U.S. patent application number 11/848047 was filed with the patent office on 2008-03-06 for human vascular ibp-like growth factor.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Gregg A. Hastings, Craig A. Rosen.
Application Number | 20080057510 11/848047 |
Document ID | / |
Family ID | 23843534 |
Filed Date | 2008-03-06 |
United States Patent
Application |
20080057510 |
Kind Code |
A1 |
Hastings; Gregg A. ; et
al. |
March 6, 2008 |
Human Vascular IBP-Like Growth Factor
Abstract
A human Vascular IBP-Like Growth Factor polypeptide (VIGF) and
DNA (RNA) encoding such polypeptide and a procedure for producing
such polypeptide by recombinant techniques is disclosed. Also
disclosed are methods for utilizing such polypeptide for wound
healing or tissue regeneration, stimulating implant fixation and
angiogenesis. Antagonist against such polypeptides and their use as
a therapeutic to treat atherosclerosis, tumors and scarring are
also disclosed. Diagnostic assays for identifying mutations in VIGF
nucleic acid sequences and altered levels of the VIGF polypeptide
are also disclosed.
Inventors: |
Hastings; Gregg A.;
(Westlake Village, CA) ; Rosen; Craig A.;
(Laytonsville, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC.;INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
23843534 |
Appl. No.: |
11/848047 |
Filed: |
August 30, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10951866 |
Sep 29, 2004 |
|
|
|
11848047 |
Aug 30, 2007 |
|
|
|
09037460 |
Mar 10, 1998 |
|
|
|
10951866 |
Sep 29, 2004 |
|
|
|
08464339 |
Jun 5, 1995 |
5747280 |
|
|
09037460 |
Mar 10, 1998 |
|
|
|
PCT/US94/14388 |
Dec 9, 1994 |
|
|
|
08464339 |
Jun 5, 1995 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/320.1; 435/325; 435/455; 435/69.1; 435/7.1; 506/9; 514/44R;
514/7.6; 514/8.2; 514/8.5; 514/8.9; 514/9.6; 530/350; 530/387.9;
536/23.1 |
Current CPC
Class: |
A61P 43/00 20180101;
G01N 2500/00 20130101; G01N 33/6893 20130101; C07K 14/65 20130101;
A61K 48/00 20130101; G01N 2333/475 20130101; A61K 38/00 20130101;
C12N 2799/026 20130101; G01N 33/74 20130101; C07K 14/475
20130101 |
Class at
Publication: |
435/006 ;
435/320.1; 435/325; 435/455; 435/069.1; 435/007.1; 506/009;
514/012; 514/044; 530/350; 530/387.9; 536/023.1 |
International
Class: |
A61K 31/70 20060101
A61K031/70; A61K 38/00 20060101 A61K038/00; A61P 43/00 20060101
A61P043/00; C07K 14/00 20060101 C07K014/00; C12N 15/00 20060101
C12N015/00; C12N 15/11 20060101 C12N015/11; C12N 15/87 20060101
C12N015/87; C12N 5/06 20060101 C12N005/06; C12P 21/04 20060101
C12P021/04; C12Q 1/68 20060101 C12Q001/68; C40B 30/04 20060101
C40B030/04; G01N 33/53 20060101 G01N033/53 |
Claims
1. An isolated polynucleotide comprising a member selected from the
group consisting of: (a) a polynucleotide encoding the polypeptide
as set forth in SEQ ID NO:2; (b) a polynucleotide encoding the
polypeptide comprising amino acid 1 to amino acid 163 as set forth
in SEQ ID NO:2 (c) a polynucleotide capable of hybridizing to and
which is at least 70% identical to the polynucleotide of (a) or
(b); and (d) a polynucleotide fragment of the polynucleotide of
(a), (b) or (c).
2. The polynucleotide of claim 1 wherein the polynucleotide is
DNA.
3. The polynucleotide of claim 2 which encodes the polypeptide as
set forth in SEQ ID NO:2.
4. The polynucleotide of claim 2 which encodes the polypeptide
comprising amino acid-21 to amino acid 163 as set forth in SEQ ID
NO:2.
5. The polynucleotide of claim 2 which encodes the polypeptide
comprising amino acid 1 to amino acid 163 as set forth in SEQ ID
NO:2.
6. An isolated polynucleotide comprising a member selected from the
group consisting of: (a) a polynucleotide which encodes a mature
polypeptide encoded by the DNA contained in ATCC.TM. Deposit No.
75874; (b) a polynucleotide which encodes a polypeptide expressed
by the DNA contained in ATCC.TM. Deposit No. 75874; (c) a
polynucleotide capable of hybridizing to and which is at least 70%
identical to the polynucleotide of (a) or (b); and (c) a
polynucleotide fragment of the polynucleotide of (a), (b) or
(c).
7. A vector containing the DNA of claim 2.
8. A host cell genetically engineered with the vector of claim
7.
9. A process for producing a polypeptide comprising: expressing
from the host cell of claim 8 the polypeptide encoded by said
DNA.
10. A process for producing cells capable of expressing a
polypeptide comprising transforming or transfecting the cells with
the vector of claim 7.
11. A polypeptide selected from the group consisting of (i) a
polypeptide having the deduced amino acid sequence of SEQ ID NO:2
and fragments, analogs and derivatives thereof; (ii) a polypeptide
comprising amino acid 1 to amino acid 262 of SEQ ID NO:2; and (iii)
a polypeptide encoded by the cDNA of ATCC.TM. Deposit No. 75874 and
fragments, analogs and derivatives of said polypeptide.
12. A compound effective as an agonist for the polypeptide of claim
11.
13. A compound effective as an antagonist against the polypeptide
of claim 11.
14. A method for the treatment of a patient having need of PGSG-1
comprising: administering to the patient a therapeutically
effective amount of the polypeptide of claim 11.
15. The method of claim 14 wherein said therapeutically effective
amount of the polypeptide is administered by providing to the
patient DNA encoding said polypeptide and expressing said
polypeptide in vivo.
16. A method for the treatment of a patient having need of VIGF
comprising: administering to the patient a therapeutically
effective amount of the compound of claim 12.
17. A method for the treatment of a patient having need to inhibit
VIGF comprising: administering to the patient a therapeutically
effective amount of the antagonist of claim 13.
18. A process for diagnosing a disease or a susceptibility to a
disease related to expression of the polypeptide of claim 11
comprising: determining a mutation in the nucleic acid sequence
encoding said polypeptide.
19. A diagnostic process comprising: analyzing for the presence of
the polypeptide of claim 11 in a sample derived from a host.
20. A method for identifying compounds which bind to and activate
or inhibit a receptor for the polypeptide of claim 11 comprising:
contacting a cell expressing on the surface thereof a receptor for
the polypeptide, said receptor being associated with a second
component capable of providing a detectable signal in response to
the binding of a compound to said receptor, with a compound to be
screened under conditions to permit binding to the receptor; and
determining whether the compound binds to and activates or inhibits
the receptor by detecting the presence or absence of a signal
generated from the interaction of the compound with the
receptor.
21. An isolated antibody or fragment thereof that specifically
binds to the polypeptide of claim 11.
Description
[0001] This application is a continuation of U.S. application Ser.
No. 10/951,866, filed Sep. 29, 2004, which is a continuation of
U.S. application Ser. No. 09/037,460, filed Mar. 10, 1998, which is
a divisional of U.S. application Ser. No. 08/464,339, filed Jun. 5,
1995 (now U.S. Pat. No. 5,747,280, issued May 5, 1998), which is a
continuation-in-part of International Application No.
PCT/US94/14388, filed Dec. 9, 1994.
STATEMENT UNDER 37 C.F.R. .sctn. 1.77(B)(5)
[0002] This application refers to a "Sequence Listing" listed
below, which is provided as a text document. The document is
entitled "PF147D1C2_ST25.txt" (9,344 bytes created Aug. 30, 2007),
and is hereby incorporated by reference herein in its entirety.
[0003] This invention relates to newly identified polynucleotides,
polypeptides encoded by such polynucleotides, the use of such
polynucleotides and polypeptides, as well as the production of such
polynucleotides and polypeptides. The invention also relates to
inhibiting the action of such polypeptides.
[0004] The polypeptide of the present invention is related to a
family of growth regulators comprising cef 10/cyr 61, connective
tissue growth factor (CTGF), and nov, as well as the insulin-like
growth factor binding protein (IBP) family which modulates the
activity of insulin-like growth factor (IGF). The mRNA
corresponding to the polypeptide of this invention is highly
expressed in vascular cell-types, thus, this polypeptide is
hereinafter referred to as human vascular IBP-like growth factor or
"VIGF".
[0005] Growth factors and other mitogens, including transforming
oncogenes, are capable of rapidly inducing a complex set of genes
to be expressed by certain cells (Lau, L. F. and Nathans, D.,
Molecular Aspects of Cellular Regulation, 6:165-202 (1991). These
genes, which have been named immediate early or early response
genes, are transcriptionally activated within minutes after contact
with a growth factor or mitogen, independent of de novo protein
synthesis. A group of these immediate early genes encodes secreted,
extracellular proteins which are needed for coordination of complex
biological processes such as differentiation and proliferation,
regeneration and wound healing (Ryseck, R. P. et al, Cell Growth
Differ., 2:235-233 (1991).
[0006] Highly related proteins which belong to this group include
cef 10 from chicken, which was detected after induction by the
viral oncogene pp60.sup.v-src (Simmons, D. L. et al, PNAS, U.S.A.,
86:1178-1182 (1989). A closely related protein, cyr 61, is rapidly
activated by serum or platelet-derived growth factor (PDGF)
(O'Brien, T. P. et al, Mol. Cell. Biol., 10:3569-3577 (1990). The
overall amino acid identity between cef 10 and cyr 61 is as high as
83%. A third member is human connective tissue growth factor (CTGF)
(Bradham, D. M. et al., J. Cell. Biol., 114:1285-1294 (1991). CTGF
is a cysteine-rich peptide which is secreted by human vascular
endothelial cells in high levels after activation with transforming
growth factor beta (TGF-.beta.). CTGF exhibits PDGF-like biological
and immunological activities and competes with PDGF for a
particular cell surface receptor.
[0007] A fourth member of the immediate-early proteins is fisp-12,
which has been shown to be induced by serum and has been mapped to
a region of the murine genome (Ryseck, R. P. et al., Cell Growth
Differ., 2:235-233 (1991). Yet another member of this family is the
chicken gene, nov, normally arrested in adult kidney cells, which
was found to be overexpressed in myeloblastosis-associated virus
type 1 induced nephroblastomas. Further, expression of an
amino-terminal-truncated nov product in chicken embryo fibroblasts
was sufficient to induce transformation (Joliot, V. et al., Mol.
Cell. Biol., 12:10-21 (1992).
[0008] The expression of these immediate early genes act as "third
messengers" in the cascade of events triggered by growth factors.
It is also thought that they are needed to integrate and coordinate
complex biological processes, such as differentiation and wound
healing in which cell proliferation is a common event.
[0009] This emerging family of growth regulators is called the CCN
family for CTGF; cef 10/cyr 61; and nov. The VIGF polypeptide of
the present invention is thought to be a member of this family of
growth regulators. The VIGF polypeptide also contains a stretch of
cysteines which is highly homologous to insulin-like growth factor
(IGF)-binding protein.
[0010] At least two different binding proteins have been identified
in adult human serum, namely, IGF-binding protein 53 and
IGF-binding protein 1. The IGF-binding proteins have both
stimulatory and inhibitory effects on IGF. Clemmons, et al, J.
Clin. Invest., 77:1548 (1986) showed increased binding to
fibroblast and smooth muscle cell surface receptors of IGF in
complex with its binding protein. The inhibitory effects of
IGF-binding protein on various IGF actions in vitro, have been
shown and they include stimulation of glucose transport by
adipocytes, sulfate incorporation by chondrocytes and thymidine
incorporation in fibroblast (Zapf, et al., J. Clin. Invest.,
63:1077 (1979)). In addition, inhibitory effects of IGF-binding
proteins on growth factor mediated mitogen activity in normal cells
has been shown.
[0011] In accordance with one aspect of the present invention,
there is provided a novel mature polypeptide which is VIGF, as well
as biologically active and diagnostically or therapeutically useful
fragments, analogs and derivatives thereof.
[0012] In accordance with another aspect of the present invention,
there are provided isolated nucleic acid molecules encoding human
VIGF, including mRNAs, DNAs, cDNAs, genomic DNAs as well as analogs
and biologically active and diagnostically or therapeutically
useful fragments and derivatives thereof.
[0013] In accordance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptide by recombinant techniques comprising culturing
recombinant prokaryotic and/or eukaryotic host cells, containing a
human VIGF nucleic acid sequence, under conditions promoting
expression of said protein and subsequent recovery of said
protein.
[0014] In accordance with yet a further aspect of the present
invention, there is provided a process of utilizing such
polypeptide, or polynucleotide encoding such polypeptide for
therapeutic purposes, for example, to treat muscle wasting
diseases, osteoporosis, to aid in implant fixation, to stimulate
wound healing or tissue regeneration, to promote angiogenesis and
to proliferate vascular smooth muscle and endothelial cell
production.
[0015] In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptides.
[0016] In accordance with yet another aspect of the present
invention, there are provided antagonists to such polypeptides,
which may be used to inhibit the action of such polypeptides, for
example, to limit the production of excess connective tissue during
wound healing or pulmonary fibrosis.
[0017] In accordance with yet a further aspect of the present
invention, there are also provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to VIGF sequences.
[0018] In accordance with still another aspect of the present
invention, there are provided diagnostic assays for detecting
diseases related to the under-expression and over-expression of the
VIGF polypeptide and mutations in the nucleic acid sequences
encoding such polypeptide.
[0019] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
[0020] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIGS. 1A, 1B, 1C, 1D and 1E, collectively, illustrate the
cDNA (SEQ ID NO:1) and corresponding deduced amino acid sequence
(SEQ ID NO:2) of the VIGF polypeptide. The initial 21 amino acids
represent the putative leader sequence such that the mature
polypeptide comprises 163 amino acids. The standard one letter
abbreviations for amino acids are used. Sequencing was performed
using a 373 Automated DNA sequencer (Applied Biosystems, Inc.).
Sequencing accuracy is predicted to be greater than 97%
accurate.
[0022] FIG. 2 shows the amino acid sequence homology between VIGF
and other proteins which are members of the CCN family. FIG. 2,
contains seven (7) comparative polypeptide sequences: ce10_chick
(SEQ ID NO:11), cyr6_mouse (SEQ ID NO:12), ctgf_human (SEQ ID
NO:13), fisp.sub.--12 (SEQ ID NO:14, nov_chick (SEQ ID NO:15),
ibp.sub.--3human (SEQ ID NO:16) and ccn-4 (SEQ ID NO:17). The
comparative polypeptide sequences are designated by one-letter
amino acid codes.
[0023] In accordance with an aspect of the present invention, there
is provided an isolated nucleic acid (polynucleotide) which encodes
for the mature polypeptide having the deduced amino acid sequence
of FIGS. 1A, 1B, 1C, 1D and 1E, collectively, (SEQ ID NO:2) or for
the mature polypeptide encoded by the cDNA of the clone deposited
as ATCC.TM. Deposit No. 75874 on Aug. 25, 1994.
[0024] The ATCC.TM. number referred to above is directed to a
biological deposit with the ATCC.TM., American Type Culture
Collection, 10801 University Boulevard, Manassas, Va. 20110-2209.
The strain is being maintained under the terms of the Budapest
Treaty and will be made available to a patent office signatory to
the Budapest Treaty.
[0025] A polynucleotide encoding a polypeptide of the present
invention may be obtained from human umbilical vein and aortic
endothelial cells, aortic smooth muscle cells, and pulmonary
artery. The polynucleotide of this invention was discovered in a
cDNA library derived from human umbilical vein endothelial cells.
It is structurally related to the IBP and CCN families. It contains
an open reading frame encoding a protein of 184 amino acid residues
of which approximately the first 21 amino acids residues are the
putative leader sequence such that the mature protein comprises 163
amino acids.
[0026] The designation of VIGF as a hybrid member of both the CCN
growth factor and IBP families was based primarily through
conservation of amino acid sequences. Similarity of VIGF to the CCN
family is inferred because of the 40-45% similarity over the entire
polypeptide, 12 of a total of 18 VIGF cysteines are conserved, and
94% identity with the IBP signature (GCGCCXXCAXXXXXXC) which is
perfectly conserved in every member of the CCN family.
[0027] The VIGF polypeptide also has significant similarity to the
IBP family. In two adjacent regions, amino acids 30-44 (IBP
signature) and 55-69, there is at least 80% identity to the IBP
family. These regions are contained within the putative IGF binding
domain of the IBPs. The human tissue and cell-type specific
expression has been determined by Northern blot analysis. The
2.3-2.4 kb VIGF mRNA is localized in the adult lung and kidney as
shown using the procedure of Example 4. VIGF gene expression was
undetectable in heart, brain, placenta, liver, skeletal muscle, and
pancreas. Cultured human umbilical vein endothelial and aortic
smooth muscle cells are cell-types which express VIGF mRNA at a
high level while dermal foreskin fibroblasts show a very low level.
Together, these results indicate that VIGF is primarily of vascular
origin.
[0028] The polynucleotide of the present invention may be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA may be double-stranded or
single-stranded, and if single stranded may be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the mature polypeptide may be identical to the coding sequence
shown in FIGS. 1A, 1B, 1C, 1D and 1E, collectively, (SEQ ID NO:1)
or that of the deposited clone or may be a different coding
sequence which coding sequence, as a result of the redundancy or
degeneracy of the genetic code, encodes the same mature polypeptide
as the DNA of FIGS. 1A, 1B, 1C, 1D and 1E, collectively, (SEQ ID
NO:1) or the deposited cDNA.
[0029] The polynucleotide which encodes for the mature polypeptide
of FIGS. 1A, 1B, 1C, 1D and 1E, collectively, (SEQ ID NO:2) or for
the mature polypeptide encoded by the deposited cDNA may include:
only the coding sequence for the mature polypeptide; the coding
sequence for the mature polypeptide and additional coding sequence
such as a leader or secretory sequence or a proprotein sequence;
the coding sequence for the mature polypeptide (and optionally
additional coding sequence) and non-coding sequence, such as
introns or non-coding sequence 5' and/or 3' of the coding sequence
for the mature polypeptide.
[0030] Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequence.
[0031] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIGS. 1A, 1B, 1C, 1D and 1E, collectively, (SEQ ID
NO:2) or the polypeptide encoded by the cDNA of the deposited
clone. The variant of the polynucleotide may be a naturally
occurring allelic variant of the polynucleotide or a non-naturally
occurring variant of the polynucleotide.
[0032] Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIGS. 1A, 1B, 1C,
1D and 1E, collectively, (SEQ ID NO:2) or the same mature
polypeptide encoded by the cDNA of the deposited clone as well as
variants of such polynucleotides which variants encode for a
fragment, derivative or analog of the polypeptide of FIGS. 1A, 1B,
1C, 1D and 1E, collectively, (SEQ ID NO:2) or the polypeptide
encoded by the cDNA of the deposited clone. Such nucleotide
variants include deletion variants, substitution variants and
addition or insertion variants.
[0033] As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic variant of
the coding sequence shown in FIGS. 1A, 1B, 1C, 1D and 1E,
collectively, (SEQ ID NO:1) or of the coding sequence of the
deposited clone. As known in the art, an allelic variant is an
alternate form of a polynucleotide sequence which may have a
substitution, deletion or addition of one or more nucleotides,
which does not substantially alter the function of the encoded
polypeptide.
[0034] The present invention also includes polynucleotides, wherein
the coding sequence for the mature polypeptide may be fused in the
same reading frame to a polynucleotide sequence which aids in
expression and secretion of a polypeptide from a host cell, for
example, a leader sequence which functions as a secretory sequence
for controlling transport of a polypeptide from the cell. The
polypeptide having a leader sequence is a preprotein and may have
the leader sequence cleaved by the host cell to form the mature
form of the polypeptide. The polynucleotides may also encode for a
proprotein which is the mature protein plus additional 5' amino
acid residues. A mature protein having a prosequence is a
proprotein and is an inactive form of the protein. Once the
prosequence is cleaved an active mature protein remains.
[0035] Thus, for example, the polynucleotide of the present
invention may encode for a mature protein, or for a protein having
a prosequence or for a protein having both a prosequence and a
presequence (leader sequence).
[0036] The polynucleotides of the present invention may also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptide of the present
invention. The marker sequence may be a hexa-histidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial host,
or, for example, the marker sequence may be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell, 37:767 (1984)).
[0037] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0038] Fragments of the full length gene of the present invention
may be used as a hybridization probe for a cDNA library to isolate
the full length cDNA and to isolate other cDNAs which have a high
sequence similarity to the gene or similar biological activity.
Probes of this type preferably have at least 30 bases and may
contain, for example, 50 or more bases. The probe may also be used
to identify a cDNA clone corresponding to a full length transcript
and a genomic clone or clones that contain the complete gene
including regulatory and promotor regions, exons, and introns. An
example of a screen comprises isolating the coding region of the
gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention are used
to screen a library of human cDNA, genomic DNA or mRNA to determine
which members of the library the probe hybridizes to.
[0039] The present invention further relates to polynucleotides
which hybridize to the hereinabove-described sequences if there is
at least 70%, preferably at least 90%, and more preferably at least
95% identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization
will occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides which
hybridize to the hereinabove described polynucleotides in a
preferred embodiment encode polypeptides which either retain
substantially the same biological function or activity as the
mature polypeptide encoded by the cDNAs of FIGS. 1A, 1B, 1C, 1D and
1E, collectively, (SEQ ID NO:1) or the deposited cDNA(s).
[0040] Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50 bases
which hybridize to a polynucleotide of the present invention and
which has an identity thereto, as hereinabove described, and which
may or may not retain activity. For example, such polynucleotides
may be employed as probes for the polynucleotide of SEQ ID NO:1,
for example, for recovery of the polynucleotide or as a diagnostic
probe or as a PCR primer.
[0041] Thus, the present invention is directed to polynucleotides
having at least a 70% identity, preferably at least 90% and more
preferably at least a 95% identity to a polynucleotide which
encodes the polypeptide of SEQ ID NO:2 as well as fragments
thereof, which fragments have at least 30 bases and preferably at
least 50 bases and to polypeptides encoded by such
polynucleotides.
[0042] The deposit(s) referred to herein will be maintained under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Micro-organisms for purposes of Patent Procedure.
These deposits are provided merely as convenience to those of skill
in the art and are not an admission that a deposit is required
under 35 U.S.C. .sctn.112. The sequence of the polynucleotides
contained in the deposited materials, as well as the amino acid
sequence of the polypeptides encoded thereby, are incorporated
herein by reference and are controlling in the event of any
conflict with any description of sequences herein. A license may be
required to make, use or sell the deposited materials, and no such
license is hereby granted.
[0043] The present invention further relates to a VIGF polypeptide
which has the deduced amino acid sequence of FIGS. 1A, 1B, 1C, 1D
and 1E, collectively, (SEQ ID NO:2) or which has the amino acid
sequence encoded by the deposited cDNA, as well as fragments,
analogs and derivatives of such polypeptide.
[0044] The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of FIGS. 1A, 1B, 1C, 1D and 1E,
collectively, (SEQ ID NO:2) or that encoded by the deposited cDNA,
means a polypeptide which retains essentially the same biological
function or activity as such polypeptide. Thus, an analog includes
a proprotein which can be activated by cleavage of the proprotein
portion to produce an active mature polypeptide.
[0045] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0046] The fragment, derivative or analog of the polypeptide of
FIGS. 1A, 1B, 1C, 1D and 1E, collectively, (SEQ ID NO:2) or that
encoded by the deposited cDNA may be (i) one in which one or more
of the amino acid residues are substituted with a conserved or
non-conserved amino acid residue (preferably a conserved amino acid
residue) and such substituted amino acid residue may or may not be
one encoded by the genetic code, or (ii) one in which one or more
of the amino acid residues includes a substituent group, or (iii)
one in which the mature polypeptide is fused with another compound,
such as a compound to increase the half-life of the polypeptide
(for example, polyethylene glycol), or (iv) one in which the
additional amino acids are fused to the mature polypeptide, such as
a leader or secretory sequence or a sequence which is employed for
purification of the mature polypeptide or a proprotein sequence.
Such fragments, derivatives and analogs are deemed to be within the
scope of those skilled in the art from the teachings herein.
[0047] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0048] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or polypeptide, separated
from some or all of the coexisting materials in the natural system,
is isolated. Such polynucleotides could be part of a vector and/or
such polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
[0049] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature polypeptide)
as well as polypeptides which have at least 70% similarity
(preferably at least 70% identity) to the polypeptide of SEQ ID
NO:2 and more preferably at least 90% similarity (more preferably
at least 90% identity) to the polypeptide of SEQ ID NO:2 and still
more preferably at least 95% similarity (still more preferably at
least 95% identity) to the polypeptide of SEQ ID NO:2 and also
include portions of such polypeptides with such portion of the
polypeptide generally containing at least 30 amino acids and more
preferably at least 50 amino acids.
[0050] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0051] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0052] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0053] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the
VIGF genes. The culture conditions, such as temperature, pH and the
like, are those previously used with the host cell selected for
expression, and will be apparent to the ordinarily skilled
artisan.
[0054] The polynucleotides of the present invention may be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
[0055] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0056] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter, the E.
coli. lac or trp, the phage lambda P.sub.L promoter and other
promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0057] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0058] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate host
to permit the host to express the protein.
[0059] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila S2 and Spodoptera Sf9; adenoviruses; animal
cells such as CHO, COS or Bowes melanoma; adenoviruses; plant
cells, etc. The selection of an appropriate host is deemed to be
within the scope of those skilled in the art from the teachings
herein.
[0060] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10,
phagescript, psiX174, pbluescript SK, pBSKS, pNH8A, pNH16a, pNH18A,
pNH46A (Stratagene); pTRC99a, pKK223-3, pKK233-3, pDR540, pRIT5
(Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
[0061] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are PKK232-8 and PCM7.
Particular named bacterial promoters include lacI, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0062] In a further embodiment, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
[0063] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0064] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
[0065] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples including the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0066] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), .alpha.-factor, acid phosphatase, or heat shock
proteins, among others. The heterologous structural sequence is
assembled in appropriate phase with translation initiation and
termination sequences, and preferably, a leader sequence capable of
directing secretion of translated protein into the periplasmic
space or extracellular medium. Optionally, the heterologous
sequence can encode a fusion protein including an N-terminal
identification peptide imparting desired characteristics, e.g.,
stabilization or simplified purification of expressed recombinant
product.
[0067] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
[0068] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC.TM. 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0069] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0070] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0071] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well know to those skilled in the art.
[0072] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
[0073] The VIGF polypeptides can be recovered and purified from
recombinant cell cultures by methods including ammonium sulfate or
ethanol precipitation, acid extraction, anion or cation exchange
chromatography, phosphocellulose chromatography, hydrophobic
interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Protein
refolding steps can be used, as necessary, in completing
configuration of the mature protein. Finally, high performance
liquid chromatography (HPLC) can be employed for final purification
steps.
[0074] The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
[0075] This VIGF polypeptide of the present invention may be
employed in wound-healing and associated therapies concerned with
re-growth of tissue, such as connective tissue, skin, bone,
cartilage, muscle, lung or kidney.
[0076] VIGF polypeptide may also be employed to enhance the growth
of vascular smooth muscle and endothelial cells leading to the
stimulation of angiogenesis. The VIGF-mediated increase in
angiogenesis would be beneficial to ischemic tissues and to
collateral coronary development in the heart subsequent to coronary
stenosis.
[0077] VIGF polypeptide may also be employed during implant
fixation to stimulate the growth of cells around the implant and
therefore, facilitate its attachment to its intended site.
[0078] VIGF polypeptide may also be employed to increase IGF
stability in tissues or in serum. It may also increase binding to
the IGF receptor. Since IGF has been shown in vitro to enhance
human marrow erythroid and granulocytic progenitor cell growth,
VIGF polypeptide may also be employed to stimulate erythropoiesis
or granulopoiesis.
[0079] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides, as a
research reagent for in vitro purposes related to scientific
research, synthesis of DNA and manufacture of DNA vectors, for the
purpose of developing therapeutics and diagnostics for the
treatment of human disease.
[0080] This invention provides a method for identification of the
receptor for VIGF. The gene encoding the receptor can be identified
by numerous methods known to those of skill in the art, for
example, ligand panning and FACS sorting (Coligan, et al., Current
Protocols in Immun., 1(2), Chapter 5, (1991)). Preferably,
expression cloning is employed wherein polyadenylated RNA is
prepared from a cell responsive to VIGF, and a cDNA library created
from this RNA is divided into pools and used to transfect COS cells
or other cells that are not responsive to VIGF. Transfected cells
which are grown on glass slides are exposed to labeled VIGF. VIGF
can be labeled by a variety of means including iodination or
inclusion of a recognition site for a site-specific protein kinase.
Following fixation and incubation, the slides are subjected to
autoradiographic analysis. Positive pools are identified and
sub-pools are prepared and retransfected using an iterative
sub-pooling and rescreening process, eventually yielding a single
clone that encodes the putative receptor.
[0081] As an alternative approach for receptor identification,
labeled VIGF can be photoaffinity linked with cell membrane or
extract preparations that express the receptor molecule.
Cross-linked material is resolved by PAGE and exposed to X-ray
film. The labeled complex containing the VIGF-receptor can be
excised, resolved into peptide fragments, and subjected to protein
microsequencing. The amino acid sequence obtained from
microsequencing would be used to design a set of degenerate
oligonucleotide probes to screen a cDNA library to identify the
gene encoding the putative receptor.
[0082] This invention is also related to a method of screening
compounds to identify those which mimic VIGF (agonists) or prevent
the effect of VIGF. An example of such a method takes advantage of
the ability of VIGF to stimulate the proliferation of endothelial
cells in the presence of the comitogen Con A. Human umbilical vein
endothelial cells are obtained and cultured in 96-well
flat-bottomed culture plates (Costar, Cambridge, Mass.) and
supplemented with a reaction mixture appropriate for facilitating
proliferation of the cells, the mixture containing Con-A
(Calbiochem, La Jolla, Calif.). Con-A and the compound to be
screened are added and after incubation at 37.degree. C., cultures
are pulsed with .sup.3[H]thymidine and harvested onto glass fiber
filters (PhD; Cambridge Technology, Watertown, Mass.). Mean
.sup.3[H]-thymidine incorporation (cpm) of triplicate cultures is
determined using a liquid scintillation counter (Beckman
Instruments, Irvine, Calif.). Significant .sup.3[H]-thymidine
incorporation indicates stimulation of endothelial cell
proliferation.
[0083] To assay for antagonists, the assay described above is
performed, however, in this assay VIGF is added along with the
compound to be screened and the ability of the compound to inhibit
.sup.3[H]-thymidine incorporation in the presence of VIGF,
indicates that the compound is an antagonist to VIGF.
Alternatively, VIGF antagonists may be detected by combining VIGF
and a potential antagonist with membrane-bound VIGF receptors or
recombinant receptors under appropriate conditions for a
competitive inhibition assay. VIGF can be labeled, such as by
radioactivity, such that the number of VIGF molecules bound to the
receptor can determine the effectiveness of the potential
antagonist.
[0084] Also, a mammalian cell or membrane preparation expressing
the VIGF receptor would be incubated with labeled VIGF in the
presence of the compound. The ability of the compound to enhance or
block this interaction could then be measured. Alternatively, VIGF,
labelled IGF and a potential compound could be incubated under
conditions where VIGF would naturally bind to IGF. The extent of
this interaction could be measured to determine if the compound is
an effective antagonist or agonist.
[0085] Examples of potential VIGF antagonists include an antibody,
or in some cases, an oligonucleotide, which binds to the
polypeptide. Alternatively, a potential antagonist may be a closely
related protein, for example, a mutated form of VIGF, which
recognizes the VIGF receptor but imparts no effect, thereby
competitively inhibiting the action of VIGF.
[0086] Another potential VIGF antagonist is an antisense construct
prepared using antisense technology. Antisense technology can be
used to control gene expression through triple-helix formation or
antisense DNA or RNA, both of which methods are based on binding of
a polynucleotide to DNA or RNA. For example, the 5' coding portion
of the polynucleotide sequence, which encodes for the mature
polypeptides of the present invention, is used to design an
antisense RNA oligonucleotide of from about 10 to 40 base pairs in
length. A DNA oligonucleotide is designed to be complementary to a
region of the gene involved in transcription (triple helix--see Lee
et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science,
241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)),
thereby preventing transcription and the production of VIGF. The
antisense RNA oligonucleotide hybridizes to the mRNA in vivo and
blocks translation of the mRNA molecule into the VIGF
(antisense--Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988)). The oligonucleotides described
above can also be delivered to cells such that the antisense RNA or
DNA may be expressed in vivo to inhibit production of VIGF.
[0087] Potential VIGF antagonists include small molecules which
bind to the active site, the receptor binding site, IGF or other
growth factor binding site of the polypeptide thereby blocking the
normal biological activity of VIGF. Examples of small molecules
include but are not limited to small peptides or peptide-like
molecules.
[0088] The antagonists may be employed to inhibit tumor
neovascularization and the neointimal proliferation of smooth
muscle cells prevalent in atherosclerosis and restenosis subsequent
to balloon angioplasty.
[0089] The antagonists may also be employed to inhibit the over
production of scar tissue seen in a keloid which forms after
surgery, fibrosis after myocardial infarction, or fibrotic lesions
associated with pulmonary fibrosis. The antagonists may be employed
in a composition with a pharmaceutically acceptable carrier, e.g.,
as hereinafter described.
[0090] The VIGF polypeptides and antagonist or agonists of the
present invention may be employed in combination with a suitable
pharmaceutical carrier. Such compositions comprise a
therapeutically effective amount of the polypeptide, and a
pharmaceutically acceptable carrier or excipient. Such a carrier
includes but is not limited to saline, buffered saline, dextrose,
water, glycerol, ethanol, and combinations thereof. The formulation
should suit the mode of administration.
[0091] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the pharmaceutical compositions
may be employed in conjunction with other therapeutic
compounds.
[0092] The pharmaceutical compositions may be administered in a
convenient manner such as by the oral, topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
administered in an amount which is effective for treating and/or
prophylaxis of the specific indication. In general, they are
administered in an amount of at least about 10 .mu.g/kg body weight
and in most cases they will be administered in an amount not in
excess of about 8 mg/Kg body weight per day. In most cases, the
dosage is from about 10 .mu.g/kg to about 1 mg/kg body weight
daily, taking into account the routes of administration, symptoms,
etc.
[0093] VIGF in combination with other growth factors including but
not limited to, PDGF, IGF, FGF, EGF or TGF-.beta. may accelerate
physiological responses as seen in wound healing.
[0094] The VIGF polypeptide and agonists and antagonists which are
polypeptides, may also be employed in accordance with the present
invention by expression of such polypeptides in vivo, which is
often referred to as "gene therapy."
[0095] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo,
with the engineered cells then being provided to a patient to be
treated with the polypeptide. Such methods are well-known in the
art. For example, cells may be engineered by procedures known in
the art by use of a retroviral particle containing RNA encoding a
polypeptide of the present invention.
[0096] Similarly, cells may be engineered in vivo for expression of
a polypeptide in vivo by, for example, procedures known in the art.
As known in the art, a producer cell for producing a retroviral
particle containing RNA encoding the polypeptide of the present
invention may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention. For example, the expression
vehicle for engineering cells may be other than a retrovirus, for
example, an adenovirus which may be used to engineer cells in vivo
after combination with a suitable delivery vehicle.
[0097] Retroviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia Virus.
[0098] The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited to,
the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter
(e.g., cellular promoters such as eukaryotic cellular promoters
including, but not limited to, the histone, pol III, and
.beta.-actin promoters). Other viral promoters which may be
employed include, but are not limited to, adenovirus promoters,
thymidine kinase (TK) promoters, and B19 parvovirus promoters. The
selection of a suitable promoter will be apparent to those skilled
in the art from the teachings contained herein.
[0099] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter.
Suitable promoters which may be employed include, but are not
limited to, adenoviral promoters, such as the adenoviral major late
promoter; or hetorologous promoters, such as the cytomegalovirus
(CMV) promoter; the respiratory syncytial virus (RSV) promoter;
inducible promoters, such as the MMT promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the ApoAI
promoter; human globin promoters; viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs (including the modified retroviral LTRs hereinabove
described); the .beta.-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter which
controls the gene encoding the polypeptide.
[0100] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, .psi.-2, .psi.-AM, PA12, T19-14X,
VT-19-17-H2, .psi.CRE, .psi.CRIP, GP+E-86, GP+envAm12, and DAN cell
lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14
(1990), which is incorporated herein by reference in its entirety.
The vector may transduce the packaging cells through any means
known in the art. Such means include, but are not limited to,
electroporation, the use of liposomes, and CaPO.sub.4
precipitation. In one alternative, the retroviral plasmid vector
may be encapsulated into a liposome, or coupled to a lipid, and
then administered to a host.
[0101] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
[0102] This invention is also related to the use of the VIGF gene
as a diagnostic. Detection of a mutated form of VIGF will allow a
diagnosis of a disease or a susceptibility to a disease, such as a
tumor, since mutations in VIGF may cause tumors.
[0103] Individuals carrying mutations in the human VIGF gene may be
detected at the DNA level by a variety of techniques. Nucleic acids
for diagnosis may be obtained from a patient's cells, such as from
blood, urine, saliva, tissue biopsy and autopsy material. The
genomic DNA may be used directly for detection or may be amplified
enzymatically by using PCR (Saiki et al., Nature, 324:163-166
(1986)) prior to analysis. RNA or cDNA may also be used for the
same purpose. As an example, PCR primers complementary to the
nucleic acid encoding VIGF can be used to identify and analyze VIGF
mutations. For example, deletions and insertions can be detected by
a change in size of the amplified product in comparison to the
normal genotype. Point mutations can be identified by hybridizing
amplified DNA to radiolabeled VIGF RNA or alternatively,
radiolabeled VIGF antisense DNA sequences. Perfectly matched
sequences can be distinguished from mismatched duplexes by RNase A
digestion or by differences in melting temperatures.
[0104] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamidine gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230:1242 (1985)).
[0105] Sequence changes at specific locations may also be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method (e.g., Cotton et al, PNAS, USA,
85:4397-4401 (1985)).
[0106] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP))
and Southern blotting of genomic DNA.
[0107] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations can also be detected by in situ analysis.
[0108] VIGF protein expression may be linked to vascular disease or
neovascularization associated with tumor formation. VIGF has a
signal peptide and the mRNA is highly expressed in endothelial
cells and to a lesser extent in smooth muscle cells which indicates
that the protein is present in serum. Accordingly, an anti-VIGF
antibody could be used to diagnose vascular disease or
neovascularization associated with tumor formation since an altered
level of this polypeptide may be indicative of such disorders.
[0109] A competition assay may be employed wherein antibodies
specific to VIGF is attached to a solid support and labeled VIGF
and a sample derived from the host are passed over the solid
support and the amount of label detected attached to the solid
support can be correlated to a quantity of VIGF in the sample.
[0110] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0111] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3' untranslated region is used to rapidly select primers
that do not span more than one exon in the genomic DNA, thus
complicating the amplification process. These primers are then used
for PCR screening of somatic cell hybrids containing individual
human chromosomes. Only those hybrids containing the human gene
corresponding to the primer will yield an amplified fragment.
[0112] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0113] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA as short as 50 or 60 bases. For a review of this technique,
see Verma et al., Human Chromosomes: a Manual of Basic Techniques,
Pergamon Press, New York (1988).
[0114] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0115] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0116] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0117] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0118] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0119] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, 1975, Nature, 256:495-497), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., 1983, Immunology
Today 4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
[0120] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice may be used to express humanized
antibodies to immunogenic polypeptide products of this
invention.
[0121] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0122] In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
[0123] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0124] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37.degree. C. are ordinarily used, but may
vary in accordance with the supplier's instructions. After
digestion the reaction is electrophoresed directly on a
polyacrylamide gel to isolate the desired fragment.
[0125] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res., 8:4057 (1980).
[0126] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0127] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T., et al., Id., p. 146). Unless otherwise provided, ligation may
be accomplished using known buffers and conditions with 10 units of
T4 DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar
amounts of the DNA fragments to be ligated.
[0128] Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A., Virology,
52:456-457 (1973).
EXAMPLE 1
Bacterial Expression and Purification of VIGF
[0129] The DNA sequence encoding VIGF, ATCC.TM. # 75874, was
initially amplified using PCR oligonucleotide primers corresponding
to the 5' sequences of the processed VIGF protein (minus the signal
peptide sequence) and the vector sequences 3' to the VIGF gene.
Additional nucleotides corresponding to VIGF were added to the 5'
and 3' sequences respectively. The 5' oligonucleotide primer has
the sequence 5' CGCAAGCTTAAATAATTATGCGGTGGACTGC 3' (SEQ ID NO:3)
contains a Hind III restriction enzyme site (in bold) followed by
21 nucleotides of VIGF coding sequence starting from the presumed
terminal amino acid of the processed protein codon (underlined).
The 3' oligonucleotide primer 5' CGCTCTAGATCAGCGTGGATTTAACCA 3'
(SEQ ID NO:4) contains an Xba I restriction site (in bold) followed
by the reverse complement of nucleotides corresponding to the
carboxy-terminal 5 amino acids and the translational stop codon
(underlined). The restriction enzyme sites correspond to the
restriction enzyme sites on the bacterial expression vector pQE-9
(Qiagen, Inc. Chatsworth, Calif.). pQE-9 encodes antibiotic
resistance (Amp.sup.r), a bacterial origin of replication (ori), an
IPTG-regulatable promoter operator (P/O), a ribosome binding site
(RBS), a 6-His tag and restriction enzyme sites. The VIGF PCR
product and pQE-9 were then digested with Hind III and Xba I and
ligated together with T4 DNA ligase. The desired recombinants would
contain the VIGF coding sequence inserted downstream from the pQE-9
encoded histidine tag and the ribosome binding site. The ligation
mixture was then used to transform E. coli strain M15[pREP4]
(Qiagen, Inc.) by the procedure described in Sambrook, J. et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory
Press, (1989). M15[pREP4] contains multiple copies of the plasmid
pREP4, which expresses the lacI repressor and also confers
kanamycin resistance (Kan.sup.r). Transformants were identified by
their ability to grow on LB plates and ampicillin/kanamycin
resistant colonies were selected. Plasmid DNA was isolated and
confirmed by restriction analysis. Clones containing the desired
constructs were grown overnight (O/N) in liquid culture in LB media
supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N
culture was used to inoculate a large culture at a ratio of 1:100
to 1:250. The cells were grown to an optical density 600
(O.D..sup.600) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene expression.
Cells were grown an extra 3 to 4 hours such that there is an
exponential growth culture present. Cells were then harvested by
centrifugation. The VIGF/6-Histidine-containing M15[pREP4] cells
were lysed in 6M GnHCl, 50 mM NaPO.sub.4 at pH 8.0. The lysate was
loaded on a Nickel-Chelate column and the flow-through collected.
The column was washed with 6M GnHCl, 50 mM NaPO.sub.4 at pH 8.0,
6.0 and 5.0. The VIGF fusion protein (>90% pure) was eluted at
pH 2.0. For the purpose of renaturation, the pH 2.0 eluate was
adjusted to 3 molar guanidine HCl, 100 mM sodium phosphate, 10
mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized).
After incubation in this solution for 12 hours the protein was
dialyzed to 10 mmolar sodium phosphate. To run the gel, the pellets
were resuspended in SDS/NaOH and SDS-PAGE loading buffer, heat
denatured, then electrophoresed on a 15% denaturing polyacrylamide
gel. The Gibco BRL low range molecular weight standard was also
electrophoresed (lane 1). The proteins were visualized with
Coomassie Brilliant Blue R-250 stain.
EXAMPLE 2
Cloning and Expression of VIGF Using the Baculovirus Expression
System
[0130] The DNA sequence encoding the full length VIGF protein,
ATCC.TM. # 75874, is digested with the restriction enzymes PvuII
and XbaI. The 639 nucleotide PvuII, XbaI fragment contains the
entire VIGF coding region plus 11 and 77 nucleotides of 5' and 3'
untranslated DNA, respectively. This fragment, designated F2, is
isolated from a 1% agarose gel using a commercially available kit
("Geneclean", BIO 101 Inc., La Jolla, Calif.).
[0131] The vector pA2 is used for the expression of the VIGF
protein using the baculovirus expression system (for review see:
Summers, M. D. and Smith, G. E. 1987, A manual of methods for
baculovirus vectors and insect cell culture procedures, Texas
Agricultural Experimental Station Bulletin No. 1555). This
expression vector contains the strong polyhedrin promoter of the
Autographa californica nuclear polyhidrosis virus (AcMNPV) followed
by the recognition sites for the restriction endonucleases SmaI and
XbaI. The polyadenylation site of the simian virus (SV)40 is used
for efficient polyadenylation. For an easy selection of recombinant
viruses the beta-galactosidase gene from E. coli is inserted in the
same orientation as the polyhedrin promoter followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin
sequences are flanked at both sides by viral sequences for the
cell-mediated homologous recombination of cotransfected wild-type
viral DNA. Many other baculovirus vectors could be used in place of
pA2 such as, pRG1, pAc373, pVL941 and pAcIM1 (Luckow, V. A. and
Summers, M. D., Virology, 170:31-39).
[0132] The plasmid is digested with the restriction enzymes SmaI
and XbaI and then dephosphorylated using calf intestinal
phosphatase by procedures known in the art. The DNA is then
isolated from a 1% agarose gel using the commercially available kit
("Geneclean" BIO 101 Inc., La Jolla, Calif.). This vector DNA is
designated V2.
[0133] Fragment F2 and the dephosphorylated plasmid V2 are ligated
with T4 DNA ligase. E. coli strain XL1 Blue (Stratagene Cloning
Systems, 11011 North Torrey Pines Road La Jolla, Calif. 92037) are
then transformed and bacteria identified that contained the plasmid
(pBac VIGF) with the VIGF cDNA using the enzymes BamHI and XbaI.
The sequence of the cloned fragment is confirmed by DNA
sequencing.
[0134] 5 .mu.g of the plasmid pBac VIGF is cotransfected with 1.0
.mu.g of a commercially available linearized baculovirus
("BaculoGold.TM. baculovirus DNA", Pharmingen, San Diego, Calif.)
using the lipofection method (Felgner et al. Proc. Natl. Acad. Sci.
USA, 84:7413-7417 (1987)).
[0135] 1 .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the
plasmid pBac VIGF are mixed in a sterile well of a microtiter plate
containing 50 .mu.l of serum free Grace's medium (Life Technologies
Inc., Gaithersburg, Md.). Afterwards 10 .mu.l Lipofectin plus 90
.mu.l Grace's medium are added, mixed and incubated for 15 minutes
at room temperature. Then the transfection mixture is added
dropwise to the Sf9 insect cells (ATCC.TM. CRL 1711) seeded in a 35
mm tissue culture plate with 1 ml Grace' medium without serum. The
plate is rocked back and forth to mix the newly added solution. The
plate is then incubated for 5 hours at 27.degree. C. After 5 hours
the transfection solution is removed from the plate and 1 ml of
Grace's insect medium supplemented with 10% fetal calf serum is
added. The plate is put back into an incubator and cultivation
continued at 27.degree. C. for four days.
[0136] After four days the supernatant is collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Blue Gal" (Life Technologies
Inc., Gaithersburg) is used which allows an easy isolation of blue
stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0137] Four days after the serial dilution, the viruses are added
to the cells and blue stained plaques are picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses is
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar is removed by a brief centrifugation and
the supernatant containing the recombinant baculoviruses is used to
infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes are harvested and then stored
at 4.degree. C.
[0138] Sf9 cells are grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells are infected with the recombinant
baculovirus V-VIGF at a multiplicity of infection (MOI) of 2. Six
hours later the medium is removed and replaced with SF900 II medium
minus methionine and cysteine (Life Technologies Inc.,
Gaithersburg). 42 hours later 5 .mu.Ci of .sup.35S-methionine and 5
.mu.Ci .sup.35S cysteine (Amersham) are added. The cells are
further incubated for 16 hours before they are harvested by
centrifugation and the labelled proteins visualized by SDS-PAGE and
autoradiography.
EXAMPLE 3
Expression of Recombinant VIGF in CHO Cells
[0139] The vector pN346 is used for the expression of the VIGF
protein. Plasmid pN346 is a derivative of the plasmid pSV2-dhfr
[ATCC.TM. Accession No. 37146]. Both plasmids contain the mouse
dhfr gene under control of the SV40 early promoter. Chinese hamster
ovary or other cells lacking dihydrofolate activity that are
transfected with these plasmids can be selected by growing the
cells in a selective medium (alpha minus MEM, Lift Technologies)
supplemented with the chemotherapeutic agent methotrexate. The
amplication of the DHFR genes in cells resistant to methotrexate
(MTX) has been well documented (see, e.g., Alt, F. W., Kellems, R.
M., Bertino, J. R., and Schimke, R. T., 1978, J. Biol. Chem.
253:1357-1370, Hamlin, J. L. and Ma, C. 1990, Biochem. et Biophys.
Acta, 1097:107-143, Page, M. J. and Sydenham, M. A. 1991,
Biotechnology Vol. 9:64-68). Cells grown in increasing
concentrations of MTX develop resistance to the drug by
overproducing the target enzyme, DHFR, as a result of amplification
of the DHFR gene. If a second gene is linked to the dhfr gene it is
usually co-amplified and overexpressed. Subsequently, when the
methotrexate is withdrawn, cell lines contain the amplified gene
integrated into the chromosome(s).
[0140] Plasmid pN346 contains for the expression of the gene of
interest a strong promoter of the long terminal repeat (LTR) of the
Rouse Sarcoma Virus (Cullen, et al., Molecular and Cellular
Biology, March 1985, 438-447) plus a fragment isolated from the
enhancer of the immediate early gene of human cytomegalovirus (CMV)
(Boshart et al., Cell 41:521-530, 1985). Downstream of the promoter
are the following single restriction enzyme cleavage sites that
allow the integration of the genes: BamHI, Pvull, and Nrul. Behind
these cloning sites the plasmid contains translational stop codons
in all three reading frames followed by the 3' intron and the
polyadenylation site of the rat preproinsulin gene. Other high
efficient promoters can also be used for the expression, e.g., the
human .beta.-actin promoter, the SV40 early or late promoters or
the long terminal repeats from other retroviruses, e.g., HIV and
HTLVI. For the polyadenylation of the mRNA other signals, e.g.,
from the human growth hormone or globin genes can be used as
well.
[0141] Stable cell lines carrying a gene of interest integrated
into the chromosome can also be selected upon co-transfection with
a selectable marker such as gpt, G418 or hygromycin. It is
advantageous to use more than one selectable marker in the
beginning, e.g. G418 plus methotrexate.
[0142] The plasmid pN346 is digested with the restriction enzyme
BamHI and then dephosphorylated using calf intestinal phosphatase
by procedures known in the art. The vector is then isolated from a
1% agarose gel.
[0143] The DNA sequence encoding the full length VIGF protein,
ATCC.TM. #75874, is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene:
[0144] The 5' primer has the sequence 5'
CGCAGATCTCCGCCACCATGAAGAGCGTCTTGCTGCTG 3' (SEQ ID NO:5) and
contains a BgIII restriction enzyme site (in bold) followed by 8
nucleotides resembling an efficient signal for the initiation of
translation in eukaryotic cells (Kozak, M., J. Mol. Biol.,
196:947-950, (1987)). The remaining nucleotides correspond to the
amino terminal 7 amino acids including the translational initiation
codon (underlined). The 3' primer has the sequence 5'
CGCAGATCTAGCCTTCTCTCAGAAATCACA 3' (SEQ ID NO:6) and contains a
BglII restriction site (in bold) and 21 nucleotides that are the
reverse complement of 3' untranslated DNA starting 7 nucleotides
downstream from the translational stop codon. The PCR product is
digested with BglII and purified on a 1% agarose gel using a
commercially available kit ("Geneclean," BIO 101 Inc., La Jolla,
Calif.). This fragment is then ligated to BamHI digested,
phosphatased pN346 plasmid with T4 DNA ligase. Xl1Blue (Stratagene)
E. coli are transformed and plated on LB, 50 .mu.g/ml ampicillin
plates. Colonies bearing the desired recombinant in the proper
orientation are screened for by PCR with a 5' primer which
corresponds to the Rous sarcoma virus promoter and a 3' primer
which corresponds to the reverse complement of VIGF codons 73-79.
The sequence of the cloned fragment is confirmed by DNA
sequencing.
Transfection of CHO-dhfr-Cells
[0145] Chinese hamster ovary cells lacking an active DHFR enzyme
are used for transfection. 5 .mu.g of the expression plasmid
pN346VIGF are cotransfected with 0.5 .mu.g of the plasmid pSVneo
using the lipofectin method (Felgner et al., supra). The plasmid
pSV2-neo contains a dominant selectable marker, the gene neo from
Tn5 encoding an enzyme that confers resistance to a group of
antibiotics including G418. The cells are seeded in alpha minus MEM
supplemented with 1 mg/ml G418. After 2 days, the cells are
trypsinized and seeded in hybridoma cloning plates (Greiner,
Germany) and cultivated from 10-14 days. After this period, single
clones are trypsinized and then seeded in 6-well petri dishes using
different concentrations of methotrexate (25, 50 nm, 100 nm, 200
nm, 400 nm). Clones growing at the highest concentrations of
methotrexate are then transferred to new 6-well plates containing
even higher concentrations of methotrexate (500 nM, 1 .mu.M, 2
.mu.M, 5 .mu.M). The same procedure is repeated until clones grew
at a concentration of 100 .mu.M.
[0146] The expression of the desired gene product is analyzed by
Western blot analysis and SDS-PAGE.
EXAMPLE 4
Tissue Localization of VIGF Gene Expression by Northern Blot
Analysis
[0147] A multiple tissue Northern blot (Clontech Laboratories,
Inc., 4030 Fabian Way; Palo Alto, Calif. 94303) containing 2 ug of
human adult brain, heart, placenta, lung, liver skeletal muscle,
kidney, and pancreas poly A+ mRNA per lane is prehybridized in
Church buffer (Church, G. M. & Gilbert, W., Proc. Natl. Acad.
Sci. USA 81, 1991-1995 (1984)) at 60.degree. C. for one hour. The
DNA sequence coding for VIGF, ATCC.TM.# 75874, is amplified from
the full length cDNA cloned in pBluescript SK(-) using the M13
Forward (5' GGGTTTTCCCAGTCACGAC 3') (SEQ ID NO:7) and Reverse (5'
ATGCTTCCGGCTCGTATG 3') (SEQ ID NO:8) primers. Twenty-five nanograms
of PCR product is random primer radiolabeled (Prime-It II,
Stratagene Cloning Systems, 11011 North Torrey Pines Rd.; La Jolla,
Calif. 92037) with .sup.32P-dCTP. The heat denatured VIGF probe is
added directly to the prehybridization buffer and incubated 16 hr
at 60.degree. C. Two ten minute washes are performed in
0.2.times.SSC, 0.1% SDS at 60.degree. C. Autoradiography is
performed at -80.degree. C.
[0148] A 2.3 kb transcript is seen in lung and kidney after a four
day exposure.
EXAMPLE 5
Cell-Type Analysis of VIGF Gene Expression by Northern Blot
Analysis
[0149] Human umbilical vein endothelial, aortic smooth muscle,
dermal foreskin fibroblast cells (Clonetics, 9620 Chesapeake Drive,
Suite #201; San Diego, Calif. 92123) were grown to 75-90%
confluency. Total RNA is extracted with RNAzol (Biotecx
Laboratories, Inc., 6023 South Loop East Houston, Tex. 77033). A
1.2% agarose formaldehyde gel is prepared and run with 20 ug of
total RNA per lane and an RNA ladder size marker (Life
Technologies, Inc., 8400 Helgerman Ct., P.O. Box 6009 Gaithersburg,
Md. 20884) according to Sambrook et al. (1989). The RNA is
transferred overnight to Hybond N+ (Amersham Corp., 2636 South
Clearbrook Drive; Arlington Heights, Ill. 60005) and bound to the
membrane with a Stratalinker UV Crosslinker (Stratagene Cloning
Systems, La Jolla, Calif.). The blot is prehybridized in Church
buffer (Church, G. M. & Gilbert, W., PNAS, USA 81:1991-1995
(1984)) at 60.degree. C. for one hour. The DNA sequence encoding
VIGF, ATCC.TM. # 75874, is amplified from the full length cDNA
cloned in pBluescript SK(-) using the M13 Forward (5'
GGGTTTTCCCAGTCACGAC 3') (SEQ ID NO:9) and Reverse (5'
ATGCTTCCGGCTCGTATG 3') (SEQ ID NO:10) primers. Twenty-five
nanograms of PCR product is random primer radiolabeled (Prime-It
II, Stratagene) with .sup.32P-dCTP. The heat denatured VIGF probe
is added directly to the prehybridization buffer and incubated 16
hr at 60.degree. C. Two ten minute washes were performed in
0.2.times.SSC, 0.1% SDS at 60.degree. C. Autoradiography is
performed at -80.degree. C. A 2.3-2.4 kb transcript is seen in
umbilical vein endothelial (lane 1) and aortic smooth muscle cells
(lane 2) after a two hour exposure and also in dermal foreskin
fibroblast (lane 3) cells after a 36 hour exposure.
EXAMPLE 6
Expression Via Gene Therapy
[0150] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0151] pMV-7 (Kirschmeier, P. T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0152] The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer containing an EcoRI site and
the 3' primer $further includes a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the amplified
$EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB101, which are then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0153] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0154] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0155] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
[0156] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described.
Sequence CWU 1
1
17 1 1271 DNA Homo sapiens misc_feature (1212)..(1212) n is a, c,
g, or t misc_feature (1255)..(1255) n is a, c, g, or t misc_feature
(1259)..(1259) n is a, c, g, or t misc_feature (1261)..(1261) n is
a, c, g, or t misc_feature (1265)..(1265) n is a, c, g, or t 1
ctgcttccca ccagcaaaga ccacgactgg agagccgagc cggagcagct gggaaacatg
60 aagagcgtct tgctgctgac cacgctcctc gtgcctgcac acctggtggc
cgcctggagc 120 aataattatg cggtggactg ccctcaacac tgtgacagca
gtgagtgcaa aagcagcccg 180 cgctgcaaga ggacagtgct cgacgactgt
ggctgctgcc gagtgtgcgc tgcagggcgg 240 ggagaaactt gctaccgcac
agtctcaggc atggatggca tgaagtgtgg cccggggctg 300 aggtgtcagc
cttctaatgg ggaggatcct tttggtgaag agtttggtat ctgcaaagac 360
tgtccctacg gcaccttcgg gatggattgc agagagacct gcaactgcca gtcaggcatc
420 tgtgacaggg ggacgggaaa atgcctgaaa ttccccttct tccaatattc
agtaaccaag 480 tcttccaaca gatttgtttc tctcacggag catgacatgg
catctggaga tggcaatatt 540 gtgagagaag aagttgtgaa agagaatgct
gccgggtctc ccgtaatgag gaaatggtta 600 aatccacgct gatcccggct
gtgatttctg agagaaggct ctattttcgt gaytgttcaa 660 cacacagcca
acattttagg aactttctag attatagcat aaggacatgt aatttttgaa 720
gaccaaatgt gatgcatggt ggatccagaa aacaaaaagt aggatactta caatccataa
780 catccatatg actgaacact tgtatgtgtt tgttaaatat tcgaatgcat
gtagatttgt 840 taaatgtgtg tgtatagtaa cactgaagaa ctaaaaatgc
aatttaggta atcttacatg 900 gagacaggtc aaccaaagag ggagctaggc
aaagctgaag accgcagtga gtcaaattag 960 ttctttgact ttgatgtaca
ttaatgttgg gatatggaat gaagacttaa gagcaggaga 1020 agatggggag
ggggtgggag tgggaaataa aatatttagc ccttccttgg taggtagctt 1080
ctctagaatt taattrtgct tttttttttt tttttgggct ttgggaaaag tcaaaataaa
1140 acaaccagaa aacccctgaa ggaagtaaga tgtttgaagc ttatggaaat
ttgagtaaca 1200 aacagctttg anctgagagc aattycaaaa ggctgctgat
gtagcccccg ggttncctnt 1260 ntctnaagga c 1271 2 184 PRT Homo sapiens
2 Met Lys Ser Val Leu Leu Leu Thr Thr Leu Leu Val Pro Ala His -20
-15 -10 Leu Val Ala Ala Trp Ser Asn Asn Tyr Ala Val Asp Cys Pro Gln
-5 1 5 His Cys Asp Ser Ser Glu Cys Lys Ser Ser Pro Arg Cys Lys Arg
10 15 20 Thr Val Leu Asp Asp Cys Gly Cys Cys Arg Val Cys Ala Ala
Gly 25 30 35 Arg Gly Glu Thr Cys Tyr Arg Thr Val Ser Gly Met Asp
Gly Met 40 45 50 Lys Cys Gly Pro Gly Leu Arg Cys Gln Pro Ser Asn
Gly Glu Asp 55 60 65 Pro Phe Gly Glu Glu Phe Gly Ile Cys Lys Asp
Cys Pro Tyr Gly 70 75 80 Thr Phe Gly Met Asp Cys Arg Glu Thr Cys
Asn Cys Gln Ser Gly 85 90 95 Ile Cys Asp Arg Gly Thr Gly Lys Cys
Leu Lys Phe Pro Phe Phe 100 105 110 Gln Tyr Ser Val Thr Lys Ser Ser
Asn Arg Phe Val Ser Leu Thr 115 120 125 Glu His Asp Met Ala Ser Gly
Asp Gly Asn Ile Val Arg Glu Glu 130 135 140 Val Val Lys Glu Asn Ala
Ala Gly Ser Pro Val Met Arg Lys Trp 145 150 155 Leu Asn Pro Arg 160
3 31 DNA Artificial Primer 3 cgcaagctta aataattatg cggtggactg c 31
4 27 DNA Artificial Primer 4 cgctctagat cagcgtggat ttaacca 27 5 38
DNA Artificial Primer 5 cgcagatctc cgccaccatg aagagcgtct tgctgctg
38 6 30 DNA Artificial Primer 6 cgcagatcta gccttctctc agaaatcaca 30
7 19 DNA Artificial Primer 7 gggttttccc agtcacgac 19 8 18 DNA
Artificial Primer 8 atgcttccgg ctcgtatg 18 9 19 DNA Artificial
Primer 9 gggttttccc agtcacgac 19 10 18 DNA Artificial Primer 10
atgcttccgg ctcgtatg 18 11 90 PRT Gallus gallus 11 Met Gly Ser Ala
Gly Ala Arg Pro Ala Leu Ala Ala Ala Leu Leu 5 10 15 Cys Leu Ala Arg
Leu Ala Leu Gly Ser Pro Cys Pro Ala Val Cys 20 25 30 Gln Cys Pro
Ala Ala Ala Pro Gln Cys Ala Pro Gly Val Gly Leu 35 40 45 Val Pro
Asp Gly Cys Gly Cys Cys Lys Val Cys Ala Lys Gln Leu 50 55 60 Asn
Glu Asp Cys Ser Arg Thr Gln Pro Cys Asp His Thr Lys Gly 65 70 75
Leu Glu Cys Asn Arg Leu Val Asn Asp Ile His Lys Phe Arg Asp 80 85
90 12 90 PRT Mus musculus 12 Met Ser Ser Ser Thr Phe Arg Thr Leu
Ala Val Ala Val Thr Leu 5 10 15 Ala His Leu Thr Arg Leu Ala Leu Ser
Thr Cys Pro Ala Ala Cys 20 25 30 His Cys Pro Leu Glu Ala Pro Lys
Cys Ala Pro Gly Val Gly Leu 35 40 45 Val Arg Asp Gly Cys Gly Cys
Cys Lys Val Cys Ala Lys Gln Leu 50 55 60 Asn Glu Asp Cys Ser Lys
Thr Gln Pro Cys Asp His Thr Lys Gly 65 70 75 Leu Glu Cys Asn Ser
Leu Phe Asn Asp Ile His Lys Phe Arg Asp 80 85 90 13 93 PRT Homo
sapiens 13 Met Thr Ala Ala Ser Met Gly Pro Val Arg Val Ala Phe Val
Val 5 10 15 Leu Leu Ala Leu Cys Ser Arg Pro Ala Val Gly Gln Asn Cys
Ser 20 25 30 Gly Pro Cys Arg Cys Pro Asp Glu Pro Ala Pro Arg Cys
Pro Ala 35 40 45 Gly Val Ser Leu Val Leu Asp Gly Cys Gly Cys Cys
Arg Val Cys 50 55 60 Ala Lys Gln Leu Gly Glu Lys Cys Thr Glu Arg
Asp Pro Cys Asp 65 70 75 Pro His Lys Gly Leu Phe Cys Asp Tyr Tyr
Arg Lys Met Tyr Gly 80 85 90 Asp Met Ala 14 51 PRT Mus musculus 14
Met Leu Ala Ser Val Ala Gly Pro Ile Ser Leu Ala Leu Val Leu 5 10 15
Leu Ala Leu Cys Thr Arg Thr Ala Thr Gly Gln Asp Cys Ser Ala 20 25
30 Gln Cys Gln Cys Ala Ala Glu Ala Ala Pro His Tyr Tyr Arg Lys 35
40 45 Met Tyr Gly Asp Met Ala 50 15 54 PRT Gallus gallus 15 Met Glu
Thr Gly Gly Gly Gln Gln Leu Pro Val Leu Leu Leu Leu 5 10 15 Leu Leu
Leu Leu Arg Pro Cys Glu Val Ser Gly Arg Glu Ala Ala 20 25 30 Cys
Pro Arg Pro Cys Gly Gly Arg Cys Pro Ala Glu Pro Pro Arg 35 40 45
Asp Pro Met Ser Ser Glu Ala Lys Ile 50 16 50 PRT Homo sapiens 16
Met Gln Arg Ala Arg Pro Thr Leu Trp Ala Ala Ala Leu Thr Leu 5 10 15
Leu Val Leu Leu Arg Gly Pro Pro Val Ala Arg Ala Gly Ala Ser 20 25
30 Ser Gly Gly Leu Gly Pro Val Val Arg Cys Glu Pro Cys Val Ala 35
40 45 Arg Ala Leu Ala Arg 50 17 42 PRT Homo sapiens 17 Met Lys Ser
Val Leu Leu Leu Thr Thr Leu Leu Val Pro Ala His 5 10 15 Leu Val Ala
Ala Trp Ser Asn Met Tyr Ala Val Asp Cys Pro Gln 20 25 30 His Cys
Asp Ser Ser Glu Cys Lys Ser Ser Pro Arg 35 40
* * * * *