U.S. patent application number 11/857399 was filed with the patent office on 2008-03-27 for derivatives of growth hormone and related proteins, and methods of use thereof.
This patent application is currently assigned to BOLDER BIOTECHNOLOGY, INC.. Invention is credited to George N. III Cox.
Application Number | 20080076706 11/857399 |
Document ID | / |
Family ID | 46329341 |
Filed Date | 2008-03-27 |
United States Patent
Application |
20080076706 |
Kind Code |
A1 |
Cox; George N. III |
March 27, 2008 |
Derivatives of Growth Hormone and Related Proteins, and Methods of
Use Thereof
Abstract
The growth hormone supergene family comprises greater than 20
structurally related cytokines and growth factors. A general method
is provided for creating site-specific, biologically active
conjugates of these proteins. The method involves adding cysteine
residues to non-essential regions of the proteins or substituting
cysteine residues for non-essential amino acids in the proteins
using site-directed mutagenesis and then covalently coupling a
cysteine-reactive polymer or other type of cysteine-reactive moiety
to the proteins via the added cysteine residue. Disclosed herein
are preferred sites for adding cysteine residues or introducing
cysteine substitutions into the proteins, and the proteins and
protein derivatives produced thereby. Also disclosed are
therapeutic methods for using the cysteine variants of the
invention.
Inventors: |
Cox; George N. III;
(Louisville, CO) |
Correspondence
Address: |
SHERIDAN ROSS PC
1560 BROADWAY
SUITE 1200
DENVER
CO
80202
US
|
Assignee: |
BOLDER BIOTECHNOLOGY, INC.
2945 Wilderness Place Suite 100
Boulder
CO
80301
|
Family ID: |
46329341 |
Appl. No.: |
11/857399 |
Filed: |
September 18, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10685288 |
Oct 13, 2003 |
7270809 |
|
|
11857399 |
Sep 18, 2007 |
|
|
|
10400377 |
Mar 26, 2003 |
7148333 |
|
|
11857399 |
Sep 18, 2007 |
|
|
|
09462941 |
Jan 14, 2000 |
6608183 |
|
|
PCT/US98/14497 |
Jul 13, 1998 |
|
|
|
10400377 |
Mar 26, 2003 |
|
|
|
10298148 |
Nov 15, 2002 |
7153943 |
|
|
10685288 |
|
|
|
|
09462941 |
Jan 14, 2000 |
6608183 |
|
|
10685288 |
|
|
|
|
09889273 |
Sep 6, 2001 |
6753165 |
|
|
PCT/US00/00931 |
Jan 14, 2000 |
|
|
|
10685288 |
|
|
|
|
10276358 |
Apr 10, 2003 |
7306931 |
|
|
PCT/US01/16088 |
May 16, 2001 |
|
|
|
10685288 |
|
|
|
|
60418106 |
Oct 11, 2002 |
|
|
|
60052516 |
Jul 14, 1997 |
|
|
|
60332285 |
Nov 15, 2001 |
|
|
|
60418040 |
Oct 11, 2002 |
|
|
|
60116041 |
Jan 14, 1999 |
|
|
|
60204617 |
May 16, 2000 |
|
|
|
Current U.S.
Class: |
424/85.1 ;
514/11.3; 514/3.8; 514/7.9; 530/397 |
Current CPC
Class: |
A61P 43/00 20180101;
C07K 14/565 20130101; C07K 14/535 20130101; A61P 7/00 20180101;
A61K 47/60 20170801; A61K 38/00 20130101 |
Class at
Publication: |
514/008 ;
530/397 |
International
Class: |
A61K 38/16 20060101
A61K038/16; A61P 43/00 20060101 A61P043/00; C07K 1/00 20060101
C07K001/00 |
Claims
1. A method to protect an animal from a disease or condition that
can be treated by granulocyte colony-stimulating factor (G-CSF),
comprising administering to an animal having said disease or
condition a composition comprising a cysteine variant of G-CSF of
SEQ ID NO: 6, wherein said G-CSF cysteine variant comprises at
least one cysteine residue substituted for at least one amino acid
located in at least one region of G-CSF selected from the group
consisting of: the A-B loop, the B-C loop, the C-D loop, the first
three or last three amino acids in helix B, the first three or last
three amino acids in helix C, the first three or last three amino
acids in helix D, and the amino acids following helix D.
2. The method of claim 1, wherein said cysteine variant comprises
at least one cysteine residue substituted for at least one amino
acid selected from the group consisting of: K40, S53, G55, W58,
A59, P60, S62, S63, P65, S66, Q67, A68, Q70, A72, Q90, A91, E93,
G94, S96, E98, G100, G125, M126, A127, A129, Q131, T133, Q134,
G135, A136, A139, A141, S142, A143, Q145, Q173 and P174.
3-59. (canceled)
60. An isolated, PEGylated granulocyte colony stimulating factor
(G-CSF) variant of SEQ ID NO:6, wherein a polyethylene glycol is
attached to the protein through an amino acid position, with
respect to SEQ ID NO:6, selected from the group consisting of: 2,
6, 7, 58, 68, 93, 129, 131, 133, 134, 136, 139, 141, and 173, and
wherein said variant has biological activity in vitro as measured
by proliferation of a cell line that proliferates in response to
G-CSF.
61. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to the protein through amino acid 2
of said G-CSF variant.
62. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to amino acid 6 of said G-CSF
variant.
63. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to amino acid 7 of said G-CSF
variant.
64. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to amino acid 58 of said G-CSF
variant.
65. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to amino acid 68 of said G-CSF
variant.
66. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to amino acid 93 of said G-CSF
variant.
67. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to amino acid 129 of said G-CSF
variant.
68. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to amino acid 131 of said G-CSF
variant.
69. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to amino acid 133 of said G-CSF
variant.
70. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to amino acid 134 of said G-CSF
variant.
71. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to amino acid 136 of said G-CSF
variant.
72. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to amino acid 139 of said G-CSF
variant.
73. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to amino acid 141 of said G-CSF
variant.
74. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to amino acid 173 of said G-CSF
variant.
75. The isolated, PEGylated G-CSF variant of claim 60, wherein the
variant is monoPEGylated.
76. The isolated, PEGylated G-CSF variant of claim 60, wherein a
non-cysteine residue is substituted for cysteine-17 of said G-CSF
variant.
77. The isolated, PEGylated G-CSF variant of claim 76, wherein said
non-cysteine amino acid is selected from the group consisting of
serine and alanine.
78. The isolated, PEGylated G-CSF variant of claim 60, wherein a
polyethylene glycol is attached to a cysteine residue substituted
for the amino acid at said amino acid position.
79. A composition comprising at least one PEGylated granulocyte
colony stimulating factor (G-CSF) variant according to claim
60.
80. A method to stimulate proliferation and differentiation of
hematopoietic cells in an animal, comprising administering to said
animal an isolated PEGylated granulocyte colony stimulating factor
(G-CSF) variant of claim 60.
81. The method of claim 80, wherein said composition is
administered by intravenous administration or subcutaneous
administration.
82. The method of claim 80, wherein said animal has a deficiency of
hematopoietic cells.
83. The method of claim 80, wherein said deficiency of
hematopoietic cells is associated with myelosuppressive
chemotherapy, bone marrow transplantation, infection with the human
immunodeficiency virus, or chronic neutropenia.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation under 35 U.S.C. .sctn.
120 of U.S. application Ser. No. 10/685,288, filed Oct. 13, 2003,
which claims the benefit of priority under 35 U.S.C. 119(e) from
U.S. Provisional Application Ser. No. 60/418,106, filed Oct. 11,
2002, entitled "Methods of Use for Granulocyte Colony Stimulating
Factor Cysteine Muteins", and from U.S. Provisional Application
Ser. No. 60/418,105, filed Oct. 11, 2002, entitled "Methods of Use
for Erythropoietin Cysteine Muteins".
[0002] U.S. application Ser. No. 10/685,288, supra, is also a
continuation-in-part of U.S. application Ser. No. 10/400,377, filed
Mar. 26, 2003, which is a divisional of U.S. application Ser. No.
09/462,941, filed Jan. 14, 2000, now U.S. Pat. No. 6,608,183, which
is a national stage filing under 35 U.S.C. 371 of PCT Application
Serial No. PCT/US98/14497, filed Jul. 13, 1998, which designates
the United States, was published in English, and claims the benefit
of priority under 35 U.S.C. 119(e) from U.S. Provisional
Application Ser. No. 60/052,516, filed Jul. 14, 1997.
[0003] U.S. application Ser. No. 10/685,288, supra, is also a
continuation-in-part of U.S. application Ser. No. 10/298,148, filed
Nov. 15, 2002, which claims priority under 35 U.S.C. 119(e) from
U.S. Provisional Application Ser. No. 60/418,040, filed Oct. 11,
2002 and from U.S. Provisional Application Ser. No. 60/332,285,
filed Nov. 15, 2001, and which also claims priority as a
continuation-in-part from said U.S. application Ser. No.
09/462,941.
[0004] U.S. application Ser. No. 10/685,288, supra, is also a
continuation-in-part of U.S. application Ser. No. 09/889,273, filed
Jul. 13, 2001, which is a national stage filing under 35 U.S.C. 371
of PCT Application Serial No. PCT/US00/00931, filed Jan. 14, 2000,
which designates the United States, was published in English, and
which claims priority under 35 U.S.C. 119(e) from U.S. Provisional
Application Ser. No. 60/116,041, filed Jan. 14, 1999.
[0005] U.S. application Ser. No. 10/685,288, supra, is also a
continuation-in-part of U.S. application Ser. No. 10/276,358, filed
Nov. 14, 2002, which is a national stage filing under 35 U.S.C. 371
of PCT Application Serial No. PCT/US01/16088, filed May 16, 2001,
which designated the United States, was published in English, and
which claims priority under 35 U.S.C. 119(e) from U.S. Provisional
Application Ser. No. 60/204,617, filed May 16, 2000.
[0006] The entire disclosure of each of the above-identified
applications is incorporated herein by reference.
REFERENCE TO SEQUENCE LISTING
[0007] This application contains a Sequence Listing submitted as an
electronic text file named "Sequence_Listing", having a size in
bytes of 102 kb, and created on 13 Oct. 2003. The information
contained in this electronic file is hereby incorporated by
reference in its entirety pursuant to 37 CFR .sctn. 1.52(e)(5).
FIELD OF THE INVENTION
[0008] The present invention relates to genetically engineered
therapeutic proteins and methods of using such proteins. More
specifically, the engineered proteins include cysteine variants of
growth hormone and related members of the growth hormone supergene
family.
BACKGROUND OF THE INVENTION
[0009] The following proteins are encoded by genes of the growth
hormone (GH) supergene family (Bazan (1990); Mott and Campbell
(1995); Silvennoinen and Ihle (1996); Blumberg et al. (2001)):
growth hormone, prolactin, placental lactogen, erythropoietin
(EPO), thrombopoietin (TPO), interleukin-2 (IL-2), IL-3, IL-4,
IL-5, IL-6, IL-7, IL-9, IL-10, IL-11, IL-12 (p35 subunit), IL-13,
IL-15, IL-19, IL-20, IL-21, MDA-7, IL-TIF, AK-155, oncostatin M,
ciliary neurotrophic factor, leukemia inhibitory factor, alpha
interferon, beta interferon, gamma interferon, omega interferon,
tau interferon, granulocyte-colony stimulating factor (G-CSF),
granulocyte-macrophage colony stimulating factor (GM-CSF),
macrophage colony stimulating factor (M-CSF) and cardiotrophin-1
(CT-1) ("the GH supergene family"). It is anticipated that
additional members of this gene family will be identified in the
future through gene cloning and sequencing. Members of the GH
supergene family have similar secondary and tertiary structures,
despite the fact that they generally have limited amino acid or DNA
sequence identity. The shared structural features allow new members
of the gene family to be readily identified.
[0010] There is considerable interest on the part of patients and
healthcare providers in the development of long acting,
"user-friendly" protein therapeutics. Proteins are expensive to
manufacture and, unlike conventional small molecule drugs, are not
readily absorbed by the body. Moreover, they are digested if taken
orally. Therefore, natural proteins must be administered by
injection. After injection, most proteins are cleared rapidly from
the body, necessitating frequent, often daily, injections. Patients
dislike injections, which leads to reduced compliance and reduced
drug efficacy. Some proteins, such as erythropoietin (EPO), are
effective when administered less often (three times per week for
EPO) because they are glycosylated. However, glycosylated proteins
are produced using expensive mammalian cell expression systems.
[0011] The length of time an injected protein remains in the body
is finite and is determined by, e.g., the protein's size and
whether or not the protein contains covalent modifications such as
glycosylation. Circulating concentrations of injected proteins
change constantly, often by several orders of magnitude, over a
24-hour period. Rapidly changing concentrations of protein agonists
can have dramatic downstream consequences, at times
under-stimulating and at other times over-stimulating target cells.
Similar problems plague protein antagonists. These fluctuations can
lead to decreased efficacy and increased frequency of adverse side
effects for protein therapeutics. The rapid clearance of
recombinant proteins from the body significantly increases the
amount of protein required per patient and dramatically increases
the cost of treatment. The cost of human protein pharmaceuticals is
expected to increase dramatically in the years ahead as new and
existing drugs are approved for more disease indications.
[0012] Thus, there is a need to develop protein delivery
technologies that lower the costs of protein therapeutics to
patients and healthcare providers. The present invention provides a
solution to this problem by providing methods to prolong the
circulating half-lives of protein therapeutics in the body so that
the proteins do not have to be injected frequently. This solution
also satisfies the needs and desires of patients for protein
therapeutics that are "user-friendly", i.e., protein therapeutics
that do not require frequent injections. The present invention
solves these and other problems by providing biologically active,
cysteine-added variants of members of the growth hormone supergene
family. The invention also provides for the chemical modification
of these variants with cysteine-reactive polymers or other types of
cysteine-reactive moieties to produce derivatives thereof and the
molecules so produced. The invention also provides for therapeutic
methods using the protein variants described herein.
SUMMARY OF THE INVENTION
[0013] The present invention provides cysteine variants of members
of the GH supergene family and uses of such cysteine variants. The
variants comprise a cysteine residue substituted for a nonessential
amino acid of the proteins. Preferably, the variants comprise a
cysteine residue substituted for an amino acid selected from amino
acids in the loop regions, the ends of the alpha helices, proximal
to the first amphipathic helix, and distal to the final amphipathic
helix or wherein the cysteine residue is added at the N-terminus or
C-terminus of the proteins. Preferred sites for substitution are
the N- and O-linked glycosylation sites. According to the present
invention, "proximal to the first amphipathic helix" refers to a
position preceding, or N-terminal to, the first amphipathic helix
(i.e., closer to the amino-terminus of the protein than the first
amphipathic helix). Similarly, "distal to the final amphipathic
helix" refers to a position following, or C-terminal to, the final
amphipathic helix (i.e., further away from the amino-terminus of
the protein than the final amphipathic helix).
[0014] Also provided are cysteine variants wherein the amino acid
substituted for is in the A-B loop, B-C loop, the C-D loop or D-E
loop of interferon/interferon-10-like members of the GH supergene
family.
[0015] Also provided are cysteine variants of members of the GH
supergene family wherein the cysteine residue is introduced between
two amino acids in the natural protein. In particular, the cysteine
residue is introduced into the loop regions, the ends of the alpha
helices, proximal to the first amphipathic helix, or distal to the
final amphipathic helix. Even more particularly, the cysteine
variant is introduced between two amino acids in an N--O-linked
glycosylation site or adjacent to an amino acid in an N-linked or
O-linked glycosylation site.
[0016] More particularly are provided cysteine variants wherein the
loop region where the cysteine is introduced is the A-B loop, the
B-C loop, the C-D loop or D-E loop of interferon/interferon-10-like
members of the GH supergene family.
[0017] Such cysteine substitutions or insertion mutations also can
include the insertion of one or more additional amino acids amino
acids at the amino-terminal or carboxy-terminal to the cysteine
substitution or insertion.
[0018] Also provided are cysteine variants that are further
derivatised by PEGylating the cysteine variants and including the
derivatised proteins produced thereby.
[0019] As set forth in the examples, specific cysteine variants of
the members of the GH supergene family also are provided, including
for example, variants of GH. The GH cysteine variants can have the
substituted--for amino acid or inserted cysteine located at the
N-terminal end of the A-B loop, the B-C loop, the C-D loop, the
first three or last three amino acids in the A, B, C and D helices
and the amino acids proximal to helix A and distal to helix D.
[0020] More particularly, the cysteine can be substituted for the
following amino acids: F1, T3, P5, E33, A34, K38, E39, Q40, S43,
Q46, N47, P48, Q49, T50, S51, S55, T60, A98, N99, S100, G104, A105,
S106, E129, D130, G131, S132, P133, T135, G136, Q137, K140, Q141,
T142, S144, K145, D147, T148, N149, S150, H151, N152, D153, S184,
E186, G187, S188, and G190.
[0021] Other examples of cysteine variants according to the
invention include erythropoietin variants. Erythropoietin variants
include those wherein the substituted for amino acid is located in
the A-B loop, the B-C loop, the C-D loop, the amino acids proximal
to helix A and distal to helix D and the N- or C-terminus. Even
more specifically, the EPO cysteine variants include molecules
wherein the amino acids indicated below have a cysteine substituted
therefor: serine-126, N24, I25, T26, N38, I39, T40, N83, S84, A1,
P2, P3, R4, D8, S9, T27, G28, A30, E31, H32, S34, N36, D43, T44,
K45, N47, A50, K52, E55, G57, Q58, G77, Q78, A79, Q86, W88, E89,
T107, R110, A111, G113, A114, Q115, K116, E117, A118, S120, P121,
P122, D123, A124, A125, A127, A128, T132, K154, T157, G158, E159,
A160, T163, G164, D165, R166 and S85.
[0022] The members of the GH supergene family include growth
hormone, prolactin, placental lactogen, erythropoietin,
thrombopoietin, interleukin-2, interleukin-3, interleukin-4,
interleukin-5, interleukin-6, interleukin-7, interleukin-9,
interleukin-10, interleukin-11, interleukin-12 (p35 subunit),
interleukin-13, interleukin-15, oncostatin M, ciliary neurotrophic
factor, leukemia inhibitory factor, alpha interferon, beta
interferon, gamma interferon, omega interferon, tau interferon,
granulocyte-colony stimulating factor, granulocyte-macrophage
colony stimulating factor, macrophage colony stimulating factor,
cardiotrophin-1 and other proteins identified and classified as
members of the family. The proteins can be derived from any animal
species including human, companion animals and farm animals.
[0023] Also provided are therapeutic methods for protecting an
animal from a disease or condition that is amenable to treatment by
any of the wild-type growth hormone superfamily proteins described
herein. The methods include administration of one or more cysteine
variants (cysteine muteins) of the invention (including those with
agonist or antagonist functions) to an animal for treatment of a
disease or condition.
[0024] In one aspect, provided is a method to protect an animal
from a disease or condition, comprising administering to the animal
a composition comprising a granulocyte-macrophage colony
stimulating factor (GM-CSF) cysteine mutein as described
herein.
[0025] In one aspect, provided is a method to protect an animal
from a disease or condition, comprising administering to the animal
a composition comprising a granulocyte colony stimulating factor
(G-CSF) cysteine mutein as described herein.
[0026] In one aspect, provided is a method to protect an animal
from a disease or condition, comprising administering to the animal
a composition comprising an erythropoietin (EPO) cysteine mutein as
described herein.
[0027] In one aspect, provided is a method to protect an animal
from a disease or condition, comprising administering to the animal
a composition comprising an alpha interferon cysteine mutein as
described herein.
[0028] Also provided is a method to prevent or treat the occurrence
of neutropenia in an animal comprising administering to the animal
a composition comprising a granulocyte-macrophage colony
stimulating factor (GM-CSF) cysteine mutein as described herein.
The neutropenia to be prevented or treated using this method can
include, but is not limited to: (a) neutropenia resulting from
myelosuppressive chemotherapy; (b) neutropenia associated with bone
marrow transplantation (c) neutropenia associated with infection
with the human immunodeficiency virus; (d) neutropenia associated
with burns, surgery, dilatation, anemia and neonatal septicemia;
(e) severe chronic neutropenia; or neutropenia associated with
aplastic anemia and acute leukemia.
[0029] Also provided is a method to protect an animal from a
disease or condition by stimulating proliferation and
differentiation of hematopoietic cells in the animal, comprising
administering to the animal a composition comprising a
granulocyte-macrophage colony stimulating factor (GM-CSF) cysteine
mutein as described herein.
[0030] Also provided is a method for stimulating the expansion and
proliferation of peripheral blood progenitor cells in an animal
comprising administering to the animal a composition comprising a
granulocyte-macrophage colony stimulating factor (GM-CSF) cysteine
mutein as described herein.
[0031] Also provided are therapeutic methods for accelerating
recovery from neutropenia in patients using cysteine variants of
granulocyte colony stimulating factor (G-CSF).
[0032] Also provided is a method to protect an animal from a
disease or condition by stimulating proliferation and
differentiation of hematopoietic cells in the animal, comprising
administering to said animal a composition comprising a G-CSF
cysteine mutein.
[0033] Also provided is a method for stimulating the expansion and
proliferation of peripheral blood progenitor cells in an animal
comprising administering to the animal a composition comprising a
G-CSF cysteine mutein.
[0034] Also provided are therapeutic methods for increasing red
blood cell formation and increasing hematocrit levels in patients
using a cysteine variant of erythropoietin (EPO).
[0035] Also provided are therapeutic methods to regulate the
proliferation and differentiation of hematopoietic progenitor cells
into mature cells such as red blood cells using a cysteine variant
of erythropoietin (EPO).
[0036] Also described herein are therapeutic methods for inhibiting
growth of cancer cells in patients using cysteine variants of alpha
interferon.
[0037] Other variations and modifications to the invention will be
obvious to those skilled in the art based on the specification and
the "rules" set forth herein. All of these are considered as part
of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0038] The present invention relates to cysteine variants and,
among other things, the site-specific conjugation of such proteins
with polyethylene glycol (PEG) or other such moieties. PEG is a
non-antigenic, inert polymer that significantly prolongs the length
of time a protein circulates in the body. This allows the protein
to be effective for a longer period of time. Covalent modification
of proteins with PEG has proven to be a useful method to extend the
circulating half-lives of proteins in the body (Abuchowski et al.,
1984; Hershfield, 1987; Meyers et al., 1991). Covalent attachment
of PEG to a protein increases the protein's effective size and
reduces its rate of clearance rate from the body. PEGs are
commercially available in several sizes, allowing the circulating
half-lives of PEG-modified proteins to be tailored for individual
indications through use of different size PEGs. Other benefits of
PEG modification include an increase in protein solubility, an
increase in vivo protein stability and a decrease in protein
immunogenicity (Katre et al., 1987; Katre, 1990).
[0039] The preferred method for PEGylating proteins is to
covalently attach PEG to cysteine residues using cysteine-reactive
PEGs. A number of highly specific, cysteine-reactive PEGs with
different reactive groups (e.g., maleimide, vinylsulfone) and
different size PEGs (2-20 kDa) are commercially available (e.g.,
from Shearwater, Polymers, Inc., Huntsville, Ala.). At neutral pH,
these PEG reagents selectively attach to "free" cysteine residues,
i.e., cysteine residues not involved in disulfide bonds. The
conjugates are hydrolytically stable. Use of cysteine-reactive PEGs
allows the development of homogeneous PEG-protein conjugates of
defined structure.
[0040] Considerable progress has been made in recent years in
determining the structures of commercially important protein
therapeutics and understanding how they interact with their protein
targets, e.g., cell-surface receptors, proteases, etc. This
structural information can be used to design PEG-protein conjugates
using cysteine-reactive PEGs. Cysteine residues in most proteins
participate in disulfide bonds and are not available for PEGylation
using cysteine-reactive PEGs. Through in vitro mutagenesis using
recombinant DNA techniques, additional cysteine residues can be
introduced anywhere into the protein. The added cysteines can be
introduced at the beginning of the protein, at the end of the
protein, between two amino acids in the protein sequence or,
preferably, substituted for an existing amino acid in the protein
sequence. The newly added "free" cysteines can serve as sites for
the specific attachment of a PEG molecule using cysteine-reactive
PEGs. The added cysteine must be exposed on the protein's surface
and accessible for PEGylation for this method to be successful. If
the site used to introduce an added cysteine site is non-essential
for biological activity, then the PEGylated protein will display
essentially wild type (normal) in vitro bioactivity. The major
technical challenge in PEGylating proteins with cysteine-reactive
PEGs is the identification of surface exposed, non-essential
regions in the target protein where cysteine residues can be added
or substituted for existing amino acids without loss of
bioactivity.
[0041] Cysteine-added variants of a few human proteins and
PEG-polymer conjugates of these proteins have been described. U.S.
Pat. No. 5,206,344 describes cysteine-added variants of IL-2. These
cysteine-added variants are located within the first 20 amino acids
from the amino terminus of the mature IL-2 polypeptide chain. The
preferred cysteine variant is at position 3 of the mature
polypeptide chain, which corresponds to a threonine residue that is
O-glycosylated in the naturally occurring protein. Substitution of
cysteine for threonine at position 3 yields an IL-2 variant that
can be PEGylated with a cysteine-reactive PEG and retain full in
vitro bioactivity (Goodson and Katre, 1990). In contrast, natural
IL-2 PEGylated with lysine-reactive PEGs displays reduced in vitro
bioactivity (Goodson and Katre, 1990). The effects of cysteine
substitutions at other positions in IL-2 were not reported.
[0042] U.S. Pat. No. 5,166,322 teaches cysteine-added variants of
IL-3. These variants are located within the first 14 amino acids
from the N-terminus of the mature protein sequence. The patent
teaches expression of the proteins in bacteria and covalent
modification of the proteins with cysteine-reactive PEGs. No
information is provided as to whether the cysteine-added variants
and PEG-conjugates of IL-3 are biologically active. Cysteine-added
variants at other positions in the polypeptide chain were not
reported.
[0043] PCT Publication No. WO 9412219 and PCT Application No.
PCT/US95/06540 teach cysteine-added variants of insulin-like growth
factor-I (IGF-I). IGF-I has a very different structure from GH and
is not a member of the GH supergene family (Mott and Campbell,
1995). Cysteine substitutions at many positions in the IGF-I
protein are described. Only certain of the cysteine-added variants
are biologically active. The preferred site for the cysteine added
variant is at amino acid position 69 in the mature protein chain.
Cysteine substitutions at positions near the N-terminus of the
protein (residues 1-3) yielded IGF-I variants with reduced
biological activities and improper disulfide bonds.
[0044] PCT Publication No. WO 9422466 teaches two cysteine-added
variants of insulin-like growth factor (IGF) binding protein-1,
which has a very different structure than GH and is not a member of
the GH supergene family. The two cysteine-added IGF binding
protein-1 variants disclosed are located at positions 98 and 101 in
the mature protein chain and correspond to serine residues that are
phosphorylated in the naturally-occurring protein.
[0045] U.S. patent application Ser. No. 07/822,296 teaches cysteine
added variants of tumor necrosis factor binding protein, which is a
soluble, truncated form of the tumor necrosis factor cellular
receptor. Tumor necrosis factor binding protein has a very
different structure than GH and is not a member of the GH supergene
family.
[0046] IGF-I, IGF binding protein-1 and tumor necrosis factor
binding protein have secondary and tertiary structures that are
very different from GH and the proteins are not members of the GH
supergene family. Because of this, it is difficult to use the
information gained from studies of IGF-I, IGF binding protein-1 and
tumor necrosis factor binding protein to create cysteine-added
variants of members of the GH supergene family. The studies with
IL-2 and IL-3 were carried out before the structures of IL-2 and
IL-3 were known (McKay 1992; Bazan, 1992) and before it was known
that these proteins are members of the GH supergene family.
Previous experiments aimed at identifying preferred sites for
adding cysteine residues to IL-2 and IL-3 were largely empirical
and were performed prior to experiments indicating that members of
the GH supergene family possessed similar secondary and tertiary
structures.
[0047] Based on the structural information now available for
members of the GH supergene family, the present invention provides
"rules" for determining a priori which regions and amino acid
residues in members of the GH supergene family can be used to
introduce or substitute cysteine residues without significant loss
of biological activity. In contrast to the naturally occurring
proteins, these cysteine-added variants of members of the GH
supergene family will possess novel properties such as the ability
to be covalently modified at defined sites within the polypeptide
chain with cysteine-reactive polymers or other types of
cysteine-reactive moieties. The covalently modified proteins will
be biologically active.
[0048] GH is the best-studied member of the GH supergene family. GH
is a 22 kDa protein secreted by the pituitary gland. GH stimulates
metabolism of bone, cartilage and muscle and is the body's primary
hormone for stimulating somatic growth during childhood.
Recombinant human GH (rhGH) is used to treat short stature
resulting from GH inadequacy and renal failure in children. GH is
not glycosylated and can be produced in a fully active form in
bacteria. The protein has a short in vivo half-life and must be
administered by daily subcutaneous injection for maximum
effectiveness (MacGillivray et al., 1996). Recombinant human GH
(rhGH) was approved recently for treating cachexia in AIDS patients
and is under study for treating cachexia associated with other
diseases.
[0049] The sequence of human GH is well known (see, e.g., Martial
et al. 1979; Goeddel et al. 1979 which are incorporated herein by
reference; SEQ ID NO:1). GH is closely related in sequence to
prolactin and placental lactogen and these three proteins were
considered originally to comprise a small gene family. The primary
sequence of GH is highly conserved among animal species
(Abdel-Meguid et al., 1987), consistent with the protein's broad
species cross-reactivity. The three dimensional folding pattern of
porcine GH has been solved by X-ray crystallography (Abdel-Meguid
et al., 1987). The protein has a compact globular structure,
comprising four amphipathic alpha helical bundles joined by loops.
Human GH has a similar structure (de Vos et al., 1992). The four
alpha helical regions are termed A-D beginning from the N-terminus
of the protein. The loop regions are referred to by the helical
regions they join, e.g., the A-B loop joins helical bundles A and
B. The A-B and C-D loops are long, whereas the B-C loop is short.
GH contains four cysteine residues, all of which participate in
disulfide bonds. The disulfide assignments are cysteine53 joined to
cysteine165 and cysteine182 joined to cysteine189.
[0050] The crystal structure of GH bound to its receptor revealed
that GH has two receptor binding sites and binds two receptor
molecules (Cunningham et al., 1991; de Vos et al., 1992). The two
receptor binding sites are referred to as site I and site II. Site
I encompasses the Carboxy (C)-terminal end of helix D and parts of
helix A and the A-B loop, whereas site II encompasses the Amino
(N)-terminal region of helix A and a portion of helix C. Binding of
GH to its receptor occurs sequentially, with site I always binding
first. Site II then engages a second GH receptor, resulting in
receptor dimerization and activation of the intracellular signaling
pathways that lead to cellular responses to GH. A GH mutein in
which site II has been mutated (a glycine to arginine mutation at
amino acid 120) is able to bind a single GH receptor, but is unable
to dimerize GH receptors; this mutein acts as a GH antagonist in
vitro, presumably by occupying GH receptor sites without activating
intracellular signaling pathways (Fuh et al., 1992).
[0051] The roles of particular regions and amino acids in GH
receptor binding and intracellular signaling also have been studied
using techniques such as mutagenesis, monoclonal antibodies and
proteolytic digestion. The first mutagenesis experiments entailed
replacing entire domains of GH with similar regions of the closely
related protein, prolactin (Cunningham et al., 1989). One finding
was that replacement of the B-C loop of GH with that of prolactin
did not affect binding of the hybrid GH protein to a soluble form
of the human GH receptor, implying that the B-C loop was
non-essential for receptor binding. Alanine scanning mutagenesis
(replacement of individual amino acids with alanine) identified 14
amino acids that are critical for GH bioactivity (Cunningham and
Wells, 1989). These amino acids are located in the helices A, B, C,
and D and the A-B loop and correspond to sites I and II identified
from the structural studies. Two lysine residues at amino acid
positions 41 and 172, K41 and K172, were determined to be critical
components of the site I receptor binding site, which explains the
decrease in bioactivity observed when K172 is acetylated (Teh and
Chapman, 1988). Modification of K168 also significantly reduced GH
receptor binding and bioactivity (de la Llosa et al., 1985; Martal
et al., 1985; Teh and Chapman, 1988). Regions of GH responsible for
binding the GH receptor have also been studied using monoclonal
antibodies (Cunningham et al., 1989). A series of eight monoclonal
antibodies was generated to human GH and analyzed for the ability
to neutralize GH activity and prevent binding of GH to its
recombinant soluble receptor. The latter studies allowed the
putative binding site for each monoclonal antibody to be localized
within the GH three-dimensional structure. Of interest was that
monoclonal antibodies 1 and 8 were unable to displace GH from
binding its receptor. The binding sites for these monoclonal
antibodies were localized to the B-C loop (monoclonal number 1) and
the N-terminal end of the A-B loop (monoclonal number 8). No
monoclonals were studied that bound the C-D loop specifically. The
monoclonal antibody studies suggest that the B-C loop and
N-terminal end of the A-B loop are non-essential for receptor
binding. Finally, limited cleavage of GH with trypsin was found to
produce a two chain derivative that retained full activity (Mills
et al., 1980; Li, 1982). Mapping studies indicated that trypsin
cleaved and/or deleted amino acids between positions 134 and 149,
which corresponds to the C-D loop. These studies suggest the C-D
loop is not involved in receptor binding or GH bioactivity.
[0052] Structures of a number of cytokines, including G-CSF (Hill
et al., 1993), GM-CSF (Diederichs et al., 1991; Walter et al.,
1992), IL-2 (Bazan, 1992; McKay, 1992), IL-4 (Redfield et al.,
1991; Powers et al., 1992), and IL-5 (Milburn et al., 1993) have
been determined by X-ray diffraction and NMR studies and show
striking conservation with the GH structure, despite a lack of
significant primary sequence homology. EPO is considered to be a
member of this family based upon modeling and mutagenesis studies
(Boissel et al., 1993; Wen et al., 1994). A large number of
additional cytokines and growth factors including ciliary
neurotrophic factor (CNTF), leukemia inhibitory factor (LIF),
thrombopoietin (TPO), oncostatin M, macrophage colony stimulating
factor (M-CSF), IL-3, IL-6, IL-7, IL-9, IL-12, IL-13, IL-15, and
alpha, beta, omega, tau and gamma interferon belong to this family
(reviewed in Mott and Campbell, 1995; Silvennoinen and Ihle 1996).
All of the above cytokines and growth factors are now considered to
comprise one large gene family, of which GH is the prototype.
[0053] In addition to sharing similar secondary and tertiary
structures, members of this family share the property that they
must oligomerize cell surface receptors to activate intracellular
signaling pathways. Some GH family members, e.g., GH and EPO, bind
a single type of receptor and cause it to form homodimers. Other
family members, e.g., IL-2, IL-4, and IL-6, bind more than one type
of receptor and cause the receptors to form heterodimers or higher
order aggregates (Davis et al., 1993; Paonessa et al., 1995; Mott
and Campbell, 1995). Mutagenesis studies have shown that, like GH,
these other cytokines and growth factors contain multiple receptor
binding sites, typically two, and bind their cognate receptors
sequentially (Mott and Campbell, 1995; Matthews et al., 1996). Like
GH, the primary receptor binding sites for these other family
members occur primarily in the four alpha helices and the A-B loop
(reviewed in Mott and Campbell, 1995). The specific amino acids in
the helical bundles that participate in receptor binding differ
amongst the family members (Mott and Campbell, 1995). Most of the
cell surface receptors that interact with members of the GH
supergene family are structurally related and comprise a second
large multi-gene family (Bazan, 1990; Mott and Campbell, 1995;
Silvennoinen and Ihle 1996).
[0054] A general conclusion reached from mutational studies of
various members of the GH supergene family is that the loops
joining the alpha helices generally tend to not be involved in
receptor binding. In particular the short B-C loop appears to be
non-essential for receptor binding in most, if not all, family
members. For this reason, the B-C loop is a preferred region for
introducing cysteine substitutions in members of the GH supergene
family. The A-B loop, the B-C loop, the C-D loop (and D-E loop of
interferon/IL-10-like members of the GH superfamily) also are
preferred sites for introducing cysteine mutations. Amino acids
proximal to helix A and distal to the final helix also tend not to
be involved in receptor binding and also are preferred sites for
introducing cysteine substitutions. Certain members of the GH
family, e.g., EPO, IL-2, IL-3, IL-4, IL-6, G-CSF, GM-CSF, TPO,
IL-10, IL-12 p35, IL-13, IL-15 and beta-interferon contain N-linked
and O-linked sugars. The glycosylation sites in the proteins occur
almost exclusively in the loop regions and not in the alpha helical
bundles. Because the loop regions generally are not involved in
receptor binding and because they are sites for the covalent
attachment of sugar groups, they are preferred sites for
introducing cysteine substitutions into the proteins. Amino acids
that comprise the N- and O-linked glycosylation sites in the
proteins are preferred sites for cysteine substitutions because
these amino acids are surface-exposed, the natural protein can
tolerate bulky sugar groups attached to the proteins at these sites
and the glycosylation sites tend to be located away from the
receptor binding sites.
[0055] Many additional members of the GH gene family are likely to
be discovered in the future. New members of the GH supergene family
can be identified through computer-aided secondary and tertiary
structure analyses of the predicted protein sequences. Members of
the GH supergene family will possess four or five amphipathic
helices joined by non-helical amino acids (the loop regions). The
proteins may contain a hydrophobic signal sequence at their
N-terminus to promote secretion from the cell. Such later
discovered members of the GH supergene family also are included
within this invention.
[0056] The present invention provides "rules" for creating
biologically active cysteine-added variants of members of the GH
supergene family. These "rules" can be applied to any existing or
future member of the GH supergene family. The cysteine-added
variants will posses novel properties not shared by the naturally
occurring proteins. Most importantly, the cysteine added variants
will possess the property that they can be covalently modified with
cysteine-reactive polymers or other types of cysteine-reactive
moieties to generate biologically active proteins with improved
properties such as increased in vivo half-life, increased
solubility and improved in vivo efficacy.
[0057] Specifically, the present invention provides biologically
active cysteine variants of members of the GH supergene family by
substituting cysteine residues for non-essential amino acids in the
proteins. Preferably, the cysteine residues are substituted for
amino acids that comprise the loop regions, for amino acids near
the ends of the alpha helices and for amino acids proximal to the
first amphipathic helix or distal to the final amphipathic helix of
these proteins. Other preferred sites for adding cysteine residues
are at the N-terminus or C-terminus of the proteins. Cysteine
residues also can be introduced between two amino acids in the
disclosed regions of the polypeptide chain. The present invention
teaches that N- and O-linked glycosylation sites in the proteins
are preferred sites for introducing cysteine substitutions either
by substitution for amino acids that make up the sites or, in the
case of N-linked sites, introduction of cysteines therein. The
glycosylation sites can be serine or threonine residues that are
O-glycosylated or asparagine residues that are N-glycosylated.
N-linked glycosylation sites have the general structure
asparagine-X-serine or threonine (N--X--S/T), where X can be any
amino acid. The asparagine residue, the amino acid in the X
position and the serine/threonine residue of the N-linked
glycosylation site are preferred sites for creating biologically
active cysteine-added variants of these proteins. Amino acids
immediately surrounding or adjacent to the O-linked and N-linked
glycosylation sites (within about 10 residues on either side of the
glycosylation site) are preferred sites for introducing
cysteine-substitutions.
[0058] More generally, certain of the "rules" for identifying
preferred sites for creating biologically active cysteine-added
protein variants can be applied to any protein, not just proteins
that are members of the GH supergene family. Specifically,
preferred sites for creating biologically active cysteine variants
of proteins (other than IL-2) are O-linked glycosylation sites.
Amino acids immediately surrounding the O-linked glycosylation site
(within about 10 residues on either side of the glycosylation site)
also are preferred sites. N-linked glycosylation sites, and the
amino acid residues immediately adjacent on either side of the
glycosylation site (within about 10 residues of the N-X-S/T site)
also are preferred sites for creating cysteine added protein
variants. Amino acids that can be replaced with cysteine without
significant loss of biological activity also are preferred sites
for creating cysteine-added protein variants. Such non-essential
amino acids can be identified by performing cysteine-scanning
mutagenesis on the target protein and measuring effects on
biological activity. Cysteine-scanning mutagenesis entails adding
or substituting cysteine residues for individual amino acids in the
polypeptide chain and determining the effect of the cysteine
substitution on biological activity. Cysteine scanning mutagenesis
is similar to alanine-scanning mutagenesis (Cunningham et al.,
1992), except that target amino acids are individually replaced
with cysteine rather than alanine residues.
[0059] Application of the "rules" to create cysteine-added variants
and conjugates of protein antagonists also is contemplated. Excess
production of cytokines and growth factors has been implicated in
the pathology of many inflammatory conditions such as rheumatoid
arthritis, asthma, allergies and wound scarring. Excess production
of GH has been implicated as a cause of acromegaly. Certain growth
factors and cytokines, e.g., GH and IL-6, have been implicated in
proliferation of particular cancers. Many of the growth factors and
cytokines implicated in inflammation and cancer are members of the
GH supergene family. There is considerable interest in developing
protein antagonists of these molecules to treat these diseases. One
strategy involves engineering the cytokines and growth factors so
that they can bind to, but not oligomerize receptors. This is
accomplished by mutagenizing the second receptor binding site (site
JJ) on the molecules. The resulting muteins are able to bind and
occupy receptor sites but are incapable of activating intracellular
signaling pathways. This strategy has been successfully applied to
GH to make a GH antagonist (Cunningham et al., 1992). Similar
strategies are being pursued to develop antagonists of other
members of the GH supergene family such as IL-2 (Zurawski et al.,
1990; Zurawski and Zurawski, 1992), IL-4 (Kruse et al., 1992), IL-5
(Tavernier et al., 1995), GM-CSF (Hercus et al., 1994) and EPO
(Matthews et al., 1996). Since the preferred sites for adding
cysteine residues to members of the GH supergene family described
here lie outside of the receptor binding sites in these proteins,
and thus removed from any sites used to create protein antagonists,
the cysteine-added variants described herein could be used to
generate long-acting versions of protein antagonists. As an
example, Cunningham et al. (1992) developed an in vitro GH
antagonist by mutating a glycine residue (amino acid 120) to an
arginine. This glycine residue is a critical component of the
second receptor binding site in GH; when it is replaced with
arginine, GH cannot dimerize receptors. The glycine to arginine
mutation at position 120 can be introduced into DNA sequences
encoding the cysteine-added variants of GH contemplated herein to
create a cysteine-added GH antagonist that can be conjugated with
cysteine-reactive PEGs or other types of cysteine-reactive
moieties. Similarly, amino acid changes in other proteins that turn
the proteins from agonists to antagonists could be incorporated
into DNA sequences encoding cysteine-added protein variants
described herein. Considerable effort is being spent to identify
amino acid changes that convert protein agonists to antagonists.
Hercus et al. (1994) reported that substituting arginine or lysine
for glutamic acid at position 21 in the mature GM-CSF protein
converts GM-CSF from an agonist to an antagonist. Tavernier et al.
(1995) reported that substituting glutamine for glutamic acid at
position 13 of mature IL-5 creates an IL-5 antagonist. Prolactin
antagonists can be created by substituting other amino acids, in
particular alanine, aspartic acid and glutamic acid, for serine-179
of prolactin (Chen et al., 1998). Receptor antagonists of
erythropoietin can be created by substituting alanine for
arginine-103 of erythopoietin (Matthews et al., 1996).
[0060] Experimental strategies similar to those described above can
be used to create cysteine-added variants (both agonists and
antagonists) of members of the GH supergene family derived from
various animals. This is possible because the primary amino acid
sequences and structures of cytokines and growth factors are
largely conserved between human and animal species. For this
reason, the "rules" disclosed herein for creating biologically
active cysteine-added variants of members of the GH supergene
family will be useful for creating biologically active
cysteine-added variants of members of the GH supergene family of
companion animals (e.g., dogs, cats, horses) and commercial animal
(e.g., cow, sheep, pig) species. Conjugation of these
cysteine-added variants with cysteine-reactive PEGs will create
long-acting versions of these proteins that will benefit the
companion animal and commercial farm animal markets.
[0061] Proteins that are members of the GH supergene family
(hematopoietic cytokines) are provided in Silvennoimem and Ihle
(1996). Silvennoimem and Ihle (1996) also provide information about
the structure and expression of these proteins. DNA sequences,
encoded amino acids and in vitro and in vivo bioassays for the
proteins described herein are described in Aggarwal and Gutterman
(1992; 1996), Aggarwal (1998), and Silvennoimem and Ihle (1996).
Bioassays for the proteins also are provided in catalogues of
various commercial suppliers of these proteins such as R&D
Systems, Inc. and Endogen, Inc.
[0062] The cysteine variants of the present invention can be used
for any of the known therapeutic uses of the native proteins in
essentially the same forms and doses all well known in the art. By
way of example, therapeutic methods for increasing hematopoeisis in
a patient and for accelerating recovery from neutropenia are
described herein which use a cysteine variant of granulocyte
macrophage colony stimulating factor (GM-CSF) according to the
present invention. Also described herein are therapeutic methods
for accelerating recovery from neutropenia in patients using
cysteine variants of granulocyte colony stimulating factor (G-CSF),
therapeutic methods for increasing red blood cell formation and
increasing hematocrit levels in patients using a cysteine variant
of erythopoietin (EPO), and therapeutic methods for inhibiting
growth of cancer cells in patients using cysteine variants of alpha
interferon. It is to be understood, however, that general
discussion regarding modes of administration, dosage and delivery
of cysteine variants such as the GM-CSF, G-CSF, EPO and alpha
interferon cysteine muteins, is generally intended to apply to
therapeutic methods using any of the cysteine variants described
herein.
[0063] One embodiment of the invention relates to a method to treat
or protect an animal from a disease or condition that is amenable
to treatment with granulocyte-macrophage colony stimulating factor
(GM-CSF), comprising administering to the animal a composition
comprising a granulocyte-macrophage colony stimulating factor
(GM-CSF) cysteine mutein as described herein. In one embodiment,
the cysteine mutein is prepared using methods described in PCT
Application No. PCT/US01/16088 (PCT Publication No. WO 01/87925 A2,
published Nov. 22, 2001), incorporated herein by reference in its
entirety.
[0064] Another embodiment of the invention relates to a method to
treat or protect an animal from a disease or condition which is
amenable to treatment with granulocyte colony stimulating factor
(G-CSF), comprising administering to the animal a composition
comprising a granulocyte colony stimulating factor (G-CSF) cysteine
mutein as described herein. In one embodiment, the cysteine mutein
is prepared using methods described in PCT Application No.
PCT/US01/16088, supra.
[0065] Another embodiment of the invention relates to a method to
treat or protect an animal from a disease or condition that is
amenable to treatment with erythropoietin (EPO), comprising
administering to the animal a composition comprising an
erythropoietin (EPO) cysteine mutein as described herein. In one
embodiment, the cysteine mutein is prepared using methods described
in PCT Application No. PCT/US00/00931 (PCT Publication No. WO
00/42175, published Jul. 20, 2000), incorporated herein by
reference in its entirety.
[0066] Another embodiment of the invention relates to a method to
protect an animal from a disease or condition that is amenable to
treatment with alpha interferon, comprising administering to the
animal a composition comprising an alpha interferon cysteine mutein
as described herein. In one embodiment, the cysteine mutein is
prepared using methods described in PCT Application No.
PCT/US00/00931, supra, and PCT Application No. PCT/US01/16088,
supra.
[0067] Another embodiment of the invention relates to a method to
prevent or treat the occurrence of neutropenia in an animal
comprising administering to the animal a composition comprising a
granulocyte-macrophage colony stimulating factor (GM-CSF) cysteine
mutein as described herein and in one embodiment, as prepared using
methods described in PCT Application No. PCT/US01/16088, supra.
Another embodiment of the invention relates to a method to prevent
or treat the occurrence of neutropenia in an animal comprising
administering to the animal a composition comprising a G-CSF
cysteine mutein as described herein and in one embodiment, as
prepared using methods described in PCT Application No.
PCT/US01/16088, supra. The neutropenia to be prevented or treated
using this method can include, but is not limited to: (a)
neutropenia resulting from myelosuppressive chemotherapy; (b)
neutropenia associated with bone marrow transplantation (c)
neutropenia associated with infection with the human
immunodeficiency virus; (d) neutropenia associated with burns,
surgery, dilatation, anemia and neonatal septicemia; (e) severe
chronic neutropenia; or neutropenia associated with aplastic anemia
and acute leukemia.
[0068] Another embodiment of the present invention relates to a
method to protect an animal from a disease or condition by
stimulating proliferation and differentiation of hematopoietic
cells in the animal, comprising administering to said animal a
composition comprising a granulocyte-macrophage colony stimulating
factor (GM-CSF) cysteine mutein as described herein and in one
embodiment, as prepared using methods described in PCT Application
No. PCT/US01/16088, supra.
[0069] Another embodiment of the present invention relates to a
method to protect an animal from a disease or condition by
stimulating proliferation and differentiation of hematopoietic
cells in the animal, comprising administering to said animal a
composition comprising a G-CSF cysteine mutein as described herein
and in one embodiment, as prepared using methods described in PCT
Application No. PCT/US01/16088, supra.
[0070] Another embodiment of the present invention relates to a
method to protect an animal from a disease or condition by
stimulating proliferation and differentiation of hematopoietic
cells in the animal, comprising administering to said animal a
composition comprising an EPO cysteine mutein as described herein
and in one embodiment, as prepared using methods described in PCT
Application No. PCT/US00/00931, supra.
[0071] Hematopoeitic cells include, but are not limited to,
neutrophil, monocyte, eosinophil, erythroid, and megakaryocyte cell
lineages. According to the present invention, a cell of
hematopoietic lineage is able to develop into cell types including,
but not limited to, erythrocyte cells (i.e. a red blood cell),
leukocyte cells (i.e. a white blood cell), or thrombocyte cells
(i.e. platelet cell). Leukocyte cells include, but are not limited
to, granular leukocytes, including eosinophils, basophils,
neutrophils, and mast cells; as well as non-granular leukocytes,
including megakaryocytes, polymorphonuclear cells, lymphocytes and
monocytes (i.e. macrophages). According to the present invention,
the term "lineage" refers to all of the stages of the development
of a cell type, from the earliest precursor cell to a completely
mature cell (i.e. a specialized cell). As used herein, the terms
"develop", "differentiate" and "mature" all refer to the
progression of a cell from the stage of having the potential to
differentiate into at least two different cellular lineages to
becoming a specialized cell. Such terms can be used interchangeably
for the purposes of the present application.
[0072] Yet another embodiment of the present invention relates to a
method for stimulating the expansion and proliferation of
peripheral blood progenitor cells in an animal comprising
administering to the animal a composition comprising a
granulocyte-macrophage colony stimulating factor (GM-CSF) cysteine
mutein as described herein and in one embodiment, as prepared using
methods described in PCT Application No. PCT/US01/16088, supra.
[0073] Another embodiment of the present invention relates to a
method for stimulating the expansion and proliferation of
peripheral blood progenitor cells in an animal comprising
administering to the animal a composition comprising a G-CSF
cysteine mutein as described herein and in one embodiment, as
prepared using methods described in PCT Application No.
PCT/US01/16088, supra.
[0074] Reference to a progenitor cell or a precursor cell is
reference to a group of cells capable of developing into a more
mature cell. A precursor cell population can comprise cells that
are totipotent, cells that are pluripotent and cells that are stem
cell lineage restricted (i.e. cells capable of developing into less
than all hematopoietic lineages, or into, for example, only cells
of erythroid lineage). Peripheral blood progenitor cells are cells
that differentiate into various cells that circulate in the blood,
such as peripheral blood mononuclear cells (PBMC).
[0075] Granulocyte-Macrophage Colony Stimulating Factor (GM-CSF) is
a glycoprotein having a molecular mass of 14.5-35 kDa that
regulates the proliferation and differentiation of hematopoietic
progenitor cells into mature cells such as mature neutrophils,
macrophages and eosinophils. GM-CSF also stimulates the functional
properties of mature monocytes, neutrophils and eosinophils.
Recombinant GM-CSF is used to ameliorate neutropenia following
myelosuppressive chemotherapy and bone marrow transplantation.
GM-CSF also has been used to treat severe chronic neutropenia,
aplastic anemia, and acute leukemia, and to mobilize peripheral
blood progenitor cells for transplantation and blood banking.
GM-CSF also may be useful for reversing neutropenia associated with
the human immunodeficiency virus, burns, surgery, dilatation,
anemia and neonatal septicemia. The ability of GM-CSF to enhance
the functional properties of monocytes, neutrophils and eosinophils
suggests that GM-CSF may have utility as an anti-neoplastic agent
either alone or in combination with other anti-neoplastic agents
such as cytotoxic drugs, chemotherapeutic agents, polyclonal
antibodies and monoclonal antibodies targeting tumor cells. The
immunomodulatory properties of GM-CSF also suggest that GM-CSF may
have utility as an adjuvant for vaccines against tumors and
infectious agents.
[0076] GM-CSF has a short circulating half life, which necessitates
daily subcutaneous injections for maximum effectiveness in humans.
The present inventors have created novel GM-CSF analogs (i.e., the
GM-CSF cysteine muteins described herein) with improved in vivo
characteristics such as increased circulating half-life and
improved therapeutic efficacy through site-specific chemical
modification of the protein with cysteine-reactive Polyethylene
Glycol (PEG) reagents. These analogs were created by introducing a
"free" cysteine residue (i.e., a cysteine residue not involved in a
disulfide bond) into the protein using site-directed mutagenesis.
The free cysteine residue serves as the site for covalent
modification of the protein with cysteine-reactive PEG reagents.
The present application teaches a variety of human GM-CSF cysteine
muteins that can be modified with cysteine-reactive PEG reagents
and retain biological activity, and PCT Application No.
PCT/US01/16088, supra, describes additional methods of preparing
such muteins.
[0077] Human and rodent GM-CSF proteins perform similar functions
in their respective species and studies with rodent GM-CSF proteins
can be used to predict the function of human GM-CSF in humans.
Human and rodent GM-CSF proteins share 50-60% amino acid identity,
but there is no cross species cross-reactivity in terms of
biological activity or receptor binding. It is possible to use the
significant amino acid identity between human and rodent GM-CSF
proteins to construct murine GM-CSF cysteine muteins that are
analogues of human GM-CSF cysteine muteins. The murine GM-CSF
cysteine analogs can be expressed, purified and PEGylated using
procedures similar to those described for human GM-CSF cysteine
variants herein and in PCT Application No. PCT/US01/16088, supra.
Biological activities of the PEGylated murine GM-CSF cysteine
muteins can be tested in rodent animal disease models and used to
predict the effectiveness of PEGylated human GM-CSF cysteine
analogs in humans. Toward that end, the present inventors
constructed the murine GM-CSF T3C mutein, which is an analog of the
human GM-CSF A3C mutein described herein. As shown in Example 26,
the PEGylated murine T3C analog is effective at stimulating
hematopoiesis in a mammal (a rodent), which indicates that
PEGylated human GM-CSF cysteine muteins will be effective at
stimulating hematopoiesis in humans. Stimulating hematopoiesis will
be useful for ameliorating disease indications in which
hematopoiesis is impaired, such as neutropenia (see Example 27).
PEGylated human GM-CSF cysteine analogs can used to ameliorate
neutropenia following myelosuppressive chemotherapy and bone marrow
transplantation based on the observed efficacy of GM-CSF in these
indications (Cebon and Lieschke 1994). Similarly PEGylated human
GM-CSF cysteine analogs will be useful in treating diseases and
conditions for which the therapeutic use of GM-CSF is well
established (Armitage, 1998) such as peripheral blood cell
progenitor cell transplantation, engraftment failure or delay after
bone marrow transplantation, and induction therapy for acute
myelogenous leukemia.
[0078] Similarly, based on the observed effects of GM-CSF,
PEGylated human GM-CSF cysteine analogs also may be useful in
treatment of a wide variety of cancers such as breast cancer, lung
cancer, non-Hodgkin's lymphoma and ovarian cancer, by allowing
chemotherapy dose intensification (Cebon and Lieschke 1994). Human
GM-CSF also can be used to treat severe chronic neutropenia, for
example in Felty syndrome (Joseph et al, 1991) or myelokathexis
(Hess et al.), as well as aplastic anemia, and acute leukemia.
Human GM-CSF (and therefore GM-CSF cysteine variants of the
invention) also may be useful for reversing neutropenia associated
with the human immunodeficiency virus infection, myelodysplastic
syndrome and ideopathic neutropenia (Kaczmarski et al, 1993).
Neutropenia resulting from other causes such as burns, surgery,
dilatation, anemia and neonatal septicemia may also be treated by
administration of PEGylated human GM-CSF cysteine analogs. The
ability of GM-CSF to enhance the functional properties of
monocytes, neutrophils and eosinophils suggests that PEGylated
human GM-CSF cysteine analogs may have utility as an
anti-neoplastic agent either alone or in combination with other
anti-neoplastic agents such as cytotoxic drugs, chemotherapeutic
agents, polyclonal antibodies and monoclonal antibodies targeting
tumor cells (Armitage, 1998). GM-CSF administration may be useful
in the treatment of prostate cancer (Small et al, 1999). GM-CSF
monotherapy also has been reported to reduce melanoma metastases
(Hoeller et al, 2001). GM-CSF also may be useful in the treatment
of melanoma when co-administered with anti-neoplastic agents
(Vaughan et al, 2000). The immunomodulatory properties of GM-CSF
also suggest that PEGylated human GM-CSF cysteine analogs may have
utility as an adjuvant for vaccines against tumors and infectious
agents (Gaudernack and Gjertsen, 1999, Warren and Weiner, 2000).
For example adjuvant therapy using GM-CSF may be useful in
treatment of malignant melanoma (Spitler et al, 2000) following
surgical resection. GM-CSF co-administration with a monoclonal
antibody-based immunogen may be useful in the treatment of
metastatic coleorectal cancer (Rucker et al. 1999). The
immunomodulatory properties of GM-CSF indicate that PEGylated human
GM-CSF cysteine analogs may also provide useful therapy for
enhancing immune function in immunocompromised patients such as
those infected with the HIV virus (Armitage, 1998). The
immunomodulatory properties of GM-CSF indicate that PEGylated human
GM-CSF cysteine analogs may also provide useful therapy against
bacterial and fungal infections (Armitage, 1998; Jones, 1999).
[0079] GM-CSF also may be used to accelerate wound healing of
surgical incisions (Jyung et al., 1994) and also to accelerate
healing of refractory wounds or ulcers such as those of patients
with diabetes Canturk et al, 1999) and PEGylated human GM-CSF
cysteine analogs may also be used in these indications.
[0080] In some diseases, antagonists of GM-CSF activity could
provide therapeutic benefit. For example there is evidence that
rheumatoid arthritis is promoted by GM-CSF activity (Campbell et
al, 1997; Bischof et al, 2000; Campbell et al., 1998; Yang and
Hamilton, 2001) and an anti-GM-CSF antibody has been shown to
reduce the severity of arthritis observed in a murine model (Cook
et al, 2001). Therefore PEGylated human GM-CSF cysteine analogs
that contain one or more additional mutations that result in GM-CSF
antagonist activity could be used to treat arthritis. GM-CSF
activity is similarly implicated in the development and progression
of multiple sclerosis (McQualter et al., 2001) and PEGylated human
GM-CSF cysteine analogs that contain one or more additional
mutations that result in GM-CSF antagonist activity could be used
to treat multiple sclerosis.
[0081] As discussed above, various embodiments of the invention
relate to methods of use of GM-CSF cysteine muteins. In particular,
the present invention relates to the use of these muteins to
protect an animal from a disease or condition that is amenable to
treatment by the use of wild-type GM-CSF or an antagonist thereof,
or which might be particularly amenable to treatment using the
GM-CSF cysteine muteins of the present invention.
[0082] Erythropoietin (EPO) is a 35-39 kDa glycoprotein hormone
produced by the kidney that stimulates red blood cell formation.
EPO is used to treat anemia or low hematocrit levels resulting from
chemotherapy, renal failure, and drug complications, and to boost
red blood cell levels prior to elective surgeries. A limitation of
recombinant human EPO in the clinical setting is the fact that EPO,
although highly glycosylated, has a relatively short circulating
half-life in humans, and pharmacodynamic studies indicate that it
is best given by intravenous or subcutaneous injections 2 to 3
times per week. The present inventors have created novel EPO
analogs (i.e., the EPO cysteine muteins described herein) with
improved in vivo characteristics such as increased circulating
half-life and improved therapeutic efficacy through site-specific
chemical modification of the protein with cysteine-reactive PEG
reagents. These analogs were created by introducing a "free"
cysteine residue (i.e., a cysteine residue not involved in a
disulfide bond) into the protein using site-directed mutagenesis.
The free cysteine residue serves as the site for covalent
modification of the protein with cysteine-reactive PEG reagents.
The present application teaches a variety of human EPO cysteine
muteins that can be modified with cysteine-reactive PEG reagents
and retain biological activity, and PCT Application No.
PCT/US00/00931, supra, describes additional methods of preparing
such muteins.
[0083] The present invention generally relates to methods of use of
erythropoietin ("EPO") cysteine muteins. In particular, the present
invention relates to the use of these muteins to protect an animal
from a disease or condition that is amenable to treatment by the
use of wild-type EPO, or which might be particularly amenable to
treatment using the EPO cysteine muteins of the present invention.
In particular, protecting an animal from a disease is accomplished
by inducing a beneficial or protective therapeutic response in the
animal by administration of an EPO cysteine mutein of the present
invention.
[0084] G-CSF is a 19 kDa glycoprotein cytokine that stimulates the
proliferation, differentiation and functional activation of
neutrophilic granulocytes. G-CSF is widely used to ameliorate
neutropenia following myelosuppressive chemotherapy and bone marrow
transplantation. G-CSF also is used to treat severe chronic
neutropenia, aplastic anemia, acute leukemia and to mobilize
peripheral blood progenitor cells for transplantation and blood
banking. A limitation of G-CSF in the clinical setting is the fact
that G-CSF has a short circulating half-life in humans, which
necessitates daily subcutaneous injections for maximum
effectiveness. The present inventors have created novel G-CSF
analogs (i.e., the G-CSF cysteine muteins described herein) with
improved in vivo characteristics such as increased circulating
half-life and improved therapeutic efficacy through site-specific
chemical modification of the protein with cysteine-reactive PEG
reagents. These analogs were created by introducing a "free"
cysteine residue (i.e., a cysteine residue not involved in a
disulfide bond) into the protein using site-directed mutagenesis.
The free cysteine residue serves as the site for covalent
modification of the protein with cysteine-reactive PEG reagents.
The present application teaches a variety of human G-CSF cysteine
muteins that can be modified with cysteine-reactive PEG reagents
and retain biological activity, and PCT Application No.
PCT/US01/16088, supra, describes additional methods of preparing
such muteins.
[0085] The present invention also relates to methods of use of
G-CSF cysteine muteins. In particular, the present invention
relates to the use of these muteins to protect an animal from a
disease or condition that is amenable to treatment by the use of
wild-type G-CSF, or which might be particularly amenable to
treatment using the G-CSF cysteine muteins of the present
invention. Protecting an animal from a disease is accomplished by
inducing a beneficial or protective therapeutic response in the
animal by administration of a G-CSF cysteine mutein of the present
invention.
[0086] Alpha interferon (IFN-.alpha.) is a protein that exhibits
antiviral and antiproliferative effects on many cell types. There
are over 25 distinct IFN-.alpha. genes. The IFN-.alpha.2 protein is
approved for use in humans and the most is known about its activity
in the human clinical setting. Recombinant IFN-.alpha. is used to
treat viral diseases such as Hepatitis B, Hepatitis C and genital
warts, and cancers including, but not limited to, leukemias,
including hairy cell leukemia, malignant melanoma, and AIDS-related
Kaposi's sarcoma. A limitation of recombinant human IFN-.alpha. in
the clinical setting is the fact that IFN-.alpha. has a short
circulating half-life in humans and generally must be administered
by daily subcutaneous or intramuscular injection or by thrice
weekly injections. The present inventors have created novel
IFN-.alpha. analogs (i.e., the IFN-.alpha. cysteine muteins
described herein) with improved in vivo characteristics such as
increased circulating half-life and improved therapeutic efficacy
through site-specific chemical modification of the protein with
cysteine-reactive PEG reagents. These analogs were created by
introducing a "free" cysteine residue (i.e., a cysteine residue not
involved in a disulfide bond) into the protein using site-directed
mutagenesis. The free cysteine residue serves as the site for
covalent modification of the protein with cysteine-reactive PEG
reagents. The present application teaches a variety of human
IFN-.alpha. cysteine muteins that can be modified with
cysteine-reactive PEG reagents and retain biological activity, and
PCT Application No. PCT/US01/16088, supra, and PCT/US00/00931,
supra, describe additional methods of preparing such muteins. The
present invention generally relates to methods of use of
IFN-.alpha. cysteine muteins. In particular, the present invention
relates to the use of these muteins to protect an animal from a
disease or condition that is amenable to treatment by the use of
wild-type IFN-.alpha., or which might be particularly amenable to
treatment using the IFN-.alpha. cysteine muteins of the present
invention. In particular, protecting an animal from a disease is
accomplished by inducing a beneficial or protective therapeutic
response in the animal by administration of an IFN-.alpha. cysteine
mutein of the present invention.
[0087] As used herein, the phrase "protected from a disease" refers
to reducing the symptoms of the disease, reducing the occurrence of
the disease, and/or reducing the severity of the disease.
Protecting an animal can refer to the ability of a therapeutic
composition of the present invention, when administered to an
animal, to prevent a disease from occurring and/or to cure or to
alleviate disease symptoms, signs or causes. As such, to protect an
animal from a disease includes both preventing disease occurrence
(prophylactic treatment) and treating an animal that has a disease
or that is experiencing initial symptoms of a disease (therapeutic
treatment). In particular, protecting an animal from a disease is
accomplished by inducing a beneficial or protective therapeutic
response in the animal by administration of a GM-CSF cysteine
mutein, a G-CSF cysteine mutein, an EPO cysteine mutein, an
IFN-.alpha. cysteine mutein, or any of the other cysteine muteins
of the present invention as described herein. The term, "disease"
refers to any deviation from the normal health of a mammal and
includes a state when disease symptoms are present, as well as
conditions in which a deviation (e.g., infection, gene mutation,
genetic defect, etc.) has occurred, but symptoms are not yet
manifested.
[0088] Accordingly, a GM-CSF cysteine mutein of the present
invention can be administered to regulate the proliferation and
differentiation of hematopoietic progenitor cells into mature cells
such as neutrophils, macrophages and eosinophils. A GM-CSF cysteine
mutein can also be administered to stimulate the functional
properties of mature monocytes, neutrophils and eosinophils. A
GM-CSF cysteine mutein, or antagonist thereof, can be administered
to an animal to prevent or ameliorate any disease or condition for
which the use of the wild-type protein, or antagonist thereof,
respectively, can be used. Such diseases and conditions are
described in detail above. In one embodiment, a GM-CSF cysteine
mutein of the present invention is used as an anti-neoplastic agent
either alone or in combination with other anti-neoplastic agents
such as cytotoxic drugs, chemotherapeutic agents, polyclonal
antibodies and monoclonal antibodies targeting tumor cells. In yet
another embodiment, the GM-CSF cysteine mutein of the present
invention is used as an adjuvant for vaccines against tumors and
infectious agents.
[0089] Accordingly, an EPO cysteine mutein of the present invention
can be administered to regulate the proliferation and
differentiation of hematopoietic progenitor cells into mature cells
such as red blood cells. An EPO cysteine mutein, or antagonist
thereof, can be administered to an animal to prevent or ameliorate
any disease or condition for which the use of the wild-type
protein, or antagonist thereof, respectively, can be used. Such
diseases and conditions are described in detail above. Accordingly,
an EPO cysteine mutein of the present invention can be administered
to treat anemia or low blood hematocrit levels resulting from
chemotherapy, renal disease, renal failure, and drug complications,
and to boost red blood cell levels prior to elective surgeries.
[0090] As discussed above, an EPO cysteine mutein or composition
comprising the same of the present invention is administered to an
animal in a manner effective to deliver the composition to a target
cell, a target tissue, or systemically to the animal, whereby
provision of a therapeutic benefit is achieved as a result of the
administration of the mutein or composition. Suitable
administration protocols include any in vivo or ex vivo
administration protocol. According to the present invention,
suitable methods of administering a composition of the present
invention to a patient include any route of in vivo administration
that is suitable for delivering the composition into a patient. The
preferred routes of administration will be apparent to those of
skill in the art, depending on the type of condition to be
prevented or treated and/or the target cell population.
[0091] The present invention also relates to methods of use of
G-CSF cysteine muteins. A G-CSF cysteine mutein, or antagonist
thereof, can be administered to an animal to prevent or ameliorate
any disease or condition for which the use of the wild-type
protein, or antagonist thereof, respectively, can be used.
Accordingly, a G-CSF cysteine mutein of the present invention can
be administered to regulate the proliferation and differentiation
of hematopoietic progenitor cells into mature neutrophils,
macrophages and eosinophils. A G-CSF cysteine mutein can also be
administered to stimulates the functional properties of mature
neutrophils and eosinophils. Another embodiment of the invention is
the administration of a G-CSF cysteine mutein to ameliorate
neutropenia following myelosuppressive chemotherapy and/or bone
marrow transplantation. A G-CSF cysteine mutein of the present
invention can also be administered to an animal to treat severe
chronic neutropenia, aplastic anemia, and acute leukemia, and to
mobilize peripheral blood progenitor cells for transplantation and
blood banking. A G-CSF cysteine mutein of the present invention can
also be administered to an animal to reverse neutropenia associated
with the human immunodeficiency virus, burns, surgery, dilatation,
anemia and neonatal septicemia.
[0092] As discussed above, a G-CSF cysteine mutein or composition
comprising the same of the present invention is administered to an
animal in a manner effective to deliver the composition to a target
cell, a target tissue, or systemically to the animal, whereby
provision of a therapeutic benefit is achieved as a result of the
administration of the mutein or composition. Suitable
administration protocols include any in vivo or ex vivo
administration protocol. According to the present invention,
suitable methods of administering a composition of the present
invention to a patient include any route of in vivo administration
that is suitable for delivering the composition into a patient. The
preferred routes of administration will be apparent to those of
skill in the art, depending on the type of condition to be
prevented or treated and/or the target cell population.
[0093] The present invention also relates to methods of use of
IFN-.alpha. cysteine muteins. An IFN-.alpha. cysteine mutein, or
antagonist thereof, can be administered to an animal to prevent or
ameliorate any disease or condition for which the use of the
wild-type protein, or antagonist thereof, respectively, can be
used. Accordingly, an IFN-.alpha. cysteine mutein of the present
invention can be administered to treat viral diseases including,
but not limited to Hepatitis B, Hepatitis C, Severe Acute
Respiratory Syndrome (SARS) and genital warts, and to treat various
cancers including, but not limited to leukemias, hairy cell
leukemia, melanoma, breast cancer, colon cancer, and Kaposi's
sarcoma. In one embodiment, an IFN-.alpha. cysteine mutein of the
present invention is used as an anti-neoplastic agent either alone
or in combination with other anti-neoplastic agents such as
cytotoxic drugs, chemotherapeutic agents, polyclonal antibodies and
monoclonal antibodies targeting tumor cells. In yet another
embodiment, an IFN-.alpha. cysteine mutein of the present invention
is used as an antiviral agent either alone or in combination with
other antiviral agents such as other anti-viral drugs, including
ribivarin and its derivatives, other cytokines such as GM-CSF,
interleukin-2, other alpha interferon species, beta interferon, and
gamma interferon, and polyclonal antibodies and monoclonal
antibodies targeting viruses or virally infected cells.
[0094] As discussed above, an IFN-.alpha. cysteine mutein or
composition comprising the same of the present invention is
administered to an animal in a manner effective to deliver the
composition to a target cell, a target tissue, or systemically to
the animal, whereby provision of a therapeutic benefit is achieved
as a result of the administration of the mutein or composition.
Suitable administration protocols include any in vivo or ex vivo
administration protocol. According to the present invention,
suitable methods of administering a composition of the present
invention to a patient include any route of in vivo administration
that is suitable for delivering the composition into a patient. The
preferred routes of administration will be apparent to those of
skill in the art, depending on the type of condition to be
prevented or treated and/or the target cell population.
[0095] Cysteine muteins of the present invention are preferably
administered in a composition. Compositions can include a cysteine
mutein of the invention and any other suitable pharmaceutically
acceptable carrier, as well as, in some aspects, additional
components that may be useful in the treatment of a give disease or
condition. According to the present invention, a "pharmaceutically
acceptable carrier" includes pharmaceutically acceptable excipients
and/or pharmaceutically acceptable delivery vehicles, which are
suitable for use in administration of the composition to a suitable
in vitro, ex vivo or in vivo site. A suitable in vitro, in vivo or
ex vivo site is preferably any site where the cysteine mutein will
provide a detectable effect as compared to in the absence of the
mutein, and includes a disease site or a site of cell types to be
contacted with the mutein. Preferred pharmaceutically acceptable
carriers are capable of maintaining the mutein of the present
invention in a form that, upon arrival of the mutein at the cell
target in a culture or in patient, the mutein is capable of
interacting with its target (e.g., hematopoeitic cell for
GM-CSF).
[0096] Suitable excipients of the present invention include
excipients or formularies that transport or help transport, but do
not specifically target a composition to a cell or area (also
referred to herein as non-targeting carriers). Examples of
pharmaceutically acceptable excipients include, but are not limited
to water, phosphate buffered saline, Ringer's solution, dextrose
solution, serum-containing solutions, Hank's solution, other
aqueous physiologically balanced solutions, oils, esters and
glycols. Aqueous carriers can contain suitable auxiliary substances
required to approximate the physiological conditions of the
recipient, for example, by enhancing chemical stability and
isotonicity. Compositions of the present invention can be
sterilized by conventional methods and/or lyophilized.
[0097] One type of pharmaceutically acceptable carrier includes a
controlled release formulation that is capable of slowly releasing
a composition of the present invention into a patient or culture.
As used herein, a controlled release formulation comprises a
cysteine mutein of the present invention in a controlled release
vehicle. Suitable controlled release vehicles include, but are not
limited to, biocompatible polymers, other polymeric matrices,
capsules, microcapsules, microparticles, bolus preparations,
osmotic pumps, diffusion devices, liposomes, lipospheres, and
transdermal delivery systems. Other carriers of the present
invention include liquids that, upon administration to a patient,
form a solid or a gel in situ. Preferred carriers are also
biodegradable (i.e., bioerodible). In the event that a cysteine
mutein of the invention is administered as a recombinant nucleic
acid molecule encoding the cysteine mutein (e.g., gene therapy or
genetic immunization), suitable carriers include, but are not
limited to liposomes, viral vectors or other carriers, including
ribozymes, gold particles, poly-L-lysine/DNA-molecular conjugates,
and artificial chromosomes. Natural lipid-containing carriers
include cells and cellular membranes. Artificial lipid-containing
carriers include liposomes and micelles.
[0098] A carrier of the present invention can be modified to target
to a particular site in a patient, thereby targeting and making use
of a compound of the present invention at that site. A
pharmaceutically acceptable carrier which is capable of targeting
can also be referred to herein as a "delivery vehicle" or
"targeting carrier". Suitable modifications include manipulating
the chemical formula of the lipid portion of the delivery vehicle
and/or introducing into the vehicle a targeting agent capable of
specifically targeting a delivery vehicle to a preferred site or
target site, for example, a preferred cell type. A "target site"
refers to a site in a patient to which one desires to deliver a
composition. Suitable targeting compounds include ligands capable
of selectively (i.e., specifically) binding another molecule at a
particular site. Examples of such ligands include antibodies,
antigens, receptors and receptor ligands. Manipulating the chemical
formula of the lipid portion of the delivery vehicle can modulate
the extracellular or intracellular targeting of the delivery
vehicle. For example, a chemical can be added to the lipid formula
of a liposome that alters the charge of the lipid bilayer of the
liposome so that the liposome fuses with particular cells having
particular charge characteristics.
[0099] One delivery vehicle of the present invention is a liposome.
A liposome is capable of remaining stable in an animal for a
sufficient amount of time to deliver a nucleic acid molecule or
protein described in the present invention to a preferred site in
the animal. A liposome, according to the present invention,
comprises a lipid composition that is capable of delivering a
nucleic acid molecule or protein to a particular, or selected, site
in a patient. A liposome according to the present invention
comprises a lipid composition that is capable of fusing with the
plasma membrane of the targeted cell to deliver a nucleic acid
molecule or protein into a cell. Suitable liposomes for use with
the present invention include any liposome. Preferred liposomes of
the present invention include those liposomes commonly used in, for
example, gene delivery methods known to those of skill in the art.
More preferred liposomes comprise liposomes having a polycationic
lipid composition and/or liposomes having a cholesterol backbone
conjugated to polyethylene glycol. Complexing a liposome with a
nucleic acid molecule or protein of the present invention can be
achieved using methods standard in the art.
[0100] Another type of delivery vehicle, when the cysteine mutein
is administered as a nucleic acid encoding the mutein, comprises a
viral vector. A viral vector includes an isolated nucleic acid
molecule, in which the nucleic acid molecules are packaged in a
viral coat that allows entrance of DNA into a cell. A number of
viral vectors can be used, including, but not limited to, those
based on alphaviruses, poxviruses, adenoviruses, herpesviruses,
lentiviruses, adeno-associated viruses and retroviruses.
[0101] According to the present invention, an effective
administration protocol (i.e., administering a therapeutic
composition in an effective manner) comprises suitable dose
parameters and modes of administration that result in the desired
effect in the patient (e.g., stimulation of proliferation and/or
differentiation of neutrophils), preferably so that the patient is
protected from the disease (e.g., by disease prevention or by
alleviating one or more symptoms of ongoing disease). Effective
dose parameters can be determined using methods standard in the art
for a particular disease. Such methods include, for example,
determination of survival rates, side effects (i.e., toxicity) and
progression or regression of disease.
[0102] In accordance with the present invention, a suitable single
dose size is a dose that results in the desired therapeutic effect
in the patient, depending on the cysteine mutein that is
administered, or in the amelioration of at least one symptom of a
condition in the patient, when administered one or more times over
a suitable time period. Doses can vary depending upon the disease
being treated. One of skill in the art can readily determine
appropriate single dose sizes for a given patient based on the size
of a patient and the route of administration.
[0103] In one aspect of the invention, a suitable single dose of a
therapeutic composition of the present invention is an amount that,
when administered by any route of administration, provides a
therapeutic effect in the patient as described above, as compared
to a patient which has not been administered with the therapeutic
composition of the present invention (i.e., a control patient), as
compared to the patient prior to administration of the composition,
or as compared to a standard established for the particular
disease, patient type and composition.
[0104] In one aspect of the invention an appropriate single dose of
a cysteine mutein of the present invention is at least about 0.01
.mu.g per kg of the animal to which the mutein is administered, and
in other aspects, at least about 0.1 .mu.g/kg, at least about 0.2
.mu.g/kg, at least about 0.5 .mu.g/kg, at least about 1 .mu.g/kg,
at least about 5 .mu.g/kg, at least about 10 .mu.g/kg, at least
about 25 .mu.g/kg, at least about 50 .mu.g/kg, at least about 75
.mu.g/kg, at least about 100 .mu.g/kg, at least about 200 .mu.g/kg,
at least about 300 .mu.g/kg, at least about 400 .mu.g/kg, at least
about 500 .mu.g/kg, at least about 750 .mu.g/kg, at least about 1
mg/kg, or at least about 5 mg/kg. In one embodiment, a preferred
single dose of a GM-CSF cysteine mutein of the present invention is
at least about 0.1 .mu.g/kg, and more preferably, from about 25 to
about 300 .mu.g/kg. In one embodiment, a preferred single dose of
an EPO cysteine mutein of the present invention is at least about
0.01 .mu.g/kg, and more preferably, from about 1 to about 300
.mu.g/kg. In one embodiment, a preferred single dose of a G-CSF
cysteine mutein of the present invention is at least about 0.1
.mu.g/kg, and more preferably, from about 1 to about 300 .mu.g/kg.
In one embodiment, a preferred single dose of an IFN-.alpha.
cysteine mutein of the present invention is at least about 0.1
.mu.g/kg, and more preferably, from about 1 to about 300
.mu.g/kg.
[0105] As discussed above, a therapeutic composition of the present
invention is administered to a patient in a manner effective to
deliver the composition to a cell, a tissue, and/or systemically to
the patient, whereby the desired result is achieved as a result of
the administration of the composition. Suitable administration
protocols include any in vivo or ex vivo administration protocol.
The preferred routes of administration will be apparent to those of
skill in the art, depending on the type of condition to be
prevented or treated; whether the composition is nucleic acid based
or protein based; and/or the target cell/tissue. For proteins or
nucleic acid molecules, preferred methods of in vivo administration
include, but are not limited to, intravenous administration,
intraperitoneal administration, intramuscular administration,
intranodal administration, intracoronary administration,
intraarterial administration (e.g., into a carotid artery),
subcutaneous administration, transdermal delivery, intratracheal
administration, subcutaneous administration, intraarticular
administration, intraventricular administration, inhalation (e.g.,
aerosol), intracranial, intraspinal, intraocular, intranasal, oral,
bronchial, rectal, topical, vaginal, urethral, pulmonary
administration, impregnation of a catheter, and direct injection
into a tissue. Routes useful for deliver to mucosal tissues
include, bronchial, intradermal, intramuscular, intranasal, other
inhalatory, rectal, subcutaneous, topical, transdermal, vaginal and
urethral routes. Combinations of routes of delivery can be used and
in some instances, may enhance the therapeutic effects of the
composition. Particularly preferred routes of delivery include
subcutaneous and intravenous delivery.
[0106] Ex vivo administration refers to performing part of the
regulatory step outside of the patient, such as administering a
composition of the present invention to a population of cells
removed from a patient under conditions such that the composition
contacts and/or enters the cell, and returning the cells to the
patient. Ex vivo methods are particularly suitable when the target
cell type can easily be removed from and returned to the
patient.
[0107] Many of the above-described routes of administration,
including intravenous, intraperitoneal, intradermal, and
intramuscular administrations can be performed using methods
standard in the art. Aerosol (inhalation) delivery can also be
performed using methods standard in the art (see, for example,
Stribling et al., Proc. Natl. Acad. Sci. USA 189:11277-11281, 1992,
which is incorporated herein by reference in its entirety). Oral
delivery can be performed by complexing a therapeutic composition
of the present invention to a carrier capable of withstanding
degradation by digestive enzymes in the gut of an animal. Examples
of such carriers, include plastic capsules or tablets, such as
those known in the art.
[0108] One method of local administration is by direct injection.
Direct injection techniques are particularly useful for
administering a composition to a cell or tissue that is accessible
by surgery, and particularly, on or near the surface of the body.
Administration of a composition locally within the area of a target
cell refers to injecting the composition centimeters and
preferably, millimeters from the target cell or tissue.
[0109] Various methods of administration and delivery vehicles
disclosed herein have been shown to be effective for delivery of a
nucleic acid molecule to a target cell, whereby the nucleic acid
molecule transfected the cell and was expressed. In many studies,
successful delivery and expression of a heterologous gene was
achieved in preferred cell types and/or using preferred delivery
vehicles and routes of administration of the present invention. All
of the publications discussed below and elsewhere herein with
regard to gene delivery and delivery vehicles are incorporated
herein by reference in their entirety.
[0110] For example, using liposome delivery, U.S. Pat. No.
5,705,151, issued Jan. 6, 1998, to Dow et al. demonstrated the
successful in vivo intravenous delivery of a nucleic acid molecule
encoding a superantigen and a nucleic acid molecule encoding a
cytokine in a cationic liposome delivery vehicle, whereby the
encoded proteins were expressed in tissues of the animal, and
particularly in pulmonary tissues. In addition, Liu et al., Nature
Biotechnology 15:167, 1997, demonstrated that intravenous delivery
of cholesterol-containing cationic liposomes containing genes
preferentially targets pulmonary tissues and effectively mediates
transfer and expression of the genes in vivo. Several publications
by Dzau and collaborators demonstrate the successful in vivo
delivery and expression of a gene into cells of the heart,
including cardiac myocytes and fibroblasts and vascular smooth
muscle cells using both naked DNA and Hemagglutinating virus of
Japan-liposome delivery, administered by both incubation within the
pericardium and infusion into a coronary artery (intracoronary
delivery) (See, for example, Aoki et al., 1997, J. Mol. Cell,
Cardiol. 29:949-959; Kaneda et al., 1997, Ann N.Y. Acad. Sci.
811:299-308; and von der Leyen et al., 1995, Proc Natl Acad Sci USA
92:1137-1141).
[0111] Delivery of numerous nucleic acid sequences has been
accomplished by administration of viral vectors encoding the
nucleic acid sequences. Using such vectors, successful delivery and
expression has been achieved using ex vivo delivery (See, of many
examples, retroviral vector; Blaese et al., 1995, Science
270:475-480; Bordignon et al., 1995, Science 270:470-475), nasal
administration (CFTR-adenovirus-associated vector), intracoronary
administration (adenoviral vector and Hemagglutinating virus of
Japan, see above), intravenous administration (adeno-associated
viral vector; Koeberl et al., 1997, Proc Natl Acad Sci USA
94:1426-1431). A publication by Maurice et al. (1999, J. Clin.
Invest. 104:21-29) demonstrated that an adenoviral vector encoding
a .beta.2-adrenergic receptor, administered by intracoronary
delivery, resulted in diffuse multichamber myocardial expression of
the gene in vivo, and subsequent significant increases in
hemodynamic function and other improved physiological parameters.
Levine et al. describe in vitro, ex vivo and in vivo delivery and
expression of a gene to human adipocytes and rabbit adipocytes
using an adenoviral vector and direct injection of the constructs
into adipose tissue (Levine et al., 1998, J. Nutr. Sci. Vitaminol.
44:569-572).
[0112] In the area of neuronal gene delivery, multiple successful
in vivo gene transfers have been reported. Millecamps et al.
reported the targeting of adenoviral vectors to neurons using
neuron restrictive enhancer elements placed upstream of the
promoter for the transgene (phosphoglycerate promoter). Such
vectors were administered to mice and rats intramuscularly and
intracerebrally, respectively, resulting in successful
neuronal-specific transfection and expression of the transgene in
vivo (Millecamps et al., 1999, Nat. Biotechnol. 17:865-869). As
discussed above, Bennett et al. reported the use of
adeno-associated viral vector to deliver and express a gene by
subretinal injection in the neural retina in vivo for greater than
1 year (Bennett, 1999, ibid.).
[0113] Gene delivery to synovial lining cells and articular joints
has had similar successes. Oligino and colleagues report the use of
a herpes simplex viral vector which is deficient for the immediate
early genes, ICP4, 22 and 27, to deliver and express two different
receptors in synovial lining cells in vivo (Oligino et al., 1999,
Gene Ther. 6:1713-1720). The herpes vectors were administered by
intraarticular injection. Kuboki et al. used adenoviral
vector-mediated gene transfer and intraarticular injection to
successfully and specifically express a gene in the
temporomandibular joints of guinea pigs in vivo (Kuboki et al.,
1999, Arch. Oral. Biol. 44:701-709). Apparailly and colleagues
systemically administered adenoviral vectors encoding IL-10 to mice
and demonstrated successful expression of the gene product and
profound therapeutic effects in the treatment of experimentally
induced arthritis (Apparailly et al., 1998, J. Immunol.
160:5213-5220). In another study, murine leukemia virus-based
retroviral vector was used to deliver (by intraarticular injection)
and express a human growth hormone gene both ex vivo and in vivo
(Ghivizzani et al., 1997, Gene Ther. 4:977-982). This study showed
that expression by in vivo gene transfer was at least equivalent to
that of the ex vivo gene transfer. As discussed above, Sawchuk et
al. has reported successful in vivo adenoviral vector delivery of a
gene by intraarticular injection, and prolonged expression of the
gene in the synovium by pretreatment of the joint with anti-T cell
receptor monoclonal antibody (Sawchuk et al., 1996, ibid. Finally,
it is noted that ex vivo gene transfer of human interleukin-1
receptor antagonist using a retrovirus has produced high level
intraarticular expression and therapeutic efficacy in treatment of
arthritis, and is now entering FDA approved human gene therapy
trials (Evans and Robbins, 1996, Curr. Opin. Rheumatol. 8:230-234).
Therefore, the state of the art in gene therapy has led the FDA to
consider human gene therapy an appropriate strategy for the
treatment of at least arthritis. Taken together, all of the above
studies in gene therapy indicate that delivery and expression of a
recombinant nucleic acid molecule according to the present
invention is feasible.
[0114] Another method of delivery of recombinant molecules is in a
non-targeting carrier (e.g., as "naked" DNA molecules, such as is
taught, for example in Wolff et al., 1990, Science 247, 1465-1468).
Such recombinant nucleic acid molecules are typically injected by
direct or intramuscular administration. Recombinant nucleic acid
molecules to be administered by naked DNA administration include an
isolated nucleic acid molecule of the present invention, and
preferably includes a recombinant molecule of the present invention
that preferably is replication, or otherwise amplification,
competent. A naked nucleic acid reagent of the present invention
can comprise one or more nucleic acid molecules of the present
invention including a dicistronic recombinant molecule. Naked
nucleic acid delivery can include intramuscular, subcutaneous,
intradermal, transdermal, intranasal and oral routes of
administration, with direct injection into the target tissue being
most preferred. A preferred single dose of a naked nucleic acid
vaccine ranges from about 1 nanogram (ng) to about 100 .mu.g,
depending on the route of administration and/or method of delivery,
as can be determined by those skilled in the art. Suitable delivery
methods include, for example, by injection, as drops, aerosolized
and/or topically. In one embodiment, pure DNA constructs cover the
surface of gold particles (1 to 3 .mu.m in diameter) and are
propelled into skin cells or muscle with a "gene gun."
[0115] In the method of the present invention, compositions can be
administered to any animal and preferably, to any member of the
Vertebrate class, Mammalia, including, without limitation,
primates, rodents, livestock and domestic pets. Livestock include
mammals to be consumed or that produce useful products (e.g., sheep
for wool production). Preferred mammals to protect include humans,
dogs, cats, mice, rats, sheep, cattle, horses and pigs, with humans
being particularly preferred.
[0116] The following examples are provided to demonstrate how the
"rules" described herein can be used to create cysteine-added
variants of GH, erythropoietin, alpha interferon, beta interferon,
G-CSF, GM-CSF and other members of the GH supergene family. The
examples also demonstrate the therapeutic uses of cysteine variants
of the present invention. The examples are not intended to be
limiting, but only exemplary of specific embodiments of the
invention.
EXAMPLE 1
Cysteine-Added Variants of GH
[0117] This example discloses certain amino acids in GH that are
non-essential for biological activity and which, when mutated to
cysteine residues, will not alter the normal disulfide binding
pattern and overall conformation of the molecule. These amino acids
are located at the N-terminal end of the A-B loop (amino acids
34-52 of the mature protein sequence; SEQ ID NO: 1; Martial et al
1979; Goeddel et al 1979), the B-C loop (amino acids 97-105 in the
mature protein sequence), and the C-D loop (amino acids 130-153 in
the mature protein sequence). Also identified as preferred sites
for introducing cysteine residues are the first three or last three
amino acids in the A, B, C and D helices and the amino acids
proximal to helix A (amino acids 1-5) and distal to helix D (amino
acids 184-191). Helix A encompasses amino acids 6-33, helix B
encompasses amino acids 75-96, helix C encompasses amino acids
106-129 and helix D encompasses amino acids 154-183. The entire A-B
loop encompasses amino acids 34-74.
[0118] DNA sequences encoding wild type GH can be amplified using
the polymerase chain reaction technique from commercially available
single-stranded cDNA prepared from human pituitaries (ClonTech, San
Diego, Calif.) or assembled using overlapping oligonucleotides.
Specific mutations can be introduced into the GH sequence using a
variety of procedures such as phage techniques (Kunkel et al 1987),
PCR mutagenesis techniques (Innis et al 1990; White 1993)
mutagenesis kits such as those sold by Stratagene ("Quick-Change
Mutagenesis" kit, San Diego, Calif.) or Promega (Gene Editor Kit,
Madison Wis.).
[0119] Cysteine substitutions can be introduced into any of the
amino acids comprising the B-C loop, C-D loop and N-terminal end of
the A-B loop or into the first three amino acids of the alpha
helical regions that adjoin these regions or in the region proximal
to helix A or distal to helix D. Preferred sites for introduction
of cysteine residues are: F1, T3, P5, E33, A34, K38, E39, Q40, S43,
Q46, N47, P48, Q49, T50, S51, S55, T60, A98, N99, S100, G104, A105,
S106, E129, D130, G131, S132, P133, T135, G136, Q137, K140, Q141,
T142, S144, K145, D147, T148, N149, S150, H151, N152, D153, S184,
E186, G187, S188, and G190. Cysteine residues also can be
introduced at the beginning of the mature protein, i.e., proximal
to the F1 amino acid, or following the last amino acid in the
mature protein, i.e., following F191. If desirable, two or more
such mutations can be readily combined in the same protein either
by in vitro DNA recombination of cloned mutant genes and/or
sequential construction of individual desired mutations.
1. Cloning the Gene for Human Growth Hormone (GH)
[0120] The human GH gene was amplified from human pituitary
single-stranded cDNA (commercially available from CLONTECH, Inc.,
Palo Alto, Calif.) using the polymerase chain reaction (PCR)
technique and primers BB1 and BB2. The sequence of BB1 is
5'-GGGGGTCGACCATATGTTCCCAACCATTCCCTTATCCAG-3' (SEQ ID NO: 24). The
sequence of BB2 is 5'-GGGGGATCCTCACTAGAAGCCACAGCTGCCCTC-3' (SEQ ID
NO: 25). Primer BB1 was designed to encode an initiator methionine
preceding the first amino acid of mature GH, phenylalanine, and
SalI and NdeI sites for cloning purposes. The reverse primer, BB2,
contains a BamHI site for cloning purposes. The PCR 100 microliter
reactions contained 20 pmoles of each oligonucleotide primer,
1.times.PCR buffer (Perkin-Elmer buffer containing MgCl.sub.2), 200
micromolar concentration of each of the four nucleotides dA, dC, dG
and dT, 2 ng of single-stranded cDNA, 2.5 units of Taq polymerase
(Perkin-Elmer) and 2.5 units of Pfu polymerase (Stratagene, Inc).
The PCR reaction conditions were 96.degree. C. for 3 minutes, 35
cycles of (95.degree. C., 1 minute; 63.degree. C. for 30 seconds;
72.degree. C. for 1 minute), followed by 10 minutes at 72.degree.
C. The thermocycler employed was the Amplitron II Thermal Cycler
(Thermolyne). The approximate 600 bp PCR product was digested with
SalI and BamHI, gel purified and cloned into similarly digested
plasmid pUC19 (commercially available from New England BioLabs,
Beverly, Mass.). The ligation mixture was transformed into E. coli
strain DH5alpha and transformants selected on LB plates containing
ampicillin. Several colonies were grown overnight in LB media and
plasmid DNA isolated using miniplasmid DNA isolation kits purchased
from Qiagen, Inc (Valencia, Calif.). Clone LB6 was determined to
have the correct DNA sequence.
[0121] For expression in E. coli, clone LB6 was digested with NdeI
and EcoRI, the approximate 600 bp fragment gel-purified, and cloned
into plasmid pCYB1 (commercially available from New England
BioLabs, Beverly, Mass.) that had been digested with the same
enzymes and phosphatased. The ligation mixture was transformed into
E. coli DH5alpha and transformants selected on LB ampicillin
plates. Plasmid DNA was isolated from several transformants and
screened by digestion with NdeI and EcoRI. A correct clone was
identified and named pCYB1: wtGH (pBBT120). This plasmid was
transformed into E. coli strains JM109 or W3110 (available from New
England BioLabs and the American Type Culture Collection).
2. Construction of STII-GH
[0122] Wild type GH clone LB6 (pUC19: wild type GH) was used as the
template to construct a GH clone containing the E. coli STII signal
sequence (Picken et al. 1983). Because of its length, the STII
sequence was added in two sequential PCR reactions. The first
reaction used forward primer BB12 and reverse primer BB10. BB10 has
the sequence: 5'CGCGGATCCGATTAGAATCCACAGCTCCCCTC 3' (SEQ ID NO:
28).
[0123] BB12 has the sequence: TABLE-US-00001 (SEQ ID NO:30)
5'ATCTATGTTCGTTTTCTCTATCGCTACCAACGCTTACGCATTCCCAAC
CATTCCCTTATCCAG-3'.
[0124] The PCR reactions were as described for amplifying wild type
GH except that approximately 4 ng of plasmid LB6 was used as the
template rather than single-stranded cDNA and the PCR conditions
were 96.degree. C. for 3 minutes, 30 cycles of (95.degree. C. for 1
minute; 63.degree. C. for 30 seconds; 72.degree. C. for 1 minute)
followed by 72.degree. C. for 10 minutes. The approximate 630 bp
PCR product was gel-purified using the Qiaex II Gel Extraction Kit
(Qiagen, Inc), diluted 50-fold in water and 2 microliters used as
template for the second PCR reaction. The second PCR reaction used
reverse primer BB10 and forward primer BB11. BB11 has the sequence:
TABLE-US-00002 (SEQ ID NO:29)
5'CCCCCTCTAGACATATGAAGAAGAACATCGCATTCCTGCTGGCATCTA
TGTTCGTTTTCTCTATCG-3'.
[0125] Primer BB111 contains XbaI and NdeI sites for cloning
purposes. PCR conditions were as described for the first reaction.
The approximate 660 bp PCR product was digested with XbaI and
BamHI, gel-purified and cloned into similarly cut plasmid
pCDNA3.1(+) (Invitrogen, Inc. Carlsbad, Calif.). Clone
pCDNA3.1(+)::stII-GH(5C) or "5C" was determined to have the correct
DNA sequence.
[0126] Clone "5C" was cleaved with NdeI and BamHI and cloned into
similarly cut pBBT108 (a derivative of pUC19 which lacks a Pst I
site, this plasmid is described below). A clone with the correct
insert was identified following digestion with these enzymes. This
clone, designated pBBT111, was digested with NdeI and SalI, the 660
bp fragment containing the stII-GH fusion gene, was gel-purified
and cloned into the plasmid expression vector pCYB1 (New England
BioLabs) that had been digested with the same enzymes and
phosphatased. A recombinant plasmid containing the stII-GH
insertion was identified by restriction endonuclease digestions.
One such isolate was chosen for further studies and was designated
pBBT114. This plasmid was transformed into E. coli strains JM109 or
W3110 (available from New England BioLabs and the American Type
Culture Collection).
3. Construction of ompA-GH
[0127] Wild type GH clone LB6 (pUC19: wild type GH) was used as the
template to construct a GH clone containing the E. coli ompA signal
sequence (Movva et al 1980). Because of its length, the ompA
sequence was added in two sequential PCR reactions. The first
reaction used forward primer BB7: TABLE-US-00003 (SEQ ID NO:31)
5'GCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCCTTCCCAACC ATTCCCTTATCCAG
3',
[0128] and reverse primer BB10: TABLE-US-00004 (SEQ ID NO:28) 5'
CGCGGATCCGATTAGAATCCACAGCTCCCCTC 3'.
[0129] The PCR reactions were as described for amplifying wild type
GH except that approximately 4 ng of plasmid LB6 was used as the
template rather than single-stranded cDNA and the PCR conditions
were 96.degree. C. for 3 minutes, 30 cycles of (95.degree. C. for 1
minute; 63.degree. C. for 30 seconds; 72.degree. C. for 1 minute)
followed by 72.degree. C. for 10 minutes. The approximate 630 bp
PCR product was gel-purified using the Qiaex II Gel Extraction Kit
(Qiagen, Inc), diluted 50-fold in water and 2 microliters used as
template for the second PCR reaction. The second PCR reaction used
reverse primer BB10 and forward PrimerBB6: TABLE-US-00005 (SEQ ID
NO:32) 5'CCCCGTCGACACATATGAAGAAGACAGCTATCGCGATTGCAGTGGCAC
TGGCTGGTTTC 3'.
[0130] PCR conditions were as described for the first reaction. The
approximate 660 bp PCR product was gel-purified, digested with Sal
I and Bam H1 and cloned into pUC19 (New England BioLabs) which was
cut with Sal I and Bam H1 or pCDNA3.1(+) (Invitrogen) which had
been cut by Xho I and Bam H1 (Sal I and Xho I produce compatible
single-stranded overhangs). When several clones were sequenced, it
was discovered that all pUC19 clones (8/8) contained errors in the
region of the ompA sequence. Only one pCDNA3.1(+) clone was
sequenced and it contained a sequence ambiguity in the ompA region.
In order to generate a correct ompA-GH fusion gene segments of two
sequenced clones which contained different errors separated by a
convenient restriction site were recombined and cloned into the
pUC19-derivative that lacks the Pst I site (see pBBT108 described
below). The resulting plasmid, termed pBBT112, carries the ompA-GH
fusion gene cloned as an Nde I-Bam H1 fragment into these same
sites in pBBT108. This plasmid is designated pBBT112 and is used in
PCR-based, site-specific mutagenesis of GH as described below.
4. Construction of Pst-pUC19
[0131] To facilitate mutagenesis of the cloned GH gene for
construction of selected cysteine substitution and insertion
mutations a derivative of the plasmid pUC19 (New England BioLabs)
lacking a Pst I site was constructed as follows. pUC19 plasmid DNA
was digested with Pst I and subsequently treated at 75 deg. C. with
PFU DNA Polymerase (Stratagene) using the vendor-supplied reaction
buffer supplemented with 200 uM dNTPs. Under these conditions the
polymerase will digest the 3' single-stranded overhang created by
Pst I digestion but will not digest into the double-stranded
region. The net result will be the deletion of the 4
single-stranded bases which comprise the middle four bases of the
Pst I recognition site. The resulting molecule has double-stranded,
i.e., "blunt", ends. Following these enzymatic reactions, the
linear monomer was gel-purified using the Qiaex II Gel Extraction
Kit (Qiagen, Inc). This purified DNA was treated with T4 DNA Ligase
(New England BioLabs) according to the vendor protocols, digested
with Pst I, and used to transform E coli DH5alpha. Transformants
were picked and analyzed by restriction digestion with Pst I and
Bam H1. One of the transformants which was not cleaved by Pst I but
was cleaved at the nearby Bam H1 site was picked and designated
pBBT108.
5. Construction of GH Muteins
[0132] GH muteins were generally constructed using site-directed
PCR-based mutagenesis as described in PCR Protocols: Current
Methods and Applications edited by B. A. White, 1993 Humana Press,
Inc., Totowa, N.J. and PCR Protocols: A Guide to Methods and
Applications edited by Innis, M. A. et al 1990 Academic Press Inc
San Diego, Calif. Typically PCR primer oligonucleotides are
designed to incorporate nucleotide changes to the coding sequence
of GH that result in substitution of a cysteine residue for an
amino acid at a specific position within the protein. Such
mutagenic oligonucleotide primers can also be designed to
incorporate an additional cysteine residue at the carboxy terminus
or amino terminus of the coding sequence of GH. In this latter case
one or more additional amino acid residues could also be
incorporated at the amino terminal and/or carboxy terminal to the
added cysteine residue if that were desirable. Moreover,
oligonucleotides can be designed to incorporate cysteine residues
as insertion mutations at specific positions within the GH coding
sequence if that were desirable. Again, one or more additional
amino acids could be inserted along with the cysteine residue and
these amino acids could be positioned at the amino terminal and/or
carboxy terminal to the cysteine residue.
[0133] The cysteine substitution mutation T135C was constructed as
follows. The mutagenic reverse oligonucleotide BB28: TABLE-US-00006
(SEQ ID NO:33) 5'CTGCTTGAAGATCTGCCCACACCGGGGGCTGCCATC3'
was designed to change the codon ACT for threonine at amino acid
residue 135 to a TGT codon encoding cysteine and to span the nearby
Bgl II site. This oligonucleotide was used in PCR along with the
forward oligonucleotide BB34 5'GTAGCGCAGGCCTTCCCAACCATT3' (SEQ ID
NO: 34) which anneals to the junction region of the ompA-GH fusion
gene and is not mutagenic. The PCR was performed in a 50 ul
reaction in 1.times.PCR buffer (Perkin-Elmer buffer containing 1.5
mM MgCl.sub.2), 200 micromolar concentration of each of the four
nucleotides dA, dC, dG and dT, with each oligonucleotide primer
present at 0.5 .mu.M, 5 pg of pBBT112 (described above) as template
and 1.25 units of Amplitac DNA Polymerase (Perkin-Elmer) and 0.125
units of PFU DNA Polymerase (Stratagene). Reactions were performed
in a Robocycler Gradient 96 thermal cycler (Stratagene). The
program used entailed: 95 deg C. for 3 minutes followed by 25
cycles of 95 deg C. for 60 seconds, 45 deg C. or 50 deg C. or 55
deg C. for 75 seconds, 72 deg C. for 60 seconds followed by a hold
at 6 deg C. The PCR reactions were analyzed by agarose gel
electrophoresis to identify annealing temperatures that gave
significant product of the expected size; .about.430 bp. The 45-deg
C reaction was "cleaned up" using the QIAquick PCR Purification Kit
(Qiagen), digested with Bgl II and Pst I. The resulting 278 bp Bgl
II-Pst I fragment, which includes the putative T135C mutation, was
gel-purified and ligated into pBBT111 the pUC19 derivative carrying
the stII-GH fusion gene (described above) which had been digested
with Bgl II and Pst I and gel-purified. Transformants from this
ligation were initially screened by digestion with Bgl II and Pst I
and subsequently one clone was sequenced to confirm the presence of
the T135C mutation and the absence of any additional mutations that
could potentially be introduced by the PCR reaction or by the
synthetic oligonucleotides. The sequenced clone was found to have
the correct sequence.
[0134] The substitution mutation S132C was constructed using the
protocol described above for T135C with the following differences:
mutagenic reverse oligonucleotide BB29
5'CTGCTTGAAGATCTGCCCAGTCCGGGGGCAGCCATCTTC3' (SEQ ID NO: 35) was
used instead of BB28 and the PCR reaction with annealing
temperature of 50 deg C. was used for cloning. One of two clones
sequenced was found to have the correct sequence.
[0135] The substitution mutation T148C was constructed using an
analogous protocol but employing a different cloning strategy. The
mutagenic forward oligonucleotide BB30
5'GGGCAGATCTTCAAGCAGACCTACAGCAAGTTCGACTGCAACTCACACAAC3' (SEQ ID NO:
36) was used in PCR with the non-mutagenic reverse primer BB33
5'CGCGGTACCCGGGATCCGATTAGAATCCACAGCT3' (SEQ ID NO: 37) which
anneals to the most 3' end of the GH coding sequence and spans the
Bam H1 site immediately downstream. PCR was performed as described
above with the exception that the annealing temperatures used were
46, 51 and 56 deg C. Following PCR and gel analysis as described
above the 46 and 51 deg C. reactions were pooled for cloning. These
were digested with Bam H1 and Bgl II, gel-purified and cloned into
pBBT111 which had been digested with Bam H1 and Bgl II, treated
with Calf intestinal Alkaline Phosphatase (Promega) according to
the vendor protocols, and gel-purified. Transformants from this
ligation were analyzed by digestion with Bam H1 and Bgl II to
identify clones in which the 188 bp Bam H1-Bgl II mutagenic PCR
fragment was cloned in the proper orientation. Because Bam H1 and
Bgl II generate compatible ends, this cloning step is not
orientation specific. Five of six clones tested were shown to be
correctly oriented. One of these was sequenced and was shown to
contain the desired T148C mutation. The sequence of the remainder
of the 188 bp Bam H1-Bgl II mutagenic PCR fragment in this clone
was confirmed as correct.
[0136] The construction of the substitution mutation S144C was
identical to the construction of T148C with the following
exceptions. Mutagenic forward oligonucleotide BB31 TABLE-US-00007
BB32 (SEQ ID NO:39)
5'CGCGGTACCGGATCCTTAGCAGAAGCCACAGCTGCCCTCCAC3'
was used instead of BB30. Two of six clones tested were shown to be
correctly oriented. One of these was sequenced and was shown to
contain the desired S144C mutation. The sequence of the remainder
of the 188 bp Bam H1-Bgl II mutagenic PCR fragment in this clone
was confirmed as correct.
[0137] A mutation was also constructed that added a cysteine
residue to the natural carboxy terminus of GH. The construction of
this mutation, termed stp192C, was similar to that of T148C, but
employed different oligonucleotide primers. The reverse mutagenic
oligonucleotide: TABLE-US-00008 BB31 (SEQ ID NO:38)
5'GGGCAGATCTTCAAGCAGACCTACTGCAAGTTCGAC3'
which inserts a TGC codon for cysteine between the codon for the
carboxy terminal phe residue of GH and the TAA translational stop
codon and spans the nearby Bam H1 site was used along with BB34
5'GTAGCGCAGGCCTTCCCAACCATT3' (SEQ ID NO: 40) which is described
above. Following PCR and gel analysis as described above, the 46
deg C. reaction was used for cloning. Three of six clones tested
were shown to be correctly oriented. One of these was sequenced and
was shown to contain the desired stp192C mutation. The sequence of
the remainder of the 188 bp Bam H1-Bgl II mutagenic PCR fragment in
this clone was confirmed as correct.
[0138] Analogous PCR mutagenesis procedures can be used to generate
other cysteine mutations. The choice of sequences for mutagenic
oligonucleotides will be dictated by the position where the desired
cysteine residue is to be placed and the propinquity of useful
restriction endonuclease sites. Generally, it is desirable to place
the mutation, i.e., the mismatched segment near the middle of the
oligonucleotide to enhance the annealing of the oligonucleotide to
the template. Appropriate annealing temperatures for any
oligonucleotide can be determined empirically. It is also desirable
for the mutagenic oligonucleotide to span a unique restriction site
so that the PCR product can be cleaved to generate a fragment that
can be readily cloned into a suitable vector, e.g., one that can be
used to express the mutein or provides convenient restriction sites
for excising the mutated gene and readily cloning it into such an
expression vector. Sometimes mutation sites and restriction sites
are separated by distances that are greater than that which is
desirable for synthesis of synthetic oligonucleotides: it is
generally desirable to keep such oligonucleotides under 80 bases in
length and lengths of 30-40 bases are more preferable.
[0139] In instances where this is not possible, genes targeted for
mutagenesis could be re-engineered or re-synthesized to incorporate
restriction sites at appropriate positions. Alternatively,
variations of PCR mutagenesis protocols employed above, such as the
so-called "Megaprimer Method" (Barik, S., pp. 277-286 in Methods in
Molecular Biology, Vol. 15: PCR Protocols: Current Methods and
Applications edited by B. A. White, 1993, Humana Press, Inc.,
Totowa, N.J.) or "Gene Splicing by Overlap Extension" (Horton, R.
M., pp. 251-261, in Methods in Molecular Biology, Vol. 15: PCR
Protocols: Current Methods and Applications, edited by B. A. White,
1993, Humana Press, Inc., Totowa, N.J.) can also be employed to
construct such mutations.
6. Expression of GH in pCYB1
[0140] To express GH in E. coli, pBBT120 (GH gene with no leader
sequence cloned into the tac expression vector pCYB1) and pBBT114
(GH gene with stII leader sequence cloned into the tac expression
vector pCYB1) were transformed into E. coli strains JM109 and
W3110. The parental vector pCYB1 was also transformed into JM109
and W3110.
[0141] These strains were given the following designations:
TABLE-US-00009 BOB119: JM109 (pCYB1) BOB130: W3110 (pCYB1) BOB129:
JM109 (pBBT120) BOB133: W3110 (pBBT120) BOB121: JM109 (pBBT114)
BOB132: W3110 (pBBT114)
[0142] For expression, strains were grown overnight at 37.degree.
C. in Luria Broth (LB) (Sambrook, et al 1989) containing 100
.mu.g/ml ampicillin. These saturated overnight cultures were
diluted to .about.0.03 OD at A.sub.600 in LB containing 100
.mu.g/ml ampicillin and incubated at 37.degree. C. in shake flasks
in rotary shaker, typically at 250-300 rpm. ODs were monitored and
IPTG was added to a final concentration of 0.5 mM when culture ODs
reached .about.0.25-0.5, typically between 0.3 and 0.4. Cultures
were sampled typically at 1, 3, 5 and .about.16 h post-induction.
The ".about.16 h" time points represented overnight incubation of
the cultures and exact times varied from .about.15-20 h. Samples of
induced and uninduced cultures were pelleted by centrifugation,
resuspended in 1.times. sample buffer (50 mM Tris-HCl (pH 6.8), 2%
sodium lauryl sulfate, 10% glycerol, 0.1% bromphenol blue) with the
addition of 1% .beta.-mercaptoethanol when desirable. Samples were
boiled for .about.10 minutes or heated to 95.degree. C. for
.about.10 minutes. Samples were cooled to room temperature before
being loaded onto SDS polyacrylamide gels or were stored at
-20.degree. C. if not run immediately. Samples were run on precast
15% polyacrylamide "Ready Gels" (Bio-Rad, Hercules Calif.) using a
Ready Gel Cell electrophoresis apparatus (Bio-Rad) according to the
vendor protocols. Typically gels were run at 200 volts for
.about.35-45 minutes. Gels were stained with Coomassie Blue or were
analyzed by Western Blot following electro-blotting. Coomassie
staining of whole cell lysates from strains BOB129, BOB133, BOB121
and BOB 132 showed a band of .about.22 kD that co-migrated with
purified recombinant human GH standard purchased from Research
Diagnostics Inc (Flanders, N.J.). That band was most prominent in
induced cultures following overnight induction. However, a band was
also observed at that molecular weight in uninduced cultures of
these same strains and could also be observed with and without
induction in the BOB119 and BOB130 control strains that carried the
expression vector pCYB1 lacking the GH gene. To clarify this
observation, Western Blot analyses were performed on whole cell
lysates of induced cultures of strains BOB119, BOB130, BOB129,
BOB133, BOB121, and BOB132. Western blots were performed with
polyclonal rabbit anti-human GH antiserum purchased from United
States Biological; catalogue # G 9000-11 (Swampscott, Mass.) This
primary antibody was used at a 1:5000 dilution and its binding was
detected with goat anti-rabbit IgG Fc conjugated to alkaline
phosphatase, (product # 31341) purchased from Pierce (Rockford,
Ill.). This secondary antibody was used at a 1:10,0000 dilution.
Alkaline phosphatase activity was detected using the
ImmunoPure.RTM. Fast Red TR/AS-MX Substrate Kit (Pierce, Rockford
Ill.) according to the vendor protocols. The Western Blots clearly
demonstrated presence of GH in lysates of induced cultures of
BOB129, BOB133, BOB121, and BOB132 at both 3 and 16 h
post-induction. In the induced culture of control strains, BOB119
and BOB130, no GH was detected by Western blot at 3 or 16 h
post-induction time points.
[0143] In these preliminary experiments, the highest yields of GH
were obtained from BOB132 W3110(pBBT114) in which the GH gene is
fused downstream of the stII secretion signal sequence. This strain
was tested further to determine if the GH protein was secreted to
the periplasm as would be expected. An induced culture of BOB132
was prepared as described above and subjected to osmotic shock
according to the procedure of Koshland and Botstein (Cell 20 (1980)
pp. 749-760). This procedure ruptures the outer membrane and
releases the contents of the periplasm into the surrounding medium.
Subsequent centrifugation separates the periplasmic contents,
present in the supernatant from the remainder of the
cell-associated components. In this experiment, the bulk of the GH
synthesized by BOB132 was found to be localized to the periplasm.
This result is consistent with the finding that the bulk of the
total GH is also indistinguishable in size from the purified GH
standard, which indicated that the stII signal sequence had been
removed. This is indicative of secretion. A larger scale (500 ml)
culture of BOB132 was also induced, cultured overnight and
subjected to osmotic shock according to the procedure described by
Hsiung et al, 1986 (Bio/Technology 4, pp. 991-995). Gel analysis
again demonstrated that the bulk of the GH produced was soluble,
periplasmic, and indistinguishable in size from the GH standard.
This material could also be quantitatively bound to, and eluted
from, a Q-Sepharose column using conditions very similar to those
described for recombinant human GH by Becker and Hsiung, 1986 (FEBS
Lett 204 pp 145-150).
7. Cloning the Human GH Receptor
[0144] The human GH receptor was cloned by PCR using forward primer
BB3 and reverse primer BB4. BB3 has the sequence: TABLE-US-00010
(SEQ ID NO:26) 5'-CCCCGGATCCGCCACCATGGATCTCTGGCAGCTGCTGTT-3'.
[0145] BB4 has the sequence: TABLE-US-00011 (SEQ ID NO:27)
5'CCCCGTCGACTCTAGAGCTATTAAATACGTAGCTCTTGGG-3'.
The template was single-stranded cDNA prepared from human liver
(commercially available from CLONTECH Laboratories). Primers BB3
and BB4 contain BamHI and SalI restriction sites, respectively, for
cloning purposes. The 100 .mu.l PCR reactions contained 2.5 ng of
the single-stranded cDNA and 20 picomoles of each primer in
1.times.PCR buffer (Perkin-Elmer buffer containing MgCl.sub.2), 200
micromolar concentration of each of the four nucleotides dA, dC, dG
and dT, 2.5 units of Taq polymerase (Perkin-Elmer) and 2.5 units of
Pfu polymerase (Stratagene, Inc). The PCR reaction conditions were:
96.degree. C. for 3 minutes, 35 cycles of (95.degree. C., 1 minute;
58.degree. C. for 30 seconds; 72.degree. C. for 2 minutes),
followed by 10 minutes at 72.degree. C. The thermocycler employed
was the Amplitron II Thermal Cycler (Thermolyne). The approximate
1.9 kb PCR product was digested with BamHI and SalI and ligated
with similarly cut plasmid pUC19 (New England BioLabs). However,
none of the transformants obtained from this ligation reaction
contained the 1.9 kb PCR fragment. Leung et al (Nature 1987 330 pp
537-543) also failed to obtain full-length cDNA clones of the human
GH receptor in pUC19. Subsequently the PCR fragment was cloned into
a low copy number vector, pACYC184 (New England BioLabs) at the
BamHI and SalI sites in this vector. Such clones were obtained at
reasonable frequencies but E coli strains carrying the cloned PCR
fragment grew poorly, forming tiny and heterogeneous looking
colonies, in the presence of chloramphenicol, which is used to
select for maintenance of pACYC184.
[0146] The PCR fragment was simultaneously cloned into pCDNA3.1 (+)
(Invitrogen). The approximate 1.9 kb PCR product was digested with
BamHI and SalI and ligated into the
[0147] BamHI and XhoI cloning sites of pCDNA3.1 (+). Only
infrequent transformants from this ligation contained the cloned GH
receptor cDNA and all of those were found to contain deletions of
segments of the receptor coding sequence. One of these clones was
sequenced and found to contain a deletion of 135 bp within the GH
receptor coding sequence: the sequence of the rest of the gene was
in agreement with that reported by Leung et al (1987).
8. Cloning the Rabbit GH Receptor
[0148] The rabbit GH receptor was cloned by PCR using forward
primer BB3 (described above) and reverse primer BB36. BB36 has the
sequence TABLE-US-00012 (SEQ ID NO: 41)
5'CCCCGTCGACTCTAGAGCCATTAGATACAAAGCTCTTGGG3'
and contains XbaI and Sal I restriction sites for cloning purposes.
Rabbit liver poly(A).sup.+ mRNA was purchased from CLONTECH, Inc.
and used as the substrate in first strand synthesis of
single-stranded cDNA to produce template for PCR amplification.
First strand synthesis of single-stranded cDNA was accomplished
using a 1st Strand cDNA Synthesis Kit for RT-PCR (AMV) kit from
Boehringer Mannheim Corp (Indianapolis, Ind.) according to the
vendor protocols. Parallel first strand cDNA syntheses were
performed using random hexamers or BB36 as the primer. Subsequent
PCR reactions with the products of the first strand syntheses as
templates, were carried out with primers BB3 and BB36 according to
the 1st Strand cDNA Synthesis Kit for RT-PCR (AMV) kit protocol and
using 2.5 units of Amplitac DNA Polymerase (Perkin-Elmer) and 0.625
units of Pfu DNA Polymerase (Stratagene). The PCR reaction
conditions were 96.degree. C. for 3 minutes, 35 cycles of
(95.degree. C., 1 minute; 58.degree. C. for 30 seconds; 72.degree.
C. for 2 minutes), followed by 10 minutes at 72.degree. C. The
thermocycler employed was the Amplitron II Thermal Cycler
(Thermolyne). The expected .about.1.9 kb PCR product was observed
in PCR reactions using random hexamer-primed or BB36 primed cDNA as
template. The random hexamer-primed cDNA was used in subsequent
cloning experiments. It was digested with Bam H1 and XbaI and run
out over a 1.2% agarose gel. This digest generates two fragments
(.about.365 bp and .about.1600 bp) because the rabbit GH receptor
gene contains an internal Bam H1 site. Both fragments were
gel-purified. Initially the .about.1600 bp Bam H1-XbaI fragment was
cloned into pCDNA3.1 (+) which had been digested with these same
two enzymes. These clones were readily obtained at reasonable
frequencies and showed no evidence of deletions as determined by
restriction digests and subsequent sequencing. To generate a full
length clone, one of the plasmids containing the 1600 bp Bam H1-Xba
I fragment (pCDNA3.1(+):: rab-ghr-2A) was digested with Bam H1,
treated with Calf Intestinal Alkaline Phosphatase (Promega)
according to the vendor protocols, gel-purified and ligated with
the gel purified .about.365 bp Bam H1 fragment that contains the 5'
portion of the rabbit GH receptor gene. Transformants from this
ligation were picked and analyzed by restriction digestion and PCR
to confirm the presence of the .about.365 bp fragment and to
determine its orientation relative to the distal segment of the
rabbit GH receptor gene. Three out of four clones analyzed were
found to contain the .about.365 bp fragment cloned in the correct
orientation for reconstitution of the rabbit GH receptor gene. The
lack of complications in the cloning in E coli of the rabbit gene,
in contrast to the human gene, is consistent with the results of
Leung et al (1987) who also readily obtained full length cDNA
clones for the rabbit GH receptor gene but were unable to clone a
full length cDNA of the human gene in E coli. The rabbit GH
receptor can be employed in assays with human GH as a ligand as it
has been shown that the human GH binds the rabbit receptor with
high affinity (Leung et al 1987). Plasmids containing the cloned
rabbit GH receptor should be sequenced to identify a rabbit GH
receptor cDNA with the correct sequence before use. 9. Construction
of a Human/Rabbit Chimeric GH Receptor Gene
[0149] As an alternative to the rabbit receptor, a chimeric
receptor could be constructed which combines the extracellular
domain of the human receptor with the transmembrane and cytoplasmic
domains of the rabbit receptor. Such a chimeric receptor could be
constructed by recombining the human and rabbit genes at the unique
Nco I site that is present in each (Leung et al 1987). Such a
recombinant, containing the human gene segment located 5' to, or
"upstream" of the Nco I site and the rabbit gene segment 3' to, or
"downstream" of the Nco I site would encode a chimeric receptor of
precisely the desired type, having the extracellular domain of the
human receptor with the transmembrane and cytoplasmic domains of
the rabbit receptor. This would allow analysis of the interaction
of GH, GH muteins, and PEGylated GH muteins with the natural
receptor binding site but could avoid the necessity of cloning the
full length human GH receptor in E coli.
[0150] The GH muteins can be expressed in a variety of expression
systems such as bacteria, yeast or insect cells. Vectors for
expressing GH muteins in these systems are available commercially
from a number of suppliers such as Novagen, Inc. (pET15b for
expression in E. coli), New England Biolabs (pC4B1 for expression
in E. coli) Invitrogen (pVL1392, pVL1393, and pMELBAC for
expression in insect cells using Baculovirus vectors, Pichia
vectors for expression in yeast cells, and pCDNA3 for expression in
mammalian cells). GH has been successfully produced in E. coli as a
cytoplasmic protein and as a secreted, periplasmic, protein using
the E. coli OmpA or STII signal sequences to promote secretion of
the protein into the periplasmic space (Chang et al., 1987; Hsiung
et al., 1986). It is preferable that the GH muteins are expressed
as secreted proteins so that they do not contain an N-terminal
methionine residue, which is not present in the natural human
protein. For expression in E. coli, DNA sequences encoding GH or GH
muteins can be cloned into E. coli expression vectors such as
pET15b that uses the strong T7 promoter or pCYB1 that uses the TAC
promoter. Adding IPTG (isopropylthiogalactopyranoside, available
form Sigma Chemical Company) to the growth media, can induce
expression of the protein. Recombinant GH will be secreted into the
periplasmic space from which it can be released by, and
subsequently purified, following osmotic shock (Becker and Hsiung,
1986). The protein can be purified further using other
chromatographic methods such as ion-exchange, hydrophobic
interaction, size-exclusion and reversed phase chromatography, all
of which are well known to those of skill in the art (e.g., see
Becker and Hsiung, 1986). Protein concentrations can be determined
using commercially available protein assay kits such as those sold
by BioRad Laboratories (Richmond, Calif.). If the GH proteins are
insoluble when expressed in E. coli they can be refolded using
procedures well known to those skilled in the art (see Cox et al.,
1994 and World patent applications WO9422466 and WO9412219).
[0151] Alternatively, the proteins can be expressed in insect cells
as secreted proteins. The expression plasmid can be modified to
contain the GH signal sequence to promote secretion of the protein
into the medium. The cDNAs can be cloned into commercially
available vectors, e.g., pVL1392 from Invitrogen, Inc., and used to
infect insect cells. The GH and GH muteins can be purified from
conditioned media using conventional chromatography procedures.
Antibodies to rhGH can be used in conjunction with Western blots to
localize fractions containing the GH proteins during
chromatography. Alternatively, fractions containing GH can be
identified using ELISA assays.
[0152] The cysteine-added GH variants also can be expressed as
intracellular or secreted proteins in eukaryotic cells such as
yeast, insect cells or mammalian cells. Vectors for expressing the
proteins and methods for performing such experiments are described
in catalogues from various commercial supply companies such as
Invitrogen, Inc., Stratagene, Inc. and ClonTech, Inc. The GH and GH
muteins can be purified using conventional chromatography
procedures.
[0153] Biological activity of the GH muteins can be measured using
a cell line that proliferates in response to GH. Fuh et al. (1992)
created a GH-responsive cell line by stably transforming a myeloid
leukemia cell line, FDC-P1, with a chimeric receptor comprising the
extracellular domain of the rabbit GH receptor fused to the mouse
G-CSF receptor. This cell line proliferates in response to GH with
a half maximal effective concentration (EC.sub.50) of 20 picomolar.
A similar cell line can be constructed using the published
sequences of these receptors and standard molecular biology
techniques (Fuh et al., 1992). Alternatively, the extracellular
domain of the human GH receptor can be fused to the mouse G-CSF
receptor using the published sequences of these receptors and
standard molecular biology techniques. Transformed cells expressing
the chimeric receptor can be identified by flow cytometry using
labeled GH, by the ability of transformed cells to bind
radiolabeled GH, or by the ability of transformed cells to
proliferate in response to added GH. Purified GH and GH muteins can
be tested in cell proliferation assays using cells expressing the
chimeric receptor to measure specific activities of the proteins.
Cells can be plated in 96-well dishes with various concentrations
of GH or GH muteins. After 18 h, cells are treated for 4 hours with
.sup.3H-thymidine and harvested for determination of incorporated
radioactivity. The EC.sub.50 can be determined for each mutein.
Assays should be performed at least three times for each mutein
using triplicate wells for each data point. GH muteins displaying
similar optimal levels of stimulation and EC.sub.50 values
comparable to or greater than wild type GH are preferable.
[0154] GH muteins that retain in vitro activity can be PEGylated
using a cysteine-reactive 8 kDa PEG-maleimide (or PEG-vinylsulfone)
commercially available from Shearwater, Inc. Generally, methods for
PEGylating the proteins with these reagents will be similar to
those described in world patent applications WO 9412219 and WO
9422466 and PCT application US95/06540, with minor modifications.
The recombinant proteins must be partially reduced with
dithiothreitol (DTT) in order to achieve optimal PEGylation of the
free cysteine. Although the free cysteine is not involved in a
disulfide bond, it is relatively unreactive to cysteine-reactive
PEGs unless this partial reduction step is performed. The amount of
DTT required to partially reduce each mutein can be determined
empirically, using a range of DTT concentrations. Typically, a 5-10
fold molar excess of DTT for 30 min at room temperature is
sufficient. Partial reduction can be detected by a slight shift in
the elution profile of the protein from a reversed-phase column.
Care must be taken not to over-reduce the protein and expose
additional cysteine residues. Over-reduction can be detected by
reversed phase-HPLC (the protein will have a retention time similar
to the fully reduced and denatured protein) and by the appearance
of GH molecules containing two PEGs (detectable by a molecular
weight change on SDS-PAGE). Wild type GH can serve as a control
since it should not PEGylate under similar conditions. Excess DTT
can be removed by size exclusion chromatography using spin columns.
The partially reduced protein can be reacted with various
concentrations of PEG-maleimide (PEG: protein molar ratios of 1:1,
5:1, 10:1 and 50:1) to determine the optimum ratio of the two
reagents. PEGylation of the protein can be monitored by a molecular
weight shift using sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE). The lowest amount of PEG that gives
significant quantities of mono-pegylated product without giving
di-pegylated product will be considered optimum (80% conversion to
mono-pegylated product is considered good). Generally,
mono-PEGylated protein can be purified from non-PEGylated protein
and unreacted PEG by size-exclusion or ion exchange chromatography.
The purified PEGylated protein can be tested in the cell
proliferation assay described above to determine its specific
activity.
[0155] The above experiments will allow identification of amino
acids in the B-C loop, C-D loop or N-terminal end of the A-B loop
in GH that can be changed to cysteine residues, PEGylated and
retain in vitro biological activity. These muteins can be tested in
animal disease models well known in the art.
[0156] Experiments can be performed to confirm that the PEG
molecule is attached to the protein at the proper site. This can be
accomplished by proteolytic digestion of the protein, purification
of the PEG peptide (which will have a large molecular weight) by
size exclusion, ion exchange or reversed phase chromatography,
followed by amino acid sequencing or mass spectroscopy. The
PEG-coupled amino acid will appear as a blank in the amino acid
sequencing run.
[0157] The pharmacokinetic properties of the PEG-GH proteins can be
determined as follows, or as described in world patent application
WO9422466. Pairs of rats or mice can receive an intravenous bolus
injection of the test proteins. Circulating levels of the proteins
are measured over the course of 24 h by removing a small sample of
blood from the animals at desired time points. Circulating levels
of the test proteins can be quantitated using ELISA assays.
Additional experiments can be performed using the subcutaneous
route to administer the proteins. Similar experiments should be
performed with the non-PEGylated protein to serve as a control.
These experiments will reveal whether attachment of a PEG reagent
to the protein alters its pharmacokinetic properties. Covalent
modification of the protein with PEG should increase the protein's
circulating half-life relative to the unPEGylated protein. Larger
PEG molecules and/or attachment of multiple PEG molecules should
lengthen the circulating half-life longer than smaller PEG
molecules.
[0158] PEG-GH proteins can be tested in rodent models of growth
hormone deficiency (Cox et al., 1994) and cachexia (Tomas et al.,
1992; Read et al., 1992) to determine optimum dosing schedules and
demonstrate efficacy. These studies can explore different size PEG
molecules, e.g., 8 and 20 kDa, and dosing schedules to determine
the optimum PEG size and dosing schedule. It is expected that the
larger PEG molecule will increase the circulating half-life greater
than the smaller PEG molecule and will require less frequent
dosing. However, large proteins potentially may have reduced
volumes of distribution in vivo; thus, it is possible a 20 kDa PEG
attached to GH will limit bioavailability, reducing its efficacy.
Rodent models will allow determination of whether this is the case.
Once the optimum dosing schedules and PEG sizes are determined, the
efficacy of PEG-GH to GH can be compared in the animal models.
While all PEG-GH proteins having GH activity are included in the
invention, the preferred PEG-GH proteins are those that enhance
growth equal or superior to GH, but which can be given less
frequently. PEG-GH should be more efficacious than GH when both are
administered using the less frequent dosing schedules.
[0159] One GH deficiency model that can be used is a
hypophysectomized rat. GH stimulates body weight gain and bone and
cartilage growth in this model (Cox et al., 1994).
Hypophysectomized rats can be purchased from Charles River. Rats
can be injected with GH, PEG-GH or placebo and weight gain measured
daily over a 10-14 day period. At time of sacrifice, tibial
epiphysis width can be determined as a measure of bone growth.
Experimental methods for performing these studies are described in
Cox et al. (1994).
[0160] The efficacy of PEG-GH in rodent cachexia models can be
tested in a similar manner. Daily administration of dexamethasone,
via osmotic pumps or subcutaneous injection, can be used to induce
weight loss (Tomas et al., 1992; Read et al., 1992; PCT patent
application US95/06540).
EXAMPLE 2
Cysteine-Added Variants of Erythropoietin
[0161] This example relates to cysteine-added variants of
erythropoietin (EPO). EPO is the hormone primarily responsible for
stimulating erythropoiesis or red blood cell formation. EPO acts on
immature red blood cell precursors to stimulate their further
proliferation and differentiation into mature red blood cells. A
commercial pharmaceutical version is available from Amgen, Inc.
Human EPO is a 35-39 kDa glycoprotein secreted by the adult kidney.
The mature human protein contains 166 amino acids and is heavily
glycosylated. The sequence of human EPO (SEQ ID NO: 2) is shown in
Lin et al 1985 and Jacobs et al. 1985, which are incorporated
herein by reference. The primary sequence of EPO is highly
conserved among species (greater than 80% identity; Wen et al.,
1994). Sugar groups account for greater than 40% of the protein's
mass. Human EPO contains three N-linked glycosylation sites and one
O-linked glycosylation site. The N-linked glycosylation sites are
conserved in different species whereas the O-linked glycosylation
site is not. The extensive glycosylation of EPO has prevented the
protein's crystallization, so the X-ray structure of the protein is
not known. Human EPO contains four cysteine residues. The disulfide
assignments are Cys7 to Cys161 and Cys29 to Cys33. Cys33 is not
conserved in mouse EPO, suggesting that the Cys29-Cys33 disulfide
bond is not critical to mouse EPO's structure or function. This
conclusion also seems to hold for human EPO (Boissel et al.,
1993).
[0162] The amino acid sequence of EPO is consistent with the
protein being a member of the GH supergene family and mutational
studies support this view of EPO's structure (Boissel et al., 1993;
Wen et al., 1994). A model of the three dimensional structure of
EPO, modeled after the GH structure has been proposed (Boissel et
al., 1993; Wen et al., 1994). Helix A encompasses amino acids 9-22,
Helix B encompasses amino acids 59-76, Helix C encompasses amino
acids 90-107 and Helix D encompasses amino acids 132-152. Amino
acids in EPO important for receptor binding have been identified
through mutagenesis experiments and reside primarily in the
N-terminal half of presumptive helix A and the C-terminal half of
presumptive helix D (Boissel et al., 1993; Wen et al., 1994;
Matthews et al., 1996). Only a single cell surface receptor for EPO
has been identified (D'Andrea et al., 1989). It is believed that
EPO dimerizes its receptor in much the same way that GH dimerizes
its receptor (Matthew's et al., 1996).
[0163] Human EPO contains three sites for N-linked glycosylation
(asparagine-24, -38 and -83) and one site for O-linked
glycosylation (serine-126). The N-linked glycosylation sites are
located in the A-B and B-C loops and the O-glycosylation site is
located in the C-D loop. The N-linked glycosylation sites are
conserved among species whereas the O-linked glycosylation site is
absent in rodent EPO (Wen et al., 1993). A non-O-linked
glycosylated human variant containing methionine at position 126
has been described (U.S. Pat. No. 4,703,008). The N-linked sugar
groups are heavily branched and contain terminal sialic acid
residues (Sasaki et al., 1987; Takeuchi et al., 1988). N-38 and
N-83 contain the most highly branched oligosaccharides (Sasaki et
al., 1988).
[0164] The terminal sialic residues on EPO are critical for the
protein's in vivo function because removal of these residues by
digestion eliminates in vivo activity (Fukada et al., 1989; Spivak
and Hogans, 1989). Loss of activity correlates with faster
clearance of the asialated protein from the body. The circulating
half-life of the asialated protein in rats is less than ten
minutes, in contrast to that of the sialated protein, which is
approximately 2 hr (Fukada et al., 1989; Spivak and Hogans, 1989).
Thus, in vivo activity of EPO directly correlates with its
circulating half-life.
[0165] The role of N-linked sugars in EPO's biological activities
has been better defined by mutating, individually and in
combination, the three asparagine residues comprising the N-linked
glycosylation sites. EPO muteins in which only a single N-linked
glycosylation site was mutated, i.e., N24Q, N38Q and N83Q, were
secreted from mammalian cells as efficiently as wild type EPO,
indicating that N-linked glycosylation at all three sites is not
required for protein secretion (N24Q indicates that the asparagine
at position 24 is mutated to glutamine). In contrast, EPO muteins
in which two or more N-linked glycosylation sites were mutated were
secreted less efficiently than wild type EPO from mammalian cells
(Yamaguchi et al., 1991; Delorme et al., 1992). Mutagenesis studies
found that each of the single N-linked glycosylation site muteins
had in vitro biological activities equal to or greater than wild
type EPO. Thus, it was concluded that none of the N-linked
glycosylation sites is essential for secretion or in vitro
biological activity of EPO. In fact, removal of one of the
glycosylation sites seemed to improve biological activity
(Yamaguchi et al., 1991).
[0166] The in vivo biological activity of N-linked glycosylation
muteins was studied by two groups. Yamaguchi et al. (1991)
concluded that the N24Q and N83Q muteins had in vivo activities
greater than wild type EPO, which correlated with their increased
in vitro activities. These authors found that the N38Q mutein had
decreased in vivo activity, about 60% of wild type EPO. N38 is the
most heavily branched of the three N-linked glycosylation sites
(Sasaki et al., 1988). Delorme et al. (1992) reported that mutating
any of the N-linked glycosylation sites reduced in vivo biological
activity by about 50%. Muteins in which two or more glycosylation
sites were mutated had decreased in vivo activities in both
studies.
[0167] The above studies indicate that some N-linked glycosylation
is required for in vitro and in vivo activity of EPO. Individually,
however, none of the three glycosylation sites is absolutely
essential for activity. The N-linked sugars increase the apparent
molecular weight of EPO and prolong its circulating half-life,
which correlates with bioactivity. Natural EPO and EPO manufactured
in mammalian cells have complex N-linked sugars containing
galactose and terminal sialic acid residues. The galactose residues
are recognized by specific receptors on hepatocytes and promote
rapid clearance of EPO from the body unless the galactose residues
are masked by the terminal sialic acid residues.
[0168] Mutagenesis studies concluded that O-linked glycosylation is
not required for in vitro or in vivo function of EPO (Delorme et
al., 1992). This is in keeping with the observation that rodent EPO
is not O-glycosylated and with the existence of a naturally
occurring human EPO variant in which serine-126 is replaced by
methionine, with a corresponding lack of O-linked glycosylation.
Mutagenesis of serine-126 revealed that certain amino acid changes
at this site (to valine, histidine or glutamic acid) yielded EPO
muteins with biological activities similar to wild type EPO,
whereas other amino acid changes (to alanine or glycine) resulted
in EPO molecules with severely reduced activities (Delorme et al.,
1992). The effect of changing serine-126 to cysteine was not
studied. The in vivo bioactivity of S126V EPO was found to be
similar to wild type EPO (Delorme et al., 1992).
[0169] The requirement for complex, N-linked carbohydrates
containing terminal sialic acid residues for in vivo activity of
EPO has limited commercial manufacture of the protein to mammalian
cells. The important functions of the sialated N-linked sugars are
to prevent protein aggregation, increase protein stability and
prolong the circulating half-life of the protein. The terminal
sialic acid residues prolong EPO's circulating half-life by masking
the underlying galactose residues, which are recognized by specific
receptors on hepatocytes and promote clearance of the asialated
protein. EPO can be produced in insect cells and is N-glycosylated
and fully active in vitro; its activity in vivo has not been
reported (Wojchowski et al., 1987).
[0170] This example provides for the design of cysteine-added EPO
variants and their use in preparing conjugates using
cysteine-reactive PEGs and other cysteine-reactive moieties.
Certain amino acids in EPO are non-essential for biological
activity and can be mutated to cysteine residues without altering
the normal disulfide binding pattern and overall conformation of
the molecule. These amino acids are located in the A-B loop (amino
acids 23-58 of the mature protein sequence), the B-C loop (amino
acids 77-89 of the mature protein sequence), the C-D loop (amino
acids 108-131 of the mature protein sequence), proximal to helix A
(amino acids 1-8) and distal to helix D (amino acids 153-166 of the
mature protein sequence). Also contemplated as preferred sites for
adding cysteine residues are at the N-terminus or C-terminus of the
protein sequence. Preferred sites for cysteine substitutions are
the O-- linked glycosylation site (serine-126) and the amino acids
comprising the three N-linked glycosylation sites (N24, 125, T26,
N38, I39, T40, N83, S84, S85). Glycosylation sites are attractive
sites for introducing cysteine substitutions and attaching PEG
molecules to EPO because (1) these sites are surface exposed; (2)
the natural protein can tolerate bulky sugar groups at these
positions; (3) the glycosylation sites are located in the putative
loop regions and away from the receptor binding site (Wen et al.,
1994); and (4) mutagenesis studies indicate these sites (at least
individually) are not essential for in vitro or in vivo activity
(Yamaguchi et al., 1991; Delorme et al., 1992). As discussed above,
the local conformation of the region encompassing the
O-glycosylation site region seems to be important for biological
activity. Whether a cysteine substitution at position 126 affects
biological activity has not been studied. The cysteine-29 to
cysteine-33 disulfide bond is not necessary for biological activity
of EPO because changing both residues to tyrosine simultaneously
yielded a biologically active EPO protein (Boissel et al., 1993;
Wen et al., 1994). A "free" cysteine can be created by changing
either cysteine-29 or cysteine-33 to another amino acid. Preferred
amino acid changes would be to serine or alanine. The remaining
"free" cysteine (cysteine-29 or cysteine-33) would be a preferred
site for covalently modifying the protein with cysteine-reactive
moieties.
[0171] Bill et al. (1995) individually substituted cysteine for
N24, N38 and N83 and reported that the muteins had greatly reduced
in vitro biological activities (less than 20% of wild type
activity). Bill et al. (1995) expressed the EPO variants as fusion
proteins (fused to glutathionine-S-transferase) in bacteria. One
aspect of the present invention is to provide expression systems in
which the N24C, N38C and N83C EPO variants will have in vitro
biological activities more similar to wild type EPO.
[0172] U.S. Pat. No. 4,703,008 contemplates naturally occurring
variants of EPO as well as amino acid substitutions that are
present in EPO proteins of mammals. Ovine EPO contains a cysteine
residue at position 88 of the polypeptide chain. The inventor is
unaware of any other naturally occurring human or animal cysteine
variants of EPO in which the cysteine residue occurs in the
polypeptide regions disclosed herein as being useful for generating
cysteine-added EPO variants. U.S. Pat. No. 4,703,008 specifically
teaches away from cysteine-added EPO variants by suggesting that
expression of EPO might be improved by deleting cysteine residues
or substituting naturally occurring cysteine residues with serine
or histidine residues.
[0173] The mature protein form of EPO can contain 165 or 166 amino
acids because of post-translational removal of the C-terminal
arginine. Asp-165 is the C-terminus of the 165 amino acid form and
Agr-166 is the C-terminal amino acid of the 166 amino acid form.
The cysteine substitution and insertion mutations described herein
can comprise either the 165 or 166 amino acid forms of mature
EPO.
[0174] A cDNA encoding EPO can be cloned using the polymerase chain
reaction (PCR) technique from the human HepG2 or Hep3B cell lines,
which are known to express EPO when treated with hypoxia or cobalt
chloride (Wen et al., 1993) and are available from the American
Type Culture Collection (ATCC). Cysteine mutations can be
introduced into the cDNA by standard phage, plasmid or PCR
mutagenesis procedures as described for GH. As described above, the
preferred sites for introduction of cysteine substitution mutations
are in the A-B loop, the B-C loop, the C-D loop and the region
proximal to helix A and distal to helix D. The most preferred sites
in these regions are the N- and O-linked glycosylation sites:
S126C; N24C; I25C, T26C; N38C; I39C, T40C; N83C, S84C and S85C.
Other preferred sites for cysteine substitution mutagenesis are in
the A-B loop, the B-C loop and the C-D loop, amino acids
surrounding the glycosylation sites and the region of the protein
proximal to helix A and distal to helix D (Boissel et al., 1993;
Wen et al., 1994). Other preferred sites for cysteine substitutions
in these regions are: A1, P2, P3, R4, D8, S9, T27, G28, A30, E31,
H32, S34, N36, D43, T44, K45, N47, A50, K52, E55, G57, Q58, G77,
Q78, A79, Q86, W88, E89, T107, R110, A111, G113, A114, Q115, K116,
E117, A118, S120, P121, P122, D123, A124, A125, A127, A128, T132,
K154, T157, G158, E159, A160, T163, G164, D165 and R166. Cysteine
residues also can be introduced proximal to the first amino acid of
the mature protein, i.e., proximal to A1, or distal to the final
amino acid in the mature protein, i.e., distal to D165 or R166.
Other variants in which cys-29 or cys-33 have been replaced with
other amino acids, preferably serine or alanine, also are
provided.
[0175] Wild type EPO and EPO muteins can be expressed using insect
cells to determine whether the cysteine-added muteins are
biologically active. DNAs encoding EPO/EPO muteins can be cloned
into the Baculovirus expression vector pVL1392 (available from
Invitrogen, Inc. and Sigma Corporation (St. Louis, Mo.) and used to
infect insect cells. Recombinant Baculoviruses producing EPO can be
identified by Western blots of infected insect cell conditioned
media using polyclonal anti-human EPO antiserum (available from
R&D Systems). The secreted EPO mutein proteins can be purified
by conventional chromatographic procedures well known to those of
skill in the art. Protein concentrations can be determined using
commercially available protein assay kits or ELISA assay kits
(available from R&D Systems and Bio-Rad Laboratories).
[0176] Purified EPO and EPO muteins can be tested in cell
proliferation assays using EPO-responsive cell lines such as
UT7-epo (Wen et al., 1994) or TF1 (available from the ATCC) to
measure specific activities of the proteins. Cells can be plated in
96-well microtiter plates with various concentrations of EPO.
Assays should be performed in triplicate. After 1-3 days in
culture, cell proliferation can be measured by .sup.3H-thymidine
incorporation, as described above for GH. The concentration of
protein giving half-maximal stimulation (EC.sub.50) can be
determined for each mutein. Assays should be performed at least
three times for each mutein, with triplicate wells for each data
point. EC.sub.50 values can be used to compare the relative
potencies of the muteins. Alternatively, cell proliferation in
response to added EPO muteins can be analyzed using an MTT
dye-exclusion assay (Komatsu et al. 1991). Proteins displaying
similar optimal levels of stimulation and EC.sub.50 values
comparable to or greater than wild type EPO are preferable.
[0177] The above studies confirm identification of amino acid
residues in EPO that can be changed to cysteine residues and retain
biological activity. Muteins that retain activity can be PEGylated
using a cysteine-reactive 8 kDa PEG-maleimide as described above
for GH muteins. Wild type EPO should be used as a control since it
should not react with the cysteine-reactive PEG under identical
partial reduction conditions. The lowest amount of PEG that gives
significant quantities of mono-PEGylated product without giving
di-PEGylated product should be considered optimum. Mono-PEGylated
protein can be purified from non-PEGylated protein and unreacted
PEG by size-exclusion or ion exchange chromatography. The purified
PEGylated proteins should be tested in the cell proliferation assay
described above to determine their bioactivities.
[0178] One or more of the PEGylated EPO muteins that retain in
vitro bioactivity, are candidates for testing in animal disease
models. PEGylation of the protein at the proper amino acid can be
determined as described for GH.
[0179] In vivo testing of PEGylated EPO muteins expressed using
insect cells may require that they be re-engineered for expression
in mammalian cells to ensure proper glycosylation. PEG-EPO
candidates produced using insect cells can be tested in the animal
models described below to determine if they are active in vivo and
whether they are as active as PEG-EPO produced using mammalian cell
expression systems. For expression in mammalian cells, the EPO
muteins can be subcloned into commercially available eukaryotic
expression vectors and used to stably transform Chinese Hamster
Ovary (CHO) cells (available from the ATCC). Sublines can be
screened for EPO expression using ELISA assays. Sufficient
quantities of the insect cell- and mammalian cell-produced EPO
muteins can be prepared to compare their biological activities in
animal anemia models.
[0180] In vivo bioactivities of the EPO muteins can be tested using
the artificial polycythemia or starved rodent models (Cotes and
Bangham., 1961; Goldwasser and Gross., 1975). In the starved rodent
model, rats are deprived of food on day one and treated with test
samples on days two and three. On day four, rats receive an
injection of radioactive iron-59. Approximately 18 h later, rats
are anesthetized and blood samples drawn. The percent conversion of
labeled iron into red blood cells is then determined. In the
artificial polycythemia model, mice are maintained in a closed tank
and exposed for several days to hypobaric air. The animals are then
brought to normal air pressure. Red blood cell formation is
suppressed for several days. On day four or six after return to
normal air pressure, mice are injected with erythropoietin or
saline. Mice receive one injection per day for one to two days. One
day later the animals receive an intravenous injection of labeled
iron-59. The mice are euthanized 20 h later and the amount of
labeled iron incorporated into red blood cells determined. EPO
stimulates red blood cell formation in both models as measured by a
dose-dependent increase in labeled iron incorporated into red blood
cells. In both models different dosing regimens and different times
of injections can be studied to determine if PEG-EPO is
biologically active and/or more potent and produces longer acting
effects than natural EPO.
EXAMPLE 3
Alpha Interferon
[0181] Alpha interferon is produced by leukocytes and has
antiviral, anti-tumor and immunomodulatory effects. There are at
least 20 distinct alpha interferon genes that encode proteins that
share 70% or greater amino acid identity. Amino acid sequences of
the known alpha interferon species are given in Blatt et al.
(1996). A "consensus" interferon that incorporates the most common
amino acids into a single polypeptide chain has been described
(Blatt et al., 1996). A hybrid alpha interferon protein may be
produced by splicing different parts of alpha interferon proteins
into a single protein (Horisberger and Di Marco, 1995). Some alpha
interferons contain N-linked glycosylation sites in the region
proximal to helix A and near the B-C loop (Blatt et al. 1966). The
alpha 2 interferon protein (SEQ ID NO: 3) contains four cysteine
residues that form two disulfide bonds. The cys1-cys98 disulfide
bond (cys1-cys99 in some alpha interferon species such as alpha 1;
SEQ ID NO: 4) is not essential for activity. The alpha 2-interferon
protein does not contain any N-linked glycosylation sites. There
are two subtypes of the alpha-2 interferon protein; one subtype has
arginine at position 23 whereas the other subtype has lysine at
position 23. The crystal structure of alpha interferon has been
determined (Radhakrishnan et al., 1996). Alpha interferon has five
major alpha helices referred to as helices A-E. Helix A encompasses
amino acids 9-21, helix B encompasses amino acids 52-68, helix C
encompasses amino acids 78-100, helix D encompasses amino acids
112-132 and helix E encompasses amino acids 137-160.
[0182] This example provides cysteine added variants in the region
proximal to the A helix (amino acids 1-8), distal to the E helix
(amino acids 161-165), in the A-B loop (amino acids 22-51), in the
B-C loop (amino acids 69-77), in the C-D loop (amino acids 101-111)
and in the D-E loop (amino acids 133-136). This Example also
provides cysteine-added variants at the first three or last three
amino acids in helices A, B, C, D and E. Preferred sites for the
introduction of cysteine residues in these regions of the alpha
interferon-2 species are: D2, L3, P4, Q5, T6, S8, Q20, R22, K/R23,
S25, F27, S28, K31, D32, R33, D35, G37, F38, Q40, E41, E42, F43,
G44, N45, Q46, F47, Q48, K49, A50, N65, S68, T69, K70, D71, S72,
S73, A74, A75, D77, E78, T79, Y89, Q90, Q91, N93, D94, E96, A97,
Q101, G102, G104, T106, E107, T108, P109, K112, E113, D114, S115,
K131, E132, K133, K134, Y135, S136, A139, S152, S154, T155, N156,
L157, Q158, E159, S160, L161, R162, S163, K164, E165. Variants in
which cysteine residues are introduced proximal to the first amino
acid of the mature protein, i.e., proximal to C1, or distal to the
final amino acid in the mature protein, i.e., distal to E165 are
provided. Other variants in which cys-1 or cys-98 (cys-99 in some
alpha interferon species) have been replaced with other amino
acids, preferably serine or alanine, also are provided. Other
variants in which Cys-1 has been deleted (des Cys-1) also are
provided. The cysteine variants may be in the context of any
naturally occurring or non-natural alpha interferon sequence, e.g.,
consensus interferon or interferon protein hybrids. Some naturally
occurring alpha interferon species (e.g., alpha interferon-1)
contain a naturally occurring "free" cysteine. In such interferon
species the naturally occurring free cysteine can be changed to
another amino acid, preferably serine or alanine.
[0183] This example also provides cysteine variants of other alpha
interferon species, including consensus interferon, at equivalent
sites in these proteins. The alignment of the alpha interferon-2
species with other known alpha interferon species and consensus
interferon is given in Blatt et al. (1996). The crystal structure
of alpha interferon-2 has been determined by Rhadhakrishnan et al.
(1996). Lydon et al (1985) found that deletion of the first four
amino acids from the N-terminus of alpha interferon did not affect
biological activity. Valenzuela et al (1985) found that
substitution of Phe-47 in alpha interferon-2 with Cys, Tyr or Ser
did not alter biological activity of the protein. Cys-1 and Cys-98
have been changed individually to glycine and serine, respectively,
without altering biological activity of the protein (DeChiara et
al, 1986).
[0184] DNA sequences encoding alpha interferon-2 can be amplified
from human genomic DNA, since alpha interferon genes do not contain
introns (Pestka et al., 1987). The DNA sequence of alpha
interferon-2 is given in Goeddel et al. (1980). Alternatively, a
cDNA for alpha interferon-2 can be isolated from human
lymphoblastoid cell lines that are known to express alpha
interferon spontaneously or after exposure to viruses (Goeddell et
al., 1980; Pickering et al., 1980). Many of these cell lines are
available from the American Type Culture Collection (Rockville,
Md.). Specific mutations can be introduced into the alpha
interferon sequence using plasmid-based site-directed mutagenesis
kits (e.g., Quick-Change Mutagenesis Kit, Stratagene, Inc.), phage
mutagenesis strategies or employing PCR mutagenesis as described
for GH.
[0185] Alpha interferon has been successfully produced in E. coli
as an intracellular protein (Tarnowski et al., 1986; Thatcher and
Panayotatos, 1986). Similar procedures can be used to express alpha
interferon muteins. Plasmids encoding alpha interferon or alpha
interferon muteins can be cloned into an E. coli expression vector
such as pET15b (Novagene, Inc.) that uses the strong T7 promoter or
pCYB1 (New England BioLabs, Beverly, Mass.) that uses the TAC
promoter. Expression of the protein can be induced by adding IPTG
to the growth media.
[0186] Recombinant alpha interferon expressed in E. coli is
sometimes soluble and sometimes insoluble (Tarnowski et al., 1986;
Thatcher and Panayotatos, 1986). Insolubility appears to be related
to the degree of overexpression of the protein. Insoluble alpha
interferon proteins can be recovered as inclusion bodies and
renatured to a fully active conformation following standard
oxidative refolding protocols (Thatcher and Panayotatos, 1986; Cox
et al., 1994). The alpha interferon proteins can be purified
further using other chromatographic methods such as ion-exchange,
hydrophobic interaction, size-exclusion and reversed phase resins
(Thatcher and Panayotaos, 1986). Protein concentrations can be
determined using commercially available protein assay kits (Bio-Rad
Laboratories).
[0187] If E. coli expression of alpha interferon muteins is not
successful, one can express the proteins in insect cells as
secreted proteins as described for GH. The proteins can be modified
to contain the natural alpha interferon signal sequence (Goeddell
et al., 1980) or the honeybee mellitin signal sequence (Invitrogen,
Inc.) to promote secretion of the proteins. Alpha interferon and
alpha interferon muteins can be purified from conditioned media
using conventional chromatography procedures. Antibodies to alpha
interferon can be used in conjunction with Western blots to
localize fractions containing the alpha interferon proteins during
chromatography. Alternatively, fractions containing alpha
interferon proteins can be identified using ELISAs.
[0188] Bioactivities of alpha interferon and alpha interferon
muteins can be measured using an in vitro viral plaque reduction
assay (Ozes et al., 1992; Lewis, 1995). Human HeLa cells can be
plated in 96-well plates and grown to near confluency at 37.degree.
C. The cells are then washed and treated for 24 hour with different
concentrations of each alpha interferon preparation. Controls
should include no alpha interferon and wild type alpha interferon
(commercially available from Endogen, Inc., Woburn, Mass.). A virus
such as Vesicular stomatitis virus (VSV) or encephalomyocarditis
virus (EMCV) is added to the plates and the plates incubated for a
further 24-48 hours at 37.degree. C. Additional controls should
include samples without virus. When 90% or more of the cells have
been killed in the virus-treated, no alpha interferon control wells
(determined by visual inspection of the wells), the cell monolayer
are stained with crystal violet and absorbance of the wells read
using a microplate reader. Alternatively, the cell monolayers can
be stained with the dye MTT (Lewis, 1995). Samples should be
analyzed in duplicate or triplicate. EC.sub.50 values (the amount
of protein required to inhibit the cytopathic effect of the virus
by 50%) can be used to compare the relative potencies of the
proteins. Wild type alpha interferon-2 protects cells from the
cytopathic effects of VSV and EMCV and has a specific activity of
approximately 2.times.10.sup.8 units/mg in this assay (Ozes et al.,
1992). Alpha interferon muteins displaying EC.sub.50 values
comparable to wild type Alpha Interferon are preferable.
[0189] Alpha interferon muteins that retain activity can be
PEGylated using procedures similar to those described for GH. Wild
type alpha interferon-2 can serve as a control since it should not
PEGylate under similar conditions. The lowest amount of PEG that
gives significant quantities of mono-pegylated product without
giving di-pegylated product should be considered optimum.
Mono-PEGylated protein can be purified from non-PEGylated protein
and unreacted PEG by size-exclusion or ion exchange chromatography.
The purified PEGylated proteins can be tested in the viral plaque
reduction bioassay described above to determine their
bioactivities. PEGylated alpha interferon proteins with
bioactivities comparable to wild type alpha interferon are
preferable. Mapping the PEG attachment site and determination of
pharmacokinetic data for the PEGylated protein can be performed as
described for GH.
[0190] In vivo bioactivities of the PEG-alpha interferon muteins
can be tested using tumor xenograft models in nude mice and viral
infection models (Balkwill, 1986; Fish et al., 1986). Since
PEG-alpha interferon bioactivity may be species-specific, one
should confirm activity of the PEGylated protein using appropriate
animal cell lines in in vitro virus plaque reduction assays,
similar to those described above. Next, one should explore the
effects of different dosing regimens and different times of
injections to determine if PEG-alpha interferon is more potent and
produces longer lasting effects than non-PEGylated alpha
interferon.
[0191] The novel alpha interferon-derived molecules of this example
can be formulated and tested for activity essentially as set forth
in Examples 1 and 2, substituting, however, the appropriate assays
and other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 4
Beta Interferon
[0192] Beta interferon is produced by fibroblasts and exhibits
antiviral, antitumor and immunomodulatory effects. The single-copy
beta interferon gene encodes a preprotein that is cleaved to yield
a mature protein of 166 amino acids (Taniguchi et al. 1980; SEQ ID
NO: 5). The protein contains three cysteines, one of which,
cysteine-17, is "free", i.e., it does not participate in a
disulfide bond. The protein contains one N-linked glycosylation
site. The crystal structure of the protein has been determined
(Karpusas et al. 1997). Beta interferon has five major alpha
helices referred to as helices A-E. Helix A encompasses amino acids
2-22, helix B encompasses amino acids 51-71, helix C encompasses
amino acids 80-107, helix D encompasses amino acids 118-136 and
helix E encompasses amino acids 139-162.
[0193] This example provides cysteine-added variants at any of the
three amino acids that comprise the N-linked glycosylation sites,
i.e., N80C, E81C or T82C. This example also provides cysteine-added
variants in the region proximal to the A helix (amino acid 1),
distal to the E helix (amino acids 163-166), in the A-B loop (amino
acids 23-50), in the B-C loop (amino acids 72-79), in the C-D loop
(amino acids 108-117) and in the D-E loop (amino acids 137-138).
This Example also provides cysteine-added variants at the first
three or last three amino acids in helices A, B, C, D and E.
Preferred sites for introduction of cysteine residues in these
regions are: M1, S2, Y3, N4, L5, Q23, N25, G26, R27, E29, Y30, K33,
D34, R35, N37, D39, E42, E43, K45, Q46, L47, Q48, Q49, Q51, K52,
E53, A68, F70, R71, Q72, D73, S74, S75, S76, T77, G78, E107, K108,
E109, D110, F111, T112, R113, G114, K115, L116, A135, K136, E137,
K138, S139, 1157, N158, R159, L160, T161, G162, Y163, L164, R165
and N166. Variants in which cysteine residues are introduced
proximal to the first amino acid of the mature protein, i.e.,
proximal to M1, or distal to the final amino acid in the mature
protein, i.e., distal to N166 also are provided.
[0194] These variants are produced in the context of the natural
protein sequence or a variant protein in which the naturally
occurring "free" cysteine residue (cysteine-17) has been changed to
another amino acid, preferably serine or alanine.
[0195] The novel beta interferon-derived molecules of this example
can be formulated and tested for activity essentially as set forth
in Examples 1 and 2, substituting, however, the appropriate assays
and other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 5
Granulocyte Colony-Stimulating Factor (G-CSF)
[0196] G-CSF is a pleuripotent cytokine that stimulates the
proliferation, differentiation and function of granulocytes. The
protein is produced by activated monocytes and macrophages. The
amino acid sequence of G-CSF (SEQ ID NO: 6) is given in Souza et
al. (1986), Nagata et al. (1986a, b) and U.S. Pat. No. 4,810,643
all incorporated herein by reference. The human protein is
synthesized as a preprotein of 204 or 207 amino acids that is
cleaved to yield mature proteins of 174 or 177 amino acids. The
larger form has lower specific activity than the smaller form. The
protein contains five cysteines, four of which are involved in
disulfide bonds. Cysteine-17 is not involved in a disulfide bond.
Substitution of cysteine-17 with serine yields a mutant G-CSF
protein that is fully active (U.S. Pat. No. 4,810,643). The protein
is O-glycosylated at threonine-133 of the mature protein. G-CSF
contains four major alpha helices referred to as helices A-D. Helix
A encompasses amino acids 11-39, helix B encompasses amino acids
71-91, helix C encompasses amino acids 100-123 and helix D
encompasses amino acids 143-172.
[0197] This example provides a cysteine-added variant at
threonine-133. This example provides other cysteine-added variants
in the region proximal to helix A (amino acids 1-10), distal to
helix D (amino acids 173-174), in the A-B loop (amino acids 40-70),
B-C loop (amino acids 92-99) and C-D loop (amino acids 124-142).
This Example also provides cysteine-added variants at the first
three or last three amino acids in helices A, B, C and D. Preferred
sites for introduction of cysteine substitutions in these regions
are: T1, P2, L3, G4, P5, A6, S7, S8, L9, P10, Q11, S12, T38, K40,
S53, G55, W58, A59, P60, S62, S63, P65, S66, Q67, A68, Q70, A72,
Q90, A91, E93, G94, S96, E98, G100, G125, M126, A127, A129, Q131,
T133, Q134, G135, A136, A139, A141, S142, A143, Q145, Q173 and
P174. Variants in which cysteine residues are introduced proximal
to the first amino acid of the mature protein, i.e., proximal to
T1, or distal to the final amino acid in the mature protein, i.e.,
distal to P174 are provided. These variants are provided in the
context of the natural protein sequence or a variant protein in
which the naturally occurring "free" cysteine residue (cysteine-17)
has been changed to another amino acid, preferably serine or
alanine.
[0198] A cDNA encoding human G-CSF can be purchased from R&D
Systems (Minneapolis, Minn.) or amplified using PCR from mRNA
isolated from human carcinoma cell lines such as 5637 and U87-MG
known to express G-CSF constitutively (Park et al., 1989; Nagata,
1994). These cell lines are available from the American Type
Culture collection (Rockville, Md.). Specific mutations can be
introduced into the G-CSF sequence using plasmid-based
site-directed mutagenesis kits (e.g., Quick-Change Mutagenesis Kit,
Stratagene, Inc.), phage mutagenesis methods or employing PCR
mutagenesis as described for GH.
[0199] G-CSF has been successfully produced in E. coli as an
intracellular protein (Souza et al., 1986). One can employ similar
procedures to express G-CSF and G-CSF muteins. Plasmids encoding
G-CSF or G-CSF muteins can be cloned into an E. coli expression
vector such as pET15b (available from Novagen, Inc., Madison, Wis.)
that uses the strong T7 promoter or pCYB1 (available from New
England BioLabs, Beverly, Mass.) that uses the strong TAC promoter.
Expression of the protein can be induced by adding IPTG to the
growth media. Recombinant G-CSF expressed in E. coli is insoluble
and can be recovered as inclusion bodies. The protein can be
renatured to a fully active conformation following standard
oxidative refolding protocols (Souza et al., 1986; Lu et al., 1992;
Cox et al., 1994). Similar procedures can be used to refold
cysteine muteins. The proteins can be purified further using other
chromatographic methods such as ion exchange, hydrophobic
interaction, size-exclusion and reversed phase resins (Souza et
al., 1986; Kuga et al., 1989; Lu et al., 1992). Protein
concentrations can be determined using commercially available
protein assay kits (Bio-Rad Laboratories).
[0200] If E. coli expression of G-CSF or G-CSF muteins is not
successful, one can express G-CSF and G-CSF muteins in insect cells
as secreted proteins as described for GH. The proteins can be
modified to contain the natural G-CSF signal sequence (Souza et
al., 1986; Nagata et al., 1986a; Nagata et al, 1986b) or the
honeybee mellitin signal sequence (Invitrogen, Inc., Carlsbad,
Calif.) to promote secretion of the proteins. G-CSF and G-CSF
muteins can be purified from conditioned media using conventional
chromatography procedures. Antibodies to G-CSF can be used in
conjunction with Western blots to localize fractions containing the
G-CSF proteins during chromatography. Alternatively, fractions
containing G-CSF proteins can be identified using ELISAs.
[0201] G-CSF muteins also can be expressed in mammalian cells as
described for erythropoietin in Example 2.
[0202] Bioactivities of G-CSF and the G-CSF muteins can be measured
using an in vitro cell proliferation assay. The mouse NFS-60 cell
line and the human AML-193 cell line can be used to measure G-CSF
bioactivity (Tsuchiya et al., 1986; Lange et al., 1987; Shirafuji
et al., 1989). Both cell lines proliferate in response to human
G-CSF. The AML-193 cell line is preferable since it is of human
origin, which eliminates the possibility of a false conclusion
resulting from species differences. The NFS60 cell lines
proliferates in response to G-CSF with a half-maximal effective
concentration (EC.sub.50) of 10-20 picomolar. Purified G-CSF and
G-CSF muteins can be tested in cell proliferation assays using
these cell lines to determine specific activities of the proteins,
using published methods (Tsuchiya et al., 1986; Lange et al., 1987;
Shirafuji et al., 1989). Cells can be plated in 96-well tissue
culture dishes with different concentrations of G-CSF or G-CSF
muteins. After 1-3 days at 37.degree. C. in a humidified tissue
culture incubator, proliferation can be measured by
.sup.3H-thymidine incorporation as described for GH. Assays should
be performed at least three times for each mutein using triplicate
wells for each data point. EC.sub.50 values can be used to compare
the relative potencies of the muteins. G-CSF muteins displaying
similar optimal levels of stimulation and EC.sub.50 values
comparable to wild type G-CSF are preferable.
[0203] G-CSF muteins that retain activity can be PEGylated using
procedures similar to those described for GH. Wild type G-CSF and
ser-17 G-CSF can serve as controls since they should not PEGylate
under similar conditions. The lowest amount of PEG that gives
significant quantities of mono-PEGylated product without giving
di-PEGylated product should be considered optimum. Mono-PEGylated
protein can be purified from non-PEGylated protein and unreacted
PEG by size-exclusion or ion exchange chromatography. The purified
PEGylated proteins can be tested in the cell proliferation assay
described above to determine their bioactivities.
[0204] The PEG site in the protein can be mapped using procedures
similar to those described for GH. Pharmacokinetic data for the
PEGylated proteins can be obtained using procedures similar to
those described for GH.
[0205] Initial studies to demonstrate in vivo efficacy of PEG-G-CSF
can be done in normal Sprague-Dawley rats, which can be purchased
from Charles River. Groups of rats should receive single
subcutaneous or intravenous injections of various doses of G-CSF,
PEG-G-CSF or placebo. Animals should be sacrificed at daily
intervals for up to a week for determination of neutrophil and
total white blood cell counts in peripheral blood. Other blood cell
types (platelets and red blood cells) can be measured to
demonstrate cell specificity.
[0206] The efficacy of PEG-G-CSF can be tested in a rat neutropenia
model. Neutropenia can be induced by treatment with
cyclophosphamide, which is a commonly used chemotherapeutic agent
that is myelosuppressive. G-CSF accelerates recovery of normal
neutrophil levels in cyclophosphamide-treated animals (Kubota et
al., 1990). Rats receive an injection of cyclophosphamide on day 0
to induce neutropenia. The animals are then be divided into
different groups, which will receive subcutaneous injections of
G-CSF, PEG-G-CSF or placebo. Neutrophil and total white blood cell
counts in peripheral blood should be measured daily until they
return to normal levels. Initially one should confirm that G-CSF
accelerates recovery from neutropenia when injected daily. Next,
one should explore the effects of different dosing regimens and
different times of injections to determine if PEG-G-CSF is more
potent and produces longer lasting effects than non-PEGylated
G-CSF.
[0207] The novel GCSF-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 6
Thrombopoietin (TPO)
[0208] Thrombopoietin stimulates the development of megakaryocyte
precursors of platelets. The amino acid sequence of TPO (SEQ ID NO:
7) is given in Bartley et al. (1994), Foster et al. (1994), de
Sauvage et al. (1994), each incorporated herein by reference.
[0209] The protein is synthesized as a 353 amino acid precursor
protein that is cleaved to yield a mature protein of 332 amino
acids. The N-terminal 154 amino acids have homology with EPO and
other members of the GH supergene family. The C-terminal 199 amino
acids do not share homology with any other known proteins. The
C-terminal region contains six N-linked glycosylation sites and
multiple O-linked glycosylation sites (Hoffman et al., 1996).
O-linked glycosylation sites also are found in the region proximal
to the A helix, in the A-B loop, and at the C-terminus of Helix C
(Hoffman et al., 1996). A truncated TPO protein containing only
residues 1-195 of the mature protein is fully active in vitro
(Bartley et al., 1994).
[0210] This example provides cysteine-added variants at any of the
amino acids that comprise the N-linked glycosylation sites and the
O-linked glycosylation sites. This example also provides
cysteine-added variants in the region proximal to the A helix
(amino acids 1-7), distal to the D helix (amino acids 148-332), in
the A-B loop (amino acids 34-58), in the B-C loop (amino acids
78-86), and in the C-D loop (amino acids 111-122). This Example
also provides cysteine-added variants at the first three or last
three amino acids in helices A, B, C and D. Helix a encompasses
amino acids 8-33, helix B encompasses amino acids 59-77, helix C
encompasses amino acids 87-110 and helix D encompasses amino acids
123-147.
[0211] Preferred sites for introduction of cysteine residues are:
S1, P2, A3, P4, P5, A6, T37, A43, D45, S47, G49, E50, K52, T53,
Q54, E56, E57, T58, A76, A77, R78, G79, Q80, G82, T84, S87, S88,
G109, T110, Q111, P113, P114, Q115, G116, R117, T118, T119, A120,
H121, K122, G146, G147, S148, T149, A155, T158, T159, A160, S163,
T165, S166, T170, N176, R177, T178, S179, G180, E183, T184, N185,
F186, T187, A188, S189, A190, T192, T193, G194, S195, N213, Q214,
T215, S216, S218, N234, G235, T236, S244, T247, S254, S255, T257,
S258, T260, S262, S272, S274, T276, T280, T291, T294, S307, T310,
T312, T314, S315, N319, T320, S321, T323, S325, Q326, N327, L328,
S329, Q330, E331 and G332. Variants in which cysteine residues are
introduced proximal to the first amino acid of the mature protein,
i.e., proximal to S1, or distal to the final amino acid in the
mature protein, i.e., distal to G332 are provided. The
cysteine-added variants are provided in the context of the natural
human protein or a variant protein that is truncated between amino
acids 147 and the C-terminus of the natural protein, G332. Variants
in which cysteine residues are added distal to the final amino acid
of a TPO protein that is truncated between amino acids 147 and 332
also are provided.
[0212] The novel TPO-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 7
Granulocyte-Macrophage Colony Stimulating Factor (GM-CSF)
[0213] GM-CSF stimulates the proliferation and differentiation of
various hematopoietic cells, including neutrophil, monocyte,
eosinophil, erythroid, and megakaryocyte cell lineages. The amino
acid sequence of human GM-CSF (SEQ ID NO: 8) is given in Cantrell
et al. (1985) and Lee et al (1985) both incorporated herein by
reference.
[0214] GM-CSF is produced as a 144 amino acid preprotein that is
cleaved to yield a mature 127 amino acid protein. The mature
protein has two sites for N-linked glycosylation. One site is
located at the C-terminal end of Helix A; the second site is in the
A-B loop. GM-CSF has four major alpha helices referred to as
helices A-D. helix A encompasses amino acids 13-27, helix B
encompasses amino acids 55-65, helix C encompasses amino acids
74-86 and helix D encompasses amino acids 103-116.
[0215] This example provides cysteine-added variants at any of the
amino acids that comprise the N-linked glycosylation sites, i.e.,
N27C, L28C, S29C, N37C, E38C and T39C. This example also provides
cysteine-added variants in the region proximal to the A helix
(amino acids 1-12), distal to the D helix (amino acids 117-127), in
the A-B loop (amino acids 28-54), in the B-C loop (amino acids
66-73), and in the C-D loop (amino acids 87-102). This Example also
provides cysteine-added variants at the first three or last three
amino acids in helices A, B, C and D. Preferred sites for
introduction of cysteine substitutions in these regions are: A1,
P2, A3, R4, S5, P6, S7, P8, S9, T10, Q11, R30, D31, T32, A33, A34,
E35, E41, S44, E45, D48, Q50, E51, T53, Q64, G65, R67, G68, S69,
L70, T71, K72, K74, G75, T91, E93, T94, S95, A97, T98, T102, I117,
D120, E123, V125, Q126 and E127. Variants in which cysteine
residues are introduced proximal to the first amino acid of the
mature protein, i.e., proximal to A1, or distal to the final amino
acid in the mature protein, i.e., distal to E127 are provided.
[0216] The novel GM-CSF-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 8
IL-2
[0217] IL-2 is a T cell growth factor that is synthesized by
activated T cells. The protein stimulates clonal expansion of
activated T cells. Human IL-2 is synthesized as a 153 amino acid
precursor that is cleaved to yield a 133 amino acid mature protein
(Tadatsugu et al., 1983; Devos et al., 1983; SEQ ID NO: 9).
[0218] The amino acid sequence of IL-2 is set forth in (Tadatsugu
et al. 1983; Devos et al. 1983). The mature protein contains three
cysteine residues, two of which form a disulfide bond. Cysteine-125
of the mature protein is not involved in a disulfide bond.
Replacement of cysteine-125 with serine yields an IL-2 mutein with
full biological activity (Wang et al., 1984). The protein is
O-glycosylated at threonine-3 of the mature protein chain. IL-2 has
four major alpha helices referred to as helices A-D. Helix a
encompasses amino acids 1-11, helix B encompasses amino acids
54-73, helix C encompasses amino acids 83-97 and helix d
encompasses amino acids 115-133.
[0219] This example provides cysteine-added variants in the last
four positions of the D helix, in the region distal to the D helix
(amino acids 130-133), in the A-B loop (amino acids 28-53), in the
B-C loop (amino acids 74-82), and in the C-D loop (amino acids
98-114). These variants are provided in the context of the natural
protein sequence or a variant protein in which the naturally
occurring "free" cysteine residue (cysteine-125) has been changed
to another amino acid, preferably serine or alanine. Variants in
which cysteine residues are introduced proximal to the first amino
acid, i.e., A1, or distal to the final amino acid, i.e., T133, of
the mature protein, also are provided.
[0220] The novel IL-2-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 9
IL-3
[0221] IL-3 is produced by activated T cells and stimulates the
proliferation and differentiation of pleuripotent hematopoietic
stem cells. The amino acid sequence of human IL-3 (SEQ ID NO: 10)
is given in Yang et al. (1986); Dorssers et al. (1987) and Otsuka
et al. (1988) all incorporated herein by reference. The protein
contains two cysteine residues and two N-linked glycosylation
sites. Two alleles have been described, resulting in isoforms
having serine or proline at amino acid position 8 or the mature
protein.
[0222] This example provides cysteine-added variants at any of the
amino acids that comprise the N-linked glycosylation sites. This
example also provides cysteine-added variants in the region
proximal to the A helix, distal to the D helix, in the A-B loop, in
the B-C loop, and in the C-D loop. Variants in which cysteine
residues are introduced proximal to the first amino acid or distal
to the final amino acid in the mature protein, also are
provided.
[0223] The novel IL-3-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 10
IL-4
[0224] IL-4 is a pleiotropic cytokine that stimulates the
proliferation and differentiation of monocytes and T and B cells.
IL-4 has been implicated in the process that leads to B cells
secreting IgE, which is believed to play a role in asthma and
atopy. The bioactivity of IL-4 is species specific. IL-4 is
synthesized as a 153 amino acid precursor protein that is cleaved
to yield a mature protein of 129 amino acids. The amino acid
sequence of human IL-4 (SEQ ID NO:11) is given in Yokota et al.
(1986) which is incorporated herein by reference. The protein
contains six cysteine residues and two N-linked glycosylation
sites. The glycosylation sites are located in the A-B and C-D
loops.
[0225] This example provides cysteine-added variants at any of the
amino acids that comprise the N-linked glycosylation sites. This
example also provides cysteine-added variants in the region
proximal to the A helix, distal to the D helix, in the A-B loop, in
the B-C loop, and in the C-D loop. Variants in which cysteine
residues are introduced proximal to the first amino acid, H1, or
distal to the final amino acid, S129, of the mature protein are
provided.
[0226] The novel IL-4-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 11
IL-5
[0227] IL-5 is a differentiation and activation factor for
eosinophils. The amino acid sequence of human IL-5 (SEQ ID NO:12)
is given in Yokota et al. (1987) which is incorporated herein by
reference. The mature protein contains 115 amino acids and exists
in solution as a disulfide-linked homodimer. The protein contains
both O-linked and N-linked glycosylation sites.
[0228] This example provides cysteine-added variants in the region
proximal to the A helix, distal to the D helix, in the A-B loop, in
the B-C loop, and in the C-D loop. Variants in which cysteine
residues are added proximal to the first amino acid or distal to
the final amino acid in the mature protein are provided.
[0229] The novel IL-5-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 12
IL-6
[0230] IL-6 stimulates the proliferation and differentiation of
many cell types. The amino acid sequence of human IL-6 (SEQ ID
NO:13) is given in Hirano et al. (1986) which is incorporated
herein by reference. IL-6 is synthesized as a 212 amino acid
preprotein that is cleaved to generate a 184 amino acid mature
protein. The mature protein contains two sites for N-linked
glycosylation and one site for O-glycosylation, at T137, T138, T142
or T143.
[0231] This example provides cysteine-added variants at any of the
amino acids that comprise the N-linked glycosylation sites and at
the O-linked glycosylation site. Also provided are cysteine-added
variants in the region proximal to the A helix, distal to the D
helix, in the A-B loop, in the B-C loop, and in the C-D loop.
Variants in which cysteine residues are added proximal to the first
amino acid or distal to the final amino acid of the mature protein
also are provided.
[0232] The novel IL-6-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 13
IL-7
[0233] IL-7 stimulates proliferation of immature B cells and acts
on mature T cells. The amino acid sequence of human IL-7 (SEQ ID
NO:14) is given in Goodwin et al. (1989) which is incorporated
herein by reference. The protein is synthesized as a 177 amino acid
preprotein that is cleaved to yield a 152 amino acid mature protein
that contains three sites for N-linked glycosylation.
[0234] This example provides cysteine-added variants at any of the
amino acids that comprise the N-linked glycosylation sites. This
example also provides cysteine-added variants in the region
proximal to the A helix, distal to the D helix, in the A-B loop, in
the B-C loop, and in the C-D loop.
[0235] The novel IL-7-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example. Variants in which cysteine residues are
added proximal to the first amino acid or distal to the final amino
acid of the mature protein also are provided.
EXAMPLE 14
IL-9
[0236] IL-9 is a pleiotropic cytokine that acts on many cell types
in the lymphoid, myeloid and mast cell lineages. IL-9 stimulates
the proliferation of activated T cells and cytotoxic T lymphocytes,
stimulates proliferation of mast cell precursors and synergizes
with erythropoietin in stimulating immature red blood cell
precursors. The amino acid sequence of human IL-9 (SEQ ID NO:15) is
given in Yang et al. (1989) which is incorporated herein by
reference. IL-9 is synthesized as a precursor protein of 144 amino
acids that is cleaved to yield a mature protein of 126 amino acids.
The protein contains four potential N-linked glycosylation
sites.
[0237] This example provides cysteine-added variants at any of the
three amino acids that comprise the N-linked glycosylation sites.
This example also provides cysteine-added variants in the region
proximal to the A helix, distal to the D helix, in the A-B loop, in
the B-C loop, and in the C-D loop. Variants in which cysteine
residues are added proximal to the first amino acid or distal to
the final amino acid of the mature protein also are provided.
[0238] The novel IL-9-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 15
IL-10
[0239] The amino acid sequence of human IL-10 (SEQ ID NO:16) is
given in Vieira et al. (1991) which is incorporated herein by
reference. IL-10 is synthesized as a 178 amino acid precursor
protein that is cleaved to yield a mature protein of 160 amino
acids. IL-10 can function to activate or suppress the immune
system. The protein shares structural homology with the
interferons, i.e., it contains five amphipathic helices. The
protein contains one N-linked glycosylation site.
[0240] This example provides cysteine-added variants at any of the
three amino acids comprising the N-linked glycosylation site. This
example also provides cysteine-added variants in the region
proximal to the A helix, distal to the E helix, in the A-B loop, in
the B-C loop, in the C-D loop and in the D-E loop. Variants in
which cysteine residues are added proximal to the first amino acid
or distal to the final amino acid of the mature protein also are
provided.
[0241] The novel IL-10-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 16
IL-11
[0242] IL-11 is a pleiotropic cytokine that stimulates
hematopoiesis, lymphopoeisis and acute phase responses. IL-11
shares many biological effects with IL-6. The amino acid sequence
of human IL-11 (SEQ ID NO:17) is given in Kawashima et al. (1991)
and Paul et al. (1990) both incorporated herein by reference. IL-11
is synthesized as a precursor protein of 199 amino acids that is
cleaved to yield a mature protein of 178 amino acids. There are no
N-linked glycosylation sites in the protein. IL-11 has four major
alpha helices referred to as helices A-D. Relative to the amino
acid sequence shown in SEQ ID NO:17, helix A encompasses amino
acids 37-56, helix B encompasses amino acids 92-112, helix C
encompasses amino acids 125-147 and helix D encompasses amino acids
173-196. Amino acids 1-21 of SEQ ID NO:17 encompasses the IL-11
signal sequence.
[0243] This example provides cysteine-added variants in the region
proximal to the A helix (amino acids 22-36 of SEQ ID NO:17), distal
to the D helix (amino acids 197-199 of SEQ ID NO:17), in the A-B
loop (amino acids 57-91 of SEQ ID NO:17), in the B-C loop (amino
acids 113-124 of SEQ ID NO:17), and in the C-D loop (amino acids
148-172 of SEQ ID NO:17). This Example also provides cysteine-added
variants at the first three or last three amino acids in helices A,
B, C and D. Variants in which cysteine residues are added proximal
to the first amino acid of the mature protein (amino acid 22 of SEQ
ID NO:17) or distal to the final amino acid of the mature protein
(amino acid 199 of SEQ ID NO:17) also are provided.
[0244] The novel IL-11-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 17
IL-12 p35
[0245] IL-12 stimulates proliferation and differentiation of NK
cells and cytotoxic T lymphocytes. IL-12 exists as a heterodimer of
a p35 subunit and a p40 subunit. The p35 subunit is a member of the
GH supergene family. The amino acid sequence of the p35 subunit
(SEQ ID NO:18) is given in Gubler et al. (1991) and Wolf et al.
(1991) both incorporated herein by reference. p35 is synthesized as
a precursor protein of 197 amino acids and is cleaved to yield a
mature protein of 175 amino acids. The protein contains 7 cysteine
residues and three potential N-linked glycosylation sites.
[0246] This example provides cysteine-added variants at any of the
three amino acids that comprise the three N-linked glycosylation
sites. This example also provides cysteine-added variants in the
region proximal to the A helix, distal to the D helix, in the A-B
loop, in the B-C loop, and in the C-D loop. These variants are
provided in the context of the natural protein sequence or a
variant protein in which the naturally occurring "free" cysteine
residue has been changed to another amino acid, preferably serine
or alanine. Variants in which cysteine residues are added proximal
to the first amino acid or distal to the final amino acid of the
mature protein also are provided.
[0247] The novel IL-12 p35-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 18
IL-13
[0248] IL-13 shares many biological properties with IL-4. The amino
acid sequence of human IL-13 (SEQ ID NO:19) is given in McKenzie et
al. (1993) and Minty et al. (1993) both incorporated herein by
reference. The protein is synthesized as a 132 amino acid precursor
protein that is cleaved to yield a mature protein of 112 amino
acids. The mature protein contains 5 cysteine residues and multiple
N-linked glycosylation sites. A variant in which glutamine at
position 78 is deleted due to alternative mRNA splicing has been
described (McKenzie et al 1993)
[0249] This example provides cysteine-added variants at any of the
three amino acids comprising the N-linked glycosylation sites. This
example also provides cysteine-added variants in the region
proximal to the A helix, distal to the D helix, in the A-B loop, in
the B-C loop, and in the C-D loop. These variants are provided in
the context of the natural protein sequence or a variant sequence
in which the pre-existing "free" cysteine has been changed to
another amino acid, preferably to alanine or serine. Variants in
which cysteine residues are added proximal to the first amino acid
or distal to the final amino acid of the mature protein also are
provided.
[0250] The novel IL-13-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 19
IL-15
[0251] IL-15 stimulates the proliferation and differentiation of T
cells, NK cells, LAK cells and Tumor Infiltrating Lymphocytes.
IL-15 may be useful for treating cancer and viral infections. The
sequence of IL-15 (SEQ ID NO: 20) is given in Anderson et al.
(1995) which is incorporated herein by reference. IL-15 contains
two N-linked glycosylation sites, which are located in the C-D loop
and C-terminal end of the D helix. IL-15 encodes a 162 amino acid
preprotein that is cleaved to generate a mature 114 amino acid
protein. IL-15 contains four major alpha helices referred to as
helices A-D. Helix A encompasses amino acids 1-15, helix B
encompasses amino acids 38-57, helix C encompasses amino acids
65-78 and helix D encompasses amino acids 97-114.
[0252] This example provides cysteine-added variants at any of the
three amino acids comprising the N-linked glycosylation sites in
the C-D loop or C-terminal end of the D helix. This example also
provides cysteine-added variants proximal to helix A, in the A-B
loop (amino acids 16-37), the B-C loop (amino acids 58-64), the C-D
loop (amino acids 79-96) or distal to helix D. This Example also
provides cysteine-added variants at the first three or last three
amino acids in helices A, B, C and D. Variants in which cysteine
residues are added proximal to the first amino acid or distal to
the final amino acid of the mature protein also are provided.
[0253] The novel IL-15-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 20
Macrophage Colony Stimulating Factor (M-CSF)
[0254] M-CSF regulates the growth, differentiation and function of
monocytes. The protein is a disulfide-linked homodimer. Multiple
molecular weight species of M-CSF, which arise from differential
mRNA splicing, have been described. The amino acid sequence of
human M-CSF and its various processed forms are given in Kawasaki
et al (1985), Wong et al. (1987) and Cerretti et al (1988) which
are incorporated herein by reference. Cysteine-added variants can
be produced following the general teachings of this application and
in accordance with the examples set forth herein.
[0255] The novel MCSF-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 21
Oncostatin M
[0256] Oncostatin M is a multifunctional cytokine that affects the
growth and differentiation of many cell types. The amino acid
sequence of human oncostatin M (SEQ ID NO: 21) is given in Malik et
al. (1989) which is incorporated herein by reference. Oncostatin M
is produced by activated monocytes and T lymphocytes. Oncostatin M
is synthesized as a 252 amino acid preprotein that is cleaved
sequentially to yield a 227 amino acid protein and then a 196 amino
acid protein (Linsley et al., 1990). The mature protein contains
O-linked glycosylation sites and two N-linked glycosylation sites.
The protein is O-glycosylated at T160, T162 and S165. The mature
protein contains five cysteine residues.
[0257] This example provides cysteine-added variants at either of
the three amino acids comprising the N-linked glycosylation sites
or at the amino acids that comprise the O-linked glycosylation
sites. This example also provides cysteine-added variants proximal
to helix A, in the A-B loop, in the B-C loop, in the C-D loop or
distal to helix D. These variants are provided in the context of
the natural protein sequence or a variant sequence in which the
pre-existing "free" cysteine has been changed to another amino
acid, preferably to alanine or serine. Variants in which cysteine
residues are added proximal to the first amino acid or distal to
the final amino acid of the mature protein also are provided.
[0258] The novel Oncostatin M-derived molecules of this example can
be formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 22
Ciliary Neurotrophic Factor (CNTF)
[0259] The amino acid sequence of human CNTF (SEQ ID NO: 22) is
given in Lam et al. (1991) which is incorporated herein by
reference. CNTF is a 200 amino acid protein that contains no
glycosylation sites or signal sequence for secretion. The protein
contains one cysteine residue. CNTF functions as a survival factor
for nerve cells.
[0260] This example provides cysteine-added variants proximal to
helix A, in the A-B loop, the B-C loop, the C-D loop or distal to
helix D. These variants are provided in the context of the natural
protein sequence or a variant sequence in which the pre-existing
"free" cysteine has been changed to another amino acid, preferably
to alanine or serine. Variants in which cysteine residues are added
proximal to the first amino acid or distal to the final amino acid
of the mature protein also are provided.
[0261] The novel CNTF-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 23
Leukemia Inhibitory Factor (LIF)
[0262] The amino acid sequence of LIF (SEQ ID NO: 23) is given in
Moreau et al. (1988) and Gough et al. (1988) both incorporated
herein by reference. The human gene encodes a 202 amino acid
precursor that is cleaved to yield a mature protein of 180 amino
acids. The protein contains six cysteine residues, all of which
participate in disulfide bonds. The protein contains multiple O-
and N-linked glycosylation sites. The crystal structure of the
protein was determined by Robinson et al. (1994). The protein
affects the growth and differentiation of many cell types.
[0263] This example provides cysteine-added variants at any of the
three amino acids comprising the N-linked glycosylation sites or
the O-linked glycosylation site. Also provided are cysteine-added
variants proximal to helix A, in the A-B loop, the B-C loop, the
C-D loop or distal to helix D. Variants in which cysteine residues
are added proximal to the first amino acid or distal to the final
amino acid of the mature protein also are provided.
[0264] The novel LIF-derived molecules of this example can be
formulated and tested for activity essentially as set forth in
Examples 1 and 2, substituting, however, the appropriate assays and
other considerations known in the art related to the specific
proteins of this example.
EXAMPLE 24
Expression and Purification of Wild Type Murine GM-CSF and Cysteine
Muteins of Murine GM-CSF
A. Expression and Purification of Wild Type Murine GM-CSF
(muGM-CSF)
[0265] Cloning of a cDNA encoding wild type murine GM-CSF (WT
muGM-CSF) is described in PCT/US01/16088, incorporated herein by
reference in its entirety. Wild type muGM-CSF was expressed and
purified using the following protocol. A fresh saturated overnight
culture of E. coli strain W3110 transformed with
pBBT257::stII-muGM-CSF, which encodes wild type muGM-CSF and is
described in PCT/US01/16088, was inoculated at .about.0.05 OD @
A.sub.600 in LB containing 10 .mu.g/ml tetracycline. The 400 ml
culture was grown in a 2 L baffled shake flask at 28.degree. C. in
a gyrotory shaker water bath at .about.250 rpm. When the culture
reached a density of .about.0.6 OD, IPTG was added to a final
concentration of 0.5 mM. The induced culture was then incubated
overnight for .about.16 h. The cells were pelleted by
centrifugation and frozen at -80.degree. C. The cell pellet was
thawed and treated with 5 mL of B-PER bacterial protein extraction
reagent according to the manufacturer's (Pierce Chemical Company)
protocols. The insoluble portion, and the bulk of the muGM-CSF
protein, was recovered by centrifugation and resuspended in B-PER.
This mixture was treated with lysozyme (200 .mu.g/mL) for 10 min to
further disrupt the bacterial cell walls, and MgCl.sub.2 (10 mM
final) and protease-free DNAse (2 .mu.g/ml) were added. Insoluble
mGM-CSF was collected by centrifugation and washed, by resuspension
in water and recentrifugation, to remove most of the solubilized
cell debris. For refolding, the resulting pellet containing
insoluble muGM-CSF was dissolved in 10 ml of 8 M urea, 25 mM
cysteine in 20 mM Tris Base. This mixture was stirred for 30 min at
room temperature then diluted into 100 ml of 20 mM Tris, 40 .mu.M
copper sulfate, 15% glycerol, pH 8.0. This refold mixture was held
at 4.degree. C. for 2 days and then centrifuged and loaded onto a 5
ml Q-Sepharose HiTrap column (Amersham Pharmacia) equilibrated in
20 mM Tris, pH 8.0 (Buffer A). The bound proteins were eluted with
a linear salt gradient from 0-35% Buffer B (1M NaCl, 20 mM Tris, pH
8). Column fractions were analyzed by non-reducing SDS-PAGE.
muGM-CSF eluted at approximately 190 mM NaCl. Fractions containing
primarily muGM-CSF were pooled.
[0266] The Q-Sepharose pool was adjusted to 30% ammonium sulfate by
slow addition of solid ammonium sulfate. The mixture was warmed to
room temperature before being loaded onto a 1 mL Phenyl HP HiTrap
column (Amersham Pharmacia) previously equilibrated with 30%
ammonium sulfate in 20 mM sodium phosphate, pH 7.5. The muGM-CSF
was recovered from the column by elution with a reverse salt
gradient (30% ammonium sulfate to 0% ammonium sulfate in 20 mM
sodium phosphate, pH 7.5). The Phenyl HP column elution profile for
GM-CSF showed a single major peak, eluting at a conductivity of
approximately 1.28 mS/cm. Column fractions across the peak were
analyzed by non-reducing SDS-PAGE. Fractions containing muGM-CSF
and no visible contaminants were pooled. Protein concentrations
were determined using a MicroBCA kit (Pierce Chemical Company).
B. Expression and Purification of T3C Murine GM-CSF
[0267] Construction of the muGM-CSF T3C cysteine mutein
(substitution of cysteine for threonine at position 3 of muGM-CSF)
is described in PCT/US01/16088. E. coli strain 3110 transformed
with pBBT257::stII-muGM-CSF(T3C), which encodes the muGM-CSF T3C
mutein and is described in PCT/US01/16088, was grown, induced and
harvested using the protocols described in Example 24A for wild
type muGM-CSF. The mutein was refolded and purified using the
protocol described for wild type muGM-CSF. The mutein eluted from
the Q-Sepharose column at approximately 220 mM NaCl and from the
Phenyl HP column at a conductivity around 2 mS/CM. The mutein was
recovered predominantly as a monomer, with an apparent molecular
weight of approximately 14 kDa by non-reducing SDS-PAGE. Protein
concentrations were determined using a MicroBCA kit (Pierce
Chemical Company).
EXAMPLE 25
PEGylation of the muGM-CSF T3C Mutein
[0268] One milligram of muGM-CSF T3C protein prepared as described
in Example 24B was diluted 3-fold with 100 mM Tris, pH 8, to a
final concentration of 0.1 mg/ml protein. A 20-fold molar excess of
20 kDa maleimide-Polyethylene Glycol (20 kDa-mPEG-maleimide,
Shearwater Corporation) was added followed by a 15.times. fold
excess of TCEP (Pierce Chemical Company). The mixture was allowed
to sit at room temperature for 4 hours before being diluted 5-fold
with 20 mM Tris pH 8. The PEGylation reaction was next loaded on to
a 1 ml Q-Sepharose HiTrap column (Amersham Pharmacia) equilibrated
in 20 mM Tris, pH 8.0 (Buffer A). The bound proteins were eluted
with a linear salt gradient from 0-35% Buffer B (1M NaCl, 20 mM
Tris, pH 8). Column fractions were analyzed by non-reducing
SDS-PAGE. The T3C protein modified with the 20 kDa maleimide-PEG
eluted at approximately 90 mM NaCl. Fractions containing purified
20 kDa PEG-T3C protein were pooled. The T3C protein modified with a
10 kDa mPEG-maleimide (Shearwater Corporation) and a 40 kDa mPEG2
maleimide (Shearwater Corporation) were prepared using this same
protocol.
EXAMPLE 26
Effects of Wild Type muGM-CSF and PEG-T3C GM-CSF Proteins on
Hematopoiesis
[0269] The purpose of this study was to determine if the PEG-T3C
GM-CSF proteins are effective at stimulating hematopoiesis in a
mammal. The study was performed in rats because rats are predictive
of the situation in other mammals, including humans. Similar types
of experiments can be performed with other PEGylated GM-CSF
cysteine muteins such as those described in Example 7 and in
PCT/US01/16088 to demonstrate that these proteins are effective at
stimulating hematopoiesis. The PEGylated GM-CSF cysteine muteins
will be effective from the low .mu.g/kg to the mg/kg range with the
preferred level being between 25-300 .mu.g/kg. Male Sprague Dawley
rats weighing approximately 350 grams were given a single
intravenous dose of wild type muGM-CSF, or the T3C mutein modified
with 10 kDa-, 20 kDa and 40 kDa-maleimide PEGs. All rats were dosed
at 100 .mu.g/kg. The protein solutions were prepared at 100
.mu.g/ml in phosphate buffered saline. Blood samples (0.4 ml) were
collected at pre-dose, 0.25 h, 1.5 h, 4 h, 10 hr, 24 h, 48 h, 72
hr, 96 h, 120 h and 144 h post-injection in an EDTA-coated tube.
Blood samples were centrifuged and the plasma stored at -80.degree.
C. At pre-dose, 4, 10, 24, 48, 72, 96, 120 and 144 h post-injection
approximately 0.2 ml of whole EDTA blood was removed prior to
centrifugation and placed in an EDTA microtainer tube for
submission to a commercial firm for a complete blood cell (CBC)
analysis. Results of the CBC analyses are shown in Tables 1-5. The
data show that the PEG-T3C GM-CSF proteins are effective at
stimulating hematopoiesis in a mammal. In particular the proteins
are effective at increasing blood levels of white blood cells,
granulocytes (neutrophils and eosinophils), monocytes and
lymphocytes. TABLE-US-00013 TABLE 1 Effects of wild type muGM-CSF
and 10 kDa-, 20 kDa- and 40 kDa-PEG T3C muGM-CSF on white blood
cell counts 10 kDa-PEG T3C 20 kDa-PEG T3C 40 kDa-PEG T3C Wild type
muGM-CSF Time (thousand cells/.mu.l) (thousand cells/.mu.l)
(thousand cells/.mu.l) (thousand cells/.mu.l) (h) Rat 1 Rat 2 Rat 3
Rat 4 Rat 5 Rat 6 Rat 7 Rat 8 Rat 9 Rat 10 Rat 11 Rat 12 0 9.2 9.0
8 7.8 7.7 4.3 3.5 3.7 6.6 3.1 6 2.4 4 19 11 11 13.8 8.8 14 12 7.4
11 11.3 17 10.7 10 12.5 12.7 11.8 14.6 12.3 14.1 15.9 9 12.5 10.5
17.5 10.2 24 8.2 9.2 8.1 15.2 11.4 9.5 16 8.7 15 6 8.7 5.8 48 8.9
9.6 8.4 10.9 11.5 8.9 27.9 13.3 17.1 5.7 9.1 6.4 72 9.2 10.9 8.3
8.7 9.6 8.8 17.8 11.2 17.7 5 13.1 7.3 96 12 11.6 9.2 13.1 14 14.1
22.6 14.4 20.1 8.4 11.9 11.2 120 9.2 8.9 7.2 10.4 11.5 11.8 16 14
13.8 9 10.3 14.9 144 5.3 6 3.3 4.5 2.2 4.8 4.8 8.2 4.7 6 6.6
7.1
[0270] TABLE-US-00014 TABLE 2 Effects of wild type muGM-CSF and 10
kDa-, 20 kDa- and 40 kDa-PEG T3C muGM-CSF on blood neutrophil
counts 10 kDa-PEG T3C 20 kDa-PEG T3C 40 kDa-PEG T3C Wild type
muGM-CSF Time (cells/.mu.l) (cells/.mu.l) (cells/.mu.l)
(cells/.mu.l) (h) Rat 1 Rat 2 Rat 3 Rat 4 Rat 5 Rat 6 Rat 7 Rat 8
Rat 9 Rat 10 Rat 11 Rat 12 0 1104 1350 1360 624 770 344 350 407 660
186 600 96 4 13300 5280 6050 9522 4644 9240 6240 5254 5610 6102
13600 8346 10 5625 5969 5546 10658 7134 9447 9815 6300 8250 4305
7875 5918 24 2378 1564 2106 7752 5928 3895 9280 6177 10650 1620
1914 2088 48 1157 1344 1680 3052 3450 1869 13392 7315 9234 1026
1820 1984 72 552 981 1079 1044 960 528 2492 4032 5487 450 1965 2628
96 1320 1508 1380 2882 2660 2679 5650 5904 5829 1428 2142 4368 120
828 1246 1008 1768 1265 1652 2400 5880 2622 1980 1339 8344 144 530
1020 132 1260 704 1008 960 3444 987 1260 1188 4118
[0271] TABLE-US-00015 TABLE 3 Effects of wild type muGM-CSF and 10
kDa-, 20 kDa- and 40 kDa-PEG T3C muGM-CSF on blood monocyte counts
10 kDa-PEG T3C 20 kDa-PEG T3C 40 kDa-PEG T3C Wild type muGM-CSF
Time (cells/.mu.l) (cells/.mu.l) (cells/.mu.l) (cells/.mu.l) (h)
Rat 1 Rat 2 Rat 3 Rat 4 Rat 5 Rat 6 Rat 7 Rat 8 Rat 9 Rat 10 Rat 11
Rat 12 0 460 360 400 390 154 86 35 37 66 31 120 0 4 950 330 440 276
352 280 120 148 220 339 340 214 10 250 508 354 292 492 282 151 90
125 210 350 102 24 246 184 162 152 228 190 160 87 150 180 174 58 48
356 384 336 436 460 356 558 399 342 171 273 192 72 92 218 166 87 96
88 178 224 354 50 262 146 96 240 232 276 393 280 282 678 432 804
168 238 448 120 82 178 144 208 345 354 800 700 276 360 206 447 144
106 240 33 45 44 48 96 164 94 60 66 142
[0272] TABLE-US-00016 TABLE 4 Effects of wild type muGM-CSF and 10
kDa-, 20 kDa- and 40 kDa-PEG T3C muGM-CSF on blood eosinophil
counts 10 kDa-PEG T3C 20 kDa-PEG T3C 40 kDa-PEG T3C Wild type
muGM-CSF Time (cells/.mu.l) (cells/.mu.l) (cells/.mu.l)
(cells/.mu.l) (h) Rat 1 Rat 2 Rat 3 Rat 4 Rat 5 Rat 6 Rat 7 Rat 8
Rat 9 Rat 10 Rat 11 Rat 12 0 92 90 80 156 77 45 35 37 66 31 60 24 4
0 110 110 138 88 280 120 0 110 113 0 0 10 250 254 236 292 123 141
151 90 125 210 175 102 24 492 184 405 760 342 285 480 174 150 240
87 58 48 178 96 252 545 345 267 837 266 342 171 91 64 72 92 109 249
261 192 88 356 112 354 300 131 73 96 240 116 184 262 140 141 226
288 201 168 119 225 120 184 178 216 208 230 236 320 280 138 180 103
149 144 0 120 0 90 44 96 96 164 47 120 66 142
[0273] TABLE-US-00017 TABLE 5 Effects of wild type muGM-CSF and 10
kDa-, 20 kDa- and 40 kDa-PEG T3C muGM-CSF on blood lymphocyte
counts 10 kDa-PEG T3C 20 kDa-PEG T3C 40 kDa-PEG T3C Wild type
muGM-CSF Time (cells/.mu.l) (cells/.mu.l) (cells/.mu.l)
(cells/.mu.l) (h) Rat 1 Rat 2 Rat 3 Rat 4 Rat 5 Rat 6 Rat 7 Rat 8
Rat 9 Rat 10 Rat 11 Rat 12 0 7544 7200 6160 6630 6699 3827 3080
3219 5808 2852 5220 2280 4 4750 5280 4400 3864 3696 4200 5520 1998
5060 4746 3060 2140 10 6375 5969 5664 3358 4551 4230 4983 2520 4000
5775 9100 4080 24 5084 7268 5427 6536 4902 5130 6080 2262 4050 3960
6525 3596 48 7209 7776 6132 6867 7245 6408 13113 5320 7182 4332
6916 4160 72 8464 9592 6806 7306 8352 8096 14774 6832 11505 4200
10742 4453 96 10200 9976 7360 9563 10920 10998 16046 7776 13266
6636 9401 6160 120 8096 7298 5832 8216 9660 9558 12480 7140 10764
6480 8652 5960 144 4664 4620 3135 3105 1408 3648 3648 4428 3572
4560 5280 2698
EXAMPLE 27
Accelerating Recovery from Neutropenia with PEGylated GM-CSF
Cysteine Mutein
[0274] The purpose of this study was to determine whether the
PEGylated GM-CSF cysteine muteins could accelerate recovery from
chemotherapy-induced neutropenia in a mammal. The study was
performed in rats because rats are predictive of neutropenia in
other mammals, including humans. Similar types of experiments can
be performed with other PEGylated GM-CSF cysteine muteins such as
those described in Example 7 and in PCT/US01/16088 to demonstrate
that these proteins are effective at accelerating recovery from
neutropenia. The PEGylated GM-CSF muteins will be effective from
the low .mu.g/kg (e.g., at least about 0.1 .mu.g/kg) to the mg/kg
range (e.g., at least about 0.1 mg/kg) with the preferred level
being between 25-300 .mu.g/kg.
[0275] Male Sprague Dawley rats (5 animals per group) weighing
approximately 180 g were given an intraperitoneal dose of
cyclophosphamide (CPA; 100 mg/kg) on Day 0. Wild type muGM-CSF, 20
kDa-PEG-T3C muGM-CSF or 40 kDa-PEG-T3C muGM-CSF prepared as
described in Example 25 were then injected subcutaneously into rats
at a dose of 100 .mu.g/kg on Days 1-5. Protein samples were
prepared in phosphate buffered saline. As controls, different
groups of rats were injected with wild type muGM-CSF (Example 24)
or vehicle (phosphate buffered saline). There was one group of rats
that received no chemotherapy. A blood sample was collected at
pre-dose (Day 0) and on Days 1-11 and 13 from all groups to perform
a complete blood cell count (CBC) analysis. 400 .mu.l of whole EDTA
blood was removed and placed in an eppendorf tube for submission to
an external lab for CBC analysis.
[0276] Results of the CBC analysis for white blood cells and
neutrophils are shown in Tables 6 and 7. CPA-treatment caused a
drastic drop in neutrophil and white blood cell counts by Day 1. It
was found that the 20 kDa-PEG-T3C and 40 kDa-PEG-T3C muGM-CSF
accelerated the recovery of neutropenia compared to the CPA-only
treated group and the wild type muGM-CSF treated group. Neutrophil
counts returned to normal levels (day 0 values) between Days 5 and
6 for the PEG-T3C muGM-CSF proteins versus between Day 9 and 10 for
the CPA-only treated animals and the wild type muGM-CSF treated
animals. White blood cell counts returned to normal levels between
Days 6 and 8 for the PEG-T3C muGM-CSF proteins, whereas white blood
cell counts in the CPA-treated animals and the wild type muGM-CSF
treated animals had not returned to normal levels (day 0 values)
even by day 13 when the experiment was terminated. Similar types of
experiments could be performed using different dosing schedules,
e.g., a single injection on day 1, every other day injections or
every third day injections, or weekly injections to determine an
optimum dosing schedule for the PEG-GM-CSF cysteine muteins.
TABLE-US-00018 TABLE 6 Effects of multiple doses of muGM-CSF, 20
kDa-PEG-T3C and 40 kDa-PEG-T3C on white blood cell (WBC) counts in
neutropenic rats White Blood Cells (1000/.mu.L)* Time Control (Day)
(Vehicle) CPA-alone muGM-CSF 20 kDa-PEG-T3C 40 kDa-PEG-T3C 0 9.8
+/- 0.5 9.4 +/- 0.5 9.8 +/- 0.5 9.8 +/- 0.8 10.4 +/- 0.3 1 9.1 +/-
0.2 3.4 +/- 0.5 3.3 +/- 0.2 3.1 +/- 0.2 3.3 +/- 0.3 2 13.6 +/- 0.5
2.2 +/- 0.2 1.6 +/- 0.2 1.4 +/- 0.1 2.3 +/- 0.3 3 11.2 +/- 0.5 1.6
+/- 0.6 1.2 =/- 0.3 4.3 +/- 0.5 3.7 +/- 0.4 4 13.6 +/- 0.5 2.3 +/-
0.2 1.6 +/- 0.2 1.4 +/- 0.1 2.3 +/- 0.3 5 11.2 +/- 1.0 1.0 +/- 0.1
1.0 +/- 0.1 0.9 +/- 0.1 1.3 +/- 0.4 6 10.4 +/- 0.4 1.4 +/- 0.3 1.4
+/- 0.1 4.3 +/- 0.6 4.0 +/- 1.1 7 11.6 +/- 0.6 2.2 +/- 0.3 3.4 +/-
0.3 11.1 +/- 1.1 8.7 +/- 1.4 8 11.8 +/- 0.5 3.0 +/- 0.2 3.8 +/- 0.3
10.6 +/- 0.7 11.4 +/- 1.4 9 14.6 +/- 0.4 3.6 +/- 0.2 4.9 +/- 0.4
10.1 +/- 1.0 12.3 +/- 2.1 10 11.3 +/- 0.8 4.8 +/- 0.5 6.5 +/- 0.3
7.2 +/- 0.6 9.6 +/- 1.9 11 11.1 +/- 0.9 5.0 +/- 0.3 6.5 +/- 0.2 5.7
+/- 0.4 6.2 +/- 0.9 13 13.2 +/- 0.4 6.6 +/- 0.5 6.2 +/- 0.3 5.0 +/-
0.8 5.1 +/- 0.2 *WBC counts are means .+-. SE from 5 rats/group
[0277] TABLE-US-00019 TABLE 7 Effects of multiple doses of
muGM-CSF, 20 kDa-PEG-T3C and 40 kDa-PEG-T3C on absolute neutrophil
counts in neutropenic rats Absolute Neutrophil Count (cells/.mu.L)*
Time Control (Day) (Vehicle) CPA-alone muGM-CSF 20 kDa-PEG-T3C 40
kDa-PEG-T3C 0 1333 +/- 90 1352 +/- 153 1328 +/- 111 1330 +/- 177
1335 +/- 103 1 1778 +/- 121 902 +/- 191 700 +/- 38 735 +/- 78 790
+/- 68 2 1659 +/- 280 602 +/- 82 154 +/- 14 566 +/- 64 1181 +/- 217
3 1688 +/- 233 428 +/- 193 277 +/- 91 3060 +/- 333 2620 +/- 238 4
1659 +/- 280 625 +/- 101 154 +/- 14 566 +/- 64 1181 +/- 217 5 1108
+/- 187 130 +/- 66 152 +/- 41 236 +/- 57 370 +/- 155 6 1355 +/- 222
103 +/- 35 189 +/- 49 2041 +/- 369 2215 +/- 844 7 1445 +/- 196 227
+/- 53 593 +/- 136 6366 +/- 759 4338 +/- 999 8 1786 +/- 240 338 +/-
35 631 +/- 220 4870 +/- 321 5171 +/- 836 9 2371 +/- 221 676 +/- 161
1156 +/- 197 3277 +/- 436 3636 +/- 1346 10 2178 +/- 279 1617 +/-
228 2573 +/- 135 2508 +/- 332 2636 +/- 887 11 1964 +/- 164 2337 +/-
183 2952 +/- 360 2296 +/- 304 2161 +/- 313 13 1830 +/- 159 2244 +/-
166 1843 +/- 172 1502 +/- 222 1433 +/- 72 *Neutrophil counts are
means .+-. SE for 5 rats/group
EXAMPLE 28
Expression, Purification and PEGylation of EPO Cysteine Muteins
[0278] A detailed background of protein expression, purification,
PEGylation and analysis, as well as useful sites for introducing
free cysteine residues into EPO are described in Example 2 and
PCT/US01/16088, which is incorporated herein by reference in its
entirety. Example 2 and PCT/US01/16088 describe cysteine muteins of
human EPO that can be modified with cysteine-reactive PEG reagents
and retain activity in in vitro bioactivity assays. The purpose of
the studies outlined below was to determine whether the PEGylated
EPO cysteine muteins stimulated red blood cell formation (as
measured by an increase in blood hematocrit levels) in normal
animals. Similar types of experiments can be performed with other
PEGylated EPO cysteine muteins such as those described in Example 2
and PCT/US01/16088 to demonstrate that these proteins are effective
at increasing red blood cell formation (hematocrit levels) in mice.
The studies were performed in mice because mice are predictive of
erythropoiesis in other mammals, including humans.
[0279] An EPO cysteine mutein, *167C, was created by adding a
cysteine residue following the last amino acid, R166, in the EPO
coding sequence. Construction of the *167C EPO cysteine mutein is
described in PCT/US00/00931. EPO cysteine mutein *167C was
expressed in CHO cells and secreted into the culture medium as
follows. The DNA encoding the EPO mutein was preceded by the
natural EPO secretory signal sequence and followed by a seven amino
acid linker sequence SGGSGGS and a Flag peptide sequence (Kodak),
DYKDDDDK. This EPO gene was cloned into the expression vector pcDNA
3.1 (Invitrogen) by standard recombinant DNA techniques. The
resulting plasmid is termed pBBT410. A stably transformed CHO cell
line expressing the EPO mutein was constructed as follows. The CHO
DXB11 DHFR deficient cell line was obtained from Dr. Lawrence
Chasin (Columbia University). The cells were co-transfected with
plasmid pdhfr 3.2 (American Type Culture Collection, Rockville,
Md.; catalogue #37166) and plasmid pBBT410, which is described in
PCT/US00/19336, using lipofectamine reagent and Opti-MEM media
(Invitrogen Corporation). After 3 days of growth in non-selective
media (Alpha MEM media containing 10% dialyzed fetal calf serum, 1
.mu.M sodium hypoxanthine, 16 .mu.M thymidine), the cells were
split 1:10 and 1:20 into selective media (Alpha MEM media
containing 10% dialyzed fetal calf serum, 300 .mu.g/ml geneticin
(Invitrogen Corporation). After about 2 weeks, stable clones were
picked with the aid of cloning rings. Clones were screened for
those that express EPO protein by Western blot analysis of the
conditioned media using anti-EPO antisera (R&D Systems, Inc.)
and by ELISA using Quantikine human EPO ELISA kits obtained from
R&D Systems, Inc. One positive clone was selected for
production of protein. Large amounts of the *167C EPO cysteine
mutein were obtained by seeding twenty T150 flasks with clone and
allowing the cells to grow to confluency in selective media. Once
the cells reached confluency, conditioned medium was collected on
days 3, 6 and 9. The medium was clarified by centrifugation and
frozen at -80.degree. C. The *167C EPO cysteine mutein was purified
from the conditioned media as follows. Approximately 700 ml of
conditioned media was filtered through a 0.2 um filter. A 1M
solution of cystine was then added to the conditioned media to a
final concentration of 2.5 mM. The use of cystine to assist
purification of EPO cysteine muteins is described in
PCT/US00/00931. In some of the purification runs, NaCl was added to
a final concentration of 150 mM. Anti-flag M2 affinity resin (Sigma
Aldrich Company, catalogue # A2220) was washed with Buffer B (0.1M
Glycine pH 3.0, 0.05% Tween 20, 20% Glycerol) and then with Buffer
A (50 mM Tris pH 7.5, 150 mM NaCl, 0.05% Tween 20, 20% Glycerol).
In some experiments the glycerol concentration in Buffers A and B
was lowered from 20% to 10%. The washed resin was batch loaded with
the filtered conditioned media on a roller bottle apparatus at
4.degree. C., overnight, The affinity resin was collected in a
column and washed with Buffer A until the A280 reached baseline.
Bound proteins were eluted with Buffer B. Fractions were collected
and immediately neutralized to approximately pH 8. The unbound
material from the first affinity column was rebatched with the
anti-flag resin and the affinity column purification procedure
repeated. Fractions containing *167C-EPO-flag protein from each
column run were pooled, diluted 5-10-fold with Buffer C (20 mM
Bis-Tris pH 7.0, 0.01% Tween 20, 10% Glycerol) and loaded on a 1 ml
HiTrap Q-Sepharose column (Amersham Pharmacia). Bound proteins were
eluted with Buffer D (20 mM Bis-Tris pH 7.0, 0.01% Tween 20, 10%
Glycerol, 1M NaCl). In some purification runs Buffers C and D
contained 10 mM Tris pH 7.5 rather than 20 mM Bis-Tris pH 7.0 and
Buffer D contained 0.5M NaCl rather than 1M NaCl. Fractions
containing the *167C-EPO-flag protein were pooled and loaded (in
500 ul loads) onto a Superdex 200 10/30 column (Amersham Pharmacia)
pre-equilibrated with 50 mM sodium phosphate pH 7.5, 150 mM NaCl,
15% glycerol. Fractions containing the *167C-EPO flag protein were
pooled and the protein concentration determined using a Bradford
Dye Binding assay kit (Bio-Rad Laboratories) that uses bovine serum
albumin as the standard. Approximately 1.4 mg of *167C-EPO flag
protein was recovered from the 700 ml of conditioned media.
[0280] The *167C-EPO-flag protein can be captured on a
Blue-Sepharose column prior to purification of the protein using
the Anti-flag M2 affinity resin. In these experiments, cystine is
added to the conditioned media to a final concentration of 5 mM
cystine and the pH is adjusted to pH 5 with glacial acetic acid.
The media is then filtered through a 0.2 .mu.m filter and loaded
onto a 5 ml HiTrap Blue-Sepharose column (Amersham Pharmacia) that
has been pre-equilibrated with Buffer E (20 mM sodium acetate pH
5.0, 100 mM NaCl, 5 mM CaCl.sub.2). The column is then washed with
four column volumes of Buffer F (20 mM Tris pH 6.5, 5 mM
CaCl.sub.2) and the bound proteins eluted with Buffer G (100 mM
Tris pH 9.2, 1.5 M NaCl, 5 mM CaCl.sub.2, 0.01% Tween 20).
Fractions containing the *167C-EPO-flag protein are pooled and can
be further purified using the Anti-flag affinity, Q-Sepharose and
Superdex 200 columns as described above.
[0281] The following procedure was used to modify about 1 mg of
*167C-EPO-flag protein with maleimide-PEGs. Maleimide-PEGs of
various sizes (2-40 kDa) are available from Shearwater, Inc.
(Huntsville, Ala.). Other types of cysteine-reactive PEGs, such as
vinylsulfone PEGs, can be substituted for maleimide PEGs, if
desired. The *167C-EPO-flag protein was incubated for 2 hours at
room temperature in a pH 8.0 solution containing a 20-fold molar
excess of TCEP [(Tris(2-carboxyethyl) phosphine)-HCl] (Pierce
Chemical Company), a 20-fold molar excess of 20 kDa-maleimide PEG
(20 kDa-mPEG, Shearwater, Inc.) or 40 kDa-maleimide-PEG (40
kDa-mPEG2, Shearwater, Inc.), and 0.01% Tween 20. An additional
10-fold molar excess of TCEP and 10-fold molar excess of
maleimide-PEG were then added to the reaction and the mixture
incubated for another 1 hour at room temperature. The PEGylation
reaction was then diluted 10-fold with Buffer H (20 mM Bis-Tris pH
7.0, 0.01% Tween 20, 10% glycerol) and loaded onto a 1 ml HiTrap
Q-Sepharose column (Amersham Pharmacia) that had been
pre-equilibrated with Buffer H. Bound proteins were eluted with a
50% step of Buffer H containing 1M NaCl. In some experiments Buffer
H contained 20 mM Tris pH 7.5 rather than 20 mM Bis-Tris pH 7.0.
Fractions containing the PEG-*167C-flag protein were pooled and
loaded (approximately 500 .mu.l per column run) onto a Superdex 200
10/30 column pre-equilibrated with 50 mM sodium phosphate pH 7.5,
150 mM NaCl, 10% glycerol. Fractions containing the mono-PEGylated
*167C-EPO-flag protein were pooled, diluted 10-fold with Buffer C
(20 mM Bis-Tris pH 7.0, 0.01% Tween 20, 10% glycerol) and loaded
onto a 1 ml HiTrap Q-Sepharose column (Amersham Pharmacia)
pre-equilibrated with Buffer C. Bound proteins were eluted with a
50% step of Buffer D (20 mM Bis-Tris pH 7.0, 0.01% Tween 20, 10%
glycerol, 1M NaCl). Fractions containing the mono-PEGylated
*167C-EPO-flag protein were pooled and protein concentration
determined using a Bradford dye binding assay kit (Bio-Rad
Laboratories), using bovine serum albumin as the standard.
Approximately 560 .mu.g of 20 kDa-mono-PEGylated *167C-EPO-flag
protein was recovered from 1 mg of starting protein. Approximately
700 ug of 40 kDa-mono-PEGylated *167C-EPO-flag protein was
recovered from 1.5 mg of starting protein.
EXAMPLE 29
Use of PEG-*167C-Epo to Increase Hematocrit Levels in Mice
[0282] In this study, it was shown that times per week (TIW)
administration of 40 kDa-monoPEGylated *167C-EPO-flag is effective
at increasing red blood cell formation (hematocrit levels) in mice.
Forty mice (strain CD-1) were used in the study. After arrival, the
animals were allowed to acclimatize to their environment for 10
days. The animals were then divided in 5 groups, 8 mice/group.
Group 1 mice did not receive any injections. Group 2 mice were
injected subcutaneously TIW for three weeks with Dulbecco's PBS, 10
ml/kg, containing 250 .mu.g/ml of murine albumin ("vehicle"). The
remaining three groups were treated TIW for three weeks with
various doses of 40 kDa PEG-*167C-EPO-Flag suspended in vehicle.
Groups 3, 4, and 5 received TIW injections 2.5 .mu.g/kg, 5
.mu.g/kg, and 20 .mu.g/kg per injection of 40 kDa
PEG-*167C-EPO-Flag, respectively. Retroorbital blood samples were
taken from all groups twice/week, starting on day 0 (where day 1
was the first day of injections) and hematocrits measured. Animals
received injections of test samples on days 1, 4, 6, 8, 11, 13, 15,
18 and 20. Blood samples were drawn for hematocrit measurements on
days 0, 5, 8, 12, 15, 19 and 22. For each group, the average
hematocrit and standard error of the mean (S.E.M.) was calculated
over time (Table 8). The data show that all doses of the 40
kDa-PEG-*167C-EPO protein were effective at increasing hematocrit
levels in the mice using the TIW dosing frequency. TABLE-US-00020
TABLE 8 40 K-PEG-*167C EPO Increases Hematocrit Levels In Mice
Hematocrit (%) .+-. SEM Group 1 Group 3 Group 4 Group 5 No Group 2
PEG-*167C PEG-*167C PEG-*167C Day injections Vehicle 2.5 .mu.g/kg 5
.mu.g/kg 20 .mu.g/kg 0 45.6 .+-. 1.0 45.6 .+-. 0.7 45.9 .+-. 0.3
45.9 .+-. 0.3 45.9 .+-. 0.1 5 44.2 .+-. 0.2 45.6 .+-. 1.2 47.3 .+-.
1.1 49.8 .+-. 0.7 54.7 .+-. 1.1 8 43.9 .+-. 0.3 44.2 .+-. 0.7 49.9
.+-. 1.1 54.5 .+-. 0.9 63.0 .+-. 1.1 12 46.5 .+-. 0.5 46.1 .+-. 0.9
52.7 .+-. 1.0 59.2 .+-. 1.6 68.4 .+-. 2.0 15 45.9 .+-. 0.4 44.6
.+-. 0.8 53.5 .+-. 1.3 60.7 .+-. 2.4 73.4 .+-. 1.4 19 46.2 .+-. 0.6
44.1 .+-. 0.7 52.8 .+-. 0.9 62.8 .+-. 2.4 72.9 .+-. 0.9 22 44.8
.+-. 0.9 46.0 .+-. 1.1 53.2 .+-. 1.6 66.0 .+-. 2.8 72.9 .+-.
3.1
EXAMPLE 30
20 kDa-PEG-*167C-Epo and 40 kDa-PEG-*167C-Epo Increase Hematocrit
Levels in Mice when Administered Once Per Week
[0283] In this study, it was demonstrated that once per week (QW)
administration of 20 kDa PEG-*167C-EPO-flag and 40
kDa-PEG-*167C-EPO-flag was effective at increasing red blood cell
formation (hematocrit levels) in mice. Forty mice (strain CD-1)
were used in the study. After arrival, the animals were allowed to
acclimatize to their environment for 10 days. The animals were then
divided in 5 groups, 8 mice/group. Group 1 was injected
subcutaneously QW for three weeks with Dulbecco's PBS, 10 ml/kg,
containing 250 .mu.g/ml of murine albumin ("vehicle"). The
remaining four groups were treated QW for three weeks with various
doses of 20 kDa PEG-*167C-EPO-flag or 40 kDa PEG-*167C-EPO-flag
suspended in vehicle. Groups 2, 3, and 4 received once per week
injections of 23.5 .mu.g/kg, 47 .mu.g/kg, and 94 .mu.g/kg of 40 kDa
PEG-*167C-EPO-flag, respectively. Group 5 received once per week
injections of 31 .mu.g/kg of 20 kDa PEG-*167C-EPO-flag.
Retroorbital blood samples were taken from all groups twice/week,
starting on day 0 (where day 1 was the first day of injections),
and hematocrits measured. Mice received injections of test samples
on days 1, 8, and 15. Mice were bled and their hematocrits measured
on days 0, 5, 8, 12, 15, 19 and 22. For each group, the average
hematocrit and standard error of the mean was calculated and is
shown in Table 9. The data show that all doses of the 20
kDa-PEG-*167C-EPO and 40 kDA-PEG-*167C-EPO were effective at
increasing hematocrit levels in the mice using the once per week
dosing frequency. Similar experiments can be performed using less
frequent dosing schedules such as once every 2-3 weeks. Similar
experiments can be performed with other EPO cysteine muteins, and
EPO cysteine muteins that do not contain the Flag peptide or
peptide linker. TABLE-US-00021 TABLE 9 20 kDa-PEG-*167C-Epo and 40
kDa-PEG-*167C-Epo increase hematocrit levels in mice when
administered once per week Hematocrit (%) .+-. s.e.m. Group 2 Group
3 Group 4 Group 5 Group 1 40 K-PEG-*167C-EPO 40 K-PEG-*167C-EPO 40
K-PEG-*167C-EPO 20 K-PEG-*167C-EPO Day Vehicle 23.5 .mu.g/kg 47
.mu.g/kg 94 .mu.g/kg 31 .mu.g/kg 1 43.12 .+-. 1.43 43.88 .+-. 0.45
44.13 .+-. 0.34 44.05 .+-. 0.16 44.09 .+-. 0.07 5 42.92 .+-. 0.62
53.66 .+-. 0.57 50.26 .+-. 0.97 53.29 .+-. 1.84 55.16 .+-. 0.76 8
45.50 .+-. 0.65 56.59 .+-. 0.74 57.07 .+-. 1.12 62.06 .+-. 2.07
60.30 .+-. 1.44 12 45.74 .+-. 0.93 59.11 .+-. 0.94 59.18 .+-. 1.57
68.48 .+-. 1.37 63.00 .+-. 0.97 15 45.78 .+-. 0.98 59.17 .+-. 1.38
62.26 .+-. 1.85 69.86 .+-. 1.76 62.93 .+-. 1.78 19 46.75 .+-. 1.02
57.36 .+-. 1.54 65.45 .+-. 2.36 68.06 .+-. 2.67 64.06 .+-. 2.51 22
46.08 .+-. 0.80 52.73 .+-. 3.08 62.87 .+-. 2.65 62.99 .+-. 3.40
62.46 .+-. 2.25
EXAMPLE 31
Preparation, Expression, Purification of PEGylated G-CSF Cysteine
Muteins
[0284] A detailed background of protein expression, purification,
PEGylation and analysis, as well as useful sites for introducing
free cysteine residues into G-CSF are described in Example 5 and
PCT/US01/16088, which is incorporated herein by reference in its
entirety. Example 5 and PCT/US01/16088 describe cysteine muteins of
human G-CSF that can be modified with cysteine-reactive PEG
reagents and retain activity in in vitro bioactivity assays.
[0285] The purpose of the studies outlined below was to determine
whether the PEGylated G-CSF cysteine muteins could accelerate
recovery from chemotherapy-induced neutropenia in a mammal. The
studies were performed in rats because rats are predictive of
neutropenia in other mammals, including humans. Similar types of
experiments can be performed with other PEGylated G-CSF cysteine
muteins such as those described in Example 5 and PCT/US01/16088 to
demonstrate that these proteins are effective at accelerating
recovery from neutropenia.
[0286] The G-CSF L3C and A141C cysteine muteins are described in
Example 5. Construction, expression and purification of
G-CSF-L3C(C17S/L3C) and G-CSF-A141C(C17S/A141C) were performed as
described in PCT/US01/16088 except the protein refolding was
performed overnight rather than for 2 days. The PEGylation of
G-CSF-L3C(C17S/L3C) was done as previously outlined in
PCT/US01/16088. The protein was modified with 20 kDa-mPEG (Cat.
#2D2M0P01) and 40 kDa-branched mPEG (Cat. #2D3X0T01) obtained from
Shearwater, Inc. Concentration of the purified protein was measured
using a Bradford dye binding assay using bovine serum albumin as
the standard. The purified protein was stored frozen at -80.degree.
C. until use.
EXAMPLE 32
Treatment of Neutropenia with Multiple Doses of PEGylated G-CSF
Cysteine Muteins
[0287] In experiments to evaluate the ability of multiple doses of
G-CSF PEGylated cysteine muteins to accelerate recovery from
chemotherapy-induced neutropenia, male Sprague Dawley rats (5
animals per group) weighing approximately 180 g were given an
intraperitoneal dose of cyclophosphamide CPA (100 mg/kg) on Day
0.20 kDa-PEGylated (C17S/L3C) was then injected subcutaneous into
rats at a dose of 100 .mu.g/kg on Days 1-5. Protein samples were
prepared in phosphate buffered saline. As controls, different
groups of rats were injected with commercial G-CSF (Neupogen,
Amgen, Inc.) or vehicle (phosphate buffered saline). There was one
group of rats that received no chemotherapy. A blood sample was
collected at pre-dose (Day 0) and on Days 1-10 and 12 from all
groups to perform a complete blood cell count (CBC) analysis. 400
.mu.l of whole EDTA blood was removed and placed in an eppendorf
tube for submission to an external lab for CBC analysis.
[0288] Results of the CBC analysis for white blood cells and
neutrophils are shown in Tables 10 and 11. CPA-treatment caused a
drastic drop in neutrophil and white blood cell counts by Day 1. It
was shown that the 20 kDa-PEG-G-CSF cysteine mutein accelerated the
recovery of neutropenia compared to the CPA-only treated group
(neutrophil and white blood cell counts approached normal levels
between Days 4 and 5 versus Day 8 for CPA treated animals).
Although Neupogen stimulated time-dependent increases in neutrophil
counts and white blood cell counts, the PEGylated G-CSF cysteine
mutein was far superior to Neupogen, stimulating greater and longer
lasting increases in these parameters. In addition, recovery began
up to a day earlier with the 20 kDa-PEGylated G-CSF (C17S/L3C)
cysteine mutein. TABLE-US-00022 TABLE 10 Effects of multiple doses
of Neupogen or 20 kDa-PEG-GCSF (C17S/L3C) on white blood cell (WBC)
counts in neutropenic rats White Blood Cells (1000/.mu.L)* 20
kDa-PEG- Time Control G-CSF (Day) (Vehicle) CPA-alone G-CSF
(C17S/L3C) 0 10.1 .+-. 0.6 9.6 .+-. 1.7 9.4 .+-. 0.5 11.4 .+-. 0.8
1 10.2 .+-. 0.5 2.7 .+-. 0.3 2.3 .+-. 0.1 2.8 .+-. 0.2 2 12.6 .+-.
1.1 2.2 .+-. 0.3 4.3 .+-. 0.3 4.3 .+-. 0.9 3 11.2 .+-. 1.2 2.2 .+-.
0.1 1.2 .+-. 0.1 1.6 .+-. 0.2 4 11 .+-. 1.3 1.4 .+-. 0.1 1.5 .+-.
0.1 1.9 .+-. 0.2 5 10.6 .+-. 1.5 1.7 .+-. 0.2 3.7 .+-. 0.6 8.2 .+-.
1.0 6 11 .+-. 0 3.6 .+-. 0.7 10.8 .+-. 4.9 24.5 .+-. 2.3 7 11.8
.+-. 0.6 3.6 .+-. 0.1 5.0 .+-. 0.5 28.1 .+-. 2.6 8 12 .+-. 0.4 4.8
.+-. 0.5 5.9 .+-. 0.8 24.4 .+-. 3.0 9 13.2 .+-. 0.4 8.9 .+-. 1.2
7.6 .+-. 0.9 17.8 .+-. 2.2 10 10.2 .+-. 0.6 8.4 .+-. 1.1 7.0 .+-.
0.6 11.3 .+-. 1.4 12 10.3 .+-. 0.7 9.8 .+-. 1.2 4.3 .+-. 0.4 6.5
.+-. 1.1 *WBC counts are means .+-. SE from 5 rats/group
[0289] TABLE-US-00023 TABLE 11 Effects of multiple doses of
Neupogen and 20 kDa-PEG-GCSF (C17S/L3C) on neutrophil counts in
neutropenic rats Absolute Neutrophil Count (cells/.mu.L)* 20
kDa-PEG- Time Control G-CSF (Day) (Vehicle) CPA-alone G-CSF
(C17S/L3C) 0 1374 .+-. 135 1350 .+-. 281 1388 .+-. 143 1397 .+-. 72
1 1236 .+-. 123 484 .+-. 39 488 .+-. 65 773 .+-. 219 2 1796 .+-.
156 837 .+-. 163 2151 .+-. 182 2277 .+-. 843 3 1390 .+-. 35 531
.+-. 113 203 .+-. 65 680 .+-. 77 4 1328 .+-. 274 263 .+-. 36 434
.+-. 138 475 .+-. 95 5 1285 .+-. 139 237 .+-. 69 1644 .+-. 350 4872
.+-. 840 6 1760 .+-. 110 327 .+-. 9 6975 .+-. 3789 18621 .+-. 2144
7 1837 .+-. 197 303 .+-. 93 1971 .+-. 262 20973 .+-. 2478 8 1573
.+-. 194 1558 .+-. 461 2171 .+-. 410 15157 .+-. 2288 9 1804 .+-.
257 4214 .+-. 929 3911 .+-. 573 9159 .+-. 1094 10 1923 .+-. 281
4634 .+-. 1022 3911 .+-. 398 6223 .+-. 1364 12 1430 .+-. 161 49.31
.+-. 1188 1567 .+-. 251 2960 .+-. 863 *Neutrophil counts are means
.+-. SE for 5 rats/group
EXAMPLE 33
Treatment of Neutropenia with a Single Dose of PEGylated G-CSF
Cysteine Muteins
[0290] In experiments to evaluate the ability of a single dose of
PEGylated G-CSF cysteine mutein (C17S/L3C) to accelerate recovery
from chemotherapy-induced neutropenia, male Sprague Dawley rats (5
animals per group) weighing approximately 180 g were given an
intraperitoneal dose of CPA (100 mg/kg) on Day 0.20 kDa- or 40
kDa-PEGylated G-CSF cysteine muteins was then injected subcutaneous
into rats as a single dose of 100 .mu.g/kg on Day 1. Protein
samples were prepared in phosphate buffered saline. As controls,
different groups of rats were injected with commercial G-CSF
(Neupogen, Amgen, Inc.) or vehicle (phosphate buffered saline).
There was one group of rats that received no chemotherapy. A blood
sample was collected at pre-dose (Day 0) and on Days 1-10 and 12
from all groups to perform a complete blood cell count (CBC)
analysis. 400 .mu.l of whole EDTA blood was removed and placed in
an eppendorf tube for submission to an external lab for CBC
analysis.
[0291] Results of the CBC analysis for white blood cells and
neutrophils are shown in Tables 12 and 13. CPA-treatment caused a
significant decrease in neutrophil and white blood cell counts by
Day 1. The 20 kDa- or 40 kDa-PEGylated G-CSF cysteine muteins
accelerated the recovery of neutropenia compared to the CPA-only
treated group (neutrophil and white blood cell counts reached
normal levels between Days 4 and 5 versus Day 9 for the CPA-only
control). Neupogen provided little benefit when given as a single
dose, whereas the 20 kDa- or 40 kDa-PEGylated G-CSF cysteine mutein
stimulated significant increases in both neutrophils and white
blood cells compared to CPA-only treated animals. Animals receiving
20 kDa- or 40 kDa-PEGylated G-CSF cysteine mutein showed
accelerated recovery of neutrophils and white blood cells as
compared to animals receiving only CPA.
[0292] A similar experiment was performed with the G-CSF
(C17S/A141C) cysteine mutein modified with 20 kDa- ands 40
kDa-maleimide PEGs. Male Sprague Dawley rats (5 animals per group)
weighing approximately 180 g were given an intraperitoneal dose of
CPA (100 mg/kg) on Day 0.20 kDa- or 40 kDa-PEGylated G-CSF cysteine
mutein was then injected subcutaneous into rats as a single dose of
100 .mu.g/kg on Day 1. Protein samples were prepared in phosphate
buffered saline. As a control one group of rats was injected with
vehicle (phosphate buffered saline). There was one additional group
of rats that received no chemotherapy. A blood sample was collected
at pre-dose (Day 0) and on Days 1-10 and 12 from all groups to
perform a complete blood cell count (CBC) analysis. 400 .mu.l of
whole EDTA blood was removed and placed in an eppendorf tube for
submission to an external lab for CBC analysis. Results are shown
in Tables 14 and 15. Both the 20 kDa- and 40 kDa-PEGylated G-CSF
(C17S/A141C) cysteine mutein accelerated recovery of neutrophils
and total white blood cells in neutropenic rats compared to
CPA-only treated rats. TABLE-US-00024 TABLE 12 Effects of a single
dose of Neupogen or 20 kDa- or 40 kDa-PEG-GCSF (C17S/L3C) on white
blood cell counts in neutropenic rats White Blood Cells
(1000/.mu.L)* 20 kDa- 40 kDa- No CPA PEG- PEG- Time Control CPA-
G-CSF G-CSF (Day) (Vehicle) alone G-CSF (C17S/L3C) (C17S/L3C) 0 9.9
.+-. 0.5 9.4 .+-. 1.1 10.5 .+-. 0.5 10.6 .+-. 0.6 10.8 .+-. 0.8 1
11.3 .+-. 0.7 2.2 .+-. 0.3 3.0 .+-. 0.1 3.1 .+-. 0.2 2.8 .+-. 0.3 2
10.9 .+-. 0.7 1.9 .+-. 0.1 4.9 .+-. 0.3 5.9 .+-. 0.6 6.1 .+-. 0.7 3
10.1 .+-. 0.4 1.5 .+-. 0.2 1.6 .+-. 0.1 2.0 .+-. 0.1 1.8 .+-. 0.2 4
10.8 .+-. 1.1 1.0 .+-. 0.1 1.5 .+-. 0.1 2.7 .+-. 0.4 1.9 .+-. 0.2 5
12.0 .+-. 0.7 1.8 .+-. 0.3 2.2 .+-. 0.1 5.5 .+-. 0.4 6.5 .+-. 0.4 6
13.4 .+-. 0.8 3.3 .+-. 0.5 5.0 .+-. 0.4 6.8 .+-. 0.4 8.3 .+-. 0.5 7
11.9 .+-. 0.5 2.6 .+-. 0.3 3.5 .+-. 0.1 4.8 .+-. 0.4 4.9 .+-. 0.4 8
12.9 .+-. 0.7 3.9 .+-. 0.5 5.8 .+-. 0.3 6.1 .+-. 0.7 5.4 .+-. 1.0 9
13.8 .+-. 0.4 7.0 .+-. 1.0 8.7 .+-. 0.3 8.9 .+-. 1.1 9.3 .+-. 0.9
10 11.2 .+-. 0.4 6.1 .+-. 0.6 6.8 .+-. 0.2 6.2 .+-. 0.2 6.7 .+-.
0.5 12 10.5 .+-. 1.1 5.1 .+-. 0.5 5.1 .+-. 0.5 5.8 .+-. 0.3 5.1
.+-. 0.9 *WBC counts are means .+-. SE from 5 rats/group
[0293] TABLE-US-00025 TABLE 13 Effects of a single dose of Neupogen
or 20 kDa- or 40 kDa-PEG-GCSF (C17S/L3C) on neutrophil counts in
neutropenic rats Absolute Neutrophil Counts (cells/.mu.L)* No CPA
20 kDa-PEG- 40 kDa-PEG- Time Control G-CSF G-CSF (Day) (Vehicle)
CPA-alone G-CSF (C17S/L3C) (C17S/L3C) 0 1144 .+-. 185 1134 .+-. 178
1166 .+-. 99 1139 .+-. 88 1148 .+-. 100 1 1442 .+-. 191 449 .+-. 70
783 .+-. 166 830 .+-. 205 758 .+-. 196 2 1760 .+-. 224 457 .+-. 40
2538 .+-. 260 3316 .+-. 474 3647 .+-. 547 3 1076 .+-. 127 350 .+-.
55 145 .+-. 32 488 .+-. 79 455 .+-. 51 4 1499 .+-. 238 105 .+-. 25
212 .+-. 38 917 .+-. 363 439 .+-. 77 5 1565 .+-. 116 236 .+-. 67
344 .+-. 54 2356 .+-. 308 3551 .+-. 395 6 1761 .+-. 195 473 .+-.
137 1255 .+-. 153 3106 .+-. 232 4476 .+-. 314 7 1792 .+-. 241 435
.+-. 66 891 .+-. 108 1635 .+-. 233 2207 .+-. 380 8 2214 .+-. 388
1054 .+-. 291 2345 .+-. 197 2276 .+-. 422 2358 .+-. 460 9 1995 .+-.
284 3057 .+-. 725 4169 .+-. 183 4010 .+-. 799 3723 .+-. 330 10 1571
.+-. 118 2520 .+-. 392 2761 .+-. 144 2242 .+-. 180 2820 .+-. 314 12
1833 .+-. 309 2109 .+-. 337 1648 .+-. 182 1845 .+-. 174 1886 .+-.
306 *Neutrophil counts are means .+-. SE for 5 rats/group
[0294] TABLE-US-00026 TABLE 14 Effects of a single dose of Neupogen
or 20 kDa- or 40 kDa-PEG-GCSF (C17S/A141C) on white blood cell
counts in neutropenic rats White Blood Cells (1000/.mu.L)* No CPA
20 kDa-PEG- 40 kDa-PEG- Time Control G-CSF G-CSF (Day) (Vehicle)
CPA-alone G-CSF (C17S/A141C) (C17S/A141C) 0 12 .+-. 0.9 11.3 .+-.
0.8 12.9 .+-. 0.6 12.5 .+-. 0.6 12 .+-. 0.7 1 12.2 .+-. 2.1 4 .+-.
0.4 3.9 .+-. 0.3 3.7 .+-. 0.3 3.7 .+-. 0.5 2 13.9 .+-. 0.9 2.4 .+-.
0.3 6.2 .+-. 0.3 9 .+-. 0.4 7.3 .+-. 0.3 3 12 .+-. 0.5 1.7 .+-. 0.2
1.5 .+-. 0.1 3.3 .+-. 0.3 2.8 .+-. 0.1 4 9.4 .+-. 0.7 1.0 .+-. 0.1
1.0 .+-. 0.1 1.9 .+-. 0.3 1.4 .+-. 0.2 5 9.8 .+-. 1.2 1.1 .+-. 0.2
1.3 .+-. 0.2 3.7 .+-. 0.4 5.5 .+-. 0.8 6 12.6 .+-. 1.1 3 .+-. 0.6
4.8 .+-. 0.4 8.9 .+-. 1.9 9.5 .+-. 0.5 7 10.6 .+-. 0.7 2.8 .+-. 0.2
2.4 .+-. 0.4 6.5 .+-. 1.1 7 .+-. 0.8 8 12.5 .+-. 0.8 3.8 .+-. 0.2
4.3 .+-. 0.3 7.6 .+-. 1.1 6.7 .+-. 1.2 9 13.7 .+-. 0.6 6.6 .+-. 0.5
7.5 .+-. 0.4 10.4 .+-. 0.9 10 .+-. 1 10 12.1 .+-. 0.7 6.3 .+-. 0.5
6.6 .+-. 0.5 6.9 .+-. 0.9 6.4 .+-. 0.5 12 8.6 .+-. 1.2 4.7 .+-. 0.4
4.0 .+-. 0.4 6.0 .+-. 0.6 5.9 .+-. 0.7 *WBC counts are means .+-.
SE from 5 rats/group
[0295] TABLE-US-00027 TABLE 15 Effects of a single dose of Neupogen
or 20 kDa- or 40 kDa-PEG-GCSF (C17S/A141C) on neutrophil counts in
neutropenic rats Absolute Neutrophil Counts (cells/.mu.L)* No CPA
20 kDa-PEG- 40 kDa-PEG- Time Control G-CSF G-CSF (Day) (Vehicle)
CPA-alone G-CSF (C17SA141C) (C17S/A141C) 0 2406 .+-. 527 2312 .+-.
368 2306 .+-. 330 2251 .+-. 217 2254 .+-. 203 1 1987 .+-. 356 1007
.+-. 200 644 .+-. 62 687 .+-. 94 762 .+-. 289 2 2138 .+-. 304 642
.+-. 123 3606 .+-. 142 5977 .+-. 288 4675 .+-. 241 3 1992 .+-. 190
499 .+-. 89 243 .+-. 26 1312 .+-. 102 1027 .+-. 95 4 1181 .+-. 163
125 .+-. 9 137 .+-. 16 334 .+-. 93 265 .+-. 61 5 1310 .+-. 229 135
.+-. 27 187 .+-. 37 1302 .+-. 181 3006 .+-. 568 6 4188 .+-. 1679
540 .+-. 186 1239 .+-. 239 4621 .+-. 1369 5388 .+-. 507 7 1506 .+-.
80 409 .+-. 98 422 .+-. 88 3242 .+-. 915 3717 .+-. 523 8 1721 .+-.
147 794 .+-. 127 1158 .+-. 112 3827 .+-. 801 2668 .+-. 556 9 2505
.+-. 229 2962 .+-. 375 3618 .+-. 334 5712 .+-. 674 4225 .+-. 189 10
2135 .+-. 634 2745 .+-. 169 3228 .+-. 609 3262 .+-. 453 3242 .+-.
353 12 1391 .+-. 250 1533 .+-. 108 1281 .+-. 174 1842 .+-. 283 1937
.+-. 179 *Neutrophil counts are means .+-. SE for 5 rats/group
EXAMPLE 34
Use of Alpha Interferon Cysteine Muteins to Inhibit growth of Human
Cancer Cells
[0296] IFN-.alpha.2 cysteine muteins and methods for expressing,
purifying and PEGylating the proteins are described in Example 3
and in PCT/US00/00931 and PCT/US01/16088. The M111C mutein was
expressed and refolded as described in PCT/US00/00931 and
PCT/US01/16088. M111 is located in the C-D loop of alpha
interferon-2. The protein was purified by a combination of
S-Sepharose, copper chelating (immobilized metal affinity
chromatography) and Phenyl-Sepharose (hydrophobic interaction
chromatography) column chromatography, methods for which are
described in PCT/US00/00931 and PCT/US01/16088. The protein was
modified with a 20 kDa-maleimide PEG (Shearwater Corporation) using
dithiothreitol (DTT) as the reducing agent. The protein was
partially reduced by incubation with a 25-fold molar excess of DTT
for 20 minutes at room temperature. The solution was dialyzed
against 20 mM MES, pH5. The PEGylation step was performed using a
10-fold molar excess of 20 kDa-maleimide PEG, 100 mM Tris, 0.5M
EDTA, 2.6 micromolar IFN-.alpha. (M111C) at pH 7.5, at room
temperature for 1 hour. The reaction was stopped by diluting the
sample 1:4 with 20 mM MES, pH 5 and adjusting the pH to <4.
PEGylated M111C protein was separated from unPEGylated protein by
S-Sepharose chromatography. Similar methods were used to prepare
the M111C protein modified with a 40 kDa-branched maleimide PEG
(Shearwater Corporation).
[0297] A study was done to evaluate the potential of the PEGylated
IFN-.alpha.2 (M111C) cysteine mutein to inhibit growth of human
tumor cells in a tumor xenograft model. The human tumor cell line
used was the ovarian carcinoma cell line NIH-OVCAR-3, which was
obtained from the American Type Culture Collection (Rockville,
Md.). Cells were grown in vitro in MEM media containing 10% fetal
bovine serum, glutamine and penicillin. Female athymic nude (nu/nu)
mice, 5 to 6 weeks of age and weighing approximately 23 grams at
study initiation, were obtained from Charles River (Wilmington,
Mass.). The NIH-OVCAR-3 cells were harvested by trypsinization,
washed and resuspended at a concentration of 25.times.10.sup.6
cells per ml in a 50:50 mixture of Phosphate Buffered Saline
(PBS)/Matrigel. Matrigel was purchased from BD Biosciences
(Bedford, Mass.). Animals (10-11 animals/group) were injected
subcutaneously in the axillary area with 0.2 ml of the PBS/Matrigel
mixture containing 5 millions cells on day O, Subcutaneous dosing
(0.2 ml/animal) of the test compounds began on day 1 and continued
through day 69 using a 3 times per week dosing schedule (Monday,
Wednesday, Friday). Mice were weighed on day 0, prior to the
injection of cells, and on the days of tumor measurements. Animals
were randomized according to body weight on day 0. Tumors were
measured using calipers at 3-4 day intervals for 10 weeks post
injection. Tumor volume was determined using a formula of
((Width.times.Width).times.Length)/2). The length and width of the
tumors were measured with a Fowler Ultra-Cal III caliper. These
measurements were taken perpendicular to each other. The unit of
measurement was in millimeters. This volume (mm.sup.3) is
considered a valid estimate of weight (in mg). Dosing of the test
compounds began on day 1 and continued for 10 weeks. The dosing
route was subcutaneous. The dose volume remained constant at 0.2
ml/animal. One group of 10 animals received vehicle solution
(phosphate buffered saline containing 0.1 mg/ml of mouse
albumin).
[0298] A second group of 11 animals received 5
micrograms/injection/mouse of IFN-.alpha.2 (Roferon, Roche) in
vehicle solution. A third group of 11 animals received 5
micrograms/injection/mouse of 20 kDa-PEG-IFN-.alpha. (M111C) in
vehicle solution. Table 16 shows the mean tumor volumes for the
test groups over time. All of the test groups showed an initial
decline in tumor volume through about day 20, which appears to be
due to absorption of the PBS/matrigel mixture. From about day 20
until the end of the study, tumors increased in volume in animals
receiving the vehicle solution. Tumor volumes in animals receiving
20 kDa-PEG-IFN-.alpha. (M111C) were significantly smaller than
tumor volumes in animals receiving vehicle solution at all times
from about day 16 to day 70. Mean tumor weight at necropsy (day 70)
also was significantly reduced in animals receiving 20
kDa-PEG-IFN-.alpha.2 (M111C) compared to animals receiving vehicle.
The data demonstrate that 20 kDa-PEG-IFN-.alpha.2 (M111C) is very
effective at inhibiting growth of human tumors in animals. Similar
experiments can be performed testing lower or higher doses of the
PEGylated cysteine mutein, different dosing regimens, e.g., once
per week or once every other week, or different routs of
administration, e.g., intravenous or intraperitoneal.
TABLE-US-00028 TABLE 16 20 K-PEG IFN-.alpha. (M111C) Inhibits
growth of human Tumor Xenografts in Nude Mice Mean Tumor Volume
.+-. SEM (cubic millimeters) 20 K-PEG IFN-.alpha. Day of study
Vehicle WT IFN-.alpha. (M111C) 1 175.93 .+-. 11.98 208.21 .+-.
14.98 204.45 .+-. 10.85 2 186.58 .+-. 8.28 166.08 .+-. 12.55 159.38
.+-. 10.09 6 102.22 .+-. 6.61 87.99 .+-. 8.82 76.28 .+-. 4.70 9
74.36 .+-. 4.65 64.33 .+-. 7.59 56.73 .+-. 3.47 13 70.73 .+-. 4.81
59.81 .+-. 10.50 45.43 .+-. 3.89 16 74.98 .+-. 5.11 51.76 .+-. 4.33
36.13 .+-. 3.03 20 79.44 .+-. 3.34 50.52 .+-. 4.17 26.75 .+-. 4.25
23 85.55 .+-. 5.12 61.65 .+-. 5.78 36.29 .+-. 4.98 27 100.18 .+-.
4.52 64.93 .+-. 6.35 27.20 .+-. 3.98 30 110.05 .+-. 6.58 56.17 .+-.
5.20 23.48 .+-. 4.15 34 115.81 .+-. 9.30 48.56 .+-. 5.19 18.46 .+-.
5.40 37 142.18 .+-. 11.26 47.71 .+-. 5.40 15.29 .+-. 3.60 41 190.06
.+-. 16.06 80.82 .+-. 11.29 24.09 .+-. 5.95 44 211.06 .+-. 16.94
99.86 .+-. 12.74 26.01 .+-. 7.62 48 252.63 .+-. 25.13 110.22 .+-.
12.33 47.14 .+-. 10.56 51 288.32 .+-. 41.95 138.89 .+-. 15.74 36.49
.+-. 7.53 55 388.16 .+-. 54.09 154.49 .+-. 18.20 39.92 .+-. 8.14 58
392.12 .+-. 65.46 162.00 .+-. 18.64 34.73 .+-. 9.26 62 438.91 .+-.
93.31 192.96 .+-. 25.85 28.89 .+-. 8.80 65 442.13 .+-. 85.65 212.40
.+-. 30.03 23.30 .+-. 8.36 70 561.30 .+-. 138.49 200.51 .+-. 24.87
12.69 .+-. 6.65
[0299] All of the documents cited herein are incorporated herein by
reference.
[0300] The protein analogues disclosed herein can be used for the
known therapeutic uses of the native proteins in essentially the
same forms and doses all well known in the art.
[0301] While the exemplary preferred embodiments of the present
invention are described herein with particularity, those having
ordinary skill in the art will recognize changes, modifications,
additions, and applications other than those specifically described
herein, and may adapt the preferred embodiments and methods without
departing from the spirit of this invention.
REFERENCES
[0302] Abdel-Meguid, S. S., Shieh, h.-S., Smith W. W., Dayringer,
H. E., Violand, B. N. and Bentle, L. A. (1987) Proc. Natl. Acad.
Sci. USA 84: 6434-6437. [0303] Abuchowski, A., Kazo, G. M.,
Verhoest, C. R., van Es, T., Kafkewitz, D., Nucci, M. L., Viau, A.
T. and Davis, F. F. (1984) Cancer Biochem. Biophys. 7: 175-186.
[0304] Aggarwal, B. B. (1998) Human Cytokines. Handbook for Basic
and Clinical Research. Volume I11. Blackwell Science, Malden, Mass.
[0305] Aggarwal, B. B. and Gutterman, J. U. (1992) Human Cytokines.
Handbook for Basic and Clinical Research. Volume I. Blackwell
Scientific Publications, Cambridge, Mass. [0306] Aggarwal, B. B.
and Gutterman, J. U. (1996) Human Cytokines. Handbook for Basic and
Clinical Research. Volume II. Blackwell Science, Cambridge, Mass.
[0307] Anderson, D. M., Johnson, L., Glaccum, M. B., Copeland, N.
G., Gilbert, D. J., Jenkins, N. A., Valentine, V., Kirstein, M. N.,
Shapiro, D. N., Morris, S. W., Grabstein, K. and cosman, D. (1995)
Genomics 25: 701-706. [0308] Armitage, J. O. (1998) Blood 92:
4491-4508. [0309] Balkwill, F. R. (1986) Methods Enzymology 119:
649-657. [0310] Bartley, T. D., Bogenberger, J. et al., (1994) Cell
77: 1117-1124. [0311] Bazan, F. (1991) Immunology Today 11:
350-354. [0312] Bazan, J. F. (1992) Science 257: 410-411. [0313]
Becker, G. W. and Hsiung, H. M. (1986) FEBS Letters 204: 145-150.
[0314] Bill, R. M., Winter, P. C., McHale, C. M., Hodges, V. M.,
Elder, G. E., Caley, J., Flitsch, S. L., Bicknell, R. Lappin, T. R.
J. (1995) Biochem. Biophys. Acta 1261: 35-43. [0315] Bischof, R.
J., Zafiropoulos, D., Hamilton, J. A. and Campbell, I. K. (2000)
Clin. Exp. Immunology 119: 361-367. [0316] Bittorf, T., Jaster, R.,
Brock, J. (1993) FEBS Letters 336: 133-136. [0317] Blatt, L. M.,
Davis, J. M., Klein, S. B. and Taylor, M. W. (1996) Journal of
Interferon and cytokine Research 16: 489-499. [0318] Blumberg, H.,
Conklin, D., Xu, W., Grossmann A. et al. (2001) Cell 104: 9-19.
[0319] Boissel, J.-P., Lee, W.-R., Presnell, S. R., Cohen, F. E.
and Bunn, H. F. (1993) J. Biol. Chem. 268: 15983-15993. [0320]
Butler, C. A. (1996) Lehman Brothers Technical Report "A Paradigm
for Success". [0321] Campbell, I. K., Bendele, A., smith, D. A. and
Hamilton, J. A. (1997) Annals of the Rheumatic Diseases 56:
364-368. [0322] Campbell, I. K., Rich, M. J., Bischof, R. J., Dunn,
A. R., Grail, D. and Hamilton, J. A. (1998) The Journal of
Immunology 161: 3639-3644. [0323] Cantrell, M. A., Anderson, D.,
Cerretti, D. P., Price, V., McKereghan, K., Tushinski, R. J.,
Mochizuki, D. Y., Larsen, A., Grabstein, K., Gillis, S, and Cosman,
D. Proc. Natl. Acad. Sci. USA 82: 6250-6254. [0324] Canturk, N. Z.,
Vural, B., Esen, N., Canturk, Z., Oktay, G., Kirkali, G. and
Solakoglu, S. (1999) Endocr Res. 25: 105-116. [0325] Cebon, J. S,
and Lieschke, G. J. (1994) Oncology 51: 177-188. [0326] Cerretti,
D. P. et al. (1988) Molecular Immunology 25: 761. [0327] Chang, C.
N., Rey, B., Bochner, B., Heyneker, H. and Gray, G. (1987) Gene:
189-196. [0328] Chen, T. J., Kuo, C. B., Tsai, K. F., Liu, J. W.,
Chen, D. Y. and Walker, A. M. (1998) Endocrinology 139: 609-616.
[0329] Cook, A. D., Braine, E. L., campbell, I. K., Rich, M. J. and
Hamilton, A. J. (2001) Arthritis Res. 3: 293-298. [0330] Cotes, P.
M. and Bangham, D. R. (1961) Nature 191: 1065-1067 Cox, G. N.,
McDermott, M. J., Merkel, E., Stroh, C. A., Ko, S. C., Squires, C.
H., Gleason, T. M. and Russell, D. (1994) Endocrinology 135:
1913-1920. [0331] Cunningham, B. C. and Wells, J. A. (1989) Science
244: 1081-1085. [0332] Cunningham, B. C., Jhurani, P., Ng, P. and
Wells, J. A. (1989) Science 243: 1330-1336. [0333] Cunningham, B.
C., Ultsch, M., de Vos, A. M., Mulkerrin, M. G., Clauser, K. R. and
Wells, J. A. (1991) Science 254: 821-825. [0334] D'Andrea, A. D.,
Lodish, H. F. and Wong, G. G. (1989) Cell 57: 277-285. [0335]
Davis, S., Aldrich, T. H., Stahl, N., Pan, L., Taga, T., Kishimoto,
T., Ip, N. Y. and Yancopoulus, G. D. (1993) Science 260: 1805-1808.
[0336] DeChiara, T. M., Erlitz, F. and Tarnowski, S. J. (1986)
Methods Enzymology, 119: 403-15. [0337] de la Llosa, P., Chene, N.
and Martal, J. (1985) FEBS Letts. 191: 211-215 Delorme, E.,
Lorenzini, T., Giffin, J., Martin, F., Jacobsen, F., Boone, T.,
Elliot, S. (1992) Biochemistry 31: 9871-9876. [0338] de Sauvage, F.
J., Hass, P. E., Spencer, S. D. et al. (1994) Nature 369: 533-538.
[0339] de Vos, A. M., Ultsch, M. and Kossiakoff, A. A. (1992)
Science 255: 306-312. [0340] Devos, R., Plaetinck, G., Cheroutre,
H., Simons, G., Degrave, W., Tavernier, J., Remaut, E. and Fiers,
W. (1983) Nucleic Acids Research 11: 4307. [0341] Diederichs, K.,
Boone, T. and Karplus, A. (1991) Science 154: 1779-1782. [0342]
Dorssers, L., Burger, H., Bot, F., Delwel, R., Van Kessel, A. H. M.
G., Lowenberg, B. and Wagemaker, G. (1987) 55: 115-124. [0343]
Dube, S., Fisher, J. W., Powell, J. S. (1988) J. Biol. Chem. 263:
17526-17521. [0344] Fish, E. N., Banerjee, K., Levine, H. L. and
Stebbing, N. (1986) Antimicrob. Agents Chemother. 30: 52-56. [0345]
Foster, D. C., Sprecher, C. A., Grant, F. J., Kramer, J. M. et al.
(1994) Proc. Natl. Acad. Sci. USA 91: 13023-13027. [0346] Fukuda,
M. N., Sasaki, H., Fukuda, M. (1989) Blood 73: 84-89. [0347]
Gaudernack, G. and Gjertsen, M. K. (1999) Eur. J. Cancer 35
(Supplement 3): S33-35. [0348] Goeddel, D. V., Heyneker, H. L.,
Hozumi, T. et al., (1979) Nature 281: 544-548. [0349] Goeddel, D.
V., Yelverton, E., Ullrich, A., Heynecker, H. L., Miozzari, G.,
Holmes, W., Seeburg, P. H., Dull, T., Mat, L., Stebbing, N., Crea,
R., Maeda, S., McCandliss, R., Sloma, A., Tabor, J. M., Gross, M.,
Familletti, P. C. and Pestka, S. (1980) Nature 287: 411-416. [0350]
Goldwasser, E. and Gross, M. (1975) Methods Enzymology 37: 109-121.
[0351] Goodson, R. J. and Katre, N. V. (1990) Biotechnology 8:
343-346. [0352] Goodwin, R. G., Lupton, S., Schmierer, A.,
Hjerrild, K. J., Jerzy, R., Clevenger, W., Gillis, S., Cosman, D.
and Namen, A. E. (1989) Proc. Natl. Acad. Sci. USA 86: 302-306.
[0353] Gough, N. M. et al., (1988) Proc. Natl. Acad. Sci. USA 85:
2623-2627. [0354] Gubler, U., Chua, A. O., Schoenhaut, D. S.,
Dwyer, C. M., McComas, W., Motyka, R., Nabavi, N., Wolitzky, A. G.,
Quinn, P. M., Familletti, P. C. and Gately, M. K. (1991) Proc.
Natl. Acad. Sci. USA 88: 4143-4147. [0355] Hershfield, M. S.,
Buckley, R. H., Greenberg, M. L. et al., (1987) N. Engl. J.
Medicine 316: 589-596. [0356] Hill, C. P., Osslund, T. D. and
Eisenberg, D. (1993) Proc. Natl. Acad. Sci. USA 90:5167-5171.
[0357] Hoeller, C., Jansen, B., Heere-Ress, E., Pustelnik, T.,
Mossbacher, U., Schlagbauer-Wadl, H., Wolff, K. and Pehamberger, H.
(2001) J. Invest. Dermatol. 117: 371-374. [0358] Hoffman, R. C.,
Andersen, H., Walker, K., Krakover, J. D., Patel, S., Stamm, M. R.
and Osborn, S. G. (1996) Biochemistry 35: 14849-14861. [0359]
Hsiung, H. M., Mayne, N. G. and Becker, G. W. (1986) Biotechnology
4: 991-995. [0360] Hercus, T. R., Bagley, C. J., Cambareri, B.,
Dottore, M., Woodcock, J. M., Vadas, M. A., Shannon, M. F., and
Lopez, A. F. (1994) Proc. Natl. Acad. Sci. USA 91: 5838-5842.
[0361] Hirano, T., Yasukawa, K., Harada, H., Taga, T., Watanabe,
Y., Matsuda, T., Kashiwamura, S.-I., Nakajima, K., Koyama, K.,
Iwamatsu, A., Tsunasawa, S., Sakiyama, F., Matsui, H., Takahara,
Y., Taniguchi, T. and Kishimoto, T. (1986) Nature 324: 73-76.
[0362] Horisberger, M. A. and Di Marco, S. (1995) Pharmac. Ther.
66: 507-534. [0363] Innis, M. A., Gelfand, D. H., Sninsky, J. J.
and White, T. J. (1990) PCR Protocols: A Guide to Methods and
Applications. Academic Press, San Diego, Calif. [0364] Jacobs, K.,
Shoemaker, C., Rudersdorf, R. et al., (1985) Nature 313: 806-810.
[0365] Jones, T. C. (1999) Eur. J. Cancer 35 (Supplement 3): S8-10.
[0366] Joseph, G., Neustadt, D. H., Hamm, J., Kellihan, M. and
Hadley, T. (1991) American Journal of Hematology 37: 55-56. [0367]
Jyung, R. W., Wu, L., Pierce, G. L. and Mustoe, T. A. (1994)
Surgery 115: 325-334. [0368] Kaczmarski, R. S., Pozniak, A.,
Lakhani, A., Harvey, E. and mufti, G. J. (1993) British Journal of
Haematology (1993) 84: 338-340. [0369] Karpusas, M., Nolte, M.,
Benton, C. B., Meier, W., Lipscomb, W. N. and Goelz, S. (1997)
Proc. Natl. Acad. Sci. USA 94: 11813-11818. [0370] Katre, N. V.
(1990) J. Immunology 144: 209-213. [0371] Katre, N. V., Knauf, M.
J. and Laird, W. J. (1987) Proc. Natl. Acad. Sci. USA 84:
1487-1491. [0372] Kawasaki, E. S. et al., (1985) Science 230: 291.
[0373] Kawashima, I., Ohsumi, J., Mita-Honjo, K., Shimoda-Takano,
Ishikawa, H., Sakakibara, S., Miyadai, K. and Takiguchi, Y. (1991)
FEBS Letts. 283: 199-202. [0374] Kingsley, D. M. (1994) Genes Dev.
8: 133-146. [0375] Komatsu, N., Nakauchi, H., Miwa, A., Ishihara,
T., Eguguchi, M. et al., (1991) Cancer Research 51, 341-348. [0376]
Kruse, N., Tony, H.-P. and Sebald, W. (1992) EMBO J. 11: 3237-3244.
[0377] Lam, A., Fuller, F., Miller, J., Kloss, J., Manthorpe, M.,
Varon, S, and Cordell, B. (1991) Gene 102: 271-276. [0378] Kubota,
N., Orita, T., Hattori, K., Oh-eda, M., Ochi, N. and Yamazaki, T.
(1990) J. Biochem. 107: 486-492. [0379] Kuga, T., Komatsu, Y.,
Yamasaki, M., De4kine, S., Miyaji, H., Nishi, T., Sato, M., Yokoo,
Y., Asano, M., Okabe, M., Morimoto, M. and Itoh, S. (1989) Bioch.
Biophys. Res. Comm. 159: 103-111. [0380] Kunkel, T. A., Roberts, J.
D. and Zakour, R. A. (1987) Methods in Enzymology 154: 367-382.
[0381] Lange, B., Valtieri, M., Santoli, D., Caracciolo, D.,
Mavilio, F., Gemperlein, I., Griffin, C., Emanuel, B., Finan, J.,
Nowell, P. and Rovera, G. (1987) Blood 70: 192-199. [0382] Lee, F.,
Yokota, T., Otsuka, T., Gemmell, L., Larson, N., Luh, J., Arai,
K.-I. and Rennick, D. (1985) Proc. Natl. Acad. Sci. USA 82:
4360-4364. [0383] Lewis, J. A. (1995) Chapter 9: Antiviral activity
of cytokines. pp. 129-141. [0384] Li, C. H. (1982) Mol. Cell.
Biochem. 46: 31-41. [0385] Lin, F.-K. (1996) U.S. Pat. No.
5,547,933. [0386] Lin, F.-K., Suggs, S., Lin, C.-H., et al., Proc.
Natl. Acad. Sci. USA (1985) 82: 7580-7584. [0387] Linsley, P. S.,
Kallestad, J., Ochs, V. and Neubauer, M. (1990) 10: 1882-1890.
[0388] Livnah, O., Stura, E. A., Johnson, D. L. et al., (1996)
Science 273: 464-471. [0389] Lu, H. S., Clogston, C. L., Narhi, L.
O., Merewether, L. A., Pearl, W. R. and Boone, T. C. (1992) J.
Biol. Chem. 267: 8770-8777. [0390] Lydon, N. B., Favre, C., Bore,
S., Neyret, O., Benureau, S., Levine, A. M., Seelig, G. F.,
Nagabhushan, T. L. and Trotta, P. P. (1985) Biochemistry 24:
4131-41. [0391] MacGillivray, M. H., Baptista, J. and Johnson, A.
(1996) J. Clin. Endocrinol. Metab. 81: 1806-1809. [0392] McQualter,
J. L., Darwiche, R., Ewing, C., Onuki, M., Kay, T. W., Hamilton, J.
A., Reid, H. H., and Bernard, C. C. A. (2001) J. Exp. Med. 194:
873-881. [0393] Malik, N., Kallestad, J. C., Gunderson, N. L.,
Austin, S. D., Neubauer, M. G., Ochs, V., Marquardt, H., Zarling,
J. M., Shoyab, M., Wei, C.-M., Linsley, P. S, and Rose, T. M.
(1989) Molecular and Cellular Biology 9: 2847-2853. [0394] Martial,
J., Chene, N. and de la Llosa, P. (1985) FEBS. Letts. 180: 295-299.
[0395] Martial, J. A., Hallewell, R. A., Baxter, J. D. and Goodman,
H. M. (1979) Science 205: 602-606. [0396] Matthews, D. J., Topping,
R. S., Cass, R. T. and Giebel, L. B. (1996) Proc. Natl. Acad. Sci.
USA 93: 9471-9476. [0397] McKay, D. B. (1992) Science 257: 412.
[0398] McKenzie, A. N. J., Culpepper, J. A., Malefyt, R. de W.,
Briere, F., Punnonen, J., Aversa, G., Sato, A., Dang, W., Cocks, B.
G., Menon, S., de Vries, J. E., Banchereau, J., and Zurawski, G.
(1993) Proc. Natl. Acad. Sci. USA 90: 3735-3739. [0399] Meyers, F.
J., Paradise, C., Scudder, S. A., Goodman, G. and Konrad, M. (1991)
Clin. Pharmacol. Ther. 49: 307-313. [0400] Milbum, M. V., Hassell,
A. M., Lambert, M. H., Jordan, S. R., Proudfoot, A. E., Graber, P.
and Wells, T. N. C. (1993) Nature 363: 172-176. [0401] Mills, J.
B., Kostyo, J. L., Reagan, C. R., Wagner, S. A., Moseley, M. H. and
Wilhelm, A. E. (1980) Endocrinology 107: 391-399. [0402] Minty, A.,
Chalon, P., Derocq, J.-M., Dumont, X., Guilemot, J.-C., Kaghad, M.,
Labit, C., Leplatois, P., Liauzun, P., Miloux, B., Minty, C.,
Casellas, P., Loison. G., Lupker, J., Shire, D., Ferrara, P. and
Caput, D. (1993) Nature 362: 248-250. [0403] Moreau, J.-F.,
Donaldson, D. D., Bennett, F., Witek-Giannotti, J., Clark, S. C.
and Wong, G. G. (1988) Nature 336: 690-692. [0404] Mott, H. R. and
Campbell, I. D. (1995) Current Opinion in Structural Biology 5:
114-121. [0405] Martial, J. A., Hallewell, R. A., Baxter, J. D. and
Goodman, H. M. (1979) Science 205: 602-606. [0406] Nagata, S.
(1994) in Cytokines and Their Receptors, N. A. Nicola ed., Oxford
University Press, Oxford, pp. 158-160. [0407] Nagata, S., Tsuchiya,
M., Asano, S., Kziro, Y., Yamazaki, T., Yamamoto, O., Hirata, Y.,
Kubota, N., Oh-eda, M., Nomura, H. and Ono, M. (1986a) Nature 319:
415-418. [0408] Nagata, S., Tsuchiya, M., Asano, S., Yamamoto, O.,
Hirata, Y., Kubota, N., Oh-eda, M., Nomura, H. and Yamazaki, T.
(1986b) EMBO J. 5: 575-581. [0409] O'Reilly, D. R., Miller, L. K.,
Luckow, V. A. (1992) Caculovirus Expression Vectors, W.H. Freeman
Co. publishers, New York. [0410] Otsuka, T., Miyajima, A., Brown,
N., Otsu, K., Abrams, J., Saeland, S., Caux, C., De Waal-Malefyt,
De Vries, J., Meyerson, P., Yokota, K., Gemmell, Rennick, D., Lee,
F., Arai, N., Arai, K.-I. and Yokota, T. (1988) J. Immunology 140:
2288-2295. [0411] Owers-Narhi, L., Arakawa, T., Aoki, K. H.,
Elmore, R., Rohde, M. F., Boone, T., Strickland, T. W. (1991) J.
Biol. Chem. 266: 23022-23026. [0412] Ozes, O. S., Reiter, Z.,
Klein, S., Blatt, L. M. and Taylor, M. W. (1992) J. Interferon
Research 12: 55-59. [0413] Paonessa, G., Graziani, R., de Serio,
A., Savino, R., C.sub.1-apponi, L., Lahm, A., Ssalvati, A. L.,
Toniatti, C. and Ciliberto, G. (1995) EMBO J. 14: 1942-1951. [0414]
Park, L. S., Waldron, P. E., Friend, D., Sassenfeld, H. M., Price,
V., Anderson, D., Cosman, D., Andrews, R. G., Bernstein, I. D. and
Urdal, D. L. (1989) Blood 74: 56-65. [0415] Paul, S. R., Bennett,
F., Calvetti, J. A., Kelleher, K., Wood, C. R., O'Hara, R. M.,
Leary, A. C., Sibley, B., Clark, S. C., William, D. A. and Yang,
Y.-C. (1990) Proc. Natl. Acad. Sci. USA 87: 7512-7516. [0416]
Pestka, S., Langer, J. A., Zoon, K. C. and Samuel, C. E. (1987)
Ann. Rev. Biochem. 56: 727-777. [0417] Pickering, L. A.,
Kronenberg, L. H. and Stewart, W. E., II (1980) Proc. Natl. Acad.
Sci. USA 77: 5938-5942. [0418] Powers, R., Garrett, D. S., March,
C. J., Frieden, E. A., Gronenborn, A. M. and Clore, G. M. (1992)
Science 256:1673-1677. [0419] Radhakrishnan, R., Walter, L. J.,
Hruka, A., Reichert, P., Trotta, P. P., Nagabhushan, T. L. and
Walter, M. R. (1996) Structure 4: 1453-1463. [0420] Read, L. C.,
Tomas, F. M., Howarth, G. S., Martin, A. A., Edson, K. J.,
Gillespie, C. M., Owens, P. C. and Ballard, F. J. (1992) J.
Endocrinology 133: 421-431.
[0421] Redfield, C., Smith L. J., Boyd, J., Lawrence, G. M. P.,
Edwards, R. G., Smith, R. A. G., and Dobson, C. M. (1991)
Biochemistry 30: 11029-11035. [0422] Robinson, R. C., Grey, L. M.,
Stauton, D., Vankelecom, H., Vernallis, A. B., Moreau, J.-F.,
Rucker, R., Bresler, H. S., Heffelfinger, M., Kim, J. A., Martin,
E. W. and Triozzi, P. L. (1999) Journal of Immunotherapy 22: 80-84.
[0423] Stuart, D. I., Heath, J. K. and Jones, E. Y. (1994) Cell 77:
1101-1116. [0424] Sasaki, H., Bothner, B., Dell, A. and Fukuda, M.
(1987) J. Biol. Chem. 262: 12059-12076. [0425] Sasaki, H. Ochi, N.,
Dell, A. and Fukuda, M. (1988) Biochemistry 27: 8616-8626. [0426]
Shaw, G., Veldman, G. and Wooters, J. L. (1992) U.S. Pat. No.
5,166,322. [0427] Shirafuji, N., Asano, S., Matsuda, S., Watari,
K., Takaku, F. and Nagata, S. (1989) Exp Hematol. 17: 116-119.
[0428] Silvennoinen, O. and Ihle, J. N. (1996) Signalling by the
Hematopoietic Cytokine Receptors, R. G. Landes, Company, Austin,
Tex. [0429] Small, E. J., Reese, D. M., Um, B., Whisenant, S.,
Dixon, S. C. and Figg, W. D. (1999) Clin. Cancer Res. 5: 1738-1744.
[0430] Souza, L. M., Boone, T. C., Gabrilove, J., Lai, P. H.,
Zsebo, K. M., Murdock, D. C., Chazin, V. R., Bruszewski, J., Lu,
H., Chen, K. K., Barendt, J., Platzer, E., Moore, M. A. S.,
Mertelsmann, R. and Welte, K. (1986) Science 232: 61-65. [0431]
Spitler, L. E., Grossbard, M. L., Emstoff, M. S., Silver, G.,
Jacobs, M., Hayes, F. A. and Soong, S. J. (2000) 18: 1603-1605.
[0432] Spivak, J. L., Hogans, B. B. (1989) Blood 73: 90-99. [0433]
Takeuchi, M., Takasaki, S., Miyazaki, H., Takashi, D., Hoshi, S.,
Kochibe, N. and Kotaba, A. (1988) J. Biol. Chem. 263: 3657-3663.
[0434] Tanaka, H., Satake-Ishikawa, R., Ishikawa, M., Matsuki, S,
and Asano, K. (1991) Cancer Research 51: 3710-3714. [0435]
Taniguchi, T., Matsui, H., Fujita, T., Takaoka, C., Kashima, N.,
Yoshimoto, R. and Hamuro, J. (1983) Nature 302: 305-310. [0436]
Taniguchi, T., Ohno, S., Fujii-Kuriyama, Y. and Muramatsu, M.
(1980) Gene 10: 11-15. [0437] Tarnowski, S. J., Roy, S. K., Liptak,
R. A., Lee, D. K. and Ning, R. Y. (1986) Methods Enzymology
119:153-165. [0438] Tavernier, J., Tuypens, T., Verhee, A.,
Plaetinck, G., Devos, R., Van Der Heyden, J., Guisez, Y. and
Oefner, C. (1995) Proc. Natl. Acad. Sci. USA 92: 5194-5198. [0439]
Teh, L.-C. and Chapman, G. E. (1988) Biochem. Biophys. Res. Comm.
150: 391-398. [0440] Thatcher, D. R. and Panayotatos, N. (1986)
Methods Enzymology 119: 166-177. [0441] Tomas, F. M., Knowles, S.
E., Owens, P. C., Chandler, C. S., Francis, G. L., Read, L. C. and
Ballard, F. J. (1992) Biochem. J. 282: 91-97. [0442] Tsuchiya, M.,
Asano, S., Kaziro, Y. and Nagata, S. (1986) Proc. Natl. Acad. Sci.
USA 83: 7633-7637. [0443] Tsuda, E., Kawanishi, G., Ueda, M.,
Masuda, S, and Sasaki, R. (1990) Eur. J. Biochem. 188: 405-411.
[0444] Vaughan, m. M., Moore, J., Riches, P. G., Johnston, S. R.,
A'Hem, R. P., Hill, M. E., Eisen, T., Ayliffe, M. J., Thomas, J. M.
and Gore, M. E. (2000) Ann. Oncol. 11: 1183-1189. [0445] Vieira,
P., de Waal-Malefyt, R., Dang, M. N., Johnson, K. E., Kastelein,
R., Fiorentino, D. F., de Vries, J. E., Roncarolo, M.-G., Mosmann,
T. R. and Moore, K. W. (1991) Proc. Natl. Acad. Sci. USA 88:
1172-1176. [0446] Wang, A., Lu, S.-D., and Mark, D. F. (1984)
Science 224: 1431-1433. [0447] Walter, M. R., Cook, W. J., Ealick,
S. E., Nagabhusan, T. L., Trotta, P. T. and Bugg, C. E. (1992) J.
Mol. Biol. 224: 1075-1085. [0448] Warren, T. L. and Weiner, G. J.
(2000) Curr. Opin. Hematology 7: 168-173. [0449] Wen, D., Boissel,
J.-P. R., Tracy, T. E., Gruninger, R. H., Mulcahy, L. S.,
Czelusniak, J., Goodman, M. and Bunn, H. F. (1993) Blood:
1507-1516. [0450] Wen, D., Boissel, J. P., Showers, M., Ruch, B. C.
and Bunn, H. F. (1994) J. Biol. Chem. 269: 22839-22846. [0451]
White, B. A., (1993), Methods in Molecular Biology, volume 15: PCR
Protocols: Current Methods and Applications. Humana Press, Totowa,
N. J. [0452] Wojchowski, D. M., Orkin, S. H., Sytkowshi, A. J.
(1987) Biochim. Biophys. Acta 910: 224-232. [0453] Wolf, S. F.,
Temple, P. A., Kobayashi, M., Young, D., Dicig, M., Lowe, L.,
Dzialo, R., Fitz, L., Ferenz, C., Hewick, R. M., Kelleher, K.,
Herrmann, S. H., Clark, S. C., Azzoni, L., Chan, S. H., Trinchieri,
G. and Perussia, B. (1991) J. Immunology 146: 3074-3081. [0454]
Wong, G. G. et al., (1987) Science 235: 1504. [0455] Wrighton, N.
C., Farrell, F. X., Chang, R. et al., (1996) Science 273: 458-463.
[0456] Yamaguchi, K., Akai, K., Kawanishi, G. Ueda, M., Masuda, S.,
Sasaki, R. (1991). J. Biol. Chem. 266: 20434-20439. [0457] Yang, H.
Y. and Hamilton, J. A. (2001) Arthritis and Rheumatism 44: 111-119.
[0458] Yang, Y.-C., Ciarletta, A. B., Temple, P. A., Chung, M. P.,
Kovacic, S., Witek-Giannotti, J. S., Leary, A. C., Kriz, R.,
Donahue, R. E., Wong, G. G. and Clark, S. C. (1986) Cell 47: 3-10.
[0459] Yang, Y.-C., Ricciadi, S., Ciarletta, A., Calvetti, J.,
Kelleher, K. and Clark, S. C. (1989) Blood 74: 1880-1884. [0460]
Yokota, T., Otsuka, T., Mosmann, T., Banchereau, J., DeFrance, T.,
Blanchard, D., De Vries, J. E., Lee F. and Arai, K.-I. (1986) Proc.
Natl. Acad. Sci. USA 83: 5894-5898. [0461] Yokota, T., Coffman, R.
L., Hagiwara, H., Rennick, D. M., Takebe, Y., Yokota, K., Gemmell,
L., Shrader, B., Yang, G., Meyerson, P., Luh, J., Hoy, P., Pene,
J., Briere, F., Spits, H., Banchereau, J., De Vries, J., Lee, F.,
Arai, N. and Arai, K.-I. (1987) Proc. Natl. Acad. Sci. USA 84:
7388-7392. [0462] Zurawski, S. M., Imler, J. L., and Zurawski, G.
(1990) EMBO J. 9: 3899-3905. [0463] Zurawski, S. M. and Zurawski,
G. (1992) EMBO J. 11: 3905-3910.
* * * * *