U.S. patent application number 11/893211 was filed with the patent office on 2008-03-06 for novel dkr polypeptides.
This patent application is currently assigned to AMGEN INC.. Invention is credited to Michael Brian Bass, John Kevin Sullivan, Lars Eyde Theill, Daguang Wang.
Application Number | 20080057540 11/893211 |
Document ID | / |
Family ID | 22580414 |
Filed Date | 2008-03-06 |
United States Patent
Application |
20080057540 |
Kind Code |
A1 |
Bass; Michael Brian ; et
al. |
March 6, 2008 |
Novel DKR polypeptides
Abstract
Disclosed are nucleic acid molecules encoding novel DKR
polypeptides. Also disclosed are methods of preparing the nucleic
acid molecules and polypeptides, and methods of using these
molecules.
Inventors: |
Bass; Michael Brian;
(Thousand Oaks, CA) ; Sullivan; John Kevin;
(Newbury Park, CA) ; Theill; Lars Eyde; (Thousand
Oaks, CA) ; Wang; Daguang; (New York, NY) |
Correspondence
Address: |
AMGEN INC.;LAW DEPARTMENT
1201 AMGEN COURT WEST
SEATTLE
WA
98119
US
|
Assignee: |
AMGEN INC.
Thousand Oaks
CA
|
Family ID: |
22580414 |
Appl. No.: |
11/893211 |
Filed: |
August 14, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10998271 |
Nov 24, 2004 |
|
|
|
11893211 |
Aug 14, 2007 |
|
|
|
09976736 |
Oct 9, 2001 |
|
|
|
10998271 |
Nov 24, 2004 |
|
|
|
09161241 |
Sep 25, 1998 |
6344541 |
|
|
09976736 |
Oct 9, 2001 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/243; 435/320.1; 530/350; 536/23.5 |
Current CPC
Class: |
C07K 14/47 20130101;
C07K 14/475 20130101; A61P 35/00 20180101 |
Class at
Publication: |
435/069.1 ;
435/243; 435/320.1; 530/350; 536/023.5 |
International
Class: |
C12P 21/02 20060101
C12P021/02; C07H 21/00 20060101 C07H021/00; C07K 14/435 20060101
C07K014/435; C12N 1/00 20060101 C12N001/00; C12N 15/63 20060101
C12N015/63 |
Claims
1. An isolated nucleic acid molecule encoding a biologically active
DKR polypeptide selected from the group consisting of: (a) the
nucleic acid molecule comprising SEQ ID NO:1; (b) the nucleic acid
molecule comprising SEQ ID NO:2; (c) the nucleic acid molecule
comprising SEQ ID NO:3; (d) the nucleic acid molecule comprising
SEQ ID NO:4; (e) the nucleic acid molecule comprising SEQ ID NO:5;
(f) the nucleic acid molecule comprising SEQ ID NO:6; (g) the
nucleic acid molecule comprising SEQ ID NO:7; (h) the nucleic acid
molecule comprising SEQ ID NO:75; (i) the nucleic acid molecule
comprising SEQ ID NO:76; (j) the nucleic acid molecule comprising
SEQ ID NO:77; (k) the nucleic acid molecule comprising SEQ ID
NO:78; (l) the nucleic acid molecule encoding the polypeptide of
SEQ ID NO:8; (m) a nucleic acid molecule encoding the polypeptide
of SEQ ID NO:9; (n) a nucleic acid molecule encoding the
polypeptide of SEQ ID NO:10, or a biologically active fragment
thereof; (o) a nucleic acid molecule encoding the polypeptide of
SEQ ID NO:11, or a biologically active fragment thereof; (p) a
nucleic acid molecule encoding the polypeptide of SEQ ID NO:12, or
a biologically active fragment thereof; (q) a nucleic acid molecule
encoding the polypeptide of SEQ ID NO:13, or a biologically active
fragment thereof; (r) a nucleic acid molecule encoding the
polypeptide of SEQ ID NO:14, or a biologically active fragment
thereof (s) a nucleic acid molecule that encodes a polypeptide that
is at least 85 percent identical to the polypeptide of SEQ ID NOs:
10, 11, 12, 13, or 14; (t) a nucleic acid molecule that encodes a
biologically active DKR polypeptide that has 1-100 amino acid
substitutions and/or deletions as compared with the polypeptide of
any of SEQ ID NOs:8, 9, 10, 11, 12, 13, or 14; and (u) a nucleic
acid molecule that hybridizes under conditions of high stringency
to any of (c), (d), (e), (f), (g), (h), (i), (k), (l), (m), (n),
(o), (p), (q), (r), (s), and (t) above.
2. An isolated nucleic acid molecule that is the complement of the
nucleic acid molecule of claim 1.
3. An isolated nucleic acid molecule comprising SEQ ID NO:1, SEQ ID
NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID
NO:7.
4. An isolated nucleic acid molecule encoding the polypeptide of
SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12,
SEQ ID NO:13, or SEQ ID NO:14.
5. An isolated nucleic acid molecule encoding a biologically active
DKR polypeptide selected from the group consisting of: amino acids
16-350, 21-350, 22-350, 23-350, 33-350, or 42-350, 21-145, 40-145,
40-150, 45-145, 45-145, 145-290, 145-300, 145-350, 150-290,
300-350, or 310-350 of SEQ ID NO:9; amino acids 15-266, 24-266, or
32-266 of SEQ ID NO:10; amino acids 17-259, 26-259, or 34-359 of
SEQ ID NO:12; and amino acids 19-224, 20-224, 21-224, or 22-224 of
SEQ ID NO:14.
6. A vector comprising the nucleic acid molecule of claim 1.
7. A vector comprising the nucleic acid molecule of claim 2.
8. A vector comprising the nucleic acid molecule of claim 3.
9. A vector comprising the nucleic acid molecule of claim 4.
10. A vector comprising the nucleic acid molecule of claim 5.
11. A host cell comprising the vector of claim 6.
12. A host cell comprising the vector of claim 7.
13. A host cell comprising the vector of claim 8.
14. A host cell comprising the vector of claim 9.
15. A host cell comprising the vector of claim 10.
16. A process for producing a biologically active DKR polypeptide
comprising the steps of: (a) expressing a polypeptide encoded by
the nucleic acid of claim 1 in a suitable host; and (b) isolating
the polypeptide.
17. The process of claim 16 wherein the polypeptide is SEQ ID NO:8,
SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13
or SEQ ID NO:14.
18. A biologically active DKR polypeptide selected from the group
consisting of: (a) the polypeptide of SEQ ID NO:8; (b) the
polypeptide of SEQ ID NO:9; (c) the polypeptide of SEQ ID NO:10;
(d) the polypeptide of SEQ ID NO:11; (e) the polypeptide of SEQ ID
NO:12; (f) the polypeptide of SEQ ID NO:13; (g) the polypeptide of
SEQ ID NO:14; (h) a polypeptide that has 1-100 amino acid
substitutions or deletions as compared with the polypeptide of any
of (a)-(h) above; and (i) a polypeptide that is at least 85 percent
identical to any of the polypeptides of (c)-(h) above.
19. The polypeptide of claim 18 that does not possess an endogenous
signal peptide.
20. A polypeptide selected from the group consisting of amino acids
16-350, 21-350, 22-350, 23-350, 33-350, 42-350, 21-145, 40-145,
40-150, 45-145, 45-145, 145-290, 145-300, 145-350, 150-290,
300-350, or 310-350 of SEQ ID NO:9; amino acids 15-266, 24-266, or
32-266 of SEQ ID NO:10; amino acids 17-259, 26-259, or 34-259 of
SEQ ID NO:12; and amino acids 19-224, 20-224, 21-224, or 22-224 of
SEQ ID NO:14.
Description
[0001] This application is a continuation of U.S. Ser. No.
10/998,271, filed Nov. 24, 2004, which is a continuation of U.S.
Ser. No. 09/976,736, filed Oct. 9, 2001 (now abandoned), which is a
divisional of U.S. Ser. No. 09/161,241, filed Sep. 25, 1998 (now
U.S. Pat. No. 6,344,541), which are hereby incorporated by
reference.
FIELD OF THE INVENTION
[0002] This invention relates generally to novel genes encoding
proteins that have use as anti-cancer therapeutics.
BACKGROUND
Related Art
[0003] One of the hallmarks of cells that have become cancerous is
the change in the gene expression pattern in those cells as
compared to normal, non-cancerous cells. An intricate series of
cell signaling events leads to this so called "differential gene
expression", resulting in conversion of a normal cell to a cancer
cell (also known as "oncogenesis" or "cell transformation"). A
number of cell signaling pathways have been implicated in the
process of cell transformation, such as, for example, the cadherin
pathway, the delta/jagged pathway, the hedgehog/sonic hedgehog
pathway, and the wnt/wingless pathway (Hunter, Cell, 88:333-346
[1997]; Currie, J. Mol. Med., 76:421-433 [1998]; Peifer, Science,
275:1752-1753 [1997]. Interestingly, these same pathways are
involved in cell morphogenesis, or cell differentiation, during
embryo development (Hunter, supra; Cadigan et al., Genes and
Develop., 11:3286-3305 [1997]).
[0004] The wnt genes encode glycoproteins that are secreted from
the cell. These glycoproteins are found in both vertebrate and
invertebrate organisms. Currently, there are at least 20 wnt family
members, and these members are believed to function variously in
control of growth and in tissue differention. Recently, discovery
of a novel gene was identified in Xenopus and mouse and has been
termed dickkopf-1 ("dkk-1"). This gene is purportedly a potent
antagonist of wnt-8 signaling (Glinka et al., Nature, 391:357-362
[1998]). Interestingly, this gene is also purportedly involved in
morphogenesis in the developing embryo (Glinka et al., supra). This
gene thus represents a novel growth factor which may be useful in
tissue regeneration, and also represents a means for potentially
inhibiting cell transformation via wnt signaling.
[0005] The Frzb proteins and the protein Cerberus are examples of
secreted proteins that purportedly inhibit wnt signaling (Brown,
Curr. Opinion Cell Biol., 10:182-187 [1998).
[0006] PCT WO 98/35043, published 13 Aug. 1998 describes human
SDF-5 proteins which are purportedly useful in regulating the
binding of wnt polypeptides to their receptors.
[0007] PCT WO 98/23730, published 4 Jun. 1998, describes
transfecting tumors cells with wnt-5a to purportedly decrease
tumorigenicity. Wnt-5a purportedly is an antagonist of other
wnts.
[0008] In view of the devastating effects of cancer, there is a
need in the art to identify additional genes that may serve as
antagonists of proteins involved in cell transformation.
[0009] Accordingly, it is an object of this invention to provide
nucleic acid molecules and polypeptides that may be useful as
anti-cancer compounds.
[0010] It is a further object to provide methods of altering the
level of expression and/or activity of such polypeptides in the
human body.
[0011] Other related objects will readily be apparent from a
reading of this disclosure.
SUMMARY OF THE INVENTION
[0012] In one embodiment, the present invention provides an
isolated nucleic acid molecule encoding a biologically active DKR
polypeptide selected from the group consisting of:
[0013] (a) the nucleic acid molecule comprising SEQ ID NO:1;
[0014] (b) the nucleic acid molecule comprising SEQ ID NO:2;
[0015] (c) the nucleic acid molecule comprising SEQ ID NO:3;
[0016] (d) the nucleic acid molecule comprising SEQ ID NO:4;
[0017] (e) the nucleic acid molecule comprising SEQ ID NO:5;
[0018] (f) the nucleic acid molecule comprising SEQ ID NO:6;
[0019] (g) the nucleic acid molecule comprising SEQ ID NO:7;
[0020] (h) the nucleic acid molecule comprising SEQ ID NO:75;
[0021] (i) the nucleic acid molecule comprising SEQ ID NO:76;
[0022] (j) the nucleic acid molecule comprising SEQ ID NO:77;
[0023] (k) the nucleic acid molecule comprising SEQ ID NO:78;
[0024] (l) the nucleic acid molecule encoding the polypeptide of
SEQ ID NO:8;
[0025] (m) a nucleic acid molecule encoding the polypeptide of SEQ
ID NO:9;
[0026] (n) a nucleic acid molecule encoding the polypeptide of SEQ
ID NO:10, or a biologically active fragment thereof;
[0027] (o) a nucleic acid molecule encoding the polypeptide of SEQ
ID NO:11, or a biologically active fragment thereof;
[0028] (p) a nucleic acid molecule encoding the polypeptide of SEQ
ID NO:12, or a biologically active fragment thereof;
[0029] (q) a nucleic acid molecule encoding the polypeptide of SEQ
ID NO:13, or a biologically active fragment thereof;
[0030] (r) a nucleic acid molecule encoding the polypeptide of SEQ
ID NO:14, or a biologically active fragment thereof;
[0031] (s) a nucleic acid molecule that encodes a polypeptide that
is at least 85 percent identical to the polypeptide of SEQ ID NOs:
10, 11, 12, 13, or 14;
[0032] (t) a nucleic acid molecule that encodes a biologically
active DKR polypeptide that has 1-100 amino acid substitutions
and/or deletions as compared with the polypeptide of any of SEQ ID
NOs:8, 9, 10, 11, 12, 13, or 14; and
[0033] (u) a nucleic acid molecule that hybridizes under conditions
of high stringency to any of (c), (d), (e), (f), (g), (h), (i),
(k), (l), (m), (n), (o), (p), (q), (r), (s), and (t) above.
[0034] In another embodiment, the invention provides an isolated
nucleic acid molecule that is the complement of any of the nucleic
acid molecules above.
[0035] In yet another embodiment, the invention provides an
isolated nucleic acid molecule encoding a biologically active DKR
polypeptide selected from the group of: amino acids 16-350, 21-350,
22-350, 23-350, 33-350, or 42-350, 21-145, 40-145, 40-150, 45-145,
45-145, 145-290, 150-290, 300-350, or 310-350 of SEQ ID NO:9; amino
acids 15-266, 24-266, or 32-266 of SEQ ID NO:10; amino acids
17-259, 26-259, or 34-359 of SEQ ID NO:12; and amino acids 19-224,
20-224, 21-224, or 22-224 of SEQ ID NO:14.
[0036] In other embodiments, the invention provides vectors
comprising the nucleic acid molecules, and host cells comprising
the vectors.
[0037] In still another embodiment, the invention provides a
process for producing a biologically active DKR polypeptide
comprising the steps of:
[0038] (a) expressing a polypeptide encoded by any of the nucleic
acid molecules herein in a suitable host; and
[0039] (b) isolating the polypeptide.
[0040] In still one other embodiment, the invention provides a
biologically active DKR polypeptide selected from the group
consisting of:
[0041] (a) the polypeptide of SEQ ID NO:8;
[0042] (b) the polypeptide of SEQ ID NO:9;
[0043] (c) the polypeptide of SEQ ID NO:10;
[0044] (d) the polypeptide of SEQ ID NO:11;
[0045] (e) the polypeptide of SEQ ID NO:12;
[0046] (f) the polypeptide of SEQ ID NO:13;
[0047] (g) the polypeptide of SEQ ID NO:14;
[0048] (h) a polypeptide that has 1-100 amino acid substitutions or
deletions as compared with the polypeptide of any of (a)-(g) above;
and
[0049] (i) a polypeptide that is at least 85 percent identical to
any of the polypeptides of (c)-(h) above.
[0050] In still one other embodiment, the invention provides the
following polypeptides: a polypeptide that is amino acids 16-350,
21-350, 22-350, 23-350, 33-350, or 42-350, 21-145, 40-145, 40-150,
45-145, 45-145, 145-290, 145-300, 145-350, 150-290, 300-350, or
310-350 of FIG. 9, a polypeptide that is amino acids 15, 266,
24-266, or 32-266 of FIG. 10, a polypeptide that is amino acids
17-259, 26-259, or 34-259 of FIG. 12, and a polypeptide that is
amino acids 19-224, 20-224, 21-224, or 22-224 of FIG. 14.
BRIEF DESCRIPTION OF THE DRAWINGS
[0051] FIG. 1 (SEQ ID NO:1) depicts the cDNA sequence of mouse
DKR-3.
[0052] FIG. 2 (SEQ ID NO:2) depicts the cDNA sequence of human
DKR-3.
[0053] FIG. 3 (SEQ ID NO:3) depicts the DNA sequence of human
DKR-1.
[0054] FIG. 4 (SEQ ID NO:4) depicts the cDNA sequence of mouse
DKR-2.
[0055] FIG. 5 (SEQ ID NO:5) depicts the cDNA sequence of human
DKR-2.
[0056] FIG. 6 (SEQ ID NO:6) depicts the cDNA sequence of human
DKR-2a, a splice variant of the DKR-2 gene.
[0057] FIG. 7 (SEQ ID NO:7) depicts the cDNA sequence of human
DKR-4.
[0058] FIG. 8 (SEQ ID NO:8) depicts the amino acid sequence of
mouse DKR-3 as translated from the corresponding cDNA.
[0059] FIG. 9 (SEQ ID NO:9) depicts the amino acid sequence of
human DKR-3 as translated from the corresponding cDNA.
[0060] FIG. 10 (SEQ ID NO:10) depicts the amino acid sequence of
human DKR-1 as translated from the corresponding cDNA.
[0061] FIG. 11 (SEQ ID NO:11) depicts the amino acid sequence of
mouse DKR-2 as translated from the corresponding cDNA.
[0062] FIG. 12 (SEQ ID NO:12) depicts the amino acid sequence of
human DKR-2 as translated from the corresponding cDNA.
[0063] FIG. 13 (SEQ ID NO:13) depicts the amino acid sequence of
human DKR-2a as translated from the corresponding cDNA.
[0064] FIG. 14 (SEQ ID NO:14) depicts the amino acid sequence of
human DKR-4 as translated from the corresponding cDNA.
[0065] FIGS. 15A-15D are photographs of Northern blots which were
probed with human DKR-3. FIG. 15A shows the transcript level of
DKR-3 in various human normal (Lanes 1-2) and immortal (Lanes 3-4)
cell lines, and in human estrogen receptor plus ("ER+"; Lanes 5-9)
and estrogen receptor minus ("ER-"; Lanes 10-16) breast cancer cell
lines. FIG. 15B shows the transcript level of human DKR-3 in human
normal lung cells (Lane 1), and in various human non-small cell
lung cancer ("NSCLC"; Lanes 2-9) and small cell lung cancer
("SCLC"; Lanes 10-15) cell lines. FIG. 15C shows the amount of
transcript of human DKR-3 in five glioblastoma cell lines; three of
these lines (SNB-19, U-87MG, and U-373MG) are capable of forming
tumors in nude mice, while the other two lines (Hs 683 and A 172)
are not. FIG. 15D shows the transcript level of human DKR-3 in
human immortal (non-cancerous) and normal cervical cells, and in
human cervical cancer cell lines (indicated as "tumor cells").
[0066] FIG. 16 is a photograph of SDS gel electrophoresis. The
contents of the lanes are set forth in the Examples herein.
[0067] FIG. 17 is a photograph of SDS gel electrophoresis. The
contents of the lanes are set forth in the Examples herein.
[0068] FIG. 18 is a photograph of SDS gel electrophoresis. The
contents of the lanes are set forth in the Examples herein.
[0069] FIG. 19 is a photograph of SDS gel electrophoresis. The
contents of the lanes are set forth in the Examples herein.
[0070] FIG. 20 is a photograph of SDS gel electrophoresis. The
contents of the lanes are set forth in the Examples herein.
[0071] FIG. 21 is a photograph of a Western blot. Contents of the
Lanes are indicated in the Examples herein.
[0072] FIG. 22 (SEQ ID NO:75) is a nucleic acid sequence of human
DKR-1 with codons optimized for expression in E. coli.
[0073] FIG. 23 (SEQ ID NO:76) is a nucleic acid sequence of human
DKR-2 with codons optimized for expression in E. coli.
[0074] FIG. 24 SEQ ID NO:77) is a nucleic acid sequence of human
DKR-3 with codons optimized for expression in E. coli.
[0075] FIG. 25 (SEQ ID NO:78) is a nucleic acid sequence of human
DKR-4 with codons optimized for expression in E. coli.
DETAILED DESCRIPTION OF THE INVENTION
[0076] Included in the scope of this invention are DKR polypeptides
such as the polypeptides of SEQ ID NOs:8-14, and related
biologically active polypeptide fragments, variants, and
derivatives thereof.
[0077] Also included within the scope of the present invention are
nucleic acid molecules that encode DKR polypeptides such as the
nucleic acid molecules of SEQ ID Nos:1-7.
[0078] Additionally included within the scope of the present
invention are non-human mammals such as mice, rats, rabbits, goats,
or sheep in which the gene (or genes) encoding a native DKR
polypeptide has (have) been disrupted ("knocked out") such that the
level of expression of this gene or genes is (are) significantly
decreased or completely abolished. Such mammals may be prepared
using techniques and methods such as those described in U.S. Pat.
No. 5,557,032. The present invention further includes non-human
mammals such as mice, rats, rabbits, goats, or sheep in which the
gene (or genes) encoding DKR polypeptides in which either the
native form of the gene(s) for that mammal or a heterologous DKR
polypeptide gene(s) is (are) over expressed by the mammal, thereby
creating a "transgenic" mammal. Such transgenic mammals may be
prepared using well known methods such as those described in U.S.
Pat. No. 5,489,743 and PCT patent application no. WO94/28122,
published 8 Dec. 1994. The present invention further includes
non-human mammals in which the promoter for one or more of the DKR
polypeptides of the present invention is either activated or
inactivated (using homologous recombination methods as described
below) to alter the level of expression of one or more of the
native DKR polypeptides.
[0079] The DKR polypeptides of the present invention are expected
to have utility as anti-cancer therapeutics for those cancers such
as mammary tumors, stem cell tumors, or other cancers in which the
wnt and/or sonic hedgehog (shh) signal transduction pathways are
activated. Specific wnt members can transform mammary tissue
(Hunter, supra) and are abnormally expressed in many human tumors
(Huguet, Cancer Res., 54:2615-2621 [1994]; Dale, Cancer Res.,
56:4320-4323 [1996]; see also PCT WO 97/39357). Such activity is
expected in view of data presented herein in which the level of
DKR-3 transcript is decreased or not detectable at all in many
cancer cell lines as compared to similar normal cell lines.
Further, such activity is expected in view of the relationship of
the genes and polypeptides of the present invention to the gene
dickkopf-1 (which, as mentioned above, is purportedly a potent
antagonist of wnt-8). DKR-1, a novel gene of the present invention,
is a human ortholog of dkk-1. DKR-2, DKR-3, and DKR-4, all novel
genes of the present invention, are each related to DKR-1 by their
cysteine pattern. In particular, these DKR polypeptides may be of
use for treatment of stem cell tumors, mammary tumors, and other
cancers in which wnt genes are expressed, and in cancers where wnt
and/or shh signaling is activated.
[0080] The DKR polypeptides of the present invention may also be
administered as agents that can induce and/or enhance tissue
differentiation, such as bone formation, cartilage formation,
muscle tissue formation, nerve tissue formation, and hematopoietic
cell formation. Such activities are expected in view of the fact
that a) Xenopus dkk-1 purportedly promotes head induction, heart
formation, and differentiation or the developing CNS (Glinka,
supra); and b) certain wnt polypeptides appear to function in
embryo development (Cadigan, Genes and Devel., 11:3286-3305
[1997]), specifically development of the pituitary (Treier, Genes
and Devel., 12:1691-1704 [1998]), myogenesis (Munsterberg et al.,
Genes and Devel., 9:2911-2922 [1995]), osteogenesis (PCT WO
95/17416; PCT WO98/16641), kidney development (Stark et al., Nature
372:679-683 [1994]), development of the CNS (Dickinson et al.,
Development, 120:1453-1471 [1994]), and hematopoiesis (PCT WO
98/06747). Thus, addition of certain DKR polypeptides in such cell
cultures or tissues may serve to modify the activity of various wnt
polypeptides in cellular differentiation processes.
[0081] The DKR polypeptides herein may be used in either an in vivo
manner or an ex vivo manner for such applications. For example, one
or more of the DKR polypeptides of the present invention may be
added to a culture of cartilage tissue or nerve tissue, or
hematopoietic stem cells, either alone, or in combination with
other growth factors and/or other tissue differentiation factors,
so as to induce or enhance the regeneration of such tissues.
Alternatively, such DKR polypeptides of the present invention may,
for example, be injected directly into a joint in need of
cartilage, into the spinal cord where the cord has been damaged,
into damaged brain tissue, or into bone marrow to enhance
hematopoiesis.
[0082] The term "DKR polypeptides" as used herein refers to any
protein or polypeptide having the properties described herein for
DKR polypeptides. The DKR polypeptides may or may not have amino
terminal methionines, depending on the manner in which they are
prepared. By way of illustration, DKR polypeptides refers to (1) a
biologically active polypeptide encoded by any of the DKR
polypeptides nucleic acid molecules as defined in any of items
(a)-(f) below; (2) naturally occurring allelic variants and
synthetic variants of any of DKR polypeptide in which one or more
amino acid substitutions, deletions, and/or insertions are present
as compared to the DKR polypeptides of SEQ ID NOs:8-14, and/or (3)
biologically active polypeptides, or fragments or variants thereof,
that have been chemically modified.
[0083] As used herein, the term "DKR polypeptide fragment" refers
to a peptide or polypeptide that is less than the full length amino
acid sequence of a naturally occurring DKR polypeptide but has the
biological activity of any of the DKR polypeptides provided herein.
Such a fragment may be truncated at the amino terminus, the carboxy
terminus, and/or internally (such as by natural splicing), and may
be a variant or a derivative of any of the DKR polypeptides. Such
DKR polypeptides fragments may be prepared with or without an amino
terminal methionine. In addition, DKR polypeptides fragments can be
naturally occurring fragments such as DKR polypeptide splice
variants (SEQ ID NO:13), other splice variants, and fragments
resulting from naturally occurring in vivo protease activity.
Preferred DKR polypeptide fragments include amino acids 16-350,
21-350, 22-350, 23-350, 33-350, 42-350, 21-145, 40-145, 40-150,
45-145, 145-290, 145-300, 145-350, 150-290, 300-350, and 310-350,
of SEQ ID NO:9; amino acids 15-266, 24-266, or 32-266 of SEQ ID
NO:10; amino acids 17-259, 26-259, or 34-359 of SEQ ID NO:12; and
amino acids 19-224, 20-224, 21-224, or 22-224 of SEQ ID NO:14.
[0084] As used herein, the term "DKR polypeptide variants" refers
to DKR polypeptides whose amino acid sequences contain one or more
amino acid sequence substitutions, deletions, and/or insertions as
compared to the DKR polypeptides amino acid sequences set forth in
SEQ ID NOS:8-14. Such DKR polypeptides variants can be prepared
from the corresponding DKR polypeptides nucleic acid molecule
variants, which have a DNA sequence that varies accordingly from
the DNA sequences for wild type DKR polypeptides as set forth in
SEQ ID NOS:7-14. Preferred variants of the human DKR polypeptides
include alanine substitutions at one or more of amino acid
positions. Other preferred substitutions include conservative
substitutions at the amino acid positions indicated in the Examples
herein, as well as those encoded by DKR nucleic acid molecules as
described below.
[0085] As used herein, the term "DKR polypeptide derivatives"
refers to DKR polypeptides, variants, or fragments thereof, that
have been chemically modified, as for example, by addition of one
or more polyethylene glycol molecules, sugars, phosphates, and/or
other such molecules, where the molecule or molecules are not
naturally attached to wild-type DKR polypeptides.
[0086] As used herein, the terms "biologically active DKR
polypeptides", "biologically active DKR polypeptide fragments",
"biologically active DKR polypeptide variants", and "biologically
active DKR polypeptide derivatives" refer to DKR polypeptides that
have the ability to decrease cancer cell proliferation in the
Anchorage Independent Growth Assay of Example 12 herein, or in the
In Vivo Tumor Assay of Example 13 herein, or in both assays.
[0087] As used herein, the term "DKR polypeptide nucleic acids"
when used to describe a nucleic acid molecule refers to a nucleic
acid molecule or fragment thereof that (a) has the nucleotide
sequence as set forth in any of SEQ ID NOs:1-7; (b) has a nucleic
acid sequence encoding a polypeptide that is at least 85 percent
identical, but may be greater than 85 percent, i.e., 86, 87, 88,
89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identical to
the polypeptide encoded by any of SEQ ID NOS:10-14; (c) is a
naturally occurring allelic variant or alternate splice variant of
(a) or (b); (d) is a nucleic acid variant of (a)-(c) produced as
provided for herein; (e) has a sequence that is complementary to
(a)-(d); (f) hybridizes to any of (a)-(e) under conditions of high
stringency and/or (g) has a nucleic acid sequence encoding 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25,
30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or up to
100 amino acid substitutions and/or deletions of any mature DKR
polypeptide (i.e., a DKR polypeptide with its endogenous signal
peptide removed).
[0088] Percent sequence identity can be determined by standard
methods that are commonly used to compare the similarity in
position of the amino acids of two polypeptides. By way of example,
using a computer algorithm such as GAP (Genetic Computer Group,
University of Wisconsin, Madison, Wis.), the two polypeptides for
which the percent sequence identity is to be determined are aligned
for optimal matching of their respective amino acids (the "matched
span", as determined by the algorithm). A gap opening penalty
(which is calculated as 3.times. the average diagonal; the "average
diagonal" is the average of the diagonal of the comparison matrix
being used; the "diagonal" is the score or number assigned to each
perfect amino acid by the particular comparison matrix) and a gap
extension penalty (which is usually 1/10 times the gap opening
penalty), as well as a comparison matrix such as PAM 250 or BLOSUM
62 are used in conjunction with the algorithm. A standard
comparison matrix (see Dayhoff et al., in: Atlas of Protein
Sequence and Structure, vol. 5, supp. 3 [1978] for the PAM250
comparison matrix; see Henikoff et al., Proc. Natl. Acad. Sci. USA,
89:10915-10919 [1992] for the BLOSUM 62 comparison matrix) is also
used by the algorithm. The percent identity is then calculated by
the algorithm by determining the percent identity as follows: Total
.times. .times. number .times. .times. of .times. .times. identical
.times. .times. matches in .times. .times. the .times. .times.
matched .times. .times. span [ length .times. .times. of .times.
.times. the .times. .times. longer .times. .times. sequence within
.times. .times. the .times. .times. matched .times. .times. span ]
+ [ number .times. .times. of .times. .times. gaps .times. .times.
introduced .times. .times. into the .times. .times. longer .times.
.times. sequence .times. .times. in .times. .times. order .times.
.times. to align .times. .times. the .times. .times. two .times.
.times. sequences ] 100 ##EQU1##
[0089] Polypeptides that are at least 85 percent identical will
typically have one or more amino acid substitutions, deletions,
and/or insertions as compared with any of the wild type DKR
polypeptides. Usually, the substitutions of the native residue will
be either alanine, or a conservative amino acid so as to have
little or no effect on the overall net charge, polarity, or
hydrophobicity of the protein. Conservative substitutions are set
forth in Table I below. TABLE-US-00001 TABLE I Conservative Amino
Acid Substitutions Basic: arginine lysine histidine Acidic:
glutamic acid aspartic acid Uncharged Polar: glutamine asparagine
serine threonine tyrosine Non-Polar: phenylalanine tryptophan
cysteine glycine alanine valine proline methionine leucine
isoleucine
[0090] The term "conditions of high stringency" refers to
hybridization and washing under conditions that permit binding of a
nucleic acid molecule used for screening, such as an
oligonucleotide probe or cDNA molecule probe, to highly homologous
sequences. An exemplary high stringency wash solution is
0.2.times.SSC and 0.1 percent SDS used at a temperature of between
50.degree. C.-65.degree. C.
[0091] Where oligonucleotide probes are used to screen cDNA or
genomic libraries, one of the following two high stringency
solution may be used. The first of these is 6.times.SSC with 0.05
percent sodium pyrophosphate at a temperature of 35.degree.
C.-62.degree. C., depending on the length of the oligonucleotide
probe. For example, 14 base pair probes are washed at 35-40.degree.
C., 17 base pair probes are washed at 45-50.degree. C., 20 base
pair probes are washed at 52-57.degree. C., and 23 base pair probes
are washed at 57-63.degree. C. The temperature can be increased
2-3.degree. C. where the background non-specific binding appears
high. A second high stringency solution utilizes
tetramethylammonium chloride (TMAC) for washing oligonucleotide
probes. One stringent washing solution is 3 M TMAC, 50 mM Tris-HCl,
pH 8.0, and 0.2 percent SDS. The washing temperature using this
solution is a function of the length of the probe. For example, a
17 base pair probe is washed at about 45-50.degree. C.
[0092] As used herein, the terms "effective amount" and
"therapeutically effective amount" refer to the amount of a DKR
polypeptide necessary to support one or more biological activities
of the DKR polypeptides as set forth above.
[0093] A full-length DKR polypeptide or fragment thereof can be
prepared using well known recombinant DNA technology methods such
as those set forth in Sambrook et al. (Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. [1989]) and/or Ausubel et al., eds., (Current
Protocols in Molecular Biology, Green Publishers Inc. and Wiley and
Sons, N.Y. [1994]). A gene or cDNA encoding a DKR polypeptide or
fragment thereof may be obtained for example by screening a genomic
or cDNA library, or by PCR amplification. Probes or primers useful
for screening the library can be generated based on sequence
information for other known genes or gene fragments from the same
or a related family of genes, such as, for example, conserved
motifs found in other DKR polypeptides such as the cysteine
pattern. In addition, where a gene encoding DKR polypeptide has
been identified from one species, all or a portion of that gene may
be used as a probe to identify homologous genes from other species.
The probes or primers may be used to screen cDNA libraries from
various tissue sources believed to express the DKR gene. Typically,
conditions of high stringency will be employed for screening to
minimize the number of false positives obtained from the
screen.
[0094] Another means to prepare a gene encoding a DKR polypeptide
or fragment thereof is to employ chemical synthesis using methods
well known to the skilled artisan such as those described by Engels
et al. (Angew. Chem. Intl. Ed., 28:716-734 [1989]). These methods
include, inter alia, the phosphotriester, phosphoramidite, and
H-phosphonate methods for nucleic acid synthesis. A preferred
method for such chemical synthesis is polymer-supported synthesis
using standard phosphoramidite chemistry. Typically, the DNA
encoding the DKR polypeptide will be several hundred nucleotides in
length. Nucleic acids larger than about 100 nucleotides can be
synthesized as several fragments using these methods. The fragments
can then be ligated together to form the full length DKR
polypeptide. Usually, the DNA fragment encoding the amino terminus
of the polypeptide will have an ATG, which encodes a methionine
residue. This methionine may or may not be present on the mature
form of the DKR polypeptide, depending on whether the polypeptide
produced in the host cell is designed to be secreted from that
cell.
[0095] In some cases, it may be desirable to prepare nucleic acid
and/or amino acid variants of the naturally occurring DKR
polypeptides. Nucleic acid variants may be produced using site
directed mutagenesis, PCR amplification, or other appropriate
methods, where the primer(s) have the desired point mutations (see
Sambrook et al., supra, and Ausubel et al., supra, for descriptions
of mutagenesis techniques). Chemical synthesis using methods
described by Engels et al., supra, may also be used to prepare such
variants. Other methods known to the skilled artisan may be used as
well. Preferred nucleic acid variants are those containing
nucleotide substitutions accounting for codon preference in the
host cell that is to be used to produce the DKR polypeptide(s).
Such "codon optimization" can be determined via computer
algorithers which incorporate codon frequency tables such as
"Ecohigh. Cod" for codon preference of highly expressed bacterial
genes as provided by the University of Wisconsin Package Version
9.0, Genetics Computer Group, Madison, Wis. Other useful codon
frequency tables include "Celegans_high.cod", "Celegans_low.cod",
"Drosophila_high.cod", "Human_high.cod", "Maize_high.cod", and
"Yeast_high.cod". Other preferred variants are those encoding
conservative amino acid changes as described above (e.g., wherein
the charge or polarity of the naturally occurring amino acid side
chain is not altered substantially by substitution with a different
amino acid) as compared to wild type, and/or those designed to
either generate a novel glycosylation and/or phosphorylation
site(s), or those designed to delete an existing glycosylation
and/or phosphorylation site(s).
[0096] The gene, cDNA, or fragment thereof encoding the DKR
polypeptide can be inserted into an appropriate expression or
amplification vector using standard ligation techniques. The vector
is typically selected to be functional in the particular host cell
employed (i.e., the vector is compatible with the host cell
machinery such that amplification of the gene and/or expression of
the gene can occur). The gene, cDNA or fragment thereof encoding
the DKR polypeptide may be amplified/expressed in prokaryotic,
yeast, insect (baculovirus systems) and/or eukaryotic host cells.
Selection of the host cell will depend in part on whether the DKR
polypeptide or fragment thereof is to be glycosylated and/or
phosphorylated. If so, yeast, insect, or mammalian host cells are
preferable.
[0097] Typically, the vectors used in any of the host cells will
contain 5' flanking sequence (also referred to as a "promoter") and
other regulatory elements as well such as an enhancer(s), an origin
of replication element, a transcriptional termination element, a
complete intron sequence containing a donor and acceptor splice
site, a signal peptide sequence, a ribosome binding site element, a
polyadenylation sequence, a polylinker region for inserting the
nucleic acid encoding the polypeptide to be expressed, and a
selectable marker element. Each of these elements is discussed
below. Optionally, the vector may contain a "tag" sequence, i.e.,
an oligonucleotide molecule located at the 5' or 3' end of the DKR
polypeptide coding sequence; the oligonucleotide molecule encodes
polyHis (such as hexaHis), or other "tag" such as FLAG, HA
(hemaglutinin Influenza virus) or myc for which commercially
available antibodies exist. This tag is typically fused to the
polypeptide upon expression of the polypeptide, and can serve as
means for affinity purification of the DKR polypeptide from the
host cell. Affinity purification can be accomplished, for example,
by column chromatography using antibodies against the tag as an
affinity matrix. Optionally, the tag can subsequently be removed
from the purified DKR polypeptide by various means such as using
certain peptidases.
[0098] The human immunoglobulin hinge and Fc region could be fused
at either the N-terminus or C-terminus of the DKR polypeptides by
one skilled in the art. The subsequent Fc-fusion protein could be
purified by use of a Protein A affinity column. Fc is known to
exhibit a long pharmacokinetic half-life in vivo and proteins fused
to Fc have been found to exhibit a substantially greater half-life
in vivo than the unfused counterpart. Also, fusion to the Fc region
allows for dimerization/multimerization of the molecule that may be
useful for the bioactivity of some molecules.
[0099] The 5' flanking sequence may be homologous (i.e., from the
same species and/or strain as the host cell), heterologous (i.e.,
from a species other than the host cell species or strain), hybrid
(i.e., a combination of 5' flanking sequences from more than one
source), synthetic, or it may be the native DKR polypeptides gene
5' flanking sequence. As such, the source of the 5' flanking
sequence may be any unicellular prokaryotic or eukaryotic organism,
any vertebrate or invertebrate organism, or any plant, provided
that the 5' flanking sequence is functional in, and can be
activated by, the host cell machinery.
[0100] The 5' flanking sequences useful in the vectors of this
invention may be obtained by any of several methods well known in
the art. Typically, 5' flanking sequences useful herein other than
the DKR gene flanking sequence will have been previously identified
by mapping and/or by restriction endonuclease digestion and can
thus be isolated from the proper tissue source using the
appropriate restriction endonucleases. In some cases, the full
nucleotide sequence of the 5' flanking sequence may be known. Here,
the 5' flanking sequence may be synthesized using the methods
described above for nucleic acid synthesis or cloning.
[0101] Where all or only a portion of the 5' flanking sequence is
known, it may be obtained using PCR and/or by screening a genomic
library with suitable oligonucleotide and/or 5' flanking sequence
fragments from the same or another species.
[0102] Where the 5' flanking sequence is not known, a fragment of
DNA containing a 5' flanking sequence may be isolated from a larger
piece of DNA that may contain, for example, a coding sequence or
even another gene or genes. Isolation may be accomplished by
restriction endonuclease digestion using one or more carefully
selected enzymes to isolate the proper DNA fragment. After
digestion, the desired fragment may be isolated by agarose gel
purification, Qiagen.RTM. column or other methods known to the
skilled artisan. Selection of suitable enzymes to accomplish this
purpose will be readily apparent to one of ordinary skill in the
art.
[0103] The origin of replication element is typically a part of
prokaryotic expression vectors purchased commercially, and aids in
the amplification of the vector in a host cell. Amplification of
the vector to a certain copy number can, in some cases, be
important for optimal expression of the DKR polypeptide. If the
vector of choice does not contain an origin of replication site,
one may be chemically synthesized based on a known sequence, and
ligated into the vector.
[0104] The transcription termination element is typically located
3' of the end of the DKR polypeptide coding sequence and serves to
terminate transcription of the DKR polypeptide. Usually, the
transcription termination element in prokaryotic cells is a G-C
rich fragment followed by a poly T sequence. While the element is
easily cloned from a library or even purchased commercially as part
of a vector, it can also be readily synthesized using methods for
nucleic acid synthesis such as those described above.
[0105] A selectable marker gene element encodes a protein necessary
for the survival and growth of a host cell grown in a selective
culture medium. Typical selection marker genes encode proteins that
(a) confer resistance to antibiotics or other toxins, e.g.,
ampicillin, tetracycline, or kanamycin for prokaryotic host cells,
(b) complement auxotrophic deficiencies of the cell; or (c) supply
critical nutrients not available from complex media. Preferred
selectable markers are the kanamycin resistance gene, the
ampicillin resistance gene, and the tetracycline resistance
gene.
[0106] The ribosome binding element, commonly called the
Shine-Dalgarno sequence (prokaryotes) or the Kozak sequence
(eukaryotes), is usually necessary for translation initiation of
mRNA. The element is typically located 3' to the promoter and 5' to
the coding sequence of the DKR polypeptide to be synthesized. The
Shine-Dalgarno sequence is varied but is typically a polypurine
(i.e., having a high A-G content). Many Shine-Dalgarno sequences
have been identified, each of which can be readily synthesized
using methods set forth above and used in a prokaryotic vector.
[0107] In those cases where it is desirable for DKR polypeptide to
be secreted from the host cell, a signal sequence may be used to
direct the DKR polypeptide out of the host cell where it is
synthesized, and the carboxy-terminal part of the protein may be
deleted in order to prevent membrane anchoring. Typically, the
signal sequence is positioned in the coding region of the DKR gene
or cDNA, or directly at the 5' end of the DKR gene coding region.
Many signal sequences have been identified, and any of them that
are functional in the selected host cell may be used in conjunction
with the DKR gene or cDNA. Therefore, the signal sequence may be
homologous or heterologous to the DKR gene or cDNA, and may be
homologous or heterologous to the DKR polypeptides gene or cDNA.
Additionally, the signal sequence may be chemically synthesized
using methods set forth above.
[0108] In most cases, secretion of the polypeptide from the host
cell via the presence of a signal peptide will result in the
removal of the amino terminal methionine from the polypeptide.
[0109] In many cases, transcription of the DKR gene or cDNA is
increased by the presence of one or more introns in the vector;
this is particularly true where the DKR polypeptide is produced in
eukaryotic host cells, especially mammalian host cells. The introns
used may be naturally occurring within the DKR gene, especially
where the gene used is a full length genomic sequence or a fragment
thereof. Where the intron is not naturally occurring within the
gene (as for most cDNAs), the intron(s) may be obtained from
another source. The position of the intron with respect to the 5'
flanking sequence and the DKR gene is generally important, as the
intron must be transcribed to be effective. As such, where the DKR
gene inserted into the expression vector is a cDNA molecule, the
preferred position for the intron is 3' to the transcription start
site, and 5' to the polyA transcription termination sequence.
Preferably for DKR cDNA, the intron or introns will be located on
one side or the other (i.e., 5' or 3') of the cDNA such that it
does not interrupt the this coding sequence. Any intron from any
source, including any viral, prokaryotic and eukaryotic (plant or
animal) organisms, may be used to practice this invention, provided
that it is compatible with the host cell(s) into which it is
inserted. Also included herein are synthetic introns. Optionally,
more than one intron may be used in the vector.
[0110] Where one or more of the elements set forth above are not
already present in the vector to be used, they may be individually
obtained and ligated into the vector. Methods used for obtaining
each of the elements are well known to the skilled artisan and are
comparable to the methods set forth above (i.e., synthesis of the
DNA, library screening, and the like).
[0111] The final vectors used to practice this invention are
typically constructed from a starting vectors such as a
commercially available vector. Such vectors may or may not contain
some of the elements to be included in the completed vector. If
none of the desired elements are present in the starting vector,
each element may be individually ligated into the vector by cutting
the vector with the appropriate restriction endonuclease(s) such
that the ends of the element to be ligated in and the ends of the
vector are compatible for ligation. In some cases, it may be
necessary to "blunt" the ends to be ligated together in order to
obtain a satisfactory ligation. Blunting is accomplished by first
filling in "sticky ends" using Klenow DNA polymerase or T4 DNA
polymerase in the presence of all four nucleotides. This procedure
is well known in the art and is described for example in Sambrook
et al., supra.
[0112] Alternatively, two or more of the elements to be inserted
into the vector may first be ligated together (if they are to be
positioned adjacent to each other) and then ligated into the
vector.
[0113] One other method for constructing the vector to conduct all
ligations of the various elements simultaneously in one reaction
mixture. Here, many nonsense or nonfunctional vectors will be
generated due to improper ligation or insertion of the elements,
however the functional vector may be identified and selected by
restriction endonuclease digestion.
[0114] Preferred vectors for practicing this invention are those
which are compatible with bacterial, insect, and mammalian host
cells. Such vectors include, inter alia, pCRII, pCR3, and pcDNA3.1
(Invitrogen Company, San Diego, Calif.), pBSII (Stratagene Company,
La Jolla, Calif.), pET15b (Novagen, Madison, Wis.), pGEX (Pharmacia
Biotech, Piscataway, N.J.), pEGFP-N2 (Clontech, Palo Alto, Calif.),
pETL (BlueBacII; Invitrogen), and pFastBacDual (Gibco/BRL, Grand
Island, N.Y.).
[0115] After the vector has been constructed and a nucleic acid
molecule encoding full length or truncated DKR polypeptide has been
inserted into the proper site of the vector, the completed vector
may be inserted into a suitable host cell for amplification and/or
polypeptide expression.
[0116] Host cells may be prokaryotic host cells (such as E. coli)
or eukaryotic host cells (such as a yeast cell, an insect cell, or
a vertebrate cell). The host cell, when cultured under appropriate
conditions, can synthesize DKR polypeptide which can subsequently
be collected from the culture medium (if the host cell secretes it
into the medium) or directly from the host cell producing it (if it
is not secreted). After collection, the DKR polypeptide can be
purified using methods such as molecular sieve chromatography,
affinity chromatography, and the like.
[0117] Selection of the host cell for DKR polypeptide production
will depend in part on whether the DKR polypeptide is to be
glycosylated or phosphorylated (in which case eukaryotic host cells
are preferred), and the manner in which the host cell is able to
"fold" the protein into its native tertiary structure (e.g., proper
orientation of disulfide bridges, etc.) such that biologically
active protein is prepared by the DKR polypeptide that has
biological activity, the DKR polypeptide may be "folded" after
synthesis using appropriate chemical conditions as discussed
below.
[0118] Suitable cells or cell lines may be mammalian cells, such as
Chinese hamster ovary cells (CHO), human embryonic kidney (HEK) 293
or 293T cells, or 3T3 cells. The selection of suitable mammalian
host cells and methods for transformation, culture, amplification,
screening and product production and purification are known in the
art. Other suitable mammalian cell lines, are the monkey COS-1 and
COS-7 cell lines, and the CV-1 cell line. Further exemplary
mammalian host cells include primate cell lines and rodent cell
lines, including transformed cell lines. Normal diploid cells, cell
strains derived from in vitro culture of primary tissue, as well as
primary explants, are also suitable. Candidate cells may be
genotypically deficient in the selection gene, or may contain a
dominantly acting selection gene. Other suitable mammalian cell
lines include but are not limited to, mouse neuroblastoma N2A
cells, HeLa, mouse L-929 cells, 3T3 lines derived from Swiss,
Balb-c or NIH mice, BHK or HaK hamster cell lines.
[0119] Similarly useful as host cells suitable for the present
invention are bacterial cells. For example, the various strains of
E. coli (e.g., HB101, DH5.alpha., DH10, and MC1061) are well-known
as host cells in the field of biotechnology. Various strains of B.
subtilis, Pseudomonas spp., other Bacillus spp., Streptomyces spp.,
and the like may also be employed in this method.
[0120] Many strains of yeast cells known to those skilled in the
art are also available as host cells for expression of the
polypeptides of the present invention.
[0121] Additionally, where desired, insect cell systems may be
utilized in the methods of the present invention. Such systems are
described for example in Kitts et al. (Biotechniques, 14:810-817
[1993]), Lucklow (Curr. Opin. Biotechnol., 4:564-572 [1993]) and
Lucklow et al. (J. Virol., 67:4566-4579 [1993]). Preferred insect
cells are Sf-9 and Hi5 (Invitrogen, Carlsbad, Calif.).
[0122] Insertion (also referred to as "transformation" or
"transfection") of the vector into the selected host cell may be
accomplished using such methods as calcium chloride,
electroporation, microinjection, lipofection or the DEAE-dextran
method. The method selected will in part be a function of the type
of host cell to be used. These methods and other suitable methods
are well known to the skilled artisan, and are set forth, for
example, in Sambrook et al., supra.
[0123] The host cells containing the vector (i.e., transformed or
transfected) may be cultured using standard media well known to the
skilled artisan. The media will usually contain all nutrients
necessary for the growth and survival of the cells. Suitable media
for culturing E. coli cells are for example, Luria Broth (LB)
and/or Terrific Broth (TB). Suitable media for culturing eukaryotic
cells are RPMI 1640, MEM, DMEM, all of which may be supplemented
with serum and/or growth factors as required by the particular cell
line being cultured. A suitable medium for insect cultures is
Grace's medium supplemented with yeastolate, lactalbumin
hydrolysate, and/or fetal calf serum as necessary.
[0124] Typically, an antibiotic or other compound useful for
selective growth of the transformed cells only is added as a
supplement to the media. The compound to be used will be dictated
by the selectable marker element present on the plasmid with which
the host cell was transformed. For example, where the selectable
marker element is kanamycin resistance, the compound added to the
culture medium will be kanamycin.
[0125] The amount of DKR polypeptide produced in the host cell can
be evaluated using standard methods known in the art. Such methods
include, without limitation, Western blot analysis,
SDS-polyacrylamide gel electrophoresis, non-denaturing gel
electrophoresis, HPLC separation, immunoprecipitation, and/or
activity assays such as DNA binding gel shift assays.
[0126] If the DKR polypeptide has been designed to be secreted from
the host cells, the majority of polypeptide may be found in the
cell culture medium. Polypeptides prepared in this way will
typically not possess an amino terminal methionine, as it is
removed during secretion from the cell. If however, the DKR
polypeptide is not secreted from the host cells, it will be present
in the cytoplasm and/or the nucleus (for eukaryotic host cells) or
in the cytosol (for gram negative bacteria host cells) and may have
an amino terminal methionine.
[0127] For DKR polypeptide situated in the host cell cytoplasm
and/or nucleus, the host cells are typically first disrupted
mechanically or with detergent to release the intra-cellular
contents into a buffered solution. DKR polypeptide can then be
isolated from this solution.
[0128] Purification of DKR polypeptide from solution can be
accomplished using a variety of techniques. If the polypeptide has
been synthesized such that it contains a tag such as Hexahistidine
(DKR polypeptide/hexaHis) or other small peptide such as FLAG
(Eastman Kodak Co., New Haven, Conn.) or myc (Invitrogen, Carlsbad,
Calif.) at either its carboxyl or amino terminus, it may
essentially be purified in a one-step process by passing the
solution through an affinity column where the column matrix has a
high affinity for the tag or for the polypeptide directly (i.e., a
monoclonal antibody specifically recognizing DKR polypeptide). For
example, polyhistidine binds with great affinity and specificity to
nickel, thus an affinity column of nickel (such as the Qiagen.RTM.
nickel columns) can be used for purification of DKR
polypeptide/polyHis. (See for example, Ausubel et al., eds.,
Current Protocols in Molecular Biology, Section 10.11.8, John Wiley
& Sons, New York [1993]).
[0129] Where the DKR polypeptide is prepared without a tag
attached, and no antibodies are available, other well known
procedures for purification can be used. Such procedures include,
without limitation, ion exchange chromatography, molecular sieve
chromatography, HPLC, native gel electrophoresis in combination
with gel elution, and preparative isoelectric focusing ("Isoprime"
machine/technique, Hoefer Scientific). In some cases, two or more
of these techniques may be combined to achieve increased
purity.
[0130] If it is anticipated that the DKR polypeptide will be found
primarily intracellularly, the intracellular material (including
inclusion bodies for gram-negative bacteria) can be extracted from
the host cell using any standard technique known to the skilled
artisan. For example, the host cells can be lysed to release the
contents of the periplasm/cytoplasm by French press,
homogenization, and/or sonication followed by centrifugation.
[0131] If the DKR polypeptide has formed inclusion bodies in the
cytosol, the inclusion bodies can often bind to the inner and/or
outer cellular membranes and thus will be found primarily in the
pellet material after centrifugation. The pellet material can then
be treated at pH extremes or with chaotropic agent such as a
detergent, guanidine, guanidine derivatives, urea, or urea
derivatives in the presence of a reducing agent such as
dithiothreitol at alkaline pH or tris carboxyethyl phosphine at
acid pH to release, break apart, and solubilize the inclusion
bodies. The DKR polypeptide in its now soluble form can then be
analyzed using gel electrophoresis, immunoprecipitation or the
like. If it is desired to isolate the DKR polypeptide, isolation
may be accomplished using standard methods such as those set forth
below and in Marston et al. (Meth. Enz., 182:264-275 [1990]). In
some cases, the DKR polypeptide may not be biologically active upon
isolation. Various methods for "refolding" or converting the
polypeptide to its tertiary structure and generating disulfide
linkages, can be used to restore biological activity. Such methods
include exposing the solubilized polypeptide to a pH usually above
7 and in the presence of a particular concentration of a chaotrope.
The selection of chaotrope is very similar to the choices used for
inclusion body solubilization but usually at a lower concentration
and is not necessarily the same chaotrope as used for the
solubilization. In most cases the refolding/oxidation solution will
also contain a reducing agent or the reducing agent plus its'
oxidized form in a specific ratio to generate a particular redox
potential allowing for disulfide shuffling to occur in the
formation of the protein's cysteine bridge(s). Some of the commonly
used redox couples include cysteine/cystamine, glutathione
(GSH)/dithiobis GSH, cupric chloride, dithiothreitol (DTT)/dithiane
DTT, 2-mercaptoethanol (bME)/dithio-b (ME). In many instances a
cosolvent is necessary to increase the efficiency of the refolding
and the more common reagents used for this purpose include
glycerol, polyethylene glycol of various molecular weights, and
arginine.
[0132] If DKR polypeptide inclusion bodies are not formed to a
significant degree in the host cell, the DKR polypeptide will be
found primarily in the supernatant after centrifugation of the cell
homogenate, and the DKR polypeptide can be isolated from the
supernatant using methods such as those set forth below.
[0133] In those situations where it is preferable to partially or
completely isolate the DKR polypeptide, purification can be
accomplished using standard methods well known to the skilled
artisan. Such methods include, without limitation, separation by
electrophoresis followed by electroelution, various types of
chromatography (immunoaffinity, molecular sieve, and/or ion
exchange), and/or high pressure liquid chromatography. In some
cases, it may be preferable to use more than one of these methods
for complete purification.
[0134] In addition to preparing and purifying DKR polypeptide using
recombinant DNA techniques, the DKR polypeptides, fragments, and/or
derivatives thereof may be prepared by chemical synthesis methods
(such as solid phase peptide synthesis) using techniques known in
the art such as those set forth by Merrifield et al., (J. Am. Chem.
Soc., 85:2149 [1963]), Houghten et al. (Proc Natl Acad. Sci. USA,
82:5132 [1985]), and Stewart and Young (Solid Phase Peptide
Synthesis, Pierce Chemical Co., Rockford, Ill. [1984]). Such
polypeptides may be synthesized with or without a methionine on the
amino terminus. Chemically synthesized DKR polypeptides or
fragments may be oxidized using methods set forth in these
references to form disulfide bridges. The DKR polypeptides or
fragments are expected to have biological activity comparable to
DKR polypeptides produced recombinantly or purified from natural
sources, and thus may be used interchangeably with recombinant or
natural DKR polypeptide.
[0135] Chemically modified DKR polypeptide compositions in which
DKR polypeptide is linked to a polymer are included within the
scope of the present invention. The polymer selected is typically
water soluble so that the protein to which it is attached does not
precipitate in an aqueous environment, such as a physiological
environment. The polymer selected is usually modified to have a
single reactive group, such as an active ester for acylation or an
aldehyde for alkylation, so that the degree of polymerization may
be controlled as provided for in the present methods. The polymer
may be of any molecular weight, and may be branched or unbranched.
Included within the scope of DKR polypeptide polymers is a mixture
of polymers. Preferably, for therapeutic use of the end-product
preparation, the polymer will be pharmaceutically acceptable.
[0136] The water soluble polymer or mixture thereof may be selected
from the group consisting of, for example, polyethylene glycol
(PEG), monomethoxy-polyethylene glycol, dextran, cellulose, or
other carbohydrate based polymers, poly-(N-vinyl pyrrolidone)
polyethylene glycol, propylene glycol homopolymers, a polypropylene
oxide/ethylene oxide co-polymer, polyoxyethylated polyols (e.g.,
glycerol) and polyvinyl alcohol.
[0137] For the acylation reactions, the polymer(s) selected should
have a single reactive ester group. For reductive alkylation, the
polymer(s) selected should have a single reactive aldehyde group. A
preferred reactive aldehyde is polyethylene glycol propionaldehyde,
which is water stable, or mono C1-C10 alkoxy or aryloxy derivatives
thereof (see U.S. Pat. No. 5,252,714).
[0138] Pegylation of DKR polypeptides may be carried out by any of
the pegylation reactions known in the art, as described for example
in the following references: Focus on Growth Factors 3: 4-10
(1992); EP 0 154 316; and EP 0 401 384. Preferably, the pegylation
is carried out via an acylation reaction or an alkylation reaction
with a reactive polyethylene glycol molecule (or an analogous
reactive water-soluble polymer) as described below.
[0139] A particularly preferred water-soluble polymer for use
herein is polyethylene glycol, abbreviated PEG. As used herein,
polyethylene glycol is meant to encompass any of the forms of PEG
that have been used to derivatize other proteins, such as
mono-(C1-C10) alkoxy- or aryloxy-polyethylene glycol.
[0140] In general, chemical derivatization may be performed under
any suitable conditions used to react a biologically active
substance with an activated polymer molecule. Methods for preparing
pegylated DKR polypeptides will generally comprise the steps of (a)
reacting the polypeptide with polyethylene glycol (such as a
reactive ester or aldehyde derivative of PEG) under conditions
whereby DKR polypeptide becomes attached to one or more PEG groups,
and (b) obtaining the reaction product(s). In general, the optimal
reaction conditions for the acylation reactions will be determined
based on known parameters and the desired result. For example, the
larger the ratio of PEG:protein, the greater the percentage of
poly-pegylated product.
[0141] Generally, conditions which may be alleviated or modulated
by administration of the present polymer/polypeptides include those
described herein for DKR polypeptides molecules. However, the
polymer/DKR polypeptides molecules disclosed herein may have
additional activities, enhanced or reduced biological activity, or
other characteristics, such as increased or decreased half-life, as
compared to the non-derivatized molecules.
[0142] The DKR polypeptides, fragments thereof, variants, and
derivatives, may be employed alone, together, or in combination
with other pharmaceutical compositions. The DKR polypeptides,
fragments, variants, and derivatives may be used in combination
with cytokines, growth factors, antibiotics, anti-inflammatories,
and/or chemotherapeutic agents as is appropriate for the indication
being treated.
[0143] DKR nucleic acid molecules, fragments, and/or derivatives
that do not themselves encode polypeptides that are active in
activity assays may be useful as hybridization probes in diagnostic
assays to test, either qualitatively or quantitatively, for the
presence of DKR DNA or corresponding RNA in mammalian tissue or
bodily fluid samples.
[0144] DKR polypeptide fragments, variants, and/or derivatives that
are not themselves active in activity assays may be useful for
preparing antibodies that recognize DKR polypeptides.
[0145] The DKR polypeptides, fragments, variants, and/or
derivatives may be used to prepare antibodies using standard
methods. Thus, antibodies that react with the DKR polypeptides, as
well as reactive fragments of such antibodies, are also
contemplated as within the scope of the present invention. The
antibodies may be polyclonal, monoclonal, recombinant, chimeric,
single-chain and/or bispecific. Typically, the antibody or fragment
thereof will either be of human origin, or will be "humanized",
i.e., prepared so as to prevent or minimize an immune reaction to
the antibody when administered to a patient. The antibody fragment
may be any fragment that is reactive with DKR polypeptides of the
present invention, such as, F.sub.ab, F.sub.ab', etc. Also provided
by this invention are the hybridomas generated by presenting any
DKR polypeptide or fragments thereof as an antigen to a selected
mammal, followed by fusing cells (e.g., spleen cells) of the mammal
with certain cancer cells to create immortalized cell lines by
known techniques. The methods employed to generate such cell lines
and antibodies directed against all or portions of a human DKR
polypeptide of the present invention are also encompassed by this
invention.
[0146] The antibodies may be used therapeutically, such as to
inhibit binding of the DKR polypeptide to its binding partner. The
antibodies may further be used for in vivo and in vitro diagnostic
purposes, such as in labeled form to detect the presence of DKR
polypeptide in a body fluid or cell sample.
[0147] Preferred antibodies are human antibodies, either polyclonal
or monoclonal.
Therapeutic Compositions and Administration
[0148] Therapeutic compositions of DKR polypeptides are within the
scope of the present invention. Such compositions may comprise a
therapeutically effective amount of the polypeptide or fragments,
variants, or derivatives in admixture with a pharmaceutically
acceptable carrier. The carrier material may be water for
injection, preferably supplemented with other materials common in
solutions for administration to mammals. Typically, a DKR
polypeptide therapeutic compound will be administered in the form
of a composition comprising purified polypeptide, fragment,
variant, or derivative in conjunction with one or more
physiologically acceptable carriers, excipients, or diluents.
Neutral buffered saline or saline mixed with serum albumin are
exemplary appropriate carriers. Preferably, the product is
formulated as a lyophilizate using appropriate excipients (e.g.,
sucrose). Other standard carriers, diluents, and excipients may be
included as desired. Other exemplary compositions comprise Tris
buffer of about pH 7.0-8.5, or acetate buffer of about pH 4.0-5.5,
which may further include sorbitol or a suitable substitute
therefor.
[0149] The DKR polypeptide compositions can be administered
parenterally. Alternatively, the compositions may be administered
intravenously or subcutaneously. When systemically administered,
the therapeutic compositions for use in this invention may be in
the form of a pyrogen-free, parenterally acceptable aqueous
solution. The preparation of such pharmaceutically acceptable
protein solutions, with due regard to pH, isotonicity, stability
and the like, is within the skill of the art.
[0150] Therapeutic formulations of DKR polypeptide compositions
useful for practicing the present invention may be prepared for
storage by mixing the selected composition having the desired
degree of purity with optional physiologically acceptable carriers,
excipients, or stabilizers (Remington's Pharmaceutical Sciences,
18th Edition, A. R. Gennaro, ed., Mack Publishing Company [1990])
in the form of a lyophilized cake or an aqueous solution.
Acceptable carriers, excipients or stabilizers are nontoxic to
recipients and are preferably inert at the dosages and
concentrations employed, and include buffers such as phosphate,
citrate, or other organic acids; antioxidants such as ascorbic
acid; low molecular weight polypeptides; proteins, such as serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine, glutamine,
asparagine, arginine or lysine; monosaccharides, disaccharides, and
other carbohydrates including glucose, mannose, or dextrins;
chelating agents such as EDTA; sugar alcohols such as mannitol or
sorbitol; salt-forming counterions such as sodium; and/or nonionic
surfactants such as Tween, pluronics or polyethylene glycol
(PEG).
[0151] An effective amount of the DKR polypeptide composition(s) to
be employed therapeutically will depend, for example, upon the
therapeutic objectives such as the indication for which the DKR
polypeptide is being used, the route of administration, and the
condition of the patient. Accordingly, it will be necessary for the
therapist to titer the dosage and modify the route of
administration as required to obtain the optimal therapeutic
effect. A typical daily dosage may range from about 0.1 .mu.g/kg to
up to 100 mg/kg or more, depending on the factors mentioned above.
Typically, a clinician will administer the composition until a
dosage is reached that achieves the desired effect. The composition
may therefore be administered as a single dose, or as two or more
doses (which may or may not contain the same amount of DKR
polypeptide) over time, or as a continuous infusion via
implantation device or catheter.
[0152] As further studies are conducted, information will emerge
regarding appropriate dosage levels for treatment of various
conditions in various patients, and the ordinary skilled worker,
considering the therapeutic context, the type of disorder under
treatment, the age and general health of the recipient, will be
able to ascertain proper dosing.
[0153] The DKR polypeptide composition to be used for in vivo
administration must be sterile. This is readily accomplished by
filtration through sterile filtration membranes. Where the
composition is lyophilized, sterilization using these methods may
be conducted either prior to, or following, lyophilization and
reconstitution. The composition for parenteral administration
ordinarily will be stored in lyophilized form or in solution.
[0154] Therapeutic compositions generally are placed into a
container having a sterile access port, for example, an intravenous
solution bag or vial having a stopper pierceable by a hypodermic
injection needle.
[0155] The route of administration of the composition is in accord
with known methods, e.g. oral, injection or infusion by
intravenous, intraperitoneal, intracerebral (intraparenchymal),
intracerebroventricular, intramuscular, intraocular, intraarterial,
or intralesional routes, or by sustained release systems or
implantation device which may optionally involve the use of a
catheter. Where desired, the compositions may be administered
continuously by infusion, bolus injection or by implantation
device.
[0156] Alternatively or additionally, the composition may be
administered locally via implantation into the affected area of a
membrane, sponge, or other appropriate material on to which DKR
polypeptide has been absorbed.
[0157] Where an implantation device is used, the device may be
implanted into any suitable tissue or organ, and delivery of DKR
polypeptide may be directly through the device via bolus, or via
continuous administration, or via catheter using continuous
infusion.
[0158] DKR polypeptide may be administered in a sustained release
formulation or preparation. Suitable examples of sustained-release
preparations include semipermeable polymer matrices in the form of
shaped articles, e.g. films, or microcapsules. Sustained release
matrices include polyesters, hydrogels, polylactides (U.S. Pat. No.
3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma
ethyl-L-glutamate (Sidman et al, Biopolymers, 22: 547-556 [1983]),
poly(2-hydroxyethyl-methacrylate) (Langer et al., J. Biomed. Mater.
Res., 15: 167-277 [1981] and Langer, Chem. Tech., 12: 98-105
[1982]), ethylene vinyl acetate (Langer et al., supra) or
poly-D(-)-3-hydroxybutyric acid (EP 133,988). Sustained-release
compositions also may include liposomes, which can be prepared by
any of several methods known in the art (e.g., Eppstein et al.,
Proc. Natl. Acad. Sci. USA, 82: 3688-3692 [1985]; EP 36,676; EP
88,046; EP 143,949).
[0159] In some cases, it may be desirable to use DKR polypeptide
compositions in an ex vivo manner. Here, cells, tissues, or organs
that have been removed from the patient are exposed to DKR
polypeptide compositions after which the cells, tissues and/or
organs are subsequently implanted back into the patient.
[0160] In other cases, DKR polypeptide may be delivered through
implanting into patients certain cells that have been genetically
engineered, using methods such as those described herein, to
express and secrete the polypeptides, fragments, variants, or
derivatives. Such cells may be animal or human cells, and may be
derived from the patient's own tissue or from another source,
either human or non-human. Optionally, the cells may be
immortalized. However, in order to decrease the chance of an
immunological response, it is preferred that the cells be
encapsulated to avoid infiltration of surrounding tissues. The
encapsulation materials are typically biocompatible, semi-permeable
polymeric enclosures or membranes that allow release of the protein
product(s) but prevent destruction of the cells by the patient's
immune system or by other detrimental factors from the surrounding
tissues.
[0161] Methods used for membrane encapsulation of cells are
familiar to the skilled artisan, and preparation of encapsulated
cells and their implantation in patients may be accomplished
without undue experimentation. See, e.g., U.S. Pat. Nos. 4,892,538;
5,011,472; and 5,106,627. A system for encapsulating living cells
is described in PCT WO 91/10425 (Aebischer et al.). Techniques for
formulating a variety of other sustained or controlled delivery
means, such as liposome carriers, bio-erodible particles or beads,
are also known to those in the art, and are described, for example,
in U.S. Pat. No. 5,653,975 (Baetge et al., CytoTherapeutics, Inc.).
The cells, with or without encapsulation, may be implanted into
suitable body tissues or organs of the patient.
[0162] As discussed above, it may be desirable to treat isolated
cell populations such as stem cells, lymphocytes, red blood cells,
chondrocytes, neurons, and the like with one or more DKR
polypeptides, variants, derivatives and/or fragments. This can be
accomplished by exposing the isolated cells to the polypeptide,
variant, derivative, or fragment directly, where it is in a form
that is permeable to the cell membrane. Alternatively, gene therapy
can be employed as described below.
[0163] One manner in which gene therapy can be applied is to use
the DKR gene (either genomic DNA, cDNA, and/or synthetic DNA
encoding a DKR polypeptide, or a fragment, variant, or derivative
thereof) which may be operably linked to a constitutive or
inducible promoter to form a "gene therapy DNA construct". The
promoter may be homologous or heterologous to the endogenous DKR
gene, provided that it is active in the cell or tissue type into
which the construct will be inserted. Other components of the gene
therapy DNA construct may optionally include, as required, DNA
molecules designed for site-specific integration (e.g., endogenous
flanking sequences useful for homologous recombination),
tissue-specific promoter, enhancer(s) or silencer(s), DNA molecules
capable of providing a selective advantage over the parent cell,
DNA molecules useful as labels to identify transformed cells,
negative selection systems, cell specific binding agents (as, for
example, for cell targeting) cell-specific internalization factors,
and transcription factors to enhance expression by a vector as well
as factors to enable vector manufacture.
[0164] This gene therapy DNA construct can then be introduced into
the patient's cells (either ex vivo or in vivo). One means for
introducing the gene therapy DNA construct is via viral vectors.
Suitable viral vectors typically used in gene therapy for delivery
of gene therapy DNA constructs include, without limitation,
adenovirus, adeno-associated virus, herpes simplex virus,
lentivirus, papilloma virus, and retrovirus vectors. Some of these
vectors, such as retroviral vectors, will deliver the gene therapy
DNA construct to the chromosomal DNA of the patient's cells, and
the gene therapy DNA construct can integrate into the chromosomal
DNA; other vectors will function as episomes and the gene therapy
DNA construct will remain in the cytoplasm. The use of gene therapy
vectors is described, for example, in U.S. Pat. Nos. 5,672,344 (30
Sep. 1997; Kelly et al., University of Michigan), 5,399,346 (21
Mar. 1995; Anderson et al., U.S Dept. Health and Human Services),
5,631,236 (20 May 1997; Woo et al., Baylor College of Medicine),
and 5,635,399 (3 Jun. 1997; Kriegler et al., Chiron Corp.).
[0165] Alternative means to deliver gene therapy DNA constructs to
a patient's cells without the use of viral vectors include, without
limitation, liposome-mediated transfer, direct injection of naked
DNA, receptor-mediated transfer (ligand-DNA complex),
electroporation, calcium phosphate precipitation, and microparticle
bombardment (e.g., "gene gun"). See U.S. Pat. Nos. 4,970,154 (13
Nov. 1990; Chang, Baylor College of Medicine), WO 96/40958 (19 Dec.
1996; Smith et al., Baylor College of Medicine) 5,679,559 (21 Oct.
1997; Kim et al., University of Utah) 5,676,954 (14 Oct. 1997;
Brigham, Vanderbilt University), and 5,593,875 (14 Jan. 1997; Wurm
et al., Genentech).
[0166] Another means to increase endogenous DKR polypeptide
expression in a cell via gene therapy is to insert one or more
enhancer elements into the DKR polypeptide promoter, where the
enhancer element(s) can serve to increase transcriptional activity
of the DKR polypeptides gene. The enhancer element(s) used will be
selected based on the tissue in which one desires to activate the
gene(s); enhancer elements known to confer promoter activation in
that tissue will be selected. For example, if a DKR polypeptide is
to be "turned on" in T-cells, the lck promoter enhancer element may
be used. Here, the functional portion of the transcriptional
element to be added may be inserted into a fragment of DNA
containing the DKR polypeptide promoter (and optionally, vector, 5'
and/or 3' flanking sequence, etc.) using standard cloning
techniques. This construct, known as a "homologous recombination
construct" can then be introduced into the desired cells either ex
vivo or in vivo.
[0167] Gene therapy can be used to decrease DKR polypeptide
expression by modifying the nucleotide sequence of the endogenous
promoter(s). Such modification is typically accomplished via
homologous recombination methods. For example, a DNA molecule
containing all or a portion of the promoter of the DKR gene(s)
selected for inactivation can be engineered to remove and/or
replace pieces of the promoter that regulate transcription. Here,
the TATA box and/or the binding site of a transcriptional activator
of the promoter may be deleted using standard molecular biology
techniques; such deletion can inhibit promoter activity thereby
repressing transcription of the corresponding DKR gene. Deletion of
the TATA box or transcription activator binding site in the
promoter may be accomplished by generating a DNA construct
comprising all or the relevant portion of the DKR polypeptide
promoter(s) (from the same or a related species as the DKR gene(s)
to be regulated) in which one or more of the TATA box and/or
transcriptional activator binding site nucleotides are mutated via
substitution, deletion and/or insertion of one or more nucleotides
such that the TATA box and/or activator binding site has decreased
activity or is rendered completely inactive. This construct, which
also will typically contain at least about 500 bases of DNA that
correspond to the native (endogenous) 5' and 3' flanking regions of
the promoter segment that has been modified, may be introduced into
the appropriate cells (either ex vivo or in vivo) either directly
or via a viral vector as described above. Typically, integration of
the construct into the genomic DNA of the cells will be via
homologous recombination, where the 5' and 3' flanking DNA
sequences in the promoter construct can serve to help integrate the
modified promoter region via hybridization to the endogenous
chromosomal DNA.
[0168] Other gene therapy methods may also be employed where it is
desirable to inhibit one or more DKR polypeptides. For example,
antisense DNA or RNA molecules, which have a sequence that is
complementary to at least a portion of the selected DKR polypeptide
gene(s) can be introduced into the cell. Typically, each such
antisense molecule will be complementary to the start site (5' end)
of each selected DKR gene. When the antisense molecule then
hybridizes to the corresponding DKR polypeptides mRNA, translation
of this mRNA is prevented.
[0169] Alternatively, gene therapy may be employed to create a
dominant-negative inhibitor of one or more of the DKR polypeptides.
In this situation, the DNA encoding a mutant full length or
truncated polypeptide of each selected DKR polypeptide can be
prepared and introduced into the cells of a patient using either
viral or non-viral methods as described above. Each such mutant is
typically designed to compete with endogenous polypeptide in its
biological role.
[0170] Samples of the E. coli cell lines GM121 and GM94 have been
deposited with the American Type Culture Collection, 10801
University Blvd., Manassas, Va., USA on DATE as accession numbers X
and Y, respectively.
[0171] The following examples are intended for illustration
purposes only, and should not be construed as limiting the scope of
the invention in any way.
EXAMPLES
Example 1
Cloning of the Mouse DKR-3 Gene
[0172] About 120 adult mice with an average body weight of about 18
grams were each injected intraperitoneally with a kainate solution
(prepared as a stock solution of about 1 mg/ml kainate in sterile
PBS) at a dose of about 25 mg kainate per kilogram body weight.
About six hours after injection, the mice were sacrificed, and the
hippocampus was dissected from each mouse. Total RNA was extracted
from hippocampal tissue using the Trizol method (Gibco BRL, Grand
Island, N.Y.). The poly(A+) mRNA fraction was isolated from total
RNA using Message Maker (Gibco BRL, Grand Island, N.Y.) according
to the manufacturer's recommended procedure. Hippocampal tissue was
also obtained from control mice (which received an injection of PBS
only), and poly(a+) mRNA was obtained from this tissue as well
using the same procedures.
[0173] Two random primed cDNA libraries were prepared; one from the
kainate-treated and one from the control poly (A+) mRNA using the
Superscript.RTM. plasmid system (Gibco BRL, Gaithersburg, Md.). A
random cDNA primer containing an internal NotI restriction site was
used to initiate first strand synthesis and had the following
sequence: TABLE-US-00002 (SEQ ID NO:15)
GGAAGGAAAAAAGCGGCCGCAACANNNNNNNNN
where N is A, G, C, or T.
[0174] Both first strand cDNA synthesis and second strand cDNA
synthesis were performed according to the manufacturer's
recommended protocol. After second strand synthesis, the reaction
products were extracted with phenol:chloroform:isoamyl alcohol (in
a volume ratio of 25:24:1), followed by ethanol precipitation. The
double strand cDNA products were ligated using standard ligation
procedures to the following double stranded oligonucleotide adapter
(obtained from Gibco BRL, Grand Island, N.Y.): TABLE-US-00003 (SEQ
ID NO:16) TCGACCCACGCGTCCG (SEQ ID NO:17) GGGTGCGCAGGC
[0175] After ligation, the cDNA was digested to completion with
NotI, and size fractionated on a 1 percent agarose gel. The cDNA
products between about 250 and 800 base pairs were selected and
purified from the gel using the Qiagen.RTM. gel extraction kit
(Qiagen, Chatsworth, Calif.). The purified cDNA products were
directionally ligated into the vector pYY41L (American Type Culture
Collection, "ATCC"; 10801 University Blvd., Manassas, Va., USA;
accession number 209636) which had been previously digested with
NotI and SalI. The ligated cDNA was then introduced into
electrocompetent ElectroMax.RTM. DH108 E. coli cells (Gibco-BRL,
Grand Island, N.Y.) via standard electroporation techniques. The
library was then titered by a serial dilution of the transformation
cell mixture.
[0176] About one million primary clones were divided into 20 pools
(50,000 clones each pool) and each pool was plated on 245
mm.times.245 mm square plate containing MR2001 medium (MacConnel
Research, San Diego, Calif.) and about 60 ug/ml carbonocillin.
After incubation overnight at 37 C, the colonies were scraped off
the plate in about 20 ml SOC (SOC contains about 2 percent
Bactotryptone, 0.5 percent yeast extract, 10 mM sodium chloride,
2.5 mM potassium chloride, and 10 mM magnesium sulfate) and were
pelleted by centrifugation at about 6000 rpm for about 10 minutes.
The plasmids were then recovered from the cells using Qiagen.RTM.
maxi prep columns (Qiagen, Chatsworth, Calif.) according to the
protocol suggested by the manufacturer.
[0177] About two hundred and fifty thousand clones (50 ug total
plasmids/10 ug from each pool) were used to transform yeast strain
YPH499 (ATCC accession number 90834) and an amylase-based signal
trap assay was conducted as follows (see co-pending U.S. Ser. No.
09/026,959 filed 20 Feb. 1998 for a detailed description of this
technique). Around 1000 transformants were plated on a single
starch-containing selection plate (15 cm diameter with a medium
containing about 0.6 percent yeast nitrogen base, 2 percent
glucose, 0.1 percent CAA, 1.0.times. trp dropout solution, 0.7
percent potato starch azure, and 1.5 percent agarose). The plates
were incubated at about 30 C for 4-5 days until full development of
halos was observed. The colonies in the center of the halo were
picked and restreaked on a fresh plate to form single colonies. The
single colonies with halos were then picked and arrayed into 96
well microtiter plates containing about 100 ul of water per well,
thereby generating the "yeast colony solutions".
[0178] About ten microliters of each well of each yeast colony
solution was used as template to recover the cDNA fragment from
that colony through PCR. Therefore, ninety-six PCR reactions were
independently performed using PCR-Ready Beads.RTM. (96 well format,
Amersham-Pharmacia Biotech, Pistcataway, N.J.) and the following
oligonucleotides according to the manufacturer's protocol:
TABLE-US-00004 (SEQ ID NO:18) ACTAGCTCCAGTGATCTC (SEQ ID NO:19)
CGTCATTGTTCTCGTTCC
[0179] PCR was conducted using a Perkin-Elmer 9600 thermocycler
with the following cycle conditions: 94 C for 10 minutes followed
by 35 cycles of 94 C for 30 seconds, 55 C for 30 seconds and 72 C
for 1 minute, after which a final extension cycle of 72 C for 10
minutes was conducted. Most PCR reactions contained a single PCR
product. The amplified cDNA products were purified using the
Qiagen.RTM. PCR purification kit (Qiagen, Chatsworth, Calif.).
These products were sequenced on an Applied Biosystems 373A
automated DNA sequencer using the following oligonucleotide primer:
TABLE-US-00005 (SEQ ID NO:35) GCTATACCAAGCATACAATC
[0180] Taq dye-terminator sequencing reactions (Applied Biosystems,
Foster City, Calif.) were conducted following the manufacturer's
recommended procedures.
[0181] Each PCR fragment was translated in all six possible ways to
identify those fragments which (1) had a potential signal peptide
in the same direction as reporter gene; (2) had a stop codon(s)
upstream of the putative methionine translation start site; and (3)
appeared to lack a transmembrane domain.
[0182] One clone that met these criteria, termed "ymrs2-00009-c4",
was selected for further analysis. This clone contained 5'
sequence, including a putative signal sequence, but was lacking 3'
sequence.
[0183] To obtain the 3' sequence of this clone, a 3' RACE reaction
was performed using as a template pool number 4 from the YmHK2 cDNA
library. This YmHK2 library was prepared as follows: First strand
cDNA synthesis was performed using about 2 micrograms of the RNA
obtained from the hippocampus of the kainate treated mice and about
1 ug of Not I primer-adapter having the following sequence:
TABLE-US-00006 (SEQ ID NO:42)
GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT
[0184] Both the first strand and second strand cDNA synthesis
reactions were performed using the Superscript.RTM. plasmid system
(Gibco BRL, Grand Island, N.Y.). After second strand synthesis, the
double stranded cDNA products were ligated into the double stranded
adapters of SEQ ID NOs:16 and 17.
[0185] After ligation, the cDNA was digested to completion with Not
I, and size fractionated on a 0.8 percent agarose gel. The cDNA
products larger than about 800 base pairs were selected and
purified from the gel using the Qiagen.RTM. gel extraction kit
(Qiagen, Chatsworth, Calif.). The purified cDNA products were
directly ligated into Sal I and Not I digested pSport.RTM. vector
(Gibco BRL, Grand Island, N.Y.).
[0186] The ligated cDNA products were then introduced into
electrocompetent E. coli cells called ElectroMax.RTM. DH10B (Gibco
BRL, Grand Island, N.Y.). The library was then titered.
[0187] About twelve million primary clones were obtained, and
expanded into about 250 ml of LB containing about 100 ug/ml
ampicillin. After overnight incubation at 37 C, the plasmids were
recovered using the Qiagen.RTM. maxi-prep kit (Qiagen, Chatsworth,
Calif.).
[0188] About 20 ng of the plasmid library were used to transform
the ElectroMax.RTM. DH10B electrocompetent E. coli cells using
standard electroporation techniques. About two million
transformants were divided into 40 pools (containing approximately
50,000 plasmids/pool). Each pool was then expanded into about 3 ml
of LB medium containing about 100 ug/ml ampicillin. After overnight
incubation at 37 C, the plasmids were recovered using the
Qiagen.RTM. mini-prep kit. The DNA from each pool were then stored
at about minus 20 C for future use.
[0189] The 3' RACE reaction was performed using about 1.5 ng of
pool #4 of the YmHK2 library as a template, and using the
Advantage.RTM. cDNA PCR kit (Clontech, Palo Alto, Calif.) with the
following oligonucleotides: TABLE-US-00007 (SEQ ID NO:20)
CCAGCTGCTCTGTGGCAGCCCAG (SEQ ID NO:21)
CCCAGTCACGACGTTGTAAAACGACGGCC
[0190] The reaction was conducted in a standard thermocycler
(Perkin-Elmer 9600) for thirty five cycles under the following
conditions: 94 C for 1 minute; 94 C for 5 seconds, and 72 C for 5
minutes. This was followed by a final extension at 72 C for 10
minutes. About one microliter of the reaction products was diluted
to 50 ul using TE buffer (10 mM TRIS pH 8.0 and 1 mM EDTA).
[0191] To enrich the RACE reaction for the gene of interest, a
nested PCR reaction was conducted using about five microliters of
the TE solution (containing the RACE reaction products as described
in the preceding paragraph) together with the following
oligonucleotides: TABLE-US-00008 (SEQ ID NO:22)
AACATGCAGCGGCTCGGGGG (SEQ ID NO:23)
GGTGACACTATAGAAGAGCTATGACGTCGC
[0192] The nested PCR reaction was incubated in a thermocycler
(Perkin-Elmer 9600) using the following protocol: 94 C for one
minute; five cycles of 94 C for 5 seconds followed by 72 C for 5
minutes; five cycles of 94 C for five seconds, followed by 70 C for
5 minutes; and 20-25 cycles of 94 C for 5 seconds followed by 68 C
for 5 minutes. After this PCR, the 3' RACE products and the nested
PCR products were analyzed using standard agarose gel
electrophoresis.
[0193] A PCR product of about 3.3 kb was identified from the nested
PCR reaction. This fragment was purified using Qiagen.RTM. Gel
Extraction Kit (Qiagen, Chatsworth, Calif.) and ligated into the
vector pCRII-TOPO (Invitrogen, Carlsbad, Calif.) according to the
procedures recommended by the manufacturer. After ligation, the
products were transformed into One Shot.RTM. E. coli cells
(Invitrogen, Carlsbad, Calif.) and plated on a LB (Luria broth)
plate containing about 100 ug/ml ampicillin and about 1.6 mg X-gal.
After overnight incubation at 37 C, 12 white colonies and one blue
colony were selected, and screened using PCR-Ready Beads.RTM.
(Amersham-Pharmacia Biotech, Pistcataway, N.J.) according to the
manufacturer's recommended protocol using oligonucleotide SEQ ID
NO:20 together with the following primer: TABLE-US-00009 (SEQ ID
NO:24) GTGCTGAGTGTCTTCCATCAGC
[0194] Two colonies were picked that had yielded PCR products of
the expected size of about 192 base pairs. These colonies were
inoculated into about 3 ml of LB medium containing about 100 ug/ml
ampicillin, and were incubated at 37 C. The cultures were placed on
a shaker for about 16 hours, and the plasmids were recovered using
Qiagen.RTM. mini prep columns (Qiagen, Chatsworth, Calif.)
according to the manufacturer's protocol. Plasmid DNA was then
sequenced as described above.
[0195] A contiguous stretch of DNA of about 3366 nucleotides was
assembled by combining the sequence of clone ymrs2-00009-c4
(containing 5' sequence) together with the nested PCR fragment of
3.3 kb containing 3' sequence. Within this contiguous sequence is
an open reading frame of 349 amino acids. The nucleotide sequence
of this novel mouse gene, referred to as DKR-3, is set forth in
FIG. 1. The putative amino acid sequence, as translated from the
DNA sequence, is set forth in FIG. 8
[0196] A BLAST search of the Genbank database using the amino acid
sequence of DKR-3 revealed that this open reading frame has
homology to a gene known as human rig-like 7-1 mRNA (Genbank
accession number AF034208; see also Ligon et al., J NeuroVirology,
4:217-226 [1998]). DKR-3 also has homology to the gene for chicken
lens fiber protein clfest4 (Genbank accession number D26311); the
overall identity to this protein is about 50 percent with the
highest homology in the middle of the protein.
Example 2
Cloning of the Human DKR-3 Gene
[0197] Mouse DKR-3 DNA can be used to search a public EST database
for human homologs, resulting in the identification of the
following Genbank accession numbers:
[0198] AA628979
[0199] AA349552
[0200] AA633061
[0201] AA351624
[0202] W61032
[0203] T30923
[0204] AA683017
[0205] AA324686
[0206] T08793
[0207] T31076
[0208] R14945
[0209] AA226979
[0210] W45085
[0211] AA424460
[0212] R58671
[0213] R57834
[0214] AF034208
[0215] These EST sequences were analyzed and assembled to create a
putative sequence for human DKR-3. Based on this putative sequence,
two oligonulceotides were designed for use in PCR in an attempt to
clone the human DKR-3 gene. The sequence of these oligonucleotides
is: TABLE-US-00010 (SEQ ID NO:25) GAGATGCAGCGGCTTGGGGCCACCC (SEQ ID
NO:26) GCCTGGTCAGCCCACGCCTAAAG
[0216] PCR was performed using the Advantage.RTM. cDNA PCR kit
(Clontech, Palo Alto, Calif.) together with human fetal brain
Quick-Clone.RTM. cDNA (Clontech). PCR was conducted in a
thermocycler (Perkin-Elmer 9600) under the following cycle
conditions: 94 C for 2 minute; 94 C for 30 seconds, and 72 C for 2
minutes. Thirty-five cycles were conducted after which samples were
treated at 72 C for 10 minutes. A single fragment of about 1150
base pairs was visible when the PCR products were visualized on a 1
percent agarose gel. This fragment was purified using the
Qiagen.RTM. Gel Extraction Kit (Qiagen, Chatsworth, Calif.) and
ligated into the vector pCRII-TOPO (Invitrogen, Carlsbad, Calif.).
After ligation, the products were transformed into One Shoot E.
coli.RTM. (Invitrogen, Carlsbad, Calif.) and plated on a LB plate
containing about 100 ug/ml ampicillin and about 1.6 mg X-gal. After
overnight incubation at 37 C, 2 white colonies were picked and
inoculated into about 3 ml of LB medium containing about 100 ug/ml
ampicillin. The cultures were kept on a shaker at about 37 C for
about 16 hours. The plasmids were isolated using Qiagen.RTM.
mini-prep columns (Qiagen, Chatsworth, Calif.) according to the
manufacturer's recommended protocol, and the inserts were then
sequenced using methods described above.
[0217] The cloned fragment is 1141 bp in length and contains an
open reading frame of 350 amino acids. The nucleotide sequence is
set forth in FIG. 2, and the putative amino acid sequence, as
translated from the DNA sequence, is set forth in FIG. 9. This
amino acid sequence is about 80 percent identical to the mouse
DKR-3 gene. In addition, human DKR-3 is identical to the human
rig-like protein fragment described by Lignon et al., supra between
amino acids 157 and 308 of DKR-3. Significantly, the rig-like
protein has an amino terminal start corresponding to amino acid 156
of DKR-3. Rig-like does not appear to be a secreted protein, and
the carboxy terminal region of rig-like protein has no homology to
human DKR-3. Just as for mouse DKR-3, human DKR-3 is about 54
percent identical to the chicken lens fiber protein clfest. Human
DKR-3 appears to be secreted, with a signal peptide cleavage site
after either amino acid 20 or 21. Other potential cleavage sites
(due to signal peptides or to other endogenous processing sites are
after amino acid 16, 22, 32, and/or 41). There appear to be
N-linked glycosylation sites at amino acids 96, 106, 121, and 204,
which would render them preferable sites for generating
substitution mutants. Human DKR-3 and mouse DKR-3 amino acid
sequences differ at amino acid positions 6, 7, 11, 24, 27, 29, 30,
32, 33, 39, 81, 89, 93, 99, 101, 103, 109, 113, 115, 123, 126, 142,
156, 157, 162, 165, 173, 175, 191, 197, 198, 201, 203, 245, 247,
259, 283, 287, 292, 294, 295, 296, 298, 299, 304, 310, 311, 312,
314, 315, 329, 330, 334, 335, 336, 339, 340, 341, 342, 343, 345,
and 347 (all with respect to the human DKR-3 sequence), which
renders these positions preferable for generating human DKR-3
substitution or deletion variants. Based on computer analysis of
the amino acid sequence of DKR-3, significant regions of the
molecule include the span from about amino acids 21-145 (a
potential alpha-helical region and region of potential N-linked
glycosylation) such as for example amino acids 21-145, 40-145,
40-150, 45-145, and 45-150, the span from about amino acids
145-350, such as, for example 145-290, 145-300, and 145-350, and
the span from about amino acids 300-350 (a second potential
alpha-helical region), such as for example amino acids 310-350.
Such regions would be suitable fragments of full length DKR-3.
[0218] Northern blot analysis was conducted to assess the tissue
specific expression of human DKR-3. A probe for use in Northern
blot analysis was prepared by PCR of human fetal brain
Quick-Clone.RTM. cDNA (Clontech, Palo Alto, Calif.) using the
following oligonucleotides: TABLE-US-00011 (SEQ ID NO:27)
CCTGCTGCTGGCGGCGGCGGTCCCCACGGC (SEQ ID NO:28)
GCCTGGTCAGCCCACGCCTAAAG
[0219] The PCR reaction was conducted in a thermocycler
(Perkin-Elmer 9600). PCR conditions were: 94 C for 2 minute; 94 C
for 30 seconds, and 72 C for 2 and 1/2 minutes. Thirty-five cycles
were conducted followed by a final extension treatment at 72 C for
10 minutes. PCR products were run on a one percent agarose gel, and
a band of about 1100 bp was gel purified using the Qiagen gel
extraction kit (Qiagen.RTM., Chatsworth, Calif.), cloned into the
vector CRII-TOPO (Invitrogen, Carlsbad, Calif.) and sequenced to
confirm that the band contained the human DKR-3 open reading frame
minus the amino terminal 10 amino acids.
[0220] About twenty-five nanograms of this probe was denatured by
heating to about 100 C for about 5 minutes, followed by placing on
ice, and then radioactively labeled with alpha-32P-dCTP using the
Rediprime.RTM. labeling kit (Amersham, Arlington Heights, Ill.) and
following the manufacturer's instructions. A human multiple tissue
Northern blot was purchased (Clontech, Palo Alto, Calif.) and was
first prehybridized in about 5 ml of Clontech Express.RTM.
hybridization buffer at about 68 C for 30-60 minutes. After
prehybridization, the labeled probe was added to the solution and
allowed to hybridize for about 60 minutes. After hybridization, the
blot was first washed with 2.times.SSC plus 0.05 percent SDS at
room temperature for about 30 minutes, then washed with
0.1.times.SSC plus 0.1 percent SDS at about 65 C for about 30
minutes. The blot was dried briefly and then exposed to a
Phosphorimager screen (Molecular Dynamics, Sunnyvale, Calif.).
After overnight exposure, the image of the blot was analyzed on a
Storm 820 machine (Molecular Dynamics, Sunnyvale, Calif.) with
Imagequat software (Molecular Dynamics, Sunnyvale, Calif.).
[0221] The size of the human DKR-3 RNA transcript is about 2.6 kb.
The results of the Northern blot analysis indicate that human DKR-3
is highly expressed in adult heart and brain, although weak
expression in placenta, adult lung, skeletal muscle, kidney, and
pancreas is also apparent. A second smaller transcript is apparent
in adult pancreas, and could result from degradation of the full
length transcript.
[0222] To evaluate the role of this gene in cancer, a variety of
human cancer cell lines were analyzed for the presence or absence
of DKR-3 RNA transcript.
[0223] The glioblastoma cell lines Hs 683; A 172; SNB-19; U-87MG;
and U-373MG are all from ATCC, and cultured in the media
recommended by ATCC.
[0224] Normal human mammary epithelial cells (NMECs) derived from
reduction mammoplasties were purchased from Clonetics Corp. (San
Diego, Calif.) and the Corriel Institute (Camden, N.J.). The
immortalized breast epithelial cell line MCF-10 and the ER+ cell
line MCF-7 can be obtained from the American Type Culture
Collection. The ER+ BT20T cells were provided by Dr. K. Keyomarsi
(N.Y. State Dept. of Health). Immortalized 184A1 and other breast
cancer cells including T47-D, ZR75-1, and BT474, MDA-MB-157,
MDA-MB-231, MDA-MB-361, MDA-MB-453, MD-MBA-468, HS578T and SKBr3
were all obtained from the American Type Culture Collection (10801
University Blvd., Manassas, Va.).
[0225] NMECs, 184A1 and MCF10 cells were cultured in a modified
DME/F12 medium (Gibco/BRL, Grand Island, N.Y.) supplemented with 10
mM Hepes, 2 mM glutamine, 0.1 mM nonessential amino acids, 0.5 mM
ethanolamine, 5 mg/ml transferrin, 1 mg/ml Bovine serum albumin,
5.0 ng/ml sodium selenite, 20 ng/ml triiodothyronine, 10 ng/ml EGF,
5 .mu.g/ml insulin and 0.5 .mu.g/ml hydrocortisone (DMEM/F12C)
(Ethier et al, Cancer Letters, 74:189-195 [1993]). The ER+ and ER+
breast cancer cells were cultured in Alpha or Richter improved
minimal essential medium (MEM) (Gibco/BRL) supplemented with 10 mM
Hepes, 2 mM glutamine, 0.1 mM nonessential amino acids, 10 percent
fetal bovine serum and 1 .mu.g/ml insulin.
[0226] Normal human bronchial and cervical epithelial cells were
purchased from Clonetics Corp. (San Diego, Calif.). Normal cervical
epithelial cells were culture in KBM2 (Clonetics Corp. San Diego,
Calif.) supplemented with 13 mg/ml bovine pituitary extract, 0.5
.mu.g/ml hydrocortisone, 2 ng/ml EGF, 0.5 mg/ml epinephrine, 0.1
ng/ml retinoic acid, 5 .mu.g/ml transferrin, 6.5 ng/ml
triiodothyronine and 5 .mu.g/ml insulin. Normal bronchial
epithelial cells were cultured in BEBM (Clonetics Crop., San Diego,
Calif.) supplemented with 0.5 mg/ml hydrocortisone, 0.5 ng/ml EGF,
0.5 .mu.g/ml epinephrine, 10 .mu.g/ml transferrin, 5 .mu.g/ml
insulin, 0.1 ng/ml retinoic acid and 5.5 ng/ml triiodthyronine.
[0227] The lung cancer cell lines H1299, H23, H358, H441, H460,
H520, H522, H727, H146, H209, H446, H510A, H526, and H889 and the
cervical cancer cells Caski, C-4-I, MS751, SiHa and C-33-A were all
obtained from the American Type Culture Collection. The lung cancer
cells were cultured in RPMI (MEM) (Gibco/BRL) supplemented with 10
mM Hepes, 2 mM glutamine, 0.1 mM nonessential amino acids and 10
percent fetal bovine serum (FBS). The cervical cancer cells were
cultured in Earles MEM supplemented with 0.1 mM nonessential amino
acids, 1 mM sodium pyruvate and 10 percent FBS. All cells were
routinely screened for mycoplasma contamination and maintained at
about 37.degree. C. in an atmosphere of about 6.5 percent
CO.sub.2.
[0228] Total RNA was prepared by lysing cell monolayers in
guanidinium isothiocyanate and centrifuging over a 5.7 M CsCl
cushion as described previously (Gudas, Proc. Natl. Acad. Sci. USA,
85:4705-4709 [1988]). RNA (about 20 ug) was electrophoresed on
denaturing formaldehyde gels, transferred to MagnaNT membranes
(Micron Separations Inc., Westboro, Ma) and cross-linked with UV
irradiation.
[0229] The blots were prehybridized, probed, and washed under the
same conditions as those set forth above for the tissue blot. The
blots were dried briefly and then exposed to a Phosphorimager
screen (Molecular Dynamics, Sunnyvale, Calif.). After overnight
exposure, the image of the blot was analyzed on a Storm 820 machine
with Imagequat software (both from Molecular Dynamics).
[0230] The results are shown in FIGS. 15A-15D. As can be seen in
FIG. 15A, expression of DKR-3 is decreased in most of the breast
cancer cell lines as compared to the normal cell lines. FIG. 15B
indicates that DKR-3 expression is decreased in the non-small cell
lung cancer cell lines, and in most of the small cell lung cancer
cell lines as well. FIG. 15C indicates that expression of DKR-3 is
decreased in three glioblastoma cell lines (SNB-19, U-87MG, and
U-373MG) that are capable of forming tumors in nude mice (the other
two cell lines, Hs 683 and A 172 do not form tumors in nude mice).
FIG. 15D indicates that expression of DKR-3 is reduced in cervical
cancer cell lines as compared to normal and immortalized cells.
Example 3
Cloning of the Human DKR-1 Gene
[0231] Human and mouse DKR-3 cDNA and amino acid sequences were
used to search Genbank using the BLAST program in an attempt to
identify DKR-3 related genes. A number of EST (expressed sequence
tags) were found and were analyzed to determine whether the
sequences overlapped. Using the following human EST accessions, a
novel gene, termed DKR-1, was predicted.
[0232] AA336797
[0233] R27865
[0234] W39690
[0235] AA043027
[0236] HUM517H04B
[0237] AA143670
[0238] W51876
[0239] N94525
[0240] AA641247
[0241] AA137219
[0242] AA115249
[0243] AA031969
[0244] AA136192
[0245] AA032060
[0246] AA035583
[0247] AA207078
[0248] AA371363
[0249] AA037322
[0250] AA088618
[0251] W46873
[0252] AA115337
[0253] AA693679
[0254] W30750
[0255] H83554
[0256] PCR was conducted in an attempt to clone the full length
gene, and the following two oligonucleotides were used for PCR:
TABLE-US-00012 CCCGGACCCTGACTCTGCAGCCG (SEQ ID NO:29)
GAGGAAAAATAGGCAGTGCAGCACC (SEQ ID NO:30)
[0257] PCR was performed using the Advantage.RTM. cDNA PCR kit
(Clontech, Palo Alto, Calif.) containing the oligonucleotides
listed above and human placenta Quick-Clone.RTM. cDNA (Clontech,
Palo Alto, Calif.). The reaction was conducted according to the
manufacturer's recommendations. Thirty-five cycles of PCR were
conducted in a thermocycler (Perkin-Elmer 9600) under the following
conditions: 94 C for 2 minutes; 94 C for 30 seconds, and 72 C for
11/2 minutes, followed by a final extension at 72 C for 10
minutes.
[0258] After cycling, the PCR products were analyzed on a one
percent agarose gel. A single band of about 1200 base pairs in
length was detected after agarose gel electrophoresis. This
fragment was purified using the Qiagen.RTM. gel extraction kit
(Qiagen, Chatsworth, Calif.) and ligated into the vector pCRII-TOPO
(Invitrogen, Carlsbad, Calif.) using standard ligation procedures.
After ligation, the products were transformed into One Shoot.RTM.
competent E. coli cells according to the procedures recommended by
manufacturer (Invitrogen, Carlsbad, Calif.). The transformed E.
coli cells were plated on a LB plate containing about 100 ug/ml
ampicillin and about 1.6 mg X-gal.
[0259] After overnight incubation at about 37 C, two white colonies
were picked and inoculated into about 3 ml of TB containing 100
ug/ml ampicillin. The culture was incubated at about 37 C for about
16 hours, plasmids were then recovered using Qiagen.RTM. mini-prep
columns (Qiagen, Chatsworth, Calif.) and sequenced. Both colonies
contained the same insert.
[0260] The insert is 1193 base pairs, and is referred to as human
DKR-1. The sequence of this gene is set forth in FIG. 3. This gene
contains an open reading frame of 266 amino acids. The amino acid
sequence is set forth in FIG. 10. A stop codon is present upstream
of the first methionine, indicating the first methionine is likely
to be the amino terminus of the protein. Human DKR-1 has a
predicted signal peptide with a predicted signal peptide cleavage
site between amino acids 19 and 20.
[0261] The gene has about 80 percent homology to the mouse gene
dkk-1 (Glinka et al., supra), however the mouse dkk-1 gene is 272
amino acids in length while human DKR-1 is 266 amino acids in
length. Human DKR-1 differs from mouse dkk-1 at amino acid
positions 3, 4, 5, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19, 22,
23, 24, 29, 53, 55, 62, 66, 69, 77, 93, 98, 101, 105, 106, 123,
139, 140, 143, 144, 153, 155, 157, 158, 163, 164, 165, 169, 175,
178, 197, 224, and 244. In addition, the alignment of human DKR-1
and mouse dkk-1 shows one gap in human DKR-1 between amino acids 37
and 38, and two gaps between 103 and 104, 146 and 147, and 165 and
166. Glinka et al. state on page 362 of their article that
"Coordinates of Xenopus dkk family members have been deposited in
Genbank with the following accession numbers . . . hdkk-1
AA207078." However, forward three frame translations of AA207078 by
the inventors herein showed no homology to the published mouse and
Xenopus dkk-1 sequences, or to the human DKR-1 sequence, except in
the 3' end of this accession, which exhibits a 95 percent identity
to human DKR-1 from amino acids 81-179, indicating that AA207078
does not encode full length human dkk-1. Significantly, AA207078 is
missing amino acids 1-90 and 180-350 of human DKR-1 which includes
the signal peptide and the second cysteine right domain
respectively.
Example 4
Cloning of the Mouse DKR-2 Gene
[0262] Genbank accession number AA265561 (a mouse sequence) has
homology to both human DKR-1 and human DKR-3 at the amino acid
level based primarily on its cysteine pattern.
[0263] To extend this EST sequence in both the 5' and 3'
directions, the following oligonucleotides were designed:
TABLE-US-00013 GCCACAGTCCCCACCAAGGATCATC (SEQ ID NO:31)
GATGATCCTTGGTGGGGACTGTGGC (SEQ ID NO:32) CTGCAAACCAGTGCTCCATCAGGG
(SEQ ID NO:33) CCCTGATGGAGCACTGGTTTGCAG (SEQ ID NO:34)
[0264] Separately, 5' RACE and 3' RACE reactions were performed
according to the manufacturer's protocol using mouse heart
Marathon-Ready.RTM. cDNA and the Advantage.RTM. cDNA PCR kit (both
from Clontech, Palo Alto, Calif.) and using oligonucleotide SEQ ID
NOs: 31 and 34. The RACE reactions were incubated in a thermocycler
(Perkin-Elmer 9600) using the following cycling conditions: 94 C
for one minute; five cycles of 94 C for 5 seconds followed by 72 C
for 5 minutes; five cycles of 94 C for five seconds, followed by 70
C for 5 minutes; and 20-25 cycles of 94 C for 5 seconds followed by
68 C for 5 minutes.
[0265] To enrich each RACE reaction for the desired product, about
one microliter of each of the RACE PCR products was added together,
and the mixture was diluted to about 50 ul using TE buffer. About
five microliters of this solution were used to conduct nested PCR
reactions. The Advantage.RTM. cDNA PCR kit (Clontech, Palo Alto,
Calif.) and oligonucleotide SEQ ID NOs: 32 and 33 were used for the
5' and 3' nesting reactions, respectively. The nested PCR reactions
were incubated in a thermocycler (Perkin-Elmer 9600) using the
following program for thirty five cycles: 94 C for 1 minute; 94 C
for 5 seconds; and 72 C for 2 minutes. A final extension was then
conducted at 72 C for 10 minutes. The PCR products were analyzed
using a one percent agarose gel.
[0266] Several fragments ranging from about 500 bp to about 1500
base pairs were obtained from the 5' nested PCR reaction, and two
fragments of about 1900 bp and 450 bp were obtained from the 3'
nested PCR reaction. These PCR products were purified using the
Qiagen.RTM. PCR purification kit (Qiagen, Chatsworth, Calif.) and
were then ligated into the vector pCRII-TOPO (Invitrogen). The
ligation products were transformed into OneShot.RTM. E. coli cells
(Invitrogen, Carlsbad, Calif.), and the cells were then plated on
to two X-gal containing plates (one for each reaction) as described
above.
[0267] Eight white colonies from each plate were picked and PCR
selected via RACE reactions using the Clontech primer AP2 and the
oligonucleotide SEQ ID NO:32 (for the 5' RACE) or the
oligonucleotide SEQ ID NO:33 (for the 3' RACE). Three colonies from
each plate that contained the correct size fragments were cultured,
and the plasmids were isolated and sequenced using procedures
described above.
[0268] Three clones, 9813302, 9813304 and 9813305 contained
sequence which extended the EST sequence in the 5' direction. One
clone, 9813308, contained sequence which extended the EST sequence
in the 3' direction. A continuous sequence of 2678 base pairs was
thus assembled using the sequence of clones 9813308, 9813304, and
the EST AA265561. This full length DNA has been termed DKR-2, and
the sequence is set forth in FIG. 4. The corresponding amino acid
sequence is set forth in FIG. 11.
[0269] Within the amino acid sequence is an open reading frame of
259 amino acids. This protein has approximately 38 percent identity
with mouse dkk-1 at the amino acid level. Mouse DKR-2 has a
predicted signal peptide with a signal peptide cleavage site
between amino acids 33 and 34.
Example 5
Cloning of the Human DKR-2 Gene
[0270] The Genbank EST database was searched using the BLAST
program with both DNA and amino acid sequences from human DKR-1 and
human DKR-3, and one human EST, W55979, was identified that showed
homology to both human DKR-1 and human DKR-3 at the amino acid
level based on its cysteine pattern. W55979 is about 88 percent
identical to mouse DKR-2 at the DNA level, and about 93 percent
identical to mouse DKR-2 at the amino acid level.
[0271] A BLAST search of Genbank W55979 indicated that W55979 has
homology to BAC clone number B284B3 (Genbank accession number
AC003099). BAC clone B284B3 is 95129 base pairs in length. Three
portions of W55979 are homologous to three different regions of BAC
clone B284B3, indicating that human DKR-2 has at least three exons.
A 3' sequence of 556 bp in length was assembled based on the
sequences of both BAC clone B284B3 and W55979, and it was
determined that this sequence is the 3' portion of the human
ortholog of mouse DKR-2. Within this 3' sequence of human DKR-2 is
an open reading frame of 174 amino acids, and a stop codon is
present after amino acid 174. This 3' sequence of human DKR-2 is
about 97 percent identical to mouse DKR-2.
[0272] To obtain the 5' end sequence of human DKR-2, a 5' RACE
reaction was performed using Clontech human heart
Marathon-Ready.RTM. cDNA and the Advantage.RTM. cDNA PCR kit,
together with oligonucleotide SEQ ID NO:34. The RACE reaction was
performed according to the manufacturer's protocol. The 5' RACE
reaction products were then subjected to nesting PCR to enrich for
the 5' sequence using the Advantage.RTM. cDNA PCR kit and
oligonucleotide SEQ ID NO:32. The PCR conditions for both the 5'
RACE reaction and the nested PCR reaction were the same as those
described in Example 4.
[0273] The nested PCR products were purified using the Qiagen.RTM.
(Qiagen, Chatsworth, Calif.) PCR purification kit, and were ligated
into the vector Zero-Blunt.RTM. (Invitrogen, San Diego, Calif.)
according to the procedures recommended by the manufacturer. The
ligation products were transformed into OneShot.RTM. E. coli cells
which were then plated on X-gal containing plates as described
above.
[0274] After overnight culturing, three white colonies were picked
and were inoculated into about 3 ml of TB containing about 100
ug/ml ampicillin. The cultures were allowed to grow for about 16
hours, after which the plasmids were isolated using Qiagen.RTM.
mini-prep columns (Qiagen, Chatsworth, Calif.) according to the
manufacturer's protocol. The sequence of each insert was then
obtained.
[0275] One of the 5'-RACE clones, termed 9812826, extended the
human DKR-2 sequence 5'-terminally. A contiguous sequence of 1531
bp in length was assembled using this clone 9812826 together with
the human DKR-2 3'sequence. Within this contiguous sequence is an
open reading frame of 259 amino acids. The human DKR-2 gene has a
predicted signal peptide of about 33 amino acids, with a predicted
cut site between amino acids 33 and 34, and is about 95 percent
identical to mouse DKR-2 at the amino acid level. The amino acid
positions that differ between human and mouse DKR-2 include (with
respect to the numbering of the human sequence) 7, 12, 28, 48, 50,
58, 71, 102, 119, 170, 173, and 191, rendering these positions
preferable for generating amino acid substitution or deletion
variants.
[0276] An alternative spliced isoform of human DKR-2 was discovered
when PCR was conducted using human heart Marathon-Ready.RTM. cDNA
(Clontech, Palo Alto, Calif.) and the Advantage.RTM. cDNA PCR kit
(Clontech, Palo Alto, Calif.) together with the following
oligonucleotides: TABLE-US-00014 GGGTTGAGGGAACACAATCTGCAAG (SEQ ID
NO:36) GTCTGCAATTGATGATGTTCCTCAATGG (SEQ ID NO:37)
[0277] PCR was conducted using parameters set forth in the
manufacturer's protocol. PCR products were analyzed by agarose gel
electrophoresis, and two PCR products were obtained. The bands
corresponding to these products were gel purified as described
above, amplified and purified as described above, and then
sequenced. One product corresponded to full length DKR-2, however,
the other band corresponded to an isoform of DKR-2. This isoform
has an open reading frame of 207 amino acids, and appears to be
missing an exon. This isoform is referred to as human DKR-2a. The
DNA sequence of human DKR-2a is set forth in FIG. 6, and the amino
acid sequence as translated from the DNA is set forth in FIG.
13.
Example 6
Cloning of the Human DKR-4 Gene
[0278] A human EST that showed significant homology to human DKR-1
and human DKR-3 on protein level was identified in Genbank. This
sequence, Genbank accession number AA565546, has a cysteine pattern
that is similar to that of human DKR-1 and human DKR-3.
[0279] A BLAST search of Genbank showed no human ESTs overlapping
with AA565546. Therefore, to extend the EST sequence in the 5'
direction, a 5' RACE reaction was performed using human heart
Marathon-Ready.RTM. cDNA (Clontech, Palo Alto, Calif.) together
with the Advantage.RTM. cDNA PCR kit (Clontech, Palo Alto, Calif.)
and the following oligonucleotide: TABLE-US-00015
CCAGGGCCACAGTCGCAACGCTGG (SEQ ID NO:38)
[0280] The RACE reaction was performed according to the protocol
provided with the Advantage.RTM. kit. After 5' RACE, the products
were nested to enrich for the desired 5' sequence using the
Advantage.RTM. cDNA PCR kit according to the manufacturer's
recommendations, together with the following oligonucleotide:
TABLE-US-00016 CTCCCTCTTGTCCCTTCCTGCCTTG (SEQ ID NO:39)
[0281] After the nested PCR reaction, the products were purified
using the Qiagen.RTM. PCR purification kit (Qiagen, Chatsworth,
Calif.), ligated into the vector pCRII-TOPO (Invitrogen, Carlsbad,
Calif.), and transformed into OneShot.RTM. E. coli cells as
described above. After transformation, the cells were plated on a
LB plate containing about 100 ug/ml ampicillin and about 1.6 mg
X-gal.
[0282] After overnight incubation at 37 C, four white colonies were
picked from the plate and were inoculated in about 3 ml TB
containing about 100 ug/ml ampicillin. The cultures were incubated
at about 37 C for about 16 hours. The plasmids were then recovered
using Qiagen.RTM. mini-prep columns (Qiagen, Chatsworth, Calif.)
and sequenced.
[0283] Two clones, termed 9813563 and 9853564, were found to
contain the 5' sequence of human DKR-4.
[0284] To obtain the 3' sequence of human DKR-4, a 3' RACE reaction
was performed using human uterus Marathon-Ready.RTM. cDNA
(Clontech, Palo Alto, Calif.) together with the Advantage.RTM. cDNA
PCR kit (Clontech) and the following oligonucleotide:
TABLE-US-00017 CAAGGCAGGAAGGGACAAGAGGGAG (SEQ ID NO:40)
[0285] The 3' RACE reaction was performed according to the
manufacturer's recommendations. After the RACE reaction, the
products were nested using the Advantage.RTM. cDNA PCR kit and the
following oligonucleotide: TABLE-US-00018 CCAGCGTTGCGACTGTGGCCCTGG
(SEQ ID NO:41)
[0286] The parameters for PCR were 94 C for 1 minute followed by
thirty five cycles of 94 C for 5 seconds and then 72 C for 2
minutes, after which a final extension of 70 C for 10 minutes was
conducted. After the nesting reaction, the products were analyzed
on a 1 percent agarose gel. A single band of about 1200 bp in
length was observed. This band was purified from the gel using
methods described above, and was then cloned into the vector
pCR2.1-TOPO (Invitrogen, Carlsbad, Calif.) and sequenced. Sequence
of this band indicated that it contained the 3' sequence of human
DKR-4., and this sequence was assembled together with the 5'
sequence (from clones 9813563 and 9853564) to generated the full
length sequence of human DKR-4. This sequence is set forth in FIGS.
7 (DNA sequence) and 14 (translated amino acid sequence). The
polypeptide is 224 amino acids in length and is about 34 percent
identical to human DKR-1 at the amino acid sequence level.
Example 7
Expression of Human DKR-1 in Bacteria
[0287] PCR amplification employing the primer pairs and template
described below were used to generate a recombinant form of human
DKR-1. One primer of each pair introduces a TAA stop codon and a
unique BamHI site following the carboxy terminus of the gene. The
other primer of each pair introduces a unique NdeI site, a
N-terminal methionine, and optimized codons for the amino terminal
portion of the gene. PCR and thermocycling was performed using
standard recombinant DNA methodology. The PCR products were
purified, restriction digested, and inserted into the unique NdeI
and BamHI sites of vector pAMG21 (ATCC accession no. 98113) and
transformed into the prototrophic E. coli host GM121 (deposited
with the American Type Culture Collection on XX as accession number
XX). Other commonly used E. coli expression vectors and host cells
are also suitable for expression by one skilled in the art. After
transformation, positive clones were selected and examined for
expression of the recombinant gene product.
[0288] The construct pAMG21-human DKR-1-24-266 was engineered to be
244 amino acids in length and have the following N-terminal and
C-terminal residues, respectively: TABLE-US-00019
Met-His-Pro-Leu-Leu-Gly (SEQ ID NO:43) Thr-Cys-Gln-Arg-His (SEQ ID
NO:44)
[0289] The template used for PCR was human DKR-1 cDNA and the
following oligonucleotides were the primer pair used for PCR and
cloning this gene construct: TABLE-US-00020 (SEQ ID NO:45)
GTTCTCCTCATATGCATCCATTATTAGGCGTAAGTGCCACCTTGAACTCG GTTCTCAAT (SEQ
ID NO:46) TACGCACTGGATCCTTAGTGTCTCTGACAAGTGTGAAG
[0290] Transformed E. coli strain GM121 containing pAMG21-human
DKR-1-24-266 were grown in 2.times. YT media containing 20
micrograms/ml kanamycin at 30 C until the culture reached an
optical density of about 600 nm of about 0.5. Induction of DKR-1
protein expression was achieved by addition of Vibrio fischeri
synthetic autoinducer to 100 ng/ml final and incubation of the
culture at either 30.degree. C. or 37.degree. C. for about 9 hours
further with shaking. In addition, as a uninduced control, for each
culture no autoinducer was added to an aliquot of the culture, but
the culture was also incubated for about 9 hours further at about
30 C with shaking along with the induced cultures. After about 9
hours, the optical density of cultures were measured at 600 nm, an
aliquot of cultures were examined by oil emersion microscopy at
1600.times. magnification, and aliquots of cultures were pelleted
by centrifugation. Bacterial pellets of cultures were processed for
SDS-polyacrylamide gel electrophoresis on a 14 percent gelto
examine levels of protein produced in crude lysates and for
N-terminal sequencing confirmation of the recombinant gene product.
The gel was stained with Coomassie blue.
[0291] The results are shown in the photo of FIG. 16. Lane 1
contains molecular weight markers; Lanes 2 and 5 contain crude
lysates of uninduced control cells incubated at 30 C; Lanes 3 and 6
are crude lysates of induced cells cultured at 30 C; Lanes 4 and 7
are crude lysates of induced cells cultured at 37 C. The arrow on
the left of Lane 1 indicates the expected location of human
DKR-1-24-266. As can be seen, large amounts of recombinant protein
were observed in crude lysates of induced cultures at both
30.degree. C. and 37.degree. C. (Lanes 3 and 6, and 4 and 7).
Microscopic analysis of bacterial cells revealed most cells
contained at least one inclusion body, suggesting that at least
some of the protein may be produced in the insoluble fraction of E.
coli.
Example 8
Expression of DKR-2 in Bacteria
[0292] PCR amplification employing the primer pairs and templates
described below were used to generate various forms of DKR-2. One
primer of each pair introduces a TAA stop codon and a unique BamHI
site following the carboxy terminus of the gene. The other primer
of each pair introduces a unique NdeI site, a N-terminal
methionine, and optimized codons for the amino terminal portion of
the gene. PCR and thermocycling was performed using standard
recombinant DNA methodology. The PCR products were purified,
restriction digested, and inserted into the unique NdeI and BamHI
sites of vector pAMG21 (ATCC accession no. 98113) and transformed
into either prototrophic E. coli host GM121 or GM94 (GM 94 was
deposited with the ATCC on XX as accession number XX). Other
commonly used E. coli expression vectors and host cells are also
suitable for expression. After transformation, positive clones were
selected and examined for expression of the recombinant gene
product.
[0293] The construct pAMG21-human DKR-2-26-259 was engineered to be
235 amino acids in length and have the following N-terminal and the
following C-terminal amino acids, respectively: TABLE-US-00021
Met-Ser-Gln-Ile-Gly-Ser (SEQ ID NO:47) Val-Cys-Gln-Lys-Ile. (SEQ ID
NO:48)
[0294] The template used for PCR was human DKR-2 cDNA and the
following oligonucleotides were the primer pair used for PCR and
cloning this gene construct. TABLE-US-00022 (SEQ ID NO:49)
GTTCTCCTCATATGTCTCAAATTGGTAGTTCTCGTGCCAAACTCAACTCC ATCAAG (SEQ ID
NO:50) TACGCACTGGATCCTTAAATTTTCTGACACACATGGAGT
[0295] The construct pAMG21 mouse DKR-2-26-259 was engineered to be
235 amino acids in length and have the following N-terminal and
C-terminal residues, respectively: TABLE-US-00023
Met-Ser-Gln-Leu-Gly-Ser (SEQ ID NO:51) Val-Cys-Gln-Lys-Ile (SEQ ID
NO:52)
[0296] The template used for PCR was mouse DKR-2 cDNA, and the
following oligonucleotides were the primer pair used for PCR and
cloning this gene construct. TABLE-US-00024 (SEQ ID NO:53)
GTTCTCCTCATATGTCTCAATTAGGTAGCTCTCGTGCTAAACTCAACTCC ATCAAGTCC (SEQ
ID NO:54) TACGCACTGGATCCTTAGATCTTCTGGCATACATGGAGT
[0297] Transformed E. coli GM121 or GM94 containing either
pAMG21-human DKR-2-26-259 or pAMG21-mouse DKR-2-26-259 plasmid were
grown in 2.times. YT media containing 20 .mu.g/ml kanamycin at
30.degree. C. until the culture reached an optical density at 600
nm of about 0.5. Induction of DKR-2 protein expression was achieved
by addition of Vibrio fischeri synthetic autoinducer to 100 ng/ml
final and incubation of the culture at either 30 C or 37 C for
about 5 or 9 hours further with shaking. In addition, as a
uninduced control, for each culture no autoinducer was added to an
aliquot of the culture, but the culture was also incubated for
about 5 or 9 hours further at 30 C with shaking along with the
induced cultures. After either 5 or 9 hours incubation, the optical
density of cultures were measured at about 600 nm, an aliquot of
cultures were examined by oil emersion microscopy at 1600.times.
magnification, and aliquots of cultures were pelleted by
centrifugation. Bacterial pellets of cultures were processed for
SDS-polyacrylamide gel electrophoresis on a 14 percent gel to
examine levels of protein produced in crude lysates and for
N-terminal sequencing confirmation of the recombinant gene product.
The gel was stained with Coomassie blue.
[0298] The results are shown in FIG. 16, Lanes 8-10 (human DKR-2
polypeptide) and in FIG. 17 (mouse DKR-2 polypeptide). In FIG. 16,
Lane 8 contains crude lysate of uninduced control cells; Lane 9
contains crude lysate of induced cells cultured at 30 C, and Lane
10 contains crude lysate of induced cells cultured at 37 C. The
arrow to the left of Lane 10 indicates the expected location of
human DKR-2-26-259. As can be seen, significant amounts of
polypeptide were generated in the induced cultures whether grown at
30 C or 37 C, while the uninduced cells did not produce a large
amount of polypeptide. FIG. 17 shows the results of polypeptide
production of mouse DKR-2-26-259. Lane 1 is molecular weight
markers. Lanes 2-4 are one clone of E. coli cells transfected with
the DKR-2 plasmid, while Lanes 5-7 are a second clone transfected
with the same plasmid. Lanes 2 and 5 are crude lysates of uninduced
control cells; Lanes 3 and 6 are crude lysates of induced cells
cultured at 30 C; and Lanes 4 and 7 are crude lysates of cells
cultured at 37 C. The arrows to the left of Lanes 4 and 7 indicate
the expected location of the DKR-2 polypeptide. As can be seen,
large amounts of recombinant protein were observed in crude lysates
of induced cultures at 37 C but not at 30 C. Microscopic analysis
of bacterial cells revealed most cells contained at least one
inclusion body, suggesting that at least some of the protein may be
produced in the insoluble fraction of E. coli.
Example 9
Expression of DKR-3 in Bacteria
[0299] PCR amplification employing the primer pairs and templates
described below were used to generate various forms of DKR-3. One
primer of each pair introduces a TAA stop codon and a unique SacII
site following the carboxy terminus of the gene. The other primer
of each pair introduces a unique NdeI site, a N-terminal
methionine, and optimized codons for the amino terminal portion of
the gene. PCR and thermocycling was performed using standard
recombinant DNA methodology. The PCR products were purified,
restriction digested, and inserted into the unique NdeI and SacII
sites of vector pAMG21 (ATCC accession no. 98113) and transformed
into the prototrophic E. coli host GM121. Other commonly used E.
coli expression vectors and host cells are also suitable for
expression by one skilled in the art. After transformation,
positive clones were selected, plasmid DNA was isolated and the
sequence of the DKR-3 gene insert was confirmed.
[0300] The construct pAMG21-human DKR-3-23-350 was engineered to be
329 amino acids in length and have the following N-terminal and
C-terminal residues, respectively: TABLE-US-00025
Met-Pro-Ala-Pro-Thr-Ala (SEQ ID NO:55) Gly-Gly-Glu-Glu-Ile. (SEQ ID
NO:56)
[0301] The template used for PCR was human DKR-3 cDNA and the
following oligonucleotides were the primer pair used for PCR and
cloning this gene construct. TABLE-US-00026 (SEQ ID NO:57)
GTTCTCCTCATATGCCTGCTCCAACTGCAACTTCGGCTCCAGTCAAGCCC GGCC (SEQ ID
NO:58) TACGCACTCCGCGGTTAAATCTCTTCCCCTCCCAGCA
[0302] The construct pAMG21-human DKR-3-33-350 was engineered to be
319 amino acids in length and have the following N-terminal and
C-terminal residues, respectively: TABLE-US-00027
Met-Lys-Pro-Gly-Pro-Ala (SEQ ID NO:59) Gly-Gly-Glu-Glu-Ile (SEQ ID
NO:60)
[0303] The template used for PCR was human DKR-3 cDNA and the
following oligonucleotides were the primer pair used for PCR and
cloning this gene construct: TABLE-US-00028 (SEQ ID NO:61)
GTTCTCCTCATATGAAACCAGGTCCAGCCTTAAGCTACCCGCAGGAGGAG GCCA (SEQ ID
NO:62) TACGCACTCCGCGGTTAAATCTCTTCCCCTCCCAGCA
[0304] The construct pAMG21-human DKR-3-42-350 was engineered to be
310 amino acids in length and have the following N-terminal and
C-terminal residues, respectively: TABLE-US-00029
Met-Gln-Glu-Glu-Ala-Thr (SEQ ID NO:63) Gly-Gly-Glu-Glu-Ile (SEQ ID
NO:64)
[0305] The template used for PCR was human DKR-3 cDNA and the
following oligonucleotides were the primer pair used for PCR and
cloning this gene construct: TABLE-US-00030 (SEQ ID NO:65)
GTTCTCCTCATATGCAAGAAGAAGCTACTCTGAATGAGATGTTCCGCGAG GTT (SEQ ID
NO:66) TACGCACTCCGCGGTTAAATCTCTTCCCCTCCCAGCA
[0306] The construct pAMG21-mouse DKR-3-33-349 was engineered to be
318 amino acids in length and have the following N-terminal and
C-terminal residues, respectively: TABLE-US-00031
Met-Glu-Pro-Gly-Pro-Ala (SEQ ID NO:67) Gly-Glu-Glu-Glu-Ile (SEQ ID
NO:68)
[0307] The template used for PCR was mouse DKR-3 cDNA and the
following oligonucleotides were the primer pair used for PCR and
cloning this gene construct: TABLE-US-00032 (SEQ ID NO:69)
GTTCTCCTCATATGGAACCAGGTCCAGCTTTAAACTACCCTCAGGAGGAA GCTA (SEQ ID
NO:70) TACGCACTCCGCGGTTAAATCTCCTCCTCTCCGCCTA
[0308] Transformed E. coli GM121 containing the various pAMG21
DKR-3 plasmids described above were grown in 2.times. YT media
containing 20 micrograms/ml kanamycin at 30.degree. C. until the
culture reached an optical density at 600 nm of about 0.5.
Induction of DKR-3 polypeptide expression was achieved by addition
of Vibrio fischeri synthetic autoinducer to 100 ng/ml final
concentration and incubation of the culture at either 30 or 37 C
for about 6 hours further with shaking. In addition, as a uninduced
control, for each culture no autoinducer was added to an aliquot of
the culture, but the culture was also incubated for about 6 hours
further at 30 C with shaking along with the induced cultures. After
about 6 hours, the optical density of cultures were measured at
about 600 nm, an aliquot of cultures were examined by oil emersion
microscopy at 1600.times. magnification, and aliquots of cultures
were pelleted by centrifugation. Bacterial pellets of cultures were
processed for SDS-polyacrylamide gel electrophoresis to examine
levels of protein produced in crude lysates, or bacterial pellets
were processed to determine whether the recombinant protein was in
the soluble or insoluble fraction of E. coli and for N-terminal
sequencing confirmation of the recombinant gene product. The
results are shown as photos of the SDS gels in FIGS. 18 and 19. In
FIG. 18, Lane 10 is molecular weight markers, and Lanes 1-9 are
crude lystes of bacterial cells. Lane 1 is crude lysate of
uninduced control cells; Lanes 2, 4, 6, and 8 are crude lysates of
induced cells cultured at 30 C; Lanes 3, 5, 7, and 9 are induced
cells cultured at 37 C. Lanes 1-5 contain lysates of cells
transfected with the pAMG21-human DKR-3-23-350 construct; and Lanes
6-9 contain lysates of cells transfected with the pAMG21-human
DKR-3-33-350 construct. The arrows to the left of Lane 2 and the
right of Lane 9 indicate the expected location of the DKR-3
polypeptides. FIG. 19 contains molecular weight markers in Lane 10;
Lanes 1-5 are crude lysates of cultured cells transfected with the
pAMG21-human DKR-3-42-350 construct; Lanes 6-9 are crude lysates of
cells transfected with the pAMG21-mouse DKR-3-33-349 construct.
Lanes 1 and 6 are uninduced controls; Lanes 2, 4, 7, and 8 are
crude lysates of induced cells cultured at 30 C (two different
clones of each construct); Lanes 3, 5, and 9 are crude lysates of
induced cells cultured at 37 C (two separate clones of the human
DKR-3-42-350 construct in Lanes 3 and 5). The arrow to the right of
Lane 9 indicates the expected location of the mouse DKR-3
polypeptides; the arrow to the left of Lane 4 indicates the
expected location of human DKR-3 polypeptide. As can be seen, all
DKR-3 constructs produced large amounts of recombinant protein in
E. coli. No inclusion bodies could be detected by oil emersion
microscopy, and the recombinant polypeptides were mostly found in
the soluble fraction of the cells.
Example 10
Expression of DKR-4 in Bacteria
[0309] PCR amplification employing the primer pairs and template
described below were used to generate a recombinant form of human
DKR-4. One primer of each pair introduces a TAA stop codon and a
unique BamHI site following the carboxy terminus of the gene. The
other primer of each pair introduces a unique NdeI site, a
N-terminal methionine, and optimized codons for the amino terminal
portion of the gene. PCR and thermocycling was performed using
standard recombinant DNA methodology. The PCR products were
purified, restriction digested, and inserted into the unique NdeI
and BamHI sites of the vector pAMG21 (ATCC accession no. 98113) and
transformed into the prototrophic E. coli host GM94. Other commonly
used E. coli expression vectors and host cells are also suitable
for expression. After transformation, positive clones were selected
and will be examined for expression of the recombinant gene
product.
[0310] The construct pAMG21-human DKR-4-19-224 was engineered to be
207 amino acids in length and have the following N-terminal and
C-terminal residues, respectively: TABLE-US-00033
Met-Leu-Val-Leu-Asp-Phe (SEQ ID NO:71) Lys-Ile-Glu-Lys-Leu (SEQ ID
NO:72)
[0311] The template used for PCR was human DKR-4 cDNA and the
following oligonucleotides were the primer pair used for PCR and
cloning this gene construct: TABLE-US-00034 (SEQ ID NO:73)
GTTCTCCTCATATGTTAGTTTTGGATTTCAACAACATCAGGAGCTCT (SEQ ID NO:74)
TACGCACTGGATCCTTACAGTTTTTCTATTTTTTGGCATACTCTTAATC
[0312] It is anticipated that DKR-4 polypeptide could be prepared
using the PCR product as described above for the other DKR
polypeptides.
Example 11
Production and Purification of DKR-3 Polypeptide in Mammalian
Cells
[0313] Human DKR-3 cDNA was cloned onto the mammalian expression
vector pcDNA3.1 (-)/mycHis (Invitrogen, Carlsbad, Calif.) and the
vector construct was amplified using the Qiagen maxi-prep kit
(Qiagen, Chatsworth, Calif.) standard ligation techniques.
[0314] Human embryonic kidney 293T cells (American Type Culture
Collection) were cultured in 10 cm dishes, and grown to about 80
percent confluence. The cells were then transfected with the vector
construct using the DMRIE-C.RTM. liposome formulation (Gibco BRL,
Grand Island, N.Y.) as follows. About 240 microliters of
DMRIE-C.RTM. were added to 8 ml of Optimem medium. About 40 ul
(equivalent to about 56 micrograms) of purified vector construct
was then added to another 8 ml of Optimem. After mixing and
incubation at room temperature for about 15 minutes, 2 ml of this
solution was added to each of 8 plates. After about 5 hours, the
medium was aspirated and 10 ml of DME medium containing about 10
percent fetal calf serum was added. The cells were incubated 16-18
hours after which the medium was removed and about 10 ml of SF
Optimem medium per well without phenol red were added. After about
24 hours, this medium, the "conditioned medium" was harvested,
passed over a 0.22 micron filter and stored at 4.degree. C. The
cells were then incubated in another 10 ml of SF Optimem per plate.
After 24 hours, this medium was collected, filtered and also stored
at 4.degree. C.
[0315] The conditioned media was added to a buffer containing 50 mM
NaP0.sub.4, pH8, and 250 mM sodium chloride, and passed over a
column of nickel-Sephadex (Qiagen, Chatsworth, Calif.).
Non-specifically bound proteins were eluted using the same buffer
containing 10 mM imidazole, followed by the same buffer containing
20 mM imidazole. DKR-3 was then eluted using 125 mM-250 mM
imidazole. Fractions from the column were subjected to 12 percent
SDS gel electrophores and silver stained. The results are shown in
FIG. 20. Lane 2 contains material that was loaded on to the gel.
Lane 3 contains the flow through fraction after loading the column
with conditioned medium, Lanes 4, 5, 6, and 7 contain column
fractions after treatment with 10, 20, 125, and 250 mM imidazole.
Molecular weight standards are shown in Lane 8. As can be seen a
single band of protein of the correct molecular weight is seen in
Lanes 5 and 6, indicating that this procedure resulted in
generation of purified DKR-3 protein (attached to myc and His
tags). Smearing of the protein band may be due to glycosylation.
Separately, a Western blot was run to confirm that the purified
protein did indeed have a His tag (indicating that the fusion
protein DKR-3 mycHis had been produced). The Western blot was
prepared using standard procedures and was proved with a polyclonal
anti-His-HRP antibody (Invitrogen, Carlsbad, Calif.). A photo of
the Western blot is shown in FIG. 21; the Lanes correspond to that
for the gel (described immediately above). As can be seen, there is
antibody binding in Lanes 2, 5, and 6, indicating that DKR-3 mycHis
was loaded on to the column and was eluted in the 20 and 125 mM
imidazole washes.
Example 12
Anchorage Independent Growth Assay
[0316] A distinguishing feature of many cancer cell lines is their
ability to grow in an anchorage independent manner. Whereas normal
cells will only grow and divide until they come in contact with
their neighbors, cancer cells continue to grow and divide after
contact, thereby forming tumors. Thus, one assay for cancer cell
growth inhibitor compounds measures the ability of cancer cells to
grow and divide in the presence of the compound. There are many
ways known to the skilled artisan in which this assay can be
conducted, however two preferred methods are set forth below.
A. Stably Transfected Cell Assay
[0317] In this procedure, any human cancer cell line that does not
express the DKR gene to be tested (either human DKR-1, 2, 3, 4, or
a fragment or variant thereof) is transfected with the DKR gene
under evaluation, where the DKR gene is inserted into a vector such
as pcDNA3.1 (Invitrogen, Carlsbad, Calif.) or other suitable
mammalian expression vector. Transfection can be conducted as
described herein. The transfected cancer cells are cultured to
generate a stably transfected cell line. Once a stably transfected
cell line has been established, the cells are added to Noble or
equivalent agar (about 0.35 percent) prepared in standard mammalian
cell culture medium such as RPMI. The cell/agar solution is poured
on to petri plates containing solidified agar ban (about 0.5
percent agar). Colony formation is evaluated daily to determine the
rate of growth of the cells, and culture medium is added to each
plate as needed. Separately, the same cells are transfected with
vector only (containing no DKR gene). These "control" cells are
then treated in an identical manner to the DKR gene containing
cells and can be used as a standard of comparison for the DKR gene
containing cells.
[0318] Examples of suitable cancer cell lines for conducting this
assay include, without limitation, human breast cancer cell line
MCF7 and the glioblastoma cell line U-87MG.
B. Protein Assay
[0319] An alternate or additional assay to measure the growth of
cancer cell lines treated with a DKR polypeptide is as follows. Any
human cancer cell line not expressing the DKR polypeptide under
evaluation can be cultured and prepared with an agar solution as
described above. The cells can then be plated as described, and a
solution of DKR polypeptide (either full length, or a fragment or
variant thereof) in culture medium can be added to the agar either
daily, every other day, or once per week for three weeks.
Typically, a concentration of about 10 nM will be added, although a
series of dilutions ranging from 1 nM to 1 mM can be used. Control
plates will receive a solution of culture medium only. The plates
can be monitored daily for up to about three weeks to evaluate cell
colony formation. After three weeks, control and experimental
plates can be compared for the number and size of cell colonies. It
is anticipated that those plates receiving DKR polypeptide that is
biologically active will have fewer cell colonies, and the colonies
will be smaller, as compared to control plates.
Example 13
In Vivo Tumor Assay
[0320] The ability of each DKR polypeptide to inhibit tumor growth
in vivo can be evaluated as follows. Tumor cells not expressing the
DKR gene under evaluation can be transfected using procedures
described herein with a DKR nucleic acid construct encoding a full
length DKR gene, or a fragment or variant thereof. The transfected
cells can be maintained in culture (as described herein) until
ready for use.
[0321] Male or female athymic nude mice (Charles River Labs,
Boston, Mass.) are kept in a sterile environment. The mice are then
injected with about 2.times.10.sup.6 cells (either DKR transfected
cells or control "vector only" transfected cells) in a total volume
of about 0.1 ml can be injected subcutaneously. The mice can then
be examined daily for appearance of (a) tumor(s) and for the size
of the tumor. Preferably, the mice will be examined for up to about
six months so as to provide time for tumor growth (and regression
where DKR polypeptides are effective at decreasing tumor growth).
The tumor(s), where present, can then be removed, weighed and
examined for (1) the presence of DKR polypeptide, and (2)
morphology. Tumors from mice containing DKR construct transfected
cells can be compared to tumors from mice containing cells
transfected with vector only. It is anticipated that DKR
polypeptides, due to their similarity with dkk-1, a potent wnt8
antagonist, will be able to decrease the size of the tumor as
compared with controls.
Sequence CWU 1
1
78 1 1050 DNA Mouse 1 atgcagcggc tcgggggtat tttgctgtgt acactgctgg
cggcggcggt ccccactgct 60 cctgctcctt ccccgacggt cacttggact
ccggcggagc cgggcccagc tctcaactac 120 cctcaggagg aagctacgct
caatgagatg tttcgagagg tggaggagct gatggaagac 180 actcagcaca
aactgcgcag tgccgtggag gagatggagg cggaagaagc agctgctaaa 240
acgtcctctg aggtgaacct ggcaagctta cctcccaact atcacaatga gaccagcacg
300 gagaccaggg tgggaaataa cacagtccat gtgcaccagg aagttcacaa
gataaccaac 360 aaccagagtg gacaggtggt cttttctgag acagtcatta
catctgtagg ggatgaagaa 420 ggcaagagga gccatgaatg tatcattgat
gaagactgtg ggcccaccag gtactgccag 480 ttctccagct tcaagtacac
ctgccagcca tgccgggacc agcagatgct atgcacccga 540 gacagtgagt
gctgtggaga ccagctgtgt gcctggggtc actgcaccca aaaggccacc 600
aaaggtggca atgggaccat ctgtgacaac cagagggatt gccagcctgg cctgtgttgt
660 gccttccaaa gaggcctgct gttccccgtg tgcacacccc tgcccgtgga
gggagagctc 720 tgccatgacc ccaccagcca gctgctggat ctcatcacct
gggaactgga gcctgaagga 780 gctttggacc gatgcccctg cgccagtggc
ctcctatgcc agccacacag ccacagtctg 840 gtgtacatgt gcaagccagc
cttcgtgggc agccatgacc acagtgagga gagccagctg 900 cccagggagg
ccccggatga gtacgaagat gttggcttca taggggaagt gcgccaggag 960
ctggaagacc tggagcggag cctagcccag gagatggcat ttgaggggcc tgcccctgtg
1020 gagtcactag gcggagagga ggagatttag 1050 2 1053 DNA Human 2
atgcagcggc ttggggccac cctgctgtgc ctgctgctgg cggcggcggt ccccacggcc
60 cccgcgcccg ctccgacggc gacctcggct ccagtcaagc ccggcccggc
tctcagctac 120 ccgcaggagg aggccaccct caatgagatg ttccgcgagg
ttgaggaact gatggaggac 180 acgcagcaca aattgcgcag cgcggtggaa
gagatggagg cagaagaagc tgctgctaaa 240 gcatcatcag aagtgaacct
ggcaaactta cctcccagct atcacaatga gaccaacaca 300 gacacgaagg
ttggaaataa taccatccat gtgcaccgag aaattcacaa gataaccaac 360
aaccagactg gacaaatggt cttttcagag acagttatca catctgtggg agacgaagaa
420 ggcagaagga gccacgagtg catcatcgac gaggactgtg ggcccagcat
gtactgccag 480 tttgccagct tccagtacac ctgccagcca tgccggggcc
agaggatgct ctgcacccgg 540 gacagtgagt gctgtggaga ccagctgtgt
gtctggggtc actgcaccaa aatggccacc 600 aggggcagca atgggaccat
ctgtgacaac cagagggact gccagccggg gctgtgctgt 660 gccttccaga
gaggcctgct gttccctgtg tgcacacccc tgcccgtgga gggcgagctt 720
tgccatgacc ccgccagccg gcttctggac ctcatcacct gggagctaga gcctgatgga
780 gccttggacc gatgcccttg tgccagtggc ctcctctgcc agccccacag
ccacagcctg 840 gtgtatgtgt gcaagccgac cttcgtgggg agccgtgacc
aagatgggga gatcctgctg 900 cccagagagg tccccgatga gtatgaagtt
ggcagcttca tggaggaggt gcgccaggag 960 ctggaggacc tggagaggag
cctgactgaa gagatggcgc tgggggagcc tgcggctgcc 1020 gccgctgcac
tgctgggagg ggaagagatt tag 1053 3 801 DNA Human 3 atgatggctc
tgggcgcagc gggagctacc cgggtctttg tcgcgatggt agcggcggct 60
ctcggcggcc accctctgct gggagtgagc gccaccttga actcggttct caattccaac
120 gctatcaaga acctgccccc accgctgggc ggcgctgcgg ggcacccagg
ctctgcagtc 180 agcgccgcgc cgggaatcct gtacccgggc gggaataagt
accagaccat tgacaactac 240 cagccgtacc cgtgcgcaga ggacgaggag
tgcggcactg atgagtactg cgctagtccc 300 acccgcggag gggacgcggg
cgtgcaaatc tgtctcgcct gcaggaagcg ccgaaaacgc 360 tgcatgcgtc
acgctatgtg ctgccccggg aattactgca aaaatggaat atgtgtgtct 420
tctgatcaaa atcatttccg aggagaaatt gaggaaacca tcactgaaag ctttggtaat
480 gatcatagca ccttggatgg gtattccaga agaaccacct tgtcttcaaa
aatgtatcac 540 accaaaggac aagaaggttc tgtttgtctc cggtcatcag
actgtgcctc aggattgtgt 600 tgtgctagac acttctggtc caagatctgt
aaacctgtcc tgaaagaagg tcaagtgtgt 660 accaagcata ggagaaaagg
ctctcatgga ctagaaatat tccagcgttg ttactgtgga 720 gaaggtctgt
cttgccggat acagaaagat caccatcaag ccagtaattc ttctaggctt 780
cacacttgtc agagacacta a 801 4 780 DNA Mouse 4 atggccgcgc tgatgcgggt
caaggattca tcccgctgcc ttctcctact ggccgcggtg 60 ctgatggtgg
agagctcaca gctaggcagc tcgcgggcca aactcaactc catcaagtcc 120
tctctaggag gggagactcc tgctcagtca gccaaccgat ctgcaggcat gaaccaagga
180 ctggctttcg gcggcagtaa gaagggcaaa agcctggggc aggcctaccc
ttgcagcagt 240 gataaggaat gtgaagttgg aagatactgc cacagtcccc
accaaggatc atcagcctgc 300 atgctctgta ggaggaaaaa gaaacgatgc
cacagagatg ggatgtgttg ccctggtacc 360 cgctgcaata atggaatctg
catcccagtc actgagagca tcctcacccc acatatccca 420 gctctggatg
gcacccggca tagagatcgc aaccatggtc actattccaa ccatgacctg 480
ggatggcaga atctaggaag gccacactcc aagatgcctc atataaaagg acatgaagga
540 gacccatgcc tacggtcatc agactgcatt gatgggtttt gttgtgctcg
ccacttctgg 600 accaaaatct gcaaaccagt gctccatcag ggggaagtct
gtaccaaaca acgcaagaag 660 ggttcgcacg ggctggagat tttccagagg
tgtgactgtg caaagggcct gtcctgcaaa 720 gtgtggaaag atgccaccta
ctcttccaaa gccagactcc atgtatgcca gaagatctga 780 5 780 DNA Human 5
atggccgcgt tgatgcggag caaggattcg tcctgctgcc tgctcctact ggccgcggtg
60 ctgatggtgg agagctcaca gatcggcagt tcgcgggcca aactcaactc
catcaagtcc 120 tctctgggcg gggagacgcc tggtcaggcc gccaatcgat
ctgcgggcat gtaccaagga 180 ctggcattcg gcggcagtaa gaagggcaaa
aacctggggc aggcctaccc ttgtagcagt 240 gataaggagt gtgaagttgg
gaggtattgc cacagtcccc accaaggatc atcggcctgc 300 atggtgtgtc
ggagaaaaaa gaagcgctgc caccgagatg gcatgtgctg ccccagtacc 360
cgctgcaata atggcatctg tatcccagtt actgaaagca tcttaacccc tcacatcccg
420 gctctggatg gtactcggca cagagatcga aaccacggtc attactcaaa
ccatgacttg 480 ggatggcaga atctaggaag accacacact aagatgtcac
atataaaagg gcatgaagga 540 gacccctgcc tacgatcatc agactgcatt
gaagggtttt gctgtgctcg tcatttctgg 600 accaaaatct gcaaaccagt
gctccatcag ggggaagtct gtaccaaaca acgcaagaag 660 ggttctcatg
ggctggaaat tttccagcgt tgcgactgtg cgaagggcct gtcttgcaaa 720
gtatggaaag atgccaccta ctcctccaaa gccagactcc atgtgtgtca gaaaatttga
780 6 624 DNA Human 6 atggccgcgt tgatgcggag caaggattcg tcctgctgcc
tgctcctact ggccgcggtg 60 ctgatggtgg agagctcaca gatcggcagt
tcgcgggcca aactcaactc catcaagtcc 120 tctctgggcg gggagacgcc
tggtcaggcc gccaatcgat ctgcgggcat gtaccaagga 180 ctggcattcg
gcggcagtaa gaagggcaaa aacctggggc aggcctaccc ttgtagcagt 240
gataaggagt gtgaagttgg gaggtattgc cacagtcccc accaaggatc atcggcctgc
300 atggtgtgtc ggagaaaaaa gaagcgctgc caccgagatg gcatgtgctg
ccccagtacc 360 cgctgcaata atgggcatga aggagacccc tgcctacgat
catcagactg cattgaaggg 420 ttttgctgtg ctcgtcattt ctggaccaaa
atctgcaaac cagtgctcca tcagggggaa 480 gtctgtacca aacaacgcaa
gaagggttct catgggctgg aaattttcca gcgttgcgac 540 tgtgcgaagg
gcctgtcttg caaagtatgg aaagatgcca cctactcctc caaagccaga 600
ctccatgtgt gtcagaaaat ttga 624 7 675 DNA Human 7 atggtggcgg
ccgtcctgct ggggctgagc tggctctgct ctcccctggg agctctggtc 60
ctggacttca acaacatcag gagctctgct gacctgcatg gggcccggaa gggctcacag
120 tgcctgtctg acacggactg caataccaga aagttctgcc tccagccccg
cgatgagaag 180 ccgttctgtg ctacatgtcg tgggttgcgg aggaggtgcc
agcgagatgc catgtgctgc 240 cctgggacac tctgtgtgaa cgatgtttgt
actacgatgg aagatgcaac cccaatatta 300 gaaaggcagc ttgatgagca
agatggcaca catgcagaag gaacaactgg gcacccagtc 360 caggaaaacc
aacccaaaag gaagccaagt attaagaaat cacaaggcag gaagggacaa 420
gagggagaaa gttgtctgag aacttttgac tgtggccctg gactttgctg tgctcgtcat
480 ttttggacga aaatttgtaa gccagtcctt ttggagggac aggtctgctc
cagaagaggg 540 cataaagaca ctgctcaagc tccagaaatc ttccagcgtt
gcgactgtgg ccctggacta 600 ctgtgtcgaa gccaattgac cagcaatcgg
cagcatgctc gattaagagt atgccaaaaa 660 atagaaaagc tataa 675 8 349 PRT
Mouse 8 Met Gln Arg Leu Gly Gly Ile Leu Leu Cys Thr Leu Leu Ala Ala
Ala 1 5 10 15 Val Pro Thr Ala Pro Ala Pro Ser Pro Thr Val Thr Trp
Thr Pro Ala 20 25 30 Glu Pro Gly Pro Ala Leu Asn Tyr Pro Gln Glu
Glu Ala Thr Leu Asn 35 40 45 Glu Met Phe Arg Glu Val Glu Glu Leu
Met Glu Asp Thr Gln His Lys 50 55 60 Leu Arg Ser Ala Val Glu Glu
Met Glu Ala Glu Glu Ala Ala Ala Lys 65 70 75 80 Thr Ser Ser Glu Val
Asn Leu Ala Ser Leu Pro Pro Asn Tyr His Asn 85 90 95 Glu Thr Ser
Thr Glu Thr Arg Val Gly Asn Asn Thr Val His Val His 100 105 110 Gln
Glu Val His Lys Ile Thr Asn Asn Gln Ser Gly Gln Val Val Phe 115 120
125 Ser Glu Thr Val Ile Thr Ser Val Gly Asp Glu Glu Gly Lys Arg Ser
130 135 140 His Glu Cys Ile Ile Asp Glu Asp Cys Gly Pro Thr Arg Tyr
Cys Gln 145 150 155 160 Phe Ser Ser Phe Lys Tyr Thr Cys Gln Pro Cys
Arg Asp Gln Gln Met 165 170 175 Leu Cys Thr Arg Asp Ser Glu Cys Cys
Gly Asp Gln Leu Cys Ala Trp 180 185 190 Gly His Cys Thr Gln Lys Ala
Thr Lys Gly Gly Asn Gly Thr Ile Cys 195 200 205 Asp Asn Gln Arg Asp
Cys Gln Pro Gly Leu Cys Cys Ala Phe Gln Arg 210 215 220 Gly Leu Leu
Phe Pro Val Cys Thr Pro Leu Pro Val Glu Gly Glu Leu 225 230 235 240
Cys His Asp Pro Thr Ser Gln Leu Leu Asp Leu Ile Thr Trp Glu Leu 245
250 255 Glu Pro Glu Gly Ala Leu Asp Arg Cys Pro Cys Ala Ser Gly Leu
Leu 260 265 270 Cys Gln Pro His Ser His Ser Leu Val Tyr Met Cys Lys
Pro Ala Phe 275 280 285 Val Gly Ser His Asp His Ser Glu Glu Ser Gln
Leu Pro Arg Glu Ala 290 295 300 Pro Asp Glu Tyr Glu Asp Val Gly Phe
Ile Gly Glu Val Arg Gln Glu 305 310 315 320 Leu Glu Asp Leu Glu Arg
Ser Leu Ala Gln Glu Met Ala Phe Glu Gly 325 330 335 Pro Ala Pro Val
Glu Ser Leu Gly Gly Glu Glu Glu Ile 340 345 9 350 PRT Human 9 Met
Gln Arg Leu Gly Ala Thr Leu Leu Cys Leu Leu Leu Ala Ala Ala 1 5 10
15 Val Pro Thr Ala Pro Ala Pro Ala Pro Thr Ala Thr Ser Ala Pro Val
20 25 30 Lys Pro Gly Pro Ala Leu Ser Tyr Pro Gln Glu Glu Ala Thr
Leu Asn 35 40 45 Glu Met Phe Arg Glu Val Glu Glu Leu Met Glu Asp
Thr Gln His Lys 50 55 60 Leu Arg Ser Ala Val Glu Glu Met Glu Ala
Glu Glu Ala Ala Ala Lys 65 70 75 80 Ala Ser Ser Glu Val Asn Leu Ala
Asn Leu Pro Pro Ser Tyr His Asn 85 90 95 Glu Thr Asn Thr Asp Thr
Lys Val Gly Asn Asn Thr Ile His Val His 100 105 110 Arg Glu Ile His
Lys Ile Thr Asn Asn Gln Thr Gly Gln Met Val Phe 115 120 125 Ser Glu
Thr Val Ile Thr Ser Val Gly Asp Glu Glu Gly Arg Arg Ser 130 135 140
His Glu Cys Ile Ile Asp Glu Asp Cys Gly Pro Ser Met Tyr Cys Gln 145
150 155 160 Phe Ala Ser Phe Gln Tyr Thr Cys Gln Pro Cys Arg Gly Gln
Arg Met 165 170 175 Leu Cys Thr Arg Asp Ser Glu Cys Cys Gly Asp Gln
Leu Cys Val Trp 180 185 190 Gly His Cys Thr Lys Met Ala Thr Arg Gly
Ser Asn Gly Thr Ile Cys 195 200 205 Asp Asn Gln Arg Asp Cys Gln Pro
Gly Leu Cys Cys Ala Phe Gln Arg 210 215 220 Gly Leu Leu Phe Pro Val
Cys Thr Pro Leu Pro Val Glu Gly Glu Leu 225 230 235 240 Cys His Asp
Pro Ala Ser Arg Leu Leu Asp Leu Ile Thr Trp Glu Leu 245 250 255 Glu
Pro Asp Gly Ala Leu Asp Arg Cys Pro Cys Ala Ser Gly Leu Leu 260 265
270 Cys Gln Pro His Ser His Ser Leu Val Tyr Val Cys Lys Pro Thr Phe
275 280 285 Val Gly Ser Arg Asp Gln Asp Gly Glu Ile Leu Leu Pro Arg
Glu Val 290 295 300 Pro Asp Glu Tyr Glu Val Gly Ser Phe Met Glu Glu
Val Arg Gln Glu 305 310 315 320 Leu Glu Asp Leu Glu Arg Ser Leu Thr
Glu Glu Met Ala Leu Gly Glu 325 330 335 Pro Ala Ala Ala Ala Ala Ala
Leu Leu Gly Gly Glu Glu Ile 340 345 350 10 266 PRT Human 10 Met Met
Ala Leu Gly Ala Ala Gly Ala Thr Arg Val Phe Val Ala Met 1 5 10 15
Val Ala Ala Ala Leu Gly Gly His Pro Leu Leu Gly Val Ser Ala Thr 20
25 30 Leu Asn Ser Val Leu Asn Ser Asn Ala Ile Lys Asn Leu Pro Pro
Pro 35 40 45 Leu Gly Gly Ala Ala Gly His Pro Gly Ser Ala Val Ser
Ala Ala Pro 50 55 60 Gly Ile Leu Tyr Pro Gly Gly Asn Lys Tyr Gln
Thr Ile Asp Asn Tyr 65 70 75 80 Gln Pro Tyr Pro Cys Ala Glu Asp Glu
Glu Cys Gly Thr Asp Glu Tyr 85 90 95 Cys Ala Ser Pro Thr Arg Gly
Gly Asp Ala Gly Val Gln Ile Cys Leu 100 105 110 Ala Cys Arg Lys Arg
Arg Lys Arg Cys Met Arg His Ala Met Cys Cys 115 120 125 Pro Gly Asn
Tyr Cys Lys Asn Gly Ile Cys Val Ser Ser Asp Gln Asn 130 135 140 His
Phe Arg Gly Glu Ile Glu Glu Thr Ile Thr Glu Ser Phe Gly Asn 145 150
155 160 Asp His Ser Thr Leu Asp Gly Tyr Ser Arg Arg Thr Thr Leu Ser
Ser 165 170 175 Lys Met Tyr His Thr Lys Gly Gln Glu Gly Ser Val Cys
Leu Arg Ser 180 185 190 Ser Asp Cys Ala Ser Gly Leu Cys Cys Ala Arg
His Phe Trp Ser Lys 195 200 205 Ile Cys Lys Pro Val Leu Lys Glu Gly
Gln Val Cys Thr Lys His Arg 210 215 220 Arg Lys Gly Ser His Gly Leu
Glu Ile Phe Gln Arg Cys Tyr Cys Gly 225 230 235 240 Glu Gly Leu Ser
Cys Arg Ile Gln Lys Asp His His Gln Ala Ser Asn 245 250 255 Ser Ser
Arg Leu His Thr Cys Gln Arg His 260 265 11 259 PRT Mouse 11 Met Ala
Ala Leu Met Arg Val Lys Asp Ser Ser Arg Cys Leu Leu Leu 1 5 10 15
Leu Ala Ala Val Leu Met Val Glu Ser Ser Gln Leu Gly Ser Ser Arg 20
25 30 Ala Lys Leu Asn Ser Ile Lys Ser Ser Leu Gly Gly Glu Thr Pro
Ala 35 40 45 Gln Ser Ala Asn Arg Ser Ala Gly Met Asn Gln Gly Leu
Ala Phe Gly 50 55 60 Gly Ser Lys Lys Gly Lys Ser Leu Gly Gln Ala
Tyr Pro Cys Ser Ser 65 70 75 80 Asp Lys Glu Cys Glu Val Gly Arg Tyr
Cys His Ser Pro His Gln Gly 85 90 95 Ser Ser Ala Cys Met Leu Cys
Arg Arg Lys Lys Lys Arg Cys His Arg 100 105 110 Asp Gly Met Cys Cys
Pro Gly Thr Arg Cys Asn Asn Gly Ile Cys Ile 115 120 125 Pro Val Thr
Glu Ser Ile Leu Thr Pro His Ile Pro Ala Leu Asp Gly 130 135 140 Thr
Arg His Arg Asp Arg Asn His Gly His Tyr Ser Asn His Asp Leu 145 150
155 160 Gly Trp Gln Asn Leu Gly Arg Pro His Ser Lys Met Pro His Ile
Lys 165 170 175 Gly His Glu Gly Asp Pro Cys Leu Arg Ser Ser Asp Cys
Ile Asp Gly 180 185 190 Phe Cys Cys Ala Arg His Phe Trp Thr Lys Ile
Cys Lys Pro Val Leu 195 200 205 His Gln Gly Glu Val Cys Thr Lys Gln
Arg Lys Lys Gly Ser His Gly 210 215 220 Leu Glu Ile Phe Gln Arg Cys
Asp Cys Ala Lys Gly Leu Ser Cys Lys 225 230 235 240 Val Trp Lys Asp
Ala Thr Tyr Ser Ser Lys Ala Arg Leu His Val Cys 245 250 255 Gln Lys
Ile 12 259 PRT Human 12 Met Ala Ala Leu Met Arg Ser Lys Asp Ser Ser
Cys Cys Leu Leu Leu 1 5 10 15 Leu Ala Ala Val Leu Met Val Glu Ser
Ser Gln Ile Gly Ser Ser Arg 20 25 30 Ala Lys Leu Asn Ser Ile Lys
Ser Ser Leu Gly Gly Glu Thr Pro Gly 35 40 45 Gln Ala Ala Asn Arg
Ser Ala Gly Met Tyr Gln Gly Leu Ala Phe Gly 50 55 60 Gly Ser Lys
Lys Gly Lys Asn Leu Gly Gln Ala Tyr Pro Cys Ser Ser 65 70 75 80 Asp
Lys Glu Cys Glu Val Gly Arg Tyr Cys His Ser Pro His Gln Gly 85 90
95 Ser Ser Ala Cys Met Val Cys Arg Arg Lys Lys Lys Arg Cys His Arg
100 105 110 Asp Gly Met Cys Cys Pro Ser Thr Arg Cys Asn Asn Gly Ile
Cys Ile 115 120 125 Pro Val Thr Glu Ser Ile Leu Thr Pro His Ile Pro
Ala Leu Asp Gly 130 135 140 Thr Arg His Arg Asp Arg Asn His Gly His
Tyr Ser Asn His Asp Leu 145 150 155 160 Gly Trp Gln Asn Leu Gly Arg
Pro His Thr Lys Met Ser His Ile Lys 165 170 175 Gly His Glu Gly Asp
Pro Cys Leu Arg Ser Ser Asp Cys Ile Glu Gly 180 185 190 Phe Cys Cys
Ala Arg His Phe Trp Thr Lys Ile Cys Lys Pro Val Leu 195 200 205 His
Gln Gly Glu Val Cys Thr Lys Gln Arg Lys Lys Gly Ser His Gly 210 215
220 Leu Glu Ile Phe
Gln Arg Cys Asp Cys Ala Lys Gly Leu Ser Cys Lys 225 230 235 240 Val
Trp Lys Asp Ala Thr Tyr Ser Ser Lys Ala Arg Leu His Val Cys 245 250
255 Gln Lys Ile 13 207 PRT Human 13 Met Ala Ala Leu Met Arg Ser Lys
Asp Ser Ser Cys Cys Leu Leu Leu 1 5 10 15 Leu Ala Ala Val Leu Met
Val Glu Ser Ser Gln Ile Gly Ser Ser Arg 20 25 30 Ala Lys Leu Asn
Ser Ile Lys Ser Ser Leu Gly Gly Glu Thr Pro Gly 35 40 45 Gln Ala
Ala Asn Arg Ser Ala Gly Met Tyr Gln Gly Leu Ala Phe Gly 50 55 60
Gly Ser Lys Lys Gly Lys Asn Leu Gly Gln Ala Tyr Pro Cys Ser Ser 65
70 75 80 Asp Lys Glu Cys Glu Val Gly Arg Tyr Cys His Ser Pro His
Gln Gly 85 90 95 Ser Ser Ala Cys Met Val Cys Arg Arg Lys Lys Lys
Arg Cys His Arg 100 105 110 Asp Gly Met Cys Cys Pro Ser Thr Arg Cys
Asn Asn Gly His Glu Gly 115 120 125 Asp Pro Cys Leu Arg Ser Ser Asp
Cys Ile Glu Gly Phe Cys Cys Ala 130 135 140 Arg His Phe Trp Thr Lys
Ile Cys Lys Pro Val Leu His Gln Gly Glu 145 150 155 160 Val Cys Thr
Lys Gln Arg Lys Lys Gly Ser His Gly Leu Glu Ile Phe 165 170 175 Gln
Arg Cys Asp Cys Ala Lys Gly Leu Ser Cys Lys Val Trp Lys Asp 180 185
190 Ala Thr Tyr Ser Ser Lys Ala Arg Leu His Val Cys Gln Lys Ile 195
200 205 14 224 PRT Human 14 Met Val Ala Ala Val Leu Leu Gly Leu Ser
Trp Leu Cys Ser Pro Leu 1 5 10 15 Gly Ala Leu Val Leu Asp Phe Asn
Asn Ile Arg Ser Ser Ala Asp Leu 20 25 30 His Gly Ala Arg Lys Gly
Ser Gln Cys Leu Ser Asp Thr Asp Cys Asn 35 40 45 Thr Arg Lys Phe
Cys Leu Gln Pro Arg Asp Glu Lys Pro Phe Cys Ala 50 55 60 Thr Cys
Arg Gly Leu Arg Arg Arg Cys Gln Arg Asp Ala Met Cys Cys 65 70 75 80
Pro Gly Thr Leu Cys Val Asn Asp Val Cys Thr Thr Met Glu Asp Ala 85
90 95 Thr Pro Ile Leu Glu Arg Gln Leu Asp Glu Gln Asp Gly Thr His
Ala 100 105 110 Glu Gly Thr Thr Gly His Pro Val Gln Glu Asn Gln Pro
Lys Arg Lys 115 120 125 Pro Ser Ile Lys Lys Ser Gln Gly Arg Lys Gly
Gln Glu Gly Glu Ser 130 135 140 Cys Leu Arg Thr Phe Asp Cys Gly Pro
Gly Leu Cys Cys Ala Arg His 145 150 155 160 Phe Trp Thr Lys Ile Cys
Lys Pro Val Leu Leu Glu Gly Gln Val Cys 165 170 175 Ser Arg Arg Gly
His Lys Asp Thr Ala Gln Ala Pro Glu Ile Phe Gln 180 185 190 Arg Cys
Asp Cys Gly Pro Gly Leu Leu Cys Arg Ser Gln Leu Thr Ser 195 200 205
Asn Arg Gln His Ala Arg Leu Arg Val Cys Gln Lys Ile Glu Lys Leu 210
215 220 15 33 DNA Artificial Sequence Description of Artificial
Sequence Oligonucleotide primer 15 ggaaggaaaa aagcggccgc aacannnnnn
nnn 33 16 16 DNA Artificial Sequence Description of Artificial
Sequence Oligonucleotide adapter 16 tcgacccacg cgtccg 16 17 12 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide adapter 17 gggtgcgcag gc 12 18 18 DNA Artificial
Sequence Description of Artificial Sequence Oligonucleotide primer
18 actagctcca gtgatctc 18 19 18 DNA Artificial Sequence Description
of Artificial Sequence Oligonucleotide primer 19 cgtcattgtt
ctcgttcc 18 20 23 DNA Artificial Sequence Description of Artificial
Sequence Oligonucleotide primer 20 ccagctgctc tgtggcagcc cag 23 21
29 DNA Artificial Sequence Description of Artificial Sequence
Oligonucleotide primer 21 cccagtcacg acgttgtaaa acgacggcc 29 22 20
DNA Artificial Sequence Description of Artificial Sequence
Oligonucleotide primer 22 aacatgcagc ggctcggggg 20 23 30 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide primer 23 ggtgacacta tagaagagct atgacgtcgc 30 24 22
DNA Artificial Sequence Description of Artificial Sequence
Oligonucleotide primer 24 gtgctgagtg tcttccatca gc 22 25 25 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probes 25 gagatgcagc ggcttggggc caccc 25 26 23 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probes 26 gcctggtcag cccacgccta aag 23 27 30 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probes 27 cctgctgctg gcggcggcgg tccccacggc 30 28 23
DNA Artificial Sequence Description of Artificial Sequence
Oligonucleotide probes 28 gcctggtcag cccacgccta aag 23 29 23 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probes 29 cccggaccct gactctgcag ccg 23 30 25 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probes 30 gaggaaaaat aggcagtgca gcacc 25 31 25 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide primers 31 gccacagtcc ccaccaagga tcatc 25 32 25 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide primers 32 gatgatcctt ggtggggact gtggc 25 33 24 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide primers 33 ctgcaaacca gtgctccatc aggg 24 34 24 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide primers 34 ccctgatgga gcactggttt gcag 24 35 20 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide primer 35 gctataccaa gcatacaatc 20 36 25 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probe 36 gggttgaggg aacacaatct gcaag 25 37 28 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probe 37 gtctgcaatt gatgatgttc ctcaatgg 28 38 24
DNA Artificial Sequence Description of Artificial Sequence
Oligonucleotide probe 38 ccagggccac agtcgcaacg ctgg 24 39 25 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probe 39 ctccctcttg tcccttcctg ccttg 25 40 25 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probe 40 caaggcagga agggacaaga gggag 25 41 24 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probe 41 ccagcgttgc gactgtggcc ctgg 24 42 44 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide primer/adapter 42 gactagttct agatcgcgag cggccgccct
tttttttttt tttt 44 43 6 PRT Human 43 Met His Pro Leu Leu Gly 1 5 44
5 PRT Human 44 Thr Cys Gln Arg His 1 5 45 59 DNA Artificial
Sequence Description of Artificial Sequence Oligonucleotide probe
45 gttctcctca tatgcatcca ttattaggcg taagtgccac cttgaactcg gttctcaat
59 46 38 DNA Artificial Sequence Description of Artificial Sequence
Oligonucleotide probe 46 tacgcactgg atccttagtg tctctgacaa gtgtgaag
38 47 6 PRT Human 47 Met Ser Gln Ile Gly Ser 1 5 48 5 PRT Human 48
Val Cys Gln Lys Ile 1 5 49 56 DNA Artificial Sequence Description
of Artificial Sequence Oligonucleotide probe 49 gttctcctca
tatgtctcaa attggtagtt ctcgtgccaa actcaactcc atcaag 56 50 39 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probe 50 tacgcactgg atccttaaat tttctgacac acatggagt
39 51 6 PRT Mouse 51 Met Ser Gln Leu Gly Ser 1 5 52 5 PRT Mouse 52
Val Cys Gln Lys Ile 1 5 53 59 DNA Artificial Sequence Description
of Artificial Sequence Oligonucleotide probe 53 gttctcctca
tatgtctcaa ttaggtagct ctcgtgctaa actcaactcc atcaagtcc 59 54 39 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probe 54 tacgcactgg atccttagat cttctggcat acatggagt
39 55 6 PRT Human 55 Met Pro Ala Pro Thr Ala 1 5 56 5 PRT Human 56
Gly Gly Glu Glu Ile 1 5 57 54 DNA Artificial Sequence Description
of Artificial Sequence Oligonucleotide probe 57 gttctcctca
tatgcctgct ccaactgcaa cttcggctcc agtcaagccc ggcc 54 58 37 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probe 58 tacgcactcc gcggttaaat ctcttcccct cccagca
37 59 6 PRT Human 59 Met Lys Pro Gly Pro Ala 1 5 60 5 PRT Human 60
Gly Gly Glu Glu Ile 1 5 61 54 DNA Artificial Sequence Description
of Artificial Sequence Oligonucleotide probe 61 gttctcctca
tatgaaacca ggtccagcct taagctaccc gcaggaggag gcca 54 62 37 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probe 62 tacgcactcc gcggttaaat ctcttcccct cccagca
37 63 6 PRT Human 63 Met Gln Glu Glu Ala Thr 1 5 64 5 PRT Human 64
Gly Gly Glu Glu Ile 1 5 65 53 DNA Artificial Sequence Description
of Artificial Sequence Oligonucleotide probe 65 gttctcctca
tatgcaagaa gaagctactc tgaatgagat gttccgcgag gtt 53 66 37 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probe 66 tacgcactcc gcggttaaat ctcttcccct cccagca
37 67 6 PRT Mouse 67 Met Glu Pro Gly Pro Ala 1 5 68 5 PRT Mouse 68
Gly Glu Glu Glu Ile 1 5 69 54 DNA Artificial Sequence Description
of Artificial Sequence Oligonucleotide probe 69 gttctcctca
tatggaacca ggtccagctt taaactaccc tcaggaggaa gcta 54 70 37 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide probe 70 tacgcactcc gcggttaaat ctcctcctct ccgccta
37 71 6 PRT Human 71 Met Leu Val Leu Asp Phe 1 5 72 5 PRT Human 72
Lys Ile Glu Lys Leu 1 5 73 47 DNA Artificial Sequence Description
of Artificial Sequence Oligonucleotide probe 73 gttctcctca
tatgttagtt ttggatttca acaacatcag gagctct 47 74 49 DNA Artificial
Sequence Description of Artificial Sequence Oligonucleotide probe
74 tacgcactgg atccttacag tttttctatt ttttggcata ctcttaatc 49 75 798
DNA Human 75 atgatggctc tgggtgctgc tggtgctacc cgtgttttcg ttgctatggt
tgctgctgct 60 ctgggtggtc acccgctgct gggtgtttcc gctaccctga
actccgttct gaactccaac 120 gctatcaaaa acctgccgcc gccgctgggt
ggtgctgctg gtcacccggg ttccgctgtt 180 tccgctgctc cgggtatcct
gtacccgggt ggtaacaaat accagaccat cgacaactac 240 cagccgtacc
cgtgcgctga agacgaagaa tgcggtaccg acgaatactg cgcttccccg 300
acccgtggtg gtgacgctgg tgttcagatc tgcctggctt gccgtaaacg tcgtaaacgt
360 tgcatgcgtc acgctatgtg ctgcccgggt aactactgca aaaacggtat
ctgcgtttcc 420 tccgaccaga accacttccg tggtgaaatc gaagaaacca
tcaccgaatc cttcggtaac 480 gaccactcca ccctggacgg ttactcccgt
cgtaccaccc tgtcctccaa aatgtaccac 540 accaaaggtc aggaaggttc
cgtttgcctg cgttcctccg actgcgcttc cggtctgtgc 600 tgcgctcgtc
acttctggtc caaaatctgc aaaccggttc tgaaagaagg tcaggtttgc 660
accaaacacc gtcgtaaagg ttcccacggt ctggaaatct tccagcgttg ctactgcggt
720 gaaggtctgt cctgccgtat ccagaaagac caccaccagg cttccaactc
ctcccgtctg 780 cacacctgcc agcgtcac 798 76 777 DNA Human 76
atggctgctc tgatgcgttc caaagactcc tcctgctgcc tgctgctgct ggctgctgtt
60 ctgatggttg aatcctccca gatcggttcc tcccgtgcta aactgaactc
catcaaatcc 120 tccctgggtg gtgaaacccc gggtcaggct gctaaccgtt
ccgctggtat gtaccagggt 180 ctggctttcg gtggttccaa aaaaggtaaa
aacctgggtc aggcttaccc gtgctcctcc 240 gacaaagaat gcgaagttgg
tcgttactgc cactccccgc accagggttc ctccgcttgc 300 atggtttgcc
gtcgtaaaaa aaaacgttgc caccgtgacg gtatgtgctg cccgtccacc 360
cgttgcaaca acggtatctg catcccggtt accgaatcca tcctgacccc gcacatcccg
420 gctctggacg gtacccgtca ccgtgaccgt aaccacggtc actactccaa
ccacgacctg 480 ggttggcaga acctgggtcg tccgcacacc aaaatgtccc
acatcaaagg tcacgaaggt 540 gacccgtgcc tgcgttcctc cgactgcatc
gaaggtttct gctgcgctcg tcacttctgg 600 accaaaatct gcaaaccggt
tctgcaccag ggtgaagttt gcaccaaaca gcgtaaaaaa 660 ggttcccacg
gtctggaaat cttccagcgt tgcgactgcg ctaaaggtct gtcctgcaaa 720
gtttggaaag acgctaccta ctcctccaaa gctcgtctgc acgtttgcca gaaaatc 777
77 1050 DNA Human 77 atgcagcgtc tgggtgctac cctgctgtgc ctgctgctgg
ctgctgctgt tccgaccgct 60 ccggctccgg ctccgaccgc tacctccgct
ccggttaaac cgggtccggc tctgtcctac 120 ccgcaggaag aagctaccct
gaacgaaatg ttccgtgaag ttgaagaact gatggaagac 180 acccagcaca
aactgcgttc cgctgttgaa gaaatggaag ctgaagaagc tgctgctaaa 240
gcttcctccg aagttaacct ggctaacctg ccgccgtcct accacaacga aaccaacacc
300 gacaccaaag ttggtaacaa caccatccac gttcaccgtg aaatccacaa
aatcaccaac 360 aaccagaccg gtcagatggt tttctccgaa accgttatca
cctccgttgg tgacgaagaa 420 ggtcgtcgtt cccacgaatg catcatcgac
gaagactgcg gtccgtccat gtactgccag 480 ttcgcttcct tccagtacac
ctgccagccg tgccgtggtc agcgtatgct gtgcacccgt 540 gactccgaat
gctgcggtga ccagctgtgc gtttggggtc actgcaccaa aatggctacc 600
cgtggttcca acggtaccat ctgcgacaac cagcgtgact gccagccggg tctgtgctgc
660 gctttccagc gtggtctgct gttcccggtt tgcaccccgc tgccggttga
aggtgaactg 720 tgccacgacc cggcttcccg tctgctggac ctgatcacct
gggaactgga accggacggt 780 gctctggacc gttgcccgtg cgcttccggt
ctgctgtgcc agccgcactc ccactccctg 840 gtttacgttt gcaaaccgac
cttcgttggt tcccgtgacc aggacggtga aatcctgctg 900 ccgcgtgaag
ttccggacga atacgaagtt ggttccttca tggaagaagt tcgtcaggaa 960
ctggaagacc tggaacgttc cctgaccgaa gaaatggctc tgggtgaacc ggctgctgct
1020 gctgctgctc tgctgggtgg tgaagaaatc 1050 78 672 DNA Human 78
atggttgctg ctgttctgct gggtctgtcc tggctgtgct ccccgctggg tgctctggtt
60 ctggacttca acaacatccg ttcctccgct gacctgcacg gtgctcgtaa
aggttcccag 120 tgcctgtccg acaccgactg caacacccgt aaattctgcc
tgcagccgcg tgacgaaaaa 180 ccgttctgcg ctacctgccg tggtctgcgt
cgtcgttgcc agcgtgacgc tatgtgctgc 240 ccgggtaccc tgtgcgttaa
cgacgtttgc accaccatgg aagacgctac cccgatcctg 300 gaacgtcagc
tggacgaaca ggacggtacc cacgctgaag gtaccaccgg tcacccggtt 360
caggaaaacc agccgaaacg taaaccgtcc atcaaaaaat cccagggtcg taaaggtcag
420 gaaggtgaat cctgcctgcg taccttcgac tgcggtccgg gtctgtgctg
cgctcgtcac 480 ttctggacca aaatctgcaa accggttctg ctggaaggtc
aggtttgctc ccgtcgtggt 540 cacaaagaca ccgctcaggc tccggaaatc
ttccagcgtt gcgactgcgg tccgggtctg 600 ctgtgccgtt cccagctgac
ctccaaccgt cagcacgctc gtctgcgtgt ttgccagaaa 660 atcgaaaaac tg
672
* * * * *