U.S. patent application number 11/942503 was filed with the patent office on 2008-03-27 for method of creating a library of bacterial clones with varying levels of gene expression.
Invention is credited to Marguerite A. CERVIN, Philippe SOUCAILLE, Fernando VALLE.
Application Number | 20080076678 11/942503 |
Document ID | / |
Family ID | 39225757 |
Filed Date | 2008-03-27 |
United States Patent
Application |
20080076678 |
Kind Code |
A1 |
SOUCAILLE; Philippe ; et
al. |
March 27, 2008 |
Method of creating a library of bacterial clones with varying
levels of gene expression
Abstract
The present invention relates to a method of creating DNA
libraries that include an artificial promoter library and/or a
modified ribosome binding site library and transforming bacterial
host cells with the library to obtain a population of bacterial
clones having a range of expression levels for a chromosomal gene
of interest.
Inventors: |
SOUCAILLE; Philippe; (Deyme,
FR) ; CERVIN; Marguerite A.; (Palo Alto, CA) ;
VALLE; Fernando; (Palo Alto, CA) |
Correspondence
Address: |
LYNN MARCUS-WYNER;GENENCOR INTERNATIONAL, INC.
925 PAGE MILL ROAD
PALO ALTO
CA
94304-1013
US
|
Family ID: |
39225757 |
Appl. No.: |
11/942503 |
Filed: |
November 19, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10511043 |
Jun 15, 2005 |
|
|
|
11942503 |
Nov 19, 2007 |
|
|
|
Current U.S.
Class: |
506/17 ;
435/6.16; 506/26 |
Current CPC
Class: |
C40B 50/06 20130101;
C12N 15/1086 20130101; C40B 40/08 20130101 |
Class at
Publication: |
506/017 ;
435/006; 506/026 |
International
Class: |
C40B 40/08 20060101
C40B040/08; C12Q 1/68 20060101 C12Q001/68; C40B 50/06 20060101
C40B050/06 |
Claims
1. A method of creating a library of artificial promoters
comprising a) obtaining an insertion DNA cassette, which comprises,
a first recombinase site, a second recombinase site and a selective
marker gene located between the first and the second recombinase
sites; b) obtaining a first oligonucleotide which comprises, i) a
first nucleic acid fragment homologous to an upstream region of a
chromosomal gene of interest, and ii) a second nucleic acid
fragment homologous to a 5' end of the insertion DNA cassette; c)
obtaining a second oligonucleotide which comprises, i) a third
nucleic acid fragment homologous to a 3' end of said insertion DNA
cassette, ii) a precursor promoter comprising a -35 consensus
region (-35 to -30), a linker sequence and a -10 consensus region
(-12 to -7), wherein the linker sequence comprises between 14-20
nucleotides and is flanked by the -35 region and the -10 region,
wherein said precursor promoter has been modified to include at
least one modified nucleotide position of the precursor promoter
and wherein the -35 region and the -10 region each include between
4 to 6 conserved nucleotides of the promoter, and iii) a fourth
nucleic acid fragment homologous to a downstream region of the
transcription start site of the promoter; and d) mixing the first
oligonucleotide and the second oligonucleotide in an amplification
reaction with the insertion DNA cassette to obtain a library of
double stranded amplified products comprising artificial
promoters.
2. The method according to claim 1 further comprising purifying the
amplified products.
3. The method according to claim 1, wherein the amplification step
is a polymerase chain reaction step.
4. The method according to claim 1, wherein the -35 region of the
precursor promoter is selected from the group consisting of TTGACA,
TTGCTA, TTGCTT, TTGATA, TTGACT, TTTACA and TTCAAA.
5. The method according to claim 1, wherein the -35 region of the
precursor promoter comprises a modification to the -30 residue of
the precursor promoter.
6. The method according to claim 1, wherein the -10 region of the
precursor promoter is selected from the group consisting of TAAGAT,
TATAAT, AATAAT, TATACT, GATACT, TACGAT, TATGTT and GACAAT.
7. The method according to claim 1, wherein the -35 region of the
precursor promoter is TTGACA and the -10 region of the precursor
promoter is TATAAT.
8. The method according to claim 1, wherein the 35 region of the
precursor promoter is TTGACA and the -10 region of the precursor is
AATAAT.
9. The method according to claim 1, wherein the linker sequence
comprises between 16 and 18 nucleotides.
10. The method according to claim 1, wherein the precursor promoter
is obtained from a promoter selected from the group consisting of
P.sub.trc (SEQ ID NO 2); P.sub.D/E20 ((SEQ ID NO. 4); P.sub.H207
(SEQ ID NO. 3); P.sub.N25 (SEQ ID NO. 5); P.sub.G25 (SEQ ID NO. 6);
P.sub.J5 (SEQ ID NO. 7); P.sub.A1 (SEQ ID NO. 8); P.sub.A2 (SEQ ID
NO. 9); P.sub.A3 (SEQ ID NO. 10); P.sub.lac (SEQ ID NO. 1);
P.sub.GI (SEQ ID NO. 15); P.sub.lacUV5 (SEQ ID NO. 12); P.sub.CON
(SEQ ID NO. 4); and P.sub.bls (SEQ ID NO. 14).
11. The method according to claim 1, wherein the library of
artificial promoters includes SEQ ID NO. 15, SEQ ID NO. 16 and SEQ
ID NO. 17.
12. The method according to claim 1, wherein the precursor promoter
and the chromosomal gene of interest are heterologous.
13. The method according to claim 1, wherein the precursor promoter
and the chromosomal gene of interest are homologous.
14. The method according to claim 1 further comprising modifing the
ribosome binding site including, d) obtaining a third
oligonucleotide which comprises, i) a fifth nucleic acid fragment
homologous to the 5' end of said chromosomal gene of interest, ii)
a modified ribosome binding site of the gene of interest, said
ribosome binding site includes at least one modified nucleotide,
and iii) a sixth nucleic acid fragment homologous to a downstream
region of the -10 region of the second oligonucleotide; and e)
mixing the PCR products of claim 1 with the third oligonucleotide
and the first oligonucleotide of claim 1 in a PCR reaction to
obtain PCR products comprising artificial promoters with modified
ribosome binding sites.
15. The method according to claim 14, wherein the ribosome binding
site from the precursor promoter is selected from the group
consisting of AGGAAA, (SEQ ID NO. 30), AGAAAA (SEQ ID NO. 31),
AGAAGA (SEQ ID NO. 32), AGGAGA (SEQ ID NO. 33), AAGAAGGAAA (SEQ ID
NO. 34), AAGGAAAA (SEQ ID NO. 35), AAGGAAAG (SEQ ID NO. 36),
AAGGAAAU (SEQ ID NO. 37), AAGGAAAAA (SEQ ID NO. 38), AAGGAAAAG (SEQ
ID NO. 39), AAGGAAAAU (SEQ ID NO. 40), AAGGAAAAAA (SEQ ID NO. 41),
AAGGAAAAAG (SEQ ID NO. 42), AAGGAAAAAU (SEQ ID NO. 43), AAGGAAAAAAA
(SEQ ID NO. 44), AAGGAAAAAAG (SEQ ID NO. 45), AAGGAAAAAAU (SEQ ID
NO. 46), AAGGAAAAAAAA (SEQ ID NO. 47), AAGGAAAAAAAG (SEQ ID NO.
48), AAGGAAAAAAAU (SEQ ID NO. 49), AAGGAAAAAAAAA (SEQ ID NO. 50),
AAGGAAAAAAAAG (SEQ ID NO. 51), AAGGAAAAAAAAU (SEQ ID NO. 52),
AAGGAAAAAAAAAA (SEQ ID NO. 53), AAGGAAAAAAAAAG (SEQ ID NO. 54),
AAGGAGGAAA (SEQ ID NO. 55), and AAGGAAAAAAAAAU (SEQ ID NO. 56).
16. The method according to claim 14 further comprising inserting a
stabilizing mRNA sequence between the modified ribosome binding
site and a transcription initiation site of the third
oligonucleotide.
17. The method of claim 14, further comprising altering the start
codon of the gene of interest in the third oligonucleotide.
18. The method according to claim 1 further comprising, d)
obtaining a third oligonucleotide comprising i) a fifth nucleic
acid fragment homologous to the 5' end of the chromosomal gene of
interest in claim 1, ii) a start codon of the gene of interest,
wherein said start codon is degenerated and includes at least one
modification oligonucleotide and iii) a sixth nucleic acid fragment
homologous to the downstream region of the -10 region of the second
oligonucleotide, and e) mixing the PCR products of claim 1 with the
third oligonucleotide and the first oligonucleotide in a PCR
reaction to obtain PCR products comprising artificial promoters
with modified start codons.
19. The method according to claim 17 further comprising inserting a
stabilizing mRNA sequence between the -10 box of the artificial
promoter and a transcription initiation site of the third
oligonucleotide.
20. The artificial promoter library produced by the method of claim
1.
21. The artificial promoter library produced by the method of claim
2.
22. An artificial promoter library comprising a mixture of double
stranded polynucleotides which include in sequential order: a) a
nucleic acid fragment homologous to an upstream region of a
chromosomal gene of interest, b) a first recombinase site, c) a
nucleic acid sequence encoding an antimicrobial resistance gene, d)
a second recombinase site, e) two consensus regions of a promoter
and a linker sequence, wherein the first consensus region comprises
a -35 region, the second consensus region comprises a -10 region
and the linker sequence comprises at least 14-20 nucleotides and is
flanked by the first consensus region and wherein the -35 region
and the -10 region each include between 4-6 conserved nucleotides
of corresponding consensus regions of the promoter, and f) a
nucleic acid fragment homologous to the downstream region of the +1
transcription start site of the promoter.
23. The artificial promoter library of claim 22, wherein the double
stranded polynucleotides further include a modified ribosome
binding site of the promoter wherein said binding site is located
between the -10 region and the nucleic acid sequence homologous to
the downstream region of the +1 transcription start site.
24. The artificial promoter library of claim 22, wherein the double
stranded polynucleotides further include a modified start codon,
wherein the modified start codon sequence is located between the
-10 region and the nucleic acid sequence homologous to the
downstream region of the +1 transcription start site.
25. The artificial promoter library of claim 22, wherein the double
stranded polynucleotides further include a stabilizing mRNA nucleic
acid sequence, wherein the stabilizing mRNA sequence is located
between the -10 region and the nucleic acid sequence homologous to
the downstream region of the +1 transcription start site.
26. The artificial promoter library of claim 22, wherein the -35
region includes a substitution in one nucleotide position with the
remaining nucleotide positions conserved.
27. The artificial promoter library of claim 26, further including
a substitution in one nucleotide position of the -10 region with
the remaining nucleotide positions conserved.
28. A method of modifying a promoter in selected host cells
comprising a) obtaining a library of PCR products comprising
artificial promoters according to claim 1; b) transforming
bacterial host cells with the PCR library, wherein the PCR products
comprising the artificial promoters are integrated into the
bacterial host cells by homologous recombination; c) growing the
transformed bacteria cells; d) selecting the transformed bacterial
cells comprising the artificial promoters.
29. A method of modifying a promoter in selected host cells
comprising a) obtaining a library of PCR products comprising
artificial promoters according to claim 14; b) transforming
bacterial host cells with the PCR library, wherein the PCR products
comprising the artificial promoters are integrated into the
bacterial host cells by homologous recombination to produce
transformed bacterial cells; c) growing the transformed bacteria
cells; d) selecting the transformed bacterial cells comprising at
least one artificial promoter.
30. A method of modifying a promoter in selected host cells
comprising a) obtaining a library of PCR products comprising
artificial promoters according to claim 18; b) transforming
bacterial host cells with the PCR library, wherein the PCR products
comprising the artificial promoters are integrated into the
bacterial host cells by homologous recombination to produce
transformed bacterial cells; c) growing the transformed bacteria
cells; d) selecting the transformed bacterial cells comprising at
least one artificial promoter.
31. The method according to claim 28, wherein the bacterial host
cell is selected from the group consisting of E. coli, Pantoea sp.
and Bacillus sp.
32. The method according to claim 29, wherein the bacterial host
cell is selected from the group consisting of E. coli, Pantoea sp.
and Bacillus sp.
33. The method according to claim 30, wherein the bacterial host is
selected from the group consisting of E. coli, Pantoea sp. and
Bacillus sp.
34. A method of creating a library of bacterial cells having a
range of expression levels of a chromosomal gene of interest
comprising, a) obtaining a library of PCR products comprising
artificial promoters according to claim 1; b) transforming
bacterial host cells with the PCR products, wherein the PCR
products comprising the artificial promoters are integrated into
bacterial host cells by homologous recombination to produce
transformed bacterial cells; c) growing the transformed bacteria
cells; and d) obtaining a library of transformed bacterial cells
wherein the library exhibits a range of expression levels of a
chromosomal gene of interest.
35. The method according to claim 34, further comprising selecting
transformed bacterial cells from the library.
36. The method of claim 35, wherein the selected transformed
bacterial cells have a low level of expression of the gene of
interest.
37. The method of claim 35, wherein the selected transformed
bacterial cells have a high level of expression of the gene of
interest.
38. The method according to claim 35 further comprising excising
the selective marker gene from the transformed bacterial cells.
39. Transformed bacterial cells selected according to the method of
claim 35.
40. The method according to claim 35, wherein the bacterial host
cell is an E. coli, Bacillus sp. or Pantoea sp. cell.
Description
FIELD OF INVENTION
[0001] The present invention relates to the genetic modification of
bacterial cells. Particularly to a method of creating DNA libraries
that comprise a library of artificial promoters and/or a library of
modified regulatory regions, and the use of the libraries to
replace precursor promoters and regulatory regions in bacterial
host cells resulting in a library of bacterial clones having a
range of expression levels of a gene of interest.
BACKGROUND OF THE INVENTION
[0002] For many years microorganisms have been exploited in
industrial applications for the production of valuable commercial
products, such as industrial enzymes, hormones and antibodies.
Despite the fact that recombinant DNA technology has been used in
an attempt to increase the productivity of these microorganisms,
the use of metabolic genetic engineering to improve strain
performance, particularly in industrial fermentations has been
disappointing.
[0003] A common strategy used to increase microbial strain
performance is to alter gene expression, and a number of means have
been used to achieve this end. One approach includes the cloning of
a heterologous or a homologous gene in a multi-copy plasmid in a
selected host strain. Another approach concerns altering
chromosomal gene expression. This has been accomplished by various
methods some of which include: (1) site-specific mutations,
deletions or insertions at a predetermined region of a chromosome;
(2) reliance on transposons to insert DNA randomly into chromosomes
and (3) altering of native regulatory regions of a gene at its
chromosomal location. The alteration of regulatory regions can be
accomplished for example, by changing promoter strength or by using
regulatable promoters which are influenced by inducer
concentration. Reference is made to Jensen and Hammer, (1998)
Biotechnology and Bioengineering 58:193-195; Jensen and Hammer
(1998) Appl. Environ. Microbio. 64:82-85; and Khlebnikov et al.
(2001) Microbiol. 147:3241. Other techniques used to replace
regulatory regions of chromosomal gene have been disclosed in
Abdel-Hamid et al. (2001) Microbiol. 147:1483-1498 and Repoila and
Gottesman (2001) J. Bacteriol. 183:4012-4023.
[0004] With respect to optimizing metabolic pathway engineering in
a selected host, the above-mentioned approaches have had limited
success and each approach has certain disadvantages. Research has
shown the expression level of a genetically modified gene on a
plasmid is not necessarily correlated with the level of expression
of the same modified gene located in the chromosome (See Khlebnikov
et al. (2001) Microbiol. 147:3241 and McCraken and Timms (1999) J.
Bacteriol. 18:6569).
[0005] Moreover, the effect of increasing expression of one gene in
a metabolic pathway may only have a marginal effect on the flux
through that metabolic pathway. This may be true even if the gene
being manipulated codes for an enzyme in a rate-limiting step
because control of a metabolic pathway may be distributed over a
number of enzymes. Therefore, while a gene has been engineered to
achieve a high level of expression, for example a 10 to 100 fold
increase in expression, the overall performance of the engineered
microorganism in a bioreactor may decrease. The decrease could be
due to the balance of other factors involved in the metabolic
pathway or the depletion of other substances necessary for optimum
cell growth.
[0006] The above problem is addressed in part by Jensen and Hammer
(WO 98/07846). The disclosure of WO98/07846 describes the
construction of a set of constitutive promoters that provide
different levels of gene expression. Specifically, artificial
promoter libraries are constructed comprising variants of a
regulatory region that includes a -35 consensus box, a -10
consensus box and a spacer (linker) region that lies between these
consensus regions. However, one of the drawbacks of the method
described in WO 98/07846 is the extensive screening (in terms of
time and numbers of steps), which would be required to create a
library of clones with different levels of gene expression. It is
also disclosed in the reference that the modulation of promoter
strength, by a few base-pair changes in the consensus sequences or
by changes in the linker sequence, would result in a large impact
in promoter strength, and therefore, it would not be feasible to
achieve small steps on promoter strength modulation.
[0007] Therefore, a need still exists in the area of metabolic
pathway engineering to develop a quick and efficient means of
determining the optimum expression of a gene of interest in a
metabolic pathway which in turn results in an optimization of
strain performance for a desired product. The present method
satisfies this need by providing a method to characterize small
changes in gene expression level and hence allowing for the
selection of a cell providing an optimum level of expression.
SUMMARY OF THE INVENTION
[0008] In one aspect the invention relates to a method of creating
a library of artificial promoters comprising a) obtaining an
insertion DNA cassette, which comprises, a first recombinase site,
a second recombinase site and a selective marker gene located
between the first and the second recombinase sites; b) obtaining a
first oligonucleotide which comprises, i) a first nucleic acid
fragment homologous to an upstream region of a chromosomal gene of
interest, and ii) a second nucleic acid fragment homologous to a 5'
end of the insertion DNA cassette; c) obtaining a second
oligonucleotide which comprises, i) a third nucleic acid fragment
homologous to a 3' end of said insertion DNA cassette, ii) a
precursor promoter comprising a -35 consensus region (-35 to -30),
a linker sequence and a -10 consensus region (-12 to -7), wherein
the linker sequence comprises between 14-20 nucleotides and is
flanked by the -35 region and the -10 region, wherein said
precursor promoter has been modified to include at least one
modified nucleotide position of the precursor promoter and wherein
the -35 region and the -10 region each include between 4 to 6
conserved nucleotides of the promoter, and iii) a fourth nucleic
acid fragment homologous to a downstream region of the
transcription start site of the promoter; and d) mixing the first
oligonucleotide and the second oligonucleotide in an amplification
reaction with the insertion DNA cassette to obtain a library of
double stranded amplified products comprising artificial promoters.
In one embodiment, the method further comprises purifying the
amplified products. In another embodiment, the amplification step
is by PCR. In another embodiment, the precursor promoter is
selected from the group consisting of P.sub.trc (SEQ ID NO 2);
P.sub.D/E20 ((SEQ ID NO. 4); P.sub.H207 (SEQ ID NO. 3); P.sub.N25
(SEQ ID NO. 5); P.sub.G25 (SEQ ID NO. 6); P.sub.J5 (SEQ ID NO. 7);
P.sub.A1 (SEQ ID NO. 8); P.sub.A2 (SEQ ID NO. 9); P.sub.A3 (SEQ ID
NO. 10); P.sub.lac (SEQ ID NO. 1); P.sub.lacUV5 (SEQ ID NO. 12);
P.sub.CON (SEQ ID NO. 4); P.sub.GI (SEQ ID NO. 15) and P.sub.bls
(SEQ ID NO. 14). In a further embodiment the artificial promoter
library includes the promoters designated by SEQ ID NO. 15, SEQ ID
NO. 16 and SEQ ID NO. 17. In a further embodiment the invention
includes the artificial promoter library produced according to the
above method.
[0009] In a second aspect, the invention relates to a method of
creating a library of ribosome binding sites (RBS) comprising a)
obtaining an insertion DNA cassette, which comprises, a first
recombinase site, a second recombinase site and a selective marker
gene located between the first and the second recombinase sites; b)
obtaining a first oligonucleotide which comprises, i) a first
nucleic acid fragment homologous to an upstream region of a
chromosomal gene of interest, and ii) a second nucleic acid
fragment homologous to a 5' end of the insertion DNA cassette; c)
obtaining a second oligonucleotide which comprises, i) a third
nucleic acid fragment homologous to a 3' end of said insertion DNA
cassette, ii) a precursor promoter comprising a -35 consensus
region (-35 to -30), a linker sequence and a -10 consensus region
(-12 to -7), wherein the linker sequence comprises between 14-20
nucleotides and is flanked by the -35 region and the -10 region,
wherein said precursor promoter has been modified to include at
least one modified nucleotide position of the precursor promoter
and wherein the -35 region and the -10 region each include between
4 to 6 conserved nucleotides of the promoter, and iii) a fourth
nucleic acid fragment homologous to a downstream region of the
transcription start site of the promoter; and d) mixing the first
oligonucleotide and the second oligonucleotide in an amplification
reaction with the insertion DNA cassette to obtain a library of
double stranded amplified products comprising artificial promoters
and e) obtaining a third oligonucleotide which comprises, i) a
fifth nucleic acid fragment homologous to the 5' end of said
chromosomal gene of interest, ii) a modified ribosome binding site
of the gene of interest, said ribosome binding site including at
least one modified nucleotide, and iii) a sixth nucleic acid
fragment homologous to a downstream region of the -10 region of the
second oligonucleotide; and e) mixing the PCR products of step d)
with the third oligonucleotide of step e) and the first
oligonucleotide og step b) in a PCR reaction to obtain PCR products
comprising artificial promoters with modified ribosome binding
sites. In an embodiment the ribosome binding site is selected from
the group consisting of AGGAAA, (SEQ ID NO. 30), AGAAAA (SEQ ID NO.
31), AGAAGA (SEQ ID NO. 32), AGGAGA (SEQ ID NO. 33), AAGAAGGAAA
(SEQ ID NO. 34), AAGGAAAA (SEQ ID NO. 35), AAGGAAAG (SEQ ID NO.
36), AAGGAAAU (SEQ ID NO. 37), AAGGAAAAA (SEQ ID NO. 38), AAGGAAAAG
(SEQ ID NO. 39), AAGGAAAAU (SEQ ID NO. 40), AAGGAAAAAA (SEQ ID NO.
41), AAGGAAAAAG (SEQ ID NO. 42), AAGGAAAAAU (SEQ ID NO. 43),
AAGGAAAAAAA (SEQ ID NO. 44), AAGGAAAAAAG (SEQ ID NO. 45),
AAGGAAAAAAU (SEQ ID NO. 46), AAGGAAAAAAAA (SEQ ID NO. 47),
AAGGAAAAAAAG (SEQ ID NO. 48), AAGGAAAAAAAU (SEQ ID NO. 49),
AAGGAAAAAAAAA (SEQ ID NO. 50), AAGGAAAAAAAAG (SEQ ID NO. 51),
AAGGAAAAAAAAU (SEQ ID NO. 52), AAGGAAAAAAAAAA (SEQ ID NO. 53),
AAGGAAAAAAAAAG (SEQ ID NO. 54), AAGGAGGAAA (SEQ ID NO. 55), and
AAGGAAAAAAAAAU (SEQ ID NO. 56). In a further embodiment the
invention includes the artificial promoter library produced
according to the above method.
[0010] In a third aspect, the invention relates to an artificial
promoter library comprising a mixture of double stranded
polynucleotides which include in sequential order: a) a nucleic
acid fragment homologous to an upstream region of a chromosomal
gene of interest, b) a first recombinase site, c) a nucleic acid
sequence encoding an antimicrobial resistance gene, d) a second
recombinase site, e) two consensus regions of a promoter and a
linker sequence, wherein the first consensus region comprises a -35
region, the second consensus region comprises a -10 region and the
linker sequence comprises at least 14-20 nucleotides and is flanked
by the first consensus region and wherein the second consensus
region and the -35 region and the -10 region each include between
4-6 conserved nucleotides of corresponding consensus regions of the
promoter, and f) a nucleic acid fragment homologous to the
downstream region of the +1 transcription start site of the
promoter. In one embodiment the promoter library of the double
stranded polynucleotides will also include a modified start codon,
wherein the modified start codon sequence is located between the
-10 region and the nucleic acid sequence homologous to the
downstream region of the +1 transcription start site. In another
embodiment the promoter library of double stranded polynucleotides
further include a stabilizing mRNA nucleic acid sequence, wherein
the stabilizing mRNA sequence is located between the -10 region and
the nucleic acid sequence homologous to the downstream region of
the +1 transcription start site.
[0011] In a fourth aspect, the invention relates to a method of
modifying a promoter in selected host cells comprising obtaining a
library of PCR products comprising artificial promoters, RBS, start
codons or stablizing mRNA sequences or combinations thereof
according to the invention; b) transforming bacterial host cells
with the PCR library, wherein the PCR products comprising the
artificial promoters are integrated into the bacterial host cells
by homologous recombination; c) growing the transformed bacteria
cells; d) selecting the transformed bacterial cells comprising the
artificial promoters. In certain embodiments the bacterial host
cell is selected from the group consisting of E. coli, Pantoea sp.
and Bacillus sp.
[0012] In a fifth aspect, the invention relates to a method of
creating a library of bacterial cells having a range of expression
levels of a chromosomal gene of interest comprising, a) obtaining a
library of PCR products comprising artificial promoters according
to the invention; b) transforming bacterial host cells with the PCR
products, wherein the PCR products comprising the artificial
promoters are integrated into bacterial host cells by homologous
recombination to produce transformed bacterial cells; c) growing
the transformed bacteria cells; and d) obtaining a library of
transformed bacterial cells wherein the library exhibits a range of
expression levels of a chromosomal gene of interest. In one
embodiment the method further comprises selecting transformed
bacterial cells from the library. In a second embodiment the
selected transformed cells will have a low level of expression of
the gene of interest, and in another embodiment the selected
transformed bacterial cells have a high level of expression of the
gene of interest.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1 illustrates a schematic representation of a method of
creating an artificial promoter library and the double stranded PCR
products obtained according to the method of the invention. Two
oligonucleotides which are represented by numbers (1) and (2) and
an insertion DNA cassette on a plasmid (3) are mixed together in a
PCR reaction to form a mixture of double stranded PCR products.
Oligonucleotide (1) includes nucleic acid sequences homologous to
an upstream region of a chromosomal gene of interest (H1) and a
primer site (PS1). The PS1 is homologous to the first end (5') of
an insertion DNA cassette (3). Oligonucleotide (2) is degenerated
and includes a primer site (PS2) and artificial promoter sequences
(H2). The PS2 is homologous to the second end (3') of the insertion
DNA cassette (3). The artificial promoter sequences (H2) comprise
different modified -35 consensus regions, different modified linker
regions, and different modified -10 consensus regions or
combinations thereof. The insertion DNA construct (3) includes a
selective marker, which is preferably an antibiotic resistant gene,
flanked by two recombinase sites (FRT).
[0014] FIG. 2 is a schematic representation of the method of
creating a DNA library comprising artificial promoters, modified
ribosome binding sites, mRNA stabilizing sequences, and/or modified
start codons according to the invention. In this figure, the
mixture of double stranded PCR products of FIG. 1 are mixed in a
further PCR reaction with the oligonucleotide (1) and a third
oligonucleotide (4) comprising a nucleic acid fragment homologous
to the 5' end of the gene of interest (which is the same gene of
interest in FIG. 1) a start codon, which may be a modified start
codon; a modified ribosome binding site of the precursor promoter;
a stabilizing mRNA segment and a nucleic acid fragment homologous
to a downstream region of the start codon of the gene of interest
to obtain a new mixture of double stranded PCR products. X
indicates that the start codon may be modified.
[0015] FIG. 3 is a schematic representation of the replacement of a
chromosomal regulatory sequence with the PCR products according to
the invention.
[0016] FIG. 4 illustrates the sequences of various
well-characterized promoters and includes approximately 50 base
pair (bp) upstream of the transcription start site (+1), including
the -35 consensus boxes, the linker sequences and the -10 consensus
boxes. The promoters are aligned with respect to the first T of the
-35 consensus box and the last T of the -10 consensus box. The
conserved regions are indicated in bold. P.sub.D/E20 is represented
by SEQ ID NO. 3; P.sub.H207 is represented by SEQ ID NO. 4;
P.sub.N25 is represented by SEQ ID NO. 5; P.sub.G25 is represented
by SEQ ID NO. 6; P.sub.J5 is represented by SEQ ID NO. 7; P.sub.A1
is represented by SEQ ID NO. 8; P.sub.A2 is represented by SEQ ID
NO. 9; P.sub.A3 is represented by SEQ ID NO. 10; P.sub.L is
represented by SEQ ID NO. 11; P.sub.lac is represented by SEQ ID
NO. 1; P.sub.lacUV5 is represented by SEQ ID NO. 12; P.sub.tacl is
represented by SEQ ID NO. 2; P.sub.con is represented by SEQ ID NO.
13; and P.sub.bla is represented by SEQ ID NO. 14.
[0017] FIG. 5 compares the chromosomal organization of the lactose
operon of the wild-type strain (A) and chromosomal organization of
a host strain transformed with a promoter (B) according to the
invention.
[0018] FIG. 6 illustrates a library of promoters comprising three
artificial promoters used to replace the lactose operon promoter
Plac (SEQ ID NO. 18) and the lacI regulator. The library of
promoters comprises three artificial glucose isomerase promoters:
1.6 GI lacZ (SEQ ID NO. 19) which includes the 1.6GI promoter (SEQ
ID NO. 15); 1.5 GI lacZ (SEQ ID NO. 20) which includes the 1.5GI
promoter (SEQ ID NO. 16); and 1.2 GI lacZ (SEQ ID NO. 21) which
includes the 1.2GI promoter (SEQ ID NO. 17).
[0019] FIG. 7 illustrates the expression of the lacZ gene measured
as specific activity of .beta.-galactosidase in a library of E.
coli cells transformed with the library comprising 1.6 GI lacZ (SEQ
ID NO. 19), 1.5 GI lacZ (SEQ ID NO. 20) and 1.2 GI lacZ (SEQ ID NO.
21).
[0020] FIG. 8 illustrates the expression of the lacZ gene with the
1.6GI promoter (SEQ ID NO. 19), wherein the ribosome binding site
has been altered. Transformants are designated TABLE-US-00001 A =
CAAGGAGGAA ACAGCTATG, (SEQ ID NO. 22) B = CAAGAAGGAA ACAGCTATG,
(SEQ ID NO. 23) C = CACACAGGAA ACAGCTATG. (SEQ ID NO. 24) D =
CTCACAGGAG ACAGCTATG, (SEQ ID NO. 25) E = CTCACAGGAA ACAGCTATG,
(SEQ ID NO. 26) F = CACACAGAAA ACAGCTATG, (SEQ ID NO. 27) G =
CTCACAGAGA ACAGCTATG, (SEQ ID NO. 28) and H = CTCACAGAAA ACAGCTATG.
(SEQ ID NO. 29)
[0021] FIG. 9 illustrates the expression of the lacZ gene with the
1.6GI promoter (SEQ ID NO. 19), wherein the ribosome binding site
(AGGAAA) has been altered and a stabilizing mRNA sequence has been
inserted.
DETAILED DESCRIPTION OF THE INVENTION
[0022] The present invention relates to a method of creating a
library of bacterial clones from amplified DNA libraries,
particularly PCR generated DNA libraries, wherein the bacterial
clones express a chromosomal gene of interest at different levels.
The generated DNA libraries include any one of the following
libraries, artificial promoters, ribosome binding sites (RBS),
start codons and mRNA stabilizing sequences. An advantage of the
method disclosed herein is that only one in vivo step is required
to create the library of bacterial clones.
[0023] One aspect of the present invention relates to the
discovery, that gene expression level is changed by altering one or
two nucleotides in the -35 consensus region (-35 box), the -10
consensus region (-10 box), the linker region, the RBS, and/or the
start codon and further that the alteration allows a quick
identification of a range of gene expression that would produce a
significant phenotypic change. A second aspect, the invention
relates to the use of precursor promoter sequences, RBSs, start
codons and/or mRNA stabilizing sequences which are contained within
one or two degenerated oligonucleotides so that the DNA library may
be generated by one or two amplification steps.
DEFINITIONS
[0024] Within this application, unless otherwise stated,
illustration of the techniques used may be found in any of several
well-known references such as: Sambrook, J., et al., MOLECULAR
CLONING: A LABORATORY MANUAL, Cold Spring Harbor Laboratory Press
(1989); Goeddel, D., ed., GENE EXPRESSION TECHNOLOGY, METHODS IN
ENZYMOLOGY, 185, Academic Press, San Diego, Calif. (1991); "GUIDE
TO PROTEIN PURIFICATION" in Deutshcer, M. P., ed., Methods in
Enzymology, Academic Press, San Diego, Calif. (1989); and, Innis,
et. al., PCR PROTOCOLS: A GUIDE TO METHODS AND APPLICATIONS,
Academic Press, San Diego, Calif. (1990). Unless defined otherwise,
all technical and scientific terms used herein have the same
meaning as commonly understood by one or ordinary skill in the art
to which this invention pertains. Both Singleton et al., DICTIONARY
OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2D. Ed., John Wiley and
Sons, New York (1994) and Hale and Martin, THE HARPER COLLINS
DICTIONARY OF BIOLOGY, Harper Perennial, New York (1991) provide
one of skill in the art with general dictionaries of many of the
terms used in this invention.
[0025] Although any methods and materials similar or equivalent to
those described herein can be used in the practice or testing of
the present invention, the preferred methods and materials are
described. Numeric ranges are inclusive of the numbers defining the
range.
[0026] Unless otherwise indicated, nucleic acids are written left
to right in 5' to 3' orientation; amino acid sequences are written
left to right in amino to carboxy orientation, respectively. The
headings provided herein are not limitations of the various aspects
or embodiments of the invention which can be had by reference to
the specification as a whole. Accordingly, the terms defined
immediately below are more fully defined by reference to the
specification as a whole. The references, issued patents and
pending patent applications cited herein are incorporated by
reference into this application.
[0027] For the purpose of this invention "a DNA library" includes
any one or a combination of the following, artificial promoter
libraries, modified ribosome binding site (RBS) libraries, modified
start codon libraries, and stabilizing mRNA libraries. While a
library may include 10.sup.3 or more members, in preferred
embodiments a library will include at least 2, at least 3, at least
4, at least 6, at least 8, at least 16 or at least 64 members. A
DNA library also referres to double stranded DNA molecules.
[0028] For the purposes of this application, a "promoter" or
"promoter region" is a nucleic acid sequence that is recognized and
bound by a DNA dependent RNA polymerase during initiation of
transcription. The promoter, together with other transcriptional
and translational regulatory nucleic acid sequences (also termed
"control sequences") is necessary to express a given gene or group
of genes (an operon). In general, the transcriptional and
translational regulatory sequences include, but are not limited to,
promoter sequences, ribosomal binding sites, transcriptional start
and stop sequences, translational start and stop sequences, and
enhancer or activator sequences. The "transcription start site"
means the first nucleotide to be transcribed and is designated +1.
Nucleotides downstream of the start site are numbered +2, +3, +4
etc., and nucleotides in the opposite (upstream) direction are
numbered -1, -2, -3 etc. A promoter may be a regulatable promoter,
such as Ptrc, which is induced by IPTG or a constitutive
promoter.
[0029] In the context of the present invention, a promoter includes
two consensus regions. A consensus region is a distinct group of
conserved short sequences recognized by RNA polymerases differing
in their sigma factors. One consensus region is centered about 10
base pairs (bp) upstream from the start site of transcription
initiation and is referred to as the -10 consensus region (-10 box
or Pribnow box). The other consensus region is centered about 35 bp
upstream of the transcriptional start site and is referred to as
the -35 consensus region (-35 box). A linker sequence extends
between each consensus region and is comprised of about 14 to 20
bp.
[0030] A precursor promoter according to the invention may be a
native (endogenous) promoter or an exogenous promoter. Further a
precursor promoter may be a genetically engineered promoter that is
either heterologous or homologous to a gene of interest. Generally
precursor promoters will be in the range of 250 to 25 base pairs
(bp); 150 to 25 bp; 100 to 25 bp; 75 to 25 bp and preferably 50 to
30 bp from the transcription start site (+1).
[0031] An "artificial promoter" according to the invention is a
precursor promoter that has been modified by altering a nucleotide
in at least one position corresponding to a position in the -35
box, the -10 box and/or the linker sequence. In a preferred
embodiment, an artificial promoter will comprise 30 to 50 bp
upstream of the transcription start site (+1) and will be derived
from a precursor promoter having 50 to 30 bp.
[0032] A "library of promoters" refers to a population of promoters
which includes artificial promoters, having at least two members.
In one embodiment a library will be derived from the same precursor
promoter.
[0033] A "ribosome binding site" (RBS) is a short nucleotide
sequence usually comprising about 4-16 base pairs and functions by
positioning the RBS on the mRNA molecule for translation of an
encoded protein. A "modified ribosome binding" site is a ribosome
binding site wherein one or more base pairs have been altered. A
preferred modified RBS is derived from the same regulatory region
as a precursor promoter when both the precursor promoter and RBS
are modified and used in the same library. A library of modified
ribosome binding sites includes at least two modified ribosome
binding sites derived from the same precursor.
[0034] A "stabilizing mRNA" is a nucleic acid sequence insert used
to influence gene expression. These inserts are generally located
between the transcription and translational start sites of a gene
or nucleic acid sequence.
[0035] A "library of bacterial clones" refers to a population of
bacterial cells grown under essentially the same growth conditions
and which are identical in most of their genome but include a DNA
library as defined herein which may comprise for example a library
of artificial promoters. A library of bacterial clones will have
different levels of expression of the same gene of interest.
[0036] As used herein, the term "nucleic acid" includes RNA, DNA
and cDNA molecules. It will be understood that, as a result of the
degeneracy of the genetic code, a multitude of nucleotide sequences
encoding a given protein may be produced. The term nucleic acid is
used interchangeably with the term "polynucleotide". An
"oligonucleotide" is a short chain nucleic acid molecule. A primer
is an oligonucleotide, whether occurring naturally as in a purified
restriction digest or produced synthetically, which is capable of
acting as a point of initiation of synthesis when placed under
conditions in which synthesis of a primer extension product which
is complementary to a nucleic acid strand is induced, (i.e., in the
presence of nucleotides and an inducing agent such as DNA
polymerase and at a suitable temperature and pH). The primer is
preferably single stranded for maximum efficiency in amplification,
but may alternatively be double stranded. If double stranded, the
primer is first treated to separate its strands before being used
to prepare extension products. Preferably, the primer is an
oligodeoxyribonucleotide. The primer must be sufficiently long to
prime the synthesis of extension products in the presence of the
inducing agent. The exact lengths of the primers will depend on
many factors, including temperature, source of primer and the use
of the method.
[0037] As used herein, the term "gene" means the segment of DNA
involved in producing a polypeptide chain, that may or may not
include regions preceding and following the coding region (e.g. 5'
untranslated (5' UTR) or "leader" sequences and 3' UTR or "trailer"
sequences), as well as intervening sequences (introns) between
individual coding segments (exons).
[0038] As used herein the term "polypeptide" refers to a compound
made up of amino acid residues linked by peptide bonds. The terms
protein, peptide and polypeptide are used interchangeably
herein.
[0039] The term "modification" includes a deletion, insertion,
substitution or interruption of at least one nucleotide or amino
acid in a sequence.
[0040] As used herein, a "deletion" is defined as a change in
either a nucleotide or amino acid sequence in which one or more
nucleotides or amino acid residues, respectively, are absent.
[0041] As used herein, an "insertion" or "addition" is that change
in a nucleotide or amino acid sequence which has resulted in the
addition of one or more nucleotides or amino acid residues,
respectively, as compared to a parent sequence.
[0042] As used herein, a "substitution" results from the
replacement of one or more nucleotides or amino acids by different
nucleotides or amino acids, respectively.
[0043] In one embodiment a modified DNA sequence is generated with
site saturation mutagenesis in at least one nucleotide. In another
embodiment, site saturation mutagenesis is performed for two or
more nucleotides. In a further embodiment, a modified or mutant DNA
sequence has more than 40%, more than 45%, more than 50%, more than
55%, more than 60%, more than 65%, more than 70%, more than 75%,
more than 80%, more than 85%, more than 90%, more than 95%, more
than 96%, more than 97%, or more than 98% homology with a wild-type
sequence from which it was modified from. In alternative
embodiments, mutant DNA is generated in vivo using any known
mutagenic procedure such as, for example, radiation,
nitrosoguanidine and the like.
[0044] A nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, a promoter is operably linked to a coding sequence if it
affects the transcription of the sequence; or a ribosome binding
site is operably linked to a coding sequence if it is positioned so
as to facilitate translation. Linking of nucleic acid sequences may
be accomplished by ligation at convenient restriction sites. If
such sites do not exist, synthetic oligonucleotide adaptors or
linkers may be used in accordance with conventional practice.
[0045] As used herein a "DNA construct" refers to a nucleic acid
sequence or fragment that is used to introduce sequences into a
host cell or organism. The DNA may be generated in vitro by PCR or
any other suitable techniques. In some embodiments a DNA construct
according to the invention comprises homologous upstream (5')
and/or homologous downstream (3') sequences to a precursor
promoter, a gene of interest or to another DNA segment. In yet
another embodiment a DNA construct may be inserted into a vector.
The DNA constructs may include homologous or heterologous sequences
to a host cell gene and further may include a combination of
heterologous sequences and homologous sequences. In some
embodiments, a DNA construct will include a selective marker gene.
In other embodiments, a DNA construct will include an artificial
promoter and in other embodiments a DNA construct will include a
modified RBS sequence, a modified translational start codon and
stabilizing mRNA sequences. These DNA constructs are sometimes
referred to herein collectively or individually as "regulatory DNA
constructs".
[0046] As used herein, the term "vector" refers to a nucleic acid
construct designed for transfer between different host cells. A
vector may be a plasmid, a bacteriophage, a cloning vector, a
shuttle vector or an expression vector. An "expression vector"
refers to a vector that has the ability to incorporate and express
heterologous DNA fragments in a foreign cell. Many prokaryotic and
eukaryotic expression vectors are commercially available. Selection
of appropriate expression vectors is within the knowledge of those
having skill in the art. Vectors used in the process of the may be
any vector suitable for isolation and characterization of a
promoter.
[0047] As used herein, a "flanking sequence" refers to any sequence
that is either upstream or downstream of the sequence being
discussed (e.g., for genes A B C, gene B is flanked by the A and C
gene sequences). In some embodiments, a flanking sequence is
present on only a single side (either 3' or 5') of a DNA fragment,
but in preferred embodiments, it is on each side of the sequence
being flanked.
[0048] As used herein the terms, "heterologous nucleic acid
sequence" or heterologous DNA construct" refers to a portion of a
genetic sequence that is not native to the cell in which it is
expressed. "Heterologous," with respect to a control sequence
refers to a control sequence (i.e., promoter) that does not
function in nature to regulate the same gene the expression of
which it is currently regulating. Generally, heterologous nucleic
acid sequences are not endogenous to the cell or part of the genome
in which they are present, and have been added to the cell, by
infection, transfection, microinjection, electroporation, or the
like. In some embodiments, "heterologous nucleic acid constructs"
contain a control sequence/DNA coding sequence combination that is
the same as, or different from a control sequence/DNA coding
sequence combination found in the native cell.
[0049] As used herein, "homology" refers to sequence similarity or
identity, with identity being preferred. This homology is
determined using standard techniques known in the art (See e.g.,
Smith and Waterman, Adv. Appl. Math., 2:482 (1981); Needleman and
Wunsch, J. Mol. Biol., 48:443 (1970); Pearson and Lipman, Proc.
Natl. Acad. Sci. USA 85:2444 (1988); programs such as GAP, BESTFIT,
FASTA, and TFASTA in the Wisconsin Genetics Software Package
(Genetics Computer Group, Madison, Wis.); and Devereux et al.,
Nucl. Acid Res., 12:387-395 (1984)).
[0050] The term "target site" is intended to mean a predetermined
genomic location within a bacterial chromosome where integration of
a DNA construct or a DNA library is to occur.
[0051] As used herein, the term "chromosomal integration" refers to
the process whereby an exogenous nucleic acid sequence is
introduced into the chromosome of a host cell (e.g., Bacillus). The
homologous sequences of the exogenous nucleic acid sequence align
with homologous regions of the chromosome. Subsequently, the
sequence between the homologous regions of the chromosomal sequence
is replaced by the incoming exogenous sequence in a double
crossover (i.e., homologous recombination).
[0052] As used herein, the term "introduced" used in the context of
inserting a nucleic acid sequence into a cell, means
"transfection," "transformation," or "transduction," and includes
reference to the incorporation of a nucleic acid sequence into a
eukaryotic or prokaryotic cell where the nucleic acid sequence may
be incorporated into the genome of the cell (e.g., chromosome,
plasmid, plastid, or mitochondrial DNA), converted into an
autonomous replicon, or transiently expressed (for example,
transfected mRNA).
[0053] As used herein, the terms "transformed," "stably
transformed," and "transgenic" used in reference to a cell means
the cell has a non-native (heterologous) nucleic acid sequence
integrated into its genome or as an episomal plasmid that is
maintained through two or more generations.
[0054] As used herein "an insertion DNA construct" or "insertion
DNA cassette" is a DNA construct that includes a selectable marker
gene which is flanked on both sides by a recombinase recognition
site. A "recombinase recognition site" is a novel recombination
site that facilitates directional insertion of nucleotide sequences
into corresponding recombination sites at a predetermined genomic
location (a target site) within the bacterial chromosome where the
integration of a DNA fragment is to occur.
[0055] As used herein, the term "selectable marker" refers to a
gene capable of expression in host cell which allows for ease of
selection of those hosts containing an introduced nucleic acid or
vector. Examples of such selectable markers include but are not
limited to antimicrobials, (e.g., kanamycin, erythromycin,
actinomycin, chloramphenicol and tetracycline). Thus, the term
"selectable marker" refers to genes that provide an indication that
a host cell has taken up an exogenous polynucleotide sequence or
some other reaction has occurred. Typically, selectable markers are
genes that confer antimicrobial resistance or a metabolic advantage
on the host cell to allow cells containing the exogenous DNA to be
distinguished from cells that have not received any exogenous
sequence during the transformation.
[0056] As used herein, the terms "amplification" and "gene
amplification" refer to a process by which specific DNA sequences
are disproportionately replicated such that the amplified nucleic
acid sequence becomes present in a higher copy number than was
initially present in the genome. The term also refers to the
introduction into a single cell of an amplifiable marker in
conjunction with other gene sequences (i.e., comprising one or more
non-selectable genes such as those contained within an expression
vector) and the application of appropriate selective pressure such
that the cell amplifies both the amplifiable marker and the other,
non-selectable gene sequences. The amplifiable marker may be
physically linked to the other gene sequences or alternatively two
separate pieces of DNA, one containing the amplifiable marker and
the other containing the non-selectable marker, may be introduced
into the same cell.
[0057] As used herein, the term "polymerase chain reaction" ("PCR")
refers to the methods of U.S. Pat. Nos. 4,683,195; 4,683,202, and
4,965,188, hereby incorporated by reference, which include methods
for increasing the concentration of a segment of a polynucleotide
or target sequence in a mixture of genomic DNA without cloning or
purification. This process for amplifying the target sequence
consists of introducing a large excess of two oligonucleotide
primers to the DNA mixture containing the desired target sequence,
followed by a precise sequence of thermal cycling in the presence
of a DNA polymerase. The two primers are complementary to their
respective strands of the double stranded target sequence. To
effect amplification, the mixture is denatured and the primers then
annealed to their complementary sequences within the target
molecule. Following annealing, the primers are extended with a
polymerase so as to form a new pair of complementary strands. The
steps of denaturation, primer annealing and polymerase extension
can be repeated many times (i.e., denaturation, annealing and
extension constitute one "cycle"; there can be numerous "cycles")
to obtain a high concentration of an amplified segment of the
desired target sequence. The length of the amplified segment of the
desired target sequence is determined by the relative positions of
the primers with respect to each other, and therefore, this length
is a controllable parameter. Because the desired amplified segments
of the target sequence become the predominant sequences (in terms
of concentration) in the mixture, they are said to be "PCR
amplified".
[0058] As used herein, the term "PCR product," refers to the
resultant mixture of compounds after two or more cycles of the PCR
steps of denaturation, annealing and extension are complete. These
terms encompass the case where there has been amplification of one
or more segments of one or more target sequences. The term double
stranded amplified products includes PCR products.
[0059] As used herein, the term "restriction enzymes" refers to
bacterial enzymes, each of which cut double-stranded DNA at or near
a specific nucleotide sequence.
[0060] With PCR, it is possible to amplify a single copy of a
specific target sequence in genomic DNA to a level detectable by
several different methodologies (e.g., hybridization with a labeled
probe; incorporation of biotinylated primers followed by
avidin-enzyme conjugate detection; incorporation of
.sup.32P-labeled deoxynucleotide triphosphates, such as dCTP or
dATP, into the amplified segment). In addition to genomic DNA, any
oligonucleotide or polynucleotide sequence can be amplified with
the appropriate set of primer molecules. In particular, the
amplified segments created by the PCR process itself are,
themselves, efficient templates for subsequent PCR
amplifications.
[0061] As used herein, "host cell" refers to a cell that has the
capacity to act as a host and expression vehicle for an introduced
DNA (exogenous) sequence according to the invention.
[0062] As used herein the term "expression" refers to the process
by which a polypeptide is produced based on the nucleic acid
sequence of a gene. The process includes both transcription and
translation.
[0063] A "range of expression levels" means the expression of a
gene of interest obtained from a library of bacterial clones
transformed with PCR generated DNA libraries. In one embodiment,
the level of expression in a clone library will range from 1 to
500%, compared to the expression of a control which includes a
precursor or native promoter and regulatory region when grown under
essentially the same conditions.
[0064] "Optimal expression" refers to the cumulative conditions
that provide an optimal level of gene expression for a particular
coding region. Under certain laboratory conditions, optimal
expression means a lower level of gene expression and under other
conditions, optimal expression means a higher level of gene
expression that can coexist in a cell in situations where, under
certain conditions the expressed gene or product produced therefrom
would be detrimental to the viability of the cells or have an
adverse effect upon the cells.
[0065] "Isolated" as used herein refers to a nucleic acid or
polypeptide that is removed from at least one component with which
it is naturally associated.
[0066] The term "comprises and its cognates are used in their
inclusive sense: that is equivalent to the term including and its
cognates.
[0067] "A", "an" and "the" include plural references unless the
context clearly dictates otherwise.
PREFERRED EMBODIMENTS OF THE INVENTION
[0068] Promoter sequences useful for creating artificial promoters
according to the invention include the precursor promoters listed
in Table 1 below. FIG. 4 illustrates the sequence of some of these
precursor promoters including the -35 box, -10 box and linker
region. All promoters in the table are characterized with respect
to the beta-lactamase promoter Pbla and promoter strengths are
given in "Pbla-units". (Deuschle et al., EMBO Journal
5(11):2987-2994 (1986)).
[0069] In general, promoters useful in the invention include
promoter sequences of between 200 to 20 base pairs (bp), preferably
150 to 25 bp, more preferably between 100 to 30 bp and most
preferably between 50 to 30 bp upstream from the transcription
start site (+1). The shorter sequences (between 50 to 30 bp) are
most preferred because DNA libraries may be created more easily
within a single degenerated oligonucleotide with the shorter
sequences. Therefore in a preferred embodiment, a short sequence of
the promoters as disclosed in FIG. 4 would be used to obtain
artificial promoters according to the invention. These preferred
sequences would include about 50 to 30 bp staring at about the
transcriptional start site (+1) of said promoters. TABLE-US-00002
TABLE 1 Relative PROMOTER Source Activity SEQ ID NO.
.beta.-lactamase (bla) E. coli vector 1 14 PConsensus Synthetic DNA
4 13 (con) PTac I (Trc) Hybrid of 2 17 2 promoters PLacUV5 Mutant
of Lac 3.3 12 Plac E. coli lacZ gene 5.7 1 PL Phage .lamda. 37 11
PA1 Phage T7 22 8 PA2 Phage T7 20 9 PA3 Phage T7 76 10 PJ5 Phage T5
9 7 PG25 Phage T5 19 6 PN25 Phage T5 30 5 PD/E20 Phage T5 56 4
PH207 Phage T5 55 3
[0070] Additional promoters useful in the invention are disclosed
in Sommer et al., (2000) Microbiol. 146:2643-2653, wherein the
sequence of Ptac and variants containing 1 or 2 base pair changes
are taught. In one embodiment a preferred precursor promoter is a
trc promoter (Ptrc). The -35 box (TTGACA) and the -10 box (TATAAT)
is the same as Ptac. However, the linker region of Ptrc includes 17
bp as compared to 16 bp for Ptac. There is an addition of a "C"
between nucleotides -18 and -10 of Ptac. (Russell and Bennett,
(1982) Gene: 20:231 and Amann et al., (1983) Gene 25:167-178).
[0071] A further useful promoter is the glucose isomerase promoter
P.sub.GI. This promoter is also known in the literature as a xylose
isomerase promoter and reference is made to Amone et al., (1989)
Appl. Microbiol. Biotechnol. 30:351-357. The P.sub.GI comprises the
following GCCCTTGACAATGCCACATCCTGAGCA AATAAT TCAACCACTA
ATTGTGAGCGGATAACA (SEQ ID NO. 15), wherein the -35 box is
represented by TTGACA, the -10 box is represented by AATAAT and the
+1 transcription start site is A.
[0072] In addition to the above promoters, a variety of precursor
promoters can be utilized in the practice of the present invention.
In some cases, strong promoters tend to be overexpressed to the
detriment of the host cell viability. Cells use a limited set of
signals to engage the transcriptional machinery and transcribe a
gene. Bacteria such as E. coli, uses a core RNA polymerase and
several sigma subunits to recognize different type of promoters
(deHaseth et al. 1998. J. Bact. 180: 3019-3025. The E. coli genes
required for fast growth are mainly under the control of the sigma
factor coded by the rpoD gene. The most obvious components of a
RpoD-dependent promoter are the -35 and -10 regions that contain
variations of the consensus sequences TTGACA and TATAAT
respectively. The promoter region contains 2 other components that
affect promoter strength in a subtler manner: the upstream (Gourse
et al., 2000. Mol. Microbiol. 37: 687-695) and the spacer regions
(Burr et al. (2000) NAR 28: 1864-1870). The contribution of each
one of these 2 elements varies depending on how similar the -35 and
-10 region are to the consensus.
[0073] A precursor promoter used to obtain a library of artificial
promoters as described herein may be determined by various
exemplary methods. While not wanting to be limited, in one
embodiment, sequencing of a particular host genome may be performed
and putative promoter sequences identified using computerized
searching algorithms. For example, a region of a genome may be
sequenced and analyzed for the presence of putative promoters using
Neural Network for Promoter Prediction software, NNPP. NNPP is a
time-delay neural network consisting mostly of two feature layers,
one for recognizing TATA-boxes and one for recognizing so called
"initiators", which are regions spanning the transcription start
site. Both feature layers are combined into one output unit.
Further identification of precursor promoter sequences can be
identified by examination of putative promoter sequences identified
in a genome of a host cell using homology analysis. For example, by
using BLAST. These putative sequences may then be cloned into a
cassette suitable for preliminary characterization in E. coli
and/or direct characterization in E. coli.
[0074] In another embodiment, identification of consensus promoter
sequences can be identified by examination of the family of genomes
and putative promoter sequences identified in the genome in
question using homology analysis. For example, a homology study of
a family of genomes may be performed and analyzed for the presence
of putative consensus promoters using BLAST. These putative
promoter sequences may then be cloned into a cassette suitable for
preliminary characterization in E. coli.
[0075] An artificial promoter according to the invention will
comprise at least one modification to a nucleotide in a precursor
promoter. In one embodiment the modification will be to a
nucleotide positioned in the -35 consensus region. This
modification may include a modification to one or more nucleotides
at a position equivalent to a nucleotide at the -30, -31, -33, -34,
-35, and/or -36 position of a precursor promoter. Preferably the
modification will be of one or two nucleotides, and preferably the
modification will be a substitution of one nucleotide or two
nucleotides. When two positions are to be modified, four positions
will be conserved, and when one position is modified, five
positions will be conserved. In another embodiment the modification
will include a modification to the nucleotide represented by
position -30 and/or a change to a position corresponding to
-35.
[0076] In preferred embodiments, an artificial promoter is obtained
from a precursor promoter having a -35 box represented by the
following sequences, TTGACA, TTGCTA, TTGCTT, TTGATA, TTGACT, TTTACA
and TTCAAA. Particularly preferred -35 consensus regions from
precursor promoters are TTTACA and TTGACA. As a non-limiting
example when TTGACA is the -35 box of a precursor promoter, the
nucleotide at position -30 is A and it may be substituted with a T,
G or C nucleotide, the nucleotide at position -31 is C and it may
be substituted with a A, T or G nucleotide; the nucleotide at
position -32 is A and it may be substituted with a T, G or C
nucleotide; the nucleotide at position -33 is G and it may be
substituted with a A, T, or C nucleotide; the nucleotide at
position -34 is T and it may be substituted with a A, G or C
nucleotide; and the nucleotide at position -35 is T and it may be
substituted with a A, G or C nucleotide.
[0077] In another embodiment, the modification will be in the -10
consensus region. This modification may include a modification to
one or more nucleotides at a position corresponding to the -7, -8,
-9, -10, -11, and/or -12 position of a precursor promoter.
Preferably the modification will be in one or two nucleotide
positions. In a particularly preferred embodiment, the precursor
promoter will include the following sequences of the -10 box,
TAAGAT, TATAAT, TATACT, GATACT, TACGAT, AATAAT, TATGTT and GACAAT.
Particularly preferred are the sequences TATAAT, TATGTT, AATAAT and
TAAGAT and most preferred are TATAAT and AATAAT. In one particular
embodiment, the precursor promoter is the trc promoter and most
particularly the 50 to 30 bp sequence upstream of the +1
transcription start site and the artificial promoter will include
at least one modification to a nucleotide in the -10 box
represented by TAAGAT. For example, since the nucleotide at
position -7 is T, it may be substituted with a C, G or A
nucleotide; since the nucleotide at position -8 is A, it may be
substituted with a C, G or T nucleotide; since the nucleotide at
position -9 is G, it may be substituted with a C, T or A; since the
nucleotide at position -10 is A, it may be substituted with a T, C
or G nucleotide; since the nucleotide at position -11 is A, it may
be substituted with a T, C or G nucleotide; and since the
nucleotide at position -12 is T, it may be substituted with a C, G
or T nucleotide.
[0078] In some embodiments of the invention, both the -35 box and
the -10 box of the precursor promoter will have modifications. In
one embodiment, the modification will include one nucleotide in
each consensus region, and in a further embodiment the modification
will include two nucleotides in each consensus region. In another
embodiment a modification will include a modification to the -35
box represented by TTGACA and a modification to the -10 box
represented by AATAAT. In another embodiment the modification will
include a modification to the -35 box represented by TTGACA and a
modification to the -10 box represented by TATAAT.
[0079] The linker sequence of a precursor promoter may also be
modified to obtain an artificial promoter according to the
invention. The precursor linker sequence may include deletions,
substitutions or insertions. Preferably the linker sequence is
between 14 and 20 base pairs in length. The length of the linker
sequence may be modified to optimize expression by performing
deletion analysis, such as by site directed mutagenesis to create
sequential deletions in the precursor promoter. The linker sequence
or the precursor promoter may be modified in length to include 16
base pairs, 17 base pairs, 18 base pairs, 19 base pairs or 20 base
pairs.
[0080] In one embodiment, modified DNA sequences in the precursor
promoter are generated by using a degenerated oligonucleotide in
accordance with well know techniques. In a preferred embodiment,
the artificial promoters will comprise 30 to 50 bp upstream of the
transcription site (+1) so that the promoter could be contained
within an oligonucleotide and the library of promoters created by
degeneration of the oligonucleotide.
[0081] Promoter strength can be quantified using in vitro methods
that measure the kinetics of binding of the RNA polymerase to a
particular piece of DNA, and also allows the measurement of
transcription initiation (Hawley D. K et al., Chapter 3: in:
PROMOTERS: STRUCTURE AND FUNCTION. R. L/Rodriguez and M. J.
Chamberlin eds. Praeger Scientific. New York). In vivo methods have
been used also to quantify promoter strength. In this case, the
approach has been to fuse the promoter to a reporter gene and the
efficiency of RNA synthesis measured.
[0082] To create DNA libraries which comprise a library of
artificial promoters, a first degenerated oligonucleotide
comprising a nucleic acid sequence homologous to a first end,
preferably the 3' end, of an insertion DNA construct, a promoter as
described above, and a nucleic acid sequence homologous to the
downstream region of the transcription start site of a precursor or
native promoter is mixed with both i) a second oligonucleotide
which comprises a nucleic acid sequence homologous to an upstream
region of the precursor or native promoter of a chromosomal gene of
interest and a nucleic acid sequence homologous to a second end,
preferably the 5' end, of the insertion DNA construct, and ii) an
insertion DNA construct in an amplification reaction, preferably a
PCR reaction to obtain double stranded amplified products
comprising artificial promoters.
[0083] In a preferred embodiment, an insertion DNA construct is
carried on a plasmid, preferably on a R6K plasmid and comprises an
antibiotic resistance gene flanked on both sides by a recombinase
recognition site. (Datsenko and Warner (2000) Proc. Natl. Acad. Sc.
97:6640-6645). While any desired selective marker can be used,
antibiotic resistant markers (Anb.sup.R) are most useful. These
include but are not limited to, Cm.sup.R, Km.sup.R and Gm.sup.R.
Preferably, the recombinase recognition sites are the same.
Recombinase sites are well-known in the art and generally fall into
two distinct families based on their mechanism of catalysis and
reference is made to Huang et al., (1991) Nucleic Acids Res. 19:443
and Nunes-Duby et al., (1998) Nucleic Acid Res. 26:391-406.
[0084] A preferred recombination system is the Saccharomyces
Flp/FRT recombination system, which comprises a Flp enzyme and two
asymmetric 34 bp FRT minimum recombination sites (Zhu et al.,
(1995) J. Biol. Chem. 270:11646-11653). A FRT sites comprises two
13 bp sequences, inverted and imperfectly repeated, which surround
an 8 bp core asymmetric sequence where crossing-over occurs. The
FLP-dependent intramolecular recombination between two parallel FRT
sites results in excision of any intervening DNA sequence as a
circular molecule producing two recombination products, each
containing one FRT site (Huffman et al. (1999) J. Mol. Biol. 286:
1-13).
[0085] In general, nucleic acid sequences homologous to downstream
regions or upstream regions may include from 2-150 bp, preferably
5-100 bp, more preferably 5-50 bp and also 10-40 bp. In specific
embodiments a nucleic sequence homologous to the downstream
transcription start site of the precursor or native promoter or a
nucleic acid sequence homologous to an upstream region of the
precursor promoter of a chromosomal gene of interest may include
about 5 to 100 base pairs and also 5 to 50 base pairs. The nucleic
acid homologous to a 5' or 3' end of the insertion DNA construct
may include about 10 to 40 base pairs and preferably about 2 to 25
base pairs. An upstream region of the precursor promoter means a
segment upstream (5') of the -35 consensus sequence.
[0086] In further embodiments of the invention a RBS, downstream of
the precursor promoter region, may be modified. Preferred RBSs,
which may be modified include the sequences selected from the
following: AGGAAA, (SEQ ID NO. 30), AGAAAA (SEQ ID NO. 31), AGAAGA
(SEQ ID NO. 32), AGGAGA (SEQ ID NO. 33), AAGAAGGAAA (SEQ ID NO.
34), AAGGAAAA (SEQ ID NO. 35), AAGGAAAG (SEQ ID NO. 36), AAGGAAAU
(SEQ ID NO. 37), AAGGAAAAA (SEQ ID NO. 38), AAGGAAAAG (SEQ ID NO.
39), AAGGAAAAU (SEQ ID NO. 40), AAGGAAAAAA (SEQ ID NO. 41),
AAGGAAAAAG (SEQ ID NO. 42), AAGGAAAAAU (SEQ ID NO. 43), AAGGAAAAAAA
(SEQ ID NO. 44), AAGGAAAAAAG (SEQ ID NO. 45), AAGGAAAAAAU (SEQ ID
NO. 46), AAGGAAAAAAAA (SEQ ID NO. 47), AAGGAAAAAAAG (SEQ ID NO.
48), AAGGAAAAAAAU (SEQ ID NO. 49), AAGGAAAAAAAAA (SEQ ID NO. 50),
AAGGAAAAAAAAG (SEQ ID NO. 51), AAGGAAAAAAAAU (SEQ ID NO. 52),
AAGGAAAAAAAAAA (SEQ ID NO. 53), AAGGAAAAAAAAAG (SEQ ID NO. 54),
AAGGAGGAAA (SEQ ID NO. 55), and AAGGAAAAAAAAAU (SEQ ID NO. 56).
Most preferred RBS include AGGAAA, (SEQ ID NO. 30), AGAMA (SEQ ID
NO. 31), AGAAGA (SEQ ID NO. 32), AGGAGA (SEQ ID NO. 33), and
AAGGAGGAAA (SEQ ID NO. 55). The modified RBS may include
substitution, deletion or insertion of anyone of the base pairs
comprising the RBS.
[0087] To obtain DNA libraries comprising modified RBS libraries, a
oligonucleotide comprising a nucleic acid fragment homologous to a
downstream region of the -10 box of a promoter or artificial
promoter, a modified RBS, and a nucleic acid fragment homologous to
the 5' end of the chromosomal gene of interest which includes the
start codon, is mixed with the double stranded amplified products
comprising artificial promoters as described above and under
similar PCR reactions. The homologous nucleic acid fragments may
comprise from 2 to 100 base pairs and preferably from 2 to 50 base
pairs. In other embodiments the (XTG) start codon of the gene of
interest may be modified. These modifications may include X=A, T,
G, depending on the native start codon in the gene of interest.
[0088] In other embodiments of the method described herein a
stabilizing mRNA sequence may be incorporated into an
oligonucleotide. The oligonucleotide may comprise an artificial
promoter, a modified ribosome binding or both. The stabilizing
sequences are preferably inserted between the RBS and the
transcription start site.
[0089] Stabilizing mRNA sequence are well known in the art and
reference is made to Carrier et al. (1999) Biotechnol. Prog.
15:58-64. Preferred mRNA stabilizing sequences include the
sequences GGTCGAGTTATCTCGAGTGAGATATTGTTGACG, (SEQ ID NO. 63);
GGTGGACTTATCTCGAGTGAGATATTGTTGACG, (SEQ ID NO. 64);
CCTCGAGTTATCTCGAGTGAGATATTGTTGACG, (SEQ ID NO. 65);
GCTCGAGTTATCTCGAGTGAGATATTGTTGACG, (SEQ ID NO. 66);
CGTCGAGTTATCTCGAGTGAGATATTGTTGACG, (SEQ ID NO. 67);
GGTGGAGTTATCTCGAGTGAGATATTGTTGACG, (SEQ ID NO. 68) and
GCTGGACTTATCTCGAGTGAGATATTGTTGACG, (SEQ ID NO. 69). In a preferred
embodiment the stabilizing sequence is SEQ ID NO. 67. The double
stranded amplified products may also include modified start codons
of a gene of interest.
[0090] The double stranded amplified products which comprise
artificial promoters, modified ribosome binding sites, modified
start codons, stabilizing mRNA sequences and combinations thereof,
according to the invention may be used individually and introduced
into a host cell. Additionally, the double stranded amplified
products may be used in a DNA library wherein said library
comprises one or more of a library of artificial promoters, a
library of modified ribosome binding sites, a library of modified
start codons and which may or may not include stabilizing mRNA
sequences. The DNA libraries are introduced into bacterial host
cells wherein they replace the chromosomal regulatory regions of a
gene of interest. Preferably the double stranded amplified products
are integrated into the host cell chromosome. Flanking homologous
regions of the double stranded amplified products replace
homologous regions at a target site in a gene sequence of interest
in a host chromosome. In a preferred embodiment, the integration of
the PCR products is a stable and non-reverting integration.
Preferably replacement is by a double crossover (i.e., homologous
recombination). The introduced PCR products may create a library of
bacterial cells having a range of expression levels for a gene of
interest.
[0091] The method as disclosed herein is not limited to expression
of any particular gene or group of genes (an operon), but is
intended to be broadly applicable to many different genes or
operons. In one preferred embodiment, the artificial promoters or
other regulatory DNA constructs according to the invention will be
operably linked to a coding sequence that was heterologous to a
precursor promoter, and in another embodiment the artificial
promoters or other regulatory DNA constructs will be operably
linked to a coding sequence that was homologous to the precursor
promoter. Further the coding sequence may be heterologous or
endogenous to the host cell transformed according to the
invention.
[0092] In some embodiments, the gene encodes therapeutically
significant proteins or peptides, such as growth factors, hormones,
cytokines, ligands, receptors and inhibitors, as well as vaccines
and antibodies. A gene may also encode commercially important
proteins or peptides, such as enzymes (e.g., proteases, amylases,
glucoamylases, dehydrogenases, esterases, cellulases,
galactosidases, oxidases, reductases, kinases, xylanases, laccases,
phenol oxidases, chitinases, glucose oxidases, catalases, phytases,
isomerases, phosphatases, and lipases). In further embodiments the
gene of interest encodes global regulators; transporter proteins,
such as glucose and/or DKG permeases, and enzymes from primary and
secondary metabolism, such as tpi and nuo which code for triose
phosphate isomerase and NADH dehydrogenase, respectively.
[0093] In one embodiment, the host cell is a bacterial cell such as
a gram positive bacteria. In another embodiment the host cell is a
gram-negative bacteria. In some preferred embodiments, the term
refers to cells in the genus Pantoea, the genus Bacillus and E.
coli cells.
[0094] As used herein, "the genus Bacillus" includes all members
known to those of skill in the art, including but not limited to B.
subtilis, B. licheniformis, B. lentus, B. brevis, B.
stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B.
clausii, B. halodurans, B. megaterium, B. coagulans, B. circulans,
B. lautus, and B. thuringiensis. It is recognized that the genus
Bacillus continues to undergo taxonomical reorganization. Thus, it
is intended that the genus include species that have been
reclassified, including but not limited to such organisms as B.
stearothermophilus, which is now named "Geobacillus
stearothermophilus." The production of resistant endospores in the
presence of oxygen is considered the defining feature of the genus
Bacillus, although this characteristic also applies to the recently
named Alicyclobacillus, Amphibacillus, Aneurinibacillus,
Anoxybacillus, Brevibacillus, Filobacillus, Gracilibacillus,
Halobacillus, Paenibacillus, Salibacillus, Thermobacillus,
Ureibacillus, and Virgibacillus.
[0095] As used herein, "the genus Pantoea" includes all members
known to those of skill in the art, including but not limited to P.
agglomerans, P. dispersa, P. punctata, P. citrea, P. terrea, P.
ananas and P. sterartii. It is recognized that the genus Pantoea
continues to undergo taxonomical reorganization. Thus, it is
intended that the genus include species that have been
reclassified, including but not limited to such organisms as
Erwinia herbicola.
[0096] One skilled in the art are well aware of methods for
introducing polynucleotides into host cells and particularly into
E. coli, Bacillus and Pantoea host cells. General transformation
techniques are disclosed in CURRENT PROTOCOLS IN MOLECULAR BIOLOGY
Vol. 1, eds. Ausubel et al. John Wiley & Sons Inc, (1987) Chap.
7. and Sambrook, J., et al., MOLECULAR CLONING: A LABORATORY
MANUAL, Cold Spring Harbor Laboratory Press (1989). Reference is
also made to Ferrari et al., Genetics pgs 57-72 in Hardwood et al.
Ed. BACILLUS, Plenum Publishing Corp. 1989; Chang et al., (1979)
Mol. Gen. Genet. 168:11-15; Smith et al., (1986) Appl. and Env.
Microbiol. 51:634 and Potter, H. (1988) Anal Biochem 174:361-373
wherein methods of transformation, including electroporation,
protoplast transformation and congression; transduction and
protoplast fusion are disclosed. Methods of transformations are
particularly preferred.
[0097] Methods suitable for the maintenance and growth of bacterial
cells is well known and reference is made to the Manual of Methods
of General Bacteriology, Eds. P. Gerhardt et al., American Society
for Microbiology, Washington, D.C. (1981) and T. D. Brock in
Biotechnology: A Textbook of Industrial Microbiology 2 ed. (1989)
Sinauer Associates, Sunderland Mass.
[0098] The transformed host cells are selected based on the
phenotype response to a selectable marker which was provided in an
insertion DNA construct. In some embodiments the selectable marker
may be excised out of the host cell. (Cherepanov et al. (1995) Gene
158:9-14).
[0099] Additionally transformants may be analyzed to verify the
integration of the regulatory DNA constructs, such as artificial
promoters using various techniques. The regulatory DNA constructs
including artificial promoters may be PCR verified using
oligonucleotides outside the recombinase region. In one example the
size of the PCR product obtained from the artificial promoter is
compared to the size of the PCR product obtained from the reference
promoter on an agarose gel. The regulatory DNA constructs may be
verified by digesting the PCR product obtained from the artificial
promoter with a restriction enzyme that is unable to digest the
artificial promoter and that is able to digest the reference
promoter. The regulatory DNA constructs may also be verified by
evaluating gene expression and production. Many assays are known
for measuring enzyme activity. For example beta-galactosidase is
the enzyme produced by the lacZ gene, and the activity of this
enzyme may be determine by the assay disclosed in Miller, J. H., A
SHORT COURSE IN BACTERIAL GENETICS. Cold Spring Harbor Laboratory
Press, 1992,
[0100] Additionally, the artificial promoter region and other
regulatory regions in a host cell may be sequenced by means well
known in the art. (Maxam et al., (1977) PNAS USA 74:560-564)
[0101] Transformed host cells according to the invention may have
expression levels of a gene of interest which may be higher or
lower that the expression level of the coding region of the gene in
a parent control. In one embodiment the level of gene expression in
a transformed host will be between about 1 to 500%, between about 1
to 250%, between about 5 to 200%, between about 10 to 150% and
between about 10 to 100% of the level of expression of the same
gene in the corresponding parent. Also about 5%, 15%, 25%, 35%,
45%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 120%, 140%,
160%, 180% and 200% the expression level of a corresponding
parent.
[0102] Using a DNA library according to the invention, which
includes an artificial promoter library, a modified RBS library, a
mRNA stabilizing sequence library, or a start codon library or
combinations thereof to create a population of bacterial cells
having varying levels of expression of a gene of interest, is
particularly useful in a metabolic engineering pathway
framework.
[0103] A metabolic pathway is a series of chemical reactions that
either break down a large molecule into smaller molecules
(catabolism) or synthesize more complex molecules from smaller
molecules (anabolism). Most of these chemical reactions are
catalyzed by a number of enzymes. In many metabolic pathways there
are rate-limiting enzymatic steps which serve to regulate the
pathway. For example, in the glycolytic pathway wherein glucose is
converted to pyruvate and ATP, phosphofructokinase is considered a
key enzyme in regulation and in the pentose phosphate pathway
wherein NADPH and ribose-5-phosphate are generated,
glucose-6-phosphate dehydrogenase and fructose 1,6-diphosphatase
are considered key enzymes.
[0104] In order to be commercially viable a chemical or protein
must be capable of being produced and recovered in large quantities
in an organism with low cultivation cost. Many industrial
bioprocesses utilize whole-cell fermentation techniques. In many
instances, the use of an isolated enzyme system is too expensive or
impractical. Many enzymes, such as dehydrogenases that may be
utilized to carry out chiral synthesis of pharmaceutical
intermediates, require co-factors such as NAD(P) for their
reactions. Cofactors are utilized stoichiometrically during the
reaction and must be repeatedly added to the reaction mixture or
the reaction must regenerate the cofactor. A whole-cell system
provides an alternative for many of these enzymes. Other enzymes
may be membrane-bound or require complex subunit or multi-enzyme
complexes (such as cytochrome P-450s), allowing for simpler
implementation using a whole-cell system. Finally, the synthesis of
complex molecules such as steroids, antibiotics, and other
pharmaceuticals may require complicated and multiple catalytic
pathways.
[0105] In an isolated system, each step in a particular metabolic
pathway would need to be engineered. In contrast, the organism
utilized in a whole cell system provides each of the required
pathways. However, the use of certain promoters may incur problems,
such as being too strong. As a result, overexpression of a
particular gene may occur and be detrimental to a cell. The cell's
viability can thus be reduced and the production time may be
limited.
[0106] The methods provided herein are utilized to provided a
library of regulatory DNA constructs such as a library of modified
promoters, a library of modified RBS and, a library of modified
start codons, which may include stabilizing mRNA sequences to be
introduced into bacterial host cells which results in a population
of transformed cells having a range of gene expression. The range
of gene expression is useful because it allows the selection of
specific bacterial clones having an optimum level of expression but
still maintaining cell viability (e.g. the flux production of the
desired end product relative the viability of the host cell in
sustaining the desired level of production or sustaining the
desired level of production). In certain embodiments the optimum
level of expression of a gene will be high and in other embodiments
the optimum level of gene expression will be low. In one
embodiment, the level of expression of a gene of interest in a
clone library may range from -100 to +500%, also -50 to 150% and
-80 to 100%. For example, the expression of a gene of interest in
certain clones of a library may be 100% less than the expression of
the gene in a corresponding parent. Also, the expression of the
gene of interest in certain clones may be 500% greater than the
expression of the same gene in the corresponding parent.
[0107] A direct advantage of this method is that a bacterial clone
may be selected based on the expression level obtained from the DNA
libraries and then be ready for use in a fermentation process
whereby cell viability is not negatively affected by expression of
the gene of interest.
[0108] The following Examples are for illustrative purposes only
and are not intended, nor should they be construed as limiting the
invention in any manner. Those skilled in the art will appreciate
that variations and modifications can be made without violating the
spirit or scope of the invention.
EXAMPLES
[0109] The E. coli strain MG1655 having ATCC No. 47076 was utilized
to create a library of bacterial clones comprising a library of
artificial promoters, a library of mRNA stabilizing sequences and a
library of modified RBSs.
Example 1
Creation of a Library of Escherichia coli Clones with Different
Levels of Expression of a Chromosomal Gene by Deleting a Regulator
and Replacing the Natural Promoter by PCR Generated Artificial
Promoters of Different Strength
[0110] This example describes the deletion of lacI encoding a
repressor and the replacement into the Escherichia coli genome of
the natural lacZ (encoding the .beta.-galactosidase) promoter by
PCR generated artificial promoters of different strength.
a) Design of the Oligonucleotides for the lacZ Promoter
Replacement.
[0111] Oligonucleotides (lacZF and degenerated lacZR) were designed
to amplify by PCR a cassette containing an 79 bp sequence
homologous to the 5' of the lacI gene, a chloramphenicol-resistance
encoding gene (cat) flanked by baker yeast FRT sites, a library of
three artificial GI promoter sequences (FIG. 6) and a 40 bp
sequence homologous to the downstream region of the +1
transcription start site of the natural lacZ promoter.
[0112] The degenerated lacZR primers were 100 nucleotides long and
included the entire sequence from the +1 of the transcription start
site to the ATG of lacZ (365529 to 365567). TABLE-US-00003 LacZR
oligonucleotide: (SEQ ID NO. 57)
TAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTAGTGGTTGAAT
TATTTGCTCAGGATGTGGCATHGTCAAGGGCATATGAATATCCTCCTTAG wherein H is A,
C or T
[0113] The GI promoters from 4 bp upstream of the -35 to 8 bp
downstream the -10, were degenerated at the last base of the -35
(TTGACA, TTGACT and TTGACG) to create the diversity. The priming
site for pKD3 (Datsenko and Wanner, (2000) PNAS, 97: 6640-6645) an
R6K plasmid containing the cat gene flanked by two FRT sites.
[0114] The lacZF primer is 100 nucleotides long (SEQ ID NO. 58) and
contains: 79 bp of sequence (from 366734 to 366675) at the 5' end
of the lacI gene and the priming site for pKD3 TABLE-US-00004 LacZF
oligonucleotide: (SEQ ID NO. 58)
GTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTA
TCAGACCGTTTCCCGCGTGGTGAACCAGGGTGTAGGCTGGAGCTGCTTCG
b) Amplification and Purification of the GI Promoter Replacement
Cassettes.
[0115] Primers lacZF and lacZR were used to amplify the library of
promoter replacement cassettes using plasmid pKD3 as a template.
The amplification used 30 cycles of 94.degree. C. for 2 minutes;
60.degree. C. for 30 sec; 72.degree. C. for 2 min using Taq
polymerase as directed by the manufacturer (BioLabs, New England).
The mixture of 1.15 kb PCR products were gel purified using the
Quiaquick gel extraction kit (QIAGEN, Inc.).
c) Creation of the Library of Clones with Different Artificial
Promoter in from of the lacZ Genes.
[0116] Transformants carrying Red Helper plasmid (pKD 46) (Datsenko
and Wanner, supra) were grown in 20 ml SOB medium with
carbenicillin (100 mg/l) and L arabinose (10 mM) at 30.degree. C.
to an OD.sub.550 nm of 0.6 and then made electrocompetent by
concentration 100 fold and washed one time with ice water and twice
with ice cold 10% glycerol. Electroporation was done using a Gene
pulse (BioRad--model II apparatus 165-2106) with a voltage booster
and 0.2 cm chamber according to manufactures instructions by using
50 .mu.l of cells and 0.1 to 1.0 .mu.g of the mixtures of purified
PCR products (as described above). Shocked cells were added to 1 ml
SOC medium incubated 2 hours at 30.degree. C. and then half of the
cells were spread on agar to select Cm.sup.R transformants. Xgal 40
mg/l was added on the agar plates to evaluate the .beta.
galactosidase expression. If cells did not grow within 24 hours,
the remainder were spread after standing overnight at 30.degree.
C.
d) PCR verification of the Transformants.
[0117] Mutants were grown overnight on LB medium with 30 mg/l Cm. 1
ml of culture was washed with ice cold water and the chromosomic
DNA was recovered in the supernatant after heat treatment (5 min at
94.degree. C.) of the washed cells. The PCR was performed using the
chromosomic DNA and a set of two oligonucleotides (LacseqF and
LacseqR). The amplification was performed as disclosed above. A 1.6
PCR product was obtained. TABLE-US-00005 LacseqF oligonucleotide
GGCTGCGCAACTGTTGGGAA (SEQ ID NO. 59) LacseqR oligonucleotide
CATTGAACAGGCAGCGGAAAAG (SEQ ID NO. 60)
[0118] The PCR product was digested by ECORV (1 U/.mu.g of ECORV, 2
hrs at 37.degree. C.). The comparison of the digestion profile of
the mutants (modified precursor) with the wild-type strain showed
that the ECORV is absent when the promoter is replaced.
[0119] The sequence of the P.sub.GI in the different clones was
determined by sequencing the different 1.2 kb PCR products with the
lacseqF primer. 50 .mu.l of column purified PCR products
(Quiaquick, Quiagen, Inc.) obtained from the chromosomic DNA of the
mutants were used and sequenced by Genome Express (Meylan,
France).
[0120] The organization of the GI lacZ promoter region in the three
types of recombinant clones obtained is shown in FIG. 6. As
expected, they only differ by one base pair in their -35 region and
were named 1.6 GI lacZ for TTGACA, 1.5 GI lacZ for TTGACT and 1.20
GI lacZ for TTGACG.
e) .beta. Galactosidase Activity
[0121] A 25 ml LB culture with Cm (30 mg/l) of the mutants was
maintained for 5 hr at 37.degree. C. The cells were centrifuged 10
min at 4000 g and resuspended in 300 .mu.l of B-PER Bacterial
Protein Extraction Reagent (Pierce, Rockford). After 10 min of
incubation on ice, the solution was centrifuges 2 min at 12000 g at
4 C to separate the soluble proteins from cell debris. The
supernatant was used to evaluate the .beta. galactosidase activity.
The .beta. galactosidase activity was measured using synthetic
substrate ONPG (ortho-nitrophenyl .beta.-D-galactopyranoside)
according to the procedure of Miller, (1992) A SHORT COURSE IN
BACTERIA GENETICS, Cold Spring Harbor Laboratory Press. The
conditions of the reaction were, 37 C, pH 7.3, A 410 nm, light path
1 cm. (FIG. 7)
f) Elimination of the Antibiotic Resistance Gene:
[0122] pCP20 (Cherepanov et al., (1995) Gene: 158:9-14) is a
plasmid that carries an ampicillin resistance marker, contains a
temperature sensitive origin of replication and thermal induction
of FLP synthesis. CmR mutants were transformed (pCP20) and
ampicillin resistant transformants were selected at 30.degree. C. A
few colonies were purified selectively at 43.degree. C. and then
tested for loss of all antibiotic resistance. The majority lost the
FRT flanked resistance gene and the FLP helper plasmid
simultaneously.
Example 2
Creation of a Library of Escherichia coli Clones with Different
Levels of Expression of a Chromosomal Gene by Replacing the Natural
Promoter with the 1.6GI and Creating a Library of RBS with PCR
Generated Linear DNA Fragments
[0123] This example describes the deletion of lad and the
replacement into the Escherichia coli genome of the natural lacZ
(encoding the .beta.-galactosidase) promoters and RBS by a PCR
generated artificial promoter and RBS with different binding
capacities.
a) Design of the Oligonucleotides to Create a Library of
Replacement Cassettes to Replace the Native Promoter and Modify the
RBS and the Start Codon.
[0124] Oligonucleotide lacZRT was designed to amplify by PCR when
used with lacZF a cassette containing a 79 bp sequence homologous
to the 5' of the lad gene, a chloroamphenicol resistance encoding
gene (cat) flanked by baker yeast FRT sites, the 1.6GI promoter
sequence (SEQ ID NO. 19) and a 40 bp sequence homologous to the
downstream region of the +1 transcription start site of the natural
lacZ promoter. TABLE-US-00006 LacZRT oligonulceotide (SEQ ID NO.
70) TAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTAGTGGTTGAAT
TATTTGCTCAGGATGTGGCATGTCAAGGGCATATGAATATCCTCCTTAG
[0125] A degenerate oligonucleotide, lacZRBSR, was designed with a
60 bases region homologous to lacZ after the start codon and a 40
bases region homologous to the lacZRT oligonucleotide.
TABLE-US-00007 LacZRBS R oligonucleotide (SEQ ID NO. 61)
CAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATCCGTA
ATCATGGTCATAGCTGTYTYCTBYKWGAAATTGTTATCCGCTCACAATTA wherein B is T,
C or G; K is T or G; Y is C or T; and W is A or T.
[0126] This oligonucleotide (SEQ ID NO. 61) is degenerated in the
RBS sequence (AAGGAGGAAA, degeneration of the 1.sup.st base (A) by
a T, 2.sup.nd base (A) by a C; 3.sup.rd base (G) by a A; 4th base
(G) by an A or C; 7.sup.th base (G) by an A and the 9th base (A) by
a G.
b) Amplification and Purification of the Replacement Cassettes.
[0127] Primers lacZF and lacZRT were used to amplify by PCR the 1.6
GI promoter replacement cassette using pKD3 as template DNA. The
amplification used 30 cycles of 94.degree. C. for 2 minutes;
60.degree. C. for 30 sec; 72.degree. C. for 2 min using Taq
polymerase as directed by the manufacturer (BioLabs, New
England).
[0128] The lacZF and lacZRBSR primers were the used to amplify the
library of replacement constructs using the 1.6GI promoter
replacement cassette created above as a template. The amplification
used 30 cycles of 94.degree. C. for 2 minutes; 60.degree. C. for 3
sec; 72.degree. C. for 2 min using Taq polymerase as directed by
the manufacturer (BioLabs, New England). The 1.15 kb PCR products
were gel purified using the Quiaquick gel extraction kit (QIAGEN,
Inc.).
c) Creation of a Library of lacZ Expression Levels in Escherichia
coli by Homologous Recombination in the Chromosome Using
Replacement Cassettes in the Form of Linear DNA.
[0129] Transformants carrying red helper plasmid (pKD 46) (Datsenko
and Wanner, supra) were grown in 20 ml SOB medium with
carbenicillin (100 mg/l) and L arabinose (10 mM) at 30.degree. C.
to an OD 550 nm of 0.6 and then made electrocompetent by
concentration 100 fold and washed one time with ice water and twice
with ice cold 10% glycerol. Electroporation was done using a Gene
pulse (BioRad--model II apparatus 165-2106) according to
manufactures instructions by using 50 .mu.l of cells and 0.1 0 1.0
.mu.g of the mixtures of purified PCR products (as described
above). Shocked cells were added to 1 ml SOC medium incubated 2
hours at 30.degree. C. and then half of the cells were spread on
agar to select CmR transformants. Xgal 40 mg/l was added on the
agar plates to evaluate the .beta. galactosidase expression. If
cells did not grow within 24 hours, the remainder were spread after
standing overnight at 30.degree. C.
d) PCR verification of the Transformants.
[0130] Mutants were grown overnight on LB medium with 30 mg/l Cm.
1.0 ml of culture was washed with ice cold water and the
chromosomic DNA was recovered in the supernatant after heat
treatment (5 min at 94.degree. C.) of the washed cells. The PCR was
performed using the chromosomic DNA and the two oligonucleotides,
LacseqF and LacseqR as disclosed above in example 1. Amplification
also followed the protocol of example 1. A 1.6 kb PCR product was
obtained. The PCR product was digested by ECORV (1 U/.mu.g of
ECORV, 2 hrs at 37.degree. C.). The comparison of the digestion
profile of the mutants with the wild-type strain showed that the
ECORV site is absent when the promoter is replaced.
[0131] The sequence of the replacement cassette in the different
clones was determined by sequencing the different 1.6 kb PCR
products with the lacFprimer. 50 .mu.l of column-purified PCR
products (Quiaquick, Quiagen, Inc.) obtained from the chromosomic
DNA of the mutants were used and sequenced by Genome Express
(Meylan, France).
[0132] Eight of the recombinant clones were designated as indicated
below and the organization of the upstream region of lacZ in each
recombinant clone is A=CAAGGAGGAA ACAGCTATG (SEQ ID NO. 22),
B=CAAGAAGGAA ACAGCTATG (SEQ ID NO. 23), C=CACACAGGAA ACAGCTATG (SEQ
ID NO. 24), D=CTCACAGGAG ACAGCTATG (SEQ ID NO. 25), E=CTCACAGGAA
ACAGCTATG (SEQ ID NO. 26), F=CACACAGAAA ACAGCTATG (SEQ ID NO. 27),
G=CTCACAGAGA ACAGCTATG (SEQ ID NO. 28), and H=CTCACAGAAA ACAGCTATG
(SEQ ID NO. 29).
[0133] As expected the transformants differed only by RBS and the
range of expression among the different clones of the library was
from 5.7 to 0.02 U/mg of protein (FIG. 8).
[0134] Elimination of the antibiotic resistance gene was performed
as disclosed in example 1.
Example 3
Creation of a Library of Escherichia coli Clones with Different
Levels of Expression of a Chromosomal Gene by Both Replacing the
Native Promoter by the 1.6 GI Promoter and Introducing mRNA
Stabilizing Structures Using a Library of PCR Generated Linear DNA
Fragments
[0135] This example describes the deletion of lad and the
replacement into the Escherichia coli genome of the natural lacZ
(encoding the .beta.-galactosidase) promoter and the lac operator
by PCR generated artificial promoters of different strength and
artificial mRNA stabilizing structures with different
efficiencies.
a) Design of the Oligonucleotides to Create a Library of
Replacement Cassettes to Replace the Promoter and the Lac Operator
by a Library of Artificial Promoters and mRNA Stabilizing
Structures.
[0136] To generate broader lacZ expression level, a library of
replacement cassettes was designed to remove lacI, the natural lacZ
promoter and the lac operator and replace them by the 1.6 GI
promoter and a library of mRNA stabilizing structure. For this
purpose, a degenerate oligonucleotide, lacZmRNA, was designed with
a 43 base region homologous to lacZ downstream the RBS site, 34
bases of mRNA stabilizing structure and a 23 bases region
homologous to the lacZRT oligonucleotide upstream the +1 of
transcription. This oligonucleotide is degenerated in the mRNA
stabilizing sequence. TABLE-US-00008 LacZmRNA R oligonucleotide
(SEQ ID NO. 62) CGACGGCCAGTGAATCCGTAATCATGGTCATAGCTGTTTCCTCCTTCGTC
AACAATATCTCACTCGAGATAASTCGASSTAGTGGTTGAATTATTTGCTC AGG, wherein S
is C or G.
[0137] If lacF and lacMRNA are used in a PCR reaction with the
promoter replacement cassette (generated by PCR using the primers
lacZF and lacZRT (SEQ ID NO. 70) as template DNA, a new library
will be obtained with lad deleted, the promoter replaced and the
mRNA stabilizing structure introduced.
b) Amplification and Purification of the Replacement Cassettes:
[0138] Primers lacF and lacZMRNA were used to amplify the library
of replacement cassettes using the 1.6 GI promoter replacement
cassette created in example 2 as template DNA. Amplification
followed the procedures of example 1. The 1.15 kb PCR products were
purified by agarose gel electrophoresis followed by QIAquick gel
extraction Kit (QIAGEN).
c) Creation of a Library of lacZ Expression Level in Escherichia
coli by Homologous Recombination in the Chromosome Using
Replacement Cassettes in the Form of Linear DNA:
[0139] Transformants carrying Red Helper plasmid (pKD 46) (Datsenko
and Wanner, supra) were grown in 20 ml SOB medium with
carbenicillin (100 mg/l) and L arabinose (10 mM) at 30.degree. C.
to an OD.sub.550 nm of 0.6 and then made electrocompetent by
concentration 100 fold and washed one time with ice water and twice
with ice cold 10% glycerol. Electroporation was done using a Gene
pulse (BioRad--model II apparatus 165-2106) with a voltage booster
and 0.2 cm chambers according to manufactures instructions by using
50 .mu.l of cells and 0.1 to 1.0 .mu.g of the purified PCR products
(as described in b) above). Shocked cells were added to 1 ml SOC
medium incubated 2 hours at 30.degree. C. and then half of the
cells were spread on agar to select Cm.sup.R transformants. Xgal 40
mg/l was added on the agar plates to evaluate the .beta.
galactosidase expression. If cells did not grow within 24 hours,
the remainder were spread after standing overnight at 30.degree.
C.
d) PCR verification of the Transformants.
[0140] Mutants were grown overnight on LB medium with 30 mg/l Cm.
1.0 ml of culture was washed with ice cold water and the
chromosomic DNA was recovered in the supernatant after heat
treatment (5 min at 94.degree. C.) of the washed cells.
[0141] The PCR was performed using the chromosomic DNA and a set of
two oligonucleotides, LacseqF and LacseqR as disclosed above in
example 1. Amplification also followed the protocol of example 1. A
1.6 kb PCR product was obtained. The PCR product was digested by
ECORV (1 U/.mu.g ECORV, 2 hrs at 37.degree. C.). The comparison of
the digestion profile of the mutants with the wild-type strain
showed that the ECORV site is absent when the promoter is
replaced.
[0142] The sequence of the replacement cassette in the different
clones was determined by sequencing the different 1.6 kb PCR
products with the lacFprimer. 50 .mu.l of column-purified PCR
products (Quiaquick, Quiagen, Inc.) obtained from the chromosomic
DNA of the mutants were used and sequenced by Genome Express
(Meylan, France).
[0143] The organization of the upstream region of lacZ of the
recombinant clones is shown in FIG. 9. As expected the range of
expression among the different clones of the library was from 4.1
to 18.4 U/mg protein.
Example 4
Creation of a Library of Escherichia coli Clones with Different
Artificial Promoters, Modified Start Codons and Modified RBS Using
a Library of PCR Generated Linear DNA Fragments
[0144] This example describes the deletion of lacI and the
replacement into the Escherichia coli genome of the natural lacZ
(encoding the .beta.-galactosidase) promoter, RBS and start codon
by PCR generated artificial promoters of different strength, RBS
with different binding capacity and start codons of different
efficiency.
a) Design of the Oligonucleotides for the lacZ Promoter
Replacement.
[0145] To generate broader lacZ expression level, a library of
replacement cassettes was designed to remove lacI, replace the
promoter and modify the RBS. A degenerate oligonucleotide in RBS
and in the start codon, lacZRBSR2 was designed with a 60 base
region homologous to lacZ after the start codon and a 40 base
region homologous to the lacR oligonucleotide. TABLE-US-00009
LacZRBS R2 oligonucleotide (SEQ ID NO. 71)
CAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATCCGTA
ATCATGGTCAHAGCTGTYTYCTBYKWGAAATTGTTATCCGCTCACAATTA wherein B is T,
C or G; H is A, T or C; K is T or G; Y is C or T; and W is A or
T.
b) Amplification and Purification of the P.sub.GI Replacement
Cassettes.
[0146] Primers lacZF and lacZR were used to amplify the library of
promoter replacement cassettes using plasmid pKD3 as a template as
described in example 1. Primers LacZF and LacZRSB2R were used to
amplify the library of promoter replacement cassettes with a
modified start codon and a modified RBS using the mixture of PCR
products obtained above as a template. Amplification followed the
procedures of example 1. The 1.15 kb PCR products were purified by
agarose gel electrophoresis followed by QIAquick gel extraction Kit
(QIAGEN).
c) Creation of the Library of Clones with Different Artificial
Promoters with Modified Start Codons and Modified RBS in Front of
the lacZ Genes.
[0147] Transformants carrying Red Helper plasmid (pKD 46) (Datsenko
and Wanner, supra) were grown in 20 ml SOB medium with
carbenicillin (100 mg/l) and L arabinose (10 mM) at 30.degree. C.
to an OD.sub.550 nm of 0.6 and then made electrocompetent by
concentration 100 fold and washed one time with ice water and twice
with ice cold 10% glycerol. Electroporation was done using a Gene
pulse (BioRad--model II apparatus 165-2106) with a voltage booster
and 0.2 cm chambers according to manufactures instructions by using
50 .mu.l of cells and 0.1 to 1.0 .mu.g of the purified PCR products
(as described above). Shocked cells were added to 1 ml SOC medium
incubated 2 hours at 30.degree. C. and then half of the cells were
spread on agar to select Cm.sup.R transformants. Xgal 40 mg/l was
added on the agar plates to evaluate the .beta. galactosidase
expression. If cells did not grow within 24 hours, the remainder
were spread after standing overnight at 30.degree. C.
[0148] d) PCR Verification of the Transformants.
[0149] Mutants were grown overnight on LB medium with 30 mg/l Cm.
1.0 ml of culture was washed with ice cold water and the
chromosomic DNA was recovered in the supernatant after heat
treatment (5 min at 94.degree. C.) of the washed cells.
[0150] The PCR was performed using the chromosomic DNA and a set of
two oligonucleotides, LacseqF and LacseqR as disclosed above in
example 1. Amplification also followed the protocol of example 1. A
1.6 kb PCR product was obtained. The PCR product was digested by
ECORV (1 U/.mu.g of ECORV, 2 hrs at 37 C). The comparison of the
digestion profile of the mutants with the wild-type strain showed
that the ECORV site disappeared with the promoter replacement.
[0151] The sequence of the GI promoter in the different clones was
determined by sequencing the different PCR products with the
lacseqFprimer. 50 .mu.l of column-purified PCR products (Quiaquick,
Quiagen, Inc.) obtained from the chromosomic DNA of the mutants
were used and sequenced by Genome Express (Meylan, France). The
organization of the upstream region of lacZ in four of the
recombinant clones obtained was as expected.
1.6GI--clone 1: start codon--TTG; RBS-TCACAGGAGA;
.beta.-galactosidase activity, 0.28 U/mg;
1.6GI--clone 2: start codon--ATG; RBS-AAGGAGGAA;
.beta.-galactosidase activity, 5.7 U/mg;
1.2GI--clone 3: start codon--ATG; RBS-ACACAGGAAA;
.beta.-galactosidase activity, 0.68 U/mg; and
1.6GI--clone 4: start codon--TTG; RBS-ACACAGAAGA;
.beta.-galactosidase activity, 0.032 U/mg.
[0152] Those skilled in the art will recognize or be able to
ascertain using not more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
* * * * *