Polypeptides Having Glucoamylase Activity And Polynucleotides Encoding Same

Abstract

The present invention relates to polypeptides having glucoamylase activity and isolated polynucleotides encoding said polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides. The invention also relates to the composition comprising a glucoamylase of the invention as well as the use such compositions for starch conversion processes, brewing, including processes for producing fermentation products or syrups.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation of U.S. application Ser. No. 11/315,730 filed Dec. 22, 2005, which claims the benefit under 35 U.S.C. 119 of U.S. provisional application Nos. 60/638,614 and 60/650,612 filed Dec. 22, 2004 and Feb. 7, 2005, respectively, the contents of which are incorporated herein by reference.

CROSS-REFERENCE TO A SEQUENCE LISTING

[0002] This application contains a Sequence Listing in computer readable form. The computer readable form is incorporated herein by reference.

BACKGROUND OF THE INVENTION

[0003] 1. Field of the Invention

[0004] The present invention relates to polypeptides having glucoamylase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides, and to the use of glucoamylases of the invention for starch conversion to producing fermentation products, such as ethanol, and syrups, such as glucose. The invention also relates to a composition comprising a glucoamylase of the invention.

[0005] 2. Description of the Related Art

[0006] Glucoamylase (1,4-alpha-D-glucan glucohydrolase, EC 3.2.1.3) is an enzyme, which catalyzes the release of D-glucose from the non-reducing ends of starch or related oligo and polysaccharide molecules. Glucoamylases are produced by several filamentous fungi and yeast, with those from Aspergillus being commercially most important.

[0007] Commercially, glucoamylases are used to convert starchy material, which is already partially hydrolyzed by an alpha-amylase, to glucose. The glucose may then be converted directly or indirectly into a fermentation product using a fermenting organism. Examples of commercial fermentation products include alcohols (e.g., ethanol, methanol, butanol, 1,3-propanediol); organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid, gluconate, lactic acid, succinic acid, 2,5-diketo-D-gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); gases (e.g., H.sub.2 and CO.sub.2), and more complex compounds, including, for example, antibiotics (e.g., penicillin and tetracycline); enzymes; vitamins (e.g., riboflavin, B.sub.12, beta-carotene); hormones, and other compounds which are difficult to produce synthetically. Fermentation processes are also commonly used in the consumable alcohol (e.g., beer and wine), dairy (e.g., in the production of yoghurt and cheese), leather, and tobacco industries.

[0008] The end product may also be syrup. For instance, the end product may be glucose, but may also be converted, e.g., by glucose isomerase to fructose or a mixture composed almost equally of glucose and fructose. This mixture, or a mixture further enriched with fructose, is the most commonly used high fructose corn syrup (HFCS) commercialized throughout the world.

[0009] Boel et al., 1984, EMBO J. 3(5): 1097-1102 disclose Aspergillus niger G1 or G2 glucoamylase.

[0010] U.S. Pat. No. 4,727,046 discloses a glucoamylase derived from Corticium rolfsii which is also referred to as Athelia rolfsii.

[0011] WO 84/02921 discloses a glucoamylase derived from Aspergillus awamori.

[0012] WO 99/28248 discloses a glucoamylase derived from Talaromyces emersonii.

[0013] WO 00/75296 discloses a glucoamylase derived from Thermoascus crustaceus.

[0014] It is an object of the present invention to provide polypeptides having glucoamylase activity and polynucleotides encoding the polypeptides and which provide a high yield in fermentation product production processes, such as ethanol production processes, including one-step ethanol fermentation processes from un-gelatinized raw (or uncooked) starch.

SUMMARY OF THE INVENTION

[0015] The present invention relates to polypeptides having glucoamylase activity selected from the group consisting of:

[0016] (a) a polypeptide having an amino acid sequence which has at least 75% identity with amino acids for mature polypeptide amino acids 1 to 556 of SEQ ID NO: 2; or

[0017] (a1) a polypeptide having an amino acid sequence which has at least 75% identity with amino acids for mature polypeptide amino acids 1 to 561 of SEQ ID NO: 37;

[0018] (b) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 1, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 3, or (iii) a complementary strand of (i) or (ii); or

[0019] (b1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 36, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1737 of SEQ ID NO: 38, or (iii) a complementary strand of (i) or (ii); and

[0020] (c) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 556 of SEQ ID NO: 2, or

[0021] (c1) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 561 of SEQ ID NO: 37, The present invention also relates to polynucleotides encoding polypeptides having glucoamylase activity, selected from the group consisting of:

[0022] (a) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 75% identity with the mature polypeptide amino acids 1 to 556 of SEQ ID NO: 2;

[0023] (a1) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 75% identity with the mature polypeptide amino acids 1 to 561 of SEQ ID NO: 37;

[0024] (b) a polynucleotide having at least 60% identity with nucleotides 55 to 2166 of SEQ ID NO: 1; or

[0025] (b1) a polynucleotide having at least 60% identity with nucleotides 55 to 2166 of SEQ ID NO: 36;

[0026] (c) a polynucleotide having at least 60% identity with nucleotides 55 to 1725 of SEQ ID NO: 3; or

[0027] (c1) a polynucleotide having at least 60% identity with nucleotides 55 to 1737 of SEQ ID NO: 38;

[0028] (d) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 1, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 3, or (iii) a complementary strand of (i) or (ii), or

[0029] (d1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 36, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1737 of SEQ ID NO: 38, or (iii) a complementary strand of (i) or (ii).

[0030] In a preferred embodiment the polypeptide is derivable from a strain of the genus Trametes, preferably Trametes cingulata or the E. coli strain deposited at DSMZ and given the no. DSM 17106. Deposited strain DSM 17106 harbors plasmid HUda595 comprising a sequence identical to SEQ ID NO: 1. A specific polypeptide of the invention is the mature polypeptide obtained when expressing plasmid pHUda440 in a suitable fungal host cell such as Aspergillus oryzae as described in Example 7.

[0031] In a second aspect the present invention relates to polypeptides having glucoamylase activity selected from the group consisting of:

[0032] (a) a polypeptide having an amino acid sequence which has at least 70% identity with amino acids for mature polypeptide amino acids 1 to 575 of SEQ ID NO: 5; or

[0033] (a1) a polypeptide having an amino acid sequence which has at least 70% identity with amino acids for mature polypeptide amino acids 1 to 565 of SEQ ID NO: 40;

[0034] (b) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2189 of SEQ ID NO: 4, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 6, or (iii) a complementary strand of (i) or (ii); or

[0035] (b1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2182 of SEQ ID NO: 39, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1749 of SEQ ID NO: 41, or (iii) a complementary strand of (i) or (ii); and

[0036] (c) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 575 of SEQ ID NO: 5, or

[0037] (c1) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 565 of SEQ ID NO: 40.

[0038] The present invention also relates to polynucleotides encoding polypeptides having glucoamylase activity, selected from the group consisting of:

[0039] (a) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 75% identity with the mature polypeptide amino acids 1 to 575 of SEQ ID NO: 5; or

[0040] (a1) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 75% identity with the mature polypeptide amino acids 1 to 565 of SEQ ID NO: 40;

[0041] (b) a polynucleotide having at least 60% identity with nucleotides 55 to 2189 of SEQ ID NO: 4; or

[0042] (b1) a polynucleotide having at least 60% identity with nucleotides 55 to 2182 of SEQ ID NO: 39;

[0043] (c) a polynucleotide having at least 60% identity with nucleotides 55 to 1725 of SEQ ID NO: 6; or

[0044] (c1) a polynucleotide having at least 60% identity with nucleotides 55 to 1749 of SEQ ID NO: 41;

[0045] (d) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2189 of SEQ ID NO: 4, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 6, or (iii) a complementary strand of (i) or (ii); or

[0046] (d1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2182 of SEQ ID NO: 39, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1749 of SEQ ID NO: 41, or (iii) a complementary strand of (i) or (ii).

[0047] In a preferred embodiment the polypeptide is derivable from a strain of the genus Pachykytospora, preferably Pachykytospora papyracea or the E. coli strain deposited at DSMZ and given the no. DSM 17105. Deposited strain DSM 17105 harbors plasmid HUda594 comprising a sequence identical to SEQ ID NO: 4. A specific polypeptide of the invention is the mature polypeptide obtained when expressing plasmid pHUda450 in a suitable fungal host cell such as Aspergillus oryzae as described in Example 7.

[0048] In a third aspect the invention relates to polypeptides having glucoamylase activity selected from the group consisting of:

[0049] (a) a polypeptide having an amino acid sequence which has at least 60% identity with amino acids for mature polypeptide amino acids 1 to 556 of SEQ ID NO: 26; or

[0050] (a1) a polypeptide having an amino acid sequence which has at least 60% identity with amino acids for mature polypeptide amino acids 1 to 548 of SEQ ID NO: 24; or

[0051] (a2) a polypeptide having an amino acid sequence which has at least 60% identity with amino acids for mature polypeptide amino acids 1 to 523 of SEQ ID NO: 43;

[0052] (b) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 117 to 2249 of SEQ ID NO: 23, or (ii) which hybridizes under at least low stringency conditions with the cDNA sequence contained in nucleotides 52 to 1719 of SEQ ID NO: 25, or (iii) a complementary strand of (i) or (ii);

[0053] (b1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with the cDNA sequence contained in nucleotides 52 to 1620 of SEQ ID NO: 42 or (iii) a complementary strand of (i) or (ii); and

[0054] (c) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 556 of SEQ ID NO: 26, or

[0055] (c1) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 548 of SEQ ID NO: 24;

[0056] (c2) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 523 of SEQ ID NO: 43.

[0057] The present invention also relates to polynucleotides encoding polypeptides having glucoamylase activity, selected from the group consisting of:

[0058] (a) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 60% identity with the mature polypeptide amino acids 1 to 556 of SEQ ID NO: 26; or

[0059] (a1) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 60% identity with the mature polypeptide amino acids 1 to 548 of SEQ ID NO: 24; or

[0060] (a2) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 60% identity with the mature polypeptide amino acids 1 to 523 of SEQ ID NO: 43;

[0061] (b) a polynucleotide having at least 60% identity with nucleotides 117 to 2249 of SEQ ID NO: 23; or

[0062] (c) a polynucleotide having at least 60% identity with nucleotides 52 to 1719 of SEQ ID NO: 25; or

[0063] (c1) a polynucleotide having at least 60% identity with nucleotides 52 to 1620 of SEQ ID NO: 42;

[0064] (d) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 117 to 2249 of SEQ ID NO: 23, or (ii) which hybridizes under at least low stringency conditions with the cDNA sequence contained in nucleotides 52 to 1620 of SEQ ID NO: 42, or (iii) a complementary strand of (i) or (ii), or

[0065] (d1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with the cDNA sequence contained in nucleotides 52 to 1719 of SEQ ID NO: 25, or (iii) a complementary strand of (i) or (ii).

[0066] In a preferred embodiment the polypeptide is derivable from a strain of the genus Leucopaxillus, preferably Leucopaxillus giganteus or the sequence shown in SEQ ID NO: 26. A specific polypeptide of the invention is the mature polypeptide obtained when expressing plasmid pENI3372 in a suitable fungal host cell such as Aspergillus niger as described in Example 12.

[0067] The present invention also relates to nucleic acid constructs, recombinant expression vectors, and recombinant host cells comprising the polynucleotides in SEQ ID NO: 1 or 3 (cDNA) or 36 or 38 (cDNA); or SEQ ID NO: 4 or 6 (cDNA) or 39 or 41 (cDNA), or SEQ ID NO: 23 or 25 (cDNA) or 42 (cDNA), respectively.

[0068] Clones that, to the best of the inventors belief, are identical to SEQ ID NO: 1 and 4 was deposited on 2 Feb. 2005 under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure at Deutshe Sammmlung von Microorganismen und Zellkulturen GmbH (DSMZ), Mascheroder Weg 1b, D-38124 Braunschweig DE. The clones were giving the deposit nos. DSM 17106 and DSM 17105, respectively.

[0069] The present invention also relates to methods for producing such polypeptides having glucoamylase activity comprising (a) cultivating a recombinant host cell comprising a nucleic acid construct comprising a polynucleotide encoding the polypeptide under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.

[0070] The present invention also relates to processes of producing a fermentation product or syrup.

DEFINITIONS

[0071] Glucoamylase activity: The term glucoamylase (1,4-alpha-D-glucan glucohydrolase, EC 3.2.1.3) is defined as an enzyme, which catalyzes the release of D-glucose from the non-reducing ends of starch or related oligo- and polysaccharide molecules. For purposes of the present invention, glucoamylase activity is determined according to the procedure described in the `Materials & Methods`-section below.

[0072] The polypeptides of the present invention have at least 20%, preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95%, and even most preferably at least 100% of the glucoamylase activity of the polypeptide consisting of the amino acid sequence shown as amino acids 1 to 556 of SEQ ID NO: 2 or amino acids 1 to 561 of SEQ ID NO: 37; or amino acids 1 to 575 of SEQ ID NO: 5 or amino acids 1 to 565 of SEQ ID NO: 40; or amino acids 1 to 548 of SEQ ID NO: 24 or amino acids 1 to 556 of SEQ ID NO: 26 or amino acids 1 to 523 of SEQ ID NO: 43, respectively.

[0073] Polypeptide: The term "polypeptide" as used herein refers to a isolated polypeptide which is at least 20% pure, preferably at least 40% pure, more preferably at least 60% pure, even more preferably at least 80% pure, most preferably at least 90% pure, and even most preferably at least 95% pure, as determined by SDS-PAGE.

[0074] Substantially pure polypeptide: The term "substantially pure polypeptide" denotes herein a polypeptide preparation which contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polypeptide material with which it is natively associated. It is, therefore, preferred that the substantially pure polypeptide is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, even more preferably at least 99%, most preferably at least 99.5% pure, and even most preferably 100% pure by weight of the total polypeptide material present in the preparation.

[0075] The polypeptides of the present invention are preferably in a substantially pure form. In particular, it is preferred that the polypeptides are in "essentially pure form", i.e., that the polypeptide preparation is essentially free of other polypeptide material with which it is natively associated. This can be accomplished, for example, by preparing the polypeptide by means of well-known recombinant methods or by classical purification methods.

[0076] Herein, the term "substantially pure polypeptide" is synonymous with the terms "isolated polypeptide" and "polypeptide in isolated form".

[0077] Identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "identity".

[0078] For purposes of the present invention, the degree of identity between two amino acid sequences is determined by the Clustal method (Higgins, 1989, CABIOS 5: 151-153) using the LASERGENE.TM. MEGALIGN.TM. software (DNASTAR, Inc., Madison, Wis.) with an identity table and the following multiple alignment parameters: Gap penalty of 10 and gap length penalty of 10. Pairwise alignment parameters are Ktuple=1, gap penalty=3, windows=5, and diagonals=5.

[0079] For purposes of the present invention, the degree of identity between two nucleotide sequences is determined by the Wilbur-Lipman method (Wilbur and Lipman, 1983, Proceedings of the National Academy of Science USA 80: 726-730) using the LASERGENE.TM. MEGALIGN.TM. software (DNASTAR, Inc., Madison, Wis.) with an identity table and the following multiple alignment parameters: Gap penalty of 10 and gap length penalty of 10. Pairwise alignment parameters are Ktuple=3, gap penalty=3, and windows=20.

[0080] Polypeptide Fragment: The term "polypeptide fragment" is defined herein as a polypeptide having one or more amino acids deleted from the amino and/or carboxyl terminus of SEQ ID NO: 2 or 37; or SEQ ID NO: 5 or 40; or SEQ ID NO: 24, 26, or 43, respectively, or homologous sequences thereof, wherein the fragment has glucoamylase activity.

[0081] Subsequence: The term "subsequence" is defined herein as a nucleotide sequence having one or more nucleotides deleted from the 5' and/or 3' end of SEQ ID NO: 1, 36, or 38, respectively; or SEQ ID NO: 4, 39, or 41, or SEQ ID NO: 23, 25, or 42, respectively, or homologous sequences thereof, wherein the subsequence encodes a polypeptide fragment having glucoamylase activity.

[0082] Allelic variant: The term "allelic variant" denotes herein any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.

[0083] Substantially pure polynucleotide: The term "substantially pure polynucleotide" as used herein refers to a polynucleotide preparation free of other extraneous or unwanted nucleotides and in a form suitable for use within genetically engineered protein production systems. Thus, a substantially pure polynucleotide contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polynucleotide material with which it is natively associated. A substantially pure polynucleotide may, however, include naturally occurring 5' and 3' untranslated regions, such as promoters and terminators. It is preferred that the substantially pure polynucleotide is at least 90% pure, preferably at least 92% pure, more preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, even more preferably at least 98% pure, most preferably at least 99%, and even most preferably at least 99.5% pure by weight. The polynucleofides of the present invention are preferably in a substantially pure form. In particular, it is preferred that the polynucleotides disclosed herein are in "essentially pure form", i.e., that the polynucleotide preparation is essentially free of other polynucleotide material with which it is natively associated. Herein, the term "substantially pure polynucleotide" is synonymous with the terms "isolated polynucleotide" and "polynucleotide in isolated form." The polynucleotides may be of genomic, cDNA, RNA, semi-synthetic, synthetic origin, or any combinations thereof.

[0084] cDNA: The term "cDNA" is defined herein as a DNA molecule which can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic cell. cDNA lacks intron sequences that are usually present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA which is processed through a series of steps before appearing as mature spliced mRNA. These steps include the removal of intron sequences by a process called splicing. cDNA derived from mRNA lacks, therefore, any intron sequences.

[0085] Nucleic acid construct: The term "nucleic acid construct" as used herein refers to a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or which is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature. The term nucleic acid construct is synonymous with the term "expression cassette" when the nucleic acid construct contains the control sequences required for expression of a coding sequence of the present invention.

[0086] Control sequence: The term "control sequences" is defined herein to include all components, which are necessary or advantageous for the expression of a polynucleotide encoding a polypeptide of the present invention. Each control sequence may be native or foreign to the nucleotide sequence encoding the polypeptide. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, pro-peptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleotide sequence encoding a polypeptide.

[0087] Operably linked: The term "operably linked" denotes herein a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of the polynucleotide sequence such that the control sequence directs the expression of the coding sequence of a polypeptide.

[0088] Coding sequence: When used herein the term "coding sequence" means a nucleotide sequence, which directly specifies the amino acid sequence of its protein product. The boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with the ATG start codon or alternative start codons such as GTG and TTG. The coding sequence may a DNA, cDNA, or recombinant nucleotide sequence.

[0089] Expression: The term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0090] Expression vector: The term "expression vector" is defined herein as a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide of the invention, and which is operably linked to additional nucleotides that provide for its expression.

[0091] Host cell: The term "host cell", as used herein, includes any cell type which is susceptible to transformation, transfection, transduction, and the like with a nucleic acid construct comprising a polynucleotide of the present invention.

[0092] Modification: The term "modification" means herein any chemical modification of the polypeptide consisting of the amino acids 1 to 556 of SEQ ID NO: 2 or amino acids 1 to 561 of SEQ ID NO: 37; or amino acids 1 to 675 of SEQ ID NO: 5 or amino acids 1 to 565 of SEQ ID NO: 40; or amino acids 1 to 556 of SEQ ID NO: 26 or SEQ ID NO: 1 to 548 of SEQ ID NO: 24 or SEQ ID NO: 1 to 523 of SEQ ID NO: 43, respectively, as well as genetic manipulation of the DNA encoding the polypeptides. The modification(s) can be substitution(s), deletion(s) and/or insertions(s) of the amino acid(s) as well as replacement(s) of amino acid side chain(s).

[0093] Artificial variant: When used herein, the term "artificial variant" means a polypeptide having glucoamylase activity produced by an organism expressing a modified nucleotide sequence of SEQ ID NO: 1 or 3 (cDNA) or SEQ ID NO: 36 or 38 (cDNA); or SEQ ID NO: 4 or 6 (cDNA), or SEQ ID NO: 39 or 41 (cDNA); or SEQ ID NO: 23 or 25 (cDNA) or 42 (cDNA). The modified nucleotide sequence is obtained through human intervention by modification of the nucleotide sequence disclosed in SEQ ID NO: 1 or 3, or SEQ ID NO: 36 or 38; or SEQ ID NO: 4 or 6, or SEQ ID NO: 39 or 41; or SEQ ID NO: 23 or 25 or 42, respectively.

BRIEF DESCRIPTION OF THE DRAWING

[0094] FIG. 1 shows the debranching activity toward pullulan of Trametes cingulata glucoamylase compared to glucoamylases from Athelia rolfsii, Aspergillus niger, and Talaromyces emersonii.

DETAILED DESCRIPTION OF THE INVENTION

Polypeptides Having Glucoamylase Activity

[0095] In a first aspect, the present invention relates to polypeptides having an amino acid sequence which has a degree of identity to amino acids 1 to 556 of SEQ ID NO: 2, or amino acids 1-561 of SEQ ID NO: 37; or amino acids 1-575 of SEQ ID NO: 5 or amino acids 1-565 of SEQ ID NO: 40; or amino acids 1-556 of SEQ ID NO: 26 or amino acids 1-548 of SEQ ID NO: 24 or amino acids 1-523 of SEQ ID NO: 43 (i.e., mature polypeptide), respectively.

[0096] In an embodiment the amino acid sequence has glucoamylase activity and is at least 75%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, more preferred at least 96%, even more preferred at least 97%, even more preferred at least 98%, even more preferably at least 99% identical to the mature part of SEQ ID NO: 2 or SEQ ID NO: 37 (hereinafter "homologous polypeptides").

[0097] In another embodiment the amino acid sequence has glucoamylase activity and has at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, more preferred at least 96%, even more preferred at least 97%, even more preferred at least 98%, even more preferably at least 99% identity to the mature part of SEQ ID NO: 5 or SEQ ID NO: 40 (hereinafter "homologous polypeptides").

[0098] In an embodiment the amino acid sequence has glucoamylase activity and is at least 60%, at least 65%, at least 70%, at least 75%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, more preferred at least 96%, even more preferred at least 97%, even more preferred at least 98%, even more preferably at least 99% identical to the mature part of SEQ ID NO: 26, 24 or 43, respectively (hereinafter "homologous polypeptides").

[0099] In a preferred aspect, the homologous polypeptides have an amino acid sequence which differs by ten amino acids, preferably by five amino acids, more preferably by four amino acids, even more preferably by three amino acids, most preferably by two amino acids, and even most preferably by one amino acid from amino acids 1-556 of SEQ ID NO: 2, or amino acids 1-561 of SEQ ID NO: 37; or amino acids 1-575 of SEQ ID NO: 5, or amino acids 1-565 of SEQ ID NO: 40; or amino acids 1-556 of SEQ ID NO: 26 or amino acids 1-548 of SEQ ID NO: 24 or amino acids 1-523 of SEQ ID NO: 43, respectively.

[0100] A polypeptide of the present invention preferably comprises the mature amino acid sequences of SEQ ID NO: 2 or 37; or SEQ ID NO: 5 or 40; or SEQ ID NO: 26 24 or 43, respectively, or allelic variants thereof; or fragments thereof that have glucoamylase activity, e.g., the catalytic domain.

Catalytic Domain

[0101] In an aspect, the invention relates to polypeptides that comprise the catalytic region/domain of the amino acid sequences of SEQ ID NO: 2 or 37; or SEQ ID NO: 5 or 40 or SEQ ID NO: 26, 24, or 43, respectively.

[0102] The catalytic region/domain of the Trametes cingulata glucoamylase is located at amino acids 1-455 in SEQ ID NO: 2 or amino acids 1-460 of SEQ ID NO: 37. In one embodiment the region may be considered to include the linker region at amino acids 456-465 of SEQ ID NO: 2 or amino acids 461-470 of SEQ ID NO: 37, respectively, or part thereof. The binding domain is encoded by polynucleotides 1423-1725 in SEQ ID NO: 3 or polynucleotides 1774-2163 of SEQ ID NO: 36 or polynucleotides 1465-1737 of SEQ ID NO: 38, respectively.

[0103] The catalytic region/domain of the Pachykytospora papyracea glucoamylase is located at amino acids 1-475 in SEQ ID NO: 5 or amino acids 1-465 of SEQ ID NO: 40. In one embodiment the region may be considered to include the linker region at amino acids 476-484 of SEQ ID NO: 5 or amino acids 466-474 of SEQ ID NO: 40, respectively, or part thereof. The binding domain is encoded by polynucleotides 1420-1725 in SEQ ID NO: 6 or polynucleotides 1763-2182 of SEQ ID NO: 39 or polynucleotides 1477-1749 of SEQ ID NO: 41, respectively.

[0104] The catalytic region/domain of the Leucopaxillus giganteus glucoamylase is located at amino acids 1-451 of SEQ ID NO: 26 or amino acids 1-455 of SEQ ID NO: 24 or amino acids 1-418 of SEQ ID NO: 43, respectively. In one embodiment the region may be considered to include the linker region at amino acids 452-461 of SEQ ID NO: 26 or amino acids 456-466 of SEQ ID NO: 24 or amino acids 419-429 of SEQ ID NO: 43, respectively, or part thereof. The binding domain (CBM) is encoded by polynucleotides 1438-1719 in SEQ ID NO: 25 or polynucleotides 1854-2249 of SEQ ID NO: 23 or polynucleotides 1339-1620 of SEQ ID NO: 42, respectively.

[0105] In a preferred embodiment the invention relates to a catalytic region which has at least 60% identity, preferably at least 65% identity, more preferably at least 70% identity, more preferably at least 75% identity, more preferably at least 80% identity, more preferably at least 85% identity, even more preferably at least 90% identity, most preferably at least 95% identity, more preferred at least 96% identity, even more preferred at least 97% identity, even more preferred at least 98% identity, even more preferably at least 99% identity, especially 100% identity to amino acids 1-455 in SEQ ID NO: 2 or amino acids 1-460 of SEQ ID NO: 37 (Trametes); or amino acids 1-475 in SEQ ID NO: 5 or amino acids 1-465 of SEQ ID NO: 40 (Pachykytospora); or amino acids 1-451 in SEQ ID NO: 26 or amino acids 1-455 of SEQ ID NO: 24 or amino acids 1-418 in SEQ ID NO: 43 (Leucopaxillus), respectively, and which have glucoamylase activity (hereinafter "homologous polypeptides"). In a preferred aspect, the homologous catalytic regions have amino acid sequences which differs by ten amino acids, preferably by five amino acids, more preferably by four amino acids, even more preferably by three amino acids, most preferably by two amino acids, and even most preferably by one amino acid from amino acids 1-455 of SEQ ID NO: 2 or amino acids 1460 of SEQ ID NO: 37 (Trametes cingulata); or amino acids 1-475 of SEQ ID NO: 5 or amino acids 1-465 of SEQ ID NO: 40 (Pachykytospora) or amino acids 1-451 in SEQ ID NO: 26 or amino acids 1-455 of SEQ ID NO: 2424 or amino acids 1-418 in SEQ ID NO: 43 (Leucopaxillus giganteus), respectively.

Binding Domain

[0106] In another aspect, the invention relates to polypeptides having carbohydrate-binding affinity, preferably starch-binding affinity.

[0107] The binding domain in Trametes glucoamylase is located at amino acid 466-556 of SEQ ID NO: 2 and is encoded by polynucleotides 1420-1725 in SEQ ID NO: 3 or is located at amino acids 471-561 of SEQ ID NO: 37 and is encoded by polynucleotides 1465-1737 in SEQ ID NO: 38.

[0108] The binding domain in Pachykytospora glucoamylase is located at amino acids 485-575 is SEQ ID NO: 5 (Pachykytspora) and is encoded by polynucleotides 1423-1725 in SEQ ID NO: 6 or is located at amino acids 475-565 of SEQ ID NO: 40 and is encoded by polynucleotides 1477-1749 in SEQ ID NO: 41.

[0109] The binding domain in Leucopaxillus glucoamylase is located at amino acids 463-556 of SEQ ID NO: 26 or amino acids 467-548 of SEQ ID NO: 24 or amino acids 430-523 of SEQ ID NO: 43, respectively, and is encoded by polynucleotides 1854-2249 in SEQ ID NO: 23 or polynucleotides 1438-1719 in SEQ ID NO: 25 or polynucleotides 1339-1620 in SEQ ID NO: 42, respectively.

[0110] Consequently, in this aspect the invention relates to a polypeptide having carbohydrate binding affinity, selected from the group consisting of:

(a) i) a polypeptide comprising an amino acid sequence which has at least 60% identity with amino acids 466 to 556 of SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37, respectively; or

[0111] ii) a polypeptide comprising an amino acid sequence which has at least 60% identity with amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively; or

[0112] iii) a polypeptide comprising an amino acid sequence which has at least 60% identity with amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24, or amino acids 430 to 523 of SEQ ID NO: 43, respectively;

(b) a polypeptide which is encoded by a nucleotide sequence which hybridizes under low stringency conditions with a polynucleotide probe selected from the group consisting of

[0113] (i) the complementary strand of nucleotides 1420 to 1725 of SEQ ID NO: 3 or nucleotides 1465 to 1737 of SEQ ID NO: 38, respectively;

[0114] (ii) the complementary strand of nucleotides 1423 to 1725 of SEQ ID NO: 6 or nucleotides 1477 to 1749 of SEQ ID NO: 41, respectively;

[0115] (iii) the complementary strand of nucleotides 1438 to 1719 of SEQ ID NO: 25 or nucleotides 1854 to 2249 of SEQ ID NO: 23 or nucleotides 1339 to 1620 of SEQ ID NO: 42, respectively;

(c) a fragment of (a) or (b) that has carbohydrate binding affinity.

[0116] In a preferred embodiment the carbohydrate binding affinity is starch-binding affinity.

[0117] In a preferred embodiment the invention relates to a polypeptide having carbohydrate binding affinity which has at least 60% identity, preferably at least 70% identity, more preferably at least 75% identity, more preferably at least 80% identity, more preferably at least 85% identity, even more preferably at least 90% identity, most preferably at least 95% identity, more preferred at least 96% identity, even more preferred at least 97% identity, even more preferred at least 98% identity, even more preferably at least 99% identity, especially 100% identity to amino acids 466 to 556 in SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37, respectively, (Trametes), or amino acids 485 to 575 in SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively, (Pachykytospora), or amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24 or amino acids 430 to 523 of SEQ ID NO: 43, respectively (Leucopaxillus), respectively.

[0118] In a preferred aspect, homologous binding domains have amino acid sequences which differs by ten amino acids, preferably by five amino acids, more preferably by four amino acids, even more preferably by three amino acids, most preferably by two amino acids, and even most preferably by one amino acid from amino acids 466 to 556 of SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37, respectively, (Trametes cingulata) or amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively, (Pachykytospora) or amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24 or amino acids 430 to 523 of SEQ ID NO: 43, respectively (Leucopaxillus), respectively.

[0119] In another embodiment the invention relates to a polypeptide having carbohydrate-binding affinity, selected from the group consisting of:

(a) a polypeptide which is encoded by a nucleotide sequence which hybridizes under low stringency conditions, preferably under medium, more preferably under high stringency conditions with a polynucleotide probe selected from the group consisting of

[0120] (i) the complementary strand of nucleotides 1420 to 1725 of SEQ ID NO: 3 or nucleotides 1465 to 1737 in SEQ ID NO: 38, respectively;

[0121] (ii) the complementary strand of nucleotides 1423 to 1725 of SEQ ID NO: 6 or nucleotides 1477 to 1749 in SEQ ID NO: 41, respectively;

[0122] (iii) the complementary strand of nucleotides 1438 to 1719 of SEQ ID NO: 25 or nucleotides 1854 to 2249 in SEQ ID NO: 23 or nucleotides 1339 to 1620 in SEQ ID NO: 42, respectively;

(b) a fragment of (a) that has carbohydrate-binding affinity.

[0123] The invention also relates to a polypeptide having carbohydrate-binding affinity, where the polypeptide is an artificial variant which comprises an amino acid sequence that has at least one substitution, deletion and/or insertion of an amino acid as compared to amino acids 466 to 556 of SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37 (Trametes); or amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40 (Pachykytospora); or amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24 or amino acids 430 to 523 of SEQ ID NO: 43 (Leucopaxillus), respectively.

[0124] The invention also relates to a polypeptide having carbohydrate-binding affinity, where the polypeptide is an artificial variant which comprises an amino acid sequence that has at least one substitution, deletion and/or insertion of an amino acid as compared to the amino acid sequence encoded by the carbohydrate-binding domain encoding part of the polynucleotide sequences shown in position 1420 to 1725 in SEQ ID NO: 3 or position 1465 to 1737 in SEQ ID NO: 38; or position 1423 to 1725 of SEQ ID NO: 6 or position 1477 to 1749 in SEQ ID NO: 41; or position 1438 to 1719 of SEQ ID NO: 25 or position 1854 to 2249 in SEQ ID NO: 23 or nucleotides 1339 to 1620 in SEQ ID NO: 42, respectively.

Hybrids

[0125] The glucoamylases or catalytic regions of the invention may be linked, via a linker sequence or directly, to one or more foreign binding domains (also referred to as binding modules (CBM)). A "foreign" binding domain is a binding-domain that is not derived from the wild-type glucoamylases of the invention in question. The binding-domain is preferably a carbohydrate-binding domain (i.e., having affinity for binding to a carbohydrate), especially a starch-binding domain or a cellulose-binding domain. Preferred binding domains are of fungal or bacterial origin. Examples of specifically contemplated starch-binding domains are disclosed in WO 2005/003311 which is hereby incorporated by reference.

[0126] In a preferred embodiment the linker in a glucoamylase of the invention is replaced with a more stable linker, i.e., a linker that is more difficult to cut than the parent linker. This is done to avoid that the binding-domain is cleaved off. Specifically contemplated stable linkers include the Aspergillus kawachli linker: TABLE-US-00001 TTTTTTAAAT STSKATTSSSSSSAAATTSSS (SEQ ID NO: 22)

[0127] Thus, in a preferred embodiment the invention relates to a hybrid glucoamylase having the amino acid sequence shown in SEQ ID NO: 2 or 37, respectively, wherein the native linker located from amino acids 456 to 465 of SEQ ID NO: 2 or from amino acids 461 to 470 in SEQ ID NO: 37, respectively, or part thereof, is replaced with the Aspergillus kawachii linker shown in SEQ ID NO: 22.

[0128] Thus, in another preferred embodiment the invention relates to a hybrid glucoamylase having the amino acid sequence shown in SEQ ID NO: 5 or 40, respectively, wherein the native linker located from 476 to 484 in SEQ ID NO: 5 or from amino acids 466 to 474 in SEQ ID NO: 40, respectively, or part thereof is replaced with the Aspergillus kawachii linker shown in SEQ ID NO: 22.

[0129] Thus, in another preferred embodiment the invention relates to a hybrid glucoamylase having the amino acid sequence shown in SEQ ID NO: 26 or 24, respectively, wherein the native linker located from 452 to 462 in SEQ ID NO: 26 or from amino acids 456 466 in SEQ ID NO: 24 or from amino acids 419 to 429 in SEQ ID NO: 24, respectively, or part thereof is replaced with the Aspergillus kawachii linker shown in SEQ ID NO: 22.

[0130] Thus, the invention also relates to hybrids consisting of a glucoamylase of the invention or catalytic domain of the invention having glucoamylase activity fused to a stable linker (e.g., Aspergillus kawachii linker) and one or more carbohydrate-binding domains, e.g., a carbohydrate-binding module (CBM) disclosed in WO 2005/003311 on page 5, line 30 to page 8, line 12, hereby incorporated by reference.

Hybridization

[0131] In another aspect, the present invention relates to polypeptides having glucoamylase activity which are encoded by polynucleotides (i) which hybridizes under at least low stringency conditions, preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with a nucleotide sequence with nucleotides 55 to 2166 of SEQ ID NO: 1 or nucleotides 55 to 2166 of SEQ ID NO: 36, respectively (Trametes genomic DNA), or (ii) which hybridizes under at least medium stringency conditions, preferably medium-high stringency conditions, more preferably high stringency conditions, and more preferably very high stringency conditions with a nucleotide sequence with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 3 or nucleotides 55 to 1737 of SEQ ID NO: 38, respectively (Trametes cDNA), or (iii) a subsequence of (i) or (ii), or (iv) a complementary strand of (i), (ii), or (iii) (J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, N.Y.). A subsequence of SEQ ID NOS: 1 or 3, or SEQ ID NOS: 36 or 38 (Trametes) contains at least 100 contiguous nucleotides or preferably at least 200 continguous nucleotides. Moreover, the subsequence may encode a polypeptide fragment which has glucoamylase activity.

[0132] The invention also relates to isolated polypeptides having glucoamylase activity which are encoded by polynucleotides (i) which hybridizes under at least low stringency conditions, preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with a nucleotide sequence with nucleotides 55 to 2189 of SEQ ID NO: 4 or nucleotides 55 to 2182 of SEQ ID NO: 39, respectively (Pachykytospora genomic DNA), or (ii) which hybridizes under at least medium stringency conditions, preferably medium-high stringency conditions, more preferably high stringency conditions, and even more preferably very high stringency conditions with a nucleotide sequence with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 6 or nucleotides 55 to 1749 of SEQ ID NO: 41, respectively (Pachykytospora cDNA), or (iii) a subsequence of (i) or (ii), or (iv) a complementary strand of (i), (ii), or (iii).

[0133] The invention also relates to isolated polypeptides having glucoamylase activity which are encoded by polynucleotides (i) which hybridizes under at least low stringency conditions, preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with a nucleotide sequence with nucleotides 117 to 2249 of SEQ ID NO: 23 (Leucopaxillus genomic DNA), or (ii) which hybridizes under at least low stringency conditions, preferably medium, more preferably medium-high stringency conditions, more preferably high stringency conditions, and even more preferably very high stringency conditions with a nucleotide sequence with the cDNA sequence contained in nucleotides 52 to 1719 of SEQ ID NO: 25 or nucleotides 52 to 1620 of SEQ ID NO: 42 (Leucopaxillus cDNA), or (iii) a subsequence of (i) or (ii), or (iv) a complementary strand of (i), (ii), or (iii)

[0134] The nucleotide sequence of SEQ ID NO: 1, 3, 36, or 38, respectively, or a subsequence thereof, or the nucleotide sequence of SEQ ID NO: 4, 6, 39, or 41, respectively, or a subsequence thereof, or the nucleotide sequence of SEQ ID NO: 23, 25 or 42, respectively, or a subsequence thereof, as well as the amino acid sequence of SEQ ID NO: 2 or 37, respectively, or a fragment thereof, or the amino acid sequence of SEQ ID NO: 5 or 40, respectively, or a fragment thereof, or the amino acid sequence of SEQ ID NO: 26, 24, or 43, respectively, or a fragment thereof, may be used to design a nucleic acid probe to identify and clone DNA encoding polypeptides having glucoamylase activity from strains of different genera or species according to methods well known in the art. In particular, such probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein. Such probes can be considerably shorter than the entire sequence, but should be at least 14, preferably at least 25, more preferably at least 35, and most preferably at least 70 nucleotides in length. It is however, preferred that the nucleic acid probe is at least 100 nucleotides in length. For example, the nucleic acid probe may be at least 200 nucleotides, preferably at least 300 nucleotides, more preferably at least 400 nucleotides, or most preferably at least 500 nucleotides in length. Even longer probes may be used, e.g., nucleic acid probes which are at least 600 nucleotides, at least preferably at least 700 nucleotides, more preferably at least 800 nucleotides, or most preferably at least 900 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labeled for detecting the corresponding gene (for example, with .sup.32P, .sup.3H, .sup.35S, biotin, or avidin). Such probes are encompassed by the present invention.

[0135] A genomic DNA or cDNA library prepared from such other organisms may, therefore, be screened for DNA which hybridizes with the probes described above and which encodes a polypeptide having glucoamylase activity. Genomic or other DNA from such other organisms may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone or DNA which is homologous with SEQ ID NO: 1, 3, 36, or 38, respectively, or a subsequence thereof, or SEQ ID NO: 4, 6, 39 or 41, respectively, or a subsequence thereof, or SEQ ID NO: 23, 25, or 42, respectively, or a subsequence thereof, the carrier material is used in a Southern blot.

[0136] For purposes of the present invention, hybridization indicates that the nucleotide sequences hybridize to labeled nucleic acid probes corresponding to the nucleotide sequence shown in SEQ ID NO: 1, 3, 36 or 38, respectively, or SEQ ID NO: 4, 6, 39, or 41, respectively, or SEQ ID NO: 23, 25, or 42, respectively, its complementary strands, or subsequences thereof, under low or medium to very high stringency conditions. Molecules to which the nucleic acid probe hybridizes under these conditions can be detected using X-ray film.

[0137] In a preferred embodiment, the nucleic acid probe is nucleotides 55 to 2166 of SEQ ID NO: 1 or nucleotides 55 to 2166 of SEQ ID NO: 36, or nucleotides 1 to 1725 of SEQ ID NO: 3 or nucleotides 55 to 1737 of SEQ ID NO: 38 (Trametes cDNA). In a preferred embodiment, the nucleic acid probe is nucleotides 55 to 2186 of SEQ ID NO: 4 or nucleotides 55 to 2182 of SEQ ID NO: 39 or nucleotides 1 to 1725 of SEQ ID NO: 6 or nucleotides 55 to 1749 of SEQ ID NO: 41 (Pachykytospora cDNA). In a preferred embodiment, the nucleic acid probe is nucleotides 117 to 2249 of SEQ ID NO: 23 or nucleotides 52 to 1719 of SEQ ID NO: 25 (Leucopaxillus cDNA) or nucleotides 52 to 1620 of SEQ ID NO: 42 (Leucopaxillus cDNA). In other preferred aspect, the nucleic acid probe is a polynucleotide sequence which encodes the catalytic region between amino acids 1 and 455 of SEQ ID NO: 2 or amino acids 1 to 460 of SEQ ID NO: 37 (Trametes) or between amino acids 1 and 475 of SEQ ID NO: 5 or amino acids 1 to 465 of SEQ ID NO: 40 (Pachykytospora) or between amino acids 1 and 455 of SEQ ID NO: 24 or amino acids 1 to 451 of SEQ ID NO: 26 or amino acids 1 to 418 of SEQ ID NO: 43 (Leucopaxillus).

[0138] In another aspect the invention relates to nucleic acid probes that encode the binding domain in amino acids 466 to 456 of SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37, respectively, or amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively, or amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24 or amino acids 430 to 523 of SEQ ID NO: 43, respectively.

[0139] In another preferred aspect, the nucleic acid probe is the mature polypeptide coding region of SEQ ID NO: 1, 3, 36 or 38, respectively (Trametes). In another preferred embodiment, the nucleic acid probe is the mature polypeptide coding region of SEQ ID NO: 4, 6, 39 or 41 (Pachykytospora). In another preferred embodiment, the nucleic acid probe is the mature polypeptide coding region of SEQ ID NOS: 23, 25, or 42 (Leucopaxillus). In another preferred aspect, the nucleic acid probe is the part of the sequences in plasmids pHUda595 and pHUda594, respectively, coding for the mature polypeptides of the invention Plasmids pHUda595 and pHUda594, which are contained in Escherichia coli DSM 17106 and Escherichia coli DSM 17105, respectively, encode polypeptides having glucoamylase activity.

[0140] For long probes of at least 100 nucleotides in length, low to very high stringency conditions are defined as prehybridization and hybridization at 42.degree. C. in 5.times.SSPE, 0.3% SDS, 200 micro g/ml sheared and denatured salmon sperm DNA, and either 25% formamide for low stringencies, 35% formamide for medium and medium-high stringencies, or 50% formamide for high and very high stringencies, following standard Southern blotting procedures for 12 to 24 hours optimally.

[0141] For long probes of at least 100 nucleotides in length, the carrier material is finally washed three times each for 15 minutes using 2.times.SSC, 0.2% SDS preferably at least at 50.degree. C. (low stringency), more preferably at least at 55.degree. C. (medium stringency), more preferably at least at 60.degree. C. (medium-high stringency), even more preferably at least at 65.degree. C. (high stringency), and most preferably at least at 70.degree. C. (very high stringency).

[0142] For short probes which are about 15 nucleotides to about 70 nucleotides in length, stringency conditions are defined as prehybridization, hybridization, and washing post-hybridization at about 5.degree. C. to about 10.degree. C. below the calculated T.sub.m using the calculation according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48:1390) in 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP-40, 1.times.Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per ml following standard Southern blotting procedures.

[0143] For short probes which are about 15 nucleotides to about 70 nucleotides in length, the carrier material is washed once in 6.times.SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6.times.SSC at 5.degree. C. to 10.degree. C. below the calculated T.sub.m.

[0144] Under salt-containing hybridization conditions, the effective T.sub.m is what controls the degree of identity required between the probe and the filter bound DNA for successful hybridization. The effective T.sub.m may be determined using the formula below to determine the degree of identity required for two DNAs to hybridize under various stringency conditions. Effective T.sub.m=81.5+16.6(log M[Na.sup.+])+0.41(% G+C)-0.72(% formamide)

[0145] (See www.ndsu.nodak.edu/instruct/mccleanlplsc731/dna/dna6.htm)

[0146] The G+C content of SEQ ID NO: 1 or nucleotides 55 to 2166 of SEQ ID NO: 1 is 60.5%.

[0147] The G+C content of SEQ ID NO: 3 (cDNA) or nucleotides 55 to 1725 of SEQ ID NO: 3 is 62.3%.

[0148] The G+C content of SEQ ID NO: 4 or nucleotides 55 to 2189 of SEQ ID NO: 4 is 60.7%.

[0149] The G+C content of SEQ ID NO: 6 (cDNA) or nucleotides 55 to 1725 of SEQ ID NO: 6 is 63.7%.

[0150] For medium stringency, the formamide is 35% and the Na.sup.+ concentration for 5.times.SSPE is 0.75 M. Applying this formula to these values, the Effective T.sub.m is 79.0.degree. C.

[0151] Another relevant relationship is that a 1% mismatch of two DNAs lowers the T.sub.m by 1.4.degree. C. To determine the degree of identity required for two DNAs to hybridize under medium stringency conditions at 42.degree. C., the following formula is used: % Homology=100-[(Effective T.sub.m-Hybridization Temperature)/1.4]

[0152] (See ndsu.nodak.edu/instruct/mcclean/plsc731/dna/dna6.htm)

[0153] Applying this formula to the values, the degree of identity required for two DNAs to hybridize under medium stringency conditions at 42.degree. C. is 100-[(79.0-42)/1.4]=51%.

Variants

[0154] In a further aspect, the present invention relates to artificial variants comprising a conservative substitution, deletion, and/or insertion of one or more amino acids in SEQ ID NOS: 2, 5, 24, 26, 37, 40, and 43, respectively, or the mature polypeptide thereof. Preferably, amino acid changes are of a minor nature, that is conservative amino acid substitutions or insertions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of one to about 30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to about 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding domain.

[0155] Examples of conservative substitutions are within the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions which do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and R. L. Hill, 1979, In, The Proteins, Academic Press, New York. The most commonly occurring exchanges are Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly.

[0156] In addition to the 20 standard amino acids, non-standard amino acids (such as 4-hydroxyproline, 6-N-methyl lysine, 2-aminoisobutyric acid, isovaline, and alpha-methyl serine) may be substituted for amino acid residues of a wild-type polypeptide. A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, and unnatural amino acids may be substituted for amino acid residues. "Unnatural amino acids" have been modified after protein synthesis, and/or have a chemical structure in their side chain(s) different from that of the standard amino acids. Unnatural amino acids can be chemically synthesized, and preferably, are commercially available, and include pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline, and 3,3-dimethylproline.

[0157] Alternatively, the amino acid changes are of such a nature that the physico-chemical properties of the polypeptides are altered. For example, amino acid changes may improve the thermal stability of the polypeptide, alter the substrate specificity, change the pH optimum, and the like.

[0158] Essential amino acids in the parent polypeptides can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity (i.e., glucoamylase activity) to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., 1996, J. Biol. Chem. 271: 4699-4708. The active site of the enzymes or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309:59-64. The identities of essential amino acids can also be inferred from analysis of identities with polypeptides which are related to a polypeptide according to the invention.

[0159] Single or multiple amino acid substitutions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991, Biochem. 30:10832-10837; U.S. Pat. No. 5,223,409; WO 92/06204), and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46:145; Ner et al., 1988, DNA 7:127).

[0160] Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells. Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide of interest, and can be applied to polypeptides of unknown structure.

[0161] The total number of amino acid substitutions, deletions and/or insertions of amino acids in position 1 to 556 of SEQ ID NO: 2 or position 1 to 561 of SEQ ID NO: 37 (Trametes glucoamylase); or in position 1 to 575 in SEQ ID NO: 5 or position 1 to 565 in SEQ ID NO: 40 (Pachykytospora glucoamylase) or position 1 to 556 of SEQ ID NO: 26 or position 1 to 548 of SEQ ID NO: 24 or position 1 to 523 of SEQ ID NO: 43 (Leucopaxilus glucoamylase), respectively, is 10, preferably 9, more preferably 8, more preferably 7, more preferably at most 6, more preferably at most 5, more preferably 4, even more preferably 3, most preferably 2, and even most preferably 1.

Sources of Polypeptides Having Glucoamylase Activity

[0162] A polypeptide of the present invention may be obtained from microorganisms of any genus. For purposes of the present invention, the term "obtained from" as used herein in connection with a given source shall mean that the polypeptide encoded by a nucleotide sequence is produced by the source or by a strain in which the nucleotide sequence from the source has been inserted. In a preferred aspect, the polypeptide obtained from a given source is secreted extracellularly.

[0163] In a preferred embodiment, the glucoamylase of the invention derived from the class Basidiomycetes. In a more preferred embodiment a glucoamylase of the invention is derived from a strain of the genus Trametes, more preferably from a strain of the species Trametes cingulata, or deposited clone DSM 17106, or a strain of the genus Pachykytospora more preferably a strain of the species Pachykytospora papyracea, or the deposited clone DSM 17105, or a strain of the genus Leucopaxililus, more preferably a strain of the species Leucopaxillus giganteus.

[0164] It will be understood that for the aforementioned species, the invention encompasses both the perfect and imperfect states, and other taxonomic equivalents, e.g., anamorphs, regardless of the species name by which they are known. Those skilled in the art will readily recognize the identity of appropriate equivalents.

[0165] The Trametes cingulata strain was collected in Zimbabwe in the period from 1995 to 1997.

[0166] The Pachykytospora papyracea strain was collected in Zimbabwe in the period from 1995 to 1997.

[0167] The Leucopaxillus giganteus strain was collected in Denmark in 2003.

[0168] Furthermore, such polypeptides may be identified and obtained from other sources including microorganisms isolated from nature (e.g., soil, composts, water, etc.) using the above-mentioned probes. Techniques for isolating microorganisms from natural habitats are well known in the art. The polynucleotide may then be obtained by similarly screening a genomic or cDNA library of another microorganism. Once a polynucleotide sequence encoding a polypeptide has been detected with the probe(s), the polynucleotide can be isolated or cloned by utilizing techniques which are well known to those of ordinary skill in the art (see, e.g., Sambrook et al., 1989, supra).

[0169] Polypeptides of the present invention also include fused polypeptides or cleavable fusion polypeptides in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide or fragment thereof. A fused polypeptide is produced by fusing a nucleotide sequence (or a portion thereof) encoding another polypeptide to a nucleotide sequence (or a portion thereof) of the present invention. Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fused polypeptide is under control of the same promoter(s) and terminator.

Polynucleotides

[0170] The present invention also relates to isolated polynucleotides having a nucleotide sequence which encode a polypeptide of the present invention. In a preferred aspect, the nucleotide sequence is set forth in any of SEQ ID NO: 1, 3, 4, 6, 23, 25, 36, 38, 39, 41, or 42, respectively. In another more preferred aspect, the nucleotide sequence is the sequence contained in plasmid pHuda595 or pHuda594 that is contained in Escherichia coli DSM 17106 and Escherichia coli DSM 17105, respectively. In another preferred aspect, the nucleotide sequence is the mature polypeptide coding region of any of SEQ ID NO: 1, 3, 4, 6, 23, 25, 36, 38, 39, 41, or 42, respectively. The present invention also encompasses nucleotide sequences which encode a polypeptide having the amino acid sequence of any of SEQ ID NO: 2, 5, 24, 26, 37, 40, or 43, respectively, or the mature polypeptide thereof, which differs from SEQ ID NO: 1, 3, 4, 6, 23, 25, 36, 38, 39, 41, or 42 respectively, by virtue of the degeneracy of the genetic code. The present invention also relates to subsequences of any of SEQ ID NO: 1, 3, 4, 6, 23, 26, 36, 38, 39, 41, or 42, respectively, which encode fragments of SEQ ID NO: 2, 5, 24, 26, 37, 39, 40, or 43 respectively, that have glucoamylase activity.

[0171] The present invention also relates to mutant polynucleotides comprising at least one mutation in the mature polypeptide coding sequence of any of SEQ ID NO: 1, 3, 4, 6, 23, 25, 36, 38, 39, 41, or 42, respectively, in which the mutant nucleotide sequence encodes a polypeptide which consists of amino acids 1 to 556 of SEQ ID NO: 2, amino acids 1 to 575 of SEQ ID NO: 5, amino acids 1 to 548 of SEQ ID NO: 24, amino acid 1 to 556 of SEQ ID NO: 26, amino acids 1 to 561 of SEQ ID NO: 37, amino acids 1 to 565 of SEQ ID NO: 40, or amino acids 1 to 523 of SEQ ID NO: 43, respectively.

[0172] The techniques used to isolate or clone a polynucleotide encoding a polypeptide are known in the art and include isolation from genomic DNA, preparation from cDNA, or a combination thereof. The cloning of the polynucleotides of the present invention from such genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cloned DNA fragments with shared structural features. See, e.g., Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification procedures such as ligase chain reaction (LCR), ligated activated transcription (LAT) and nucleotide sequence-based amplification (NASBA) may be used. The polynucleotides may be cloned from a strain of the genera Trametes, Pachykytospora, Leucopaxillus or other or related organisms and thus, for example, may be an allelic or species variant of the polypeptide encoding region of the nucleotide sequences.

[0173] The present invention also relates to polynucleotides having nucleotide sequences which have a degree of identity to the mature polypeptide coding sequence of SEQ ID NO: 1 (i.e., nucleotides 55 to 2166), or SEQ ID NO: 3 (i.e., nucleotides 55 to 1725), or SEQ ID NO: 4 (i.e., nucleotides 55 to 2182), or SEQ ID NO: 6 (i.e., nucleotides 55 to 1725), or SEQ ID NO: 25 (i.e., nucleotides 52 to 1719), or SEQ ID NO: 38 (i.e., nucleotide 55 to 1737), or SEQ ID NO: 41 (i.e., nucleotide 55 to 1749), or SEQ ID NO: 42 (i.e., nucleotide 55 to 1620), respectively, of at least 60%, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, even more prefer ably 96%, even more 97%, even more 98%, and most preferably at least 99% identity, which encode an active polypeptide.

[0174] Modification of a nucleotide sequence encoding a polypeptide of the present invention may be necessary for the synthesis of polypeptides substantially similar to the polypeptide. The term "substantially similar" to the polypeptide refers to non-naturally occurring forms of the polypeptide. These polypeptides may differ in some engineered way from the polypeptide isolated from its native source, e.g., artificial variants that differ in specific activity, thermostability, pH optimum, or the like. The variant sequence may be constructed on the basis of the nucleotide sequence presented as the mature polypeptide encoding region of any of SEQ ID NO: 1, 3, 4, 6, 23, 25, 36, 38, 39, 41, or 42, respectively, e.g., subsequences thereof, and/or by introduction of nucleotide substitutions, which do not give rise to another amino acid sequence of the polypeptide encoded by the nucleotide sequence, but which correspond to the codon usage of the host organism intended for production of the enzyme, or by introduction of nucleotide substitutions which may give rise to a different amino acid sequence. For a general description of nucleotide substitution, see, e.g., Ford et al., 1991, Protein Expression and Purification 2: 95-107.

[0175] It will be apparent to those skilled in the art that such substitutions can be made outside the regions critical to the function of the molecule and still result in an active polypeptide. Amino acid residues essential to the activity of the polypeptide encoded by an isolated polynucleotide of the invention, and therefore preferably not subject to substitution, may be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, mutations are introduced at every positively charged residue in the molecule, and the resultant mutant molecules are tested for glucoamylase activity to identify amino acid residues that are critical to the activity of the molecule. Sites of substrate-enzyme interaction can also be determined by analysis of the three-dimensional structure as determined by such techniques as nuclear magnetic resonance analysis, crystallography or photoaffinity labelling (see, e.g., de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).

[0176] The present invention also relates to isolated polynucleotides encoding a polypeptide of the present invention, (i) which hybridize under low stringency conditions, more preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 1 or nucleotides 55 to 2166 of SEQ ID NO: 36, respectively, or (ii) which hybridize under medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with nucleotides the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 3 or nucleotides 55 to 1737 of SEQ ID NO: 38, respectively, or (iii) a complementary strand of (i) or (ii); or allelic variants and subsequences thereof (Sambrook et al., 1989, supra), as defined herein.

[0177] The present invention also relates to isolated polynucleotides encoding a polypeptide of the present invention, (i) which hybridize under low stringency conditions, more preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with nucleotides 55 to 2189 of SEQ ID NO: 4 or nucleotides 55 to 2182 of SEQ ID NO: 39, respectively, or (ii) which hybridize under medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with nucleotides the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 6 or nucleotides 55 to 1749 of SEQ ID NO: 41, or (iii) a complementary strand of (i) or (ii); or allelic variants and subsequences thereof (Sambrook et al., 1989, supra), as defined herein.

[0178] The present invention also relates to isolated polynucleotides encoding a polypeptide of the present invention, (i) which hybridize under low stringency conditions, more preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with nucleotides 117 to 2249 of SEQ ID NO: 23, or (ii) which hybridize under low stringency conditions, preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with nucleotides the cDNA sequence contained in nucleotides 52 to 1719 of SEQ ID NO: 25 or nucleotides 52 to 1620 of SEQ ID NO: 42, respectively, or (iii) a complementary strand of (i) or (ii); or allelic variants and subsequences thereof (Sambrook et al., 1989, supra), as defined herein.

[0179] The present invention also relates to isolated polynucleotides obtained by (a) hybridizing a population of DNA under low, medium, medium-high, high, or very high stringency conditions with (i) nucleotides 55 to 2166 of SEQ ID NO: 1 or nucleotides 55 to 2166 of SEQ ID NO: 36, respectively, or (ii) hybridizing a population of DNA under medium, medium-high, high, or very high stringency conditions with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 3 or nucleotides 55 to 1737 of SEQ ID NO: 38, respectively, or (iii) a complementary strand of (i) or (ii); and (b) isolating the hybridizing polynucleotide, which encodes a polypeptide having glucoamylase activity.

[0180] The present invention also relates to isolated polynucleotides obtained by (a) hybridizing a population of DNA under low, medium, medium-high, high, or very high stringency conditions with (i) nucleotides 55 to 2189 of SEQ ID NO: 4 or nucleotides 55 to 2182 of SEQ ID NO: 39, respectively, or (ii) hybridizing a population of DNA under medium, medium-high, high, or very high stringency conditions with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 6 or nucleotides 55 to 1749 of SEQ ID NO: 41, respectively, or (iii) a complementary strand of (i) or (ii); and (b) isolating the hybridizing polynucleotide, which encodes a polypeptide having glucoamylase activity.

[0181] The present invention also relates to isolated polynucleotides obtained by (a) hybridizing a population of DNA under low, medium, medium-high, high, or very high stringency conditions with (i) nucleotides 117 to 2249 of SEQ ID NO: 23, or (ii) hybridizing a population of DNA under medium, medium-high, high, or very high stringency conditions with the cDNA sequence contained in nucleotides 52 to 1719 of SEQ ID NO: 25 or nucleotides 52 to 1620 of SEQ ID NO: 42, respectively, or (iii) a complementary strand of (i) or (ii); and (b) isolating the hybridizing polynucleotide, which encodes a polypeptide having glucoamylase activity.

Nucleic Acid Constructs

[0182] The present invention also relates to nucleic acid constructs comprising an isolated polynucleotide of the present invention operably linked to one or more control sequences which direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

[0183] An isolated polynucleotide encoding a polypeptide of the present invention may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the polynucleotide's sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotide sequences utilizing recombinant DNA methods are well known in the art.

[0184] The control sequence may be an appropriate promoter sequence, a nucleotide sequence which is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention. The promoter sequence contains transcriptional control sequences which mediate the expression of the polypeptide. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.

[0185] Examples of suitable promoters for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, Fusarium venenatum glucoamylase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Fusarium oxysporum trypsin-like protease (WO 96/00787), Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase IV, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei beta-xylosidase, as well as the NA2-tpi promoter (a hybrid of the promoters from the genes for Aspergillus niger neutral alpha-amylase and Aspergillus oryzae triose phosphate isomerase); and mutant, truncated, and hybrid promoters thereof.

[0186] In a yeast host, useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionine (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8: 423-488.

[0187] The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

[0188] Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin-like protease.

[0189] Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C(CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.

[0190] The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used in the present invention.

[0191] Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.

[0192] Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).

[0193] The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the nucleotide sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention.

[0194] Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum trypsin-like protease, and Aspergillus niger alpha-glucosidase.

[0195] Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Molecular Cellular Biology 15: 5983-5990.

[0196] The control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway. The 5' end of the coding sequence of the nucleotide sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding region which is foreign to the coding sequence. The foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region. Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to enhance secretion of the polypeptide. However, any signal peptide coding region which directs the expressed polypeptide into the secretory pathway of a host cell of choice may be used in the present invention.

[0197] Effective signal peptide coding regions for filamentous fungal host cells are the signal peptide coding regions obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor miehei aspartic proteinase, Humicola insolens cellulase, and Humicola lanuginosa lipase.

[0198] Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding regions are described by Romanos et al., 1992, supra.

[0199] The control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propolypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding region may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic proteinase, and Myceliophthora thermophila laccase (WO 95/33836).

[0200] Where both signal peptide and propeptide regions are present at the amino terminus of a polypeptide, the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region.

[0201] It may also be desirable to add regulatory sequences which allow the regulation of the expression of the polypeptide relative to the growth of the host cell. Examples of regulatory systems are those which cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. In yeast, the ADH2 system or GAL1 system may be used. In filamentous fungi, the TAKA alpha-amylase promoter, Aspergillus niger glucoamylase promoter, and Aspergillus oryzae glucoamylase promoter may be used as regulatory sequences. Other examples of regulatory sequences are those which allow for gene amplification. In eukaryotic systems, these include the dihydrofolate reductase gene which is amplified in the presence of methotrexate, and the metallothionein genes which are amplified with heavy metals. In these cases, the nucleotide sequence encoding the polypeptide would be operably linked with the regulatory sequence.

Expression Vectors

[0202] The present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleic acids and control sequences described above may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the nucleotide sequence encoding the polypeptide at such sites. Alternatively, a nucleotide sequence of the present invention may be expressed by inserting the nucleotide sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.

[0203] The recombinant expression vector may be any vector (e.g., a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about expression of the nucleotide sequence. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vectors may be linear or closed circular plasmids.

[0204] The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.

[0205] The vectors of the present invention preferably contain one or more selectable markers which permit easy selection of transformed cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.

[0206] Examples of suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof. Preferred for use in an Aspergillus cell are the amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Streptomyces hygroscopicus.

[0207] The vectors of the present invention preferably contain an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.

[0208] For integration into the host cell genome, the vector may rely on the polynucleotide's sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should preferably contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, and most preferably 800 to 10,000 base pairs, which have a high degree of identity with the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding nucleotide sequences. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.

[0209] For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicator mediating autonomous replication which functions in a cell. The term "origin of replication" or "plasmid replicator" is defined herein as a nucleotide sequence that enables a plasmid or vector to replicate in vivo.

[0210] Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.

[0211] Examples of origins of replication useful in a filamentous fungal cell are AMA1 and ANS1 (Gems et al., 1991, Gene 98:61-67; Cullen et al., 1987, Nucleic Acids Research 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.

[0212] More than one copy of a polynucleotide of the present invention may be inserted into the host cell to increase production of the gene product. An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.

[0213] The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra).

Host Cells

[0214] The present invention also relates to recombinant host cells, comprising a polynucleotide of the present invention, which are advantageously used in the recombinant production of the polypeptides. A vector comprising a polynucleotide of the present invention is introduced into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source.

[0215] The host cell may be a eukaryote, such as a mammalian, insect, plant, or fungal cell.

[0216] In a preferred aspect, the host cell is a fungal cell. "Fungi" as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK) as well as the Oomycota (as cited in Hawksworth et al., 1995, supra, page 171) and all mitosporic fungi (Hawksworth et al., 1995, supra).

[0217] In a more preferred aspect, the fungal host cell is a yeast cell. `Yeast` as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, F. A., Passmore, S. M., and Davenport, R. R., eds, Soc. App. Bacteriol. Symposium Series No. 9, 1980).

[0218] In an even more preferred aspect, the yeast host cell is a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell.

[0219] In a most preferred aspect, the yeast host cell is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis cell. In another most preferred aspect, the yeast host cell is a Kluyveromyces lactis cell. In another most preferred aspect, the yeast host cell is a Yarrowia lipolytica cell.

[0220] In another more preferred aspect, the fungal host cell is a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). The filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.

[0221] In an even more preferred aspect, the filamentous fungal host cell is an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Coprinus, Coriolus, Cryptococcus, Filobasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.

[0222] In a most preferred aspect, the filamentous fungal host cell is an Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae cell. In another most preferred aspect, the filamentous fungal host cell is a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum cell. In another most preferred aspect, the filamentous fungal host cell is a Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceeiporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, or Ceriporiopsis subvermispora, Coprinus cinereus, Coriolus hirsutus, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichodermna harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride strain cell.

[0223] Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238 023 and Yelton et al., 1984, Proceedings of the National Academy of Sciences USA 81: 1470-1474. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J. N. and Simon, M. I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, Journal of Bacteriology 153: 163; and Hinnen et al., 1978, Proceedings of the National Academy of Sciences USA 75: 1920.

Methods of Production

[0224] The present invention also relates to methods for producing a polypeptide of the present invention, comprising (a) cultivating a cell, which in its wild-type form is capable of producing the polypeptide, under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide. Preferably, the cell is of the genus Trametes, Pachykytospora, or Leucopaxillus, and more preferably Trametes cingulata, Pachykytospora papyracea, or Leucopaxillus giganteus.

[0225] The present invention also relates to methods for producing a polypeptide of the present invention, comprising (a) cultivating a host cell under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.

[0226] The present invention also relates to methods for producing a polypeptide of the present invention, comprising (a) cultivating a host cell under conditions conducive for production of the polypeptide, wherein the host cell comprises a nucleotide sequence having the mature polypeptide coding region of SEQ ID NO: 1, 3, 4, 6, 23, 25, 36, 38, 39, 41, or 42, respectively, wherein the nucleotide sequence encodes a polypeptide which consists of amino acids 1 to 556 of SEQ ID NO: 2 or amino acids 1 to 561 of SEQ ID NO: 37, respectively; or amino acids 1 to 575 of SEQ ID NO: 5 or amino acids 1 to 565 of SEQ ID NO: 40, respectively; or amino acids 1 to 556 of SEQ ID NO: 26 or amino acids 1 to 548 of SEQ ID NO: 24 or amino acids 1 to 523 of SEQ ID NO: 43, respectively, and (b) recovering the polypeptide.

[0227] In the production methods of the present invention, the cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods well known in the art. For example, the cell may be cultivated by shake flask cultivation, and small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.

[0228] The polypeptides may be detected using methods known in the art that are specific for the polypeptides. These detection methods may include use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the polypeptide as described herein.

[0229] The resulting polypeptide may be recovered using methods known in the art. For example, the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.

[0230] The polypeptides of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

Plants

[0231] The present invention also relates to a transgenic plant, plant part, or plant cell which has been transformed with a nucleotide sequence encoding a polypeptide having glucoamylase activity of the present invention so as to express and produce the polypeptide in recoverable quantities. The polypeptide may be recovered from the plant or plant part. Alternatively, the plant or plant part containing the recombinant polypeptide may be used as such for improving the quality of a food or feed, e.g., improving nutritional value, palatability, and rheological properties, or to destroy an antinutritive factor.

[0232] The transgenic plant can be dicotyledonous (a dicot) or monocotyledonous (a monocot). Examples of monocot plants are grasses, such as meadow grass (blue grass, Poa), forage grass such as Festuca, Lolium, temperate grass, such as Agrostis, and cereals, e.g., wheat, oats, rye, barley, rice, sorghum, and maize (corn).

[0233] Examples of dicot plants are tobacco, legumes, such as lupins, potato, sugar beet, pea, bean and soybean, and cruciferous plants (family Brassicaceae), such as cauliflower, rape seed, and the closely related model organism Arabidopsis thaliana.

[0234] Examples of plant parts are stem, callus, leaves, root, fruits, seeds, and tubers as well as the individual tissues comprising these parts, e.g., epidermis, mesophyll, parenchyme, vascular tissues, meristems. Specific plant cell compartments, such as chloroplasts, apoplasts, mitochondria, vacuoles, peroxisomes and cytoplasm are also considered to be a plant part. Furthermore, any plant cell, whatever the tissue origin, is considered to be a plant part. Likewise, plant parts such as specific tissues and cells isolated to facilitate the utilisation of the invention are also considered plant parts, e.g., embryos, endosperms, aleurone and seeds coats.

[0235] Also included within the scope of the present invention are the progeny of such plants, plant parts, and plant cells.

[0236] The transgenic plant or plant cell expressing a polypeptide of the present invention may be constructed in accordance with methods known in the art. In short, the plant or plant cell is constructed by incorporating one or more expression constructs encoding a polypeptide of the present invention into the plant host genome and propagating the resulting modified plant or plant cell into a transgenic plant or plant cell.

[0237] The expression construct is conveniently a nucleic acid construct which comprises a polynucleotide encoding a polypeptide of the present invention operably linked with appropriate regulatory sequences required for expression of the nucleotide sequence in the plant or plant part of choice. Furthermore, the expression construct may comprise a selectable marker useful for identifying host cells into which the expression construct has been integrated and DNA sequences necessary for introduction of the construct into the plant in question (the latter depends on the DNA introduction method to be used).

[0238] The choice of regulatory sequences, such as promoter and terminator sequences and optionally signal or transit sequences, is determined, for example, on the basis of when, where, and how the polypeptide is desired to be expressed. For instance, the expression of the gene encoding a polypeptide of the present invention may be constitutive or inducible, or may be developmental, stage or tissue specific, and the gene product may be targeted to a specific tissue or plant part such as seeds or leaves. Regulatory sequences are, for example, described by Tague et al., 1988, Plant Physiology 86: 506.

[0239] For constitutive expression, the 35S-CaMV, the maize ubiquitin 1, and the rice actin 1 promoter may be used (Franck et al., 1980, Cell 21: 285-294, Christensen et al., 1992, Plant Mo. Biol. 18: 675-689; Zhang et al., 1991, Plant Cell 3: 1155-1165). Organ-specific promoters may be, for example, a promoter from storage sink tissues such as seeds, potato tubers, and fruits (Edwards & Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), or from metabolic sink tissues such as meristems (Ito et al., 1994, Plant Mol. Biol. 24: 863-878), a seed specific promoter such as the glutelin, prolamin, globulin, or albumin promoter from rice (Wu at al., 1998, Plant and Cell Physiology 39: 885-889), a Vicia faba promoter from the legumin B4 and the unknown seed protein gene from Vicia faba (Conrad et al., 1998, Journal of Plant Physiology 152: 708-711), a promoter from a seed oil body protein (Chen et al., 1998, Plant and Cell Physiology 39: 935-941), the storage protein napA promoter from Brassica napus, or any other seed specific promoter known in the art, e.g., as described in WO 91/14772. Furthermore, the promoter may be a leaf specific promoter such as the rbcs promoter from rice or tomato (Kyozuka et al., 1993, Plant Physiology 102: 991-1000, the chlorella virus adenine methyltransferase gene promoter (Mitra and Higgins, 1994, Plant Molecular Biology 26: 85-93), or the aldP gene promoter from rice (Kagaya et al., 1995, Molecular and General Genetics 248: 668-674), or a wound inducible promoter such as the potato pin2 promoter (Xu et al., 1993, Plant Molecular Biology 22: 573-588). Likewise, the promoter may inducible by abiotic treatments such as temperature, drought, or alterations in salinity or induced by exogenously applied substances that activate the promoter, e.g., ethanol, oestrogens, plant hormones such as ethylene, abscisic acid, and gibberellic acid, and heavy metals.

[0240] A promoter enhancer element may also be used to achieve higher expression of a polypeptide of the present invention in the plant. For instance, the promoter enhancer element may be an intron which is placed between the promoter and the nucleotide sequence encoding a polypeptide of the present invention. For instance, Xu et al., 1993, supra, disclose the use of the first intron of the rice actin 1 gene to enhance expression.

[0241] The selectable marker gene and any other parts of the expression construct may be chosen from those available in the art.

[0242] The nucleic acid construct is incorporated into the plant genome according to conventional techniques known in the art, including Agrobacterium-mediated transformation, virus-mediated transformation, microinjection, particle bombardment, biolistic transformation, and electroporation (Gasser et al., 1990, Science 244: 1293; Potrykus, 1990, Bio/Technology 8: 535; Shimamoto et al., 1989, Nature 338: 274).

[0243] Presently, Agrobacterium tumefaciens-mediated gene transfer is the method of choice for generating transgenic dicots (for a review, see Hooykas and Schilperoort, 1992, Plant Molecular Biology 19: 1538) and can also be used for transforming monocots, although other transformation methods are often used for these plants. Presently, the method of choice for generating transgenic monocots is particle bombardment (microscopic gold or tungsten particles coated with the transforming DNA) of embryonic calli or developing embryos (Christou, 1992, Plant Journal 2: 275-281; Shimamoto, 1994, Current Opinion Biotechnology 5: 158-162; Vasil et al., 1992, Bio/Technology 10: 667-674). An alternative method for transformation of monocots is based on protoplast transformation as described by Omirulleh et al., 1993, Plant Molecular Biology 21: 415-428.

[0244] Following transformation, the transformants having incorporated the expression construct are selected and regenerated into whole plants according to methods well-known in the art. Often the transformation procedure is designed for the selective elimination of selection genes either during regeneration or in the following generations by using, for example, co-transformation with two separate T-DNA constructs or site specific excision of the selection gene by a specific recombinase.

[0245] The present invention also relates to methods for producing a polypeptide of the present invention comprising (a) cultivating a transgenic plant or a plant cell comprising a polynucleotide encoding a polypeptide having glucoamylase activity of the present invention under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.

Compositions

[0246] The present invention also relates to compositions comprising a polypeptide of the present invention. Preferably, the compositions are enriched in such a polypeptide. The term "enriched" indicates that the glucoamylase activity of the composition has been increased, e.g., by an enrichment factor of 1.1.

[0247] The composition may comprise a polypeptide of the present invention as the major enzymatic component, e.g., a mono-component composition. Alternatively, the composition may comprise multiple enzymatic activities, such as an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cycliodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, haloperoxidase, invertase, laccase, lipase, mannosidase, oxidase, pectinolytic enzyme, peptidoglutaminase, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, or xylanase. The additional enzyme(s) may be produced, for example, by a microorganism belonging to the genus Aspergillus, preferably Aspergillus aculeatus, Aspertgillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae; Fusarium, preferably Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sulphureum, Fusarium toruiloseum, Fusarium trichothecioides, or Fusarium venenatum; Humicola, preferably Humicola insolens or Humicola lanuginosa; or Trichoderma, preferably Trichoderma harzianum, Trichoderma koningli, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride.

[0248] The polypeptide compositions may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry composition. For instance, the polypeptide composition may be in the form of a granulate or a microgranulate. The polypeptide to be included in the composition may be stabilized in accordance with methods known in the art.

Combination of Glucoamylase and Acid Alpha-Amylase

[0249] According to this aspect of the invention a glucoamylase of the invention may be combined with an acid alpha-amylase in a ratio of between 0.3 and 5.0 AFAU/AGU. More preferably the ratio between acid alpha-amylase activity and glucoamylase activity is at least 0.35, at least 0.40, at least 0.50, at least 0.60, at least 0.7, at least 0.8, at least 0.9, at least 1.0, at least 1.1, at least 1.2, at least 1.3, at least 1.4, at least 1.5, at least 1.6, at least 1.7, at least 1.8, at least 1.85, or even at least 1.9 AFAU/AGU. However, the ratio between acid alpha-amylase activity and glucoamylase activity should preferably be less than 4.5, less than 4.0, less than 3.5, less than 3.0, less than 2.5, or even less than 2.25 AFAU/AGU. In AUU/AGI the activities of acid alpha-amylase and glucoamylase are preferably present in a ratio of between 0.4 and 6.5 AUU/AGI. More preferably the ratio between acid alpha-amylase activity and glucoamylase activity is at least 0.45, at least 0.50, at least 0.60, at least 0.7, at least 0.8, at least 0.9, at least 1.0, at least 1.1, at least 1.2, at least 1.3, at least 1.4, at least 1.5, at least 1.6, at least 1.7, at least 1.8, at least 1.9, at least 2.0, at least 2.1, at least 2.2, at least 2.3, at least 2.4, or even at least 2.5 AUU/AGI. However, the ratio between acid alpha-amylase activity and glucoamylase activity is preferably less than 6.0, less than 5.5, less than 4.5, less than 4.0, less than 3.5, or even less than 3.0 AUU/AGI.

[0250] Above composition is suitable for use in a starch conversion process mentioned below for producing syrup and fermentation products such as ethanol.

[0251] Examples are given below of preferred uses of the polypeptide compositions of the invention. The dosage of the polypeptide composition of the invention and other conditions under which the composition is used may be determined on the basis of methods known in the art.

[0252] Combination of Trametes cingulata Glucoamylase with Another Glucoamylase and an Acid Alpha-Amylase

[0253] The Trametes cingulata glucoamylase of the invention have been found to have a 4-7 fold higher alpha-1,6-debranching activity than other glucoamylases, such as Athelia rolfsii, Aspergillus niger and Talaromyces emersonii (see Example 13).

[0254] Therefore, according to the invention the Trametes cingulata glucoamylase may be combined with acid alpha-amylase and further another glucoamylase. Such combination of enzymes would be suitable in processes comprises starch conversion, include ethanol production, including one step fermentation processes.

[0255] The alpha-amylase may be any alpha-amylase. In a preferred embodiment the alpha-amylase is any of those listed in the "Alpha-Amylase"-section below. In a preferred embodiment the alpha-amylase is a fungal alpha-amylase, especially those disclosed below in the "Fungal Alpha-Amylases"-section, especially the Aspergillus kawachii alpha-amylase. Preferred are also hybrid alpha-amylases disclosed below in the "Fungal hybrid alpha-amylase"-section below, including hybrids disclosed in U.S. Patent Publication no. 2005/0054071 (hybrids listed in Table 3 is especially contemplated), and further the hybrids disclosed in co-pending U.S. application No. 60/638,614, including especially the Fungamyl variant with catalytic domain JA118 and Athelia rolfsii SBD (SEQ ID NO: 28 herein and SEQ ID NO: 100 in U.S. 60/638,614); Rhizomucor pusillus alpha-amylase with Athelia rolfsii AMG linker and SBD (SEQ ID NO: 29 herein and SEQ ID NO: 101 in U.S. application No. 60/638,614); and Meripilus giganteus alpha-amylase with Athelia rolfsii glucoamylase linker and SBD (SEQ ID NO: 30 herein and SEQ ID NO: 102 in U.S. application No. 60/638,614).

[0256] The glucoamylase may be any glucoamylase, including glucoamylases of fungal or bacterial origin selected from the group consisting of Aspergillus glucoamylases, in particular A. niger G1 or G2 glucoamylase (Boel et al., 1984, EMBO J. 3 (5): 1097-1102), or variants thereof, such as disclosed in WO 92/00381, WO 00/04136 add WO 01/04273 (from Novozymes, Denmark); the A. awamori glucoamylase (WO 84/02921), A. oryzae (Agric. Biol. Chem., 1991, 55 (4): 941-949), or variants or fragments thereof. Other Aspergillus glucoamylase variants include variants to enhance the thermal stability: G137A and G139A (Chen et al., 1996, Prot. Eng. 9: 499-505); D257E and D293E/Q (Chen et al., 1995, Prot. Engng. 8: 575-582); N182 (Chen et al., 1994, Biochem. J. 301: 275-281); disulphide bonds, A246C (Fierobe et al., 1996, Biochemistry, 35: 8698-8704; and introduction of Pro residues in position A435 and S436 (Li et al., 1997, Protein Engng. 10: 1199-1204. Other glucoamylases include Corticium rolfsii glucoamylase (U.S. Pat. No. 4,727,046) also referred to as Athelia rolfsii, Talaromyces glucoamylases, in particular, derived from Talaromyces emersonii (WO 99/28448), Talaromyces leycettanus (U.S. Pat. No. Re. 32,153), Talaromyces duponti, Talaromyces thermophilus (U.S. Pat. No. 4,587,215), Rhizopus nivius (e.g., the enzyme available from Shin Nihon Chemicals, Japan, under the tradename "CU CONC"), Humicola grisea var. thermoidea (e.g., ATCC 16453, NRRL 15222, NRRL 15223, NRRL 15224, NRRL 15225).

[0257] Bacterial glucoamylases contemplated include glucoamylases from the genus Clostridium, in particular C. thermoamylolyticum (EP 135,138), and C. thermohydrosulfuricum (WO 86/01831).

[0258] Examples of commercially available compositions comprising other glucoamylase include AMG 200L; AMG 300 L; SAN.TM. SUPER, SAN.TM. EXTRA L, SPIRIZYME.TM. PLUS, SPIRIZYME.TM. FUEL, SPIRIZYME.TM. B4U and AMG.TM. E (from Novozymes A/S); OPTIDEX.TM. 300 (from Genencor Int.); AMIGASE.TM. and AMIGASE.TM. PLUS (from DSM); G-ZYME.TM. G900, G-ZYME.TM. and G990 ZR (from Genencor Int.).

[0259] In a specific embodiment the Trametes cingulata glucoamylase of the invention is combined with glucoamylase derived from one of Aspergillus niger, Athea rolfsii, or Talaromyces emersonii and the Rhizomucor pusillus alpha-amylase with Athelia rolfsii AMG linker and SBD (SEQ ID NO: 29 herein and SEQ ID NO: 101 in U.S. application No. 60/638,614).

Uses

[0260] The present invention is also directed to process/methods for using the polypeptides having glucoamylase activity of the invention.

[0261] Uses according to the invention include starch conversion of starch to e.g., syrup and fermentation products, including ethanol and beverages. Examples of processes where a glucoamylase of the invention may be used include the ones described in: WO 2004/081193, WO 2004/080923, WO 2003/66816, WO 2003166826, and WO 92/20777 which are hereby all incorporated by reference.

Production of Fermentation Products

Processes for Producing Fermentation Products from Gelatinized Starch-Containing Material

[0262] In this aspect the present invention relates to a process for producing a fermentation product, especially ethanol, from starch-containing material, which process includes a liquefaction step and separately or simultaneously performed saccharification and fermentation step(s).

[0263] The invention relates to a process for producing a fermentation product from starch-containing material comprising the steps of:

[0264] (a) liquefying starch-containing material in the presence of an alpha-amylase;

[0265] (b) saccharifying the liquefied material obtained in step (a) using a glucoamylase of the invention;

[0266] (c) fermenting the saccharified material using a fermenting organism.

[0267] The fermentation product, such as especially ethanol, may optionally be recovered after fermentation, e.g., by distillation. Suitable starch-containing starting materials are listed in the section "Starch-containing materials"-section below. Contemplated enzymes are listed in the "Enzymes"-section below. The fermentation is preferably carried out in the presence of yeast, preferably a strain of Saccharomyces. Suitable fermenting organisms are listed in the "Fermenting Organisms"-section below. In a preferred embodiment step (b) and (c) are carried out simultaneously (SSF process).

[0268] In a particular embodiment, the process of the invention further comprises, prior to the step (a), the steps of:

[0269] x) reducing the particle size of the starch-containing material, preferably by milling;

[0270] y) forming a slurry comprising the starch-containing material and water.

[0271] The aqueous slurry may contain from 10-40 wt-%, preferably 25-35 wt-% starch-containing material. The slurry is heated to above the gelatinization temperature and alpha-amylase, preferably bacterial and/or acid fungal alpha-amylase, may be added to initiate liquefaction (thinning). The slurry may in an embodiment be jet-cooked to further gelatinize the slurry before being subjected to an alpha-amylase in step (a) of the invention.

[0272] More specifically liquefaction may be carried out as a three-step hot slurry process. The slurry is heated to between 60-95.degree. C., preferably 80-85.degree. C., and alpha-amylase is added to initiate liquefaction (thinning). Then the slurry may be jet-cooked at a temperature between 95-140.degree. C., preferably 105-125.degree. C., for 1-15 minutes, preferably for 3-10 minutes, especially around 5 minutes. The slurry is cooled to 60-95.degree. C. and more alpha-amylase is added to finalize hydrolysis (secondary liquefaction). The liquefaction process is usually carried out at pH 4.5-6.5, in particular at a pH between 5 and 6. Milled and liquefied whole grains are known as mash.

[0273] The saccharification in step (b) may be carried out using conditions well know in the art. For instance, a full saccharification process may lasts up to from about 24 to about 72 hours, however, it is common only to do a pre-saccharification of typically 40-90 minutes at a temperature between 30-65.degree. C., typically about 60.degree. C., followed by complete saccharification during fermentation in a simultaneous saccharification and fermentation process (SSF).

[0274] Saccharification is typically carried out at temperatures from 30-65.degree. C., typically around 60.degree. C., and at a pH between 4 and 5, normally at about pH 4.5.

[0275] The most widely used process in ethanol production is the simultaneous saccharification and fermentation (SSF) process, in which there is no holding stage for the saccharification, meaning that fermenting organism, such as yeast, and enzyme(s) may be added together.

[0276] When doing SSF it is common to introduce a pre-saccharification step at a temperature above 50.degree. C., just prior to the fermentation.

[0277] In accordance with the present invention the fermentation step (c) includes, without limitation, fermentation processes used to produce alcohols (e.g., ethanol, methanol, butanol); organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); gases (e.g., H.sub.2 and CO.sub.2); antibiotics (e.g., penicillin and tetracycline); enzymes; vitamins (e.g., riboflavin, B12, beta-carotene); and hormones. Preferred fermentation processes include alcohol fermentation processes, as are well known in the art. Preferred fermentation processes are anaerobic fermentation processes, as are well known in the art.

Processes for Producing Fermentation Products from Un-Gelatinized Starch-Containing

[0278] In this aspect the invention relates to processes for producing a fermentation product from starch-containing material without gelatinization of the starch-containing material. In one embodiment only a glucoamylase of the invention is used during saccharification and fermentation. According to the invention the desired fermentation product, such as ethanol, can be produced without liquefying the aqueous slurry containing the starch-containing material. In one embodiment a process of the invention includes saccharifying milled starch-containing material below the gelatinization temperature in the presence of a glucoamylase of the invention to produce sugars that can be fermented into the desired fermentation product by a suitable fermenting organism.

[0279] Examples 8 and 9 below disclose production of ethanol from un-gelatinized (uncooked) milled corn using glucoamylases of the invention derived from Trametes cingulata and Pachykytospora papyracea. Both glucoamylases show significantly higher ethanol yields compared to corresponding processes carried out using glucoamylases derived from Aspergillus niger or Talaromyces emersonii, respectively.

[0280] Accordingly, in this aspect the invention relates to a process for producing a fermentation product from starch-containing material comprising:

[0281] (a) saccharifying starch-containing material with a glucoamylase having [0282] i) the sequence shown as amino acids 1 to 556 in SEQ ID NO: 2 or amino acids 1 to 561 in SEQ ID NO: 37, or a glucoamylase having at least 75% identity thereto, and/or [0283] ii) the sequence shown as amino acids 1 to 575 in SEQ ID NO: 5 or amino acids 1 to 565 in SEQ ID NO: 40, or a glucoamylase having at least 70% identity thereto, and/or [0284] iii) the sequence shown as amino acids 1 to 548 in SEQ ID NO: 24 or amino acids 1 to 556 in SEQ ID NO: 26 or amino acids 1 to 523 in SEQ ID NO: 43, or a glucoamylase having at least 60% identity thereto, at a temperature below the initial gelatinization temperature of said starch-containing material,

[0285] (b) fermenting using a fermenting organism.

[0286] Steps (a) and (b) of the process of the invention may be carried out sequentially or simultaneously.

[0287] The term "initial gelatinization temperature" means the lowest temperature at which gelatinization of the starch commences. Starch heated in water begins to gelatinize between 50.degree. C. and 75.degree. C.; the exact temperature of gelatinization depends on the specific starch, and can readily be determined by the skilled artisan. Thus, the initial gelatinization temperature may vary according to the plant species, to the particular variety of the plant species as well as with the growth conditions. In the context of this invention the initial gelatinization temperature of a given starch-containing material is the temperature at which birefringence is lost in 5% of the starch granules using the method described by Gorinstein and Lii, 1992, Starch/Starke 44 (12): 461-466.

[0288] Before step (a) a slurry of starch-containing material, such as granular starch, having 20-55 wt.-% dry solids, preferably 25-40 wt.-% dry solids, more preferably 30-35% dry solids of starch-containing material may be prepared. The slurry may include water and/or process waters, such as stillage (backset), scrubber water, evaporator condensate or distillate, side stripper water from distillation, or other fermentation product plant process water. Because the process of the invention is carried out below the gelatinization temperature and thus no significant viscosity increase takes place, high levels of stillage may be used if desired. In an embodiment the aqueous slurry contains from about 1 to about 70 vol.-% stillage, preferably 15-60% vol.-% stillage, especially from about 30 to 50 vol.-% stillage.

[0289] The starch-containing material may be prepared by reducing the particle size, preferably by milling, to 0.05 to 3.0 mm, preferably 0.1-0.5 mm. After being subjected to a process of the invention at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or preferably at least 99% of the dry solids of the starch-containing material is converted into a soluble starch hydrolysate.

[0290] The process of the invention is conducted at a temperature below the initial gelatinization temperature. Preferably the temperature at which step (a) is carried out is between 30-75.degree. C., preferably between 45-60.degree. C.

[0291] In a preferred embodiment step (a) and step (b) are carried out as a simultaneous saccharification and fermentation process. In such preferred embodiment the process is typically carried at a temperature between 28.degree. C. and 36.degree. C., such as between 29.degree. C. and 35.degree. C., such as between 30.degree. C. and 34.degree. C., such as around 32.degree. C. According to the invention the temperature may be adjusted up or down during fermentation.

[0292] In an embodiment simultaneous saccharification and fermentation is carried out so that the sugar level, such as glucose level, is kept at a low level such as below 6 wt.-%, preferably below about 3 wt.-%, preferably below about 2 wt.-%, more preferred below about 1 wt.-%, even more preferred below about 0.5%, or even more preferred 0.25% wt.-%, such as below about 0.1 wt.-%. Such low levels of sugar can be accomplished by simply employing adjusted quantities of enzyme and fermenting organism. A skilled person in the art can easily determine which quantities of enzyme and fermenting organism to use. The employed quantities of enzyme and fermenting organism may also be selected to maintain low concentrations of maltose in the fermentation broth. For instance, the maltose level may be kept below about 0.5 wt.-% or below about 0.2 wt.-%.

[0293] The process of the invention may be carried out at a pH in the range between 3 and 7, preferably from pH 3.5 to 6, or more preferably from pH 4 to 5.

Starch-Containing Materials

[0294] Any suitable starch-containing starting material, including granular starch, may be used according to the present invention. The starting material is generally selected based on the desired fermentation product. Examples of starch-containing starting materials, suitable for use in a process of present invention, include tubers, roots, stems, whole grains, corms, cobs, wheat, barley, rye, milo, sago, cassaya, tapioca, sorghum, rice peas, beans, or sweet potatoes, or mixtures thereof, or cereals, sugar-containing raw materials, such as molasses, fruit materials, sugar cane or sugar beet, potatoes, and cellulose-containing materials, such as wood or plant residues, or mixtures thereof. Contemplated are both waxy and non-waxy types of corn and barley.

[0295] The term "granular starch" means raw uncooked starch, i.e., starch in its natural form found in cereal, tubers or grains. Starch is formed within plant cells as tiny granules insoluble in water. When put in cold water, the starch granules may absorb a small amount of the liquid and swell. At temperatures up to 50.degree. C. to 75.degree. C. the swelling may be reversible. However, with higher temperatures an irreversible swelling called "gelatinization" begins. Granular starch to be processed may be a highly refined starch quality, preferably at least 90%, at least 95%, at least 97% or at least 99.5% pure or it may be a more crude starch containing material comprising milled whole grain including non-starch fractions such as germ residues and fibers. The raw material, such as whole grain, is milled in order to open up the structure and allowing for further processing. Two milling processes are preferred according to the invention: wet and dry milling. In dry milling whole kernels are milled and used. Wet milling gives a good separation of germ and meal (starch granules and protein) and is often applied at locations where the starch hydrolysate is used in production of syrups. Both dry and wet milling is well known in the art of starch processing and is equally contemplated for the process of the invention.

[0296] The starch-containing material is reduced in size, preferably by milling, in order to expose more surface area. In an embodiment the particle size is between 0.05 to 3.0 mm, preferably 0.1-0.5 mm, or so that at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90% of the milled starch-containing material fit through a sieve with a 0.05 to 3.0 mm screen, preferably 0.1-0.5 mm screen.

Fermentation Products

[0297] The term "fermentation product" means a product produced by a process including a fermentation step using a fermenting organism. Fermentation products contemplated according to the invention include alcohols (e.g., ethanol, methanol, butanol); organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); gases (e.g., H.sub.2 and CO.sub.2); antibiotics (e.g., penicillin and tetracydine); enzymes; vitamins (e.g., riboflavin, B.sub.12, beta-carotene); and hormones. In a preferred embodiment the fermentation product is ethanol, e.g., fuel ethanol; drinking ethanol, i.e., potable neutral spirits; or industrial ethanol or products used in the consumable alcohol industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), leather industry and tobacco industry. Preferred beer types comprise ales, stouts, porters, lagers, bitters, malt liquors, happoushu, high-alcohol beer, low-alcohol beer, low-calorie beer or light beer. Preferred fermentation processes used include alcohol fermentation processes, as are well known in the art. Preferred fermentation processes are anaerobic fermentation processes, as are well known in the art.

Fermenting Organisms

[0298] "Fermenting organism" refers to any organism, including bacterial and fungal organisms, suitable for use in a fermentation process and capable of producing desired a fermentation product. Especially suitable fermenting organisms are able to ferment, i.e., convert, sugars, such as glucose or maltose, directly or indirectly into the desired fermentation product, Examples of fermenting organisms include fungal organisms, such as yeast. Preferred yeast includes strains of Saccharomyces spp., in particular, Saccharomyces cerevisiae. Commercially available yeast include, e.g., Red Star.TM./Lesaffre Ethanol Red (available from Red Star/Lesaffre, USA) FALI (available from Fleischmann's Yeast, a division of Burns Philp Food Inc., USA), SUPERSTART (available from Alitech), GERT STRAND (available from Gert Strand AB, Sweden) and FERMIOL (available from DSM Specialties).

Enzymes

Glucoamylase

[0299] The glucoamylase is preferably a glucoamylase of the invention. However, as mentioned above a glucoamylase of the invention may also be combined with other glucoamylases.

[0300] The glucoamylase may added in an amount of 0.001 to 10 AGU/g DS, preferably from 0.01 to 5 AGU/g DS, such as around 0.1, 0.3, 0.5, 1 or 2 AGU/g DS, especially 0.1 to 0.5 AGU/g DS or 0.02-20 AGU/g DS, preferably 0.1-10 AGU/g DS.

[0301] Alpha-Amylase

[0302] The alpha-amylase may according to the invention be of any origin. Preferred are alpha-amylases of fungal or bacterial origin.

[0303] In a preferred embodiment the alpha-amylase is an acid alpha-amylase, e.g., fungal acid alpha-amylase or bacterial acid alpha-amylase. The term "acid alpha-amylase" means an alpha-amylase (E.C. 3.2.1.1) which added in an effective amount has activity optimum at a pH in the range of 3 to 7, preferably from 3.5 to 6, or more preferably from 4-5.

Bacterial Alpha-Amylases

[0304] According to the invention a bacterial alpha-amylase may preferably be derived from the genus Bacillus.

[0305] In a preferred embodiment the Bacillus alpha-amylase is derived from a strain of B. licheniformis, B. amyloliquefaciens, B. subtilis or B. stearothermophilus, but may also be derived from other Bacillus sp. Specific examples of contemplated alpha-amylases include the Bacillus licheniformis alpha-amylase (BLA) shown in SEQ ID NO: 4 in WO 99/19467, the Bacillus amyloliquefaciens alpha-amylase (BAN) shown in SEQ ID NO: 5 in WO 99/19467, and the Bacillus stearothermophilus alpha-amylase (BSG) shown in SEQ ID NO: 3 in WO 99/19467. In an embodiment of the invention the alpha-amylase is an enzyme having a degree of identity of at least 60%, preferably at least 70%, more preferred at least 80%, even more preferred at least 90%, such as at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to any of the sequences shown as SEQ ID NOS: 1, 2, 3, 4, or 5, respectively, in WO 99/19467.

[0306] The Bacillus alpha-amylase may also be a variant and/or hybrid, especially one described in any of WO 96/23873, WO 96/23874, WO 97/41213, WO 99/19467, WO 00/60059, and WO 02/10355 (all documents hereby incorporated by reference). Specifically contemplated alpha-amylase variants are disclosed in U.S. Pat. Nos. 6,093,562, 6,297,038 or U.S. Pat. No. 6,187,576 (hereby incorporated by reference) and include Bacillus stearothermophilus alpha-amylase (BSG alpha-amylase) variants having a deletion of one or two amino acids in position 179 to 182, preferably a double deletion disclosed in WO 1996/023873--see e.g., page 20, lines 1-10 (hereby incorporated by reference), preferably corresponding to delta (181-182) compared to the wild-type BSG alpha-amylase amino acid sequence set forth in SEQ ID NO: 3 disclosed in WO 99/19467 or deletion of amino acids 179 and 180 using SEQ ID NO: 3 in WO 99/19467 for numbering (which reference is hereby incorporated by reference). Even more preferred are Bacillus alpha-amylases, especially Bacillus stearothermophilus alpha-amylase, which have a double deletion corresponding to delta (181-182) and further comprise a N193F substitution (also denoted I181*+G182*+N193F) compared to the wild-type BSG alpha-amylase amino acid sequence set forth in SEQ ID NO: 3 disclosed in WO 99/19467.

[0307] The alpha-amylase may also be a maltogenic alpha-amylase. A "maltogenic alpha-amylase" (glucan 1,4-alpha-maltohydrolase, E.C. 3.2.1.133) is able to hydrolyze amylose and amylopectin to maltose in the alpha-configuration. A maltogenic alpha-amylase from Bacillus stearothermophilus strain NCIB 11837 is commercially available from Novozymes A/S, Denmark. The maltogenic alpha-amylase is described in U.S. Pat. Nos. 4,598,048, 4,604,355 and 6,162,628, which are hereby incorporated by reference.

Bacterial Hybrid Alpha-Amylases

[0308] A hybrid alpha-amylase specifically contemplated comprises 445 C-terminal amino acid residues of the Bacillus licheniformis alpha-amylase (shown as SEQ ID NO: 4 in WO 99/19467) and the 37 N-terminal amino acid residues of the alpha-amylase derived from Bacillus amyloliquefaciens (shown as SEQ ID NO: 3 in WO 99/194676), with one or more, especially all, of the following substitutions:

[0309] G48A+T49I+G107A+H156Y+A181T+N190F+I201F+A209V+Q264S (using the Bacillus licheniformis numbering). Also preferred are variants having one or more of the following mutations (or corresponding mutations in other Bacillus alpha-amylase backbones): H154Y, A181T, N190F, A209V and Q264S and/or deletion of two residues between positions 176 and 179, preferably deletion of E178 and G179 (using the SEQ ID NO: 5 numbering of WO 99/19467).

[0310] The bacterial alpha-amylase may be added in amounts as are well-known in the art. When measured in KNU units (described below in the "Materials & Methods"-section) the alpha-amylase activity is preferably present in an amount of 0.5-5,000 NU/g of DS, in an amount of 1-500 NU/g of DS, or more preferably in an amount of 51,000 NU/g of DS, such as 10-100 NU/g DS.

Fungal Alpha-Amylases

[0311] Fungal acid alpha-amylases include acid alpha-amylases derived from a strain of the genus Aspergillus, such as Aspergillus oryzae, Aspergillus niger, Aspergillus kawachii alpha-amylases.

[0312] A preferred acid fungal alpha-amylase is a Fungamyl-like alpha-amylase which is preferably derived from a strain of Aspergillus oryzae. In the present disclosure, the term "Fungamyl-like alpha-amylase" indicates an alpha-amylase which exhibits a high identity, i.e., more than 70%, more than 75%, more than 80%, more than 85% more than 90%, more than 95%, more than 96%, more than 97%, more than 98%, more than 99% or even 100% identity to the mature part of the amino acid sequence shown in SEQ ID NO: 10 in WO 96/23874.

[0313] Another preferred acid alpha-amylase is derived from a strain Aspergillus niger. In a preferred embodiment the acid fungal alpha-amylase is the one from A. niger disclosed as "AMYA_ASPNG" in the Swiss-prot/TeEMBL database under the primary accession no. P56271 and described in more detail in WO 89/01969 (Example 3). The acid Aspergillus niger acid alpha-amylase is also shown as SEQ ID NO: 1 in WO 2004/080923 (Novozymes) which is hereby incorporated by reference. Also variants of said acid fungal amylase having at least 70% identity, such as at least 80% or even at least 90% identity, such as at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 1 in WO 2004/080923 are contemplated. A suitable commercially available acid fungal alpha-amylase derived from Aspergillus niger is SP288 (available from Novozymes A/S, Denmark).

[0314] In a preferred embodiment the alpha-amylase is derived from Aspergillus kawachii and disclosed by Kaneko et al., 1996, J. Ferment. Bioeng. 81: 292-298, "Molecular-cloning and determination of the nucleotide-sequence of a gene encoding an acid-stable alpha-amylase from Aspergillus kawachii"; and further as EMBL:#AB008370.

[0315] The fungal acid alpha-amylase may also be a wild-type enzyme comprising a carbohydrate-binding module (CBM) and an alpha-amylase catalytic domain (i.e., a none-hybrid), or a variant thereof. In an embodiment the wild-type acid alpha-amylase is derived from a strain of Aspergillus kawachii.

Fungal Hybrid Alpha-Amylases

[0316] In a preferred embodiment the fungal acid alpha-amylase is a hybrid alpha-amylase. Preferred examples of fungal hybrid alpha-amylases include the ones disclosed in WO 2005/003311 or U.S. Patent Publication no. 2005/0054071 (Novozymes) or U.S. patent application No. 60/638,614 (Novozymes) which is hereby incorporated by reference. A hybrid alpha-amylase may comprise an alpha-amylase catalytic domain (CD) and a carbohydrate-binding domain/module (CBM) and optional a linker.

[0317] Specific examples of contemplated hybrid alpha-amylases include those disclosed in U.S. patent application No. 60/638,614 including Fungamyl variant with catalytic domain JA118 and Athelia rolfsii SBD (SEQ ID NO: 28 herein and SEQ ID NO: 100 in U.S. application No. 60/638,614), Rhizomucor pusillus alpha-amylase with Athelia rolfsii AMG linker and SBD (SEQ ID NO: 29 herein and SEQ ID NO: 101 in U.S. application No. 60/638,614) and Meripilus giganteus alpha-amylase with Athelia rolfsii glucoamylase linker and SBD (SEQ ID NO: 30 herein and SEQ ID NO: 102 in U.S. application No. 60/638,614).

[0318] Other specific examples of contemplated hybrid alpha-amylases include those disclosed in U.S. Patent Application Publication no. 2005/0054071, including those disclosed in Table 3 on page 15, such as Aspergillus niger alpha-amylase with Aspergillus kawachii linker and starch binding domain.

Commercial Alpha-Amylase Products

[0319] Preferred commercial compositions comprising alpha-amylase include MYCOLASE from DSM (Gist Brocades), BAN.TM., TERMAMYL.TM. SC, FUNGAMYL.TM., LIQUOZYME.TM. X and SAN.TM. SUPER, SAN.TM. EXTRA L (Novozymes A/S) and CLARASE.TM. L-40,000, DEX-LO.TM., SPEZYME.TM. FRED, SPEZYME.TM. AA, and SPEZYME.TM. DELTA M (Genencor Int.), and the acid fungal alpha-amylase sold under the trade name SP288 (available from Novozymes A/S, Denmark).

[0320] An acid alpha-amylases may according to the invention be added in an amount of 0.1 to 10 AFAU/g DS, preferably 0.10 to 5 AFAU/g DS, especially 0.3 to 2 AFAU/g DS.

Production of Syrup

[0321] The present invention also provides a process of using a glucoamylase of the invention for producing syrup, such as glucose and the like, from starch-containing material. Suitable starting materials are exemplified in the "Starch-containing materials"-section above. Generally, the process comprises the steps of partially hydrolyzing starch-containing material (liquefaction) in the presence of alpha-amylase and then further saccharifying the release of glucose from the non-reducing ends of the starch or related oligo- and polysaccharide molecules in the presence of glucoamylase of the invention.

[0322] Liquefaction and saccharification may be carried our as described above for fermentation product production.

[0323] The glucoamylase of the invention may also be used in immobilized form. This is suitable and often used for producing speciality syrups, such as maltose syrups, and further for the raffinate stream of oligosaccharides in connection with the production of fructose syrups, e.g., high fructose syrup (HFS).

[0324] Consequently, this aspect of the invention relates to a process of producing syrup from starch-containing material, comprising

[0325] (a) liquefying starch-containing material in the presence of an alpha-amylase,

[0326] (b) saccharifying the material obtained in step (a) using a glucoamylase of the invention.

[0327] A syrup may be recovered from the saccharified material obtained in step (b).

[0328] Details on suitable conditions can be found above.

Brewing

[0329] A glucoamylase of the invention can also be used in a brewing process. The glucoamylases of the invention is added in effective amounts which can be easily determined by the skilled person in the art. For instance, in the production of "low carb" or super attenuated beers, a higher proportion of alcohol and a lower amount of residual dextrin are desired. These beers are formulated using exogenous enzymes compositions comprising enzyme activities capable of debranching the limit dextrins. A glucoamylase of the invention, preferably Trametes cingulata, may be applied to reduce the content of limit dextrins as well as hydrolyzing the alpha-1,4 bonds.

[0330] The invention described and claimed herein is not to be limited in scope by the specific embodiments herein disclosed, since these embodiments are intended as illustrations of several aspects of the invention. Any equivalent embodiments are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and de-scribed herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the case of conflict, the present disclosure including definitions will control.

[0331] Various references are cited herein, the disclosures of which are incorporated by reference in their entireties. The present invention is further described by the following examples which should not be construed as limiting the scope of the invention.

Materials & Methods

Glucoamylases:

[0332] Glucoamylase derived from Trametes cingulata disclosed in SEQ ID NO: 2 and available from Novozymes A/S.

[0333] Glucoamylase derived from Pachykytospora papyraceae disclosed in SEQ ID NO: 5 and available from Novozymes A/S.

[0334] Glucoamylase derived from Leucopaxillus giganteus disclosed in SEQ ID NO: 24 and available from Novozymes A/S.

[0335] Glucoamylase derived from Aspergillus niger disclosed in Boel et al., 1984, EMBO J. 3 (5): 1097-1102 and available from Novozymes A/S.

[0336] Glucoamylase derived from Talaromyces emersonii disclosed in WO 99/28448 and available from Novozymes A/S.

[0337] Enzymes for DNA manipulations (e.g., restriction endonucleases, ligases etc.) are obtainable from New England Biolabs, Inc. and were used according to the manufacturer's instructions.

Alpha-Amylase:

[0338] Hybrid Alpha-Amylase A: Rhizomucor pusillus alpha-amylase with Athelia rolfsii glucoamylase linker and SBD disclosed in U.S. patent application No. 60/638,614 and SEQ ID NO: 29.

Yeast: Red Star.TM. available from Red Star/Lesaffre, USA

Microbial Strains

[0339] E. coli DH12alpha (GIBCO BRL, Life Technologies, USA)

[0340] Aspergillus oryzae IFO 4177 is available from Institute for Fermentation, Osaka (IFO) Culture Collection of Microorganisms, 17-85, Juso-honmachi, 2-chome, Yodogawa-ku, Osaka 532-8686, Japan.

[0341] Aspergillus oryzae BECh-2 is described in WO 2000/39322 (Novozymes). It is a mutant of JaL228 (described in WO 98/12300) which is a mutant of IFO 4177.

[0342] Aspergillus niger strain Mbin119 is described in WO 2004/090155 (see Example 12).

Other Materials

[0343] Pullulan available from Wako Pure Chemical (Japan).

Deposit of Biological Material

[0344] The following biological material has been deposited under the terms of the Budapest Treaty at Deutshe Sammmlung von Microorganismen und Zellkulturen GmbH (DSMZ), Mascheroder Weg 1b, D-38124 Braunschweig DE, and given the following accession number: TABLE-US-00002 Deposit Accession Number Date of Deposit Escherichia coli NN049798 DSM 17106 2 Feb. 2005 Escherichia coli NN049797 DSM 17105 2 Feb. 2005

[0345] The strain has been deposited under conditions that assure that access to the culture will be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 C.F.R. .sctn.1.14 and 35 U.S.C. .sctn.122. The deposit represents a substantially pure culture of the deposited strain. The deposit is available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.

Media and Reagents:

[0346] Chemicals used as buffers and substrates were commercial products of at least reagent grade.

PDA2: 39 g/L Potato Dextrose Agar, 20 g/L agar, 50 mL glycerol

Cove: 342.3 g/L Sucrose, 20 ml/L COVE salt solution, 10 mM Acetamide, 30 g/L noble agar.

Cove salt solution: per liter 26 g KCl, 26 g MgSO.sub.4-7 aq, 76 g KH.sub.2PO.sub.4, 50 ml Cove trace metals.

Cove trace metals: per liter 0.04 g NaB407-10 aq, 0.4 g CuSO4-5 aq, 1.2 g FeSO.sub.4-7 aq, 0.7 g MnSO.sub.4-aq, 0.7 g Na.sub.2MoO.sub.2-2 aq, 0.7 g ZnSO.sub.4-7 aq.

YPG: 4 g/L Yeast extract, 1 g/L KH2PO4, 0.5 g/L MgSO.sub.4-7 aq, 5 g/L Glucose, pH 6.0.

STC: 0.8 M Sorbitol, 25 mM Tris pH 8, 25 mM CaCl.sub.2.

STPC: 40% PEG4000 in STC buffer.

Cove top agarose: 342.3 g/L Sucrose, 20 ml/L COVE salt solution, 10 mM Acetamide, 10 g/L low melt agarose.

MS-9: per liter 30 g soybean powder, 20 g glycerol, pH 6.0.

MDU-pH5: per liter 45 g maltose-1 aq, 7 g yeast extract, 12 g KH.sub.2PO.sub.4, 1 g MgSO.sub.4-7 aq, 2 g K.sub.2SO.sub.4, 0.5 ml AMG trace metal solution and 25 g 2-morpholinoethanesulfonic acid, pH 5.0.

Methods

[0347] Unless otherwise stated, DNA manipulations and transformations were performed using standard methods of molecular biology as described in Sambrook et al., 1989, Molecular cloning: A laboratory manual, Cold Spring Harbor lab., Cold Spring Harbor, N.Y.; Ausubel, F. M. et al. (eds.) "Current protocols in Molecular Biology", John Wiley and Sons, 1995; Harwood, C. R., and Cutting, S. M. (eds.) "Molecular Biological Methods for Bacillus". John Wiley and Sons, 1990.

Glucoamylase Activity

[0348] Glucoamylase activity may be measured in AGI units or in Glucoamylase Units (AGU).

Glucoamylase Activity (AGI)

[0349] Glucoamylase (equivalent to amyloglucosidase) converts starch into glucose. The amount of glucose is determined here by the glucose oxidase method for the activity determination. The method described in the section 76-11 Starch--Glucoamylase Method with Subsequent Measurement of Glucose with Glucose Oxidase in "Approved methods of the American Association of Cereal Chemists". Vol. 1-2 AACC, from American Association of Cereal Chemists, (2000); ISBN: 1-891127-12-8.

[0350] One glucoamylase unit (AGI) is the quantity of enzyme which will form 1 micro mole of glucose per minute under the standard conditions of the method.

[0351] Standard Conditions/Reaction Conditions: TABLE-US-00003 Substrate: Soluble starch, concentration approx. 16 g dry matter/L. Buffer: Acetate, approx. 0.04 M, pH = 4.3 pH: 4.3 Incubation temperature: 60.degree. C. Reaction time: 15 minutes Termination of the reaction: NaOH to a concentration of approximately 0.2 g/L (pH.about.9) Enzyme concentration: 0.15-0.55 AAU/mL.

[0352] The starch should be Lintner starch, which is a thin-boiling starch used in the laboratory as calorimetric indicator. Lintner starch is obtained by dilute hydrochloric acid treatment of native starch so that it retains the ability to color blue with iodine.

Glucoamylase Activity (AGU)

[0353] The Novo Glucoamylase Unit (AGU) is defined as the amount of enzyme, which hydrolyzes 1 micromole maltose per minute under the standard conditions 37.degree. C., pH 4.3, substrate: maltose 23.2 mM, buffer: acetate 0.1 M, reaction time 5 minutes.

[0354] An autoanalyzer system may be used. Mutarotase is added to the glucose dehydrogenase reagent so that any alpha-D-glucose present is turned into beta-D-glucose. Glucose dehydrogenase reacts specifically with beta-D-glucose in the reaction mentioned above, forming NADH which is determined using a photometer at 340 nm as a measure of the original glucose concentration. TABLE-US-00004 AMG incubation: Substrate: maltose 23.2 mM Buffer: acetate 0.1 M pH: 4.30 .+-. 0.05 Incubation temperature: 37.degree. C. .+-. 1 Reaction time: 5 minutes Enzyme working range: 0.5-4.0 AGU/mL Color reaction: GlucDH: 430 U/L Mutarotase: 9 U/L NAD: 0.21 mM Buffer: phosphate 0.12 M; 0.15 M NaCl pH: 7.60 .+-. 0.05 Incubation temperature: 37.degree. C. .+-. 1 Reaction time: 5 minutes Wavelength: 340 nm

[0355] A folder (EB-SM-0131.02/01) describing this analytical method in more detail is available on request from Novozymes A/S, Denmark, which folder is hereby included by reference.

Alpha-Amylase Activity (KNU)

[0356] The alpha-amylase activity may be determined using potato starch as substrate. This method is based on the break-down of modified potato starch by the enzyme, and the reaction is followed by mixing samples of the starch/enzyme solution with an iodine solution. Initially, a blackish-blue color is formed, but during the break-down of the starch the blue color gets weaker and gradually turns into a reddish-brown, which is compared to a colored glass standard.

[0357] One Kilo Novo alpha amylase Unit (KNU) is defined as the amount of enzyme which, under standard conditions (i.e., at 37.degree. C.+/-0.05; 0.0003 M Ca.sup.2+; and pH 5.6) dextrinizes 5260 mg starch dry substance Merck Amylum solubile.

[0358] A folder EB-SM-0009.02/01 describing this analytical method in more detail is available upon request to Novozymes A/S, Denmark, which folder is hereby included by reference.

Acid Alpha-Amylase Activity

[0359] When used according to the present invention the activity of any acid alpha-amylase may be measured in AFAU (Acid Fungal Alpha-amylase Units). Alternatively activity of acid alpha-amylase may be measured in MU (Acid Alpha-amylase Units).

Acid Alpha-Amylase Units (AAU)

[0360] The acid alpha-amylase activity can be measured in AAU (Acid Alpha-amylase Units), which is an absolute method. One Acid Amylase Unit (AAU) is the quantity of enzyme converting 1 g of starch (100% of dry matter) per hour under standardized conditions into a product having a transmission at 620 nm after reaction with an iodine solution of known strength equal to the one of a color reference.

[0361] Standard Conditions/Reaction Conditions: TABLE-US-00005 Substrate: Soluble starch. Concentration approx. 20 g DS/L. Buffer: Citrate, approx. 0.13 M, pH = 4.2 Iodine solution: 40.176 g potassium iodide + 0.088 g iodine/L City water 15.degree.-20.degree.dH (German degree hardness) pH: 4.2 Incubation temperature: 30.degree. C. Reaction time: 11 minutes Wavelength: 620 nm Enzyme concentration: 0.13-0.19 AAU/mL Enzyme working range: 0.13-0.19 AAU/mL

[0362] The starch should be Lintner starch, which is a thin-boiling starch used in the laboratory as colorimetric indicator. Lintner starch is obtained by dilute hydrochloric acid treatment of native starch so that it retains the ability to color blue with iodine. Further details can be found in EP 0140410 B2, which disclosure is hereby included by reference.

Acid Alpha-Amylase Activity (AFAU)

[0363] Acid alpha-amylase activity may be measured in AFAU (Acid Fungal Alpha-amylase Units), which are determined relative to an enzyme standard. 1 AFAU is defined as the amount of enzyme which degrades 5.260 mg starch dry matter per hour under the below mentioned standard conditions.

[0364] Acid alpha-amylase, an endo-alpha-amylase (1,4-alpha-D-glucan-glucanohydrolase, E.C. 3.2.1.1) hydrolyzes alpha-1,4-glucosidic bonds in the inner regions of the starch molecule to form dextrins and oligosaccharides with different chain lengths. The intensity of color formed with iodine is directly proportional to the concentration of starch. Amylase activity is determined using reverse colorimetry as a reduction in the concentration of starch under the specified analytical conditions. ##STR1##

[0365] Standard Conditions/Reaction Conditions: TABLE-US-00006 Substrate: Soluble starch, approx. 0.17 g/L Buffer: Citrate, approx. 0.03 M Iodine (I2): 0.03 g/L CaCl.sub.2: 1.85 mM pH: 2.50 .+-. 0.05 Incubation temperature: 40.degree. C. Reaction time: 23 seconds Wavelength: 590 nm Enzyme concentration: 0.025 AFAU/mL Enzyme working range: 0.01-0.04 AFAU/mL

[0366] A folder EB-SM-0259.02/01 describing this analytical method in more detail is available upon request to Novozymes A/S, Denmark, which folder is hereby included by reference.

EXAMPLES

Example 1

Molecular Screening of Glucoamylase Genes

[0367] Trametes cingulata was grown on PDA2 medium and genome DNA was isolated from 0.2 g mycelium using FastDNA SPIN Kit for Soil (Qbiogene, USA) according to the manufacturer's instructions.

[0368] PCR reaction was done on genome DNA with the degenerated primers ArAF1 and ArAR3 TABLE-US-00007 ArAF1 5'-CRTRCTYDVCAACATYGG-3' (SEQ ID NO: 7) ArAR3 5' GTCAGARCADGGYTGRRASGTG-3' (SEQ ID NO: 8)

wherein D=A or G or T; R=A or G; S.dbd.C or G; V=A or C or G; Y.dbd.C or T

[0369] The amplification reaction (13 microL) was composed of 1 microL genome DNA solution, 1 micro M primer ArAF1, 1 micro M primer ArAR3, 11 microL Extensor Hi-Fidelity PCR Master Mix (ABgene, UK). The reaction was incubated in a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows: 1 cycle at 94.degree. C. for 2 minutes; 20 cycles each at 94.degree. C. for 30 seconds, 65.degree. C. for 45 seconds, with an annealing temperature decline of 1.degree. C. per cycle, and 72.degree. C. for 1 minute 30 seconds; followed by 20 cycles each at 94.degree. C. for 30 seconds, 45.degree. C. for 45 seconds and 72.degree. C. for 1 minute 30 seconds; 1 cycle at 72.degree. C. for 7 minutes; and a hold at 4.degree. C. The PCR product was purified using ExoSAP-IT (USB, USA) according to the manufacturer's instructions and sequenced. The sequence was subsequently compared to the Aspergillus niger glucoamylase gene, showing that the PCR product encoded a part of a glucoamylase.

Example 2

Molecular Screening of Glucoamylase Genes

[0370] Pachykytospora papyracea was grown on PDA2 medium and genome DNA was isolated from 0.2 g mycelium using FastDNA SPIN Kit for Soil (Qbiogene, USA) according to the manufacturer's instructions.

[0371] PCR reaction (PCR 1) was done on genome DNA with the degenerated primers AM2F and AM4R2: TABLE-US-00008 AM2F 5'-TGGGGIMGNCCNCARMGNGAYGG-3' (SEQ ID NO: 9) AM4R2 5'-RTCYTCNGGRTANCKNCC-3' (SEQ ID NO: 10)

wherein I=inosine; K=G or T; M=A or C; N=A or C or G or T; R=A or G; Y.dbd.C or T

[0372] The amplification reaction (25 microL) was composed of 1 microL genome DNA solution, 2 micro M primer AM2F, 2 micro M primer AM4R2, 22 microL Reddy PCR Master Mix (ABgene, UK). The reaction was incubated in a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows: 1 cycle at 94.degree. C. for 2 minutes; 20 cycles each at 94.degree. C. for 1 minute, 55.degree. C. for 1 minute, with an annealing temperature decline of 1.degree. C. per cycle, and 72.degree. C. for 1 minute; followed by 20 cycles each at 94.degree. C. for 1 minute, 40.degree. C. for 1 minute and 72.degree. C. for 1 minute; 1 cycle at 72.degree. C. for 7 minutes; and a hold at 4.degree. C.

[0373] Subsequently a PCR reaction was done on an aliquot of the first PCR reaction (PCR 1) with the degenerated primers AM3F and AM4R2: TABLE-US-00009 AM3F 5'-TAYGAYYTNYGGGARGA-3' (SEQ ID NO: 11) AM4R2 5'-RTCYTCNGGRTANCKNCC-3' (SEQ ID NO: 10)

wherein K=G or T; N=A or C or G or T; R=A or G; Y=C or T

[0374] The amplification reaction (13 microLI) was composed of 1 microL of the first PCR reaction (PCR 1), 1 microM primer AM3F, 1 micro M primer AM4R2, 11 microL Reddy PCR Master Mix (ABgene, UK). The reaction was incubated in a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows: 1 cycle at 94.degree. C. for 2 minutes; 5 cycles each at 94.degree. C. for 45 seconds, 45.degree. C. for 45 seconds and 72.degree. C. for 1 minute; followed by 30 cycles each at 94.degree. C. for 45 seconds, 40.degree. C. for 45 seconds and 72.degree. C. for 1 minute; 1 cycle at 72.degree. C. for 7 minutes; and a hold at 4.degree. C. A 0.5 kb amplified PCR band was obtained. The reaction product was isolated on a 1.0% agarose gel using TBE buffer and it was excised from the gel and purified using GFX PCR DNA and Gel band Purification Kit (Amersham Biosciences, UK). The excised band was sequenced and subsequently compared to the Aspergillus niger glucoamylase gene, showing that the PCR product encoded a part of a glucoamylase.

Example 3

Cloning of Glucoamylase Gene from Trametes cingulata

[0375] From the partial sequence of the Trametes cingulata glucoamylase more gene sequence was obtained with PCR based gene walking using the Vectorette Kit from SIGMA-Genosys. The gene walking was basically done as described in the manufacturer's protocol. 0.15 micro g genomic DNA of Trametes cingulata was digested with EcoRI, BamHI and HindIII, independently. The digested DNA was ligated with the corresponding Vectorette units supplied by the manufacturer using a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows: 1 cycle at 16.degree. C. for 60 minutes; 4 cycles each at 37.degree. C. for 20 minutes, 16.degree. C. for 60 minutes, 37.degree. C. for 10 minutes; followed by 1 cycle at 16.degree. C. for 60 minutes and a hold at 4.degree. C. The ligation reactions were subsequent diluted 5 times with sterile water.

[0376] PCR reactions with linker-ligated genome DNA of the Trametes cingulata as template was performed with a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows. 1 cycle at 94.degree. C. for 2 minutes; 40 cycles each at 94.degree. C. for 15 seconds, 72.degree. C. for 1 minute, 72.degree. C. for 1 minute, 1 cycle at 72.degree. C. for 7 minutes; and a hold at 40 using the supplied Vectorette primer and primer TraF1 as shown below. TABLE-US-00010 TraF1: 5'- TAGTCGTACTGGAACCCCACC -3' (SEQ ID NO: 12)

[0377] The amplification reactions (12.5 microL) were composed of 0.5 microL of linker-ligated genome DNAs, 400 nM Vectorette primer, 400 nM TraF1 primer, 11 microL Extensor Hi-Fidelity PCR Master Mix (ABgene, UK).

[0378] A 0.5 kb amplified band was obtained by the PCR reaction from HindIII digested genome DNA. The reaction product was isolated on a 1.0% agarose gel using TBE buffer and was excised from the gel. 100 microL sterile water was added to the excised agarose gel fragment and it was melted by incubation at 95.degree. C. for 5 minutes to release the DNA. The DNA band was reamplified by repeating the PCR reaction described above using 0.5 microL of the isolated DNA fragment instead of linker-ligated genome DNA.

[0379] After the PCR reaction the DNA was purified using ExoSAP-IT (USB, USA) according to the manufacturers instructions and sequenced and subsequently compared to the Aspergillus niger glucoamylase gene, showing that it encoded a further 250 bp part of the glucoamylase gene.

[0380] In order to clone the missing parts of the glucoamylase gene from Trametes cingulata, PCR based gene walking was carried out using LA PCR.TM. in vitro Cloning Kit (TAKARA, Japan) according to the manufacturer's instructions.

[0381] Five micro g of genome DNA of Trametes cingulata was digested with BamHI, EcoRI, HindIII, PstI, SalI and XbaI, independently. 200 ml of ice-cold ethanol was added to the reaction mixture (50 microL) and then digested DNA was recovered by centrifugation at 15,000.times.g for 30 minutes at 4.degree. C. The recovered DNA was ligated with a corresponding artificial linkers supplied by manufactures. The linker ligated DNA was recovered by adding 200 ml of ice-cold ethanol to the reaction mixture (50 microL) followed by centrifugation at 15,000.times.g for 30 minutes at 4.degree. C.

[0382] PCR reactions with linker-ligated genome DNA of the Trametes cingulata as template was performed with a LA PCR system (TAKARA, Japan) using primer C1 and TC5' for cloning of missing 5'-glucoamylase gene and primer C1 and TC3' for cloning of missing 3'-glucoamylase gene, as shown below. TABLE-US-00011 (SEQ ID NO: 13) C1: 5'-gtacatattgtcgttagaacgcgtaatacgactca-3' (SEQ ID NO: 14) TC5': 5'-cgtatatgtcagcgctaccatgt-3' (SEQ ID NO: 15) TC3': 5'-aaacgtgagcgaccattttctgt-3'

[0383] The amplification reactions (50 microL) were composed of 1 ng of template DNA per microL, 250 mM dNTP each, 250 nM primer, 250 nM primer, 0.1 U of LA Taq polymerase per microL in 1.times. buffer (TAKARA, Japan). The reactions were incubated in a DNA Engine PTC-200 (MJ-Research, Japan) programmed as follows: 1 cycle at 94.degree. C. for 2 minutes; 30 cycles each at 94.degree. C. for 0.5 minute, 55.degree. C. for 2 minutes, and 72.degree. C. for 2 minutes; 1 cycle at 72.degree. C. for 10 minutes; and a hold at 4.degree. C.

[0384] 0.4 kb and 1.0 kb amplified bands were obtained from SalI digested genome DNA with primer C1 and TC5' and XbaI digested genome DNA with primer C1 and TC3', respectively. These reaction products were isolated on a 1.0% agarose gel using TAE buffer and was excised from the gel and purified using a QIAquick.TM. Gel Extraction Kit (QIAGEN Inc., Valencia, Calif.) according to the manufacturer's instructions.

[0385] The amplified DNA fragments were ligated into pT7BIue (Invitrogen, Netherlands), independently. The ligation mixture was then transformed into E. coli DH12alpha (GIBCO BRL, Life Technologies, USA) to create pHUda438 and pHUda439 for a 0.4 kb amplified band and a 1.0 kb amplified band, respectively. The resultant plasmids were sequenced and compared to the Aspergillus niger glucoamylase gene, showing that clones encode the missing parts of the glucoamylase.

Example 4

Construction of pHUda440 Expression Vector

[0386] Expression vector pHUda440 was constructed for transcription of the glucoamylase gene from Trametes cingulata. A PCR reaction with the genome DNA of the Trametes cingulata as template was performed with an Expand.TM. PCR system (Roche Diagnostics, Japan) using primers TFF to introduce a BamH I site and primer TFR to introduce an Xho I site, as shown below. TABLE-US-00012 (SEQ ID NO: 16) TFF: 5'-tttggatccaccatgcgtttcacgctcctcacctcc-3' (SEQ ID NO: 17) TFR: 5'-tttctcgagctaccgccaggtgtcattctg-3'

[0387] The amplification reactions (50 microL) were composed of 1 ng of template DNA per microL, 250 mM dNTP each, 250 nM primer TFF, 250 nM primer TFR, 0.1 U of Taq polymerase per microL in 1.times. buffer (Roche Diagnostics, Japan). The reactions were incubated in a DNA Engine PTC-200 (MJ-Research, Japan) programmed as follows: 1 cycle at 94.degree. C. for 2 minutes; 30 cycles each at 92.degree. C. for 1 minute, 55.degree. C. for 1 minute, and 72.degree. C. for 2 minutes; 1 cycle at 72.degree. C. for 10 minutes; and a hold at 4.degree. C.

[0388] The reaction products were isolated on a 1.0% agarose gel using TAE buffer where a 2.2 kb product band was excised from the gel and purified using a QIAquick.TM. Gel Extraction Kit (QIAGEN Inc., Valencia, Calif.) according to the manufacturer's instructions.

[0389] The 2.2 kb amplified DNA fragment was digested with BamHI and XhoI, and ligated into the Aspergillus expression cassette pCaHj483 digested with BamH I and XhoI. The ligation mixture was transformed into E. coli DH12alpha (GIBCO BRL, Life Technologies, USA) to create the expression plasmid pHUda440. The amplified plasmid was recovered using a QIAprep.RTM. Spin Miniprep kit (QIAGEN Inc., Valencia, Calif.) according to the manufacturer's instructions.

[0390] Plasmid pCaHj483 comprised an expression cassette based on the Aspergillus niger neutral amylase II promoter fused to the Aspergillus nidulans triose phosphate isomerase non translated leader sequence (Na2/tpi promoter) and the Aspergillus niger glucoamylase terminator (AMG terminator), the selective marker amdS from Aspergillus nidulans enabling growth on acetamide as sole nitrogen source.

Example 5

Cloning of the glucoamylase gene from Pachykytospora Papyraceae

[0391] In order to clone the missing parts of the glucoamylase gene from Pachykytospora papyraceae, PCR based gene walking was carried out using LA PCR.TM. in vitro Cloning Kit (TAKARA, Japan) according to the manufacturers instructions.

[0392] Five micro g of genome DNA of Pachykytospora papyraceae was digested with BamHI, EcoRI, HindIII, PstI, SalI and XbaI, independently. 200 mL of ice-cold ethanol was added to the reaction mixture (50 microL) and then digested DNA was recovered by centrifugation at 15,000.times.g for 30 minutes at 4.degree. C. The recovered DNA was ligated with a corresponding artificial linkers supplied by manufactures. The linker ligated DNA was recovered by adding 200 mL of ice-cold ethanol to the reaction mixture (50 microL followed by centrifugation at 15,000.times.g for 30 minutes at 4.degree. C.

[0393] PCR reactions with linker-ligated genome DNA of the Pachykytospora papyraceae as template was performed with a LA PCR system (TAKARA, Japan) using primer C1 and PP5' for cloning of missing 5'-glucoamylase gene and primer C1 and PP3' for cloning of missing 3'-glucoamylase gene, as shown below. TABLE-US-00013 (SEQ ID NO: 13) C1: 5'-gtacatattgtcgttagaacgcgtaatacgactca-3' (SEQ ID NO: 18) PP5': 5'-cctccctgagtgagcgatgctgc-3' (SEQ ID NO: 19) PP3': 5'-caactccggcctctcctccagcg-3'

[0394] The amplification reactions (50 microL) were composed of 1 ng of template DNA per microL, 250 mM dNTP each, 250 nM primer, 250 nM primer, 0.1 U of LA Taq polymerase per microL in 1.times. buffer (TAKARA, Japan). The reactions were incubated in a DNA Engine PTC-200 (MJ-Research, Japan) programmed as follows: 1 cycle at 94.degree. C. for 2 minutes; 30 cydes each at 94.degree. C. for 0.5 minute, 55.degree. C. for 2 minutes, and 72.degree. C. for 2 minutes; 1 cycle at 72.degree. C. for 10 minutes; and a hold at 4.degree. C.

[0395] 0.5 kb and 0.9 kb amplified bands were obtained from XbaI digested genome DNA with primer C1 and PP5' and EcoRI digested genome DNA with primer C1 and PP3', respectively. These reaction products were isolated on a 1.0% agarose gel using TAE buffer and was excised from the gel and purified using a QIAquick.TM. Gel Extraction Kit (QIAGEN Inc., Valencia, Calif.) according to the manufacturer's instructions.

[0396] The amplified DNA fragments were ligated into pT7Blue (Invitrogen, Netherlands), independently. The ligation mixture was then transformed into E. coli DH12alpha (GIBCO BRL, Life Technologies, USA) to create pHUda448 and pHUda449 for a 0.5 kb amplified band and a 0.9 kb amplified band, respectively. The resultant plasmids were sequenced and compared to the Aspergillus niger glucoamylase gene, showing that clones encode the missing parts of the glucoamylase.

Example 6

Construction of pHUda450 Expression Vector

[0397] Expression vector pHUda450 was constructed for transcription of the glucoamylase gene from Pachykytospora papyraceae. A PCR reaction with the genome DNA of the Pachykytospora papyraceae as template was performed with an Expand.TM. PCR system (Roche Diagnostics, Japan) using primers PPF to introduce a BamH I site and primer PPR to to introduce an Xho I site, as shown below. TABLE-US-00014 (SEQ ID NO: 20) PPF: 5'-tttggatccaccatgcgcttcaccctcctctcctcc-3' (SEQ ID NO: 21) PPR: 5'-tttctcgagtcaccgccaggtgtcgttctg-3'

[0398] The amplification reactions (50 microL) were composed of 1 ng of template DNA per microL, 250 mM dNTP each, 250 nM primer PPF, 250 nM primer PPR, 0.1 U of Taq polymerase per microL in 1.times. buffer (Roche Diagnostics, Japan). The reactions were incubated in a DNA Engine PTC-200 (MJ-Research, Japan) programmed as follows: 1 cycle at 94.degree. C. for 2 minutes; 30 cycles each at 92.degree. C. for 1 minute, 55.degree. C. for 1 minute, and 72.degree. C. for 2 minutes; 1 cycle at 72.degree. C. for 10 minutes; and a hold at 4.degree. C.

[0399] The reaction products were isolated on a 1.0% agarose gel using TAE buffer where a 2.2 kb product band was excised from the gel and purified using a QIAquick.TM. Gel Extraction Kit (QIAGEN Inc., Valencia, Calif.) according to the manufacturer's instructions.

[0400] The 2.2 kb amplified DNA fragment was digested with BamHI and XhoI, and ligated into the Aspergillus expression cassette pCaHj483 digested with BamH I and XhoI. The ligation mixture was transformed into E. coli DH12alpha (GIBCO BRL, Life Technologies, USA) to create the expression plasmid pHUda450. The amplified plasmid was recovered using a QIAprep.RTM. Spin Miniprep kit (QIAGEN Inc., Valencia, Calif.) according to the manufacturer's instructions.

Example 7

Expression of Glucoamylase Genes Derived from Trametes cingulata and Pachykytospora papyraceae in Aspergillus oryzae

[0401] Aspergillus oryzae strain BECh-2 was inoculated to 100 mL of YPG medium and incubated for 16 hours at 32.degree. C. at 80 rpm. Pellets were collected and washed with 0.6 M KCl, and resuspended 20 ml 0.6 M KCl containing a commercial beta-glucanase product (GLUCANEX.TM., Novozymes A/S, Bagsv.ae butted.rd, Denmark) at a final concentration of 600 microL per mL. The suspension was incubated at 32.degree. C. and 80 rpm until protoplasts were formed, and then washed twice with STC buffer. The protoplasts were counted with a hematometer and resuspended and adjusted in an 8:2:0.1 solution of STC:STPC:DMSO to a final concentration of 2.5.times.10.sup.7 protoplasts/ml. Approximately 3 micro g of pHUda440 or pHUda450 was added to 100 microL of the protoplast suspension, mixed gently, and incubated on ice for 20 minutes. One mL of SPTC was added and the protoplast suspension was incubated for 30 minutes at 37.degree. C. After the addition of 10 mL of 50.degree. C. COVE top agarose, the reaction was poured onto COVE agar plates and the plates were incubated at 32.degree. C. After 5 days transformants were selected from the COVE medium.

[0402] Four randomly selected transformants were inoculated into 100 mL of MS-9 medium and cultivated at 32.degree. C. for 1 day. Three ml of MS-9 medium was inoculated into 100 mL of MDU-pH5 medium and cultivated at 30.degree. C. for 3 days. Supernatants were obtained by centrifugation at 3,000.times.g for 10 minutes.

[0403] Glucoamylase activity in the supernatant samples was determined as an increase in NADH production by glucose dehydrogenase and mutarotase reaction with generating glucose and measured the absorbance at 340 nm. Six microL of enzyme samples dissolved in 100 mM sodium acetate pH 4.3 buffer was mixed with 31 microL of 23.2 mM of maltose in 100 mM sodium acetate pH 4.3 buffer and incubated at 37.degree. C. for 5 minutes. Then, 313 microL of color reagent (430 U of glucose dehydrogenase per liter, 9 U mutarotase per liter, 0.21 mM NAD, and 0.15 M NaCl in 0.12 M phosphate pH 7.6 buffer) was added to the reaction mixture and incubated at 37.degree. C. for 5 minutes. Activity was measured at 340 nm on a spectrophotometer. Six microL of distilled water was used in place of the enzyme samples as controls.

[0404] Tables 1 and 2 show the glucoamylase activities of the selected transformants, relative to the activity of the host strain, Aspergillus oryzae BECh-2, which was normalized to 1.0. TABLE-US-00015 TABLE 1 Shake flask results of the selected transformants expressing Trametes cingulata glucoamylase T. cingulata glucoamylase (AGU/ml) Strains Relative activities #13-1 180 #13-2 199 #19-1 148 #19-2 169 BECh-2 1.0

[0405] TABLE-US-00016 TABLE 2 Shake flask results of the selected transformants expressing Pachykytospora papyraceae glucaoamylase P. papyraceae glucoamylase (AGU/ml) Strains Relative activities #B11-1 42 #B11-2 48 #B11-3 36 #B11-4 50 BECh-2 1.0

Example 8

Evaluation of Trametes cingulata Glucoamylase in One-Step Fuel Ethanol Fermentations

[0406] The relative performance of Trametes cingulata glucoamylase to Aspergillus niger glucoamylase and Talaromyces emersonii glucoamylase was evaluated via mini-scale fermentations. About 380 g of milled corn (ground in a pilot scale hammer mill through a 1.65 mm screen) was added to about 620 g tap water. This mixture was supplemented with 3 mL 1 g/L penicillin. The pH of this slurry was adjusted to 5.0 with 40% H.sub.2SO.sub.4. The dry solid (DS) level was determined in triplicate to be about 32%. Approximately 5 g of this slurry was added to 15 mL tubes.

[0407] A two dose dose-response was conducted with each enzyme. Dosages used were 0.3 and 0.6 nmol/g DS. Six replicates of each treatment were run.

[0408] After dosing the tubes were inoculated with 0.04 mL/g mash of yeast propagate (RED STAR.TM. yeast) that had been grown for 22.5 hours on corn mash. Tubes were capped with a screw on top which had been punctured with a small needle to allow gas release and vortexed briefly before weighing and incubation at 32.degree. C. 70 hour fermentations were carried out and ethanol yields were determined by weighing the tubes. Tubes were vortexed briefly before weighing. The result of the experiment is shown in Table 1.

[0409] It can be seen from Table 1 the ethanol yield per gram DS is significantly higher when using the Trametes cingulata glucoamylase compared to yields for the wild-type Aspergillus niger and Talaromyces emersonii glucoamylases. TABLE-US-00017 TABLE 1 Glucoamylase nmol/g DS Ethanol yields Trametes cingulata 0.3 56.2 Aspergillus niger 47.2 Talaromyces emersonii 30.5 Trametes cingulata 0.6 100.8 Aspergillus niger 87.2 Talaromyces emersonii 43.4

Example 9

Evaluation of Pachykytospora papyracea Glucoamylase in One Step Fuel Ethanol Fermentations

[0410] The relative performance of Pachykytospora papyracea glucoamylase to Aspergillus niger glucoamylase and Talaromyces emersonii glucoamylase was evaluated via mini-scale fermentations. About 380 g of milled corn (ground in a pilot scale hammer mill through a 1.65 mm screen) was added to about 620 g tap water. This mixture was supplemented with 3 mL 1 g/L penicillin. The pH of this slurry was adjusted to 5.0 with 40% H.sub.2SO.sub.4. The dry solid (DS) level was determined in triplicate to be about 32%. Approximately 5 g of this slurry was added to 15 mL tubes.

[0411] A two dose dose-response was conducted with each enzyme. Dosages used were 0.3 and 0.6 nmol/g DS. Six replicates of each treatment were run.

[0412] After dosing the tubes were inoculated with 0.04 mL/g mash of yeast propagate (RED STAR.TM. yeast) that had been grown for 22.5 hours on corn mash. Tubes were capped with a screw on top which had been punctured with a small needle to allow gas release and vortexed briefly before weighing and incubation at 32.degree. C. 70 hour fermentations were carried out and ethanol yields were determined by weighing the tubes. Tubes were vortexed briefly before weighing. The result of the experiment is shown in Table 2.

[0413] It can be seen from Table 2 the ethanol yield per gram DS is significantly higher when using the Pachykytospora papyracea glucoamylase compared to yields for the wild-type Aspergillus niger and Talaromyces emersonii glucoamylases. TABLE-US-00018 TABLE 2 Glucoamylase Nmol/g DS Ethanol yields Pachykytospora papyracea 0.3 76.3 Aspergillus niger 47.2 Talaromyces emersonii 30.5 Pachykytospora papyracea 0.6 102.0 Aspergillus niger 87.2 Talaromyces emersonii 43.4

Example 10

Trametes cingulata Glucoamylase in Combination with Hybrid Alpha-Amylase A from Rhizomucor pusillus for One Step Fermentation

[0414] All treatments were evaluated via mini-scale fermentations. 410 g of ground corn was added to 590 g tap water. This mixture was supplemented with 3.0 ml 1 g/L penicillin and 1 g of urea. The pH of this slurry was adjusted to 4.5 with 5 N NaOH (initial pH, before adjustment was about 3.8). Dry Solid (DS) level was determined to be 35%. Approximately 5 g of this slurry was added to 20 ml vials. Each vial was dosed with the appropriate amount of enzyme followed by addition of 200 micro liter yeast propagate/5 g fermentation. Actual dosages were based on the exact weight of corn slurry in each vial. Vials were incubated at 32.degree. C. 9 replicate fermentations of each treatment were run. Three replicates were selected for 24 hour, 48 hour and 70 hour time point analysis. Vials were vortexed at 24, 48 and 70 hours. The time point analysis consisted of weighing the vials and prepping the sample for HPLC. The HPLC preparation consisted of stopping the reaction by addition of 50 micro liters of 40% H.sub.2SO.sub.4, centrifuging, and filtering through a 0.45 micro m filter. Samples awaiting HPLC analysis were stored at 4.degree. C.

[0415] Enzymes used in this study: TABLE-US-00019 % enzyme dose AFAU/g DS Alpha-Amylase A AGU/g DS Alpha-Amylase A T. cingulata from Rhizomucor T. cingulata from Trial # glucoamylase pusillus glucoamylase Rhizomucor pusillus 1 100% 0% 0.43 0 2 90% 10% 0.387 0.01 3 80% 20% 0.344 0.02 4 70% 30% 0.301 0.03 5 60% 40% 0.258 0.04 6 45% 55% 0.1935 0.055 7 30% 70% 0.129 0.07 8 15% 85% 0.0645 0.085 9 0% 100% 0 0.1 Note: T. cingulata glucoamylase, 49 AGU/ml) and hybrid Alpha-Amylase A from Rhizomucor pusillus (17 AFAU/ml) are purified enzymes from Novozymes Japan. DS = dry solid.

Results

[0416] The synergistic effect of alpha-amylase and glucoamylase is presented in a table below. When T. cingulata glucoamylase was used alone in one step fermentation, it produced 54.1, 81.2 and 99.0 g/l ethanol after 24, 48, and 70 hours fermentation, respectively. When the hybrid alpha-amylase A from Rhizomucor pusillus is used alone in fermentation, it produced 90.5, 124.6, and 138.1 g/l ethanol after 24, 48, and 70 hour fermentation, respectively. TABLE-US-00020 T. cingulata Hybrid Alpha- glucoamylase Amylase A Ethanol (g/l) Ratio Trial # AGU/g DS AFAU/g DS 24 hrs 48 hrs 70 hrs AGU/AFAU 1 0.430 0.000 54.1 81.2 99.0 N/A 2 0.387 0.010 88.5 130.7 145.0 38.70 3 0.344 0.020 92.9 132.1 145.9 17.20 4 0.301 0.030 96.7 135.3 146.6 10.03 5 0.258 0.040 96.1 136.6 147.1 6.45 6 0.194 0.055 97.1 135.5 145.6 3.52 7 0.129 0.070 95.4 132.9 144.6 1.84 8 0.065 0.085 93.3 130.4 142.9 0.76 9 0.000 0.100 90.5 124.6 138.1 0.00

[0417] The optimal ratio of T. cingulata glucoamylase to hybrid Alpha-Amylase A from Rhizomucor pusillus alpha-amylase is about 6.5 AGU/AFAU (Table above). Essentially similar performance in term of ethanol yield after 70 hours fermentation was observed in the range of 0.76-38.7 AGU/AFAU ratio, indicating robust performance for a broad activity ration range of the mixtures of T. cingulata glucoamylase to hybrid Alpha-Amylase A.

Example 11

DNA Extraction and PCR Amplification of Leucopaxillus giganteus

[0418] 0.2-2 g of the spore forming layer (lamellas) of the fresh fruit-bodies of Leucopaxillus giganteus were used for genomic DNA extraction using FastDNA SPIN Kit for Soil (Qbiogene, USA) according to the manufacturer's instructions.

[0419] PCR reaction was done on genome DNA with the degenerated primers ArAF1 and ArAR3 TABLE-US-00021 ArAF1 5'-CRTRCTYDVCAACATYGG-3' (SEQ ID NO: 7) ArAR3 5' GTCAGARCADGGYTGRRASGTG-3' (SEQ ID NO: 8)

wherein D=A or G or T; R=A or G; S=C or G; V=A or C or G; Y=C or T

[0420] The amplification reaction (13 microL) was composed of 1 microL genome DNA solution, 1 micro M primer ArAF1 (25 .mu.mol/microL), 1 micro M primer ArAR3 (25 .mu.mol/microL), 11 microL Extensor Hi-Fidelity PCR Master Mix (ABgene, UK). The reaction was incubated in a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows: 1 cycle at 94.degree. C. for 2 minutes; 20 cycles each at 94.degree. C. for 30 seconds, 65.degree. C. for 45 seconds, with an annealing temperature decline of 1.degree. C. per cycle, and 72.degree. C. for 1 minute 30 seconds; followed by 20 cycles each at 94.degree. C. for 30 seconds, 45.degree. C. for 45 seconds and 72.degree. C. for 1 minute 30 seconds; 1 cycle at 72.degree. C. for 7 minutes; and a hold at 4.degree. C. The PCR product was purified using ExoSAP-IT (USB, USA) according to the manufacturer's instructions and sequenced using the primers as used in the amplification reaction. The sequence was subsequently compared to the Aspergillus niger glucoamylase gene, showing that the PCR product encoded a part of a glucoamylase.

[0421] From the partial sequence of the Leucopaxillus giganteus glucoamylase more gene sequence was obtained with PCR based gene walking using the Vectorette Kit from SIGMA-Genosys. The gene walking was performed as described in the manufacturer's protocol. 0.15 micro 9 genomic DNA of Leucopaxillus giganteus was digested with EcoRI, BamHI and HindIII, independently. The digested DNA was ligated with the corresponding Vectorette units supplied by the manufacture using a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows: 1 cycle at 16.degree. C. for 60 minutes; 4 cycles each at 37.degree. C. for 20 minutes, 16.degree. C. for 60 minutes, 37.degree. C. for 10 minutes; followed by 1 cycle at 16.degree. C. for 60 minutes and a hold at 4.degree. C. The ligation reactions were subsequent diluted 5 times with sterile water.

[0422] PCR reactions with linker-ligated genome DNA of the Leucopaxillus giganteus as template was performed with a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows: 1 cycle at 94.degree. C. for 2 minutes; 40 cycles each at 94.degree. C. for 15 seconds, 72.degree. C. for 1 minute, 72.degree. C. for 1 minute, 1 cycle at 72.degree. C. for 7 minutes; and a hold at 4.degree. C. using the supplied Vectorette primer and the specific Leucopaxillus giganteus AMG primers Nc1R2 and NC1F0, respectively, as shown below. TABLE-US-00022 Nc1R2: (SEQ ID NO:31) 5'-GGTAGACTAGTTACCTCGTTGG-3' Nc1F0: (SEQ ID NO:32) 5'-GCTTCCCTAGCCACTGCCATTGG-3'

[0423] The amplification reactions (12.5 microL) were composed of 0.5 microL of linker-ligated genome DNAs, 400 nM Vectorette primer, 400 nM Leucopaxillus giganteus specific primer, 11 microL Extensor Hi-Fidelity PCR Master Mix (ABgene, UK).

[0424] After the PCR reaction the PCR products were purified using ExoSAP-IT (USB, USA) according to the manufacturer's instructions and sequenced and subsequently compared to the Aspergillus niger glucoamylase gene.

[0425] A 1.7 kb amplified band was obtained by the PCR reaction from HindIII digested genome DNA amplified with the primer Nc1R2. Sequencing of the PCR product using this primer showed that it encoded the remaining 600 base pairs of the glucoamylase gene in the 5' direction.

[0426] A 1.8 amplified band was obtained by the PCR reaction from HindIII digested genome DNA amplified with the primer Nc1F0. Sequencing of the PCR product using this primer showed that it encoded further approximately 530 base pairs of the glucoamylase gene, however not reaching the end of the gene. Therefore, an additional sequencing primer Nc1F2, were designed based on the newly obtained additional sequence of the glucoamylase gene. Using Nc1F2 as a downstream primer of Nc1F0 on the same PCR product showed that it encoded the remaining approximately 520 base pairs of the glucoamylase gene in the 3' direction. TABLE-US-00023 Nc1F2 (SEQ ID NO:33) 5' GTTGATTTAACTTGGAGCTATGC

Example 12

Cloning and Expression of Leucopaxillus giganteus Glucoamylase

[0427] From the partial sequence of Leucopaxillus giganteus glucoamylase more gene sequence was obtained.

[0428] The following PCR cloning primers were used: TABLE-US-00024 Forward primer: (SEQ ID NO:34) 5' TCCCTTGGATCCAGGATGCATTTCTCTGTCCTCTC 3' BamHI Reverse primer: (SEQ ID NO:35) 5' CTTATCCTCGAGCTACTTCCACGAGTCATTCTGG 3' Xhol

[0429] PCR was made with gDNA from Leucopaxillus giganteus as template using Phusion as polymerase and the above primers introducing respectively BamHI and XhoI. 5 micro L of the PCR product was tested in a 1% agarose gel, and showed a band at about 2.2 kb. The PCR product was purified on a QIAquick column.

[0430] The purified product and Aspergillus vector pEN12516 Leucopaxillus giganteus (see WO 2004/069872) were digested with BamHI and XhoI. The vector and insert fragments were purified from a 1% preparative agarose gel using the QIAquick method. The 2.2 kb fragment was ligated into the vector pEN12516 and transformed into TOP10 E. coli competent cells. The resulting plasmid was termed as pEN13372.

Transformation in Aspergillus niger

[0431] Protoplasts of the Aspergillus niger strain Mbin119 (see WO 2004/090155) were made. About 5 micro g of pEN13372 was transformed into the protoplasts. The resulting Aspergillus niger transformants were tested for glucoamylase activity.

Example 13

Debranching Activity Toward Pullulan of Trametes cingulata Glucoamylase

[0432] The alpha-1,6-debranching activity of glucoamylases derived from Trametes cingulata, Athelia rolfsii, Aspergillus niger and Talaromyces emersonii was investigated.

[0433] Pullulan (MW 50,000.about.100,000) was dissolved in MilliQ water and added into a reaction mixture to a 3% final concentration containing 50 mM NaAc buffer, pH 4.0, with enzyme dosage of 0.42 micro 9 enzyme/mg pullulan at 37.degree. C. Oligosaccharide profile was analyzed periodically by HPLC.

[0434] The result of the test is displayed in FIG. 1.

[0435] The invention described and claimed herein is not to be limited in scope by the specific aspects herein disclosed, since these aspects are intended as illustrations of several aspects of the invention. Any equivalent aspects are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the case of conflict, the present disclosure including definitions will control.

[0436] Various references are cited herein, the disclosures of which are incorporated by reference in their entireties.

Sequence CWU 1

1

43 1 2166 DNA Trametes cingulata sig_peptide (1)..(54) CDS (1)..(162) mat_peptide (55)..(2166) Intron (163)..(247) CDS (248)..(521) Intron (522)..(577) CDS (578)..(722) Intron (723)..(772) CDS (773)..(932) Intron (933)..(1001) CDS (1002)..(1277) Intron (1278)..(1341) CDS (1342)..(1807) misc_feature (1744)..(1773) Linker region misc_feature (1774)..(2166) binding domain Intron (1808)..(1864) CDS (1865)..(1963) Intron (1964)..(2023) CDS (2024)..(2163) 1 atg cgt ttc acg ctc ctc acc tcc ctc ctg ggc ctc gcc ctc ggc gcg 48 Met Arg Phe Thr Leu Leu Thr Ser Leu Leu Gly Leu Ala Leu Gly Ala -15 -10 -5 ttc gcg cag tcg agt gcg gcc gac gcg tac gtc gcg tcc gaa tcg ccc 96 Phe Ala Gln Ser Ser Ala Ala Asp Ala Tyr Val Ala Ser Glu Ser Pro -1 1 5 10 atc gcc aag gcg ggt gtg ctc gcc aac atc ggg ccc agc ggc tcc aag 144 Ile Ala Lys Ala Gly Val Leu Ala Asn Ile Gly Pro Ser Gly Ser Lys 15 20 25 30 tcc aac gga gca aag gca agtgacacag tgacactccg gggcgcccat 192 Ser Asn Gly Ala Lys Ala 35 gcttcattct tctgtgcaca tggtagcgct gacatatcgt tgtttttgac agccc ggc 250 Gly atc gtg att gca agt ccg agc aca tcc aac ccg aac tac ctg tac aca 298 Ile Val Ile Ala Ser Pro Ser Thr Ser Asn Pro Asn Tyr Leu Tyr Thr 40 45 50 tgg acg cgc gac tcg tcc ctc gtg ttc aag gcg ctc atc gac cag ttc 346 Trp Thr Arg Asp Ser Ser Leu Val Phe Lys Ala Leu Ile Asp Gln Phe 55 60 65 acc act ggc gaa gat acc tcg ctc cga act ctg att gac gag ttc acc 394 Thr Thr Gly Glu Asp Thr Ser Leu Arg Thr Leu Ile Asp Glu Phe Thr 70 75 80 85 tcg gcg gag gcc ata ctc cag cag gtg ccg aac ccg agc ggg aca gtc 442 Ser Ala Glu Ala Ile Leu Gln Gln Val Pro Asn Pro Ser Gly Thr Val 90 95 100 agc act gga ggc ctc ggc gag ccc aag ttc aac atc gac gag acc gcg 490 Ser Thr Gly Gly Leu Gly Glu Pro Lys Phe Asn Ile Asp Glu Thr Ala 105 110 115 ttc acg gat gcc tgg ggt cgt cct cag cgc g gtaagtcgga ggttgcctcg 541 Phe Thr Asp Ala Trp Gly Arg Pro Gln Arg 120 125 acggagatac gcccagactg acttcaagac tctcag at ggt ccc gct ctc cgg 594 Asp Gly Pro Ala Leu Arg 130 gcg act gcc atc atc acc tac gcc aac tgg ctc ctc gac aac aag aac 642 Ala Thr Ala Ile Ile Thr Tyr Ala Asn Trp Leu Leu Asp Asn Lys Asn 135 140 145 acg acc tac gtg acc aac act ctc tgg cct atc atc aag ctc gac ctc 690 Thr Thr Tyr Val Thr Asn Thr Leu Trp Pro Ile Ile Lys Leu Asp Leu 150 155 160 165 gac tac gtc gcc agc aac tgg aac cag tcc ac gtatgttctc taaattctct 742 Asp Tyr Val Ala Ser Asn Trp Asn Gln Ser Thr 170 175 cccgtgggta accagtctga acgttcatag g ttt gat ctc tgg gag gag att 794 Phe Asp Leu Trp Glu Glu Ile 180 aac tcc tcg tcg ttc ttc act acc gcc gtc cag cac cgt gct ctg cgc 842 Asn Ser Ser Ser Phe Phe Thr Thr Ala Val Gln His Arg Ala Leu Arg 185 190 195 gag ggc gcg act ttc gct aat cgc atc gga caa acc tcg gtg gtc agc 890 Glu Gly Ala Thr Phe Ala Asn Arg Ile Gly Gln Thr Ser Val Val Ser 200 205 210 215 ggg tac acc acc caa gca aac aac ctt ctc tgc ttc ctg cag 932 Gly Tyr Thr Thr Gln Ala Asn Asn Leu Leu Cys Phe Leu Gln 220 225 gcagtctatc ccgtcacacg tctgtctgtt tccgttttcc cacagctcac ctcgtcccgg 992 gccctgtag tcg tac tgg aac ccc acc ggc ggc tat atc acc gca aac acg 1043 Ser Tyr Trp Asn Pro Thr Gly Gly Tyr Ile Thr Ala Asn Thr 230 235 240 ggc ggc ggc cgc tct ggc aag gac gcg aac acc gtt ctc acg tcg atc 1091 Gly Gly Gly Arg Ser Gly Lys Asp Ala Asn Thr Val Leu Thr Ser Ile 245 250 255 cac acc ttc gac ccg gcc gct gga tgc gac gct gtt acg ttc cag ccg 1139 His Thr Phe Asp Pro Ala Ala Gly Cys Asp Ala Val Thr Phe Gln Pro 260 265 270 275 tgc tcg gac aag gcg ctg tcg aac ttg aag gtg tac gtc gat gcg ttc 1187 Cys Ser Asp Lys Ala Leu Ser Asn Leu Lys Val Tyr Val Asp Ala Phe 280 285 290 cgc tcg atc tac tcc atc aac agc ggg atc gcc tcg aat gcg gcc gtt 1235 Arg Ser Ile Tyr Ser Ile Asn Ser Gly Ile Ala Ser Asn Ala Ala Val 295 300 305 gct acc ggc cgc tac ccc gag gac agc tac atg ggc gga aac 1277 Ala Thr Gly Arg Tyr Pro Glu Asp Ser Tyr Met Gly Gly Asn 310 315 320 gtgagcgacc atttctgtgc gtacaccgcg gtcgcgttaa ctgagatgtt ctcctctcct 1337 gtag cca tgg tac ctc acc acc tcc gcc gtc gct gag cag ctc tac gat 1386 Pro Trp Tyr Leu Thr Thr Ser Ala Val Ala Glu Gln Leu Tyr Asp 325 330 335 gcg ctc att gtg tgg aac aag ctt ggc gcc ctg aac gtc acg agc acc 1434 Ala Leu Ile Val Trp Asn Lys Leu Gly Ala Leu Asn Val Thr Ser Thr 340 345 350 tcc ctc ccc ttc ttc cag cag ttc tcg tca ggc gtc acc gtc ggc acc 1482 Ser Leu Pro Phe Phe Gln Gln Phe Ser Ser Gly Val Thr Val Gly Thr 355 360 365 tat gcc tca tcc tcg tcc acc ttc aag acg ctc act tcc gcc atc aag 1530 Tyr Ala Ser Ser Ser Ser Thr Phe Lys Thr Leu Thr Ser Ala Ile Lys 370 375 380 acc ttc gcc gac ggc ttc ctc gcg gtc aac gcc aag tac acg ccc tcg 1578 Thr Phe Ala Asp Gly Phe Leu Ala Val Asn Ala Lys Tyr Thr Pro Ser 385 390 395 400 aac ggc ggc ctt gct gaa cag tac agc cgg agc aac ggc tcg ccc gtc 1626 Asn Gly Gly Leu Ala Glu Gln Tyr Ser Arg Ser Asn Gly Ser Pro Val 405 410 415 agc gct gtg gac ctg acg tgg agc tat gct gct gcc ctc acg tcg ttt 1674 Ser Ala Val Asp Leu Thr Trp Ser Tyr Ala Ala Ala Leu Thr Ser Phe 420 425 430 gct gcg cgc tca ggc aag acg tat gcg agc tgg ggc gcg gcg ggt ttg 1722 Ala Ala Arg Ser Gly Lys Thr Tyr Ala Ser Trp Gly Ala Ala Gly Leu 435 440 445 act gtc ccg acg act tgc tcg ggg agt ggc ggt gct ggg act gtg gcc 1770 Thr Val Pro Thr Thr Cys Ser Gly Ser Gly Gly Ala Gly Thr Val Ala 450 455 460 gtc acc ttc aac gtg cag gcg acc acc gtg ttc ggc g gtgagtacgc 1817 Val Thr Phe Asn Val Gln Ala Thr Thr Val Phe Gly 465 470 475 catcgtatgc tactagggca gttactcata gcttgtcgga cttgtag ag aac att 1872 Glu Asn Ile tac atc aca ggc tcg gtc ccc gct ctc cag aac tgg tcg ccc gac aac 1920 Tyr Ile Thr Gly Ser Val Pro Ala Leu Gln Asn Trp Ser Pro Asp Asn 480 485 490 495 gcg ctc atc ctc tca gcg gcc aac tac ccc act tgg agc agt a 1963 Ala Leu Ile Leu Ser Ala Ala Asn Tyr Pro Thr Trp Ser Ser 500 505 cgtctgaacc gccttcagcc tgcttcatac gttcgctgac atcgggcatc catctagtca 2023 cc gtg aac ctg ccg gcg agc acg acg atc gag tac aag tac att cgc 2070 Thr Val Asn Leu Pro Ala Ser Thr Thr Ile Glu Tyr Lys Tyr Ile Arg 515 520 525 aag ttc aac ggc gcg gtc acc tgg gag tcc gac ccg aac aac tcg atc 2118 Lys Phe Asn Gly Ala Val Thr Trp Glu Ser Asp Pro Asn Asn Ser Ile 530 535 540 acg acg ccc gcg agc ggc acg ttc acc cag aac gac acc tgg cgg tag 2166 Thr Thr Pro Ala Ser Gly Thr Phe Thr Gln Asn Asp Thr Trp Arg 545 550 555 2 574 PRT Trametes cingulata 2 Met Arg Phe Thr Leu Leu Thr Ser Leu Leu Gly Leu Ala Leu Gly Ala -15 -10 -5 Phe Ala Gln Ser Ser Ala Ala Asp Ala Tyr Val Ala Ser Glu Ser Pro -1 1 5 10 Ile Ala Lys Ala Gly Val Leu Ala Asn Ile Gly Pro Ser Gly Ser Lys 15 20 25 30 Ser Asn Gly Ala Lys Ala Gly Ile Val Ile Ala Ser Pro Ser Thr Ser 35 40 45 Asn Pro Asn Tyr Leu Tyr Thr Trp Thr Arg Asp Ser Ser Leu Val Phe 50 55 60 Lys Ala Leu Ile Asp Gln Phe Thr Thr Gly Glu Asp Thr Ser Leu Arg 65 70 75 Thr Leu Ile Asp Glu Phe Thr Ser Ala Glu Ala Ile Leu Gln Gln Val 80 85 90 Pro Asn Pro Ser Gly Thr Val Ser Thr Gly Gly Leu Gly Glu Pro Lys 95 100 105 110 Phe Asn Ile Asp Glu Thr Ala Phe Thr Asp Ala Trp Gly Arg Pro Gln 115 120 125 Arg Asp Gly Pro Ala Leu Arg Ala Thr Ala Ile Ile Thr Tyr Ala Asn 130 135 140 Trp Leu Leu Asp Asn Lys Asn Thr Thr Tyr Val Thr Asn Thr Leu Trp 145 150 155 Pro Ile Ile Lys Leu Asp Leu Asp Tyr Val Ala Ser Asn Trp Asn Gln 160 165 170 Ser Thr Phe Asp Leu Trp Glu Glu Ile Asn Ser Ser Ser Phe Phe Thr 175 180 185 190 Thr Ala Val Gln His Arg Ala Leu Arg Glu Gly Ala Thr Phe Ala Asn 195 200 205 Arg Ile Gly Gln Thr Ser Val Val Ser Gly Tyr Thr Thr Gln Ala Asn 210 215 220 Asn Leu Leu Cys Phe Leu Gln Ser Tyr Trp Asn Pro Thr Gly Gly Tyr 225 230 235 Ile Thr Ala Asn Thr Gly Gly Gly Arg Ser Gly Lys Asp Ala Asn Thr 240 245 250 Val Leu Thr Ser Ile His Thr Phe Asp Pro Ala Ala Gly Cys Asp Ala 255 260 265 270 Val Thr Phe Gln Pro Cys Ser Asp Lys Ala Leu Ser Asn Leu Lys Val 275 280 285 Tyr Val Asp Ala Phe Arg Ser Ile Tyr Ser Ile Asn Ser Gly Ile Ala 290 295 300 Ser Asn Ala Ala Val Ala Thr Gly Arg Tyr Pro Glu Asp Ser Tyr Met 305 310 315 Gly Gly Asn Pro Trp Tyr Leu Thr Thr Ser Ala Val Ala Glu Gln Leu 320 325 330 Tyr Asp Ala Leu Ile Val Trp Asn Lys Leu Gly Ala Leu Asn Val Thr 335 340 345 350 Ser Thr Ser Leu Pro Phe Phe Gln Gln Phe Ser Ser Gly Val Thr Val 355 360 365 Gly Thr Tyr Ala Ser Ser Ser Ser Thr Phe Lys Thr Leu Thr Ser Ala 370 375 380 Ile Lys Thr Phe Ala Asp Gly Phe Leu Ala Val Asn Ala Lys Tyr Thr 385 390 395 Pro Ser Asn Gly Gly Leu Ala Glu Gln Tyr Ser Arg Ser Asn Gly Ser 400 405 410 Pro Val Ser Ala Val Asp Leu Thr Trp Ser Tyr Ala Ala Ala Leu Thr 415 420 425 430 Ser Phe Ala Ala Arg Ser Gly Lys Thr Tyr Ala Ser Trp Gly Ala Ala 435 440 445 Gly Leu Thr Val Pro Thr Thr Cys Ser Gly Ser Gly Gly Ala Gly Thr 450 455 460 Val Ala Val Thr Phe Asn Val Gln Ala Thr Thr Val Phe Gly Glu Asn 465 470 475 Ile Tyr Ile Thr Gly Ser Val Pro Ala Leu Gln Asn Trp Ser Pro Asp 480 485 490 Asn Ala Leu Ile Leu Ser Ala Ala Asn Tyr Pro Thr Trp Ser Ser Thr 495 500 505 510 Val Asn Leu Pro Ala Ser Thr Thr Ile Glu Tyr Lys Tyr Ile Arg Lys 515 520 525 Phe Asn Gly Ala Val Thr Trp Glu Ser Asp Pro Asn Asn Ser Ile Thr 530 535 540 Thr Pro Ala Ser Gly Thr Phe Thr Gln Asn Asp Thr Trp Arg 545 550 555 3 1725 DNA Trametes cingulata misc_feature (1)..(1725) cDNA misc_feature (55)..(1725) coding region of cDNA misc_feature (1420)..(1725) binding domain 3 atgcgtttca cgctcctcac ctccctcctg ggcctcgccc tcggcgcgtt cgcgcagtcg 60 agtgcggccg acgcgtacgt cgcgtccgaa tcgcccatcg ccaaggcggg tgtgctcgcc 120 aacatcgggc ccagcggctc caagtccaac ggagcaaagg caggcatcgt gattgcaagt 180 ccgagcacat ccaacccgaa ctacctgtac acatggacgc gcgactcgtc cctcgtgttc 240 aaggcgctca tcgaccagtt caccactggc gaagatacct cgctccgaac tctgattgac 300 gagttcacct cggcggaggc catactccag caggtgccga acccgagcgg gacagtcagc 360 actggaggcc tcggcgagcc caagttcaac atcgacgaga ccgcgttcac ggatgcctgg 420 ggtcgtcctc agcgcgatgg tcccgctctc cgggcgactg ccatcatcac ctacgccaac 480 tggctcctcg acaacaagaa cacgacctac gtgaccaaca ctctctggcc tatcatcaag 540 ctcgacctcg actacgtcgc cagcaactgg aaccagtcca cgtttgatct ctgggaggag 600 attaactcct cgtcgttctt cactaccgcc gtccagcacc gtgctctgcg cgagggcgcg 660 actttcgcta atcgcatcgg acaaacctcg gtggtcagcg ggtacaccac ccaagcaaac 720 aaccttctct gcttcctgca gtcgtactgg aaccccaccg gcggctatat caccgcaaac 780 acgggcggcg gccgctctgg caaggacgcg aacaccgttc tcacgtcgat ccacaccttc 840 gacccggccg ctggatgcga cgctgttacg ttccagccgt gctcggacaa ggcgctgtcg 900 aacttgaagg tgtacgtcga tgcgttccgc tcgatctact ccatcaacag cgggatcgcc 960 tcgaatgcgg ccgttgctac cggccgctac cccgaggaca gctacatggg cggaaaccca 1020 tggtacctca ccacctccgc cgtcgctgag cagctctacg atgcgctcat tgtgtggaac 1080 aagcttggcg ccctgaacgt cacgagcacc tccctcccct tcttccagca gttctcgtca 1140 ggcgtcaccg tcggcaccta tgcctcatcc tcgtccacct tcaagacgct cacttccgcc 1200 atcaagacct tcgccgacgg cttcctcgcg gtcaacgcca agtacacgcc ctcgaacggc 1260 ggccttgctg aacagtacag ccggagcaac ggctcgcccg tcagcgctgt ggacctgacg 1320 tggagctatg ctgctgccct cacgtcgttt gctgcgcgct caggcaagac gtatgcgagc 1380 tggggcgcgg cgggtttgac tgtcccgacg acttgctcgg ggagtggcgg tgctgggact 1440 gtggccgtca ccttcaacgt gcaggcgacc accgtgttcg gcgagaacat ttacatcaca 1500 ggctcggtcc ccgctctcca gaactggtcg cccgacaacg cgctcatcct ctcagcggcc 1560 aactacccca cttggagcag taccgtgaac ctgccggcga gcacgacgat cgagtacaag 1620 tacattcgca agttcaacgg cgcggtcacc tgggagtccg acccgaacaa ctcgatcacg 1680 acgcccgcga gcggcacgtt cacccagaac gacacctggc ggtag 1725 4 2189 DNA Pachykytospora papyracea CDS (1)..(159) sig_peptide (1)..(54) mat_peptide (55)..(2186) Intron (160)..(238) CDS (239)..(720) Intron (516)..(572) Intron (721)..(782) CDS (783)..(942) Intron (943)..(1005) CDS (1006)..(1281) Intron (1282)..(1340) CDS (1341)..(1803) misc_feature (1743)..(1769) linker misc_feature (1770)..(2189) binding region Intron (1804)..(1882) CDS (1883)..(1978) Intron (1979)..(2043) CDS (2044)..(2186) 4 atg cgc ttc acc ctc ctc tcc tcc ctc gtc gcc ctc gcc acc ggc gcg 48 Met Arg Phe Thr Leu Leu Ser Ser Leu Val Ala Leu Ala Thr Gly Ala -15 -10 -5 ttc gcc cag acc agc cag gcc gac gcg tac gtc aag tcc gag ggc ccc 96 Phe Ala Gln Thr Ser Gln Ala Asp Ala Tyr Val Lys Ser Glu Gly Pro -1 1 5 10 atc gcg aag gcg ggc ctc ctc gcc aac atc ggg ccc agc ggc tcc aag 144 Ile Ala Lys Ala Gly Leu Leu Ala Asn Ile Gly Pro Ser Gly Ser Lys 15 20 25 30 tcg cac ggg gcg aag gtgcgcttct ctttttccca ttctacgtcg cttaaagcgc 199 Ser His Gly Ala Lys 35 gctcatacat gtgcatgacc gcgttccgcg tgcgcgcag gcc ggt ctc gtc gtc 253 Ala Gly Leu Val Val 40 gcc tcc ccc agc acg tcg gac ccc gac tac gtc tac acc tgg acg cgt 301 Ala Ser Pro Ser Thr Ser Asp Pro Asp Tyr Val Tyr Thr Trp Thr Arg 45 50 55 gat tcg tca ctc gtc ttc aag act atc atc gac cag ttc acc tcc ggg 349 Asp Ser Ser Leu Val Phe Lys Thr Ile Ile Asp Gln Phe Thr Ser Gly 60 65 70 gaa gac acc tcc ctc cgc aca ctc att gac cag ttc act agc gcg gag 397 Glu Asp Thr Ser Leu Arg Thr Leu Ile Asp Gln Phe Thr Ser Ala Glu 75 80 85 aag gac ctc cag cag acg tcc aac cct agt ggc act gtt tcc acc ggc 445 Lys Asp Leu Gln Gln Thr Ser Asn Pro Ser Gly Thr Val Ser Thr Gly 90 95 100 ggt ctc ggc gag ccc aag ttc aac atc gat ggg tcc gcg ttc acc ggt 493 Gly Leu Gly Glu Pro Lys Phe Asn Ile Asp Gly Ser Ala Phe Thr Gly 105 110 115 120 gcc tgg ggt cgc cct cag cgc ggt atg cac act cta cca cag ttg aag 541 Ala Trp Gly Arg Pro Gln Arg Gly Met His Thr Leu Pro Gln Leu Lys 125 130 135 ctt gtt aag cgc tta cat gtt ttg tgc aca gac ggt cct gct ctc cgc 589 Leu Val Lys Arg Leu His Val Leu Cys Thr Asp Gly Pro Ala Leu Arg 140 145 150 gcg act gct atc ata gcc tac gct aac tgg ctg ctc gac aac aac aac 637 Ala Thr Ala Ile Ile Ala Tyr Ala Asn Trp Leu Leu Asp Asn Asn Asn 155 160 165 ggc acg tcc tac gtc acc aac acc ctc tgg ccc atc atc aag ctt gac 685 Gly Thr Ser Tyr Val Thr Asn Thr Leu Trp Pro Ile Ile Lys Leu Asp 170 175 180 ttg gac tac acc cag aac aac tgg aac cag tcg ac gtaagttcat 730 Leu Asp Tyr Thr Gln Asn Asn Trp Asn Gln Ser Thr 185 190 195 tattccagct ttggctgcta gaactgcatt gatcctcatg tcttatgccc ag g ttc 786 Phe gac ctt tgg gag gag gtc aac tcc tcc tct ttc ttc acg act gcc gtc 834 Asp Leu

Trp Glu Glu Val Asn Ser Ser Ser Phe Phe Thr Thr Ala Val 200 205 210 cag cac cgt gct ctc cgc gag ggt atc gcc ttc gcg aag aag atc ggc 882 Gln His Arg Ala Leu Arg Glu Gly Ile Ala Phe Ala Lys Lys Ile Gly 215 220 225 caa acg tcg gtc gtg agc ggc tac acc acg cag gcg acc aac ctt ctc 930 Gln Thr Ser Val Val Ser Gly Tyr Thr Thr Gln Ala Thr Asn Leu Leu 230 235 240 245 tgc ttc ctg cag gtcagtgtgc atgtgcagca cgccttatgg ctatagctta 982 Cys Phe Leu Gln acccgtgttc cgcatcttcg cag tcg tac tgg aac ccc tcg ggc ggc tat gtc 1035 Ser Tyr Trp Asn Pro Ser Gly Gly Tyr Val 250 255 act gcg aac aca ggc ggc ggc cgg tcc ggc aag gac tcg aac acc gtc 1083 Thr Ala Asn Thr Gly Gly Gly Arg Ser Gly Lys Asp Ser Asn Thr Val 260 265 270 275 ctg acc tcg atc cac acc ttc gac ccc gcc gct ggc tgc gac gcc gcg 1131 Leu Thr Ser Ile His Thr Phe Asp Pro Ala Ala Gly Cys Asp Ala Ala 280 285 290 acg ttc cag ccg tgc tct gac aag gcc ctg tcc aac ctc aag gtc tac 1179 Thr Phe Gln Pro Cys Ser Asp Lys Ala Leu Ser Asn Leu Lys Val Tyr 295 300 305 gtc gac tcg ttc cgt tcc atc tac tcc atc aac agt ggc atc gcc tcc 1227 Val Asp Ser Phe Arg Ser Ile Tyr Ser Ile Asn Ser Gly Ile Ala Ser 310 315 320 aac gcc gct gtc gct gtt ggc cgc tac ccc gag gat gtg tac tac aac 1275 Asn Ala Ala Val Ala Val Gly Arg Tyr Pro Glu Asp Val Tyr Tyr Asn 325 330 335 ggc aac gtgagttccg tgtcccctgc atcattgtca acagcagaaa ctgaatccca 1331 Gly Asn 340 tccgcgtag ccc tgg tac ctc tcc acg tcc gcc gtc gct gag cag ctc tac 1382 Pro Trp Tyr Leu Ser Thr Ser Ala Val Ala Glu Gln Leu Tyr 345 350 355 gac gcg atc atc gtc tgg aac aag ctc ggc tcg ctc gaa gtg acg agc 1430 Asp Ala Ile Ile Val Trp Asn Lys Leu Gly Ser Leu Glu Val Thr Ser 360 365 370 acc tcg ctc gcg ttc ttc aag cag ctc tcc tcg gac gcc gcc gtc ggc 1478 Thr Ser Leu Ala Phe Phe Lys Gln Leu Ser Ser Asp Ala Ala Val Gly 375 380 385 acc tac tcg tcc tcg tcc gcg acg ttc aag acg ctc act gca gcc gcg 1526 Thr Tyr Ser Ser Ser Ser Ala Thr Phe Lys Thr Leu Thr Ala Ala Ala 390 395 400 aag aca ctc gcg gat ggc ttc ctc gct gtg aac gcg aag tac acg ccc 1574 Lys Thr Leu Ala Asp Gly Phe Leu Ala Val Asn Ala Lys Tyr Thr Pro 405 410 415 tcg aac ggc ggc ctc gcg gag cag ttc agc aag agc aac ggc tcg ccg 1622 Ser Asn Gly Gly Leu Ala Glu Gln Phe Ser Lys Ser Asn Gly Ser Pro 420 425 430 435 ctc agc gcc gtc gac ctc acg tgg agc tac gcc gcc gcg ctc acg tcc 1670 Leu Ser Ala Val Asp Leu Thr Trp Ser Tyr Ala Ala Ala Leu Thr Ser 440 445 450 ttt gcc gcg cgt gag ggc aag acc ccc gcg agc tgg ggc gct gcg ggc 1718 Phe Ala Ala Arg Glu Gly Lys Thr Pro Ala Ser Trp Gly Ala Ala Gly 455 460 465 ctc acc gtg ccg tcg acg tgc tcg ggt aac gcg ggc ccc agc gtg aag 1766 Leu Thr Val Pro Ser Thr Cys Ser Gly Asn Ala Gly Pro Ser Val Lys 470 475 480 gtg acg ttc aac gtc cag gct acg act acc ttc ggc g gtcagtcctc 1813 Val Thr Phe Asn Val Gln Ala Thr Thr Thr Phe Gly 485 490 495 ttctccaact cgtttcggtc ggtgatgttg agcattcgtc tgacgtgtgt gtgttactgc 1873 tgcttgcag ag aac atc tac atc acc ggt aac acc gct gcg ctc cag aac 1923 Glu Asn Ile Tyr Ile Thr Gly Asn Thr Ala Ala Leu Gln Asn 500 505 tgg tcg ccc gat aac gcg ctc ctc ctc tct gct gac aag tac ccc acc 1971 Trp Ser Pro Asp Asn Ala Leu Leu Leu Ser Ala Asp Lys Tyr Pro Thr 510 515 520 525 tgg agc a gtacgtgtca tctcatctcc agcctctcat attacgttgt ttgctcatct 2028 Trp Ser gcatgtgctt cgcag tc acg ctc gac ctc ccc gcg aac acc gtc gtc gag 2078 Ile Thr Leu Asp Leu Pro Ala Asn Thr Val Val Glu 530 535 tac aaa tac atc cgc aag ttc aac ggc cag gtc acc tgg gaa tcg gac 2126 Tyr Lys Tyr Ile Arg Lys Phe Asn Gly Gln Val Thr Trp Glu Ser Asp 540 545 550 555 ccc aac aac tcg atc acg acg ccc gcc gac ggt acc ttc acc cag aac 2174 Pro Asn Asn Ser Ile Thr Thr Pro Ala Asp Gly Thr Phe Thr Gln Asn 560 565 570 gac acc tgg cgg tga 2189 Asp Thr Trp Arg 575 5 593 PRT Pachykytospora papyracea 5 Met Arg Phe Thr Leu Leu Ser Ser Leu Val Ala Leu Ala Thr Gly Ala -15 -10 -5 Phe Ala Gln Thr Ser Gln Ala Asp Ala Tyr Val Lys Ser Glu Gly Pro -1 1 5 10 Ile Ala Lys Ala Gly Leu Leu Ala Asn Ile Gly Pro Ser Gly Ser Lys 15 20 25 30 Ser His Gly Ala Lys Ala Gly Leu Val Val Ala Ser Pro Ser Thr Ser 35 40 45 Asp Pro Asp Tyr Val Tyr Thr Trp Thr Arg Asp Ser Ser Leu Val Phe 50 55 60 Lys Thr Ile Ile Asp Gln Phe Thr Ser Gly Glu Asp Thr Ser Leu Arg 65 70 75 Thr Leu Ile Asp Gln Phe Thr Ser Ala Glu Lys Asp Leu Gln Gln Thr 80 85 90 Ser Asn Pro Ser Gly Thr Val Ser Thr Gly Gly Leu Gly Glu Pro Lys 95 100 105 110 Phe Asn Ile Asp Gly Ser Ala Phe Thr Gly Ala Trp Gly Arg Pro Gln 115 120 125 Arg Gly Met His Thr Leu Pro Gln Leu Lys Leu Val Lys Arg Leu His 130 135 140 Val Leu Cys Thr Asp Gly Pro Ala Leu Arg Ala Thr Ala Ile Ile Ala 145 150 155 Tyr Ala Asn Trp Leu Leu Asp Asn Asn Asn Gly Thr Ser Tyr Val Thr 160 165 170 Asn Thr Leu Trp Pro Ile Ile Lys Leu Asp Leu Asp Tyr Thr Gln Asn 175 180 185 190 Asn Trp Asn Gln Ser Thr Phe Asp Leu Trp Glu Glu Val Asn Ser Ser 195 200 205 Ser Phe Phe Thr Thr Ala Val Gln His Arg Ala Leu Arg Glu Gly Ile 210 215 220 Ala Phe Ala Lys Lys Ile Gly Gln Thr Ser Val Val Ser Gly Tyr Thr 225 230 235 Thr Gln Ala Thr Asn Leu Leu Cys Phe Leu Gln Ser Tyr Trp Asn Pro 240 245 250 Ser Gly Gly Tyr Val Thr Ala Asn Thr Gly Gly Gly Arg Ser Gly Lys 255 260 265 270 Asp Ser Asn Thr Val Leu Thr Ser Ile His Thr Phe Asp Pro Ala Ala 275 280 285 Gly Cys Asp Ala Ala Thr Phe Gln Pro Cys Ser Asp Lys Ala Leu Ser 290 295 300 Asn Leu Lys Val Tyr Val Asp Ser Phe Arg Ser Ile Tyr Ser Ile Asn 305 310 315 Ser Gly Ile Ala Ser Asn Ala Ala Val Ala Val Gly Arg Tyr Pro Glu 320 325 330 Asp Val Tyr Tyr Asn Gly Asn Pro Trp Tyr Leu Ser Thr Ser Ala Val 335 340 345 350 Ala Glu Gln Leu Tyr Asp Ala Ile Ile Val Trp Asn Lys Leu Gly Ser 355 360 365 Leu Glu Val Thr Ser Thr Ser Leu Ala Phe Phe Lys Gln Leu Ser Ser 370 375 380 Asp Ala Ala Val Gly Thr Tyr Ser Ser Ser Ser Ala Thr Phe Lys Thr 385 390 395 Leu Thr Ala Ala Ala Lys Thr Leu Ala Asp Gly Phe Leu Ala Val Asn 400 405 410 Ala Lys Tyr Thr Pro Ser Asn Gly Gly Leu Ala Glu Gln Phe Ser Lys 415 420 425 430 Ser Asn Gly Ser Pro Leu Ser Ala Val Asp Leu Thr Trp Ser Tyr Ala 435 440 445 Ala Ala Leu Thr Ser Phe Ala Ala Arg Glu Gly Lys Thr Pro Ala Ser 450 455 460 Trp Gly Ala Ala Gly Leu Thr Val Pro Ser Thr Cys Ser Gly Asn Ala 465 470 475 Gly Pro Ser Val Lys Val Thr Phe Asn Val Gln Ala Thr Thr Thr Phe 480 485 490 Gly Glu Asn Ile Tyr Ile Thr Gly Asn Thr Ala Ala Leu Gln Asn Trp 495 500 505 510 Ser Pro Asp Asn Ala Leu Leu Leu Ser Ala Asp Lys Tyr Pro Thr Trp 515 520 525 Ser Ile Thr Leu Asp Leu Pro Ala Asn Thr Val Val Glu Tyr Lys Tyr 530 535 540 Ile Arg Lys Phe Asn Gly Gln Val Thr Trp Glu Ser Asp Pro Asn Asn 545 550 555 Ser Ile Thr Thr Pro Ala Asp Gly Thr Phe Thr Gln Asn Asp Thr Trp 560 565 570 Arg 575 6 1725 DNA Pachykytospora papyracea misc_feature (1)..(1725) cDNA misc_feature (55)..(1725) coding region of cDNA misc_feature (1423)..(1725) binding domain 6 atgcgcttca ccctcctctc ctccctcgtc gccctcgcca ccggcgcgtt cgcccagacc 60 agccaggccg acgcgtacgt caagtccgag ggccccatcg cgaaggcggg cctcctcgcc 120 aacatcgggc ccagcggctc caagtcgcac ggggcgaagg ccggtctcgt cgtcgcctcc 180 cccagcacgt cggaccccga ctacgtctac acctggacgc gtgattcgtc actcgtcttc 240 aagactatca tcgaccagtt cacctccggg gaagacacct ccctccgcac actcattgac 300 cagttcacta gcgcggagaa ggacctccag cagacgtcca accctagtgg cactgtttcc 360 accggcggtc tcggcgagcc caagttcaac atcgatgggt ccgcgttcac cggtgcctgg 420 ggtcgccctc agcgcgacgg tcctgctctc cgcgcgactg ctatcatagc ctacgctaac 480 tggctgctcg acaacaacaa cggcacgtcc tacgtcacca acaccctctg gcccatcatc 540 aagcttgact tggactacac ccagaacaac tggaaccagt cgacgttcga cctttgggag 600 gaggtcaact cctcctcttt cttcacgact gccgtccagc accgtgctct ccgcgagggt 660 atcgccttcg cgaagaagat cggccaaacg tcggtcgtga gcggctacac cacgcaggcg 720 accaaccttc tctgcttcct gcagtcgtac tggaacccct cgggcggcta tgtcactgcg 780 aacacaggcg gcggccggtc cggcaaggac tcgaacaccg tcctgacctc gatccacacc 840 ttcgaccccg ccgctggctg cgacgccgcg acgttccagc cgtgctctga caaggccctg 900 tccaacctca aggtctacgt cgactcgttc cgttccatct actccatcaa cagtggcatc 960 gcctccaacg ccgctgtcgc tgttggccgc taccccgagg atgtgtacta caacggcaac 1020 ccctggtacc tctccacgtc cgccgtcgct gagcagctct acgacgcgat catcgtctgg 1080 aacaagctcg gctcgctcga agtgacgagc acctcgctcg cgttcttcaa gcagctctcc 1140 tcggacgccg ccgtcggcac ctactcgtcc tcgtccgcga cgttcaagac gctcactgca 1200 gccgcgaaga cactcgcgga tggcttcctc gctgtgaacg cgaagtacac gccctcgaac 1260 ggcggcctcg cggagcagtt cagcaagagc aacggctcgc cgctcagcgc cgtcgacctc 1320 acgtggagct acgccgccgc gctcacgtcc tttgccgcgc gtgagggcaa gacccccgcg 1380 agctggggcg ctgcgggcct caccgtgccg tcgacgtgct cgggtaacgc gggccccagc 1440 gtgaaggtga cgttcaacgt ccaggctacg actaccttcg gcgagaacat ctacatcacc 1500 ggtaacaccg ctgcgctcca gaactggtcg cccgataacg cgctcctcct ctctgctgac 1560 aagtacccca cctggagcat cacgctcgac ctccccgcga acaccgtcgt cgagtacaaa 1620 tacatccgca agttcaacgg ccaggtcacc tgggaatcgg accccaacaa ctcgatcacg 1680 acgcccgccg acggtacctt cacccagaac gacacctggc ggtga 1725 7 18 DNA Artificial Degenerated Primer ArAF1 misc_feature (2)..(2) R = A or G misc_feature (4)..(4) R = A or G misc_feature (7)..(7) Y = C or T misc_feature (8)..(8) D = A or G or T misc_feature (9)..(9) V = A or C or G misc_feature (16)..(16) Y = C or T 7 crtrctydvc aacatygg 18 8 22 DNA Artificial Degenerated Primer ArAF3 misc_feature (7)..(7) R = A or G misc_feature (10)..(10) D = A or G or T misc_feature (13)..(13) Y = C or T misc_feature (16)..(16) R = A or G misc_feature (17)..(17) R = A or G misc_feature (19)..(19) S = C or G 8 gtcagarcad ggytgrrasg tg 22 9 23 DNA Artificial AM2F degenerated primer misc_feature (6)..(6) n is inosine misc_feature (7)..(7) M = A or C misc_feature (9)..(9) N = A or C or G or T misc_feature (12)..(12) N = A or C or G or T misc_feature (15)..(15) R = A or G misc_feature (16)..(16) M = A or C misc_feature (18)..(18) N = A or C or G or T misc_feature (21)..(21) Y = C or T 9 tggggnmgnc cncarmgnga ygg 23 10 18 DNA Artificial AM4R2 degenerated primer misc_feature (1)..(1) R = A or G misc_feature (4)..(4) Y = C or T misc_feature (7)..(7) N = A or C or G or T misc_feature (10)..(10) R = A or G misc_feature (13)..(13) N = A or C or G or T misc_feature (15)..(15) K = G or T misc_feature (16)..(16) n is a, c, g, or t misc_feature (136)..(16) N = A or C or G or T 10 rtcytcnggr tanckncc 18 11 17 DNA Artificial AMF3 degenerated primer misc_feature (3)..(3) Y = C or T misc_feature (6)..(6) Y = C or T misc_feature (7)..(7) Y = C or T misc_feature (9)..(9) N = A or C or G or T misc_feature (10)..(10) Y = C or T misc_feature (15)..(15) R = A or G 11 taygayytny gggarga 17 12 21 DNA Artificial TraF1 primer misc_feature (1)..(21) TraF1 primer 12 tagtcgtact ggaaccccac c 21 13 35 DNA Artificial C1 primer 13 gtacatattg tcgttagaac gcgtaatacg actca 35 14 23 DNA Artificial TC5' primer misc_feature (1)..(23) TC5' primer 14 cgtatatgtc agcgctacca tgt 23 15 23 DNA Artificial TC3' primer misc_feature (1)..(23) TC3' primer 15 aaacgtgagc gaccattttc tgt 23 16 36 DNA Artificial TFF primer 16 tttggatcca ccatgcgttt cacgctcctc acctcc 36 17 30 DNA Artificial TFR primer 17 tttctcgagc taccgccagg tgtcattctg 30 18 23 DNA Artificial PP5' primer 18 cctccctgag tgagcgatgc tgc 23 19 23 DNA Artificial PP3' primer 19 caactccggc ctctcctcca gcg 23 20 36 DNA Artificial PPF primer 20 tttggatcca ccatgcgctt caccctcctc tcctcc 36 21 30 DNA Artificial PPR primer 21 tttctcgagt caccgccagg tgtcgttctg 30 22 31 PRT Aspergillus kawachii PEPTIDE (1)..(31) Linker 22 Thr Thr Thr Thr Thr Thr Ala Ala Ala Thr Ser Thr Ser Lys Ala Thr 1 5 10 15 Thr Ser Ser Ser Ser Ser Ser Ala Ala Ala Thr Thr Ser Ser Ser 20 25 30 23 2494 DNA Leucopaxillus giganteus misc_feature (29)..(29) n is a, c, g, or t misc_feature (38)..(38) n is a, c, g, or t sig_peptide (66)..(128) CDS (66)..(319) mat_peptide (117)..(2249) Intron (320)..(375) CDS (376)..(540) Intron (541)..(591) CDS (592)..(605) Intron (606)..(664) CDS (665)..(809) Intron (810)..(863) CDS (864)..(1023) Intron (1024)..(1088) CDS (1089)..(1361) Intron (1362)..(1415) CDS (1416)..(1896) misc_feature (1821)..(1853) Linker misc_feature (1854)..(2249) binding domain Intron (1897)..(1954) CDS (1955)..(2014) Intron (2015)..(2106) CDS (2107)..(2249) 23 tataaagagc gtcgcttcag cgatacctnt tcttcagngc atttcgcctc tcccttctaa 60 gcagg atg cat ttc tct gtc ctc tcc gta ttt ctc gcg att agt tct gct 110 Met His Phe Ser Val Leu Ser Val Phe Leu Ala Ile Ser Ser Ala -15 -10 -5 tgg gct cag tct agc gca gtc gat gcc tat ctc gct ctc gaa tcc tcc 158 Trp Ala Gln Ser Ser Ala Val Asp Ala Tyr Leu Ala Leu Glu Ser Ser -1 1 5 10 gtc gcc aag gcc ggg ttg ctc gcc aac att ggc cca tct ggt tca aag 206 Val Ala Lys Ala Gly Leu Leu Ala Asn Ile Gly Pro Ser Gly Ser Lys 15 20 25 30 tct tcg ggt gcc aag tct ggg att gtc att gcg tcg cct tcg cat agc 254 Ser Ser Gly Ala Lys Ser Gly Ile Val Ile Ala Ser Pro Ser His Ser 35 40 45 aac cct gac tac ctg ttc acc tgg acc cgc gat tct tcg ctt gtg ttc 302 Asn Pro Asp Tyr Leu Phe Thr Trp Thr Arg Asp Ser Ser Leu Val Phe 50 55 60 cag act atc atc aac ca gtaggtgtct tcctcttcta ggtcgctgct 349 Gln Thr Ile Ile Asn Gln 65 tgtcgttgac acgaggacac gcccag g ttc acg ttg gga cac gac aat agt 400 Phe Thr Leu Gly His Asp Asn Ser 70 75 ttg agg cct gag att gac aat ttt gtt gat tcc caa agg aag atc caa 448 Leu Arg Pro Glu Ile Asp Asn Phe Val Asp Ser Gln Arg Lys Ile Gln 80 85 90 caa gtc tca aac cct tcg gga act gtt agt tct ggc ggc ctt ggc gag 496 Gln Val Ser Asn Pro Ser Gly Thr Val Ser Ser Gly Gly Leu Gly Glu 95 100 105 ccc aag ttc aat atc gac gaa acc gcc ttt aca ggg gca tgg gg 540 Pro Lys Phe Asn Ile Asp Glu Thr Ala Phe Thr Gly Ala Trp Gly 110 115 120 gtgagtcctt cctggactgc gtcatataca taattcacag atattgtcta g g cgg 595 Arg ccc caa cga g gtaactagtc taccatgatt accgggatgc aacatcaaca 645 Pro Gln Arg 125 gttttcgcat tatttgtag at gga cct gct ctc cga tcc acc gcg ctc att 696 Asp Gly Pro Ala Leu Arg Ser Thr Ala Leu Ile 130 135 acc tgg gcc aat tac ctg atc gct aac agc aac aca tcc tac gtc acc 744 Thr Trp Ala Asn Tyr Leu Ile Ala Asn Ser Asn Thr Ser Tyr Val Thr 140 145 150 aac acc cta tgg ccc atc atc aaa ttg gac ctc gac tac gtc gcg

tcc 792 Asn Thr Leu Trp Pro Ile Ile Lys Leu Asp Leu Asp Tyr Val Ala Ser 155 160 165 170 aac tgg aac cag act gg gtgagtcact tgactatttt cgcaactttc 839 Asn Trp Asn Gln Thr Gly 175 ttggttcatg aaagctactc ccag t ttc gat ttg tgg gaa gaa gta tcc tct 891 Phe Asp Leu Trp Glu Glu Val Ser Ser 180 185 tct tcc ttc ttc act act gcg gtt caa cac cgc tcc ctt cgc caa ggt 939 Ser Ser Phe Phe Thr Thr Ala Val Gln His Arg Ser Leu Arg Gln Gly 190 195 200 gct tcc cta gcc act gcc att gga caa acc tct gtc gtt cct ggc tac 987 Ala Ser Leu Ala Thr Ala Ile Gly Gln Thr Ser Val Val Pro Gly Tyr 205 210 215 acc acc cag gcc aac aat ata ctc tgc ttt caa cag gtggctcctt 1033 Thr Thr Gln Ala Asn Asn Ile Leu Cys Phe Gln Gln 220 225 tctttctttt cttacaacta gcatacacga agaacctgac actcaaattt gctag tcc 1091 Ser 230 tac tgg aac tca gct ggg tat atg act gcc aat acc gga ggc ggg cgt 1139 Tyr Trp Asn Ser Ala Gly Tyr Met Thr Ala Asn Thr Gly Gly Gly Arg 235 240 245 tct ggg aaa gac gcc aac acc gtc ctc aca agt att cac aca ttc gat 1187 Ser Gly Lys Asp Ala Asn Thr Val Leu Thr Ser Ile His Thr Phe Asp 250 255 260 ccc gat gcc ggc tgc gat tcc atc act ttc caa cct tgt tca gac cgt 1235 Pro Asp Ala Gly Cys Asp Ser Ile Thr Phe Gln Pro Cys Ser Asp Arg 265 270 275 gcg ctc atc aac ctt gtc aca tac gtc aat gca ttc cga agc atc tac 1283 Ala Leu Ile Asn Leu Val Thr Tyr Val Asn Ala Phe Arg Ser Ile Tyr 280 285 290 gct atc aac gcg ggc atc gct aat aac caa ggc gtt gcc act ggt agg 1331 Ala Ile Asn Ala Gly Ile Ala Asn Asn Gln Gly Val Ala Thr Gly Arg 295 300 305 310 tat cct gaa gat ggc tac atg ggc gga aac gtatgccttg tccactcgcc 1381 Tyr Pro Glu Asp Gly Tyr Met Gly Gly Asn 315 320 gtccacagtc ctcgaagcct gatcgctgcc ttag cct tgg tat ctg act act tta 1436 Pro Trp Tyr Leu Thr Thr Leu 325 gcc gtt tct gaa cag ctc tac tac gct ctc tcc act tgg aag aaa cat 1484 Ala Val Ser Glu Gln Leu Tyr Tyr Ala Leu Ser Thr Trp Lys Lys His 330 335 340 agc tcc ctc acc att acg gcg aca tca caa cct ttt ttc gcg ctc ttc 1532 Ser Ser Leu Thr Ile Thr Ala Thr Ser Gln Pro Phe Phe Ala Leu Phe 345 350 355 tcg ccg ggt gtt gct act ggc aca tat gcg tcc tct acg act acc tat 1580 Ser Pro Gly Val Ala Thr Gly Thr Tyr Ala Ser Ser Thr Thr Thr Tyr 360 365 370 375 gct aca ctt act act gct att cag aat tac gcg gat agc ttc atc gct 1628 Ala Thr Leu Thr Thr Ala Ile Gln Asn Tyr Ala Asp Ser Phe Ile Ala 380 385 390 gtc gtg gct aag tat acg cct gcc aat ggc gga ctg gcg gaa cag tac 1676 Val Val Ala Lys Tyr Thr Pro Ala Asn Gly Gly Leu Ala Glu Gln Tyr 395 400 405 agc agg agt aac ggt ttg ccc gtt agt gcc gtt gat tta act tgg agc 1724 Ser Arg Ser Asn Gly Leu Pro Val Ser Ala Val Asp Leu Thr Trp Ser 410 415 420 tat gcc gct ctc ttg acg gcg gct gat gcg cga gcg ggg cta aca ccc 1772 Tyr Ala Ala Leu Leu Thr Ala Ala Asp Ala Arg Ala Gly Leu Thr Pro 425 430 435 gct gca tgg gga gca gcg ggg ttg acc gtg cca agc act tgc tct act 1820 Ala Ala Trp Gly Ala Ala Gly Leu Thr Val Pro Ser Thr Cys Ser Thr 440 445 450 455 ggg ggt ggt tca aac cca ggt ggt gga ggg tcg gtc tct gtt acg ttc 1868 Gly Gly Gly Ser Asn Pro Gly Gly Gly Gly Ser Val Ser Val Thr Phe 460 465 470 aat gtt caa gct aca acc acc ttt ggt g gtaggtccca ttcaacacgc 1916 Asn Val Gln Ala Thr Thr Thr Phe Gly 475 480 gcagattttg ctgggaaatc tcatgattgg tttgacag aa aac att ttt ttg acc 1971 Glu Asn Ile Phe Leu Thr 485 ggc tcg atc aac gag tta gct aac tgg tct cct gat aat gct c 2014 Gly Ser Ile Asn Glu Leu Ala Asn Trp Ser Pro Asp Asn Ala 490 495 500 tcgccctctc tgcggccaat tatcccacct ggagcagtca gtcccagtcc atcgctccac 2074 tacaagccat caaccgctga ccatatctct ag ta acc gtc aac gtt ccc gca 2126 Leu Thr Val Asn Val Pro Ala 505 agc act acg atc caa tac aag ttt atc cgt aaa ttc aac gga gcc atc 2174 Ser Thr Thr Ile Gln Tyr Lys Phe Ile Arg Lys Phe Asn Gly Ala Ile 510 515 520 acc tgg gag tcc gac ccg aat agg cag atc aca acg ccg tct tcg gga 2222 Thr Trp Glu Ser Asp Pro Asn Arg Gln Ile Thr Thr Pro Ser Ser Gly 525 530 535 agt ttt gtc cag aat gac tcg tgg aag tagtcggtag ataagatgtg 2269 Ser Phe Val Gln Asn Asp Ser Trp Lys 540 545 caagatgagg tccatggctc acccaaacgt tactcatagt aaatttgata ctgaaatttg 2329 ttcagcacat gaaatcgtta ttcctcctct gacgtttagt gaagaataaa gcgagatccc 2389 gcccaggaag gtgctatagt gtagtggtta tcactcggga ttttgatgtg gtactaagta 2449 tcatacaaca ttcccgagac ccaggttcga accctggtag cacct 2494 24 565 PRT Leucopaxillus giganteus 24 Met His Phe Ser Val Leu Ser Val Phe Leu Ala Ile Ser Ser Ala Trp -15 -10 -5 Ala Gln Ser Ser Ala Val Asp Ala Tyr Leu Ala Leu Glu Ser Ser Val -1 1 5 10 15 Ala Lys Ala Gly Leu Leu Ala Asn Ile Gly Pro Ser Gly Ser Lys Ser 20 25 30 Ser Gly Ala Lys Ser Gly Ile Val Ile Ala Ser Pro Ser His Ser Asn 35 40 45 Pro Asp Tyr Leu Phe Thr Trp Thr Arg Asp Ser Ser Leu Val Phe Gln 50 55 60 Thr Ile Ile Asn Gln Phe Thr Leu Gly His Asp Asn Ser Leu Arg Pro 65 70 75 Glu Ile Asp Asn Phe Val Asp Ser Gln Arg Lys Ile Gln Gln Val Ser 80 85 90 95 Asn Pro Ser Gly Thr Val Ser Ser Gly Gly Leu Gly Glu Pro Lys Phe 100 105 110 Asn Ile Asp Glu Thr Ala Phe Thr Gly Ala Trp Gly Arg Pro Gln Arg 115 120 125 Asp Gly Pro Ala Leu Arg Ser Thr Ala Leu Ile Thr Trp Ala Asn Tyr 130 135 140 Leu Ile Ala Asn Ser Asn Thr Ser Tyr Val Thr Asn Thr Leu Trp Pro 145 150 155 Ile Ile Lys Leu Asp Leu Asp Tyr Val Ala Ser Asn Trp Asn Gln Thr 160 165 170 175 Gly Phe Asp Leu Trp Glu Glu Val Ser Ser Ser Ser Phe Phe Thr Thr 180 185 190 Ala Val Gln His Arg Ser Leu Arg Gln Gly Ala Ser Leu Ala Thr Ala 195 200 205 Ile Gly Gln Thr Ser Val Val Pro Gly Tyr Thr Thr Gln Ala Asn Asn 210 215 220 Ile Leu Cys Phe Gln Gln Ser Tyr Trp Asn Ser Ala Gly Tyr Met Thr 225 230 235 Ala Asn Thr Gly Gly Gly Arg Ser Gly Lys Asp Ala Asn Thr Val Leu 240 245 250 255 Thr Ser Ile His Thr Phe Asp Pro Asp Ala Gly Cys Asp Ser Ile Thr 260 265 270 Phe Gln Pro Cys Ser Asp Arg Ala Leu Ile Asn Leu Val Thr Tyr Val 275 280 285 Asn Ala Phe Arg Ser Ile Tyr Ala Ile Asn Ala Gly Ile Ala Asn Asn 290 295 300 Gln Gly Val Ala Thr Gly Arg Tyr Pro Glu Asp Gly Tyr Met Gly Gly 305 310 315 Asn Pro Trp Tyr Leu Thr Thr Leu Ala Val Ser Glu Gln Leu Tyr Tyr 320 325 330 335 Ala Leu Ser Thr Trp Lys Lys His Ser Ser Leu Thr Ile Thr Ala Thr 340 345 350 Ser Gln Pro Phe Phe Ala Leu Phe Ser Pro Gly Val Ala Thr Gly Thr 355 360 365 Tyr Ala Ser Ser Thr Thr Thr Tyr Ala Thr Leu Thr Thr Ala Ile Gln 370 375 380 Asn Tyr Ala Asp Ser Phe Ile Ala Val Val Ala Lys Tyr Thr Pro Ala 385 390 395 Asn Gly Gly Leu Ala Glu Gln Tyr Ser Arg Ser Asn Gly Leu Pro Val 400 405 410 415 Ser Ala Val Asp Leu Thr Trp Ser Tyr Ala Ala Leu Leu Thr Ala Ala 420 425 430 Asp Ala Arg Ala Gly Leu Thr Pro Ala Ala Trp Gly Ala Ala Gly Leu 435 440 445 Thr Val Pro Ser Thr Cys Ser Thr Gly Gly Gly Ser Asn Pro Gly Gly 450 455 460 Gly Gly Ser Val Ser Val Thr Phe Asn Val Gln Ala Thr Thr Thr Phe 465 470 475 Gly Glu Asn Ile Phe Leu Thr Gly Ser Ile Asn Glu Leu Ala Asn Trp 480 485 490 495 Ser Pro Asp Asn Ala Leu Thr Val Asn Val Pro Ala Ser Thr Thr Ile 500 505 510 Gln Tyr Lys Phe Ile Arg Lys Phe Asn Gly Ala Ile Thr Trp Glu Ser 515 520 525 Asp Pro Asn Arg Gln Ile Thr Thr Pro Ser Ser Gly Ser Phe Val Gln 530 535 540 Asn Asp Ser Trp Lys 545 25 1722 DNA Leucopaxillus giganteus CDS (1)..(1719) cDNA sig_peptide (1)..(51) misc_feature (1)..(1404) Catalytic Domain mat_peptide (52)..(1719) misc_feature (1405)..(1437) Linker misc_feature (1438)..(1719) binding domain 25 atg cat ttc tct gtc ctc tcc gta ttt ctc gcg att agt tct gct tgg 48 Met His Phe Ser Val Leu Ser Val Phe Leu Ala Ile Ser Ser Ala Trp -15 -10 -5 gct cag tct agc gca gtc gat gcc tat ctc gct ctc gaa tcc tcc gtc 96 Ala Gln Ser Ser Ala Val Asp Ala Tyr Leu Ala Leu Glu Ser Ser Val -1 1 5 10 15 gcc aag gcc ggg ttg ctc gcc aac att ggc cca tct ggt tca aag tct 144 Ala Lys Ala Gly Leu Leu Ala Asn Ile Gly Pro Ser Gly Ser Lys Ser 20 25 30 tcg ggt gcc aag tct ggg att gtc att gcg tcg cct tcg cat agc aac 192 Ser Gly Ala Lys Ser Gly Ile Val Ile Ala Ser Pro Ser His Ser Asn 35 40 45 cct gac tac ctg ttc acc tgg acc cgc gat tct tcg ctt gtg ttc cag 240 Pro Asp Tyr Leu Phe Thr Trp Thr Arg Asp Ser Ser Leu Val Phe Gln 50 55 60 act atc atc aac cag ttc acg ttg gga cac gac aat agt ttg agg cct 288 Thr Ile Ile Asn Gln Phe Thr Leu Gly His Asp Asn Ser Leu Arg Pro 65 70 75 gag att gac aat ttt gtt gat tcc caa agg aag atc caa caa gtc tca 336 Glu Ile Asp Asn Phe Val Asp Ser Gln Arg Lys Ile Gln Gln Val Ser 80 85 90 95 aac cct tcg gga act gtt agt tct ggc ggc ctt ggc gag ccc aag ttc 384 Asn Pro Ser Gly Thr Val Ser Ser Gly Gly Leu Gly Glu Pro Lys Phe 100 105 110 aat atc gac gaa acc gcc ttt aca ggg gca tgg ggg gat gga cct gct 432 Asn Ile Asp Glu Thr Ala Phe Thr Gly Ala Trp Gly Asp Gly Pro Ala 115 120 125 ctc cga tcc acc gcg ctc att acc tgg gcc aat tac ctg atc gct aac 480 Leu Arg Ser Thr Ala Leu Ile Thr Trp Ala Asn Tyr Leu Ile Ala Asn 130 135 140 agc aac aca tcc tac gtc acc aac acc cta tgg ccc atc atc aaa ttg 528 Ser Asn Thr Ser Tyr Val Thr Asn Thr Leu Trp Pro Ile Ile Lys Leu 145 150 155 gac ctc gac tac gtc gcg tcc aac tgg aac cag act agt ttc gat ttg 576 Asp Leu Asp Tyr Val Ala Ser Asn Trp Asn Gln Thr Ser Phe Asp Leu 160 165 170 175 tgg gaa gaa gta tcc tct tct tcc ttc ttc act act gcg gtt caa cac 624 Trp Glu Glu Val Ser Ser Ser Ser Phe Phe Thr Thr Ala Val Gln His 180 185 190 cgc tcc ctt cgc caa ggt gct tcc cta gcc act gcc att gga caa acc 672 Arg Ser Leu Arg Gln Gly Ala Ser Leu Ala Thr Ala Ile Gly Gln Thr 195 200 205 tct gtc gtt ccw ggc tac acc acc cag gcc aac aat ata ctc tgc ttt 720 Ser Val Val Xaa Gly Tyr Thr Thr Gln Ala Asn Asn Ile Leu Cys Phe 210 215 220 caa cag tcc tac tgg aac tca gct ggg tat atg act gcc aat acc gga 768 Gln Gln Ser Tyr Trp Asn Ser Ala Gly Tyr Met Thr Ala Asn Thr Gly 225 230 235 ggc ggg cgt tct ggg aaa gac gcc aac acc gtc ctc aca agt att cac 816 Gly Gly Arg Ser Gly Lys Asp Ala Asn Thr Val Leu Thr Ser Ile His 240 245 250 255 aca ttc gat ccc gat gcc ggc tgc gat tcc atc act ttc caa cct tgt 864 Thr Phe Asp Pro Asp Ala Gly Cys Asp Ser Ile Thr Phe Gln Pro Cys 260 265 270 tca gac cgt gcg ctc atc aac ctt gtc aca tac gtc aat gca ttc cga 912 Ser Asp Arg Ala Leu Ile Asn Leu Val Thr Tyr Val Asn Ala Phe Arg 275 280 285 agc atc tac gct atc aac gcg ggc atc gct aat aac caa ggc gtt gcc 960 Ser Ile Tyr Ala Ile Asn Ala Gly Ile Ala Asn Asn Gln Gly Val Ala 290 295 300 act ggt agg tat cct gaa gat ggc tac atg ggc gga aac cct tgg tat 1008 Thr Gly Arg Tyr Pro Glu Asp Gly Tyr Met Gly Gly Asn Pro Trp Tyr 305 310 315 ctg act act tta gcc gtt tct gaa cag ctc tac tac gct ctc tcc act 1056 Leu Thr Thr Leu Ala Val Ser Glu Gln Leu Tyr Tyr Ala Leu Ser Thr 320 325 330 335 tgg aag aaa cat agc tcc ctc acc att acg gcg aca tca caa cct ttt 1104 Trp Lys Lys His Ser Ser Leu Thr Ile Thr Ala Thr Ser Gln Pro Phe 340 345 350 ttc gcg ctc ttc tcg ccg ggt gtt gct act ggc aca tat gcg tcc tct 1152 Phe Ala Leu Phe Ser Pro Gly Val Ala Thr Gly Thr Tyr Ala Ser Ser 355 360 365 acg act acc tat gct aca ctt act act gct att cag aat tac gcg gat 1200 Thr Thr Thr Tyr Ala Thr Leu Thr Thr Ala Ile Gln Asn Tyr Ala Asp 370 375 380 agc ttc atc gct gtc gtg gct aag tat acg cct gcc aat ggc gga ctg 1248 Ser Phe Ile Ala Val Val Ala Lys Tyr Thr Pro Ala Asn Gly Gly Leu 385 390 395 gcg gaa cag tac agc agg agt aac ggt ttg ccc gtt agt gcc gtt gat 1296 Ala Glu Gln Tyr Ser Arg Ser Asn Gly Leu Pro Val Ser Ala Val Asp 400 405 410 415 tta act tgg agc tat gcc gct ctc ttg acg gcg gct gat gcg cga gcg 1344 Leu Thr Trp Ser Tyr Ala Ala Leu Leu Thr Ala Ala Asp Ala Arg Ala 420 425 430 ggg cta aca ccc gct gca tgg gga gca gcg ggg ttg acc gtg cca agc 1392 Gly Leu Thr Pro Ala Ala Trp Gly Ala Ala Gly Leu Thr Val Pro Ser 435 440 445 act tgc tct act ggg ggt ggt tca aac cca ggt ggt gga ggg tcg gtc 1440 Thr Cys Ser Thr Gly Gly Gly Ser Asn Pro Gly Gly Gly Gly Ser Val 450 455 460 tct gtt acg ttc aat gtt caa gct aca acc acc ttt ggt gaa aac att 1488 Ser Val Thr Phe Asn Val Gln Ala Thr Thr Thr Phe Gly Glu Asn Ile 465 470 475 ttt ttg acc ggc tcg atc aac gag tta gct aac tgg tct cct gat aat 1536 Phe Leu Thr Gly Ser Ile Asn Glu Leu Ala Asn Trp Ser Pro Asp Asn 480 485 490 495 gct ctc gcc ctc tct gcg gcc aat tat ccc acc tgg agc agt acc gtc 1584 Ala Leu Ala Leu Ser Ala Ala Asn Tyr Pro Thr Trp Ser Ser Thr Val 500 505 510 aac gtt ccc gca agc act acg atc caa tac aag ttt atc cgt aaa ttc 1632 Asn Val Pro Ala Ser Thr Thr Ile Gln Tyr Lys Phe Ile Arg Lys Phe 515 520 525 aac gga gcc atc acc tgg gag tcc gac ccg aat agg cag atc aca acg 1680 Asn Gly Ala Ile Thr Trp Glu Ser Asp Pro Asn Arg Gln Ile Thr Thr 530 535 540 ccg tct tcg gga agt ttt gtc cag aat gac tcg tgg aag tag 1722 Pro Ser Ser Gly Ser Phe Val Gln Asn Asp Ser Trp Lys 545 550 555 26 573 PRT Leucopaxillus giganteus misc_feature (211)..(211) The 'Xaa' at location 211 stands for Pro. 26 Met His Phe Ser Val Leu Ser Val Phe Leu Ala Ile Ser Ser Ala Trp -15 -10 -5 Ala Gln Ser Ser Ala Val Asp Ala Tyr Leu Ala Leu Glu Ser Ser Val -1 1 5 10 15 Ala Lys Ala Gly Leu Leu Ala Asn Ile Gly Pro Ser Gly Ser Lys Ser 20 25 30 Ser Gly Ala Lys Ser Gly Ile Val Ile Ala Ser Pro Ser His Ser Asn 35 40 45 Pro Asp Tyr Leu Phe Thr Trp Thr Arg Asp Ser Ser Leu Val Phe Gln 50 55 60 Thr Ile Ile Asn Gln Phe Thr Leu Gly His Asp Asn Ser Leu Arg Pro 65 70 75 Glu Ile Asp Asn Phe Val Asp Ser Gln Arg Lys Ile Gln Gln Val Ser 80 85 90 95 Asn Pro Ser Gly Thr Val Ser Ser Gly Gly Leu Gly Glu Pro

Lys Phe 100 105 110 Asn Ile Asp Glu Thr Ala Phe Thr Gly Ala Trp Gly Asp Gly Pro Ala 115 120 125 Leu Arg Ser Thr Ala Leu Ile Thr Trp Ala Asn Tyr Leu Ile Ala Asn 130 135 140 Ser Asn Thr Ser Tyr Val Thr Asn Thr Leu Trp Pro Ile Ile Lys Leu 145 150 155 Asp Leu Asp Tyr Val Ala Ser Asn Trp Asn Gln Thr Ser Phe Asp Leu 160 165 170 175 Trp Glu Glu Val Ser Ser Ser Ser Phe Phe Thr Thr Ala Val Gln His 180 185 190 Arg Ser Leu Arg Gln Gly Ala Ser Leu Ala Thr Ala Ile Gly Gln Thr 195 200 205 Ser Val Val Xaa Gly Tyr Thr Thr Gln Ala Asn Asn Ile Leu Cys Phe 210 215 220 Gln Gln Ser Tyr Trp Asn Ser Ala Gly Tyr Met Thr Ala Asn Thr Gly 225 230 235 Gly Gly Arg Ser Gly Lys Asp Ala Asn Thr Val Leu Thr Ser Ile His 240 245 250 255 Thr Phe Asp Pro Asp Ala Gly Cys Asp Ser Ile Thr Phe Gln Pro Cys 260 265 270 Ser Asp Arg Ala Leu Ile Asn Leu Val Thr Tyr Val Asn Ala Phe Arg 275 280 285 Ser Ile Tyr Ala Ile Asn Ala Gly Ile Ala Asn Asn Gln Gly Val Ala 290 295 300 Thr Gly Arg Tyr Pro Glu Asp Gly Tyr Met Gly Gly Asn Pro Trp Tyr 305 310 315 Leu Thr Thr Leu Ala Val Ser Glu Gln Leu Tyr Tyr Ala Leu Ser Thr 320 325 330 335 Trp Lys Lys His Ser Ser Leu Thr Ile Thr Ala Thr Ser Gln Pro Phe 340 345 350 Phe Ala Leu Phe Ser Pro Gly Val Ala Thr Gly Thr Tyr Ala Ser Ser 355 360 365 Thr Thr Thr Tyr Ala Thr Leu Thr Thr Ala Ile Gln Asn Tyr Ala Asp 370 375 380 Ser Phe Ile Ala Val Val Ala Lys Tyr Thr Pro Ala Asn Gly Gly Leu 385 390 395 Ala Glu Gln Tyr Ser Arg Ser Asn Gly Leu Pro Val Ser Ala Val Asp 400 405 410 415 Leu Thr Trp Ser Tyr Ala Ala Leu Leu Thr Ala Ala Asp Ala Arg Ala 420 425 430 Gly Leu Thr Pro Ala Ala Trp Gly Ala Ala Gly Leu Thr Val Pro Ser 435 440 445 Thr Cys Ser Thr Gly Gly Gly Ser Asn Pro Gly Gly Gly Gly Ser Val 450 455 460 Ser Val Thr Phe Asn Val Gln Ala Thr Thr Thr Phe Gly Glu Asn Ile 465 470 475 Phe Leu Thr Gly Ser Ile Asn Glu Leu Ala Asn Trp Ser Pro Asp Asn 480 485 490 495 Ala Leu Ala Leu Ser Ala Ala Asn Tyr Pro Thr Trp Ser Ser Thr Val 500 505 510 Asn Val Pro Ala Ser Thr Thr Ile Gln Tyr Lys Phe Ile Arg Lys Phe 515 520 525 Asn Gly Ala Ile Thr Trp Glu Ser Asp Pro Asn Arg Gln Ile Thr Thr 530 535 540 Pro Ser Ser Gly Ser Phe Val Gln Asn Asp Ser Trp Lys 545 550 555 27 1761 DNA Artificial Hybrid Fungamyl variant JA118 with A. rolfsii SBD mat_peptide (1)..(1758) CDS (1)..(1758) 27 gca acg cct gcg gac tgg cga tcg caa tcc att tat ttc ctt ctc acg 48 Ala Thr Pro Ala Asp Trp Arg Ser Gln Ser Ile Tyr Phe Leu Leu Thr 1 5 10 15 gat cga ttt gca agg acg gat ggg tcg acg act gcg act tgt aat act 96 Asp Arg Phe Ala Arg Thr Asp Gly Ser Thr Thr Ala Thr Cys Asn Thr 20 25 30 gcg gat cag aaa tac tgt ggt gga aca tgg cag ggc atc atc gac aag 144 Ala Asp Gln Lys Tyr Cys Gly Gly Thr Trp Gln Gly Ile Ile Asp Lys 35 40 45 ttg gac tat atc cag gga atg ggc ttc aca gcc atc tgg atc acc ccc 192 Leu Asp Tyr Ile Gln Gly Met Gly Phe Thr Ala Ile Trp Ile Thr Pro 50 55 60 gtt aca gcc cag ctg ccc cag acc acc gca tat gga gat gcc tac cat 240 Val Thr Ala Gln Leu Pro Gln Thr Thr Ala Tyr Gly Asp Ala Tyr His 65 70 75 80 ggc tac tgg cag cag gat ata tac tct ctg aac gaa aac tac ggc act 288 Gly Tyr Trp Gln Gln Asp Ile Tyr Ser Leu Asn Glu Asn Tyr Gly Thr 85 90 95 gca gat gac ttg aag gcg ctc tct tcg gcc ctt cat gag agg ggg atg 336 Ala Asp Asp Leu Lys Ala Leu Ser Ser Ala Leu His Glu Arg Gly Met 100 105 110 tat ctt atg gtc gat gtg gtt gct aac cat atg ggc tat gat gga ccg 384 Tyr Leu Met Val Asp Val Val Ala Asn His Met Gly Tyr Asp Gly Pro 115 120 125 ggt agc tca gtc gat tac agt gtg ttt gtt ccg ttc aat tcc gct agc 432 Gly Ser Ser Val Asp Tyr Ser Val Phe Val Pro Phe Asn Ser Ala Ser 130 135 140 tac ttc cac ccg ttc tgt ttc att caa aac tgg aat gat cag act cag 480 Tyr Phe His Pro Phe Cys Phe Ile Gln Asn Trp Asn Asp Gln Thr Gln 145 150 155 160 gtt gag gat tgc tgg cta gga gat aac act gtc tcc ttg cct gat ctc 528 Val Glu Asp Cys Trp Leu Gly Asp Asn Thr Val Ser Leu Pro Asp Leu 165 170 175 gat acc acc aag gat gtg gtc aag aat gaa tgg tac gac tgg gtg gga 576 Asp Thr Thr Lys Asp Val Val Lys Asn Glu Trp Tyr Asp Trp Val Gly 180 185 190 tca ttg gta tcg aac tac tcc att gac ggc ctc cgt atc gac aca gta 624 Ser Leu Val Ser Asn Tyr Ser Ile Asp Gly Leu Arg Ile Asp Thr Val 195 200 205 aaa cac gtc cag aag gac ttc tgg ccc ggg tac aac aaa gcc gca ggc 672 Lys His Val Gln Lys Asp Phe Trp Pro Gly Tyr Asn Lys Ala Ala Gly 210 215 220 gtg tac tgt atc ggc gag gtg ctc gac ggt gat ccg gcc tac act tgt 720 Val Tyr Cys Ile Gly Glu Val Leu Asp Gly Asp Pro Ala Tyr Thr Cys 225 230 235 240 ccc tac cag gaa gtc ctg gac ggc gta ctg aac tac ccc att tac tat 768 Pro Tyr Gln Glu Val Leu Asp Gly Val Leu Asn Tyr Pro Ile Tyr Tyr 245 250 255 cca ctc ctc aac gcc ttc aag tca acc tcc ggc agc atg gac gac ctc 816 Pro Leu Leu Asn Ala Phe Lys Ser Thr Ser Gly Ser Met Asp Asp Leu 260 265 270 tac aac atg atc aac acc gtc aaa tcc gac tgt cca gac tca aca ctc 864 Tyr Asn Met Ile Asn Thr Val Lys Ser Asp Cys Pro Asp Ser Thr Leu 275 280 285 ctg ggc aca ttc gtc gag aac cac gac aac cca cgg ttc gct tct tac 912 Leu Gly Thr Phe Val Glu Asn His Asp Asn Pro Arg Phe Ala Ser Tyr 290 295 300 acc aac gac ata gcc ctc gcc aag aac gtc gca gca ttc atc atc ctc 960 Thr Asn Asp Ile Ala Leu Ala Lys Asn Val Ala Ala Phe Ile Ile Leu 305 310 315 320 aac gac gga atc ccc atc atc tac gcc ggc caa gaa cag cac tac gcc 1008 Asn Asp Gly Ile Pro Ile Ile Tyr Ala Gly Gln Glu Gln His Tyr Ala 325 330 335 ggc gga aac gac ccc gcg aac cgc gaa gca acc tgg ctc tcg ggc tac 1056 Gly Gly Asn Asp Pro Ala Asn Arg Glu Ala Thr Trp Leu Ser Gly Tyr 340 345 350 ccg acc gac agc gag ctg tac aag tta att gcc tcc gcg aac gca atc 1104 Pro Thr Asp Ser Glu Leu Tyr Lys Leu Ile Ala Ser Ala Asn Ala Ile 355 360 365 cgg aac tat gcc att agc aaa gat aca gga ttc gtg acc tac aag aac 1152 Arg Asn Tyr Ala Ile Ser Lys Asp Thr Gly Phe Val Thr Tyr Lys Asn 370 375 380 tgg ccc atc tac aaa gac gac aca acg atc gcc atg cgc aag ggc aca 1200 Trp Pro Ile Tyr Lys Asp Asp Thr Thr Ile Ala Met Arg Lys Gly Thr 385 390 395 400 gat ggg tcg cag atc gtg act atc ttg tcc aac aag ggt gct tcg ggt 1248 Asp Gly Ser Gln Ile Val Thr Ile Leu Ser Asn Lys Gly Ala Ser Gly 405 410 415 gat tcg tat acc ctc tcc ttg agt ggt gcg ggt tac aca gcc ggc cag 1296 Asp Ser Tyr Thr Leu Ser Leu Ser Gly Ala Gly Tyr Thr Ala Gly Gln 420 425 430 caa ttg acg gag gtc att ggc tgc acg acc gtg acg gtt gat tcg tcg 1344 Gln Leu Thr Glu Val Ile Gly Cys Thr Thr Val Thr Val Asp Ser Ser 435 440 445 gga gat gtg cct gtt cct atg gcg ggt ggg cta cct agg gta ttg tat 1392 Gly Asp Val Pro Val Pro Met Ala Gly Gly Leu Pro Arg Val Leu Tyr 450 455 460 ccg act gag aag ttg gca ggt agc aag atc tgt agt agc tcg ggt gct 1440 Pro Thr Glu Lys Leu Ala Gly Ser Lys Ile Cys Ser Ser Ser Gly Ala 465 470 475 480 aca agc ccg ggt ggc tcc tcg ggt agt gtc gag gtc act ttc gac gtt 1488 Thr Ser Pro Gly Gly Ser Ser Gly Ser Val Glu Val Thr Phe Asp Val 485 490 495 tac gct acc aca gta tat ggc cag aac atc tat atc acc ggt gat gtg 1536 Tyr Ala Thr Thr Val Tyr Gly Gln Asn Ile Tyr Ile Thr Gly Asp Val 500 505 510 agt gag ctc ggc aac tgg aca ccc gcc aat ggt gtt gca ctc tct tct 1584 Ser Glu Leu Gly Asn Trp Thr Pro Ala Asn Gly Val Ala Leu Ser Ser 515 520 525 gct aac tac ccc acc tgg agt gcc acg atc gct ctc ccc gct gac acg 1632 Ala Asn Tyr Pro Thr Trp Ser Ala Thr Ile Ala Leu Pro Ala Asp Thr 530 535 540 aca atc cag tac aag tat gtc aac att gac ggc agc acc gtc atc tgg 1680 Thr Ile Gln Tyr Lys Tyr Val Asn Ile Asp Gly Ser Thr Val Ile Trp 545 550 555 560 gag gat gct atc agc aat cgc gag atc acg acg ccc gcc agc ggc aca 1728 Glu Asp Ala Ile Ser Asn Arg Glu Ile Thr Thr Pro Ala Ser Gly Thr 565 570 575 tac acc gaa aaa gac act tgg gat gaa tct tag 1761 Tyr Thr Glu Lys Asp Thr Trp Asp Glu Ser 580 585 28 586 PRT Artificial Synthetic Construct 28 Ala Thr Pro Ala Asp Trp Arg Ser Gln Ser Ile Tyr Phe Leu Leu Thr 1 5 10 15 Asp Arg Phe Ala Arg Thr Asp Gly Ser Thr Thr Ala Thr Cys Asn Thr 20 25 30 Ala Asp Gln Lys Tyr Cys Gly Gly Thr Trp Gln Gly Ile Ile Asp Lys 35 40 45 Leu Asp Tyr Ile Gln Gly Met Gly Phe Thr Ala Ile Trp Ile Thr Pro 50 55 60 Val Thr Ala Gln Leu Pro Gln Thr Thr Ala Tyr Gly Asp Ala Tyr His 65 70 75 80 Gly Tyr Trp Gln Gln Asp Ile Tyr Ser Leu Asn Glu Asn Tyr Gly Thr 85 90 95 Ala Asp Asp Leu Lys Ala Leu Ser Ser Ala Leu His Glu Arg Gly Met 100 105 110 Tyr Leu Met Val Asp Val Val Ala Asn His Met Gly Tyr Asp Gly Pro 115 120 125 Gly Ser Ser Val Asp Tyr Ser Val Phe Val Pro Phe Asn Ser Ala Ser 130 135 140 Tyr Phe His Pro Phe Cys Phe Ile Gln Asn Trp Asn Asp Gln Thr Gln 145 150 155 160 Val Glu Asp Cys Trp Leu Gly Asp Asn Thr Val Ser Leu Pro Asp Leu 165 170 175 Asp Thr Thr Lys Asp Val Val Lys Asn Glu Trp Tyr Asp Trp Val Gly 180 185 190 Ser Leu Val Ser Asn Tyr Ser Ile Asp Gly Leu Arg Ile Asp Thr Val 195 200 205 Lys His Val Gln Lys Asp Phe Trp Pro Gly Tyr Asn Lys Ala Ala Gly 210 215 220 Val Tyr Cys Ile Gly Glu Val Leu Asp Gly Asp Pro Ala Tyr Thr Cys 225 230 235 240 Pro Tyr Gln Glu Val Leu Asp Gly Val Leu Asn Tyr Pro Ile Tyr Tyr 245 250 255 Pro Leu Leu Asn Ala Phe Lys Ser Thr Ser Gly Ser Met Asp Asp Leu 260 265 270 Tyr Asn Met Ile Asn Thr Val Lys Ser Asp Cys Pro Asp Ser Thr Leu 275 280 285 Leu Gly Thr Phe Val Glu Asn His Asp Asn Pro Arg Phe Ala Ser Tyr 290 295 300 Thr Asn Asp Ile Ala Leu Ala Lys Asn Val Ala Ala Phe Ile Ile Leu 305 310 315 320 Asn Asp Gly Ile Pro Ile Ile Tyr Ala Gly Gln Glu Gln His Tyr Ala 325 330 335 Gly Gly Asn Asp Pro Ala Asn Arg Glu Ala Thr Trp Leu Ser Gly Tyr 340 345 350 Pro Thr Asp Ser Glu Leu Tyr Lys Leu Ile Ala Ser Ala Asn Ala Ile 355 360 365 Arg Asn Tyr Ala Ile Ser Lys Asp Thr Gly Phe Val Thr Tyr Lys Asn 370 375 380 Trp Pro Ile Tyr Lys Asp Asp Thr Thr Ile Ala Met Arg Lys Gly Thr 385 390 395 400 Asp Gly Ser Gln Ile Val Thr Ile Leu Ser Asn Lys Gly Ala Ser Gly 405 410 415 Asp Ser Tyr Thr Leu Ser Leu Ser Gly Ala Gly Tyr Thr Ala Gly Gln 420 425 430 Gln Leu Thr Glu Val Ile Gly Cys Thr Thr Val Thr Val Asp Ser Ser 435 440 445 Gly Asp Val Pro Val Pro Met Ala Gly Gly Leu Pro Arg Val Leu Tyr 450 455 460 Pro Thr Glu Lys Leu Ala Gly Ser Lys Ile Cys Ser Ser Ser Gly Ala 465 470 475 480 Thr Ser Pro Gly Gly Ser Ser Gly Ser Val Glu Val Thr Phe Asp Val 485 490 495 Tyr Ala Thr Thr Val Tyr Gly Gln Asn Ile Tyr Ile Thr Gly Asp Val 500 505 510 Ser Glu Leu Gly Asn Trp Thr Pro Ala Asn Gly Val Ala Leu Ser Ser 515 520 525 Ala Asn Tyr Pro Thr Trp Ser Ala Thr Ile Ala Leu Pro Ala Asp Thr 530 535 540 Thr Ile Gln Tyr Lys Tyr Val Asn Ile Asp Gly Ser Thr Val Ile Trp 545 550 555 560 Glu Asp Ala Ile Ser Asn Arg Glu Ile Thr Thr Pro Ala Ser Gly Thr 565 570 575 Tyr Thr Glu Lys Asp Thr Trp Asp Glu Ser 580 585 29 558 PRT Artificial Hybrid alpha-amylase with Rhizomucor pusillus catalytic domain and A. rolfsii linker and SBD 29 Ser Pro Leu Pro Gln Gln Gln Arg Tyr Gly Lys Arg Ala Thr Ser Asp 1 5 10 15 Asp Trp Lys Ser Lys Ala Ile Tyr Gln Leu Leu Thr Asp Arg Phe Gly 20 25 30 Arg Ala Asp Asp Ser Thr Ser Asn Cys Ser Asn Leu Ser Asn Tyr Cys 35 40 45 Gly Gly Thr Tyr Glu Gly Ile Thr Lys His Leu Asp Tyr Ile Ser Gly 50 55 60 Met Gly Phe Asp Ala Ile Trp Ile Ser Pro Ile Pro Lys Asn Ser Asp 65 70 75 80 Gly Gly Tyr His Gly Tyr Trp Ala Thr Asp Phe Tyr Gln Leu Asn Ser 85 90 95 Asn Phe Gly Asp Glu Ser Gln Leu Lys Ala Leu Ile Gln Ala Ala His 100 105 110 Glu Arg Asp Met Tyr Val Met Leu Asp Val Val Ala Asn His Ala Gly 115 120 125 Pro Thr Ser Asn Gly Tyr Ser Gly Tyr Thr Phe Gly Asp Ala Ser Leu 130 135 140 Tyr His Pro Lys Cys Thr Ile Asp Tyr Asn Asp Gln Thr Ser Ile Glu 145 150 155 160 Gln Cys Trp Val Ala Asp Glu Leu Pro Asp Ile Asp Thr Glu Asn Ser 165 170 175 Asp Asn Val Ala Ile Leu Asn Asp Ile Val Ser Gly Trp Val Gly Asn 180 185 190 Tyr Ser Phe Asp Gly Ile Arg Ile Asp Thr Val Lys His Ile Arg Lys 195 200 205 Asp Phe Trp Thr Gly Tyr Ala Glu Ala Ala Gly Val Phe Ala Thr Gly 210 215 220 Glu Val Phe Asn Gly Asp Pro Ala Tyr Val Gly Pro Tyr Gln Lys Tyr 225 230 235 240 Leu Pro Ser Leu Ile Asn Tyr Pro Met Tyr Tyr Ala Leu Asn Asp Val 245 250 255 Phe Val Ser Lys Ser Lys Gly Phe Ser Arg Ile Ser Glu Met Leu Gly 260 265 270 Ser Asn Arg Asn Ala Phe Glu Asp Thr Ser Val Leu Thr Thr Phe Val 275 280 285 Asp Asn His Asp Asn Pro Arg Phe Leu Asn Ser Gln Ser Asp Lys Ala 290 295 300 Leu Phe Lys Asn Ala Leu Thr Tyr Val Leu Leu Gly Glu Gly Ile Pro 305 310 315 320 Ile Val Tyr Tyr Gly Ser Glu Gln Gly Phe Ser Gly Gly Ala Asp Pro 325 330 335 Ala Asn Arg Glu Val Leu Trp Thr Thr Asn Tyr Asp Thr Ser Ser Asp 340 345 350 Leu Tyr Gln Phe Ile Lys Thr Val Asn Ser Val Arg Met Lys Ser Asn 355 360 365 Lys Ala Val Tyr Met Asp Ile Tyr Val Gly Asp Asn Ala Tyr Ala Phe 370 375 380 Lys His Gly Asp Ala Leu Val Val Leu Asn Asn Tyr Gly Ser Gly Ser 385 390 395 400 Thr Asn Gln Val Ser Phe Ser Val Ser Gly Lys Phe Asp Ser Gly Ala 405 410 415 Ser Leu Met Asp Ile Val Ser Asn Ile Thr Thr Thr

Val Ser Ser Asp 420 425 430 Gly Thr Val Thr Phe Asn Leu Lys Asp Gly Leu Pro Ala Ile Phe Thr 435 440 445 Ser Ala Gly Ala Thr Ser Pro Gly Gly Ser Ser Gly Ser Val Glu Val 450 455 460 Thr Phe Asp Val Tyr Ala Thr Thr Val Tyr Gly Gln Asn Ile Tyr Ile 465 470 475 480 Thr Gly Asp Val Ser Glu Leu Gly Asn Trp Thr Pro Ala Asn Gly Val 485 490 495 Ala Leu Ser Ser Ala Asn Tyr Pro Thr Trp Ser Ala Thr Ile Ala Leu 500 505 510 Pro Ala Asp Thr Thr Ile Gln Tyr Lys Tyr Val Asn Ile Asp Gly Ser 515 520 525 Thr Val Ile Trp Glu Asp Ala Ile Ser Asn Arg Glu Ile Thr Thr Pro 530 535 540 Ala Ser Gly Thr Tyr Thr Glu Lys Asp Thr Trp Asp Glu Ser 545 550 555 30 574 PRT Artificial Hybrid alpha-amylase with Meripilus giganteous catalytic domain with A. rolfsii linker and SBD. 30 Arg Pro Thr Val Phe Asp Ala Gly Ala Asp Ala His Ser Leu His Ala 1 5 10 15 Arg Ala Pro Ser Gly Ser Lys Asp Val Ile Ile Gln Met Phe Glu Trp 20 25 30 Asn Trp Asp Ser Val Ala Ala Glu Cys Thr Asn Phe Ile Gly Pro Ala 35 40 45 Gly Tyr Gly Phe Val Gln Val Ser Pro Pro Gln Glu Thr Ile Gln Gly 50 55 60 Ala Gln Trp Trp Thr Asp Tyr Gln Pro Val Ser Tyr Thr Leu Thr Gly 65 70 75 80 Lys Arg Gly Asp Arg Ser Gln Phe Ala Asn Met Ile Thr Thr Cys His 85 90 95 Ala Ala Gly Val Gly Val Ile Val Asp Thr Ile Trp Asn His Met Ala 100 105 110 Gly Val Asp Ser Gly Thr Gly Thr Ala Gly Ser Ser Phe Thr His Tyr 115 120 125 Asn Tyr Pro Gly Ile Tyr Gln Asn Gln Asp Phe His His Cys Gly Leu 130 135 140 Glu Pro Gly Asp Asp Ile Val Asn Tyr Asp Asn Ala Val Glu Val Gln 145 150 155 160 Thr Cys Glu Leu Val Asn Leu Ala Asp Leu Ala Thr Asp Thr Glu Tyr 165 170 175 Val Arg Gly Arg Leu Ala Gln Tyr Gly Asn Asp Leu Leu Ser Leu Gly 180 185 190 Ala Asp Gly Leu Arg Leu Asp Ala Ser Lys His Ile Pro Val Gly Asp 195 200 205 Ile Ala Asn Ile Leu Ser Arg Leu Ser Arg Ser Val Tyr Ile Thr Gln 210 215 220 Glu Val Ile Phe Gly Ala Gly Glu Pro Ile Thr Pro Asn Gln Tyr Thr 225 230 235 240 Gly Asn Gly Asp Val Gln Glu Phe Arg Tyr Thr Ser Ala Leu Lys Asp 245 250 255 Ala Phe Leu Ser Ser Gly Ile Ser Asn Leu Gln Asp Phe Glu Asn Arg 260 265 270 Gly Trp Val Pro Gly Ser Gly Ala Asn Val Phe Val Val Asn His Asp 275 280 285 Thr Glu Arg Asn Gly Ala Ser Leu Asn Asn Asn Ser Pro Ser Asn Thr 290 295 300 Tyr Val Thr Ala Thr Ile Phe Ser Leu Ala His Pro Tyr Gly Thr Pro 305 310 315 320 Thr Ile Leu Ser Ser Tyr Asp Gly Phe Thr Asn Thr Asp Ala Gly Ala 325 330 335 Pro Asn Asn Asn Val Gly Thr Cys Ser Thr Ser Gly Gly Ala Asn Gly 340 345 350 Trp Leu Cys Gln His Arg Trp Thr Ala Ile Ala Gly Met Val Gly Phe 355 360 365 Arg Asn Asn Val Gly Ser Ala Ala Leu Asn Asn Trp Gln Ala Pro Gln 370 375 380 Ser Gln Gln Ile Ala Phe Gly Arg Gly Ala Leu Gly Phe Val Ala Ile 385 390 395 400 Asn Asn Ala Asp Ser Ala Trp Ser Thr Thr Phe Thr Thr Ser Leu Pro 405 410 415 Asp Gly Ser Tyr Cys Asp Val Ile Ser Gly Lys Ala Ser Gly Ser Ser 420 425 430 Cys Thr Gly Ser Ser Phe Thr Val Ser Gly Gly Lys Leu Thr Ala Thr 435 440 445 Val Pro Ala Arg Ser Ala Ile Ala Val His Thr Gly Gln Lys Gly Ser 450 455 460 Gly Gly Gly Ala Thr Ser Pro Gly Gly Ser Ser Gly Ser Val Glu Val 465 470 475 480 Thr Phe Asp Val Tyr Ala Thr Thr Val Tyr Gly Gln Asn Ile Tyr Ile 485 490 495 Thr Gly Asp Val Ser Glu Leu Gly Asn Trp Thr Pro Ala Asn Gly Val 500 505 510 Ala Leu Ser Ser Ala Asn Tyr Pro Thr Trp Ser Ala Thr Ile Ala Leu 515 520 525 Pro Ala Asp Thr Thr Ile Gln Tyr Lys Tyr Val Asn Ile Asp Gly Ser 530 535 540 Thr Val Ile Trp Glu Asp Ala Ile Ser Asn Arg Glu Ile Thr Thr Pro 545 550 555 560 Ala Ser Gly Thr Tyr Thr Glu Lys Asp Thr Trp Asp Glu Ser 565 570 31 22 DNA Artificial Primer 31 ggtagactag ttacctcgtt gg 22 32 23 DNA Artificial Primer 32 gcttccctag ccactgccat tgg 23 33 23 DNA Artificial Primer 33 gttgatttaa cttggagcta tgc 23 34 35 DNA Artificial Leucopaxillus forward Primer 34 tcccttggat ccaggatgca tttctctgtc ctctc 35 35 34 DNA Artificial Leucopaxillus reverse Primer 35 cttatcctcg agctacttcc acgagtcatt ctgg 34 36 2166 DNA Trametes cingulata CDS (1)..(171) misc_signal (1)..(54) mat_peptide (55)..(2166) Intron (172)..(244) CDS (245)..(521) Intron (522)..(577) CDS (578)..(722) Intron (723)..(772) CDS (773)..(935) Intron (936)..(1001) CDS (1002)..(1277) Intron (1278)..(1341) CDS (1342)..(1807) misc_feature (1744)..(1773) Linker misc_feature (1774)..(2163) binding domain Intron (1808)..(1864) CDS (1865)..(1960) Intron (1961)..(2020) CDS (2021)..(2163) 36 atg cgt ttc acg ctc ctc acc tcc ctc ctg ggc ctc gcc ctc ggc gcg 48 Met Arg Phe Thr Leu Leu Thr Ser Leu Leu Gly Leu Ala Leu Gly Ala -15 -10 -5 ttc gcg cag tcg agt gcg gcc gac gcg tac gtc gcg tcc gaa tcg ccc 96 Phe Ala Gln Ser Ser Ala Ala Asp Ala Tyr Val Ala Ser Glu Ser Pro -1 1 5 10 atc gcc aag gcg ggt gtg ctc gcc aac atc ggg ccc agc ggc tcc aag 144 Ile Ala Lys Ala Gly Val Leu Ala Asn Ile Gly Pro Ser Gly Ser Lys 15 20 25 30 tcc aac gga gca aag gca agt gac aca gtgacactcc ggggcgccca 191 Ser Asn Gly Ala Lys Ala Ser Asp Thr 35 tgcttcattc ttctgtgcac atggtagcgc tgacatatcg ttgtttttga cag ccc 247 Pro 40 ggc atc gtg att gca agt ccg agc aca tcc aac ccg aac tac ctg tac 295 Gly Ile Val Ile Ala Ser Pro Ser Thr Ser Asn Pro Asn Tyr Leu Tyr 45 50 55 aca tgg acg cgc gac tcg tcc ctc gtg ttc aag gcg ctc atc gac cag 343 Thr Trp Thr Arg Asp Ser Ser Leu Val Phe Lys Ala Leu Ile Asp Gln 60 65 70 ttc acc act ggc gaa gat acc tcg ctc cga act ctg att gac gag ttc 391 Phe Thr Thr Gly Glu Asp Thr Ser Leu Arg Thr Leu Ile Asp Glu Phe 75 80 85 acc tcg gcg gag gcc ata ctc cag cag gtg ccg aac ccg agc ggg aca 439 Thr Ser Ala Glu Ala Ile Leu Gln Gln Val Pro Asn Pro Ser Gly Thr 90 95 100 gtc agc act gga ggc ctc ggc gag ccc aag ttc aac atc gac gag acc 487 Val Ser Thr Gly Gly Leu Gly Glu Pro Lys Phe Asn Ile Asp Glu Thr 105 110 115 120 gcg ttc acg gat gcc tgg ggt cgt cct cag cgc g gtaagtcgga 531 Ala Phe Thr Asp Ala Trp Gly Arg Pro Gln Arg 125 130 ggttgcctcg acggagatac gcccagactg acttcaagac tctcag at ggt ccc 585 Asp Gly Pro gct ctc cgg gcg act gcc atc atc acc tac gcc aac tgg ctc ctc gac 633 Ala Leu Arg Ala Thr Ala Ile Ile Thr Tyr Ala Asn Trp Leu Leu Asp 135 140 145 150 aac aag aac acg acc tac gtg acc aac act ctc tgg cct atc atc aag 681 Asn Lys Asn Thr Thr Tyr Val Thr Asn Thr Leu Trp Pro Ile Ile Lys 155 160 165 ctc gac ctc gac tac gtc gcc agc aac tgg aac cag tcc ac 722 Leu Asp Leu Asp Tyr Val Ala Ser Asn Trp Asn Gln Ser Thr 170 175 gtatgttctc taaattctct cccgtgggta accagtctga acgttcatag g ttt gat 779 Phe Asp ctc tgg gag gag att aac tcc tcg tcg ttc ttc act acc gcc gtc cag 827 Leu Trp Glu Glu Ile Asn Ser Ser Ser Phe Phe Thr Thr Ala Val Gln 185 190 195 cac cgt gct ctg cgc gag ggc gcg act ttc gct aat cgc atc gga caa 875 His Arg Ala Leu Arg Glu Gly Ala Thr Phe Ala Asn Arg Ile Gly Gln 200 205 210 acc tcg gtg gtc agc ggg tac acc acc caa gca aac aac ctt ctc tgc 923 Thr Ser Val Val Ser Gly Tyr Thr Thr Gln Ala Asn Asn Leu Leu Cys 215 220 225 230 ttc ctg cag gca gtctatcccg tcacacgtct gtctgtttcc gttttcccac 975 Phe Leu Gln Ala agctcacctc gtcccgggcc ctgtag tcg tac tgg aac ccc acc ggc ggc tat 1028 Ser Tyr Trp Asn Pro Thr Gly Gly Tyr 235 240 atc acc gca aac acg ggc ggc ggc cgc tct ggc aag gac gcg aac acc 1076 Ile Thr Ala Asn Thr Gly Gly Gly Arg Ser Gly Lys Asp Ala Asn Thr 245 250 255 gtt ctc acg tcg atc cac acc ttc gac ccg gcc gct gga tgc gac gct 1124 Val Leu Thr Ser Ile His Thr Phe Asp Pro Ala Ala Gly Cys Asp Ala 260 265 270 275 gtt acg ttc cag ccg tgc tcg gac aag gcg ctg tcg aac ttg aag gtg 1172 Val Thr Phe Gln Pro Cys Ser Asp Lys Ala Leu Ser Asn Leu Lys Val 280 285 290 tac gtc gat gcg ttc cgc tcg atc tac tcc atc aac agc ggg atc gcc 1220 Tyr Val Asp Ala Phe Arg Ser Ile Tyr Ser Ile Asn Ser Gly Ile Ala 295 300 305 tcg aat gcg gcc gtt gct acc ggc cgc tac ccc gag gac agc tac atg 1268 Ser Asn Ala Ala Val Ala Thr Gly Arg Tyr Pro Glu Asp Ser Tyr Met 310 315 320 ggc gga aac gtgagcgacc atttctgtgc gtacaccgcg gtcgcgttaa 1317 Gly Gly Asn 325 ctgagatgtt ctcctctcct gtag cca tgg tac ctc acc acc tcc gcc gtc 1368 Pro Trp Tyr Leu Thr Thr Ser Ala Val 330 335 gct gag cag ctc tac gat gcg ctc att gtg tgg aac aag ctt ggc gcc 1416 Ala Glu Gln Leu Tyr Asp Ala Leu Ile Val Trp Asn Lys Leu Gly Ala 340 345 350 ctg aac gtc acg agc acc tcc ctc ccc ttc ttc cag cag ttc tcg tca 1464 Leu Asn Val Thr Ser Thr Ser Leu Pro Phe Phe Gln Gln Phe Ser Ser 355 360 365 ggc gtc acc gtc ggc acc tat gcc tca tcc tcg tcc acc ttc aag acg 1512 Gly Val Thr Val Gly Thr Tyr Ala Ser Ser Ser Ser Thr Phe Lys Thr 370 375 380 ctc act tcc gcc atc aag acc ttc gcc gac ggc ttc ctc gcg gtc aac 1560 Leu Thr Ser Ala Ile Lys Thr Phe Ala Asp Gly Phe Leu Ala Val Asn 385 390 395 gcc aag tac acg ccc tcg aac ggc ggc ctt gct gaa cag tac agc cgg 1608 Ala Lys Tyr Thr Pro Ser Asn Gly Gly Leu Ala Glu Gln Tyr Ser Arg 400 405 410 415 agc aac ggc tcg ccc gtc agc gct gtg gac ctg acg tgg agc tat gct 1656 Ser Asn Gly Ser Pro Val Ser Ala Val Asp Leu Thr Trp Ser Tyr Ala 420 425 430 gct gcc ctc acg tcg ttt gct gcg cgc tca ggc aag acg tat gcg agc 1704 Ala Ala Leu Thr Ser Phe Ala Ala Arg Ser Gly Lys Thr Tyr Ala Ser 435 440 445 tgg ggc gcg gcg ggt ttg act gtc ccg acg act tgc tcg ggg agt ggc 1752 Trp Gly Ala Ala Gly Leu Thr Val Pro Thr Thr Cys Ser Gly Ser Gly 450 455 460 ggt gct ggg act gtg gcc gtc acc ttc aac gtg cag gcg acc acc gtg 1800 Gly Ala Gly Thr Val Ala Val Thr Phe Asn Val Gln Ala Thr Thr Val 465 470 475 ttc ggc g gtgagtacgc catcgtatgc tactagggca gttactcata gcttgtcgga 1857 Phe Gly 480 cttgtag ag aac att tac atc aca ggc tcg gtc ccc gct ctc cag aac 1905 Glu Asn Ile Tyr Ile Thr Gly Ser Val Pro Ala Leu Gln Asn 485 490 495 tgg tcg ccc gac aac gcg ctc atc ctc tca gcg gcc aac tac ccc act 1953 Trp Ser Pro Asp Asn Ala Leu Ile Leu Ser Ala Ala Asn Tyr Pro Thr 500 505 510 tgg agc a gtacgtctga accgccttca gcctgcttca tacgttcgct gacatcgggc 2010 Trp Ser atccatctag tc acc gtg aac ctg ccg gcg agc acg acg atc gag tac 2058 Ile Thr Val Asn Leu Pro Ala Ser Thr Thr Ile Glu Tyr 515 520 525 aag tac att cgc aag ttc aac ggc gcg gtc acc tgg gag tcc gac ccg 2106 Lys Tyr Ile Arg Lys Phe Asn Gly Ala Val Thr Trp Glu Ser Asp Pro 530 535 540 aac aac tcg atc acg acg ccc gcg agc ggc acg ttc acc cag aac gac 2154 Asn Asn Ser Ile Thr Thr Pro Ala Ser Gly Thr Phe Thr Gln Asn Asp 545 550 555 acc tgg cgg tag 2166 Thr Trp Arg 560 37 579 PRT Trametes cingulata 37 Met Arg Phe Thr Leu Leu Thr Ser Leu Leu Gly Leu Ala Leu Gly Ala -15 -10 -5 Phe Ala Gln Ser Ser Ala Ala Asp Ala Tyr Val Ala Ser Glu Ser Pro -1 1 5 10 Ile Ala Lys Ala Gly Val Leu Ala Asn Ile Gly Pro Ser Gly Ser Lys 15 20 25 30 Ser Asn Gly Ala Lys Ala Ser Asp Thr Pro Gly Ile Val Ile Ala Ser 35 40 45 Pro Ser Thr Ser Asn Pro Asn Tyr Leu Tyr Thr Trp Thr Arg Asp Ser 50 55 60 Ser Leu Val Phe Lys Ala Leu Ile Asp Gln Phe Thr Thr Gly Glu Asp 65 70 75 Thr Ser Leu Arg Thr Leu Ile Asp Glu Phe Thr Ser Ala Glu Ala Ile 80 85 90 Leu Gln Gln Val Pro Asn Pro Ser Gly Thr Val Ser Thr Gly Gly Leu 95 100 105 110 Gly Glu Pro Lys Phe Asn Ile Asp Glu Thr Ala Phe Thr Asp Ala Trp 115 120 125 Gly Arg Pro Gln Arg Asp Gly Pro Ala Leu Arg Ala Thr Ala Ile Ile 130 135 140 Thr Tyr Ala Asn Trp Leu Leu Asp Asn Lys Asn Thr Thr Tyr Val Thr 145 150 155 Asn Thr Leu Trp Pro Ile Ile Lys Leu Asp Leu Asp Tyr Val Ala Ser 160 165 170 Asn Trp Asn Gln Ser Thr Phe Asp Leu Trp Glu Glu Ile Asn Ser Ser 175 180 185 190 Ser Phe Phe Thr Thr Ala Val Gln His Arg Ala Leu Arg Glu Gly Ala 195 200 205 Thr Phe Ala Asn Arg Ile Gly Gln Thr Ser Val Val Ser Gly Tyr Thr 210 215 220 Thr Gln Ala Asn Asn Leu Leu Cys Phe Leu Gln Ala Ser Tyr Trp Asn 225 230 235 Pro Thr Gly Gly Tyr Ile Thr Ala Asn Thr Gly Gly Gly Arg Ser Gly 240 245 250 Lys Asp Ala Asn Thr Val Leu Thr Ser Ile His Thr Phe Asp Pro Ala 255 260 265 270 Ala Gly Cys Asp Ala Val Thr Phe Gln Pro Cys Ser Asp Lys Ala Leu 275 280 285 Ser Asn Leu Lys Val Tyr Val Asp Ala Phe Arg Ser Ile Tyr Ser Ile 290 295 300 Asn Ser Gly Ile Ala Ser Asn Ala Ala Val Ala Thr Gly Arg Tyr Pro 305 310 315 Glu Asp Ser Tyr Met Gly Gly Asn Pro Trp Tyr Leu Thr Thr Ser Ala 320 325 330 Val Ala Glu Gln Leu Tyr Asp Ala Leu Ile Val Trp Asn Lys Leu Gly 335 340 345 350 Ala Leu Asn Val Thr Ser Thr Ser Leu Pro Phe Phe Gln Gln Phe Ser 355 360 365 Ser Gly Val Thr Val Gly Thr Tyr Ala Ser Ser Ser Ser Thr Phe Lys 370 375 380 Thr Leu Thr Ser Ala Ile Lys Thr Phe Ala Asp Gly Phe Leu Ala Val 385 390 395 Asn Ala Lys Tyr Thr Pro Ser Asn Gly Gly Leu Ala Glu Gln Tyr Ser 400 405 410 Arg Ser Asn Gly Ser Pro Val Ser Ala Val Asp Leu Thr Trp Ser Tyr 415 420 425 430 Ala Ala Ala Leu Thr Ser Phe Ala Ala Arg Ser Gly Lys Thr Tyr Ala 435 440 445 Ser Trp Gly Ala Ala Gly Leu Thr Val Pro Thr Thr Cys Ser Gly Ser 450 455 460 Gly Gly Ala Gly Thr Val Ala Val Thr Phe Asn Val Gln Ala Thr Thr 465 470 475 Val Phe Gly Glu Asn Ile Tyr Ile Thr Gly Ser Val Pro Ala Leu Gln 480 485 490 Asn Trp Ser Pro Asp Asn Ala Leu Ile Leu Ser Ala Ala Asn Tyr Pro

495 500 505 510 Thr Trp Ser Ile Thr Val Asn Leu Pro Ala Ser Thr Thr Ile Glu Tyr 515 520 525 Lys Tyr Ile Arg Lys Phe Asn Gly Ala Val Thr Trp Glu Ser Asp Pro 530 535 540 Asn Asn Ser Ile Thr Thr Pro Ala Ser Gly Thr Phe Thr Gln Asn Asp 545 550 555 Thr Trp Arg 560 38 1740 DNA Trametes cingulata misc_feature (1)..(1740) cDNA misc_feature (55)..(1740) mature peptide coding region of cDNA misc_feature (1435)..(1464) linker misc_feature (1465)..(1740) Binding domain 38 atgcgtttca cgctcctcac ctccctcctg ggcctcgccc tcggcgcgtt cgcgcagtcg 60 agtgcggccg acgcgtacgt cgcgtccgaa tcgcccatcg ccaaggcggg tgtgctcgcc 120 aacatcgggc ccagcggctc caagtccaac ggagcaaagg caagtgacac cccggcatcg 180 ntgattgcaa gtccgagcac atccaacccg aactacctgt acacatggac gcgcgactcg 240 tccctcgtgt tcaaggcgct catcgaccag ttcaccactg gcgaagatac ctcgctccga 300 actctgattg acgagttcac ctcggcggag gccatactcc agcaggtgcc gaacccgagc 360 gggacagtca gcactggagg cctcggcgag cccaagttca acatcgacga gaccgcgttc 420 acggatgcct ggggtcgtcc tcagcgcgat ggtcccgctc tccgggcgac tgccatcatc 480 acctacgcca actggctcct cgacaacaag aacacgacct acgtgaccaa cactctctgg 540 cctatcatca agctcgacct cgactacgtc gccagcaact ggaaccagtc cacgtttgat 600 ctctgggagg agattaactc ctcgtcgttc ttcactaccg ccgtccagca ccgtgctctg 660 cgcgagggcg cgactttcgc taatcgcatc ggacaaacct cggtggtcag cgggtacacc 720 acccaagcaa acaaccttct ctgcttcctg caggcatcgt actggaaccc caccggcggc 780 tatatcaccg caaacacggg cggcggccgc tctggcaagg acgcgaacac cgttctcacg 840 tcgatccaca ccttcgaccc ggccgctgga tgcgacgctg ttacgttcca gccgtgctcg 900 gacaaggcgc tgtcgaactt gaaggtgtac gtcgatgcgt tccgctcgat ctactccatc 960 aacagcggga tcgcctcgaa tgcggccgtt gctaccggcc gctaccccga ggacagctac 1020 atgggcggaa acccatggta cctcaccacc tccgccgtcg ctgagcagct ctacgatgcg 1080 ctcattgtgt ggaacaagct tggcgccctg aacgtcacga gcacctccct ccccttcttc 1140 cagcagttct cgtcaggcgt caccgtcggc acctatgcct catcctcgtc caccttcaag 1200 acgctcactt ccgccatcaa gaccttcgcc gacggcttcc tcgcggtcaa cgccaagtac 1260 acgccctcga acggcggcct tgctgaacag tacagccgga gcaacggctc gcccgtcagc 1320 gctgtggacc tgacgtggag ctatgctgct gccctcacgt cgtttgctgc gcgctcaggc 1380 aagacgtatg cgagctgggg cgcggcgggt ttgactgtcc cgacgacttg ctcggggagt 1440 ggcggtgctg ggactgtggc cgtcaccttc aacgtgcagg cgaccaccgt gttcggcgag 1500 aacatttaca tcacaggctc ggtccccgct ctccagaact ggtcgcccga caacgcgctc 1560 atcctctcag cggccaacta ccccacttgg agcatcaccg tgaacctgcc ggcgagcacg 1620 acgatcgagt acaagtacat tcgcaagttc aacggcgcgg tcacctggga gtccgacccg 1680 aacaactcga tcacgacgcc cgcgagcggc acgttcaccc agaacgacac ctggcggtag 1740 39 2182 DNA Pachykytospora papyraceae CDS (1)..(159) misc_signal (1)..(54) mat_peptide (55)..(2182) Intron (160)..(238) CDS (239)..(515) Intron (516)..(565) misc_feature (523)..(524) n is a, c, g, or t misc_feature (555)..(555) n is a, c, g, or t CDS (566)..(713) misc_feature (613)..(613) n is a, c, g, or t misc_feature (648)..(648) n is a, c, g, or t Intron (714)..(775) misc_feature (727)..(727) n is a, c, g, or t misc_feature (753)..(753) n is a, c, g, or t misc_feature (768)..(768) n is a, c, g, or t misc_feature (770)..(770) n is a, c, g, or t CDS (776)..(935) Intron (936)..(971) CDS (972)..(1274) Intron (1275)..(1333) CDS (1334)..(1796) misc_feature (1736)..(1762) Linker misc_feature (1763)..(2182) Binding domain Intron (1797)..(1875) CDS (1876)..(1971) Intron (1972)..(2036) CDS (2037)..(2179) 39 atg cgc ttc acc ctc ctc tcc tcc ctc gtc gcc ctc gcc acc ggc gcg 48 Met Arg Phe Thr Leu Leu Ser Ser Leu Val Ala Leu Ala Thr Gly Ala -15 -10 -5 ttc acc cag acc agc cag gcc gac gcg tac gtc aag tcc gag ggc ccc 96 Phe Thr Gln Thr Ser Gln Ala Asp Ala Tyr Val Lys Ser Glu Gly Pro -1 1 5 10 atc gcg aag gcg ggc ctc ctc gcc aac atc ggg ccc agc ggc tcc aag 144 Ile Ala Lys Ala Gly Leu Leu Ala Asn Ile Gly Pro Ser Gly Ser Lys 15 20 25 30 tcg cac ggg gcg aag gtgcgcttct ctttttccca ttctacgtcg cttaaagcgc 199 Ser His Gly Ala Lys 35 gctcatacat gtgcatgacc gcgttccgcg tgcgcgcag gcc ggt ctc gtc gtc 253 Ala Gly Leu Val Val 40 gcc ccc ccc agc acg tcg gac ccc gac tac gtc tac acc tgg acg ctg 301 Ala Pro Pro Ser Thr Ser Asp Pro Asp Tyr Val Tyr Thr Trp Thr Leu 45 50 55 gat tcg tca ctc gtc ttc aag act atc atc gac cag ttc acc tcc ggg 349 Asp Ser Ser Leu Val Phe Lys Thr Ile Ile Asp Gln Phe Thr Ser Gly 60 65 70 gaa gac act tcc ctc cgc aca ctc att gac cag ttc act agc gcg gag 397 Glu Asp Thr Ser Leu Arg Thr Leu Ile Asp Gln Phe Thr Ser Ala Glu 75 80 85 aag gac ctc cag cag acg tcc aac cct agt ggc act gtt tcc acc ggc 445 Lys Asp Leu Gln Gln Thr Ser Asn Pro Ser Gly Thr Val Ser Thr Gly 90 95 100 ggt ctc ggc gag ccc aag ttc aac atc gat ggg tcc gcg ttc acc ggt 493 Gly Leu Gly Glu Pro Lys Phe Asn Ile Asp Gly Ser Ala Phe Thr Gly 105 110 115 120 gcc tgg ggt cgc cct cag cgc g gtatgcanna cagttgaagc ttgttaagcg 545 Ala Trp Gly Arg Pro Gln Arg 125 cttacatgtn ttgtgtacag ac ggc cct gct ctc cgc gcg act gct atc ata 597 Asp Gly Pro Ala Leu Arg Ala Thr Ala Ile Ile 130 135 gcc tac gct aac tgg ntg ctc gac aac aac aac ggc acg tct tac gtc 645 Ala Tyr Ala Asn Trp Xaa Leu Asp Asn Asn Asn Gly Thr Ser Tyr Val 140 145 150 acn aac acc ctc tgg ccc atc atc aag ctt gac ttg gac tac acc cag 693 Thr Asn Thr Leu Trp Pro Ile Ile Lys Leu Asp Leu Asp Tyr Thr Gln 155 160 165 170 aac aac tgg aac cag tcg ac gtaagttcat tatnccagct ttggctgtta 743 Asn Asn Trp Asn Gln Ser Thr 175 gaactgcatn gatcctcatg tcttntnccc ag g ttc gac ctt tgg gag gag gtc 797 Phe Asp Leu Trp Glu Glu Val 180 aac tcc tcc tct ttc ttc acg act gcc gtc cag cac cgt gct ctc cgc 845 Asn Ser Ser Ser Phe Phe Thr Thr Ala Val Gln His Arg Ala Leu Arg 185 190 195 200 gag ggt atc gcc ttc gcg aag aag atc ggc caa acg tcg gtc gtg agc 893 Glu Gly Ile Ala Phe Ala Lys Lys Ile Gly Gln Thr Ser Val Val Ser 205 210 215 ggc tac acc acg cag gcg acc aac ctt ctc tgc ttc ctg cag 935 Gly Tyr Thr Thr Gln Ala Thr Asn Leu Leu Cys Phe Leu Gln 220 225 230 gtcagtacgc atgtgcagca cgccttctgg ctatag ctt aac ccg tgt tcc gca 989 Leu Asn Pro Cys Ser Ala 235 tct tcg cag tcg tac tgg aac ccc tcg ggc ggc tat gtc act gcg aac 1037 Ser Ser Gln Ser Tyr Trp Asn Pro Ser Gly Gly Tyr Val Thr Ala Asn 240 245 250 aca ggc ggc ggc cgg tcc ggc aag gac tcg aac acc gtc ctg acc tcg 1085 Thr Gly Gly Gly Arg Ser Gly Lys Asp Ser Asn Thr Val Leu Thr Ser 255 260 265 atc cac acc ttc gac ccc gcc gct ggc tgc gac gcc gcg acg ttc cag 1133 Ile His Thr Phe Asp Pro Ala Ala Gly Cys Asp Ala Ala Thr Phe Gln 270 275 280 ccg tgc tct gac aag gcc ctg tcc aac ctt aag gtc tac gtc gac tcg 1181 Pro Cys Ser Asp Lys Ala Leu Ser Asn Leu Lys Val Tyr Val Asp Ser 285 290 295 300 ttc cgt tcc atc tac tcc atc aac agt ggc atc acc tcc aac gcc gct 1229 Phe Arg Ser Ile Tyr Ser Ile Asn Ser Gly Ile Thr Ser Asn Ala Ala 305 310 315 gtc gct gtt ggc cgc tac ccc gag gat gtg tac tac aac ggc aac 1274 Val Ala Val Gly Arg Tyr Pro Glu Asp Val Tyr Tyr Asn Gly Asn 320 325 330 gtgagttccg tgtcccctgc atcattgtca acagcagaaa ctgaatccca tccgcgtag 1333 ccc tgg tgc ctc tcc acg tcc gcc gtc gct gag cag ctc tac gac gcg 1381 Pro Trp Cys Leu Ser Thr Ser Ala Val Ala Glu Gln Leu Tyr Asp Ala 335 340 345 atc atc gtc tgg aac aag ctc ggc tcg ctc gaa gtg acg agc acc tcg 1429 Ile Ile Val Trp Asn Lys Leu Gly Ser Leu Glu Val Thr Ser Thr Ser 350 355 360 ctc gcg ttc ttc aag cag ctc tcc tcg gat gcc gcc gtc ggc acc tac 1477 Leu Ala Phe Phe Lys Gln Leu Ser Ser Asp Ala Ala Val Gly Thr Tyr 365 370 375 tcg tcc tcg tcc gcg acg ttc aag acg ctc acc gcg gcc gcg aag acg 1525 Ser Ser Ser Ser Ala Thr Phe Lys Thr Leu Thr Ala Ala Ala Lys Thr 380 385 390 395 ctc gcg gat ggc ttc ctc gct gtg aac gcg aag tac acg ccc tcg aac 1573 Leu Ala Asp Gly Phe Leu Ala Val Asn Ala Lys Tyr Thr Pro Ser Asn 400 405 410 ggc ggc ctc gcg gag cag ttc agc aag agc aac ggc tcg ccg ctc agc 1621 Gly Gly Leu Ala Glu Gln Phe Ser Lys Ser Asn Gly Ser Pro Leu Ser 415 420 425 gcc gtc gac ctc acg tgg agc tac gcc gcc gcg ctc acg tcc ttt gcc 1669 Ala Val Asp Leu Thr Trp Ser Tyr Ala Ala Ala Leu Thr Ser Phe Ala 430 435 440 gcg cgt gag ggc aag acc ccc gcg agc tgg ggc gct gcg ggc ctc acc 1717 Ala Arg Glu Gly Lys Thr Pro Ala Ser Trp Gly Ala Ala Gly Leu Thr 445 450 455 gtg ccg tcg acg tgc tcg ggt aac gcg ggc ccc agc gtg aag gtg acg 1765 Val Pro Ser Thr Cys Ser Gly Asn Ala Gly Pro Ser Val Lys Val Thr 460 465 470 475 ttc aac gtc cag gct acg act acc ttc ggc g gtcagtcctc ttctccaact 1816 Phe Asn Val Gln Ala Thr Thr Thr Phe Gly 480 485 cgtttcggtc ggtgatgttg agcattcgtc tgacgtgtgt gtgttactgc tgcttgcag 1875 ag aac atc tac atc acc ggt aac acc gct gcg ctc cag aac tgg tcg 1922 Glu Asn Ile Tyr Ile Thr Gly Asn Thr Ala Ala Leu Gln Asn Trp Ser 490 495 500 ccc gat aac gcg ctc ctc ctc tct gct gac aag tac ccc acc tgg agc a 1971 Pro Asp Asn Ala Leu Leu Leu Ser Ala Asp Lys Tyr Pro Thr Trp Ser 505 510 515 gtacgtgtca tctcatctcc agcctctcat attacgttgt ttgctcatct gcatgtgctt 2031 cgcag tc acg ctc gac ctc ccc gcg aac acc gtc gtc gag tac aaa tac 2080 Ile Thr Leu Asp Leu Pro Ala Asn Thr Val Val Glu Tyr Lys Tyr 520 525 530 atc cgc aag ttc aac ggc cag gtc acc tgg gaa tcg gac ccc aac aac 2128 Ile Arg Lys Phe Asn Gly Gln Val Thr Trp Glu Ser Asp Pro Asn Asn 535 540 545 tcg atc acg acg ccc gcc gac ggt acc ttc acc cag aac gac acc tgg 2176 Ser Ile Thr Thr Pro Ala Asp Gly Thr Phe Thr Gln Asn Asp Thr Trp 550 555 560 cgg tga 2182 Arg 565 40 583 PRT Pachykytospora papyraceae misc_feature (144)..(144) The 'Xaa' at location 144 stands for Met, Val, or Leu. 40 Met Arg Phe Thr Leu Leu Ser Ser Leu Val Ala Leu Ala Thr Gly Ala -15 -10 -5 Phe Thr Gln Thr Ser Gln Ala Asp Ala Tyr Val Lys Ser Glu Gly Pro -1 1 5 10 Ile Ala Lys Ala Gly Leu Leu Ala Asn Ile Gly Pro Ser Gly Ser Lys 15 20 25 30 Ser His Gly Ala Lys Ala Gly Leu Val Val Ala Pro Pro Ser Thr Ser 35 40 45 Asp Pro Asp Tyr Val Tyr Thr Trp Thr Leu Asp Ser Ser Leu Val Phe 50 55 60 Lys Thr Ile Ile Asp Gln Phe Thr Ser Gly Glu Asp Thr Ser Leu Arg 65 70 75 Thr Leu Ile Asp Gln Phe Thr Ser Ala Glu Lys Asp Leu Gln Gln Thr 80 85 90 Ser Asn Pro Ser Gly Thr Val Ser Thr Gly Gly Leu Gly Glu Pro Lys 95 100 105 110 Phe Asn Ile Asp Gly Ser Ala Phe Thr Gly Ala Trp Gly Arg Pro Gln 115 120 125 Arg Asp Gly Pro Ala Leu Arg Ala Thr Ala Ile Ile Ala Tyr Ala Asn 130 135 140 Trp Xaa Leu Asp Asn Asn Asn Gly Thr Ser Tyr Val Thr Asn Thr Leu 145 150 155 Trp Pro Ile Ile Lys Leu Asp Leu Asp Tyr Thr Gln Asn Asn Trp Asn 160 165 170 Gln Ser Thr Phe Asp Leu Trp Glu Glu Val Asn Ser Ser Ser Phe Phe 175 180 185 190 Thr Thr Ala Val Gln His Arg Ala Leu Arg Glu Gly Ile Ala Phe Ala 195 200 205 Lys Lys Ile Gly Gln Thr Ser Val Val Ser Gly Tyr Thr Thr Gln Ala 210 215 220 Thr Asn Leu Leu Cys Phe Leu Gln Leu Asn Pro Cys Ser Ala Ser Ser 225 230 235 Gln Ser Tyr Trp Asn Pro Ser Gly Gly Tyr Val Thr Ala Asn Thr Gly 240 245 250 Gly Gly Arg Ser Gly Lys Asp Ser Asn Thr Val Leu Thr Ser Ile His 255 260 265 270 Thr Phe Asp Pro Ala Ala Gly Cys Asp Ala Ala Thr Phe Gln Pro Cys 275 280 285 Ser Asp Lys Ala Leu Ser Asn Leu Lys Val Tyr Val Asp Ser Phe Arg 290 295 300 Ser Ile Tyr Ser Ile Asn Ser Gly Ile Thr Ser Asn Ala Ala Val Ala 305 310 315 Val Gly Arg Tyr Pro Glu Asp Val Tyr Tyr Asn Gly Asn Pro Trp Cys 320 325 330 Leu Ser Thr Ser Ala Val Ala Glu Gln Leu Tyr Asp Ala Ile Ile Val 335 340 345 350 Trp Asn Lys Leu Gly Ser Leu Glu Val Thr Ser Thr Ser Leu Ala Phe 355 360 365 Phe Lys Gln Leu Ser Ser Asp Ala Ala Val Gly Thr Tyr Ser Ser Ser 370 375 380 Ser Ala Thr Phe Lys Thr Leu Thr Ala Ala Ala Lys Thr Leu Ala Asp 385 390 395 Gly Phe Leu Ala Val Asn Ala Lys Tyr Thr Pro Ser Asn Gly Gly Leu 400 405 410 Ala Glu Gln Phe Ser Lys Ser Asn Gly Ser Pro Leu Ser Ala Val Asp 415 420 425 430 Leu Thr Trp Ser Tyr Ala Ala Ala Leu Thr Ser Phe Ala Ala Arg Glu 435 440 445 Gly Lys Thr Pro Ala Ser Trp Gly Ala Ala Gly Leu Thr Val Pro Ser 450 455 460 Thr Cys Ser Gly Asn Ala Gly Pro Ser Val Lys Val Thr Phe Asn Val 465 470 475 Gln Ala Thr Thr Thr Phe Gly Glu Asn Ile Tyr Ile Thr Gly Asn Thr 480 485 490 Ala Ala Leu Gln Asn Trp Ser Pro Asp Asn Ala Leu Leu Leu Ser Ala 495 500 505 510 Asp Lys Tyr Pro Thr Trp Ser Ile Thr Leu Asp Leu Pro Ala Asn Thr 515 520 525 Val Val Glu Tyr Lys Tyr Ile Arg Lys Phe Asn Gly Gln Val Thr Trp 530 535 540 Glu Ser Asp Pro Asn Asn Ser Ile Thr Thr Pro Ala Asp Gly Thr Phe 545 550 555 Thr Gln Asn Asp Thr Trp Arg 560 565 41 1752 DNA Pachykytospora papyraceae misc_feature (1)..(54) Signal misc_feature (55)..(1752) mature peptide coding cDNA misc_feature (1450)..(1476) Linker misc_feature (1477)..(1752) Binding domain 41 atgcgcttca ccctcctctc ctccctcgtc gccctcgcca ccggcgcgtt cacccagacc 60 agccaggccg acgcgtacgt caagtccgag ggccccatcg cgaaggcggg cctcctcgcc 120 aacatcgggc ccagcggctc caagtcgcac ggggcgaagg ccggtctcgt cgtcgccccc 180 cccagcacgt cggaccccga ctacgtctac acctggacgc tggattcgtc actcgtcttc 240 aagactatca tcgaccagtt cacctccggg gaagacactt ccctccgcac actcattgac 300 cagttcacta gcgcggagaa ggacctccag cagacgtcca accctagtgg cactgtttcc 360 accggcggtc tcggcgagcc caagttcaac atcgatgggt ccgcgttcac cggtgcctgg 420 ggtcgccctc agcgcgacgg ccctgctctc cgcgcgactg ctatcatagc ctacgctaac 480 tggntgctcg acaacaacaa cggcacgtct tacgtcacya acaccctctg gcccatcatc 540 aagcttgact tggactacac ccagaacaac tggaaccagt cgacgttcga cctttgggag 600 gaggtcaact cctcctcttt cttcacgact gccgtccagc accgtgctct ccgcgagggt 660 atcgccttcg cgaagaagat cggccaaacg tcggtcgtga gcggctacac cacgcaggcg 720 accaaccttc tctgcttcct gcagcttaac ccgtgttccg catcttcgca gtcgtactgg 780 aacccctcgg gcggctatgt cactgcgaac acaggcggcg gccggtccgg caaggactcg 840 aacaccgtcc tgacctcgat ccacaccttc gaccccgccg ctggctgcga cgccgcgacg 900 ttccagccgt gctctgacaa ggccctgtcc aaccttaagg tctacgtcga ctcgttccgt 960 tccatctact ccatcaacag tggcatcacc tccaacgccg ctgtcgctgt tggccgctac 1020 cccgaggatg tgtactacaa cggcaacccc tggtgcctct ccacgtccgc cgtcgctgag 1080 cagctctacg acgcgatcat cgtctggaac aagctcggct cgctcgaagt gacgagcacc 1140 tcgctcgcgt tcttcaagca gctctcctcg gatgccgccg tcggcaccta ctcgtcctcg 1200 tccgcgacgt tcaagacgct caccgcggcc gcgaagacgc tcgcggatgg cttcctcgct 1260 gtgaacgcga agtacacgcc ctcgaacggc ggcctcgcgg agcagttcag caagagcaac 1320 ggctcgccgc tcagcgccgt cgacctcacg tggagctacg ccgccgcgct cacgtccttt 1380 gccgcgcgtg agggcaagac ccccgcgagc tggggcgctg cgggcctcac cgtgccgtcg 1440 acgtgctcgg gtaacgcggg ccccagcgtg aaggtgacgt tcaacgtcca ggctacgact 1500 accttcggcg agaacatcta catcaccggt aacaccgctg cgctccagaa ctggtcgccc 1560 gataacgcgc tcctcctctc tgctgacaag taccccacct ggagcatcac gctcgacctc 1620 cccgcgaaca ccgtcgtcga gtacaaatac atccgcaagt tcaacggcca ggtcacctgg 1680

gaatcggacc ccaacaactc gatcacgacg cccgccgacg gtaccttcac ccagaacgac 1740 acctggcggt ga 1752 42 1623 DNA Leucopaxillus giganteus CDS (1)..(1620) cDNA misc_signal (1)..(51) mat_peptide (52)..(1620) misc_feature (1306)..(1338) linker misc_feature (1339)..(1620) binding domain misc_feature (1339)..(1620) binding domain 42 atg cat ttc tct gtc ctc tcc gta ttt ctc gcg att agt tct gct tgg 48 Met His Phe Ser Val Leu Ser Val Phe Leu Ala Ile Ser Ser Ala Trp -15 -10 -5 gct cag tct agc gca gtc gat gcc tat ctc gct ctc gaa tcc tcc gtc 96 Ala Gln Ser Ser Ala Val Asp Ala Tyr Leu Ala Leu Glu Ser Ser Val -1 1 5 10 15 gcc aag gcc ggg ttg ctc gcc aac att ggc cca tct ggt tca aag tct 144 Ala Lys Ala Gly Leu Leu Ala Asn Ile Gly Pro Ser Gly Ser Lys Ser 20 25 30 tcg ggt gcc aag tct ggg att gtc att gcg tcg cct tcg cat agc aac 192 Ser Gly Ala Lys Ser Gly Ile Val Ile Ala Ser Pro Ser His Ser Asn 35 40 45 cct gac tac ctg ttc acc tgg acc cgc gat tct tcg ctt gtg ttc cag 240 Pro Asp Tyr Leu Phe Thr Trp Thr Arg Asp Ser Ser Leu Val Phe Gln 50 55 60 act atc atc aac cag ttc acg ttg gga cac gac aat agt ttg agg cct 288 Thr Ile Ile Asn Gln Phe Thr Leu Gly His Asp Asn Ser Leu Arg Pro 65 70 75 gag att gac aat ttt gtt gat tcc caa agg aag atc caa caa gtc tca 336 Glu Ile Asp Asn Phe Val Asp Ser Gln Arg Lys Ile Gln Gln Val Ser 80 85 90 95 aac cct tcg gga act gtt agt tct ggc ggc ctt ggc gag ccc aag ttc 384 Asn Pro Ser Gly Thr Val Ser Ser Gly Gly Leu Gly Glu Pro Lys Phe 100 105 110 aat atc gac gaa acc gcc ttt aca ggg gca tgg ggc aac aca tcc tac 432 Asn Ile Asp Glu Thr Ala Phe Thr Gly Ala Trp Gly Asn Thr Ser Tyr 115 120 125 gtc acc aac acc cta tgg ccc atc atc aaa ttg gac ctc gac tac gtc 480 Val Thr Asn Thr Leu Trp Pro Ile Ile Lys Leu Asp Leu Asp Tyr Val 130 135 140 gcg tcc aac tgg aac cag act ggt ttc gat ttg tgg gaa gaa gta tcc 528 Ala Ser Asn Trp Asn Gln Thr Gly Phe Asp Leu Trp Glu Glu Val Ser 145 150 155 tct tct tcc ttc ttc act act gcg gtt caa cac cgc tcc ctt cgc caa 576 Ser Ser Ser Phe Phe Thr Thr Ala Val Gln His Arg Ser Leu Arg Gln 160 165 170 175 ggt gct tcc cta gcc act gcc att gga caa acc tct gtc gtt cct ggc 624 Gly Ala Ser Leu Ala Thr Ala Ile Gly Gln Thr Ser Val Val Pro Gly 180 185 190 tac acc acc cag gcc aac aat ata ctc tgc ttt caa cag tcc tac tgg 672 Tyr Thr Thr Gln Ala Asn Asn Ile Leu Cys Phe Gln Gln Ser Tyr Trp 195 200 205 aac tca gct ggg tat atg act gcc aat acc gga ggc ggg cgt tct ggg 720 Asn Ser Ala Gly Tyr Met Thr Ala Asn Thr Gly Gly Gly Arg Ser Gly 210 215 220 aaa gac gcc aac acc gtc ctc aca agt att cac aca ttc gat ccc gat 768 Lys Asp Ala Asn Thr Val Leu Thr Ser Ile His Thr Phe Asp Pro Asp 225 230 235 gcc ggc tgc gat tcc atc act ttc caa cct tgt tca gac cgt gcg ctc 816 Ala Gly Cys Asp Ser Ile Thr Phe Gln Pro Cys Ser Asp Arg Ala Leu 240 245 250 255 atc aac ctt gtc aca tac gtc aat gca ttc cga agc atc tac gct atc 864 Ile Asn Leu Val Thr Tyr Val Asn Ala Phe Arg Ser Ile Tyr Ala Ile 260 265 270 aac gcg ggc atc gct aat aac caa ggc gtt gcc act ggt agg tat cct 912 Asn Ala Gly Ile Ala Asn Asn Gln Gly Val Ala Thr Gly Arg Tyr Pro 275 280 285 gaa gat ggc tac atg ggc gga aac ctc tac tac gct ctc tcc act tgg 960 Glu Asp Gly Tyr Met Gly Gly Asn Leu Tyr Tyr Ala Leu Ser Thr Trp 290 295 300 aag aaa cat agc tcc ctc acc att acg gcg aca tca caa cct ttt ttc 1008 Lys Lys His Ser Ser Leu Thr Ile Thr Ala Thr Ser Gln Pro Phe Phe 305 310 315 gcg ctc ttc tcg ccg ggt gtt gct act ggc aca tat gcg tcc tct acg 1056 Ala Leu Phe Ser Pro Gly Val Ala Thr Gly Thr Tyr Ala Ser Ser Thr 320 325 330 335 act acc tat gct aca ctt act act gct att cag aat tac gcg gat agc 1104 Thr Thr Tyr Ala Thr Leu Thr Thr Ala Ile Gln Asn Tyr Ala Asp Ser 340 345 350 ttc atc gct gtc gtg gct aag tat acg cct gcc aat ggc gga ctg gcg 1152 Phe Ile Ala Val Val Ala Lys Tyr Thr Pro Ala Asn Gly Gly Leu Ala 355 360 365 gaa cag tac agc agg agt aac ggt ttg ccc gtt agt gcc gtt gat tta 1200 Glu Gln Tyr Ser Arg Ser Asn Gly Leu Pro Val Ser Ala Val Asp Leu 370 375 380 act tgg agc tat gcc gct ctc ttg acg gcg gct gat gcg cga gcg ggg 1248 Thr Trp Ser Tyr Ala Ala Leu Leu Thr Ala Ala Asp Ala Arg Ala Gly 385 390 395 cta aca ccc gct gca tgg gga gca gcg ggg ttg acc gtg cca agc act 1296 Leu Thr Pro Ala Ala Trp Gly Ala Ala Gly Leu Thr Val Pro Ser Thr 400 405 410 415 tgc tct act ggg ggt ggt tca aac cca ggt ggt gga ggg tcg gtc tct 1344 Cys Ser Thr Gly Gly Gly Ser Asn Pro Gly Gly Gly Gly Ser Val Ser 420 425 430 gtt acg ttc aat gtt caa gct aca acc acc ttt ggt gaa aac att ttt 1392 Val Thr Phe Asn Val Gln Ala Thr Thr Thr Phe Gly Glu Asn Ile Phe 435 440 445 ttg acc ggc tcg atc aac gag tta gct aac tgg tct cct gat aat gct 1440 Leu Thr Gly Ser Ile Asn Glu Leu Ala Asn Trp Ser Pro Asp Asn Ala 450 455 460 ctc gcc ctc tct gcg gcc aat tat ccc acc tgg agc ata acc gtc aac 1488 Leu Ala Leu Ser Ala Ala Asn Tyr Pro Thr Trp Ser Ile Thr Val Asn 465 470 475 gtt ccc gca agc act acg atc caa tac aag ttt atc cgt aaa ttc aac 1536 Val Pro Ala Ser Thr Thr Ile Gln Tyr Lys Phe Ile Arg Lys Phe Asn 480 485 490 495 gga gcc atc acc tgg gag tcc gac ccg aat agg cag atc aca acg ccg 1584 Gly Ala Ile Thr Trp Glu Ser Asp Pro Asn Arg Gln Ile Thr Thr Pro 500 505 510 tct tcg gga agt ttt gtc cag aat gac tcg tgg aag tag 1623 Ser Ser Gly Ser Phe Val Gln Asn Asp Ser Trp Lys 515 520 43 540 PRT Leucopaxillus giganteus 43 Met His Phe Ser Val Leu Ser Val Phe Leu Ala Ile Ser Ser Ala Trp -15 -10 -5 Ala Gln Ser Ser Ala Val Asp Ala Tyr Leu Ala Leu Glu Ser Ser Val -1 1 5 10 15 Ala Lys Ala Gly Leu Leu Ala Asn Ile Gly Pro Ser Gly Ser Lys Ser 20 25 30 Ser Gly Ala Lys Ser Gly Ile Val Ile Ala Ser Pro Ser His Ser Asn 35 40 45 Pro Asp Tyr Leu Phe Thr Trp Thr Arg Asp Ser Ser Leu Val Phe Gln 50 55 60 Thr Ile Ile Asn Gln Phe Thr Leu Gly His Asp Asn Ser Leu Arg Pro 65 70 75 Glu Ile Asp Asn Phe Val Asp Ser Gln Arg Lys Ile Gln Gln Val Ser 80 85 90 95 Asn Pro Ser Gly Thr Val Ser Ser Gly Gly Leu Gly Glu Pro Lys Phe 100 105 110 Asn Ile Asp Glu Thr Ala Phe Thr Gly Ala Trp Gly Asn Thr Ser Tyr 115 120 125 Val Thr Asn Thr Leu Trp Pro Ile Ile Lys Leu Asp Leu Asp Tyr Val 130 135 140 Ala Ser Asn Trp Asn Gln Thr Gly Phe Asp Leu Trp Glu Glu Val Ser 145 150 155 Ser Ser Ser Phe Phe Thr Thr Ala Val Gln His Arg Ser Leu Arg Gln 160 165 170 175 Gly Ala Ser Leu Ala Thr Ala Ile Gly Gln Thr Ser Val Val Pro Gly 180 185 190 Tyr Thr Thr Gln Ala Asn Asn Ile Leu Cys Phe Gln Gln Ser Tyr Trp 195 200 205 Asn Ser Ala Gly Tyr Met Thr Ala Asn Thr Gly Gly Gly Arg Ser Gly 210 215 220 Lys Asp Ala Asn Thr Val Leu Thr Ser Ile His Thr Phe Asp Pro Asp 225 230 235 Ala Gly Cys Asp Ser Ile Thr Phe Gln Pro Cys Ser Asp Arg Ala Leu 240 245 250 255 Ile Asn Leu Val Thr Tyr Val Asn Ala Phe Arg Ser Ile Tyr Ala Ile 260 265 270 Asn Ala Gly Ile Ala Asn Asn Gln Gly Val Ala Thr Gly Arg Tyr Pro 275 280 285 Glu Asp Gly Tyr Met Gly Gly Asn Leu Tyr Tyr Ala Leu Ser Thr Trp 290 295 300 Lys Lys His Ser Ser Leu Thr Ile Thr Ala Thr Ser Gln Pro Phe Phe 305 310 315 Ala Leu Phe Ser Pro Gly Val Ala Thr Gly Thr Tyr Ala Ser Ser Thr 320 325 330 335 Thr Thr Tyr Ala Thr Leu Thr Thr Ala Ile Gln Asn Tyr Ala Asp Ser 340 345 350 Phe Ile Ala Val Val Ala Lys Tyr Thr Pro Ala Asn Gly Gly Leu Ala 355 360 365 Glu Gln Tyr Ser Arg Ser Asn Gly Leu Pro Val Ser Ala Val Asp Leu 370 375 380 Thr Trp Ser Tyr Ala Ala Leu Leu Thr Ala Ala Asp Ala Arg Ala Gly 385 390 395 Leu Thr Pro Ala Ala Trp Gly Ala Ala Gly Leu Thr Val Pro Ser Thr 400 405 410 415 Cys Ser Thr Gly Gly Gly Ser Asn Pro Gly Gly Gly Gly Ser Val Ser 420 425 430 Val Thr Phe Asn Val Gln Ala Thr Thr Thr Phe Gly Glu Asn Ile Phe 435 440 445 Leu Thr Gly Ser Ile Asn Glu Leu Ala Asn Trp Ser Pro Asp Asn Ala 450 455 460 Leu Ala Leu Ser Ala Ala Asn Tyr Pro Thr Trp Ser Ile Thr Val Asn 465 470 475 Val Pro Ala Ser Thr Thr Ile Gln Tyr Lys Phe Ile Arg Lys Phe Asn 480 485 490 495 Gly Ala Ile Thr Trp Glu Ser Asp Pro Asn Arg Gln Ile Thr Thr Pro 500 505 510 Ser Ser Gly Ser Phe Val Gln Asn Asp Ser Trp Lys 515 520

Claims

1-91. (canceled)

92. An isolated polypeptide having glucoamylase activity, selected from the group consisting of: (a) a polypeptide having an amino acid sequence which has at least 90% sequence identity with amino acids 1 to 556 of SEQ ID NO: 2; and (b) a polypeptide having an amino acid sequence which has at least 90% sequence identity with amino acids 1 to 561 of SEQ ID NO: 37.

93. A fusion polypeptide comprising the polypeptide of claim 92 and a second polypeptide.

94. A composition comprising the polypeptide of claim 92 and an alpha-amylase.

95. The composition of claim 94, wherein the alpha-amylase is a fungal alpha-amylase.

96. The composition of claim 94, wherein the alpha-amylase is obtained from Aspergillus, Meriplus, or Rhizomucor.

97. The composition of claim 94, wherein the alpha-amylase is obtained from Aspergillus awamori, Aspergillus kawachii, Aspergillus niger, Aspergillus oryzae, Meripilus giganteus, or Rhizomucor pusillus.

98. The composition of claim 94, wherein the alpha-amylase comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30.

99. A process for producing a fermentation product from starch-containing material comprising the steps of: (a) liquefying the starch-containing material in the presence of an alpha-amylase; (b) saccharifying the liquefied material obtained in step (a) using a polypeptide of claim 92; and (c) fermenting the saccharified material using a fermenting organism.

100. A process for producing a fermentation product from starch-containing material comprising: (a) saccharifying starch-containing material with a polypeptide of claim 92 at a temperature below the initial gelatinization temperature of said starch-containing material, and (b) fermenting using a fermenting organism.

101. The process of claim 100, wherein the polypeptide has an amino acid sequence which has at least 95% sequence identity with amino acids 1 to 556 of SEQ ID NO: 2 or amino acids 1 to 561 of SEQ ID NO: 37 or is a fragment of the sequence of amino acids 1 to 556 of SEQ ID NO: 2 or of amino acids 1 to 561 of SEQ ID NO: 37 which has glucoamylase activity.

102. The process of claim 100, which comprises the sequence of amino acids 1 to 556 of SEQ ID NO: 2 or amino acids 1 to 561 of SEQ ID NO: 37.

103. The process of claim 100, which is a fragment of the sequence of amino acids 1 to 556 of SEQ ID NO: 2 or a fragment of the sequence of amino acids 1 to 561 of SEQ ID NO: 37 which has glucoamylase activity.

104. An isolated polypeptide having glucoamylase activity, selected from the group consisting of: (a) a polypeptide comprising a catalytic domain having an amino acid sequence which has at least 90% sequence identity with amino acids 1 to 455 of SEQ ID NO: 2; and (b) a polypeptide comprising a catalytic domain having an amino acid sequence which has at least 90% sequence identity with amino acids 1 to 460 of SEQ ID NO: 37.

105. The isolated polypeptide of claim 104, which comprises a foreign binding domain.

106. A fusion polypeptide comprising the polypeptide of claim 104 and a second polypeptide.

107. A composition comprising a polypeptide of claim 104 and an alpha-amylase.

108. A process for producing a fermentation product from starch-containing material comprising the steps of: (a) liquefying the starch-containing material in the presence of an alpha-amylase; (b) saccharifying the liquefied material obtained in step (a) using a polypeptide of claim 104; and (c) fermenting the saccharified material using a fermenting organism.

109. A process for producing a fermentation product from starch-containing material comprising: (a) saccharifying starch-containing material with a polypeptide of claim 104 at a temperature below the initial gelatinization temperature of said starch-containing material, and (b) fermenting using a fermenting organism.

110. An isolated polypeptide having carbohydrate binding activity, selected from the group consisting of: (a) a polypeptide comprising a binding domain having an amino acid sequence which has at least 90% sequence identity with amino acids 466 to 556 of SEQ ID NO: 2; and (b) a polypeptide comprising a binding domain having an amino acid sequence which has at least 90% sequence identity with amino acids 471 to 561 of SEQ ID NO: 37.

111. The polypeptide of claim 110, which further comprises a catalytic domain obtained from a glucoamylase polypeptide.