U.S. patent application number 12/000683 was filed with the patent office on 2008-04-24 for two-step immunization procedure against chlamydia infection.
Invention is credited to Robert C. Brunham, Andrew D. Murdin.
Application Number | 20080095804 12/000683 |
Document ID | / |
Family ID | 22335290 |
Filed Date | 2008-04-24 |
United States Patent
Application |
20080095804 |
Kind Code |
A1 |
Brunham; Robert C. ; et
al. |
April 24, 2008 |
Two-step immunization procedure against chlamydia infection
Abstract
A host is immunized against infection by a strain of Chlamydia
by initial administration of an attenuated bacteria harbouring a
nucleic acid encoding a Chlamydia protein followed by
administration of a Chlamydia protein in ISCOMs. This procedure
enables a high level of protection to be achieved.
Inventors: |
Brunham; Robert C.;
(Vancouver, CA) ; Murdin; Andrew D.; (Richmond
Hill, CA) |
Correspondence
Address: |
SIM & MCBURNEY
330 UNIVERSITY AVENUE
6TH FLOOR
TORONTO
ON
M5G 1R7
CA
|
Family ID: |
22335290 |
Appl. No.: |
12/000683 |
Filed: |
December 17, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09857305 |
Oct 3, 2001 |
|
|
|
PCT/CA99/01151 |
Dec 2, 1999 |
|
|
|
12000683 |
Dec 17, 2007 |
|
|
|
60110855 |
Dec 4, 1998 |
|
|
|
Current U.S.
Class: |
424/258.1 ;
424/263.1; 435/252.3 |
Current CPC
Class: |
A61P 27/02 20180101;
A61K 39/00 20130101; A61P 43/00 20180101; A61K 2039/51 20130101;
C07K 14/295 20130101; A61P 31/00 20180101; C12N 15/87 20130101;
A61P 31/04 20180101; A61P 15/00 20180101 |
Class at
Publication: |
424/258.1 ;
424/263.1; 435/252.3 |
International
Class: |
A61K 39/00 20060101
A61K039/00; A61P 43/00 20060101 A61P043/00; C12N 1/20 20060101
C12N001/20 |
Claims
1. A method of immunizing a host against infection caused by a
strain of Chlamydia, which comprises: initially administering to
the host an immunoeffective amount of an attenuated bacteria
harbouring a nucleic acid molecule encoding at least one
immunoprotection-inducing Chlamydia protein or a fragment thereof
which generates a Chlamydia protein specific immune response, and
subsequently administering to the host an immunoeffective amount of
at least one purified Chlamydia protein or a fragment thereof which
generates a Chlamydia protein specific immune response, of the same
at least one Chlamydia protein as the initial administration to
achieve a Chlamydia specific protective immune response in the
host.
2. The method of claim 1 wherein said immunoprotection inducing
Chlamydia protein or fragment thereof is a major outer membrane
protein (OMP) of a strain of Chlamydia.
3. The method of claim 2 wherein said strain of Chlamydia is a
strain of Chlamydia pneumoniae.
4. The method of claim 2 wherein said strain of Chlamydia is a
strain of Chlamydia trachomatis.
5. The method of claim 1 wherein said nucleic acid molecule is
provided in a vector comprising the same and a promoter sequence
operatively coupled to said nucleic acid molecule for expression of
said Chlamydia protein or fragment thereof in said host.
6. The method of claim 5 wherein said nucleic acid molecule encodes
a full-length major outer membrane protein (MOMP) of a strain of
Chlamydia.
7. The method of claim 6 wherein said strain of Chlamydia is a
strain of Chlamydia pneumoniae.
8. The method of claim 6 wherein said strain of Chlamydia is a
strain of Chlamydia trachomatis.
9. The method of claim 1 wherein said attenuated bacteria is an
attenuated strain of Salmonella.
10. The method of claim 5 wherein said promoter is a
cytomegalovirus promoter.
11. The method of claim 5 wherein said vector is a plasmid
vector.
12. The method of claim 11 wherein said plasmid vector has the
identifying characteristics of pcDNA3/MOMP as seen in FIG. 5.
13. The method of claim 1 wherein said immunoprotection-inducing
chlamydial protein used in said subsequent administration step is
administered incorporated into an immunostimulating complex
(ISCOM).
14. The method of claim 13 wherein said chlamydial protein or
fragment thereof is a major outer membrane protein (MOMP) of a
strain of Chlamydia.
15. The method of claim 14 wherein said strain of Chlamydia is a
strain of Chlamydia pneumoniae.
16. The method of claim 14 wherein said strain of Chlamydia is a
strain of Chlamydia trachomatis.
17. The method of claim 1 wherein said first administration step is
effected to mucosal surfaces.
18. The method of claim 17 wherein said first administration step
is effected by intranasal administration and said second
administration step is effected by intramuscular
administration.
19. An attenuated strain of a bacterium harbouring a nucleic acid
molecule encoding at least one immunoprotection-inducing Chlamydia
protein or a fragment thereof which generates a Chlamydia protein
specific immune response.
20. The attenuated strain of claim 19 wherein said immunoprotection
inducing Chlamydia protein or fragment thereof is a major outer
membrane protein (MOMP) of a strain of Chlamydia.
21. The attenuated strain of claim 20 wherein said strain of
Chlamydia is a strain of Chlamydia pneumoniae.
22. The attenuated strain of claim 20 wherein said strain of
Chlamydia is a strain of Chlamydia trachomatis.
23. The attenuated strain of claim 19 wherein said nucleic acid
molecule is provided in a vector comprising the same and a promoter
sequence operatively coupled to said nucleic acid molecule for
expression of said Chlamydia protein or fragment thereof in said
host.
24. The attenuated strain of claim 23 wherein said promoter is a
cytomegalovirus promoter.
25. The attenuated strain of claim 23 wherein said vector is a
plasmid vector.
26. The attenuated strain of claim 25 wherein said plasmid vector
has the identifying characteristics of pcDNA3/MOMP as seen in FIG.
5.
27. The attenuated strain of claim 19 wherein said attenuated
bacteria is an attenuated strain of Salmonella.
28. The attenuated strain of claim 27 wherein said attenuated
strain of Salmonella is an attenuated strain of Salmonella
typhimurium.
29. A method of immunizing a host against infection caused by a
strain of Chlamydia, which comprises: administering to the host an
immunoeffective amount of an attenuated bacteria harbouring a
nucleic acid molecule encoding at least one
immunoprotection-inducing Chlamydia protein or a fragment thereof
which generates a Chlamydia protein specific immune response.
30. The method of claim 29 wherein said immunoprotection inducing
Chlamydia protein or fragment thereof is a major outer membrane
protein (MOMP) of a strain of Chlamydia.
31. The method of claim 30 wherein said strain of Chlamydia is a
strain of Chlamydia pneumoniae.
32. The method of claim 30 wherein said strain of Chlamydia is a
strain of Chlamydia trachomatis.
33. The method of claim 29 wherein said nucleic acid molecule is
provided in a vector comprising the same and a promoter sequence
operatively coupled to said nucleic acid molecule for expression of
said Chlamydia protein or fragment thereof in said host.
34. The method of claim 33 wherein said promoter is a
cytomegalovirus promoter.
35. The method of claim 33 wherein said vector is a plasmid
vector.
36. The method of claim 35 wherein said plasmid vector has the
identifying characteristics of pcDNA3/MOMP as seen in FIG. 5.
37. The method of claim 29 wherein said attenuated bacteria is an
attenuated strain of Salmonella.
38. The method of claim 37 wherein said attenuated strain of
Salmonella is an attenuated strain of Salmonella typhimurium.
39. The method of claim 29 wherein said administration is effected
to mucosal surfaces.
40. The method of claim 39 wherein said administration is effected
by intranasal administration.
Description
FIELD OF INVENTION
[0001] The present invention relates to the field of immunology
and, in particular, to a vaccination procedure for protection of a
host against disease caused by infection with a bacterium of the
Chlamydiacease genus, particularly Chlamydia trachomatis.
BACKGROUND OF INVENTION
[0002] Chlamydia trachomatis is a species of the genus
Chlamydiacease, order Chlamydiales, C. trachomatis infects the
epithelia of the conjunctivae and the genital tract, causing
trachoma and a variety of sexually transmitted diseases (STDs)
which can lead to, respectively, blindness or infertility. There
are at least 15 serovars of C. trachomatis, of which A, B and C are
causative agents of trachoma, while serovars D, E, F, G, H, I, J
and K are the most common causative agents of the Chlamydial STDs.
C. trachomatis infections are endemic throughout the world.
Trachoma is the leading cause of preventable blindness in
developing nations, and it is estimated that 600 million people
suffer from trachoma worldwide, with as many as 10 million of them
being blinded by the disease. In the United States, there are an
estimated 3 million cases per year of STDs caused by C.
trachomatis.
[0003] The pathogenesis of trachoma involves repeated ocular
infections and the generation of a deleterious hypersensitivity
response to chlamydial antigen(s) (refs. 1 to 4--Throughout this
specification, various references are referred to in parenthesis to
more fully describe the state of the art of which this invention
pertains. Full bibliographic information for each citation is found
at the end of the specification. The disclosure of these references
are hereby incorporated by reference into the present disclosure).
The available evidence supports the hypotheses that both secretory
IgA and cell-mediated immune responses are important components of
protection. Ocular infection in a primate model induces rapid and
persistent production of IgA in tears, whereas the presence of IgG
in tears is transient, corresponding to the period of peak
conjunctival inflammation (refs. 5). Protective immunity following
experimental ocular infection in a sub-human primate model is
homotypic and resistance to ocular challenge correlates with the
presence of serovar-specific antibodies in tears (refs. 1, 2, 6).
Tears from infected humans neutralized the infectivity of
homologous but not heterologous trachoma serovars for owl monkeys
eyes (ref. 7) whereas passive humoral immunization with
antitrachoma antibodies was not protective (ref. 8). Several lines
of evidence indicate the importance of cell-mediated responses in
protection from or clearance of chlamydial infection. B-cell
deficient mice can resolve infection, whereas nude mice become
persistently infected. Adoptive transfer of at least some
chlamydia-specific T-cell lines or clones can cure persistently
infected nude mice, and this anti-chlamydial activity is probably a
function of the ability of the T-cells to secrete
interferon-.gamma. (refs. 9 to 16).
[0004] Past attempts to develop whole-cell vaccines against
trachoma have actually potentiated disease by sensitizing vaccines
(refs. 1, 2). Sensitization has been determined to be elicited to a
57 kD stress response protein (SRP)(HSP60) present in all serovars
of C. trachomatis. Repeated exposure to the 57 kD SRP can result in
a delayed hypersensitivity reaction, causing the chronic
inflammation commonly associated with Chlamydial infections. Thus,
an immunogenic preparation capable of inducing a strong and
enduring mucosal neutralizing antibody response and a strong
cellular immune response without sensitizing the host would be
useful (ref. 17).
[0005] A most promising candidate antigen for the development of a
vaccine is the chlamydial major outer membrane protein (MOMP)
(refs. 18 to 20). Other surface proteins and the surface
lipopolysaccharide are also immunogenic, but the antibodies they
induce have not been found to be protective (refs. 21, 33). The
MOMP, which is the predominant surface protein, is an integral
membrane protein with a mass of about 40 kDa which, with the
exception of four variable domains (VDs) designated I, II, III and
IV, is highly conserved amongst serovars. The sequences of all four
VDs have been determined for fifteen serovars (refs. 23, 24).
Antibodies capable of neutralizing chlamydial infectivity recognize
the MOMP (refs. 25, 26, 27, 28). Epitopes to which MOMP-specific
neutralizing monoclonal antibodies bind have been mapped for
several serovars (refs. 21, 22, 29, 30, 31, 32, 33), and represent
important targets for the development of synthetic or subunit
vaccines. The binding sites are contiguous sequences of six to
eight amino acids located within VDs I or II, and IV, depending on
the serovar. Subunit immunogens (e.g. isolated MOMP or synthetic
peptides) containing MOMP epitopes can induce antibodies capable of
recognizing intact chlamydiae (ref. 25). However, conventionally
administered subunit immunogens are generally poor inducers of
mucosal immunity. It would be useful to formulate chlamydial
antigens in such a way as to enhance their immunogenicity and to
elicit both humoral and cell-mediated immune responses.
[0006] Immune stimulating complexes (ISCOMs) are cage-like
structures formed from a mixture of saponins (or saponin
derivatives), cholesterol and unsaturated fatty acids. The
components of ISCOMs are held together by hydrophobic interactions,
and consequently proteins which are naturally hydrophobic (such as
MOMP) or which have been treated to expose or add hydrophobic
residues can be efficiently incorporated into the ISCOMs as they
form (refs. 34, 35, 36).
[0007] C. trachomatis naturally infects the mucosal surfaces of the
eye and genital tract. Local antibody and local cellular immune
responses are an important component of protection from mucosal
infections. Consequently, it would be useful for a chlamydial
vaccine to induce a mucosal immune response including both cellular
and antibody components.
[0008] DNA immunization is an approach for generating protective
immunity against infectious diseases (ref. 37). Unlike protein or
peptide based subunit vaccines, DNA immunization provides
protective immunity through expression of foreign proteins by host
cells, thus allowing the presentation of antigen to the immune
system in a manner more analogous to that which occurs during
infection with viruses or intracellular pathogens (ref. 38).
Although considerable interest has been generated by this
technique, successful immunity has been most consistently induced
by DNA immunization for viral diseases (ref. 39). Results have been
more variable with non-viral pathogens which may reflect
differences in the nature of the pathogens, in the immunizing
antigens chosen, and in the routes of immunization (ref. 40).
Further development of DNA vaccination will depend on elucidating
the underlying immunological mechanisms and broadening its
application to other infectious diseases for which existing
strategies of vaccine development have failed.
[0009] The use of attenuated bacteria, in particular S.
typhimurium, has recently been reported for delivery of plasmid DNA
for genetic immunization (refs. 41, 42). This type of delivery
offers the added benefit of delivering the DNA to cell types that
induce a specific immune response, such as a mucosal immune
response. This type of vaccination also offers the advantages of
being safe, as many safe, attenuated strains of Salmonella are
readily available, and cost effective.
[0010] EP 0192033 B1 and U.S. Pat. No. 5,770,714 describe the
provision of a DNA construct for the expression, in vitro, of
Chlamydia trachomatis MOMP polypeptides comprising the following
operably linked elements:
[0011] a transcriptional promoter,
[0012] a DNA molecule encoding a C. trachomatis MOMP polypeptide
comprising a MOMP polynucleotide at least 27 base pairs in length
from a sequence provided in Appendix A thereto, and
[0013] a transcriptional terminator, wherein at least one of the
transcriptional regulatory elements is not derived from Chlamydia
trachomatis.
There is no disclosure or suggestion in this prior art to effect
DNA immunization with any such constructs.
[0014] Copending U.S. patent application Ser. No. 08/893,381 filed
July 11, 1996 (WO 98/02546), assigned to University of Manitoba and
the disclosure of which is incorporated herein by reference,
describes an immunogenic composition for in vivo administration to
a host for the generation in the host of a protective immune
response to a major outer membrane protein (MOMP) of a strain of
Chlamydia, comprising a non-replicating vector comprising a
nucleotide sequence encoding a MOMP or MOMP fragment that generates
a MOMP specific immune response, and a promoter sequence
operatively coupled to the nucleotide sequence for expression of
the MOMP or MOMP fragment in the host; and a
pharmaceutically-acceptable carrier therefor.
[0015] Copending U.S. patent application Ser. No. 08/713,236 filed
Sep. 16, 1996 (WO 98/10789), assigned to Connaught Laboratories
Limited and the disclosure of which is incorporated herein by
reference, describes an immunogenic composition, comprising the
major outer membrane protein (MOMP) of a strain of Chlamydia, which
may be Chlamydia trachomatis, and an immunostimulating complex
(ISCOM).
SUMMARY OF INVENTION
[0016] The present invention provides a novel immunization strategy
to provide protection against disease caused by infection of
members of the Chlamydiae family, particularly Chlamydia
trachomatis and materials used therein. The immunization strategy
provided herein leads to a stronger protective immune response than
other strategies.
[0017] According to one aspect of the invention, there is provided
a method of immunizing a host against disease caused by infection
by Chlamydia which comprises:
[0018] initially administering to the host an immunoeffective
amount of an attenuated bacteria harbouring a nucleic acid sequence
encoding at least one immunoprotective-inducing Chlamydia protein
or fragment thereof which generates a Chlamydia protein-specific
immune response, operatively connected to a eukaryotic expression
element, such as the cytomegalovirus promoter, and
[0019] subsequently administering to the host an immunoeffective
amount of at least one purified Chlamydia protein or fragment
thereof which generates a Chlamydia protein specific immune
response, of the same at least one Chlamydia protein or immunogenic
fragment thereof as used in the initial administration, to achieve
a Chlamydia specific protective immune response in the host.
[0020] The attenuated bacteria may be an attenuated strain of
Salmonella or Shigella and the nucleic acid sequence may be the
MOMP gene or fragments thereof from a strain of Chlamydia,
including Chlamydia trachomatis and Chlamydia pneumoniae. The
boosting protein can be the MOMP protein or immunogenic fragments
thereof from a strain of Chlamydia, including Chlamydia trachomatis
and Chlamydia pneumoniae.
[0021] The administration steps may be effected to mucosal
surfaces, such as by intranasal administration or by an initial
intranasal administration of DNA followed by intramuscular
administration of Chlamydia protein.
[0022] The immune response which is achieved in the host by the
method of the invention preferably includes the production of
Chlamydia-specific protection against live Chlamydia challenge and
enhanced immunogenicity with greater delayed-type hypersensitivity
(DTH) responses and high IgG.sub.2 and IgG.sub.1 antibody responses
than achieved in other immunization procedures.
[0023] In another aspect, the present invention includes an
attenuated strain of a bacterium harbouring a nucleic acid molecule
encoding at least one immunoprotection-inducing Chlamydia protein
or a fragment thereof which generates a Chlamydia protein specific
immune response. The bacterium preferably is a strain of
Salmonella, such as a strain of Salmonella typhimurium. The
invention extends to such attenuated strain of a bacterium when
used as an immunogen and to the use of such attenuated strain in
the manufacture of an immunogen for administration to a host.
[0024] The present invention, in a further aspect, provides a
method of immunizing a host against infection caused by a strain of
Chlamydia, which comprises:
[0025] administering to the host an immunoeffective amount of an
attenuated bacteria harbouring a nucleic acid molecule encoding at
least one immunoprotection-inducing Chlamydia protein or a fragment
thereof which generates a Chlamydia protein specific immune
response. Any of the embodiments described herein with respect to
the priming administration in the prime-boost immunization protocol
described herein applies to this aspect of the invention.
BRIEF DESCRIPTION OF DRAWINGS
[0026] FIG. 1, containing panels A, B, C, D, E and F, shows the
protection results of administering the MOMP-DNA either
intramuscularly (panels A, B and C) or intranasally (panels D, E
and F).
[0027] FIG. 2, containing panels A, B and C, shows the protection
results from mice immunized with Salmonella transfected with
MOMP-DNA (pcDNA3).
[0028] FIG. 3, containing panels A, B and C, shows the protection
results from mice intranasally immunized with Salmonella
transfected with pcDNA3, then boosted intramuscularly with MOMP
embedded in ISCOM.
[0029] FIG. 4, containing panels A, B and C, shows the DTH response
(panel A) and the IgG.sub.2a (panel B) and IgG.sub.1 (panel C)
antibody responses from mice primed intranasally with the
Salmonella delivered DNA (pcDNA3) then boosted intramuscularly with
the MOMP-ISCOM protein. The data represent means .+-.SEM of
log.sub.10 titres of the antibody. * represents p<0.05, when
compared with naive group and group immunized with 10.sup.8 CFU
pMOMP-Salmonella only.
[0030] FIG. 5 shows the elements and construction of plasmid
pcDNA3/MOMP, approximately 64 kb in size.
GENERAL DESCRIPTION OF THE INVENTION
[0031] The present invention relates to methods of immunization
comprising an initial administration of a nucleic acid sequence
encoding at least one Chlamydia protein or immunogenic fragment
thereof, operatively connected to a eukaryotic expression element,
delivered by an attenuated Salmonella and a subsequent
administration of at least one protein or fragment thereof of the
same protein of the Chlamydia. The at least one protein may
comprise a Chlamydia protein, such as MOMP and may be formulated
into an ISCOM for administration to the host. The at least one
protein may be produced recombinantly or isolated from a chlamydial
preparation.
[0032] To illustrate the present invention, plasmid DNA was
constructed containing the MOMP gene and MOMP gene fragments from
the C. trachomatis mouse pneumonitis strain (MoPn), which is a
natural murine pathogen, permitting experimentation to be effected
in mice. Primary infection in the model induces strong protective
immunity to reinfection. For human immunization, a human pathogen
strain is used, such as serovar C of C. trachomatis.
[0033] Any convenient plasmid vector may be used for the MOMP gene
or fragment, such as pcDNA3, a eukaryotic expression vector
(Invitrogen, San Diego, Calif., USA), containing a suitable
promoter, such as a cytomegalovirus promoter. The MOMP gene or MOMP
gene fragment may be inserted in the vector in any convenient
manner. The gene or gene fragments may be amplified from Chlamydia
trachomatis genomic DNA by PCR using suitable primers and the PCR
product cloned into the vector. The MOMP gene-carrying plasmid may
be transferred, such as by electroporation, into E. coli for
replication therein. A MOMP-carrying plasmid, pcDNA3/MOMP, of
approximately 64 kb in size, is shown in FIG. 5. Plasmids may be
extracted from the E. coli in any convenient manner.
[0034] The plasmid containing the MOMP gene or MOMP gene fragment
may be used to transform an attenuated Salmonella bacteria
according to standard protocols, such as electroporation (ref
43).
[0035] As described above, the primary (priming) immunization may
be effected by administration of an attenuated bacterial vector,
such as Salmonella, wherein the transfected DNA is not expressed in
the bacterial vector. The expression of the primary DNA is effected
when the bacterial vector has released the DNA into the appropriate
host cells, such as macrophages or dendritic cells. After uptake of
the bacterial vector by the host cells, the auxotrophic bacteria
dies after a few rounds of division due to their inability to
synthesize the essential nutrients, such as amino acids or
nucleotides. The plasmid DNA then is released into the cytoplasm of
the infected host cells and the encoded gene expressed in the host
cell.
[0036] The boosting immunization may be a Chlamydia protein
incorporated into a immunostimulatory complex (ISCOM) or a
recombinantly produced Chlamydia protein. The Chlamydia protein can
also be an isolated native Chlamydia protein, which is extracted
from a Chlamydia extract.
[0037] It is clearly apparent to one skilled in the art, that the
various embodiments of the present invention may have applications
in the fields of vaccination and the treatment of Chlamydia
infections. A further non-limiting discussion of such uses is
further presented below.
EXAMPLES
[0038] The above disclosure generally describes the present
invention. A more complete understanding can be obtained by
reference to the following specific Examples. These Examples are
described solely for purposes of illustration and are not intended
to limit the scope of the invention. Changes in form and
substitution of equivalents are contemplated as circumstances may
suggest or render expedient. Although specific terms have been
employed herein, such terms are intended as descriptive and not for
purposes of limitation.
Example 1
[0039] This Example illustrates the preparation of a plasmid vector
containing the MOMP gene.
[0040] A pMOMP expression vector was made as described in the
aforementioned U.S. patent application Ser. No. 08/893,381 (WO
98/02546). Briefly, the MOMP gene was amplified from Chlamydia
trachomatis mouse pneumonitis (MoPn) strain genomic DNA by
polymerase chain reaction (PCR) with a 5' primer
(GGGGATCCGCCACCATGCTGCCTGTGGGGAATCCT) (SEQ ID NO:1) which includes
a BamHI site, a ribosomal binding site, an initiation codon and the
N-terminal sequence of the mature MOMP of MoPn and a 3' primer
(GGGGCTCGAGCTATTAACGGAACTGAGC) (SEQ ID NO:2) which includes the
C-terminal sequence of the MoPn MOMP, XhoI site and a stop codon.
The DNA sequence of the MOMP leader peptide gene sequence was
excluded. After digestion with BamHI and XhoI, the PCR product was
cloned into the pcDNA3 eukaryotic II-selectable expression vector
(Invitrogen, San Diego) with transcription under control of the
human cytomegalovirus major intermediate early enhancer region (CMV
promoter). The MOMP gene-encoding plasmid was transferred by
electroporation into E. coli DH5.alpha.F which was grown in LB
broth containing 100 .mu.g/ml of ampicillin. The plasmids was
extracted by Wizard.TM. Plus Maxiprep DNA purification system
(Promega, Madison). The sequence of the recombinant MOMP gene was
verified by PCR direct sequence analysis, as described (ref. 44).
Purified plasmid DNA was dissolved in saline at a concentration of
1 mg/ml. The DNA concentration was determined by DU-62
spectrophotometer (Beckman, Fullerton, Calif.) at 260 nm and the
size of the plasmid was compared with DNA standards in ethidium
bromide-stained agarose gel.
[0041] The MOMP gene containing plasmid, pcDNA3/MOMP, and its
constitutive elements are shown in FIG. 5.
Example 2
[0042] This Example illustrates DNA immunization of mice.
[0043] A model of murine pneumonia induced by the C. trachomatis
mouse pneumonitis strain (MoPn) was used (ref. 45). Unlike most
strains of C. trachomatis, which are restricted to producing
infection and disease in humans, MoPn is a natural murine pathogen.
It has previously been demonstrated that primary infection in this
model induces strong protective immunity to reinfection. In
addition, clearance of infection is related to CD4 Th1 lymphocyte
responses and is dependent on MHC class II antigen presentation
(ref 45).
[0044] Three different concentrations of MOMP-DNA were compared,
administered either intramuscularly or intranasally (FIG. 1). The
results clearly show that mucosal delivery of naked MOMP-DNA is
protective and appeared more so than intramuscularly delivered
MOMP-DNA. Intranasal delivery of MOMP-DNA was evaluated in multiple
experiments to determine its reproducibility. As shown in Table 1,
mucosal delivery of MOMP-DNA evoked protective immune responses but
the magnitude of the protective index was highly variable, ranging
from 0.5 to 4.1 log.sub.10 protection in different experiments. The
basis for such variability may be due to the limited immunogenicity
of naked DNA vaccination since challenging vaccinated animals with
a higher inoculum of MoPn markedly reduced the protective index.
Naked DNA applied to a mucosal surface may also have a very
variable fate with some being degraded by extracellular nucleases
and some being taken up the somatic cells.
Example 3
[0045] This Example illustrates the delivery of DNA with attenuated
Salmonella.
[0046] Salmonella typhimurium strain 22-4 is described in ref. 46.
Such strain was transfected with pcDNA3/MOMP and pcDNA3 by
electroporation. Attenuated strains of Salmonella, transfected with
plasmid DNA, were cultured for 16 to 25 hours at 37.degree. C.,
without shaking in Luria Broth (LB) medium containing 100 .mu.g/ml
ampicillin. Bacteria were collected by centrifugation and
resuspended in PBS. Different concentrations of Salmonella were
diluted with PBS and the same volume of 10% sodium bicarbonate was
added immediately before immunization. Groups of 5 to 10 female
Balb/c mice, 6 to 8 weeks of age, were deprived of water for 5 to 6
hours before immunization. Approximately 10.sup.5 to 10.sup.10 CFU
of bacteria in 100 .mu.l were fed by feeding needles (Ejay
International Inc.). Four inoculations at 2 week intervals were
administered.
[0047] As shown in FIG. 2, mice immunized with Salmonella
transfected with MOMP-DNA had partial protection against lung
challenge with MoPn. Immunization at one mucosal surface (the gut)
provides protection against challenge infection at a distant
mucosal surface (the lung).
Example 4
[0048] This Example illustrates a DNA prime and protein boost
immunization schedule in mice.
[0049] MOMP-DNA transfected Salmonella, prepared as described in
Example 3, administered at 10.sup.8 cfu was compared to MOMP-DNA
transfected Salmonella administered at 10.sup.6 cfu among groups of
Balb/c mice orally immunized at two-week intervals on four
occasions. Mice immunized with 10.sup.6 cfu had a single protein
boost intramuscularly with 1 .mu.g MoPn MOMP embedded in ISCOM (14)
at the time of the fourth immunization. The ISCOM preparation was
prepared as described in aforementioned U.S. patent application
Ser. No. 08/718,236 (WO98/10789). The mice were challenged with
5000 IFU MoPn EB intranasally two weeks after the last
immunization. Challenged mice were sacrificed at day 10
postinfection. The body weight was measured daily after infection
until mice were sacrificed (FIG. 3, panel A). These mice were much
better protected than mice given 10.sup.8 cfu Salmonella without a
protein boost, as described in Example 3. Chlamydia EB growth in
the lungs at day 10 postinfection was analyzed by quantitative
tissue culture (FIG. 3, panel B and C). In FIG. 3, panel B, the
data represents the mean .+-.SEM of log.sub.10 IFU per lung of 5 to
6 mice and panel C represents the results observed in individual
mice. DNA primed, protein boosted mice also demonstrated enhanced
immunogenicity with greater DTH responses (FIG. 4, panel A) and
higher serum IgG.sub.2 and IgG.sub.1 antibody responses (FIG. 4,
panels B and C). Sera were collected from immunized mice 2 weeks
after the last immunization. MoPn-specific IgG.sub.2a (panel B) and
IgG.sub.1 (panel C) antibodies were tested by ELISA.
Example 5
[0050] This Example describes the measurement of MoPn-specific
delayed-type hypersensitivity (DTH).
[0051] To evaluate DTH, 25 .mu.l of ultraviolet (UV)-killed MoPn
EBs (2.times.10.sup.5 IFU) in SPG buffer 25 was injected into the
right hind footpad of mice and the same volume of SPG buffer was
injected into the left hind footpad as a control. Footpad swelling
was measured at 48 hours and 72 hours post injection using a
dila-gauge caliper. The difference between the thickness of the two
footpads was used as a measure of the DTH response.
SUMMARY OF DISCLOSURE
[0052] In summary of this disclosure, the present invention
provides methods of immunizing a host against Chlamydia infection
using DNA carried by an attenuated bacteria and materials used in
such procedures. Modifications are possible within the scope of the
invention. TABLE-US-00001 TABLE 1 Intranasal (IN) immunization with
MOMP-DNA evokes protective immunity to Chlamydia trachomatis MoPn
lung infection. EXPER- IMENT LOG10 IFU/LUNG PROTECTIVE CHALLENGE
Number PcDNA3-IN pMOMP-IN Index Inoculum (IFU) 2 4.93 .+-. 0.68
3.65 .+-. 0.94 1.28 1000 (N = 7) (N = 6) 3 6.1 .+-. 0.32 3.0 .+-.
1.15 4.1 5000 (N = 4) (N = 4) 4 4.4 .+-. 0.32 3.9 .+-. 0.13 0.5
5000 .times. 2 (N = 7) (N = 7) 7 5.39 .+-. 0.3 3.8 .+-. 0.63 1.59
5000 (N = 8) (N = 8)
REFERENCES
[0053] 1. Grayston, J. T. and S.-P. Wang. 1975. New knowledge of
chlamydiae and the diseases they cause. J. Infect. Dis., 132:
87-104. [0054] 2. Grayston, J. T., S.-P. Wang, L.-J. Yeh, and C.-C.
Kuo. 1985. Importance of reinfection in the pathogenesis of
trachoma. Rev. Infect. Dis. 7:717- [0055] 3. Taylor, H. R., et al.,
1982. Animal Model of Trachema. II. The importance of repeated
infection. Invest. Opthalmol. Visual. Sci. 23:507-515. [0056] 4.
Taylor, H. R., et al. 1981. An Animal Model for Cicatrizing
Trachoma. Invest. Opthalmol. Sci. 21:422-433. [0057] 5. Caldwell,
H. D., et al. 1987. Tear and serum antibody response to chlamydia
trachomatis antigens during acute chlamydial conjunctivitis in
monkeys as determined by immunoblotting. Infect. Immun. 55:93-98.
[0058] 6. Wang, S.-P., et al., 1985. Immunotyping of Chlamydia
trachomatis with monoclonal antibodies. J. Infect. Dis.
152:791-800. [0059] 7. Nichols, R. L., et al., 1973. Immunity to
chlamydial infections of the eye. VI. Homologous neutralization of
trachoma infectivity for the owl monkey conjunctivae by eye
secretions from humans with trachoma. J. Infect. Dis. 127:429-432.
[0060] 8. Orenstein, N. S., et al., 1973. Immunity to chlamydial
infections of the eye V. Passive transfer of antitrachoma
antibodies to owl monkeys. Infect. Immun. 7:600-603. [0061] 9.
Ramsey, K H, et al., (March 1991) Resolution of Chlamydia Genital
Infection with Antigen-Specific T-Lymphocyte Lines. Infect. and
Immun. 59:925-931. [0062] 10. Magee, D M, et al., (1995). Role of
CD8 T Cells in Primary Chlamydia Infection. Infect. Immun. February
1995. 63:516-521. [0063] 11 Su, H. and Caldwell, H D., (1995) CD4+
T Cells Play a Significant Role in Adoptive Immunity to Chlamydia
trachomatis Infection of the Mouse Genital Tract. Infect. Immun.
September 1995, 63: 3302-3308. [0064] 12. Beatty, P R., and
Stephens R S., (1994) CD8+ T Lymphocyte-Mediated Lysis of
Chlamydia-Infected L Cells Using an Endogenous Antigen Pathway.,
Journal of Immun. 1994, 153:4588. [0065] 13. Stambach, M N., Bevan,
M J. and Lampe, M F. (1994), Protective Cytotoxic T. Lymphocytes
are Induced During Murine Infection with Chlamydia trachomatis,
Journal of Immun. 1994, 153:5183. [0066] 14. Stambach, M N, Bevan,
M J. And Lampe, W F., (1995), Murine Cytotoxic T. Lymphocytes
Induced Following Chlamydia trachomatis Intraperitonal or Genital
Tract Infection Respond to Cells Infected with Multiple Serovars.,
Infect. & Immun. September 1995, 63:3527-3530. [0067] 15.
Igietseme, J U, (1996), Molecular mechanism of T-cell control of
Chlamydia in mice: role of nitric oxide in vivo. Immunology 1996,
88:1-5. [0068] 16. Igietseme. J U, (1996), The Molecular mechanism
of T-cell control of Chlamydia in mice; role of nitric oxide.
Immunology 1996, 87:1-8. [0069] 17. Ward, M. E. 1992. Chlamydial
vaccines--future trends. J. Infection 25 Supp. 1:11-26. [0070] 18.
Caldwell, H. D., et al., (1981). Purification and partial
characterization of the major outer membrane protein of Chlamydia
trachomatis. Infect. Immun. 31:1161-1176. [0071] 19. Bavoil, P.,
Ohlin, A. and Schachter, J., (1984) Role of Disulfide Bonding in
Outer Membrane Structure and Permeability in Chlamydia trachomatis.
Infect. Immun., 44: 479-485. [0072] 20. Campos, M., et al., (1995)
A Chlamydia Major Outer Membrane Protein Extract as a Trachoma
Vaccine Candidate., Invest. Opthalmol. Vis. Sci. 36:1477-1491.
[0073] 21. Zhang Y.-X., et al., (1989). Protective monoclonal
antibodies to Chlamydia trachomatis serovar- and serogroup-specific
major outer membrane protein determinants. Infect. Immun.
57:636-638. [0074] 22. Zhang, Y.-X., et al., 1987. Protective
monoclonal antibodies recognise epitopes located on the major outer
membrane protein of Chlamydia trachomatis. J. Immunol. 138:575-581.
[0075] 23. Department of Health and Human Services, (1989)
Nucleotide and amino acid sequences of the four variable domains of
the major outer membrane proteins of Chlamydia trachomatis. Report
Nos: PAT-APPL-7-324664. National Technical Information Services,
Springfield, Va. [0076] 24. Yuan, Y., et al. (1989) Nucleotide and
deduced amino acid sequences for the four variable domains of the
major outer membrane proteins of the 15 Chlamydia trachomatis
serovars. Infect. Immun. 57:104-1049. [0077] 25. Su, H. and
Caldwell, H. D. 1992. Immunogenicity of a chimeric peptide
corresponding to T-helper and B-cell epitopes of the Chlamydia
trachomatis major outer membrane protein. J. Exp. Med. 175:227-235.
[0078] 26. Su. H., N. G. Watkins. Y.-X. Zhang and H. D. Caldwell
(1990). Chlamydia trachomatis-host cell interactions: role of the
chlamydial major outer membrane protein as an adhesin. Infect.
Immun. 58:1017-1025. [0079] 27. Peeling, R., I. W. McClean and R.
C. Brunham. (1984). In vitro neutralization of Chlamydia
trachomatis with monoclonal antibody to an epitope on the major
outer membrane protein. Infect. Immun. 46:484-488. [0080] 28.
Lucero, M. E. and C.-C. Kuo. (1985). Neutralization of. Chlamydia
trachomatis cell culture infection by serovar specific monoclonal
antibodies. Infect. Immun. 50:595-597. [0081] 29. Baehr. W., et al.
(1988) Mapping antigenic domains expressed by Chlamydia trachomatis
major outer membrane protein genes. Proc. Natl. Acad. Sci. USA,
85:4000-4004. [0082] 30. Stephens, R. S., et al. (1988)
High-resolution mapping of serovar-specific and common antigenic
determinants of the major outer membrane protein of Chlamydia
trachomatis. J. Exp. Med. 167:817-831. [0083] 31. Conlan, J. W., I.
N. Clarke and M. E. Ward. (1988). Epitope mapping with solid-phase
peptides: Identification of type-, subspecies-, species-, and
genus-reactive antibody binding domains on the major outer membrane
protein of Chlamydia trachomatis. Mol. Microbiol. 2:673-679. [0084]
32. Conlan, J. W., et al., (1990). Isolation of recombinant
fragments of the major outer membrane protein of Chlamydia
trachomatis: their potential as subunit vaccines. J. Gen.
Microbial. 136: 2013-2020. [0085] 33. Morrison, R. P., D. S.
Manning, and H. D. Caldwell. (1992). Immunology of Chlamydia
trachomatis infections. p. 57-84 In T. C. Quinn (ed) Sexually
transmitted diseases. Raven Press Ltd., NY. [0086] 34. Kersten, G.
F. A. and Crommelin, D. J. A. (1995). Liposomes and ISCOMs as
vaccine formulations. Biochimica et Biophysica Acta 1241 (1995)
117-138. [0087] 35. Morein, B., et al., (1990) The iscom--a modern
approach to vaccines seminars in Virology, Vol. 1, 1990: pp. 49-55.
[0088] 36. Mowat & Reid, 1992. Preparation of Immune
Stimulating Complexes (ISCOMs) as Adjuvants. Current Protocols in
Immunology 1992. Supplement 4: 2.11.1. to 2.11.12. [0089] 37. M. A.
Liu et al. 1995. Ann. N.Y. Acad. Sci. 772. [0090] 38. W. M.
McDonnell and F. K. Askari 1996. N. Engl. J. Med. 334:42. [0091]
39. J. B. Ulmer et al. 1993. Science 259:1745. [0092] 40. M.
Sedegah et al. 1994. Proc. Natl. Acad. Sci. U.S.A. 91:9866. [0093]
41. A. Darji et al. 1997. Cell 91:765-775. [0094] 42. D. R.
Sizemore, 1997. Vaccine 15:804-807. [0095] 43. D. O'Callaghan and
A. Charbit. 1990. Mol. Gen. Genet. 223:156-158. [0096] 44. R.
Brunham et al. 1994. J. Clin. Invest. 94:458-463. [0097] 45. R. P.
Morrison et al. 1995. Infect. Immun. 63:4661. [0098] 46. K. Y.
Leung et al., 1991, PNAS 88(24):1147-4.
* * * * *