U.S. patent application number 11/722089 was filed with the patent office on 2008-01-03 for ligation-based rna amplification.
This patent application is currently assigned to GE HEALTHCARE BIO-SCIENCES CORP.. Invention is credited to Rohini Dhulipala, R. Scott Duthie, Gregory A. Grossmann, John R. Nelson, Anuradha Sekher.
Application Number | 20080003602 11/722089 |
Document ID | / |
Family ID | 36499164 |
Filed Date | 2008-01-03 |
United States Patent
Application |
20080003602 |
Kind Code |
A1 |
Nelson; John R. ; et
al. |
January 3, 2008 |
Ligation-Based Rna Amplification
Abstract
Methods of amplification, purification and detection of nucleic
acid sequences especially RNA are described. One aspect of the
method involves the hybridisation and subsequent ligation of a
nucleic acid structure to the nucleic acid sequence desired to be
manipulated. The methods require that the nucleic acid structure
comprises a double stranded region and a single stranded region.
The single stranded region is complementary to the RNA sequence of
interest. The double stranded region may also contain additional
functionalities which are then used subsequently in the method.
Inventors: |
Nelson; John R.; (Clifton
Park, NY) ; Duthie; R. Scott; (Schenectady, NY)
; Dhulipala; Rohini; (Kendall Park, NJ) ;
Grossmann; Gregory A.; (Halfmoon, NY) ; Sekher;
Anuradha; (Niskayuna, NY) |
Correspondence
Address: |
GE HEALTHCARE BIO-SCIENCES CORP.;PATENT DEPARTMENT
800 CENTENNIAL AVENUE
PISCATAWAY
NJ
08855
US
|
Assignee: |
GE HEALTHCARE BIO-SCIENCES
CORP.
800 CENTENNIAL AVENUE
PISCATAWAY
NJ
08855
|
Family ID: |
36499164 |
Appl. No.: |
11/722089 |
Filed: |
December 22, 2005 |
PCT Filed: |
December 22, 2005 |
PCT NO: |
PCT/US05/46800 |
371 Date: |
June 19, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60638937 |
Dec 23, 2004 |
|
|
|
60685661 |
May 27, 2005 |
|
|
|
Current U.S.
Class: |
435/6.18 ;
435/183; 435/194; 435/6.1; 435/91.2 |
Current CPC
Class: |
C12Q 1/6865 20130101;
C12N 15/1096 20130101; C12Q 1/6865 20130101; C12Q 2525/143
20130101; C12Q 2521/501 20130101 |
Class at
Publication: |
435/006 ;
435/183; 435/194; 435/091.2 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12N 9/00 20060101 C12N009/00; C12N 9/12 20060101
C12N009/12; C12P 19/34 20060101 C12P019/34 |
Claims
1. A method of producing a ligated nucleic acid molecule
comprising: a) supplying RNA other than poly A; b) supplying one or
more nucleic acids having a double stranded region and a single
stranded 3' terminal region; and c) hybridizing the single stranded
3' terminal region of the nucleic acid sequence to the RNA and
ligating one 5' end of the double stranded region of the nucleic
acid to the 3' end of the RNA by enzymatic means.
2. The method of claim 1, wherein the nucleic acids of step b)
comprise DNA.
3. The method of claim 1, wherein the nucleic acids incorporates
one or more features selected from the group consisting of: a) a
nucleotide sequence that can subsequently be used as a promoter
sequence for RNA synthesis; and b) a Tag which can be used to label
the nucleic acid or manipulate the nucleic acid.
4. The method of claim 3, further comprising transcribing the
product obtained using the nucleotide sequence of 1) and of tag 2)
with RNA polymerase to produce a 5' sequence tagged cRNA.
5. The method of claim 4, wherein the 5' tagged cRNA molecule is
ligated with a second double stranded DNA sequence comprising a
double stranded region and a single stranded region.
6. The method of claim 5, wherein the ligated RNA-DNA molecule
product is further transcribed by RNA polymerase to produce
multiple copies of RNA containing tags at the 5' and 3' end of the
RNA molecule.
7. The method of claim 6, wherein the 5' and 3' tagged RNA sequence
is: a) mixed and hybridized with a DNA primer which is
complementary to the sequence tag at the 3' end of the RNA; b)
incubated with reverse transcriptase and dNTPs to produce a single
strand cDNA-RNA heteroduplex; c) incubating the product of step b)
with RNase; and d) incubating the product of step c) with a second
single strand primer the sequence of which is complementary to the
tag sequence at the 3' end of the single strand cDNA and DNA
polymerase to produce a double stranded cDNA containing sequence
tags at both ends.
8. A method of amplifying a target RNA sequence comprising the
steps of: a) supplying the RNA in single stranded form; b) adding a
DNA sequence that comprises a double stranded region which contains
a promoter sequence for RNA polymerase and a single stranded region
which hybridizes to the target RNA; c) ligating the DNA sequence to
the 3' end of RNA by enzymatic means to produce a DNA-RNA; and d)
transcribing the DNA-RNA with RNA polymerase to produce antisense
complementary RNA (cRNA).
9. The method of amplification of claim 8, further comprising: e)
adding a DNA sequence that comprises a double stranded region which
contains a promoter sequence for RNA polymerase and a single
stranded region which hybridizes to the cRNA; f) ligating the cRNA
and DNA sequence by enzymatic means; and g) transcribing the
product of step f) with RNA polymerase to produce multiple copies
of RNA having the same sense as the target RNA.
10. The method of amplification of claim 9, wherein at least one of
the double stranded DNA sequence contains a sequence Tag.
11. The method of amplification of claim 9, wherein both double
stranded DNA sequence contain a sequence Tag.
12. The method of amplification of claim 11, wherein the sequence
Tags are different.
13. The method of claim 9, wherein the double stranded DNA sequence
used in steps b) and e) contains a promoter for different RNA
polymerase.
14. The method of claim 8, wherein step d) is performed in a
reaction comprising one or more nucleotide analogues.
15-21. (canceled)
22. The method according to claim 14, where the synthesized cRNA is
used to measure gene expression.
23-24. (canceled)
25. The method of claim 1, in which the nucleic acids further
comprises an affinity tag wherein the affinity tag can be used to
purify the ligated nucleic acid molecule.
26. A method of analyzing nucleic acid comprising: a) hybridizing
an oligodeoxyribonucleotide which contains natural and modified
nucleotides to an RNA sequence such that the
oligodeoxyribonucleotide is complementary to a portion of the RNA;
b) contacting the resulting RNA-DNA heteroduplex with an agent that
specifically nicks only the RNA strand; and c) ligating a DNA
sequence to the trimmed RNA 3' end of step b).
27. The method of claim 26, further comprising producing cRNA
according to the method of claim 8.
28. A method of analyzing nucleic acid comprising: a) hybridizing
an oligodeoxyribonucleotide which contains natural and modified
nucleotides to an RNA sequence such that the
oligodeoxyribonucleotide is complementary to a portion of the RNA
and that the oligodeoxyribonucleotide hybridises at the poly(A)
tail:message junction b) contacting the resulting RNA-DNA
heteroduplex with an agent that specifically nicks only the RNA
strand at the poly(A):message junction c) determining the size of
the poly(A) tail.
29. A kit comprising a nucleic acid sequence that comprises or
nucleic acid sequences that comprise a double stranded region and a
single stranded region and a DNA ligase.
30. The kit of claim 29, wherein the DNA ligase is T4 DNA
ligase.
31. The kit of claim 29, which additionally contains an exonuclease
and an RNA polymerase.
32. The kit of claim 29, which additionally contains oligo
(dA).
33. The kit of claim 29, wherein the nucleic acid sequence
comprises an oligodeoxynucleotide containing natural and modified
nucleotides.
Description
FIELD OF THE INVENTION
[0001] The invention relates to a new method of amplification,
purification and detection of nucleic acids.
BACKGROUND OF THE INVENTION
[0002] The ability to amplify the quantity of nucleic acid,
especially specific nucleic acid sequences, in a sample is an
important aspect of many molecular biology techniques and assays.
Polymerase chain reaction (PCR), U.S. Pat. No. 4,683,195 and U.S.
Pat. No. 4,683,202 has been widely used to achieve amplification of
specific nucleic acid sequences. In this method a mixture of
nucleic acid sequences is mixed with two short oligodeoxynucleotide
primers which specify the specific sequences are to be
amplified.
[0003] Many of the previous methods are related to amplification of
DNA. However, there have been increasing attempts to amplify target
RNA molecules. The amplification of RNA is important in areas such
as expression analysis and viral detection. One technique involved
in amplification of RNA is called RT-PCR. In this technique RNA
molecules are copied into complementary DNA (cDNA) sequences by the
action of reverse transcriptase. The cDNA is then amplified by DNA
polymerase in conjunction with appropriate primers.
[0004] A separate methodology has been described by Van Gelder et
al. U.S. Pat. No. 5,545,522, U.S. Pat. No. 5,716,785 and U.S. Pat.
No. 5,891,636. Here RNA target molecules are reverse transcribed
into cDNA by reverse transcriptase in conjunction with a primer
which also combines a promoter sequence for T7 RNA polymerase.
After double stranded cDNA has been produced, T7 RNA polymerase is
added and multiple copies of complementary RNA (cRNA) are produced
by transcription.
[0005] The method described by Van Gelder et al requires cDNA
synthesis and is multi-step, requiring reverse transcriptase,
RNAse, polymerase and ligase and also requires a purification step
in the middle of the protocol. These additional steps add to the
complexity and also cost of the synthesis of cRNA.
[0006] Recently it has been demonstrated that DNA dependent RNA
polymerases (RNA polymerases) can replicate short fragments of RNA
by transcription if the RNA molecule to be transcribed is attached
to a double stranded DNA promoter. After transcription initiation
by the RNA polymerase on the double stranded DNA region,
transcription proceeds across the RNA-DNA junction and through the
RNA region with no observable loss of speed or processivity.
Additionally, the template RNA being transcribed can be single
stranded RNA, double stranded RNA, or a DNA:RNA heteroduplex. The
only requirement for this process being that the RNA polymerase
must initiate transcription on a double stranded DNA segment
(Arnaud-Barbe, et al. Nucleic Acid Research 26 3550-3554
(1998)).
[0007] DNA ligases catalyze the joining of DNA strands to one
another, while RNA ligases catalyze the joining of RNA strands to
one another. It is a common misconception that DNA ligase is very
inefficient at ligation of DNA to RNA strands. It has been
demonstrated, however, that DNA ligase catalyzes the efficient
joining of 3'-OH-terminated RNA to 5'-phosphate-terminated DNA on a
DNA scaffold (Arnaud-Barbe, et al, 1998). DNA ligase is much less
effective at joining 3'-OH-terminated DNA to
5'-phosphate-terminated RNA (much like the nick present during
Okazaki strand maturation prior to RNA primer removal) and is
extremely weak at phosphodiester formation between two RNA strands
(Sekiguchi and Shuman. Biochem 36: 9073-9079 (1997)).
[0008] Nath and Hurwitz JBC 249 3680-3688 (1974) described the
covalent ligation of the 3'-OH of polyA to the 5'-phosphate of
polydA provided a polydT sequence was present to provide
hybridisation using either E-coli DNA ligase or T4 DNA ligase.
Similar observations were reported by Fareed et al. (J. Biol. Chem.
246 925 (1971)).
SUMMARY OF THE INVENTION
[0009] At least one example embodiment of the present invention
removes some of the steps mentioned in the previous amplification
methods. Also the previous methods described to purify
polyadenylated (poly(A)) mRNA do not attach the oligo(dT) sequence
to RNA by a covalent bond, they only use base pairing (hydrogen
bonding, which is not covalent) so buffer conditions need to be
gentle. If ligation of sequence to end of RNA is used it results in
very stable covalent attachment, allowing more stringent buffer
conditions to be used. The methods described involve the production
of a nucleic acid structure and its subsequent use in the
purification and amplification of nucleic acid. The methods require
a DNA sequence that comprises a double stranded region and a single
stranded region. The single stranded region is complementary to the
RNA sequence of interest. The RNA sequence is then hybridized to
the single stranded region of the DNA sequence and then the two
sequences are ligated in a novel procedure to produce an RNA-DNA
molecule. The DNA sequence also contains an additional feature
depending on the future use of the RNA-DNA molecule produced.
[0010] Embodiments also include methods whereby the 3' end of RNA
is first ligated to a double stranded DNA oligonucleotide
containing a promoter sequence. This double stranded DNA
oligonucleotide contains a promoter for RNA polymerase within the
double stranded region that is followed by a segment of single
stranded DNA forming a 3' overhang. When the 3' overhang contains a
string of thymidine residues, the single stranded portion of the
double stranded DNA will hybridize to the 3' end of messenger RNA
(mRNA) poly(A) tails. After the addition of ligase mRNA will have
one strand of this double stranded DNA sequence ligated to the 3'
end. When an RNA polymerase is added, these hybrid molecules will
be efficiently transcribed to synthesize cRNA. As transcription
reactions using RNA polymerase typically transcribe each template
multiple times, this method allows for effective RNA
amplification.
[0011] Another method similar to that described above involves the
ligation of the DNA oligonucleotide to the RNA as described.
However, the DNA oligonucleotide is either attached to a solid
support or contains an affinity tag. This allows for very efficient
covalent attachment and/or capture of RNA molecules, which can be
used for any of a variety of purposes.
[0012] Yet another method utilizes the ligation and subsequent
transcription to create complementary RNA containing a user-defined
sequence at the 5' end of the cRNA. This sequence "tag" is placed
between the RNA polymerase promoter and the 3' end of the ligated
RNA molecule. The user-defined sequence can be used for
purification or identification or other sequence specific
manipulations of this cRNA. If this cRNA product is subsequently
ligated and re-amplified according to the described method, the
resulting doubly-amplified product will be "sense", with respect to
the original sense template and this new product can have two
separate user-defined sequences located at it's 5' ends. These
sequences can be used for synthesis of cDNA, allowing for
full-length synthesis and directional cloning. Those skilled in the
art will understand that either with or without the user defined
sequences, this double amplification method can provide a
significant increase in RNA amount, allowing for analysis of
samples previously too small for consideration.
BRIEF DESCRIPTION OF THE FIGURES
[0013] FIG. 1 is a schematic representation of the initial ligation
and subsequent transcription reactions.
[0014] FIG. 2 is a schematic representation of further ligation and
transcription reactions.
[0015] FIG. 3 is a schematic representation of the methods to
produce cDNA.
[0016] FIG. 4 shows results of volume density measurements.
[0017] FIG. 5 shows hybridisation results obtained from various on
tissues on arrays.
[0018] FIG. 6 shows results from FIG. 5 in chart form.
[0019] FIG. 7 shows results of DNA and RNA before and after
purification.
[0020] FIG. 8 shows results obtained from HPLC analysis of
exonuclease digested cRNA. All results were normalised to `C`.
DETAILED DESCRIPTION OF THE INVENTION
a) Outline
[0021] The methods described involve the novel production of a
nucleic acid structure and its subsequent use in purification and
amplification of nucleic acid. The methods require a DNA sequence
that comprises both a double stranded region and a single stranded
region. Note that this conformation may be formed by mixing two DNA
oligos together or by using on oligo capable of forming a hairpin
loop. The single stranded region is complementary to the RNA
sequence of interest and may contain either: 1) a poly(dT)
sequence, e.g., 5'-d[ . . . (T)x]-3' where X may be any whole
number and ` . . . ` represents one strand of the preceding double
stranded region, or 2) a poly(dT) sequence with variable nucleotide
sequences at the 3' end, e.g., 5'-d[ . . . TTT(V)x(N)x]-3' where V
may be A, C, or G, N may be any of all four nucleotides, X may be
any whole number and ` . . . ` represents one strand of the
preceding double stranded region. RNA is then hybridized to the
single stranded region of the DNA sequence and the two sequences
ligated in a novel procedure to produce an RNA-DNA molecule. One
skilled in the art will recognize that the poly(dT) portion may be
eliminated so that the composition of the single stranded would be
5'-d[ . . . (V)x(N)x]-3', d[ . . . (V)x]-3', or d[ . . .
(N)x]-3'.
b) Nucleic Acid Consideration
[0022] The methods described have particular use in the
amplification and purification of RNA. The RNA can come from a
variety of sources but the methods are particularly suitable for
eukaryotic mRNA containing polyA tails. For example the RNA can
come from human or other animal sources and could be part of
studies comparing RNA samples between healthy and disease/infected
populations or between treated and control samples and could also
include RNA for evaluation from individuals to aid in diagnostic
procedures, disease vs healthy, cancer vs non, treated vs non for
experimental, drug screening, infectious agent screening. The RNA
is usually a mixture of different RNA sequences from the sample and
comprises RNA sequences with the four naturally occurring bases
A,C,G and U. Other unusual or modified bases may also be
present.
[0023] The generation of multiple copies of RNA, particularly
labeled RNA, is important for a number of applications. These
include situations where samples are limited such as fetal origin,
aged persons, single cell or limited cell analysis, patient biopsy,
high throughput laboratories, samples which are dilute, such as
rare event screening such as cells in mixed samples such as cancer
cells in blood during metastatic or pre-metastatic cancer,
environmental samples (biowarfare detection, water purity, food
testing).
c) Initial Hybridization and Ligation
[0024] The RNA sample is mixed with a nucleic acid sequence that
comprises or nucleic acid sequences that comprise a double stranded
region and a single stranded region. The single stranded region of
the nucleic acid sequence hybridizes to the RNA. Ligation of one 5'
end of the double stranded region of the nucleic acid to the 3' end
of RNA is achieved by enzymatic means. The nucleic acid sequence
used may be DNA, RNA, a combination of DNA and RNA or nucleic acid
analogues such as PNA. The nucleic acid sequence may comprise two
separate strands of different length or may be a single strand
which contains a hairpin structure allowing for the formation of a
double stranded region and a single stranded region.
[0025] For convenience a detailed description is provided where the
nucleic acid sequence comprises DNA. As shown in FIG. 1, the first
step of the one example embodiment of the present invention is to
ligate a DNA sequence to the 3'end of mRNA sequence. This DNA
sequence comprises a double strand region and a single stranded
region. The single stranded region is used to hybridize the 3' end
of the mRNA and position the double stranded region adjacent to the
RNA sequence. As shown, the single stranded DNA (portion/region)
may be composed of several T residues (poly dT) which then
hybridize to the poly A tail of the mRNA. The poly dT sequence can
be 1 to 100 long, more preferably 3 to 25 long.
[0026] It has been found that the ligation of the DNA sequence to
the 3' end of the mRNA can be achieved by the use of many different
DNA or RNA ligase enzymes. T4 DNA ligase has been shown to be
particularly suitable. The recessed 5' end of the DNA requires a
phosphate group for successful ligation.
[0027] Depending on the intended use for the RNA-DNA molecule which
is later produced, the double stranded DNA portion/region of the
molecule comprises at least one of the following features. In a
first instance an affinity tag may be present which allows the
separation and purification of the RNA-DNA molecule and hence
provides a simple method of RNA purification. Examples of affinity
tags include biotin which can be bound to avidin or streptavidin
coated supports or other tag/binding partners e.g. His tags or
antibodies and other systems well known to those skilled in the
art. The affinity tag may be present at the 3' end of the ligated
DNA.
[0028] Secondly a promoter sequence for RNA polymerase activity can
be incorporated into the double stranded DNA sequence. These are
well known and the most preferable sequence is the one for T7 RNA
polymerase although sequences for SP6 or T3 RNA can be used. Indeed
any DNA dependent RNA polymerase that requires a double stranded
promoter sequence for the initiation of RNA synthesis recognition
would function in this system. The RNA polymerase promoter is
ideally located 1-40 base pairs from the 5' end of the
oligonucleotide.
[0029] Additionally, a tag region (depicted as Tag #1 in FIG. 1)
can be introduced into the double stranded DNA region downstream
from the site of transcription, prior to the RNA-DNA function. This
region which allows for the subsequent manipulation of the nucleic
acid structure that has been produced by ligation or ligation
followed by amplification. One example of a Tag region is a
nucleotide sequence for restriction enzyme cleavage. Other examples
of tag regions include nucleotide sequences for binding of other
protein molecules.
[0030] It is also possible that the hybridisation/annealing of the
double stranded DNA sequence to the RNA is stimulated by a double
stranded DNA sequence located immediately adjacent to the
subsequent ligation point which contains a nucleotide sequence
which is involved in co-operative binding of nucleic acid
sequences.
[0031] Further examples of a Tag could be dyes or
radioactivity.
d) Purification
[0032] If a suitable affinity tag has been included in the nucleic
acid sequence, preferably at the 3' end of the nucleic acid
sequence, which is subsequently ligated to the RNA sequence then
purification of the ligated RNA--nucleic acid molecule can be
achieved. In some embodiments the nucleic acid sequence comprises
DNA, preferably double stranded DNA. The affinity tag is preferably
included in the double stranded DNA region of the DNA sequence so
that possible interference of hybridization to the RNA is
minimized. Because the RNA is ligated to the nucleic acid sequence
and hence indirectly to the affinity tag then much more stringent
purification conditions can be used compared with other methods
which rely on base pairing (hydrogen bonding) of the RNA. This is
schematically represented in the first part of FIG. 1. If the only
intended use is in purification the double strand DNA region need
not contain an RNA polymerase promoter region. The affinity tag can
include examples such as biotin, digoxigen, fluorescein, His Tags
and many other well known in the art.
e) Amplification
[0033] As shown in FIG. 1 the ligated DNA-RNA molecule can serve as
a template for RNA synthesis using the promoter sequence contained
in the ligated double stranded DNA molecule. Different RNA
polymerases may be used but T7 RNA polymerase is preferred.
Transcription of the ligated DNA-RNA molecules produces multiple
copies of RNA complimentary to the original starting mRNA sequence
i.e., it is an antisense strand cRNA. A tag region [shown as Tag
#1] can also have been introduced into the 5' region of the
cRNA.
f) Subsequent Hybridization and Ligation
[0034] As shown in FIG. 2 the 5' tagged cRNA [antisense strand]
produced by the reaction scheme of FIG. 1 can now be hybridized and
ligated to a further DNA sequence. This DNA sequence is of
generally the same DNA structure as shown in FIG. 1 but as shown in
FIG. 2 the single stranded region is not poly dT but is composed of
a random sequence of bases which acts to hybridize to 3' end of the
antisense strand. In addition the single stranded DNA region may
also have a specific known sequence so that a specific RNA is
amplified.
[0035] The double stranded region may contain a different Tag
region designated Tag 2 but the Tag may be the same as Tag 1 used
previously. It is of course possible to the use the method for
amplification without the use of any Tags. The promoter sequence
may be the same as the sequence used previously and is preferably
the same but however a different promoter sequence may be used.
After hybridization the mixture is ligated with T4 DNA ligase to
produce a ligated cRNA-DNA hybrid.
[0036] The ligated cRNA-DNA can then be used to transcribe multiple
copies of RNA using the appropriate RNA polymerase. T7 RNA
polymerase is suitable for this step but SP6 RNA polymerase, T3 RNA
polymerase and E. coli RNA polymerase may also be used. The RNA
produced in this reaction is in the same sense as the starting RNA
shown in figure but is present in multiple copies and can have two
different Tag regions present as shown in FIG. 2.
g) cDNA Synthesis
[0037] The RNA produced as described in FIG. 2 or for that matter
any of the figures, can be used to produce cDNA as shown in FIG. 3.
The RNA is hybridized with a single stranded DNA primer containing
the compliment to the Tag#1 sequence. The RNA-DNA hybrid is then
used to synthesize first strand cDNA using reverse transcriptase
and dNTPs. Once first strand cDNA synthesis is complete, RNAse is
used to remove the RNA of the heteroduplex. Second strand synthesis
is done using Tag#2 primer DNA polymerase and dNTPs which produces
full length cDNA which has the a Tag sequence at both ends. The
cDNA has multiple uses including protein expression, RNA splice
site analysis and gene discovery.
h) Removal of Nucleic Acid Sequences
[0038] For many applications it may be desirable to remove unused
nucleic acid sequences. For example, DNA sequences which did not
ligate to the RNA can be removed by treating the reaction products
at the appropriate stage with a suitable exonuclease such as lambda
exonuclease or T7 gene 6 exonuclease.
i) Nucleotide Considerations
[0039] For many of the applications described the standard
nucleotides eg rNTPs (UTP, ATP, GTP and CTP) or dNTPs (TTP, dATP,
dGTP and dCTP) may be used. However, it is possible for some
applications that it will be desirable to add nucleotide analogues
such as methylated nucleotides or nucleotides such as rNTP.alpha.S
or dNTP.alpha.S. A mixture of standard nucleotides and nucleotide
analogues may be appropriate.
j) Further Considerations
[0040] The skilled person will realize that further variations to
components and of the method are possible.
[0041] The DNA sequence comprising a double stranded and single
stranded regions may be further modified to contain nucleotide
analogues which are resistant to exonuclease degradation. In this
circumstance, it is preferred to have the modified nucleotide
analogues in the DNA strand which does not ligate to the target
RNA.
[0042] In some methods it is also possible to add additional
complementary top strand oligonucleotides either before or after
exonuclease digestion.
[0043] It is also possible to add additional oligonucleotides to
the transcription reactions. The additional oligonucleotides may be
polyA or polydA although other sequences are possible.
[0044] The ligated DNA-cRNA molecule produced by the methods
described may also be treated with reverse transcriptase prior to
transcription.
[0045] The RNA produced in any of the methods described (either
cRNA or amplified target RNA) can be used for a variety of purposes
including the use of immobilised nucleic acid, especially in
microarray format, for the purpose of RNA analysis.
[0046] The input RNA can be treated with an RNase in the presence
of an oligonucleotide such the RNA is nicked at a specific location
defined by the oligonucleotide. The oligonucleotide may contain
methylated nucleotides in addition to standard nucleotides. The
oligonucleotide may contain a randomized sequence of bases or a
specific defined sequence. This method is disclosed in example 11.
The method comprises hybridizing an oligodeoxyribonucleotide which
contains natural and modified nucleotides to an RNA sequence,
contacting the resulting RNA-DNA hybrid with an agent that
specifically nicks only the RNA strand and ligating a DNA sequence
to the trimmed RNA 3' tail. The oligodeoxynucleotide should ideally
be greater than eight nucleotides long and the nucleotides which
are modified can be modified by methylation of 2'-OH group. The
agent used to nick only the RNA strand is preferably RNAse H. The
nicked RNA produced by this embodiment can then be used in the
previous embodiments to produce amplified quantities of the RNA
which can be labeled by the methods outlined previously as
appropriate.
EXAMPLES
[0047] The present examples are provided for illustrative purposes
only, and should not be construed as limiting the scope of the
present invention as defined by the appended claims. All references
given below and elsewhere in the present specification are hereby
included herein by reference.
Materials
Water
[0048] All water used in these examples, including water used to
prepare electrophoresis buffer, had been treated with diethyl
pyrocarbonate (DEPC) and autoclaved to remove any contaminating RNA
nucleases. The water used in preparation of ligation or
transcription reactions was DEPC-treated and obtained from Ambion.
TABLE-US-00001 PT7IVS5 (Qiagen Operon) Oligo SEQ ID NO:1
5'-d[GTAATACGACTCACTATAGGGAG(T).sub.24]-3'.
[0049] The deoxyribooligonucleotide (oligo) is composed of three
parts. [0050] 1) The promoter sequence for T7 RNA polymerase is
indicated in bold (Lopez, et al. J. Mol. Biol. 269: 41-51(1997).
[0051] 2) A five base intervening sequence (IVS), or that sequence
complementary to the start site of transcription to where the
poly(dT) sequence starts, is indicated in italics.
[0052] 3) A 24 base poly(dT) sequence (T.sub.24), or the sequence
used to "capture" the mRNA 3' poly(rA) tail, is underlined.
TABLE-US-00002 cPT7IVS5 (Qiagen Operon) Oligo SEQ ID NO:2
5'-Phosphate-d[AAAACTCCCTATAGTGAGTCGTATTAC]-3'
[0053] The oligo is composed of four parts and is the template for
RNA synthesis. [0054] 1) The 5' phosphate group participates in
covalent bond formation with the 3' hydroxyl group of mRNA. [0055]
2) Four dA residues in a row in italics promote complementary
binding of the 3' poly(rA) tail of mRNA. [0056] 3) The first base
transcribed by the RNA polymerase is indicated by the underlined C.
Synthesis would proceed towards the 5' end of the cPT7IVS5 oligo
into the attached mRNA sequence.
[0057] 4) Sequence complementary to the promoter sequence is
indicated in bold. TABLE-US-00003 PT7IVS15 (Qiagen Operon) Oligo
SEQ ID NO:3
5'-d[AAATTAATACGACTCACTATAGGGAGACCACAACGG(T).sub.24]-3'
[0058] The oligo is composed of three parts. [0059] 1) The promoter
sequence for T7 RNA polymerase is indicated in bold. [0060] 2) A 15
base IVS, or that sequence complementary to the start site of
transcription to where the poly(dT) sequence starts, is
italicized.
[0061] 3) A 24 base poly(dT) sequence (T.sub.24), or the sequence
used to "capture" the mRNA 3' poly(rA) tail, is underlined.
TABLE-US-00004 cPT7IVS15 (Qiagen Operon) Oligo SEQ ID NO:4
5'-Phosphate-d[AAAACCGTTGTGGTCTCCCTATAGTGAGTCGTATT AATTT]-3'
[0062] The oligo is composed of four parts and is the template for
RNA synthesis. [0063] 1) The 5' phosphate group participates in
covalent bond formation with the 3' hydroxyl group of mRNA. [0064]
2) Four dA residues in a row in italics promote complementary
binding of the 3' poly(rA) tail of mRNA. [0065] 3) The first base
transcribed by the RNA polymerase is indicated by the underlined C.
Synthesis would proceed towards the 5' end of the cPT7IVS5 oligo
through the IVS into the attached mRNA sequence.
[0066] 4) Sequence complementary to the promoter sequence is
indicated in bold. TABLE-US-00005 RNA.sub.35 (Dharmacon) Oligo SEQ
ID NO:5 5'-r[UGUUG(U).sub.30[-3'
[0067] A synthetic RNA designed to test ligation and transcription
reactions. The 3'-hydroxyl of this molecule becomes joined to the
5'-phosphate group of the cPT7 oligos (IVS5 or IVS15) through the
actions of a ligase enzyme. TABLE-US-00006 RNA.sub.65 (Dharmacon)
Oligo SEQ ID NO:6 5'-r[UACAACGUCGUGACUGGGAAAAC(A).sub.42]-3'
[0068] A synthetic RNA designed to test ligation and transcription
reactions. The 3'-hydroxyl of this molecule becomes joined to the
5'-phosphate group of the cPT7 oligos (IVS5 or IVS15) through the
actions of a ligase enzyme. TABLE-US-00007 PT3w/T24 (Qiagen Operon)
Oligo SEQ ID NO:7
5'-d[AAATAATTAACCCTCACTAAAGGGAGACCACAACGG(T).sub.24]-3'
[0069] The oligo is composed of three parts. [0070] 1) The promoter
sequence for T3 RNA polymerase is indicated in bold (Ling M-L, et
al. Nucl. Acids Res 17: 1605-1618 (1989). [0071] 2) A 15 base IVS,
or that sequence complementary to the start site of transcription
to where the poly(dT) sequence starts, is italicized.
[0072] 3) A 24 base poly(dT) sequence (T.sub.24), or the sequence
used to "capture" the mRNA 3' poly(rA) tail, is underlined.
TABLE-US-00008 cPT3 (Qiagen Operon) Oligo SEQ ID NO:8
5'-Phosphate-d[AAAACCGTTGTGGTCTCCCTTTAGTGAGGGTTAAT TATTT]-3'
[0073] The oligo is composed of four parts and is the template for
RNA synthesis. [0074] 1) The 5' phosphate group participates in
covalent bond formation with the 3' hydroxyl group of mRNA. [0075]
2) Four dA residues in a row in italics promote complementary
binding of the 3' poly(rA) tail of mRNA. [0076] 3) The first base
transcribed by the RNA polymerase is indicated by the underlined C.
Synthesis would proceed towards the 5' end of the cPT7IVS5 oligo
through the IVS into the attached mRNA sequence.
[0077] 4) Sequence complementary to the promoter sequence is
indicated in bold. TABLE-US-00009 poly dA.sub.20 (Integrated DNA
Technologies, INC.; IDT) Oligo SEQ ID NO:9
5'-d[AAAAAAAAAAAAAAAAAAAA]-3'
[0078] TABLE-US-00010 Biotin-cPT7IVS15 (Qiagen Operon) Oligo SEQ ID
NO:10 5'-Phosphate-d[AAAACCGTTGTGGTCTCCCTATAGTGAGTCGTATT
AATTT]-Biotin-3'
[0079] The oligo is composed of five parts and is the template for
RNA synthesis. [0080] 1) The 5' phosphate group participates in
covalent bond formation with the 3' hydroxyl group of mRNA. [0081]
2) Four dA residues in a row in italics promote complementary
binding of the 3' poly(rA) tail of mRNA. [0082] 3) The first base
transcribed by the RNA polymerase is indicated by the underlined C.
Synthesis would proceed towards the 5' end of the Biotin-cPT7IVS15
oligo through the IVS into the attached mRNA sequence. [0083] 4)
Sequence complementary to the promoter sequence is indicated in
bold.
[0084] 5) A biotin group has been attached to the 5 position on the
base of the ultimate 3' `T` residue. TABLE-US-00011 OHThioPT7IVS25
(Qiagen Operon) Oligo SEQ ID NO: 11
5'-d[A*A*AAATTAATACGACTCACTATAGGGAGTAATAGGACTCACTA
TAGGG(T.sub.g)]-3'
[0085] The oligo is composed of four parts. [0086] 1) Two
overhanging `A` residues linked by phosphorothioate bonds (*).
[0087] 2) The promoter sequence for T7 RNA polymerase is indicated
in bold. [0088] 3) A 25 base IVS, or that sequence complementary to
the start site of transcription to where the poly(dT) sequence
starts, is italicized.
[0089] 4) A 24 base poly(dT) sequence (T.sub.24), or the sequence
used to "capture" the mRNA 3' poly(rA) tail, is underlined.
TABLE-US-00012 HT-III 10c Oligo SEQ ID NO: 12
5'-mUmUmUdTdTdTdTdTdVmN-3'
[0090] The oligo is composed of four parts. [0091] 1) Three
2'-O-methyl uridine monophosphate residues and five deoxythmidine
monophosphate residues target the oligo to the polyA tail of mRNA.
[0092] 2) dV and mN are degenerate bases, dV being only `A`, `C`,
or `G` and mN being all four bases with a 2'-O-methylation, that
anchor the oligo to the last two bases of the mRNA message just 5'
to the poly(A) tail. [0093] 3) The methylated residues prevent
RNase H from nicking the mRNA outside the dT region.
[0094] 4) Five dT residues allow RNase H to bind and target nicking
of the mRNA within this region. TABLE-US-00013 HT-III 10d Oligo SEQ
ID NO: 13 5'-mUmUmUdTdTdTdTdTdVdN-3'
[0095] The oligo is composed of four parts. [0096] 1) Three
2'-O-methyl uridine monophosphate residues and five deoxythmidine
monophosphate residues target the oligo to the polyA tail of mRNA.
[0097] 2) dV and N are degenerate bases, dV being only `A`, `C`, or
`G` and N being all four bases, that anchor the oligo to the last
two bases of the mRNA message just 5' to the polyA tail. [0098] 3)
The 2'-O-methyl residues prevent RNase H from nicking the mRNA
outside the dT region.
[0099] 4) Five dT residues allow RNase H to bind and target nicking
of the mRNA within this region. TABLE-US-00014 HT-III 10g Oligo SEQ
ID NO: 14 5'-mUmUmUmUdTdTdTdTdVmN-3'
[0100] The oligo is composed of four parts. [0101] 1) Four
2'-O-methyl uridine monophosphate residues and four deoxythmidine
monophosphate residues target the oligo to the polyA tail of mRNA.
[0102] 2) dV and mN are degenerate bases, dV being only `A`, `C`,
or `G` and mN being all four bases with a 2'-O-methylation, that
anchor the oligo to the last two bases of the mRNA message just 5'
to the polyA tail. [0103] 3) The 2'-O-methyl residues prevent RNase
H from nicking the mRNA outside the dT region.
[0104] 4) Four dT residues allow RNase H to bind and target nicking
of the mRNA within this region. TABLE-US-00015 HT-III B5 Oligo SEQ
ID NO: 15 5'-d[CGCAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTV
N]-3'
[0105] The oligo is composed of four parts. [0106] 1) The promoter
sequence for T7 RNA polymerase is indicated in bold. [0107] 2) A 15
base IVS, or that sequence complementary to the start site of
transcription to where the poly(dT) sequence starts, is italicized.
[0108] 3) A 3 base poly(dT) sequence, or part of the sequence used
to "capture" the mRNA 3' poly(rA) tail, is underlined.
[0109] 4) V and N are degenerate bases, V being only `A`, `C`, or
`G` and N being all four bases, that anchor the oligo to the last
two bases of the mRNA message just 5' to the polyA tail.
TABLE-US-00016 cpT7'-IR.sub.15-(NoA)5'P Oligo SEQ ID NO: 16
5'-Phosphate-d[CCGTTGTGGTCTCCCTATAGTGAGTCGTATTAATT TGCG]-3'
[0110] The oligo is composed of four parts and is the template for
RNA synthesis. [0111] 1) The 5' phosphate group participates in
covalent bond formation with the 3' hydroxyl group of mRNA. [0112]
2) The first base transcribed by the RNA polymerase is indicated by
the underlined C. Synthesis would proceed towards the 5' end of the
cPT7IVS5 oligo through the IVS into the attached mRNA sequence.
[0113] 3) Sequence complementary to the promoter sequence is
indicated in bold.
[0114] 4) A 15 base IVS is indicated by italics. TABLE-US-00017
HT-111 10f Oligo SEQ ID NO: 17 5'-mUmUmUmUmUdTdTdTdVmN
[0115] The oligo is composed of four parts. [0116] 1) Five
2'-O-methyl uridine monophosphate residues and four deoxythmidine
monophosphate residues target the oligo to the polyA tail of mRNA.
[0117] 2) dV and mN are degenerate bases, dV being only `A`, `C`,
or `G` and mN being all four bases with a 2'-O-methylation, that
anchor the oligo to the last two bases of the mRNA message just 5'
to the polyA tail. [0118] 3) The 2'-O-methyl residues prevent RNase
H from nicking the mRNA outside the dT region. [0119] 4) Three dT
residues allow RNase H to bind and target nicking of the mRNA
within this region. Ligase
[0120] Any enzyme capable of forming intra- or inter-molecular
covalent bonds between a 5'-phosphate group on a nucleic acid and a
3'-hydroxyl group on a nucleic acid. The examples include T4 DNA
Ligase, T4 RNA Ligase and E. coli DNA Ligase.
Example 1
Ligation of Double Stranded DNA to Synthetic RNA
[0121] All ligation reaction components except E. coli DNA Ligase
(New England Biolabs; 10 units/.mu.L) were mixed as indicated in
Table 1. The reactions were heated at 60.degree. C. for five
minutes and allowed to cool to room temperature. E. coli DNA Ligase
was added to the appropriate tubes and the reactions incubated at
30.degree. C. for two hours. Each reaction was stopped by the
addition of 1 .mu.L RNase-free 0.5 M EDTA (US Biochemicals, Inc.).
TABLE-US-00018 TABLE 1 Ligation reaction formulations for Example
1. ID Component 1 2 3 4 5 6 7 Water (Ambion) 16 .mu.l 15 .mu.l 16
.mu.l 15 .mu.l 14 .mu.l 13 .mu.l 15 .mu.l 10X E. coli Ligase Buffer
2 .mu.l 2 .mu.l 2 .mu.l 2 .mu.l 2 .mu.l 2 .mu.l 2 .mu.l SUPERase In
1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l (Ambion 20
Units/.mu.l) PT7IVS15 (15 pmol/.mu.l) 1 .mu.l 1 .mu.l 1 .mu.l
cPT7IVS15 (15 pmol/.mu.l) 1 .mu.l 1 .mu.l 1 .mu.l RNA.sub.35 (16
pmol/.mu.l) 3 .mu.l 3 .mu.l E. coli Ligase 1 .mu.l 1 .mu.l 1 .mu.l
Total Volume 20 .mu.l 20 .mu.l 20 .mu.l 20 .mu.l 20 .mu.l 20 .mu.l
20 .mu.l ID Component 8 9 10 11 12 Water 14 .mu.l 12 .mu.l 11 .mu.l
15 .mu.l 14 .mu.l 10X E. coli Ligase Buffer 2 .mu.l 2 .mu.l 2 .mu.l
SUPERase In 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l PT7IVS15 (15
pmol/.mu.l) 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l cPT7IVS15 (15
pmol/.mu.l) 1 .mu.l 1 .mu.l 1 .mu.l RNA.sub.35 (16 pmol/.mu.l) 3
.mu.l 3 .mu.l 3 .mu.l 3 .mu.l E. coli Ligase 1 .mu.l 1 .mu.l 1
.mu.l Total Volume 20 .mu.l 20 .mu.l 20 .mu.l 20 .mu.l 20 .mu.l
[0122] Five microliter samples of every reaction were mixed with 5
.mu.l of Gel Loading Buffer II (Ambion) and heat denatured at
95.degree. C. for two minutes. The entire amount of each sample was
loaded into separate wells of 15% acrylamide, 7M urea TBE gels
(Invitrogen) and subjected to electrophoresis at room temperature
following the manufacturer's recommendations. Samples were loaded
in numerical order from left to right, respectively, with DNA
molecular weight makers interspersed. Electrophoresis was stopped
when the bromophenol blue (BPB) loading dye was at the bottom of
the gel. Each gel was stained by soaking in a 1:200 dilution of
SYBR Gold Dye (Molecular Probes) in water for 10 minutes. After
staining the gels were rinsed with distilled water and the DNA
bands visualized by scanning in a Typhoon.TM. 8600 Variable Mode
Imager (Typhoon; GE Healthcare Bio-Sciences).
[0123] The gels were scanned using the green (532) laser and
fluorescein 526 SP emission filter.
[0124] The DNA molecular weight markers are a mixture of 100
Base-Pair Ladder (0.5 .mu.g), Homo-Oligomeric pd(A).sub.40-60
(1.25.times.10.sup.-3 A.sub.260 Units) and Oligo Sizing Markers
(8-32 bases; 0.75 .mu.l; all from GE Healthcare Bio-sciences). The
results show that the three separate nucleic acid components of the
ligation reaction do not form self-ligation products: The results
also show a band of the appropriate size (75 bases) in the complete
reaction to be the expected product of the cPT7IVS15 and RNA.sub.35
ligation (DNA:RNA hybrid).
Example 2
Three Different Ligases Will Ligate Double Stranded DNA to RNA
[0125] All ligation reaction components except the ligase enzymes
were mixed as indicated in Table 2. The reactions were heated at
60.degree. C. for five minutes and allowed to cool to room
temperature. Different ligase enzymes were added to the appropriate
tubes and the reactions incubated at 30.degree. C. for two hours.
Each reaction was stopped by the addition of 1 .mu.l RNase-free 0.5
M EDTA (US Biochemicals, Inc.). TABLE-US-00019 TABLE 2 Ligation
reaction formulations for Example 2. 10X ligation buffers were
supplied with the enzymes. ID Component 1 2 3 4 5 6 7 8 Water 10
.mu.l 9 .mu.l 12 .mu.l 11 .mu.l 12 .mu.l 11 .mu.l 13 .mu.l 12 .mu.l
10X E. coli Ligase Buffer 2 .mu.l 2 .mu.l 10X T4 DNA Ligase 2 .mu.l
2 .mu.l Buffer 10X T4 RNA Ligase 2 .mu.l 2 .mu.l 2 .mu.l 2 .mu.l
Buffer SUPERase In 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l
1 .mu.l 1 .mu.l (Ambion 20 Units/.mu.l) 5 mM NAD 2 .mu.l 2 .mu.l
PT7IVS15 (15 pmol/.mu.) 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l 1
.mu.l cPT7IVS15 (15 pmol/.mu.l) 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l 1
.mu.l 1 .mu.l 1 .mu.l 1 .mu.l RNA.sub.35 (16 pmol/.mu.l) 3 .mu.l 3
.mu.l 3 .mu.l 3 .mu.l 3 .mu.l 3 .mu.l 3 .mu.l 3 .mu.l E. coli
Ligase 1 .mu.l (NEBL 10 Units/.mu.l) T4 DNA Ligase 1 .mu.l (NEBL
400 Units/.mu.l) T4 RNA Ligase 1 .mu.l 1 .mu.l (NEBL 10
Units/.mu.l) Total Volume 20 .mu.l 20 .mu.l 20 .mu.l 20 .mu.l 20
.mu.l 20 .mu.l 20 .mu.l 20 .mu.l
[0126] Five microliter samples of every reaction were mixed with 5
.mu.l of Gel Loading Buffer II (Ambion) and heat denatured at
95.degree. C. for two minutes. The entire amount of each sample was
loaded into separate wells of a 15% acrylamide, 7M urea TBE gel
(Invitrogen) and subjected to electrophoresis at room temperature
following the manufacturer's recommendations. Samples were loaded
in numerical order from left to right, respectively, with DNA
molecular weight makers interspersed. Electrophoresis was stopped
when the BPB loading dye was at the bottom of the gel. The gel was
stained by soaking in a 1:200 dilution of SYBR Gold Dye (Molecular
Probes) in water for 10 minutes. After staining the gel was rinsed
in distilled water and the DNA bands visualized by scanning in a
Typhoon (GE Healthcare Bio-sciences). The gel was scanned using the
same parameters as in Example 1.
[0127] The results show ligation products were produced indicating
that all three ligases function to ligate a DNA 5'-phosphate group
to an RNA 3'-hydroxyl group. No ligation product was seen in
reaction lacking the PT7IVS15 oligo.
Example 3
Ligated RNA can be Transcribed
[0128] All ligation reaction components except E. coli DNA Ligase
were mixed as indicated in Table 3. The reactions were heated at
60.degree. C. for five minutes and allowed to cool to room
temperature. E. coli DNA Ligase was added to the appropriate tubes
and the reactions incubated at 16.degree. C. for two hours. Each
reaction was stopped by the addition of 1 .mu.l RNase-free 0.5 M
EDTA (US Biochemicals, Inc.). TABLE-US-00020 TABLE 3 Ligation
reaction formulations for Example 3. ID Component 1 2 3 4 Water 12
.mu.l 11 .mu.l 12 .mu.l 11 .mu.l 10X E. coli Ligase Buffer 2 .mu.l
2 .mu.l 2 .mu.l 2 .mu.l SUPERase In 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l
PT7IVS5 (15 pmol/.mu.l) 1 .mu.l 1 .mu.l cPT7IVS5 (5 pmol/.mu.l) 1
.mu.l 1 .mu.l PT7IVS15 (15 pmol/.mu.l) 1 .mu.l 1 .mu.l cPT7IVS15 (5
pmol/.mu.l) 1 .mu.l 1 .mu.l RNA.sub.35 (5 pmol/.mu.l) 3 .mu.l 3
.mu.l 3 .mu.l 3 .mu.l E. coli Ligase 1 .mu.l 1 .mu.l Total Volume
20 .mu.l 20 .mu.l 20 .mu.l 20 .mu.l
[0129] Five microliter samples of every reaction were mixed with 5
.mu.l of Gel Loading Buffer II (Ambion) and heat denatured at
95.degree. C. for two minutes. The entire amount of each sample was
loaded into separate wells of a 15% acrylamide, 7M urea TBE gel
(Invitrogen) and subjected to electrophoresis at room temperature
following the manufacturer's recommendations. Samples were loaded
in numerical order from left to right, respectively, with an RNA
molecular weight maker (Decade TM Markers from Ambion) in lane 1.
Electrophoresis was stopped when the BPB loading dye was at the
bottom of the gel. The gel was stained by soaking in a 1:200
dilution of SYBR Gold Dye (Molecular Probes) in water for 10
minutes. After staining the gel was rinsed in distilled water and
the DNA bands visualized by scanning in a Typhoon (GE Healthcare
Bio-Sciences).
[0130] The gel was scanned using the same parameters as in Example
1. Expected ligation products were seen from reactions 2 and 4,
respectively.
[0131] Amplification was accomplished using aliquots of reactions 2
and 4 and MEGAscript.TM. T7 Kit (Ambion) as outlined in Table 4.
All components were mixed together and incubated at 37.degree. C.
for one hour. TABLE-US-00021 TABLE 4 Amplification reactions for
Example 3. ID Component 1 2 3 4 Water 2.6 .mu.l 0.6 .mu.l 2.6 .mu.l
0.6 .mu.l 10X Reaction Buffer 2 .mu.l 2 .mu.l 2 .mu.l 2 .mu.l
SUPERase in 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l Example 3 Reaction 2 4
.mu.l 4 .mu.l Example 3 Reaction 4 4 .mu.l 4 .mu.l 20 mM MgCl.sub.2
4 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l 10 mM NTP Mix 6.4 .mu.l 6.4 .mu.l
6.4 .mu.l 6.4 .mu.l T7 Enzyme Mix 2 .mu.l 2 .mu.l Total Volume 20
.mu.l 20 .mu.l 20 .mu.l 20 .mu.l
[0132] Following incubation, reactions 2 and 4 were each split into
equal aliquots. One aliquot of each reaction had 0.5 .mu.l, 0.5 M
EDTA added and were stored on ice until gel analysis. The remaining
aliquots were heated at 70.degree. C. for 5 minutes to inactivate
the SUPERase In. Each heated aliquot had 1 .mu.l, of RNase A (44
Units; US Biochemical, Inc.) added and were incubated for 10
minutes at 37.degree. C. The RNase digests were each stopped by the
addition of 0.5 .mu.l 0.5 M EDTA. Five microliter samples of every
reaction were mixed with 5 .mu.l of Gel Loading Buffer II (Ambion)
and heat denatured at 95.degree. C. for two minutes. The entire
amount of each sample was loaded into separate wells of a 15%
acrylamide, 7M urea TBE gel (Invitrogen) and subjected to
electrophoresis at room temperature following the manufacturer's
recommendations. Electrophoresis was stopped when the BPB loading
dye was approximately 2 cm from the bottom of the gel. The gel was
stained by soaking in a 1:200 dilution of SYBR Gold Dye (Molecular
Probes) in water for 10 minutes. After staining the gel was rinsed
in distilled water and the DNA bands visualized by scanning in a
Typhoon (GE Healthcare Bio-Sciences). The gel was scanned using the
same parameters as in Example 1.
[0133] Transcription reaction products from reactions 2 and 5,
respectively were, in general, typical of a T7 RNA polymerase
(RNAP) reaction. A runoff transcript of the expected 9 nucleotides
(nt) was observed situated above the BPB dye. This short runoff
transcript results from unligated PT7IVS5 and cPT7IVS5 oligos
carried over from the ligation reaction. T7 RNAP is known to
perform a non-templated addition of one nucleotide in runoff
reactions (Arnaud-Barbe, et al. 1998) and this was be seen just
above the 9 nt product. Additionally, the RNAP, after binding to
the double stranded DNA promoter, is also known to go through
rounds of abortive transcription (Lopez, et al. 1997) until a long
enough nascent transcript has been synthesized for the polymerase
to clear the promoter. Abortive transcription products were
observed below the 9 nt product in some reactions. Surprisingly,
this reaction contains no runoff transcript in the expected size
range of 44 nt. Instead a smear of RNA was observed higher in the
gel that suggests a heterodisperse population of product sizes
(non-specific products). An RNA smear disappeared upon treatment
with RNase A but the DNA bands remained. This smearing is another
trait of T7 RNAP (Macdonald, et al., J. Mol. Biol. 232:1030-1047
(1993) and results from the enzyme slipping forward and backward
during polymerization along homopolymeric templates.
[0134] The same types of reaction products were observed in the
transcriptions containing PT7IVS15 and cPT7IVS15 oligos (lane 6).
An expected 19 nt runoff transcript from the carryover of unligated
oligos from the ligation reaction were observed (arrow) as well as
smaller abortive transcripts. However, the non-templated addition
of a nt was obscured by what appears to be a stuttering of the
polymerase as it enters the RNA portion of the DNA:RNA hybrid.
Again, no expected transcript size of 75 nt was observed, but
rather an RNA smear that disappeared with RNase A treatment. The
RNA smear was denser in some reactions suggesting that the longer
IVS allows the RNAP to enter the RNA portion of the DNA:RNA hybrid
more efficiently.
Example 4
Double Stranded DNA to mRNA
[0135] All components were mixed as indicated in Table 5 and
incubated at 30.degree. C. for 15 minutes. There was no annealing
step included in this example. Besides ligation of cPT7IVS15 to
RNA.sub.35, skeletal muscle polyA RNA (smRNA; Russian Cardiology
Research and Development Center) was also used as a ligation target
for this system. Each reaction was stopped by the addition of 1
.mu.l RNase-free 0.5 M EDTA (US Biochemicals, Inc.). TABLE-US-00022
TABLE 5 Ligation reaction formulations for Example 4. The 10X
Ligation Buffer and T4 DNA Ligase were certified RNase-free and
supplied by Takara. ID Component 1 2 3 4 5 Water 3.9 .mu.l 6.6
.mu.l 2.9 .mu.l 3.9 .mu.l 2.9 .mu.l 10X Ligation Buffer 2 .mu.l 2
.mu.l 2 .mu.l 2 .mu.l 2 .mu.l SUPERase In 1 .mu.l 1 .mu.l 1 .mu.l 1
.mu.l 1 .mu.l PT7IVS15 (15 pmol/.mu.l) 1 .mu.l 1 .mu.l 1 .mu.l 1
.mu.l cPT7IVS15 (5 pmol/.mu.l) 2.7 .mu.l 2.7 .mu.l 2.7 .mu.l 2.7
.mu.l smRNA (1 .mu.g/.mu.l) 1 .mu.l 1 .mu.L 1 .mu.l RNA.sub.35 (16
pmol/.mu.l) 1 .mu.l 1 .mu.l 50% PEG 8000 8.4 .mu.l 8.4 .mu.l 8.4
.mu.l 8.4 .mu.l 8.4 .mu.l T4 DNA Ligase 1 .mu.l 1 .mu.l 1 .mu.l
(350 Units/.mu.l) Total Volume 20 .mu.l 20 .mu.l 20 .mu.l 20 .mu.l
20 .mu.l
[0136] Five microliter samples of every reaction were mixed with 5
.mu.l of Gel Loading Buffer II (Ambion) and heat denatured at
95.degree. C. for two minutes. The entire amount of each sample was
loaded into separate wells of a 15% acrylamide, 7M, urea TBE gel
(Invitrogen) and subjected to electrophoresis at room temperature
following the manufacturer's recommendations. Electrophoresis was
stopped when the BPB loading dye was approximately 2 cm from the
bottom of the gel. The gel was stained by soaking in a 1:200
dilution of SYBR Gold Dye (Molecular Probes) in water for 10
minutes. After staining the gel was rinsed in distilled water and
the DNA bands visualized by scanning in a Typhoon (GE Healthcare
Bio-Sciences). The gel was scanned using the same parameters as in
Example 1.
[0137] The expected ligation product of the oligos with the
RNA.sub.35 was seen.
[0138] Amplification was carried out using aliquots of reactions 1
and 3 and MEGAscript.TM. T7 Kit (Ambion) as outlined in Table 6.
All components were mixed together and incubated at 37.degree. C.
for one hour. TABLE-US-00023 TABLE 6 Reactions for Example 3. NTP
Mix Component 75 mM ATP 2.8 .mu.l 75 mM CTP 2.8 .mu.l 75 mM GTP 2.8
.mu.l 75 mM UTP 2.8 .mu.l Total Volume 11.2 .mu.l Rxn Setup ID
Component 1 2 NTP Mix 11.2 .mu.l 11.2 .mu.l Water 15.8 .mu.l 15.8
.mu.l 10X Transcription Buffer 4 .mu.l 4 .mu.l SUPERase In 1 .mu.l
1 .mu.l Ligation #1 4 .mu.l Ligation #3 4 .mu.l T7 Enzyme Mix 4
.mu.l 4 .mu.l Total Volume 40 .mu.l 40 .mu.l
[0139] The reactions were each stopped by the addition of 1 .mu.l
0.5 M EDTA. Five microliter samples of every reaction were mixed
with 5 .mu.l of Gel Loading Buffer II (Ambion) and heat denatured
at 95.degree. C. for two minutes. The entire amount of each sample
was loaded into separate wells of a 15% acrylamide, 7M urea TBE gel
(Invitrogen) and subjected to electrophoresis at room temperature
following the manufacturer's recommendations. Electrophoresis was
stopped when the BPB loading dye was approximately 2 cm from the
bottom of the gel. The gel was stained by soaking in a 1:200
dilution of SYBR Gold Dye (Molecular Probes) in water for 10
minutes. After staining the gel was rinsed in distilled water and
the DNA bands visualized by scanning in a Typhoon (GE Healthcare
Bio-Sciences). The gel was scanned using the same parameters as in
Example 1.
[0140] The results show both run off and abortive transcripts as
well as a single base non-templated nucleotide addition, much as
was observed in Example 3. The RNA smear at the top of the gel in
some reactions, along with the relative decrease in intensity of
the runoff transcript when compared to lane 1, suggests the
capability of this system to both anneal to, ligate a double
stranded DNA RNAP promoter to and transcribe complementary RNA from
a DNA:mRNA hybrid.
Example 5
Fast Ligation Kinetics
[0141] Ligation reactions were prepared as outlined in Table 7. A
bulk mix was prepared containing all components of the reaction
except T4 DNA ligase and 19 .mu.l aliquoted into each of 7 tubes.
The zero time point had 1 .mu.l of water and 1 .mu.l 0.5 M EDTA
added and was stored on ice until gel analysis. All remaining
reactions had 1 .mu.l T4 DNA Ligase (350 Units; Takara) added and
were incubated at room temperature for between 30 seconds ('') and
8 minutes ('). At the indicated time interval 1 .mu.l of 0.5 M EDTA
was added to the appropriate tube and the reaction placed on ice
until gel analysis. TABLE-US-00024 TABLE 7 Formulation of the bulk
mix and reaction time intervals for Example 5. Component 1X 8X Time
Points Water 10.3 .mu.l 82.4 .mu.l 0 30'' 60'' 90'' 2' 4' 8' 10X
Ligation Buffer 2 .mu.l 16 .mu.l SUPERase In 1 .mu.l 8 .mu.l
PT7IVS15 (15 pmol/.mu.l) 1 .mu.l 8 .mu.l cPT7IVS15 (5 pmol/.mu.l)
2.7 .mu.l 21.6 .mu.l RNA.sub.35 (16 pmol/.mu.l) 1 .mu.l 8 .mu.l
smRNA (1 .mu.g/.mu.l) 1 .mu.l 8 .mu.l Total Volume 19 .mu.l 152
.mu.l
[0142] Five microliter samples of every reaction were mixed with 5
.mu.L of Gel Loading Buffer II (Ambion) and heat denatured at
95.degree. C. for two minutes. The entire amount of each sample was
loaded into separate wells of a 15% acrylamide, 7M urea TBE gel
(Invitrogen) and subjected to electrophoresis at room temperature
following the manufacturer's recommendations. Electrophoresis was
stopped when the BPB loading dye was at the bottom of the gel. The
gel was stained by soaking in a 1:200 dilution of SYBR Gold Dye
(Molecular Probes) in water for 10 minutes. After staining the gel
was rinsed in distilled water and the DNA bands visualized by
scanning in a Typhoon. The gel was scanned using the same
parameters as in Example 1.
[0143] The appearance of the cPT7IVS15 RNA.sub.35 ligation product
in as little as 30 seconds and the fact that this ligation product
did not appear to increase in intensity over time suggests very
rapid reaction kinetics.
Example 6
Amplification Yields Improve With the Addition of Either EDTA or
Citrate
[0144] Oligos used in the ligations for this example were first
mixed together as outlined in Table 8. Ligation reactions were then
prepared as outlined in Table 9. The ligations were mixed and
incubated at 30.degree. C. for 15 minutes. Ligation number 1 had 1
.mu.l of 0.5 M EDTA added, while ligations 2-4 each had 2 .mu.l 0.5
M EDTA added. Ligations 2-4 were pooled together and mixed well.
TABLE-US-00025 TABLE 8 Mixture of oligos for Example 6. Component
1X 10X PT7IVS15 (15 pmol/.mu.l) 1 .mu.l 10 .mu.l cPT7IVS15 (5
pmol/.mu.l) 2.7 .mu.l 27 .mu.l Total Volume 3.7 .mu.l 37 .mu.l
[0145] TABLE-US-00026 TABLE 9 Ligation reactions for Example 6. ID
Component 1 2 3 4 Water 14.6 .mu.l 28.6 .mu.l 28.6 .mu.l 28.6 .mu.l
10X Ligation Buffer 2 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l SUPERase In 1
.mu.l 2 .mu.l 2 .mu.l 2 .mu.l Oligo Mix (Table 8) 1.4 .mu.l 1.4
.mu.l 1.4 .mu.l 1.4 .mu.l smRNA (1 .mu.g/.mu.l) 1 .mu.l 2 .mu.l 2
.mu.l 2 .mu.l T4 DNA Ligase 2 .mu.l 2 .mu.l 2 .mu.l (350
units/.mu.l) Total Volume 20 .mu.l 40 .mu.l 40 .mu.l 40 .mu.l
[0146] Amplification was accomplished using aliquots of the
ligation reactions and MEGAscript.TM. T7 Kit (Ambion) as outlined
in Table 10. All components were mixed together and incubated at
37.degree. C. for one hour. Each reaction was stopped by the
addition of 2 .mu.l 0.5 M EDTA. TABLE-US-00027 TABLE 10 Reactions
for Example 6. ID Component 1 2 3 4 5 6 7 8 9 Water 15.8 .mu.l 15.8
.mu.l 14.8 .mu.l 14.8 .mu.l 13.8 .mu.l 14.8 .mu.l 13.8 .mu.l 11.8
.mu.l 7.8 .mu.l NTP Mix (as 11.2 .mu.l 11.2 .mu.l 11.2 .mu.l 11.2
.mu.l 11.2 .mu.l 11.2 .mu.l 11.2 .mu.l 11.2 .mu.l 11.2 .mu.l
Example 4) 304 mM 1 .mu.l 1 .mu.l Citrate 324 mM DTT 1 .mu.l 1
.mu.l 20 mM EDTA 1 .mu.l 2 .mu.l 4 .mu.l 8 .mu.l 10X 4 .mu.l 4
.mu.l 4 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l
Transcription Buffer SUPERase In 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l 1
.mu.l 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l Ligation #1 4 .mu.l Ligation
2 + 3 + 4 4 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l 4
.mu.l T7 Enzyme 4 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l 4
.mu.l 4 .mu.l 4 .mu.l Mix Total Volume 40 .mu.l 40 .mu.l 40 .mu.l
40 .mu.l 40 .mu.l 40 .mu.l 40 .mu.l 40 .mu.l 40 .mu.l
[0147] Gel analysis was as outlined for Example 5 using a 6% 7M
urea TBE gel (Invitrogen). The BPB dye was run to the bottom of the
gel. FIG. 8 is the fluorescent of the gel that was boxed off for
volume density analysis using ImageQuant.TM. Version 5.2 software
(GE Healthcare Bio-Sciences). The gel was scanned using the same
parameters as in Example 1. The results are shown in FIG. 4.
[0148] Surprisingly, both citrate and EDTA were observed to
stimulate yields from amplification reactions, as evidenced by an
increase in volume density, using RNA as the template. Results
suggest that other compounds observed to stimulate amplification
reaction yields on DNA templates would also function with RNA
templates. These compounds would include polyamine (US
2003/0073202) and nitrirotriacetic acid, uramil diacetic acid,
trans-1,2-cyclohexanediaminetetraacetic acid,
diethylenetriamine-pentaacetic acid, ethylene glycol
bis(2-aminoethyl)ether diaminetetraacetic acid,
triethylenetetraminehexaacetic acid and their salts (U.S. Pat. No.
6,261,773). Additionally, other compounds with the ability to
chelate metal ions, e.g., isocitrate,
trans-1,2-diaminocyclohexanetetraacetic acid, and
(ethylene-dioxy)diethylenedinitrilotetraacetic acid, would also be
expected to stimulate yields from amplification reactions when used
at the proper concentration.
Example 7
Replication Kinetics in the Presence of EDTA
[0149] A kinetic study of amplification reactions in the presence
or absence of EDTA was completed. Additionally, all the reactions
contained biotin-11-UTP (Perkin Elmer Life Sciences). Ligations and
replication reactions were prepared as outlined in Table 11 A-C.
The ligations were mixed and incubated at 30.degree. C. for 15
minutes and then 60.degree. C. for 10 minutes to heat-kill the
ligase. Bulk replication reactions were prepared with or without
EDTA. Aliquots of 20 .mu.L of each bulk mix were distributed to
tubes for incubation. Zero time points immediately had 1 .mu.l each
of 0.5 M EDTA added and were stored at -80.degree. C. The remaining
tubes were incubated for the following time intervals at 37.degree.
C.: 1, 2, 4, 8, or 16 hours. Each reaction was stopped by the
addition of 1 .mu.l of 0.5 M EDTA and stored at -80.degree. C.
until gel analysis (data not shown) and purification. Each reaction
was purified by using Microcon.TM. YM-30 filter units (Millipore)
according to the manufacturer's instructions. Following
purification aliquots of each reaction had the absorbance
determined at 260 nm. RNA yields were determined by multiplying the
absorbance reading times the dilution times 40 .mu.g/ml
TABLE-US-00028 TABLE 11 Ligation and Replicationreactions for
Example 7. A. Oligo Mixture for Example 7. Component 1X 10X
PT7IVS15 (15 pmol/.mu.l) 1 .mu.l 10 .mu.l cPT7IVS15 (5 pmol/.mu.l)
2.7 .mu.l 27 .mu.l Total Volume 3.7 .mu.l 37 .mu.l B. Ligation
Reactions for Example 7. ID Component L1 Water 44 .mu.l 10X
Ligation Buffer 6 .mu.l SUPERase In 2 .mu.l Oligo Mix 2 .mu.l smRNA
(1 .mu.g/.mu.l) 3 .mu.l T4 DNA Ligase (350 units/.mu.l) 3 .mu.l
Total Volume 60 .mu.l C. Reaction preparation for Example 7. NTP
Master Mix Component Volume 75 mM ATP 36 .mu.l 75 mM CTP 36 .mu.l
75 mM GTP 36 .mu.l 75 mM UTP 28.8 .mu.l Biotin-11-UTP 54 .mu.l
Total Volume 190.8 .mu.l Reaction Master Mixes ID Component A B
Water 14 .mu.l 7 .mu.l 80 mM EDTA none 7 .mu.l NTP Mix 74.2 .mu.l
74.2 .mu.l 10X Transcription Buffer 14 .mu.l 14 .mu.l SUPERase In 7
.mu.l 7 .mu.l Ligation L1 16.8 .mu.l 16.8 .mu.l T7 RNAP Mix 14
.mu.l 14 .mu.l Total Volume 140 .mu.l 140 .mu.l
[0150] The results showed an increase in RNA yield over several
hours and also that RNA yield was increased at the 8 and 16 hour
time points in the presence of EDTA.
Example 8
HPLC Analysis of Replication Products
[0151] Products from Ligation-Based RNA Amplification reactions
were analyzed by simultaneous digestion with two different RNA
exonucleases and analyzed by HPLC. Digestions of 10 .mu.g amplified
RNA (cRNA) with both 2 .mu.g snake venom phosphodiesterase and 0.6
Units bacterial alkaline phosphatase (both from GE Healthcare
Bio-sciences) were performed in 50 mM HEPES buffer, pH 8, and 15 mM
MgCl.sub.2 for 6 hours at 37.degree. C. Additionally, 4 mM
solutions of each nucleoside triphosphate were also digested as a
reference. After digestion, the 60 .mu.l reaction volumes were
brought to 120 .mu.l with water and purified using 0.2 .mu.m nylon
Acrodisc.TM. syringe filters (Pall Life Sciences) to remove
protein. Each digestion had between 20-40 .mu.l injected into an
HPLC connected to an XTerra.RTM. MS C18 5 .mu.m 4.6.times.100 mm
column (Waters) with the buffer gradient profile in Table 12.
Buffer A was 0.1% triethyl ammonium acetate (Applied Biosystems,
Inc.) and Buffer B was acetonitrile (VWR Scientific).
TABLE-US-00029 TABLE 12 Gradient Table for Nucleoside Analysis by
HPLC in Example 8. Time Flow (min) (ml/mm) % A % B 1 0 0.70 100.0
0.0 2 10.00 0.70 95.0 5.0 3 11.00 0.70 90.0 10.0 4 13.00 0.70 70.0
30.0 5 14.00 0.70 0.0 100.0 6 17.00 0.70 0.0 100.0 7 18.00 0.70 100
0.0 8 27.00 0.70 100 0.0
[0152] Using this solvent system, the order of nucleoside elution,
earliest to latest, was `C`, `U`, `G`, and `A`. Original digestion
data indicated that a non-specific product was synthesized when
ligations and amplification reactions were performed as outlined in
Example 6 Reaction 2 with incubation at 37.degree. C. for 14 hours.
This non-specific product was higher in `A` and `U` nucleosides as
compared to control reactions performed using a DNA template.
[0153] The results showed HPLC traces between 2 minutes and 12
minutes of digested RNA for Example 8. A. Nucleosides only (used as
a reference for elution time). B. Control reaction using a DNA
template. C. Ligation-Based RNA Amplification material
demonstrating a high `A` and high `U` non-specific product.
[0154] It was also observed that addition of either biotin-11-UTP
or Cy5-UTP to Ligation-Based RNA Amplification reactions decreased
the high `U` peak of the non-specific product.
[0155] Decrease in the high `U` peak in RNA exonuclease digested
Ligation-Based RNA Amplification reactions when biotin-11-UTP was
included. A 25% biotin-11-UTP data were generated using T3 RNA
polymerase and oligos PT3w/T24 and cPT3. B 50% Cy5-UTP data were
generated using T7 RNA polymerase.
[0156] Various NTP analogs were tested in Ligation-Based RNA
Amplification reactions in an attempt to decrease the high `A` peak
observed in the RNA exonuclease digests. The analogs were
substituted at concentrations between 100% and 20% with a
concomitant decrease in the non-analog nucleoside. For example, if
the nucleotide analog was substituted at a 25% concentration, then
the corresponding nucleotide had its concentration dropped to 75%.
Of the various analogs and concentrations tested (Table 13) only
2'-Amino-2'-deoxyadenosine-5'-Triphosphate and
2-Aminoadenosine-5'-Triphosphate (diaminopurine; DAP) were observed
to decrease the high `A` peak of the non-specific product.
TABLE-US-00030 TABLE 13 NTP analogs and concentrations tested for
Example 8. % Substitution of Corresponding NTP Analog NTP
5-Bromouridine-5'-Triphosphate 25 (SIGMA)
5-Iodouridine-5'-Triphosphate (SIGMA) 50, 25
5-Bromocytidine-5'-Triphosphate 100, 75, 50, 25
5-Iodocytidine-5'-Triphosphate 50, 25
N.sup.6-Methyladenosine-5'-Triphosphate 75, 50, 25
2-Thiocytidine-5'-Triphosphate 100, 75, 50, 25
2'-Amino-2'-deoxyadenosine-5'- 100, 75, 50, 25 Triphosphate
2'-Amino-2'-deoxycytidine-5'- 75, 50, 25 Triphosphate
2'-Azido-2'-deoxycytidine-5'- 75, 50, 25 Triphosphate
5-Methyluridine-5'-Triphosphate 100, 75, 50, 25
2'-Amino-2'-deoxyuridine-5'- 25 Triphosphate
2'-O-methyluridine-5'-Triphosphate 75, 50, 25
2'-O-methylpseudouridine-5'- 75, 50, 25 Triphosphate
Inosine-5'-Triphosphate 45, 22.5 2-Aminoadenosine-5'-Triphosphate
75, 50, 25 5-Aminoallyluridine-5'-Triphosphate 50, 25
2'-O-Methyl-5-methyluridine-5'- 75, 50, 25 Triphosphate
[0157] It was observed that a decrease in the high `A` peak upon
digestion with snake venom phosphodiesterase and bacterial alkaline
phosphatase of Ligation-Based RNA Amplification reactions
containing substitutions of either A 75%
2'-Amino-2'-deoxyadenosine-5'-Triphosphate (and 25% ATP) or B 50%
diaminopurine (and 50% ATP). C shows the migration of DAP alone in
this HPLC solvent system.
[0158] Whilst not being bound by theory it is possible that in the
synthesis of poly `A` poly `U` non-specific products in the
Ligation-Based RNA Amplification reaction products contained two
parts: 1) the RNA polymerase slipped when transcribing the mRNA
poly `A` tail generating a poly `U` RNA product, and 2) the poly
`U` RNA formed a duplex or triplex with the poly `A` mRNA tail
allowing the RNA polymerase to switch strands, transcribing the
poly `U` template and generating poly `A` RNA. We predicted that by
eliminating the poly `U` from the strand switching reaction by
adding a poly dA molecule to hybridize to it, the non-specific `A`
peak would disappear.
[0159] It was observed that was a decrease in non-specific `A` peak
with the addition of 6 .mu.g poly dA.sub.20 to the reaction as
demonstrated by RNA exonuclease digestion and HPLC analysis of the
resulting cRNA. Peak areas were normalized to `C` before graphing.
Control: reaction without biotin-UTP or dA.sub.20. +B-UTP: reaction
containing 25% biotin-UTP. +B-UTP+dA.sub.20: reaction containing
both 25% biotin-UTP and 6 .mu.g poly dA.sub.20.
[0160] Additionally, that adding a low concentration of a
denaturant to the reaction also appeared to prevent the poly `U`
product from annealing to the template RNA with a resulting
decrease in synthesis of poly `A.` Results were obtained using RNA
exonuclease digestion and resulting HPLC analysis when 0.0005% SDS
was included in Ligation-Based RNA Amplification reactions.
[0161] The results showed a decrease in non-specific `A` peak with
the addition of 0.0005% SDS to the reaction as demonstrated by cRNA
digestion with RNA exonuclease and HPLC analysis.
Example 9
Microarray Analysis of Transcribed Material
[0162] Ligations were prepared as outlined in Table 14, `A` and
`B`, using rat total RNA from both kidney and liver (Russian
Cardiology Research and Development Center). Components were mixed
and incubated at room temperature for 2 minutes. Ligations L1 and
L2 each had 1 .mu.l Lambda Exonuclease (20 units/.mu.l; diluted
from 50 units/.mu.l in 1.times. ligation buffer; NEBL) while
ligations L3 and L4 each had 3 .mu.l of Lambda Exonuclease added
(T7 gene 6 protein also could be added here; data not shown). All
ligations were then placed at 37.degree. C. and incubated for 30
minutes. Ligations L1 and L2 each had 1.6 .mu.L of 0.5 M EDTA
(Ambion) added, while ligations L3 and L4 each had 4.8 .mu.l of 0.5
M EDTA added. The ligations were then incubated for 15 minutes at
65.degree. C. to heat-kill all the enzymes in the mixtures.
Following these manipulations the total volumes were now 16.5 .mu.l
each for L1 and L2 or 49.5 .mu.l each for L3 and L4 with an EDTA
concentration in each equal to approximately 48.48 mM.
TABLE-US-00031 TABLE 14 Ligations for Example 9. A. Oligo Mix
Component Amt OHThioPT7IVS25 (15 pmol/.mu.l) 10 .mu.l cPT7-PIVS25
(15 pmol/.mu.l) 10 .mu.l Water 17.5 .mu.l Total Volume 37.5 .mu.l
B. Reactions ID Component L1 (X1) L2 (X1) L3 (X3) L4 (X3) Water 7.7
.mu.l 7.7 .mu.l 18.3 .mu.l 18.3 .mu.l 10X Ligation Buffer 1.6 .mu.l
1.6 .mu.l 4.8 .mu.l 4.8 .mu.l RNasin 1.6 .mu.l 1.6 .mu.l 4.8 .mu.l
4.8 .mu.l Oligo Mix 1 .mu.l 1 .mu.l 3 .mu.l 3 .mu.l Rat Kidney
Total RNA 1 .mu.l 3 .mu.l (1 .mu.g/.mu.l) Rat Liver Total RNA 1
.mu.l 3 .mu.l (1 .mu.g/.mu.l) Bacterial Control mRNA 1 .mu.l 1
.mu.l 3 .mu.l 3 .mu.l T4 DNA Ligase (Takara 4.8 .mu.l 4.8 .mu.l
#K2071BC) Total Volume 13.9 .mu.l 13.9 .mu.l 41.7 .mu.l 41.7
.mu.l
[0163] Reactions were prepared as outlined in Table 15 using the
ligated material prepared in Table 14. Reagents used in the
reactions were from CodeLink.TM..TM. Expression Assay Reagent Kit,
Manual Prep (GE Healthcare), except the 10.times. Buffer. The
10.times. buffer used in this example was composed of 400 mM
Tris-HCl, pH 8.0 (Ambion), 300 mM MgCl.sub.2 (Ambion), 100 mM
dithiothreitol (US Biochemical), and 20 mM spermidine (SIGMA). An
8.times. master mix of NTPs, biotin-11-UTP, 10.times. Buffer,
dA.sub.20 and T7 RNA polymerase was prepared based upon the
1.times. formulation in Table 15 A. Master Mix. This master mix was
then aliquoted as outlined in Table 15 B. Reactions. Each reaction
was incubated at 37.degree. C. for 14 hours. TABLE-US-00032 TABLE
15 Reactions prepared using the ligated material from Table 14. A.
Master Mix Component X1 X8 Water 0.5 .mu.l 4 .mu.l 75 mM ATP 4
.mu.l 32 .mu.l 75 mM CTP 4 .mu.l 32 .mu.l 75 mM GTP 4 .mu.l 32
.mu.l 75 mM UTP 3 .mu.l 24 .mu.l 10 mM Biotin-11-UTP (PE Life 7.5
.mu.l 60 .mu.l Sciences) 10X Buffer 5 .mu.l 40 .mu.l dA.sub.20
(IDT; 6 .mu.g/.mu.l) 0.5 .mu.l 4 .sup. T7 RNAP Mix 4 .mu.l 32 .mu.l
Total Volume 32.5 .mu.l 260 .mu.l B. Reactions ID Component T1 T2
T3 T4 T5 T6 Water 1 .mu.l 1 .mu.l 1 .mu.l 1 .mu.l 8X Master Mix
32.5 .mu.l 32.5 .mu.l 32.5 .mu.l 32.5 .mu.l 32.5 .mu.l 32.5 .mu.l
Ligation L1 16.5 .mu.l Ligation L2 16.5 .mu.l Ligation L3 16.5
.mu.l 16.5 .mu.l Ligation L4 16.5 .mu.l 16.5 .mu.l 0.025% SDS 1
.mu.l 1 .mu.l Total Volume 50 .mu.l 50 .mu.l 50 .mu.l 50 .mu.l 50
.mu.l 50 .mu.l
[0164] When the incubations were complete, each reaction was
purified using an RNeasy Column (Qiagen) according to the
manufacturer's instructions. An aliquot of each reaction was
diluted either 1:7.5 (L1 and L2) or 1:30 (L3-L6) in water and the
absorbance determined at 260 nm. FIG. 16 demonstrates the cRNA
yields from each reaction assuming that 1 A260 unit of RNA contains
40 .mu.g/mL of material.
[0165] The results showed the yields of cRNA obtained from
reactions in Example 9.
[0166] Four micrograms from reactions L3-L6 or as much volume as
possible from L1 and L2 were prepared for hybridization and
hybridized to CodeLink.TM. ADME Rat Bioarray's (GE Healthcare)
according to the manufacturer's instructions found in "CodeLink.TM.
Gene Expression System: 16--Assay Bioarray Hybridization and
Detection" rev. AA/2004-07 (GE Healthcare). Hybridizations were
incubated at 37.degree. C. for just over 19 hours with shaking at
250 rpm. When the hybridizations were complete, each chamber was
washed three times with 250 .mu.l of 46.degree. C. 0.75.times. TNT
buffer (1.times. TNT Buffer is 0.1 M Tris-HCl, pH 7.6, 0.15 M NaCl
and 0.05% Tween 20). Following the washes, 250 .mu.l on 46.degree.
C. 0.75.times. TNT Buffer was added to each chamber, the slides
sealed and incubated at 46.degree. C. for no longer than 10
minutes. The 0.75.times. TNT Buffer was removed and each chamber
washed once with 250 .mu.l of Cy5-Streptavadin conjugate (GE
Healthcare) in TNB Buffer prepared as outlined in Table 16. TNB
Buffer is 0.1 M Tris-HCl, pH 7.6, 0.15 M NaCl and 0.5% NEN Blocking
Reagent (PerkinElmer). Following the wash, 250 .mu.l of
Cy5-Streptavadin conjugate (GE Healthcare) in TNB Buffer was added
to each chamber, the slides were sealed and incubated at ambient
temperature in the dark for 30 minutes. TABLE-US-00033 TABLE 16
Preparation of the Cy5-Streptavadin Conjugate in TNB Buffer for one
CodeLink .TM. ADME rat Bioarray (16 wells). Component Amt TNB
Buffer 8.8 ml Cy5-Streptavadin 17.6 .mu.l Conjugate
[0167] Following conjugation of the Cy5-Streptavadin, each chamber
was washed three times with 250 .mu.L each of ambient temperature
0.75.times. TNT Buffer. Following the last wash, each chamber had
250 .mu.l of ambient temperature 0.75.times. TNT Buffer added, the
slides were sealed and incubated for 20 minutes at ambient
temperature in the dark. The final wash was 250 .mu.l of
0.1.times.SSC Buffer (Ambion) containing 0.05% Tween 20. This wash
was added to each chamber and immediately removed. The slides were
dried and scanned using an Axon Instruments GenePix.RTM. 4000B
array scanner as outlined in "CodeLink.TM. Gene Expression System:
16--Assay Bioarray Hybridization and Detection" rev. AA/2004-07 (GE
Healthcare). FIG. 17 shows the hybridization results for Example
9.
[0168] FIG. 5 shows, Top Row, left to right, Kidney Total RNA
without ligase added to the ligation (T1), Liver Total RNA without
ligase added to the ligation (T2). Middle Row, left to right,
Kidney Total RNA plus ligase without SDS added to the reaction
(T3), Kidney Total RNA plus ligase with SDS added to the reaction
(T4). Bottom Row, left to right, Liver Total RNA plus ligase
without SDS added to the reaction (T5), Liver Total RNA plus ligase
with SDS added to the reaction (T5). Note: not all bioarray data
are shown in this figure.
[0169] Signal intensities were determined on the ADME Rat Bioarrays
using CodeLink.TM. Gene Expression Analysis software (GE
Healthcare) according to the manufacturer's instructions.
Expression levels were compared using average normalized signal
intensities between arrays and the ratios derived thereof. The
ratios were also used to determine differential expression levels
between kidney and liver total RNA samples. Charts of these
comparisons are found in FIG. 6.
Example 10
Purification of mRNA Using Streptavidin Beads
[0170] Ligations were prepared as outlined in Table 17, mixed and
incubated at ambient temperature for two minutes. Four microliters
of Lambda Exonuclease were added to each tube and the reactions
incubated at 37.degree. C. for 15 minutes. Each tube had 6.4 .mu.l
of 0.5 M EDTA added and the reactions were incubated at 65.degree.
C. for 15 minutes. For each ligation to be purified, 100 .mu.l of
MPG Streptavidin magnetic particles (PureBiotech LLC) were washed
once according to the manufacturer's instructions with 100 .mu.l
each 2 M KCl and then resuspended in 100 .mu.l each of 2 M KCl and
82.5 .mu.l each water. Each 182.5 .mu.l preparation of washed
magnetic beads had 17.5 .mu.l of the appropriate ligation added and
were incubated at ambient temperature for 15 minutes with
occasional gentle mixing. The beads were separated from the liquid
phase with a magnetic and washed twice with 200 .mu.l each of 70%
ethanol. Each bead pellet was resuspended in 50 .mu.l of water and
heated at 65.degree. C. for 3 minutes. The beads were again
separated from the liquid phase with a magnetic and the liquid
phase saved for subsequent analysis. TABLE-US-00034 TABLE 17
Ligations for Example 10. ID Component A B C D E F Water 40.4 .mu.l
34.8 .mu.l 18.8 .mu.l 42.8 .mu.l 41.2 .mu.l 38.8 .mu.l 10X Ligation
6.4 .mu.l 6.4 .mu.l 6.4 .mu.l 6.4 .mu.l 6.4 .mu.l 6.4 .mu.l Buffer
RNasin 6.4 .mu.l 6.4 .mu.l 6.4 .mu.l 6.4 .mu.l 6.4 .mu.l 6.4 .mu.l
PT7w/T9 1.2 .mu.l 4 .mu.l 12 .mu.l 4 .mu.l 4 .mu.l (15
pmol/.lamda.) Biotin-cPT7-P 1.2 .mu.l 4 .mu.l 12 .mu.l 4 .mu.l 4
.mu.l (15 pmol/.mu.l) smRNA 4 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l 4 .mu.l
(1 .mu.g/.mu.l, P921-128) T4 DNA 6.4 .mu.l 6.4 .mu.l 6.4 .mu.l 6.4
.mu.l 6.4 .mu.l Ligase Total Volume 66 .mu.l 66 .mu.l 66 .mu.l 66
.mu.l 66 .mu.l 66 .mu.l
[0171] Nucleic acid concentrations (both DNA and RNA) were
determined in the before and after purification samples using
RiboGreen.RTM. RNA Quantitation Kit (Molecular Probes). RiboGreen
was diluted 1:200 in TE Buffer (Molecular Probes). The kit
Ribosomal RNA (rRNA) Standard was diluted 1:50 in TE Buffer and a
standard curve prepared as outlined in Table 18. Each before and
after sample was diluted by mixing 17.5 .mu.L with 82.5 .mu.L TE
Buffer. Ten microliters from each diluted sample were then each
mixed with 90 .mu.L TE Buffer and 100 .mu.L RiboGreen. Absorbance
of the diluted samples in RiboGreen and the standard curve were
determined in a FARCyte.TM. Fluorescent Plate Reader (GE
Healthcare) using the manufacturer's default settings for
fluorescein dye. TABLE-US-00035 TABLE 18 Preparation of the
Standard Curve for Example 10. 2 .mu.g/ml Volume Volume rRNA 1:200
Amt RNA TE Standard RiboGreen Added 100 .mu.l None 100 .mu.l Blank
90 .mu.l 10 .mu.l 100 .mu.l 20 ng 50 .mu.l 50 .mu.l 100 .mu.l 100
ng None 100 .mu.l 100 .mu.l 200 ng
Example 11
RNase H Trimming of poly(A) Tail
[0172] The workflow for this experiment was: 1) targeted trimming
of the poly(A) tail of mRNA using RNase H (New England Biolabs; 10
Units/.mu.l), 2) Ligation-Based Amplification of the trimmed
poly(A) mRNA, and 3) selection of certain reactions for RNA
exonuclease digestion and HPLC analysis. Trimming of the poly(A)
tail of mRNA consisted of mixing either mRNA or total RNA (Russian
Cardiology Research and Development Center) in separate reactions
with oligos HT-III 10c, HT-III 10d, HT-III 10f or HT-III 10g in the
presence of RNase H. A representative formula for the RNase H
digestion is found in Table 19. RNase H was diluted in 1.times.
Ligation Buffer to 2.5 Units/.mu.l and digests were carried out at
37.degree. C. for 30 minutes. TABLE-US-00036 TABLE 19 A
representative formulation for the trimming of the poly(A) tail
from mRNA or mixed populations of RNA. Component Volume Volume
Water 4.5 .mu.l 4 .mu.l 10X Ligation Buffer 1 .mu.l 1 .mu.l 0.1%
NP-40 (SIGMA) 1 .mu.l 1 .mu.l mRNA (1 .mu.g/.mu.l) 0.5 .mu.l Total
RNA (1 .mu.g/.mu.l) 1 .mu.l 10 .mu.M Appropriate Oligo 2 .mu.l 2
.mu.l RNase H 1 .mu.l 1 .mu.l Total Volume 10 .mu.l 10 .mu.l
[0173] Five microliters from each RNase H digestion were carried
into separate, identically labeled, Ligation-Based RNA
Amplification Reactions using the generalized reaction conditions
in Table 20. Ligations were incubated at ambient temperature for 15
minutes and then each had 1 .mu.l (5 Units) Lambda exonuclease
added. After a 30 minute incubation at 37.degree. C., each ligation
had 1 .mu.l of 129 mM EDTA added and was further incubated at
65.degree. C. for 15 minutes. Reactions were prepared as generally
outlined in Table 20 and incubated at 37.degree. C. for 16 hours
when 2 .mu.l from each were analyzed by gel electrophoresis as in
Example 5. TABLE-US-00037 TABLE 20 Generalized ligation and
amplification reactions for Example 11. A. Ligation Reactions B.
Amplification Reactions ID ID Component 1X Component 1X Water 1
.mu.l Water 1.25 .mu.l 10X Ligation Buffer 0.5 .mu.l 75 mm ATP 1
.mu.l RNasin 1 .mu.l 75 mm CTP 1 .mu.l HT-III B5 (10 pmol/.mu.l) 1
.mu.l 75 mm GTP 1 .mu.l cpT7'-IR15-(no A)5'-P (10 pmol/ 1 .mu.l 75
mm UTP 1 .mu.l .mu.l) RNase H Digestion Reaction 5 .mu.l 10X Buffer
1 .mu.l T4 DNA Ligase (350 Units/.mu.l) 0.5 .mu.l Ligation 2.75
.mu.l Total Volume 10 .mu.l T7 RNAP Mix 1 .mu.l Total Volume 10
.mu.l
[0174] Gel results indicated an increase in high molecular weight
transcription products with RNase H added to the poly(A) trimming
reactions from Table 19. These results showed all oligos capable of
trimming the poly(A) tails from mRNA in both purified and mixed RNA
populations. Additionally, the capture oligos HT-III B5 and
cpT7'-IR15-(NoA)5'P were able to hybridize, ligate and transcribe
this modified mRNA.
[0175] Purified products from representativ reactions were digested
with RNA exonucleases and analyzed by HPLC as outlined in Example
8. Included in these digests was a purified product from a reaction
that did not have the poly(A) tail trimmed from the mRNA (labeled
as `Control`). FIG. 8 is a graph of the results of this HPLC
analysis.
[0176] Results in FIG. 8 demonstrated that removing the poly(A)
tail from mRNA prevented synthesis of high molecular weight
artifacts during transcription. Additionally, material prepared as
Example 11 has been shown to be functionally active in microarray
hybridization experiments (data not shown).
[0177] It is apparent to those skilled in the art of the size of
the poly(A) tail in mRNA can be determined by the methods
described. If the nicking activity of RNaseH is moved three bases
to the 5' end of the mRNA, the mRNA would be nicked at the
message-poly(A) tail junction. The poly(A) tail length could then
be sized by electrophoresis in a high per cent (20%-30%)
polyacrylamide denaturing gel.
[0178] All patents, patent publications, and other published
references mentioned herein are hereby incorporated by reference in
their entireties as if each had been individually and specifically
incorporated by reference herein. While preferred illustrative
embodiments of the present invention are described, one skilled in
the art will appreciate that the present invention can be practiced
by other than the described embodiments, which are presented for
purposes of illustration only and not by way of limitation. The
present invention is limited only by the claims that follow.
Sequence CWU 1
1
17 1 47 DNA Artificial sequence Synthetic oligonucleotide 1
gtaatacgac tcactatagg gagttttttt tttttttttt ttttttt 47 2 27 DNA
Artificial sequence Synthetic oligonucleotide 2 aaaactccct
atagtgagtc gtattac 27 3 60 DNA Artificial Sequence Synthetic
oligonucleotide 3 aaattaatac gactcactat agggagacca caacggtttt
tttttttttt tttttttttt 60 4 40 DNA Artificial sequence Synthetic
oligonucleotide 4 aaaaccgttg tggtctccct atagtgagtc gtattaattt 40 5
35 RNA Artificial sequence Synthetic oligonucleotide 5 uguuguuuuu
uuuuuuuuuu uuuuuuuuuu uuuuu 35 6 65 RNA Artificial sequence
Synthetic oligonucleotide 6 uacaacgucg ugacugggaa aacaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 60 aaaaa 65 7 60 DNA Artificial
sequence Synthetic oligonucleotide 7 aaataattaa ccctcactaa
agggagacca caacggtttt tttttttttt tttttttttt 60 8 40 DNA Artificial
Sequence Synthetic oligonucleotide 8 aaaaccgttg tggtctccct
ttagtgaggg ttaattattt 40 9 20 DNA Artificial sequence Synthetic
oligonucleotide 9 aaaaaaaaaa aaaaaaaaaa 20 10 40 DNA Artificial
sequence Synthetic oligonucleotide misc_feature (40)..() Biotin
attached at 3' end 10 aaaaccgttg tggtctccct atagtgagtc gtattaattt
40 11 57 DNA Artificial Sequence Synthetic oligonucleotide
misc_feature (1)..(3) First two A residues are linked by
phosphorothioate bonds 11 aaaaattaat acgactcact atagggagta
ataggactca ctatagggtt ttttttt 57 12 10 DNA Artificial sequence
Synthetic oligonucleotide misc_feature (1)..(3) u residues at
positions 1 to 3 contain 2'-O-methyl groups misc_feature (9)..(9) v
is degenerate base being only A, C or G misc_feature (10)..(10) n
residue at position 10 contain 2'-O-methyl group and base can be A.
C, G or T 12 uuutttttvn 10 13 10 DNA Artificial Sequence Synthetic
oligonucleotide misc_feature (1)..(3) u residues at position 1 to 3
contain 2'-O-methyl groups misc_feature (9)..(9) v at position 9
can be A, C or G misc_feature (10)..(10) n at position 10 can be
any of A, C, G or T 13 uuutttttvn 10 14 10 DNA Artificial Sequence
Synthetic oligonucleotide misc_feature (1)..(4) u residues at
position 1 to 4 contain 2'-O-methyl groups misc_feature (9)..(9) v
residues at position 9 can be A, C or G misc_feature (10)..(10) n
residue at position 10 can be A, C, G or T and contains 2'-O-methyl
group 14 uuuuttttvn 10 15 44 DNA Artificial sequence Synthetic
oligonucleotide misc_feature (43)..() V at position 43 ia a
degenerate base and can be A,C or G misc_feature (44)..(44) n at
position 44 is a degenerate base and can be A, C, G or T 15
cgcaaattaa tacgactcac tatagggaga ccacaacggt ttvn 44 16 39 DNA
Artificial Sequence Synthetic oligonucleotide 16 ccgttgtggt
ctccctatag tgagtcgtat taatttgcg 39 17 10 DNA Artificial sequence
Synthetic oligonucleotide misc_feature (1)..(5) u residues at
position 1 to 5 contain 2'-O-methyl groups misc_feature (9)..(9) v
residue at position 9 can be A,C or G misc_feature (10)..(10) N
residue at position 10 can be A, C, G or T and conatin 2'-o-methyl
group 17 uuuuutttvn 10
* * * * *