U.S. patent application number 11/606650 was filed with the patent office on 2007-12-20 for compositions and methods for detection of a target nucleic acid sequence.
This patent application is currently assigned to Stratagene California. Invention is credited to Joseph A. Sorge.
Application Number | 20070292934 11/606650 |
Document ID | / |
Family ID | 24927402 |
Filed Date | 2007-12-20 |
United States Patent
Application |
20070292934 |
Kind Code |
A1 |
Sorge; Joseph A. |
December 20, 2007 |
Compositions and methods for detection of a target nucleic acid
sequence
Abstract
The present invention is directed compositions having a Fen
nuclease consisting of a 5' to 3' exonuclease and/or endonuclease
activity and pyrophosphate.
Inventors: |
Sorge; Joseph A.; (Wilson,
WY) |
Correspondence
Address: |
AGILENT TECHOLOGIES INC
P.O BOX 7599
BLDG E , LEGAL
LOVELAND
CO
80537-0599
US
|
Assignee: |
Stratagene California
|
Family ID: |
24927402 |
Appl. No.: |
11/606650 |
Filed: |
November 29, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11106237 |
Apr 14, 2005 |
|
|
|
11606650 |
Nov 29, 2006 |
|
|
|
09728574 |
Nov 30, 2000 |
7118860 |
|
|
11106237 |
Apr 14, 2005 |
|
|
|
09650888 |
Aug 30, 2000 |
6548250 |
|
|
09728574 |
Nov 30, 2000 |
|
|
|
09430692 |
Oct 29, 1999 |
6528254 |
|
|
09650888 |
Aug 30, 2000 |
|
|
|
Current U.S.
Class: |
435/194 ;
435/196 |
Current CPC
Class: |
C12Q 1/6823 20130101;
C12Q 1/6823 20130101; C12Q 2561/101 20130101; C12Q 1/6816 20130101;
C12Q 1/6823 20130101; C12Q 1/6823 20130101; C12Q 1/6816 20130101;
C12Q 1/6823 20130101; C12Q 2521/107 20130101; C12Q 2521/307
20130101; C12Q 2531/113 20130101; C12Q 2531/113 20130101; C12Q
2531/113 20130101; C12Q 2531/113 20130101; C12Q 2561/109 20130101;
C12Q 2565/519 20130101; C12Q 2521/301 20130101; C12Q 2521/307
20130101; C12Q 2525/161 20130101; C12Q 2525/301 20130101 |
Class at
Publication: |
435/194 ;
435/196 |
International
Class: |
C12N 9/16 20060101
C12N009/16; C12N 9/12 20060101 C12N009/12 |
Claims
1. A composition comprising an isolated Fen nuclease consisting of
a 5' to 3' exonuclease and/or endonuclease activity and a
pyrophosphate.
2. The composition of claim 1 or 2, further comprising a labeled
oligonucleotide.
3. The composition of claim 1 or 2, further comprising a nucleic
acid primer.
4. The composition of claim 3, further comprising a nucleic acid
primer.
5. The composition of claim 1 or 2, wherein said fen nuclease is
thermostable.
6. The composition of claim 3, wherein said fen nuclease is
thermostable.
7. The composition of claim 4, wherein said fen nuclease is
thermostable.
8. The composition of claim 8, wherein said fen nuclease is
selected from the group consisting of a fen nuclease enzyme of
Archaeglobus fulgidus, Methanococcus jannaschii, Pyrococcus
furiosus, and Pyrococcus horikoshii.
9. The composition of claim 1 or 2, further comprising a nucleic
acid polymerase that substantially lacks 5' to 3' exonuclease
activity.
10. The composition of claim 10, wherein said nucleic acid
polymerase is thermostable.
11. The composition of claim 11, wherein said nucleic acid
polymerase is selected from the group consisting of Pfu, Pfu-exo,
Taq, Yaq-exo, Deep vent and Deep vent exo.
12. The composition of claim 3, wherein said nucleic acid primer is
between about 10 to 100 nucleotides in length.
13. The composition of claim 3, wherein said nucleic acid primer is
between about 17-50 nucleotides in length.
14. The composition of claim 3, wherein said nucleic acid primer is
between about 17-45 nucleotides in length.
15. The composition of claim 1, wherein said Fen nuclease is a
Fen-1 nuclease.
Description
FIELD OF THE INVENTION
[0001] The invention relates in general to methods of detecting or
measuring a target nucleic acid sequence.
BACKGROUND OF THE INVENTION
[0002] The fidelity of DNA replication, recombination, and repair
is essential for maintaining genome stability, and all of these
processes depend on 5'.fwdarw.3' exonuclease enzymes which are
present in all organisms. For DNA repair, these enzymes are
required for damaged fragment excision and recombinational mismatch
correction. For replication, these nucleases are critical for the
efficient processing of Okazaki fragments during lagging strand DNA
synthesis. In Escherichia coli, this latter activity is provided by
DNA polymerase I (PolI); E. coli strains with inactivating
mutations in the Poll 5'.fwdarw.3' exonuclease domain are not
viable due to an inability to process Okazaki fragments. Eukaryotic
DNA polymerases, however, lack an intrinsic 5'.fwdarw.3'
exonuclease domain, and this critical activity is provided by the
multifunctional, structure-specific metallonuclease FEN-1 (five'
exonuclease-1 or flap endonuclease-1), which also acts as an
endonuclease for 5' DNA flaps (Reviewed in Hosfield et al., 1998a,
Cell, 95:135).
[0003] Methods of detecting and/or measuring a nucleic acid wherein
an enzyme produces a labeled nucleic acid fragment are known in the
art.
[0004] U.S. Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717
and 5,888,780 disclose a method of cleaving a target DNA molecule
by incubating a 5' labeled target DNA with a DNA polymerase
isolated from Thermus aquaticus (Taq polymerase) and a partially
complementary oligonucleotide capable of hybridizing to sequences
at the desired point of cleavage. The partially complementary
oligonucleotide directs the Taq polymerase to the target DNA
through formation of a substrate structure containing a duplex with
a 3' extension opposite the desired site of cleavage wherein the
non-complementary region of the oligonucleotide provides a 3' arm
and the unannealed 5' region of the substrate molecule provides a
5' arm. The partially complementary oligonucleotide includes a 3'
nucleotide extension capable of forming a short hairpin. The
release of labeled fragment is detected following cleavage by Taq
polymerase.
[0005] U.S. Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717
and 5,888,780 disclose the generation of mutant, thermostable DNA
polymerases that have very little or no detectable synthetic
activity, and wild type thermostable nuclease activity. The mutant
polymerases are said to be useful because they lack 5' to 3'
synthetic activity; thus synthetic activity is an undesirable side
reaction in combination with a DNA cleavage step in a detection
assay.
[0006] U.S. Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717
and 5,888,780 disclose that wild type Taq polymerase or mutant Taq
polymerases that lack synthetic activity can release a labeled
fragment by cleaving a 5' end labeled hairpin structure formed by
heat denaturation followed by cooling, in the presence of a primer
that binds to the 3' arm of the hairpin structure. Further, U.S.
Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717 and 5,888,780
teach that the mutant Taq polymerases lacking synthetic activity
can also cleave this hairpin structure in the absence of a primer
that binds to the 3' arm of the hairpin structure.
[0007] U.S. Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717
and 5,888,780 also disclose that cleavage of this hairpin structure
in the presence of a primer that binds to the 3' arm of the hairpin
structure by mutant Taq polymerases lacking synthetic activity
yields a single species of labeled cleaved product, while wild type
Taq polymerase produces multiple cleavage products and converts the
hairpin structure to a double stranded form in the presence of
dNTPs, due to the high level of synthetic activity of the wild type
Taq enzyme.
[0008] The 5' to 3' exonuclease activity of a nucleic acid
polymerase can impair the amplification of certain nucleic acids.
There is also a need in the art for a method of generating a signal
using a nucleic acid cleavage reaction in the absence of a 5' to 3'
exonuclease activity of a nucleic acid polymerase.
[0009] U.S. Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717
and 5,888,780 also disclose that mutant Taq polymerases exhibiting
reduced synthetic activity, but not wild type Taq polymerase, can
release a single labeled fragment by cleaving a linear nucleic acid
substrate comprising a 5' end labeled target nucleic acid and a
complementary oligonucleotide wherein the complementary
oligonucleotide hybridizes to a portion of the target nucleic acid
such that 5' and 3' regions of the target nucleic acid are not
annealed to the oligonucleotide and remain single stranded.
[0010] There is a need in the art for a method of generating a
signal of a discrete size that can be easily distinguished from
oligonucleotide fragments that may arise from nuclease
contaminants, using a nucleic acid cleavage reaction in the absence
of 5' to 3' exonuclease activity of a nucleic acid polymerase.
[0011] U.S. Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717
and 5,888,780 also disclose a method of cleaving a labeled nucleic
acid substrate at naturally occurring areas of secondary structure.
According to this method, biotin labeled DNA substrates are
prepared by PCR, mixed with wild type Taq polymerase or CleavaseBN
(a mutant Taq polymerase with reduced synthetic activity and wild
type 5' to 3' nuclease activity), incubated at 95.degree. C. for 5
seconds to denature the substrate and then quickly cooled to
65.degree. C. to allow the DNA to assume its unique secondary
structure by allowing the formation of intra-strand hydrogen bonds
between the complementary bases. The reaction mixture is incubated
at 65.degree. C. to allow cleavage to occur and biotinylated
cleavage products are detected.
[0012] There is a need in the art for a method of generating a
signal using a nucleic acid cleavage reaction in the absence of a
5' to 3' exonuclease activity of a nucleic acid polymerase wherein
the cleavage structure is not required to contain areas of
secondary structure.
[0013] Methods of detecting and/or measuring a nucleic acid wherein
a FEN-1 enzyme is used to generate a labeled nucleic acid fragment
are known in the art.
[0014] U.S. Pat. No. 5,843,669 discloses a method of detecting
polymorphisms by cleavase fragment length polymorphism analysis
using a thermostable FEN-1 nuclease in the presence or absence of a
mutant Taq polymerase exhibiting reduced synthetic activity.
According to this method, double stranded Hepatitis C virus (HCV)
DNA fragments are labeled by using 5' end labeled primers (labeled
with TMR fluorescent dye) in a PCR reaction. The TMR labeled PCR
products are denatured by heating to 95.degree. C. and cooled to
55.degree. C. to generate a cleavage structure. U.S. Pat. No.
5,843,669 discloses that a cleavage structure comprises a region of
a single stranded nucleic acid substrate containing secondary
structure. Cleavage is carried out in the presence of CleavaseBN
nuclease, FEN-1 nuclease derived from the archaebacteria
Methanococcus jannaschii or both enzymes. Labeled reaction products
are visualized by gel electrophoresis followed by fluoroimaging.
U.S. Pat. No. 5,843,669 discloses that CleavaseBN nuclease and
Methanococcus jannaschii FEN-1 nuclease produce cleavage patterns
that are easily distinguished from each other, and that the
cleavage patterns from a reaction containing both enzymes include
elements of the patterns produced by cleavage with each individual
enzyme but are not merely a composite of the cleavage patterns
produced by each individual enzyme. This indicates that some of the
fragments that are not cleaved by one enzyme (and which appear as a
band in that enzyme's pattern) can be cleaved by a second enzyme in
the same reaction mixture.
[0015] Lyamichev et al. disclose a method for detecting DNAs
wherein overlapping pairs of oligonucleotide probes that are
partially complementary to a region of target DNA are mixed with
the target DNA to form a 5' flap region, and wherein cleavage of
the labeled downstream probe by a thermostable FEN-1 nuclease
produces a labeled cleavage product. Lyamichev et al. also disclose
reaction conditions wherein multiple copies of the downstream
oligonucleotide probe can be cleaved for a single target sequence
in the absence of temperature cycling, so as to amplify the
cleavage signal and allow quantitative detection of target DNA at
sub-attomole levels (Lyamichev et al., 1999, Nat. Biotechnol.,
17:292).
[0016] The polymerase chain reaction (PCR) technique, is disclosed
in U.S. Pat. Nos. 4,683,202, 4,683,195 and 4,800,159. In its
simplest form, PCR is an in vitro method for the enzymatic
synthesis of specific DNA sequences, using two oligonucleotide
primers that hybridize to opposite strands and flank the region of
interest in the target DNA. A repetitive series of reaction steps
involving template denaturation, primer annealing and the extension
of the annealed primers by DNA polymerase results in the
exponential accumulation of a specific fragment whose termini are
defined by the 5' ends of the primers. PCR is reported to be
capable of producing a selective enrichment of a specific DNA
sequence by a factor of 10.sup.9. The PCR method is also described
in Saiki et al., 1985, Science, 230:1350.
[0017] While the PCR technique is an extremely powerful method for
amplifying nucleic acid sequences, the detection of the amplified
material requires additional manipulation and subsequent handling
of the PCR products to determine whether the target DNA is present.
It is desirable to decrease the number of subsequent handling steps
currently required for the detection of amplified material. An
assay system, wherein a signal is generated while the target
sequence is amplified, requires fewer handling steps for the
detection of amplified material, as compared to a PCR method that
does not generate a signal during the amplification step.
[0018] U.S. Pat. Nos. 5,210,015 and 5,487,972 disclose a PCR based
assay for releasing labeled probe comprising generating a signal
during the amplification step of a PCR reaction in the presence of
a nucleic acid to be amplified, Taq polymerase that has 5' to 3'
exonuclease activity and a 5', 3' or 5' and 3' end-labeled probe
comprising a region complementary to the amplified region and an
additional non-complementary 5' tail region. U.S. Pat. Nos.
5,210,015 and 5,487,972 disclose further that this PCR based assay
can liberate the 5' labeled end of a hybridized probe when the Taq
polymerase is positioned near the labeled probe by an upstream
probe in a polymerization independent manner, e.g. in the absence
of dNTPs.
[0019] There is a need in the art for a method of detecting or
measuring a target nucleic acid sequence that does not require
multiple steps.
[0020] There is also a need in the art for a PCR process for
detecting or measuring a target nucleic acid sequence that does not
require multiple steps subsequent to the amplification process.
[0021] There is also a need in the art for a PCR process for
detecting or measuring a target nucleic acid sequence that allows
for concurrent amplification and detection of a target nucleic acid
sequence in a sample.
[0022] There is also a need in the art for a PCR process for
detecting or measuring a target nucleic acid sequence wherein the
PCR process occurs in the presence of a nucleic acid polymerase
that lacks 5' to 3' exonuclease activity.
SUMMARY OF THE INVENTION
[0023] The invention provides a method of generating a signal
indicative of the presence of a target nucleic acid sequence in a
sample comprising forming a cleavage structure by incubating a
sample comprising a target nucleic acid sequence with a nucleic
acid polymerase, and cleaving the cleavage structure with a FEN
nuclease to generate a signal, wherein generation of the signal is
indicative of the presence of a target nucleic acid sequence in the
sample.
[0024] As used herein a "FEN nuclease" refers to an enzyme that
cleaves a cleavage structure according to the invention. The term
"FEN nuclease" encompasses an enzyme that consists essentially of a
5' exonuclease and/or an endonuclease activity. As used herein,
"consists essentially of" refers to an enzyme wherein the
predominant activity of the enzyme is a 5' exonucleolytic and/or
endonucleolytic activity, such that one or both of 5' to 3'
synthetic activity and 3' single-stranded flap cleavage activity
(i.e., 3' endonucleolytic and/or 3'exonucleolytic activity) are
substantially lacking. "Substantially lacks" means that the FEN
nuclease possesses no more than 5% or 10% and preferably less than
0.1%, 0.5%, or 1% of the activity of a wild type enzyme (e.g. for
5' to 3' synthetic activity and the 3' endonucleolytic and/or '3
exonucleolytic activities, the enzyme may be a wild type DNA
polymerase having these activities). 5' to 3' synthetic activity
can be measured, for example, in a nick translation assay or an
enzymatic sequencing reaction which involve the formation of a
phosphodiester bridge between the 3'-hydroxyl group at the growing
end of an oligonucleotide primer and the 5'-phosphate group of an
incoming deoxynucleotide, such that the overall direction of
synthesis is in the 5' to 3' direction. 3' flap cleavage may be
measured in a DNA synthesis reaction in which, because the
(labelled) 3' end of a DNA duplex is unpaired, it is cleaved from
the duplex. A FEN nuclease that "consists of" a 5' exonuclease
and/or endonuclease activity refers to an enzyme that "lacks" 5' to
3' synthetic activity and/or 3' single-stranded flap cleavage
activity. "Lacks" means that the Fen nuclease has no detectable
activity or has only "minor" activity, i.e., less than 1.0%, 0.5%,
0.1% or 0.01% of the activity of a wild type enzyme. As used
herein, "FEN nuclease" encompasses a 5' flap-specific nuclease.
[0025] As used herein, "wild type" refers to a gene or gene product
which has the characteristics of (i.e., either has the sequence of
or encodes, for the gene, or possesses the sequence or activity of,
for an enzyme) that gene or gene product when isolated from a
naturally occurring source.
[0026] A "5' flap-specific nuclease" (also referred to herein as a
"flap-specific nuclease") according to the invention is an
endonuclease which can remove a single stranded flap that protrudes
as a 5' single strand. A flap-specific nuclease according to the
invention can also cleave a pseudo-Y structure. A substrate of a
flap-specific nuclease according to the invention, comprises a
target nucleic acid, a second nucleic acid, a portion of which
specifically hybridizes with a target nucleic acid, and a primer
extension product from a third nucleic acid that specifically
hybridizes with a target nucleic acid sequence.
[0027] As used herein, a "cleavage structure" refers to a
polynucleotide structure (for example as illustrated in FIG. 1)
comprising at least a duplex nucleic acid having a single stranded
region comprising a flap, a loop, a single-stranded bubble, a
D-loop, a nick or a gap. A cleavage structure according to the
invention thus includes a polynucleotide structure comprising a
flap strand of a branched DNA wherein a 5' single-stranded
polynucleotide flap extends from a position near its junction to
the double stranded portion of the structure and preferably the
flap is labelled with a detectable label. A flap of a cleavage
structure according to the invention is preferably about 1-500
nucleotides, more preferably about 5-25 nucleotides and most
preferably about 10-20 nucleotides and is preferably cleaved at a
position located either one nucleotide proximal and/or one
nucleotide distal from the elbow of the flap strand.
[0028] A cleavage structure according to the invention preferably
comprises a target nucleic acid sequence, and also may include an
oligonucleotide that specifically hybridizes with the target
nucleic acid sequence, and a flap extending from the hybridizing
oligonucleotide. For example, a cleavage structure according to the
invention may comprise a target nucleic acid sequence (for example
B in FIG. 3), an upstream oligonucleotide that is complementary to
the target sequence (for example A in FIG. 3), and a downstream
oligonucleotide that is complementary to the target sequence (for
example C in FIG. 3). In such a cleavage structure, the downstream
oligonucleotide may be blocked at the 3' terminus to prevent
extension of the 3' end of the downstream oligonucleotide.
[0029] A cleavage structure according to the invention may be a
polynucleotide structure comprising a flap extending from the
downstream oligonucleotide, wherein the flap is formed by extension
of the upstream oligonucleotide by the synthetic activity of a
nucleic acid polymerase, and subsequent, partial, displacement of
the 5' end of the downstream oligonucleotide.
[0030] A cleavage structure according to the invention may be
formed by hybridizing a target nucleic acid sequence with an
oligonucleotide wherein the oligonucleotide comprises a
complementary region that anneals to the target nucleic acid
sequence, and a non-complementary region that does not anneal to
the target nucleic acid sequence and forms a 5' flap.
[0031] A cleavage structure also may be a pseudo-Y structure
wherein a pseudo Y-structure is formed if the strand upstream of a
flap (referred to herein as a flap adjacent strand or primer
strand) is removed, and double stranded DNA substrates containing a
gap or nick. A "cleavage structure", as used herein, does not
include a double stranded nucleic acid structure with only a 3'
single-stranded flap. As used herein, a "cleavage structure"
comprises ribonucleotides or deoxyribonucleotides and thus can be
RNA or DNA.
[0032] A cleavage structure according to the invention may be an
overlapping flap wherein the 3' end of an upstream oligonucleotide
capable of hybridizing to a target nucleic acid sequence (for
example A in FIG. 3) is complementary to 1 base pair of the
downstream oligonucleotide (for example C in FIG. 3) that is
annealed to a target nucleic acid sequence and wherein the overlap
is directly downstream of the point of extension of the single
stranded flap.
[0033] A cleavage structure according to the invention is formed by
the steps of 1. incubating a) an upstream extendable 3' end,
preferably an oligonucleotide primer, b) an oligonucleotide primer
probe located not more than 5000 nucleotides downstream of the
upstream primer and c) an appropriate target nucleic acid sequence
wherein the target sequence is complementary to both the upstream
primer and downstream probe and d) a suitable buffer, under
conditions that allow the nucleic acid sequence to hybridize to the
oligonucleotide primers, and 2. extending the 3' end of the
upstream oligonucleotide primer by the synthetic activity of a
polymerase such that the newly synthesized 3' end of the upstream
oligonucleotide primer becomes adjacent to and/or displaces at
least a portion of (i.e., at least 5-10 nucleotides of) the 5' end
of the downstream oligonucleotide probe. According to the method of
the invention, buffers and extension temperatures are favorable for
strand displacement by a particular nucleic acid polymerase
according to the invention. Preferably, the downstream
oligonucleotide is blocked at the 3' terminus to prevent extension
of the 3' end of the downstream oligonucleotide. In another
embodiment of the invention, a cleavage structure according to the
invention can be prepared by incubating a target nucleic acid
sequence with an oligonucleotide primer comprising a
non-complementary 5' region that does not anneal to the target
nucleic acid sequence and forms a 5' flap, and a complementary 3'
region that anneals to the target nucleic acid sequence.
[0034] In a preferred embodiment of the invention a cleavage
structure is labelled. A labelled cleavage structure according to
the invention is formed by the steps of 1. incubating a) an
upstream extendable 3' end, preferably an oligonucleotide primer,
b) a labelled probe preferably located not more than 5000 and more
preferably located not more than 500 nucleotides downstream of the
upstream primer and c) an appropriate target nucleic acid sequence
wherein the target sequence is complementary to both the primer and
the labelled probe and d) a suitable buffer, under conditions that
allow the nucleic acid sequence to hybridize to the primers, and 2.
extending the 3' end of the upstream primer by the synthetic
activity of a polymerase such that the newly synthesized 3' end of
the upstream primer partially displaces the 5' end of the
downstream probe. According to the method of the invention, buffers
and extension temperatures are favorable for strand displacement by
a particular nucleic acid polymerase according to the invention.
Preferably, the downstream oligonucleotide is blocked at the 3'
terminus to prevent extension of the 3' end of the downstream
oligonucleotide. In another embodiment, a cleavage structure
according to the invention can be prepared by incubating a target
nucleic acid sequence with a probe comprising a non-complementary,
labeled, 5' region that does not anneal to the target nucleic acid
sequence and forms a 5' flap, and a complementary 3' region that
anneals to the target nucleic acid sequence.
[0035] As used herein, "label" or "labelled moiety capable of
providing a signal" refers to any atom or molecule which can be
used to provide a detectable (preferably quantifiable) signal, and
which can be operatively linked to a nucleic acid. Labels may
provide signals detectable by fluorescence, radioactivity,
colorimetry, gravimetry, X-ray diffraction or absorption,
magnetism, enzymatic activity, mass spectrometry, binding affinity,
hybridization radiofrequency and the like.
[0036] As used herein, "generating a signal" refers to detecting
and or measuring a released nucleic acid fragment as an indication
of the presence of a target nucleic acid sequence in a sample.
[0037] As used herein, "sample" refers to any substance containing
or presumed to contain a nucleic acid of interest (a target nucleic
acid sequence) or which is itself a nucleic acid containing or
presumed to contain a target nucleic acid sequence of interest. The
term "sample" thus includes a sample of nucleic acid (genomic DNA,
cDNA, RNA), cell, organism, tissue, fluid, or substance including
but not limited to, for example, plasma, serum, spinal fluid, lymph
fluid, synovial fluid, urine, tears, stool, external secretions of
the skin, respiratory, intestinal and genitourinary tracts, saliva,
blood cells, tumors, organs, tissue, samples of in vitro cell
culture constituents, natural isolates (such as drinking water,
seawater, solid materials), microbial specimens, and objects or
specimens that have been "marked" with nucleic acid tracer
molecules.
[0038] As used herein, "target nucleic acid sequence" or "template
nucleic acid sequence" refers to a region of a nucleic acid that is
to be either replicated, amplified, and/or detected. In one
embodiment, the "target nucleic acid sequence" or "template nucleic
acid sequence" resides between two primer sequences used for
amplification.
[0039] As used herein, "nucleic acid polymerase" refers to an
enzyme that catalyzes the polymerization of nucleoside
triphosphates. Generally, the enzyme will initiate synthesis at the
3'-end of the primer annealed to the target sequence, and will
proceed in the 5'-direction along the template, and if possessing a
5' to 3' nuclease activity, hydrolyzing intervening, annealed probe
to release both labeled and unlabeled probe fragments, until
synthesis terminates. Known DNA polymerases include, for example,
E. coli DNA polymerase I, T7 DNA polymerase, Thermus thermophilus
(Tth) DNA polymerase, Bacillus stearothermophilus DNA polymerase,
Thermococcus litoralis DNA polymerase, Thermus aquaticus (Taq) DNA
polymerase and Pyrococcus furiosus (Pfu) DNA polymerase.
[0040] As used herein, "5' to 3' exonuclease activity" or
"5'.fwdarw.3' exonuclease activity" refers to that activity of a
template-specific nucleic acid polymerase e.g. a 5'.fwdarw.3'
exonuclease activity traditionally associated with some DNA
polymerases whereby mononucleotides or oligonucleotides are removed
from the 5' end of a polynucleotide in a sequential manner, (i.e.,
E. coli DNA polymerase I has this activity whereas the Klenow
(Klenow et al., 1970, Proc. Natl. Acad. Sci., USA, 65:168) fragment
does not, (Klenow et al., 1971, Eur. J. Biochem., 22:371)), or
polynucleotides are removed from the 5' end by an endonucleolytic
activity that may be inherently present in a 5' to 3' exonuclease
activity.
[0041] As used herein, the phrase "substantially lacks 5' to 3'
exonuclease activity" or "substantially lacks 5'-3' exonuclease
activity" means having less than 10%, 5%, 1%, 0.5%, or 0.1% of the
activity of a wild type enzyme. The phrase "lacking 5' to 3'
exonuclease activity" or "lacking 5'-3' exonuclease activity" means
having undetectable 5' to 3' exonuclease activity or having less
than about 1%, 0.5%, or 0.1% of the 5' to 3' exonuclease activity
of a wild type enzyme. 5' to 3' exonuclease activity may be
measured by an exonuclease assay which includes the steps of
cleaving a nicked substrate in the presence of an appropriate
buffer, for example 10 mM Tris-HCl (pH 8.0), 10 mM MgCl.sub.2 and
50 .mu.g/ml bovine serum albumin) for 30 minutes at 60.degree. C.,
terminating the cleavage reaction by the addition of 95% formamide
containing 10 mM EDTA and 1 mg/ml bromophenol blue, and detecting
nicked or un-nicked product.
[0042] Nucleic acid polymerases useful according to the invention
include but are not limited to Pfu, exo-Pfu (a mutant form of Pfu
that lacks 3' to 5' exonuclease activity), the Stoffel fragment of
Taq, N-truncated Bst, N-truncated Bca, Genta, JdF3 exo-, Vent, Vent
exo- (a mutant form of Vent that lacks 3' to 5' exonuclease
activity), Deep Vent, Deep Vent exo- (a mutant form of Deep Vent
that lacks 3' to 5' exonuclease activity), U1Tma and Sequenase.
Additional nucleic acid polymerases useful according to the
invention are included below in the section entitled, "Nucleic Acid
Polymerases".
[0043] As used herein, "cleaving" refers to enzymatically
separating a cleavage structure into distinct (i.e. not physically
linked to other fragments or nucleic acids by phosphodiester bonds)
fragments or nucleotides and fragments that are released from the
cleavage structure. For example, cleaving a labelled cleavage
structure refers to separating a labelled cleavage structure
according to the invention and defined below, into distinct
fragments including fragments derived from an oligonucleotide that
specifically hybridizes with a target nucleic acid sequence or
wherein one of the distinct fragments is a labelled nucleic acid
fragment derived from a target nucleic acid sequence and/or derived
from an oligonucleotide that specifically hybridizes with a target
nucleic acid sequence that can be detected and/or measured by
methods well known in the art and described herein that are
suitable for detecting the labelled moiety that is present on a
labelled fragment.
[0044] As used herein, "endonuclease" refers to an enzyme that
cleaves bonds, preferably phosphodiester bonds, within a nucleic
acid molecule. An endonuclease according to the invention can be
specific for single-stranded or double-stranded DNA or RNA.
[0045] As used herein, "exonuclease" refers to an enzyme that
cleaves bonds, preferably phosphodiester bonds, between nucleotides
one at a time from the end of a polynucleotide. An exonuclease
according to the invention can be specific for the 5' or 3' end of
a DNA or RNA molecule, and is referred to herein as a 5'
exonuclease or a 3' exonuclease.
[0046] As used herein a "flap" refers to a region of single
stranded DNA that extends from a double stranded nucleic acid
molecule. A flap according to the invention is preferably between
about 1-500 nucleotides, more preferably between about 5-25
nucleotides and most preferably between about 10-20
nucleotides.
[0047] In a preferred embodiment, the nucleic acid polymerase
substantially lacks 5' to 3' exonuclease activity.
[0048] In a preferred embodiment, the cleavage structure comprises
at least one oligonucleotide primer.
[0049] The invention also provides a method of detecting or
measuring a target nucleic acid sequence comprising forming a
cleavage structure by incubating a sample comprising a target
nucleic acid sequence with a nucleic acid polymerase, cleaving the
cleavage structure with a FEN nuclease to release a nucleic acid
fragment, and detecting and/or measuring the release of the
fragment as an indication of the presence of the target sequence in
the sample.
[0050] As used herein, "detecting a target nucleic acid sequence"
or "measuring a target nucleic acid sequence" refers to determining
the presence of a particular target nucleic acid sequence in a
sample or determining the amount of a particular target nucleic
acid sequence in a sample as an indication of the presence of a
target nucleic acid sequence in a sample. The amount of a target
nucleic acid sequence that can be measured or detected is
preferably about 1 molecule to 10.sup.20 molecules, more preferably
about 100 molecules to 10.sup.17 molecules and most preferably
about 1000 molecules to 10.sup.14 molecules. According to the
invention, the detected nucleic acid is derived from the labelled
5' end of a downstream probe of a cleavage structure according to
the invention (for example C in FIG. 3), that is displaced from the
target nucleic acid sequence by the 3' extension of an upstream
probe of a cleavage structure according to the invention (for
example A of FIG. 3). According to the present invention, a label
is attached to the 5' end of the downstream probe (for example C in
FIG. 3) comprising a cleavage structure according to the invention.
Alternatively, a label is attached to the 3' end of the downstream
probe and a quencher is attached to the 5' flap of the downstream
probe. According to the invention, a label may be attached to the
3' end of the downstream probe (for example C in FIG. 3) comprising
a cleavage structure according to the invention.
[0051] According to the invention, the downstream probe (for
example C in FIG. 3) may be labelled internally. In a preferred
embodiment, a cleavage structure according to the invention can be
prepared by incubating a target nucleic acid sequence with a probe
comprising a non-complementary, labeled, 5' region that does not
anneal to the target nucleic acid sequence and forms a 5' flap, and
a complementary 3' region that anneals to the target nucleic acid
sequence. According to this embodiment of the invention, the
detected nucleic acid is derived from the labelled 5' flap region
of the probe. Preferably there is a direct correlation between the
amount of the target nucleic acid sequence and the signal generated
by the cleaved, detected nucleic acid.
[0052] As used herein, "detecting release of labelled fragments" or
"measuring release of labelled fragments" refers to determining the
presence of a labelled fragment in a sample or determining the
amount of a labelled fragment in a sample. Methods well known in
the art and described herein can be used to detect or measure
release of labelled fragments. A method of detecting or measuring
release of labelled fragments will be appropriate for measuring or
detecting the labelled moiety that is present on the labelled
fragments. The amount of a released labelled fragment that can be
measured or detected is preferably about 25%, more preferably about
50% and most preferably about 95% of the total starting amount of
labelled probe.
[0053] As used herein, "labelled fragments" refer to cleaved
mononucleotides or small oligonucleotides or oligonucleotides
derived from the labelled cleavage structure according to the
invention wherein the cleaved oligonucleotides are preferably
between about 2-1000 nucleotides, more preferably between about
5-50 nucleotides and most preferably between about 16-18
nucleotides, which are cleaved from a cleavage structure by a FEN
nuclease and can be detected by methods well known in the art and
described herein.
[0054] In a preferred embodiment, the nucleic acid polymerase
substantially lacks 5' to 3' exonuclease activity.
[0055] In another preferred embodiment, the nucleic acid polymerase
is a DNA polymerase.
[0056] In another preferred embodiment, the nucleic acid polymerase
is thermostable.
[0057] As used herein, "thermostable" refers to an enzyme which is
stable and active at temperatures as great as preferably between
about 90-100.degree. C. and more preferably between about
70-98.degree. C. to heat as compared, for example, to a
non-thermostable form of an enzyme with a similar activity. For
example, a thermostable nucleic acid polymerase or FEN nuclease
derived from thermophilic organisms such as P. furiosus, M.
jannaschii, A. fulgidus or P. horikoshii are more stable and active
at elevated temperatures as compared to a nucleic acid polymerase
from E. coli or a mammalian FEN enzyme. A representative
thermostable nucleic acid polymerase isolated from Thermus
aquaticus (Taq) is described in U.S. Pat. No. 4,889,818 and a
method for using it in conventional PCR is described in Saiki et
al., 1988, Science 239:487. Another representative thermostable
nucleic acid polymerase isolated from P. furiosus (Pfu) is
described in Lundberg et al., 1991, Gene, 108:1-6. Additional
representative temperature stable polymerases include, e.g.,
polymerases extracted from the thermophilic bacteria Thermus
flavus, Thermus ruber, Thermus thermophilus, Bacillus
stearothermophilus (which has a somewhat lower temperature optimum
than the others listed), Thermus lacteus, Thermus rubens,
Thermotoga maritima, or from thermophilic archaea Thermococcus
litoralis, and Methanothermus fervidus.
[0058] Temperature stable polymerases and FEN nucleases are
preferred in a thermocycling process wherein double stranded
nucleic acids are denatured by exposure to a high temperature
(about 95.degree. C.) during the PCR cycle.
[0059] In another preferred embodiment, the FEN nuclease is a
flap-specific nuclease.
[0060] In another preferred embodiment, the FEN nuclease is
thermostable.
[0061] In another preferred embodiment, the cleavage structure is
formed comprising at least one labeled moiety capable of providing
a signal.
[0062] In another preferred embodiment, the cleavage structure is
formed comprising a pair of interactive signal generating labeled
moieties effectively positioned to quench the generation of a
detectable signal, wherein the labeled moieties are separated by a
site susceptible to FEN nuclease cleavage, thereby allowing the
nuclease activity of the FEN nuclease to separate the first
interactive signal generating labeled moiety from the second
interactive signal generating labeled moiety by cleaving at the
site susceptible to FEN nuclease, thereby generating a detectable
signal.
[0063] In yet another preferred embodiment, the cleavage structure
is formed comprising a hairpin-forming oligonucleotide probe having
secondary structure.
[0064] As used herein, "secondary structure" refers to the
conformation (for example a hairpin, a stem-loop structure, an
internal loop, a bulge loop, a branched structure, or a pseudoknot)
of a nucleic acid molecule wherein a sequence comprising a first
single stranded sequence of bases followed by a second
complementary sequence in the same molecule folds back on itself to
generate an antiparallel duplex structure wherein the single
stranded sequence and the complementary sequence anneal by the
formation of hydrogen bonds. A "secondary structure" also refers to
the conformation of a nucleic acid molecule comprising an affinity
pair, wherein the affinity pair reversibly associates as a result
of attractive forces that exist between the moieties. As used
herein, "secondary structure" refers to a nucleic acid conformation
which prevents probe binding to a capture element.
[0065] As used herein, a "hairpin structure" or a "stem" refers to
a double-helical region formed by base pairing between adjacent,
inverted, complementary sequences in a single strand of RNA of
DNA.
[0066] As used herein, "stem loop" structure refers to a hairpin
structure, further comprising a loop of unpaired bases at, one
end.
[0067] In another preferred embodiment, the pair of interactive
signal generating moieties comprises a quencher moiety and a
fluorescent moiety.
[0068] In another preferred embodiment, the cleavage structure
comprises at least one oligonucleotide primer.
[0069] The invention also provides a polymerase chain reaction
process for detecting a target nucleic acid sequence in a sample
comprising providing a cleavage structure, providing a set of
oligonucleotide primers wherein a first primer contains a sequence
complementary to a region in one strand of the target nucleic acid
sequence and primes the synthesis of a complementary DNA strand,
and a second primer contains a sequence complementary to a region
in a second strand of the target nucleic acid sequence and primes
the synthesis of a complementary DNA strand, and amplifying the
target nucleic acid sequence employing a nucleic acid polymerase as
a template-dependent polymerizing agent under conditions which are
permissive for PCR cycling steps of (i) annealing of primers
required for amplification to a template nucleic acid sequence
contained within the target sequence and annealing primers required
for formation of a cleavage structure to a target nucleic acid
sequence, (ii) extending the primers wherein the nucleic acid
polymerase synthesizes a primer extension product, and (iii)
cleaving the cleavage structure employing a FEN nuclease as a
cleavage agent for release of labeled fragments from the cleavage
structure thereby creating detectable labeled fragments; and (d)
detecting and/or measuring the release of labeled fragments as an
indication of the presence of the target nucleic acid sequence in
the sample.
[0070] The invention provides for a polymerase chain reaction
process wherein amplification and detection of a target nucleic
acid sequence occur concurrently (i.e. real time detection). The
invention also provides for a polymerase chain reaction process
wherein amplification of a target nucleic acid sequence occurs
prior to detection of the target nucleic acid sequence (i.e. end
point detection).
[0071] As used herein, an "oligonucleotide primer" refers to a
single stranded DNA or RNA molecule that is hybridizable to a
nucleic acid template and primes enzymatic synthesis of a second
nucleic acid strand. Oligonucleotide primers useful according to
the invention are between about 10 to 100 nucleotides in length,
preferably about 17-50 nucleotides in length and more preferably
about 17-45 nucleotides in length. Oligonucleotide probes useful
for the formation of a cleavage structure according to the
invention are between about 17-40 nucleotides in length, preferably
about 17-30 nucleotides in length and more preferably about 17-25
nucleotides in length. Oligonucleotide probes, as used in the
present invention include oligonucleotides comprising secondary
structure, including, but not limited to molecular beacons, safety
pins (FIG. 10), scorpions (FIG. 11), and sunrise/amplifluor probes
(FIG. 12), the details and structures of which are described below
and in the corresponding figures.
[0072] As used herein, "template dependent polymerizing agent"
refers to an enzyme capable of extending an oligonucleotide primer
in the presence of adequate amounts of the four deoxyribonucleoside
triphosphates (dATP, dGTP, dCTP and dTTP) or analogs as described
herein, in a reaction medium comprising appropriate salts, metal
cations, appropriate stabilizers and a pH buffering system.
Template dependent polymerizing agents are enzymes known to
catalyze primer- and template-dependent DNA synthesis, and possess
5' to 3' nuclease activity. Preferably, a template dependent
polymerizing agent according to the invention lacks 5' to 3'
nuclease activity.
[0073] As used herein, "amplifying" refers to producing additional
copies of a nucleic acid sequence, including the method of the
polymerase chain reaction.
[0074] In a preferred embodiment, the nucleic acid polymerase
substantially lacks 5' to 3' exonuclease activity.
[0075] In a preferred embodiment, the oligonucleotide primers of
step b of the polymerase chain reaction process described above are
oriented such that the forward primer is located upstream of a
cleavage structure according to the invention and the reverse
primer is located downstream of a cleavage structure according to
the invention. The reverse primer is complementary to the opposite
strand of the forward primer which is complementary to a strand of
the cleavage structure.
[0076] In another preferred embodiment, the nucleic acid polymerase
is a DNA polymerase.
[0077] In another preferred embodiment, the nucleic acid polymerase
is thermostable.
[0078] In another preferred embodiment, the nucleic acid polymerase
is selected from the group consisting of Taq polymerase and Pfu
polymerase.
[0079] In another preferred embodiment the FEN nuclease is
thermostable.
[0080] In another preferred embodiment the FEN nuclease is a
flap-specific nuclease.
[0081] In another preferred embodiment the FEN nuclease is selected
from the group consisting of FEN nuclease enzyme derived from
Archaeglobus fulgidus, Methanococcus jannaschii, Pyrococcus
furiosus, human, mouse or Xenopus laevis. A FEN nuclease according
to the invention also includes Saccharomyces cerevisiae RAD27, and
Schizosaccharomyces pombe RAD2, Pol I DNA polymerase associated 5'
to 3' exonuclease domain, (e.g. E. coli, Thermus aquaticus (Taq),
Thermus flavus (Tfl), Bacillus caldotenax (Bca), Streptococcus
pneumoniae) and phage functional homologs of FEN including but not
limited to T4 RNaseH, T5 5' to 3' exonuclease, T7 gene 6
exonuclease and T3 gene 6 exonuclease.
[0082] Preferably, only the 5' to 3' exonuclease domains of Taq,
Tfl and Bca FEN nuclease are used.
[0083] In another preferred embodiment, the labeled cleavage
structure is formed by the addition of at least one labeled moiety
capable of providing a signal.
[0084] The invention also provides a polymerase chain reaction
process for simultaneously forming a cleavage structure, amplifying
a target nucleic acid sequence in a sample and cleaving the
cleavage structure comprising: (a) providing an upstream
oligonucleotide primer complementary to a region in one strand of
the target nucleic acid sequence and a downstream labeled probe
complementary to a region in the same strand of the target nucleic
acid sequence, wherein the upstream primer contains a sequence
complementary to a region in one strand of the target nucleic acid
sequence and primes the synthesis of a complementary DNA strand,
and the downstream probe contains a sequence complementary to a
region in a second strand of the target nucleic acid sequence and
primes the synthesis of a complementary DNA strand; and (b)
detecting a nucleic acid which is produced in a reaction comprising
amplification of the target nucleic acid sequence and cleavage
thereof wherein a nucleic acid polymerase is a template-dependent
polymerizing agent under conditions which are permissive for PCR
cycling steps of (i) annealing of primers to a target nucleic acid
sequence, (ii) extending the primers of step (a) wherein the
nucleic acid polymerase synthesizes primer extension products, and
wherein the primer extension product of the primer of step (a)
partially displaces the downstream probe of step (a) to form a
cleavage structure; and (iii) cleaving the cleavage structure
employing a FEN nuclease as a cleavage agent for release of labeled
fragments from the cleavage structure thereby creating detectable
labeled fragments.
[0085] In a preferred embodiment, the nucleic acid polymerase
substantially lacks 5' to 3' exonuclease activity.
[0086] The invention also provides a method of forming a cleavage
structure comprising the steps of: (a) providing a target nucleic
acid sequence, (b) providing an upstream primer complementary to
said target nucleic acid sequence, (c) providing a downstream probe
complementary to said target nucleic acid sequence, (d) extending
the 3' end of the upstream primer with a nucleic acid polymerase;
and (e) displacing the 5' end of the downstream probe.
[0087] Preferably the downstream probe is located not more than 500
nucleotides downstream of the upstream primer.
[0088] During the extension step, the 3' end of the upstream primer
is extended by the synthetic activity of a polymerase such that the
newly synthesized 3' end of the upstream primer partially displaces
the 5' end of the downstream probe.
[0089] In a preferred embodiment, the nucleic acid polymerase
substantially lacks 5' to 3' exonuclease activity.
[0090] In another embodiment of the invention, a cleavage structure
according to the invention can be prepared by incubating a target
nucleic acid sequence with a probe comprising a non-complementary
5' region that does not anneal to the target nucleic acid sequence
and forms a 5' flap, and a complementary 3' region that anneals to
the target nucleic acid sequence.
[0091] The invention also provides a method of forming a labeled
cleavage structure comprising the steps of: (a) providing a target
nucleic acid sequence, (b) providing an upstream primer
complementary to said target nucleic acid sequence, (c) providing a
downstream end labeled probe complementary to said target nucleic
acid sequence, (d) extending the 3' end of the upstream primer with
a nucleic acid polymerase; and (e) displacing the 5' end of the
downstream probe.
[0092] Preferably the downstream end labeled probe is located not
more than 500 nucleotides downstream of the upstream primer.
Preferably, the downstream oligonucleotide is blocked at the 3'
terminus to prevent extension of the 3' end of the downstream
oligonucleotide. Such blockage can be achieved by placing a
phosphate, or other moiety not readily removed, on the 3' terminal
hydroxyl of the oligonucleotide.
[0093] During the extension step, the 3' end of the upstream primer
is extended by the synthetic activity of a polymerase such that the
newly synthesized 3' end of the upstream primer partially displaces
the 5' end of the downstream probe. According to the method of the
invention, buffers and extension temperatures are favorable for
strand displacement by a particular nucleic acid polymerase
according to the invention.
[0094] In one embodiment of the invention, a cleavage structure
according to the invention can be prepared by incubating a target
nucleic acid sequence with a probe comprising a non-complementary,
labeled, 5' region that does not anneal to the target nucleic acid
sequence and forms a 5' flap, and a complementary 3' region that
anneals to the target nucleic acid sequence.
[0095] The invention also provides a kit for generating a signal
indicative of the presence of a target nucleic acid sequence in a
sample comprising a nucleic acid polymerase, a FEN nuclease and a
suitable buffer. In a preferred embodiment, the invention also
provides a kit for generating a signal indicative of the presence
of a target nucleic acid sequence in a sample comprising one or
more nucleic acid polymerases, a FEN nuclease and a suitable
buffer.
[0096] In a preferred embodiment, the nucleic acid polymerase
substantially lacks 5' to 3' exonuclease activity.
[0097] In a preferred embodiment the nucleic acid polymerase is
thermostable.
[0098] In another preferred embodiment the FEN nuclease is
thermostable.
[0099] In another preferred embodiment the kit further comprises a
labeled nucleic acid complementary to the target nucleic acid
sequence.
[0100] The invention also provides a composition comprising a
nucleic acid polymerase and a FEN nuclease.
[0101] In a preferred embodiment, the nucleic acid polymerase
substantially lacks a 5' to 3' exonuclease activity.
[0102] In another preferred embodiment the invention provides for a
composition comprising one or more nucleic acid polymerases and a
FEN nuclease.
[0103] Further features and advantages of the invention are as
follows. The claimed invention provides a method of generating a
signal to detect and/or measure a target nucleic acid wherein the
generation of a signal is an indication of the presence of a target
nucleic acid in a sample. The method of the claimed invention does
not require multiple steps. The claimed invention also provides a
PCR based method for detecting and/or measuring a target nucleic
acid comprising generating a signal as an indication of the
presence of a target nucleic acid. The claimed invention allows for
simultaneous amplification and detection and/or measurement of a
target nucleic acid sequence. The claimed invention also provides a
PCR based method for detecting and/or measuring a target nucleic
acid comprising generating a signal in the absence of a nucleic
acid polymerase that demonstrates 5' to 3' exonuclease
activity.
[0104] Further features and advantages of the invention will become
more fully apparent in the following description of the embodiments
and drawings thereof, and from the claims.
BRIEF DESCRIPTION OF DRAWINGS
[0105] FIG. 1 demonstrates FEN nuclease cleavage structures.
[0106] FIG. 2 demonstrates three templates (labeled 1, 2, and 3)
that may be used to detect FEN nuclease activity.
[0107] FIG. 3 is a diagram illustrating a synthesis and cleavage
reaction to generate a signal according to the invention.
[0108] FIG. 4 is a Sypro Orange stained polyacrylamide gel
demonstrating CBP-tagged Pfu FEN-1 protein.
[0109] FIG. 5 is an autoradiograph of a FEN-1 nuclease assay.
[0110] FIG. 6 is a graph representing detection of .beta.-actin
sequences in genomic DNA using fluorescently labeled .beta.-actin
probe in the presence of FEN-1 and a Taq polymerase deficient in 5'
to 3' exonuclease activity.
[0111] FIG. 7 is a graph representing detection of .beta.-actin
sequences in genomic DNA using fluorescently labeled .beta.-actin
probe in the presence of FEN-1 and a Pfu polymerase deficient in 3'
to 5' exonuclease activity.
[0112] FIG. 8 is a representation of an open circle probe for
rolling circle amplification.
[0113] FIG. 9 is a representation of rolling circle
amplification.
[0114] FIG. 10 is a representation of a safety pin probe.
[0115] FIG. 11 is a representation of scorpion probe.
[0116] FIG. 12 is a representation of a sunrise/amplifluor
probe.
DESCRIPTION
[0117] The invention provides for a method of generating a signal
to detect the presence of a target nucleic acid in a sample wherein
a nucleic acid is treated with the combination of a nucleic acid
polymerase and a FEN nuclease. The invention also provides for a
process for detecting or measuring a nucleic acid that allows for
concurrent amplification, cleavage and detection of a target
nucleic acid sequence in a sample.
[0118] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular biology,
microbiology and recombinant DNA techniques, which are within the
skill of the art. Such techniques are explained fully in the
literature. See, e.g., Sambrook, Fritsch & Maniatis, 1989,
Molecular Cloning: A Laboratory Manual, Second Edition;
Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Nucleic Acid
Hybridization (B. D. Harnes & S. J. Higgins, eds., 1984); A
Practical Guide to Molecular Cloning (B. Perbal, 1984); and a
series, Methods in Enzymology (Academic Press, Inc.). All patents,
patent applications, and publications mentioned herein, both supra
and infra, are hereby incorporated by reference.
I. FEN Nucleases
[0119] FEN-1 is an .about.40 kDa divalent metal ion-dependent exo-
and endonuclease that specifically recognizes the backbone of a 5'
single-stranded flap strand and tracks down this arm to the
cleavage site, which is located at the junction wherein the two
strands of duplex DNA adjoin the single-stranded arm. Both the
endo- and exonucleolytic activities show little sensitivity to the
base at the most 5' position at the flap or nick. Both FEN-1 endo-
and exonucleolytic substrate binding and cutting are stimulated by
an upstream oligonucleotide (flap adjacent strand or primer). This
is also the case for E. coli pol I. The endonuclease activity of
the enzyme is independent of the 5' flap length, cleaving a 5' flap
as small as one nucleotide. The endonuclease and exonuclease
activities are insensitive to the chemical nature of the substrate,
cleaving both DNA and RNA.
[0120] Both the endo- and exonucleolytic activities are inhibited
by concentrations of salts in the physiological range. The
exonuclease activity is inhibited 50-fold at 50 mM NaCl as compared
to 0 mM NaCl. The endonuclease activity is inhibited only sevenfold
at 50 mM NaCl (Reviewed in Lieber 1997, supra).
[0121] Although a 5'-OH terminus is a good substrate for FEN-1
loading onto a 5' flap substrate, it serves as a very poor
substrate when part of a nick in an otherwise double stranded DNA
structure. The electrostatic repulsion by the terminal phosphate is
likely to favor breathing of the substrate into a pseudo-flap
configuration, providing the active form of the substrate for
FEN-1. Such an explanation would indicate a single active site and
a single mechanism of loading of FEN-1 onto the 5' ssDNA terminus
of the flap or pseudo-flap configuration of the nick. Consistent
with this model are observations that optimal activity at a nick
requires very low Mg.sup.2+ and monovalent salt concentrations,
which destabilize base-pairing and would favor breathing of a nick
to a flap. Higher Mg.sup.2+ and monovalent salt concentrations
would disfavor breathing and inhibit cutting of nicked or gapped
structures that do require breathing to convert to a flap. Cleavage
of stable flap structures is optimal at moderate Mg.sup.2+ levels
and does not decrease with increasing Mg.sup.2+ concentration. This
is because a flap substrate does not have to melt out base pairs to
achieve its structure; hence, it is entirely insensitive to
Mg.sup.2+. Though the endonucleolytic activity decreases with
monovalent salt, the decline is not nearly as sharp as that seen
for the exonucleolytic activity. Furthermore, it has previously
been shown that one-nucleotide flaps are efficient substrates. All
of these observations are consistent with the fact that when FEN-1
has been interpreted to be functioning as an exonuclease, the size
of the degradation products vary from one to several nucleotides in
length. Breathing of nicks into flaps of varying length would be
expected to vary with local sequence, depending on the G/C content.
In summary, a nick breathing to form a transient flap means that
the exonucleolytic activity of FEN-1 is the same as the
endonucleolytic activity (Reviewed in Lieber, 1997, supra).
[0122] The endonuclease and exonuclease activities of FEN-1 cleave
both DNA and RNA without requiring accessory proteins. At the
replication fork, however, FEN-1 does interact with other proteins,
including a DNA helicase and the proliferating cell nuclear antigen
(PCNA), the processivity factor for DNA polymerases .delta. and
.epsilon.. PCNA significantly stimulates FEN-1 endo- and
exonucleolytic activity.
[0123] The FEN-1 enzymes are functionally related to several
smaller bacteriophage 5'.fwdarw.3' exonucleases such as T5 5'
exonuclease and T4 RNase H as well as to the larger eukaryotic
nucleotide excision repair enzymes such as XPG, which also acts in
the transcription-coupled repair of oxidative base damage. In
eubacteria such as Escherichia coli and Thermus aquaticus, Okazaki
processing is provided by the PolI 5'.fwdarw.3' exonuclease domain.
These bacterial and phage enzymes share two areas of limited
sequence homology with FEN-1, which are termed the N(N-terminal)
and I (intermediate) regions, with the residue similarities
concentrated around seven conserved acidic residues. Based on
crystal structures of T4 RNase H and T5 exonuclease as well as
mutagenesis data, it has been proposed that these residues bind to
two Mg.sup.2+ ions that are required for affecting DNA hydrolysis;
however, the role each metal plays in the catalytic cycle, which is
subtly different for each enzyme, is not well understood (Reviewed
in Hosfield et al., 1998b, supra).
[0124] fen-1 genes encoding FEN-1 enzymes useful in the invention
include murine fen-1, human fen-1, rat fen-1, Xenopus laevis fen-1,
and fen-1 genes derived from four archaebacteria Archaeglobus
fulgidus, Methanococcus jannaschii, Pyrococcus furiosus and
Pyrococcus horikoshii. cDNA clones encoding FEN-1 enzymes have been
isolated from human (GenBank Accession Nos.: NM.sub.--004111 and
L37374), mouse (GenBank Accession No.: L26320), rat (GenBank
Accession No.: AA819793), Xenopus laevis (GenBank Accession Nos.:
U68141 and U64563), and P. furiosus (GenBank Accession No.:
AF013497). The complete nucleotide sequence for P. horikoshii flap
endonuclease has also been determined (GenBank Accession No.:
AB005215). The FEN-1 family also includes the Saccharomyces
cerevisiae RAD27 gene (GenBank Accession No.: Z28113 Y13137) and
the Saccharomyces pombe RAD2 gene (GenBank Accession No.: X77041).
The archaeal genome of Methanobacterium thermautotrophiculum has
also been sequenced. Although the sequence similarity between FEN-1
and prokaryotic and viral 5'.fwdarw.3' exonucleases is low, FEN-1s
within the eukaryotic kingdom are highly conserved at the amino
acid level, with the human and S. cerevisiae proteins being 60%
identical and 78% similar. The three archaebacterial FEN-1 proteins
are also, highly homologous to the eukaryotic FEN-1 enzymes
(Reviewed in Matsui et al., 1999., J. Biol. Chem., 274:18297,
Hosfield et al., 1998b, J. Biol. Chem., 273:27154 and Lieber, 1997,
BioEssays, 19:233).
[0125] The sequence similarities in the two conserved nuclease
domains (N-terminal or N and intermediate or I domains) between
human and other FEN-1 family members are 92% (murine), 79% (S.
cerevisiae), 77% (S. pombe), 72% (A. fulgidus), 76% (M.
jannaschii), and 74% (P. furiosus).
[0126] FEN-1 specifically recognizes the backbone of a 5'
single-stranded flap strand and migrates down this flap arm to the
cleavage site located at the junction between the two strands of
duplex DNA and the single-stranded arm. If the strand upstream of
the flap (sometimes called the flap adjacent strand or primer
strand) is removed, the resulting structure is termed a pseudo-Y
(see FIG. 1). This structure is cleaved by FEN-1, but at 20- to
100-fold lower efficiency. FEN-1 does not cleave 3' single-stranded
flaps. However, FEN-1 acting as an exonuclease will hydrolyze dsDNA
substrates containing a gap or nick (Reviewed in Hosfield et al.,
1998a, supra, Hosfield et al., 1999b, supra and Lieber 1997,
supra). Exonucleolytically, FEN-1 acts at a nick and, with lower
efficiency, at a gap or a recessed 5' end on dsDNA. At gapped
structures, the efficiency of FEN-1 binding and cutting decreases
with increasing gap size up to approximately five nucleotides and
then stabilizes at a level of cleavage that is equivalent to
activity on a recessed 5' end within dsDNA. Blunt dsDNA, recessed
3' ends and ssDNA are not cleaved (Reviewed in Lieber 1997,
supra).
[0127] FEN nucleases that are useful according to the invention
have been isolated from a variety of organisms including human
(GenBank Accession Nos.: NM.sub.--004111 and L37374), mouse
(GenBank Accession No.: L26320), rat (GenBank Accession No.:
AA819793), yeast (GenBank Accession No.: Z28113 Y13137 and GenBank
Accession No.: X77041) and xenopus laevis (GenBank Accession Nos.:
U68141 and U64563). Such enzymes can be cloned and overexpressed
using conventional techniques well known in the art.
[0128] A FEN nuclease according to the invention is preferably
thermostable. Thermostable FEN nucleases have been isolated and
characterized from a variety of thermostable organisms including
four archeaebacteria. The cDNA sequence (GenBank Accession No.:
AF013497) and the amino acid sequence (Hosfield et al., 1998a,
supra and Hosfield et al., 1998b) for P. furiosus flap endonuclease
have been determined. The complete nucleotide sequence (GenBank
Accession No.: AB005215) and the amino acid sequence (Matsui et
al., supra) for P. horikoshii flap endonuclease have also been
determined. The amino acid sequence for M. jannaschii (Hosfield et
al., 1998b and Matsui et al., 1999 supra) and A. fulgidus (Hosfield
et al., 1998b) flap endonuclease have also been determined.
[0129] Thermostable FEN1 enzymes can be cloned and overexpressed
using techniques well known in the art and described in Hosfield et
al., 1998a, supra, Hosfield et al., 1998b, Kaiser et al., 1999, J.
Biol. Chem., 274: 21387 and Matusi et al., supra and herein in
Example 2 entitled "Cloning Pfu FEN-1".
[0130] The endonuclease activity of a FEN enzyme can be measured by
a variety of methods including the following.
A. FEN Endonuclease Activity Assay
[0131] 1. Templates (for example as shown in FIG. 2) are used to
evaluate the activity of a FEN nuclease according to the
invention.
[0132] Template 1 is a 5' .sup.33P labeled oligonucleotide
(Heltest4) with the following sequence:
5'AAAATAAATAAAAAAAATACTGTTGGGAAGGGCGATCGGTGCG3' The underlined
section of Heltest4 represents the region complementary to
M13mp18+. The cleavage product is an 18 nucleotide fragment with
the sequence AAAATAAATAAAAAAAAT.
[0133] Heltest4 binds to M13 to produce a complementary double
stranded domain as well as a non-complementary 5' overhang. This
duplex forms template 2 (FIG. 2) which is also used for helicase
assays. Template 3 (FIG. 2) has an additional primer (FENAS) bound
to M13 and is directly adjacent to Heltest 4. The sequence of FENAS
is: 5' CCATTCGCCATTCAGGCTGCGCA 3'. In the presence of template 3,
FEN binds the free 5' terminus of Heltest4, migrates to the
junction and cleaves Heltest4 to produce an 18 nucleotide fragment.
Templates 1 and 2 serve as controls, although template 2 can also
serve as a template.
[0134] Templates are prepared as described below: TABLE-US-00001
Template 1 Template 2 Template 3 Heltest4 14 .mu.l 14 .mu.l 14
.mu.l M13 ** 14 .mu.l 14 .mu.l FENAS ** ** 14 .mu.l H.sub.2O 28
.mu.l 14 .mu.l ** 10.times. Pfu Buff. 4.6 .mu.l 4.6 .mu.l 4.6
.mu.l
[0135] 10.times.Pfu buffer is available from Stratagene (Catalog
#200536). According to the method of the invention, 10.times.Pfu
buffer is diluted such that a reaction is carried out in the
presence of 1.times. buffer.
[0136] M13 is M13mp18+ strand and is at a concentration of 200
ng/.mu.L, .sup.33P labeled Heltest4 is at an approximate
concentration of 0.7 ng/.mu.l, and FENAS is at a concentration of
4.3 ng/.mu.l. Based on these concentrations, the Heltest4 and M13
are at approximately equal molar amounts (5.times.10.sup.-14) and
FENAS is present in an approximately 10.times. molar excess
(6.times.10.sup.-13).
[0137] The template mixture is heated at 95.degree. C. for five
minutes, cooled to room temperature for 45 minutes and stored at
4.degree. C. overnight.
[0138] 2 .mu.l of FEN-1 or, as a control, H.sub.2O are mixed with
the three templates as follows:
3 .mu.l template
0.7 .mu.l 10.times. cloned Pfu buffer
0.56 .mu.l 100 mM MgCl.sub.2
2.00 .mu.l enzyme or H.sub.2O
0.74 .mu.l H.sub.20
7.00 .mu.l total volume
[0139] The reactions are allowed to proceed for 30 minutes at
50.degree. C. and stopped by the addition of 2 .mu.l formamide
"Sequencing Stop" solution to each sample. Samples are heated at
95.degree. C. for five minutes and loaded on a 6% acrylamide, 7M
urea CastAway (Stratagene) gel.
[0140] Alternatively, FEN activity can be analyzed in the following
buffer wherein a one hour incubation time is utilized.
10.times.FEN Buffer
500 mM Tris-HCl pH 8.0
100 mM MgCl.sub.2
[0141] The reaction mixture below is mixed with 2 .mu.l of FEN or,
as a control, 211 of H.sub.2O.
3 .mu.l template
0.7 .mu.l 10.times. cloned Pfu buffer
0.56 .mu.l 100 mM MgCl.sub.2
2.00 .mu.l enzyme or H.sub.2O
1.3 .mu.l H.sub.2O
7.00 .mu.l total volume
[0142] Samples are incubated for one hour at 50.degree. C. in a
Robocyler 96 hot top thermal cycler. Following the addition of 2
.mu.l of Sequencing Stop dye solution, samples are heated at
99.degree. C. for five minutes. Samples are loaded on an
eleven-inch long, hand-poured, 20% acrylamide/bis acrylamide, 7M
urea gel. The gel is run at 20 watts until the bromophenol blue has
migrated approximately 2/3 the total distance. The gel is removed
from the glass plates and soaked for 10 minutes in fix (15%
methanol, 5% acetic acid) and then for 10 minutes in water. The gel
is placed on Whatmann 3 mm paper, covered with plastic wrap and
dried for 2 hours in a heated vacuum gel dryer. The gel is exposed
overnight to X-ray film.
[0143] 2. FEN endonuclease activity can also be measured according
to the method of Kaiser et al., supra). Briefly, reactions are
carried out in a 10 .mu.l volume containing 10 mM MOPS, pH 7.5,
0.05% Tween 20, 0.05% Nonidet P-40, 10 .mu.g/ml tRNA, and 200 mM
KCl for TaqPol and TthPol or 50 mM KCl for all other enzymes.
Reaction conditions can be varied depending on the cleavage
structure being analyzed. Substrates (2 .mu.M) and varying amounts
of enzyme are mixed with the indicated (above) reaction buffer and
overlaid with Chill-out (MJ Research) liquid wax. Substrates are
heat denatured at 90.degree. C. for 20 s and cooled to 50.degree.
C., then reactions are started by addition of MgCl.sub.2 or
MnCl.sub.2 and incubated at 50.degree. C. for the specified length
of time. Reactions are stopped by the addition of 10 .mu.l of 95%
formamide containing 10 mM EDTA and 0.02% methyl violet (Sigma).
Samples are heated to 90.degree. C. for 1 min immediately before
electrophoresis on a 20% denaturing acrylamide gel (19:1
cross-linked), with 7M urea, and in a buffer of 45 mM Tris borate,
pH 8.3, 1.4 mM EDTA. Unless otherwise indicated, 1 .mu.l of each
stopped reaction is loaded per lane. Gels are scanned on an
FMBIO-100 fluorescent gel scanner (Hitachi) using a 505-nm filter.
The fraction of cleaved product is determined from intensities of
bands corresponding to uncut and cut substrate with FMBIO Analysis
software (version 6.0, Hitachi). The fraction of cut product should
not exceed 20% to ensure that measurements approximate initial
cleavage rates. The cleavage rate is defined as the concentration
of cut product divided by the enzyme concentration and the time of
the reaction (in minutes). For each enzyme three data points are
used to determine the rate and experimental error.
[0144] 3. FEN endonuclease activity can also be measured according
to the method of Hosfield et al., 1998a, supra. Briefly, in a final
volume of 13 .mu.l, varying amounts of FEN and 1.54 pmol of labeled
cleavage substrate are incubated at different temperatures for 30
min before the reaction is quenched with an equal volume of stop
solution (10 mM EDTA, 95% deionized formamide, and 0.008%
bromophenol blue and xylene cyanol). Samples are electrophoresed
through denaturing 15% polyacrylamide gels, and the relative
amounts of starting material and product are quantitated using the
IPLabGel system (Stratagene) running MacBAS image analysis
software. Most reactions are performed in standard assay buffer (10
mM Tris-HCl (pH 8.0), 10 mM MgCl.sub.2, and 50 .mu.g/ml bovine
serum albumin); however, in a series of experiments the effect of
different divalent metals and pH levels are studied by varying the
standard buffer. For divalent metals, MgCl.sub.2 is omitted, and
different metal ions are used at a final concentration of 10 mM. To
study the influence of pH, buffers containing different amounts of
Tris-HCl, glycine, and sodium acetate are used at a final
concentration of 10 mM to obtain a wide range of pH levels at
25.degree. C.
[0145] 4. FEN endonuclease activity can also be measured according
to the method of Matusi et al., 1999, supra. Briefly, the enzyme
are performed in a 15-.mu.l reaction mixture containing 50 mM
Tris-HCl (pH 7.4), 1.5 mM MgCl.sub.2, 0.5 mM
.beta.-mercaptoethanol, 100 .mu.g/ml bovine serum albumin, and 0.6
pmol of a labeled cleavage structure. After incubation for 30 min
at 60.degree. C., the reaction is terminated by adding 15 .mu.l of
95% formamide containing 10 mM EDTA and 1 mg/ml bromphenol blue.
The samples are heated at 95.degree. C. for 10 min, loaded onto a
15% polyacrylamide gel (35 cm.times.42.5 cm) containing 7M urea and
10.times.TBE (89 mM Tris-HCl, 89 mM boric acid, 2 mM EDTA (ph
8.0)), and then electrophoresed for 2 h at 2000 V. Reaction
products are visualized and quantified using a PhosphorImager
(Bio-Rad). Size marker, oligonucleotides are 5' end-labeled with
[.gamma.-.sup.32P]ATP and T4 polynucleotide kinase.
[0146] To determine the optimum pH, the reaction is performed in an
assay mixture (15 .mu.l) containing 1.5 mM MgCl.sub.2, 0.5 mM
.beta.-mercaptoethanol, 100 .mu.g/ml bovine serum albumin, and 0.6
pmol of 5' end-labeled cleavage structure in 50 mM of one of the
following buffers at 60.degree. C. for 30 min. Three different 50
mM buffers are used to obtain a wide pH range as follows: sodium
acetate buffer (pH 4.0-5.5), phosphate buffer (pH 5.5-8.0), and
borate buffer (pH 8.0-9.4).
B. FEN Exonuclease Activity Assay
[0147] The exonuclease activity of a FEN nuclease according to the
invention can be measured by the method of measuring FEN-1
endonuclease activity described in Matsui et al., 1999, supra and
summarized above.
[0148] Alternatively, the exonuclease activity of a FEN enzyme can
be analyzed by the method described in Hosfield et al., 1998b,
supra. Briefly, exonuclease activities are assayed using a nicked
substrate of FEN under conditions identical to those described for
the endonuclease assays (described above).
[0149] The precise positions of DNA cleavage in both the
exonuclease and endonuclease experiments can be obtained by partial
digestion of a 5' .sup.32P-labeled template strand using the 3'-5'
exonuclease activity of Klenow fragment.
[0150] A cleavage structure according to the invention comprises a
partially displaced 5' end of an oligonucleotide annealed to a
target nucleic acid sequence. Another cleavage structure according
to the invention comprises a target nucleic acid sequence (for
example B in FIG. 3), an upstream oligonucleotide that is
complementary to the target sequence (for example A in FIG. 3), and
a downstream oligonucleotide that is complementary to the target
sequence (for example C in FIG. 3). A cleavage structure according
to the invention can be formed by overlap between the upstream
oligonucleotide and the downstream probe, or by extension of the
upstream oligonucleotide by the synthetic activity of a nucleic
acid polymerase, and subsequent partial displacement of the 5' end
of the downstream oligonucleotide. A cleavage structure of this
type is formed according to the method described in the section
entitled "Cleavage Structure".
[0151] Alternatively, a cleavage structure according to the
invention is formed by annealing a target nucleic acid sequence to
an oligonucleotide wherein the oligonucleotide comprises a
complementary region that anneals to the target nucleic acid
sequence, and a non-complementary region that does not anneal to
the target nucleic acid sequence and forms a 5' flap. According to
this embodiment, a cleavage structure comprises a 5' flap formed by
a non-complementary region of the oligonucleotide.
[0152] A cleavage structure according to the invention also
comprises an overlapping flap wherein the 3' end of an upstream
oligonucleotide capable of annealing to a target nucleic acid
sequence (for example A in FIG. 3) is complementary to 1 (or more)
base pair of the downstream oligonucleotide (for example C in FIG.
3) that is annealed to a target nucleic acid sequence and wherein
the 1 (or more) base pair overlap is directly downstream of the
point of extension of the single stranded flap and is formed
according to method described in the section entitled "Cleavage
Structure".
II. Nucleic Acid Polymerases
[0153] The invention provides for nucleic acid polymerases.
Preferably, the nucleic acid polymerase according to the invention
is thermostable.
[0154] Known DNA polymerases include, for example, E. coli DNA
polymerase I, Thermus thermophilus (Tth) DNA polymerase, Bacillus
stearothermophilus DNA polymerase, Thermococcus litoralis DNA
polymerase, Thermus aquaticus (Taq) DNA polymerase and Pyrococcus
furiosus (Pfu) DNA polymerase.
[0155] Nucleic acid polymerases substantially lacking 5' to 3'
exonuclease activity useful according to the invention include but
are not limited to Klenow and Klenow exo-, and T7 DNA polymerase
(Sequenase).
[0156] Thermostable nucleic acid polymerases substantially lacking
5' to 3' exonuclease activity useful according to the invention
include but are not limited to Pfu, exo-Pfu (a mutant form of Pfu
that lacks 3' to 5' exonuclease activity), the Stoffel fragment of
Taq, N-truncated Bst, N-truncated Bca, Genta, JdF3 exo-, Vent, Vent
exo- (a mutant form of Vent that lacks 3' to 5' exonuclease
activity), Deep Vent, Deep Vent exo- (a mutant form of Deep Vent
that lacks 3' to 5' exonuclease activity), U1Tma, and
ThermoSequenase.
[0157] Nucleic acid polymerases useful according to the invention
include both native polymerases as well as polymerase mutants,
which lack 5' to 3' exonuclease activity. Nucleic acid polymerases
useful according to the invention can possess different degrees of
thermostability. Preferably, a nucleic acid polymerase according to
the invention exhibits strand displacement activity at the
temperature at which it can extend a nucleic acid primer. In a
preferred embodiment of the invention, a nucleic acid polymerase
lacks both 5' to 3' and 3' to 5' exonuclease activity.
[0158] Additional nucleic acid polymerases substantially lacking 5'
to 3' exonuclease activity with different degrees of
thermostability useful according to the invention are listed
below.
A. Bacteriophage DNA Polymerases (Useful for 37.degree. C.
Assays):
[0159] Bacteriophage DNA polymerases are devoid of 5' to 3'
exonuclease activity, as this activity is encoded by a separate
polypeptide. Examples of suitable DNA polymerases are T4, T7, and
.phi.29 DNA polymerase. The enzymes available commercially are: T4
(available from many sources e.g., Epicentre) and T7 (available
from many sources, e.g. Epicentre for unmodified and USB for 3' to
5' exo.sup.- T7 "Sequenase" DNA polymerase).
B. Archaeal DNA Polymerases:
[0160] There are 2 different classes of DNA polymerases which have
been identified in archaea: 1. Family B/pol .alpha. type (homologs
of Pfu from Pyrococcus furiosus) and 2. pol II type (homologs of P.
furiosus DP1/DP2 2-subunit polymerase). DNA polymerases from both
classes have been shown to naturally lack an associated 5' to 3'
exonuclease activity and to possess 3' to 5' exonuclease
(proofreading) activity. Suitable DNA polymerases (pol .alpha. or
pol II) can be derived from archaea with optimal growth
temperatures that are similar to the desired assay temperatures.
Examples of suitable archaea include, but are not limited to:
[0161] 1. Thermolabile (useful for 37.degree. C. assays)--e.g.,
Methanococcus voltae
[0162] 2. Thermostable (useful for non-PCR assays)--e.g.,
Sulfolobus solfataricus, Sulfolobus acidocaldarium, Methanococcus
jannaschi, Thermoplasma acidophilum. It is estimated that suitable
archaea exhibit maximal growth temperatures of
.ltoreq.80-85.degree. C. or optimal growth temperatures of
.ltoreq.70-80.degree. C.
[0163] 3. Thermostable (useful for PCR assays)--e.g., Pyrococcus
species (furiosus, species GB-D, species strain KOD1, woesii,
abysii, horikoshii), Thermococcus species (litoralis, species
9.degree. North-7, species JDF-3, gorgonarius), Pyrodictium
occultum, and Archaeoglobus fulgidus. It is estimated that suitable
archaea would exhibit maximal growth temperatures of
.gtoreq.80-85.degree. C. or optimal growth temperatures of
.gtoreq.70-80.degree. C. Appropriate PCR enzymes from the archaeal
pol a DNA polymerase group are commercially available, including
KOD (Toyobo), Pfx (Life Technologies, Inc.), Vent (New England
BioLabs), Deep Vent (New England BioLabs), and Pwo
(Boehringer-Mannheim).
[0164] Additional archaea related to those listed above are
described in the following references: Archaea: A Laboratory Manual
(Robb, F. T. and Place, A. R., eds.), Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1995 and Thermophilic Bacteria
(Kristjansson, J. K., ed.) CRC Press, Inc., Boca Raton, Fla.,
1992.
C. Eubacterial DNA Polymerases:
[0165] There are 3 classes of eubacterial DNA polymerases, pol I,
II, and III. Enzymes in the Pol I DNA polymerase family possess 5'
to 3' exonuclease activity, and certain members also exhibit 3' to
5' exonuclease activity. Pol II DNA polymerases naturally lack 5'
to 3' exonuclease activity, but do exhibit 3' to 5' exonuclease
activity. Pol III DNA polymerases represent the major replicative
DNA polymerase of the cell and are composed of multiple subunits.
The pol III catalytic subunit lacks 5' to 3' exonuclease activity,
but in some cases 3' to 5' exonuclease activity is located in the
same polypeptide.
[0166] There are no commercial sources of eubacterial pol II and
pol III DNA polymerases.
[0167] There are a variety of commercially available Pol I DNA
polymerases, some of which have been modified to reduce or abolish
5' to 3' exonuclease activity. Methods used to eliminate 5' to 3'
exonuclease activity of pol I DNA polymerases include: [0168]
mutagenesis (as described in Xu et al., 1997, J. Mol. Biol.,
268:284 and Kim et al., 1997, Mol. Cells, 7:468). [0169]
N-truncation by proteolytic digestion (as described in Klenow et
al., 1971, Eur. J. Biochem., 22: 371), or [0170] N-truncation by
cloning and expressing as C-terminal fragments (as described in
Lawyer et al., 1993, PCR Methods Appl., 2:275).
[0171] As for archaeal sources, the assay-temperature requirements
determine which eubacteria should be used as a source of a DNA
polymerase useful according to the invention (e.g., mesophiles,
thermophiles, hyperthermophiles).
[0172] 1. Mesophilic/Thermolabile (Useful for 37.degree. C. Assays)
[0173] i. DNA polymerases naturally substantially lacking 5' to 3'
exonuclease activity: pol II or the pol III catalytic subunit from
mesophilic eubacteria, such as Escherchia coli, Streptococcus
pneumoniae, Haemophilus influenza, Mycobacterium species
(tuberculosis, leprae) [0174] ii. DNA polymerase mutants
substantially lacking 5' to 3' exonuclease activity: Pol I DNA
polymerases for N-truncation or mutagenesis can be isolated from
the mesophilic eubacteria listed above (Ci). A
commercially-available eubacterial DNA polymerase pol I fragment is
the Klenow fragment (N-truncated E. coli pol I; Stratagene).
[0175] 2. Thermostable (Useful for Non PCR Assays) [0176] i. DNA
polymerases naturally substantially lacking 5' to 3' exonuclease
activity: Pol II or the pol III catalytic subunit from thermophilic
eubacteria, such as Bacillus species (e.g., stearothermophilus,
caldotenax, caldovelox) [0177] ii. DNA polymerase mutants
substantially lacking 5' to 3' exonuclease activity: Suitable pol I
DNA polymerases for N-truncation or mutagenesis can be isolated
from thermophilic eubacteria such as the Bacillus species listed
above. Thermostable N-truncated fragments of B. stearothermophilus
DNA polymerase pol I are commercially available and sold under the
trade names Bst DNA polymerase I large fragment (Bio-Rad and
Isotherm DNA polymerase (Epicentre)). A C-terminal fragment of
Bacillus caldotenax pol I is available from Panvera (sold under the
tradename Ladderman).
[0178] 3. Thermostable (Useful for PCR Assays) [0179] i. DNA
polymerases naturally substantially lacking 5' to 3' exonuclease
activity: Pol II or pol III catalytic subunit from Thermus species
(aquaticus, thermophilus, flavus, ruber, caldophilus, filiformis,
brokianus) or from Thermotoga maritima. The catalytic pol III
subunits from Thermus thermophilus and Thermus aquaticus are
described in Yi-Ping et al., 1999, J. Mol. Evol., 48:756 and
McHenry et al., 1997, J. Mol. Biol., 272:178. [0180] ii. DNA
polymerase mutants substantially lacking 5' to 3' exonuclease
activity: Suitable pol I DNA polymerases for N-truncation or
mutagenesis can be isolated from a variety of thermophilic
eubacteria, including Thermus species and Thermotoga maritima (see
above). Thermostable fragments of Thermus aquaticus DNA polymerase
pol I (Taq) are commercially available and sold under the trade
names KlenTaq1 (Ab Peptides), Stoffel fragment (Perkin-Elmer), and
ThermoSequenase (Amersham). In addition to C-terminal fragments, 5'
to 3' exonuclease.sup.- Taq mutants are also commercially
available, such as TaqFS (Hoffman-LaRoche). In addition to 5'-3'
exonuclease.sup.- versions of Taq, an N-truncated version of
Thermotoga maritima DNA polymerase I is also commercially available
(tradename U1Tma, Perkin-Elmer).
[0181] Additional eubacteria related to those listed above are
described in Thermophilic Bacteria (Kristjansson, J. K., ed.) CRC
Press, Inc., Boca Raton, Fla., 1992.
D. Eukaryotic 5' to 3' Exonuclease.sup.- DNA Polymerases (Useful
for 37.degree. C. Assays)
[0182] There are several DNA polymerases that have been identified
in eukaryotes, including DNA pol a (replication/repair), .delta.
(replication), .epsilon. (replication), .beta. (repair) and .gamma.
(mitochondrial replication). Eukaryotic DNA polymerases are devoid
of 5' to 3' exonuclease activity, as this activity is encoded by a
separate polypeptide (e.g., mammalian FEN-1 or yeast RAD2).
Suitable thermolabile DNA polymerases may be isolated from a
variety of eukaryotes (including but not limited to yeast,
mammalian cells, insect cells, Drosophila) and eukaryotic viruses
(e.g., EBV, adenovirus).
[0183] It is possible that DNA polymerase mutants lacking 3'-5'
exonuclease (proofreading) activity, in addition to lacking 5' to
3' exonuclease activity, could exhibit improved performance in
FEN-based detection strategies. For example, reducing or abolishing
inherent 3' to 5' exonuclease activity may lower background signals
by diminishing non-specific exonucleolytic degradation of labeled
probes. Three 3' to 5' exonuclease motifs have been identified, and
mutations in these regions have been shown to abolish 3' to 5'
exonuclease activity in Klenow, .phi.29, T4, T7, and Vent DNA
polymerases, yeast Pol .alpha., Pol .beta., and Pol .gamma., and
Bacillus subtilis Pol III (reviewed in Derbeyshire et al., 1995,
Methods. Enzymol. 262:363). Methods for preparing additional DNA
polymerase mutants, with reduced or abolished 3' to 5' exonuclease
activity, are well known in the art.
[0184] Commercially-available enzymes that lack both 5' to 3' and
3' to 5' exonuclease activities include Sequenase (exo.sup.- T7;
USB), Pfu exo.sup.- (Stratagene), exo.sup.- Vent (New England
BioLabs), exo.sup.- DeepVent (New England BioLabs), exo.sup.-
Klenow fragment (Stratagene), Bst (Bio-Rad), Isotherm (Epicentre),
Ladderman (Panvera), KlenTaq1 (Ab Peptides), Stoffel fragment
(Perkin-Elmer), ThermoSequenase (USB), and TaqFS
(Hoffman-LaRoche).
[0185] If polymerases other than Pfu are used, buffers and
extension temperatures are selected to allow for optimal activity
by the particular polymerase useful according to the invention.
Buffers and extension temperatures useful for polymerases according
to the invention are know in the art and can also be determined
from the Vendor's specifications.
III. Nucleic Acids
[0186] A. Nucleic Acid Sequences Useful in the Invention
[0187] The invention provides for methods of detecting or measuring
a target nucleic acid sequence; and also utilizes oligonucleotides,
primers and probes for forming a cleavage structure according to
the invention and primers for amplifying a template nucleic acid
sequence. As used herein, the terms "nucleic acid",
"polynucleotide" and "oligonucleotide" refer to primers, probes,
and oligomer fragments to be detected, and shall be generic to
polydeoxyribonucleotides (containing 2-deoxy-D-ribose), to
polyribonucleotides (containing D-ribose), and to any other type of
polynucleotide which is an N-glycoside of a purine or pyrimidine
base, or modified purine or pyrimidine bases (including abasic
sites). There is no intended distinction in length between the term
"nucleic acid", "polynucleotide" and "oligonucleotide", and these
terms will be used interchangeably. These terms refer only to the
primary structure of the molecule. Thus, these terms include
double- and single-stranded DNA, as well as double- and
single-stranded RNA.
[0188] The complement of a nucleic acid sequence as used herein
refers to an oligonucleotide which, when aligned with the nucleic
acid sequence such that the 5' end of one sequence is paired with
the 3' end of the other, is in "antiparallel association."
[0189] The oligonucleotide is not necessarily physically derived
from any existing or natural sequence but may be generated in any
manner, including chemical synthesis, DNA replication, reverse
transcription or a combination thereof. The terms "oligonucleotide"
or "nucleic acid" intend a polynucleotide of genomic DNA or RNA,
cDNA, semisynthetic, or synthetic origin which, by virtue of its
synthetic origin or manipulation: (1) is not associated with all or
a portion of the polynucleotide with which it is associated in
nature; and/or (2) is linked to a polynucleotide other than that to
which it is linked in nature.
[0190] Oligonucleotides, according to the present invention,
additionally comprise nucleic acid sequences which function as
probes and can have secondary structure such as hairpins and
stem-loops. Such oligonucleotide probes include, but are not
limited to the molecular beacons, safteypins, scorpions, and
sunrise/amplifluor probes described herein.
[0191] Because mononucleotides are reacted to make oligonucleotides
in a manner such that the 5' phosphate of one mononucleotide
pentose ring is attached to the 3' oxygen of its neighbor in one
direction via a phosphodiester linkage, an end of oligonucleotide
is referred to as the "5' end" if its 5' phosphate is not linked to
the 3' oxygen of a mononucleotide pentose ring and as the "3' end"
if its 3' oxygen is not linked to a 5' phosphate of a subsequent
mononucleotide pentose ring. As used herein, a nucleic acid
sequence, even if internal to a larger oligonucleotide, also may be
said to have 5' and 3' ends.
[0192] When two different, non-overlapping oligonucleotides anneal
to different regions of the same linear complementary nucleic acid
sequence, and the 3' end of one oligonucleotide points toward the
5' end of the other, the former may be called the "upstream"
oligonucleotide and the latter the "downstream"
oligonucleotide.
[0193] Certain bases not commonly found in natural nucleic acids
may be included in the nucleic acids of the present invention and
include, for example, inosine and 7-deazaguanine. Complementarity
need not be perfect; stable duplexes may contain mismatched base
pairs or unmatched bases. Those skilled in the art of nucleic acid
technology can determine duplex stability empirically considering a
number of variables including, for example, the length of the
oligonucleotide, base composition and sequence of the
oligonucleotide, ionic strength, and incidence of mismatched base
pairs.
[0194] Stability of a nucleic acid duplex is measured by the
melting temperature, or "T.sub.m". The T.sub.m of a particular
nucleic acid duplex under specified conditions is the temperature
at which half of the base pairs have disassociated.
[0195] B. Primers and Probes Useful According to the Invention
[0196] The invention provides for oligonucleotide primers and
probes useful for detecting or measuring a nucleic acid, for
amplifying a template nucleic acid sequence, and for forming a
cleavage structure according to the invention.
[0197] The term "primer" may refer to more than one primer and
refers to an oligonucleotide, whether occurring naturally, as in a
purified restriction digest, or produced synthetically, which is
capable of acting as a point of initiation of synthesis along a
complementary strand when placed under conditions in which
synthesis of a primer extension product which is complementary to a
nucleic acid strand is catalyzed. Such conditions include the
presence of four different deoxyribonucleoside triphosphates and a
polymerization-inducing agent such as DNA polymerase or reverse
transcriptase, in a suitable buffer ("buffer" includes substituents
which are cofactors, or which affect pH, ionic strength, etc.), and
at a suitable temperature. The primer is preferably single-stranded
for maximum efficiency in amplification.
[0198] Oligonucleotide primers useful according to the invention
are single-stranded DNA or RNA molecules that are hybridizable to a
template nucleic acid sequence and prime enzymatic synthesis of a
second nucleic acid strand. The primer is complementary to a
portion of a target molecule present in a pool of nucleic acid
molecules. It is contemplated that oligonucleotide primers
according to the invention are prepared by synthetic methods,
either chemical or enzymatic. Alternatively, such a molecule or a
fragment thereof is naturally-occurring, and is isolated from its
natural source or purchased from a commercial supplier.
Oligonucleotide primers and probes are 5 to 100 nucleotides in
length, ideally from 17 to 40 nucleotides, although primers and
probes of different length are of use. Primers for amplification
are preferably about 17-25 nucleotides. Primers for the production
of a cleavage structure according to the invention are preferably
about 17-45 nucleotides. Primers useful according to the invention
are also designed to have a particular melting temperature (Tm) by
the method of melting temperature estimation. Commercial programs,
including Oligo.TM., Primer Design and programs available on the
internet, including Primer3 and Oligo Calculator can be used to
calculate a Tm of a nucleic acid sequence useful according to the
invention. Preferably, the Tm of an amplification primer useful
according to the invention, as calculated for example by Oligo
Calculator, is preferably between about 45 and 65.degree. C. and
more preferably between about 50 and 60.degree. C. Preferably, the
Tm of a probe useful according to the invention is 7.degree. C.
higher than the Tm of the corresponding amplification primers.
[0199] As used herein, "probe" refers to a labeled primer useful
for preparation of a cleavage structure according to the invention.
Pairs of single-stranded DNA primers can be annealed to sequences
within a target nucleic acid sequence or can be used to prime
amplifying DNA synthesis of a target nucleic acid sequence.
[0200] Typically, selective hybridization occurs when two nucleic
acid sequences are substantially complementary (at least about 65%
complementary over a stretch of at least 14 to 25 nucleotides,
preferably at least about 75%, more preferably at least about 90%
complementary). See Kanehisa, M., 1984, Nucleic Acids Res. 12: 203,
incorporated herein by reference. As a result, it is expected that
a certain degree of mismatch at the priming site is tolerated. Such
mismatch may be small, such as a mono-, di- or tri-nucleotide.
Alternatively, a region of mismatch may encompass loops, which are
defined as regions in which there exists a mismatch in an
uninterrupted series of four or more nucleotides.
[0201] Numerous factors influence the efficiency and selectivity of
hybridization of the primer to a second nucleic acid molecule.
These factors, which include primer length, nucleotide sequence
and/or composition, hybridization temperature, buffer composition
and potential for steric hindrance in the region to which the
primer is required to hybridize, will be considered when designing
oligonucleotide primers according to the invention.
[0202] A positive correlation exists between primer length and both
the efficiency and accuracy with which a primer will anneal to a
target sequence. In particular, longer sequences have a higher
melting temperature (T.sub.M) than do shorter ones, and are less
likely to be repeated within a given target sequence, thereby
minimizing promiscuous hybridization. Primer sequences with a high
G-C content or that comprise palindromic sequences tend to
self-hybridize, as do their intended target sites, since
unimolecular, rather than bimolecular, hybridization kinetics are
generally favored in solution. However, it is also important to
design a primer that contains sufficient numbers of G-C nucleotide
pairings since each G-C pair is bound by three hydrogen bonds,
rather than the two that are found when A and T bases pair to bind
the target sequence, and therefore forms a tighter, stronger bond.
Hybridization temperature varies inversely with primer annealing
efficiency, as does the concentration of organic solvents, e.g.
formamide, that might be included in a priming reaction or
hybridization mixture, while increases in salt concentration
facilitate binding. Under stringent annealing conditions, longer
hybridization probes, or synthesis primers, hybridize more
efficiently than do shorter ones, which are sufficient under more
permissive conditions. Stringent hybridization conditions typically
include salt concentrations of less than about 1M, more usually
less than about 500 mM and preferably less than about 200 mM.
Hybridization temperatures range from as low as 0.degree. C. to
greater than 22.degree. C., greater than about 30.degree. C., and
(most often) in excess of about 37.degree. C. Longer fragments may
require higher hybridization temperatures for specific
hybridization. As several factors affect the stringency of
hybridization, the combination of parameters is more important than
the absolute measure of a single factor.
[0203] Oligonucleotide primers can be designed with these
considerations in mind and synthesized according to the following
methods.
[0204] 1. Oligonucleotide Primer Design Strategy
[0205] The design of a particular oligonucleotide primer for the
purpose of sequencing, PCR or for the preparation of a cleavage
structure according to the invention, involves selecting a sequence
that is capable of recognizing the target sequence, but has a
minimal predicted secondary structure. The oligonucleotide sequence
binds only to a single site in the target nucleic acid sequence.
Furthermore, the Tm of the oligonucleotide is optimized by analysis
of the length and GC content of the oligonucleotide. Furthermore,
when designing a PCR primer useful for the amplification of genomic
DNA, the selected primer sequence does not demonstrate significant
matches to sequences in the GenBank database (or other available
databases).
[0206] The design of a primer is facilitated by the use of readily
available computer programs, developed to assist in the evaluation
of the several parameters described above and the optimization of
primer sequences. Examples of such programs are "PrimerSelect" of
the DNAStar.TM. software package (DNAStar, Inc.; Madison, Wis.),
OLIGO 4.0 (National Biosciences, Inc.), PRIMER, Oligonucleotide
Selection Program, PGEN and Amplify (described in Ausubel et al.,
1995, Short Protocols in Molecular Biology, 3rd Edition, John Wiley
& Sons). In one embodiment, primers are designed with sequences
that serve as targets for other primers to produce a PCR product
that has known sequences on the ends which serve as targets for
further amplification (e.g. to sequence the PCR product). If many
different target nucleic acid sequences are amplified with specific
primers that share a common `tail` sequence`, the PCR products from
these distinct genes can subsequently be sequenced with a single
set of primers. Alternatively, in order to facilitate subsequent
cloning of amplified sequences, primers are designed with
restriction enzyme site sequences appended to their 5' ends. Thus,
all nucleotides of the primers are derived from a target nucleic
acid sequence or sequences adjacent to a target nucleic acid
sequence, except for the few nucleotides necessary to form a
restriction enzyme site. Such enzymes and sites are well known in
the art. If the genomic sequence of a target nucleic acid sequence
and the sequence of the open reading frame of a target nucleic acid
sequence are known, design of particular primers is well within the
skill of the art.
[0207] It is well known by those with skill in the art that
oligonucleotides can be synthesized with certain chemical and/or
capture moieties, such that they can be coupled to solid supports.
Suitable capture moieties include, but are not limited to, biotin,
a hapten, a protein, a nucleotide sequence, or a chemically
reactive moiety. Such oligonucleotides may either be used first in
solution, and then captured onto a solid support, or first attached
to a solid support and then used in a detection reaction. An
example of the latter would be to couple a downstream probe
molecule to a solid support, such that the 5' end of the downstream
probe molecule comprised a fluorescent quencher. The same
downstream probe molecule would also comprise a fluorophore in a
location such that a FEN nuclease cleavage would physically
separate the quencher from the fluorophore. For example, the target
nucleic acid could hybridize with the solid-phase downstream probe
oligonucleotide, and a liquid phase upstream primer could also
hybridize with the target molecule, such that a FEN cleavage
reaction occurs on the solid support and liberates the 5' quencher
moiety from the complex. This would cause the solid support-bound
fluorophore to be detectable, and thus reveal the presence of a
cleavage event upon a suitably labeled or identified solid support.
Different downstream probe molecules could be bound to different
locations on an array. The location on the array would identify the
probe molecule, and indicate the presence of the template to which
the probe molecule can hybridize.
[0208] 2. Synthesis
[0209] The primers themselves are synthesized using techniques that
are also well known in the art. Methods for preparing
oligonucleotides of specific sequence are known in the art, and
include, for example, cloning and restriction digest analysis of
appropriate sequences and direct chemical synthesis. Once designed,
oligonucleotides are prepared by a suitable chemical synthesis
method, including, for example, the phosphotriester method
described by Narang et al., 1979, Methods in Enzymology, 68:90, the
phosphodiester method disclosed by Brown et al., 1979, Methods in
Enzymology, 68:109, the diethylphosphoramidate method disclosed in
Beaucage et al., 1981, Tetrahedron Letters, 22:1859, and the solid
support method disclosed in U.S. Pat. No. 4,458,066, or by other
chemical methods using either a commercial automated
oligonucleotide synthesizer (which is commercially available) or
VLSIPS.TM. technology.
[0210] C. Probes
[0211] The invention provides for probes useful for forming a
labeled cleavage structure as defined herein. Methods of preparing
a labeled cleavage structure according to the invention are
provided in the section entitled "Cleavage Structure" below.
[0212] As used herein, the term "probe" refers to a labeled
oligonucleotide which forms a duplex structure with a sequence in
the target nucleic acid, due to complementarity of at least one
sequence in the probe with a sequence in the target region. The
probe, preferably, does not contain a sequence complementary to
sequence(s) used in the primer extension (s). Generally the 3'
terminus of the probe will be "blocked" to prohibit incorporation
of the probe into a primer extension product. "Blocking" can be
achieved by using non-complementary bases or by adding a chemical
moiety such as biotin or a phosphate group to the 3' hydroxl of the
last nucleotide, which may, depending upon the selected moiety,
serve a dual purpose by also acting as a label for subsequent
detection or capture of the nucleic acid attached to the label.
Blocking can also be achieved by removing the 3'-OH or by using a
nucleotide that lacks a 3'-OH such as dideoxynucleotide.
[0213] Additionally, according to the present invention, a probe
can be an oligonucletide with secondary structure such as a hairpin
or a stem-loop, and includes, but is not limited to molecular
beacons, safety pins, scorpions, and sunrise/amplifluor,
probes.
[0214] Molecular beacon probes comprise a hairpin, or stem-loop
structure which possesses a pair of interactive signal generating
labeled moieties (e.g., a fluorophore and a quencher) effectively
positioned to quench the generation of a detectable signal. The
loop comprises a region that is complementary to a target nucleic
acid. The loop is flanked by 5' and 3' regions ("arms") that
reversibly interact with one another by means of complementary
nucleic acid sequences when the region of the probe that is
complementary to a nucleic acid target sequence is not bound to the
target nucleic acid. Alternatively, the loop is flanked by 5' and
3' regions ("arms") that reversibly interact with one another by
means of attached members of an affinity pair to form a secondary
structure when the region of the probe that is complementary to a
nucleic acid target sequence is not bound to the target nucleic
acid. As used herein, "arms" refers to regions of a probe that
reversibly interact with one another by means of complementary
nucleic acid sequences when the region of the probe that is
complementary to a nucleic acid target sequence is not bound to the
target nucleic acid or regions of a probe that reversibly interact
with one another by means of attached members of an affinity pair
to form a secondary structure when the region of the probe that is
complementary to a nucleic acid target sequence is not bound to the
target nucleic acid. When a molecular beacon probe is not
hybridized to target, the arms hybridize with one another to form a
stem hybrid, which is sometimes referred to as the "stem duplex".
This is the closed conformation. When a molecular beacon probe
hybridizes to its target the "arms" of the probe are separated.
This is the open conformation. In the open conformation an arm may
also hybridize to the target. Such probes may be free in solution,
or they may be tethered to a solid surface. When the arms are
hybridized (e.g. form a stem) the quencher is very close to the
fluorophore and effectively quenches or suppresses its
fluorescence, rendering the probe dark. Such probes are described
in U.S. Pat. No. 5,925,517 and U.S. Pat. No. 6,037,130.
[0215] As, used herein, a molecular beacon probe that is an
"allele-discriminating" probe will not hybridize sufficiently to a
target-like nucleic acid sequence that contains one or more
internally located nucleotide mismatches as compared to the target
nucleic acid complementary sequence and thus will not convert
conformationally to an open conformation in the presence of a
target-like nucleic acid sequence, and under conditions that would
support hybridization, of the allele discriminating probe to a
target nucleic acid sequence. In other embodiments a molecular
beacon probe will hybridize sufficiently to a target-like nucleic
acid sequence that contains one or more internally located
nucleotide mismatches as compared to the target nucleic acid
complementary sequence and will convert conformationally to an open
conformation in the presence of a target-like nucleic acid
sequence, and under conditions that would support hybridization of
the allele discriminating probe to a target nucleic acid sequence.
Molecular beacon probes have a fluorophore attached to one arm and
a quencher attached to the other arm. The fluorophore and quencher,
for example, tetramethylrhodamine and DABCYL, need not be a FRET
pair.
[0216] For stem loop probes useful in this invention, the length of
the probe sequence that is complementary to the target, the length
of the regions of a probe (e.g., stem hybrid) that reversibly
interact with one another by means of complementary nucleic
acid-sequences when the region complementary to a nucleic acid
target sequence is not bound to the target nucleic acid and the
relation of the two is designed according to the assay conditions
for which the probe is to be utilized. The lengths of the
target-complementary sequences and the stem hybrid sequences for
particular assay conditions can be estimated according to what is
known in the art. The regions of a probe that reversibly interact
with one another by means of complementary nucleic acid sequences
when the region of the probe that is complementary to a nucleic
acid target sequence is not bound to the target nucleic acid are in
the range of 6 to 100, preferably 8 to 50 nucleotides and most
preferably 8 to 25 nucleotides each. The length of the probe
sequence that is complementary to the target is preferably 17-40
nucleotides, more preferably 17-30 nucleotides and most preferably
17-25 nucleotides long. The stability of the interaction between
the regions of a probe that reversibly interact with one another by
means of complementary nucleic acid sequences is determined by
routine experimentation to achieve proper functioning.
[0217] The oligonucleotide sequences of molecular beacon probes
modified according to this invention may be DNA, RNA, cDNA or
combinations thereof. Modified nucleotides may be included, for
example nitropyrrole-based nucleotides or
2'-O-methylribonucleotides. Modified linkages also may be included,
for example phosphorothioates. Modified nucleotides and modified
linkages may also be incorporated in wavelength-shifting primers
according to this invention.
[0218] A safety pin probe, as utilized in the present invention,
requires a "universal" hairpin probe 1 (FIG. 10, b171), comprising
a hairpin structure, with a fluorophore (FAM) on the 5' arm of the
hairpin and a quencher (Dabcyl) on the 3' arm, and a probe 2 (FIG.
10, SP 170a) comprising a stem-loop comprising two domains: the 5'
two thirds of probe 2 have a (universal) sequence complementary to
the hairpin-probe 1, and nucleotides that will stop the DNA
polymerase, and the 3' one third of probe 2, which serves as the
target specific primer. As the polymerase, primed from the reverse
primer (that is, the 3' one third of probe 2) synthesizes the top
strand, the 5' end of probe 2 will be displaced and degraded by the
5' exonucleolytic activity until the "stop nucleotides" are
reached. At this time the remainder of probe 2 opens up or unfolds
and serves as a target for, hairpin probe 1, thereby separating the
fluorophore from the quencher (FIG. 10).
[0219] Scorpion probes, as used in the present invention comprise a
3' primer with a 5' extended probe tail comprising a
hairpin-structure which possesses a fluorophore/quencher pair. The
probe tail is "protected" from replication in the 5'.fwdarw.3'
direction by the inclusion of hexethylene glycol (HEG) which blocks
the polymerase from replicating the probe. During the first round
of amplification the 3' target-specific primer anneals to the
target and is extended such that the scorpion is now incorporated
into the newly synthesized strand, which possesses a newly
synthesized target region for the 5' probe. During the next round
of denaturation and annealing, the probe region of the scorpion
hairpin loop will hybridize to the target, thus separating the
fluorophore and quencher and creating a measurable signal. Such
probes are described in Whitcombe et al., Nature Biotechnology 17.
804-807 (1999), and in FIG. 11.
[0220] An additional oligonucleotide probe useful in the present
invention is the sunrise/amplifluor probe. The sunrise/amplifluor
probe is of similar construction as the scorpion probe with the
exception that is lacks the HEG monomer to block the 5'.fwdarw.3'
replication of the hairpin probe region. Thus, in the first round
of amplification, the 3' target specific primer of the
sunrise/amplifluor anneals to the target and is extended, thus
incorporating the hairpin probe into the newly synthesized strand
(sunrise strand). During the second round of amplification a
second, non-labeled primer anneals to the 3' end of the sunrise,
strand (Cycle 2 in FIG. 12). However, as the polymerase reaches the
5' end of the hairpin, due to the lack of the HEG stop sequence,
the polymerase will displace and replicate the hairpin, thus
separating the fluorophore and quencher, and incorporating the
linearized hairpin probe into the new strand. Probes of this type
are described further in Nazarneko et al., Nucleic Acid Res. 25:
2516-2521 (1997), and in FIG. 12.
[0221] For probes useful in this invention, the length of the probe
sequence that is complementary to the target, the length of the
regions of a probe. (e.g., stem hybrid) that reversibly interact
with one another by means of complementary nucleic acid sequences
when the region complementary to a nucleic acid target sequence is
not bound to the target nucleic acid and the relation of the two is
designed according to the assay conditions for which the probe is
to be utilized. The lengths of the target-complementary sequences
and the stem hybrid sequences for particular assay conditions can
be estimated according to what is known in the art. The regions of
a probe that reversibly interact with one another by means of
complementary nucleic acid sequences when the region-complementary
to a nucleic acid target sequence is not bound to the target
nucleic acid are in the range of 6 to 100, preferably 8 to 50
nucleotides and most preferably 8 to 25 nucleotides each. The
length of the probe sequence that is complementary to the target is
preferably 17-40 nucleotides, more preferably 17-30 nucleotides and
most preferably 17-25 nucleotides long. The stability of the
interaction between the regions of a probe that reversibly interact
with one another by means of complementary nucleic acid sequences
is determined by routine experimentation to achieve proper
functioning. In addition to length, stability of the interaction
the regions of a probe that reversibly interact with one another by
means of complementary nucleic acid sequences between the regions
of a probe that reversibly interact with one another by means of
complementary nucleic acid sequences can be adjusted by altering
the G-C content and inserting destabilizing mismatches. One of the
regions of a probe that reversibly interact with one another by
means of complementary nucleic acid sequences can be designed to be
partially or completely complementary to the target. If the 3' arm
is complementary to the target the probe can serve as a primer for
a DNA polymerase. Also, wavelength-shifting molecular beacon probes
can be immobilized to solid surfaces, as by tethering, or be
free-floating.
[0222] A wide range of fluorophores may be used in probes and
primers according to this invention. Available fluorophores include
coumarin, fluorescein tetrachlorofluorescein,
hexachlorofluorescein, Lucifer yellow, rhodamine, BODIPY;
tetramethylrhodamine, Cy3, Cy5, Cy7, eosine, Texas red and ROX.
Combination fluorophores such as fluorescein-rhodamine dimers,
described, for example, by Lee et. al. (1997), Nucleic Acids
Research 25:2816, are also suitable. Fluorophores may be chosen to
absorb and emit in the visible spectrum or outside the visible
spectrum, such as in the ultraviolet or infrared ranges.
[0223] A quencher is a moiety that, when placed very close to an
excited fluorophore, causes there to be little or no fluorescence.
Suitable quenchers described in the art include particularly DABCYL
and variants thereof, such as DABSYL, DABMI and Methyl Red.
Fluorophores can also be used as quenchers, because they tend to
quench-fluorescence when touching certain other fluorophores.
Preferred quenchers are either chromophores such as DABCYL or
malachite green, or fluorophores that do not fluoresce in the
detection range when the probe is in the open conformation.
[0224] Methods of labeling a probe according to the invention and
suitable labels are described below in the section entitled
"Cleavage Structure".
[0225] D. Production of a Nucleic Acid
[0226] The invention provides nucleic acids to be detected and or
measured, for amplification of a target nucleic acid sequence and
for formation of a cleavage structure.
[0227] The present invention utilizes nucleic acids comprising RNA,
cDNA, genomic DNA, synthetic forms, and mixed polymers. The
invention includes both sense and antisense strands of a nucleic
acid. According to the invention, the nucleic acid may be
chemically or biochemically modified or may contain non-natural or
derivatized nucleotide bases. Such modifications include, for
example, labels, methylation, substitution of one or more of the
naturally occurring nucleotides with an analog, internucleotide
modifications such as uncharged linkages (e.g. methyl phosphonates,
phosphorodithioates, etc.), pendent moieties (e.g., polypeptides),
intercalators, (e.g. acridine, psoralen, etc.) chelators,
alkylators, and modified linkages (e.g. alpha anomeric nucleic
acids, etc.) Also included are synthetic molecules that mimic
polynucleotides in their ability to bind to a designated sequence
via hydrogen bonding and other chemical interactions. Such
molecules are known in the art and include, for example, those in
which peptide linkages substitute for phosphate linkages in the
backbone of the molecule.
[0228] 1. Nucleic Acids Comprising DNA
[0229] a. Cloning
[0230] Nucleic acids comprising DNA can be isolated from cDNA or
genomic libraries by cloning methods well known to those skilled in
the art (Ausubel et al., supra). Briefly, isolation of a DNA clone
comprising a particular nucleic acid sequence involves screening a
recombinant DNA or cDNA library and identifying the clone
containing the desired sequence. Cloning will involve the following
steps. The clones of a particular library are spread onto plates,
transferred to an appropriate substrate for screening, denatured,
and probed for the presence of a particular nucleic acid. A
description of hybridization conditions, and methods for producing
labeled probes is included below.
[0231] The desired clone is preferably identified by hybridization
to a nucleic acid probe or by expression of a protein that can be
detected by an antibody. Alternatively, the desired clone is
identified by polymerase chain amplification of a sequence defined
by a particular set of primers according to the methods described
below.
[0232] The selection of an appropriate library involves identifying
tissues or cell lines that are an abundant source of the desired
sequence. Furthermore, if a nucleic acid of interest contains
regulatory sequence or intronic sequence a genomic library is
screened (Ausubel et al., supra).
[0233] b. Genomic DNA
[0234] Nucleic acid sequences of the invention are amplified from
genomic DNA. Genomic DNA is isolated from tissues or cells
according to the following method.
[0235] To facilitate detection of a variant form of a gene from a
particular tissue, the tissue is isolated free from surrounding
normal tissues. To isolate genomic DNA from mammalian tissue, the
tissue is minced and frozen in liquid nitrogen. Frozen tissue is
ground into a fine powder with a prechilled mortar and pestle, and
suspended in digestion buffer (100 mM NaCl, 10 mM Tris-HCl, pH 8.0,
25 mM EDTA, pH 8.0, 0.5% (w/v) SDS, 0.1 mg/ml proteinase K) at 1.2
ml digestion buffer per 100 mg of tissue. To isolate genomic DNA
from mammalian tissue culture cells, cells are pelleted by
centrifugation for 5 min at 500.times.g, resuspended in 1-10 ml
ice-cold PBS, repelleted for 5 min at 500.times.g and resuspended
in 1 volume of digestion buffer.
[0236] Samples in digestion buffer are incubated (with shaking) for
12-18 hours at 50.degree. C., and then extracted with an equal
volume of phenol/chloroform/isoamyl alcohol. If the phases are not
resolved following a centrifugation step (10 min at 1700.times.g),
another volume of digestion buffer (without proteinase K) is added
and the centrifugation step is repeated. If a thick white material
is evident at the interface of the two phases, the organic
extraction step is repeated. Following extraction the upper,
aqueous layer is transferred to a new tube to which will be added
1/2 volume of 7.5M ammonium acetate and 2 volumes of 100% ethanol.
The nucleic acid is pelleted by centrifugation for 2 min at
1700.times.g, washed with 70% ethanol, air dried and resuspended in
TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0) at 1 mg/ml.
Residual RNA is removed by incubating the sample for 1 hour at
37.degree. C. in the presence of 0.1% SDS and 1 .mu.g/ml DNase-free
RNase, and repeating the extraction and ethanol precipitation
steps. The yield of genomic DNA, according to this method is
expected to be approximately 2 mg DNA/1 g cells or tissue (Ausubel
et al., supra). Genomic DNA isolated according to this method can
be used for PCR analysis, according to the invention.
[0237] c. Restriction Digest (of cDNA or Genomic DNA)
[0238] Following the identification of a desired cDNA or genomic
clone containing a particular target nucleic acid sequence, nucleic
acids of the invention may be isolated from these clones by
digestion with restriction enzymes.
[0239] The technique of restriction enzyme digestion is well known
to those skilled in the art (Ausubel et al., supra). Reagents
useful for restriction enzyme digestion are readily available from
commercial vendors including Stratagene, as well as other
sources.
[0240] d. PCR
[0241] Nucleic acids of the invention may be amplified from genomic
DNA or other natural sources by the polymerase chain reaction
(PCR). PCR methods are well-known to those skilled in the art.
[0242] PCR provides a method for rapidly amplifying a particular
DNA sequence by using multiple cycles of DNA replication catalyzed
by a thermostable, DNA-dependent DNA polymerase to amplify the
target sequence of interest. PCR requires the presence of a target
nucleic acid sequence to be amplified, two single stranded
oligonucleotide primers flanking the sequence to be amplified, a
DNA polymerase, deoxyribonucleoside triphosphates, a buffer and
salts.
[0243] PCR, is performed as described in Mullis and Faloona, 1987,
Methods Enzymol., 155: 335, herein incorporated by reference.
[0244] The polymerase chain reaction (PCR) technique, is disclosed
in U.S. Pat. Nos. 4,683,202, 4,683,195 and 4,800,159. In its
simplest form, PCR is an in vitro method for the enzymatic
synthesis of specific DNA sequences, using two oligonucleotide
primers that hybridize to opposite strands and flank the region of
interest in the target DNA. A repetitive series of reaction steps
involving template denaturation, primer annealing and the extension
of the annealed primers by DNA polymerase results in the
exponential accumulation of a specific fragment whose termini are
defined by the 5' ends of the primers. PCR is reported to be
capable of producing a selective enrichment of a specific DNA
sequence by a factor of 10.sup.9. The PCR method is also described
in Saiki et al., 1985, Science 230:1350.
[0245] PCR is performed using template DNA (at least 1 fg; more
usefully, 1-1000 ng) and at least 25 pmol of oligonucleotide
primers. A typical reaction mixture includes: 2 .mu.l of DNA, 25
pmol of oligonucleotide primer, 2.5 .mu.l of a suitable buffer, 0.4
.mu.l of 1.25 .mu.M dNTP, 2.5 units of Taq DNA polymerase
(Stratagene) and deionized water to a total volume of 25 .mu.l.
Mineral oil is overlaid and the PCR is performed using a
programmable thermal cycler.
[0246] The length and temperature of each step of a PCR cycle, as
well as the number of cycles, are adjusted according to the
stringency requirements in effect. Annealing temperature and timing
are determined both by the efficiency with which a primer is
expected to anneal to a template and the degree of mismatch that is
to be tolerated. The ability to optimize the stringency of primer
annealing conditions is well within the knowledge of one of
moderate skill in the art. An annealing temperature of between
30.degree. C. and 72.degree. C. is used. Initial denaturation of
the template molecules normally occurs at between 92.degree. C. and
99.degree. C. for 4 minutes, followed by 20-40 cycles consisting of
denaturation (94-99.degree. C. for 15 seconds to 1 minute),
annealing (temperature determined as discussed above; 1-2 minutes),
and extension (72.degree. C. for 1 minute). The final extension
step is generally carried out for 4 minutes at 72.degree. C., and
may be followed by an indefinite (0-24 hour) step at 4.degree.
C.
[0247] Detection methods generally employed in standard PCR
techniques use a labeled probe with the amplified DNA in a
hybridization assay. Preferably, the probe is labeled, e.g., with
.sup.32P, biotin, horseradish peroxidase (HRP), etc., to allow for
detection of hybridization.
[0248] Other means of detection include the use of fragment length
polymorphism (PCR FLP), hybridization to allele-specific
oligonucleotide (ASO) probes (Saiki et al., 1986, Nature 324:163),
or direct sequencing via the dideoxy method (using amplified DNA
rather than cloned DNA). The standard PCR technique operates
(essentially) by replicating a DNA sequence positioned between two
primers, providing as the major product of the reaction a DNA
sequence of discrete length terminating with the primer at the 5'
end of each strand. Thus, insertions and deletions between the
primers result in product sequences of different lengths, which can
be detected by sizing the product in PCR-FLP. In an example of ASO
hybridization, the amplified DNA is fixed to a nylon filter (by,
for example, UV irradiation) in a series of "dot blots", then
allowed to hybridize with an oligonucleotide probe labeled with HRP
under stringent conditions. After washing, terramethylbenzidine
(TMB) and hydrogen peroxide are added: HRP oxidizes the hydrogen
peroxide, which in turn oxidizes the TMB to a blue precipitate,
indicating a hybridized probe.
[0249] A PCR assay for detecting or measuring a nucleic assay
according to the invention is described in the section entitled
"Methods of Use".
[0250] 2. Nucleic Acids Comprising RNA
[0251] The present invention also provides a nucleic acid
comprising RNA.
[0252] Nucleic acids comprising RNA can be purified according to
methods well known in the art (Ausubel et al., supra). Total RNA
can be isolated from cells and tissues according to methods well
known in the art (Ausubel et al., supra) and described below.
[0253] RNA is purified from mammalian tissue according to the
following method. Following removal of the tissue of interest,
pieces of tissue of .ltoreq.2 g are cut and quick frozen in liquid
nitrogen, to prevent degradation of RNA. Upon the addition of a
suitable volume of guanidinium solution (for example 20 ml
guanidinium solution per 2 g of tissue), tissue samples are ground
in a tissuemizer with two or three 10-second bursts. To prepare
tissue guanidinium solution (1 L) 590.8 g guanidinium
isothiocyanate is dissolved in approximately 400 ml DEPC-treated
H.sub.2O. 25 ml of 2 M Tris-HCl, pH 7.5 (0.05 M final) and 20 ml
Na.sub.2EDTA (0.01 M final) is added, the solution is stirred
overnight, the volume is adjusted to 950 ml, and 50 ml 2-ME is
added.
[0254] Homogenized tissue samples are subjected to centrifugation
for 10 min at 12,000.times.g at 12.degree. C. The resulting
supernatant is incubated for 2 min at 65.degree. C. in the presence
of 0.1 volume of 20% Sarkosyl, layered over 9 ml of a 5.7M CsCl
solution (0.1 g CsCl/ml), and separated by centrifugation overnight
at 113,000.times.g at 22.degree. C. After careful removal of the
supernatant, the tube is inverted and drained. The bottom of the
tube (containing the RNA pellet) is placed in a 50 ml plastic tube
and incubated overnight (or longer) at 4.degree. C. in the presence
of 3 ml tissue resuspension buffer (5 mM EDTA, 0.5% (v/v) Sarkosyl,
5% (v/v) 2-ME) to allow complete resuspension of the RNA pellet.
The resulting RNA solution is extracted sequentially with 25:24:1
phenol/chloroform/isoamyl alcohol, followed by 24:1
chloroform/isoamyl alcohol, precipitated by the addition of 3 M
sodium acetate, pH 5.2, and 2.5 volumes of 100% ethanol, and
resuspended in DEPC water (Chirgwin et al., 1979, Biochemistry, 18:
5294).
[0255] Alternatively, RNA is isolated from mammalian tissue
according to the following single step protocol. The tissue of
interest is prepared by homogenization in a glass teflon
homogenizer in 1 ml denaturing solution (4M guanidinium
thiosulfate, 25 mM sodium citrate, pH 7.0, 0.1M 2-ME, 0.5% (w/v)
N-laurylsarkosine) per 100 mg tissue. Following transfer of the
homogenate to a 5-ml polypropylene tube, 0.1 ml of 2 M sodium
acetate, pH 4, 1 ml water-saturated phenol, and 0.2 ml of 49:1
chloroform/isoamyl alcohol are added sequentially. The sample is
mixed after the addition of each component, and incubated for 15
min at 0-4.degree. C. after all components have been added. The
sample is separated by centrifugation for 20 min at 10,000.times.g,
4.degree. C., precipitated by the addition of 1 ml of 100%
isopropanol, incubated for 30 minutes at -20.degree. C. and
pelleted by centrifugation for 10 minutes at 10,000.times.g,
4.degree. C. The resulting RNA pellet is dissolved in 0.3 ml
denaturing solution, transferred to a microfuge tube, precipitated
by the addition of 0.3 ml of 100% isopropanol for 30 minutes at
-20.degree. C., and centrifuged for 10 minutes at 10,000.times.g at
4.degree. C. The RNA pellet is washed in 70% ethanol, dried, and
resuspended in 100-200 .mu.l DEPC-treated water or DEPC-treated
0.5% SDS (Chomczynski and Sacchi, 1987, Anal. Biochem., 162:
156).
[0256] Nucleic acids comprising RNA can be produced according to
the method of in vitro transcription.
[0257] The technique of in vitro transcription is well known to
those of skill in the art. Briefly, the gene of interest is
inserted into a vector containing an SP6, T3 or T7 promoter. The
vector is linearized with an appropriate restriction enzyme that
digests the vector at a single site located downstream of the
coding sequence. Following a phenol/chloroform extraction, the DNA
is ethanol precipitated, washed in 70% ethanol, dried and
resuspended in sterile water. The in vitro transcription reaction
is performed by incubating the linearized DNA with transcription
buffer (200 mM Tris-HCl, pH 8.0, 40 mM MgCl.sub.2, 10 mM
spermidine, 250 NaCl [T7 or T3] or 200 mM Tris-HCl, pH 7.5, 30 mM
MgCl.sub.2, 10 mM spermidine [SP6]), dithiothreitol, RNase
inhibitors, each of the four ribonucleoside triphosphates, and
either SP6, T7 or T3 RNA polymerase for 30 min at 37.degree. C. To
prepare a radiolabeled polynucleotide comprising RNA, unlabeled UTP
will be omitted and .sup.35S-UTP will be included in the reaction
mixture. The DNA template is then removed by incubation with
DNaseI. Following ethanol precipitation, an aliquot of the
radiolabeled RNA is counted in a scintillation counter to determine
the cpm/.mu.l (Ausubel et al., supra).
[0258] Alternatively, nucleic acids comprising RNA are prepared by
chemical synthesis techniques such as solid phase phosphoramidite
(described above).
[0259] 3. Nucleic Acids Comprising Oligonucleotides
[0260] A nucleic acid comprising oligonucleotides can be made by
using oligonucleotide synthesizing machines which are commercially
available (described above).
IV. Cleavage Structure
[0261] The invention provides for a cleavage structure that can be
cleaved by a FEN nuclease, and therefore teaches methods of
preparing a cleavage structure. The invention also provides a
labeled cleavage structure and methods of preparing a labeled
cleavage structure.
[0262] A. Preparation of a Cleavage Structure
[0263] A cleavage structure according to the invention is formed by
incubating a) an upstream, preferably extendable 3' end, preferably
an oligonucleotide primer, b) an oligonucleotide probe located not
more than 5000 nucleotides downstream of the upstream primer and c)
an appropriate target nucleic acid sequence wherein the target
sequence is complementary to both primers and d) a suitable buffer
(for example Sentinel Molecular Beacon PCR core buffer (Catalog
#600500) or 10.times.Pfu buffer available from Stratagene (Catalog
#200536), under conditions that allow the nucleic acid sequence to
hybridize to the oligonucleotide primers (for example 95.degree. C.
for 2-5 minutes followed by cooling to between approximately
50-60.degree. C.). The optimal temperature will vary depending on
the specific probe(s), primers and polymerases. In preferred
embodiments of the invention a cleavage structure comprises an
overlapping flap wherein the 3' end of an upstream oligonucleotide
capable of hybridizing to a target nucleic acid sequence (for
example A in FIG. 3) is complementary to 1 or more base pair(s) of
the downstream oligonucleotide (for example C in FIG. 3) that is
annealed to a target nucleic acid sequence and wherein the 1 base
pair overlap is directly downstream of the point of extension of
the single stranded flap.
[0264] The 3' end of the upstream oligonucleotide primer is
extended by the synthetic activity of a polymerase according to the
invention such that the newly synthesized 3' end of the upstream
oligonucleotide primer partially displaces the 5' end of the
downstream oligonucleotide probe. Extension is preferably carried
out in the presence of 1.times. Sentinel Molecular beacon core
buffer or 1.times.Pfu buffer for 15 seconds at 72.degree. C. In one
embodiment of the invention, a cleavage structure according to the
invention can be prepared by incubating a target nucleic acid
sequence with a partially complementary oligonucleotide primer such
that the 3' complementary region anneals to the target nucleic acid
sequence and the non-complementary 5' region that does not anneal
to the target nucleic acid sequence forms a 5' flap. Annealing is
preferably carried out under conditions that allow the nucleic acid
sequence to hybridize to the oligonucleotide primer (for example
95.degree. C. for 2-5 minutes followed by cooling to between
approximately 50-60.degree. C.) in the presence a suitable buffer
(for example 1.times. Sentinel Molecular beacon core buffer or
1.times.Pfu buffer.
[0265] B. How to Prepare a Labeled Cleavage Structure
[0266] In the present invention, a label is attached to an
oligonucleotide primer comprising the cleavage structure, thereby
forming a probe. Thus, the cleaved mononucleotides or small
oligonucleotides which are cleaved by the endonuclease activity of
the flap-specific nuclease can be detected.
[0267] A labeled cleavage structure according to the invention is
formed by incubating a) an upstream extendable 3' end, preferably
an oligonucleotide primer, b) a labeled probe located not more than
500 nucleotides downstream of the upstream primer and c) an
appropriate target nucleic acid sequence wherein the target
sequence is complementary to the oligonucleotides and d) a suitable
buffer (for example 1.times. Sentinel Molecular beacon core buffer
or 1.times.Pfu buffer), under conditions that allow the nucleic
acid sequence to hybridize to the oligonucleotide primers (for
example 95.degree. C. for 2-5 minutes followed by cooling to
between approximately 50-60.degree. C.). A cleavage structure
according to the invention also comprises an overlapping flap
wherein the 3' end of an upstream oligonucleotide capable of
hybridizing to a target nucleic acid sequence (for example A in
FIG. 3) is complementary to 1 base pair of the downstream
oligonucleotide (for example C in FIG. 3) that is annealed to a
target nucleic acid sequence and wherein the 1 base pair overlap is
directly downstream of the point of extension of the single
stranded flap. The 3' end of the upstream primer is extended by the
synthetic activity of a polymerase such that the newly synthesized
3' end of the upstream primer partially displaces the labeled 5'
end of the downstream probe. Extension is preferably carried out in
the presence of 1.times. Sentinel Molecular beacon core buffer or
1.times.Pfu buffer for 15 seconds at 72.degree. C. A cleavage
structure according to the invention can be prepared by incubating
a target nucleic acid sequence with a probe comprising a
non-complementary, labeled, 5' region that does not anneal to the
target nucleic acid sequence and forms a 5' flap, and a
complementary 3' region that anneals to the target nucleic acid
sequence. Annealing is preferably carried out under conditions that
allow the nucleic acid sequence to hybridize to the oligonucleotide
primer (for example 95.degree. C. for 2-5 minutes followed by
cooling to between approximately 50-60.degree. C.) in the presence
a suitable buffer (for example 1.times. Sentinel Molecular beacon
core buffer or 1.times.Pfu buffer).
[0268] Subsequently, any of several strategies may be employed to
distinguish the uncleaved labeled nucleic acid from the cleaved
fragments thereof. In this manner, the present invention permits
identification of those samples that contain a target nucleic acid
sequence.
[0269] The oligonucleotide probe is labeled, as described below, by
incorporating moieties detectable by spectroscopic, photochemical,
biochemical, immunochemical, enzymatic or chemical means. The
method of linking or conjugating the label to the oligonucleotide
probe depends, of course, on the type of label(s) used and the
position of the label on the probe. Preferably a probe is labeled
at the 5' end although probes labeled at the 3' end or labeled
throughout the length of the probe are also useful in particular
embodiments of the invention.
[0270] A variety of labels that would be appropriate for use in the
invention, as well as methods for their inclusion in the probe, are
known in the art and include, but are not limited to, enzymes
(e.g., alkaline phosphatase and horseradish peroxidase) and enzyme
substrates, radioactive atoms, fluorescent dyes, chromophores,
chemiluminescent labels, electrochemiluminescent labels, such as
Origen.TM. (Igen), that may interact with each other to enhance,
alter, or diminish a signal. Of course, if a labeled molecule is
used in a PCR based assay carried out using a thermal cycler
instrument, the label must be able to survive the temperature
cycling required in this automated process.
[0271] Among radioactive atoms, .sup.33P or, .sup.32P is preferred.
Methods for introducing .sup.33P or, .sup.32P into nucleic acids
are known in the art, and include, for example, 5' labeling with a
kinase, or random insertion by nick translation. "Specific binding
partner" refers to a protein capable of binding a ligand molecule
with high specificity, as for example in the case of an antigen and
a monoclonal antibody specific therefor. Other specific binding
partners include biotin and avidin or streptavidin, IgG and protein
A, and the numerous receptor-ligand couples known in the art. The
above description is not meant to categorize the various labels
into distinct classes, as the same label may serve in several
different modes. For example, .sup.125I may serve as a radioactive
label or as an electron-dense reagent. HRP may serve as an enzyme
or as antigen for a monoclonal antibody. Further, one may combine
various labels for desired effect. For example, one might label a
probe with biotin, and detect the presence of the probe with avidin
labeled with .sup.125I, or with an anti-biotin monoclonal antibody
labeled with HRP. Other permutations and possibilities will be
readily apparent to those of ordinary skill in the art and are
considered as equivalents within the scope of the instant
invention.
[0272] Fluorophores for use as labels in constructing labeled
probes of the invention include rhodamine and derivatives (such as
Texas Red), fluorescein and derivatives (such as 5-bromomethyl
fluorescein), Lucifer Yellow, IAEDANS,
7-Me.sub.2N-coumarin-4-acetate, 7-OH-4-CH.sub.3-coumarin-3-acetate,
7-NH.sub.2-4-CH.sub.3-coumarin-3-acetate (AMCA), monobromobimane,
pyrene trisulfonates, such as Cascade Blue, and
monobromorimethyl-ammoniobimane. In general, fluorophores with wide
Stokes shifts are preferred, to allow using fluorimeters with
filters rather than a monochromometer and to increase the
efficiency of detection.
[0273] Probes labeled with fluorophores can readily be used in FEN
mediated cleavage of a cleavage structure comprising a labeled
probe according to the invention. If the label is on the 5'-end of
the probe, the FEN generated labeled fragment is separated from the
intact, hybridized probe by procedures well known in the art. The
fluorescence of the released label is then compared to the label
remaining bound to the target. It is not necessary to separate the
FEN generated fragment and the probe that remains bound to the
target after cleavage in the presence of FEN if the probe is
synthesized with a fluorophore, usually at the 5'-end, and a
quencher, usually about 20 nucleotides downstream of the dye. Such
a dual labeled probe will not fluoresce when intact because the
light emitted from the dye is quenched by the quencher. Thus, any
fluorescence emitted by an intact probe is considered to be
background fluorescence. When a labeled probe is cleaved by a FEN
nuclease, dye and quencher are separated and the released fragment
will fluoresce. The amount of fluorescence is proportional to the
amount of nucleic acid target sequence present in a sample.
[0274] In some situations, one can use two interactive labels on a
single oligonucleotide with due consideration given for maintaining
an appropriate spacing of the labels on the oligonucleotide to
permit the separation of the labels during oligonucleotide
hydrolysis. Preferred interactive labels useful according to the
invention include, but are not limited to rhodamine and
derivatives, fluorescein and derivatives, Texas Red, coumarin and
derivatives, crystal violet and include, but are not limited to
DABCYL, TAMRA and NTB (nitrothiazole blue).
[0275] In another embodiment of the invention, detection of the
hydrolyzed, labeled probe can be accomplished using, for example,
fluorescence polarization, a technique to differentiate between
large and small molecules based on molecular tumbling. Large
molecules (i.e., intact labeled probe) tumble in solution much more
slowly than small molecules. Upon linkage of a fluorescent moiety
to the molecule of interest (e.g., the 5' end of a labeled probe),
this fluorescent moiety can be measured (and differentiated) based
on molecular tumbling, thus differentiating between intact and
digested probe.
[0276] In yet another embodiment, two labeled nucleic acids are
used, each complementary to separate regions of separate strands of
a double-stranded target sequence, but not to each other, so that a
labeled nucleic acid anneals downstream of each primer. For
example, the presence of two probes can potentially double the
intensity of the signal generated from a single label and may
further serve to reduce product strand reannealing, as often occurs
during PCR amplification. The probes are selected so that the
probes bind at positions adjacent (downstream) to the positions at
which primers bind.
[0277] One can also use multiple probes in the present invention to
achieve other benefits. For instance, one could test for any number
of pathogens in a sample simply by putting as many probes as
desired into the reaction mixture; the probes could each comprise a
different label to facilitate detection.
[0278] One can also achieve allele-specific or species-specific
discrimination using multiple probes in the present invention, for
instance, by using probes that have different T.sub.ms and
conducting the annealing/cleavage reaction at a temperature
specific for only one probe/allele duplex. One can also achieve
allele specific discrimination by using only a single probe and
examining the types of cleavage products generated. In this
embodiment of the invention, the probe is designed to be exactly
complementary, at least in the 5' terminal region, to one allele
but not to the other allele(s). With respect to the other
allele(s), the probe will be mismatched in the 5' terminal region
of the probe so that a different cleavage product will be generated
as compared to the cleavage product generated when the probe is
hybridized to the exactly complementary allele.
[0279] Although probe sequence can be selected to achieve important
benefits, one can also realize important advantages by selection of
probe labels(s). The labels may be attached to the oligonucleotide
directly or indirectly by a variety of techniques. Depending on the
precise type of label used, the label can be located at the 5' or
3' end of the probe, located internally in the probe, or attached
to spacer arms of various sizes and compositions to facilitate
signal interactions. Using commercially available phosphoramidite
reagents, one can produce oligomers containing functional groups
(e.g., thiols or primary amines) at either the 5- or the 3-terminus
via an appropriately protected phosphoramidite, and can label them
using protocols described in, for example, PCR Protocols: A Guide
to Methods and Applications, Innis et al., eds. Academic Press,
Ind., 1990.
[0280] Methods for introducing oligonucleotide functionalizing
reagents to introduce one or more sulfhydryl, amino or hydroxyl
moieties into the oligonucleotide probe sequence, typically at the
5' terminus, are described in U.S. Pat. No. 4,914,210. A 5'
phosphate group can be introduced as a radioisotope by using
polynucleotide kinase and gamma-.sup.32P-ATP or gamma-.sup.33P-ATP
to provide a reporter group. Biotin can be added to the 5' end by
reacting an aminothymidine residue, or a 6-amino hexyl residue,
introduced during synthesis, with an N-hydroxysuccinimide ester of
biotin. Labels at the 3' terminus may employ polynucleotide
terminal transferase to add the desired moiety, such as for
example, cordycepin .sup.35S-dATP, and biotinylated dUTP.
[0281] Oligonucleotide derivatives are also available labels. For
example, etheno-dA and etheno-A are known fluorescent adenine
nucleotides that can be incorporated into a nucleic acid probe.
Similarly, etheno-dC or 2-amino purine deoxyriboside is another
analog that could be used in probe synthesis. The probes containing
such nucleotide derivatives may be hydrolyzed to release much more
strongly fluorescent mononucleotides by flap-specific nuclease
activity.
[0282] C. Cleaving a Cleavage Structure and Generating a Signal
[0283] A cleavage structure according to the invention can be
cleaved by the methods described in the section above, entitled
"FEN Nucleases".
[0284] D. Detection of Released Labeled Fragments
[0285] Detection or verification of the labeled fragments may be
accomplished by a variety of methods well known in the art and may
be dependent on the characteristics of the labeled moiety or
moieties comprising a labeled cleavage structure.
[0286] In one embodiment of the invention, the reaction products,
including the released labeled fragments, are subjected to size
analysis. Methods for determining the size of a labeled fragment
are known in the art and include, for example, gel electrophoresis,
sedimentation in gradients, gel exclusion chromatography, mass
spectroscopy, and homochromatography.
[0287] During or after amplification, separation of the released
labeled fragments from, for example, a PCR mixture can be
accomplished by, for example, contacting the PCR with a solid phase
extractant (SPE). For example, materials having an ability to bind
nucleic acids on the basis of size, charge, or interaction with the
nucleic acid bases can be added to the PCR mixture, under
conditions where labeled, uncleaved nucleic acids are bound and
short, labeled fragments are not. Such SPE materials include ion
exchange resins or beads, such as the commercially available
binding particles Nensorb (DuPont Chemical Co.), Nucleogen (The
Nest Group), PEI, BakerBond.TM. PEI, Amicon PAE 1,000,
Selectacel.TM. PEI, Boronate SPE with a 3'-ribose probe, SPE
containing sequences complementary to the 3'-end of the probe, and
hydroxylapatite. In a specific embodiment, if a dual labeled
oligonucleotide comprising a 3' biotin label separated from a 5'
label by a nuclease susceptible cleavage site is employed as the
signal means, the reaction mixture, for example a PCR amplified
mixture can be contacted with materials containing a specific
binding partner such as avidin or streptavidin, or an antibody or
monoclonal antibody to biotin. Such materials can include beads and
particles coated with specific binding partners and can also
include magnetic particles.
[0288] Following the step in which a reaction mixture, for example
a PCR mixture has been contacted with an SPE, the SPE material can
be removed by filtration, sedimentation, or magnetic attraction,
leaving the labeled fragments free of uncleaved labeled
oligonucleotides and available for detection.
IV. Methods of Use
[0289] The invention provides for a method of generating a signal
indicative of the presence of a target nucleic acid sequence in a
sample comprising the steps of forming a labeled cleavage structure
by incubating a target nucleic acid sequence with a nucleic acid
polymerase, and cleaving the cleavage structure with a FEN
nuclease. The method of the invention can be used in a PCR based
assay as described below.
[0290] A labeled cleavage structure comprising an upstream
oligonucleotide primer (for example A, FIG. 3), a 5' end labeled
downstream oligonucleotide probe (for example C in FIG. 3) and a
target nucleic acid sequence (for example B in FIG. 3) is formed as
described above in the section entitled "Cleavage Structure".
Briefly, a cleavage structure is formed and cleaved in the presence
of a target nucleic acid sequence, an upstream primer (for example
A, FIG. 3), a labeled downstream probe (for example C, FIG. 3)
amplification primers specific for the target nucleic acid
sequence, a nucleic acid polymerase deficient in 5' to 3'
exonuclease activity, a FEN nuclease and an appropriate buffer (for
example 10.times.Pfu buffer, Stratagene, Catalog #200536) in a PCR
reaction with the following thermocycling parameters: 95.degree. C.
for 2 minutes and 40 cycles of 95.degree. C. for 15 sec
(denaturation step), 60.degree. C. for 60 sec (annealing step) and
72.degree. C. for 15 sec (extension step). During this reaction an
upstream oligonucleotide (for example A, FIG. 3) is extended such
that oligonucleotide A partially displaces the 5' labeled end of a
downstream oligonucleotide that is annealed to a target nucleic
acid sequence (for example oligonucleotide C, FIG. 3) and the
resulting labeled structure is cleaved with a FEN nuclease
according to the invention.
[0291] The methods of the invention can also be used in non-PCR
based applications to detect a target nucleic acid sequence, where
such target that may be immobilized on a solid support. Methods of
immobilizing a nucleic acid sequence on a solid support are known
in the art and are described in Ausubel F M et al. Current
Protocols in Molecular Biology, John Wiley and Sons, Inc. and in
protocols provided by the manufacturers, e.g. for membranes: Pall
Corporation, Schleicher & Schuell, for magnetic beads: Dynal,
for culture plates: Costar, Nalgenunc, and for other supports
useful according to the invention, CPG, Inc. A solid support useful
according to the invention includes but is not limited to silica
based matrices, membrane based matrices and beads comprising
surfaces including, but not limited to styrene, latex or silica
based materials and other polymers. Magnetic beads are also useful
according to the invention. Solid supports can be obtained from the
above manufacturers and other known manufacturers.
[0292] The invention also provides for a non-PCR based assay for
detecting a target nucleic acid sequence in solution. The method of
the invention can be used to detect naturally occurring target
nucleic acid sequences in solution including but not limited to RNA
and DNA that is isolated and purified from cells, tissues, single
cell organisms, bacteria or viruses. The method of the invention
can also be used to detect synthetic targets in solution, including
but not limited to RNA or DNA oligonucleotides, and peptide nucleic
acids (PNAs). Non-PCR assays include but are not limited to
detection assays involving isothermal linear or exponential
amplification, where the amount of nucleic acid synthesized by the
3'-5' synthetic activity increases linearly or exponentially, and a
FEN nuclease is used to cleave the displaced strand during
synthesis. One such example utilizes rolling circle
amplification.
[0293] Detection of a nucleic acid target sequence that is either
immobilized or in solution can be performed by incubating an
immobilized nucleic acid target sequence or a target nucleic acid
sequence in solution with an upstream oligonucleotide primer that
is complementary to the target nucleic acid sequence (for example
A, FIG. 3) and a downstream oligonucleotide probe that is
complementary to the target nucleic acid sequence (for example C,
FIG. 3), a FEN nuclease and a nucleic acid polymerase lacking 5' to
3' exonuclease activity. The downstream probe is either end labeled
at the 5' or 3' end, or is labeled internally. Detection of a
released labeled fragment involves isotopic, enzymatic, or
colorimetric methods appropriate for the specific label that has
been incorporated into the probe. Labels useful according to the
invention and methods for the detection of labels useful according
to the invention are described in the section entitled "Cleavage
Structure". Alternatively, the downstream probe comprises a pair of
interactive signal generating labeled moieties (for example a dye
and a quencher) that are positioned such that when the probe is
intact, the generation of a detectable signal is quenched, and
wherein the pair of interactive signal generating moieties are
separated by a FEN nuclease cleavage site. Upon cleavage by a FEN
nuclease, the two signal generating moieties are separated from
each other and a detectable signal is produced. Nucleic acid
polymerases that are useful for detecting an immobilized nucleic
acid target sequence or a nucleic acid target sequence in solution
according to the method of the invention include mesophilic,
thermophilic or hyper-thermophilic DNA polymerases lacking 5' to 3'
exonucleolytic activity (described in the section entitled,
"Nucleic Acid Polymerases)".
[0294] According to this non-PCR based method, the amount of a
target nucleic acid sequence that can be detected is preferably
about 1 pg to 1 .mu.g, more preferably about 1 pg to 10 ng and most
preferably about 1 pg to 10 pg. Alternatively, this non-PCR based
method can measure or detect preferably about 1 molecule to
10.sup.20 molecules, more preferably about 100 molecules to
10.sup.17 molecules and most preferably about 1000 molecules to
10.sup.14 molecules.
[0295] The invention also provides for a method of detecting a
target nucleic acid sequence in a sample wherein a cleavage
structure is formed as described in the section entitled, "Cleavage
Structure", and the target nucleic acid sequence is amplified by a
non-PCR based method including but not limited to an isothermal
method, for example rolling circle, Self-sustained Sequence
Replication Amplification (3SR), Transcription based amplification
system (TAS), and Strand Displacement Amplification (SDA) and a
non-isothermal method, for example Ligation chain reaction (LCR). A
FEN nuclease useful for non-PCR amplification methods will be
active at a temperature range that is appropriate for the
particular amplification method that is employed.
[0296] In the amplification protocols described below, samples
which need to be prepared in order to quantify the target include:
samples, no-template controls, and reactions for preparation of a
standard curve (containing dilutions over the range of six orders
of magnitude of a solution with a defined quantity of target).
[0297] Strand Displacement Amplification (SDA) is based on the
ability of a restriction enzyme to nick the unmodified strand of a
hemiphosphorothioate form of its recognition site. The appropriate
DNA polymerase will initiate replication at this nick and displace
the downstream non-template strand (Walker, 1992, Proc. Natl. Acad.
Sci. USA, 89: 392, and PCR Methods and Applications 3: 1-6, 1993).
The polymerases (Bca and Bst) which are used according to the
method of SDA can also be used in FEN directed cleavage according
to the invention. According to the method of the invention, a
molecular beacon is replaced by a FEN nuclease active at 42.degree.
C. and a cleavable probe comprising a cleavage structure according
to the invention.
[0298] A molecular beacon (Mb) is a fluorogenic probe which forms a
stem-loop structure is solution. Typically: 5'-fluorescent dye
(e.g. FAM), attached to the 5'-stem region (5-7 nt), the loop
region (complementary to the target, 20 to 30 nt), the 3'-stem
region (complementary to the 5'-stem region), and the quencher
(e.g. DABCYL). If no target is present, the MB forms its stem,
which brings dye and quencher into close proximity, and therefore
no fluorescence is emitted. When an MB binds to its target, the
stem is opened, dye is spatially separated from the quencher, and
therefore the probe emits fluorescence (Tyagi S and Kramer F R,
Nature Biotechnology 14: 303-308 (1996) and U.S. Pat. No.
5,925,517).
[0299] Strand Displacement Amplification (SDA) is essentially
performed as described by Spargo et al., Molecular and Cellular
Probes 10: 247-256 (1996). The enzymes used include restriction
endonuclease BsoBI (New England Biolabs), DNA polymerase 5'-exo-Bca
(PanVera Corporation). The target is an insertion-like element
(IS6110) found in the Mycobacterium tuberculosis (Mtb) genome. The
primers used are B1: cgatcgagcaagcca, B2: cgagccgctcgctg, S1:
accgcatcgaatgcatgtctcgggtaaggcgtactcgacc and S2:
cgattccgctccagacttctcgggtgtactgagatcccct. The Mycobacterium
tuberculosis genomic DNA is serially diluted in human placental
DNA. SDA is performed in 50 ul samples containing 0 to 1000 Mtb
genome equivalents, 500 ng human placental DNA, 160 units BsoB1, 8
units of 5'-exo-Bca, 1.4 mM each dCTPalphaS, TTP, dGTP, dATP, 35 mM
K.sub.2PO.sub.4, pH 7.6 0.1 mg/ml acetylated bovine serum albumin
(BSA), 3 mM Tris-HCl, 10 mM MgCl.sub.2, 11 mM NaCl, 0.3 mM DTT, 4
mM KCl, 4% glycerol, 0.008 mM EDTA, 500 nM primers S1 and S2 and 50
nM primers B1 and B2 (KCl, glycerol and EDTA are contributed by the
BsoB1 storage solution). The samples (35 .mu.l) were heated in a
boiling water bath for 3 minutes before the addition of BsoB1 and
5'-exo Bca (10.7 units/.mu.l BsoB1 and 0.53 units/.mu.l 5'-exo Bca
in 15 .mu.l of New England Biolabs Buffer 2 (20 mM Tris-HCl pH 7.9,
10 mM MgCl.sub.2, 50 mM NaCl, 1 mM DTT). Incubation is at
60.degree. C. for 15 minutes, followed by 5 minutes in a boiling
water bath.
[0300] Five .mu.l of each sample in duplicate are removed for
detection. Each reaction contains 1.times. Cloned Pfu buffer, 3.0
mM MgCl.sub.2, 200 uM of each dNTP, 5 units exo-Pfu, 23 ng Pfu
FEN-1, 1 ng PEF, 300 nM each upstream primer: aaggcgtactcgacctgaaa
and fluorogenic probe (for example FAM-DABCYL):
accatacggataggggatctc. The reactions are subjected to one cycle in
a thermal cycler: 2 minutes at 95.degree. C., 1 minute at
55.degree. C., 1 minute at 72.degree. C. The fluorescence is then
determined in a fluorescence plate reader, such as Stratagene's
FluorTracker or PE Biosystems' 7700 Sequence Detection System in
Plate-Read Mode.
[0301] According to the method of nucleic acid sequence-based
amplification (NASBA), molecular beacons are used for
quantification of the NASBA RNA amplicon in real-time analysis
(Leone, et al., 1998, Nucleic Acids Res. 26: 2150). According to
the method of the invention, NASBA can be carried out wherein the
molecular beacon probe is replaced by a FENnuclease cleavable probe
comprising a cleavage structure according to the invention and a
FEN nuclease active at 41.degree. C.
[0302] NASBA amplification is performed essentially as described by
Leone G, et al., Nucleic Acids Res. 26: 2150-2155 (1998). Genomic
RNA from the potato leafroll virus (PLRV) is amplified using the
PD415 or PD416 (antisense) and the PD417 (sense) primers, which are
described in detail in Leone G et al., J. Virol. Methods 66: 19-27
(1997). Each NASBA reaction contains a premix of 6 .mu.l of sterile
water, 4 .mu.l of 5.times.NASBA buffer (5.times.NASBA buffer is 200
mM Tris-HCl, pH 8.5, 60 mM MgCl.sub.2, 350 mM KCl, 2.5 mM DTT, 5 mM
each of dNTP, 10 mM each of ATP, UTP and CTP, 7.5 mM GTP and 2.5 mM
ITP), 4 .mu.l of 5.times. primer mix (75% DMSO and 1 .mu.M each of
antisense and sense primers). The premix is divided into 14 .mu.l
aliquots, to which 1 .mu.l of PLRV target is added. After
incubation for 5 minutes at 65.degree. C. and cooling to 41.degree.
C. for 5 minutes, 5 .mu.l of enzyme mix is added (per reaction 375
mM sorbitol, 2.1 .mu.g BSA, 0.08 units of RNase H (Pharmacia), 32
units of T7 RNA polymerase (Pharmacia) and 6.4 units of AMV-RT
(Seigakaku)). Amplification is for 90 minutes at 41.degree. C.
[0303] Five .mu.l of each sample in duplicate are removed for
detection. Each reaction contains 1.times. Cloned Pfu buffer, 3.0
mM MgCl.sub.2, 200 uM of each dNTP, 5 units exo-Pfu, 23 ng Pfu
FEN-1, 1 ng PEF, 300 nM each upstream primer PD415 or PD416 and the
fluorogenic probe (for example FAM-DABCYL): gcaaagtatcatccctccag.
The reactions are subjected to one cycle in a thermal cycler: 2
minutes at 95.degree. C., 1 minute at 55.degree. C., 1 minute at
72.degree. C. The fluorescence in then determined in a fluorescence
plate reader, such as Stratagene's FluorTracker or PE Biosystems'
7700 Sequence Detection System in Plate-Read Mode.
[0304] Generally, according to these methods wherein amplification
occurs by a non-PCR based method, amplification may be carried out
in the presence of a FEN nuclease, and amplification and cleavage
by the FEN nuclease occur simultaneously. Detection of released
labeled fragments is performed as described in the section entitled
"Cleavage Structure" and may occur concurrently with (real time) or
after (end-point) the amplification and cleavage process have been
completed.
[0305] Endpoint assays can be used to quantify amplified target
produced by non-PCR based methods wherein the amplification step is
carried out in the presence of a FEN nuclease (described
above).
[0306] Endpoint assays include, but are not limited to the
following.
[0307] A. Ligation chain reaction (LCR), as described in Landegren,
et al., 1988, Science, 241: 1077 and Barany, PCR Methods and
Applications 1: 5-16 (1991). An LCR product useful according to the
invention will be long enough such that the upstream primer and the
labeled downstream probe are separated by a gap larger than 8
nucleotides to allow for efficient cleavage by a FEN nuclease.
[0308] B. Self-sustained sequence replication amplification (3SR)
Fahy, et al. PCR Methods and Applications 1: 25-33 (1991).
Self-Sustained Sequence Replication Amplification (3SR) is a
technique which is similar to NASBA. Ehricht R, et al., Nucleic
Acids Res. 25: 4697-4699 (1997) have evolved the 3SR procedure to a
cooperatively coupled in vitro amplification system (CATCH). Thus,
in CATCH, a molecular beacon probe is used for real-time analysis
of an RNA amplicon. The synthetic target amplified has the
sequence: cctctgcagactactattacataatacgactcactatagggatc
tgcacgtattagcctatagtgagtcgtattaataggaaacaccaaagatgatatttcgtcacagcaagaattc-
agg. The 3SR reactions contain 40 mM Tris-HCl pH 8.0, 5 mM KCl, 30
mM MgCl.sub.2, 1 mM of each dNTP, 1 nM of the double stranded
target, 2 .mu.M P1: cctctgcagactactattac and P2:
cctgaattcttgctgtgacg, 5 mM DTT, 2 mM spermidine, 6 units/ul His
tagged HIV-1 reverse transcriptase, 3 units/ul T7-RNA polymerase
and 0.16 units/ul Escherichia coli RNase H. The 100 ul reactions
are incubated for 30 minutes at 42.degree. C.
[0309] Five .mu.l of each sample in duplicate are removed for
detection. Each reaction contains 1.times. Cloned Pfu buffer, 3.0
mM MgCl.sub.2, 200 uM of each dNTP, 5 units exo-Pfu, 23 ng Pfu
FEN-1, 1 ng PEF, 300 nM each upstream primer P1 and fluorogenic
probe (for example FAM-DABCYL): taggaaacaccaaagatgatattt. The
reactions are subjected to one cycle in a thermal cycler: 2 minutes
at 95.degree. C., 1 minute at 55.degree. C., 1 minute at 72.degree.
C. The fluorescence in then determined in a fluorescence plate
reader, such as Stratagene's FluorTracker or PE Biosystems' 7700
Sequence Detection System in Plate-Read Mode.
[0310] C. Rolling circle amplification is described in U.S. Pat.
No. 5,854,033 and the related Ramification-Extension Amplification
Method (RAM) (U.S. Pat. No. 5,942,391). Rolling circle
amplification adapted to the invention is described in Example 3
below.
[0311] Real-time assays can also be used to quantify amplified
target produced by non-PCR based methods wherein the amplification
step is carried out in the presence of a FEN nuclease (described
above). The method of rolling circle amplification (U.S. Pat. No.
5,854,033) is adapted to include secondary primers for
amplification and detection, in conjunction with a FEN nuclease and
a cleavable probe comprising a cleavage structure according to the
invention and is carried out at temperatures between 50-60.degree.
C.
[0312] The cleavage pattern of a FEN nuclease can be altered by the
presence of a single mismatched base located anywhere between 1 and
15 nucleotides from the 5' end of the primer wherein the DNA primer
is otherwise fully annealed. Typically, on a fully annealed
substrate, a FEN nuclease will exonucleolytically cleave the 5'
most nucleotide. However, a single nucleotide mismatch up to 15
nucleotides in from the 5' end promotes endonucleolytic cleavages.
This constitutes a 5' proofreading process in which the mismatch
promotes the nuclease action that leads to its removal. Thus, the
mechanism of FEN nuclease cleavage is shifted from predominantly
exonucleolytic cleavage to predominantly endonucleolytic cleavage
simply by the presence of a single mismatched base pair. Presumably
this occurs because a mismatch allows a short flap to be created
(Rumbaugh et al., 1999, J. Biol. Chem., 274:14602).
[0313] The method of the invention can be used to generate a signal
indicative of the presence of a sequence variation in a target
nucleic acid sequence, wherein a labeled cleavage structure
comprising a fully annealed DNA primer is formed by incubating a
target nucleic acid sequence with a nucleic acid polymerase (as
described in the section entitled, "Cleavage Structure") and
cleaving the labeled cleavage structure with a FEN nuclease wherein
the release of labeled fragments comprising endonucleolytic
cleavage products is indicative of the presence of a sequence
variation. Released labeled fragments are detected as described in
the section entitled, "Cleavage Structure".
V. Samples
[0314] The invention provides for a method of detecting or
measuring a target nucleic acid sequence in a sample, as defined
herein. As used herein, "sample" refers to any substance containing
or presumed to contain a nucleic acid of interest (a target nucleic
acid sequence) or which is itself a target nucleic acid sequence,
containing or presumed to contain a target nucleic acid sequence of
interest. The term "sample" thus includes a sample of target
nucleic acid sequence (genomic DNA, cDNA or RNA), cell, organism,
tissue, fluid or substance including but not limited to, for
example, plasma, serum, spinal fluid, lymph fluid, synovial fluid,
urine, tears, stool, external secretions of the skin, respiratory,
intestinal and genitourinary tracts, saliva, blood cells, tumors,
organs, tissue, samples of in vitro cell culture constituents,
natural isolates (such as drinking water, seawater, solid
materials,) microbial specimens, and objects or specimens that have
been "marked" with nucleic acid tracer molecules.
EXAMPLES
[0315] The invention is illustrated by the following nonlimiting
examples wherein the following materials and methods are employed.
The entire disclosure of each of the literature references cited
hereinafter are incorporated by reference herein.
Example 1
[0316] A target nucleic acid sequence can be detected and/or
measured by the following method. A labeled cleavage structure is
formed prior to the addition of a FEN nuclease by heating at
95.degree. C. for 5 minutes and then cooling to approximately
50-60.degree. C. (a) a sample containing a target nucleic acid
sequence (B in FIG. 3) with (b) an upstream oligonucleotide that
specifically hybridizes to the target nucleic acid sequence, (A, in
FIG. 3), and (c) a downstream, 5' end labeled oligonucleotide (C in
FIG. 3) that specifically hybridizes to a region of the target
nucleic acid sequence that is downstream of the hybridizing region
of oligonucleotide A. A polymerase that lacks a 5' to 3'
exonuclease activity but that possesses a 3' to 5' DNA synthetic
activity, such as the enzyme a) Yaq exo-, (prepared by mutagenesis
using the Stratagene QuikChange Site-Directed Mutagenesis kit,
catalog number #200518, to modify Taq polymerase (Tabor and
Richardson, 1985, Proc. Natl. Acad. Sci. USA, 82:1074)), a mutant
form of Taq polymerase that lacks 5' to 3' exonuclease activity, b)
Pfu, or c) a mutant form of Pfu polymerase that lacks 3' to 5'
exonuclease activity (exo-Pfu) is added and incubated under
conditions that permit the polymerase to extend oligonucleotide A
such that it partially displaces the 5' end of oligonucleotide C
(for example 72.degree. C. in 1.times.Pfu buffer (Stratagene) for 5
minutes to 1 hour. The displaced region of oligonucleotide C forms
a 5' flap that is cleaved upon the addition of a FEN nuclease.
[0317] A mutant form of Taq polymerase that lacks a 5' to 3'
exonuclease activity but that possesses a 3' to 5' DNA synthetic
activity comprises the following mutation: D144S/F667Y Taq wherein
D144S eliminates 5' to 3' exonuclease activity and F667Y improves
ddNTP incorporation.
[0318] Exo-mutants of PolI polymerase can be prepared according to
the method of Xu et al., 1997, J. Mol. Biol., 268: 284.
[0319] A labeled cleavage structure according to the invention is
cleaved with a preparation of PfuFEN-1 (i.e. cloned Pyrococcus
furiosus FEN-1 that is prepared as described below in Example 2).
Cleavage is carried out by adding 2 .mu.l of PfuFEN-1 to a 7 .mu.l
reaction mixture containing the following:
3 .mu.l cleavage structure (10 ng-10 .mu.g)
0.7 .mu.l 10.times.FEN nuclease buffer (10.times.FEN nuclease
buffer contains 500 mM Tris-HCl pH 8.0, 100 mM MgCl.sub.2)
2.00 .mu.l PfuFEN-1 enzyme or H.sub.2O
1.3 .mu.l H.sub.2O
7.00 .mu.l total volume
[0320] Samples are incubated for one hour at 50.degree. C. in a
Robocyler 96 hot top thermal cycler. Following the addition of 2
.mu.l of Sequencing Stop dye solution (included in the Stratagene
Cyclist DNA sequencing kit, catalog #200326, and described in
example 3), samples are heated at 99.degree. C. for five minutes.
Samples are loaded on an eleven inch long, hand-poured, 20%
acrylamide/bis acrylamide, 7M urea gel. The gel is run at 20 watts
until the bromophenol blue has migrated approximately 2/3 the total
distance. The gel is removed from the glass plates and soaked for
10 minutes in fix solution (15% methanol, 5% acetic acid) and then
for 10 minutes in water. The gel is placed on Whatmann 3 mm paper,
covered with plastic wrap and dried for 2 hours in a heated vacuum
gel dryer (.about.80.degree. C.). The gel is exposed overnight to
X-ray film to detect the presence of a signal that is indicative of
the presence of a target nucleic acid sequence.
Example 2
Cloning Pfu FEN-1
[0321] A thermostable FEN nuclease enzyme useful according to the
invention can be prepared according to the following method.
[0322] The thermostable FEN nuclease gene can be isolated from
genomic DNA derived from P. furiosus (ATCC#43587) according to
methods of PCR cloning well known in the art. The cloned PfuFEN-1
can be overexpressed in bacterial cells according to methods well
known in the art and described below.
[0323] The following pCAL-n-EK cloning oligonucleotides were
synthesized and purified: TABLE-US-00002 a.
5'GACGACGACAAGATGGGTGTCCCAATTGGTGAGATTATACCAAGAAAA G 3' and b.
5'GGAACAAGACCCGTTTATCTCTTGAACCAACTTTCAAGGGTTGATTGT TTTCCACT 3'.
[0324] The Affinity.RTM. Protein Expression and Purification System
was obtained from Stratagene and used according to the
manufacturer's protocols.
Amplification
[0325] The insert DNA was prepared by PCR amplification with
gene-specific primers (oligonucleotides a and b, described above)
that include 12 and 13-nucleotide sequences at the 5' ends that are
complementary to the pCAL-n-EK vector single-stranded tails, thus
allowing for directional cloning. The FEN-1 sequence was amplified
from genomic DNA derived from P. furiosus by preparing
amplification reactions (five independent 100 .mu.l reactions)
containing:
50 .mu.l 10.times. cPfu Buffer (Stratagene)
7.5 .mu.l Pfu Genomic DNA (approx: 100 ng/.mu.l)
7.5 .mu.l PfuTurbo (2.5 u/.mu.l), (Stratagene, Catalog #600250)
15 .mu.l mixed primer pair (100 ng/.mu.l each) (oligonucleotides a
and b, described above)
4 .mu.l 100 mM dNTP
416 .mu.l H.sub.2O
500 .mu.l total
[0326] and carrying out the amplification under the following
conditions using a Stratagene Robocycler 96 hot top thermal cycler:
TABLE-US-00003 Window 1 95.degree. C. 1 minute 1 cycle Window 2
95.degree. C. 1 minute 50.degree. C. 1 minute 30 cycles 72.degree.
C. 3 minutes
[0327] The PCR products from each of the five reactions were
combined into one tube, purified using StrataPrep PCR and eluted in
50 .mu.l 1 mM Tris-HCl pH 8.6. The FEN-1 PCR product was analyzed
on a gel and was determined to be approximately 1000 bp.
[0328] The PCR product comprising the fen-1 gene was cloned into
the pCALnEK LIC vector (Stratagene) by creating ligation
independent cloning termini (LIC), annealing the PCR product
comprising the fen-1 gene to the pCALnEK LIC vector (Stratagene),
and transforming cells with the annealing mixture according to the
following method. Briefly, following PCR amplification, the PCR
product is purified and treated with Pfu DNA polymerase in the
presence of dATP (according to the manual included with the
Affinity.RTM. Protein Expression and Purification System,
Stratagene, catalog #200326). In the absence of dTTP, dGTP and
dCTP, the 3' to 5'-exonuclease activity of Pfu DNA polymerase
removes at least 12 and 13 nucleotides at the respective 3' ends of
the PCR product. This activity continues until the first adenine is
encountered, producing a DNA fragment with 5'-extended
single-stranded tails that are complementary to the single-stranded
tails of the pCAL-n-EK vector.
Creating LIC Termini
[0329] LIC termini were created by preparing the following
mixture:
45 .mu.l purified PCR product (.about.0.5 .mu.g/.mu.l)
2.5 .mu.l 10 mM dATP
5 .mu.l 10.times.cPfu buffer
1 .mu.l cPfu (2.5 u/.mu.l)
0.5 .mu.l H.sub.2O
[0330] cPfu and cPfu buffer can be obtained from Stratagene (cPfu,
Stratagene Catalog #600153 and cPfu buffer, Stratagene Catalog
#200532).
[0331] Samples were incubated at 72.degree. C. for 20 minutes and
products were cooled to room temperature. To each sample was added
40 ng prepared pCALnEK LIC vector (the prepared vector is available
commercially from Stratagene in the Affinity LIC Cloning and
Protein Purification Kit (214405)). The vector and insert DNA are
combined, allowed to anneal at room temperature and transformed
into highly competent bacterial host cells (Wyborski et al., 1997,
Strategies, 10:1).
Preparing Cells for Production of FEN
[0332] Two liters of LB-AMP was inoculated with 20 ml of an
overnight culture of a FEN-1 clone (clone 3). Growth was allowed to
proceed for approximately 11 hours at which point cells had reached
an OD.sub.600=0.974. Cells were induced overnight (about 12 hours)
with 1 mM IPTG. Cells were collected by centrifugation and the
resulting cell paste was stored at -20.degree. C.
Purification of Tagged FEN-1
[0333] Cells were resuspended in 20 ml of Calcium binding
buffer
CaCl.sub.2 Binding Buffer
50 mM Tris-HCl (pH 8.0)
150 mM NaCl
1.0 mM MgOAc
2 mM CaCl.sub.2
[0334] The samples were sonicated with a Branson Sonicator using a
microtip. The output setting was 5 and the duty cycle was 90%.
Samples were sonicated three times and allowed to rest on ice
during the intervals. The sonicate was centrifuged at
26,890.times.g. Cleared supernatants were mixed with 1 ml of washed
(in CaCl.sub.2 binding buffer) calmodulin agarose (CAM agarose) in
a 50 ml conical tube and incubated on a slowly rotating wheel in a
cold room (4.degree. C.) for 5 hours. The CAM agarose was collected
by light centrifugation (5000 rpm in a table top centrifuge).
[0335] Following removal of the supernatant, the CAM agarose was
washed with 50 ml CaCl.sub.2 binding buffer and transferred to a
disposable drip column. The original container and pipet were
rinsed thoroughly to remove residual agarose. The column was rinsed
with approximately 200 ml of CaCl.sub.2 binding buffer.
[0336] Elution was carried out with 10 ml of 50 mM NaCl elution
buffer (50 mM NaCl, 50 mM Tris-HCl pH 8.0, 2 mM EGTA). 0.5 ml
fractions were collected. A second elution step was carried out
with 1M NaCl elution buffer wherein 0.5 ml fractions were
collected.
Evaluation of Purified Tagged FEN-1
[0337] Fractions containing CBP-tagged Pfu FEN-1 eluted in 1M NaCl
were boiled in SDS and analyzed by SDS-PAGE on a 4-20% gel stained
with Sypro Orange (FIG. 4).
[0338] The protein concentration of uncleaved FEN-1 was determined
to be approximately 150 ng/microliter (below).
Enterokinase Protease (EK) Cleavage of the Purified FEN-1
[0339] Fractions 3-9 were dialyzed in 50 mM NaCl, 50 mM Tris-HCl pH
8.0 and 2 mM CaCl.sub.2 overnight at 4.degree. C.
[0340] An opaque, very fine precipitate appeared in the dialyzed
FEN-1. When the sample was diluted 1/20 the precipitate was
removed. When the sample was diluted 1/3 insoluble material was
still detectable. The 1/3 diluted material was heated at 37.degree.
C. for 2 minutes and mixed with Tween 20 to a final concentration
of 0.1%. Upon the addition of the Tween 20, there was an almost
immediate formation of "strings" and much coarser solids in the
solution which could not be reversed even after the solution was
adjusted to 1M NaCl.
[0341] EK cleavage was carried out using as a substrate the sample
that was diluted 1/20 as well as with a dilute sample prepared by
rinsing the dialysis bag with 1.times.EK buffer.
[0342] EK cleavage was carried out by the addition of 1 .mu.l EK (1
u/.mu.l) overnight at room temperature (about 16 hours).
[0343] 100 .mu.l of STI agarose combined with 100 .mu.l of CAM
agarose were rinsed twice with 10 ml of 1.times.STI buffer (50 mM
Tris-HCl pH 8.0, 200 mM NaCl, 2 mM CaCl.sub.2, 0.1% Tween 20). NaCl
was added to the two EK samples to bring the final concentration to
200 mM NaCl. The two samples were combined and added to the rinsed
agarose. The samples were rotated slowly on a wheel at 4.degree. C.
for three hours and separated by light centrifugation in a table
top centrifuge (as described). The supernatant was removed and the
resin was rinsed twice with 500 .mu.l 1.times.STI. The two rinses
were combined and saved separately from the original supernatant.
Samples were analyzed by SDS-PAGE on a 4-20% gel.
[0344] The concentration of digested product was approximately 23
ng/.mu.l as determined by comparison to a Pfu standard at a
concentration of approximately 50 ng/ml.
Example 3
FEN Nuclease Activity
[0345] The endonuclease activity of a FEN nuclease and the cleavage
structure requirements of a FEN nuclease prepared as described in
Example 2 can be determined according to the methods described
either in the section entitled "FEN nucleases" or below.
[0346] Briefly, three templates (FIG. 2) are used to evaluate the
activity of a FEN nuclease according to the invention. Template 1
is a 5' .sup.33P labeled oligonucleotide (Heltest4) with the
following sequence: TABLE-US-00004
5'AAAATAAATAAAAAAAATACTGTTGGGAAGGGCGATCGGTGCG3'.
[0347] The underlined section of Heltest4 represents the region
complementary to M13mp18+. The cleavage product is an 18 nucleotide
fragment with the sequence AAAATAAATAAAAAAAAT. Heltest4 binds to
M13 to produce a complementary double stranded domain as well as a
non-complementary 5' overhang. This duplex forms template 2 (FIG.
2). Template 3 (FIG. 2) has an additional primer (FENAS) bound to
M13 which is directly adjacent to Heltest 4. The sequence of FENAS
is:
[0348] 5' CCATTCGCCATTCAGGCTGCGCA 3'. In the presence of template
3, a FEN nuclease binds the free 5' terminus of Heltest4, migrates
to the junction and cleaves Heltest4 to produce an 18 nucleotide
fragment. The resulting cleavage products are separated on a 6%
acrylamide, 7M urea sequencing gel.
[0349] Templates are prepared as described below: TABLE-US-00005
Template 1 Template 2 Template 3 Heltest4 14 .mu.l 14 .mu.l 14
.mu.l M13 ** 14 .mu.l 14 .mu.l FENAS ** ** 14 .mu.l H.sub.2O 28
.mu.l 14 .mu.l ** 10.times. Pfu Buff. 4.6 .mu.l 4.6 .mu.l 4.6
.mu.l
[0350] Pfu buffer can be obtained from Stratagene (Catalog
#200536).
[0351] The template mixture is heated at 95.degree. C. for five
minutes, cooled to room temperature for 45 minutes and stored at
4.degree. C. overnight.
The enzyme samples are as follows:
A. H.sub.2O (control)
B. 2 .mu.l undiluted uncleaved FEN-1 (.about.445 ng/.mu.l)
C. 2 .mu.l 1/10 dilution of uncleaved FEN-1 (.about.44.5
ng/.mu.l)
D. 2 .mu.l enterokinase protease (EK) cleaved FEN-1 (.about.23
ng/.mu.l)
[0352] The four reaction mixtures are mixed with the three
templates as follows
3 .mu.l template 1, template 2 or template 3
0.7 .mu.l 10.times. cloned Pfu buffer
0.6 .mu.l 100 mM MgCl.sub.2
2.00 .mu.l FEN-1 or H.sub.2O
7.00 .mu.l total volume
[0353] The reactions are allowed to proceed for 30 minutes at
50.degree. C. and stopped by the addition of 2 .mu.l formamide
"Sequencing Stop" solution to each sample. Samples are eated at
95.degree. C. for five minutes and loaded on a 6% acrylamide 7M
urea CastAway gel (Stratagene).
[0354] Alternatively, FEN nuclease activity can be analyzed in the
following buffer wherein a one hour incubation time is
utilized.
10.times.FEN Nuclease Buffer
500 mM Tris-HCl pH 8.0
100 mM MgCl.sub.2
[0355] The reaction mixture is as follows:
3 .mu.l template 1, template 2 or template 3
0.7 .mu.l 10.times.FEN nuclease buffer
2.00 .mu.l FEN-1 or H.sub.2O (A-D, above)
1.3 .mu.l H.sub.2O
7.00 .mu.l total volume
[0356] Samples are incubated for one hour at 50.degree. C. in the
Robocyler 96 hot top thermal cycler. Following the addition of 2
.mu.l of Sequencing Stop (95% formamide, 20 mM EDTA, 0.05%
bromophenol blue, 0.05% xylene cyanol, available from Stratagene)
dye solution, samples are heated at 99.degree. C. for five minutes.
Samples are loaded on an eleven inch long, hand-poured, 20%
acrylamide/bis acrylamide, 7M urea gel. The gel is run at 20 watts
until the bromophenol blue has migrated approximately 2/3 the total
distance. The gel is removed from the glass plates and soaked for
10 minutes in fix solution (15% methanol, 5% acetic acid) and then
for 10 minutes in water. The gel is placed on Whatmann 3 mm paper,
covered with plastic wrap and dried for 2 hours in a heated vacuum
gel dryer (.about.800 C). The gel is exposed overnight to X-ray
film.
[0357] An autoradiograph of a FEN-1 nuclease assay wherein
templates 1, 2 and 3 (prepared as described above) are cleaved by
the addition of:
A. H.sub.2O
B. 2 .mu.l 1 of CBP-tagged Pfu FEN-1
C. 2 .mu.l 1 of CBP-tagged Pfu FEN-1 diluted (1:10)
D. 2 .mu.l 1 of EK cleaved Pfu FEN-1
is presented in FIG. 5.
[0358] The lanes are as follows. Lanes 1A, 1B, 1C and 1D represent
template 1 cleaved with H.sub.2O, undiluted CBP-tagged Pfu FEN-1, a
1:10 dilution of CBP-tagged Pfu FEN-1 and EK cleaved Pfu FEN-1,
respectively. Lanes 2A, 2B, 2C and 2D represent template 2 cleaved
with H.sub.2O, undiluted CBP-tagged Pfu FEN-1, a 1:10 dilution of
CBP-tagged Pfu FEN-1 and EK cleaved Pfu FEN-1, respectively. Lanes
3A, 3B, 3C and 3D represent template 3 cleaved with H.sub.2O,
undiluted CBP-tagged Pfu FEN-1, a 1:10 dilution of CBP-tagged Pfu
FEN-1 and EK cleaved Pfu FEN-1, respectively.
[0359] Tagged Pfu FEN-1 contains the N-terminal CBP affinity
purification tag. Any differences in activity between tagged and
untagged versions of FEN-1 are due to differences in protein
concentration (concentrations of enzyme samples are provided above)
since the amounts of tagged versus untagged FEN-1 are not
equivalent. Both tagged and untagged Pfu FEN-1 demonstrate cleavage
activity.
[0360] FIG. 5 demonstrates the background level of cleavage in the
absence of FEN-1 (lanes 1A, 2A and 3A). Further, this figure
demonstrates that tagged Pfu FEN-1 cleaves more of template 2 as
compared to template 1. In particular, the greatest amount of
template 2 is cleaved in the presence of undiluted, tagged Pfu
FEN-1 (lane 2B). Analysis of template 3 demonstrates that the
greatest amount of template 3 is cleaved by undiluted, tagged Pfu
FEN-1 and the least amount of template 3 is cleaved by diluted
tagged FEN-1. Labeled probe migrates as a 40-43 nucleotide band.
FEN-1 preferentially cleaves template 3 (which comprises an
upstream primer) as compared to template 2. The cleavage product
bands are the major bands migrating at 16-20 nucleotides.
Heterogeneity in the labeled cleavage products is the result of
heterogeneity in the labeled substrate, which was not gel-purified
prior to use.
Example 4
PCR Amplification and Detection of .beta.-Actin in the Presence of
a FEN-1 Nuclease and a Tag Polymerase Deficient in 5' to 3'
Exonuclease Activity
[0361] A PCR assay is used to detect a target nucleic acid
sequence. According to the method of this assay, a PCR reaction is
carried out in the presence of a Taq polymerase deficient in 5' to
3' exonuclease activity (for example Yaq exo-), and a thermostable
FEN-1 nuclease (e.g. Pfu FEN-1, prepared as described in Example
2). Detection of the release of fluorescently labeled fragments
indicates the presence of the target nucleic acid sequence.
[0362] Duplicate PCR reactions containing 1.times. Sentinel
Molecular beacon core buffer, 3.5 mM MgCl.sub.2, 200 .mu.M of each
dNTP, a Taq polymerase deficient in 5' to 3' exonuclease activity
(.about.1.45 U), Pfu FEN-1 (.about.23 ng), PE Biosystems
.beta.-Actin primers (300 nM each) (CATALOG #600500) and
.beta.-actin specific fluorogenic probe (200 nM; 5' FAM-3'TAMRA+PE
Biosystems catalog #P/N 401846) were prepared. 10 ng of human
genomic DNA (Promega) was used as the target nucleic acid sequence
in each reaction. This reaction was performed in a 50 .mu.l volume.
Negative control reactions containing either Pfu FEN-1 alone, a Taq
polymerase deficient in 5' to 3' exonuclease activity alone or
reaction mixtures containing all components except a human genomic
DNA template were prepared. Positive control reactions comprising
2.5 Units of Taq 2000 were also prepared. Reactions were assayed in
a spectrofluorometric thermocycler (ABI 7700). Thermocycling
parameters were 95.degree. C. for 2 min and 40 cycles of 95.degree.
C. for 15 sec, 60.degree. C. for 60 sec and 72.degree. C. for 15
sec. Samples were interrogated during the annealing step.
[0363] As demonstrated in FIG. 6, no signal was generated in the
presence of either Pfu FEN-1 alone or a Taq polymerase deficient in
5' to 3' exonuclease activity alone. In the presence of both a Taq
polymerase deficient in 5' to 3' exonuclease activity and Pfu FEN-1
a signal was generated with a threshold cycle (Ct) of 26 and a
final fluorescence intensity (FI) of 12,000 units. In the presence
of Taq 2000 (a nucleic acid polymerase which has 5' to 3'
exonuclease activity) (Taqman) a signal was generated with a Ct of
23 and a FI of 17,000 units.
[0364] These results demonstrate that .beta.-actin DNA sequences
can be detected by a PCR assay wherein a signal is generated in the
presence of a Taq polymerase deficient in 5' to 3' exonuclease
activity and a thermostable FEN-1 nuclease. Further, the 5' to 3'
exonuclease activity that is absent in the Taq polymerase deficient
in 5' to 3' exonuclease activity can be restored, in trans by the
addition of Pfu FEN-1.
Example 5
PCR Amplification and Detection of .beta.-Actin in the Presence of
a FEN-1 Nuclease and a Pfu Polymerase Deficient in 5' to 3'
Exonuclease Activity
[0365] A PCR assay is used to detect a target nucleic acid
sequence. According to the method of this assay, a PCR reaction is
carried out in the presence of a Pfu polymerase (naturally lacking
5' to 3' exonuclease activity) or, in addition, Pfu polymerase
deficient in 3' to 5' exonuclease activity as well (for example
exo-Pfu), and a thermostable FEN-1 nuclease (Pfu FEN-1). Detection
of the release of fluorescently labeled fragments indicates the
presence of the target nucleic acid sequence.
[0366] Duplicate PCR reactions containing 1.times. Cloned Pfu
buffer (available from Stratagene, Catalog #200532), 3.0 mM
MgCl.sub.2, 200 .mu.M of each dNTP, 5 units of a Pfu polymerase
deficient in 3' to 5' exonuclease activity, tagged or untagged Pfu
FEN-1 (.about.23 ng), PEF (1 ng) (described in WO 98/42860), PE
Biosystems .beta.-Actin primers (300 nM each) (CATALOG #600500),
and fluorogenic probe (200 nM; 5' FAM-3'TAMRA-PE Biosystems catalog
#P/N 401846) were prepared. 10 ng of human genomic DNA (Promega)
was used as the target nucleic acid sequence in each reaction.
Reactions were performed in a 50 .mu.l volume. Negative control
reactions comprising a Pfu polymerase deficient in both 5' to 3'
and 3' to 5' exonuclease activities alone or containing all of the
components except the human genomic DNA template were also
prepared. A reaction mixture containing 2.5 Units of Taq 2000 was
prepared and used as a positive control. Reactions were analyzed in
a spectrofluorometric thermocycler (ABI 7700). Thermocycling
parameters were 95.degree. C. for 2 min and 40 cycles of 95.degree.
C. for 15 sec, 60.degree. C. for 60 sec and 72.degree. C. for 15
sec.
[0367] As demonstrated in FIG. 7, no signal was generated in the
presence of a Pfu polymerase, naturally deficient in 5' to 3'
exonuclease activity alone. In the presence of both a Pfu
polymerase deficient in 5' to 3' exonuclease activity and tagged
Pfu FEN-1 a signal was generated with a threshold cycle (Ct) of 23
and a final fluorescence intensity (FI) of 20,000 units. In the
presence of a Pfu polymerase deficient in 5' to 3' exonuclease
activity and untagged Pfu FEN-1 a signal was generated with a Ct of
21 and a final FI of 20,000 units. In the presence of Taq 2000, a
signal was generated with a Ct of 21 and a FI of 19,000 units
(TaqMan).
[0368] These results demonstrate that the presence of .beta.-actin
target can be detected by a PCR assay wherein a signal is generated
in the presence of a Pfu polymerase deficient in 5' to 3'
exonuclease activity and a thermostable FEN-1 nuclease. This signal
is comparable to the signal generated in the presence of Taq 2000
in the absence of FEN-1. Further, the 5' to 3' exonuclease activity
that is absent in a Pfu polymerase can be restored in trans by the
addition of Pfu FEN-1.
Example 6
[0369] An assay according to the invention involving rolling circle
amplification is performed using the human ornithine
transcarbamylase gene as a target, which is detected in human DNA
extracted from buffy coat by standard procedures. Target (400 ng)
is heat-denatured for 4 minutes at 97.degree. C., and incubated
under ligation conditions in the presence of two 5'-phosphorylated
oligonucleotides, an open circle probe and one gap oligonucleotide.
The open circle probe has the sequence: gaggagaataaaagtttctca
taagactcgtcatgtctcagcagcttctaacggtcactaatacgactcactataggttctgcctctgggaaca-
c, the gap nucleotide for the wild-type sequence is: tagtgatc.
FIGS. 8 and 9 depict rolling circle probes and rolling circle
amplification. The reaction buffer (40 ul) contains 5 units/.mu.l
of T4 DNA ligase (New England Biolabs), 10 mM Tris-HCl, pH 7.5, 0.2
M NaCl, 10 mM MgCl.sub.2, 4 mM ATP, 80 nM open circle probe and 100
nM gap oligonucleotide. After incubation for 25 minutes at
37.degree. C., 25 ul are removed and added to 25 ul of a solution
containing 50 mM Tris-HCl, pH 7.5, 10 mM MgCl.sub.2, 1 mM DTT, 400
.mu.M each of dTTP, dATP, dGTP, dCTP, 0.2 .mu.M rolling circle
replication primer: gctgagacatgacgagtc, phi29 DNA polymerase (160
ng/50 ul). The sample is incubated for 30 minutes at 30.degree.
C.
[0370] RNA is produced from a T7 promoter present in the open
circle probe, by the addition of a compensating buffer (a stock
solution or concentrate) that is diluted to achieve the following
concentration of reagents: 35 mM Tris-HCl, pH 8.2, 2 mM spermidine,
18 mm MgCl.sub.2, 5 mM GMP, 1 mM of ATP, CTP, GTP, 333 uM UTP, 667
uM Biotin-16-UTP, 0.03% Tween 20, 2 units per ul of T7 RNA
polymerase. RNA production is performed as described in U.S. Pat.
No. 5,858,033. The incubation is allowed to proceed for 90 minutes
at 37.degree. C.
[0371] Five .mu.l of each sample (the actual test sample, a (-)
ligase control sample, a (-) phi29 DNA polymerase control and a
(-)T7 RNA polymerase control) in duplicate are removed for
detection. The reverse transcription process includes the steps of
A) ligating the open circle, B) synthesizing rolling circle single
stranded DNA, C) making RNA (from a T7 promoter present in the open
circle probe), D) reverse transcribing the RNA to make cDNA, and E)
performing PCR amplification of the cDNA using primers and probes
for generation of an detection of FEN cleavage structures,
according to the invention. For reverse transcription, the reagents
and protocols supplied with the Stratagene Sentinel Single-Tube
RT-PCR Core Reagent Kit (Cat# 600505) are used, except for the
substitution of equal amounts of Yaq DNA polymerase for the Taq
2000 DNA polymerase which is recommended by the manufacturer. Each
reaction contains 1.times. Sentinel molecular beacon RT-PCR core
buffer, 3.5 mM MgCl.sub.2, 200 .mu.M of each dNTP, 5 units exo-Pfu,
23 ng Pfu FEN-1, 1 ng PEF, 500 nM each of the upstream primer:
aagtttctcataagactcgtcat, the reverse primer:
aggcagaacctatagtgagtcgt, and the fluorogenic probe (for example
FAM-DABCYL): agcttctaacggtcactaatacg. The reactions are subjected
to incubation for 30 minutes at 45.degree. C., 3 minutes at
95.degree. C., followed by one cycle in a thermal cycler: 2 minutes
at 95.degree. C., 1 minute at 50.degree. C., 1 minute at 72.degree.
C. The fluorescence in then determined in a fluorescence plate
reader, such as Stratagene's FluorTracker or PE Biosystems' 7700
Sequence Detection System in Plate-Read Mode.
[0372] A crosscheck for the efficiency of detection is possible
because of the incorporation of Biotin-16-UTP in the rolling circle
amplification RNA product. An aliquot of the reactions is captured
on glass slides (or alternatively in microwell plates) using an
immobilized capture probe. Detection of the captured RNA amplicon
is described in detail in U.S. Pat. No. 5,854,033, hereby
incorporated by reference.
OTHER EMBODIMENTS
[0373] Other embodiments will be evident to those of skill in the
art. It should be understood that the foregoing detailed
description is provided for clarity only and is merely exemplary.
The spirit and scope of the present invention are not limited to
the above examples, but are encompassed by the following claims.
Sequence CWU 1
1
21 1 43 DNA Artificial Sequence Description of Artificial Sequence
Synthetic oligonucleotide 1 aaaataaata aaaaaaatac tgttgggaag
ggcgatcggt gcg 43 2 18 DNA Artificial Sequence Description of
Artificial Sequence Synthetic oligonucleotide 2 aaaataaata aaaaaaat
18 3 23 DNA Artificial Sequence Description of Artificial Sequence
Synthetic oligonucleotide 3 ccattcgcca ttcaggctgc gca 23 4 15 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
primer 4 cgatcgagca agcca 15 5 14 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 5 cgagccgctc
gctg 14 6 40 DNA Artificial Sequence Description of Artificial
Sequence Synthetic primer 6 accgcatcga atgcatgtct cgggtaaggc
gtactcgacc 40 7 40 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 7 cgattccgct ccagacttct
cgggtgtact gagatcccct 40 8 20 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 8 aaggcgtact cgacctgaaa 20
9 21 DNA Artificial Sequence Description of Artificial Sequence
Synthetic probe 9 accatacgga taggggatct c 21 10 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic probe 10
gcaaagtatc atccctccag 20 11 120 DNA Artificial Sequence Description
of Artificial Sequence Synthetic oligonucleotide 11 cctctgcaga
ctactattac ataatacgac tcactatagg gatctgcacg tattagccta 60
tagtgagtcg tattaatagg aaacaccaaa gatgatattt cgtcacagca agaattcagg
120 12 20 DNA Artificial Sequence Description of Artificial
Sequence Synthetic oligonucleotide 12 cctctgcaga ctactattac 20 13
20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic oligonucleotide 13 cctgaattct tgctgtgacg 20 14 24 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
probe 14 taggaaacac caaagatgat attt 24 15 49 DNA Artificial
Sequence Description of Artificial Sequence Synthetic
oligonucleotide 15 gacgacgaca agatgggtgt cccaattggt gagattatac
caagaaaag 49 16 56 DNA Artificial Sequence Description of
Artificial Sequence Synthetic oligonucleotide 16 ggaacaagac
ccgtttatct cttgaaccaa ctttcaaggg ttgattgttt tccact 56 17 95 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
probe 17 gaggagaata aaagtttctc ataagactcg tcatgtctca gcagcttcta
acggtcacta 60 atacgactca ctataggttc tgcctctggg aacac 95 18 18 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
primer 18 gctgagacat gacgagtc 18 19 23 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 19 aagtttctca
taagactcgt cat 23 20 23 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 20 aggcagaacc tatagtgagt cgt
23 21 23 DNA Artificial Sequence Description of Artificial Sequence
Synthetic probe 21 agcttctaac ggtcactaat acg 23
* * * * *