U.S. patent application number 11/568760 was filed with the patent office on 2008-04-17 for methods for prediction of clinical outcome to epidermal growth factor receptor inhibitors by cancer patients.
This patent application is currently assigned to THE REGENTS OF THE UNIVERSITY OF COLORADO. Invention is credited to Paul A. Bunn, Federico Cappuzzo, Wilbur A. Franklin, Marileila Varella Garcia, Fred R. Hirsch.
Application Number | 20080090233 11/568760 |
Document ID | / |
Family ID | 35463260 |
Filed Date | 2008-04-17 |
United States Patent
Application |
20080090233 |
Kind Code |
A1 |
Garcia; Marileila Varella ;
et al. |
April 17, 2008 |
Methods for Prediction of Clinical Outcome to Epidermal Growth
Factor Receptor Inhibitors by Cancer Patients
Abstract
Disclosed are biomarkers, methods and assay kits for the
identification of cancer patients who are predicted to benefit, or
not to benefit, from the therapeutic administration of an epidermal
growth factor receptor (EGFR) inhibitor. The biomarkers of the
present invention include detection of EGFR and HER 2 gene
amplification and polysomy, EGFR protein expression, EGFR
mutations, phosphorylated Akt protein expression, and various
combinations of such biomarkers, as well as the combination of
these biomarkers with mutations in the tyrosine kinase domain of
the EGFR gene. Increased EGFR gene copy number, increased HER2 gene
copy number, increased EGFR, protein expression, activated AKT
protein expression (phosphorylated AKT) and EGFR mutations are all
associated with better outcome for cancer patients treated with
EGFR inhibitors. The invention provides a diagnostic paradigm based
on each of these tests and combinations of these tests to select
cancer patients who will benefit from EGFR inhibitor therapy, as
well as a diagnostic paradigm to select cancer patients who will
not benefit from EGFR inhibitor therapy.
Inventors: |
Garcia; Marileila Varella;
(Greenwood Village, CO) ; Bunn; Paul A.;
(Evergreen, CO) ; Cappuzzo; Federico; (Bologna,
IT) ; Franklin; Wilbur A.; (Denver, CO) ;
Hirsch; Fred R.; (Denver, CO) |
Correspondence
Address: |
SHERIDAN ROSS PC
1560 BROADWAY, SUITE 1200
DENVER
CO
80202
US
|
Assignee: |
THE REGENTS OF THE UNIVERSITY OF
COLORADO
Boulder
CO
|
Family ID: |
35463260 |
Appl. No.: |
11/568760 |
Filed: |
May 26, 2005 |
PCT Filed: |
May 26, 2005 |
PCT NO: |
PCT/US05/18879 |
371 Date: |
November 9, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60575789 |
May 27, 2004 |
|
|
|
60677852 |
May 3, 2005 |
|
|
|
Current U.S.
Class: |
435/6.14 ; 435/4;
435/40.5 |
Current CPC
Class: |
C12Q 2600/158 20130101;
C12Q 2600/156 20130101; C12Q 2600/106 20130101; C12Q 2600/112
20130101; C12Q 2600/118 20130101; C12Q 1/6886 20130101 |
Class at
Publication: |
435/6 ; 435/4;
435/40.5 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12Q 1/00 20060101 C12Q001/00; G01N 33/483 20060101
G01N033/483 |
Claims
1. A method to select a cancer patient who is predicted to benefit
or not benefit from therapeutic administration of an EGFR
inhibitor, comprising: a) detecting in a sample of tumor cells from
a patient a level of a biomarker selected from the group consisting
of: i) a level of amplification of the epidermal growth factor
receptor (EGFR) gene; ii) a level of polysomy of the EGFR gene;
iii) a level of amplification of the human tyrosine kinase
receptor-type receptor (HER2) gene; and iv) a level of polysomy of
the HER2 gene; b) comparing the level of the biomarker in the tumor
cell sample to a control level of the biomarker selected from the
group consisting of: i) a control level of the biomarker that has
been correlated with sensitivity to the EGFR inhibitor; and ii) a
control level of the biomarker that has been correlated with
resistance to the EGFR inhibitor; and c) selecting the patient as
being predicted to benefit from therapeutic administration of the
EGFR inhibitor, if the level of the biomarker in the patient's
tumor cells is statistically similar to or greater than the control
level of the biomarker that has been correlated with sensitivity to
the EGFR inhibitor, or if the level of the biomarker in the
patient's tumor cells is statistically greater than the level of
the biomarker that has been correlated with resistance to the EGFR
inhibitor; or d) selecting the patient as being predicted to not
benefit from therapeutic administration of the EGFR inhibitor, if
the level of the biomarker in the patient's tumor cells is
statistically less than the control level of the biomarker that has
been correlated with sensitivity to the EGFR inhibitor, or if the
level of the biomarker in the patient's tumor cells is
statistically similar to or less than the level of the biomarker
that has been correlated with resistance to the EGFR inhibitor.
2. The method of claim 1, wherein the step of detecting in (a)(i)
or (a)(ii) is performed using a nucleotide probe that hybridizes to
the EGFR gene.
3. The method of claim 1, wherein the step of detecting in (a)(iii)
or (a)(iv) is performed using a nucleotide probe that hybridizes to
the HER2 gene.
4. The method of claim 2, wherein the step of detecting further
comprises using a nucleotide probe that hybridizes to chromosome 7
centromere sequences.
5. The method of claim 2, wherein the step of detecting further
comprises using a nucleotide probe that hybridizes to chromosome 17
centromere sequences.
6. The method of claim 2, wherein the step of detecting comprises
using a chimeric nucleotide probe that hybridizes to the EGFR gene
and to chromosome 7 centromere sequences.
7. The method of claim 3, wherein the step of detecting comprises
using a chimeric nucleotide probe that hybridizes to the HER2 gene
and to chromosome 17 centromere sequences.
8. The method of claim 1, wherein the step of detecting comprises
detecting the number of copies of the EGFR gene or HER2 gene per
tumor cell in one or more tumor cells in the sample.
9. The method of claim 1, wherein the step of detecting in (a)(i)
comprises detecting EGFR gene amplification per tumor cell in one
or more tumor cells in the sample.
10. The method of claim 1, wherein the step of detecting in
(a)(iii) comprises detecting HER2 gene amplification per tumor cell
in one or more tumor cells in the sample.
11. The method of claim 1, wherein the step of detecting comprises
any two of steps (a)(i), (a)(ii), (a)(iii) and (a)(iv).
12. The method of claim 1, wherein the step of detecting comprises
any three of steps (a)(i), (a)(ii), (a)(iii) and (a)(iv).
13. The method of claim 1, wherein the step of detecting comprises
all four of steps (a)(i), (a)(ii), (a)(iii) and (a)(iv).
14. The method of claim 1, wherein the step of detecting comprises
both step (a)(i) and step (a)(ii).
15. The method of claim 13, wherein the step of detecting further
comprises step (a)(iii).
16. The method of claim 13, wherein the step of detecting further
comprises step (a)(iv).
17. The method of claim 1, wherein the step of detecting comprises
both step (a)(iii) and (a)(iv).
18. The method of claim 16, wherein the step of detecting further
comprises step (a)(i).
19. The method of claim 16, wherein the step of detecting further
comprises step (a)(ii).
20. The method of claim 1, wherein the step of detecting comprises
both step (a)(ii) and (a)(iv).
21. The method of claim 1, wherein the step of detecting is
performed by fluorescent in situ hybridization (FISH).
22. The method of claim 1, wherein the step of comparing comprises
comparing the biomarker level in the tumor cells to a control level
of the biomarker in one or more control cells that are resistant to
the EGFR inhibitor.
23. The method of claim 1, wherein the step of comparing comprises
comparing the biomarker level in the tumor cells to a control level
of the biomarker in one or more control cells that are sensitive to
the EGFR inhibitor.
24. The method of claim 1, wherein the control level of the
biomarker that has been correlated with sensitivity and/or
resistance to the EGFR inhibitor has been predetermined.
25. The method of claim 1, wherein a patient having a tumor sample
with 3 or more copies of the EGFR gene in less than about 40% of
cells is predicted to be a poor- or non-responder to treatment with
the EGFR inhibitor.
26. The method of claim 1, wherein a patient having a tumor sample
with about 4 or more copies of the EGFR gene in greater than or
equal to about 40% of cells is predicted to benefit from treatment
with the EGFR inhibitor.
27. The method of claim 1, wherein a patient is predicted to
benefit from to treatment with the EGFR inhibitor, when the patient
has a tumor sample with EGFR gene clusters or: a) a ratio of EGFR
gene copies to chromosome 7 copies per cell of about 2 or more; or
b) an average of about 15 or more copies of the EGFR gene per cell
in greater than or equal to about 10% of analyzed cells.
28. The method of claim 1, wherein a patient having a tumor sample
with 3 or more copies of the HER2 gene in less than about 40% of
cells is predicted to be a poor- or non-responder from treatment
with the EGFR inhibitor.
29. The method of claim 1, wherein a patient having a tumor sample
with about 4 or more copies of the HER2 gene in greater than or
equal to about 40% of cells is predicted to benefit from treatment
with the EGFR inhibitor.
30. The method of claim 1, wherein a patient is predicted to
benefit from treatment with the EGFR inhibitor, when the patient
has a tumor sample with HER2 gene clusters or: a) a ratio of HER2
gene copies to chromosome 17 copies per cell of about 2 or more; or
b) an average of about 15 or more copies of the HER2 gene per cell
in greater than or equal to about 10% of analyzed cells.
31. The method of claim 1, wherein selection of the patient in step
(d) based on EGFR gene amplification or polysomy is reversed if the
patient is selected as being predicted to benefit from therapeutic
administration of the EGFR inhibitor based on HER2 gene
amplification or polysomy.
32. The method of claim 1, wherein the selection of the patient in
step (c) based on EGFR gene amplification or polysomy and the
positive selection of the patient based on HER2 gene amplification
or polysomy increases the likelihood that the patient will respond
to treatment with the EGFR inhibitor as compared to selection of
the patient in step (c) based on EGFR gene amplification or
polysomy alone.
33. The method of claim 1, further comprising: a) detecting a level
of expression of epidermal growth factor receptor (EGFR) protein in
the tumor cell sample; b) comparing the level of EGFR protein
expression in the tumor cell sample to a control level of EGFR
protein expression selected from the group consisting of: i) a
control level that has been correlated with sensitivity to the EGFR
inhibitor; and ii) a control level that has been correlated with
resistance to the EGFR inhibitor; and c) selecting the patient as
being predicted to benefit from therapeutic administration of the
EGFR inhibitor, if the level of EGFR protein expression in the
patient's tumor cells is statistically similar to or greater than
the control level of EGFR protein expression that has been
correlated with sensitivity to the EGFR inhibitor, or if the level
of EGFR protein expression in the patient's tumor cells is
statistically greater than the level of EGFR protein expression
that has been correlated with resistance to the EGFR inhibitor; or
d) selecting the patient as being predicted to not benefit from
therapeutic administration of the EGFR inhibitor, if the level of
EGFR protein expression in the patient's tumor cells is
statistically less than the control level of EGFR protein
expression that has been correlated with sensitivity to the EGFR
inhibitor, or if the level of EGFR protein expression in the
patient's tumor cells is statistically similar to or less than the
level of EGFR protein expression that has been correlated with
resistance to the EGFR inhibitor.
34. The method of claim 33, wherein the level of EGFR protein
expression is detected using immunohistochemistry (IHC).
35. The method of claim 1, further comprising: a) detecting a level
of expression of phosphorylated Akt protein in the tumor cell
sample; b) comparing the level of phosphorylated Akt protein
expression in the tumor cell sample to a control level of
phosphorylated Akt protein expression selected from the group
consisting of: i) a control level that has been correlated with
sensitivity to the EGFR inhibitor; and ii) a control level that has
been correlated with resistance to the EGFR inhibitor; and c)
selecting the patient as being predicted to benefit from
therapeutic administration of the EGFR inhibitor, if the level of
phosphorylated Akt protein expression in the patient's tumor cells
is statistically similar to or greater than the control level of
phosphorylated Akt protein expression that has been correlated with
sensitivity to the EGFR inhibitor, or if the level of
phosphorylated Akt protein expression in the patient's tumor cells
is statistically greater than the level of phosphorylated Akt
protein expression that has been correlated with resistance to the
EGFR inhibitor; or d) selecting the patient as being predicted to
not benefit from therapeutic administration of the EGFR inhibitor,
if the level of phosphorylated Akt protein expression in the
patient's tumor cells is statistically less than the control level
of phosphorylated Akt protein expression that has been correlated
with sensitivity to the EGFR inhibitor, or if the level of
phosphorylated Akt protein expression in the patient's tumor cells
is statistically similar to or less than the level of
phosphorylated Akt protein expression that has been correlated with
resistance to the EGFR inhibitor.
36. The method of claim 35, wherein the level of phosphorylated Akt
protein expression is detected using immunohistochemistry
(IHC).
37. The method of claim 35, wherein the step of detecting comprises
detecting EGFR polysomy and expression of phosphorylated AKT
protein.
38. The method of claim 1, further comprising a step of detecting
mutations in the EGFR gene, wherein detection of one or more
mutations in the EGFR gene is further predictive that the patient
will benefit from treatment with the EGFR inhibitor.
39. The method of claim 38, comprising detecting mutations in any
one or more of exons 18, 19 and 21 of the EGFR gene.
40. The method of claim 38, comprising detecting mutations in the
tyrosine kinase domain of the EGFR gene.
41. A method to select a cancer patient who is predicted to benefit
or not benefit from therapeutic administration of an EGFR
inhibitor, comprising: a) detecting in a sample of tumor cells from
a patient a level of expression of epidermal growth factor receptor
(EGFR) protein; b) comparing the level of EGFR protein expression
in the tumor cell sample to a control level of EGFR protein
expression selected from the group consisting of: i) a control
level that has been correlated with sensitivity to the EGFR
inhibitor; and ii) a control level that has been correlated with
resistance to the EGFR inhibitor; and c) selecting the patient as
being predicted to benefit from therapeutic administration of the
EGFR inhibitor, if the level of EGFR protein expression in the
patient's tumor cells is statistically similar to or greater than
the control level of EGFR protein expression that has been
correlated with sensitivity to the EGFR inhibitor, or if the level
of EGFR protein expression in the patient's tumor cells is
statistically greater than the level of EGFR protein expression
that has been correlated with resistance to the EGFR inhibitor; or
d) selecting the patient as being predicted to not benefit from
therapeutic administration of the EGFR inhibitor, if the level of
EGFR protein expression in the patient's tumor cells is
statistically less than the control level of EGFR protein
expression that has been correlated with sensitivity to the EGFR
inhibitor, or if the level of EGFR protein expression in the
patient's tumor cells is statistically similar to or less than the
level of EGFR protein expression that has been correlated with
resistance to the EGFR inhibitor.
42. The method of claim 41, wherein the level of EGFR protein
expression is detected using immunohistochemistry (IHC).
43. The method of claim 41, further comprising a step of detecting
mutations in the EGFR gene, wherein detection of one or more
mutations in the EGFR gene is further predictive that the patient
will respond to treatment with the EGFR inhibitor.
44. The method of claim 43, comprising detecting mutations in any
one or more of exons 18, 19 and 21 of the EGFR gene.
45. The method of claim 43, comprising detecting mutations in the
tyrosine kinase domain of the EGFR gene.
46. The method of claim 41, further comprising: a) detecting a
level of expression of phosphorylated Akt protein in the tumor cell
sample; b) comparing the level of phosphorylated Akt protein
expression in the tumor cell sample to a control level of
phosphorylated Akt protein expression selected from the group
consisting of: i) a control level that has been correlated with
sensitivity to the EGFR inhibitor; and ii) a control level that has
been correlated with resistance to the EGFR inhibitor; and c)
selecting the patient as being predicted to benefit from
therapeutic administration of the EGFR inhibitor, if the level of
phosphorylated Akt protein expression in the patient's tumor cells
is statistically similar to or greater than the control level of
phosphorylated Akt protein expression that has been correlated with
sensitivity to the EGFR inhibitor, or if the level of
phosphorylated Akt protein expression in the patient's tumor cells
is statistically greater than the level of phosphorylated Akt
protein expression that has been correlated with resistance to the
EGFR inhibitor; or d) selecting the patient as being predicted to
not benefit from therapeutic administration of the EGFR inhibitor,
if the level of phosphorylated Akt protein expression in the
patient's tumor cells is statistically less than the control level
of phosphorylated Akt protein expression that has been correlated
with sensitivity to the EGFR inhibitor, or if the level of
phosphorylated Akt protein expression in the patient's tumor cells
is statistically similar to or less than the level of
phosphorylated Akt protein expression that has been correlated with
resistance to the EGFR inhibitor.
47. The method of claim 1, wherein the patient has lung cancer.
48. The method of claim 1, wherein the patient has non-small cell
lung carcinoma (NSCLC).
49. The method of claim 1, wherein the patient has
bronchioloalveolar carcinoma (BAC) or adenocarcinomas with BAC
features.
50. The method of claim 1, wherein the EGFR inhibitor is
gefitinib.
51. The method of claim 1, wherein the EGFR inhibitor is
eroltinib.
52. The method of claim 1, wherein the EGFR inhibitor is
cetuximab.
53. An assay kit for selecting a cancer patient who is predicted to
benefit or not to benefit from therapeutic administration of an
EGFR inhibitor, the assay kit comprising: a) a means for detecting
in a sample of tumor cells a level of a biomarker or a combination
of biomarkers selected from the group consisting of: i) a level of
amplification of the epidermal growth factor receptor (EGFR) gene;
ii) a level of polysomy of the EGFR gene; iii) a level of
amplification of the human tyrosine kinase receptor-type receptor
(HER2) gene; iv) a level of polysomy of the HER2 gene; v) a level
of EGFR protein expression; and vi) a level of phosphorylated Akt
protein expression; and b) a control selected from the group
consisting of: i) a control sample for detecting sensitivity to the
EGFR inhibitor; ii) a control sample for detecting resistance to
the EGFR inhibitor; iii) information containing a predetermined
control level of the biomarker that has been correlated with
sensitivity to the EGFR inhibitor; and iv) information containing a
predetermined control level of the biomarker that has been
correlated with resistance to the EGFR inhibitor.
54. The assay kit of claim 53, further comprising at least one
means for detecting at least one mutation in the EGFR gene.
55. The assay kit of claim 53, wherein the means for detecting in
any of (a)(i)-(a)(iv) comprises a nucleotide probe that hybridizes
to a portion of the gene.
56. The assay kit of claim 55, wherein the nucleotide probe
hybridizes to a portion of human chromosome 7 or human chromosome
17.
57. The assay kit of claim 53, wherein the means for detecting in
(a)(i) or (a)(ii) comprises a nucleotide probe that hybridizes to a
portion of an EGFR gene and to a portion of the chromosome 7 other
than the EGFR gene.
58. The assay kit of claim 53, wherein the means for detecting in
(a)(iii) or (a)(iv) comprises a nucleotide probe that hybridizes to
a portion of an HER2 gene and to a portion of the chromosome 17
other than the HER2 gene.
59. The assay kit of claim 53, wherein the means for detecting is
for use in fluorescent in situ hybridization (FISH).
60. The assay kit of claim 53, wherein the means for detecting in
(a)(v) or (a)(vi) comprises an antibody or antigen binding fragment
thereof that selectively binds to the protein.
61. The assay kit of claim 53, wherein the means for detecting
comprises a detectable label.
62. The assay kit of claim 53, wherein the means for detecting is
immobilized on a substrate.
Description
FIELD OF THE INVENTION
[0001] The present invention generally relates to biomarkers,
methods and assay kits for the identification of cancer patients
who are predicted to benefit from EGFR inhibitor therapy.
BACKGROUND OF THE INVENTION
[0002] Neoplasia, or a process of rapid cellular proliferation
resulting in new, abnormal growth, is a characteristic of many
diseases which can be serious, and sometimes, life-threatening.
Typically, neoplastic growth of cells and tissues is characterized
by greater than normal proliferation of cells, wherein the cells
continue to grow even after the instigating factor (e.g., tumor
promoter, carcinogen, virus) is no longer present. The cellular
growth tends to show a lack of structural organization and/or
coordination with the normal tissue and usually creates a mass of
tissue (e.g., a tumor) which may be benign or malignant. Malignant
cellular growth, or malignant tumors (cancer), are a leading cause
of death worldwide, and the development of effective therapy for
neoplastic disease is the subject of a large body of research.
Although a variety of innovative approaches to treat and prevent
cancers have been proposed, many cancers continue to cause a high
rate of mortality and may be difficult to treat or relatively
unresponsive to conventional therapies. In addition, patients may
respond differently to various cancer therapies, making some
approaches useful for some patients and not for others. Therefore,
there is a continuing need in the art for the identification of
additional cancer risk factors and methods for early diagnosis and
therapy for cancers, as well as methods for identifying patients
that are expected to benefit from a particular type of therapy.
[0003] Illustrating this point, non-small cell lung cancer (NSCLC)
is the leading cause of cancer death in the world. While
chemotherapy has produced modest survival benefits in advanced
stages, standard two-drug combinations generate considerable
toxicity and require intravenous administration (Non-small Cell
Lung Cancer Collaborative Group, 1995; Schiller et al., 2002; Kelly
et al., 2001). Progress in the field of lung cancer biology led to
the development of small molecule inhibitors of target proteins
involved in the proliferation, apoptosis and angiogenesis. Targeted
therapy agents such as imatinib and trastuzumab produced consistent
survival benefit in chronic myeloid leukemia (Druker, 2001),
gastrointestinal stromal tumors (GIST) (Demetri 2002) and breast
cancers that overexpress the target proteins (Slamon 2001). The
epidermal growth factor receptor (EGFR) superfamily, including the
four distinct receptors EGFR/erbB-1, HER2/erbB-2, HER3/erbB-3, and
HER4/erbB-4, was early identified as a potential therapeutic target
in solid tumors. After ligand binding, these receptors homo- and
heterodimerize, and the tyrosine-kinase domain is activated,
initiating a cascade of events implicated in the development and
progression of cancer through effects on cell-cycle progression,
apoptosis, angiogenesis, and metastasis (Salomon et al., 2001;
Arteaga, 2002; Hirsch et al., 2003, Lung Cancer; Ciardello and
Tortora, 2001). EGFR is overexpressed in many human epithelial
malignancies, including NSCLC (Hirsch et al., 2003, J. Clin.
Oncol.; Salomon et al., 1995).
[0004] Given the biological importance of the EGFR molecular
network in carcinomas, several molecules were synthesized to
inhibit the tyrosine kinase domain of EGFR (Levitzki and Gazit,
1995; Levitt and Koty, 1999). Among the most promising of these new
drugs are gefitinib (ZD 1839, Iressa.RTM., AstraZeneca, UK), and
erlotinib (OSI 774, Tarceva.RTM., Genentech, USA). Both are orally
active, selective EGFR tyrosine-kinase inhibitors (EGFR-TKI) that
demonstrated antitumor activity against a variety of human cancer
cell lines expressing EGFR (Ciardiello et al., 2000). Likewise,
both have well documented activity as single agents in phase I
studies, including chemotherapy resistant NSCLC patients who had
response rates of about 10% (Kris et al., 2000, Lung Cancer;
Baselga et al., 2002; Herbst et al, 2002; Ranson et al., 2002;
Hidalgo et al., 2001). Activity was confirmed in large phase II
trials showing response rates of 19-26% in previously untreated,
advanced NSCLC patients, and 12-18% in patients who had failed one
or more prior chemotherapy combinations (Fukuoka et al., 2003; Kris
et al., 2003, JAMA; Perez-Soler et al., 2001; Miller et al., 2003).
More recently, a phase III trial (BR1) comparing erlotinib with
placebo as a second or third line therapy reported a survival
benefit for the EGFR inhibitor (Hazard Ratio: 0.73) (Shepherd et
al., 2004). Importantly, this survival benefit was not confined to
objective responders, nor to a single gender or histology, which
makes selection based on clinical and histopathological features
alone difficult.
[0005] In phase II trials with gefitinib, no correlation was
detected between EGFR protein expression and response to therapy,
although few studies have directly addressed this question.
Patients with squamous cell carcinomas had lower response rates
compared to patients with adenocarcinoma despite their higher rates
of EGFR expression (Ciardiello et al., 2000; Fukuoka et al., 2003;
Kris et al., 2003, JAMA). Recent reports showed that specific
missense and deletion mutations in the tyrosine kinase domain of
the EGFR gene 2005/117553 PCT/US2005/018879 (Lynch et all, 2004;
Paez et al., 2004) are significantly associated with gefitinib
sensitivity. However, while objective response has been reported in
up to 18% and symptomatic improvement in 40% of the unselected
gefitinib treated NSCLC patients (Fukuoka et al., 2003; Kris et
al., 2003, JAMA), the frequency of these mutations in unselected US
patients is low (Paez et al., 2004). These observations and the
finding that objective response can be detected in patients
carrying apparently wild type allele of the EGFR gene (Lynch et al,
Pao et al., Han et al (JCO, 23:2493, 2005), Mitsudomi et al., JCO
23:2513, 2005, Kim et al., Clinical Cancer Res, 11:2244, 2005)
suggest that other mechanisms are also involved in the response to
gefitinib. Furthermore, while these activating mutations identify
patients with high response rates, they cannot account for the high
stable disease rates, reported to occur in about 30% of NSCLC
patients treated with gefitinib (Fukuoka et al., 2003; Kris et al.,
2003, JAMA).
[0006] In summary, there are no reliable selection criteria for
determining which cancer patients, including NSCLC patients, will
benefit from treatment with EGFR inhibitors exemplified by, but not
limited to, gefitinib. Therefore, it is of great interest to
identify both patients that would benefit from EGFR inhibitors and
patients who are not going to benefit from such therapy, as well as
to identify treatments which can improve the responsiveness of
cancer cells which are resistant to EGFR inhibitors, and to develop
adjuvant treatments that enhance the response.
SUMMARY OF THE INVENTION
[0007] One embodiment of the invention relates to a method to
select a cancer patient who is predicted to benefit or not benefit
from therapeutic administration of an EGFR inhibitor. The method
includes the steps of: (a) detecting in a sample of tumor cells
from a patient a level of a biomarker selected from the group
consisting of: (b) comparing the level of the biomarker in the
tumor cell sample to a control level of the biomarker selected from
the group consisting of: (i) a control level of the biomarker that
has been correlated with sensitivity to the EGFR inhibitor; and
(ii) a control level of the biomarker that has been correlated with
resistance to the EGFR inhibitor; and (c) selecting the patient as
being predicted to benefit from therapeutic administration of the
EGFR inhibitor, if the level of the biomarker in the patient's
tumor cells is statistically similar to or greater than the control
level of the biomarker that has been correlated with sensitivity to
the EGFR inhibitor, or if the level of the biomarker in the
patient's tumor cells is statistically greater than the level of
the biomarker that has been correlated with resistance to the EGFR
inhibitor; or (d) selecting the patient as being predicted to not
benefit from therapeutic administration of the EGFR inhibitor, if
the level of the biomarker in the patient's tumor cells is
statistically less than the control level of the biomarker that has
been correlated with sensitivity to the EGFR inhibitor, or if the
level of the biomarker in the patient's tumor cells is
statistically similar to or less than the level of the biomarker
that has been correlated with resistance to the EGFR inhibitor. The
biomarker is selected from: (i) a level of amplification of the
epidermal growth factor receptor (EGFR) gene; (ii) a level of
polysomy of the EGFR gene; (iii) a level of amplification of the
human tyrosine kinase receptor-type receptor (HER2) gene; and (iv)
a level of polysomy of the HER2 gene. The step of detecting can
include detecting any one, two, three, or all four of the
biomarkers (i)-(iv). Particularly preferred combinations include,
but are not limited to: detecting (i) and (ii), and in one
embodiment, also detecting (iii) or (iv); detecting (iii) and (iv),
and in one embodiment, also detecting (i) or (ii); and detecting
(ii) and (iv).
[0008] The step of detecting can include, but is not limited to,
using a nucleotide probe that hybridizes to the EGFR gene or the
HER2 gene, and/or using a nucleotide probe that hybridizes to
chromosome 7 centromere sequences or to chromosome 17 centromere
sequences. In one aspect, the probe is a chimeric probe (e.g., that
hybridizes to the EGFR gene and to chromosome 7 centromere
sequences or that hybridizes to the HER2 gene and to chromosome 17
centromere sequences). The step of detecting can include, in one
aspect, detecting the number of copies of the EGFR gene or HER2
gene per tumor cell in one or more tumor cells in the sample,
and/or detecting EGFR or HER2 gene amplification per tumor cell in
one or more tumor cells in the sample. In a preferred embodiment,
the step of detecting is performed by fluorescent in situ
hybridization (FISH).
[0009] In one aspect of this embodiment, the step of comparing
comprises comparing the biomarker level in the tumor cells to a
control level of the biomarker in one or more control cells that
are resistant to the EGFR inhibitor, and/or in one or more control
cells that are sensitive to the EGFR inhibitor. In one aspect, the
control level of the biomarker that has been correlated with
sensitivity and/or resistance to the EGFR inhibitor has been
predetermined.
[0010] In one aspect of this embodiment, a patient having a tumor
sample with 3 or more copies of the EGFR gene in less than about
40% of cells is predicted to be a poor- or non-responder to
treatment with the EGFR inhibitor. In another aspect, a patient
having a tumor sample with about 4 or more copies of the EGFR gene
in greater than or equal to about 40% of cells is predicted to
benefit from treatment with the EGFR inhibitor. In another aspect,
a patient is predicted to benefit from to treatment with the EGFR
inhibitor, when the patient has a tumor sample with EGFR gene
clusters or: (a) a ratio of EGFR gene copies to chromosome 7 copies
per cell of about 2 or more; or (b) an average of about 15 or more
copies of the EGFR gene per cell in greater than or equal to about
10% of analyzed cells. In another aspect, a patient having a tumor
sample with 3 or more copies of the HER2 gene in less than about
40% of cells is predicted to be a poor- or non-responder from
treatment with the EGFR inhibitor. In yet another aspect, a patient
having a tumor sample with about 4 or more copies of the HER2 gene
in greater than or equal to about 40% of cells is predicted to
benefit from treatment with the EGFR inhibitor. In another aspect,
a patient is predicted to benefit from treatment with the EGFR
inhibitor, when the patient has a tumor sample with HER2 gene
clusters or: (a) a ratio of HER2 gene copies to chromosome 17
copies per cell of about 2 or more; or (b) an average of about 15
or more copies of the HER2 gene per cell in greater than or equal
to about 10% of analyzed cells.
[0011] In one aspect of this embodiment, selection of the patient
in step (d) based on EGFR gene amplification or polysomy is
reversed if the patient is selected as being predicted to benefit
from therapeutic administration of the EGFR inhibitor based on HER2
gene amplification or polysomy. In another aspect of this
embodiment, the selection of the patient in step (c) based on EGFR
gene amplification or polysomy and the positive selection of the
patient based on HER2 gene amplification or polysomy increases the
likelihood that the patient will respond to treatment with the EGFR
inhibitor as compared to selection of the patient in step (c) based
on EGFR gene amplification or polysomy alone.
[0012] In another aspect of this embodiment, the method further
includes further steps of: (a) detecting a level of expression of
epidermal growth factor receptor (EGFR) protein in the tumor cell
sample; (b) comparing the level of EGFR protein expression in the
tumor cell sample to a control level of EGFR protein expression
selected from the group consisting of: (i) a control level that has
been correlated with sensitivity to the EGFR inhibitor; and (ii) a
control level that has been correlated with resistance to the EGFR
inhibitor; and (c) selecting the patient as being predicted to
benefit from therapeutic administration of the EGFR inhibitor, if
the level of EGFR protein expression in the patient's tumor cells
is statistically similar to or greater than the control level of
EGFR protein expression that has been correlated with sensitivity
to the EGFR inhibitor, or if the level of EGFR protein expression
in the patient's tumor cells is statistically greater than the
level of EGFR protein expression that has been correlated with
resistance to the EGFR inhibitor; or (d) selecting the patient as
being predicted to not benefit from therapeutic administration of
the EGFR inhibitor, if the level of EGFR protein expression in the
patient's tumor cells is statistically less than the control level
of EGFR protein expression that has been correlated with
sensitivity to the EGFR inhibitor, or if the level of EGFR protein
expression in the patient's tumor cells is statistically similar to
or less than the level of EGFR protein expression that has been
correlated with resistance to the EGFR inhibitor. In a preferred
embodiment, the level of EGFR protein expression is detected using
immunohistochemistry (IHC).
[0013] In another aspect of any of the embodiments of the method
above, the method also includes the following steps: (a) detecting
a level of expression of phosphorylated Akt protein in the tumor
cell sample; (b) comparing the level of phosphorylated Akt protein
expression in the tumor cell sample to a control level of
phosphorylated Akt protein expression selected from the group
consisting of: (i) a control level that has been correlated with
sensitivity to the EGFR inhibitor; and (ii) a control level that
has been correlated with resistance to the EGFR inhibitor; and (c)
selecting the patient as being predicted to benefit from
therapeutic administration of the EGFR inhibitor, if the level of
phosphorylated Akt protein expression in the patient's tumor cells
is statistically similar to or greater than the control level of
phosphorylated Akt protein expression that has been correlated with
sensitivity to the EGFR inhibitor, or if the level of
phosphorylated Akt protein expression in the patient's tumor cells
is statistically greater than the level of phosphorylated Akt
protein expression that has been correlated with resistance to the
EGFR inhibitor; or (d) selecting the patient as being predicted to
not benefit from therapeutic administration of the EGFR inhibitor,
if the level of phosphorylated Akt protein expression in the
patient's tumor cells is statistically less than the control level
of phosphorylated Akt protein expression that has been correlated
with sensitivity to the EGFR inhibitor, or if the level of
phosphorylated Akt protein expression in the patient's tumor cells
is statistically similar to or less than the level of
phosphorylated Akt protein expression that has been correlated with
resistance to the EGFR inhibitor. In a preferred embodiment, the
level of phosphorylated Akt protein expression is detected using
immunohistochemistry (IHC). In one aspect, the method includes the
step of detecting comprises detecting EGFR polysomy and expression
of phosphorylated AKT protein.
[0014] Any of the above-described embodiments of the invention can
further include a step of detecting mutations in the EGFR gene,
wherein detection of one or more mutations in the EGFR gene is
further predictive that the patient will benefit from treatment
with the EGFR inhibitor. For example, mutations in any one or more
of exons 18, 19 and 21 of the EGFR gene or in the tyrosine kinase
domain of the EGFR gene can be detected.
[0015] Another embodiment of the present invention relates to a
method to select a cancer patient who is predicted to benefit or
not benefit from therapeutic administration of an EGFR inhibitor.
The method comprises the steps of: (a) detecting in a sample of
tumor cells from a patient a level of expression of epidermal
growth factor receptor (EGFR) protein; (b) comparing the level of
EGFR protein expression in the tumor cell sample to a control level
of EGFR protein expression selected from the group consisting of:
(i) a control level that has been correlated with sensitivity to
the EGFR inhibitor; and (ii) a control level that has been
correlated with resistance to the EGFR inhibitor; and (c) selecting
the patient as being predicted to benefit from therapeutic
administration of the EGFR inhibitor, if the level of EGFR protein
expression in the patient's tumor cells is statistically similar to
or greater than the control level of EGFR protein expression that
has been correlated with sensitivity to the EGFR inhibitor, or if
the level of EGFR protein expression in the patient's tumor cells
is statistically greater than the level of EGFR protein expression
that has been correlated with resistance to the EGFR inhibitor; or
(d) selecting the patient as being predicted to not benefit from
therapeutic administration of the EGFR inhibitor, if the level of
EGFR protein expression in the patient's tumor cells is
statistically less than the control level of EGFR protein
expression that has been correlated with sensitivity to the EGFR
inhibitor, or if the level of EGFR protein expression in the
patient's tumor cells is statistically similar to or less than the
level of EGFR protein expression that has been correlated with
resistance to the EGFR inhibitor. In a preferred embodiment, the
level of EGFR protein expression is detected using
immunohistochemistry (IHC).
[0016] In one aspect of this embodiment, the method further
includes a step of detecting mutations in the EGFR gene, wherein
detection of one or more mutations in the EGFR gene is further
predictive that the patient will respond to treatment with the EGFR
inhibitor. For example, mutations in any one or more of exons 18,
19 and 21 of the EGFR gene or mutations in the tyrosine kinase
domain of the EGFR gene can be detected.
[0017] In another aspect of this embodiment, the method includes
further steps of: (a) detecting a level of expression of
phosphorylated Akt protein in the tumor cell sample; (b) comparing
the level of phosphorylated Akt protein expression in the tumor
cell sample to a control level of phosphorylated Akt protein
expression selected from the group consisting of: (i) a control
level that has been correlated with sensitivity to the EGFR
inhibitor; and (ii) a control level that has been correlated with
resistance to the EGFR inhibitor; and (c) selecting the patient as
being predicted to benefit from therapeutic administration of the
EGFR inhibitor, if the level of phosphorylated Akt protein
expression in the patient's tumor cells is statistically similar to
or greater than the control level of phosphorylated Akt protein
expression that has been correlated with sensitivity to the EGFR
inhibitor, or if the level of phosphorylated Akt protein expression
in the patient's tumor cells is statistically greater than the
level of phosphorylated Akt protein expression that has been
correlated with resistance to the EGFR inhibitor; or (d) selecting
the patient as being predicted to not benefit from therapeutic
administration of the EGFR inhibitor, if the level of
phosphorylated Akt protein expression in the patient's tumor cells
is statistically less than the control level of phosphorylated Akt
protein expression that has been correlated with sensitivity to the
EGFR inhibitor, or if the level of phosphorylated Akt protein
expression in the patient's tumor cells is statistically similar to
or less than the level of phosphorylated Akt protein expression
that has been correlated with resistance to the EGFR inhibitor.
[0018] The method in any of the embodiments of the invention
described above can be used with a patient having any type of
cancer. In one preferred embodiment, the patient has lung cancer,
including, but not limited to, non-small cell lung carcinoma
(NSCLC), bronchioloalveolar carcinoma (BAC), or adenocarcinomas
with BAC features.
[0019] In any of the embodiments of the invention described above,
responsiveness to any EGFR inhibitor can be evaluated, including,
but not limited to, gefitinib, erlotinib, and cetuximab.
[0020] Yet another embodiment of the invention relates to an assay
kit for selecting a cancer patient who is predicted to benefit or
not to benefit from therapeutic administration of an EGFR
inhibitor. The assay kit includes: (a) a means for detecting in a
sample of tumor cells a level of a biomarker or a combination of
biomarkers selected from: (i) a level of amplification of the
epidermal growth factor receptor (EGFR) gene; (ii) a level of
polysomy of the EGFR gene; (iii) a level of amplification of the
human tyrosine kinase receptor-type receptor (HER2) gene; (iv) a
level of polysomy of the HER2 gene; (v) a level of EGFR protein
expression; and/or (vi) a level of phosphorylated Akt protein
expression. The kit also includes: (b) a control selected from: (i)
a control sample for detecting sensitivity to the EGFR inhibitor;
(ii) a control sample for detecting resistance to the EGFR
inhibitor; (iii) information containing a predetermined control
level of the biomarker that has been correlated with sensitivity to
the EGFR inhibitor; and/or (iv) information containing a
predetermined control level of the biomarker that has been
correlated with resistance to the EGFR inhibitor. In one aspect,
the kit can further include at least one means for detecting at
least one mutation in the EGFR gene.
[0021] In one aspect of this embodiment, the means for detecting in
any of (a)(i)-(a)(iv) comprises a nucleotide probe that hybridizes
to a portion of the gene, including but not limited to: a
nucleotide probe that hybridizes to a portion of human chromosome 7
or human chromosome 17; a nucleotide probe that hybridizes to a
portion of an EGFR gene and to a portion of the chromosome 7 other
than the EGFR gene; and a nucleotide probe that hybridizes to a
portion of an HER2 gene and to a portion of the chromosome 17 other
than the HER2 gene. In a preferred embodiment, the means for
detecting is for use in fluorescent in situ hybridization (FISH).
In another aspect of this embodiment, the means for detecting in
(a)(v) or (a)(vi) comprises an antibody or antigen binding fragment
thereof that selectively binds to the protein. Preferably, any of
the above-described means for detecting comprises a detectable
label and/or is immobilized on a substrate.
BRIEF DESCRIPTION OF THE FIGURES OF THE INVENTION
[0022] FIGS. 1A and 1B show Kaplan Meyers curves for time to
disease progression (A) and survival (B) in the six FISH
categories: Disomy, Low Trisomy, High Trisomy, Low Polysomy, High
Polysomy and Gene Amplification in Example 1.
[0023] FIGS. 2A and 2B show Kaplan Meyers curves for time to
disease progression (A) and survival (B) in FISH Groups 1 and 2 in
Example 1.
[0024] FIGS. 3A and 3B show Kaplan-Meier curves for time to disease
progression (FIG. 3A) and survival (FIG. 3B), analyzed according to
gene copy numbers.
[0025] FIGS. 3C and 3D show Kaplan-Meier curves for time to disease
progression (FIG. 3C) and survival (FIG. 3D), analyzed according to
level of protein expression.
[0026] FIGS. 3E and 3F show Kaplan-Meier curves for time to disease
progression (FIG. 3E) and survival (FIG. 3F), analyzed according to
presence of mutations.
[0027] FIG. 4A shows survival curves for the whole S 0126 cohort
(N=136 patients) compared to the EGFR FISH sub cohort (N=81
patients).
[0028] FIG. 4B shows progression free survival for the EGFR FISH
positive and FISH negative groups.
[0029] FIG. 4C shows the overall survival curves for the EGFR FISH
positive and FISH negative groups.
DETAILED DESCRIPTION OF THE INVENTION
[0030] Based on promising results from clinical Phase II studies,
gefitinib was approved by the US Food and Drug Administration for
treatment of advanced chemorefractory NSCLC in 2003, and erlotinib
in 2004 after it demonstrated a significant survival benefit
compared to placebo in pretreated NSCLC patients (Shepherd et al.,
2004). The clinical efficacy of these EGFR tyrosine kinase
inhibitors (EGFR-TKIs) is significant but unfortunately is limited
to a subgroup of the patients. In the Canadian BR-21 study
(erlotinib versus placebo), about 30% of the patients died within 3
months after the treatment start, which indicated that no clinical
benefit was achieved in this subgroup of patients. Clinically,
patients who benefit are more likely to have female gender,
adenocarcinoma histology and a never-smoking history (Fukuoka et
al., 2003; Kris et al., 2003, JAMA; Miller et al., 2004, J. Clin.
Oncol.). However, clinical features alone are not sufficient for
patient selection because patients lacking individual features may
still benefit. These observations have left a need to provide
biologic features that could predict for patient benefit in NSCLC
and other cancers associated with EGFR expression. The present
invention provides powerful biomarkers and protocols that address
this problem.
[0031] The present invention is generally related to the
identification of cancer patients that are predicted to benefit
from the therapeutic administration of an epidermal growth factor
receptor (EGFR) inhibitor. The present invention is also generally
related to methods to identify treatments that can improve the
responsiveness of EGFR inhibitor-resistant cancer cells to the
treatment, and to the development of adjuvant treatments that
enhance the EGFR inhibitor response.
[0032] Accordingly, one embodiment of the present invention relates
to a method and corresponding assay kit for use to select a cancer
patient who is predicted to benefit from therapeutic administration
of an epidermal growth factor receptor (EGFR) inhibitor, an agonist
thereof, or a drug having substantially similar biological activity
as the reference EGFR inhibitor. The method generally includes
detecting in a sample of tumor cells from a patient the biomarkers
related to EGFR and combinations thereof that have been discovered
by the inventors to be invaluable in the detection of EGFR
inhibitor-sensitive or resistant tumor cells, thus predicting the
patients' clinical benefit to treatment using the EGFR inhibitor.
Based on the inventors' discovery, a variety of tests and
combinations of biomarker detection strategies are proposed, and
will be discussed in detail below. Initially, however, the present
invention includes the use of the following strategies for
detection of biomarkers, alone or in various combinations: (1)
detection of the level of amplification of the epidermal growth
factor receptor (EGFR) gene (i.e., the gene encoding EGFR); (2)
detection of a level of polysomy of the epidermal growth factor
receptor (EGFR) gene; (3) detection of a level of gene
amplification of the HER2 gene; (4) detection of the level of
polysomy of the HER2 gene; (5) detection of mutations in the EGFR
gene; (6) detection of EGFR protein expression; and (7) detection
of phosphorylated Akt expression. The invention includes the use of
these detection protocols individually or in various combinations,
and the invention further includes the use of various combinations
of one or more biomarker detection techniques to further enhance
the ability of the present method to identify EGFR
inhibitor-sensitive and -resistant tumors, as well as to predict
patients' clinical benefit (e.g, response and outcome) to EGFR
inhibitors.
[0033] The inventors have also discovered that combinations of the
tests described herein can be used to select patients with cancer,
including NSCLC, who will not have clinical benefit from EGFR
inhibitors (e.g. patients with tumors that are negative for two or
more tests).
[0034] The present inventors have discovered that patients with
tumor cells displaying EGFR gene amplification and/or high polysomy
with respect to the EGFR gene (also generally referred to herein as
an increase in EGFR gene copy number or a gain in EGFR copy
number), and/or HER2 gene amplification and/or high polysomy (also
generally referred to herein as an increase in HER2 gene copy
number or a gain in HER2 copy number) with respect to the HER2
gene, are predicted to be especially responsive to treatment with
EGFR inhibitors, and are therefore the best candidates for the use
of this line of therapy. In contrast, patients having tumors with
little or no gain in copy number of the EGFR and/or HER2 genes are
predicted to have a poor outcome to treatment with EGFR
inhibitors.
[0035] Interestingly, the present inventors have also discovered
that for patients that are EGFR negative (i.e., not predicted to
respond to EGFR inhibitors based on EGFR results alone), if such
patients' tumors have HER2 gene amplification and/or polysomy
(e.g., high trisomy or low or high polysomy) of the HER2 gene, the
patient outcome is better as compared to patients without HER2 gene
amplification. Furthermore, for patients that are predicted to
respond to EGFR inhibitors based on EGFR results alone, HER2 gene
amplification and/or high polysomy in these patients' tumors is
predictive of even greater sensitivity to the EGFR inhibitor
treatment than in the absence of the HER2 gene amplification.
[0036] The inventors have also found that EGFR protein expression
can be used to predict patient outcome with EGFR inhibitor
treatment, in contrast to prior studies that detected no
correlation between EGFR protein expression and response to
therapy. Specifically, the present inventors have used assessment
criteria that accounts for both expression intensity and the
fraction of expression-positive cells in a sample, and have now
demonstrated that patients having tumor cells in the upper 50% of
the scoring protocol (i.e., denoted positive/high EGFR expressors)
had much better outcomes (e.g., better response times, slower
progression rates and longer survival times) when treated with EGFR
inhibitors than those in the lower expressing groups. Furthermore,
the inventors have demonstrated that the combination of detection
of EGFR protein expression with HER2 or EGFR gene amplification or
polysomy is significantly more predictive of patient outcome to
EGFR inhibitor treatment than the detection of one or no
markers.
[0037] The inventors have also found that a group of cancer
patients with low/no gain of EGFR gene (e.g., "FISH-negative") and
low/no expression of EGFR protein (e.g., "IHC-negative"), which
constitute about 30% of the total NSCLC population, seem not to
have any clinical benefit (no/very low response rate, short time to
progression and short survival time) from EGFR inhibitors.
[0038] The inventors have also shown that two other biomarkers,
namely mutated EGFR genes or phosphorylated Akt expression, can be
combined with any of these biomarkers and protocols discussed above
to improve the ability to detect patients predicted to respond to
EGFR inhibitor treatment. For example, the inventors demonstrate
herein that the combination of detection of mutations in the EGFR
gene with EGFR protein expression, EGFR gene amplification and/or
polysomy, and/or HER2 gene amplification and/or polysomy, can be
used to select patients who will have clinical benefit from EGFR
inhibitor therapy. The inventors have also demonstrated herein that
the combination of the detection of phosphorylated Akt (i.e.,
activated Akt) with detection of EGFR protein expression and/or
detection of EGFR gene amplification and/or polysomy can be used to
select patients who will have clinical benefit from EGFR inhibitor
therapy.
[0039] The present inventors also demonstrate herein the power of
using particular detection techniques, fluorescence in situ
hybridization (FISH) and immunohistochemistry (IHC) in the present
methods, although the methods of the invention are not limited to
the use of these techniques.
[0040] Finally, although many of the examples provided herein are
directed to the EGFR inhibitor, gefitinib, the methods of the
present invention are not limited to the prediction of patients
that will respond or not respond to this particular EGFR inhibitor,
but rather, can be used to predict patient's outcome to any EGFR
inhibitor, including inhibitors that are small molecules (drugs),
peptides, antibodies, nucleic acids, or other types of inhibitors.
For example, the present inventors have also demonstrated the use
of the present methods to predict tumor resistance or
susceptibility to the EGFR inhibitor, Cetuximab (Erbitux.RTM.),
which is a monoclonal antibody that binds to EGFR and prevents the
binding of the natural ligand to the receptor.
[0041] More specifically, the present inventors have demonstrated
that EGFR gene copy number (determined by polysomy and/or gene
amplification) detected by FISH and EGFR protein expression by IHC
significantly correlated with gefitinib activity, and those
patients carrying EGFR gene amplification and/or polysomy
(particularly high polysomy) and/or high EGFR protein expression
had a significant improvement in response, time to progression and
survival. The inventors have also demonstrated that HER2 gene
amplification and/or polysomy (particularly high polysomy) provides
similar effects. The strongest benefit was observed in patients
with gene amplification, with the combination of EGFR gene
amplification and HER2 gene amplification being particularly
strong. Multivariate analysis confirmed that EGFR gene
amplification and polysomy (particularly high polysomy) and EGFR
protein expression significantly reduced the risk of death in
patients receiving gefitinib. Among clinical characteristics
(gender, smoking history, performance status and histology), only
histology and PS resulted significantly related to the risk of
death when the model was adjusted for EGFR status. Risk of death
was significantly lower for patients with adenocarcinoma or
bronchioloalveolar carcinoma and significantly higher for those
with performance status 2.
[0042] Prior to the present invention, the prognostic role of EGFR
protein expression or gene status in NSCLC has been unclear at
best, as there have been varying reports in the literature. The
inventors have studied the prognostic role of EGFR protein
expression and gene copy number and found that EGFR protein
expression correlated with increased gene copy number, and that
high gene copy number per cell showed a trend towards poor
prognosis (Hirsch et al., 2003 JCO). Likewise, the inventors
studied HER2 gene copy number and protein expression in 238
patients with NSCLC and found that high HER2 protein expression
showed a tendency toward a shorter survival (Hirsch et al, BJC,
2002). However, the levels of EGFR protein expression evaluated by
immunohistochemical assays have not previously been demonstrated to
correlate with response to therapy in preclinical (Sirotnak et al.,
Clin Cancer Res 2000; 6:4885-92) and clinical studies (Kris et al.,
2003, JAMA; Giaccone et al., 2004). Gefitinib exerts its action at
the protein level, therefore it was not at all expected that the
number of copies of the EGFR gene per cell could be a predictor for
clinical response, given the lack of correlation with the
immunohistochemical studies.
[0043] In the study illustrated in Example 1, a better outcome was
observed in the cohort with amplification or high polysomy for the
EGFR gene, therefore confirming the positive impact of the drug in
this group of patients. Moreover, the 1-year survival of patients
in FISH positive patients (Group 2 in Example 1 below) was
remarkably higher in the present inventors' study than reported on
the previous phase II trials with gefitinib.
[0044] A major drawback for the gefitinib clinical studies has been
the lack of correlation between level of EGFR protein expression
and response to treatment. Other studies focusing on HER2 and
response to trastuzumab in breast cancer confirmed that genomic
analyses correlate better with response than protein expression
scored as 2+ in the HerceptTest (Vogel et al., 2002; Bartlett et
al., 2003). The identification of specific EGFR gene mutations in
gefitinib sensitive patients confirmed the validity of analyses at
genomic level (Lynch et al., 2004; Paez et al., 2004). However,
these studies involved technology for analysis completely different
from what is proposed in the present invention.
[0045] In the studies presented herein, EGFR and HER2 gene copy
numbers were studied by FISH because this method presents several
advantages, although the practice of the present invention is not
limited to this technique. FISH is DNA-based and can be
successfully performed in fresh or preserved paraffin-embedded
tumor samples. The technology is well established, has short
turn-around in clinical cytogenetics and molecular pathology
laboratories, and an EGFR FISH probe is already commercially
available. Moreover, for patients with advanced disease, and
especially for those progressing after standard therapies, disease
stabilization and symptomatic improvement are important end-points,
and gefitinib reaches this goal in about 40% of cases (Fukuoka et
al., 2003; Kris et al., 2003, JAMA). The results demonstrated that
patients with EGFR gene amplification and high polysomy had
significant advantages not only on response, but also on disease
control rate. These findings, combined with the simplicity of the
assay and the reproducibility of the result, support the routine
use of EGFR-FISH analysis and related techniques for selecting
NSCLC patients to gefitinib therapy.
[0046] The clinical characteristics of the population evaluated in
the study described in Examples 1 and 3 reflect what is generally
observed in Italy in the clinical practice, and the outcome of this
cohort is in the same range of the IDEAL 1 and 2 trials (Fukuoka et
al., 2003; Kris et al., 2003, JAMA). The EGFR gene status has only
been scarcely studied in lung cancer. In the current study, 12.7%
of tumors had gene amplification and 19.7% had high level of
polysomy. Gene amplification has been reported in 6.2% of 286
specimens using Southern Blot analysis (Reissmann et al., 1999),
while polysomy and amplification have been respectively observed in
13% and 9% of 183 NSCLC investigated in a tumor microarray (Hirsch
et al., 2003 JCO). Other population studies will verify if this
variability represents the actual heterogeneity in the NSCLC
patients.
[0047] Levels of protein expression of EGFR were also assessed by
immunohistochemistry and high levels were statistically
significantly associated with better response, disease control
rate, time to progression and survival as described below in the
Examples. In the studies presented herein, gefitinib sensitivity
was associated with high EGFR protein expression; outcomes in
patients with low EGFR expression scores (<200) were as poor as
those in patients with low gene copy numbers or lacking mutations.
The reasons for the difference in results from this invention
compared to previous reports might be multiple. For example, the
present inventors have used a different scoring system than prior
investigators, taking both the fraction of EGFR expressing cells
(0-100%) and the expression intensity (1-4) into account, which may
have improved the inventors' ability to detect and analyze
differences in expression. However, the application of this
invention is not restricted to this scoring criteria, and other
assessment methods may be useful in the practice of the invention.
Immunohistochemical analysis for EGFR protein expression is an easy
clinically applicable assay and the antibody used in this invention
is based on commercially available antibody (Zymed; see Examples).
However, the application of this invention is not restricted to a
specific antibody.
[0048] Another important finding of the studies described herein
was the virtual absence of EGFR mutations in patients with stable
disease. Among the 21 patients with stable disease who were
assessed for EGFR mutations, only one patient had an EGFR mutation.
The small number of mutations in patients with stable disease is of
clinical relevance because data from one clinical trial showed that
the survival benefit of gefitinib is not confined to responding
patients (Shepherd et al., 2004). It is possible that survival
improvement in the gefitinib-treated patients, as a whole, is due
to the presence of a group of patients with an intermediate benefit
from the treatment, such as those with stable disease, who would be
excluded from tyrosine kinase inhibitor treatment if mutation
analysis were established as the test of choice for patient
selection. Moreover, although previous studies suggested that EGFR
mutations are present in the vast majority of responding patients
(Lynch et al., 2004; Paez et al., 2004; Pao et al., 2004), in this
study, the inventors observed that 40% of patients with EGFR
mutations had progressive disease.
[0049] In the studies presented herein, the inventors also found an
association between activated Akt pathway (e.g. expression of
phosphorylated Akt) and gefitinib sensitivity, an association that
has also been described and discussed by others (Sordella et al.,
2004; Cappuzzo et al., 2004, J. Natl Cancer Inst.). The
combinatorial analysis of EGFR and P-Akt status indicated that,
independent of the method of EGFR assessment, when EGFR status was
positive, the presence of Akt phosphorylation was significantly
related to better response, disease control rate, time to
progression, and survival. Importantly, better outcome was observed
not only when the subset of EGFR+/P-Akt+ patients was compared with
all the other groups combined but also when this subset was
compared with patients EGFR positive but P-Akt negative. These
findings support the hypothesis that, when the gefitinib target is
present but the anti-apoptotic pathway is not activated, the
patient is not sensitive to the inhibitory effects of gefitinib. As
expected, the EGFR+/P-Akt+ group also had a significantly better
outcome compared with the EGFR negative and P-Akt positive group,
confirming preclinical data indicating that aberrant,
EGFR-independent Akt activation may lead to gefitinib resistance
(Bianco et al., 2003; Janmaat et al., 2003). These data indicate
that P-Akt positive status is relevant in EGFR-positive patients
for the identification of a subgroup of patients particularly
sensitive to the drug. In EGFR-negative patients, P-Akt positive
status may identify a group of patients with a very low chance of
benefiting from gefitinib treatment.
[0050] Information regarding the relationship between EGFR protein
expression and Akt pathway activation would greatly advance the
understanding of the mechanisms of gefitinib sensitivity. The
inventors compared EGFR protein and P-Akt expression in a subgroup
of patients and, in general, the inventors found expression of EGFR
and P-Akt proteins in the same cell populations (data not shown),
suggesting that the observed P-Akt was a result of EGFR
activity.
[0051] The methods and test kits provided by the present invention
are extremely useful for patients with any cancer that can be
treated with EGFR inhibitors, such as NSCLC. Such patients might,
as a result of the methods provided herein, be spared from side
effects and financial costs of an ineffective therapy in the event
that they do not have genomic gain affecting the EGFR locus and
they have low or no EGFR protein expression. Second, it is useful
for physicians, who can recommend, or not, this specific treatment
(i.e., EGFR inhibitor therapy) to particular patients based on
information on the molecular characteristics of their tumors.
Third, it will increase the demand for the FISH assay with
available and yet-to-be developed EGFR probes.
[0052] More specific embodiments of the invention are described as
follows. In one embodiment, the method includes the detection in a
sample of tumor cells from a patient a level of amplification
(described in detail below) of the epidermal growth factor receptor
(EGFR) gene (i.e., the gene encoding EGFR). Patients with tumor
cells displaying EGFR gene amplification are predicted to be
responsive to treatment with EGFR inhibitors, and are therefore the
best candidates for the use of this line of therapy. In contrast,
patients having tumors with little or no EGFR gene amplification
gain are predicted to be poor or non-responders to treatment with
EGFR inhibitors and therefore, different therapeutic treatments can
be used with such patients. In another, related embodiment, the
method includes the detection in a sample of tumor cells from a
patient a level of polysomy (described in detail below) of the
epidermal growth factor receptor (EGFR) gene. In this embodiment,
patients with tumor cells displaying higher polysomy with respect
to the EGFR gene are predicted to be responsive to treatment with
EGFR inhibitors, and are therefore the best candidates for the use
of this line of therapy. In contrast, patients having tumors with
low copy numbers with respect to the EGFR gene are predicted to be
poor or non-responders to treatment with EGFR inhibitors. In one
embodiment, this method of detecting polysomy can be combined with
the detection of EGFR gene amplification in the tumor cells.
Collectively, gene amplification and polysomy can be referred to as
a gain in EGFR gene copy number or increased EGFR gene copy number.
In addition, the present inventors demonstrate herein that
increased EGFR gene copy number detected by FISH is associated with
improved survival after gefitinib therapy in patients with advanced
stage bronchioalveolar carcinoma (BAC) and adenocarcinoma with BAC
features, a subset of NSCLC that can serve as a model for study of
EGFR pathways due to its underlying biologic characteristics.
[0053] In another embodiment of the invention, the method includes
the detection in a sample of tumor cells from a patient a level of
gene amplification of the HER2 gene (i.e., the gene encoding HER2).
Patients with tumor cells displaying HER2 gene amplification are
predicted to be responsive to treatment with EGFR inhibitors, and
are therefore the best candidates for the use of this line of
therapy. In contrast, patients having tumors with low or no HER2
gene amplification are predicted to be poor or non-responders to
treatment with EGFR inhibitors and therefore, different therapeutic
treatments can be used with such patients. In another embodiment,
the method includes the detection in a sample of tumor cells from a
patient a level of polysomy of the HER2 gene. In this embodiment,
patients with tumor cells displaying higher polysomy with respect
to the HER2 gene are predicted to be responsive to treatment with
EGFR inhibitors, and are therefore the best candidates for the use
of this line of therapy. In contrast, patients having tumors with
low copy numbers with respect to the HER2 gene are predicted to be
poor or non-responders to treatment with EGFR inhibitors. In one
embodiment, this method of detecting polysomy can be combined with
the detection of HER2 gene amplification in the tumor cells.
Collectively, gene amplification and polysomy can be referred to as
a gain in HER2 gene copy number or increased HER2 gene copy number.
These methods can also be combined with the detection of EGFR gene
amplification and/or EGFR polysomy. Patients having tumors
displaying both an increase in EGFR gene copy numbers and an
increase in HER2 gene copy numbers are predicted to be even better
candidates for responsiveness to treatment with EGFR inhibitors
than patients with tumors displaying increases in EGFR gene copy
numbers alone. Moreover, patients having tumors displaying low or
no gain in EGFR gene copy numbers but having increases in HER2 gene
copy numbers are predicted to be better responders to treatment
with EGFR inhibitors than patients having tumors with low or no
gain in HER2 gene copy numbers.
[0054] In another embodiment of the invention, the method includes
the detection in a sample of tumor cells from a patient a level of
EGFR protein expression (e.g., by using immunohistochemical
techniques). Patients with tumor cells displaying higher levels of
EGFR protein are predicted to be responsive to treatment with EGFR
inhibitors, and are therefore the best candidates for the use of
this line of therapy. In particular, patients with tumor cells
having both a higher fraction of cells expressing EGFR and a higher
intensity of expression of EGFR by the cells are predicted to be
responsive to treatment with EGFR inhibitors. In one embodiment
using a scoring system of 0-400 based on fraction and intensity
scores (described in detail below), patients with tumor cells
receiving EGFR protein expression scores of greater than 200 are
predicted to have a good outcome of treatment with EGFR inhibitors.
In further embodiments, this method can be combined with the
detection of HER2 gene amplification and/or polysomy; detection of
EGFR gene amplification and/or polysomy; detection of mutations in
EGFR (described below) and/or detection of phosphorylated Akt
protein levels (described below). Patients having tumors with high
EGFR protein expression in combination with: HER2 gene
amplification and/or HER2 polysomy, with EGFR gene amplification
and/or EGFR polysomy, mutations in the EGFR gene, and/or
phosphorylated Akt expression, are predicted to be responsive to
treatment with EGFR inhibitors.
[0055] In one embodiment of the invention, the method includes
detection mutations in the EGFR gene in a sample of tumor cells
from a patient. Patients with tumor cells displaying mutations in
the EGFR gene are predicted to be responsive to treatment with EGFR
inhibitors, and are therefore the best candidates for the use of
this line of therapy. Activating mutations cause ligand-independent
activity of receptor tyrosine kinases, and recent reports show that
specific missense and deletion mutations in the tyrosine kinase
domain of the EGFR gene (Lynch et al., 2004; Paez et al., 2004; Pao
et al., 2004) are associated with EGFR tyrosine kinase inhibitor
sensitivity, and also with female gender, adenocarcinoma histology,
and never smoking status, all clinical characteristics that are
known to be related to tyrosine kinase inhibitor sensitivity
(Fukuoka et al., 2003; Kris et al., 2003, JAMA; Perez-Soler et al.,
2001; Miller et al., 2003, Proc. Am Soc Clin Oncol.; Miller et al.,
2004, J. Clin. Oncol.). Although these EGFR mutations can account
for the vast majority of objective responses obtained with tyrosine
kinase inhibitors, the clinical benefit observed with these drugs
and the survival benefit identified in the a prior clinical trial
cannot be explained only by the presence of mutations.
[0056] While any EGFR mutations may be detected, multiple mutations
are already known to occur in humans, particularly on exons 18, 19
and 21. As discussed above, this method can be combined with the
detection of EGFR protein expression; detection of EGFR gene
amplification and/or polysomy; detection of HER2 gene amplification
and/or polysomy; and/or detection of phosphorylated Akt protein
levels (described below). Patients having tumors with one or more
mutations in the EGFR gene in combination with: high EGFR protein
expression, HER2 gene amplification and/or HER2 polysomy, EGFR gene
amplification and/or EGFR polysomy, and/or phosphorylated Akt
expression, are predicted to be responsive to treatment with EGFR
inhibitors.
[0057] In another embodiment of the invention, the method includes
detection in a sample of tumor cells from a patient phosphorylated
Akt protein levels. The activation status of the Akt protein has
been highlighted as an important player in EGFR tyrosine kinase
inhibitor sensitivity in preclinical and clinical studies (Sordella
et al., 2004; Cappuzzo et al., 2004, J. Natl. Cancer Inst.). Akt is
a serine/threonine kinase that acts downstream of EGFR to regulate
many cellular processes, including cell survival, proliferation,
and growth, and it is activated by phosphorylation at amino acids
Thr308 and Ser473 (Datta et al., 1999). Sordella et al., supra,
showed that gefitinib-sensitizing EGFR mutations activate
anti-apoptotic pathways involving Akt in lung cancer cell lines,
and Cappuzzo et al., supra, have shown that the activation status
of Akt is associated with gefitinib sensitivity of NSCLC patients,
in terms of response and time to progression, but not in terms of
survival. The lack of association with survival could be explained
by the presence of a subset of phosphorylated (P)-Akt-positive
patients who are resistant to gefitinib therapy as a consequence of
Akt activation by a non-EGFR dependent mechanism.
[0058] Patients with tumor cells expressing phosphorylated Akt
protein are predicted to be responsive to treatment with EGFR
inhibitors, and are therefore the best candidates for the use of
this line of therapy. As discussed above, this method is intended
to be combined with any one or more of: the detection of EGFR
protein expression; detection of EGFR gene amplification and/or
polysomy; detection of HER2 gene amplification and/or polysomy;
and/or detection of mutations in the EGFR gene, in order to enhance
the ability to identify patients having tumors that are predicted
to respond to EGFR inhibitor therapy. Patients having tumors that
express phosphorylated Akt in combination with: one or more
mutations in the EGFR gene, high EGFR protein expression, HER2 gene
amplification and/or HER2 polysomy, and/or EGFR gene amplification
and/or EGFR polysomy, are predicted to be responsive to treatment
with EGFR inhibitors.
[0059] In one embodiment of the invention, the method includes the
detection of EGFR and HER2 gene amplification and/or polysomy using
fluorescent in situ hybridization (FISH).
[0060] In one embodiment of the invention, the method includes the
detection of EGFR protein or phosphorylated Akt protein using
immunohistochemistry (IHC) techniques.
[0061] It will be apparent to those of skill in the art from the
description of the invention herein that a variety of combinations
of the above-described biomarkers and detection protocols can
enhance or improve the ability to identify patients that are
predicted to be responsive to therapy with EGFR inhibitors (and
patients that are predicted to be poor responders). Therefore, any
combination of the use of the biomarkers, detection protocols and
detection techniques is encompassed by the invention. Moreover, the
invention is not limited to the detection techniques described
herein (e.g., FISH and IHC), since other techniques may be used to
achieve the same result. By way of example, the following
particular combinations have been demonstrated by the inventors to
be particularly useful in predicting responsiveness to EGFR
inhibitors: (1) combination of detection of EGFR gene amplification
and/or polysomy using FISH and detection of HER2 gene amplification
and/or polysomy using FISH; (2) combination of detection of EGFR
protein expression using IHC and detection of HER2 gene
amplification and/or polysomy using FISH; (3) combination of
detection of mutations in the EGFR gene and detection of HER2 gene
amplification and/or polysomy using FISH; (4) combination of
detection of EGFR gene amplification and/or polysomy using FISH and
detection of EGFR protein expression using IHC; (5) combination of
detection of EGFR protein expression using IHC and detection of
mutations in the EGFR gene; (6) combination of detection of EGFR
protein expression and detection of phosphorylated Akt protein
using IHC; (7) detection of EGFR gene amplification and/or polysomy
and detection of mutations in the EGFR gene; (8) detection of EGFR
gene amplification and/or polysomy, detection of EGFR protein
expression using IHC, and detection of mutations in the EGFR gene;
and (9) detection of EGFR gene amplification and/or polysomy,
detection of EGFR protein expression using IHC, and detection of
phosphorylated Akt protein expression using IHC.
[0062] The methods of the present invention can be used to
effectively predict the responsiveness of patient tumors and
clinical outcome to treatment with any EGFR inhibitor. Although
most of the data provided herein was generated in patients
receiving the well-known EGFR inhibitor, gefitinib (ZD 1839,
Iressa.RTM., AstraZeneca, UK), it is to be understood that the
evaluation of patient tumor responsiveness to any EGFR inhibitor of
any type is encompassed by the present invention.
[0063] According to the present invention, an EGFR inhibitor is any
agent that inhibits (blocks, reduces, antagonizes, decreases,
reverses) the expression and/or biological activity of an epidermal
growth factor receptor (EGFR), including any EGFR. Therefore, an
inhibitor can include, but is not limited to, a product of
drug/compound/peptide design or selection, an antibody or antigen
binding fragment thereof, a protein, a peptide, a nucleic acid
(including ribozymes, antisense, RNAi and aptamers), or any other
agent that inhibits the expression and/or biological activity of an
EGFR. For example, known inhibitors of EGFR include the drugs,
gefitinib (ZD 1839, Iressa.RTM., AstraZeneca, UK) and erlotinib
(OSI 774, Tarceva.RTM., Genentech, USA), and the monoclonal
antibody, Cetuximab (Erbitux.RTM., Imclone, Bristol-Myers Squibb).
However, the invention is not limited to these specific agents, and
can include an agonist (described below) of such agents or agents
having substantially similar biological activity as these agents.
The biological activity or biological action of a protein, such as
an EGFR, refers to any function(s) exhibited or performed by a
naturally occurring form of the protein as measured or observed in
vivo (i.e., in the natural physiological environment of the
protein) or in vitro (i.e., under laboratory conditions).
Biological activities of EGFR include, but are not limited to,
binding to EGF, receptor homo- or heterodimerization, tyrosine
kinase activity, and downstream activities related to cellular
homeostasis and development.
[0064] Various definitions and aspects of the invention will be
described below, but the invention is not limited to any specific
embodiments that may be used for illustrative or exemplary
purposes. To the extent that gefitinib is described herein, it is
an exemplary EGFR inhibitor and, as discussed above, the methods of
the invention are applicable to evaluation of patient tumor
sensitivity or resistance to any EGFR inhibitor.
[0065] The methods of the present invention include detecting in a
sample of tumor cells from a patient to be tested, any one or any
combination of 2, 3, 4, 5, 6 or all 7 of the following biomarkers
and types of detection of such biomarkers: (1) a level of
amplification of the epidermal growth factor receptor (EGFR) gene
(i.e., the gene encoding EGFR); (2) a level of polysomy of the
epidermal growth factor receptor (EGFR) gene; (3) a level of gene
amplification of the HER2 gene; (4) a level of polysomy of the HER2
gene; (5) mutations in the EGFR gene; (6) EGFR protein expression;
and/or (7) phosphorylated Akt expression. Detection of (1) and (2)
together and/or detection of (3) and (4) together can generally be
referred to as detecting a gain or an increase in gene copy number.
According to the present invention, a biomarker includes any gene
or protein or portion thereof that can be detected, measured or
otherwise evaluated and is used to identify, measure or predict a
particular effect, which in the present invention is patient tumor
responsiveness (or non-responsiveness) to an EGFR inhibitor.
Biomarkers useful in the present invention include EGFR gene, EGFR
protein, HER2 gene and phosphorylated Akt protein. The use of a
biomarker according to the invention can include the use of a
particular protocol or technique to detect or measure the biomarker
(types of detection, e.g., FISH or IHC) or the identification of a
particular characteristic associated with the biomarker, such as
gene amplification, gene polysomy, expression level of the gene or
protein, identification of a mutation, etc. Particularly preferred
combinations include combinations of the following biomarkers and
types of detection thereof as described above: (1) and (2); (3) and
(4); (1), (2), (3) and (4); (2) and (4); (1) and/or (2) and (6);
(1) and/or (2) and (7); and (6) and (7). The invention is not
limited to these combinations.
[0066] Suitable methods of obtaining a patient sample are known to
a person of skill in the art. A patient sample can include any
bodily fluid or tissue from a patient that may contain tumor cells
or proteins of tumor cells. More specifically, according to the
present invention, the term "test sample" or "patient sample" can
be used generally to refer to a sample of any type which contains
cells or products that have been secreted from cells to be
evaluated by the present method, including but not limited to, a
sample of isolated cells, a tissue sample and/or a bodily fluid
sample. Most typically in the present invention, the sample is a
tissue sample. According to the present invention, a sample of
isolated cells is a specimen of cells, typically in suspension or
separated from connective tissue which may have connected the cells
within a tissue in vivo, which have been collected from an organ,
tissue or fluid by any suitable method which results in the
collection of a suitable number of cells for evaluation by the
method of the present invention. The cells in the cell sample are
not necessarily of the same type, although purification methods can
be used to enrich for the type of cells that are preferably
evaluated. Cells can be obtained, for example, by scraping of a
tissue, processing of a tissue sample to release individual cells,
or isolation from a bodily fluid.
[0067] A tissue sample, although similar to a sample of isolated
cells, is defined herein as a section of an organ or tissue of the
body which typically includes several cell types and/or
cytoskeletal structure which holds the cells together. One of skill
in the art will appreciate that the term "tissue sample" may be
used, in some instances, interchangeably with a "cell sample",
although it is preferably used to designate a more complex
structure than a cell sample. A tissue sample can be obtained by a
biopsy, for example, including by cutting, slicing, or a punch.
[0068] A bodily fluid sample, like the tissue sample, contains the
cells to be evaluated, and is a fluid obtained by any method
suitable for the particular bodily fluid to be sampled. Bodily
fluids suitable for sampling include, but are not limited to,
blood, mucous, seminal fluid, saliva, sputum, bronchial lavage,
breast milk, bile and urine.
[0069] In general, the sample type (i.e., cell, tissue or bodily
fluid) is selected based on the accessibility and structure of the
organ or tissue to be evaluated for tumor cell growth and/or on
what type of cancer is to be evaluated. For example, if the
organ/tissue to be evaluated is the breast, the sample can be a
sample of epithelial cells from a biopsy (i.e., a cell sample) or a
breast tissue sample from a biopsy (a tissue sample). The present
invention is particularly useful for evaluating patients with lung
cancer and particularly, non-small cell lung carcinoma, and in this
case, a typical sample is a section of a lung tumor from the
patient.
[0070] The copy number of genes in tumor cells according to the
invention can be measured, for example in FISH assays, in nuclei,
and the protein expression can be measured, for example in
immunohistochemistry assays, in tumor cell nuclei, cytoplasm and/or
membranes. Both tests, e.g., FISH and immunohistochemistry, as well
as other detection methods, can be performed in primary tumors,
metastatic tumors, locally recurring tumors, sputum, bronchial
lavage, ascites, spinal fluid, or other tumoral settings. The
markers can be measured in tumor specimens that are fresh, frozen,
fixed or otherwise preserved.
[0071] Once a sample is obtained from the patient, the sample is
evaluated for detection of one or more of any of the biomarkers
described herein. In some embodiments of the present invention, a
tissue, a cell or a portion thereof (e.g., a section of tissue, a
component of a cell such as nucleic acids, etc.) is contacted with
one or more nucleic acids. Such protocols are used to detect gene
expression, gene amplification, and/or gene polysomy, for example.
Such methods can include cell-based assays or non-cell-based
assays. The tissue or cell expressing a target gene is typically
contacted with a detection agent (e.g., a probe, primer, or other
detectable marker), by any suitable method, such as by mixing,
hybridizing, or combining in a manner that allows detection of the
target gene by a suitable technique.
[0072] The patient sample is prepared by any suitable method for
the detection technique utilized. In one embodiment, the patient
sample can be used fresh, frozen, fixed or otherwise preserved. For
example, the patient tumor cells can be prepared by immobilizing
patient tissue in, for example, paraffin. The immobilized tissue
can be sectioned and then contacted with a probe for detection of
hybridization of the probe to a target gene (e.g., EGFR or
HER2).
[0073] In a preferred embodiment, detection of a gene according to
the present invention is accomplished using hybridization assays.
Nucleic acid hybridization simply involves contacting a probe
(e.g., an oligonucleotide or larger polynucleotide) and target
nucleic acid under conditions where the probe and its complementary
target can form stable hybrid duplexes through complementary base
pairing. As used herein, hybridization conditions refer to standard
hybridization conditions under which nucleic acid molecules are
used to identify similar nucleic acid molecules. Such standard
conditions are disclosed, for example, in Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Labs
Press, 1989. Sambrook et al., ibid., is incorporated by reference
herein in its entirety (see specifically, pages 9.31-9.62). In
addition, formulae to calculate the appropriate hybridization and
wash conditions to achieve hybridization permitting varying degrees
of mismatch of nucleotides are disclosed, for example, in Meinkoth
et al., 1984, Anal. Biochem. 138, 267-284; Meinkoth et al., ibid.,
is incorporated by reference herein in its entirety. Nucleic acids
that do not form hybrid duplexes are washed away from the
hybridized nucleic acids and the hybridized nucleic acids can then
be detected, typically through detection of an attached detectable
label. It is generally recognized that nucleic acids are denatured
by increasing the temperature or decreasing the salt concentration
of the buffer containing the nucleic acids. Under low stringency
conditions (e.g., low temperature and/or high salt) hybrid duplexes
(e.g., DNA:DNA, RNA:RNA, or RNA:DNA) will form even where the
annealed sequences are not perfectly complementary. Thus
specificity of hybridization is reduced at lower stringency.
Conversely, at higher stringency (e.g., higher temperature or lower
salt) successful hybridization requires fewer mismatches.
[0074] High stringency hybridization and washing conditions, as
referred to herein, refer to conditions which permit isolation of
nucleic acid molecules having at least about 90% nucleic acid
sequence identity with the nucleic acid molecule being used to
probe in the hybridization reaction (i.e., conditions permitting
about 10% or less mismatch of nucleotides). One of skill in the art
can use the formulae in Meinkoth et al., 1984, Anal. Biochem. 138,
267-284 (incorporated herein by reference in its entirety) to
calculate the appropriate hybridization and wash conditions to
achieve these particular levels of nucleotide mismatch. Such
conditions will vary, depending on whether DNA:RNA or DNA:DNA
hybrids are being formed. Calculated melting temperatures for
DNA:DNA hybrids are 10.degree. C. less than for DNA:RNA hybrids. In
particular embodiments, stringent hybridization conditions for
DNA:DNA hybrids include hybridization at an ionic strength of
6.times.SSC (0.9 M Na.sup.+) at a temperature of between about
20.degree. C. and about 35.degree. C., more preferably, between
about 28.degree. C. and about 40.degree. C., and even more
preferably, between about 35.degree. C. and about 45.degree. C. In
particular embodiments, stringent hybridization conditions for
DNA:RNA hybrids include hybridization at an ionic strength of
6.times.SSC (0.9 M Na.sup.+) at a temperature of between about
30.degree. C. and about 45.degree. C., more preferably, between
about 38.degree. C. and about 50.degree. C., and even more
preferably, between about 45.degree. C. and about 55.degree. C.
These values are based on calculations of a melting temperature for
molecules larger than about 100 nucleotides, 0% formamide and a G+C
content of about 40%. Alternatively, T.sub.m can be calculated
empirically as set forth in Sambrook et al., supra, pages 9.31 to
9.62.
[0075] The hybridized nucleic acids are detected by detecting one
or more labels attached to the sample nucleic acids. The labels may
be incorporated by any of a number of means well known to those of
skill in the art. Detectable labels suitable for use in the present
invention include any composition detectable by spectroscopic,
photochemical, biochemical, immunochemical, electrical, optical or
chemical means. Useful labels in the present invention include
fluorescent dyes (e.g., fluorescein, texas red, rhodamine, Alexa
fluors, Spectrum dyes, and the like), quantum dots, radiolabels
(e.g., .sup.3H, .sup.125I, .sup.35S, .sup.14C, or .sup.32P), and
colorimetric labels. Means of detecting such labels are well known
to those of skill in the art. Thus, for example, radiolabels may be
detected using photographic film or scintillation counters,
fluorescent markers may be detected using a photodetector to detect
emitted light and fluorescence microscopes. Colorimetric labels are
detected by simply visualizing the colored label. Preferably, the
hybridizing nucleic acids are detected by fluorescent labels and
most preferably, in the context of a fluorescence in situ
hybridization (FISH) assay. FISH assays are well known in the art
and are described, for example, in the Examples section.
[0076] In accordance with the present invention, an isolated
polynucleotide, or an isolated nucleic acid molecule, is a nucleic
acid molecule that has been removed from its natural milieu (i.e.,
that has been subject to human manipulation), its natural milieu
being the genome or chromosome in which the nucleic acid molecule
is found in nature. As such, "isolated" does not necessarily
reflect the extent to which the nucleic acid molecule has been
purified, but indicates that the molecule does not include an
entire genome or an entire chromosome in which the nucleic acid
molecule is found in nature. Polynucleotides such as those used in
a method of the present invention to detect genes (e.g., by
hybridization to a gene) are typically a portion of the target gene
that is suitable for use as a hybridization probe or PCR primer for
the identification of a full-length gene (or portion thereof) in a
given sample (e.g., a cell sample). An isolated nucleic acid
molecule can include a gene or a portion of a gene (e.g., the
regulatory region or promoter). An isolated nucleic acid molecule
that includes a gene is not a fragment of a chromosome that
includes such gene, but rather includes the coding region and
regulatory regions associated with the gene, but no additional
genes naturally found on the same chromosome. An isolated nucleic
acid molecule can also include a specified nucleic acid sequence
flanked by (i.e., at the 5' and/or the 3' end of the sequence)
additional nucleic acids that do not normally flank the specified
nucleic acid sequence in nature (i.e., heterologous sequences).
Isolated nucleic acid molecule can include DNA, RNA (e.g., mRNA),
or derivatives of either DNA or RNA (e.g., cDNA). Although the
phrase "nucleic acid molecule" primarily refers to the physical
nucleic acid molecule and the phrase "nucleic acid sequence"
primarily refers to the sequence of nucleotides on the nucleic acid
molecule, the two phrases can be used interchangeably, especially
with respect to a nucleic acid molecule, or a nucleic acid
sequence, being capable of encoding a protein. Preferably, an
isolated nucleic acid molecule of the present invention is produced
using recombinant DNA technology (e.g., polymerase chain reaction
(PCR) amplification, cloning) or chemical synthesis.
[0077] According to the present invention, a probe (oligonucleotide
probe) is a nucleic acid molecule which typically ranges in size
from about 50-100 nucleotides to several hundred nucleotides to
several thousand nucleotides in length. Therefore, a probe can be
any suitable length for use in an assay described herein, including
any length in the range of 50 to several thousand nucleotides, in
whole number increments. Such a molecule is typically used to
identify a target nucleic acid sequence in a sample by hybridizing
to such target nucleic acid sequence under stringent hybridization
conditions. Hybridization conditions have been described in detail
above.
[0078] PCR primers are also nucleic acid sequences, although PCR
primers are typically oligonucleotides of fairly short length
(e.g., 8-30 nucleotides) that are used in polymerase chain
reactions. PCR primers and hybridization probes can readily be
developed and produced by those of skill in the art, using sequence
information from the target sequence. (See, for example, Sambrook
et al., supra or Glick et al., supra).
[0079] The nucleotide sequence of the human epidermal growth factor
receptor (EGFR) gene is known in the art and can be found under
GenBank Accession No. AY588246 (incorporated herein by reference),
for example. The nucleotide sequence of the human tyrosine kinase
receptor-type receptor (HER2) gene is also known in the art and can
be found, for example, under GenBank Accession Nos. M16789, M16790,
M16791, M16792 and M11730 (all incorporated herein by reference).
Nucleotide probes are also known in the art and available for use
as probes to detect EGFR genes or HER2 genes. For example, such a
probe for detecting both EGFR and chromosome 7 centromere sequences
is available (e.g., LSI EGFR SpectrumOrange/CEP 7 SpectrumGreen
probe (Vysis, Abbott Laboratories).
[0080] In the method of the invention, the level of EGFR gene
amplification and/or polysomy in the tumor cell sample is compared
to a control level of EGFR gene amplification and/or polysomy
selected from: (i) a control level that has been correlated with
sensitivity to an EGFR inhibitor; and (ii) a control level that has
been correlated with resistance to the EGFR inhibitor. A patient is
selected as being predicted to benefit from therapeutic
administration of an EGFR inhibitor, an agonist thereof, or a drug
having substantially similar biological activity as the EGFR
inhibitor, if the level of EGFR gene amplification and/or polysomy
in the patient's tumor cells is statistically similar to or greater
than the control level of EGFR gene amplification and/or polysomy
that has been correlated with sensitivity to the EGFR inhibitor, or
if the level of EGFR gene amplification and/or polysomy in the
patient's tumor cells is statistically greater than the level of
EGFR gene amplification and/or polysomy that has been correlated
with resistance to the EGFR inhibitor. A patient is selected as
being predicted to not benefit from therapeutic administration of
an EGFR inhibitor, an agonist thereof, or a drug having
substantially similar biological activity as the EGFR inhibitor, if
the level of EGFR gene amplification and/or polysomy in the
patient's tumor cells is statistically less than the control level
of EGFR gene amplification and/or polysomy that has been correlated
with sensitivity to the EGFR inhibitor, or if the level of EGFR
gene amplification and/or polysomy in the patient's tumor cells is
statistically similar to or less than the level of EGFR gene
amplification and/or polysomy that has been correlated with
resistance to the EGFR inhibitor.
[0081] Similarly, in the case where HER2 gene amplification and/or
polysomy is evaluated, the level of HER2 gene amplification and/or
polysomy in the tumor cell sample is compared to a control level of
HER2 gene amplification and/or polysomy selected from: (i) a
control level that has been correlated with sensitivity to the EGFR
inhibitor; and (ii) a control level that has been correlated with
resistance to the EGFR inhibitor. A patient is selected as being
predicted to benefit from therapeutic administration of the EGFR
inhibitor, an agonist thereof, or a drug having substantially
similar biological activity as the EGFR inhibitor, if the level of
HER2 gene amplification and/or polysomy in the patient's tumor
cells is statistically similar to or greater than the control level
of HER2 gene amplification and/or polysomy that has been correlated
with sensitivity to the EGFR inhibitor, or if the level of HER2
gene amplification and/or polysomy in the patient's tumor cells is
statistically greater than the level of HER2 gene amplification
and/or polysomy that has been correlated with resistance to the
EGFR inhibitor. A patient is selected as being predicted to not
benefit from therapeutic administration of an EGFR inhibitor, an
agonist thereof, or a drug having substantially similar biological
activity as the EGFR inhibitor, if the level of HER2 gene
amplification and/or polysomy in the patient's tumor cells is
statistically less than the control level of HER2 gene
amplification and/or polysomy that has been correlated with
sensitivity to the EGFR inhibitor, or if the level of HER2 gene
amplification and/or polysomy in the patient's tumor cells is
statistically similar to or less than the level of HER2 gene
amplification and/or polysomy that has been correlated with
resistance to the EGFR inhibitor.
[0082] More specifically, according to the present invention, a
"control level" is a control level of gene amplification and/or
polysomy, which can include a level that is correlated with
sensitivity to the EGFR inhibitor or a level that is correlated
with resistance to the EGFR inhibitor. Therefore, it can be
determined, as compared to the control or baseline level of gene
amplification and/or polysomy, whether a patient sample is more
likely to be sensitive to or resistant to the EGFR inhibitor
therapy (e.g., a good responder or responder (one who will benefit
from the therapy), or a poor responder or non-responder (one who
will not benefit or will have little benefit from the
therapy)).
[0083] In one embodiment of the invention wherein gene copy number
is assessed (i.e., by gene amplification and/or gene polysomy),
patients are classified into six categories with ascending number
of copies per cell: (1) Disomy (.ltoreq.2 copies of both targets in
>90% of cells); (2) Low trisomy (.ltoreq.2 copies of the gene in
.gtoreq.40% of cells and 3 copies in 10-40% of the cells); (3) High
trisomy (.ltoreq.2 copies of the gene in .gtoreq.40% of cells and 3
copies in .gtoreq.40% of cells); (4) Low polysomy (.gtoreq.4 copies
of the gene in 10-40% of cells); (5) High polysomy (.gtoreq.4
copies of the gene in .gtoreq.40% of cells); and (6) Gene
Amplification (GA), defined by presence of tight EGFR gene clusters
and a ratio gene/chromosome per cell.gtoreq.2, or an average of
.gtoreq.15 copies of EGFR per cell in .gtoreq.10% of analyzed
cells. The present inventors have found that patients with high
gene copy numbers or a gain in copy numbers (e.g., gene
amplification and/or polysomy including high trisomy, low polysomy
or high polysomy) of EGFR and/or HER2 are more likely to have a
higher response rate to EGFR inhibitor therapy, a lower rate of
progressive disease, a longer time to progression, and a higher
rate of long term survivors. The higher the polysomy or overall
gain in gene copy number, the better the predicted outcome. The
present inventors found that the presence of HER2 gene
amplification and/or polysomy in patient tumor cells confers a more
sensitive phenotype to EGFR positive patients (e.g., patients
showing a gain in EGFR gene copy numbers) and a better outcome to
EGFR negative patients (e.g., patients having no or low gain in
EGFR gene copy numbers).
[0084] The method for establishing a control level of gene
amplification or polysomy is selected based on the sample type, the
tissue or organ from which the sample is obtained, and the status
of the patient to be evaluated. Preferably, the method is the same
method that will be used to evaluate the sample in the patient. In
a preferred embodiment, the control level is established using the
same cell type as the cell to be evaluated. In a preferred
embodiment, the control level is established from control samples
that are from patients or cell lines known to be resistant or
sensitive to gefitinib. In one aspect, the control samples were
obtained from a population of matched individuals. According to the
present invention, the phrase "matched individuals" refers to a
matching of the control individuals on the basis of one or more
characteristics which are suitable for the type of cell or tumor
growth to be evaluated. For example, control individuals can be
matched with the patient to be evaluated on the basis of gender,
age, race, or any relevant biological or sociological factor that
may affect the baseline of the control individuals and the patient
(e.g., preexisting conditions, consumption of particular
substances, levels of other biological or physiological factors).
To establish a control level, samples from a number of matched
individuals are obtained and evaluated in the same manner as for
the test samples. The number of matched individuals from whom
control samples must be obtained to establish a suitable control
level (e.g., a population) can be determined by those of skill in
the art, but should be statistically appropriate to establish a
suitable baseline for comparison with the patient to be evaluated
(i.e., the test patient). The values obtained from the control
samples are statistically processed using any suitable method of
statistical analysis to establish a suitable baseline level using
methods standard in the art for establishing such values. The
Examples section describes such statistical methods.
[0085] It will be appreciated by those of skill in the art that a
control level need not be established for each assay as the assay
is performed but rather, a baseline or control can be established
by referring to a form of stored information regarding a previously
determined control level for sensitive and resistant patients
(responders and non-responders), such as a control level
established by any of the above-described methods. Such a form of
stored information can include, for example, but is not limited to,
a reference chart, listing or electronic file of population or
individual data regarding sensitive and resistant tumors/patients,
or any other source of data regarding control level gene
amplification or polysomy that is useful for the patient to be
evaluated. For example, one can use the guidelines established
above and further described in the Examples for establishing
polysomy and for detecting gene amplification, which have already
been correlated with responsiveness to an EGFR inhibitor, to rate a
given patient sample.
[0086] In one embodiment of the present invention, the method
includes a step of detecting the expression of a protein, including
EGFR or phosphorylated Akt. Protein expression can be detected in
suitable tissues, such as tumor tissue and cell material obtained
by biopsy. For example, the patient tumor biopsy sample, which can
be immobilized, can be contacted with an antibody, an antibody
fragment, or an aptamer, that selectively binds to the protein to
be detected, and determining whether the antibody, fragment thereof
or aptamer has bound to the protein. Protein expression can be
measured using a variety of methods standard in the art, including,
but not limited to: Western blot, immunoblot, enzyme-linked
immunosorbant assay (ELISA), radioimmunoassay (RIA),
immunoprecipitation, surface plasmon resonance, chemiluminescence,
fluorescent polarization, phosphorescence, immunohistochemical
analysis, matrix-assisted laser desorption/ionization
time-of-flight (MALDI-TOF) mass spectrometry, microcytometry,
microarray, microscopy, fluorescence activated cell sorting (FACS),
and flow cytometry. In a preferred embodiment, immunohistochemical
(IHC) analysis is used to detect protein expression. IHC methods
and preferred assessment criteria for detection of protein
expression are described in detail, for example, in Hirsch et al.,
J. Clin. Oncol. 2003, 21:3798-3807, and are also described in the
Examples.
[0087] In a preferred, but non-limiting method for assessing
protein expression, the following protocol is used as an evaluation
of immunohistochemistry results. P-Akt expression and EGFR
expression can be scored, in one aspect of the invention, based on
intensity and fraction of positive cells, although other scoring
systems will be apparent to those of skill in the art, given the
guidance provided herein. The intensity score is defined as
follows: 0=no appreciable staining in the tumor cells, 1=barely
detectable staining in the cytoplasm and/or nucleus as compared
with the stromal elements, 2=readily appreciable brown staining
distinctly marking the tumor cell cytoplasm and/or nucleus, 3=dark
brown staining in tumor cells obscuring the cytoplasm and/or
nucleus, or 4=very strong staining of nucleus and/or cytoplasm. The
score is based on the fraction of positive cells (0%-100%). The
total score is calculated by multiplying the intensity score and
the fraction score producing a total range of 0 to 400. For
statistical analyses, scores of 0-200 are considered to be
negative/low expression, and scores of 201-400 are considered to be
positive/high expression. This cut-off level is based on previous
studies from the inventors, in which they found a correlation
between increased EGFR protein expression and increased gene copy
number (Hirsch et al., J. Clin. Oncol. 2003, 21:3798-3807). These
cut-off levels are convenient levels for performing the assay, but
not absolute levels. It is contemplated, for example, that this
scoring system can be revised or manipulated, such as by lowering
or raising the cut-off score by 5, 10, 15, 20, 25, 30, 35, or more
points.
[0088] In the method of the invention, the level of EGFR protein
expression and/or phosphorylated Akt expression in the tumor cell
sample is compared to a control level of EGFR protein expression
and/or phosphorylated Akt expression selected from: (i) a control
level that has been correlated with sensitivity to an EGFR
inhibitor; and (ii) a control level that has been correlated with
resistance to the EGFR inhibitor. A patient is selected as being
predicted to benefit from therapeutic administration of an EGFR
inhibitor, an agonist thereof, or a drug having substantially
similar biological activity as the EGFR inhibitor, if the level of
EGFR protein expression and/or phosphorylated Akt expression in the
patient's tumor cells is statistically similar to or greater than
the control level of EGFR protein expression and/or phosphorylated
Akt expression that has been correlated with sensitivity to the
EGFR inhibitor, or if the level of EGFR protein expression and/or
phosphorylated Akt expression in the patient's tumor cells is
statistically greater than the level of EGFR protein expression
and/or phosphorylated Akt expression that has been correlated with
resistance to the EGFR inhibitor. A patient is selected as being
predicted to not benefit from therapeutic administration of an EGFR
inhibitor, an agonist thereof, or a drug having substantially
similar biological activity as the EGFR inhibitor, if the level of
EGFR protein expression and/or phosphorylated Akt expression in the
patient's tumor cells is statistically less than the control level
of EGFR protein expression and/or phosphorylated Akt expression
that has been correlated with sensitivity to the EGFR inhibitor, or
if the level of EGFR protein expression and/or phosphorylated Akt
expression in the patient's tumor cells is statistically similar to
or less than the level of EGFR protein expression and/or
phosphorylated Akt expression that has been correlated with
resistance to the EGFR inhibitor.
[0089] Appropriate controls have been discussed above with regard
to detection of gene amplification and polysomy, and such
discussion can readily be extrapolated to controls for protein
expression. As discussed above, a control level for comparison can
be any type of control, including a preestablished control that is
provided as a form of information. For example, with regard to EGFR
protein expression, using the scoring system for EGFR expression
described above and in the Examples, a score of greater than about
200 (201-400) is considered to be a patient with high expression
(positive for EGFR expression) and a score of about 0-200 is
considered to be a patient with low expression (negative for EGFR
expression). Other scoring systems can be devised based on
comparisons with controls, and patients falling near the cut-off,
can be evaluated by other criteria, biomarkers, or techniques in
order to confirm a diagnosis. Also, the cut-off can be varied as
desired by the clinician or investigator according to patient
populations. The cut-off levels described above are convenient
levels for performing the assay and optimized by the present
inventors given the current data, but are not absolute levels. It
is contemplated, for example, that this scoring system can be
revised or manipulated, such as by lowering or raising the cut-off
score by 5, 10, 15, 20, 25, 30, 35, or more points. With regard to
phosphorylated Akt, similar methodology was used.
[0090] In one embodiment of the present invention, the method
includes an additional step of detection of a mutation in the
tyrosine kinase domain of the EGFR gene. In particular, exons 18,
19 and 21 of the EGFR gene are good targets for the evaluation of
mutations, since these exons contain about 98% of the 56 EGFR
mutations in NSCLC reported to date. In Lynch et al. or Paez et al.
(26, 27), somatic mutations were identified in the tyrosine kinase
domain of the EGFR gene in the majority of patients with
gefitinib-responsive lung cancer, as compared with none of the
patients with no response (P<0.001). Mutations were either
small, in-frame deletions or amino acid substitutions clustered
around the ATP-binding pocket of the tyrosine kinase domain.
Similar mutations were detected in tumors from 8% of patients with
primary non-small-cell lung cancer who had not been exposed to
gefitinib. All mutations were heterozygous, and identical mutations
were observed in multiple patients, suggesting an additive specific
gain of function. In vitro, EGFR mutants demonstrated enhanced
tyrosine kinase activity in response to epidermal growth factor and
increased sensitivity to inhibition by gefitinib. Therefore, the
present invention contemplates the detection of such mutations in
the tumor cell samples for use in combination with or as a
secondary screening subsequent to the screening for EGFR gene
amplification and/or polysomy and/or for HER2 gene amplification.
Detection of one or more mutations in the EGFR gene is predictive
that a patient is more likely to respond or benefit from EGFR
inhibitor therapy. Detection of no mutations is predictive that a
patient is less likely to respond or benefit from EGFR inhibitor
therapy. Methods for screening for gene mutations are well-known in
the art, are described in Lynch et al. and Paez et al., and
include, but are not limited to, hybridization, polymerase chain
reaction, polyacrylamide gel analysis, chromatography or
spectroscopy, and can further include screening for an altered
protein product encoded by the gene (e.g., via immunoblot (e.g.,
Western blot), enzyme-linked immunosorbant assay (ELISA),
radioimmunoassay (RIA), immunoprecipitation, immunohistochemistry,
immunofluorescence, fluorescence activated cell sorting (FACS) and
immunofluorescence microscopy).
[0091] As used herein, the term "selectively binds to" refers to
the specific binding of one protein to another (e.g., an antibody,
fragment thereof, or binding partner to an protein), wherein the
level of binding, as measured by any standard assay (e.g., an
immunoassay), is statistically significantly higher than the
background control for the assay. For example, when performing an
immunoassay, controls typically include a reaction well/tube that
contain antibody or antigen binding fragment alone (i.e., in the
absence of antigen), wherein an amount of reactivity (e.g.,
non-specific binding to the well) by the antibody or antigen
binding fragment thereof in the absence of the antigen is
considered to be background.
[0092] The steps of detection of the biomarkers according to the
present invention may be combined in many different combinations as
described herein, and the steps can be performed in any order, or
substantially simultaneously. Statistical analysis to determine
differences between controls and patient samples can be performed
using any methods known in the art, including, but not limited to,
Fisher's exact test of Pearson's chi-square test for qualitative
variables, and using Student's t test or analysis of variance for
continuous variables. Statistical significance is typically defined
as p<0.05. Statistical methods are described in more detail in
the Examples.
[0093] The method of the present invention is useful for
determining or predicting patients that are most likely to respond
(e.g., with a therapeutic benefit) to therapy using an EGFR
inhibitor, an agonist thereof, or a drug having substantially
similar biological activity as the EGFR inhibitor, as well as to
determine or predict patients that are most likely not to respond
to therapy using an EGFR inhibitor. An agonist, as used herein, is
a compound that is characterized by the ability to agonize (e.g.,
stimulate, induce, increase, enhance, or mimic) the biological
activity of a naturally occurring or reference protein or compound.
More particularly, an agonist can include, but is not limited to, a
compound, protein, peptide, antibody, or nucleic acid that mimics
or enhances the activity of the natural or reference compound, and
includes any homologue, mimetic, or any suitable product of
drug/compound/peptide design or selection which is characterized by
its ability to agonize (e.g., stimulate, induce, increase, enhance)
the biological activity of a naturally occurring or reference
compound. In contrast, an antagonist refers to any compound which
inhibits (e.g., antagonizes, reduces, decreases, blocks, reverses,
or alters) the effect of a naturally occurring or reference
compound as described above. More particularly, an antagonist is
capable of acting in a manner relative to the activity of the
reference compound, such that the biological activity of the
natural or reference compound, is decreased in a manner that is
antagonistic (e.g., against, a reversal of, contrary to) to the
natural action of the reference compound. Such antagonists can
include, but are not limited to, any compound, protein, peptide, or
nucleic acid (including ribozymes and antisense) or product of
drug/compound/peptide design or selection that provides the
antagonistic effect.
[0094] Agonists and antagonists that are products of drug design
can be produced using various methods known in the art. Various
methods of drug design, useful to design mimetics or other
compounds useful in the present invention are disclosed in Maulik
et al., 1997, Molecular Biotechnology: Therapeutic Applications and
Strategies, Wiley-Liss, Inc., which is incorporated herein by
reference in its entirety. An agonist or antagonist can be
obtained, for example, from molecular diversity strategies (a
combination of related strategies allowing the rapid construction
of large, chemically diverse molecule libraries), libraries of
natural or synthetic compounds, in particular from chemical or
combinatorial libraries (i.e., libraries of compounds that differ
in sequence or size but that have the similar building blocks) or
by rational, directed or random drug design. See for example,
Maulik et al., supra.
[0095] In a molecular diversity strategy, large compound libraries
are synthesized, for example, from peptides, oligonucleotides,
natural or synthetic steroidal compounds, carbohydrates and/or
natural or synthetic organic and non-steroidal molecules, using
biological, enzymatic and/or chemical approaches. The critical
parameters in developing a molecular diversity strategy include
subunit diversity, molecular size, and library diversity. The
general goal of screening such libraries is to utilize sequential
application of combinatorial selection to obtain high-affinity
ligands for a desired target, and then to optimize the lead
molecules by either random or directed design strategies. Methods
of molecular diversity are described in detail in Maulik, et al.,
ibid.
[0096] A drug having substantially similar biological activity as
gefitinib refers to a drug having substantially any function(s)
exhibited or performed by the reference compound that is ascribed
to the reference compound as measured or observed in vivo (i.e.,
under physiological conditions) or in vitro (i.e., under laboratory
conditions).
[0097] Other types of EGFR inhibitors can include, but are not
limited to, aptamers, RNAi, and ribozymes. Aptamers are short
strands of synthetic nucleic acids (usually RNA but also DNA)
selected from randomized combinatorial nucleic acid libraries by
virtue of their ability to bind to a predetermined specific target
molecule with high affinity and specificity. Aptamers assume a
defined three-dimensional structure and are capable of
discriminating between compounds with very small differences in
structure. RNA interference (RNAi) is a process whereby double
stranded RNA, and in mammalian systems, short interfering RNA
(siRNA), is used to inhibit or silence expression of complementary
genes. In the target cell, siRNA are unwound and associate with an
RNA induced silencing complex (RISC), which is then guided to the
mRNA sequences that are complementary to the siRNA, whereby the
RISC cleaves the mRNA. A ribozyme is an RNA segment that is able to
perform biological catalysis (e.g., by breaking or forming covalent
bonds). More specifically, ribozymes are antisense RNA molecules
that function by binding to the target RNA moiety and inactivate it
by cleaving the phosphodiester backbone at a specific cutting
site.
[0098] Another type of EGFR inhibitor can include an antibody,
antigen binding fragment thereof, or an antigen binding peptide or
"binding partner". Antibodies are characterized in that they
comprise immunoglobulin domains and as such, they are members of
the immunoglobulin superfamily of proteins. An antibody can include
polyclonal and monoclonal antibodies, divalent and monovalent
antibodies, bi- or multi-specific antibodies, serum containing such
antibodies, antibodies that have been purified to varying degrees,
and any functional equivalents of whole antibodies. Isolated
antibodies useful as EGFR inhibitors can include serum containing
such antibodies, or antibodies that have been purified to varying
degrees. Whole antibodies of the present invention can be
polyclonal or monoclonal. Alternatively, functional equivalents of
whole antibodies, such as antigen binding fragments in which one or
more antibody domains are truncated or absent (e.g., Fv, Fab, Fab',
or F(ab).sup.2 fragments), as well as genetically-engineered
antibodies or antigen binding fragments thereof, including single
chain antibodies or antibodies that can bind to more than one
epitope (e.g., bi-specific antibodies), or antibodies that can bind
to one or more different antigens (e.g., bi- or multi-specific
antibodies), may also be employed as EGFR inhibitors. Binding
partners are designed to bind specifically to and inhibit an EGFR
may also be evaluated. Examples of the design of such polypeptides,
which possess a prescribed ligand specificity are given in Beste et
al. (Proc. Natl. Acad. Sci. 96:1898-1903, 1999).
[0099] Another embodiment of the invention includes an assay kit
for performing any of the methods of the present invention. The
assay kit can include any one or more of the following components:
(a) a means for detecting in a sample of tumor cells a level of
amplification of the epidermal growth factor receptor (EGFR) gene
and/or a level of polysomy of the epidermal growth factor receptor
(EGFR) gene; (b) a means for detecting in a sample of tumor cells a
level of amplification of the HER2 gene; (c) a means for detecting
in a sample of tumor cells the expression of EGFR protein; (d) a
means for detecting in a sample of tumor cells the expression of
phosphorylated Akt protein; and/or (e) a means for detecting in a
sample of tumor cells at least one (but can include more than one)
mutations in the EGFR gene. The assay kit preferably also includes
one or more controls. The controls could include: (i) a control
sample for detecting sensitivity to the EGFR inhibitor being
evaluated for use in a patient; (ii) a control sample for detecting
resistance to the EGFR inhibitor; (iii) information containing a
predetermined control level of particular biomarker to be measured
with regard to EGFR inhibitor sensitivity or resistance (e.g., a
predetermined control level of EGFR gene amplification and/or
polysomy that has been correlated with sensitivity to the EGFR
inhibitor or resistance to EGFR inhibitor).
[0100] In one embodiment, a means for detecting EGFR or HER2 gene
amplification and/or polysomy can generally be any type of reagent
that can be used in a method of the present invention. Such a means
for detecting include, but are not limited to: a probe or primer(s)
that hybridizes under stringent hybridization conditions to an EGFR
gene or a HER2 gene or a portion of chromosome 7 (chromosome on
which EGFR is located) or chromosome 17 (chromosome on which HER2
is located). Nucleic acid sequences for the EGFR and HER2 genes are
known in the art and can be used to produce such reagents for
detection. Additional reagents useful for performing an assay using
such means for detection can also be included, such as reagents for
performing in situ hybridization, reagents for detecting
fluorescent markers, reagents for performing polymerase chain
reaction, etc.
[0101] In another embodiment, a means for detecting EGFR or
phosphorylated Akt protein expression can generally be any type of
reagent that can be used in a method of the present invention. Such
a means for detection includes, but is not limited to, antibodies
and antigen binding fragments thereof, peptides, binding partners,
aptamers, enzymes, and small molecules. Additional reagents useful
for performing an assay using such means for detection can also be
included, such as reagents for performing immunohistochemistry or
another binding assay.
[0102] The means for detecting of the assay kit of the present
invention can be conjugated to a detectable tag or detectable
label. Such a tag can be any suitable tag which allows for
detection of the reagents used to detect the gene or protein of
interest and includes, but is not limited to, any composition or
label detectable by spectroscopic, photochemical, electrical,
optical or chemical means. Useful labels in the present invention
include: biotin for staining with labeled streptavidin conjugate,
magnetic beads (e.g., Dynabeads.TM.), fluorescent dyes (e.g.,
fluorescein, texas red, rhodamine, green fluorescent protein, and
the like), radiolabels (e.g., .sup.3H, .sup.125I, .sup.35S,
.sup.14C, or .sup.32P), enzymes (e.g., horse radish peroxidase,
alkaline phosphatase and others commonly used in an ELISA), and
colorimetric labels such as colloidal gold or colored glass or
plastic (e.g., polystyrene, polypropylene, latex, etc.) beads.
[0103] In addition, the means for detecting of the assay kit of the
present invention can be immobilized on a substrate. Such a
substrate can include any suitable substrate for immobilization of
a detection reagent such as would be used in any of the previously
described methods of detection. Briefly, a substrate suitable for
immobilization of a means for detecting includes any solid support,
such as any solid organic, biopolymer or inorganic support that can
form a bond with the means for detecting without significantly
affecting the activity and/or ability of the detection means to
detect the desired target molecule. Exemplary organic solid
supports include polymers such as polystyrene, nylon,
phenol-formaldehyde resins, and acrylic copolymers (e.g.,
polyacrylamide). The kit can also include suitable reagents for the
detection of the reagent and/or for the labeling of positive or
negative controls, wash solutions, dilution buffers and the like.
The kit can also include a set of written instructions for using
the kit and interpreting the results.
[0104] The kit can also include a means for detecting a control
marker that is characteristic of the cell type being sampled can
generally be any type of reagent that can be used in a method of
detecting the presence of a known marker (at the nucleic acid or
protein level) in a sample, such as by a method for detecting the
presence of a biomarker described previously herein. Specifically,
the means is characterized in that it identifies a specific marker
of the cell type being analyzed that positively identifies the cell
type. For example, in a lung tumor assay, it is desirable to screen
lung epithelial cells for the level of the biomarker expression
and/or biological activity. Therefore, the means for detecting a
control marker identifies a marker that is characteristic of an
epithelial cell and preferably, a lung epithelial cell, so that the
cell is distinguished from other cell types, such as a connective
tissue or inflammatory cell. Such a means increases the accuracy
and specificity of the assay of the present invention. Such a means
for detecting a control marker include, but are not limited to: a
probe that hybridizes under stringent hybridization conditions to a
nucleic acid molecule encoding a protein marker; PCR primers which
amplify such a nucleic acid molecule; an aptamer that specifically
binds to a conformationally distinct site on the target molecule;
and/or an antibody, antigen binding fragment thereof, or antigen
binding peptide that selectively binds to the control marker in the
sample. Nucleic acid and amino acid sequences for many cell markers
are known in the art and can be used to produce such reagents for
detection.
[0105] The assay kits and methods of the present invention can be
used not only to identify patients that are predicted to be
responsive to a particular EGFR inhibitor, but also to identify
treatments that can improve the responsiveness of cancer cells
which are resistant to EGFR inhibitors, and to develop adjuvant
treatments that enhance the response of the EGFR inhibitors.
[0106] The Examples, which follow, are illustrative of specific
embodiments of the invention, and various uses thereof. They are
set forth for explanatory purposes only, and are not to be taken as
limiting the invention.
EXAMPLES
Example 1
[0107] The following example demonstrates the use of detection of
EGFR gene amplification and polysomy to predict treatment outcome
of NSCLC tumors to EGFR inhibitors (based on the study of an
Italian cohort).
Methods
Patient Selection and Study Design
[0108] Patients for this study were accrued in three Italian
institutions: the Bellaria Hospital, (Bologna), the Scientific
Institute University Hospital San Raffaele (Milano), and the
Policlinico Monteluce (Perugia). Eligibility included
histologically confirmed NSCLC patients with measurable, locally
advanced or metastatic disease, who had progressed or relapsed
after chemotherapy, and patients ineligible for chemotherapy
because they were elderly, had poor performance status, or comorbid
medical condition. Before trial inclusion, smoking status was
assessed and patients were classified as never, former (smoking
cessation>6 months prior to trial inclusion), or current smokers
(cessation<6 months before trial inclusion or active smoker).
The study was approved by the appropriate ethical review boards and
written informed consent was obtained from each patient before
entering the study.
[0109] From May 2001 to January 2004, 108 patients received
gefitinib at the daily oral dose of 250 mg until disease
progression, unacceptable toxicity or refusal. The efficacy results
for some of the patients were previously reported (28, 29).
Patients were evaluated for response according to the RECIST
criteria (30). Tumor response was assessed by computer tomography
scan every two months, with a confirmatory evaluation to be
repeated in responding patients at least 4 weeks after the initial
determination of response. Time to disease progression (TTP) was
calculated from the date of initiation of gefitinib treatment to
the date of detection of progressive disease or last contact.
Survival (OS) was calculated from the date of therapy initiation to
the date of death or last contact.
Tissue Preparation and FISH analysis
[0110] Tumor specimens were obtained at time of diagnosis prior to
any cancer therapy. For each patient, serial 5-.mu.m-thick tissue
sections were sliced from paraffin-embedded blocks containing
representative malignant cells. Histopathological classification
was performed on hematoxylin-eosin (HE) stained section based on
the World Health Organization (WHO) criteria (31). Dual-target,
dual-color FISH assays were performed using the LSI EGFR
SpectrumOrange/CEP 7 SpectrumGreen probe (Vysis, Abbott
Laboratories) according to a protocol described elsewhere (10).
Using the reference HE-stained slide of the adjacent section where
the dominant tumor foci were identified, copy numbers of the EGFR
gene and chromosome 7 probes were assessed and recorded
independently in at least 100 non-overlapping nuclei with intact
morphology. Analysis was performed independently by two observers
(FC, MVG) blinded to the patients' clinical characteristics,
following strict scoring guidelines. There was a high correlation
(r=0.96; p<0.01) between the FISH patterns identified by the two
observers suggesting that the selected criteria for scoring were
reproducible. Discordant FISH patterns were re-evaluated and a
consensus was reached by the two investigators.
[0111] According to the frequency of tumor cells with specific
number of copies of the EGFR gene and chromosome 7 centromere,
patients were classified into six FISH categories with ascending
number of copies per cell: (1) Disomy (.ltoreq.2 copies of both
targets in >90% of cells); (2) Low trisomy (.ltoreq.2 copies of
the gene in .gtoreq.40% of cells and 3 copies in 10-40% of the
cells); (3) High trisomy (.ltoreq.2 copies of the gene in
.gtoreq.40% of cells and 3 copies in .gtoreq.40% of cells); (4) Low
polysomy (.gtoreq.4 copies of the gene in 10-40% of cells); (5)
High polysomy (.gtoreq.4 copies of the gene in .gtoreq.40% of
cells); and (6) Gene Amplification, defined by presence of tight
EGFR gene clusters and a ratio gene/chromosome per cell.gtoreq.2,
or an average of .gtoreq.15 copies of EGFR per cell in .gtoreq.10%
of analyzed cells.
RNA Extraction and Quantitative RT-PCR
[0112] RNA was isolated, cDNA transcribed, and quantitative
real-time polymerase chain reactions performed as described
previously (Rosell et al., Clin Cancer Res 2004; 10:1318-25).
Microdissection of tumor cells was performed by manual or by laser
capture technique using the PALM instrument (P.A.L.M. Microlaser
Technologies AG Inc., Bernried, Germany), according to the
manufacturer's guidelines. Primers and probes were as follows:
Forward EGFR primer: 5'-TCCGTCTCTTGCCGGGAAT-3' (SEQ ID NO:1);
Reverse EGFR primer: 5'-GGCTCACCCTCCAGAACCTT-3' (SEQ ID NO:2); EGFR
Taqman probe: 5'-ACGCATTCCCTGCCTCGGCTG-3'. (Gen Bank accession:
NM.sub.--005228).
Statistical Analysis
[0113] Differences between the FISH groups were compared by
Fisher's exact test or .chi..sup.2 test for qualitative variables
and by t-student test or ANOVA for continuous variables. Normality
of the distribution was assessed by Kolmogorov-Smirnov test. Time
to progression (TTP), overall survival (OS) and the 95% confidence
intervals were evaluated by the Kaplan-Meier method (32), comparing
the FISH groups by log rank test. Risk factors associated with
survival were evaluated using Cox's proportional-hazards regression
model with a step-down procedure (33). Only those variables with
significant results in univariate analysis were included in the
multivariate analysis. The criteria for variable removal was the
likelihood ratio statistic based on the maximum partial likelihood
estimated (default p-value=0.10 for removal from the model).
Results
Clinical Characteristics
[0114] A total of 108 patients entered onto the study and 102 were
completely analyzed. Three patients were lost to follow up and FISH
results were not obtained in 3 specimens due to tumor necrosis or
poor tissue preservation. Nine patients (8.8%) received gefitinib
as first-line therapy: one patient for age>80 years, one for
refusal to chemotherapy, and 7 patients for comorbidities
contraindicating chemotherapy. The remaining patients received
chemotherapy prior to gefitinib, and 78.4% of these had received a
platinum agent. Median gefitinib treatment duration was 2.8 months
(range 0.6-20). At the time of trial inclusion, the majority of
patients were current (52.9%) or former smokers (32.4%).
[0115] One complete response (CR: 1%), 13 partial responses (PR:
12.7%) and 26 stable diseases (SD: 25.5%) were observed, for an
objective response rate (OR=CR+PR) of 13.7%, and an overall disease
control rate (DCR: CR+PR+SD) of 39.2%. Final analyses for TTP and
OS were performed in April 2004, when at least 3 months had elapsed
from the enrollment of the last patient. With a median follow-up of
7.0 months, the median TTP for the whole population was 2.9 months
(standard deviation: 5.1 months), the median OS was 7.0 months
(standard deviation: 7.2 months), and the 1-year survival was
45.1%.
[0116] Table 1 shows the relation between patient characteristics
and response, time to progression and survival. Females had a
higher response rate (28.6% versus 6.0%, p=0.004), a longer TTP
(median 4.5 versus 2.7 months, p=0.02), and a slightly better
survival (median 9.0 versus 6.9 months, p=0.059) compared to males.
Better response rate was observed also in never smoking patients
(40.0% versus 20.8%, p=0.006) compared to former and current
smokers, with no difference in TTP and survival. In patients with
adenocarcinoma and bronchioloalveolar carcinoma, although the
differences in response rates and TTP were not significant, median
survival was higher (p=0.02) compared to those with other
histologies. Better survival was also observed in patients with PS
0 and 1 (p=0.01) compared to patients with PS 2. Age and disease
stage had no correlation with gefitinib activity.
TABLE-US-00001 TABLE 1 Characteristics of the non-small-cell lung
cancer patients and gefitinib outcome* 1-year % Objective
Progressive Median Time Median Cumulative Patient No. of Response
Disease to Progression Survival in Survival .+-. % Characteristic*
Patients/% Total/%.dagger. Total/% in months months SD Total
102/100 14/14 62/60 2.9 9.4 41 .+-. 5 Sex Male 67/66 4/6 46/69 2.7
8.3 37 .+-. 6 Female 35/34 10/29 16/46 5.2 11.3 48 .+-. 9 P .004
.03|| .004.sctn. .03.sctn. .22.sctn. Stage III 14/13 1/7 6/43 6.0
8.3 36 .+-. 13 IV 88/87 13/15 56/64 2.7 9.5 42 .+-. 5 P .7 .15||
.3.sctn. .9.sctn. .77.sctn. Histology Adenocarcinoma.sup.A 54/13
8/15 34/63 3.2 11.3 45 .+-. 7 Bronchioloalveolar.sup.A 9/9 3/33
5/56 3.0 16.5 67 .+-. 16 Squamous cell.sup.B 26/25 2/8 14/54 2.2
6.5 22 .+-. 9 Large cell.sup.B 2/2 0 2/100 0.8 0.8 0 .+-. 0
Undifferentiated.sup.B 11/11 1/9 7/64 2.1 9.0 45 .+-. 15 P (.sup.A
versus .sup.B) .2 .7|| .3.sctn. .03.sctn. .04.sctn. Performance
status.dagger-dbl. 0 49/48. 5/10 32/65 2.6 10.1 40 .+-. 7 1 41/40
7/17 22/54 4.2 10.9 47 .+-. 8 2 12/12 2/17 8/67 2.1 2.7 22 .+-. 13
P (0 + 1 versus 2) .7 .7|| .2.sctn. .004.sctn. .007.sctn. Smoking
status Never smoker 15/15 6/40 6/40 5.3 10.9 47 .+-. 14 Former
smoker 33/32 5/15 17/51 3.6 13.8 55 .+-. 9 Current smoker 54/53 3/6
39/72 2.3 4.5 30 .+-. 6 P (Never versus .006 .7|| .07.sctn.
.25.sctn. .35.sctn. others) *Characteristics of 102 patients with
histologically confirmed non-small-cell lung cancer with
measurable, locally advanced or metastatic disease, progressing or
relapsing after chemotherapy, or medical contraindications for
chemotherapy who were subsequently treated with 250 mg gefitinib
daily. .dagger.Objective Response = Partial and complete response
.dagger-dbl.Performance status was defined as 0 = Fully active,
able to carry on all pre-disease performance without restriction; 1
= Restricted in physically strenuous activity but ambulatory and
able to perform work of a light or sedentary nature, e.g., light
house work, office work; and 2 = Ambulatory and capable of all self
care but unable to perform any work activities, and up and about
more than 50% of waking hours(Eastern 31 Cooperative Oncology Group
criteria, 34) .sctn.P values (two-sided) calculated using the
log-rank test. ||P values (two-sided) calculated using Pearson's
chi-square test. P values (two-sided) calculated using Fisher's
exact test.
FISH and Quantitative RT-PCR
[0117] EGFR gene expression was also evaluated by quantitative
real-time polymerase chain reaction in 63 specimens. The relative
gene expression was 2.90 (range=0.17 to 28.0) in 40 specimens with
low EGFR gene copy numbers (disomy to low polysomy) and 7.15
(range=0.19 to 28.3) in 23 specimens with high EGFR gene copy
numbers (high polysomy and gene amplification), and was
particularly high among nine tumors with gene amplification
(average=8.46, range=1.7 to 21.5). There was a significant positive
correlation between the relative expression and the gene copy
number (Pearson r=0.33; P=0.007), indicating that specimens with
gain in copy numbers had higher levels of gene expression.
FISH and Clinical Variables
[0118] Disomy was present in 35.3% of cases, low trisomy in 16.7%,
high trisomy in 2%, low polysomy in 13.7%, high polysomy in 19.6%
and gene amplification in 12.7%.
[0119] The relationship between FISH results, response to
gefitinib, time to disease progression after gefitinib and survival
after gefitinib is shown in Table 2. In the disomy category, there
were no responders, 75% progressed, and the median TTP and one-year
survival rate were low (FIG. 1). Similarly poor results were noted
in the groups with low trisomy and low polysomy, where there were
no responders, 71% and 86% with progressive disease, short time to
progression, and few long term survivors. In contrast, in patients
with high trisomy and high polysomy responders were identified,
fewer patients with progressive disease, longer times to
progression, and longer survival. Patients with gene amplification
had a high response rate (53.8%), a low rate of progressive disease
(23.1%), a long time to progression, and a high rate of long term
survivors (Table 2; FIG. 1).
[0120] Patients with high copy numbers of the EGFR gene due to gene
amplification or high polysomy were combined (Group 2) and compared
with the combined FISH categories having 2 or 3 gene copies (Group
1), as shown in Table 2. Among patients with objective response,
85.7% (12/14) were in Group 2. Furthermore, among patients with
disease stabilization, 38.5% (10/26) were in Group 2. The OR rates
were 25% in the high polysomy category, 54% in the amplification
category, and 36% in the combined Group 2, which was significantly
higher compared to Group 1 (2.9%, p<0.001). Disease control
rates were also significantly higher in Group 2 compared to Group 1
(66.7% vs. 26.1%; p<0.001). It should be noted that the group
with high trisomy contained only two patients, both of whom had a
good outcome. If these patients were combined with Group 2
patients, the differences would be even more striking. However,
from the molecular standpoint these patients with fewer EGFR gene
copies seemed more closely aligned with those with disomy and low
trisomy.
TABLE-US-00002 TABLE 2 Objective response rate, disease control
rate, time to progression and survival analysis according to the
groups of NSCLC patients with ascending number of copies of the
epidermal growth factor receptor gene. FISH Groups Group 1 Group 2
Total Low High Low High Gene Characteristics Patients Disomy
Trisomy Trisomy Polysomy Total Polysomy Amplification Total Total
No. 102 36 17 2 14 69 20 13 33 % 100 35.3 16.7 2.0 13.7 67.6 19.6
12.7 32.4 Complete and Partial Response No. 14 2 2 5 7 12 % 13.7
100 2.9 25 53.8 36.4 Stable Disease No. 26 9 5 2 16 7 3 10 % 25.5
25.0 29.4 14.3 23.2 35 23.1 30.3 Progressive Disease No. 62 27 12
12 51 8 3 11 % 60.8 75.0 70.6 85.7 73.9 40 23.1 33.3 Disease
Control Rate 39.2 25.0 29.4 100 14.3 26.1 60.0 76.9 66.7 Median
Time to Progression (months) 2.9 2.5 3.6 9.3 2.1 2.5 6.6 6.0 6.3 %
Patients without disease 18.6 8.3 5.9 100 0 8.7 35.0 46.2 39.4
progression at 12 months Median Overall Survival (months) 7.0 6.9
10.2 13.7 3.0 6.5 8.3 9.0 9.0 One-year Survival Rate 45.1 38.9 41.2
100 14.3 36.2 65.0 61.5 63.6
[0121] With respect to time to progression, Group 2 patients also
did better than Group 1. At 12 months, 91% of Group 1 patients had
progressed compared to 61% of Group 2. The difference in TTP by log
rank test was significant (p<0.001) (FIG. 2A). Survival was also
superior in Group 2 patients compared with Group 1 (FIG. 2B). The
one- and two-year survival rates were 63.6% and 40% for Group 2
compared to 36.2% and 17% for Group 1. By log rank test the
difference between these groups was statistically significant
(p=0.03).
[0122] Table 3 shows the relation between EGFR gene status and
patient characteristics. Patients with EGFR gene amplification and
high polysomy were more likely to be female (p=0.037) and never
smokers (p=0.001), while the association with histology was not
significant. Multivariate analysis showed that the risk of death
was significantly lower in patients from Group 2 (HR: 0.40, 95% CI:
0.21-0.76, p=0.005) and in patients with adenocarcinoma or
bronchioloalveolar carcinoma (HR: 0.58, 95% CI 0.35-0.97, p=0.03).
Conversely, the risk of death was significantly higher for patients
with poor performance status (PS 2) (HR 3.86, 95% CI: 1.76-8.46,
p=0.001).
TABLE-US-00003 TABLE 3 Epidermal growth factor receptor gene status
determined by FISH and patients' characteristics. Number of FISH
Patterns.sup.1 Characteristics Patients Group 1 Group 2 P value
Total of Patients Evaluated by FISH No. 102 69 33 % 100 67.6 32.4
Gender Male No. 67 50 17 0.037* % 100 74.6 25.4 Female No. 35 19 16
% 100 54.3 45.7 Histology Adenocarcinoma No. 54 36 18 0.788.sup.2
No. 100 66.7 33.3 Bronchioloalveolar Carcinoma No. 9 6 3 % 100 66.7
33.3 Squamous Cell Carcinoma No. 26 17 9 % 100 65.4 34.6 Large Cell
Carcinoma No. 2 1 1 % 100 50.0 50.0 Indifferentiated Carcinoma No.
11 9 2 % 100 81.8 18.2 Smoking Never Smoker No. 15 4 11
0.001*.sup.3 History % 100 26.7 73.3 Former Smoker No. 33 25 8 %
100 75.8 24.2 Current Smoker No. 54 40 14 % 100 74.1 25.9
*Statistically significant. .sup.1FISH Group 1 includes tumors with
disomy, low trisomy, high trisomy and low polysomy; FISH Group 2
includes tumors with high polysomy and gene amplification.
.sup.2Adenocarcinoma + Bronchioloalveolar Carcinoma vs. others.
.sup.3Never smoker vs. Former Smoker + Current Smoker.
[0123] In summary, these studies examined the correlation between
the number of copies per cell of the EGFR gene and gefitinib
activity in NSCLC in 102 NSCLC patients who had progressed or
relapsed with chemotherapy and were treated with gefitinib at a
daily dose of 250 mg. The majority of these patients were male
(67%), with ECOG performance status of 0/1 (88%) and the median age
was 62 years (range 25-83). Adenocarcinoma was the main histology
(52%), followed by squamous-cell carcinoma (26%), undifferentiated
carcinoma (11%) and bronchioloalveolar carcinoma (9%). The majority
of patients were current (53%) or former smokers (32%). The
inventors observed one complete (CR) and 13 partial (PR) responses
and 26 disease stabilizations (SD), for an objective response rate
(OR=CR+PR) of 14%, and a disease control rate (DCR=CR+PR+SD) of
39%. For the whole population, the median time to progression (TTP)
was 2.9 months, and the median survival 7.0 months. Tumor tissue
specimens collected at disease diagnosis prior to any cancer
therapy were used for determination of the copy number of the EGFR
gene per cell by fluorescence in situ hybridization (FISH). The LSI
EGFR SpectrumOrange/CEP 7 SpectrumGreen dual color probe
(Vysis/Abbott) was used and approximately 100 tumor cells were
scored per specimen. According to the number of copies per cell of
the EGFR gene and chromosome 7 centromere, patients were classified
into two major groups: Group 1 included 69 patients (68%) with no
or very low genomic gain (disomy, trisomy, low polysomy); Group 2
included 33 patients (32%) with high polysomy and gene
amplification. Group 2 patients had significantly better objective
response (OR) and disease control (DCR) rates (OR=36.4%, DCR=66.7%)
than patients in Group 1 (OR=2.9%, DCR=26.1%; p<0.001 for both
comparisons). In patients with gene amplification, objective
response was seen in 53.8% and 76% had disease control. Median time
to progression and overall survival were significantly longer in
Group 2 (6.3 and 9.0 months) than in Group 1 (2.5 and 6.5 months;
p<0.001 and 0.03, respectively). In the multivariate analysis
Group 2 had a significantly lower risk of death (Hazard Ratio:
0.44, 95% CI=0.23 to 0.82). In conclusion, EGFR gene amplification
and high polysomy identified by FISH are highly effective molecular
predictors for gefitinib activity in advanced NSCLC.
[0124] The results from the studies described herein demonstrate
that gefitinib is highly active in advanced NSCLC patients with
EGFR gene amplification or high level of polysomy and support the
use of the EGFR-FISH assay for selection of NSCLC patients for
tyrosine kinase inhibitor therapy. The strong correlation between
response to gefitinib and EGFR genomic gain detected by FISH is
expected to be a powerful factor to define patient eligibility for
this drug. A positive correlation between clinical outcome and
chromosomal polysomy also suggest that assessing chromosome 7
centromeric sequences may contribute to a panel of multiple tests
for response prediction. The lack of correlation between patients
with no or low genomic gain indicates that the treatment is not
effective in this particular patients set, therefore minimizing
possibly clinical and certainly financial burden of this
therapeutic approach.
[0125] The inventors also demonstrated that genomic gains in the
EGFR gene can be identified by other molecular techniques such as
quantitative real-time PCR, which results correlated in a
significant positive pattern with the FISH results.
[0126] The question could be raised whether increased EGFR copy
number per se has a positive impact on prognosis, independent of
the treatment. However, the opposite appears to be the case. The
inventors have previously reported that NSCLC patients with
resected tumors carrying high EGFR gene copy number have a tendency
to a shorter survival (Hirsch et al., 2003, J. Clin. Oncol.). Thus,
similar to the findings in breast cancer for HER2 and trastuzumab
(Herceptin.RTM., Genentech/Roche), increased EGFR gene copy number
in NSCLC seems to be a poor prognostic feature but a good predictor
for sensitivity to EGFR inhibitors.
Example 2
[0127] The following example demonstrates the use of detection of
EGFR gene amplification and polysomy to predict treatment outcome
of patients with BAC tumors to EGFR inhibitors (based on the SWOG
cohort).
[0128] Bronchioalveolar carcinoma (BAC) subtypes of NSCLC are
characterized by unique pathologic, radiographic, and clinical
features (Travis et al., 1999), and appears to be increasing in
incidence, particularly in younger non-smoking women (Barsky et
al., 1994; Furak et al., 2003). BAC and adenocarcinoma with BAC
features have been reported to be particularly sensitive to EGFR
tyrosine kinase inhibitors, with response rates of 25-30% (Miller
et al., 2003) and prolonged survival in a subset of patients. The
inventors and colleagues have previously reported the efficacy of
gefitinib in a large cohort of advanced stage BAC patients treated
on a prospective clinical trial of the Southwest Oncology Group
(S0126) (Gandara et al., 2004). Since archival tumor tissue was
collected from the great majority of patients enrolled, the S0126
trial represents a unique pathologic resource for study of EGFR
pathways. Based on the inventors' prior experience with NSCLC
patients treated with gefitinib it was hypothesized that increased
EGFR and/or HER2 gene copy numbers detected by FISH would be
associated with increased efficacy of gefitinib in the subset of
NSCLCs who have BAC or adenocarcinoma with BAC features. This
example reports the results of this analysis in patient tumor
tissue from the S0126 study, correlated with clinical outcome.
Material and Methods
[0129] All patients enrolled were required to have histologically
proven, stage IIIB (by pleural effusion) or IV BAC or
adenocarcinoma with BAC features. Pathologic eligibility was based
on an institutional definition of BAC, although a central review
was subsequently carried out using the World Health Classification
(Travis et al., 1999). Histopathological subtypes in this report
are based on this central pathology review. Cytologic specimens
were not accepted for the BAC diagnosis, and patients with only
cytological diagnosis were not eligible for S0126.
[0130] Patients were required to have a SWOG performance status of
0-2. Pre-study evaluation included: history and physical
examination; complete blood count with differential and platelets,
serum chemistries of alkaline phosphatase, SGOT or SGPT, LDH and
albumin; chest radiograph; CT of chest, liver, and adrenal glands.
Bone scan and/or brain CT or MRI were required only if clinically
indicated based on symptoms and physician judgment. Patients with a
history of brain metastases were ineligible for the present study.
Pregnant or nursing women were ineligible, and women and men of
reproductive potential were unable to participate unless they
agreed to use an effective contraceptive method. Eligible patients
had no other prior malignancy except for adequately treated basal
cell or squamous cell skin cancer, in situ cervical cancer,
adequately treated stage I or II cancer from which the patient was
in complete remission, or any other cancer from which the patient
was disease-free for at least five years.
[0131] All patients were informed of the investigational nature of
this study and signed a written informed consent in accordance with
local institutional review board and federal guidelines. All
patients had measurable or evaluable disease.
[0132] The study consisted of 137 eligible patients divided into
two cohorts: chemonaive patients (N=101), and those with previous
chemotherapy (N=36); one patient died prior to initiation of
treatment. Patients were treated with daily oral gefitinib a dose
of 500 mg/day until progression or prohibitive toxicity. Patient
characteristics were median age 68 years (range 34-88), male/female
distribution 45%/51%, performance status 0-1/2 89%/11%, and stage
IIIB/IV 11%/89%.
[0133] Histopathological diagnosis and subtyping of BAC was
performed on hematoxylin-eosin stained sections by consensus
reading by two of the authors (WAF and FRH) using the WHO criteria
(Travis et al., 1999). For each patient, serial 4-.mu.m
paraffin-embedded tissue sections containing representative
malignant cells were sliced. Cell copy number were investigated by
FISH using the LSI EGFR SpectrumOrange/CEP 7 SpectrumGreen probe
according to protocols described elsewhere (Hirsch et al., 2003, J.
Clin. Oncol.; Hirsch et al., 2002, Br. J. Cancer). Using the
reference HE-stained slide of the adjacent section where the
dominant tumor foci were identified, copy numbers of the EGFR and
HER2 genes and chromosome 7 and 17 probes were assessed and
recorded independently in at least 100 non-overlapping nuclei with
intact morphology. The FISH analysis was performed independently by
two observers (MVG, ACX) blinded to the patients' clinical
characteristics. According to the frequency of tumor cells with
specific number of copies of the EGFR or HER2 genes and chromosome
7 and 17 centromeres, patients were classified into two strata:
FISH negative, with no or low genomic gain (.ltoreq.4 copies of the
gene in >40% of cells) and FISH positive, with high level of
polysomy (.gtoreq.4 copies of the gene in .gtoreq.40% of cells) or
gene amplification, defined by presence of tight gene clusters and
a ratio gene/chromosome per cell.gtoreq.2, or .gtoreq.15 copies of
the genes per cell in .gtoreq.10% of analyzed cells.
Statistical Methods:
Outcome Definitions
[0134] Response evaluation was performed by standard criteria
(RECIST) (Therasse et al., 2000). Only patients with measurable
disease were included in the response evaluation, while the
survival analysis included all the patients. Survival data were
analysed from the day the patient started gefitinib treatment until
death. Overall survival (OS) was calculated as the time from
registration to S0126 to death from any cause or last contact.
Progression-free survival (PFS) was calculated as the time from
registration to S0126 to either progression of disease or death
from any cause or last contact.
Analysis Methods
[0135] Survival curves were estimated by the product-limit method
(Kaplan and Meier; 1958) and compared using the log rank test
(Mantel, 1966). Cox proportional hazards regression was used to
assess the influence of EGFR FISH and standard prognostic factors
on survival outcomes and to estimate hazard ratios (Cox, 1972).
Multivariate models were constructed using backward stepwise
regression methods. All univariately significant covariates were
included in the stepwise selection.
Results
[0136] Protocol S0126 enrolled 145 patients, of whom 8 were
ineligible and one did not receive protocol treatment, leaving 136
eligible patients for analysis. Among those, 81 patients had tumour
tissue available for EGFR gene analysis by FISH analysis (Table 4)
and 56 had tissue available for HER2 gene analysis by FISH.
TABLE-US-00004 TABLE 4 Demographic data of the FISH cohort compared
to the total SWOG S0126 cohort. EGFR/FISH S0126 Cohort (N = 81)
Characteristics (N = 136) Positive Negative Total Females 69 (51%)
13 (50%) 28 (51%) 41 (51%) Males 67 (49%) 13 (50%) 27 (49%) 40
(49%) Smokers 97 (71%) 20 (77%) 39 (71%) 59 (73%) Never smokers 39
(29%) 6 (27%) 16 (29%) 22 (27%) PS = 0 62 (46%) 13 (50%) 22 (40%)
35 (43%) PS = 1 59 (43%) 11 (42%) 23 (42%) 34 (42%) PS = 2 15 (11%)
2 (8%) 10 (18%) 12 (15%) ADC 11 (11%) 5 (20%) 2 (4%) 7 (9%) ADC
with BAC 34 (34%) 8 (32%) 16 (29%) 24 (30%) BAC Mucinous 17 (17%) 1
(4%) 13 (24%) 14 (18%) BAC non-Mucinous 37 (37%) 11 (44%) 24 (44%)
35 (44%)
[0137] There were no statistical differences in gender, smoking
status, performance status and histology between the total S0126
cohort and the sub-cohort of 81 patients who underwent EGFR FISH
analysis (Table 4). Similarly, no statistical difference in
survival outcome between the total S0126 population and the EGFR
FISH sub-cohort was observed (FIG. 4A). Thus, the EGFR FISH
sub-cohort appeared representative of the total S0126
population.
[0138] The number of patients in each EGFR FISH category is shown
in Table 5. Altogether, 26/81 patients (32%) were positive for EGFR
FISH, and there were no significant differences between the EGFR
FISH positive and negative groups in terms of gender, histology,
smoking status or performance status (Table 4). For response
analysis, 55 out of the 81 EGFR FISH patients had measurable
disease. In the FISH positive group 5 of 19 patients (26%) had
objective response and 12 patients (63%) had disease control
(objective response or stable disease), while in the FISH negative
group 4 of 36 patients (11%) had objective response (p=0.14) and 14
patients (39%) had disease control (p=0.087) (Table 5).
TABLE-US-00005 TABLE 5 Treatment outcome according to EGFR FISH
strata. EGFR FISH TTP (mo) Median survival 1-year result No. pts.
RSP(%).sup.1 DCR (%).sup.1 (95% Cl) (mo) survival (%) FISH negative
55 4/36 (11%) 14/36 (39%) 4 (2-5) 4 (2-5) 42% (29%-55%) FISH
positive 26 5/19 (26%)* 12/19 (63%)** 9 (3-20) >18*** 81%
(65%-96%) TOTAL 81 9/55 (16%) 26/55 (47%) 4 (2-6) 14 (8-19) 54%
(43%-65%) .sup.1Limited to the subgroup of patients with measurable
disease. *p = 0.15, **p = 0.087 ***Median survival not yet
reached.
[0139] All 81 eligible patients with assessable tumor tissue for
EGFR FISH analysis were included in the survival analysis. The
progression free survival and overall survival curves for patients
with FISH positive and negative tumors are shown in FIGS. 4B and
4C, respectively. The median progression-free survival time for the
FISH negative patients was 4 months (95% C.I.: 2, 5) versus 9
months (95% C.I.: 3, 20) for the FISH positive patients with a
hazard ratio of 1.67 (p=0.072) (95% CI: 0.96, 2.91, p=0.072) (FIG.
4B). The median survival time for the FISH negative patients was 8
months (95% C.I.: 6, 15). While the median survival for the FISH
positive patients has not yet been reached, it is approaching 18
months, with a hazard ratio of 2.02 (95% CI: 1.03, 3.99, p=0.042)
(FIG. 4C).
[0140] The response rates and survival were also analyzed with
respect to histological subtypes. Among the 8 patients with
adenocarcinoma no responders were observed, but 2 patients had
stable disease (DCR 2/8=25%). However, among 27 patients with
adenocarcinoma with BAC features 5 patients (19%) achieved response
and 12 patients (44%) stable disease (DCR 17/27=63%). In the BAC
non-mucinous group 6 out of 20 patients (30%) had response and 8
patients (40%) had stable disease (DCR 14/20=70%), while in the BAC
mucinous group none of the 11 patients had response or stable
disease (chi-square p=0.0004).
[0141] A multivariate Cox regression model (Table 6) was used to
assess the possibility that the effect of EGFR copy number by FISH
on survival could be explained by other standard prognostic
factors. EGFR copy number by FISH remained a significant prognostic
factor for both overall (p=0.0261) and progression-free survival
(p=0.034) after accounting for smoking status, sex, histology and
performance status.
TABLE-US-00006 TABLE 6 Multivariate analysis for overall survival
in patients with data for all the variables (N = 80 pts) Hazard
Ratio Variable No. Pts (%) (95% CI) P-value Current/Former Smokers
58 (73%) 3.72 (1.67-8.30) 0.0013 Adenocarcinoma 7 (9%) 4.86
(1.69-14.01) 0.0034 Performance status 2 12 (15%) 4.24 (1.95-9.25)
0.0003 BAC Mucinous 14 (18%) 2.86 (1.43-5.73) 0.0030 EGFR FISH
negative 55 (69%) 2.50 (1.12-5.62) 0.0261
Discussion
[0142] This study demonstrates that increased EGFR gene copy number
detected by FISH is associated with improved survival after
gefitinib therapy in patients with advanced stage BAC and
adenocarcinoma with BAC features, a subset of NSCLC that may serve
as a model for study of EGFR pathways due to its underlying
biologic characteristics (Gandara et al., 2004). In the current
study, about one third of the patients had increased EGFR gene copy
number, and these patients also had a trend for higher response
rates and a longer time to progression after gefitinib therapy.
While RECIST response assessment is commonly not applicable in
patients with BAC because the diffuse pulmonary infiltration cannot
be measured, without being bound by theory, the inventors believe
that the significant difference in survival between patients with
EGFR FISH positive and negative tumors strongly support the
hypothesis that increased gene copy number associates with
increased efficacy of gefitinib. There is very little information
in the literature regarding survival for patients with advanced
BAC. In a study by Breathnach et al (Breathnach et al., 1999), 28
patients with advanced BAC treated with chemotherapy or
radiotherapy were analyzed. The median survival time from start of
initial treatment was 11.7 months (95CI 8.7-16.7). In a previous
SWOG trial (S9714) evaluating paclitaxel in advanced BAC, the
median survival was 12 months (West et al., 2005). In the current
study, the median survival time for the FISH positive group has not
yet been reached but is approaching 18 months versus 8 months for
the FISH negative group. The inventors and colleagues have
previously reported that increased EGFR gene copy number was
associated with a poor prognosis in patients with surgically
resected NSCLC (Hirsch et al., 2003, J. Clin. Oncol.). In this
study, the inventors verify that increased EGFR gene copy number is
a positive predictive marker for improved survival under the
influence of gefitinib therapy. These observations are similar to
data reported for breast cancer patients with HER2 gene
amplification, who have a poor prognosis but a greater likelihood
of benefiting from trastuzumab (Herceptin.RTM.) (Slamon et al.,
2001).
[0143] Demographic and survival data were compared between the EGFR
FISH positive subpopulation and the total study population, and no
differences were observed in terms of known prognostic factors such
as gender, smoking status, performance status or histology. In
addition, there was no difference in overall survival between the
total population and the FISH-tested cohort.
[0144] The focus of this example is the predictive value of EGFR
FISH for survival in patients with advanced stage BAC. Correlation
with other methods of assessing the biologic viability of EGFR and
associated signal transduction pathways, such as EGFR protein
levels, EGFR mutation analysis, and measurement of downstream
markers like AKT and MAPK is discussed elsewhere herein and can be
further described with regard to advanced BAC. MAPK levels, as
assessed by immunohistochemistry (IHC), are predictive of
sensitivity to gefitinib in BAC tumors (Gandara et al., 2004) and
may be included as an additional biomarker in the methods
herein.
[0145] The clinical implications of these findings are considerable
in regard to patient selection for therapy with EGFR tyrosine
kinase inhibitors (EGFR TKIs). BAC is a disease entity that appears
to be increasing in incidence (Barsky et al., 1994; Furak et al.,
2003). While preliminary studies have demonstrated relatively high
response rates for EGFR inhibitors in patients with BAC and its
histological subtypes (West et al., 2005; Patel et al., 2003;
Miller et al., 2004), no studies have yet demonstrated survival
benefit from these agents in this patient population. The current
study demonstrated a significant survival benefit in EGFR FISH
positive patients indicating that increased EGFR gene copy numbers
detected by FISH can be used as a marker to assess survival
potential in patients to be treated with EGFR TKIs. FISH technology
is applicable for clinical use, as analysis is performed on routine
paraffin embedded material.
Example 3
[0146] The following example demonstrates the use of EGFR protein
expression, phosphorylated AKT expression, and the combination of
these markers with EGFR gene copy numbers and EGFR mutation to
predict outcome to EGFR inhibitor therapy in NSCLC patients
(Italian cohort).
Methods
Patient Selection and Study Design
[0147] Patients included in this study were accrued from a
prospective study of gefitinib (Cappuzzo et al., 2004, J. Natl.
Cancer Inst.) and the Expanded Access Study of gefitinib conducted
at Bellaria Hospital (Bologna), Scientific Institute University
Hospital San Raffaele (Milano), and Policlinico Monteluce
(Perugia). Complete clinical information and tissue blocks were
available from 80 out of 106 patients enrolled in the Akt clinical
trial (Cappuzzo et al., ibid.), and from an additional 22 patients
in the Expanded Access Study who were treated consecutively at the
end of the Akt study and followed in the same way as patients in
the Akt trial. These studies were approved by the Bellaria Hospital
institutional ethical review board, and written informed consent
was obtained from each patient before enrollment. In the subgroup
of patients participating in the Expanded Access Study of
gefitinib, institutional review board approval was obtained
according to Good Clinical Practice, and specific written informed
consent was obtained from each patient (Expanded Access Study
consent form, Italian version).
[0148] Eligibility for both studies included histologically
confirmed NSCLC with measurable, locally advanced or metastatic
disease, progressing or relapsing after chemotherapy or with
medical contraindications for chemotherapy. Patients had
performance status ranging from grade 0 to 2. Performance status
was defined according to Eastern Cooperative Oncology Group (Oken
et al., 1982) and considered grade 0 when the patient was fully
active and able to perform all pre-disease activities without
restriction, grade 1 when the patient was restricted in physically
strenuous activity but ambulatory and able to perform work of a
light or sedentary nature, and grade 2 when the patient was
ambulatory and capable of all self-care but unable to perform any
work activities.
[0149] Patients received gefitinib (250 mg per day) and were
evaluated for response according to the Response Evaluation
Criteria in Solid Tumors criteria (Therasse et al., 2000). Tumor
response was assessed by computer tomography scan after 2 months,
with a confirmatory evaluation to be repeated in responders and in
patients with stable disease at least 4 weeks after the initial
determination of response. Time to disease progression was
calculated from the date of initiation of gefitinib treatment to
the date of detection of progressive disease or to the date of last
contact. Survival was calculated from the date of therapy
initiation to the date of death or to the date of last contact.
Tissue Preparation and Protein Analysis
[0150] Tumor specimens were obtained before any cancer therapy and
embedded in paraffin. Serial sections (4 .mu.m) containing
representative malignant cells were stained with hematoxylin and
eosin and classified based on the World Health Organization
criteria (Travis et al., 1999).
[0151] EGFR protein expression was evaluated by
immunohistochemistry using methods and assessment criteria
described elsewhere (Hirsch et al., 2003, J. Clin. Oncol.) with the
mouse anti-human EGFR, clone 31G7 monoclonal antibody (Zymed
Laboratories, Inc., San Francisco, Calif.). P-Akt was also detected
by immunohistochemistry using the rabbit anti-mouse P-Akt (Ser 473)
polyclonal antibody (Cell Signaling Technology, Beverly, Mass.,
USA), according to the manufacturer's protocol. P-Akt expression
and EGFR expression were scored based on intensity and fraction of
positive cells. The intensity score was defined as follows: 0=no
appreciable staining in the tumor cells, 1=barely detectable
staining in the cytoplasm and/or nucleus as compared with the
stromal elements, 2=readily appreciable brown staining distinctly
marking the tumor cell cytoplasm and/or nucleus, 3=dark brown
staining in tumor cells obscuring the cytoplasm and/or nucleus, or
4=very strong staining of nucleus and/or cytoplasm. The score was
based on the fraction of positive cells (0%-100%). The total score
was calculated by multiplying the intensity score and the fraction
score producing a total range of 0 to 400. For statistical
analyses, scores of 0-200 were considered negative/low expression,
and scores of 201-400 were considered positive/high expression.
This cut-off level was based on consistency with previous studies
from our group, in which we found a correlation between increased
EGFR protein expression and increased gene copy number (Hirsch et
al., 2003, ibid.). Immunohistochemistry assays were scored jointly
by two investigators, blinded to clinical, FISH, and EGFR mutation
results, and if discrepancies occurred, a consensus score was made
by the two readers after discussion of the slide.
Statistical Analysis:
[0152] Differences between and among groups were compared using
Fisher's exact test or Pearson's chi square test for qualitative
variables and using student's t test or analysis of variance for
continuous variables. Normality of the distribution was assessed
using the Kolmogorov-Smirnov test (Curiel et al., 1990). Time to
progression, overall survival, and 95% confidence intervals were
calculated and evaluated by the Kaplan-Meier method (Don et al.,
1991); different groups were compared using the log-rank test.
Association of risk factors associated with survival was evaluated
using Cox proportional hazards regression modeling with a step-down
procedure (Armitage and Berry, 1994). Only those variables with
significant results in univariate analysis were included in the
multivariable analysis. The criterion for variable removal was the
likelihood ratio statistic, based on the maximum partial likelihood
estimates (default P value of 0.10 for removal from the model). The
study design guarantees independence of the observations. The
proportional hazard assumption was tested by log-survival function
analysis and found to hold. All statistical tests were two-sided
and statistical significance was defined as P<0.05. All analyses
were performed using the statistical package SPSS version 11.5
(SPSS Italia srI, Bologna, Italy).
Results
Clinical Characteristics
[0153] The clinical outcome based on gender, stage, histology,
performance status, and smoking status, most of which was reported
in previous publication (Cappuzzo et al, JNCI, 2004), is shown in
Table 1 (see Example 1). For the entire group, the objective
response rate was 14%, the progression rate was 60%, the median
time to progression was 2.9 months, the median survival was 9.4
months, and 1-year survival was 40.7%. Female sex (mean difference
22.6%, 95% CI: 6.6 to 38.6, P=0.004) and never smoking status (mean
difference 30.8%, 95% CI: 5.3 to 56.3, P=0.006) were statistically
significantly associated with better response, and female sex (mean
difference 3.0 months, 95% CI: 4.5 to 10.5 months, P=0.03),
adenocarcinoma and bronchioloalveolar histology (mean difference
5.0 months, 95% CI: 2.8 to 7.2 months, P=0.03), and performance
status 0-1 (mean difference 7.4 months, 95% CI: 5.6 to 9.1 months,
P=0.004) were statistically significantly associated with longer
survival.
[0154] Time to disease progression was calculated from the date of
initiation of gefitinib treatment to the date of detection of
progressive disease or to the date of last contact. Survival was
calculated from the date of therapy initiation to the date of death
or to the date of last contact. Statistical significance of
differences between groups were evaluated with the log-rank
test.
EGFR Protein Expression and Clinical Outcome
[0155] EGFR protein expression was evaluated by
immunohistochemistry in 98 patients (data not shown) and the
outcome of patients according to protein score is shown in Table 7a
and FIG. 3A-3B. Patients with the lowest scores (0-99) had no
response, and only one had stable disease. These patients had a
short time to progression (median 2.1 months) and short median
survival (4.5 months) and 27% had 1-year survival. Patients with
scores of 100-199 also had a poor outcome, with a 65% rate of
progressive disease, short time to progression (median 2.3 months),
and poor survival (only 35% of the patients alive at 1 year).
Because their outcomes were similarly poor, the 40 patients (41%)
with scores below 100 and 100-199 were combined (EGFR IHC-).
Patients with EGFR immunohistochemistry scores of 200-299 and of
300-399 had much better outcomes than patients in the EGFR IHC-
group, and because they had similar response rates, progression
times, and survival, they were also grouped together (EGFR IHC+).
EGFR IHC+ patients, compared with IHC- patients, had significantly
higher objective response rate (21% versus 5%, P=0.03), lower
progression rate (44.8% versus 80%, P<0.001), longer time to
progression (5.2 versus 2.3 months, P=0.001), and longer survival
(11.5 versus 5.0 months, P=0.01). Protein status was not associated
with clinical characteristics (Table 8) but was statistically
significantly correlated with gene copy numbers (Pearson r=0.28,
P=0.006).
TABLE-US-00007 TABLE 7a EGFR-Protein Expression and Clinical
Outcome in 98 patients with advanced NSCLC treated with gefitininb.
IHC Score N OR PD TTP (mo) MS (mo) 1-year Total: 98 (100%) 14 (14%)
58 (59%) 2.9 9.5 41 .+-. 5 0-99 20 (20%) 0 (0%) 19 (95%) 2.1 4.5 27
.+-. 10 100-199 20 (20%) 2 (10%) 13 (65%) 2.3 5.3 35 .+-. 10
200-299 15 (15%) 4 (26%) 5 (33%) 8.6 15.2 71 .+-. 12 300-400 43
(44%) 8 (19%) 21 (49%) 4.5 11.3 41 .+-. 8 EGFR IHC / (<200) 40
(41%) 2 (5%) 32 (80%) 2.3 5.0 31 .+-. 7 EGFR IHC + (.gtoreq.200) 58
(59%) 12 (21%) 26 (45%) 5.2 11.5 48 .+-. 7 P (IHC / vs. IHC+) 0.03
<0.001 0.001 0.01 0.01 *Characteristics of 102 patients with
histologically confirmed non-small cell lung cancer with
measurable, locally advanced or metastatic disease, progressing or
relapsing after chemotherapy, or medical contraindications for
chemotherapy that were subsequently treated with 250 mg gefitinib
daily. OR = objective response, PD = progressive disease, TTP =
time to progression MS = median overall survival. Protein statusby
immunohistochemistry (IHC) was defined was based on fraction of
positive cells; 0-100% and staining intensity in a scale from 1-4.
The total score was calculated by multiplying the intensity score
and the fraction score, making a total range of 0-400. .dagger.P
values (two-sided) calculated using the log rank test .dagger-dbl.P
values (two-sided) calculated using Pearson's chi-square test
.sctn.P values (two-sided) calculated using Fisher's exact test
EGFR Mutation and Clinical Outcome
[0156] Mutation analysis for EGFR exons 18, 19, and 21 was
performed in a total of 89 case patients (60 microdissected and 29
non-microdissected specimens). EGFR mutations were found in 15
patients (EGFR mutation positive=17%), 12 from microdissected and
three from non-microdissected specimens (P=0.30), and consisted of
missense mutations in exon 21 (n=8) or small in-frame deletions in
codons 746-753 in exon 19 (n=7) (Tables 7b and 9). All of these
mutations have previously been described (11-13), with the
exception of the missense mutation in exon 21 (valine 851 to
isoleucine, V851I), which occurred in a male patient experiencing
progressive disease. The presence of EGFR mutations was associated
with never-smoking history (P=0.007). The associations with sex and
histology were not statistically significant (P=0.10 for both),
although mutations were more frequent in women and in patients with
adenocarcinoma (Table 8).
TABLE-US-00008 TABLE 7b EGFR Mutation and Clinical Outcome in 89
patients with advanced NSCLC treated with gefitininb. EGFR
Mutations N OR PD TTP (mo) MS (mo) 1-year Total: 89 (100%) 12 (13%)
56 (63%) 2.9 9.4 41 .+-. 5 Mutation Absent 74 (83%) 4 (5%) 50 (68%)
2.6 8.4 38 .+-. 6 Mutation Present 15 (17%) 8 (53%) 6 (40%) 9.9
20.8 57 .+-. 13 P (Mutation Absent 0.001 0.04 0.02 0.09 0.22 vs.
Present)
TABLE-US-00009 TABLE 8 Epidermal growth factor receptor (EGFR) and
characteristics of the non-small-cell lung cancer patients
according to FISH, protein and gene mutation status* EGFR FISH
status EGFR protein status EGFR gene mutation Patient
Characteristics Positive, N/% Negative, N/% Positive, N/% Negative,
N/% Present, N/% Absent, N/% Total 33/32 69/68 58/59 40/41 15/17
74/83 Sex Male 17/51 50/72 37/64 27/67 7/47 51/69 Female 16/48
19/28 21/36 13/32 8/53 23/31 P .04.dagger. .70.dagger. .10.dagger.
Histology Adenocarcinoma.sup.A 18/54 36/52 29/50 22/55 10/67 40/54
Bronchioloalveolar.sup.A 3/9 6/9 4/7 5/12 2/13 6/8 Squamous
cell.sup.B 9/27 17/25 18/31 8/20 1/7 20/27 Large cell.sup.B 1/3 1/1
1/2 1/2 0 1/1 Undifferentiated.sup.B 2/6 9/13 6/10 4/10 2/13 7/9 P
(.sup.A versus .sup.B) .78.dagger. .29.dagger. .10.dagger.
Performance status 0 13/39 36/52 27/47 20/50 8/53 35/47 1 13/39
28/40 27/47 12/30 5/33 31/42 2 7/21 5/7 4/7 8/20 2/13 8/11 P (0 + 1
versus 2) .053.dagger-dbl. .06.dagger-dbl. .60.dagger-dbl. Smoking
status Never smoker 11/33 4/6 10/17 5/12 6/40 7/9 Former smoker
8/24 25/36 21/36 11/27 5/33 24/32 Current smoker 14/42 40/58 27/47
24/60 4/26 43/58 P (Never versus others) .001.dagger-dbl.
.52.dagger-dbl. .007.dagger-dbl. *Characteristics of 102 patients
with histologically confirmed non-small-cell lung cancer patients
with measurable, locally advanced or metastatic disease,
progressing or relapsing after chemotherapy, or medical
contraindications for chemotherapy who were subsequently treated
with 250 mg gefitinib daily Performance status was defined as 0 =
Fully active, able to carry on all pre-disease performance without
restriction;1 = Restricted in physically strenuous activity but
ambulatory and able to perform work of a light or sedentary nature,
e.g., light house work, office work; and 2 = Ambulatory and capable
of all self care but unable to perform any work activities, and up
and about more than 50% of waking hours (Eastern Cooperative
Oncology Group criteria, 34) FISH = fluorescence in situ
hybridization. .dagger.P values (two-sided) calculated using
Pearson's chi-square test .dagger-dbl.P values (two-sided)
calculated using Fisher's exact test
TABLE-US-00010 TABLE 9 Exon 19 deletions EGFR protein 739
K```I```P```V```A```I```K```E```L```R```E```A```T```S```P```K```A```N
756 SEQ ID NO:4 EGFR gene 2215 AAA ATT CCC GTC GCT ATC AAG GAA TTA
AGA GAA GCA ACA TCT CCG AAA GCC AAC 2268 SEQ ID NO:5 Patient 15 AAA
ATT CCC GTC GCT ATC AAG ... ... ... ... ... ````TCT CCG AAA GCC AAC
SEQ ID NO:6 Patients 19, 30, 41 and 53* AAA ATT CCC GTC GCT ATC AA.
... ... ... ... .A ACA TCT CCG AAA GCC AAC SEQ ID NO:7 Patient 57
AAA ATT CCC GTC GCT ATC AAG GAA T.. ... ... ... ... .CT CCG AAA GCC
AAC SEQ ID NO:8 Patient 75.dagger. AAA ATT CCC GTC GCT ATC AAG ...
... ... ... ... ACA TCT CCG AAA GCC AAC SEQ ID NO:9 Exon 21
mutations EGFR protein 850
H```V```K```I```T```D```F```G```L```A```K```L```L```G 863 SEQ ID
NO:10 EGFR gene 2538 CAT GTC AAG ATC ACA GAT TTT GGG CTG GCC AAA
CTG CTG GGT 2589 SEQ ID NO:11 Patients 1, 2, 16, 26, 31, 38, 100
H```V```K```I```T```D```F```G```R```A```K```L```L```G SEQ ID NO:12
(substitution 2573 T > G).dagger-dbl. CAT GTC AAG ATC ACA GAT
TTT GGG CGG GCC AAA CTG CTG GGT SEQ ID NO:13 Patient 3
H```I```K```I```T```D```F```G```L```A```K```L```L```G SEQ ID NO:14
(Substitution 2541 G > A)# CAT ATC AAG ATC ACA GAT TTT GGG CTG
GCC AAA CTG CTG GGT SEQ ID NO:15 Primers used for Mutation Analysis
Exon 18 forward GACCCTTGTCTCTGTGTTCTTGT SEQ ID NO:16 Exon 18
reverse outside TATACAGCTTGCAAGGACTCTGG SEQ ID NO:17 Exon 18
reverse inside CCAGACCATGAGAGGCCCTG SEQ ID NO:18 Exon 19 forward
CACAATTGCCAGTTAACGTCTTC SEQ ID NO:19 Exon 19 reverse outside
AGGGTCTAGAGCAGAGCAGC SEQ ID NO:20 Exon 19 reverse inside
GCCTGAGGTTCAGAGCCAT SEQ ID NO:21 Exon 21 forward
CATGATGATCTGTCCCTCACAG SEQ ID NO:22 Exon 21 reverse outside
CTGGTCCCTGGTGTCAGGAA SEQ ID NO:23 Exon 21 reverse inside
GCTGGCTGACCTAAAGCCACC SEQ ID NO:24 Notes *Similar to patient 1 in
(11) .dagger.Similar to the Del-1b (12) .dagger-dbl.Patient 38
predominantly mutant. #Patient 3 mutation has not been reported in
SNP database.
[0157] The inventors also compared associations between EGFR
mutation status, FISH status, and level of protein expression in
each tumor with patient outcome. EGFR mutations were statistically
significantly associated with FISH+ status (P=0.01), but not with
high protein expression (P=0.10). Gene mutations were statistically
significantly associated with better response (54% versus 5%, mean
difference 47.9%, 95% CI: 22.2 to 73.7, P<0.001) and longer time
to progression (9.9 versus 2.6 months, mean difference 7.3 months,
95% CI: 2.1 to 16.7 months, P=0.02) (Table 7). Patients with EGFR
mutations had better survival, although it was not statistically
significant (median 20.8 versus 8.4 months, mean difference 12.4
months, 95% CI: 1.7 to 26.4 months, P=0.09). However, six of the 15
patients with mutations (40%), five of whom carried point mutations
in exon 21 (patients 1, 2, 3, 16, and 100; Tables 9 and 10) and one
of whom had an exon 19 deletion (patient 41, Tables 9 and 10) had
progressive disease. Among the eight patients with EGFR mutations
responding to the treatment, seven were also FISH+, whereas four of
six progressing patients with mutations were FISH- (disomy, Table
10). Moreover, among the 21 patients with stable disease, only one
presented EGFR mutations.
TABLE-US-00011 TABLE 10 Epidermal growth factor receptor (EGFR) and
phosphorylated (P)-Akt protein levels and outcome for
non-small-cell lung cancer patients presenting EGFR mutation or
gene amplification* Time to Overall EGFR Gene EGFR Gene EGFR
Progression, Survival, Patient Amplification Mutation IHC P-Akt
Response months months 1 - L858R - + PD 2.11 2.11 2 - L858R + - PD
2.18 +5.3 3 - V852I + + PD 4.05 4.05 4 + ND - + PD 2.2 2.73 12 +
none - + SD 5.99 8.32 15 + Exon 19 del + + PR +5.33 +5.33 16 -
L858R + - PD 1.61 3.16 19 + Exon 19 del - + PR 9.18 +18.9 26 -
L858R + + PR 13.6 +26.2 30 - Exon 19 del + + SD 9.87 11.5 31 +
L858R + + PR +17.4 +17.4 37 + none + + PD 2.66 4.05 38 + L858R + +
CR 19.7 20.8 41 - Exon 19 del - + PD 2.89 5.72 51 + ND + + SD 7.7
+8.75 53 + Exon 19 del + + PR +20.7 +20.7 57 - Exon 19 del + + PR
11.3 +12.2 75 + Exon 19 del + + PR 15.6 +30.2 91 + ND + + SD 5.16
8.098 100 - L858R - ND PD 1.55 2.86 101 + ND + + PR 9.05 10.3 102 +
none + + PD 3.22 3.95 *Characteristics of 102 patients with
histologically confirmed non-small-cell lung cancer with
measurable, locally advanced or metastatic disease, progressing or
relapsing after chemotherapy, or medical contraindications for
chemotherapy who were subsequently treated with 250 mg gefitinib
daily. ND: not determined; PD = progressive disease, SD = stable
disease, PR = partial response; CR = complete response. IHC =
immunohistochemistry. EGFR gene amplification+ = Presence of gene
amplification. EGFR gene amplification- = Absence of amplification.
EGFR IHC+ = Positive. EGFR IHC- = Negative. P-Akt+ = Positive.
P-Akt- = Negative. Time to progression and survival+ = Censored
EGFR Multivariable Analysis
[0158] To define which variables were predictive for survival,
those factors that were significant in the univariate analysis
(sex, histology, performance status, FISH, and protein status) were
included in a multivariable model. Mutation and smoking status were
not included because they were not associated with survival (P=0.09
and P=0.20, respectively) in univariate analyses. Poor performance
status (PS 2) remained statistically significantly associated with
increased risk of death (hazard ratio [HR]=3.27, 95% CI=1.49 to
7.17, P=0.003), whereas adenocarcinoma/bronchioloalveolar
histologies (HR=0.58, 95% CI=0.35 to 0.96, P=0.035) and FISH status
(HR=0.44, 95% CI=0.23 to 0.82, P=0.01) were statistically
significantly associated with better survival. Protein status
(HR=0.60, 95% CI=0.36 to 1.01, P=0.056) and sex (HR=1.43, 95%
CI=0.79 to 2.6, P=0.20) were not statistically significantly
associated with survival.
Association Between EGFR and P-Akt
[0159] Evaluation of the P-Akt protein was successful in 98
patients. P-Akt positive status was significantly associated with
better response rate (21% versus 0%, mean difference 20.6%, 95% CI:
11.0 to 30.2, P=0.004), disease control rate (50% versus 22%, mean
difference 28.1%, 95% CI: 9.5 to 46.7, P=0.008), longer time to
progression (4.2 versus 2.1 months, mean difference 2.1 months, 95%
CI: 0.7 to 3.4 months, P=0.01), but not with survival (11.4 versus
9.4 months, mean difference 2.0 months, 95% CI: 1.3 to 5.3 months,
P=0.20). P-Akt positive status was also significantly associated
with EGFR gene gain (FISH+ Pearson r=0.30, P=0.01) and high level
of protein expression (EGFR IHC+Pearson r=0.27, P=0.01), but not
with EGFR mutation (P=0.08).
[0160] Combining FISH and P-Akt data (Table 11), the inventors
observed that double positive patients (EGFR FISH+/P-Akt+) had a
significantly higher response rate (41% versus 3%, mean difference
38.5%, 95% CI: 20.1 to 56.8, P<0.001) and disease control rate
(72% versus 28%, mean difference 44.9%, 95% CI: 26.6 to 65.3,
P<0.001), longer time to progression (9.0 versus 2.5 months,
mean difference 6.5 months, 95% CI: 3.3 to 9.8 months, P<0.001)
and survival (18.7 versus 9.4 months, mean difference 9.3 months,
95% CI: 4.7 to 13.9 months, P=0.04) compared with patients EGFR
FISH- and/or P-Akt- patients. Similar findings were observed when
EGFR immunohistochemistry and mutation data were combined with
P-Akt data. Compared with EGFR- and/or P-Akt- patients, EGFR
IHC+/P-Akt+ patients had a significantly better response rate (29%
versus 4%, mean difference 25.8%, 95% CI: 10.9 to 40.4,
P<0.001), disease control rate (66% versus 23%, mean difference
43.1%, 95% CI: 23.9 to 60.6, P<0.001), longer time to
progression (6.2 versus 2.3, mean difference 3.9 months, 95% CI:
1.5 to 6.3 months, P=0.001), and longer survival (14.9 versus 8.3
months, mean difference 6.6 months, 95% CI: 4.0 to 9.2 months,
P=0.03). EGFR mutation+/P-Akt+ patients had a statistically
significantly better response rate (67% versus 6%, mean difference
61.2%, 95% CI: 34.0 to 88.4, P<0.001), disease control rate (75%
versus 32%, mean difference 43.5%, 95% CI: 16.8 to 70.2, P=0.008),
longer time to progression (11.2 versus 2.6 months, mean difference
8.6 months, 95% CI: 3.3 to 14.0 months, P=0.004), and longer
survival (20.8 versus 9.3 months, mean difference 11.5 months, 95%
CI: 1.1 to 24.2 months, P=0.044) than EGFR mutation- and/or P-Akt-
patients.
TABLE-US-00012 TABLE 11 Association between epidermal growth factor
receptor (EGFR) fluorescence in situ hybridization (FISH),
immunohistochemistry (IHC), and mutation with phosphorylated
(P)-Akt in non-small-cell lung cancer patients* Median Objective
Disease Time to Median 1-year No. of Response, Control Progression,
Survival, Cumulative Markers Patients/% N/% Rate, N/% months months
Survival .+-. SD, % EGFR FISH/P-Akt 98/100 14/14 40/40 4.5 11.5 47
.+-. 6 EGFR FISH+/P-Akt+ 29/30 12/41 21/72 9.0 18.7 33 .+-. 9 EGFR
FISH+/P-Akt- 4/4 0 1/25 1.1 13.8 75 .+-. 22 EGFR FISH-/P-Akt+ 38/39
2/5 12/32 2.6 8.4 38 .+-. 8 EGFR FISH-/P-Akt- 27/28 0 6/22 2.4 6.0
57 .+-. 9 Any Negative 69/70 2/3 19/27 2.5 9.4 37 .+-. 6 P
(Any-versus +/+) <.001.sctn. <.001.dagger-dbl.
<.001.dagger. .041.dagger. .075.dagger. EGFR IHC/P-Akt 98/100
14/14 40/40 3.2 11.3 45 .+-. 6 EGFR IHC+/P-Akt+ 41/42 12/29 27/66
6.2 14.9 29 .+-. 14 EGFR IHC+/P-Akt- 17/17 0 5/29 1.8 9.4 35 .+-.
12 EGFR IHC-/P-Akt+ 26/27 2/8 7/27 2.3 6.4 38 .+-. 10 EGFR
IHC-/P-Akt- 14/14 0 1/7 2.0 4.2 54 .+-. 8 Any negative 57/58 2/3
13/23 2.3 8.3 35 .+-. 7 P (Any-versus +/+) <.001.dagger-dbl.
<.001.dagger-dbl. .001.dagger. .029.dagger. .032.dagger. EGFR
Mutation/P-Akt 85/100 12/14 32/38 2.9 10.1 43 .+-. 5 EGFR
Mutation+/P-Akt+ 12/14 8/67 9/75 11.2 20.8 38 .+-. 10 EGFR
Mutation+/P-Akt- 2/2 0 0 1.1 3.1 40 .+-. 7 EGFR Mutation-/P-Akt+
44/52 4/9 17/39 2.7 8.4 50 .+-. 35 EGFR Mutation-/P-Akt- 27/32 0
6/22 2.4 9.4 65 .+-. 14 Any Negative 73/86 4/5 23/31 2.6 9.3 39
.+-. 6 P (Any-versus +/+) <.001.sctn. .008.sctn. .004.sctn.
.044.dagger. .116.dagger. *Characteristics of 102 patients with
histologically confirmed non-small-cell lung cancer with
measurable, locally advanced or metastatic disease, progressing or
relapsing after chemotherapy, or medical contraindications for
chemotherapy who were subsequently treated with 250 mg gefitinib
daily. .dagger.P values (two-sided) calculated using the log-rank
test. .dagger-dbl.P values (two-sided) calculated using Pearson's
chi-square test. .sctn.P values (two-sided) calculated using
Fisher's exact test.
[0161] Independent of the method of EGFR assessment, patients who
were EGFR positive and P-Akt negative did not respond to gefitinib
treatment (Table 11). The group of patients EGFR IHC+/P-Akt- had a
significantly worse outcome than the group positive for both
proteins, in terms of response rate (0% versus 29%, mean difference
29.3%, 95% CI: 15.3 to 43.2, P=0.012), disease control rate (29%
versus 66%, mean difference 36.5%, 95% CI: 10.4 to 62.5, P=0.011),
and had a not significant tendency toward shorter time to
progression (1.8 versus 6.2 months, mean difference 4.4 months, 95%
CI: 2.3 to 6.4 months, P=0.08) and survival (9.4 versus 14.9
months, mean difference 5.5 months, 95% CI: 1.6 to 9.3 months,
P=0.21). No comparisons were made with EGFR FISH and EGFR mutation
because of the small number of patients (i.e. 4 and 2,
respectively) in the group positive for EGFR and negative for
P-Akt.
[0162] Unfavorable outcomes were also observed in the group of
patients negative for EGFR but positive for P-Akt (Table 11).
Compared with the double positive group, the EGFR FISH-/P-Akt+
group had a statistically significant worse response rate (5%
versus 41%, mean difference 36.1%, 95% CI: 16.8 to 55.4,
P<0.001), disease control rate (32% versus 72%, mean difference
40.8%, 95% CI: 18.9 to 62.8, P=0.001), and time to progression (2.6
versus 9.0 months, mean difference 6.4 months, 95% CI: 3.7 to 9.1
months, P=0.001) and a non-statistically significant shorter
survival (8.4 versus 18.7 months, mean difference 10.3 months, 95%
CI: 7.2 to 13.4 months, P=0.083). Similar findings were observed
when EGFR was evaluated by immunohistochemistry or for mutations.
In both cases, the EGFR-/P-Akt+ group had a statistically
significantly worse response rate (P=0.034 and P<0.001,
respectively, for protein and mutation), disease control rate
(P=0.002 and P=0.025), time to progression (P=0.010 and P=0.009)
and had a non-statistically significant worse survival (P=0.080 and
P=0.070), compared with the double positive group.
Discussion
[0163] In this study, the inventors have shown that EGFR protein
expression was associated to improved response rate, statistically
significant prolonged time to progression and survival. Patients
with low IHC scores (<200) had an outcome as poor as those with
low gene copy numbers or lacking mutations. In addition, in
patients with positive EGFR status by any means, the presence of
Akt phosphorylation was significantly related to better response,
disease control rate, time to progression, and survival. The
results indicate that high EGFR protein expression is an effective
molecular predictive marker for gefitinib sensitivity in patients
with advanced NSCLC.
[0164] The presence of EGFR gene mutations was also related to
better response to gefitinib and time to progression, but the
difference in survival did not reach statistical significance. An
interesting finding was the association between EGFR mutations and
increased gene copy number, a phenomenon that was recently
described in the human lung cancer cell line H3255 (Tracy et al.,
Cancer Res, 2004; 64:7241-44) and that is probably relevant to
gefitinib sensitivity. In fact, among the eight patients with EGFR
mutations who responded to gefitinib therapy, seven were also
FISH+, and among the six non-responding patients with EGFR
mutations, four presented a disomic pattern. This observation
suggests that the impact of genomic gain is critical for EGFR
mutations to predict gefitinib sensitivity.
[0165] Another important finding from these studies was the virtual
absence of EGFR mutations in patients with stable disease. Among
the 21 patients with stable disease who were assessed for EGFR
mutations, only one patient had an EGFR mutation. Stable disease
was defined here as neither sufficient shrinkage to qualify for
partial response, nor sufficient increase to qualify for
progressive disease, as confirmed by two consecutive observations
no less than 4 weeks apart. The small number of mutations in
patients with stable disease is of clinical relevance because data
from the BR.21 trial (Shepherd et al., 2004) show that the survival
benefit of gefitinib is not confined to responding patients. It is
possible that survival improvement in the gefitinib-treated
patients, as a whole, is due to the presence of a group of patients
with an intermediate benefit from the treatment, such as those with
stable disease, who would be excluded from tyrosine kinase
inhibitor treatment if mutation analysis were established as the
test of choice for patient selection. Moreover, although previous
studies suggested that EGFR mutations are present in the vast
majority of responding patients (Lynch et al., 2004; Paiez et al.,
2004; Pao et al., 2004), in this study, the inventors observed that
40% of patients with EGFR mutations had progressive disease. These
results could be explained by the fact that this is the first study
conducted in a large and unselected cohort of gefitinib treated
patients, in whom clinical results are similar to those obtained in
large clinical trials with gefitinib (Fukuoka et al., 2003; Kris et
al., 2003, JAMA).
[0166] In this study, gefitinib sensitivity was associated with
high EGFR protein expression; outcomes in patients with low EGFR
expression scores (<200) were as poor as those in patients with
low gene copy numbers or lacking mutations, which is different from
what has been observed in previous studies (Cappuzzo et al., 2003,
J. Clin. Oncol.; Bailey et al., 2003; Parra et al., 2004).
Differences in staining procedures and guidelines for
interpretation of the EGFR assessment may be the major reason for
the conflicting results across studies. The sampling size and
selection of tissue material for immunohistochemical staining might
also contribute to differences in results across the studies. For
instance, tumors from only 43 and 50 patients were evaluated by
Cappuzzo et al. (Cappuzzo et al., 2003, J. Clin. Oncol.) and Parra
et al. (Parra et al., 2004), respectively. In the retrospective
immunohistochemical analysis of tumor tissue from the IDEAL trials,
less than 40% of the total population of patients were studied
(Bailey et al., 2003), whereas in the present study, more than 90%
of patients had tissue available for immunohistochemical
staining.
[0167] In this study, the inventors also found an association
between activated Akt pathway (e.g. expression of phosphorylated
Akt) and gefitinib sensitivity, an association that has also been
described and discussed by others (Sordella et al., 2004; Cappuzzo
et al., 2004, J. Natl. Cancer Inst.). The combinatorial analysis of
EGFR and P-Akt status indicated that, independent of the method of
EGFR assessment, when EGFR status was positive, the presence of Akt
phosphorylation was significantly related to better response,
disease control rate, time to progression, and survival.
Importantly, better outcome was observed not only when the subset
of EGFR+/P-Akt+ patients was compared with all the other groups
combined but also when this subset was compared with patients EGFR
positive but P-Akt negative. These findings support the hypothesis
that, when the gefitinib target is present but the anti-apoptotic
pathway is not activated, the patient is not sensitive to the
inhibitory effects of gefitinib, as suggested previously (Cappuzzo
et al., 2004, J. Natl. Cancer Inst.) and as demonstrated in
preclinical models (Ono et al., 2004; Bianco et al., 2003). As
expected, the EGFR+/P-Akt+ group also had a significantly better
outcome compared with the EGFR negative and P-Akt positive group,
confirming preclinical data indicating that aberrant,
EGFR-independent Akt activation may lead to gefitinib resistance
(Bianco et al., 2003; Janmaat et all, 2003). These data indicate
that P-Akt positive status is relevant in EGFR-positive patients
for the identification of a subgroup of patients particularly
sensitive to the drug. In EGFR-negative patients, P-Akt positive
status may identify a group of patients with a very low chance of
benefiting from gefitinib treatment.
[0168] Information regarding the relationship between EGFR protein
expression and Akt pathway activation would greatly advance the
understanding of the mechanisms of gefitinib sensitivity. The
inventors compared EGFR protein and P-Akt expression in a subgroup
of patients and, in general, expression of EGFR and P-Akt proteins
was found in the same cell populations (data not shown), indicating
that the observed P-Akt was a result of EGFR activity. However, in
some cases discrepancies were found in the expression (i.e., some
cells expressed EGFR and not P-Akt and vice versa.), which may be
due to biological causes or technical causes.
[0169] In conclusion, results from this study demonstrate that
gefitinib is effective in advanced NSCLC patients with high EGFR
protein expression and combinations of EGFR protein/mutation, EGFR
protein/FISH. IHC represents an ideal test for selecting candidate
NSCLC patients for gefitinib therapy. Because patients who had
either high EGFR expression and P-Akt had a better response,
disease control rate, time to progression, and survival, analysis
of the activating status of the Akt protein is also believed to be
relevant for proper patient selection.
Example 4
[0170] The following example summarizes results of studies
demonstrating the use of HER2 gene amplification and HER2 polysomy
to predict outcome to EGFR inhibitors in NSCLC patients (Italian
cohort).
[0171] In these experiments, HER2 gene copy numbers per cell were
measured by FISH, HER2 protein levels were measured by
immunohistochemistry and mutations in HER2 exon 20 were evaluated
in a cohort of 102 advanced stage NSCLC patients treated with
gefitinib.
Results and Conclusions
[0172] HER2 FISH analysis was completed in 102 patients. Patients
with HER2 high copy number (high polysomy and gene amplification:
HER2 FISH+) represented 22.8% of cases and compared with patients
with no or low gain (HER2 FISH-) had significantly better objective
response (OR: 34.8% versus 6.4%, p=0.001), disease control rate
(DCR: 56.5% versus 33.3%, p=0.04), time to progression (TTP: 9.05
versus 2.7 months, p=0.02) and a trend toward longer survival (OS:
20.8 versus 8.4 months, p=0.056).
[0173] HER2 protein expression was investigated in 72 patients and
5 (7%) patients were positive for high level of HER2 expression. No
significant association was detected with response or survival in
this cohort but the ultimate clinical role of HER2 protein
expression in relation to tyrosine kinase inhibitors needs to be
investigated in a larger study population.
[0174] Exon 20 of the HER2 gene was sequenced in 89 patients and
all were negative for mutations. Therefore, mutations in the
tyrosine kinase domain of the HER2 gene seem to be infrequent and
not clinically relevant.
[0175] In conclusion, this study showed that patients with HER2
FISH+ NSCLC have clinical benefit from the TKI gefitinib treatment,
represented by higher response rate, disease control rate and
longer time to progression.
Example 5
[0176] The following example summarizes results of studies
demonstrating the use of HER2 gene amplification and polysomy
together with EGFR gene amplification and polysomy to predict
outcome to EGFR inhibitors in NSCLC patients) Italian cohort).
[0177] In this study, HER2 FISH pattern analysis was combined with
EGFR FISH pattern analysis, using the methodology previously
described herein.
[0178] Results showed that patients with HER2 FISH+/EGFR FISH+
tumors had a significantly better OR and DCR than patients negative
for both receptors. Patients with high copy number of both genes
(HER2 FISH+/EGFR FISH+) had the highest OR (53.8%) and DCR (76.9%),
and these results were significantly better than those observed in
patients with HER2 FISH- and/or EGFR FISH- tumors (OR: 6.8%,
p<0.001; DCR: 33.0%, p=0.002). The HER2 FISH+/EGFR FISH-
patients had lower OR than double positive patients, although the
difference was not statistically significant (OR: 21.0%, p=0.07).
No difference response was observed between HER2 FISH-/EGFR FISH+
patients and the double negative HER2 FISH-/EGFR FISH- patients
(OR: 10.0% versus 1.6%, p=0.27; DCR: 30.0% versus 25.4%, p=0.71),
although the latter group had a significantly worse outcome when
compared to HER2 FISH+ and/or EGFR FISH+ (OR: 1.6% versus 28.6%,
p<0.001; DCR: 25.4 versus 57.1%, p=0.001). Patients with HER2
FISH+/EGFR FISH+ tumors had a significantly longer time to
progression and overall survival than patients negative for both
receptors. In the double positive HER2 FISH+/EGFR FISH+ patients,
the median TTP and OS were 9.8 and 20.8 months, respectively,
significantly longer than those observed in the HER2 FISH- and/or
EGFR FISH- groups (TTP: 2.6 months, p=0.007; OS: 8.3 months,
p=0.04), and with a non significant trend when compared to the HER2
FISH-/EGFR FISH+ patients (TTP: 5.3 months, p=0.20; OS: 9.3 months,
p=0.13). Patients with HER2 FISH+/EGFR FISH- tumors had the same
poor outcome as the double negative group (TTP: 2.3 versus 2.6
months, p=0.4, OS: 6.0 versus 7.3 months, p=0.4).
Example 6
[0179] The following example summarizes the results of studies
demonstrating the use of HER2 gene amplification and HER2 polysomy
together with detection of EGFR protein levels to predict outcome
to EGFR inhibitors in patients with NSCLC tumors.
[0180] In these studies, HER2 FISH pattern was combined with EGFR
protein expression determined by immunohistochemistry (IHC), using
the methodology described previously herein.
[0181] Patients with HER2 FISH+/EGFR IHC+ tumors had significantly
better OR and DCR than patients negative for both receptors. OR and
DCR were significantly better in double positive HER2 FISH+/EGFR
IHC+ patients when compared to all other groups of patients (OR:
53.8% versus 7.1%, p<0.001; DCR: 76.9 versus 34.5, p=0.004).
Significant difference in OR was observed between double positive
and HER2 FISH-/EGFR IHC+patients (OR: 11.1%, p=0.003). No
difference was found between HER2 FISH+/EGFR IHC- and double
negative HER FISH-/EGFR IHC- patients, in which OR and DCR were
significantly worse than in the other three groups combined (OR: 0%
versus 19.1%, p=0.009; DCR: 13.7% versus 51.5%, p=0.001). Patients
with HER2 FISH+/EGFR IHC+ tumors also had a significantly longer
time to progression and overall survival than patients negative for
both receptors. TTP and survival were significantly longer in
double positive patients (HER FISH+/EGFR IHC+) when compared with
the other three group of patients combined (HER2 FISH- and/or EGFR
IHC-; TTP: 12.3 versus 2.6 months, p=0.006; OS: 20.8 versus 8.4
months, p=0.030) and with a statistically significant longer TTP
and trend toward better survival when compared to patients with
HER2 FISH-/EGFR IHC+ tumors (TTP: 4.2 months, p=0.046; OS: 11.3,
p=0.12). The patients with HER2 FISH+/EGFR IHC- tumors had
similarly poor outcome than the double negative group (TTP: 2.3
versus 2.1 months, p=0.06; OS: 3.3 versus 5.0 months, p=0.39).
Example 7
[0182] The following example summarizes the results of studies
demonstrating the use of HER2 gene amplification and HER2 polysomy
together with detection of mutations in the EGFR gene to predict
outcome to EGFR inhibitors in patients with NSCLC tumors.
[0183] In this example, HER2 FISH pattern was combined with
presence of mutations in the EGFR gene determined by DNA
sequencing, using the methodology described previously herein.
[0184] Patients with HER2 FISH+/EGFR mutation+ tumors had the best
OR and DCR (87.5% for both), which were significantly higher than
in patients HER2 FISH- and/or EGFR mutation- (OR: 5.0%, p<0.001;
DCR: 31.3%, p=0.003). Among the 7 HER2 FISH-/EGFR mutation+
patients, a single patient responded (OR: 14.2%) and a single
patient had disease stabilization (DCR: 28.5%). In the HER2
FISH+/EGFR mutation- group, no patient responded and DCR was 27.2%.
These results were not different than those observed in double
negative HER2 FISH-/EGFR mutation- patients (OR: 4.8%, p=1.0; DCR:
32.2%, p=1.0), in whom OR was significantly worse than in the other
groups combined (OR: 30.8%, p=0.002).
[0185] Patients with HER2 FISH+/EGFR mutation+ tumors had a
significantly longer TTP and OS when compared to other patients
combined (TTP: 15.5 versus 2.6 months, p=0.003; OS: not reached
versus 8.3, p=0.001), but also when compared to patients HER2
FISH-/EGFR mutation+ (TTP: 2.8 months, p=0.004; OS: 5.7, p=0.030).
The group of patients EGFR mutation-/HER2 FISH+ had the worst
outcome in terms of TTP (2.3 months) and OS (6.5 months).
Example 8
[0186] Based on studies combining the Italian study cohort and the
Southwest Oncology Group study 0126 further support of the
predictive role of the individual test as well as combinations of
tests is given:
(1) Support of Increased EGFR Gene Copy Number as Predictive Marker
for Clinical Effect from EGFR Inhibitors in NSCLC Patients
[0187] The University of Colorado Cancer Center has performed
laboratory analysis from two clinical trials. In order to make a
more substantial statistical analysis and power, the inventors have
analyzed the combined data set, which includes altogether 204
patients with NSCLC. One trial from Italy (102 patients), in which
patients with advanced non-small cell lung cancer (NSCLC) have been
treated with gefitinib 250 mg daily after failure of at least one
prior chemotherapy regimen. The other clinical trial is performed
by the Southwest Oncology Group (SWOG) in 136 patients with
bronchioloalveolar carcinoma (BAC) or adenocarcinoma with BAC
features. Tables 12 and 13 show the characterization of the
combined patients and EGFR IHC, EGFR FISH, EGFR mutation,
phosphorylated Akt and KRas status.
TABLE-US-00013 TABLE 12 S0126 Italian Cohort Cohort Total Male 68
(65%) 48 (48%)* 116 (57%) Female 36 (35%) 52 (52%) 88 (43%)
Current/Former 89 (86%) 73 (73%)* 162 (79%) Smokers Never Smoked 15
(14%) 27 (27%) 42 (21%) Performance 91 (87%) 86 (86%) 177 (87%)
Status 0-1 Performance 13 (13%) 14 (14%) 27 (13%) Status 2
Adenocarcinoma 55 (53%) 44 (45%) 99 (49%) BAC 9 (9%) 54 (55%) 63
(31%) Large Cell 2 (2%) 2 (1%) Squamous Cell 26 (25%) 26 (13%)
Undifferentiated 12 (12%) 12 (6%) Stage III Disease 14 (13%) 7 (7%)
21 (11%) Stave IV Disease 90 (87%) 89 (93%) 179 (89%) Overall
Response 13% 17% 15% Disease Control 39% 48% 43% Rate Median Time
to 3 (2-4) 4 (3-6)* 3 (3-4) Progression Median Survival 9 (6-11) 14
(10-18)* 11 (8-14) One-YR Survival 41% (31-51) 55% (45-64) 48%
(41-55) *p < 0.05
TABLE-US-00014 TABLE 13 EGFR EGFR EGFR EGFR EGFR EGFR IHC+ IHC-
FISH+ FISH- M+ M- PAKT+ PAKT- KRAS+ KRAS- Male 68/121 45/79 30/59
77/124 18/43 72/113 72/127 30/57 25/36 58/102 (56%) (57%) (51%)
(62%) (42%) (64%) (57%) (53%) (69%) (57%) Female 53/121 34/79 29/59
47/124 25/43 41/113 55/127 27/57 11/36 44/102 (44%) (43%) (49%)
(38%) (58%) (36%) (43%) (47%) (31%) (43%) Chi Square Chi Square Chi
Square Chi Square Chi Square p-value = 0.915 p-value = 0.149
p-value = 0.014 p-value = 0.608 p-value = 0.185 Current/Former
99/121 59/79 42/59 104/124 30/43 96/114 26/127 12/57 33/36 80/102
Smokers (82%) (75%) (71%) (84%) (70%) (84%) (20%) (21%) (92%) (78%)
Never Smoked 22/121 20/79 17/59 20/124 13/43 18/114 101/127 45/57
3/36 22/102 (18%) (25%) (29%) (16%) (30%) (16%) (80%) (79%) (8%)
(22%) Chi-square Chi-square Chi-square Chi Square Chi Square
p-value = 0.226 p-value = 0.046 p-value = 0.045 p-value = 0.928
p-value = 0.076 Adenocarcinoma 58/120 38/78 31/58 54/124 24/42
58/112 59/126 26/57 21/36 45/101 (48%) (49%) (53%) (44%) (57%)
(52%) (47%) (46%) (58%) (45%) BAC 36/120 27/78 15/58 43/124 13/42
27/112 43/126 19/57 14/36 29/101 (30%) (35%) (26%) (35%) (31%)
(24%) (34%) (33%) (39%) (29%) Large Cell 1/120 1/78 1/58 1/124 0/42
1/112 1/126 1/57 0/36 1/101 (1%) (1%) (2%) (1%) (0%) (1%) (1%) (2%)
(0%) (1%) Squamous Cell 18/120 8/78 9/58 17/124 2/42 19/112 17/126
8/57 1/36 18/101 (15%) (10%) (16%) (14%) (5%) (17%) (13%) (14%)
(3%) (18%) Undifferentiated 7/120 4/78 2/58 9/124 3/42 7/112 6/126
3/57 0/36 8/101 (6%) (5%) (3%) (7%) (7%) (6%) (5%) (5%) (0%) (8%)
Chi-square Chi-square Chi-square Chi Square Chi Square p-value =
0.867 p-value = 0.536 p-value = 0.347 p-value = 0.984 p-value =
0.051
[0188] As shown in Table 14 (see below), in the study 183 patients
had FISH analysis performed, and 52 patients (32%) were EGFR
"FISH-positive" (had high polysomy or gene amplification). The
"overall response" rate was 33% for the FISH-positive group versus
6% for the FISH-negative (disomy, trisomy and low polysomy) group
(p<0.001). The "disease control" rate (objective response+stable
disease) was 65% in the FISH positive group versus 30% in the FISH
negative group (p<0.001). Time to progression (TTP) was in
median 9 months (95% CI 5-10) for the FISH positive group versus 3
months (95% CI 2-3) for the FISH negative group (p<0.001).
Median survival was 18 months (95% CI 14-21) in the FISH positive
group versus 8 months (95% CI 6-11) in the FISH negative group
(p=0.002) and 1 year survival rate was 68% (95% CI 56-80%) in the
FISH positive group versus 37% (95% CI 29-46%) in the FISH negative
group.
[0189] In conclusion this combined data analysis demonstrated
statistically significant better response, disease control, time to
progression and survival for patients with increased EGFR gene copy
number ("FISH-positive") compared to FISH-negative patients. These
analyses which now include 183 patients support the individual
results from the Italian study cohort (Cappuzzo et al., 2005 JNCI)
and the Southwest Oncology Group Study (Hirsch et al., JCO in press
2005).
(2) Support of EGFR Protein Expression Detected by
Immunohistochemistry as a Predictive Marker for Clinical Effect of
EGFR Inhibitors in NSCLC Patients.
[0190] As shown in Table 14, EGFR protein expression was measured
in 203 patients by immunohistochemistry. EGFR protein was
considered positive in 121 patients (61%). The overall response in
the EGFR-positive patients was 22% versus 5% in the EGFR-negative
group (p=0.002) and disease control rate was 56% versus 27%
(p<0.001). Time to progression was 5 months (95% CI 3-7) versus
3 months for the EGFR negative patients (p=0.006), and median
survival was 14 months (95% CI 11-21) versus 7 months (5-10)
(p=0.003). One year survival rates were 56% (95% CI 47-65%) for the
EGFR positive group versus 37% (26-48%) for the EGFR negative
group.
[0191] In conclusion, EGFR protein expression determined by
immunohistochemistry predicted significant better response, disease
control rate, median survival and 1-year survival after treatment
with EGFR inhibitor compared to the EGFR-negative group of
patients.
TABLE-US-00015 TABLE 14 No. pts OR DC TTP MS 1-yr OS FISH+ 59 (32%)
33% 65% 9 (5-10) 18 (14-21) 68% (56%-80%) FISH- 124 (68%) 6% 30% 3
(2-3) 8 (6-11) 37% (29%-46%) p-value <0.001 p-value <0.001
p-value <0.001 p-value = 0.002 IHC+ 121 (61%) 22% 56% 5 (3-7) 14
(11-21) 56% (47%-65%) IHC- 79 (40%) 5% 27% 3 (2-3) 7 (5-10) 37%
(26%-48%) p-value = 0.002 p-value <0.001 p-value = 0.006 p-value
= 0.003 EGFR Mutation+ 43 (28%) 39% 52% 3 (2-11) 13 (6-21) 52%
(37%-68%) EGFR Mutation- 113 (72%) 7% 37% 3 (2-4) 11 (7-13) 46%
(37%-55%) p-value <0.001 p-value = 0.151 p-value = 0.180 p-value
= 0.210 P-AKT+ 127 (69%) 20% 49% 4 (3-5) 13 (10-16) 52% (43%-61%)
P-AKT- 57 (31%) 2% 33% 3 (2-5) 8 (6-14) 41% (28%-54%) p-value =
0.005 p-value = 0.10 p-value = 0.09 p-value = 0.34 KRAS Mutation+
36 (26%) 7% 39% 3 (2-4) 11 (6-23) 49% (33%-66%) KRAS Mutation- 102
(74%) 19% 40% 3 (2-4) 12 (8-15) 50% (40%-60%) p-value = 0.237
p-value = 0.99 p-value = 0.890 p-value = 0.890
(3) Combination of EGFR Protein Assessment by Immunohistochemistry
and EGFR Gene Copy Number by FISH Strongly Predict Good Outcome
after EGFR Inhibitor Therapy, and Patients with "Negative" Results
for Both EGFR Protein and EGFR Gene Copy Number by FISH can be Used
to Select Lung Cancer Patients Who Will not have any Clinical
Benefit from EGFR Inhibitors in NSCLC Patients
[0192] From the combined data analysis came two clear results:
[0193] As shown in Table 15, among 42 patients who were both "EGFR
FISH-positive" and "EGFR IHC-positive", the response rate was high,
41%, and 76% had disease control. The time to progression for the
"double positive" group of patients was 9 months (95% CI 6-16
months), median survival was 21 months (95% CI 15-21) and 1-year
survival was 77% (95% CI 63-90). In contrast, the corresponding
values for the "double negative" group of patients (patients with
"EGFR FISH negative" and "EGFR IHC-negative") was response rate of
2%, disease control rate of 17%, time to progression was 2 months,
median survival was 6 months and 1-year survival was 30%. There was
statistical significance difference (p<0.001) in all
parameters.
TABLE-US-00016 TABLE 15 Combined FISH and IHC results (n = 179
patients) No. pts RSP DCR TTP (mo) MS (mo) 1-yr FISH+/IHC+ 42 41%
76% 9 (6-16) 21 (15-21) 77% (63-90) p-value* <0.001 p-value*
<0.001 p-value* <0.001 p-value* <0.001 FISH+ or IHC+ 83
10% 43% 3 (2-5) 11 (7-15) 44% (33-55) FISH-/IHC- 54 2% 17% 2 (2-3)
6 (4-8) 30% (18-43) *p-value of FISH+/IHC+ versus other two
groups
[0194] In conclusion, lung cancer patients, whose tumors strongly
express both EGFR protein (detected by immunohistochemistry) and
increased EGFR gene copy number (detected by FISH) have a high
response rate, disease control rate and significantly prolonged
survival after EGFR inhibitor therapy compared to patients with
"double negative" assessments.
[0195] Patients with NSCLC, who tested "double negative" (no/low
EGFR protein overexpression and no/low gain of the EGFR gene) will
most likely not benefit from EGFR inhibitor therapy and should not
be offered this therapy.
[0196] Thus, the combination of EGFR FISH- and IHC assay should be
used to select NSCLC patients who will benefit and those without
any expected clinical benefit from EGFR therapy.
(4) Combination of EGFR Mutation and EGFR Protein Expression
[0197] As shown in Table 16, among 28 patients with positive test
both for EGFR mutation and EGFR protein expression the response
rate for the patients with double positive test was 50%, disease
control rate was 60%, time to progression was 10 months, median
survival was 21 months and 1-year survival was 63%. Corresponding
values for patients with double negative test was 12%, 25%, 2
months, 7 months and 37%.
TABLE-US-00017 TABLE 16 Combined EGFR mutation and IHC results (n =
152 patients) No. pts RSP DCR TTP (mo) MS (mo) 1-yr EGFR+/IHC+ 28
50% 60% 10 (2-16) 21 (10-21) 63% (45-81) p-value* <0.001
p-value* = 0.086 p-value* = 0.04 p-value* = 0.06 EGFR+ or IHC+ 77
12% 47% 3 (2-5) 12 (8-15) 50% (39-61) EGFR-/IHC- 47 2% 25% 2 (2-3)
7 (5-12) 37% (23-51) *p-value of EGFR+/IHC+ versus other two
groups
[0198] In conclusion, combination of EGFR mutation and EGFR protein
expression can be used to select lung cancer patients, who will
benefit from those, who most likely will not benefit from EGFR
inhibitor therapy.
(5) Combination of EGFR Protein Expression and Activated
(Phosphorylated) AKT Protein Expression as Predictor for Outcome to
EGFR Inhibitors in NSCLC Patients
[0199] As shown in Table 17, one hundred and eighty-two patients
had a positive test for EGFR protein expression (detected by IHC)
and phosphorylated AKT expression (detected by IHC). Double
positive test was found in 78 patients, and they had a response
rate of 30%, disease control rate of 64%, time to progression 6
months, median survival 16 months and 1-year survival 63%.
TABLE-US-00018 TABLE 17 Combined P-AKT and IHC results (n = 182
patients) No. pts RSP DCR TTP (mo) MS (mo) 1-yr P-AKT+/IHC+ 78 30%
64% 6 (4-10) 16 (12-21) 63% (51-74) p-value* <0.001 p-value* =
0.003 p-value* <0.001 p-value* = 0.004 P-AKT+ or IHC+ 84 6% 34%
3 (2-3) 8 (6-14) 43% (32-54) P-AKT-/IHC- 23 0% 21% 2 (2-4) 6 (5-9)
30% (12-49) *p-value of P-AKT+/IHC+ versus other two groups
[0200] In contrast, among the 23 patients with double negative test
none had objective response, 21% had disease control, time to
progression was 2 months, median survival was 6 months and 1-year
survival was 30%. In all the mentioned clinical outcome parameters
was there a statistical difference (p<0.05) between the double
positive group and the double negative group.
[0201] In conclusion, combination of EGFR protein expression
detected by IHC and phosphorylated AKT detected by IHC can be used
to select lung cancer patients, who will most likely have clinical
benefit from EGFR inhibitor therapy, and those patients, who most
likely will not have any clinical benefit from such a
treatment.
(6) Combination of Increased Gene Copy Number Detected by FISH and
EGFR Mutations as Predictor for Outcome to EGFR Inhibitors in NSCLC
Patients.
[0202] As shown in Table 18, altogether 143 patients were studied
both for EGFR gene copy number and EGFR mutations.
TABLE-US-00019 TABLE 18 Combined FISH and EGFR mutation results (n
= 143 patients) No. pts RSP DCR TTP (mo) MS (mo) 1-yr FISH+/ 17 69%
69% 16 (3-20) NR 67% (71-100) EGFR+ p-value* <0.001 p-value* =
0.031 p-value* = 0.004 p-value* = 0.003 FISH+ or 46 15% 45% 3 (2-5)
10 (5-14) 45% (30-59) EGFR+ FISH-/EGFR- 80 3% 29% 3 (2-3) 10 (6-13)
42% (31-53) *p-value of FISH+/EGFR+ versus other two groups
[0203] Among the 17 patients, who had double positive tests, the
response rate was 69%, disease control rate was 69%, time to
progression was 16 months, median survival was not yet achieved,
but exceeding 20 months, and 1-year survival was 67%. All these
parameters were statistical significantly better than the out come
for the patients with the double negative tests. They had response
rate of 3%, disease control rate of 29%, time to progression 3
month, median survival 10 months and 1-year survival 42%.
[0204] In conclusion, the combination of increased EGFR gene copy
number detected by FISH and EGFR mutations can be used to select
the patients, who will have clinical benefit from EGFR inhibitor
therapy.
(7) Combination of Increased EGFR Gene Copy Number, EGFR Protein
Expression and EGFR Mutation Predicts Superior Clinical Outcome to
EGFR Inhibitor Therapy in NSCLC Patients.
[0205] As shown in Table 19, the combined data analysis from the
Italian cohort and the Southwest Oncology Group study cohort
demonstrated that among 12 patients, who had triple positive tests
had very high response rate of 78%, disease control rate of 78%,
time to progression of 20 months, median survival, which was not
yet achieved but exceeding 20 months, and 1-year survival of
100%.
TABLE-US-00020 TABLE 19 FISH IHC EGFR Mut n OR DCR TTP OS 1-yr surv
+ + + 12 78% 78% 20 (11-20) NR 100% + + - 20 22% 61% 5 (3-12) 15
(6-16) 64% (42-86) + - + 5 50% 50% 3 (2-9) NR 60% (17-100) - + + 12
22% 44% 4 (2-7) 11 (3-11) 42% (1470) + - - 8 0% 39% 2 (1-6) 9 (1-9)
38% (7-66) - + - 39 3% 41% 3 (2-5) 11 (8-18) 49% (33-64) - - + 6 0%
0% 2 (1-2) 3 (1-3) 0% (0-30) - - - 37 3% 21% 2 (2-3) 6 (4-12) 37%
(21-52)
[0206] In conclusion, combination of increased EGFR gene copy
number detected by FISH, EGFR protein expression detected by IHC
and EGFR mutations can be used to select patients, who will have
good clinical outcome after EGFR inhibitor therapy.
(8) Combination of EGFR Gene Copy Number, EGFR Protein Expression
and Phosphorolated AKT Expression Predicts Superior Clinical
Outcome after EGFR Inhibitor Therapy of NSCLC Patients.
[0207] As shown in Table 20, in the combined data analysis from the
Italian cohort and the Southwest Oncology Group Study cohort we
demonstrated that the patients with triple positive tests had a
high response rate of 43%, disease control rate of 80%, time to
progression of 12 months, median survival not achieved yet, but
exceeding 20 months and 1-year survival of 84%.
TABLE-US-00021 TABLE 20 FISH IHC P-AKT N OR DCR TTP OS 1-yr surv +
+ + 34 43% 80% 12 (6-19) NR 84% (70-97) + + - 4 0% 67% 9 (2-9) 18
(5-18) 75% (33-100) + - + 15 15% 46% 3 (2-6) 14 (3-19) 53% (28-79)
- + + 35 13% 47% 4 (2-6) 11 (6-15) 43% (26-59) + - - 2 0% 0% 2 (NA)
9 (NA) 0% (0-69) - + - 23 6% 50% 4 (2-7) 9 (7-9) 47% (27-68) - - +
32 4% 18% 2 (2-3) 6 (4-10) 29% (13-44) - - - 17 0% 14% 2 (2-5) 6
(4-12) 29% (8-51)
(9) Multivariable Analysis Demonstrates that Both Increased EGFR
Gene Copy Number and Increased EGFR Protein Expression are
Independent Prognostic/Predictive Factors for Survival Outcome in
NSCLC Patients Treated with EGFR Inhibitors:
[0208] Multivariable analysis including data from the Italian study
cohort and the Southwest Oncology Group clinical trial 0126
demonstrated that both increased EGFR gene copy number detected by
FISH and increased EGFR protein expression detected by IHC were
independent prognostic/predictive factors for survival (Table 21).
The multivariable analysis is based on an initial univariable
analysis including clinical- and biological markers by using
backward stepwise regression methods. All univariately significant
covariates were included in the stepwise selection.
TABLE-US-00022 TABLE 21 Multivariabel analysis of
predictive/prognostic factors in 179 NSCLC patients treated with
gefitinib. VARIABLE No. patients HR p-value Current/Former 142 2.68
0.0005 smokers Performance status 2 24 3.64 0.0001 FISH- 120 1.87
0.006 IHC- 71 1.70 0.007
[0209] In conclusion, each of the markers: EGFR gene copy number
detected by FISH, EGFR protein expression detected by IHC and
expression of activated (phosphorylated) AKT, HER2 gene copy number
and EGFR mutation analysis can be used for the selection of lung
cancer patients, who will have a good clinical outcome after EGFR
inhibitor therapy. The combined data analysis performed based on
the two studies showed that combinations of tests gives a very high
prediction of which patients will benefit from EGFR inhibitors and
who will not. The combination of the analysis of EGFR gene copy
number by FISH and EGFR protein expression by IHC demonstrated a
very strong prediction for increased response, increased time to
progression and significantly prolonged survival (median 21 months)
compared to the results from unselected patients. The data showed
also that patients with no or low EGFR gene copy number (FISH
negative) and no or low EGFR protein expression did not benefit
from EGFR inhibitor therapy as there were no responders and only
one patients classified as having stable disease. However, the time
to progression was very short and median survival in this group was
6 months. The group of patients with "double negative" tests had a
similar outcome as the placebo treated patients in the Canadian
study, BR-21, in which a similar group of advanced NSCLC patients,
who had previously failed on at least one previous chemotherapy
regimen were randomized to placebo or erlotinib (Tsao et al., JCO
23:16 S:622S #7007). Thus, a combination of two established
clinical applicable tests (FISH and IHC), are in the inventors'
studies demonstrated to be of significant value for selection of
cancer patients to EGFR inhibitors.
Example 9
[0210] The following example demonstrates that EGFR and HER2 gene
copy numbers detected by FISH are associated with sensitivity to
Cetuximab (C225, Erbitux.TM., BMS/Imclone) in NSCLC cell lines.
[0211] Studies performed in 25 NSCLC cell lines showed that 5 lines
were sensitive to Cetuximab (IC.sub.50<1 uM) and 20 lines were
resistant (IC50>1 uM). All five sensitive cell lines, namely
H827, H3255, H358, H2279 and Calu 3, displayed EGFR and/or HER2
gene amplification by FISH. Conversely, among the 20 NSCLC lines
which were resistant to Cetuximab, none had EGFR or HER gene
amplification and only 6 had high polysomy for EGFR and/or HER2.
The distribution of NSCLC lines with high level of genomic gain and
no/low level of genomic gain was significantly different between
the Cetuximab sensitive and Cetuximab resistant lines (chi-square
10.84, p<0.001). These results support the conclusion that copy
number status of the EGFR and HER2 genes is a predictor of
sensitivity to antibody therapy.
[0212] Each reference cited herein is incorporated by reference in
its entirety. U.S. Provisional Patent Application Ser. No.
60/575,789, filed May 27, 2004, is specifically incorporated herein
by reference in its entirety.
REFERENCES
[0213] Arteaga, Sem Oncol 2002; 29:3-9. [0214] Andrecheck et al.
Proc Natl Acad Sc USA 2000; 97:3444-49. [0215] Armitage and Berry,
Statistical Methods in Medical Research. Blackwell Scientific
Publication Limited, Oxford, 1994. [0216] Bailey et al., Lung
Cancer 2003; 41:s71 (abstr). [0217] Barsky et al., Cancer 73:
1163-1170, 1994 [0218] Bartlett et al., J Pathol 2003; 199:411-7.
[0219] Baselga et al., J Clin Oncol. 2002; 20:4292-302. [0220]
Bianco et al., Oncogene 2003; 22:2812-22 [0221] Breathnach et al.,
Cancer 86: 1165-1173, 1999 [0222] Cappuzzo et al., J Clin Oncol
2003; 21:2658-63. [0223] Cappuzzo et al., Proc Am Soc Clin Oncol
2004; 23:3004. [0224] Cappuzzo et al., Natl Cancer Inst 2004;
96:1133-41. [0225] Cappuzzo et al., J Natl Cancer Inst, in press.
[0226] Ciardello and Tortora, Clin Cancer Res 2001; 7:2958-70.
[0227] Ciardiello et al., Clin Cancer Res 2000; 6:2053-63. [0228]
Cox, J R Stat Soc B 1972; 34:187-220. [0229] Datta S R, Genes and
Development 1999; 13:2905-27. [0230] Demetri et al., N Engl J Med
2002; 347:472-80. [0231] Druker et al., N Engl J Med 2001;
344:1031-7. [0232] Frederick et al., Cancer Res 2000; 60, 1383-87.
[0233] Fukuoka et al., J Clin Oncol. 2003; 21:2237-46. [0234] Furak
et al., European J Cardio-Thoracic Surgery 23:818-823, 2003. [0235]
Gandara et al., Clin Cancer Res 10: 4205-4209, 2004. [0236]
Giaccone et al., J Clin Oncol 2004; 22:777-84 [0237] Herbst et al.,
J Clin Oncol. 2002; 20:3815-25. [0238] Herbst et al., Proc Am Soc
Clin Oncol 23; 617, 2004. [0239] Hidalgo et al., J Clin Oncol.
2001; 19:3267-79. [0240] Hirsch et al., Lung Cancer 2003; 41 Suppl
1:S29-42. [0241] Hirsch et al., Br J Cancer 86: 1449-1456, 2002
[0242] Hirsch et al., J Clin Oncol 2003; 21:3798-807. [0243] Hirsch
et al., Lung Cancer 2003; 41 Suppl 1:S29-42. [0244] Janmaat et al.,
Clin Cancer Res 2003; 9:2316-26. [0245] Kaplan and Meier, J Am Stat
Assoc 1985; 53:457-81. [0246] Kelly et al., J Clin Oncol. 2001;
19:3210-8. [0247] Kris et al., JAMA 2003; 290:2149-58. [0248] Kris
et al., Lung Cancer 2000; Suppl 1; 29:233 abstract. [0249] Levitt
and Koty, Investig New Drugs 1999; 7:213-26. [0250] Levitzki and
Gazit, Science 1995; 267:1782-8. [0251] Lynch et al., N Engl J Med
2004; 350:2129-39 [0252] Mantel N, Cancer Chemother Rep 50:163-170,
1966. [0253] Miller et al., J Clin Oncol. 2004; 22:1103-9. [0254]
Miller et al., Proc Am Soc Clin Oncol 2003; 22 (abstract 2491).
[0255] Non-small cell Lung Cancer Collaborative Group. BMJ 1995;
311:899-909. [0256] Oken et al., Am J Clin Oncol 1982; 5:649-655.
[0257] Ono et al., Mol Cancer Ther 2004; 3:465-72 [0258] Paez et
al., Science 2004; 304:1497-1500. [0259] Pao et al., PNAS 2004;
101: 13306-11. [0260] Parkin, Lancet Oncology 2001, 2:533-43.
[0261] Parra et al., Brit J Cancer, 91: 208-212, 2004. [0262] Patel
et al., Lung Cancer 41: S56, 2003 (suppl 2). [0263] Perez-Soler et
al., J Clin Oncol 2004; 22:3238-47. [0264] Perez-Soler et al.,
Proc. Am. Soc. Clin. Oncol., 20: 310a 2001. [0265] Ranson et al., J
Clin Oncol. 2002; 20:2240-50. [0266] Reissmann et al., J Cancer Res
Clin Oncol 1999; 125:61-70. [0267] Rosell et al., Clin Cancer Res
2004; 10:1318-25. [0268] Salomon et al., Crit Rev Oncol Hematol
1995; 19:183-232. [0269] Salomon et al., Signal 2001; 2:4-11.
[0270] Schiller et al., N Engl J Med 2002; 346:92-8. [0271]
Shepherd et al., Proc Am Soc Clin Oncol 2004; 23 (abstract). [0272]
Slamon et al., N Engl J Med 2001; 344:783-92. [0273] Slamon et al.,
Science 235:177-182, 1987. [0274] Sordella et al., Science 2004;
305:1163-7 [0275] Therasse, J Nat Cancer Inst 2000; 92:205-16.
[0276] Tracy et al., Cancer Res 2004; 64:7241-44. [0277] Travis et
al., Histological typing of lung and pleural tumors. Third edition,
Berlin: Springer, 1999. [0278] Vogel et al., J Clin Oncol 2002;
20:719-26. [0279] West et al., Advanced bronchioloalveolar
carcinoma: a phase II trial of paclitaxel by 96-h infusion (SWOG
9714): a Southwest Oncology Group study. Ann Oncol, in press
[0280] While various embodiments of the present invention have been
described in detail, it is apparent that modifications and
adaptations of those embodiments will occur to those skilled in the
art. It is to be expressly understood, however, that such
modifications and adaptations are within the scope of the present
invention, as set forth in the following claims.
Sequence CWU 1
1
24119DNAHomo sapiens 1tccgtctctt gccgggaat 19220DNAHomo sapiens
2ggctcaccct ccagaacctt 20321DNAHomo sapiens 3acgcattccc tgcctcggct
g 21418PRTHomo sapiens 4Lys Ile Pro Val Ala Ile Lys Glu Leu Arg Glu
Ala Thr Ser Pro Lys1 5 10 15Ala Asn554DNAHomo sapiens 5aaaattcccg
tcgctatcaa ggaattaaga gaagcaacat ctccgaaagc caac 54636DNAHomo
sapiens 6aaaattcccg tcgctatcaa gtctccgaaa gccaac 36739DNAHomo
sapiens 7aaaattcccg tcgctatcaa aacatctccg aaagccaac 39839DNAHomo
sapiens 8aaaattcccg tcgctatcaa ggaatctccg aaagccaac 39939DNAHomo
sapiens 9aaaattcccg tcgctatcaa gacatctccg aaagccaac 391014PRTHomo
sapiens 10His Val Lys Ile Thr Asp Phe Gly Leu Ala Lys Leu Leu Gly1
5 101142DNAHomo sapiens 11catgtcaaga tcacagattt tgggctggcc
aaactgctgg gt 421214PRTHomo sapiens 12His Val Lys Ile Thr Asp Phe
Gly Arg Ala Lys Leu Leu Gly1 5 101342DNAHomo sapiens 13catgtcaaga
tcacagattt tgggcgggcc aaactgctgg gt 421414PRTHomo sapiens 14His Ile
Lys Ile Thr Asp Phe Gly Leu Ala Lys Leu Leu Gly1 5 101542DNAHomo
sapiens 15catatcaaga tcacagattt tgggctggcc aaactgctgg gt
421623DNAHomo sapiens 16gacccttgtc tctgtgttct tgt 231723DNAHomo
sapiens 17tatacagctt gcaaggactc tgg 231820DNAHomo sapiens
18ccagaccatg agaggccctg 201923DNAHomo sapiens 19cacaattgcc
agttaacgtc ttc 232020DNAHomo sapiens 20agggtctaga gcagagcagc
202119DNAHomo sapiens 21gcctgaggtt cagagccat 192222DNAHomo sapiens
22catgatgatc tgtccctcac ag 222320DNAHomo sapiens 23ctggtccctg
gtgtcaggaa 202421DNAHomo sapiens 24gctggctgac ctaaagccac c 21
* * * * *