U.S. patent application number 11/702972 was filed with the patent office on 2008-03-06 for methods for the treatment of thrombosis.
This patent application is currently assigned to Amgen, Inc.. Invention is credited to Thomas C. Boone, Huimin Li, Michael B. Mann.
Application Number | 20080058256 11/702972 |
Document ID | / |
Family ID | 23628486 |
Filed Date | 2008-03-06 |
United States Patent
Application |
20080058256 |
Kind Code |
A1 |
Boone; Thomas C. ; et
al. |
March 6, 2008 |
Methods for the treatment of thrombosis
Abstract
A fibrinolytically active metalloproteinase polypeptide (called
"novel acting thrombolytic") which is useful for blood clot lysis
in vivo and methods and materials for its production by recombinant
expression are described.
Inventors: |
Boone; Thomas C.; (Newbury
Park, CA) ; Li; Huimin; (Newbury Park, CA) ;
Mann; Michael B.; (Thousand Oaks, CA) |
Correspondence
Address: |
ROBINS & PASTERNAK
1731 EMBARCADERO ROAD
SUITE 230
PALO ALTO
CA
94303
US
|
Assignee: |
Amgen, Inc.
Thousand Oaks
CA
91320-1799
|
Family ID: |
23628486 |
Appl. No.: |
11/702972 |
Filed: |
February 6, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10441667 |
May 20, 2003 |
7195903 |
|
|
11702972 |
Feb 6, 2007 |
|
|
|
09846729 |
May 1, 2001 |
6617145 |
|
|
10441667 |
May 20, 2003 |
|
|
|
09411329 |
Oct 1, 1999 |
6261820 |
|
|
09846729 |
May 1, 2001 |
|
|
|
Current U.S.
Class: |
435/219 ;
435/243; 435/254.23; 435/320.1; 435/69.1; 514/14.9; 530/350;
530/402; 536/23.1 |
Current CPC
Class: |
A61K 38/1703 20130101;
A61P 7/00 20180101; C12N 9/6489 20130101; A61P 7/02 20180101; C12N
9/6418 20130101 |
Class at
Publication: |
514/012 ;
435/243; 435/254.23; 435/320.1; 435/069.1; 530/350; 530/402;
536/023.1 |
International
Class: |
A61K 38/17 20060101
A61K038/17; A61P 7/00 20060101 A61P007/00; C07H 21/04 20060101
C07H021/04; C07K 14/435 20060101 C07K014/435; C12N 1/00 20060101
C12N001/00; C12N 15/63 20060101 C12N015/63; C12P 21/00 20060101
C12P021/00 |
Claims
1. A thrombolytically active variant of SEQ ID NO:5, wherein the
sequence of amino acid residues Gln-Gln-Arg at positions 1-3 of SEQ
ID NO:5 is substituted with an amino acid that facilitates kex-2
cleavage when the amino acid occurs on the C-terminal side of the
kex-2 hydrolysis site, and the remainder of the amino acid sequence
of SEQ ID NO:5 is unchanged.
2. A fusion polypeptide comprising the thrombolytically active
variant of claim 1 fused to a heterologous polypeptide
sequence.
3. A composition comprising the thrombolytically active variant of
claim 1, and one or more components selected from a
pharmaceutically acceptable diluent, a pharmaceutically acceptable
preservative, a pharmaceutically acceptable solubilizer, a
pharmaceutically acceptable emulsifier, a pharmaceutically
acceptable adjuvant, or a pharmaceutically acceptable carrier.
4. A method for treating thrombosis in a mammal comprising
administering locally to a clot in a blood vessel of the mammal a
thrombolytically effective amount of the composition of claim
3.
5. The method of claim 4, wherein the composition is administered
as two or more doses.
6. The method of claim 4, wherein the mammal is a human.
7. A method for lysing a blood clot comprising contacting the blood
clot with a thrombolytically effective amount of the composition of
claim 3.
8. The method of claim 7, wherein the blood clot is contacted in
vivo.
9. The method of claim 8, wherein the blood clot is contacted in
vivo in a human.
10. The method of claim 7, wherein the blood clot is contacted in
vitro.
11. A nucleic acid molecule comprising a coding sequence encoding
the thrombolytically active variant of claim 1.
12. An expression vector comprising the nucleic acid molecule of
claim 11, operatively linked to expression regulatory elements.
13. A host cell comprising the expression vector of claim 12.
14. The host cell of claim 13, wherein the cell is a yeast
cell.
15. The host cell of claim 14, wherein the yeast is Pichia
pastoris.
16. A method for producing a recombinant polypeptide comprising
providing a population of host cells according to claim 13 and
causing expression of the polypeptide.
17. A method for producing a recombinant polypeptide comprising
providing a population of host cells according to claim 14 and
causing expression of the polypeptide.
18. A method for producing a recombinant polypeptide comprising
providing a population of host cells according to claim 15 and
causing expression of the polypeptide.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application of U.S. Ser.
No. 10/441,667, filed May 20, 2003, which is a divisional
application of U.S. Ser. No. 09/846,729, filed May 1, 2001, now
U.S. Pat. No. 6,617,145, which is a divisional application of U.S.
Ser. No. 09/411,329, filed Oct. 1, 1999, now U.S. Pat. No.
6,261,820, from which applications priority is claimed pursuant to
35 U.S.C. .sctn.120, and which applications are incorporated herein
by reference in their entireties.
FIELD OF THE INVENTION
[0002] This invention relates to a fibrinolytically active
metalloproteinase of non-naturally occurring sequence, to combinant
methods for its manufacture, and to its use in treating thrombosis
in vivo.
BACKGROUND OF THE INVENTION
[0003] Fibrolase is an enzymatically active polypeptide
(specifically, a metalloproteinase) composed of 203 amino acid
residues that was originally isolated by purification from the
venom of the Southern Copperhead snake; U.S. Pat. No. 4,610,879,
issued Sep. 9, 1986 (Markland et al.); and Guan et al., Archives of
Biochemistry and Biophysics, Volume 289, Number 2, pages 197-207
(1991). The enzyme exhibits direct fibrinolytic activity with
little or no hemorrhagic activity, and it dissolves blood clots
made either from fibrinogen or from whole blood.
[0004] The amino acid sequence of fibrolase has also been
determined, with methods described for recombinant production in
yeast and use for the treatment of thrombembolic conditions in
vivo; Randolph et al., Protein Science, Cambridge University Press
(1992), pages 590-600, and European Patent Application No. 0 323
722 (Valenzuela et al.), published Jul. 12, 1989.
SUMMARY OF THE INVENTION
[0005] This invention provides a fibinolytic metalloproteinase
having the non-naturally occurring linear array of amino acids
depicted in SEQ ID NO: 1, also referred to herein as "novel acting
thrombolytic" (or "NAT"). Also provided are nucleic acid molecules,
such as the one of SEQ ID NO: 2 and variants thereof encoding
NAT.
[0006] The term "mature" is used in its conventional sense to refer
to the biologically active polypeptide which has been enzymatically
processed in situ in the host cell to cleave it from the prepro
region.
[0007] Because of its fibrinolytic activity, NAT is useful in vivo
as a blood clot lysing agent to treat thrombosis in a mammal
(including rats, pigs and humans).
[0008] The NAT polypeptide of this invention provides advantages
over naturally occurring fibrolase as a therapeutic agent (i.e.,
the fibrinolytic polypeptide found in snake venom). Native
fibrolase is known to contain several alternate N-termini: QQRFP,
EQRFP and ERFP (in which "E" designates a cyclized glutamine, or
pyroglutamic acid). More specifically, starting with an N-terminus
composed of QQRFP, the fibrolase molecule undergoes degradation to
result in two isoforms, having N-terminal sequences of EQRFP and
ERFP, respectively. Recombinant fibrolase as produced in yeast
typically yields a mixture of all three of these forms and is thus
not homogeneous. See Loayza et al., Journal of Chromatography, B
662, pages 227-243 (1994). Moreover, the cyclized glutamine residue
results in a "blocked" N-terminus which makes sequencing
impossible.
[0009] In contrast, the recombinant NAT of this invention provides
a single species: only one N-terminus is typically produced. The
result is greater homogeneity of the end product compared to
recombinant fibrolase, which is beneficial when medical
applications are the intended end use.
BRIEF DESCRIPTION OF THE FIGURES
[0010] FIG. 1 depicts in linear fashion the full amino acid
sequence of NAT (SEQ ID NO: 3), consisting of the "prepro" region
(underscored), which includes the "signal" peptide, and the mature
polypeptide (non-underscored).
DETAILED DESCRIPTION OF THE INVENTION
[0011] NAT may be produced by recombinant expression of the nucleic
acid molecule of SEQ ID NO: 4, which encodes the full amino acid
sequence of NAT (SEQ ID NO: 3), including the prepro region from
nucleotides 1-783 and mature polypeptide from nucleotides 784-1386,
in a suitable host. Following expression, the prepro region is
enzymatically processed off in the host cell to yield the mature
active polypeptide (SEQ ID NO: 1).
[0012] Preferably, NAT is produced recombinantly in yeast, as will
be explained in greater detail further below.
[0013] The mature polypeptide (SEQ ID NO: 1) which is thus produced
may or may not have an amino terminal methionine, depending on the
manner in which it is prepared. Typically, an amino terminal
methionine residue will be present when the polypeptide is produced
recombinantly in a non-secreting bacterial (e.g., E. coli) strain
as the host.
[0014] Besides the nucleic acid molecule of SEQ ID NO: 2, also
utilizable are degenerate sequences thereof which encode the same
polypeptide. The present invention also embraces nucleic acid
molecules that may encode additional amino acid residues flanking
the 5' or 3' portions of the region encoding the mature
polypeptide, such as sequences encoding alternative pre/pro regions
(i.e., sequences responsible for secretion of the polypeptide
through cell membranes) in place of the "native" pre/pro region
(i.e., found in naturally occurring fibrolase). The additional
sequences may also be noncoding sequences, including regulatory
sequences such as promoters of transcription or translation,
depending on the host cell.
[0015] NAT can be prepared using well known recombinant DNA
technology methods, such as those set forth in Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989) and/or Ausubel et
al., editors, Current Protocols in Molecular Biology, Green
Publishers Inc. and Wiley and Sons, New York (1994). A DNA molecule
encoding the polypeptide or truncated version thereof may be
obtained, for example, by screening a genomic or cDNA library, or
by PCR amplification, to obtain a nucleic acid molecule encoding
fibrolase, followed by replacement of the codons encoding the
N-terminal amino acid residues QQR with a codon for serine (S).
Alternatively, a DNA molecule encoding NAT may be prepared by
chemical synthesis using methods well known to the skilled artisan,
such as those described by Engels et al. in Angew. Chem. Intl. Ed.,
Volume 28, pages 716-734 (1989). Typically, the DNA will be several
hundred nucleotides in length. Nucleic acids larger than about one
hundred nucleotides can be synthesized as several fragments using
these same methods and the fragments can then be ligated together
to form a nucleotide sequence of the desired length.
[0016] The DNA molecule is inserted into an appropriate expression
vector for expression in a suitable host cell. The vector is
selected to be functional in the particular host cell employed
(i.e., the vector is compatible with the host cell machinery, such
that expression of the DNA can occur). The polypeptide may be
expressed in prokaryotic, yeast, insect (baculovirus systems) or
eukaryotic host cells, although yeast is preferred as will be
explained in greater detail further below.
[0017] The vectors used in any of the host cells to express NAT may
also contain a 5' flanking sequence (also referred to as a
"promoter") and other expression regulatory elements operatively
linked to the DNA to be expressed, as well as enhancer(s), an
origin of replication element, a transcriptional termination
element, a complete intron sequence containing a donor and acceptor
splice site, a signal peptide sequence, a ribosome binding site
element, a polyadenylation sequence, a polylinker region for
inserting the nucleic acid encoding NAT, and a selectable marker
element. Each of these elements is discussed below.
[0018] Optionally, the vector may also contain a "tag" sequence,
i.e., an oligonucleotide sequence located at the 5' or 3' end of
the polypeptide-coding sequence that encodes polyHis (such as
hexaHis) or another small immunogenic sequence (such as the c-myc
or hemagglutinin epitope, for which antibodies, including
monoclonal antibodies, are commercially available). This tag will
be expressed along with NAT, and can serve as an affinity tag for
purification of this polypeptide from the host cell. Optionally,
the tag can subsequently be removed from the purified polypeptide
by various means, for example, with use of a selective
peptidase.
[0019] The 5' flanking sequence may be the native 5' flanking
sequence, or it may be homologous (i.e., from the same species
and/or strain as the host cell), heterologous (i.e., from a species
other than the host cell species or strain), hybrid (i.e., a
combination of 5' flanking sequences from more than one source), or
synthetic. The source of the 5' flanking sequence may be any
unicellular prokaryotic or eukaryotic organism, any vertebrate or
invertebrate organism, or any plant, provided that the 5' flanking
sequence is functional in, and can be activated by the host cell
machinery.
[0020] The origin of replication element is typically a part of
prokaryotic expression vectors purchased commercially and aids in
the amplification of the vector in a host cell. Amplification of
the vector to a certain copy number can, in some cases, be
important for optimal expression of NAT. If the vector of choice
does not contain an origin of replication site, one may be
chemically synthesized based on a known sequence, and then ligated
into the vector.
[0021] The transcription termination element is typically located
3' to the end of the polypeptide coding sequence and serves to
terminate transcription of the mRNA. Usually, the transcription
termination element in prokaryotic cells is a G-C rich fragment
followed by a poly T sequence. While the element is easily cloned
from a library or even purchased commercially as part of a vector,
it can also be readily synthesized using known methods for nucleic
acid synthesis.
[0022] A selectable marker gene element encodes a protein necessary
for the survival and growth of a host cell grown in a selective
culture medium. Typical selection marker genes encode proteins
that: (a) confer resistance to antibiotics or other toxins, for
example, ampicillin, tetracycline or kanamycin for prokaryotic host
cells, zeocin for yeast host cells, and neomycin for mammalian host
cells; (b) complement auxotrophic deficiencies of the cell; or (c)
supply critical nutrients not available from complex media.
Preferred selectable markers for use in prokaryotic expression are
the kanamycin resistance gene, the ampicillin resistance gene, and
the tetracycline resistance gene.
[0023] The ribosome binding element, commonly called the
Shine-Dalgarno sequence (for prokaryotes) or the Kozak sequence
(for eukaryotes), is necessary for the initiation of translation of
mRNA. The element is typically located 3' to the promoter and 5' to
the coding sequence of the polypeptide to be synthesized. The
Shine-Dalgarno sequence is varied but is typically a polypurine
(i.e., having a high A-G content). Many Shine-Dalgarno sequences
have been identified, each of which can be readily synthesized
using methods set forth above and used in a prokaryotic vector. The
Kozak sequence typically includes sequences immediately before and
after the initiating codon. A preferred Kozak sequence is one that
is associated with a high efficiency of initiation of translation
at the AUG start codon.
[0024] In those cases where it is desirable for NAT polypeptide to
be secreted from the host cell, a signal sequence may be used to
direct the polypeptide out of the host cell where it is
synthesized. Typically, the signal sequence is positioned in the
coding region of nucleic acid sequence, or directly at the 5' end
of the coding region. Many signal sequences have been identified,
and any of them that are functional in the selected host cell may
be used here. Consequently, the signal sequence may be homologous
or heterologous to the polypeptide. Additionally, the signal
sequence may be chemically synthesized using methods referred to
above.
[0025] After the vector has been constructed and a nucleic acid has
been inserted into the proper site of the vector, the completed
vector may be inserted into a suitable host cell for amplification
and/or polypeptide expression.
[0026] As mentioned, host cells may be prokaryotic (such as E.
coli) or eukaryotic (such as a yeast cell, an insect cell, or a
vertebrate cell). The host cell, whether it be yeast or some other
host, when cultured under appropriate conditions can synthesize
NAT, which can subsequently be collected from the culture medium
(if the host cell secretes it into the medium) or directly from the
host cell producing it (if it is not secreted). After collection,
NAT polypeptide can be purified using methods such as molecular
sieve chromatography, affinity chromatography, and the like.
[0027] Selection of the host cell will depend in large part on
whether the manner in which the host cell is able to "fold" NAT
into its native secondary and tertiary structure (e.g., proper
orientation of disulfide bridges, etc.) such that biologically
active material is prepared by the cell. However, even where the
host cell does not synthesize biologically active material, it may
be "folded" after synthesis using appropriate chemical conditions,
such as ones that are known to those skilled in the art. In either
case, proper folding can be inferred from the fact that
biologically active material has been obtained.
[0028] Suitable host cells or cell lines may be mammalian cells,
such as Chinese hamster ovary cells (CHO) or 3T3 cells. The
selection of suitable mammalian host cells and methods for
transformation, culture, amplification, screening and product
production and purification are known in the art. Other suitable
mammalian cell lines are the monkey COS-1 and COS-7 cell lines, and
the CV-1 cell line. Further exemplary mammalian host cells include
primate cell lines and rodent cell lines, including transformed
cell lines. Normal diploid cells, cell strains derived from in
vitro culture of primary tissue, as well as primary explants, are
also suitable. Candidate cells may be genotypically deficient in
the selection gene, or may contain a dominantly acting selection
gene. Still other suitable mammalian cell lines include but are not
limited to, HeLa, mouse L-929 cells, 3T3 lines derived from Swiss,
Balb-c or NIH mice, BHK or HaK hamster cell lines.
[0029] Also useful as host cells are bacterial cells. For example,
the various strains of E. coli (e.g., HB101, DH5a, DH10, and
MC1061) are well-known as host cells in the field of biotechnology.
Various strains of B. subtilis, Pseudomonas spp., other Bacillus
spp., Streptomyces spp., and the like, may also be employed.
Additionally, many strains of yeast cells known to those skilled in
the art are also available as host cells for expression of the
polypeptide of the present invention. Also, where desired, insect
cells may be utilized as host cells. See, for example, Miller et
al., Genetic Engineering, Volume 8, pages 277-298 (1986).
[0030] Insertion (also referred to as "transformation" or
"transfection") of the vector into the selected host cell may be
accomplished using such methods as calcium phosphate,
electroporation, microinjection, lipofection or the DEAE-dextran
method. The method selected will in part be a function of the type
of host cell to be used. These methods and other suitable methods
are well known to the skilled artisan, and are set forth, for
example, in Sambrook et al., above.
[0031] The host cells containing the vector may be cultured using
standard media well known to the skilled artisan. The media will
usually contain all nutrients necessary for the growth and survival
of the cells. Suitable media for culturing E. coli cells are, for
example, Luria Broth (LB) and/or Terrific Broth (TB). Suitable
media for culturing eukaryotic cells are RPMI 1640, MEM, DMEM, all
of which may be supplemented with serum and/or growth factors as
required by the particular cell line being cultured. A suitable
medium for insect cultures is Grace's medium supplemented with
yeastolate, lactalbumin hydrolysate and/or fetal calf serum, as
necessary.
[0032] Typically, an antibiotic or other compound useful for
selective growth of the transformed cells only is added as a
supplement to the media. The compound to be used will be dictated
by the selectable marker element present on the plasmid with which
the host cell was transformed. For example, where the selectable
marker element is kanamycin resistance, the compound added to the
culture medium will be kanamycin.
[0033] The amount of NAT produced in the host cell can be evaluated
using standard methods known in the art. Such methods include,
without limitation, Western blot analysis, SDS-polyacrylamide gel
electrophoresis, non-denaturing gel electrophoresis, HPLC
separation, immunoprecipitation, and/or activity assays such as DNA
binding gel shift assays.
[0034] If NAT is secreted from the host cells other than
gram-negative bacteria, the majority will likely be found in the
cell culture medium. If NAT is secreted from gram-negative
bacteria, it will to some degree be found in the periplasm. If NAT
is not secreted, it will be present in the cytoplasm.
[0035] For intracellular NAT, the host cells are typically first
disrupted mechanically. For NAT having a periplasmic location,
either mechanical disruption or osmotic treatment can be used to
release the periplasmic contents into a buffered solution. NAT
polypeptide is then isolated from this solution. Purification from
solution can thereafter be accomplished using a variety of
techniques. If NAT has been synthesized so that it contains a tag
such as hexahistidine or other small peptide at either its carboxyl
or amino terminus, it may essentially be purified in a one-step
process by passing the solution through an affinity column where
the column matrix has a high affinity for the tag or for the
polypeptide directly (i.e., a monoclonal antibody). For example,
polyhistidine binds with great affinity and specificity to nickel,
thus an affinity column of nickel (such as the Qiagen nickel
columns) can be used for purification. (See, for example, Ausubel
et al., editors, Current Protocols in Molecular Biology,
above).
[0036] Where, on the other hand, the polypeptide has no tag and no
antibodies are available, other well known procedures for
purification can be used. Such procedures include, without
limitation, ion exchange chromatography, molecular sieve
chromatography, reversed phase chromatography, HPLC, native gel
electrophoresis in combination with gel elution, and preparative
isoelectric focusing ("Isoprime" machine/technique, Hoefer
Scientific). In some cases, two or more of these techniques may be
combined to achieve increased purity.
[0037] Especially preferred for use in the production of NAT are
yeast cells, and most advantageously those of the yeast genus known
as Pichia (e.g., Pichia pastoris), because of the greater
efficiency of refolding compared to, for instance, bacterial cells
such as E. coli. Suitable recombinant methods of expression for
this yeast strain are described in U.S. Pat. Nos. 4,855,231
(Stroman et al.), 4,812,405 (Lair et al.), 4,818,700 (Cregg et
al.), 4,885,242 (Cregg) and 4,837,148 (Cregg), the disclosures of
which are incorporated herein by reference.
[0038] Notably, Pichia cells can also be used to express fibrolase
with similar efficiency from DNA molecules encoding this
metalloproteinase, and such a method constitutes an additional
aspect of the present invention. Fibrolase is a known
metalloproteinase which has been described in the scientific and
patent literature; see Randolph et al., and European Patent
Application No. 0 323 722, cited above. Typically, the fibrolase to
be expressed will be of SEQ ID NO: 5, which is encoded by the cDNA
molecule of SEQ ID NO: 6 (or variants thereof encoding the same
amino acid sequence). The expression of fibrolase in such a system
will typically involve a DNA molecule of SEQ ID NO: 7, which
encodes "prepro" sequence (nucleotides 1-783) in addition to the
"mature" polypeptide (nucleotides 784-1392).
[0039] Chemically modified versions of NAT in which the polypeptide
is linked to a polymer or other molecule to form a derivative in
order to modify properties are also included within the scope of
the present invention. For human therapeutic purposes especially,
it may be advantageous to derivatize NAT in such a manner by the
attachment of one or more other chemical moieties to the
polypeptide moiety. Such chemical moieties may be selected from
among various water soluble polymers. The polymer should be water
soluble so that the NAT polypeptide to which it is attached is
miscible in an aqueous environment, such as a physiological
environment. The water soluble polymer may be selected from the
group consisting of, for example, polyethylene glycol, copolymers
of ethylene glycol/propylene glycol, carboxymethylcellulose,
dextran, polyvinyl alcohol, polyvinyl pyrolidone,
poly-1,3-dioxolane, poly-1,3,6-trioxane, ethylene/maleic anhydride
copolymer, polyaminoacids (either homopolymers or random or
non-random copolymers (see further below regarding fusion
molecules), and dextran or poly(n-vinyl pyrolidone)polyethylene
glycol, propylene glycol homopolymers, polypropylene oxide/ethylene
oxide co-polymers, polyoxyethylated polyols, polystyrenemaleate and
polyvinyl alcohol. Polyethylene glycol propionaldenhyde may have
advantages in manufacturing due to its stability in water.
[0040] The polymer may be of any molecular weight, and may be
branched or unbranched. For polyethylene glycol, the preferred
molecular weight is between about 2 kilodaltons (kDa) and about 100
kDa (the term "about" indicating that in preparations of
polyethylene glycol, some molecules will weigh more, some less,
than the stated molecular weight) for ease in handling and
manufacturing. Other sizes may be used, depending on the desired
therapeutic profile (e.g., the duration of sustained release
desired, the effects, if any on biological activity, the ease in
handling, the degree or lack of antigenicity and other known
effects of the polyethylene glycol on a therapeutic protein).
[0041] The number of polymer molecules so attached may vary, and
one skilled in the art will be able to ascertain the effect on
function. One may mono-derivatize, or may provide for a di-, tri-,
tetra- or some combination of derivatization, with the same or
different chemical moieties (e.g., polymers, such as different
weights of polyethylene glycols). The proportion of polymer
molecules to NAT polypeptide molecules will vary, as will their
concentrations in the reaction mixture. In general, the optimum
ratio (in terms of efficiency of reaction in that there is no
excess unreacted polypeptide or polymer) will be determined by
factors such as the desired degree of derivatization (e.g., mono,
di-, tri-, etc.), the molecular weight of the polymer selected,
whether the polymer is branched or unbranched, and the reaction
conditions.
[0042] The chemical moieties should be attached to NAT with
consideration of effects on functional or antigenic domains of the
polypeptide. There are a number of attachment methods available to
those skilled in the art. See, for example, EP 0 401 384 (coupling
PEG to G-CSF), and Malik et al., Experimental Hematology, Volume
20, pages 1028-1035 (1992) (reporting the pegylation of GM-CSF
using tresyl chloride). By way of illustration, polyethylene glycol
may be covalently bound through amino acid residues via a reactive
group, such as, a free amino or carboxyl group. Reactive groups are
those to which an activated polyethylene glycol molecule (or other
chemical moiety) may be bound. The amino acid residues having a
free amino group may include lysine residues and the N-terminal
amino acid residue. Those having a free carboxyl group may include
aspartic acid residues, glutamic acid residues, and the C-terminal
amino acid residue. Sulfhydryl groups may also be used as a
reactive group for attaching the polyethylene glycol molecule(s)
(or other chemical moiety). Preferred for manufacturing purposes is
attachment at an amino group, such as at the N-terminus or to a
lysine group. Attachment at residues important for receptor binding
should be avoided if receptor binding is desired.
[0043] One may specifically desire N-terminally chemically modified
derivatives. Using polyethylene glycol as an illustration, one may
select from a variety of polyethylene glycol molecules (by
molecular weight, branching, etc.), the proportion of polyethylene
glycol molecules to polypeptide molecules in the reaction mixture,
the type of pegylation reaction to be performed, and the method of
obtaining the selected N-terminally pegylated NAT. The method of
obtaining the N-terminally pegylated preparation (i.e., separating
this moiety from other monopegylated moieties if necessary) may be
by purification of the N-terminally pegylated material from a
population of pegylated NAT molecules. Selective N-terminal
chemical modification may be accomplished by reductive alkylation
which exploits differential reactivity of different types of
primary amino groups (lysine versus the N-terminal) available for
derivatization. See PCT application WO 96/11953, published Apr. 25,
1996. Under the appropriate reaction conditions, substantially
selective derivatization of NAT at the N-terminus with a carbonyl
group containing polymer is achieved. For example, one may
selectively N-terminally pegylate NAT by performing the reaction at
a pH which allows one to take advantage of the pK.sub.a differences
between the .epsilon.-amino group of the lysine residues and that
of the .alpha.-amino group of the N-terminal residue of the
polypeptide. By such selective derivatization, attachment of a
polymer to a polypeptide is controlled: the conjugation with the
polymer takes place predominantly at the N-terminus of the
polypeptide and no significant modification of other reactive
groups, such as lysine side chain amino groups, occurs. Using
reductive alkylation, the polymer may be of the type described
above, and should have a single reactive aldehyde for coupling to
the polypeptide. Polyethylene glycol propionaldehyde, containing a
single reactive aldehyde, may be used.
[0044] NAT or chemically modified derivatives in accordance with
the invention may be formulated for in vivo administration, and
most preferably via intra-thrombus (i.e., via localized delivery
directly to the site of the clot in the blood vessel, e.g., as by
catheter). Systemic delivery is normally not preferred due to the
likelihood that innate a2 macroglobulin in the general circulation
may complex with NAT to prevent interaction with fibrin or
fibrinogen, thus impairing clot lysis. However, there may be
instances where larger amounts of NAT can be used which exceed the
circulating levels of .alpha.2 macroglobulin, thus enabling
systemic administration and delivery. In general, encompassed
within the invention are pharmaceutical compositions comprising
effective amounts of NAT together with pharmaceutically acceptable
diluents, preservatives, solubilizers, emulsifiers, adjuvants
and/or carriers. By "effective amount" is meant amount sufficient
to produce a measurable biological effect (i.e., a thrombolytically
effective amount which effects lysis of the blood clot or clots
being treated).
[0045] Typically, NAT will be in highly purified form, and any
pharmaceutical composition being used as the delivery vehicle will
normally be presterilized for use, such as by filtration through
sterile filtration membranes.
[0046] One skilled in the art will be able to ascertain effective
dosages by administration and observing the desired therapeutic
effect. Particular effective doses within this range will depend on
the particular disorder or condition being treated, as well as the
age and general health of the recipient, and can be determined by
standard clinical procedures. Where possible, it will be desirable
to determine the dose-response curve of the pharmaceutical
composition first in vitro, as in bioassay systems, and then in
useful animal model systems in vivo prior to testing in humans. The
skilled practitioner, considering the therapeutic context, type of
disorder under treatment, and other applicable factors, will be
able to ascertain proper dosing without undue effort. Typically, a
practitioner will administer the NAT composition until a dosage is
reached that achieves the desired effect (i.e., lysis of the blood
clot). The composition may be administered as a single dose, or as
two or more doses (which may or may not contain the same amount of
polypeptide) over time, or on a continuous basis.
[0047] NAT may also be used to generate antibodies in accordance
with standard methods. The antibodies may be polyclonal,
monoclonal, recombinant, chimeric, single-chain and/or bispecific,
etc. To improve the likelihood of producing an immune response, the
amino acid sequence of NAT can be analyzed to identify portions of
the molecule that may be associated with increased immunogenicity.
For example, the amino acid sequence may be subjected to computer
analysis to identify surface epitopes, such as in accordance with
the method of Hope and Woods, Proceedings of the National Academy
of Science USA, Volume 78, pages 3824-3828 (1981).
[0048] Various procedures known in the art can be used for the
production of polyclonal antibodies which recognize epitopes of
NAT. For the production of antibody, various host animals can be
immunized by injection with the polypeptide, including but not
limited to rabbits, mice, rats, etc. Various adjuvants may be used
to increase the immunological response, depending on the host
species, including but not limited to Freund's, mineral gels such
as aluminum hydroxide (alum), surface active substances such as
lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions, keyhole limpet hemocyanins, dinitrophenol, and
potentially useful human adjuvants such as Bacille Calmette-Guerin
and Corynebacterium parvum.
[0049] For the preparation of monoclonal antibodies directed toward
NAT, any technique which provides for the production of antibody
molecules by continuous cell lines in culture may be used. For
example, the hybridoma technique originally developed by Kohler and
Milstein which is described in Nature, Volume 256, pages 495-497
(1975), as well as the trioma technique, the human B-cell hybridoma
technique described by Kozbor et al. in Immunology Today, Volume 4,
page 72 (1983), and the EBV-hybridoma technique to produce
monoclonal antibodies described by Cole et al. in "Monoclonal
Antibodies and Cancer Therapy", Alan R. Liss, Inc., pages 77-96
(1985), are all useful for preparation of monoclonal antibodies in
accordance with this invention.
[0050] The antibodies of this invention can be used
therapeutically, such as to bind to and thereby neutralize or
inhibit excess amounts of NAT in vivo after administration. The
antibodies can further be used for diagnostic purposes, such as in
labeled form to detect the presence of NAT in a body fluid, tissue
sample or other extract, in accordance with known diagnostic
methods.
DESCRIPTION OF SPECIFIC EMBODIMENTS
[0051] The invention is further illustrated in the following
examples.
EXAMPLE 1
Derivation of NAT Sequence
[0052] An effective way to produce fibrolase is to express it
initially as preprofibolase in which cleavage by the protease kex-2
occurs at the junction of the "prepro" and "mature" regions to
yield biologically active material ("mature" fibrolase). From this
design, the synthesis and processing of the preprofibrolase leads
to secretion of mature fibrolase into the culture medium. The
actual sequence at the cleaved junction is ( . . . TKR.dwnarw.QQRF
. . . ).
[0053] Kex-2 is an endoprotease that cleaves after two adjacent
basic amino acids, in this case lysine(K)-arginine(R). Mature
fibrolase expressed from DNA having the above mentioned sequence
revealed that the expected N-terminal glutamine (Q) residue had in
fact undergone deamidation and cyclization to generate pyroglutamic
acid (E). This chemical modification was deemed undesirable, since
peptides with an N-terminal cyclized glutamine (pyroglutamic acid)
residue fail to react in the Edman-degradation procedure for amino
acid sequencing. Accordingly, both of the glutamine (Q) residues at
the N-terminus in the sequence for mature fibrolase were deleted,
resulting in an N-terminal arginine (R) residue. Since kex-2
cleaves after two adjacent basic amino acids as mentioned, it was
anticipated that the sequence ( . . . KRRF . . . ) would present an
ambiguous site for kex-2 cleavage. Accordingly, the N-terminal
arginine (R) residue (shown underlined above) was replaced with a
serine (S) residue to result in the sequence ( . . . KRSF . . . ).
The choice of serine was based on the need to introduce an amino
acid which facilitates kex-2 cleavage when it occurs on the
C-terminal side of the hydrolysis site. Rholam et al., European
Journal of Biochemistry, Volume 227, pages 707-714 (1995).
[0054] As a result, the DNA sequence for preprofibrolase was
modified by site-directed mutagenesis at the N-terminal coding
region for mature fibrolase to substitute the codons for "QQR" with
a codon for "S", using a standard PCR protocol, thus resulting in
preproNAT having the amino acid sequence of SEQ ID NO: 3. The
oligonucleotides used to prime the PCR reactions are listed below,
and their homology with the target sequence is also shown.
Initially, two PCR reactions were carried out using oligos 1 and 4
as one primer pair and oligos 2 and 3 as another primer pair, both
with DNA of the parent gene as the template. The DNA products of
these two reactions (601 and 815 nucleotides in length) were
purified by agarose gel electrophoresis and combined to serve as a
template in a second round of PCR using oligos 1 and 2 as the
primer pair. This final PCR product (1372 nucleotides in length)
was cleaved with restriction endonucleases XhoI and NotI. The
digest was deproteinized with phenol/chloroform and DNA
precipitated. A portion of the recovered DNA was ligated into the
plasmid pPICZ.alpha. (Invitrogen, Carlsbad, Calif., Catalog No.
VI95-20), which had been similarly cleaved with restriction
endonucleases XhoI and NotI, enzymatically dephosphorylated, and
deproteinized with phenol/chloroform. All subsequent steps were
carried out according to the Invitrogen Pichia Expression Kit
manual (Invitrogen Corp., Catalog No. K1710-01). The ligation
reaction products were transformed into E. coli by electroporation
and selected for survival on zeocin-containing solid media. The
plasmid was isolated and the profibrolase region was confirmed by
DNA sequencing. The plasmid was linearized by cleaving with
restriction endonuclease PmeI and then transformed into Pichia
pastoris GS115his.sup.+. The GS115 strain is normally his.sup.-, so
the his.sup.+ genotype was restored by transformation with a DNA
source carrying the wild type version of the his4 gene.
Alternatively, a his.sup.+ strain can be obtained commercially from
Invitrogen Corp. (X-33 cell line, Catalog No. C180-00). Integrants
were selected as zeocin-resistant colonies. Candidate clones were
induced in methanol-containing media, and the broth was assayed for
NAT production on 4-20% PAGE, using Coomassie staining.
[0055] The oligonucleotides used for site-directed PCR mutagenesis
were as follows: TABLE-US-00001 Oligo 1 (SEQ ID NO: 8)
5'-TACTATTGCCAGCATTGCTGC-3' Oligo 2 (SEQ ID NO: 9)
5'-GCAAATGGCATTCTGACATCC-3' Oligo 3 (SEQ ID NO: 10)
5'-TCCAATTAAACTTGACTAAGAGATCTTTCCCACAAAGATACGTA C-3' Oligo 4 (SEQ
ID NO: 11) 5'-GTACGTATCTTTGTGGGAAAGATCTCTTAGTCAAGTTTAATTGG-3'
[0056] The location of these oligonucleotides is shown below in
relation to the double-stranded DNA sequence (SEQ ID NO: 12 coding
or sense strand, SEQ ID NO: 13 complementary or antisense strand)
and corresponding amino acid sequence (SEQ ID NO: 14) of fibrolase
(including the prepro region) being modified to create NAT. The
N-terminal and C-terminal regions of mature fibrolase are indicated
by underlining of terminal amino acid sequences (QQRF and LNKP).
The N-terminal region (QQRF) is the one being modified (to
substitute S for QQR). For oligos 3 and 4, below, dashed lines are
inserted to denote the location of the omitted codons encoding for
residues QQ in the N-terminal region of fibrolase. TABLE-US-00002
ATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCATCCTCCGCATTAGCTGCT
---------+---------+---------+---------+---------+---------+
TACTCTAAAGGAAGTTAAAAATGACGACAAAATAAGCGTCGTAGGAGGCGTAATCGACGA M R F
P S I F T A V L F A A S S A L A A
CCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGT
---------+---------+---------+---------+---------+---------+
GGTCAGTTGTGATGTTGTCTTCTACTTTGCCGTGTTTAAGGCCGACTTCGACAGTAGCCA P V N
T T T E D E T A Q I P A E A V I G
TACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAAT
---------+---------+---------+---------+---------+---------+
ATGAGTCTAAATCTTCCCCTAAAGCTACAACGACAAAACGGTAAAAGGTTGTCGTGTTTA Y S D
L E G D F D V A V L P F S N S T N Oligo 1
5'-TACTATTGCCAGCATTGCTGC-3'
AACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTA
---------+---------+---------+---------+---------+---------+
TTGCCCAATAACAAATATTTATGATGATAACGGTCGTAACGACGATTTCTTCTTCCCCAT N G L
L F I N T T I A S I A A K E E G V XhoI |
TCTCTCGAGAAAAGAGAGGCTGAAGCTTCTTCTATTATCTTGGAATCTGGTAACGTTAAC
---------+---------+---------+---------+---------+---------+
AGAGAGCTCTTTTCTCTCCGACTTCGAAGAAGATAATAGAACCTTAGACCATTGCAATTG S L E
K R E A E A S S I I L E S G N V N
GATTACGAAGTTGTTTATCCAAGAAAGGTCACTCCAGTTCCTAGGGGTGCTGTTCAACCA
---------+---------+---------+---------+---------+---------+
CTAATGCTTCAACAAATAGGTTCTTTCCAGTGAGGTCAAGGATCCCCACGACAAGTTGGT D Y E
V V Y P R K V T P V P R G A V Q P
AAGTACGAAGATGCCATGCAATACGAATTCAAGGTTAACAGTGAACCAGTTGTCTTGCAC
---------+---------+---------+---------+---------+---------+
TTCATGCTTCTACGGTACGTTATGCTTAAGTTCCAATTGTCACTTGGTCAACAGAACGTG K Y E
D A M Q Y E F K V N S E P V V L H
TTGGAAAAAAACAAAGGTTTGTTCTCTGAAGATTACTCTGAAACTCATTACTCCCCAGAT
---------+---------+---------+---------+---------+---------+
AACCTTTTTTTGTTTCCAAACAAGAGACTTCTAATGAGACTTTGAGTAATGAGGGGTCTA L E K
N K G L F S E D Y S E T H Y S P D
GGTAGAGAAATTACTACTTACCCATTGGGTGAAGATCACTGTTACTACCATGGTAGAATC
---------+---------+---------+---------+---------+---------+
CCATCTCTTTAATGATGAATGGGTAACCCACTTCTAGTGACAATGATGGTACCATCTTAG G R E
I T T Y P L G E D H C Y Y H G R I
GAAAACGATGCTGACTCCACTGCTTCTATCTCTGCTTGTAACGGTTTGAAGGGTCATTTC
---------+---------+---------+---------+---------+---------+
CTTTTGCTACGACTGAGGTGACGAAGATAGAGACGAACATTGCCAAACTTCCCAGTAAAG E N D
A D S T A S I S A C N G L K G H F
AAGTTGCAAGGTGAAATGTACTTGATTGAACCATTGGAATTGTCCGACTCTGAAGCCCAT
---------+---------+---------+---------+---------+---------+
TTCAACGTTCCACTTTACATGAACTAACTTGGTAACCTTAACAGGCTGAGACTTCGGGTA K L Q
G E M Y L I E P L E L S D S E A H
GCTGTCTACAAGTACGAAAACGTCGAAAAGGAAGATGAAGCCCCAAAGATGTGTGGTGTT
---------+---------+---------+---------+---------+---------+
CGACAGATGTTCATGCTTTTGCAGCTTTTCCTTCTACTTCGGGGTTTCTACACACCACAA A V Y
K Y E N V E K E D E A P K M C G V Oligo 3' 5'-TCCAATTAAACTTGACTAAG
ACCCAAAACTGGGAATCATATGAACCAATCAAGAAGGCCTTCCAATTAAACTTGACTAAG
---------+---------+---------+---------+---------+---------+
TGGGTTTTGACCCTTAGTATACTTGGTTAGTTCTTCCGGAAGGTTAATTTGAACTGATTC Oligo
4 3'-GGTTAATTTGAACTGATTC T Q N W E S Y E P I K K A F Q L N L T K
AGA------TCTTTCCCACAAAGATACGTAC-3'
AGACAACAAAGATTCCCACAAAGATACGTACAGCTGGTTATCGTTGCTGACCACCGTATG
---------+---------+---------+---------+---------+---------+
TCTGTTGTTTCTAAGGGTGTTTCTATGCATGTCGACCAATAGCAACGACTGGTGGCATAC
TCT------AGAAAGGGTGTTTCTATGCATG-5' P Q Q R F P Q R Y V Q L V I V A
D H R M
AACACTAAATACAACGGTGACTCTGACAAAATCCGTCAATGGGTGCACCAAATCGTCAAC
---------+---------+---------+---------+---------+---------+
TTGTGATTTATGTTGCCACTGAGACTGTTTTAGGCAGTTACCCACGTGGTTTAGCAGTTG N T K
Y N G D S D K I R Q W V H Q I V N
ACCATTAACGAAATCTACAGACCACTGAACATCCAATTCACTTTGGTTGGTTTGGAAATC
---------+---------+---------+---------+---------+---------+
TGGTAATTGCTTTAGATGTCTGGTGACTTGTAGGTTAAGTGAAACCAACCAAACCTTTAG T I N
E I Y R P L N I Q F T L V G L E I
TGGTCCAACCAAGATTTGATCACCGTTACTTCTGTATCCCACGACACTCTGGCATCCTTC
---------+---------+---------+---------+---------+---------+
ACCAGGTTGGTTCTAAACTAGTGGCAATGAAGACATAGGGTGCTGTGAGACCGTAGGAAG W S N
Q D L I T V T S V S H D T L A S F
GGTAACTGGCGTGAAACCGACCTGCTGCGTCGCCAACGTCATGATAACGCTCAACTGCTG
---------+---------+---------+---------+---------+---------+
CCATTGACCGCACTTTGGCTGGACGACGCAGCGGTTGCAGTACTATTGCGAGTTGACGAC G N W
R E T D L L R R Q R H D N A Q L L
ACCGCTATCGACTTCGACGGTGATACTGTTGGTCTGGCTTACGTTGGTGGCATGTGTCAA
---------+---------+---------+---------+---------+---------+
TGGCGATAGCTGAAGCTGCCACTATGACAACCAGACCGAATGCAACCACCGTACACAGTT T A I
D F D G D T V G L A Y V G G M C Q
CTGAAACATTCTACTGGTGTTATCCAGGACCACTCCGCTATTAACCTGCTGGTTGCTCTG
---------+---------+---------+---------+---------+---------+
GACTTTGTAAGATGACCACAATAGGTCCTGGTGAGGCGATAATTGGACGACCAACGAGAC L K H
S T G V I Q D H S A I N L L V A L
ACCATGGCACACGAACTGGGTCATAACCTGGGTATGAACCACGATGGCAACCAGTGTCAC
---------+---------+---------+---------+---------+---------+
TGGTACCGTGTGCTTGACCCAGTATTGGACCCATACTTGGTGCTACCGTTGGTCACAGTG T M A
H E L G H N L G M N H D G N Q C H
TGCGGTGCAAACTCCTGTGTTATGGCTGCTATGCTGTCCGATCAACCATCCAAACTGTTC
---------+---------+---------+---------+---------+---------+
ACGCCACGTTTGAGGACACAATACCGACGATACGACAGGCTAGTTGGTAGGTTTGACAAG C G A
N S C V M A A M L S D Q P S K L F
TCCGACTGCTCTAAGAAAGACTACCAGACCTTCCTGACCGTTAACAACCCGCAGTGTATC
---------+---------+---------+---------+---------+---------+
AGGCTGACGAGATTCTTTCTGATGGTCTGGAAGGACTGGCAATTGTTGGGCGTCACATAG S D C
S K K D Y Q T F L T V N N P Q C I NotI |
CTGAACAAACCGTAAGCGGCCGCCAGCTTTCTAGAACAAAAACTCATCTCAGAAGAGGAT
---------+---------+---------+---------+---------+---------+
GACTTGTTTGGCATTCGCCGGCGGTCGAAAGATCTTGTTTTTGAGTAGAGTCTTCTCCTA L N K
P * A A A S F L E Q K L I S E E D
CTGAATAGCGCCGTCGACCATCATCATCATCATCATTGAGTTTGTAGCCTTAGACATGAC
---------+---------+---------+---------+---------+---------+
GACTTATCGCGGCAGCTGGTAGTAGTAGTAGTAGTAACTCAAACATCGGAATCTGTACTG L N S
A V D H H H H H H * V C S L R H D
TGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAG
---------+---------+---------+---------+---------+---------+
ACAAGGAGTCAAGTTCAACCCGTGAATGCTCTTCTGGCCAGAACGATCTAAGATTAGTTC C S S
V Q V G H L R E D R S C * I L I K
AGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATT
---------+---------+---------+---------+---------+---------+
TCCTACAGTCTTACGGTAAACGGACTCTCTACGTCCGAAGTAAAAACTATGAAAAAATAA
CCTACAGTCTTACGGTAAACG-5' Oligo 2 R M S E C H L P E R C R L H F * Y
F F I
EXAMPLE 2
Expression of NAT in Pichia pastoris
[0057] When attempts were made to express the DNA for NAT in E.
coli, very poor refolding and a requirement for dilute conditions
reduced the purification efficiency. These and other considerations
led to the usage of Pichia pastoris, a yeast species, as the host
cell. A culture of selected clones of Pichia pastoris which had
been transfected with prepro NAT cDNA (SEQ ID NO: 4) was inoculated
into 500 ml of the following inoculation growth medium:
TABLE-US-00003 Per liter of batch medium Yeast extract 30.0 g
Potassium phosphate dibasic 17.2 g Glucose 20.0 g Biotin 0.004 g
Water to 1 liter Phosphoric acid, 85% to adjust pH to 6.00
[0058] The transfected P. pastoris cells were incubated at
30.degree. C. in a shaker for about 30 to 32 hours. About 1% (w/v)
of the resulting culture was used to inoculate a 10-liter
fermentor. The fermentor contained sterilized basal salts and
glucose (below). Twelve milliliters per liter of PTM4 salts (PTM4
is a trace metals solution containing cupric sulfate pentahydrate,
sodium iodide, manganese sulfate monohydrate, sodium molybdate
dihydrate, boric acid, cobaltous chloride hexahydrate, zinc
chloride, ferrous sulfate heptahydrate, d-biotin, sulfuric acid and
purified water) were added per liter of batch medium after
fermentor sterilization. The fermentation growth temperature was
30.degree. C. The fermentor pH was controlled with ammonium
hydroxide and phosphoric acid at pH 6.00. Zinc from the zinc salts
added to the medium becomes incorporated into NAT as part of the
metalloproteinase structure. TABLE-US-00004 Basal salts per liter
of batch medium Phosphoric acid, 85% 26.7 ml Calcium sulfate 0.93 g
Potassium sulfate 18.2 g Magnesium sulfate-7H.sub.2O 14.9 g
Potassium hydroxide 4.13 g Glucose 30.0 g Water to 1 liter
[0059] The batch culture was grown until the glucose was completely
consumed (17 to 20 hours). Then a fed-batch phase was initiated.
The fed-batch phase media consisted of glucose and 12 ml of PTM4
salts per liter. The induction feed consisted of glucose, 25%
methanol, and 12 ml of PTM4 salts per liter. At induction, the
temperature of the reactor was shifted to 20.degree. C. The
induction phase lasted 60 to 75 hours. The conditioned media were
harvested and the cellular debris was discarded.
EXAMPLE 3
Purification of NAT from Pichia pastoris
[0060] The yeast broth (conditioned media less cellular debris)
from Example 2 was clarified and the pH and conductivity were
adjusted to 6.5 and 10-20 mS/cm, respectively. The broth was loaded
onto an immobilized metal affinity resin that had been charged with
copper (Cu) and equilibrated with phosphate buffered saline (PBS).
The resin was washed with PBS and eluted with an imidazole gradient
(0-100 mM) in PBS. Fractions containing "mature" NAT (SEQ ID NO: 1)
were pooled and diluted until the conductivity was less than 1.5
mS/cm, pH 6.4. The diluted pool was loaded onto an SP Sepharose
resin (Amersham Pharmacia Biotech, Inc., Piscataway, N.J.) that had
been equilibrated with 10 mM 2-(N-morpholino)ethanesulfonic acid
(MES). The column was washed with MES and eluted with a NaCl
gradient (0-500 mM) in MES. Fractions containing NAT were pooled
and stored.
EXAMPLE 4
[0061] Thrombolysis in Acute Thrombosis of Rat Carotid Artery;
Comparison of NAT with Urokinase
[0062] To demonstrate that "mature" NAT (SEQ ID NO: 1) is
biologically active and functionally unique, acute pharmacology
studies were conducted in rats where focal injury to one of the
carotid arteries was created by applying anodal current. This
injury produces an occlusive thrombus which generally forms within
fifteen minutes. Once the thrombus was formed, the artery was
observed for a period of thirty minutes to assure that the carotid
occlusion was stable. Then heparin and aspirin were administered
intravenously to prevent further propagation of the thrombus. The
animals were then treated with an intraarterial infusion of test
material. Blood flow through the carotid artery was monitored
during the delivery of test material so that successful clot lysis
could be detected and the time at which clot lysis occurred could
be noted. The percentage of experiments where clot lysis occurred
was noted and group means were calculated for only those
experiments where clot lysis was successful. As a measure of the
hemorrhagic potential of the test material, any blood that was shed
from the surgical site was collected with gauze swabs. The swabs
were placed in a detergent solution to solubilize red blood cells
and release hemoglobin, which was then quantified
spectrophotometrically. Shed hemoglobin was used to calculate a
volume of blood loss. Test data are reported in the Table below.
TABLE-US-00005 TABLE 1 Incidence of Clot Lysis, Time to Clot Lysis
and Surgical Blood Loss (Mean .+-. std. dev.) INCIDENCE TIME TO OF
LYSIS LYSIS BLOOD LOSS (%) (min) (ml) SALINE 0% N/A 0.10 .+-. 0.23
(n = 6) (0 of 6) Urokinase 33% 55.3 .+-. 15.9 1.06 .+-. 1.59 25
U/min (5 of 15) (n = 15) Urokinase 86% 33.5 .+-. 15.3 1.43 .+-.
1.45 250 U/min (13 of 15) (n = 15) NAT 2 mg 78% 6.3 .+-. 5.8 0.96
.+-. 0.77 (n = 14) (11 of 14)
[0063] These studies establish that NAT is biologically active in
an animal model of in vivo clot lysis. Further, clot lysis was
achieved in a markedly reduced amount of time and with less blood
loss from the surgical site, in comparison with urokinase. Thus,
the activity profile of NAT can be distinguished from the
plasminogen activator class of thrombolytic agents (represented by
urokinase) in that clot lysis with NAT occurs more rapidly and with
reduced hemorrhagic complications.
[0064] The fibrinolytic activity of NAT is comparable to that of
fibrolase. In addition, as mentioned above the stability of the
N-terminus of NAT results in a more homogeneous end product upon
recombinant expression, which is a distinct advantage (i.e., the
N-terminus will not change over time resulting in a mixture of
different forms, thus making the polypeptide more stable).
Sequence CWU 1
1
29 1 201 PRT Artificial NAT (analog of fibrolase of Agkistrodon
Contourtrix) 1 Ser Phe Pro Gln Arg Tyr Val Gln Leu Val Ile Val Ala
Asp His Arg 1 5 10 15 Met Asn Thr Lys Tyr Asn Gly Asp Ser Asp Lys
Ile Arg Gln Trp Val 20 25 30 His Gln Ile Val Asn Thr Ile Asn Glu
Ile Tyr Arg Pro Leu Asn Ile 35 40 45 Gln Phe Thr Leu Val Gly Leu
Glu Ile Trp Ser Asn Gln Asp Leu Ile 50 55 60 Thr Val Thr Ser Val
Ser His Asp Thr Leu Ala Ser Phe Gly Asn Trp 65 70 75 80 Arg Glu Thr
Asp Leu Leu Arg Arg Gln Arg His Asp Asn Ala Gln Leu 85 90 95 Leu
Thr Ala Ile Asp Phe Asp Gly Asp Thr Val Gly Leu Ala Tyr Val 100 105
110 Gly Gly Met Cys Gln Leu Lys His Ser Thr Gly Val Ile Gln Asp His
115 120 125 Ser Ala Ile Asn Leu Leu Val Ala Leu Thr Met Ala His Glu
Leu Gly 130 135 140 His Asn Leu Gly Met Asn His Asp Gly Asn Gln Cys
His Cys Gly Ala 145 150 155 160 Asn Ser Cys Val Met Ala Ala Met Leu
Ser Asp Gln Pro Ser Lys Leu 165 170 175 Phe Ser Asp Cys Ser Lys Lys
Asp Tyr Gln Thr Phe Leu Thr Val Asn 180 185 190 Asn Pro Gln Cys Ile
Leu Asn Lys Pro 195 200 2 603 DNA Artificial Native pro-NAT (analog
of fibrolase) 2 tctttcccac aaagatacgt acagctggtt atcgttgctg
accaccgtat gaacactaaa 60 tacaacggtg actctgacaa aatccgtcaa
tgggtgcacc aaatcgtcaa caccattaac 120 gaaatctaca gaccactgaa
catccaattc actttggttg gtttggaaat ctggtccaac 180 caagatttga
tcaccgttac ttctgtatcc cacgacactc tggcatcctt cggtaactgg 240
cgtgaaaccg acctgctgcg tcgccaacgt catgataacg ctcaactgct gaccgctatc
300 gacttcgacg gtgatactgt tggtctggct tacgttggtg gcatgtgtca
actgaaacat 360 tctactggtg ttatccagga ccactccgct attaacctgc
tggttgctct gaccatggca 420 cacgaactgg gtcataacct gggtatgaac
cacgatggca accagtgtca ctgcggtgca 480 aactcctgtg ttatggctgc
tatgctgtcc gatcaaccat ccaaactgtt ctccgactgc 540 tctaagaaag
actaccagac cttcctgacc gttaacaacc cgcagtgtat cctgaacaaa 600 ccg 603
3 462 PRT Artificial Native pro-NAT (analog of fibrolase) 3 Met Arg
Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala Ser Ser 1 5 10 15
Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln 20
25 30 Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp
Phe 35 40 45 Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn
Gly Leu Leu 50 55 60 Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala
Lys Glu Glu Gly Val 65 70 75 80 Ser Leu Glu Lys Arg Glu Ala Glu Ala
Ser Ser Ile Ile Leu Glu Ser 85 90 95 Gly Asn Val Asn Asp Tyr Glu
Val Val Tyr Pro Arg Lys Val Thr Pro 100 105 110 Val Pro Arg Gly Ala
Val Gln Pro Lys Tyr Glu Asp Ala Met Gln Tyr 115 120 125 Glu Phe Lys
Val Asn Ser Glu Pro Val Val Leu His Leu Glu Lys Asn 130 135 140 Lys
Gly Leu Phe Ser Glu Asp Tyr Ser Glu Thr His Tyr Ser Pro Asp 145 150
155 160 Gly Arg Glu Ile Thr Thr Tyr Pro Leu Gly Glu Asp His Cys Tyr
Tyr 165 170 175 His Gly Arg Ile Glu Asn Asp Ala Asp Ser Thr Ala Ser
Ile Ser Ala 180 185 190 Cys Asn Gly Leu Lys Gly His Phe Lys Leu Gln
Gly Glu Met Tyr Leu 195 200 205 Ile Glu Pro Leu Glu Leu Ser Asp Ser
Glu Ala His Ala Val Tyr Lys 210 215 220 Tyr Glu Asn Val Glu Lys Glu
Asp Glu Ala Pro Lys Met Cys Gly Val 225 230 235 240 Thr Gln Asn Trp
Glu Ser Tyr Glu Pro Ile Lys Lys Ala Phe Gln Leu 245 250 255 Asn Leu
Thr Lys Arg Ser Phe Pro Gln Arg Tyr Val Gln Leu Val Ile 260 265 270
Val Ala Asp His Arg Met Asn Thr Lys Tyr Asn Gly Asp Ser Asp Lys 275
280 285 Ile Arg Gln Trp Val His Gln Ile Val Asn Thr Ile Asn Glu Ile
Tyr 290 295 300 Arg Pro Leu Asn Ile Gln Phe Thr Leu Val Gly Leu Glu
Ile Trp Ser 305 310 315 320 Asn Gln Asp Leu Ile Thr Val Thr Ser Val
Ser His Asp Thr Leu Ala 325 330 335 Ser Phe Gly Asn Trp Arg Glu Thr
Asp Leu Leu Arg Arg Gln Arg His 340 345 350 Asp Asn Ala Gln Leu Leu
Thr Ala Ile Asp Phe Asp Gly Asp Thr Val 355 360 365 Gly Leu Ala Tyr
Val Gly Gly Met Cys Gln Leu Lys His Ser Thr Gly 370 375 380 Val Ile
Gln Asp His Ser Ala Ile Asn Leu Leu Val Ala Leu Thr Met 385 390 395
400 Ala His Glu Leu Gly His Asn Leu Gly Met Asn His Asp Gly Asn Gln
405 410 415 Cys His Cys Gly Ala Asn Ser Cys Val Met Ala Ala Met Leu
Ser Asp 420 425 430 Gln Pro Ser Lys Leu Phe Ser Asp Cys Ser Lys Lys
Asp Tyr Gln Thr 435 440 445 Phe Leu Thr Val Asn Asn Pro Gln Cys Ile
Leu Asn Lys Pro 450 455 460 4 1386 DNA Artificial Encodes pro-NAT
(analog of fibrolase) 4 atgagatttc cttcaatttt tactgctgtt ttattcgcag
catcctccgc attagctgct 60 ccagtcaaca ctacaacaga agatgaaacg
gcacaaattc cggctgaagc tgtcatcggt 120 tactcagatt tagaagggga
tttcgatgtt gctgttttgc cattttccaa cagcacaaat 180 aacgggttat
tgtttataaa tactactatt gccagcattg ctgctaaaga agaaggggta 240
tctctcgaga aaagagaggc tgaagcttct tctattatct tggaatctgg taacgttaac
300 gattacgaag ttgtttatcc aagaaaggtc actccagttc ctaggggtgc
tgttcaacca 360 aagtacgaag atgccatgca atacgaattc aaggttaaca
gtgaaccagt tgtcttgcac 420 ttggaaaaaa acaaaggttt gttctctgaa
gattactctg aaactcatta ctccccagat 480 ggtagagaaa ttactactta
cccattgggt gaagatcact gttactacca tggtagaatc 540 gaaaacgatg
ctgactccac tgcttctatc tctgcttgta acggtttgaa gggtcatttc 600
aagttgcaag gtgaaatgta cttgattgaa ccattggaat tgtccgactc tgaagcccat
660 gctgtctaca agtacgaaaa cgtcgaaaag gaagatgaag ccccaaagat
gtgtggtgtt 720 acccaaaact gggaatcata tgaaccaatc aagaaggcct
tccaattaaa cttgactaag 780 agatctttcc cacaaagata cgtacagctg
gttatcgttg ctgaccaccg tatgaacact 840 aaatacaacg gtgactctga
caaaatccgt caatgggtgc accaaatcgt caacaccatt 900 aacgaaatct
acagaccact gaacatccaa ttcactttgg ttggtttgga aatctggtcc 960
aaccaagatt tgatcaccgt tacttctgta tcccacgaca ctctggcatc cttcggtaac
1020 tggcgtgaaa ccgacctgct gcgtcgccaa cgtcatgata acgctcaact
gctgaccgct 1080 atcgacttcg acggtgatac tgttggtctg gcttacgttg
gtggcatgtg tcaactgaaa 1140 cattctactg gtgttatcca ggaccactcc
gctattaacc tgctggttgc tctgaccatg 1200 gcacacgaac tgggtcataa
cctgggtatg aaccacgatg gcaaccagtg tcactgcggt 1260 gcaaactcct
gtgttatggc tgctatgctg tccgatcaac catccaaact gttctccgac 1320
tgctctaaga aagactacca gaccttcctg accgttaaca acccgcagtg tatcctgaac
1380 aaaccg 1386 5 203 PRT Agkistrodon contortrix misc_feature
Native fibrolase of Agkistrodon contortrix 5 Gln Gln Arg Phe Pro
Gln Arg Tyr Val Gln Leu Val Ile Val Ala Asp 1 5 10 15 His Arg Met
Asn Thr Lys Tyr Asn Gly Asp Ser Asp Lys Ile Arg Gln 20 25 30 Trp
Val His Gln Ile Val Asn Thr Ile Asn Glu Ile Tyr Arg Pro Leu 35 40
45 Asn Ile Gln Phe Thr Leu Val Gly Leu Glu Ile Trp Ser Asn Gln Asp
50 55 60 Leu Ile Thr Val Thr Ser Val Ser His Asp Thr Leu Ala Ser
Phe Gly 65 70 75 80 Asn Trp Arg Glu Thr Asp Leu Leu Arg Arg Gln Arg
His Asp Asn Ala 85 90 95 Gln Leu Leu Thr Ala Ile Asp Phe Asp Gly
Asp Thr Val Gly Leu Ala 100 105 110 Tyr Val Gly Gly Met Cys Gln Leu
Lys His Ser Thr Gly Val Ile Gln 115 120 125 Asp His Ser Ala Ile Asn
Leu Leu Val Ala Leu Thr Met Ala His Glu 130 135 140 Leu Gly His Asn
Leu Gly Met Asn His Asp Gly Asn Gln Cys His Cys 145 150 155 160 Gly
Ala Asn Ser Cys Val Met Ala Ala Met Leu Ser Asp Gln Pro Ser 165 170
175 Lys Leu Phe Ser Asp Cys Ser Lys Lys Asp Tyr Gln Thr Phe Leu Thr
180 185 190 Val Asn Asn Pro Gln Cys Ile Leu Asn Lys Pro 195 200 6
609 DNA Agkistrodon contortrix 6 caacaaagat tcccacaaag atacgtacag
ctggttatcg ttgctgacca ccgtatgaac 60 actaaataca acggtgactc
tgacaaaatc cgtcaatggg tgcaccaaat cgtcaacacc 120 attaacgaaa
tctacagacc actgaacatc caattcactt tggttggttt ggaaatctgg 180
tccaaccaag atttgatcac cgttacttct gtatcccacg acactctggc atccttcggt
240 aactggcgtg aaaccgacct gctgcgtcgc caacgtcatg ataacgctca
actgctgacc 300 gctatcgact tcgacggtga tactgttggt ctggcttacg
ttggtggcat gtgtcaactg 360 aaacattcta ctggtgttat ccaggaccac
tccgctatta acctgctggt tgctctgacc 420 atggcacacg aactgggtca
taacctgggt atgaaccacg atggcaacca gtgtcactgc 480 ggtgcaaact
cctgtgttat ggctgctatg ctgtccgatc aaccatccaa actgttctcc 540
gactgctcta agaaagacta ccagaccttc ctgaccgtta acaacccgca gtgtatcctg
600 aacaaaccg 609 7 1392 DNA Agkistrodon contortrix 7 atgagatttc
cttcaatttt tactgctgtt ttattcgcag catcctccgc attagctgct 60
ccagtcaaca ctacaacaga agatgaaacg gcacaaattc cggctgaagc tgtcatcggt
120 tactcagatt tagaagggga tttcgatgtt gctgttttgc cattttccaa
cagcacaaat 180 aacgggttat tgtttataaa tactactatt gccagcattg
ctgctaaaga agaaggggta 240 tctctcgaga aaagagaggc tgaagcttct
tctattatct tggaatctgg taacgttaac 300 gattacgaag ttgtttatcc
aagaaaggtc actccagttc ctaggggtgc tgttcaacca 360 aagtacgaag
atgccatgca atacgaattc aaggttaaca gtgaaccagt tgtcttgcac 420
ttggaaaaaa acaaaggttt gttctctgaa gattactctg aaactcatta ctccccagat
480 ggtagagaaa ttactactta cccattgggt gaagatcact gttactacca
tggtagaatc 540 gaaaacgatg ctgactccac tgcttctatc tctgcttgta
acggtttgaa gggtcatttc 600 aagttgcaag gtgaaatgta cttgattgaa
ccattggaat tgtccgactc tgaagcccat 660 gctgtctaca agtacgaaaa
cgtcgaaaag gaagatgaag ccccaaagat gtgtggtgtt 720 acccaaaact
gggaatcata tgaaccaatc aagaaggcct tccaattaaa cttgactaag 780
agacaacaaa gattcccaca aagatacgta cagctggtta tcgttgctga ccaccgtatg
840 aacactaaat acaacggtga ctctgacaaa atccgtcaat gggtgcacca
aatcgtcaac 900 accattaacg aaatctacag accactgaac atccaattca
ctttggttgg tttggaaatc 960 tggtccaacc aagatttgat caccgttact
tctgtatccc acgacactct ggcatccttc 1020 ggtaactggc gtgaaaccga
cctgctgcgt cgccaacgtc atgataacgc tcaactgctg 1080 accgctatcg
acttcgacgg tgatactgtt ggtctggctt acgttggtgg catgtgtcaa 1140
ctgaaacatt ctactggtgt tatccaggac cactccgcta ttaacctgct ggttgctctg
1200 accatggcac acgaactggg tcataacctg ggtatgaacc acgatggcaa
ccagtgtcac 1260 tgcggtgcaa actcctgtgt tatggctgct atgctgtccg
atcaaccatc caaactgttc 1320 tccgactgct ctaagaaaga ctaccagacc
ttcctgaccg ttaacaaccc gcagtgtatc 1380 ctgaacaaac cg 1392 8 21 DNA
Artificial Oligonucleotide 8 tactattgcc agcattgctg c 21 9 21 DNA
Artificial Oligonucleotide 9 gcaaatggca ttctgacatc c 21 10 45 DNA
Artificial Oligonucleotide 10 tccaattaaa cttgactaag agatctttcc
cacaaagata cgtac 45 11 44 DNA Artificial Oligonucleotide 11
gtacgtatct ttgtgggaaa gatctcttag tcaagtttaa ttgg 44 12 1620 DNA
Agkistrodon contortrix misc_feature (1)..(1620) Complementary
(sense) strand of antisense strand (See SEQ ID NO13 misc_feature
Coding sequence of native pro-fibrolase of Agkistrodon contortrix
12 atgagatttc cttcaatttt tactgctgtt ttattcgcag catcctccgc
attagctgct 60 ccagtcaaca ctacaacaga agatgaaacg gcacaaattc
cggctgaagc tgtcatcggt 120 tactcagatt tagaagggga tttcgatgtt
gctgttttgc cattttccaa cagcacaaat 180 aacgggttat tgtttataaa
tactactatt gccagcattg ctgctaaaga agaaggggta 240 tctctcgaga
aaagagaggc tgaagcttct tctattatct tggaatctgg taacgttaac 300
gattacgaag ttgtttatcc aagaaaggtc actccagttc ctaggggtgc tgttcaacca
360 aagtacgaag atgccatgca atacgaattc aaggttaaca gtgaaccagt
tgtcttgcac 420 ttggaaaaaa acaaaggttt gttctctgaa gattactctg
aaactcatta ctccccagat 480 ggtagagaaa ttactactta cccattgggt
gaagatcact gttactacca tggtagaatc 540 gaaaacgatg ctgactccac
tgcttctatc tctgcttgta acggtttgaa gggtcatttc 600 aagttgcaag
gtgaaatgta cttgattgaa ccattggaat tgtccgactc tgaagcccat 660
gctgtctaca agtacgaaaa cgtcgaaaag gaagatgaag ccccaaagat gtgtggtgtt
720 acccaaaact gggaatcata tgaaccaatc aagaaggcct tccaattaaa
cttgactaag 780 agacaacaaa gattcccaca aagatacgta cagctggtta
tcgttgctga ccaccgtatg 840 aacactaaat acaacggtga ctctgacaaa
atccgtcaat gggtgcacca aatcgtcaac 900 accattaacg aaatctacag
accactgaac atccaattca ctttggttgg tttggaaatc 960 tggtccaacc
aagatttgat caccgttact tctgtatccc acgacactct ggcatccttc 1020
ggtaactggc gtgaaaccga cctgctgcgt cgccaacgtc atgataacgc tcaactgctg
1080 accgctatcg acttcgacgg tgatactgtt ggtctggctt acgttggtgg
catgtgtcaa 1140 ctgaaacatt ctactggtgt tatccaggac cactccgcta
ttaacctgct ggttgctctg 1200 accatggcac acgaactggg tcataacctg
ggtatgaacc acgatggcaa ccagtgtcac 1260 tgcggtgcaa actcctgtgt
tatggctgct atgctgtccg atcaaccatc caaactgttc 1320 tccgactgct
ctaagaaaga ctaccagacc ttcctgaccg ttaacaaccc gcagtgtatc 1380
ctgaacaaac cgtaagcggc cgccagcttt ctagaacaaa aactcatctc agaagaggat
1440 ctgaatagcg ccgtcgacca tcatcatcat catcattgag tttgtagcct
tagacatgac 1500 tgttcctcag ttcaagttgg gcacttacga gaagaccggt
cttgctagat tctaatcaag 1560 aggatgtcag aatgccattt gcctgagaga
tgcaggcttc atttttgata cttttttatt 1620 13 1620 DNA Agkistrodon
contortrix misc_feature (1)..(1620) Complementary (antisense)
strand of sense strand (See SEQ ID NO12 misc_feature Anti-coding
sequence of native pro-fibrolase of Agkistrodon contortrix 13
aataaaaaag tatcaaaaat gaagcctgca tctctcaggc aaatggcatt ctgacatcct
60 cttgattaga atctagcaag accggtcttc tcgtaagtgc ccaacttgaa
ctgaggaaca 120 gtcatgtcta aggctacaaa ctcaatgatg atgatgatga
tggtcgacgg cgctattcag 180 atcctcttct gagatgagtt tttgttctag
aaagctggcg gccgcttacg gtttgttcag 240 gatacactgc gggttgttaa
cggtcaggaa ggtctggtag tctttcttag agcagtcgga 300 gaacagtttg
gatggttgat cggacagcat agcagccata acacaggagt ttgcaccgca 360
gtgacactgg ttgccatcgt ggttcatacc caggttatga cccagttcgt gtgccatggt
420 cagagcaacc agcaggttaa tagcggagtg gtcctggata acaccagtag
aatgtttcag 480 ttgacacatg ccaccaacgt aagccagacc aacagtatca
ccgtcgaagt cgatagcggt 540 cagcagttga gcgttatcat gacgttggcg
acgcagcagg tcggtttcac gccagttacc 600 gaaggatgcc agagtgtcgt
gggatacaga agtaacggtg atcaaatctt ggttggacca 660 gatttccaaa
ccaaccaaag tgaattggat gttcagtggt ctgtagattt cgttaatggt 720
gttgacgatt tggtgcaccc attgacggat tttgtcagag tcaccgttgt atttagtgtt
780 catacggtgg tcagcaacga taaccagctg tacgtatctt tgtgggaatc
tttgttgtct 840 cttagtcaag tttaattgga aggccttctt gattggttca
tatgattccc agttttgggt 900 aacaccacac atctttgggg cttcatcttc
cttttcgacg ttttcgtact tgtagacagc 960 atgggcttca gagtcggaca
attccaatgg ttcaatcaag tacatttcac cttgcaactt 1020 gaaatgaccc
ttcaaaccgt tacaagcaga gatagaagca gtggagtcag catcgttttc 1080
gattctacca tggtagtaac agtgatcttc acccaatggg taagtagtaa tttctctacc
1140 atctggggag taatgagttt cagagtaatc ttcagagaac aaacctttgt
ttttttccaa 1200 gtgcaagaca actggttcac tgttaacctt gaattcgtat
tgcatggcat cttcgtactt 1260 tggttgaaca gcacccctag gaactggagt
gacctttctt ggataaacaa cttcgtaatc 1320 gttaacgtta ccagattcca
agataataga agaagcttca gcctctcttt tctcgagaga 1380 taccccttct
tctttagcag caatgctggc aatagtagta tttataaaca ataacccgtt 1440
atttgtgctg ttggaaaatg gcaaaacagc aacatcgaaa tccccttcta aatctgagta
1500 accgatgaca gcttcagccg gaatttgtgc cgtttcatct tctgttgtag
tgttgactgg 1560 agcagctaat gcggaggatg ctgcgaataa aacagcagta
aaaattgaag gaaatctcat 1620 14 464 PRT Agkistrodon contortrix
misc_feature Native pro-fibrolase of Agkistrodon contortrix 14 Met
Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala Ser Ser 1 5 10
15 Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln
20 25 30 Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly
Asp Phe 35 40 45 Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn
Asn Gly Leu Leu 50 55 60 Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala
Ala Lys Glu Glu Gly Val 65 70 75 80 Ser Leu Glu Lys Arg Glu Ala Glu
Ala Ser Ser Ile Ile Leu Glu Ser 85 90 95 Gly Asn Val Asn Asp Tyr
Glu Val Val Tyr Pro Arg Lys Val Thr Pro 100 105 110 Val Pro Arg Gly
Ala Val Gln Pro Lys Tyr Glu Asp Ala Met Gln Tyr 115 120 125 Glu Phe
Lys Val Asn Ser Glu Pro Val Val Leu His Leu Glu Lys Asn 130 135 140
Lys Gly Leu Phe Ser Glu Asp Tyr Ser Glu Thr His Tyr Ser Pro Asp 145
150 155 160 Gly Arg Glu Ile Thr Thr Tyr Pro Leu Gly Glu Asp His Cys
Tyr Tyr 165
170 175 His Gly Arg Ile Glu Asn Asp Ala Asp Ser Thr Ala Ser Ile Ser
Ala 180 185 190 Cys Asn Gly Leu Lys Gly His Phe Lys Leu Gln Gly Glu
Met Tyr Leu 195 200 205 Ile Glu Pro Leu Glu Leu Ser Asp Ser Glu Ala
His Ala Val Tyr Lys 210 215 220 Tyr Glu Asn Val Glu Lys Glu Asp Glu
Ala Pro Lys Met Cys Gly Val 225 230 235 240 Thr Gln Asn Trp Glu Ser
Tyr Glu Pro Ile Lys Lys Ala Phe Gln Leu 245 250 255 Asn Leu Thr Lys
Arg Gln Gln Arg Phe Pro Gln Arg Tyr Val Gln Leu 260 265 270 Val Ile
Val Ala Asp His Arg Met Asn Thr Lys Tyr Asn Gly Asp Ser 275 280 285
Asp Lys Ile Arg Gln Trp Val His Gln Ile Val Asn Thr Ile Asn Glu 290
295 300 Ile Tyr Arg Pro Leu Asn Ile Gln Phe Thr Leu Val Gly Leu Glu
Ile 305 310 315 320 Trp Ser Asn Gln Asp Leu Ile Thr Val Thr Ser Val
Ser His Asp Thr 325 330 335 Leu Ala Ser Phe Gly Asn Trp Arg Glu Thr
Asp Leu Leu Arg Arg Gln 340 345 350 Arg His Asp Asn Ala Gln Leu Leu
Thr Ala Ile Asp Phe Asp Gly Asp 355 360 365 Thr Val Gly Leu Ala Tyr
Val Gly Gly Met Cys Gln Leu Lys His Ser 370 375 380 Thr Gly Val Ile
Gln Asp His Ser Ala Ile Asn Leu Leu Val Ala Leu 385 390 395 400 Thr
Met Ala His Glu Leu Gly His Asn Leu Gly Met Asn His Asp Gly 405 410
415 Asn Gln Cys His Cys Gly Ala Asn Ser Cys Val Met Ala Ala Met Leu
420 425 430 Ser Asp Gln Pro Ser Lys Leu Phe Ser Asp Cys Ser Lys Lys
Asp Tyr 435 440 445 Gln Thr Phe Leu Thr Val Asn Asn Pro Gln Cys Ile
Leu Asn Lys Pro 450 455 460 15 203 PRT Agkistrodon contortrix
misc_feature Native fibrolase of Agkistrodon contortrix
misc_feature Xaa in position 1 represents the chemical compound,
pyroglutamic acid. This chemical compound is referred to in the
specification as the letter "E" 15 Xaa Gln Arg Phe Pro Gln Arg Tyr
Val Gln Leu Val Ile Val Ala Asp 1 5 10 15 His Arg Met Asn Thr Lys
Tyr Asn Gly Asp Ser Asp Lys Ile Arg Gln 20 25 30 Trp Val His Gln
Ile Val Asn Thr Ile Asn Glu Ile Tyr Arg Pro Leu 35 40 45 Asn Ile
Gln Phe Thr Leu Val Gly Leu Glu Ile Trp Ser Asn Gln Asp 50 55 60
Leu Ile Thr Val Thr Ser Val Ser His Asp Thr Leu Ala Ser Phe Gly 65
70 75 80 Asn Trp Arg Glu Thr Asp Leu Leu Arg Arg Gln Arg His Asp
Asn Ala 85 90 95 Gln Leu Leu Thr Ala Ile Asp Phe Asp Gly Asp Thr
Val Gly Leu Ala 100 105 110 Tyr Val Gly Gly Met Cys Gln Leu Lys His
Ser Thr Gly Val Ile Gln 115 120 125 Asp His Ser Ala Ile Asn Leu Leu
Val Ala Leu Thr Met Ala His Glu 130 135 140 Leu Gly His Asn Leu Gly
Met Asn His Asp Gly Asn Gln Cys His Cys 145 150 155 160 Gly Ala Asn
Ser Cys Val Met Ala Ala Met Leu Ser Asp Gln Pro Ser 165 170 175 Lys
Leu Phe Ser Asp Cys Ser Lys Lys Asp Tyr Gln Thr Phe Leu Thr 180 185
190 Val Asn Asn Pro Gln Cys Ile Leu Asn Lys Pro 195 200 16 202 PRT
Agkistrodon contortrix misc_feature Native fibrolase of Agkistrodon
contortrix misc_feature Xaa in position 1 represents the chemical
compound, pyroglutamic acid. This chemical compound is referred to
in the specification as the letter "E" 16 Xaa Arg Phe Pro Gln Arg
Tyr Val Gln Leu Val Ile Val Ala Asp His 1 5 10 15 Arg Met Asn Thr
Lys Tyr Asn Gly Asp Ser Asp Lys Ile Arg Gln Trp 20 25 30 Val His
Gln Ile Val Asn Thr Ile Asn Glu Ile Tyr Arg Pro Leu Asn 35 40 45
Ile Gln Phe Thr Leu Val Gly Leu Glu Ile Trp Ser Asn Gln Asp Leu 50
55 60 Ile Thr Val Thr Ser Val Ser His Asp Thr Leu Ala Ser Phe Gly
Asn 65 70 75 80 Trp Arg Glu Thr Asp Leu Leu Arg Arg Gln Arg His Asp
Asn Ala Gln 85 90 95 Leu Leu Thr Ala Ile Asp Phe Asp Gly Asp Thr
Val Gly Leu Ala Tyr 100 105 110 Val Gly Gly Met Cys Gln Leu Lys His
Ser Thr Gly Val Ile Gln Asp 115 120 125 His Ser Ala Ile Asn Leu Leu
Val Ala Leu Thr Met Ala His Glu Leu 130 135 140 Gly His Asn Leu Gly
Met Asn His Asp Gly Asn Gln Cys His Cys Gly 145 150 155 160 Ala Asn
Ser Cys Val Met Ala Ala Met Leu Ser Asp Gln Pro Ser Lys 165 170 175
Leu Phe Ser Asp Cys Ser Lys Lys Asp Tyr Gln Thr Phe Leu Thr Val 180
185 190 Asn Asn Pro Gln Cys Ile Leu Asn Lys Pro 195 200 17 462 PRT
Artificial Analog form of native pro-fibrolase of Agkistrodon
contortrix 17 Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala
Ala Ser Ser 1 5 10 15 Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu
Asp Glu Thr Ala Gln 20 25 30 Ile Pro Ala Glu Ala Val Ile Gly Tyr
Ser Asp Leu Glu Gly Asp Phe 35 40 45 Asp Val Ala Val Leu Pro Phe
Ser Asn Ser Thr Asn Asn Gly Leu Leu 50 55 60 Phe Ile Asn Thr Thr
Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val 65 70 75 80 Ser Leu Glu
Lys Arg Glu Ala Glu Ala Ser Ser Ile Ile Leu Glu Ser 85 90 95 Gly
Asn Val Asn Asp Tyr Glu Val Val Tyr Pro Arg Lys Val Thr Pro 100 105
110 Val Pro Arg Gly Ala Val Gln Pro Lys Tyr Glu Asp Ala Met Gln Tyr
115 120 125 Glu Phe Lys Val Asn Ser Glu Pro Val Val Leu His Leu Glu
Lys Asn 130 135 140 Lys Gly Leu Phe Ser Glu Asp Tyr Ser Glu Thr His
Tyr Ser Pro Asp 145 150 155 160 Gly Arg Glu Ile Thr Thr Tyr Pro Leu
Gly Glu Asp His Cys Tyr Tyr 165 170 175 His Gly Arg Ile Glu Asn Asp
Ala Asp Ser Thr Ala Ser Ile Ser Ala 180 185 190 Cys Asn Gly Leu Lys
Gly His Phe Lys Leu Gln Gly Glu Met Tyr Leu 195 200 205 Ile Glu Pro
Leu Glu Leu Ser Asp Ser Glu Ala His Ala Val Tyr Lys 210 215 220 Tyr
Glu Asn Val Glu Lys Glu Asp Glu Ala Pro Lys Met Cys Gly Val 225 230
235 240 Thr Gln Asn Trp Glu Ser Tyr Glu Pro Ile Lys Lys Ala Phe Gln
Leu 245 250 255 Asn Leu Thr Lys Arg Ser Phe Pro Gln Arg Tyr Val Gln
Leu Val Ile 260 265 270 Val Ala Asp His Arg Met Asn Thr Lys Tyr Asn
Gly Asp Ser Asp Lys 275 280 285 Ile Arg Gln Trp Val His Gln Ile Val
Asn Thr Ile Asn Glu Ile Tyr 290 295 300 Arg Pro Leu Asn Ile Gln Phe
Thr Leu Val Gly Leu Glu Ile Trp Ser 305 310 315 320 Asn Gln Asp Leu
Ile Thr Val Thr Ser Val Ser His Asp Thr Leu Ala 325 330 335 Ser Phe
Gly Asn Trp Arg Glu Thr Asp Leu Leu Arg Arg Gln Arg His 340 345 350
Asp Asn Ala Gln Leu Leu Thr Ala Ile Asp Phe Asp Gly Asp Thr Val 355
360 365 Gly Leu Ala Tyr Val Gly Gly Met Cys Gln Leu Lys His Ser Thr
Gly 370 375 380 Val Ile Gln Asp His Ser Ala Ile Asn Leu Leu Val Ala
Leu Thr Met 385 390 395 400 Ala His Glu Leu Gly His Asn Leu Gly Met
Asn His Asp Gly Asn Gln 405 410 415 Cys His Cys Gly Ala Asn Ser Cys
Val Met Ala Ala Met Leu Ser Asp 420 425 430 Gln Pro Ser Lys Leu Phe
Ser Asp Cys Ser Lys Lys Asp Tyr Gln Thr 435 440 445 Phe Leu Thr Val
Asn Asn Pro Gln Cys Ile Leu Asn Lys Pro 450 455 460 18 602 DNA
Agkistrodon contortrix misc_feature Fragment of fibrolase of
Agkistrodon contortrix 18 tactattgcc agcattgctg ctaaagaaga
aggggtatct ctcgagaaaa gagaggctga 60 agcttcttct attatcttgg
aatctggtaa cgttaacgat tacgaagttg tttatccaag 120 aaaggtcact
ccagttccta ggggtgctgt tcaaccaaag tacgaagatg ccatgcaata 180
cgaattcaag gttaacagtg aaccagttgt cttgcacttg gaaaaaaaca aaggtttgtt
240 ctctgaagat tactctgaaa ctcattactc cccagatggt agagaaatta
ctacttaccc 300 attgggtgaa gatcactgtt actaccatgg tagaatcgaa
aacgatgctg actccactgc 360 ttctatctct gcttgtaacg gtttgaaggg
tcatttcaag ttgcaaggtg aaatgtactt 420 gattgaacca ttggaattgt
ccgactctga agcccatgct gtctacaagt acgaaaacgt 480 cgaaaaggaa
gatgaagccc caaagatgtg tggtgttacc caaaactggg aatcatatga 540
accaatcaag aaggccttcc aattaaactt gactaagaga tctttcccac aaagatacgt
600 ac 602 19 816 DNA Agkistrodon contortrix misc_feature Fragment
of fibrolase of Agkistrodon contortrix 19 tccaattaaa cttgactaag
agatctttcc cacaaagata cgtacagctg gttatcgttg 60 ctgaccaccg
tatgaacact aaatacaacg gtgactctga caaaatccgt caatgggtgc 120
accaaatcgt caacaccatt aacgaaatct acagaccact gaacatccaa ttcactttgg
180 ttggtttgga aatctggtcc aaccaagatt tgatcaccgt tacttctgta
tcccacgaca 240 ctctggcatc cttcggtaac tggcgtgaaa ccgacctgct
gcgtcgccaa cgtcatgata 300 acgctcaact gctgaccgct atcgacttcg
acggtgatac tgttggtctg gcttacgttg 360 gtggcatgtg tcaactgaaa
cattctactg gtgttatcca ggaccactcc gctattaacc 420 tgctggttgc
tctgaccatg gcacacgaac tgggtcataa cctgggtatg aaccacgatg 480
gcaaccagtg tcactgcggt gcaaactcct gtgttatggc tgctatgctg tccgatcaac
540 catccaaact gttctccgac tgctctaaga aagactacca gaccttcctg
accgttaaca 600 acccgcagtg tatcctgaac aaaccgtaag cggccgccag
ctttctagaa caaaaactca 660 tctcagaaga ggatctgaat agcgccgtcg
accatcatca tcatcatcat tgagtttgta 720 gccttagaca tgactgttcc
tcagttcaag ttgggcactt acgagaagac cggtcttgct 780 agattctaat
caagaggatg tcagaatgcc atttgc 816 20 1373 DNA Agkistrodon contortrix
misc_feature Fragment of fibrolase of Agkistrodon contortrix 20
tactattgcc agcattgctg ctaaagaaga aggggtatct ctcgagaaaa gagaggctga
60 agcttcttct attatcttgg aatctggtaa cgttaacgat tacgaagttg
tttatccaag 120 aaaggtcact ccagttccta ggggtgctgt tcaaccaaag
tacgaagatg ccatgcaata 180 cgaattcaag gttaacagtg aaccagttgt
cttgcacttg gaaaaaaaca aaggtttgtt 240 ctctgaagat tactctgaaa
ctcattactc cccagatggt agagaaatta ctacttaccc 300 attgggtgaa
gatcactgtt actaccatgg tagaatcgaa aacgatgctg actccactgc 360
ttctatctct gcttgtaacg gtttgaaggg tcatttcaag ttgcaaggtg aaatgtactt
420 gattgaacca ttggaattgt ccgactctga agcccatgct gtctacaagt
acgaaaacgt 480 cgaaaaggaa gatgaagccc caaagatgtg tggtgttacc
caaaactggg aatcatatga 540 accaatcaag aaggccttcc aattaaactt
gactaagaga tctttcccac aaagatacgt 600 acagctggtt atcgttgctg
accaccgtat gaacactaaa tacaacggtg actctgacaa 660 aatccgtcaa
tgggtgcacc aaatcgtcaa caccattaac gaaatctaca gaccactgaa 720
catccaattc actttggttg gtttggaaat ctggtccaac caagatttga tcaccgttac
780 ttctgtatcc cacgacactc tggcatcctt cggtaactgg cgtgaaaccg
acctgctgcg 840 tcgccaacgt catgataacg ctcaactgct gaccgctatc
gacttcgacg gtgatactgt 900 tggtctggct tacgttggtg gcatgtgtca
actgaaacat tctactggtg ttatccagga 960 ccactccgct attaacctgc
tggttgctct gaccatggca cacgaactgg gtcataacct 1020 gggtatgaac
cacgatggca accagtgtca ctgcggtgca aactcctgtg ttatggctgc 1080
tatgctgtcc gatcaaccat ccaaactgtt ctccgactgc tctaagaaag actaccagac
1140 cttcctgacc gttaacaacc cgcagtgtat cctgaacaaa ccgtaagcgg
ccgccagctt 1200 tctagaacaa aaactcatct cagaagagga tctgaatagc
gccgtcgacc atcatcatca 1260 tcatcattga gtttgtagcc ttagacatga
ctgttcctca gttcaagttg ggcacttacg 1320 agaagaccgg tcttgctaga
ttctaatcaa gaggatgtca gaatgccatt tgc 1373 21 4 PRT Artificial
Analog form of native pro-fibrolase of Agkistrodon contortrix 21
Lys Arg Arg Phe 1 22 27 PRT Agkistrodon contortrix misc_feature
Native pro-fibrolase of Agkistrodon contortrix 22 Ala Ala Ala Ser
Phe Leu Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu 1 5 10 15 Asn Ser
Ala Val Asp His His His His His His 20 25 23 22 PRT Agkistrodon
contortrix misc_feature Native pro-fibrolase of Agkistrodon
contortrix 23 Val Cys Ser Leu Arg His Asp Cys Ser Ser Val Gln Val
Gly His Leu 1 5 10 15 Arg Glu Asp Arg Ser Cys 20 24 19 PRT
Agkistrodon contortrix misc_feature Native pro-fibrolase of
Agkistrodon contortrix 24 Ile Leu Ile Lys Arg Met Ser Glu Cys His
Leu Pro Glu Arg Cys Arg 1 5 10 15 Leu His Phe 25 4 PRT Agkistrodon
contortrix misc_feature Native pro-fibrolase of Agkistrodon
contortrix 25 Tyr Phe Phe Ile 1 26 27 PRT Artificial Analog form of
native pro-fibrolase of Agkistrodon contortrix 26 Ala Ala Ala Ser
Phe Leu Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu 1 5 10 15 Asn Ser
Ala Val Asp His His His His His His 20 25 27 22 PRT Artificial
Analog form of native pro-fibrolase of Agkistrodon contortrix 27
Val Cys Ser Leu Arg His Asp Cys Ser Ser Val Gln Val Gly His Leu 1 5
10 15 Arg Glu Asp Arg Ser Cys 20 28 19 PRT Artificial Analog form
of native pro-fibrolase of Agkistrodon contortrix 28 Ile Leu Ile
Lys Arg Met Ser Glu Cys His Leu Pro Glu Arg Cys Arg 1 5 10 15 Leu
His Phe 29 4 PRT Artificial Analog form of native pro-fibrolase of
Agkistrodon contortrix 29 Tyr Phe Phe Ile 1
* * * * *