleotides.
11. The method of claim 1, wherein the primers each comprise a
specific nucleotide sequence.
12. The method of claim 1, wherein the primers each have a specific
nucleotide sequence.
13. The method of claim 1, wherein the primers can specifically
hybridize to a nucleotide sequence in the circular genome under
conditions that promote replication of the circular genome.
14. The method of claim 1, wherein the primers each separately have
a length 5 nucleotides, 6 nucleotides, 7 nucleotides, 8
nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12
nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16
nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20
nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24
nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28
nucleotides, 29 nucleotides, or 30 nucleotides.
15. The method of claim 1, wherein the primers each separately have
a length less than 6 nucleotides, less than 7 nucleotides, less
than 8 nucleotides, less than 9 nucleotides, less than 10
nucleotides, less than 11 nucleotides, less than 12 nucleotides,
less than 13 nucleotides, less than 14 nucleotides, less than 15
nucleotides, less than 16 nucleotides, less than 17 nucleotides,
less than 18 nucleotides, less than 19 nucleotides, less than 20
nucleotides, less than 21 nucleotides, less than 22 nucleotides,
less than 23 nucleotides, less than 24 nucleotides, less than 25
nucleotides, less than 26 nucleotides, less than 27 nucleotides,
less than 28 nucleotides, less than 29 nucleotides, less than 30
nucleotides, or less than 31 nucleotides.
16. The method of claim 1, wherein the set of primers comprises 2
primers, 3 primers, 4 primers, 5 primers, 6 primers, 7 primers, 8
primers, 9 primers, 10 primers, 11 primers, 12 primers, 13 primers,
14 primers, 15 primers, 16 primers, 17 primers, 18 primers, 19
primers, 20 primers, 21 primers, 22 primers, 23 primers, 24
primers, 25 primers, 26 primers, 27 primers, 28 primers, 29
primers, 30 primers, 31 primers, 32 primers, 33 primers, 34
primers, 35 primers, 36 primers, 37 primers, 38 primers, 39
primers, 40 primers, 41 primers, 42 primers, 43 primers, 44
primers, 45 primers, 46 primers, 47 primers, 48 primers, 49
primers, 50 primers, 51 primers, 52 primers, 53 primers, 54
primers, 55 primers, 56 primers, 57 primers, 58 primers, 59
primers, 60 primers, 61 primers, 62 primers, 63 primers, 75
primers, 100 primers, 150 primers, 200 primers, 300 primers, 400
primers, wherein each primer in the set has a different specific
nucleotide sequence.
17. The method of claim 1, wherein the primers each have a
nucleotide sequence complementary to a nucleotide sequence in the
circular genome, wherein the distance between consecutive primers
hybridized to the same strand of the circular genome averages from
about 200 to about 20000 nucleotides, about 200 to about 6000
nucleotides, about 300 to about 5000 nucleotides, or about 400 to
about 4000 nucleotides.
18. The method of claim 1, wherein the primers each have a
nucleotide sequence complementary to a nucleotide sequence in the
circular genome, wherein the distance between consecutive primers
hybridized to the same strand of the circular genome are from about
200 to about 20000 nucleotides, about 200 to about 6000
nucleotides, about 300 to about 5000 nucleotides, or about 400 to
about 4000 nucleotides.
19. The method of claim 1, wherein the circular genome is
double-stranded, wherein one or more of the primers have a
nucleotide sequence complementary to one of the strands of the
circular genome and one or more of the primers have a nucleotide
sequence complementary to the other strand of the circular genome,
wherein all of the primers have a nucleotide sequence complementary
to one of the strands of the circular genome, or all of the primers
have a nucleotide sequence complementary to the other strand of the
circular genome.
20. The method of claim 1, wherein the circular genome is
single-stranded, wherein one or more of the primers have a
nucleotide sequence complementary to the circular genome and one or
more of the primers have a nucleotide sequence that matches a
sequence of the circular genome, wherein rolling circle replication
results in the formation of tandem sequence DNA, wherein the one or
more of the primers that have a nucleotide sequence that matches a
sequence of the circular genome prime strand displacement
replication of the tandem sequence DNA, wherein replication of the
tandem sequence DNA results in formation of secondary tandem
sequence DNA.
21. The method of claim 1, wherein the primers each separately
comprise deoxyribonucleotides, ribonucloetides, modified
nucleotides, nucleotide analogs, labelled nucleotides, oligomer
analogs, or a combination.
22. The method of claim 1, wherein the genomic nucleic acid sample
is a blood sample, a urine sample, a semen sample, a lymphatic
fluid sample, a cerebrospinal fluid sample, amniotic fluid sample,
a biopsy sample, a needle aspiration biopsy sample, a cancer
sample, a tumor sample, a tissue sample, a cell sample, a cell
lysate sample, a crude cell lysate sample, a forensic sample, an
archeological sample, an infection sample, a nosocomial infection
sample, an environmental sample, or a combination thereof.
23. The method of claim 1, wherein the conditions that promote
replication of the circular genome are substantially
isothermic.
24. The method of claim 1, wherein the genomic nucleic acid sample
is treated with an exonuclease prior to incubating the genomic
nucleic acid sample under conditions that promote replication of
the circular genome in the genomic nucleic acid sample.
25. A method of identifying a set of primers for differential
amplification of a circular genome, the method comprising selecting
test primers for a test set of primers, wherein each primer can
specifically hybridize to a nucleotide sequence in a circular
genome, wherein the distance between consecutive primers hybridized
to the same strand of the circular genome averages from about 200
to about 20000 nucleotides, about 200 to about 6000 nucleotides,
bringing into contact the test set of primers, DNA polymerase, and
a genomic nucleic acid sample, wherein the test genomic nucleic
acid sample comprises the circular genome and non-target nucleic
acids, incubating the genomic nucleic acid sample under conditions
that promote replication of the circular genome in the genomic
nucleic acid sample, wherein replication of the circular genome
proceeds by rolling circle replication, wherein the conditions that
promote replication of the circular genome do not involve thermal
cycling, and determining the relative amplification of the circular
genome and the non-target nucleic acids, wherein the test set of
primers are identified if the circular genome is amplified at least
10 fold compared to the non-target nucleic acids.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to Provisional Application
No. 60/862,678 filed Oct. 24, 2006, which application is hereby
incorporated by this reference in its entirety.
FIELD OF THE INVENTION
[0002] The disclosed invention is generally in the field of nucleic
acid amplification.
BACKGROUND OF THE INVENTION
[0003] A number of methods have been developed for exponential
amplification of nucleic acids. These include the polymerase chain
reaction (PCR), ligase chain reaction (LCR), self-sustained
sequence replication (3SR), nucleic acid sequence based
amplification (NASBA), strand displacement amplification (SDA), and
amplification with Q.beta. replicase (Birkenmeyer and Mushahwar, J.
Virological Methods, 35:117-126 (1991); Landegren, Trends Genetics
9:199-202 (1993)).
[0004] Fundamental to most genetic analysis is availability of
genomic DNA of adequate quality and quantity. Techniques for whole
genome amplification (WGA) by have been developed. Whole genome
PCR, a variant of PCR amplification, involves the use of random or
partially random primers to amplify the entire genome of an
organism in the same PCR reaction. Whole genome amplification via
Multiple Displacement Amplification (MDA) is an isothermic reaction
involving strand displacement amplification that can provide high
quality amplification of genomes of high complexity. This is
described in U.S. Pat. No. 6,124,120 to Lizardi. Amplification
proceeds by replication initiating at each primer and continuing so
that the growing strands encounter and displace adjacent replicated
strands.
[0005] Rolling Circle Amplification (RCA) driven by DNA polymerase
has been used to replicate circular oligonucleotide probes with
either linear or geometric kinetics under isothermal conditions
(Lizardi et al., Nature Genet. 19: 225-232 (1998); U.S. Pat. Nos.
5,854,033 and 6,143,495; PCT Application No. WO 97/19193). If a
single primer is used, RCA generates in a few minutes a linear
chain of hundreds or thousands of tandemly-linked DNA copies of a
target that is covalently linked to that target. Generation of a
linear amplification product permits both spatial resolution and
accurate quantitation of a target. DNA generated by RCA can be
labeled with fluorescent oligonucleotide tags that hybridize at
multiple sites in the tandem DNA sequences. RCA can be used with
fluorophore combinations designed for multiparametric color coding
(PCT Application No. WO 97/19193), thereby markedly increasing the
number of targets that can be analyzed simultaneously. RCA
technologies can be used in solution, in situ and in microarrays.
In solid phase formats, detection and quantitation can be achieved
at the level of single molecules (Lizardi et al., 1998).
Ligation-mediated Rolling Circle Amplification (LM-RCA) involves
circularization of a probe molecule hybridized to a target sequence
and subsequent rolling circle amplification of the circular probe
(U.S. Pat. Nos. 5,854,033 and 6,143,495; PCT Application No. WO
97/19193). Very high yields of amplified products can be obtained
with exponential rolling circle amplification (U.S. Pat. Nos.
5,854,033 and 6,143,495; PCT Application No. WO 97/19193) and
multiply-primed rolling circle amplification (Dean et al., Genome
Research 11: 1095-1099 (2001)).
BRIEF SUMMARY OF THE INVENTION
[0006] Disclosed are compositions and a method for amplification of
circular genomes. The method is based on rolling circle
amplification of the circular genomes which involves strand
displacement replication by primers. The disclosed method allows
differential amplification of circular genomes of interest. In
genomic nucleic acid samples containing both a circular genome of
interest and non-target nucleic acids, such as non-target genomes,
the disclose methods and compositions can result in many-fold
differential amplification of the circular genome of interest over
non-target nucleic acids. It has been discovered that selection of
a set of primers complementary to a circular genome of interest can
result in much greater amplification of the circular genome of
interest relative to non-target nucleic acids present. Such
differential amplification of circular genomes is very useful for
obtaining useful amounts of genomes of interest from a mixed
nucleic acid sample. For example, mitochondrial genomes, which,
absent complicated and time consuming purification, are in the
presence of non-target nucleic acids (such as the host cell
genome), can be differentially amplified relative to the host cell
genome and other non-target nucleic acids using the disclosed
methods and composition.
[0007] Some forms of the disclosed methods can involve bringing
into contact a set of primers, DNA polymerase, and a genomic
nucleic acid sample, where the genomic nucleic acid sample
comprises a circular genome, and incubating the genomic nucleic
acid sample under conditions that promote replication of the
circular genome in the genomic nucleic acid sample. Replication of
the circular genome can proceed by rolling circle replication. The
conditions that promote replication of the circular genome need not
involve thermal cycling and/or can be substantially isothermic. In
the disclosed methods, the circular genome is differentially
replicated compared to the non-target nucleic acids present in the
genomic nucleic acid sample. Thus, for example, non-target nucleic
acids present in the genomic nucleic acid sample generally would
not be substantially, significantly, or notably replicated. For
example, the primers in the set of primers and the reaction
conditions generally can be selected such that non-target nucleic
acids in the genomic nucleic acid sample are not substantially,
significantly, or notably replicated.
[0008] Replication of the circular genomes results in replicated
strands. Such replication proceeds by rolling circle replication to
produce tandem sequence DNA. The replicated strands are displaced
from the nucleic acid molecules by strand displacement replication
of another replicated strand. Such amplification can proceed by
replication with a highly processive polymerase initiating at each
primer and continuing until spontaneous termination. A useful
feature of the method is that as a DNA polymerase extends a primer,
the polymerase displaces the replication products (that is, DNA
strands) that resulted from extension of other primers. The
polymerase is continuously extending new primers and displacing the
replication products of previous priming events. In this way,
multiple overlapping copies of all of the nucleic acid molecules
and sequences in the circular genome can be synthesized in a short
time. The disclosed method has advantages over the polymerase chain
reaction since it can be carried out under isothermal conditions.
In the disclosed method amplification takes place not in cycles,
but in a continuous, isothermal replication. This makes
amplification less complicated and much more consistent in output.
Strand displacement allows rapid generation of multiple copies of a
nucleic acid sequence or sample in a single, continuous, isothermal
reaction.
[0009] When the genomic nucleic acid sample comprises one or more
non-target genomes (including non-target genomes that may be
circular), the circular genome of interest can be differentially
amplified relative to the non-target genomes. The genomic nucleic
acid sample can comprises a plurality of genomes including the
circular genome of interest and one or more non-target genomes.
Thus, for example, non-target nucleic acids present in the genomic
nucleic acid sample generally would not be substantially,
significantly, or notably replicated and/or amplified. For example,
the primers in the set of primers and the reaction conditions
generally can be selected such that non-target nucleic acids in the
genomic nucleic acid sample are not substantially, significantly,
or notably replicated and/or amplified.
[0010] The differential amplification of the circular genome can be
described in quantitative terms. For example, the circular genome
can be amplified, for example, at least 10 fold, 50 fold, 100 fold,
200 fold, 500 fold, 1000 fold, 2000 fold, or 5000 fold compared to
the non-target nucleic acids and/or non-target genomes. Such
differential amplification generally can be assessed by measuring
the relative amplification of selected sequences within the
circular genome and within one or more non-target nucleic acids
and/or non-target genomes. Such assessments are described elsewhere
herein.
[0011] The circular genome to be amplified can be any circular
genome of interest. Circular genomes include, for example,
organelle genomes, mitochondrial genomes, chloroplast genomes,
plastid genomes, bacterial plasmid genomes, viral genomes,
bacterial genomes, microbial genomes, and/or pathogen genomes. The
circular genome can be a naturally occurring genome, a genome that
is not artificially modified, and/or a genome that is not an
artificial nucleic acid. The circular genome can be
double-stranded, single-stranded, or partially double-stranded.
Circular genomes occur in a variety of sizes and the disclosed
methods can be used to amplify circular genomes of any size. For
example, small viral genomes are typically between 5 and 40 kb, but
some viral genomes are larger. Circular microbial genomes are known
up to 1500 kb. Accordingly, the circular genome to be amplified can
have, for example, a length of from about 3000 to about 300000
nucleotides, about 4000 to about 260000 nucleotides, about 5000 to
about 150000 nucleotides, or about 5500 to about 40000
nucleotides.
[0012] The non-target genomes can be any genome that may be in a
genomic nucleic acid sample. For example, non-target genomes can
be, for example, bacterial genomes, viral genomes, microbial
genomes, pathogen genomes, eukaryotic genomes, plant genomes,
animal genomes, vertebrate genomes, fish genomes, avian genomes,
mammalian genomes, rodent genomes, murine genomes, human genomes,
host genomes, and/or non-target circular genomes. Circular genomes
can be in the presence of non-target genomes. For example,
organelle genomes are commonly in the presence of the cell genome
of the cell in which the organelle resides. Pathogen genomes are
commonly in the presence of host cell genomes.
[0013] It has been discovered that design and selection of primers
for a set of primers allows differential amplification of circular
genomes as described herein. The primers can each comprise or have
a specific nucleotide sequence. All or a part of the specific
nucleotide sequence can be complementary to a sequence in the
circular genome. The primers can also include portions and/or
sequences that are not complementary to the circular genome. The
primers can specifically hybridize to a nucleotide sequence in the
circular genome. For example, the primers can specifically
hybridize to a nucleotide sequence in the circular genome under the
conditions that promote replication of the circular genome.
Generally each primer in a set of primers can hybridize to a
different sequence and/or at a different location in the circular
genome.
[0014] The primers can each have a nucleotide sequence
complementary to a nucleotide sequence in the circular genome such
that the primers hybridize at particular intervals on the circular
genome. For example, the distance between consecutive primers
hybridized to the same strand of the circular genome can average,
for example, from about 200 to about 20000 nucleotides, about 200
to about 6000 nucleotides, about 300 to about 5000 nucleotides, or
about 400 to about 4000 nucleotides. A minimum separation within
such averages can also be specified. The distance between
consecutive primers hybridized to the same strand of the circular
genome can also be, for example, from about 200 to about 20000
nucleotides, about 200 to about 6000 nucleotides, about 300 to
about 5000 nucleotides, or about 400 to about 4000 nucleotides.
[0015] When the circular genome is double-stranded or partially
double-stranded, one or more of the primers can have a nucleotide
sequence complementary to one of the strands of the circular genome
and one or more of the primers can have a nucleotide sequence
complementary to the other strand of the circular genome, all of
the primers can have a nucleotide sequence complementary to one of
the strands of the circular genome, or all of the primers can have
a nucleotide sequence complementary to the other strand of the
circular genome. Generally amplification will be more efficient if
some of the primers are complementary to one strand and other
primers are complementary to the other strand. Rolling circle
replication of either or each strand of the circular genome will
result in the formation of tandem sequence DNA complementary to
that strand.
[0016] When the circular genome is single-stranded, the primers can
have a nucleotide sequence complementary to the circular genome.
Rolling circle replication of the single-stranded circular genome
will result in the formation of tandem sequence DNA complementary
to the circular genome. In some forms of the method, one or more of
the primers can also have a nucleotide sequence that matches a
sequence of the circular genome. In this case, the one or more of
the primers that have a nucleotide sequence that matches a sequence
of the circular genome can prime strand displacement replication of
the tandem sequence DNA produced by rolling circle replication of
the single-stranded circular genome by the primers that have a
nucleotide sequence complementary to the circular genome.
Replication of the tandem sequence DNA results in formation of
secondary tandem sequence DNA.
[0017] When the circular genome is partially double-stranded (for
example, where one strand is a continuous, closed circular strand
and the other strand is discontinuous and non-circular), the
primers can have a nucleotide sequence complementary to the
circular strand of the circular genome. Rolling circle replication
of the circular strand will result in the formation of tandem
sequence DNA complementary to the circular strand. In some forms of
the method, one or more of the primers can also have a nucleotide
sequence that matches a sequence of the circular strand of the
circular genome and/or is complementary to the non-circular strand
of the circular genome. In this case, the one or more of the
primers that have a nucleotide sequence that matches a sequence of
the circular genome and/or is complementary to the non-circular
strand of the circular genome can prime strand displacement
replication of the tandem sequence DNA produced by rolling circle
replication of the circular strand of the circular genome by the
primers that have a nucleotide sequence complementary to the
circular strand of the circular genome. Replication of the tandem
sequence DNA results in formation of secondary tandem sequence
DNA.
[0018] The primers can be composed in various ways. For example,
the primers can each separately comprise deoxyribonucleotides,
ribonucloetides, modified nucleotides, nucleotide analogs, labelled
nucleotides, oligomer analogs, or a combination. In some forms of
the disclosed methods and compositions, the primers can each
contain at least one modified nucleotide such that the primers are
nuclease resistant.
[0019] The primers can have any length that allows differential
amplification of the circular genome of interest. The primers can
have a complementary portion that can have any length that allows
differential amplification of the circular genome of interest. For
example, the primers can each separately have a length of, and/or
can have a complementary portion having a length of, 5 nucleotides,
6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10
nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14
nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18
nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22
nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26
nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, or 30
nucleotides. As another example, the primers can each separately
have a length of, and/or can have a complementary portion having a
length of, less than 6 nucleotides, less than 7 nucleotides, less
than 8 nucleotides, less than 9 nucleotides, less than 10
nucleotides, less than 11 nucleotides, less than 12 nucleotides,
less than 13 nucleotides, less than 14 nucleotides, less than 15
nucleotides, less than 16 nucleotides, less than 17 nucleotides,
less than 18 nucleotides, less than 19 nucleotides, less than 20
nucleotides, less than 21 nucleotides, less than 22 nucleotides,
less than 23 nucleotides, less than 24 nucleotides, less than 25
nucleotides, less than 26 nucleotides, less than 27 nucleotides,
less than 28 nucleotides, less than 29 nucleotides, less than 30
nucleotides, or less than 31 nucleotides.
[0020] The set of primers can include any number of primers that
allows differential amplification of the circular genome of
interest. Generally, the number of primers can vary based on the
size of the circular genome. The number of primers can also vary
based on whether the circular genome is single-stranded or
double-stranded. The number of primers can also vary based on the
desired spacing between the primers when hybridized to the circular
genome. As an example, the set of primers can comprise 2 primers, 3
primers, 4 primers, 5 primers, 6 primers, 7 primers, 8 primers, 9
primers, 10 primers, 11 primers, 12 primers, 13 primers, 14
primers, 15 primers, 16 primers, 17 primers, 18 primers, 19
primers, 20 primers, 21 primers, 22 primers, 23 primers, 24
primers, 25 primers, 26 primers, 27 primers, 28 primers, 29
primers, 30 primers, 31 primers, 32 primers, 33 primers, 34
primers, 35 primers, 36 primers, 37 primers, 38 primers, 39
primers, 40 primers, 41 primers, 42 primers, 43 primers, 44
primers, 45 primers, 46 primers, 47 primers, 48 primers, 49
primers, 50 primers, 51 primers, 52 primers, 53 primers, 54
primers, 55 primers, 56 primers, 57 primers, 58 primers, 59
primers, 60 primers, 61 primers, 62 primers, 63 primers, 75
primers, 100 primers, 150 primers, 200 primers, 300 primers, or 400
primers.
[0021] Any material or sample containing or suspected of containing
a circular genome of interest can be used as the genomic nucleic
acid sample. For example, the genomic nucleic acid sample can be a
blood sample, a urine sample, a semen sample, a lymphatic fluid
sample, a cerebrospinal fluid sample, amniotic fluid sample, a
biopsy sample, a needle aspiration biopsy sample, a cancer sample,
a tumor sample, a tissue sample, a cell sample, a cell lysate
sample, a crude cell lysate sample, a forensic sample, an
archeological sample, an infection sample, a nosocomial infection
sample, an environmental sample, or a combination thereof.
[0022] Also disclosed is a method of identifying a set of primers
for differential amplification of a circular genome. Such a method
can generally involve selecting test primers for a test set of
primers, bringing into contact the test set of primers, DNA
polymerase, and a genomic nucleic acid sample, incubating the
genomic nucleic acid sample under conditions that promote
replication of the circular genome in the genomic nucleic acid
sample, and determining the relative amplification of the circular
genome and non-target nucleic acids. The test set of primers are
identified if the circular genome is amplified at least 10 fold
compared to the non-target nucleic acids. Generally, each primer
can specifically hybridize to a nucleotide sequence in a circular
genome of interest such that the distance between consecutive
primers hybridized to the same strand of the circular genome
averages from about 200 to about 20000 nucleotides, about 200 to
about 6000 nucleotides. The test genomic nucleic acid sample
comprises the circular genome and non-target nucleic acids.
Replication of the circular genome proceeds by rolling circle
replication. Generally, the conditions that promote replication of
the circular genome do not involve thermal cycling and/or can be
substantially isothermic.
[0023] Following amplification, the amplified sequences can be used
for any purpose, such as uses known and established for amplified
sequences. For example, amplified sequences can be detected using
any of conventional detection systems for nucleic acids such as
detection of fluorescent labels, enzyme-linked detection systems,
antibody-mediated label detection, and detection of radioactive
labels. A preferred form of labeling involves labeling of the
replicated strands (that is, the strands produced in multiple
displacement amplification) using terminal deoxynucleotidyl
transferase. The replicated strands can be labeled by, for example,
the addition of modified nucleotides, such as biotinylated
nucleotides, fluorescent nucleotides, 5 methyl dCTP, BrdUTP, or
5-(3-aminoallyl)-2'-deoxyuridine 5'-triphosphates, to the 3' ends
of the replicated strands. Amplification of forensic material for
RFLP-based testing is one useful application for the disclosed
method.
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] FIG. 1 is a graph of the yield of amplification of
mitochondrial DNA using either a set of primer each 10 nucleotides
long or a set of primers each 14 nucleotides long.
[0025] FIG. 2 is a graph of Ct for a mitochondrial locus and a
nuclear locus obtained in real-time PCR of DNA amplified according
to the disclosed method using a set of primer each 10 nucleotides
long, DNA amplified according to the disclosed method using a set
of primer each 14 nucleotides long, and unamplified source DNA.
DETAILED DESCRIPTION OF THE INVENTION
[0026] The disclosed method makes use of certain materials and
procedures which allow amplification of target nucleic acid
sequences and whole genomes or other highly complex nucleic acid
samples. These materials and procedures are described in detail
below.
Materials
[0027] Disclosed are materials, compositions, and components that
can be used for, can be used in conjunction with, can be used in
preparation for, or are products of the disclosed method and
compositions. These and other materials are disclosed herein, and
it is understood that when combinations, subsets, interactions,
groups, etc. of these materials are disclosed that while specific
reference of each various individual and collective combinations
and permutation of these compounds may not be explicitly disclosed,
each is specifically contemplated and described herein. For
example, if a rolling circle replication primer is disclosed and
discussed and a number of modifications that can be made to a
number of molecules including the rolling circle replication primer
are discussed, each and every combination and permutation of the
rolling circle replication primer and the modifications that are
possible are specifically contemplated unless specifically
indicated to the contrary. Thus, if a class of molecules A, B, and
C are disclosed as well as a class of molecules D, E, and F and an
example of a combination molecule, A-D is disclosed, then even if
each is not individually recited, each is individually and
collectively contemplated. Thus, is this example, each of the
combinations A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are
specifically contemplated and should be considered disclosed from
disclosure of A, B, and C; D, E, and F; and the example combination
A-D. Likewise, any subset or combination of these is also
specifically contemplated and disclosed. Thus, for example, the
sub-group of A-E, B-F, and C-E are specifically contemplated and
should be considered disclosed from disclosure of A, B, and C; D,
E, and F; and the example combination A-D. This concept applies to
all aspects of this disclosure including, but not limited to, steps
in methods of making and using the disclosed compositions. Thus, if
there are a variety of additional steps that can be performed it is
understood that each of these additional steps can be performed
with any specific embodiment or combination of embodiments of the
disclosed methods, and that each such combination is specifically
contemplated and should be considered disclosed.
A. Circular Genome
[0028] The circular genome to be amplified can be any circular
genome of interest, such as naturally occurring circular nucleic
acids. Circular genomes include, for example, organelle genomes,
mitochondrial genomes, chloroplast genomes, plastid genomes,
bacterial plasmid genomes, viral genomes, bacterial genomes,
microbial genomes, and/or pathogen genomes. The circular genome can
be double-stranded, single-stranded, or partially
double-stranded.
[0029] The circular genome can be a naturally occurring genome, a
genome that is not artificially modified, and/or a genome that is
not an artificial nucleic acid. As used herein, a naturally
occurring genome is a genome that is substantially derived from
natural processes and occurs in nature. A naturally occurring
genome can include genetic modifications that were introduced
unnaturally (such as via recombinant or transgenic DNA techniques)
so long as the genome involved derived from natural processes and
occurs in nature. Examples of naturally occurring genomes include
organelle genomes, viral genomes, bacterial genomes, microbial
genomes, and pathogen genomes. Examples of non-naturally occurring
genomes include vectors and plasmids created via recombinant DNA
and yeast artificial chromosomes. As used herein, a genome that is
not artificially modified is a genome that has not been purposely
modified such as via recombinant or transgenic DNA techniques. As
used herein, an artificial nucleic acid is a nucleic acid purposely
created using recombinant and other artificial, non-natural
techniques.
[0030] Circular genomes occur in a variety of sizes and the
disclosed methods can be used to amplify circular genomes of any
size. For example, small viral genomes are typically between 5 and
40 kb, but some viral genomes are larger. Circular microbial
genomes are known up to 1500 kb. Accordingly, the circular genome
to be amplified can have, for example, a length of from about 3000
to about 300000 nucleotides, about 3000 to about 200000
nucleotides, about 3000 to about 150000 nucleotides, about 3000 to
about 100000 nucleotides, about 3000 to about 75000 nucleotides,
about 3000 to about 50000 nucleotides, about 3000 to about 40000
nucleotides, about 3000 to about 30000 nucleotides, about 3000 to
about 25000 nucleotides, about 3000 to about 20000 nucleotides,
about 3000 to about 18000 nucleotides, about 3000 to about 15000
nucleotides, about 3000 to about 12000 nucleotides, about 3000 to
about 10000 nucleotides, about 3000 to about 8000 nucleotides,
about 3000 to about 7000 nucleotides, about 3000 to about 6000
nucleotides, about 3000 to about 5000 nucleotides, about 3000 to
about 4000 nucleotides, about 4000 to about 300000 nucleotides,
about 5000 to about 300000 nucleotides, about 6000 to about 300000
nucleotides, about 7000 to about 300000 nucleotides, about 8000 to
about 300000 nucleotides, about 10000 to about 300000 nucleotides,
about 12000 to about 300000 nucleotides, about 15000 to about
300000 nucleotides, about 18000 to about 300000 nucleotides, about
20000 to about 300000 nucleotides, about 25000 to about 300000
nucleotides, about 30000 to about 300000 nucleotides, about 40000
to about 300000 nucleotides, about 50000 to about 300000
nucleotides, about 75000 to about 300000 nucleotides, about 100000
to about 300000 nucleotides, about 150000 to about 300000
nucleotides, about 200000 to about 300000 nucleotides, about 4000
to about 260000 nucleotides, about 4000 to about 200000
nucleotides, about 4000 to about 150000 nucleotides, about 4000 to
about 40000 nucleotides, about 5000 to about 260000 nucleotides,
about 5000 to about 200000 nucleotides, about 5000 to about 150000
nucleotides, about 5000 to about 40000 nucleotides, about 5500 to
about 260000 nucleotides, about 5500 to about 200000 nucleotides,
about 5500 to about 150000 nucleotides, about 5500 to about 40000
nucleotides, about 6000 to about 260000 nucleotides, about 6000 to
about 200000 nucleotides, about 6000 to about 150000 nucleotides,
about 6000 to about 40000 nucleotides, about 10000 to about 260000
nucleotides, about 10000 to about 200000 nucleotides, about 10000
to about 150000 nucleotides, or about 10000 to about 40000
nucleotides.
[0031] A circular genome can be in any nucleic acid sample of
interest. The source, identity, and preparation of many such
nucleic acid samples are known. It is preferred that nucleic acid
samples known or identified for use in amplification or detection
methods be used for the method described herein. The nucleic acid
sample can be, for example, a nucleic acid sample from one or more
cells, tissue, or bodily fluids such as blood, urine, semen,
lymphatic fluid, cerebrospinal fluid, or amniotic fluid, or other
biological samples, such as tissue culture cells, buccal swabs,
mouthwash, stool, tissues slices, and biopsy aspiration. Genomic
nucleic acid samples can be derived from any source including, but
not limited to, eukaryotes, plants, animals, vertebrates, fish,
mammals, humans, non-humans, bacteria, microbes, viruses,
biological sources, serum, plasma, blood, urine, semen, lymphatic
fluid, cerebrospinal fluid, amniotic fluid, biopsies, needle
aspiration biopsies, cancers, tumors, tissues, cells, cell lysates,
crude cell lysates, tissue lysates, tissue culture cells, buccal
swabs, mouthwash, stool, forensic sources, autopsies, infections,
nosocomial infections, and/or other terrestrial or
extra-terrestrial materials and sources.
[0032] The sample may also contain mixtures of material from one or
more different sources. For example, circular genomes of an
infecting bacterium or virus can be amplified in the presence of
human nucleic acids when circular genomes from such infected cells
or tissues are amplified using the disclosed methods. Types of
useful target samples include eukaryotic samples, plant samples,
animal samples, vertebrate samples, fish samples, mammalian
samples, human samples, non-human samples, bacterial samples,
microbial samples, viral samples, biological samples, serum
samples, plasma samples, blood samples, urine samples, semen
samples, lymphatic fluid samples, cerebrospinal fluid samples,
amniotic fluid samples, biopsy samples, needle aspiration biopsy
samples, cancer samples, tumor samples, tissue samples, cell
samples, cell lysate samples, crude cell lysate samples, tissue
lysate samples, tissue culture cell samples, buccal swab samples,
mouthwash samples, stool samples, forensic samples, autopsy
samples, infection samples, nosocomial infection samples, and/or
other terrestrial or extra-terrestrial samples.
[0033] B. Genomic Nucleic Acid Samples Genomic nucleic acid
molecules can be any nucleic acid from any source. In general, the
disclosed method is performed using a sample that contains (or is
suspected of containing) circular genomes to be amplified. Samples
containing, or suspected of containing, circular genomes can also
be referred to as genomic nucleic acid samples. Samples, such as
genomic nucleic acid samples can comprise circular genomes. Cell
and tissue samples are a form of genomic nucleic acid sample.
Samples for use in the disclosed methods can also be samples that
are to be tested for the presence of circular genomes (that is,
samples that may or may not contain circular genomes). A genomic
nucleic acid sample is a form of nucleic acid sample and a form of
sample. Reference herein to a sample encompasses nucleic acid
samples and genomic samples unless the context clearly indicates
otherwise. Reference herein to a nucleic acid sample encompasses
genomic nucleic acid samples unless the context clearly indicates
otherwise.
[0034] A sample can comprise a circular genome, and the circular
genome can comprise any fraction of the nucleic acids in the
sample. The circular genome can comprise, for example, at least 1
copy, at least 10 copies, at least 100 copies, at least 1000
copies, at least more than 1000 copies, or at least 0.001%, at
least 0.01%, at least 0.1%, at least 1%, or more of the nucleic
acids in the sample.
[0035] The nucleic acids in a sample need not be pure to be
amplified in the disclosed methods. Some forms of the disclosed
methods are useful for amplifying impure nucleic acid samples, such
as crude cell lysates. The nucleic acids in a sample or in a
stabilized or neutralized sample can be, for example, less than
0.01% pure, less than 0.5% pure, less than 0.1% pure, less than
0.2% pure, less than 0.4% pure, less than 0.6% pure, less than 0.8%
pure, less than 1% pure, less than 2% pure, less than 3% pure, less
than 4% pure, less than 5% pure, less than 6% pure, less than 8%
pure, less than 10% pure, less than 15% pure, less than 20% pure,
less than 25% pure, less than 30% pure, less than 40% pure, or less
than 50% pure by weight excluding water.
[0036] A genomic nucleic acid sample can be any nucleic acid sample
of interest. The source, identity, and preparation of many such
nucleic acid samples are known. It is preferred that nucleic acid
samples known or identified for use in amplification or detection
methods be used for the method described herein. The nucleic acid
sample can be, for example, a nucleic acid sample comprising or
derived from one or more eukaryotes, plants, animals, vertebrates,
fish, mammals, humans, non-humans, bacteria, microbes, viruses,
biological sources, serum, plasma, blood, urine, semen, lymphatic
fluid, cerebrospinal fluid, amniotic fluid, biopsies, needle
aspiration biopsies, cancers, tumors, tissues, cells, cell lysates,
crude cell lysates, tissue lysates, tissue culture cells, buccal
swabs, mouthwash, stool, forensic sources, autopsies, infections,
nosocomial infections, and/or other terrestrial or
extra-terrestrial materials and sources. Types of useful nucleic
acid samples include eukaryotic samples, plant samples, animal
samples, vertebrate samples, fish samples, mammalian samples, human
samples, non-human samples, bacterial samples, microbial samples,
viral samples, biological samples, serum samples, plasma samples,
blood samples, urine samples, semen samples, lymphatic fluid
samples, cerebrospinal fluid samples, amniotic fluid samples,
biopsy samples, needle aspiration biopsy samples, cancer samples,
tumor samples, tissue samples, cell samples, cell lysate samples,
crude cell lysate samples, tissue lysate samples, tissue culture
cell samples, buccal swab samples, mouthwash samples, stool
samples, forensic samples, autopsy samples, infection samples,
nosocomial infection samples, and/or other terrestrial or
extra-terrestrial samples.
[0037] It is unnecessary to have prior knowledge of whether or not
a sample contains amplifiable circular genomes. Some forms of the
disclosed methods can be employed to test whether or not a sample
suspected of containing circular genomes actually does contain
circular genomes. Production of amplified DNA from such samples
using the disclosed method is evidence that the sample contained
circular genomes.
[0038] The genomic nucleic acid sample can be from a single cell.
The genomic nucleic acid sample can be, or can be derived from, for
example, one or more whole genomes from the same or different
organisms, tissues, cells or a combination; one or more partial
genomes from the same or different organisms, tissues, cells or a
combination; one or more whole chromosomes from the same or
different organisms, tissues, cells or a combination; one or more
partial chromosomes from the same or different organisms, tissues,
cells or a combination; one or more chromosome fragments from the
same or different organisms, tissues, cells or a combination; one
or more artificial chromosomes; one or more yeast artificial
chromosomes; one or more bacterial artificial chromosomes; one or
more cosmids; or any combination of these.
[0039] Samples can be used and manipulated in the disclosed
methods. For example, a sample can be exposed to alkaline
conditions or brought into contact or mixed with a lysis solution
or denaturing solution. Lysis can be performed, for example, by
mild lysis solutions such as low salt solutions that result
hypotonic burst of cells or harsh lysis such as lysis solutions
containing alkaline or chaotropic salts or organic sovents. Nucleic
acid samples may be purified or may be crude lysates. Nucleic acid
samples can be further manipulated by adding substances for
different purposes such as e.g. stabilizing of biomolecules, better
accessibility of biomolecules, neutralizing inhibitory substances,
degrading contaminating molecules, separation of biomolecules.
Nucleic acid samples can be further manipulated by adding enzymes
for different purpose e.g. eliminating proteins (proteases:
Protease K, Trypsin, Chymotrypsin, Collagenase, or other enzymes
deemed to be suitable by the artisan), elimanting nucleic acids
(e.g. RNases, Exonucleases, see also U.S. Pat. No. 6,242,220 Wahle
et al.), polysaccharides (e.g. Amylase, Pectinases, Glycosylases,
Hyaluronidase). As used herein, the term sample refers both to
source samples, samples used in the disclosed methods in whole, and
to portions of source samples used in the disclosed methods. Thus,
for example, a portion of a source sample that is exposed to
alkaline conditions is considered to be a sample itself. All or a
portion of a sample can be exposed to alkaline conditions or
brought into contact or mixed with a lysis solution or denaturing
solution. Similarly, the pH of all or a portion of a sample exposed
to alkaline conditions or brought into contact or mixed with a
lysis solution or denaturing solution can be reduced, or all or a
portion of a sample exposed to alkaline conditions or brought into
contact with a lysis solution or denaturing solution can be brought
into contact or mixed with a stabilization solution. All or a
portion of the resulting stabilized or neutralized sample can be
incubated under conditions that promote replication of nucleic
acids. An amplification mixture can comprise all or a portion of a
stabilized or neutralized sample. An amplification mixture is the
reaction solution where nucleic acids are amplified.
C. Primers
[0040] Primers for use in the disclosed amplification method are
oligonucleotides having sequence complementary to a target
sequence. In the disclosed method, the target sequence can be a
sequence in a circular genome of interest or the complement of a
sequence in a circular genome of interest. This sequence is
referred to as the complementary portion of the primer. The
complementary portion of a primer can be any length that supports
specific and stable hybridization between the primer and the target
sequence under the reaction conditions. Generally, for reactions at
37.degree. C., this can be 10 to 35 nucleotides long or 10 to 24
nucleotides long. Generally, for reactions at 30.degree. C., this
can be, for example, 6 to 20 nucleotides long or 8 to 12
nucleotides long. The primers can be, for example, from 6 to 60
nucleotides long or 8 to 60 nucleotides long, and in particular,
can be 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and/or
20 nucleotides long. The primers also can be, for example, at least
6 nucleotides long, at least 7 nucleotides long, at least 8
nucleotides long, at least 9 nucleotides long, at least 10
nucleotides long, at least 11 nucleotides long, and/or at least 12
nucleotides long.
[0041] It has been discovered that design and selection of primers
for a set of primers allows differential amplification of circular
genomes as described herein. The primers can each comprise or have
a specific nucleotide sequence. All or a part of the specific
nucleotide sequence can be complementary to a sequence in the
circular genome. The primers can also include portions and/or
sequences that are not complementary to the circular genome. The
primers can specifically hybridize to a nucleotide sequence in the
circular genome. For example, the primers can specifically
hybridize to a nucleotide sequence in the circular genome under the
conditions that promote replication of the circular genome.
Generally each primer in a set of primers can hybridize to a
different sequence and/or at a different location in the circular
genome.
[0042] The primers used in an amplification reaction need not be
all of the same length, although this is preferred. For example,
the primers can each separately have a length of, and/or can have a
complementary portion having a length of, 5 nucleotides, 6
nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10
nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14
nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18
nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22
nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26
nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, or 30
nucleotides. As another example, the primers can each separately
have a length of, and/or can have a complementary portion having a
length of, less than 6 nucleotides, less than 7 nucleotides, less
than 8 nucleotides, less than 9 nucleotides, less than 10
nucleotides, less than 11 nucleotides, less than 12 nucleotides,
less than 13 nucleotides, less than 14 nucleotides, less than 15
nucleotides, less than 16 nucleotides, less than 17 nucleotides,
less than 18 nucleotides, less than 19 nucleotides, less than 20
nucleotides, less than 21 nucleotides, less than 22 nucleotides,
less than 23 nucleotides, less than 24 nucleotides, less than 25
nucleotides, less than 26 nucleotides, less than 27 nucleotides,
less than 28 nucleotides, less than 29 nucleotides, less than 30
nucleotides, or less than 31 nucleotides.
[0043] It is preferred that, when hybridized to nucleic acid
molecules in a nucleic acid sample, the primers hybridize at
intervals that allow efficient amplification. This generally can be
accomplished by using a number of primers in the amplification
reaction such that the primers collectively will be complementary
to sequence in the nucleic acid sample at desired intervals. Thus,
for example, each primer can specifically hybridize to a nucleotide
sequence in a circular genome of interest such that the distance
between consecutive primers hybridized to the same strand of the
circular genome averages from about 200 to about 20000 nucleotides,
about 200 to about 6000 nucleotides.
[0044] The primers can specifically hybridize to a nucleotide
sequence in a circular genome of interest such that the distance
between consecutive primers hybridized to the same strand of the
circular genome averages 10,000 nucleotides or less, 9,500
nucleotides or less, 9,000 nucleotides or less, 8,500 nucleotides
or less, 8,000 nucleotides or less, 7,500 nucleotides or less,
7,000 nucleotides or less, 6,500 nucleotides or less, 6,000
nucleotides or less, 5,500 nucleotides or less, 5,000 nucleotides
or less, 4,500 nucleotides or less, 4,000 nucleotides or less,
3,500 nucleotides or less, 3,000 nucleotides or less, 2,500
nucleotides or less, 2,000 nucleotides or less, 1,500 nucleotides
or less, 1,000 nucleotides or less, 900 nucleotides or less, 800
nucleotides or less, 700 nucleotides or less, 600 nucleotides or
less, 500 nucleotides or less, 400 nucleotides or less, 300
nucleotides or less, 200 nucleotides or less, 100 nucleotides or
less, or 50 nucleotides or less. A minimum separation within such
averages can also be specified.
[0045] The optimal interval or separation distance between primer
complementary sequences (and thus, the optimum number of primers)
will not be the same for all DNA polymerases, because this
parameter is dependent on the net polymerization rate. To obtain an
optimal yield in the disclosed method, the number of primers and
their composition can be adjusted to suit the polymerase being
used. Use of fewer primers is preferred when using a polymerase
with a rapid polymerization rate. Use of more primers is preferred
when using a polymerase with a slower polymerization rate. Also
disclosed is a method of identifying a set of primers for
differential amplification of a circular genome. Such a method can
generally involve selecting test primers for a test set of primers,
bringing into contact the test set of primers, DNA polymerase, and
a genomic nucleic acid sample, incubating the genomic nucleic acid
sample under conditions that promote replication of the circular
genome in the genomic nucleic acid sample, and determining the
relative amplification of the circular genome and non-target
nucleic acids. The test set of primers are identified if the
circular genome is amplified at least 10 fold compared to the
non-target nucleic acids.
[0046] The following assay can also be used to determine optimal
spacing with any circular genome of interest. The assay uses some
combination of two, three, four, five, six, seven, eight, nine,
ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen,
seventeen, eighteen, nineteen, and twenty or more primers. For a
given circular genome of interest, each new primer reduces the
average distance between complementary sequences in the circular
genome. The number of primers can be varied systematically between
a range of primer numbers (the average distance between priming
sites varies with the number of primers used). A series of
reactions can be performed in which the same nucleic acid sample is
amplified using the different numbers of primers. The number of
primers that produces the highest experimental yield of DNA is the
optimal primer number for the specific DNA polymerase, or DNA
polymerase plus accessory protein combination being used. This
assay can also be used to determine optimal spacing with any
polymerase.
[0047] DNA replication initiated at the sites in nucleic acid
molecules where the primers hybridize will extend to and displace
strands being replicated from primers hybridized at adjacent sites.
Displacement of an adjacent strand makes it available for
hybridization to another primer and subsequent initiation of
another round of replication. This process is referred to herein as
strand displacement replication.
[0048] When the circular genome is double-stranded or partially
double-stranded, one or more of the primers can have a nucleotide
sequence complementary to one of the strands of the circular genome
and one or more of the primers can have a nucleotide sequence
complementary to the other strand of the circular genome, all of
the primers can have a nucleotide sequence complementary to one of
the strands of the circular genome, or all of the primers can have
a nucleotide sequence complementary to the other strand of the
circular genome. Generally, amplification will be more efficient if
some of the primers are complementary to one strand and other
primers are complementary to the other strand. Rolling circle
replication of either or each strand of the circular genome will
result in the formation of tandem sequence DNA complementary to
that strand.
[0049] When the circular genome is single-stranded, the primers can
have a nucleotide sequence complementary to the circular genome.
Rolling circle replication of the single-stranded circular genome
will result in the formation of tandem sequence DNA complementary
to the circular genome. In some forms of the method, one or more of
the primers can also have a nucleotide sequence that matches a
sequence of the circular genome. In this case, the one or more of
the primers that have a nucleotide sequence that matches a sequence
of the circular genome can prime strand displacement replication of
the tandem sequence DNA produced by rolling circle replication of
the single-stranded circular genome by the primers that have a
nucleotide sequence complementary to the circular genome.
Replication of the tandem sequence DNA results in formation of
secondary tandem sequence DNA.
[0050] When the circular genome is partially double-stranded (for
example, where one strand is a continuous, closed circular strand
and the other strand is discontinuous and non-circular), the
primers can have a nucleotide sequence complementary to the
circular strand of the circular genome. Rolling circle replication
of the circular strand will result in the formation of tandem
sequence DNA complementary to the circular strand. In some forms of
the method, one or more of the primers can also have a nucleotide
sequence that matches a sequence of the circular strand of the
circular genome and/or is complementary to the non-circular strand
of the circular genome. In this case, the one or more of the
primers that have a nucleotide sequence that matches a sequence of
the circular genome and/or is complementary to the non-circular
strand of the circular genome can prime strand displacement
replication of the tandem sequence DNA produced by rolling circle
replication of the circular strand of the circular genome by the
primers that have a nucleotide sequence complementary to the
circular strand of the circular genome. Replication of the tandem
sequence DNA results in formation of secondary tandem sequence DNA.
Primers that have a nucleotide sequence that matches a sequence of
the circular genome can be referred to as secondary DNA strand
displacement primers.
[0051] The set of primers can include any number of primers that
allows differential amplification of the circular genome of
interest. Generally, the number of primers can vary based on the
size of the circular genome. The number of primers can also vary
based on whether the circular genome is single-stranded or
double-stranded. The number of primers can also vary based on the
desired spacing between the primers when hybridized to the circular
genome. For example, the set of primers can comprise 2 primers, 3
primers, 4 primers, 5 primers, 6 primers, 7 primers, 8 primers, 9
primers, 10 primers, 11 primers, 12 primers, 13 primers, 14
primers, 15 primers, 16 primers, 17 primers, 18 primers, 19
primers, 20 primers, 21 primers, 22 primers, 23 primers, 24
primers, 25 primers, 26 primers, 27 primers, 28 primers, 29
primers, 30 primers, 31 primers, 32 primers, 33 primers, 34
primers, 35 primers, 36 primers, 37 primers, 38 primers, 39
primers, 40 primers, 41 primers, 42 primers, 43 primers, 44
primers, 45 primers, 46 primers, 47 primers, 48 primers, 49
primers, 50 primers, 51 primers, 52 primers, 53 primers, 54
primers, 55 primers, 56 primers, 57 primers, 58 primers, 59
primers, 60 primers, 61 primers, 62 primers, 63 primers, 75
primers, 100 primers, 150 primers, 200 primers, 300 primers, or 400
primers. There is no fundamental upper limit to the number of
primers that can be used. Generally, the number of primers used can
be chosen based on the size of the circular genome to be amplified
and the average spacing between primers. When multiple primers are
used, the primers should each have a different specific nucleotide
sequence.
[0052] The primers used in the disclosed method can be selected
and/or designed to have certain desirable features and functional
characteristics. The goal of primer selection and primer design can
be obtaining better amplification results. For example, particular
primers can be selected that result in the highest amplification
yield (that is, the highest amount of increase in the amount of
nucleic acid), and/or the differential amplification of the
circular genome compared to non-target sequences. This can be
determined by testing particular primers in amplification reactions
using a nucleic acid sample of interest. Different primers may
produce optimal results for different nucleic acid samples.
However, the primer number and primer composition principles
described herein will generally produce good amplification results
with most circular genomes.
[0053] The primers can also have other characteristics that can,
for example, increase amplification yield and reduce production of
artifacts or artifactual amplification. For example, generation of
primer dimer artifacts can be reduced by designing primers to avoid
3' end sequences that are complementary, either between primers or
within the same primer. Such sequences to be avoided can be
referred to as inter-complementary 3' ends. A useful measure of a
primer's ability to avoid artifactual amplification is the lack or
relative insignificance of amplification (that is, nucleic acid
produced) when the primer is used in an amplification reaction
without a nucleic acid sample.
[0054] The primers can be composed in various ways. For example,
the primers can each separately comprise deoxyribonucleotides,
ribonucloetides, modified nucleotides, nucleotide analogs, labelled
nucleotides, oligomer analogs, or a combination. In some forms of
the disclosed methods and compositions, the primers can each
contain at least one modified nucleotide such that the primers are
nuclease resistant.
[0055] The disclosed primers can have one or more modified
nucleotides. Such primers are referred to herein as modified
primers. Modified primers have several advantages. First, some
forms of modified primers, such as RNA/2'-O-methyl RNA chimeric
primers, have a higher melting temperature (Tm) than DNA primers.
This increases the stability of primer hybridization and will
increase strand invasion by the primers. This will lead to more
efficient priming. Also, since the primers are made of RNA, they
will be exonuclease resistant. Such primers, if tagged with minor
groove binders at their 5' end, will also have better strand
invasion of the template dsDNA.
[0056] Chimeric primers can also be used. Chimeric primers are
primers having at least two types of nucleotides, such as both
deoxyribonucleotides and ribonucleotides, ribonucleotides and
modified nucleotides, or two different types of modified
nucleotides. One form of chimeric primer is peptide nucleic
acid/nucleic acid primers. For example, 5'-PNA-DNA-3' or
5'-PNA-RNA-3' primers may be used for more efficient strand
invasion and polymerization invasion. The DNA and RNA portions of
such primers can have random or degenerate sequences. Other forms
of chimeric primers are, for example, 5'-(2'-O-Methyl) RNA-RNA-3'
or 5'-(2'-O-Methyl) RNA-DNA-3'.
[0057] Many modified nucleotides (nucleotide analogs) are known and
can be used in oligonucleotides. A nucleotide analog is a
nucleotide which contains some type of modification to either the
base, sugar, or phosphate moieties. Modifications to the base
moiety would include natural and synthetic modifications of A, C,
G, and T/U as well as different purine or pyrimidine bases, such as
uracil-5-yl, hypoxanthin-9-yl (I), and 2-aminoadenin-9-yl. A
modified base includes but is not limited to 5-methylcytosine
(5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine,
2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and
guanine, 2-propyl and other alkyl derivatives of adenine and
guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine,
5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo
uracil, cytosine and thymine, 5-uracil (pseudouracil),
4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and
other 8-substituted adenines and guanines, 5-halo particularly
5-bromo, 5-trifluoromethyl and other 5-substituted uracils and
cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine. Additional base modifications can be found for
example in U.S. Pat. No. 3,687,808, Englisch et al., Angewandte
Chemie, International Edition, 1991, 30, 613, and Sanghvi, Y. S.,
Chapter 15, Antisense Research and Applications, pages 289-302,
Crooke, S. T. and Lebleu, B. ed., CRC Press, 1993. Certain
nucleotide analogs, such as 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine can increase the stability of
duplex formation. Other modified bases are those that function as
universal bases. Universal bases include 3-nitropyrrole and
5-nitroindole. Universal bases substitute for the normal bases but
have no bias in base pairing. That is, universal bases can base
pair with any other base. Primers composed, either in whole or in
part, of nucleotides with universal bases are useful for reducing
or eliminating amplification bias against repeated sequences in a
target sample. This would be useful, for example, where a loss of
sequence complexity in the amplified products is undesirable. Base
modifications often can be combined with for example a sugar
modification, such as 2'-O-methoxyethyl, to achieve unique
properties such as increased duplex stability. There are numerous
United States patents such as U.S. Pat. Nos. 4,845,205; 5,130,302;
5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255;
5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121,
5,596,091; 5,614,617; and 5,681,941, which detail and describe a
range of base modifications. Each of these patents is herein
incorporated by reference.
[0058] Nucleotide analogs can also include modifications of the
sugar moiety. Modifications to the sugar moiety would include
natural modifications of the ribose and deoxyribose as well as
synthetic modifications. Sugar modifications include but are not
limited to the following modifications at the 2' position: OH; F;
O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or
O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be
substituted or unsubstituted C1 to C10, alkyl or C2 to C10 alkenyl
and alkynyl. 2' sugar modifications also include but are not
limited to --O[(CH.sub.2)n O]m CH.sub.3, --O(CH.sub.2)n OCH.sub.3,
--O(CH.sub.2)n NH.sub.2, --O(CH.sub.2)n CH.sub.3, --O(CH.sub.2)n
--ONH.sub.2, and --O(CH.sub.2)nON[(CH.sub.2)n CH.sub.3)].sub.2,
where n and m are from 1 to about 10.
[0059] Other modifications at the 2' position include but are not
limited to: C1 to C10 lower alkyl, substituted lower alkyl,
alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl,
Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2 CH.sub.3,
ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl,
heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted
silyl, an RNA cleaving group, a reporter group, an intercalator, a
group for improving the pharmacokinetic properties of an
oligonucleotide, or a group for improving the pharmacodynamic
properties of an oligonucleotide, and other substituents having
similar properties. Similar modifications may also be made at other
positions on the sugar, particularly the 3' position of the sugar
on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides
and the 5' position of 5' terminal nucleotide. Modified sugars
would also include those that contain modifications at the bridging
ring oxygen, such as CH.sub.2 and S. Nucleotide sugar analogs may
also have sugar mimetics such as cyclobutyl moieties in place of
the pentofuranosyl sugar. There are numerous United States patents
that teach the preparation of such modified sugar structures such
as U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044;
5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811;
5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873;
5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is
herein incorporated by reference in its entirety.
[0060] Nucleotide analogs can also be modified at the phosphate
moiety. Modified phosphate moieties include but are not limited to
those that can be modified so that the linkage between two
nucleotides contains a phosphorothioate, chiral phosphorothioate,
phosphorodithioate, phosphotriester, aminoalkylphosphotriester,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonate and chiral phosphonates, phosphinates, phosphoramidates
including 3'-amino phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, and boranophosphates. It is understood
that these phosphate or modified phosphate linkages between two
nucleotides can be through a 3'-5' linkage or a 2'-5' linkage, and
the linkage can contain inverted polarity such as 3'-5' to 5'-3' or
2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are
also included. Numerous United States patents teach how to make and
use nucleotides containing modified phosphates and include but are
not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301;
5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302;
5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233;
5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111;
5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is
herein incorporated by reference.
[0061] It is understood that nucleotide analogs need only contain a
single modification, but may also contain multiple modifications
within one of the moieties or between different moieties.
[0062] Nucleotide substitutes are molecules having similar
functional properties to nucleotides, but which do not contain a
phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide
substitutes are molecules that will recognize and hybridize to
complementary nucleic acids in a Watson-Crick or Hoogsteen manner,
but which are linked together through a moiety other than a
phosphate moiety. Nucleotide substitutes are able to conform to a
double helix type structure when interacting with the appropriate
target nucleic acid.
[0063] Nucleotide substitutes are nucleotides or nucleotide analogs
that have had the phosphate moiety and/or sugar moieties replaced.
Nucleotide substitutes do not contain a standard phosphorus atom.
Substitutes for the phosphate can be for example, short chain alkyl
or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl
or cycloalkyl internucleoside linkages, or one or more short chain
heteroatomic or heterocyclic internucleoside linkages. These
include those having morpholino linkages (formed in part from the
sugar portion of a nucleoside); siloxane backbones; sulfide,
sulfoxide and sulfone backbones; formacetyl and thioformacetyl
backbones; methylene formacetyl and thioformacetyl backbones;
alkene containing backbones; sulfamate backbones; methyleneimino
and methylenehydrazino backbones; sulfonate and sulfonamide
backbones; amide backbones; and others having mixed N, O, S and CH2
component parts. Numerous United States patents disclose how to
make and use these types of phosphate replacements and include but
are not limited to U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and
5,677,439, each of which is herein incorporated by reference.
[0064] It is also understood in a nucleotide substitute that both
the sugar and the phosphate moieties of the nucleotide can be
replaced, by for example an amide type linkage (aminoethylglycine)
(PNA). U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262 teach how
to make and use PNA molecules, each of which is herein incorporated
by reference. (See also Nielsen et al., Science 254:1497-1500
(1991)).
[0065] Primers can be comprised of nucleotides and can be made up
of different types of nucleotides or the same type of nucleotides.
For example, one or more of the nucleotides in a primer can be
ribonucleotides, 2'-O-methyl ribonucleotides, or a mixture of
ribonucleotides and 2'-O-methyl ribonucleotides; about 10% to about
50% of the nucleotides can be ribonucleotides, 2'-O-methyl
ribonucleotides, or a mixture of ribonucleotides and 2'-O-methyl
ribonucleotides; about 50% or more of the nucleotides can be
ribonucleotides, 2'-O-methyl ribonucleotides, or a mixture of
ribonucleotides and 2'-O-methyl ribonucleotides; or all of the
nucleotides are ribonucleotides, 2'-O-methyl ribonucleotides, or a
mixture of ribonucleotides and 2'-O-methyl ribonucleotides. The
nucleotides can be comprised of bases (that is, the base portion of
the nucleotide) and can (and normally will) comprise different
types of bases. For example, one or more of the bases can be
universal bases, such as 3-nitropyrrole or 5-nitroindole; about 10%
to about 50% of the bases can be universal bases; about 50% or more
of the bases can be universal bases; or all of the bases can be
universal bases.
[0066] Primers may, but need not, also contain additional sequence
at the 5' end of the primer that is not complementary to the target
sequence. This sequence is referred to as the non-complementary
portion of the primer. The non-complementary portion of the primer,
if present, serves to facilitate strand displacement during DNA
replication. The non-complementary portion of the primer can also
include a functional sequence such as a promoter for an RNA
polymerase. The non-complementary portion of a primer may be any
length, but is generally 1 to 100 nucleotides long, and preferably
4 to 8 nucleotides long. The use of a non-complementary portion is
not preferred when random or partially random primers are used for
whole genome amplification.
[0067] It is specifically contemplated that use of conditions that
allow or are compatible with substantial, significant or notable
mismatch hybridization of the primers to nucleic acid molecules
being amplified can be excluded. As used herein, substantial
mismatch hybridization of a primer refers to hybridization where
90% or more of the primer nucleotides are unpaired to nucleotides
in the hybridization partner. Significant mismatch hybridization of
a primer refers to hybridization where 50% or more of the primer
nucleotides are unpaired to nucleotides in the hybridization
partner. Notable mismatch hybridization of a primer refers to
hybridization where 10% or more of the primer nucleotides are
unpaired to nucleotides in the hybridization partner. Choosing
conditions that avoid or that are not compatible with substantial
or significant or notable mismatch hybridization of the primers
emphasizes the use of specific or substantially specific
hybridization of the primers in the disclosed method.
[0068] An important factor for conditions that do or do not allow,
or that are or are not compatible with, a given level of mismatch
hybridization is the temperature at which the amplification is
carried out. Thus, for example, a temperature significantly below
the melting temperature of a primer generally would allow a higher
level of mismatch hybridization by that primer than a temperature
closer to its melting temperature because hybrids involving only
some of the nucleotides in the primer would be stable at the lower
temperature. In this way, the reaction temperature (that is, the
temperature at which the nucleic acid sample, primer and DNA
polymerase are incubated for amplification) affects the level of
mismatch hybridization and the intervals at which primers will
hybridize to nucleotide sequences in the nucleic acid sample.
[0069] To make use of primer specificity in the disclosed method,
the primers can be designed (or, conversely, the incubation
temperature can be chosen) to reduce the level of mismatch
hybridization. In general, this can involve use of lower incubation
temperatures for shorter primers and higher incubation temperatures
for longer primers. As deemed suitable and desirable, the primers
can be designed for use at, and/or the amplification reaction can
be incubated at 20.degree. C., 21.degree. C., 22.degree. C.,
23.degree. C., 24.degree. C., 25.degree. C., 26.degree. C.,
27.degree. C., 28.degree. C., 29.degree. C., 30.degree. C.,
31.degree. C., 32.degree. C., 33.degree. C., 34.degree. C.,
35.degree. C., 36.degree. C., 37.degree. C., 38.degree. C.,
39.degree. C., 40.degree. C., 41.degree. C., 42.degree. C.,
43.degree. C., 44.degree. C., 45.degree. C., 46.degree. C.,
47.degree. C., 48.degree. C., 49.degree. C., 50.degree. C.,
51.degree. C., 52.degree. C., 53.degree. C., 54.degree. C.,
55.degree. C., 56.degree. C., 57.degree. C., 58.degree. C.,
59.degree. C., 60.degree. C., 61.degree. C., 62.degree. C.,
63.degree. C., 64.degree. C., 65.degree. C., 66.degree. C.,
67.degree. C., 68.degree. C., 69.degree. C., 70.degree. C.,
71.degree. C., 72.degree. C., 73.degree. C., 74.degree. C.,
75.degree. C., 76.degree. C., 77.degree. C., 78.degree. C.,
79.degree. C., or 80.degree. C. The primers can be designed for use
at, and/or the amplification reaction can be incubated at less than
21.degree. C., less than 22.degree. C., less than 23.degree. C.,
less than 24.degree. C., less than 25.degree. C., less than
26.degree. C., less than 27.degree. C., less than 28.degree. C.,
less than 29.degree. C., less than 30.degree. C., less than
31.degree. C., less than 32.degree. C., less than 33.degree. C.,
less than 34.degree. C., less than 35.degree. C., less than
36.degree. C., less than 37.degree. C., less than 38.degree. C.,
less than 39.degree. C., less than 40.degree. C., less than
41.degree. C., less than 42.degree. C., less than 43.degree. C.,
less than 44.degree. C., less than 45.degree. C., less than
46.degree. C., less than 47.degree. C., less than 48.degree. C.,
less than 49.degree. C., less than 50.degree. C., less than
51.degree. C., less than 52.degree. C., less than 53.degree. C.,
less than 54.degree. C., less than 55.degree. C., less than
56.degree. C., less than 57.degree. C., less than 58.degree. C.,
less than 59.degree. C., less than 60.degree. C., less than
61.degree. C., less than 62.degree. C., less than 63.degree. C.,
less than 64.degree. C., less than 65.degree. C., less than
66.degree. C., less than 67.degree. C., less than 68.degree. C.,
less than 69.degree. C., less than 70.degree. C., less than
71.degree. C., less than 72.degree. C., less than 73.degree. C.,
less than 74.degree. C., less than 75.degree. C., less than
76.degree. C., less than 77.degree. C., less than 78.degree. C.,
less than 79.degree. C., or less than 80.degree. C.
[0070] 1. Detection Tags
[0071] The non-complementary portion of a primer can include
sequences to be used to further manipulate or analyze amplified
sequences. An example of such a sequence is a detection tag, which
is a specific nucleotide sequence present in the non-complementary
portion of a primer. Detection tags have sequences complementary to
detection probes. Detection tags can be detected using their
cognate detection probes. Detection tags become incorporated at the
ends of amplified strands. The result is amplified DNA having
detection tag sequences that are complementary to the complementary
portion of detection probes. If present, there may be one, two,
three, or more than three detection tags on a primer. It is
preferred that a primer have one, two, three or four detection
tags. Most preferably, a primer will have one detection tag.
Generally, it is preferred that a primer have 10 detection tags or
less. There is no fundamental limit to the number of detection tags
that can be present on a primer except the size of the primer. When
there are multiple detection tags, they may have the same sequence
or they may have different sequences, with each different sequence
complementary to a different detection probe. It is preferred that
a primer contain detection tags that have the same sequence such
that they are all complementary to a single detection probe. For
some multiplex detection methods, it is preferable that primers
contain up to six detection tags and that the detection tag
portions have different sequences such that each of the detection
tag portions is complementary to a different detection probe. A
similar effect can be achieved by using a set of primers where each
has a single different detection tag. The detection tags can each
be any length that supports specific and stable hybridization
between the detection tags and the detection probe. For this
purpose, a length of 10 to 35 nucleotides is preferred, with a
detection tag portion 15 to 20 nucleotides long being most
preferred.
[0072] 2. Address Tag
[0073] Another example of a sequence that can be included in the
non-complementary portion of a primer is an address tag. An address
tag has a sequence complementary to an address probe. Address tags
become incorporated at the ends of amplified strands. The result is
amplified DNA having address tag sequences that are complementary
to the complementary portion of address probes. If present, there
may be one, or more than one, address tag on a primer. It is
preferred that a primer have one or two address tags. Most
preferably, a primer will have one address tag. Generally, it is
preferred that a primer have 10 address tags or less. There is no
fundamental limit to the number of address tags that can be present
on a primer except the size of the primer. When there are multiple
address tags, they may have the same sequence or they may have
different sequences, with each different sequence complementary to
a different address probe. It is preferred that a primer contain
address tags that have the same sequence such that they are all
complementary to a single address probe. The address tag portion
can be any length that supports specific and stable hybridization
between the address tag and the address probe. For this purpose, a
length between 10 and 35 nucleotides long is preferred, with an
address tag portion 15 to 20 nucleotides long being most
preferred.
D. Fluorescent Change Probes and Primers
[0074] Fluorescent change probes and fluorescent change primers
refer to all probes and primers that involve a change in
fluorescence intensity or wavelength based on a change in the form
or conformation of the probe or primer and nucleic acid to be
detected, assayed or replicated. Examples of fluorescent change
probes and primers include molecular beacons, Amplifluors, FRET
probes, cleavable FRET probes, TaqMan probes, scorpion primers,
fluorescent triplex oligos, fluorescent water-soluble conjugated
polymers, PNA probes and QPNA probes.
[0075] Fluorescent change probes and primers can be classified
according to their structure and/or function. Fluorescent change
probes include hairpin quenched probes, cleavage quenched probes,
cleavage activated probes, and fluorescent activated probes.
Fluorescent change primers include stem quenched primers and
hairpin quenched primers. The use of several types of fluorescent
change probes and primers are reviewed in Schweitzer and Kingsmore,
Curr. Opin. Biotech. 12:21-27 (2001). Hall et al., Proc. Natl.
Acad. Sci. USA 97:8272-8277 (2000), describe the use of fluorescent
change probes with Invader assays.
[0076] Hairpin quenched probes are probes that when not bound to a
target sequence form a hairpin structure (and, typically, a loop)
that brings a fluorescent label and a quenching moiety into
proximity such that fluorescence from the label is quenched. When
the probe binds to a target sequence, the stem is disrupted, the
quenching moiety is no longer in proximity to the fluorescent label
and fluorescence increases. Examples of hairpin quenched probes are
molecular beacons, fluorescent triplex oligos, and QPNA probes.
[0077] Cleavage activated probes are probes where fluorescence is
increased by cleavage of the probe. Cleavage activated probes can
include a fluorescent label and a quenching moiety in proximity
such that fluorescence from the label is quenched. When the probe
is clipped or digested (typically by the 5'-3' exonuclease activity
of a polymerase during amplification), the quenching moiety is no
longer in proximity to the fluorescent label and fluorescence
increases. TaqMan probes (Holland et al., Proc. Natl. Acad. Sci.
USA 88:7276-7280 (1991)) are an example of cleavage activated
probes.
[0078] Cleavage quenched probes are probes where fluorescence is
decreased or altered by cleavage of the probe. Cleavage quenched
probes can include an acceptor fluorescent label and a donor moiety
such that, when the acceptor and donor are in proximity,
fluorescence resonance energy transfer from the donor to the
acceptor causes the acceptor to fluoresce. The probes are thus
fluorescent, for example, when hybridized to a target sequence.
When the probe is clipped or digested (typically by the 5'-3'
exonuclease activity of a polymerase during amplification), the
donor moiety is no longer in proximity to the acceptor fluorescent
label and fluorescence from the acceptor decreases. If the donor
moiety is itself a fluorescent label, it can release energy as
fluorescence (typically at a different wavelength than the
fluorescence of the acceptor) when not in proximity to an acceptor.
The overall effect would then be a reduction of acceptor
fluorescence and an increase in donor fluorescence. Donor
fluorescence in the case of cleavage quenched probes is equivalent
to fluorescence generated by cleavage activated probes with the
acceptor being the quenching moiety and the donor being the
fluorescent label. Cleavable FRET (fluorescence resonance energy
transfer) probes are an example of cleavage quenched probes.
[0079] Fluorescent activated probes are probes or pairs of probes
where fluorescence is increased or altered by hybridization of the
probe to a target sequence. Fluorescent activated probes can
include an acceptor fluorescent label and a donor moiety such that,
when the acceptor and donor are in proximity (when the probes are
hybridized to a target sequence), fluorescence resonance energy
transfer from the donor to the acceptor causes the acceptor to
fluoresce. Fluorescent activated probes are typically pairs of
probes designed to hybridize to adjacent sequences such that the
acceptor and donor are brought into proximity. Fluorescent
activated probes can also be single probes containing both a donor
and acceptor where, when the probe is not hybridized to a target
sequence, the donor and acceptor are not in proximity but where the
donor and acceptor are brought into proximity when the probe
hybridized to a target sequence. This can be accomplished, for
example, by placing the donor and acceptor on opposite ends a the
probe and placing target complement sequences at each end of the
probe where the target complement sequences are complementary to
adjacent sequences in a target sequence. If the donor moiety of a
fluorescent activated probe is itself a fluorescent label, it can
release energy as fluorescence (typically at a different wavelength
than the fluorescence of the acceptor) when not in proximity to an
acceptor (that is, when the probes are not hybridized to the target
sequence). When the probes hybridize to a target sequence, the
overall effect would then be a reduction of donor fluorescence and
an increase in acceptor fluorescence. FRET probes are an example of
fluorescent activated probes.
[0080] Stem quenched primers are primers that when not hybridized
to a complementary sequence form a stem structure (either an
intramolecular stem structure or an intermolecular stem structure)
that brings a fluorescent label and a quenching moiety into
proximity such that fluorescence from the label is quenched. When
the primer binds to a complementary sequence, the stem is
disrupted, the quenching moiety is no longer in proximity to the
fluorescent label and fluorescence increases. In the disclosed
method, stem quenched primers are used as primers for nucleic acid
synthesis and thus become incorporated into the synthesized or
amplified nucleic acid. Examples of stem quenched primers are
peptide nucleic acid quenched primers and hairpin quenched
primers.
[0081] Peptide nucleic acid quenched primers are primers associated
with a peptide nucleic acid quencher or a peptide nucleic acid
fluor to form a stem structure. The primer contains a fluorescent
label or a quenching moiety and is associated with either a peptide
nucleic acid quencher or a peptide nucleic acid fluor,
respectively. This puts the fluorescent label in proximity to the
quenching moiety. When the primer is replicated, the peptide
nucleic acid is displaced, thus allowing the fluorescent label to
produce a fluorescent signal.
[0082] Hairpin quenched primers are primers that when not
hybridized to a complementary sequence form a hairpin structure
(and, typically, a loop) that brings a fluorescent label and a
quenching moiety into proximity such that fluorescence from the
label is quenched. When the primer binds to a complementary
sequence, the stem is disrupted, the quenching moiety is no longer
in proximity to the fluorescent label and fluorescence increases.
Hairpin quenched primers are typically used as primers for nucleic
acid synthesis and thus become incorporated into the synthesized or
amplified nucleic acid. Examples of hairpin quenched primers are
Amplifluor primers (Nazerenko et al., Nucleic Acids Res.
25:2516-2521 (1997)) and scorpion primers (Thelwell et al., Nucleic
Acids Res. 28(19):3752-3761 (2000)).
[0083] Cleavage activated primers are similar to cleavage activated
probes except that they are primers that are incorporated into
replicated strands and are then subsequently cleaved. Little et
al., Clin. Chem. 45:777-784 (1999), describe the use of cleavage
activated primers.
E. Detection Labels
[0084] To aid in detection and quantitation of nucleic acids
amplified using the disclosed method, detection labels can be
directly incorporated into amplified nucleic acids or can be
coupled to detection molecules. As used herein, a detection label
is any molecule that can be associated with amplified nucleic acid,
directly or indirectly, and which results in a measurable,
detectable signal, either directly or indirectly. Many such labels
for incorporation into nucleic acids or coupling to nucleic acid
probes are known to those of skill in the art. Examples of
detection labels suitable for use in the disclosed method are
radioactive isotopes, fluorescent molecules, phosphorescent
molecules, enzymes, antibodies, and ligands.
[0085] Examples of suitable fluorescent labels include fluorescein
isothiocyanate (FITC), 5,6-carboxymethyl fluorescein, Texas red,
nitrobenz-2-oxa-1,3-diazol-4-yl (NBD), coumarin, dansyl chloride,
rhodamine, amino-methyl coumarin (AMCA), Eosin, Erythrosin,
BODIPY.RTM., Cascade Blue.RTM., Oregon Green.RTM., pyrene,
lissamine, xanthenes, acridines, oxazines, phycoerythrin,
macrocyclic chelates of lanthanide ions such as Quantum Dye.TM.,
fluorescent energy transfer dyes, such as thiazole orange-ethidium
heterodimer, and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7.
Examples of other specific fluorescent labels include
3-Hydroxypyrene 5,8,10-Tri Sulfonic acid, 5-Hydroxy Tryptamine
(5-HT), Acid Fuchsin, Alizarin Complexon, Alizarin Red,
Allophycocyanin, Aminocoumarin, Anthroyl Stearate, Astrazon
Brilliant Red 4G, Astrazon Orange R, Astrazon Red 6B, Astrazon
Yellow 7 GLL, Atabrine, Auramine, Aurophosphine, Aurophosphine G,
BAO 9 (Bisaminophenyloxadiazole), BCECF, Berberine Sulphate,
Bisbenzamide, Blancophor FFG Solution, Blancophor SV, Bodipy F1,
Brilliant Sulphoflavin FF, Calcien Blue, Calcium Green, Calcofluor
RW Solution, Calcofluor White, Calcophor White ABT Solution,
Calcophor White Standard Solution, Carbostyryl, Cascade Yellow,
Catecholamine, Chinacrine, Coriphosphine O, Coumarin-Phalloidin,
CY3.1 8, CY5.1 8, CY7, Dans (1-Dimethyl Amino Naphaline 5 Sulphonic
Acid), Dansa (Diamino Naphtyl Sulphonic Acid), Dansyl NH--CH3,
Diamino Phenyl Oxydiazole (DAO), Dimethylamino-5-Sulphonic acid,
Dipyrrometheneboron Difluoride, Diphenyl Brilliant Flavine 7GFF,
Dopamine, Erythrosin ITC, Euchrysin, FIF (Formaldehyde Induced
Fluorescence), Flazo Orange, Fluo 3, Fluorescamine, Fura-2,
Genacryl Brilliant Red B, Genacryl Brilliant Yellow 10 GF, Genacryl
Pink 3G, Genacryl Yellow 5GF, Gloxalic Acid, Granular Blue,
Haematoporphyrin, Indo-1, Intrawhite Cf Liquid, Leucophor PAF,
Leucophor SF, Leucophor WS, Lissamine Rhodamine B200 (RD200),
Lucifer Yellow CH, Lucifer Yellow VS, Magdala Red, Marina Blue,
Maxilon Brilliant Flavin 10 GFF, Maxilon Brilliant Flavin 8 GFF,
MPS (Methyl Green Pyronine Stilbene), Mithramycin, NBD Amine,
Nitrobenzoxadidole, Noradrenaline, Nuclear Fast Red, Nuclear
Yellow, Nylosan Brilliant Flavin E8G, Oxadiazole, Pacific Blue,
Pararosaniline (Feulgen), Phorwite AR Solution, Phorwite BKL,
Phorwite Rev, Phorwite RPA, Phosphine 3R, Phthalocyanine,
Phycoerythrin R, Polyazaindacene Pontochrome Blue Black, Porphyrin,
Primuline, Procion Yellow, Pyronine, Pyronine B, Pyrozal Brilliant
Flavin 7GF, Quinacrine Mustard, Rhodamine 123, Rhodamine 5 GLD,
Rhodamine 6G, Rhodamine B, Rhodamine B 200, Rhodamine B Extra,
Rhodamine BB, Rhodamine BG, Rhodamine WT, Serotonin, Sevron
Brilliant Red 2B, Sevron Brilliant Red 4G, Sevron Brilliant Red B,
Sevron Orange, Sevron Yellow L, SITS (Primuline), SITS (Stilbene
Isothiosulphonic acid), Stilbene, Snarf 1, sulpho Rhodamine B Can
C, Sulpho Rhodamine G Extra, Tetracycline, Thiazine Red R,
Thioflavin S, Thioflavin TCN, Thioflavin 5, Thiolyte, Thiozol
Orange, Tinopol CBS, True Blue, Ultralite, Uranine B, Uvitex SFC,
Xylene Orange, and XRITC.
[0086] Preferred fluorescent labels are fluorescein
(5-carboxyfluorescein-N-hydroxysuccinimide ester), rhodamine
(5,6-tetramethyl rhodamine), and the cyanine dyes Cy3, Cy3.5, Cy5,
Cy5.5 and Cy7. The absorption and emission maxima, respectively,
for these fluors are: FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm),
Cy3.5 (581 nm; 588 nm), Cy5 (652 nm: 672 nm), Cy5.5 (682 nm; 703
nm) and Cy7 (755 nm; 778 nm), thus allowing their simultaneous
detection. Other examples of fluorescein dyes include
6-carboxyfluorescein (6-FAM), 2',4',1,4,-tetrachlorofluorescein
(TET), 2',4',5',7',1,4-hexachlorofluorescein (HEX),
2',7'-dimethoxy-4',5'-dichloro-6-carboxyrhodamine (JOE),
2'-chloro-5'-fluoro-7',8'-fused
phenyl-1,4-dichloro-6-carboxyfluorescein (NED), and
2'-chloro-7'-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC).
Fluorescent labels can be obtained from a variety of commercial
sources, including Amersham Pharmacia Biotech, Piscataway, N.J.;
Molecular Probes, Eugene, Oreg.; and Research Organics, Cleveland,
Ohio.
[0087] Additional labels of interest include those that provide for
signal only when the probe with which they are associated is
specifically bound to a target molecule, where such labels include:
"molecular beacons" as described in Tyagi & Kramer, Nature
Biotechnology (1996) 14:303 and EP 0 070 685 B1. Other labels of
interest include those described in U.S. Pat. No. 5,563,037; WO
97/17471 and WO 97/17076.
[0088] Labeled nucleotides are a preferred form of detection label
since they can be directly incorporated into the amplification
products during synthesis. Examples of detection labels that can be
incorporated into amplified nucleic acids include nucleotide
analogs such as BrdUrd (5-bromodeoxyuridine, Hoy and Schimke,
Mutation Research 290:217-230 (1993)), aminoallyldeoxyuridine
(Henegariu et al, Nature Biotechnology 18:345-348 (2000)),
5-methylcytosine (Sano et al., Biochim. Biophys. Acta 951:157-165
(1988)), bromouridine (Wansick et al., J. Cell Biology 122:283-293
(1993)) and nucleotides modified with biotin (Langer et al., Proc.
Natl. Acad. Sci. USA 78:6633 (1981)) or with suitable haptens such
as digoxygenin (Kerkhof, Anal. Biochem. 205:359-364 (1992)).
Suitable fluorescence-labeled nucleotides are
Fluorescein-isothiocyanate-dUTP, Cyanine-3-dUTP and Cyanine-5-dUTP
(Yu et al., Nucleic Acids Res., 22:3226-3232 (1994)). A preferred
nucleotide analog detection label for DNA is BrdUrd
(bromodeoxyuridine, BrdUrd, BrdU, BUdR, Sigma-Aldrich Co). Other
preferred nucleotide analogs for incorporation of detection label
into DNA are AA-dUTP (aminoallyl-deoxyuridine triphosphate,
Sigma-Aldrich Co.), and 5-methyl-dCTP (Roche Molecular
Biochemicals). A preferred nucleotide analog for incorporation of
detection label into RNA is biotin-16-UTP
(biotin-16-uridine-5'-triphosphate, Roche Molecular Biochemicals).
Fluorescein, Cy3, and Cy5 can be linked to dUTP for direct
labelling. Cy3.5 and Cy7 are available as avidin or
anti-digoxygenin conjugates for secondary detection of biotin- or
digoxygenin-labeled probes.
[0089] Detection labels that are incorporated into amplified
nucleic acid, such as biotin, can be subsequently detected using
sensitive methods well-known in the art. For example, biotin can be
detected using streptavidin-alkaline phosphatase conjugate (Tropix,
Inc.), which is bound to the biotin and subsequently detected by
chemiluminescence of suitable substrates (for example,
chemiluminescent substrate CSPD: disodium,
3-(4-methoxyspiro-[1,2,-dioxetane-3-2'-(5'-chloro)tricyclo
[3.3.1.1.sup.3,7]decane]-4-yl) phenyl phosphate; Tropix, Inc.).
Labels can also be enzymes, such as alkaline phosphatase, soybean
peroxidase, horseradish peroxidase and polymerases, that can be
detected, for example, with chemical signal amplification or by
using a substrate to the enzyme which produces light (for example,
a chemiluminescent 1,2-dioxetane substrate) or fluorescent
signal.
[0090] Molecules that combine two or more of these detection labels
are also considered detection labels. Any of the known detection
labels can be used with the disclosed probes, tags, and method to
label and detect nucleic acid amplified using the disclosed method.
Methods for detecting and measuring signals generated by detection
labels are also known to those of skill in the art. For example,
radioactive isotopes can be detected by scintillation counting or
direct visualization; fluorescent molecules can be detected with
fluorescent spectrophotometers; phosphorescent molecules can be
detected with a spectrophotometer or directly visualized with a
camera; enzymes can be detected by detection or visualization of
the product of a reaction catalyzed by the enzyme; antibodies can
be detected by detecting a secondary detection label coupled to the
antibody. As used herein, detection molecules are molecules which
interact with amplified nucleic acid and to which one or more
detection labels are coupled.
F. Detection Probes
[0091] Detection probes are labeled oligonucleotides having
sequence complementary to detection tags or another sequence on
amplified nucleic acids. The complementary portion of a detection
probe can be any length that supports specific and stable
hybridization between the detection probe and its complementary
sequence on the amplified DNA. For this purpose, a length of 10 to
35 nucleotides is preferred, with a complementary portion of a
detection probe 16 to 20 nucleotides long being most preferred.
Detection probes can contain any of the detection labels described
above. Preferred labels are biotin and fluorescent molecules. A
particularly preferred detection probe is a molecular beacon.
Molecular beacons are detection probes labeled with fluorescent
moieties where the fluorescent moieties fluoresce only when the
detection probe is hybridized (Tyagi and Kramer, Nature Biotechnol.
14:303-309 (1995)). The use of such probes eliminates the need for
removal of unhybridized probes prior to label detection because the
unhybridized detection probes will not produce a signal. This is
especially useful in multiplex assays.
G. Address Probes
[0092] An address probe is an oligonucleotide having a sequence
complementary to address tags on primers. The complementary portion
of an address probe can be any length that supports specific and
stable hybridization between the address probe and the address tag.
For this purpose, a length of 10 to 35 nucleotides is preferred,
with a complementary portion of an address probe 12 to 18
nucleotides long being most preferred. An address probe can contain
a single complementary portion or multiple complementary portions.
Preferably, address probes are coupled, either directly or via a
spacer molecule, to a solid-state support. Such a combination of
address probe and solid-state support are a preferred form of
solid-state detector.
H. Oligonucleotide Synthesis
[0093] Primers, detection probes, address probes, and any other
oligonucleotides can be synthesized using established
oligonucleotide synthesis methods. Methods to produce or synthesize
oligonucleotides are well known in the art. Such methods can range
from standard enzymatic digestion followed by nucleotide fragment
isolation (see for example, Sambrook et al., Molecular Cloning: A
Laboratory Manual, 2nd Edition (Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1989) Chapters 5, 6) to purely
synthetic methods, for example, by the cyanoethyl phosphoramidite
method. Solid phase chemical synthesis of DNA fragments is
routinely performed using protected nucleoside cyanoethyl
phosphoramidites (S. L. Beaucage et al. (1981) Tetrahedron Lett.
22:1859). In this approach, the 3'-hydroxyl group of an initial
5'-protected nucleoside is first covalently attached to the polymer
support (R. C. Pless et al. (1975) Nucleic Acids Res. 2:773
(1975)). Synthesis of the oligonucleotide then proceeds by
deprotection of the 5'-hydroxyl group of the attached nucleoside,
followed by coupling of an incoming nucleoside-3'-phosphoramidite
to the deprotected hydroxyl group (M. D. Matteucci et al. (1981) J.
Am. Chem. Soc. 103:3185). The resulting phosphite triester is
finally oxidized to a phosphorotriester to complete the
internucleotide bond (R. L. Letsinger et al. (1976) J. Am. Chem.
Soc. 9:3655). Alternatively, the synthesis of phosphorothioate
linkages can be carried out by sulfurization of the phosphite
triester. Several chemicals can be used to perform this reaction,
among them 3H-1,2-benzodithiole-3-one, 1,1-dioxide (R. P. Iyer, W.
Egan, J. B. Regan, and S. L. Beaucage, J. Am. Chem. Soc., 1990,
112, 1253-1254). The steps of deprotection, coupling and oxidation
are repeated until an oligonucleotide of the desired length and
sequence is obtained. Other methods exist to generate
oligonucleotides such as the H-phosphonate method (Hall et al,
(1957) J. Chem. Soc., 3291-3296) or the phosphotriester method as
described by Ikuta et al., Ann. Rev. Biochem. 53:323-356 (1984),
(phosphotriester and phosphite-triester methods), and Narang et
al., Methods Enzymol., 65:610-620 (1980), (phosphotriester method).
Protein nucleic acid molecules can be made using known methods such
as those described by Nielsen et al., Bioconjug. Chem. 5:3-7
(1994). Other forms of oligonucleotide synthesis are described in
U.S. Pat. No. 6,294,664 and U.S. Pat. No. 6,291,669.
[0094] The nucleotide sequence of an oligonucleotide is generally
determined by the sequential order in which subunits of subunit
blocks are added to the oligonucleotide chain during synthesis.
Each round of addition can involve a different, specific nucleotide
precursor, or a mixture of one or more different nucleotide
precursors. For the disclosed primers of specific sequence,
specific nucleotide precursors would be added sequentially. In
general, degenerate or random positions in an oligonucleotide can
be produced by using a mixture of nucleotide precursors
representing the range of nucleotides that can be present at that
position. Thus, precursors for A and T can be included in the
reaction for a particular position in an oligonucleotide if that
position is to be degenerate for A and T. Precursors for all four
nucleotides can be included for a fully degenerate or random
position. Completely random oligonucleotides can be made by
including all four nucleotide precursors in every round of
synthesis. Degenerate oligonucleotides can also be made having
different proportions of different nucleotides. Such
oligonucleotides can be made, for example, by using different
nucleotide precursors, in the desired proportions, in the
reaction.
[0095] Many of the oligonucleotides described herein are designed
to be complementary to certain portions of other oligonucleotides
or nucleic acids such that stable hybrids can be formed between
them. The stability of these hybrids can be calculated using known
methods such as those described in Lesnick and Freier, Biochemistry
34:10807-10815 (1995), McGraw et al., Biotechniques 8:674-678
(1990), and Rychlik et al., Nucleic Acids Res. 18:6409-6412
(1990).
[0096] So long as their relevant function is maintained, primers,
detection probes, address probes, and any other oligonucleotides
can be made up of or include modified nucleotides (nucleotide
analogs). Many modified nucleotides are known and can be used in
oligonucleotides. A nucleotide analog is a nucleotide which
contains some type of modification to either the base, sugar, or
phosphate moieties. Modifications to the base moiety would include
natural and synthetic modifications of A, C, G, and T/U as well as
different purine or pyrimidine bases, such as uracil-5-yl,
hypoxanthin-9-yl (I), and 2-aminoadenin-9-yl. A modified base
includes but is not limited to 5-methylcytosine (5-me-C),
5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine,
6-methyl and other alkyl derivatives of adenine and guanine,
2-propyl and other alkyl derivatives of adenine and guanine,
2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and
cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine
and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo,
8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted
adenines and guanines, 5-halo particularly 5-bromo,
5-trifluoromethyl and other 5-substituted uracils and cytosines,
7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine,
7-deazaguanine and 7-deazaadenine and 3-deazaguanine and
3-deazaadenine. Additional base modifications can be found for
example in U.S. Pat. No. 3,687,808, Englisch et al., Angewandte
Chemie, International Edition, 1991, 30, 613, and Sanghvi, Y. S.,
Chapter 15, Antisense Research and Applications, pages 289-302,
Crooke, S. T. and Lebleu, B. ed., CRC Press, 1993. Certain
nucleotide analogs, such as 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine can increase the stability of
duplex formation. Other modified bases are those that function as
universal bases. Universal bases include 3-nitropyrrole and
5-nitroindole. Universal bases substitute for the normal bases but
have no bias in base pairing. That is, universal bases can base
pair with any other base. Base modifications often can be combined
with for example a sugar modification, such as 2'-O-methoxyethyl,
to achieve unique properties such as increased duplex stability.
There are numerous United States patents such as U.S. Pat. Nos.
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; and 5,681,941, which
detail and describe a range of base modifications. Each of these
patents is herein incorporated by reference in its entirety, and
specifically for their description of base modifications, their
synthesis, their use, and their incorporation into oligonucleotides
and nucleic acids.
[0097] Nucleotide analogs can also include modifications of the
sugar moiety. Modifications to the sugar moiety would include
natural modifications of the ribose and deoxyribose as well as
synthetic modifications. Sugar modifications include but are not
limited to the following modifications at the 2' position: OH; F;
O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or
O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be
substituted or unsubstituted C1 to C10, alkyl or C2 to C10 alkenyl
and alkynyl. 2' sugar modifications also include but are not
limited to --O[(CH.sub.2)n O]m CH.sub.3, --O(CH.sub.2)n OCH.sub.3,
--O(CH.sub.2)n NH.sub.2, --O(CH.sub.2)n CH.sub.3, --O(CH.sub.2)n
--ONH.sub.2, and --O(CH.sub.2)nON[(CH.sub.2)n CH.sub.3)].sub.2,
where n and m are from 1 to about 10.
[0098] Other modifications at the 2' position include but are not
limited to: C1 to C10 lower alkyl, substituted lower alkyl,
alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl,
Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2 CH.sub.3,
ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl,
heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted
silyl, an RNA cleaving group, a reporter group, an intercalator, a
group for improving the pharmacokinetic properties of an
oligonucleotide, or a group for improving the pharmacodynamic
properties of an oligonucleotide, and other substituents having
similar properties. Similar modifications may also be made at other
positions on the sugar, particularly the 3' position of the sugar
on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides
and the 5' position of 5' terminal nucleotide. Modified sugars
would also include those that contain modifications at the bridging
ring oxygen, such as CH.sub.2 and S. Nucleotide sugar analogs may
also have sugar mimetics such as cyclobutyl moieties in place of
the pentofuranosyl sugar. There are numerous United States patents
that teach the preparation of such modified sugar structures such
as U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044;
5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811;
5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873;
5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is
herein incorporated by reference in its entirety, and specifically
for their description of modified sugar structures, their
synthesis, their use, and their incorporation into nucleotides,
oligonucleotides and nucleic acids.
[0099] Nucleotide analogs can also be modified at the phosphate
moiety. Modified phosphate moieties include but are not limited to
those that can be modified so that the linkage between two
nucleotides contains a phosphorothioate, chiral phosphorothioate,
phosphorodithioate, phosphotriester, aminoalkylphosphotriester,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonate and chiral phosphonates, phosphinates, phosphoramidates
including 3'-amino phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, and boranophosphates. It is understood
that these phosphate or modified phosphate linkages between two
nucleotides can be through a 3'-5' linkage or a 2'-5' linkage, and
the linkage can contain inverted polarity such as 3'-5' to 5'-3' or
2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are
also included. Numerous United States patents teach how to make and
use nucleotides containing modified phosphates and include but are
not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301;
5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302;
5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233;
5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111;
5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is
herein incorporated by reference its entirety, and specifically for
their description of modified phosphates, their synthesis, their
use, and their incorporation into nucleotides, oligonucleotides and
nucleic acids.
[0100] It is understood that nucleotide analogs need only contain a
single modification, but may also contain multiple modifications
within one of the moieties or between different moieties.
[0101] Nucleotide substitutes are molecules having similar
functional properties to nucleotides, but which do not contain a
phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide
substitutes are molecules that will recognize and hybridize to
(base pair to) complementary nucleic acids in a Watson-Crick or
Hoogsteen manner, but which are linked together through a moiety
other than a phosphate moiety. Nucleotide substitutes are able to
conform to a double helix type structure when interacting with the
appropriate target nucleic acid.
[0102] Nucleotide substitutes are nucleotides or nucleotide analogs
that have had the phosphate moiety and/or sugar moieties replaced.
Nucleotide substitutes do not contain a standard phosphorus atom.
Substitutes for the phosphate can be for example, short chain alkyl
or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl
or cycloalkyl internucleoside linkages, or one or more short chain
heteroatomic or heterocyclic internucleoside linkages. These
include those having morpholino linkages (formed in part from the
sugar portion of a nucleoside); siloxane backbones; sulfide,
sulfoxide and sulfone backbones; formacetyl and thioformacetyl
backbones; methylene formacetyl and thioformacetyl backbones;
alkene containing backbones; sulfamate backbones; methyleneimino
and methylenehydrazino backbones; sulfonate and sulfonamide
backbones; amide backbones; and others having mixed N, O, S and CH2
component parts. Numerous United States patents disclose how to
make and use these types of phosphate replacements and include but
are not limited to U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and
5,677,439, each of which is herein incorporated by reference its
entirety, and specifically for their description of phosphate
replacements, their synthesis, their use, and their incorporation
into nucleotides, oligonucleotides and nucleic acids.
[0103] It is also understood in a nucleotide substitute that both
the sugar and the phosphate moieties of the nucleotide can be
replaced, by for example an amide type linkage (aminoethylglycine)
(PNA). U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262 teach how
to make and use PNA molecules, each of which is herein incorporated
by reference. (See also Nielsen et al., Science 254:1497-1500
(1991)).
[0104] Oligonucleotides can be comprised of nucleotides and can be
made up of different types of nucleotides or the same type of
nucleotides. For example, one or more of the nucleotides in an
oligonucleotide can be ribonucleotides, 2'-O-methyl
ribonucleotides, or a mixture of ribonucleotides and 2'-O-methyl
ribonucleotides; about 10% to about 50% of the nucleotides can be
ribonucleotides, 2'-O-methyl ribonucleotides, or a mixture of
ribonucleotides and 2'-O-methyl ribonucleotides; about 50% or more
of the nucleotides can be ribonucleotides, 2'-O-methyl
ribonucleotides, or a mixture of ribonucleotides and 2'-O-methyl
ribonucleotides; or all of the nucleotides are ribonucleotides,
2'-O-methyl ribonucleotides, or a mixture of ribonucleotides and
2'-O-methyl ribonucleotides. Such oligonucleotides can be referred
to as chimeric oligonucleotides.
I. DNA Polymerases
[0105] DNA polymerases useful in the disclosed methods must be
capable of displacing, either alone or in combination with a
compatible strand displacement factor, a hybridized strand
encountered during replication. Such polymerases are referred to
herein as strand displacement DNA polymerases. It is preferred that
a strand displacement DNA polymerase lack a 5' to 3' exonuclease
activity. Strand displacement is necessary to result in synthesis
of multiple copies of a target sequence. A 5' to 3' exonuclease
activity, if present, might result in the destruction of a
synthesized strand. It is also preferred that DNA polymerases for
use in the disclosed method are highly processive. The suitability
of a DNA polymerase for use in the disclosed method can be readily
determined by assessing its ability to carry out strand
displacement replication. Particularly useful enzymes are able to
displace nucleic acids in a length of at least 1000 bp. The
polymerase can be heat labile or heat stabile. The polymerase can
be a holoenzyme, a part of a holoenzyme, or a mutated or
genetically modified form of polymerases from viruses, phages,
prokaryotes, eukayrotes, or Archaebacteria. The polymerase can be
isolated from the original organism or produced in genetically
modified organism.
[0106] Preferred strand displacement DNA polymerases are
bacteriophage .phi.29-type DNA polymerase (U.S. Pat. Nos. 5,198,543
and 5,001,050 to Blanco et al.), Bst large fragment DNA polymerase
(Exo(-) Bst; Aliotta et al., Genet. Anal. (Netherlands) 12:185-195
(1996)) and exo(-)Bca DNA polymerase (Walker and Linn, Clinical
Chemistry 42:1604-1608 (1996)). .phi.29-type DNA-polymerases are
polymerases derived e.g. from the phages .phi.29, Cp-1, PRD-1, Phi
15, Phi 21, PZE, PZA, Nf, M2Y, B103, SF5, GA-1, Cp-5, Cp-7, PR4,
PR5, PR722, and L 17 vor. Other useful polymerases include phage M2
DNA polymerase (Matsumoto et al., Gene 84:247 (1989)), phage
.phi.PRD1 DNA polymerase (Jung et al., Proc. Natl. Acad. Sci. USA
84:8287 (1987)), exo(-)VENT.RTM. DNA polymerase (Kong et al., J.
Biol. Chem. 268:1965-1975 (1993)), Klenow fragment of DNA
polymerase I (Jacobsen et al., Eur. J. Biochem. 45:623-627 (1974)),
T5 DNA polymerase (Chatterjee et al., Gene 97:13-19 (1991)),
Sequenase (U.S. Biochemicals), PRD1 DNA polymerase (Zhu and Ito,
Biochim. Biophys. Acta. 1219:267-276 (1994)), and T4 DNA polymerase
holoenzyme (Kaboord and Benkovic, Curr. Biol. 5:149-157 (1995)).
.phi.29 DNA polymerase is most preferred. More examples for
suitable polymerase with strand-displacement activity are
holoenzyme complexes from prokaryotes, eukayrotes, or
Archaebacteria that may contain all or a part of accessory proteins
like Helicasen, Single-stranded-binding proteins, or proteins
involved in recombination. Other accessory molecules may enhance
the strand-displacement (e.g. ribozymes).
[0107] As used herein, a thermolabile nucleic acid polymerase is a
nucleic acid polymerase that is notably inactivated at the
temperature at which an amplification reaction is carried out in
the absence of an additive, dNTPs, and template nucleic acid. Thus,
whether a nucleic acid polymerase is thermolabile depends on the
temperature at which an amplification reaction is carried out. Note
that as used herein, thermolability does not require denaturation
or irreversible inactivation of a polymerase. All that is required
is that the polymerase be notably incapable of performing
template-dependent polymerization at the temperature at which an
amplification reaction is carried out in the absence of an
additive. Reversibly-inactivated polymerases can also be used.
[0108] As used herein, an elevated temperature is a temperature at
or above which a given nucleic acid polymerase is notably
inactivated in the absence of an additive, dNTPs, and template
nucleic acid. Thus, what constitutes an elevated temperature
depends on the particular nucleic acid polymerase. As used herein,
notable inactivation refers to a reduction in activity of 40% or
more. Substantial inactivation refers to a reduction in activity of
60% or more. Significant inactivation refers to a reduction in
activity of 80% or more.
[0109] Strand displacement can be facilitated through the use of a
strand displacement factor, such as helicase or single-stranded
binding proteins. It is considered that any DNA polymerase that can
perform strand displacement replication in the presence of a strand
displacement factor is suitable for use in the disclosed method,
even if the DNA polymerase does not perform strand displacement
replication in the absence of such a factor. Strand displacement
factors useful in strand displacement replication include BMRF1
polymerase accessory subunit (Tsurumi et al., J. Virology
67(12):7648-7653 (1993)), adenovirus DNA-binding protein
(Zijderveld and van der Vliet, J. Virology 68(2):1158-1164 (1994)),
herpes simplex viral protein ICP8 (Boehmer and Lehman, J. Virology
67(2):711-715 (1993); Skaliter and Lehman, Proc. Natl. Acad. Sci.
USA 91(22):10665-10669 (1994)); single-stranded DNA binding
proteins (SSB; Rigler and Romano, J. Biol. Chem. 270:8910-8919
(1995)); phage T4 gene 32 protein (Villemain and Giedroc,
Biochemistry 35:14395-14404 (1996); and calf thymus helicase
(Siegel et al., J. Biol. Chem. 267:13629-13635 (1992)).
[0110] The ability of a polymerase to carry out strand displacement
replication can be determined by using the polymerase in a strand
displacement replication assay such as described in the Example.
The assay in the example can be modified as appropriate. Such
assays should be performed at a temperature suitable for optimal
activity for the enzyme being used, for example, from 25-40.degree.
C. for .phi.29 DNA polymerase, from 46.degree. C. to 64.degree. C.
for exo(-) Bst DNA polymerase, or from about 60.degree. C. to
70.degree. C. for an enzyme from a hyperthermophylic organism. For
assays from 60.degree. C. to 70.degree. C., primer length may be
increased to provide a melting temperature appropriate for the
assay temperature. Another useful assay for selecting a polymerase
is the primer-block assay described in Kong et al., J. Biol. Chem.
268:1965-1975 (1993). The assay consists of a primer extension
assay using an M13 ssDNA template in the presence or absence of an
oligonucleotide that is hybridized upstream of the extending primer
to block its progress. Enzymes able to displace the blocking primer
in this assay are expected to be useful for the disclosed
method.
J. Kits
[0111] The materials described above can be packaged together in
any suitable combination as a kit useful for performing the
disclosed method. Kit components in a given kit can be designed and
adapted for use together in the disclosed method. For example,
disclosed are kits for amplifying circular genomes, the kit
comprising at least a reaction buffer and a DNA polymerase. The
components of such a kit are described elsewhere herein. In some
forms of the disclosed kits, the kit can further comprise a set of
primers. In some forms of the disclosed kits, the kit can further
comprise a lysis solution. In some forms of the disclosed kits, the
kit can further comprise a stabilization solution. In some forms of
the disclosed kits, the kit can further comprise deoxynucleotide
triphosphates. In some forms of the disclosed kits, the kit can
further comprise one or more detection probes. Detection probes are
described elsewhere herein. In some forms of the kit, the detection
probes can each comprise a complementary portion, where the
complementary portion is complementary to a nucleic acid sequence
of interest. In some forms of the kit, the kit can further comprise
denaturing solution. In some forms of the kit, the kit can further
comprise reaction mix. The kits also can contain nucleotides,
buffers, detection probes, fluorescent change probes, lysis
solutions, stabilization solutions, denaturation solutions, or a
combination.
[0112] Any of the components that can be present in a kit that can
be used together can be combined in a single component of the kit.
Thus, a reaction mix can include, for example, buffers,
deoxynucleotide triphosphates and primers. Similarly, components
and solutions can be divided into constituent parts or
sub-solutions. The kits can be used for any purpose, generally for
nucleic acid amplification. In some forms, the kit can be designed
to detect nucleic acid sequences of interest in a genome or other
nucleic acid sample. In some forms, the kit can be designed to
assess a disease, condition or predisposition of an individual
based on a nucleic acid sequences of interest.
K. Mixtures
[0113] Disclosed are mixtures formed by performing, or formed
during the course of performing, any form of the disclosed method.
For example, disclosed are mixtures comprising, for example, a
genomic nucleic acid sample, a set of primer primers, and DNA
polymerase; a genomic nucleic acid sample, a set of primer primers,
DNA polymerase, and tandem sequence DNA. Whenever the method
involves mixing or bringing into contact, for example, compositions
or components or reagents, performing the method creates a number
of different mixtures. For example, if the method includes three
mixing steps, after each one of these steps a unique mixture is
formed if the steps are performed sequentially. In addition, a
mixture is formed at the completion of all of the steps regardless
of how the steps were performed. The present disclosure
contemplates these mixtures, obtained by the performance of the
disclosed method as well as mixtures containing any disclosed
reagent, composition, or component, for example, disclosed
herein.
L. Systems
[0114] Disclosed are systems useful for performing, or aiding in
the performance of, the disclosed method. Systems generally
comprise combinations of articles of manufacture such as
structures, machines, devices, and the like, and compositions,
compounds, materials, and the like. Such combinations that are
disclosed or that are apparent from the disclosure are
contemplated. For example, disclosed and contemplated are systems
comprising solid supports and primers, nucleic acid samples,
detection probes, fluorescent change probes, or a combination.
M. Data Structures and Computer Control
[0115] Disclosed are data structures used in, generated by, or
generated from, the disclosed method. Data structures generally are
any form of data, information, and/or objects collected, organized,
stored, and/or embodied in a composition or medium. A nucleic acid
library stored in electronic form, such as in RAM or on a storage
disk, is a type of data structure.
[0116] The disclosed method, or any part thereof or preparation
therefor, can be controlled, managed, or otherwise assisted by
computer control. Such computer control can be accomplished by a
computer controlled process or method, can use and/or generate data
structures, and can use a computer program. Such computer control,
computer controlled processes, data structures, and computer
programs are contemplated and should be understood to be disclosed
herein.
Uses
[0117] The disclosed methods and compositions are applicable to
numerous areas including, but not limited to, analysis of nucleic
acids present in cells (for example, analysis of genomic DNA in
cells), disease detection, mutation detection, gene discovery, gene
mapping (molecular haplotyping), and agricultural research.
Method
[0118] Disclosed is a method for amplification of circular genomes.
The method is based on rolling circle amplification of the circular
genomes which involves strand displacement replication by primers.
The disclosed method allows differential amplification of circular
genomes of interest. In genomic nucleic acid samples containing
both a circular genome of interest and non-target nucleic acids,
such as non-target genomes, the disclose methods and compositions
can result in many-fold differential amplification of the circular
genome of interest over non-target nucleic acids. It has been
discovered that selection of a set of primers complementary to a
circular genome of interest can result in much greater
amplification of the circular genome of interest relative to
non-target nucleic acids present. Such differential amplification
of circular genomes is very useful for obtaining useful amounts of
genomes of interest from a mixed nucleic acid sample. For example,
mitochondrial genomes, which, absent complicated and time consuming
purification, are in the presence of non-target nucleic acids (such
as the host cell genome), can be differentially amplified relative
to the host cell genome and other non-target nucleic acids using
the disclosed methods and composition.
[0119] Some forms of the disclosed methods can involve bringing
into contact a set of primers, DNA polymerase, and a genomic
nucleic acid sample, where the genomic nucleic acid sample
comprises a circular genome, and incubating the genomic nucleic
acid sample under conditions that promote replication of the
circular genome in the genomic nucleic acid sample. Replication of
the circular genome can proceed by rolling circle replication. The
conditions that promote replication of the circular genome need not
involve thermal cycling and/or can be substantially isothermic. In
the disclosed methods, the circular genome is differentially
replicated compared to the non-target nucleic acids present in the
genomic nucleic acid sample. Thus, for example, non-target nucleic
acids present in the genomic nucleic acid sample generally would
not be substantially, significantly, or notably replicated. For
example, the primers in the set of primers and the reaction
conditions generally can be selected such that non-target nucleic
acids in the genomic nucleic acid sample are not substantially,
significantly, or notably replicated.
[0120] Replication of the circular genomes results in replicated
strands. Such replication proceeds by rolling circle replication to
produce tandem sequence DNA. The replicated strands are displaced
from the nucleic acid molecules by strand displacement replication
of another replicated strand. Such amplification can proceed by
replication with a highly processive polymerase initiating at each
primer and continuing until spontaneous termination. A useful
feature of the method is that as a DNA polymerase extends a primer,
the polymerase displaces the replication products (that is, DNA
strands) that resulted from extension of other primers. The
polymerase is continuously extending new primers and displacing the
replication products of previous priming events. In this way,
multiple overlapping copies of all of the nucleic acid molecules
and sequences in the circular genome can be synthesized in a short
time. The disclosed method has advantages over the polymerase chain
reaction since it can be carried out under isothermal conditions.
In the disclosed method amplification takes place not in cycles,
but in a continuous, isothermal replication. This makes
amplification less complicated and much more consistent in output.
Strand displacement allows rapid generation of multiple copies of a
nucleic acid sequence or sample in a single, continuous, isothermal
reaction.
[0121] When the genomic nucleic acid sample comprises one or more
non-target genomes (including non-target genomes that may be
circular), the circular genome of interest can be differentially
amplified relative to the non-target genomes. The genomic nucleic
acid sample can comprises a plurality of genomes including the
circular genome of interest and one or more non-target genomes.
Thus, for example, non-target nucleic acids present in the genomic
nucleic acid sample generally would not be substantially,
significantly, or notably replicated and/or amplified. For example,
the primers in the set of primers and the reaction conditions
generally can be selected such that non-target nucleic acids in the
genomic nucleic acid sample are not substantially, significantly,
or notably replicated and/or amplified.
[0122] The differential amplification of the circular genome can be
described in quantitative terms. For example, the circular genome
can be amplified, for example, at least 5 fold, 8 ford, 10 fold, 20
fold, 30 fold, 40 fold, 50 fold, 60 fold, 75 fold, 100 fold, 150
fold, 200 fold, 500 fold, 1000 fold, 2000 fold, 5000 fold, 10000
fold, 20000 fold, 50000 fold, 100000 fold, 200000 fold, 500000
fold, 1000000 fold, or 2000000 fold or more compared to the
non-target nucleic acids and/or non-target genomes. Such
differential amplification generally can be assessed by measuring
the relative amplification of selected sequences within the
circular genome and within one or more non-target nucleic acids
and/or non-target genomes. Such assessments are described elsewhere
herein.
[0123] The non-target genomes can be any genome that may be in a
genomic nucleic acid sample. For example, non-target genomes can
be, for example, bacterial genomes, viral genomes, microbial
genomes, pathogen genomes, eukaryotic genomes, plant genomes,
animal genomes, vertebrate genomes, fish genomes, avian genomes,
mammalian genomes, rodent genomes, murine genomes, human genomes,
host genomes, and/or non-target circular genomes. Circular genomes
can be in the presence of non-target genomes. For example,
organelle genomes are commonly in the presence of the cell genome
of the cell in which the organelle resides. Pathogen genomes are
commonly in the presence of host cell genomes.
[0124] Any material or sample containing or suspected of containing
a circular genome of interest can be used as the genomic nucleic
acid sample. For example, the genomic nucleic acid sample can be a
blood sample, a urine sample, a semen sample, a lymphatic fluid
sample, a cerebrospinal fluid sample, amniotic fluid sample, a
biopsy sample, a needle aspiration biopsy sample, a cancer sample,
a tumor sample, a tissue sample, a cell sample, a cell lysate
sample, a crude cell lysate sample, a forensic sample, an
archeological sample, an infection sample, a nosocomial infection
sample, an environmental sample, or a combination thereof.
[0125] Also disclosed is a method of identifying a set of primers
for differential amplification of a circular genome. Such a method
can generally involve selecting test primers for a test set of
primers, bringing into contact the test set of primers, DNA
polymerase, and a genomic nucleic acid sample, incubating the
genomic nucleic acid sample under conditions that promote
replication of the circular genome in the genomic nucleic acid
sample, and determining the relative amplification of the circular
genome and non-target nucleic acids. The test set of primers are
identified if the circular genome is amplified at least 10 fold
compared to the non-target nucleic acids. Generally, each primer
can specifically hybridize to a nucleotide sequence in a circular
genome of interest such that the distance between consecutive
primers hybridized to the same strand of the circular genome
averages from, for example, about 200 to about 20000 nucleotides,
or about 200 to about 6000 nucleotides. The test genomic nucleic
acid sample comprises the circular genome and non-target nucleic
acids. Replication of the circular genome proceeds by rolling
circle replication. Generally, the conditions that promote
replication of the circular genome do not involve thermal cycling
and/or can be substantially isothermic.
[0126] Following amplification, the amplified sequences can be used
for any purpose, such as uses known and established for amplified
sequences. For example, amplified sequences can be detected using
any of conventional detection systems for nucleic acids such as
detection of fluorescent labels, enzyme-linked detection systems,
antibody-mediated label detection, and detection of radioactive
labels. A preferred form of labeling involves labeling of the
replicated strands (that is, the strands produced in multiple
displacement amplification) using terminal deoxynucleotidyl
transferase. The replicated strands can be labeled by, for example,
the addition of modified nucleotides, such as biotinylated
nucleotides, fluorescent nucleotides, 5 methyl dCTP, BrdUTP, or
5-(3-aminoallyl)-2'-deoxyuridine 5'-triphosphates, to the 3' ends
of the replicated strands. Amplification of forensic material for
RFLP-based testing is one useful application for the disclosed
method.
[0127] Non-target nucleic acids present in the genomic nucleic acid
sample generally would not be substantially, significantly, and/or
notably replicated and/or amplified in the disclosed methods. As
used herein, a substantial replication or amplification of a
nucleic acid refers to an increase in the amount of the nucleic
acid of 50 fold or more. As used herein, a notable replication or
amplification of a nucleic acid refers to an increase in the amount
of the nucleic acid of 10 fold or more. As used herein, a
significant replication or amplification of a nucleic acid refers
to an increase in the amount of the nucleic acid of 5 fold or
more.
[0128] Nucleotides incorporated during Rolling Circle Amplification
may be dNTPs, NTPs, modified by tags having a molecular weight
larger than a methyl group such as fluorophores, haptens etc. Many
such modified nucleotides for direct incorporation into replicated
nucleic acids are known and can be use in the disclosed method.
[0129] The disclosed amplification generally is carried out in the
presence of a buffer. The buffer can be a solution that contains
components needed to provide solution conditions that promote
replication of the circular genome. The pH of the buffer can be,
for example, between 5 and 10, between 6 and 10, or between 7 and
9. Ions dissociated in the buffer may help to increase the reaction
product. The buffer may contain Mg.sup.2+ ions in a concentration
between 0.1 mM and 30 mM, preferably between 0.1 mM and 25 mM, more
preferably between 1 mM and 20 mM, most preferably between 2 mM and
15 mM. The buffer may contain monovalent salts such as NaCl or KCl
in a concentration between 0.1 mM and 200 mM, preferably between 1
mM and 150 mM, more preferably between 5 mM and 125 mM, most
preferably between 10 mM and 100 mM. The buffer may contain ammonia
salts such as (NH.sub.4).sub.2SO.sub.4, or NH.sub.4Cl, or salts of
polyamines such as spermine, spermidine, amino acids. For example,
the buffer can comprise Tris, pH 8.5; 10 mM MgCl.sub.2, 50 mM KCl,
20 mM (NH.sub.4).sub.2SO.sub.4.
[0130] The disclosed amplification can be carried at any suitable
temperature that allows replication of the circular genome. For
example, the reaction temperature can be, for example, between 20
and 80.degree. C., between 22.degree. C. and 70.degree. C., between
25.degree. C. and 47.degree. C., or between 25.degree. C. and
42.degree. C. Generally, the conditions that promote replication of
the circular genome do not involve thermal cycling and/or can be
substantially isothermic. The temperature during amplification
reaction can be substantially isothermal. As used herein,
substantially isothermal means that the reaction temperature does
not change during amplification of nucleic acids by more than 10%,
excluding initial and/or terminal heating and cooling (such heating
and cooling could be used for denaturation, hybridization and/or
enzyme inactivation or activation). The amplification can be
carried out at a reaction temperature that does not change by more
than 25%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% during
the amplification. The amplification can be carried out in the
absence of thermal cycling, excluding initial and/or terminal
heating and cooling. Thus, for example, the amplification can be
carried out with no more than 4, no more than 3, or no more than 2
significant temperature changes. A significant temperature change
is a temperature change of greater than 10%. The amplification can
be carried out with no more than 4, no more than 3, or no more than
2 changes in reaction temperature of more than 25%, 15%, 10%, 9%,
8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% during the amplification.
[0131] The concentration of nucleic acids in the amplification
mixture can be, for example, 300 ng/.mu.l or less, 200 ng/.mu.l or
less, 150 ng/.mu.l or less, 100 ng/.mu.l or less, 95 ng/.mu.l or
less, 90 ng/.mu.l or less, 85 ng/.mu.l or less, 80 ng/.mu.l or
less, 75 ng/.mu.l or less, 70 ng/.mu.l or less, 65 ng/.mu.l or
less, 60 ng/.mu.l or less, 55 ng/.mu.l or less, 50 ng/.mu.l or
less, 45 ng/.mu.l or less, 40 ng/.mu.l or less, 35 ng/.mu.l or
less, 30 ng/.mu.l or less, 25 ng/.mu.l or less, 20 ng/.mu.l or
less, 15 ng/.mu.l or less, 10 ng/.mu.l or less, 9 ng/.mu.l or less,
8 ng/.mu.l or less, 7 ng/.mu.l or less, 6 ng/.mu.l or less, 5
ng/.mu.l or less, 4 ng/.mu.l or less, 3 ng/.mu.l or less, 2
ng/.mu.l or less, 1 ng/.mu.l or less, 0.8 ng/.mu.l or less, 0.6
ng/.mu.l or less, 0.5 ng/.mu.l or less, 0.4 ng/.mu.l or less, 0.3
ng/.mu.l or less, 0.2 ng/.mu.l or less, or 0.1 ng/.mu.l or
less.
[0132] The disclosed method involves rolling circle amplification.
Rolling circle amplification refers to nucleic acid amplification
reactions where a circular nucleic acid template is replicated in a
single long strand with tandem repeats of the sequence of the
circular template. This first, directly produced tandem repeat
strand is referred to as tandem sequence DNA (TS-DNA) and its
production is referred to as rolling circle replication. Rolling
circle amplification refers both to rolling circle replication and
to processes involving both rolling circle replication and
additional forms of amplification. For example, tandem sequence DNA
can be replicated to form complementary strands referred to a
secondary tandem sequence DNA. Secondary tandem sequence DNA can,
in turn, be replicated, and so on. Tandem sequence DNA can also be
transcribed. Rolling circle amplification involving production of
only the first tandem sequence DNA (that is, the replicated strand
produced by rolling circle replication) can be referred to as of
linear rolling circle amplification (where "linear" refers to the
general amplification kinetics of the amplification).
A. Amplification Level
[0133] The disclosed method can produce a high level of
amplification. For example, the disclosed method can produce a
10,000-fold amplification or more. Fold amplification refers to the
number of copies generated of the template being amplified. For
example, if 1 .mu.g of DNA is generated from 1 ng of template, the
level of amplification is 1,000-fold. The disclosed method can
produce, for example, amplification of about 1-fold, about 2-fold,
about 3-fold, about 4-fold, about 5-fold, about 6-fold, about
7-fold, about 8-fold, about 9-fold, about 10-fold, about 11-fold,
about 12-fold, about 14-fold, about 16-fold, about 20-fold, about
24-fold, about 30-fold, about 35-fold, about 40-fold, about
50-fold, about 60-fold, about 70-fold, about 80-fold, about
90-fold, about 100-fold, about 150-fold, about 200-fold, about
250-fold, about 300-fold, about 400-fold, about 500-fold, about
600-fold, about 700-fold, about 800-fold, about 900-fold, about
1,000-fold, about 10,000-fold, about 100,000-fold, about
1,000,000-fold, about 10,000,000-fold, or about
100,000,000-fold.
[0134] The disclosed method can produce, for example, amplification
of at least 2-fold, at least 3-fold, at least 4-fold, at least
5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least
9-fold, at least 10-fold, at least 11-fold, at least 12-fold, at
least 14-fold, at least 16-fold, at least 20-fold, at least
24-fold, at least 30-fold, at least 35-fold, at least 40-fold, at
least 50-fold, at least 60-fold, at least 70-fold, at least
80-fold, at least 90-fold, at least 100-fold, at least 150-fold, at
least 200-fold, at least 250-fold, at least 300-fold, at least
400-fold, at least 500-fold, at least 600-fold, at least 700-fold,
at least 800-fold, at least 900-fold, at least 1,000-fold, at least
10,000-fold, at least 100,000-fold, at least 1,000,000-fold, at
least 10,000,000-fold, or at least 100,000,000-fold.
B. Primer Selection
[0135] Primers and sets of primers for use in the disclosed method
can be selected for their ability to differentially amplify a
circular genome of interest to particular desired extents. Such
primers and sets of primers are particularly useful in the
disclosed method. All of the primers can be selected primers or
some of the primers can be selected primers. Any useful criteria
can be used for primer selection. Useful criteria include the
relative amplification of the circular genome compared to
non-target nucleic acids and the level of amplification of the
circular genome. Primers and sets of primers that meet given
selection criteria (or a selection criterion) are referred to
herein as selected primers and selected primer sets (for those
selection criteria). Primers and sets of primers that do not meet
the given selection criteria (or selection criterion) are referred
to herein as non-selected primers and non-selected primer sets (for
those selection criteria). Both selected and non-selected primers
can be used together in the disclosed method, although use of
selected primers is preferred.
[0136] Selected primers and sets of primers meeting different
selection criteria can be used together in the disclosed method.
That is, the primers and sets of primers used in a given
amplification reaction need not all have the same capabilities or
meet the same criteria. Similarly, non-selected primers and
non-selected primer sets failing to meet different selection
criteria can be included or excluded from use in the disclosed
method. That is, primers and sets of primers not used (or used)
need not lack the same capabilities or fail to meet the same
criteria. Selected primers and sets of primers meeting a selection
criterion, selection criteria, or a combination of different
selection criteria, can be used with non-selected primers and
non-selected primer sets failing to meet the same or a different
selection criterion, selection criteria, or a combination of the
same or different selection criteria.
[0137] The disclosed method thus can be performed with one or more
selected primers or sets of primers. The disclosed method can also
be performed with one or more selected primers or sets of primers
and one or more non-selected primers or non-selected primer sets.
Whether a primer or primer set is a selected primer or primer set
or a non-selected primer or primer set can be determined by testing
the primer or primer set for the selection criterion or criteria.
Thus, for example, the primer or primer set can be tested in a form
of the disclosed method. Such a method could use a nucleic acid
sample of interest, such as a nucleic acid sample having relevant
characteristics. A nucleic acid sample used for this purpose is
referred to herein as a selection nucleic acid sample. Particularly
useful selection nucleic acid samples are nucleic acid samples of
the same type that the selected primers will be used to amplify.
Thus, a human nucleic acid sample can be used as the selection
sample for selecting primers to be used to amplify human
mitochondrial DNA.
[0138] A primer or primer set can be selected based on producing a
certain level or range of differential amplification of circular
genome relative to non-target nucleic acids in a selection nucleic
acid sample. Any amplification level can be used. For example, any
of the amplification levels described elsewhere herein can be used
as the selection criterion. A selected primer or primer set can
produce, for example, differential amplification of about 1-fold,
about 2-fold, about 3-fold, about 4-fold, about 5-fold, about
6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold,
about 11-fold, about 12-fold, about 14-fold, about 16-fold, about
20-fold, about 24-fold, about 30-fold, about 35-fold, about
40-fold, about 50-fold, about 60-fold, about 70-fold, about
80-fold, about 90-fold, about 100-fold, about 150-fold, about
200-fold, about 250-fold, about 300-fold, about 400-fold, about
500-fold, about 600-fold, about 700-fold, about 800-fold, about
900-fold, about 1,000-fold, about 10,000-fold, about 100,000-fold,
about 1,000,000-fold, about 10,000,000-fold, or about
100,000,000-fold. Fold amplification refers to the number of copies
generated of the template being amplified. For example, if 1 .mu.g
of DNA is generated from 1 ng of template, the level of
amplification is 1,000-fold.
[0139] A selected primer or primer set can produce, for example,
differential amplification of at least 2-fold, at least 3-fold, at
least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at
least 8-fold, at least 9-fold, at least 10-fold, at least 11-fold,
at least 12-fold, at least 14-fold, at least 16-fold, at least
20-fold, at least 24-fold, at least 30-fold, at least 35-fold, at
least 40-fold, at least 50-fold, at least 60-fold, at least
70-fold, at least 80-fold, at least 90-fold, at least 100-fold, at
least 150-fold, at least 200-fold, at least 250-fold, at least
300-fold, at least 400-fold, at least 500-fold, at least 600-fold,
at least 700-fold, at least 800-fold, at least 900-fold, at least
1,000-fold, at least 10,000-fold, at least 100,000-fold, at least
1,000,000-fold, at least 10,000,000-fold, or at least
100,000,000-fold.
C. Nucleic Acid Sample Preparation and Treatment
[0140] Nucleic acids for amplification are often obtained from
cellular samples. This generally requires disruption of the cell
(to make the nucleic acid accessible) and can include purification
of the nucleic acids prior to amplification. It also can include
the separation of nucleic acids and other biomolecules. It also can
include the inactivation of protein factors such as nucleases that
could degrade the DNA, or of factors such as histones that could
bind to DNA strands and impede their use as a template for DNA
synthesis by a polymerase. It also can include the use of enzymes
to degrade biomolecules that contaminate the nucleic acid sample.
These enzymes can comprise Proteases (e.g. Protease K, Trypsin,
Chymotrypsin, Collagenase, or other enzymes deemed to be suitable
by the artisan). These enzymes can comprise Nucleases (.e.g.
RNases, Exonucleases). These enzymes may comprise single-stranded
specific nucleases if dsDNA is the circular genome of interest.
These enzymes can comprise Polysaccharide degrading enzymes (e.g.
Hyalurondiase, amylase, pectinase, cellulose) These enzyme may
comprise lipases (e.g . . . ) There are a variety of techniques
used to break open cells, such as sonication, freeze-thaw cycles,
enzymatic digestion of cell walls, heating, and exposure to lytic
conditions (e.g. organis solvents, chaotropic salts, hypothonic
conditions). Some lytic conditions involve use of non-physiological
pH and/or solvents. Many lytic techniques can result in damage to
nucleic acids in cells, including, for example, breakage of genomic
DNA. In particular, use of heating to lyse cells can damage genomic
DNA and reduce the amount and quality of amplification products of
genomic DNA. It has been discovered that alkaline lysis can cause
less damage to genomic DNA and can thus result in higher quality
amplification results. Alkaline lysis also inactivates protein
factors such as nucleases, histones, or other factors that could
impede the amplification of DNA within the sample. In addition, it
is a useful property of alkaline lysis that reducing the pH does
not reactivate the protein factors, but that such protein factors
remain inactivated when the pH of the solution is brought back
within a neutral range.
[0141] In some forms of the disclosed method, a genomic sample is
prepared by exposing cells to alkaline conditions, thereby lysing
the cells and resulting in a cell lysate; reducing the pH of the
cell lysate to make the pH of the cell lysate compatible with DNA
replication; and incubating the cell lysate under conditions that
promote replication of the genome of the cells by multiple
displacement amplification. Alkaline conditions are conditions
where the pH is greater than 9.0. Particularly useful alkaline
conditions for the disclosed method are conditions where the pH is
greater than 10.0. The alkaline conditions can be, for example,
those that cause a substantial number of cells to lyse, those that
cause a significant number of cells to lyse, or those that cause a
sufficient number of cells to lyse. The number of lysed cells can
be considered sufficient if the genome can be sufficiently
amplified in the disclosed method. The amplification is sufficient
if enough amplification product is produced to permit some use of
the amplification product, such as detection of sequences or other
analysis. The reduction in pH is generally into the neutral range
of pH 9.0 to pH 6.0.
[0142] The cells can be exposed to alkaline conditions by mixing
the cells with a lysis solution. The amount of lysis solution mixed
with the cells can be that amount that causes a substantial number
of cells to lyse or those that cause a sufficient number of cells
to lyse. Generally, this volume will be a function of the pH of the
cell/lysis solution mixture. Thus, the amount of lysis solution to
mix with cells can be determined generally from the volume of the
cells and the alkaline concentration of the lysis buffer. For
example, a smaller volume of a lysis solution with a stronger base
and/or higher concentration of base would be needed to create
sufficient alkaline conditions than the volume needed of a lysis
solution with a weaker base and/or lower concentration of base. The
lysis solution can be formulated such that the cells are mixed with
an equal volume of the lysis solution (to produce the desired
alkaline conditions).
[0143] In some embodiments, the lysis solution can comprise a base,
such as an aqueous base. Useful bases include potassium hydroxide,
sodium hydroxide, potassium acetate, sodium acetate, ammonium
hydroxide, lithium hydroxide, calcium hydroxide, magnesium
hydroxide, sodium carbonate, sodium bicarbonate, calcium carbonate,
ammonia, aniline, benzylamine, n-butylamine, diethylamine,
dimethylamine, diphenylamine, ethylamine, ethylenediamine,
methylamine, N-methylaniline, morpholine, pyridine, triethylamine,
trimethylamine, aluminum hydroxide, rubidium hydroxide, cesium
hydroxide, strontium hydroxide, barium hydroxide, and DBU
(1,8-diazobicyclo[5,4,0]undec-7-ene). Useful formulations of lysis
solution include lysis solution comprising 400 mM KOH, lysis
solution comprising 400 mM KOH, 100 mM dithiothreitol, and 10 mM
EDTA, and lysis solution consisting of 400 mM KOH, 100 mM
dithiothreitol, and 10 mM EDTA.
[0144] In some embodiments, the lysis solution can comprise a
plurality of basic agents. As used herein, a basic agent is a
compound, composition or solution that results in alkaline
conditions. In some embodiments, the lysis solution can comprise a
buffer. Useful buffers include phosphate buffers, "Good" buffers
(such as BES, BICINE, CAPS, EPPS, HEPES, MES, MOPS, PIPES, TAPS,
TES, and TRICINE), sodium cacodylate, sodium citrate,
triethylammonium acetate, triethylammonium bicarbonate, Tris,
Bis-tris, and Bis-tris propane. The lysis solution can comprise a
plurality of buffering agents. As used herein, a buffering agent is
a compound, composition or solution that acts as a buffer. An
alkaline buffering agent is a buffering agent that results in
alkaline conditions. In some embodiments, the lysis solution can
comprise a combination of one or more bases, basic agents, buffers
and buffering agents.
[0145] The pH of the cell lysate can be reduced to form a
stabilized cell lysate. A stabilized cell lysate is a cell lysate
the pH of which is in the neutral range (from about pH 6.0 to about
pH 9.0). Useful stabilized cell lysates have a pH that allows
replication of nucleic acids in the cell lysate. For example, the
pH of the stabilized cell lysate is usefully at a pH at which the
DNA polymerase can function. The pH of the cell lysate can be
reduced by mixing the cell lysate with a stabilization solution.
The stabilization solution comprises a solution that can reduce the
pH of a cell lysate exposed to alkaline conditions as described
elsewhere herein.
[0146] The amount of stabilization solution mixed with the cell
lysate can be that amount that causes a reduction in pH to the
neutral range (or other desired pH value). Generally, this volume
will be a function of the pH of the cell lysate/stabilization
solution mixture. Thus, the amount of stabilization solution to mix
with the cell lysate can be determined generally from the volume of
the cell lysate, its pH and buffering capacity, and the acidic
concentration of the stabilization buffer. For example, a smaller
volume of a stabilization solution with a stronger acid and/or
higher concentration of acid would be needed to reduce the pH
sufficiently than the volume needed of a stabilization solution
with a weaker acid and/or lower concentration of acid. The
stabilization solution can be formulated such that the cell lysate
is mixed with an equal volume of the stabilization solution (to
produce the desired pH).
[0147] In some embodiments, the stabilization solution can comprise
an acid. Useful acids include hydrochloric acid, sulfuric acid,
phosphoric acid, acetic acid, acetylsalicylic acid, ascorbic acid,
carbonic acid, citric acid, formic acid, nitric acid, perchloric
acid, HF, HBr, HI, H.sub.2S, HCN, HSCN, HClO, monochloroacetic
acid, dichloroacetic acid, trichloroacetic acid, and any carboxylic
acid (ethanoic, propanoic, butanoic, etc., including both linear or
branched chain carboxylic acids). In some embodiments, the
stabilization solution can comprise a buffer. Useful buffers
include Tris-HCl, HEPES, "Good" buffers (such as BES, BICINE, CAPS,
EPPS, HEPES, MES, MOPS, PIPES, TAPS, TES, and TRICINE), sodium
cacodylate, sodium citrate, triethylammonium acetate,
triethylammonium bicarbonate, Tris, Bis-tris, and Bis-tris propane.
Useful formulations of stabilization solutions include
stabilization solution comprising 800 mM Tris-HCl; stabilization
solution comprising 800 mM Tris-HCl at pH 4.1; and stabilization
solution consisting of 800 mM Tris-HCl, pH 4.1.
[0148] In some embodiments, the stabilization solution can comprise
a plurality of acidic agents. As used herein, an acidic agent is a
compound, composition or solution that forms an acid in solution.
In some embodiments, the stabilization solution can comprise a
plurality of buffering agents. An acidic buffering agent is a
buffering agent that forms an acid in solution. In some
embodiments, the stabilization solution can comprise a combination
of one or more acids, acidic agents, buffers and buffering
agents.
[0149] In some embodiments, the cells are not lysed by heat. Those
of skill in the art will understand that different cells under
different conditions will be lysed at different temperatures and so
can determine temperatures and times at which the cells will not be
lysed by heat. In general, the cells are not subjected to heating
above a temperature and for a time that would cause substantial
cell lysis in the absence of the alkaline conditions used. As used
herein, substantial cell lysis refers to lysis of 90% or greater of
the cells exposed to the alkaline conditions. Significant cell
lysis refers to lysis of 50% or more of the cells exposed to the
alkaline conditions. Sufficient cell lysis refers to lysis of
enough of the cells exposed to the alkaline conditions to allow
synthesis of a detectable amount of amplification products by
multiple strand displacement amplification. In general, the
alkaline conditions used in the disclosed method need only cause
sufficient cell lysis. It should be understood that alkaline
conditions that could cause significant or substantial cell lysis
need not result in significant or substantial cell lysis when the
method is performed.
[0150] In some embodiments, the cells are not subjected to heating
substantially or significantly above the temperature at which the
cells grow. As used herein, the temperature at which the cells grow
refers to the standard temperature, or highest of different
standard temperatures, at which cells of the type involved are
cultured. In the case of animal cells, the temperature at which the
cells grow refers to the body temperature of the animal. In other
embodiments, the cells are not subjected to heating substantially
or significantly above the temperature of the amplification
reaction (where the genome is replicated).
[0151] In some embodiments, the cell lysate is not subjected to
purification prior to the amplification reaction. In the context of
the disclosed method, purification generally refers to the
separation of nucleic acids from other material in the cell lysate.
It has been discovered that multiple displacement amplification can
be performed on unpurified and partially purified samples. It is
commonly thought that amplification reactions cannot be efficiently
performed using unpurified nucleic acid. In particular, PCR is very
sensitive to contaminants.
[0152] Forms of purification include centrifugation, extraction,
chromatography, precipitation, filtration, and dialysis. Partially
purified cell lysate includes cell lysates subjected to
centrifugation, extraction, chromatography, precipitation,
filtration, and dialysis. Partially purified cell lysate generally
does not include cell lysates subjected to nucleic acid
precipitation or dialysis. As used herein, separation of nucleic
acid from other material refers to physical separation such that
the nucleic acid to be amplified is in a different container or
container from the material. Purification does not require
separation of all nucleic acid from all other materials. Rather,
what is required is separation of some nucleic acid from some other
material. As used herein in the context of nucleic acids to be
amplified, purification refers to separation of nucleic acid from
other material. In the context of cell lysates, purification refers
to separation of nucleic acid from other material in the cell
lysate. As used herein, partial purification refers to separation
of nucleic acid from some, but not all, of other material with
which the nucleic acid is mixed. In the context of cell lysates,
partial purification refers to separation of nucleic acid from
some, but not all, of the other material in the cell lysate.
[0153] Unless the context clearly indicates otherwise, reference
herein to a lack of purification, lack of one or more types of
purification or separation operations or techniques, or exclusion
of purification or one or more types of purification or separation
operations or techniques does not encompass the exposure of cells
to alkaline conditions (or the results thereof) the reduction of pH
of a cell lysate (or the results thereof). That is, to the extent
that the alkaline conditions and pH reduction of the disclosed
method produce an effect that could be considered "purification" or
"separation," such effects are excluded from the definition of
purification and separation when those terms are used in the
context of processing and manipulation of cell lysates and
stabilized cell lysates (unless the context clearly indicates
otherwise).
[0154] As used herein, substantial purification refers to
separation of nucleic acid from at least a substantial portion of
other material with which the nucleic acid is mixed. In the context
of cell lysates, substantial purification refers to separation of
nucleic acid from at least a substantial portion of the other
material in the cell lysate. A substantial portion refers to 90% of
the other material involved. Specific levels of purification can be
referred to as a percent purification (such as 95% purification and
70% purification). A percent purification refers to purification
that results in separation from nucleic acid of at least the
designated percent of other material with which the nucleic acid is
mixed.
[0155] Denaturation of nucleic acid molecules to be amplified is
common in amplification techniques. This is especially true when
amplifying genomic DNA. In particular, PCR uses multiple
denaturation cycles. Denaturation is generally used to make nucleic
acid strands accessible to primers. Nucleic acid molecules, genomic
DNA, for example, need not be denatured for efficient multiple
displacement amplification. Elimination of a denaturation step and
denaturation conditions has additional advantages such as reducing
sequence bias in the amplified products (that is, reducing the
amplification bias). In preferred forms of the disclosed method,
the nucleic acid sample or template nucleic acid is not subjected
to denaturating conditions and/or no denaturation step is used.
[0156] In some forms of the disclosed method, the nucleic acid
sample or template nucleic acid is not subjected to heat
denaturating conditions and/or no heat denaturation step is used.
In some forms of the disclosed method, the nucleic acid sample or
template nucleic acid is not subjected to alkaline denaturating
conditions and/or no alkaline denaturation step is used. It should
be understood that while sample preparation (for example, cell
lysis and processing of cell extracts) may involve conditions that
might be considered denaturing (for example, treatment with
alkali), the denaturation conditions or step eliminated in some
forms of the disclosed method refers to denaturation steps or
conditions intended and used to make nucleic acid strands
accessible to primers. Such denaturation is commonly a heat
denaturation, but can also be other forms of denaturation such as
chemical denaturation. It should be understood that in the
disclosed method where the nucleic acid sample or template nucleic
acid is not subjected to denaturing conditions, the template
strands are accessible to the primers (since amplification occurs).
However, the template stands are not made accessible via general
denaturation of the sample or template nucleic acids.
[0157] Alternatively, the nucleic acid sample or template nucleic
acid can be subjected to denaturating conditions and/or a
denaturation step can be used. In some forms of the disclosed
method, the nucleic acid sample or template nucleic acid can be
subjected to heat denaturating conditions and/or a heat
denaturation step can be used. In some forms of the disclosed
method, the nucleic acid sample or template nucleic acid can be
subjected to alkaline denaturating conditions and/or an alkaline
denaturation step can be used.
D. Detection of Amplification Products
[0158] Products of amplification can be detected using any nucleic
acid detection technique. For real-time detection, the
amplification products and the progress of amplification are
detected during amplification. Real-time detection is usefully
accomplished using one or more or one or a combination of
fluorescent change probes and fluorescent change primers. Other
detection techniques can be used, either alone or in combination
with real-timer detection and/or detection involving fluorescent
change probes and primers. Many techniques are known for detecting
nucleic acids. The nucleotide sequence of the amplified sequences
also can be determined using any suitable technique.
E. Modifications And Additional Operations
[0159] 1. Detection of Amplification Products
[0160] Amplification products can be detected directly by, for
example, primary labeling or secondary labeling, as described
below.
[0161] i. Primary Labeling
[0162] Primary labeling consists of incorporating labeled moieties,
such as fluorescent nucleotides, biotinylated nucleotides,
digoxygenin-containing nucleotides, or bromodeoxyuridine, during
strand displacement replication. For example, one may incorporate
cyanine dye deoxyuridine analogs (Yu et al., Nucleic Acids Res.,
22:3226-3232 (1994)) at a frequency of 4 analogs for every 100
nucleotides. A preferred method for detecting nucleic acid
amplified in situ is to label the DNA during amplification with
BrdUrd, followed by binding of the incorporated BrdU with a
biotinylated anti-BrdU antibody (Zymed Labs, San Francisco,
Calif.), followed by binding of the biotin moieties with
Streptavidin-Peroxidase (Life Sciences, Inc.), and finally
development of fluorescence with Fluorescein-tyramide (DuPont de
Nemours & Co., Medical Products Dept.). Other methods for
detecting nucleic acid amplified in situ include labeling the DNA
during amplification with 5-methylcytosine, followed by binding of
the incorporated 5-methylcytosine with an antibody (Sano et al.,
Biochim. Biophys. Acta 951:157-165 (1988)), or labeling the DNA
during amplification with aminoallyl-deoxyuridine, followed by
binding of the incorporated aminoallyl-deoxyuridine with an Oregon
Green.RTM. dye (Molecular Probes, Eugene, Oreg.) (Henegariu et al.,
Nature Biotechnology 18:345-348 (2000)).
[0163] Another method of labeling amplified nucleic acids is to
incorporate 5-(3-aminoallyl)-dUTP (AAdUTP) in the nucleic acid
during amplification followed by chemical labeling at the
incorporated nucleotides. Incorporated
5-(3-aminoallyl)-deoxyuridine (AAdU) can be coupled to labels that
have reactive groups that are capable of reacting with amine
groups. AAdUTP can be prepared according to Langer et al. (1981).
Proc. Natl. Acad. Sci. USA. 78: 6633-37. Other modified nucleotides
can be used in analogous ways. That is, other modified nucleotides
with minimal modification can be incorporated during replication
and labeled after incorporation.
[0164] Examples of labels suitable for addition to AAdUTP are
radioactive isotopes, fluorescent molecules, phosphorescent
molecules, enzymes, antibodies, and ligands. Examples of suitable
fluorescent labels include fluorescein isothiocyanate (FITC),
5,6-carboxymethyl fluorescein, Texas red,
nitrobenz-2-oxa-1,3-diazol-4-yl (NBD), coumarin, dansyl chloride,
rhodamine, amino-methyl coumarin (AMCA), Eosin, Erythrosin,
BODIPY.RTM., Cascade Blue.RTM., Oregon Green.RTM., pyrene,
lissamine, xanthenes, acridines, oxazines, phycoerythrin,
macrocyclic chelates of lanthanide ions such as Quantum Dye.TM.,
fluorescent energy transfer dyes, such as thiazole orange-ethidium
heterodimer, and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7.
Examples of other specific fluorescent labels include
3-Hydroxypyrene 5,8,10-Tri Sulfonic acid, 5-Hydroxy Tryptamine
(5-HT), Acid Fuchsin, Alizarin Complexon, Alizarin Red,
Allophycocyanin, Aminocoumarin, Anthroyl Stearate, Astrazon
Brilliant Red 4G, Astrazon Orange R, Astrazon Red 6B, Astrazon
Yellow 7 GLL, Atabrine, Auramine, Aurophosphine, Aurophosphine G,
BAO 9 (Bisaminophenyloxadiazole), BCECF, Berberine Sulphate,
Bisbenzamide, Blancophor FFG Solution, Blancophor SV, Bodipy F1,
Brilliant Sulphoflavin FF, Calcien Blue, Calcium Green, Calcofluor
RW Solution, Calcofluor White, Calcophor White ABT Solution,
Calcophor White Standard Solution, Carbostyryl, Cascade Yellow,
Catecholamine, Chinacrine, Coriphosphine O, Coumarin-Phalloidin,
CY3.1 8, CY5.1 8, CY7, Dans (1-Dimethyl Amino Naphaline 5 Sulphonic
Acid), Dansa (Diamino Naphtyl Sulphonic Acid), Dansyl NH--CH3,
Diamino Phenyl Oxydiazole (DAO), Dimethylamino-5-Sulphonic acid,
Dipyrrometheneboron Difluoride, Diphenyl Brilliant Flavine 7GFF,
Dopamine, Erythrosin ITC, Euchrysin, FIF (Formaldehyde Induced
Fluorescence), Flazo Orange, Fluo 3, Fluorescamine, Fura-2,
Genacryl Brilliant Red B, Genacryl Brilliant Yellow 10GF, Genacryl
Pink 3G, Genacryl Yellow 5GF, Gloxalic Acid, Granular Blue,
Haematoporphyrin, Indo-1, Intrawhite Cf Liquid, Leucophor PAF,
Leucophor SF, Leucophor WS, Lissamine Rhodamine B200 (RD200),
Lucifer Yellow CH, Lucifer Yellow VS, Magdala Red, Marina Blue,
Maxilon Brilliant Flavin 10 GFF, Maxilon Brilliant Flavin 8 GFF,
MPS (Methyl Green Pyronine Stilbene), Mithramycin, NBD Amine,
Nitrobenzoxadidole, Noradrenaline, Nuclear Fast Red, Nuclear
Yellow, Nylosan Brilliant Flavin E8G, Oxadiazole, Pacific Blue,
Pararosaniline (Feulgen), Phorwite AR Solution, Phorwite BKL,
Phorwite Rev, Phorwite RPA, Phosphine 3R, Phthalocyanine,
Phycoerythrin R, Polyazaindacene Pontochrome Blue Black, Porphyrin,
Primuline, Procion Yellow, Pyronine, Pyronine B, Pyrozal Brilliant
Flavin 7GF, Quinacrine Mustard, Rhodamine 123, Rhodamine 5 GLD,
Rhodamine 6G, Rhodamine B, Rhodamine B 200, Rhodamine B Extra,
Rhodamine BB, Rhodamine BG, Rhodamine WT, Serotonin, Sevron
Brilliant Red 2B, Sevron Brilliant Red 4G, Sevron Brilliant Red B,
Sevron Orange, Sevron Yellow L, SITS (Primuline), SITS (Stilbene
Isothiosulphonic acid), Stilbene, Snarf 1, sulpho Rhodamine B Can
C, Sulpho Rhodamine G Extra, Tetracycline, Thiazine Red R,
Thioflavin S, Thioflavin TCN, Thioflavin 5, Thiolyte, Thiozol
Orange, Tinopol CBS, True Blue, Ultralite, Uranine B, Uvitex SFC,
Xylene Orange, and XRITC.
[0165] Preferred fluorescent labels are fluorescein
(5-carboxyfluorescein-N-hydroxysuccinimide ester), rhodamine
(5,6-tetramethyl rhodamine), and the cyanine dyes Cy3, Cy3.5, Cy5,
Cy5.5 and Cy7. The absorption and emission maxima, respectively,
for these fluors are: FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm),
Cy3.5 (581 nm; 588 nm), Cy5 (652 nm: 672 nm), Cy5.5 (682 nm; 703
nm) and Cy7 (755 nm; 778 nm), thus allowing their simultaneous
detection. Other examples of fluorescein dyes include
6-carboxyfluorescein (6-FAM), 2',4',1,4,-tetrachlorofluorescein
(TET), 2',4',5',7',1,4-hexachlorofluorescein (HEX),
2',7'-dimethoxy-4',5'-dichloro-6-carboxyrhodamine (JOE),
2'-chloro-5'-fluoro-7',8'-fused
phenyl-1,4-dichloro-6-carboxyfluorescein (NED), and
2'-chloro-7'-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC).
Fluorescent labels can be obtained from a variety of commercial
sources, including Amersham Pharmacia Biotech, Piscataway, N.J.;
Molecular Probes, Eugene, Oreg.; and Research Organics, Cleveland,
Ohio.
[0166] A useful form of primary labeling is the use of fluorescent
change primers during amplification. Fluorescent change primers
exhibit a change in fluorescence intensity or wavelength based on a
change in the form or conformation of the primer and the amplified
nucleic acid. Stem quenched primers are primers that when not
hybridized to a complementary sequence form a stem structure
(either an intramolecular stem structure or an intermolecular stem
structure) that brings a fluorescent label and a quenching moiety
into proximity such that fluorescence from the label is quenched.
When the primer binds to a complementary sequence, the stem is
disrupted, the quenching moiety is no longer in proximity to the
fluorescent label and fluorescence increases. In the disclosed
method, stem quenched primers can be used as primers for nucleic
acid synthesis and thus become incorporated into the synthesized or
amplified nucleic acid. Examples of stem quenched primers are
peptide nucleic acid quenched primers and hairpin quenched
primers.
[0167] Peptide nucleic acid quenched primers are primers associated
with a peptide nucleic acid quencher or a peptide nucleic acid
fluor to form a stem structure. The primer contains a fluorescent
label or a quenching moiety and is associated with either a peptide
nucleic acid quencher or a peptide nucleic acid fluor,
respectively. This puts the fluorescent label in proximity to the
quenching moiety. When the primer is replicated, the peptide
nucleic acid is displaced, thus allowing the fluorescent label to
produce a fluorescent signal.
[0168] Hairpin quenched primers are primers that when not
hybridized to a complementary sequence form a hairpin structure
(and, typically, a loop) that brings a fluorescent label and a
quenching moiety into proximity such that fluorescence from the
label is quenched. When the primer binds to a complementary
sequence, the stem is disrupted, the quenching moiety is no longer
in proximity to the fluorescent label and fluorescence increases.
Hairpin quenched primers are typically used as primers for nucleic
acid synthesis and thus become incorporated into the synthesized or
amplified nucleic acid. Examples of hairpin quenched primers are
Amplifluor primers and scorpion primers.
[0169] Cleavage activated primers are primers where fluorescence is
increased by cleavage of the primer. Generally, cleavage activated
primers are incorporated into replicated strands and are then
subsequently cleaved. Cleavage activated primers can include a
fluorescent label and a quenching moiety in proximity such that
fluorescence from the label is quenched. When the primer is clipped
or digested (typically by the 5'-3' exonuclease activity of a
polymerase during amplification), the quenching moiety is no longer
in proximity to the fluorescent label and fluorescence increases.
Little et al., Clin. Chem. 45:777-784 (1999), describe the use of
cleavage activated primers. Use of cleavage activated primers is
not preferred in the disclosed method.
[0170] ii. Secondary Labeling with Detection Probes
[0171] Secondary labeling consists of using suitable molecular
probes, referred to as detection probes, to detect the amplified
nucleic acids. For example, a primer may be designed to contain, in
its non-complementary portion, a known arbitrary sequence, referred
to as a detection tag. A secondary hybridization step can be used
to bind detection probes to these detection tags. The detection
probes may be labeled as described above with, for example, an
enzyme, fluorescent moieties, or radioactive isotopes. By using
three detection tags per primer, and four fluorescent moieties per
each detection probe, one may obtain a total of twelve fluorescent
signals for every replicated strand. Detection probes can interact
by hybridization or annealing via normal Watson-Crick base-pairing
(or related alternatives) or can interact with double-stranded
targets to form a triple helix. Such triplex-forming detection
probes can be used in the same manner as other detection probes,
such as in the form of fluorescent change probes.
[0172] A useful form of secondary labeling is the use of
fluorescent change probes and primers in or following
amplification. Hairpin quenched probes are probes that when not
bound to a target sequence form a hairpin structure (and,
typically, a loop) that brings a fluorescent label and a quenching
moiety into proximity such that fluorescence from the label is
quenched. When the probe binds to a target sequence, the stem is
disrupted, the quenching moiety is no longer in proximity to the
fluorescent label and fluorescence increases. Examples of hairpin
quenched probes are molecular beacons, fluorescent triplex oligos,
and QPNA probes.
[0173] Cleavage activated probes are probes where fluorescence is
increased by cleavage of the probe. Cleavage activated probes can
include a fluorescent label and a quenching moiety in proximity
such that fluorescence from the label is quenched. When the probe
is clipped or digested (typically by the 5'-3' exonuclease activity
of a polymerase during or following amplification), the quenching
moiety is no longer in proximity to the fluorescent label and
fluorescence increases. TaqMan probes are an example of cleavage
activated probes.
[0174] Cleavage quenched probes are probes where fluorescence is
decreased or altered by cleavage of the probe. Cleavage quenched
probes can include an acceptor fluorescent label and a donor moiety
such that, when the acceptor and donor are in proximity,
fluorescence resonance energy transfer from the donor to the
acceptor causes the acceptor to fluoresce. The probes are thus
fluorescent, for example, when hybridized to a target sequence.
When the probe is clipped or digested (typically by the 5'-3'
exonuclease activity of a polymerase during or after
amplification), the donor moiety is no longer in proximity to the
acceptor fluorescent label and fluorescence from the acceptor
decreases. If the donor moiety is itself a fluorescent label, it
can release energy as fluorescence (typically at a different
wavelength than the fluorescence of the acceptor) when not in
proximity to an acceptor. The overall effect would then be a
reduction of acceptor fluorescence and an increase in donor
fluorescence. Donor fluorescence in the case of cleavage quenched
probes is equivalent to fluorescence generated by cleavage
activated probes with the acceptor being the quenching moiety and
the donor being the fluorescent label. Cleavable FRET (fluorescence
resonance energy transfer) probes are an example of cleavage
quenched probes.
[0175] Fluorescent activated probes are probes or pairs of probes
where fluorescence is increased or altered by hybridization of the
probe to a target sequence. Fluorescent activated probes can
include an acceptor fluorescent label and a donor moiety such that,
when the acceptor and donor are in proximity (when the probes are
hybridized to a target sequence), fluorescence resonance energy
transfer from the donor to the acceptor causes the acceptor to
fluoresce. Fluorescent activated probes are typically pairs of
probes designed to hybridize to adjacent sequences such that the
acceptor and donor are brought into proximity. Fluorescent
activated probes can also be single probes containing both a donor
and acceptor where, when the probe is not hybridized to a target
sequence, the donor and acceptor are not in proximity but where the
donor and acceptor are brought into proximity when the probe
hybridized to a target sequence. This can be accomplished, for
example, by placing the donor and acceptor on opposite ends a the
probe and placing target complement sequences at each end of the
probe where the target complement sequences are complementary to
adjacent sequences in a target sequence. If the donor moiety of a
fluorescent activated probe is itself a fluorescent label, it can
release energy as fluorescence (typically at a different wavelength
than the fluorescence of the acceptor) when not in proximity to an
acceptor (that is, when the probes are not hybridized to the target
sequence). When the probes hybridize to a target sequence, the
overall effect would then be a reduction of donor fluorescence and
an increase in acceptor fluorescence. FRET probes are an example of
fluorescent activated probes. Stem quenched primers (such as
peptide nucleic acid quenched primers and hairpin quenched primers)
can be used as secondary labels.
[0176] iii. Multiplexing and Hybridization Array Detection
[0177] Detection of amplified nucleic acids can be multiplexed by
using sets of different primers, each set designed for amplifying
different target sequences. Only those primers that are able to
find their targets will give rise to amplified products. There are
two alternatives for capturing a given amplified nucleic acid to a
fixed position in a solid-state detector. One is to include within
the non-complementary portion of the primers a unique address tag
sequence for each unique set of primers. Nucleic acid amplified
using a given set of primers will then contain sequences
corresponding to a specific address tag sequence. A second and
preferred alternative is to use a sequence present in the target
sequence as an address tag. The disclosed method can be easily
multiplexed by, for example, using sets of different detection
probes directed to different target sequences. Use of different
fluorescent labels with different detection probes allows specific
detection of different target sequences.
[0178] 2. Combinatorial Multicolor Coding
[0179] One form of multiplex detection involves the use of a
combination of labels that either fluoresce at different
wavelengths or are colored differently. One of the advantages of
fluorescence for the detection of hybridization probes is that
several targets can be visualized simultaneously in the same
sample. Using a combinatorial strategy, many more targets can be
discriminated than the number of spectrally resolvable
fluorophores. Combinatorial labeling provides the simplest way to
label probes in a multiplex fashion since a probe fluor is either
completely absent (-) or present in unit amounts (+); image
analysis is thus more amenable to automation, and a number of
experimental artifacts, such as differential photobleaching of the
fluors and the effects of changing excitation source power
spectrum, are avoided. Combinatorial labeling can be used with
fluorescent change probes and primers.
[0180] The combinations of labels establish a code for identifying
different detection probes and, by extension, different target
molecules to which those detection probes are associated with. This
labeling scheme is referred to as Combinatorial Multicolor Coding
(CMC). Such coding is described by Speicher et al., Nature Genetics
12:368-375 (1996). Use of CMC is described in U.S. Pat. No.
6,143,495. Any number of labels, which when combined can be
separately detected, can be used for combinatorial multicolor
coding. It is preferred that 2, 3, 4, 5, or 6 labels be used in
combination. It is most preferred that 6 labels be used. The number
of labels used establishes the number of unique label combinations
that can be formed according to the formula 2.sup.N-1, where N is
the number of labels. According to this formula, 2 labels forms
three label combinations, 3 labels forms seven label combinations,
4 labels forms 15 label combinations, 5 labels form 31 label
combinations, and 6 labels forms 63 label combinations.
[0181] For combinatorial multicolor coding, a group of different
detection probes are used as a set. Each type of detection probe in
the set is labeled with a specific and unique combination of
fluorescent labels. For those detection probes assigned multiple
labels, the labeling can be accomplished by labeling each detection
probe molecule with all of the required labels. Alternatively,
pools of detection probes of a given type can each be labeled with
one of the required labels. By combining the pools, the detection
probes will, as a group, contain the combination of labels required
for that type of detection probe. Where each detection probe is
labeled with a single label, label combinations can also be
generated by using primers with coded combinations of detection
tags complementary to the different detection probes. In this
scheme, the primers will contain a combination of detection tags
representing the combination of labels required for a specific
label code. Further illustrations are described in U.S. Pat. No.
6,143,495. Use of pools of detection probes each probe with a
single label is preferred when fluorescent change probes are
used.
[0182] Speicher et al. describes a set of fluors and corresponding
optical filters spaced across the spectral interval 350-770 nm that
give a high degree of discrimination between all possible fluor
pairs. This fluor set, which is preferred for combinatorial
multicolor coding, consists of 4'-6-diamidino-2-phenylinodole
(DAPI), fluorescein (FITC), and the cyanine dyes Cy3, Cy3.5, Cy5,
Cy5.5 and Cy7. Any subset of this preferred set can also be used
where fewer combinations are required. The absorption and emission
maxima, respectively, for these fluors are: DAPI (350 nm; 456 nm),
FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm), Cy3.5 (581 nm; 588
nm), Cy5 (652 nm; 672 nm), Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm;
778 nm). The excitation and emission spectra, extinction
coefficients and quantum yield of these fluors are described by
Ernst et al., Cytometry 10:3-10 (1989), Mujumdar et al., Cytometry
10:11-19 (1989), Yu, Nucleic Acids Res. 22:3226-3232 (1994), and
Waggoner, Meth. Enzymology 246:362-373 (1995). These fluors can all
be excited with a 75W Xenon arc.
[0183] To attain selectivity, filters with bandwidths in the range
of 5 to 16 nm are preferred. To increase signal discrimination, the
fluors can be both excited and detected at wavelengths far from
their spectral maxima. Emission bandwidths can be made as wide as
possible. For low-noise detectors, such as cooled CCD cameras,
restricting the excitation bandwidth has little effect on
attainable signal to noise ratios. A list of preferred filters for
use with the preferred fluor set is listed in Table 1 of Speicher
et al. It is important to prevent infra-red light emitted by the
arc lamp from reaching the detector; CCD chips are extremely
sensitive in this region. For this purpose, appropriate IR blocking
filters can be inserted in the image path immediately in front of
the CCD window to minimize loss of image quality. Image analysis
software can then be used to count and analyze the spectral
signatures of fluorescent dots.
[0184] i. Enzyme-linked Detection
[0185] Amplified nucleic acid labeled by incorporation of labeled
nucleotides can be detected with established enzyme-linked
detection systems. For example, amplified nucleic acid labeled by
incorporation of biotin using biotin-16-UTP (Roche Molecular
Biochemicals) can be detected as follows. The nucleic acid is
immobilized on a solid glass surface by hybridization with a
complementary DNA oligonucleotide (address probe) complementary to
the target sequence (or its complement) present in the amplified
nucleic acid. After hybridization, the glass slide is washed and
contacted with alkaline phosphatase-streptavidin conjugate (Tropix,
Inc., Bedford, Mass.). This enzyme-streptavidin conjugate binds to
the biotin moieties on the amplified nucleic acid. The slide is
again washed to remove excess enzyme conjugate and the
chemiluminescent substrate CSPD (Tropix, Inc.) is added and covered
with a glass cover slip. The slide can then be imaged in a Biorad
Fluorimager.
[0186] 3. Using Products of Circular Genome Amplification
[0187] The nucleic acids produced using the disclosed method can be
used for any purpose. For example, the amplified nucleic acids can
be analyzed (such as by sequencing, any technique using
hybridization, e.g., of probe or primers) to determine
characteristics of the amplified sequences or the presence or
absence or certain sequences. The amplified nucleic acids can also
be used as reagents for assays or other methods. For example,
nucleic acids produced in the disclosed method can be coupled or
adhered to a solid-state substrate. The resulting immobilized
nucleic acids can be used as probes or indexes of sequences in a
sample. Nucleic acids produced in the disclosed method can be
coupled or adhered to a solid-state substrate in any suitable way.
For example, nucleic acids generated by multiple strand
displacement can be attached by adding modified nucleotides to the
3' ends of nucleic acids produced by strand displacement
replication using terminal deoxynucleotidyl transferase, and
reacting the modified nucleotides with a solid-state substrate or
support thereby attaching the nucleic acids to the solid-state
substrate or support.
[0188] Nucleic acids produced in the disclosed method also can be
used as probes or hybridization partners. For example, sequences of
interest can be amplified in the disclosed method and provide a
ready source of probes. The replicated strands (produced in the
disclosed method) can be cleaved prior to use as hybridization
probes. For example, the replicated strands can be cleaved with
DNAse I. The hybridization probes can be labeled as described
elsewhere herein with respect to labeling of nucleic acids produce
in the disclosed method.
[0189] Nucleic acids produced in the disclosed method also can be
used for subtractive hybridization to identify sequences that are
present in only one of a pair or set of samples. For example,
amplified cDNA from different samples can be annealed and the
resulting double-stranded material can be separated from
single-stranded material. Unhybridized sequences would be
indicative of sequences expressed in one of the samples but not
others.
SPECIFIC EMBODIMENTS
[0190] Disclosed is a method of amplifying a circular genome, the
method comprising, bringing into contact a set of primers, DNA
polymerase, and a genomic nucleic acid sample, wherein the genomic
nucleic acid sample comprises a circular genome, and incubating the
genomic nucleic acid sample under conditions that promote
replication of the circular genome in the genomic nucleic acid
sample, wherein replication of the circular genome proceeds by
rolling circle replication, wherein the conditions that promote
replication of the circular genome do not involve thermal cycling,
wherein the genomic nucleic acid sample further comprises
non-target nucleic acids, wherein the circular genome is amplified
at least 10 fold compared to the non-target nucleic acids.
[0191] The non-target nucleic acids can comprise one or more
non-target genomes, wherein the circular genome is amplified at
least 10 fold compared to the non-target genomes. The circular
genome can be amplified at least 50 fold, 100 fold, 200 fold, 500
fold, 1000 fold, 2000 fold, or 5000 fold compared to the non-target
genomes. The non-target genome can be a bacterial genome, viral
genome, microbial genome, pathogen genome, eukaryotic genome, plant
genome, animal genome, vertebrate genome, fish genome, avian
genome, mammalian genome, rodent genome, murine genome, human
genome, host genome, a non-target circular genome, or a
combination. The circular genome can be an organelle genome, a
mitochondrial genome, a chloroplast genome, a plastid genome, a
bacterial plasmid genome, a viral genome, a bacterial genome, a
microbial genome, a pathogen genome, or a combination. The circular
genome can be a naturally occurring genome. The circular genome can
not be artificially modified. The circular genome can not be an
artificial nucleic acid. The circular genome can be double-stranded
or single-stranded. The circular genome can have a length of from
about 3000 to about 300000 nucleotides, about 4000 to about 260000
nucleotides, about 5000 to about 150000 nucleotides, or about 5500
to about 40000 nucleotides.
[0192] The primers can each comprise a specific nucleotide
sequence. The primers can each have a specific nucleotide sequence.
The primers can specifically hybridize to a nucleotide sequence in
the circular genome under conditions that promote replication of
the circular genome. The primers can each separately have a length
5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9
nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13
nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17
nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21
nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25
nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29
nucleotides, or 30 nucleotides.
[0193] The primers can each separately have a length less than 6
nucleotides, less than 7 nucleotides, less than 8 nucleotides, less
than 9 nucleotides, less than 10 nucleotides, less than 11
nucleotides, less than 12 nucleotides, less than 13 nucleotides,
less than 14 nucleotides, less than 15 nucleotides, less than 16
nucleotides, less than 17 nucleotides, less than 18 nucleotides,
less than 19 nucleotides, less than 20 nucleotides, less than 21
nucleotides, less than 22 nucleotides, less than 23 nucleotides,
less than 24 nucleotides, less than 25 nucleotides, less than 26
nucleotides, less than 27 nucleotides, less than 28 nucleotides,
less than 29 nucleotides, less than 30 nucleotides, or less than 31
nucleotides.
[0194] The set of primers can comprise 2 primers, 3 primers, 4
primers, 5 primers, 6 primers, 7 primers, 8 primers, 9 primers, 10
primers, 11 primers, 12 primers, 13 primers, 14 primers, 15
primers, 16 primers, 17 primers, 18 primers, 19 primers, 20
primers, 21 primers, 22 primers, 23 primers, 24 primers, 25
primers, 26 primers, 27 primers, 28 primers, 29 primers, 30
primers, 31 primers, 32 primers, 33 primers, 34 primers, 35
primers, 36 primers, 37 primers, 38 primers, 39 primers, 40
primers, 41 primers, 42 primers, 43 primers, 44 primers, 45
primers, 46 primers, 47 primers, 48 primers, 49 primers, 50
primers, 51 primers, 52 primers, 53 primers, 54 primers, 55
primers, 56 primers, 57 primers, 58 primers, 59 primers, 60
primers, 61 primers, 62 primers, 63 primers, 75 primers, 100
primers, 150 primers, 200 primers, 300 primers, 400 primers,
wherein each primer in the set has a different specific nucleotide
sequence.
[0195] The primers can each have a nucleotide sequence
complementary to a nucleotide sequence in the circular genome,
wherein the distance between consecutive primers hybridized to the
same strand of the circular genome averages from about 200 to about
20000 nucleotides, about 200 to about 6000 nucleotides, about 300
to about 5000 nucleotides, or about 400 to about 4000 nucleotides.
The primers can each have a nucleotide sequence complementary to a
nucleotide sequence in the circular genome, wherein the distance
between consecutive primers hybridized to the same strand of the
circular genome are from about 200 to about 20000 nucleotides,
about 200 to about 6000 nucleotides, about 300 to about 5000
nucleotides, or about 400 to about 4000 nucleotides. The circular
genome can be double-stranded, wherein one or more of the primers
have a nucleotide sequence complementary to one of the strands of
the circular genome and one or more of the primers have a
nucleotide sequence complementary to the other strand of the
circular genome, wherein all of the primers have a nucleotide
sequence complementary to one of the strands of the circular
genome, or all of the primers have a nucleotide sequence
complementary to the other strand of the circular genome.
[0196] The circular genome can be single-stranded, wherein one or
more of the primers have a nucleotide sequence complementary to the
circular genome and one or more of the primers have a nucleotide
sequence that matches a sequence of the circular genome, wherein
rolling circle replication results in the formation of tandem
sequence DNA, wherein the one or more of the primers that have a
nucleotide sequence that matches a sequence of the circular genome
prime strand displacement replication of the tandem sequence DNA,
wherein replication of the tandem sequence DNA results in formation
of secondary tandem sequence DNA.
[0197] The primers can each separately comprise
deoxyribonucleotides, ribonucloetides, modified nucleotides,
nucleotide analogs, labelled nucleotides, oligomer analogs, or a
combination.
[0198] The genomic nucleic acid sample can be a blood sample, a
urine sample, a semen sample, a lymphatic fluid sample, a
cerebrospinal fluid sample, amniotic fluid sample, a biopsy sample,
a needle aspiration biopsy sample, a cancer sample, a tumor sample,
a tissue sample, a cell sample, a cell lysate sample, a crude cell
lysate sample, a forensic sample, an archeological sample, an
infection sample, a nosocomial infection sample, an environmental
sample, or a combination thereof.
[0199] The conditions that promote replication of the circular
genome can be substantially isothermic.
[0200] Also disclosed is a method of identifying a set of primers
for differential amplification of a circular genome, the method
comprising selecting test primers for a test set of primers,
wherein each primer can specifically hybridize to a nucleotide
sequence in a circular genome, wherein the distance between
consecutive primers hybridized to the same strand of the circular
genome averages from about 200 to about 20000 nucleotides, about
200 to about 6000 nucleotides, bringing into contact the test set
of primers, DNA polymerase, and a genomic nucleic acid sample,
wherein the test genomic nucleic acid sample comprises the circular
genome and non-target nucleic acids, incubating the genomic nucleic
acid sample under conditions that promote replication of the
circular genome in the genomic nucleic acid sample, wherein
replication of the circular genome proceeds by rolling circle
replication, wherein the conditions that promote replication of the
circular genome do not involve thermal cycling, and determining the
relative amplification of the circular genome and the non-target
nucleic acids, wherein the test set of primers are identified if
the circular genome is amplified at least 10 fold compared to the
non-target nucleic acids.
EXAMPLES
Differential Amplification of Mitochondrial Genome
[0201] This example describes amplification of mitochondrial DNA
according the disclosed method. A nucleic acid preparation isolated
by the QIAamp procedure (QIAGEN) from human blood contains both
mitochondrial DNA in modest amounts and a large amount of nuclear
DNA. Primers were selected according to the principles disclosed
herein that bind specifically to mitochondrial DNA. Amplification
using primers10 nucleotides in length were compared with
amplification using primers 14 nucleotides in length. The primer
sequences are shown in Tables 1 and 2. The distance between
consecutive primers on each strand of the mitochondrial DNA was
about 4000 nucleotides. TABLE-US-00001 TABLE 1 Mitochondrial
specific primers (10 nucleotide long primers) Primer Name Primer
Sequence mt1s2 CCCCATTC*C*A (SEQ ID NO. 1) mt2as2 CAATTGAG*T*A (SEQ
ID NO. 2) mt3s2 AATCCTTC*T*A (SEQ ID NO. 3) mt4as2 CGGTCTGT*T*A
(SEQ ID NO. 4) mt5s2 GCCACAAC*T*A (SEQ ID NO. 5) mt6as2
TATGAGAG*T*A (SEQ ID NO. 6) mt7s2 CAAACATC*T*A (SEQ ID NO. 7)
mt8as2 CGTGGTTG*T*A (SEQ ID NO. 8) Asterisks indicate Exonuclease
resistant Phosphorothioate Modification.
[0202] TABLE-US-00002 TABLE 2 Mitochondrial specific primers (14
nucleotide long primers) Primer Name Primer Sequence mt1s3
GCATCCCCATTC*C*A (SEQ ID NO. 9) mt2as3 TTCCCAATTGAG*T*A (SEQ ID NO.
10) mt3s3 CCATAATCCTTC*T*A (SEQ ID NO. 11) mt4as3 GTTGCGGTCTGT*T*A
(SEQ ID NO. 12) mt5s3 TATTGCCACAAC*T*A (SEQ ID NO. 13) mt6as3
GGGTTATGAGAG*T*A (SEQ ID NO. 14) mt7s3 GACCCAAACATC*T*A (SEQ ID NO.
15) mt8as3 TGGTCGTGGTTG*T*A (SEQ ID NO. 16) Asterisks indicate
Exonuclease resistant Phosphorothioate Modification.
[0203] To carry out the reactions, 10 ng of DNA (containing nuclear
and mitochondrial DNA) was added to an REPLI-g buffer (QIAGEN) with
or without primers. For reactions with primers, either the eight 10
nucleotide primers or the eight 14 nucleotide primers were added.
The mixture was heated to 70.degree. C. for 5 min. After heating
the reaction was cooled down on ice and Phi29 DNA Polymerase was
added. The amplification was performed for eight hours at
30.degree. C. The resulting nucleic acid was quantified by
PicoGreen Assay (Invitrogen). The results are shown in FIG. 1. The
10 nucleotide primers resulting in significantly greater yield than
the 14 nucleotide primers. This was not expected and shows that
shorter primers can have a thermodynamic advantage over longer
primers in rolling circle amplification of circular genomes. The
shorter primers resulted in not only a higher specificity (as shown
by lower CT values, see below) but also and unexpectedly in a
better amplification rate (FIG. 1).
[0204] The differential amplification of the mitochondrial DNA over
nuclear DNA was determined by real-time PCR using 10 ng of
amplified DNA from the amplification reaction or 10 ng of the
unamplified source nucleic acid. Single sequences in the
mitochondrial DNA and in the nuclear DNA were used for this
assessment.
[0205] Primers for Real-Time PCR System for Nuclear DNA
TABLE-US-00003 699s TGCTCCCTGTCCCATCTG (SEQ ID NO. 17) 699as
AGACAGTATGCCTTTATTTCACCC (SEQ ID NO. 18)
[0206] Primers for Real-Time PCR System for Mitochondrial DNA
TABLE-US-00004 mt9s/665 CTCTTGCTCAGCCTATATAC (SEQ ID NO. 19)
mt10as/665 GTAGAAAATGTAGCCCATTAC (SEQ ID NO. 20)
[0207] The results are shown in FIG. 2. The Ct values between
nuclear and mitochondrial specific markers are very similar if
using gDNA (=nucleic acid sample) that contain both nuclear DNA and
mitochondrial DNA. The Ct value of the mitochondrial marker is
decreased by .about.4 cycles after having performed the
mitochondrial specific RCA using 10 nt long mitochondrial DNA
specific primers. In contrast, the Ct value of the nuclear marker
is increased by .about.4 cycles after the mitochondrial specific
RCA. In contrast, the results obtained with 14 nt long primers did
not result in a highly specific amplification of mitochondrial DNA:
Both, the Ct values of nuclear and mitochondrial specific markers
increased. This indicated that an amplification of a non-specific
DNA has occurred. It has been described in the art that
non-specific DNA can be generated in the presence of primers by
forming large artificial DNA molecules starting from intermolecular
primer aggregates. In addition, a lower yield was observed with 14
nt Primers as compared to 10 nt long primers (see FIG. 1). This
indicates that the DNA polymerase prefers to build an elongation
complex with the shorter primers rather than with the longer
primers.
[0208] It is understood that the disclosed invention is not limited
to the particular methodology, protocols, and reagents described as
these may vary. It is also to be understood that the terminology
used herein is for the purpose of describing particular embodiments
only, and is not intended to limit the scope of the present
invention which will be limited only by the appended claims.
[0209] It must be noted that as used herein and in the appended
claims, the singular forms "a", "an", and "the" include plural
reference unless the context clearly dictates otherwise. Thus, for
example, reference to "a host cell" includes a plurality of such
host cells, reference to "the antibody" is a reference to one or
more antibodies and equivalents thereof known to those skilled in
the art, and so forth.
[0210] Unless defined otherwise, all technical and scientific terms
used herein have the same meanings as commonly understood by one of
skill in the art to which the disclosed invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, the preferred methods, devices, and materials are as
described. Publications cited herein and the material for which
they are cited are specifically incorporated by reference. Nothing
herein is to be construed as an admission that the invention is not
entitled to antedate such disclosure by virtue of prior
invention.
[0211] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
20 1 10 DNA Artificial Sequence Description of Artificial Sequence
Synthetically constructed Mitochondrial specific primer
modified_base 8, 9 Exonuclease resistant Phosphorothioate
Modification 1 ccccattcca 10 2 10 DNA Artificial Sequence
Description of Artificial Sequence Synthetically constructed
Mitochondrial specific primer modified_base 8, 9 Exonuclease
resistant Phosphorothioate Modification 2 caattgagta 10 3 10 DNA
Artificial Sequence Description of Artificial Sequence
Synthetically constructed Mitochondrial specific primer
modified_base 8, 9 Exonuclease resistant Phosphorothioate
Modification 3 aatccttcta 10 4 10 DNA Artificial Sequence
Description of Artificial Sequence Synthetically constructed
Mitochondrial specific primer modified_base 8, 9 Exonuclease
resistant Phosphorothioate Modification 4 cggtctgtta 10 5 10 DNA
Artificial Sequence Description of Artificial Sequence
Synthetically constructed Mitochondrial specific primer
modified_base 8, 9 Exonuclease resistant Phosphorothioate
Modification 5 gccacaacta 10 6 10 DNA Artificial Sequence
Description of Artificial Sequence Synthetically constructed
Mitochondrial specific primer modified_base 8, 9 Exonuclease
resistant Phosphorothioate Modification 6 tatgagagta 10 7 10 DNA
Artificial Sequence Description of Artificial Sequence
Synthetically constructed Mitochondrial specific primer
modified_base 8, 9 Exonuclease resistant Phosphorothioate
Modification 7 caaacatcta 10 8 10 DNA Artificial Sequence
Description of Artificial Sequence Synthetically constructed
Mitochondrial specific primer modified_base 8, 9 Exonuclease
resistant Phosphorothioate Modification 8 cgtggttgta 10 9 14 DNA
Artificial Sequence Description of Artificial Sequence
Synthetically constructed Mitochondrial specific primer
modified_base 12, 13 Exonuclease resistant Phosphorothioate 9
gcatccccat tcca 14 10 14 DNA Artificial Sequence Description of
Artificial Sequence Synthetically constructed Mitochondrial
specific primer modified_base 12, 13 Exonuclease resistant
Phosphorothioate Modification 10 ttcccaattg agta 14 11 14 DNA
Artificial Sequence Description of Artificial Sequence
Synthetically constructed Mitochondrial specific primer
modified_base 12, 13 Exonuclease resistant Phosphorothioate
Modification 11 ccataatcct tcta 14 12 14 DNA Artificial Sequence
Description of Artificial Sequence Synthetically constructed
Mitochondrial speciific primer modified_base 12, 13 Exonuclease
resistant Phosphorothioate Modification 12 gttgcggtct gtta 14 13 14
DNA Artificial Sequence Description of Artificial Sequence
Synthetically constructed Mitochondrial specific primer
modified_base 12, 13 Exonuclease resistant Phosphorothioate
Modification 13 tattgccaca acta 14 14 14 DNA Artificial Sequence
Description of Artificial Sequence Synthetically constructed
Mitochondrial specific primer modified_base 12, 13 Exonuclease
resistant Phosphorothioate Modification 14 gggttatgag agta 14 15 14
DNA Artificial Sequence Description of Artificial Sequence
Synthetically constructed Mitochondrial specific primer
modified_base 12, 13 Exonuclease resistant Phosphorothioate
Modification 15 gacccaaaca tcta 14 16 14 DNA Artificial Sequence
Description of Artificial Sequence Synthetically constructed
Mitochondrial specific primer modified_base 12, 13 Exonuclease
resistant Phosphorothioate Modification 16 tggtcgtggt tgta 14 17 18
DNA Artificial Sequence Description of Artificial Sequence
Synthetically constructed nuclear DNA specific primer 17 tgctccctgt
cccatctg 18 18 24 DNA Artificial Sequence Description of Artificial
Sequence Synthetically constructed nuclear DNA specific primer 18
agacagtatg cctttatttc accc 24 19 20 DNA Artificial Sequence
Description of Artificial Sequence note= synthetic construct 19
ctcttgctca gcctatatac 20 20 21 DNA Artificial Sequence Description
of Artificial Sequence note= synthetic construct 20 gtagaaaatg
tagcccatta c 21
* * * * *