Transgene expression in a avians

Abstract

A transgenic avian containing in its genome an exogenous nucleotide sequence which includes a promoter component and a vector with reduced promoter interference wherein the exogenous nucleotide sequence is integrated into the genome and the avian.

Description

RELATED APPLICATION INFORMATION

[0001] This application claims the benefit of U.S. provisional application Nos. 60/930,491, filed May 16, 2007 and 60/994,203, filed Sep. 18, 2007 and is a continuation-in-part of U.S. patent application Ser. No. 11/699,257, filed Jan. 26, 2007 and is also a continuation-in-part of U.S. patent application Ser. No. 11/799,253, filed May 1, 2007 which is a continuation-in-part of U.S. patent application Ser. No. 11/210,165, filed Aug. 23, 2005 which claims the benefit of U.S. provisional application No. 60/640,203, filed Dec. 29, 2004. The disclosures of each of these three U.S. patent applications and two provisional applications are incorporated in their entirety herein by reference.

FIELD OF THE INVENTION

[0002] The present invention relates generally to the use of promoters which function in cells of a transgenic avian (e.g., oviduct cells) such as a transgenic chicken and vectors which contain such promoters. More specifically, the invention relates to recombinant nucleic acids and expression vectors, transfected cells and transgenic animals, for example, transgenic avians such as transgenic chickens, that contain vectors with gene expression controlling regions operably linked to coding sequences.

BACKGROUND

[0003] The field of transgenics was initially developed to understand the action of a single gene in the context of the whole animal and the phenomena of gene activation, expression and interaction. Transgenics technology has also been used to produce models for various diseases in humans and other animals and is among the most powerful tools available for the study of genetics, and the understanding of genetic mechanisms and function. From an economic perspective, the use of transgenic technology to convert animals into "protein factories" for the production of specific proteins or other substances of pharmaceutical interest (Gordon et al., 1987, Biotechnology 5: 1183-1187; Wilmut et al., 1990, Theriogenology 33: 113-123) offers significant advantages over more conventional methods of protein production by gene expression.

[0004] One system useful for expressing foreign proteins is the avian reproductive system. The production of an avian egg begins with formation of a large yolk in the ovary of the hen. The unfertilized oocyte or ovum is positioned on top of the yolk sac. After ovulation, the ovum passes into the infundibulum of the oviduct where it is fertilized, if sperm are present, and then moves into the magnum of the oviduct, which is lined with tubular gland cells. These cells secrete the egg-white proteins, including ovalbumin, lysozyme, ovomucoid, conalbumin and ovomucin, into the lumen of the magnum where they are deposited onto the avian embryo and yolk. In the past exogenous protein production has been performed in the avian reproductive system specifically targeting the avian oviduct.

[0005] Advantages of targeting the avian oviduct for exogenous protein expression can include proper folding and post-translation modification of the target protein, the ease of product recovery, and a shorter developmental period of birds such as chickens compared to other animal species.

[0006] Directing expression of a heterologous gene product in the oviduct of a transgenic avian can be significantly advantageous over ubiquitous expression in the bird. That is, the consequences of ubiquitous expression of a bioactive gene product in a host animal may be undesirable. For example, in certain instances the ubiquitous presence of the recombinant protein may be harmful to the development of the avian which can kill the bird. Additionally, the bird's health may be negatively effected leading to reduced levels of protein production.

[0007] By weight, approximately 60% of an avian egg is composed of albumen which is composed of four major protein components; ovalbumin, ovomucoid, lysozyme and ovotransferrin with ovalbumin and ovomucoid being present in the greatest quantities.

[0008] The ovalbumin promoter, ovomucoid promoter and lysozyme promoter have been successfully employed for the production of heterologous (exogenous) protein in the oviduct of transgenic avians in the past. See, for example, U.S. Pat. Nos. 6,875,588, issued Apr. 5, 2005; U.S. Pat. No. 7,176,300, issued Feb. 13, 2007; U.S. Pat. No. 7,199,279, issued Apr. 3, 2007; and US patent publication No. 2006/0130170, published Jun. 15, 2006 (the disclosures of each of these three issued patents and one published patent application are incorporated in their entirety herein by reference) which discloses the production of exogenous protein in the avian oviduct facilitated by various avian promoters which are primarily or exclusively expressed in the oviduct. Though expression levels in avians using the promoters and fragments of the promoters disclosed in these issued patents and published application have been at useful levels, the yeilds have typically been well below 0.1 mg/ml of egg white.

[0009] What is needed is a system that will provide for high level expression of an exogenous coding sequence in the cells of a transgenic avian, in particular, in the oviduct cells (e.g., tubular gland cells) of a transgenic avian.

SUMMARY OF THE INVENTION

[0010] The present invention meets this need and more. After years of exogenous protein production in transgenic avian oviduct tissue with modest yield the inventors of the present invention have discovered that such production levels can be boosted by about 10 fold to about 100 fold and more by employing new compositions and methods as disclosed herein.

[0011] In one aspect, the invention is directed to transgenic avians (e.g., chicken, turkey, quail) containing in their genome an exogenous nucleotide sequence which includes a promoter component and a SIN vector. Typically, the promoter component is linked to a coding sequence exogenous to the avian, i.e., the coding sequence is not normally or naturally present in the avian. Typically, the exogenous nucleotide sequence is integrated into the genome of the avian. In one particularly useful embodiment, the promoter component functions or expresses primarily in the oviduct (e.g., tubular gland cells) of an avian. For example, the promoter component may be an oviduct specific promoter. For example, the promoter component may be one of an avian ovomucoid promoter component, an avian ovalbumin promoter component, an avian lysozyme promoter component and an avian ovoinhibitor promoter component (i.e., conalbumin promoter component).

[0012] SIN vectors have been shown by the inventors to be particularly useful for increasing the quantity of exogenous protein produced in the avian oviduct. This effect can be further enhanced when the SIN vector is also an SC negative vector (i.e., a vector not containing a selectable marker cassette with a functional promoter).

[0013] The invention also includes methods of making the transgenic avians of the invention and methods of producing an exogenous protein using transgenic avians of the invention. In one embodiment, the transgenic avian has a nucleotide sequence in its genome comprising a vector which is at least one of a SIN vector and an SC negative vector. Typically, the nucleotide sequence includes a promoter component linked to an exogenous coding sequence.

[0014] In one useful embodiment, the exogenous coding sequence is expressed in avian oviduct cells and is secreted from the oviduct cells. For example, the exogenous coding sequence may be expressed in tubular gland cells. In one embodiment, the exogenous protein is deposited in a hard shell egg laid by the transgenic avian. In one embodiment, the exogenous protein is a human protein. In one embodiment, the exogenous protein is a therapeutic protein, e.g., a cytokine.

[0015] In one embodiment, the transgenic avian contains an exogenous nucleotide sequence in its genome which has a SC negative vector and a promoter component linked to an exogenous coding sequence encoding an exogenous protein. In one embodiment, the SC negative vector is also a SIN vector.

[0016] In one aspect, avian leukosis virus vector (ALV), a murine leukemia virus (MLV) retroviral vector, moloney murine leukemia Virus (MMLV) and a lentiviral vector can be used in accordance with the invention.

[0017] The invention includes chimeric transgenic avians and fully transgenic germline avians which can be obtained from germline chimeras as is understood by a practitioner of skill in the art of poultry breeding.

[0018] The invention also includes gene expression controlling regions or promoters having a nucleotide sequence (i.e., DNA sequence) similar or identical to the following sequences numbered 1 to 8. In a particularly useful embodiment of the invention, the fragments are listed top to bottom in the 5' to 3' linear order in which they are present on a single DNA molecule. For example, the 3' end of the 3.5 kb OV fragment of sequence 1 would be covalently linked to the 5' end of the 5' UTR-5' portion and the 3' end of the 5' UTR-5' portion would be covalently linked to the 5' end of 5' UTR-3' portion. However, the invention is not limited to any particular order of the fragments and intervening nucleotide sequences may be present between the fragments. [0019] 1. 3.5 kb OV fragment (includes DHS I, II & III) [0020] 5' UTR-5' portion (from Exon L) [0021] 5' UTR-3' portion (from Exon 1); [0022] 2. 3.5 kb OV fragment (includes DHS I, II & III) [0023] 5' UTR-5' portion (from Exon L) [0024] Intron A [0025] 5' UTR-3' portion (from Exon 1) [0026] 3' UTR; [0027] 3. 3.5 kb OV fragment (includes DHS I, II & III) [0028] 5' UTR-5' portion (from Exon L) [0029] Intron A [0030] 5' UTR-3' portion (from Exon 1); [0031] 4. 3.5 kb OV fragment (includes DHS I, II & III) [0032] 5' UTR-5' portion (from Exon L) [0033] 5' UTR-3' portion (from Exon 1) [0034] 3' UTR; [0035] 5. 3.5 kb OV fragment (includes DHS I, II & III) [0036] 5' UTR-5' portion (from Exon L) [0037] Intron A [0038] 5' UTR-3' portion (from Exon 1) [0039] 3' UTR/DHS A (bp 13576 to 15163 of SEQ ID NO: 22) [0040] 6. 3.5 kb OV fragment (includes DHS I, II & III) [0041] 5' UTR-5' portion (from Exon L) [0042] 5' UTR-3' portion (from Exon 1) [0043] 3' UTR/DHS A (bp 13576 to 15163 of SEQ ID NO: 22) [0044] 7. 3.5 kb OV fragment (includes DHS I, II & III) [0045] 5' UTR-5' portion (from Exon L) [0046] Intron A [0047] 5' UTR-3' portion (from Exon 1) [0048] partial 3' UTR [0049] RRE (Rev response element) FIG. 9a [0050] 8. ALV CTE (FIG. 9b) inserted 5' of 3.5 kb OV fragment [0051] 3.5 kb OV fragment (includes DHS I, II & III) [0052] 5' UTR-5' portion (from Exon L) [0053] Intron A [0054] 5' UTR-3' portion (from Exon 1) [0055] partial 3' UTR;

[0056] Coordinates of some of the elements for specific ovalbumin constructs disclosed herein (e.g., constructs 1 to 8 described above) are shown in the 16051 bp ovalbumin DNA segment of SEQ ID NO: 22 as follows:

[0057] 3.5 kb OV fragment (includes DHS I, II & III): Start: 3199 End: 6659 of FIG. 8 (SEQ ID NO: 22);

[0058] 1.4 kb OV fragment (includes DHS I & II): Start: 5209 End: 6659 of FIG. 8 (SEQ ID NO: 22);

[0059] 3.8 kb OV fragment: Start: 2863 End: 6659 of FIG. 8 (SEQ ID NO: 22);

[0060] 5.2 kb OV fragment: Start: 1463 End: 6659 of FIG. 8 (SEQ ID NO: 22);

[0061] 5' UTR-5' portion (from Exon L): Start: 6659 End: 6705 of FIG. 8 (SEQ ID NO: 22);

[0062] 5' UTR-3' portion (from Exon 1): Start: 8295 End: 8311 of FIG. 8 (SEQ ID NO: 22);

[0063] 3' UTR: Start: 13576 End: 14209 of FIG. 8 (SEQ ID NO: 22);

[0064] partial 3' UTR: Start 13576 End: 13996 of FIG. 8 (SEQ ID NO: 22);

[0065] Intron A: Start: 6706 End: 8294 of FIG. 8 (SEQ ID NO: 22);

[0066] Intron E: Start: 10010 End: 10968 of FIG. 8 (SEQ ID NO: 22);

[0067] Exon L: Start: 6659 End: 6705 of FIG. 8 (SEQ ID NO: 22);

[0068] Exon 1: Start: 8295 End: 8478 of FIG. 8 (SEQ ID NO: 22);

[0069] Exon 2: Start: 8731 End: 8781 of FIG. 8 (SEQ ID NO: 22);

[0070] Exon 3: Start: 9363 End: 9491 of FIG. 8 (SEQ ID NO: 22);

[0071] Exon 4: Start: 9892 End: 10009 of FIG. 8 (SEQ ID NO: 22);

[0072] Exon 5: Start: 10968 End: 11110 of FIG. 8 (SEQ ID NO: 22);

[0073] Exon 6: Start: 11442 End: 11597 of FIG. 8 (SEQ ID NO: 22);

[0074] Exon 7: Start: 13180 End: 13575 of FIG. 8 (SEQ ID NO: 22);

[0075] +1 SITE: Start: 6659 End: 6659 of FIG. 8 (SEQ ID NO: 22);

[0076] ATG: Start: 8312 End: 8312 of FIG. 8 (SEQ ID NO: 22);

[0077] Poly A: Start: 14204 End: 14209 of FIG. 8 (SEQ ID NO: 22);

[0078] TATA: Start: 6627 End: 6632 of FIG. 8 (SEQ ID NO: 22);.

[0079] DHS A: Start: 13858 End: 15163 of FIG. 8 (SEQ ID NO: 22);

[0080] DHS IV: Start: 459 End: 859 of FIG. 8 (SEQ ID NO: 22);

[0081] DHS III: Start: 3253 End: 3559 of FIG. 8 (SEQ ID NO: 22);

[0082] DHS II: Start: 5629 End: 6009 of FIG. 8 (SEQ ID NO: 22); and

[0083] DHS I: Start: 6359 End: 6659 of FIG. 8 (SEQ ID NO: 22).

[0084] Promoter constructs are also contemplated that have a nucleotide sequence 80% identical and 85% identical and 90% identical and 91% identical and 92% identical and 93% identical and 94% identical and 95% identical and 96% identical and 97% identical and 98% identical and 99% identical to each of the promoter constructs disclosed herein, such as those described above (i.e., 1 to 8 above).

[0085] The invention also contemplates promoter constructs which correspond to promoter constructs 1 through 8 above in which the 3.5 kb OV fragment is replaced with the 3.8 kb OV fragment. The invention also contemplates promoter constructs which correspond to promoter constructs 1 through 8 in which the 3.5 kb OV fragment is replaced with the 5.2 kb OV fragment.

[0086] Promoter constructs are also contemplated for each of the above specified recombinant promoters (i.e., 1 to 8) in which DHS III is omitted from the construct.

[0087] Promoter constructs are contemplated corresponding to each of constructs 2, 3, 5, 7 and 8 above in which Intron A is replaced with Intron E which may lead to increased levels of exogenous protein production. Intron A and E have DNA sequences that induce alignment of histones in surrounding DNA regions. Such alignment can provide for transcriptional regulation of the OV gene. Without wishing to be bound to any particular theory or mechanism of operation, substitution of Intron E with Intron A may provide a preferential spacing of histones that result from use of Intron E (i.e., the periodicity for Intron A is 202 bp.+-.5 bp, for Intron E is 196 bp.+-.5 bp). For example, it is believed that the packaging of DNA by histones leads to topological alteration of DNA the manipulation of which can lead to preferential alignment of binding sites for proteins responsible for the transcription regulation (e.g., transcription factors) leading to an enhanced level of transcription.

[0088] Also included in the invention are vector constructs, and other constructs and nucleotide sequences disclosed herein, having a nucleotide sequence 80% identical and 85% identical and 90% identical and 91% identical and 92% identical and 93% identical and 94% identical and 95% identical and 96% identical and 97% identical and 98% identical and 99% identical to each vector construct and other constructs and nucleotide sequences disclosed herein.

[0089] Any useful combination of features described herein is included within the scope of the present invention provided that the features included in any such combination are not mutually inconsistent as will be apparent from the context, this specification, and the knowledge of one of ordinary skill in the art Additional objects and aspects of the present invention will become more apparent upon review of the detailed description set forth below when taken in conjunction with the accompanying figures, which are briefly described as follows.

BRIEF DESCRIPTION OF THE FIGURES

[0090] FIG. 1 shows a circular map of the pALV-SIN-4.2-Lys-IFNa-2B vector. The sequence of pALV-SIN-4.2-Lys-IFNa-2B is shown in SEQ ID NO: 1.

[0091] FIG. 2 is a bar graph illustrating expression levels of IFNa in the egg white of a transgenic quail. G0 quail was produced by injection of pALV-SIN-4.0-Lys-IFNa-2B retroviral vector transduction particles into Japanese quail embryos.

[0092] FIG. 3 shows a circular map of the pSIN-OV-3.5-I-CTLA4-inv vector. The nucleotide sequence of pSIN-OV-3.5-I-CTLA4-inv is shown in SEQ ID NO: 19.

[0093] FIG. 4 shows a circular map of the pSIN-3.9-OM-CTLA4-Fc vector. The nucleotide sequence of pSIN-3.9-OM-CTLA4-Fc is shown in SEQ ID NO: 20.

[0094] FIG. 5 shows a circular map of the pBS-OM-4.4 vector. The nucleotide sequence of pBS-OM-4.4 is shown in SEQ ID NO: 23.

[0095] FIG. 6 shows a circular map of the pAVIJCR-A137.91.1.2 vector. The nucleotide sequence of pAVIJCR-A137.91.1.2 is shown in SEQ ID NO: 24.

[0096] FIG. 7 shows a circular map of the pSIN-1.8-OM-IFNa-2B plasmid vector. The nucleotide sequence of pSIN-1.8-OM-IFNa-2B is shown in SEQ ID NO: 21.

[0097] FIG. 8a-e (SEQ ID NO: 22) shows a segment of a chicken ovalbumin gene.

[0098] FIG. 9a (SEQ ID NO: 25) shows the RRE (rev responsive element) sequence of a lenti virus. FIG. 9b (SEQ ID NO: 26) shows the ALV CTE (constitutive transport element) sequence.

[0099] FIG. 10a shows a diagram of the segment deleted from an exemplary retroviral LTR (ALV) to make a SIN vector. FIG. 10b (SEQ ID NO: 29) shows the sequence of the LTR shown in 10a. The underlined sequence is the deleted sequence.

DETAILED DESCRIPTION

Definitions

[0100] The term "animal" is used herein to include all vertebrate animals, including avians and may include humans. It also includes an individual animal in all stages of development, including embryonic and fetal stages.

[0101] The term "antibody" as used herein refers to polyclonal and monoclonal antibodies and functional fragments thereof. An antibody includes modified or derivatised antibody variants that retain the ability to specifically bind an epitope. Antibodies are capable of selectively binding to a target antigen or epitope. Antibodies may include, but are not limited to polyclonal antibodies, monoclonal antibodies (mAbs), humanized and other chimeric antibodies, single chain antibodies (scFvs), Fab fragments, F(ab').sub.2 fragments and disulfide-linked Fvs (sdFv) fragments.

[0102] The term "avian" as used herein refers to any species, subspecies or strain of organism of the taxonomic class ava, such as, but not limited to, such organisms as chicken, turkey, duck, goose, quail, pheasants, parrots, finches, hawks, crows and ratites including ostrich, emu and cassowary. The term includes the various known strains of Gallus gallus, or chickens, (for example, White Leghorn, Brown Leghorn, Barred-Rock, Sussex, New Hampshire, Rhode Island, Ausstralorp, Minorca, Amrox, California Gray, Italian Partridge-colored), as well as strains of turkeys, pheasants, quails, duck, ostriches and other poultry commonly bred in commercial quantities.

[0103] The phrase "based on" or "derived from" as in a retroviral vector being based on or derived from a particular retrovirus or based on a nucleotide sequence of a particular retrovirus mean that the genome of the retroviral vector contains a substantial portion of the nucleotide sequence of the genome of the particular retrovirus. The substantial portion may be a particular gene or nucleotide sequence such as the nucleotide sequence encoding the gag, pol and/or env proteins or other structural or functional nucleotide sequence of the virus genome such as sequences encoding the LTRs or may be substantially the complete retrovirus genome, for example, most (e.g., more than 60% or more than 70% or more than 80% or more than 90%) or all of the retrovirus genome, as will be apparent from the context in the specification as the knowledge of one skilled in the art. Examples of retroviral vectors that are based on or derived from a retrovirus are the NL retroviral vectors (e.g., NLB) which are based on the ALV retrovirus as disclosed in Cosset et al, Journal of Virology (1991) vol 65, p 3388-3394.

[0104] The term "coding sequence" and "coding region" as used herein refer to nucleotide sequences and nucleic acid sequences, including both RNA and DNA, that encode genetic information for the synthesis of an RNA, a protein, or any portion of an RNA or protein. Nucleotide sequences that are not naturally part of a particular organism's genome are referred to as "foreign nucleotide sequences," "heterologous nucleotide sequences" or "exogenous nucleotide sequences". "Heterologous proteins" are proteins encoded by foreign, heterologous or exogenous nucleotide sequences and therefore are often not naturally expressed in the cell. A nucleotide sequence that has been isolated and then reintroduced into the same type (e.g., same species) of organism is not considered to be a naturally occurring part of a particular organism's genome and is therefore considered exogenous or heterologous.

[0105] The term "construct" as used herein refers to a linear or circular nucleotide sequence such as DNA that has been assembled from more than one segments of nucleotide sequence which have been isolated from a natural source or have been chemically synthesized, or combinations thereof.

[0106] The term "complementary" as used herein refers to two nucleic acid molecules that can form specific interactions with one another. In the specific interactions, an adenine base within one strand of a nucleic acid can form two hydrogen bonds with thymine within a second nucleic acid strand when the two nucleic acid strands are in opposing polarities. Also in the specific interactions, a guanine base within one strand of a nucleic acid can form three hydrogen bonds with cytosine within a second nucleic acid strand when the two nucleic acid strands are in opposing polarities. Complementary nucleic acids as referred to herein, may further comprise modified bases wherein a modified adenine may form hydrogen bonds with a thymine or modified thymine, and a modified cytosine may form hydrogen bonds with a guanine or a modified guanine.

[0107] The term "cytokine" as used herein refers to any secreted amino acid sequence that affects the functions of cells and is a molecule that modulates interactions between cells in the immune, inflammatory or hematopoietic responses. A cytokine includes, but is not limited to, monokines and lymphokines regardless of which cells produce them. For instance, a monokine is generally referred to as being produced and secreted by a mononuclear cell, such as a macrophage and/or monocyte. Many other cells however also produce monokines, such as natural killer cells, fibroblasts, basophils, neutrophils, endothelial cells, brain astrocytes, bone marrow stromal cells, epideral keratinocytes and B-lymphocytes. Lymphokines are generally referred to as being produced by lymphocyte cells. Examples of cytokines include, but are not limited to, Interleukin-l (IL-1), Interleukin-6 (IL-6), Interleukin-8 (IL-8), Tumor Necrosis Factor-alpha (TNF-alpha) and Tumor Necrosis Factor beta (TNF-beta).

[0108] The term "expressed" or "expression" as used herein refers to the transcription from a gene to give an RNA nucleic acid molecule at least complementary in part to a region of one of the two nucleic acid strands of the gene. The term "expressed" or "expression" as used herein can also refer to the translation of RNA to produce a protein or peptide.

[0109] The term "expression vector" as used herein refers to a nucleic acid vector that comprises a gene expression controlling region, such as a promoter or promoter component, operably linked to a nucleotide sequence coding at least one polypeptide.

[0110] The term "fragment" as used herein can refer to, for example, an at least about 10, 20, 50, 75, 100, 150, 200, 250, 300, 500, 1000, 2000, 5000, 6,000, 8,000, 10,000, 20,000, 30,000, 40,000, 50,000 or 60,000 nucleotide long portion of a nucleic acid that has been constructed artificially (e.g., by chemical synthesis) or by cleaving a natural product into multiple pieces, using restriction endonucleases or mechanical shearing, or enzymatically, for example, by PCR or any other polymerizing technique known in the art, or expressed in a host cell by recombinant nucleic acid technology known to one of skill in the art. The term "fragment" as used herein may also refer to, for example, an at least about 5, 10, 20, 30, 40, 50, 75, 100, 150, 200, 250, 300, 400, 500, 1000, 2000, 5000, 6,000, 8,000 or 10,000 amino acid portion of an amino acid sequence, which portion is cleaved from a naturally occurring amino acid sequence by proteolytic cleavage by at least one protease, or is a portion of the naturally occurring amino acid sequence synthesized by chemical methods or using recombinant DNA technology (e.g., expressed from a portion of the nucleotide sequence encoding the naturally occurring amino acid sequence) known to one of skill in the art. "Fragment" may also refer to a portion, for example, of about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80% about 90% about 95% or about 99% of a particular nucleotide sequence or amino acid sequence.

[0111] "Functional portion" or "functional fragment" are used interchangeably and as used herein means a portion or fragment of a whole capable of performing, in whole or in part, a function of the whole. For example, a biologically functional portion of a molecule means a portion of the molecule that performs a biological function of the whole or intact molecule. For example, a functional portion of a gene expression controlling region is a fragment or portion of the specified gene expression controlling region that, in whole or in part, regulates or controls gene expression (e.g., facilitates either in whole or in part) in a biological system (e.g., a promoter). Functional portions may be of any useful size. For example, a functional fragment may range in size from about 20 bases in length to a length equal to the entire length of the specified sequence minus one nucleotide. In another example, a functional fragment may range in size from about 50 bases in length to a length equal to the entire length of the specified sequence minus one nucleotide. In another example, a functional fragment may range in size from about 50 bases in length to about 20 kb in length. In another example, a functional fragment may range in size from about 500 bases in length to about 20 kb in length. In another example, a functional fragment may range in size from about 1 kb in length to about 20 kb in length. In another example, a functional fragment may range in size from about 0.1 kb in length to about 10 kb in length. In another example, a functional fragment may range in size from about 20 bases kb in length to about 10 kb in length.

[0112] The term "gene expression controlling region" as used herein refers to nucleotide sequences that are associated with a coding sequence and which regulate, in whole or in part, expression of the coding sequence, for example, regulate, in whole or in part, the transcription of the coding sequence. Gene expression controlling regions may be isolated from a naturally occurring source or may be chemically synthesized and can be incorporated into a nucleic acid vector to enable regulated transcription in appropriate cells. The "gene expression controlling regions" may precede, but is not limited to preceding, the region of a nucleic acid sequence that is in the region 5' of the end of a coding sequence that may be transcribed into mRNA.

[0113] The terms "heterologous", "exogenous" and "foreign" are used interchangeably herein and in general refer to a biomolecule such as a nucleic acid or a protein that is not normally found in a certain organism or in a certain cell, tissue or other component contained in or produced by an organism. For example, a protein that is heterologous or exogenous to an egg is a protein that is not normally found in the egg. As used herein, the terms "heterologous", "exogenous" and "foreign" with reference to nucleic acids, such as DNA and RNA, are used interchangeably and refer to nucleic acid that does not occur naturally as part of a chromosome, a genome or cell in which it is present or which is found in a location(s) and/or in amounts that differ from the location(s) and/or amounts in which it occurs in nature. It can be nucleic acid that is not endogenous to the genome, chromosome or cell and has been exogenously introduced into the genome, chromosome or cell. Examples of heterologous DNA include, but are not limited to, a DNA comprising a gene expression control region and DNA that encodes a product or products, for example, RNA or protein product. Examples of heterologous DNA include, but are not limited to, gene expression controlling regions or promoters disclosed herein once isolated from the avian and as used thereafter, e.g., after re-introduction into an avian genome.

[0114] The term "isolated nucleic acid" as used herein covers, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic molecule but is not flanked by at least one of the sequences that flank that part of the molecule in the genome of the species in which it naturally occurs; (b) a nucleic acid which has been incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting vector or genomic DNA is not identical to naturally occurring DNA from which the nucleic acid was obtained; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), ligase chain reaction (LCR) or chemical synthesis, or a restriction fragment; (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein, and (e) a recombinant nucleotide sequence that is part of a hybrid sequence that is not naturally occurring. Isolated nucleic acid molecules of the present invention can include, for example, natural allelic variants as well as nucleic acid molecules modified by nucleotide deletions, insertions, inversions, or substitutions.

[0115] The term "nucleic acid" as used herein refers to any linear or sequential array of nucleotides and nucleosides, for example cDNA, genomic DNA, mRNA, tRNA, oligonucleotides, oligonucleosides and derivatives thereof. For ease of discussion, non-naturally occurring nucleic acids may be referred to herein as constructs. Nucleic acids can include bacterial plasmid vectors including expression, cloning, cosmid and transformation vectors such as, animal viral vectors such as, but not limited to, modified adenovirus, influenza virus, polio virus, pox virus, retroviruses such as avian leukosis virus (ALV) retroviral vector, a murine leukemia virus (MLV) retroviral vector, and a lentivirus vector, and the like and fragments thereof. In addition, the nucleic acid can be an LTR of an avian leukosis virus (ALV) retroviral vector, a murine leukemia virus (MLV) retroviral vector, or a lentivirus vector and fragments thereof. Nuclic acids can also include NL vectors such as NLB, NLD and NLA and fragments thereof and synthetic oligonucleotides such as chemically synthesized DNA or RNA. Nucleic acids can include modified or derivatised nucleotides and nucleosides such as, but not limited to, halogenated nucleotides such as, but not only, 5-bromouracil, and derivatised nucleotides such as biotin-labeled nucleotides.

[0116] The term "vector" and "nucleic acid vector" as used herein refers to a natural or synthetic single or double stranded plasmid or viral nucleic acid molecule that can be transfected or transformed into cells and replicate independently of, or within, the host cell genome. A circular double stranded vector can be linearized by treatment with an appropriate restriction enzyme based on the nucleotide sequence of the vector. A nucleic acid can be inserted into a vector by cutting the vector with restriction enzymes and ligating the desired pieces together.

[0117] The term "operably linked" refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Gene expression controlling regions or promoters (e.g., promoter components) operably linked to a coding sequence are capable of effecting the expression of the coding sequence. The controlling sequences need not be contiguous with the coding sequence, so long as they function to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present. between a promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.

[0118] The term "oviduct specific promoter" as used herein refers to promoters and promoter components which are functional, i.e., provide for transcription of a coding sequence, to a large extent, for example, primarily (i.e., more than 50% of the transcription product produced in the animal by a particular promoter type being produced in oviduct cells) or exclusively in oviduct cells of a bird. Examples of oviduct specific promoters include, ovalbumin promoter, ovomucoid promoter, ovoinhibitor promoter, lysozyme promoter and ovotransferrin promoter and functional portions of these promoters, e.g., promoter components.

[0119] The terms "percent sequence identity" "percent identity" as used in, for example, "% identical" and "percent sequence homology" "percent homology", as used in, for example, "% homology" and "percent sequence similarity" each refer to the degree of sequence matching between two nucleic acid sequences or two amino acid sequences as determined using the algorithm of Karlin & Attschul (1990) Proc. Natl. Acad. Sci. 87: 2264-2268, modified as in Karlin & Attschul (1993) Proc. Natl. Acad. Sci. 90: 5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Attschul et al. (1990) T. Mol. Biol. Q15: 403-410. BLAST nucleotide searches are performed with the NBLAST program,. score=100, wordlength =12, to obtain nucleotide sequences homologous to a nucleic acid molecule of the invention. BLAST protein searches are performed with the XBLAST program, score=50, wordlength=3, to obtain amino acid sequences homologous to a reference amino acid sequence. To obtain gapped alignments for comparison purposes, Gapped BLAST is utilized as described in Attschul et al. (1997) Nucl. Acids Res. 25: 3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g. XBLAST and NBLAST) are used. Other algorithms, programs and default settings may also be suitable such as, but not only, the GCG-Sequence Analysis Package of the U.K. Human Genome Mapping Project Resource Centre that includes programs for nucleotide or amino acid sequence comparisons.

[0120] The terms "polynucleotide," "oligonucleotide", "nucleotide sequence" and "nucleic acid sequence" can be used interchangeably herein and include, but are not limited to, coding sequences, i.e., polynucleotide(s) or nucleic acid sequence(s) which are transcribed and translated into polypeptide in vitro or in vivo when placed under the control of appropriate regulatory or control sequences; controlling sequences, e.g., translational start and stop codons, promoter sequences, ribosome binding sites, polyadenylation signals, transcription factor binding sites, transcription termination sequences, upstream and downstream regulatory domains, enhancers, silencers, DNA sequences to which a transcription factor(s) binds and alters the activity of a gene's promoter either positively (induction) or negatively (repression) and the like. No limitation as to length or to synthetic origin are suggested by the terms described herein.

[0121] As used herein the terms "polypeptide" and "protein" refer to a polymer of amino acids of three or more amino acids in a serial array, linked through peptide bonds. The term "polypeptide" includes proteins, protein fragments, protein analogues, oligopeptides and the like. The term "polypeptides" includes polypeptides as defined above that are encoded by nucleic acids, produced through recombinant technology (e.g., isolated from a transgenic bird), or synthesized. The term "polypeptides" further contemplates polypeptides as defined above that include chemically modified amino acids or amino acids covalently or noncovalently linked to labeling ligands.

[0122] The term "promoter" as used herein refers to a DNA sequence useful to initiate transcription initiation by an RNA polymerase in an avian cell. A "promoter component" is a DNA sequence that can, by itself or, in combination with other DNA sequences effect or facilitate transcription. Specific promoter components such as ovalbumin promoter components, ovomucoid promoter components and lysozyme promoter components and other promoters and promoter components disclosed and claimed herein do not describe a specific promoter sequence. Rather, they encompass any sequence or sequence fragment of the respective promoter that is useful to effect or facilitate transcription of a coding sequence. For example, an ovomucoid promoter component includes, without limitation, the about 1.8 kb, the about 3.9 kb and the about 10 kb ovomucoid promoters disclosed in U.S. Publication No. 11/649,543, published May 17 2007, which is incorporated in its entirety herein by reference. "Promoter components" can also encompass rearranged gene expression controlling regions which function to initiate RNA transcription and hybrid DNA molecules composed of naturally occurring DNA sequences and/or synthetic DNA sequences which function to initiate RNA transcription.

[0123] The terms "recombinant nucleic acid" and "recombinant DNA" as used herein refer to combinations of at least two nucleic acid sequences that are not naturally found in a eukaryotic or prokaryotic cell. The nucleic acid sequences may include, but are not limited to, nucleic acid vectors, gene expression regulatory elements, origins of replication, suitable gene sequences that when expressed confer antibiotic resistance, protein-encoding sequences and the like. The term "recombinant polypeptide" is meant to include a polypeptide produced by recombinant DNA techniques such that it is distinct from a naturally occurring polypeptide either in its location, purity or structure. Generally, such a recombinant polypeptide will be present in a cell in an amount different from that normally observed in nature.

[0124] As used herein, the term "regulatory sequences" includes promoters, enhancers, and other elements that may control gene expression.

[0125] An "SC negative vector" is a vector that does not contain a selectable or screenable cassette marker having a functional promoter. The promoter may be deleted in whole or in part or may be inactivated by a nucleotide sequence insertion. Screenable cassettes include, without limitation, DNA sequences for antibiotic resistance markers such as neomycin resistance and DNA sequences for other selectable markers such as GFP or lacZ.

[0126] A "SIN vector" is a self-inactivating vector. In particular, a SIN vector is a retroviral vector having an altered genome such that upon integration into genomic DNA of the target cell (e.g., avian embryo cells) the 5' LTR of the integrated retroviral vector will not function as a promoter. For example, a portion or all of the nucleotide sequence of the retroviral vector that results in the U3 region of the 5' LTR of the retroviral vector once integrated may be deleted or altered in order to reduce or eliminate promoter activity of the 5' LTR. In certain examples, deletion of the CAAT box and/or the TAATA box from U3 of the 5' LTR can result in a SIN vector, as is understood in the art.

[0127] A "SIN/SC negative vector" is a vector, i.e., a retroviral vector, that is both a SIN vector and a SC negative vector.

[0128] The term "sense strand" as used herein refers to a single stranded DNA, molecule from a genomic DNA that may be transcribed into RNA and translated into the natural polypeptide product of the gene. The term "antisense strand" as used herein refers to the single strand DNA molecule of a genomic DNA that is complementary with the sense strand of the gene.

[0129] A "therapeutic protein" or "pharmaceutical protein" is a substance that, in whole or in part, makes up a drug. In particular, "therapeutic proteins" and "pharmaceutical proteins" include an amino acid sequence which in whole or in part makes up a drug.

[0130] The terms "transcription regulatory sequences" and "gene expression control regions" and "promoter components" as used herein refer to nucleotide sequences that are associated with a nucleic acid sequence and which regulate the transcriptional expression of a coding sequence. Exemplary transcription regulatory sequences include enhancer elements, hormone response elements, steroid response elements, negative regulatory elements, and the like. The "transcription regulatory sequences" may be isolated and incorporated into a vector nucleic acid to enable regulated transcription in appropriate cells of portions of the vector DNA. The "transcription regulatory sequence" may precede, but is not limited to, the region of a nucleic acid sequence that is in the region 5' of the end of a protein coding sequence that may be transcribed into mRNA. Transcriptional regulatory sequences may also be located within a protein coding region, in regions of a gene that are identified as "intron" regions, or may be in regions of nucleic acid sequence that are in the region of nucleic acid.

[0131] The terms "transformation" and "transfection" as used herein refer to the process of inserting a nucleic acid into a host. Many techniques are well known to those skilled in the art to facilitate transformation or transfection of a nucleic acid into a prokaryotic or eukaryotic organism. These methods involve a variety of techniques, such as treating the cells with high concentrations of salt such as, but not only a calcium or magnesium salt, an electric field, detergent, or liposome mediated transfection, to render the host cell competent for the uptake of the nucleic acid molecules.

[0132] As used herein, a "transgenic animal" is any non-human animal, such as an avian species, including the chicken, in which one or more of the cells of the avian may contain heterologous nucleic acid introduced by way of human intervention, such as by transgenic techniques known in the art (see, for example, US patent publication No. 2007/0243165, published Oct. 18, 2007, the disclosure of which is incorporated in its entirety herein by reference) including those disclosed herein. The nucleic acid is introduced into an animal, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus. The term genetic manipulation does not include classical cross-breeding, or in vitro fertilization, but rather is directed to the introduction of a recombinant DNA molecule. This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA. In the typical transgenic animal, the transgene can cause cells to express a recombinant form of the target protein or polypeptide. The terms "chimeric animal" or "mosaic animal" are used herein to refer to animals in which a transgene is found, or in which the recombinant nucleotide sequence is expressed in some but not all cells of the animal. A germ-line chimeric animal contains a transgene in its germ cells and can give rise to a transgenic animal in which most or all cells of the offspring animal will contain the transgene.

[0133] As used herein, the term "transgene" means a nucleic acid sequence (encoding, for example, a human protein) that is partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout). A transgene according to the present invention can include a vector of the invention (e.g., SIN vector) which contains sequences useful for exogenous protein production in an avian (e.g., in an avian oviduct).

[0134] Techniques useful for isolating and characterizing the nucleic acids and proteins of the present invention are well known to those of skill in the art and standard molecular biology and biochemical manuals may be consulted to select suitable protocols for use without undue experimentation. See, for example, Sambrook et al, 1989, "Molecular Cloning: A Laboratory Manual", 2nd ed., Cold Spring Harbor, the content of which is herein incorporated by reference in its entirety.

Abbreviations:

[0135] Abbreviations used herein may include the following: aa, amino acid(s); bp, base pair(s); cDNA, DNA complementary to an RNA; nt, nucleotide(s); kb, 1000 base pairs; .mu.g, microgram; ml, milliliter; ng, nanogram.

Description:

[0136] SIN vectors designed and used in accordance with the invention can reduce or eliminate promoter interference of promoters of interest which are employed in transgenic avians. In a particularly useful embodiment, the promoters (i.e., promoter components) of interest preferentially express their gene product in oviduct cells or oviduct tissue, e.g., oviduct specific promoters. Examples of such promoters (e.g., promoter components) include but are not limited to, functional portions of the ovalbumin, lysozyme, conalbumin (i.e., ovotransferrin), ovomucoid, ovomucin, and/or ovoinhibitor gene expression controlling regions or promoter regions. In one embodiment, the promoter of interest is a combination or a fusion of one or more promoters or a fusion of a fragment of one or more promoters such as ovalbumin, lysozyme, conalbumin (i.e., ovotransferrin), ovomucoid, ovomucin, and/or ovoinhibitor promoters with another promoter or promoter fragment such as a viral promoter (e.g., an LTR promoter).

[0137] SIN vectors have been shown to be particularly useful with oviduct specific promoters. Without wishing to limit the invention to any particular theory or mechanism of operation it is believed that oviduct specific promoters can be particularly susceptible to influences of a retroviral LTR promoter. As a result, SIN vectors are particularly useful when employed in combination with avian oviduct specific promoters.

[0138] In one particularly useful embodiment, a SIN vector is produced in which an interfering promoter (e.g., an LTR promoter) that can at least partially inhibit transcription of a coding sequence operably linked to an oviduct specific promoter of the invention is inactivated, for example, by a deletion, insertion or transposition of all or part of the interfering promoter sequence. For example, the vector pALV-SIN-4.2-Lys-IFNa-2B, shown in FIG. 1, the 3' RAV2 LTR has a deletion in the enhancer such that when the retroviral region integrates, the 5' LTR is inactivated, as is understood in the art. For a detailed diagrammatic of an LTR deletion, see FIG. 10.

[0139] In one useful embodiment of the invention, a SIN vector is employed that is also an SC negative vector to produce a SIN/SC negative vector. The combination of SC negative vector and SIN vector can result in a vector with a substantially reduced amount of promoter interference compared to a vector that is only a SIN vector or only a SC negative vector. For example, pALV-SIN-4.2-Lys-IFNa-2B as well as other SIN vectors disclosed in the Examples also lacks an antibiotic resistance marker making it both a SC negative vector and a SIN vector.

[0140] SIN vectors, SC negative vectors and SIN/SC negative vectors are contemplated for use in accordance with the invention in any useful avian such as chicken, quail and turkey to produce chimeras including germ-line chimeras and progeny birds produced using breeding techniques such as those known to practitioners of ordinary skill in the art. In addition, it is contemplated that an SC negative retroviral vector (which is a non-SIN vector) will also enhance or increase the quantity of exogenous protein produced in a transgenic avian relative to a transgenic avian produced with essentially the same retroviral vector that is not a SC negative vector.

[0141] Without wishing to limit the invention to any particular theory or mechanism of operation it is believed that the lack of a selectable marker cassette decreases the presence of promoter elements such as enhancers which would otherwise be in cis and in close proximity to the promoter employed for exogenous protein production in avian oviduct cells (e.g., oviduct specific promoters). This close proximity may allow for interference by the transcription regulating elements of the marker gene with the promoter of interest, i.e., the promoter employed for exogenous protein production. However, the invention contemplates that marker gene coding sequences, for example, and without limitation, neomycin resistance coding sequence and beta lactamase coding sequence, may be operably linked to a promoter (i.e., second promoter) which does not interfere with the promoter employed for exogenous protein production in avian oviduct cells (i.e., first promoter). For example, it is contemplated that if the marker promoter and the promoter of interest are the same or similar promoters, interference by the selectable cassette will be minimized or eliminated. For example, a second ovalbumin promoter operably linked to a marker gene coding sequence may not interfere with a first ovalbumin promoter employed for exogenous protein production in avian oviduct cells.

[0142] The invention contemplates the employment of any useful oviduct specific promoter, and oviduct specific promoter fragments, in vectors of the invention for exogenous protein expression in avians. For example, promoters and useful (e.g., functional) fragments of promoters (e.g., promoter components) disclosed in US patent publication No. 2005/0176047, filed Jan. 31, 2005, the disclosure of which is incorporated in its entirety herein by reference, and US patent publication No. 2007/0124829, filed Jan. 26, 2007, the disclosure of which is incorporated in its entirety herein by reference, and US patent publication No. 2006/0130170, filed Dec. 11, 2003, the disclosure of which is incorporated in its entirety herein by reference, are contemplated for use in conjunction with SIN vectors and SC negative vectors and SIN/SC negative vectors in accordance with the invention.

[0143] The invention also contemplates other promoters and transcriptionally functional portions thereof (e.g., promoter components) for use as promoters of interest in accordance with the invention such as a cytomegalovirus (CMV) promoter, a rous-sarcoma virus (RSV) promoter, a .beta.-actin promoter (e.g., a chicken .beta.-actin promoter) a murine leukemia virus (MLV) promoter, a mouse mammary tumor virus (MMTV) promoter.

[0144] The invention also includes various ovalbumin promoter components which are contemplated for use in producing exogenous proteins in transgenic avians. Each of the promoters disclosed herein are contemplated for use in vectors in accordance with the invention.

[0145] Examples of vectors of the invention which contain recombinant ovalbumin DNA are shown below. The fragments are listed top to bottom in the 5' to 3' linear order in which they are present on a single DNA molecule. For example, the 3' end of the 3.5 kb OV fragment of sequence 1 would be covalently linked to the 5' end of the 5' UTR-5' portion and the 3' end of the 5' UTR-5' portion would be covalently linked to the 5' end of 5' UTR-3' portion. [0146] 1. pSIN-OV-3.5-CSI [0147] 3.5 kb OV fragment (includes DHS I, II & III) [0148] 5' UTR-5' portion (from Exon L) [0149] 5' UTR-3' portion (from Exon 1) [0150] 2. pSIN-OV-3.5-Int-CSI-inv [0151] 3.5 kb OV fragment (includes DHS I, II & III) [0152] 5' UTR-5' portion (from Exon L) [0153] Intron A [0154] 5' UTR-3' portion (from Exon 1) [0155] 3' UTR [0156] 3. pSIN-OV-3.5-Int-CSI [0157] 3.5 kb OV fragment (includes DHS I, II & III) [0158] 5' UTR-5' portion (from Exon L) [0159] Intron A [0160] 5' UTR-3' portion (from Exon 1) [0161] 4. pSIN-OV-3.5-CSI-UTR-inv [0162] 3.5 kb OV fragment (includes DHS I, II & III) [0163] 5' UTR-5' portion (from Exon L) [0164] 5' UTR-3' portion (from Exon 1) [0165] 3' UTR [0166] 5. pSIN-OV-3.5-Int-CSI-LUTR-inv [0167] 3.5 kb OV fragment (includes DHS I, II & III) [0168] 5' UTR-5' portion (from Exon L) [0169] Intron A [0170] 5' UTR-3' portion (from Exon 1) [0171] 3' UTR/DHS A (bp 13576 to 15163 of FIG. 8); [0172] 6. pSIN-OV-3.5-CSI-LUTR-inv [0173] 3.5 kb OV fragment (includes DHS I, II & III) [0174] 5' UTR-5' portion (from Exon L) [0175] 5' UTR-3' portion (from Exon 1) [0176] 3' UTR/DHS A (bp 13576 to 15163 of FIG. 8); [0177] 7. pSIN-OV-3.5-Int-CSI-RRE [0178] 3.5 kb OV fragment (includes DHS I, II & III) [0179] 5' UTR-5' portion (from Exon L) [0180] Intron A [0181] 5' UTR-3' portion (from Exon 1) [0182] partial 3' UTR [0183] RRE (Rev response element) FIG. 9a

[0184] Construct 7 includes RRE to allow transport of the unspliced RNA genome to the cytoplasm and thus may enhance packaging of intact retroviral RNA. RRE is only active in presence of the Rev protein. Rev activity is provided in the form of DNA encoding the Rev, RNA encoding the Rev, and/or the Rev protein, which is well known in the art and commercially available (e.g., Invitrogen, Inc.), during the transient transfection of retroviral components. Thus the intron will be present in the transgene contained in the genome of the transgenic bird produced by the virus particles (the rev protein is not present in the cells of the transgenic bird). As a result the RNA should be spliced in the oviduct cells of a laying hen resulting in an enhanced level of protein expression compared to a same transgenic bird having the same transgene without the intron. [0185] 8. pSIN-CTE-OV-3.5-Int-CSI [0186] ALV CTE (FIG. 9b_k ) inserted 5' of 3.5 kb OV fragment [0187] 3.5 kb OV fragment (includes DHS I, II & III) [0188] 5' UTR-5' portion (from Exon L) [0189] Intron A [0190] 5' UTR-3' portion (from Exon 1) [0191] partial 3' UTR

[0192] Coordinates for some of the elements for the above eight vectors are described elsewhere in the application. For example, coordinates of sequences from the ovalbumin nucleotide sequence are described in the Summary section above. CSI means a coding sequence of interest, i.e., nucleotide sequence encoding the protein desired to be expressed in a transgenic avian oviduct.

[0193] SIN vectors, SIN/SC negative vectors and SC negative vectors for use in accordance with the invention include vectors such as Avian Leukemia/Leukosis Viruses (ALV), for example, and without limitation, RAV-0, RAV-1, RAV-2; Avian Sarcoma Viruses (ASV); Avian Sarcoma/Acute Leukemia Viruses (ASLV) including, without limitation, Rous Sarcoma Virus (RSV); Fujinami Sarcoma Viruses (FSV); Avian Myeloblastosis Viruses (AMV); Avian Erythroblastosis Viruses (AEV); Avian Myelocytomatosis Viruses (MCV), for example, and without limitation, MC29; Reticuloendotheliosis Viruses (REV), for example, and without limitation, Spleen Necrosis Virus (SNV). The invention also contemplates other useful retroviral vector, including, without limitation, retroviral vectors based upon Murine Leukemia Viruses (MLV); Molony Murine Sarcoma Viruses (MMSV); Moloney Murine Leukemia Viruses (MMLV); and lentiviruses (e.g., human immunodeficiency virus (HIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) and simian immunodeficiency virus (SIV) which are altered to be SIN vectors, SIN/SC negative vectors or SC negative vectors as is understood by a practitioner of ordinary skill in the art.

[0194] In one very specific embodiment, a portion of the 5' LTR of a modified ALV vector disclosed in Cosset et al, J of Virology (1991) vol 65, no. 6, p 3388-3394, the disclosure of which is incorporated in its entirety herein by reference, is deleted to produce a SIN vector. In particular, nucleotides 1 to 173 were deleted from the ALV based vector LTR sequence shown in SEQ ID NO: 29. Specific deletions from 5' LTR sequences useful to produce SIN vectors from other vectors which can be used in avian transgenesis can be determined by a practitioner of ordinary skill in the art.

[0195] In one particularly useful embodiment, the invention is drawn to the production of therapeutic proteins which may be produced in the oviduct of a transgenic avian, such as a chicken, in accordance with the invention. Exemplary proteins for production in accordance with the invention include, without limitation, erythropoietin, GM-CSF, interferon .beta., fusion protein, CTLA4-Fc fusion protein, growth hormones, cytokines, structural proteins, interferon, lysozyme, .beta.-casein, albumin, .alpha.-1 antitrypsin, antithrombin III, collagen, factors VIII, IX, X (and the like), fibrinogen, lactoferrin, protein C, tissue-type plasminogen activator (tPA), somatotropin, and chymotrypsin, immunoglobulins, antibodies, immunotoxins, factor VIII, b-domain deleted factor VIII, factor VIIa, factor IX, anticoagulants; hirudin, alteplase, tpa, reteplase, tpa, tpa--3 of 5 domains deleted, insulin, insulin lispro, insulin aspart, insulin glargine, long-acting insulin analogs, glucagons, tsh, follitropin-beta, fsh, pdgh, inf-beta, inf-alpha 1, ifn-alpha 2, inf-beta, inf-beta 1b, ifn-beta 1a, ifn-gamma, ifn-gamma 1b, il-2, il-1 1, hbsag, ospa, dornase-alpha dnase, beta glucocerebrosidase, tnf-alpha, il-2-diptheria toxin fusion protein, tnfr-lgg fragment fusion protein laronidase, dnaases, alefacept, tositumomab, murine mab, alemtuzumab, rasburicase, agalsidase beta, teriparatide, parathyroid hormone derivatives, adalimumab (lgg1), anakinra, nesiritide, human b-type natriuretic peptide (hbnp), colony stimulating factors, pegvisomant, human growth hormone receptor antagonist, recombinant activated protein c, omalizumab, immunoglobulin e (lge) blocker, lbritumomab tiuxetan, ACTH, glucagon, somatostatin, somatotropin, thymosin, parathyroid hormone, pigmentary hormones, somatomedin, luteinizing hormone, chorionic gonadotropin, hypothalmic releasing factors, etanercept, antidiuretic hormones, prolactin and thyroid stimulating hormone, an immunoglobulin polypeptide, immunoglobulin polypeptide D region, immunoglobulin polypeptide J region, immunoglobulin polypeptide C region, immunoglobulin light chain, immunoglobulin heavy chain, an immunoglobulin heavy chain variable region, an immunoglobulin light chain variable region and a linker peptide. Production of each of these, and other, proteins is contemplated using methods, vectors and promoters of the invention.

[0196] The present invention is further illustrated by the following examples, which are provided by way of illustration and should not be construed as limiting. The contents of all references, published patents and patents cited throughout the present application are hereby incorporated by reference in their entireties.

EXAMPLE 1

Production of pALV-SIN-4.2-Lys-IFNa-2B

[0197] The vector pALV-SIN-4.2-Lys-IFNa-2B (shown in FIG. 1) was constructed and is shown in FIG. 1. The sequence of pALV-SIN-4.2-Lys-IFNa-2B is shown in SEQ ID NO: 1. The 4.2 Kb lysozyme promoter spans from nucleotides 4810 to 9008 of SEQ ID NO: 1. The lysozyme signal peptide coding sequence spans from nucleotides 9037 to 9090 of SEQ ID NO: 1. The interferon alpha 2b coding sequence spans from nucleotides 9091 to 9585 of SEQ ID NO: 1. Other components of the sequence include LTRs spanning from nucleotides 4000 to 4345 and from nucleotides 725 to 897 of SEQ ID NO: 1.

[0198] pALV-SIN-4.2-Lys-IFNa-2B can be constructed by a variety of methods which are apparent to a practitioner of skill in the art. However, the method believed to be the most useful for making the vector is as follows: A 3427 bp region of pNLB-CMV-IFN-alpha2B (disclosed in U.S. patent application Ser. No. 11/167,052, filed Jun. 24, 2005, the disclosure of which is incorporated in its entirety herein by reference) is PCR amplified using primers ATGCGCGCATTGGTAATTGATCGGCTGG (Primer ALV-SIN-1, SEQ ID NO: 2) and ATATGCGGCCGCGGTACCGCCCGGGCATCGATATCAAGCTTACGGTTCACT A AACGAGCTCTGCTTATATAGACCTCCCA (Primer ALV-SIN-2, SEQ ID NO: 3). The product is digested with BssHII and Not I resulting in a 3428 bp fragment which can be isolated by gel purification. A 1436 bp region of pNLB-CMV-IFN-alpha2B is PCR amplified with primers ATATGCGGCCGCGTCGACGGCCGGCCAGATCTGCTGAGCCGGTCGCTACCA TTACCAGT (Primer ALV-SIN-3, SEQ ID NO: 4) and ATACGCGTATTCCCTAACGATCACGTCG (Primer ALV-SIN-4, SEQ ID NO: 5). The resulting product is digested with Not I and Mlu I yielding a 1438 bp fragment which is isolated by gel purification. A Bluescript II SK vector containing a BssHII stuffer fragment is digested with BssHII resulting in a linearized Bluescript vector of 2788 bp which is gel purified and then ligated to the 3428 bp and 1438 bp PCR products to yield JCR.A108.49.5.24.

[0199] JCR.A108.49.5.24 is digested with Hind III and the resulting 6823 bp fragment is circularized by ligation to yield JCR.A108.76.1.1.

[0200] A 1175 bp region of JCR.A108.76.1.1 is PCR amplified with primers CTGAAGTGTAAGGAATGTAAG (Primer ALV-SIN-5, SEQ ID NO: 6) and GCGCGTCTCATCCCCCTCCCTATGCAAAAG (Primer ALV-SIN-6, SEQ ID NO: 7) and the resulting fragment is digested with Blp I and Esp3I producing a 1030 bp fragment which is isolated by gel purification. A 660 bp region of JCR.A108.76.1.1 is PCR amplified with primers GGGCGTCTCAGGGACGGATTGGACGAACCACTGAATT (Primer ALV-SIN-7, SEQ ID NO: 8) and TTAGTGCTTTACGGCACCTC (Primer ALV-SIN-8, SEQ ID NO: 9) and digested with Esp3I and DraIII resulting in a 596 bp fragment which is isolated by gel purification. JCR.A108.76.1.1 is digested with DraIII and Blp I and the 5024 bp linear vector is ligated to the 1030 and 596 bp PCR fragments to produce pALV-SIN.

[0201] pALV-SIN is digested with BamHI and the 4795 bp linear vector is isolated by gel purification. A 4815 bp region of JCR.115.93.1.2 (disclosed in US patent application No. 2007/0124829, filed Jan. 26, 2007,) is PCR amplified with primers GACGGATCCGATACCGTCCCTATTTTTGTGTTTGCTTC (Primer ALV-SIN-9, SEQ ID NO: 10) and TAACGGATCCTAGACTTTTTACTCCTTAGA (Primer ALV-SIN-10, SEQ ID NO: 11) and is digested with BamHI. The resulting 4802 fragment is ligated to the 4795 bp linear pALV-SIN to produce pALV-SIN-4.0-Lys-IFNa-2B.

EXAMPLE 2

Production of Transgenic Ouail Using pALV-SIN-4.2-Lys-IFNa-2B

[0202] Transduction particles of the vector pALV-SIN-4.2-Lys-IFNa-2B were produced in fibroblast cells as disclosed in US patent publication No. 2007/0077650, published Apr. 5, 2007, entitled: Rapid Production of High Titer Virus, the disclosure of which is incorporated in its entirety herein by reference.

[0203] Fertilized Japanese quail eggs were windowed essentially according to the Speksnijder procedure disclosed in U.S. Pat. No. 5,897,998, the disclosure of which is incorporated in its entirety herein by reference. Eighty eggs were injected in the subgerminal cavity with about 7 microliters (approximately 7.times.10.sup.4 viral particles total) of pALV-SIN-4.2-Lys-IFNa-2B transducing particles per egg. Since no selectable marker is used in pALV-SIN-4.2-Lys-IFNa-2B, the concentration of viral particles is estimated based upon past results for viral particle production where a selectable cassette or marker was used in the vector which allowed for particle quantification. Sixteen chicks hatched about 18 days after injection and human IFN levels were measured by IFN ELISA from serum samples collected from chicks 12 weeks after hatch. None were positive for the IFN protein in the serum.

[0204] In order to identify G0 quail which contained the interferon alpha 2 coding sequence containing transgene in their genome, DNA was extracted from blood of the birds and the DNA samples were subjected to Taqman.RTM. analysis on a 7700 Sequence Detector (Perkin Elmer).

[0205] Eggs from eight G0 quail were tested for the presence of the IFN protein in the egg white by ELISA. Quail No. 4 was found to have significant levels of IFN in egg white from her eggs. FIG. 2 shows a bar graph illustrating expression levels of IFN in the egg white of Quail No. 4. Quail No. 4 expressed IFN-alpha-2 at 0.45 .mu.g/ml of egg white, which is a high level of expression for a G0 avian. There was no interferon alpha 2 detected in the blood of Quail No. 4 which is particularly significant. For example, in certain instances the recombinant protein may be harmful to the development or health of the avian when present in the blood which can kill the bird or can lead to reduced levels of protein production.

EXAMPLE 3

Production of Transgenic Ouail Using pALV-SIN-6.5-Lys-IFNa-2B

[0206] The 4.2 kb lysozyme promoter of vector pALV-SIN-4.2-Lys-IFNa-2B is removed and replaced with a 6.5 kb lysozyme promoter corresponding to about nucleotides 5363 to 11863 of SEQ ID NO: 12, using standard methodologies known to practitioners of skill in the art, resulting in pALV-SIN-6.5-Lys-IFNa-2B. Transduction particles of the new vector pALV-SIN-6.5-Lys-IFNa-2B are produced as disclosed in US patent publication No. 2007/0077650, published Apr. 5, 2007.

[0207] Fertilized chicken eggs or Japanese quail eggs are windowed and about 7.times.10.sup.4 pALV-SIN-6.5-Lys-IFNa-2B transducing particles are injected into the subgerminal cavity of each egg. Eggs hatch 21 or 18 days after injection and chimeric birds are identified that contain the active transgene in their genome, as described in Example 2. Fully transgenic G1 birds which contain the transgene in their genome are produced from chimeras using methods known in the art, i.e., crossing male chimeras with non-transgenic females.

EXAMPLE 4

Production of Vector pSIN-OV-3.5-I-CTLA4-Fc-Inv

[0208] This vector includes the ovalbumin Dnase hypersensitive sites (DHS) I, II and III, the first exon (exon L), the first intron and the CTLA4-Fc fusion protein coding sequence inserted in frame with the ATG of second exon (exon 1) and with the 3' untranslated region (UTR). The expression cassette is inserted in the inverse orientation into an avian leukosis virus (ALV) vector, which was made self-inactivating (SIN) by deletion of nucleotides 1 to 173 of the ALV LTR sequence shown in SEQ ID NO: 29.

[0209] The vector was constructed as follows: pNLB-3.9-OM-CTLA4-Fc, disclosed in Example 20 of US patent publication No. 2007/0113299, published May 17, 2007, the disclosure of which is incorporated in its entirety herein by reference, was cut with Nae I and Not I. The Not I site was filled in by Klenow reaction. The resulting 8125 bp fragment was gel purified, religated, producing pOM-3.9-CTLA4-dSacl. pOM-3.9-CTLA4-dSacl was cut with EcoRI and Kpn I and the 8115 bp fragment gel purified. The 3' UTR of the chicken ovalbumin gene was PCRed from BAC 26, disclosed in US patent publication No. 2006/0130170, published Jun. 15, 2006, with the primers 5'-GCGGAATTCAAAGAAGAAAGCTGAAAAAC-3' (SEQ ID NO: 13) and 5'-GCGGGTACCTTCAAATACTACAAGTGAAA-3' (SEQ ID NO: 14). The 3' UTR PCR was cut with Eco RI and Kpn I and the 684 bp fragment gel purified. The 8115 bp fragment of pOM-3.9-CTLA4-dSacl was ligated to the 684 bp fragment of 3' UTR PCR, producing pOM-3.9-CTLA4-OV3' UTR.

[0210] The 3.5 kb OV promoter region, exon L, first intron and the UTR of exon 1 was PCR amplified with BAC26 as a template and with primers 5'-GGCCTCGAGTCAAGTTCTGAGTAGGTTTTAGTG-3' (SEQ ID NO: 15) and 5'-GCGCGTCTCTGTCTAGAGCAAACAGCAGAACAGTGAAAATG-3' (SEQ ID NO: 16). The PCR product was cut with Xho I and Esp3I and the 5094 bp product was gel purified.

[0211] A 5' portion of the CTLA4-Fc gene was PCR amplified using pOM-3.9-CTLA4 as a template and primers 5'-GCGCGTCTCAAGACAACTCAGAGTTCACCATGGGTGTACTGCTCACACAG-3' (SEQ ID NO: 17) and 5'-GGCCCGGGAGTTTTGTCAGAAGATTTGGG-3' (SEQ ID NO: 18). The PCR product was cut with Esp3I and SacI and the 384 bp product gel purified.

[0212] pOM-3.9-CTLA4-OV3' UTR was cut with Sac I and Xho I, the 4473 bp product gel purified and ligated to the 5094 bp OV PCR fragment and 384 bp CTLA4-Fc fragment, producing pOV-3.5-I-CTLA4.

[0213] pALV-SIN, disclosed, for example, in Example 10 of parent case US patent publication No. 2007/0124829, published May 31, 2007, was cut with Mfe I and Xho I, filled in with Klenow and the 4911 bp fragment gel purified.

[0214] pOV-3.5-I-CTLA4 was cut with XhoI and BamHI, filled in with Klenow and the 6957 bp fragment gel purified. This fragment was ligated into the 4911 bp fragment of pAVI-SIN such that the CTLA4-Fc gene and flanking expression elements are in the opposite orientation of the ALV long terminal repeats, producing pSIN-OV-3.5-I-CTLA4-inv. See FIG. 3 and SEQ ID NO: 19. Such opposite orientation may be preferred if the coding sequence of interest (i.e., CSI) in the transgene contains one or more introns or splice sites.

EXAMPLE 5

Production Of Transgenic Ouail Using SIN-OV-3.5-I-CTLA4-inv

[0215] Retroviral particles containing the pSIN-OV-3.5-I-CTLA4-inv vector (FIG. 3) and pseudotyped with the VSV envelope protein were produced as described in US patent publication No.2007/0077650, published Apr. 5, 2007. Virus particles were harvested at 48 hours post-transfection, concentrated and on the same day, approximately 4 microliters of the virus suspension containing about 1.times.10.sup.5 particles was injected into the subgerminal cavity of stage X quail eggs. Eggs were resealed and hatched.

[0216] ALV has a CTE element in the 3' end of its genome that allows transport of unspliced retroviral RNA to the cytoplasm. In pSIN-OV-3.5-I-CTLA4-inv, due to the inverse orientation of the OV promoter relative to the LTRs, the CTE is upstream of the OV promoter such that the CTE element is only in RNAs derived from the 5' LTR promoter and not in RNAs transcribed by the OV promoter. Therefore, any RNA transcribed by the OV promoter should be spliced prior to being transported into the cytoplasm.

[0217] Egg whites from chimeric quail were assayed using an ELISA for CTLA4-Fc. One quail was found to have CTLA4-Fc in her egg white at approximately 16 .mu.g/ml. The transgenesis level in these quail is estimated at about 5% or less. Thus the level in a GI should be substantially greater. It is expected that similar levels would be seen in a chicken and other avians, as the quail and chicken ovalbumin genes, as well as ovalbumin genes of other avians, are very similar.

EXAMPLE 6

Construction of pSIN-3.9-OM-CTLA4-Fc

[0218] The 4907 bp Mfe I/Xho I fragment of pALV-SIN (disclosed, for example, in US patent publication No. 2007/0124829, published May 31, 2007) was ligated to the 5115 XhoI/EcoRI fragment of pOM-3.9-CTLA4 (shown in FIG. 15 of US patent publication No. 2007/0113299, published May 17, 2007), producing pSIN-3.9-OM-CTLA4-Fc Shown in FIG. 4 and SEQ ID NO: 20,

EXAMPLE 7

Production Of Transgenic Chickens Using pSIN-3.9-OM-CTLA4-Fc

[0219] Retroviral particles pseudotyped with the VSV envelope protein and containing the pSIN-3.9-OM-CTLA4-Fc (FIG. 4) vector were produced as described in US patent publication No. 2007/0077650, published Apr. 5, 2007. Virus was harvested at 48 hours post-transfection, concentrated and on the same day approximately 7 microliters injected into the subgerminal cavity of stage X eggs. Eggs were resealed and incubated until hatch.

[0220] Egg white from hens was assayed using an ELISA for CTLA4-Fc. One hen was found to have CTLA4-Fc in her egg white at approximately 0.37 .mu.g/ml. The transgenesis level in these hens is estimated at 5% or less. Thus the levels in a G1 should be substantially greater.

[0221] Any useful coding sequence may be inserted in place of the CTLA4-Fc coding sequence for production of the corresponding product.

EXAMPLE 8

Construction of pSIN-1.8-OM-IFNa-2B

[0222] The 1051 bp Nco I-Nco I fragment from pBS-OM-4.4 (FIG. 5 SEQ ID NO: 23) was inserted into the Nco I site of pAVIJCR-A137.91.1.2 (FIG. 6 SEQ ID NO: 24), thereby inserting the 1 kb ovomucoid promoter in front of an IFN coding sequence and SV40 polyadenylation signal and producing plkb-OM-IFNMM. A 1816 bp Cla I-Sac I fragment of p1kb-OM-IFNMM was inserted into the 6245 bp Cla I-Sac I fragment of pBS-OM-4.4, thereby fusing the 4.4 kb ovomucoid fragment with the IFN coding sequence and producing p4.40M-IFNMM. The 8511 bp BamH I-Sal I fragment of pBS-OMUP-10 was ligated to the 5148 bp BamH I-Sal I fragment of p4.40M-IFN, thereby placing the 10 kb ovomucoid promoter in front of the IFN coding sequence, producing p10-OM-IFN.

[0223] Region 2487-4889 of p10.0-OM-IFN was PCR amplified with primers 5'-GGCGTCGACGGATCCGTTAACCCTAGAACTAGTGGATCTCTGCCCTTGTGC TGAC-3' (SEQ ID NO: 27) and 5'-GGCCTCGAGCCTAGACTTTTTACTCCTTAGA-3' (SEQ ID NO: 28). The PCR product was digested with Sal I and Xho I and the 2435 bp isolated. pALV-SIN (disclosed, for example, in US patent publication No. 2007/0124829, published May 31, 2007) was digested with Xho I and the 4915 bp fragment isolated and ligated to the 2435 bp fragment, producing pSIN-1.8-OM-IFNa-2B, shown in FIG. 7 and SEQ ID NO: 21.

EXAMPLE 9

Production Of Transgenic Chickens Using pSIN-1.8-OM-IFNa-2B

[0224] Retroviral particles having the pSIN-1.8-OM-IFNa-2B transgene and pseudotyped with the VSV envelope protein were produced as described in US patent publication No. 2007/0077650, published Apr. 5, 2007. Virus was harvested at 48 hours post-transfection, concentrated and, on the same day, approximately 7 microliters injected into the subgerminal cavity of stage X eggs. Eggs were resealed and incubated until hatch.

[0225] Egg whites from hens were assayed using an ELISA for IFNa-2B. Hens were found to have IFNa-2B in egg white at levels that ranged from 1.5 to 865.0 ng/ml with IFNa-2B levels at least about 600 fold lower in the serum. The transgenesis level in these hens is estimated at 5% or less.

[0226] Five G0 sperm positive roosters were bred to non-transgenic hens. Of 1251 offspring, 30 carried the pSIN-1.8-OM-IFNa-2B transgene. Six of the 30 hens expressed human IFN-.alpha.-2B at 34.1 to 165.6 .mu.g/ml of egg white. Each of the six hens had a single copy of the transgene. Serum levels of human IFN-.alpha.-2B were 0.3 to 9.2 ng/ml which, on average, was 30,000 fold lower than egg white levels.

EXAMPLE 10

Production Of Transgenic Chickens Using Lentivirus Vectors And Moloney Murine Leukemia Virus

[0227] The invention specifically contemplates the employment of other retroviral vectors that are useful in avian transgenesis to be used in accordance with the present invention. Such vectors can be employed to produce transgenic avians, for example, in the same way as ALV-SIN vectors have been used in Examples' 1 to 9 above. For example, Moloney Murine Leukemia Virus (MMLV) and Lentiviral Vectors can be used in accordance with the invention, each, for example, by deleting one or more of the CAAT box; the TAATA box; and enhancer contained in the U3 region of the upstream LTR of each virus to produce a SIN vector. Alternatively, or in addition (i.e., in conjunction with a SIN vector) no transcriptionally active markers or selectable cassettes are included in each of the retroviral vectors.

[0228] Although preferred embodiments of the invention have been described using specific terms, devices, and methods, such description is for illustrative purposes only. The words used are words of description rather than of limitation. It is to be understood that changes and variations may be made by those of ordinary skill in the art without departing from the spirit or the scope of the present inventions which is set forth in the following claims. In addition, it should be understood that aspects of the various embodiments may be interchanged both in whole or in part.

Sequence CWU 1

1

29 1 9597 DNA Artificial Sequence pALV-SIN-4.2-Lys-IFNa-2B Vector 1 gatcccccgt gctgcagaac cgagcggcta ttgacttctt gctcctagct cacggccatg 60 gctgtgagga cattgcggga atgtgttgtt tcaatctgag tgatcacagt gagtctatac 120 agaagaagtt ccagctaatg aaggaacatg tcaataagat cggcgtgaac aacgacccaa 180 tcggaagttg gctgcgagga ttattcggag gaataggaga atgggccgta cacttgctga 240 aaggactgct tttggggctt gtagttatct tgttgctagt agtatgcttg ccttgccttt 300 tgcaatgtgt atctagtagt attcgaaaga tgattgataa ttcactcggc tatcgcgagg 360 aatataaaaa aattacagga ggcttataag cagcccgaaa gaagagcgta ggcgagttct 420 tgtattccgt gtgatagctg gttggattgg taattgatcg gctggcacgc ggaatatagg 480 aggtcgctga atagtaaact tgtagacttg gctacagcat agagtatctt ctgtagctct 540 gatgactgct aggaaataat gctacggata atgtggggag ggcaaggctt gcgaatcggg 600 ttgtaacggg caaggcttga ctgaggggac aatagcatgt ttaggcgaaa agcggggctt 660 cggttgtacg cggttaggag tcccctcagg atatagtagt ttcgcttttg catagggagg 720 gggacggatt ggacgaacca ctgaattccg cattgcagag atattgtatt taagtgccta 780 gctcgataca ataaacgcca tttgaccatt caccacattg gtgtgcacct gggttgatgg 840 ccggaccgtt gattccctgr cgactacgag cacatgcatg aagcagaagg cttcatttgg 900 tgaccccgac gtgatcgtta gggaatacgc gctcactggc cgtcgtttta caacgtcgtg 960 actgggaaaa ccctggcgtt acccaactta atcgccttgc agcacatccc cctttcgcca 1020 gctggcgtaa tagcgaagag gcccgcaccg atcgcccttc ccaacagttg cgcagcctga 1080 atggcgaatg gaaattgtaa gcgttaatat tttgttaaaa ttcgcgttaa atttttgtta 1140 aatcagctca ttttttaacc aataggccga aatcggcaaa atcccttata aatcaaaaga 1200 atagaccgag atagggttga gtgttgttcc agtttggaac aagagtccac tattaaagaa 1260 cgtggactcc aacgtcaaag ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga 1320 accatcaccc taatcaagtt ttttggggtc gaggtgccgt aaagcactaa atcggaaccc 1380 taaagggagc ccccgattta gagcttgacg gggaaagccg gcgaacgtgg cgagaaagga 1440 agggaagaaa gcgaaaggag cgggcgctag ggcgctggca agtgtagcgg tcacgctgcg 1500 cgtaaccacc acacccgccg cgcttaatgc gccgctacag ggcgcgtcag gtggcacttt 1560 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 1620 tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 1680 gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 1740 ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 1800 agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 1860 agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 1920 tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 1980 tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 2040 cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 2100 aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 2160 tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 2220 tgtagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 2280 ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 2340 ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 2400 cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 2460 gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 2520 actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 2580 aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 2640 caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 2700 aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 2760 accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 2820 aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 2880 ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 2940 agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 3000 accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 3060 gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 3120 tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 3180 cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 3240 cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 3300 cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 3360 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 3420 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 3480 gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 3540 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct 3600 cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat 3660 tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg ccaagcgcgc 3720 attggtaatt gatcggctgg cacgcggaat ataggaggtc gctgaatagt aaacttgtag 3780 acttggctac agcatagagt atcttctgta gctctgatga ctgctaggaa ataatgctac 3840 ggataatgtg gggagggcaa ggcttgcgaa tcgggttgta acgggcaagg cttgactgag 3900 gggacaatag catgtttagg cgaaaagcgg ggcttcggtt gtacgcggtt aggagtcccc 3960 tcaggatata gtagtttcgc ttttgcatag ggagggggaa atgtagtctt atgcaatact 4020 cttgtagtct tgcaacatgc ttatgtaacg atgagttagc aacatgcctt ataaggagag 4080 aaaaagcacc gtgcatgccg attggtggga gtaaggtggt atgatcgtgg tatgatcgtg 4140 ccttgttagg aaggcaacag acgggtctaa cacggattgg acgaaccact gaattccgca 4200 ttgcagagat attgtattta agtgcctagc tcgatacaat aaacgccatt tgaccattca 4260 ccacattggt gtgcacctgg gttgatggcc ggaccgttga ttccctgrcg actacgagca 4320 catgcatgaa gcagaaggct tcatttggtg accccgacgt gatcgttagg gaatagtggt 4380 cggccacagg cggcgtggcg atcctgtcct catccgtctc gcttattcgg ggagcggacg 4440 atgaccctag tagagggggc tgcggcttag gagggcagaa gctgagtggc gtcggaggga 4500 gccctactgc agggggccaa cataccctac cgagaactca gagagtcgtt ggaagacggg 4560 aaggaagccc gacgactgag cggtccaccc caggcgtgat tccggttgct ctgcgtgatt 4620 ccggtcgccc ggtggatcaa gcatggaagc cgtcataaag gtgatttcgt ccgcgtgtaa 4680 gacctattgc gggaaaacct ctccttctaa gaaggaaata ggggctatgt tgtccctgtt 4740 acaaaaggaa gggttgctta cgtccccctc agacttatat tccccggggt cctgggatcc 4800 gataccgtcc ctatttttgt gtttgcttca gcagccattt aattcttcag tgtcatcttg 4860 ttctgttgat gccactggaa caggattttc agcagtcttg caaagaacat ctagctgaaa 4920 actttctgcc attcaatatt cttaccagtt cttcttgttt gaggtgagcc ataaattact 4980 agaacttcgt cactgacaag tttatgcatt ttattacttc tattatgtac ttactttgac 5040 ataacacaga cacgcacata ttttgctggg atttccacag tgtctctgtg tccttcacat 5100 ggttttactg tcatacttcc gttataacct tggcaatctg cccagctgcc catcacaaga 5160 aaagagattc cttttttatt acttctcttc agccaataaa caaaatgtga gaagcccaaa 5220 caagaacttg tggggcaggc tgccatcaag ggagagacag ctgaagggtt gtgtagctca 5280 atagaattaa gaaataataa agctgtgtca gacagttttg cctgatttat acaggcacgc 5340 cccaagccag agaggctgtc tgccaaggcc accttgcagt ccttggtttg taagataagt 5400 cataggtaac ttttctggtg aattgcgtgg agaatcatga tggcagttct tgctgtttac 5460 tatggtaaga tgctaaaata ggagacagca aagtaacact tgctgctgta ggtgctctgc 5520 tatccagaca gcgatggcac tcgcacacca agatgaggga tgctcccagc tgacggatgc 5580 tggggcagta acagtgggtc ccatgctgcc tgctcattag catcacctca gccctcacca 5640 gcccatcaga aggatcatcc caagctgagg aaagttgctc atcttcttca catcatcaaa 5700 cctttggcct gactgatgcc tcccggatgc ttaaatgtgg tcactgacat ctttattttt 5760 ctatgatttc aagtcagaac ctccggatca ggagggaaca catagtggga atgtaccctc 5820 agctccaagg ccagatcttc cttcaatgat catgcatgct acttaggaag gtgtgtgtgt 5880 gtgaatgtag aattgccttt gttatttttt cttcctgctg tcaggaacat tttgaatacc 5940 agagaaaaag aaaagtgctc ttcttggcat gggaggagtt gtcacacttg caaaataaag 6000 gatgcagtcc caaatgttca taatctcagg gtctgaagga ggatcagaaa ctgtgtatac 6060 aatttcaggc ttctctgaat gcagcttttg aaagctgttc ctggccgagg cagtactagt 6120 cagaaccctc ggaaacagga acaaatgtct tcaaggtgca gcaggaggaa acaccttgcc 6180 catcatgaaa gtgaataacc actgccgctg aaggaatcca gctcctgttt gagcaggtgc 6240 tgcacactcc cacactgaaa caacagttca tttttatagg acttccagga aggatcttct 6300 tcttaagctt cttaattatg gtacatctcc agttggcaga tgactatgac tactgacagg 6360 agaatgagga actagctggg aatatttctg tttgaccacc atggagtcac ccatttcttt 6420 actggtattt ggaaataata attctgaatt gcaaagcagg agttagcgaa gatcttcatt 6480 tcttccatgt tggtgacagc acagttctgg ctatgaaagt ctgcttacaa ggaagaggat 6540 aaaaatcata gggataataa atctaagttt gaagacaatg aggttttagc tgcatttgac 6600 atgaagaaat tgagacctct actggatagc tatggtattt acgtgtcttt ttgcttagtt 6660 acttattgac cccagctgag gtcaagtatg aactcaggtc tctcgggcta ctggcatgga 6720 ttgattacat acaactgtaa ttttagcagt gatttagggt ttatgagtac ttttgcagta 6780 aatcataggg ttagtaatgt taatctcagg gaaaaaaaaa aaaagccaac cctgacagac 6840 atcccagctc aggtggaaat caaggatcac agctcagtgc ggtcccagag aacacaggga 6900 ctcttctctt aggaccttta tgtacagggc ctcaagataa ctgatgttag tcagaagact 6960 ttccattctg gccacagttc agctgaggca atcctggaat tttctctccg ctgcacagtt 7020 ccagtcatcc cagtttgtac agttctggca ctttttgggt caggccgtga tccaaggagc 7080 agaagttcca gctatggtca gggagtgcct gaccgtccca actcactgca ctcaaacaaa 7140 ggcgaaacca caagagtggc ttttgttgaa attgcagtgt ggcccagagg ggctgcacca 7200 gtactggatt gaccacgagg caacattaat cctcagcaag tgcaatttgc agccattaaa 7260 ttgaactaac tgatactaca atgcaatcag tatcaacaag tggtttggct tggaagatgg 7320 agtctagggg ctctacagga gtagctactc tctaatggag ttgcattttg aagcaggaca 7380 ctgtgaaaag ctggcctcct aaagaggctg ctaaacatta gggtcaattt tccagtgcac 7440 tttctgaagt gtctgcagtt ccccatgcaa agctgcccaa acatagcact tccaattgaa 7500 tacaattata tgcaggcgta ctgcttcttg ccagcactgt ccttctcaaa tgaactcaac 7560 aaacaatttc aaagtctagt agaaagtaac aagctttgaa tgtcattaaa aagtatatct 7620 gctttcagta gttcagctta tttatgccca ctagaaacat cttgtacaag ctgaacactg 7680 gggctccaga ttagtggtaa aacctacttt atacaatcat agaatcatag aatggcctgg 7740 gttggaaggg accccaagga tcatgaagat ccaacacccc cgccacaggc agggccacca 7800 acctccagat ctggtactag accaggcagc ccagggctcc atccaacctg gccatgaaca 7860 cctccaggga tggagcatcc acaacctctc tgggcagcct gtgccagcac ctcaccaccc 7920 tctctgtgaa gaacttttcc ctgacatcca atctaagcct tccctccttg aggttagatc 7980 cactccccct tgtgctatca ctgtctactc ttgtaaaaag ttgattctcc tcctttttgg 8040 aaggttgcaa tgaggtctcc ttgcagcctt cttctcttct gcaggatgaa caagcccagc 8100 tccctcagcc tgtctttata ggagaggtgc tccagccctc tgatcatctt tgtggccctc 8160 ctctggaccc gctccaagag ctccacatct ttcctgtact gggggcccca ggcctgaatg 8220 cagtactcca gatggggcct caaaagagca gagtaaagag ggacaatcac cttcctcacc 8280 ctgctggcca gccctcttct gatggagccc tggatacaac tggctttctg agctgcaact 8340 tctccttatc agttccacta ttaaaacagg aacaatacaa caggtgctga tggccagtgc 8400 agagtttttc acacttcttc atttcggtag atcttagatg aggaacgttg aagttgtgct 8460 tctgcgtgtg cttcttcctc ctcaaatact cctgcctgat acctcacccc acctgccact 8520 gaatggctcc atggccccct gcagccaggg ccctgatgaa cccggcactg cttcagatgc 8580 tgtttaatag cacagtatga ccaagttgca cctatgaata cacaaacaat gtgttgcatc 8640 cttcagcact tgagaagaag agccaaattt gcattgtcag gaaatggttt agtaattctg 8700 ccaattaaaa cttgtttatc taccatggct gtttttatgg ctgttagtag tggtacactg 8760 atgatgaaca atggctatgc agtaaaatca agactgtaga tattgcaaca gactataaaa 8820 ttcctctgtg gcttagccaa tgtggtactt cccacattgt ataagaaatt tggcaagttt 8880 agagcaatgt ttgaagtgtt gggaaatttc tgtatactca agagggcgtt tttgacaact 8940 gtagaacaga ggaatcaaaa gggggtggga ggaagttaaa agaagaggca ggtgcaagag 9000 agcttgcagt cccgctgtgt gtacgacact ggcaacatga ggtctttgct aatcttggtg 9060 ctttgcttcc tgcccctggc tgccttaggg tgcgatctgc ctcagaccca cagcctgggc 9120 agcaggagga ccctgatgct gctggctcag atgaggagaa tcagcctgtt tagctgcctg 9180 aaggataggc acgattttgg ctttcctcaa gaggagtttg gcaaccagtt tcagaaggct 9240 gagaccatcc ctgtgctgca cgagatgatc cagcagatct ttaacctgtt tagcaccaag 9300 gatagcagcg ctgcttggga tgagaccctg ctggataagt tttacaccga gctgtaccag 9360 cagctgaacg atctggaggc ttgcgtgatc cagggcgtgg gcgtgaccga gacccctctg 9420 atgaaggagg atagcatcct ggctgtgagg aagtactttc agaggatcac cctgtacctg 9480 aaggagaaga agtacagccc ctgcgcttgg gaagtcgtga gggctgagat catgaggagc 9540 tttagcctga gcaccaacct gcaagagagc ttgaggtcta aggagtaaaa agtctag 9597 2 28 DNA Artificial Sequence Primer ALV-SIN-1 2 atgcgcgcat tggtaattga tcggctgg 28 3 80 DNA Artificial Sequence Primer ALV-SIN-2 3 atatgcggcc gcggtaccgc ccgggcatcg atatcaagct tacggttcac taaacgagct 60 ctgcttatat agacctccca 80 4 59 DNA Artificial Sequence Primer ALV-SIN-3 4 atatgcggcc gcgtcgacgg ccggccagat ctgctgagcc ggtcgctacc attaccagt 59 5 28 DNA Artificial Sequence Primer ALV-SIN-4 5 atacgcgtat tccctaacga tcacgtcg 28 6 21 DNA Artificial Sequence Primer ALV-SIN-5 6 ctgaagtgta aggaatgtaa g 21 7 30 DNA Artificial Sequence Primer ALV-SIN-6 7 gcgcgtctca tccccctccc tatgcaaaag 30 8 37 DNA Artificial Sequence Primer ALV-SIN-7 8 gggcgtctca gggacggatt ggacgaacca ctgaatt 37 9 20 DNA Artificial Sequence Primer ALV-SIN-8 9 ttagtgcttt acggcacctc 20 10 38 DNA Artificial Sequence Primer ALV-SIN-9 10 gacggatccg ataccgtccc tatttttgtg tttgcttc 38 11 30 DNA Artificial Sequence Primer ALV-SIN-10 11 taacggatcc tagacttttt actccttaga 30 12 11945 DNA Artificial Sequence Proximal promoter and lysozyme signal peptide 12 tgccgccttc tttgatattc actctgttgt atttcatctc ttcttgccga tgaaaggata 60 taacagtctg tataacagtc tgtgaggaaa tacttggtat ttcttctgat cagtgttttt 120 ataagtaatg ttgaatattg gataaggctg tgtgtccttt gtcttgggag acaaagccca 180 cagcaggtgg tggttggggt ggtggcagct cagtgacagg agaggttttt ttgcctgttt 240 tttttttttt tttttttttt aagtaaggtg ttcttttttc ttagtaaatt ttctactgga 300 ctgtatgttt tgacaggtca gaaacatttc ttcaaaagaa gaaccttttg gaaactgtac 360 agcccttttc tttcattccc tttttgcttt ctgtgccaat gcctttggtt ctgattgcat 420 tatggaaaac gttgatcgga acttgaggtt tttatttata gtgtggcttg aaagcttgga 480 tagctgttgt tacacgagat accttattaa gtttaggcca gcttgatgct ttattttttc 540 cctttgaagt agtgagcgtt ctctggtttt tttcctttga aactggtgag gcttagattt 600 ttctaatggg attttttacc tgatgatcta gttgcatacc caaatgcttg taaatgtttt 660 cctagttaac atgttgataa cttcggattt acatgttgta tatacttgtc atctgtgttt 720 ctagtaaaaa tatatggcat ttatagaaat acgtaattcc tgatttcctt tttttttatc 780 tctatgctct gtgtgtacag gtcaaacaga cttcactcct atttttattt atagaatttt 840 atatgcagtc tgtcgttggt tcttgtgttg taaggataca gccttaaatt tcctagagcg 900 atgctcagta aggcgggttg tcacatgggt tcaaatgtaa aacgggcacg tttggctgct 960 gccttcccga gatccaggac actaaactgc ttctgcactg aggtataaat cgcttcagat 1020 cccagggaag tgcagatcca cgtgcatatt cttaaagaag aatgaatact ttctaaaata 1080 ttttggcata ggaagcaagc tgcatggatt tgtttgggac ttaaattatt ttggtaacgg 1140 agtgcatagg ttttaaacac agttgcagca tgctaacgag tcacagcgtt tatgcagaag 1200 tgatgcctgg atgcctgttg cagctgttta cggcactgcc ttgcagtgag cattgcagat 1260 aggggtgggg tgctttgtgt cgtgttccca cacgctgcca cacagccacc tcccggaaca 1320 catctcacct gctgggtact tttcaaacca tcttagcagt agtagatgag ttactatgaa 1380 acagagaagt tcctcagttg gatattctca tgggatgtct tttttcccat gttgggcaaa 1440 gtatgataaa gcatctctat ttgtaaatta tgcacttgtt agttcctgaa tcctttctat 1500 agcaccactt attgcagcag gtgtaggctc tggtgtggcc tgtgtctgtg cttcaatctt 1560 ttaaagcttc tttggaaata cactgacttg attgaagtct cttgaagata gtaaacagta 1620 cttacctttg atcccaatga aatcgagcat ttcagttgta aaagaattcc gcctattcat 1680 accatgtaat gtaattttac acccccagtg ctgacacttt ggaatatatt caagtaatag 1740 actttggcct caccctcttg tgtactgtat tttgtaatag aaaatatttt aaactgtgca 1800 tatgattatt acattatgaa agagacattc tgctgatctt caaatgtaag aaaatgagga 1860 gtgcgtgtgc ttttataaat acaagtgatt gcaaattagt gcaggtgtcc ttaaaaaaaa 1920 aaaaaaaaag taatataaaa aggaccaggt gttttacaag tgaaatacat tcctatttgg 1980 taaacagtta catttttatg aagattacca gcgctgctga ctttctaaac ataaggctgt 2040 attgtcttcc tgtaccattg catttcctca ttcccaattt gcacaaggat gtctgggtaa 2100 actattcaag aaatggcttt gaaatacagc atgggagctt gtctgagttg gaatgcagag 2160 ttgcactgca aaatgtcagg aaatggatgt ctctcagaat gcccaactcc aaaggatttt 2220 atatgtgtat atagtaagca gtttcctgat tccagcaggc caaagagtct gctgaatgtt 2280 gtgttgccgg agacctgtat ttctcaacaa ggtaagatgg tatcctagca actgcggatt 2340 ttaatacatt ttcagcagaa gtacttagtt aatctctacc tttagggatc gtttcatcat 2400 ttttagatgt tatacttgaa atactgcata acttttagct ttcatgggtt cctttttttc 2460 agcctttagg agactgttaa gcaatttgct gtccaacttt tgtgttggtc ttaaactgca 2520 atagtagttt accttgtatt gaagaaataa agaccatttt tatattaaaa aatacttttg 2580 tctgtcttca ttttgacttg tctgatatcc ttgcagtgcc cattatgtca gttctgtcag 2640 atattcagac atcaaaactt aacgtgagct cagtggagtt acagctgcgg ttttgatgct 2700 gttattattt ctgaaactag aaatgatgtt gtcttcatct gctcatcaaa cacttcatgc 2760 agagtgtaag gctagtgaga aatgcataca tttattgata cttttttaaa gtcaactttt 2820 tatcagattt ttttttcatt tggaaatata ttgttttcta gactgcatag cttctgaatc 2880 tgaaatgcag tctgattggc atgaagaagc acagcactct tcatcttact taaacttcat 2940 tttggaatga aggaagttaa gcaagggcac aggtccatga aatagagaca gtgcgctcag 3000 gagaaagtga acctggattt ctttggctag tgttctaaat ctgtagtgag gaaagtaaca 3060 cccgattcct tgaaagggct ccagctttaa tgcttccaaa ttgaaggtgg caggcaactt 3120 ggccactggt tatttactgc attatgtctc agtttcgcag ctaacctggc ttctccacta 3180 ttgagcatgg actatagcct ggcttcagag gccaggtgaa ggttgggatg ggtggaagga 3240 gtgctgggct gtggctgggg ggactgtggg gactccaagc tgagcttggg gtgggcagca 3300 cagggaaaag tgtgggtaac tatttttaag tactgtgttg caaacgtctc atctgcaaat 3360 acgtagggtg tgtactctcg aagattaaca gtgtgggttc agtaatatat ggatgaattc 3420 acagtggaag cattcaaggg tagatcatct aacgacacca gatcatcaag ctatgattgg 3480 aagcggtatc agaagagcga ggaaggtaag cagtcttcat atgttttccc tccacgtaaa 3540 gcagtctggg aaagtagcac cccttgagca gagacaagga aataattcag gagcatgtgc 3600 taggagaact ttcttgctga attctacttg caagagcttt gatgcctggc ttctggtgcc 3660 ttctgcagca cctgcaaggc ccagagcctg tggtgagctg gagggaaaga ttctgctcaa 3720 gtccaagctt cagcaggtca ttgtctttgc ttcttccccc agcactgtgc agcagagtgg 3780 aactgatgtc gaagcctcct gtccactacc tgttgctgca ggcagactgc tctcagaaaa 3840 agagagctaa ctctatgcca tagtctgaag gtaaaatggg ttttaaaaaa gaaaacacaa 3900 aggcaaaacc ggctgcccca tgagaagaaa gcagtggtaa acatggtaga aaaggtgcag 3960 aagcccccag gcagtgtgac aggcccctcc tgccacctag aggcgggaac aagcttccct 4020 gcctagggct ctgcccgcga agtgcgtgtt tctttggtgg gttttgtttg gcgtttggtt 4080 ttgagattta gacacaaggg aagcctgaaa ggaggtgttg ggcactattt tggtttgtaa 4140 agcctgtact tcaaatatat attttgtgag ggagtgtagc gaattggcca atttaaaata 4200 aagttgcaag agattgaagg ctgagtagtt gagagggtaa cacgtttaat

gagatcttct 4260 gaaactactg cttctaaaca cttgtttgag tggtgagacc ttggataggt gagtgctctt 4320 gttacatgtc tgatgcactt gcttgtcctt ttccatccac atccatgcat tccacatcca 4380 cgcatttgtc acttatccca tatctgtcat atctgacata cctgtctctt cgtcacttgg 4440 tcagaagaaa cagatgtgat aatccccagc cgccccaagt ttgagaagat ggcagttgct 4500 tctttccctt tttcctgcta agtaaggatt ttctcctggc tttgacacct cacgaaatag 4560 tcttcctgcc ttacattctg ggcattattt caaatatctt tggagtgcgc tgctctcaag 4620 tttgtgtctt cctactctta gagtgaatgc tcttagagtg aaagagaagg aagagaagat 4680 gttggccgca gttctctgat gaacacacct ctgaataatg gccaaaggtg ggtgggtttc 4740 tctgaggaac gggcagcgtt tgcctctgaa agcaaggagc tctgcggagt tgcagttatt 4800 ttgcaactga tggtggaact ggtgcttaaa gcagattccc taggttccct gctacttctt 4860 ttccttcttg gcagtcagtt tatttctgac agacaaacag ccacccccac tgcaggctta 4920 gaaagtatgt ggctctgcct gggtgtgtta cagctctgcc ctggtgaaag gggattaaaa 4980 cgggcaccat tcatcccaaa caggatcctc attcatggat caagctgtaa ggaacttggg 5040 ctccaacctc aaaacattaa ttggagtacg aatgtaatta aaactgcatt ctcgcattcc 5100 taagtcattt agtctggact ctgcagcatg taggtcggca gctcccactt tctcaaagac 5160 cactgatgga ggagtagtaa aaatggagac cgattcagaa caaccaacgg agtgttgccg 5220 aagaaactga tggaaataat gcatgaattg tgtggtggac atttttttta aatacataaa 5280 ctacttcaaa tgaggtcgga gaaggtcagt gttttattag cagccataaa accaggtgag 5340 cgagtaccat ttttctctac aagaaaaacg attctgagct ctgcgtaagt ataagttctc 5400 catagcggct gaagctcccc cctggctgcc tgccatctca gctggagtgc agtgccattt 5460 ccttggggtt tctctcacag cagtaatggg acaatacttc acaaaaattc tttcttttcc 5520 tgtcatgtgg gatccctact gtgccctcct ggttttacgt taccccctga ctgttccatt 5580 cagcggtttg gaaagagaaa aagaatttgg aaataaaaca tgtctacgtt atcacctcct 5640 ccagcatttt ggtttttaat tatgtcaata actggcttag atttggaaat gagagggggt 5700 tgggtgtatt accgaggaac aaaggaaggc ttatataaac tcaagtcttt tatttagaga 5760 actggcaagc tgtcaaaaac aaaaaggcct taccaccaaa ttaagtgaat agccgctata 5820 gccagcaggg ccagcacgag ggatggtgca ctgctggcac tatgccacgg cctgcttgtg 5880 actctgagag caactgcttt ggaaatgaca gcacttggtg caatttcctt tgtttcagaa 5940 tgcgtagagc gtgtgcttgg cgacagtttt tctagttagg ccacttcttt tttccttctc 6000 tcctcattct cctaagcatg tctccatgct ggtaatccca gtcaagtgaa cgttcaaaca 6060 atgaatccat cactgtagga ttctcgtggt gatcaaatct ttgtgtgagg tctataaaat 6120 atggaagctt atttattttt cgttcttcca tatcagtctt ctctatgaca attcacatcc 6180 accacagcaa attaaaggtg aaggaggctg gtgggatgaa gagggtcttc tagctttacg 6240 ttcttccttg caaggccaca ggaaaatgct gagagctgta gaatacagcc tggggtaaga 6300 agttcagtct cctgctggga cagctaaccg catcttataa ccccttctga gactcatctt 6360 aggaccaaat agggtctatc tggggttttt gttcctgctg ttcctcctgg aaggctatct 6420 cactatttca ctgctcccac ggttacaaac caaagataca gcctgaattt tttctaggcc 6480 acattacata aatttgacct ggtaccaata ttgttctcta tatagttatt tccttcccca 6540 ctgtgtttaa ccccttaagg cattcagaac aactagaatc atagaatggt ttggattgga 6600 aggggcctta aacatcatcc atttccaacc ctctgccatg ggctgcttgc cacccactgg 6660 ctcaggctgc ccagggcccc atccagcctg gccttgagca cctccaggga tggggcaccc 6720 acagcttctc tgggcagcct gtgccaacac ctcaccactc tctgggtaaa gaattctctt 6780 ttaacatcta atctaaatct cttctctttt agtttaaagc cattcctctt tttcccgttg 6840 ctatctgtcc aagaaatgtg tattggtctc cctcctgctt ataagcagga agtactggaa 6900 ggctgcagtg aggtctcccc acagccttct cttctccagg ctgaacaagc ccagctcctt 6960 cagcctgtct tcgtaggaga tcatcttagt ggccctcctc tggacccatt ccaacagttc 7020 cacggctttc ttgtggagcc ccaggtctgg atgcagtact tcagatgggg ccttacaaag 7080 gcagagcaga tggggacaat cgcttacccc tccctgctgg ctgcccctgt tttgatgcag 7140 cccagggtac tgttggcctt tcaggctccc agaccccttg ctgatttgtg tcaagctttt 7200 catccaccag aacccacgct tcctggttaa tacttctgcc ctcacttctg taagcttgtt 7260 tcaggagact tccattcttt aggacagact gtgttacacc tacctgccct attcttgcat 7320 atatacattt cagttcatgt ttcctgtaac aggacagaat atgtattcct ctaacaaaaa 7380 tacatgcaga attcctagtg ccatctcagt agggttttca tggcagtatt agcacatagt 7440 caatttgctg caagtacctt ccaagctgcg gcctcccata aatcctgtat ttgggatcag 7500 ttaccttttg gggtaagctt ttgtatctgc agagaccctg ggggttctga tgtgcttcag 7560 ctctgctctg ttctgactgc accattttct agatcaccca gttgttcctg tacaacttcc 7620 ttgtcctcca tcctttccca gcttgtatct ttgacaaata caggcctatt tttgtgtttg 7680 cttcagcagc catttaattc ttcagtgtca tcttgttctg ttgatgccac tggaacagga 7740 ttttcagcag tcttgcaaag aacatctagc tgaaaacttt ctgccattca atattcttac 7800 cagttcttct tgtttgaggt gagccataaa ttactagaac ttcgtcactg acaagtttat 7860 gcattttatt acttctatta tgtacttact ttgacataac acagacacgc acatattttg 7920 ctgggatttc cacagtgtct ctgtgtcctt cacatggttt tactgtcata cttccgttat 7980 aaccttggca atctgcccag ctgcccatca caagaaaaga gattcctttt ttattacttc 8040 tcttcagcca ataaacaaaa tgtgagaagc ccaaacaaga acttgtgggg caggctgcca 8100 tcaagggaga gacagctgaa gggttgtgta gctcaataga attaagaaat aataaagctg 8160 tgtcagacag ttttgcctga tttatacagg cacgccccaa gccagagagg ctgtctgcca 8220 aggccacctt gcagtccttg gtttgtaaga taagtcatag gtaacttttc tggtgaattg 8280 cgtggagaat catgatggca gttcttgctg tttactatgg taagatgcta aaataggaga 8340 cagcaaagta acacttgctg ctgtaggtgc tctgctatcc agacagcgat ggcactcgca 8400 caccaagatg agggatgctc ccagctgacg gatgctgggg cagtaacagt gggtcccatg 8460 ctgcctgctc attagcatca cctcagccct caccagccca tcagaaggat catcccaagc 8520 tgaggaaagt tgctcatctt cttcacatca tcaaaccttt ggcctgactg atgcctcccg 8580 gatgcttaaa tgtggtcact gacatcttta tttttctatg atttcaagtc agaacctccg 8640 gatcaggagg gaacacatag tgggaatgta ccctcagctc caaggccaga tcttccttca 8700 atgatcatgc atgctactta ggaaggtgtg tgtgtgtgaa tgtagaattg cctttgttat 8760 tttttcttcc tgctgtcagg aacattttga ataccagaga aaaagaaaag tgctcttctt 8820 ggcatgggag gagttgtcac acttgcaaaa taaaggatgc agtcccaaat gttcataatc 8880 tcagggtctg aaggaggatc agaaactgtg tatacaattt caggcttctc tgaatgcagc 8940 ttttgaaagc tgttcctggc cgaggcagta ctagtcagaa ccctcggaaa caggaacaaa 9000 tgtcttcaag gtgcagcagg aggaaacacc ttgcccatca tgaaagtgaa taaccactgc 9060 cgctgaagga atccagctcc tgtttgagca ggtgctgcac actcccacac tgaaacaaca 9120 gttcattttt ataggacttc caggaaggat cttcttctta agcttcttaa ttatggtaca 9180 tctccagttg gcagatgact atgactactg acaggagaat gaggaactag ctgggaatat 9240 ttctgtttga ccaccatgga gtcacccatt tctttactgg tatttggaaa taataattct 9300 gaattgcaaa gcaggagtta gcgaagatct tcatttcttc catgttggtg acagcacagt 9360 tctggctatg aaagtctgct tacaaggaag aggataaaaa tcatagggat aataaatcta 9420 agtttgaaga caatgaggtt ttagctgcat ttgacatgaa gaaattgaga cctctactgg 9480 atagctatgg tatttacgtg tctttttgct tagttactta ttgaccccag ctgaggtcaa 9540 gtatgaactc aggtctctcg ggctactggc atggattgat tacatacaac tgtaatttta 9600 gcagtgattt agggtttatg agtacttttg cagtaaatca tagggttagt aatgttaatc 9660 tcagggaaaa aaaaaaaaag ccaaccctga cagacatccc agctcaggtg gaaatcaagg 9720 atcacagctc agtgcggtcc cagagaacac agggactctt ctcttaggac ctttatgtac 9780 agggcctcaa gataactgat gttagtcaga agactttcca ttctggccac agttcagctg 9840 aggcaatcct ggaattttct ctccgctgca cagttccagt catcccagtt tgtacagttc 9900 tggcactttt tgggtcaggc cgtgatccaa ggagcagaag ttccagctat ggtcagggag 9960 tgcctgaccg tcccaactca ctgcactcaa acaaaggcga aaccacaaga gtggcttttg 10020 ttgaaattgc agtgtggccc agaggggctg caccagtact ggattgacca cgaggcaaca 10080 ttaatcctca gcaagtgcaa tttgcagcca ttaaattgaa ctaactgata ctacaatgca 10140 atcagtatca acaagtggtt tggcttggaa gatggagtct aggggctcta caggagtagc 10200 tactctctaa tggagttgca ttttgaagca ggacactgtg aaaagctggc ctcctaaaga 10260 ggctgctaaa cattagggtc aattttccag tgcactttct gaagtgtctg cagttcccca 10320 tgcaaagctg cccaaacata gcacttccaa ttgaatacaa ttatatgcag gcgtactgct 10380 tcttgccagc actgtccttc tcaaatgaac tcaacaaaca atttcaaagt ctagtagaaa 10440 gtaacaagct ttgaatgtca ttaaaaagta tatctgcttt cagtagttca gcttatttat 10500 gcccactaga aacatcttgt acaagctgaa cactggggct ccagattagt ggtaaaacct 10560 actttataca atcatagaat catagaatgg cctgggttgg aagggacccc aaggatcatg 10620 aagatccaac acccccgcca caggcagggc caccaacctc cagatctggt actagaccag 10680 gcagcccagg gctccatcca acctggccat gaacacctcc agggatggag catccacaac 10740 ctctctgggc agcctgtgcc agcacctcac caccctctct gtgaagaact tttccctgac 10800 atccaatcta agccttccct ccttgaggtt agatccactc ccccttgtgc tatcactgtc 10860 tactcttgta aaaagttgat tctcctcctt tttggaaggt tgcaatgagg tctccttgca 10920 gccttcttct cttctgcagg atgaacaagc ccagctccct cagcctgtct ttataggaga 10980 ggtgctccag ccctctgatc atctttgtgg ccctcctctg gacccgctcc aagagctcca 11040 catctttcct gtactggggg ccccaggcct gaatgcagta ctccagatgg ggcctcaaaa 11100 gagcagagta aagagggaca atcaccttcc tcaccctgct ggccagccct cttctgatgg 11160 agccctggat acaactggct ttctgagctg caacttctcc ttatcagttc cactattaaa 11220 acaggaacaa tacaacaggt gctgatggcc agtgcagagt ttttcacact tcttcatttc 11280 ggtagatctt agatgaggaa cgttgaagtt gtgcttctgc gtgtgcttct tcctcctcaa 11340 atactcctgc ctgatacctc accccacctg ccactgaatg gctccatggc cccctgcagc 11400 cagggccctg atgaacccgg cactgcttca gatgctgttt aatagcacag tatgaccaag 11460 ttgcacctat gaatacacaa acaatgtgtt gcatccttca gcacttgaga agaagagcca 11520 aatttgcatt gtcaggaaat ggtttagtaa ttctgccaat taaaacttgt ttatctacca 11580 tggctgtttt tatggctgtt agtagtggta cactgatgat gaacaatggc tatgcagtaa 11640 aatcaagact gtagatattg caacagacta taaaattcct ctgtggctta gccaatgtgg 11700 tacttcccac attgtataag aaatttggca agtttagagc aatgtttgaa gtgttgggaa 11760 atttctgtat actcaagagg gcgtttttga caactgtaga acagaggaat caaaaggggg 11820 tgggaggaag ttaaaagaag aggcaggtgc aagagagctt gcagtcccgc tgtgtgtacg 11880 acactggcaa catgaggtct ttgctaatct tggtgctttg cttcctgccc ctggctgcct 11940 taggg 11945 13 29 DNA Artificial Sequence BAC 26 Primer-1 13 gcggaattca aagaagaaag ctgaaaaac 29 14 29 DNA Artificial Sequence BAC 26 Primer-2 14 gcgggtacct tcaaatacta caagtgaaa 29 15 33 DNA Artificial Sequence BAC 26-OV Primer 1 15 ggcctcgagt caagttctga gtaggtttta gtg 33 16 41 DNA Artificial Sequence BAC 26-OV Primer 2 16 gcgcgtctct gtctagagca aacagcagaa cagtgaaaat g 41 17 50 DNA Artificial Sequence CTLA-4-Fc Primer 1 17 gcgcgtctca agacaactca gagttcacca tgggtgtact gctcacacag 50 18 29 DNA Artificial Sequence CTLA-4-Fc Primer 2 18 ggcccgggag ttttgtcaga agatttggg 29 19 11868 DNA Artificial Sequence pSIN-OV-3.5-I-CTLA4-inv Vector 19 aattgctaga ctaggatccc ccgtgctgca gaaccgagcg gctattgact tcttgctcct 60 agctcacggc catggctgtg aggacattgc gggaatgtgt tgtttcaatc tgagtgatca 120 cagtgagtct atacagaaga agttccagct aatgaaggaa catgtcaata agatcggcgt 180 gaacaacgac ccaatcggaa gttggctgcg aggattattc ggaggaatag gagaatgggc 240 cgtacacttg ctgaaaggac tgcttttggg gcttgtagtt atcttgttgc tagtagtatg 300 cttgccttgc cttttgcaat gtgtatctag tagtattcga aagatgattg ataattcact 360 cggctatcgc gaggaatata aaaaaattac aggaggctta taagcagccc gaaagaagag 420 cgtaggcgag ttcttgtatt ccgtgtgata gctggttgga ttggtaattg atcggctggc 480 acgcggaata taggaggtcg ctgaatagta aacttgtaga cttggctaca gcatagagta 540 tcttctgtag ctctgatgac tgctaggaaa taatgctacg gataatgtgg ggagggcaag 600 gcttgcgaat cgggttgtaa cgggcaaggc ttgactgagg ggacaatagc atgtttaggc 660 gaaaagcggg gcttcggttg tacgcggtta ggagtcccct caggatatag tagtttcgct 720 tttgcatagg gagggggacg gattggacga accactgaat tccgcattgc agagatattg 780 tatttaagtg cctagctcga tacaataaac gccatttgac cattcaccac attggtgtgc 840 acctgggttg atggccggac cgttgattcc ctgrcgacta cgagcacatg catgaagcag 900 aaggcttcat ttggtgaccc cgacgtgatc gttagggaat acgcgctcac tggccgtcgt 960 tttacaacgt cgtgactggg aaaaccctgg cgttacccaa cttaatcgcc ttgcagcaca 1020 tccccctttc gccagctggc gtaatagcga agaggcccgc accgatcgcc cttcccaaca 1080 gttgcgcagc ctgaatggcg aatggaaatt gtaagcgtta atattttgtt aaaattcgcg 1140 ttaaattttt gttaaatcag ctcatttttt aaccaatagg ccgaaatcgg caaaatccct 1200 tataaatcaa aagaatagac cgagataggg ttgagtgttg ttccagtttg gaacaagagt 1260 ccactattaa agaacgtgga ctccaacgtc aaagggcgaa aaaccgtcta tcagggcgat 1320 ggcccactac gtgaaccatc accctaatca agttttttgg ggtcgaggtg ccgtaaagca 1380 ctaaatcgga accctaaagg gagcccccga tttagagctt gacggggaaa gccggcgaac 1440 gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg ctagggcgct ggcaagtgta 1500 gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta atgcgccgct acagggcgcg 1560 tcaggtggca cttttcgggg aaatgtgcgc ggaaccccta tttgtttatt tttctaaata 1620 cattcaaata tgtatccgct catgagacaa taaccctgat aaatgcttca ataatattga 1680 aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc ttattccctt ttttgcggca 1740 ttttgccttc ctgtttttgc tcacccagaa acgctggtga aagtaaaaga tgctgaagat 1800 cagttgggtg cacgagtggg ttacatcgaa ctggatctca acagcggtaa gatccttgag 1860 agttttcgcc ccgaagaacg ttttccaatg atgagcactt ttaaagttct gctatgtggc 1920 gcggtattat cccgtattga cgccgggcaa gagcaactcg gtcgccgcat acactattct 1980 cagaatgact tggttgagta ctcaccagtc acagaaaagc atcttacgga tggcatgaca 2040 gtaagagaat tatgcagtgc tgccataacc atgagtgata acactgcggc caacttactt 2100 ctgacaacga tcggaggacc gaaggagcta accgcttttt tgcacaacat gggggatcat 2160 gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt 2220 gacaccacga tgcctgtagc aatggcaaca acgttgcgca aactattaac tggcgaacta 2280 cttactctag cttcccggca acaattaata gactggatgg aggcggataa agttgcagga 2340 ccacttctgc gctcggccct tccggctggc tggtttattg ctgataaatc tggagccggt 2400 gagcgtgggt ctcgcggtat cattgcagca ctggggccag atggtaagcc ctcccgtatc 2460 gtagttatct acacgacggg gagtcaggca actatggatg aacgaaatag acagatcgct 2520 gagataggtg cctcactgat taagcattgg taactgtcag accaagttta ctcatatata 2580 ctttagattg atttaaaact tcatttttaa tttaaaagga tctaggtgaa gatccttttt 2640 gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc 2700 gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg 2760 caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact 2820 ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt ccttctagtg 2880 tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg 2940 ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac 3000 tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca 3060 cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga 3120 gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc 3180 ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct 3240 gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg 3300 agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct 3360 tttgctcaca tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc 3420 tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc 3480 gaggaagcgg aagagcgccc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat 3540 taatgcagct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt 3600 aatgtgagtt agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt 3660 atgttgtgtg gaattgtgag cggataacaa tttcacacag gaaacagcta tgaccatgat 3720 tacgccaagc gcgcattggt aattgatcgg ctggcacgcg gaatatagga ggtcgctgaa 3780 tagtaaactt gtagacttgg ctacagcata gagtatcttc tgtagctctg atgactgcta 3840 ggaaataatg ctacggataa tgtggggagg gcaaggcttg cgaatcgggt tgtaacgggc 3900 aaggcttgac tgaggggaca atagcatgtt taggcgaaaa gcggggcttc ggttgtacgc 3960 ggttaggagt cccctcagga tatagtagtt tcgcttttgc atagggaggg ggaaatgtag 4020 tcttatgcaa tactcttgta gtcttgcaac atgcttatgt aacgatgagt tagcaacatg 4080 ccttataagg agagaaaaag caccgtgcat gccgattggt gggagtaagg tggtatgatc 4140 gtggtatgat cgtgccttgt taggaaggca acagacgggt ctaacacgga ttggacgaac 4200 cactgaattc cgcattgcag agatattgta tttaagtgcc tagctcgata caataaacgc 4260 catttgacca ttcaccacat tggtgtgcac ctgggttgat ggccggaccg ttgattccct 4320 grcgactacg agcacatgca tgaagcagaa ggcttcattt ggtgaccccg acgtgatcgt 4380 tagggaatag tggtcggcca caggcggcgt ggcgatcctg tcctcatccg tctcgcttat 4440 tcggggagcg gacgatgacc ctagtagagg gggctgcggc ttaggagggc agaagctgag 4500 tggcgtcgga gggagcccta ctgcaggggg ccaacatacc ctaccgagaa ctcagagagt 4560 cgttggaaga cgggaaggaa gcccgacgac tgagcggtcc accccaggcg tgattccggt 4620 tgctctgcgt gattccggtc gcccggtgga tcaagcatgg aagccgtcat aaaggtgatt 4680 tcgtccgcgt gtaagaccta ttgcgggaaa acctctcctt ctaagaagga aataggggct 4740 atgttgtccc tgttacaaaa ggaagggttg cttacgtccc cctcagactt atattccccg 4800 gggtcctggg atcccattac cgcggcgctc tctcagcggg ctatggtact tggaaaatcg 4860 ggagagttaa aaacctgggg attggttttg ggggcattga aggcggctcg agatccggta 4920 ccttcaaata ctacaagtga aaagtgtttg cttaaacatg tttttattat gattaaagga 4980 acaaaagagc acattcacaa gacccattac atatgggtac aaggaaaaca atttgaatag 5040 taatatacca tatttgccaa cataccatga ttgagtcaaa gtttagggag aaatgtgaat 5100 tataagattt ttataatgca tctttaggaa gtcaggaaga gccttgtagt atcaggaaca 5160 cagagaacaa gcaattgcct tgtcagcata ggaatggttg gtgacagttg ataatttaat 5220 ctgagagatt ttgagtgact aattctggag cagcttggtc atacagatat ctggcttaat 5280 tggaaggctg catttttccc ccataaacct tctgctgatg tatcaggttg catttttcag 5340 tgtgatgact cagtactgtg agtccaattt cattccctta agccttcatc catgagttac 5400 cagtattact ctgtgtaaag gaaaagtgaa ttgcacctgt tctcacagtg taatttcttt 5460 ctgatttttt ttctagatta agctccagct tttatgaagt ctggatgcag cagataacat 5520 acttttcatt ttacccctga tactacagtg ctctgggtct tgttggaagg gacagagttt 5580 ttcagctttc ttctttgaat tcctcattta cccggagaca gggagaggct cttctgcgtg 5640 tagtggttgt gcagagcctc atgcatcacg gagcatgaga agacgttccc ctgctgccac 5700 ctgctcttgt ccacggtgag cttgctgtag aggaagaagg agccgtcgga gtccagcacg 5760 ggaggcgtgg tcttgtagtt gttctccggc tgcccattgc tctcccactc cacggcgatg 5820 tcgctgggat agaagccttt gaccaggcag gtcaggctga cctggttctt ggtcagctca 5880 tcccgggatg ggggcagggt gtacacctgt ggttctcggg gctgcccttt ggctttggag 5940 atggttttct cgatgggggc tgggagggct ttgttggaga ccttgcactt gtactccttg 6000 ccattcagcc agtcctggtg caggacggtg aggacgctga ccacccggta cgtgctgttg 6060 tactgctcct cccgcggctt tgtcttggca ttatgcacct ccacgccgtc cacgtaccag 6120 ttgaacttga cctcagggtc ttcgtggctc acgtccacca ccacgcatgt gacctcaggg 6180 gtccgggaga tcatgagggt gtccttgggt tttgggggga agaggaagac tgacgatccc 6240 cccaggagtt caggtgctgg ggacggtggg gatgtgtgag ttttgtcaga agatttgggc 6300 tcctgatcag aatctgggca cggttctgga tcaattacat aaatctgggt tccgttgcct 6360 atgcccaggt agtatggcgg tgggtacatg agctccacct tgcagatgta gagtcccgtg 6420 tccatggccc tcagtccttg gatagtgagg ttcacttgat ttccactgga ggtgcccgtg 6480 cagatggaat catctaggaa ggtcaactca ttccccatca tgtaggttgc cgcacagact 6540 tcagtcacct ggctgtcagc ctgccgaagc actgtcaccc ggacctcagt ggctttgcct 6600 ggagatgcat

actcacacac aaagctrgcg atgcctcggc tgctggccag taccacagca 6660 ggctgggcca cgtgcattgc catgctcgcc atgcttggaa acaggagtgc aaggaccaga 6720 ctgagcagcg tcctctgtgt gagcagtaca cccatggtga actctgagtt gtctagagca 6780 aacagcagaa cagtgaaaat gtaaggatgg aatgctgtac atagtaccat gcagggtact 6840 ctatggtagg ctacaacagt aaattacgag cagtttttag gcaattaaat gttaacaagt 6900 agttttaaag taattctgtg gtaatgtgtc tgttgctata tccacctctc atgtgcatgt 6960 tcaaaaccat attcataaat ctatttatgt atttgcattc agttgtcttt tgggtagcaa 7020 actgtcccag aagccagttg cctctacata tttttgttca gtgaaagcta gaattcattg 7080 atacttttca gtacctctga ttaaaacaca atctgatagg cttgcaaaac tggaaattca 7140 aagagcaaat ttcagtaaac tttaggtttg gacagatata tgagaaagca gaggcttgct 7200 gactatttta tttcttattt ttattcccta aaaataaatg tagagaaata tctgtttgtt 7260 gcacactact tgctatgagt agatcttcaa aagtattttt acctttgttt tggtgatggc 7320 agaatagata aggaatgtaa tttatatggg gtcatgtagt ctaggagaaa gacacgcatg 7380 taattcatat tctgctctat tgcactttca ggtatggttt gctttgctca aagatatgca 7440 tgtgtactgt agtataaact ttctgtggag ttaaatttta gtggtgacat tcagacagaa 7500 gagaaatgca gacatgataa aatagcaatg tttactataa aacagagcca ctgaatgaat 7560 tcttgttcat gacatagacc aatagaagat ttatacttgt tctgtctgtt tctattataa 7620 agagctgaac tgtacaacta ttgtatagcc agtgtgctta tataaagcac agcttttgga 7680 gccagcatga atctagttgc tttcctgaga tttatataat ctgtgaaagt cagaagtcct 7740 tcagagccca gccctttata tgcgtactga gtgctggggc ctcaggattg gattttctgt 7800 attaaacccc tcaaaagttt ttactgacca cgtgtgtgag tatacacaca cacatttttc 7860 tcattttctt ttctgtatat aagttcacat gtatctatta ttgtaagaat atacgtttat 7920 gcacccccca catttttatc ttgtgtagtg atcagcagct gcactttgca ggaattaaac 7980 ttctagagaa ttttcacatt aaaataactc cccagaattc actgaacacc atgattttgc 8040 tctctgtgca ctctgtaggg ctagaagtta atcaagcaaa ctgcaaagca tatcagatag 8100 tgaacgacag gataagatgt tctgaaatta aaaacatatt ttaagcacaa agaataagcc 8160 tcctgaaaac aaacacaaag cttttacaca taataaaata gtgcagaatg catacacagg 8220 tgagaagttt ttataggggg tatcacgcag gtacttcacc cttaaagata caacacatag 8280 cacaataatt gttaattttt taaagtttag gtgcaagtaa gagctaatat agagagaagg 8340 taattccaga gagttgctta cctttcgagc ttgactgcta aaggcaatac agctttctag 8400 ctgtatgtac agacactggc tgagccctgg ggaatatata gtctgaattg tgacccaccc 8460 acaggttccc ttcagaagtt tgacctttga caccatagaa atcatttaat gggattgggt 8520 tagattttag tttcaatagg tccattttgg attgaatgga gagcaaatat tagtttttaa 8580 ttctgggtaa caatgtgttt tctgcctgtt ctgctaatcc atcaggactg ttggatggga 8640 gagaagactg ggaaatattg ctcatgttcc attgagcttc agttacaacc agataatggg 8700 atctttaaga aaacagaaaa atgtgggaac cttggagatg gaaaacataa ttagcaatta 8760 ttagttagtg tgcttattac tatggttgta gtaacagacc agaagtctgt ttcatttgat 8820 ccttcttgta tgtacaatgt gcatctgagc cacgctagac aggacataaa tgagaacaag 8880 acttgaccta ttattttctt gacaaaatag gagaaataaa gaagcgtgca tgtgaaggag 8940 ccaactgaga ctagagtgaa gagcagacac actttctttc ctatagttgg aatatttaaa 9000 tctatctttt tatgggtgtg aatgctttat aacaaacttt tattctgagg atacagcaaa 9060 acatagctcc atacaatgca aaacaatact caatttcaaa tgtgtttatg atatgaactt 9120 gcagtgttcc tcaaagatct tccatgaata acttaatggc ctggcagatg acagaggaat 9180 tgtgaaattc agctggagga gtgttcatgg ttcgagggac aatcataata tacaatagca 9240 aatatatttc agttatagaa gctattgttc tgtattgaaa taatagaatt gacaaacagt 9300 aaagaaacca ttctgacctc tgtaaagcac tgtttgattt aaaaatgggg gaaaaaagta 9360 caacataatt cttcaggaca tacatagaga tcactgcaat ctctgttaag cagaattact 9420 ttcctatacc actagctgaa gtttagtcag tgccattttc ttttgtttct ctccttcctt 9480 ttgtgaaaac atatatactg tggaaatcta cattctcctt gccaagtctg aggacttaag 9540 acaagatggt agtgcaaata atattttttt gctggatgtc tacaccacag gtatcaactg 9600 attttttttg tttcattttg tttttaatca cgtcttttgc ttctatttca gccactaaga 9660 aagtctgaaa atcttgcctg ctttttgtga tgatagatgt gcttcccagt aaatgttatc 9720 tctacctatg aaatgcatgt cagtctgcag aaagagaaag gagattggga ataggttttc 9780 tcagatgcac ttctctgtca tctggtgtca atcaaacact aataatttgt gtatagatat 9840 cttatatata tatatatatt tggaatttgc aggttggcat agttcagata gtcctgtcac 9900 attgtaatat cctggtgaga taacaaggaa aagagagacc gtttcggctc ttactaaggc 9960 agggaactgc ttaccagaca gggaggttct ggagatgaca tccagcatga aaagcacact 10020 tccaaatact taaaggtatc aagtctaact tgtcagacag gctccagaat aacttctgtc 10080 ctaatgctac agaaaagggg gaaggtatcc accatggcca aaattgtcag ccattttgtc 10140 tcagcaaaca gcagatctgg tcagtaagga caagattctt ccaaagcaac catgccatat 10200 ataattaagc atgtgtaatt aattaataaa aaatataatt tagtgtattt cctcctttgg 10260 atgttatgaa gaaatgcttt tattaacaat tcaccataat ctgtcctaag agtagtgaat 10320 aacaacaggc tgcttctcac cctgtggttg ggtgtaccag tgagccagag ctaaacgcca 10380 cgtttcctct tttgtatccc atagcagaga gggtctccat ttcatttctg tagctcagaa 10440 agttgtagtg gatttacact acaagttgtg gtagtggagg tctgccggag tggcctctgt 10500 gaacagagcc cagcagctgt cccgtgtcct caaaagggag ctgccactgg ccagagctga 10560 gccagtgatc gatgctagat gtacctcagg aggagcaata tgtaagaaca actgctgtac 10620 aatggtagtt gggagaggtg agtgagaaaa tgtgagagaa acagccctga tgacactgag 10680 gtcagtgcgg aggagggcag gaggtgttcc aggtgtagaa cagaagttcc ctgcagccca 10740 agagaggccc atggtggagc actctgaccc tctgcagccc atggtatatc atataaacct 10800 cagttctgtg acattatttt aactccatat cccttttctg ttcagggtca ctttgagttc 10860 acagccattt ctttatattt ctccaatatc agccttccat tgctacatat gagacttgga 10920 cagtacatct gattcagtca aatctgcctt cagaacgtcc ctgaagccct tcttagacag 10980 tctcaattct ccttcccttc atctctttta tcatacatgg accacggacc tgtccagacc 11040 tgagtcatat gtccatcttt acgtccatct ctatgtcttg tactttaaga caaataaaat 11100 atcaaggaaa ttgatgcagt tatgtcagtt atcactgtca tagtatcgtg ctgcaaatat 11160 aagatgagaa tgatcccaaa ggctttttaa agctgctcta tttgacttcc acatagtgtc 11220 ctgattccag acctacagaa cagttttgta tgcatttgac ttgcagagct ttgttttgtg 11280 agtcttataa aagccatttt tcctctccaa gaagtagccg gtggtttaaa acaatgtaga 11340 ttaagtgtgg agcatgagaa tttctgcttt tctgtcagat gagaaggata tactacactc 11400 tttcccaatg gaagaccagc tgcaagcaac aaaaattgtc catgaacaaa tgagatcttg 11460 atcagaacag gctgtcatca tagtgttgtc agcatacctg catagttggt ttgacttggg 11520 ggtctagaga gagtaagcaa caatcttctt gcagttggaa ggttacctgg gataggtggc 11580 aatggattgc cctgcccagc acagctgtgc aaagcagtac aaatagtttt gtcacacatt 11640 gtttgacaat gcttgtccca agaaaaggtc agctaaggct ctgctgccct ttcctatgcc 11700 aggcatttca ttgtgggtct gtccctaaac caacagtctc atgaataaag actcggagac 11760 ctgaaagtta taaaagcact ttttatccaa aaggatatga agtccaggtg agctcacagg 11820 tcaaagcctc ttatccaatc actaaaacct actcagaact tgactcga 11868 20 10021 DNA Artificial Sequence pSIN-3.9-OM-CTLA4-Fc Vector 20 ctagactagg atcccccgtg ctgcagaacc gagcggctat tgacttcttg ctcctagctc 60 acggccatgg ctgtgaggac attgcgggaa tgtgttgttt caatctgagt gatcacagtg 120 agtctataca gaagaagttc cagctaatga aggaacatgt caataagatc ggcgtgaaca 180 acgacccaat cggaagttgg ctgcgaggat tattcggagg aataggagaa tgggccgtac 240 acttgctgaa aggactgctt ttggggcttg tagttatctt gttgctagta gtatgcttgc 300 cttgcctttt gcaatgtgta tctagtagta ttcgaaagat gattgataat tcactcggct 360 atcgcgagga atataaaaaa attacaggag gcttataagc agcccgaaag aagagcgtag 420 gcgagttctt gtattccgtg tgatagctgg ttggattggt aattgatcgg ctggcacgcg 480 gaatatagga ggtcgctgaa tagtaaactt gtagacttgg ctacagcata gagtatcttc 540 tgtagctctg atgactgcta ggaaataatg ctacggataa tgtggggagg gcaaggcttg 600 cgaatcgggt tgtaacgggc aaggcttgac tgaggggaca atagcatgtt taggcgaaaa 660 gcggggcttc ggttgtacgc ggttaggagt cccctcagga tatagtagtt tcgcttttgc 720 atagggaggg ggacggattg gacgaaccac tgaattccgc attgcagaga tattgtattt 780 aagtgcctag ctcgatacaa taaacgccat ttgaccattc accacattgg tgtgcacctg 840 ggttgatggc cggaccgttg attccctgrc gactacgagc acatgcatga agcagaaggc 900 ttcatttggt gaccccgacg tgatcgttag ggaatacgcg ctcactggcc gtcgttttac 960 aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc 1020 ctttcgccag ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc 1080 gcagcctgaa tggcgaatgg aaattgtaag cgttaatatt ttgttaaaat tcgcgttaaa 1140 tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa tcccttataa 1200 atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttggaaca agagtccact 1260 attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc 1320 actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta aagcactaaa 1380 tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg cgaacgtggc 1440 gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt 1500 cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg gcgcgtcagg 1560 tggcactttt cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc 1620 aaatatgtat ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag 1680 gaagagtatg agtattcaac atttccgtgt cgcccttatt cccttttttg cggcattttg 1740 ccttcctgtt tttgctcacc cagaaacgct ggtgaaagta aaagatgctg aagatcagtt 1800 gggtgcacga gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt 1860 tcgccccgaa gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt 1920 attatcccgt attgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa 1980 tgacttggtt gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag 2040 agaattatgc agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac 2100 aacgatcgga ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac 2160 tcgccttgat cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac 2220 cacgatgcct gtagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac 2280 tctagcttcc cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact 2340 tctgcgctcg gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg 2400 tgggtctcgc ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt 2460 tatctacacg acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat 2520 aggtgcctca ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta 2580 gattgattta aaacttcatt tttaatttaa aaggatctag gtgaagatcc tttttgataa 2640 tctcatgacc aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga 2700 aaagatcaaa ggatcttctt gagatccttt ttttctgcgc gtaatctgct gcttgcaaac 2760 aaaaaaacca ccgctaccag cggtggtttg tttgccggat caagagctac caactctttt 2820 tccgaaggta actggcttca gcagagcgca gataccaaat actgtccttc tagtgtagcc 2880 gtagttaggc caccacttca agaactctgt agcaccgcct acatacctcg ctctgctaat 2940 cctgttacca gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag 3000 acgatagtta ccggataagg cgcagcggtc gggctgaacg gggggttcgt gcacacagcc 3060 cagcttggag cgaacgacct acaccgaact gagataccta cagcgtgagc tatgagaaag 3120 cgccacgctt cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac 3180 aggagagcgc acgagggagc ttccaggggg aaacgcctgg tatctttata gtcctgtcgg 3240 gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct 3300 atggaaaaac gccagcaacg cggccttttt acggttcctg gccttttgct ggccttttgc 3360 tcacatgttc tttcctgcgt tatcccctga ttctgtggat aaccgtatta ccgcctttga 3420 gtgagctgat accgctcgcc gcagccgaac gaccgagcgc agcgagtcag tgagcgagga 3480 agcggaagag cgcccaatac gcaaaccgcc tctccccgcg cgttggccga ttcattaatg 3540 cagctggcac gacaggtttc ccgactggaa agcgggcagt gagcgcaacg caattaatgt 3600 gagttagctc actcattagg caccccaggc tttacacttt atgcttccgg ctcgtatgtt 3660 gtgtggaatt gtgagcggat aacaatttca cacaggaaac agctatgacc atgattacgc 3720 caagcgcgca ttggtaattg atcggctggc acgcggaata taggaggtcg ctgaatagta 3780 aacttgtaga cttggctaca gcatagagta tcttctgtag ctctgatgac tgctaggaaa 3840 taatgctacg gataatgtgg ggagggcaag gcttgcgaat cgggttgtaa cgggcaaggc 3900 ttgactgagg ggacaatagc atgtttaggc gaaaagcggg gcttcggttg tacgcggtta 3960 ggagtcccct caggatatag tagtttcgct tttgcatagg gagggggaaa tgtagtctta 4020 tgcaatactc ttgtagtctt gcaacatgct tatgtaacga tgagttagca acatgcctta 4080 taaggagaga aaaagcaccg tgcatgccga ttggtgggag taaggtggta tgatcgtggt 4140 atgatcgtgc cttgttagga aggcaacaga cgggtctaac acggattgga cgaaccactg 4200 aattccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgccattt 4260 gaccattcac cacattggtg tgcacctggg ttgatggccg gaccgttgat tccctgrcga 4320 ctacgagcac atgcatgaag cagaaggctt catttggtga ccccgacgtg atcgttaggg 4380 aatagtggtc ggccacaggc ggcgtggcga tcctgtcctc atccgtctcg cttattcggg 4440 gagcggacga tgaccctagt agagggggct gcggcttagg agggcagaag ctgagtggcg 4500 tcggagggag ccctactgca gggggccaac ataccctacc gagaactcag agagtcgttg 4560 gaagacggga aggaagcccg acgactgagc ggtccacccc aggcgtgatt ccggttgctc 4620 tgcgtgattc cggtcgcccg gtggatcaag catggaagcc gtcataaagg tgatttcgtc 4680 cgcgtgtaag acctattgcg ggaaaacctc tccttctaag aaggaaatag gggctatgtt 4740 gtccctgtta caaaaggaag ggttgcttac gtccccctca gacttatatt ccccggggtc 4800 ctgggatccc attaccgcgg cgctctctca gcgggctatg gtacttggaa aatcgggaga 4860 gttaaaaacc tggggattgg ttttgggggc attgaaggcg gctcgaggtc gacggtatcg 4920 ataagcttgc agtccaaggc tttgtctgtg tacccagtga aatccttcct ctgttacata 4980 aagcccagat aggactcaga aatgtagtca ttccagcccc cctcttcctc agatctggag 5040 cagcacttgt ttgcagccag tcctccccaa aatgcacaga cctcgccgag tggagggaga 5100 tgtaaacagc gaaggttaat tacctccttg tcaaaaacac tttgtggtcc atagatgttt 5160 ctgtcaatct tacaaaacag aaccgagagg cagcgagcac tgaagagcgt gttcccatgc 5220 tgagttaatg agacttggca gctcgctgtg cagagatgat ccctgtgctt catgggaggc 5280 tgtaacctgt ctccccatcg ccttcacacc gcagtgctgt cctggacacc tcaccctcca 5340 taagctgtag gatgcagctg cccagggatc aagagacttt tcctaaggct cttaggactc 5400 atctttgccg ctcagtagcg tgcagcaatt actcatccca actatactga atgggtttct 5460 gccagctctg cttgtttgtc aataagcatt tcttcatttt gcctctaagt ttctctcagc 5520 agcaccgctc tgggtgacct gagtggccac ctggaacccg aggggcacag ccaccacctc 5580 cctgttgctg ctgctccagg gactcatgtg ctgctggatg gggggaagca tgaagttcct 5640 cacccagaca cctgggttgc aatggctgca gcgtgctctt cttggtatgc agattgtttc 5700 cagccattac ttgtagaaat gtgctgtgga agccctttgt atctctttct gtggcccttc 5760 agcaaaagct gtgggaaagc tctgaggctg ctttcttggg tcgtggagga attgtatgtt 5820 ccttctttaa caaaaattat ccttaggaga gagcactgtg caagcattgt gcacataaaa 5880 caattcaggt tgaaagggct ctctggaggt ttccagcctg actactgctc gaagcaaggc 5940 caggttcaaa gatggctcag gatgctgtgt gccttcctga ttatctgtgc caccaatgga 6000 ggagattcac agccactctg cttcccgtgc cactcatgga gaggaatatt cccttatatt 6060 cagatagaat gttatccttt agctcagcct tccctataac cccatgaggg agctgcagat 6120 ccccatactc tccccttctc tggggtgaag gccgtgtccc ccagcccccc ttcccaccct 6180 gtgccctaag cagcccgctg gcctctgctg gatgtgtgcc tatatgtcaa tgcctgtcct 6240 tgcagtccag cctgggacat ttaattcatc accagggtaa tgtggaactg tgtcatcttc 6300 ccctgcaggg tacaaagttc tgcacggggt cctttcggtt caggaaaacc ttcactggtg 6360 ctacctgaat caagctctat ttaataagtt cataagcaca tggatgtgtt ttcctagaga 6420 tacgttttaa tggtatcagt gatttttatt tgctttgttg cttacttcaa acagtgcctt 6480 tgggcaggag gtgagggacg ggtctgccgt tggctctgca gtgatttctc caggcgtgtg 6540 gctcaggtca gatagtggtc actctgtggc cagaagaagg acaaagatgg aaattgcaga 6600 ttgagtcacg ttaagcaggc atcttggagt gatttgaggc agtttcatga aagagctacg 6660 accacttatt gttgttttcc ccttttacaa cagaagtttt catcaaaata acgtggcaaa 6720 gcccaggaat gtttgggaaa agtgtagtta aatgttttgt aattcatttg tcggagtgct 6780 accagctaag aaaaaagtcc tacctttggt atggtagtcc tgcagagaat acaacatcaa 6840 tattagtttg gaaaaaaaca ccaccaccac cagaaactgt aatggaaaat gtaaaccaag 6900 aaattccttg ggtaagagag aaaggatgtc gtatactggc caagtcctgc ccagctgtca 6960 gcctgctgac cctctgcagt tcaggaccat gaaacgtggc actgtaagac gtgtcccctg 7020 cctttgcttg cccacagatc tctgcccttg tgctgactcc tgcacacaag agcatttccc 7080 tgtagccaaa cagcgattag ccataagctg cacctgactt tgaggattaa gagtttgcaa 7140 ttaagtggat tgcagcagga gatcagtggc agggttgcag atgaaatcct tttctagggg 7200 tagctaaggg ctgagcaacc tgtcctacag cacaagccaa accagccaag ggttttcctg 7260 tgctgttcac agaggcaggg ccagctggag ctggaggagg ttgtgctggg acccttctcc 7320 ctgtgctgag aatggagtga tttctgggtg ctgttcctgt ggcttgcact gagcagctca 7380 agggagatcg gtgctcctca tgcagtgcca aaactcgtgt ttgatgcaga aagatggatg 7440 tgcacctccc tcctgctaat gcagccgtga gcttatgaag gcaatgagcc ctcagtgcag 7500 caggagctgt agtgcactcc tgtaggtgct agggaaaatc tctggttccc agggatgcat 7560 tcataagggc aatatatctt gaggctgcgc caaatctttc tgaaatattc atgcgtgttc 7620 ccttaattta tagaaacaaa cacagcagaa taattattcc aatgcctccc ctcgaaggaa 7680 acccatattt ccatgtagaa atgtaaccta tatacacaca gccatgctgc atccttcaga 7740 acgtgccagt gctcatctcc catggcaaaa tactacaggt attctcacta tgttggacct 7800 gtgaaaggaa ccatggtaag aaacttcggt taaaggtatg gctgcaaaac tactcatacc 7860 aaaacagcag agctccagac ctcctcttag gaaagagcca cttggagagg gatggtgtga 7920 aggctggagg tgagagacag agcctgtccc agttttcctg tctctatttt ctgaaacgtt 7980 tgcaggagga aaggacaact gtactttcag gcatagctgg tgccctcacg taaataagtt 8040 ccccgaactt ctgtgtcatt tgttcttaag atgctttggc agaacacttt gagtcaattc 8100 gcttaactgt gactaggtct gtaaataagt gctccctgct gataaggttc aagtgacatt 8160 tttagtggta tttgacagca tttaccttgc tttcaagtct tctaccaagc tcttctatac 8220 ttaagcagtg aaaccgccaa gaaacccttc cttttatcaa gctagtgcta aataccatta 8280 acttcatagg ttagatacgg tgctgccagc ttcacctggc agtggttggt cagttctgct 8340 ggtgacaaag cctccctggc ctgtgctttt acctagaggt gaatatccaa gaatgcagaa 8400 ctgcatggaa agcagagctg caggcacgat ggtgctgagc cttagctgct tcctgctggg 8460 agatgtggat gcagagacga atgaaggacc tgtcccttac tcccctcagc attctgtgct 8520 atttagggtt ctaccagagt ccttaagagg tttttttttt ttttggtcca aaagtctgtt 8580 tgtttggttt tgaccactga gagcatgtga cacttgtctc aagctattaa ccaagtgtcc 8640 agccaaaatc aattgcctgg gagacgcaga ccattacctg gaggtcagga cctcaataaa 8700 tattaccagc ctcattgtgc cgctgacaga ttcagctggc tgctccgtgt tccagtccaa 8760 cagttcggac gccacgtttg tatatatttg caggcagcct cggggggacc atctcaggag 8820 cagagcaccg gcagccgcct gcagagccgg gcagtacctc aacatgggtg tactgctcac 8880 acagaggacg ctgctcagtc tggtccttgc actcctgttt ccaagcatgg cgagcatggc 8940 aatgcacgtg gcccagcctg ctgtggtact ggccagcagc cgaggcatcg cyagctttgt 9000 gtgtgagtat gcatctccag gcaaagccac tgaggtccgg gtgacagtgc ttcggcaggc 9060 tgacagccag gtgactgaag tctgtgcggc aacctacatg atggggaatg agttgacctt 9120 cctagatgat tccatctgca cgggcacctc cagtggaaat caagtgaacc tcactatcca 9180 aggactgagg gccatggaca cgggactcta catctgcaag gtggagctca tgtacccacc 9240 gccatactac ctgggcatag gcaacggaac ccagatttat gtaattgatc cagaaccgtg 9300 cccagattct gatcaggagc ccaaatcttc tgacaaaact cacacatccc caccgtcccc 9360 agcacctgaa ctcctggggg gatcgtcagt cttcctcttc cccccaaaac ccaaggacac 9420 cctcatgatc tcccggaccc ctgaggtcac atgcgtggtg gtggacgtga gccacgaaga 9480 ccctgaggtc aagttcaact ggtacgtgga cggcgtggag gtgcataatg ccaagacaaa 9540 gccgcgggag gagcagtaca acagcacgta ccgggtggtc agcgtcctca ccgtcctgca 9600 ccaggactgg ctgaatggca aggagtacaa gtgcaaggtc tccaacaaag ccctcccagc 9660 ccccatcgag aaaaccatct ccaaagccaa agggcagccc cgagaaccac aggtgtacac 9720 cctgccccca

tcccgggatg agctgaccaa gaaccaggtc agcctgacct gcctggtcaa 9780 aggcttctat cccagcgaca tcgccgtgga gtgggagagc aatgggcagc cggagaacaa 9840 ctacaagacc acgcctcccg tgctggactc cgacggctcc ttcttcctct acagcaagct 9900 caccgtggac aagagcaggt ggcagcaggg gaacgtcttc tcatgctccg tgatgcatga 9960 ggctctgcac aaccactaca cgcagaagag cctctccctg tctccgggta aatgaggaat 10020 t 10021 21 7350 DNA Artificial Sequence pSIN-1.8-OM-IFNa-2B Vector 21 tcgagatcaa ttgctagact aggatccccc gtgctgcaga accgagcggc tattgacttc 60 ttgctcctag ctcacggcca tggctgtgag gacattgcgg gaatgtgttg tttcaatctg 120 agtgatcaca gtgagtctat acagaagaag ttccagctaa tgaaggaaca tgtcaataag 180 atcggcgtga acaacgaccc aatcggaagt tggctgcgag gattattcgg aggaatagga 240 gaatgggccg tacacttgct gaaaggactg cttttggggc ttgtagttat cttgttgcta 300 gtagtatgct tgccttgcct tttgcaatgt gtatctagta gtattcgaaa gatgattgat 360 aattcactcg gctatcgcga ggaatataaa aaaattacag gaggcttata agcagcccga 420 aagaagagcg taggcgagtt cttgtattcc gtgtgatagc tggttggatt ggtaattgat 480 cggctggcac gcggaatata ggaggtcgct gaatagtaaa cttgtagact tggctacagc 540 atagagtatc ttctgtagct ctgatgactg ctaggaaata atgctacgga taatgtgggg 600 agggcaaggc ttgcgaatcg ggttgtaacg ggcaaggctt gactgagggg acaatagcat 660 gtttaggcga aaagcggggc ttcggttgta cgcggttagg agtcccctca ggatatagta 720 gtttcgcttt tgcataggga gggggacgga ttggacgaac cactgaattc cgcattgcag 780 agatattgta tttaagtgcc tagctcgata caataaacgc catttgacca ttcaccacat 840 tggtgtgcac ctgggttgat ggccggaccg ttgattccct grcgactacg agcacatgca 900 tgaagcagaa ggcttcattt ggtgaccccg acgtgatcgt tagggaatac gcgctcactg 960 gccgtcgttt tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt 1020 gcagcacatc cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct 1080 tcccaacagt tgcgcagcct gaatggcgaa tggaaattgt aagcgttaat attttgttaa 1140 aattcgcgtt aaatttttgt taaatcagct cattttttaa ccaataggcc gaaatcggca 1200 aaatccctta taaatcaaaa gaatagaccg agatagggtt gagtgttgtt ccagtttgga 1260 acaagagtcc actattaaag aacgtggact ccaacgtcaa agggcgaaaa accgtctatc 1320 agggcgatgg cccactacgt gaaccatcac cctaatcaag ttttttgggg tcgaggtgcc 1380 gtaaagcact aaatcggaac cctaaaggga gcccccgatt tagagcttga cggggaaagc 1440 cggcgaacgt ggcgagaaag gaagggaaga aagcgaaagg agcgggcgct agggcgctgg 1500 caagtgtagc ggtcacgctg cgcgtaacca ccacacccgc cgcgcttaat gcgccgctac 1560 agggcgcgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 1620 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 1680 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 1740 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 1800 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 1860 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 1920 tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 1980 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 2040 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 2100 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 2160 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 2220 acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 2280 gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 2340 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 2400 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 2460 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 2520 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 2580 catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 2640 tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 2700 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 2760 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 2820 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc 2880 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 2940 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 3000 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 3060 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 3120 agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 3180 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 3240 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 3300 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 3360 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 3420 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 3480 cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 3540 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 3600 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 3660 cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 3720 accatgatta cgccaagcgc gcattggtaa ttgatcggct ggcacgcgga atataggagg 3780 tcgctgaata gtaaacttgt agacttggct acagcataga gtatcttctg tagctctgat 3840 gactgctagg aaataatgct acggataatg tggggagggc aaggcttgcg aatcgggttg 3900 taacgggcaa ggcttgactg aggggacaat agcatgttta ggcgaaaagc ggggcttcgg 3960 ttgtacgcgg ttaggagtcc cctcaggata tagtagtttc gcttttgcat agggaggggg 4020 aaatgtagtc ttatgcaata ctcttgtagt cttgcaacat gcttatgtaa cgatgagtta 4080 gcaacatgcc ttataaggag agaaaaagca ccgtgcatgc cgattggtgg gagtaaggtg 4140 gtatgatcgt ggtatgatcg tgccttgtta ggaaggcaac agacgggtct aacacggatt 4200 ggacgaacca ctgaattccg cattgcagag atattgtatt taagtgccta gctcgataca 4260 ataaacgcca tttgaccatt caccacattg gtgtgcacct gggttgatgg ccggaccgtt 4320 gattccctgr cgactacgag cacatgcatg aagcagaagg cttcatttgg tgaccccgac 4380 gtgatcgtta gggaatagtg gtcggccaca ggcggcgtgg cgatcctgtc ctcatccgtc 4440 tcgcttattc ggggagcgga cgatgaccct agtagagggg gctgcggctt aggagggcag 4500 aagctgagtg gcgtcggagg gagccctact gcagggggcc aacataccct accgagaact 4560 cagagagtcg ttggaagacg ggaaggaagc ccgacgactg agcggtccac cccaggcgtg 4620 attccggttg ctctgcgtga ttccggtcgc ccggtggatc aagcatggaa gccgtcataa 4680 aggtgatttc gtccgcgtgt aagacctatt gcgggaaaac ctctccttct aagaaggaaa 4740 taggggctat gttgtccctg ttacaaaagg aagggttgct tacgtccccc tcagacttat 4800 attccccggg gtcctgggat cccattaccg cggcgctctc tcagcgggct atggtacttg 4860 gaaaatcggg agagttaaaa acctggggat tggttttggg ggcattgaag gcggctcgac 4920 ggatccgtta accctagaac tagtggatct ctgcccttgt gctgactcct gcacacaaga 4980 gcatttccct gtagccaaac agcgattagc cataagctgc acctgacttt gaggattaag 5040 agtttgcaat taagtggatt gcagcaggag atcagtggca gggttgcaga tgaaatcctt 5100 ttctaggggt agctaagggc tgagcaacct gtcctacagc acaagccaaa ccagccaagg 5160 gttttcctgt gctgttcaca gaggcagggc cagctggagc tggaggaggt tgtgctggga 5220 cccttctccc tgtgctgaga atggagtgat ttctgggtgc tgttcctgtg gcttgcactg 5280 agcagctcaa gggagatcgg tgctcctcat gcagtgccaa aactcgtgtt tgatgcagaa 5340 agatggatgt gcacctccct cctgctaatg cagccgtgag cttatgaagg caatgagccc 5400 tcagtgcagc aggagctgta gtgcactcct gtaggtgcta gggaaaatct ctggttccca 5460 gggatgcatt cataagggca atatatcttg aggctgcgcc aaatctttct gaaatattca 5520 tgcgtgttcc cttaatttat agaaacaaac acagcagaat aattattcca atgcctcccc 5580 tcgaaggaaa cccatatttc catgtagaaa tgtaacctat atacacacag ccatgctgca 5640 tccttcagaa cgtgccagtg ctcatctccc atggcaaaat actacaggta ttctcactat 5700 gttggacctg tgaaaggaac catggtaaga aacttcggtt aaaggtatgg ctgcaaaact 5760 actcatacca aaacagcaga gctccagacc tcctcttagg aaagagccac ttggagaggg 5820 atggtgtgaa ggctggaggt gagagacaga gcctgtccca gttttcctgt ctctattttc 5880 tgaaacgttt gcaggaggaa aggacaactg tactttcagg catagctggt gccctcacgt 5940 aaataagttc cccgaacttc tgtgtcattt gttcttaaga tgctttggca gaacactttg 6000 agtcaattcg cttaactgtg actaggtctg taaataagtg ctccctgctg ataaggttca 6060 agtgacattt ttagtggtat ttgacagcat ttaccttgct ttcaagtctt ctaccaagct 6120 cttctatact taagcagtga aaccgccaag aaacccttcc ttttatcaag ctagtgctaa 6180 ataccattaa cttcataggt tagatacggt gctgccagct tcacctggca gtggttggtc 6240 agttctgctg gtgacaaagc ctccctggcc tgtgctttta cctagaggtg aatatccaag 6300 aatgcagaac tgcatggaaa gcagagctgc aggcacgatg gtgctgagcc ttagctgctt 6360 cctgctggga gatgtggatg cagagacgaa tgaaggacct gtcccttact cccctcagca 6420 ttctgtgcta tttagggttc taccagagtc cttaagaggt tttttttttt tttggtccaa 6480 aagtctgttt gtttggtttt gaccactgag agcatgtgac acttgtctca agctattaac 6540 caagtgtcca gccaaaatca attgcctggg agacgcagac cattacctgg aggtcaggac 6600 ctcaataaat attaccagcc tcattgtgcc gctgacagat tcagctggct gctccgtgtt 6660 ccagtccaac agttcggacg ccacgtttgt atatatttgc aggcagcctc ggggggacca 6720 tctcaggagc agagcaccgg cagccgcctg cagagccggg cagtacctca ccatggcttt 6780 gacctttgcc ttactggtgg ctctcctggt gctgagctgc aagagcagct gctctgtggg 6840 ctgcgatctg cctcagaccc acagcctggg cagcaggagg accctgatgc tgctggctca 6900 gatgaggaga atcagcctgt ttagctgcct gaaggatagg cacgattttg gctttcctca 6960 agaggagttt ggcaaccagt ttcagaaggc tgagaccatc cctgtgctgc acgagatgat 7020 ccagcagatc tttaacctgt ttagcaccaa ggatagcagc gctgcttggg atgagaccct 7080 gctggataag ttttacaccg agctgtacca gcagctgaac gatctggagg cttgcgtgat 7140 ccagggcgtg ggcgtgaccg agacccctct gatgaaggag gatagcatcc tggctgtgag 7200 gaagtacttt cagaggatca ccctgtacct gaaggagaag aagtacagcc cctgcgcttg 7260 ggaagtcgtg agggctgaga tcatgaggag ctttagcctg agcaccaacc tgcaagagag 7320 cttgaggtct aaggagtaaa aagtctaggc 7350 22 16051 DNA Artificial Sequence 16 kbp Ovalbumin Sequence 22 ctgcagccca ggcagcacac tagagcagag aaatctagtt agcagcaacc actggcagac 60 agaaatgatt atatagatta catactgacc ctagcctctt acactgccta ctgcatcact 120 gaaaggactg ggaagaagag agtgcaataa cgaagctgaa gctaggagga aggcaaggag 180 aactgaagct gactagggaa aagggggatt aaaggtttaa gtgtctattc catagtttgc 240 tggtttgttt tttgtcaatt cctgaatcag taatttttat gttaattagc aaaaaattac 300 aaacactccc caagtcagga ctgttaccta caacagaagc tcagatcagc tgagccttag 360 tcttttggtc cctccctagg gaatgctgta tgtgtctctc tctccaggcc tgctcaaaat 420 tgacctcaga cccaaacttt tgctgaatct ccagtaccac ctcttttgct cctaactaga 480 taacaaagcc ctgagcgctt tgcttttagc aaagctttaa gtgccattac caactgcacc 540 tggagccttt acctacccct atggacccag gctctatatt taagctctgc cctgaacctt 600 cacttctttc ctgtcctaag ttagatgtac tagtatggtg tgtactatgt ctccagttca 660 aacacagctg tgcccatacc tggccaagga ctcctagtat gacctgggct gtgccttgct 720 gctaaggacc tgctgggtga ttgctggacc tgatcctaat cctgaattaa gaaatgattt 780 cttggcttga ctggatgtgc cctgtggtat gatactgcct tatgatttgg actcttgttt 840 gcagctgtgc aaatccctaa ggagcccagt ctctggccac ctggaatctt gtcactacca 900 aacttcctga gggactggtc ttgctctggg ttctgatctc tggacagtac tcacccttta 960 ctcagcccag gctcccagtt aagccccttt ccaccctgcc aggctctccg ctccatccct 1020 agcaggggct ctcatgacag tgtgaccccc ccttactcag gtcagggcca cttgtgccac 1080 gttcctttcc tgtcttctgt ccctgccttg gctctaaagc agtgtgctac catccacaac 1140 cactgcatct ctctaaagta agcctctcct gagcccaagt ctctgtaacg aggaaggatg 1200 cactttgctc agaaggatgc gaggctgctt ctgagctctg agggcactga cctcccatga 1260 ggtacacccc atacccagga ccacaattca gcctgctgga accatcaact cctgctggag 1320 taaggccata gcaagaccag catccacctc cctgcagccc tgccctgccc agatattggg 1380 cctgctgatc tcaggatgca gacttgcttc tcagcttgac ctaagcattg ccctgtcttt 1440 atggacccac ctggttagca agttcagtgc agaaggaggc tgttggcatc tagctaattt 1500 tccacccaca ttactgtctg ctgactcatt ctacgtctct cccatcttgt tacaataata 1560 atttgggaga tcatattgaa ggtcttaata aagtcaaggc atgtgatatt ctctgctttg 1620 cctttgtttc tagaataagc cacttcatca tagaagatga aaatgctgat cagcagagat 1680 ctgtgcttga taaatccatg ctggcttttc ctatcacctt atattccttc atatgccttg 1740 agacacccaa ggaggccttg gatcagagct gtctgtagca gtcctaactg gtatacaatt 1800 agttgtacaa caggtagtga tccgcataat agttggcgtg agaaagtggg cctgtgctgt 1860 gtcaagcata gagtttgggt tccagtcctg ttctgcatgg cacatatgcc tgagcagctg 1920 ggtaatctct gcattccaat tggaaggcag gggcctgtag gcagttccca cttggcatgg 1980 gtgattgtac cacctgtgtc ctcatctgtg aagcatcatg ttttcattca aatatccttt 2040 tgtttgacag tagaaatgaa cagaattgtt tttttttcct aagcaaattc tgcaagagct 2100 ctgaagaaca aggtgtcagt gaacttctag ctccatagat aggacttgca tcacatgtca 2160 tgccttgatt ggaggtctat ccgatactga acaacttgtg gttccctgag ggaatgtaag 2220 attactgata ctactctctc tttatgttag ctacaataaa tggtaggtta agcaatagat 2280 acagagtttg agtgcctttc ttacaagcat catagtgaac aaatccactg gtgatctacc 2340 ttttcaataa ctacagagaa ttgtaatctc ttggattctc ctccttcccc gttctgaaaa 2400 tgtgttcttt ttttccaaat cagaaacctt cctcaaccac cctgactatt ctttggacat 2460 tgttttgttc ttgctcctaa ataggcttta taatttttgt aagtgaaagg ctttgcatgc 2520 aggtgaggct acaactcatt cagtaacaat gaggaagact gtcagatttt ggggaaaatt 2580 ctcccaccca accttttgct agccagtaag atgtaatcac tgaatgtcat gccacaaaga 2640 ccataccaac atcagaccac atatctacag gaagctttaa ggaatcattg actgtacagt 2700 gaagggtaaa tcaaattaaa atgaatgtga ggtctgatac gagatatcct catgggaatc 2760 aagagcaaag acaaatagtt tttcacagtc ttgtcatgat ctgtcacaga ccaaggcagc 2820 acagcaggca acaatgttgg tctcttcaga atggcacagc accgctgcag aaaaatgcca 2880 ggtggactat gaactcacat ccaaaggagc ttgacctgat acctgatttt cttcaaacag 2940 gggaaacaac acaatcccac aaaatagctc agagagaaac catcactgat ggctacagca 3000 ccaaggtatg caatggcaat ccattcgaca ttcatctgtg acctgagcaa aatgatttat 3060 ctctccatga atggttgctt ctttccctca tgaaaaggca atttccacac tcacaatatg 3120 caacaaagac aaacagagaa caattaatgt gctccttcct aatgtcaaaa ttgtagtggc 3180 aaagaggaga acaaaatctc aagttctgag taggttttag tgattggata agaggctttg 3240 acctgtgagc tcacctggac ttcatatcct tttggataaa aagtgctttt ataactttca 3300 ggtctccgag tctttattca tgagactgtt ggtttaggga cagacccaca atgaaatgcc 3360 tggcatagga aagggcagca gagccttagc tgaccttttc ttgggacaag cattgtcaaa 3420 caatgtgtga caaaactatt tgtactgctt tgcacagctg tgctgggcag ggcaatccat 3480 tgccacctat cccaggtaac cttccaactg caagaagatt gttgcttact ctctctagac 3540 ccccaagtca aaccaactat gcaggtatgc tgacaacgct atgatgacag cctgttctga 3600 tcaagatctc atttgttcat ggacaatttt tgttgcttgc agctggtctt ccattgggaa 3660 agagtgtagt atatccttct catctgacag aaaagcagaa attctcatgc tccacactta 3720 atctacattg ttttaaacca ccagctactt cttggagagg aaaaatggct tttataagac 3780 tcacaaaaca aagctctgca agtcaaatgc atacaaaact gttctgtagg tctggaatca 3840 ggacactatg tggaagtcaa atagagaagc tttaaaaaaa cctttgggat cattctcatc 3900 ttatatttgc agcacgatac tatgacagtg ataactgaca taactgcatc aatttccttg 3960 atattttatt tgtcttaaag tacaagacat agagatggac gtaaagatgg acatatgact 4020 caggtctgga caggtccgtg gtccatgtat gataaaagag atgaagggaa ggagaatgga 4080 gactgtctaa gaagggcttc agggacgttc tgaaggcaga tttgactgaa tcagatgtac 4140 tgtccaagtc tcatatgtag caatggaaga ctgatattgg agaaatataa agaaatggct 4200 gtgaactcaa agtgaccctg aacagaaaag ggatatggag ttaaaataat ggcacagaac 4260 tgaggtttat atgatatacc atgggctgca gagggtcaga gtgctccacc atgggcctct 4320 cttgggctgc agggaacttc tgttctacac ctggaacacc tcctgccctc ctccgcactg 4380 acctcagtgt catcagggct gtttctctca cattttctca ctcacctctc ccaactacca 4440 ttgtacagca gttgttctta catcttgctc ctcctgaggt gcatctagca tcgatcactg 4500 gctcagctct ggccagtggc agctcccttt tgaggacacg ggacagctgc tgggctctgt 4560 tcacagaggc cactccagca gacctccact accacaactt gtagtgtaaa tccactacaa 4620 ctttctgagc tacagaaatg aaatggagac cctctctgct atgggataca aaagaggaaa 4680 cgtggcgttt agtgctctgg ctcactggta cacccaacca cagggtgaga agcagcctgt 4740 tgttattcac tactcttagg acagattatg gtgaattgtt aataaaagca tttcttcata 4800 acatccaaag gaggaaatac actaaattat attttttatt tattaattac acatgcttaa 4860 ttatatatgg catggttgct ttgaaagaac cttgtcctta ctgaccagat ctgctgtttg 4920 ctgagacaaa atggctgaca attttggcca tggtggatac cttccccctt ttctgtagca 4980 ttaggacaga agttattctg gagcctgtct gacaagtcag acttgataac tttaagtatt 5040 tggaagtgtg cttttcatgc tggatgtcat ctccagaacc tccctgtctg gtaagcagtt 5100 ccctgcctta gtaagagccg aaacggtctc tcttttcctt gttatctcac caggatatta 5160 caatgtgaca ggactatctg aactacgcca acctgcaaat tccaaatata tatatatata 5220 tgtaagatat ctatacacaa attattagtg tttgattgac accagatgac agagaagtgc 5280 atctgagaaa acctattccc aatctccttt ctctttctgc agactgacat gcatttcata 5340 ggtagagata acatttactg ggaagcacat ctatcatcat aaaaagcagg caagattttc 5400 agactttctt agtggctgaa atagaagcaa aagacgtgat taaaaacaaa atgaaacaaa 5460 aaaaatcagt tgatacctgt ggtgtagaca tccagcaaaa aaatattatt tgcactacca 5520 tcttgtctta agtcctcaga cttggcaagg agaatgtaga tttctacagt atatatgttt 5580 tcacaaaagg aaggagagaa acaaaagaaa atggcactga ctaaacttca gctagtggta 5640 taggaaagta attctgctta acagagattg cagtgatctc tatgtatgtc ctgaagaatt 5700 atgttgtact tttttccccc atttttaaat caaacagtgc tttacagagg tcagaatggt 5760 ttctttactg tttgtcaatt ctattatttc aatacagaac aatagcttct ataactgaaa 5820 tatatttgct attgtatatt atgattgtcc ctcgaaccat gaacactcct ccagctgaat 5880 ttcacaattc ctctgtcatc tgccaggcca ttaagttatt catggaagat ctttgaggaa 5940 cactgcaagt tcatatcata aacacatttg aaattgagta ttgttttgca ttgtatggag 6000 ctatgttttg ctgtatcctc agaaaaaaag tttgttataa agcattcaca cccataaaaa 6060 gatagattta aatattccag ctataggaaa gaaagtgcgt ctgctcttca ctctagtctc 6120 agttggctcc ttcacatgca tgcttcttta tttctcctat tttgtcaaga aaataatagg 6180 tcacgtcttg ttctcactta tgtcctgcct agcatggctc agatgcacgt tgtagataca 6240 agaaggatca aatgaaacag acttctggtc tgttactaca accatagtaa taagcacact 6300 aactaataat tgctaattat gttttccatc tctaaggttc ccacattttt ctgttttctt 6360 aaagatccca ttatctggtt gtaactgaag ctcaatggaa catgagcaat atttcccagt 6420 cttctctccc atccaacagt cctgatggat tagcagaaca ggcagaaaac acattgttac 6480 ccagaattaa aaactaatat ttgctctcca ttcaatccaa aatggaccta ttgaaactaa 6540 aatctaaccc aatcccatta aatgatttct atggcgtcaa aggtcaaact tctgaaggga 6600 acctgtgggt gggtcacaat tcaggctata tattccccag ggctcagcca gtgtctgtac 6660 atacagctag aaagctgtat tgcctttagc agtcaagctc gaaaggtaag caactctctg 6720 gaattacctt ctctctatat tagctcttac ttgcacctaa actttaaaaa attaacaatt 6780 attgtgctat gtgttgtatc tttaagggtg aagtacctgc gtgatacccc ctataaaaac 6840 ttctcacctg tgtatgcatt ctgcactatt ttattatgtg taaaagcttt gtgtttgttt 6900 tcaggaggct tattctttgt gcttaaaata tgtttttaat ttcagaacat cttatcctgt 6960 cgttcactat ctgatatgct ttgcagtttg cttgattaac ttctagccct acagagtgca 7020 cagagagcaa aatcatggtg ttcagtgaat tctggggagt tattttaatg tgaaaattct 7080 ctagaagttt aattcctgca aagtgcagct gctgatcact acacaagata aaaatgtggg 7140 gggtgcataa acgtatattc ttacaataat agatacatgt gaacttatat acagaaaaga 7200 aaatgagaaa aatgtgtgtg

tgtatactca cacacgtggt cagtaaaaac ttttgagggg 7260 tttaatacag aaaatccaat cctgaggccc cagcactcag tacgcatata aagggctggg 7320 ctctgaagga cttctgactt tcacagatta tataaatctc aggaaagcaa ctagattcat 7380 gctggctcca aaagctgtgc tttatataag cacactggct atacaatagt tgtacagttc 7440 agctctttat aatagaaaca gacagaacaa gtataaatct tctattggtc tatgtcatga 7500 acaagaattc attcagtggc tctgttttat agtaaacatt gctattttat catgtctgca 7560 tttctcttct gtctgaatgt caccactaaa atttaactcc acagaaagtt tatactacag 7620 tacacatgca tatctttgag caaagcaaac catacctgaa agtgcaatag agcagaatat 7680 gaattacatg cgtgtctttc tcctagacta catgacccca tataaattac attacttatc 7740 tattctgcca tcaccaaaac aaaggtaaaa atacttttga agatctactc atagcaagta 7800 gtgtgcaaca aacagatatt tctctacatt tatttttagg gaataaaaat aagaaataaa 7860 atagtcagca agcctctgct ttctcatata tctgtccaaa cctaaagttt actgaaattt 7920 gctctttgaa tttccagttt tgcaagccta tcagattgtg ttttaatcag aggtactgaa 7980 aagtatcaat gaattctagc tttcactgaa caaaaatatg tagaggcaac tggcttctgg 8040 gacagtttgc tacccaaaag acaactgaat gcaaatacat aaatagattt atgaatatgg 8100 ttttgaacat gcacatgaga ggtggatata gcaacagaca cattaccaca gaattacttt 8160 aaaactactt gttaacattt aattgcctaa aaactgctcg taatttactg ttgtagccta 8220 ccatagagta ccctgcatgg tactatgtac agcattccat ccttacattt tcactgttct 8280 gctgtttgct ctagacaact cagagttcac catgggctcc atcggtgcag caagcatgga 8340 attttgtttt gatgtattca aggagctcaa agtccaccat gccaatgaga acatcttcta 8400 ctgccccatt gccatcatgt cagctctagc catggtatac ctgggtgcaa aagacagcac 8460 caggacacaa ataaataagg tgagcctaca gttaaagatt aaaacctttg ccctgctcaa 8520 tggagccaca gcacttaatt gtatgataat gtcccttgga aactgcatag ctcagaggct 8580 gaaaatctga aaccagagtt atctaaaagt gtggccacct ccaactccca gagtgttacc 8640 caaatgcact agctagaaat cttgaaactg gattgcataa cttctttttg tcataaccat 8700 tatttcagct actattattt tcaattacag gttgttcgct ttgataaact tccaggattc 8760 ggagacagta ttgaagctca ggtacagaaa taatttcacc tccttctcta tgtccctttc 8820 ctctggaagc aaaatacagc agatgaagca atctcttagc tgttccaagc cctctctgat 8880 gagcagctag tgctctgcat ccagcagttg ggagaacact gttcataaga acagagaaaa 8940 agaaggaagt aacaggggat tcagaacaaa cagaagataa aactcaggac aaaaataccg 9000 tgtgaatgag gaaacttgtg gatatttgta cgcttaagca agacagctag atgattctgg 9060 ataaatgggt ctggttggaa aagaaggaaa gcctggctga tctgctggag ctagattatt 9120 gcagcaggta ggcaggagtt ccctagagaa aagtatgagg gaattacaga agaaaaacag 9180 cacaaaattg taaatattgg aaaaggacca catcagtgta gttactagca gtaagacaga 9240 caggatgaaa aatagttttg taaacagaag tatctaacta ctttactctg ttcatacact 9300 acgtaaaact tactaagtaa taaaactaga ataacaacat ctttctttct ctttgtattc 9360 agtgtggcac atctgtaaac gttcactctt cacttagaga catcctcaac caaatcacca 9420 aaccaaatga tgtttattcg ttcagccttg ccagtagact ttatgctgaa gagagatacc 9480 caatcctgcc agtaagttgc tctaaaatct gatctgagtg tattccatgc caaagctcta 9540 ccattctgta atgcaaaaac agtcagagtt ccacatgttt cactaagaaa atttcttttt 9600 ctcttgtttt tacaaatgaa agagaggaca aataacattt ctctatcacc gacctgaaac 9660 tctacagtct tcagagaatg aatggcttgc taaaagaatg tcaaatctta ctatacagct 9720 atttcatatt acactactaa atacactata aggcatagca tgtagtaata cagtgtaaaa 9780 tagcttttta cactactata ttattaatat ctgttaattc cagtcttgca tttcacattt 9840 gcaaaacgtt ttgaaattcg tatctgaaag ctgaatactc ttgctttaca ggaatacttg 9900 cagtgtgtga aggaactgta tagaggaggc ttggaaccta tcaactttca aacagctgca 9960 gatcaagcca gagagctcat caattcctgg gtagaaagtc agacaaatgg taaggtagaa 10020 catgctttgt acatagtgag agttggttca ccctaatact gagaacttgg atatagctca 10080 gccagcgtgc tttgcgttca agcttaccag agctgttgta tgcctgttaa gcagggcata 10140 cagtcatgag gctcttgaaa aatcttaaca gacaaagggc aatggaaaat cggagttaag 10200 ggatggtagg gataaaatgc atagaaagag gtaccacaat tttgattttt gccctaatgc 10260 ctctctgcgt ggttcctcaa tttttctact tcattcctca tctcctcaga gcattccttt 10320 ccctcatgct tgaaacacag atgaaagact gtgaattcta actgagatga aaacatccac 10380 aaccacacaa cctctggtgt ggagtcacat tctgtgaagg caaaaactag gccacgtaat 10440 ctatgcgtgc aagctacgcg taagctatgt gtgtgacagg acaatgtgag gaacatacta 10500 tgtgcacaag gactgcagaa taaacaggag caaagttttt gaagaaaaca gagtaaaatc 10560 ctgttttcct cttttgttac attctttaca tatatctcaa atttcctctt tggttagaag 10620 caagtaatat ttatgtttct tggtactgtt tgggttgaag accattctgg gataagagaa 10680 attccagtgg ttcttcccct aatcataaaa tgtcaggttt agtttttttg taacacagaa 10740 atctcttcat cttttatctt ttgttgtgat tcttgataga gagagaaaca agacttactg 10800 acaatagcag caagaaaatc aatcttggaa gaacaagatt gcaattgcaa aaacaaacca 10860 atgtccttgc ccctacatcc tcttccccat aaattctaca ttctctatct accttgtgct 10920 tgccaacatg atatacgtaa actctctttt cctattcatt cttaaaggaa ttatcagaaa 10980 tgtccttcag ccaagctccg tggattctca aactgcaatg gttctggtta atgccattgt 11040 cttcaaagga ctgtgggaga aagcatttaa ggatgaagac acacaagcaa tgcctttcag 11100 agtgactgag gtatatgggc ataccttaga gatgtaatct agaatttatg aagagagtag 11160 acatgttgtt atatgaacac tgcattagcg tatctgctca tttgtctgca tctctttcag 11220 acactgtgtt aaaagcaggg aattttcctt atgtctctct cgtcacaata ttcctgacat 11280 tgcaaagctc ctgagaaata acttcagatt ccacttttcc taggaaggct tctggatgag 11340 aactaatcat cttaactgta actagacatt tctgcatcca agaataatct ttgttaaaac 11400 tatattctct ctctcttttt tttttttttt tggttctcca gcaagaaagc aaacctgtgc 11460 agatgatgta ccagattggt ttatttagag tggcatcaat ggcttctgag aaaatgaaga 11520 tcctggagct tccatttgcc agtgggacaa tgagcatgtt ggtgctgttg cctgatgaag 11580 tctcaggcct tgagcaggta tggccctaga agttggcttc agaatattaa aaacacatgg 11640 aaatttagct gttgtaaagc tcttttcaac acagttatcc taaaacattt aaccagcaca 11700 aatttcatca tgattcaata tgtgattgtt gcatagaagt gtagatttgt cccactgggt 11760 cctgcaatag cccatgctga gcatggcttg ctgaaagaac tgctttagag ggtgaaaagt 11820 ttgacacagc agacaagatg attctcacct aagcagctgt tactgtagtg gcttgaactc 11880 taaaggtctt gtatctccat tcctgtgcac tgaggagctt cttggaaagt tcatataagg 11940 tttactagtt ctaactatta tctcatttgg tggcactcaa tgtgctttgt tcacgtcttc 12000 ataaattaat ctatctaaaa attggatgtg gttaaagcaa tttcagaaat aacatgtaca 12060 taatgtacaa ttattgatat gaacagaaca caggcatagc atattgtaat taggaggact 12120 gtagttattt tgaataggaa acacaatgta ataaatgaga attcattgaa atgttagtat 12180 gctaactcaa tctaaattat aaagataaag aggcatttaa tcacagctag atttccatca 12240 cttgtgacag acaggcatat gaatgattat gtacagctct aggaaaaaaa gtatgtagga 12300 aaactagtac attttgatta gaaagtctga aaatgaggtg ccttgatcaa agagaatacg 12360 tgtgtttgag aaaaaaaaag tttggataga ggtggtaaga gagaatatat tgaaatggtg 12420 tttctacaaa ctgccatggc cagatttgtg taagagacat tcagtaagta ggcaaggaaa 12480 gaaatattac taggtacaaa gcaacatcag taataccaaa agaaaccaat tattccagat 12540 gccaatctcg taatagggtt aagagatttc cacccctcta gtggtcacca gtgcaaccag 12600 taactttgct aatttacatt ttcttttttt aaatggcaga tatagctttg aactgagtga 12660 tcatgaactg gtactgtgta atagatgaag acatacttga cgactaaact tctgattttt 12720 aaaaactcaa attctcttga aagatcagtt cccagtctag taacagctga tagtttaagt 12780 atcagtaatt ggctaccatt aacaactggc tcctgagagg tcttaaatgt agagacagct 12840 ttaaactcaa aagcacagag tgatttttag aatagatttc ccaagcaaag aaaataaaca 12900 gggaggagct ttaagggagt agccatctca ttattattat tatttaaaga aatggcagca 12960 agcctacaaa agaaaaataa gacagagcag agaagaaaga gtcatggtat gcttttctat 13020 cttagcaaaa ttaatctcta catgcctagg aaaaagccat gacaagagca atcagttcaa 13080 aaggtgtatg caaaaaacca cataatagta actagtactg cattgccagg aaggaagtta 13140 tgtcgccatt ccatggatct cattctcatt tccttgcagc ttgagagtat aatcaacttt 13200 gaaaaactga ctgaatggac cagttctaat gttatggaag agaggaagat caaagtgtac 13260 ttacctcgca tgaagatgga ggaaaaatac aacctcacat ctgtcttaat ggctatgggc 13320 attactgacg tgtttagctc ttcagccaat ctgtctggca tctcctcagc agagagcctg 13380 aagatatctc aagctgtcca tgcagcacat gcagaaatca atgaagcagg cagagaggtg 13440 gtagggtcag cagaggctgg agtggatgct gcaagcgtct ctgaagaatt tagggctgac 13500 catccattcc tcttctgtat caagcacatc gcaaccaacg ccgttctctt ctttggcaga 13560 tgtgtttccc cttaaaaaga agaaagctga aaaactctgt cccttccaac aagacccaga 13620 gcactgtagt atcaggggta aaatgaaaag tatgttatct gctgcatcca gacttcataa 13680 aagctggagc ttaatctaga aaaaaaatca gaaagaaatt acactgtgag aacaggtgca 13740 attcactttt cctttacaca gagtaatact ggtaactcat ggatgaaggc ttaagggaat 13800 gaaattggac tcacagtact gagtcatcac actgaaaaat gcaacctgat acatcagcag 13860 aaggtttatg ggggaaaaat gcagccttcc aattaagcca gatatctgta tgaccaagct 13920 gctccagaat tagtcactca aaatctctca gattaaatta tcaactgtca ccaaccattc 13980 ctatgctgac aaggcaattg cttgttctct gtgttcctga tactacaagg ctcttcctga 14040 cttcctaaag atgcattata aaaatcttat aattcacatt tctccctaaa ctttgactca 14100 atcatggtat gttggcaaat atggtatatt actattcaaa ttgttttcct tgtacccata 14160 tgtaatgggt cttgtgaatg tgctcttttg ttcctttaat cataataaaa acatgtttaa 14220 gcaaacactt ttcacttgta gtatttgaag tacagcaagg ttgtgtagca gggaaagaat 14280 gacatgcaga ggaataagta tggacacaca ggctagcagc gactgtagaa caagtactag 14340 tgggtgagaa gttgaacaag agtcccctac aagcaactta atctaataag ctagtggtct 14400 acatcagcta aaagagcata gtgagggatg aaattggttc tcctttctaa gcatcacctg 14460 ggacaactca tctggagcag tgtgtccaat ctgccgctgc cctgatctcg gctggggtga 14520 tgggacagac cttggctgcc actgagacat ctgagacact gagatctgtc tcaactcaga 14580 tttacccaag aacagctcat tgccaacaga acaaaatctc aaacttatgg ctagtgatga 14640 cagcagtcag ttgtcccatc tgtgacccac caaggctggc atgctggaat gagcaggctt 14700 tggtggcatg tagttactgg acagcaccac tgacatgggc aggggaaaaa ctgagcatgg 14760 tgtaaatcac tgcctcaaag ccacttctct gtgcctgcac catgcttgaa agctcttcta 14820 caggagctgg gtttgttcaa gaaagcttct gtttctccca tctgcttctt gtaccttcac 14880 agggacagag ttagaagggt acagccatgg ctggaagggg ctgactttca aatgtgccta 14940 attttccttt ggttgctgct gcagctgcag aagaaggggt tcagaagcca agagctttga 15000 gataaggatg cctaacctat gttgaagaca tttgtgctga cacctcaggc cccaggatag 15060 gacaactgct ggattgtggc taacccacta gctacagaac ctaatttata ttaccagatt 15120 aggaagagca aaagaacatg tatttataac aggaggtctt ctgtgcttct ctactaaaag 15180 gtgctgtgaa ggagcccaca gtgcagcagt gtatgaggcc tgaaagaggc cgcagcacac 15240 gaagagccct ggtaggagca gcacacagag gggcaggagg gctgggggaa ctgccaccca 15300 tggggacctg tgtgaagcag tgcactcctg aggggtggac tgcgtgggaa aggaaaagaa 15360 agcaaacaga cctgtgatga actgtcacac agactgcaga gtgacagagg agggcacgag 15420 gcagtgcgcc cactgcaggg agtggcgctc cttcctcaca gcagcgctaa cagcttggca 15480 ccaatattca gtagtctgtg gtgatacttt ttccagtttc accacacagc atttcgcttg 15540 ttctacttgt tttagctttc cccctccaca agataacaca tactttgcca gtcagtccct 15600 aagaccttaa cttaacagtt agcaaacagg atcttgcaaa agaaggaaga taacatgaca 15660 ccaccttcac tggtgtataa atagttcaaa tactttcctt cactttcccg taaattagtt 15720 gattgcaggt caggagataa caggggaact tactgcaaga gagaaaatga tgtttaatat 15780 tgtcttggac tttctggtgg tctgggcatg aaaatggggt actcaaaatc ctcgggacgt 15840 ttatttttca cctgatttat tcccaaactg cactatttct aggccattgg agttcttatc 15900 aattaaatta tactttggct ctctgctatc tcactccctt tcatcttcag catcactttc 15960 agcacaatta caggagaaga cttagactca gagctttagg actcatcata agaggctttc 16020 attgctctgt caccacaccc catatagatc t 16051 23 7334 DNA Artificial Sequence pBS-OM-4.4 Vector 23 atcaagctta tcgataccgt cgacctcgag ggggggcccg gtacccagct tttgttccct 60 ttagtgaggg ttaatttcga gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa 120 ttgttatccg ctcacaattc cacacaacat acgagccgga agcataaagt gtaaagcctg 180 gggtgcctaa tgagtgagct aactcacatt aattgcgttg cgctcactgc ccgctttcca 240 gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg 300 tttgcgtatt gggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg 360 gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg 420 ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa 480 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 540 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 600 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 660 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 720 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 780 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 840 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 900 gttcttgaag tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc 960 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 1020 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 1080 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 1140 acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa 1200 ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta 1260 ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt 1320 tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag 1380 tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag caataaacca 1440 gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc 1500 tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt 1560 tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag 1620 ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt 1680 tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat 1740 ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt 1800 gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc 1860 ttgcccggcg tcaatacggg ataataccgc gccacatagc agaactttaa aagtgctcat 1920 cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag 1980 ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt 2040 ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg 2100 gaaatgttga atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta 2160 ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc 2220 gcgcacattt ccccgaaaag tgccacctaa attgtaagcg ttaatatttt gttaaaattc 2280 gcgttaaatt tttgttaaat cagctcattt tttaaccaat aggccgaaat cggcaaaatc 2340 ccttataaat caaaagaata gaccgagata gggttgagtg ttgttccagt ttggaacaag 2400 agtccactat taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt ctatcagggc 2460 gatggcccac tacgtgaacc atcaccctaa tcaagttttt tggggtcgag gtgccgtaaa 2520 gcactaaatc ggaaccctaa agggagcccc cgatttagag cttgacgggg aaagccggcg 2580 aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg gcgctagggc gctggcaagt 2640 gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc ttaatgcgcc gctacagggc 2700 gcgtcccatt cgccattcag gctgcgcaac tgttgggaag ggcgatcggt gcgggcctct 2760 tcgctattac gccagctggc gaaaggggga tgtgctgcaa ggcgattaag ttgggtaacg 2820 ccagggtttt cccagtcacg acgttgtaaa acgacggcca gtgaattgta atacgactca 2880 ctatagggcg aattggagct ccaccgcggt ggcggccgct ctagaactag tggatccttc 2940 ttaaaaagca gaccatcatt cactgcaaac ccagagcttc atgcctctcc ttccacaacc 3000 gaaaacagcc ggcttcattt gtctttttta aatgctgttt tccaggtgaa ttttggccag 3060 cgtgttggct gagatccagg agcacgtgtc agctttctgc tctcattgct cctgttctgc 3120 attgcctctt tctggggttt ccaagagggg gggagacttt gcgcggggat gagataatgc 3180 cccttttctt agggtggctg ctgggcagca gagtggctct gggtcactgt ggcaccaatg 3240 ggaggcacca gtgggggtgt gttttgtgca ggggggaagc attcacagaa tggggctgat 3300 cctgaagctt gcagtccaag gctttgtctg tgtacccagt gaaatccttc ctctgttaca 3360 taaagcccag ataggactca gaaatgtagt cattccagcc cccctcttcc tcagatctgg 3420 agcagcactt gtttgcagcc agtcctcccc aaaatgcaca gacctcgccg agtggaggga 3480 gatgtaaaca gcgaaggtta attacctcct tgtcaaaaac actttgtggt ccatagatgt 3540 ttctgtcaat cttacaaaac agaaccgaga ggcagcgagc actgaagagc gtgttcccat 3600 gctgagttaa tgagacttgg cagctcgctg tgcagagatg atccctgtgc ttcatgggag 3660 gctgtaacct gtctccccat cgccttcaca ccgcagtgct gtcctggaca cctcaccctc 3720 cataagctgt aggatgcagc tgcccaggga tcaagagact tttcctaagg ctcttaggac 3780 tcatctttgc cgctcagtag cgtgcagcaa ttactcatcc caactatact gaatgggttt 3840 ctgccagctc tgcttgtttg tcaataagca tttcttcatt ttgcctctaa gtttctctca 3900 gcagcaccgc tctgggtgac ctgagtggcc acctggaacc cgaggggcac agccaccacc 3960 tccctgttgc tgctgctcca gggactcatg tgctgctgga tggggggaag catgaagttc 4020 ctcacccaga cacctgggtt gcaatggctg cagcgtgctc ttcttggtat gcagattgtt 4080 tccagccatt acttgtagaa atgtgctgtg gaagcccttt gtatctcttt ctgtggccct 4140 tcagcaaaag ctgtgggaaa gctctgaggc tgctttcttg ggtcgtggag gaattgtatg 4200 ttccttcttt aacaaaaatt atccttagga gagagcactg tgcaagcatt gtgcacataa 4260 aacaattcag gttgaaaggg ctctctggag gtttccagcc tgactactgc tcgaagcaag 4320 gccaggttca aagatggctc aggatgctgt gtgccttcct gattatctgt gccaccaatg 4380 gaggagattc acagccactc tgcttcccgt gccactcatg gagaggaata ttcccttata 4440 ttcagataga atgttatcct ttagctcagc cttccctata accccatgag ggagctgcag 4500 atccccatac tctccccttc tctggggtga aggccgtgtc ccccagcccc ccttcccacc 4560 ctgtgcccta agcagcccgc tggcctctgc tggatgtgtg cctatatgtc aatgcctgtc 4620 cttgcagtcc agcctgggac atttaattca tcaccagggt aatgtggaac tgtgtcatct 4680 tcccctgcag ggtacaaagt tctgcacggg gtcctttcgg ttcaggaaaa ccttcactgg 4740 tgctacctga atcaagctct atttaataag ttcataagca catggatgtg ttttcctaga 4800 gatacgtttt aatggtatca gtgattttta tttgctttgt tgcttacttc aaacagtgcc 4860 tttgggcagg aggtgaggga cgggtctgcc gttggctctg cagtgatttc tccaggcgtg 4920 tggctcaggt cagatagtgg tcactctgtg gccagaagaa ggacaaagat ggaaattgca 4980 gattgagtca cgttaagcag gcatcttgga gtgatttgag gcagtttcat gaaagagcta 5040 cgaccactta ttgttgtttt ccccttttac aacagaagtt ttcatcaaaa taacgtggca 5100 aagcccagga atgtttggga aaagtgtagt taaatgtttt gtaattcatt tgtcggagtg 5160 ctaccagcta agaaaaaagt cctacctttg gtatggtagt cctgcagaga atacaacatc 5220 aatattagtt tggaaaaaaa caccaccacc accagaaact gtaatggaaa atgtaaacca 5280 agaaattcct tgggtaagag agaaaggatg tcgtatactg gccaagtcct gcccagctgt 5340 cagcctgctg accctctgca gttcaggacc atgaaacgtg gcactgtaag acgtgtcccc 5400 tgcctttgct tgcccacaga tctctgccct tgtgctgact cctgcacaca agagcatttc 5460 cctgtagcca aacagcgatt agccataagc tgcacctgac tttgaggatt aagagtttgc 5520 aattaagtgg attgcagcag gagatcagtg gcagggttgc agatgaaatc cttttctagg 5580 ggtagctaag ggctgagcaa cctgtcctac agcacaagcc aaaccagcca agggttttcc 5640 tgtgctgttc acagaggcag ggccagctgg agctggagga ggttgtgctg ggacccttct 5700 ccctgtgctg agaatggagt gatttctggg tgctgttcct gtggcttgca ctgagcagct 5760 caagggagat cggtgctcct catgcagtgc caaaactcgt gtttgatgca gaaagatgga 5820 tgtgcacctc cctcctgcta atgcagccgt gagcttatga aggcaatgag ccctcagtgc 5880 agcaggagct gtagtgcact cctgtaggtg ctagggaaaa tctctggttc ccagggatgc 5940 attcataagg gcaatatatc ttgaggctgc gccaaatctt tctgaaatat tcatgcgtgt 6000 tcccttaatt tatagaaaca aacacagcag aataattatt ccaatgcctc ccctcgaagg 6060 aaacccatat ttccatgtag aaatgtaacc tatatacaca cagccatgct gcatccttca 6120 gaacgtgcca gtgctcatct cccatggcaa

aatactacag gtattctcac tatgttggac 6180 ctgtgaaagg aaccatggta agaaacttcg gttaaaggta tggctgcaaa actactcata 6240 ccaaaacagc agagctccag acctcctctt aggaaagagc cacttggaga gggatggtgt 6300 gaaggctgga ggtgagagac agagcctgtc ccagttttcc tgtctctatt ttctgaaacg 6360 tttgcaggag gaaaggacaa ctgtactttc aggcatagct ggtgccctca cgtaaataag 6420 ttccccgaac ttctgtgtca tttgttctta agatgctttg gcagaacact ttgagtcaat 6480 tcgcttaact gtgactaggt ctgtaaataa gtgctccctg ctgataaggt tcaagtgaca 6540 tttttagtgg tatttgacag catttacctt gctttcaagt cttctaccaa gctcttctat 6600 acttaagcag tgaaaccgcc aagaaaccct tccttttatc aagctagtgc taaataccat 6660 taacttcata ggttagatac ggtgctgcca gcttcacctg gcagtggttg gtcagttctg 6720 ctggtgacaa agcctccctg gcctgtgctt ttacctagag gtgaatatcc aagaatgcag 6780 aactgcatgg aaagcagagc tgcaggcacg atggtgctga gccttagctg cttcctgctg 6840 ggagatgtgg atgcagagac gaatgaagga cctgtccctt actcccctca gcattctgtg 6900 ctatttaggg ttctaccaga gtccttaaga ggtttttttt ttttttggtc caaaagtctg 6960 tttgtttggt tttgaccact gagagcatgt gacacttgtc tcaagctatt aaccaagtgt 7020 ccagccaaaa tcaattgcct gggagacgca gaccattacc tggaggtcag gacctcaata 7080 aatattacca gcctcattgt gccgctgaca gattcagctg gctgctccgt gttccagtcc 7140 aacagttcgg acgccacgtt tgtatatatt tgcaggcagc ctcgggggga ccatctcagg 7200 agcagagcac cggcagccgc ctgcagagcc gggcagtacc tcaccatggc catggcaggt 7260 gtcttcgtgc tgttctcttt cgtgctttgt ggcttcctcc caggtgagta actcccagag 7320 tgctgcagaa gctt 7334 24 4327 DNA Artificial Sequence pAVIJCR-A137.91.1.2 Vector 24 gccaatgtgg tacttcccac attgtataag aaatttggca agtttagagc aatgtttgaa 60 gtgttgggaa atttctgtat actcaagagg gcgtttttga caactgtaga acagaggaat 120 caaaaggggg tgggaggaag ttaaaagaag aggcaggtgc aagagagctt gcagtcccgc 180 tgtgtgtacg acactggcac catggctttg acctttgcct tactggtggc tctcctggtg 240 ctgagctgca agagcagctg ctctgtgggc tgcgatctgc ctcagaccca cagcctgggc 300 agcaggagga ccctgatgct gctggctcag atgaggagaa tcagcctgtt tagctgcctg 360 aaggataggc acgattttgg ctttcctcaa gaggagtttg gcaaccagtt tcagaaggct 420 gagaccatcc ctgtgctgca cgagatgatc cagcagatct ttaacctgtt tagcaccaag 480 gatagcagcg ctgcttggga tgagaccctg ctggataagt tttacaccga gctgtaccag 540 cagctgaacg atctggaggc ttgcgtgatc cagggcgtgg gcgtgaccga gacccctctg 600 atgaaggagg atagcatcct ggctgtgagg aagtactttc agaggatcac cctgtacctg 660 aaggagaaga agtacagccc ctgcgcttgg gaagtcgtga gggctgagat catgaggagc 720 tttagcctga gcaccaacct gcaagagagc ttgaggtcta aggagtaaaa agtctagagt 780 cggggcggcc ggccgcttcg agcagacatg ataagataca ttgatgagtt tggacaaacc 840 acaactagaa tgcagtgaaa aaaatgcttt atttgtgaaa tttgtgatgc tattgcttta 900 tttgtaacca ttataagctg caataaacaa gttaacaaca acaattgcat tcattttatg 960 tttcaggttc agggggaggt gtgggaggtt ttttaaagca agtaaaacct ctacaaatgt 1020 ggtaaaatcg ataaggatcc gtcgaccgat gcccttgaga gccttcaacc cagtcagctc 1080 cttccggtgg gcgcggggca tgactatcgt cgccgcactt atgactgtct tctttatcat 1140 gcaactcgta ggacaggtgc cggcagcgct cttccgcttc ctcgctcact gactcgctgc 1200 gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat 1260 ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca 1320 ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 1380 atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 1440 aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 1500 gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcaatgc tcacgctgta 1560 ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 1620 ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 1680 acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 1740 gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat 1800 ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 1860 ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc 1920 gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt 1980 ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct 2040 agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt 2100 ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc 2160 gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac 2220 catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat 2280 cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg 2340 cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata 2400 gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta 2460 tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt 2520 gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag 2580 tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa 2640 gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc 2700 gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt 2760 taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc 2820 tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta 2880 ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa 2940 taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca 3000 tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac 3060 aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgcgccc tgtagcggcg 3120 cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgccc 3180 tagcgcccgc tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc 3240 gtcaagctct aaatcggggg ctccctttag ggttccgatt tagtgcttta cggcacctcg 3300 accccaaaaa acttgattag ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg 3360 tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg 3420 gaacaacact caaccctatc tcggtctatt cttttgattt ataagggatt ttgccgattt 3480 cggcctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaat tttaacaaaa 3540 tattaacgtt tacaatttcc cattcgccat tcaggctgcg caactgttgg gaagggcgat 3600 cggtgcgggc ctcttcgcta ttacgccagc ccaagctacc atgataagta agtaatatta 3660 aggtacggga ggtacttgga gcggccgcaa taaaatatct ttattttcat tacatctgtg 3720 tgttggtttt ttgtgtgaat cgatagtact aacatacgct ctccatcaaa acaaaacgaa 3780 acaaaacaaa ctagcaaaat aggctgtccc cagtgcaagt gcaggtgcca gaacatttct 3840 ctatcgatag gtaccgagct cttacgcgtg ctagccccga tgtacgggcc agatatacgc 3900 gttgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 3960 gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 4020 ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 4080 ggactttcca ttgacgtcaa tgggtggact atttacggta aactgcccac ttggcagtac 4140 atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 4200 cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 4260 tattagtcat cgctattacc atgcatggct ttgacctttg ccttactggt ggctctcctg 4320 gtgctta 4327 25 244 DNA Artificial Sequence The RRE (rev responsive element) sequence 25 aattgaggag ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcg 60 tcaatgacgc tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac 120 aatttgctga gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc 180 aagcagctcc aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg 240 gtac 244 26 158 DNA Artificial Sequence The ALV CTE (constitutive transport element) sequence 26 aatgtgggga gggcaaggct tgcgaatcgg gttgtaacgg gcaaggcttg actgagggga 60 caatagcatg tttaggcgaa aagcggggct tcggttgtac gcggttagga gtcccctcag 120 gatatagtag tttcgctttt gcatagggag ggggaaat 158 27 55 DNA Artificial Sequence p10.0-OM-IFN-1 Primer 27 ggcgtcgacg gatccgttaa ccctagaact agtggatctc tgcccttgtg ctgac 55 28 31 DNA Artificial Sequence p10.0-OM-IFN-2 28 ggcctcgagc ctagactttt tactccttag a 31 29 346 DNA Artificial Sequence ALV vector 5' LTR sequence 29 aatgtagtct tatgcaatac tcttgtagtc ttgcaacatg cttatgtaac gatgagttag 60 caacatgcct tataaggaga gaaaaagcac cgtgcatgcc gattggtggg agtaaggtgg 120 tatgatcgtg gtatgatcgt gccttgttag gaaggcaaca gacgggtcta acacggattg 180 gacgaaccac tgaattccgc attgcagaga tattgtattt aagtgcctag ctcgatacaa 240 taaacgccat ttgaccattc accacattgg tgtgcacctg ggttgatggc cggaccgttg 300 attccctgrc gactacgagc acatgcatga agcagaaggc ttcatt 346

Claims

1. A transgenic avian containing in its genome an exogenous nucleotide sequence comprising a promoter component and a SIN vector wherein the exogenous nucleotide sequence is integrated into the genome and the avian produces an exogenous protein which is deposited in a hard shell egg laid by the avian.

2. The transgenic avian of claim 1 wherein the promoter component is an oviduct specific promoter.

3. The transgenic avian of claim 1 wherein the avian is selected from the group consisting of a chicken, a turkey and a quail.

4. The transgenic avian of claim 1 wherein the promoter component is linked to a coding sequence exogenous to the avian.

5. The transgenic avian of claim 1 wherein the promoter component is an avian ovomucoid promoter component.

6. The transgenic avian of claim 1 wherein the promoter component is an avian ovalbumin promoter component.

7. The transgenic avian of claim 1 wherein the promoter component is an avian lysozyme promoter component.

8. The transgenic avian of claim 1 wherein the exogenous protein is a therapeutic protein.

9. The transgenic avian of claim 1 wherein the exogenous protein is a cytokine.

10. The transgenic avian of claim 1 wherein the exogenous protein is selected from the group consisting of erythropoietin, GM-CSF, interferon, fusion protein, CTLA4-Fc fusion protein, growth hormones, cytokines, structural, interferon, lysozyme, .beta.-casein, albumin, .alpha.-1 antitrypsin, antithrombin III, collagen, factors VIII, IX, X (and the like), fibrinogen, lactoferrin, protein C, tissue-type plasminogen activator (tPA), somatotropin, and chymotryp sin, immunoglobulins, antibodies, immunotoxins, factor VIII, b-domain deleted factor VIII, factor VIIa, factor IX, anticoagulants; hirudin, alteplase, tpa, reteplase, tpa, tpa--3 of 5 domains deleted, insulin, insulin lispro, insulin aspart, insulin glargine, long-acting insulin analogs, glucagons, tsh, follitropin-beta, fsh, pdgh, inf-beta, inf-alpha 1, ifn-alpha 2, inf-beta, inf-beta 1b, ifn-beta 1a, ifn-gamma, ifn-gamma 1b, il-2, il-1 1, hbsag, ospa, dornase-alpha dnase, beta glucocerebrosidase, tnf-alpha, il-2-diptheria toxin fusion protein, tnfr-lgg fragment fusion protein laronidase, dnaases, alefacept, tositumomab, murine mab, alemtuzumab, rasburicase, agalsidase beta, teriparatide, parathyroid hormone derivatives, adalimumab (lggl), anakinra, biological modifier, nesiritide, human b-type natriuretic peptide (hbnp), colony stimulating factors, pegvisomant, human growth hormone receptor antagonist, recombinant activated protein c, omalizumab, immunoglobulin e (lge) blocker, lbritumomab tiuxetan, ACTH, glucagon, somatostatin, somatotropin, thymosin, parathyroid hormone, pigmentary hormones, somatomedin, luteinizing hormone, chorionic gonadotropin, hypothalmic releasing factors, etanercept, antidiuretic hormones, prolactin and thyroid stimulating hormone, an immunoglobulin polypeptide, immunoglobulin polypeptide D region, immunoglobulin polypeptide J region, immunoglobulin polypeptide C region, immunoglobulin light chain, immunoglobulin heavy chain, an immunoglobulin heavy chain variable region, an immunoglobulin light chain variable region and a linker peptide.

11. The transgenic avian of claim 1 wherein the retrovirus is selected from the group consisting of avian leukosis virus vector (ALV), a murine leukemia virus (MLV) retroviral vector, moloney murine leukemia Virus (MMLV) and a lentiviral vector.

12. A transgenic avian comprising an oviduct cell which contains an exogenous nucleotide sequence comprising a promoter component linked to an exogenous coding sequence contained in an integrated SIN vector wherein the exogenous coding sequence is expressed in the oviduct cell and is secreted from the oviduct cell.

13. The transgenic avian of claim 12 wherein the avian is a chicken.

14. The transgenic avian of claim 12 wherein the oviduct cell is a tubular gland cell.

15. The transgenic avian of claim 12 wherein the promoter component is an avian ovomucoid promoter component.

16. The transgenic avian of claim 12 wherein the promoter component is an avian ovalbumin promoter component.

17. The transgenic avian of claim 12 wherein the promoter component is an avian lysozyme promoter component.

18. A method of producing an exogenous protein comprising producing a transgenic avian having a nucleotide sequence in its genome comprising a vector which is at least one of a SIN vector and an SC negative vector wherein the nucleotide sequence comprises a promoter component linked to an exogenous coding sequence.

19. The method of claim 18 wherein the exogenous coding sequence encodes a human protein.

20. The method of claim 18 wherein the exogenous coding sequence encodes a therapeutic protein.

21. The method of claim 18 wherein the promoter component comprises a functional promoter sequence of a promoter selected from the group consisting of avian ovalbumin promoter component, avian ovomucoid promoter component, avian lysozyme promoter component and avian conalbumin promoter component.

22. The method of claim 18 wherein the avian is a chicken.

23. A transgenic avian containing in its genome an exogenous nucleotide sequence comprising a promoter component and a SC negative vector wherein the exogenous nucleotide sequence is integrated into the genome and the avian produces an exogenous protein.

24. The transgenic avian of claim 23 wherein the promoter component comprises a functional promoter sequence of a promoter selected from the group consisting of avian ovalbumin promoter component, avian ovomucoid promoter component and avian lysozyme promoter component.

25. A nucleic acid 90% identical to a nucleic acid molecule selected from the group consisting of nucleotide sequences that contain: 1. 3.5 kb OV fragment (includes DHS I, II & III) 5' UTR-5' portion (from Exon L) 5' UTR-3' portion (from Exon 1); 2. 3.5 kb OV fragment (includes DHS I, II & III) 5' UTR-5' portion (from Exon L) Intron A 5' UTR-3' portion (from Exon 1) 3' UTR; 3. 3.5 kb OV fragment (includes DHS I, II & III) 5' UTR-5' portion (from Exon L) Intron A 5' UTR-3' portion (from Exon 1); 4. 3.5 kb OV fragment (includes DHS I, II & III) 5' UTR-5' portion (from Exon L) 5' UTR-3' portion (from Exon 1) 3' UTR; 5. 3.5 kb OV fragment (includes DHS I, II & III) 5' UTR-5' portion (from Exon L) Intron A 5' UTR-3' portion (from Exon 1) 3' UTR/DHSA(bp 13576 to 15163 of FIG. 8); 6. 3.5 kb OV fragment (includes DHS I, II & III) 5' UTR-5' portion (from Exon L) 5' UTR-3' portion (from Exon 1) 3' UTR/DHSA(bp 13576 to 15163 of FIG. 8); 7. 3.5 kb OV fragment (includes DHS I, II & III) 5' UTR-5' portion (from Exon L) Intron A 5' UTR-3' portion (from Exon 1) partial 3' UTR RRE; 8. ALV CTE 3.5 kb OV fragment (includes DHS I, II & III) 5' UTR-5' portion (from Exon L) Intron A 5' UTR-3' portion (from Exon 1) partial 3' UTR; wherein, 3.5 kb OV fragment (includes DHS I, II & III): Start: 3199 End: 6659 of FIG. 8 (SEQ ID NO: 22); 5' UTR-5' portion (from Exon L): Start: 6659 End: 6705 of FIG. 8 (SEQ ID NO: 22); 5' UTR-3' portion (from Exon 1): Start: 8295 End: 8311 of FIG. 8 (SEQ ID NO: 22); 3' UTR: Start: 13576 End: 14209 of FIG. 8 (SEQ ID NO: 22); partial 3' UTR: Start 13576 End: 13996 of FIG. 8 (SEQ ID NO: 22); Intron A: Start: 6706 End: 8294 of FIG. 8 (SEQ ID NO: 22); Exon L: Start: 6659 End: 6705 of FIG. 8 (SEQ ID NO: 22); Exon 1: Start: 8295 End: 8478 of FIG. 8 (SEQ ID NO: 22); DHS III: Start: 3253 End: 3559 of FIG. 8 (SEQ ID NO: 22); DHS II: Start: 5629 End: 6009 of FIG. 8 (SEQ ID NO: 22); DHS I: Start: 6359 End: 6659 of FIG. 8 (SEQ ID NO: 22); and RRE: shown in FIG. 9a (SEQ ID NO: 25) ALV CTE shown in FIG. 9b (SEQ ID NO: 26)