U.S. patent application number 11/714689 was filed with the patent office on 2008-03-20 for dihydropyrancarboxamides and uses thereof.
Invention is credited to Zoltan Maliga, Timothy J. Mitchison, Stuart L. Schreiber, Robert A. Stavenger.
Application Number | 20080070916 11/714689 |
Document ID | / |
Family ID | 31997664 |
Filed Date | 2008-03-20 |
United States Patent
Application |
20080070916 |
Kind Code |
A1 |
Schreiber; Stuart L. ; et
al. |
March 20, 2008 |
Dihydropyrancarboxamides and uses thereof
Abstract
The present invention provides novel dihydropyrancarboxamide
compounds of formula (I): ##STR1## and collections of these
compounds, and provides methods for the synthesis of these
compounds; wherein R.sup.1-R.sup.6 are as defined herein.
Additionally, the present invention provides pharmaceutical
compositions and methods for treating disorders such as
proliferative diseases, and cancer, to name a few.
Inventors: |
Schreiber; Stuart L.;
(Boston, MA) ; Stavenger; Robert A.; (Blue Bell,
PA) ; Mitchison; Timothy J.; (Brookline, MA) ;
Maliga; Zoltan; (East Brunswick, NJ) |
Correspondence
Address: |
CHOATE, HALL & STEWART/HARVARD UNIVERSITY
TWO INTERNATIONAL PLACE
BOSTON
MA
02110
US
|
Family ID: |
31997664 |
Appl. No.: |
11/714689 |
Filed: |
March 6, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10649532 |
Aug 27, 2003 |
7186709 |
|
|
11714689 |
Mar 6, 2007 |
|
|
|
60406140 |
Aug 27, 2002 |
|
|
|
Current U.S.
Class: |
514/235.5 ;
506/15; 514/231.5; 514/278; 514/294; 544/143; 544/146; 546/20;
546/96 |
Current CPC
Class: |
C07D 405/14 20130101;
C07D 407/04 20130101; C07D 409/14 20130101; C07D 413/14 20130101;
C07D 471/10 20130101; C07D 471/04 20130101; C07D 309/30 20130101;
C07D 405/04 20130101; C07D 409/04 20130101; A61P 35/00 20180101;
C07D 417/14 20130101 |
Class at
Publication: |
514/235.5 ;
506/015; 514/231.5; 514/278; 514/294; 544/143; 544/146; 546/020;
546/096 |
International
Class: |
A61K 31/438 20060101
A61K031/438; A61K 31/435 20060101 A61K031/435; A61K 31/5377
20060101 A61K031/5377; A61P 35/00 20060101 A61P035/00; C07D 413/14
20060101 C07D413/14; C07D 455/04 20060101 C07D455/04; C07D 471/10
20060101 C07D471/10; C40B 40/04 20060101 C40B040/04 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] This invention was made in part with a grant from the
National Institute of General Medical Sciences (Grant Number:
GM-52067). Therefore, the government has certain rights in the
invention.
Claims
1. A compound having the structure: ##STR106## wherein R.sub.1,
R.sub.2 and R.sub.4 are each independently hydrogen or an
aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety; R.sub.3 is hydrogen or an aliphatic,
heteroaliphatic alkylaryl, heteroaryl or alkylheteroaryl moiety;
R.sub.5 and R.sub.6 are each independently hydrogen or an
aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl, or
alkylheteroaryl moiety, and wherein R.sub.6 and R.sub.7, taken
together, may form a cyclic aliphatic, heteroaliphatic,
aliphatic(aryl), heteroaliphatic(aryl), aliphatic(heteroaryl) or
heteroaliphatic(heteroaryl) moiety, or an aryl or heteroaryl
moiety; wherein each of the foregoing aliphatic and heteroaliphatic
moieties may be substituted or unsubstituted, cyclic or acyclic,
saturated or unsaturated or linear or branched; and each of the
foregoing aryl, heteroaryl, alkylaryl or alkylheteroaryl moieties
may be substituted or unsubstituted; and pharmaceutically
acceptable derivatives thereof.
2. The compound of claim 1, wherein the compound has the structure
(II): ##STR107## wherein R.sub.1, R.sub.2 and R.sub.4 are each
independently hydrogen or an aliphatic, heteroaliphatic, aryl,
heteroaryl, alkylaryl or alkylheteroaryl moiety; R.sub.3 is
hydrogen or an aliphatic, heteroaliphatic, alkylaryl, heteroaryl or
alkylheteroaryl moiety; R.sub.5 and R.sub.6 are each independently
hydrogen or an aliphatic, heteroaliphatic, aryl, heteroaryl,
alkylaryl, or alkylheteroaryl moiety, and wherein R.sub.6 and
R.sub.7, taken together, may form a cyclic aliphatic,
heteroaliphatic, aliphatic(aryl), heteroaliphatic(aryl),
aliphatic(heteroaryl) or heteroaliphatic(heteroaryl) moiety, or an
aryl or heteroaryl moiety; wherein each of the foregoing aliphatic
and heteroaliphatic moieties may be substituted or unsubstituted,
cyclic or acyclic, saturated or unsaturated or linear or branched;
and each of the foregoing aryl, heteroaryl, alkylaryl or
alkylheteroaryl moieties may be substituted or unsubstituted; and
pharmaceutically acceptable derivatives thereof.
3. The compound of claim 1, wherein R.sup.1 is hydrogen or an
alkyl, heteroalkyl, aryl or heteroaryl moiety substituted with Z,
wherein Z is hydrogen, --(CH.sub.2).sub.qOR.sup.Z,
--(CH.sub.2).sub.qSR.sup.Z, --(CH.sub.2).sub.qN(R.sup.Z).sub.2,
--(C.dbd.O)R.sup.Z, --(C.dbd.O)N(R.sup.Z).sub.2, or an aliphatic,
heteroaliphatic, aryl, heteroaryl, -(aliphatic)aryl,
-(aliphatic)heteroaryl, -(heteroaliphatic)aryl, or
-(heteroaliphatic)heteroaryl moiety, wherein q is 0-4, and wherein
each occurrence of R.sup.Z is independently hydrogen, a protecting
group, a solid support unit, or an aliphatic, heteroaliphatic,
aryl, heteroaryl, -(aliphatic)aryl, -(aliphatic)heteroaryl,
-(heteroaliphatic)aryl, or -(heteroaliphatic)heteroaryl moiety;
wherein each of the foregoing alkyl or heteroalkyl moieties may be
substituted or unsubstituted, linear or branched, cyclic or
acyclic, saturated or unsaturated; and wherein each of the
foregoing aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl moieties may be
substituted or unsubstituted.
4. The compound of claim 3, wherein R.sup.1 is hydrogen, lower
alkyl, a substituted or unsubstituted phenyl or -(lower
alkyl)phenyl moiety, --(CH.sub.2).sub.nOR.sup.z,
--[(CH.sub.2).sub.nO].sub.mR.sup.z,
--(CH.sub.2).sub.n--Ar--(CH.sub.2).sub.mOR.sup.z; wherein n and m
are each independently integers from 1-6, Ar represents a
substituted or unsubstituted aryl or heteroaryl moiety, and R.sup.z
is independently hydrogen, a protecting group, a solid support
unit, or an aliphatic, heteroaliphatic, aryl, heteroaryl,
-(aliphatic)aryl, -(aliphatic)heteroaryl, -(heteroaliphatic)aryl,
or -(heteroaliphatic)heteroaryl moiety; wherein each of the
foregoing alkyl or heteroalkyl moieties may be substituted or
unsubstituted, linear or branched, cyclic or acyclic, saturated or
unsaturated; and wherein each of the foregoing aryl, heteroaryl,
-(alkyl)aryl, -(alkyl)heteroaryl, -(heteroalkyl)aryl, or
-(heteroalkyl)heteroaryl moieties may be substituted or
unsubstituted.
5. The compound of claim 4, wherein R.sup.1 is hydrogen, ethyl, or
has one of the structures: ##STR108## wherein R.sup.z is as defined
in claim 4.
6. The compound of claim 1, wherein R.sup.2 is hydrogen or an
alkyl, heteroalkyl, aryl or heteroaryl moiety substituted with Z,
wherein Z is hydrogen, --(CH.sub.2).sub.qOR.sup.Z,
--(CH.sub.2).sub.qSR.sup.Z, --(CH.sub.2).sub.qN(R.sup.Z).sub.2,
--(C.dbd.O)R.sup.Z, --(C.dbd.O)N(R.sup.Z).sub.2, or an aliphatic,
heteroaliphatic, aryl, heteroaryl, -(aliphatic)aryl,
-(aliphatic)heteroaryl, -(heteroaliphatic)aryl, or
-(heteroaliphatic)heteroaryl moiety, wherein q is 0-4, and wherein
each occurrence of R.sup.z is independently hydrogen, a protecting
group, a solid support unit, or an aliphatic, heteroaliphatic,
aryl, heteroaryl, -(aliphatic)aryl, -(aliphatic)heteroaryl,
-(heteroaliphatic)aryl, or -(heteroaliphatic)heteroaryl moiety;
wherein each of the foregoing alkyl or heteroalkyl moieties may be
substituted or unsubstituted, linear or branched, cyclic or
acyclic, saturated or unsaturated; and wherein each of the
foregoing aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl moieties may be
substituted or unsubstituted.
7. The compound of claim 6, wherein R.sup.2 is hydrogen, lower
alkyl, a substituted or unsubstituted phenyl or -(lower
alkyl)phenyl moiety, --(CH.sub.2).sub.nOR.sup.z,
--[(CH.sub.2).sub.nO].sub.mR.sup.z,
--(CH.sub.2).sub.n--Ar--(CH.sub.2).sub.mOR.sup.z; wherein n and m
are each independently integers from 1-6, Ar represents a
substituted or unsubstituted aryl or heteroaryl moiety, and R.sup.z
is independently hydrogen, a protecting group, a solid support
unit, or an aliphatic, heteroaliphatic, aryl, heteroaryl,
-(aliphatic)aryl, -(aliphatic)heteroaryl, -(heteroaliphatic)aryl,
or -(heteroaliphatic)heteroaryl moiety; wherein each of the
foregoing alkyl or heteroalkyl moieties may be substituted or
unsubstituted, linear or branched, cyclic or acyclic, saturated or
unsaturated; and wherein each of the foregoing aryl, heteroaryl,
-(alkyl)aryl, -(alkyl)heteroaryl, -(heteroalkyl)aryl, or
-(heteroalkyl)heteroaryl moieties may be substituted or
unsubstituted.
8. The compound of claim 6, wherein R.sup.2 is hydrogen or has one
of the structures: ##STR109## wherein R.sup.z is as defined in
claim 6.
9. The compound of claim 1, wherein R.sup.3 is an alkyl,
heteroalkyl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl moiety; wherein
each of the foregoing alkyl or heteroalkyl moieties may be
substituted or unsubstituted, linear or branched, cyclic or
acyclic, saturated or unsaturated; and wherein each of the
foregoing heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl moieties may be
substituted or unsubstituted.
10. The compound of claim 9, wherein R.sup.3 has one of the
structures: ##STR110##
11. The compound of claim 1, wherein R.sup.4 is hydrogen or an
alkyl heteroalkyl, aryl, heteroaryl, -(alkyl)aryl,
-(alkyl)heteroaryl, -(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl
moiety; wherein each of the foregoing alkyl or heteroalkyl moieties
may be substituted or unsubstituted, linear or branched, cyclic or
acyclic, saturated or unsaturated; and wherein each of the
foregoing aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl moieties may be
substituted or unsubstituted.
12. The compound of claim 11, wherein R.sup.4 is hydrogen alkyl or
heteroalkyl.
13. The compound of claim 1, wherein R.sup.5 and R.sup.6 are each
independently hydrogen or an alkyl, heteroalkyl, aryl, heteroaryl,
-(alkyl)aryl, -(alkyl)heteroaryl, -(heteroalkyl)aryl, or
-(heteroalkyl)heteroaryl moiety; or wherein R.sup.5 and R.sup.6,
taken together, form a substituted or unsubstituted, saturated or
unsaturated cyclic moiety comprising 5-12 carbon atoms, 0-5 oxygen
atoms, 0-5 sulfur atoms and 1-5 nitrogen atoms; and wherein each of
the foregoing alkyl or heteroalkyl moieties may be substituted or
unsubstituted, linear or branched, cyclic or acyclic, saturated or
unsaturated; and wherein each of the foregoing aryl, heteroaryl,
-(alkyl)aryl, -(alkyl)heteroaryl, -(heteroalkyl)aryl, or
-(heteroalkyl)heteroaryl moieties may be substituted or
unsubstituted.
14. The compound of claim 1, wherein --NR.sup.5R.sup.6 is one of
the following the structures: ##STR111## ##STR112## ##STR113##
15. (canceled)
16. (canceled)
17. (canceled)
18. The compound of claim 1 having the structure: ##STR114##
19. The compound of claim 1 having the structure: ##STR115##
20. The compound of claim 1 having the structure: ##STR116##
21. The compound of claim 1 having the structure: ##STR117##
22. (canceled)
23. A library of compounds comprising a plurality of library
members, wherein at least two library members are a compound of
claim 1.
24. (canceled)
25. (canceled)
26. The library of claim 23, wherein the library comprises at least
100 compounds.
27. The library of claim 23, wherein the library comprises at least
1,000 compounds.
28. The library of claim 23, wherein the library comprises at least
2,000 compounds.
29. The library of claim 23, wherein the library comprises at least
10,000 compounds.
30. A pharmaceutical composition comprising a compound according to
claim 1 and a pharmaceutically acceptable carrier.
31-39. (canceled)
Description
PRIORITY INFORMATION
[0001] The present application claims priority under 35 U.S.C.
.sctn. 119 to U.S. provisional application No. 60/406,140, filed
Aug. 27, 2002, entitled "Dihydropyrancarboxamides and Uses
Thereof", the entire contents of which are hereby incorporated by
reference.
BACKGROUND OF THE INVENTION
[0003] The identification of small organic molecules that affect
specific biological functions is an endeavor that impacts both
biology and medicine. Such molecules are useful as therapeutic
agents and as probes of biological function. In but one example
from the emerging field of chemical genetics, in which small
molecules are used to alter the function of biological molecules to
which they bind, small molecules have helped elucidate signal
transduction pathways by acting as chemical protein knockouts.
(Schreiber et al., J. Am. Chem. Soc., 1990, 112, 5583; Mitchison,
Chem. and Biol., 1994, 1, 3). Of course, small molecules that
interact with particular biological targets and affect specific
biological functions, may also serve as candidates for the
development of therapeutics. One important class of small molecules
are natural products, which are small molecules obtained from
nature. Natural products have played an important role in the
development of biology and medicine, serving as pharmaceutical
leads, drugs (Newman et al., Nat. Prod. Rep. 2000, 17, 215-234),
and powerful reagents for studying cell biology (Schreiber, S. L.
Chem. and Eng News 1992 (October 26), 22-32). More generally, any
organic compounds, whether naturally-occurring, reminiscent of
natural products or artificially created (e.g., via chemical
synthesis or semi-synthesis), are also of interest since they may
serve as candidates for the development of therapeutics.
[0004] Because it is difficult to predict which small molecules
will interact with a biological target, and it is often difficult
to obtain or efficiently synthesize small molecules found in
nature, intense efforts have been directed toward the generation of
large numbers, or libraries, of small organic compounds, often
"natural product-like" libraries. These libraries can be tested in
sensitive assays for a particular biological activity, such as
binding to a target of interest.
[0005] Clearly, it would be desirable to develop compounds with a
desired biological activity. Additionally, it would be desirable to
identify novel compounds capable of acting as probes of biological
function.
SUMMARY OF THE INVENTION
[0006] In one aspect of the invention, novel compounds having the
structure (1) are provided: ##STR2##
[0007] wherein R.sup.1-R.sup.4 are each independently hydrogen or
an aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety;
[0008] R.sup.5 and R.sup.6 are each independently hydrogen or an
aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl, or
alkylheteroaryl moiety, and wherein R.sup.5 and R.sup.6, taken
together, may form a cyclic aliphatic, heteroaliphatic,
aliphatic(aryl), heteroaliphatic(aryl), aliphatic(heteroaryl) or
heteroaliphatic(heteroaryl) moiety, or an aryl or heteroaryl
moiety;
[0009] wherein each of the foregoing aliphatic and heteroaliphatic
moieties may be substituted or unsubstituted, cyclic or acyclic,
saturated or unsaturated or linear or branched; and each of the
foregoing aryl, heteroaryl, alkylaryl or alkylheteroaryl moieties
may be substituted or unsubstituted; and
[0010] pharmaceutically acceptable derivatives thereof.
[0011] In certain embodiments, compounds having the structure (II)
are provided: ##STR3##
[0012] or enantiomer thereof;
[0013] wherein R.sup.1-R.sup.4 are each independently hydrogen or
an aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety;
[0014] R.sup.5 and R.sup.6 are each independently hydrogen or an
aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl, or
alkylheteroaryl moiety, and wherein R.sup.5 and R.sup.6, taken
together, may form a cyclic aliphatic, heteroaliphatic,
aliphatic(aryl), heteroaliphatic(aryl), aliphatic(heteroaryl) or
heteroaliphatic(heteroaryl) moiety, or an aryl or heteroaryl
moiety;
[0015] wherein each of the foregoing aliphatic and heteroaliphatic
moieties may be substituted or unsubstituted, cyclic or acyclic,
saturated or unsaturated or linear or branched; and each of the
foregoing aryl, heteroaryl, alkylaryl or alkylheteroaryl moieties
may be substituted or unsubstituted; and
[0016] pharmaceutically acceptable derivatives thereof.
[0017] In yet other embodiments, a collection of compounds
comprising two or more of the compounds of structures (I) or (II)
is provided. In certain embodiments, the collection is provided in
array format. In yet other embodiments, the collection is provided
in array format on a glass slide. In still other embodiments, the
collection comprises at least 100 compounds. In yet other
embodiments, the collection comprises at least 1,000 compounds. In
still further embodiments, the collection comprises at least 2,000
compounds. In yet other embodiments, the collection comprises at
least 10,000 compounds.
[0018] In another aspect of the invention, a method for the
synthesis of the core structure (III) is provided, one method
comprising steps of:
[0019] providing a vinyl ether having the structure: ##STR4##
[0020] providing an unsaturated ketoester having the structure:
##STR5##
[0021] subjecting the vinyl ether and the unsaturated ketoester to
suitable conditions to generate a scaffold having the core
structure: ##STR6##
[0022] wherein R.sup.1 and R.sup.2 are each independently hydrogen
or an aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety; wherein one of R.sup.1 or R.sup.2 is
attached to a solid support;
[0023] R.sup.3 and R.sup.4 are each independently hydrogen or an
aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety;
[0024] R.sup.A is hydrogen or is an aliphatic, heteroaliphatic,
aryl, heteroaryl, alkylaryl, or alkylheteroaryl moiety;
[0025] wherein each of the foregoing aliphatic and heteroaliphatic
moieties may be substituted or unsubstituted, cyclic or acyclic,
saturated or unsaturated or linear or branched; and each of the
foregoing aryl, heteroaryl, alkylaryl or alkylheteroaryl moieties
may be substituted or unsubstituted.
[0026] In certain embodiments, the method further comprises
cleaving the core structure (III) from the solid support to which
it is attached.
[0027] In certain embodiments, the method further comprises
subjecting the core structure (III) to one or more diversification
reactions to generate one or more compounds having the structure
(I): ##STR7##
[0028] wherein R.sup.1 and R.sup.6 are as defined above.
[0029] In certain embodiments, the method further comprises
cleaving the core structure (I) from the solid support to which it
is attached.
[0030] In yet another aspect of the invention, pharmaceutical
compositions are provided comprising any one of the compounds
described above and herein; and a pharmaceutically acceptable
carrier or diluent.
[0031] In still another aspect of the invention, methods of
treating a variety of disorders are provided comprising
administering a therapeutically effective compound or composition
thereof to a subject in need thereof. In certain other embodiments,
the inventive compounds are utilized to treat proliferative
disorders, including, but not limited to cancer.
[0032] In yet another aspect of the present invention, methods of
screening compounds for identifying those inventive compounds that
exhibit a biological activity of interest are provided.
DEFINITIONS
[0033] This invention provides a new family of compounds with a
range of biological properties. Compounds of this invention have
biological activities relevant for the treatment of diseases
including proliferative diseases such as cancer. Compounds of this
invention include those specifically set forth above and described
herein, and are illustrated in part by the various classes,
subgenera and species disclosed elsewhere herein.
[0034] It will be appreciated by one of ordinary skill in the art
that asymmetric centers may exist in the compounds of the present
invention. Thus, inventive compounds and pharmaceutical
compositions thereof may be in the form of an individual
enantiomer, diastereomer or geometric isomer, or may be in the form
of a mixture of stereoisomers. In certain embodiments, the
compounds of the invention are enantiopure compounds. In certain
other embodiments, a mixtures of stereoisomers or diastereomers are
provided.
[0035] Additionally, the present invention provides
pharmaceutically acceptable derivatives of the inventive compounds,
and methods of treating a subject using these compounds,
pharmaceutical compositions thereof, or either of these in
combination with one or more additional therapeutic agents. The
phrase, "pharmaceutically acceptable derivative", as used herein,
denotes any pharmaceutically acceptable salt, ester, or salt of
such ester, of such compound, or any other adduct or derivative
which, upon administration to a patient, is capable of providing
(directly or indirectly) a compound as otherwise described herein,
or a metabolite or residue thereof. Pharmaceutically acceptable
derivatives thus include among others pro-drugs. A pro-drug is a
derivative of a compound, usually with significantly reduced
pharmacological activity, which contains an additional moiety which
is susceptible to removal in vivo yielding the parent molecule as
the pharmacologically active species. An example of a pro-drug is
an ester which is cleaved in vivo to yield a compound of interest.
Pro-drugs of a variety of compounds, and materials and methods for
derivatizing the parent compounds to create the pro-drugs, are
known and may be adapted to the present invention. Certain
exemplary pharmaceutical compositions and pharmaceutically
acceptable derivatives will be discussed in more detail below.
[0036] Certain compounds of the present invention, and definitions
of specific functional groups are also described in more detail
below. For purposes of this invention, the chemical elements are
identified in accordance with the Periodic Table of the Elements,
CAS version, Handbook of Chemistry and Physics, 75th Ed., inside
cover, and specific functional groups are generally defined as
described therein. Additionally, general principles of organic
chemistry, as well as specific functional moieties and reactivity
are described in "Organic Chemistry", Thomas Sorrell, University
Science Books, Sausalito: 1999, the entire contents of which are
incorporated herein by reference. Furthermore, it will be
appreciated by one of ordinary skill in the art that the synthetic
methods, as described herein, may utilize a variety of protecting
groups. By the term "protecting group", has used herein, it is
meant that a particular functional moiety, e.g., O, S, or N, is
temporarily blocked so that a reaction can be carried out
selectively at another reactive site in a multifunctional compound.
In preferred embodiments, a protecting group reacts selectively in
good yield to give a protected substrate that is stable to the
projected reactions; the protecting group should be selectively
removed in good yield by readily available, preferably nontoxic
reagents that do not attack the other functional groups; the
protecting group forms an easily separable derivative (more
preferably without the generation of new stereogenic centers); and
the protecting group has a minimum of additional functionality to
avoid further sites of reaction. As detailed herein, oxygen,
sulfur, nitrogen and carbon protecting groups may be utilized.
Exemplary protecting groups are detailed herein, however, it will
be appreciated that the present invention is not intended to be
limited to these protecting groups; rather, a variety of additional
equivalent protecting groups can be readily identified using the
above criteria and utilized in the method of the present invention.
Additionally, a variety of protecting groups are described in
"Protective Groups in Organic Synthesis" Third Ed. Greene, T. W.
and Wuts, P. G., Eds., John Wiley & Sons, New York: 1999, the
entire contents of which are hereby incorporated by reference.
[0037] It will be appreciated that the compounds described herein,
may be substituted with any number of substituents or functional
moieties. In general, the term "substituted" whether preceded by
the term "optionally" or not, and substituents contained in
formulas of this invention, refer to the replacement of hydrogen
radicals in a given structure with the radical of a specified
substituent. When more than one position in any given structure may
be substituted with more than one substituent selected from a
specified group, the substituent may be either the same or
different at every position unless otherwise indicated. As used
herein, the term "substituted" is contemplated to include all
permissible substituents of organic compounds. In a broad aspect,
the permissible substituents include acyclic and cyclic, branched
and unbranched, carbocyclic and heterocyclic, aromatic and
nonaromatic substituents of organic compounds. For purposes of this
invention, heteroatoms such as nitrogen may have hydrogen
substituents and/or any permissible substituents of organic
compounds described herein which satisfy the valencies of the
heteroatoms. Furthermore, this invention is not intended to be
limited in any manner by the permissible substituents of organic
compounds. Combinations of substituents and variables envisioned by
this invention are preferably those that result in the formation of
stable compounds useful in the treatment, for example, of
proliferative disorders, cancer, and wound healing, to name a few.
The term "stable", as used herein, preferably refers to compounds
which possess stability sufficient to allow manufacture and which
maintain the integrity of the compound for a sufficient period of
time to be detected and preferably for a sufficient period of time
to be useful for the purposes detailed herein.
[0038] The term "aliphatic", as used herein, includes both
saturated and unsaturated, straight chain (i.e., unbranched),
branched, cyclic, or polycyclic aliphatic hydrocarbons, which are
optionally substituted with one or more functional groups. As will
be appreciated by one of ordinary skill in the art, "aliphatic" is
intended herein to include, but is not limited to, alkyl, alkenyl,
alkynyl, cycloalkyl, cycloalkenyl, and cycloalkynyl moieties. Thus,
as used herein, the term "alkyl" includes both straight, branched
and cyclic alkyl groups. An analogous convention applies to other
generic terms such as "alkenyl", "alkynyl" and the like.
Furthermore, as used herein, the terms "alkyl", "alkenyl",
"alkynyl" and the like encompass both substituted and unsubstituted
groups.
[0039] In certain embodiments, the alkyl, alkenyl and alkynyl
groups employed in the invention contain 1-20 aliphatic carbon
atoms. In certain other embodiments, the alkyl, alkenyl, and
alkynyl groups employed in the invention contain 1-10 aliphatic
carbon atoms. In still other embodiments, the alkyl, alkenyl, and
alkynyl groups employed in the invention contain 1-6 aliphatic
carbon atoms. In yet other embodiments, the alkyl, alkenyl, and
alkynyl groups employed in the invention contain 1-4 aliphatic
carbon atoms. Illustrative aliphatic groups thus include, but are
not limited to, for example, methyl, ethyl, n-propyl, isopropyl,
cyclopropyl, --CH.sub.2-cyclopropyl, allyl, n-butyl, sec-butyl,
isobutyl, tert-butyl, cyclobutyl, --CH.sub.2-cyclobutyl, n-pentyl,
sec-pentyl, isopentyl, tert-pentyl, cyclopentyl,
--CH.sub.2-cyclopentyl, n-hexyl, sec-hexyl, cyclohexyl,
--CH.sub.2-cyclohexyl moieties and the like, which again, may bear
one or more substituents. Alkenyl groups include, but are not
limited to, for example, ethenyl, propenyl, butenyl,
1-methyl-2-buten-1-yl, and the like. Representative alkynyl groups
include, but are not limited to, ethynyl, 2-propynyl(propargyl),
1-propynyl and the like.
[0040] The term "alkoxy", or "thioalkyl" as used herein refers to
an alkyl group, as previously defined, attached to the parent
molecular moiety through an oxygen atom or through a sulfur atom.
In certain embodiments, the alkyl group contains 1-20 alipahtic
carbon atoms. In certain other embodiments, the alkyl group
contains 1-10 aliphatic carbon atoms. In still other embodiments,
the alkyl group contains 1-6 aliphatic carbon atoms. In yet other
embodiments, the alkyl group contains 1-4 aliphatic carbon atoms.
Examples of alkoxy, include but are not limited to, methoxy,
ethoxy, propoxy, isopropoxy, n-butoxy, tert-butoxy, neopentoxy and
n-hexoxy. Examples of thioalkyl include, but are not limited to,
methylthio, ethylthio, propylthio, isopropylthio, n-butylthio, and
the like.
[0041] The term "alkylamino" refers to a group having the structure
--NHR' wherein R' is alkyl, as defined herein. In certain
embodiments, the alkyl group contains 1-20 aliphatic carbon atoms.
In certain other embodiments, the alkyl group contains 1-10
aliphatic carbon atoms. In still other embodiments, the alkyl group
contains 1-6 aliphatic carbon atoms. In yet other embodiments, the
alkyl group contains 1-4 aliphatic carbon atoms. Examples of
alkylamino include, but are not limited to, methylamino,
ethylamino, iso-propylamino and the like.
[0042] Some examples of substituents of the above-described
aliphatic (and other) moieties of compounds of the invention
include, but are not limited to aliphatic; heteroaliphatic; aryl;
heteroaryl; alkylaryl; alkylheteroaryl; alkoxy; aryloxy;
heteroalkoxy; heteroaryloxy; alkylthio; arylthio; heteroalkylthio;
heteroarylthio; F; Cl; Br; I; --OH; --NO.sub.2; --CN; --CF.sub.3;
--CH.sub.2CF.sub.3; --CHCl.sub.2; --CH.sub.2OH;
--CH.sub.2CH.sub.2OH; --CH.sub.2NH.sub.2;
--CH.sub.2SO.sub.2CH.sub.3; --C(O)R.sub.x; --CO.sub.2(R.sub.x);
--CON(R.sub.x).sub.2; --OC(O)R.sub.x; --OCO.sub.2R.sub.x;
--OCON(R.sub.x).sub.2; --N(R.sub.x).sub.2; --S(O).sub.2R.sub.x;
wherein each occurrence of R.sub.x independently includes, but is
not limited to, aliphatic, heteroaliphatic, aryl, heteroaryl,
alkylaryl, or alkylheteroaryl, wherein any of the aliphatic,
heteroaliphatic, alkylaryl, or alkylheteroaryl substituents
described above and herein may be substituted or unsubstituted,
branched or unbranched, cyclic or acyclic, and wherein any of the
aryl or heteroaryl substituents described above and herein may be
substituted or unsubstituted. Additional examples of generally
applicable substituents are illustrated by the specific embodiments
shown in the Examples which are described herein.
[0043] In general, the terms "aryl" and "heteroaryl", as used
herein, refer to stable mono- or polycyclic, heterocyclic,
polycyclic, and polyheterocyclic unsaturated moieties having
preferably 3-14 carbon atoms, each of which may be substituted or
unsubstituted. Substituents include, but are not limited to, any of
the previously mentioned substitutents, i.e., the substituents
recited for aliphatic moieties, or for other moieties as disclosed
herein, resulting in the formation of a stable compound. In certain
embodiments of the present invention, "aryl" refers to a mono- or
bicyclic carbocyclic ring system having one or two aromatic rings
including, but not limited to, phenyl, naphthyl,
tetrahydronaphthyl, indanyl, indenyl and the like. In certain
embodiments of the present invention, the term "heteroaryl", as
used herein, refers to a cyclic aromatic radical having from five
to ten ring atoms of which one ring atom is selected from S, O and
N; zero, one or two ring atoms are additional heteroatoms
independently selected from S, O and N; and the remaining ring
atoms are carbon, the radical being joined to the rest of the
molecule via any of the ring atoms, such as, for example, pyridyl,
pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl,
oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl,
furanyl, quinolinyl, isoquinolinyl, and the like.
[0044] It will be appreciated that aryl and heteroaryl groups
(including bicyclic aryl groups) can be unsubstituted or
substituted, wherein substitution includes replacement of one, two
or three of the hydrogen atoms thereon independently with any one
or more of the following moieties including, but not limited to:
aliphatic; heteroaliphatic; aryl; heteroaryl; alkylaryl;
alkylheteroaryl; alkoxy; aryloxy; heteroalkoxy; heteroaryloxy;
alkylthio; arylthio; heteroalkylthio; heteroarylthio; F; Cl; Br; I;
--OH; --NO.sub.2; --CN; --CF.sub.3; --CH.sub.2CF.sub.3;
--CHCl.sub.2; --CH.sub.2OH; --CH.sub.2CH.sub.2OH;
--CH.sub.2NH.sub.2; --CH.sub.2SO.sub.2CH.sub.3; --C(O)R.sub.x;
--CO.sub.2(R.sub.x); --CON(R.sub.x).sub.2; --OC(O)R.sub.x;
--OCO.sub.2R.sub.x; --OCON(R.sub.x).sub.2; --N(R.sub.x).sub.2;
--S(O).sub.2R.sub.x; wherein each occurrence of R.sub.x
independently includes, but is not limited to, aliphatic,
heteroaliphatic, aryl, heteroaryl, alkylaryl, or alkylheteroaryl,
wherein any of the aliphatic, heteroaliphatic, alkylaryl, or
alkylheteroaryl substituents described above and herein may be
substituted or unsubstituted, branched or unbranched, cyclic or
acyclic, and wherein any of the aryl or heteroaryl substituents
described above and herein may be substituted or unsubstituted.
Additional examples of generally applicable substitutents are
illustrated by the specific embodiments shown in the Examples which
are described herein.
[0045] The term "cycloalkyl", as used herein, refers specifically
to groups having three to seven, preferably three to ten carbon
atoms. Suitable cycloalkyls include, but are not limited to
cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and
the like, which, as in the case of other aliphatic, heteroaliphatic
or heterocyclic moieties, may optionally be substituted with
substituents including, but not limited to aliphatic;
heteroaliphatic; aryl; heteroaryl; alkylaryl; alkylheteroaryl;
alkoxy; aryloxy; heteroalkoxy; heteroaryloxy; alkylthio; arylthio;
heteroalkylthio; heteroarylthio; F; Cl; Br; I; --OH; --NO.sub.2;
--CN; --CF.sub.3; --CH.sub.2CF.sub.3; --CHCl.sub.2; --CH.sub.2OH;
--CH.sub.2CH.sub.2OH; --CH.sub.2NH.sub.2;
--CH.sub.2SO.sub.2CH.sub.3; --C(O)R.sub.x; --CO.sub.2(R.sub.x);
--CON(R.sub.x).sub.2; --OC(O)R.sub.x; --OCO.sub.2R.sub.x;
--OCON(R.sub.x).sub.2; --N(R.sub.x).sub.2; --S(O).sub.2R.sub.x;
wherein each occurrence of R.sub.x independently includes, but is
not limited to, aliphatic, heteroaliphatic, aryl, heteroaryl,
alkylaryl, or alkylheteroaryl, wherein any of the aliphatic,
heteroaliphatic, alkylaryl, or alkylheteroaryl substituents
described above and herein may be substituted or unsubstituted,
branched or unbranched, cyclic or acyclic, and wherein any of the
aryl or heteroaryl substituents described above and herein may be
substituted or unsubstituted. Additional examples of generally
applicable substitutents are illustrated by the specific
embodiments shown in the Examples which are described herein.
[0046] The term "heteroaliphatic", as used herein, refers to
aliphatic moieties which contain one or more oxygen, sulfur,
nitrogen, phosphorous or silicon atoms, e.g., in place of carbon
atoms. Heteroaliphatic moieties may be branched, unbranched or
cyclic and include saturated and unsaturated heterocycles such as
morpholino, pyrrolidinyl, etc. In certain embodiments,
heteroaliphatic moieties are substituted by independent replacement
of one or more of the hydrogen atoms thereon with one or more
moieties including, but not limited to aliphatic; heteroaliphatic;
aryl; heteroaryl; alkylaryl; alkylheteroaryl; alkoxy; aryloxy;
heteroalkoxy; heteroaryloxy; alkylthio; arylthio; heteroalkylthio;
heteroarylthio; F; Cl; Br; I; --OH; --NO.sub.2; --CN; --CF.sub.3;
--CH.sub.2CF.sub.3; --CHCl.sub.2; --CH.sub.2OH;
--CH.sub.2CH.sub.2OH; --CH.sub.2NH.sub.2;
--CH.sub.2SO.sub.2CH.sub.3; --C(O)R.sub.x; --CO.sub.2(R.sub.x);
--CON(R.sub.x).sub.2; --OC(O)R.sub.x; --OCO.sub.2R.sub.x;
--OCON(R.sub.x).sub.2; --N(R.sub.x).sub.2; --S(O).sub.2R.sub.x;
wherein each occurrence of R.sub.x independently includes, but is
not limited to, aliphatic, heteroaliphatic, aryl, heteroaryl,
alkylaryl, or alkylheteroaryl, wherein any of the aliphatic,
heteroaliphatic, alkylaryl, or alkylheteroaryl substituents
described above and herein may be substituted or unsubstituted,
branched or unbranched, cyclic or acyclic, and wherein any of the
aryl or heteroaryl substituents described above and herein may be
substituted or unsubstituted. Additional examples of generally
applicable substitutents are illustrated by the specific
embodiments shown in the Examples which are described herein.
[0047] The terms "halo" and "halogen" as used herein refer to an
atom selected from fluorine, chlorine, bromine and iodine.
[0048] The term "haloalkyl" denotes an alkyl group, as defined
above, having one, two, or three halogen atoms attached thereto and
is exemplified by such groups as chloromethyl, bromoethyl,
trifluoromethyl, and the like.
[0049] The term "heterocycloalkyl" or "heterocycle", as used
herein, refers to a non-aromatic 5-, 6- or 7-membered ring or a
polycyclic group, including, but not limited to a bi- or tri-cyclic
group comprising fused six-membered rings having between one and
three heteroatoms independently selected from oxygen, sulfur and
nitrogen, wherein (i) each 5-membered ring has 0 to 1 double bonds
and each 6-membered ring has 0 to 2 double bonds, (ii) the nitrogen
and sulfur heteroatoms may be optionally be oxidized, (iii) the
nitrogen heteroatom may optionally be quaternized, and (iv) any of
the above heterocyclic rings may be fused to a benzene ring.
Representative heterocycles include, but are not limited to,
pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl,
imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl,
isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, and
tetrahydrofuryl. In certain embodiments, a "substituted
heterocycloalkyl or heterocycle" group is utilized and as used
herein, refers to a heterocycloalkyl or heterocycle group, as
defined above, substituted by the independent replacement of one,
two or three of the hydrogen atoms thereon with but are not limited
to aliphatic; heteroaliphatic; aryl; heteroaryl; alkylaryl;
alkylheteroaryl; alkoxy; aryloxy; heteroalkoxy; heteroaryloxy;
alkylthio; arylthio; heteroalkylthio; heteroarylthio; F; Cl; Br; I;
--OH; --NO.sub.2; --CN; --CF.sub.3; --CH.sub.2CF.sub.3;
--CHCl.sub.2; --CH.sub.2OH; --CH.sub.2CH.sub.2OH;
--CH.sub.2NH.sub.2; --CH.sub.2SO.sub.2CH.sub.3; --C(O)R.sub.x;
--CO.sub.2(R.sub.x); --CON(R.sub.x).sub.2; --OC(O)R.sub.x;
--OCO.sub.2R.sub.x; --OCON(R.sub.x).sub.2; --N(R.sup.x).sub.2;
--S(O).sub.2R.sub.x; wherein each occurrence of R.sub.x
independently includes, but is not limited to, aliphatic,
heteroaliphatic, aryl, heteroaryl, alkylaryl, or alkylheteroaryl,
wherein any of the aliphatic, heteroaliphatic, alkylaryl, or
alkylheteroaryl substituents described above and herein may be
substituted or unsubstituted, branched or unbranched, cyclic or
acyclic, and wherein any of the aryl or heteroaryl substituents
described above and herein may be substituted or unsubstituted.
Additional examples of generally applicable substitutents are
illustrated by the specific embodiments shown in the Examples which
are described herein.
[0050] The term "solid support", as used herein, refers to a
material having a rigid or semi-rigid surface. Such materials will
preferably take the form of small beads, pellets, disks, chips,
dishes, multi-well plates, glass slides, wafers, or the like,
although other forms may be used. In some embodiments, at least one
surface of the substrate will be substantially flat. The term
"surface" refers to any generally two-dimensional structure on a
solid substrate and may have steps, ridges, kinks, terraces, and
the like without ceasing to be a surface.
[0051] The term "polymeric support", as used herein, refers to a
soluble or insoluble polymer to which an amino acid or other
chemical moiety can be covalently bonded by reaction with a
functional group of the polymeric support. Many suitable polymeric
supports are known, and include soluble polymers such as
polyethylene glycols or polyvinyl alcohols, as well as insoluble
polymers such as polystyrene resins. A suitable polymeric support
includes functional groups such as those described below. A
polymeric support is termed "soluble" if a polymer, or a
polymer-supported compound, is soluble under the conditions
employed. However, in general, a soluble polymer can be rendered
insoluble under defined conditions. Accordingly, a polymeric
support can be soluble under certain conditions and insoluble under
other conditions.
[0052] The term "linker", as used herein, refers to a chemical
moiety utilized to attach a compound of interest to a solid support
to facilitate synthesis of inventive compounds. Exemplary linkers
are described in Example 2, as described herein. It will be
appreciated that other linkers (including silicon-based linkers and
other linkers) that are known in the art can also be employed for
the synthesis of the compounds of the invention.
BRIEF DESCRIPTION OF THE DRAWING
[0053] FIG. 1 depicts an exemplary synthesis of the inventive
dihydropyrancarboxamides.
[0054] FIG. 2 depicts an exemplary encoded split-pool synthesis of
dihydropyrancarboxamides, with the (S)-1 catalyst. The
corresponding opposite enantiomers of compounds 7-15 are obtained
when the (R)-1 catalyst is used. Encircled R.sup.1 and R.sup.2
symbols represent elements found in building blocks BB1-A-H in FIG.
3. PyBOP=benzotriazol-1-yloxytripyrrolidinophosphonium
hexafluorophosphate, DMF=N,N-dimethylformamide,
THF=tetrahydrofuran.
[0055] FIG. 3 depicts building blocks for the inventive
dihydropyrancarboxamide libraries.
[0056] FIG. 4 depicts four bright-field microscopy images of
silicon-functionalized polystyrene resins that have been subjected
to different washing and drying experiments as described in the
text: (a) an image of "reference beads"; (b) an image of "gentle
conditions"; (c) an image of "best practice" beads; (d) a magnified
image of a typical broken bead found in the "damaged beads".
[0057] FIG. 5 depicts a graphical representation of the
optimization of diazoketone tag and rhodium catalyst 5
concentration in encoding reactions.
[0058] FIG. 6A depicts a graph of quantitative GC data for encoding
test resin 6 with Tags C3Cl3, C3Cl5, C9Cl5, and C16Cl5 with various
tag pre-soaking times. Encoding conditions: 2 h reaction time after
addition of Tags or catalyst 5, 25.degree. C. Decoding conditions:
0.25 M CAN (1:1 THF/H.sub.2O), 2 h, 25.degree. C., 1 min
sonication, 1 .mu.L N,O-bis(trimethylsilyl)aceteamide (BSA). Each
data point is an average of 10 identical experiments with
individual beads.
[0059] FIG. 6B depicts a graph of quantitative GC data for a time
course experiment for encoding test resin 6 with Tags C3Cl3, C3Cl5,
C9Cl5, and C16Cl5. Encoding conditions: pre-soak with Tags 45 min
prior to addition of catalyst 5, quench reactions by the addition
of 5 .mu.L heptylamine. Decoding conditions: 0.24 M CAN (5:1
THF/H.sub.2O), 21 h, 37.degree. C., 1 min sonication, 1 .mu.L 1:1
BSA/decane. Each data point is an average of 10 identical
experiments with individual beads.
[0060] FIG. 6C depicts a graph of quantitative GC data for the
decoding one bead of test resin 6 before compound cleavage, after
compound cleavage, or from 100% of the cleaved compound. Encoding
conditions: 45 min tag pre-soak prior to addition of catalyst 5, 2
h, 25.degree. C. Decoding conditions: 0.25 M CAN (1:1
THF/H.sub.2O), 2 h, 25.degree. C., 1 min sonication, 1 .mu.L BSA.
Each data point is an average of 10 identical experiments with
individual beads.
[0061] FIG. 6D depicts a graph of quantitative GC data for a time
course experiment for decoding test resin 7. Decoding conditions:
0.25 M CAN (1:1 THF/H.sub.2O), 25.degree. C., 1 min sonication, 1
.mu.L 1:1 BSA:decane. Each data point is an average of 10 identical
experiments with individual beads.
[0062] FIG. 6E depicts a graph of quantitative GC data for decoding
test resin 7 at various temperatures. Reactions stored at room
temperature, placed in a 37.degree. C. incubator, or placed in a
60.degree. C. oven. Decoding conditions: 0.25 M CAN (1:1
THF/H.sub.2O), 2 h, 1 min sonication, 1 .mu.L 1:1 BSA:decane. Each
data point is an average of 10 identical experiments with
individual beads.
[0063] FIG. 6F depicts a graph of quantitative GC data for the
decoding of test resin 7 with varying CAN solution concentrations
and solvent compositions. Decoding conditions: 21 h, 37.degree. C.,
1 min sonication, 1 .mu.L 1:1 BSA:decane. Each data point is an
average of 10 identical experiments with individual beads.
[0064] FIG. 6G depicts a graph of quantitative GC data for
subjection of decoding test resin 7 to various time periods of
sonication after CAN cleavage. Decoding conditions: 0.25 M CAN (1:1
THF/H.sub.2O), 2 h, 25.degree. C., 1 .mu.L 1:1 BSA:decane. Each
data point is an average of 10 identical experiments with
individual beads.
[0065] FIG. 6H depicts a graph of quantitative GC data for
subjection of Tag alcohols cleaved from decoding test resin 7 to
various amounts of BSA/decane solutions prior to GC analyses.
Decoding conditions: 0.24 M CAN (5:1 THF/H.sub.2O), 21 h,
37.degree. C., 1 min sonication. Each data point is an average of
10 identical experiments with individual beads.
[0066] FIG. 6I depicts a graph of quantitative GC data for the
decoding of test resin 7 using either our optimized decoding
protocol for 500-600 .mu.m polystyrene beads or the decoding
protocol reported by the Pharmacopeia Company for 90 .mu.m TentaGel
(See Dolle, R. E.; Guo, J.; O'Brien, L.; Jin, Y.; Piznik, M.;
Bowman, K. J.; Li, W.; Ehan, W. I.; Carvallaro, C.; Roughton, A.
L.; Zhao, Q.; Reader, J. C.; Orlowski, M.; Jacob-Samuel, B.;
Carroll, C. D. J. Comb. Chem. 2000, 2, 716-731). Each data point is
an average of 10 identical experiments with individual beads.
[0067] FIG. 7 depicts purity data determined by LC/MS for the 108
representative compounds cleaved from library 12, as described in
Example 2 herein.
[0068] FIGS. 8A-8D depicts structures of the 54 compounds cleaved
from beads chosen from batches of resin exposed to the S--Cu (II)
catalyst in library 12, as described in Example 2 herein. Numbers
in bold refer to bead number. Except for compound 105, all
structures showed agreement between GC decoding and MS data.
[0069] FIGS. 9A and 9B depict representative examples of GC (a, b),
LC (c, d), and MS (e, f) spectra from bead and stock-solution
decoding (samples 12 and 48, respectively), as described in Example
2 herein. The bead-decoding GC trace for sample 12 (a) decodes for
a library compound with an exact mass identical to that obtained by
MS (e) of the compound cleaved from that bead (APCI, observed
mass=479.9 [M+1]). The stock-solution-decoding GC trace for sample
48 (b) decodes for a library compound with an exact mass identical
to that obtained by MS (f) of the compound stock solution (APCI,
observed mass=626.8 [M+1]). The single peaks in the LC spectra (c,
d) correspond to these molecular ions. [The starred peak (*) in the
GC traces (a, b) is an impurity frequently present with the
electrophoric tags.]
[0070] FIG. 10 outlines an exemplary embodiment of the invention: a
`one-bead, one-stock solution` technology platform directed toward
chemical genetics. DVB=divinylbenzene.
[0071] FIG. 11 depicts an overview of exemplary library formatting
and annotation screening.
[0072] FIG. 12 depicts a bead arrayer. The bead arrayer is (a)
attached to standard nitrogen and vacuum lines. Vacuum is applied
and beads are (b) decanted onto the platform for entrainment by 384
depressions. Excess beads are recovered, leaving (c) a regular
array of 384 beads with identical spacing to a standard 384-well
microtiter plate.
[0073] FIG. 13 depicts a representative reverse chemical genetic
assay, as described in Example 3 herein. A small molecule
microarray containing members of 10 was probed with purified
Cy5-labeled (His)6-FKBP12. a: Fluorescence intensity at duplicate
spots (false-colored red) containing a `hit` is shown compared to a
rhodamine control spot (false-colored green). b: The structure of
the `hit` (11) was determined by bead decoding and confirmed by
LC/MS.
[0074] FIG. 14 depicts representative forward chemical genetic
assays as described in Example 3 herein. Human A549 cells were
exposed in duplicate to stock solutions of 10. `Hits` (gray boxes)
are those wells that scored in both replicates of a given
experiment. Data from 48 representative wells are shown as
multiplicative overlays of cytoblot results from (a) a BrdU
incorporation assay, and (b) a genistein suppressor screen. c:
Structures of representative `hits`. Beads or stock solutions
corresponding to `hits` in cytoblot assays were exposed to the
optimized decoding protocol described in the preceding paper in
this issue. Compounds are labeled by well position in the assay
plates.
[0075] FIG. 15 depicts an exemplary inventive compound identified
in an Eg5 inhibitor assay, as described in Example 3 herein.
[0076] FIGS. 16A-16D depict LC traces from 25 inventive livrary
members (e.g., quality control compounds).
[0077] FIGS. 17A-17C depict MS traces corresponding to the LC
traces of FIGS. 16A-16D.
[0078] FIG. 18 depicts exemplary raw data from protein-binding
experiments described in Example 3. FIG. 18A depicts the array from
"plate 0" probed with FKBP-Cy5. FIGS. 18B and 18C depict the array
from "Plate 1" probed with FKBP-GST (red channel only). FIGS. 18D
and 18E depict the array from "Plate 1" probed with FKBP-GST (red
and green channels).
[0079] FIG. 19 depicts exemplary raw data from BrdU Cytoblot
(cell-based assay) experiments described in Example 3. FIGS. 19A
and 19B depict replicate assays of "Plate 0" by the BrdU cytoblot
assay. FIGS. 19C and 19D depict replicate assays of "Plate 1" by
the BrdU cytoblot assay. FIGS. 19E and 19F depict multiplicative
overlays of the replicate "Plate 0" and "Plate 1" assays depicted
in FIGS. 19A-B and FIGS. 19C-D, respectively.
[0080] FIG. 20 depicts results of an exemplary genistein suppressor
assay, as described in Example 3. FIGS. 20A and 20B represent
duplicate assays of "Plate 1".
[0081] FIG. 21A depicts a 384-well-plate from a BrdU incorporation
inhibition assay, identifying wells containing compounds inhibiting
BrdU incorporation in cells.
[0082] FIG. 21B depicts a 384-well-plate from a Genistein
suppression assay, identifying wells containing compounds than can
suppress the ability of genistein to inhibit BrdU
incorporation.
[0083] FIG. 22 depicts an example of LC and MS results from "hits"
generated from cytoblot assay of exemplary inventive compounds.
[0084] FIG. 23 depicts a robotic 384 pin arrayer.
[0085] FIG. 24 depicts small molecule printing.
[0086] FIG. 25 depicts a small molecule microarraying robot.
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS OF THE INVENTION
[0087] As discussed above, there remains a need for the development
of novel therapeutic agents and agents capable of elucidating
biological functions. In one aspect, the present invention provides
novel compounds of general formula (I), and methods for the
synthesis thereof, which compounds are useful, for example, as DNA
synthase inhibitors and Eg5 inhibitors, and thus are useful for the
treatment of, for example, proliferative diseases and cancer. In
certain embodiments, the inventive compounds are additionally
useful as tools to probe biological function.
[0088] General Description of Compounds of the Invention
[0089] As detailed above, in one aspect of the invention, novel
dihydropyrancarboxamides having the following structure (I) are
provided: ##STR8##
[0090] wherein R.sup.1-R.sup.4 are each independently hydrogen or
an aliphatic, heteroaliphatic, aryl, heteroaryl, aliphatic(aryl),
heteroaliphatic(aryl), aliphatic(heteroaryl) or
heteroaliphatic(heteroaryl) moiety;
[0091] R.sup.5 and R.sup.6 are each independently hydrogen or an
aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl, or
alkylheteroaryl moiety, and wherein R.sup.5 and R.sup.6, taken
together, may form a cyclic aliphatic, heteroaliphatic,
aliphatic(aryl), heteroaliphatic(aryl), aliphatic(heteroaryl) or
heteroaliphatic(heteroaryl) moiety, or an aryl or heteroaryl
moiety;
[0092] wherein each of the foregoing aliphatic and heteroaliphatic
moieties may be substituted or unsubstituted, cyclic or acyclic,
saturated or unsaturated or linear or branched; and each of the
foregoing aryl, heteroaryl, aliphatic(aryl), heteroaliphatic(aryl),
aliphatic(heteroaryl) or heteroaliphatic(heteroaryl) moieties may
be substituted or unsubstituted; and
[0093] pharmaceutically acceptable derivatives thereof.
[0094] In one exemplary subset of the invention, compounds having
the following structure (II) are provided: ##STR9##
[0095] wherein R.sup.1-R.sup.4 are each independently hydrogen or
an aliphatic, heteroaliphatic, aryl, heteroaryl, aliphatic(aryl),
heteroaliphatic(aryl), aliphatic(heteroaryl) or
heteroaliphatic(heteroaryl) moiety;
[0096] R.sup.5 and R.sup.6 are each independently hydrogen or an
aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl, or
alkylheteroaryl moiety, and wherein R.sup.5 and R.sup.6, taken
together, may form a cyclic aliphatic, heteroaliphatic,
aliphatic(aryl), heteroaliphatic(aryl), aliphatic(heteroaryl) or
heteroaliphatic(heteroaryl) moiety, or an aryl or heteroaryl
moiety;
[0097] wherein each of the foregoing aliphatic and heteroaliphatic
moieties may be substituted or unsubstituted, cyclic or acyclic,
saturated or unsaturated or linear or branched; and each of the
foregoing aryl, heteroaryl, aliphatic(aryl), heteroaliphatic(aryl),
aliphatic(heteroaryl) or heteroaliphatic(heteroaryl) moieties may
be substituted or unsubstituted; and
[0098] pharmaceutically acceptable derivatives thereof.
[0099] In still other subsets of the invention, compounds are
provided in which the conjugated carboxylate (R.sup.4) is
functionalized. In still other subsets of the invention, compounds
are provided in which the carbonyl is functionalized. In still
other subsets of the invention, compounds are provided in which
R.sup.1 is a solid support linked through a silyl linker as
described in Examples 1 and 2 herein. In still other subsets of the
invention, compounds are provided in which R.sup.2 is a solid
support linked through a silyl linker as described in Examples 1
and 2 herein. In further subsets of the invention, compounds having
functionalization at two or more of these sites are provided. In
still other subsets of the invention, compounds having
functionalization at each of these sites are provided. In certain
other subsets of the invention, compounds are provided as described
using the reagents detailed in Example 1.
[0100] In another embodiment of the invention, the inventive
compounds are provided as a collection and thus may be provided as
a collection of two or more of any of the compounds as detailed
above or as described herein. In certain embodiments, the
collection is provided in array format. In certain other
embodiments, the collection is provided in array format on a glass
slide. In still other embodiments, the collection comprises at
least 100 compounds. In yet other embodiments, the collection
comprises at least 1,000, 2,000 or 10,000 compounds.
[0101] 2) Featured Classes of Compounds
[0102] In certain embodiments, the present invention defines
certain classes of compounds which are of special interest.
[0103] For example, one class of compounds of special interest
includes those compounds of the invention as described above and in
certain subclasses herein, in which R.sup.1 is hydrogen, Z or an
alkyl, heteroalkyl, aryl or heteroaryl moiety substituted with Z,
wherein Z is hydrogen, --(CH.sub.2).sub.qOR.sup.Z,
--(CH.sub.2).sub.qSR.sup.Z, --(CH.sub.2).sub.qN(Re).sub.2,
--(C.dbd.O)R.sup.Z, --(C.dbd.O)N(R.sup.Z).sub.2, or an aliphatic,
heteroaliphatic, aryl, heteroaryl, -(aliphatic)aryl,
-(aliphatic)heteroaryl, -(heteroaliphatic)aryl, or
-(heteroaliphatic)heteroaryl moiety, wherein q is 0-4, and wherein
each occurrence of R.sup.Z is independently hydrogen, a protecting
group, a solid support unit, or an aliphatic, heteroaliphatic,
aryl, heteroaryl, -(aliphatic)aryl, -(aliphatic)heteroaryl,
-(heteroaliphatic)aryl, or -(heteroaliphatic)heteroaryl moiety;
wherein each of the foregoing alkyl or heteroalkyl moieties may be
substituted or unsubstituted, linear or branched, cyclic or
acyclic, saturated or unsaturated; and wherein each of the
foregoing aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
(heteroalkyl)aryl, or -heteroalkyl)heteroaryl moieties may be
substituted or unsubstituted.
[0104] Another class of compounds of special interest includes
those compounds of the invention as described above and in certain
subclasses herein, in which R.sup.2 is hydrogen, Z or an alkyl,
heteroalkyl, aryl or heteroaryl moiety substituted with Z, wherein
Z is hydrogen, --(CH.sub.2).sub.qOR.sup.Z,
--(CH.sub.2).sub.qSR.sup.Z, --(CH.sub.2).sub.qN(R.sup.Z).sub.2,
--(C.dbd.O)R.sup.Z, --(C.dbd.O)N(R.sup.Z).sub.2, or an aliphatic,
heteroaliphatic, aryl, heteroaryl, -(aliphatic)aryl,
-(aliphatic)heteroaryl, -(heteroaliphatic)aryl, or
-heteroaliphatic)heteroaryl moiety, wherein q is 0-4, and wherein
each occurrence of R.sup.Z is independently hydrogen, a protecting
group, a solid support unit, or an aliphatic, heteroaliphatic,
aryl, heteroaryl, -(aliphatic)aryl, -(aliphatic)heteroaryl,
-(heteroaliphatic)aryl, or -(heteroaliphatic)heteroaryl moiety;
wherein each of the foregoing alkyl or heteroalkyl moieties may be
substituted or unsubstituted, linear or branched, cyclic or
acyclic, saturated or unsaturated; and wherein each of the
foregoing aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl moieties may be
substituted or unsubstituted.
[0105] Another class of compounds of special interest includes
those compounds of the invention as described above and in certain
subclasses herein, in which R.sup.3 is an alkyl, heteroalkyl, aryl,
heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl, -(heteroalkyl)aryl,
or -(heteroalkyl)heteroaryl moiety; wherein each of the foregoing
alkyl or heteroalkyl moieties may be substituted or unsubstituted,
linear or branched, cyclic or acyclic, saturated or unsaturated;
and wherein each of the foregoing aryl, heteroaryl, -(alkyl)aryl,
-(alkyl)heteroaryl, -(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl
moieties may be substituted or unsubstituted.
[0106] Another class of compounds of special interest includes
those compounds of the invention as described above and in certain
subclasses herein, in which R.sup.4 is hydrogen or an alkyl,
heteroalkyl, aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl moiety; wherein
each of the foregoing alkyl or heteroalkyl moieties may be
substituted or unsubstituted, linear or branched, cyclic or
acyclic, saturated or unsaturated; and wherein each of the
foregoing aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl moieties may be
substituted or unsubstituted.
[0107] Another class of compounds of special interest includes
those compounds of the invention as described above and in certain
subclasses herein, in which R.sup.5 and R.sup.6 are each
independently hydrogen or an alkyl, heteroalkyl, aryl, heteroaryl,
-(alkyl)aryl, -(alkyl)heteroaryl, -(heteroalkyl)aryl, or
-(heteroalkyl)heteroaryl moiety; or wherein R.sup.5 and R.sup.6,
taken together, form a substituted or unsubstituted, saturated or
unsaturated cyclic moiety comprising 5-12 carbon atoms, 0-5 oxygen
atoms, 0-5 sulfur atoms and 1-5 nitrogen atoms; and wherein each of
the foregoing alkyl or heteroalkyl moieties may be substituted or
unsubstituted, linear or branched, cyclic or acyclic, saturated or
unsaturated; and wherein each of the foregoing aryl, heteroaryl,
-(alkyl)aryl, -(alkyl)heteroaryl, -(heteroalkyl)aryl, or
-(heteroalkyl)heteroaryl moieties may be substituted or
unsubstituted.
[0108] The following compounds are illustrative of certain of the
compounds described generally and in classes and subclasses
herein:
[0109] A number of important subclasses of each of the foregoing
classes deserve separate mention; these subclasses include
subclasses of each of the foregoing classes in which:
[0110] i) compounds of the invention as described above and herein
wherein R.sup.1 is hydrogen, lower alkyl, a substituted or
unsubstituted phenyl or slower alkyl)phenyl moiety,
--(CH.sub.2).sub.nOR.sup.z, -[(CH.sub.2).sub.nO].sub.mR.sup.z, or
--(CH.sub.2).sub.n--Ar--(CH.sub.2).sub.mOR.sup.z; wherein n and m
are each independently integers from 1-6, Ar represents a
substituted or unsubstituted aryl or heteroaryl moiety, and R.sup.z
is independently hydrogen, a protecting group, a solid support
unit, or an aliphatic, heteroaliphatic, aryl, heteroaryl,
-(aliphatic)aryl, -(aliphatic)heteroaryl, -(heteroaliphatic)aryl,
or -(heteroaliphatic)heteroaryl moiety; wherein each of the
foregoing alkyl or heteroalkyl moieties may be substituted or
unsubstituted, linear or branched, cyclic or acyclic, saturated or
unsaturated; and wherein each of the foregoing aryl, heteroaryl,
-(alkyl)aryl, -(alkyl)heteroaryl, -(heteroalkyl)aryl, or
-(heteroalkyl)heteroaryl moieties may be substituted or
unsubstituted;
[0111] ii) compounds of the invention as described above and herein
wherein R.sup.1 is attached to a solid support;
[0112] iii) compounds of the invention as described above and
herein wherein R.sup.1 is --(CH.sub.2).sub.nOR.sup.z,
[(CH.sub.2).sub.nO].sub.mR.sup.z, or
--(CH.sub.2).sub.n--Ar--(CH.sub.2).sub.mOR.sup.z; wherein n and m
are each independently integers from 1-6, Ar represents a
substituted or unsubstituted aryl or heteroaryl moiety, and R.sup.z
is hydrogen, a protecting group or a solid support unit;
[0113] iv) compounds of the invention as described above and herein
wherein R.sup.1 is --(CH.sub.2).sub.nOR.sup.z,
--[(CH.sub.2).sub.nO].sub.mR.sup.z, or
--(CH.sub.2).sub.n--Ar--(CH.sub.2).sub.mOR.sup.z; wherein n and m
are each independently integers from 1-6, Ar represents a
substituted or unsubstituted aryl or heteroaryl moiety, and R.sup.z
is a solid support unit linked to O through a silyl linker; or
heteroalkyl, or substituted or unsubstituted aryl, heteroaryl,
-(alkyl)aryl, -(alkyl)heteroaryl, -(heteroalkyl)aryl, or
-(heteroalkyl)heteroaryl;
[0114] xviii) compounds as described above and herein wherein
R.sup.3 has one of the structures: ##STR10## xix) compounds as
described above and herein wherein R.sup.3 has one of the
structures: ##STR11##
[0115] xx) compounds as described above and herein wherein R.sup.4
is hydrogen, alkyl, or heteroalkyl;
[0116] xxi) compounds as described above and herein wherein R.sup.4
is hydrogen; and
[0117] xxii) compounds as described above and herein wherein
--NR.sup.5R.sup.6 has one of the structures:
[0118] v) compounds of the invention as described above and herein
wherein R.sup.1 is hydrogen, or lower alkyl;
[0119] vi) compounds of the invention as described above and herein
wherein R.sup.1 is ethyl;
[0120] vii) compounds of the invention as described above and
herein wherein R.sup.1 is hydrogen, ethyl, or has one of the
structures: ##STR12##
[0121] wherein R.sup.z is hydrogen, a protecting group or a solid
support unit;
[0122] viii) compounds of the invention as described above and
herein wherein R.sup.1 is hydrogen, ethyl, or has one of the
structures: ##STR13##
[0123] wherein R.sup.z is hydrogen, a protecting group or a solid
support unit;
[0124] ix) compounds of the invention as described above and herein
wherein R.sup.2 is hydrogen, lower alkyl, a substituted or
unsubstituted phenyl or -(lower alkyl)phenyl moiety,
--(CH.sub.2).sub.nOR.sup.z, --[(CH.sub.2).sub.nO].sub.mR.sup.z,
--(CH.sub.2).sub.n--Ar--(CH.sub.2).sub.mOR.sup.z; wherein n and m
are each independently integers from 1-6, Ar represents a
substituted or unsubstituted aryl or heteroaryl moiety, and R.sup.z
is independently hydrogen, a protecting group, a solid support
unit, or an aliphatic, heteroaliphatic, aryl, heteroaryl,
-(aliphatic)aryl, -(aliphatic)heteroaryl, -(heteroaliphatic)aryl,
or -(heteroaliphatic)heteroaryl moiety; wherein each of the
foregoing alkyl or heteroalkyl moieties may be substituted or
unsubstituted, linear or branched, cyclic or acyclic, saturated or
unsaturated; and wherein each of the foregoing aryl, heteroaryl,
-(alkyl)aryl, -(alkyl)heteroaryl, -(heteroalkyl)aryl, or
-(heteroalkyl)heteroaryl moieties may be substituted or
unsubstituted;
[0125] x) compounds of the invention as described above and herein
wherein R.sup.2 is attached to a solid support;
[0126] xi) compounds of the invention as described above and herein
wherein R.sup.2 is --(CH.sub.2).sub.nOR.sup.z,
--[(CH.sub.2).sub.nO].sub.mR.sup.z, or
--(CH.sub.2).sub.n--Ar--(CH.sub.2).sub.mOR.sup.z; wherein n and m
are each independently integers from 1-6, Ar represents a
substituted or unsubstituted aryl or heteroaryl moiety, and R.sup.z
is hydrogen, a protecting group or a solid support unit;
[0127] xii) compounds of the invention as described above and
herein wherein R.sup.2 is --(CH.sub.2).sub.nOR.sup.z,
--[(CH.sub.2).sub.nO].sub.mR.sup.z, or
--(CH.sub.2).sub.n--Ar--(CH.sub.2).sub.mOR.sup.z; wherein n and m
are each independently integers from 1-6, Ar represents a
substituted or unsubstituted aryl or heteroaryl moiety, and R.sup.z
is a solid support unit linked to O through a silyl linker;
[0128] xiii) compounds of the invention as described above and
herein wherein R.sup.2 is hydrogen or lower alkyl;
[0129] xiv) compounds of the invention as described above and
herein wherein R.sup.2 is hydrogen, methyl or ethyl;
[0130] xv) compounds of the invention as described above and herein
wherein R.sup.2 is ethyl;
[0131] xvi) compounds as described above and herein wherein R.sup.2
is hydrogen or has one of the structures: ##STR14## wherein R.sup.z
is hydrogen, a protecting group or a solid support unit;
[0132] xvii) compounds of the invention as described above and
herein wherein R.sup.3 is substituted or unsubstituted, cyclic or
acyclic, linear or branched, saturated or unsaturated alkyl
##STR15## ##STR16## ##STR17##
[0133] As the reader will appreciate, compounds of particular
interest include, among others, those which share the attributes of
one or more of the foregoing subclasses. Some of those subclasses
are illustrated by the following sorts of compounds:
[0134] I) Compounds of the Formula: ##STR18##
[0135] wherein R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6 and
R.sup.Z are as described in classes and subclasses herein; and Y is
a substituted or unsubstituted, cyclic or acyclic, linear or
branched, saturated or unsaturated aliphatic or heteroaliphatic
moiety, or a substituted or unsubstituted aryl, heteroaryl,
-(aliphatic)aryl, -(aliphatic)heteroaryl, -(heteroaliphatic)aryl,
or -(heteroaliphatic)heteroaryl moiety; wherein each of the
foregoing alkyl or heteroalkyl moieties may be substituted or
unsubstituted, linear or branched, cyclic or acyclic, saturated or
unsaturated; and wherein each of the foregoing aryl, heteroaryl,
(aliphatic)aryl, -(aliphatic)heteroaryl, -(heteroaliphatic)aryl, or
-(heteroaliphatic)heteroaryl moieties may be substituted or
unsubstituted.
[0136] In certain exemplary embodiments, Y is an alkyl,
heteroalkyl, aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl moiety; R.sup.Z is
hydrogen, a protecting group or a solid support unit; R.sup.2,
R.sup.3 and R.sup.4 are each independently hydrogen or an alkyl,
heteroalkyl, aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl moiety; and R.sup.5
and R.sup.6 are each independently hydrogen or an alkyl,
heteroalkyl, aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl moiety; or wherein
R.sup.5 and R.sup.6, taken together, form a substituted or
unsubstituted, saturated or unsaturated cyclic moiety comprising
5-12 carbon atoms, 0-5 oxygen atoms, 0-5 sulfur atoms and 1-5
nitrogen atoms; and wherein each of the foregoing alkyl or
heteroalkyl moieties may be substituted or unsubstituted, linear or
branched, cyclic or acyclic, saturated or unsaturated; and wherein
each of the foregoing aryl, heteroaryl, -(alkyl)aryl,
-(alkyl)heteroaryl, -(heteroalkyl)aryl, or (heteroalkyl)heteroaryl
moieties may be substituted or unsubstituted.
[0137] In certain embodiments, R.sup.z--Y-- together represents a
moiety having the structure: ##STR19##
[0138] wherein R.sup.z is hydrogen, a protecting group or a solid
support unit.
[0139] In certain exemplary embodiments, R.sup.z--Y-- together
represents a moiety having the structure: ##STR20##
[0140] wherein R.sup.z is hydrogen, a protecting group or a solid
support unit.
[0141] II) Compounds of the Formula: ##STR21##
[0142] wherein R.sup.1, R.sup.3, R.sup.4, R.sup.5, R.sup.6 and
R.sup.Z are as described in classes and subclasses herein; and X is
a substituted or unsubstituted, cyclic or acyclic, linear or
branched, saturated or unsaturated aliphatic or heteroaliphatic
moiety, or a substituted or unsubstituted aryl, heteroaryl,
-(aliphatic)aryl, -(aliphatic)heteroaryl, -(heteroaliphatic)aryl,
or -(heteroaliphatic)heteroaryl moiety; wherein each of the
foregoing alkyl or heteroalkyl moieties may be substituted or
unsubstituted, linear or branched, cyclic or acyclic, saturated or
unsaturated; and wherein each of the foregoing aryl, heteroaryl,
(aliphatic)aryl, -(aliphatic)heteroaryl, -(heteroaliphatic)aryl, or
-(heteroaliphatic)heteroaryl moieties may be substituted or
unsubstituted.
[0143] In certain exemplary embodiments, X is an alkyl,
heteroalkyl, aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl moiety; R.sup.Z is
hydrogen, a protecting group or a solid support unit; R.sup.2,
R.sup.3 and R.sup.4 are each independently hydrogen or an alkyl,
heteroalkyl, aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl moiety; and R.sup.5
and R.sup.6 are each independently hydrogen or an alkyl,
heteroalkyl, aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl moiety; or wherein
R.sup.5 and R.sup.6, taken together, form a substituted or
unsubstituted, saturated or unsaturated cyclic moiety comprising
5-12 carbon atoms, 0-5 oxygen atoms, 0-5 sulfur atoms and 1-5
nitrogen atoms; and wherein each of the foregoing alkyl or
heteroalkyl moieties may be substituted or unsubstituted, linear or
branched, cyclic or acyclic, saturated or unsaturated; and wherein
each of the foregoing aryl, heteroaryl, -(alkyl)aryl,
-(alkyl)heteroaryl, -(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl
moieties may be substituted or unsubstituted.
[0144] In certain embodiments, R.sup.z--X-- together represents a
moiety having the structure: ##STR22##
[0145] wherein R.sup.z is hydrogen, a protecting group or a solid
support unit.
[0146] III) Compounds of the Formula: ##STR23##
[0147] wherein R.sup.1, R.sup.2, R.sup.4, R.sup.5 and R.sup.6 are
as described in classes and subclasses herein; and Ar is a
substituted or unsubstituted aryl or heteroaryl moiety.
[0148] In certain exemplary embodiments, R.sup.1 and R.sup.2 are
each independently hydrogen, Z or an alkyl, heteroalkyl, aryl or
heteroaryl moiety substituted with Z, wherein Z is hydrogen,
--(CH.sub.2).sub.qOR.sup.Z, --(CH.sub.2).sub.qSR.sup.Z,
--(CH.sub.2).sub.qN(R.sup.Z).sub.2, --(C.dbd.O)R.sup.Z,
--(C.dbd.O)N(R.sup.Z).sub.2, or an aliphatic, heteroaliphatic,
aryl, heteroaryl, -(aliphatic)aryl, -(aliphatic)heteroaryl,
-(heteroaliphatic)aryl, or -heteroaliphatic)heteroaryl moiety,
wherein q is 0-4, and wherein each occurrence of R.sup.Z is
independently hydrogen, a protecting group, a solid support unit,
or an aliphatic, heteroaliphatic, aryl, heteroaryl,
-(aliphatic)aryl, -(aliphatic)heteroaryl, -(heteroaliphatic)aryl,
or -(heteroaliphatic)heteroaryl moiety; R.sup.4 is hydrogen or an
alkyl, heteroalkyl, aryl, heteroaryl, -(alkyl)aryl,
-(alkyl)heteroaryl, -(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl
moiety; and R.sup.5 and R.sup.6 are each independently hydrogen or
an alkyl, heteroalkyl, aryl, heteroaryl, -(alkyl)aryl,
-(alkyl)heteroaryl, -(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl
moiety; or wherein R.sup.5 and R.sup.6, taken together, form a
substituted or unsubstituted, saturated or unsaturated cyclic
moiety comprising 5-12 carbon atoms, 0-5 oxygen atoms, 0-5 sulfur
atoms and 1-5 nitrogen atoms; and wherein each of the foregoing
aliphatic, heteroaliphatic, alkyl or heteroalkyl moieties may be
substituted or unsubstituted, linear or branched, cyclic or
acyclic, saturated or unsaturated; and wherein each of the
foregoing aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, -heteroalkyl)heteroaryl, -(aliphatic)aryl,
-(aliphatic)heteroaryl, -(heteroaliphatic)aryl, or
-(heteroaliphatic)heteroaryl moieties may be substituted or
unsubstituted.
[0149] In certain exemplary embodiments, Ar is a moiety having the
structure: ##STR24##
[0150] which may further be substituted with one or more
occurrences of any substitutents described in the Definitions
above.
[0151] In certain other exemplary embodiments, Ar is a moiety
having the structure: ##STR25##
[0152] which may further be substituted with one or more
occurrences of any substitutents described in the Definitions
above.
[0153] IV) Compounds of the Formula: ##STR26##
[0154] wherein R.sup.1, R.sup.2, R.sup.3, R.sup.5 and R.sup.6 are
as described in classes and subclasses herein.
[0155] In certain exemplary embodiments, R.sup.1 and R.sup.2 are
each independently hydrogen, Z or an alkyl, heteroalkyl, aryl or
heteroaryl moiety substituted with Z, wherein Z is hydrogen,
--(CH.sub.2).sub.qOR.sup.Z, --(CH.sub.2).sub.qSR.sup.Z,
--(CH.sub.2).sub.qN(R.sup.Z).sub.2, --(C.dbd.O)R.sup.Z,
--(C.dbd.O)N(R.sup.Z).sub.2, or an aliphatic, heteroaliphatic,
aryl, heteroaryl, -(aliphatic)aryl, -(aliphatic)heteroaryl,
-(heteroaliphatic)aryl, or -(heteroaliphatic)heteroaryl moiety,
wherein q is 0-4, and wherein each occurrence of R.sup.Z is
independently hydrogen, a protecting group, a solid support unit,
or an aliphatic, heteroaliphatic, aryl, heteroaryl,
-(aliphatic)aryl, -(aliphatic)heteroaryl, -(heteroaliphatic)aryl,
or -(heteroaliphatic)heteroaryl moiety; R.sup.3 is hydrogen or an
alkyl, heteroalkyl, aryl, heteroaryl, -(alkyl)aryl,
-(alkyl)heteroaryl, -(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl
moiety; R.sup.5 and R.sup.6 are each independently hydrogen or an
alkyl, heteroalkyl, aryl, heteroaryl, -(alkyl)aryl,
-(alkyl)heteroaryl, -(heteroalkyl)aryl, or -(heteroalkyl)heteroaryl
moiety; or wherein R.sup.5 and R.sup.6, taken together, form a
substituted or unsubstituted, saturated or unsaturated cyclic
moiety comprising 5-12 carbon atoms, 0-5 oxygen atoms, 0-5 sulfur
atoms and 1-5 nitrogen atoms; and wherein each of the foregoing
aliphatic, heteroaliphatic, alkyl or heteroalkyl moieties may be
substituted or unsubstituted, linear or branched, cyclic or
acyclic, saturated or unsaturated; and wherein each of the
foregoing aryl, heteroaryl, -(alkyl)aryl, -(alkyl)heteroaryl,
-(heteroalkyl)aryl, -(heteroalkyl)heteroaryl, -(aliphatic)aryl,
-(aliphatic)heteroaryl, -(heteroaliphatic)aryl, or
-(heteroaliphatic)heteroaryl moieties may be substituted or
unsubstituted.
[0156] It will be appreciated that some of the foregoing classes
and subclasses of compounds can exist in various isomeric forms.
The invention encompasses the compounds as individual isomers
substantially free of other isomers and alternatively, as mixtures
of various isomers, e.g., racemic mixtures of stereoisomers.
Additionally, when R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5
and/or R.sup.6 comprise a double bond, the invention encompasses
both (Z) and (E) double bond isomers unless otherwise specifically
designated. The invention also encompasses tautomers of specific
compounds as described above. In addition to the above-mentioned
compounds per se, this invention also encompasses pharmaceutically
acceptable derivatives of these compounds and compositions
comprising one or more compounds of the invention and one or more
pharmaceutically acceptable excipients or additives.
[0157] Synthetic Methodology
[0158] In yet another aspect of the present invention, novel
methods for the synthesis of the novel dihydropyrancarboxamides as
described herein are provided.
[0159] According to the present invention, any available techniques
can be used to make or prepare the inventive
dihydropyrancarboxamides or compositions including them. For
example, combinatorial techniques, parallel synthesis and/or solid
phase synthetic methods such as those discussed in detail below may
be used. Alternatively, the inventive compounds may be prepared
using any of a variety of solution phase synthetic methods known in
the art (e.g., one compounds at a time).
[0160] In certain exemplary embodiments, the method takes advantage
of efficient catalytic asymmetric heterocycloaddition reactions as
depicted in FIG. 2 (see, a) D. A. Evans, J. S. Johnson, E. J.
Olhava, J. Am. Chem. Soc. 2000, 122, 1635-1649; b) D. A. Evans, E.
J. Olhava, J. S. Johnson, J. M. Janey, Angew. Chem. 1998, 110,
3554-3557; Angew. Chem. Int. Ed. 1998, 37, 3372-3375; c) J.
Thorhauge, M. Johannsen, K. A. Jorgensen, Angew. Chem. 1998, 110,
2543-2546; Angew. Chem. Int. Ed. 1998, 37, 2404-2406; d) H. E.
Balckwell, L. Perez, R. A. Stavenger, J. A. Tallarico, E. Cope
Eatough, M. A. Foley, S. L. Schreiber, Chem. Biol. 2001, 1167-1182;
e) P. A. Clemmons, A. N. Koehler, B. K. Wagner, T. G., Sprigings,
D. R. Spring, R. W. King, S. L. Schreiber, M. A. Foley, Chem. Biol.
2001, 1183-1195; and f) R. A. Stavenger, S. L. Schreiber, Angew.
Chem. Int. Ed. 2001, 40(18), 3417-3421). In certain embodiments,
following the heterocycloaddition reaction, as depicted in FIG. 2,
a variety of diversity generating reactions may be performed to
complete the synthesis of each member of the library of
compounds.
[0161] In certain exemplary embodiments, according to the method of
the present invention, a core structure can be provided, wherein
the core structure is synthesized by the method comprising:
[0162] providing a vinyl ether having the structure: ##STR27##
[0163] providing an unsaturated ketoester having the structure:
##STR28##
[0164] subjecting the vinyl ether and the unsaturated ketoester to
suitable conditions to generate a scaffold having the core
structure: ##STR29##
[0165] wherein R.sup.1 and R.sup.2 are each independently hydrogen
or an aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety; wherein one of R.sup.1 or R.sup.2 is
attached to a solid support;
[0166] R.sup.3 and R.sup.4 are each independently hydrogen or an
aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety;
[0167] R.sub.A is hydrogen or is an aliphatic, heteroaliphatic,
aryl, heteroaryl, alkylaryl, or alkylheteroaryl moiety;
[0168] wherein each of the foregoing aliphatic and heteroaliphatic
moieties may be substituted or unsubstituted, cyclic or acyclic,
saturated or unsaturated or linear or branched; and each of the
foregoing aryl, heteroaryl, alkylaryl or alkylheteroaryl moieties
may be substituted or unsubstituted.
[0169] In certain embodiments, R.sup.1 or R.sup.2 is attached to a
solid support via a silyl linker.
[0170] It will be appreciated that the synthetic methods, as
described herein, may utilize a variety of protecting groups (e.g.
O, S, or N protecting groups) to temporarily block a particular
functional group so that a reaction can be carried out selectively
at another reactive site in a multifunctional compound. One of
ordinary skill in the art will recognize that, in addition to the
specific protecting groups described in the Examples herein, a
variety of well-known protecting groups in the art of organic
synthesis can also be utilized as detailed in Greene and Wuts,
Protective Groups in Organic Synthesis, Third Edition, John Wiley
& Sons, New York: 1999, the entire contents of which are hereby
incorporated by reference.
[0171] Once the core structure is prepared, as detailed above, one
or more compounds can be synthesized via combinatorial techniques,
or by synthesizing one compound at a time, by diversifying at
particular functional groups. Thus, in another embodiment, the
method further comprises functionalizing the core structure (III)
at one or more sites to generate compounds having the structures
(Ia): ##STR30##
[0172] wherein R.sup.1-R.sup.6 are as defined in classes and
subclasses herein; and one of R.sup.1 or R.sup.2 is attached to a
solid support.
[0173] In certain embodiments, the method further comprises
functionalizing the core structure (III) at one or more sites to
generate compounds having the structures (IIa): ##STR31##
[0174] and/or enantiomer thereof;
[0175] wherein R.sup.1-R.sup.6 are as defined in classes and
subclasses herein; and one of R.sup.1 or R.sup.2 is attached to a
solid support.
[0176] In certain embodiments, the carboxylic ester moiety can be
converted, among others, to an acid halide, amide, anhydride,
diketone, imide or nitrile moiety; the conjugated carboxyl moiety
can be functionalized via conjugate addition and can be diversified
using oxygen, sulfur, nitrogen or carbon nucleophiles, to name a
few. In addition, where the substitutents R.sub.A, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5 and/or R.sup.6 comprise an aryl
or heteroaryl group, such aryl or heteroaryl group may be further
diversified by introducing additional functionalities according to
methods known in the art.
[0177] In certain embodiments, the method further comprises
cleaving the core structure (III) from the solid support to which
it is attached either before or after chemical derivatization.
[0178] In certain exemplary embodiments, the carboxylic ester
CO.sub.2R.sup.A can be derivatized to form the corresponding amido
compound having the structure (Ia): ##STR32##
[0179] wherein R.sup.1 and R.sup.2 are each independently hydrogen
or an aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety; wherein one of R.sup.1 or R.sup.2 is
attached to a solid support;
[0180] R.sup.3 and R.sup.4 are each independently hydrogen or an
aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety;
[0181] R.sup.5 and R.sup.6 are each independently hydrogen or an
aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl, or
alkylheteroaryl moiety, and wherein R.sup.5 and R.sup.6, taken
together, may form a cyclic aliphatic, heteroaliphatic,
aliphatic(aryl), heteroaliphatic(aryl), aliphatic(heteroaryl) or
heteroaliphatic(heteroaryl) moiety, or an aryl or heteroaryl
moiety;
[0182] wherein each of the foregoing aliphatic and heteroaliphatic
moieties may be substituted or unsubstituted, cyclic or acyclic,
saturated or unsaturated or linear or branched; and each of the
foregoing aryl, heteroaryl, alkylaryl or alkylheteroaryl moieties
may be substituted or unsubstituted.
[0183] In certain exemplary embodiments, synthetic transformation
of the carboxylic moiety --CO.sub.2R.sub.A is achieved by
conversion of the ester moiety to the corresponding carboxylic
acid, followed reaction with a suitable amine under conditions
suitable to effect amide formation. Examples of amines suitable for
practicing the invention include, but are not limited to ##STR33##
##STR34## ##STR35##
[0184] In certain exemplary embodiments, conjugated carboxylate
functionalization is achieved using furfuryl mercaptan,
3-(trifluoromethyl)benzyl mercaptan, 3-methyl-1-buranethiol,
4-methoxy-alpha-toluenethiol, benzyl mercaptan, 2-(tert
butyldimethylsiloxy)ethylmercaptan, cyclopentanethiol, or a skip
codol. In certain embodiments, amine (nitrogen functionalization)
is achieved using benzoyl chloride, benzyl isocyanate, ethyl
isocyanate, thiophene-2-carbonyl chloride,
3-(methylthio)propionaldehyde, undecanal,
cyclopropanecarboxaldehyde, or a skip codon. In certain
embodiments, ketone functionalization is achieved using
p-toluenesulfonhydrazide, dansyl hydrazine, methoxyamine
hydrochloride, o-Benzylhydroxylamine hydrochloride,
Carboxymethoxylamine hemihydrochloride,
p-Methoxybenzensulfonylhydrazide, 4-Nitrophenylhydrazine or a skip
codon.
[0185] Although certain exemplary diversification reactions and
reagents are described in more detail herein, it will be
appreciated that the present invention is intended to encompass
equivalent diversification reactions within the arsenal of
synthetic organic chemistry that can be utilized to diversify the
inventive scaffold as described herein (See, generally, March,
Advanced Organic Chemistry, John Wiley & Sons, 1992; and
"Comprehensive Organic Transformations, a guide to functional group
preparations", Richard C. Larock, VCH publishers, 1999; the entire
contents of which are incorporated herein by reference). For
example, although certain reagents for amide formation are
described in the examples (e.g., 2-methoxy-ethylamine), it will be
appreciated that other derivatives can be utilized (e.g.,
2-ethoxy-ethylamine, 2-propoxy-ethylamine, etc.), including, but
not limited to, homologues and other similarly substituted
moieties. These additional examples are not intended to limit the
scope of the invention; rather they are provided to exemplify the
broad utility of the inventive scaffold in the employment of a
variety of diversification reactions and reagents.
[0186] In certain embodiments, the method further comprises
cleaving the structure (Ia) from the solid support to which it is
attached to give a compound having the structure (I): ##STR36##
[0187] wherein R.sup.1-R.sup.4 are each independently hydrogen or
an aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety;
[0188] R.sup.5 and R.sup.6 are each independently hydrogen or an
aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl, or
alkylheteroaryl moiety, and wherein R.sup.5 and R.sup.6, taken
together, may form a cyclic aliphatic, heteroaliphatic,
aliphatic(aryl), heteroaliphatic(aryl), aliphatic(heteroaryl) or
heteroaliphatic(heteroaryl) moiety, or an aryl or heteroaryl
moiety;
[0189] wherein each of the foregoing aliphatic and heteroaliphatic
moieties may be substituted or unsubstituted, cyclic or acyclic,
saturated or unsaturated or linear or branched; and each of the
foregoing aryl, heteroaryl, alkylaryl or alkylheteroaryl moieties
may be substituted or unsubstituted.
[0190] In one exemplary embodiment, as depicted in FIG. 1, and as
described in Example 1, a library was synthesized on 500-600 .mu.m
high capacity polystyrene beads functionalized with a trialkylsilyl
linker (See also, Scheme 1) (P. A. Clemmons, A. N. Koehler, B. K.
Wagner, T. G., Sprigings, D. R. Spring, R. W. King, S. L.
Schreiber, M. A. Foley, Chem. Biol. 2001, 1183-1195; see also
Example 2, herein). ##STR37##
[0191] For example, as depicted in Scheme 1,
disoprolyalkylsilyl-functionalized resin 1a can be activated by
treatment with excess triflic acid to form 1b. Alcohol compound ROH
can then be trapped onto the activated resin in the presence of
excess 2,6-lutidine to generate the corresponding silyl ether 1c.
After subjecting --R to suitable reaction conditions to effect the
desired synthetic transformations, the substrate may be cleaved
from the solid support 1d by reaction with HF, followed by
quenching of excess HF with methoxytrimethylsilane (TMSOMe), to
give the desired library members. In certain embodiments, for the
library synthesis, building blocks can be selected that reacted in
good yield and, as a group, possess diverse physical
characteristics. Exemplary building blocks suitable for practicing
the invention are depicted in FIG. 3. One of ordinary skill in the
art will appreciate that other building blocks may be used.
[0192] In but one exemplary embodiment, the library was prepared as
a triplicate copy (3 bead per library member), arrayed in 384-well
plates, and detached from the solid-support with HF-pyridine.
Evaporation of the cleavage cocktail and resuspension in DMF or
DMSO afforded 4320 stock solutions for biological screening.
[0193] Research Uses
[0194] According to the present invention, the inventive compounds
may be assayed in any of the available assays known in the art for
identifying compounds having a biological activity of interest. For
example, the assay may be cellular or non-cellular, in vivo or in
vitro, etc. Any assay format may be used to screen the inventive
compounds (e.g., formats amenable to high-throughput screening).
Examples of biological activity include, but are not limited to,
binding activity or biological activity against target molecules
(e.g., inhibitors of target enzymes, competitors for binding of a
natural ligand to its receptor, agonists or antagonists for
receptor-mediated intracellular processes, to name a few), toxicity
evaluation or bioavailability assessment, etc.
[0195] In certain exemplary embodiments, compounds of this
invention were assayed for their ability to: [0196] inhibit DNA
synthesis (e.g., DNA replication); [0197] exhibit genistein
suppressor activity; [0198] exhibit Eg5 inhibitory activity;
[0199] Thus, in one aspect, compounds of this invention which are
of particular interest include those which: [0200] inhibit DNA
synthesis (e.g., DNA replication); [0201] have genistein suppressor
activity; [0202] exhibit Eg5 inhibitory activity; [0203] exhibit
cytotoxic or growth inhibitory effect on cancer cell lines
maintained in vitro or in animal studies using a scientifically
acceptable cancer cell xenograft model; [0204] exhibit a
therapeutic profile (e.g., optimum safety and curative effect) that
is comparable or superior to existing chemotherapeutic agents.
[0205] As discussed above, the compounds of the invention may be
assayed for any of a variety of biological activities (e.g., in
high-throughput screening assays). For example, the library members
may be arrayed according to the method described in patent
application Ser. No. 09/567,910, filed May 10, 2000, which is
incorporated herein by reference in its entirety, and screened for
detecting binding and/or activation events occurring between
members in the inventive library and biological macromolecules of
interest (e.g., for identifying small molecule partners (library
members) for biological macromolecules of interest). The partners
may be compounds that bind to particular macromolecules of interest
and are capable of activating or inhibiting the biological
macromolecules of interest. As discussed above, in one aspect, the
present invention provides methods, referred to herein as "small
molecule printing", for the generation of high density arrays and
the resulting compositions. According to the method of the present
invention, a collection of chemical compounds, or one type of
compound, can be "printed" onto a support to generate extremely
high density arrays. In certain embodiments, one or more library
members may be arrayed by (1) providing a solid support, wherein
the solid support is functionalized with a desired chemical moiety
capable of interacting with a desired chemical compound to form an
attachment; (2) providing one or more solutions of the library
members to be attached to the solid support; and (3) delivering the
one or more solutions of the library members to the solid support,
whereby an array of compounds is generated and the array has a
density of at least 1000 spots per cm.sup.2. In certain exemplary
embodiments, a silylation reaction can be employed to attach the
library members to a glass slide.
[0206] In certain embodiments, plain glass slides are derivatized
to yield surfaces that are densely functionalized with silyl
halides. Compounds containing hydroxyl groups (e.g., library
members) can then be provided and contacted with the functionalized
glass surface. The hydroxyl containing compounds readily attach to
the surface through the silicon-oxygen bond formed by nucleophilic
substitution on the silyl halide. In a preferred embodiment, the
silyl halide is silyl chloride, bromide, or iodide. In other
preferred embodiments, leaving groups on the silicon such as
mesylate and tosylate are used rather than halides. Preferably, the
hydroxyl groups of the compounds to be attached are unhindered
(e.g., primary alcohols). See, for example, Hergenrother et al., J.
Am. Chem. Soc., 122:7849-7850, 2000, which is incorporated herein
by reference in its entirety.
[0207] In certain embodiments, assaying the library members may be
accomplished by (1) arraying the library members, as described
above, with a density of at least 1000 spots per cm.sup.2; (2)
contacting the array with one or more types of biological
macromolecules of interest; and (3) determining the interaction of
specific small molecule-biological macromolecule partners.
[0208] It will also be appreciated that the arrays of compounds may
be utilized in a variety of ways to enable detection of
interactions between library members and biological macromolecules.
In one particularly preferred embodiment, an array of different
types of chemical compounds attached to the surface is utilized and
is contacted by one or a few types of biological macromolecules to
determine which compounds are capable of interacting with the
specific biological macromolecule(s). As one of ordinary skill in
the art will realize, if more than one type of compound is
utilized, it is desirable to utilize a method for encoding each of
the specific compounds so that a compound having a specific
interaction can be identified. Specific encoding techniques have
been recently reviewed and these techniques, as well as other
equivalent or improved techniques, can be utilized in the present
invention (see, Czarnik, A. W. Current Opinion in Chemical Biology
1997, 1, 60; which is incorporated herein by reference in its
entirety). Alternatively the arrays of the present invention may
comprise one type of chemical compound and a library of biological
macromolecules may be contacted with this array to determine the
ability of this one type of chemical compound to interact with a
variety of biological macromolecules.
[0209] As one of ordinary skill in the art will realize, the
biological macromolecule of interest may comprise any biomolecule.
In preferred embodiments, the biological macromolecule of interest
comprises a protein, and more preferably the array is contacted
with a library of recombinant proteins of interest. In yet another
preferred embodiment, the biological molecules of interest are
provided in the form of cell lysates such as, for example, those of
tumor-associated cells. As will be appreciated by one of ordinary
skill in the art, these proteins may comprise purified proteins,
pools of purified proteins, and complex mixtures such as cell
lysates, and fractions thereof, to name a few. Examples of
particularly preferred biological macromolecules to study include,
but are not limited to those involved in signal transduction,
dimerization, gene regulation, cell cycle and cell cycle
checkpoints, and DNA damage checkpoints. Furthermore, the ability
to construct libraries of expressed proteins from any organism or
tissue of interest will lead to large arrays of recombinant
proteins. The compounds of interest may be capable of either
inactivating or activating the function of the particular
biomolecule of interest.
[0210] In certain exemplary embodiments, the inventive library may
be screened to identify those library members capable of exerting
an effect on an intracellular biological or chemical process. For a
detailed description of the screening method, see U.S. patent
application Ser. No. 09/361,576 and PCT Patent Application No.:
US99/17046, each of which is incorporated herein by reference in
its entirety. In one aspect, the method encompasses screening
chemical compounds for their effects on chemical and/or biological
systems by detecting the presence or amount of a component present
or produced by the system, which component acts as a marker for the
chemical or biological process of interest. Often, detection of the
presence or amount of such a biological component will reveal a
perturbation in an underlying biological process. For example, the
biological component may be a component or product of a cell
signaling pathway, so that detection of the component allows the
identification of test compounds that perturb the pathway. In
certain embodiments, whole cells may be arrayed on a suitable solid
support and one or more library members may be contacted with the
arrayed cells under conditions suitable for at least one of the
test compounds to exert an effect on an intracellular biological or
chemical process. A ligand may then be contacted with said cells in
each reaction vessel under conditions suitable for said ligand to
associate intracellularly with at least one biological component
whose presence or amount is indicative of said biological or
chemical process. Finally, the presence or amount of the ligand
associated with said biological component may be measured with a
suitable detection method. Preferably, the biological component is
detected by means of its interaction with a binding partner ligand.
Preferably, the binding is specific. In certain preferred
embodiments, the binding partner ligand is an antibody. In certain
embodiments, the library may be screened to identify compounds that
effect changes in a variety of different cellular processes,
including, for example, protein concentration, protein
phosphorylation, methylation, acetylation, lipidation,
isoprenylation, ubiquitination, second messenger concentration, and
the rate or extent of DNA synthesis.
[0211] In certain embodiments, compounds of the invention inhibit
BrdU incorporation in cells. BrdU (5-bromodeoxyuridine) is a
thymidine analog in which the methyl group at the 5-position is
replaced with bromine (FIG. 2a). This analog is efficiently
incorporated into DNA during DNA replication, and can be detected
with an antibody raised specifically against this modified form. By
detecting the incorporation of a natural nucleotide or non-natural
nucleotide, it is possible to determine growth and viability of a
cell or collection of cells. DNA synthesis in a cell is an
indicator of growth and viability. Therefore, compounds which may
affect cell growth, the cell cycle, and viability of cells may be
assayed using BrdU as a signaling cellular component. In certain
exemplary embodiments, inventive compounds are useful for the
treatment of disorders associated with abnormal cell growth or cell
proliferation (e.g., cancer).
[0212] In certain other embodiments, compounds of the invention
exhibit Eg5 inhibitory activity. Eg5 is a kinesin-related motor
essential for bipolar spindle formation in vivo. Mitotic kinesins
are enzymes essential for assembly and function of the mitotic
spindle, but are not generally part of other microtubule
structures, such as nerve processes. Mitotic kinesins play
essential roles during all phases of mitosis. These enzymes are
"molecular motors" that translate energy released by hydrolysis of
ATP into mechanical force which drives the directional movement of
cellular cargoes along microtubules. The catalytic domain
sufficient for this task is a compact structure of approximately
340 amino acids. During mitosis, kinesins organize microtubules
into the bipolar structure that is the mitotic spindle. Kinesins
mediate movement of chromosomes along spindle microtubules, as well
as structural changes in the mitotic spindle associated with
specific phases of mitosis. Experimental perturbation of mitotic
kinesin function causes malformation or dysfunction of the mitotic
spindle, frequently resulting in cell cycle arrest. From both the
biological and enzymatic perspectives, these enzymes are attractive
targets for the discovery and development of novel anti-mitotic
chemotherapeutics.
[0213] In yet other embodiments, compounds of the invention exhibit
genistein suppressor activity. Genistein
(4',5,7-trihydroxyisoflavone) is a broad-spectrum protein tyrosine
kinase inhibitor that has been shown to have growth inhibitory
effects against several cancers both in vitro and in vivo.
[0214] Pharmaceutical Compositions
[0215] In another aspect, this invention also provides
pharmaceutical preparations comprising at least one of the
compounds as described above and herein, optionally, though
typically in combination with a pharmaceutically acceptable
carrier. In certain embodiments, the compounds are capable of
inhibiting the growth of or killing cancer cells. Thus, the present
invention provides pharmaceutical compositions for treating cancer,
preferably for preventing the recurrence of cancer, comprising a
compound of the present invention disclosed herein, as an active
ingredient, optionally, though typically in combination with a
pharmaceutically acceptable carrier.
[0216] As detailed herein, several of the inventive compositions
have been determined to have a wide range of biological activities
(e.g., inhibition of Eg5 ATPase activity, FKBP12 binding,
inhibition of DNA replication, genistein suppressor activity).
Thus, in another aspect of the present invention, pharmaceutical
compositions are provided, wherein these compositions include a
compound that is useful in treating a "physiological condition,"
defined herein as any biological or biochemical process that
affects the health of an individual, and a pharmaceutically
acceptable carrier. It will be appreciated that the inventive
pharmaceutical compositions encompasses each of those compounds
identified that inhibit or activate any physiological process.
[0217] It will also be appreciated that certain of the compounds of
the present invention can exist in free form for treatment, or
where appropriate, as a pharmaceutically acceptable derivative
thereof. According to the present invention, a pharmaceutically
acceptable derivative includes, but is not limited to,
pharmaceutically acceptable salts, esters, salts of such esters, or
any other adduct or derivative which upon administration to a
patient in need is capable of providing, directly or indirectly, a
compound as otherwise described herein, or a metabolite or residue
thereof, e.g., a prodrug.
[0218] As used herein, the term "pharmaceutically acceptable salt"
refers to those salts which are, within the scope of sound medical
judgment, suitable for use in contact with the tissues of humans
and lower animals without undue toxicity, irritation, allergic
response and the like, and are commensurate with a reasonable
benefit/risk ratio. Pharmaceutically acceptable salts are well
known in the art. For example, S. M. Berge, et al. describe
pharmaceutically acceptable salts in detail in J. Pharmaceutical
Sciences, 66: 1-19 (1977), incorporated herein by reference. The
salts can be prepared in situ during the final isolation and
purification of the compounds of the invention, or separately by
reacting the free base function with a suitable organic acid.
Examples of pharmaceutically acceptable, nontoxic acid addition
salts are salts of an amino group formed with inorganic acids such
as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric
acid and perchloric acid or with organic acids such as acetic acid,
oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid
or malonic acid or by using other methods used in the art such as
ion exchange. Other pharmaceutically acceptable salts include
adipate, alginate, ascorbate, aspartate, benzenesulfonate,
benzoate, bisulfate, borate, butyrate, camphorate,
camphorsulfonate, citrate, cyclopentanepropionate, digluconate,
dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate,
glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate,
hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate,
laurate, lauryl sulfate, malate, maleate, malonate,
methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate,
oleate, oxalate, palmitate, pamoate, pectinate, persulfate,
3-phenylpropionate, phosphate, picrate, pivalate, propionate,
stearate, succinate, sulfate, tartrate, thiocyanate,
p-toluenesulfonate, undecanoate, valerate salts, and the like.
Representative alkali or alkaline earth metal salts include sodium,
lithium, potassium, calcium, magnesium, and the like. Further
pharmaceutically acceptable salts include, when appropriate,
nontoxic ammonium, quaternary ammonium, and amine cations formed
using counterions such as halide, hydroxide, carboxylate, sulfate,
phosphate, nitrate, lower alkyl sulfonate and aryl sulfonate.
[0219] Additionally, as used herein, the term "pharmaceutically
acceptable ester" refers to esters which hydrolyze in vivo and
include those that break down readily in the human body to leave
the parent compound or a salt thereof. Suitable ester groups
include, for example, those derived from pharmaceutically
acceptable aliphatic carboxylic acids, particularly alkanoic,
alkenoic, cycloalkanoic and alkanedioic acids, in which each alkyl
or alkenyl moiety advantageously has not more than 6 carbon atoms.
Examples of particular esters includes formates, acetates,
propionates, butyrates, acrylates and ethylsuccinates.
[0220] Furthermore, the term "pharmaceutically acceptable prodrugs"
as used herein refers to those prodrugs of the compounds of the
present invention which are, within the scope of sound medical
judgment, suitable for use in contact with the tissues of humans
and lower animals with undue toxicity, irritation, allergic
response, and the like, commensurate with a reasonable benefit/risk
ratio, and effective for their intended use, as well as the
zwitterionic forms, where possible, of the compounds of the
invention. The term "prodrug" refers to compounds that are rapidly
transformed in vivo to yield the parent compound of the above
formula, for example by hydrolysis in blood. A thorough discussion
is provided in T. Higuchi and V. Stella, Pro-drugs as Novel
Delivery Systems, Vol. 14 of the A.C.S. Symposium Series, and in
Edward B. Roche, ed., Bioreversible Carriers in Drug Design,
American Pharmaceutical Association and Pergamon Press, 1987, both
of which are incorporated herein by reference.
[0221] As described above, the pharmaceutical compositions of the
present invention additionally comprise a pharmaceutically
acceptable carrier, which, as used herein, includes any and all
solvents, diluents, or other liquid vehicle, dispersion or
suspension aids, surface active agents, isotonic agents, thickening
or emulsifying agents, preservatives, solid binders, lubricants and
the like, as suited to the particular dosage form desired.
Remington's Pharmaceutical Sciences, Fifteenth Edition, E. W.
Martin (Mack Publishing Co., Easton, Pa., 1975) discloses various
carriers used in formulating pharmaceutical compositions and known
techniques for the preparation thereof. Except insofar as any
conventional carrier medium is incompatible with the compounds of
the invention, such as by producing any undesirable biological
effect or otherwise interacting in a deleterious manner with any
other component(s) of the pharmaceutical composition, its use is
contemplated to be within the scope of this invention. Some
examples of materials which can serve as pharmaceutically
acceptable carriers include, but are not limited to, sugars such as
lactose, glucose and sucrose; starches such as corn starch and
potato starch; cellulose and its derivatives such as sodium
carboxymethyl cellulose, ethyl cellulose and cellulose acetate;
powdered tragacanth; malt; gelatin; talc; excipients such as cocoa
butter and suppository waxes; oils such as peanut oil, cottonseed
oil; safflower oil; sesame oil; olive oil; corn oil and soybean
oil; glycols; such a propylene glycol; esters such as ethyl oleate
and ethyl laurate; agar; buffering agents such as magnesium
hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water;
isotonic saline; Ringer's solution; ethyl alcohol, and phosphate
buffer solutions, as well as other non-toxic compatible lubricants
such as sodium lauryl sulfate and magnesium stearate, as well as
coloring agents, releasing agents, coating agents, sweetening,
flavoring and perfuming agents, preservatives and antioxidants can
also be present in the composition, according to the judgment of
the formulator.
[0222] Uses of Compounds and Pharmaceutical Compositions
[0223] In yet another aspect, according to the methods of treatment
of the present invention, physiological conditions are treated or
prevented in a subject such as a human, lower mammal, or other
organism, by administering to the patient a therapeutically
effective amount of an inventive compound or pharmaceutical
composition thereof, as described in detail above, in such amounts
and for such time as is necessary to achieve the desired result. In
certain embodiments of the present invention a "therapeutically
effective amount" of an inventive compound or pharmaceutical
composition is that amount effective for reducing the symptoms
associated with the physiological condition. In other preferred
embodiments, a "therapeutically effective amount" of an inventive
compound or pharmaceutical composition is that amount effective for
affecting the secretory pathway of a cell. Other "therapeutically
effective amounts" include amounts effective for inhibiting the
cell cycle, e.g., inhibiting the growth of cancer cells.
Alternatively or additionally, a "therapeutically effective amount"
is an amount that is effective for inhibiting or activating a
physiological process of interest, wherein the physiological
process is related to improving the health of the individual.
[0224] The compounds and compositions, according to the method of
the present invention, may be administered using any amount and any
route of administration effective for obtaining the physiological
result. Thus, the expression "therapeutically effective amount," as
used herein, refers to a nontoxic but sufficient amount of an
inventive compound to provide the desired treatment. The exact
amount required will vary from subject to subject, depending on the
species, age, and general condition of the subject, the severity of
the physiological condition (e.g., a proliferative disorder or
cancer), the particular compound, its mode of administration, and
the like. The compounds of the invention are preferably formulated
in dosage unit form for ease of administration and uniformity of
dosage. The expression "dosage unit form" as used herein refers to
a physically discrete unit of compound appropriate for the patient
to be treated. It will be understood, however, that the total daily
usage of the compounds and compositions of the present invention
will be decided by the attending physician within the scope of
sound medical judgment. The specific therapeutically effective dose
level for any particular patient or organism will depend upon a
variety of factors including the disorder being treated and the
severity of the disorder; the activity of the specific compound
employed; the specific composition employed; the age, body weight,
general health, sex and diet of the patient; the time of
administration, route of administration, and rate of excretion of
the specific compound employed; the duration of the treatment;
drugs used in combination or coincidental with the specific
compound employed; and like factors well known in the medical arts
(see Goodman and Gilman's, "The Pharmacological Basis of
Therapeutics", Tenth Edition, A. Gilman, J. Hardman and L. Limbird,
eds., McGraw-Hill Press, 155-173, 2001, which is incorporated
herein by reference in its entirety).
[0225] Furthermore, after formulation with an appropriate
pharmaceutically acceptable carrier in a desired dosage, the
pharmaceutical compositions of this invention can be administered
to humans and other animals orally, rectally, parenterally,
intracistemally, intravaginally, intraperitoneally, topically (as
by powders, ointments, or drops), bucally, as an oral or nasal
spray, or the like, depending on the severity of the condition
being treated. In certain embodiments, the compounds of the
invention may be administered orally or parenterally at dosage
levels of about 0.01 mg/kg to about 50 mg/kg and preferably from
about 0.1 mg/kg to about 25 mg/kg, of patient body weight per day,
one or more times a day, to obtain the desired therapeutic
effect.
[0226] Liquid dosage forms for oral administration include, but are
not limited to, pharmaceutically acceptable emulsions,
microemulsions, solutions, suspensions, syrups and elixirs. In
addition to the active compounds, the liquid dosage forms may
contain inert diluents commonly used in the art such as, for
example, water or other solvents, solubilizing agents and
emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl
carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate,
propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in
particular, cottonseed, groundnut, corn, germ, olive, castor, and
sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene
glycols and fatty acid esters of sorbitan, and mixtures thereof.
Besides inert diluents, the oral compositions can also include
adjuvants such as wetting agents, emulsifying and suspending
agents, sweetening, flavoring, and perfuming agents.
[0227] Injectable preparations, for example, sterile injectable
aqueous or oleaginous suspensions may be formulated according to
the known art using suitable dispersing or wetting agents and
suspending agents. The sterile injectable preparation may also be a
sterile injectable solution, suspension or emulsion in a nontoxic
parenterally acceptable diluent or solvent, for example, as a
solution in 1,3-butanediol. Among the acceptable vehicles and
solvents that may be employed are water, Ringer's solution, U.S.P.
and isotonic sodium chloride solution. In addition, sterile, fixed
oils are conventionally employed as a solvent or suspending medium.
For this purpose any bland fixed oil can be employed including
synthetic mono- or diglycerides. In addition, fatty acids such as
oleic acid are used in the preparation of injectables.
[0228] The injectable formulations can be sterilized, for example,
by filtration through a bacterial-retaining filter, or by
incorporating sterilizing agents in the form of sterile solid
compositions which can be dissolved or dispersed in sterile water
or other sterile injectable medium prior to use.
[0229] In order to prolong the effect of a drug, it is often
desirable to slow the absorption of the drug from subcutaneous or
intramuscular injection. This may be accomplished by the use of a
liquid suspension of crystalline or amorphous material with poor
water solubility. The rate of absorption of the drug then depends
upon its rate of dissolution which, in turn, may depend upon
crystal size and crystalline form. Alternatively, delayed
absorption of a parenterally administered drug form is accomplished
by dissolving or suspending the drug in an oil vehicle. Injectable
depot forms are made by forming microencapsule matrices of the drug
in biodegradable polymers such as polylactide-polyglycolide.
Depending upon the ratio of drug to polymer and the nature of the
particular polymer employed, the rate of drug release can be
controlled. Examples of other biodegradable polymers include
poly(orthoesters) and poly(anhydrides). Depot injectable
formulations are also prepared by entrapping the drug in liposomes
or microemulsions which are compatible with body tissues.
[0230] Compositions for rectal or vaginal administration are
preferably suppositories which can be prepared by mixing the
compounds of this invention with suitable non-irritating excipients
or carriers such as cocoa butter, polyethylene glycol or a
suppository wax which are solid at ambient temperature but liquid
at body temperature and therefore melt in the rectum or vaginal
cavity and release the active compound.
[0231] Solid dosage forms for oral administration include capsules,
tablets, pills, powders, and granules. In such solid dosage forms,
the active compound is mixed with at least one inert,
pharmaceutically acceptable excipient or carrier such as sodium
citrate or dicalcium phosphate and/or a) fillers or extenders such
as starches, lactose, sucrose, glucose, mannitol, and silicic acid,
b) binders such as, for example, carboxymethylcellulose, alginates,
gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants
such as glycerol, d) disintegrating agents such as agar-agar,
calcium carbonate, potato or tapioca starch, alginic acid, certain
silicates, and sodium carbonate, e) solution retarding agents such
as paraffin, f) absorption accelerators such as quaternary ammonium
compounds, g) wetting agents such as, for example, cetyl alcohol
and glycerol monostearate, h) absorbents such as kaolin and
bentonite clay, and i) lubricants such as talc, calcium stearate,
magnesium stearate, solid polyethylene glycols, sodium lauryl
sulfate, and mixtures thereof. In the case of capsules, tablets and
pills, the dosage form may also comprise buffering agents.
[0232] Solid compositions of a similar type may also be employed as
fillers in soft and hard-filled gelatin capsules using such
excipients as lactose or milk sugar as well as high molecular
weight polyethylene glycols and the like. The solid dosage forms of
tablets, dragees, capsules, pills, and granules can be prepared
with coatings and shells such as enteric coatings and other
coatings well known in the pharmaceutical formulating art. They may
optionally contain opacifying agents and can also be of a
composition that they release the active ingredient(s) only, or
preferentially, in a certain part of the intestinal tract,
optionally, in a delayed manner. Examples of embedding compositions
which can be used include polymeric substances and waxes. Solid
compositions of a similar type may also be employed as fillers in
soft and hard-filled gelatin capsules using such excipients as
lactose or milk sugar as well as high molecular weight polyethylene
glycols and the like.
[0233] The active compounds can also be in micro-encapsulated form
with one or more excipients as noted above. The solid dosage forms
of tablets, dragees, capsules, pills, and granules can be prepared
with coatings and shells such as enteric coatings, release
controlling coatings and other coatings well known in the
pharmaceutical formulating art. In such solid dosage forms the
active compound may be admixed with at least one inert diluent such
as sucrose, lactose or starch. Such dosage forms may also comprise,
as is normal practice, additional substances other than inert
diluents, e.g., tableting lubricants and other tableting aids such
a magnesium stearate and microcrystalline cellulose. In the case of
capsules, tablets and pills, the dosage forms may also comprise
buffering agents. They may optionally contain opacifying agents and
can also be of a composition that they release the active
ingredient(s) only, or preferentially, in a certain part of the
intestinal tract, optionally, in a delayed manner. Examples of
embedding compositions which can be used include polymeric
substances and waxes.
[0234] Dosage forms for topical or transdermal administration of a
compound of this invention include ointments, pastes, creams,
lotions, gels, powders, solutions, sprays, inhalants or patches.
The active component is admixed under sterile conditions with a
pharmaceutically acceptable carrier and any needed preservatives or
buffers as may be required. Ophthalmic formulation, ear drops, and
eye drops are also contemplated as being within the scope of this
invention. Additionally, the present invention contemplates the use
of transdermal patches, which have the added advantage of providing
controlled delivery of a compound to the body. Such dosage forms
can be made by dissolving or dispensing the compound in the proper
medium. Absorption enhancers can also be used to increase the flux
of the compound across the skin. The rate can be controlled by
either providing a rate controlling membrane or by dispersing the
compound in a polymer matrix or gel.
[0235] The invention further encompasses compounds and
pharmaceutical compositions employed in combination therapies, that
is, the compounds and pharmaceutical compositions can be
administered concurrently with, prior to, or subsequent to, one or
more other desired therapeutics or medical procedures The
particular combination of therapies (therapeutics or procedures) to
employ in a combination regimen will take into account
compatibility of the desired therapeutics and/or procedures and the
desired therapeutic effect to be achieved. It will also be
appreciated that the therapies employed may achieve a desired
effect for the same disorder, or they may achieve different
effects.
[0236] For example, other compounds that may be used in combination
with the compounds that can be provided using the structural
information of the present invention. For example, if the inventive
compound is a chemotherapeutic agent, a second or third
chemotherapeutic agent, such as cisplatin, may be administered with
the inventive compound to achieve the benefit of their combined
effects. As but another example, if the compound were to treat or
prevent a reproductive disorder, the inventive compound may be
administered with a hormone, such as testosterone or estrogen. For
a more comprehensive discussion regarding physiological conditions,
symptoms and treatment, see The Merck Manual, Seventeenth Ed. 1999,
the entire contents of which are hereby incorporated by
reference.
[0237] In certain embodiments, the pharmaceutical compositions of
the present invention may further comprise other therapeutically
active ingredients (e.g., chemotherapeutic and/or palliative). For
purposes of the invention, the term "Palliative" refers to
treatment that is focused on the relief of symptoms of a disease
and/or side effects of a therapeutic regimen, but is not curative.
For example, palliative treatment encompasses painkillers,
antinausea medications and anti-sickness drugs. In addition,
chemotherapy, radiotherapy and surgery can all be used palliatively
(that is, to reduce symptoms without going for cure; e.g., for
shrinking tumors and reducing pressure, bleeding, pain and other
symptoms of cancer).
[0238] In yet another aspect, the present invention also provides a
pharmaceutical pack or kit comprising one or more containers filled
with one or more of the ingredients of the pharmaceutical
compositions of the invention, and in certain embodiments, includes
an additional approved therapeutic agent for use as a combination
therapy. Optionally associated with such container(s) can be a
notice in the form prescribed by a governmental agency regulating
the manufacture, use or sale of pharmaceutical products, which
notice reflects approval by the agency of manufacture, use or sale
for human administration.
[0239] Methods of Treatment
[0240] In another embodiment, the compounds of the present
invention, e.g., compounds having cell cycle inhibitory activity or
kinesin (e.g., Eg5) inhibitory activity, may be administered to a
subject to treat or prevent cancer including, but are not limited
to, adenocarcinoma, leukemia, lymphoma, melanoma, myeloma, sarcoma,
and teratocarcinoma, and, in particular, cancers of the adrenal
gland, bladder, bone, bone marrow, brain, breast, cervix, gall
bladder, ganglia, gastrointestinal tract, heart, kidney, liver,
lung, muscle, ovary, pancreas, parathyroid, penis, prostate,
salivary glands, skin, spleen, testis, thymus, thyroid, and uterus,
to name a few.
[0241] In another embodiment, the compounds of the present
invention, e.g., inhibitors of Eg5, may be administered to a
subject to prevent or treat a proliferative disorder. Such
disorders may include, but are not limited to, disorders or
prolactin production; infertility including tubal disease,
ovulatory defects, and endometriosis; disruptions of the estrous
cycle, disruptions of the menstrual cycle, polycystic ovary
syndrome, ovarian hyperstimulation syndrome, endometrial and
ovarian tumors, autoimmune disorders, ectopic pregnancy, and
teratogenesis; cancer of the breast, fibrocystic breast disease,
and galactorrhea; and disruptions of spermatogenesis, abnormal
sperm physiology, cancer of the testis, cancer of the prostate,
benign prostatic hyperplasia, prostatitis, carcinoma of the male
breast, and gynecomastia.
[0242] As discussed above, the methods and compositions herein are
not limited to cancer. Disease states which can be treated by the
methods and compositions provided herein include, but are not
limited to, cancer (further discussed below), restenosis,
autoimmune disease, arthritis, graft rejection, inflammatory bowel
disease, proliferation induced after medical procedures, including,
but not limited to, surgery, angioplasty, and the like. It is
appreciated that in some cases the cells may not be in a hyper or
hypo proliferation state (abnormal state) and still require
treatment. For example, during wound healing, the cells may be
proliferating "normally", but proliferation enhancement may be
desired. Similarly, as discussed above, in the agriculture arena,
cells may be in a "normal" state, but proliferation modulation may
be desired to enhance a crop by directly enhancing growth of a
crop, or by inhibiting the growth of a plant or organism which
adversely affects the crop. Thus, in one embodiment, the invention
herein includes application to cells or individuals afflicted or
impending affliction with any one of these disorders or states.
[0243] In certain embodiments, the compositions and methods
provided herein are useful for the treatment of cancer including
solid tumors such as skin, breast, brain, cervical carcinomas,
testicular carcinomas, etc. More particularly, cancers that may be
treated by the compositions and methods of the invention include,
but are not limited to: Cardiac: sarcoma (angiosarcoma,
fibrosarcoma, rhabdomyosarcoma, liposarcoma), myxoma, rhabdomyoma,
fibroma, lipoma and teratoma; Lung: bronchogenic carcinoma
(squamous cell, undifferentiated small cell, undifferentiated large
cell, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial
adenoma, sarcoma, lymphoma, chondromatous hamartoma, mesothelioma;
Gastrointestinal: esophagus (squamous cell carcinoma,
adenocarcinoma, leiomyosarcoma, lymphoma), stomach (carcinoma,
lymphoma, leiomyosarcoma), pancreas (ductal adenocarcinoma,
insulinoma, glucagonoma, gastrinoma, carcinoid tumors, vipoma),
small bowel (adenocarcinoma, lymphoma, carcinoid tumors, Karposi's
sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma),
large bowel (adenocarcinoma, tubular adenoma, villous adenoma,
hamartoma, leiomyoma); Genitourinary tract: kidney (adenocarcinoma,
Wilm's tumor [nephroblastoma], lymphoma, leukemia), bladder and
urethra (squamous cell carcinoma, transitional cell carcinoma,
adenocarcinoma), prostate (adenocarcinoma, sarcoma), testis
(seminoma, teratoma, embryonal carcinoma, teratocarcinoma,
choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma,
fibroadenoma, adenomatoid tumors, lipoma); Liver: hepatoma
(hepatocellular carcinoma), cholangiocarcinoma, hepatoblastom,
angiosarcoma, hepatocellular adenoma, hemangioma; Bone: osteogenic
sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous
histiocytoma, chondrosarcoma, Ewing's sarcoma, malignant lymphoma
(reticulum cell sarcoma), multiple myeloma, malignant giant cell
tumor chordoma, osteochronfroma (osteocartilaginous exostoses),
benign chondroma, chondroblastoma, chondromyxofibroma, osteoid
osteoma and giant cell tumors; Nervous system: skull (osteoma,
hemangioma, granuloma, xanthoma, osteitis deformans), meninges
(rheningioma, meningiosarcoma, gliomatosis), brain (astrocytoma,
medulloblastoma, glioma, ependymoma, germinoma [pinealoma,
glioblastoma multiform, oligodendroglioma, schwannoma,
retinoblastoma, congenital tumors), spinal cord neurofibroma,
meningioma, glioma, sarcoma); Gynecological: uterus (endometrial
carcinoma), cervix (cervical carcinoma, pre-tumor cervical
dysplasia), ovaries (ovarian carcinoma [serous cystadenocarcinoma,
mucinous cystadenocarcinoma, unclassified carcinoma],
granulosa-thecal cell tumors, Sertoli-Leydig cell tumors,
dysgerminoma, malignant teratoma), vulva (squamous cell carcinoma,
intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma),
vagina (clear cell carcinoma, squamous cell carcinoma, botryoid
sarcoma [embryonal rhabdomyosarcoma], fallopian tubes (carcinoma);
Hematoloaic: blood (myeloid leukemia [acute and chronic], acute
lymphoblastic leukemia, chronic lymphocytic leukemia,
myeloproliferative diseases, multiple myeloma, myelodysplastic
syndrome), Hodgkin's disease, non-Hodgkin's lymphoma [malignant
lymphoma]; Skin: malignant melanoma, basal cell carcinoma, squamous
cell carcinoma, Karposi's sarcoma, moles dysplastic nevi, lipoma,
angioma, dermatofibroma, keloids, psoriasis; and Adrenal glands:
neuroblastoma. The cancer can be solid tumors or metastatic. Thus,
the term "cancerous cell" as provided herein, includes a cell
afflicted by any one of the above identified conditions.
[0244] Those skilled in the art will appreciate that the invention
is by no means limited to the treatment of the above disorders, but
can be used to treat any disorder that may be identified by a
practicing physician and which symptoms may be decreased by the
compounds of the invention.
[0245] In another aspect, diagnostic assays are provided herein. In
one embodiment, the cellular proliferation sequences are used in
the diagnostic assays. This can be done on an individual gene or
corresponding polypeptide level. In a preferred embodiment, the
expression profiles are used, preferably in conjunction with high
throughput screening techniques to allow monitoring for expression
profile genes and/or corresponding polypeptides. In a preferred
embodiment, in situ hybridization of labeled cellular proliferation
nucleic acid probes to tissue arrays is done. For example, arrays
of tissue samples, including cellular proliferation tissue in
various states and or time points and/or normal tissue, are made.
In situ hybridization as is known in the art can then be done. It
is understood that conventional antibody and protein localization
methods can also be used in diagnostic assays herein.
EQUIVALENTS
[0246] The representative examples which follow are intended to
help illustrate the invention, and are not intended to, nor should
they be construed to, limit the scope of the invention. Indeed,
various modifications of the invention and many further embodiments
thereof, in addition to those shown and described herein, will
become apparent to those skilled in the art from the full contents
of this document, including the examples which follow and the
references to the scientific and patent literature cited herein. It
should further be appreciated that the contents of those cited
references are incorporated herein by reference to help illustrate
the state of the art. The following examples contain important
additional information, exemplification and guidance which can be
adapted to the practice of this invention in its various
embodiments and the equivalents thereof.
EXEMPLIFICATION
Example 1
Synthesis of Inventive Compounds
[0247] I. Description of Synthetic Methods
[0248] Small molecules have been used to explore many facets of
biology for over a century. However, research in biology is not
routinely performed using this approach, in the way that it is with
biochemical, genetic, and increasingly, genomic approaches. Several
problems limit the use of the former approach. Arguably, the
primary one is the lack of routine access to structurally complex
and diverse small molecules that can be used to modulate biological
systems. There are examples of simple, achiral modulators of
biological systems, notably "drug-like" molecules, though in these
cases the smaller size and complexity of the species have more to
do with delivery and pharmacokinetic parameters than with affinity
and selectivity for a protein target. Without wishing to be bound
to any particular theory, we propose that structurally complex and
diverse collections of "natural product-like", rather than
"drug-like" molecules will be better suited as biological probes.
Diversity-oriented organic synthesis, especially when coupled with
an economical and efficient technology platform, offers the means
to change this situation, as it aims to synthesize complex and
diverse small molecules efficiently (S. L. Schreiber, Science 2000,
287, 1964-1969). Diversity-oriented synthesis represents a
versatile tool to chemical genetics, which aims to explore biology
with small molecules in a systematic way (See for example, (a) T.
J. Mitchison, Chem. Biol. 1994, 1, 3-6; (b) S. L. Schreiber,
Bioorg. Med. Chem. 1998, 6, 1127-1152; (c)
http://www-schreiber.chem.harvard.edu; and
http://iccb.med.harvard.edu).
[0249] Though enantioselective catalysis is often used in
target-oriented synthesis, it is still relatively under explored in
diversity-oriented synthesis (See, for example, a) D. S. Tan, M. A.
Foley, M. D. Shair, S. L. Schreiber, J. Am. Chem. Soc. 1998, 120,
8565-8566; b) D. S. Tan, M. A. Foley, B. R. Stockwell, M. D. Shair,
S. L. Schreiber, J. Am. Chem. Soc. 1999, 121, 9073-9087; c) D. Lee,
J. K. Sello, S. L. Schreiber, J. Am. Chem. Soc. 1999, 121,
10648-10649; d) D. R. Spring, S. Krishnan, S. L. Schreiber, J. Am.
Chem. Soc. 2000, 122, 5656-5657; e) S. M. Sternson, J. B. Louca, J.
C. Wong, S. L. Schreiber, J. Am. Chem. Soc. 2001, 123,
1740-1747).
[0250] For other approaches to asymmetric diversity synthesis, see:
a) J. S. Panek, B. Zhu, J. Am. Chem. Soc. 1997, 119, 12022-12023;
b) D. A. Annis, O. Helluin, E. N. Jacobsen, Angew. Chem. 1998, 110,
2010-2012; Angew. Chem., Int. Ed. Engl. 1998, 37, 1907-1909; c) M.
Reggelin, V. Brenig, R. Welcker, Tetrahedron Lett. 1998, 39,
4801-4804; d) N. Zou, B. Jiang, J. Comb. Chem. 1999, 2, 6-7; e) S.
Henessian, J. Ma, W. Wang, Tetrahedron Lett. 1999, 40, 4631; f) I.
Paterson, M. Donghi, K. Gerlach, Angew. Chem., Int. Ed. 2000, 39,
3315-3319.
[0251] In certain embodiments, reactions catalyzed by
bis(oxazoline) metal Lewis acid complexes were explored because of
their high efficiency, selectivity, and broad substrate tolerance
(See, a) J. S. Johnson, D. A. Evans, Acc. Chem. Res. 2000, 33,
325-335; b) K. A. Jorgensen, M. Johannsen, S. Yao, H. Audrain, J.
Thorhauge, Acc. Chem. Res. 1999, 32, 605-613). In certain exemplary
embodiments, inverse electron demand heterocycloadditions of vinyl
ethers and .beta.,.chi.-unsaturated ketoesters (FIG. 2) were
investigated. See, a) D. A. Evans, J. S. Johnson, E. J. Olhava, J.
Am. Chem. Soc. 2000, 122, 1635-1649; b) D. A. Evans, E. J. Olhava,
J. S. Johnson, J. M. Janey, Angew. Chem. 1998, 110, 3554-3557;
Angew. Chem. Int. Ed. 1998, 37, 3372-3375; c) J. Thorhauge, M.
Johannsen, K. A. Jorgensen, Angew. Chem. 1998, 110, 2543-2546;
Angew. Chem. Int. Ed. 1998, 37, 2404-2406.
[0252] An account of related cycloadditions on solid support has
been described (S. Leconte, G. Dujardin, E. Brown, Eur. J. Org.
Chem. 2000, 639-643. For a related heterocycloaddition on solid
support see: F. Tietze, T. Hippe, A. Steinmetz, Synlett 1996,
1043-1044. For a report of an asymmetric cycloaddition with
external control on a solid support, see reference 5d); however,
the reported reactions were performed in the presence of achiral
catalysts and with the heterodiene bound to the polystyrene (PS)
solid support through the ester. In certain embodiments, this mode
of cycloaddition was initially investigated and found to be highly
selective when using the enantiomerically pure catalysts (S)- or
(R)-1 [(a) D. A. Evans, J. S. Johnson, E. J. Olhava, J. Am. Chem.
Soc. 2000, 122, 1635-1649; b) D. A. Evans, E. J. Olhava, J. S.
Johnson, J. M. Janey, Angew. Chem. 1998, 110, 3554-3557; Angew.
Chem. Int. Ed. 1998, 37, 3372-3375; c) J. Thorhauge, M. Johannsen,
K. A. Jorgensen, Angew. Chem. 1998, 110, 2543-2546; Angew. Chem.
Int. Ed 1998, 37, 2404-2406].
[0253] In certain exemplary embodiments, support-bound vinyl ethers
were used, that were linked to the macrobead through either carbon
or oxygen. This approach was found to be more effective with regard
to effective functionalization of the cycloadduct.
[0254] Described herein is an application of this asymmetric
cycloaddition reaction to the synthesis of dihydropyrancarboxamides
on high capacity, 500-600 .mu.m PS macrobeads in a one bead-one
stock solution technology platform. The diversity pathway explored
resulted in the highly diastereo- and enantioselective synthesis of
4320 encoded small molecules [See (a) M. H. J. Ohlmeyer, R. N.
Swanson, L. W. Dillard, J. C. Reader, G. Asouline, R. Kobayashi, M.
Wigler, W. C. Still, Proc. Natl. Acad. Sci. USA. 1993, 90,
10922-10926; (b) H. P. Nestler, P. A. Bartlett, W. C. Still J. Org.
Chem. 1994, 59, 4723-4724; and (c) H. E. Blackwell, L. Perez, S. L.
Schreiber, Angew. Chem. Int. Ed. 2001, 40(18), 3421-3425], which
were arrayed as 5 mM stock solutions from individual beads, each
containing predominantly a single dihydropyrancarboxamide. These
stock solutions permit many phenotypic and proteomic assays to be
performed. For a description of a fully automated procedure for
deriving and arraying stock solutions from the
dihydropyrancarboxamide-containing macrobead, see Paul A. Clemons
et al., "A one-bead, one-stock solution approach to chemical
genetics: Part 2"; Chemistry & Biology, 2001, 8:1183-1195.
[0255] Collections of vinyl ethers and unsaturated ketoesters were
first synthesized and were used as candidate partners for the
cycloaddition reaction. Depicted below are the vinyl ethers that
were synthesized for the study: ##STR38## ##STR39##
[0256] Depicted below are the unsaturated ketoesters that were
synthesized for the study: ##STR40## ##STR41##
[0257] One of ordinary skill in the art will recognize that other
vinyl ether and/or unsaturated ketoester building blocks may be
used to practice the invention, leading to the preparation of
dihydropyrancarboxamides other than those disclosed in the
Exemplification herein, without departing from the scope of the
invention.
[0258] In certain embodiments, each of the vinyl ethers BB1A-N was
loaded onto pools of PS macrobeads via the in situ generated silyl
triflate 3 as depicted in Scheme 2. The support-bound vinyl ethers
were then treated with heterodienes (either BB2-B, R=phenyl or
BB2-E, R=4-piperonyl) (3 equiv) in tetrahydrofuran (THF) in the
presence of 20 mol % of the t-Bu BOX--Cu(OTf).sub.2 complex ((S)-
or (R)-1) and 4 .ANG. molecular sieves to provide support-bound
cycloadducts (not shown) [Note: After surveying several
loading/ligand/metal/solvent combinations, 20 mol % of 1 in THF was
found to provide the best combination of kinetics and selectivity].
Both enantiomers of the ligand were used in separate reactions to
obtain a duplicate result and to detect potential
matched/mismatched pairs when chiral starting materials were used.
After washing and drying steps, each of the cycloadducts was
cleaved from the silyl ether linker with hydrogen fluoride-pyridine
(HF-py) and analyzed for purity using .sup.1H NMR spectroscopy and
mass spectrometry (LC-MS). ##STR42## ##STR43##
[0259] These studies showed that support-bound vinyl ethers with
amino or amido functionality led to low conversion, and the
support-bound form of bis(vinyl ether) BB1-N underwent a single,
rather than the desired double, cycloaddition, even when a
stoichiometric amount of the copper complex was used. The chiral
vinyl ether derived from threitol (support-bound form of BB1-I)
reacted efficiently with only the (S)-enantiomer of the catalyst,
suggesting that double diastereoselection was taking place (see
below). Upon treatment of the corresponding PS macrobeads with
HF-py, the remaining vinyl ethers studied provided high purity
cycloadducts 4-6 (Table 1). The ethenyl ethers BB1-A, B, G, H also
yielded dihydropyrans 4 in high diastereo- and enantioselectivity
(The configurations of the cycloadducts were assigned by analogy.
See D. A. Evans, J. S. Johnson, E. J. Olhava, J. Am. Chem. Soc.
2000, 122, 1635-1649; and J. Thorhauge, M. Johannsen, K. A.
Jorgensen, Angew. Chem. 1998, 110, 2543-2546; Angew. Chem. Int. Ed.
1998, 37, 2404-2406). Both configurations of substituted enol
ethers BB1-C--F led to good to high diastereoselectivity of the
tetrasubstituted dihydropyrans 5 and 6. Although previous results
had shown high diastereoselectivity with cyclic vinyl ethers (See
D. A. Evans, J. S. Johnson, E. J. Olhava, J. Am. Chem. Soc. 2000,
122, 1635-1649; and J. Thorhauge, M. Johannsen, K. A. Jorgensen,
Angew. Chem. 1998, 110, 2543-2546; Angew. Chem. Int. Ed. 1998, 37,
2404-2406), we found that Z-configured enol ethers (BB1-D, F)
provided only moderate diastereoselection, whereas the E-enol
ethers (BB1-C, E) resulted in high levels of diastereoselection.
Without wishing to be bound to any particular theory, we propose
that the lower diastereoselectivity in the Z-enol ether
cycloadditions may arise from an endo-exo switch in the transition
structure for cycloaddition. It was thought unlikely that
isomerization of the alkenyl ether and epimerization of the acetal
center is/are responsible for the lower selectivity. TABLE-US-00001
TABLE 1 Asymmetric cycloadditions of resin-bound vinyl ethers
BB1..sup.[i] ##STR44## ##STR45## ##STR46## ##STR47## purity, BB1-
BB2- product %.sup.[ii] dr.sup.[iii] er.sup.[iv] A E 7-A-E
.gtoreq.95 .gtoreq.15/1 .gtoreq.49/1 B E 7-B-E .gtoreq.95
.gtoreq.15/1 .gtoreq.24/1 C B 9-C-B .gtoreq.95 .gtoreq.20/1
.gtoreq.49/1 D B 8-D-B .gtoreq.95 .gtoreq.5/1 .gtoreq.30/1 E B
9-E-B .gtoreq.95 .gtoreq.20/1 .gtoreq.49/1 F B 8-D-B .gtoreq.95
.gtoreq.10/1 .gtoreq.30/1 G E 7-G-E .gtoreq.95 .gtoreq.30/1
.gtoreq.49/1 H E 7-G-E .gtoreq.95 .gtoreq.20/1 .gtoreq.24/1
.sup.[i]Reactions were performed with 20 mol % of (S)-1 or (R)-1;
the results presented are an average of the two runs.
.sup.[ii]Estimated based on .sup.1H NMR analysis and HPLC-ESIMS.
.sup.[iii]Determined by .sup.1H NMR analysis and/or CSP HPLC or CSP
SFC. .sup.[iv]Determined by CSP HPLC or CSP SFC.
[0260] We next turned our attention to the substitution on the
heterodiene partner. In most instances, treatment of the
support-bound vinyl ether BB1-H with a variety of hetereodienes
under the previous conditions again led to highly pure cycloadducts
following HF-py cleavage from the PS macrobeads (Table 2), though
again amine functionality (BB2-K) was incompatible. Similar to the
case above with the threitol-derived vinyl ether, only the
(S)-enantiomer of the catalyst efficiently provided cycloadduct
with the mannose-derived heterodiene BB2-L. Overall, ten
heterodienes (BB2-A-J) resulted in somewhat variable, but uniformly
high diastereo- and enantioselectivities and high purities based on
.sup.1H NMR spectroscopy and LC-MS analyses. These building blocks
were chosen for subsequent incorporation into the library
synthesis. TABLE-US-00002 TABLE 2 Asymmetric cycloadditions of
resin-bound vinyl ether 4-H with heterodienes..sup.[i] ##STR48##
##STR49## ##STR50## purity, BB2- products %.sup.[ii] dr.sup.[iii]
er.sup.[iv] A 10-H-A .gtoreq.95 .gtoreq.16/1 .gtoreq.16/1 B 10-H-B
.gtoreq.95 .gtoreq.20/1 .gtoreq.24/1 C 10-H-C .gtoreq.95
.gtoreq.9/1 .gtoreq.24/1 D 10-H-D .gtoreq.95 .gtoreq.9/1
.gtoreq.9/1 E 10-H-E .gtoreq.95 .gtoreq.20/1 .gtoreq.24/1 F 10-H-F
.gtoreq.95 .gtoreq.25/1 .gtoreq.24/1 G 10-H-G .gtoreq.95
.gtoreq.9/1 .gtoreq.49/1 H 10-H-H .gtoreq.95 .gtoreq.15/1
.gtoreq.24/1 I 10-H-I .gtoreq.95 .gtoreq.12/1 .gtoreq.49/1 J 10-H-J
.gtoreq.95 .gtoreq.9/1 .gtoreq.49/1 .sup.[i]Reactions were
performed with 20 mol % of (S)-1 or (R)-1; the results presented
are an average of the two runs. .sup.[ii]Estimated based on .sup.1H
NMR analysis and HPLC-ESIMS. .sup.[iii]Determined by .sup.1H NMR
analysis and/or CSP HPLC or CSP SFC. .sup.[iv]Determined by CSP
HPLC or CSP SFC.
[0261] Further functionalization of the cycloadducts was then
pursued. Conversion of the support-bound cycloadduct 7-H-E, upon
treatment with (PPh.sub.3).sub.4Pd and thiosalicylic acid, to the
corresponding acid 11-H-E was achieved in high purity (Scheme 2).
Treatment of the support-bound acid 11-H-E with 20 equiv of
benzylamine, PyBOP, and diisopropylethylamine in 3:1
CH.sub.2Cl.sub.2:DMF led to the desired benzylamide. These
conditions were applied to a diverse collection of amines and
support-bound acid 11-H-E to select 25 amines for use in the
library synthesis: ##STR51## ##STR52## ##STR53##
[0262] These pathway development studies were necessary to select
the reactions and building blocks for a library realization that
would result in single compound stock solutions from individual
macrobeads. The library synthesis was initiated with sufficient PS
macrobeads (13,000) to produce, on average, three beads containing
each theoretical compound. The chosen vinyl ethers were attached to
the supports, and following the initial cycloaddition step, the two
enantiomeric sets of cycloadducts were not pooled. (Each set
includes cycloadduct attached to either the C1 oxygen or C2 carbon
of the dihydropyran ring.) Instead, the two sets were carried
through the remaining steps in parallel in order to provide an
independent means (when coupled to mass spectrometry) to assess the
ability of tags to infer the absolute configuration of library
members (See Scheme 3). The supports were not repooled following
the amide coupling, thereby reducing the number of chemical
encoding steps to which the macrobeads were subjected and
simplifying the decoding of library members. In the end, 54
separate portions of macrobeads were produced (50 portions
containing dihydropyrancarboxamides, 2 containing
dihydropyrancarboxylic acids, and 2 containing
dihydropyrancarboxylic esters), each containing, theoretically,
three copies of 80 compounds for a total of 4320 distinct,
spatially-segregated, and stereochemically-defined dihydropyran
derivatives.
[0263] In order to analyze the purity of members of the library,
two macrobeads from each of the above 54 pools were removed,
arrayed, treated with HF-py, and fractions of the eluted products
(10 .mu.L of 5 mM stock solutions) were assayed by LC-MS (See H. E.
Blackwell, L. Perez, S. L. Schreiber, Angew. Chem. Int. Ed. 2001,
40(18), 3421-3425). In summary, 78 samples (72%) were .gtoreq.95%
pure, 93 samples (86%) were .gtoreq.90% pure, 104 samples (96%)
were .gtoreq.75% pure, and the remaining 4 samples were of roughly
50% purity. Direct structure determination by MS was successful in
83/108 cases (e.g., for 25 of the 108 samples, the molecular ion
observed upon ionization corresponded to a fragment of the
compound), and indirect structure inference by decoding of the
chloroaromatic diazoketone tags (See for example, H. P. Nestler, P.
A. Bartlett, W. C. Still J. Org. Chem. 1994, 59, 4723-4724; and H.
E. Blackwell, L. Perez, S. L. Schreiber, Angew. Chem. Int. Ed.
2001, 40(18), 3421-3425) was successful in 108/108 cases.
##STR54##
[0264] Although the Examples described herein disclose a synthesis
of the inventive library using stereochemistry as a diversity
element whereby only one of two potential diastereomers (for the
unsubstituted vinyl ethers) was accessed, it is to be understood
that other reagents (e.g., catalyst) and/or reaction conditions may
be used that would allow access to the full set of diastereomers,
without departing from the scope of the invention. For example, the
present invention encompasses the use of catalyst systems with
truly complete external control over enantioselectivity and
diastereo-selectivity to allow access to stereoselective catalysis
in diversity-oriented organic synthesis. In addition, in one
aspect, the present invention discloses a novel approach whereby
asymmetric heterocycloaddition reaction is applied to solid phase
(To the best of our knowledge, this is the first report of the use
of a sub-stoichiometric amount of chiral controller to perform a
carbon-carbon bond forming reaction on solid phase). Additionally,
in another aspect, the present invention describes the generation
of spatially-segregated stock solutions from individual macrobeads,
which renders the inventive compounds amenable to both phenotypic
and protein-binding assays. In addition, their common primary
hydroxyl group ensures that every compound can be robotically
arrayed onto a glass microscope slide for protein-binding assays
[a) G. Macbeath, A. N. Koehler, S. L. Schreiber, J. Am. Chem. Soc.
1999, 121, 7967-7968; b) P. J. Hergenrother, K. M. Depew, S. L.
Schreiber, J. Am. Chem. Soc. 2000, 122, 7849-7850]. Indeed, small
molecule microarrays of the dihydropyrancarboxamides have already
been manufactured and screened, leading to the discovery of a small
molecule that binds to a protein of interest.
[0265] II. Experimental Protocol
[0266] General Methods. Reagents were obtained from commercial
sources and used without purification. Reaction solvents (THF, DMF,
CH.sub.2Cl.sub.2) were obtained from J. T. Baker (HPLC grade) and
purified by passage through two solvent columns prior to use. The
CH.sub.2Cl.sub.2 purification system was composed of one activated
alumina (A-2) column and one supported copper redox catalyst (Q-5
reactant) column. The THF purification system was composed of two
activated alumina (A-2) columns and the DMF purification system is
composed of two activated molecular sieve columns. [See: A. B.
Pangborn, M. A. Giardello, R. H. Grubbs, R. K. Rosen, F. J.
Timmers, Organometallics 1996, 15, 1518-1520.] Triethylamine,
diisopropylethylamine, and 2,6-lutidine were distilled from
CaH.sub.2. Brominated polystyrene resin (Br--PS, 2 meq/g) was
obtained from Polymer Labs, and functionalized with the
silicon-based linker according to the reported protocol (See J. A.
Tallarico, K. M. Depew, H. E. Pelish, N. J. Westwood, C. W.
Lindsley, M. D. Shair, S. L. Schreiber, M. A. Foley, J. Comb. Chem.
2001, 3, 312-318).
2,2'-Isopropylidenebis[(4S)-4-t-butyl-2-oxazoline] was purchased
from Aldrich, while the enantiomer,
2,2'-Isopropylidenebis[(4R)-4-t-butyl-2-oxazoline] was prepared as
previously described starting for (R)-t-leucine (See D. A. Evans,
G. S. Peterson, J. S. Johnson, D. M. Barnes, K. R. Campos, K. A.
Woerpel, J. Org. Chem. 1998, 63, 4541-4544). Flash chromatography
was performed on E. Merck 60 230-400 mesh silica gel. TLC was
performed on 0.25 mm E Merck silica gel F.sub.254 plates and
visualized by UV, cerium ammonium molybdate and/or I.sub.2. NMR
spectra were recorded on a Varian Mercury 400 (400 MHz .sup.1H, 100
MHz .sup.13C), Varian Unity 500 (500 MHz .sup.1H) or Varian Unity
600 (600 MHz .sup.1H). Chemical shifts are quoted in ppm and
reference to TMS or residual protonated solvent. Mass spectra were
obtained on a Jeol AX-505H or SX-102A mass spectrometer.
[0267] Solid Phase Reactions. All solid phase reactions were
conducted in oven dried glass vials under an atmosphere of dry Ar,
with mixing provide by a VWR Vortex Genie-2 vortexer. Resin
washings were performed in 2 mL fritted polypropylene Bio-Spin.RTM.
chromatography columns (BioRad) or 10 mL fritted polypropylene
PD-10 columns (Pharmacia Biotech) with 360.degree. rotation on a
Barnstead-Thermolyne Labquake.TM. shaker. For cleavage reactions,
resin samples were transferred to Eppendorf tubes and a cleavage
cocktail comprising 85/10/5 THF/py/HF-py was added and the samples
were vortexed for 1-2 h at rt. The samples were then treated with
methoxytrimethylsilane and vortexed for an additional 30 min. The
samples were then filtered through a pipette plugged with glass
wool, the resin washed with additional THF and the filtrate
concentrated.
[0268] (a) Synthesis of Vinyl Ethers
(E)-5-Ethoxy-pent-4-en-1-ol
[0269] ##STR55##
[0270] 5-Ethoxy-pent-4-yn-1-ol (1.28 g, 10.0 mmol, 1.0 equiv) in
THF (2 mL) was added to a suspension LiAlH.sub.4 (0.80 g, 21 mmol,
2.1 equiv) in THF (20 mL) and the resulting solution was stirred at
rt for 16 h. At this time 0.8 mL of H.sub.2O was added dropwise,
followed by 0.8 mL of 15% NaOH, then 2.4 mL of H.sub.2O. Eventually
(30 min) white solids formed, the mixture was filtered and the
solids were extensively washed with EtOAc. The filtrate and
washings were combined, dried (Na.sub.2SO.sub.4), filtered, and the
filtrate was concentrated to give and oil which was purified by
column chromatography (6/1 hexanes/EtOAc) to give 1.14 g (88%) of
the vinyl ether BB1-C as a clear colorless oil with better than
19/1 E/Z selectivity (.sup.1H NMR): .sup.1H NMR (500 MHz) 6.24 (d,
J=12.7, 1H, HC (5)); 4.76 (dt, J=12.7, 7.3, 1H, HC (4)); 3.69 (q,
J=6.8, 2H, H.sub.2C (1')); 3.65 (q, J=5.3, 2H, H.sub.2C (1')); 2.01
(q, J=7.3, 2H, H.sub.2C (3)); 1.60 (quint, J=7.3, 2H, H.sub.2C
(2)); 1.39 (t J=5.4, 1H, OH); 1.25 (t, J=6.8, 3H, H.sub.3C (2'));
.sup.13C NMR (100 MHz) 146.12; 103.26; 64.56; 61.99; 33.46; 24.08;
14.85.
tert-Butyl-{2-[2-(2-chloro-ethoxy)-ethoxy]-ethoxy}-dimethyl-silane
[0271] ##STR56##
[0272] Triethylamine (9.2 mL, 66 mmol, 1.2 equiv), DMAP (0.67 g,
5.5 mmol, 0.1 equiv) and TBSCl (9.1 g, 60.5 mmol, 1.1 equiv) were
dissolved in CH.sub.2Cl.sub.2 (60 mL). The
2-chloro(ethoxyethoxy)ethanol (8.0 mL, 55.0 mmol, 1.0 equiv) was
added dropwise over 5 min, then the mixture was stirred at rt for
1.5 h. The reaction mixture was poured into H.sub.2O and extracted
with EtOAc, the combined organic layers were washed with brine,
dried (MgSO.sub.4), filtered and concentrated to give a cloudy oil
which was passed through a short column of silica gel eluting with
9/1 hexane/EtOAc to give 14.8 g (96%) of the silyl ether as a
clear, colorless oil: .sup.1H NMR (500 MHz) 3.74 (q, J=5.4, 4H,
H.sub.2C (1'') and H.sub.2C (2)); 3.64 (s, 4H, H.sub.2C (1') and
H.sub.2C (2')); 3.60 (t, J=5.9, 2H, H.sub.2CO); 3.54 (t, J=5.9, 2H,
H.sub.2CO)); 0.87 (s, 9H, H.sub.3CCSi); 0.04 (s, 6H, H.sub.3CSi)
.sup.13C NMR (100 MHz) .delta.2.67; 71.31; 70.68; 70.66; 42.59;
25.86; 18.30; -5.34.
2-[2-(4-Ethoxy-but-3-ynyloxy)-ethoxy]-ethanol
[0273] ##STR57##
[0274]
tert-Butyl-{2-[2-(2-chloro-ethoxy)-ethoxy]-ethoxy}-dimethyl-silane
was converted to the corresponding iodide by refluxing with 5 equiv
of NaI in 2-butanone for 6 h. This was then alkynylated and
deprotected by the same process described above to provide
E-5-Ethoxy-pent-4-en-1-ol: .sup.1H NMR (500 MHz) 4.02 (q, J=6.8,
2H, H.sub.2C (5'')); 3.74-3.70 (m, 2H, HCO); 3.68-3.66 (m, 2H,
HCO); 3.64-3.60 (m, 4H, HCO); 3.54 (t, J=7.3, 2H, H.sub.2CO)); 2.49
(t, J=6.3, 1H, OH); 2.41 (t, J 7.3, 2H, H.sub.2CO); 1.33 (t, J=7.3,
3H, H.sub.3C (6'')); .sup.13C NMR (100 MHz) 128.24; 89.89; 73.91;
72.47; 70.56; 70.25; 70.14; 61.66; 18.38; 14.26; MS (CI, NH.sub.3)
220 (M+NH.sub.4); 186.
(Z)-5-Ethoxy-pent-4-en-1-ol
[0275] ##STR58##
[0276] 5-Ethoxy-pent-4-yn-1-ol (1.28 g, 10 mmol) and Lindlar
catalyst (400 mg) were combined in EtOAc (20 mL) containing
pyridine (1 mL). This mixture was hydrogenated at rt under 1 atm of
H.sub.2 for 16 h, then filtered through celite and poured into
H.sub.2O. The organic later was washed with sat. CuSO.sub.4,
H.sub.2O and brine, then dried (Na.sub.2SO.sub.4), filtered, and
the filtrate concentrated to give an oil which was purified by
column chromatography (6/1 hexanes/EtOAc) to give 0.91 g (70%) of
the vinyl ether BB1-D as a slightly yellow oil with better than
25/1Z/E selectivity (.sup.1H NMR): .sup.1H NMR (500 MHz) 6.01 (d,
J=6.4, 1H, HC (5)); 4.36 (q, J=7.8, 1H, HC (4)); 3.79 (q, J=7.3,
2H, H.sub.2C (1')); 3.63 (t, J=6.3, 2H, H.sub.2C (1); 2.17 (q,
J=7.8, 2H, H.sub.2C (3)); 2.06 (br s, 1H, OH); 1.59 (quint, J=6.3,
2H, H.sub.2C (2)); 1.25 (t, J=7.3, 3H, H.sub.3C2')); .sup.13C NMR
(100 MHz) 145.20; 105.45; 67.55; 61.56; 31.83; 19.71; 15.18.
(E)-2-[2-(4-Ethoxy-but-3-enyloxy)-ethoxy]-ethanol
[0277] ##STR59##
[0278] The procedure described above for the synthesis of BB1-C
provided the Z-vinyl ether BB1-E: .sup.1H NMR (500 MHz) 6.29 (d,
J=12.7, 1H, HC (4'')); 4.73 (dt, J=12.2, 7.8, 1H, HC (3''));
3.76-3.64 (m, 6H, H.sub.2CO); 3.62-3.59 (m, 4H, H.sub.2CO); 3.44
(t, J=6.8, 2H, H.sub.2C (1'')); 2.21 (qd, J=7.3, 1.0, 2H, H.sub.2C
(2'')); 1.25 (t, J=7.3, 3H, H.sub.3C (6'')); .sup.13C NMR (100 MHz)
147.41; 99.52; 72.44; 71.97; 70.25; 70.05; 64.44; 61.59; 28.13;
14.60; MS (CI, NH.sub.3) 222 (M+NH.sub.4); 176.
(Z)-2-[2-(4-Ethoxy-but-3-enyloxy)-ethoxy]-ethanol
[0279] ##STR60##
[0280] The procedure described above for the synthesis of BB1-D
provided the Z-vinyl ether BBL-F: .sup.1H NMR (400 MHz) 5.99 (dt,
J=6.3, 1.5, 1H, HC (4'')); 4.36 (q, J=6.3, 1H, HC (3'')); 3.77 (q,
J=6.8, 2H, H.sub.2C (5'')); 3.74-3.70 (m, 2H, HCO); 3.68-3.66 (m,
2H, HCO); 3.62-3.58 (4H, m, H.sub.2CO); 3.48 (t, J=7.3, 2H,
H.sub.2C (1'')); 2.56 (br s, 1H, OH); 2.37 (qd, J=6.8, 1.5, 2H,
H.sub.2C (2'')); 1.23 (t, J=7.3, 3H, H.sub.3C (6'')); .sup.13C NMR
(100 MHz) 146.01; 102.19; 72.45; 71.00; 70.43; 69.95; 67.53; 61.77;
24.50; 15.21; MS (CI, NH.sub.3) 222 (M+NH.sub.4); 176; 159.
(4-Vinyloxymethyl-phenyl)-methanol
[0281] ##STR61##
[0282] Benzene-1,4-dimethanol (2.76 g, 20.0 mmol, 1.0 equiv) and
Hg(OAc).sub.2 (1 g, 3.0 mmol, 0.15 equiv) were heated to reflux in
butyl vinyl ether (50 mL) for 30 min. The reaction mixture was
cooled, poured into sat. NaHCO.sub.3 and was extracted with EtOAc.
The organic extracts were combined, washed with H.sub.2O and brine,
dried (Na.sub.2SO.sub.4), filtered and the filtrate concentrated to
give a paste, which contained both mono- and bis-vinyl ethers and
starting diol. Column chromatography (4/1 hexanes/EtOAc) provided
1.07 g (33%) of the mono-vinyl ether BB1-G as an oil which
solidified on standing: .sup.1H NMR (400 MHz) 7.39-7.34 (m, 4H,
HAr); 6.65 (dd, J=14.6, 7.0, 1H, HC (1')); 4.76 (s, 2H, H.sub.2C
(5)); 4.70 (d, J=5.9, 2H, H.sub.2COH)); 4.30 (dd, J=14.6, 2.2, 1H,
HC (2')); 4.08 (dd, J=7.0, 2.2, 1H, HC (2')); 1.62 (t, J=5.9, 1H,
OH); .sup.13C NMR (100 MHz) 151.50; 140.57; 136.13; 127.70; 127.04;
87.39; 69.75; 64.83; MS (CI, NH.sub.3) 182 (M+NH.sub.4); 138;
100.
tert-Butyl-(3-iodo-propoxy)-dimethyl-silane
[0283] ##STR62##
[0284] Triethylamine (8.5 mL, 61.0 mmol, 1.2 equiv), DMAP (0.610 g,
5.0 mmol, 0.1 equiv) and TBSCl (8.4 g, 55.5 mmol, 1.1 equiv) were
dissolved in CH.sub.2Cl.sub.2 (50 mL). 3-Iodopropanol (9.4 g, 50.5
mmol, 1 equiv) was added and the mixture was allowed to stir at rt
for 16 h. The cloudy mixture was then poured into H.sub.2O and
extracted with hexane. The combined organic layers were washed with
H.sub.2O, sat. CuSO.sub.4, H.sub.2O and brine, then dried
(Na.sub.2SO.sub.4), filtered and the filtrate was concentrated to
give an oil. The crude oil was purified by passed through a short
plug of silica gel using 19/1 hexanes/EtOAc as eluent to give 13.9
g (92%) of the silyl ether as a clear, colorless oil: .sup.1H NMR
(500 MHz) 3.67 (t, J=5.9, 2H, H.sub.2C (1)); 3.28 (t, J=6.8, 2H,
H.sub.2C (3)); 1.99 (quint, J=5.9, 2H, H.sub.2C (2)); 0.89 (s, 9H,
H.sub.3CCSi)); 0.07 (s, 6H, H.sub.3CSi). .sup.13C NMR (100 MHz)
.delta.2.33; 36.14; 25.90; 18.27; 3.68; -5.33.
5-Ethoxy-pent-4-yn-1-ol
[0285] ##STR63##
[0286] A solution of ethyl alkynyl ether (7.8 g of a 40% wt. soln.
in hexanes, roughly 3.1 g alkynyl ether, 44 mmol, 1.2 equiv) in THF
(80 mL) was cooled to -78.degree. C. and nBuLi (16.1 mL of 2.5 M in
hexane, 40.3 mmol, 1.1 equiv) was added over 5 min. This solution
was allowed to stir for 20 min at -78.degree. C., then HMPA (14.0
mL, 80.6 mmol, 2.2 equiv) was added and the solution was stirred
for a further 20 min, then
tert-butyl-(3-iodo-propoxy)-dimethyl-silane (11.0 g, 36.6 mmol, 1.0
equiv) was added over 1 min and the mixture was allowed to warm
slowly to rt and stir overnight (16 h). The crude reaction mixture
was poured into H.sub.2O and extracted with hexane. The organic
layers were combined, washed with brine, dried (Na.sub.2SO.sub.4),
filtered and the filtrate was concentrated to give a dark oil which
was immediately dissolved in THF (35 mL). TBAF (1.0 M in THF, 38
mL, 38 mmol, 1.04 equiv) was then added and the resulting solution
was stirred at rt for 1 h, the then reaction mixture was poured
into H.sub.2O and extracted with EtOAc. The combined extracts were
washed with H.sub.2O and brine, dried (Na.sub.2SO.sub.4), filtered
and the filtrate was concentrated to give a dark oil which was
chromatographed (6/1 hexanes/EtOAc) to give 3.43 g (73%) of the
alkynyl ether as a slightly yellow oil: .sup.1H NMR (500 MHz) 4.02
(q, J=7.3, 2H, H.sub.2C (2')); 3.73 (q, J=5.8, 2H, H.sub.2C (1));
2.24 (t, J=6.8, 2H, H.sub.2C (3)); 1.70 (quint, J=6.8, 2H, H.sub.2C
(2)); 1.65 (t, J=5.9, 1H, OH); 1.33 (t, J=7.3, 3H, H.sub.3C (2'));
.sup.13C NMR (100 MHz) 128.20; 89.55; 73.83; 61.67; 32.11; 14.22;
13.67.
N,N-Bis-(2-hydroxy-ethyl)-4-methoxy-benzenesulfonamide
[0287] ##STR64##
[0288] Diethanolamine (8.40 g, 80 mmol, 1.50 equiv) was dissolved
in CH.sub.2Cl.sub.2 (30 mL) and pyridine (5.1 mL, 63.6 mmol, 1.2
equiv). A solution of 4-methoxybenzenesulfonyl chloride (10.9 g, 53
mmol, 1.0 equiv) n CH.sub.2Cl.sub.2 (30 mL) was added quickly and
the resulting mixture was stirred at rt overnight, then poured into
H.sub.2O and extracted with EtOAc. The organic layers were washed
with 1M HCl and brine, dried (MgSO.sub.4), filtered, and the
filtrate was concentrated to give an oil which was purified by
column chromatography (95/5 CH.sub.2Cl.sub.2/MeOH) to give 12 g
(83%) of the sulfonamide as an oil which crystallized on standing:
.sup.1H NMR (500 MHz) 7.75 (d, J=8.8, 2H, HAr); 6.99 (d, J=8.8, 2H,
HAr); 3.87 (a, 3H, H.sub.3CO); 3.86 (t, J=4.9, 4H, H.sub.2C (1');
3.42 (br s, 2H, OH); 3.26 (t, J=4.9, 4H, H.sub.2C (2')). .sup.13C
NMR (100 MHz) 163.05; 129.85; 129.37; 114.37; 62.25; 55.61;
52.90.
N-(2-Hydroxy-ethyl)-4-methoxy-N-(2-vinyloxy-ethyl)-benzenesulfonamide
[0289] ##STR65##
[0290] The general procedure above for the synthesis of monovinyl
ether BB1-G provided 38% of the desired vinyl ether sulfonamide
BB1-H: .sup.1H NMR (500 MHz) 7.76 (d, J=8.8, 2H, HAr); 6.99 (d,
J=8.8, 2H, HAr); 6.42 (dd, J=14.7, 6.8, 1H, HC (3'')); 4.23 (dd,
J=14.6, 2.4, 1H, HC (4'')); 4.07 (dd, J=6.8, 2.4, 1H, HC (4''));
3.93 (t, J=5.4, 2H, H.sub.2C (2'')); 3.87 (s, 3H, H.sub.3CO); 3.76
(q, J=5.4, 2H, H.sub.2C (2')); 3.42 (t, J=5.4, 2H, H.sub.2C (1''));
3.27 (t, J=5.4, 2H, H.sub.2C (1')); 2.75 (t, J=6.3, 1H, OH);
.sup.13C NMR (100 MHz) 163.00; 150.83; 130.12; 129.35; 114.31;
87.79; 67.48; 61.26; 55.58; 56.62; 48.87.
2-(Trimethylsilanyloxy)-acrylic acid allyl ester
[0291] ##STR66##
[0292] Triethylamine (33 mL, 235 mmol, 1.1 equiv) was added to a
solution of TMSOTf (50 g, 225 mmol, 1.05 equiv) in benzene (225 mL)
and the resulting solution was cooled to 0.degree. C. Allyl
pyruvate (27.4 g, 214 mmol, 1.0 equiv) was added over 30 min and
the resulting two phase mixture was stirred at 0.degree. C. for
another 2 h, then poured into ice cold H.sub.2O and extracted with
hexane. The hexane extracts were washed with H.sub.2O, sat.
CuSO.sub.4, H.sub.2O and brine, then dried (Na.sub.2SO.sub.4),
filtered, and the filtrate was concentrated to give 30.4 g (68%) of
the silyl enol ether as a yellow oil which was used without further
purification: .sup.1H NMR (500 MHz) 5.86 (ddd, J=171, 10.7, 1.4,
1H, HC (2')); 5.55 (d, J=1.0, 1H, HC (4)); 5.35 (dd, J=17.1, 1.3,
1H, HC (3')); 5.26 (dd, J=10.7, 1.5, 1H, HC (3')); 4.9 (d, J=1.0,
1H, HC (4)); 4.74-4.72 (m, 2H, H.sub.2C (1')); 0.06 (s, 9H,
H.sub.3CSi); .sup.13C NMR (100 MHz) 164.01; 146.88; 131.79; 118.39;
104.24; 65.75; -0.08. MS (EI) 200 (M+); 185; 157; 141; 115.
[0293] (b) General Synthesis of .beta.,.gamma.-Unsaturated
Ketoesters
[0294] See, for example, (a) H. Sugimura, K. Yoshida, Bull. Chem.
Soc. Jpn. 1992, 65, 3209-3211. (b) D. A. Evans, J. S. Johnson, E.
J. Olhava, J. Am. Chem. Soc. 2000, 122, 1635-1649. Borontrifluoride
etherate (2.2 equiv) was added over 5 min to a solution of aldehyde
(1.0 equiv) in CH.sub.2Cl.sub.2 (0.5 M) at -78.degree. C. The
resulting solution was stirred for 30 min, then
2-(Trimethylsilanyloxy)-acrylic acid allyl ester (1.1 equiv) was
added dropwise over 5 min. The solution was allowed to stir at
-78.degree. C. for 10 min, then warmed slowly to rt and stirred
overnight. The mixture was poured into sat. NaHCO.sub.3 and
extracted with EtOAc, the organic layers were combined, dried
(Na.sub.2SO.sub.4), filtered and the filtrate concentrated to give
an oil which was dissolved in benzene (0.2 M) and silica gel (1 g
per mmol) added). This mixture was heated to reflux for 2-4 h,
cooled, filtered, the filter pad washed with EtOAc and the combined
filtrates were concentrated to give the crude unsaturated esters.
Purification by column chromatography then provided the pure
unsaturated esters.
5-Methyl-2-oxo-hex-3-enoic acid allyl ester
[0295] ##STR67##
[0296] .sup.1H NMR (400 MHz) 7.14 (dd, J=15.6, 6.3, 1H, HC (4));
6.60 (dd, J=15.6, 1.5, 1H, HC (3)); 5.98 (ddt, J=17.6, 10.7; 5.9,
1H, HC (2')); 5.41 (d, J=17.1, 1H, HC (3')); 5.31 (d, J=10.7, 1H,
HC (3)); 4.76 (dt, J=5.6, 1.5, 2H, H.sub.2C (1')); 2.55 (m, 1H, HC
(5)); 1.10 (d, J=6.8, 6H, H.sub.3C (6)); .sup.13C NMR (100 MHz)
183.22; 161.85; 160.67; 130.70; 122.25; 66.51; 31.76; 20.90; MS
(EI) 182 (M+); 109; 97; 87.
2-Oxo-4-phenyl-but-3-enoic acid allyl ester
[0297] ##STR68##
[0298] .sup.1H NMR (500 MHz) 7.87 (d J=16.1, 1H, HC (4)); 7.66 (d,
J=8.3, 2H, HC (2')); 7.45 (m, 3H, HAr); 7.36 (d, J=16.1, 1H, HC
(3)); 6.02 (ddt, J=17.1, 10.8, 3.9, 1H, HC (2'')); 5.44 (dd,
J=17.1, 1.5, 1H, HC (3'')); 5.35 (dd, J=10.7, 1.2, 1H, HC (3''));
4.83 (d, J=5.9, 2H, H.sub.2C (1'')); .sup.13C NMR (100 MHz) 182.44;
161.72; 148.48; 133.86; 131.59; 130.78; 128.99; 128.95; 120.43;
119.83; 66.74; MS (EI) 216 (M+); 131; 103.
4-(9H-Fluoren-2-yl)-2-oxo-but-3-enoic acid allyl ester
[0299] ##STR69##
[0300] .sup.1H NMR (500 MHz) 7.96 (d, J=16.1, 1H, HC (4)); 7.82 (m,
2H, HC (1' and 8')); 7.67 (m, 1H, HAr); 7.59 (m, 1H, HAr); 7.43 (d,
J=16.1, 1H, HC (3)); 7.44-7.35 (m, 3H, HAr); 6.05 (ddt, J=17.1,
10.3, 5.9, 1H, HC (2'')); 5.46 (d, J=17.1, 1H, HC (3'')); 5.36 (d,
J=10.2, 1H, HC (3'')); 4.84 (dt, J=5.9, 1.5, 2H, H.sub.2C (1''));
3.95 (s, 2H, H.sub.2C (9')); .sup.13C NMR (100 MHz) 182.17; 161.85;
148.92; 145.40; 143.98; 143.76; 140.44; 132.36; 130.82; 128.63;
127.83; 127.00; 125.26; 125.10; 120.53; 120.23; 119.79; 119.38;
66.79; 36.75; MS (EI) 304 (M+); 220; 219; 191; 189.
4-(3-Allyloxycarbonyl-3-oxo-propenyl)-benzoic acid methyl ester
[0301] ##STR70##
[0302] .sup.1H NMR (500 MHz) 8.08 (d, J=8.8, 2H, HC (2)); 7.87 (d,
J=16.1, 1H, HC (1')); 7.69 (d, J=8.3, 2H, HC (3)); 7.43 (d, J=16.1,
1H, HC (2')); 6.07 (ddt, J=17.1, 10.3, 6.3, 1H, HC (2'')); 5.44
(dd, J=17.1, 1.0, 1H, HC (3'')); 5.35 (dd, J=10.7, 1.3, 1H, HC
(3'')); 4.82 (d, J=5.9, 2H, H.sub.2C (1'')); 3.94 (s, 3H,
H.sub.3CO.sub.2)); .sup.13C NMR (100 MHz) 182.03; 166.00; 161.31;
146.59; 137.86; 132.31; 130.61; 130.06; 128.66; 122.33; 119.97;
66.95; 52.36; MS (EI) 274 (M+); 243; 189.
4-Benzo[1,3]dioxol-5-yl-2-oxo-but-3-enoic acid allyl ester
[0303] ##STR71##
[0304] .sup.1H NMR (500 MHz) 7.78)(d, 16.1, 1H, HC (4)); 7.14 (d,
J=17.1, 1H, HC (3)); 6.85 (d, J=7.1, 1H, Har)); 7.14 (s, 1H, HC
(6')); 7.13 (d, J=7.2, 1H, Har)); 6.04 (s, 2H, H.sub.2CO.sub.2);
6.01 (ddt, J=17.1, 10.7, 5.9, 1H, HC (2'')); 5.43 (dd, J=17.1, 1.0,
1H, HC (3'')); 5.33 (d, J=10.6, 1.0, 1H, HC (3'')); 4.81 (dt,
J=5.9, 1.5, 2H, H.sub.2C (1'')); .sup.13C NMR (100 MHz) 182.01;
161.82; 150.83; 148.43; 148.22; 130.80; 128.42; 126.49; 119.77;
118.39; 108.68; 106.80; 101.79; 66.76; MS (EI) 260 (M+); 175.
2-Oxo-4-thiophen-3-yl-but-3-enoic acid allyl ester
[0305] ##STR72##
[0306] .sup.1H NMR (500 MHz) 7.86 (d, J=16.1, 1H, HC (4)); 7.69 (m,
1H, HAr); 7.40 (m, 1H, HAr); 7.36 (s, 1H, HC (2')); 7.16 (d,
J=16.1, 1H, HC (3); 6.04 (ddt, J=17.1, 10.7, 5.9, 1H, HC (2''));
5.44, (dd, J=17.1, 1.5, 1H, HC (3'')); 5.34 (dd, J=10.6, 1.4, 1H,
HC (3'')); 4.81 (dt, J=6.3, 1.0, 2H, H.sub.2C (1'')); .sup.13C NMR
(100 MHz) 182.38; 161.56; 131.23; 130.66; 129.59; 127.64; 127.23;
125.07; 120.08; 119.62; 66.12; MS (EI) 222 (M+); 137; 109.
4-(Benzofuran-3-yl)-2-oxo-but-3-enoic acid allyl ester
[0307] ##STR73##
[0308] .sup.1H NMR (500 MHz) 7.74 (d, J=15.6, 1H, HC (4)); 7.62 (d,
J=7.3, 1H, HAr); 7.51 (d, J=8.3, 1H, HAr); 7.47 (d, J=15.6, 1H, HC
(3)); 7.42 (td, J=7.3, 1.0, 1H, HAr); 7.28 (td, J=8.3, 1.0, 1H,
HAr)); 7.14 (s, 1H, HC (2')); 6.03 (ddt, J=17.1, 10.3, 5.9, 1H, HC
(2')); 5.45 (dd, J=17.1, 1.0, 1H, HC (3'')); 5.36 (dd, J=10.2, 1.0,
1H, HC (3'')); 4.83 (dt, J=5.9, 1.5, 2H, H.sub.2C (1'')); .sup.13C
NMR (100 MHz) 181.69; 161.26; 155.85; 152.04; 133.75; 130.73;
128.19; 127.49; 123.54; 122.07; 120.43; 119.87; 114.69; 111.55;
66.90; MS (EI) 256 (M+); 228; 213; 185; 129.
4-(1-Acetyl-1H-indol-3-yl)-2-oxo-but-3-enoic acid allyl ester
[0309] ##STR74##
[0310] .sup.1H NMR (500 MHz) 8.49 (d, J=7.8, 1H, HAr)); 8.03 (d,
J=16.1, 1H, HC (4)); 7.91 (d, J=6.8, 1H, HAr); 7.86 (s, 1H, HC
(2')); 7.53 (d, J=16.1, 1H, HC (3)); 7.48-7.40 (m, 2H. HAr); 6.21
(ddt, J=17.1, 10.7, 5.9, 1H, HC (2'')); 5.46 (dd, J=17.1, 1.5, 1H,
HC (3'')); 5.36 (dd, J=10.7, 1.5, 1H, HC (3'')); 4.84 (dt, J=5.9,
1.5, 2H, HC (1'')); 2.71 (s, 3H, H.sub.3CC(O)); .sup.13C NMR (100
MHz) 181.88; 168.14; 161.75; 139.69; 136.63; 130.77; 130.14;
127.27; 126.35; 124.75; 120.23; 120.13; 119.85; 118.40; 116.87;
66.87; 24.01; MS (ED) 297 (M+); 212; 170.
2-Oxo-4-(4-oxo-4H-chromen-3-yl)-but-3-enoic acid allyl ester
[0311] ##STR75##
[0312] .sup.1H NMR (500 MHz) 8.29 (dd, J=7.8, 1.5, 1H, HAr); 8.23
(t, J=8.8, 2H, HAr); 7.78 (m, 1H); 7.57 (d, J=15.1, 1H); 7.30 (m,
2H); 6.02 (ddt, J=17.1, 10.3, 6.3, 1H, HC (2'')); 5.44 (dd, J=17.1,
1.0, 1H, HC (3'')); 5.34 (dd, J=10.7, 1.5, 1H, HC (3'')); 4.82 (dt,
J=5.9, 1.4, 2H, H.sub.2C (1'')); .sup.13C NMR (100 MHz) 183.08;
175.40; 161.39; 159.31; 155.23; 139.13; 130.72; 126.23; 126.06;
124.01; 123.84; 119.76; 118.99; 118.08; 66.76; MS (EI) 284 (M+);
256; 228; 199; 149.
4-(1,5-Dimethyl-3-oxo-2-phenyl-2,3-dihydro-1H-pyrazol-4-yl)-2-oxo-but-3-en-
oic acid allyl ester
[0313] ##STR76##
[0314] .sup.1H NMR (500 MHz) 7.92 (d, J=15.1, 1H, HC (4)); 7.68 (d,
J=15.1, 1H, HC (3)); 7.50 (t, J=7.3, 2H, HAr); 7.39 (t, J=6.3, 1H,
HAr); 7.31 (d, J=8.3, 2H, HAr); 5.96 (ddt, J=17.6, 10.7, 2.9, 1H,
HC (2'')); 5.38 (dd, J=17.1, 1.5, 1H, HC (3'')); 5.27 (dd, J=10.7,
1.5, 1H, HC (3'')); 4.76 (d, J=3.0, 2H, H.sub.2C (1'')); 3.32 (s,
3H, H.sub.3CN); 2.42 (s, 3H, H.sub.3CC); .sup.13C NMR (100 MHz)
182.87; 162.68; 162.09; 153.01; 137.21; 133.46; 130.97; 129.36;
128.20; 125.90; 119.34; 116.98; 103.62; 66.36; 34.46; 10.83; MS
(EI) 326 (M+); 241.
[0315] (c) Building Block Testing
[0316] General procedure for test cycloadditions. Vinyl ether resin
(prepared as described below) (5 mg, .about.1.1 meq/g, .about.0.005
mmol, 1 equiv), the appropriate heterodiene (0.015 mmol, 3 equiv)
and 5 mg of activated powdered 4 .ANG. molecular sieves were placed
in a dry 4 mL vial, capped with septa and placed under Ar. THF (80
uL) was added, followed by a 0.05 M solution of the appropriate
catalyst 1 solution (prepared as described below). The resulting
mixture was vortexed gently for 16-24 h then filtered (powdered
sieves pass through the filter, thus separating them from the resin
beads) and washed with 4.times.1 mL.times.20 min THF, then
3.times.1 mL.times.15 min CH.sub.2Cl.sub.2 and dried briefly. The
resin was then transferred to an Eppendorf tube and treated with
cleavage cocktail as described above, after concentration the
samples were analyzed by .sup.1H NMR, LCMS and CSP HPLC and/or CSP
SFC.
[0317] (d) Vinyl Ether Testing:
(4R,6R)-4-Benzo[1,3]dioxol-5-yl-6-(4-hydroxy-butoxy)-5,6-dihydro-4H-pyran--
2-carboxylic acid allyl ester
[0318] ##STR77##
[0319] .sup.1H NMR (600 MHz) 6.74-6.72 (m, 2H, HAr); 6.67 (dd,
J=7.8, 1.5, 1H, HAr)); 6.14 (d, J=2.9, 1H, HC (3)); 5.96 (ddt,
J=17.1, 10.7, 5.3, 1H, HC (8')); 5.93 (d, J=1.5, 2H,
H.sub.2CO.sub.2)); 5.36 (dd, J=17.1, 1.5, 1H, HC (9')); 5.26 (dd,
J=10.7, 1.5, 1H, HC (9')); 5.14 (dd, J=7.3, 2.0, 1H, HC (6)); 4.71
(ABX, J=14.3, 5.3, 2H, H.sub.2C (7')); 4.01 (dt, J=9.8, 5.9, 1H, HC
(1'')); 3.70-3.60 (m, 4H, HC (4), HC (1''), H.sub.2C (4'')); 2.28
(ddd, J=13.2, 6.8, 1.5, 1H, HC (5)); 1.93 (dt, J=13.6, 7.8, 1H, HC
(5)); 1.72-1.59 (m, 4H, H.sub.2C (2''); H.sub.2C (3'')); MS (ESI)
400 (M+Na+1); 399 (M+Na); 387; 287; 261; HRMS (ESI)
C.sub.20H.sub.24O.sub.7--Na requires 399.1420; found 399.1432.
(4R,6R)-4-Benzo[1,3]dioxol-5-yl-6-[2-(2-hydroxy-ethoxy)-ethoxy]-5,6-dihydr-
o-4H-pyran-2-carboxylic acid allyl ester
[0320] ##STR78##
[0321] .sup.1H NMR (600 MHz) 6.72-6.69 (m, 3H, HAr); 6.23 (d,
J=4.3, 1H, HC (3)); 6.0-5.96 (m, 1H, HC (8')); 5.93 (d, J=5.4, 2H,
H.sub.2CO.sub.2); 5.35 (dd, J=17.1, 1.0, 1H, HC (9')); 5.26 (dd,
J=10.3, 1.0, 1H, HC (9')); 5.16 (d, J=2.4, 1H, HC (6)); 4.72 (ABX,
J=18.6, 5.9, 5.9, 2H, H.sub.2C (7')); 3.94 (ddd, J=14.1, 9.8, 6.8,
1H, HC (1'')); 3.61-3.50 (m, 7H, HCO); 2.19 (m, 1H, HC (5). Other
low field signals obscured by plasticizer.
(4R,6R)-4-Benzo[1,3]dioxol-5-yl-6-(4-hydroxymethyl-benzyloxy)-5,6-dihydro--
4H-pyran-2-carboxylic acid allyl ester
[0322] ##STR79##
[0323] .sup.1H NMR (600 MHz) 7.36-7.30 (m, 4H, HAr); 6.74-6.70 (m,
2H, HAr); 6.66 (dd, J=7.8, 1.5, 1H, HC (Ar)); 6.15 (d, J=2.9, 1H,
HC (3)); 6.00-5.93 (m, 1H, HC (8')); 5.93 (s, 2H,
H.sub.2CO.sub.2)); 5.37 (dd, J=17.1, 1.5, 1H, HC (9')); 5.27 (dd,
J=10.7, 1.5, 1H, HC (9')); 5.20 (dd, J=7.3, 2.0 , 1H, HC (6)); 4.96
(d, J=11.7, 1H, HC (1'')); 4.78-4.68 (m, 5H, H.sub.2C (6''); HC
(1''); H.sub.2C (7')); 3.62 (ddd, J=10.7, 8.3, 2.9, 1H, HC (4));
2.29 (ddd, J=14.3, 6.8, 1.5, 1H, HC (5)); 1.99 (dt, J=14.2, 7.8,
1H, HC (5)); MS (ESI) 447 (M+Na); 407; 363; 285; HRMS (ESI)
C.sub.24H.sub.24O.sub.7--Na requires 447.1420; found 447.1401.
(4R,5S,6R)-6-Ethoxy-5-(3-hydroxy-propyl)-4-phenyl-5,6-dihydro-4H-pyran-2-c-
arboxylic acid allyl ester
[0324] ##STR80##
[0325] .sup.1H NMR (600 MHz) 7.32-7.20 (m, 5H, HAr); 6.29 (d,
J=3.9, 1H, HC (3)); 5.96 (ddt, J=17.1, 10.6, 5.9, 1H, HC (6'));
5.36 (dd, J=17.1, 1.5, 1H, HC (7')); 5.26 (dd, J=10.7, 1.5, 1H, HC
(7')); 4.76-4.65 (m, 2H, H.sub.2C (5')); 3.96 (dq, J=7.3, 7.1, 1H,
HC (4'')); 3.7-3.5 (m, 3H, HC (4'') and H.sub.2C (3'')); 3.49 (t,
J=6.3, 1H, HC (4)); 2.25-2.20 (m, 1H, HC (5); 1.60-1.22 (m, 4H,
H.sub.2C (1'') and H.sub.2C (2'')); 1.19 (t, J=7.1, 3H, H.sub.3C
(5'')); MS (ESI) 369 (M+Na); 357; 299; 280; 217; HRMS (ESI)
C.sub.20H.sub.26O.sub.5--Na requires 369.1678; found 369.1669.
(4R,5R,6R)-6-Ethoxy-5-(3-hydroxy-propyl)-4-phenyl-5,6-dihydro-4H-pyran-2-c-
arboxylic acid allyl ester
[0326] ##STR81##
[0327] .sup.1H NMR (600 MHz) 7.31-7.20 (m, 5H, HAr); 6.16 (d,
J=3.4, 1H, HC (3)); 5.95 (ddt, J=17.1, 10.7, 5.9, 1H, HC (6'));
5.35 (dd, J=17.1, 1.5, 1H, HC (7')); 5.25 (dd, J=10.7, 1.4, 1H, HC
(7')); 4.92 (d, J=5.9, 1H, HC (6)); 4.71 (ABX, J=17.6, 5.4, 2H,
H.sub.2C (5')); 4.00 (dq, J=7.3, 6.8, 1H, HC (4'')); 3.60-3.52 (m,
3H, H.sub.2C (3'') and HC (4'')); 3.34 (dd, J=6.8, 3.4, 1H, HC
(4)); 2.03 (quint, J=6.9, 1H, HC (5)); 1.62-1.56 (m, 2H, H.sub.2C
(1'')); 1.50-1.46 (m, 2H, H.sub.2C (2'')); 1.20 (t, J=7.3, 3H,
H.sub.3C (5'')); MS (ESI) 369 (M+Na); 299; 280; 217. HRMS (ESI)
C.sub.20H.sub.26O.sub.5--Na requires 369.1678; found 369.1577.
(4R,5S,6R)-4-Benzo[1,3]dioxol-5-yl-6-ethoxy-5-{2-[2-(2-hydroxy-ethoxy)etho-
xy]-ethyl}-5,6-dihydro-4H-pyran-2-carboxylic acid allyl ester
[0328] ##STR82##
[0329] .sup.1H NMR (600 MHz) 6.75-6.65 (m, 3H, HAr); 6.24 (d,
J=3.9, 1H, HC (3)); 5.99-5.92 (m, 1H, HC (8')); 5.93 (d, J=1.5, 1H,
HCO.sub.2)); 5.91 (d, J=1.5, HCO.sub.2)); 5.35 (dd, J=17.1, 1.5,
1H, HC (9')); 5.25 (dd, J=10.7, 1.5, 1H, HC (9')); 5.19 (d, J=2.4,
1H, HC (6)); 4.77-4.66 (m, 2H, H.sub.2C (7')); 3.93-3.90 (m, 1H, HC
(7'')); 3.78-3.30 (m, 12H, H.sub.2CO; HC (7''); HC (4)); 1.19 (t,
J=6.9, 3H, H.sub.3C (8'')); other signals obscured; MS (ESI) 487
(M+Na); 419; 417; 261; HRMS (ESI) C.sub.24H.sub.32O.sub.9--Na
487.1944; found 487.1943.
(4R,5R,6R)-4-Benzo[1,3]dioxol-5-yl-6-ethoxy-5-{2-[2-(2-hydroxy-ethoxy)etho-
xy]-ethyl}-5,6-dihydro-4H-pyran-2-carboxylic acid allyl ester
[0330] ##STR83##
[0331] .sup.1H NMR (600 MHz) 6.75-6.66 (m, 3H, HAr); 6.11 (d,
J=3.4, 1H, HC (3)); 5.97-5.92 (m, 1H, HC (8')); 5.93 (d, J=2.4, 2H,
H.sub.2CO.sub.2)); 5.35 (dd, J=17.6, 1.5, 1H, HC (9')); 5.25 (d, J
10.3, 1H, HC (9')); 4.92 (d, J=5.9, 1H, HC (6)); 4.70 (ABX, J=13.6,
5.9, 2H, H.sub.2C (7')); 3.96 (qd, J=7.3, 6.8, 1H, HC (7''));
3.75-3.43 (m, 11H, HCO; HC (7')); 3.33 (dd, J=6.3, 3.4, 1H, HC
(4)); 2.07, quint, J=5.9, 1H, HC (5)); 1.72-1.63 (m, 2H, H.sub.2C
(1'')); 1.19 (t, J=6.8, 3H, H.sub.3C (8'')); MS (ESI) 487 (M+Na);
419; 261; HRMS (ESI) C.sub.24H.sub.32O.sub.9--Na requires 487.1944;
found 487.1921.
(4R,6R)-4-Benzo[1,3]dioxol-5-yl-6-{2-[(2-hydroxy-ethyl)-(4-methoxybenzenes-
ulfonyl)-amino]-ethoxy}-5,6-dihydro-4H-pyran-2-carboxylic acid
allyl ester
[0332] ##STR84##
[0333] .sup.1H NMR (600 MHz) 7.76 (d, J=8.8, 2H, HAr); 6.97 (d,
J=8.8, 2H, HAr); 6.74 (d, J=7.8, 1H, HAr)); 6.68-6.64 (m, 2H,
HAr)); 6.13 (d, J=2.9, 1H, HC (3)); 6.00-5.90 (m, 1H, HC (8'));
5.93 (s, 2H, H.sub.2CO.sub.2)); 5.35 (d, J=17.1, 1.5, 1H, HC (9'));
5.26 (dd, J=10.7, 1.5, 1H, HC (9')); 5.10 (dd, J=8.3, 2.0, 1H, HC
(6)); 4.77-4.65 (m, 2H, H.sub.2C (7')); 4.14-4.10 (m, 1H);
3.92-3.84 (m, 1H, 3.86 (s, 3H, H.sub.3CO); 3.71-3.68 (m, 2H);
3.64-3.62 (m, 1H, HC (4)); 3.48 (dt, J=15.1, 4.4, 1H); 3.36-3.22
(m, 2H); 3.08 (dt, J=14.6, 4.9, 1H); 2.26 (dd, J=12.7, 6.8, 1H, HC
(5)); 1.86 (dt, J=13.2, 8.3, 1H, HC (5)); MS (ESI) 584 (M+Na); 287;
276. HRMS (ESI) C.sub.27H.sub.31NO.sub.10S--Na requires 584.1566;
found 584.1572.
[0334] (e) Heterodiene Testing:
(4S,6R)-6-{2-[(2-Hydroxy-ethyl)-(4-methoxy-benzenesulfonyl)-amino]-ethoxy}-
-4-isopropyl-5,6-dihydro-4H-pyran-2-carboxylic acid allyl ester
[0335] ##STR85##
[0336] .sup.1H NMR (600 MHz) 7.78-7.77 (m, 2H, HAr); 7.00-6.96 (m,
2H, HAr); 6.04 (d, J=2.0, 1H, HC (3)); 5.87 (ddd, J=17.1, 10.7,
1.5, 1H, HC (10'')); 5.35 (dd, J=17.1, 1.5, 1H, HC (11'')); 5.25
(dd, J=10.7, 1.5, 1H, HC (11'')); 4.97 (dd, J=9.3, 1.3, 1H, HC
(6)); 4.72-4.64 (m, 2H, H.sub.2C (9'')); 4.14-4.10 (m, 1H);
4.02-3.99 (m, 1H); 3.96-3.90 (m, 1H); 3.87 (s, 3H, H.sub.3CO);
3.80-3.70 (m, 2H); 3.50-3.32 (m, 2H); 3.29-3.26 (m, 1H); 3.18-3.16
(m, 1H); 2.32-2.26 (m, 1H, HC (5)); 1.98-1.96 (m, 1H, HC (5));
1.74-1.65 (m, 1H, HC (1')); 0.96 (d, J=7.1, 3H, H.sub.3C (2'));
0.94 (d, J=7.1, 3H, H.sub.3C (1')); MS (ESI 506 (M+Na); 484 (M+1);
276; 258; HRMS (ESI) C.sub.23H.sub.33NO.sub.8S--Na requires
506.1825; found 506.1847.
(4R,6R)-6-{2-[(2-Hydroxy-ethyl)-(4-methoxy-benzenesulfonyl)-amino]-ethoxy}-
-4-phenyl-5,6-dihydro-4H-pyran-2-carboxylic acid allyl ester
[0337] ##STR86##
[0338] .sup.1H NMR (600 MHz) 7.76-7.70 (m, 2H, HAr); 7.31-7.19 (m,
5H, HAr); 7.00-6.96 (m, 2H, HAr); 6.20 (d, J=2.9, 1H, HC (3)); 5.93
(ddd, J=17.1, 10.7, 1.6, 1H, HC (10'')); 5.36 (dd, J=17.1, 1.5, 1H,
HC (11'')); 5.26 (dd, J=10.7, 1.5, 1H, HC (11'')); 5.14 (dd, J=7.8,
2.0, 1H, HC (6)); 4.77-4.68 (m, 2H, H.sub.2C (9'')); 4.15-4.10 (m,
1H); 4.02-3.98 (m, 1H); 3.91-3.84 (m, 1H); 3.87 (s, 3H, H.sub.3CO);
3.74-3.70 (m, 1H); 3.65-3.60 (m, 1H); 3.50-3.40 (m, 1H); 3.29-3.22
(m, 2H); 3.08-3.00 (m, 1H); 2.31 (m, 1H, HC (5)); 1.93 (dt, J=14.0,
7.5, 1H, HC (5)); MS (ESI) 540 (M+Na); 518 (M+1); 276; 258; HRMS
(ESI) C.sub.26H.sub.31NO.sub.8S--Na requires 540.1668; found
540.1644.
(4R,6R)-4-(9H-Fluoren-2-yl)-6-{2-[(2-hydroxy-ethyl)-(4-methoxybenzenesulfo-
nyl)-amino]-ethoxy}-5,6-dihydro-4H-pyran-2-carboxylic acid allyl
ester
[0339] ##STR87##
[0340] .sup.1H NMR (600 MHz) 7.77-7.70 (m); 7.55-7.53 (m);
7.38-7.20 (m); 7.70-6.94 (m); 6.24 (d, J=2.9, 1H, HC (3)); 5.96
(ddd, J=17.1, 10.7, 1.5, 1H, HC (10'')); 5.36 (dd, J=17.1, 1.5, 1H,
HC (11'')); 5.26 (dd, J=10.7, 1.5, 1H, HC (11'')); 5.17 (dd, J=7.8,
2.0, 1H, HC (6)); 4.77-4.68 (m, 2H, H.sub.2C (9'')); 4.16-4.11 (m,
1H); 3.95-3.90 (m, 1H); 3.88-3.82 (m, 1H); 3.83 (s, 3H, H.sub.3CO);
3.82-3.80 (m, 1H, HC (4)); 3.64-3.62 (m, 1H); 3.51-3.46 (m, 1H);
3.30-3.22 (m, 2H); 3.06-3.00 (m, 1H); 2.36 (dd, J=12.7, 7.3, 1H, HC
(5)); 1.98 (dt, J=13.6, 8.8, 1H, HC (5)); MS (ESI) 628 (M+Na); 606
(M+1); 536; 478; 276; HRMS (ESI) C.sub.33H.sub.35NO.sub.8S--Na
requires 628.1998; found 628.2008.
(4R,6R)-6-{2-[(2-Hydroxy-ethyl)-(4-methoxy-benzenesulfonyl)-amino]-ethoxy}-
-4-(4-methoxycarbonyl-phenyl)-5,6-dihydro-4H-pyran-2-carboxylic
acid allyl ester
[0341] ##STR88##
[0342] .sup.1H NMR (600 MHz) 7.98 (d, J=8.8, 2H, HC (3'));
7.76-7.72 (m, 2H, HAr); 7.28 (d, J=8.8, 2H, HC (2')); 6.99-6.95 (m,
2H, HAr)); 6.19 (d, J=2.9, 1H, HC (3)); 5.86 (ddd, J=17.1, 10.7,
1.5, 1H. HC (10'')); 5.36 (dd, J=17.1, 1.4, 1H, HC (11'')); 5.26
(dd, J=10.7, 1.5, 1H, HC (11'')); 5.17 (dd, J=7.8, 2.0, 1H, HC
(6)); 4.77-4.66 (m, 2H, H.sub.2C (9'')); 4.14-4.08 (m, 1H);
3.93-3.85 (m, 2H); 3.91 (s, 3H, H.sub.3CO.sub.2C)); 3.86 (s, 3H,
H.sub.3CO); 3.79-3.76 (m, 1H, HC (4)); 3.62-3.60 (m, 1H); 3.46-3.42
(dt, J=15.1, 4.9, 1H); 3.26-3.19 (m, 2H); 3.01 (dt, J=10.2, 5.9,
1H); 2.36-2.30 (m, 1H, HC (5)); 1.96-1.92 (m, 1H, HC (5)); MS (ESI)
598 (M+Na); 576 (M+1); 276; HRMS (ESI)
C.sub.28H.sub.33NO.sub.10S--Na requires 598.1723; found
598.1702.
(4R,6R)-6-{2-[(2-Hydroxy-ethyl)-(4-methoxy-benzenesulfonyl)-amino]-ethoxy}-
-4-thiophen-3-yl-5,6-dihydro-4H-pyran-2-carboxylic acid allyl
ester
[0343] ##STR89##
[0344] .sup.1H NMR (600 MHz) 7.77-7.74 (m, 2H, HAr); 7.74-7.72 (m,
1H, HAr); 7.29 (dd, J=4.9, 2.9, 1H, HAr); 7.05-6.95 (m, 3H, HAr);
6.21 (d, J=3.4, 1H, HC (3)); 5.86 (ddd, J=17.1, 10.7, 1.4, 1H, HC
(10'')); 5.36 (dd, J=17.1, 1.5, 1H, HC (11'')); 5.26 (dd, J=10.7,
1.5, 1H, HC (11'')); 5.15 (dd, J=7.8, 2.0, 1H, HC (6)); 4.75-4.64
(m, 2H, HC (9'')); 4.12-4.08 (m, 1H); 4.02-3.98 (m, 1H); 3.92-3.80
(m, 2H); 3.86 (s, 3H, H.sub.3CO); 3.74-3.70 (m, 1H); 3.68 (t,
J=4.9, 1H); 3.50-3.40 (m, 1H); 3.32-3.22 (m, 1H); 3.07-3.02 (m,
1H); 2.34-2.30 (m, 1H, HC (5)); 2.00-1.95 (m, 1H, HC (5)); MS (ESI)
546 (M+Na); 524 (M+1); 302; 276; 258; 249; HRMS (ESI)
C.sub.24H.sub.29NO.sub.8S.sub.2 requires 546.1232; found
546.1230.
(4R,6R)-4-Benzofuran-3-yl-6-{2-[(2-hydroxy-ethyl)-(4-methoxybenzenesulfony-
l)-amino]-ethoxy}-5,6-dihydro-4H-pyran-2-carboxylic acid allyl
ester
[0345] ##STR90##
[0346] .sup.1H NMR (600 MHz) 7.74-7.70 (m, 2H, HAr); 7.48 (d,
J=6.8, 1H, HAr); 7.42 (d, J=8.3, 1H, Hr); 7.26-7.18 (m, 2H, HAr);
7.00-6.97 (m, 2H, HAr); 6.47 (s, 1H, HC (2')); 6.34 (d, J=3.9, 1H,
HC (3)); 5.97 (ddd, J=17.1, 10.7, 1.5, 1H, HC (10'')); 5.38 (dd,
J=17.1, 1.5, 1H, HC (11'')); 5.24 (dd, J=10.1, 1.4, 1H, HC (11''));
5.19 (dd, J=6.3, 2.4, 1H, HC (6)); 4.78-4.68 (m, 2H, H.sub.2C
(9'')); 4.05-4.00 (m, 1H); 3.90-3.80 (m, 1H); 3.86 (s, 3H,
H.sub.3CO); 3.74-3.70 (m, 1H); 3.50-3.40 (m, 2H); 3.29-3.24 (m,
1H); 3.20-3.16 (m, 1H); 3.13-3.07 (m, 1H); 2.98-2.90 (m, 1H);
2.37-2.25 (m, 2H, H.sub.2C (5)); MS (ESI) 580 (M+Na); 558 (+1);
258; HRMS (ESI) C.sub.29H.sub.31NO.sub.9S--Na requires 580.1617;
found 580.1595.
(4R,6R)-4-(1-Acetyl-1H-indol-3-yl)-6-{2-[(2-hydroxy-ethyl)-(4-methoxybenze-
nesulfonyl)-amino]-ethoxy}-5,6-dihydro-4H-pyran-2-carboxylic acid
allyl ester
[0347] ##STR91##
[0348] .sup.1H NMR (600 MHz) 7.77-7.75 (m, 2H, HAr); 7.51-7.49 (m,
1H); 7.35-7.26 (m, 3H, HAr); 6.95-6.90 (m, 2H, HAr); 6.21 (d,
J=2.8, 1H, HC (3)); 5.91 (ddd, J=17.1, 10.7, 1.4, 1H, HC (10''));
5.36 (dd, J=17.1, 1.5, 1H, HC (11'')); 5.25 (dd, J=10.7, 1.5, 1H,
HC (11'')); 5.19 (dd, J=8.4, 1.3, 1H, HC (6)); 4.68-4.61 (m, 2H,
H.sub.2C (9'')); 4.05-4.00 (m, 1H); 3.99-3.82 (m, 2H); 3.85 (s, 3H,
H.sub.3CO); 3.84-3.80 (m, 1H); 3.60-3.56 (m, 1H); 3.45-3.20 (m,
3H); 3.01 (dt, J=14.1, 5.1, 1H): 2.58 (s, 3H, H.sub.3CC(O)));
2.38-2.33 (m, 1H, HC (5)); 2.06-2.00 (m, 1H, HC (5)); MS (ESI) 621
(M+Na); 599 (M+1); 276; HRMS (ESI)
C.sub.30H.sub.34N.sub.2O.sub.9S--Na requires 621.1883; found
621.1860.
(4R,6R)-6-{2-[(2-Hydroxy-ethyl)-(4-methoxy-benzenesulfonyl)-amino]-ethoxy}-
-4-(4-oxo-4H-chromen-3-yl)-5,6-dihydro-4H-pyran-2-carboxylic acid
allyl ester
[0349] ##STR92##
[0350] .sup.1H NMR (600 MHz) 8.25 (d, J=7.8, 1.5, 1 HAr); 7.87 (s,
1H, HC (2')); 7.72 (d, J=9.3, 2H, HC (6'')); 7.68-7.64 (m, 1H,
HAr); 7.46-7.40 (m, 2H, HAr); 6.97 (d, J=9.3, 2H, HC (7'')); 6.19
(d, J=3.9, 1H, HC (3)); 6.03 (ddd, J=17.1, 10.7, 1.5, 1H, HC
(10'')); 5.37 (dd, J 17.1, 1.5, 1H. HC (11'')); 5.28 (dd, J=10.7,
1.4, 1H, HC (11'')); 5.20 (dd, J=4.9, 2.4, 1H, HC (6)); 4.78-4.69
(m, 2H, HC (9'')); 4.02-3.98 (m, 1H, HC (4)); 3.88-3.72 (m, 2H);
3.86 (s, 3H, H.sub.3CO); 3.58 (t, J=4.8, 1H); 3.36 (dt, J=14.7,
4.9, 1H); 3.32-3.24 (m, 1H); 3.17 (dt, J=15.1, 4.9, 1H); 3.10-3.06
(m, 1H); 2.38-2.34 (m, 1H, HC (5)); 2.00-1.94 (m, 1H, HC (5)); MS
(ESI) 608 (M+Na); 586 (M+1); 311; HRMS (ESI)
C.sub.29H.sub.31NO.sub.10S--Na requires 608.1566; found
608.1572.
(4R,6R)-4-(1,5-Dimethyl-3-oxo-2-phenyl-2,3-dihydro-1H-pyrazol-4-yl)-6-{2-[-
(2-hydroxy-ethyl)-(4-methoxy-benzenesulfonyl)-amino]-ethoxy}-5,6-dihydro-4-
H-pyran-2-carboxylic acid allyl ester
[0351] ##STR93##
[0352] .sup.1H NMR (600 MHz) 7.76 (m, 2H, HAr); 7.46-7.30 (m, 5H,
HAr); 6.99-6.96 (m, 2H, HAr); 6.11 (d, J=2.9, 1H, HC (3); 5.96
(ddd, J=17.1, 10.7, 1.5, 1H, HC (10'')); 5.35 (dd, J=17.1, 1.5, 1H,
HC (11'')); 5.26 (dd, J=10.7, 1.5, 1H, HC (11'')); 5.11 (dd, J=8.3,
2.0, 1H, HC (6)); 4.77-4.65 (m, 2H, H.sub.2C (9'')); 4.04-3.99 (m,
1H); 3.90-3.85 (m, 1H); 3.86 (s, 3H, H.sub.3CO); 3.72-3.70 (m, 2H);
3.44-3.40 (m, 2H); 3.33-3.20 (m, 3H); 3.06 (s, 3H, H.sub.3CN);
2.30-2.22 (m, 1H, HC (5)); 2.22 (s, 3H, H.sub.3CC); 2.02-1.96 (m,
1H, HC (5)); MS (ESI) 650 (M+Na); 628 (M+1); HRMS (ESI)
C.sub.31H.sub.37N.sub.3O.sub.9S--Na requires 628.2329; found
628.2348.
[0353] (D) Amine Building Blocks:
[4-(2-Amino-phenylcarbamoyl)-benzyl]-carbamic acid tert-butyl
ester
[0354] ##STR94##
[0355] .sup.1H NMR (500 MHz, dmso-d.sub.6) 9.60 (s, 1H, ArNH); 7.91
(d, J=7.8, 2H, HC (3'')); 7.48 (t, J=6.4, 1H, CH.sub.2NH); 7.33 (d,
J=6.8, 2H, HC (2'')); 7.15 (d, J=7.8, 1H, HC (6')); 6.96 (t, J=7.8,
1H, HC (4')); 6.76 (d, J=7.8, 1H, HC (3')); 6.58 (t, J=7.3, 1H, HC
(5')); 4.88 (s, 2H, NH.sub.2); 4.17 (d, J=6.4, 2H, H.sub.2Car);
1.39 (s, 9H, H.sub.3C); .sup.13C NMR (100 MHz, dmso-d.sub.6)
165.17; 155.85; 143.78; 143.16; 133.06; 127.83; 127.56; 126.95;
126.66; 126.48; 123.37; 116.28; 116.15; 77.94; 43.19; 28.26; MS
(ESI) 342 (M+1); 286.
[0356] (g) Encoded Split-Pool Library Synthesis
[0357] Loading. A potion of the silyl functionalized resin 2 (1.43
meq/g, 2.10 g, 3.0 mmol) was divided into eight equal portions (262
mg, 0.375 mmol, 1.0 equiv), placed under argon in PD-10 tubes and
suspended in 3 mL of 3% (vol/vol) TMSCl/CH.sub.2Cl.sub.2 (in PD-10
columns). The swollen beads were allowed to stand for 30 min, then
filtered (under argon) and washed with 4.times.3 mL.times.2 min
CH.sub.2Cl.sub.2. Then, a solution of TfOH (3% in CH.sub.2Cl.sub.2,
6.6 mL, 2.25 mmol, 6.0 equiv) was added and the resin was allowed
to stand (with occasional gentle mixing) for 25 min. The resin was
filtered (under argon) and washed with 4.times.3 mL.times.2 min
CH.sub.2Cl.sub.2. After the final wash an additional 2 mL of
CH.sub.2Cl.sub.2 was added to each pool, followed by 2,6-lutidine
(350 uL, 3.0 mmol, 8.0 equiv) and the resin was allowed to stand
(with occasional gentle mixing) for 15 minutes. At this point each
of the vinyl ethers BB1A-H were added (0.75 mmol, 2.0 equiv) as
solutions in 1 mL of CH.sub.2Cl.sub.2. The tubes were then allowed
to stand for 2.5 h (with occasional gentle mixing) then the resin
was filtered and washed with 4.times.3 mL.times.2 min
CH.sub.2Cl.sub.2, then 1.times.5 mL.times.15 min THF, then
1.times.5 mL.times.15 min CH.sub.2Cl.sub.2 then the resin pools
were dried, first by simple suction for 10 min, then under vacuum
for 2 h and taken to the next step.
[0358] First Encoding Step. Each of the eight resin pools from
above (0.375 mmol, 1 equiv) was placed in a dry 8 mL vial capped
with a septum. To each vial was added the appropriate diazoketone
tags (see Table 3 below) (0.0672 mmol total tag for each reaction),
followed by CH.sub.2Cl.sub.2 (4.0 mL, 16.8 mM total tag
concentration) was added to each vial and the vials were gently
shaken on a vortexer for 1 h. Then, a solution of
Rh.sub.2(O.sub.2CPh.sub.3).sub.4 (4 mL, 2.5 mg/mL) in
CH.sub.2Cl.sub.2 was added to each vial and the resulting mixture
vortexed for an additional 4 h, then the resin was filtered and
washed with 2.times.5 mL.times.15 min CH.sub.2Cl.sub.2, then
1.times.5 mL.times.5 min THF, then 1.times.5 mL.times.8 h THF, then
2.times.5 mL.times.0 min THF, then 3.times.5 mL.times.15 min
CH.sub.2Cl.sub.2. At this point the resin was pooled and
rotated/washed in 1.times.15 mL.times.30 min THF then 3.times.15
mL.times.30 min CH.sub.2Cl.sub.2, and dried as above to give 2.12 g
of tagged vinyl ether. TABLE-US-00003 TABLE 3 Binary tagging scheme
for first tagging step. BB1- T2B (C4Cl3) T4B (C6Cl3) T1A (C3Cl5)
T2A (C4Cl5) A 29.7 mg -- -- -- B -- 31.8 mg -- -- C -- -- 33.5 mg
-- D -- -- -- 34.5 mg E 14.9 mg 15.9 mg -- -- F 14.9 mg -- 16.7 mg
-- G 14.9 mg -- -- 17.2 mg H -- 15.9 mg 16.7 mg --
[0359] Cycloaddition. The resin from above was divided into 20
equal portions (106 mg each, 0.15 mmol (theory), 1.0 equiv) and
placed in dry 4 mL vials containing diene building blocks BB2A-J (2
vials per building block, 0.45 mmol, 3.0 equiv) and 10 mg of
activated powdered 4 A molecular sieves. The vials were capped with
septa and placed under argon. THF (0.8 mL) was added to each vial,
followed by a solution of appropriate catalyst solution (0.8 mL).
(Catalyst solutions were prepared by mixing 1 equiv of each
2,2'-Isopropylidenebis[(4S)-4-t-butyl-2-oxazoline] ligand (141 mg)
and Cu(OTf).sub.2 (173 mg) with 4 .ANG. molecular sieves (50 mg) in
THF (12.8 mL) and stirred at rt temp to give a deep green mixture.
An identical procedure was used for the (R)-enantiomer of
catalyst). The resulting mixtures were vortexed gently for 20 h
then filtered (powdered sieves pass through the filter, thus
separating them from the resin beads) and washed with 4.times.5
mL.times.30 min THF, then 3.times.5 mL.times.15 min
CH.sub.2Cl.sub.2 and dried as above to give 20 pools of partially
encoded cycloadducts.
[0360] Second Encoding Step. Each of the 20 resin pools (0.15 mmol
(theory), 1 equiv) was placed in a dry 8 mL vial capped with a
septum. To each pool was added the appropriate combination of tags
(0.027 mmol total tag, see table 4 below) followed by 1.6 mL of
CH.sub.2Cl.sub.2 and the mixture vortexed gently for 1 h. Then, a
solution of Rh.sub.2(O.sub.2CPh.sub.3).sub.4 (1.6 mL, 2.5 mg/mL) in
CH.sub.2Cl.sub.2 was added to each vial and the resulting mixture
vortexed for an additional 14 h, then the resin was filtered and
washed with 2.times.5 mL.times.15 min CH.sub.2Cl.sub.2, then
2.times.5 mL.times.15 min THF, then 1.times.5 mL.times.6 h THF,
then 2.times.5 mL.times.15 min THF, then 3.times.5 mL.times.15 min
CH.sub.2Cl.sub.2. At this point the resin pools derived from the
(R) were combined (likewise the pools from the (S) catalyst were
combined) and the two pseudo-enantiomeric pools were independently
mixed /washed with 2.times.15 mL.times.30 min THF and 3.times.15
mL.times.15 min CH.sub.2Cl.sub.2, then filtered and dried to give
two pseudo-enantiomeric pools of resin, each containing roughly
1.43 g of fully encoded, resin bound cycloadducts. A portion of
each pool ( 1/27) by weight was set aside at this point to provide
samples of the initial cycloadducts in the final library
collection. TABLE-US-00004 TABLE 4 Binary tagging scheme for second
tagging step. BB2- catalyst T3A (C5Cl5) T4A (C6Cl5) T5A (C7Cl5) T6A
(C8Cl5) T7A (C9Cl5) A (S)-1 14.2 mg -- -- -- -- B (S)-1 -- 14.5 mg
-- -- -- C (S)-1 -- -- 14.9 mg -- -- D (S)-1 -- -- -- 15.3 mg -- E
(S)-1 -- -- -- -- 15.7 mg F (S)-1 7.1 mg 7.3 mg -- -- -- G (S)-1
7.1 mg -- 7.5 mg -- -- H (S)-1 7.1 mg -- -- 7.6 mg -- I (S)-1 7.1
mg -- -- -- 7.9 mg J (S)-1 -- 7.3 mg 7.5 mg -- -- A (R)-1 -- 7.3 mg
-- 7.6 mg -- B (R)-1 -- 7.3 mg -- -- 7.9 mg C (R)-1 -- -- 7.5 mg
7.6 mg -- D (R)-1 -- -- 7.5 mg -- 7.9 mg E (R)-1 -- -- -- 7.6 mh
7.9 mg F (R)-1 4.7 mg 4.8 mg 5.0 mg -- -- G (R)-1 4.7 mg 4.8 mg --
5.1 mg -- H (R)-1 4.7 mg 4.8 mg -- -- 5.2 mg I (R)-1 4.7 mg -- 5.0
mg 5.1 mg -- J (R)-1 4.7 mg -- 5.0 mg -- 5.2 mg
[0361] Deallylation. Each of the two resin pools from above (1.5
mmol (theory) 1.0 equiv) was treated identically.
Tetrakis(triphenylphosphine)palladium (1.73 g, 1.5 mmol, 1.0 equiv)
was dissolved in 26 mL of THF. The dry resin was then added to this
solution followed by thiosalicylic acid (1.62 g, 10.5 mmol, 7
equiv) and the mixture was vortexed gently for 12 h, then the resin
pools were filtered and each washed separately with 4.times.15
mL.times.1 h THF, then 2.times.15 mL.times.15 min DMF, then
1.times.15 mL.times.15 min THF, then 1.times.15 mL.times.15 min
DMF, then 4.times.15 mL.times.15 min CH.sub.2Cl.sub.2 then dried to
give two pools of resin each weighing roughly 1.34 g. A portion of
each pool ( 1/26 by weight) was set aside at this point to provide
samples of the cycloadduct carboxylic acids in the final library
collection.
[0362] Amide Formation. Each of the two pools from above were split
into 25 equal portions (0.056 mmol (theory), 1 equiv), then each
set of 25 was treated identically. To each portion of resin in a 4
mL vial was added a stock solution of PyBop (193 mg/mL in
CH.sub.2Cl.sub.2, 1.5 mL, 0.55 mmol, 10 equiv) followed by stock
solutions of the amine building blocks (1.1 M in DMF, 500 uL, 0.56
mmol, 10 equiv). Then, diisopropylethylamine (100 uL, 0.56 mmol, 10
equiv) was added to each vial and the resulting mixtures were
vortexed for 12 h. Each reaction mixture was then filtered and
washed with 2.times.1 mL.times.30 min CH.sub.2Cl.sub.2, then
2.times.1 mL.times.30 min DMF, then 3.times.1 mL.times.30 min THF,
then 3.times.1 mL.times.30 min CH.sub.2Cl.sub.2 then dried as above
to give 50 spatially segregated pools of dihydropyrancarboxamides
plus the four pools from above for both (R) and (S)-derived esters
and acids. These samples were kept separate to allow for "spatial
coding" of the amine building block, in addition to the chemical
encoding of the first and second building blocks.
Example 2
Solid Support Synthesis of Inventive Compounds
Decoding Methodology
[0363] Discussion of Methodology
[0364] As described above and in Scheme 4, an encoded split-pool
library of 4320 dihydropyrancarboxamides (12) was synthesized
featuring an R- or S-bis(oxazoline)copper (II) triflate-catalyzed
heterocycloaddition reaction as a diversity-generating step. The
three sets of BBs used in the library synthesis are shown in FIG.
3. As discussed above, the library synthesis was based on three
chemical steps: (1) loading of eight vinyl ethers onto the PS beads
(4), (2) enantioselective cycloaddition with 10
.beta.,c-unsaturated ketoesters, followed by allyl ester
deprotection, and (3) PyBOP
(benzotriazole-1-yl-oxy-tris-pyrrolidino-phosphonium
hexafluorophosphate)-mediated coupling (See J. Coste, D. Lenguyen,
B. Castro, PyBOP: a new peptide coupling reagent devoid of toxic
byproduct, Tetrahedron Lett. 1990, 31:205-208) to 25 different
amines to yield support-bound dihydropyrancarboxamides (11).
##STR95## ##STR96##
[0365] Reaction step and BB encoding were carried out twice in the
library synthesis: first, after loading the eight vinyl ethers, and
second, after the cycloaddition reaction with ten heterodienes. The
tags and binary codes used for each BB are shown in Tables 5 and 6.
In the cycloaddition reaction, one set of beads (10 portions) was
treated with the (S)--Cu (II) catalyst, and the other ten portions
were treated with the (R)-catalyst (Scheme 4). From this step
onwards, these two groups of enantiomers were kept separate even
though they were encoded for each enantiomer of the catalyst used.
The subsequent reactions were carried out in parallel so that
spatial decoding could be performed had the chemical encoding
failed. The 25 final amide pools were kept separate to reduce the
number of chemical encoding steps. This library synthesis resulted
in 54 (27.times.2 enantiomers) separate portions of solid supports
(11) containing, theoretically, three copies of 4320
stereochemically and structurally distinct compounds (12). Finally,
as our macrobead handling `best practices` were observed throughout
the library synthesis, the majority of the library supports
remained intact (>90%). In order to test the integrity of our
optimized library encoding/decoding protocol, 108 macrobeads from
the library (theoretically 2.5% of the total library compounds)
were arrayed into tubes and treated with HF/py, followed by TMSOMe
to release the compounds (12) from the beads. The residue isolated
from each bead was dissolved in CH.sub.3CN and transferred to
individual glass autosampler inserts to provide arrayed stock
solutions of small molecules. A fraction of each of these stock
solutions was subjected to LC/MS analysis, and the corresponding
macrobeads were submitted to our optimized decoding protocol to
compare the two results (FIG. 7). TABLE-US-00005 TABLE 5 Binary
codes for encoding BB1 of library 12 Entry Tag C4Cl3 Tag C6Cl3 Tag
C3Cl5 Tag C4Cl5 BB1-A 1 0 0 0 BB1-B 0 1 0 0 BB1-C 0 0 1 0 BB1-D 0 0
0 1 BB1-E 1 1 0 0 BB1-F 1 0 1 0 BB1-G 1 0 0 1 BB1-H 0 1 1 0
[0366] TABLE-US-00006 TABLE 6 Binary codes for encoding BB2 of
library 12 in heterocycloadditions catalyzed by either R- or
S-bis(oxazoline)copper (II) tri.English Pound.ate Entry Catalyst
Tag C5Cl5 Tag C6Cl5 Tag C7Cl5 Tag C8Cl5 Tag C9Cl5 BB2-A S 1 0 0 0 0
BB2-B 0 1 0 0 0 BB2-C 0 0 1 0 0 BB2-D 0 0 0 1 0 BB2-E 0 0 0 0 1
BB2-F 1 1 0 0 0 BB2-G 1 0 1 0 0 BB2-H 1 0 0 1 0 BB2-I 1 0 0 0 1
BB2-J 0 1 1 0 0 BB2-A R 0 1 0 1 0 BB2-B 0 1 0 0 1 BB2-C 0 0 1 1 0
BB2-D 0 0 1 0 1 BB2-E 0 0 0 1 1 BB2-F 1 1 1 0 0 BB2-G 1 1 0 1 0
BB2-H 1 1 0 0 1 BB2-I 1 0 1 1 0 BB2-J 1 0 1 0 1
[0367] Decoding consisted of deriving the identities of BBs 1 and 2
by GC tag analysis, adding their combined molecular weight to that
of the amine corresponding to the pool of supports from which the
macrobead was taken, and comparing this composite mass to the mass
observed experimentally by APCI/MS. The structural data obtained
via GC decoding were in complete agreement with the MS data
obtained from the compounds' stock solutions (FIGS. 6A-I) for 107
of the 108 samples. Seventy of the 108 macrobeads (65%) yielded GC
traces that decoded for a compound with a molecular ion identical
to that expected based on the MS data. Twenty-five macrobeads (23%)
showed GC traces that decoded for a compound whose molecular ion
corresponded to a fragment of the proposed structure. Direct stock
solution decoding, using the optimized decoding protocol on a
fraction (.about.5%) of the stock solutions generated from
individual macrobeads, was carried out successfully to identify the
structures of the 12 remaining samples (See H. E. Blackwell, L.
Perez, S. L. Schreiber, "Decoding products of diversity pathways
from stock solutions derived from single polymeric macrobeads",
Angew. Chem. Int. Ed. 2001, 40:3421-3425). Structures of 25
representative compounds from the 108 beads decoded of library 12
are shown below (numbers in bold refer to bead number). All
structures show agreement between their GC and MS decoding data.
Representative GC, LC, and MS traces for a single macrobead are
shown in FIGS. 9A-B. In addition, LC and MS traces for 25 inventive
compounds (quality control compounds) are depicted in FIGS. 16
(16A-16D) and 17 (17A-17C). ##STR97## ##STR98## ##STR99##
##STR100## ##STR101##
[0368] The successful synthesis and partial decoding of library 12
validate not only our binary encoding/decoding protocol, but also
the entire synthesis platform as a reliable procedure for the
generation of encoded split-pool libraries. The use of stock
solution decoding further enables this platform as it simplifies
the elucidation of structures of `hits` from assays and lends
itself to future automation.
[0369] The successful synthesis of an encoded split-pool library
(12) using this platform validates the approach. The synthesis
platform uses commercially available reagents and straightforward
synthetic procedures; therefore, we believe it could be readily
established in other laboratories. This work lays the foundation
for the second phase of platform development, where the members of
libraries are distributed on a per bead basis into multiwell assay
plates, submitted to automated cleavage, and resuspended to
generate plates of pure, arrayed stock solutions, as described in
Example 3 (See also P. A. Clemons, A. N. Koehler, B. K. Wagner, T.
G. Sprigings, D. R. Spring, R. W. King, S. L. Schreiber, M. A.
Foley, "A one-bead, onestock solution approach to chemical
genetics, part 2", Chem. Biol. 2001 , 8:1183-1195). The individual
stock solutions originating from single macrobeads have been found
to be sufficient for hundreds of phenotypic assays (forward
chemical genetics) and thousands of protein-binding assays (reverse
chemical genetics) before a need for re-synthesis (FIG. 10).
[0370] Experimental Section
[0371] I. General Synthetic Methods
[0372] General Methods. Reagents were obtained from Aldrich
Chemical Co., Acros, Novabiochem, or J. T. Baker and used without
further purification. Reaction solvents (THF, Et.sub.2O, DMF,
toluene, and CH.sub.2Cl.sub.2) were obtained from J. T. Baker (HPLC
grade) and purified by passage through two solvent columns prior to
use. The CH.sub.2Cl.sub.2 and toluene purification systems were
composed of one activated alumina (A-2) column and one supported
copper redox catalyst (Q-5 reactant) column. The THF and Et.sub.2O
purification systems were composed of two activated alumina (A-2)
columns, and the DMF purification system was composed of two
activated molecular sieve columns. See: Pangborn, A. B.; Giardello,
M. A.; Grubbs, R. H.; Rosen, R. K.; Timmers, F. J. Organometallics
1996, 15, 1518-1520. Diisopropylethylamine (DIPEA) and 2,6-lutidene
were distilled from calcium hydride; MeOH was distilled from
magnesium methoxide. Brominated polystyrene (Br--PS, 2 mequiv/g)
was obtained from Polymer Labs (Product #:1462-9999, $18/g).
Solution phase reactions were performed in oven- or flame-dried
glassware under positive N.sub.2 pressure.
[0373] Solid Phase Reactions. Small-scale solid phase reactions
(5-10 mg resin) were performed in 500 .mu.L polypropylene Eppendorf
tubes with mixing provided by a Vortex Genie-2 vortexer fitted with
a 60 microtube insert. Medium-scale solid phase reactions (20-500
mg resin) were performed in 2 mL fritted polypropylene
Bio-Spin.RTM. chromatography columns (Bio-Rad) or 10 mL fritted
polypropylene PD-10 columns (Pharmacia Biotech) with 360.degree.
rotation on a Barnstead-Thermolyne Labquake.TM. Shaker. Large-scale
solid phase reactions (>500 mg resin) were performed in
silanized 50 or 100 mL fritted glass tubes equipped for vacuum
filtration and N.sub.2 bubbling. The tubes were silanized by
treatment with 20% dichlorodimethylsilane/CH.sub.2Cl.sub.2 for 15
min, MeOH for 15 min, followed by oven heating at 120.degree. C.
for at least 2 h.
[0374] After small-scale reactions, resin samples were transferred
to 2 mL BioSpin.RTM. columns. Resin samples in polypropylene
columns were washed on a Vac-Man.RTM. Laboratory Vacuum Manifold
(Promega) fitted with nylon 3-way stopcocks (Bio-Rad). Resin
samples in glass tubes were washed in the tubes with alternating
periods of N.sub.2 bubbling and vacuum draining. The following
standard wash procedure was used: 3.times.THF, 3.times.DMF,
3.times.THF, 3.times.CH.sub.2Cl.sub.2.
[0375] Resin samples were then transferred via spatula to 500 .mu.L
Ependorf tubes and suspended in Ar-degassed HPLC grade THF followed
by pyridine and hydrogen fluoride-pyridine (Aldrich, HF
(70%)/pyridine (30%)) in a ratio of 90:5:5. Samples were then
sealed with parafilm and gently agitated on a vortexer for 30 min.
Methoxy-trimethylsilane (TMSOMe) was added and the samples were
sealed with Parafilm and placed on a vortexer for an additional 30
min. The supernatant fluid was removed, transferred to another
Eppendorf tube, and concentrated in vacuo.
[0376] Purification and Analysis. Flash chromatography was
performed on E. Merck 60 230-400 mesh silica gel. TLC was performed
on 0.25 mm E. Merck silica gel 60 F.sub.254 plates and visualized
by UV (254 nm) and cerium ammonium molybdate. HPLC was performed on
a Nest Group (Southborough, Mass.) Hypersil C18 100 .ANG. 3 .mu.M,
4.6 mm.times.6 cm column using a flow rate of 3 mL/min and a 4 min
gradient of 0-99.9% CH.sub.3CN in H.sub.2O/0.1% TFA, constant 0.1%
MeOH with diode array UV detection. IR spectra were recorded on a
Nicolet 5PC FT-IR Spectrometer or a Bruker Vector 22 Spectrometer
with peaks reported in cm.sup.-1. NMR spectra were recorded on
Varian Inova 500 MHz and 400 MHz instruments. Solid-phase NMR
spectra were recorded on a Varian Inova 500 MHz equipped with a
Nanoprobe (See (a) Fitch, W. L.; Detre, G.; Holmes, C. P.;
Shoolery, J. N.; Keifer, P. A. J. Org. Chem. 1994, 59, 7955-7956.
(b) Keifer, P. A.; Baltusis, L.; Rice, D. M.; Tymiak, A. A.;
Shoolery, J. N. J. Magn. Reson., Series A 1996 119, 65-75).
Chemical shifts are expressed in ppm relative to TMS (0.00 ppm) or
residual solvents. Peak assignments were made based on homonuclear
decoupling and/or two-dimensional DQF-COSY, TOCSY, and/or NOESY
experiments. Mass spectra were obtained on JEOL AX-505H or SX-102A
mass spectrometers by electron impact ionization (EI), chemical
ionization (CI) with ammonia (NH.sub.3), or fast atom bombardment
ionization (FAB) with glycerol or 3-nitrobenzyl alcohol/sodium
iodide (NBA/NaI) matrices. LC/MS data was obtained on a Micromass
Platform LCZ mass spectrometer in atmospheric pressure chemical
ionization (APCI) mode attached to a Waters 2690 HPLC system. LC/MS
chromatography was performed on a Waters Symmetry C18 3.5 .mu.M,
2.1 mm.times.50 mm column using a flow rate of 0.4 mL/min and a 10
min gradient of 15-100% CH.sub.3CN in H.sub.2O, constant 0.1%
formic acid with 200-450 nm detection on Waters 996 photodiode
array detector. GC/ECD data was obtained on a Hewlett Packard 6890
Gas Chromatograph fitted with a 7683 series injector and
autosampler, split-splitless inlet, .mu.-ECD detector, and a
J&W DB1 15 m.times.0.25 mm.times.0.25 .mu.m column. (Gradient
start temperature: 110.degree. C.; hold 1 min, ramp 45.degree.
C./min to 250.degree. C., hold 2 min, ramp 15.degree. C./min to
325.degree. C., hold 2 min. Flow rate: constant flow, 1 mL/min.
Inlet is purged at 1 min with flow rate 60 mL/min, reduced to 20
mL/min at 2 min).
[0377] II. Allyl Silane Linker Synthesis
[0378] Diisopropyl(4-methoxyphenyl)silane. A solution of
p-bromoanisole (28.6 mL, 228 mmol, 1.0 equiv.) in THF (550 mL) was
chilled to -78.degree. C. (CO.sub.2(s), acetone) and treated with
n-BuLi (91.2 mL, 228 mmol, 2.5 M in hexanes, 1 equiv.) via cannula
over a 5 min period. After 5 min a white precipitate began to form.
The mixture had stirred for 30 min at -78.degree. C. when
diisopropylchlorosilane (34.6 g, 228 mmol, 1.0 equiv.) was slowly
added via syringe. After 1 h the ice bath was removed, and the
solution was allowed to come to 23.degree. C. with continued
stirring overnight. The mixture was treated with saturated
NH.sub.4Cl (50 mL) and extracted with ether (3.times.500 mL). The
combined organic extracts were washed with brine, dried over
MgSO.sub.4, filtered and concentrated in vacuo to yield a light
yellow oil. Silica gel chromatography (gradient: 3-5%
EtOAc/hexanes) yielded (47.7 g, 94%) of a colorless oil. This
material could also be purified by distillation [BP=76-85.degree.
C. @ 275 mTorr (40 g, 63%)]. TLC R.sub.f=0.61 (1:9 EtOAc/hexanes).
IR (film): 2393, 1853, 1710, 1691, 1658, 1584, 1482, 1346. .sup.1H
NMR (500 MHz, CDCl.sub.3): .delta.7.48 (d, 2H, J=8.10), 6.95 (d,
2H, J=8.10), 3.97 (s, 1H, Si--H), 3.85 (s, 3H), 1.39 (q, 2H, J=3),
1.10 (d, 6H, J=6.5), 1.03 (d, 6H, J=7.5). .sup.13C NMR (126 MHz,
CDCl.sub.3): .delta. 137.13, 113.73, 113.62, 55.18, 18.95, 18.72,
11.08. Elemental analysis, Calcd.: C, 70.21; H, 9.97; Si, 12.63.
Found: C, 70.43; H, 9.83; Si, 12.39.
[0379] Chloro(4-methoxyphenyl)diisopropylsilane.
Diisopropyl(4-methoxyphenyl)silane (47.7 g, 214 mmol, 1.0 equiv.),
was taken up in CH.sub.2Cl.sub.2 (700 mL). The solution was cooled
to 0.degree. C. and trichloroisocyanuric acid (16.6 g, 71.3 mmol,
0.33 equiv.) was carefully added in three equal portions, making
sure that each portion had at least 7 min to react before the next
was added. (Caution! Adding trichloroisocyanuric acid too rapidly
results in a rapid evolution of gas and concomitant expulsion of
the reaction vessel contents). The mixture was stirred at 0.degree.
C. for 40 min, followed by warming to 23.degree. C. with stirring.
The solids were filtered under an inert atmosphere, and the
filtrate was concentrated in vacuo to yield 54.8 g (98%) of a
cloudy oil. The chlorosilane, which is unstable, was used
immediately and without purification in the next step.
[0380] Allyl(4-methoxyphenyl)diisopropylsilane. To the crude
chloro(4-methoxyphenyl)-diisopropylsilane (54.8 g, 214 mmol, 1.0
equiv.) was added THF (335 mL) via cannula under Ar. The solution
was chilled to 0.degree. C. and treated with allylmagnesium
chloride (128 mL, 256 mmol, 2.0 M in THF, 1.2 equiv.). After 3 h at
0.degree. C., the solution was allowed to warm to 23.degree. C.
with stirring overnight (16 h). The mixture was treated with
saturated NH.sub.4Cl (50 mL), and the aqueous layer was extracted
with ether (3.times.500 mL). The combined organic extracts were
washed with brine, dried over MgSO.sub.4, filtered, and
concentrated in vacuo. The crude material was purified by silica
flash chromatography (3-5% EtOAc/hexanes) to yield 52.86 g (94%) of
a slightly cloudy, clear viscous oil. This reagent distills at
80.degree. C. at 500 mTorr as a colorless oil. TLC R.sub.f=0.40
(1:9 EtOAc/hexanes). IR (film): 2942, 2865, 1630, 1595, 1504, 1463,
1277. .sup.1H NMR (500 MHz, CDCl.sub.3): .delta. 7.32 (d, 2H,
J=6.84), 6.81 (d, 2H, J=6.84), 5.82 (q, 1H, J=8.5, 8.5), 4.88 (d,
1H, J=17.05), 4.76 (d, 1H, J=9.77), 1.82 (d, 2H, J=7.32), 1.17 (q,
2H, J=7.3), 0.94 (d, 6H, J=7.3), 0.90 (d, 6H, J=7.3). .sup.13C NMR
(126 MHz, CDCl.sub.3): .delta. 160.51, 136.48, 135.70, 125.78,
113.78, 113.62, 55.09, 19.34, 18.22, 18.17, 17.68, 11.30. Elemental
analysis, Calcd.: C, 73.22; H, 9.98; Si, 10.70. Found: C, 73.25; H,
9.97; Si, 10.77.
[0381] III. PS Resin Derivatization
[0382] Hydroboration of Allyl(4-methoxyphenyl)diisopropylsilane.
Solid 9-BBN dimer (6.29 g, 53.0 mmol, 0.95 equiv.) was weighed out
in a glove box and sealed under an Ar atmosphere. Freshly distilled
THF (365 mL) and allyl(4-methoxyphenyl)diisopropylsilane (14.64 g,
55.8 mmol, 1.0 equiv.) were added via syringe, and the mixture was
allowed to stir for 3 h at 23.degree. C. The overall concentration
of the allyl(4-methoxyphenyl)diisopropylsilane in THF was 0.16 M,
which was the appropriate concentration for the subsequent Suzuki
coupling. The yield of this reaction was assumed to be
quantitative.
[0383] Suzuki Coupling. To the alkyl-borane containing THF solution
above (53.0 mmol in 365 mL of THF, 1.74 equiv.) was added the solid
Br--PS (15.25 g, 2 mequiv/g 30.5 mmol of Br, 1.0 equiv.) Care was
taken to maintain an Ar blanket over the solution. Br--PS was
allowed to swell for 45 min, and then treated with
tetrakis(triphenylphosphine)palladium(0) (880 mg, 0.76 mmol, 0.025
equiv.) followed by aqueous NaOH solution (61 mmol, 30.5 mL of a 2M
NaOH solution, 2.0 equiv.). The reaction was then heated to reflux
with gentle stirring for 24 h. Pd(0) (880 mg, 0.76 mmol, 0.025
equiv.) was added, and the reaction was heated to reflux for
another 12 h. The biphasic reaction mixture turned slightly green
from its initial yellow color. The mixture was filtered, and the
beads were washed repeatedly (see below). While it was unnecessary
to agitate the beads during the wash cycle, it was critical to
allow the beads sufficient time to absorb the washing solvent. Wash
procedure: THF (2.times.100 mL.times.45 min), 3:1 THF/1 M NaCN
(1.times.100 mL.times.1 h or until all dark color is gone), 3:1
THF/H.sub.2O (2.times.100 mL.times.45 min), 3:1 THF/IPA
(2.times.100 mL.times.45 min), THF (2.times.100 mL.times.45 min),
CH.sub.2Cl.sub.2 (2.times.100 mL.times.45 min). The beads were
air-dried overnight, then placed on a lyophilizer for 24 h,
producing an almost colorless, opaque resin. .sup.1H NMR (500 MHz,
nanoprobe, CD.sub.2Cl.sub.2 gel phase): .delta. 7.34 (m, 4H), 6.82
(m, 4H), 3.69 (s, 3H), 1.76 (m, 2H), 1.22 (m, 2H), 1.16 (m, 2H),
0.97 (m, 2H), 0.91 (m, 12H) [For a discussion of the effect of
resin linker length on gel-phase NMR spectral line widths, see:
Keifer, P. A. J. Org. Chem. 1996, 61, 1558-1559]. Elemental
analysis. Found C, 83.54; H, 8.28; Si, 4.35; Br, <0.02; Cl,
0.247.
[0384] Determination of Bead Loading by Elemental Analysis. 2.0
mmol p-bromopolystyrene beads, quantitatively loaded with the
silicon linker above, contain 41 mg Si/g resin or 4.1% Si. Assuming
quantitative loading, the mass of 1 g resin would increase to 1.37
g; therefore, the linker loading is calculated as 1.45 mequiv/mol.
Thus, the resin loading is estimated from two elemental analyses
parameters, % Si and % Br. The % Br<0.02 by weight indicates
qualitative disappearance of Br (note that halogens can be confused
by elemental analysis, hence it is necessary to perform separate Br
and Cl analysis), while percent Si indicates the loading level.
Percent Si typically ranges from 3.79 to 4.05%. The procedure used
to calculate percent Si can overestimate the actual amount of Si by
0.2-0.3% as these numbers are calculated by weighing ash resultant
from sample digestion with acid and residue combustion, which
leaves some elements unresolved from Si. 4.35% Si is equivalent to
43.5 mg Si/g resin, or 1.54 mequiv Si/g. The actual loading used in
subsequent calculations was 1.45 mequiv/g, the theoretical maximum.
There were 9,350 beads/g of 500-600 copolymerized
p-bromopolystyrene beads with 2.0 mmol Br/g loading level. We
assumed quantitative conversion, justified by disappearance of
bromine and appearance of appropriate amount of silicon. Thus, the
number of polystyrene beads in one gram of resin was then scaled
with a 37% mass increase, or about 6,800 beads/g.
[0385] IV. Bead Stability Studies (FIG. 4)
[0386] While the use of sequences of tandem organic reactions can
efficiently generate complex molecules in diversity-oriented
syntheses [S. L. Schreiber, Target-oriented and diversity-oriented
organic synthesis in drug discovery, Science 287 (2000) 1964-1969],
we have observed that successive organic transformations, coupled
with rigorous bead washing between reactions, can damage the PS
macrobeads. The exemplary technology platform used for the present
study (FIG. 10), however, implies that we isolate one physically
intact bead per well prior to compound cleavage for several
reasons. First, fragments of beads yield weaker compound stock
solutions after bead arraying, cleavage, and resuspension. Second,
the possibility of isolating more than one fragment per well allows
for stock solution contamination and the concomitant incorrect
decoding of that well. To avoid these problems, we have developed a
set of standard practices for bead handling during library
synthesis and encoding that dramatically minimize the possibility
of bead breakage.
[0387] In general, we have found that the less we handle the solid
supports physically, either by submission to chemical reactions,
washing, or drying, the less bead breakage we observe. This
reinforces the importance of an effective planning algorithm for
diversity-oriented syntheses. Short reaction sequences yielding
complex and diverse compounds not only ensure that positives can be
re-synthesized readily, but also promote the integrity of the
beads. In order to quantify bead integrity, we used population size
distribution measurements (obtained by light obscuration) to
monitor the shift of the average particle size in a sample of beads
(data not shown). We first observed that the PS macrobeads were
fragile when swollen in organic solvents. Since the use of solvents
and drying are required in library synthesis, we assessed several
solvent, drying, and agitation conditions. Even though certain
chemical transformations appear to cause more bead breakage than
others, we did not include different chemical reactions as
experimental variables in our studies because we did not want to
limit the types of chemistry utilized in library synthesis.
[0388] As evidence that even the most simple and gentle handling
induces damage, supports swollen in dichloro-methane
(CH.sub.2Cl.sub.2) and drained seven times, followed by overnight
air drying resulted in a shift to a smaller average size
distribution. As an example of extreme damage, beads were subjected
to swelling in tetrahydrofuran (THF) (45 min), followed by
treatment with methanol (MeOH) (45-min) and 360.degree. rotation.
The beads were then rapidly dried via lyophilization, and the whole
process was repeated seven times. These supports show even more
extensive damage and a greater degree of bead fragmentation. The
`best practices` we extrapolated from these experiments include
light agitation from a wrist-action shaker, followed by blowing
N.sub.2 over the resin (30 min), and final drying under high vacuum
conditions from any organic solvent. While a shift in average size
still exists, these conditions minimize fragmentation and are
suitable for library syntheses, as judged by our ability to array
one intact bead per well after library synthesis (see FIG. 4) [See
S. M. Sternson, J. B. Louca, J. C. Wong, S. L. Schreiber,
Split-pool synthesis of 1,3-dioxanes leading to arrayed stock
solutions of single compounds sufficient for multiple phenotypic
and protein-binding assays, J. Am. Chem. Soc. 123 (2001) 1740-1747;
and P. A. Clemons, A. N. Koehler, B. K. Wagner, T. G. Sprigings, D.
R. Spring, R. W. King, S. L. Schreiber, M. A. Foley, A one-bead,
one-stock solution approach to chemical genetics, part 2, Chem.
Biol. 8 (2001) 1183-1195].
[0389] V. Library Encoding and Decoding Protocols
[0390] Representative Bead Encoding Procedure. Place 20 dry beads
(approximately 3 mg resin) in a 700 .mu.L Eppendorf tube. Prepare a
fresh 8.4 mM (in each tag) solution in dry CH.sub.2Cl.sub.2 in an
oven-dried, Teflon capped glass vial. (NOTE: The tag concentration
can be cut by one-half to one-fifth, and the tags will still be
readable by GC (the late tags will be weak). This might be
necessary for large library syntheses where a large quantity of tag
is required, or if more than 4 tags are used in each tagging step.
Use the same volume of tag solution as described below.) Add 50
.mu.L of the tag solution to the Eppendorf tube. Set the tube to
shake for 45 min at room temperature on a tabletop orbital shaker.
Prepare a 4.4 mg/mL solution of the catalyst, rhodium
triphenylacetate (Rh.sub.2(O.sub.2CC(Ph).sub.3).sub.4), in dry
CH.sub.2Cl.sub.2 under Ar in an oven-dried, Teflon capped glass
vial. (NOTE: The catalyst concentration can be cut by one-half to
one-fifth and the tags will still be readable by GC (the late tags
will be weak). Use the same volume of catalyst solution as
described below.) Add 50 .mu.L of the catalyst solution to the
resin and keep the Eppendorf in agitation for 16 h (overnight) at
room temperature. Wash the resin in a 1 mL BioRad tube 2.times.15
min CH.sub.2Cl.sub.2, 16 h (overnight) THF, 2.times.15 min THF, and
2.times.15 min CH.sub.2Cl.sub.2. Dry the resin under house vacuum
for ca. 15 min before proceeding to compound cleavage. Compound
Cleavage: Place the beads into a 700 .mu.L Eppendorf tube. Add 100
.mu.L of freshly-prepared 5% (HF/py)/THF solution (v/v). Set the
tube to shake for 90 min at room temperature on a tabletop
Eppendorf shaker. Quench HF by adding 200 .mu.L TMSOMe to the tube.
Set the tube to shake for 30 min at room temperature on a tabletop
Eppendorf shaker. Collect the filtrate (if desired) and wash the
resin: 3.times.5 min CH.sub.2Cl.sub.2, 3.times.5 min THF, and
3.times.5 min CH.sub.2Cl.sub.2. Dry under house vacuum for at least
1 h before decoding.
[0391] Representative Bead Decoding Procedure. Place one bead into
an autosampler glass sample insert with the aid of tweezers. A 0.24
M solution of CAN in 5:1 THF/H.sub.2O is prepared (132 mg CAN/0.83
mL dry, degassed THF+0.17 mL doubly-distilled H.sub.2O) in an
oven-dried vial. This solution should be prepared immediately
before use. Add 5 .mu.L of the CAN solution to the glass
autosampler insert. Add 8 .mu.L of dry decane to the glass insert
and then centrifuge the insert in a Micro-Centrifuge to separate
the two layers. Place the insert in an autosampler vial and cap
tightly. Seal with Parafilm, and heat the glass insert at
37.degree. C. for 21 h (in a standard laboratory incubator). Allow
the sample to cool to room temperature, and remove the glass insert
from the autosampler vial. Sonicate the insert for 1-10 min.
Centrifuge the insert again in the Micro-Centrifuge. Use a 200
.mu.L Pipetman equipped with a gel-loading tip to remove the top
decane layer and transfer it to a new GC autosampler glass insert.
(After heating overnight, the CAN layer will be colorless, so
caution must be used to not contaminate the decane layer with CAN
in transfer.) Prepare a 1:1 BSA/decane solution in an oven-dried
vial. This solution should be prepared immediately before use. Add
1.0 .mu.L of this BSA solution to the decane layer in the GC
insert. Spin down the insert in the Microfuge for 30-40 sec to
ensure efficient mixing of the BSA solution with the sample. Place
the insert in an autosampler vial, cap tightly, and store at
0.degree. C. until GC analysis. TABLE-US-00007 TABLE 5 Binary
decoding data from GC and LC/MS analysis of 108 beads from
dihydropyrancarboxamide library 12. (BB = building block). GC and
MS data for bead #105 could not be correlated. Tag Tag Tag Tag Tag
Tag Tag Tag Tag Expected Bead # 2B 4B 1A 2A 3A 4A 5A 6A 7A BB1 BB2
BB3 mass Observed mass 1 0 1 1 0 1 1 0 0 0 H F A 572 M + H 2 1 0 0
1 0 1 1 0 0 G J A 539 M + H 3 0 1 1 0 1 1 0 0 0 H F B 552 M + H 4 1
1 0 0 0 0 0 1 0 B D B 435 M + H 5 1 0 0 1 1 1 0 0 0 G F C 447 M + H
6 0 0 0 1 1 0 1 0 0 D G C 447 M + H 7 1 1 0 0 1 0 0 0 0 E A D 441 M
+ H 8 1 0 0 1 1 0 0 0 0 G A D 401 M + H 9 0 0 0 1 0 0 0 1 0 D D E
514 M + H 10 0 1 0 0 0 0 0 0 1 C E E 500 M + H 11 1 0 0 1 1 0 1 0 0
G G F 473 M + H 12 1 1 0 0 1 1 0 0 0 E F F 479 M + H 13 1 1 0 0 1 0
1 0 0 E G G 592 M + H 14 1 1 0 0 0 0 0 0 1 E E G 596 M + H 15 0 0 0
1 0 1 1 0 0 D J H 540 M - EtOH 16 1 0 0 0 1 0 0 1 0 A H H 497 M + H
17 0 1 0 0 1 1 0 0 0 B F I 582 M + H 18 0 0 0 1 1 0 1 0 0 D G I 614
M - BB1_D 19 0 1 0 0 0 1 1 0 0 B J J 640 M + H 20 0 0 1 0 0 1 1 0 0
C J J 638 M + H 21 1 0 0 0 0 0 0 1 0 A D K 563 M + H 22 0 0 1 0 1 0
1 0 0 C G K 559 M - EtOH 23 1 0 0 0 1 1 0 0 0 A F L 497 M + H 24 0
1 0 0 0 1 1 0 0 B J L 617 M + H 25 0 1 1 0 0 0 1 0 0 H C M 694 M +
H 26 0 0 0 1 0 1 1 0 0 D J M 545 M + H 27 1 0 0 1 0 1 1 0 0 G J N
540 M + H 28 0 1 1 0 0 0 1 0 0 H C N 655 M + H 29 1 0 0 0 0 1 0 0 0
A B O 383 M + H 30 0 0 0 1 0 0 1 0 0 D C O 485 M - BB1_D 31 0 1 0 0
0 1 1 0 0 B J P 607 M + MeOH--H.sub.2O 32 1 1 0 0 1 0 0 0 1 E I P
637 M + MeOH--H.sub.2O 33 1 0 0 1 1 0 0 1 0 G H Q 644 M + H 34 1 0
1 0 1 0 0 1 0 F H Q 684 M + H 35 1 0 0 1 1 0 0 0 0 G A R 413 M + H
36 0 0 0 1 1 1 0 0 0 D F R 419 M - EtOH 37 0 1 1 0 0 1 1 0 0 H J S
1049 M + H 38 0 1 1 0 1 1 0 0 0 H F S 945 M + H 39 0 0 1 0 1 1 0 0
0 C F T 513 M + H 40 0 0 1 0 0 1 1 0 0 C J T 617 M + H 41 0 0 0 1 1
0 0 0 1 D I U 469 M - EtOH 42 1 0 1 0 1 0 1 0 0 F G U 515 M -
C.sub.4O.sub.2H.sub.8 43 0 0 0 1 0 0 1 0 0 D C V 558 M - EtOH 44 0
1 0 0 0 0 1 0 0 B C V 560 M + H 45 1 0 1 0 1 0 0 0 1 F I W 505 M -
C.sub.4O.sub.2H.sub.8 46 1 0 0 1 0 1 1 0 0 G J W 507 M + H 47 0 0 1
0 1 0 0 0 1 C I X 576 M - EtOH 48 1 0 1 0 0 0 0 0 1 F E X 626 M + H
49 1 0 0 0 1 0 0 0 1 A I Y 413 M + H 50 0 0 1 0 0 1 1 0 0 C J Y 469
M + H 51 1 0 0 1 0 0 1 0 1 G D A 487 M + H 52 0 0 0 1 1 0 1 1 0 D I
A 463 M - EtOH 53 1 0 0 1 0 1 0 1 0 G A B 375 M - H.sub.2O 54 0 1 1
0 0 1 0 1 0 H A B 512 M + H 55 0 0 1 0 0 1 0 1 0 H A C 544 M - MeOH
56 0 0 0 1 1 1 0 0 1 D H C 488 M + H 57 0 0 1 0 1 1 0 1 0 F G D 515
M - EtOH 58 1 0 0 0 0 0 1 0 1 A D D 445 M + H 59 0 0 0 1 0 1 0 0 1
D B E 456 M + H 60 1 0 0 1 0 1 0 0 1 G B E 490 M + H 61 1 0 0 1 0 1
0 0 1 G B F 433 M + H 62 0 1 1 0 0 0 0 1 1 H E F 614 M + H 63 1 0 0
0 1 0 1 0 1 A J G 574 M + H 64 0 0 0 1 1 1 0 0 1 D H G 559 M + H 65
0 0 0 1 1 0 1 1 0 D I H 498 M - EtOH 66 0 0 1 0 1 0 1 0 1 C J H 540
M + H 67 0 1 0 0 0 1 0 0 1 B B I 576 M + H 68 0 1 1 0 0 0 0 1 1 D E
I 618 M + H 69 1 0 0 1 1 1 0 1 0 G G J 602 M + H 70 1 0 0 1 0 1 0 1
0 G A J 528 M + H 71 1 1 0 0 0 0 1 0 1 E D K 651 M + H 72 1 0 1 0 0
0 0 1 1 F E K 637 M + H 73 1 0 1 0 1 1 1 0 0 F F L 585 M + H 74 1 0
0 1 0 0 0 1 1 G E L 583 M + H 75 1 0 1 0 1 1 0 0 1 F H M 590 M + H
76 1 0 1 0 0 0 0 1 1 F E M 553 M - C.sub.4O.sub.2H.sub.8 77 0 0 1 0
1 0 1 0 1 C J N 506 M + H 78 1 0 0 1 0 0 1 1 0 G C N 518 M + H 79 1
0 0 0 0 0 1 1 0 E C O 559 M + H 80 1 1 0 0 1 1 1 0 0 E F O 477 M +
H 81 1 0 0 1 1 1 0 1 0 G G P 569 M + MeOH--H.sub.2O 82 0 1 1 0 0 0
1 1 0 H C P 754 M + H 83 0 0 0 1 1 1 0 1 0 D G Q 569 M - EtOH 84 1
0 0 1 1 1 0 1 0 G G Q 603 M - H.sub.2O 85 1 0 0 0 1 0 1 1 0 A I R
467 M + H 86 0 0 1 0 0 0 0 1 1 C E R 457 M - EtOH 87 0 1 0 0 1 1 0
1 0 B G S 810 M + H 88 1 0 0 0 1 1 0 1 0 A G S 794 M + H 89 1 0 1 0
1 1 0 1 0 F G T 621 M - C.sub.4O.sub.2H.sub.8 90 1 0 0 1 0 0 1 1 0
G C T 629 M + H 91 1 0 1 0 0 0 1 0 1 F D U 533 M -
C.sub.4O.sub.2H.sub.8 92 0 0 1 0 1 0 1 0 1 C J U 511 M + H 93 0 0 1
0 0 1 0 1 0 C A V 436 M - EtOH 94 0 0 0 1 0 0 1 1 0 D C V 558 M + H
95 0 1 1 0 0 1 0 1 0 H A W 500 M + H 96 0 0 1 0 1 0 1 0 1 C J W 473
M + H 97 1 1 0 0 0 0 0 1 1 E E X 626 M + H 98 0 0 1 0 1 1 1 0 0 C F
X 514 M + H 99 0 0 1 0 1 1 1 0 0 C F Y 365 M + H 100 0 0 0 1 1 0 1
1 0 D I Y 427 M - EtOH 101 1 0 0 0 1 0 0 0 0 A A 298 M + Na 102 1 0
1 0 1 0 0 0 1 F I 488 M - EtOH 103 0 0 0 1 1 1 0 0 1 D H 427 M -
EtOH 104 0 1 0 0 0 1 0 0 1 B B 348 M + H 105 1 0 1 0 1 0 1 0 0 F G
420 M - C.sub.4O.sub.2H.sub.8 106 1 0 1 0 1 0 0 0 0 F A 346 M + Na
107 1 1 0 0 0 0 1 0 1 E D 438 M - EtOH 108 0 1 0 0 1 1 0 1 0 B G
348 M + H
Example 3
Biological Testing
[0392] 1. Discussion of Methodology
[0393] Cell and Protein Based Screens
[0394] It will be appreciated that the small molecule compounds of
the present invention may be screened in any of a variety of
biological assays. For example, cell-based assays may be employed
(see FIG. 11). Such cell-based assays generally involve contacting
a cell with a compound and detecting any of a number of events,
such as binding of the compound to the cell, initiation of a
biochemical pathway or physiological change in the cell, changes in
cell morphology, initiation or blockage of the cell cycle etc.
[0395] In but one example, once synthesized, the compounds may be
arrayed in 384-well plates by a robotic 384 pin arrayer, as shown
in FIG. 23, and assayed for their ability to bind to a particular
cell type present in the well. Detection can be carried out, for
example, by detecting a tag that is attached to the small molecule.
Alternatively, the small molecule may be detected by using a second
molecule that has a tag, the second molecule specifically binding
the small molecule, e.g., a tagged antibody specific to the small
molecule.
[0396] Alternatively or additionally, inventive compounds may be
studied in such assays. In such assays, the compounds are bound to
a solid support and then contacted with a protein of interest. The
presence or absence of binding between the compound and the protein
is then detected. In certain cases, the protein itself is tagged
with a molecule that can be detected, e.g., with a fluorescent
molecule. Alternatively, the protein is detected by utilizing any
immunoassay, such as the ELISA.
[0397] For example, a process known as small molecule printing
(see, for example, U.S. Ser. No. 09/567,910, filed May 10, 2000,
the entire contents of which are hereby incorporated by reference),
may be utilized to screen proteins that interact with the library
compounds. First, a split pool library is arrayed onto beads. The
compounds are then cleaved from the beads and prepared in a
standard stock solution, such as DMSO. The compounds are then
arrayed onto a 384-well stock plate. Next, the compounds are
printed onto glass slides, e.g., a glass microscope slides, and the
slides are probed with a tagged ligand, e.g., a tagged protein of
interest. Binding between a compound and the ligand is then
detected by any available means appropriate to the tag being
utilized, e.g., via fluorescence. (See FIGS. 24 and 25).
[0398] It will be appreciated that any of the general assay methods
described above, as well as other assays known in the art, may
identify dihydropyrancarboxamide-like molecules having certain
biological properties. Described below are assays that examples of
assays that were used to screen the inventive library of compounds,
and that helped identify library members that exhibited certain
biological activity (e.g., BdrU incorporation, Genistein suppressor
activity and Eg5 inhibition).
[0399] As discussed above, in certain embodiments, the inventive
library is prepared by three diversity-generating steps, the first
two of which were encoded with chloroaromatic tags, as described in
Example 2 above. As the final diversity-generating step was not
chemically encoded, the library was prepared as 54 separate
portions of dry resin (9) totaling three theoretical copies of 4320
stereochemically and structurally distinct compounds (10) (see
Scheme 4).
[0400] Cleavage and Elution of a Diversity Set of
Dihydropyrancarboxamides
[0401] A robotic cleavage and elution protocol was used to deliver
actual library members from the inventive library into chemical
genetic assays. As described in Scheme 5, an encoded, split-pool
library of 4320 dihydropyrancarboxamides (10) (an exemplary
synthesis of which is described herein. See also, R. A. Stavenger,
S. L. Schreiber, Asymmetric catalysis in diversity-oriented organic
synthesis: enantioselective synthesis of 4320 encoded and spatially
segregated dihydropyrancarboxamides, Angew. Chem. Int. Ed. 2001,
40:3417-3421). ##STR102##
[0402] Briefly, as discussed above, in one embodiment, a method for
preparing this library comprises three diversity-generating steps,
the first two of which were encoded with chloroaromatic tags as
described in H. E. Blackwell, L. Perez, R. A. Stavenger, J. A.
Tallarico, E. Cope-Eatough, S. L. Schreiber, M. A. Foley, "A
one-bead, one-stock solution approach to chemical genetics, part
1", Chem. Biol. 2001, 8:1167-1182. As the final
diversity-generating step was not chemically encoded, we acquired
this library as 54 separate portions of dry resin (9) totaling
three theoretical copies of 4320 stereochemically and structurally
distinct compounds (10). We first exposed 324 individual beads, six
from each of the 54 separate portions of 9, to our manual `best
practices` cleavage and elution conditions (Scheme 5) in a single
microtiter plate. In this case, compounds were eluted directly into
DMF to prepare a diversity plate of stock solutions (plate 0)
amenable to small molecule printing. Glass microscope slides were
activated for covalent attachment of alcohols, and compounds (10)
from the 320 stock solutions were printed according to a method
described in U.S. patent application Ser. No. 09/567,910 (see also,
P. J. Hergenrother, K. M. Depew, S. L. Schreiber, Small molecule
microarrays: covalent attachment and screening of
alcohol-containing small molecules on glass slides, J. Am. Chem.
Soc. 122 (2000) 7849-7850).
[0403] To test the availability of 10 to a protein-binding assay,
we probed the small molecule microarray with purified Cy5-labeled
(His)6-FKBP12 (See G. MacBeath, A. N. Koehler, S. L. Schreiber,
Printing small molecules as microarrays and detecting
protein-ligand interactions en masse, J. Am. Chem. Soc. 121 (1999)
7967-7968). As a positive control for protein-ligand interaction,
AP1497 was included on the slide by adding it in DMF solution to an
empty well of the stock plate (See, for example, D. A. Holt, J. I.
Luengo, D. S. Yamashita, H.-J. Oh, A. L. Konialian, H.-K. Yen, L.
W. Rozamus, M. Brandt, M. J. Bossard, M. A. Levy, D. S. Eggleston,
J. Liang, L. W. Schultz, T. J. Stout, J. Clardy, Design, synthesis,
and kinetic evaluation of high-a.sctn.nity FKBP ligands and the
X-ray crystal structures of their complexes with FKBP12, J. Am.
Chem. Soc. 115 (1993) 9925-9938; and J. F. Amara, T. Clackson, V.
M. Rivera, T. Guo, T. Keenan, S. Natesan, R. Pollock, W. Yang, N.
L. Courage, D. A. Holt, M. Gilman, A versatile synthetic dimerizer
for the regulation of protein-protein interactions, Proc. Natl.
Acad. Sci. USA 94 (1997) 10618-10623). Following incubation, the
slide was washed and scanned for the presence of a Cy5 fluorescence
signal (See G. MacBeath, A. N. Koehler, S. L. Schreiber, Printing
small molecules as microarrays and detecting protein-ligand
interactions en masse, J. Am. Chem. Soc. 121 (1999) 7967-7968),
which appeared both at the AP1497 control spots (data not shown)
and at spots corresponding to a member of 10 (FIG. 13 (a)). The
bead corresponding to the novel FKBP12-binding entity was subjected
to the optimized bead decoding protocol described in Example 2
herein. Using this procedure, we were able unambiguously to
determine the structure (FIG. 13 (b)) of this `hit` (11) in a
protein-binding assay, as was subsequently confirmed by tandem
liquid chromatography/mass spectroscopy (LC/MS).
[0404] Formatting and Assaying of Representative
Dihydropyrancarboxamides
[0405] To apply the robotic process to a fraction of resin 9, we
arrayed 128 beads from each of three separate portions of 9 into a
single 384-well microtiter plate. These beads were subjected to
robotic cleavage and CH.sub.3CN elution as described earlier to
prepare a `mother plate` (plate 1) containing 384 members of 10.
Subsequently, the `mother plate` was mapped into six `daughter
plates` by volumetric transfer using the syringe-array robot.
`Daughter plates` were prepared for cell-based assays.sup.[1,2]
(50% of stock solution), HPLC analysis (25%), LC/MS analysis (10%),
small molecule printing.sup.[3,4] (2.times.5%), and stock solution
decoding (5%) [(1) T. U. Mayer, T. M. Kapoor, S. J. Haggarty, R. W.
King, S. L. Schreiber, T. J. Mitchison, Small molecule inhibitor of
mitotic spindle bipolarity identified in a phenotype-based screen,
Science 286 (1999) 971-974; (2) B. R. Stockwell, S. J. Haggarty, S.
L. Schreiber, High-throughput screening of small molecules in
miniaturized mammalian cell-based assays involving
post-translational modifications, Chem. Biol. 6 (1999) 71-83; (3)
G. MacBeath, A. N. Koehler, S. L. Schreiber, Printing small
molecules as microarrays and detecting protein-ligand interactions
en masse, J. Am. Chem. Soc. 121 (1999) 7967-7968; and (4) P. J.
Hergenrother, K. M. Depew, S. L. Schreiber, Small molecule
microarrays: covalent attachment and screening of
alcohol-containing small molecules on glass slides, J. Am. Chem.
Soc. 122 (2000) 7849-7850]. In each case, the CH.sub.3CN solution
was evaporated following volumetric transfer so that each copy
could be resuspended in the solvent most appropriate to its use. In
particular, DMSO was used to resuspend the `daughter plate` for
cell-based assays and DMF was used to resuspend the `daughter
plate` for small molecule printing. The plate containing the beads
was also stored, but due to the success of stock solution decoding
[H. E. Blackwell, L. Perez, S. L. Schreiber, Decoding products of
diversity pathways from stock solutions derived from single
polymeric macrobeads, Angew. Chem. Int. Ed. 40 (2001) 3421-3425],
and the difficulties associated with maintaining positional
integrity within plates of beads, formatting a `daughter plate`
explicitly destined for structure determination has become the
standard in our library realization process.
[0406] Both plates of stock solutions (10) were used in phenotypic
assays. In particular, we exposed living human A549 lung carcinoma
cells to 708 (324+384) stock solutions under two different assay
conditions. These experiments were performed with a hand-held
pin-transfer tool, though our complete technology platform includes
a pin-transfer robot capable of mapping into multiple microtiter
plates. In certain embodiments, cultured cells exposed to
5-bromodeoxyuridine (BrdU) will incorporate this base analog into
their DNA when actively dividing, and this incorporation can be
detected by cytoblot assay using antibodies directed against BrdU
(B. R. Stockwell, S. J. Haggarty, S. L. Schreiber, High-throughput
screening of small molecules in miniaturized mammalian cell-based
assays involving post-translational modifications, Chem. Biol. 6
(1999) 71-83). First, to determine if any stock solution of 10
inhibits BrdU incorporation, we transferred .about.100 nl of each
stock solution into individual assay wells containing A549 cells
actively growing in the presence of 1% fetal bovine serum. Second,
we exposed A549 cells to .about.100 nl of each stock solution, and
simultaneously challenged the cells with 100 .mu.M genistein, a
broad-spectrum protein tyrosine kinase inhibitor (T. Akiyama, J.
Ishida, S, Nakagawa, H. Ogawara, S. Watanabe, N. Itoh, M. Shibuya,
Y. Fukami, Genistein, a specific inhibitor of tyrosine-specific
protein kinases, J. Biol. Chem. 262 (1987) 5592-5595). Under the
latter conditions, BrdU incorporation, again judged by cytoblot
assay, is impaired (For a discussion of the cytoblot assay
technology, see U.S. patent application Ser. No. 09/361,576; and B.
R. Stockwell, S. J. Haggarty, S. L. Schreiber, High-throughput
screening of small molecules in miniaturized mammalian cell-based
assays involving post-translational modifications, Chem. Biol. 6
(1999) 71-83). Thus, `hits` in the former assay are detected as a
loss of signal in a high-signal array (FIG. 14 (a)), while `hits`
in the latter assay are detected as a gain of signal in a lowsignal
array (FIG. 14 (b)). The latter assay is referred to as a genistein
suppressor screen, as we are seeking a member of 10 that can
suppress the ability of genistein to inhibit BrdU
incorporation.
[0407] For each of these assays, aliquots from each of the two
plates (10) were exposed to cells in duplicate to ensure the
fidelity of the results. Compounds were scored as `hits` only if
they scored strongly in both replicates of a given experiment. From
plate 0, 11 compounds scored as inhibitors of BrdU incorporation,
while 10 compounds scored as suppressors of the action of
genistein. From plate 1, 12 compounds scored as inhibitors of BrdU
incorporation, while nine compounds scored as suppressors of the
action of genistein. It is interesting that roughly the same number
of first-pass `hits` were identified on each plate, despite the
difference in diversity between the two collections. This finding
may reflect the fact that assay results were tabulated by visual
scoring of photographic film, but is not limited to such detection
methods. Conversely, in the case of an FKBP12-binding assay using
microarrayed compounds, plate 1 produced no `hits` (data not
shown).
[0408] To ensure that we can obtain exact structural information on
the `hits` found in these experiments, we performed either bead
decoding [H. E. Blackwell, L. Perez, R. A. Stavenger, J. A.
Tallarico, E. Cope-Eatough, S. L. Schreiber, M. A. Foley, A
one-bead, one-stock solution approach to chemical genetics, part 1,
Chem. Biol. 8 (2001) 1167-1182] or stock solution decoding [H. E.
Blackwell, L. Perez, S. L. Schreiber, Decoding products of
diversity pathways from stock solutions derived from single
polymeric macrobeads, Angew. Chem. Int. Ed. 40 (2001) 3421-3425] on
all 42 compounds scoring as positive in either assay. Decoding
results were compared with LC/MS results for each sample to verify
that a compound of the correct mass was present. In all but nine
cases, LC traces revealed a single clean peak, and for each of the
42 `hits`, a parent ion or fragment matching the proposed structure
was observed by MS. Thus, we were able to decode and confirm the
structure (FIG. 14 (c)) of each `hit` detected in either the BrdU
or the genistein suppressor cytoblot assay.
[0409] The library was also screened for Eg5 inhibitory activity.
The following library member was found to inhibit Eg5 (FIG. 15):
##STR103##
[0410] From a statistical perspective, the library of
dihydropyrancarboxamides (9) was fully encoded, either chemically
using chloroaromatic tags (first two diversity-generating steps),
or positionally by inclusion into one of 54 pools of resin (third
diversity-generating step). Our collection of decoded `hits` was
analyzed to assign statistical significance to a process of `codon`
selection, by a given assay, of particular encoded events (or
combinations of encoded events) during the chemical history of the
library. The formal details of this analytical process will be
reported once applied to the entire collection of 4320
dihydropyrancarboxamides (9). One immediate consequence is that a
consensus set of structures corresponding to a particular assay
activity need not be limited to individual structures that scored
as `hits` in the assay. For example, if two codons corresponding to
building blocks from two different diversity-generating steps were
each strongly selected by a given assay, one might predict that a
compound incorporating both moieties would yield higher potency in
that assay. In the absence of additional information, we would
predict such a consensus structure even if the exact compound in
question was not present in the initial screen. Alternatively, if
the assay in question selected against this particular combination
of codons, we would uncover this `forbidden` combination, even if
each codon alone was frequently observed among structures scoring
as `hits`. Traditionally, structure-activity relationships are
determined by processes ranging from an intuitive viewing of `hit`
structures to a comparison of `hits` on the basis of existing
quantitative molecular descriptors (each based on some arbitrary
metric). Our analysis introduces a novel approach, whereby we
require no structural information in advance of defining
significant biological activity. Rather, we allow the biological
system under study to dictate the requirements for its activity.
Such analysis illustrates the power of annotation screens to inform
chemistry, through the technology platform, in ways that can
influence planning steps in future diversity-oriented
syntheses.
CONCLUSION
[0411] A technology platform aimed at advancing chemical genetics
was applied to the identification of novel dihydropyrancarboxamides
with certain biological activities. The platform encompasses an
optimized procedure for compound cleavage and elution from large PS
beads, a novel bead arraying method, and robotic implementation of
library formatting, the process by which small molecules from
diversity-oriented syntheses are made accessible to chemical
genetic assays. We validated this approach by successfully
synthesizing, encoding, and formatting a split-pool library of
dihydropyrancarboxamides (9). It is important to note that
optimization of the library formatting process occurred
independently of the development of chemistry required to
synthesize the library. Rather, optimization of the formatting
process used generic model compounds to establish parameters, while
formatting the split-pool library used the output of the
optimization as a general, or `best practices`, method for library
realization.
[0412] By exposing each member of a diversity-oriented synthesis to
multiple phenotypic and proteomic assays, we can annotate each
compound in the collection in a way that is complementary to other
methods of small molecule characterization, such as MS and NMR.
Statistical analysis of the biological performance of an encoded
collection of small molecules allows us to inform further synthetic
efforts (e.g. scaled synthesis of subset libraries based on primary
screening data) in ways not necessarily available by traditional
structure activity analyses. Annotation screening is a term we use
to describe the generation of multiple datasets by comprehensive
screening of such libraries over a range of biological outcomes.
The analysis of data resulting from annotation screening comprises
both the challenge and the promise of chemical genetic
research.
[0413] 2. Experimental
[0414] Materials and Methods
[0415] Model Resin Preparation
[0416] 2-Naphthaleneethanol (6), K-methyl-2-naphthalenemethanol
(7), and 2-naphthol (8) were obtained commercially (Sigma-Aldrich)
and dried azeotropically prior to the loading reaction. Resin 1 was
a generous gift of Max Narovlyansky and Dr. John A. Tallarico, and
contains .about.200 mmol Si/bead calculated based on elemental
analysis, assuming that 550 .mu.m is the average bead size in a
population of beads pre-sized at 500-600 .mu.m. Loading reactions
were performed in fritted polypropylene PD-10 columns (Amersham
Pharmacia Biotech) and agitated by rocking on a Labquake.TM.
(Barnstead Thermolyne) shaker. ##STR104##
[0417] Resin samples were washed on a Vac-Man.RTM. vacuum manifold
(Promega) fitted with nylon stopcocks (Bio-Rad). HPLC-grade
reaction solvents (J. T. Baker) were purified by passage through
two solvent columns prior to use. Et.sub.3N and 2,6-lutidene were
distilled over calcium hydride. In loading reactions,
bromostyrene-copolymerized beads were added to a PD-10 (Amersham
Pharmacia Biotech) column, which was capped with a septum and
plastic stopcock and flushed with Ar. After swelling with
CH.sub.2Cl.sub.2 (10 ml), a 2.5% (v/v) solution of TMSCl in
CH.sub.2Cl.sub.2 was added. The beads were suspended for 15 min and
filtered with Ar pressure. The beads were washed with
CH.sub.2Cl.sub.2 (3.times.2 min), then suspended in a solution of
TfOH (6 eq.) in CH.sub.2Cl.sub.2 for 15 min, during which time Ar
was bubbled gently through the reaction via a syringe. Next, the
beads were rinsed with CH.sub.2Cl.sub.2 (3.times.2 min) under Ar
and suspended in CH.sub.2Cl.sub.2. Freshly distilled 2,6-lutidine
(8 eq.) and model alcohol 6, 7, or 8 (3 eq.) were successively
added. The tube was capped and sealed to stand for 18 h at ambient
temperature, after which the beads were filtered and rinsed with
CH.sub.2Cl.sub.2 (4.times.3 min) and dried under house vacuum.
[0418] Cleavage and Quenching
[0419] Commercially available HF/py (Sigma-Aldrich) is
approximately a 7:3 mixture of HF and pyridine, which was buffered
with additional pyridine in THF solution. In manual experiments,
beads were transferred individually by forceps to wells of 384-well
microtiter plates (Genetix). Cleavage and quenching reagents, as
well as elution solvents, were added by a P20 single-channel
pipettor (Gilson). Data from 19F NMR experiments were obtained at
470.169 MHz on a Varian (Varian, Inc., http://www.varianinc.com/)
AS500 (nt=128). To avoid etching of the NMR tube by HF/py
solutions, samples were placed in a PTFE-FEP NMR tube liner
(Wilmad-LabGlass).
[0420] HPLC Quantitation
[0421] HPLC analysis was carried out using a ThermoSeparation
Products (Thermo-Finnigan) instrument with a PC0100 system
controller and associated software. All samples were run on a
Hypersil C18 mini-pharmaceutical column (The Nest Group) using a
flow rate of 3 ml/min, an 80 s gradient of 0-99.9% CH.sub.3CN in
water/0.1% trifluoroacetic acid/0.1% methanol, and diode array
detection. Single peaks at 224 nm absorbance were characteristic of
compounds 6 (rt=1.54 min), 7 (rt=1.54 min), and 8 (rt-1.49 min). To
establish boundary conditions for detection of cleaved compounds by
HPLC, standard curves were determined using pure samples of 6-8.
Mock cleavage reactions (no HF present, but otherwise treated as
described in the text) were carried out on resins 3-5 to determine
the experimental noise for our HPLC detection method.
##STR105##
[0422] Robotic Implementation
[0423] Before bead arraying, 384-well plates (Genetix) were
pre-wetted using a Multidrop 384 (Thermo-Labsystems) to dispense
solvent. HF/py solutions were delivered using an Ivek multiplex
controller module with linear actuator pump module (Ivek
Corporation, http://www.ivek.com/) coupled to an ADM-661 automatic
dispensing system with TruPath 300 controller module (Creative
Automation, http://www.creativedispensing.com/), and fully
contained within a Captair ductless fume hood with recirculating
air filtration system (Captair LabX, http://www.erlab-dfs.com/).
Automated plate handling was carried out by Twister Universal
microplate handlers (Zymark Corporation, http://www.zymark.com/).
Evaporation of quenched reaction mixtures was done using a GeneVac
HT4 Atlas evaporator with VC3000D vapor condenser (GeneVac
Technologies, http://www.genevac.co.uk/). Elution of compounds from
beads into 100 .mu.l/well `mother plates` (Marsh), as well as
formatting of 50 .mu.l/well `daughter plates` (Genetix), was done
with a Hydra Microdispenser 384 (Robbins Scientific Corporation,
http://www.robsci.com/).
[0424] Small Molecule Microarrays
[0425] Small molecules were printed as described in P. J.
Hergenrother, K. M. Depew, S. L. Schreiber, Small molecule
microarrays: covalent attachment and screening of
alcohol-containing small molecules on glass slides, J. Am. Chem.
Soc. 122 (2000) 7849-7850, either with a microarray robot built as
described by Dr. Pat O. Brown
(http://cmgm.stanford.edu/pbrown/mguide/), or with an Omni-Grid.TM.
multi-axis robot (GeneMachines, http://www.genemachines.com/).
Briefly, slides were activated for covalent attachment of alcohols
as described previously. Standard microscope slides (VWR,
48300-036) were cleaned in piranha solution (70:30 v/v solution of
concentrated H.sub.2SO.sub.4 and 30% H.sub.2O.sub.2) for 16 hours
at room temperature. The slides were washed extensively in
ddH.sub.2O and kept in water until use. To convert to a silyl
chloride surface, the slides were removed from water and dried by
centrifugation. The slides were then immersed in a solution of dry
THF containing 1% SOCl.sub.2 and 0.1% DMF. The slides were
incubated in this activating solution for 4 hours at room
temperature. The slides were then removed, washed briefly in THF,
and then placed onto the encased microarrayer platform under argon.
Small molecules were printed as described previously. Printing was
carried out using a microarraying robot, constructed in this
laboratory by Dr. James Hardwick and Dr. Jeff Tong according to
directions provided by Dr. Pat Brown
(http://cmgm.stanford.edu/pbrown/mguide/). The microarrayer
typically withdraws 250 mL from a 384-well (or 96-well) plate and
repetitively delivers 1 mL to defined locations on a series of
activated slides. The pins were washed for 8 seconds in acetone and
dried under vacuum for 8 seconds in between each sample. The
arrayer was instructed to print the samples described here
approximately 500 .mu.m apart. Following printing, the slides were
allowed to stand at ambient temperature for 12 hours. The slides
were then washed for 2 hours in DMF, 1 hour in THF, and 1 hour in
ethanol. Slides were dried by centrifugation and were at room
temperature under vacuum until use.
[0426] (His)6-FKBP12 was purified to homogeneity as described in G.
MacBeath, A. N. Koehler, S. L. Schreiber, Printing small molecules
as microarrays and detecting protein-ligand interactions en masse,
J. Am. Chem. Soc. 121 (1999) 7967-7968. Cy5-labeled protein was
prepared using FluoroLink.TM. monofunctional reactive dye (Amersham
Pharmacia Biotech) according to the manufacturer's protocol.
Fluorescence detection of binding events was monitored using an
ArrayWoRx biochip reader (Applied Precision,
http://www.api.com/).
[0427] N-terminal His-tagged FKBP12 was expressed using the T5
expression plasmid pQE-30-FKBP12 (3757 bp) in M15-[pREP4] (Qiagen)
purified to homogeneity as described previously. A starter culture
was prepared by inoculating 5 mL LB medium supplemented with 100
.mu.g/mL sodium ampicillin and 50 .mu.g/mL kanamycin from a single
colony and grown for 16 hours at 37.degree. C. The cells were
subcultured into 500 mL of the same medium at an initial OD.sub.600
of 0.1. The culture was grown at 37.degree. C. up to an OD.sub.600
of 0.8. The culture was cooled to room temperature and isopropyl
1-thio-.beta.-D-galactopyranoside (IPTG) was added to a final
concentration of 1 mM. After a 16 hour induction at 30.degree. C.,
the cells were harvested and frozen at -80.degree. C. for 24 hours.
The cell pellet was resuspended in 20 mL of PBS buffer supplemented
with 10% (v/v) glycerol and a protease inhibitor cocktail
mini-tablet (Boerhinger Mannheim). Cells were lysed by addition of
1 mg lysozyme per gram of wet cell pellet. The suspension was
incubated on ice for 1 hour and followed by a 4 minute incubation
at 37.degree. C. with gentle mixing. The lysate was then kept on
ice for 10 minutes. The lysate was clarified by centrifugation
(28,000 g, 30 minutes, 4.degree. C.) and loaded onto a column
packed with 5 mL of Ni-NTA (Qiagen) that had been equilibrated in
PBS. The column was washed with 50 mL of PBS buffer containing 10
mM imidazole. Protein bound to the column was eluted with PBS
buffer containing 250 mM imidazole. The sample was dialyzed against
PBS at 4.degree. C. Cy5-labeled (His)6-FKBP12 was prepared using
FluoroLink.TM. monofunctional reactive dye (Amersham Pharmacia
Biotech) according to the manufacturer's protocol. Slides were
blocked for 1 hour by incubation with PBST (PBS buffer containing
0.1% Tween-20) containing 3% BSA. After a brief rinse with PBST,
fluorescently labeled protein was added a concentration of 1
.mu.g/mL in PBST supplemented with 1% BSA. Slides were incubated
with labeled protein for 30 minutes at room temperature. Slides
were then washed in PBST for 3 minutes three times and dried by
centrifugation. Slides were then scanned using an ArrayWoRx slide
scanner (Applied Precision) at a resolution of 5 .mu.m per pixel.
The following filter sets were employed: Cy5 excitation/emission (1
second exposure) and Cy3 excitation/emission (1 second
exposure).
[0428] Cell-Based Assays
[0429] Transfer of stock solutions of 10 into assay plates (Nunc)
was done using a VP386 384-pin MultiBlot.TM. replicator (VpP
Scientific, http://www.vp-scientific.com/). Cell culture methods
and the BrdU assay protocol were carried out as described in B. R.
Stockwell, S. J. Haggarty, S. L. Schreiber, High-throughput
screening of small molecules in miniaturized mammalian cell-based
assays involving post-translational modifications, Chem. Biol.,
6:71-83, 1999. Detection of assay results was carried out using
X-oMAT AR film (Kodak), and multiplicative overlays of digitally
scanned replicate films were prepared using Photoshop 5.0 (Adobe
Systems). The Multidrop 384 liquid dispenser (Labsystems) was used
for all liquid additions, and a 24-channel wand (V&P
Scientific) attached to a house vacuum source was used for all
liquid aspirations. Two thousand A549 cells were seeded per well of
a 384-well plate (Nalge Nunc, white, tissue culture treated) in
Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal
bovine serum (FBS). Immediately upon seeding, 50 mL compound from
the RAS combinatorial library was pin-transferred, one compound per
well, from a 5-mM stock solution in DMSO to a final concentration
of 5 .mu.M. After 24 hours at 37.degree. C. with 5% CO.sub.2, 10
.mu.L of a 10.times. stock of bromodeoxyuridine (BrdU) in DMEM+10%
FBS was added, for a final concentration of 10 .mu.M BrdU. The
cells were incubated for 4 hours at 37.degree. C. with 5% CO.sub.2,
cooled on ice for 15 minutes, and fixed in 50 .mu.L 70% ethanol/30%
phosphate buffered saline (PBS). All subsequent steps were
performed at 4.degree. C. Cells were washed with 90 .mu.L cold PBS,
incubated in 25 .mu.L 2 M HCl/0.5% Tween-20 in ddH.sub.2O for 20
minutes at room temperature, and incubated instantly in 90 .mu.L
10% 2 M NaOH/90% Hanks Buffered Salt Solution (HBSS; Gibco BRL).
Cells were washed twice with 90 .mu.L HBSS and blocked with 75
.mu.L PBSTB (PBS, 0.1% Tween-20, 3% bovine serum albumin).
Subsequently, 20 .mu.L antibody solution, consisting of 0.5
.mu.g/mL mouse anti-BrdU (Pharmingen), diluted 1:1000 in PBSTB, and
anti-mouse IgG conjugated to horseradish peroxidase (HRP;
Amersham), diluted 1:2000 in PBSTB, was added to each well. After
overnight incubation at 4.degree. C., wells were washed twice in 90
.mu.L PBS and detected with 20 .mu.L HRP substrate solution (ECL
detection; Amersham). Film (X-OMAT AR; Kodak) was placed on top of
the plates in a darkroom and developed after one to five minutes
with a Kodak M35A X-OMAT processor.
[0430] Eg5 Inhibition
[0431] Cloning and Expression of Eg5 Constructs
[0432] Coding regions for the expression of C-terminally
His.sub.6-tagged constructs of human Eg5 were generated by
polymerase chain reaction using a pBluescript template containing
full length human Eg5 [23] and the following primers: a common
N-terminal primer 5'-GCAACGATTAATATGGCGTCGCAGCCAAATTCGTCTGCGAAG and
specific C-terminal primers;
5'-GCAACGCTCGAGTCAGTGATGATGGTGGTGATGCTGATTCACTTCAGGCTTATTCAATAT
(hEg5-367H),
5'-GCAACGCTCGAGTCAGTGATGATGGTGGTGATGCATGACTCTAAAATTTTCTTCAGAAAT
(hEg5-405H),
5'-GCAACGCTCGAGTCAGTGATGATGGTGGTGATGTGTAACCCTATTCAGCTCCTCCTCAACAGC
(hEg5-437H). The PCR products were ligated into a pRSETa backbone.
Eg5 protein constructs were expressed and purified as described
previously [Woehlke, G., Ruby, A. K., Hart, C. L., Ly, B.,
Hom-Booher, N. and Vale, R. D. (1997) Microtubule interaction site
of the kinesin motor. Cell. 90, 207-216]. The Eg5 containing
fractions from Superose 6 sizing chromatography were pooled,
supplemented with sucrose to 10% (w/v) as a cryo-protectant, flash
frozen in liquid nitrogen, and stored at -80.degree. C. The
concentration of Eg5 was measured using the Edelhoch [Pace, C. N.,
Vajdos, F., Fee, L., Grimsley, G. and Gray, T. (1995) How to
measure and predict the molar absorption coefficient of a protein.
Protein Science. 4(11), 2411-2423] as well as Bradford
techniques.
[0433] Steady-State Eg5 ATPase Assay
[0434] We measured the ATPase activity of Eg5 in vitro using an
assay that couples the hydrolysis of ATP to the oxidation of NADH
[Woehlke, G., Ruby, A. K., Hart, C. L., Ly, B., Hom-Booher, N. and
Vale, R. D. (1997) Microtubule interaction site of the kinesin
motor. Cell. 90, 207-216]. In the assay, the concentration of ATP
remains constant however, the decrease in NADH fluorescence is a
convenient measure of the amount of ATP turned over. Our typical
reaction buffer contained 25 mM Potassium Chloride, 25 mM Potassium
PIPES (6.90), 2 mM Magnesium Chloride, 1 mM Potassium Phosphoenol
Pyruvate, 200 .mu.M di-Potassium NADH, 1 mM Dithiothreitol, 10
.mu.M Taxol, 9 U/ml Lactate Dehydrogenase, 1 U/ml Pyruvate Kinase
and taxol-stabilized microtubules as needed. To measure the ATPase
activity in a reaction, the assay buffer was supplemented with 1 mM
MgCl.sub.2:ATP (1:1), 1 .mu.M microtubules and 40 nM Eg5-367H.
Time-points for NADH fluorescence were measured in 384 well black
plates (NalgeneNUNC) by a Wallac Victor.sup.2 1420 multilabel
counter, umbelliferone filter set (excitation: 355 nm, emission:
420 nm), and the steady-state rate of fluorescence decay was
calculated using a linear fit by Microsoft Excel. The coupling
activity of the enzyme system was 100-fold greater than the Eg5
ATPase activity used in our experiments. To calculate IC.sub.50
values for enantiomerically pure monastrol in the presence or
absence of microtubules, we fit enzyme velocity as a function of
monastrol concentration to the equation:
V=V.sub.residual+(V.sub.inhibited.times.IC.sub.50)/(IC.sub.50+[monastrol]-
). Enzyme velocities were fit as a function of microtubule or ATP
concentrations at particular monastrol concentration to the
equation:
V=([substrate].times.V.sub.max)/([substrate]+K.sub.m).
[0435] Cell Culture Methods
[0436] BS--C-1 cells were cultured on glass coverslips as described
previously [Cramer L P, Mitchison T J, Theriot J A. (1994)
Actin-dependent motile forces and cell motility. Curr. Opin. Cell.
Biol. 6(1), 82-6]. AB9 Zebrafish cells [Hukreide N A, Joly L, Tsang
M, et. al. (1999) Radiation hybrid mapping of the zebrafish genome.
Proc. Natl. Acad. Sci. 96, 9745-9750] were grown in DMEM at
28.degree. C. in a 5% CO.sub.2 atmosphere on polylysine coated
coverslips. Cells were grown to 50% confluence, rinsed with warm
PBS, and incubated an additional 6 hours in growth medium
supplemented with 20 mM Potassium HEPES and compound at a final
DMSO concentration of 0.2%. Cells were fixed with 1% formaldehyde
in 1.times. Tris Buffered Saline containing 0.1% Triton X-100 as
detergent. Cells were so-stained with Alexa-488-conjugated goat
anti-mouse antibodies, DM-1A, a mouse antibody against
.alpha.-tubulin (Sigma), and Hoechst dye. We counted mono-astral,
mitotic, and interphase cells by visual inspection to calculate the
percentage of monastral cells at each drug concentration.
* * * * *
References