U.S. patent application number 11/894555 was filed with the patent office on 2008-03-06 for method of increasing trafficking of endothelial progenitor cells to ischemia-damaged tissue.
This patent application is currently assigned to The Trustees of Columbia University in the City of New York. Invention is credited to Silviu Itescu.
Application Number | 20080057069 11/894555 |
Document ID | / |
Family ID | 24349821 |
Filed Date | 2008-03-06 |
United States Patent
Application |
20080057069 |
Kind Code |
A1 |
Itescu; Silviu |
March 6, 2008 |
Method of increasing trafficking of endothelial progenitor cells to
ischemia-damaged tissue
Abstract
This invention provides a method of increasing trafficking of
endothelial progenitor cells to ischemia-damaged tissue in a
subject comprising administering to the subject an agent that
inhibits interaction between Stromal-Derived Factor-1 and
CXCR-4.
Inventors: |
Itescu; Silviu; (New York,
NY) |
Correspondence
Address: |
John P. White;Cooper & Dunham LLP
1185 Avenue of the Americas
New York
NY
10036
US
|
Assignee: |
The Trustees of Columbia University
in the City of New York
|
Family ID: |
24349821 |
Appl. No.: |
11/894555 |
Filed: |
August 20, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11234879 |
Sep 22, 2005 |
|
|
|
11894555 |
Aug 20, 2007 |
|
|
|
10220554 |
Mar 4, 2003 |
|
|
|
PCT/US01/18399 |
Jun 5, 2001 |
|
|
|
11234879 |
Sep 22, 2005 |
|
|
|
09587441 |
Jun 5, 2000 |
|
|
|
10220554 |
Mar 4, 2003 |
|
|
|
Current U.S.
Class: |
424/141.1 ;
424/93.7; 514/44R |
Current CPC
Class: |
A61P 9/10 20180101; A61K
38/193 20130101; C07K 14/52 20130101; C07K 16/2866 20130101; A61K
2039/505 20130101; A61P 43/00 20180101; A61K 38/195 20130101; C12N
2501/21 20130101; A61P 35/00 20180101; A61P 7/04 20180101; A61P
9/00 20180101; A61P 9/08 20180101; A61P 7/02 20180101; C12N 5/0692
20130101; A61P 25/28 20180101; A61P 9/04 20180101; A61P 3/10
20180101; C07K 16/24 20130101; A61K 35/44 20130101 |
Class at
Publication: |
424/141.1 ;
424/093.7; 514/044 |
International
Class: |
A61K 31/70 20060101
A61K031/70; A61K 39/00 20060101 A61K039/00; A61K 39/395 20060101
A61K039/395 |
Claims
1-68. (canceled)
69. A method of increasing trafficking of endothelial progenitor
cells to ischemia-damaged tissue in a subject comprising
administering to the subject an agent that inhibits interaction
between Stromal-Derived Factor-1 and CXCR-4.
70. The method of claim 69, wherein the agent that inhibits
interaction between Stromal-Derived Factor-1 and CXCR-4 is an
anti-Stromal-Derived Factor-1 monoclonal antibody or an anti-CXCR4
monoclonal antibody.
71. The method of claim 69, wherein the agent that inhibits
interaction between Stromal-Derived Factor-1 and CXCR-4 is
granulocyte-colony stimulating factor.
72. The method of claim 69, wherein the agent that inhibits
interaction between Stromal-Derived Factor-1 and CXCR-4 is
administered to the subject by injection into the subject's
peripheral circulation.
73. The method of claim 69, wherein the ischemia-damaged tissue is
an ischemic myocardium and wherein trafficking of endothelial
progenitor cells to the ischemic myocardium improves cardiac
function in the ischemic myocardium of the subject.
74. The method of claim 69, wherein the subject has suffered or is
suffering from one or more of the following: myocardial infarction,
chronic heart failure, ischemic heart disease, coronary artery
disease, diabetic heart disease or hemorrhagic stroke, thrombotic
stroke, limb ischemia, or other disease in which a tissue is
rendered ischemic.
75. The method of claim 69, further comprising administering to the
subject one or more of the following: an inhibitor of Plasminogen
Activator Inhibitor, Angiotensin Converting Enzyme Inhibitor or a
beta blocker.
76. A method of stimulating vasculogenesis in ischemia-damaged
tissue of a subject comprising: (a) removing stem cells from a
location within the subject; (b) recovering endothelial progenitor
cells from the stem cells removed in step (a); and (c) introducing
the endothelial progenitor cells from step (b) into a different
location within the subject such that the endothelial progenitor
cells stimulate vasculogenesis in the subject's ischemia-damaged
tissue.
77. A method of stimulating angiogenesis in peri-infarct tissue in
a subject comprising: (a) removing stem cells from a location
within the subject; (b) recovering endothelial progenitor cells
from the stem cells removed in step (a); (c) expanding the
endothelial progenitor cells recovered in step (b) by contacting
the progenitor cells with a growth factor; and (d) introducing the
expanded endothelial progenitor cells from step (c) into a
different location in the subject such that the endothelial
progenitor cells stimulate angiogenesis in peri-infarct tissue in
the subject.
78. A method of selectively increasing the trafficking of
endothelial progenitor cells to ischemia-damaged tissue in a
subject comprising: (a) administering endothelial progenitor cells
to the subject; and (b) administering a chemokine to the subject so
as to thereby attract the endothelial progenitor cells to the
ischemia-damaged tissue.
79. A method of increasing trafficking of endothelial progenitor
cells to ischemia-damaged tissue in a subject comprising inhibiting
any interaction between Stromal-Derived Factor-1 and CXCR4.
80. A method of reducing trafficking of endothelial progenitor
cells to bone marrow in a subject comprising inhibiting production
of Stromal-Derived Factor-1 in the subject's bone marrow.
81. A method for treating cancer in a subject comprising
administering to the subject a monoclonal antibody directed against
an epitome of a specific chemokine produced by proliferating cells
associated with the cancer so as to reduce trafficking of
endothelial progenitor cells to such proliferating cells and
thereby treat the cancer in the subject.
82. A method for treating a cancer in a subject comprising
administering to the subject a monoclonal antibody directed against
an epitome of a specific receptor located on an endothelial
progenitor cell, for a chemokine produced by proliferating cells
associated with the cancer, so as to reduce trafficking of the
endothelial progenitor cell to such proliferating cells and thereby
treat the cancer in the subject.
83. A method for treating a tumor in a subject comprising
administering to the subject an antagonist to a specific receptor
on an endothelial progenitor cell so as to reduce the progenitor
cell's ability to induce vasculogenesis in the subject's tumor and
thereby treat the tumor.
84. A method for treating a tumor in a subject comprising
administering to the subject an antagonist to a specific receptor
on an endothelial progenitor cell so as to reduce the progenitor
cell's ability to induce angiogenesis in the subject's tumor and
thereby treat the tumor.
85. A method for expressing a gene of interest in an endothelial
progenitor cell or mast progenitor cell which comprises inserting
into the cell a vector comprising a promoter containing a GATA-2
motif and the gene of interest.
86. A composition comprising an amount of a monoclonal antibody
directed against an epitome of a specific chemokine produced by a
cancer effective to reduce trafficking of endothelial progenitor
cells to the cancer, and a pharmaceutically acceptable carrier.
87. A method of treating an abnormality in a subject wherein the
abnormality is treated by the expression of a GATA-2 activated gene
product in the subject comprising: (a) removing stem cells from a
location within the subject; (b) recovering endothelial progenitor
cells from the stem cells removed in step (a); (c) recovering those
endothelial progenitor cells recovered in step (b) that express
GATA-2; (d) inducing the cells recovered in step (c) as expressing
GATA-2 to express a GATA-2 activated gene product; and (e)
introducing the cells expressing a GATA-2 activated gene product
from step (d) into a different location in the subject such as to
treat the abnormality.
88. A method of treating an abnormality in a subject wherein the
abnormality is treated by the expression of a GATA-2 activated gene
product in the subject comprising: (a) removing stem cells from a
location within the subject; (b) recovering mast progenitor cells
from the stem cells removed in step (a); (c) recovering those mast
progenitor cells recovered in step (b) that express GATA-2; (d)
inducing the cells recovered in step (c) as expressing GATA-2 to
express a GATA-2 activated gene product; and (e) introducing the
cells expressing a GATA-2 activated gene product from step (d) into
a different location in the subject such as to treat the
abnormality.
89. A method of improving myocardial function in a subject that has
suffered a myocardial infarct comprising: (a) removing stem cells
from a location in the subject; (b) recovering cells that express
CD117 from the stem cells; and (c) introducing the recovered cells
into a different location in the subject such that the cells
improve myocardial function in the subject.
90. A method of stimulating vasculogenesis in ischemia-damaged
tissue in a subject comprising: (a) obtaining allogeneic stem
cells; (b) recovering endothelial progenitor cells from the stem
cells removed in step (a); and (c) introducing the endothelial
progenitor cells recovered in step (b) into the subject such that
the endothelial progenitor cells stimulate vasculogenesis in the
subject's ischemia-damaged tissue.
91. A method of stimulating angiogenesis in ischemia-damaged tissue
in a subject comprising: (a) obtaining allogeneic stem cells; (b)
recovering endothelial progenitor cells in the stem cells removed
in step (a); and (c) introducing the endothelial progenitor cells
recovered in step (b) into the subject such that the endothelial
progenitor cells stimulate angiogenesis in the subject's
ischemia-damaged tissue.
92. A method of improving myocardial function in a subject that has
suffered myocardial infarct comprising injecting G-CSF into the
subject in order to mobilize endothelial progenitor cells.
93. A method of improving myocardial function in a subject that has
suffered a myocardial infarct comprising injecting anti-CXR4
antibody into the subject.
Description
[0001] This application is a continuation-in-part and claims
priority of U.S. Ser. No. 09/587,441, filed Jun. 5, 2000, the
contents of which are hereby incorporated by reference.
[0002] Throughout this application, various references are referred
to within parentheses. Disclosures of these publications in their
entireties are hereby incorporated by reference into this
application to more fully describe the state of the art to which
this invention pertains. Full bibliographic citation for these
references may be found at the end of this application, preceding
the claims.
BACKGROUND OF THE INVENTION
[0003] Left ventricular remodeling after myocardial infarction is a
major cause of subsequent heart failure and death. The capillary
network cannot keep pace with the greater demands of the
hypertrophied but viable myocardium, resulting in myocardial death
and fibrous replacement. The first series of experiments of the
present invention, described below, show that human adult bone
marrow contains endothelial cell precursors with phenotypic and
functional characteristics of embryonic hemangioblasts, and that
these can be mobilized, expanded, and used to induce infarct bed
vasculogenesis after experimental myocardial infarction. The
neo-angiogenesis results in significant and sustained increase in
viable myocardial tissue, reduction in collagen deposition, and
improved myocardial function. The use of cytokine-mobilized
autologous human bone marrow-derived angioblasts for
revascularization of myocardial infarct tissue, alone or in
conjunction with currently used therapies, offers the potential to
significantly reduce morbidity and mortality associated with left
ventricular remodeling post-myocardial infarction.
[0004] Although prompt reperfusion within a narrow time window has
significantly reduced early mortality from acute myocardial
infarction, post-infarction heart failure is increasing and
reaching epidemic proportions (1). Left ventricular remodeling
after myocardial infarction, characterized by expansion of the
initial infarct area, progressive thinning of the wall surrounding
the infarct, and dilation of the left ventricular lumen, has been
identified as a major prognostic factor for subsequent heart
failure (2,3). This process is accompanied by transcription of
genes normally expressed only in the fetal state, rapid and
progressive increase in collagen secretion by cardiac fibroblasts,
deposition of fibrous tissue in the ventricular wall, increased
wall stiffness, and both diastolic and systolic dysfunction (4,5).
Hypoxia directly stimulates collagen secretion by cardiac
fibroblasts, while inhibiting DNA synthesis and cellular
proliferation (6). In animal models, late reperfusion following
experimental myocardial infarction at a point beyond myocardial
salvage significantly benefits remodeling (7). Moreover, the
presence of a patent infarct related artery is consistently
associated with survival benefits in the post-infarction period in
humans (8). This appears to be due to adequate reperfusion of the
infarct vascular bed which modifies the ventricular remodeling
process and prevents abnormal changes in wall motion (9).
[0005] Successful reperfusion of non-cardiac tissues rendered
ischemic in experimental animal models has recently been
demonstrated by use of either circulating or bone marrow-derived
cellular elements (10-13). Although the precise nature of these
cells was not defined in these studies, the presence of precursor
cells in both adult human circulation and bone marrow which have
the capability to differentiate into functional endothelial cells,
a process termed vasculogenesis (14-16), has been shown. In the
pre-natal period, precursor cells derived from the ventral
endothelium of the aorta in human and lower species have been shown
to give rise to cellular elements involved in both the processes of
vasculogenesis and hematopoiesis (17,18). These cells have been
termed embryonic hemangioblasts, are characterized by expression of
CD34, CD117 (stem cell factor receptor), Flk-1 (vascular
endothelial cell growth factor receptor-2, VEGFR-2), and Tie-2
(angiopoietin receptor), and have been shown to have high
proliferative potential with blast colony formation in response to
VEGF (19-22). The subsequent proliferation and differentiation of
embryonic hemangioblasts to adult-type pluripotent stem cells
appears to be related to co-expression of the GATA-2 transcription
factor, since GATA-2 knockout embryonic stem cells have a complete
block in definitive hematopoiesis and seeding of the fetal liver
and bone marrow (23). Moreover, the earliest precursor of both
hematopoietic and endothelial cell lineage to have diverged from
embryonic ventral endothelium has been shown to express VEGF
receptors as well as GATA-2 and alpha4-integrins (24). The first
series of experiments of the present invention shows that GATA-2
positive stem cell precursors are also present in adult human bone
marrow, demonstrate properties of hemangioblasts, and can be used
to induce vasculogenesis, thus preventing remodeling and heart
failure in experimental myocardial infarction.
[0006] Growth of new vessels from pre-existing mature endothelium
has been termed angiogenesis, and can be regulated by many factors
including certain CXC chemokines (47-50). In contrast,
vasculogenesis is mediated by bone marrow-derived endothelial
precursors (51-53) with phenotypic characteristics of embryonic
angioblasts and growth/differentiation properties regulated by
receptor tyrosine kinases such as vascular endothelial growth
factor (VEGF) (54-57). Therapeutic vasculogenesis (58-61) has the
potential to improve perfusion of ischemic tissues, however the
receptor/ligand interactions involved in selective trafficking of
endothelial precursors to sites of tissue ischemia are not known.
The second series of experiments of the present invention,
described below, show that vasculogenesis can develop in infarcted
myocardium as a result, of interactions between CXC receptors on
human bone marrow-derived angioblasts and ELR-positive CXC
chemokines induced by ischemia, including IL-8 and Gro-alpha.
Moreover, redirected trafficking of angioblasts from the bone
marrow to ischemic myocardium can be achieved by blocking
CXCR4/SDF-1 interactions, resulting in increased vasculogenesis,
decreased myocardial death and fibrous replacement, and improved
cardiac function. The results of the experiments indicate that CXC
chemokines, including IL-8, Gro-alpha, and stromal-derived factor-1
(SDF-1), play a central role in regulating vasculogenesis in the
adult human, and suggest that manipulating interactions between CXC
chemokines and their receptors on bone marrow-derived angioblasts
can lead to optimal therapeutic vasculogenesis and salvage of
ischemic tissues. The third series of experiments, described below,
show that CC chemokines also play a role in mediating angioblast
chemotaxis to ischemic myocardium.
[0007] The angiogenic response during wound repair or inflammation
is thought to result from changes in adhesive interactions between
endothelial cells in pre-existing vasculature and extracellular
matrix which are regulated by locally-produced factors and which
lead to endothelial cell migration, proliferation, reorganization
and microvessel formation (70). The human CXC chemokine family
consists of small (<10 kD) heparin-binding polypeptides that
bind to and have potent chemotactic activity for endothelial cells.
Three amino acid residues at the N-terminus (Glu-Leu-Arg, the ELR
motif) determine binding of CXC chemokines such as IL-8 and
Gro-alpha to CXC receptors 1 and 2 on endothelial cells (49, 71),
thus promoting endothelial chemotaxis and angiogenesis (47-48). In
contrast, CXC chemokines lacking the ELR motif bind to different
CXC receptors and inhibit growth-factor mediated angiogenesis
(49-72). Although SDF-1, an ELR-negative CXC chemokine, is a potent
inducer of endothelial chemotaxis through interactions with CXCR4
(73), its angiogenic effects appear to be limited to the developing
gastrointestinal tract vascular system (50).
[0008] Vasculogenesis first occurs during the pre-natal period,
with haemangioblasts derived from the human ventral aorta giving
rise to both endothelial and haematopoietic cellular elements
(74,75). Similar endothelial progenitor cells have recently been
identified in adult human bone marrow (51-53), and shown to have
the potential to induce vasculogenesis in ischemic tissues (59-61).
However, the signals from ischemic sites required for
chemoattraction of such bone marrow-derived precursors, and the
receptors used by these cells for selective trafficking to these
sites, are unknown. Following myocardial infarction a process of
neoangiogenesis occurs (62,63), but is insufficient to sustain
viable tissue undergoing compensatory hypertrophy, leading to
further cell death, expansion of the initial infarct area, and
collagen replacement (64-66). This process, termed remodeling,
results in progressive heart failure (67-69). In the experiments
described below, a nude rat model of myocardial infarction was used
to investigate whether CXC chemokines containing the ELR motif
regulate migration of human bone marrow-derived angioblasts to
sites of tissue ischemia. Moreover, since selective bone marrow
homing and engraftment of haematopoietic progenitors depends on
CXCR4 binding to SDF-1 expressed constitutively in the bone marrow
(76-78), whether interruption of CXCR4/SDF-1 interactions could
redirect trafficking of human bone marrow-derived angioblasts to
sites of tissue ischemia, thereby augmenting therapeutic
vasculogenesis, was examined. The results of the experiments
indicate that CXC chemokines, including IL-8, Gro-alpha, and SDF-1,
play a central role in regulating human adult bone marrow-dependent
vasculogenesis. Further, the fourth series of experiments described
below show that stem cells can induce angiogenesis in peri-infarct
tissue.
SUMMARY OF THE INVENTION
[0009] This invention provides a method of stimulating
vasculogenesis in ischemia-damaged tissue of a subject comprising:
[0010] (a) removing stem cells from a location within the subject;
[0011] (b) recovering endothelial progenitor cells from the stem
cells removed in step (a); and [0012] (c) introducing the
endothelial progenitor cells from step (b) into a different
location within the subject such that the endothelial progenitor
cells stimulate vasculogenesis in the subject's ischemia-damaged
tissue.
[0013] This invention also provides the instant method, wherein
subsequent to step (b), but before step (c), the endothelial
progenitor cells are expanded by contacting them with a growth
factor.
[0014] This invention also provides the instant method, wherein the
growth factor is a cytokine.
[0015] This invention also provides the instant method, wherein the
cytokine is VEGF, FGF, G-CSF, IGF, M-CSF, or GM-CSF.
[0016] This invention also provides the instant method, wherein the
growth factor is a chemokine.
[0017] This invention also provides the instant method, wherein the
chemokine is Interleukin-8.
[0018] This invention also provides the instant method, wherein the
endothelial progenitor cells are separated from other stem cells
before expansion.
[0019] This invention also provides the instant method, wherein the
ischemia-damaged tissue is myocardium.
[0020] This invention also provides the instant method, wherein the
ischemia-damaged tissue is nervous system tissue.
[0021] This invention also provides the instant method, wherein the
stem cells are removed from the subject's bone marrow.
[0022] This invention also provides the instant method, wherein the
removal of the stem cells from the bone marrow is effected by
aspiration from the subject's bone marrow.
[0023] This invention also provides the instant method, wherein the
removal of the stem cells from the subject is effected by a method
comprising: [0024] (a) introducing a growth factor into the subject
to mobilize the stem cells into the subject's blood; and [0025] (b)
removing a sample of blood containing the stem cells from the
subject.
[0026] This invention also provides the instant method, wherein the
growth factor is introduced into the subject subcutaneously,
orally, intravenously or intramuscularly.
[0027] This invention also provides the instant method, wherein the
growth factor is a chemokine that induces mobilization.
[0028] This invention also provides the instant method, wherein the
chemokine is Interleukin-8.
[0029] This invention also provides the instant method, wherein the
growth factor is a cytokine.
[0030] This invention also provides the instant method, wherein the
cytokine is G-CSF, M-CSF, or GM-CSF.
[0031] This invention also provides the instant method, wherein the
endothelial progenitor cells are recovered based upon their
expression of CD117.
[0032] This invention also provides the instant method, wherein the
endothelial progenitor cells are recovered based upon their
expression of a GATA-2 activated gene product.
[0033] This invention also provides the instant method, wherein the
endothelial progenitor cells are recovered based upon their
expression of one or more of CD34, VEGF-R, Tie-2, GATA-3 or
AC133.
[0034] This invention also provides the instant method, wherein the
subject has suffered or is suffering from one or more of the
following: myocardial infarction, chronic heart failure, ischemic
heart disease, coronary artery disease, diabetic heart disease,
hemorrhagic stroke, thrombotic stroke, embolic stroke, limb
ischemia, or another disease in which tissue is rendered
ischemic.
[0035] This invention also provides the instant method, wherein
step (a) occurs prior to the subject suffering ischemia-damaged
tissue and wherein step (c) occurs after the subject has suffered
ischemia-damaged tissue.
[0036] This invention also provides the instant method, wherein the
endothelial progenitor cells are frozen for a period of time
between steps (b) and (c).
[0037] This invention also provides the instant method, wherein the
endothelial progenitor cells are frozen for a period of time after
being expanded but before step (c) is performed.
[0038] This invention also provides the instant method, wherein the
endothelial progenitor cells are introduced into the subject by
injection directly into the peripheral circulation, heart muscle,
left ventricle, right ventricle, coronary artery, cerebro-spinal
fluid, neural tissue, ischemic tissue, or post-ischemic tissue.
[0039] This invention also provides the instant method, further
comprising administering to the subject one or more of the
following: an inhibitor of Plasminogen Activator Inhibitor,
Angiotensin Converting Enzyme Inhibitor or a beta blocker, wherein
such administration occurs prior to, concomitant with, or following
step (c).
[0040] This invention also provides a method of stimulating
angiogenesis in peri-infarct tissue in a subject comprising: [0041]
(a) removing stem cells from a location within a subject; [0042]
(b) recovering endothelial progenitor cells from the stem cells
removed in step (a); [0043] (c) expanding the endothelial
progenitor cells recovered in step (b) by contacting the progenitor
cells with a growth factor; and [0044] (d) introducing the expanded
endothelial progenitor cells from step (c) into a different
location in the subject such that the endothelial progenitor cells
stimulate angiogenesis in peri-infarct tissue in the subject.
[0045] This invention also provides a method of selectively
increasing the trafficking of endothelial progenitor cells to
ischemia-damaged tissue in a subject comprising: [0046] (a)
administering endothelial progenitor cells to a subject; and [0047]
(b) administering a chemokine to the subject so as to thereby
attract the endothelial progenitor cells to the ischemia-damaged
tissue.
[0048] This invention also provides the instant method, wherein the
chemokine is administered to the subject prior to administering the
endothelial progenitor cells.
[0049] This invention also provides the instant method, wherein the
chemokine is administered to the subject concurrently with the
endothelial progenitor cells.
[0050] This invention also provides the instant method, wherein the
chemokine is administered to the subject after administering the
endothelial progenitor cells.
[0051] This invention also provides the instant method, wherein the
chemokine is a CXC chemokine.
[0052] This invention also provides the instant method, wherein the
CXC chemokine is selected from the group consisting of
Interleukin-8, Gro-Alpha, or Stromal-Derived Factor-1.
[0053] This invention also provides the instant method, wherein the
chemokine is a CC chemokine.
[0054] The method of claim 34, wherein the CC chemokine is selected
from the group consisting of RANTES, EOTAXIN, MCP-1, MCP-2, MCP-3,
or MCP-4.
[0055] This invention also provides the instant method, wherein the
chemokine is administered to the subject by injection into the
subject's peripheral circulation, heart muscle, left ventricle,
right ventricle, coronary arteries, cerebro-spinal fluid, neural
tissue, ischemic tissue, or post-ischemic tissue.
[0056] This invention also provides a method of increasing
trafficking of endothelial progenitor cells to ischemia-damaged
tissue in a subject comprising inhibiting any interaction between
Stromal-Derived Factor-1 and CXCR4.
[0057] This invention also provides the instant method, wherein
interaction between Stromal-Derived Factor-1 (SDF-1) and CXCR4 is
inhibited by administration of an anti-SDF-1 or an anti-CXCR4
monoclonal antibody to the subject.
[0058] This invention also provides the instant method, further
comprising administering to the subject an angiotensin converting
enzyme inhibitor, an AT.sub.1-receptor blocker, or a beta
blocker.
[0059] This invention also provides a method of reducing
trafficking of endothelial progenitor cells to bone marrow in a
subject comprising inhibiting production of Stromal-Derived
Factor-1 in the subject's bone marrow.
[0060] This invention also provides the instant method, wherein
SDF-1 production is inhibited by administration of an anti-SDF-1 or
anti-CXCR4 monoclonal antibody to the subject.
[0061] This invention also provides a method for treating a cancer
in a subject comprising administering to the subject a monoclonal
antibody directed against an epitope of a specific chemokine
produced by proliferating cells associated with the cancer so as to
reduce trafficking of endothelial progenitor cells to such
proliferating cells and thereby treat the cancer in the
subject.
[0062] This invention also provides a method for treating a cancer
in a subject comprising administering to the subject a monoclonal
antibody directed against an epitope of a specific receptor located
on an endothelial progenitor cell, for a chemokine produced by
proliferating cells associated with the cancer, so as to reduce
trafficking of the endothelial progenitor cell to such
proliferating cells and thereby treat the cancer in the
subject.
[0063] This invention also provides a method for treating a tumor
in a subject comprising administering to the subject an antagonist
to a specific receptor on an endothelial progenitor cell so as to
reduce the progenitor cell's ability to induce vasculogenesis in
the subject's tumor and thereby treat the tumor.
[0064] This invention also provides a method for treating a tumor
in a subject comprising administering to the subject an antagonist
to a specific receptor on an endothelial progenitor cell so as to
reduce the progenitor cell's ability to induce angiogenesis in the
subject's tumor and thereby treat the tumor.
[0065] This invention also provides the instant method, wherein the
receptor is a CD117 receptor.
[0066] This invention also provides a method for expressing a gene
of interest in an endothelial progenitor cell or a mast progenitor
cell which comprises inserting into the cell a vector comprising a
promoter containing a GATA-2 motif and the gene of interest.
[0067] This invention also provides the instant method, wherein the
vector is inserted into the cell by transfection.
[0068] This invention also provides the instant method, wherein the
promoter is a preproendothelin-1 promoter.
[0069] This invention also provides the instant method, wherein the
promoter is of mammalian origin.
[0070] This invention also provides the instant method, wherein the
promoter is of human origin.
[0071] This invention provides a composition comprising an amount
of a monoclonal antibody directed against an epitope of a specific
chemokine produced by a cancer effective to reduce trafficking of
endothelial progenitor cells to the cancer, and a pharmaceutically
acceptable carrier.
[0072] This invention provides a method of treating an abnormality
in a subject wherein the abnormality is treated by the expression
of a GATA-2 activated gene product in the subject comprising:
[0073] (a) removing stem cells from a location within the subject;
[0074] (b) recovering endothelial progenitor cells from the stem
cells removed in step (a); [0075] (c) recovering those endothelial
progenitor cells recovered in step (b) that express GATA-2; [0076]
(d) inducing the cells recovered in step (c) as expressing GATA-2
to express a GATA-2 activated gene product; and [0077] (e)
introducing the cells expressing a GATA-2 activated gene product
from step (d) into a different location in the subject such as to
treat the abnormality.
[0078] This invention provides a method of treating an abnormality
in a subject wherein the abnormality is treated by the expression
of a GATA-2 activated gene product in the subject comprising:
[0079] (a) removing stem cells from a location within the subject;
[0080] (b) recovering mast progenitor cells from the stem cells
removed in step (a); [0081] (c) recovering those mast progenitor
cells recovered in step (b) that express GATA-2; [0082] (d)
inducing the cells recovered in step (c) as expressing GATA-2 to
express a GATA-2 activated gene product; and [0083] (e) introducing
the cells expressing a GATA-2 activated gene product from step (d)
into a different location in the subject such as to treat the
abnormality
[0084] This invention provides the instant method, wherein the
abnormality is ischemia-damaged tissue.
[0085] This invention provides the instant method, wherein the gene
product is proendothelin.
[0086] This invention provides the instant method, wherein the gene
product is endothelin.
[0087] This invention provides the a method of improving myocardial
function in a subject that has suffered a myocardial infarct
comprising: [0088] (a) removing stem cells from a location in the
subject; [0089] (b) recovering cells that express CD117 from the
stem cells; and [0090] (c) introducing the recovered cells into a
different location in the subject such that the cells improve
myocardial function in the subject.
[0091] This invention provides the instant methods, wherein the
subject is of mammalian origin.
[0092] This invention provides the instant method, wherein the
mammal is of human origin.
[0093] This invention also provides a method of stimulating
vasculogenesis in ischemia-damaged tissue in a subject comprising:
[0094] (a) obtaining allogeneic stem cells; [0095] (b) recovering
endothelial progenitor cells from the stem cells removed in step
(a); and [0096] (c) introducing the endothelial progenitor cells
recovered in step (b) into the subject such that the endothelial
progenitor cells stimulate vasculogenesis in the subject's
ischemia-damaged tissue.
[0097] This invention provides the instant method, wherein the
allogeneic stem cells are obtained from embryonic, fetal or cord
blood sources.
[0098] This invention provides a method of stimulating angiogenesis
in ischemia-damaged tissue in a subject comprising: [0099] (a)
obtaining allogeneic stem cells; [0100] (b) recovering endothelial
progenitor cells in the stem cells removed in step (a); and [0101]
(c) introducing the endothelial progenitor cells recovered in step
(b) into the subject such that the endothelial progenitor cells
stimulate angiogenesis in the subject's ischemia-damaged
tissue.
[0102] This invention provides the instant method, wherein the
allogeneic stem cells are obtained from embryonic, fetal or cord
blood sources.
[0103] This invention also provides a method of improving
myocardial function in a subject that has suffered a myocardial
infarct comprising injecting G-CSF into the subject in order to
mobilize endothelial progenitor cells.
[0104] This invention also provides a method of improving
myocardial function in a subject that has suffered a myocardial
infarct comprising injecting anti-CXCR4 antibody into the
subject.
[0105] This invention also provides the instant method further
comprising introducing endothelial progenitor cells into the
subject.
[0106] This invention also provides the instant method further
comprising introducing G-CSF into the subject in order to mobilize
endothelial progenitor cells.
BRIEF DESCRIPTION OF THE FIGURES
[0107] FIG. 1. G-CSF Mobilizes Two Human Bone Marrow-Derived
Populations Expressing VEGF Receptors: One With Characteristics Of
Mature Endothelial Cells And A Second With Characteristics Of
Embryonic Angioblasts.
[0108] A-D depicts four-parameter flow cytometric phenotype
characterization of G-CSF mobilized bone marrow-derived cells
removed by leukopharesis from a representative human donor adult
(25). Only live cells were analyzed, as defined by 7-AAD staining.
For each marker used, shaded areas represent background log
fluorescence relative to isoytpe control antibody. [0109] A.
Following immunoselection of mononuclear cells (25), >95% of
live cells express CD34. [0110] B. The CD34+CD117.sup.dim subset
contains a population with phenotypic characteristics of mature,
vascular endothelium. [0111] C. The CD34+CD117.sup.bright subset
contains a population expressing markers characteristic of
primitive hemangioblasts arising during waves of murine and human
embryogenesis. [0112] D. CD34+CD117.sup.bright cells co-expressing
GATA-2 and GATA-3 also express AC133, another marker which defines
hematopoietic cells with angioblast potential.
[0113] FIG. 2. Bone Marrow-Derived Angioblasts (BA) Have Greater
Proliferative Activity In Response To Both VEGF And Ischemic Serum
Than Bone Marrow-Derived Endothelial Cells (BMEC).
[0114] Depicted is the response of single-donor CD34-positive human
cells sorted by a fluorescent GATA-2 mAb and cultured for 96 hours
in RPMI with 20% normal rat serum, ischemic rat serum or 20 ng/ml
VEGF. The numbers of CD117.sup.brightGATA-2-2.sup.pos and
CD117.sup.dim GATA-2.sup.neg cells were quantitated by both
[.sup.3H] thymidine uptake and by flow cytometry. [0115] A. In
comparison to culture in normal serum, the proliferative responses
to either VEGF or ischemic serum were significantly higher for
CD117.sup.brightGATA-2.sup.pos BA relative to
CD117.sup.dimGATA-2.sup.negBMEC from the same donor (both
p<0.01). [0116] B. The population expanded by culture with
either VEGF or ischemic serum and characterized by multiparameter
flow cytometric analysis as CD117.sup.brightGATA-2.sup.pos
consisted of large blast cells, as demonstrated by high forward
scatter (fsc). [0117] C. The expanded population of
CD117.sup.brightGATA-2.sup.pos cells did not demonstrate increased
surface expression of mature endothelial cell markers after culture
with VEGF in comparison to culture with normal medium, indicating
blast proliferation without differentiation.
[0118] FIG. 3. Highly Purified Human Bone Marrow-Derived CD34 Cells
Differentiate Into Endothelial Cells After in Vitro Culture.
[0119] Culture of highly-purified CD34+ human cells for 7 days in
endothelial growth medium results in outgrowth of cells with
morphologic and characteristic features of mature endothelial cell
monolayers. The majority of the monolayers (>90%) demonstrate:
[0120] A. Exuberant cobblestone pattern of cellular proliferation
and growth; [0121] B. Uniform uptake of DiI-labeled acetylated LDL;
[0122] C. CD34 expression, as measured by immunofluorescence using
a fluorescein-conjugated mAb; [0123] D. Factor VIII expression, as
measured by immunoperoxidase using a biotin-conjugated mAb; and
[0124] E. Expression of eNOS, determined by in situ hybridization
using a specific probe.
[0125] FIG. 4. In vivo migratory and proliferative characteristics
of bone marrow- and peripheral vasculature-derived human cells
after induction of myocardial ischemia. [0126] A-C. Intravenous
injection of 2.times.10.sup.6 DiI-labeled human CD34-enriched cells
(>95% CD34 purity), CD34-negative cells (<5% CD34 purity), or
saphenous vein endothelial cells (SVEC), into nude rats after
coronary artery ligation and infarction. Each human cellular
population caused a similar degree of infiltration in infarcted rat
myocardium at 48 hours. [0127] D. A sham procedure, with no human
cells found in the non-infarcted rat heart. [0128] E. Measurement
of human GATA-2 mRNA expression in the bone marrow and heart of
infarcted rats receiving either CD34-positive cells (>95% CD34
purity), CD34-negative cells (<5% CD34 purity), normalized for
total human RNA measured by GAPDH expression. GATA-2 mRNA in
ischemic tissue is expressed as the fold increase above that
present under the same experimental condition in the absence of
ischemia. Bone marrow from ischemic rats receiving either CD34+ or
CD34- cells contained similar levels of human GATA-2 mRNA, and
showed a similar fold induction in GATA-2 mRNA expression after
ischemia. In contrast, ischemic hearts of rats receiving CD34+
cells contained much higher levels of human GATA-2 mRNA than those
receiving CD34- cells. Moreover, the degree of increase in GATA-2
mRNA expression after infarction was 2.6-fold higher for hearts
infiltrated by CD34+ cells compared with CD34- cells, indicating
that GATA-2+ cells within the CD34+ fraction selectively traffic to
ischemic myocardium. [0129] F. Consecutive sections of a blood
vessel within the infarct bed of a nude rat two weeks after
injection of human CD34+ cells. The vessel incorporates human
endothelial cells, as defined by co-expression of DiI, HLA class I
as measured by immunofluorescence using a fluorescein-conjugated
mAb, and factor VIII, as measured by immunoperoxidase using a
biotin-conjugated mAb.
[0130] FIG. 5. Injection of G-CSF Mobilized Human CD34+ Cells Into
Rats With Acute Infarction Improves Myocardial Function.
[0131] A-D compares the functional effects of injecting
2.times.10.sup.6 G-CSF mobilized human CD34+ (>95% purity)
cells, CD34- (<5% purity) cells, peripheral saphenous vein
cells, or saline, into infarcted rat myocardium. [0132] A. Although
left ventricular ejection fraction (LVEF) was severely depressed in
each group of recipients after LAD ligation, only injection of
G-CSF mobilized adult human CD34+ cells was accompanied by
significant, and sustained, LVEF recovery (p<0.001). LVEF
recovery was calculated as the mean % improvement between LVEF
after LAD ligation and pre-infarct LVEF. [0133] B. Similarly,
although left ventricular end-systolic area (LVAs) was markedly
increased in each group of recipients after LAD ligation, only
injection of G-CSF mobilized adult human CD34+ cells was
accompanied by significant, and sustained, reduction in LVAs
(p<0.001). Reduction in LVAs was calculated as the mean %
improvement between LVAs after LAD ligation and pre-infarct LVAs.
[0134] C. Representative echocardiographic examples from each group
are shown. At 48 hours after LAD ligation, diastolic function is
severely compromised in each rat. At two weeks after injection,
diastolic function is improved only in the rat receiving CD34+
cells. This effect persists at 15 weeks. [0135] D. At 15 weeks
post-infarction, rats injected with CD34+ cells demonstrated
significantly less reduction in mean cardiac index relative to
normal rats than each of the other groups (p<0.001).
[0136] FIG. 6. Injection Of G-CSF Mobilized Human CD34+ Cells Into
Rats With Acute Infarction Induces Neo-Angiogenesis And Modifies
The Process Of Myocardian Remodeling.
[0137] A-D depicts infarcted rat myocardium at two weeks post-LAD
ligation from representative experimental and control animals
stained with either hematoxylin and eosin (A,B) or immunoperoxidase
following binding of anti-factor VIII mAb (C,D). E,F depicts Mason
trichrome stain of infarcted rat myocardium from representative
control and experimental animals at 15 weeks post-LAD ligation. G
depicts between-group differences in % scar/normal left ventricular
tissue at 15 weeks. [0138] A. Infarct zone of rat injected with
human CD34+ cells demonstrates significant increase in
microvascularity and cellularity of granulation tissue, numerous
capillaries (arrowheads), feeding vessels (arrow), and decrease in
matrix deposition and fibrosis (.times.200). [0139] B. In contrast,
infarct zone of control rat injected with saline shows a myocardial
scar composed of paucicellular, dense fibrous tissue (arrows)
(.times.200). [0140] C. Ischemic myocardium of rat injected with
human CD34+ cells demonstrates numerous factor VIII-positive
interstitial angioblasts (arrows), and diffuse increase in factor
VIII-positive capillaries (arrowheads) (.times.400). [0141] D.
Ischemic myocardium of rat injected with saline does not contain
factor VIII-positive angioblasts (arrows), and demonstrates only
focal areas of granulation tissue with factor VIII positive
vascularity (arrowheads) (.times.400). [0142] E. Trichrome stain of
rat myocardium at 15 weeks post-infarction in rat injected with
saline (.times.25). The collagen rich myocardial scar in the
anterior wall of the left ventricle (ant.) stains blue and viable
myocardium stains red. Focal islands of collagen deposition (blue)
are also present in the posterior wall of the left ventricle
(post). There is extensive loss of anterior wall myocardial mass,
with collagen deposition and scar formation extending almost
through the entire left ventricular wall thickness, causing
aneurysmal dilatation and typical EKG abnormalities (persistent ST
segment elevation). [0143] F. In contrast, trichrome stain of rat
myocardium at 15 weeks post-infarction in rat receiving highly
purified CD34+ cells (.times.25) demonstrates significantly reduced
infarct zone size together with increased mass of viable myocardium
within the anterior wall (ant.) and normal EKG. Numerous vessels
are evident at the junction of the infarct zone and viable
myocardium. There is no focal collagen deposition in the left
ventricular posterior wall (post). [0144] G. Rats receiving CD34+
cells had a significant reduction in mean size of scar tissue
relative to normal left ventricular myocardium compared with each
of the other groups (p<0.01). Infarct size, involving both
epicardial and endocardial regions, was measured with a planimeter
digital image analyzer and expressed as a percentage of the total
ventricular circumference at a given slice. For each animal, final
infarct size was calculated as the average of 10-15 slices.
[0145] FIG. 7. Human Adult Bone Marrow-Derived Endothelial
Precursor Cells Infiltrate Ischemic Myocardium, Inducing Infarct
Bed Neoangiogenesis And Preventing Collagen Deposition. [0146] A.
Four-parameter flow cytometric phenotypic characterization of G-CSF
mobilized bone marrow-derived cells removed by leukopheresis from a
representative human donor adult. Only live cells were analyzed, as
defined by 7-AAD staining. For each marker used, shaded areas
represent background log fluorescence relative to isotype control
antibody. The CD34+CD117.sup.bright subset contains a population
expressing markers characteristic of primitive haemangioblasts
arising during waves of murine and human embryogenesis, but not
markers of mature endothelium. These cells also express CXC
chemokine receptors. [0147] B. DiI-labeled human CD34-enriched
cells (>98% CD34 purity) injected intravenously into nude rats
infiltrate rat myocardium after coronary artery ligation and
infarction but not after sham operation at 48 hours. [0148] C. The
myocardial infarct bed at two weeks post-LAD ligation from
representative rats receiving 2.0.times.10.sup.6 G-CSF mobilized
human bone marrow-derived cells at 2%, 40%, or 98% CD34+ purity,
and stained with either Masson's trichrome or immunoperoxidase. The
infarct zones of rats receiving either 2% or 40% pure CD34+ cells
show myocardial scars composed of paucicellular, dense fibrous
tissue stained blue (.times.400). In contrast, the infarct zone of
the rat injected with 98% pure human CD34+ cells demonstrates
significant increase in microvascularity and cellularity of
granulation tissue, numerous capillaries, and minimal matrix
deposition and fibrosis (.times.400). Moreover, immunoperoxidase
staining following binding of anti-factor VIII mAb shows that the
infarct bed of the rat injected with 98% pure CD34+ cells
demonstrates markedly increased numbers of factor VIII-positive
capillaries, which are not seen in either of the other animals
(.times.400).
[0149] FIG. 8. Migration Of Human Bone marrow-Derived Endothelial
Precursor Cells To The Site Of Infarction Is Dependent On
Interactions Between CXCR1/2 And IL-8/Gro-Alpha Induced By
Myocardial Ischemia. [0150] A,B. Time-dependent increase in rat
myocardial IL-8 and Gro-alpha mRNA expression relative to GAPDH
from rats undergoing LAD ligation. [0151] C. IL-8, Gro-alpha, and
GAPDH mRNA expression at baseline, 12 hours and 48 hours after LAD
ligation from a representative animal. [0152] D. Time-dependent
measurement of rat IL-8/Gro-alpha protein in serum of rats
undergoing LAD ligation. Migration of CD34+ human bone
marrow-derived cells to ischemic rat myocardium is inhibited by
mAbs against either rat IL-8 or the IL-8/Gro chemokine family
receptors CXCR1 and CXCR2 (all p<0.01), but not against VEGF or
its receptor Flk-1 (results are expressed as mean .+-. sem of three
separate experiments).
[0153] FIG. 9. CXC Chemokines Directly Induce Chemotaxis Of Bone
Marrow-Derived Human CD34+ Cells To Rat Myocardium.
[0154] A and B depict results of in vitro chemotaxis of 98% pure
human CD34+ cells to various conditions using a 48-well chemotaxis
chamber (Neuro Probe, MD). Chemotaxis is defined as the number of
migrating cells per high power field (hpf) after examination of 10
hpf per condition tested. [0155] A. IL-8 induces chemotaxis in a
dose-dependent manner (results are expressed as mean .+-. sem of
three separate experiments). [0156] B. Chemotaxis is increased in
response to IL-8 and SDF-1 alpha/beta, but not VEGF or SCF. [0157]
C. Representative fluorescence microscopy demonstrating increased
infiltration of intravenously-injected DiI-labeled human CD34+
cells (98% purity) into rat heart after intracardiac injection with
IL-8 compared with saline injection. [0158] D. Intracardiac
injection of IL-8 at 1 mg/ml significantly increases in vivo
chemotaxis of DiI-labeled human CD34+ cells (98% purity) into rat
heart in comparison with injection of saline, VEGF or stem cell
factor (SCF), p<0.01 (results are expressed as mean .+-. sem of
three separate experiments).
[0159] FIG. 10. Blocking CXCR4/SDF-1 Interactions Redirects
Intravenously Injected Human CD34+ Angioblasts From Bone Marrow To
Ischemic Myocardium. [0160] A. Depicted is the response of
single-donor CD34-positive human cells cultured for 96 hours in
RPMI with 20% normal rat serum, ischemic rat serum or 20 ng/ml
VEGF. The numbers of CD117.sup.brightGATA-2.sup.pos cells were
quantitated by both [.sup.3H] thymidine uptake and by flow
cytometry. Ischemic serum induced a greater proliferative response
of CD117.sup.brightGATA-2.sup.pos cells compared with each of the
other conditions (both p<0.01). [0161] B. The proportion of
human CD34+ cells in rat bone marrow 2-14 days after intravenous
injection is significantly increased after ischemia induced by LAD
ligation (results are expressed as mean .+-. sem of bone marrow
studies in three animals at each time point). [0162] C,D. Effects
of mAbs against CXCR4, SDF-1 or anti-CD34 on trafficking of human
CD34+ cells to rat bone marrow and myocardium following LAD
ligation. Co-administration of anti-CXCR4 or anti-SDF-1
significantly reduced trafficking of 98% pure CD34+ cells to rat
bone marrow at 48 hours and increased trafficking to ischemic
myocardium (results are expressed as mean .+-. sem of bone marrow
and cardiac studies performed in three LAD-ligated animals at 48
hours after injection).
[0163] FIG. 11. Redirected Trafficking Of Human CD34+ Angioblasts
To The Site Of Infarction Prevents Remodeling And Improves
Myocardial Function. [0164] A,B. The effects of human CD34+ cells
on reduction in LVAs (A) and improvement in LVEF (B) after
myocardial infarction. Whereas injection of 2.0.times.10.sup.6
human cells containing 98% CD34+ purity significantly improved LVEF
and reduced LVAs (both p<0.01), injection of 2.0.times.10.sup.6
human cells containing 2% and 40% CD34+ purity did not have any
effect on these parameters in comparison to animals receiving
saline. However, co-administration of anti-CXCR4 together with 40%
pure CD34+ cells significantly improved LVEF and reduced LVAs (both
p<0.01), to levels approaching use of cells with 98% purity.
[0165] C. Sections of rat hearts stained with Masson's trichrome at
15 weeks after LAD ligation and injection of 2.0.times.10.sup.6
human cells containing 2%, 40%, or 98% CD34+ purity. Hearts of rats
receiving 2% and 40% pure CD34+ cells had greater loss of anterior
wall mass, collagen deposition (blue), and septal hypertrophy
compared with hearts of rats receiving 98% pure CD34+ cells.
Co-administration of anti-CXCR4 mAb together with 40% pure CD34+
cells increased left ventricular wall mass and reduced collagen
deposition. [0166] D. Shows the mean proportion of scar/normal left
ventricular myocardium in rats receiving >98% pure CD34+ cells
or 40% pure CD34+ cells together with anti-CXCR4 mAb is
significantly reduced in comparison to rats receiving 2% and 40%
pure CD34+ cells (p<0.01) (results are expressed as mean .+-.
sem of three separate experiments).
[0167] FIG. 12. Culture of CD34+CD117.sup.bright angioblasts with
serum from LAD-ligated rats increases surface expression of CCR1
and CCR2, while surface expression of CCR3 and CCR5 remains
unchanged.
[0168] FIG. 13. Infarcted myocardium demonstrate a time-dependent
increase in mRNA expression of several CCR-binding chemokines.
[0169] FIG. 14. Co-administration of blocking mAbs against MCP-1,
MCP-3, and RANTES, or against eotaxin, reduced myocardial
trafficking of human angioblasts by 40-60% relative to control
antibodies (p<0.01).
[0170] FIG. 15. Intracardiac injection of eotaxin into
non-infarcted hearts induced 1.5-1.7 fold increase in CD34+
angioblast trafficking whereas injection of the growth factors VEGF
and stem cell factor had no effect on chemotaxis despite increasing
angioblast proliferation (not shown).
DETAILED DESCRIPTION OF THE INVENTION
[0171] As used herein, and unless stated otherwise, each of the
following terms shall have the definition set forth below.
[0172] As used herein, "BMEC" is defined as bone marrow-derived
endothelial cells.
[0173] As used herein, vasculogenesis is defined as the creation of
new blood vessels from cells that are "pre-blood" cells such as
bone marrow-derived endothelial cell precursors.
[0174] As used herein, mobilization is defined as inducing bone
marrow-derived endothelial cell precursors to leave the bone marrow
and enter the peripheral circulation. One of skill is aware that
mobilized stem cells may be removed from the body by
leukopheresis.
[0175] As used herein, ischemia is defined as inadequate blood
supply (circulation) to a local area due to blockage of the blood
vessels to the area.
[0176] As used herein, cytokine is defined as a factor that causes
cells to grow or activate.
[0177] As used herein, chemokine is defined as a factor that causes
cells to move to a different area within the body.
[0178] As used herein, ischemic heart disease is defined as any
condition in which blood supply to the heart is decreased.
[0179] As used herein, "angiogenesis" is defined as the creation of
blood vessels from pre-existing blood vessel cells.
[0180] As used herein, ischemic heart disease is defined as any
condition in which blood supply to the heart is decreased.
[0181] As used herein, "VEGF" is defined as vascular endothelial
growth factor. "VEGF-R" is defined as vascular endothelial growth
factor receptor. "FGF" is defined as fibroblast growth factor.
"IGF" is defined as Insulin-like growth factor. "SCF" is defined as
stem cell factor. "G-CSF" is defined as granulocyte colony
stimulating factor. "M-CSF" is defined as macrophage colony
stimulating factor. "GM-CSF" is defined as granulocyte-macrophage
colony stimulating factor. "MCP" is defined as monocyte
chemoattractant protein.
[0182] As used herein, "CXC" chemokine refers to the structure of
the chemokine. Each "C" represents a cysteine and "X" represents
any amino acid.
[0183] As used herein, "CC" chemokine refers to the structure of
the chemokine. Each "C" represents a cysteine.
[0184] As used herein, "recovered" means detecting and obtaining a
cell based on the recoverable cell being a cell that binds a
detectably labeled antibody directed against a specific marker on a
cell including, but not limited to, CD117, GATA-2, GATA-3, and
CD34.
[0185] As described herein, the chemokine administered to the
subject could be in the protein form or nucleic acid form.
[0186] This invention provides a method of stimulating
vasculogenesis in ischemia-damaged tissue of a subject comprising:
[0187] (a) removing stem cells from a location within the subject;
[0188] (b) recovering endothelial progenitor cells from the stem
cells removed in step (a); and [0189] (c) introducing the
endothelial progenitor cells from step (b) into a different
location within the subject such that the endothelial progenitor
cells stimulate vasculogenesis in the subject's ischemia-damaged
tissue.
[0190] In a further embodiment the endothelial progenitors are
frozen for a period of time in between steps (b) and (c). In one
embodiment the ischemia-damaged tissue is myocardium. In another
embodiment the ischemia-damaged tissue is nervous system
tissue.
[0191] In one embodiment the endothelial progenitors are expanded
by contacting the endothelial progenitors with a growth factor
subsequent to step (b), but before step (c). In a further
embodiment the growth factor is a cytokine. In further embodiments
the cytokine is VEGF, FGF, G-CSF, IGF, M-CSF, or GM-CSF. In another
embodiment the growth factor is a chemokine. In a further
embodiment the chemokine is Interleukin-8. In one embodiment the
endothelial progenitors are separated from other stem cells before
expansion. In a further embodiment the endothelial progenitors are
frozen for a period of time after expansion but before step
(c).
[0192] In one embodiment step (a) occurs prior to the subject
suffering ischemia-damaged tissue and wherein step (c) occurs after
the subject has suffered ischemia-damaged tissue.
[0193] In one embodiment the stem cells are removed directly from
the subject's bone marrow. In a further embodiment the stem cells
are removed by aspiration from the subject's bone marrow. In one
embodiment the stem cells are removed from the subject by a method
comprising: [0194] a) introducing a growth factor into the subject
to mobilize the stem cells into the subject's blood; and [0195] b)
subsequently removing a sample of blood containing stem cells from
the subject.
[0196] In a further embodiment the growth factor is introduced
subcutaneously, orally, intravenously or intramuscularly. In one
embodiment the growth factor is a chemokine that induces
mobilization. In a further embodiment the chemokine is
interleukin-8. In one embodiment the growth factor is a cytokine.
In a further embodiment the cytokine is G-CSF, M-CSF, or
GM-CSF.
[0197] This invention also provides the instant method, wherein the
endothelial progenitor cells are recovered based upon their
expression of CD117.
[0198] This invention also provides the instant method, wherein the
endothelial progenitor cells are recovered based upon their
expression of a GATA-2 activated gene product. In one embodiment
the gene product is selected from the following group:
preproendothelin-1, big endothelin, endothelin-1.
[0199] In one embodiment the endothelial progenitors express
GATA-2, and the endothelial progenitors are recovered as such by
detection of intracellular GATA-2 expression or GATA-2 activity in
those cells.
[0200] In one embodiment the subject has suffered or is suffering
from one or more of the following: myocardial infarction, chronic
heart failure, ischemic heart disease, coronary artery disease,
diabetic heart disease, hemorrhagic stroke, thrombotic stroke,
embolic stroke, limb ischemia or another disease in which tissue is
rendered ischemic.
[0201] In one embodiment the endothelial progenitors are introduced
into the subject by injection directly into the peripheral
circulation, heart muscle, left ventricle, right ventricle,
coronary artery, cerebro-spinal fluid, neural tissue, ischemic
tissue or post-ischemic tissue.
[0202] In one embodiment the method further comprises administering
to the subject one or more of the following: an inhibitor of
Plasminogen Activator Inhibitor, Angiotensin Converting Enzyme
Inhibitor or a beta blocker, wherein such administration occurs
prior to, concomitant with, or following step (c).
[0203] This invention also provides a method of stimulating
angiogenesis in peri-infarct tissue in a subject comprising: [0204]
(a) removing stem cells from a location within a subject; [0205]
(b) recovering endothelial progenitor cells from the stem cells
removed in step (a); [0206] (c) expanding the endothelial
progenitor cells recovered in step (b) by contacting the progenitor
cells with a growth factor; and [0207] (d) introducing the expanded
endothelial progenitor cells from step (c) into a different
location in the subject such that the endothelial progenitor cells
stimulate angiogenesis in peri-infarct tissue in the subject.
[0208] This invention also provides a method of selectively
increasing the trafficking of endothelial progenitor cells to
ischemia-damaged tissue in a subject comprising: [0209] (a)
administering endothelial progenitor cells to a subject; and [0210]
(b) administering a chemokine to the subject so as to thereby
attract the endothelial progenitor cells to the ischemia-damaged
tissue.
[0211] In one embodiment the chemokine is administered to the
subject prior to administering the endothelial progenitors. In an
alternative embodiment the chemokine is administered to the subject
concurrently with the endothelial progenitors. In an alternative
embodiment the chemokine is administered to the subject after
administering the endothelial progenitors. In one embodiment the
chemokine is a CXC chemokine. In a further embodiment the CXC
chemokine is selected from the group consisting of Interleukin-8,
Gro-Alpha, or Stromal-Derived Factor-1. In one embodiment the
chemokine is a CC chemokine. In a further embodiment the CC
chemokine is selected from the group consisting of RANTES, EOTAXIN,
MCP-1, MCP-2, MCP-3, or MCP-4.
[0212] In one embodiment the chemokine is administered to the
subject by injection into peripheral circulation, heart muscle,
left ventricle, right ventricle, coronary arteries, cerebro-spinal
fluid, neural tissue, ischemic tissue or post-ischemic tissue.
[0213] This invention also provides a method of increasing
trafficking of endothelial progenitor cells to ischemia-damaged
tissue in a subject comprising inhibiting any interaction between
Stromal-Derived Factor-1 and CXCR4.
[0214] In one embodiment the interaction between Stromal-Derived
Factor-1 (SDF-1) and CXCR4 is inhibited by administration of an
anti-SDF-1 or an anti-CXCR4 monoclonal antibody to the subject. In
one embodiment the instant method further comprises administering
to the subject ACE inhibitor, AT-receptor blocker, or beta blocker.
ng enzyme inhibitor, an AT.sub.1-receptor blocker, or a beta
blocker.
[0215] This invention also provides a method of reducing
trafficking of endothelial progenitor cells to bone marrow in a
subject comprising inhibiting production of Stromal-Derived
Factor-1 in the subject's bone marrow. In one embodiment the SDF-1
production is inhibited by administration of an anti-SDF-1 or
anti-CXCR4 monoclonal antibody to the subject.
[0216] This invention also provides a method for treating a cancer
in a subject comprising administering to the subject a monoclonal
antibody directed against an epitope of a specific chemokine
produced by proliferating cells associated with the cancer so as to
reduce trafficking of endothelial progenitor cells to such
proliferating cells and thereby treat the cancer in the
subject.
[0217] This invention also provides a method for treating a cancer
in a subject comprising administering to the subject a monoclonal
antibody directed against an epitope of a specific receptor located
on an endothelial progenitor cell, for a chemokine produced by
proliferating cells associated with the cancer, so as to reduce
trafficking of the endothelial progenitor cell to such
proliferating cells and thereby treat the cancer in the
subject.
[0218] This invention also provides a method for treating a tumor
in a subject comprising administering to the subject an antagonist
to a specific receptor on an endothelial progenitor cell so as to
reduce the progenitor cell's ability to induce vasculogenesis in
the subject's tumor and thereby treat the tumor.
[0219] This invention also provides a method for treating a tumor
in a subject comprising administering to the subject an antagonist
to a specific receptor on an endothelial progenitor cell so as to
reduce the progenitor cell's ability to induce angiogenesis in the
subject's tumor and thereby treat the tumor.
[0220] This invention also provides a method for expressing a gene
of interest in an endothelial progenitor cell or a mast progenitor
cell which comprises inserting into the cell a vector comprising a
promoter containing a GATA-2 motif and the gene of interest.
[0221] This invention also provides the instant method, wherein the
vector is inserted into the cell by transfection.
[0222] This invention also provides the instant method, wherein the
promoter is a preproendothelin-1 promoter.
[0223] This invention also provides the instant method, wherein the
promoter is of mammalian origin.
[0224] This invention also provides the instant method, wherein the
promoter is of human origin.
[0225] This invention provides a composition comprising an amount
of a monoclonal antibody directed against an epitope of a specific
chemokine produced by a cancer effective to reduce trafficking of
endothelial progenitor cells to the cancer, and a pharmaceutically
acceptable carrier.
[0226] This invention provides a method of treating an abnormality
in a subject wherein the abnormality is treated by the expression
of a GATA-2 activated gene product in the subject comprising:
[0227] (a) removing stem cells from a location within the subject;
[0228] (b) recovering endothelial progenitor cells from the stem
cells removed in step (a); [0229] (c) recovering those endothelial
progenitor cells recovered in step (b) that express GATA-2; [0230]
(d) inducing the cells recovered in step (c) as expressing GATA-2
to express a GATA-2 activated gene product; and [0231] (e)
introducing the cells expressing a GATA-2 activated gene product
from step (d) into a different location in the subject such as to
treat the abnormality.
[0232] In one embodiment the abnormality is ischemia-damaged
tissue. In one embodiment the gene product is proendothelin. In one
embodiment the gene product is endothelin. In one embodiment the
subject is a mammal. In a further embodiment the mammal is a
human
[0233] This invention provides a method of treating an abnormality
in a subject wherein the abnormality is treated by the expression
of a GATA-2 activated gene product in the subject comprising:
[0234] (a) removing stem cells from a location within the subject;
[0235] (b) recovering mast progenitor cells from the stem cells
removed in step (a); [0236] (c) recovering those mast progenitor
cells recovered in step (b) that express GATA-2; [0237] (d)
inducing the cells recovered in step (c) as expressing GATA-2 to
express a GATA-2 activated gene product; and [0238] (e) introducing
the cells expressing a GATA-2 activated gene product from step (d)
into a different location in the subject such as to treat the
abnormality
[0239] In one embodiment the abnormality is ischemia-damaged
tissue. In one embodiment the gene product is proendothelin. In one
embodiment the gene product is endothelin. In one embodiment the
subject is a mammal. In a further embodiment the mammal is a
human
[0240] This invention provides the a method of improving myocardial
function in a subject that has suffered a myocardial infarct
comprising: [0241] (a) removing stem cells from a location in the
subject; [0242] (b) recovering cells that express CD117 from the
stem cells; and [0243] (c) introducing the recovered cells into a
different location in the subject such that the cells improve
myocardial function in the subject.
[0244] In one embodiment the subject is a mammal. In a further
embodiment the mammal is a human.
[0245] This invention also provides a method of stimulating
vasculogenesis in ischemia-damaged tissue in a subject comprising:
[0246] (a) obtaining allogeneic stem cells; [0247] (b) recovering
endothelial progenitor cells from the stem cells removed in step
(a); and [0248] (c) introducing the endothelial progenitor cells
recovered in step (b) into the subject such that the endothelial
progenitor cells stimulate vasculogenesis in the subject's
ischemia-damaged tissue.
[0249] In alternative embodiments the allogeneic stem cells are
removed from embryonic, fetal or cord blood sources.
[0250] This invention provides a method of stimulating angiogenesis
in ischemia-damaged tissue in a subject comprising: [0251] (a)
obtaining allogeneic stem cells; [0252] (b) recovering endothelial
progenitor cells in the stem cells removed in step (a); and [0253]
(c) introducing the endothelial progenitor cells recovered in step
(b) into the subject such that the endothelial progenitor cells
stimulate angiogenesis in the subject's ischemia-damaged
tissue.
[0254] In alternative embodiments the allogeneic stem cells are
removed from embryonic, fetal or cord blood sources.
[0255] This invention also provides a method of improving
myocardial function in a subject that has suffered a myocardial
infarct comprising injecting G-CSF into the subject in order to
mobilize endothelial progenitor cells.
[0256] This invention also provides a method of improving
myocardial function in a subject that has suffered a myocardial
infarct comprising injecting anti-CXCR4 antibody into the subject.
In one embodiment the method further comprises introducing
endothelial progenitors into the subject. In one embodiment the
method further comprises introducing G-CSF into the subject in
order to mobilize endothelial progenitors.
[0257] The present invention provides a method of selectively
increasing the trafficking of human bone marrow-derived endothelial
cell precursors to the site of tissue damaged by ischemic injury
which comprises administering chemokines to the subject so as to
thereby attract endothelial cell precursors to the ischemic tissue.
In an embodiment of this invention the ischemic tissue is
myocardium. In an embodiment of this invention the ischemic tissue
is neural tissue. In an embodiment of this invention the chemokine
is administered to the subject by injection into peripheral
circulation, heart muscle, left ventricle, right ventricle,
coronary arteries, spinal fluid, neural tissue, or other site of
ischemia. In an embodiment of this invention the chemokine is a CXC
chemokine. In an embodiment of this invention the CXC chemokine is
selected from the group consisting of Interleukin-8 (IL-8),
Gro-Alpha, and Stromal Derived Factor-1 (SDF-1). In an embodiment
of this invention the chemokine is a CC chemokine. In an embodiment
of this invention the CC chemokine is selected from the group
consisting of MCP-1, MCP-2, MCP-3, MCP-4, RANTES, and EOTAXIN.
[0258] This invention will be better understood by reference to the
Experimental Details which follow, but those skilled in the art
will readily appreciate that the specific experiments detailed are
only illustrative of the invention as described more fully in the
claims which follow thereafter.
Experimental Details
First Series of Experiments
Experimental Procedures and Results
1. Mobilization and Identification of Bone Marrow-Derived Cells
[0259] Following G-CSF mobilization, 60-80% of highly purified
human CD34 cells (>90% positive) co-expressed the stem cell
factor receptor CD117, FIG. 1a, of which 15-25% expressed CD117
brightly and 75-85% expressed CD117 dimly. By quadruple parameter
analysis, two populations of CD34 cells were recovered which
expressed VEGFR-2 (Flk-1), one accounting for 20-30% of
CD117.sup.dim cells and expressing high levels of VEGFR-2, and a
second accounting for 10-15% of CD117.sup.bright cells and
expressing lower levels of VEGFR-2, FIG. 1b. The VEGFR-2 positive
cells within the CD34+CD117.sup.dim population, but not those
within the CD34+CD117.sup.bright subset, displayed phenotypic
characteristics of mature, vascular endothelium, including high
level expression of Tie-2, ecNOS, vWF, E-selectin (CD62E), and ICAM
(CD54). In contrast, as shown in FIG. 1c, the VEGFR-2 positive
cells within the CD34+CD117.sup.bright subset, but not those within
the CD34+CD117.sup.dim subset, expressed markers characteristic of
primitive hemangioblasts arising during waves of murine and human
embryogenesis, including GATA-2, GATA-3, and low levels of Tie-2.
Moreover, CD117.sup.bright cells which co-expressed GATA-2 and
GATA-3 were also strongly AC133 positive, another marker which has
recently been suggested to define a hematopoietic population with
angioblast potential (2), FIG. 1d. However, since AC133 expression
was also detected on a subset of CD117.sup.dim cells which was
negative for GATA-2 and GATA-3, we conclude that identification of
an embryonic bone-marrow derived angioblast (BA) phenotype requires
concomitant expression of GATA-2, GATA-3, and CD117.sup.bright in
addition to AC133. Thus, G-CSF treatment mobilizes into the
peripheral circulation a prominent population of mature, bone
marrow-derived endothelial cells (BMEC), and a smaller bone
marrow-derived population with phenotypic characteristics of
embryonic angioblasts (BA).
2. Expansion of Bone Marrow-Derived Cells
[0260] Since the frequency of circulating endothelial cell
precursors in animal models has been shown to be increased by
either VEGF (27) or regional ischemia (10-13), we next compared the
proliferative responses of BA and BMEC to VEGF and to factors in
ischemic serum (28). As shown in FIG. 2a, following culture for 96
hours with either VEGF or ischemic serum,
CD117.sup.brightGATA-2.sup.pos BA demonstrated significantly higher
proliferative responses relative to CD117.sup.dimGATA-2.sup.neg
BMEC from the same donor. For VEGF, BA showed 2.9-fold increase in
proliferation above baseline compared with 1.2-fold increase for
BMEC, p<0.01, while for ischemic serum from Lew rats with
myocardial infarction BA showed 4.3-fold increase in proliferation
above normal serum compared with 1.7-fold increase for BMEC,
p<0.01. Culture with either VEGF or ischemic serum greatly
expanded the BA population of large blast cells, FIG. 2b, which
continued to express immature markers, including GATA-2, GATA-3,
and CD117.sup.bright, but not markers of mature endothelial cells,
FIG. 2c, indicating blast proliferation without differentiation.
Following culture of CD34-positive monolayers on fibronectin in
endothelial growth medium for 7 days (29), an exuberant cobblestone
pattern of proliferation was seen, FIG. 3a, with the majority of
the adherent monolayers (>95%) having features characteristic of
endothelial cells, FIG. 3b-e, including uniform uptake of
acetylated LDL, and co-expression of CD34, factor VIII, and eNOS.
Since the BMEC population had low proliferative responses to VEGF
or cytokines in ischemic serum, the origin of the exuberant
endothelial cell outgrowth in culture is most likely the BA
population defined by surface expression for GATA-2, GATA-3, and
CD117.sup.bright.
3. In vivo Migration of Bone Marrow-Derived CD34+ Cells to Sites of
Regional Ischemia
[0261] Next we compared the in vivo migratory and proliferative
characteristics of bone marrow- and peripheral vasculature-derived
human cells after induction of regional ischemia. As shown in FIG.
4a-c, intravenous injection of 2.times.10.sup.6 DiI-labeled human
CD34-positive cells (>95% CD34 purity), CD34-negative cells
(<5% CD34 purity), or saphenous vein endothelial cells (SVEC),
into nude rats after coronary artery ligation and infarction
resulted in similar degree of infiltration in rat myocardium at 48
hours (30) The trafficking was specifically directed to the infarct
area since few DiI-labeled cells were detected in unaffected areas
of hearts with regional infarcts, not shown, and neither G-CSF
mobilized CD34+ cells nor mature human endothelial cells
infiltrated normal myocardium, FIG. 4d. Although similar numbers of
CD34+ and CD34- cells migrated to ischemic myocardium, the
proportional increase in human GATA-2 mRNA expression in ischemic
myocardium relative to normal myocardium (31) was 2.6-fold greater
following injection of highly CD34-enriched cells compared with
CD34- cells (p<0.001), FIG. 4e. Moreover, blood vessels which
incorporated human endothelial cells, as defined by co-expression
of DiI, HLA class I, and factor VII, could be detected two weeks
after injection of human CD34+ cells, but not after injection of
CD34- cells or SVEc, FIG. 4f. Together, these results indicate that
adult bone marrow-derived human CD34+ cells contain a population
which selectively responds to in vivo signals from sites of
regional ischemia with augmented migration, localization, and
endothelial differentiation.
4. Effects of Injection of G-CSF mobilized Human CD34+ Cells into
Infarcted Rat Myocardium
[0262] We next compared the functional effects of injecting G-CSF
mobilized human CD34+ (>95%) cells, CD34- (<5%) cells,
peripheral saphenous vein cells, or saline, into infarcted rat
myocardium. After LAD ligation, left ventricular function was
severely depressed in each group of recipients, with left
ventricular ejection fraction (LVEF) being reduced by means of
25-43% and left ventricular end-systolic area being increased by
means of 44-90%, FIG. 5 a and b. Remarkably, within two weeks of
injecting G-CSF mobilized adult human CD34+ cells, LVEF recovered
by a mean of 22.+-.6% (p<0.001), FIG. 5a. This effect was
long-lived, and increased by the end of follow-up, 15 weeks, to
34.+-.4%. In contrast, injection of G-CSF mobilized human CD34-
cells, saphenous vein endothelial cells, or saline, had no effect
on LVEF. In a parallel fashion, injection of G-CSF mobilized human
CD34+ cells reduced left ventricular end-systolic area by a mean of
26.+-.8% by 2 weeks and 37.+-.6% by 15 weeks, whereas none of the
other recipient groups demonstrated such effect (p<0.001), FIG.
5b. Representative echocardiographic examples for each group are
shown in FIG. 5c. Moreover, at 15 weeks post-infarction mean
cardiac index in rats injected with CD34+ cells was only reduced by
26.+-.8% relative to normal rats, whereas mean cardiac index for
each of the other groups was reduced by 48-59% (p<0.001), FIG.
5d.
[0263] Histologic examination at two weeks post-infarction (33)
revealed that injection of CD34+ cells was accompanied by
significant increase in microvascularity and cellularity of
granulation tissue, and decrease in matrix deposition and fibrosis
within the infarct zone in comparison to controls, FIG. 6 a and b.
Moreover, ischemic myocardium of rats injected with human CD34+
cells contained significantly greater numbers of factor
VIII-positive interstitial angioblasts and capillaries in
comparison to ischemic myocardium of control rats, FIG. 6 c and d.
Quantitation of capillary numbers demonstrated a significant
increase in neo-angiogenesis within the infarct zone of rats who
received CD34+ cells (mean number of factor VIII-positive
capillaries per high power field 92.+-.5 vs 51.+-.4 in saline
controls, p<0.01), but not within normal myocardium (36.+-.2 vs
37.+-.3 capillaries per high power field). No increase in capillary
numbers were observed in ischemic rat myocardium infiltrated with
CD34- cells or SVEC. At 15 weeks post-infarction, rats receiving
highly purified CD34+ cells demonstrated significantly reduced
infarct zone sizes together with increased mass of viable
myocardium within the anterior free wall compared to each of the
other groups, FIGS. 6e and f. Numerous vessels were evident at the
junction of the infarct zone and viable myocardium in tissues
infiltrated with CD34+ cells. Whereas collagen deposition and scar
formation extended almost through the entire left ventricular wall
thickness in controls, with aneurysmal dilatation and typical EKG
abnormalities, the infarct scar extended only to 20-50% of the left
ventricular wall thickness in rats receiving CD34+ cells. Moreover,
pathological collagen deposition in the non-infarct zone was
markedly reduced in rats receiving CD34+ cells. Overall, the mean
proportion of scar/normal left ventricular myocardium was 13% in
rats receiving CD34+ cells compared with 36-45% for each of the
other groups (p<0.01), FIG. 6g.
Discussion
[0264] The experiments described above demonstrate that
neo-angiogenesis of the infarct bed by human bone marrow-derived
endothelial cell precursors prevents scar development, maintains
viable myocardium, and improves ventricular function in a rodent
model of myocardial ischemia. Following infarction, the viable
myocardial tissue bordering the infarct zone undergoes a
significant degree of hypertrophy (5, 34-35). Although
neoangiogenesis within the infarcted tissue appears to be an
integral component of the remodeling process (36,37), under normal
circumstances the capillary network cannot keep pace with tissue
growth and is unable to support the greater demands of the
hypertrophied, but viable, myocardium which subsequently undergoes
apoptosis due to inadequate oxygenation and nutrient supply. The
development of neoangiogenesis within the myocardial infarct scar
appears to require activation of latent collagenase and other
proteinases following plasminogen activation by urokinase-type
plasminogen activator (u-PA) expressed on infiltrating leukocytes
(38). The importance of bone marrow-derived endothelial precursors
in this process has been demonstrated in u-PA -/- mice where
transplantation of bone marrow from cogenic wild-type strains
restored defective myocardial revascularization post-infarction
(38). Since u-PA mRNA transcription and proteolytic activity in
human mononuclear cells and tumor cell lines is significantly
increased by the colony stimulating factors G-CSF, M-CSF, and
GM-CSF (39-41), this provides a rationale for in vivo or ex vivo
use of these cytokines to mobilize and differentiate large numbers
of human adult bone marrow-derived angioblasts for therapeutic
revascularization of the infarct zone.
[0265] Cell surface and RNA expression of the transcription factor
GATA-2 appears to selectively identify human adult bone
marrow-derived angioblasts capable of responding to signals from
ischemic sties by proliferating and migrating to the infarct zone,
and subsequently participating in the process of neo-angiogenesis.
Of particular interest, GATA-2 is a co-factor for endothelial cell
transcription of preproendothelin-1 (ppET-1) (42), the precursor
molecule of the potent vasoconstrictor and hypertrophic autocrine
peptide ET-1. Since ppET-1 transcription is also increased by
angiotensin II (43), produced as a result of activation of the
renin-angiotensin neurohormonal axis following myocardial
infarction, the angioblasts infiltrating the infarct bed may be
secreting high levels of ET-1 due to the synergistinc actions of
angiotensin II surface receptor signalling and GATA-2
transactivation. The observation that newly-formed vessels within
the infarct scar have thicker walls, lower vasodilator responses to
stronger vasoactive substances than vessels within normal
myocardium (44) are consistent with effects of increased autocrine
ET-1 activity, and support the possibility that neo-angiogenic
vasculature is derived from infiltrating GATA-2 positive
angioblasts.
[0266] Together, the results of the above-described experiments
indicate that injection of G-CSF mobilized adult human CD34+ cells
with phenotypic and functional properties of embryonic
hemangioblasts can stimulate neo-angiogenesis in the infarct
vascular bed, thus reducing collagen deposition and scar formation
in myocardial infarction. Although the degree of reduction in
myocardial remodeling as a result of neoangiogenesis was striking,
further augmentation in myocardial function might be achieved by
combining infusion of human angioblasts with ACE inhibition or
AT.sub.1-receptor blockade to reduce angiotensin II-dependent
cardiac fibroblast proliferation, collagen secretion, and
plasminogen activator-inhibitor (PAI) production (45, 46). The use
of cytokine-mobilized autologous human bone-marrow angioblasts for
revascularization of myocardial infarct tissue, in conjunction with
currently used therapies (47-49), offers the potential to
significantly reduce morbidity and mortality associated with left
ventricular remodeling post-myocardial infarction.
Second Series of Experiments
Methods
1. Purification of Cytokine-Mobilized Human CD34+ Cells
[0267] Single-donor leukopheresis products were removed from humans
treated with recombinant G-CSF 10 mg/kg (Amgen, Calif.) sc daily
for four days. Mononuclear cells were separated by Ficoll-Hypaque,
and highly-purified CD34+ cells (>98% positive) were removed
using magnetic beads coated with anti-CD34 monoclonal antibody
(mAb) (Miltenyi Biotech Ltd, CA). Purified CD34 cells were stained
with fluorescein-conjugated mAbs against CD34, CD117, VEGFR-2,
Tie-2, GATA-2, GATA-3, AC133, vWF, eNOS, CD54, CD62E, CXCR1, CXCR2,
CXCR4, and analyzed by four-parameter fluorescence using FACScan
(Becton Dickinson, Calif.).
2. Proliferative Studies of Human Endothelial Progenitors
[0268] Single-donor CD34-positive cells were cultured for 96 hours
in RPMI with either 20% normal rat serum, ischemic rat serum or 20
ng/ml VEGF, then pulsed with [.sup.3H] thymidine (Amersham Life
Science Inc, IL, USA) (1 mlCi/well) and uptake was measured in an
LK Betaplate liquid scintillation counter (Wallace, Inc.,
Gaithersburg, Md.). The proportion of
CD117.sup.brightGATA-2.sup.pos cells after 96 hours of culture in
each condition was also quantitated by flow cytometry.
3. Chemotaxis of Human Bone Marrow-Derived Endothelial
Progenitors
[0269] Highly-purified CD34+ cells (>98% positive) were plated
in 48-well chemotaxis chambers fitted with membranes (8 mm pores)
(Neuro Probe, MD). After incubation for 2 hours at 37.degree.,
chambers were inverted and cells were cultured for 3 hours in
medium containing IL-8 at 0.2, 1.0 and 5.0 mg/ml, SDF-1 alpha/beta
1.0 mg/ml, VEGF and SCF. The membranes were fixed with methanol and
stained with Leukostat (Fischer Scientific, Ill). Chemotaxis was
calculated by counting migrating cells in 10 high-power fields.
4. Animals, Surgical procedures, Injection of Human Cells, and
Quantitation of Cellular Migration into Tissues
[0270] Rowett (rnu/rnu) athymic nude rats (Harlan Sprague Dawley,
Indianapolis, Ind.) were used in studies approved by the "Columbia
University Institute for Animal Care and Use Committee". After
anesthesia, a left thoracotomy was performed, the pericardium was
opened, and the left anterior descending (LAD) coronary artery was
ligated. Sham-operated rats had a similar surgical procedure
without having a suture placed around the coronary artery 48 hours
after LAD ligation 2.0.times.10.sup.6 DiI-labeled human CD34+ cells
(>95%, 40%, <2% purity) removed from a single donor after
G-CSF mobilization were injected into the tail vein in the presence
or absence of mAbs with known inhibitory activity against CXCR1,
CXCR2, CXCR4, CD34, rat IL-8 (ImmunoLaboratories, Japan) and rat
SDF-1.RTM. & D Systems, MN), or isotype control antibodies.
Control animals received saline after LAD ligation. Each group
consisted of 6-10 rats. Quantitation of myocardial infiltration
after injection of human cells was performed by assessment of DiI
fluorescence in hearts from rats sacrificed 2 days after injection
(expressed as number of DiI-positive cells per high power field,
minimum 5 fields examined per sample). Quantitation of rat bone
marrow infiltration by human cells was performed in 12 rats at
baseline, days 2, 7, and 14 by flow cytometric and RT-PCR analysis
of the proportion of HLA class I-positive cells relative to the
total rat bone marrow population.
5. Analyses of Myocardial Function
[0271] Echocardiographic studies were performed at baseline, 48
hours after LAD ligation, and at 2, 6 and 15 weeks after injection
of cells or saline, using a high frequency liner array transducer
(SONOS 5500, Hewlett Packard, Andover, Mass.). 2D images were
removed at mid-papillary and apical levels. End-diastolic (EDV) and
end-systolic (ESV) left ventricular volumes were removed by
bi-plane area-length method, and % left ventricular ejection
fraction (LVEF) was calculated as [(EDV-ESV)/EDV].times.100. Left
ventricular area at the end of systole (LVAs) was measured by
echocardiography at the level of the mitral valve. LVEF recovery
and reduction in LVAs were calculated as the mean improvement
between the respective values for each at different time points
after LAD ligation relative to pre-infarct values.
6. Histology and Immunohistochemistry
[0272] Histologic studies were performed on explanted rat hearts at
2 and 15 weeks after injection of human cells or saline. Following
excision, left ventricles from each experimental animal were sliced
at 10-15 transverse sections from apex to base. Representative
sections were put into formalin for histological examination,
stained freshly with anti-factor VIII mAb using immunoperoxidase
technique to quantitate capillary density, or stained with Masson
trichrome and mounted. The lengths of the infarcted surfaces,
involving both epicardial and endocardial regions, were measured
with a planimeter digital image analyzer and expressed as a
percentage of the total ventricular circumference. Final infarct
size was calculated as the average of all slices from each
heart.
7. Measurement of Rat CXC Chemokine mRNA and Protein Expression
[0273] Poly(A)+ mRNA was extracted by standard methods from the
hearts of 3 normal and 12 LAD-ligated rats. RT-PCR was used to
quantify myocardial expression of rat IL-8 and Gro-alpha mRNA at
baseline and at 6, 12, 24 and 48 hours after LAD ligation after
normalizing for total rat RNA as measured by GAPDH expression.
After priming with oligo (dT) 15-mer and random hexamers, and
reverse transcribed with Monoley murine lymphotrophic virus reverse
transcriptase (Invitrogen, Carlsbad, Calif., USA), cDNA was
amplified in the polymerase chain reaction (PCR) using Taq
polymerase (Invitrogen, Carlsbad, Calif., USA), radiolabeled
dideoxy-nucleotide ([.alpha..sup.32P]-ddATP: 3,000 Ci/mmol,
Amersham, Arlington Heights, Ill.), and primers for rat IL-8,
Gro-alpha and GAPDH (Fisher Genosys, Calif.). Primer pairs
(sense/antisense) for rat IL-8, Gro-alpha AND GAPDH were,
gaagatagattgcaccgatg (SEQ ID NO:1)/catagcctctcacatttc (SEQ ID
NO:2), gcgcccgtccgccaatgagctgcgc (SEQ ID
NO:3)/cttggggacacccttcagcatcttttgg (SEQ ID NO:4), and
ctctacccacggcaagttcaa (SEQ ID NO:5)/gggatgaccttgcccacagc (SEQ ID
NO:6), respectively. The labeled samples were loaded into 2%
agarose gels, separated by electrophoresis, and exposed for
radiography for 6 h at -70.degree.. Serum levels of rat
IL-8/Gro-alpha were measured at baseline and at 6, 12, 24 and 48
hours after LAD ligation in four rats by a commercial ELISA using
polyclonal antibodies against the rat IL-8/Gro homologue CINC
(ImmunoLaboratories, Japan). The amount of protein in each serum
sample was calculated according to a standard curve of optical
density (OD) values constructed for known levels of rat
IL-8/Gro-alpha protein.
Experimental Procedures and Results
1. Selective Trafficking of Endothelial Precursors
[0274] Following immunoselection of G-CSF mobilized human CD34
cells to >98% purity, 60-80% co-expressed the stem cell factor
receptor CD117. By quadruple parameter analysis, FIG. 7a, 10-15% of
CD117.sup.bright cells were found to express a phenotype
characteristic of embryonic angioblasts, with low level surface
expression of VEGFR-2 and Tie-2, as well as the transcription
factors GATA-2 and GATA-3, and AC133, recently shown to identify
endothelial precursors (79). These cells did not express markers of
mature endothelial cells such as vWF, eNOS and E-selectin, but were
positive for the CXC chemokine receptors 1, 2, and 4. Intravenous
injection of 2.times.10.sup.6 DiI-labeled human CD34+ cells
(>98%, 40%, and 2% purity) into LAD-ligated Rowett nude rats was
accompanied at 48 hours by dense infiltration of rat myocardium,
FIG. 7b. The trafficking of these cells was specifically directed
to the infarct area since few DiI-labeled cells were detected in
unaffected areas of hearts with regional infarcts, not shown, and
DiI-labeled cells did not infiltrate myocardium from sham-operated
rats, FIG. 7b. By two weeks post-injection, rats receiving >98%
pure human CD34+ cells demonstrated increased infarct bed
microvascularity and reduced matrix deposition and fibrosis, FIG.
7c. The number of factor VIII-positive capillaries per high power
field was over three-fold higher in the infarct bed of rats
receiving 2.times.10.sup.6 cells containing >98% pure CD34+
purity than in the analogous region in rats receiving
2.times.10.sup.6 cells containing either 2% or 40% CD34+ purity,
p<0.01, FIG. 7c. Moreover, the majority of these capillaries
were of human origin since they expressed HLA class I molecules
(not shown). Thus, although various populations of human bone
marrow-derived cells migrate to the infarct bed, vasculogenesis
appears to require selective trafficking of a critical number of
endothelial precursors.
2. Effects of Ischemia on CXC Chemokine Production by Infarcted
Myocardium
[0275] Since human leukocyte chemotaxis and tissue infiltration is
regulated by interactions between specific chemokines and CXC cell
surface receptors, we next investigated the effects of ischemia on
CXC chemokine production by infarcted rat myocardium. As shown in
FIG. 8a-c, infarcted myocardium demonstrated a time-dependent
increase in mRNA expression of the CXCR1/2-binding ELR-positive
chemokines IL-8 and Gro-alpha, with maximal expression at 6-12
hours after LAD ligation. In comparison to non-infarcted
myocardium, tissues after LAD ligation expressed 7.2-7.5 fold
higher mRNA levels of these ELR-positive pro-angiogenic chemokines
after normalizing for total mRNA content (p<0.001). Moreover,
serum IL-8 levels increased by 8-10 fold within 6-12 hours after
LAD ligation (p<0.001), and remained elevated at 48 hours, FIG.
8d. Co-administration of blocking mAbs against either IL-8 and
Gro-alpha, or against the surface receptors for these
pro-angiogenic chemokines, CXCR1 or CXCR2, reduced myocardial
trafficking of human angioblasts by 40-60% relative to control
antibodies (p<0.01), FIG. 8e.
3. Chemotactic Responses of Human Bone Marrow-Derived CD34+
Angioblasts to Chemokines.
[0276] In subsequent experiments we directly measured in vitro and
in vivo chemotactic responses of human bone marrow-derived CD34+
angioblasts to IL-8. As shown in FIG. 9a, in vitro chemotaxis of
human CD34+ cells was induced by IL-8 in a dose-dependent manner,
with concentrations between 0.2-5 .mu./ml. The ELR-chemokine SDF-1,
produced constitutively by bone marrow stromal cells, induced a
similar degree of chemotaxis of CD34+ cells at concentrations
similar to IL-8, FIG. 9b. In contrast, chemotaxis was not induced
by the growth factors VEGF or stem cell factor (SCF). Moreover,
intracardiac injection of IL-8 at 1 .mu.g/ml into non-infarcted
hearts induced in vivo chemotaxis of CD34+ cells, FIG. 9c, whereas
neither VEGF nor SCF, used as controls, had any chemotactic effect
in vivo, FIG. 9d. Together, these results indicate that increased
tissue expression of ELR-positive chemokines augments
vasculogenesis in vivo by inducing chemotaxis of bone
marrow-derived endothelial precursor cells to sites of tissue
ischemia.
4. Interruption of CXCR4/SDF-1 Interactions to Redirect Trafficking
of Human CD34-Positive Cells from Bone Marrow to Myocardium.
[0277] In addition to augmenting trafficking of intravenously
injected human CD34+ angioblasts to damaged myocardium, ischemic
serum from LAD-ligated rats caused rapid expansion of the
circulating CD34+CD117.sup.bright angioblast population and
concomitantly increased trafficking of these cells to the bone
marrow. As shown in FIG. 10a, culture for 2 days with either VEGF
or ischemic serum increased proliferation of CD34+CD117.sup.bright
angioblasts by 2.8 and 4.3 fold, respectively (p<0.01).
Moreover, as shown in FIG. 10b, bone marrow from ischemic rats
after LAD ligation contained 5-8 fold higher levels of human
CD34+CD117.sup.bright angioblasts compared with bone marrow from
normal rats 2-14 days after intravenous injection of
2.times.10.sup.6 human CD34-positive cells (>95% purity),
(p<0.001). Since SDF-1 is constitutively expressed by bone
marrow stromal cells and preferentially promotes bone marrow
migration of circulating CD34+ cells which are actively cycling
(80), we investigated whether the increased homing of human
CD34+CD117.sup.bright angioblasts to ischemic rat bone marrow was
due to heightened SDF-1/CXCR4 interactions. As shown in FIG. 10c,
co-administration of mAbs against either human CXCR4 or rat SDF-1
significantly inhibited migration of intravenously administered
CD34+ human angioblasts to ischemic rat bone marrow by compared
with anti-CD34 control antibody (both p<0.001). Moreover,
co-administration of mAbs against either human CXCR4 or rat SDF-1
increased trafficking of CD34+ human angioblasts to ischemic rat
myocardium by a mean of 24% and 17%, respectively (both
p<0.001), FIG. 10d. By two weeks, the myocardial infarct bed of
rats receiving human CD34+ cells in conjunction with anti-CXCR4 mAb
demonstrated >3-fold increase in microvascularity compared with
those receiving CD34+ cells in conjunction with isotype control
antibody. These results indicate that although intravenously
injected CD34+ angioblasts traffick to infarcted myocardium and
induce vasculogenesis in response to augmented production of ELR+
chemokines, the efficiency of this process is significantly reduced
by concomitant angioblast migration to the bone marrow in response
to SDF-1. Interruption of CXCR4/SDF-1 interactions redirects
trafficking of the expanded, cycling population of human
CD34-positive cells from bone marrow to myocardium after
infarction, increasing infarct bed neoangiogenesis.
5. Improvement in Myocardial Function
[0278] Although left ventricular function was severely depressed
after LAD ligation, injection of >98% pure CD34+ cells was
associated with significant recovery in left ventricular size and
function within two weeks, and these effects persisted for the
entire 15 week period of follow-up, FIG. 11 a and b. In rats
receiving >98% pure CD34+ cells, left ventricular end-systolic
area decreased by a mean of 37.+-.6% by 15 weeks compared to
immediately post-infarction, FIG. 11a, and left ventricular
ejection fraction (LVEF) recovered by a mean of 34.+-.4% by 15
weeks (p<0.001), FIG. 11b (p<0.001). Improvement in these
parameters depended on the number of CD34+ cells injected, since
intravenous injection of 2.times.10.sup.6 G-CSF mobilized human
cells containing 2% or 40% CD34+ purity did not significantly
improve myocardial function despite similar degrees of trafficking
to ischemic myocardium, FIGS. 11 a and b. However,
co-administration of anti-CXCR4 mAb together with G-CSF mobilized
human bone marrow-derived cells containing 40% CD34+ purity
significantly improved LVEF recovery and reduced LVAs, to levels
seen with >98% CD34+ purity. By trichrome stain, significant
differences in left ventricular mass and collagen deposition were
observed between the groups, FIG. 11c. In rats receiving
2.times.10.sup.6 human cells containing 2% CD34 purity, the left
ventricular anterior wall was completely replaced by fibrous tissue
and marked compensatory septal hypertrophy was present. Similar
changes were seen in hearts of rats receiving 2.times.10.sup.6
human cells containing 40% CD34 purity. In contrast, in hearts of
rats receiving 2.times.10.sup.6 human cells containing 98% CD34
purity significantly greater anterior wall mass was maintained,
with normal septal size and minimal collagen deposition. Of
particular interest, hearts of rats receiving 2.times.10.sup.6
human cells containing 40% purity together with anti-CXCR4 mAb
demonstrated similar increase in anterior myocardial wall mass,
decrease in septal hypertrophy, and reduction in collagen
deposition.
[0279] Overall, the mean proportion of fibrous scar/normal left
ventricular myocardium was 13% and 21%, respectively, in rats
receiving >98% pure CD34+ cells or 40% pure CD34+ cells together
with anti-CXCR4 mAb, compared with 36-45% for rats receiving 2% and
40% pure CD34+ cells (p<0.01), FIG. 11d. Thus, augmentation of
infarct bed vasculogenesis by increasing selective trafficking of a
critical number of endothelial precursors leads to further
prevention of the remodeling process, salvage of viable myocardium,
and improvement in cardiac function.
Discussion
[0280] This study demonstrates that ELR+ chemokines produced by
ischemic tissues regulate the development of compensatory
vasculogenesis at ischemic sites by producing a chemoattractant
gradient for bone marrow-derived endothelial cell precursors.
Although both the ELR+ CXC chemokine IL-8 and the ELR- CXC
chemokine SDF-1 demonstrate similar effects on chemotaxis of CD34+
endothelial precursors, as well as on mature endothelium (73), when
expressed at different extravascular sites they impart opposing
biological effects on directional egress of endothelial
progenitors, and consequently on tissue neovascularization. By
understanding these interactions we were able to manipulate and
augment the chemotactic properties of a specific subset of human
bone marrow-derived CD34+ cells in order to increase myocardial
trafficking, induce infarct bed vasculogenesis, reduce
post-ischemic ventricular remodeling, and improve myocardial
function.
[0281] Since migration of bone marrow-derived progenitors through
basement membrane is dependent on secretion of proteolytic enzymes
such as metalloproteinase-9 (MMP-9, Gelatinase B) (81),
intracardiac metalloproteinase activity may be a critical
determinant of angioblast extravasation from the circulation and
transendothelial migration into the infarct zone. IL-8 induces
rapid release (within 20 minutes) of the latent form of MMP-9 from
intracellular storage granules in neutrophils (82-83), and
increases serum MMP-9 levels by up to 1,000-fold following
intravenous administration in vivo in non-human primates (84).
Since IL-8 significantly increases MMP-9 expression in bone marrow
progenitors (81), and neutralizing antibodies against MCP-9 prevent
mobilization of these cells (85), the results of our study suggest
that angioblast infiltration and subsequent infarct bed
vasculogenesis may result from IL-8-dependent increases in MMP-9
secretion.
[0282] Activation of latent MMP-9 and concomitant development of
neoangiogenesis within murine myocardial infarct scar tissue has
been shown to depend on urokinase-type plasminogen activator (u-PA)
co-expressed by bone marrow progenitors infiltrating the infarct
bed (81). Transcription and proteolytic activity of u-PA in human
cells is significantly increased by G-CSF and other colony
stimulating factors (86-88). Since IL-8-induced chemotaxis and
progenitor mobilization require the presence of additional signals
delivered through functional G-CSF receptors (89), it is possible
that increased u-PA activity is required for IL-8 mediated
trafficking of angioblasts to sites of ischemia. This would explain
the limited extent of infarct bed neoangiogenesis observed normally
after myocardial infarction (62,63) despite high levels of IL-8
production, and provides a rationale for in vivo or ex vivo
administration of colony stimulating factors to mobilize and
differentiate human bone marrow-derived angioblasts for use in
therapeutic revascularization of ischemic tissues.
[0283] Constitutive production of the CXC chemokine SDF-1 by bone
marrow stromal cells appears to be essential for bone marrow homing
and engraftment of haematopoietic progenitors (76-78). In addition,
expression of SDF-L in non-haematopoietic tissues plays a role in
the developing vascular system since SDF-1 -/- mice have defects in
both vascularization of the gastrointestinal tract (50) and
ventricular septum formation (90). Since bone marrow-derived
endothelial precursors express CXCR4 (80) and demonstrate
chemotactic responses to SDF-1, as shown here, induced expression
of SDF-1 at non-haematopoietic sites during embryogenesis or
following tissue injury may be an important element in the process
of tissue neovascularization (91). Our ability to redirect
trafficking of human bone marrow-derived angioblasts to sites of
tissue ischemia by interruption of CXCR4/SDF-1 interactions argues
strongly that SDF-L is a biologically active chemotactic factor for
human endothelial precursors, and that it may have pro-angiogenic
activity if expressed at non-haematopoietic sites. Future studies
will address whether increased expression and localization of SDF-1
and other chemokines at the sites of tissue ischemia might be
synergistic with ELR+ CXC chemokines in augmenting vasculogenesis.
Together, the results of this study indicate that CXC chemokines,
including IL-8, Gro-alpha, and SDF-1, play a central role in
regulating human bone marrow-dependent vasculogenesis, and that
manipulation of interactions between these chemokines and their
receptors on autologous human bone marrow-derived angioblasts can
enhance the potential efficacy of therapeutic vasculogenesis
following tissue ischemia.
Third Series of Experiments
Experimental Procedures and Results
1. Myocardial Ischemia Induces Production of CC Chemokines and
Increases Human CD34+ Angioblast Expression of CC Chemokine
Receptors
[0284] Since human mononuclear cell chemotaxis and tissue
infiltration is regulated by interactions between cell surface
receptors with specific chemokine ligands, the effects of ischemia
on angioblast CC chemokine receptor expression and on kinetics of
CC chemokine production by infarcted rat myocardium were
investigated. As shown in FIG. 12, culture of CD34+CD117.sup.bright
angioblasts with serum from LAD-ligated rats increased surface
expression of CCR1 and CCR2, while surface expression of CCR3 and
CCR1 remained unchanged.
[0285] As shown in FIG. 13, infarcted myocardium demonstrated a
time-dependent increase in mRNA expression of several CCR-binding
chemokines. Infarcted myocardium was found to express over 8-fold
higher levels of the CCR2-binding CC chemokine MCP-1, and
3-3.5-fold higher mRNA levels of MCP-3 and RANTES, as well as the
CCR3-binding chemokine eotaxin, after normalizing for total mRNA
content (all p<0.001). This pattern of gene expression appeared
to be relatively specific since every infarcted tissue studied
demonstrated increased expression of these CC chemokines and none
demonstrated induced expression of the CCR1-binding CC chemokines
MIP-1 alpha or MIP-1beta.
2. Trafficking of Human CD34+ Angioblasts to Ischemic Myocardium is
Regulated by Induced Expression of CC and CXC Chemokines
[0286] Next investigated was whether human angioblast trafficking
to ischemic myocardium was related to the induced expression of the
CC chemokines identified above. Co-administration of blocking mAbs
against MCP-1, MCP-3, and RANTES, or against eotaxin, reduced
myocardial trafficking of human angioblasts by 40-60% relative to
control antibodies (p<0.01), FIG. 14. To prove that CC
chemokines mediate angioblast chemotaxis to ischemic myocardium, we
measured in vivo angioblast chemotaxis in response to eotaxin. As
shown in FIG. 15, intracardiac injection of eotaxin into
non-infarcted hearts induced 1.5-1.7 fold increase in CD34+
angioblast trafficking whereas injection of the growth factors VEGF
and stem cell factor had no effect on chemotaxis despite increasing
angioblast proliferation (not shown).
Fourth Series of Experiments
[0287] Determination of Myocyte Size. Myocyte size was measured in
normal rat hearts and in the infarct zone, peri-infarct rim and
distal areas of infarct tissue sections stained by trichrome. The
transverse and longitudinal diameters (mm) of 100-200 myocytes in
each of 10-15 high-powered fields were measured at 400.times. using
Image-Pro Plus software.
Measurement of Myocyte Apoptosis by DNA End-Labeling of Paraffin
Tissue Sections.
[0288] For in situ detection of apoptosis at the single-cell level
we used the TUNEL method of DNA end-labeling mediated by
dexynucleotidyl transferase (TdT) (Boehringer Mannheim, Mannheim,
Germany). Rat myocardial tissue sections were removed from
LAD-ligated rats at two weeks after injection of either saline or
CD34+ human cells, and from healthy rats as negative controls.
Briefly, tissues were deparaffinized, digested with Proteinase K,
and incubated with TdT and fluorescein-labeled dUTP in a humid
atmosphere for 60 minutes at 370 C. After incubation for 30 minutes
with an antibody specific for fluorescein conjugated alkaline
phosphatase the TUNEL stain was visualized in which nuclei with DNA
fragmentation stained blue.
1. Neoangiogenesis Protects Hypertrophied Myocardium Against
Apoptosis.
[0289] The mechanism by which induction of neo-angiogenesis
resulted in improved cardiac function was investigated. Results
showed that two weeks after LAD ligation the myocytes in the
peri-infarct rim of saline controls had distorted appearance,
irregular shape, and similar diameter to myocytes from rats without
infarction (0.020 mm+/-0.002 vs 0.019 mm+/-0.001). In contrast, the
myocytes at the peri-infarct rim of rats who received CD34+ cells
had regular, oval shape, and were significantly larger than
myocytes from control rats (diameter 0.036 mm+/-0.004 vs 0.019
mm+/-0.001, p<0.01). By concomitant staining for the
myocyte-specific marker desmin and DNA end-labeling, 6-fold lower
numbers of apoptotic myocytes were detected in infarcted left
ventricles of rats injected with CD34+ cells compared with saline
controls (apoptotic index 1.2+0.6 vs 7.1+0.7, p<0.01). These
differences were particularly evident within the peri-infarct rim,
where the small, irregularly-shaped myocytes in the saline-treated
controls had the highest index of apoptotic nuclei. In addition,
whereas apoptotic myocytes extended throughout 75-80% of the left
ventricular wall in saline controls, apoptotic myocytes were only
detectable for up to 20-25% of the left ventricle distal to the
infarct zone in rats injected with CD34+ cells. Together, these
results indicate that the infarct zone vasculogenesis and
peri-infarct angiogenesis induced by injection of CD34+ cells
prevented an eccentrically-extending pro-apoptotic process evident
in saline controls, enabling survival of hypertrophied myocytes
within the peri-infarct zone and improving myocardial function.
2. Early Neoangiogenesis Prevents Late Myocardial Remodeling.
[0290] The last series of experiments showed the degree of
peri-infarct rim myocyte apoptosis at two weeks in control and
experimental groups (saline vs CD34+ cells) compared with
progressive myocardial remodeling over the ensuing four months.
Despite similar initial reductions in LVEF and increases, in LVAS,
by two weeks the mean proportion of collagenous deposition or scar
tissue/normal left ventricular myocardium, as defined by Massonis
trichrome stain, was 3% in rats receiving CD34+ cells compared with
12% for those receiving saline. By 15 weeks post-infarction, the
mean proportion of scar/normal left ventricular myocardium was 13%
in rats receiving CD34+ cells compared with 36-45% for each of the
other groups studied (saline, CD34-, SVEC) (p<0.01). Rats
receiving CD34+ cells demonstrated significantly increased mass of
viable myocardium within the anterior free wall which comprised
myocytes exclusively of rat origin, expressing rat but not human
MHC molecules, confirming intrinsic myocyte salvage rather than
myocyte regeneration from human stem cell precursors. Whereas
collagen deposition and scar formation extended almost through the
entire left ventricular wall thickness in controls, with aneurysmal
dilatation and typical EKG abnormalities, the infarct scar extended
only to 20-50% of the left ventricular wall thickness in rats
receiving CD34+ cells. Moreover, pathological collagen deposition
in the non-infarct zone was markedly reduced in rats receiving
CD34+ cells. Together, these results indicate that the reduction in
peri-infarct myocyte apoptosis observed at two weeks resulted in
prolonged survival of hypertrophied, but viable, myocytes and
prevented myocardial replacement with collagen and fibrous tissue
by 15 weeks.
Discussion
[0291] The observation that proliferating capillaries at the
peri-infarct rim and between myocytes were of rat origin shows that
in addition to vasculogenesis human angioblasts or other
co-administered bone-marrow derived elements may be a rich source
of pro-angiogenic factors, enabling additional induction of
angiogenesis from pre-existing vasculature.
REFERENCES
[0292] 1. Mahon N G, et al. Heart 1999; 81:478-82. [0293] 2.
Pfeffer J M, Pfeffer M A, Fletcher P J, Braunwald E. Am J Physiol
1991; 260:H1'406-14. [0294] 3. White H D, et al. Circulation 1987;
76:44-51. [0295] 4. Colucci W S. Am J Cardiol 1997;
80(11A):15L-25L. [0296] 5. Ravichandran L V and Puvanakrishnan R.
Biochem Intl 1991; 24:405-414. [0297] 6. Agocha A, Lee H-W,
Eghali-Webb M. J Mol Cell Cardiol 1997; 29:2233-2244. [0298] 7.
Hochman J S and Choo H. Circulation 1987; 75:299-306. [0299] 8.
White H D, et al. Circulation 1994; 89:61-67. [0300] 9. Nidorf S M,
Siu S C, Galambos G, Weyman A E, Picard M H. J Am Coll Cardiol
1992; 20:307-313. [0301] 10. Asahara T, et al. Science 1997;
275:964-967. [0302] 11. Takahashi T, et al. Nat Med 1999,
5:434-438. [0303] 12. Asahara T, et al. Circ Res 1999; 85:221-228.
[0304] 13. Kalka C, et al. Proc Natl Acad Sci USA 2000;
97:3422-3427. [0305] 14. Rafii S, et al. Blood 1994; 84:10-19.
[0306] 15. Shi Q, et al. Blood 1998; 92:362-367. [0307] 16. Lin Y,
Weisdorf D J, Solovey A, Hebbel R P. J Clin Invest 2000; 105:71-77.
[0308] 17. Tavian M, et al. Blood 1996; 87:67-72. [0309] 18.
Jaffredo T, Gautier R, Eichmann A, Dieterlen-Lievre F. Development
1998; 125:4575-4583. [0310] 19. Kennedy M, et al. Nature 1997;
386:488-493. [0311] 20. Choi K, Kennedy M, Kazarov A,
Papadimitriou, Keller G. Development 1998; 125:725-732. [0312] 21.
Elefanty A G, Robb L, Birner R, Begley C G. Blood 1997;
90:1435-1447. [0313] 22. Labastie M-C, Cortes F, Romeo P-H, Dulac
C, Peault B. Blood 1998; 92:3624-3635. [0314] 23. Tsai F Y, et al.
Nature 1994; 371:221-225. [0315] 24. Ogawa M, et al. Blood 1999;
93:1168-1177. [0316] 25. Peichev M, et al. Blood. 2000; 95:952-8.
[0317] 26. Asahara T, et al. EMBO J 1999; 18:3964-3972. [0318] 27.
Karam R. Healy B P, Wicker P. Circulation 1990; 81:238-246. [0319]
28. Olivetti G, Capasso J M, Meggs L G, Sonnenblick E H, Anversa P.
Circ Res 1991; 68:856-869. [0320] 29. Braunwald E and Pfeffer M A.
Am J Cardiol 1991; 68 (supplD):1-6D. [0321] 30. Nelissen-Vrancken
H, Debets J, Snoeckx L, Daemen M, Smits J. Circulation 1996;
93:349-355. [0322] 31. Kalkman E A J, et al. Cardiovasc Res 1996.
[0323] 32. Heymans S, et al. Nat Med 1999; 5:1135-1142. [0324] 33.
Hart P H, et al. Blood 1991; 77:841-848. [0325] 34. Stacey K J, et
al. Mol Cell Biol 1995; 15:3430-3441. [0326] 35. Pei X-H, et al.
Clin Exp Metastasis 1998; 16:551-558. [0327] 36. McEwan P E, Gray G
A, Sherry L, Webb D J, Kenyon C J. Circulation 1998; 98:2765-2773.
[0328] 37. Kawano H, et al. Circulation 2000; 101:1130-1137. [0329]
38. Chua B H, Chua C C, Diglio C A, Siu B B. Biochim Biophys Acta
1993; 1178:201-206. [0330] 39. Ito H, et al. J Clin Invest 1993;
92:398-403. [0331] 40. Rossi A P, Sacchetto A, Cesari M, Pessina A
C. Cardiovasc Res 1999; 43:300-307. [0332] 41. Dorfman D M, Wilson
D B, Bruns G A, Orkin S H. J Biol Chem 1992; 267:1279-85. [0333]
42. Tasaka K, Kitazumi K. Gen Pharmacol 1994; 25:1059-69. [0334]
43. Kalkman E A J, van Haren P, Saxena P R, Schoemaker R G. J Mol
Cell Cardiol 1997; 29:1487-1497. [0335] 44. Pfeffer M A, et al. N
Engl J Med 1992; 327:669-677. [0336] 45. The SOLVD investigators. N
Engl J Med 1991; 325:293-302. [0337] 46. Pitt B, et al. Lancet
1997; 349:747-752. [0338] 47. Strieter, R M. et al. Interleukin-8:
a corneal factor that induces neovascularization. Am. J. Pathol.
141, 1279-1284 (1992). [0339] 48. Koch, A E. et al. Interleukin-8
(IL-8) as a macrophage-derived mediator of angiogenesis. Science,
258:1798-1801 (1992). [0340] 49. Strieter, R M, et al The
functional role of the ELR motif in CXC chemokine-mediated
angiogenesis. J. Biol. Chem. 270, 27348-27357 (1995). [0341] 50.
Tachibana, K. et al. The chemokine receptor CXCR4 is essential for
vascularization of the gastrointestinal tract. Nature 393, 591-594
(1998). [0342] 51. Rafii S, et al. Isolation and characterization
of human bone marrow microvascular endothelial cells: hematopoietic
progenitor cell adhesion. Blood 84, 10-19 (1994). [0343] 52. Shi,
Q. et al. Evidence for circulating bone marrow-derived endothelial
cells. Blood 92, 362-367 (1998). [0344] 53. Lin, Y., Weisdorf, D.
J., Solovey, A., Hebbel, R. P. Origins of circulating endothelial
cells and endothelial outgrowth from blood. J. Clin. Invest. 105,
71-77 (2000). [0345] 54. Kennedy, M. et al. A common precursor for
primitive erythropoiesis and definitive haematopoiesis. Nature 386,
488-493 (1997). [0346] 55. Choi, K., Kennedy, M., Kazarov, A.,
Papadimitriou, Keller, G. A common precursor for hematopoietic and
endothelial cells. Development 125, 725-732 (1998). [0347] 56.
Elefanty, A. G., Robb, L., Birner, R., Begley, C. G.
Hematopoietic-specific genes are not induced during in vitro
differentiation of scl-null embryonic stem cells. Blood 90,
1435-1447 (1997). [0348] 57. Labastie, M. C., Cortes, F., Romeo, P.
H., Dulac, C., Peault, B. Molecular identity of hematopoietic
precursor cells emerging in the human embryo. Blood 92, 3624-3635
(1998). [0349] 58. Folkman, J. Therapeutic angiogenesis in ischemic
limbs. Circulation 97, 108-110 (1998). [0350] 59. Asahara, T. et
al. Isolation of putative progenitor cells for endothelial
angiogenesis. Science 275, 964-967 (1997). [0351] 60. Takahashi, T.
et al. Ischemia- and cytokine-induced mobilization of bone
marrow-derived endothelial progenitor cells for neovascularization.
Nat. Med. 5, 434-438 (1999). [0352] 61. Kalka, C. et al.
Transplantation of ex vivo expanded endothelial progenitor cells
for therapeutic neovascularization. Proc. Natl. Acad. Sci. USA 97,
3422-3427 (2000). [0353] 62. Nelissen-Vrancken, H. J., Debets, J.
J., Snoeckx L. H., Daemen, M. J., Smits, J. F. Time-related
normalization of maximal coronary flow in isolated perfused hearts
of rats with myocardial infarction. Circulation 93, (2) 349-355
(1996). [0354] 63. Kalkman, E. A. et al. Determinants of coronary
reserve in rats subjected to coronary artery ligation or aortic
banding. Cardiovasc. Res. 32, (6) 1088-1095 (1996). [0355] 64.
Colucci, W. S. Molecular and cellular mechanisms of myocardial
failure. Am. J. Cardiol. 80(11A), 15L-25L (1997). [0356] 65.
Ravichandran, L. V. and Puvanakrishnan, R. In vivo labeling studies
on the biosynthesis and degradation of collagen in experimental
myocardial myocardial infarction. Biochem. Intl. 24, 405-414
(1991). [0357] 66. Agocha, A., Lee, H. W., Eghali-Webb, M. Hypoxia
regulates basal and induced DNA synthesis and collagen type I
production in human cardiac fibroblasts: effects of TGF-beta,
thyroid hormone, angiotensis II and basic fibroblast growth factor.
J. Mol. Cell. Cardiol. 29, 2233-2244 (1997). [0358] 67. Mahon, N.
G. et al. Hospital mortality of acute myocardial infarction in the
thrombolytic era. Heart 81, 478-482 (1999). [0359] 68. Pfeffer, J.
M., Pfeffer, M. A, Fletcher, P. J., Braunwald, E. Progressive
ventricular remodeling in rat with myocardial infarction. Am. J.
Physiol. 260, H1406-414 (1991). [0360] 69. White, H. D. et al. Left
ventricular end systolic volume as the major determinant of
survival after recovery from myocardial infarction. Circulation 76,
44-51 (1987). [0361] 70. Folkman J. Angiogenesis in cancer,
vascular, rheumatoid and other disease. Nat. Med. 1:27 (1995).
[0362] 71. Murdoch C, Monk P N, Finn A. Cxc chemokine receptor
expression on human endothelial cells. Cytokine 11, 704-12 (1999).
[0363] 72. Angiolillo, A L, et al. Human interferon-inducible
protein 10 is a potent inhibitor of angiogenesis in vivo. J Exp Med
182, 155-62 (1995). [0364] 73. Feil C, Augustin H G. Endothelial
cells differentially express functional CXC-chemokine receptor-4
(CXCR-4/fusin) under the control of autocrine activity and
exogenous cytokines. Biochem Biophys Res Commun 247, 38-45 (1998).
[0365] 74. Tavian, M. et al. Aorta-associated CD34 hematopoietic
cells in the early human embryo. Blood 87, 67-72 (1996). [0366] 75.
Jaffredo, T., Gautier, R., Eichmann, A., Dieterlen-Lievre, F.
Intraaortic hemopoietic cells are derived from endothelial cells
during ontogeny. Development 125, 4575-4583 (1998). [0367] 76.
Mohle R, Bautz F, Rafii S, Moore M A, Brugger W, Kanz L. The
chemokine receptor CXCR-4 is expressed on CD34+ hematopoietic
progenitors and leukemic cells and mediates transendothelial
migration induced by stromal cell-derived factor-1. Blood 91,
4523-30 (1998). [0368] 77. Imai, K. et al. Selective secretion of
chemoattractants for haemopoietic progenitor cells by bone marrow
endothelial cells: a possible role in homing of haemopoietic
progenior cells to bone marrow. Br J Haematol 106, 905-11 (1999).
[0369] 78. Peled, A. et al. Dependence of human stem cell
engraftment and repopulation of NOD/SCID mice on CXCR4. Science
283, 845-88 (1999). [0370] 79. Peichev M, et al. Expression of
VEGFR-2 and AC133 by circulating human CD34 (+) cells identifies a
population of functional endothelial precursors. Blood 95, 952-8
(2000). [0371] 80. Voermans C, Gerritsen W R, von dem Borne A E,
van der Schoot C E. Increased migration of cord blood-derived CD34+
cells, as compared to bone marrow and mobilized peripheral blood
CD34+ cells across uncoated or fibronectin-coated filters. Exp.
Hematol. 27, 1806-14 (2000). [0372] 81. Janowska-Wieczorek, A. et
al. Growth factors and cytokines upregulate gelatinase expression
in bone marrow CD34+ cells and their transmigration through
reconstituted basement membrane. Blood 93, 3379-3390 (1999). [0373]
82. Masure, S., Proost, P., Van Damme, J., Opdenakker, M D.
Purification and identification of 91-kDa neutrophil gelatinase.
Release by the activating peptide interleukin-8. Eur. J. Biochem.
198, 391-398 (1991). [0374] 83. Pugin, J. et al. Human neutrophils
secrete gelatinase B in vitro and in vivo in response to endotoxin
and proinflammatory mediators. Am. J. Respir. Cell. Mol. Biol. 20,
458-464 (1999). [0375] 84. Pruijt J F, et al. Prevention of
interleukin-8-induced mobilization of hematopoietic progenitor
cells in rhesus monkeys by inhibitory antibodies against the
metalloproteinase gelatinase B (MMP-9). Proc Natl Acad Sci USA. 96,
10863-10868 (1999). [0376] 85. Heymans, S. et al. Inhibition of
plasminogen activators or matrix metalloproteinases prevents
cardiac rupture but impairs therapeutic angiogenesis and causes
cardiac failure. Nat. Med. 5, 1135-1142 (1999). [0377] 86. Hart, P.
H. et al. Activation of human monocytes by granulocyte-macrophage
colony-stimulating factor: increased urokinase-type plasminogen
activator activity. Blood 77, 841-848 (1991). [0378] 87. Stacey, K.
J., Fowles, L. F., Colman, M. S., Ostrowski, M. C., Hume, D. A.
Regulation of urokinase-type plasminogen activator gene
transcription by macrophage colony-stimulating factor. Mol. Cell.
Biol. 15, 3430-3441 (1995). [0379] 88. Pei, X. H. et al. G-CSF
increases secretion of urokinase-type plasminogen activator by
human lung cancer cells. Clin. Exp. Metastasis 16, 551-558 (1998).
[0380] 89. Semerad, C L, et al. A role for G-CSF receptor
signalling in the regulation of hematopoietic cell function but not
lineage commitment or differentiation. Immunity 11, 153-161 (1999).
[0381] 90. Nagasawa, T. et al. Defects of B-cell lymphopoiesis and
bone-marrow myelopoiesis in mice lacking the CXC chemokine
PBSF/SDF-1. Nature 382, 635-638 (1996). [0382] 91. Rempel S A,
Dudas S, Ge S, Gutierrez J A. Identification and localization of
the cytokine SDF1 and its receptor, CXC chemokine receptor 4, to
regions of necrosis and angiogenesis in human glioblastoma,
ClinCancerRes 6, 102-11 (2000).
Sequence CWU 1
1
6 1 20 DNA ARTIFICIAL SEQUENCE misc_feature ()..() PRIMER 1
gaagatagat tgcaccgatg 20 2 18 DNA ARTIFICIAL SEQUENCE misc_feature
()..() PRIMER 2 catagcctct cacatttc 18 3 25 DNA ARTIFICIAL SEQUENCE
misc_feature ()..() PRIMER 3 gcgcccgtcc gccaatgagc tgcgc 25 4 28
DNA ARTIFICIAL SEQUENCE misc_feature ()..() PRIMER 4 cttggggaca
cccttcagca tcttttgg 28 5 21 DNA ARTIFICIAL SEQUENCE misc_feature
()..() PRIMER 5 ctctacccac ggcaagttca a 21 6 20 DNA ARTIFICIAL
SEQUENCE misc_feature ()..() PRIMER 6 gggatgacct tgcccacagc 20
* * * * *