U.S. patent application number 11/690762 was filed with the patent office on 2008-03-27 for antibacterial amide macrocycles iv.
Invention is credited to Yolanda Cancho-Grande, Kerstin Ehlert, Rainer Endermann, Christoph Freiberg, Martin Michels, Siegfried Raddatz, Joachim Schuhmacher, Stefan Weigand.
Application Number | 20080076745 11/690762 |
Document ID | / |
Family ID | 35058296 |
Filed Date | 2008-03-27 |
United States Patent
Application |
20080076745 |
Kind Code |
A1 |
Endermann; Rainer ; et
al. |
March 27, 2008 |
ANTIBACTERIAL AMIDE MACROCYCLES IV
Abstract
The invention relates to antibacterial amide macrocycles and
processes for their preparation, their use for the treatment and/or
prophylaxis of diseases and their use for the manufacture of
medicaments for the treatment and/or prophylaxis of diseases,
especially bacterial infections.
Inventors: |
Endermann; Rainer;
(Wuppertal, DE) ; Ehlert; Kerstin; (Velbert,
DE) ; Freiberg; Christoph; (Wuppertal, DE) ;
Raddatz; Siegfried; (Koeln, DE) ; Michels;
Martin; (Koeln, DE) ; Cancho-Grande; Yolanda;
(Leverkusen, DE) ; Schuhmacher; Joachim;
(Wuppertal, DE) ; Weigand; Stefan; (Penzberg,
DE) |
Correspondence
Address: |
MORRISON & FOERSTER LLP
12531 HIGH BLUFF DRIVE
SUITE 100
SAN DIEGO
CA
92130-2040
US
|
Family ID: |
35058296 |
Appl. No.: |
11/690762 |
Filed: |
March 23, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/EP05/09912 |
Sep 15, 2005 |
|
|
|
11690762 |
Mar 23, 2007 |
|
|
|
Current U.S.
Class: |
514/183 ;
540/460 |
Current CPC
Class: |
C07K 5/0812 20130101;
C07K 7/06 20130101; Y02A 50/475 20180101; A61P 31/04 20180101; Y02A
50/481 20180101; C07K 5/1016 20130101; Y02A 50/30 20180101; A61K
38/00 20130101 |
Class at
Publication: |
514/183 ;
540/460 |
International
Class: |
C07D 245/04 20060101
C07D245/04; A61K 31/395 20060101 A61K031/395; A61P 31/04 20060101
A61P031/04 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 24, 2004 |
DE |
102004046307.7 |
Mar 30, 2005 |
DE |
102005014240.0 |
Claims
1. A compound of formula ##STR441## in which R.sup.7 represents a
group of formula ##STR442## whereby R.sup.1 is hydrogen or hydroxy,
* is the linkage site to the carbon atom, R.sup.2 represents
hydrogen, methyl or ethyl, R.sup.3 represents a group of formula
##STR443## whereby * is the linkage site to the nitrogen atom, A
represents a bond or phenyl, R.sup.4 represents hydrogen, amino or
hydroxy, R.sup.5 represents a group of formula ##STR444## wherein *
is the linkage site to the carbon atom, R.sup.23 represents
hydrogen or a group of formula *--(CH.sub.2).sub.n--OH or
*--(CH.sub.2).sub.o--NH.sub.2, wherein * is the linkage site to the
carbon atom, n and o independently of one another are a number 1,
2, 3 or 4, m is a number 0 or 1, R.sup.8 and R.sup.12 independently
of one another represent a group of formula *--CONHR.sup.14 or
*--CH.sub.2CONHR.sup.15, wherein * is the linkage site to the
carbon atom, R.sup.14 and R.sup.15 independently of one another
represent a group of formula ##STR445## wherein * is the linkage
site to the nitrogen atom, R.sup.4a represents hydrogen, amino or
hydroxy, R.sup.5a represents hydrogen, methyl or aminoethyl,
R.sup.6a represents hydrogen or aminoethyl, or R.sup.5a and
R.sup.6a together with the nitrogen atom to which they are bonded
form a piperazine ring, R.sup.8a and R.sup.12a independently of one
another represent *--(CH.sub.2).sub.Z1a--OH,
*--(CH.sub.2).sub.Z2a--NHR.sup.13a, *--CONHR.sup.14a or
*--CH.sub.2CONHR.sup.15a, wherein * is the linkage site to the
carbon atom, Z1a and Z2a independently of one another are a number
1, 2 or 3, R.sup.13a represents hydrogen or methyl, and R.sup.4a
and R.sup.15a independently of one another represent a group of
formula ##STR446## in which * is the linkage site to the nitrogen
atom, R.sup.4c represents hydrogen, amino or hydroxy, R.sup.5c
represents hydrogen, methyl or aminoethyl, R.sup.6c represents
hydrogen or aminoethyl, kc is a number 0 or 1, and lc is a number
1, 2, 3 or 4, R.sup.9a and R.sup.11a independently of one another
represent hydrogen or methyl, R.sup.10a represents amino or
hydroxy, R.sup.16a represents a group of formula ##STR447## wherein
* is the linkage site to the nitrogen atom, R.sup.d represents
hydrogen, amino or hydroxy, R.sup.5d represents hydrogen, methyl or
aminoethyl, R.sup.6d represents hydrogen or aminoethyl, kd is a
number 0 or 1, and ld is a number 1, 2, 3 or 4, ka is a number 0 or
1, and la, wa, xa and ya independently of one another are a number
1, 2, 3 or 4, R.sup.9 and R.sup.11 independently of one another
represent hydrogen, methyl, *--C(NH.sub.2).dbd.NH or a group of
formula ##STR448## wherein * is the linkage site to the nitrogen
atom, R.sup.20 represents hydrogen or
*--(CH.sub.2).sub.i--NHR.sup.22, wherein R.sup.22 represents
hydrogen or methyl, and i is a number 1, 2 or 3, R.sup.21
represents hydrogen or methyl, f is a number 0, 1, 2 or 3, g is a
number 1, 2 or 3, and h is a number 1, 2, 3 or 4, or R.sup.8
represents *--(CH.sub.2).sub.Z1--OH, wherein * is the linkage site
to the carbon atom, Z1 is a number 1, 2 or 3, and R.sup.9
represents a group of formula ##STR449## wherein * is the linkage
site to the nitrogen atom, and h is a number 1, 2, 3 or 4, R.sup.10
represents amino or hydroxy, R.sup.16 and R.sup.17 independently of
one another represent a group of formula ##STR450## wherein * is
the linkage site to the nitrogen atom, R.sup.4b represents
hydrogen, amino or hydroxy, R.sup.5b represents hydrogen, methyl or
aminoethyl, R.sup.6b represents hydrogen or aminoethyl, or R.sup.5b
and R.sup.6b together with the nitrogen atom to which they are
bonded form a piperazine ring, R.sup.8b and R.sup.12b independently
of one another represent *--(CH.sub.2).sub.Z1b--OH,
*--(CH.sub.2).sub.Z2b--NHR.sup.13b, *--CONHR.sup.14b or
*--CH.sub.2CONHR.sup.15b, wherein * is the linkage site to the
carbon atom, R.sup.3b represents hydrogen or methyl, and Z1b and
Z2b independently of one another are a number 1, 2 or 3, and
R.sup.14b and R.sup.15b independently of one another represent a
group of formula ##STR451## wherein * is the linkage site to the
nitrogen atom, R.sup.4g represents hydrogen, amino or hydroxy,
R.sup.5g represents hydrogen, methyl or aminoethyl, R.sup.6g
represents hydrogen or aminoethyl, kg is a number 0 or 1, and lg is
a number 1, 2, 3 or 4, R.sup.9b and R.sup.11b independently of one
another represent hydrogen or methyl, R.sup.10b represents amino or
hydroxy, kb is a number 0 or 1, lb, wb, xb and yb independently of
one another are a number 1, 2, 3 or 4, R.sup.18 and R.sup.19
independently of one another represent hydrogen or a group of
formula ##STR452## wherein * is the linkage site to the nitrogen
atom, R.sup.4e represents hydrogen, amino or hydroxy, R.sup.5e
represents hydrogen, methyl or aminoethyl, R.sup.6e represents
hydrogen or aminoethyl, or R.sup.5e and R.sup.6e together with the
nitrogen atom to which they are bonded form a piperazine ring,
R.sup.8e and R.sup.12e independently of one another represent
*--(CH.sub.2).sub.Z1e--OH or *--(CH.sub.2).sub.Z2e--NHR.sup.13e,
wherein * is the linkage site to the carbon atom, R.sup.13e
represents hydrogen or methyl, and Z1e and Z2e independently of one
another are a number 1, 2 or 3, R.sup.9e and R.sup.11e
independently of one another represent hydrogen or methyl,
R.sup.10c represents amino or hydroxy, ke is a number 0 or 1, and
le, we, xe and ye independently of one another are a number 1, 2, 3
or 4, whereby R.sup.18 and R.sup.19 are not simultaneously
hydrogen, R.sup.24 represents a group of formula *--CONHR.sup.25,
wherein * is the linkage site to the carbon atom, R.sup.25
represents a group of formula ##STR453## wherein * is the point of
linkage to the nitrogen atom, R.sup.4f represents hydrogen, amino
or hydroxy, R.sup.5f represents hydrogen, methyl or aminoethyl,
R.sup.6f represents hydrogen or aminoethyl, or R.sup.5f and
R.sup.6f together with the nitrogen atom to which they are bonded
form a piperazine ring, R.sup.8f and R.sup.12f independently of one
another represent *--(CH.sub.2).sub.Z1f--OH or
*--(CH.sub.2).sub.Z2f--NHR.sup.13f, wherein * is the linkage site
to the carbon atom, R.sup.3f represents hydrogen or methyl, and Z1f
and Z2f independently of one another are a number 1, 2 or 3,
R.sup.9f and R.sup.11f independently of one another represent
hydrogen or methyl, R.sup.10f represents amino or hydroxy, kf is a
number 0 or 1, and lf, wf, xf and yf independently of one another
are a number 1, 2, 3 or 4, d and e independently of one another are
a number 1, 2 or 3, k is a number 0 or 1, l, w, x and y
independently of one another are a number 1, 2, 3 or 4, ##STR454##
independently of one another may when w, x or y equals 3 carry a
hydroxy group, or one of its salts, its solvates or the solvates of
its salts.
2. The compound of claim 1, corresponding to formula ##STR455## in
which R.sup.1 represents hydrogen or hydroxy, R.sup.2 represents
hydrogen, methyl or ethyl, R.sup.3 is as defined in claim 1, or one
of its salts, its solvates or the solvates of its salts.
3. The compound of claim 1, whereby R.sup.3 represents a group of
formula ##STR456## whereby * is the linkage site to the nitrogen
atom, R.sup.4 represents hydrogen, amino or hydroxy, R.sup.5
represents a group of formula ##STR457## wherein * is the linkage
site to the carbon atom, R.sup.23 represents hydrogen or a group of
formula *--(CH.sub.2).sub.n--OH or *--(CH.sub.2).sub.o--NH.sub.2,
wherein * is the linkage site to the carbon atom, n and o
independently of one another are a number 1, 2, 3 or 4, m is a
number 0 or 1, R.sup.8 represents a group of formula
*--CONHR.sup.14 or *--CH.sub.2CONHR.sup.15, wherein * is the
linkage site to the carbon atom, R.sup.14 and R.sup.15
independently of one another represent a group of formula
##STR458## wherein * is the linkage site to the nitrogen atom,
R.sup.4a represents hydrogen, amino or hydroxy, R.sup.5a represents
hydrogen, methyl or aminoethyl, R.sup.6a represents hydrogen or
aminoethyl, or R.sup.5a and R.sup.6a together with the nitrogen
atom to which they are bonded form a piperazine ring, R.sup.5a and
R.sup.6a independently of one another represent
*--(CH.sub.2).sub.Z1a--OH, *--(CH.sub.2).sub.Z2a--NHR.sup.13a,
*--CONHR.sup.14a or *--CH.sub.2CONHR.sup.15a, wherein * is the
linkage site to the carbon atom, Z1a and Z2a independently of one
another are a number 1, 2 or 3, R.sup.13a represents hydrogen or
methyl, and R.sup.14a and R.sup.15a independently of one another
represent a group of formula ##STR459## wherein * is the linkage
site to the nitrogen atom, R.sup.4c represents hydrogen, amino or
hydroxy, R.sup.5c represents hydrogen, methyl or aminoethyl,
R.sup.6c represents hydrogen or aminoethyl, kc is a number 0 or 1,
and lc is a number 1, 2, 3 or 4, R.sup.9a and R.sup.11a
independently of one another represent hydrogen or methyl,
R.sup.10a represents amino or hydroxy, R.sup.16a represents a group
of formula ##STR460## wherein * is the linkage site to the nitrogen
atom, R.sup.4d represents hydrogen, amino or hydroxy, R.sup.5d
represents hydrogen, methyl or aminoethyl, R.sup.6d represents
hydrogen or aminoethyl, kd is a number 0 or 1, and ld is a number
1, 2, 3 or 4, ka is a number 0 or 1, and la, wa, xa and ya
independently of one another are a number 1, 2, 3 or 4, R.sup.9 and
R.sup.11 independently or one another represent hydrogen, methyl,
*--C(NH.sub.2).dbd.NH or a group of formula ##STR461## wherein * is
the linkage site to the nitrogen atom, R.sup.20 represents hydrogen
or *--(CH.sub.2).sub.i--NHR.sup.22, wherein R.sup.22 represents
hydrogen or methyl, and i is a number 1, 2 or 3, R.sup.21
represents hydrogen or methyl, f is a number 0, 1, 2 or 3, g is a
number 1, 2 or 3, and h is a number 1, 2, 3 or 4, or R.sup.8
represents *--(CH.sub.2).sub.Z1--OH wherein * is the linkage site
to the carbon atom, Z1 is a number 1, 2 or 3, and R.sup.9
represents a group of formula ##STR462## wherein * is the linkage
site to the nitrogen atom, and h is a number 1, 2, 3 or 4, R.sup.10
represents amino or hydroxy, R.sup.24 represents a group of formula
*--CONHR.sup.25, wherein * is the linkage site to the carbon atom,
R.sup.25 is a group of formula ##STR463## wherein * is the linkage
site to the nitrogen atom, R.sup.4f represents hydrogen, amino or
hydroxy, R.sup.5f represents hydrogen, methyl or aminoethyl,
R.sup.6f represents hydrogen or aminoethyl, or R.sup.5f and
R.sup.6f together with the nitrogen atom to which they are bonded
form a piperazine ring, R.sup.8f and R.sup.12f independently of one
another represent *--(CH.sub.2).sub.Z1f--OH or
*--(CH.sub.2).sub.Z2f--NHR.sup.13f, wherein * is the linkage site
to the carbon atom, R.sup.3f represents hydrogen or methyl, and Z1f
and Z2f independently of one another are a number 1, 2 or 3,
R.sup.9f and R.sup.11f independently of one another represent
hydrogen or methyl, R.sup.10f represents amino or hydroxy, kf is a
number 0 or 1, and lf, wf, xf and yf independently of one another
are a number 1, 2, 3 or 4, k is a number 0 or 1, l, w and x
independently of one another are a number 1, 2, 3 or 4, ##STR464##
independently of one another may when w or x equals 3 carry a
hydroxy group, or one of its salts, its solvates or the solvates of
its salts.
4. The compound of claim 1, whereby R.sup.3 represents a group of
formula ##STR465## whereby * is the linkage site to the nitrogen
atom, R.sup.12 represents a group of formula *--CONHR.sup.14 or
*--CH.sub.2CONHR.sup.15, wherein * is the linkage site to the
carbon atom, R.sup.14 and R.sup.15 independently of one another
represent a group of formula ##STR466## wherein * is the linkage
site to the nitrogen atom, R.sup.4a represents hydrogen, amino or
hydroxy, R.sup.5a represents hydrogen, methyl or aminoethyl,
R.sup.6a represents hydrogen or aminoethyl, or R.sup.5a and
R.sup.6a together with the nitrogen atom to which they are bonded
form a piperazine ring, R.sup.8a and R.sup.12a independently of one
another represent *--(CH.sub.2).sub.Z1a--OH,
*--(CH.sub.2).sub.Z2a--NHR.sup.13a, *--CONHR.sup.14a or
*--CH.sub.2CONHR.sup.15a, wherein * is the linkage site to the
carbon atom, Z1a and Z2a independently of one another are a number
1, 2 or 3, R.sup.13a represents hydrogen or methyl, and R.sup.14a
and R.sup.15a independently of one another represent a group of
formula ##STR467## wherein * is the linkage site to the nitrogen
atom, R.sup.4c represents hydrogen, amino or hydroxy, R.sup.5c
represents hydrogen, methyl or aminoethyl, R.sup.6c represents
hydrogen or aminoethyl, kc is a number 0 or 1, and lc is a number
1, 2, 3 or 4, R.sup.9a and R.sup.11a independently of one another
represent hydrogen or methyl, R.sup.10a represents amino or
hydroxy, R.sup.16a represents a group of formula ##STR468## wherein
* is the linkage site to the nitrogen atom, R.sup.4d represents
hydrogen, amino or hydroxy, R.sup.5d represents hydrogen, methyl or
aminoethyl, R.sup.6d represents hydrogen or aminoethyl, kd is a
number 0 or 1, and ld is a number 1, 2, 3 or 4, ka is a number 0 or
1, and la, wa, xa and ya independently of one another are a number
1, 2, 3 or 4, y is a number 1, 2, 3 or 4, ##STR469## may when y
equals 3 carry a hydroxy group, or one of its salts, its solvates
or the solvates of its salts.
5. The compound of claim 1, whereby R.sup.3 represents a group of
formula ##STR470## whereby * is the linkage site to the nitrogen
atom, A represents a bond or phenyl, R.sup.16 and R.sup.17
independently of one another represent a group of formula
##STR471## wherein * is the linkage site to the nitrogen atom,
R.sup.4b represents hydrogen, amino or hydroxy, R.sup.5b represents
hydrogen, methyl or aminoethyl, R.sup.6b represents hydrogen or
aminoethyl, or R.sup.5b and R.sup.6b together with the nitrogen
atom to which they are bonded form a piperazine ring, R.sup.8b and
R.sup.12b independently of one another represent
*--(CH.sub.2).sub.Z1b--OH or *--(CH.sub.2).sub.Z2b--NHR.sup.13b,
wherein * is the linkage site to the carbon atom, R.sup.13b
represents hydrogen or methyl, and Z1b and Z2b independently of one
another are a number 1, 2 or 3, R.sup.9b and R.sup.11b
independently of one another represent hydrogen or methyl,
R.sup.10b represents amino or hydroxy, kb is a number 0 or 1, lb,
wb, xb and yb independently of one another are a number 1, 2, 3 or
4, d is a number 1, 2 or 3, or one of its salts, its solvates or
the solvates of its salts.
6. The compound of claim 1, whereby R.sup.3 represents a group of
formula ##STR472## whereby * is the linkage site to the nitrogen
atom, R.sup.18 and R.sup.19 independently of one another represent
hydrogen or a group of formula ##STR473## wherein * is the linkage
site to the nitrogen atom, R.sup.4e represents hydrogen, amino or
hydroxy, R.sup.5e represents hydrogen, methyl or aminoethyl,
R.sup.6e represents hydrogen or aminoethyl, or R.sup.5e and
R.sup.6e together with the nitrogen atom to which they are bonded
form a piperazine ring, R.sup.8e and R.sup.12e independently of one
another represent *--(CH.sub.2).sub.Z1e--OH or
*-(CH.sub.2).sub.Z2e--NHR.sup.13e, wherein * is the linkage site to
the carbon atom, R.sup.13e represents hydrogen or methyl, and Z1e
and Z2e independently of one another are a number 1, 2 or 3,
R.sup.9c and R.sup.11c independently of one another represent
hydrogen or methyl, R.sup.10e represents amino or hydroxy, ke is a
number 0 or 1, and le, we, xe and ye independently of one another
are a number 1, 2, 3 or 4, whereby R.sup.18 and R.sup.19 are not
simultaneously hydrogen, e is a number 1, 2 or 3, or one of its
salts, its solvates or the solvates of its salts.
7. A process for preparing a compound of formula (I) of claim 1 or
one of its salts, its solvates or the solvates of its salts,
whereby [A] a compound of formula ##STR474## wherein R.sup.2 and
R.sup.7 have the meaning indicated in claim 1, and boc represents
tert-butoxycarbonyl, * is reacted in a two-stage process firstly in
the presence of one or more dehydrating reagents with a compound of
formula H.sub.2NR.sup.3 (III), wherein R.sup.3 has the meaning
indicated in claim 1, and subsequently with an acid and/or by
hydrogenolysis, or [B] a compound of formula ##STR475## wherein
R.sup.2 and R.sup.7 have the meaning indicated in claim 1, and Z
represents benzyloxycarbonyl, is reacted in a two-stage process
firstly in the presence of one or more dehydrating reagents with a
compound of formula H.sub.2NR.sup.3 (III), wherein R.sup.3 has the
meaning indicated in claim 1, and subsequently with an acid or by
hydrogenolysis.
8. A process for preparing a compound of formula (I) of claim 1 or
one of its solvates, whereby a salt of the compound or a solvate of
a salt of the compound is converted into the compound by
chromatography with the addition of a base.
9. A compound of claim 1 for the treatment of diseases.
10. A compound of claim 1 for the prophylaxis of diseases.
11. A compound of claim 1 for the treatment and prophylaxis of
diseases.
12. A method for the manufacture of a medicament for the treatment
of diseases using a compound of claim 1.
13. A method for the manufacture of a medicament for the
prophylaxis of diseases using a compound of claim 1.
14. A method for the manufacture of a medicament for the treatment
and prophylaxis of diseases using a compound of claim 1.
15. A method for the manufacture of a medicament for the treatment
of bacterial diseases using a compound of claim 1.
16. A method for the manufacture of a medicament for the
prophylaxis of bacterial diseases using a compound of claim 1.
17. A method for the manufacture of a medicament for the treatment
and prophylaxis of bacterial diseases using a compound of claim
1.
18. A medicament comprising at least one compound of claim 1 in
combination with at least one inert, non-toxic, pharmaceutically
acceptable excipient.
19. The medicament of claim 18 for the treatment of bacterial
infections.
20. The medicament of claim 18 for the prophylaxis of bacterial
infections.
21. The medicament of claim 18 for the treatment and prophylaxis of
bacterial infections.
22. A method for controlling bacterial infections in humans and
animals by administration of an antibacterially effective amount of
at least one compound of claim 1.
23. A method for controlling bacterial infections in humans and
animals by administration of a medicament of claim 18.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of pending international
application PCT/EP2005/009912, filed Sep. 15, 2005, designating US,
which claims priority from German patent applications DE 10 2004
046 307.7, filed Sep. 24, 2004, and DE 10 2005 014 240.0, filed
Mar. 30, 2005. The contents of the above-referenced applications
are incorporated herein by this reference in their entirety.
BACKGROUND OF THE INVENTION
[0002] The invention relates to antibacterial amide macrocycles and
methods for their preparation, their use for the treatment and/or
prophylaxis of diseases, and their use for manufacturing
medicaments for the treatment and/or prophylaxis of diseases, in
particular of bacterial infections.
[0003] WO 03/106480 and WO 04/012816 describe macrocycles of the
biphenomycin B type which have antibacterial activity and have
amide and ester substituents respectively.
[0004] U.S. Pat. No. 3,452,136, thesis of R. U. Meyer, Stuttgart
University, Germany (1991), thesis of V. Leitenberger, Stuttgart
University, Germany (1991), Synthesis (1992) (10):1025-1030, J.
Chem. Soc., Perkin Trans. 1 (1992) (1):123-130, J. Chem. Soc.,
Chem. Commun. (1991) (10):744, Synthesis (1991) (5):409-413, J.
Chem. Soc., Chem. Commun. (1991) (5):275-277, J. Antibiot. (1985)
38(11):1462-1468, J. Antibiot. (1985) 38(11):1453-1461 describe the
natural product biphenomycin B as having antibacterial activity.
Some steps in the synthesis of biphenomycin B are described in
Synlett (2003), 4, 522-526.
[0005] Chirality (1995) 7(4):181-1892, J. Antibiot. (1991)
44(6):674-677, J. Am. Chem. Soc. (1989) 111(19):7323-7327, J. Am.
Chem. Soc. (1989) 111(19):7328-7333, J. Org. Chem. (1987)
52(24):5435-5437, Anal. Biochem. (1987) 165(1):108-113, J. Org.
Chem. (1985) 50(8):1341-1342, J. Antibiot. (1993) 46(3):C-2, J.
Antibiot. (1993) 46(1):135-140, Synthesis (1992) (12):1248-1254,
Appl. Environ. Microbiol. (1992) 58(12):3879-3888, J. Chem. Soc.,
Chem. Commun. (1992) (13):951-953 describe a structurally related
natural product, biphenomycin A, which has a further substitution
with a hydroxy group on the macrocycle.
[0006] The natural products in terms of their properties do not
comply with the requirements for antibacterial medicaments.
Although structurally different agents with antibacterial activity
are available on the market, the development of resistance is a
regular possibility. Novel agents for good and more effective
therapy are therefore desirable.
SUMMARY OF THE INVENTION
[0007] One object of the present invention is therefore to provide
novel and alternative compounds with the same or improved
antibacterial effect for the treatment of bacterial diseases in
humans and animals.
[0008] It has surprisingly been found that certain derivatives of
these natural products in which the carboxyl group of the natural
product is replaced by an amide group which comprises a basic group
have antibacterial activity on biphenomycin-resistant S. aureus
strains (RN4220Bi.sup.R and T17).
[0009] In addition, the derivatives show an improved spontaneous
resistance rate for S. aureus wild-type strains and
biphenomycin-resistant S. aureus strains.
[0010] The invention relates to compounds of formula ##STR1##
[0011] in which
[0012] R.sup.7 represents a group of formula ##STR2##
[0013] whereby
[0014] R.sup.1 represents hydrogen or hydroxy,
[0015] is the linkage site to the carbon atom,
[0016] R.sup.2 represents hydrogen, methyl or ethyl,
[0017] R.sup.3 represents a group of formula ##STR3##
[0018] whereby
[0019] * is the linkage site to the nitrogen atom,
[0020] A represents a bond or phenyl,
[0021] R.sup.4 represents hydrogen, amino or hydroxy,
[0022] R.sup.5 represents a group of formula ##STR4##
[0023] wherein
[0024] is the linkage site to the carbon atom,
[0025] R.sup.23 represents hydrogen or a group of formula
*--(CH.sub.2).sub.n--OH or *--(CH.sub.2).sub.o--NH.sub.2,
[0026] wherein
[0027] * is the linkage site to the carbon atom,
[0028] n and o independently of one another are a number 1, 2, 3 or
4,
[0029] m is a number 0 or 1,
[0030] R.sup.8 and R.sup.12 independently of one another represent
a group of formula *--CONHR.sup.14 or *--CH.sub.2CONHR.sup.15,
[0031] wherein
[0032] is the linkage site to the carbon atom,
[0033] R.sup.14 and R.sup.15 independently of one another represent
a group of formula ##STR5##
[0034] wherein
[0035] * is the linkage site to the nitrogen atom,
[0036] R.sup.4a represents hydrogen, amino or hydroxy,
[0037] R.sup.5a represents hydrogen, methyl or aminoethyl,
[0038] R.sup.6a represents hydrogen or aminoethyl,
[0039] or
[0040] R.sup.5a and R.sup.6a together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0041] R.sup.8a and R.sup.12a independently of one another
represent *--(CH.sub.2).sub.Z1a--OH,
*--(CH.sub.2).sub.Z2a--NHR.sup.13a, *--CONHR.sup.14a or
*--CH.sub.2CONHR.sup.15a,
[0042] wherein
[0043] is the linkage site to the carbon atom,
[0044] Z1a and Z2a independently of one another are a number 1, 2
or 3,
[0045] R.sup.13a represents hydrogen or methyl,
[0046] and
[0047] R.sup.14a and R.sup.15a independently of one another
represent a group of formula ##STR6##
[0048] wherein
[0049] * is the linkage site to the nitrogen atom,
[0050] R.sup.4c represents hydrogen, amino or hydroxy,
[0051] R.sup.5c represents hydrogen, methyl or aminoethyl,
[0052] R.sup.6c represents hydrogen or aminoethyl,
[0053] kc is a number 0 or 1,
[0054] and
[0055] lc is a number 1, 2, 3 or 4,
[0056] R.sup.9a and R.sup.11a independently of one another
represent hydrogen or methyl,
[0057] R.sup.10a represents amino or hydroxy,
[0058] R.sup.16a represents a group of formula ##STR7##
[0059] wherein
[0060] * is the linkage site to the nitrogen atom,
[0061] R.sup.4d represents hydrogen, amino or hydroxy,
[0062] R.sup.5d represents hydrogen, methyl or aminoethyl,
[0063] R.sup.6d represents hydrogen or aminoethyl,
[0064] kd is a number 0 or 1,
[0065] and
[0066] ld is a number 1, 2, 3 or 4,
[0067] ka is a number 0 or 1,
[0068] and
[0069] la, wa, xa and ya independently of one another are a number
1, 2, 3 or 4,
[0070] R.sup.9 and R.sup.11 independently of one another represent
hydrogen, methyl, *--C(NH.sub.2).dbd.NH or a group of formula
##STR8##
[0071] wherein
[0072] * is the linkage site to the nitrogen atom,
[0073] R.sup.20 represents hydrogen or
*--(CH.sub.2).sub.i--NHR.sup.22,
[0074] wherein
[0075] R.sup.22 represents hydrogen or methyl,
[0076] and
[0077] i is a number 1, 2 or 3,
[0078] R.sup.21 represents hydrogen or methyl,
[0079] f is a number 0, 1, 2 or 3,
[0080] g is a number 1, 2 or 3,
[0081] and
[0082] h is a number 1, 2, 3 or 4,
[0083] or
[0084] R.sup.8 represents *--(CH.sub.2).sub.Z1--OH,
[0085] wherein
[0086] * is the linkage site to the carbon atom,
[0087] Z1 is a number 1, 2 or 3,
[0088] and
[0089] R.sup.9 represents a group of formula ##STR9##
[0090] wherein
[0091] * is the linkage site to the nitrogen atom,
[0092] and
[0093] h is a number 1, 2, 3 or 4,
[0094] R.sup.10 represents amino or hydroxy,
[0095] R.sup.16 and R.sup.17 independently of one another represent
a group of formula ##STR10##
[0096] wherein
[0097] * is the linkage site to the nitrogen atom,
[0098] R.sup.4b represents hydrogen, amino or hydroxy,
[0099] R.sup.5b represents hydrogen, methyl or aminoethyl,
[0100] R.sup.6b represents hydrogen or aminoethyl,
[0101] or
[0102] R.sup.5b and R.sup.6b together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0103] R.sup.8b and R.sup.12b independently of one another
represent *--(CH.sub.2).sub.Z1b--OH,
*--(CH.sub.2).sub.Z2b--NHR.sup.13b, *--CONHR.sup.14b or
*--CH.sub.2CONHR.sup.15b,
[0104] wherein [0105] * is the linkage site to the carbon atom,
[0106] R.sup.3b represents hydrogen or methyl,
[0107] and
[0108] Z1b and Z2b independently of one another are a number 1, 2
or 3,
[0109] and
[0110] R.sup.14b and R.sup.15b independently of one another
represent a group of formula ##STR11##
[0111] wherein
[0112] * is the linkage site to the nitrogen atom,
[0113] R.sup.4g represents hydrogen, amino or hydroxy,
[0114] R.sup.5g represents hydrogen, methyl or aminoethyl,
[0115] R.sup.6g represents hydrogen or aminoethyl,
[0116] kg is a number 0 or 1,
[0117] and
[0118] lg is a number 1, 2, 3 or 4,
[0119] R.sup.9b and R.sup.11b independently of one another
represent hydrogen or methyl,
[0120] R.sup.10b represents amino or hydroxy,
[0121] kb is a number 0 or 1,
[0122] lb, wb, xb and yb independently of one another are a number
1, 2, 3 or 4,
[0123] R.sup.18 and R.sup.19 independently of one another represent
hydrogen or a group of formula ##STR12##
[0124] wherein
[0125] * is the linkage site to the nitrogen atom,
[0126] R.sup.4e represents hydrogen, amino or hydroxy,
[0127] R.sup.5e represents hydrogen, methyl or aminoethyl,
[0128] R.sup.6e represents hydrogen or aminoethyl,
[0129] or
[0130] R.sup.5e and R.sup.6e together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0131] R.sup.8e and R.sup.12e independently of one another
represent *--(CH.sub.2).sub.Z1e--OH or
*--(CH.sub.2).sub.Z2e--NHR.sup.13e,
[0132] wherein
[0133] * is the linkage site to the carbon atom,
[0134] R.sup.13e represents hydrogen or methyl,
[0135] and
[0136] Z1e and Z2e independently of one another are a number 1, 2
or 3,
[0137] R.sup.9e and R.sup.11e independently of one another
represent hydrogen or methyl,
[0138] R.sup.10e represents amino or hydroxy,
[0139] ke is a number 0 or 1,
[0140] and
[0141] le, we, xe and ye independently of one another are a number
1, 2, 3 or 4,
[0142] whereby R.sup.18 and R.sup.19 are not simultaneously
hydrogen,
[0143] R.sup.24 represents a group of formula *--CONHR.sup.25,
[0144] wherein
[0145] * is the linkage site to the carbon atom,
[0146] R.sup.25 represents a group of formula ##STR13##
[0147] wherein
[0148] * is the point of linkage to the nitrogen atom,
[0149] R.sup.4f represents hydrogen, amino or hydroxy,
[0150] R.sup.5f represents hydrogen, methyl or aminoethyl,
[0151] R.sup.6f represents hydrogen or aminoethyl,
[0152] or
[0153] R.sup.5f and R.sup.6f together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0154] R.sup.8f and R.sup.12f independently of one another
represent *--(CH.sub.2).sub.Z1f--OH or
*--(CH.sub.2).sub.Z2f--NHR.sup.13f,
[0155] wherein
[0156] * is the linkage site to the carbon atom,
[0157] R.sup.3f represents hydrogen or methyl,
[0158] and
[0159] Z1f and Z2f independently of one another are a number 1, 2
or 3,
[0160] R.sup.9f and R.sup.11f independently of one another
represent hydrogen or methyl,
[0161] R.sup.10f represents amino or hydroxy,
[0162] kf is a number 0 or 1,
[0163] and
[0164] lf, wf, xf and yf independently of one another are a number
1, 2, 3 or 4,
[0165] d and e independently of one another are a number 1, 2 or
3,
[0166] k is a number 0 or 1,
[0167] l, w, x and y independently of one another are a number 1,
2, 3 or 4, ##STR14## independently of one another may when w, x or
y equals 3 carry a hydroxy group,
[0168] and their salts, their solvates and the solvates of their
salts.
[0169] Compounds of the invention are the compounds of formula (I)
and the salts, solvates and solvates of the salts thereof, and the
compounds which are encompassed by formula (I) and are mentioned
hereinafter as exemplary embodiment(s), and the salts, solvates and
solvates of the salts, insofar as the compounds which are
encompassed by formula (I) and are mentioned hereinafter are not
already salts, solvates and solvates of the salts.
[0170] The compounds of the invention may, depending on their
structure, exist in stereoisomeric forms (enantiomers,
diastereomers). The invention therefore relates to the enantiomers
or diastereomers and their respective mixtures. The
stereoisomerically pure constituents can be isolated from such
mixtures of enantiomers and/or diastereomers by known processes
such as chromatography on a chiral phase or crystallization using
chiral amines or chiral acids.
[0171] The invention also relates, depending on the structure of
the compounds, to tautomers of the compounds.
[0172] Salts preferred for the purposes of the invention are
physiologically acceptable salts of the compounds of the
invention.
[0173] Physiologically acceptable salts of the compounds (I)
include acid addition salts of mineral acids, carboxylic acids and
sulfonic acids, e.g. salts of hydrochloric acid, hydrobromic acid,
sulfuric acid, phosphoric acid, methanesulfonic acid,
ethanesulfonic acid, toluenesulfonic acid, benzenesulfonic acid,
naphthalenedisulfonic acid, acetic acid, propionic acid, lactic
acid, tartaric acid, malic acid, citric acid, fumaric acid, maleic
acid, trifluoroacetic acid and benzoic acid.
[0174] Physiologically acceptable salts of the compounds (I) also
include salts of conventional bases such as, by way of example and
preferably, alkali metal salts (e.g. sodium and potassium salts),
alkaline earth metal salts (e.g. calcium and magnesium salts) and
ammonium salts derived from ammonia or organic amines having 1 to
16 carbon atoms, such as, by way of example and preferably,
ethylamine, diethylamine, triethylamine, ethyldiisopropylamine,
monoethanolamine, diethanolamine, triethanolamine,
dicyclohexylamine, dimethylaminoethanol, procaine, dibenzylamine,
N-methylmorpholine, dihydroabietylamine, arginine, lysine,
ethylenediamine and methylpiperidine.
[0175] Solvates for the purposes of the invention refer to those
forms of the compounds which form a complex in the solid or liquid
state through coordination with solvent molecules. Hydrates are a
special form of solvates in which coordination takes place with
water.
[0176] A symbol # on a carbon atom means that the compound is in
enantiopure form in relation to the configuration at this carbon
atom, meaning in the context of the present invention an
enantiomeric excess of more than 90% (>90% ee).
[0177] In the formulae of the groups which R.sup.3 can represent,
the end point of the line beside which there is an * does not
represent a carbon atom or a CH.sub.2 group but is part of the bond
to the nitrogen atom to which R.sup.3 is bonded.
[0178] In the formulae of the groups which R.sup.7 can represent,
the end point of the line beside which there is an * does not
represent a carbon atom or a CH.sub.2 group but is part of the bond
to the carbon atom to which R.sup.7 is bonded.
[0179] Preference is given in the context of the present invention
to compounds of formula (I) in which
[0180] R.sup.7 represents a group of formula ##STR15##
[0181] whereby
[0182] R.sup.1 represents hydrogen or hydroxy,
[0183] * is the linkage site to the carbon atom,
[0184] R.sup.2 represents hydrogen, methyl or ethyl,
[0185] R.sup.3 represents a group of formula ##STR16##
[0186] whereby
[0187] * is the linkage site to the nitrogen atom,
[0188] A represents a bond or phenyl,
[0189] R.sup.4 represents hydrogen, amino or hydroxy,
[0190] R.sup.5 represents a group of formula ##STR17##
[0191] wherein
[0192] * is the linkage site to the carbon atom,
[0193] R.sup.23 represents hydrogen or a group of formula
*--(CH.sub.2).sub.n--OH or *--(CH.sub.2).sub.o--NH.sub.2,
[0194] wherein
[0195] * is the linkage site to the carbon atom,
[0196] n and o independently of one another are a number 1, 2, 3 or
4,
[0197] m is a number 0 or 1,
[0198] R.sup.8 and R.sup.12 independently of one another represent
a group of formula *--CONHR.sup.14 or *--CH.sub.2CONHR.sup.15,
[0199] wherein
[0200] * is the linkage site to the carbon atom,
[0201] R.sup.14 and R.sup.15 independently of one another represent
a group of formula ##STR18##
[0202] wherein
[0203] * is the linkage site to the nitrogen atom,
[0204] R.sup.4a represents hydrogen, amino or hydroxy,
[0205] R.sup.5a represents hydrogen, methyl or aminoethyl,
[0206] R.sup.6a represents hydrogen or aminoethyl,
[0207] or
[0208] R.sup.5a and R.sup.6a together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0209] R.sup.8a and R.sup.6a independently of one another represent
*--(CH.sub.2).sub.Z1a--OH, *--(CH.sub.2).sub.Z2a--NHR.sup.13a,
*--CONHR.sup.14a or *--CH.sub.2CONHR.sup.15a,
[0210] wherein
[0211] * is the point of the linkage to the carbon atom,
[0212] Z1a and Z2a independently of one another are a number 1, 2
or 3,
[0213] R.sup.13a represents hydrogen or methyl,
[0214] and
[0215] R.sup.14a and R.sup.15a independently of one another are a
group of formula ##STR19##
[0216] wherein
[0217] * is the linkage site to the nitrogen atom,
[0218] R.sup.4c represents hydrogen, amino or hydroxy,
[0219] R.sup.5c represents hydrogen, methyl or aminoethyl,
[0220] R.sup.6c represents hydrogen or aminoethyl,
[0221] kc is a number 0 or 1,
[0222] and
[0223] lc is a number 1, 2, 3 or 4,
[0224] R.sup.9a and R.sup.11a independently of one another
represent hydrogen or methyl,
[0225] R.sup.10a represents amino or hydroxy,
[0226] R.sup.16a represents a group of formula ##STR20##
[0227] wherein
[0228] * is the linkage site to the nitrogen atom,
[0229] R.sup.4d represents hydrogen, amino or hydroxy,
[0230] R.sup.5d represents hydrogen, methyl or aminoethyl,
[0231] R.sup.6d represents hydrogen or aminoethyl,
[0232] kd is a number 0 or 1,
[0233] and
[0234] ld is a number 1, 2, 3 or 4,
[0235] ka is a number 0 or 1,
[0236] and
[0237] la, wa, xa and ya independently of one another are a number
1, 2, 3 or 4,
[0238] R.sup.9 and R.sup.11 independently of one another represent
hydrogen, methyl, *--C(NH.sub.2).dbd.NH or a group of formula
##STR21##
[0239] wherein
[0240] * is the linkage site to the nitrogen atom,
[0241] R.sup.20 represents hydrogen or
*--(CH.sub.2).sub.i--NHR.sup.22,
[0242] wherein
[0243] R.sup.22 represents hydrogen or methyl,
[0244] and
[0245] i is a number 1, 2 or 3,
[0246] R.sup.21 represents hydrogen or methyl,
[0247] f is a number 0, 1, 2 or 3,
[0248] g is a number 1, 2 or 3,
[0249] and
[0250] h is a number 1, 2, 3 or 4,
[0251] or
[0252] R.sup.8 represents *--(CH.sub.2).sub.Z1--OH,
[0253] wherein
[0254] * is the linkage site to the carbon atom,
[0255] Z1 is a number 1, 2 or 3,
[0256] and
[0257] R.sup.9 represents a group of formula ##STR22##
[0258] wherein
[0259] * is the linkage site to the nitrogen atom,
[0260] and
[0261] h is a number 1, 2, 3 or 4,
[0262] R.sup.10 represents amino or hydroxy,
[0263] R.sup.16 and R.sup.17 independently of one another represent
a group of formula ##STR23##
[0264] wherein
[0265] * is the linkage site to the nitrogen atom,
[0266] R.sup.4b represents hydrogen, amino or hydroxy,
[0267] R.sup.5b represents hydrogen, methyl or aminoethyl,
[0268] R.sup.6b represents hydrogen or aminoethyl,
[0269] or
[0270] R.sup.5b and R.sup.6b together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0271] R.sup.8b and R.sup.12b independently of one another
represent *--(CH.sub.2).sub.Z1b--OH or
*--(CH.sub.2).sub.Z2b--NHR.sup.13b,
[0272] wherein
[0273] * is the linkage site to the carbon atom,
[0274] R.sup.13b represents hydrogen or methyl,
[0275] and
[0276] Z1b and Z2b independently of one another are a number 1, 2
or 3,
[0277] R.sup.9b and R.sup.11b independently of one another
represent hydrogen or methyl,
[0278] R.sup.10b represents amino or hydroxy,
[0279] kb is a number 0 or 1,
[0280] lb, wb, xb and yb independently of one another are a number
1, 2, 3 or 4,
[0281] R.sup.18 and R.sup.19 independently of one another represent
hydrogen or a group of formula ##STR24##
[0282] wherein
[0283] * is the linkage site to the nitrogen atom,
[0284] R.sup.4e represents hydrogen, amino or hydroxy,
[0285] R.sup.5e represents hydrogen, methyl or aminoethyl,
[0286] R.sup.6e represents hydrogen or aminoethyl,
[0287] or
[0288] R.sup.5e and R.sup.6e together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0289] R.sup.8e and R.sup.12e independently of one another
represent *--(CH.sub.2).sub.Z1e--OH or
*--(CH.sub.2).sub.Z2e--NHR.sup.13e,
[0290] wherein
[0291] * is the linkage site to the carbon atom,
[0292] R.sup.13e represents hydrogen or methyl,
[0293] and
[0294] Z1e and Z2e independently of one another are a number 1, 2
or 3,
[0295] R.sup.9e and R.sup.11e independently of one another
represent hydrogen or methyl,
[0296] R.sup.10e represents amino or hydroxy,
[0297] ke is a number 0 or 1,
[0298] and
[0299] le, we, xe and ye independently of one another are a number
1, 2, 3 or 4,
[0300] whereby R.sup.18 and R.sup.19 are not simultaneously
hydrogen,
[0301] R.sup.24 represents a group of formula *--CONHR.sup.25,
[0302] wherein
[0303] * is the linkage site to the carbon atom,
[0304] R.sup.25 represents a group of formula ##STR25##
[0305] wherein
[0306] * is the linkage site to the nitrogen atom,
[0307] R.sup.4f represents hydrogen, amino or hydroxy,
[0308] R.sup.5f represents hydrogen, methyl or aminoethyl,
[0309] R.sup.6f represents hydrogen or aminoethyl,
[0310] or
[0311] R.sup.5f and R.sup.6f together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0312] R.sup.8f and R.sup.12f independently of one another
represent *--(CH.sub.2).sub.Z1f--OH or
*--(CH.sub.2).sub.Z2f--NHR.sup.13f,
[0313] wherein
[0314] * is the linkage site to the carbon atom,
[0315] R.sup.3f represents hydrogen or methyl,
[0316] and
[0317] Z1f and Z2f independently of one another are a number 1, 2
or 3,
[0318] R.sup.9f and R.sup.11f independently of one another
represent hydrogen or methyl,
[0319] R.sup.10f represents amino or hydroxy,
[0320] kf is a number 0 or 1,
[0321] and
[0322] lf, wf, xf and yf independently of one another are a number
1, 2, 3 or 4,
[0323] d and e independently of one another are a number 1, 2 or
3,
[0324] k is a number 0 or 1,
[0325] l, w, x and y independently of one another are a number 1,
2, 3 or 4, ##STR26## independently of one another may when w, x or
y equals 3 carry a hydroxy group,
[0326] and their salts, their solvates and the solvates of their
salts.
[0327] Preference is also given in the context of the present
invention to compounds of formula ##STR27##
[0328] in which
[0329] R.sup.1 represents hydrogen or hydroxy,
[0330] R.sup.2 represents hydrogen, methyl or ethyl,
[0331] R.sup.3 is as defined above,
[0332] and their salts, their solvates and the solvates of their
salts.
[0333] Preference is also given in the context of the present
invention to compounds of formula (I) or (Ia) in which
[0334] R.sup.3 represents a group of formula ##STR28##
[0335] whereby
[0336] * is the linkage site to the nitrogen atom,
[0337] R.sup.4 represents hydrogen, amino or hydroxy,
[0338] R.sup.5 represents a group of formula ##STR29##
[0339] wherein
[0340] * is the linkage site to the carbon atom,
[0341] R.sup.23 represents hydrogen or a group of formula
*--(CH.sub.2).sub.n--OH or *--(CH.sub.2).sub.o--NH.sub.2,
[0342] wherein
[0343] * is the linkage site to the carbon atom,
[0344] n and o independently of one another are a number 1, 2, 3 or
4,
[0345] m is a number 0 or 1,
[0346] R.sup.8 represents a group of formula *--CONHR.sup.14 or
*--CH.sub.2CONHR.sup.15,
[0347] wherein
[0348] * is the linkage site to the carbon atom,
[0349] R.sup.14 and R.sup.15 independently of one another represent
a group of formula ##STR30##
[0350] wherein
[0351] * is the linkage site to the nitrogen atom,
[0352] R.sup.4a represents hydrogen, amino or hydroxy,
[0353] R.sup.5a represents hydrogen, methyl or aminoethyl,
[0354] R.sup.6a represents hydrogen or aminoethyl,
[0355] or
[0356] R.sup.5a and R.sup.6a together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0357] R.sup.8a and R.sup.12a independently of one another
represent *--(CH.sub.2).sub.Z1a--OH,
*--(CH.sub.2).sub.Z2a--NHR.sup.13a, *--CONHR.sup.14a or
*--CH.sub.2CONHR.sup.15a,
[0358] wherein
[0359] * is the linkage site to the carbon atom,
[0360] Z1a and Z2a independently of one another are a number 1, 2
or 3,
[0361] R.sup.13a represents hydrogen or methyl,
[0362] and
[0363] R.sup.14a and R.sup.15a independently of one another
represent a group of formula ##STR31##
[0364] wherein
[0365] * is the linkage site to the nitrogen atom,
[0366] R.sup.4c represents hydrogen, amino or hydroxy,
[0367] R.sup.5c represents hydrogen, methyl or aminoethyl,
[0368] R.sup.6c represents hydrogen or aminoethyl,
[0369] kc is a number 0 or 1,
[0370] and
[0371] lc is a number 1, 2, 3 or 4,
[0372] R.sup.9a and R.sup.11a independently of one another
represent hydrogen or methyl,
[0373] R.sup.10a represents amino or hydroxy,
[0374] R.sup.16a represents a group of formula ##STR32##
[0375] wherein
[0376] * is the linkage site to the nitrogen atom,
[0377] R.sup.4d represents hydrogen, amino or hydroxy,
[0378] R.sup.5d represents hydrogen, methyl or aminoethyl,
[0379] R.sup.6d represents hydrogen or aminoethyl,
[0380] kd is a number 0 or 1,
[0381] and
[0382] ld is a number 1, 2, 3 or 4,
[0383] ka is a number 0 or 1,
[0384] and
[0385] la, wa, xa and ya independently of one another are a number
1, 2, 3 or 4,
[0386] R.sup.9 and R.sup.11 independently of one another represent
hydrogen, methyl, *--C(NH.sub.2).dbd.NH or a group of formula
##STR33##
[0387] wherein
[0388] * is the linkage site to the nitrogen atom,
[0389] R.sup.20 represents hydrogen or
*--(CH.sub.2).sub.i--NHR.sup.22,
[0390] wherein
[0391] R.sup.22 represents hydrogen or methyl,
[0392] and
[0393] i is a number 1, 2 or 3,
[0394] R.sup.21 represents hydrogen or methyl,
[0395] f is a number 0, 1, 2 or 3,
[0396] g is a number 1, 2 or 3,
[0397] and
[0398] h is a number 1, 2, 3 or 4,
[0399] or
[0400] R.sup.8 represents *--(CH.sub.2).sub.Z1--OH
[0401] wherein
[0402] * is the linkage site to the carbon atom,
[0403] Z1 is a number 1, 2 or 3,
[0404] and
[0405] R.sup.9 represents a group of formula ##STR34##
[0406] wherein
[0407] * is the linkage site to the nitrogen atom,
[0408] and
[0409] h is a number 1, 2, 3 or 4,
[0410] R.sup.10 represents amino or hydroxy,
[0411] R.sup.24 represents a group of formula *--CONHR.sup.25,
[0412] wherein
[0413] * is the linkage site to the carbon atom,
[0414] R.sup.25 represents a group of formula ##STR35##
[0415] wherein
[0416] * is the linkage site to the nitrogen atom,
[0417] R.sup.4f represents hydrogen, amino or hydroxy,
[0418] R.sup.5f represents hydrogen, methyl or aminoethyl,
[0419] R.sup.6f represents hydrogen or aminoethyl, or
[0420] R.sup.5f and R.sup.6f together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0421] R.sup.8f and R.sup.12f independently of one another
represent *--(CH.sub.2).sub.Z1f--OH or
*--(CH.sub.2).sub.Z2f--NHR.sup.13f,
[0422] wherein
[0423] * is the linkage site to the carbon atom,
[0424] R.sup.13f represents hydrogen or methyl,
[0425] and
[0426] Z1f and Z2f independently of one another are a number 1, 2
or 3,
[0427] R.sup.9f and R.sup.11f independently of one another
represent hydrogen or methyl,
[0428] R.sup.10f represents amino or hydroxy,
[0429] kf is a number 0 or 1,
[0430] and
[0431] lf, wf, xf and yf independently of one another are a number
1, 2, 3 or 4,
[0432] k is a number 0 or 1,
[0433] l, w, and x independently of one another are a number 1, 2,
3 or 4, ##STR36## independently of one another may when w or x
equals 3 carry a hydroxy group,
[0434] and their salts, their solvates and the solvates of their
salts.
[0435] Particular preference is given in the context of the present
invention to compounds of formula (I) or (Ia) in which
[0436] R.sup.3 represents a group of formula ##STR37##
[0437] whereby
[0438] * is the linkage site to the nitrogen atom,
[0439] R.sup.4 represents hydrogen, amino or hydroxy,
[0440] R.sup.5 represents a group of formula ##STR38##
[0441] wherein
[0442] * is the linkage site to the carbon atom,
[0443] R.sup.23 represents hydrogen or a group of formula
*--(CH.sub.2).sub.n--OH or *--(CH.sub.2).sub.o--NH.sub.2,
[0444] wherein
[0445] * is the linkage site to the carbon atom,
[0446] n and o independently of one another are a number 1, 2, 3 or
4,
[0447] m is a number 0 or 1,
[0448] k is a number 0 or 1,
[0449] l is a number 1, 2, 3 or 4,
[0450] and their salts, their solvates and the solvates of their
salts.
[0451] Particular preference is also given in the context of the
present invention to compounds of formula (I) or (Ia) in which
[0452] R.sup.3 represents a group of formula ##STR39##
[0453] whereby
[0454] * is the linkage site to the nitrogen atom,
[0455] R.sup.8 represents a group of formula *--CONHR.sup.14 or
*--CH.sub.2CONHR.sup.15,
[0456] wherein
[0457] * is the linkage site to the carbon atom,
[0458] R.sup.14 and R.sup.15 independently of one another represent
a group of formula ##STR40##
[0459] wherein
[0460] * is the linkage site to the nitrogen atom,
[0461] R.sup.4a represents hydrogen, amino or hydroxy,
[0462] R.sup.5a represents hydrogen, methyl or aminoethyl,
[0463] R.sup.6a represents hydrogen or aminoethyl,
[0464] or
[0465] R.sup.5a and R.sup.6a together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0466] R.sup.8a and R.sup.12a independently of one another
represent *--(CH.sub.2).sub.Z1a--OH,
*--(CH.sub.2).sub.Z2a--NHR.sup.13a, *--CONHR.sup.14a or
*--CH.sub.2CONHR.sup.15a,
[0467] wherein
[0468] * is the linkage site to the carbon atom,
[0469] Z1a and Z2a independently of one another are a number 1, 2
or 3,
[0470] R.sup.13a represents hydrogen or methyl, and
[0471] R.sup.14a and R.sup.15a independently of one another
represent a group of formula ##STR41##
[0472] wherein
[0473] * is the linkage site to the nitrogen atom,
[0474] R.sup.4c represents hydrogen, amino or hydroxy,
[0475] R.sup.5c represents hydrogen, methyl or aminoethyl,
[0476] R.sup.6c represents hydrogen or aminoethyl,
[0477] kc is a number 0 or 1,
[0478] and
[0479] lc is a number 1, 2, 3 or 4,
[0480] R.sup.9a and R.sup.11a independently of one another
represent hydrogen or methyl,
[0481] R.sup.10a represents amino or hydroxy,
[0482] R.sup.16a represents a group of formula ##STR42##
[0483] wherein
[0484] * is the linkage site to the nitrogen atom,
[0485] R.sup.4d represents hydrogen, amino or hydroxy,
[0486] R.sup.5d represents hydrogen, methyl or aminoethyl,
[0487] R.sup.6d represents hydrogen or aminoethyl,
[0488] kd is a number 0 or 1,
[0489] and
[0490] ld is a number 1, 2, 3 or 4,
[0491] ka is a number 0 or 1,
[0492] and
[0493] la, wa, xa and ya independently of one another are a number
1, 2, 3 or 4,
[0494] R.sup.9 and R.sup.11 independently of one another represent
hydrogen, methyl, *--C(NH.sub.2).dbd.NH or a group of formula
##STR43##
[0495] wherein
[0496] * is the linkage site to the nitrogen atom,
[0497] R.sup.20 represents hydrogen or
*--(CH.sub.2).sub.i--NHR.sup.22,
[0498] wherein
[0499] R.sup.22 represents hydrogen or methyl,
[0500] and
[0501] i is a number 1, 2 or 3,
[0502] R.sup.21 represents hydrogen or methyl,
[0503] f is a number 0, 1, 2 or 3,
[0504] g is a number 1, 2 or 3,
[0505] and
[0506] h is a number 1, 2, 3 or 4,
[0507] or
[0508] R.sup.8 represents *--(CH.sub.2).sub.Z1--OH,
[0509] wherein
[0510] * is the linkage site to the carbon atom,
[0511] Z1 is a number 1, 2 or 3,
[0512] and
[0513] R.sup.9 represents a group of formula ##STR44##
[0514] wherein
[0515] * is the linkage site to the nitrogen atom,
[0516] and
[0517] h is a number 1, 2, 3 or 4,
[0518] R.sup.10 represents amino or hydroxy,
[0519] R.sup.24 represents a group of formula *--CONHR.sup.25,
[0520] wherein
[0521] * is the linkage site to the carbon atom,
[0522] R.sup.25 represents a group of formula ##STR45##
[0523] wherein
[0524] * is the linkage site to the nitrogen atom,
[0525] R.sup.4f represents hydrogen, amino or hydroxy,
[0526] R.sup.5f represents hydrogen, methyl or aminoethyl,
[0527] R.sup.6f represents hydrogen or aminoethyl,
[0528] or
[0529] R.sup.5f and R.sup.6f together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0530] R.sup.8f and R.sup.12f independently of one another
represent *--(CH.sub.2).sub.Z1f--OH or
*--(CH.sub.2).sub.Z2f--NHR.sup.13f,
[0531] wherein
[0532] * is the linkage site to the carbon atom,
[0533] R.sup.13f represents hydrogen or methyl,
[0534] and
[0535] Z1f and Z2f independently of one another are a number 1, 2
or 3,
[0536] R.sup.9f and R.sup.11f independently of one another
represent hydrogen or methyl,
[0537] R.sup.10f represents amino or hydroxy,
[0538] kf is a number 0 or 1,
[0539] and
[0540] lf, wf, xf and yf independently of one another are a number
1, 2, 3 or 4,
[0541] w and x independently of one another are a number 1, 2, 3 or
4, ##STR46## independently of one another may when w or x equals 3
carry a hydroxy group,
[0542] and their salts, their solvates and the solvates of their
salts.
[0543] Preference is also given in the context of the present
invention to compounds of formula (I) or (Ia) in which
[0544] R.sup.3 represents a group of formula ##STR47##
[0545] whereby
[0546] * is the linkage site to the nitrogen atom,
[0547] R.sup.12 represents a group of formula *--CONHR.sup.14 or
*--CH.sub.2CONHR.sup.15,
[0548] wherein
[0549] * is the linkage site to the carbon atom,
[0550] R.sup.14 and R.sup.15 independently of one another represent
a group of formula ##STR48##
[0551] wherein
[0552] * is the linkage site to the nitrogen atom,
[0553] R.sup.4a represents hydrogen, amino or hydroxy,
[0554] R.sup.5a represents hydrogen, methyl or aminoethyl,
[0555] R.sup.6a represents hydrogen or aminoethyl,
[0556] or
[0557] R.sup.5a and R.sup.6a together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0558] R.sup.8a and R.sup.12a independently of one another
represent *--(CH.sub.2).sub.Z1a--OH,
*--(CH.sub.2).sub.Z2a--NHR.sup.13a, *--CONHR.sup.14a or
*--CH.sub.2CONHR.sup.15a,
[0559] wherein
[0560] * is the linkage site to the carbon atom,
[0561] Z1a and Z2a independently of one another are a number 1, 2
or 3,
[0562] R.sup.13a represents hydrogen or methyl,
[0563] and
[0564] R.sup.14a and R.sup.15a independently of one another
represent a group of formula ##STR49##
[0565] wherein
[0566] * is the linkage site to the nitrogen atom,
[0567] R.sup.4c represents hydrogen, amino or hydroxy,
[0568] R.sup.5c represents hydrogen, methyl or aminoethyl,
[0569] R.sup.6c represents hydrogen or aminoethyl,
[0570] kc is a number 0 or 1,
[0571] and
[0572] lc is a number 1, 2, 3 or 4,
[0573] R.sup.9a and R.sup.11a independently of one another
represent hydrogen or methyl,
[0574] R.sup.10a represents amino or hydroxy,
[0575] R.sup.16a represents a group of formula ##STR50##
[0576] wherein
[0577] * is the linkage site to the nitrogen atom,
[0578] R.sup.4d represents hydrogen, amino or hydroxy,
[0579] R.sup.5d represents hydrogen, methyl or aminoethyl,
[0580] R.sup.6d represents hydrogen or aminoethyl,
[0581] kd is a number 0 or 1,
[0582] and
[0583] ld is a number 1, 2, 3 or 4,
[0584] ka is a number 0 or 1,
[0585] and
[0586] la, wa, xa and ya independently of one another are a number
1, 2, 3 or 4,
[0587] y is a number 1, 2, 3 or 4, ##STR51## may when y equals 3
carry a hydroxy group,
[0588] and their salts, their solvates and the solvates of their
salts.
[0589] Preference is also given in the context of the present
invention to compounds of formula (I) or (Ia) in which
[0590] R.sup.3 represents a group of formula ##STR52##
[0591] whereby
[0592] * is the linkage site to the nitrogen atom,
[0593] A represents a bond or phenyl,
[0594] R.sup.16 and R.sup.17 independently of one another represent
a group of formula ##STR53##
[0595] wherein
[0596] * is the linkage site to the nitrogen atom,
[0597] R.sup.4b represents hydrogen, amino or hydroxy,
[0598] R.sup.5b represents hydrogen, methyl or aminoethyl,
[0599] R.sup.6b represents hydrogen or aminoethyl,
[0600] or
[0601] R.sup.5b and R.sup.6b together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0602] R.sup.8b and R.sup.12b independently of one another
represent *--(CH.sub.2).sub.Z1b--OH or
*--(CH.sub.2).sub.Z2b--NHR.sup.13b,
[0603] wherein
[0604] * is the linkage site to the carbon atom,
[0605] R.sup.13b represents hydrogen or methyl,
[0606] and
[0607] Z1b and Z2b independently of one another are a number 1, 2
or 3,
[0608] R.sup.9b and R.sup.11b independently of one another
represent hydrogen or methyl,
[0609] R.sup.10b represents amino or hydroxy,
[0610] kb is a number 0 or 1,
[0611] lb, wb, xb and yb independently of one another are a number
1, 2, 3 or 4,
[0612] d is a number 1, 2 or 3,
[0613] and their salts, their solvates and the solvates of their
salts.
[0614] Among these, particularly preferred compounds are those in
which R.sup.3 represents a group of formula ##STR54## in particular
a group of formula ##STR55##
[0615] Preference is also given in the context of the present
invention to compounds of formula (I) or (Ia) in which
[0616] R.sup.3 represents a group of formula ##STR56##
[0617] whereby
[0618] * is the linkage site to the nitrogen atom,
[0619] R.sup.18 and R.sup.19 independently of one another represent
hydrogen or a group of formula ##STR57##
[0620] wherein
[0621] * is the linkage site to the nitrogen atom,
[0622] R.sup.4e represents hydrogen, amino or hydroxy,
[0623] R.sup.5e represents hydrogen, methyl or aminoethyl,
[0624] R.sup.6e represents hydrogen or aminoethyl,
[0625] or
[0626] R.sup.5e and R.sup.6e together with the nitrogen atom to
which they are bonded form a piperazine ring,
[0627] R.sup.8e and R.sup.12e independently of one another
represent *--(CH.sub.2).sub.Z1e--OH or
*--(CH.sub.2).sub.Z2e--NHR.sup.13e,
[0628] wherein
[0629] * is the linkage site to the carbon atom,
[0630] R.sup.13e represents hydrogen or methyl,
[0631] and
[0632] Z1e and Z2e independently of one another are a number 1, 2
or 3,
[0633] R.sup.9e and R.sup.11e independently of one another
represent hydrogen or methyl,
[0634] R.sup.10e represents amino or hydroxy,
[0635] ke is a number 0 or 1,
[0636] and
[0637] le, we, xe and ye independently of one another are a number
1, 2, 3 or 4,
[0638] whereby R.sup.18 and R.sup.19 are not simultaneously
hydrogen,
[0639] e is a number 1, 2 or 3,
[0640] and their salts, their solvates and the solvates of their
salts.
[0641] The invention further relates to a process for preparing the
compounds of formula (I) or their salts, their solvates or the
solvates of their salts, whereby according to process
[0642] [A] compounds of formula ##STR58##
[0643] wherein R.sup.2 and R.sup.7 have the meaning mentioned
above, and boc is tert-butoxycarbonyl,
[0644] are reacted in a two-stage process firstly in the presence
of one or more dehydrating reagents with compounds of formula
H.sub.2NR.sup.3 (III),
[0645] wherein R.sup.3 has the meaning mentioned above,
[0646] and subsequently with an acid and/or by hydrogenolysis,
[0647] or
[0648] [B] compounds of formula ##STR59##
[0649] wherein R.sup.2 and R.sup.7 have the meaning mentioned
above, and Z is benzyloxycarbonyl,
[0650] are reacted in a two-stage process firstly in the presence
of one or more dehydrating reagents with compounds of formula
H.sub.2NR.sup.3 (III),
[0651] wherein R.sup.3 has the meaning mentioned above,
[0652] and subsequently with an acid or by hydrogenolysis.
[0653] The free base of the salts can for example be obtained by
chromatography on a reversed phase column using an
acetonitrile-water gradient with the addition of a base, in
particular by using an RP18 Phenomenex Luna C18(2) column and
diethylamine as base.
[0654] The invention further relates to a process for preparing the
compounds of formula (I) or their solvates as claimed in claim 1 in
which salts of the compounds or solvates of the salts of the
compounds are converted by chromatography with addition of a base
into the compounds.
[0655] The hydroxy group on R.sup.1 is protected where appropriate
during the reaction with compounds of formula (III) with a
tert-butyldimethylsilyl group which is removed in the second
reaction step.
[0656] Reactive functionalities in the radical R.sup.3 of compounds
of formula (III) are introduced into the synthesis already
protected, with preference for acid-labile protective groups (e.g.
boc). After the reaction has taken place to give compounds of
formula (I), the protective groups can be removed by a deprotection
reaction. This takes place by standard methods of protective group
chemistry. Deprotection reactions under acidic conditions or by
hydrogenolysis are preferred.
[0657] The reaction in the first stage of processes [A] and [B]
generally takes place in inert solvents, where appropriate in the
presence of a base, preferably in a temperature range from
0.degree. C. to 40.degree. C. under atmospheric pressure.
[0658] Examples of suitable dehydrating reagents in this connection
include carbodiimides such as, for example, N,N'-diethyl-,
N,N'-dipropyl-, N,N'-diisopropyl-, N,N'-dicyclohexylcarbodiimide,
N-(3-dimethylaminoisopropyl)-N'-ethylcarbodiimide hydrochloride
(EDC), N-cyclohexylcarbodiimide-N'-propyloxymethyl-polystyrene
(PS-carbodiimide) or carbonyl compounds such as
carbonyldiimidazole, or 1,2-oxazolium compounds such as
2-ethyl-5-phenyl-1,2-oxazolium 3-sulfate or
2-tert-butyl-5-methylisoxazolium perchlorate, or acylamino
compounds such as 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline,
or propanephosphonic anhydride, or isobutyl chloroformate, or
bis(2-oxo-3-oxazolidinyl)phosphoryl chloride or
benzotriazolyloxytri(dimethylamino)phosphonium hexafluorophosphate,
or O-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
hexafluorophosphate (HBTU),
2-(2-oxo-1-(2H)-pyridyl)-1,1,3,3-tetramethyluronium
tetrafluoroborate (TPTU) or
O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
hexafluorophosphate (HATU), or 1-hydroxybenzotriazole (HOBt), or
benzotriazol-1-yloxytris(dimethylamino)phosphonium
hexafluorophosphate (BOP), or mixtures thereof, or mixtures thereof
together with bases.
[0659] Examples of bases include alkali metal carbonates such as,
for example, sodium or potassium carbonate, or sodium or potassium
bicarbonate, or organic bases such as trialkylamines, e.g.
triethylamine, N-methylmorpholine, N-methylpiperidine,
4-dimethylaminopyridine or diisopropylethylamine.
[0660] The condensation with HATU is preferably carried out in the
presence of a base, in particular diisopropylethylamine, or with
EDC and HOBt in the presence of a base, in particular
triethylamine.
[0661] Examples of inert solvents include halohydrocarbons such as
dichloromethane or trichloromethane, hydrocarbon such as benzene,
or nitromethane, dioxane, dimethylformamide or acetonitrile. It is
likewise possible to employ mixtures of the solvents.
Dimethylformamide is particularly preferred.
[0662] The reaction with an acid in the second stage of processes
[A] and [B] preferably takes place in a temperature range from
0.degree. C. to 40.degree. C. under atmospheric pressure.
[0663] Suitable acids in this connection include hydrogen chloride
in dioxane, hydrogen bromide in acetic acid or trifluoroacetic acid
in methylene chloride.
[0664] The hydrogenolysis in the second stage of process [B]
generally takes place in a solvent in the presence of hydrogen and
palladium on activated carbon, preferably in a temperature range
from 0.degree. C. to 40.degree. C. under atmospheric pressure.
[0665] Examples of solvents include alcohols such as methanol,
ethanol, n-propanol or isopropanol, in a mixture with water and
glacial acetic acid, with preference for a mixture of ethanol,
water and glacial acetic acid.
[0666] The compounds of formula (III) are known or can be prepared
in analogy to known processes.
[0667] The compounds of formula (II) are known or can be prepared
by reacting compounds of formula ##STR60##
[0668] wherein R.sup.2 and R.sup.7 have the meaning mentioned
above,
[0669] with di(tert-butyl)dicarbonate in the presence of a
base.
[0670] The reaction generally takes place in a solvent, preferably
in a temperature range from 0.degree. C. to 40.degree. C. under
atmospheric pressure.
[0671] Examples of bases include alkali metal hydroxides such as
sodium or potassium hydroxide, or alkali metal carbonates such as
cesium carbonate, sodium or potassium carbonate, or other bases
such as DBU, triethylamine or diisopropylethylamine, with
preference for sodium hydroxide or sodium carbonate.
[0672] Examples of solvents include halohydrocarbons such as
methylene chloride or 1,2-dichloroethane, alcohols such as
methanol, ethanol or isopropanol, or water.
[0673] The reaction is preferably carried out with sodium hydroxide
in water or sodium carbonate in methanol.
[0674] The compounds of formula (V) are known or can be prepared by
reacting compounds of formula ##STR61##
[0675] wherein R.sup.2 and R.sup.7 have the meaning mentioned
above, and
[0676] R.sup.26 represents benzyl, methyl or ethyl,
[0677] with an acid or by hydrogenolysis as described for the
second stage of process [B], where appropriate by subsequent
reaction with a base to hydrolyse the methyl or ethyl ester.
[0678] The hydrolysis can take place for example as described for
the reaction of compounds of formula (VI) to give compounds of
formula (IV).
[0679] The compounds of formula (IV) are known or can be prepared
by hydrolysing the benzyl, methyl or ethyl ester in compounds of
formula (VI).
[0680] The reaction generally takes place in a solvent in the
presence of a base, preferably in a temperature range from
0.degree. C. to 40.degree. C. under atmospheric pressure.
[0681] Examples of bases include alkali metal hydroxide such as
lithium, sodium or potassium hydroxide, with preference for lithium
hydroxide.
[0682] Examples of solvents include halohydrocarbons such as
dichloromethane or trichloromethane, ethers, such as
tetrahydrofuran or dioxane, or alcohols such as methanol, ethanol
or isopropanol, or dimethylformamide. It is likewise possible to
employ mixtures of the solvents or mixtures of the solvents with
water. Tetrahydrofuran or a mixture of methanol and water are
particularly preferred.
[0683] The compounds of formula (VI) are known or can be prepared
by reacting compounds of formula ##STR62##
[0684] wherein R.sup.2, R.sup.7 and R.sup.26 have the meaning
mentioned above,
[0685] in the first stage with acids as described for the second
stage of processes [A] and [B], and in the second stage with
bases.
[0686] The reaction with bases in the second stage generally takes
place in a solvent, preferably in a temperature range from
0.degree. C. to 40.degree. C. under atmospheric pressure.
[0687] Examples of bases include alkali metal hydroxides such as
sodium or potassium hydroxide, or alkali metal carbonates such as
cesium carbonate, sodium or potassium carbonate, or other bases
such as DBU, triethylamine or diisopropylethylamine, with
preference for triethylamine.
[0688] Examples of solvents include halohydrocarbons such as
chloroform, methylene chloride or 1,2-dichloroethane, or
tetrahydrofuran, or mixtures of the solvents, with preference for
methylene chloride or tetrahydrofuran.
[0689] The compounds of formula (VII) are known or can be prepared
by reacting compounds of formula ##STR63##
[0690] wherein R.sup.2, R.sup.7 and R.sup.26 have the meaning
mentioned above,
[0691] with pentafluorophenol in the presence of dehydrating
reagents as described for the first stage of processes [A] and
[B].
[0692] The reaction preferably takes place with DMAP and EDC in
dichloromethane in a temperature range from -40.degree. C. to
40.degree. C. under atmospheric pressure.
[0693] The compounds of formula (VIII) are known or can be prepared
by reacting compounds of formula ##STR64##
[0694] wherein R.sup.2, R.sup.7 and R.sup.26 have the meaning
mentioned above,
[0695] with fluoride, in particular with tetrabutylammonium
fluoride.
[0696] The reaction generally takes place in a solvent, preferably
in a temperature range from -10.degree. C. to 30.degree. C. under
atmospheric pressure.
[0697] Examples of inert solvents include halohydrocarbons such as
dichloromethane, or hydrocarbons such as benzene or toluene, or
ethers such as tetrahydrofuran or dioxane, or dimethylformamide. It
is likewise possible to employ mixtures of the solvents.
Tetrahydrofuran and dimethylformamide are preferred solvents.
[0698] The compounds of formula (IX) are known or can be prepared
by reacting compounds of formula ##STR65##
[0699] wherein R.sup.2 and R.sup.26 have the meaning mentioned
above,
[0700] with compounds of formula ##STR66##
[0701] wherein R.sup.7 has the meaning mentioned above,
[0702] in the presence of dehydrating reagents as described for the
first stage of processes [A] and [B].
[0703] The compounds of formula (X) are known or can be prepared in
analogy to the processes described in the examples section.
[0704] The compounds of formula (XI) are known or can be prepared
in analogy to known processes.
[0705] The compounds of the invention show a valuable range of
pharmacological and pharmacokinetic effects which could not have
been predicted.
[0706] They are therefore suitable for use as medicaments for the
treatment and/or prophylaxis of diseases in humans and animals.
[0707] The compounds of the invention can, due to their
pharmacological properties, be employed alone or in combination
with other active ingredients for the treatment and/or prophylaxis
of infectious diseases, especially of bacterial infections.
[0708] For example, it is possible to treat and/or prevent local
and/or systemic diseases caused by the following pathogens or by
mixtures of the following pathogens: gram-positive cocci, e.g.
staphylococci (Staph. aureus, Staph. epidermidis) and streptococci
(Strept. agalactiae, Strept. faecalis, Strept. pneumoniae, Strept.
pyogenes); gram-negative cocci (neisseria gonorrhoeae) and
gram-negative rods such as enterobacteriaceae, e.g. Escherichia
coli, Haemophilus influenzae, Citrobacter (Citrob. freundii,
Citrob. divernis), Salmonella and Shigella; also klebsiellas
(Klebs. pneumoniae, Klebs. oxytocy), Enterobacter (Ent. aerogenes,
Ent. agglomerans), Hafnia, Serratia (Serr. marcescens), Proteus
(Pr. mirabilis, Pr. rettgeri, Pr. vulgaris), Providencia, Yersinia,
and the genus Acinetobacter. The antibacterial range additionally
includes the genus Pseudomonas (Ps. aeruginosa, Ps. maltophilia)
and strictly anaerobic bacteria such as Bacteroides fragilis,
representatives of the genus Peptococcus, Peptostreptococcus, and
the genus Clostridium; also mycoplasmas (M. pneumoniae, M. hominis,
M. urealyticum) and mycobacteria, e.g. Mycobacterium
tuberculosis.
[0709] The above list of pathogens is merely by way of example and
is by no means to be interpreted as limiting. Examples which may be
mentioned of diseases which are caused by the pathogens mentioned
or mixed infections and can be prevented, improved or healed by
preparations of the invention, which can be used topically,
are:
[0710] infectious diseases in humans such as, for example, septic
infections, bone and joint infections, skin infections,
postoperative wound infections, abscesses, phlegmon, wound
infections, infected burns, burn wounds, infections in the oral
region, infections after dental operations, septic arthritis,
mastitis, tonsillitis, genital infections and eye infections.
[0711] Apart from humans, bacterial infections can also be treated
in other species. Examples which may be mentioned are:
[0712] Pigs: coli diarrhea, enterotoxemia, sepsis, dysentery,
salmonellosis, metritis-mastitis-agalactiae syndrome, mastitis;
[0713] Ruminants (cattle, sheep, goats): diarrhea, sepsis,
bronchopneumonia, salmonellosis, pasteurellosis, mycoplasmosis,
genital infections;
[0714] Horses: bronchopneumonias, joint ill, puerperal and
postpuerperal infections, salmonellosis;
[0715] Dogs and cats: bronchopneumonia, diarrhea, dermatitis,
otitis, urinary tract infections, prostatitis;
[0716] Poultry (chickens, turkeys, quail, pigeons, ornamental birds
and others): mycoplasmosis, E. coli infections, chronic airway
diseases, salmonellosis, pasteurellosis, psittacosis.
[0717] It is likewise possible to treat bacterial diseases in the
rearing and management of productive and ornamental fish, in which
case the antibacterial spectrum is extended beyond the pathogens
mentioned above to further pathogens such as, for example,
Pasteurella, Brucella, Campylobacter, Listeria, Erysipelothris,
corynebacteria, Borellia, Treponema, Nocardia, Rikettsie,
Yersinia.
[0718] The present invention further relates to the use of the
compounds of the invention for the treatment and/or prophylaxis of
diseases, preferably of bacterial diseases, especially of bacterial
infections.
[0719] The present invention further relates to the use of the
compounds of the invention for the treatment and/or prophylaxis of
diseases, especially of the aforementioned diseases.
[0720] The present invention further relates to the use of the
compounds of the invention for the production of a medicament for
the treatment and/or prophylaxis of diseases, especially of the
aforementioned diseases.
[0721] The present invention further relates to a method for the
treatment and/or prophylaxis of diseases, especially of the
aforementioned diseases, using an antibacterially effective amount
of the compounds of the invention.
[0722] The compounds of the invention may act systemically and/or
locally. For this purpose, they can be administered in a suitable
way such as, for example, orally, parenterally, pulmonarily,
nasally, sublingually, lingually, buccally, rectally, dermally,
transdermally, conjuctivally or otically or as implant or
stent.
[0723] The compounds of the invention can be administered in
administration forms suitable for these administration routes.
[0724] Suitable for oral administration are administration forms
which function according to the prior art and deliver the compounds
of the invention rapidly and/or in modified fashion, and which
contain the compounds of the invention in crystalline and/or
amorphized and/or dissolved form, such as, for example, tablets
(uncoated or coated tablets, for example having coatings which are
resistant to gastric juice or are insoluble or dissolve with a
delay and control the release of the compound of the invention),
tablets or films/wafers, which disintegrate rapidly in the mouth,
films/lyophilisates, capsules (for example hard or soft gelatin
capsules), sugar-coated tablets, granules, pellets, powders,
emulsions, suspensions, aerosols or solutions.
[0725] Parenteral administration can take place with avoidance of
an absorption step (e.g. intravenous, intraarterial, intracardiac,
intraspinal or intralumbar) or with inclusion of an absorption
(e.g. intramuscular, subcutaneous, intracutaneous, percutaneous or
intraperitoneal). Administration forms suitable for parenteral
administration are, inter alia, preparations for injection and
infusion in the form of solutions, suspensions, emulsions,
lyophilisates or sterile powders.
[0726] Suitable for the other administration routes are, for
example, pharmaceutical forms for inhalation (inter alia powder
inhalers, nebulizers), nasal drops, solutions, sprays; tablets,
films/wafers or capsules for lingual, sublingual or buccal
administration, suppositories, preparations for the ears or eyes,
vaginal capsules, aqueous suspensions (lotions, shaking mixtures),
lipophilic suspensions, ointments, creams, transdermal therapeutic
systems (such as, for example, patches), milk, pastes, foams,
dusting powders, implants or stents.
[0727] The compounds of the invention can be converted into the
stated administration forms. This can take place in a manner known
per se by mixing with inert, nontoxic, pharmaceutically suitable
excipients. These excipients include, inter alia, carriers (for
example microcrystalline cellulose, lactose, mannitol), solvents
(e.g. liquid polyethylene glycols), emulsifiers and dispersants or
wetting agents (for example sodium dodecyl sulfate, polyoxysorbitan
oleate), binders (for example polyvinylpyrrolidone), synthetic and
natural polymers (for example albumin), stabilizers (e.g.
antioxidants such as, for example, ascorbic acid), colors (e.g.
inorganic pigments such as, for example, iron oxides) and taste
and/or odor corrigents.
[0728] The present invention further relates to medicaments which
comprise at least one compound of the invention, normally together
with one or more inert, nontoxic, pharmaceutically suitable
excipients, and to the use thereof for the aforementioned
purposes.
[0729] It has generally proved advantageous on parenteral
administration to administer amounts of about 5 to 250 mg/kg of
body weight per 24 h to achieve effective results. The amount on
oral administration is about 5 to 100 mg/kg of body weight per 24
h.
[0730] It may nevertheless be necessary where appropriate to
deviate from the stated amounts, in particular as a function of the
body weight, administration route, individual behavior towards the
active ingredient, nature of the preparation and time or interval
over which administration takes place. Thus, it may be sufficient
in some cases to make do with less than the aforementioned minimum
amount, whereas in other cases the stated upper limit must be
exceeded. Where larger amounts are administered, it may be
advisable to divide these into a plurality of single doses over the
day.
[0731] The percentage data in the following tests and examples are
percentages by weight unless otherwise indicated; parts are parts
by weight. Solvent ratios, dilution ratios and concentration data
for liquid/liquid solutions are in each case based on volume.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
A. Examples
Abbreviations Used
[0732] abs. Absolute
[0733] aq. aqueous
[0734] Bn benzyl
[0735] boc tert-butoxycarbonyl
[0736] CDCl.sub.3 chloroform
[0737] CH cyclohexane
[0738] d doublet (in .sup.1H NMR)
[0739] dd doublet of doublets (in .sup.1H NMR)
[0740] DCC dicyclohexylcarbodiimide
[0741] DIC diisopropylcarbodiimide
[0742] DIEA diisopropylethylamine (Hunig's base)
[0743] DMSO dimethylsulfoxide
[0744] DMAP 4-N,N-dimethylaminopyridine
[0745] DMF dimethylformamide
[0746] EA ethyl acetate (acetic acid ethyl ester)
[0747] EDC
N'-(3-dimethylaminopropyl)-N-ethylcarbodiimide.times.HCl
[0748] ESI electrospray ionization (in MS)
[0749] Fmoc 9-fluorenylmethoxycarbonyl
[0750] HATU O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
hexafluorophosphate
[0751] HBTU O-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
hexafluorophosphate
[0752] HOBt 1-hydroxy-1H-benzotriazole.times.H.sub.2O
[0753] h hour(s)
[0754] HPLC high pressure, high performance liquid
chromatography
[0755] LC-MScoupled liquid chromatography-mass spectroscopy
[0756] m multiplet (in .sup.1H NMR)
[0757] min minute
[0758] MS mass spectroscopy
[0759] NMR nuclear magnetic resonance spectroscopy
[0760] MTBE methyl tert-butyl ether
[0761] Pd/C palladium/carbon
[0762] q quartet (in .sup.1H NMR)
[0763] R.sub.f retention index (in TLC)
[0764] RP reverse phase (in HPLC)
[0765] RT room temperature
[0766] R.sub.t retention time (in HPLC)
[0767] singlet (in .sup.1H NMR)
[0768] sat saturated
[0769] t triplet (in .sup.1H NMR)
[0770] TBS tert-butyldimethylsilyl
[0771] TFA trifluoroacetic acid
[0772] THF tetrahydrofuran
[0773] TLC thin-layer chromatography
[0774] TMSE 2-(trimethylsilyl)ethyl
[0775] TPTU 2-(2-oxo-1(2H)-pyridyl)-1,1,3,3,-tetramethyluronium
tetrafluoroborate
[0776] Z benzyloxycarbonyl
[0777] LC-MS and HPLC Methods:
[0778] Method 1 (HPLC): Instrument: HP 1100 with DAD detection;
column: Kromasil RP-18, 60 mm.times.2 mm, 3.5 .mu.m; eluent A: 5 ml
of perchloric acid/l of water, eluent B: acetonitrile; gradient: 0
min 2% B, 0.5 min 2% B, 4.5 min 90% B, 6.5 min 90% B; flow rate:
0.75 ml/min; oven: 30.degree. C.; UV detection: 210 nm.
[0779] Method 2 (LC-MS): Instrument: Micromass Platform LCZ;
column: Symmetry C18, 50 mm.times.2.1 mm, 3.5 .mu.m; temperature:
40.degree. C.; flow rate: 0.5 ml/min; eluent A: acetonitrile+0.1%
formic acid, eluent B: water+0.1% formic acid, gradient: 0.0 min
10% A.fwdarw.4 min 90% A.fwdarw.6 min 90% A.
[0780] Method 3 (LC-MS): Instrument: Waters Alliance 2790 LC;
column: Symmetry C18, 50 mm.times.2.1 mm, 3.5 .mu.m; eluent A:
water+0.1% formic acid, eluent B: acetonitrile+0.1% formic acid;
gradient: 0.0 min 5% B.fwdarw.5.0 min 10% B.fwdarw.6.0 min 10% B;
temperature: 50.degree. C.; flow rate: 1.0 ml/min; UV detection:
210 nm.
[0781] Method 4 (LC-MS): ZMD Waters; column: Inertsil ODS3 50
mm.times.2.1 mm, 3 .mu.m; temperature: 40.degree. C.; flow rate:
0.5 ml/min; eluent A: water+0.05% formic acid, eluent B:
acetonitrile+0.05% formic acid, gradient: 0.0 min 5% B.fwdarw.12
min.fwdarw.100% B.fwdarw.15 min 100% B.
[0782] Method 5 (LC-MS): MAT 900, Finnigan MAT, Bremen; column:
X-terra 50 mm.times.2.1 mm, 2.5 .mu.m; temperature: 25.degree. C.;
flow rate: 0.5 ml/min; eluent A: water+0.01% formic acid, eluent B:
acetonitrile+0.01% formic acid, gradient: 0.0 min 10% B.fwdarw.15
min.fwdarw.90% B.fwdarw.30 min 90% B.
[0783] Method 6 (LC-MS): TSQ 7000, Finnigan MAT, Bremen; column:
Inertsil ODS3 50 mm.times.2.1 mm, 3 .mu.m; temperature: 25.degree.
C.; flow rate: 0.5 ml/min; eluent A: water+0.05% formic acid,
eluent B: acetonitrile+0.05% formic acid, gradient: 0.0 min 15%
B.fwdarw.15 min.fwdarw.100% B.fwdarw.30 min 100% B.
[0784] Method 7 (LC-MS): 7 Tesla Apex II with external electrospray
ion source, Bruker Daltronics; column: X-terra C18 50 mm.times.2.1
mm, 2.5 .mu.m; temperature: 25.degree. C.; flow rate: 0.5 ml/min;
eluent A: water+0.1% formic acid, eluent B: acetonitrile+0.1%
formic acid, gradient: 0.0 min 5% B.fwdarw.13 min.fwdarw.100%
B.fwdarw.15 min 100% B.
[0785] Method 8 (LC-MS): MS instrument type: Micromass ZQ; HPLC
instrument type: Waters Alliance 2795; column: Merck Chromolith
SpeedROD RP-18e 50.times.4.6 mm; eluent A: water+500 .mu.l of 50%
formic acid/l; eluent B: acetonitrile+500 .mu.l of 50% formic
acid/l; gradient: 0.0 min 10% B.fwdarw.2.0 min 95% B.fwdarw.4.0 min
95% B; oven: 35.degree. C.; flow rate: 0.0 min 1.0
ml/min.fwdarw.2.0 min 3.0 ml/min.fwdarw.4.0 min 3.0 ml/min; UV
detection: 210 nm.
[0786] Method 9 (LC-MS): Instrument: Micromass Platform LCZ with
HPLC Agilent series 1100; column: Grom-SIL1200DS-4 HE, 50
mm.times.2.0 mm, 3 .mu.m; eluent A: 1 l of water+1 ml of 50% formic
acid, eluent B: 1 l of acetonitrile+1 ml of 50% formic acid;
gradient: 0.0 min 100% A.fwdarw.0.2 min 100% A.fwdarw.2.9 min 30%
A.fwdarw.3.1 min 10% A.fwdarw.4.5 min 10% A; oven: 55.degree. C.;
flow rate: 0.8 ml/min; UV detection: 210 nm.
[0787] Method 10 (LC-MS): MS instrument type: Micromass ZQ; HPLC
instrument type: Waters Alliance 2795; column: Merck Chromolith
SpeedROD RP-18e 50.times.4.6 mm; eluent A: water+500 .mu.l of 50%
formic acid/l; eluent B: acetonitrile+500 .mu.l of 50% formic
acid/l; gradient: 0.0 min 10% B.fwdarw.3.0 min 95% B.fwdarw.4.0 min
95% B; oven: 35.degree. C.; flow rate: 0.0 min 1.0
ml/min.fwdarw.3.0 min 3.0 ml/min.fwdarw.4.0 min 3.0 ml/min; UV
detection: 210 nm.
[0788] Method 11 (LC-MS): MS instrument type: Micromass ZQ; HPLC
instrument type: Waters Alliance 2790; column: Uptisphere C 18, 50
mm.times.2.0 mm, 3.0 .mu.m; eluent B: acetonitrile+0.05% formic
acid, eluent A: water+0.05% formic acid; gradient: 0.0 min 5%
B.fwdarw.2.0 min 40% B.fwdarw.4.5 min 90% B.fwdarw.5.5 min 90% B;
oven: 45.degree. C.; flow rate: 0.0 min 0.75 ml/min.fwdarw.4.5 min
0.75 ml/min.fwdarw.5.5 min 1.25 ml/min; UV detection: 210 nm.
[0789] Method 12 (LC-MS): MS instrument type: Micromass ZQ; HPLC
instrument type: Waters Alliance 2795; column: Phenomenex Synergi
2.mu. Hydro-RP Mercury 20.times.4 mm; eluent A: 1 l of water+0.5 ml
of 50% formic acid, eluent B: 1 l of acetonitrile+0.5 ml of 50%
formic acid; gradient: 0.0 min 90% A (flow rate: 1
ml/min).fwdarw.2.5 min 30% A (flow rate: 2 ml/min).fwdarw.3.0 min
5% A (flow rate: 2 ml/min).fwdarw.4.5 min 5% A (flow rate: 2
ml/min); oven: 50.degree. C.; UV detection: 210 nm.
[0790] Method 13 (LC-MS): MS instrument type: Micromass ZQ; HPLC
instrument type: HP 1100 series; UV DAD; column: Grom-Sil 1200DS-4
HE 50.times.2 mm, 3.0 .mu.m; eluent A: water+500 .mu.l of 50%
formic acid/l, eluent B: acetonitrile+500 .mu.l of 50% formic
acid/l; gradient: 0.0 min 70% B.fwdarw.4.5 min 90% B; oven:
50.degree. C., flow rate: 0.8 ml/min, UV detection: 210 nm.
[0791] Method 14 (LC-MS): Instrument: Micromass Quattro LCZ, with
HPLC Agilent series 1100; column: Grom-SIL1200DS-4 HE, 50
mm.times.2.0 mm, 3 .mu.m; eluent A: 1 l of water+1 ml of 50% formic
acid, eluent B: 1 l of acetonitrile+1 ml of 50% formic acid;
gradient: 0.0 min 100% A.fwdarw.0.2 min 100% A.fwdarw.2.9 min 30%
A.fwdarw.3.1 min 10% A.fwdarw.4.5 min 10% A; oven: 55.degree. C.;
flow rate: 0.8 ml/min; UV detection: 208-400 nm.
[0792] Method 15 (LC-MS): MS instrument type: Micromass ZQ; HPLC
instrument type: Waters Alliance 2790; column: Grom-Sil 1200DS-4 HE
50.times.2 mm, 3.0 .mu.m; eluent A: water+500 .mu.l of 50% formic
acid; eluent B: acetonitrile+500 .mu.l of 50% formic acid/l;
gradient: 0.0 min 5% B.fwdarw.2.0 min 40% B.fwdarw.4.5 min 90%
B.fwdarw.5.5 min 90% B; oven: 45.degree. C.; flow rate: 0.0 min
0.75 ml/min.fwdarw.4.5 min 0.75 ml 5.5 min.fwdarw.5.5 min 1.25 ml;
UV detection: 210 nm.
[0793] Method 16 (HPLC): Instrument: HP 1100 with DAD detection;
column: Kromasil RP-18, 60 mm.times.2 mm, 3.5 .mu.m; eluent A: 5 ml
of perchloric acid/l of water, eluent B: acetonitrile; gradient: 0
min 2% B, 0.5 min 2% B, 4.5 min 90% B, 15 min 90% B; flow rate:
0.75 ml/min; oven: 30.degree. C.; UV detection: 210 nm.
[0794] Method 17 (LC-MS): MS instrument type: Micromass ZQ; HPLC
instrument type: HP 1100 series; UV DAD; column: Phenomenex Synergi
2.mu. Hydro-RP Mercury 20 mm.times.4 mm; eluent A: 1 l of water+0.5
ml of 50% formic acid, eluent B: 1 l of acetonitrile+0.5 ml of 50%
formic acid; gradient: 0.0 min 90% A.fwdarw.2.5 min 30%
A.fwdarw.3.0 min 5% A.fwdarw.4.5 min 5% A; flow rate: 0.0 min 1
ml/min, 2.5 min/3.0 min/4.5 min 2 ml/min; oven: 50.degree. C.; UV
detection: 210 nm.
[0795] Method 18 (LC-MS): Instrument: Micromass Platform LCZ with
HPLC Agilent series 1100; column: Phenomenex Synergi 2.mu. Hydro-RP
Mercury 20 mm.times.4 mm; eluent A: 1 l of water+0.5 ml of 50%
formic acid, eluent B: 1 l of acetonitrile+0.5 ml of 50% formic
acid; gradient: 0.0 min 90% A.fwdarw.2.5 min 30% A.fwdarw.3.0 min
5% A.fwdarw.4.5 min 5% A; flow rate: 0.0 min 1 ml/min, 2.5 min/3.0
min/4.5 min 2 ml/min; oven: 50.degree. C.; UV detection: 210
nm.
[0796] Method 19 (LC-MS): Instrument: Micromass Quattro LCZ with
HPLC Agilent series 1100; column: Phenomenex Synergi 2.mu. Hydro-RP
Mercury 20 mm.times.4 mm; eluent A: 1 l of water+0.5 ml of 50%
formic acid, eluent B: 1 l of acetonitrile+0.5 ml of 50% formic
acid; gradient: 0.0 min 90% A.fwdarw.2.5 min 30% A.fwdarw.3.0 min
5% A.fwdarw.4.5 min 5% A; flow rate: 0.0 min 1 ml/min, 2.5 min/3.0
min/4.5 min 2 ml/min; oven: 50.degree. C.; UV detection: 208-400
nm.
[0797] Method 20 (LC-MS): Instrument: Micromass Platform LCZ with
HPLC Agilent series 1100; column: ThermoHypersil-Keystone HyPurity
Aquastar, 50 mm.times.2.1 mm, 3 .mu.m; eluent A: 1 l of water+1 ml
of 50% formic acid, eluent B: 1 l of acetonitrile+1 ml of 50%
formic acid; gradient: 0.0 min 100% A.fwdarw.0.2 min 100%
A.fwdarw.2.9 min 30% A.fwdarw.3.1 min 10% A.fwdarw.4.5 min 10% A;
oven: 55.degree. C.; flow rate: 0.8 ml/min; UV detection: 210
nm.
[0798] Method 21 (preparative HPLC/RP-HPLC): column: RP18
Phenomenex Luna C18(2) (New Column), 250 mm.times.21.2 mm, 5 .mu.m
(Phenomenex, Aschaffenburg, Germany), eluent: acetonitrile-water
gradient with addition of 0.2% diethylamine.
[0799] Method 22 (HPLC): Instrument: HP 1100 with DAD detection;
column: Kromasil RP-18, 60 mm.times.2 mm, 3.5 .mu.m; eluent A: 5 ml
of perchloric acid/l of water, eluent B: acetonitrile; gradient: 0
min 2% B, 0.5 min 2% B, 4.5 min 90% B, 9 min 90% B; flow rate: 0.75
ml/min; oven: 30.degree. C.; UV detection: 210 nm.
[0800] Method 23 (LC-MS): Instrument: Micromass Platform LCZ with
HPLC agilent series 1100; column: Thermo Hypersil GOLD-3.mu.
20.times.4 mm; eluent A: 1 l of water+0.5 ml of 50% formic acid,
eluent B: 1 l of acetonitrile+0.5 ml of 50% formic acid; gradient:
0.0 min 100% A.fwdarw.0.2 min 100% A.fwdarw.2.9 min 30%
A.fwdarw.3.1 min 10% A.fwdarw.5.5 min 10% A; oven: 50.degree. C.;
flow rate: 0.8 ml/min; UV detection: 210 nm.
[0801] Chemical Synthesis of the Examples
[0802] Synthesis of the Starting Compounds:
Synthesis of substituted phenylalanine derivatives using
(-)-3-(2-benzyloxy-5
iodophenyl)-2(S)-tert-butoxycarbonylaminopropionic acid [(-)-6A] as
example
[0803] ##STR67##
Synthesis of protected hydroxyornithine derivatives using
5-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamino-4(R)-(tert-butyldi-
methylsilyloxy)pentanoic acid (14A) as example
[0804] ##STR68##
Synthesis of substituted phenylalanine derivatives using methyl
2-(benzyloxy)-N-[(benzyloxy)carbonyl]-5-bromo-L-phenylalaninate]
(56A) as example
[0805] ##STR69##
Synthesis of protected biphenylbisamino acids using
2(S)-trimethylsilanylethyl
2(S)-benzyloxycarbonylamino-3-[4,4'-bis-benzyloxy-3'-(2(S)-benzyloxycarbo-
nyl-2(S)-tert-butoxycarbonylaminoethyl)biphenyl-3-yl]propionate
(12A) as example
[0806] ##STR70##
[0807] Cyclization of the Biphenylbisamino Acids ##STR71##
[0808] Starting Compounds
Example 1A
2-Hydroxy-5-iodobenzaldehyde
[0809] ##STR72##
[0810] A solution of 250 g (1.54 mol) of iodine chloride in 600 ml
of anhydrous dichloromethane is added dropwise over the course of 2
h to a solution of 188 g (1.54 mol) of salicylaldehyde in 1 l of
anhydrous dichloromethane in a heat-dried flask under argon. After
stirring at RT for 3 days, a saturated aqueous sodium sulfite
solution is added with vigorous stirring. The organic phase is
separated, washed once with water and a saturated aqueous sodium
chloride solution and dried over sodium sulfate. The solvent is
evaporated and the residue is recrystallized from ethyl acetate.
216 g (57% of theory) of product are obtained.
[0811] LC-MS (ESI, Method 4): m/z=246 (M-H).sup.-.
[0812] .sup.1H-NMR (400 MHz, CDCl.sub.3): .delta.=6.7 (d, 1H), 7.77
(dd, 1H), 7.85 (d, 1H), 9.83 (s, 1H), 10.95 (s, 1H).
Example 2A
2-Benzyloxy-5-iodobenzaldehyde
[0813] ##STR73##
[0814] 67.2 g (0.48 mol) of potassium carbonate are added to a
solution of 100 g (0.40 mol) of 2-hydroxy-5-iodobenzaldehyde
(Example 1A) in 1.5 l of dimethylformamide and, after a few
minutes, 51 ml (0.44 mol) of benzyl chloride are added. The
reaction mixture is stirred under reflux at 120.degree. C. for 24
h. After stirring at RT for a further 24 h and the addition of 1.5
l of water, a solid crystallizes out. The precipitate is collected
by suction filtration, washed twice with water and dried in vacuo.
The solid is recrystallized from 230 ml of ethanol. 122.9 g (90% of
theory) of product are obtained.
[0815] LC-MS (ESI, Method 4): m/z=338 (M+H).sup.+.
[0816] .sup.1H-NMR (400 MHz, CDCl.sub.3): .delta.=5.18 (s, 2H),
6.84 (d, 1H), 7.33-7.45 (m, 5H), 7.78 (dd, 1H), 8.12 (d, 1H), 10.4
(s, 1H).
Example 3A
(2-Benzyloxy-5-iodophenyl)methanol
[0817] ##STR74##
[0818] 100 ml of a 1M diisobutylaluminum hydride solution in
dichloromethane are added to a solution, cooled to 0.degree. C., of
33.98 g (100.5 mmol) of 2-benzyloxy-5-iodobenzaldehyde (Example 2A)
in 200 ml of dichloromethane. After stirring at 0.degree. C. for 2
h, a saturated potassium sodium tartrate solution is added while
cooling (highly exothermic reaction), and the reaction mixture is
stirred for a further 2 h. After the separation of the phases, the
organic phase is washed twice with water and once with a saturated
aqueous sodium chloride solution and dried over sodium sulfate. The
solvent is evaporated in vacuo. 31.8 g (93% of theory) of product
are obtained.
[0819] .sup.1H-NMR (400 MHz, CDCl.sub.3): .delta.=2.17 (t, 1H),
4.68 (d, 2H), 5.1 (s, 2H), 6.72 (d, 1H), 7.32-7.42 (m, 5H), 7.54
(dd, 1H), 7.63 (d, 1H).
Example 4A
1-Benzyloxy-2-bromomethyl-4-iodobenzene
[0820] ##STR75##
[0821] 3.3 ml (35 mmol) of phosphorus tribromide are added dropwise
to a solution of 35 g (103 mmol) of
(2-benzyloxy-5-iodophenyl)methanol (Example 3A) in 350 ml of
toluene at 40.degree. C. The temperature of the reaction mixture is
raised to 100.degree. C. over the course of 15 min and the reaction
mixture is stirred at this temperature for a further 10 min. After
cooling, the two phases are separated. The organic phase is washed
twice with distilled water and once with a saturated aqueous sodium
chloride solution. The organic phase is dried over sodium sulfate
and evaporated. The yield amounts to 41 g (99% of theory).
[0822] .sup.1H-NMR (300 MHz, CDCl.sub.3): .delta.=4.45 (s, 2H),
5.06 (s, 2H), 7.30 (m, 8H).
Example 5A
Diethyl
2-(2-benzyloxy-5-iodobenzyl)-2-tert-butoxycarbonylaminomalonate
[0823] ##STR76##
[0824] 41 g (101.7 mmol) of 1-benzyloxy-2-bromomethyl-4-iodobenzene
(Example 4A) are added to a solution of 28 g (101.7 mmol) of
diethyl 2-[N-(tert-butoxycarbonyl)amino]malonate and 7.9 ml (101.7
mmol) of sodium ethoxide in 300 ml of ethanol. After stirring at RT
for 3 h, the precipitated product is collected by suction
filtration. After drying in vacuo, 55 g (90% of theory) of product
are isolated.
[0825] .sup.1H-NMR (400 MHz, CDCl.sub.3): .delta.=1.12 (t, 6H),
1.46 (s, 9H), 3.68 (s, 2H), 3.8-3.9 (m, 2H), 4.15-4.25 (m, 2H), 5.0
(s, 2H), 5.7 (s, 1H), 6.58 (d, 1H), 7.28-7.4 (m, 6H), 7.4 (dd,
1H).
Example 6A
(+/-)-3-(2-Benzyloxy-5-iodophenyl)-2-tert-butoxycarbonylaminopropionic
acid
[0826] ##STR77##
[0827] 400 ml of a 1N sodium hydroxide solution are added to a
suspension of 58 g (97 mmol) of diethyl
2-(2-benzyloxy-5-iodobenzyl)-2-tert-butoxycarbonylaminomalonate
(Example 5A) in 800 ml of a mixture of ethanol and water (7:3).
After 3 h under reflux and after cooling to room temperature, the
pH of the reaction mixture is adjusted to about pH 2 with conc.
hydrochloric acid. The reaction mixture is evaporated. The residue
is taken up in MTBE and water. The aqueous phase is extracted three
times with MTBE. The combined organic phases are dried over sodium
sulfate, filtered and concentrated. After drying in vacuo 47 g (97%
of theory) of product are obtained.
[0828] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): .delta.=1.32 (s, 9H),
2.68 (dd, 1H), 3.18 (dd, 1H), 4.25 (m, 1H), 5.15 (s, 2H), 6.88 (d,
1H), 7.08 (d, 1H), 7.30-7.40 (m, 3H), 7.45-7.55 (m, 3H).
Example (-)-6A
3-(2-Benzyloxy-5-iodophenyl)-2(S)-tert-butoxycarbonylaminopropionic
acid
[0829] ##STR78##
[0830] The racemate from Example 6A
[(+/-)-3-(2-benzyloxy-5-iodophenyl)-2(S)-tert-butoxycarbonylaminopropioni-
c acid] is separated on a chiral stationary silica gel phase based
on the selector from poly(N-methacryloyl-L-leucine
dicyclopropylmethylamide) using an i-hexane/ethyl acetate mixture
as eluent. The enantiomer eluted first (98.9% ee) is dextrorotatory
in dichloromethane ([.alpha.].sub.D.sup.21: +3.0.degree., c=0.54,
dichloromethane) and corresponds to the (R) enantiomer Example
(+)-6A, as was determined by single-crystal X-ray structural
analysis. The purity of the second, levorotatory enantiomer Example
(-)-6A, i.e. the (S) enantiomer, is >99% ee.
Example 7A
Benzyl
3-(2-benzyloxy-5-iodophenyl)-2(S)-tert-butoxycarbonylaminopropionat-
e
[0831] ##STR79##
[0832] Under argon, 10 g (20.11 mmol) of
(-)-3-(2-benzyloxy-5-iodophenyl)-2(S)-tert-butoxycarbonylaminopropionic
acid (Example (-)-6A) are dissolved in 200 ml of acetonitrile. To
this are added 246 mg (2.01 mmol) of 4-dimethylaminopyridine and
4.16 ml (40.22 mmol) of benzyl alcohol. The mixture is cooled to
-10.degree. C., and 4.63 g (24.13 mmol) of EDC are added. The
mixture is allowed slowly to reach RT and is stirred overnight.
After about 16 h, the mixture is concentrated on a rotary
evaporator in vacuo, and the residue is purified by column
chromatography on silica gel (mobile phase: dichloromethane).
Yield: 10.65 g (88% of theory).
[0833] HPLC (Method 1): R.sub.t=6.03 min; LC-MS (Method 3):
R.sub.t=4.70 min
[0834] MS (DCI): m/z=605 (M+NH.sub.4).sup.+.
[0835] .sup.1H-NMR (200 MHz, CDCl.sub.3): .delta.=1.38 (s, 9H),
2.97 (dd, 1H), 3.12 (dd, 1H), 4.50-4.70 (m, 1H), 5.00-5.10 (m, 4H),
5.22 (d, 1H), 6.64 (d, 1H), 7.28-7.36 (m, 7H), 7.37-7.52 (m,
5H).
Example 8A
Benzyl
3-[2-benzyloxy-5-(4,4,5,5-tetramethyl[1,3,2]dioxaborolan-2-yl)pheny-
l]-2(S)-tert-butoxycarbonylaminopropionate
[0836] ##STR80##
[0837] 5.15 g (52.60 mmol) of potassium acetate are added to a
solution of 10.30 g (17.53 mol) of benzyl
3-(2-benzyloxy-5-iodophenyl)-2(S)-tert-butoxycarbonylaminopropionate
(Example 7A) in 70 ml of DMSO. The mixture is deoxygenated by
passing argon through the vigorously stirred solution for 15 min.
Then 5.17 g (20.16 mmol) of bis(pinacolato)diborane and 515 mg
(0.70 mmol) of bis(diphenylphosphino)ferrocenepalladium(II)
chloride are added. The mixture is then heated to 80.degree. C.
under a gentle stream of argon and after 6 h is cooled again. The
mixture is filtered through silica gel (mobile phase:
dichloromethane). The residue is purified by column chromatography
on silica gel (mobile phase: cyclohexane:ethyl acetate 4:1).
[0838] Yield: 8.15 g (79% of theory)
[0839] HPLC (Method 1): R.sub.t=6.26 min
[0840] LC-MS (Method 2): R.sub.t=5.93 and 6.09 min
[0841] MS (EI): m/z=588 (M+H).sup.+
[0842] .sup.1H-NMR (200 MHz, CDCl.sub.3): .delta.=1.26 (s, 6H),
1.33 (s, 9H), 1.36 (s, 6H), 2.91-3.10 (m, 1H), 3.12-3.28 (m, 1H),
4.49-4.68 (m, 1H), 5.05 (dd, 2H), 5.11 (dd, 2H), 5.30 (d, 1H), 6.90
(d, 1H), 7.27-7.37 (m, 7H), 7.38-7.42 (m, 3H), 7.55-7.62 (m, 1H),
7.67 (dd, 1H).
Example 9A
2(S)-Amino-3-(2-benzyloxy-5-iodophenyl)propionic acid
hydrochloride
[0843] ##STR81##
[0844] 12 g (24.13 mmol) of
3-(2-benzyloxy-5-iodophenyl)-2(S)-tert-butoxycarbonylaminopropionic
acid (Example (-)-6A) are added under argon into 60 ml of a 4M
solution of hydrogen chloride in dioxane and stirred at RT for 2 h.
The reaction solution is concentrated and dried under high
vacuum.
[0845] Yield: 10.47 g (100% of theory)
[0846] HPLC (Method 1): R.sub.t=4.10 min
[0847] MS (EI): m/z=398 (M+H-HCl).sup.+
[0848] .sup.1H-NMR (200 MHz, CDCl.sub.3): .delta.=3.17-3.31 (m,
1H), 3.33-3.47 (m, 1H), 4.22 (t, 1H), 5.13 (s, 2H), 6.69 (d, 1H),
7.24-7.40 (m, 2H), 7.41-7.45 (m, 2H), 7.48 (d, 1H), 7.52 (d, 1H),
7.60 (d, 1H), 8.66 (br. s, 2H).
Example 10A
2(S)-Benzyloxycarbonylamino-3-(2-benzyloxy-5-iodophenyl)propionic
acid
[0849] ##STR82##
[0850] 9.25 ml (53.09 mol) of N,N-diisopropylethylamine are added
to a solution of 10.46 g (24.13 mmol) of
2(S)-amino-3-(2-benzyloxy-5-iodophenyl)propionic acid hydrochloride
(Example 9A) in DMF. 6.615 g (26.54 mmol) of
N-(benzyloxycarbonyl)succinimide (Z-OSuc) are added thereto. The
resulting solution is stirred overnight and then concentrated on a
rotary evaporator in vacuo. The residue is taken up in
dichloromethane and extracted twice each with a 0.1N hydrochloric
acid solution and a saturated aqueous sodium chloride solution. The
organic phase is dried, filtered and concentrated. The mixture is
purified by column chromatography on silica gel (mobile phase:
cyclohexane/diethyl ether 9:1 to 8:2).
[0851] Yield: 8.30 g (65% of theory)
[0852] HPLC (Method 1): R.sub.t=5.01 min
[0853] MS (EI): m/z=532 (M+H).sup.+
[0854] .sup.1H-NMR (200 MHz, DMSO-d.sub.6): .delta.=3.14-3.3 (m,
2H), 4.25-4.45 (m, 1H), 4.97 (s, 2H), 5.14 (s, 2H), 6.88 (d, 1H),
7.20-7.56 (m, 12H), 7.62 (d, 1H), 12.73 (br. s, 1H).
Example 11A
(2-Trimethylsilyl)ethyl
2(S)-benzyloxycarbonylamino-3-(2-benzyloxy-5-iodophenyl)-propionate
[0855] ##STR83##
[0856] 8.35 g (15.7 mmol) of
2(S)-benzyloxycarbonylamino-3-(2-benzyloxy-5-iodophenyl)propionic
acid (Example 10A) are provided in 150 ml of THF, and 2.14 g (18.07
mmol) of 2-trimethylsilylethanol and 250 mg (2.04 mmol) of
4-dimethylaminopyridine are added. The mixture is cooled to
0.degree. C., and 2.38 g (2.95 ml, 18.86 mmol) of
N,N'-diisopropylcarbodiimide dissolved in 40 ml of THF are added.
The mixture is stirred at RT overnight and concentrated on a rotary
evaporator in vacuo for the work-up. The residue is taken up in
dichloromethane and extracted twice each with a 0.1N hydrochloric
acid solution and a saturated aqueous sodium chloride solution. The
organic phase is dried, filtered and concentrated. The mixture is
purified by column chromatography (silica gel, mobile phase:
cyclohexane/diethyl ether 9:1 to 8:2).
[0857] Yield: 8.2 g (83% of theory)
[0858] HPLC (Method 1): R.sub.t=6.42 min
[0859] MS (EI): m/z=532 (M+H).sup.+
[0860] .sup.1H-NMR (300 MHz, CDCl.sub.3): .delta.=0.01 (s, 9H),
0.88 (t, 2H), 2.96 (dd, 1H), 3.13 (dd, 1H), 4.04-4.17 (m, 2H),
4.51-4.62 (m, 1H), 4.95-5.05 (m, 4H), 5.44 (d, 1H), 6.64 (d, 1H),
7.25-7.33 (m, 7H), 7.37 (dd, 4H), 7.45 (dd, 1H).
Example 12A
2-(Trimethylsilyl)ethyl
2(S)-benzyloxycarbonylamino-3-[4,4'-bisbenzyloxy-3'-(2(S)-benzyloxycarbon-
yl-2-tert-butoxycarbonylaminoethyl)biphenyl-3-yl]propionate
[0861] ##STR84##
[0862] 45.8 mg (0.05 mmol) of
bis(diphenylphosphino)ferrocenepalladium(II) chloride
(PdCl.sub.2(dppf)) and 0.325 g (1.0 mmol) of cesium carbonate are
added to a solution of 0.316 g (0.5 mmol) of
(2-trimethylsilyl)ethyl
2(S)-benzyloxycarbonylamino-3-(2-benzyloxy-5-iodophenyl)propionate
(Example 11A) in 2.5 ml of degassed DMF under argon at RT. The
reaction mixture is heated to 40.degree. C. Over the course of 30
min, a solution of 0.294 g (0.5 mmol) of benzyl
3-[2-benzyloxy-5-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl)phenyl]-2(-
S)-tert-butoxycarbonylaminopropionate (Example 8A) in 2.5 ml of
degassed DMF is added dropwise. The reaction mixture is stirred at
40.degree. C. for 4 h and at 50.degree. C. for a further 2 h. The
solvent is evaporated and the residue is taken up in ethyl acetate.
The organic phase is extracted twice with water, dried over sodium
sulfate and concentrated. The crude product is purified by
chromatography on silica gel with dichloromethane/ethyl acetate
(30/1). 0.320 g (66% of theory) of product are obtained.
[0863] HPLC (Method 1): R.sub.t=7.65 min
[0864] MS (EI): m/z=987 (M+Na), 965 (M+H).sup.+
[0865] .sup.1H-NMR (200 MHz, CDCl.sub.3): .delta.=0.00 (s, 9H),
0.90 (t, 2H), 1.37 (s, 9H), 3.02-3.35 (m, 4H) 4.06-4.25 (m, 2H),
4.55-4.73 (m, 2H), 4.98-5.18 (m, 8H), 5.40 (d, 1H), 5.63 (d, 1H),
6.88-7.00 (m, 2H), 7.19-7.39 (m, 20H), 7.42-7.53 (m, 4H).
Example 13A
Benzyl({(2R,4S)-4-[(tert-butoxycarbonyl)amino]-5-oxotetrahydrofuran-2-yl}m-
ethyl)carbamate
[0866] ##STR85##
[0867] A solution of 7.60 g (17.3 mmol) of tert-butyl
5-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamino-4(R)-hydroxypentan-
oate (Org. Lett. (2001) 3, 20:3153-3155) in 516 ml of
dichloromethane and 516 ml of trifluoroacetic acid is stirred at RT
for 2 h. The solvent is evaporated. The remaining crude product is
dissolved in 2.6 l of anhydrous methanol and, while stirring at
0.degree. C., 6.3 g (28.8 mmol) of di-tert-butyl dicarbonate and
7.3 ml (52.43 mmol) of triethylamine are added. After 15 h, the
reaction solution is evaporated and the residue is taken up in 1 l
of ethyl acetate. After the phases have separated, the organic
phase is extracted twice with a 5% citric acid solution, twice with
water and once with a saturated aqueous sodium chloride solution,
dried over sodium sulfate and concentrated. The crude product is
purified by chromatography on silica gel with toluene/acetone
(5/1). 4.92 g (78% of theory) of product are obtained.
[0868] LC-HR-FT-ICR-MS (Method 7): calc. for
C.sub.18H.sub.28N.sub.3O.sub.6 (M+NH.sub.4).sup.+ 382.19726.
[0869] found 382.19703
[0870] .sup.1H-NMR (400 MHz, CDCl.sub.3): .delta.=1.45 (s, 9H),
2.3-2.4 (m, 1H), 2.45-2.55 (m, 1H), 3.3-3.4 (m, 1H), 3.5-3.6 (m,
1H), 4.17-4.28 (m, 1H), 4.7-4.8 (m, 1H), 5.0-5.15 (m, 4H), 7.3-7.4
(m, 5H).
Example 14A
5-Benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamino-4(R)-(tert-butyldim-
ethylsilanyloxy)pentanoic acid
[0871] ##STR86##
[0872] Method A:
[0873] 2 ml of a 1M sodium hydroxide solution are added to a
solution of 0.73 g (2 mmol) of the compound from Example 13A in 50
ml of 1,4-dioxane at 0.degree. C. The reaction solution is stirred
for 2 h and then evaporated. The residue is taken up in 50 ml of
dichloromethane. 1.12 ml (8 mmol) of triethylamine are added to
this solution and, after a short time, 1.38 ml (6 mmol) of
tert-butyldimethylsilyl trifluoromethanesulfonate are added
dropwise. After stirring at RT for 3 h, the reaction mixture is
diluted with dichloromethane. The organic phase is washed with a 1N
sodium bicarbonate solution, dried over sodium sulfate and
evaporated. The crude product is dissolved in 7.4 ml of
1,4-dioxane, and 36.2 ml of a 0.1N sodium hydroxide solution are
added. After stirring at RT for 3 h, the reaction solution is
evaporated, and the residue is taken up in water and ethyl acetate.
The organic phase is extracted three times with ethyl acetate. The
combined organic phases are dried over sodium sulfate and
evaporated. 0.90 g (90% of theory) of product are obtained.
[0874] Method B:
[0875] A solution of 14.0 g (38 mmol) of benzyl
2(S)-tert-butoxycarbonylamino-4(R)-hydroxy-5-nitropentanoate
(Example 22A) in 840 ml of ethanol/water 9/1 is mixed with 1.96 g
of palladium on carbon (10%) and hydrogenated under atmospheric
pressure at RT for 24 h. The mixture is filtered through
kieselguhr, and the filtrate is mixed with 14.7 g (114 mmol) of
diisopropylethylamine. Then 11.4 g (45.6 mmol) of
N-(benzyloxycarbonyloxy)succinimide are added, and the mixture is
stirred at RT for 4 h. The solution is concentrated, and the
residue is taken up in dichloromethane and extracted twice with
0.1N hydrochloric acid. The organic phase is separated and made
alkaline with 14.7 g (114 mmol) of diisopropylamine. The solution
is cooled to 0.degree. C., 30.1 g (114 mmol) of
dimethyl-tert-butylsilyl trifluoromethanesulfonate are added, and
the mixture is stirred at RT for 2.5 h. The organic phase is washed
with a saturated sodium bicarbonate solution, dried over sodium
sulfate and evaporated. The residue is dissolved in 50 ml of
dioxane, mixed with 200 ml of a 0.1N sodium hydroxide solution and
stirred at RT for 3 h. The mixture is extracted several times with
ethyl acetate, the collected organic phases are dried over sodium
sulfate and concentrated in vacuo. The residue is chromatographed
on silica gel (mobile phase: dichloromethane/ethanol 20/1, 9/1).
8.11 g (43% of theory) of product are obtained.
[0876] MS (ESI): m/z=497 (M+H).sup.+
[0877] .sup.1H-NMR (300 MHz, DMSO-d.sub.6): .delta.=0.00 (s, 6H),
0.99 (s, 9H), 1.33 (s, 9H), 1.59 (m, 1H), 1.80 (m, 1H), 2.75-3.15
(m, 2H), 3.81 (m, 1H), 3.98 (m, 1H), 4.96 (m, 2H), 7.04 (d, 1H),
7.19 (m, 1H), 7.30 (m, 5H), 12.37 (br. s, 1H).
Example 15A
2-(Trimethylsilyl)ethyl
3-[3'-2(S)-amino-2-benzyloxycarbonylethyl)-4,4'-bisbenzyloxybiphenyl-3-yl-
]-2(S)-benzyloxycarbonylaminopropionate hydrochloride
[0878] ##STR87##
[0879] 50 ml of a 4M solution of hydrogen chloride in dioxane are
added over the course of about 20 min to a solution, cooled to
0.degree. C., of 2.65 g (2.75 mmol) of 2-(trimethylsilyl)ethyl
2(S)-benzyloxycarbonylamino-3-[4,4'-bisbenzyloxy-3'-(2(S)-benzyloxycarbon-
yl-2-tert-butoxycarbonylaminoethyl)biphenyl-3-yl]propionate
(Example 12A) in 50 ml of anhydrous dioxane. After stirring for 3
h, the reaction solution is evaporated and dried under high
vacuum.
[0880] Yield: 100% of theory
[0881] HPLC (Method 1): R.sub.t=5.96 min
[0882] MS (EI): m/z=865 (M+H).sup.+
Example 16A
Benzyl
2(S)-[5-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamino-4(R)-(-
tert-butyldimethylsilyloxy)pentanoylamino]-3-{4,4'-bisbenzyloxy-3'-[2(S)-b-
enzyloxycarbonylamino-2-(2-trimethylsilylethoxycarbonyl)ethyl]biphenyl-3-y-
l}propionate
[0883] ##STR88##
[0884] 0.219 g (0.58 mmol) of HATU and 0.082 g (0.63 mmol) of
N,N-diisopropylethylamine are added to a solution, cooled to
0.degree. C., of 0.520 g (0.58 mmol) of (2-trimethylsilyl)ethyl
3-[3'-(2(S)-amino-2-benzyloxycarbonylethyl)-4,4'-bisbenzyloxybiphenyl-3-y-
l]-2(S)-benzyloxycarbonylaminopropionate hydrochloride (Example
15A) and 0.287 g (0.58 mmol) of
5-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamino-4(R)-(tert-butyldi-
methylsilyloxy)pentanoic acid (Example 14A) in 7.3 ml of anhydrous
DMF. After stirring at 0.degree. C. for 30 min, an additional 0.164
g (1.26 mmol) of N,N-diisopropylethylamine are added. The reaction
mixture is stirred at RT for 15 h. The solvent is then evaporated,
and the residue is taken up in ethyl acetate. The organic phase is
washed three times with water and once with a saturated aqueous
sodium chloride solution, dried over sodium sulfate and
concentrated. The crude product is purified by chromatography on
silica gel with dichloromethane/ethyl acetate (gradient
30/1.fwdarw.20/1.fwdarw.10/1). 533 mg (66% of theory) of product
are obtained.
[0885] LC-MS (ESI, Method 6): m/z=1342 (M+H).sup.+, 1365
(M+Na).sup.+
Example 17A
2(S)-Benzyloxycarbonylamino-3-{4,4'-bisbenzyloxy-3'-[2(S)-benzyloxycarbony-
l-2-(5-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamino-4(R)-hydroxype-
ntanoylamino)ethyl]biphenyl-3-yl}propionic acid
[0886] ##STR89##
[0887] 1.8 ml of 1N tetrabutylammonium fluoride in THF are added
dropwise to a solution of 800 mg (0.6 mmol) of benzyl
2(S)-[5-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamino-4(R)-(tert-b-
utyldimethylsilyloxy)pentanoylamino]-3-{4,4'-bisbenzyloxy-3'-[2(S)-benzylo-
xycarbonylamino-2-(2-trimethylsilylethoxycarbonyl)ethyl]biphenyl-3-yl}prop-
ionate (Example 16A) in 26 ml of absolute DMF at RT. After 25 min
at RT, the mixture is cooled to 0.degree. C. and a large amount of
ice-water is added. Ethyl acetate and a little 1N hydrochloric acid
solution are immediately added; the organic phase is dried with
magnesium sulfate, concentrated and dried under high vacuum for 1
h. The crude product is reacted without further purification.
[0888] LC-MS (ESI, Method 4): m/z=1129 (M+H).sup.+
[0889] LC-HR-FT-ICR-MS (Method 7): calc. for
C.sub.65H.sub.69N.sub.4O.sub.14 (M+H).sup.+ 1129.48048.
[0890] found 1129.48123.
Example 18A
Benzyl
2(S)-(5-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamino-4(R)-h-
ydroxypentanoylamino)-3-[4,4'-bisbenzyloxy-3'-(2(S)-benzyloxycarbonylamino-
-2-pentafluorophenyloxycarbonylethyl)biphenyl-3-yl]propionate
[0891] ##STR90##
[0892] 691 mg (crude mixture, approx. 0.6 mmol) of
2(S)-benzyloxycarbonylamino-3-{4,4'-bisbenzyloxy-3'-[2(S)-benzyloxycarbon-
yl-2-(5-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamino-4(R)-hydroxyp-
entanoylamino)ethyl]biphenyl-3-yl}propionic acid (Example 17A) are
provided in 25 ml of dichloromethane, and 547.6 mg (2.98 mmol) of
pentafluorophenol, dissolved in 6 ml of dichloromethane, are added.
7.3 mg (0.06 mmol) of DMAP are added, and the mixture is cooled to
-25.degree. C. (ethanol/carbon dioxide bath). At -25.degree. C.,
148 mg (0.774 mmol) of EDC are added. The mixture slowly warms to
RT overnight. The reaction mixture is concentrated in vacuo and
briefly dried under high vacuum. The crude product is reacted
without further purification.
[0893] LC-MS (ESI, Method 5): m/z=1317 (M+Na).sup.+, 1295
(M+H).sup.+
[0894] LC-HR-FT-ICR-MS (Method 7): calc. for
C.sub.71H.sub.68F.sub.5N.sub.4O.sub.14 (M+H).sup.+ 1295.46467.
[0895] found 1295.46430.
Example 19A
Benzyl
5,17-bisbenzyloxy-14(S)-benzyloxycarbonylamino-11(S)-(3-benzyloxyca-
rbonylamino-2(R)-hydroxypropyl)-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.su-
p.2,6]henicosa-1(19),2,4,6(21),16(20),17-hexaene-8(S)-carboxylate
[0896] ##STR91##
[0897] Method A:
[0898] 4 ml of a 4M solution of hydrogen chloride in dioxane are
added to a solution of 119.3 mg of benzyl
2(S)-(5-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamino-4(R)-hydroxy-
pentanoylamino)-3-[4,4'-bisbenzyloxy-3'-(2(S)-benzyloxycarbonylamino-2-pen-
tafluorophenyloxycarbonylethyl)biphenyl-3-yl]propionate (Example
18A) in 2.7 ml of 1,4-dioxane. Until the reaction is complete, a
further 1.5 ml of a 4M solution of hydrogen chloride in dioxane are
added. The reaction solution is evaporated and codistilled with
chloroform twice. The crude product (LC-HR-FT-ICR-MS, Method 7:
calc. for C.sub.66H.sub.60F.sub.5N.sub.4O.sub.12 (M+H).sup.+
1195.41224, found 1195.41419) is dissolved in 100 ml of chloroform
and added dropwise over the course of 3 h to a very strongly
stirred suspension of 200 ml of chloroform and 100 ml of a
saturated aqueous sodium bicarbonate solution. The reaction mixture
is vigorously stirred for 2 h. After the two phases have separated,
the aqueous phase is extracted with chloroform. The combined
organic phases are washed with a 5% aqueous citric acid solution,
dried over magnesium sulfate and evaporated to dryness. The crude
product is washed with acetonitrile and dried under high
vacuum.
[0899] Yield: 60.5 mg (65% of theory)
[0900] LC-MS (ESI, Method 5): m/z=101 (M+H).sup.+
[0901] Method B:
[0902] 771 mg (0.595 mmol) of benzyl
2(S)-(5-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamino-4(R)-hydroxy-
pentanoylamino)-3-[4,4'-bisbenzyloxy-3'-(2(S)-benzyloxycarbonylamino-2-pen-
tafluorophenyloxycarbonylethyl)biphenyl-3-yl]propionate (Example
18A) are dissolved in 8 ml of dioxane and then, at 0.degree. C., 16
ml of a 4N solution of hydrogen chloride in dioxane are added
dropwise. After 45 min, 6 ml of a 4N solution of hydrogen chloride
in dioxane are again added, and after 15 min a further 8 ml are
added. The mixture is stirred at 0.degree. C. for 30 min before the
reaction solution is concentrated under mild conditions,
codistilled with chloroform (twice) and briefly dried under high
vacuum. The crude product (732 mg, 0.59 mmol) is dissolved in 1000
ml of chloroform, and a solution of 6 ml of triethylamine in 50 ml
of chloroform is added dropwise. The mixture is stirred at RT
overnight. For the work-up the mixture is concentrated under mild
conditions on a rotary evaporator in vacuo and the residue is
stirred in acetonitrile. The resulting crystals are collected by
suction filtration, washed with acetonitrile and dried under high
vacuum.
[0903] Yield: 360 mg (60% of theory)
[0904] MS (EI): m/z=101 (M+H).sup.+
[0905] HPLC (Method 1): R.sub.t=5.59 min
[0906] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): .delta.=1.52-1.65 (m,
1H), 1.73-1.84 (m, 1H), 2.82-3.01 (m, 3H), 3.02-3.11 (m, 1H), 3.46
(s, 1H), 3.57-3.68 (m, 1H), 4.47-4.56 (m, 1H), 4.64-4.71 (m, 1H),
4.73-4.85 (m, 2H), 4.88-5.00 (m, 4H), 5.09 (s, 2H), 5.14-5.20 (m,
4H), 6.29 (d, 1H), 7.00-7.11 (m, 4H), 7.21-7.40 (m, 20H), 7.41-7.48
(m, 9H), 8.77 (d, 1H), 8.87 (d, 1H).
Example 20A
14(S)-Amino-11(S)-(3-amino-2(R)-hydroxypropyl)-5,17-dihydroxy-10,13-dioxo--
9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(19),2,4,6(21),16(20),17-hex-
aene-8(S)-carboxylic acid dihydrochloride (biphenomycin B)
[0907] ##STR92##
[0908] 200 mg (0.20 mmol) of benzyl
5,17-bisbenzyloxy-14(S)-benzyloxycarbonylamino-1(S)-(3-benzyloxycarbonyla-
mino-2(R)-hydroxypropyl)-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]h-
enicosa-1(19),2,4,6(21),16(20),17-hexaene-8(S)-carboxylate (Example
19A) are added to 220 ml of an acetic acid/water/ethanol 4:1:1
mixture (ethanol can be replaced by THF). 73 mg of 10%
palladium/carbon (10% Pd/C) are added, and the mixture is
hydrogenated under atmospheric pressure for 15 h. The reaction
mixture is filtered through prewashed kieselguhr, and the filtrate
is concentrated on a rotary evaporator in vacuo. The residue is
mixed with 4.95 ml of 0.1N aqueous hydrochloric acid and
concentrated. The residue is stirred with 10 ml of diethyl ether
and decantered. The remaining solid is dried under high vacuum.
[0909] Yield: 103 mg (95% of theory).
[0910] HPLC (Method 1): R.sub.t=3.04 min
[0911] LC-MS (Method 2): R.sub.t=0.38 min
[0912] MS (EI): m/z=473 (M+H).sup.+
[0913] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=2.06-2.20 (m, 1H),
2.74-2.89 (m, 1H), 2.94-3.05 (m, 1H), 3.12-3.25 (m, 2H), 3.53 (d,
1H), 3.61-3.72 (m, 1H), 3.97-4.07 (m, 1H), 4.53 (s, 1H), 4.61 (d,
1H), 4.76-4.91 (m, 2H), 7.01-7.05 (m, 2H), 7.07 (s, 1H), 7.40-7.45
(m, 2H), 7.51 (d, 1H).
Example 21A
Benzyl 2(S)-tert-butoxycarbonylamino-5-nitro-4-oxopentanoate
[0914] ##STR93##
[0915] A solution A of 10 g (30.9 mmol) of
2(S)-tert-butoxycarbonylaminosuccinic acid 1-benzyl ester and 5.27
g (32.5 mmol) of 1,1'-carbonyldiimidazole in 100 ml of
tetrahydrofuran is stirred at RT for 5 h. 18.8 g (30.9 mmol) of
nitromethane are added dropwise to a solution B of 3.2 g (34.2
mmol) of potassium tert-butoxide in 100 ml of tetrahydrofuran at
0.degree. C. Solution B is stirred while warming to RT, and then
solution A is added dropwise at RT. The resulting mixture is
stirred at RT for 16 h and adjusted to pH 2 using 20% hydrochloric
acid. The solvent is evaporated. The remaining crude product is
taken up in ethyl acetate/water. After separation of the phases,
the organic phase is extracted twice with water, dried over sodium
sulfate and concentrated. 13 g (99% of theory) of product are
obtained.
[0916] MS (ESI): m/z=334 (M+H).sup.+
[0917] .sup.1H-NMR (300 MHz, DMSO-d.sub.6): .delta.=1.37 (s, 9H),
2.91 (m, 1H), 3.13 (m, 1H), 4.44 (m, 1H), 5.12 (s, 2H), 5.81 (m,
2H), 7.2-7.5 (m, 5H).
Example 22A
Benzyl
2(S)-tert-butoxycarbonylamino-4(R)-hydroxy-5-nitropentanoate
[0918] ##STR94##
[0919] A solution of 11.3 g (30.8 mmol) of benzyl
2(S)-tert-butoxycarbonylamino-5-nitro-4-oxopentanoate in 300 ml of
tetrahydrofuran is cooled to -78.degree. C., 30.8 ml of a 1M
solution of L-Selectrideo in tetrahydrofuran are added dropwise,
and the mixture is stirred at -78.degree. C. for 1 h. After warming
to RT, a saturated ammonium chloride solution is cautiously added
to the solution. The reaction solution is concentrated, and the
residue is taken up in water and ethyl acetate. The aqueous phase
is extracted three times with ethyl acetate. The combined organic
phases are dried over sodium sulfate and evaporated. The crude
product is prepurified on silica gel 60 (mobile phase:
cyclohexane/ethyl acetate 10/1), and the collected fractions are
concentrated and stirred with cyclohexane/ethyl acetate 5/1. The
remaining crystals are collected by suction filtration and dried.
2.34 g (21% of theory) of the desired diastereomer are obtained.
Chromatographic separation of the mother liquor on Lichrospher Diol
10 .mu.m (mobile phase: ethanol/isohexane 5/95) results in a
further 0.8 g (6.7% of theory) of the product.
[0920] MS (ESI): m/z=369 (M+H).sup.+
[0921] .sup.1H-NMR (300 MHz, DMSO-d.sub.6): .delta.=1.38 (s, 9H),
1.77 (m, 1H), 1.97 (m, 1H), 4.10-4.44 (m, 3H), 4.67 (m, 1H), 5.12
(m, 2H), 5.49 (d, 1H), 7.25-7.45 (m, 5H).
Example 23A
Benzyl
2(S)-[S-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylaminopentano-
ylamino]-3-{4,4'-bisbenzyloxy-3'-[2(S)-benzyloxycarbonylamino-2-(2-trimeth-
ylsilylethoxycarbonyl)ethyl]biphenyl-3-yl}propionate
[0922] ##STR95##
[0923] Preparation takes place in analogy to Example 16A from 0.47
g (0.51 mmol) of the compound from Example 15A and 0.19 g (0.51
mmol) of
N.sup.5-[(benzyloxy)carbonyl]-N.sup.2-(tert-butoxycarbonyl)-L-ornithine
with 0.19 g (0.51 mmol) of HATU and 0.35 ml (1.65 mmol) of
N,N-diisopropylethylamine in 5.55 ml of dry DMF.
[0924] Yield: 0.58 g (92% of theory)
[0925] LC-MS (Method 10): R.sub.t=3.46 min
[0926] MS (ESI): m/z=1212 (M+H).sup.+
Example 24A
2(S)-Benzyloxycarbonylamino-3-{4,4'-bisbenzyloxy-3'-[2(S)-benzyloxycarbony-
l-2-(5-benzyloxycarbonylamino)-2(S)-tert-butoxycarbonylaminopentanoylamino-
)ethyl]biphenyl 3-yl}-propionic acid
[0927] ##STR96##
[0928] Preparation takes place in analogy to Example 17A from 0.82
g (0.68 mmol) of the compound from Example 23A with 2 equivalents
(1.3 ml) of tetrabutylammonium fluoride (1M in THF) in 30 ml of dry
DMF.
[0929] Yield: 772 mg (94% of theory)
[0930] LC-MS (Method 11): R.sub.t=1.62 min
[0931] MS (ESI): m/z=1112 (M+H).sup.+
Example 25A
Benzyl
2(S)-(5-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylaminopentano-
ylamino)-3-[4,4'-bisbenzyloxy-3'-(2(S)-benzyloxycarbonylamino-2-pentafluor-
ophenyloxycarbonylethyl)biphenyl-3-yl]propionate
[0932] ##STR97##
[0933] Preparation takes place in analogy to Example 18A from 422
mg (0.38 mmol) of the compound from Example 24A and 349 mg (1.9
mmol) of pentafluorophenol with 80 mg (0.42 mmol) of EDC and 4.63
mg (0.04 mmol) of DMAP in 4 ml of dichloromethane.
[0934] Yield: 502 mg (95% of theory)
[0935] LC-MS (Method 11): R.sub.t=3.13 min
[0936] MS (ESI): m/z=1278 (M+H).sup.+
Example 26A
Benzyl
2(S)-(5-benzyloxycarbonylamino-2(S)-aminopentanoylamino)-3-[4,4'-bi-
sbenzyloxy-3'-(2(S)-benzyloxycarbonylamino-2-pentafluorophenyloxycarbonyle-
thyl)biphenyl-3-yl]propionate hydrochloride
[0937] ##STR98##
[0938] 5 ml of a 4N solution of hydrogen chloride in dioxane are
added to 215 mg (0.17 mmol) of the compound from Example 25A while
stirring in an ice bath. The mixture is stirred for one hour and
evaporated to constant weight in vacuo.
[0939] Yield: 200 mg (92% of theory)
[0940] LC-MS (Method 11): R.sub.t=4.25 min
[0941] MS (ESI): m/z=1178 (M-HCl+H).sup.+
Example 27A
Benzyl
5,17-bisbenzyloxy-14(S)-benzyloxycarbonylamino-11(S)-(3-benzyloxyca-
rbonylamioproyl)-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa--
1(19),2,4,6(21),16(20),17-hexaene-8(S)-carboxylate
[0942] ##STR99##
[0943] 1.35 g (0.91 mmol) of the compound from Example 26A are
provided in 3 l of chloroform and, while stirring vigorously, 2.54
ml (18.2 mmol) of triethylamine in 50 ml of chloroform are added at
RT over the course of 20 min. The mixture is stirred overnight and
evaporated to dryness in vacuo. The residue is stirred with 5 ml of
acetonitrile and filtered, and the residue is dried to constant
weight.
[0944] Yield: 890 mg (93% of theory)
[0945] LC-MS (Method 11): R.sub.t=5.10 min
[0946] MS (ESI): m/z=994 (M+H).sup.+
Example 28A
(8S,11S,14S)-14-Amino-11-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-d-
iazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,6,18-hexaene-8-carb-
oxylic acid dihydrochloride
[0947] ##STR100##
[0948] 50 mg (0.05 mmol) of the compound from Example 27A are
suspended in 50 ml of glacial acetic acid/water/ethanol (4/1/1), 30
mg of Pd/C (10%) catalyst are added, and the mixture is
hydrogenated at RT for 20 hours. After removal of the catalyst by
filtration through kieselguhr, the filtrate is evaporated to
dryness in vacuo and, while stirring, 2.5 ml of 0.1N hydrochloric
acid are added. The mixture is evaporated to dryness in vacuo and
dried to constant weight.
[0949] Yield: 17 mg (63% of theory)
[0950] TLC (methanol/dichloromethane/25% ammonia=5/3/2):
R.sub.f=0.6
[0951] LC-MS (Method 3): R.sub.t=0.28 min
[0952] MS (ESI): m/z=457 (M-2HCl+H).sup.+
Example 29A
(8S,11S,14S)-14-[(tert-Butoxycarbonyl)amino-11-]3-[(tert-butoxycarbonyl)am-
ino]propyl}-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6-
]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxylic acid
[0953] ##STR101##
[0954] 600 mg (1.13 mmol) of the compound from Example 28A are
dissolved in 6 ml (5.66 mmol) of a 1N sodium hydroxide solution
and, while stirring at room temperature, 740.8 mg (3.39 mmol) of
di-tert-butyl dicarbonate, dissolved in 5 ml of methanol, are
added. The reaction is complete after one hour (TLC check, mobile
phase: dichloromethane/methanol/ammonia=80/20/2). The pH is
adjusted to 3 by dropwise addition of 0.1N hydrochloric acid. The
mixture is extracted three times with 20 ml of ethyl acetate each
time, dried with sodium sulfate and evaporated to constant weight
in vacuo.
[0955] Yield: 622 mg (84% of theory)
[0956] LC-MS (Method 10): R.sub.t=1.96 min
[0957] MS (ESI): m/z=656 (M+H).sup.+
Example 30A
2-(Benzyloxy)-N-(tert-butoxycarbonyl)-5-iodo-N-methyl-L-phenylalanine
[0958] ##STR102##
[0959] Under an argon atmosphere, 500 mg (1 mmol) of the compound
from Example (-)-6A are dissolved in 20 ml of THF, 90.5 mg (3.02
mmol) of sodium hydride and 0.51 ml (141.6 mg; 8.04 mmol) of methyl
iodide (80% pure) are added, and the mixture is stirred at room
temperature overnight. The mixture is diluted with 25 ml of ethyl
acetate and 25 ml of water and adjusted to pH=9 with 0.1N
hydrochloric acid. The mixture is concentrated to a small volume in
vacuo. 10 ml of ethyl acetate and 10 ml of water are added, the
mixture is shaken vigorously, and the organic phase is separated.
Drying with sodium sulfate and concentration in vacuo result in 140
mg of product (19% of theory). The aqueous phase is acidified
(pH=3) and extracted three times with 20 ml of ethyl acetate.
Concentration in vacuo and drying in vacuo result in 351 mg of
product (68% of theory).
[0960] LC-MS (Method 9): R.sub.t=3.9 min
[0961] MS (EI): m/z=511 (M+H).sup.+
Example 31A
Benzyl
2-(benzyloxy)-N-(tert-butoxycarbonyl)-5-iodo-N-methyl-L-phenylalani-
nate
[0962] ##STR103##
[0963] Preparation takes place in analogy to Example 7A from 350 mg
(0.68 mmol) of the compound from Example 30A, 8.29 mg (0.07 mmol)
of DMAP, 148 mg (1.37 mmol) of benzyl alcohol and 157.46 mg (0.82
mmol) of EDC in 3 ml of acetonitrile.
[0964] Yield: 382 mg (93% of theory)
[0965] LC-MS (Method 9): R.sub.t=4.8 min
[0966] MS (EI): m/z=601 (M+H).sup.+
Example 32A
Benzyl
2-(benzyloxy)-N-(tert-butoxycarbonyl)-N-methyl-5-(4,4,5,5-tetrameth-
yl-1,3,2-dioxaborolan-2-yl)-L-phenylalaninate
[0967] ##STR104##
[0968] In analogy to Example 8A, 380 mg (0.63 mmol) of the compound
from Example 31A are provided in 4 ml of DMF in a heat-dried flask
and, while stirring at room temperature, 184.5 mg (0.73 mmol) of
4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi-1,3,2-dioxaborolane, 186 mg
(1.9 mmol) of potassium acetate and 23.15 mg (0.03 mmol) of
bis(diphenylphosphino)ferrocenepalladium(II) chloride are added.
Reaction is allowed to take place at 80.degree. C. for 4 h. The
product is obtained after workup and chromatography (silica gel 60,
mobile phase: cyclohexane/ethyl acetate=4/1).
[0969] Yield: 196 mg
[0970] LC-MS (Method 9): R.sub.t=4.9 min
[0971] MS (EI): m/z=601 (M+H).sup.+
Example 33A
2-(Trimethylsilyl)ethyl
2(S)-benzyloxycarbonylamino-3-[4,4'-bisbenzyloxy-3'-(2(S)-benzyloxycarbon-
yl-(2-tert-butoxycarbonyl-2-methyl)aminoethyl)biphenyl-3-yl]propionate
[0972] ##STR105##
[0973] Preparation takes place in analogy to Example 12A from 190
mg (0.32 mmol) of the compound from Example 32A, 199.5 mg (0.32
mmol) of the compound from Example 11A, 195.5 mg (0.63 mmol) of
cesium carbonate and 23.15 mg (0.03 mmol) of
bis(diphenylphosphino)ferrocenepalladium(II) chloride in 1.5 ml of
DMF under an argon atmosphere.
[0974] Yield: 212 mg (66% of theory)
[0975] LC-MS (Method 13): R.sub.t=4.86 min
[0976] MS (EI): m/z=978 (M+H).sup.+
Example 34A
2-(Trimethylsilyl)ethyl
2(S)-benzyloxycarbonylamino-3-[4,4'-bisbenzyloxy-3'-(2(S)-benzyloxycarbon-
yl-2-methylaminoethylbiphenyl-3-yl]propionate hydrochloride
[0977] ##STR106##
[0978] Preparation takes place in analogy to Example 15A from 930
mg (0.95 mmol) of the compound from Example 33A and 22.14 ml of a
4M solution of hydrogen chloride in dioxane, in 15 ml of
dioxane.
[0979] Yield: 915 mg (78% of theory)
[0980] LC-MS (Method 13): R.sub.t=2.53 min
[0981] MS (EI): m/z=878 (M-HCl+H).sup.+
Example 35A
Benzyl
2(S)-{Methyl-[5-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamin-
o-4(R)-(tert-butyldimethylsilyloxy)pentanoyl]amino}-3-{4,4'-bisbenzyloxy-3-
'-[12(S)-benzyloxycarbonylamino-2-(2-trimethylsilylethoxycarbonyl)ethyl]bi-
phenyl 3-yl}propionate
[0982] ##STR107##
[0983] Preparation takes place in analogy to Example 16A from 922
mg (1.01 mmol) of the compound from Example 34A, 0.5 g (1.01 mmol)
of the compound from Example 14A, 421 mg (1.11 mmol) of HATU and
0.7 ml (518 mg; 3.27 mmol) of DIEA in 4.2 ml of DMF.
[0984] Yield: 703 mg (51% of theory)
[0985] LC-MS (Method 8): R.sub.t=3.17 min
[0986] MS (EI): m/z=1356 (M+H).sup.+
Example 36A
2(S)-Benzyloxycarbonylamino-3-{4,4'-bisbenzyloxy-3'-[2(S)-benzyloxycarbony-
l-2-{methyl-(5-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamino-4(R)-h-
ydroxypentanoyl)amino}ethyl]biphenyl-3-yl}propionic acid
[0987] ##STR108##
[0988] Preparation takes place in analogy to Example 17A from 360
mg (0.27 mmol) of the compound from Example 35A and 0.8 ml (3
equivalents) of a 1M tetrabutylammonium fluoride solution (THF) in
20 ml of DMF.
[0989] Yield: 159 mg (53% of theory)
[0990] LC-MS (Method 12): R.sub.t=3.19 min
[0991] MS (EI): m/z=1142 (M+H).sup.+
Example 37A
Benzyl
2(S)-[methyl-(5-benzyloxycarbonylamino)-2(S)-tert-butoxycarbonylami-
no-4(R)-hydroxypentanoyl]amino-3-[4,4'-bisbenzyloxy-3'-(2(S)-benzyloxycarb-
onylamino-2-pentafluorophenyloxycarbonylethyl)biphenyl-3-yl]propionate
[0992] ##STR109##
[0993] Preparation takes place in analogy to Example 18A from 330
mg (0.29 mmol) of the compound from Example 36A, 265.6 mg (1.44
mmol) of pentafluorophenol, 3.53 mg (0.03 mmol) of DMAP and 60.87
mg (0.32 mmol) of EDC in 10 ml of dichloromethane.
[0994] Yield: 271 mg (69% of theory)
[0995] LC-MS (Method 12): R.sub.t=3.38 min
[0996] MS (EI): m/z=1308 (M+H).sup.+
Example 38A
Benzyl
2(S)-[methyl-(5-benzyloxycarbonylamino)-2(S)-amino-4(R)-hydroxy-pen-
tanoyl]amino-3-[4,4'-bisbenzyloxy-3'-(2(S)-benzyloxycarbonylamino-2-pentaf-
luorophenyloxycarbonylethyl)biphenyl-3-yl]propionate
hydrochloride
[0997] ##STR110##
[0998] 130 mg (0.1 mmol) of the compound from Example 37A are
dissolved in 0.5 ml of dioxane, and 5 ml of a 4N solution of
hydrogen chloride in dioxane are cautiously added (ice bath). After
30 minutes, the reaction is allowed to continue at room temperature
for a further 2 h. The mixture is evaporated to dryness in vacuo
and dried to constant weight under high vacuum.
[0999] Yield: 130 mg (70% of theory)
[1000] LC-MS (Method 15): R.sub.t=2.68 min
[1001] MS (EI): m/z=1208 (M-HCl+H).sup.+
Example 39A
Benzyl(8S,11S,14S)-5,17-bis(benzyloxy)-14-{[(benzyloxy)carbonyl]amino}-11--
((2R)-3-{[(benzyloxy)carbonyl]amino}-2-hydroxypropyl-9-methyl-10,13-dioxo--
9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-
-8-carboxylate
[1002] ##STR111##
[1003] 130 mg (0.1 mmol) of the compound from Example 38A are
provided in 220 ml of dry chloroform. While stirring at room
temperature, 23 ml (20 eq.) of triethylamine in 5 ml of
dichloromethane are added over the course of 20 minutes. The
mixture is stirred overnight. The mixture is then evaporated to
dryness in vacuo. The residue is stirred with acetonitrile. After
drying of the residue 44 mg of product are obtained. Further
product (30 mg) is obtained from the mother liquor by RP-HPLC.
[1004] Yield: 74 mg (69% of theory)
[1005] LC-MS (Method 15): R.sub.t=3.13 min
[1006] MS (EI): m/z=1024 (M+H).sup.+
Example 40A
(8S,11S,14S)-14-Amino-11-[(2R)-3-amino-2-hydroxypropyl]-5,17-dihydroxy-9-m-
ethyl-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21)-
,3,5,16,18-hexaene-carboxylic acid di(hydrotrifluoroacetate)
[1007] ##STR112##
[1008] 33 mg (0.032 mmol) of the compound from Example 39A are
cautiously treated with dilute trifluoroacetic acid. The resulting
clear solution is subsequently lyophilized.
[1009] Yield: 23 mg (quantitative)
[1010] LC-MS (Method 15): R.sub.t=0.92 min
[1011] MS (EI): m/z=486 (M-2CF.sub.3CO.sub.2H+H).sup.+
Example 41A
(8S,11S,14S)-5,17-Bis(benzyloxy)-14-{[benzyloxycarbonyl]amino}-11-(2R)-3-{-
[benzyloxycarbonyl]amino}-2-hydroxypropyl-9-methyl-10,13-dioxo-9,12-diazat-
ricyclo[14.3.1.1.sup.2,6]henicosa-1
(20),2(21),3,5,16,18-hexaene-8-carboxylic acid
[1012] ##STR113##
[1013] 37 mg (0.04 mmol) of the compound from Example 39A are
dissolved in 2 ml of THF, 0.14 ml of a 1N lithium hydroxide
solution are added, and the mixture is stirred at room temperature
for 3 h. The mixture is then acidified with 1N hydrochloric acid
and evaporated to dryness under high vacuum.
[1014] Yield: 33 mg (71% of theory)
[1015] LC-MS (Method 12): R.sub.t=2.90 min
[1016] MS (EI): m/z=934 (M+H).sup.+
[1017] Examples 42A to 48A listed in the following table are
prepared from the appropriate starting materials in analogy to the
methods detailed above: TABLE-US-00001 Ex. Prepared in Analytical
No. Structure analogy to data 42A ##STR114## 16A with N.sup.5-
[(benzyl-oxy)- carbonyl]-N.sup.2- (tert-butoxy- carbonyl)-L-
ornithine LC-MS (Method 13): R.sub.t = 4.85 min. MS (EI): m/z =
1226 (M + H).sup.+ 43A ##STR115## 17A LC-MS (Method 13): R.sub.t =
2.04 min. MS (EI): m/z = 1126 (M + H).sup.+ 44A ##STR116## 18A
LC-MS (Method 13): R.sub.t = 3.79 min. MS (EI): m/z = 1292 (M +
H).sup.+ 45A ##STR117## 26A LC-MS (Method 13): R.sub.t = 3.72 min.
MS (EI): m/z = 1192 (M - HCl + H).sup.+ 46A ##STR118## 39A LC-MS
(Method 13): R.sub.t = 4.39 min. MS (EI): m/z = 1008 (M + H).sup.+
47A ##STR119## 40A LC-MS (Method 12): R.sub.t = 0.53 min. MS (EI):
m/z = 470 (M - 2HCl + H).sup.+ 48A ##STR120## 41A LC-MS (Method
14): R.sub.t = 3.64 min. MS (EI): m/z = 918 (M + H).sup.+
Example 49A
2-(Trimethylsilyl)ethyl(2Z)-3-[2-(benzyloxy)-5-bromophenyl]-2-{[(benzyloxy-
)carbonyl]amino}acrylate
[1018] ##STR121##
[1019] 7.5 g (25.8 mmol) of 2-(benzyloxy)-5-bromobenzaldehyde
(Synthesis (1992) 10: 1025-1030) and 11.8 g (28.3 mmol) of
2-(trimethylsilyl)ethyl{[(benzyloxy)carbonyl]amino}(dimethoxyphosphoryl)a-
cetate (Tetrahedron (1999) 55:10527-10536) are provided in 150 ml
of THF and, while cooling at -78.degree. C. in acetone/dry ice,
3.26 g (28.3 mmol) of 1,1,3,3-tetramethylguanidine are added. The
mixture is slowly warmed to RT and stirred at RT for a further 12
h. The solvent is distilled off in vacuo, and the crude product is
taken up in ethyl acetate and washed once each with a saturated
sodium bicarbonate solution and a saturated sodium chloride
solution. The organic phase is dried over magnesium sulfate,
filtered and concentrated to dryness in vacuo. The crude product is
recrystallized from ethyl acetate/cyclohexane (1:20).
[1020] Yield: 13 g (88% of theory)
[1021] HPLC (Method 16): R.sub.t=6.06 min
[1022] MS (DCI(NH.sub.3)): m/z=599 (M+NH.sub.4).sup.+
Example 50A
(8S,11S,14S)-5,17-Bis(benzyloxy)-14-{[(benzyloxy)carbonyl]amino}-11-(3-{[(-
benzyloxy)carbonyl]amino}propyl)-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.s-
up.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxylic acid
[1023] ##STR122##
[1024] 200 mg (0.2 mmol) of the compound from Example 27A are
provided in 8 ml of THF and 4 ml of DMF and, while stirring, 0.8 ml
of a 1M aqueous lithium hydroxide solution (4 equivalents) are
added. A gel is formed after stirring at room temperature for 2 h.
0.8 ml of 1N hydrochloric acid and a little water are added. The
mixture is then evaporated to dryness in vacuo, stirred with water,
and the precipitate is filtered and dried.
[1025] Yield: 140 mg (77% of theory)
[1026] LC-MS (Method 10): R.sub.t=2.83 min
[1027] MS (EI): m/z=904 (M+H).sup.+
Example 51A
(8S,11S,14S)-14-[(tert-Butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)a-
mino]propyl}-5,17-dihydroxy-9-methyl-10,13-dioxo-9,12-diazatricyclo[14.3.1-
.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxylic
acid
[1028] ##STR123##
[1029] 11 mg (0.02 mmol) of the compound from Example 47A are
dissolved in 0.5 ml of water, 12.27 mg (0.08 mmol) of sodium
carbonate are added, the mixture is cooled in an ice bath and,
while stirring, 13.25 mg (0.06 mmol) of di-tert-butyl dicarbonate
in 0.2 ml of methanol are added. The mixture is stirred at RT
overnight, evaporated to dryness in vacuo, dissolved in 0.5 ml of
water and acidified to pH=2 with 1N hydrochloric acid, and the
resulting suspension is extracted with ethyl acetate. Drying with
sodium sulfate is followed by evaporation to dryness in vacuo.
[1030] Yield: 10 mg (51% of theory)
[1031] LC-MS (Method 12): R.sub.t=1.92 min
[1032] MS (EI): m/z=670 (M+H).sup.+
Example 52A
(8S,11S,14S)-14-[(tert-Butoxycarbonyl)amino]-11-{(2R)-3-[(tert-butoxycarbo-
nyl)amino]-2-hydroxypropyl}-5,17-dihydroxy-9-methyl-10,13-dioxo-9,12-diaza-
tricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxy-
lic acid
[1033] ##STR124##
[1034] 90 mg (0.16 mmol) of the compound from Example 40A are
dissolved in 2.5 ml of water, 85.3 mg (0.8 mmol) of sodium
carbonate are added, the mixture is cooled in an ice bath, and
105.3 mg (0.48 mmol) of di-(tert-butyl)dicarbonate in 1.2 ml of
methanol are added. The mixture is stirred at room temperature
overnight, concentrated in vacuo to a small volume and acidified to
pH=2 with 1N hydrochloric acid. The resulting precipitate is
collected by filtration and dried.
[1035] Yield: 89 mg (73% of theory)
[1036] LC-MS (Method 12): R.sub.t=1.8 min
[1037] MS (EI): m/z=686 (M+H).sup.+
Example 53A
2-(Trimethylsilyl)ethyl
2-(benzyloxy)-N-[(benzyloxy)carbonyl]-5-bromo-L-phenylalaninate
[1038] ##STR125##
[1039] 930 mg (1.6 mmol) of the compound from Example 49A are
dissolved in 100 ml of ethanol and 10 ml of dioxane. Under an argon
atmosphere, 20 mg of
(+)-1,2-bis((2S,5S)-2,5-diethylphospholano)benzene(cyclooctadiene)r-
hodium(I) trifluoromethanesulfonate are added, and the solution is
left in an ultrasonic bath for 15 min. The mixture is then
hydrogenated under a hydrogen pressure of 3 bar for 5 d. The
mixture is filtered through silica gel and carefully washed with
ethanol. The filtrate is concentrated in vacuo, and the crude
product is dried under high vacuum.
[1040] Yield: 900 mg (96% of theory)
[1041] ee=98.8% (Chiralcel OD (Daicel); eluent: i-hexane and
ethanol (5/1 vol/vol) with addition of 0.2% by volume
diethylamine)
[1042] HPLC (Method 16): R.sub.t=6.08 min
[1043] MS (DCI(NH.sub.3)): m/z=601 (M+NH.sub.4).sup.+
Example 54A
Methyl(2Z)-3-[2-(benzyloxy)-5-bromophenyl]-2-{[(benzyloxy)carbonyl]amino}a-
crylate
[1044] ##STR126##
[1045] Preparation takes place in analogy to Example 49A from 7.5 g
(25.8 mmol) of 2-(benzyloxy)-5-bromobenzaldehyde and 8.4 g (28.3
mmol) of
2-(trimethylsilyl)ethyl{[benzyloxy)carbonyl]amino}(dimethoxyphosphoryl)ac-
etate (J. Prakt. Chem. (2000) 342: 736-744) with 3.3 g (28.3 mmol)
of 1,1,3,3-tetramethylguanidine in 150 ml of THF.
[1046] Yield: 10 g (87% of theory)
[1047] HPLC (Method 16): R.sub.t=5.42 min
[1048] MS (DCI(NH.sub.3)): m/z=479 (M+NH.sub.4).sup.+
Example 55A
Methyl
2-(benzyloxy)-N-[(benzyloxy)carbonyl]-5-bromo-L-phenylalaninate
[1049] ##STR127##
[1050] Preparation takes place in analogy to Example 53A from 1.96
g (4.2 mmol) of the compound from Example 54A and 15 mg of
(+)-1,2-bis((2S,5S)-2,5-diethylphospholano)benzene(cyclooctadiene)rhodium-
(I) trifluoromethanesulfonate in 100 ml of ethanol and 20 ml of
dioxane.
[1051] Yield: 1.96 g (99% of theory)
[1052] ee=97.6% (Chiralcel OD (Daicel); eluent: i-hexane and
ethanol (5/1 vol/vol) with addition of 0.2% by volume
diethylamine)
[1053] LC-MS (Method 17): R.sub.t=3.05 min
[1054] MS (DCI(NH.sub.3)): m/z=481 (M+NH.sub.4).sup.+
[1055] .sup.1H-NMR (300 MHz, DMSO-d.sub.6): .delta.=1.32 (s, 9H),
2.72 (m.sub.c, 1H), 3.17 (m.sub.c, 1H), 3.60 (s, 3H), 4.32
(m.sub.c, 1H), 5.13 (s, 2H), 7.01 (m.sub.c, 1H), 7.22 (m.sub.c,
1H), 7.28-7.58 (m.sub.c, 6H).
Example 56A
Methyl
2-(benzyloxy)-N-(tert-butoxycarbonyl)-5-(4,4,5,5-tetramethyl-1,3,2--
dioxaborolan-2-yl)-L-phenylalaninate
[1056] ##STR128##
[1057] 0.23 g (2.31 mmol) of potassium acetate and 4 mg (0.08 mmol)
of potassium hydroxide are added to a solution of 0.36 g (0.77
mmol) of the compound from Example 55A in 5 ml of DMF. The mixture
is deoxygenated by passing argon through the vigorously stirred
solution for 15 min. Then 0.25 g (1.0 mmol) of
4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi-1,3,2-dioxaborolane and
0.023 g (0.03 mmol, 0.04 equivalents) of
bis(diphenylphosphino)ferrocenepalladium(II) chloride are added.
The mixture is heated under a gentle stream of argon to 60.degree.
C. and stirred at this temperature for 1.5 h. The mixture is
subsequently stirred at 80.degree. C. for 30 min and then cooled to
RT. The solvent is distilled off in vacuo, and the crude product is
taken up with ethyl acetate and washed twice with a saturated
sodium chloride solution. The organic phase is dried over magnesium
sulfate, filtered and evaporated to dryness in vacuo. The residue
is purified by chromatography (RP-HPLC, acetonitrile, water).
[1058] Yield: 0.219 g (56% of theory)
[1059] MS (EI): m/z=512 (M+H).sup.+
[1060] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): .delta.=1.27 (m.sub.c,
12H), 1.29 (s, 9H), 2.75 (m.sub.c, 1H), 3.19 (m.sub.c, 1H), 3.57
(s, 3H), 4.30 (m.sub.c, 1H), 5.19 (m.sub.c, 2H), 7.04 (m.sub.c,
1H), 7.24 (m.sub.c, 1H), 7.28-7.58 (m, 6H).
Example 57A
2-(Trimethylsilyl)ethyl
2-(benzyloxy)-N-[(benzyloxy)carbonyl]-5-(4,4,5,5-tetramethyl-1,3,2-dioxab-
orolan-2-yl)-L-phenylalaninate
[1061] ##STR129##
[1062] Preparation takes place in analogy to Example 8A from 2.0 g
(3.17 mmol) of the compound from Example 11A, 0.924 g (3.64 mmol)
of 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi-1,3,2-dioxaborolane,
0.932 g (9.50 mmol) of potassium acetate and 0.116 g (0.160 mmol,
0.05 equivalents) of bis(diphenylphosphino)ferrocenepalladium(II)
chloride in 30 ml of dimethyl sulfoxide.
[1063] Yield: 1.12 g (56% of theory)
[1064] LC-MS (Method 13): R.sub.t=4.50 min
[1065] MS (EI): m/z=632 (M+H).sup.+
[1066] .sup.1H-NMR (200 MHz, CDCl.sub.3): .delta.=0.92 (dd, 2H),
1.31 (s, 12H), 2.95-3.95 (m, 2H), 4.11 (m.sub.c, 2H), 4.55 (11
(m.sub.c, 1H), 4.99 (s, 2H), 5.08 (s, 2H), 5.53 (d, 1H), 6.90 (d,
1H), 7.15-7.47 (m, 10H), 7.58 (d, 1H), 7.67 (dd, 1H).
Example 58A
2-(Trimethylsilyl)ethyl(2S)-2-{[(benzyloxyl)carbonyl]amino}-3-(4,4'-bis(be-
nzyloxy)-3'-{(2S)-2-[(tert-butoxycarbonyl)amino]-3-methoxy-3-oxopropyl}bip-
henyl-3-yl)propanoate
[1067] ##STR130##
[1068] Method A:
[1069] Preparation takes place in analogy to Example 12A from 0.46
g (0.79 mmol) of the compound from Example 53A, 0.41 g (0.79 mmol)
of the compound from Example 56A, 0.52 g (1.58 mmol) of cesium
carbonate and 0.023 g (0.032 mmol, 0.04 equivalents) of
bis(diphenylphosphino)ferrocenepalladium(II) chloride in 12 ml of
DMF.
[1070] Yield: 0.34 g (48% of theory)
[1071] Method B:
[1072] Preparation takes place in analogy to Example 53A from 0.59
g (0.67 mmol) of the compound from Example 69A and 10 mg of
(+)-1,2-bis((2S,5S)-2,5-diethylphospholano)benzene(cyclooctadiene)rhodium-
(I) trifluoromethanesulfonate in 100 ml of ethanol and 30 ml of
dioxane.
[1073] Yield: 0.60 g (99% of theory)
[1074] ee=99.5% (chiral stationary silica gel phase, based on the
selector poly(N-methacryloyl-L-leucine L-menthylamide); eluent:
i-hexane and ethyl acetate (2/1 vol/vol))
[1075] HPLC (Method 16): R.sub.t=6.54 min
[1076] MS (EI): m/z=890 (M+H).sup.+
[1077] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): .delta.=0.00 (s, 9H),
0.83 (m.sub.c, 2H), 1.31 (s, 9H), 2.86 (m, 2H), 3.25 (m, 2H), 3.62
(s, 3H), 4.09 (m, 2H), 4.41 (m.sub.c, 1H), 4.98 (m.sub.c, 2H), 5.22
(m, 4H), 7.12 (m, 2H), 7.29 (m, 2H), 7.33-7.59 (m, 20H), 7.78 (d,
1H).
[1078] Examples 59A to 64A listed in the following table are
prepared from the appropriate starting materials in analogy to the
methods detailed above: TABLE-US-00002 Ex. Prepared in Analytical
No. Structure analogy to data 59A ##STR131## 15A LC-MS (Method 12):
R.sub.t = 2.50 min. MS (EI): m/z = 789 (M - HCl + H).sup.+ 60A
##STR132## 16A LC-MS (Method 13): R.sub.t = 3.51 min. MS (EI): m/z
= 1137 (M + H).sup.+ 61A ##STR133## 17A LC-MS (Method 13): R.sub.t
= 3.20 min. MS (EI): m/z = 1037 (M + H).sup.+ 62A ##STR134## 18A
LC-MS (Method 19): R.sub.t = 3.43 min. MS (EI): m/z = 1203 (M +
H).sup.+ 63A ##STR135## 26A LC-MS (Method 12): R.sub.t = 2.83 min.
MS (EI): m/z = 1103 (M - HCl + H).sup.+ 64A ##STR136## 39A LC-MS
(Method 12): R.sub.t = 3.10 min. MS (EI): m/z = 919 (M +
H).sup.+
Example 65A
(8S,11S,14S)-14-[(tert-Butoxycarbonyl)amino]-11-{(2R)-3-[(tert-butoxycarbo-
nyl)amino]-2-hydroxypropyl}-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[-
14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxylic
acid
[1079] ##STR137##
[1080] 50 mg (0.09 mmol) of the compound from Example 20A are
provided in 8 ml of a methanol/water (9:1) mixture. 1 ml of a 1N
sodium bicarbonate solution and then 80 mg (0.37 mmol) of
di-tert-butyl dicarbonate in 2 ml of methanol/water (9:1) are
added. The mixture is stirred at RT overnight. For the work-up 60
ml of ethyl acetate and 30 ml of water are added to the solution.
The organic phase is washed once with 0.1N hydrochloric acid, dried
and concentrated on a rotary evaporator in vacuo.
[1081] Yield: 49 mg (79% of theory)
[1082] LC-MS (Method 3): R.sub.t=2.56 min
[1083] MS (EI): m/z=673 (M+H).sup.+
[1084] LC-HR-FT-ICR-MS: calc. for C.sub.33H.sub.44N.sub.4O.sub.11
(M+H).sup.+ 673.3079.
[1085] found 673.3082.
Example 66A
Benzyl(8S,11S,14S)-5,17-bis(benzyloxy)-14-{[(benzyloxy)carbonyl]amino}-11--
((2R)-3-{[(benzyloxy)carbonyl]amino}-2-{[tert-butyl(dimethyl)silyl]oxy}pro-
pyl)-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),-
3,5,16,18-hexaene-8-carboxylate
[1086] ##STR138##
[1087] 200 mg (0.20 mmol) of the compound from Example 19A are
dissolved in 50 ml of absolute DMF and, at 0.degree. C., 210 mg
(0.79 mmol) of tert-butyldimethylsilyl trifluoromethanesulfonate,
0.11 ml (0.79 mmol) of triethylamine and 20 mg (0.20 mmol) of DMAP
are added. The mixture is stirred at RT for 2 d. After the addition
of 20 ml of dichloromethane, the solution is cautiously washed with
10 ml of a saturated sodium bicarbonate solution and 10 ml of
water. The organic phase is concentrated to dryness, and the
residue is dried under high vacuum.
[1088] Yield: 215 mg (96% of theory)
[1089] LC-MS (Method 12): R.sub.t=3.43 min
[1090] MS (EI): m/z=1125 (M+H).sup.+
Example 67A
(8S,11S,14S)-5,17-Bis(benzyloxy)-14-{[(benzyloxy)carbonyl]amino}-11-((2R)--
3-{[(benzyloxy)carbonyl]amino}-2-{[tert-butyl(dimethyl)silyl]oxy}propyl)-1-
0,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16-
,18-hexaene-8-carboxylic acid
[1091] ##STR139##
[1092] 210 mg (0.19 mmol) of the compound from Example 66A are
dissolved in 2 ml of THF, and 1 ml each of water and methanol are
added. After the addition of 13 mg (0.56 mmol) of lithium hydroxide
the mixture is stirred at RT for 12 h. The reaction solution is
then diluted with 30 ml of water and adjusted to pH=3 by adding 1N
hydrochloric acid. The precipitate is collected by filtration and
dried under high vacuum.
[1093] Yield: 192 mg (99% of theory)
[1094] LC-MS (Method 12): R.sub.t=3.24 min
[1095] MS (EI): m/z=1135 (M+H).sup.+
Example 68A
Methyl(2Z)-3-[2-(benzyloxy)-5-(4,4,55-tetramethyl-1,3,2-dioxaborolan-2-yl)-
phenyl]-2-[(tert-butoxycarbonyl)amino]acrylate
[1096] ##STR140##
[1097] Preparation takes place in analogy to Example 8A from 1.0 g
(2.16 mmol) of the compound from Example 54A, 0.63 g (2.5 mmol) of
4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi-1,3,2-dioxaborolane, 0.64 g
(6.50 mmol) of potassium acetate and 0.063 g (0.087 mmol, 0.04
equivalents) of bis(diphenylphosphino)ferrocenepalladium(II)
chloride in 14 ml of dimethylsulfoxide.
[1098] Yield: 0.832 g (76% of theory)
[1099] LC-MS (Method 12): R.sub.t=2.96 min.
[1100] MS (EI): m/z=510 (M+H).sup.+
Example 69A
2-(Trimethylsilyl)ethyl-(2Z)-2-{[(benzyloxy)carbonyl]amino}-3-(4,4'-bis(be-
nzyloxy)-3'-{(1Z)-2-[(tert-butoxycarbonyl)amino]-3-methoxy-3-oxoprop-1-en--
1-yl}biphenyl-3-yl)acrylate
[1101] ##STR141##
[1102] Preparation takes place in analogy to Example 12A from 0.42
g (0.82 mmol) of the compound from Example 68A, 0.48 g (0.82 mmol)
of the compound from Example 49A, 0.54 g (1.65 mmol) of cesium
carbonate and 0.024 g (0.033 mmol, 0.04 equivalents) of
bis(diphenylphosphino)ferrocenepalladium(II) chloride in 12 ml of
DMF.
[1103] Yield: 0.47 g (64% of theory)
[1104] HPLC (Method 16): R.sub.t=6.57 min
[1105] MS (EI): m/z=886 (M+H).sup.+
Example 70A
2-(Benzyloxy)-N-(tert-butoxycarbonyl)-5-iodo-N-ethyl-L-phenylalanine
[1106] ##STR142##
[1107] Under an argon atmosphere, 1.0 g (2.01 mmol) of the compound
from Example (-)-6A is dissolved in 40 ml of THF, and 241 mg (6.03
mmol) of sodium hydride (60% dispersion in mineral oil), 1.0 g
(6.03 mmol) of potassium iodide and 1.29 ml (2509 mg; 16.1 mmol) of
ethyl iodide are added, and the mixture is stirred at room
temperature overnight. The mixture is concentrated in vacuo. The
crude product is taken up in ethyl acetate, and the organic phase
is washed several times with water, dried over sodium sulfate and
concentrated in vacuo. The crude product is purified by RP-HPLC
chromatography (mobile phase acetonitrile/water gradient).
[1108] Yield: 470 mg (44% of theory).
[1109] LC-MS (Method 12): R.sub.t=2.79 min.
[1110] MS (EI): m/z=526 (M+H).sup.+
Example 71A
Benzyl
2-(benzyloxy)-N-(tert-butoxycarbonyl)-5-iodo-N-ethyl-L-phenylalanin-
ate
[1111] ##STR143##
[1112] Preparation takes place in analogy to Example 7A from 420 mg
(0.68 mmol) of the compound from Example 70A, 9.77 mg (0.08 mmol)
of DMAP, 173 mg (1.6 mmol) of benzyl alcohol and 184 mg (0.96 mmol)
of EDC in 8 ml of acetonitrile.
[1113] Yield: 375 mg (76% of theory)
[1114] LC-MS (Method 12): R.sub.t=3.26 min.
[1115] MS (EI): m/z=616 (M+H).sup.+
[1116] .sup.1H-NMR (300 MHz, CDCl.sub.3): .delta.=0.80 (m.sub.c,
3H), 1.4 (m.sub.c, 9H) 2.75 (m.sub.c, 1H), 3.07 (m.sub.c, 1H), 3.22
(m.sub.c, 1H), 3.47 (m.sub.c, 1H), 4.23 (m.sub.c, 1H), 5.06 (s,
2H), 5.15 (m.sub.c, 2H), 6.65 (d, 1H), 7.25-7.5 (m, 12H).
Example 72A
2-(Trimethylsilyl)ethyl
2(S)-benzyloxycarbonylamino-3-[4,4'-bis-benzyloxy-3'-(2(S)-benzyloxycarbo-
nyl-(2-tert-butoxycarbonyl-2-ethyl)aminoethyl)biphenyl
3-yl]propionate
[1117] ##STR144##
[1118] Preparation takes place in analogy to Example 12A from 343
mg (0.54 mmol) of the compound from Example 57A, 334 mg (0.54 mmol)
of the compound from Example 71A, 354 mg (1.09 mmol) of cesium
carbonate and 40 mg (0.05 mmol) of
bis(diphenylphosphino)ferrocenepalladium(II) chloride in 8 ml of
DMF under an argon atmosphere.
[1119] Yield: 216 mg (40% of theory)
[1120] LC-MS (Method 12): R.sub.t=3.54 min.
[1121] MS (EI): m/z=893 (M-boc+H).sup.+
Example 73A
2-(Trimethylsilyl)ethyl
2(S)-benzyloxycarbonylamino-3-[4,4'-bis-benzyloxy-3'-(2(S)-benzyloxycarbo-
nyl-2-ethylaminoethylbiphenyl-3-yl]propionate hydrochloride
[1122] ##STR145##
[1123] Preparation takes place in analogy to Example 15A from 210
mg (0.211 mmol) of the compound from Example 72A and 15 ml of a 4N
solution of hydrogen chloride in dioxane in 4 ml of dioxane.
[1124] Yield: quantitative
[1125] LC-MS (Method 12): Rt=3.01 min.
[1126] MS (EI): m/z=893 (M-HCl+H)+
[1127] Examples 74A to 78A listed in the following table are
prepared from the appropriate starting materials in analogy to the
methods detailed above: TABLE-US-00003 Ex. Prepared in Analytical
No. Structure analogy to data 74A ##STR146## 16A with N.sup.5-
[(benzyloxy)- carbonyl]-N.sup.2- (tert-butoxy- carbonyl)-L-
ornithine LC-MS (Method 17): R.sub.t = 3.63 min. MS (EI): m/z =
1241 (M + H).sup.+ 75A ##STR147## 17A LC-MS (Method 17): R.sub.t =
3.38 min. MS (EI): m/z = 1149 (M + H).sup.+ 76A ##STR148## 18A
LC-MS (Method 17): R.sub.t = 3.58 min. MS (EI): m/z = 1315 (M +
H).sup.+ 77A ##STR149## 26A 78A ##STR150## 39A LC-MS (Method 17):
R.sub.t = 3.39 min. MS (EI): m/z = 931 (M + H).sup.+
Example 79A
Benzyl{(1S)-4-[(tert-butoxycarbonyl)amino]-1-[({2-[(tert-butoxycarbonyl)am-
ino]ethyl}amino)carbonyl]butyl}carbamate
[1128] ##STR151##
[1129] Under argon, 300 mg (0.82 mmol) of
N.sup.2-[(benzyloxy)carbonyl]-N.sup.5-(tert-butoxycarbonyl)-L-ornithine
and 171 mg (1.06 mmol) of tert-butyl-(2-aminoethyl)carbamate are
dissolved in 6 ml of dimethylformamide. Then, at 0.degree. C. (ice
bath), 204 mg (1.06 mmol) of EDC and 33 mg (0.25 mmol) of HOBt are
added. The mixture is slowly warmed to RT and stirred at RT for 12
h. The solution is concentrated in vacuo and the residue is taken
up with ethyl acetate. The organic phase is washed successively
with saturated sodium bicarbonate and sodium chloride solutions,
dried over magnesium sulfate and evaporated in vacuo. The remaining
solid is dried under high vacuum.
[1130] Yield: 392 mg (94% of theory)
[1131] LC-MS (Method 17): R.sub.t=2.36 min.
[1132] MS (EI): m/z=509 (M+H).sup.+
Example 80A
Benzyl{(1S)-4-[(tert-butoxycarbonyl)amino]-1-[({3-[(tert-butoxycarbonyl)am-
ino]-2-hydroxypropyl}amino)carbonyl]butyl}carbamate
[1133] ##STR152##
[1134] Preparation takes place in analogy to Example 79A from 300
mg (0.82 mmol) of
N.sup.2-[(benzyloxy)carbonyl]-N.sup.5-(tert-butoxycarbonyl)-L-ornithine
and 202 mg (1.06 mmol) of
tert-butyl(3-amino-2-hydroxypropyl)carbamate in 6 ml of
dimethylformamide with the addition of 204 mg (1.06 mmol) of EDC
and 33 mg (0.25 mmol) of HOBt.
[1135] Yield: 412 mg (93% of theory)
[1136] LC-MS (Method 19): R.sub.t=2.23 min.
[1137] MS (EI): m/z=539 (M+H).sup.+
Example 81A
N.sup.5-(tert-Butoxycarbonyl)-N-{2-[(tert-butoxycarbonyl)amino]ethyl}-L-or-
nithinamide
[1138] ##STR153##
[1139] A solution of 390 mg (0.77 mmol) of
benzyl{(1S)-4-[(tert-butoxycarbonyl)amino]-1-[({2-[(tert-butoxycarbonyl)a-
mino]ethyl}amino)carbonyl]butyl}carbamate (Example 79A) in 50 ml of
ethanol is hydrogenated after the addition of 40 mg of palladium on
activated carbon (10%) at RT under atmospheric pressure for 4 h.
The mixture is filtered through kieselguhr, and the residue is
washed with ethanol. The filtrate is evaporated to dryness in
vacuo. The product is reacted without further purification.
[1140] Yield: 263 mg (91% of theory)
[1141] MS (ESI): m/z=375 (M+H).sup.+; 397 (M+Na).sup.+.
Example 82A
N.sup.5-(tert-Butoxycarbonyl)-N-{3-[(tert-butoxycarbonyl)amino]-2-hydroxyp-
ropyl}-L-ornithinamide
[1142] ##STR154##
[1143] Preparation takes place in analogy to Example 81A from 412
mg (0.76 mmol) of
benzyl{(1S)-4-[(tert-butoxycarbonyl)amino]-1-[({3-[(tert-butoxycarbonyl)a-
mino]-2-hydroxypropyl}amino)carbonyl]butyl}carbamate (Example 80A)
in 50 ml of ethanol with the addition of 41 mg of palladium on
activated carbon (10%). The product is reacted without further
purification.
[1144] Yield: 306 mg (99% of theory)
[1145] MS (ESI): m/z=405 (M+H).sup.+.
Example 83A
tert-Butyl[(1S)-4-[(tert-butoxycarbonyl)amino]-1-(hydroxymethyl)butyl]carb-
amate
[1146] ##STR155##
[1147] 91 mg (0.90 mmol) of 4-methylmorpholine and 98 mg (0.90
mmol) of ethyl chloroformate are added to a solution of 300 mg
(0.90 mmol) of N.sup.2,N.sup.5-bis(tert-butoxycarbonyl)-L-ornithine
in 10 ml of tetrahydrofuran at -10.degree. C., and the mixture is
stirred for 30 min. At this temperature, 1.81 ml (1.81 mmol) of a
1M solution of lithium aluminum hydride in tetrahydrofuran are
slowly added dropwise. The mixture is slowly warmed to RT and
stirred at RT for 12 h. While cooling in ice, 0.1 ml of water and
0.15 ml of a 4.5% sodium hydroxide solution are cautiously added,
and the mixture is stirred at RT for a further 3 h. The mixture is
filtered and the filtrate is concentrated in vacuo. The residue is
dissolved in ethyl acetate, washed with water, dried over magnesium
sulfate and again evaporated to dryness in vacuo. The product is
reacted without further purification.
[1148] Yield: 239 mg (83% of theory)
[1149] MS (ESI): m/z=319 (M+H).sup.+; 341 (M+Na).sup.+.
Example 84A
(2S)-2,5-Bis[(tert-butoxycarbonyl)amino]pentyl methanesulfonate
[1150] ##STR156##
[1151] 103 mg (0.90 mmol) of methanesulfonyl chloride and 0.21 ml
(1.5 mmol) of triethylamine are added to a solution of 240 mg (0.75
mmol) of
tert-butyl[(1S)-4-[(tert-butoxycarbonyl)amino]-1-(hydroxymethyl)butyl]car-
bamate (Example 83A) in 20 ml of dichloromethane, and the mixture
is stirred at RT for 16 h. The mixture is diluted with
dichloromethane and washed twice with 0.1N hydrochloric acid. The
organic phase is dried over magnesium sulfate and evaporated to
dryness in vacuo. The product is reacted without further
purification.
[1152] Yield: 218 mg (73% of theory)
[1153] MS (ESI): m/z=419 (M+Na).sup.+.
Example 85A
tert-Butyl-{(4S)-5-azido-4-[(tert-butoxycarbonyl)amino]pentyl}carbamate
[1154] ##STR157##
[1155] A solution of 218 mg (0.55 mmol) of
(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl methanesulfonate
(Example 84A) in 15 ml of dimethylformamide is mixed with 36 mg
(0.55 mmol) of sodium azide and stirred at 70.degree. C. for 12 h.
Most of the solvent is removed by distillation in vacuo, and the
residue is diluted with ethyl acetate. The mixture is washed
several times with a saturated sodium bicarbonate solution, dried
over magnesium sulfate and evaporated to dryness in vacuo. The
product is reacted without further purification.
[1156] Yield: 188 mg (99% of theory)
[1157] MS (ESI): m/z=344 (M+H).sup.+.
Example 86A
tert-Butyl{(4S)-5-amino-4-[(tert-butoxycarbonyl)amino]pentyl}carbamate
[1158] ##STR158##
[1159] A solution of 188 mg (0.55 mmol) of
tert-butyl{(4S)-5-azido-4-[(tert-butoxycarbonyl)amino]pentyl}carbamate
(Example 85A) in ethanol is hydrogenated after the addition of 20
mg of palladium on activated carbon (10%) at RT under atmospheric
pressure for 12 h. The mixture is filtered through kieselguhr, and
the residue is washed with ethanol. The filtrate is evaporated to
dryness in vacuo. The product is reacted without further
purification.
[1160] Yield: 102 mg (59% of theory)
[1161] MS (ESI): m/z=318 (M+H).sup.+; 340 (M+Na).sup.+.
Example 87A
Benzyl[(1S)-3-[(tert-butoxycarbonyl)amino]-1-(hydroxymethyl)propyl]carbama-
te
[1162] ##STR159##
[1163] Preparation takes place in analogy to Example 83A from 300
mg (0.85 mmol) of
(2S)-2-{[(benzyloxy)carbonyl]amino}-4-[(tert-butoxycarbonyl)amino]butanoi-
c acid in 10 ml of tetrahydrofuran with 86 mg (0.85 mmol) of
4-methylmorpholine, 92 mg (0.85 mmol) of ethyl chloroformate and
1.7 ml (1.70 mmol) of a 1M solution of lithium aluminum hydride in
tetrahydrofuran. The product is reacted without further
purification.
[1164] Yield: 229 mg (80% of theory)
[1165] LC-MS (Method 12): R.sub.t=1.83 min.
[1166] MS (EI): m/z=339 (M+H).sup.+; 239
(M-C.sub.5H.sub.8O.sub.2+H).sup.+.
Example 88A
tert-Butyl[(3S)-3-amino-4-hydroxybutyl]carbamate hydrochloride
[1167] ##STR160##
[1168] Preparation takes place in analogy to Example 81A from 229
mg (0.68 mmol) of
benzyl[(1S)-3-[(tert-butoxycarbonyl)amino]-1-(hydroxymethyl)propyl]carbam-
ate (Example 87A) in 50 ml of ethanol with the addition of 23 mg of
palladium on activated carbon (10%). The crude product is stirred
in 1 ml of 1N hydrochloric acid and evaporated in vacuo and dried
to constant weight under high vacuum.
[1169] Yield: 183 mg (90% of theory)
[1170] MS (ESI): m/z=205 (M-HCl+H).sup.+.
Example 89A
tert-Butyl{(3S)-3-[(tert-butoxycarbonyl)amino]-4-hydroxybutyl}carbamate
[1171] ##STR161##
[1172] Preparation takes place in analogy to Example 83A from 300
mg (0.60 mmol) of (2S)-2,4-bis[(tert-butoxycarbonyl)amino]butanoic
acid-N-cyclohexylcyclohexanamine (1:1) in 10 ml of tetrahydrofuran
with 61 mg (0.60 mmol) of 4-methylmorpholine, 65 mg (0.60 mmol) of
ethyl chloroformate and 1.2 ml (1.20 mmol) of a 1M solution of
lithium aluminum hydride in tetrahydrofuran. The product is reacted
without further purification.
[1173] Yield: 174 mg (95% of theory)
[1174] MS (ESI): m/z=305 (M+H).sup.+.
Example 90A
(2S)-2,4-Bis[(tert-butoxycarbonyl)amino]butyl methanesulfonate
[1175] ##STR162##
[1176] Preparation takes place in analogy to Example 84A from 250
mg (0.81 mmol) of
tert-butyl{(3S)-3-[(tert-butoxycarbonyl)amino]-4-hydroxybutyl}carbamate
(Example 89A) in 20 ml of dichloromethane with 110 mg (0.97 mmol)
of methanesulfonyl chloride and 0.23 ml (1.6 mmol) of
triethylamine. The product is reacted without further
purification.
[1177] Yield: 200 mg (64% of theory)
[1178] MS (ESI): m/z=383 (M+H).sup.+; 400 (M+Na).sup.+.
Example 91A
tert-Butyl{(3S)-4-azido-3-[(tert-butoxycarbonyl)amino]butyl}carbamate
[1179] ##STR163##
[1180] Preparation takes place in analogy to Example 85A from 200
mg (0.52 mmol) of (2S)-2,4-bis[(tert-butoxycarbonyl)amino]butyl
methanesulfonate (Example 90A) in 15 ml of dimethylformamide with
34 mg (0.52 mmol) of sodium azide. The product is reacted without
further purification.
[1181] Yield: 171 mg (99% of theory)
Example 92A
tert-Butyl{(3S)-4-amino-3-[(tert-butoxycarbonyl)amino]butyl}carbamate
[1182] ##STR164##
[1183] Preparation takes place in analogy to Example 86A from 171
mg (0.52 mmol) of
tert-butyl{(3S)-4-azido-3-[(tert-butoxycarbonyl)amino]butyl}carbamate
(Example 91A) in 10 ml of ethanol with the addition of 20 mg of
palladium on activated carbon (10%). The product is reacted without
further purification.
[1184] Yield: 117 mg (75% of theory)
[1185] MS (ESI): m/z=304 (M+H).sup.+; 326 (M+Na).sup.+.
Example 93A
Benzyl((4S)-4-[(tert-butoxycarbonyl)amino]-5-{[(1S)-3-[(tert-butoxycarbony-
l)amino]-1-(hydroxymethyl)propyl]amino}-5-oxopentyl)carbamate
[1186] ##STR165##
[1187] Preparation takes place in analogy to Example 79A from 140
mg (0.38 mmol) of
N.sup.5-[(benzyloxy)carbonyl]-N.sup.2-(tert-butoxycarbonyl)-L-ornithine
and 120 mg (0.50 mmol) of tert-butyl
[(3S)-3-amino-4-hydroxybutyl]carbamate hydrochloride (Example 88A)
in 6 ml of dimethylformamide with the addition of 96 mg (0.50 mmol)
of EDC, 16 mg (0.12 mmol) of HOBt and 0.17 ml (1.00 mmol) of
diisopropylethylamine. The product is purified by preparative
RP-HPLC (mobile phase water/acetonitrile gradient:
90:10.fwdarw.10:90).
[1188] Yield: 50 mg (23% of theory)
[1189] LC-MS (Method 19): R.sub.t=2.24 min.
[1190] MS (EI): m/z=553 (M+H).sup.+
Example 94A
N.sup.2-(tert-Butoxycarbonyl)-N-[(1S)-3-[(tert-butoxycarbonyl)amino]-1-(hy-
droxymethyl)propyl]-L-ornithinamide
[1191] ##STR166##
[1192] Preparation takes place in analogy to Example 81A from 50 mg
(0.09 mmol) of
benzyl((4S)-4-[(tert-butoxycarbonyl)amino]-5-{[(1S)-3-[(tert-but-
oxycarbonyl)amino]-1-(hydroxymethyl)propyl]amino}-5-oxopentyl)carbamate
(Example 93A) in 50 ml of ethanol with the addition of 5 mg of
palladium on activated carbon (10%). The product is reacted without
further purification.
[1193] Yield: 37 mg (98% of theory)
[1194] MS (ESI): m/z=419 (M+H).sup.+
Example 95A
Benzyl{2-[((2S,4R)-5-{[(benzyloxy)carbonyl]amino}-2-[(tert-butoxycarbonyl)-
amino]-4-{[tert-butyl(dimethyl)silyl]oxy}pentanoyl)amino]ethyl}carbamate
[1195] ##STR167##
[1196] 85 mg (0.17 mmol) of
5-benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamino-4(R)-(tert-butyldi-
methylsilanyloxy)pentanoic acid (Example 14A), 67.1 mg (0.29 mmol)
of benzyl-(2-aminoethyl)carbamate hydrochloride and 0.05 ml (0.29
mmol) of diisopropylethylamine are dissolved in 3 ml of DMF and
cooled to 0.degree. C. 55.8 mg (0.29 mmol) of EDC and 7.6 mg (0.06
mmol) of HOBT are added, and the mixture is allowed to warm to room
temperature and is stirred overnight. The mixture is then
concentrated in vacuo and purified by chromatography on silica gel
(dichloromethane/methanol 20:1)
[1197] Yield: 73 mg (59% of theory).
[1198] LC-MS (Method 12): R.sub.t=3.04 min.
[1199] MS (EI): m/z=673 (M+H).sup.+.
Example 96A
Benzyl{2-[((2S,4R)-2-amino-5-{[(benzyloxy)carbonyl]amino}-4-{[tert-butyl(d-
imethyl)silyl]oxy}pentanoyl)amino]ethyl}carbamate hydrochloride
[1200] ##STR168##
[1201] 53 mg (0.08 mmol) of the compound from Example 95A are
cooled to 0.degree. C., and 1 ml of 4N hydrogen chloride in dioxane
is added. After 1 h, concentration in vacuo results in the title
compound.
[1202] Yield: 41 mg (90% of theory).
[1203] LC-MS (Method 17): R.sub.t=1.60 min.
[1204] MS (EI): m/z=459 (M-HCl+H).sup.+.
Example 97A
(2S)-2-{[(Benzyloxy)carbonyl]amino}-4-[(tert-butoxycarbonyl)amino]butanoic
acid
[1205] ##STR169##
[1206] 500 mg (1.98 mmol) of
(2S)-4-amino-2-{[(benzyloxy)carbonyl]amino}butanoic acid are
dissolved in 5 ml of water and 5 ml of a 1N sodium hydroxide
solution. 649 mg (2.97 mmol) of di-tert-butyl dicarbonate in 2 ml
of methanol are added. The mixture is briefly heated to 30.degree.
C. in a water bath and stirred at room temperature overnight. After
concentration in vacuo, purification by chromatography on silica
gel (dichloromethane/methanol/concentrated ammonia solution
85:15:3) results in the title compound.
[1207] Yield: 740 mg (99% of theory).
[1208] LC-MS (Method 17): R.sub.t=2.08 min.
[1209] MS (EI): m/z=353 (M+H).sup.+.
Example 98A
Benzyl{(1S)-3-[(tert-butoxycarbonyl)amino]-1-[({3-[(tert-butoxycarbonyl)am-
ino]-2-hydroxypropyl}amino)carbonyl]propyl}carbamate
[1210] ##STR170##
[1211] 44 mg (0.12 mmol) of the compound from Example 97A and 40 mg
(0.21 mmol) of tert-butyl(3-amino-2-hydroxypropyl)carbamate are
dissolved in 1 ml of DMF and cooled to 0.degree. C., and 40.3 mg
(0.21 mmol) of EDC and 5.51 mg (0.04 mmol) of HOBt are successively
added. The mixture is allowed to warm to room temperature and is
stirred overnight. After concentration in vacuo, purification by
chromatography on silica gel (dichloromethane/methanol 20:1)
results in the title compound.
[1212] Yield: 38 mg (59% of theory).
[1213] LC-MS (Method 17): R.sub.t=2.25 min.
[1214] MS (EI): m/z=525 (M+H).sup.+.
Example 99A
tert-Butyl[3-({(2S)-2-amino-4-[(tert-butoxycarbonyl)amino]butanoyl}amino)--
2-hydroxypropyl]carbamate
[1215] ##STR171##
[1216] 38 mg (0.12 mmol) of the compound from Example 98A are
dissolved in 10 ml of methanol, and 10 mg of palladium on activated
carbon (10%) are added. The mixture is hydrogenated under
atmospheric pressure for 2 h and filtered through kieselguhr, and
the mother liquor is concentrated in vacuo.
[1217] Yield: 26 mg (75% of theory).
[1218] LC-MS (Method 12): R.sub.t=1.10 min.
[1219] MS (EI): m/z=391 (M+H).sup.+.
Example 100A
Benzyl[(1S)-2-({3-[(tert-butoxycarbonyl)amino]-2-hydroxypropyl}amino)-1-(h-
ydroxymethyl)-2-oxoethyl]carbamate
[1220] ##STR172##
[1221] 362.8 mg (0.954 mmol) of HATU and 123.3 mg (0.954 mmol) of
N,N-diisopropylethylamine are added to a solution of 207.5 mg
(0.867 mmol) of N-[(benzyloxy)carbonyl]-L-serine in 10 ml of
anhydrous DMF. After stirring at RT for 15 min, 165 mg (0.867 mmol)
of tert-butyl(3-amino-2-hydroxypropyl)carbamate are added. The
reaction mixture is stirred at RT for 15 h. The solvent is then
evaporated and the residue is taken up in dichloromethane. The
organic phase is washed with water, dried over magnesium sulfate
and concentrated. The crude product is purified by preparative
HPLC.
[1222] Yield 175 mg (49% of theory)
[1223] LC-MS (Method 12): R.sub.t=1.56 min.
[1224] MS (EI): m/z=412 (M+H).sup.+.
Example 101A
N-{3-[(tert-Butoxycarbonyl)amino]-2-hydroxypropyl}-L-serinamide
[1225] ##STR173##
[1226] 131 mg (0.318 mmol) of
benzyl[(1S)-2-({3-[(tert-butoxycarbonyl)amino]-2-hydroxypropyl}amino)-1-(-
hydroxymethyl)-2-oxoethyl]carbamate (Example 100A) are dissolved in
20 ml of ethanol. 20 mg of palladium on activated carbon (10%) are
added thereto, and the mixture is hydrogenated under atmospheric
pressure for 15 h. The reaction mixture is filtered through
prewashed kieselguhr, and the filtrate is concentrated in vacuo on
a rotary evaporator. The crude product is reacted without further
purification.
[1227] Yield: 63 mg (71% of theory).
[1228] LC-MS (Method 19): R.sub.t=0.53 min
[1229] MS (EI): m/z=278 (M+H).sup.+.
Example 102A
Benzyl(2-{[N.sup.5-[{[(benzyloxy)carbonyl]amino}(imino)methyl]-N.sup.2-(te-
rt-butoxycarbonyl)-L-ornithyl]amino}ethyl)carbamate
[1230] ##STR174##
[1231] 419.3 mg (1.1 mmol) of HATU and 258.5 mg (2 mmol) of
N,N-diisopropylethylamine are added to a solution of 408.4 mg (1
mmol) of
N.sup.5-[{[(benzyloxy)carbonyl]amino}(imino)methyl]-N.sup.2-(tert-butoxyc-
arbonyl)-L-ornithine in 15 ml of anhydrous DMF. After stirring at
RT for 15 min, 253.76 mg (1.1 mmol) of benzyl
(2-aminoethyl)carbamate hydrochloride are added. The reaction
mixture is stirred at RT for 15 h. The solvent is then evaporated
and the residue is taken up in dichloromethane. The organic phase
is washed with water, dried over magnesium sulfate and
concentrated. The crude product is purified by preparative
HPLC.
[1232] Yield: 334 mg (41% of theory)
[1233] LC-MS (Method 17): R.sub.t=1.94
[1234] MS (EI): m/z=585 (M+H).sup.+.
Example 103A
Benzyl[(6S)-6-amino-7,12-dioxo-14-phenyl-13-oxa-2,8,11-triazatetradecan-1--
imidoyl]carbamate hydrochloride
[1235] ##STR175##
[1236] A mixture of 334 mg (0.417 mmol) of benzyl
(2-{[N.sup.5-[{[(benzyloxy)carbonyl]amino}(imino)methyl]-N.sup.2-(tert-bu-
toxycarbonyl)-L-ornithyl]amino}ethyl)carbamate (Example 102A) and
17 ml of a 4M solution of hydrogen chloride in dioxane is stirred
at RT for 4 h. The reaction solution is concentrated, coevaporated
with dichloromethane several times, and dried under high vacuum.
The crude product is reacted without further purification.
[1237] Yield: quant.
[1238] LC-MS (Method 12): R.sub.t=1.05 min.
[1239] MS (EI): m/z=485 (M-HCl+H).sup.+.
Example 104A
Benzyl[2-({(3S)-3-{[(benzyloxy)carbonyl]amino}-6-[(tert-butoxycarbonyl)ami-
no]hexanoyl}amino)ethyl]carbamate
[1240] ##STR176##
[1241] 549.7 mg (1.446 mmol) of HATU and 339.7 mg (2.629 mmol) of
N,N-diisopropylethylamine are added to a solution of 500 mg (1.31
mmol) of
(3S)-3-{[(benzyloxy)carbonyl]amino}-6-[(tert-butoxycarbonyl)amino]hexa-
noic acid in 25 ml of anhydrous DMF. After stirring at RT for 15
min, 333.5 mg (1.446 mmol) of benzyl (2-aminoethyl)carbamate
hydrochloride are added. The reaction mixture is stirred at RT for
15 h. The solvent is then evaporated and the residue is taken up in
dichloromethane. The organic phase is washed with water, dried over
magnesium sulfate and concentrated. The crude product is purified
by preparative HPLC.
[1242] Yield 556.6 mg (44% of theory)
[1243] LC-MS (Method 17): R.sub.t=2.41 min.
[1244] MS (EI): m/z=557 (M+H).sup.+.
Example 105A
Benzyl((1S)-4-amino-1-{2-[(2-{[(benzyloxy)carbonyl]amino}ethyl)amino]-2-ox-
oethyl}butyl)carbamate hydrochloride
[1245] ##STR177##
[1246] 8 ml of a 4M solution of hydrogen chloride in dioxane are
added to a solution of 320 mg (0.287 mmol) of
benzyl[2-({(3S)-3-{[(benzyloxy)carbonyl]amino}-6-[(tert-butoxycarbonyl)am-
ino]hexanoyl}amino)ethyl]carbamate (Example 104A) in 2 ml of
dioxane at 0.degree. C. After 1 h at RT, the reaction solution is
concentrated in vacuo, coevaporated with dichloromethane several
times and dried under high vacuum. The crude product is reacted
without further purification.
[1247] Yield: quant.
[1248] LC-MS (Method 20): R.sub.t=2.84 min.
[1249] MS (EI): m/z=457 (M-HCl+H).sup.+.
Example 106A
Benzyl{2-[((3S)-3-{[(benzyloxy)carbonyl]amino}-6-{[N.sup.5-[(benzyloxy)car-
bonyl]-N.sup.2-(tert-butoxycarbonyl)-L-ornithyl]amino}hexanoyl)amino]ethyl-
}carbamate
[1250] ##STR178##
[1251] 89.5 mg (0.235 mmol) of HATU and 55.3 mg (0.428 mmol) of
N,N-diisopropylethylamine are added to a solution of 78.4 mg (0.214
mmol) of
N.sup.5-[(benzyloxy)carbonyl]-N.sup.2-(tert-butoxycarbonyl)-L-ornithin-
e in 5 ml of anhydrous DMF. After stirring at RT for 15 min, a
solution of 116 mg (0.235 mmol) of
benzyl((1S)-4-amino-1-{2-[(2-{[(benzyloxy)carbonyl]amino}ethyl)amino]-2-o-
xoethyl}butyl)carbamate hydrochloride (Example 105A) in 5 ml of
anhydrous DMF is added. The reaction mixture is stirred at RT for
15 h. The solvent is then evaporated and the residue is taken up in
dichloromethane. The organic phase is washed with water, dried over
magnesium sulfate and concentrated. The crude product is purified
by preparative HPLC.
[1252] Yield 48 mg (28% of theory)
[1253] LC-MS (Method 12): R.sub.t=2.33 min.
[1254] MS (EI): m/z=805 (M+H).sup.+.
Example 107A
Benzyl((4S,10S)-4-amino-10-{[(benzyloxy)carbonyl]amino}-5,12,17-trioxo-19--
phenyl-18-oxa-6,13,16-triazanonadec-1-yl)carbamate
hydrochloride
[1255] ##STR179##
[1256] 2.5 ml of a 4M solution of hydrogen chloride in dioxane are
added to a solution of 48 mg (0.060 mmol) of
benzyl{2-[((3S)-3-{[(benzyloxy)carbonyl]amino}-6-{[N.sup.5-[(benzyloxy)ca-
rbonyl]-N.sup.2-(tert-butoxycarbonyl)-L-ornithyl]amino}hexanoyl)amino]ethy-
l}carbamate (Example 106A) in 1 ml of dioxane at RT. After 4 h at
RT, the reaction solution is concentrated in vacuo, coevaporated
with dichloromethane several times and dried under high vacuum. The
crude product is reacted without further purification.
[1257] Yield: quant.
[1258] LC-MS (Method 12): R.sub.t=1.69 min.
[1259] MS (EI): m/z=705 (M-HCl+H).sup.+.
Example 108A
Benzyl{(4S)-4-[(tert-butoxycarbonyl)amino]-5-[(2,3-dihydroxypropyl)amino]--
5-oxopentyl}carbamate
[1260] ##STR180##
[1261] 658.5 mg (1.8 mmol) of HATU and 129.2 mg (1 mmol) of
N,N-diisopropylethylamine are added to a solution of 366 mg (1
mmol) of
N.sup.5-[(benzyloxy)carbonyl]-N.sup.2-(tert-butoxycarbonyl)-L-ornithine
in 15 ml of anhydrous DMF. After stirring at RT for 15 min, 182.2
mg (1 mmol) of 3-aminopropane-1,2-diol are added. The reaction
mixture is stirred at RT for 15 h. The solvent is then evaporated
and the residue is taken up in dichloromethane. The organic phase
is washed with water, dried over magnesium sulfate and
concentrated. The crude product is purified by preparative
HPLC.
[1262] Yield 135 mg (30% of theory)
[1263] LC-MS (Method 12): R.sub.t=1.79 min.
[1264] MS (EI): m/z=440 (M+H).sup.+.
Example 109A
Benzyl{(4S)-4-amino-5-[(2,3-dihydroxypropyl)amino]-5-oxopentyl}carbamate
hydrochloride
[1265] ##STR181##
[1266] 4 ml of a 4M solution of hydrogen chloride in dioxane are
added to a solution of 135 mg (0.31 mmol) of
benzyl{(4S)-4-[(tert-butoxycarbonyl)amino]-5-[(2,3-dihydroxypropyl)amino]-
-5-oxopentyl}carbamate (Example 108A) in 0.5 ml of dioxane at
0.degree. C. After 1 h at RT, the reaction solution is concentrated
in vacuo, coevaporated with dichloromethane several times and dried
under high vacuum. The crude product is reacted without further
purification.
[1267] Yield: quant.
[1268] LC-MS (Method 12): R.sub.t=1.01 min.
[1269] MS (EI): m/z=340 (M-HCl+H).sup.+.
Example 110A
Benzyl[2-({(2S)-4-{[(benzyloxy)carbonyl]amino}-2-[(tert-butoxycarbonyl)ami-
no]butanoyl}amino)ethyl]carbamate
[1270] ##STR182##
[1271] 321.9 mg (0.847 mmol) of HATU and 199.3 mg (1.534 mmol) of
N,N-diisopropylethylamine are added to a solution of 410.8 mg
(0.770 mmol) of
(2S)-4-{[(benzyloxy)carbonyl]amino}-2-[(tert-butoxycarbonyl)amin-
o]butanoic acid --N-cyclohexylcyclohexanamine (1:1) in 25 ml of
anhydrous DMF. After stirring at RT for 15 min, 195.3 mg (0.847
mmol) of benzyl(2-aminoethyl)carbamate hydrochloride are added. The
reaction mixture is stirred at RT for 15 h. The solvent is then
evaporated and the residue is taken up in dichloromethane. The
organic phase is washed with water, dried over magnesium sulfate
and concentrated. The crude product is purified by preparative
HPLC.
[1272] Yield 270 mg (66% of theory)
[1273] LC-MS (Method 12): R.sub.t=2.19 min.
[1274] MS (EI): m/z=529 (M+H).sup.+.
Example 111A
Benzyl{2-[((2S)-2-amino-4-{[(benzyloxy)carbonyl]amino}butanoyl)amino]ethyl-
}carbamate hydrochloride
[1275] ##STR183##
[1276] A mixture of 270 mg (0.511 mmol) of
benzyl-[2-({(2S)-4-{[(benzyloxy)carbonyl]amino}-2-[(tert-butoxycarbonyl)a-
mino]butanoyl}amino)ethyl]carbamate (Example 110A) and 9 ml of a 4M
solution of hydrogen chloride in dioxane is stirred at RT for 2 h.
The reaction solution is concentrated, coevaporated with
dichloromethane several times and dried under high vacuum. The
crude product is reacted without further purification.
[1277] Yield: quant.
[1278] LC-MS (Method 17): R.sub.t=1.58 min.
[1279] MS (EI): m/z=429 (M-HCl+H).sup.+.
Example 112A
Benzyl{2-[((2S)-4-{[(benzyloxy)carbonyl]amino}-2-{[N.sup.5-(benzyloxy)carb-
onyl]-N.sup.2-(tert-butoxycarbonyl)-L-ornithyl]amino}butanoyl)amino]ethyl}-
carbamate
[1280] ##STR184##
[1281] 217.0 mg (0.467 mmol) of HATU and 109.7 mg (1.534 mmol) of
N,N-diisopropylethylamine are added to a solution of 155.4 mg
(0.770 mmol) of
N.sup.5-[(benzyloxy)carbonyl]-N.sup.2-(tert-butoxycarbonyl)-L-or-
nithine in 5 ml of anhydrous DMF. After stirring at RT for 15 min,
a solution of 195.3 mg (0.849 mmol) of
benzyl{2-[((2S)-2-amino-4-{[(benzyloxy)carbonyl]amino}butanoyl)amino]ethy-
l}carbamate hydrochloride (Example 111A) in 5 ml of anhydrous DMF
is added. The reaction mixture is stirred at RT for 15 h. The
solvent is then evaporated and the residue is taken up in
dichloromethane. The organic phase is washed with water, dried over
magnesium sulfate and concentrated. The crude product is purified
by preparative HPLC.
[1282] Yield 71 mg (21% of theory)
[1283] LC-MS (Method 12): R.sub.t=2.42 min.
[1284] MS (EI): m/z=777 (M+H).sup.+
Example 113A
Benzyl[(4S,7S)-4-amino-7-(2-{[(benzyloxy)carbonyl]amino}ethyl)-5,8,13-trio-
xo-15-phenyl-14-oxa-6,9,12-triazapentadec-1-yl]carbamate
hydrochloride
[1285] ##STR185##
[1286] 3.7 ml of a 4M solution of hydrogen chloride in dioxane are
added to a solution of 71 mg (0.091 mmol) of
benzyl{2-[((2S)-4-{[(benzyloxy)carbonyl]amino}-2-{[N.sup.5-[(benzyloxy)ca-
rbonyl]-N.sup.2-(tert-butoxycarbonyl)-L-ornithyl]amino}butanoyl)amino]ethy-
l}carbamate (Example 112A) in 1.5 ml of dioxane at RT. After 4 h at
RT, the reaction solution is concentrated in vacuo, coevaporated
with dichloromethane several times and dried under high vacuum. The
crude product is reacted without further purification.
[1287] Yield: quant.
[1288] LC-MS (Method 12): R.sub.t=1.70 min.
[1289] MS (EI): m/z=677 (M-HCl+H).sup.+
Example 114A
Benzyl{(1S)-4-[(tert-butoxycarbonyl)amino]-1-[2-({2-[(tert-butoxycarbonyl)-
amino]ethyl}amino)-2-oxoethyl]butyl}carbamate
[1290] ##STR186##
[1291] 836.5 mg (2.2 mmol) of HATU and 517.0 mg (4 mmol) of
N,N-diisopropylethylamine are added to a solution of 760.9 mg (2
mmol) of
(3S)-3-{[(benzyloxy)carbonyl]amino}-6-[(tert-butoxycarbonyl)amino]hexanoi-
c acid in 25 ml of anhydrous DMF. After stirring at RT for 45 min
352.5 mg (2.2 mmol) of tert-butyl (2-aminoethyl)carbamate
hydrochloride are added. The reaction mixture is stirred at RT for
15 h. The solvent is then evaporated and the residue is taken up in
dichloromethane. The organic phase is washed with water, dried over
magnesium sulfate and concentrated. The crude product is purified
by preparative HPLC.
[1292] Yield 400 mg (38% of theory)
[1293] LC-MS (Method 19): R.sub.t=2.33 min.
[1294] MS (EI): m/z=523 (M+H).sup.+.
Example 115A
tert-Butyl[(4S)-4-amino-6-({2-[(tert-butoxycarbonyl)amino]ethyl}amino)-6-o-
xohexyl]carbamate
[1295] ##STR187##
[1296] 400 mg (0.765 mmol) of
benzyl{(1S)-4-[(tert-butoxycarbonyl)amino]-1-[2-({2-[(tert-butoxycarbonyl-
)amino]ethyl}amino)-2-oxoethyl]butyl}carbamate (Example 114A) are
dissolved in 50 ml of ethanol. 80 mg of palladium on activated
carbon (10%) are added thereto, and the mixture is then
hydrogenated under atmospheric pressure for 15 h. The reaction
mixture is filtered through prewashed kieselguhr, and the filtrate
is concentrated on a rotary evaporator in vacuo. The crude product
is reacted without further purification.
[1297] Yield: quant.
[1298] LC-MS (Method 17): R.sub.t=1.42 min
[1299] MS (EI): m/z=389 (M+H).sup.+.
[1300] Examples 116A and 117A detailed in the following table are
prepared from the appropriate starting compounds in analogy to the
method of Example 83A detailed above: TABLE-US-00004 Ex. Prepared
in Analytical No. Structure analogy to data 116A ##STR188##
N.sup.6-[(Bezyloxy)- carbonyl]-N.sup.2-(tert- butoxycarbonyl)-
L-lysine LC-MS (Method 12): R.sub.t = 1.94 min. MS (EI): m/z = 367
(M + H)+ 117A ##STR189## N-[(Benzyloxy)- carbonyl]-3-[(tert-
butoxycarbonyl)- amino]-L-alanine LC-MS (Method 19): R.sub.t = 1.98
min. MS (EI): m/z = 325 (M + H)+
Example 118A
Benzyl[(1S)-2-amino-1-(hydroxymethyl)ethyl]carbamate
hydrochloride
[1301] ##STR190##
[1302] A mixture of 269 mg (0.83 mmol) of benzyl
tert-butyl[(2S)-3-hydroxypropane-1,2-diyl]biscarbamate (Example
117A) and 5 ml of a 4M solution of hydrogen in dioxane chloride is
stirred at RT for 2 h. The reaction solution is concentrated,
coevaporated with dichloromethane several times and dried under
high vacuum. The crude product is reacted without further
purification.
[1303] Yield: 212 mg (98% of theory)
[1304] LC-MS (Method 12): R.sub.t=0.55 min.
[1305] MS (EI): m/z=225 (M-HCl+H).sup.+.
Example 119A
Benzyl{(1S)-1-[({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl}amino)carb-
onyl]-4-[(tert-butoxycarbonyl)amino]butyl}carbamate
[1306] ##STR191##
[1307] Preparation takes place in analogy to Example 79A from 120
mg (0.33 mmol) of
N.sup.5-(tert-butoxycarbonyl)-N.sup.2-[(benzyloxy)carbonyl]-L-ornithine
and 136 mg (0.43 mmol) of
tert-butyl{(4S)-5-amino-4-[(tert-butoxycarbonyl)amino]pentyl}carbamate
(Example 86A) in 6 ml of dimethylformamide with the addition of 82
mg (0.43 mmol) of EDC and 13 mg (0.1 mmol) of HOBt. The product is
purified by preparative RP-HPLC (mobile phase water/acetonitrile
gradient: 90:10.fwdarw.5:95).
[1308] Yield: 132 mg (61% of theory)
[1309] LC-MS (Method 17): R.sub.t=2.68 min.
[1310] MS (EI): m/z=666 (M+H).sup.+
Example 120A
tert-Butyl[(4S)-4-amino-5-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl-
}amino)-5-oxopentyl]carbamate
[1311] ##STR192##
[1312] Preparation takes place in analogy to Example 81A from 132
mg (0.20 mmol) of
benzyl{(1S)-1-[({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl}amino)car-
bonyl]-4-[(tert-butoxycarbonyl)amino]butyl}carbamate (Example 119A)
in 50 ml of ethanol with the addition of 13 mg of palladium on
activated carbon (10%). The product is reacted without further
purification.
[1313] Yield: quant.
[1314] MS (ESI): m/z=532 (M+H).sup.+
Example 121A
Benzyl[2-({(2S)-5-{[(benzyloxy)carbonyl]amino}-2-[(tert-butoxycarbonyl)ami-
no]pentanoyl}amino)ethyl]carbamate
[1315] ##STR193##
[1316] Preparation takes place in analogy to Example 79A from 300
mg (0.82 mmol) of
N.sup.5-[(benzyloxy)carbonyl]-N-(tert-butoxycarbonyl)-L-ornithine
and 246 mg (1.06 mmol) of benzyl (2-aminoethyl)carbamate
hydrochloride in 6 ml of dimethylformamide with the addition of 204
mg (1.06 mmol) of EDC, 33 mg (0.25 mmol) of HOBt and 148 mg (1.15
mmol) of N,N-diisopropylethylamine.
[1317] Yield: 397 mg (89% of theory)
[1318] LC-MS (Method 12): R.sub.t=2.20 min.
[1319] MS (EI): m/z=543 (M+H).sup.+
Example 122A
Benzyl{(4S)-4-amino-5-[(2-{[(benzyloxy)carbonyl]amino}ethyl)amino]-5-oxope-
ntyl}carbamate hydrochloride
[1320] ##STR194##
[1321] A mixture of 400 mg (0.73 mmol) of
benzyl[2-({(2S)-5-{[(benzyloxy)carbonyl]amino}-2-[(tert-butoxycarbonyl)am-
ino]pentanoyl}amino)ethyl]carbamate (Example 121A) and 1 ml of a 4M
solution of hydrogen chloride in dioxane is stirred at RT for 2 h.
The reaction solution is concentrated, coevaporated with
dichloromethane several times and dried under high vacuum. The
crude product is reacted without further purification.
[1322] Yield: quant
[1323] LC-MS (Method 19): R.sub.t=1.61 min.
[1324] MS (EI): m/z=443 (M-HCl+H).sup.+.
Example 123A
N.sup.5-[(Benzyloxy)carbonyl]-N.sup.2-(tert-butoxycarbonyl)-L-ornithyl-N.s-
up.5-[(benzyloxy)carbonyl]-N-(2-{[(benzyloxy)carbonyl]amino}ethyl)-L-ornit-
hinamide
[1325] ##STR195##
[1326] 350 mg (0.92 mmol) of HATU and 330 mg (2.56 mmol) of
N,N-diisopropylethylamine are added to a solution of 320 mg (0.88
mmol) of
N.sup.5-[(benzyloxy)carbonyl]-N.sup.2-(tert-butoxycarbonyl)-L-ornithin-
e and 350 mg (0.73 mmol) of
benzyl{(4S)-4-amino-5-[(2-{[(benzyloxy)carbonyl]amino}ethyl)amino]-5-oxop-
entyl}carbamate (Example 122A) in 5 ml of anhydrous DMF at
0.degree. C. The reaction mixture is stirred at RT for 15 h. The
solvent is then evaporated and the residue is stirred with water,
collected by filtration and dried under high vacuum.
[1327] Yield 480 mg (68% of theory)
[1328] LC-MS (Method 19): R.sub.t=2.61 min.
[1329] MS (EI): m/z=791 (M+H).sup.+.
Example 124A
N.sup.5-[(Benzyloxy)carbonyl]-L-ornithyl-N.sup.5-[(benzyloxy)carbonyl]-N-(-
2-{[(benzyloxy)carbonyl]amino}ethyl)-L-ornithinamide
hydrochloride
[1330] ##STR196##
[1331] Preparation takes place in analogy to Example 122A from 70
mg (0.09 mmol) of
N.sup.5-[(benzyloxy)carbonyl]-N.sup.2-(tert-butoxycarbonyl)-L-ornithyl-N.-
sup.5-[(benzyloxy)carbonyl]-N-(2-{[(benzyloxy)carbonyl]amino}ethyl)-L-orni-
thinamide (Example 123A) in 0.68 ml of a 4M solution of hydrogen
chloride in dioxane.
[1332] Yield: 65 mg (98% of theory)
[1333] MS (ESI): m/z=691 (M-HCl+H).sup.+
Example 125A
Benzyl[2-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl}amino)-2-oxoethy-
l]carbamate
[1334] ##STR197##
[1335] Preparation takes place in analogy to Example 79A from 92 mg
(0.44 mmol) of N-[(benzyloxy)carbonyl]glycine and 181 mg (0.57
mmol) of
tert-butyl{(4S)-5-amino-4-[(tert-butoxycarbonyl)amino]pentyl}carbamate
(Example 86A) in 6 ml of dimethylformamide with the addition of 110
mg (0.57 mmol) of EDC and 18 mg (0.13 mmol) of HOBt. The product is
purified by preparative RP-HPLC (mobile phase water/acetonitrile
gradient: 90:10.fwdarw.5:95).
[1336] Yield: 105 mg (47% of theory)
[1337] LC-MS (Method 12): R.sub.t=2.12 min.
[1338] MS (EI): m/z=509 (M+H).sup.+
Example 126A
tert-Butyl{(4S)-5-[(aminoacetyl)amino]-4-[(tert-butoxycarbonyl)amino]penty-
l}carbamate
[1339] ##STR198##
[1340] Preparation takes place in analogy to Example 81A from 105
mg (0.21 mmol) of
benzyl[2-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl}amino)-2-oxoeth-
yl]carbamate (Example 125A) in 50 ml of ethanol with the addition
of 11 mg of palladium on activated carbon (10%). The product is
reacted without further purification.
[1341] Yield: 64 mg (83% of theory)
[1342] MS (ESI): m/z=375 (M+H).sup.+
Example 127A
Benzyl[(1S)-1-[(benzyloxy)methyl]-2-({(2S)-2,5-bis[(tert-butoxycarbonyl)am-
ino]pentyl}amino)-2-oxoethyl]carbamate
[1343] ##STR199##
[1344] Preparation takes place in analogy to Example 79A from 150
mg (0.46 mmol) of O-benzyl-N-[(benzyloxy)carbonyl]-L-serine and 188
mg (0.59 mmol) of
tert-butyl{(4S)-5-amino-4-[(tert-butoxycarbonyl)amino]pentyl}car-
bamate (Example 86A) in 6 ml of dimethylformamide with the addition
of 114 mg (0.57 mmol) of EDC and 18 mg (0.13 mmol) of HOBt. The
product is purified by preparative RP-HPLC (mobile phase
water/acetonitrile gradient: 90:10.fwdarw.5:95).
[1345] Yield: 129 mg (45% of theory)
[1346] LC-MS (Method 17): R.sub.t=2.81 min.
[1347] MS (EI): m/z=629 (M+H).sup.+
Example 128A
tert-Butyl{(4S)-5-{[(2S)-2-amino-3-hydroxypropanoyl]amino}-4-[(tert-butoxy-
carbonyl)amino]pentyl}carbamate
[1348] ##STR200##
[1349] A solution of 128 mg (0.77 mmol) of
benzyl[(1S)-1-[(benzyloxy)methyl]-2-({(2S)-2,5-bis[(tert-butoxycarbonyl)a-
mino]pentyl}amino)-2-oxoethyl]carbamate (Example 127A) in 50 ml of
ethanol is hydrogenated after the addition of 13 mg of palladium on
activated carbon (10%) at RT under atmospheric pressure for 48 h.
The mixture is filtered through kieselguhr and the residue is
washed with ethanol. The filtrate is evaporated to dryness in
vacuo. The product is purified by preparative RP-HPLC (mobile phase
water/acetonitrile gradient: 90:10.fwdarw.5:95).
[1350] Yield: 22 mg (27% of theory)
[1351] LC-MS (Method 19): R.sub.t=1.43 min.
[1352] MS (EI): m/z=405 (M+H).sup.+
Example 129A
9H-Fluoren-9-ylmethyl{(1S)-4-amino-1-[({(2S)-2,5-bis[(tert-butoxycarbonyl)-
amino]pentyl}amino)carbonyl]-4-oxobutyl}carbamate
[1353] ##STR201##
[1354] 129 mg (0.34 mmol) of HATU and 133 mg (0.95 mmol) of
N,N-diisopropylethylamine are added to a solution of 100 mg (0.27
mmol) of N.sup.2-[(9H-fluoren-9-ylmethoxy)carbonyl]-L-glutamine and
112 mg (0.35 mmol) of
tert-butyl{(4S)-5-amino-4-[(tert-butoxycarbonyl)amino]pentyl}carbamate
(Example 86A) in 5 ml of anhydrous DMF at 0.degree. C. The reaction
mixture is stirred at RT for 15 h. The solvent is then evaporated
and the residue is stirred with water, collected by filtration and
dried under high vacuum.
[1355] Yield 45 mg (25% of theory)
[1356] LC-MS (Method 12): R.sub.t=2.27 min.
[1357] MS (EI): m/z=668 (M+H).sup.+.
Example 130A
tert-Butyl[(1S)-4-[(tert-butoxycarbonyl)amino]-1-({[(2S)-2,5-diamino-5-oxo-
pentanoyl]amino}methyl)butyl]carbamate
[1358] ##STR202##
[1359] A solution of 33 mg (0.05 mmol) of
9H-fluoren-9-ylmethyl{(1S)-4-amino-1-[({(2S)-2,5-bis[(tert-butoxycarbonyl-
)amino]pentyl}amino)carbonyl]-4-oxobutyl}carbamate (Example 129A)
in 1 ml of dimethylformamide is stirred after the addition of 4 mg
(0.05 mmol) of piperidine at room temperature for 45 min. The
solvent is evaporated and the crude product is reacted without
further purification.
[1360] Yield: quant.
[1361] MS (ESI): m/z=446 (M+H).sup.+
[1362] Examples 131A to 135 listed in the following table are
prepared from the appropriate starting materials in analogy to the
method of Example 79A detailed above: TABLE-US-00005 Ex. Prepared
in Analytical No. Structure analogy to data 131A ##STR203##
N.sup.5-[(Benzyloxy)- carbonyl]-N.sup.2-(tert- butoxycarbonyl)-L-
ornithine and tert-butyl (2- aminoethyl)- carbamate LC-MS (Method
19): R.sub.t = 2.33 min. MS (EI): m/z = 509 (M + H).sup.+ 132A
##STR204## N.sup.2,N.sup.5-Bis(tert- butoxycarbonyl)- L-ornithine
and Example 118A LC-MS (Method 19): R.sub.t = 2.20 min. MS (EI):
m/z = 539 (M + H).sup.+ 133A ##STR205## N.sup.2-[(benzyloxy)-
carbonyl]-N.sup.5-(tert- butoxycarbonyl)-L- ornothine and Eaxmple
142A LC-MS (Method 19): R.sub.t = 2.31 min. MS (EI): m/z = 581 (M +
H).sup.+ 134A ##STR206## N.sup.2-[(Benzyloxy)-
carbonyl]-L-asparagine and tert-butyl (2- aminoethyl)- carbamate
LC-MS (Method 19): R.sub.t = 1.75 min. MS (EI): m/z = 409 (M +
H).sup.+ 135A ##STR207## O-Benzyl-N- [(benzyl- oxy)carbonyl]-L-
tyrosine and Example 86A LC-MS (Method 12): R.sub.t = 2.79 min. MS
(EI): m/z = 705 (M + H).sup.+
[1363] Examples 136A to 141A listed in the following table are
prepared from the appropriate starting materials in analogy to the
method of Example 129A detailed above: TABLE-US-00006 Ex. Prepared
in Analytical No. Structure analogy to data 136A ##STR208##
N.sup.2-[(9H-Fluoren-9- ylmethoxy)- carbonyl]-L-alpha- asparagine
and tert-butyl (3- amino-2-hydroxy- propyl)carbamate LC-MS (Method
17): R.sub.t = 2.09 min. MS (EI): m/z = 527 (M + H).sup.+ 137A
##STR209## N.sup.2-[(Benzyloxy)- carbonyl]-L-alpha glutamine and
Example 86A LC-MS (Method 12): R.sub.t = 1.93 min. MS (EI): m/z =
580 (M + H).sup.+ 138A ##STR210## N.sup.2-[(9H-Fluoren-9-
ylmethoxy)- carbonyl]-L- asparagine and tert-butyl (3-
amino-2-hydroxy- propyl)carbamate LC-MS (Method 12): R.sub.t = 1.88
min. MS (EI): m/z = 527 (M + H).sup.+ 139A ##STR211##
N-[(9H-Fluoren-9- ylmethoxy)carbonyl]- L-glutaminic acid and
tert-butyl-(2- aminoethyl)- carbamate LC-MS (Method 12): R.sub.t =
2.31 min. MS (EI): m/z = 654 (M + H).sup.+ 140A ##STR212##
N-[(9H-Fluroen-9- ylmethoxy)carbonyl]- L-asparaginic acid and
tert-butyl (2- aminoethyl)- carbamate LC-MS (Method 19): R.sub.t =
2.52 min. MS (EI): m/z = 640 (M + H).sup.+ 141A ##STR213##
N.sup.2-[(9H-Fluoren-9- ylmethoxy)- carbonyl]-L- asparagine and
Example 92A LC-MS (Method 17): R.sub.t = 2.46 min. MS (EI): m/z =
640 (M + H).sup.+
[1364] Examples 142A to 148A listed in the following table are
prepared from the appropriate starting materials in analogy to the
method of Example 81A detailed above: TABLE-US-00007 Ex. Prepared
in Analytical No. Structure analogy to data 142A ##STR214## Example
116A MS (ESI): m/z = 233 (M + H)+ 143A ##STR215## Example 131A MS
(ESI): m/z = 375 (M + H).sup.+ 144A ##STR216## Example 133A MS
(ESI): m/z = 447 (M + H).sup.+ 145A ##STR217## Example 132A MS
(ESI): m/z = 405 (M + H).sup.+ 146A ##STR218## Example 134A LC-MS
(Method 12): R.sub.t = 0.41 min. MS (EI): m/z = 275 (M + H).sup.+
147A ##STR219## Example 135A LC-MS (Method 17): R.sub.t = 1.67 min.
MS (EI): m/z = 481 (M + H).sup.+ 148A ##STR220## Example 137A MS
(ESI): m/z = 289 (M + H).sup.+
[1365] Examples 149A to 153A listed in the following table are
prepared from the appropriate starting materials in analogy to the
method of Example 130A detailed above: TABLE-US-00008 Ex. Prepared
in Analytical No. Structure analogy to data 149A ##STR221## Example
136A MS (ESI): m/z = 305 (M + H).sup.+ 150A ##STR222## Example 138A
MS (ESI): m/z = 305 (M + H).sup.+ 151A ##STR223## Example 139A MS
(ESI): m/z = 432 (M + H).sup.+ 152A ##STR224## Example 140A MS
(ESI): m/z = 418 (M + H).sup.+ 153A ##STR225## Example 141A MS
(ESI): m/z = 418 (M + H).sup.+
Example 154A
Benzyl[(3S)-[(ter-butoxycarbonyl)amino]-4-({3-[tert-butoxycarbonyl)amino]--
2-hydroxypropyl}amino)-4-oxybutyl]carbamate
[1366] ##STR226##
[1367] 104.5 mg (0.275 mmol) of HATU and 64.6 mg (0.500 mmol) of
N,N-diisopropylethylamine are added to a solution of 133.4 mg (0.25
mmol) of
(2S)-4-{[(benzyloxy)carbonyl]amino}-2-[(tert-butoxycarbonyl)amino]buta-
noic acid-N-cyclohexylcyclohexanamine (1:1) in 10 ml of anhydrous
DMF. After stirring at RT for 15 min, 52.3 mg (0.275 mmol) of
tert-butyl(3-amino-2-hydroxypropyl)carbamate are added. The
reaction mixture is stirred at RT for 15 h. The solvent is then
evaporated and the residue is taken up in dichloromethane. The
organic phase is washed with water, dried over magnesium sulfate
and concentrated. The crude product is purified by preparative
HPLC.
[1368] Yield 25 mg (19% of theory)
[1369] LC-MS (Method 17): R.sub.t=2.23 min.
[1370] MS (EI): m/z=525 (M+H).sup.+
Example 155A
tert-Butyl[3-({(2S)-4-amino-2-[(tert-butoxycarbonyl)amino]butanoyl}amino)--
2-hydroxypropyl]carbamate
[1371] ##STR227##
[1372] 25 mg (0.048 mmol) of
benzyl[(3S)-3-[(tert-butoxycarbonyl)amino]-4-({3-[(tert-butoxycarbonyl)am-
ino]-2-hydroxypropyl}amino)-4-oxobutyl]carbamate (Example 154A) are
dissolved in 10 ml of ethanol. 10 mg of palladium on activated
carbon (10%) are added thereto, and the mixture is then
hydrogenated under atmospheric pressure for 15 h. The reaction
mixture is filtered through prewashed kieselguhr, and the filtrate
is concentrated on a rotary evaporator in vacuo. The crude product
is reacted without further purification.
[1373] Yield: quant.
[1374] LC-MS (Method 12): R.sub.t=1.10 min
[1375] MS (EI): m/z=391 (M+H).sup.+
Example 156A
Di-tert-butyl[2-({(2S)-4-{[(benzyloxy)carbonyl]amino}-2-[(tert-butoxycarbo-
nyl)amino]butanoyl}amino)propane-1,3-diyl]biscarbamate
[1376] ##STR228##
[1377] 11.9 mg (0.294 mmol) of HATU and 64.1 mg (0.535 mmol) of
N,N-diisopropylethylamine are added to a solution of 142.7 mg
(0.267 mmol) of
(2S)-4-{[(benzyloxy)carbonyl]amino}-2-[(tert-butoxycarbonylamino-
]butanoic acid-N-cyclohexylcyclohexanamine (1:1) in 10 ml of
anhydrous DMF. After stirring at RT for 15 min, 100 mg (0.294 mmol)
of di-tert-butyl(2-aminopropane-1,3-diyl)biscarbamate hydrochloride
are added. The reaction mixture is stirred at RT for 15 h. The
solvent is then evaporated and the residue is taken up in
dichloromethane. The organic phase is washed with water, dried over
magnesium sulfate and concentrated. The crude product is purified
by preparative HPLC.
[1378] Yield 116 mg (70% of theory)
[1379] LC-MS (Method 19): R.sub.t=2.71 min.
[1380] MS (EI): m/z=624 (M+H).sup.+
Example 157A
Di-tert-butyl[2-({(2S)-4-amino-2-[(tert-butoxycarbonyl)amino]butanoyl}amin-
o)propane-1,3-diyl]biscarbamate
[1381] ##STR229##
[1382] 116 mg (0.186 mmol) of
di-tert-butyl[2-({(2S)-4-{[(benzyloxy)carbonyl]amino}-2-[(tert-butoxycarb-
onyl)amino]butanoyl}amino)propane-1,3-diyl]biscarbamate (Example
156A) are dissolved in 20 ml of ethanol. 30 mg of palladium on
activated carbon (10%) are added thereto, and the mixture is then
hydrogenated under atmospheric pressure for 15 h. The reaction
mixture is filtered through prewashed kieselguhr and the filtrate
is concentrated on a rotary evaporator in vacuo. The crude product
is reacted without further purification.
[1383] Yield: 72 mg (80% of theory)
[1384] LC-MS (Method 17): R.sub.t=1.75 min
[1385] MS (EI): m/z=490 (M+H).sup.+
Example 158A
Benzyl(2-{[N-(tert-butoxycarbonyl)-L-seryl]amino}ethyl)carbamate
[1386] ##STR230##
[1387] 627.4 mg (1.650 mmol) of HATU and 387.7 mg (3.0 mmol) of
N,N-diisopropylethylamine are added to a solution of 307.8 mg (1.50
mmol) of N-(tert-butoxycarbonyl)-L-serine in 25 ml of anhydrous
DMF. After stirring at RT for 15 min, 380.6 mg (1.650 mmol) of
benzyl(2-aminoethyl)carbamate hydrochloride are added. The reaction
mixture is stirred at RT for 15 h. The solvent is then evaporated
and the residue is taken up in dichloromethane. The organic phase
is washed with water, dried over magnesium sulfate and
concentrated. The crude product is purified by preparative
HPLC.
[1388] Yield: 49 mg (7% of theory)
[1389] LC-MS (Method 17): R.sub.t=1.83 min.
[1390] MS (EI): m/z=382 (M+H).sup.+
Example 159A
Benzyl[2-(L-serylamino)ethyl]carbamate hydrochloride
[1391] ##STR231##
[1392] 1.5 ml of a 4M solution of hydrogen chloride in dioxane are
added to a solution of 49 mg (0.128 mmol) of
benzyl(2-{[N-(tert-butoxycarbonyl)-L-seryl]amino}ethyl)carbamate
(Example 158A) in 1 ml of dioxane. The mixture is stirred at RT for
2 h. The reaction solution is concentrated, coevaporated with
dichloromethane several times and dried under high vacuum. The
crude product is reacted without further purification.
[1393] Yield: 33 mg (91% of theory)
[1394] LC-MS (Method 19): R.sub.t=0.89 min.
[1395] MS (EI): m/z=282 (M-HCl+H).sup.+
Example 160A
Benzyl{(1S)-5-{[(benzyloxy)carbonyl]amino}-1-[2-({3-[(tert-butoxycarbonyl)-
amino]-2-hydroxypropyl}amino)-2-oxoethyl]pentyl}carbamate
[1396] ##STR232##
[1397] 418.2 mg (1.1 mmol) of HATU and 258.7 mg (2 mmol) of
N,N-diisopropylethylamine are added to a solution of 428.5 mg (1
mmol) of (3S)-3,7-bis{[(benzyloxy)carbonyl]amino}heptanoic acid in
30 ml of anhydrous DMF. After stirring at RT for 15 min, 209.2 mg
(1.1 mmol) of tert-butyl(3-amino-2-hydroxypropyl)carbamate are
added. The reaction mixture is stirred at RT for 15 h. The solvent
is then evaporated and the residue is taken up in dichloromethane.
The organic phase is washed with water, dried over magnesium
sulfate and concentrated. The crude product is purified by
preparative HPLC.
[1398] Yield 310 mg (47% of theory)
[1399] LC-MS (Method 17): R.sub.t=2.38 min.
[1400] MS (EI): m/z=601 (M+H).sup.+
Example 161A
Benzyl((5S)-7-[(3-amino-2-hydroxypropyl)amino]-5-{[(benzyloxy)carbonyl]ami-
no}-7-oxoheptyl)carbamate hydrochloride
[1401] ##STR233##
[1402] 11 ml of a 4M solution of hydrogen chloride in dioxane are
added to a solution of 160 mg (0.267 mmol) of
benzyl{(1S)-5-{[(benzyloxy)carbonyl]amino}-1-[2-({3-[(tert-butoxycarbonyl-
)amino]-2-hydroxypropyl}amino)-2-oxoethyl]pentyl}carbamate (Example
160A) in 5.5 ml of dioxane at 0.degree. C. The mixture is stirred
at RT for 1 h. The reaction solution is concentrated, coevaporated
with dichloromethane several times and dried under high vacuum. The
crude product is reacted without further purification.
[1403] Yield: quant.
[1404] LC-MS (Method 17): R.sub.t=1.77 min.
[1405] MS (EI): m/z=501 (M-HCl+H).sup.+.
Example 162A
Benzyl[(1S)-2-({2-[(tert-butoxycarbonyl)amino]ethyl}amino)-1-(hydroxymethy-
l)-2-oxoethyl]carbamate
[1406] ##STR234##
[1407] 1.05 g (2.759 mmol) of HATU and 648.3 mg (5.016 mmol) of
N,N-diisopropylethylamine are added to a solution of 600 mg (2.5
mmol) of N-[(benzyloxy)carbonyl]-L-serine in 25 ml of anhydrous
DMF. After stirring at RT for 15 min, 442.0 mg (2.76 mmol) of
tert-butyl(2-aminoethyl)carbamate are added. The reaction mixture
is stirred at RT for 15 h. The solvent is then evaporated and the
residue is taken up in dichloromethane. The organic phase is washed
with water, dried over magnesium sulfate and concentrated. The
crude product is purified by preparative HPLC.
[1408] Yield 295 mg (31% of theory)
[1409] LC-MS (Method 12): R.sub.t=1.63 min.
[1410] MS (EI): m/z=382 (M+H).sup.+
Example 163A
Benzyl[(1S)-2-[(2-aminoethyl)amino]-1-(hydroxymethyl)-2-oxoethyl]carbamate
hydrochloride
[1411] ##STR235##
[1412] A mixture of 58 mg (0.152 mmol) of
benzyl[(1S)-2-({2-[(tert-butoxycarbonyl)amino]ethyl}amino)-1-(hydroxymeth-
yl)-2-oxoethyl]carbamate (Example 162A) in 25 ml of dioxane of a 4M
solution of hydrogen chloride in dioxane is stirred at RT for 2 h.
The reaction solution is concentrated, coevaporated with
dichloromethane several times and dried under high vacuum. The
crude product is reacted without further purification.
[1413] Yield: 42 mg (65% of theory)
[1414] LC-MS (Method 17): R.sub.t=0.59 min.
[1415] MS (EI): m/z=282 (M-HCl+H).sup.+.
Example 164A
N.sup.5-[(Benzyloxy)carbonyl]-N.sup.2-(tert-butoxycarbonyl)-L-ornithyl-N-(-
2-{[(benzyloxy)carbonyl]amino}ethyl)-L-serinamide
[1416] ##STR236##
[1417] 2.76 g (7.27 mmol) of HATU and 1.71 g (13.22 mmol) of
N,N-diisopropylethylamine are added to a solution of 2.42 g (6.61
mmol) of
N.sup.5-[(benzyloxy)carbonyl]-N-(tert-butoxycarbonyl)-L-ornithine
in 10 ml of anhydrous DMF at 0.degree. C. After stirring at RT for
15 min, 2.1 g (6.61 mmol) of benzyl[2-(L-serylamino)ethyl]carbamate
hydrochloride (Example 159A) are added. The reaction mixture is
stirred at RT for 15 h. The solvent is then evaporated and the
residue is taken up in dichloromethane. The organic phase is washed
with water, dried over magnesium sulfate and concentrated. The
crude product is purified by preparative HPLC.
[1418] Yield 122 mg (3% of theory)
[1419] LC-MS (Method 17): R.sub.t=2.25 min.
[1420] MS (EI): m/z=630 (M+H).sup.+
Example 165A
N.sup.5-[(Benzyloxy)carbonyl]-L-ornithyl-N-(2-{[(benzyloxy)carbonyl]amino}-
ethyl)-L-serinamide hydrochloride
[1421] ##STR237##
[1422] 10 ml of a 4M solution of hydrogen chloride in dioxane are
added to a solution of 120 mg (0.191 mmol) of
N.sup.5-[(benzyloxy)carbonyl]-N.sup.2-(tert-butoxycarbonyl)-L-ornithyl-N--
(2-{[(benzyloxy)carbonyl]amino}ethyl)-L-serinamide (Example 164A)
in 5 ml of dioxane at RT. The mixture is stirred at RT for 1 h. The
reaction solution is concentrated, coevaporated with
dichloromethane several times and dried under high vacuum. The
crude product is reacted without further purification.
[1423] Yield: quant.
[1424] LC-MS (Method 19): R.sub.t=1.63 min.
[1425] MS (EI): m/z=530 (M-HCl+H).sup.+.
Example 166A
tert-Butyl(3-{[(2S)-5-[(tert-butoxycarbonyl)amino]-2-({[(8S,11S,14S)-14-[(-
tert-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-5,17--
dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2-
(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)pentanoyl]amino}-2-hydroxypropyl-
)carbamate
[1426] ##STR238##
[1427] Under argon, 50 mg (0.076 mmol) of the compound from Example
29A and 40 mg (0.10 mmol) of
N.sup.5-(tert-butoxycarbonyl)-N-{3-[(tert-butoxycarbonyl)amino]-2-hydroxy-
propyl}-L-ornithinamide (Example 82A) are dissolved in 1.7 ml of
dimethylformamide. Then, at 0.degree. C. (ice bath), 19 mg (0.10
mmol) of EDC and 3.1 mg (0.023 mmol) of HOBt are added. The mixture
is slowly warmed to RT and stirred at RT for 12 h. The solution is
concentrated in vacuo, and the residue is stirred with water. The
remaining solid is collected by suction filtration and purified by
chromatography on silica gel (mobile phase
dichloromethane/isopropanol 30:1 to 10:1).
[1428] Yield: 47 mg (48% of theory)
[1429] LC-MS (Method 17): R.sub.t=2.40 min.
[1430] MS (EI): m/z=1043 (M+H).sup.+
Example 167A
tert-Butyl(2-{[(2S)-5-[(tert-butoxycarbonyl)amino]-2-({[(8S,11S,14S)-14-[(-
tert-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-5,17--
dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2-
(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)pentanoyl]amino}ethyl)carbamate
[1431] ##STR239##
[1432] Under argon, 50 mg (0.076 mmol) of the compound from Example
29A and 37 mg (0.10 mmol) of
N.sup.5-(tert-butoxycarbonyl)-N-{2-[(tert-butoxycarbonyl)amino]ethyl}-L-o-
rnithinamide (Example 81A) are dissolved in 1.7 ml of
dimethylformamide. Then, at 0.degree. C. (ice bath), 19 mg (0.10
mmol) of EDC and 3.1 mg (0.023 mmol) of HOBT are added. The mixture
is slowly warmed to RT and stirred at RT for 12 h. The solution is
concentrated in vacuo, and the residue is stirred with water. The
remaining solid is collected by suction filtration and purified by
chromatography on silica gel (mobile phase
dichloromethane/isopropanol 30:1 to 10:1).
[1433] Yield: 43 mg (55% of theory)
[1434] LC-MS (Method 12): R.sub.t=2.29 min.
[1435] MS (EI): m/z=1013 (M+H).sup.+
Example 168A
tert-Butyl((3S)-3-{[(2S)-2-[(tert-butoxycarbonyl)amino]-5-({[(8S,11S,14S)--
14-[(tert-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}--
5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(-
20),2(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)pentanoyl]amino}-4-hydroxyb-
utyl)carbamate
[1436] ##STR240##
[1437] Under argon, 50 mg (0.076 mmol) of the compound from Example
29A and 42 mg (0.10 mmol) of
N.sup.2-(tert-butoxycarbonyl)-N-[(1S)-3-[(tert-butoxycarbonyl)amino]-1-(h-
ydroxymethyl)propyl]-L-ornithinamide (Example 94A) are dissolved in
1.7 ml of dimethylformamide. Then, at 0.degree. C. (ice bath), 19
mg (0.10 mmol) of EDC and 3.1 mg (0.023 mmol) of HOBT are added.
The mixture is slowly warmed to RT and stirred at RT for 12 h. The
solution is concentrated in vacuo, and the residue is stirred with
water. The remaining solid is collected by suction filtration and
purified by chromatography on silica gel (mobile phase
dichloromethane/isopropanol 30:1 to 10:1).
[1438] Yield: 25 mg (31% of theory)
[1439] LC-MS (Method 12): R.sub.t=2.18 min.
[1440] MS (EI): m/z=1057 (M+H).sup.+
Example 169A
(8S,11S,14S)-14-Amino-11-(3-aminopropyl)-9-ethyl-5,17-dihydroxy-10,13-diox-
o-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexae-
ne-8-carboxylic acid dihydrochloride
[1441] ##STR241##
[1442] 930 mg (0.91 mmol) of the compound from Example 78A are
suspended in 260 ml of glacial acetic acid/water/ethanol (4/1/1),
mixed with 270 mg of palladium on activated carbon (10%) and
hydrogenated under atmospheric pressure at room temperature for 24
h. Removal of the catalyst by filtration through kieselguhr is
followed by evaporation of the filtrate to dryness in vacuo and
addition of 36.5 ml of 0.1N hydrochloric acid with stirring. The
mixture is evaporated to dryness in vacuo and dried to constant
weight.
[1443] Yield: 500 mg (98% of theory)
[1444] LC-MS (Method 20): R.sub.t=2.45 min.
[1445] MS (ESI): m/z=485 (M-2HCl+H).sup.+
Example 170A
(8S,11S,14S)-14-[(tert-Butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)a-
mino]propyl}-9-ethyl-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.-
1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxylic
acid
[1446] ##STR242##
[1447] 710 mg (1.27 mmol) of the compound from Example 169A are
dissolved in 15 ml of water and 6.5 ml (6.5 mmol) of a 1N sodium
hydroxide solution and, while stirring at room temperature, 834 mg
(3.82 mmol) of di-tert-butyl dicarbonate dissolved in 5.5 ml of
methanol are added. The reaction is complete after one hour (check
by analytical RP-HPLC, mobile phase: acetonitrile/water). The pH is
adjusted to 3 by dropwise addition of 0.1N hydrochloric acid.
Extraction three times with 20 ml of ethyl acetate each time is
followed by drying with sodium sulfate and evaporation to constant
weight in vacuo.
[1448] Yield: 770 mg (88% of theory)
[1449] LC-MS (Method 19): R.sub.t=2.16 min.
[1450] MS (ESI): m/z=685 (M+H).sup.+
Example 171A
Benzyl(2-{[(2S,4R)-5-{[(benzyloxy)carbonyl]amino}-2-({[(8S,11S,14S)-14-[(t-
ert-butoxycarbonyl)amino]-11-{(2R)-3-[(tert-butoxycarbonyl)amino]-2-hydrox-
ypropyl}-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]he-
nicosa-1(20),2(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)-4-hydroxypentanoy-
l]amino}ethyl)carbamate
[1451] ##STR243##
[1452] 44 mg (0.07 mmol) of
(8S,11S,14S)-14-[(tert-butoxycarbonyl)amino]-11-{(2R)-3-[(tert-butoxycarb-
onyl)amino]-2-hydroxypropyl}-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo-
[14.3.1.126]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxylic
acid (Example 65A) are dissolved in 3 ml of DMF, and 38.9 mg (0.08
mmol) of the compound from Example 96A are added. The mixture is
cooled to 0.degree. C. and 29.8 mg (0.08 mmol) of HATU and 13 mg
(0.1 mmol) of diisopropylethylamine are successively added. After
30 min at 0.degree. C., the mixture is allowed to warm to room
temperature and, after the addition of a further 26 mg (0.2 mmol)
of diisopropylethylamine, stirred overnight. Concentration in vacuo
is followed by purification by chromatography on silica gel
(dichloromethane/methanol 9:1) and then by preparative HPLC.
[1453] Yield: 14 mg (20% of theory).
[1454] LC-MS (Method 19): R.sub.t=2.42 min.
[1455] MS (EI): m/z=1114 (M+H).sup.+.
Example 172A
tert-Butyl{(2R)-3-[(8S,11S,14S)-8-{[((1S,3R)-4-amino-1-{[(2-aminoethyl)ami-
no]carbonyl}-3-hydroxybutyl)amino]carbonyl}-14-[(tert-butoxycarbonyl)amino-
]-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa--
1(20),2(21),3,5,16,18-hexaen-11-yl]-2-hydroxypropyl}carbamate
dihydrochloride
[1456] ##STR244##
[1457] 23 mg (0.02 mmol) of the compound from Example 171A are
dissolved in 20 ml of a glacial acetic acid/methanol/water mixture
(4/1/1), and 12 mg of palladium on activated carbon (10%) are
added. The mixture is hydrogenated under atmospheric pressure for 4
h and then the catalyst is removed by filtration. The mother liquor
obtained in this way is evaporated to dryness in vacuo, stirred
with 2 ml of 0.1N hydrochloric acid and again evaporated to
dryness. The crude product obtained in this way is reacted without
further purification.
[1458] Yield: 16 mg (83% of theory).
[1459] LC-MS (Method 12): R.sub.t=1.23 min.
[1460] MS (EI): m/z=845 (M-2HCl+H).sup.+.
Example 173A
tert-Butyl(3-{[(2S)-4-[(tert-butoxycarbonyl)amino]-2-({[(8S,11S,14S)-14-[(-
tert-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-5,17--
dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2-
(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)butanoyl]amino}-2-hydroxypropyl)-
carbamate
[1461] ##STR245##
[1462] 36 mg (0.06 mmol) of
(8S,11S,14S)-14-[(tert-butoxycarbonyl)amino-11-[3-[(tert-butoxycarbonyl)a-
mino]propyl}-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,-
6]-henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxylic acid
(Example 29A) and 26 mg (0.07 mmol) of
tert-butyl[3-({(2S)-2-amino-4-[(tert-butoxycarbonyl)amino]butanoyl}amino)-
-2-hydroxypropyl]carbamate (Example 99A) are dissolved in 1 ml of
DMF and cooled to 0.degree. C., and 18 mg (0.09 mmol) of EDC and 2
mg (0.02 mmol) of HOBt are successively added. The mixture is
allowed to warm to room temperature and is stirred overnight. The
residue is stirred in water, and the precipitate resulting
therefrom is collected by filtration, dried and purified by
chromatography on silica gel (dichloromethane/methanol 100:7).
[1463] Yield: 9 mg (14% of theory).
[1464] LC-MS (Method 12): R.sub.t=2.22 min.
[1465] MS (EI): m/z=1029 (M+H).sup.+.
Example 174A
Benzyl(2-{[(2S,4R)-5-{[(benzyloxy)carbonyl]amino}-2-({[(8S,11S,14S)-14-[(t-
ert-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)aminopropyl]}-5,17-d-
ihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(-
21),3,5,16,18-hexaen-8-yl]carbonyl}amino)-4-hydroxypentanoyl]amino}ethyl)c-
arbamate
[1466] ##STR246##
[1467] 30 mg (0.05 mmol) of
(8S,11S,14S)-14-[(tert-butoxycarbonyl)aminopropyl]-11-{3-[(tert-butoxycar-
bonyl)amino]}-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2-
,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxylic acid
(Example 29A) are dissolved in 1 ml of DMF, and 27 mg (0.05 mmol)
of the compound from Example 96A are added. The mixture is cooled
to 0.degree. C., and 21 mg (0.05 mmol) of HATU and 10 mg (0.07
mmol) of diisopropylethylamine are successively added. After 30 min
at 0.degree. C., the mixture is allowed to warm to room temperature
and, after the addition of a further 0.20 mg (0.14 mmol) of
diisopropylethylamine, stirred overnight. Concentration in vacuo is
followed by purification by chromatography on silica gel
(dichloromethane/methanol/concentrated ammonia solution 90:10:1).
After concentration of the fractions, the residue is stirred in
acetonitrile and the precipitate is collected by filtration and
dried in vacuo.
[1468] Yield: 16 mg (30% of theory).
[1469] LC-MS (Method 17): R.sub.t=2.52 min.
[1470] MS (EI): m/z=1197 (M+H).sup.+.
Example 175A
tert-Butyl{3-[(8S,11S,14S)-8-{[((1S,3R)-4-amino-1-{[(2-aminoethyl)amino]ca-
rbonyl}-3-hydroxybutyl)amino]carbonyl}-14-[(tert-butoxycarbonyl)amino]-5,1-
7-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20)-
,2(21),3,5,16,18-hexaen-1-yl]propyl}carbamate
[1471] ##STR247##
[1472] 16 mg (0.01 mmol) of the compound from Example 174A are
dissolved in 10 ml of methanol, and 8 mg of palladium on activated
carbon (10%) are added. The mixture is hydrogenated under
atmospheric pressure for 4 h, and then the catalyst is removed by
filtration. The mother liquor obtained in this way is evaporated to
dryness in vacuo. The crude product obtained in this way is reacted
without further purification.
[1473] Yield: 10 mg (74% of theory).
[1474] LC-MS (Method 12): R.sub.t=1.18 min.
[1475] MS (EI): m/z=829 (M+H).sup.+.
Example 176A
Benzyl(2-{[(3S)-3-{[(benzyloxy)carbonyl]amino}-6-({[(8S,11S,14S)-14-[(tert-
-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-9-ethyl-5-
,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(2-
0),2(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)hexanoyl]-amino}ethyl)carbam-
ate
[1476] ##STR248##
[1477] Under argon, 30 mg (0.044 mmol) of
(8S,11S,14S)-14-[(tert-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)-
amino]propyl}-9-ethyl-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo-[14.3.-
1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxylic
acid (Example 170A) and 80 mg (0.162 mmol) of
benzyl-((1S)-4-amino-1-{2-[(2-{[(benzyloxy)carbonyl]amino}ethyl)amino]-2--
oxoethyl}butyl)carbamate hydrochloride (Example 105A) are dissolved
in 2 ml of dimethylformamide. Then, at 0.degree. C. (ice bath),
31.16 mg (0.162 mmol) of EDC and 1.95 mg (0.014 mmol) of HOBt are
added. The mixture is slowly warmed to RT and stirred at 50.degree.
C. for 3 days. The solution is concentrated in vacuo and the
residue is purified by preparative HPLC.
[1478] Yield: 14.5 mg (30% of theory)
[1479] LC-MS (Method 17): R.sub.t=2.55 min.
[1480] MS (EI): m/z=1123 (M+H).sup.+.
Example 177A
tert-Butyl[(4S)-5-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl}amino)--
4-({[(8S,11S,14S)-14-[(tert-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbo-
nyl)amino]propyl}-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.s-
up.2,6]henicosa-1(20),2(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)-5-oxopen-
tyl]carbamate
[1481] ##STR249##
[1482] Under argon, 50 mg (0.076 mmol) of the compound from Example
29A and 53 mg (0.10 mmol) of
tert-butyl[(4S)-4-amino-5-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]penty-
l}amino)-5-oxopentyl]carbamate (Example 120A) are dissolved in 1.7
ml of dimethylformamide. Then, at 0.degree. C. (ice bath), 19 mg
(0.10 mmol) of EDC and 3.1 mg (0.023 mmol) of HOBt are added. The
mixture is slowly warmed to RT and stirred at RT for 12 h. The
solution is concentrated in vacuo and the residue is stirred with
water. The remaining solid is collected by suction filtration and
purified by preparative HPLC (Kromasil, mobile phase:
acetonitrile/0.2% aqueous trifluoroacetic acid
5:95.fwdarw.95:5).
[1483] Yield: 40 mg (45% of theory)
[1484] LC-MS (Method 12): R.sub.t=2.46 min.
[1485] MS (EI): m/z=1170 (M+H).sup.+
Example 178A
tert-Butyl[(1S)-4-[(tert-butoxycarbonyl)amino]-1-({[({[(8S,11S,14S)-14-[(t-
ert-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-5,17-d-
ihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(-
21),3,5,16,18-hexaen-8-yl]carbonyl}amino)acetyl]amino}methyl)butyl]carbama-
te
[1486] ##STR250##
[1487] Under argon, 43 mg (0.066 mmol) of the compound from Example
29A and 32 mg (0.085 mmol) of
tert-butyl{(4S)-5-[(aminoacetyl)amino]-4-[(tert-butoxycarbonyl)amino]pent-
yl}carbamate (Example 126A) are dissolved in 1.7 ml of
dimethylformamide. Then, at 0.degree. C. (ice bath), 16 mg (0.085
mmol) of EDC and 2.7 mg (0.02 mmol) of HOBt are added. The mixture
is slowly warmed to RT and stirred at RT for 12 h. The solution is
concentrated in vacuo and the residue is stirred with water. The
remaining solid is collected by suction filtration and purified by
preparative HPLC (Kromasil, mobile phase: acetonitrile/0.2% aqueous
trifluoroacetic acid 5:95.fwdarw.95:5).
[1488] Yield: 11.5 mg (17% of theory)
[1489] LC-MS (Method 19): R.sub.t=2.47 min.
[1490] MS (EI): m/z=1013 (M+H).sup.+
Example 179A
tert-Butyl[(1S)-4-[(tert-butoxycarbonyl)amino]-1-({[(2S)-2-({[(8S,11S,14S)-
-14-[(tert-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-
-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1-
(20),2(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)-3-hydroxypropanoyl]amino}-
methyl)butyl]carbamate
[1491] ##STR251##
[1492] Under argon, 28 mg (0.042 mmol) of the compound from Example
29A and 22 mg (0.055 mmol) of
tert-butyl{(4S)-5-{[(2S)-2-amino-3-hydroxypropanoyl]amino}-4-[(tert-butox-
ycarbonyl)amino]pentyl}carbamate (Example 128A) are dissolved in
1.7 ml of dimethylformamide. Then, at 0.degree. C. (ice bath), 11
mg (0.055 mmol) of EDC and 1.7 mg (0.013 mmol) of HOBt are added.
The mixture is slowly warmed to RT and stirred at RT for 12 h. The
solution is concentrated in vacuo and the residue is stirred with
water. The remaining solid is collected by suction filtration and
purified by chromatography (Sephadex LH20, mobile phase:
methanol/acetic acid (0.25%)).
[1493] Yield: 18.4 mg (42% of theory)
[1494] LC-MS (Method 17): R.sub.t=2.43 min.
[1495] MS (EI): m/z=1043 (M+H).sup.+
Example 180A
tert-Butyl{(1S)-1-({[(2S)-5-amino-2-({[(8S,11S,14S)-14-[(tert-butoxycarbon-
yl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-5,17-dihydroxy-10,13-d-
ioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]-henicosa-1(20),2(21),3,5,16,18-h-
exaen-8-yl]carbonyl}amino)-5-oxopentanoyl]amino}methyl)-4-[(tert-butoxycar-
bonyl)amino]butyl}carbamate
[1496] ##STR252##
[1497] Under argon, 27 mg (0.042 mmol) of the compound from Example
29A and 21 mg (0.047 mmol) of
tert-butyl[(1S)-4-[(tert-butoxycarbonyl)amino]-1-({[(2S)-2,5-diamino-5-ox-
opentanoyl]amino}methyl)butyl]carbamate (Example 130A) are
dissolved in 2 ml of dimethylformamide. Then, at 0.degree. C. (ice
bath), 10 mg (0.053 mmol) of EDC and 1.7 mg (0.013 mmol) of HOBt
are added. The mixture is slowly warmed to RT and stirred at RT for
12 h. The solution is concentrated in vacuo and the residue is
stirred with water. The remaining solid is collected by suction
filtration and purified by chromatography (Sephadex LH20, mobile
phase: methanol/acetic acid (0.25%)).
[1498] Yield: 16 mg (36% of theory)
[1499] LC-MS (Method 19): R.sub.t=2.38 min.
[1500] MS (EI): m/z=1084 (M+H).sup.+
Example 181
N.sup.5-[(Benzyloxy)carbonyl]-N.sup.2-{[(8S,11S,14S)-14-[(tert-butoxycarbo-
nyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-5,17-dihydroxy-10,13--
dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-h-
exaen-8-yl]carbonyl}-L-ornithyl-N.sup.5-[(benzyloxy)carbonyl]-N-(2-{[(benz-
yloxy)carbonyl]amino}ethyl)-L-ornithinamide
[1501] ##STR253##
[1502] Under argon, 40 mg (0.061 mmol) of the compound from Example
29A and 66 mg (0.091 mmol) of
N.sup.5-[(benzyloxy)carbonyl]-L-ornithyl-N.sup.5-[(benzyloxy)carbonyl]-N--
(2-{[(benzyloxy)carbonyl]amino}ethyl)-L-ornithinamide (Example
124A) are dissolved in 2 ml of dimethylformamide. Then, at
0.degree. C. (ice bath), 15 mg (0.079 mmol) of EDC and 2.5 mg
(0.018 mmol) of HOBt are added. The mixture is slowly warmed to RT
and stirred at RT for 12 h. The solution is concentrated in vacuo
and the residue is stirred with water. The remaining solid is
collected by suction filtration and purified by preparative HPLC
(mobile phase: acetonitrile/water gradient).
[1503] Yield: 25 mg (26% of theory)
[1504] LC-MS (Method 17): R.sub.t=2.73 min.
[1505] MS (EI): m/z=1330 (M+H).sup.+
Example 182A
tert-Butyl(2-{[2-({[(8S,11S,14S)-14-[(tert-butoxycarbonyl)amino]-11-{3-[(t-
ert-butoxycarbonyl)amino]propyl}-5,17-dihydroxy-10,13-dioxo-9,12-diazatric-
yclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaen-8-yl]carbonyl}-
amino)ethyl]amino}-2-oxoethyl)carbamate
[1506] ##STR254##
[1507] Under argon, 34 mg (0.052 mmol) of the compound from Example
29A and 17 mg (0.078 mmol) of
tert-butyl{2-[(2-aminoethyl)amino]-2-oxoethyl}carbamate (Russ. J.
Bioorg. Chem. (1994) 20:397-405) are dissolved in 2 ml of
dimethylformamide. Then, at 0.degree. C. (ice bath), 13 mg (0.068
mmol) of EDC and 2.1 mg (0.016 mmol) of HOBt are added. The mixture
is slowly warmed to RT and stirred at RT for 12 h. The solution is
concentrated in vacuo and the residue is stirred with water. The
remaining solid is collected by suction filtration and purified by
chromatography (Sephadex LH20, mobile phase: methanol/acetic acid
(0.25%)).
[1508] Yield: 23 mg (50% of theory)
[1509] LC-MS (Method 19): R.sub.t=2.16 min.
[1510] MS (EI): m/z=856 (M+H).sup.+
[1511] Examples 183A to 203A listed in the following table are
prepared from the appropriate starting materials in analogy to the
method of Example 166A: TABLE-US-00009 Starting Ex. material
Analytical No. example Structure data 183A 29A and methyl glycinate
##STR255## LC-MS (Method 12): R.sub.t = 1.90 min. MS (EI): m/z =
728 (M + H).sup.+ 184A 29A and 143A ##STR256## LC-MS (Method 19):
R.sub.t = 2.42 min. MS (EI): m/z = 1013 (M + H).sup.+ 185A 29A and
144A ##STR257## LC-MS (Method 17): R.sub.t = 2.42 min. MS (EI): m/z
= 1086 (M + H).sup.+ 186A 29A and 145A ##STR258## LC-MS (Method
17): R.sub.t = 2.41 min. MS (EI): m/z = 1043 (M + H).sup.+ 187A 29A
and 146A ##STR259## LC-MS (Method 12): R.sub.t = 1.94 min. MS (EI):
m/z = 913 (M + H).sup.+ 188A 29A and 101A ##STR260## LC-MS (Method
12): R.sub.t = 1.91 min. MS (EI): m/z = 916 (M + H).sup.+ 189A 29A
and 107A ##STR261## LC-MS (Method 17): R.sub.t = 2.65 min. MS (EI):
m/z = 1344 (M + H).sup.+ 190A 29A and 105A ##STR262## LC-MS (Method
12): R.sub.t = 2.35 min. MS (EI): m/z = 1095 (M + H).sup.+ 191A 29A
and 111A ##STR263## LC-MS (Method 19): R.sub.t = 2.53 min. MS (EI):
m/z = 1067 (M + H).sup.+ 192A 29A and 113A ##STR264## LC-MS (Method
19): R.sub.t = 2.70 min. MS (EI): m/z = 1315 (M + H).sup.+ 193A 29A
and 115A ##STR265## LC-MS (Method 19): R.sub.t = 2.42 min. MS (EI):
m/z = 1027 (M + H).sup.+ 194A 29A and 103A ##STR266## LC-MS (Method
19): R.sub.t = 2.17 min. MS (EI): m/z = 1123 (M + H).sup.+ 195A 29A
and 155A ##STR267## LC-MS (Method 12): R.sub.t = 2.15 min. MS (EI):
m/z = 1029 (M + H).sup.+ 196A 29A and 157A ##STR268## LC-MS (Method
19): R.sub.t = 2.63 min. MS (EI): m/z = 1128 (M + H).sup.+ 197A 29A
and 149A ##STR269## LC-MS (Method 19): R.sub.t = 2.07 min. MS (EI):
m/z = 943 (M + H).sup.+ 198A 29A and 148A ##STR270## LC-MS (Method
12): R.sub.t = 2.17 min. MS (EI): m/z = 1084 (M + H).sup.+ 199A 29A
and 147A ##STR271## LC-MS (Method 19): R.sub.t = 2.54 min. MS (EI):
m/z = 1119 (M + H).sup.+ 200A 29A and 150A ##STR272## LC-MS (Method
17): R.sub.t = 2.11 min. MS (EI): m/z = 943 (M + H).sup.+ 201A 29A
and 151A ##STR273## LC-MS (Method 17): R.sub.t = 2.39 min. MS (EI):
m/z = 1070 (M + H).sup.+ 202A 29A and 152A ##STR274## LC-MS (Method
17): R.sub.t = 2.44 min. MS (EI): m/z = 1056 (M + H).sup.+ 203A 29A
and 153A ##STR275## LC-MS (Method 17): R.sub.t = 2.40 min. MS (EI):
m/z = 1056 (M + H).sup.+
Example 204A
tert-Butyl{3-[(8S,11S,14S)-8-[({(4S)-4-amino-6-[(2-aminoethyl)amino]-6-oxo-
hexyl}amino)carbonyl]-14-[(tert-butoxycarbonyl)amino]-9-ethyl-5,17-dihydro-
xy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,-
5,16,18-hexaen-11-yl]propyl}carbamate
[1512] ##STR276##
[1513] 14.5 mg (0.013 mmol) of
benzyl(2-{[(3S)-3-{[(benzyloxy)carbonyl]amino}-6-({[(8S,11S,14S)-14-[(ter-
t-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-9-ethyl--
5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(-
20),2(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)hexanoyl]amino}ethyl)carbam-
ate (Example 176A) are dissolved in 3 ml of ethanol. 15 mg of
palladium on activated carbon (10%) are added thereto, and the
mixture is then hydrogenated under atmospheric pressure for 15 h.
The reaction mixture is filtered through prewashed kieselguhr, and
the filtrate is concentrated on a rotary evaporator in vacuo. The
crude product is reacted without further purification.
[1514] Yield: 8 mg (73% of theory).
[1515] LC-MS (Method 19): R.sub.t=1.59 min.
[1516] MS (EI): m/z=855 (M+H).sup.+.
Example 205A
tert-Butyl{3-[(8S,11S,14S)-8-[({(1S)-4-amino-1-[({(4S)-4-amino-6-[(2-amino-
ethyl)amino]-6-oxohexyl}amino)carbonyl]butyl}amino)carbonyl]-14-[(tert-but-
oxycarbonyl)amino]-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.-
sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaen-11-yl]propyl}carbamate
tris(hydroacetate)
[1517] ##STR277##
[1518] 9 mg (0.007 mmol) of
benzyl((1S)-4-{[(2S)-5-{[(benzyloxy)carbonyl]amino}-2-({[(8S,11S,14S)-14--
[(tert-butoxycarbonyl)amino]-1-{3-[(tert-butoxycarbonyl)amino]propyl}-5,17-
-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),-
2(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)pentanoyl]amino}-1-{2-[(2-{[(be-
nzyloxy)carbonyl]amino}ethyl)amino]-2-oxoethyl}butyl)carbamate
(Example 189A) are added into 8 ml of a 4:1:1 acetic
acid/water/ethanol mixture. 1 mg of palladium on activated carbon
(10%) is added thereto, and the mixture is then hydrogenated at RT
under atmospheric pressure for 15 h. The reaction mixture is
filtered through prewashed kieselguhr and washed with ethanol, and
the filtrate is concentrated on a rotary evaporator in vacuo.
[1519] Yield: quant.
[1520] LC-MS (Method 17): R.sub.t=1.33 min.
[1521] MS (EI): m/z=941 (M-3HOAc+H).sup.+
Example 206A
tert-Butyl{3-[(8S,11S,14S)-8-[({(4S)-4-amino-6-[(2-aminoethyl)amino]-6-oxo-
hexyl}amino)carbonyl]-14-[(tert-butoxycarbonyl)amino]-5,17-dihydroxy-10,13-
-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18--
hexaen-11-yl]propyl}carbamate bis(hydroacetate)
[1522] ##STR278##
[1523] 12 mg (0.011 mmol) of
benzyl(2-{[(3S)-3-{[(benzyloxy)carbonyl]amino}-6-({[(8S,11S,14S)-14-[(ter-
t-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-5,17-dih-
ydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21-
),3,5,16,18-hexaen-8-yl]carbonyl}amino)hexanoyl]amino}ethyl)carbamate
(Example 190A) are added into 3 ml of a 4:1:1 acetic
acid/water/ethanol mixture. 1.5 mg of palladium on activated carbon
(10%) are added thereto, and the mixture is then hydrogenated at RT
under atmospheric pressure for 15 h. The reaction mixture is
filtered through prewashed kieselguhr and washed with ethanol, and
the filtrate is concentrated on a rotary evaporator in vacuo.
[1524] Yield: quant.
[1525] LC-MS (Method 17): R.sub.t=1.48 min.
[1526] MS (EI): m/z=827 (M-2HOAc+H).sup.+
Example 207A
tert-Butyl{3-[(8S,11S,14S)-8-{[((1S)-3-amino-1-{[(2-aminoethyl)amino]carbo-
nyl}propyl)amino]carbonyl}-14-[(tert-butoxycarbonyl)amino]-5,17-dihydroxy--
10,13-dioxo-9,12-diazatricyclo-[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,-
16,18-hexaen-11-yl]propyl}carbamate bis(hydroacetate)
[1527] ##STR279##
[1528] 29 mg (0.027 mmol) of
benzyl(2-{[(2S)-4-{[(benzyloxy)carbonyl]amino}-2-({[(8S,11S,14S)-14-[(ter-
t-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-5,17-dih-
ydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21-
),3,5,16,18-hexaen-8-yl]carbonyl}amino)butanoyl]amino}ethyl)carbamate
(Example 191A) are added into 8 ml of a 4:1:1 acetic
acid/water/ethanol mixture. 2.5 mg of palladium on activated carbon
(10%) are added thereto, and the mixture is then hydrogenated at RT
under atmospheric pressure for 15 h. The reaction mixture is
filtered through prewashed kieselguhr and washed with ethanol, and
the filtrate is concentrated on a rotary evaporator in vacuo.
[1529] Yield: 16 mg (74% of theory)
[1530] LC-MS (Method 19): R.sub.t=1.48 min.
[1531] MS (EI): m/z=799 (M-2HOAc+H).sup.+
Example 208A
tert-Butyl{3-[(8S,11S,14S)-8-{[((1S)-4-amino-1-{[((1S)-3-amino-1-{[(2-amin-
oethyl)amino]carbonyl}propyl)amino]carbonyl}butyl)amino]carbonyl}-14-[(ter-
t-butoxycarbonyl)amino]-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3-
.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaen-11-yl]propyl}carbamate
tris(hydroacetate)
[1532] ##STR280##
[1533] 12 mg (0.009 mmol) of
benzyl{(3S)-3-{[(2S)-5-{[(benzyloxy)carbonyl]amino}-2-({[(8S,11S,14S)-14--
[(tert-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-5,1-
7-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2]henicosa-1(20),2-
(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)pentanoyl]amino}-4-[(2-{[(benzyl-
oxy)carbonyl]amino}ethyl)amino]-4-oxobutyl}carbamate (Example 192A)
are added into 8 ml of a 4:1:1 acetic acid/water/ethanol mixture. 1
mg of palladium on activated carbon (10%) is added thereto, and the
mixture is then hydrogenated at RT under atmospheric pressure for
15 h. The reaction mixture is filtered through prewashed kieselguhr
and washed with ethanol, and the filtrate is concentrated on a
rotary evaporator in vacuo.
[1534] Yield: 7 mg (84% of theory)
[1535] LC-MS (Method 17): R.sub.t=1.31 min.
[1536] MS (EI): m/z=913 (M-3HOAc+H).sup.+
Example 209A
tert-Butyl{3-[(8S,11S,14S)-8-{[((1S)-1-{[(2-aminoethyl)amino]carbonyl}-4-{-
[amino(imino)methyl]amino}butyl)amino]carbonyl}-14-[(tert-butoxycarbonyl)a-
mino]-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henic-
osa-1(20),2(21),3,5,16,18-hexaen-11-yl]propyl}carbamate
di(hydrotrifluoroacetate)
[1537] ##STR281##
[1538] 13.4 mg (0.012 mmol) of
benzyl[(6S)-6-({[(8S,11S,14S)-14-[(tert-butoxycarbonyl)amino]-1-{3-[(tert-
-butoxycarbonyl)amino]propyl}-5,17-dihydroxy-10,13-dioxo-9,12-diazatricycl-
o[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaen-8-yl]carbonyl}ami-
no)-7,12-dioxo-14-phenyl-13-oxa-2,8,11-triazatetradecane-1-imidoyl]carbama-
te (Example 194A) are added into 5 ml of a 4:1:1 acetic
acid/water/ethanol mixture. 1 mg of palladium on activated carbon
(10%) is added thereto, and the mixture is then hydrogenated at RT
under atmospheric pressure for 15 h. The reaction mixture is
filtered through prewashed kieselguhr and washed with ethanol, and
the filtrate is concentrated on a rotary evaporator in vacuo. The
target product is purified and converted into the
di(hydrotrifluoroacetate) by preparative HPLC (Kromasil, mobile
phase acetonitrile/0.2% aqueous trifluoroacetic acid
5:95.fwdarw.95:5).
[1539] Yield: 5.3 mg (41% of theory)
[1540] LC-MS (Method 12): R.sub.t=1.19 min.
[1541] MS (EI): m/z=855 (M-2TFA+H).sup.+
Example 210A
N.sup.2-{[(8S,11S,14S)-14-[(tert-Butoxycarbonyl)amino]-11-{3-[(tert-butoxy-
carbonyl)amino]propyl}-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.-
1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaen-8-yl]carbonyl}-L-ornithy-
l-N-(2-aminoethyl)-L-ornithinamide tris(hydroacetate)
[1542] ##STR282##
[1543] 25 mg (0.02 mmol) of the compound from Example 181A are
added into 8 ml of a 4:1:1 acetic acid/water/ethanol mixture. 3 mg
of palladium on activated carbon (10%) are added thereto, and the
mixture is then hydrogenated at RT under atmospheric pressure for
48 h. The reaction mixture is filtered through prewashed kieselguhr
and washed with ethanol, and the filtrate is evaporated to dryness
in vacuo.
[1544] Yield: 8.5 mg (41% of theory)
[1545] LC-MS (Method 20): R.sub.t=2.63 min.
[1546] MS (EI): m/z=927 (M-3HOAc+H).sup.+
[1547] Examples 211A to 215A listed in the following table are
prepared from the appropriate starting materials in analogy to the
method of Example 166A. TABLE-US-00010 Starting Ex. material
Analytical No. example Structure data 211A 29A and 159A ##STR283##
LC-MS (Method 17): R.sub.t = 2.21 min. MS (EI): m/z = 920 (M +
H).sup.+ 212A 29A and 109A ##STR284## LC-MS (Method 17): R.sub.t =
2.17 min. MS (EI): m/z = 978 (M + H).sup.+ 213A 29A and 165A
##STR285## LC-MS (Method 19): R.sub.t = 2.42 min. MS (EI): m/z =
1168 (M + H).sup.+ 214A 29A and 161A ##STR286## LC-MS (Method 19):
R.sub.t = 2.48 min. MS (EI): m/z = 1139 (M + H).sup.+ 215A 29A and
163A ##STR287## LC-MS (Method 12): R.sub.t = 1.98 min. MS (EI): m/z
= 920 (M + H).sup.+
[1548] Examples 216A to 220A listed in the following table are
prepared from the appropriate starting materials in analogy to the
method of Example 205A. TABLE-US-00011 Starting Example material
Analytical No. example Structure data 216A 211A ##STR288## LC-MS
(Method 19): R.sub.t =1.69 min. MS (EI): m/z = 786 (M - HOAc +
H).sup.+ 217A 212A ##STR289## LC-MS (Method 17): R.sub.t =1.62 min.
MS (EI): m/z = 844 (M - HOAc + H).sup.+ 218A 213A ##STR290## LC-MS
(Method 19): R.sub.t =1.48 min. MS (EI): m/z = 899 (M - 2HOAc +
H).sup.+ 219A 214A ##STR291## LC-MS (Method 19): R.sub.t =1.30 min.
MS (EI): m/z = 869 (M - 2HOAc - H).sup.- 220A 215A ##STR292## LC-MS
(Method 17): R.sub.t =1.69 min. MS (EI): m/z = 786 (M - HOAc +
H).sup.+
Example 221A
tert-Butyl{3-[(8S,11S,14S)-8-[({2-[(2-aminoethyl)amino]-2-oxoethyl}amino)c-
arbonyl]-14-[(tert-butoxycarbonyl)amino]-5,17-dihydroxy-10,13-dioxo-9,12-d-
iazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaen-11-yl]-
propyl}carbamate hydrotrifluoroacetate
[1549] ##STR293##
[1550] 45 mg (0.057 mmol) of the compound from Example 183A are
dissolved in 1 ml of ethane-1,2-diamine and, after the addition of
0.75 mg of potassium cyanide, stirred at RT for 12 h. The mixture
is then diluted with 15 ml of water and extracted once with ethyl
acetate. The organic phase is washed with water, and the combined
aqueous phases are evaporated to dryness in vacuo. The residue is
purified by RP-HPLC (Kromasil 100C18, mobile phase:
acetonitrile/trifluoroacetic acid (0.2%) 5:95 to 95:5).
[1551] Yield: 6.4 mg (15% of theory)
[1552] LC-MS (Method 19): R.sub.t=1.69 min.
[1553] MS (EI): m/z=756 (M-TFA+H).sup.+
Example 222A
Benzyl
tert-butyl-[(2S)-3-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl-
}amino)-3-oxopropan-1,2-diyl]biscarbamate
[1554] ##STR294##
[1555] Under argon, 0.208 g (0.40 mmol) of
3-{[(benzyloxy)carbonyl]amino}-N-(tert-butoxycarbonyl)-L-alanine-N-cycloh-
exylcyclohexanamine (1:1), 126 mg (0.40 mmol) of
tert-butyl{(4S)-5-amino-4-[(tert-butoxycarbonyl)amino]pentyl}carbamate
(Example 86A) and 0.21 ml of triethylamine (1.48 mmol) are
dissolved in 5 ml of dimethylformamide. Then, at 0.degree. C. (ice
bath), 130 mg (0.68 mmol) of EDC and 18 mg (0.13 mmol) of HOBt are
added. The mixture is slowly warmed to RT and stirred at RT for 12
h. The solution is concentrated in vacuo and the residue is taken
up with ethyl acetate. The organic phase is washed successively
with saturated sodium bicarbonate and sodium chloride solutions,
dried over magnesium sulfate and evaporated in vacuo. The crude
product is purified by preparative HPLC (Kromasil, mobile phase
acetonitrile/0.25% aqueous trifluoroacetic acid
5:95.fwdarw.95:5).
[1556] Yield: 88 mg (35% of theory)
[1557] LC-MS (Method 19): R.sub.t=2.65 min.
[1558] MS (EI): m/z=638 (M+H).sup.+
Example 223A
tert-Butyl{(4S)-5-({(2S)-3-amino-2-[(tert-butoxycarbonyl)amino]propanoyl}a-
mino)-4-[(tert-butoxycarbonyl)amino]pentyl}carbamate
hydroacetate
[1559] ##STR295##
[1560] 110 mg (0.172 mmol) of benzyl
tert-butyl[(2S)-3-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl}amino)-
-3-oxopropane-1,2-diyl]biscarbamate (Example 222A) are dissolved in
25 ml of a glacial acetic acid/water mixture (4:1). 20 mg of
palladium on activated carbon (10%) are added thereto, and the
mixture is then hydrogenated under atmospheric pressure for 15 h.
The reaction mixture is filtered through prewashed kieselguhr and
the filtrate is concentrated on a rotary evaporator in vacuo. The
crude product is reacted without further purification.
[1561] Yield: 85 mg (93% of theory)
[1562] LC-MS (Method 17): R.sub.t=1.67 min.
[1563] MS (EI): m/z=503 (M-HOAc+H).sup.+
Example 224A
Benzyl[(5S)-5-[(tert-butoxycarbonyl)amino]-7-({2-[(tert-butoxycarbonyl)ami-
no]ethyl}amino)-7-oxoheptyl]carbamate
[1564] ##STR296##
[1565] Under argon, 1 g (2.54 mmol) of
(3S)-7-{[(benzyloxy)carbonyl]amino}-3-[(tert-butoxycarbonyl)amino]heptano-
ic acid, 406 mg (2.54 mmol) of tert-butyl (2-aminoethyl)carbamate
and 0.96 ml of triethylamine (6.85 mmol) are dissolved in 20 ml of
dimethylformamide. Then, at 0.degree. C. (ice bath), 826 mg (4.3
mmol) of EDC and 113 mg (0.84 mmol) of HOBt are added. The mixture
is slowly warmed to RT and stirred at RT for 12 h. The solution is
concentrated in vacuo and the residue is taken up with ethyl
acetate. The organic phase is washed successively with saturated
sodium bicarbonate and sodium chloride solutions, dried over
magnesium sulfate and evaporated in vacuo. The remaining solid is
dried under high vacuum.
[1566] Yield: quant.
[1567] LC-MS (Method 12): R.sub.t=2.21 min.
[1568] MS (EI): m/z=537 (M+H).sup.+
Example 225A
tert-Butyl((1S)-5-amino-1-{2-[(2-{[(benzyloxy)carbonyl]amino}ethyl)amino]--
2-oxoethyl}pentyl)carbamate hydroacetate bock
[1569] ##STR297##
[1570] 1.3 g (2.42 mmol) of
benzyl[(5S)-5-[(tert-butoxycarbonyl)amino]-7-({2-[(tert-butoxycarbonyl)am-
ino]ethyl}amino)-7-oxoheptyl]carbamate (Example 224A) are dissolved
in 100 ml of a glacial acetic acid/water mixture (4:1). 70 mg of
palladium on activated carbon (10%) are added thereto, and the
mixture is then hydrogenated under atmospheric pressure for 15 h.
The reaction mixture is filtered through prewashed kieselguhr and
the filtrate is concentrated on a rotary evaporator in vacuo. The
crude product is reacted without further purification.
[1571] Yield: quant.
[1572] LC-MS (Method 19): R.sub.t=1.35 min.
[1573] MS (EI): m/z=403 (M-HOAc+H).sup.+
Example 226A
Benzyl((1S,8S)-8-[(tert-butoxycarbonyl)amino]-1-{3-[(tert-butoxycarbonyl)a-
mino]propyl}-17,17-dimethyl-2,10,15-trioxo-16-oxa-3,11,14-triazaoctadec-1--
yl)carbamate
[1574] ##STR298##
[1575] Under argon, 0.397 g (1.08 mmol) of
N.sup.2-[(benzyloxy)carbonyl]-N.sup.5-(tert-butoxycarbonyl)-L-ornithine,
0.500 g (1.08 mmol) of
tert-butyl((1S)-5-amino-1-{2-[(2-{[(benzyloxy)carbonyl]amino}ethyl)amino]-
-2-oxoethyl}pentyl)carbamate (Example 225A) and 0.56 ml of
triethylamine (4.0 mmol) are dissolved in 10 ml of
dimethylformamide. Then, at 0.degree. C. (ice bath), 352 mg (1.84
mmol) of EDC and 48.2 mg (0.36 mmol) of HOBt are added. The mixture
is slowly warmed to RT and stirred at RT for 12 h. The solution is
concentrated in vacuo and the residue is taken up with ethyl
acetate. The organic phase is washed successively with saturated
sodium bicarbonate and sodium chloride solutions, dried over
magnesium sulfate and evaporated in vacuo. The remaining solid is
purified by preparative HPLC (Kromasil, mobile phase:
acetonitrile/0.25% aqueous trifluoroacetic acid
5:95.fwdarw.95:5).
[1576] Yield: 290 mg (36% of theory)
[1577] LC-MS (Method 19): R.sub.t=2.30 min.
[1578] MS (EI): m/z=751 (M+H).sup.+
Example 227A
tert-Butyl{(4S,11S)-4-amino-11-[(tert-butoxycarbonyl)amino]-20,20-dimethyl-
-5,13,18-trioxo-19-oxa-6,14,17-triazahenicos-1-yl}carbamate
hydroacetate
[1579] ##STR299##
[1580] 290 mg (0.390 mmol) of
benzyl((1S,8S)-8-[(tert-butoxycarbonyl)amino]-1-{3-[(tert-butoxycarbonyl)-
amino]propyl}-17,17-dimethyl-2,10,15-trioxo-16-oxa-3,11,14-triazaoctadec-1-
-yl)carbamate (Example 226A) are dissolved in 10 ml of a 4/1
glacial acetic acid/water mixture. 75 mg of palladium on activated
carbon (10%) are added thereto, and the mixture is then
hydrogenated under atmospheric pressure for 15 h. The reaction
mixture is filtered through a Millipore filter and the filtrate is
concentrated and dried under high vacuum. The crude product is
reacted without further purification.
[1581] Yield: quant.
[1582] LC-MS (Method 17): R.sub.t=1.72 min.
[1583] MS (EI): m/z=617 (M-HOAc+H).sup.+
Example 228A
N.sup.5--[N.sup.2-[(Benzyloxy)carbonyl]-N.sup.5-(tert-butoxycarbonyl)-D-or-
nithyl]-N.sup.2-(tert-butoxycarbonyl)-N-{2-[(tert-butoxycarbonyl)amino]eth-
yl}-L-ornithinamide
[1584] ##STR300##
[1585] Under argon, 286 mg (0.78 mmol) of
N.sup.2-[(benzyloxy)carbonyl]-N.sup.5-(tert-butoxycarbonyl)-D-ornithine
and 439 mg (0.17 mmol) of the compound from Example 143A are
dissolved in 16 ml of dimethylformamide. Then, at 0.degree. C. (ice
bath), 255 mg (1.33 mmol) of EDC and 106 mg (0.78 mmol) of HOBt are
added. The mixture is slowly warmed to RT and stirred at RT for 48
h. The solution is concentrated in vacuo and the residue is taken
up in dichloromethane and washed with a saturated aqueous sodium
bicarbonate solution, 0.1N hydrochloric acid and water. The
combined organic phases are concentrated in vacuo and the solid
obtained in this way is reacted further without purification.
[1586] Yield: 0.58 g (quant.)
[1587] LC-MS (Method 17): R.sub.t=2.59 min.
[1588] MS (EI): m/z=723 (M+H).sup.+
Example 229A
N.sup.5-[N.sup.5-(tert-Butoxycarbonyl)-D-ornithyl]-N.sup.2-(tert-butoxycar-
bonyl)-N-{2-[(tert-butoxycarbonyl)amino]ethyl}-L-ornithinamide
[1589] ##STR301##
[1590] 0.58 g (0.80 mmol) of the compound from Example 228A are
dissolved in 27 ml of ethanol, and 0.06 g (0.06 mmol) of Pd/C are
added. The mixture is hydrogenated under atmospheric pressure for
12 h and, after filtration through celite, the filtrate is
concentrated in vacuo. The solid obtained in this way is reacted
further without purification.
[1591] Yield: 0.47 g (97% of theory)
[1592] LC-MS (Method 19): R.sub.t=1.61 min.
[1593] MS (EI): m/z=589 (M+H).sup.+
Example 230A
Benzyl{(4S)-6-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl}amino)-4-[(-
tert-butoxycarbonyl)amino]-6-oxohexyl}carbamate
[1594] ##STR302##
[1595] Under argon, 0.1 g (0.263 mmol) of
(3S)-6-{[(benzyloxy)carbonyl]amino}-3-[(tert-butoxycarbonyl)amino]hexanoi-
c acid (Bioorg. Med. Chem. Lett. (1998) 8:1477-1482) and 0.108 g
(0.342 mmol) of
tert-butyl{(4S)-5-amino-4-[(tert-butoxycarbonyl)amino]pentyl}car-
bamate (Example 86A) are dissolved in 6 ml of dimethylformamide.
Then, at 0.degree. C. (ice bath), 0.066 g (0.342 mmol) of EDC and
0.011 g (0.079 mmol) of HOBt are added. The mixture is slowly
warmed to RT and stirred at RT for 12 h. The solution is
concentrated in vacuo and the residue is taken up with ethyl
acetate. The organic phase is washed successively with saturated
sodium bicarbonate and sodium chloride solutions, dried over
magnesium sulfate and evaporated in vacuo. The remaining solid is
dried to constant weight under high vacuum.
[1596] Yield: 0.127 g (71% of theory)
[1597] LC-MS (Method 19): R.sub.t=2.36 min.
[1598] MS (EI): m/z=680 (M+H).sup.+
Example 231A
tert-Butyl{(1S)-4-amino-1-[2-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pen-
tyl}amino)-2-oxoethyl]butyl}carbamate
[1599] ##STR303##
[1600] 20 mg of palladium on activated carbon (10%) are added to a
mixture of 0.127 g (0.19 mmol) of the compound from Example 230A in
10 ml of ethanol, and the mixture is then hydrogenated under
atmospheric pressure for 12 h. The reaction mixture is filtered
through kieselguhr, and the filtrate is concentrated in vacuo and
dried under high vacuum. The crude product is reacted without
further purification.
[1601] Yield: quant.
[1602] MS (EI): m/z=546 (M+H).sup.+
Example 232A
Benzyl
tert-butyl[(2S)-3-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl}-
amino)-3-oxopropane-1,2-diyl]biscarbamate
[1603] ##STR304##
[1604] Under argon, 0.127 g (0.37 mmol) of
N-[(benzyloxy)carbonyl]-3-[(tert-butoxycarbonyl)amino]-L-alanine
and 0.193 g (0.49 mmol) of
tert-butyl{(4S)-5-amino-4-[(tert-butoxycarbonyl)amino]pentyl}carbamate
(Example 86A) are dissolved in 6 ml of dimethylformamide. Then, at
0.degree. C. (ice bath), 0.093 g (0.49 mmol) of EDC and 0.015 g
(0.11 mmol) of HOBt are added. The mixture is slowly warmed to RT
and stirred at RT for 12 h. The solution is concentrated in vacuo
and the residue is taken up with ethyl acetate. The organic phase
is washed successively with saturated sodium bicarbonate and sodium
chloride solutions, dried over magnesium sulfate and evaporated in
vacuo. The remaining solid is purified by preparative HPLC
(Kromasil, mobile phase acetonitrile/0.25% aqueous trifluoroacetic
acid 5:95.fwdarw.95:5).
[1605] Yield: 0.126 g (53% of theory)
[1606] LC-MS (Method 19): R.sub.t=2.65 min.
[1607] MS (EI): m/z=638 (M+H).sup.+
Example 233A
tert-Butyl[(2S)-2-amino-3-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl-
}amino)-3-oxopropyl]carbamate
[1608] ##STR305##
[1609] 20 mg of palladium on activated carbon (10%) are added to a
mixture of 0.122 g (0.19 mmol) of the compound from Example 232A in
50 ml of ethanol, and the mixture is then hydrogenated under
atmospheric pressure for 4 h. The reaction mixture is filtered
through kieselguhr, and the filtrate is concentrated in vacuo and
dried under high vacuum. The crude product is reacted without
further purification.
[1610] Yield: quant.
[1611] MS (EI): m/z=504 (M+H).sup.+
Example 234A
Benzyl{(1S)-1-[2-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl}amino)-2-
-oxoethyl]-4-[(tert-butoxycarbonyl)amino]butyl}carbamate
[1612] ##STR306##
[1613] Under argon, 0.1 g (0.26 mmol) of
(3S)-3-{[(benzyloxy)carbonyl]amino}-6-[(tert-butoxycarbonyl)amino]hexanoi-
c acid (J. Med. Chem. (2002) 45:4246-4253) and 0.11 g (0.34 mmol)
of
tert-butyl{(4S)-5-amino-4-[(tert-butoxycarbonyl)amino]pentyl}carbamate
(Example 86A) are dissolved in 6 ml of dimethylformamide. Then, at
0.degree. C. (ice bath), 0.065 g (0.34 mmol) of EDC and 0.011 g
(0.079 mmol) of HOBt are added. The mixture is slowly warmed to RT
and stirred at RT for 12 h. The solution is concentrated in vacuo
and the residue is taken up with ethyl acetate. The organic phase
is washed successively with saturated sodium bicarbonate and sodium
chloride solutions, dried over magnesium sulfate and evaporated in
vacuo. The remaining solid is dried to constant weight under high
vacuum.
[1614] Yield: 0.146 g (82% of theory)
[1615] LC-MS (Method 12): R.sub.t=2.5 min.
[1616] MS (EI): m/z=680 (M+H).sup.+
Example 235A
tert-Butyl[(4S)-4-amino-6-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl-
}amino)-6-oxohexyl]carbamate
[1617] ##STR307##
[1618] 22 mg of palladium on activated carbon (10%) are added to a
mixture of 0.146 g (0.22 mmol) of the compound from Example 234A in
10 ml of ethanol, and the mixture is then hydrogenated under
atmospheric pressure for 12 h. The reaction mixture is filtered
through kieselguhr, and the filtrate is concentrated in vacuo and
dried under high vacuum. The crude product is reacted without
further purification.
[1619] Yield: quant.
[1620] MS (EI): m/z=546 (M+H).sup.+
Example 236A
Benzyl{(3S)-3-[(tert-butoxycarbonyl)amino]-4-hydroxybutyl}carbamate
[1621] ##STR308##
[1622] Preparation takes place in analogy to Example 83A from 300
mg (0.85 mmol) of
(2S)-4-{[(benzyloxy)carbonyl]amino}-2-[(tert-butoxycarbonyl)amino]butanoi-
c acid in 10 ml of tetrahydrofuran with 86 mg (0.85 mmol) of
4-methylmorpholine, 92 mg (0.85 mmol) of ethyl chloroformate and
1.7 ml (1.70 mmol) of a 1M solution of lithium aluminum hydride in
tetrahydrofuran. The product is reacted without further
purification.
[1623] Yield: 238 mg (82% of theory)
[1624] LC-MS (Method 12): R.sub.t=1.83 min.
[1625] MS (EI): m/z=339 (M+H).sup.+
Example 237A
tert-Butyl[(1S)-3-amino-1-(hydroxymethyl)propyl]carbamate
[1626] ##STR309##
[1627] Preparation takes place in analogy to Example 81A from 237
mg (0.7 mmol) of
benzyl{(3S)-3-[(tert-butoxycarbonyl)amino]-4-hydroxybutyl}carbam-
ate (Example 236A) in 50 ml of ethanol with the addition of 23 mg
of palladium on activated carbon (10%).
[1628] Yield: 177 mg (quant.)
[1629] MS (ESI): m/z=205 (M+H).sup.+.
Example 238A
Benzyl{(1S)-4-[(tert-butoxycarbonyl)amino]-1-[({(3S)-3-[(tert-butoxycarbon-
yl)amino]-4-hydroxybutyl}amino)carbonyl]butyl}carbamate
[1630] ##STR310##
[1631] Under argon, 0.082 g (0.22 mmol) of
N.sup.2-[(benzyloxy)carbonyl]-N.sup.5-(tert-butoxycarbonyl)-L-ornithine
and 0.059 g (0.29 mmol) of
benzyl{(3S)-3-[(tert-butoxycarbonyl)amino]-4-hydroxybutyl}carbamate
(Example 237A) are dissolved in 6 ml of dimethylformamide. Then, at
0.degree. C. (ice bath), 0.056 g (0.29 mmol) of EDC and 0.009 g
(0.067 mmol) of HOBt are added. The mixture is slowly warmed to RT
and stirred at RT for 12 h. The solution is concentrated in vacuo
and the residue is taken up with ethyl acetate. The organic phase
is washed successively with saturated sodium bicarbonate and sodium
chloride solutions, dried over magnesium sulfate and evaporated in
vacuo. The remaining solid is dried to constant weight under high
vacuum.
[1632] Yield: 0.088 g, (72% of theory)
[1633] LC-MS (Method 12): R.sub.t=2.04 min.
[1634] MS (EI): m/z=553 (M+H).sup.+
Example 239A
N.sup.5-(tert-Butoxycarbonyl)-N-{(3S)-3-[(tert-butoxycarbonyl)amino]-4-hyd-
roxybutyl}-L-ornithinamide
[1635] ##STR311##
[1636] 17 mg of palladium on activated carbon (10%) are added to a
mixture of 0.088 g (0.16 mmol) of the compound from Example 238A in
10 ml of ethanol, and the mixture is then hydrogenated under
atmospheric pressure for 12 h. The reaction mixture is filtered
through kieselguhr, and the filtrate is concentrated in vacuo and
dried under high vacuum. The crude product is reacted without
further purification.
[1637] Yield: 0.064 g (96% of theory)
[1638] MS (EI): m/z=419 (M+H).sup.+
Example 240A
Benzyl
tert-butyl-[5-({2-[(tert-butoxycarbonyl)amino]ethyl}amino)-5-oxopen-
tane-1,3-diyl]biscarbamate
[1639] ##STR312##
[1640] Under argon, 0.20 g (0.55 mmol) of
3-{[(benzyloxy)carbonyl]amino}-5-[(tert-butoxycarbonyl)amino]pentanoic
acid (Bioorg. Chem. Med. Lett. (2003) 13:241-246) and 0.114 g (0.71
mmol) of tert-butyl(2-aminoethyl)carbamate are dissolved in 6 ml of
dimethylformamide. Then, at 0.degree. C. (ice bath), 0.136 g (0.71
mmol) of EDC and 0.022 g (0.164 mmol) of HOBt are added. The
mixture is warmed slowly to RT and stirred at RT for 12 h. The
solution is concentrated in vacuo and the residue is taken up with
ethyl acetate. The organic phase is washed successively with
saturated sodium bicarbonate and sodium chloride solutions, dried
over magnesium sulfate and evaporated in vacuo. The remaining solid
is purified by preparative HPLC (Kromasil, mobile phase
acetonitrile/0.25% aqueous trifluoroacetic acid
5:95.fwdarw.95:5).
[1641] Yield: 0.074 g (27% of theory)
[1642] LC-MS (Method 17): R.sub.t=2.37 min.
[1643] MS (EI): m/z=509 (M+H).sup.+
Example 241A
tert-Butyl[3-amino-5-({2-[(tert-butoxycarbonyl)amino]ethyl}amino)-5-oxopen-
tyl]carbamate
[1644] ##STR313##
[1645] 15 mg of palladium on activated carbon (10%) are added to a
mixture of 0.074 g (0.15 mmol) of the compound from Example 240A in
10 ml of ethanol, and the mixture is then hydrogenated under
atmospheric pressure for 12 h. The reaction mixture is filtered
through kieselguhr, and the filtrate is concentrated in vacuo and
dried under high vacuum. The crude product is reacted without
further purification.
[1646] Yield: 0.050 g (92% of theory)
[1647] MS (EI): m/z=375 (M+H).sup.+
Example 242A
Benzyl[3-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl}amino)-3-oxoprop-
yl]carbamate
[1648] ##STR314##
[1649] Under argon, 0.10 g (0.45 mmol) of
N-[(benzyloxy)carbonyl]beta-alanine and 0.185 g (0.58 mmol) of
tert-butyl{(4S)-5-amino-4-[(tert-butoxycarbonyl)amino]pentyl}carbamate
(Example 86A) are dissolved in 6 ml of dimethylformamide. Then, at
0.degree. C. (ice bath), 0.112 g (0.58 mmol) of EDC and 0.018 g
(0.134 mmol) of HOBt are added. The mixture is warmed slowly to RT
and stirred at RT for 12 h. The solution is concentrated in vacuo
and the residue is taken up with ethyl acetate. The organic phase
is washed successively with saturated sodium bicarbonate and sodium
chloride solutions, dried over magnesium sulfate and evaporated in
vacuo. The remaining solid is dried to constant weight under high
vacuum.
[1650] Yield: 0.215 g (92% of theory)
[1651] LC-MS (Method 12): R.sub.t=2.19 min.
[1652] MS (EI): m/z=523 (M+H).sup.+
Example 243A
tert-Butyl{(4S)-5-[(3-aminopropanoyl)amino]-4-[(tert-butoxycarbonyl)amino]-
pentyl}carbamate
[1653] ##STR315##
[1654] 40 mg of palladium on activated carbon (10%) are added to a
mixture of 0.215 g (0.41 mmol) of the compound from Example 242A in
10 ml of ethanol, and the mixture is then hydrogenated under
atmospheric pressure for 12 h. The reaction mixture is filtered
through kieselguhr, and the filtrate is concentrated in vacuo and
dried under high vacuum. The crude product is reacted without
further purification.
[1655] Yield: 0.160 g (quant.)
[1656] MS (EI): m/z=389 (M+H).sup.+
Example 244A
Benzyl
tert-butyl-[5-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl}amin-
o)-5-oxopentane-1,3-diyl]biscarbamate
[1657] ##STR316##
[1658] Under argon, 0.146 g (0.40 mmol) of
3-{[(benzyloxy)carbonyl]amino}-5-[(tert-butoxycarbonyl)amino]pentanoic
acid and 0.164 g (0.52 mmol) of
tert-butyl{(4S)-5-amino-4-[(tert-butoxycarbonyl)amino]pentyl}carbamate
(Example 86A) are dissolved in 8 ml of dimethylformamide. Then, at
0.degree. C. (ice bath), 0.10 g (0.52 mmol) of EDC and 0.009 g
(0.12 mmol) of HOBt are added. The mixture is slowly warmed to RT
and stirred at RT for 12 h. The solution is concentrated in vacuo
and the residue is taken up with ethyl acetate. The organic phase
is washed successively with saturated sodium bicarbonate and sodium
chloride solutions, dried over magnesium sulfate and evaporated in
vacuo. The remaining solid is dried to constant weight under high
vacuum.
[1659] Yield: 0.232 g, (87% of theory)
[1660] LC-MS (Method 17): R.sub.t=2.73 min.
[1661] MS (EI): m/z=666 (M+H).sup.+
Example 245A
tert-Butyl[3-amino-5-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pentyl}amin-
o)-5-oxopentyl]carbamate
[1662] ##STR317##
[1663] 35 mg of palladium on activated carbon (10%) are added to a
mixture of 0.232 g (0.35 mmol) of the compound from Example 244A in
10 ml of ethanol, and the mixture is then hydrogenated under
atmospheric pressure for 12 h. The reaction mixture is filtered
through kieselguhr, and the filtrate is concentrated in vacuo and
dried under high vacuum. The crude product is reacted without
further purification.
[1664] Yield: 0.175 g (94% of theory)
[1665] LC-MS (Method 17): R.sub.t=1.8 min.
[1666] MS (EI): m/z=532 (M+H).sup.+
Example 246A
Benzyl{(4S)-4-[(tert-butoxycarbonyl)amino]-5-hydroxypentyl}carbamate
[1667] ##STR318##
[1668] Preparation takes place in analogy to Example 83A from 1.0 g
(2.73 mmol) of
N.sup.5-[(benzyloxy)carbonyl]-N.sup.2-(tert-butoxycarbonyl)-L-or-
nithine in 35 ml of tetrahydrofuran with 0.276 g (2.73 mmol) of
4-methylmorpholine, 0.296 g (2.73 mmol) of ethyl chloroformate and
5.5 ml (5.5 mmol) of a 1M solution of lithium aluminum hydride in
tetrahydrofuran. The product is purified by preparative HPLC
(Kromasil, mobile phase acetonitrile/0.25% aqueous trifluoroacetic
acid 5:95.fwdarw.95:5).
[1669] Yield: 0.398 g (41% of theory)
[1670] LC-MS (Method 12): R.sub.t=1.84 min.
[1671] MS (EI): m/z=354 (M+H).sup.+
Example 247A
tert-Butyl[(1S)-4-amino-1-(hydroxymethyl)butyl]carbamate
[1672] ##STR319##
[1673] Preparation takes place in analogy to Example 81A from 0.232
g (0.66 mmol) of
benzyl{(4S)-4-[(tert-butoxycarbonyl)amino]-5-hydroxypentyl}carbamate
(Example 246A) in 50 ml of ethanol with the addition of 23 mg of
palladium on activated carbon (10%).
[1674] Yield: 135 mg (94% of theory)
[1675] MS (ESI): m/z=219 (M+H).sup.+.
Example 248A
Benzyl{(1S)-4-[(tert-butoxycarbonyl)amino]-1-[({(4S)-4-[(tert-butoxycarbon-
yl)amino]-5-hydroxypentyl}amino)carbonyl]butyl}carbamate
[1676] ##STR320##
[1677] Under argon, 0.155 g (0.42 mmol) of
N.sup.2-[(benzyloxy)carbonyl]-N.sup.5-(tert-butoxycarbonyl)-L-ornithine
and 0.12 g (0.55 mmol) of
tert-butyl[(1S)-4-amino-1-(hydroxymethyl)butyl]carbamate (Example
247A) are dissolved in 6 ml of dimethylformamide. Then, at
0.degree. C. (ice bath), 0.105 g (0.55 mmol) of EDC and 0.017 g
(0.13 mmol) of HOBt are added. The mixture is slowly warmed to RT
and stirred at RT for 12 h. The solution is concentrated in vacuo
and the residue is taken up with ethyl acetate. The organic phase
is washed successively with saturated sodium bicarbonate and sodium
chloride solutions, dried over magnesium sulfate and evaporated in
vacuo. The remaining solid is purified by preparative HPLC
(Kromasil, mobile phase acetonitrile/0.25% aqueous trifluoroacetic
acid 5:95.fwdarw.95:5).
[1678] Yield: 0.164 g (69% of theory)
[1679] LC-MS (Method 12): R.sub.t=2.05 min.
[1680] MS (EI): m/z=567 (M+H).sup.+
Example 249A
N.sup.5-(tert-Butoxycarbonyl)-N-{(4S)-4-[(tert-butoxycarbonyl)amino]-5-hyd-
roxypentyl}-L-ornithinamide
[1681] ##STR321##
[1682] 30 mg of palladium on activated carbon (10%) are added to a
mixture of 0.164 g (0.29 mmol) of the compound from Example 248A in
10 ml of ethanol, and the mixture is then hydrogenated under
atmospheric pressure for 12 h. The reaction mixture is filtered
through kieselguhr, and the filtrate is concentrated in vacuo and
dried under high vacuum. The crude product is reacted without
further purification.
[1683] Yield: 0.125 g (quant.)
[1684] MS (EI): m/z=433 (M+H).sup.+
Example 250A
Benzyl tert-butyl-[(2S)-3-hydroxypropane-1,2-diyl]biscarbamate
[1685] ##STR322##
[1686] Preparation takes place in analogy to Example 83A from 0.40
g (0.18 mmol) of
N-[(benzyloxy)carbonyl]-3-[(tert-butoxycarbonyl)amino]-L-alanine in
20 ml of tetrahydrofuran with 0.12 g (1.18 mmol) of
4-methylmorpholine, 0.13 g (1.18 mmol) of ethyl chloroformate and
2.4 ml (2.4 mmol) of a 1M solution of lithium aluminum hydride in
tetrahydrofuran. The product is purified by preparative HPLC
(Kromasil, mobile phase acetonitrile/0.25% aqueous trifluoroacetic
acid 5:95.fwdarw.95:5).
[1687] Yield: 0.193 g (50% of theory)
[1688] LC-MS (Method 12): R.sub.t=1.79 min.
[1689] MS (EI): m/z=325 (M+H).sup.+
Example 251A
tert-Butyl[(2S)-2-amino-3-hydroxypropyl]carbamate
[1690] ##STR323##
[1691] Preparation takes place in analogy to Example 81A from 0.193
g (0.59 mmol) of benzyl
tert-butyl-[(2S)-3-hydroxypropane-1,2-diyl]biscarbamate (Example
250A) in 10 ml of ethanol with the addition of 23 mg of palladium
on activated carbon (10%).
[1692] Yield: 112 mg (99% of theory)
[1693] MS (ESI): m/z=191 (M+H).sup.+.
Example 252A
Benzyl[(1S)-4-[(tert-butoxycarbonyl)amino]-1-({[(1S)-2-[(tert-butoxycarbon-
yl)amino]-1-(hydroxymethyl)ethyl]amino}carbonyl)butyl]carbamate
[1694] ##STR324##
[1695] Under argon, 0.18 g (0.49 mmol) of
N.sup.2-[(benzyloxy)carbonyl]-N.sup.5-(tert-butoxycarbonyl)-L-ornithine
and 0.122 g (0.64 mmol) of
tert-butyl[(2S)-2-amino-3-hydroxypropyl]carbamate (Example 251A)
are dissolved in 6 ml of dimethylformamide. Then, at 0.degree. C.
(ice bath), 0.123 g (0.64 mmol) of EDC and 0.02 g (0.15 mmol) of
HOBt are added. The mixture is slowly warmed to RT and stirred at
RT for 12 h. The solution is concentrated in vacuo and the residue
is taken up with ethyl acetate. The organic phase is washed
successively with saturated sodium bicarbonate and sodium chloride
solutions, dried over magnesium sulfate and evaporated in vacuo.
The remaining solid is purified by preparative HPLC (Kromasil,
mobile phase acetonitrile/0.25% aqueous trifluoroacetic acid
5:95.fwdarw.95:5).
[1696] Yield: 0.216 g (81% of theory)
[1697] LC-MS (Method 12): R.sub.t=2.07 min.
[1698] MS (EI): m/z=539 (M+H).sup.+
Example 253A
N.sup.5-(tert-Butoxycarbonyl)-N-[(1S)-2-[(tert-butoxycarbonyl)amino]-1-(hy-
droxymethyl)ethyl]-L-ornithinamide
[1699] ##STR325##
[1700] 40 mg of palladium on activated carbon (10%) are added to a
mixture of 0.216 g (0.40 mmol) of the compound from Example 252A in
10 ml of ethanol, and the mixture is then hydrogenated under
atmospheric pressure for 12 h. The reaction mixture is filtered
through kieselguhr, and the filtrate is concentrated in vacuo and
dried under high vacuum. The crude product is reacted without
further purification.
[1701] Yield: quant.
[1702] MS (EI): m/z=405 (M+H).sup.+
Example 254A
Benzyl[3-({2-[(tert-butoxycarbonyl)amino]ethyl}amino)-3-oxopropyl]carbamat-
e
[1703] ##STR326##
[1704] Under argon, 0.20 g (0.90 mmol) of
N-[(benzyloxy)carbonyl]-beta-alanine and 0.187 g (1.17 mmol) of
tert-butyl(2-aminoethyl)carbamate are dissolved in 6 ml of
dimethylformamide. Then, at 0.degree. C. (ice bath), 0.223 g (1.17
mmol) of EDC and 0.036 g (0.27 mmol) of HOBt are added. The mixture
is slowly warmed to RT and stirred at RT for 12 h. The solution is
concentrated in vacuo and the residue is taken up with ethyl
acetate. The organic phase is washed successively with saturated
sodium bicarbonate and sodium chloride solutions, dried over
magnesium sulfate and evaporated in vacuo. The remaining solid is
dried to constant weight under high vacuum.
[1705] Yield: 0.30 g (82% of theory)
[1706] LC-MS (Method 19): R.sub.t=1.93 min.
[1707] MS (EI): m/z=366 (M+H).sup.+
Example 255A
N-{2-[(tert-Butoxycarbonyl)amino]ethyl}-beta-alaninamide
[1708] ##STR327##
[1709] 80 mg of palladium on activated carbon (10%) are added to a
mixture of 0.30 g (0.82 mmol) of the compound from Example 254A in
10 ml of ethanol, and the mixture is then hydrogenated under
atmospheric pressure for 12 h. The reaction mixture is filtered
through kieselguhr, and the filtrate is concentrated in vacuo and
dried under high vacuum. The crude product is reacted without
further purification.
[1710] Yield: 0.190 g (quant.)
[1711] MS (EI): m/z=232 (M+H).sup.+
Example 256A
di-tert-Butyl((6S)-6-{[(benzyloxy)carbonyl]amino}-10-hydroxy-15,15-dimethy-
l-7,13-dioxo-14-oxa-2,8,12-triazahexadecane-1-imidoyl)imidodicarbonate
[1712] ##STR328##
[1713] Under argon, 0.30 g (0.49 mmol) of
N.sup.2-[(benzyloxy)carbonyl]-N.sup.5-[[bis(tert-butoxycarbonyl)amino](im-
ino)methyl]-L-ornithine-cyclohexanamine (1:1) and 0.12 g (0.64
mmol) of tert-butyl(3-amino-2-hydroxypropyl)carbamate are dissolved
in 6 ml of dimethylformamide. Then, at 0.degree. C. (ice bath),
0.123 g (0.64 mmol) of EDC and 0.02 g (0.15 mmol) of HOBt are
added. The mixture is slowly warmed to RT and stirred at RT for 12
h. The solution is concentrated in vacuo and the residue is taken
up with ethyl acetate. The organic phase is washed successively
with saturated sodium bicarbonate and sodium chloride solutions,
dried over magnesium sulfate and evaporated in vacuo. The remaining
solid is purified by preparative HPLC (Kromasil, mobile phase
acetonitrile/0.25% aqueous trifluoroacetic acid
5:95.fwdarw.95:5).
[1714] Yield: 0.183 g (54% of theory)
[1715] LC-MS (Method 12): R.sub.t=2.58 min.
[1716] MS (EI): m/z=681 (M+H).sup.+
Example 257A
N.sup.5-[[bis(tert-Butoxycarbonyl)amino](imino)methyl]-N-{3-[(tert-butoxyc-
arbonyl)amino]-2-hydroxypropyl}-L-ornithinamide
[1717] ##STR329##
[1718] 28 mg of palladium on activated carbon (10%) are added to a
mixture of 0.182 g (0.27 mmol) of the compound from Example 256A in
10 ml of ethanol, and the mixture is then hydrogenated under
atmospheric pressure for 12 h. The reaction mixture is filtered
through kieselguhr, and the filtrate is concentrated in vacuo and
dried under high vacuum. The crude product is reacted without
further purification.
[1719] Yield: 0.138 g (94% of theory)
[1720] MS (EI): m/z=547 (M+H).sup.+
Example 258A
Benzyl{(1S)-4-{[(benzyloxy)carbonyl]amino}-1-[({3-[(tert-butoxycarbonyl)am-
ino]-2-hydroxypropyl}amino)carbonyl]butyl}carbamate
[1721] ##STR330##
[1722] Under argon, 0.20 g (0.50 mmol) of
N.sup.2,N.sup.5-bis[(benzyloxy)carbonyl]-L-ornithine and 0.124 g
(0.65 mmol) of tert-butyl(3-amino-2-hydroxypropyl)carbamate are
dissolved in 6 ml of dimethylformamide. Then, at 0.degree. C. (ice
bath), 0.124 g (0.65 mmol) of EDC and 0.02 g (0.15 mmol) of HOBt
are added. The mixture is slowly warmed to RT and stirred at RT for
12 h. The solution is concentrated in vacuo and the residue is
taken up with ethyl acetate. The organic phase is washed
successively with saturated sodium bicarbonate and sodium chloride
solutions, dried over magnesium sulfate and evaporated in vacuo.
The remaining solid is dried to constant weight under high
vacuum.
[1723] Yield: 0.245 g (86% of theory)
[1724] LC-MS (Method 12): R.sub.t=2.15 min.
[1725] MS (EI): m/z=573 (M+H).sup.+
Example 259A
Benzyl((4S)-5-[(3-amino-2-hydroxypropyl)amino]-4-{[(benzyloxy)carbonyl]ami-
no}-5-oxopentyl)carbamate hydrochloride
[1726] ##STR331##
[1727] 6.8 ml of a 4N solution of hydrogen chloride in dioxane are
added to a solution of 0.263 g (0.46 mmol) of the compound from
Example 258A in 1 ml of dioxane at 0.degree. C. After 2 h at RT,
the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is dried to
constant weight under high vacuum.
[1728] Yield: 0.205 g (88% of theory)
[1729] LC-MS (Method 12): R.sub.t=1.47 min.
[1730] MS (EI): m/z=473 (M-HCl+H).sup.+
Example 260A
Benzyl[(2S)-2-[(tert-butoxycarbonyl)amino]-3-({2-[(tert-butoxycarbonyl)ami-
no]ethyl}amino)-3-oxopropyl]carbamate
[1731] ##STR332##
[1732] Under argon, 0.50 g (0.96 mmol) of
3-{[(benzyloxy)carbonyl]amino}-N-(tert-butoxycarbonyl)-L-alanine-N-cycloh-
exylcyclohexanamine (1:1) and 0.154 g (0.96 mmol) of
tert-butyl(2-aminoethyl)carbamate are dissolved in 10 ml of
dimethylformamide and 0.5 ml of triethylamine. Then, at 0.degree.
C. (ice bath), 0.314 g (1.64 mmol) of EDC and 0.043 g (0.32 mmol)
of HOBt are added. The mixture is slowly warmed to RT and stirred
at RT for 12 h. The solution is concentrated in vacuo and the
residue is taken up with ethyl acetate. The organic phase is washed
successively with saturated sodium bicarbonate and sodium chloride
solutions, dried over magnesium sulfate and evaporated in vacuo.
The remaining solid is dried to constant weight under high
vacuum.
[1733] Yield: 0.41 g (88% of theory)
[1734] LC-MS (Method 12): R.sub.t=2.17 min.
[1735] MS (EI): m/z=481 (M+H).sup.+
Example 261A
3-Amino-N-(tert-butoxycarbonyl)-N-{2-[(tert-butoxycarbonyl)amino]ethyl}-L--
alaninamide hydroacetate
[1736] ##STR333##
[1737] 50 mg of palladium on activated carbon (10%) are added to a
mixture of 0.41 g (0.847 mmol) of the compound from Example 260A in
80 ml of acetic acid/ethanol/water (4:1:1), and the mixture is then
hydrogenated under atmospheric pressure for 12 h. The reaction
mixture is filtered through kieselguhr, and the filtrate is
concentrated in vacuo and dried under high vacuum. The crude
product is reacted without further purification.
[1738] Yield: quant.
[1739] LC-MS (Method 12): R.sub.t=1.09 min.
[1740] MS (EI): m/z=347 (M-HOAc+H).sup.+
Example 262A
tert-Butyl{3-[(8S,11S,14S)-8-{(6S,11S)-6,11-bis[(tert-butoxycarbonyl)amino-
]-18,18-dimethyl-8,16-dioxo-17-oxa-2,9,15-triazanonadecan-1-oyl}-14-[(tert-
-butoxycarbonyl)amino]-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.-
1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaen-11-yl]propyl}carbamate
[1741] ##STR334##
[1742] Under argon, 20 mg (0.03 mmol) of the compound from Example
29A and 22 mg (0.04 mmol) of
tert-butyl{(1S)-4-amino-1-[2-({(2S)-2,5-bis[(tert-butoxycarbonyl)amino]pe-
ntyl}amino)-2-oxo-ethyl]butyl}carbamate (Example 231A) are
dissolved in 1 ml of dimethylformamide. Then, at 0.degree. C. (ice
bath), 7.6 mg (0.04 mmol) of EDC and 1.24 mg (0.009 mmol) of HOBt
are added. The mixture is slowly warmed to RT and stirred at RT for
12 h. The solution is concentrated in vacuo and the residue is
stirred with water. The remaining solid is collected by suction
filtration and purified by chromatography (Sephadex LH20, mobile
phase: methanol/acetic acid (0.25%)).
[1743] Yield: 25.4 mg (70% of theory)
[1744] LC-MS (Method 17): R.sub.t=2.81 min.
[1745] MS (EI): m/z=1184 (M+H).sup.+
Example 263A
N.sup.5-{N-[(Benzyloxy)carbonyl]glycyl}-N.sup.2-(tert-butoxycarbonyl)-N-{2-
-[(tert-butoxycarbonyl)amino]ethyl}-L-ornithinamide
[1746] ##STR335##
[1747] Under argon, 300 mg (1.43 mmol) of
N-[(benzyloxy)carbonyl]glycine and 830 mg (2.15 mmol) of the
compound from Example 143A are dissolved in 28 ml of
dimethylformamide. Then, at 0.degree. C. (ice bath), 467 mg (2.44
mmol) of EDC and 194 mg (1.43 mmol) of HOBt are added. The mixture
is slowly warmed to RT and stirred at RT for 48 h. The solution is
concentrated in vacuo and the residue is taken up with
dichloromethane and washed with a saturated sodium bicarbonate
solution, 0.1 N hydrochloric acid and water. The combined organic
phases are concentrated in vacuo, and the solid obtained in this
way is reacted further without purification.
[1748] Yield: quant.
[1749] LC-MS (Method 12): R.sub.t=1.98 min.
[1750] MS (EI): m/z=566 (M+H).sup.+
Example 264A
N.sup.5-Glycyl-N.sup.2-(tert-butoxycarbonyl)-N-{2-[(tert-butoxycarbonyl)am-
ino]ethyl}-L-ornithinamide
[1751] ##STR336##
[1752] 1030 mg (1.82 mmol) of the compound from Example 263A are
dissolved in 60 ml of ethanol, and 100 mg (0.09 mmol) of Pd/C (10%)
are added. The mixture is hydrogenated under atmospheric pressure
overnight and, after filtration through celite, the filtrate is
concentrated in vacuo. The solid obtained in this way is reacted
further without purification.
[1753] Yield: 693 mg (84% of theory)
[1754] LC-MS (Method 17): R.sub.t=1.41 min.
[1755] MS (EI): m/z=432 (M+H).sup.+
Example 265A
N.sup.5--[N.sup.2-[(Benzyloxy)carbonyl]-N-(tert-butoxycarbonyl)-L-ornithyl-
]-N.sup.2-(tert-butoxycarbonyl)-N-{2-[(tert-butoxycarbonyl)amino]ethyl}-L--
ornithinamide
[1756] ##STR337##
[1757] Under argon, 1.95 g (5.31 mmol)
N.sup.2-[(benzyloxy)carbonyl]-N.sup.5-(tert-butoxycarbonyl)-L-ornithine
and 3.12 g (7.97 mmol) of the compound from Example 143A are
dissolved in 100 ml of dimethylformamide. Then, at 0.degree. C.
(ice bath), 1.73 g (9.03 mmol) of EDC and 0.72 g (5.31 mmol) of
HOBt are added. The mixture is slowly warmed to RT and stirred at
RT for 48 h. The solution is concentrated in vacuo and the residue
is taken up with dichloromethane and washed with a saturated
aqueous sodium bicarbonate solution, 0.1 N hydrochloric acid and
water. The combined organic phases are concentrated in vacuo, and
the solid obtained in this way is reacted further without
purification.
[1758] Yield: 4.23 g (96% of theory)
[1759] LC-MS (Method 19): R.sub.t=2.19 min.
[1760] MS (EI): m/z=723 (M+H).sup.+
Example 266A
N.sup.5--[N.sup.5-(tert-Butoxycarbonyl)-L-ornithyl]-N.sup.2-(tert-butoxyca-
rbonyl)-N-{2-[(tert-butoxycarbonyl)amino]ethyl}-L-ornithinamide
[1761] ##STR338##
[1762] 4.23 g (5.09 mmol) of the compound from Example 265A are
dissolved in 250 ml of ethanol, and 0.42 g (0.39 mmol) of Pd/C
(10%) are added. The mixture is hydrogenated under atmospheric
pressure for 6 h and, after filtration through celite, the filtrate
is concentrated in vacuo. The solid obtained in this way is reacted
further without purification.
[1763] Yield: 2.4 g (72% of theory)
[1764] LC-MS (Method 12): R.sub.t=1.31 min.
[1765] MS (EI): m/z=589 (M+H).sup.+
Example 267A
Benzyl((1S,7S)-7-[(tert-butoxycarbonyl)amino]-1-{2-[(tert-butoxycarbonyl)a-
mino]ethyl}-15,15-dimethyl-2,8,13-trioxo-14-oxa-3,9,12-triazahexadec-1-yl)-
carbamate
[1766] ##STR339##
[1767] Under argon, 250 mg (0.71 mmol) of
(2S)-2-{[(benzyloxy)carbonyl]amino}-4-[(tert-butoxycarbonyl)amino]butanoi-
c acid and 410 mg (1.06 mmol) of the compound from Example 143A are
dissolved in 14 ml of dimethylformamide. Then, at 0.degree. C. (ice
bath), 231 mg (1.21 mmol) of EDC and 96 mg (0.71 mmol) of HOBt are
added. The mixture is slowly warmed to RT and stirred at RT for 48
h. The solution is concentrated in vacuo and the residue is taken
up with dichloromethane and washed with a saturated sodium
bicarbonate solution, 0.1 N hydrochloric acid and water. The
combined organic phases are concentrated in vacuo, and the solid
obtained in this way is reacted further without purification.
[1768] Yield: 355 mg (66% of theory)
[1769] LC-MS (Method 12): R.sub.t=2.32 min.
[1770] MS (EI): m/z=709 (M+H).sup.+
Example 268A
N.sup.5-{(2S)-2-Amino-4-[(tert-butoxycarbonyl)amino]butanoyl}-N.sup.2-(ter-
t-butoxycarbonyl)-N-{2-[(tert-butoxycarbonyl)amino]ethyl}-L-ornithinamide
[1771] ##STR340##
[1772] 355 mg (0.5 mmol) of the compound from Example 267A are
dissolved in 17 ml of ethanol, and 36 mg (0.03 mmol) of Pd/C (10%)
are added. The mixture is hydrogenated under atmospheric pressure
overnight and, after filtration through celite, the filtrate is
concentrated in vacuo. The solid obtained in this way is reacted
further without purification.
[1773] Yield: 304 mg (82% of theory)
[1774] LC-MS (Method 17): R.sub.t=1.64 min.
[1775] MS (EI): m/z=575 (M+H).sup.+
[1776] Examples 269A to 286A listed in the following table are
prepared in analogy to the method of Example 262A. TABLE-US-00012
Example Precursor Analytical No. example Structure data 269A 233A
+29A ##STR341## LC-MS (Method 19): R.sub.t =2.69 min. MS (EI): m/z
= 1142 (M + H).sup.+. 270A 235A +29A ##STR342## LC-MS (Method 12):
R.sub.t =2.55 min. MS (EI): m/z = 1184 (M + H).sup.+. 271A 81A +65A
##STR343## LC-MS (Method 17): R.sub.t =2.52 min. MS (EI): m/z =
1029 (M + H).sup.+. 272A 239A +29A ##STR344## LC-MS (Method 19):
R.sub.t =2.32 min. MS (EI): m/z = 1057 (M + H).sup.+. 273A 241A
+29A ##STR345## LC-MS (Method 12): R.sub.t =2.28 min. MS (EI): m/z
= 1013 (M + H).sup.+. 274A 243A +29A ##STR346## LC-MS (Method 12):
R.sub.t =2.31 min. MS (EI): m/z = 1027 (M + H).sup.+. 275A 245A
+29A ##STR347## LC-MS (Method 19): R.sub.t =2.36 min. MS (EI): m/z
= 1170 (M + H).sup.+. 276A 249A +29A ##STR348## LC-MS (Method 19):
R.sub.t =2.30 min. MS (EI): m/z = 1171 (M + H).sup.+. 277A 253A
+29A ##STR349## LC-MS (Method 19): R.sub.t =2.14 min. MS (EI): m/z
= 1043 (M + H).sup.+. 278A 120A +65A ##STR350## LC-MS (Method 12):
R.sub.t =2.51 min. MS (EI): m/z = 1186 (M + H).sup.+. 279A 255A
+29A ##STR351## LC-MS (Method 12): R.sub.t =2.04 min. MS (EI): m/z
= 870 (M + H).sup.+. 280A 257A +29A ##STR352## LC-MS (Method 12):
R.sub.t =2.64 min. MS (EI): m/z = 1185 (M + H).sup.+. 281A 259A
+29A ##STR353## LC-MS (Method 17): R.sub.t =2.62 min. MS (EI): m/z
= 1111 (M + H).sup.+. 282A 253A +65A ##STR354## LC-MS (Method 19):
R.sub.t =2.25 min. MS (EI): m/z = 1059 (M + H).sup.+. 283A 29A
+264A ##STR355## LC-MS (Method 17): R.sub.t =2.46 min. MS (EI): m/z
= 1070 (M + H).sup.+. 284A 29A +266A ##STR356## LC-MS (Method 17):
R.sub.t =2.64 min. MS (EI): m/z = 1227 (M + H).sup.+. 285A 29A
+268A ##STR357## LC-MS (Method 17): R.sub.t =2.68 min. MS (EI): m/z
= 1213 (M + H).sup.+. 286A 29A +268A ##STR358## LC-MS (Method 17):
R.sub.t =2.66 min. MS (EI): m/z = 1227 (M + H).sup.+.
[1777] Examples 287A to 293A listed in the following table are
prepared in analogy to the method of Example 178A. TABLE-US-00013
Example Precursor Analytical No. example Structure data 287A 170A
+81A ##STR359## LC-MS (Method 17): R.sub.t =2.69 min. MS (EI): m/z
= 1041 (M + H).sup.+. 288A 29A +225A ##STR360## LC-MS (Method 17):
R.sub.t =2.50 min. MS (EI): m/z = 1041 (M + H).sup.+. 289A 143A
+65A ##STR361## LC-MS (Method 17): R.sub.t =2.39 min. 290A 52A
+223A ##STR362## LC-MS (Method 17): R.sub.t =2.73 min. MS (EI): m/z
= 1173 (M + H).sup.+. 291A 29A +223A ##STR363## LC-MS (Method 17):
R.sub.t =2.71 min. MS (EI): m/z = 1142 (M + H).sup.+. 292A 261A
+52A ##STR364## LC-MS (Method 19): R.sub.t =2.42 min. MS (EI): m/z
= 1015 (M + H).sup.+. 293A 261A +29A ##STR365## LC-MS (Method 19):
R.sub.t =2.42 min. MS (EI): m/z = 985 (M + H).sup.+.
[1778] Examples 294A to 297A listed in the following table are
prepared in analogy to the method of Example 171A. TABLE-US-00014
Example Precursor Analytical No. example Structure data 294A 227A
+29A ##STR366## LC-MS (Method 12): R.sub.t =2.47 min. MS (EI): m/z
= 1255 (M + H).sup.+. 295A 52A +225A ##STR367## LC-MS (Method 12):
R.sub.t =2.26 min. MS (EI): m/z = 1071 (M + H).sup.+. 296A 52A
+227A ##STR368## LC-MS (Method 12): R.sub.t =2.46 min. MS (EI): m/z
= 1285 (M + H).sup.+. 297A 52A +81A ##STR369## LC-MS (Method 12):
R.sub.t =2.33 min. MS (EI): m/z = 1043 (M + H).sup.+.
[1779] Example 298A detailed in the following table are prepared in
analogy to the method of Example 205A. TABLE-US-00015 Example
Precursor Analytical No. example Structure data 298A 281A
##STR370## LC-MS (Method 12): R.sub.t =1.14 min. MS (EI): m/z = 843
(M - 2HOAc + H).sup.+.
Exemplary Embodiments
[1780] Exemplary embodiments can be synthesized starting from
partially protected biphenomycin derivatives (such as, for example,
29A). ##STR371##
Example 1
(8S,11S,14S)-14-Amino-N-((1S)-4-amino-1-{[(3-amino-2-hydroxypropyl)amino]c-
arbonyl}butyl)-11-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diazatri-
cyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamid-
e tetrahydrochloride
[1781] ##STR372##
[1782] 36 mg (0.035 mmol) of
tert-butyl(3-{[(2S)-5-[(tert-butoxycarbonyl)amino]-2-({[(8S,11S,14S)-14-[-
(tert-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-5,17-
-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),-
2(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)pentanoyl]amino}-2-hydroxypropy-
l)carbamate (Example 166A) are dissolved in 3.0 ml of 4N hydrogen
chloride in dioxane and stirred at room temperature for 2 h. The
solvent is evaporated in vacuo and the remaining solid is dried to
constant weight under high vacuum.
[1783] Yield: 25 mg (92% of theory).
[1784] MS (ESI): m/z=643 (M-4HCl+H).sup.+.
[1785] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.55-2.05 (m, 8H),
2.75-3.15 (m, 8H), 3.17-3.45 (m, 3H), 3.54 (m.sub.c, 1H), 3.73
(m.sub.c, 1H), 3.87-4.0 (m, 2H), 4.23 (m.sub.c, 1H), 4.41 (m.sub.c,
1H), 4.82 (m.sub.c, 1H), 6.83-6.92 (m, 2H), 6.96 (s, 1H), 7.25 (s,
1H), 7.36 (d, 1H), 7.42 (d, 1H).
[1786] The tetrahydrochloride salt is converted by preparative HPLC
(Reprosil ODS-A, mobile phase acetonitrile/0.2% aqueous
trifluoroacetic acid 5:95.fwdarw.95:5) into the
tetra(hydrotrifluoroacetate).
Example 2
(8S,11S,14S)-14-Amino-N-((1S)-4-amino-1-{[(2-aminoethyl)amino]carbonyl}but-
yl)-1-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1-
.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamide
tetra(hydrotrifluoroacetate)
[1787] ##STR373##
[1788] 29.7 mg (0.029 mmol) of
tert-butyl(2-{[(2S)-5-[(tert-butoxycarbonyl)amino]-2-({[(8S,11S,14S)-14-[-
(tert-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-5,17-
-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),-
2(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)pentanoyl]amino}ethyl)carbamate
(Example 167A) are dissolved in 3.0 ml of 4N hydrogen chloride in
dioxane and stirred at room temperature for 2 h. The solvent is
evaporated in vacuo and the remaining solid is converted by
preparative HPLC (Reprosil ODS-A, mobile phase acetonitrile/0.2%
aqueous trifluoroacetic acid 5:95.fwdarw.95:5) into the
tetra(hydrotrifluoroacetate).
[1789] Yield: 20 mg (64% of theory).
[1790] MS (ESI): m/z=613 (M-4TFA+H).sup.+.
[1791] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.53-1.93 (m, 8H),
2.32 (m.sub.c, 1H), 2.93 (m.sub.c, 4H), 3.02 (m.sub.c, 1H), 3.08
(m.sub.c, 2H), 3.23 (m.sub.c, 1H), 3.35-3.60 (m, 3H), 4.23
(m.sub.c, 2H), 4.40 (m.sub.c, 1H), 4.82 (m.sub.c, 1H), 6.82-6.93
(m, 2H), 6.97 (s, 1H), 7.25 (s, 1H), 7.36 (d, 1H), 7.43 (d,
1H).
Example 3
(8S,11S,14S)-14-Amino-N-((4S)-4-amino-5-{[(1S)-3-amino-1-(hydroxymethyl)pr-
opyl]amino}-5-oxopentyl)-11-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,1-
2-diazatricyclo[14.3.1.1.sup.2,6]-henicosa-1(20),2(21),3,5,16,18-hexaene-8-
-carboxamide tetrahydrochloride
[1792] ##STR374##
[1793] 24.9 mg (0.024 mmol) of
tert-butyl((3S)-3-{[(2S)-2-[(tert-butoxycarbonyl)amino]-5-({[(8S,11S,14S)-
-14-[(tert-butoxycarbonyl)amino]-1-{3-[(tert-butoxycarbonyl)amino]propyl}--
5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(-
20),2(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)pentanoyl]amino}-4-hydroxyb-
utyl)carbamate (Example 168A) are dissolved in 3.0 ml of 4N
hydrogen chloride in dioxane and stirred at room temperature for 2
h. The solvent is evaporated in vacuo and the remaining solid is
dried to constant weight under high vacuum.
[1794] Yield: 17 mg (90% of theory).
[1795] MS (ESI): m/z=657 (M-4HCl+H).sup.+.
[1796] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-1.95 (m, 10H),
2.75-3.05 (m, 7H), 3.08-3.18 (m, 2H), 3.3 (m.sub.c, 1H), 3.43-3.61
(m, 3H), 3.87-3.97 (m, 2H), 4.41 (m.sub.c, 1H), 4.82 (m.sub.c, 1H),
6.83-6.92 (m, 2H), 6.96 (s, 1H), 7.25 (s, 1H), 7.34 (d, 1H), 7.42
(d, 1H).
[1797] The tetrahydrochloride salt is converted by preparative HPLC
(Reprosil ODS-A, mobile phase acetonitrile/0.2% aqueous
trifluoroacetic acid 5:95.fwdarw.95:5) into the
tetra(hydrotrifluoroacetate).
Example 4
(8S,11S,14S)-14-Amino-N-((1S,3R)-4-amino-1-{[(2-aminoethyl)amino]carbonyl}-
-3-hydroxybutyl)-11-[(2R)-3-amino-2-hydroxypropyl]-5,17-dihydroxy-10,13-di-
oxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hex-
aene-8-carboxamide tetrahydrochloride
[1798] ##STR375##
[1799] 16 mg (0.02 mmol) of the compound from Example 172A are
provided in 0.5 ml of dioxane and cooled to 0.degree. C., and 1 ml
of 4N hydrogen chloride in dioxane is added. The mixture is allowed
to warm to room temperature and is stirred for 1 h. The mixture is
then concentrated in vacuo and the residue is dried under high
vacuum. Stirring with acetonitrile and collecting the precipitate
which has separated out by filtration results in the title compound
as a solid.
[1800] Yield: 8 mg (42% of theory).
[1801] LC-MS (Method 20): R.sub.t=1.03 min.
[1802] MS (EI): m/z=645 (M-4HCl+H).sup.+.
Example 5
(8S,11S,14S)-14-Amino-N-((1S)-3-amino-1-{[(3-amino-2-hydroxypropyl)amino]c-
arbonyl}propyl)-11-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diazatr-
icyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxami-
de tetrahydrochloride
[1803] ##STR376##
[1804] 9 mg (0.01 mmol) of the compound from Example 173A are
cooled to 0.degree. C. and 1 ml of 4N hydrogen chloride in dioxane
is added. After 1 h, the mixture is concentrated in vacuo. The
residue is taken up in acetonitrile and again concentrated.
[1805] Yield: 7 mg (98% of theory).
[1806] LC-MS (Method 20): R.sub.t=0.95 min.
[1807] MS (EI): m/z=629 (M-4HCl+H).sup.+.
Example 6
(8S,11S,14S)-14-Amino-N-((1S,3R)-4-amino-1-{[(2-aminoethyl)amino]carbonyl}-
-3-hydroxybutyl)-11-[3-aminopropyl]-5,17-dihydroxy-10,13-dioxo-9,12-diazat-
ricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxam-
ide tetrahydrochloride
[1808] ##STR377##
[1809] 8 mg (0.01 mmol) of the compound from Example 175A are mixed
at 0.degree. C. with 0.5 ml of 4N hydrogen chloride in dioxane. The
mixture is allowed to warm to room temperature and is stirred for 1
h. The mixture is then concentrated in vacuo, and the residue is
dried under high vacuum. Stirring with acetonitrile and collecting
the precipitate which has separated out by filtration results in
the title compound as a solid.
[1810] Yield: 7 mg (59% of theory).
[1811] LC-MS (Method 20): R.sub.t=0.90 min.
[1812] MS (EI): m/z=630 (M-4HCl+H).sup.+.
Example 7
(8S,11S,14S)-14-Amino-N-{(4S)-4-amino-6-[(2-aminoethyl)amino]-6-oxohexyl}--
11-(3-aminopropyl)-9-ethyl-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[1-
4.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamide
tetrahydrochloride
[1813] ##STR378##
[1814] 0.1 ml of 4M solution of hydrogen chloride in dioxane is
added to a solution of 7.5 mg (0.009 mmol) of
tert-butyl{3-[(8S,11S,14S)-8-[({(4S)-4-amino-6-[(2-aminoethyl)amino]-6-ox-
ohexyl}amino)carbonyl]-14-[(tert-butoxycarbonyl)amino]-9-ethyl-5,17-dihydr-
oxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3-
,5,16,18-hexaen-11-yl]propyl}carbamate (Example 204A) in 0.1 ml of
dioxane at 0.degree. C. After 2 h at RT, the reaction solution is
concentrated in vacuo, coevaporated with dichloromethane several
times and dried under high vacuum. The residue is mixed with
diethyl ether and concentrated.
[1815] Yield: 4.9 mg (70% of theory)
[1816] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=0.87 (m, 3H),
1.10-1.27 (m, 2H), 1.5-1.9 (m, 8H), 2.53-3.80 (m, 14H), 4.47 (m,
1H), 4.96 (m, 1H), 5.65 (m, 1H), 6.90 (d, 2H), 7.06 (s, 1H), 7.21
(s, 1H), 7.45 (d, 1H), 7.53 (d, 1H).
Example 8
(8S,11S,14S)-14-Amino-N-[(1S)-2-[(3-amino-2-hydroxypropyl)amino]-1-(hydrox-
ymethyl)-2-oxoethyl]-1-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-dia-
zatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carbo-
xamide trihydrochloride
[1817] ##STR379##
[1818] A mixture of 12.7 mg (0.014 mmol) of
tert-butyl(3-{[(2S)-2-({[(8S,11S,14S)-14-[(tert-butoxycarbonyl)amino]-11--
{3-[(tert-butoxycarbonyl)amino]propyl}-5,17-dihydroxy-10,13-dioxo-9,12-dia-
zatricyclo[14.3.1.1.sup.26]henicosa-1(20),2(21),3,5,16,18-hexaen-8-yl]carb-
onyl}amino)-3-hydroxypropanoyl]amino}-2-hydroxypropyl)carbamate
(Example 188A) in 1 ml of a 4M solution of hydrogen chloride in
dioxane is stirred at RT for 20 min. The reaction solution is
concentrated, coevaporated with dichloromethane several times and
dried under high vacuum.
[1819] Yield: 9.1 mg (90% of theory)
[1820] LC-MS (Method 20): R.sub.t=1.83 min.
[1821] MS (EI): m/z=616 (M-3HCl+H).sup.+
[1822] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.56-1.90 (m, 4H),
2.78-3.82 (m, 14H), 3.96 (m, 1H), 4.42 (m, 1H), 4.88 (m, 1H), 6.91
(d, 2H), 6.97 (s, 1H), 7.27 (s, 1H), 7.36 (d, 1H), 7.43 (d,
1H).
Example 9
(8S,11S,14S)-14-Amino-N-((1S)-4-amino-1-{2-[(2-aminoethyl)amino]-2-oxoethy-
l}butyl)-1-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[1-
4.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamide
tetrahydrochloride
[1823] ##STR380##
[1824] A mixture of 30 mg (0.029 mmol) of
tert-butyl(2-{[(3S)-6-[(tert-butoxycarbonyl)amino]-3-({[(8S,11S,14S)-14-[-
(tert-butoxycarbonyl)amino]-11-{3-[(tert-butoxycarbonyl)amino]propyl}-5,17-
-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),-
2(21),3,5,16,18-hexaen-8-yl]carbonyl}amino)hexanoyl]amino}ethyl)carbamate
(Example 193A) in 2 ml of a 4M solution of hydrogen chloride in
dioxane is stirred at RT for 20 min. The reaction solution is
concentrated, coevaporated with dichloromethane several times and
dried under high vacuum.
[1825] Yield: quant.
[1826] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-2.0 (m, 8H),
2.18-3.53 (m, 20H), 4.25 (m, 1H), 4.45 (m, 1H), 6.69 (d, 2H), 6.76
(s, 1H), 7.07 (s, 1H), 7.15 (s, 1H), 7.22 (d, 1H), 7.63 (s,
1H).
Example 10
(8S,11S,14S)-14-Amino-N-{(1S)-4-amino-1-[({(4R)-4-amino-6-[(2-aminoethyl)a-
mino]-6-oxohexyl}amino)carbonyl]butyl}-1-(3-aminopropyl)-5,17-dihydroxy-10-
,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,-
18-hexaene-8-carboxamide pentahydrochloride
[1827] ##STR381##
[1828] 6 mg (0.006 mmol) of
tert-butyl{3-[(8S,11S,14S)-8-({[(1S)-4-amino-1-({[(4S)-4,8-diamino-6-oxoo-
ctyl]amino}carbonyl)butyl]amino}carbonyl)-14-[(tert-butoxycarbonyl)amino]--
5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo-[14.3.1.1.sup.2,6]henicosa-1-
(20),2(21),3,5,16,18-hexaen-11-yl]propyl}carbamate
tris(hydroacetate) (Example 205A) are added into 0.3 ml of a 4N
solution of hydrogen chloride in dioxane and stirred at RT for 30
min. The reaction solution is concentrated, coevaporated with
dichloromethane several times and dried under high vacuum.
[1829] Yield: 5 mg (85% of theory)
[1830] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-1.7 (m, 13H),
2.52-3.75 (m, 17H), 4.22 (m, 1H), 4.45 (m, 1H), 4.50 (m, 1H), 4.83
(m, 1H), 6.91 (d, 2H), 6.97 (s, 1H), 7.27 (s, 1H), 7.36 (d, 1H),
7.43 (d, 1H).
Example 11
(8S,11S,14S)-14-Amino-N-{(4S)-4-amino-6-[(2-aminoethyl)amino]-6-oxohexyl}--
1-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.s-
up.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamide
tetrahydrochloride
[1831] ##STR382##
[1832] 8 mg (0.010 mmol) of
tert-butyl{3-[(8S,11S,14S)-8-[({(4S)-4-amino-6-[(2-aminoethyl)amino]-6-ox-
ohexyl}amino)carbonyl]-14-[(tert-butoxycarbonyl)amino]-5,17-dihydroxy-10,1-
3-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-
-hexaen-11-yl]propyl}carbamate bis(hydroacetate) (Example 206A) are
added into 0.4 ml of a 4N solution of hydrogen in dioxane chloride
and stirred at RT for 30 min. The reaction solution is
concentrated, coevaporated with dichloromethane several times and
dried under high vacuum.
[1833] Yield: quant.
[1834] LC-MS (Method 12): R.sub.t=0.20 min.
[1835] MS (EI): m/z=627 (M+-4HCl+H).sup.+
[1836] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.19 (m, 1H), 1.25
(m, 2H), 1.5-1.9 (m, 8H), 2.53-2.71 (m, 1H), 2.79-3.64 (m, 15H),
4.44 (m, 1H), 6.90 (d, 2H), 6.97 (s, 1H), 7.27 (s, 1H), 7.36 (d,
1H), 7.43 (d, 1H).
Example 12
(8S,11S,14S)-14-Amino-N-((1S)-3-amino-1-{[(2-aminoethyl)amino]carbonyl}pro-
pyl)-1-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.-
1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamide
tetrahydrochloride
[1837] ##STR383##
[1838] 15 mg (0.019 mmol) of
tert-butyl{3-[(8S,11S,14S)-8-{[((1S)-3-amino-1-{[(2-aminoethyl)amino]carb-
onyl}propyl)amino]carbonyl}-14-[(tert-butoxycarbonyl)amino]-5,17-dihydroxy-
-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,-
16,18-hexaen-11-yl]propyl}carbamate bis(hydroacetate) (Example
207A) are added into 1 ml of a 4N solution of hydrogen chloride in
dioxane and stirred at RT for 20 min. The reaction solution is
concentrated, coevaporated with dichloromethane several times and
dried under high vacuum.
[1839] Yield: 12 mg (86% of theory)
[1840] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.6-2.0 (m, 5H),
2.07-2.30 (m, 2H), 2.84-3.23 (m, 10H), 3.33 (m, 1H), 3.51-3.83 (m,
4H), 4.50 (m, 1H), 4.90 (m, 1H), 6.98 (d, 2H), 7.06 (s, 1H), 7.35
(s, 1H), 7.45 (d, 1H), 7.52 (d, 1H).
Example 13
(8S,11S,14S)-14-Amino-N-((1S)-4-amino-1-{[((1S)-3-amino-1-{[(2-aminoethyl)-
amino]carbonyl}propyl)amino]carbonyl}butyl)-11-(3-aminopropyl)-5,17-dihydr-
oxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3-
,5,16,18-hexaene-8-carboxamide pentahydrochloride
[1841] ##STR384##
[1842] 7 mg (0.008 mmol) of
tert-butyl{3-[(8S,11S,14S)-8-{[((1S)-4-amino-1-{[((1S)-3-amino-1-{[(2-ami-
noethyl)amino]carbonyl}propyl)amino]carbonyl}butyl)amino]carbonyl}-14-[(te-
rt-butoxycarbonyl)amino]-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.-
3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaen-11-yl]propyl}carbamate
tris(hydroacetate) (Example 208A) are added into 0.6 ml of a 4N
solution of hydrogen chloride in dioxane and stirred at RT for 30
min. The reaction solution is concentrated, coevaporated with
dichloromethane several times and dried under high vacuum.
[1843] Yield: 6.1 mg (89% of theory)
[1844] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-2.3 (m, 11H),
2.80-3.70 (m, 14H), 4.29-4.48 (m, 3H), 4.85 (m, 1H), 6.91 (d, 2H),
6.97 (s, 1H), 7.27 (s, 1H), 7.36 (d, 1H), 7.44 (d, 1H).
Example 14
(8S,11S,14S)-14-Amino-N-((1S)-1-{[(2-aminoethyl)amino]carbonyl}-4-{[amino(-
imino)methyl]amino}butyl)-11-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,-
12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-
-carboxamide pentahydrochloride
[1845] ##STR385##
[1846] 5.3 mg (0.005 mmol) of
tert-butyl{3-[(8S,11S,14S)-8-{[((1S)-1-{[(2-aminoethyl)amino]carbonyl}-4--
{[amino(imino)methyl]amino}butyl)amino]carbonyl}-14-[(tert-butoxycarbonyl)-
amino]-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]heni-
cosa-1(20),2(21),3,5,16,18-hexaen-11-yl]propyl}carbamate
di(hydrotrifluoroacetate) (Example 209A) are added into 0.4 ml of a
4N solution of hydrogen chloride in dioxane and stirred at RT for
30 min. The reaction solution is concentrated, coevaporated with
dichloromethane several times and dried under high vacuum.
[1847] Yield: quant.
[1848] LC-MS (Method 20): R.sub.t=1.75 min.
[1849] MS (EI): m/z=655 (M-5HCl+H).sup.+
[1850] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-1.9 (m, 8H),
2.81-3.75 (m, 13H), 4.25 (m, 1H), 4.44 (m, 1H), 4.84 (m, 1H), 6.86
(d, 1H), 6.90 (d, 2H), 6.97 (s, 1H), 7.28 (s, 1H), 7.36 (d, 1H),
7.45 (m, 2H).
Example 15
N.sup.2-{[(8S,11S,14S)-14-Amino-1-(3-aminopropyl)-5,17-dihydroxy-10,13-dio-
xo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexa-
en-8-yl]carbonyl}-N.sup.1-[(2S)-2,5-diaminopentyl]-L-glutamamide
tetrahydrochloride
[1851] ##STR386##
[1852] 7 mg (0.01 mmol) of the compound from Example 180A are mixed
with 0.1 ml of 4N hydrogen chloride in dioxane. The mixture is
stirred at RT for 4 h. The mixture is then concentrated in vacuo,
and the residue is dried under high vacuum.
[1853] Yield: 4.2 mg (78% of theory).
[1854] MS (ESI): m/z=684 (M-4HCl+H).sup.+.
Example 16
(8S,11S,14S)-14-Amino-N-[(1S)-4-amino-1-({[(2S)-2,5-diaminopentyl]amino}ca-
rbonyl)butyl]-1-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diazatricy-
clo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamide
tetrahydrochloride
[1855] ##STR387##
[1856] 40 mg (0.034 mmol) of the compound from Example 177A are
dissolved at 0.degree. C. in 1 ml of dioxane. Then 0.5 ml of a 4N
hydrogen chloride solution in dioxane are added and the mixture is
stirred at RT for 2 h. The mixture is evaporated to dryness in
vacuo and the residue is dried to constant weight under high
vacuum.
[1857] Yield: 26 mg (88% of theory).
[1858] MS (ESI): m/z=670 (M-4HCl+H).sup.+.
[1859] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.45-1.95 (m, 12H),
2.8-3.05 (m, 6H), 3.1-3.4 (m, 4H), 3.42 (m.sub.c, 2H), 3.54
(m.sub.c, 1H), 3.97 (m.sub.c, 1H), 4.41 (m.sub.c, 1H), 4.6-4.8 (m,
2H, under D.sub.2O), 6.83-6.9 (m, 2H), 6.95 (s, 1H), 7.24 (s, 1H),
7.32 (d, 1H), 7.4 (d, 1H).
Example 17
(8S,11S,14S)-14-Amino-11-(3-aminopropyl)-N-(2-{[(2S)-2,5-diaminopentyl]ami-
no}-2-oxoethyl)-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup-
.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamide
tetrahydrochloride
[1860] ##STR388##
[1861] 11.5 mg (0.011 mmol) of the compound from Example 178A are
dissolved at 0.degree. C. in 1 ml of dioxane. Then, 0.2 ml of a 4N
hydrogen chloride solution in dioxane are added and the mixture is
stirred at RT for 2 h. The mixture is evaporated to dryness in
vacuo, and the residue is dried to constant weight under high
vacuum.
[1862] Yield: 8.5 mg (99% of theory).
[1863] MS (ESI): m/z=613 (M-4HCl+H).sup.+.
[1864] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-1.9 (m, 8H),
2.75-3.05 (m, 6H), 3.24 (m.sub.c, 1H), 3.3-3.43 (m, 2H), 3.45-3.55
(m, 2H), 3.87-3.97 (m, 2H), 4.41 (m.sub.c, 1H), 4.7 (m, 1H, under
D.sub.2O), 4.83 (m.sub.c, 1H), 6.83-6.9 (m, 2H), 6.95 (s, 1H), 7.23
(s, 1H), 7.3 (d, 1H), 7.4 (d, 1H).
Example 18
(8S,11S,14S)-14-Amino-1-(3-aminopropyl)-N-[(1S)-2-{[(2S)-2,5-diaminopentyl-
]amino}-1-(hydroxymethyl)-2-oxoethyl]-5,17-dihydroxy-10,13-dioxo-9,12-diaz-
atricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carbox-
amide tetrahydrochloride
[1865] ##STR389##
[1866] 18.4 mg (0.018 mmol) of the compound from Example 179A are
dissolved at 0.degree. C. in 1 ml of dioxane. Then 0.26 ml of a 4N
hydrogen chloride solution in dioxane are added and the mixture is
stirred at RT for 4 h. The mixture is evaporated to dryness in
vacuo, and the residue is dried to constant weight under high
vacuum.
[1867] Yield: 13 mg (93% of theory).
[1868] MS (ESI): m/z=643 (M-4HCl+H).sup.+.
[1869] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.4-1.85 (m, 8H),
2.75-3.05 (m, 6H), 3.26 (m.sub.c, 1H), 3.35-3.85 (m, 7H), 4.41
(m.sub.c, 1H), 4.7 (m, 1H, under D.sub.2O), 4.87 (m.sub.c, 1H),
6.85-6.92 (m, 2H), 6.96 (s, 1H), 7.22 (s, 1H), 7.32 (d, 1H), 7.4
(d, 1H).
Example 19
N.sup.2-{[(8S,11S,14S)-14-Amino-1-(3-aminopropyl)-5,17-dihydroxy-10,13-dio-
xo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexa-
en-8-yl]carbonyl}-L-ornithyl-N-(2-aminoethyl)-L-ornithinamide
pentahydrochloride
[1870] ##STR390##
[1871] 8.5 mg (0.008 mmol) of the compound from Example 210A are
mixed with 0.2 ml of a 4N hydrogen chloride solution in dioxane and
stirred at RT for 3 h. The mixture is evaporated to dryness in
vacuo, and the residue is dried to constant weight under high
vacuum.
[1872] Yield: quant.
[1873] MS (ESI): m/z=727 (M-5HCl+H).sup.+.
[1874] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.55-1.95 (m, 12H),
2.75-3.15 (m, 10H), 3.25 (m.sub.c, 1H), 3.35-3.75 (m, 3H),
4.25-4.35 (m, 2H), 4.41 (m.sub.c, 1H), 4.7-4.9 (m, 2H, under
D.sub.2O), 6.91 (m.sub.c, 2H), 6.98 (s, 1H), 7.28 (s, 1H), 7.38 (d,
1H), 7.45 (d, 1H).
[1875] Examples 20 to 39 listed in the following table are prepared
in analogy to the method of Example 1 as hydrochloride or
hydrotrifluoroacetate salt according to the respective method of
isolation. TABLE-US-00016 Example Precursor Analytical No. example
Structure data 20 221A ##STR391## LC-MS (Method 20): R.sub.t =1.87
min. MS (EI): m/z = 556 (M - 3HCl + H).sup.+. .sup.1H-NMR (400 MHz,
D.sub.2O): .delta. = 1.55-1.90 (m, 4 H), 2.8-2.97 (m, 3 H),
3.0-3.15 (m, 3 H), 3.27 (m.sub.c, 1 H), 3.45-3.75 (m, 5 H), # 4.40
(m.sub.c, 1 H), 4.8 (m.sub.c, 1 H, under D.sub.2O), 4.72 (m.sub.c,
1 H), 6.8- 6.9 (m, 2 H), 6.94 (s, 1 H), 7.23 (s, 1 H), 7.34 (d, 1
H), 7.42 (d, 1 H). 21 184A ##STR392## MS (EI): m/z = 613 (M - 4HCl
+ H).sup.+.sup.1H-NMR (400 MHz, D.sub.2O): .delta. = 1.45-1.95 (m,
6 H), 2.82-3.2 (m, 8 H), 3.25-3.45 (m, 2 H), 3.47-3.75 (m, 4 H),
3.94 (m.sub.c, 1 H), 4.42 (M.sub.c, 1 H), 4.68 (m, 1 H, under
D.sub.2O), 4.77 (m.sub.c, 1 H) # 6.83-6.92 (m, 2 H), 6.97 (s, 1 H),
7.25 (s, 1 H), 7.36 (d, 1 H), 7.43 (d, 1 H). 22 185A ##STR393##
LC-MS (Method 20): R.sub.t =1.83 min. MS (EI): m/z = 685 (M - 4HCl
+ H).sup.+. .sup.1H-NMR (400 MHz, D.sub.2O): .delta. = 1.2-1.9 (m,
14 H), 2.7-3.1 (m, 5 H), 3.1-3.3 (m, 4 H), 3.5- 3.6 (m, 2 H), 3.72
(m.sub.c, 2 H), 3.88 # (m.sub.c, 2 H), 4.18 (m.sub.c, 1 H), 4.41
(m.sub.c, 1 H), 4.78 (m.sub.c, 1 H), 6.83- 6.92 (m, 2 H), 6.97 (s,
1 H), 7.25 (s, 1 H), 7.36 (d, 1 H), 7.43 (d, 1 H). 23 187A
##STR394## MS (EI): m/z = 643 (M - 4HCl + H).sup.+. .sup.1H-NMR
(400 MHz, D.sub.2O): .delta. = 1.5-2.0 (m, 8 H), 2.7-3.1 (m, 6 H),
3.22 (m.sub.c, 1 H), 3.3-3.8 (m, 5 H), 3.9-4.05 (m, 2 H), 4.4
(m.sub.c, 1 H), 4.6-4.8 (m, 2 H under # D.sub.2O), 6.8-6.93 (m,
2H), 6.96 (s, 1 H), 7.23 (s, 1 H), 7.34 (d, 1 H), 7.42 (d, 1 H). 24
187A ##STR395## LC-MS (Method 12): R.sub.t =0.238 min. MS (EI): m/z
= 613 (M - 3HCl + H).sup.+ 25 216A ##STR396## LC-MS (Method 20):
R.sub.t =2.17 min. MS (EI): m/z = 586 (M - 3HCl + H).sup.+ 26 217A
##STR397## LC-MS (Method 20): R.sub.t =2.03 min. MS (EI): m/z = 644
(M - 3HCl + H).sup.+.sup.1H-NMR (400 MHz, D.sub.2O): .delta. =
1.6-1.7 (m, 7 H), 2.80-3.78 (m, 15 H), 4.24 (m, 1 H), 4.43 (m, 1
H), 4.80 (m, 1 H), 6.90 (d, # 2 H), 6-97 (s, 1 H), 7.28 (s, 1 H),
7.36 (d, 1 H), 7.43 (d, 1 H) 27 218A ##STR398## LC-MS (Method 17):
R.sub.t =0.24 min. MS (EI): m/z = 700 (M - 4HCl +
H).sup.+.sup.1H-NMR (400 MHz, D.sub.2O): .delta. = 1.5-1.9 (m, 9
H), 2.81-3.83 (m, 20 H), 4.32-4.39 (m, 2 H), 4.44 (m, 1 H), 4.84
(m, 1 H), # 6.90 (d, 2 H), 6.97 *s, 1 H), 7.28 (s, 1 H), 7.36 (d, 1
H), 7.44 (d, 1 H). 28 219A ##STR399## LC-MS (Method 20): R.sub.t
=1.82 min. MS (EI): m/z = 671 (M - 4TFA + H).sup.+ 29 195A
##STR400## .sup.1H-NMR (400 MHz, D.sub.2O): .delta. = 1.58-1.89 (m,
4 H), 2.02- 2.16 (m, 2 H), 2.80-3.75 (m, 15 H), 3.97 (m, 2 H), 4.44
(m, 1 H), 6.90 (d, 2 H), 6.98 (s, 1 H), # 7.26 (s, 1 H), 7.37 (d, 1
H), 7.44 (d, 1 H). 30 196A ##STR401## LC-MS (Method 20): R.sub.t
=0.45 min. MS (EI): m/z = 628 (M - 5HCl + H).sup.+.sup.1H-NMR (400
MHz, D.sub.2O): .delta. = 1.57-1.87 (m, 4 H), 2.09 (m, 1 H), 2.20
(m, 1 H), 2.85-3.76 (m, 15 H), 4.01 (m, 1 H), 4.45 (s, # 1 H), 4.50
(m, 1 H), 6.90 (d, 2 H), 6.98 (s, 1 H), 7.26 (s, 1 H), 7.37 (d, 1
H), 7.44 (d, 1 H). 31 220A ##STR402## LC-MS (Method 20): R.sub.t
=1.80 min. MS (EI): m/z = 585 (M - 3HCl + H).sup.+.sup.1H-NMR (400
MHz, D.sub.2O): .delta. = 1.53-1.89 (m, 4 H), 2.81- 3.46 (m, 10 H),
3.56 (m, 1 H), 3.67 (s, 2 H), 3.84-3.93 (m, 2 H), 4.05 (m, 1 H),
4.44 (m, 1 H), # 6.90 (d, 2 H), 6.97 (s, 1 H), 7.27 (s, 1 H), 7.36
(d, 1 H), 7.43 (d, 1 H). 32 182A ##STR403## LC-MS (Method 20):
R.sub.t =1.68 min. MS (EI): m/z = 556 (M - 3HCl +
H).sup.+.sup.1H-NMR (400 MHz, D.sub.2O): .delta. = 1.55-1.85 (m, 4
H), 2.81- 3.05 (m, 4 H), 3.15-3.7 (m, 9 H), 4.42 (m.sub.c, 1 H),
4.6-4.8 (m, 2 H under D.sub.2O), 6.88 # (d, 2 H), 6.95 (s, 1 H),
7.26 (s, 1 H), 7.35 (d, 1 H), 7.41 (d, 1 H). 33 199A ##STR404## MS
(EI): m/z = 719 (M - 4HCl + H).sup.+.sup.1H-NMR (400 MHz,
D.sub.2O): .delta. = 1.45-1.75 (m, 8 H), 2.7-3.05 (m, 6 H), 3.15
(m.sub.c, 1 H), 3.26 (m.sub.c, 1 H), 3.45 (m.sub.c, 2 H), 3.55
(m.sub.c, 1 H), 4.42 (m.sub.c, 1 H), 4.48 (m.sub.c,1 H), 4.6-4.8 #
(m, 2 H, under D.sub.2O), 6.75 (d, 2 H), 6.88 (d, 2 H), 6.94 (s, 1
H), 7.07 (d, 2 H), 7.2 (s, 1 H), 7.33 (d, 1 H), 7.42 (d, 1 H). 34
197A ##STR405## LC-MS (Method 20): R.sub.t =1.72 min. MS (EI): m/z
= 643 (M - 3HCl + H).sup.+.sup.1H-NMR (400 MHz, D.sub.2O): .delta.
= 1.55-1.85 (m, 4 H), 2.6-3.35 (m, 11 H), 3.5-3.75 (m, 2 H), 3.92
(m.sub.c, 1 H), 4.41 (m.sub.c, 1 H), 4.48 # (m.sub.c, 1 H), 4.7 (m,
1 H, under D.sub.2O), 4.78 (d, 1 H), 6.87 (d, 2 H), 6.93 (s, 1 H),
7.23 (s, 1 H), 7.32 (d, 1 H), 7.4 (d, 1 H). 35 198A ##STR406## MS
(EI): m/z = 684 (M - 4HCl + H).sup.+ 36 200A ##STR407## LC-MS
(Method 20): R.sub.t =1.74 min. MS (EI): m/z = 643 (M - 3HCl +
H).sup.+.sup.1H-NMR (400 MHz, D.sub.2O): .delta. = 1.45-1.85 (m, 4
H), 2.65-3.1 (m, 7 H), 3.2-3.4 (m, 4 H), 3.5- 3.75 (m, 2 H), 3.92
(m.sub.c, 1 H), # 4.41 (m.sub.c, 1 H), 4.48 (m.sub.c, 1 H), 4.7 (m,
1 H, under D.sub.2O), 4.78 (d, 1 H), 6.87 (d, 2 H), 6.93 (s, 1 H),
7.23 (s, 1 H), 7.32 (d, 1 H), 7.4 (d, 1 H). 37 201A ##STR408## MS
(EI): m/z = 670 (M - 4HCl + H).sup.+ 38 202A ##STR409## MS (EI):
m/z = 656 (M - 4HCl + H).sup.+ 39 203A ##STR410## MS (EI): m/z =
656 (M - 4TFA + H).sup.+
Example 40
(8S,11S,14S)-14-Amino-N-((4S)-4-amino-6-{[(2S)-2,5-diaminopentyl]amino}-6--
oxohexyl)-1-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[-
14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamide
pentahydrochloride
[1876] ##STR411##
[1877] 0.32 ml of a 4N solution of hydrogen chloride in dioxane are
added to a solution of 25 mg (0.021 mmol) of the compound from
Example 262A in 1 ml of dioxane at 0.degree. C. After 2 h at RT,
the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is dried to
constant weight under high vacuum.
[1878] Yield: 17.8 mg (96% of theory)
[1879] MS (ESI): m/z=684 (M-5HCl+H).sup.+.
[1880] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.4-1.9 (m, 12H),
2.5-3.2 (m, 10H), 3.3-3.7 (m, 6H), 4.41 (m.sub.c, 1H), 4.7-4-9 (m,
2H, under D.sub.2O), 6.85-6.92 (m, 2H), 6.96 (s, 1H), 7.28 (s, 1H),
7.38 (d, 1H), 7.44 (d, 1H).
Example 41
(8S,11S,14S)-14-Amino-N-((1S)-1-(aminomethyl)-2-{[(2S)-2,5-diaminopentyl]a-
mino}-2-oxoethyl)-11-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12
diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8
carboxamide pentahydrochloride
[1881] ##STR412##
[1882] 0.62 ml of a 4N solution of hydrogen chloride in dioxane are
added to a solution of 47 mg (0.021 mmol) of the compound from
Example 269A in 1 ml of dioxane at 0.degree. C. After 3 h at RT,
the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is dried to
constant weight under high vacuum.
[1883] Yield: 33 mg (98% of theory)
[1884] MS (ESI): m/z=642 (M-5HCl+H).sup.+.
[1885] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-1.9 (m, 8H),
2.8-3.1 (m, 6H), 3.2-3.7 (m, 8H), 4.41 (m.sub.c, 1H), 4.7-4.9 (m,
2H, under D.sub.2O), 6.91 (m.sub.c, 2H), 7.0 (s, 1H), 7.27 (s, 1H),
7.38 (d, 1H), 7.45 (d, 1H).
Example 42
(8S,11S,14S)-14-Amino-N-[(1S)-4-amino-1-(2-{[(2S)-2,5-diaminopentyl]amino}-
-2-oxoethyl)butyl]-11-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diaz-
atricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carbox-
amide pentahydrochloride
[1886] ##STR413##
[1887] 0.22 ml of a 4N solution of hydrogen chloride in dioxane are
added to a solution of 17 mg (0.014 mmol) of the compound from
Example 270A in 1 ml of dioxane at 0.degree. C. After 3 h at RT,
the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is dried to
constant weight under high vacuum.
[1888] Yield: 12 mg (99% of theory)
[1889] MS (ESI): m/z=684 (M-5HCl+H).sup.+.
[1890] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.4-1.9 (m, 12H),
2.37 (m.sub.c, 1H), 2.55 (m.sub.c, 1H), 2.7-3.2 (m, 7H), 3.2-3.7
(m, 6H), 4.22 (m.sub.c, 1H), 4.42 (m.sub.c, 1H), 4.7-4.9 (m, 2H,
under D.sub.2O), 6.89 (m.sub.c, 2H), 6.96 (s, 1H), 7.27 (s, 1H),
7.36 (d, 1H), 7.42 (d, 1H).
Example 43
(8S,11S,14S)-14-Amino-N-((1S)-4-amino-1-{[(2-aminoethyl)amino]carbonyl}but-
yl)-1-[(2R)-3-amino-2-hydroxypropyl]-5,17-dihydroxy-10,3-dioxo-9,12-diazat-
ricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxam-
ide tetrahydrochloride
[1891] ##STR414##
[1892] 0.83 ml of a 4N solution of hydrogen chloride in dioxane are
added to 57 mg (0.014 mmol) of the compound from Example 271A at
0.degree. C. After 3 h at RT, the reaction solution is concentrated
in vacuo and coevaporated with dichloromethane several times. The
remaining solid is dried to constant weight under high vacuum.
[1893] Yield: 44 mg (99% of theory)
[1894] MS (ESI): m/z=629 (M-4HCl+H).sup.+.
[1895] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-2.1 (m, 6H),
2.7-3.2 (m, 8H), 3.28 (m.sub.c, 1H), 3.37-3.62 (m, 3H), 3.86
(m.sub.c, 1H), 4.27 (m.sub.c, 1H), 4.42 (m.sub.c, 1H), 4.7-4.9 (m,
2H, under D.sub.2O), 6.91 (m.sub.c, 2H), 6.99 (s, 1H), 7.29 (s,
1H), 7.38 (d, 1H), 7.44 (d, 1H).
Example 44
(8S,11S,14S)-14-Amino-N-[(1S)-4-amino-1-({[(3S)-3-amino-4-hydroxybutyl]ami-
no}carbonyl)butyl]-1-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diaza-
tricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxa-
mide tetrahydrochloride
[1896] ##STR415##
[1897] 0.27 ml of a 4N solution of hydrogen chloride in dioxane are
added to 19 mg (0.018 mmol) of the compound from Example 272A at
0.degree. C. After 3 h at RT, the reaction solution is concentrated
in vacuo and coevaporated with dichloromethane several times. The
remaining solid is dried to constant weight under high vacuum.
[1898] Yield: 14 mg (97% of theory)
[1899] MS (ESI): m/z=657 (M-4HCl+H).sup.+.
[1900] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.55-1.95 (m, 10H),
2.75-3.1 (m, 4H), 3.2-3.4 (m, 4H), 3.5-3.6 (m, 2H), 3.7-3.8 (m,
2H), 3.93 (m.sub.c, 1H), 4.21 (m.sub.c, 1H), 4.45 (m.sub.c, 1H),
4.7-4.9 (m, 2H, under D.sub.2O), 6.91 (m.sub.c, 2H), 6.98 (s, 1H),
7.28 (s, 1H), 7.38 (d, 1H), 7.44 (d, 1H).
Example 45
(8S,11S,14S)-14-Amino-N-{1-(2-aminoethyl)-3-[(2-aminoethyl)amino]-3-oxopro-
pyl}-1-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.-
1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamide
tetrahydrochloride
[1901] ##STR416##
[1902] 0.41 ml of a 4N solution of hydrogen chloride in dioxane are
added to a solution of 28 mg (0.028 mmol) of the compound from
Example 273A in 1 ml of dioxane at 0.degree. C. After 3 h at RT,
the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is dried to
constant weight under high vacuum.
[1903] Yield: 12 mg (58% of theory)
[1904] MS (ESI): m/z=627 (M-4HCl+H).sup.+.
[1905] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-2.0 (m, 6H),
2.3-2.65 (m, 2H), 2.7-3.2 (m, 8H), 3.3-3.8 (m, 4H), 4.28 (m.sub.c,
1H), 4.42 (m.sub.c, 1H), 4.7-4.9 (m, 2H, under D.sub.2O), 6.90
(m.sub.c, 2H), 6.96 (s, 1H), 7.27 (s, 1H), 7.36 (d, 1H), 7.43 (d,
1H).
Example 46
(8S,11S,14S)-14-Amino-11-(3-aminopropyl)-N-(3-{[(2S)-2,5-diaminopentyl]ami-
no}-3-oxopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.su-
p.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamide
tetrahydrochloride
[1906] ##STR417##
[1907] 0.30 ml of a 4N solution of hydrogen chloride in dioxane are
added to a solution of 20.7 mg (0.020 mmol) of the compound from
Example 274A in 1 ml of dioxane at 0.degree. C. After 3 h at RT,
the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is dried to
constant weight under high vacuum.
[1908] Yield: 15 mg (98% of theory)
[1909] MS (ESI): m/z=627 (M-4HCl+H).sup.+.
[1910] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-1.9 (m, 8H),
2.35-2.55 (m, 2H), 2.7-3.2 (m, 7H), 3.3-3.7 (m, 6H), 4.42 (m.sub.c,
1H), 4.7-4.9 (m, 2H, under D.sub.2O), 6.90 (m.sub.c, 2H), 6.96 (s,
1H), 7.25 (s, 1H), 7.35 (d, 1H), 7.42 (d, 1H).
Example 47
(8S,11S,14S)-14-Amino-N-(1-(2-aminoethyl)-3-{[(2S)-2,5-diaminopentyl]amino-
}-3-oxopropyl)-11-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diazatri-
cyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamid-
e pentahydrochloride
[1911] ##STR418##
[1912] 0.355 ml of a 4N solution of hydrogen chloride in dioxane
are added to a solution of 27.7 mg (0.024 mmol) of the compound
from Example 275A in 1 ml of dioxane at 0.degree. C. After 3 h at
RT, the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is dried to
constant weight under high vacuum.
[1913] Yield: 20 mg (99% of theory)
[1914] MS (ESI): m/z=670 (M-5HCl+H).sup.+.
[1915] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-1.9 (m, 10H),
2.3-2.7 (m, 2H), 2.7-3.7 (m, 13H), 4.24 (m.sub.c, 1H), 4.42
(m.sub.c, 1H), 4.7-4.9 (m, 2H, under D.sub.2O), 6.90 (m.sub.c, 2H),
6.96 (s, 1H), 7.26 (s, 1H), 7.36 (d, 1H), 7.43 (d, 1H).
Example 48
(8S,11S,14S)-14-Amino-N-[(1S)-4-amino-1-({[(4S)-4-amino-5-hydroxypentyl]am-
ino}carbonyl)butyl]-11-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-dia-
zatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carbo-
xamide tetrahydrochloride
[1916] ##STR419##
[1917] 0.11 ml of a 4N solution of hydrogen chloride in dioxane are
added to 7.8 mg (0.007 mmol) of the compound from Example 276A at
0.degree. C. After 3 h at RT, the reaction solution is concentrated
in vacuo and coevaporated with dichloromethane several times. The
remaining solid is dried to constant weight under high vacuum.
[1918] Yield: 5.8 mg (99% of theory)
[1919] MS (ESI): m/z=671 (M-4HCl+H).sup.+.
[1920] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.4-1.95 (m, 12H),
2.75-3.4 (m, 10H), 3.5-3.8 (m, 3H), 4.20 (m.sub.c, 1H), 4.44
(m.sub.c, 1H), 4.7-4.9 (m, 2H, under D.sub.2O), 6.91 (m.sub.c, 2H),
6.98 (s, 1H), 7.28 (s, 1H), 7.38 (d, 1H), 7.45 (d, 1H).
Example 49
(8S,11S,14S)-14-Amino-N-[(1S)-4-amino-1-({[(S)-2-amino-1-(hydroxymethyl)et-
hyl]amino}carbonyl)butyl]-1-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,1-
2-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8--
carboxamide tetrahydrochloride
[1921] ##STR420##
[1922] 0.56 ml of a 4N solution of hydrogen chloride in dioxane are
added to a solution of 39 mg (0.037 mmol) of the compound from
Example 277A in 1 ml of dioxane at 0.degree. C. After 3 h at RT,
the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is dried to
constant weight under high vacuum.
[1923] Yield: 25 mg (85% of theory)
[1924] MS (ESI): m/z=643 (M-4HCl+H).sup.+.
[1925] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-1.9 (m, 8H),
2.83 (m.sub.c, 1H), 2.9-3.1 (m, 6H), 3.15-3.3 (m, 2H), 4.19
(m.sub.c, 1H), 4.29 (m.sub.c, 1H), 4.43 (m.sub.c, 1H), 4.7-4.9 (m,
2H, under D.sub.2O), 6.89 (m.sub.c, 2H), 6.96 (s, 1H), 7.26 (s,
1H), 7.36 (d, 1H), 7.43 (d, 1H).
Example 50
(8S,11S,14S)-14-Amino-N-[(1S)-4-amino-1-({[(2S)-2,5-diaminopentyl]amino}ca-
rbonyl)butyl]-11-[(2R)-3-amino-2-hydroxypropyl]-5,17-dihydroxy-10,13-dioxo-
-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaen-
e-8-carboxamide pentahydrochloride
[1926] ##STR421##
[1927] 0.30 ml of a 4N solution of hydrogen chloride in dioxane are
added to a solution of 24 mg (0.02 mmol) of the compound from
Example 278A in 1 ml of dioxane at 0.degree. C. After 3 h at RT,
the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is dried to
constant weight under high vacuum.
[1928] Yield: 17 mg (97% of theory)
[1929] MS (ESI): m/z=686 (M-5HCl+H).sup.+.
[1930] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.3-1.9 (m, 10H),
2.5-2.95 (m, 7H), 2.95-3.25 (m, 3H), 3.3-3.5 (m, 2H), 3.62
(m.sub.c, 1H), 4.06 (m.sub.c, 1H), 4.18 (m.sub.c, 1H), 4.7-4.9 (m,
2H, under D.sub.2O), 6.67 (m.sub.c, 2H), 6.75 (s, 1H), 7.05 (s,
1H), 7.14 (d, 1H), 7.21 (d, 1H).
Example 51
(8S,11S,14S)-14-Amino-N-{3-[(2-aminoethyl)amino]-3-oxopropyl}-11-(3-aminop-
ropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]heni-
cosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamide
trihydrochloride
[1931] ##STR422##
[1932] 0.36 ml of a 4N solution of hydrogen chloride in dioxane are
added to a solution of 21 mg (0.024 mmol) of the compound from
Example 279A in 1 ml of dioxane at 0.degree. C. After 3 h at RT,
the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is dried to
constant weight under high vacuum.
[1933] Yield: 16 mg (98% of theory)
[1934] LC-MS (Method 23): R.sub.t=1.84 min.
[1935] MS (ESI): m/z=570 (M-3HCl+H).sup.+.
[1936] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-1.9 (m, 4H),
2.3-2.6 (m, 2H), 2.7-3.2 (m, 7H), 3.3-3.7 (m, 5H), 4.42 (m.sub.c,
1H), 4.7-4.9 (m, 2H, under D.sub.2O), 6.89 (m.sub.c, 2H), 6.95 (s,
1H), 7.25 (s, 1H), 7.34 (d, 1H), 7.42 (d, 1H).
Example 52
rel-(8S,11S,14S)-14-Amino-N-((1S)-1-{[(3-amino-2-hydroxypropyl)amino]carbo-
nyl}-4-{[amino(imino)methyl]amino}butyl)-11-(3-aminopropyl)-5,17-dihydroxy-
-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,-
16,18-hexaene-8-carboxamide tetrahydrochloride
[1937] ##STR423##
[1938] 0.52 ml of a 4N solution of hydrogen chloride in dioxane are
added to a solution of 41 mg (0.035 mmol) of the compound from
Example 280A in 1 ml of dioxane at 0.degree. C. After 3 h at RT,
the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is dried to
constant weight under high vacuum.
[1939] Yield: 28.5 mg (99% of theory)
[1940] MS (ESI): m/z=685 (M-4HCl+H).sup.+.
[1941] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-1.9 (m, 8H),
2.7-3.4 (m, 11H), 3.5-3.7 (m, 1H), 3.97 (m.sub.c, 1H), 4.28
(m.sub.c, 1H), 4.47 (m.sub.c, 1H), 4.7-4.9 (m, 2H, under D.sub.2O),
6.94 (m.sub.c, 2H), 7.01 (s, 1H), 7.31 (s, 1H), 7.40 (d, 1H), 7.48
(d, 1H).
Example 53
rel-(8S,11S,14S)-14-Amino-11-(3-aminopropyl)-5,17-dihydroxy-N-[2-hydroxy-3-
-(L-ornithylamino)propyl]-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]-
henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamide
tetrahydrotrifluoroacetate
[1942] ##STR424##
[1943] 1.52 ml of a 4N solution of hydrogen chloride in dioxane are
added to a solution of 98 mg (0.101 mmol) of the compound from
Example 281A in 1 ml of dioxane at 0.degree. C. After 3 h at RT,
the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is
converted by preparative HPLC (Reprosil ODS-A, mobile phase
acetonitrile/0.2% aqueous trifluoroacetic acid 5:95.fwdarw.95:5)
into the tetra(hydrotrifluoroacetate).
[1944] Yield: 24.6 mg (22% of theory)
[1945] MS (ESI): m/z=643 (M-4TFA+H).sup.+.
[1946] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.55-2.0 (m, 8H),
2.8-3.5 (m, 11H), 3.56 (m.sub.c, 1H), 3.86 (m.sub.c, 1H), 3.97
(m.sub.c, 1H), 4.43 (m.sub.c, 1H), 4.7-4.9 (m, 2H, under D.sub.2O),
6.91 (m.sub.c, 2H), 6.98 (s, 1H), 7.27 (s, 1H), 7.36 (d, 1H), 7.44
(d, 1H).
Example 54
(8S,11S,14S)-14-Amino-N-[(1S)-4-amino-1-({[(1S)-2-amino-1-(hydroxymethyl)e-
thyl]amino}carbonyl)butyl]-11-[(2R)-3-amino-2-hydroxypropyl]-5,17-dihydrox-
y-10,13-dioxo-9,12-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5-
,16,18-hexaene-8-carboxamide tetrahydrochloride
[1947] ##STR425##
[1948] 0.31 ml of a 4N solution of hydrogen chloride in dioxane are
added to a solution of 22 mg (0.021 mmol) of the compound from
Example 282A in 1 ml of dioxane at 0.degree. C. After 3 h at RT,
the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is dried to
constant weight under high vacuum.
[1949] Yield: 16 mg (98% of theory)
[1950] MS (ESI): m/z=659 (M-4HCl+H).sup.+.
[1951] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.6-2.05 (m, 6H),
2.8-3.15 (m, 6H), 3.2-3.35 (m, 2H), 3.5-3.7 (m, 3H), 3.87 (m.sub.c,
1H), 4.21 (m.sub.c, 1H), 4.31 (m.sub.c, 1H), 4.43 (m.sub.c, 1H),
4.7-4.9 (m, 2H, under D.sub.2O), 6.92 (m.sub.c, 2H), 6.99 (s, 1H),
7.29 (s, 1H), 7.38 (d, 1H), 7.45 (d, 1H).
Example 55
(8S,11S,14S)-14-Amino-N-{(2S)-2-amino-3-[(2-aminoethyl)amino]-3-oxopropyl}-
-1-[(2R)-3-amino-2-hydroxypropyl]-5,17-dihydroxy-9-methyl-10,13-dioxo-9,12-
-diazatricyclo[14.3.1.1.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-c-
arboxamide tetrahydrochloride
[1952] ##STR426##
[1953] 2 ml of a 4N solution of hydrogen chloride in dioxane are
added to a solution of 19.4 mg (0.019 mmol) of the compound from
Example 292A in 1 ml of dioxane at 0.degree. C. After 3 h at RT,
the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is dried to
constant weight under high vacuum.
[1954] Yield: 12 mg (81% of theory)
[1955] LC-MS (Method 23): R.sub.t=0.47 min.
[1956] MS (ESI): m/z=615 (M-4HCl+H).sup.+.
[1957] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.92-2.12 (m, 2H),
2.9-3.3 (m, 8H), 3.4-3.9 (m, 7H), 4.0 (m.sub.c, 1H), 4.17 (m.sub.c,
1H), 4.51 (m.sub.c, 1H), 5.15 (m.sub.c, 1H), 5.70 (m.sub.c, 1H),
6.97 (m.sub.c, 2H), 7.03 (s, 1H), 7.10 (s, 1H), 7.49 (d, 1H), 7.56
(d, 1H).
Example 56
(8S,11S,14S)-14-Amino-N-{(2S)-2-amino-3-[(2-aminoethyl)amino]-3-oxopropyl}-
-11-(3-aminopropyl)-5,17-dihydroxy-10,13-dioxo-9,12-diazatricyclo[14.3.1.1-
.sup.2,6]henicosa-1(20),2(21),3,5,16,18-hexaene-8-carboxamide
tetrahydrochloride
[1958] ##STR427##
[1959] 2 ml of a 4N solution of hydrogen chloride in dioxane are
added to a solution of 18.2 mg (0.018 mmol) of the compound from
Example 293A in 1 ml of dioxane at 0.degree. C. After 3 h at RT,
the reaction solution is concentrated in vacuo and coevaporated
with dichloromethane several times. The remaining solid is dried to
constant weight under high vacuum.
[1960] Yield: 13 mg (98% of theory)
[1961] LC-MS (Method 23): R.sub.t=0.43 min.
[1962] MS (ESI): m/z=585 (M-4HCl+H).sup.+.
[1963] .sup.1H-NMR (400 MHz, D.sub.2O): .delta.=1.5-1.9 (m, 4H),
2.8-3.3 (m, 7H), 3.4-3.9 (m, 5H), 4.12 (m.sub.c, 1H), 4.45
(m.sub.c, 1H), 4.7-4.9 (m, 2H, under D.sub.2O), 6.91 (m.sub.c, 2H),
6.98 (s, 1H), 7.25 (s, 1H), 7.37 (d, 1H), 7.44 (d, 1H).
[1964] Examples 57 to 69 listed in the following table are prepared
in analogy to the method of Example 56. TABLE-US-00017 Example
Precursor Analytical No. example Structure data 57 287A ##STR428##
LC-MS (Method 23): R.sub.t =0.90 min. MS (EI): m/z = 640 (M - 4TFA
+ H).sup.+. 58 288A ##STR429## LC-MS (Method 17): R.sub.t =0.33
min. MS (EI): m/z = 641 (M - 4HCl + H).sup.+. 59 295A ##STR430##
LC-MS (Method 23): R.sub.t =1.86 min. MS (EI): m/z = 671 (M - 4HCl
+ H).sup.+. 60 296A ##STR431## LC-MS (Method 23): R.sub.t =1.74
min. MS (EI): m/z = 785 (M - 5HCl + H).sup.+. 61 294A ##STR432##
LC-MS (Method 23): R.sub.t =0.46 min. MS (EI): m/z = 755 (M - 5HCl
+ H).sup.+. 62 297A ##STR433## LC-MS (Method 23): R.sub.t =1.73
min. MS (EI): m/z = 643 (M - 4HCl + H).sup.+. 63 289A ##STR434##
LC-MS (Method 19): R.sub.t =0.22 min. MS (EI): m/z = 629 (M - 4HCl
+ H).sup.+. 64 283A ##STR435## LC-MS (Method 23): R.sub.t =0.51
min. MS (EI): m/z = 670 (M - 4HCl + H).sup.+. 65 284A ##STR436##
LC-MS (Method 23): R.sub.t =0.37 min. MS (EI): m/z = 727 (M - 5HCl
+ H).sup.+. 66 286A ##STR437## LC-MS (Method 23): R.sub.t =0.37
min. MS (EI): m/z = 727 (M - 5TFA + H).sup.+. 67 285A ##STR438##
LC-MS (Method 23): R.sub.t =0.37 min. MS (EI): m/z = 713 (M - 5HCl
+ H).sup.+. 68 290A ##STR439## LC-MS (Method 23): R.sub.t =0.37
min. MS (EI): m/z = 672 (M - 5HCl + H).sup.+. 69 291A ##STR440##
LC-MS (Method 23): R.sub.t =0.35 min. MS (EI): m/z = 642 (M - 5HCl
+ H).sup.+.
B. Assessment of the Physiological Activity
[1965] Abbreviations Used:
[1966] AMP adenosine monophosphate
[1967] ATP adenosine triphosphate
[1968] BHI mediumbrain heart infusion medium
[1969] CoA coenzyme A
[1970] DMSO dimethylsulfoxide
[1971] DTT dithiothreitol
[1972] EDTA ethylenediaminetetraacetic acid
[1973] KCl potassium chloride
[1974] KH.sub.2PO.sub.4 potassium dihydrogen phosphate
[1975] MgSO.sub.4 magnesium sulfate
[1976] MIC minimum inhibitory concentration
[1977] MTP microtiter plate
[1978] NaCl sodium chloride
[1979] Na.sub.2HPO.sub.4 disodium hydrogen phosphate
[1980] NHbCl ammonium chloride
[1981] NTP nucleotide triphosphate
[1982] PBS phosphate-buffered saline
[1983] PCR polymerase chain reaction
[1984] PEG polyethylene glycol
[1985] PEP phosphoenolpyruvate
[1986] Tris tris[hydroxymethyl]aminomethane
[1987] The in vitro effect of the compounds of the invention can be
shown in the following assays:
[1988] In Vitro Transcription-Translation with E. coli Extracts
[1989] In order to prepare an S30 extract logarithmically growing
Escherichia coli MRE 600 (M. Muller; Freiburg University) are
harvested, washed and employed as described for the in vitro
transcription-translation assay (Muller, M. and Blobel, G., Proc
Natl Acad Sci USA (1984) 81:7421-7425).
[1990] 1 .mu.l of cAMP (11.25 mg/ml) are additionally added per 501
of reaction mix to the reaction mix for the in vitro
transcription-translation assay. The assay mixture amounts to 105
.mu.l, with 5 .mu.l of the substance to be tested being provided in
5% DMSO. 1 .mu.g/100 .mu.l of mixture of the plasmid pBESTluc
(Promega, Germany) are used as transcription templates. After
incubation at 30.degree. C. for 60 min, 501 of luciferin solution
(20 mM tricine, 2.67 mM MgSO.sub.4, 0.1 mM EDTA, 33.3 mM DTT pH
7.8, 270 .mu.M CoA, 470 .mu.M luciferin, 530 .mu.M ATP) are added,
and the resulting bioluminescence is measured in a luminometer for
1 minute. The concentration of an inhibitor which leads to a 50%
inhibition of the translation of firefly luciferase is given as the
IC.sub.50.
[1991] In Vitro Transcription-Translation with S. aureus
Extracts
[1992] Construction of an S. aureus Luciferase Reporter Plasmid
[1993] For the construction of a reporter plasmid which can be used
in an in vitro transcription-translation assay from S. aureus the
plasmid pBESTluc (Promega Corporation, USA) is used. The E. coli
tac promoter present in this plasmid in front of the firefly
luciferase is replaced by the capA1 promoter with appropriate
Shine-Dalgamo sequence from S. aureus. The primers CAPFor
5'-CGGCCAAGCTTACTCGGATCCAG
AGTTTGCAAAATATACAGGGGATTATATATAATGGAAAACAAGAAAGGAAAATAG
GAGGTTTATATGGAAGACGCCA-3' and CAPRev 5'-GTCATCGTCGGGAAGACCTG-3' are
used for this. The primer CAPFor contains the capA1 promoter, the
ribosome binding site and the 5' region of the luciferase gene.
After PCR using pBESTluc as template it is possible to isolate a
PCR product which contains the firefly luciferase gene with the
fused capA1 promoter. This is, after restriction with ClaI and
HindIII, ligated into the vector pBESTluc which has likewise been
digested with ClaI and HindIII. The resulting plasmid p1a is able
to replicate in E. coli and be used as template in the S. aureus in
vitro transcription-translation assay.
[1994] Preparation of S30 Extracts from S. aureus
[1995] Six litres of BHI medium are inoculated with a 250 ml
overnight culture of an S. aureus strain and allowed to grow at
37.degree. C. until the OD600 nm is 2-4. The cells are harvested by
centrifugation and washed in 500 ml of cold buffer A (10 mM Tris
acetate, pH 8.0, 14 mM magnesium acetate, 1 mM DTT, 1 M KCl). After
renewed centrifugation, the cells are washed in 250 ml of cold
buffer A with 50 mM KCl, and the resulting pellets are frozen at
-20.degree. C. for 60 min. The pellets are thawed on ice in 30 to
60 min and taken up in buffer B (10 mM Tris acetate, pH 8.0, 20 mM
magnesium acetate, 1 mM DTT, 50 mM KCl) up to a total volume of 99
ml. 1.5 ml portions of lysostaphin (0.8 mg/ml) in buffer B are
introduced into 3 precooled centrifuge cups and each is mixed with
33 ml of the cell suspension. The samples are incubated at
37.degree. C., shaking occasionally, for 45 to 60 min, before 1501
of a 0.5 M DTT solution are added. The lysed cells are centrifuged
at 30 000.times.g and 4.degree. C. for 30 min. The cell pellet is
taken up in buffer B and then centrifuged again under the same
conditions, and the collected supernatants are combined. The
supernatants are centrifuged again under the same conditions, and
0.25 volumes of buffer C (670 mM Tris acetate, pH 8.0, 20 mM
magnesium acetate, 7 mM Na.sub.3 phosphoenolpyruvate, 7 mM DTT, 5.5
mM ATP, 70 .mu.M amino acids (complete from Promega), 75 .mu.g of
pyruvate kinase (Sigma, Germany))/ml are added to the upper 2/3 of
the supernatant. The samples are incubated at 37.degree. C. for 30
min. The supernatants are dialysed against 2 l of dialysis buffer
(10 mM Tris acetate, pH 8.0, 14 mM magnesium acetate, 1 mM DTT, 60
mM potassium acetate) in a dialysis tube with a 3500 Da cut-off
with one buffer change at 4.degree. C. overnight. The dialysate is
concentrated to a protein concentration of about 10 mg/ml by
covering the dialysis tube with cold PEG 8000 powder (Sigma,
Germany) at 4.degree. C. The S30 extracts can be stored in aliquots
at -70.degree. C.
[1996] Determination of the IC.sub.50 in the S. aureus In Vitro
Transcription-Translation Assay
[1997] Inhibition of protein biosynthesis of the compounds can be
shown in an in vitro transcription-translation assay. The assay is
based on the cell-free transcription and translation of firefly
luciferase using the reporter plasmid p1a as template and cell-free
S30 extracts obtained from S. aureus. The activity of the resulting
luciferase can be detected by luminescence measurement.
[1998] The amount of S30 extract or plasmid p1a respectively to be
employed must be tested anew for each preparation in order to
ensure an optimal concentration in the assay. 3 .mu.l of the
substance to be tested, dissolved in 5% DMSO, are introduced into
an MTP. Then 10 .mu.l of a suitably concentrated plasmid solution
p1a are added. Then 46 .mu.l of a mixture of 23 .mu.l of premix
(500 mM potassium acetate, 87.5 mM Tris acetate, pH 8.0, 67.5 mM
ammonium acetate, 5 mM DTT, 50 .mu.g of folic acid/ml, 87.5 mg of
PEG 8000/ml, 5 mM ATP, 1.25 mM each NTP, 20 .mu.M each amino acid,
50 mM PEP (Na.sub.3 salt), 2.5 mM cAMP, 250 .mu.g each E. coli
tRNA/ml) and 23 .mu.l of a suitable amount of S. aureus S30 extract
are added and mixed. After incubation at 30.degree. C. for 60 min,
501 of luciferin solution (20 mM tricine, 2.67 mM MgSO.sub.4, 0.1
mM EDTA, 33.3 mM DTT pH 7.8, 270 .mu.M CoA, 470 .mu.M luciferin,
530 .mu.M ATP) are added, and the resulting bioluminescence is
measured in a luminometer for 1 min. The concentration of an
inhibitor which leads to a 50% inhibition of the translation of
firefly luciferase is given as the IC.sub.50.
[1999] Determination of the Minimum Inhibitory Concentration
(MIC)
[2000] The minimum inhibitory concentration (MIC) is the minimum
concentration of an antibiotic with which the growth of a test
microbe is inhibited over 18-24 h. The inhibitor concentration can
in these cases be determined by standard microbiological methods
(see, for example, The National Committee for Clinical Laboratory
Standards. Methods for dilution antimicrobial susceptibility tests
for bacteria that grow aerobically; approved standard-fifth
edition. NCCLS document M7-A5 [ISBN 1-56238-394-9]. NCCLS, 940 West
Valley Road, Suite 1400, Wayne, Pa. 19087-1898 USA, 2000). The MIC
of the compounds of the invention is determined in the liquid
dilution test on the 96-well microtitre plate scale. The bacterial
microbes are cultivated in a minimal medium (18.5 mM
Na.sub.2HPO.sub.4, 5.7 mM KH.sub.2PO.sub.4, 9.3 mM NH.sub.4Cl, 2.8
mM MgSO.sub.4, 17.1 mM NaCl, 0.033 .mu.g/ml thiamine hydrochloride,
1.2 .mu.g/ml nicotinic acid, 0.003 .mu.g/ml biotin, 1% glucose, 25
.mu.g/ml of each proteinogenic amino acid with the exception of
phenylalanine; [H.-P. Kroll; unpublished]) with the addition of
0.4% BH broth (test medium). In the case of Enterococcus faecium
L4001, heat-inactivated fetal calf serum (FCS; GibcoBRL, Germany)
is added to the test medium in a final concentration of 10%.
Overnight cultures of the test microbes are diluted to an
OD.sub.578 of 0.001 (to 0.01 in the case of enterococci) in fresh
test medium, and incubated 1:1 with dilutions of the test
substances (1:2 dilution steps) in test medium (200 .mu.l final
volume). The cultures are incubated at 37.degree. C. for 18-24
hours; enterococci in the presence of 5% CO.sub.2.
[2001] The lowest substance concentration in each case at which no
visible bacterial growth occurred any more is defined as the
MIC.
[2002] Alternative Method for Determining the Minimum Inhibitory
Concentration (MIC)
[2003] The minimum inhibitory concentration (MIC) is the minimum
concentration of an antibiotic with which the growth of a test
microbe is inhibited over 18-24 h. The inhibitor concentration can
in these cases be determined by standard microbiological methods
with modified medium in an agar dilution test (see, for example,
The National Committee for Clinical Laboratory Standards. Methods
for dilution antimicrobial susceptibility tests for bacteria that
grow aerobically; approved standard-fifth edition. NCCLS document
MV-A5 [ISBN 1-56238-394-9]. NCCLS, 940 West Valley Road, Suite
1400, Wayne, Pa. 19087-1898 USA, 2000). The bacterial microbes are
cultivated on 1.5% agar plates which contain 20% defibrinated horse
blood. The test microbes, which are incubated overnight on Columbia
blood agar plates (Becton-Dickinson), are diluted in PBS, adjusted
to a microbe count of about 5.times.10 microbe/ml and placed
dropwise (1-3 .mu.l) on test plates. The test substances comprise
different dilutions of the test substances (1:2 dilution steps).
The cultures are incubated at 37.degree. C. in the presence of 5%
CO.sub.2 for 18-24 hours.
[2004] The lowest substance concentration in each case at which no
visible bacterial growth occurred any more is defined as the MIC
and is reported in .mu.g/ml. TABLE-US-00018 TABLE 1 (with
comparative example 20A (biphenomycin B)) MIC MIC MIC IC.sub.50 Ex.
S. aureus S. aureus E. faecium S. aureus 133 No. 133 T17 L4001
translation 6 1 2 8 0.1 10 0.5 0.5 8 0.07 13 0.5 0.5 16 0.06 14 1 2
4 0.07 16 2 2 >32 0.1 23 0.5 1 4 0.32 20A <0.03 >32 0.5
1.5 Concentration data: MIC in .mu.g/ml; IC.sub.50 in .mu.M.
[2005] Systemic Infection with S. aureus 133
[2006] The suitability of the compounds of the invention for the
treatment of bacterial infections can be shown in various animal
models. For this purpose, the animals are generally infected with a
suitable virulent microbe and then treated with the compound to be
tested, which is in a formulation which is adapted to the
particular therapy model. The suitability of the compounds of the
invention can be demonstrated specifically for the treatment of
bacterial infections in a mouse sepsis model after infection with
S. aureus.
[2007] For this purpose, S. aureus 133 cells are cultured overnight
in BH broth (Oxoid, Germany). The overnight culture was diluted
1:100 in fresh BH broth and expanded for 3 hours. The bacteria
which are in the logarithmic phase of growth are centrifuged and
washed twice with buffered physiological saline solution. A cell
suspension in saline solution with an extinction of 50 units is
then adjusted in a photometer (Dr Lange LP 2W). After a dilution
step (1:15), this suspension is mixed 1:1 with a 10% mucine
suspension. 0.2 ml of this infection solution is administered i.p.
per 20 g of mouse. This corresponds to a cell count of about
1-2.times.10.sup.6 microbes/mouse. The i.v. therapy takes place 30
minutes after the infection. Female CFW1 mice are used for the
infection test. The survival of the animals is recorded over 6
days. The animal model is adjusted so that untreated animals die
within 24 h after the infection. It was possible to demonstrate in
this model a therapeutic effect of ED.sub.100=1.25 mg/kg for the
compound of Example 2.
[2008] Determination of the Rates of Spontaneous Resistance to S.
aureus
[2009] The spontaneous resistance rates for the compounds of the
invention are determined as follows: the bacterial microbes are
cultivated in 30 ml of a minimal medium (18.5 mM Na.sub.2HPO.sub.4,
5.7 mM KH.sub.2PO.sub.4, 9.3 mM NH.sub.4Cl, 2.8 mM MgSO.sub.4, 17.1
mM NaCl, 0.033 .mu.g/ml thiamine hydrochloride, 1.2 .mu.g/ml
nicotinic acid, 0.003 .mu.g/ml biotin, 1% glucose, 25 .mu.g/ml of
each proteinogenic amino acid with the addition of 0.4% BH broth)
at 37.degree. C. overnight, centrifuged at 6000.times.g for 10 min
and resuspended in 2 ml of phosphate-buffered physiological NaCl
solution (about 2.times.10.sup.9 microbes/ml). 100 .mu.l of this
cell suspension, and 1:10 and 1:100 dilutions, are plated out on
predried agar plates (1.5% agar, 20% defibrinated horse blood, or
1.5% agar, 20% bovine serum in 1/10 Muller-Hinton medium diluted
with PBS) which contain the compound of the invention to be tested
in a concentration equivalent to 5.times.MIC or 10.times.MIC
respectively, and incubated at 37.degree. C. for 48 h. The
resulting colonies (cfu) are counted.
[2010] Isolation of the Biphenomycin-Resistant S. aureus Strains
RN4220Bi.sup.R and T17
[2011] The S. aureus strain RN4220Bi.sup.R is isolated in vitro.
For this purpose, 100 .mu.l portions of an S. aureus RN4220 cell
suspension (about 1.2.times.10.sup.8 cfu/ml) are plated out on an
antibiotics-free agar plate (18.5 mM Na.sub.2HPO.sub.4, 5.7 mM
KH.sub.2PO.sub.4, 9.3 mM NH.sub.4Cl, 2.8 mM MgSO.sub.4, 17.1 mM
NaCl, 0.033 .mu.g/ml thiamine hydrochloride, 1.2 .mu.g/ml nicotinic
acid, 0.003 .mu.g/ml biotin, 1% glucose, 25 .mu.g/ml of each
proteinogenic amino acid with the addition of 0.4% BH broth and 1%
agarose) and on an agar plate containing 2 .mu.g/ml biphenomycin B
(10.times.MIC), and incubated at 37.degree. C. overnight. Whereas
about 1.times.10.sup.7 cells grow on the antibiotics-free plate,
about 100 colonies grow on the antibiotics-containing plate,
corresponding to a resistance rate of 1.times.10.sup.-5. Some of
the colonies grown on the antibiotics-containing plate are tested
for the biphenomycin B MIC. One colony with an MIC of >50 .mu.M
is selected for further use, and the strain is referred to as
RN4220Bi.sup.R.
[2012] The S. aureus strain T17 is isolated in vivo. CFW1 mice are
infected intraperitoneally with 4.times.10.sup.7 S. aureus 133
cells per mouse. 0.5 h after the infection, the animals are treated
intravenously with 50 mg/kg biphenomycin B. The kidneys are removed
from the surviving animals on day 3 after the infection. After
homogenization of the organs, the homogenates are plated out as
described for RN4220Bi.sup.R on antibiotics-free and
antibiotics-containing agar plates and incubated at 37.degree. C.
overnight. About half the colonies isolated from the kidney show
growth on the antibiotics-containing plates (2.2.times.10.sup.6
colonies), demonstrating the accumulation of biphenomycin
B-resistant S. aureus cells in the kidney of the treated animals.
About 20 of these colonies are tested for the biphenomycin B MIC,
and a colony with an MIC of >50 .mu.M is selected for further
cultivation, and the strain is referred to as T17.
C. Exemplary Embodiments of Pharmaceutical Compositions
[2013] The compounds of the invention can be converted into
pharmaceutical preparations in the following way:
[2014] Solution which can be Administered Intravenously:
[2015] Composition:
[2016] 1 mg of the compound of Example 1, 15 g of polyethylene
glycol 400 and 250 g of water for injections.
[2017] Preparation:
[2018] The compound of the invention is dissolved together with
polyethylene glycol 400 in the water with stirring. The solution is
sterilized by filtration (pore diameter 0.22 .mu.m) and dispensed
under aseptic conditions into heat-sterilized infusion bottles.
These are closed with infusion stoppers and crimped caps.
* * * * *