U.S. patent application number 11/708333 was filed with the patent office on 2008-02-07 for methods for improving the function of heterlogous g protein-coupled receptors.
This patent application is currently assigned to BASF Aktiengesellschaft. Invention is credited to Mark Henry Pausch, Jurgen Wess.
Application Number | 20080032317 11/708333 |
Document ID | / |
Family ID | 36821679 |
Filed Date | 2008-02-07 |
United States Patent
Application |
20080032317 |
Kind Code |
A1 |
Pausch; Mark Henry ; et
al. |
February 7, 2008 |
Methods for improving the function of heterlogous G protein-coupled
receptors
Abstract
This invention relates to mutant G protein-coupled receptors
with improved G-protein coupling and receptor response, yeast cells
expressing such receptors, vectors useful for making such cells,
and methods of making and using same.
Inventors: |
Pausch; Mark Henry; (Rocky
Hill, NJ) ; Wess; Jurgen; (Bethesda, MD) |
Correspondence
Address: |
WYETH/FINNEGAN HENDERSON, LLP
901 NEW YORK AVENUE, NW
WASHINGTON
DC
20001-4413
US
|
Assignee: |
BASF Aktiengesellschaft
|
Family ID: |
36821679 |
Appl. No.: |
11/708333 |
Filed: |
February 21, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11473109 |
Jun 23, 2006 |
|
|
|
11708333 |
Feb 21, 2007 |
|
|
|
09786033 |
Jul 3, 2001 |
7094593 |
|
|
PCT/US99/20013 |
Sep 1, 1999 |
|
|
|
11473109 |
Jun 23, 2006 |
|
|
|
60098704 |
Sep 1, 1998 |
|
|
|
09786033 |
Jul 3, 2001 |
|
|
|
Current U.S.
Class: |
435/7.31 ;
435/254.11 |
Current CPC
Class: |
G01N 2333/726 20130101;
C07K 14/705 20130101; G01N 2500/10 20130101; G01N 33/566
20130101 |
Class at
Publication: |
435/007.31 ;
435/254.11 |
International
Class: |
G01N 33/53 20060101
G01N033/53; C12N 1/19 20060101 C12N001/19 |
Claims
1-38. (canceled)
39. A yeast cell comprising a nucleic acid sequence encoding a
modified, heterologous G protein-coupled receptor (GPCR), wherein
the modification comprises a mutation in an intracellular domain of
the G protein-coupled receptor and results in an improved
functional response and a cell-based assay as compared to a
wild-type form of the heterologous G protein-coupled receptor, and
wherein the modified G protein-coupled receptor is selected from
the group consisting of a muscarinic acetylcholine receptor, a
cholecystokinin CCKB receptor, a somatostatin receptor, an alpha 2A
adrenergic receptor, and a serotonin receptor.
40. The yeast cell according to claim 39, wherein the modification
promotes agonist stimulated growth, and wherein the agonist is a G
protein-coupled receptor agonist.
41. The yeast cell according to claim 40, wherein the modification
results in improved coupling between the receptor and a
heterotrimeric G protein or failure of the receptor to interact
with cell desensitization or sequestration-internalization
machinery or proper plasma membrane localization.
42. The yeast cell according to claim 39, wherein the muscarinic
acetylcholine receptor is a rat M3 muscarinic acetylcholine
receptor or a D. melanogaster muscarinic acetylcholine
receptor.
43. The yeast cell according to claim 1, wherein the muscarinic
acetylcholine receptor is a rat M3 muscarinic acetylcholine
receptor or a D. melanogaster muscarinic acetylcholine
receptor.
44. The yeast cell according to claim 1, wherein the
cholecystokinin CCKB receptor is a rat cholecystokinin CCKB
receptor.
45. The yeast cell according to claim 1, wherein the somatostatin
receptor is a rat somatostatin receptor subtype 3.
46. A yeast cell comprising a nucleic acid sequence encoding a
chimeric G protein-coupled receptor, wherein the chimeric G
protein-coupled receptor comprises a first heterologous G
protein-coupled receptor in which an intracellular domain has been
replaced with a modified intracellular domain of a second
heterologous G protein-coupled receptor, and wherein the modified
intracellular domain of the second heterologous G protein-coupled
receptor confers an improved functional response to the chimeric G
protein coupled-receptor in a cell-based assay as compared to a
wild-type form of the first heterologous G protein-coupled
receptor.
47. The yeast cell according to claim 46, wherein the modified
intracellular domain is the third intracellular loop.
48. The yeast cell according to claim 39 or 46, further comprising
a plasmid comprising an inducible reporter gene.
49. The yeast cell according to claim 48, wherein the reporter gene
is a green fluorescent protein.
50. The cell according to claim 49, wherein the green fluorescent
protein is operably linked to a FUS2 promoter.
51. A method for screening compounds capable of binding to G
protein-coupled receptors comprising: (a) subjecting the yeast cell
according to claim 39 or 47 to a test compound; and (b) measuring
the effect of the test compounds on cell growth.
Description
STATEMENT OF RELATED APPLICATIONS
[0001] This application hereby claims the benefit of U.S.
provisional application Ser. No. 60/098,704 filed Sep. 1, 1998. The
entire disclosure of this provisional application is relied upon
and incorporated by reference herein.
FIELD OF THE INVENTION
[0002] This invention relates to mutant G protein-coupled receptors
with improved G-protein coupling and receptor response, host cells
expressing such receptors, vectors useful for making such cells,
and methods of making and using same.
BACKGROUND OF THE INVENTION
[0003] The actions of many extracellular signals, such as
neurotransmitters, hormones, odorants, and light, are mediated by a
triad of proteins which has been identified in organisms from yeast
to mammals. This triad consists of a receptor, coupled to a
trimeric guanine nucleotide-binding regulatory protein (G protein),
which in turn is coupled to a cellular effector. These receptors
have seven transmembrane domains and are named for their
association with the G protein as "G protein-coupled receptors"
("GPCRs").
[0004] The regulatory G proteins are comprised of three subunits: a
guanylnucleotide binding a subunit; a .beta. subunit; and a .gamma.
subunit. B. R. Conklin and H. R. Bourne (1993). G proteins cycle
between two forms, depending on whether GDP or GTP is bound to the
.alpha. subunit. When GDP is bound, the G protein exists as a
heterotrimer, the G.alpha..beta..gamma. complex. When GTP is bound,
the .alpha. subunit dissociates, leaving a G.beta..gamma. complex.
Importantly, when a G.alpha..beta..gamma. complex operatively
associates with an activated G protein coupled receptor in a cell
membrane, the rate of exchange of GTP for bound GDP is increased
and, hence, the rate of disassociation of the bound G.alpha.
subunit from the G.beta..gamma. complex increases. The free
G.alpha. subunit and G.beta..gamma. complex are capable of
transmitting a signal to downstream elements of a variety of signal
transduction pathways. Examples of these downstream cellular
effector proteins include, among others, adenylate cyclases, ion
channels, and phospholipases. This fundamental scheme of events
forms the basis for a multiplicity of different cell signaling
phenomena. H. G. Dohlman et al. (1991).
[0005] Because of their ubiquitous nature in important biochemical
pathways, the G protein-coupled receptors represent important
targets for new therapeutic drugs. In turn, the discovery of such
drugs will necessarily require screening assays of high specificity
and throughput termed high-throughput screening (HTS) assays.
Screening assays utilizing microorganisms, such as yeast strains
genetically modified to accommodate functional expression of the G
protein-coupled receptors offer significant advantages in research
involving ligand binding to numerous receptors implicated in
various disease states.
[0006] However, microorganisms transformed with wild-type receptors
may perform poorly in growth assays, exhibiting, for example, the
inability to interact with the heterotrimeric G protein,
inappropriate localization and/or desensitization. Many GPCRs are
phosphorylated in response to chronic and persistent agonist
stimulation which often leads to desensitization followed by
sequestration or internalization of the receptors. Desensitization
of GPCRs causes uncoupling from interaction with heterotrimeric G
proteins. This process is mediated by a variety of regulatory
receptor protein kinases, including G protein-coupled receptor
kinases (GRK), protein kinase A (PKA), protein kinase C (PKC), and
casein kinases (CK). Internalization involves removal of GPCRs from
the plasma membrane via receptor-mediated endocytosis. Internalized
receptors may be recycled back to the cell surface, or delivered to
a lysosomal/vacuolar compartment for degradation. The
ubiquitin-mediated degradative pathway is also involved in this
process. The ultimate result of receptor phosphorylation and
sequestration/internalization is often cell growth arrest, which
significantly reduces the utility of the genetically modified
microorganism in screening assays.
SUMMARY OF THE INVENTION
[0007] It is an object of this invention to provide modified G
protein-coupled receptors that function well in high throughput
screening assays, implemented in any eukaryotic cell, preferably
yeast cells. Thus, a first aspect of the present invention is
directed to nucleotide sequences encoding a G protein-coupled
receptor which has been modified to improve the function of the
GPCR by causing the receptor to couple more efficiently with the
heterotrimeric G protein and/or to fail to interact with the cell
desensitization and/or sequestration/internalization machinery,
and/or to appropriately localize to the plasma membrane. In
preferred embodiments, such modifications lead to improved
agonist-stimulated growth-promoting ability. One specific
modification of the nucleotide sequence encoding a G
protein-coupled receptor encompassed by this invention is a
mutation in any intracellular domain or membrane region proximal to
internal domains. The mutation may be a deletion, including, for
example, a point mutation.
[0008] This invention is also directed to chimeric GPCRs in which
intracellular domains of heterologous GPCRs that provide favorable
G protein coupling properties or domains not subject to the yeast
cell desensitization and/or sequestration/internalization machinery
are used to replace comparable domains in GPCRs of interest. This
invention also relates to the modified nucleotide sequences
encoding the chimeric GPCRs, to expression vectors comprising the
modified nucleotide sequences, and to host cells transformed
therewith.
[0009] An additional aspect of this invention is an improved method
of assaying compounds to determine effects of ligand binding to the
mutant or chimeric GPCRs of this invention by measuring the effect
of the test compound on cell growth. The mutant GPCRs prevent or
reduce the rate of cell growth arrest due to chronic and persistent
agonist stimulation, thereby decreasing the number of false
negatives that occur with prior art screening methods and/or
increasing the sensitivity of the bioassay.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIG. 1A depicts the results of liquid culture assays on
yeast cells containing the rat M3 muscarinic acetylcholine receptor
(MAR) using MAR agonist carbachol (CCh). Yeast cells containing a
M3 MAR with a deletion in the third intracellular loop (IC3.DELTA.)
produced an agonist-dependent growth response, while the wild type
MAR did not, indicating that the M3 MAR IC3.DELTA. is functional
GPCR. FIG. 1B depicts the results of liquid culture fluorescence
induction assays on yeast cells containing the rat M3 MAR
IC3.DELTA. and the FUS2-GFP reporter plasmid using the MAR agonist
carbachol (CCh). A dose-dependent increase in the expression of the
green fluorescent protein is observed in response to CCh activation
of the M3 MAR IC3.DELTA. expressed in yeast.
[0011] FIG. 2 depicts the results of liquid culture assays on yeast
cells containing the Drosophila muscarinic acetylcholine receptor
using the MAR agonist carbachol (CCh). Yeast cells containing a
mutated Drosophila MAR containing the M3 MAR IC3.DELTA. produced an
agonist-dependent growth response while the wild type Drosophila
MAR lacked an agonist-dependent yeast cell growth response.
[0012] FIG. 3 depicts the results of an agar-based plate bioassay.
FIG. 3A shows a robust growth responses of yeast cells containing
the IC3.DELTA. cholecystokinin CCKB receptor. FIG. 3B shows only
limited growth by yeast cells containing the wild type CCKB
receptor, indicating that the deletion of a portion of the third
intracellular loop of the. CCKB receptor improves its function in
yeast.
[0013] FIG. 4 depicts yeast cells transformed with rSSTR3 and with
rSSTR3.DELTA.IC3. FIG. 4A demonstrates that yeast cells containing
p426GPD-rSSTR3 show a weak response to somatostatin (S-14). FIG. 4B
demonstrates a much stronger response by yeast cells containing
p426GPD-rSSTR3.DELTA.IC3 assayed under similar conditions.
[0014] FIG. 5 depicts the results of liquid culture assays on yeast
cells containing-wild type IC3.DELTA. human alpha2A adrenergic
receptor using the alpha adrenergic receptor full agonist UK14304.
Yeast cells containing the wild type and IC3.DELTA. human alpha 2A
adrenergic receptor produced a dose-dependent growth response,
indicating that the IC3 deletion is functional.
[0015] FIG. 6 depicts the results of liquid culture assays on yeast
cells containing wildtype and carboxy terminally truncated rat
NT1-neurotensin receptors using the neurotensin receptor agonist
AcNT8-13. Truncation of the rat NT1-neurotensin receptor produces
an agonist-dependent growth response that is more sensitive than
that observed with the wildtype receptor.
[0016] FIG. 7 depicts the results of liquid culture assays on yeast
cells containing the C. elegans serotonin receptor using serotonin
(5HT) to stimulate yeast cells growth. Yeast cells, containing a
mutated C. elegans serotonin receptor containing the M3 -MAR
IC3.DELTA. produced a 5HT-dependent growth response. The growth
response was blocked by addition of the serotonin receptor
antagonists lisuride and mianserin.
DETAILED DESCRIPTION OF THE INVENTION
Modified G Protein-Coupled Receptors
[0017] Nucleotide sequences encoding G protein-coupled receptors
may be modified to improve the function of the GPCR by causing the
receptor to couple more efficiently with the heterotrimeric G
protein and/or to fail to interact with the cell desensitization
and/or sequestration/internalization machinery. Such modifications
lead to improved agonist-stimulated yeast cell growth-promoting
ability. The improvement of GPCR-G protein coupling and/or
elimination of receptor phosphorylation and/or
sequestration/internalization in the host cell provides a means to
improve the function of wildtype heterologous GPCRs that fail to
stimulate a useful yeast cell growth response. Thus, GPCRs that
fail to function in their wild type form may be made to work by the
methods of this invention.
[0018] The improvement of GPCR-G protein coupling and or
elimination of receptor phosporylation and/or
sequestration/internalization in the host cell may be assessed by
using routine techniques, such as those described in the Examples
set fort below or known to those of skill in the art. For example,
improvement of the function of a mutated GPCR over wild type may be
quantified as an increase in the signal-to-noise ratio and/or in
the sensitivity of the liquid bioassay. The, signal-to-noise ratio
is determined by comparing the agonist-induced growth rate to the
growth rate observed in the absence of agonist. A
statistically-significant increase in the signal-to-noise ratio
resulting from agonist-stimulation of a mutated GPCR over similar
values obtained from cells containing a wild type receptor
indicates that the function of the mutated GPCR has been
improved.
[0019] The sensitivity of the liquid bioassay is defined as the
agonist concentration necessary to produce a half-maximal growth
rate (ED50 or EC50). The sensitivity of the bioassay is increased
if a mutated GPCR produces a half-maximal growth rate at an agonist
concentration that is less than that required by the wild type
GPCR.
[0020] Similarly, the more qualitative agar based bioassay will
reflect increases in signal-to-noise ratio and/or sensitivity due
to agonist stimulation of mutated GPCRs. In the agar based
bioassay, signal-to-noise ratio increases are determined by
comparing the extent of growth within the agonist-induced growth
zone resulting from stimulation of mutated and wild type receptor.
The sensitivity of the bioassay is proportional to the radius of
the growth zone. Since applied compounds diffuse radially from the
site of application to the agar, agonist concentration varies with
the square of the radius of the growth zone. Thus, a larger zone of
growth in response to agonist activation of mutated GPCRs reflects
an increase in sensitivity.
[0021] Any G protein-coupled receptor may be employed in practicing
this invention. Examples of such receptors include, but are not
limited to, adenosine receptors, somatostatin receptors, dopamine
receptors, cholecystokinin receptors, muscarinic cholinergic
receptors, .alpha.-adrenergic receptors, .beta.-adrenergic
receptors, opiate receptors, cannabinoid receptors, growth hormone
releasing factor, glucagon; serotonin receptors, vasopressin
receptors, melanocortin receptors, and neurotensin receptors. In
certain preferred embodiments, the receptor is a muscarinic
acetylcholine receptor and more preferably, the muscarinic
acetylcholine receptor is of the M3 subtype.
[0022] Similarly, any suitable host cell may be transformed with
the nucleotide sequences encoding the modified. G protein-coupled
receptors of this invention. Examples of suitable host cells are
yeast cells, mammalian cells, insect cells, and bacterial cells.
Preferably, the host cells are yeast cells.
[0023] One generalizable method for improving the function of a
GPCR expressed in a host cell is by modification or elimination of
intracellular domains of the GPCR, such as the third intracellular
loop (IC3) sequences of the G protein-coupled receptor. Because the
desensitization and internalization machinery acts upon the
intracellular domains of the GPCR, elimination of the intracellular
domains of the GPCRs produces a more stable receptor expression.
This has been demonstrated in experiments conducted in mammalian
cells. Muscarinic acetylcholine receptors including the M3 subtype,
lacking a domain of their third intracellular loop thought to be
involved in receptor internalization, are maintained in the plasma
membrane to a greater extent than their wild type counterparts.
Moro et al. (1993).
[0024] Representative embodiments of the invention are described in
more detail in the following examples.
EXAMPLE 1
Functional Expression of a Mutated Rat M3 Muscarinic Acetylcholine
Receptor (MAR) in Yeast
[0025] The third intracellular loops of GPCRs are thought to
interact with and participate in the activation of G proteins upon
agonist binding. J. Wess (1997). Mutations in IC3 of the yeast
mating pheromone receptors, Ste2 and Ste3 have profound effects on
coupling the G proteins. C Boone el al. (1993) and C. Clark et al.
(1994). Importantly, deletion of portion of the IC3 of mammalian
MARs, in particular the rat M3 MAR, is correlated with improved
functional expression in . mammalian cells with retention of full
ability to couple to the heterotrimeric G protein, Gq
(G.alpha..beta..gamma.). The mutated M3 MAR retains all external
loops. Transmembrane domains (TMDs) and internal domains other than
the IC3 are unchanged. The IC3, found between 5th and 6th membrane
spanning helices, was the only domain modified. The bulk of this
domain, 96 amino acids in the center of the IC3 (Ala273-Lys469),
were deleted, leaving only 22 amino acids proximal to both the 5th
and 6th transmembrane helices. Thus, the third intracellular loop
of the MAR. containing the IC3 deletion (IC3.DELTA.) is 44 amino
acids in length, compared to 240 amino acids in the IC3 of wild
type M3 MAR. The improvement in functional expression may due to
elimination of domains known to interact with cellular
desensitization mechanisms, allowing more functional MAR to be
retained at the cell surface.
[0026] In order to test the possibility that this IC3.DELTA.
mutation would also improve functional expression in yeast, the DNA
sequences encoding the wild type and IC3.DELTA. rat M3 MARs were
cloned into proximity to the glycerol-phosphate dehydrogenase
promoter in the yeast expression plasmid, p426GPD, by standard
methods. Rat M3 MAR sequences were amplified by PCR using
oligonucleotides containing 5' BglII (AAAAGATCT AAA ATG TAC CCC TAC
GAC GTC CCC) (SEQ ID NO: 1) and 3' XhoI (AAA CTCGAG CTA CAA GGC CTG
CTC CGG CAC TCG C) (SEQ ID NO: 2) sites. The resulting PCR product
was digested with the appropriate restriction. endonucleases,
purified and ligated into appropriate sites in p426GPD. To form the
rat M3 IC3.DELTA., three M3 MAR fragments were amplified by PCR. An
amino-terminal coding fragment was amplified using oligonucleotides
containing 5' BglII (AAAAGATCT AAA ATG TAC CCC TAC GAC GTC CCC)
(SEQ ID NO: 1) and 3' AgeI (ATAGTCATGATGGTG ACCGGT
ATGTAAAAGGCAGCGATC) (SEQ ID NO: 3) sites. A carboxy-terminal coding
fragment was amplified using oligonucleotides containing 5' PmlI
(GCCTTCATCAT CACGTG GACCCCCTACACC) (SEQ ID NO: 4) and 3' XhoI (AAA
CTCGAGCTA CAA GGC CTG CTC CGG CAC TCG C) (SEQ ID NO: 2) sites. An
IC3 coding fragment was amplified using oligonucleotides containing
5' AgeI (CGATCGCTGCCTTTTACTT ACCGGT CACCATCATGACTAT) (SEQ ID NO: 5)
and 3' PmlI (GTTGTAGGGGGTC CACGTG ATGATGAAGGC) (SEQ ID NO: 6) sites
using the M3 IC3.DELTA. sequence. J. Wess (1997). The resulting PCR
products were digested with the appropriate restriction
endonucleases, purified and ligated into appropriate sites in
p426GPD. Plasmids were confirmed by restriction endonuclease
mapping and DNA sequencing. Using a conventional lithium acetate
transformation procedure, the resulting plasmids were introduced
into yeast cells useful for performing assays of GPCR
agonist-stimulated growth, such as those described in U.S. Pat. No.
5,691,188, incorporated herein by reference, including,
specifically, the MPY578fc cells described in Pausch et al.
(1998).
[0027] Yeast cells containing the MARs were assayed in liquid
culture using the MAR agonist carbachol (CCh). The cells were
cultured overnight in 2 ml SC-glucose-ura medium. The cells were
diluted 500 fold in SC-glucose-ura-his, pH 6.8 medium containing 5
mM 3-aminotriazole to decrease basal growth rate. Samples of the
cell suspension (180 .mu.l) were dispensed to wells of sterile 96
well microtiter dishes containing 20 .mu.l of serially-diluted
samples (10.sup.-1-10.sup.-8M) of the muscarinic receptor agonists.
The plates were incubated at 30.degree. C. for 18 hours with
agitation (600 rpm). Growth was monitored by recording increases in
OD.sub.620 using a microplate reader. Assays were conducted in
duplicate and growth rate measurements obtained during the
logarithmic phase of yeast cell growth. Optical density
measurements were analyzed using GraphPad Prism and are presented
as the mean.+-.SEM and were plotted vs. agonist concentration. As
shown in FIG. 1, the yeast cells containing the M3 MAR IC3.DELTA.
produced an agonist-dependent growth response, demonstrating that
the M3 MAR IC3.DELTA. is functional, while the wild type MAR is
non-functional, as indicated by the lack of agonist-dependent yeast
cell growth. The growth response of the M3 MAR IC3.DELTA.
containing cells was dose-dependent giving an EC.sub.50 for
carbachol (CCh) equal to 3 .mu.M. This value matches the K.sub.D
for CCh obtained in HEK cells (7.9 .mu.M) and the EC.sub.50 for CCh
induced IP.sub.3 (inositol triphosphate) accumulation (4.0 .mu.M),
suggesting that the M3 MAR IC3.DELTA. retains the expected
pharmacological properties when expressed in yeast cell membranes.
Further, the growth response is blocked by the MAR-specific
antagonist, atropine (At).
[0028] Alternatively, the response to CCh by yeast cells containing
the M3 MAR IC3.DELTA. may be observed by measuring the
agonist-induced increase in fluorescent emission from a green
fluorescent protein reporter gene whose expression is stimulated by
MAR agonists. Green fluorescent protein (GFP) is a protein from
Aequorea that is intrinsically fluorescent when expressed in yeast
cells. The fluorescence from GFP is detectable in live yeast calls;
making it possible to measure the level of its expression without
any deleterious treatment of the yeast cells. This feature is
particularly advantageous in the reporter gene assays that do not
require additional steps to permit its detection. An inducible
reporter gene that is useful in detecting the agonist-activation of
heterologous GPCRs expressed in yeast utilizes transcriptional
promoters that are activated by the mating signal transduction
pathway. One such promoter is the FUS2 promoter. In the absence of
agonist stimulation, little or no expression of the Fus2 protein or
any other protein whose expression is directed by the FUS2 promoter
is detectable. After treatment with agonist, transcription from the
FUS2 promoter is induced up to 700 fold, leading to substantial
increases in Fus2 expression or in the expression of any gene
product whose expression is placed under control of the FUS2
promoter. Thus, yeast cell fluorescence resulting from GFP
expression under the control of the FUS2 promoter from a FUS2-GFP
reporter gene is only observed after agonist activation of a
heterologous GPCR.
[0029] In order to produce a GFP reporter gene, DNA sequences
encoding the enhanced GFP (EGFP, Clonetech), FUS2 promoter and FUS2
transcriptional terminator sequences were amplified by PCR. The
fragments were assembled into the centromere containing plasmid
pRS414 so as to place EGFP expression under control of the
pheromone responsive FUS2 promoter in the centromere containing
plasmid. pRS414, producing plasmid pMP241. Using a conventional
lithium acetate transformation procedure, the resulting plasmids
were introduced into yeast cells of the kind described in U.S. Pat.
No. 5,691,188, that are useful for performing assays of GPCR
agonist-stimulated growth of cells containing the M3 MAR
IC3.DELTA.. Specifically, the plasmids were introduced into the
MPY578fc cells described in Pausch et al. (1998).
[0030] Yeast cells containing the M3 MAR IC3.DELTA. and the
FUS2-EGFP reporter plasmid were assayed in liquid culture using the
MAR agonist carbachol (CCh). The cells were cultured overnight in 2
ml SC-glucose-ura medium. The cells were washed and diluted 5 fold
in SC-glucose-ura-his, pH 6.8 medium containing 5 mM
3-aminotriazole to decrease basal growth rate. Samples of the cell
suspension (180 .mu.l) were dispensed to wells of sterile 96 well
microtiter dishes containing 20 .mu.l of serially-diluted samples
(10.sup.-1-10.sup.-8 M) of CCh. The plates were incubated at
30.degree. C. for 6 hours with agitation (600 rpm). Stimulation of
the FUS2-EGFP reporter gene expression was monitored by recording
increases in emission at 530 nm after excitation with 480 nm light
using a fluorescence microplate reader. Assays were conducted in
duplicate and measurements obtained during the logarithmic phase of
yeast cell growth. Fluorescence emission measurements were analyzed
using GraphPad Prism and were presented as the mean.+-.SEM and were
plotted vs. agonist concentration. As shown in FIG. 1B, the yeast
cells containing the M3 MAR IC3.DELTA. produced a dose dependent
increase in florescence emission, consistent with increased
expression of the EGFP from the agonist inducible FUS2-GFP reporter
gene construct. The EC50 for CCh stimulation of fluorescence
emission is 4 .mu.M, identical to values obtained in the growth
assay.
[0031] Thus, deletion of a portion of the IC3 of the rat M3 MAR has
produced a functional GPCR when expressed in yeast, suggesting that
modification of internal domains may be a generalizable method for
improving the function of heterologous GPCRs expressed in
yeast.
EXAMPLE 2
Functional Expression of a Mutated D. melanogaster Muscarinic
Acetylcholine Receptor in Yeast
[0032] Agonist of the G protein-coupled insect muscarinic
acetylcholine receptors (MARs) possess substantial insecticidal and
miticidal activity. M. R. Dick et al. (1997). These observations
suggest that development of a yeast-based high throughput screen
(HTS) for agonists active at insect MARs may be useful in
identifying lead compounds that might be developed into
insecticides with novel mode of action. Preliminary experiments
indicate that the wild type D. melanogaster MAR (DMAR), an insect G
protein-coupled receptors (GPCRs), is non-functional in yeast.
Thus, an effort to develop a method for improving the function of
the DMAR in yeast was mounted, via replacement of the DMAR IC3 with
the functional IC3 from the M3 MAR IC3.DELTA..
[0033] In insect cells, the DMAR interacts with the heterotrimeric
Gq protein leading to an increase in intracellular calcium in
response to muscarinic agonists. One potential explanation for the
inactivity of the DMAR in yeast is an inability to efficiently
couple to the yeast heterotrimeric G protein. Thus, to devise a
method to improve the DMAR function in yeast, selected mutations in
the GPCRs that serve to improve functional expression and coupling
to the heterotrimeric G protein were examined.
[0034] In order to construct the IC3 replacement, PCR fragments
encoding three domains were prepared by standard means. Fragment 1
consisted of the amino terminal coding portion of the Drosophila
MAR up to an Agel site within the 5th TMD, amplified by PCR using
oligonucleotides (AAA AGATCT AAA ATG TACGGAAACCAGACGAAC) (SEQ ID
NO: 7) and (CCA GTA GAG GAA GCACATGATGGTC AGGCCT AAG TAG AAG GCG
GCC AGT GC) (SEQ ID NO: 8). The second fragment of the DMAR was
composed of carboxy terminal coding sequences starting with a PmII
site in the 6th TMD, amplified by PCR using oligonucleotides
(TTCATCATCACGTGGACTCCGTACAACATC) (SEQ ID NO: 9) and (AAA CTCGAG
TTATCTAATTGTAGACGCGGC) (SEQ ID NO: 10). The M3 MAR IC3.DELTA.
domain was amplified as an Agel-PmII fragment with coding sequence
in frame with fragments 1 and 2, described in Example 1. These
fragments were assembled in plasmid p426GPD to place the mutated
DMAR under control of the GPD promoter. The wild type DMAR was
cloned into the expression vector, pMP3, described in U.S. Pat. No.
5,691,188. Using a conventional lithium acetate; transformation
procedure, the resulting plasmids were introduced into yeast cells
useful for performing assays of GPCR agonist-stimulated growth,
such as those described in U.S. Pat. No. 5,691,188, including,
specifically, the MPY578fc cells described in Pausch et al.
(1998).
[0035] Yeast cells containing the DMAR and the plasmid containing
the wild type DMAR were assayed in liquid culture using the MAR
agonist carbachol (CCh). The cells were cultured overnight in 2 ml
SC-glucose-ura medium. The cells were diluted 500 fold in
SC-glucose-ura-his, pH 6.8, medium containing 5 mM 3-aminotriazole
to decrease basal growth rate. Samples of the cell suspension (180
.mu.l) were dispensed to wells of sterile 96 well microtiter dishes
containing 20 .mu.l of serially-diluted samples
(10.sup.-1-10.sup.-8 M) of the muscarinic receptor agonists. The
plates were incubated at 30.degree. C. for 18 hours with agitation
(600 rpm). Growth was monitored by recording increases in OD620
using a microplate reader. Assays were conducted in duplicate and
growth rate measurements obtained during the logarithmic phase of
yeast cell growth. Optical density measurements were analyzed using
GraphPad Prism and are presented as the mean.+-.SEM and were
plotted vs. agonist concentration. As shown in FIG. 2, the yeast
cells containing the mutated DMAR, i.e., the M3 MAR IC3.DELTA.,
produced an agonist-dependent growth response, demonstrating that
the DMAR-M3 MAR IC3.DELTA. is functional. The wild type DMAR is
non-functional, as indicated by the lack of agonist-dependent yeast
cell growth.
[0036] Thus, replacing IC3 of the DMAR with the functional deleted
IC3 from the rat M3 MAR produces a functional chimeric GPCR when
expressed in yeast, indicating that this method of replacing
internal domains may be a generalizable method for improving the
functional expression of heterologous GPCRs in cell-based assays,
such as yeast assays.
EXAMPLE 3
Functional Expression of a Mutated Rat Cholecystokinin CCKB
Receptor in Yeast
[0037] As shown in Examples 1 and 2, deletion of portion of the IC3
of mammalian MARs, in particular the rat M3 MAR, is correlated with
improved functional expression in mammalian and yeast cells with
retention of full ability to couple to the heterotrimeric G
protein. In order to test the possibility that this IC3.DELTA.
mutation would also improve functional expression of other GPCRs in
yeast, the DNA sequences encoding the rat wild type and IC3.DELTA.
cholecystokinin CCKB receptor were amplified by PCR and cloned into
proximity to the glycerol-phosphate dehydrogenase promoter in yeast
expression plasmid, p426GPD, by standard methods. The wild type
CCKBR was amplified by PCR using oligonucleotides
(ACTTAGATCAAAAAATGGAGCGCTCAAGCTGAACCG) (SEQ ID NO: 11) and
(CTCCCGTCGACTCAGCCAGGCCCCAGTGTGCTG) (SEQ ID NO: 12). The IC3.DELTA.
cholecystokinin CCKB receptor was prepared by fusing two
overlapping fragments. Fragment 1 contained amino terminal coding
sequences including 22 amino acids proximal to the 5th TMD,
amplified by PCR using oligonucleotides
(ACTTAGATCAAAAAATGGAGCGCTCAAGCTGAACCG) (SEQ ID NO: 11) and
(CGAGGGCCAGGGACTGGCCCCGGCCGGGCCCGGCTTTGGGTCTCG) (SEQ ID NO: 13).
Fragment 2 contained carboxy terminal coding sequences including 22
amino acids proximal to the 6th TMD, amplified by PCR using
oligonucleotides (TCCCGTCGACTCAGCCAGGCCCCAGTGTGCTG) (SEQ ID NO: 12)
and (CGAGACCCAAAGCCGGGCCCGGCCGGGGCCAGTCCCTGGCCCTCG) (SEQ ID NO:
14). The two fragments were fused by amplification by PCR using
oligos at 5' and 3' ends of the full length CCKB receptor. Using a
conventional lithium acetate transformation procedure, the
resulting plasmids were introduced into yeast cells useful for
performing assays of GPCR agonist-stimulated growth, such as those
described in U.S. Pat. No. 5,691,188, including, specifically, the
MPY578fc cells described in Pausch et al. (1998).
[0038] Yeast strains containing wild type and IC3.DELTA.
cholecystokinin CCKB receptor were grown overnight in 2 ml
synthetic complete liquid medium containing glucose (2%) and
lacking uracil (SCD-ura) medium. In this agar-based plate bioassay,
molten (50.degree. C.) SCD-ura his agar medium (35 ml, adjusted to
pH 6.8 by addition of concentrated KOH or NH.sub.4OH prior to
autoclaving) containing 0.5 mM AT (3-aminotriazole) was inoculated
with the overnight culture (2.times.10.sup.4 cells/ml) and poured
into square (9.times.9 cm) petri plates. Solutions of CCK agonists
in DMSO (1 mM, 10 .mu.l) were applied to the surface of the
solidified agar (Upper left: CCK8S; upper right, CCK8US; lower
left, CCK5; lower right, CCK4). Compounds applied to the surface of
the plate diffused radially from the site of application and bound
to CCKB receptors expressed on the surface of cells embedded in the
agar, resulting in induction of FUS1-HIS3 expression. The
responding cells formed a dense growth zone readily detectable over
the limited growth of cells observed in response to basal FUS1-HIS3
expression. Plates were incubated at 30.degree. C. for 3 days (FIG.
3). FIG. 3A demonstrates the robust growth response of yeast cells
containing the IC3.DELTA. cholecystokinin CCKB receptor, while FIG.
3B shows only limited growth by yeast cells containing the wild
type CCKB receptor, indicating that the deletion of portion of the
third intracellular loop of the CCKB receptor improves its function
in yeast.
EXAMPLE 4
Functional Expression of a Mutated Rat Somatostatin Receptor (SSTR)
in Yeast
[0039] The third intracellular loop participates in many GPCR
functions, including G protein coupling, desensitization and
interaction with diverse modifying proteins. Somatostatin receptors
are encoded in five subtypes, labeled SSTR1-5. Several amino acids
are found in the third intracellular loop of the SSTR3 subtype, but
not in the equivalent region of SSTR2 subtype. Since SSTR2
functions efficiently in yeast, deletion of those amino acids from
IC3 may impart this functional efficiency upon SSTR3. Thus, 8 amino
acids, Gln-Trp-Val-Gln-Ala-Pro-Ala-Cys (SEQ ID NO: 15), were
deleted from the third intracellular loop of the rSSTR3 cDNA,
enabling more efficient receptor signaling in yeast.
[0040] Rat SSTR3 sequences were amplified by PCR using
oligonucleotides containing 5' BglII and 3' XhoI sites. The
resulting PCR product of approximately 1.3 kb was digested with
BglII and XhoI, purified and inserted between the BamHI and XhoI
sites in p426GPD to generate the plasmid p26GPD-rSSTR3. Recombinant
plasmids were confirmed by restriction endonuclease digestion and
DNA sequencing.
[0041] Standard PCR reactions were used to amplify the rSSTR3 cDNA
to yield two PCR fragments that have 36 bp overlap as follows. PCR
insert A of approximate size 750 bp was generated using the 5' Bgl
oligonucleotide (AAAAAGATCT AAAATGGCCA CTGTTACCTA T) (SEQ ID NO:
16) and the 3' oligonucleotide CTCAGAGCGG CGTCGCCGCT GACACGAGGG
CGCCCG (SEQ ID NO: 17). PCR insert B of approximate size 530 bp was
generated using the 5' oligonucleotide GCGCCCTCGT GTCAGCGGCG
ACGCCGCTCT GAG (SEQ ID NO: 18) and the 3' XhoI oligonucleotide
(AAAACTCGAG TTACAGATGG CTCAGTGTGC T) (SEQ ID NO: 19). PCR fragments
A and B were gel purified, annealed and amplified by PCR using the
flanking 5' BglII and 3' XhoI oligonucleotides to yield the
.about.1.3 kb rSSTR3.DELTA.IC3 PCR product. Following purification
and digestion with BglII-XhoI, the rSST3.DELTA.IC3 insert was
ligated into BamHI-XhoI sites of p426GPD to generate the plasmid
p426GPD-rSSTR3.DELTA.IC3. Restriction mapping and DNA sequencing
confirmed correct reading frame and sequence.
[0042] Yeast cells of the type useful for expression of GPCRs,
described in U.S. Pat. No. 5,691,188, were transformed with
p426GPD-rSSTR3 and p426GPD-rSSTR3.DELTA.IC3, using standard
procedures. The cells (i.e., the LY296 cells, described in Price el
al. (1995)) were assayed using the agar-based bioassay format
described in Example 3. Samples (10 .mu.l) of Somatostatin (S-14, 1
mM) were applied to the surface of the selective agar medium
containing the yeast cells expressing the SSTR3. The plates were
incubated for 3 days at 30.degree. C. Yeast cells transformed with
p426GPD-rSSTR3 along with pLP82 (containing a Gpal/G.alpha.i2
chimeric G-protein expression plasmid) showed a weak growth
response to S-14 (FIG. 4A), whereas a much stronger response was
observed when p426GPD-rSSTR3.DELTA.IC3 was assayed under similar
conditions (FIG. 4B). These results indicate that deletion of a
portion of the IC3 improves the function of the SSTR3 in yeast.
EXAMPLE 5
An IC3 Deleted Human Alpha2A Adrenergic Receptor
[0043] As shown in Examples 1-4, deletion of portion of the IC3 of
mammalian GPCRs is correlated with improved functional expression
in mammalian and yeast cells with retention of full ability to
couple to the heterotrimeric G protein. The mutated MARs, CCKBR,
and SSTR3 retain all external loops. Transmembrane domains and
internal domains other than the IC3 are unchanged. The IC3, found
between 5th and 6th membrane spanning helices, was the only domain
modified. The bulk of this domain was deleted leaving only 22 amino
acids proximal to both the 5th and 6th transmembrane helices. Thus,
IC3 of the GPCRs containing the IC3 deletion (IC3.DELTA.) is 44
amino acids in length. The improvement in functional expression may
be due to elimination of domains known to interact with cellular
desensitization mechanisms, allowing more functional MAR to be
retained at the cell surface.
[0044] In order to test the possibility that other IC3.DELTA.
mutations would also improve functional expression of other GPCRs
in yeast, DNA sequences encoding an IC3.DELTA. human alpha2A
adrenergic receptor were amplified by PCR and cloned into proximity
to the glycerol-phosphate dehydrogenase promoter in yeast
expression plasmid, p426GPPD, by standard methods. The IC3.DELTA.
human alpha2A adrenergic receptor was prepared by fusing two
overlapping fragments. Fragment 1 contained amino terminal coding
sequences including 39 amino acids proximal to the 5th TMD,
amplified by PCR using oligonucleotides
(GGCCAGGATCCAAAAATGGGCTCCCTGCAGCCGGACGC) (SEQ ID NO: 20) and
(CGGGCCCCGCGGGCGCTCGGGGCCCAGACCGTTGGGC) (SEQ ID NO: 21). Fragment 2
contained carboxy terminal coding sequences including 41 amino
acids proximal to the 6th TMD, amplified by PCR using
oligonucleotides (CGGGCGACAGCCTGCCGCGGC) (SEQ ID NO: 22) and
(AGCGGTCGACTCACACGATCCGCTTCCTGTCCCC) (SEQ ID NO: 23). The two
fragments were fused by amplification by PCR using oligos at 5' and
3' ends of the full length alpha2A adrenergic receptor. Using a
conventional lithium acetate transformation procedure, the
resulting plasmids were introduced into yeast cells useful for
performing assays of GPCR agonist-stimulated growth, such as those
described in U.S. Pat. No. 5,691,188, including, specifically, the
MPY578fc cells described in Pausch et al. (1998).
[0045] Yeast cells containing the wild type IC3.DELTA. human
alpha2A adrenergic receptor were assayed in, liquid culture using
the alpha adrenergic receptor full agonist UKC14304 (RBI) and
partial agonist clonidine. The cells were cultured overnight in 2
ml SC-glucose-ura medium. The cells were diluted 500 fold in
SC-glucose-ura-his, pH 6.8 medium. Samples of the cell suspension
(180 .mu.l) were dispensed to wells of sterile 96 well microtiter
dishes containing 20 .mu.l of serially-diluted samples of the
adrenergic receptor agonist, UK14304 (10.sup.-3-10.sup.-10 M). The
plates were incubated at 30.degree. C. for 18 hours with agitation
(600 rpm). Growth was monitored by recording increases in OD620
using a microplate reader. Assays were conducted in duplicate and
growth rate measurements obtained during the logarithmic phase of
yeast cell growth. Optical density measurements were analyzed using
GraphPad Prism and are presented as the mean.+-.SEM and were
plotted vs. agonist concentration.
[0046] The yeast cells containing the wild type IC3.DELTA. human
alpha 2A adrenergic receptor produced a dose-dependent growth
response, indicating that this IC3 deletion is functional (FIG.
5).
EXAMPLE 6
Truncation of the Rat Neurotensin NT1 Receptor Causes an Increase
in Agonist Sensitivity
[0047] In examples 1-4, modification of the third intracellular
loop leads to improvement in functional expression of a variety of
heterologous, GPCRs expressed in yeast. Agonist induced
desensitization of the GPCRs is also mediated in part by GPCR
internal domains other than the third intracellular loop, such as
the intracellular carboxy-terminal tail.
[0048] Elimination of the carboxy terminal domains from GPCRs has
been shown to improve functional expression in yeast and mammalian
cells. Truncation of the carboxy terminal tail of the G
protein-coupled alpha mating pheromone receptor expressed in
.alpha.-mating type yeast cells causes supersensitivity to the
presence of mating pheromone (Reneke el al. (1988); Konopka et al
(1988)). Consistent with these observations, a mutated rat
neurotensin NT1 receptor (rNTR1) lacking its carboxy terminal tail
is resistant to agonist-induced internalization when expressed in
mammalian cells (Hermans et al (1996)).
[0049] To test whether carboxy-terminal truncation improves the
functional response of a heterologous GPCR expressed in yeast, the
rat NTR1 was modified by deleting the 52 amino acids that
constitute the carboxy terminal tail, leaving a shortened receptor
372 amino acids in length. The coding sequences of the wild type
and truncated neurotensin NT1 receptor (rNTR1 C-term .DELTA.), were
amplified by PCR using a 5' oligonucleotide primer that specified a
common amino-terminal coding sequence (AGTCAGATCTAAGCTT AAAA ATG
CAC CTC AAC AGC TCC)(SEQ ID NO: 24) and separate oligos that define
the wild type (AGTC AGATCT CTA GTA CAG GGTCTCCC) (SEQ ID NO: 25)
and truncated carboxy termini (AGAG AGATCT TTAGCGCCACCCAGGACAAAGGC)
(SEQ ID NO: 26). These fragments were cloned into proximity of the
PGK promoter in the yeast expression vector ppgK by standard
methods (Y-S. Kang el al. (1990)). Using a conventional lithium
acetate transformation procedure, the resulting plasmids were
introduced into yeast cells of the kind described in U.S. Pat. No.
5,691,188 that are useful for performing assays of GPCR
agonist-stimulated growth, including, specifically, the MPY578fc
cells described in Pausch et al. (1998).
[0050] Yeast cells containing the NTR1s were assayed in liquid
culture using the NT receptor agonist acetyl neurotensin 8-13
(AcNt8-13). The cells were cultured overnight in 2 ml
SC-glucose-ura medium. The cells were diluted 500 fold in
SC-glucose-ura-his, pH 6.8 medium containing 2 mM 3-aminotriazole
to decrease basal growth rate. Samples of the cell suspension (180
.mu.l) were dispensed to wells of sterile 96 well microtiter dishes
containing 20 .mu.l of serially-diluted samples
(10.sup.-3-10.sup.-10 M) of AcNT8-13. The plates were incubated at
30.degree. C. for 18 hours with agitation (600 rpm). Growth was
monitored by recording increases in OD.sub.620 using a microplate
reader. Growth rate measurements were obtained during the
logarithmic phase of yeast cell growth. Optical density
measurements were analyzed using GraphPad Prism and are presented
as the mean.+-.SEM and were plotted against agonist concentration.
As shown in FIG. 6, the yeast cells containing the NTR1s produced
an agonist-dependent growth response demonstrating that both the
wild type and carboxy terminally truncated NTR1s were functional.
The growth response of the rNTR1 C-term .DELTA. containing cells
was dose-dependent giving an EC50 for AcNT8-13 equal to 520 nM.
This value is five fold, lower than observed for cells expressing
the wild type NTR1 (2.1 .mu.M). The carboxy terminal deletion has
produced a rNTR1 that responds to a lower concentration of NTR
agonist improving the sensitivity of the yeast bioassay.
[0051] Thus, deletion of a portion of the carboxy terminal
intracellular domain of the rat NTR1 has produced a functional GPCR
with increased agonist sensitivity when expressed in yeast,
suggesting that modification of this internal domain is a
generalizable method for improving the function of heterologous
GPCRs expressed in yeast.
EXAMPLE 7
Functional Expression of a Mutated C. elegans Serotonin Receptor in
Yeast
[0052] Agonists of the G protein-coupled C. elegans serotonin
receptor (Ce 5HTR) may possess substantial nematacidal activity.
These observations suggest that development of a yeast-based HTS
for agonists active at Ce 5HTRs may be useful in identifying lead
compounds that might be developed into nematacides with a novel
mode of action. Preliminary experiments indicated that the wild
type Ce 5HTR was non-functional in yeast. Thus, an effort to
develop a method for improving the function of the Ce 5HTR in yeast
was mounted, via replacement of the Ce 5HTR IC3 with the functional
IC3 from the M3 MAR IC3.DELTA..
[0053] In order to construct the IC3 replacement, PCR fragments
encoding three domains were prepared by standard means. Fragment 1
contains the amino terminal-coding portion of the Ce 5HTR to the
intracellular interface of the 5th TMD, amplified by PCR using
oligonucleotides (AAAAGATCTAAAATGATCGACGAGACGCTTC) (SEQ ID NO: 27)
and (CCGCTTGGTGATCTGACTTCTGGTTTCTGTCCCAGAGGCCTGTAGGCCAG
CCAGCTCTTTGGTACGCTTCTCAGTTTCCTTATAGATCTFCCAGTACACGC AAATTATTGC)
(SEQ ID NO: 28). The second fragment of the Ce 5HTR contains
carboxy-terminal coding sequences starting proximal to the
intracellular interface of the 6th TMD, amplified by PCR using
oligonucleotides (AAAACTCGAGTCAATAATCGTGAATAAGGCA) (SEQ ID NO: 29)
and (GGCCTACAGGCCTCTGGGACAGAAACCAGAAGTCAGATCACCAAGCGGA
AGAGGATGTCGCTCATCAAGGAGAAGAAGGCCGCCAGAACGCTAGCAAT TATTACAGGTAC)
(SEQ ID NO: 30). The M3 MAR IC3.DELTA. domain was amplified by PCR
as described in Example 1.
[0054] These fragments were isolated, mixed and amplified by PCR
with 5' (AAAAGATCTAAAATGATCGACGAGACGCTTC) (SEQ ID NO: 27) and 3'
(AAAACTCGAGTCAATAATCGTGAATAAGGCA) (SEQ ID NO: 29) oligonucleotides.
The resulting fragment was digested with appropriate restriction
endonucleases and assembled in p426GPD to place the mutated Ce 5HTR
under control of the GPD promoter. Using a conventional lithium
acetate transformation procedure, the resulting plasmids were
introduced into yeast cells useful for performing assays of GPCR
agonist-stimulated growth, such as those described in U.S. Pat. No.
5,691,188, including, specifically, the MPY578fc cells described in
Pausch el al. 1998.
[0055] Yeast cells containing the Ce 5HTR were assayed in liquid
culture. The cells were cultured overnight in 2 ml SC-glucose-ura
medium. The cells were diluted 500 fold in SC-glucose-ura-his, pH
6.8 medium containing 2 mM 3-aminotriazole to decrease basal growth
rate. Samples of the cell suspension (200 .mu.l) were dispensed to
wells of sterile 96 well microtiter dishes containing 2.0 .mu.l of
serially-diluted samples (10.sup.-2-10.sup.-9 M) of serotonin
(5HT). In similar reactions, the serotonergic antagonists lisuride
and mianserin were added to each well at 10 .mu.M. The plates were
incubated at 30.degree. C. for 18 hours with agitation (600 rpm).
Growth was monitored by recording increases in OD620 using a
microplate reader. Assays were conducted in duplicate and growth
rate measurements were obtained during the logarithmic phase of
yeast cell growth. Optical density measurements were analyzed using
GraphPad Prism and are presented as the mean.+-.SEM, plotted vs.
agonist concentration. Ki values were determined using the equation
of Cheng and Pruesoff (Y. Cheng el al. (1973)). As shown in FIG. 7,
the yeast cells containing the mutated Ce 5HTR containing the M3
MAR IC3.DELTA. produced an agonist-dependent growth response,
demonstrating that the Ce 5HTR-M3 MAR IC3.DELTA. is functional. As
expected, the serotonergic antagonists lisuride and mianserin
blocked the growth inducing effect of serotonin, demonstrating that
the Ce 5HTR exhibits the expected pharmacological properties when
expressed in yeast.
[0056] Thus, replacing IC3 of the Ce 5HTR with the functional
deleted IC3 from the rat M3 MAR produces a functional chimeric GPCR
when expressed in yeast, indicating that this method of replacing
internal domains may be a generalizable method for improving the
functional expression of heterologous GPCRs in cell-based assays,
such as yeast assays.
[0057] Other embodiments of the invention will be apparent to those
skilled in the art from consideration of the specification and
practice of the invention disclosed herein. It is intended that the
specification and examples be considered as exemplary only, with a
true scope and spirit of the invention being indicated by the
following claims.
[0058] The references cited herein are specifically incorporated by
reference in their entirety.
REFERENCES
[0059] C. Boone et al., "Mutations That Alter the Third Cytoplasmic
Loop of the A-Factor Receptor Lead to a Constitutive and
Hypersensitive Phenotype," Genetics, Proc. Nat'l. Acad. Sci.
U.S.A., 90:9921-9925 (November 1993).
[0060] M. G. Caron, "The Guanine Nucleotide Regulatory
Protein-Coupled Receptors for Nucelotides, Amino Acids, and Amine
Neurotransmitters," Cell Biology, 1:159-166 (1989).
[0061] Y. Cheng et al.; "Relationship between the inhibition
constant (Ki) and the concentration of inhibitor which causes 50
percent inhibition (150) of an enzymatic reaction," Biochem.
Pharmacol., 22: 3099-3108 (1973).
[0062] C. D. Clark et al., "Systematic Mutagenesis of the Yeast
Mating Pheromone Receptor Third Intracellular Loop," J. Biol.
Chem., 269(12):8831-8841 (1994).
[0063] B. R. Conklin and H. R. Bourne, "Structural Elements of G
Alpha Subunits that Interact with G Beta Gamma Receptors, and
Effectors," Cell, 73:631-641 (1993).
[0064] M. R. Dick et al., "Muscarinic Agonists as Insecticides and
Acaricides," Pestic. Sci., 49:268-276 (1997).
[0065] H. G. Dohlman et al., "Model Systems for the Study of
Seven-Transmembrane-Segment Receptors," Ann. Rev. Biochem.,
60:653-688 (1991).
[0066] E. Hermans et al., "Interaction of the COOH-Terminal Domain
of the Neurotensin Receptor with a G Protein Does Not Control the
Phospholipase C Activation But is Involved in the Agonist Induced
Internalization;" Mol. Pharmacol., 49:365-372 (1996).
[0067] Y. S. Kang et al., "Effects of Expression of Mammalian G
Alpha and Hybrid Mammalian-Yeast G Alpha Proteins on the Yeast
Pheromone Response Signal Transduction Pathway," Mol. Cell. Biol.,
10(6):2582-2590 (1990).
[0068] J. B. Konopka et al., "The C-Terminus of the S. cerevisiae
Alpha Pheromone Receptor Mediates an Adaptive Response to
Pheromone," Cell, 54:609-620 (1988).
[0069] M. Krieger et al., "Isolation of Chinese Hamster Cell
Mutants Defective in the Receptor-Mediated Endocytosis of Low
Density Lipoprotein," J. Mol. Biol., 150(2);167-84 (August
1981).
[0070] J. Lameh et al., "Hm1 Muscarinic Cholinergic Receptor
Internalization Requires a Domain in the Third Cytoplasmic Loop,"
J. Biol. Chem., 267(19):13406-13412 (1992).
[0071] S. B. Liggett et al., "Sites in the Third Intracellular Loop
of the .alpha..sub.2A-Adrenergic Receptor Confer Short Term
Agonist-Promoted Desensitization," J. Biol. Chem., 267(7):4740-4746
(1992).
[0072] O. Moro et al., "Serine- and Threonine-rich Domain Regulates
Internalization of Muscarinic Cholinergic Receptors," J. Biol.
Chem., 268(10):6862-6865 (1993).
[0073] M. H. Pausch et al., "G-Protein-Coupled Receptors in
Saccharomyces Cerevisiae: High-Throughput Screening Assays for Drug
Discovery," Trends in Biotechnology, 15:487-494 (1997).
[0074] M. H. Pausch et al., "Heterologous G protein-coupled
receptors in Saccharomyces cerevisiae, Methods for genetic analysis
and ligand identification," Identification and expression of G
protein-coupled receptors, Lynch, K. R., Ed., Wiley-Liss, New York,
N.Y., 196-212 (1998).
[0075] L. A. Price et al., "Functional coupling of a mammalian
somatostatin receptor to the yeast pheromone response pathway,"
Mol. Cell. Biol. 15, 6188-6195, (1995).
[0076] J. E. Reneke et al., "The Carboxy Terminal Segment of the
Yeast Alpha Factor Receptor Is a Regulatory Domain," Cell,
55:221-234 (1988).
[0077] A. B. Tobin et al., "Identification of a Novel Receptor
Kinase That Phosphorylates A Phospholipase C-linked Muscarinic
Receptor," J. Biol. Chem., 271(7):3907-3916 (1996).
[0078] A. B. Tobin et al., "Stimulus-Dependent Phosphorylation of
G-Protein-Coupled Receptors by Casein Kinase 1.alpha.," J. Biol.
Chem., 272(33):20844-20849 (1997).
[0079] H. Tsuga et al., "Internalization and Down-Regulation of
Human Muscarinic Acetylcholine Receptor m2 Subtypes," J. Biol.
Chem., 273(9):5323-5330 (1996).
[0080] J. Wess, "G-Protein-Coupled Receptors: Molecular Mechanisms
Involved in Receptor Activation and Selectivity of G-Protein
Recognition," FASEB J., 11: 346-354 (1997).
* * * * *