U.S. patent application number 11/726598 was filed with the patent office on 2007-12-20 for human rnase h1 oligonucleotide compositions thereof.
This patent application is currently assigned to ISIS Pharmaceuticals, Inc.. Invention is credited to Stanley T. Crooke, Walter F. Lima, Muthiah Monoharan, Hongjiang Wu.
Application Number | 20070292875 11/726598 |
Document ID | / |
Family ID | 23622519 |
Filed Date | 2007-12-20 |
United States Patent
Application |
20070292875 |
Kind Code |
A1 |
Crooke; Stanley T. ; et
al. |
December 20, 2007 |
Human RNase H1 oligonucleotide compositions thereof
Abstract
The present invention provides oligonucleotides that can serve
as substrates for human Type 2 RNase H. The present invention is
also directed to methods of using these oligonucleotides in
enhancing antisense oligonucleotide therapies.
Inventors: |
Crooke; Stanley T.;
(Carlsbad, CA) ; Lima; Walter F.; (San Diego,
CA) ; Wu; Hongjiang; (Carlsbad, CA) ;
Monoharan; Muthiah; (Weston, MA) |
Correspondence
Address: |
WOODCOCK WASHBURN LLP
CIRA CENTRE, 12TH FLOOR
2929 ARCH STREET
PHILADELPHIA
PA
19104-2891
US
|
Assignee: |
ISIS Pharmaceuticals, Inc.
Carlsbad
CA
|
Family ID: |
23622519 |
Appl. No.: |
11/726598 |
Filed: |
March 21, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10616009 |
Jul 8, 2003 |
|
|
|
11726598 |
Mar 21, 2007 |
|
|
|
09409926 |
Sep 30, 1999 |
6617442 |
|
|
10616009 |
Jul 8, 2003 |
|
|
|
Current U.S.
Class: |
435/6.14 ;
536/124; 536/23.1 |
Current CPC
Class: |
C12N 2310/31 20130101;
C12N 2310/321 20130101; C12N 2310/321 20130101; C12N 9/22 20130101;
C07H 21/00 20130101; C12N 2310/3525 20130101; C12N 2310/322
20130101; C12N 2310/32 20130101; C12N 2310/3521 20130101; C12N
2310/321 20130101; C12N 15/113 20130101; C12N 2310/346 20130101;
C07K 2319/00 20130101; C12N 2310/3341 20130101 |
Class at
Publication: |
435/006 ;
536/124; 536/023.1 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/00 20060101 C07H021/00 |
Claims
1. A mixed sequence oligonucleotide comprising at least 12
nucleotides in length and having a 3' end and a 5' end and divided
into a first portion and a further portion, said first portion
comprising nucleotides that support cleavage of a complementary
target RNA by human RNase H1 polypeptide, said further portion
comprising nucleotides that do not support said cleavage by said
RNase H1, wherein said first portion comprises at least 6
contiguous nucleotides and is positioned in said oligonucleotide
such that at least one of said at least 6 contiguous nucleotides is
8 to 12 nucleotides from the 3' end of said oligonucleotide.
2. A mixed sequence oligonucleotide comprising at least 12
nucleotides and having a 3' end and a 5' end and divided into a
first portion and a further portion, said first portion supports
cleavage of a complementary target RNA by a purified or isolated
human RNase H1 polypeptide, said further portion does not support
said cleavage by said purified or isolated RNase H1 and where said
first portion comprises at least 6 contiguous nucleotides and is
positioned in said oligonucleotide such that at least one of said
at least 6 contiguous nucleotides is 8 to 12 nucleotides from the
3' end of said oligonucleotide.
3. The oligonucleotide of claim 2 comprising from about 12 to about
50 nucleotides.
4. The oligonucleotide of claim 2 comprising from about 12 to about
25 nucleotides.
5. A mixed sequence oligonucleotide comprising at least 12
nucleotides and having a 3' end and a 5' end and divided into a
first portion and a further portion, said first portion supports
cleavage of a complementary target RNA by human RNase H1
polypeptide, said further portion does not support said cleavage by
said RNase H1; wherein: said first portion comprises at least 6
nucleotides and is positioned in said oligonucleotide such that at
least one of said at least 6 nucleotides is 8 to 12 nucleotides
from the 3' end of said oligonucleotide; said nucleotides of said
first portion have B-form conformational geometry and are joined
together in a continuous sequence, and at least one of said
nucleotides having B-form conformational geometry is not a
2'-deoxyribonucleotide.
6. A mixed sequence oligonucleotide comprising at least 12
nucleotides and having a 3' end and a 5' end and divided into a
first portion and a further portion, said first portion supports
cleavage of a complementary target RNA by human RNase H1
polypeptide, said further portion does not support said cleavage by
said RNase H1; wherein: said first portion comprises at least 6
contiguous nucleotides and is positioned in said oligonucleotide
such that at least one of said at least 6 contiguous nucleotides is
8 to 12 nucleotides from the 3' end of said oligonucleotide; and
each of said nucleotides of said first portion is, independently, a
2'-SCH.sub.3 ribonucleotide, a 2'-NH.sub.2 ribonucleotide, a
2'-NH(C.sub.1-C.sub.2 alkyl) ribonucleotide, a 2'-N(C.sub.1-C.sub.2
alkyl).sub.2 ribonucleotide, a 2'-CF.sub.3 ribonucleotide, a
2'=CH.sub.2 ribonucleotide, a 2'=CHF ribonucleotide, a 2'=CF.sub.2
ribonucleotide, a 2'-CH.sub.3 ribonucleotide, a 2'-C.sub.2H.sub.5
ribonucleotide, a 2'-CH.dbd.CH.sub.2 ribonucleotide or a 2'-CCH
ribonucleotide.
7. The oligonucleotide of claim 2 wherein at least one of said
nucleotides of said first portion is a 2'-deoxyribonucleotide.
8. The oligonucleotide of claim 2 wherein said nucleotides of said
first portion are joined together in said continuous sequence by
phosphorothioate linkages.
9. The oligonucleotide of claim 2 wherein said further portion
includes a plurality of nucleotides, at least some of said
nucleotides comprise a 2' substituent group wherein each
substituent group is, independently, hydroxyl, C.sub.1-C.sub.20
alkyl, C.sub.2-C.sub.20 alkenyl, C.sub.2-C.sub.20 alkynyl, halogen,
amino, thiol, keto, carboxyl, nitro, nitroso, nitrile,
trifluoromethyl, trifluoromethoxy, O-alkyl, O-alkenyl, O-alkynyl,
S-alkyl, S-alkenyl, S-alkynyl, NH-alkyl, NH-alkenyl, NH-alkynyl,
N-dialkyl, O-aryl, S-aryl, NH-aryl, O-aralkyl, S-aralkyl,
NH-aralkyl, N-phthalimido, imidazole, azido, hydrazino,
hydroxylamino, isocyanato, sulfoxide, sulfone, sulfide, disulfide,
silyl, aryl, heterocycle, carbocycle, intercalator, reporter
molecule, conjugate, polyamine, polyamide, polyalkylene glycol, or
polyether; or each substituent group has one of formula I or II:
##STR3## wherein: Z.sub.0 is O, S or NH; J is a single bond, O or
C(.dbd.O); E is C.sub.1-C.sub.10 alkyl, N(R.sub.1)(R.sub.2),
N.dbd.C(R.sub.1)(R.sub.2), or has one of formula III or IV;
##STR4## each R.sub.6, R.sub.7, R.sub.8, R.sub.9 and R.sub.10 is,
independently, hydrogen, C(O)R.sub.11, substituted or unsubstituted
C.sub.1-C.sub.10 alkyl, substituted or unsubstituted
C.sub.2-C.sub.10 alkenyl, substituted or unsubstituted
C.sub.2-C.sub.10 alkynyl, alkylsulfonyl, arylsulfonyl, a chemical
functional group or a conjugate group, wherein the substituent
groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl,
phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and
alkynyl; or optionally, R.sub.7 and R.sub.8, together form a
phthalimido moiety with the nitrogen atom to which they are
attached; or optionally, R.sub.9 and R.sub.10, together form a
phthalimido moiety with the nitrogen atom to which they are
attached; each R.sub.11 is, independently, substituted or
unsubstituted C.sub.1-C.sub.10 alkyl, trifluoromethyl,
cyanoethyloxy, methoxy, ethoxy, t-butoxy, allyloxy,
9-fluorenylmethoxy, 2-(trimethylsilyl)-ethoxy,
2,2,2-trichloroethoxy, benzyloxy, butyryl, iso-butyryl, phenyl or
aryl; each R.sub.1 and R.sub.2 is, independently, H, a nitrogen
protecting group, substituted or unsubstituted C.sub.1-C.sub.10
alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl,
substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein said
substitution is OR.sub.3, SR.sub.3, NH.sub.3.sup.+,
N(R.sub.3)(R.sub.4), guanidino or acyl where said acyl is an acid
amide or an ester; or R.sub.1 and R.sub.2, together, are a nitrogen
protecting group or are joined in a ring structure that optionally
includes an additional heteroatom selected from N and O; or
R.sub.1, T and L, together, are a chemical functional group; each
R.sub.3 and R.sub.4 is, independently, H, C.sub.1-C.sub.10 alkyl, a
nitrogen protecting group, or R.sub.3 and R.sub.4, together, are a
nitrogen protecting group; or R.sub.3 and R.sub.4 are joined in a
ring structure that optionally includes an additional heteroatom
selected from N and O; Z.sub.4 is OX, SX, or N(X).sub.2; each X is,
independently, H, C.sub.1-C.sub.8 alkyl, C.sub.1-C.sub.8 haloalkyl,
C(.dbd.NH)N(H)R.sub.5, C(.dbd.O)N(H)R.sub.5 or
OC(.dbd.O)N(H)R.sub.5; R.sub.5 is H or C.sub.1-C.sub.8 alkyl;
Z.sub.1, Z.sub.2 and Z.sub.3 comprise a ring system having from
about 4 to about 7 carbon atoms or having from about 3 to about 6
carbon atoms and 1 or 2 hetero atoms wherein said hetero atoms are
selected from oxygen, nitrogen and sulfur and wherein said ring
system is aliphatic, unsaturated aliphatic, aromatic, or saturated
or unsaturated heterocyclic; Z.sub.5 is alkyl or haloalkyl having 1
to about 10 carbon atoms, alkenyl having 2 to about 10 carbon
atoms, alkynyl having 2 to about 10 carbon atoms, aryl having 6 to
about 14 carbon atoms, N(R.sub.1)(R.sub.2) OR, halo, SR.sub.1 or
CN; each q.sub.1 is, independently, an integer from 1 to 10; each
q.sub.2 is, independently, 0 or 1; q.sub.3 is 0 or an integer from
1 to 10; q.sub.4 is an integer from 1 to 10; and q.sub.5 is 0, 1 or
2; provided that when q.sub.3 is 0, q.sub.4 is greater than 1.
10. The oligonucleotide of claim 2 wherein said further portion
comprises a plurality of nucleotides and wherein each of said
nucleotides of said further portion is, independently, a 2'-F
ribonucleotide, a 2'-O-(C.sub.1-C.sub.6 alkyl) ribonucleotide, or a
2'-O-(C.sub.1-C.sub.6 substituted alkyl) ribonucleotide wherein the
substitution is C.sub.1-C.sub.6 ether, C.sub.1-C.sub.6 thioether,
amino, amino(C.sub.1-C.sub.6 alkyl) or amino(C.sub.1-C.sub.6
alkyl).sub.2.
11. The oligonucleotide of claim 2 wherein said further portion
comprises a plurality of nucleotides and wherein at least two of
said nucleotides of said further portion are joined together in a
continuous sequence that is positioned 3' to said first
portion.
12. The oligonucleotide of claim 2 wherein said further portion
comprises a plurality of nucleotides and wherein at least two of
said nucleotides of said further portion are joined together in a
continuous sequence that is positioned 5' to said first
portion.
13. The oligonucleotide of claim 2 wherein said further portion
comprises a plurality of nucleotides and wherein at least two of
said nucleotides of said further portion are joined together in a
continuous sequence that is positioned 3' to said first portion and
at least two of said further portion are joined together in a
continuous sequence that is positioned 5' to said first
portion.
14. The oligonucleotide of claim 2 wherein said further portion
comprises a plurality of nucleotides and wherein at least four of
said nucleotides of said further portion are joined together in a
continuous sequence that is positioned 3' to said first
portion.
15. The oligonucleotide of claim 2 wherein said further portion
comprises a plurality of nucleotides and wherein at least four of
said nucleotides of said further portion are joined together in a
continuous sequence that is positioned 5' to said first
portion.
16. The oligonucleotide of claim 2 wherein said further portion
comprises a plurality of nucleotides and wherein at least four of
said nucleotides of said further portion are joined together in a
continuous sequence that is positioned 3' to said first portion and
at least four of said nucleotides of said further portion are
joined together in a continuous sequence that is positioned 5' to
said first portion.
17. A mixed sequence oligonucleotide comprising at least 8
oligonucleotides and having a 2'-OH arabinonucleotide sequence of
at least 6 nucleotides and where at least one of said
arabinonucleotides is positioned 8 to 12 nucleotides from the 3'
end of said oligonucleotide, and wherein said oligonucleotide
supports cleavage of a complementary target RNA by human RNase H1
polypeptide.
18. A mixed sequence oligonucleotide comprising at least 8
oligonucleotides and having a a 2'-F arabinonucleotide sequence of
at least 6 nucleotides and where at least one of said 2'-F
arabinonucleotides is positioned 8 to 12 nucleotides from the 3'
end of said oligonucleotide, and wherein said oligonucleotide
supports cleavage of a complementary target RNA by human RNase H1
polypeptide.
19. A mixed sequence oligonucleotide comprising 8 to 25 nucleotides
and having a 2'-OH arabinonucleotide sequence wherein at least one
of the nucleotides of said sequence is positioned 8 to 12
nucleotides from the 3' end of said oligonucleotide, wherein said
oligonucleotide supports cleavage of a complementary target RNA by
human RNase H1 polypeptide.
20. A mixed sequence oligonucleotide comprising 8 to 25 nucleotides
and having a 2'-F arabinonucleotide sequence wherein at least one
of the nucleotides of said sequence is positioned 8 to 12
nucleotides from the 3' end of said oligonucleotide, wherein said
oligonucleotide supports cleavage of a complementary target RNA by
human RNase H1 polypeptide.
21. A chimeric oligonucleotide comprising 8 to 25 nucleotides and
having a portion that supports cleavage of a complementary target
RNA by human RNase H1 polypeptide wherein said portion supporting
said cleavage is at least 6 contiguous nucleotides in length and is
positioned in said oligonucleotide such that at least one of said
at least 6 contiguous nucleotides is positioned 8 to 12 nucleotides
from the 3' end of said oligonucleotide, wherein said
oligonucleotide supports cleavage of a complementary target RNA by
human RNase H1 polypeptide.
22. The oligonucleotide of claim 21 wherein said RNase H1
polypeptide is a purified or isolated polypeptide.
23. A method comprising contacting an oligonucleotide according to
claim 2 with RNA or DNA in vitro.
24. A method comprising contacting an oligonucleotide according to
claim 5 with RNA or DNA in vitro.
25. A method comprising contacting an oligonucleotide according to
claim 6 with RNA or DNA in vitro.
26. A method comprising contacting an oligonucleotide according to
claim 17 with RNA or DNA in vitro.
27. A method comprising contacting an oligonucleotide according to
claim 18 with RNA or DNA in vitro.
28. A method comprising contacting an oligonucleotide according to
claim 19 with RNA or DNA in vitro.
29. A method comprising contacting an oligonucleotide according to
claim 20 with RNA or DNA in vitro.
30. A method comprising contacting an oligonucleotide according to
claim 2 with RNA or DNA in a cellular assay.
31. A method comprising contacting an oligonucleotide according to
claim 5 with RNA or DNA in a cellular assay.
32. A method comprising contacting an oligonucleotide according to
claim 6 with RNA or DNA in a cellular assay.
33. A method comprising contacting an oligonucleotide according to
claim 17 with RNA or DNA in a cellular assay.
34. A method comprising contacting an oligonucleotide according to
claim 18 with RNA or DNA in a cellular assay.
35. A method comprising contacting an oligonucleotide according to
claim 19 with RNA or DNA in a cellular assay.
36. A method comprising contacting an oligonucleotide according to
claim 20 with RNA or DNA in a cellular assay.
37. A method comprising contacting an oligonucleotide according to
claim 21 with RNA or DNA in vitro.
38. A method comprising contacting an oligonucleotide according to
claim 21 with RNA or DNA in a cellular assay.
39. A method comprising contacting an oligonucleotide according to
claim 22 with RNA or DNA in vitro.
40. A method comprising contacting an oligonucleotide according to
claim 22 with RNA or DNA in a cellular assay.
41. A method comprising: selecting a parameter associated with
interaction of an oligonucleotide, a target nucleic acid and human
RNase H1 polypeptide, selecting a cell containing human RNase H1
polypeptide and a target nucleic acid, selecting first and second
oligonucleotides each having a sequence substantially commpementary
to said target nucleic acid, contacting said cell with said first
oligonucleotide and measuring said parameter, contacting said cell
with said second oligonucleotide and measuring said parameter,
comparing measurements, and using said comparison to select one of
said first or said second oligonucleotides for modulating said
target in the presence of said human RNase H1 polypeptide in said
cell.
42. The method of claim 41 wherein said parameter is one of site
preference for cleavage, sequence preference for cleavage or
processivity of cleavage.
43. The method of claim 41 wherein said measurement is a
measurement of at least one of K.sub.d, K.sub.max, K.sub.m or
K.sub.cat.
44. An oligonucleotide for modulating a target nucleic acid in the
presence of human RNase H1 polypeptide wherein said oligonucleotide
is identified using the process of claim 41.
45. An optimized oligonucleotide for modulating a target nucleic
acid wherein said optimized oligonucleotide is identified using the
process of claim 41.
46. The method of claim 41 further comprising: selecting a further
oligonucleotide, contacting said cell with said further
oligonucleotide and measuring said parameter, comparing the
measurement of this further oligonucleotide to that of said
selected first or said second oligonucleotides and selecting one of
said first, said second or said further oligonucleotide.
Description
CROSS REFERENCE
[0001] This application is a continuation of U.S. patent
application Ser. No. 10/616,009, filed Jul. 8, 2003, now pending,
which is a continuation of U.S. patent application Ser. No.
09/409,926, filed Sep. 30, 1999, now U.S. Pat. No. 6,617,442, both
of which are hereby incorporated by reference in their
entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to a human Type 2 RNase H
which has now been cloned, expressed and purified to
electrophoretic homogeneity. The present invention further relates
to oligonucleotide compositions that may serve as substrates for
human RNase H1 or human Type 2 RNase H.
BACKGROUND OF THE INVENTION
[0003] RNase H hydrolyzes RNA in RNA-DNA hybrids. This enzyme was
first identified in calf thymus but has subsequently been described
in a variety of organisms (Stein, H. and Hausen, P., Science, 1969,
166, 393-395; Hausen, P. and Stein, H.,Eur. J. Biochem., 1970, 14,
278-283). RNase H activity appears to be ubiquitous in eukaryotes
and bacteria (Itaya, M. and Kondo K. Nucleic Acids Res., 1991, 19,
4443-4449; Itaya et al., Mol. Gen. Genet., 1991 227, 438-445;
Kanaya, S., and Itaya, M., J. Biol. Chem., 1992, 267, 10184-10192;
Busen, W., J. Biol. Chem., 1980, 255, 9434-9443; Rong, Y. W. and
Carl, P. L., 1990, Biochemistry 29, 383-389; Eder et al.,
Biochimie, 1993 75, 123-126). Although RNase Hs constitute a family
of proteins of varying molecular weight, nucleolytic activity and
substrate requirements appear to be similar for the various
isotypes. For example, all RNase Hs studied to date function as
endonucleases, exhibiting limited sequence specificity and
requiring divalent cations (e.g., Mg.sup.2+, Mn.sup.2+) to produce
cleavage products with 5' phosphate and 3' hydroxyl termini
(Crouch, R. J., and Dirksen, M. L., Nuclease, Linn, S, M., &
Roberts, R. J., Eds., Cold Spring Harbor Laboratory Press,
Plainview, N.Y. 1982, 211-241).
[0004] In addition to playing a natural role in DNA replication,
RNase H has also been shown to be capable of cleaving the RNA
component of certain oligonucleotide-RNA duplexes. While many
mechanisms have been proposed for oligonucleotide mediated
destabilization of target RNAs, the primary mechanism by which
antisense oligonucleotides are believed to cause a reduction in
target RNA levels is through this RNase H action. Monia et al., J.
Biol. Chem., 1993, 266:13, 14514-14522. In vitro assays have
demonstrated that oligonucleotides that are not substrates for
RNase H can inhibit protein translation (Blake et al.,
Biochemistry, 1985, 24, 6139-4145) and that oligonucleotides
inhibit protein translation in rabbit reticulocyte extracts that
exhibit low RNase H activity. However, more efficient inhibition
was found in systems that supported RNase H activity (Walder, R. Y.
and Walder, J. A., Proc. Nat'l Acad. Sci. USA, 1988, 85, 5011-5015;
Gagnor et al., Nucleic Acid Res., 1987, 15, 10419-10436; Cazenave
et al., Nucleic Acid Res., 1989, 17, 4255-4273; and Dash et al.,
Proc. Nat'l Acad. Sci. USA, 1987, 84, 7896-7900.
[0005] Oligonucleotides commonly described as "antisense
oligonucleotides" comprise nucleotide sequences sufficient in
identity and number to effect specific hybridization with a
particular nucleic acid. This nucleic acid or the protein(s) it
encodes is generally referred to as the "target." Oligonucleotides
are generally designed to bind either directly to mRNA transcribed
from, or to a selected DNA portion of, a preselected gene target,
thereby modulating the amount of protein translated from the mRNA
or the amount of mRNA transcribed from the gene, respectively.
Antisense oligonucleotides may be used as research tools,
diagnostic aids, and therapeutic agents.
[0006] "Targeting" an oligonucleotide to the associated nucleic
acid, in the context of this invention, also refers to a multistep
process which usually begins with the identification of the nucleic
acid sequence whose function is to be modulated. This may be, for
example, a cellular gene (or mRNA transcribed from the gene) whose
expression is associated with a particular disorder or disease
state, or a foreign nucleic acid from an infectious agent. The
targeting process also includes determination of a site or sites
within this gene for the oligonucleotide interaction to occur such
that the desired effect, either detection or modulation of
expression of the protein, will result.
[0007] RNase H1 from E.coli is the best-characterized member of the
RNase H family. The 3-dimensional structure of E.coli RNase HI has
been determined by x-ray crystallography, and the key amino acids
involved in binding and catalysis have been identified by
site-directed mutagenesis (Nakamura et al., Proc. Natl. Acad. Sci.
USA, 1991, 88, 11535-11539; Katayanagi et al., Nature, 1990, 347,
306-309; Yang et al., Science, 1990, 249, 1398-1405; Kanaya et al.,
J. Biol. Chem., 1991, 266, 11621-11627). The enzyme has two
distinct structural domains. The major domain consists of four
helices and one large sheet composed of three antiparallel strands.
The Mg.sup.2+ binding site is located on the sheet and consists of
three amino acids, Asp-10, Glu-48, and Gly-11 (Katayanagi et al.,
Proteins: Struct., Funct., Genet., 1993, 17, 337-346). This
structural motif of the Mg.sup.2+ binding site surrounded by
strands is similar to that in DNase 3 (Suck, D., and Oefner, C.,
Nature, 1986, 321, 620-625). The minor domain is believed to
constitute the predominant binding region of the enzyme and is
composed of an helix terminating with a loop. The loop region is
composed of a cluster of positively charged amino acids that are
believed to bind electrostatistically to the minor groove of the
DNA/RNA heteroduplex substrate. Although the conformation of the
RNA/DNA substrate can vary, from A-form to B-form depending on the
sequence composition, in general RNA/DNA heteroduplexes adopt an
A-like geometry (Pardi et al., Biochemistry, 1981, 20, 3986-3996;
Hall, K. B., and Mclaughlin, L. W., Biochemistry, 1991, 30,
10606-10613; Lane et al., Eur. J. Biochem., 1993, 215, 297-306).
The entire binding interaction appears to comprise a single helical
turn of the substrate duplex. Recently the binding characteristics,
substrate requirements, cleavage products and effects of various
chemical modifications of the substrates on the kinetic
characteristics of E.coli RNase HI have been studied in more detail
(Crooke, S. T. et al., Biochem. J., 1995, 312, 599-608; Lima, W. F.
and Crooke, S. T., Biochemistry, 1997, 36, 390-398; Lima, W. F. et
al., J. Biol. Chem., 1997, 272, 18191-18199; Tidd, D. M. and
Worenius, H. M., Br. J. Cancer, 1989, 60, 343; Tidd, D. M. et al.,
Anti-Cancer Drug Des., 1988, 3, 117.
[0008] In addition to RNase HI, a second E.coli RNase H, RNase HII
has been cloned and characterized (Itaya, M., Proc. Natl. Acad.
Sci. USA, 1990, 87, 8587-8591). It is comprised of 213 amino acids
while RNase HI is 155 amino acids long. E. coli RNase HIM displays
only 17% homology with E.coli RNase HI. An RNase H cloned from S.
typhimurium differed from E.coli RNase HI in only 11 positions and
was 155 amino acids in length (Itaya, M. and Kondo K., Nucleic
Acids Res., 1991, 19, 4443-4449; Itaya et al., Mol. Gen. Genet.,
1991, 227, 438-445). An enzyme cloned from S. cerevisae was 30%
homologous to E.coli RNase HI (Itaya, M. and Kondo K., Nucleic
Acids Res., 1991, 19,4443-4449; Itaya et al., Mol. Gen. Genet.,
1991, 227, 438-445). Thus, to date, no enzyme cloned from a species
other than E. coli has displayed substantial homology to E.coli
RNase H II.
[0009] Proteins that display RNase H activity have also been cloned
and purified from a number of viruses, other bacteria and yeast
(Wintersberger, U. Pharmac. Ther., 1990, 48, 259-280). In many
cases, proteins with RNase H activity appear to be fusion proteins
in which RNase H is fused to the amino or carboxy end of another
enzyme, often a DNA or RNA polymerase. The RNase H domain has been
consistently found to be highly homologous to E.coli RNase HI, but
because the other domains vary substantially, the molecular weights
and other characteristics of the fusion proteins vary widely.
[0010] In higher eukaryotes two classes of RNase H have been
defined based on differences in molecular weight, effects of
divalent cations, sensitivity to sulfhydryl agents and
immunological cross-reactivity (Busen et al., Eur. J. Biochem.,
1977, 74, 203-208). RNase H Type 1 enzymes are reported to have
molecular weights in the 68-90 kDa range, be activated by either
Mn.sup.2+ or Mg.sup.2+ and be insensitive to sulfhydryl agents. In
contrast, RNase H Type 2 enzymes have been reported to have
molecular weights ranging from 31-45 kDa, to require Mg.sup.2+ to
be highly sensitive to sulfhydryl agents and to be inhibited by
Mn.sup.2+ (Busen, W., and Hausen, P., Eur. J. Biochem., 1975, 52,
179-190; Kane, C. M., Biochemistry, 1988, 27, 3187-3196; Busen, W.,
J. Biol. Chem., 1982, 257, 7106-7108.).
[0011] An enzyme with Type 2 RNase H characteristics has been
purified to near homogeneity from human placenta (Frank et al.,
Nucleic Acids Res., 1994, 22, 5247-5254). This protein has a
molecular weight of approximately 33 kDa and is active in a pH
range of 6.5-10, with a pH optimum of 8.5-9. The enzyme requires
Mg.sup.2+ and is inhibited by Mn.sup.2+ and n-ethyl maleimide. The
products of cleavage reactions have 3' hydroxyl and 5' phosphate
termini.
[0012] Despite the substantial information about members of the
RNase family and the cloning of a number of viral, prokaryotic and
yeast genes with RNase H activity, until now, no mammalian RNase H
had been cloned. This has hampered efforts to understand the
structure of the enzyme(s), their distribution and the functions
they may serve.
[0013] In the present invention, a cDNA of human RNase H with Type
2 characteristics and the protein expressed thereby are
provided.
SUMMARY OF THE INVENTION
[0014] The present invention provides oligonucleotides that can
serve as substrates for human RNase H1. These oligonucleotides are
mixed sequence oligonucleotides comprising at least two portions
wherein a first portion is capable of supporting human RNase H1
cleavage of a complementary target RNA and a further portion which
is not capable of supporting such human RNase H1 cleavage.
[0015] The present invention provides a mixed sequence
oligonucleotide comprising at least 12 nucleotides and having a 3'
end and a 5' end, said oligonucleotide being divided into a first
portion and a further portion,
[0016] said first portion being capable of supporting cleavage of a
complementary target RNA by human RNase H1 polypeptide,
[0017] said further portion being incapable of supporting said
RNase H cleavage;
[0018] wherein said first portion comprises at least 6 nucleotides
and is positioned in said oligonucleotide such that at least one of
said 6 nucleotides is 8 to 12 nucleotides from the 3' end of said
oligonucleotide.
[0019] In a preferred embodiment the oligonucleotide comprises at
least one CA nucleotide sequence. In another embodiment the first
portion of the mixed sequence oligonucleotide of the present
invention comprises nucleotides having a B-form conformational
geometry. In a further embodiment each of the nucleotides of the
first portion of the oligonucleotide are 2'-deoxyribonucleotides.
In a still further embodiment each of the nucleotides of the first
portion of the oligonucleotide is a 2'-F arabinonucleotide or a
2'-OH arabinonucleotide. In yet another embodiment the nucleotides
of the first portion are joined together in a continuous sequence
by phosphate, phosphorothioate, phosphorodithioate or
boranophosphate linkages. In yet a further embodiment all of the
nucleotides of the further portion of the oligonucleotide are
joined together in a continuous sequence by 3'-5' phosphodiester,
2'-5' phosphodiester, phosphorothioate, Sp phosphorothioate, Rp
phosphorothioate, phosphorodithioate, 3'-deoxy-3'-amino
phosphoroamidate, 3'-methylenephosphonate, methylene(methylimino),
dimethylhydrazino, amide 3, amide 4 or boranophosphate
linkages.
[0020] Yet another object of the present invention is to provide
methods for identifying agents which modulate activity and/or
levels of human RNase H1. In accordance with this aspect, the
polynucleotides and polypeptides of the present invention are
useful for research, biological and clinical purposes. For example,
the polynucleotides and polypeptides are useful in defining the
interaction of human RNase H1 and antisense oligonucleotides and
identifying means for enhancing this interaction so that antisense
oligonucleotides are more effective at inhibiting their target
mRNA.
[0021] Yet another object of the present invention is to provide a
method of prognosticating efficacy of antisense therapy of a
selected disease which comprises measuring the level or activity of
human RNase H in a target cell of the antisense therapy. Similarly,
oligonucleotides can be screened to identify those oligonucleotides
which are effective antisense agents by measuring binding of the
oligonucleotide to the human RNase H1.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1 shows the effects of conditions on human RNase H1
activity.
[0023] FIG. 2 shows a denaturing polyacrylamide gel analysis of
human RNase H1 cleavage of a 17-mer RNA-DNA gapmer duplex.
[0024] FIG. 3 shows analysis of human Rnase H1 cleavage of a 25-mer
Ras RNA hybridized with phosphodiester oligodeoxynucleotides of
different lengths.
[0025] FIG. 4 shows analysis of human RNase H1 cleavage of RNA-DNA
duplexes with different sequences, length and 3' or 5'
overhangs.
[0026] FIG. 5 shows product and processivity analysis of human
RNase H1 cleavage on 17-mer Ras RNA-DNA duplexes.
[0027] FIG. 6 provides the human Type 2 RNase H primary sequence
(286 amino acids; SEQ ID NO: 1) and sequence comparisons with
chicken (293 amino acids; SEQ ID NO: 2), yeast (348 amino acids;
SEQ ID NO: 3) and E. coli RNase H1 (155 amino acids; SEQ ID NO: 4)
as well as an EST deduced mouse RNase H homolog (GenBank accession
no. AA389926 and AA518920; SEQ ID NO: 5). Boldface type indicates
amino acid residues identical to human. "@" indicates the conserved
amino acid residues implicated in E. coli RNase H1 Mg.sup.2+
binding site and catalytic center (Asp-10, Gly-11, Glu-48 and
Asp-70). "*" indicates the conserved residues implicated in E. coli
RNases H1 for substrate binding.
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0028] A Type 2 human RNase H has now been cloned and expressed.
The enzyme encoded by this cDNA is inactive against single-stranded
RNA, single-stranded DNA and double-stranded DNA. However, this
enzyme cleaves the RNA in an RNA/DNA duplex and cleaves the RNA in
a duplex comprised of RNA and a chimeric oligonucleotide with 2'
methoxy flanks and a 5-deoxynucleotide center gap. The rate of
cleavage of the RNA duplexed with this so-called "deoxy gapmer" was
significantly slower than observed with the full RNA/DNA duplex.
These properties are consistent with those reported for E.coli
RNase H1 (Crooke et al., Biochem. J., 1995, 312, 599-608; Lima, W.
F. and Crooke, S. T., Biochemistry, 1997, 36, 390-398). They are
also consistent with the properties of a human Type 2 RNase H
protein purified from placenta, as the molecular weight (32 kDa) is
similar to that reported by Frank et al., Nucleic Acids Res., 1994,
22, 5247-5254) and the enzyme is inhibited by Mn.sup.2+.
[0029] Thus, in accordance with one aspect of the present
invention, there are provided isolated polynucleotides which encode
human Type 2 RNase H polypeptides having the deduced amino acid
sequence of FIG. 1. By "polynucleotides" it is meant to include any
form of RNA or DNA such as mRNA or cDNA or genomic DNA,
respectively, obtained by cloning or produced synthetically by well
known chemical techniques. DNA may be double- or single-stranded.
Single-stranded DNA may comprise the coding or sense strand or the
non-coding or antisense strand.
[0030] Methods of isolating a polynucleotide of the present
invention via cloning techniques are well known. For example, to
obtain the cDNA contained in ATCC Deposit No. 98536, primers based
on a search of the XREF database were used. An approximately 1 Kb
cDNA corresponding to the carboxy terminal portion of the protein
was cloned by 3' RACE. Seven positive clones were isolated by
screening a liver cDNA library with this 1 Kb cDNA. The two longest
clones were 1698 and 1168 base pairs. They share the same 5'
untranslated region and protein coding sequence but differ in the
length of the 3' UTR. A single reading frame encoding a 286 amino
acid protein (calculated mass: 32029.04 Da) was identified (FIG.
1). The proposed initiation codon is in agreement with the
mammalian translation initiation consensus sequence described by
Kozak, M., J. Cell Biol., 1989, 108, 229-241, and is preceded by an
in-frame stop codon. Efforts to clone cDNA's with longer 5' UTR's
from both human liver and lymphocyte cDNA's by 5' RACE failed,
indicating that the 1698-base-pair clone was full length.
[0031] In a preferred embodiment, the polynucleotide of the present
invention comprises the nucleic acid sequence of the cDNA contained
within ATCC Deposit No. 98536. The deposit of E. coli DH5
containing a BLUESCRIPT.RTM. plasmid containing a human Type 2
RNase H cDNA was made with the American Type Culture Collection,
12301 Park Lawn Drive, Rockville, Md. 20852, USA, on Sep. 4, 1997
and assigned ATCC Deposit No. 98536. The deposited material is a
culture of E. coli DH5 containing a BLUESCRIPT.RTM. plasmid
(Stratagene, La Jolla Calif.) that contains the full-length human
Type 2 RNase H cDNA. The deposit has been made under the terms of
the Budapest Treaty on the international recognition of the deposit
of micro-organisms for the purposes of patent procedure. The
culture will be released to the public, irrevocably and without
restriction to the public upon issuance of this patent. The
sequence of the polynucleotide contained in the deposited material
and the amino acid sequence of the polypeptide encoded thereby are
controlling in the event of any conflict with the sequences
provided herein. However, as will be obvious to those of skill in
the art upon this disclosure, due to the degeneracy of the genetic
code, polynucleotides of the present invention may comprise other
nucleic acid sequences encoding the polypeptide of FIG. 1 and
derivatives, variants or active fragments thereof.
[0032] Another aspect of the present invention relates to the
polypeptides encoded by the polynucleotides of the present
invention. In a preferred embodiment, a polypeptide of the present
invention comprises the deduced amino acid sequence of human Type 2
RNase H provided in FIG. 1 as SEQ ID NO: 1. However, by
"polypeptide" it is also meant to include fragments, derivatives
and analogs of SEQ ID NO: 1 which retain essentially the same
biological activity and/or function as human Type 2 RNase H.
Alternatively, polypeptides of the present invention may retain
their ability to bind to an antisense-RNA duplex even though they
do not function as active RNase H enzymes in other capacities. In
another embodiment, polypeptides of the present invention may
retain nuclease activity but without specificity for the RNA
portion of an RNA/DNA duplex. Polypeptides of the present invention
include recombinant polypeptides, isolated natural polypeptides and
synthetic polypeptides, and fragments thereof which retain one or
more of the activities described above.
[0033] In a preferred embodiment, the polypeptide is prepared
recombinantly, most preferably from the culture of E. coli of ATCC
Deposit No. 98536. Recombinant human RNase H fused to histidine
codons (his-tag; in the present embodiment six histidine codons
were used) expressed in E.coli can be conveniently purified to
electrophoretic homogeneity by chromatography with Ni-NTA followed
by C4 reverse phase HPLC. The purified recombinant polypeptide of
SEQ ID NO: 1 is highly homologous to E.coli RNase H, displaying
nearly 34% amino acid identity with E.coli RNase H1. FIG. 1
compares the protein sequences deduced from human RNase H cDNA (SEQ
ID NO: 1) with those of chicken (SEQ ID NO: 2), yeast (SEQ ID NO:
3) and E.coli RNase HI (Gene Bank accession no. 1786408; SEQ ID NO:
4), as well as an EST deduced mouse RNase H homolog (Gene Bank
accession no. AA389926 and AA518920; SEQ ID NO: 5). The deduced
amino acid sequence of human RNase H (SEQ ID NO: 1) displays strong
homology with yeast (21.8% amino acid identity), chicken (59%),
E.coli RNase HI (33.6%) and the mouse EST homolog (84.3%). They are
all small proteins (<40 KDa) and their estimated pls are all 8.7
and greater. Further, the amino acid residues in E.coli RNase HI
thought to be involved in the Mg.sup.2+ binding site, catalytic
center and substrate binding region are completely conserved in the
cloned human RNase H sequence (FIG. 1).
[0034] The human Type 2 RNase H of SEQ ID NO: 1 is expressed
ubiquitously. Northern blot analysis demonstrated that the
transcript was abundant in all tissues and cell lines except the
MCR-5 line. Northern blot analysis of total RNA from human cell
lines and Poly A containing RNA from human tissues using the 1.7 kb
full length probe or a 332-nucleotide probe that contained the 5'
UTR and coding region of human RNase H cDNA revealed two strongly
positive bands with approximately 1.2 and 5.5 kb in length and two
less intense bands approximately 1.7 and 4.0 kb in length in most
cell lines and tissues. Analysis with the 332-nucleotide probe
showed that the 5.5 kb band contained the 5' UTR and a portion of
the coding region, which suggests that this band represents a
pre-processed or partially processed transcript, or possibly an
alternatively spliced transcript. Intermediate sized bands may
represent processing intermediates. The 1.2 kb band represents the
full length transcripts. The longer transcripts may be processing
intermediates or alternatively spliced transcripts.
[0035] RNase H is expressed in most cell lines tested; only MRC5, a
breast cancer cell line, displayed very low levels of RNase H.
However, a variety of other malignant cell lines including those of
bladder (T24), breast (T-47D, HS578T), lung (A549), prostate
(LNCap, DU145), and myeloid lineage (HL-60), as well as normal
endothelial cells (HUVEC), expressed RNase H. Further, all normal
human tissues tested expressed RNase H. Again, larger transcripts
were present as well as the 1.2 kb transcript that appears to be
the mature mRNA for RNase H. Normalization based on G3PDH levels
showed that expression was relatively consistent in all of the
tissues tested.
[0036] The Southern blot analysis of EcoRI digested human and
various mammalian vertebrate and yeast genomic DNAs probed with the
1.7 kb probe shows that four EcoRI digestion products of human
genomic DNA (2.4, 4.6, 6.0, 8.0 Kb) hybridized with the 1.7 kb
probe. The blot re-probed with a 430 nucleotide probe corresponding
to the C-terminal portion of the protein showed only one 4.6 kbp
EcoRI digestion product hybridized. These data indicate that there
is only one gene copy for RNase H and that the size of the gene is
more than 10 kb. Both the full length and the shorter probe
strongly hybridized to one EcoRI digestion product of yeast genomic
DNA (about 5 kb in size), indicating a high degree of conservation.
These probes also hybridized to the digestion product from monkey,
but none of the other tested mammalian genomic DNAs including the
mouse which is highly homologous to the human RNase H sequence.
[0037] A recombinant human RNase H (his-tag fusion protein)
polypeptide of the present invention was expressed in E.coli and
purified by Ni-NTA agarose beads followed by C4 reverse phase
column chromatography. A 36 kDa protein copurified with activity
measured after renaturation. The presence of the his-tag was
confirmed by Western blot analyses with an anti-penta-histidine
antibody (Qiagen, Germany).
[0038] Renatured recombinant human RNase H displayed RNase H
activity. Incubation of 10 ng purified renatured RNase H with
RNA/DNA substrate for 2 hours resulted in cleavage of 40% of the
substrate. The enzyme also cleaved RNA in an oligonucleotide/RNA
duplex in which the oligonucleotide was a gapmer with a
5-deoxynucleotide gap, but at a much slower rate than the full
RNA/DNA substrate. This is consistent with observations with E.coli
RNase HI (Lima, W. F. and Crooke, S. T., Biochemistry, 1997, 36,
390-398). It was inactive against single-stranded RNA or
double-stranded RNA substrates and was inhibited by Mn.sup.2+. The
molecular weight (.about.36kDa) and inhibition by Mn.sup.2+
indicate that the cloned enzyme is highly homologous to E.coli
RNase HI and has properties consistent with those assigned to Type
2 human RNase H.
[0039] The sites of cleavage in the RNA in the full RNA/DNA
substrate and the gapmer/RNA duplexes (in which the oligonucleotide
gapmer had a 5-deoxynucleotide gap) resulting from the recombinant
enzyme were determined. In the full RNA/DNA duplex, the principal
site of cleavage was near the middle of the substrate, with
evidence of less prominent cleavage sites 3' to the primary
cleavage site. The primary cleavage site for the gapmer/RNA duplex
was located across the nucleotide adjacent to the junction of the
2' methoxy wing and oligodeoxy nucleotide gap nearest the 3' end of
the RNA. Thus, the enzyme resulted in a major cleavage site in the
center of the RNA/DNA substrate and less prominent cleavages to the
3' side of the major cleavage site. The shift of its major cleavage
site to the nucleotide in apposition to the DNA 2' methoxy junction
of the 2' methoxy wing at the 5' end of the chimeric
oligonucleotide is consistent with the observations for E.coli
RNase HI (Crooke et al. (1995) Biochem. J. 312, 599-608; Lima, W.
F. and Crooke, S. T. (1997) Biochemistry 36, 390-398). The fact
that the enzyme cleaves at a single site in a 5-deoxy gap duplex
indicates that the enzyme has a catalytic region of similar
dimensions to that of E.coli RNase HI.
[0040] Accordingly, expression of large quantities of a purified
human RNase H polypeptide of the present invention is useful in
characterizing the activities of a mammalian form of this enzyme.
In addition, the polynucleotides and polypeptides of the present
invention provide a means for identifying agents which enhance the
function of antisense oligonucleotides in human cells and
tissues.
[0041] For example, a host cell can be genetically engineered to
incorporate polynucleotides and express polypeptides of the present
invention. Polynucleotides can be introduced into a host cell using
any number of well known techniques such as infection,
transduction, transfection or transformation. The polynucleotide
can be introduced alone or in conjunction with a second
polynucleotide encoding a selectable marker. In a preferred
embodiment, the host comprises a mammalian cell. Such host cells
can then be used not only for production of human Type 2 RNase H,
but also to identify agents which increase or decrease levels of
expression or activity of human Type 2 RNase H in the cell. In
these assays, the host cell would be exposed to an agent suspected
of altering levels of expression or activity of human Type 2 RNase
in the cells. The level or activity of human Type 2 RNase in the
cell would then be determined in the presence and absence of the
agent. Assays to determine levels of protein in a cell are well
known to those of skill in the art and include, but are not limited
to, radioimmunoassays, competitive binding assays, Western blot
analysis and enzyme linked immunosorbent assays (ELISAs). Methods
of determining increase activity of the enzyme, and in particular
increased cleavage of an antisense-mRNA duplex can be performed in
accordance with the teachings of Example 5. Agents identified as
inducers of the level or activity of this enzyme may be useful in
enhancing the efficacy of antisense oligonucleotide therapies.
[0042] The present invention also relates to prognostic assays
wherein levels of RNase in a cell type can be used in predicting
the efficacy of antisense oligonucleotide therapy in specific
target cells. High levels of RNase in a selected cell type are
expected to correlate with higher efficacy as compared to lower
amounts of RNase in a selected cell type which may result in poor
cleavage of the mRNA upon binding with the antisense
oligonucleotide. For example, the MRC5 breast cancer cell line
displayed very low levels of RNase H as compared to other malignant
cell types. Accordingly, in this cell type it may be desired to use
antisense compounds which do not depend on RNase H activity for
their efficacy. Similarly, oligonucleotides can be screened to
identify those which are effective antisense agents by contacting
human Type 2 RNase H with an oligonucleotide and measuring binding
of the oligonucleotide to the human Type 2 RNase H. Methods of
determining binding of two molecules are well known in the art. For
example, in one embodiment, the oligonucleotide can be radiolabeled
and binding of the oligonucleotide to human Type 2 RNase H can be
determined by autoradiography. Alternatively, fusion proteins of
human Type 2 RNase H with glutathione-S-transferase or small
peptide tags can be prepared and immobilized to a solid phase such
as beads. Labeled or unlabeled oligonucleotides to be screened for
binding to this enzyme can then be incubated with the solid phase.
Oligonucleotides which bind to the enzyme immobilized to the solid
phase can then be identified either by detection of bound label or
by eluting specifically the bound oligonucleotide from the solid
phase. Another method involves screening of oligonucleotide
libraries for binding partners. Recombinant tagged or labeled human
Type 2 RNase H is used to select oligonucleotides from the library
which interact with the enzyme. Sequencing of the oligonucleotides
leads to identification of those oligonucleotides which will be
more effective as antisense agents.
[0043] The oligonucleotides of the present invention are formed
from a plurality of nucleotides that are joined together via
internucleotide linkages. While joined together as a unit in the
oligonucleotide, the individual nucleotides of oligonucleotides are
of several types. Each of these types contribute unique properties
to the oligonucleotide. A first type of nucleotides are joined
together in a continuous sequence that forms a first portion of the
oligonucleotide. The remaining nucleotides are of at least one
further type and are located in one or more remaining portions or
locations within the oligonucleotide. Thus, the oligonucleotides of
the invention include a nucleotide portion that contributes one set
of attributes and a further portion (or portions) that contributes
another set of attributes.
[0044] One attribute that is desirable is eliciting RNase H
activity. To elicit RNase H activity, a portion of the
oligonucleotides of the invention is selected to have B-form like
conformational geometry. The nucleotides for this B-form portion
are selected to specifically include ribo-pentofuranosyl and
arabino-pentofuranosyl nucleotides. 2'-Deoxy-erythro-pentfuranosyl
nucleotides also have B-form geometry and elicit RNase H activity.
While not specifically excluded, if 2'-deoxy-erythro-pentfuranosyl
nucleotides are included in the B-form portion of an
oligonucleotide of the invention, such
2'-deoxy-erythro-pentfuranosyl nucleotides preferably does not
constitute the totality of the nucleotides of that B-form portion
of the oligonucleotide, but should be used in conjunction with
ribonucleotides or an arabino nucleotides. As used herein, B-form
geometry is inclusive of both C2'-endo and O4'-endo pucker, and the
ribo and arabino nucleotides selected for inclusion in the
oligonucleotide B-form portion are selected to be those nucleotides
having C2'-endo conformation or those nucleotides having O4'-endo
conformation. This is consistent with Berger, et. al., Nucleic
Acids Research, 1998, 26, 2473-2480, who pointed out that in
considering the furanose conformations in which nucleosides and
nucleotides reside, B-form consideration should also be given to a
O4'-endo pucker contribution.
[0045] A-form nucleotides are nucleotides that exhibit C3'-endo
pucker, also known as north, or northern, pucker. In addition to
the B-form nucleotides noted above, the A-form nucleotides can be
C3'-endo pucker nucleotides or can be nucleotides that are located
at the 3' terminus, at the 5' terminus, or at both the 3' and the
5' terminus of the oligonucleotide. Alternatively, A-form
nucleotides can exist both in a C3'-endo pucker and be located at
the ends, or termini, of the oligonucleotide. In selecting
nucleotides that have C3'-endo pucker or in selecting nucleotides
to reside at the 3' or 5' ends of the oligonucleotide,
consideration is given to binding affinity and nuclease resistance
properties that such nucleotides need to impart to the resulting
the oligonucleotide.
[0046] Nucleotides selected to reside at the 3' or 5' termini of
oligonucleotides of the invention are selected to impart nuclease
resistance to the oligonucleotide. This nuclease resistance can
also be achieved via several mechanisms, including modifications of
the sugar portions of the nucleotide units of the oligonucleotides,
modification of the internucleotide linkages or both modification
of the sugar and the internucleotide linkage.
[0047] A particularly useful group of nucleotides for use in
increasing nuclease resistance at the termini of oligonucleotides
are those having 2'-O-alkylamino groups thereon. The amino groups
of such nucleotides can be groups that are protonated at
physiological pH. These include amines, monoalkyl substituted
amines, dialkyl substituted amines and heterocyclic amines such as
imidazole. Particularly useful are the lower alkyl amines including
2'-O-ethylamine and 2'-O-propylamine. Such O-alkylamines can also
be included on the 3' position of the 3' terminus nucleotide. Thus
the 3' terminus nucleotide could include both a 2' and a
3'-alkylamino substituent.
[0048] In selecting for nuclease resistance, it is important not to
detract from binding affinity. Certain phosphorus based linkage
have been shown to increase nuclease resistance. The above
described phosphorothioate linkage increase nuclease resistance,
however, it also causes loss of binding affinity. Thus, generally
for use in this invention, if phosphorothioate internucleotide
linkage are used, other modification will be made to nucleotide
units that increase binding affinity to compensate for the
decreased affinity contribute by the phosphorothioate linkages.
[0049] Other phosphorus based linkages having increase nuclease
resistance that do not detract from binding affinity include
3'-methylene phosphonates and 3'-deoxy-3'-amino-phosphoroamidate
linkages. A further class of linkages that contribute nuclease
resistance but do not detract from binding affinity are
non-phosphate in nature. Preferred among these are
methylene(methylimino) linkages, dimethylhydraxino linkages, and
amine 3 and amide 4 linkages as described (Freier and Altmann,
Nucleic Acid Research, 1997, 25, 4429-4443).
[0050] J. There are a number of potential items to consider when
designing oligonucleotides having improved binding affinities. It
appears that one effective approach to constructing modified
oligonucleotides with very high RNA binding affinity is the
combination of two or more different types of modifications, each
of which contributes favorably to various factors that might be
important for binding affinity.
[0051] Freier and Altmann, Nucleic Acids Research, (1997)
25:4429-4443, recently published a study on the influence of
structural modifications of oligonucleotides on the stability of
their duplexes with target RNA. In this study, the authors reviewed
a series of oligonucleotides containing more than 200 different
modifications that had been synthesized and assessed for their
hybridization affinity and T.sub.m. Sugar modifications studied
included substitutions on the 2'-position of the sugar,
3'-substitution, replacement of the 4'-oxygen, the use of bicyclic
sugars, and four member ring replacements. Several nucleobase
modifications were also studied including substitutions at the 5,
or 6 position of thymine, modifications of pyrimidine heterocycle
and modifications of the purine heterocycle. Numerous backbone
modifications were also investigated including backbones bearing
phosphorus, backbones that did not bear a phosphorus atom, and
backbones that were neutral.
[0052] Four general approaches might be used to improve
hybridization of oligonucleotides to RNA targets. These include:
preorganization of the sugars and phosphates of the
oligodeoxynucleotide strand into conformations favorable for hybrid
formation, improving stacking of nucleobases by the addition of
polarizable groups to the heterocycle bases of the nucleotides of
the oligonucleotide, increasing the number of H-bonds available for
A-U pairing, and neutralization of backbone charge to facilitate
removing undesirable repulsive interactions. We have found that by
utilizing the first of these, preorganization of the sugars and
phosphates of the oligodeoxynucleotide strand into conformations
favorable for hybrid formation, to be a preferred method to achieve
improve binding affinity. It can further be used in combination
with the other three approaches.
[0053] Sugars in DNA:RNA hybrid duplexes frequently adopt a C3'
endo conformation. Thus modifications that shift the conformational
equilibrium of the sugar moieties in the single strand toward this
conformation should preorganize the antisense strand for binding to
RNA. Of the several sugar modifications that have been reported and
studied in the literature, the incorporation of electronegative
substituents such as 2'-fluoro or 2'-alkoxy shift the sugar
conformation towards the 3' endo (northern) pucker conformation.
This preorganizes an oligonucleotide that incorporates such
modifications to have an A-form conformational geometry. This
A-form conformation results in increased binding affinity of the
oligonucleotide to a target RNA strand.
[0054] As used herein, the terms "substituent" and "substituent
group" refers to groups that are attached to nucleosides of the
invention. Substituent groups are preferably attached to selected
sugar moieties but can alternatively be attached to selected
heterocyclic base moieties. Selected nucleosides may have
substituent groups at both the heterocyclic base and the sugar
moiety, however a single substituent group is preferred at a sugar
2',3' or 5'-positions with the 2'-position being particularly
preferred.
[0055] Substituent groups include fluoro, O-alkyl, O-alkylamino,
O-alkylalkoxy, O-alkylaminoalkyl, O-alkyl imidazole, and polyethers
of the formula (O-alkyl).sub.m, where m is 1 to about 10. Preferred
among these polyethers are linear and cyclic polyethylene glycols
(PEGs), and (PEG)-containing groups, such as crown ethers and those
which are disclosed by Ouchi et al. (Drug Design and Discovery
1992, 9, 93), Ravasio et al. (J. Org. Chem. 1991, 56, 4329) and
Delgardo et. al. (Critical Reviews in Therapeutic Drug Carrier
Systems 1992, 9, 249), each of which is herein incorporated by
reference in its entirety. Further sugar modifications are
disclosed in Cook, P. D., Anti-Cancer Drug Design, 1991, 6,
585-607. Fluoro, O-alkyl, O-alkylamino, O-alkyl imidazole,
O-alkylaminoalkyl, and alkyl amino substitution is described in
U.S. patent application Ser. No. 08/398,901, filed Mar. 6, 1995,
entitled Oligomeric Compounds having Pyrimidine Nucleotide(s) with
2' and 5' Substitutions, hereby incorporated by reference in its
entirety.
[0056] Additional substituent groups amenable to the present
invention include --SR and --NR.sub.2 groups, wherein each R is,
independently, hydrogen, a protecting group or substituted or
unsubstituted alkyl, alkenyl, or alkynyl. 2'-SR nucleosides are
disclosed in U.S. Pat. No. 5,670,633, issued Sep. 23, 1997, hereby
incorporated by reference in its entirety. The incorporation of
2'-SR monomer synthons are disclosed by Hamm et al., J. Org. Chem.,
1997, 62, 3415-3420. 2'-NR.sub.2 nucleosides are disclosed by
Goettingen, M., J. Org. Chem., 1996, 61, 6273-6281; and Polushin et
al., Tetrahedron Lett., 1996, 3 7, 3227-3230.
[0057] Further representative substituent groups include hydrogen,
hydroxyl, C.sub.1-C.sub.20 alkyl, C.sub.2-C.sub.20 alkenyl,
C.sub.2-C.sub.20 alkynyl, halogen, amino, thiol, keto, carboxyl,
nitro, nitroso, nitrile, trifluoromethyl, trifluoromethoxy,
O-alkyl, O-alkenyl, O-alkynyl, S-alkyl, S-alkenyl, S-alkynyl,
NH-alkyl, NH-alkenyl, NH-alkynyl, N-dialkyl, O-aryl, S-aryl,
NH-aryl, O-aralkyl, S-aralkyl, NH-aralkyl, N-phthalimido,
imidazole, azido, hydrazino, hydroxylamino, isocyanato, sulfoxide,
sulfone, sulfide, disulfide, silyl, aryl, heterocycle, carbocycle,
intercalator, reporter molecule, conjugate, polyamine, polyamide,
polyalkylene glycol, or polyether;
[0058] or each substituent group has one of formula I or II:
##STR1## wherein:
[0059] Z.sub.0 is O, S or NH;
[0060] J is a single bond, O or C(.dbd.O);
[0061] E is C.sub.1-C.sub.10 alkyl, N(R.sub.1)(R.sub.2),
N(R.sub.1)(R.sub.5), N.dbd.C(R.sub.1)(R.sub.2),
N.dbd.C(R.sub.1)(R.sub.5) or has one of formula III or IV;
##STR2##
[0062] each R.sub.6, R.sub.7, R.sub.8, R.sub.9 and R.sub.10 is,
independently, hydrogen, C(O)R.sub.11, substituted or unsubstituted
C.sub.1-C.sub.10 alkyl, substituted or unsubstituted
C.sub.2-C.sub.10 alkenyl, substituted or unsubstituted
C.sub.2-C.sub.10 alkynyl, alkylsulfonyl, arylsulfonyl, a chemical
functional group or a conjugate group, wherein the substituent
groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl,
phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and
alkynyl;
[0063] or optionally, R.sub.7 and R.sub.8, together form a
phthalimido moiety with the nitrogen atom to which they are
attached;
[0064] or optionally, R.sub.9 and R.sub.10, together form a
phthalimido moiety with the nitrogen atom to which they are
attached;
[0065] each R.sub.11 is, independently, substituted or
unsubstituted C.sub.1-C.sub.10 alkyl, trifluoromethyl,
cyanoethyloxy, methoxy, ethoxy, t-butoxy, allyloxy,
9-fluorenylmethoxy, 2-(trimethylsilyl)-ethoxy,
2,2,2-trichloroethoxy, benzyloxy, butyryl, iso-butyryl, phenyl or
aryl;
[0066] R.sub.5 is T-L,
[0067] T is a bond or a linking moiety;
[0068] L is a chemical functional group, a conjugate group or a
solid support material;
[0069] each R.sub.1 and R.sub.2 is, independently, H, a nitrogen
protecting group, substituted or unsubstituted C.sub.1-C.sub.10
alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl,
substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein said
substitution is OR.sub.3, SR.sub.3, NH.sub.3.sup.+,
N(R.sub.3)(R.sub.4), guanidino or acyl where said acyl is an acid
amide or an ester;
[0070] or R.sub.1 and R.sub.2, together, are a nitrogen protecting
group or are joined in a ring structure that optionally includes an
additional heteroatom selected from N and O;
[0071] or R.sub.1, T and L, together, are a chemical functional
group;
[0072] each R.sub.3 and R.sub.4 is, independently, H,
C.sub.1-C.sub.10 alkyl, a nitrogen protecting group, or R.sub.3 and
R.sub.4, together, are a nitrogen protecting group;
[0073] or R.sub.3 and R.sub.4 are joined in a ring structure that
optionally includes an additional heteroatom selected from N and
O;
[0074] Z.sub.4 is OX, SX, or N(X).sub.2;
[0075] each X is, independently, H, C.sub.1-C.sub.8 alkyl,
C.sub.1-C.sub.9 haloalkyl, C(.dbd.NH)N(H)R.sub.5,
C(.dbd.O)N(H)R.sub.5 or OC(.dbd.O)N(H)R.sub.5;
[0076] R.sub.5 is H or C.sub.1-C.sub.8 alkyl;
[0077] Z.sub.1, Z.sub.2 and Z.sub.3 comprise a ring system having
from about 4 to about 7 carbon atoms or having from about 3 to
about 6 carbon atoms and 1 or 2 hetero atoms wherein said hetero
atoms are selected from oxygen, nitrogen and sulfur and wherein
said ring system is aliphatic, unsaturated aliphatic, aromatic, or
saturated or unsaturated heterocyclic;
[0078] Z.sub.5 is alkyl or haloalkyl having 1 to about 10 carbon
atoms, alkenyl having 2 to about 10 carbon atoms, alkynyl having 2
to about 10 carbon atoms, aryl having 6 to about 14 carbon atoms,
N(R.sub.1)(R.sub.2) OR.sub.1 halo, SR.sub.1 or CN;
[0079] each q.sub.1 is, independently, an integer from 1 to 10;
[0080] each q.sub.2 is, independently, 0 or 1;
[0081] q.sub.3 is 0 or an integer from 1 to 10;
[0082] q.sub.4 is an integer from 1 to 10;
[0083] q.sub.5 is from 0, 1 or 2; and provided that when q.sub.3 is
0, q.sub.4 is greater than 1.
[0084] Representative substituents groups of Formula I are
disclosed in U.S. patent application Ser. No. 09/130,973, filed
Aug. 7, 1998, entitled "Capped 2'-Oxyethoxy Oligonucleotides,"
hereby incorporated by reference in its entirety.
[0085] Representative cyclic substituent groups of Formula II are
disclosed in U.S. patent application Ser. No. 09/123,108, filed
Jul. 27, 1998, entitled "RNA Targeted 2'-Modified Oligonucleotides
that are Conformationally Preorganized," hereby incorporated by
reference in its entirety.
[0086] Particularly preferred substituent groups include
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10.
[0087] Some preferred oligomeric compounds of the invention
contain, at least one nucleoside having one of the following
substituent groups: C.sub.1 to C.sub.10 lower alkyl, substituted
lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH,
SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3,
SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, an RNA cleaving group, a
reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligomeric compound, or a group
for improving the pharmacodynamic properties of an oligomeric
compound, and other substituents having similar properties. A
preferred modification includes 2'-methoxyethoxy
[2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE] (Martin et al., Helv. Chim. Acta,
1995, 78, 486), i.e., an alkoxyalkoxy group. A further preferred
modification is 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE.
Representative aminooxy substituent groups are described in
co-owned U.S. patent application Ser. No. 09/344,260, filed Jun.
25, 1999, entitled "Aminooxy-Functionalized Oligomers"; and a U.S.
patent application entitled "Aminooxy-Functionalized Oligomers and
Methods for Making Same," filed Aug. 9, 1999, presently identified
by attorney docket number ISIS-3993, hereby incorporated by
reference in their entirety.
[0088] Other preferred modifications include 2'-methoxy
(2'-O--CH.sub.3), 2'-aminopropoxy
(2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2'-fluoro (2'-F).
Similar modifications may also be made at other positions on
nucleosides and oligomers, particularly the 3' position of the
sugar on the 3' terminal nucleoside or in 2'-5' linked oligomers
and the 5' position of 5' terminal nucleoside. Oligomers may also
have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugars structures include,
but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,0531 5,639,873; 5,646,265; 5,658,873; 5,670,633; and
5,700,920, certain of which are commonly owned, and each of which
is herein incorporated by reference, and commonly owned U.S. patent
application Ser. No. 08/468,037, filed on Jun. 5, 1995, also herein
incorporated by reference.
[0089] Representative guanidino substituent groups that are shown
in formula III and IV are disclosed in co-owned U.S. patent
application Ser. No. 09/349,040 entitled "Functionalized
Oligomers," filed Jul. 7, 1999, hereby incorporated by reference in
its entirety.
[0090] Representative acetamido substituent groups are disclosed in
a U.S. patent application entitled "2'-O-Acetamido Modified
Monomers and Oligomers," filed Aug. 19, 1999, presently identified
by attorney docket number ISIS-4071, hereby incorporated by
reference in its entirety.
[0091] Representative dimethylaminoethyloxyethyl substituent groups
are disclosed in an International Patent Application entitled
"2'-O-Dimethylaminoethyloxyethyl-Modified Oligonucleotides," filed
Aug. 6, 1999, presently identified by attorney docket number
ISIS-4045, hereby incorporated by reference in its entirety.
[0092] Several 2'-substituents confer a 3'-endo pucker to the sugar
where they are incorporated. This pucker conformation further
assists in increasing the Tm of the oligonucleotide with its
target.
[0093] The high binding affinity resulting from 2' substitution has
been partially attributed to the 2' substitution causing a C3' endo
sugar pucker which in turn may give the oligomer a favorable A-form
like geometry. This is a reasonable hypothesis since substitution
at the 2' position by a variety of electronegative groups (such as
fluoro and O-alkyl chains) has been demonstrated to cause C3' endo
sugar puckering (De Mesmaeker et al., Acc. Chem. Res., 1995, 28,
366-374; Lesnik et al., Biochemistry, 1993, 32, 7832-7838).
[0094] In addition, for 2'-substituents containing an ethylene
glycol motif, a gauche interaction between the oxygen atoms around
the O--C--C--O torsion of the side chain may have a stabilizing
effect on the duplex (Freier et al.,Nucleic Acids Research, (1997)
25:4429-4442). Such gauche interactions have been observed
experimentally for a number of years (Wolfe et al., Acc. Chem.
Res., 1972, 5, 102; Abe et al., J. Am. Chem. Soc., 1976, 98, 468).
This gauche effect may result in a configuration of the side chain
that is favorable for duplex formation. The exact nature of this
stabilizing configuration has not yet been explained. While we do
not want to be bound by theory, it may be that holding the
O--C--C--O torsion in a single gauche configuration, rather than a
more random distribution seen in an alkyl side chain, provides an
entropic advantage for duplex formation.
[0095] To better understand the higher RNA affinity of
2'-O-methoxyethyl substituted RNA and to examine the conformational
properties of the 2'-O-methoxyethyl substituent, a
self-complementary dodecamer oligonucleotide
[0096] 2'-O-MOE r(CGCGAAUUCGCG) SEQ ID NO: 1
[0097] was synthesized, crystallized and its structure at a
resolution of 1.7 Angstrom was determined. The crystallization
conditions used were 2 mM oligonucleotide, 50 mM Na Hepes pH
6.2-7.5, 10.50 mM MgCl.sub.2, 15% PEG 400. The crystal data showed:
space group C2, cell constants a=41.2 .ANG., b=34.4 .ANG., c=46.6
.ANG., =92.4.degree.. The resolution was 1.7 .ANG. at -170.degree.
C. The current R=factor was 20% (R.sub.free 26%).
[0098] This crystal structure is believed to be the first crystal
structure of a fully modified RNA oligonucleotide analogue. The
duplex adopts an overall A-form conformation and all modified
sugars display C3'-endo pucker. In most of the 2'-O-substituents,
the torsion angle around the A'-B' bond, as depicted in Structure
II below, of the ethylene glycol linker has a gauche conformation.
For 2'-O-MOE, A' and B' of Structure II below are methylene
moieties of the ethyl portion of the MOE and R' is the methoxy
portion.
[0099] In the crystal, the 2'-O-MOE RNA duplex adopts a general
orientation such that the crystallographic 2-fold rotation axis
does not coincide with the molecular 2-fold rotation axis. The
duplex adopts the expected A-type geometry and all of the 24
2'-O-MOE substituents were visible in the electron density maps at
full resolution. The electron density maps as well as the
temperature factors of substituent atoms indicate flexibility of
the 2'-O-MOE substituent in some cases.
[0100] Most of the 2'-O-MOE substituents display a gauche
conformation around the C--C bond of the ethyl linker. However, in
two cases, a trans conformation around the C--C bond is observed.
The lattice interactions in the crystal include packing of duplexes
against each other via their minor grooves. Therefore, for some
residues, the conformation of the 2'-O-substituent is affected by
contacts to an adjacent duplex. In general, variations in the
conformation of the substituents (e.g. g.sup.+ or g.sup.- around
the C--C bonds) create a range of interactions between
substituents, both inter-strand, across the minor groove, and
intra-strand. At one location, atoms of substituents from two
residues are in van der Waals contact across the minor groove.
Similarly, a close contact occurs between atoms of substituents
from two adjacent intra-strand residues.
[0101] Previously determined crystal structures of A-DNA duplexes
were for those that incorporated isolated 2'-O-methyl T residues.
In the crystal structure noted above for the 2'-O-MOE substituents,
a conserved hydration pattern has been observed for the 2'-O-MOE
residues. A single water molecule is seen located between O2', O3'
and the methoxy oxygen atom of the substituent, forming contacts to
all three of between 2.9 and 3.4 A. In addition, oxygen atoms of
substituents are involved in several other hydrogen bonding
contacts. For example, the methoxy oxygen atom of a particular
2'-O-substituent forms a hydrogen bond to N3 of an adenosine from
the opposite strand via a bridging water molecule.
[0102] In several cases a water molecule is trapped between the
oxygen atoms O2', O3' and OC' of modified nucleosides. 2'-O-MOE
substituents with trans conformation around the C--C bond of the
ethylene glycol linker are associated with close contacts between
OC' and N2 of a guanosine from the opposite strand, and,
water-mediated, between OC' and N3(G). When combined with the
available thermodynamic data for duplexes containing 2'-O-MOE
modified strands, this crystal structure allows for further
detailed structure-stability analysis of other antisense
modifications.
[0103] In extending the crystallographic structure studies,
molecular modeling experiments were performed to study further
enhanced binding affinity of oligonucleotides having
2'-O-modifications of the invention. The computer simulations were
conducted on compounds of SEQ ID NO: 1, above, having
2'-O-modifications of the invention located at each of the
nucleoside of the oligonucleotide. The simulations were performed
with the oligonucleotide in aqueous solution using the AMBER force
field method (Cornell et al., J. Am. Chem. Soc., 1995, 117,
5179-5197)(modeling software package from UCSF, San Francisco,
Calif.). The calculations were performed on an Indigo2 SGI machine
(Silicon Graphics, Mountain View, Calif.).
[0104] Further 2'-O-modifications of the inventions include those
having a ring structure that incorporates a two atom portion
corresponding to the A' and B' atoms of Structure II. The ring
structure is attached at the 2' position of a sugar moiety of one
or more nucleosides that are incorporated into an oligonucleotide.
The 2'-oxygen of the nucleoside links to a carbon atom
corresponding to the A' atom of Structure II. These ring structures
can be aliphatic, unsaturated aliphatic, aromatic or heterocyclic.
A further atom of the ring (corresponding to the B' atom of
Structure II), bears a further oxygen atom, or a sulfur or nitrogen
atom. This oxygen, sulfur or nitrogen atom is bonded to one or more
hydrogen atoms, alkyl moieties, or haloalkyl moieties, or is part
of a further chemical moiety such as a ureido, carbamate, amide or
amidine moiety. The remainder of the ring structure restricts
rotation about the bond joining these two ring atoms. This assists
in positioning the "further oxygen, sulfur or nitrogen atom" (part
of the R position as described above) such that the further atom
can be located in close proximity to the 3'-oxygen atom (O3') of
the nucleoside.
[0105] The ring structure can be further modified with a group
useful for modifying the hydrophilic and hydrophobic properties of
the ring to which it is attached and thus the properties of an
oligonucleotide that includes the 2'-O-modifications of the
invention. Further groups can be selected as groups capable of
assuming a charged structure, e.g. an amine. This is particularly
useful in modifying the overall charge of an oligonucleotide that
includes a 2'-O-modifications of the invention. When an
oligonucleotide is linked by charged phosphate groups, e.g.
phosphorothioate or phosphodiester linkages, location of a counter
ion on the 2'-O-modification, e.g. an amine functionality, locally
naturalizes the charge in the local environment of the nucleotide
bearing the 2'-O-modification. Such neutralization of charge will
modulate uptake, cell localization and other pharmacokinetic and
pharmacodynamic effects of the oligonucleotide.
[0106] Preferred ring structures of the invention for inclusion as
a 2'-O modification include cyclohexyl, cyclopentyl and phenyl
rings as well as heterocyclic rings having spacial footprints
similar to cyclohexyl, cyclopentyl and phenyl rings. Particularly
preferred 2'-O-substituent groups of the invention are listed below
including an abbreviation for each:
[0107] 2'-O-(trans 2-methoxy cyclohexyl)--2'-O-(TMCHL)
[0108] 2'-O-(trans 2-methoxy cyclopentyl)--2'-O-(TMCPL)
[0109] 2'-O-(trans 2-ureido cyclohexyl)--2'-O-(TUCHL)
[0110] 2'-O-(trans 2-methoxyphenyl)--2'-O-(2MP)
[0111] Structural details for duplexes incorporating such
2-O-substituents were analyzed using the described AMBER force
field program on the Indigo2 SGI machine. The simulated structure
maintained a stable A-form geometry throughout the duration of the
simulation. The presence of the 2' substitutions locked the sugars
in the C3'-endo conformation.
[0112] The simulation for the TMCHL modification revealed that the
2'-O-(TMCHL) side chains have a direct interaction with water
molecules solvating the duplex. The oxygen atoms in the
2'-O-(TMCHL) side chain are capable of forming a water-mediated
interaction with the 3' oxygen of the phosphate backbone. The
presence of the two oxygen atoms in the 2'-O-(TMCHL) side chain
gives rise to favorable gauche interactions. The barrier for
rotation around the O--C--C--O torsion is made even larger by this
novel modification. The preferential preorganization in an A-type
geometry increases the binding affinity of the 2'-O-(TMCHL) to the
target RNA. The locked side chain conformation in the 2'-O-(TMCHL)
group created a more favorable pocket for binding water molecules.
The presence of these water molecules played a key role in holding
the side chains in the preferable gauche conformation. While not
wishing to be bound by theory, the bulk of the substituent, the
diequatorial orientation of the substituents in the cyclohexane
ring, the water of hydration and the potential for trapping of
metal ions in the conformation generated will additionally
contribute to improved binding affinity and nuclease resistance of
oligonucleotides incorporating nucleosides having this
2'-O-modification.
[0113] As described for the TMCHL modification above, identical
computer simulations of the 2'-O-(TMCPL), the 2'-O-(2MP) and
2'-O-(TUCHL) modified oligonucleotides in aqueous solution also
illustrate that stable A-form geometry will be maintained
throughout the duration of the simulation. The presence of the 2'
substitution will lock the sugars in the C3'-endo conformation and
the side chains will have direct interaction with water molecules
solvating the duplex. The oxygen atoms in the respective side
chains are capable of forming a water-mediated interaction with the
3' oxygen of the phosphate backbone. The presence of the two oxygen
atoms in the respective side chains give rise to the favorable
gauche interactions. The barrier for rotation around the respective
O--C--C--O torsions will be made even larger by respective
modification. The preferential preorganization in A-type geometry
will increase the binding affinity of the respective 2'-O-modified
oligonucleotides to the target RNA. The locked side chain
conformation in the respective modifications will create a more
favorable pocket for binding water molecules. The presence of these
water molecules plays a key role in holding the side chains in the
preferable gauche conformation. The bulk of the substituent, the
diequatorial orientation of the substituents in their respective
rings, the water of hydration and the potential trapping of metal
ions in the conformation generated will all contribute to improved
binding affinity and nuclease resistance of oligonucleotides
incorporating nucleosides having these respective
2'-O-modification.
[0114] Preferred for use as the B-form nucleotides for eliciting
RNase H are ribonucleotides having 2'-deoxy-2'-S-methyl,
2'-deoxy-2'-methyl, 2'-deoxy-2'-amino, 2'-deoxy-2'-mono or dialkyl
substituted amino, 2'-deoxy-2'-fluoromethyl,
2'-deoxy-2'-difluoromethyl, 2'-deoxy-2'-trifluoromethyl,
2'-deoxy-2'-methylene, 2'-deoxy-2'-fluoromethylene,
2'-deoxy-2'-difluoromethylene, 2'-deoxy-2'-ethyl,
2'-deoxy-2'-ethylene and 2'-deoxy-2'-acetylene. These nucleotides
can alternately be described as 2'-SCH.sub.3 ribonucleotide,
2'-CH.sub.3 ribonucleotide, 2'-NH.sub.2 ribonucleotide
2'-NH(C.sub.1-C.sub.2 alkyl) ribonucleotide, 2'-N(C.sub.1-C.sub.2
alkyl).sub.2 ribonucleotide, 2'-CH.sub.2F ribonucleotide,
2'-CHF.sub.2 ribonucleotide, 2'-CF.sub.3 ribonucleotide,
2'=CH.sub.2 ribonucleotide, 2'=CHF ribonucleotide, 2'=CF.sub.2
ribonucleotide, 2'-C.sub.2H.sub.5 ribonucleotide,
2'-CH.dbd.CH.sub.2 ribonucleotide, 2'-CCH ribonucleotide. A further
useful ribonucleotide is one having a ring located on the ribose
ring in a cage-like structure including
3',O,4'-C-methyleneribonucleotides. Such cage-like structures will
physically fix the ribose ring in the desired conformation.
[0115] Additionally, preferred for use as the B-form nucleotides
for eliciting RNase H are arabino nucleotides having
2'-deoxy-2'-cyano, 2'-deoxy-2'-fluoro, 2'-deoxy-2'-chloro,
2'-deoxy-2'-bromo, 2'-deoxy-2'-azido, 2'-methoxy and the unmodified
arabino nucleotide (that includes a 2'-OH projecting upwards
towards the base of the nucleotide). These arabino nucleotides can
alternately be described as 2'-CN arabino nucleotide, 2'-F arabino
nucleotide, 2'-Cl arabino nucleotide, 2'-Br arabino nucleotide,
2'-N.sub.3 arabino nucleotide, 2'-O--CH.sub.3 arabino nucleotide
and arabino nucleotide.
[0116] Such nucleotides are linked together via phosphorothioate,
phosphorodithioate, boranophosphate or phosphodiester linkages,
particularly preferred is the phosphorothioate linkage.
[0117] Illustrative of the B-form nucleotides for use in the
invention is a 2'-S-methyl (2'-SMe) nucleotide that resides in C2'
endo conformation. It can be compared to 2'-O-methyl
(2'-OMe)nucleotides that resides in a C3' endo conformation.
Particularly suitable for use in comparing these two nucleotides
are molecular dynamic investigations using a SGI [Silicon Graphics,
Mountain View, Calif.] computer and the AMBER [UCSF, San Francisco,
Calif.] modeling software package for computer simulations.
[0118] Ribose conformations in C2'-modified nucleosides containing
S-methyl groups were examined. To understand the influence of
2'-O-methyl and 2'-S-methyl groups on the conformation of
nucleosides, we evaluated the relative energies of the 2'-O- and
2'-S-methylguanosine, along with normal deoxyguanosine and
riboguanosine, starting from both C2'-endo and C3'-endo
conformations using ab initio quantum mechanical calculations. All
the structures were fully optimized at HF/6-31G* level and single
point energies with electron-correlation were obtained at the
MP2/6-31G*//HF/6-31G* level. As shown in Table 1, the C2'-endo
conformation of deoxyguanosine is estimated to be 0.6 kcal/mol more
stable than the C3'-endo conformation in the gas-phase. The
conformational preference of the C2'-endo over the C3'-endo
conformation appears to be less dependent upon electron correlation
as revealed by the MP2/6-31G*//HF/6-31G* values which also predict
the same difference in energy. The opposite trend is noted for
riboguanosine. At the HF/6-31G* and MP2/6-31G*//HF/6-31G* levels,
the C3'-endo form of riboguanosine is shown to be about 0.65 and
1.41 kcal/mol more stable than the C2'endo form, respectively.
TABLE-US-00001 TABLE 1 Relative energies* of the C3'-endo and
C2'-endo conformations of representative nucleosides. CONTINUUM
HF/6-31G MP2/6-31-G MODEL AMBER dG 0.60 0.56 0.88 0.65 rG -0.65
-1.41 -0.28 -2.09 2'-O-MeG -0.89 -1.79 -0.36 -0.86 2'-S-MeG 2.55
1.41 3.16 2.43 *energies are in kcal/mol relative to the C2'-endo
conformation
[0119] Table 1 also includes the relative energies of
2'-O-methylguanosine and 2'-S-methylguanosine in C2'-endo and
C3'-endo conformation. This data indicates the electronic nature of
C2'-substitution has a significant impact on the relative stability
of these conformations. Substitution of the 2'-O-methyl group
increases the preference for the C3'-endo conformation (when
compared to riboguanosine) by about 0.4 kcal/mol at both the
HF/6-31G* and MP2/6-31G*//HF/6-31G* levels. In contrast, the
2'-S-methyl group reverses the trend. The C2'-endo conformation is
favored by about 2.6 kcal/mol at the HF/6-31G* level, while the
same difference is reduced to 1.41 kcal/mol at the
MP2/6-31G*//HF/6-31G* level. For comparison, and also to evaluate
the accuracy of the molecular mechanical force-field parameters
used for the 2'-O-methyl and 2'-S-methyl substituted nucleosides,
we have calculated the gas phase energies of the nucleosides. The
results reported in Table 1 indicate that the calculated relative
energies of these nucleosides compare qualitatively well with the
ab initio calculations.
[0120] Additional calculations were also performed to gauge the
effect of solvation on the relative stability of nucleoside
conformations. The estimated solvation effect using HF/6-31G*
geometries confirms that the relative energetic preference of the
four nucleosides in the gas-phase is maintained in the aqueous
phase as well (Table 1). Solvation effects were also examined using
molecular dynamics simulations of the nucleosides in explicit
water. From these trajectories, one can observe the predominance of
C2'-endo conformation for deoxyriboguanosine and
2'-S-methylriboguanosine while riboguanosine and
2'-O-methylriboguanosine prefer the C3'-endo conformation. These
results are in much accord with the available NMR results on
2'-S-methylribonucleosides. NMR studies of sugar puckering
equilibrium using vicinal spin-coupling constants have indicated
that the conformation of the sugar ring in 2'-S-methylpyrimidine
nucleosides show an average of >75% S-character, whereas the
corresponding purine analogs exhibit an average of >90% S-pucker
[Fraser, A., Wheeler, P., Cook, P. D. and Sanghvi, Y. S., J.
Heterocycl. Chem., 1993, 30, 1277-1287]. It was observed that the
2'-S-methyl substitution in deoxynucleoside confers more
conformational rigidity to the sugar conformation when compared
with deoxyribonucleosides.
[0121] Structural features of DNA:RNA, OMe_DNA:RNA and SMe_DNA:RNA
hybrids were also observed. The average RMS deviation of the
DNA:RNA structure from the starting hybrid coordinates indicate the
structure is stabilized over the length of the simulation with an
approximate average RMS deviation of 1.0 .ANG.. This deviation is
due, in part, to inherent differences in averaged structures (i.e.
the starting conformation) and structures at thermal equilibrium.
The changes in sugar pucker conformation for three of the central
base pairs of this hybrid are in good agreement with the
observations made in previous NMR studies. The sugars in the RNA
strand maintain very stable geometries in the C3'-endo conformation
with ring pucker values near 0.degree.. In contrast, the sugars of
the DNA strand show significant variability.
[0122] The average RMS deviation of the OMe_DNA:RNA is
approximately 1.2 .ANG. from the starting A-form conformation;
while the SMe_DNA:RNA shows a slightly higher deviation
(approximately 1.8 .ANG.) from the starting hybrid conformation.
The SMe_DNA strand also shows a greater variance in RMS deviation,
suggesting the S-methyl group may induce some structural
fluctuations. The sugar puckers of the RNA complements maintain C3
'-endo puckering throughout the simulation. As expected from the
nucleoside calculations, however, significant differences are noted
in the puckering of the OMe_DNA and SMe_DNA strands, with the
former adopting C3'-endo, and the latter, C1'-exo/C2'-endo
conformations.
[0123] An analysis of the helicoidal parameters for all three
hybrid structures has also been performed to further characterize
the duplex conformation. Three of the more important axis-basepair
parameters that distinguish the different forms of the duplexes,
X-displacement, propeller twist, and inclination, are reported in
Table 2. Usually, an X-displacement near zero represents a B-form
duplex; while a negative displacement, which is a direct measure of
deviation of the helix from the helical axis, makes the structure
appear more A-like in conformation. In A-form duplexes, these
values typically vary from -4 .ANG. to -5.ANG.. In comparing these
values for all three hybrids, the SMe_DNA:RNA hybrid shows the most
deviation from the A-form value, the OMe_DNA:RNA shows the least,
and the DNA:RNA is intermediate. A similar trend is also evident
when comparing the inclination and propeller twist values with
ideal A-form parameters. These results are further supported by an
analysis of the backbone and glycosidic torsion angles of the
hybrid structures. Glycosidic angles (X) of A-form geometries, for
example, are typically near -159E while B form values are near
-102E. These angles are found to be -162E, -133E, and -108E for the
OMe_DNA, DNA, and SMe_DNA strands, respectively. All RNA
complements adopt an X angle close to -160E. In addition,
"crankshaft" transitions were also noted in the backbone torsions
of the central UpU steps of the RNA strand in the SMe_DNA:RNA and
DNA;RNA hybrids. Such transitions suggest some local conformational
changes may occur to relieve a less favorable global conformation.
Taken overall, the results indicate the amount of A-character
decreases as OMe_DNA:RNA>DNA:RNA>SMe_DNA:RNA, with the latter
two adopting more intermediate conformations when compared to A-
and B-form geometries. TABLE-US-00002 TABLE 2 Average helical
parameters derived from the last 500 ps of simulation time.
(canonical A- and B-form values are given for comparison)
Helicoidal B-DNA B-DNA A-DNA Parameter (x-ray) (fibre) (fibre)
DNA:RNA OMe_DNA:RNA SMe_DNA:RNA X-disp 1.2 0.0 -5.3 -4.5 -5.4 -3.5
Inclination -2.3 1.5 20.7 11.6 15.1 0.7 Propeller -16.4 -13.3 -7.5
-12.7 -15.8 -10.3
[0124] Stability of C2'-modified DNA:RNA hybrids was determined.
Although the overall stability of the DNA:RNA hybrids depends on
several factors including sequence-dependencies and the purine
content in the DNA or RNA strands DNA:RNA hybrids are usually less
stable than RNA:RNA duplexes and, in some cases, even less stable
than DNA:DNA duplexes. Available experimental data attributes the
relatively lowered stability of DNA:RNA hybrids largely to its
intermediate conformational nature between DNA:DNA (B-family) and
RNA:RNA (A-family) duplexes. The overall thermodynamic stability of
nucleic acid duplexes may originate from several factors including
the conformation of backbone, base-pairing and stacking
interactions. While it is difficult to ascertain the individual
thermodynamic contributions to the overall stabilization of the
duplex, it is reasonable to argue that the major factors that
promote increased stability of hybrid duplexes are better stacking
interactions (electrostatic B--B_interactions) and more favorable
groove dimensions for hydration. The C2'-S-methyl substitution has
been shown to destabilize the hybrid duplex. The notable
differences in the rise values among the three hybrids may offer
some explanation. While the 2'-S-methyl group has a strong
influence on decreasing the base-stacking through high rise values
(.about.3.2 .ANG.), the 2'-O-methyl group makes the overall
structure more compact with a rise value that is equal to that of
A-form duplexes (.about.2.6 .ANG.). Despite its overall A-like
structural features, the SMe_DNA:RNA hybrid structure possesses an
average rise value of 3.2 .ANG. which is quite close to that of
B-family duplexes. In fact, some local base-steps (CG steps) may be
observed to have unusually high rise values (as high as 4.5 .ANG.).
Thus, the greater destabilization of 2'-S-methyl substituted
DNA:RNA hybrids may be partly attributed to poor stacking
interactions.
[0125] It has been postulated that RNase H binds to the minor
groove of RNA:DNA hybrid complexes, requiring an intermediate minor
groove width between ideal A- and B-form geometries to optimize
interactions between the sugar phosphate backbone atoms and RNase
H. A close inspection of the averaged structures for the hybrid
duplexes using computer simulations reveals significant variation
in the minor groove width dimensions as shown in Table 3. Whereas
the O-methyl substitution leads to a slight expansion of the minor
groove width when compared to the standard DNA:RNA complex, the
S-methyl substitution leads to a general contraction (approximately
0.9 .ANG.). These changes are most likely due to the preferred
sugar puckering noted for the antisense strands which induce either
A- or B-like single strand conformations. In addition to minor
groove variations, the results also point to potential differences
in the steric makeup of the minor groove. The O-methyl group points
into the minor groove while the S-methyl is directed away towards
the major groove. Essentially, the S-methyl group has flipped
through the bases into the major groove as a consequence of
C2'-endo puckering. TABLE-US-00003 TABLE 3 Minor groove widths
averaged over the last 500 ps of simulation time Phosphate DNA:RNA
RNA:RNA Distance DNA:RNA OMe_DNA:RNA SMe_DNA:RNA (B-form) (A-form)
P5-P20 15.27 16.82 13.73 14.19 17.32 P6-P19 15.52 16.79 15.73 12.66
17.12 P7-P18 15.19 16.40 14.08 11.10 16.60 P8-P17 15.07 16.12 14.00
10.98 16.14 P9-P16 15.29 16.25 14.98 11.65 16.93 P10-P15 15.37
16.57 13.92 14.05 17.69
[0126] In addition to the modifications described above, the
nucleotides of the oligonucleotides of the invention can have a
variety of other modification so long as these other modifications
do not significantly detract from the properties described above.
Thus, for nucleotides that are incorporated into oligonucleotides
of the invention, these nucleotides can have sugar portions that
correspond to naturally-occurring sugars or modified sugars.
Representative modified sugars include carbocyclic or acyclic
sugars, sugars having substituent groups at their 2' position,
sugars having substituent groups at their 3' position, and sugars
having substituents in place of one or more hydrogen atoms of the
sugar. Other altered base moieties and altered sugar moieties are
disclosed in U.S. Pat. No. 3,687,808 and PCT application
PCT/US89/02323.
[0127] Altered base moieties or altered sugar moieties also include
other modifications consistent with the spirit of this invention.
Such oligonucleotides are best described as being structurally
distinguishable from, yet functionally interchangeable with,
naturally occurring or synthetic wild type oligonucleotides. All
such oligonucleotides are comprehended by this invention so long as
they function effectively to mimic the structure of a desired RNA
or DNA strand. A class of representative base modifications include
tricyclic cytosine analog, termed "G clamp" (Lin, et al., J. Am.
Chem. Soc. 1998, 120, 8531). This analog makes four hydrogen bonds
to a complementary guanine (G) within a helix by simultaneously
recognizing the Watson-Crick and Hoogsteen faces of the targeted G.
This G clamp modification when incorporated into phosphorothioate
oligonucleotides, dramatically enhances antisense potencies in cell
culture. The oligonucleotides of the invention also can include
phenoxazine-substituted bases of the type disclosed by Flanagan, et
al., Nat. Biotechnol. 1999, 17(1), 48-52.
[0128] Additional modifications may also be made at other positions
on the oligonucleotide, particularly the 3' position of the sugar
on the 3' terminal nucleotide and the 5' position of 5' terminal
nucleotide. For example, one additional modification of the
oligonucleotides of the invention involves chemically linking to
the oligonucleotide one or more moieties or conjugates which
enhance the activity, cellular distribution or cellular uptake of
the oligonucleotide. Such moieties include but are not limited to
lipid moieties such as a cholesterol moiety (Letsinger et al.,
Proc. Natl. Acad. Sci. USA, 1989, 86, 6553), cholic acid (Manoharan
et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053), a thioether,
e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N. Y Acad. Sci.,
1992, 660, 306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3,
2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res.,
1992, 20, 533), an aliphatic chain, e.g., dodecandiol or undecyl
residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 111; Kabanov
et al., FEBS Lett., 1990, 259, 327; Svinarchuk et al., Biochimie,
1993, 75, 49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or
triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651; Shea et al.,
Nucl. Acids Res., 1990, 18, 3777), a polyamine or a polyethylene
glycol chain (Manoharan et al., Nucleosides & Nucleotides,
1995, 14, 969), or adamantane acetic acid (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651), a palmityl moiety (Mishra et
al., Biochim. Biophys. Acta, 1995, 1264, 229), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923).
[0129] Human RNase H1 displays a strong positional preference for
cleavage, i.e., it cleaves between 8-12 nucleotides from the
5N-RNA:3N-DNA terminus of the duplex. Within the preferred cleavage
site, the enzyme displays modest sequence preference with GU being
a preferred dinucleotide. The minimum RNA:DNA duplex length that
supports cleavage is 6-base pairs and the minimum RNA:DNA "gap
size" that supports cleavage is 5-base pairs.
Properties of Purified Human RNase H1
[0130] The effects of various reaction conditions on the activity
of Human RNase H1 were evaluated (FIG. 1). The optimal pH for the
enzyme in both Tris HCl and phosphate buffers was 7.0-8.0. At pH's
above pH8.0, enzyme activity was reduced. However, this could be
due to instability of the substrate or effects on the enzyme, or
both. To evaluate the potential contribution of changes in ionic
strength to the activities observed at different pHs, two buffers,
NaHPO.sub.4 and Tris HCl were studied at pH 7.0 and gave the same
enzyme activity even though the ionic strengths differed. Enzyme
activity was inhibited by increasing ionic strength (FIG. 1B) and
N-ethymaleamide (FIG. 1C). Enzyme activity increased as the
temperature was raised from 25-42.degree. C (FIG. 1D). Mg.sup.2+
stimulated enzyme activity with an optimal concentration of 1 mM.
At higher concentrations, Mg.sup.2+ was inhibitory (FIG. 1E). In
the presence of 1 mM Mg.sup.2+, Mn.sup.2+ was inhibitory at all
concentrations tested (FIG. 1F). The purified enzyme was quite
stable and easily handled. In fact, the enzyme could be boiled and
rapidly or slowly cooled without significant loss of activity (FIG.
1D). The initial rates of cleavage were determined for four duplex
substrates studied simultaneously. The initial rate of cleavage for
a phosphodiester DNA:RNA duplex was 1050.+-.203 pmol
L.sup.-min.sup.- (Table 4A). The initial rate of cleavage of a
phosphorothioate oligodeoxynucleotide duplex was approximately
four-fold faster than that of the same duplex comprised of a
phosphodiester antisense oligodeoxynucleotide (Table 4A). The
initial rates for 17-mer and 20-mer substrates of different
sequences were equal (Table 4B). However, when a 25-mer
heteroduplex, containing the 17-mer sequence in the center of the
duplex was digested (RNA 3), the rate was 50% faster.
Interestingly, the Km of the enzyme for the 25 mer duplex was 40%
lower than that for the 17 mer while the Vmax's for both duplexes
were the same (see Table 6), suggesting that with the increase in
length, a larger number of cleavage sites are available resulting
in an increase in the number of productive binding interactions
between the enzyme and substrate. As a result, a lower substrate
concentration is required for the longer duplex to achieve a
cleavage rate equal to that of the shorter duplex.
[0131] To better characterize the substrate specificity of Human
RNase H1, duplexes in which the antisense oligonucleotide was
modified in the 2'-position were studied. As previously reported
for E. coli RNase H1, Human RNase H1 was unable to cleave
substrates with 2'-modifications at the cleavage site of the
antisense DNA strand or the sense RNA strand (Table 5). For
example, the initial rate of cleavage of a duplex containing a
phosphorothioate oligodeoxynucleotide and its complement was 3400
pmol L.sup.-1min.sup.-1 while that of its 2'-propoxy modified
analog was undetectable (Table 5). A duplex comprised of a fully
modified 2'-methoxy antisense strand also failed to support any
cleavage (Table 5). The placement of 2'-methoxy modifications
around a central region of oligodeoxynucleotides reduced the
initial rate (Table 5). The smaller the central
oligodeoxynucleotide "gap" the lower the initial rate. The smallest
"gapmer" for which cleavage could be measured was a 5
deoxynucleotide gap. These data are highly consistent with
observations we have previously reported for E. coli RNase H1
except that for the bacterial enzyme the minimum gap size was 4
deoxynucleotides.
[0132] The Km and Vmax of Human RNase H1 for three substrates are
shown in Table 6. The Km valves for all three substrates were
substantially lower than those of E. coli RNase H1 (Table 6). As
previously reported for E. coli RNase H1, the Km for a
phosphorothioate containing duplex was lower than that of a
phosphodiester duplex. The Vmax of the human enzyme was 30 fold
lower than that of the E. coli enzyme. The Vmax for the
phosphorothioate containing substrate was less than the
phosphodiester duplex. This is probably due to inhibition of the
enzyme at higher concentrations by excess phosphorothioate single
strand oligonucleotide as the initial rate of cleavage for a
phosphorothioate containing duplex was, in fact, greater than the
phosphodiester (Table 4)
Binding Affinity and Specificity
[0133] To evaluate the binding affinity of Human RNase H1, a
competitive cleavage assay in which increasing concentrations of
noncleavable substrates were added was used. Using this approach,
the Ki is formally equivalent to the Kd for the competing
substrates. Of the noncleavable substrates studied, Lineweaver-Burk
analyses demonstrated that all inhibitors shown in Table 7 were
competitive (data not shown). A duplex containing a phosphodiester
oligodeoxynucleotide hybridized to a phosphodiester 2'-methoxy
oligonucleotide as the noncleavable substrate is considered most
like DNA:RNA. Table 7 shows the results of these studies and
compares them to previously reported results for the E. coli enzyme
performed under similar conditions. Clearly, the affinity of the
human enzyme for its DNA:RNA like substrate (DNA:2'-O-Me) was
substantially greater than that of the E. coli enzyme, consistent
with the differences observed in Km (Table 6).
[0134] E. coli RNase H1 displays approximately equal affinity for
RNA:RNA, RNA:2'-O-Me and DNA:2'-O-Me duplexes (Table 7). The human
enzyme displays similar binding properties, but is more able to
discriminate between various duplexes. For example, the Kd for
RNA:RNA was approximately 5 fold lower than the Kd for DNA:2'-O-Me.
This is further demonstrated by the Kd for the RNA:2'F duplex. The
Kd for the DNA:2'-F duplex was slightly greater than for the
RNA:2'-F duplex and the RNA:RNA duplex, but clearly lower than for
other duplexes. Thus, both enzymes can be considered double strand
RNA binding proteins. However, Human RNase H1 is somewhat less
specific for duplexes as compared to single strand oligonucleotides
than the E. coli enzyme. The enzyme bound to single strand RNA and
DNA only 20 fold less well than an RNA:RNA duplex while the E. coli
enzyme bound to single strand DNA nearly 600 fold less than to an
RNA:RNA duplex (Table 7). The affinity of a single strand
phosphorothioate oligodeoxynucleotide for both enzymes was
significant relative to the affinity for the natural substrate and
accounts for the inhibition of the enzymes by members of this class
oligonucleotides. Remarkably, Human RNase H1 displayed the highest
affinity for a single strand phosphorothioate oligodeoxynucleotide.
Thus, this noncleavable substrate is a very effective inhibitor of
the enzyme and excess phosphorothioate antisense drug in cells
might be highly inhibitory.
Site and Sequence Preferences for Cleavage
[0135] FIG. 2 shows the cleavage pattern for RNA duplexed with its
phosphorothioate oligodeoxynucleotide and the pattern for several
gapmers. In the parent duplex, RNA cleavage occurred at a single
major site with minor cleavage noted at several sites 3' to this
major cleavage site that was 8 nucleotides from 5'-terminus of the
RNA. Note that the preferred site occured at a GU dinucleotide.
Cleavage of several "gapmers" occurred more slowly and the major
cleavage site was at a different position from that of the parent
duplex. Further, in contrast to the observations we have made for
E. coli RNase H1, the major cleavage site in gapmers treated with
Human RNase H1 did not occur at the nucleotide apposed to the
nucleotide adjacent to the first 2' methoxy nucleotide in the wing
hybridized to the 3' portion of the RNA.
[0136] To further evaluate the site and sequence specificities of
Human RNase H1, cleavage of substrates shown in FIG. 3 and FIG. 4
was studied. In FIG. 3, the sequence of the RNA is displayed below
the sequencing gels and the length and position of the
complementary phosphodiester oligodeoxynucleotide indicated by the
solid line below the RNA sequence. This figure demonstrates several
important properties of the enzyme. First, the main cleavage site
was consistently observed 8-9 nucleotides from the 5'-RNA:3'-DNA
terminus of the duplex irrespective of whether there were 5' or
3'-RNA single strand overhangs. Second, the enzyme, like E. coli
RNase H1 was capable of cleaving single strand regions of RNA
adjacent to the 3'-terminus of an RNA:DNA duplex. Third, the
minimum duplex length that supported any cleavage was approximately
6 nucleotides. RNase protection assays were used to confirm that
under conditions of the assay the shorter duplexes were fully
hybridized, so the differences observed were not due to the failure
to hybridize. To assure that the 6-nucleotide duplex was fully
hybridized, the reactions were carried out at a 50:1 DNA:RNA ratio
(data not shown). Fourth, the figure shows that for duplexes
smaller than the nine base pairs, the smaller the duplex, the
slower the cleavage rate. Fifth, the preferred cleavage site was
located at a GU dinucleotide.
[0137] The site and sequence specificities are further explored in
FIG. 4. That the enzyme displays little sequence preference is
demonstrated by comparing the rates and sites of cleavage for
duplexes A, C and D. In all cases, the preferred site of cleavage
was 8-12 nucleotides from the 5'-RNA:3'-DNA terminus of the duplex
irrespective of the sequence. comparison of the cleavage pattern
for duplexes A and B shows that cleavage occurred at the 8-12
nucleotide position even when there were RNA overhangs also as
shown in FIG. 3. Cleavage of duplex F demonstrated that the site of
cleavage was retained even if there were 5'- and 3'-DNA overhangs.
In a longer substrate, duplex G, the main site of cleavage was
still 8-12 nucleotides from the terminus of the duplex. However,
minor cleavage sites were observed throughout the RNA suggesting
that this substrate might support binding of more than one enzyme
molecule per substrate, but that the preferred site was near the
5'-RNA:3'-DNA terminus. Finally, optimal cleavage seemed to occur
when a GU dinucleotide was located 8-12 nucleotides from the
5'-RNA:3'-DNA terminus of the duplex.
[0138] To address both the mechanism of cleavage and processivity,
the cleavage of 5'-labeled and 3'-labeled substrates was compared
(FIG. 5). Lane C shows that CIP treatment prior to and after
digestion with Human RNase H1 resulted in a shift in the mobility
of the digested fragments suggesting that Human RNase H1 generates
cleavage products with 5'-phosphates. Thus, it is similar to E.
coli RNase H1 in this regard. A second intriguing observation is
that the addition of pC to the 3'-end of the RNA caused a shift in
the position of the preferred cleavage site (A vs B or C). The four
cleavage sites in the center of the duplex observed with a
5'-phosphate labeled RNA were observed in 3' pC-labeled substrates.
However, the main cleavage site shifted from base pair 8 to base
pair 12. Interestingly, the sequence at both sites was GU. Thus, it
is conceivable that the enzyme selects a position 8-12 nucleotide
from the 5'-RNA:3'-DNA terminus, then cleaves at a preferred
dinucleotide such as GU. Third, this figure considered along with
the cleavage patterns shown in FIGS. 3 and 4 demonstrates that this
enzyme displays minimal processivity in either the 5' or
3'-direction. In no time course experiment using any substrate have
we observed a pattern that would be consistent with processivity.
The possibility that the failure to observe processivity in FIGS. 3
and 4 was due to processivity in the 3' to 5'-direction is excluded
by the results in FIG. 5. Again, this is significantly different
from observations we have previously reported for E. coli RNase
H1.
General Properties of Human RNase H1 Activity
[0139] The present invention also describes the properties of human
RNase H1 that have been characterized. As the protein studied is a
his-tag fusion and was denatured and refolded, it is possible that
the activity of the enzyme in its native state might be greater
than we have observed. However, basic properties are certainly
likely to reflect the basic properties of the native enzyme.
Numerous studies have shown that a his-tag does not interfere with
protein folding and crystallization, kinetic and catalytic
properties, or nucleic acid binding properties since it is very
small (few amino acids) and its pK is near neutral. It is shown in
the present invention that the his-tag fusion protein behaves like
other RNase H's. It cleaved specifically the RNA strand in RNA:DNA
duplexes, resulted in cleavage products with
5.quadrature.-phosphate termini (FIG. 5) and was affected by
divalent cations (FIG. 1). Optimal conditions for Human RNase H1
were similar to, but not identical to, E. coli RNase H1. For the
human enzyme, the Mg.sup.2+ optimum was 1 mM and 5 mM Mg.sup.2+ was
inhibitory. In the presence of Mg.sup.2+, both enzymes were
inhibited by Mn.sup.2+. The human enzyme was inhibited by
n-ethylmaleimide and was quite stable, easily handled and did not
form multimeric structures (FIG. 1). The ease of handling,
denaturation, refolding and stability in various conditions suggest
that the Human RNase H1 was active as a monomer and has a
relatively stable preferred conformation.
[0140] Studies on the structure and enzymatic activities of a
number of mutants of E. coli RNase H1 have recently led to a
hypothesis to explain the effects of divalent cations termed an
activation/attenuation model. The effects of divalent cations on
Human RNase H1 are complex and are consistent with the suggested
activation/attenuation model. The amino acids proposed to be
involved in both cation binding sites are conserved in Human RNase
H1.
Positional and Sequence Preferences and Processivity
[0141] The site and sequence specificity of Human RNase H1 differ
substantially from E. coli RNase H1. Although neither enzyme
displays significant sequence specificity and FIGS. 2-5 this
manuscript, the human enzyme displays remarkable site specificity.
FIGS. 2-4 show that Human RNase H1 preferentially cleaved 8-12
nucleotides 3' from the 5'-RNA:3'-DNA terminus of a DNA:RNA duplex
irrespective of whether there were 5' or 3'-RNA or DNA overhangs.
The process by which a position is selected and then within that
position on the duplex a particular dinucleotide is cleaved
preferentially must be relatively complex and influenced by
sequence. Clearly, the dinucleotide, GU, is a preferred sequence.
In FIG. 3, for example, all the duplexes contained a GU sequence
near the optimal position for the enzyme and in all cases the
preferential cleavage site was GU. Additionally, in duplexes A and
B a second GU was also cleaved, albeit at a very slow rate. The
third site in duplexes A and B cleaved was a GG dinucleotide 7 base
pairs from the 3'-RNA:5'-DNA terminus. Thus, the data suggest that
the enzyme displays strong positional preference and within the
appropriate site, slight preference for GU dinucleotides.
[0142] The strong positional preference exhibited by Human RNase H1
suggests that the enzyme fixes its position on the duplex via the
5'-RNA:3'-DNA terminus. Interestingly, the in-vitro cleavage
pattern observed for the enzyme is compatible with its proposed
in-vivo role, namely, the removal of RNA primers during DNA
replication of the lagging strand. The average length of the RNA
primer ranges from 7-14 nucleotides. Consequently, synthesis of the
lagging strand results in chimeric sequences consisting of 7-14
ribonucleotides at the 5.quadrature.-terminus with contiguous
stretches of DNA extending in the 3' direction. The positional
preference observed for Human RNase H1, (i.e., 8-12 residues from
the 5'-terminus of the RNA), would suggest that cleavage of the
chimeric lagging strand by RNase H1 would occur at or near the
RNA:DNA junction. The removal of residual ribonucleatides following
RNase H digestion has been shown to be performed by the
endonuclease FEN1.
[0143] FIG. 4 provides additional insight into the positional and
sequence preferences of the enzyme. When there was a GU
dinucleotide present in the correct position in the duplex, it was
cleaved preferentially. When a GU dinucleotide was absent, AU was
cleaved as well as other dinucleotides. For duplex G both a GU and
a GG dinucleotide were present within the preferred site, and in
this case the GG dinucleotide was cleaved slightly more extensively
than the GU dinucleotide. Clearly, additional duplexes of different
sequences must be studied before definitive conclusions concerning
the roles of various sequences within the preferred cleavage sites
can be drawn.
[0144] In FIG. 5, the 3'-terminus of the RNA was labeled with
.sup.32pC. In this case the same four nucleotides were cleaved as
when the RNA was 5' labeled (FIG. 5, panels B & C). However,
the GU closer to the 3'-terminus of the RNA was cleaved at least as
rapidly as the 5'-GU. Interestingly in studies on the partially
purified enzyme, differences in the cleavage pattern were also
observed when 5N-labeled substrates were compared to 3'-labeled
substrates. A possible explanation for this observation is that the
presence of a 3'-phosphate on an oligonucleotide substrate affects
the scanning mechanism the enzyme uses to select preferred
positions for cleavage.
[0145] In a duplex comprised of RNA annealed to a chimeric
oligonucleotide with an oligodeoxynucleotide center flanked by
2N-modified nucleotide wings, the cleavage by Human RNase H1 was
directed to the DNA:RNA portion of the duplex as was observed for
E. coli RNase H1. However, within this region, the preferred sites
of cleavage for the human enzyme differed from E. coli RNase H1. E.
coli RNase H1 preferentially cleaved at the ribonucleotide apposed
to first 2'-modified nucleotide in the wing of antisense
oligonucleotide at the 3'-end of the RNA. In contrast, the human
enzyme preferentially cleaved at sites more centered within the gap
until the gap was reduced to 5 nucleotides. Further, the minimum
gap size for the human enzyme was 5 nucleotides while that of E.
coli RNase H1 was 4 nucleotides. These differences in behavior
suggest differences in the structures of the enzymes and their
interactions with substrate that will require additional study.
[0146] Although E. coli RNase H1 degrades the heteroduplex
substrate in a predominantly distributive manner, the enzyme
displays modest 5'-3'-processivity. In contrast, Human RNase H1
evidences no 5'-3' or 3'-5'-processivity suggesting that the human
enzyme hydrolyzes the substrate in an exclusively distributive
manner. The lack of processivity observed with the Human RNase H1
may be a function of the significantly tighter binding affinity
(Table 7), thereby reducing the ability of the enzyme to move on
the substrate. Alternatively, Human RNase H1 appears to fix its
position on the substrate with respect to the 5'-RNA:3'-DNA
terminus and this strong positional preference may preclude
cleavage of the substrate in a processive manner. (FIG. 5). Thus,
despite the fact that the enzymes are both metal-dependent
endonucleases that result in cleavage products with 5'-phosphates
(FIG. 5) and both can cleave single-strand 3'-RNA overhangs (FIG.
5), these enzymes display substantial differences.
[0147] E. coli RNase H1 has been suggested to exhibit "binding
directionality" with respect to the RNA of the substrate such that
the primary binding region of the enzyme is positioned several
nucleotides 5' to the catalytic center. This results in cleavage
sites being restricted from the 5'-RNA:3'-DNA end of a duplex, and
cleavage sites occurring at the 3'-RNA:5'-DNA end of the duplex and
in 3'-single-strand overhangs. The human enzyme behaves entirely
analogously. Thus, we conclude that Human RNase H1 likely has the
same binding directionality as the E. coli enzyme.
Substrate Binding
[0148] RNA:RNA duplexes have been shown to adopt an A-form
conformation. Many 2'-modifications shift the sugar conformation
into a 3'-endo pucker characteristic of RNA. Consequently, when
hybridized to RNA, the resulting duplex is "A" form and this is
manifested in a more stable duplex. 2'-F Oligonucleotides display
duplex forming properties most like RNA, while 2'-methoxy
oligonucleotides result in duplexes intermediate information
between DNA:RNA and RNA:RNA duplexes.
[0149] The results shown in Table 7 demonstrate that like the E.
coli enzyme, Human RNase H1 is a double strand RNA binding protein.
Moreover, it displays some ability to discriminate between various
A-form duplexes (Table 7). The observation that the Kd for an
RNA:2'-F duplex is equal to that for an RNA:RNA dupex suggests that
2'-hydroxy group is not required for binding to the enzyme.
Nevertheless, we cannot exclude the possibility that bulkier
2'-modifications, e.g. 2'-methoxy or 2'-propyl might sterically
inhibit the binding of the enzyme as well as alter the A-form
quality of the duplex. The human enzyme displays substantially
greater affinity for all oligonucleotides than the E. coli enzyme
and this is reflected in a lower Km for cleavable substrates
(Tables 6 and 7). In addition, the tighter binding affinity
observed for Human RNase H1 may be responsible for the 20-fold
lower Vmax when compared to the E. coli enzyme. In this case,
assuming that the E. coli and human enzymes exhibit similar
catalytic rates (Kcat), then an increase in the binding affinity
would result in a lower turnover rate and ultimately a lower
Vmax.
[0150] The principal substrate binding site in E. coli RNase H1 is
thought to be a cluster of lysines that are believed to bind to the
phosphates of the substrates. The interaction of the binding
surface of the enzyme and substrate is believed to occur within the
minor groove. This region is highly conserved in the human enzyme.
In addition, eukaryotic enzymes contain an extra N-terminal region
of variable length containing an abundance of basic amino acids.
This region is homologous with a double strand RNA binding motif
and indeed in the S. cerevasiae RNase H has been shown to bind to
double strand RNA. The N-terminal extension in Human RNase H1 is
longer than that in the S. cerevasiae enzyme and appears to
correspond to a more complete double strand RNA binding motif.
Consequently, the enhanced binding of Human RNase H1 to various
nucleic acids may be due to the presence of this additional binding
site.
[0151] As used herein, the term "alkyl" includes but is not limited
to straight chain, branch chain, and cyclic unsaturated hydrocarbon
groups including but not limited to methyl, ethyl, and isopropyl
groups. Alkyl groups of the present invention may be substituted.
Representative alkyl substituents are disclosed in U.S. Pat. No.
5,212,295, at column 12, lines 41-50, hereby incorporated by
reference in its entirety.
[0152] Alkenyl groups according to the invention are to straight
chain, branch chain, and cyclic hydrocarbon groups containing at
least one carbon-carbon double bond, and alkynyl groups are to
straight chain, branch chain, and cyclic hydrocarbon groups
containing at least one carbon-carbon triply bond. Alkenyl and
alkynyl groups of the present invention can be substituted.
[0153] Aryl groups are substituted and unsubstituted aromatic
cyclic moieties including but not limited to phenyl, naphthyl,
anthracyl, phenanthryl, pyrenyl, and xylyl groups. Alkaryl groups
are those in which an aryl moiety links an alkyl moiety to a core
structure, and aralkyl groups are those in which an alkyl moiety
links an aryl moiety to a core structure.
[0154] In general, the term "hetero" denotes an atom other than
carbon, preferably but not exclusively N, O, or S. Accordingly, the
term "heterocyclic ring" denotes a carbon-based ring system having
one or more heteroatoms (i.e., non-carbon atoms). Preferred
heterocyclic rings include, for example but not limited to
imidazole, pyrrolidine, 1,3-dioxane, piperazine, morpholine rings.
As used herein, the term "heterocyclic ring" also denotes a ring
system having one or more double bonds, and one or more
heteroatoms. Preferred heterocyclic rings include, for example but
not limited to the pyrrolidino ring.
[0155] Oligonucleotides according to the present invention that are
hybridizable to a target nucleic acid preferably comprise from
about 5 to about 50 nucleosides. It is more preferred that such
compounds comprise from about 8 to about 30 nucleosides, with 15 to
25 nucleosides being particularly preferred. As used herein, a
target nucleic acid is any nucleic acid that can hybridize with a
complementary nucleic acid-like compound. Further in the context of
this invention, "hybridization" shall mean hydrogen bonding, which
may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen
bonding between complementary nucleobases. "Complementary" as used
herein, refers to the capacity for precise pairing between two
nucleobases. For example, adenine and thymine are complementary
nucleobases which pair through the formation of hydrogen bonds.
"Complementary" and "specifically hybridizable," as used herein,
refer to precise pairing or sequence complementarity between a
first and a second nucleic acid-like oligomers containing
nucleoside subunits. For example, if a nucleobase at a certain
position of the first nucleic acid is capable of hydrogen bonding
with a nucleobase at the same position of the second nucleic acid,
then the first nucleic acid and the second nucleic acid are
considered to be complementary to each other at that position. The
first and second nucleic acids are complementary to each other when
a sufficient number of corresponding positions in each molecule are
occupied by nucleobases which can hydrogen bond with each other.
Thus, "specifically hybridizable" and "complementary" are terms
which are used to indicate a sufficient degree of complementarity
such that stable and specific binding occurs between a compound of
the invention and a target RNA molecule. It is understood that an
oligomeric compound of the invention need not be I 00%
complementary to its target RNA sequence to be specifically
hybridizable. An oligomeric compound is specifically hybridizable
when binding of the oligomeric compound to the target RNA molecule
interferes with the normal function of the target RNA to cause a
loss of utility, and there is a sufficient degree of
complementarity to avoid non-specific binding of the oligomeric
compound to non-target sequences under conditions in which specific
binding is desired, i.e. under physiological conditions in the case
of in vivo assays or therapeutic treatment, or in the case of in
vitro assays, under conditions in which the assays are
performed.
[0156] As used herein, "human type 2 RNase H" and "human RNase H1"
refer to the same human RNase H enzyme. Accordingly, these terms
are meant to be used interchangeably.
[0157] The oligonucleotides of the invention can be used in
diagnostics, therapeutics and as research reagents and kits. They
can be used in pharmaceutical compositions by including a suitable
pharmaceutically acceptable diluent or carrier. They further can be
used for treating organisms having a disease characterized by the
undesired production of a protein. The organism should be contacted
with an oligonucleotide having a sequence that is capable of
specifically hybridizing with a strand of nucleic acid coding for
the undesirable protein. Treatments of this type can be practiced
on a variety of organisms ranging from unicellular prokaryotic and
eukaryotic organisms to multicellular eukaryotic organisms. Any
organism that utilizes DNA-RNA transcription or RNA-protein
translation as a fundamental part of its hereditary, metabolic or
cellular control is susceptible to therapeutic and/or prophylactic
treatment in accordance with the invention. Seemingly diverse
organisms such as bacteria, yeast, protozoa, algae, all plants and
all higher animal forms, including warm-blooded animals, can be
treated. Further, each cell of multicellular eukaryotes can be
treated, as they include both DNA-RNA transcription and RNA-protein
translation as integral parts of their cellular activity.
Furthermore, many of the organelles (e.g., mitochondria and
chloroplasts) of eukaryotic cells also include transcription and
translation mechanisms. Thus, single cells, cellular populations or
organelles can also be included within the definition of organisms
that can be treated with therapeutic or diagnostic
oligonucleotides.
[0158] The following nonlimiting examples are provided to further
illustrate the present invention.
EXAMPLES
Example 1
5'-O-DMT-2'-O-(2-methoxyethyl)-5-methyl uridine and
5'-O-DMT-3'-O-(2-methoxyethyl)5-methyl uridine
[0159] 2',3'-O-dibutylstannylene 5-methyl uridine (345 g) (prepared
as per: Wagner et al., J. Org. Chem., 1974, 39, 24) was alkylated
with 2-methoxyethyl bromide (196 g) in the presence of
tetrabutylammonium iodide (235 g) in DMF (3 L) at 70.degree. C. to
give a mixture of 2'-O- and 3'-O-(2-methoxyethyl)-5-methyl uridine
(150 g) in nearly 1:1 ratio of isomers. The mixture was treated
with DMT chloride (110 g, DMT-Cl) in pyridine (1 L) to give a
mixture of the 5'-O-DMT-nucleosides. After the standard work-up the
isomers were separated by silica gel column chromatography. The
2'-isomer eluted first, followed by the 3'-isomer.
Example 2
5'-O-DMT-3'-O-(2-methoxyethyl)-5-methyl-uridine-2'-O-(2-cyanoethyl-N,N-dii-
sopropyl) phosphoramidite
[0160] 5'-O-DMT-3'-O-(2-methoxyethyl)-5-methyluridine (5 g, 0.008
mol) was dissolved in CH.sub.2Cl.sub.2 (30 mL) and to this
solution, under argon, diisopropylaminotetrazolide (0.415 g) and
2-cyanoethoxy-N,N-diisopropyl phosphoramidite (3.9 mL) were added.
The reaction was stirred overnight. The solvent was evaporated and
the residue was applied to silica column and eluted with ethyl
acetate to give 3.75 g title compound.
Example 3
5'-O-DMT-3'-O-(2-methoxyethyl)-N.sup.4-benzoyl-5-methyl-cytidine
[0161] 5'-O-DMT-3'-O-(2-methoxyethyl)-5-methyl uridine (15 g) was
treated with 150 mL anhydrous pyridine and 4.5 mL of acetic
anhydride under argon and stirred overnight. Pyridine was
evaporated and the residue was partitioned between 200 mL of
saturated NaHCO.sub.3 solution and 200 mL of ethylacetate. The
organic layer was dried (anhydrous MgSO.sub.4) and evaporated to
give 16 g of 2'-acetoxy-5'-O-(DMT)-3'-O-(2-methoxyethyl)-5-methyl
uridine.
[0162] To an ice-cold solution of triazole (19.9 g) in
triethylamine (50 mL) and acetonitrile (150 mL), with mechanical
stirring, 9 mL of POCl.sub.3 was added dropwise. After the
addition, the ice bath was removed and the mixture stirred for 30
min. The 2'-acetoxy-5'-O-(DMT)-3'-O-(2-methoxyethyl)-5-methyl
uridine (16 g in 50 mL CH.sub.3CN) was added dropwise to the above
solution with the receiving flask kept at ice bath temperatures.
After 2 hrs, TLC indicated a faster moving nucleoside,
C-4-triazole-derivative. The reaction flask was evaporated and the
nucleoside was partitioned between ethylacetate (500 mL) and
NaHCO.sub.3 (500 mL). The organic layer was washed with saturated
NaCl solution, dried (anhydrous NgSO.sub.4) and evaporated to give
15 g of C-4-triazole nucleoside. This compound was then dissolved
in 2:1 mixture of NH.sub.4OH/dioxane (100 mL:200 mL) and stirred
overnight. TLC indicated disappearance of the starting material.
The solution was evaporated and dissolved in methanol to
crystallize out 9.6 g of 5'-O-(DMT)-3'-O-(2-methoxyethyl)5-methyl
cytidine.
[0163] 5'-O-DMT-3'-O-(2-methoxyethyl)-5-methyl cytidine (9.6 g,
0.015 mol) was dissolved in 50 mL of DMF and treated with 7.37 g of
benzoic anhydride. After 24 hrs of stirring, DMF was evaporated and
the residue was loaded on silica column and eluted with 1:1
hexane:ethylacetate to give the desired nucleoside.
Example 4
5'-O-DMT-3'-O-(2-methoxyethyl)-N.sup.4-benzoyl-5-methyl-cytidine-2'-O-(2-c-
yanoethyl-N,N-diisopropyl) phosphoramidite
[0164]
5'-O-DMT-3'-O-(2-methoxyethyl)-N.sup.4-benzoyl-5-methyl-cytidine-2-
'-O-(2-cyanoethyl-N,N-diisopropyl) phosphoramidite was obtained
from the above nucleoside using the phosphitylation protocol
described for the corresponding 5-methyl-uridine derivative.
Example 5
N.sup.6-Benzoyl-5'-O-(DMT)-3'-O-(2-methoxyethyl) adenosine
[0165] A solution of adenosine (42.74 g, 0.16 mol) in dry dimethyl
formamide (800 mL) at 5.degree. C. was treated with sodium hydride
(8.24 g, 60% in oil prewashed thrice with hexanes, 0.21 mol). After
stirring for 30 min, 2-methoxyethyl bromide (0.16 mol) was added
over 20 min. The reaction was stirred at 5.degree. C. for 8 h, then
filtered through Celite. The filtrate was concentrated under
reduced pressure followed by coevaporation with toluene
(2.times.100 mL). The residue was adsorbed on silica gel (100 g)
and chromatographed (800 g, chloroform-methanol 9:14:1). Selected
fractions were concentrated under reduced pressure and the residue
was a mixture of 2'-O-(2-(methoxyethyl) adenosine and
3'-O-(2-methoxyethyl) adenosine in the ratio of 4:1.
[0166] The above mixture (0.056 mol) in pyridine (100 mL) was
evaporated under reduced pressure to dryness. The residue was
redissolved in pyridine (560 mL) and cooled in an ice water bath.
Trimethylsilyl chloride (36.4 mL, 0.291 mol) was added and the
reaction was stirred at 5.degree. C. for 30 min. Benzoyl chloride
(33.6 mL, 0.291 mol) was added and the reaction was allowed to warm
to 25.degree. C. for 2 h and then cooled to 5.degree. C. The
reaction was diluted with cold water (112 mL) and after stirring
for 15 min, concentrated ammonium hydroxide (112 Ml) was added.
After 30 min, the reaction was concentrated under reduced pressure
(below 30.degree. C.) followed by coevaporation with toluene
(2.times.100 mL). The residue was dissolved in ethyl
acetate-methanol (400 mL, 9:1) and the undesired silyl by-products
were removed by filtration. The filtrate was concentrated under
reduced pressure and then chromatographed on silica gel (800 g,
chloroform-methanol 9:1). Selected fractions were combined,
concentrated under reduced pressure and dried at 25.degree. C./0.2
mmHg for 2 h to give pure N.sup.6-Benzoyl-2'-O-(2-methoxyethyl)
adenosine and pure N.sup.6-Benzoyl-3'-O-(2-methoxyethyl)
adenosine.
[0167] A solution of N.sup.6-Benzoyl-3'-O-(2-methoxyethyl)
adenosine (11.0 g, 0.285 mol) in pyridine (100 mL) was evaporated
under reduced pressure to an oil. The residue was redissolved in
dry pyridine (300 mL) and DMT-Cl (10.9 g, 95%, 0.31 mol) was added.
The mixture was stirred at 25.degree. C. for 16 h and then poured
onto a solution of sodium bicarbonate (20 g) in ice water (500 mL).
The product was extracted with ethyl acetate (2.times.150 mL). The
organic layer was washed with brine (50 mL), dried over sodium
sulfate (powdered) and evaporated under reduced pressure (below
40C). The residue was chromatographed on silica gel (400 g, ethyl
acetate-acetonitrile-triethylamine 99:1:195:5:1). Selected
fractions were combined, concentrated under reduced pressure and
dried at 25.degree. C./0.2 mmHg to give 16.8 g (73%) of the title
compound as a foam. The TLC was homogenous.
Example 6
[N.sup.6-Benzoyl-5'-O-(DMT)-3'-O-(2-methoxyethyl)adenosin-2'-O-(2-cyanoeth-
yl-N,N-diisopropyl) phosphoramidite
[0168] The title compound was prepared in the same manner as the
5-methyl-cytidine and 5-methyluridine analogs of Examples 2 and 4
by starting with the title compound of Example 5. Purification
using ethyl acetate-hexanes-triethylamine 59:40:1 as the
chromatography eluent gave 67% yield of the title compound as a
solid foam. The TLC was homogenous. .sup.31P-NMR (CDCl.sub.3,
H.sub.3PO.sub.4 std.). 147.89; 148.36 (diastereomers).
Example 7
5'-O-(DMT)-N.sup.2-isobutyryl-3'-O-(2-methoxyethyl) guanosine
A. 2,6-Diaminopurine riboside
[0169] To a 2 L stainless steel Parr bomb was added guanosine
hydrate (100 g, 0.35 mol, Aldrich), hexamethyl) disilazane (320 mL,
1.52 mol, 4.4 eq.), trimethyl) silyl triflouromethanesulfonate (8.2
mL), and toluene (350 mL). The bomb was sealed and partially
submerged in an oil bath (170.degree. C.; internal T 150.degree.
C., 150 psi) for 5 days. The bomb was cooled in a dry ice/acetone
bath and opened. The contents were transferred with methanol (300
mL) to a flask and the solvent was evaporated under reduced
pressure. Aqueous methanol (50%, 1.2 L) was added. The resulting
brown suspension was heated to reflux for 5 h. The suspension was
concentrated under reduced pressure to one half volume in order to
remove most of the methanol. Water (600 mL) was added and the
solution was heated to reflux, treated with charcoal (5 g) and hot
filtered through Celite. The solution was allowed to cool to
25.degree. C. The resulting precipitate was collected, washed with
water (200 mL) and dried at 90.degree. C./0.2 mmHg for 5 h to give
a constant weight of 87.4 g (89%) of tan, crystalline solid; mp
247.degree. C. (shrinks), 255.degree. C. (dec, lit. (1) mp
250-252.degree. C.); TLC homogenous (Rf 0.50, isopropanol-ammonium
hydroxide-water 16:3:1 ); PMR (DMSO), 5.73 (d, 2, 2-NH.sub.2), 5.78
(s, 1, H-1), 6.83 (br s, 2, 6-NH.sub.2).
B. 2'-O-(2-methoxyethyl)-2,6-diaminopurine riboside and
3'-O-(2-methoxyethyl)-2,6-diaminopurine riboside
[0170] To a solution of 2,6-diaminopurine riboside (10.0 g, 0.035
mol) in dry dimethyl formamide (350 mL) at 0.degree. C. under an
argon atmosphere was added sodium hydride (60% in oil, 1.6 g, 0.04
mol). After 30 min., 2-methoxyethyl bromide (0.44 mol) was added in
one portion and the reaction was stirred at 25.degree. C. for 16 h.
Methanol (10 mL) was added and the mixture was concentrated under
reduced pressure to an oil (20 g). The crude product, containing a
ratio of 4:1 of the 2'/3' isomers, was chromatographed on silica
gel (500 g, chloroform-methanol 4:1). The appropriate fractions
were combined and concentrated under reduced pressure to a
semi-solid (12 g). This was triturated with methanol (50 mL) to
give a white, hygroscopic solid. The solid was dried at 40.degree.
C./0.2 mmHg for 6 h to give a pure 2' product and the pure 3'
isomer, which were confirmed by NMR.
C. 3'-O-2-(methoxyethyl)guanosine
[0171] With rapid stirring, 3'-O-(2-methoxyethyl)-2,6-diaminopurine
riboside (0.078 mol) was dissolved in monobasic sodium phosphate
buffer (0.1 M, 525 mL, pH 7.3-7.4) at 25.degree. C. Adenosine
deaminase (Sigma type II, 1 unit/mg, 350 mg) was added and the
reaction was stirred at 25.degree. C. for 60 h. The mixture was
cooled to 5.degree. C. and filtered. The solid was washed with
water (2.times.25 mL) and dried at 60.degree. C./0.2 mmHg for 5 h
to give 10.7 g of first crop material. A second crop was obtained
by concentrating the mother liquors under reduced pressure to 125
mL, cooling to 5.degree. C., collecting the solid, washing with
cold water (2.times.20 mL) and drying as above to give 6.7 g of
additional material for a total of 15.4 g (31% from guanosine
hydrate) of light tan solid; TLC purity 97%.
D. N.sup.2-Isobutyryl-3'-O-2-(methoxyethyl)guanosine
[0172] To a solution of 3'-O-2-(methoxyethyl)guanosine (18.1 g,
0.0613 mol) in pyridine (300 mL) was added trimethyl silyl chloride
(50.4 mL, 0.46 mol). The reaction was stirred at 25.degree. C. for
16 h. Isobutyryl chloride (33.2 mL, 0.316 mol) was added and the
reaction was stirred for 4 h at 25.degree. C. The reaction was
diluted with water (25 mL). After stirring for 30 min, ammonium
hydroxide (concentrated, 45 mL) was added until pH 6 was reached.
The mixture was stirred in a water bath for 30 min and then
evaporated under reduced pressure to an oil. The oil was suspended
in a mixture of ethyl acetate (600 mL) and water (100 mL) until a
solution formed. The solution was allowed to stand for 17 h at
25.degree. C. The resulting precipitate was collected, washed with
ethyl acetate (2.times.50 mL) and dried at 60.degree. C./0.2 mmHg
for 5 h to give 16.1 g (85%) of tan solid; TLC purity 98%.
E. 5'-O-(DMT)-N'-isobutyryl-3'-O-(2-methoxyethyl) guanosine
[0173] A solution of N.sup.2-Isobutyryl-3'-O-2-(methoxyethyl)
guanosine (0.051 mol) in pyridine (150 mL) was evaporated under
reduced pressure to dryness. The residue was redissolved in
pyridine (300 mL) and cooled to 10-15.degree. C. DMT-C1 (27.2 g,
95%, 0.080 mol) was added and the reaction was stirred at
25.degree. C. for 16 h. The reaction was evaporated under reduced
pressure to an oil, dissolved in a minimum of methylene chloride
and applied on a silica gel column (500 g). The product was eluted
with a gradient of methylene chloride-triethylamine (99:1) to
methylene chloride-methanol-triethylamine (99:1:1). Selected
fractions were combined, concentrated under reduced pressure and
dried at 40.degree. C./0.2 mmHg for 2 h to afford 15 g (15.5% from
guanosine hydrate) of tan foam; TLC purity 98%.
Example 8
[5'-O-(DMT)-N.sup.2-isobutyryl-3'-O-(2-methoxyethyl)
guanosin-2'-O-(2-cyanoethyl-N,N-diisopropyl) phosphoramidite
[0174] The protected nucleoside from Example 7 (0.0486 mol) was
placed in a dry 1 L round bottom flask containing a Teflon
stir-bar. The flask was purged with argon. Anhydrous methylene
chloride (400 mL) was cannulated into the flask to dissolve the
nucleoside. Previously vacuum dried
N,N-diisopropylaminohydrotetrazolide (3.0 g, 0.0174 mol) was added
under argon. With stirring,
bis-N,N-diisopropyl-aminocyanoethylphosphoramidite (18.8 g, 0.0689
mol) was added via syringe over 1 min (no exotherm noted). The
reaction was stirred under argon at 25.degree. C. for 16 h. After
verifying the completion of the reaction by TLC, the reaction was
transferred to a separatory funnel (1 L). The reaction flask was
rinsed with methylene chloride (2.times.50 mL). The combined
organic layer was washed with saturated aq. sodium bicarbonate (200
mL) and then brine (200 mL). The organic layer was dried over
sodium sulfate (50 g, powdered) for 2 h. The solution was filtered
and concentrated under reduced pressure to a viscous oil. The
resulting phosphoramidite was purified by silica gel flash
chromatography (800 g, ethyl acetate-triethylamine 99:1). Selected
fractions were combined, concentrated under reduced pressure, and
dried at 25C/0.2 mmHg for 16 h to give 18.0 g (46%, 3% from
guanosine hydrate) of solid foam TLC homogenous. .sup.31P-NMR
(CDCl.sub.3, H.sub.3PO.sub.4 std.). 147.96; 148.20
(diastereomers).
Example 9
5'-O-DMT-3'-O-(2-methoxyethyl)-5-methyl-uridine-2'-O-succinate
[0175] 5'-O-DMT-3'-O-(2-methoxyethyl)-thymidine was first
succinylated on the 2'-position. Thymidine nucleoside (4 mmol) was
reacted with 10.2 mL dichloroethane, 615 mg (6.14 mmol) succinic
anhydride, 570 .mu.L (4.09 mmol) triethylamine, and 251 mg (2.05
mmol) 4-dimethylaminopyridine. The reactants were vortexed until
dissolved and placed in heating block at 55.degree. C. for
approximately 30 minutes. Completeness of reaction checked by thin
layer chromatography (TLC). The reaction mixture was washed three
times with cold 10% citric acid followed by three washes with
water. The organic phase was removed and dried under sodium
sulfate. Succinylated nucleoside was dried under P.sub.2O.sub.5
overnight in vacuum oven.
Example 10
5'-O-DMT-3'-O-methoxyethyl-5-methyl-uridine-2'-O-succinoyl Linked
LCA CPG
[0176] 5'-O-DMT-3'-O-(2-methoxyethyl)-2'-O-succinyl-thymidine was
coupled to controlled pore glass (CPG). 1.09 g (1.52 mmol) of the
succinate were dried overnight in a vacuum oven along with
4-dimethylaminopyridine (DMAP), 2,2'-dithiobis (5-nitro-pyridine)
(dTNP), triphenylphosphine (TPP), and pre-acid washed CPG
(controlled pore glass). After about 24 hours, DMAP (1.52 mmol, 186
mg) and acetonitrile (13.7 mL) were added to the succinate. The
mixture was stirred under an atmosphere of argon using a magnetic
stirrer. In a separate flask, dTNP (1.52 mmol, 472 mg) was
dissolved in acetonitrile (9.6 mL) and dichloromethane (4.1 mL)
under argon. This reaction mixture was then added to the succinate.
In another separate flask, TPP (1.52 mmol, 399 mg) was dissolved in
acetonitrile (37 mL) under argon. This mixture was then added to
the succinate/DMAP/dTNP reaction mixture. Finally, 12.23 g pre-acid
washed LCA CPG (loading=115.2 .mu.mol/g) was added to the main
reaction mixture, vortexed shortly and placed on shaker for
approximately 3 hours. The mixture was removed from the shaker
after 3 hours and the loading was checked. A small sample of CPG
was washed with copious amounts of acetonitrile, dichloromethane,
and then with ether. The initial loading was found to be 63
.mu.mol/g (3.9 mg of CPG was cleaved with trichloroacetic acid, the
absorption of released trityl cation was read at 503 nm on a
spectrophotometer to determine the loading.) The whole CPG sample
was then washed as described above and dried under P.sub.2O.sub.5
overnight in vacuum oven. The following day, the CPG was capped
with 25 mL CAP A (tetrahydrofuran/acetic anhydride) and 25 mL CAP B
(tetrahydrofuran/pyridine/1-methyl imidazole) for approximately 3
hours on shaker. Filtered and washed with dichloromethane and
ether. The CPG was dried under P.sub.2O.sub.5 overnight in vacuum
oven. After drying, 12.25 g of CPG was isolated with a final
loading of 90 .mu.mol/g.
Example 11
3'-O-Methoxyethyl-5-methyl-N-benzoyl-cytidine-2'-O-succinate
[0177] 5'-O-DMT-3'-O-(2-methoxy) ethyl-N-benzoyl-cytidine was first
succinylated on the 2'-position. Cytidine nucleoside (4 mmol) was
reacted with 10.2 mL dichloroethane, 615 mg (6.14 mmol) succinic
anhydride, 570 .mu.L (4.09 mmol) triethylamine, and 251 mg (2.05
mmol) 4-dimethylaminopyridine. The reactants were vortexed until
dissolved and placed in a heating block at 55.degree. C. for
approximately 30 minutes. Completeness of reaction was checked by
thin layer chromatography (TLC). The reaction mixture was washed
three times with cold 10% citric acid followed by three washes with
water. The organic phase was removed and dried under sodium
sulfate. The succinylated nucleoside was dried under P.sub.2O.sub.5
overnight in vacuum oven.
Example 12
5'-O-DMT-3'-O-methoxyethyl-5-methyl-N-benzoyl-cytidine-2'-O-succinoyl
linked LCA CPG
[0178] 5'-O-DMT-3'-O-(2-methoxyethyl)-2'-O-succinyl-N.sup.4-benzoyl
cytidine was coupled to controlled pore glass (CPG). 1.05 g (1.30
mmol) of the succinate were dried overnight in a vacuum oven along
with 4-dimethylaminopyridine (DMAP), 2,2'-dithiobis
(5-nitro-pyridine) (dTNP), triphenylphosphine (TPP), and pre-acid
washed CPG (controlled pore glass). The following day, DMAP (1.30
mmol, 159 mg) and acetonitrile (11.7 mL) were added to the
succinate. The mixture was "mixed" by a magnetic stirrer under
argon. In a separate flask, dTNP (1.30 mmol, 400 mg) was dissolved
in acetonitrile (8.2 mL) and dichloromethane (3.5 mL) under argon.
This reaction mixture was then added to the succinate. In another
separate flask, TPP (1.30 mmol, 338 mg) was dissolved in
acetonitrile (11.7 mL) under argon. This mixture was then added to
the succinate/DMAP/dTNP reaction mixture. Finally, 10.46 g pre-acid
washed LCA CPG (loading=115.2 .mu.mol/g) were added to the main
reaction mixture, vortexed shortly and placed on shaker for
approximately 2 hours. A portion was removed from shaker after 2
hours and the loading was checked. A small sample of CPG was washed
with copious amounts of acetonitrile, dichloromethane, and then
with ether. The initial loading was found to be 46 .mu.mol/g. (3.4
mg of CPG were cleaved with trichloroacetic acid). The absorption
of released trityl cation was read at 503 nm on a spectrophotometer
to determine the loading. The whole CPG sample was then washed as
described above and dried under P.sub.2O.sub.5 overnight in vacuum
oven. The following day, the CPG was capped with 25 mL CAP A
(tetrahydrofuran/acetic anhydride) and 25 mL CAP B
(tetrahydrofuran/pyridine/1-methyl imidazole) for approximately 3
hours on a shaker. The material was filtered and washed with
dichloromethane and ether. The CPG was dried under P.sub.2O.sub.5
overnight in vacuum oven. After drying, 10.77 g of CPG was isolated
with a final loading of 63 .mu.mol/g.
Example 13
5'-O-DMT-3'-O-methoxyethyl-N6-benzoyl-adenosine-2'-O-succinate
[0179] 5'-O-DMT-3'-O-(2-methoxyethyl)-N.sup.6-benzoyl adenosine was
first succinylated on the 2'-position. 3.0 g (4.09 mmol) of the
adenosine nucleoside were reacted with 10.2 mL dichloroethane, 615
mg (6.14 mmol) succinic anhydride, 570 .mu.L (4.09 mmol)
triethylamine, and 251 mg (2.05 mmol) 4-dimethylaminopyridine. The
reactants were vortexed until dissolved and placed in heating block
at 55.degree. C. for approximately 30 minutes. Completeness of
reaction was checked by thin layer chromatography (TLC). The
reaction mixture was washed three times with cold 10% citric acid
followed by three washes with water. The organic phase was removed
and dried under sodium sulfate. Succinylated nucleoside was dried
under P.sub.2O.sub.5 overnight in vacuum oven.
Example 14
5'-O-DMT-3'-O-(2-methoxyethyl)-N6-benzoyl-adenosine-2'-O-succinoyl
Linked LCA CPG
[0180] Following succinylation,
5'-O-DMT-3'-O-(2-methoxyethyl)-2'-O-succinyl-N.sup.6-benzoyl
adenosine was coupled to controlled pore glass (CPG). 3.41 g (4.10
mmol) of the succinate were dried overnight in a vacuum oven along
with 4-dimethylaminopyridine (DMAP), 2,2'-dithiobis
(5-nitro-pyridine) (dTNP), triphenylphosphine (TPP), and pre-acid
washed CPG (controlled pore glass). The following day, DMAP (4.10
mmol, 501 mg) and acetonitrile (37 mL) were added to the succinate.
The mixture was "mixed" by a magnetic stirrer under argon. In a
separate flask, dTNP (4.10 mmol, 1.27g) was dissolved in
acetonitrile (26 mL) and dichloromethane (11 mL) under argon. This
reaction mixture was then added to the succinate. In another
separate flask, TPP (4.10 mmol, 1.08 g) was dissolved in
acetonitrile (37 mL) under argon. This mixture was then added to
the succinate/DMAP/dTNP reaction mixture. Finally, 33 g pre-acid
washed LCA CPG (loading=115.2 .mu.mol/g) were added to the main
reaction mixture, vortexed shortly and placed on shaker for
approximately 20 hours. Removed from shaker after 20 hours and the
loading was checked. A small sample of CPG was washed with copious
amounts of acetonitrile, dichloromethane, and then with ether. The
initial loading was found to be 49 .mu.mol/g. (2.9 mg of CPG were
cleaved with trichloroacetic acid). The absorption of released
trityl cation was read at 503 nm on a spectrophotometer to
determine the loading. The whole CPG sample was then washed as
described above and dried under P.sub.2O.sub.5 overnight in vacuum
oven. The following day, the CPG was capped with 50 mL CAP A
(tetrahydro-furan/acetic anhydride) and 50 mL CAP B
(tetrahydrofuran/pyridine/1-methyl imidazole) for approximately 1
hour on the shaker. The material was filtered and washed with
dichloromethane and ether. The CPG was dried under P.sub.2O.sub.5
overnight in vacuum oven. After drying, 33.00 g of CPG was obtained
with a final loading of 66 .mu.mol/g.
Example 15
5'-O-DMT-3'-O-(2-methoxyethyl)-N2-isobutyryl-guanosine-2'-O-succinate
[0181] 5'-O-DMT-3'-O-(2-methoxyethy)1-N.sup.2-isobutyryl guanosine
was succinylated on the 2'-sugar position. 3.0 g (4.20 mmol) of the
guanosine nucleoside were reacted with 10.5 mL dichloroethane, 631
mg (6.30 mmol) succinic anhydride, 585 .mu.L (4.20 mmol)
triethylamine, and 257 mg (2.10 mmol) 4-dimethylaminopyridine. The
reactants were vortexed until dissolved and placed in heating block
at 55.degree. C. for approximately 30 minutes. Completeness of
reaction checked by thin layer chromatography (TLC). The reaction
mixture was washed three times with cold 10% citric acid followed
by three washes with water. The organic phase was removed and dried
under sodium sulfate. The succinylated nucleoside was dried under
P.sub.2O.sub.5 overnight in vacuum oven.
Example 16
5'-O-DMT-3'-O-methoxyethyl-N2-isobutyryl-guanosine-2'-O-succinoyl
Linked LCA CPG
[0182] Following succinylation,
5'-O-DMT-3'-O-(2-methoxyethyl)-2'-O-succinyl-N.sup.2-benzoyl
guanosine was coupled to controlled pore glass (CPG). 3.42 g (4.20
mmol) of the succinate were dried overnight in a vacuum oven along
with 4-dimethylaminopyridine (DMAP), 2,2'-dithiobis
(5-nitro-pyridine) (dTNP), triphenylphosphine (TPP), and pre-acid
washed CPG (controlled pore glass). The following day, DMAP (4.20
mmol, 513 mg) and acetonitrile (37.5 mL) were added to the
succinate. The mixture was "mixed" by a magnetic stirrer under
argon. In a separate flask, dTNP (4.20 mmol, 1.43 g) was dissolved
in acetonitrile (26 mL) and dichloromethane (11 mL) under argon.
This reaction mixture was then added to the succinate. In another
separate flask, TPP (4.20 mmol, 1.10 g) was dissolved in
acetonitrile (37.5 mL) under argon. This mixture was then added to
the succinate/DMAP/dTNP reaction mixture. Finally, 33.75 g pre-acid
washed LCA CPG (loading=115.2 .mu.mol/g) were added to the main
reaction mixture, vortexed shortly and placed on shaker for
approximately 20 hours. Removed from shaker after 20 hours and the
loading was checked. A small sample of CPG was washed with copious
amounts of acetonitrile, dichloromethane, and then with ether. The
initial loading was found to be 64 .mu.mol/g. (3.4 mg of CPG were
cleaved with trichloroacetic acid). The absorption of released
trityl cation was read at 503 nm on a spectrophotometer to
determine the loading. The CPG was then washed as described above
and dried under P.sub.2O.sub.5 overnight in vacuum oven. The
following day, the CPG was capped with 50 mL CAP A
(tetrahydrofuran/acetic anhydride) and 50 mL CAP B
(tetrahydrofuran/pyridine/1-methyl imidazole) for approximately 1
hour on a shaker. The material was filtered and washed with
dichloromethane and ether. The CPG was dried under P.sub.2O.sub.5
overnight in vacuum oven. After drying, 33.75 g. of CPG was
isolated with a final loading of 72 .mu.mol/g.
Example 17
5'-O-DMT-3'-O-[hexyl-(6-phthalimido)]-uridine
[0183] 2',3'-O-Dibutyl stannylene-uridine was synthesized according
to the procedure of Wagner et. al., J. Org. Chem., 1974, 39, 24.
This compound was dried over P.sub.2O.sub.5 under vacuum for 12
hours. To a solution of this compound (29 g, 42.1 mmol) in 200 mL
of anhydrous DMF were added (16.8 g, 55 mmol) of 6-bromohexyl
phthalimide and 4.5 g of sodium iodide and the mixture was heated
at 130.degree. C. for 16 hours under argon. The reaction mixture
was evaporated, co-evaporated once with toluene and the gummy tar
residue was applied on a silica column (500 g). The column was
washed with 2 L of EtOAc followed by eluting with 10% methanol
(MeOH):90% EtOAc. The product, 2'- and 3'-isomers of
O-hexyl-6-N-phthalimido uridine, eluted as an inseparable mixture
(Rf0.64 in 10% MeOH in EtOAc). By .sup.13C NMR, the isomeric ration
was about 55% of the 2' isomer and about 45% of the 3' isomer. The
combined yield was 9.2 g (46.2%). This mixture was dried under
vacuum and re-evaporated twice with pyridine. It was dissolved in
150 mL anhydrous pyridine and treated with 7.5 g of DMT-Cl (22.13
mmol) and 500 mg of dimethylaminopyridine (DMAP). After 2 hours,
thin layer chromatography (TLC; 6:4 EtOAc:Hexane) indicated
complete disappearance of the starting material and a good
separation between 2' and 3' isomers (Rf0.29 for the 2' isomer and
0.12 for the 3' isomer). The reaction mixture was quenched by the
addition of 5 mL of CH.sub.3OH and evaporated under reduced
pressure. The residue was dissolved in 300 mL CH.sub.2Cl.sub.2,
washed successively with saturated NaHCO.sub.3 followed by
saturated NaC.sub.1 solution. It was dried over Mg.sub.2SO.sub.4
and evaporated to give 15 g of a brown foam which was purified on a
silica gel (500 g) to give 6.5 g of the 2'-isomer and 3.5 g of the
3' isomer.
Example 18
5'-O-DMT-3'-O-[hexyl-(6-phthalimido)]-uridine-2'-O-(2-cyanoethyl-N,N,-diis-
opropyl) phosphoramidite
[0184] 5'-DMT-3'-O-[hexyl-(6-phthalimido)]uridine (2 g, 2.6 mmol)
was dissolved in 20 mL anhydrous CH.sub.2Cl.sub.2. To this solution
diisopropylaminotetrazolide (0.2 g, 1.16 mmol) and 2.0 mL
2-cyanoethyl-N,N,N',N'-tetraisopropyl phosphoramidite (6.3 mmol)
were added with stirred overnight. TLC (1:1 EtOAc/hexane) showed
complete disappearance of starting material. The reaction mixture
was transferred with CH.sub.2Cl.sub.2 and washed with saturated
NaHCO.sub.3 (100 mL), followed by saturated NaCl solution. The
organic layer was dried over anhydrous Na.sub.2SO.sub.4 and
evaporated to yield 3.8 g of a crude product, which was purified in
a silica column (200 g) using 1:1 hexane/EtOAc to give 1.9 g (1.95
mmol, 74% yield) of the desired phosphoramidite.
Example 19
Preparation of
5'-O-DMT-3'-O-[hexyl-(6-phthalimido)]-uridine-2'-O-succinoyl-aminopropyl
CPG
[0185] Succinylated and capped aminopropyl controlled pore glass
(CPG; 500 .ANG. pore diameter, aminopropyl CPG, 1.0 grams prepared
according to Damha et. al., Nucl. Acids Res. 1990, 18, 3813.) was
added to 12 mL anhydrous pyridine in a 100 mL round-bottom flask.
1-(3-Dimethylaminopropyl)-3-ethyl-carbodiimide (DEC; 0.38 grams,
2.0 mmol)], triethylamine (TEA; 100 .mu.l, distilled over
CaH.sub.2), dimethylaminopyridine (DMAP; 0.012 grams, 0.1 mmol) and
nucleoside 5'-O-DMT-3'-O-[hexyl-(6-phthalimido)]uridine (0.6 grams,
0.77 mmol) were added under argon and the mixture shaken
mechanically for 2 hours. Additional nucleoside (0.20 grams) was
added and the mixture shaken for 24 hours. The CPG was filtered off
and washed successively with dichloromethane, triethylamine, and
dichloromethane. The CPG was then dried under vacuum, suspended in
10 mL piperidine and shaken 15 minutes. The CPG was filtered off,
washed thoroughly with dichloromethane and again dried under
vacuum. The extent of loading (determined by spectrophotometric
assay of DMT cation in 0.3 M p-toluenesulfonic acid at 498 nm) was
approximately 28 .mu.mol/g. The
5'-O-(DMT)-3'-O-[hexyl-(6-phthalimido]uridine-2'-O-succinyl-aminopropyl
controlled pore glass was used to synthesize the oligomers in an
ABI 380B DNA synthesizer using phosphoramidite chemistry standard
conditions. A four base oligomer 5'-GACU*-3' was used to confirm
the structure of 3'-O-hexylamine tether introduced into the
oligonucleotide by NMR. As expected a multiplet signal was observed
between 1.0-1.8 ppm in .sup.1H NMR.
Example 20
5'-O-DMT-3'-O-[hexylamino]-uridine
[0186] 5'-O-(DMT)-3'-O-[hexyl-(6-phthalimido)]uridine (4.5 grams,
5.8 mmol) is dissolved in 200 mL methanol in a 500 mL flask.
Hydrazine (1 ml, 31 mmol) is added to the stirring reaction
mixture. The mixture is heated to 60-65.degree. C. in an oil bath
and refluxed 14 hours. The solvent is evaporated in vacuo and the
residue is dissolved in dichloromethane (250 mL) and extracted
twice with an equal volume NH.sub.4OH. The organic layer is
evaporated to yield the crude product which NMR indicates is not
completely pure. R.sub.f0 in 100% ethyl acetate. The product is
used in subsequent reactions without further purification.
Example 21
3'-O-[Propyl-(3-phthalimido)]-adenosine
[0187] To a solution of adenosine (20.0 g, 75 mmol) in dry
dimethylformamide (550 ml) at 5.degree. C. was added sodium hydride
(60% oil, 4.5 g, 112 mmol). After one hour,
N-(3-bromopropyl)phthalimide (23.6 g, 86 mmol) was added and the
temperature was raised to 30.degree. C. and held for 16 hours. Ice
is added and the solution evaporated in vacuo to a gum. The gum was
partitioned between water and ethyl acetate (4.times.300 mL). The
organic phase was separated, dried, and evaporated in vacuo and the
resultant gum chromatographed on silica gel (95/5
CH.sub.2Cl.sub.2/MeOH) to give a white solid (5.7 g) of the
2'-O-(propylphthalimide)adenosine. Thee fractions containing the
3'-O-(propylphthalimide)adenosine were chromatographed a second
time on silica gel using the same solvent system.
[0188] Crystallization of the 2'-O-(propylphthalimide)adenosine
fractions from methanol gave a crystalline solid, m.p. 123-124C.
.sup.1H NMR (400 MHZ: DMSO-d.sub.6). 1.70(m, 2H, CH.sub.2), 3.4-3.7
(m, 6H, C.sub.5, CH.sub.2, OCH.sub.2, Phth CH.sub.2), 3.95 (q, 1H,
C.sub.4'H), 4.30 (q, 1H, C.sub.5'H), 4.46 (t, 1H, C.sub.2'H), 5.15
(d, 1H, C.sub.3'OH), 5.41 (t, 1H, C.sub.5'OH), 5.95 (d, 1H,
C.sub.1'H) 7.35 (s, 2H, NH.sub.2), 7.8 (brs, 4H, Ar), 8.08 (s, 1H,
C.sub.2H) and 8.37 (s, 1H, C.sub.8H). Anal. Calcd.
C.sub.21H.sub.22N.sub.6O.sub.6: C, 5503; H, 4.88; N, 18.49. Found:
C, 55.38; H, 4.85; N, 18.46.
[0189] Crystallization of the 3'-O-(propylphthalimide)adenosine
fractions from H.sub.2O afforded an analytical sample, m.p.
178-179C. .sup.1H NMR (400 MHZ: DMSO-d.sub.6). 5.86 (d, 1H,
H-1').
Example 22
3'-O-[Propyl-(3-phthalimido)]-N6-benzoyl-adenosine
[0190] 3'-O-(3-propylphthalimide)adenosine is treated with benzoyl
chloride in a manner similar to the procedure of Gaffney, et al.,
Tetrahedron Lett. 1982, 23, 2257. Purification of crude material by
chromatography on silica gel (ethyl acetate-methanol) gives the
title compound.
Example 23
3'-O-[Propyl-(3-phthalimido)]-5'-O-DMT-N6-benzoyl-adenosine
[0191] To a solution of
3'-O-(propyl-3-phthalimide)-N.sup.6-benzoyladenosine (4.0 g) in
pyridine (250 ml) is added DMT-Cl (3.3 g). The reaction is stirred
for 16 hours. The reaction is added to ice/water/ethyl acetate, the
organic layer separated, dried, and concentrated in vacuo and the
resultant gum chromatographed on silica gel (ethyl acetate-methanol
triethylamine) to give the title compound.
Example 24
3'-O-[Propyl-(3-phthalimido)]-5'-O-DMT-N6-Benzoyl-adenosine-2'-O-(2-cyanoe-
thyl-N,N-diisopropyl) phosphoramidite
[0192]
3'-O-(Propyl-3-phthalimide)-5'-O-DMT-N.sup.6-benzoyladenosine is
treated with (-cyanoethoxy)chloro-N,N-diisopropyl)aminophosphane in
a manner similar to the procedure of Seela, et al., Biochemistry
1987, 26, 2233. Chromatography on silica gel (EtOAc/hexane) gives
the title compound as a white foam.
Example 25
3'-O-(Aminopropyl)-adenosine
[0193] A solution of 3'-O-(propyl-3-phthalimide)adenosine (8.8 g,
19 mmol), 95% ethanol (400 mL) and hydrazine (10 mL, 32 mmol) is
stirred for 16 hrs at room temperature. The reaction mixture is
filtered and filtrate concentrated in vacuo. Water (150 mL) is
added and acidified with acetic acid to pH 5.0. The aqueous
solution is extracted with EtOAc (2.times.30 mL) and the aqueous
phase is concentrated in vacuo to afford the title compound as a
HOAc salt.
Example 26
3'-O-[3-(N-trifluoroacetamido)propyl]-adenosine
[0194] A solution of 3'-O-(propylamino)adenosine in methanol (50
mL) and triethylamine (15 mL, 108 mmol) is treated with ethyl
trifluoroacetate (18 mL, 151 mmol). The reaction is stirred for 16
hrs and then concentrated in vacuo and the resultant gum
chromatographed on silica gel (9/1, EtOAc/MeOH) to give the title
compound.
Example 27
N6-Dibenzoyl-3'-O-[3-(N-trifluoroacetamido)propyl]-adenosine
[0195] 3'-O-[3-(N-trifluoroacetamido)propyl]adenosine is treated as
per Example 22 using a Jones modification wherein
tetrabutylammonium fluoride is utilized in place of ammonia
hydroxide in the work up. The crude product is purified using
silica gel chromatography (EtOAc/MeOH 1/1) to give the title
compound.
Example 28
N6-Dibenzoyl-5'-O-DMT-3'-O-[3-(N-trifluoroacetamido)propyl]-adenosine
[0196] DMT-Cl (3.6 g, 10.0 mmol) is added to a solution of
N.sup.6-(dibenzoyl)-3'-O-[3-(N-trifluoroacetamido)propyl)adenosine
in pyridine (100 mL) at room temperature and stirred for 16 hrs.
The solution is concentrated in vacuo and chromatographed on silica
gel (EtOAc/TEA 99/1) to give the title compound.
Example 29
N6-Dibenzoyl-5'-O-DMT-3'-O-[3-(N-trifluoroacetamido)propyl]-adenosine-2'-O-
-(2-cyanoethyl-N,N-diisopropyl) phosphoramidite
[0197] A solution of
N.sup.6-(dibenzoyl)-5'-O-(DMT)-3'-O-[3-(N-trifluoroacetamido)-propyl]aden-
osine in dry CH.sub.2Cl.sub.2 is treated with
bis-N,N-diisopropylamino cyanoethyl phosphite (1.1 eqiv) and
N,N-diisopropylaminotetrazolide (catalytic amount) at room
temperature for 16 hrs. The reaction is concentrated in vacuo and
chromatographed on silica gel (EtOAc/hexane/TEA 6/4/1) to give the
title compound.
Example 30
3'-O-(butylphthalimido)-adenosine
[0198] The title compound is prepared as per Example 21, using
N-(4-bromobutyl)phthalimide in place of the 1-bromopropane.
Chromatography on silica gel (EtOAC-MeOH) gives the title compound.
.sup.1H NMR (200 MHZ, DMSO-d.sub.6). 5.88 (d, 1H, C.sub.1'H).
Example 31
N6-Benzoyl-3'-O-(butylphthalimido)-adenosine
[0199] Benzoylation of 3'-O-(butylphthalimide)adenosine as per
Example 22 gives the title compound.
Example 32
N6-Benzoyl-5'-O-DMT-3'-O-(butylphthalimido)-adenosine
[0200] The title compound is prepared from
3'-O-(butyl-phthalimide)-N.sup.6-benzoyladenosine as per Example
22.
Example 33
N6-Benzoyl-5'-O-DMT-3'-O-(butylphthalimido)-Adenosine-2'-O-(2-cyanoethyl-N-
,N-diisopropyl) phosphoramidite
[0201] The title compound is prepared from
3'-O-(butylphthalimide)-5'-O-DMT-N.sup.6-benzoyladenosine as per
Example 24.
Example 34
3'-O-(Pentylphthalimido)-adenosine
[0202] The title compound is prepared as per Example 21, using
N-(5-bromopentyl)phthalimide. The crude material from the
extraction is chromatographed on silica gel using CHCl.sub.3/MeOH
(95/5) to give a mixture of the 2' and 3' isomers. The 2' isomer is
recrystallized from EtOH/MeOH 8/2. The mother liquor is
rechromatographed on silica gel to afford the 3' isomer.
[0203] 2'-O-(Pentylphthalimido)adenosine: M.P. 159-160.degree. C.
Anal. Calcd. for C.sub.23H.sub.24N.sub.6O.sub.5: C, 57.26; H, 5.43;
N, 17.42. Found: C, 57.03; H, 5.46; N, 17.33.
3'-O-(Pentylphthalimido)adenosine: .sup.1H NMR (DMSO-d.sub.6). 5.87
(d, 1H, H-1').
Example 35
N6-Benzoyl-3'-O-(pentylphthalimido)-adenosine
[0204] Benzoylation of 3'-O-(pentylphthalimido)adenosine is
achieved as per the procedure of Example 22 to give the title
compound.
Example 36
N6-Benzoyl-5'-O-DMT-3'-O-(pentylphthalimido)-adenosine
[0205] The title compound is prepared from
3'-O-(pentyl-phthalimide)-N.sup.6-benzoyladenosine as per the
procedure of Example 23. Chromatography on silica gel
(ethylacetate, hexane, triethylamine), gives the title
compound.
Example 37
N6-Benzoyl-5'-O-DMT-3'-O-(pentylphthalimido)-adenosine-2'-O-(2-cyanoethyl--
N,N-diisopropyl) phosphoramidite
[0206] The title compound is prepared from
3'-O-(pentyl-phthalimide)-5'-O-(DMT)-N.sup.6-benzoyladenosine as
per the procedure of Example 24 to give the title compound.
Example 38
3'-O-(Propylphthalimido)uridine
[0207] A solution of uridine-tin complex (48.2 g, 115 mmol) in dry
DMF (150 ml) and N-(3-bromopropyl)phthalimide (46 g, 172 mmol) was
heated at 130.degree. C. for 6 hrs. The crude product was
chromatographed directly on silica gel CHCl.sub.3/MeOH 95/5. The
isomer ratio of the purified mixture was 2'/3' 81/19. The 2' isomer
was recovered by crystallization from MeOH. The filtrate was
rechromatographed on silica gel using CHCl.sub.3CHCl.sub.3/MeOH
(95/5) gave the 3' isomer as a foam.
[0208] 2'-O-(Propylphthalimide)uridine: Analytical sample
recrystallized from MeOH, m.p. 165.5-166.5C, .sup.1NMR (200 MHZ,
DMSO-d.sub.6). 1.87 (m, 2H, CH.sub.2), 3.49-3.65 (m, 4H,
C.sub.2'H), 3.80-3.90 (m, 2H, C.sub.3'H.sub.1C.sub.4'H), 4.09(m,
1H, C.sub.2'H), 5.07 (d, 1 h, C.sub.3'OH), 5.16 (m, 1H,
C.sub.5'OH), 5.64 (d, 1H, CH=), 7.84 (d, 1H, C.sub.1'H), 7.92 (bs,
4H, Ar), 7.95 (d, 1H, CH.dbd.) and 11.33 (s, 1H, ArNH). Anal.
C.sub.20H.sub.21N.sub.3H.sub.8, Calcd. C, 55.69; H, 4.91;, N, 9.74.
Found, C, 55.75; H, 5.12; N, 10.01.
3'-O-(Propylphthalimide)uridine: .sup.1H NMR (DMSO-d.sub.6). 5.74
(d, 1H, H-1').
Example 39
3'-O-(Aminopropyl)-uridine
[0209] The title compound is prepared as per the procedure of
Example 25.
Example 40
3'-O-[3-(N-trifluoroacetamido)propyl]-uridine
[0210] 3'-O-(Propylamino)uridine is treated as per the procedure of
Example 26 to give the title compound.
Example 41
5'-O-DMT-3'-O-[3-(N-trifluoroacetaznido)propyl]-uridine
[0211] 3'-O-[3-(N-trifluoroacetamido)propyl]uridine is treated as
per the procedure of Example 28 to give the title compound.
Example 42
5'-O-DMT-3'-O-[3-(N-trifluoroacetamido)propyl]-uridine-2'-O-(2-cyanoethyl--
N,N-diisopropyl) phosphoramidite
[0212] 5'-O-(DMT)-3'-O-[3-(N-trifluoroacetamido)propyl]uridine is
treated as per the procedure of Example 29 to give the title
compound.
Example 43
3'-O-(Propylphthalimido)-cytidine
[0213] The title compounds were prepared as per the procedure of
Example 21.
[0214] 2'-O-(propylphthalimide)cytidine: .sup.1H NMR (200 MHZ,
DMSO-d.sub.6). 5.82 (d, 1H, C.sub.1'H).
[0215] 3'-O-(propylphthalimide)cytidine: .sup.1H NMR (200 MHZ,
DMSO-d.sub.6). 5.72 (d, 1H, C.sub.1'H).
Example 44
3'-O-(Anminopropyl)-cytidine
[0216] 3'-O-(Propylphthalimide)cytidine is treated as per the
procedure of Example 25 to give the title compound.
Example 45
3'-O-[3-(N-trifluoroacetamido)propyl]-cytidine
[0217] 3'-O-(Propylamino)cytidine is treated as per the procedure
of Example 26 to give the title compound.
Example 46
N4-Benzoyl-3'-O-[3-(N-trifluoroacetamido)propyl]-cytidine
[0218] 3'-O-[3-(N-trifluoroacetamido)propyl]cytidine is treated as
per the procedure of Example 27 to give the title compound.
Example 47
N4-Benzoyl-5'-O-DMT-3'-O-[3-(N-trifluoroacetamido)propyl]-cytidine
[0219]
N.sup.4-(Benzoyl)-3'-O-[3-(N-trifluoroacetamido)propyl]cytidine is
treated as per the procedure of Example 28 to give the title
compound.
Example 48
N4-Benzoyl-5'-O-DMT-3'-O-[3-(N-trifluoroacetamido)propyl]-cytidine-2'-O-(2-
-cyanoethyl-N,N-diisopropyl) phosphoramidite
[0220]
N.sup.4-(Benzoyl)-5'-O-(DMT)-3'-O-[3-(N-trifluoroacetamido)propyl]-
cytidine is treated as per the procedure of Example 29 to give the
title compound.
Example 49
General Procedures for Oligonucleotide Synthesis
[0221] Oligonucleotides were synthesized on a Perseptive Biosystems
Expedite 8901 Nucleic Acid Synthesis System. Multiple 1-.mu.mol
syntheses were performed for each oligonucleotide. Trityl groups
were removed with trichloroacetic acid (975 lL over one minute)
followed by an acetonitrile wash. All standard amidites (0.1 M)
were coupled twice per cycle (total coupling time was approximately
4 minutes). All novel amidites were dissolved in dry acetonitrile
(100 mg of amidite/1 mL acetonitrile) to give approximately
0.08-0.1 M solutions. Total coupling time was approximately 6
minutes (105 .mu.L of amidite delivered). 1-H-tetrazole in
acetonitrile was used as the activating agent. Excess amidite was
washed away with acetonitrile. (1S)-(+)-(10-camphorsulfonyl)
oxaziridine (CSO, 1.0 g CSO/8.72 mL dry acetonitrile) was used to
oxidize (4 minute wait step) phosphodiester linkages while
3H-1,2-benzodithiole-3-one-1,1-dioxide (Beaucage reagent, 3.4 g
Beaucage reagent/200 mL acetonitrile) was used to oxidize (one
minute wait step) phosphorothioate linkages. Unreacted
functionalities were capped with a 50:50 mixture of
tetrahyrdofuran/acetic anhydride and
tetrahydrofuran/pyridine/1-methyl imidazole. Trityl yields were
followed by the trityl monitor during the duration of the
synthesis. The final DMT group was left intact. The
oligonucleotides were deprotected in 1 mL 28.0-30% ammonium
hydroxide (NH.sub.4OH) for approximately 16 hours at 55.degree. C.
Oligonucleotides were also made on a larger scale (20
.mu.mol/synthesis). Trityl groups were removed with just over 8 mL
of trichloroacetic acid. All standard amidites (0.1 M) were coupled
twice per cycle (13 minute coupling step). All novel amidites were
also coupled four times per cycle but the coupling time was
increased to approximately 20 minutes (delivering 480 .mu.L of
amidite). Oxidation times remained the same but the delivery of
oxidizing agent increased to approximately 1.88 mL per cycle.
Oligonucleotides were cleaved and deprotected in 5 mL 28.0-30%
NH.sub.4OH at 55.degree. C., for approximately 16 hours.
TABLE-US-00004 TABLE I 3'-O-(2-methoxyethyl) containing 2'-5'
linked oligonucleotides. Back- ISIS # Sequence (5'-3').sup.1 bone
Chemistry 17176 ATG-CAT-TCT-GCC-CCC-AAG-GA* P.dbd.S 3'-O-MOE 17177
ATG-CAT-TCT-GCC-CCC-AAG-G* P.dbd.S 3'-O-MOE A* 17178
ATG-CAT-TCT-GCC-CCC-AAG.sub.o- P.dbd.S/ 3'-O-MOE G*.sub.oA* P.dbd.O
17179 A*TG-CAT-TCT-GCC-CCC-AAG- P.dbd.S 3'-O-MOE GA* 17180
A*TG-CAT-TCT-GCC-CCC-AAG-G* P.dbd.S 3'-O-MOE A* 17181
A*.sub.oTG-CAT-TCT-GCC-AAA-AAG.sub.o- P.dbd.S/ 3'-O-MOE G*.sub.oA*
P.dbd.O 21415 A*T*G-CAT-TCT-GCC-AAA-AAG- P.dbd.S 3'-O-MOE G*A*
21416 A*.sub.oT*.sub.oG-CAT-TCT-GCC-AAA- P.dbd.S/ 3'-O-MOE
AAG.sub.o-G*.sub.oA* P.dbd.O 21945 A*A*A* P.dbd.O 3'-O-MOE 21663
A*A*A*A* P.dbd.O 3'-O-MOE 20389 A*U*C*G* P.dbd.O 3'-O-MOE 20390
C*G*C*-G*A*A*-T*T*C*-G*C*G* P.dbd.O 3'-O-MOE .sup.1All nucleosides
with an asterisk contain 3'-O-(2-methoxyethyl).
Example 50
General Procedure for Purification of Oligonucleotides
[0222] Following cleavage and deprotection step, the crude
oligonucleotides (such as those synthesized in Example 49) were
filtered from CPG using Gelman 0.45 .mu.m nylon acrodisc syringe
filters. Excess NH.sub.4OH was evaporated away in a Savant AS 160
automatic speed vac. The crude yield was measured on a Hewlett
Packard 8452A Diode Array Spectrophotometer at 260 nm. Crude
samples were then analyzed by mass spectrometry (MS) on a Hewlett
Packard electrospray mass spectrometer and by capillary gel
electrophoresis (CGE) on a Beckmann P/ACE system 5000. Trityl-on
oligonucleotides were purified by reverse phase preparative high
performance liquid chromatography (HPLC). HPLC conditions were as
follows: Waters 600E with 991 detector; Waters Delta Pak C4 column
(7.8.times.300 mm); Solvent A: 50 mM triethylammonium acetate
(TEA-Ac), pH 7.0; B: 100% acetonitrile; 2.5 mL/min flow rate;
Gradient: 5% B for first five minutes with linear increase in B to
60% during the next 55 minutes. Larger oligo yields from the larger
20 .mu.mol syntheses were purified on larger HPLC columns (Waters
Bondapak HC18HA) and the flow rate was increased to 5.0 mL/min.
Appropriate fractions were collected and solvent was dried down in
speed vac. Oligonucleotides were detritylated in 80% acetic acid
for approximately 45 minutes and lyophilized again. Free trityl and
excess salt were removed by passing detritylated oligonucleotides
through Sephadex G-25 (size exclusion chromatography) and
collecting appropriate samples through a Pharmacia fraction
collector. Solvent again evaporated away in speed vac. Purified
oligonucleotides were then analyzed for purity by CGE, HPLC (flow
rate: 1.5 mL/min; Waters Delta Pak C4 column, 3.9.times.300 mm),
and MS. The final yield was determined by spectrophotometer at 260
nm. TABLE-US-00005 TABLE II Physical characteristics of
3'-O-(2-methoxyethyl) containing 2'-5' linked oligonucleotides.
Expected Observed HPLC.sup.2 T.sub.R #Ods(260 nm) Mass Mass (min.)
Purified 17176 6440.743 6440.300 23.47 3006 17177 6514.814 6513.910
23.67 3330 17178 6482.814 6480.900 23.06 390 17179 6513.798
6513.560 23.20 3240 17180 6588.879 6588.000 23.96 3222 17181
6540.879 6539.930 23.01 21415 6662.976 6662.700 24.18 4008 21416
6598.969 6597.800 23.01 3060 21945 1099.924 1099.300 19.92 121
21663 1487.324 1486.800 20.16 71 20389 1483.000 1482.000 62 20390
4588.000 4591.000 151 .sup.2Conditions: Waters 600E with detector
991; Waters C4 column (3.9 .times. 300 mm); Solvent A: 50 mM
TEA-Ac, pH 7.0; B: 100% acetonitrile; 1.5 mL/min. flow rate;
Gradient: 5% B for first five minutes with linear increase in B to
60% during the next 55 minutes.
Example 51
T.sub.m Studies on Modified Oligonucleotides
[0223] Oligonucleotides synthesized in Examples 49 and 50 were
evaluated for their relative ability to bind to their complementary
nucleic acids by measurement of their melting temperature
(T.sub.m). The melting temperature (T.sub.m), a characteristic
physical property of double helices, denotes the temperature (in
degrees centigrade) at which 50% helical (hybridized) versus coil
(unhybridized) forms are present. Tm is measured by using the UV
spectrum to determine the formation and breakdown (melting) of the
hybridization complex. Base stacking, which occurs during
hybridization, is accompanied by a reduction in UV absorption
(hypochromicity). Consequently, a reduction in UV absorption
indicates a higher T.sub.m. The higher the T.sub.m, the greater the
strength of the bonds between the strands.
[0224] Selected test oligonucleotides and their complementary
nucleic acids were incubated at a standard concentration of 4 .mu.M
for each oligonucleotide in buffer (100 mM NaCl, 10 mM sodium
phosphate, pH 7.0, 0.1 mM EDTA). Samples were heated to 90.degree.
C. and the initial absorbance taken using a Guilford Response II
Spectrophotometer (Corning). Samples were then slowly cooled to
15.degree. C. and then the change in absorbance at 260 nm was
monitored with heating during the heat denaturation procedure. The
temperature was increased by 1 degree .degree. C./absorbance
reading and the denaturation profile analyzed by taking the
1.sup.st derivative of the melting curve. Data was also analyzed
using a two-state linear regression analysis to determine the Tm=s.
The results of these tests for the some of the oligonucleotides
from Examples 49 and 50 are shown in in Table III below.
TABLE-US-00006 TABLE III Tm Analysis of Oligonucleotides # #2'-5'
ISIS # Sequence (5'-3') Backbone T.sub.m Mods Linkages 11061
ATG-CAT-TCT-GCC-CCC-AAG-GA P.dbd.S 61.4 0 0 17176
ATG-CAT-TCT-GCC-CCC-AAG-GA* P.dbd.S 61.4 1 0 17177
ATG-CAT-TCT-GCC-CCC-AAG-G*A* P.dbd.S 61.3 2 1 17178
ATG-CAT-TCT-GCC-CCC-AAG.sub.o-G*.sub.oA* P.dbd.S/P.dbd.O 61.8 2 1
17179 A*TG-CAT-TCT-GCC-CCC-AAG-GA* P.dbd.S 61.1 2 1 17180
A*TG-CAT-TCT-GCC-CCC-AAG-G*A* P.dbd.S 61.0 3 2 17181
A*.sub.oTG-CAT-TCT-GCC-AAA-AAG.sub.o-G*.sub.oA* P.dbd.S/P.dbd.O
61.8 3 2 21415 A*T*G-CAT-TCT-GCC-AAA-AAG-G*A* P.dbd.S 61.4 4 3
21416 A*.sub.oT*.sub.oG-CAT-TCT-GCC-AAA-AAG.sub.o-G*.sub.oA*
P.dbd.S/P.dbd.O 61.7 4 3 .sup.1All nucleosides with an asterisk
contain 3'-O-(2-methoxyethyl).
Example 52
NMR Experiments on Modified Oligonucleotides Comparison of 3',5'
versus, 2',5' Internucleotide Linkages and 2'-Substituents Versus
3'-Substituents by NMR
[0225] The 400MHz .sup.1H spectrum of oligomer d(GAU.sub.2*CT),
where U.sub.2*=2'-O-aminohexyluridine showed 8 signals between 7.5
and 9.0 ppm corresponding to the 8 aromatic protons. In addition,
the anomeric proton of U* appears as a doublet at 5.9 ppm with
J.sub.1',.sub.2'=7.5Hz, indicative of C2'-endo sugar puckering. The
corresponding 2'-5' linked isomer shows a similar structure with
J.sub.1',.sub.2'=3.85 Hz at 5.75 ppm, indicating an RNA type sugar
puckering at the novel modification site favorable for
hybridization to an mRNA target. The proton spectrum of the
oligomer d(GACU.sub.3*), where U.sub.3*=3'-O-hexylamine, showed the
expected 7 aromatic proton signals between 7.5 and 9.0 ppm and the
anomeric proton doublet at 5.9 ppm with J.sub.1',.sub.2'=4.4 Hz.
This suggests more of a C3'-endo puckering for the 3'-O-alkylamino
compounds compared to their 2' analogs. .sup.31P NMR of these
oligonucleotides showed the expected 4 and 3 signals from the
internucleotide phosphate linkages for d(GAU*CT) and d(GACU*),
respectively. 3'-5' Linked vs. 2'-5' linked have different
retention times in RP HPLC and hence different lipophilicities,
implying potentially different extent of interactions with cell
membranes.
Example 53
T.sub.m Analysis of 2',5'-Linked Oligonucleotides Versus
3',5'-Linked Oligonucleotides
[0226] Thermal melts were done as per standarized literature
procedures. Oligonucleotide identity is as follows:
[0227] Oligonucleotide A is a normal 3'-5' linked phosphodiester
oligodeoxyribonucleotide of the sequence d(GGC TGU* CTG CG)where
the * indicates the attachment site of a 2'-aminolinker.
Oligonucleotide B is a normal 3'-5' linked phosphodiester
oligoribonucleotide of the sequence d(GGC TGU* CTG CG) where the *
indicates the attachment site of a 2'-aminolinker. Each of the
ribonucleotides of the oligonucleotide, except the one bearing the
* substituent, are 2'-O-methyl ribonucleotides. Oligonucleotide C
has 2'-5' linkage at the * position in addition to a 3'-aminolinker
at this site. The remainder of the oligonucleotide is a
phosphodiester oligodeoxyribonucleotide of the sequence d(GGC TGU*
CTG CG). The base oligonucleotide (no 2'-aminolinker) was not
included in the study. TABLE-US-00007 TABLE IIIa DNA RNA
OLIGONUCLEOTIDE MODIFICATION TARGET TARGET A none 52.2 54.1
2'-aminolinker 50.9 55.5 B none 51.5 72.3 2'-aminolinker 49.8 69.3
C none NA 51.7 3'-aminolinker 42.7 The 2'-5' linkages demonstrated
a higher melting temperature against an RNA target compared to a
DNA target.
Example 54
Snake Venom Phosphodiesterase and Liver Homogenate Experiments on
Oligonucleotide Stability
[0228] The following oligonucleotides were synthesized following
the procedure of Example 49. TABLE-US-00008 TABLE IV Modified
Oligonucleotides Synthesized to evaluate stability ISIS # Sequence
(5'-3').sup.1 Backbone Chemistry 22110
TTT-TTT-TTT-TTT-TTT-T*T*T*-T* P.dbd.O 3'-O-MOE 22111
TTT-TTT-TTT-TTT-TTT-T.sup.#T.sup.#T.sup.#-U.sup.# P.dbd.O 3'-O-MOE
22112 TTT-TTT-TTT-TTT-TTT-T*T*T*-T* P.dbd.S 3'-O-MOE 22113
TTT-TTT-TTT-TTT-TTT-T.sup.#T.sup.#T.sup.#-U.sup.# P.dbd.S 3'-O-MOE
22114 TTT-TTT-TTT-TTT-TTT.sub.O-T*.sub.OT*.sub.OT*.sub.OT*
P.dbd.S/P.dbd.O 3'-O-MOE 22115
TTT-TTT-TTT-TTT-TTT.sub.O-T.sup.#.sub.OT.sup.#.sub.OT.sup.#.sub.O-U.-
sup.# P.dbd.S/P.dbd.O 3'-O-MOE .sup.1All nucleosides with an
asterisk contain 3'-O-(2-methoxyethyl). All nucleosides with a #
contain 2'-O-(2-methoxyethyl).
[0229] The oligonucleotides were purified following the procedure
of Example 50 and analyzed for their structure. TABLE-US-00009
TABLE V Properties of Modified Oligonucleotides Expected Observed
HPLC.sup.2 #Ods (260 nm) ISIS # Sequence (5'-3').sup.1 Mass Mass
T.sub.R (min.) Purified 22110 TTT-TTT-TTT-TTT-TTT-T*T*T*-T*
6314.189 6315.880 20.39 174 22111
TTT-TTT-TTT-TTT-TTT-T.sup.#T.sup.#T.sup.#-U.sup.# 6004.777 5997.490
20.89 147 22112 TTT-TTT-TTT-TTT-TTT-T*T*T*-T* 6298.799 6301.730
25.92 224 22113 TTT-TTT-TTT-TTT-TTT-T.sup.#T.sup.#T.sup.#-U.sup.#
6288.745 6286.940 24.77 209 22114
TTT-TTT-TTT-TTT-TTT.sub.O-T*.sub.OT*.sub.OT*.sub.OT* 6234.799
6237.150 24.84 196 22115
TTT-TTT-TTT-TTT-TTT.sub.O-T.sup.#.sub.OT.sup.#.sub.OT.sup.#.sub.O-U.-
sup.# 6224.745 6223.780 23.30 340 .sup.1All nucleosides with an
asterisk contain 3'-O-(2-methoxyethyl). All nucleosides with a #
contain 2'-O-(2-methoxy)ethyl. .sup.2Conditions: Waters 600E with
detector 991; Waters C4 column (3.9 .times. 300 mm); Solvent A: 50
mM TEA-Ac, pH 7.0; B: 100% acetonitrile; 1.5 mL/min. flow rate;
Gradient: 5% B for first five minutes with linear increase in B to
60% during the next 55 minutes.
Example 55
3'-O-Aminopropyl Modified Oligonucleotides
[0230] Following the procedures illustrated above for the synthesis
of oligonucleotides, modified 3'-amidites were used in addition to
conventional amidites to prepare the oligonucleotides listed in
tables VI and VII. Nucleosides used include:
N6-benzoyl-3'-O-propylphthalimido-A-2'-amidite,
2'-O-propylphthaloyl-A-3'-amidite,
2'-O-methoxyethyl-thymidine-3'-amidite (RIC, Inc.),
2'-O-MOE-G-3'-amidite (RI Chemical),
2'-O-methoxyethyl-5-methylcytidine-3'-amidite,
2'-O-methoxyethyl-adenosine-3'-amidite (RI Chemical), and
5-methylcytidine-3'-amidite. 3'-propylphthalimido-A and
2'-propylphthalimido-A were used as the LCA-CPG solid support. The
required amounts of the amidites were placed in dried vials,
dissolved in acetonitrile (unmodified nucleosides were made into 1M
solutions and modified nucleosides were 100 mg/mL), and connected
to the appropriate ports on a Millipore Expedite.TM. Nucleic Acid
Synthesis System. Solid support resin (60 mg) was used in each
column for 2.times.1 .mu.mole scale synthesis (2 columns for each
oligo were used). The synthesis was run using the IBP-PS(1
.mu.mole) coupling protocol for phosphorothioate backbones and
CSO-8 for phosphodiesters. The trityl reports indicated normal
coupling results.
[0231] After synthesis the oligonucleotides were deprotected with
conc. ammonium hydroxide(aq) containing 10% of a solution of 40%
methylamine (aq) at 55.degree. C. for approximately 16 hrs. Then
they were evaporated, using a Savant AS160 Automatic SpeedVac, (to
remove ammonia) and filtered to remove the CPG-resin. The crude
samples were analyzed by MS, HPLC, and CE. Then they were purified
on a Waters 600E HPLC system with a 991 detector using a Waters C4
Prep. scale column (Alice C4 Prep.) and the following solvents: A:
50 mM TEA-Ac, pH 7.0 and B: acetonitrile utilizing the AMPREP2@
method. After purification the oligonucleotides were evaporated to
dryness and then detritylated with 80% acetic acid at room temp.
for approximately 30 min. Then they were evaporated.
[0232] The oligonucleotides were dissolved in conc. ammonium
hydroxide and run through a column containing Sephadex G-25 using
water as the solvent and a Pharmacia LKB SuperFrac fraction
collector. The resulting purified oligonucleotides were evaporated
and analyzed by MS, CE, and HPLC. TABLE-US-00010 TABLE VI
Oligonucleotides bearing Aminopropyl Substituents Back- ISIS #
Sequence (5'-3').sup.1 bone 23185-1 A*TG-CAT-TCT-GCC-CCC-AAG-GA*
P.dbd.S 23186-1 A*TG-CAT-TCT-GCC-CCC-AAG-GA* P.dbd.S 23187-1
A*.sub.oT.sub.oG.sub.o-C.sub.oA.sub.sT.sub.s-T.sub.sC.sub.sT.sub.s-
-G.sub.sC.sub.sC.sub.s-C.sub.sC.sub.sC.sub.s- P.dbd.S/
A.sub.oA.sub.oG.sub.o-G.sub.oA* P.dbd.O 23980-1
*.sub.oT.sub.oG.sub.o-C.sub.oA.sub.sT.sub.s-T.sub.sC.sub.sT.sub.s--
G.sub.sC.sub.sC.sub.s-C.sub.sC.sub.sC.sub.s- P.dbd.S/
A.sub.oA.sub.oG.sub.o-G.sub.o* P.dbd.O 23981-1
*TG-CAT-TCT-GCC-CCC-AAG-G* P.dbd.S 23982-1
A*TG-CAT-TCT-GCC-CCC-AAG-GA* P.dbd.S .sup.1All underlined
nucleosides bear a 2'-O-methoxyethyl substituent; internucleotide
linkages in PS/PO oligonucleotides are indicated by subscript
>s= and >o= notations respectively; A* = 3'-aminopropyl-A; *
= 2'-aminopropyl-A; C = 5-methyl-C
[0233] TABLE-US-00011 TABLE VII Aminopropyl Modified
Oligonucleotides Expected Observed Mass Mass HPLC Retention CE
Retention Crude Yield Final Yield ISIS # (G/mol) (g/mol) Time (min)
Time (min) (Ods) (Ods) 23185-1 6612.065 6610.5 23.19 5.98 948 478
23186-1 7204.697 7203.1 24.99 6.18 1075 379 23187-1 7076.697
7072.33 23.36 7.56 838 546 23980-1 7076.697 7102.31 23.42 7.16 984
373 23981-1 7204.697 7230.14 25.36 7.18 1170 526 23982-1 6612.065
6635.71 23.47 7.31 1083 463
Example 56
In Vivo Stability of Modified Oligonucleotides
[0234] The in vivo stability of selected modified oligonucleotides
synthesized in Examples 49 and 55 was determined in BALB/c mice.
Following a single i.v. administration of 5 mg/kg of
oligonucleotide, blood samples were drawn at various time intervals
and analyzed by CGE. For each oligonucleotide tested, 9 male BALB/c
mice (Charles River, Wilmington, Mass.) weighing about 25 g were
used. Following a one week acclimatization the mice received a
single tail-vein injection of oligonucleotide (5 mg/kg)
administered in phosphate buffered saline (PBS), pH 7.0. One
retro-orbital bleed (either at 0.25, 0.5, 2 or 4 h post-dose) and a
terminal bleed (either 1, 3, 8, or 24 h post-dose) were collected
from each group. The terminal bleed (approximately 0.6-0.8 mL) was
collected by cardiac puncture following ketamine/xylazine
anasthesia. The blood was transferred to an EDTA-coated collection
tube and centrifuged to obtain plasma. At termination, the liver
and kidneys were collected from each mouse. Plasma and tissue
homogenates were used for analysis to determine intact
oligonucleotide content by CGE. All samples were immediately frozen
on dry ice after collection and stored at -80C until analysis.
[0235] The CGE analysis inidcated the relative nuclease resistance
of 2',5'-linked oligomers compared to ISIS 11061 (Table III,
Example 51) (uniformly 2'-deoxy-phosphorothioate oligonucleotide
targeted to mouse c-raf). Because of the nuclease resistance of the
2',5'-linkage, coupled with the fact that 3'-methoxyethoxy
substituents are present and afford further nuclease protection the
oligonucleotides ISIS 17176, ISIS 17177, ISIS 17178, ISIS 17180,
ISIS 17181 and ISIS 21415 were found to be more stable in plasma,
while ISIS 11061 (Table III) was not. Similar observations were
noted in kidney and liver tissue. This implies that 2',5'-linkages
with 3'-methoxyethoxy substituents offer excellent nuclease
resistance in plasma, kidney and liver against 5'-exonucleases and
3'-exonucleases. Thus oligonucleotides with longer durations of
action can be designed by incorporating both the 2',5'-linkage and
3'-methoxyethoxy motifs into their structure. It was also observed
that 2',5'-phosphorothioate linkages are more stable than
2',5'-phosphodiester linkages. A plot of the percentage of full
length oligonucleotide remaining intact in plasma one hour
following administration of an i.v. bolus of 5 mg/kg
oligonucleotide is shown in FIG. 4.
[0236] A plot of the percentage of full length oligonucleotide
remaining intact in tissue 24 hours following administration of an
i.v. bolus of 5 mg/kg oligonucleotide is shown in FIG. 5.
[0237] CGE traces of test oligonucleotides and a standard
phosphorothioate oligonucleotide in both mouse liver samples and
mouse kidney samples after 24 hours are shown in FIG. 6. As is
evident from these traces, there is a greater amount of intact
oliogonucleotide for the oligonucleotides of the invention as
compared to the standard seen in panel A. The oligonucleotide shown
in panel B included one substituent of the invention at each of the
5' and 3' ends of a phosphorothioate oligonucleotide while the
phosphorothioate oligonucleotide seen in panel C included one
substituent at the 5' end and two at the 3' end. The
oligonucleotide of panel D includes a substituent of the invention
incorporated in a 2',5' phosphodiester linkage at both its 5' and
3' ends. While less stable than the oligonucleotide seen in panels
B and C, it is more stable than the full phosphorothioate standard
oligonucleotide of panel A.
Example 57
Control of c-raf Message in bEND Cells Using Modified
Oligonucleotides
[0238] In order to assess the activity of some of the
oligonucleotides, an in vitro cell culture assay was used that
measures the cellular levels of c-raf expression in bEND cells.
[0239] Cells and Reagents
[0240] The bEnd.3 cell line, a brain endothelioma, was obtained
from Dr. Werner Risau (Max-Planck Institute). Opti-MEM,
trypsin-EDTA and DMEM with high glucose were purchased from
Gibco-BRL (Grand Island, N.Y.). Dulbecco's PBS was purchased from
Irvine Scientific (Irvine, Calif.). Sterile, 12 well tissue culture
plates and Facsflow solution were purchased from Becton Dickinson
(Mansfield, Mass.). Ultrapure formaldehyde was purchased from
Polysciences (Warrington, Pa.). NAP-5 columns were purchased from
Pharmacia (Uppsala, Sweden).
[0241] Oligonucleotide Treatment
[0242] Cells were grown to approximately 75% confluency in 12 well
plates with DMEM containing 4.5 g/L glucose and 10% FBS. Cells were
washed 3 times with Opti-MEM pre-warmed to 37.degree. C.
Oligonucleotide were premixed with a cationic lipid (Lipofectin
reagent, (GIBCO/BRL) and, serially diluted to desired
concentrations and transferred on to washed cells for a 4 hour
incubation at 37.degree. C. Media was then removed and replaced
with normal growth media for 24 hours for northern blot analysis of
mRNA.
[0243] Northern Blot Analysis
[0244] For determination of mRNA levels by Northern blot analysis,
total RNA was prepared from cells by the guanidinium isothiocyanate
procedure (Monia et al., Proc. Natl. Acad. Sci. USA, 1996, 93,
15481-15484) 24 h after initiation of oligonucleotide treatment.
Total RNA was isolated by centrifugation of the cell lysates over a
CsCl cushion. Northern blot analysis, RNA quantitation and
normalization to G#PDH mRNA levels were done according to a
reported procedure (Dean and McKay, Proc. Natl. Acad. Sci. USA,
1994, 91, 11762-11766). In bEND cells the
2-,5-linked-3'-O-methoxyethyl oligonucleotides showed reduction of
c-raf message activity as a function of concentration. The fact
that these modified oligonucleotides retained activity promises
reduced frequency of dosing with these oligonucleotides which also
show increased in vivo nuclease resistance. All 2',5'-linked
oligonucleotides retained the activity of parent 11061 (Table III)
oligonucleotide and improved the activity even further. A graph of
the effect of the oligonucleotides of the present invention on
c-raf expression (compared to control) in bEND cells is shown in
FIG. 7.
Example 58
Synthesis of MMI-Containing Oligonucleotides
[0245] a. Bis-2'-O-methyl MMI Building Blocks
[0246] The synthesis of MMI (i.e., R=CH.sub.3) dimer building
blocks have been previously described (see, e.g., Swayze, et al.,
Synlett 1997, 859; Sanghvi, et al., Nucleosides & Nucleotides
1997, 16 907; Swayze, et al., Nucleosides & Nucleotides 1997,
16, 971; Dimock, et al., Nucleosides & Nucleotides 1997, 16,
1629). Generally,
5'-O-(4,4'-dimethoxytrityl)-2'-O-methyl-3'-C-formyl nucleosides
were condensed with
5'-O-(N-methylhydroxylamino)-2'-O-methyl-3'-O-TBDPS nucleosides
using 1 equivalent of BH.sub.3 pyridine/1 equivalent of pyridinium
para-toluene sulfonate (PPTS) in 3:1 MeOH/THF. The resultant MMI
dimer blocks were then deprotected at the lower part of the sugar
with 15 equivalents of Et.sub.3N-2HF in THF. Thus the T*G.sup.iBu
dimer unit was synthesized and phosphitylated to give T*G(MMI)
phosphoramidite. In a similar fashion, A.sup.BZ*T(MMI) dimer was
synthesized, succinylated and attached to controlled pore
glass.
[0247] b. Oligonucleotide Synthesis
[0248] Oligonucleotides were synthesized on a Perseptive Biosystems
Expedite 8901 Nucleic Acid Synthesis System. Multiple 1-.mu.mol
syntheses were performed for each oligonucleotide. A*.sub.MMIT
solid support was loaded into the column. Trityl groups were
removed with trichloroacetic acid (975 .mu.L over one minute)
followed by an acetonitrile wash. The oligonucleotide was built
using a modified thioate protocol. Standard amidites were delivered
(210 .mu.L) over a 3 minute period in this protocol. The
T*.sub.MMIG amidite was double coupled using 210 .mu.L over a total
of 20 minutes. The amount of oxidizer,
3H-1,2-benzodithiole-3-one-1,1-dioxide (Beaucage reagent, 3.4 g
Beaucage reagent/200 mL acetonitrile), was 225 .mu.L (one minute
wait step). The unreacted nucleoside was capped with a 50:50
mixture of tetrahyrdofuran/acetic anhydride and
tetrahydrofuran/pyridine/1-methyl imidazole. Trityl yields were
followed by the trityl monitor during the duration of the
synthesis. The final DMT group was left intact. After the
synthesis, the contents of the synthesis cartridge (1 .mu.mole)
were transferred to a Pyrex vial and the oligonucleotide was
cleaved from the controlled pore glass (CPG) using 5 mL of 30%
ammonium hydroxide (NH.sub.4OH) for approximately 16 hours at
55.degree. C.
[0249] c. Oligonucleotide Purification
[0250] After the deprotection step, the samples were filtered from
CPG using Gelman 0.45 .mu.m nylon acrodisc syringe filters. Excess
NH.sub.4OH was evaporated away in a Savant AS160 automatic
SpeedVac. The crude yield was measured on a Hewlett Packard 8452A
Diode Array Spectrophotometer at 260 nm. Crude samples were then
analyzed by mass spectrometry (MS) on a Hewlett Packard
electrospray mass spectrometer. Trityl-on oligonucleotides were
purified by reverse phase preparative high performance liquid
chromatography (HPLC). HPLC conditions were as follows: Waters 600E
with 991 detector; Waters Delta Pak C4 column (7.8.times.300 mm);
Solvent A: 50 mM triethylammonium acetate (TEA-Ac), pH 7.0; B: 100%
acetonitrile; 2.5 mL/min flow rate; Gradient: 5% B for first five
minutes with linear increase in B to 60% during the next 55
minutes. Fractions containing the desired product (retention
time=41 min. for DMT-ON-16314; retention time=42.5 min. for
DMT-ON-16315) were collected and the solvent was dried off in the
SpeedVac. Oligonucleotides were detritylated in 80% acetic acid for
approximately 60 minutes and lyophilized again. Free trityl and
excess salt were removed by passing detritylated oligonucleotides
through Sephadex G-25 (size exclusion chromatography) and
collecting appropriate samples through a Pharmacia fraction
collector. The solvent was again evaporated away in a SpeedVac.
Purified oligonucleotides were then analyzed for purity by CGE,
HPLC (flow rate: 1.5 mL/min; Waters Delta Pak C4 column,
3.9.times.300mm), and MS. The final yield was determined by
spectrophotometer at 260 nm.
[0251] The synthesized oligonucleotides and their physical
characteristics are shown, respectively, in Tables VIII and IX. All
nucleosides with an asterisk contain MMI linkage. TABLE-US-00012
TABLE VIII ICAM-1 Oligonucleotides Containing MMI Dimers
Synthesized for in Vivo Nuclease and Pharmacology Studies Back-
ISIS # Sequence (5'-3') bone 2'-Chemistry 16314 TGC ATC CCC CAG GCC
P.dbd.S, Bis-2'-Ome-MMI, ACC A*T MMI 2'-H 16315 T*GC ATC CCC CAG
GCC P.dbd.S, Bis-2'-Ome-MMI, ACC A*T MMI 2'-H 3082 TGC ATC CCC CAG
GCG P.dbd.S 2'-H, single ACC AT Mis- match 13001 TGC ATC CCC CAG
GCC P.dbd.S 2'-H ACC AT
[0252] TABLE-US-00013 TABLE IX Physical Characteristics of MMI
Oligomers Synthesized for Pharmacology, and In Vivo Nuclease
Studies ISIS # Retn. Expected Observed HPLC (min) Sequence (5'-3')
Mass (g) Mass (g) Time 16314 TGC ATC CCC CAG 6295 6297 23.9 GCC ACC
A*T 16315 T*G C ATC CCC CAG 6302 6303 24.75 GCC ACC A*T
[0253] HPLC Conditions: Waters 600E with detector 991; Waters C4
column (3.9.times.300 mm); Solvent A: 50 mM TEA-Ac, pH 7.0; B: 100%
acetonitrile; 1.5 mL/min. flow rate; Gradient: 5% B for first five
minutes with linear increase in B to 60% during the next 55
minutes.
Example 59
Synthesis of Sp Terminal Oligonucleotide
[0254] a. 3'-O-t-Butyldiphenylsilyl-thymidine (1)
[0255] 5'-O-Dimethoxytritylthymidine is silylated with 1 equivalent
of t-butyldiphenylsilyl chloride (TBDPSCl) and 2 equivalents of
imidazole in DMF solvent at room temperature. The 5'-protecting
group is removed by treating with 3% dichloracetic acid in
CH.sub.2Cl.sub.2.
[0256] b.
5'-O-Dimethoxytrityl-thymidin-3'-O-yl-N,N-diisopropylamino
(S-pivaloyl-2-mercaptoethoxy) phosphoramidite (2)
[0257] 5'-O-Dimethoxytrityl thymidine is treated with
bis-(N,N-diisopropylamino)-S-pivaloyl-2-mercaptoethoxy
phosphoramidite and tetrazole in CH.sub.2Cl.sub.2/CH.sub.3CN as
described by Guzaev et al., Bioorganic & Medicinal Chemistry
Letters 1998, 8, 1123) to yield the title compound.
[0258] c.
5'-O-Dimethoxytrityl-2'-deoxy-adenosin-3'-O-yl-N,N-diisopropyla-
mino (S-pivaloyl-2-mercapto ethoxy) phosphoramidite (3)
[0259] 5'-O-Dimethoxytrityl-N-6-benzoyl-2'-deoxy-adenosine is
phosphitylated as in the previous example to yield the desired
amidite.
[0260] d.
3'-O-t-Butyldiphenylsilyl-2'-deoxy-N.sub.2-isobutyryl-guanosine
(4)
[0261] 5'-O-Dimethoxytrityl-2'-deoxy-N.sub.2-isobutyryl-guanisine
is silylated with TBDPSCl and imidazole in DMF. The 5'-DMT is then
removed with 3% DCA in CH.sub.2Cl.sub.2.
[0262] e. T.sub.(Sp)G Dimers and T.sub.(S) Phosphoramidite
[0263] Compounds 4 and 2 are condensed (1:1 equivalents) using
1H-tetrazole in CH.sub.3CN solvent followed by sulfurization
employing Beaucage reagent (see, e.g., Iyer, et al., J. Org. Chem.
1990, 55, 4693). The dimers (TG) are separated by column
chromatography and the silyl group is deprotected using t-butyl
ammonium fluoride/THF to give Rp and Sp dimers of T.sub.sG. Small
amounts of these dimers are completely deprotected and treated with
either P1 nuclease or snake venom phosphodiesterase. The R isomer
is resistant to P1 nuclease and hydrolyzed by SVPD. The S isomer is
resistant to SVPD and hydrolyzed P1 nuclease. The Sp isomer of the
fully protected T.sub.sG dimer is phosphitylated to give
DMT-T-Sp-G-phosphoramidite.
[0264] f. A,T Dimers and Solid Support Containing A.sub.SPT
Dimer
[0265] Compounds 3 and 1 are condensed using 1H-tetrazole in
CH.sub.3CN solvent followed by sulfurization to give AT dimers. The
dimers are separated by column chromatography and the silyl group
is deprotected with TBAF/THF. The configurational assignments are
done generally as in the previous example. The Sp isomer is then
attached to controlled pore glass according to standard procedures
to give DMT-A.sub.SP-T-CPG oligomerization with chirally pure Sp
dimer units at the termini.
[0266] g. Oligonucleotide Synthesis
[0267] The oligonucleotide having the sequence T*GC ATC CCC CAG GCC
ACC A*T is synthesized, where T*G and A*T represent chiral Sp dimer
blocks described above. DMT-A.sub.SP-T-CPG is taken in the
synthesis column and the next 16b residues are built using standard
phosphorothioate protocols and 3H-1,2-benzodithiol-3-one 1,1
dioxide as the sulfurizing agent. After building this 18 mer unit
followed by final detritylation, the chiral Sp dimer
phosphoramidite of 5'-DMT-Tsp-G amidite is coupled to give the
desired antisense oligonucleotide. This compound is then
deprotected in 30% NH.sub.4OH over 16 hours and the oligomer
purified in HPLC and desalted in Sephader G-25 column. The final
oligomer has Sp configuration at the 5'-terminus and 3'-terminus
and the interior has diastereomeric mixture of Rp and Sp
configurations.
Example 60
Evaluation of in Vivo Stability of MMI Capped Oligonucleotides
Mouse Experiment Procedures
[0268] For each oligonucleotide tested, 9 male BALB/c mice (Charles
River, Wilmington, Mass.), weighing about 25 g was used (Crooke et
al., J. Pharmacol. Exp. Ther., 1996, 277, 923). Following a 1-week
acclimation, mice received a single tail vein injection of
oligonucleotide (5 mg/kg) administered in phosphate buffered saline
(PBS), pH 7.0 One retro-orbital bleed (either 0.25, 0.5, 2 or 41 v
post dose) and a terminal bleed (either 1, 3, 8 or 24 h post dose)
were collected from each group. The terminal bleed (approximately
0.6-0.8 mL) was collected by cardiac puncture following
ketamine/xylazine anesthesia. The blood was transferred to an
EDTA-coated collection tube and centrifuged to obtain plasma. At
termination, the liver and kidneys were collected from each mouse.
Plasma and tissues homogenates were used for analysis for
determination of intact oligonucleotide content by CGE. All samples
were immediately frozen on dry ice after collection and stored at
-80.degree. C. until analysis.
[0269] The capillary gel electrophoretic analysis indicated the
relative nuclease resistance of MMI capped oligomers compared to
ISIS 3082 (uniform 2'-deoxy phosphorothioate). Because of the
resistance of MMI linkage to nucleases, the compound 16314 was
found to be stable in plasma while 3082 was not. However, in kidney
and liver, the compound 16314 also showed certain amount of
degradation. This implied that while 3'-exonuclease is important in
plasma, 5'-exonucleases or endonucleases may be active in tissues.
To distinguish between these two possibilities, the data from 16315
was analyzed. In plasma as well as in tissues, (liver and kidney)
the compound was stable in various time points. (1, 3 and 24 hrs.).
The fact that no degradation was detected proved that
5'-exonucleases and 3'-exonuclease are prevalent in tissues and
endonucleases are not active. Furthermore, a single linkage (MMI or
Sp thioate linkage) is sufficient as a gatekeeper against
nucleases.
Control of ICAM-1 Expression Cells and Reagents
[0270] The bEnd.3 cell line, a brain endothelioma, was the kind
gift of Dr. Werner Risau (Max-Planck Institute). Opti-MEM,
trypsin-EDTA and DMEM with high glucose were purchased from
Gibco-BRL (Grand Island, N.Y.). Dulbecco's PBS was purchased from
Irvine Scientific (Irvine, Calif.). Sterile, 12 well tissue culture
plates and Facsflow solution were purchased from Becton Dickinson
(Mansfield, Mass.). Ultrapure formaldehyde was purchased from
Polysciences (Warrington, Pa.). Recombinant human TNF-a was
purchased from R&D Systems (Minneapolis, Minn.). Mouse
interferon. was purchased from Genzyme (Cambridge, Mass.). Fraction
V, BSA was purchased from Sigma (St. Louis, Mo.). The mouse
ICAM-1-PE, VCAM-1-FITC, hamster IgG-FITC and rat IgG.sub.2a-PE
antibodies were purchased from Pharmingen (San Diego, Calif.).
Zeta-Probe nylon blotting membrane was purchased from Bio-Rad
(Richmond, Calif.). QuickHyb solution was purchased from Stratagene
(La Jolla, Calif.). A cDNA labeling kit, Prime-a-Gene, was
purchased from ProMega (Madison, WI). NAP-5 columns were purchased
from Pharmacia (Uppsala, Sweden).
[0271] Oligonucleotide Treatment
[0272] Cells were grown to approximately 75% confluency in 12 well
plates with DMEM containing 4.5 g/L glucose and 10% FBS. Cells were
washed 3 times with Opti-MEM pre-warmed to 37.degree. C.
Oligonucleotide was premixed with Opti-MEM, serially diluted to
desired concentrations and transferred onto washed cells for a 4
hour incubation at 37.degree. C. Media was removed and replaced
with normal growth media with or without 5 ng/mL TNF- and 200 U/mL
interferon, incubated for 2 hours for northern blot analysis of
mRNA or overnight for flow cytometric analysis of cell surface
protein expression.
[0273] Flow Cytometry
[0274] After oligonucleotide treatment, cells were detached from
the plates with a short treatment of trypsin-EDTA (1-2 min.). Cells
were transferred to 12.times.75 mm polystyrene tubes and washed
with 2% BSA, 0.2% sodium azide in D-PBS at 4.degree. C. Cells were
centrifuged at 1000 rpm in a Beckman GPR centrifuge and the
supernatant was then decanted. ICAM-1, VCAM-1 and the control
antibodies were added at 1 ug/mL in 0.3 mL of the above buffer.
Antibodies were incubated with the cells for 30 minutes at
4.degree. C. in the dark, under gentle agitation. Cells were washed
again as above and then resuspended in 0.3 mL of FacsFlow buffer
with 0.5% ultrapure formaldehyde. Cells were analyzed on a Becton
Dickinson FACScan. Results are expressed as percentage of control
expression, which was calculated as follows: [((CAM expression for
oligonucleotide-treated cytokine induced cells)-(basal CAM
expression))/((cytokine-induced CAM expression)-(basal CAM
expression))].times.100. For the experiments involving cationic
lipids, both basal and cytokine-treated control cells were
pretreated with Lipofectin for 4 hours in the absence of
oligonucleotides.
[0275] The results reveal the following: 1) Isis 3082 showed an
expected dose response (25-200 nM); 2) Isis 13001 lost its ability
to inhibit ICAM-1 expression as expected from a mismatch compound,
thus proving an antisense mechanism; 3) 3'-MMI capped oligomer
16314 improved the activity of 3082, and at 200 nM concentration,
nearly twice as active as 3082; 4) 5'- and 3'-MMI capped oligomer
is the most potent compound and it is nearly 4 to 5 times more
efficacious than the parent compound at 100 and 200 nM
concentrations. Thus, improved nuclease resistance increased the
potency of the antisense oligonucleotides.
Example 61
Control of H-ras Expression
[0276] Antisense oligonucleotides targeting the H-ras message were
tested for their ability to inhibit production of H-ras mRNA in
T-24 cells. For these test, T-24 cells were plated in 6-well plates
and then treated with various escalating concentrations of
oligonucleotide in the presence of cationic lipid (Lipofectin,
GIBCO) at the ratio of 2.5 .mu.g/ml Lipofectin per 100 nM
oligonucleotide. Oligonucleotide treatment was carried out in serum
free media for 4 hours. Eighteen hours after treatment the total
RNA was harvested and analyzed by northern blot for H-ras mRNA and
control gene G3PDH. The data is presented in FIGS. 8 and 9 in bar
graphs as percent control normalized for the G3PDH signal. As can
be seen, the oligonucleotide having a single MMI linkage in each of
the flank regions showed significant reduction of H-ras mRNA.
Example 62
5-Lipoxygenase Analysis and Assays
[0277] A. Therapeutics
[0278] For therapeutic use, an animal suspected of having a disease
characterized by excessive or abnormal supply of 5-lipoxygenase is
treated by administering a compound of the invention. Persons of
ordinary skill can easily determine optimum dosages, dosing
methodologies and repetition rates. Such treatment is generally
continued until either a cure is effected or a diminution in the
diseased state is achieved. Long term treatment is likely for some
diseases.
[0279] B. Research Reagents
[0280] The oligonucleotides of the invention will also be useful as
research reagents when used to cleave or otherwise modulate
5-lipoxygenase mRNA in crude cell lysates or in partially purified
or wholly purified RNA preparations. This application of the
invention is accomplished, for example, by lysing cells by standard
methods, optimally extracting the RNA and then treating it with a
composition at concentrations ranging, for instance, from about 100
to about 500 ng per 10 Mg of total RNA in a buffer consisting, for
example, of 50 mm phosphate, pH ranging from about 4-10 at a
temperature from about 30 to about 50.degree. C. The cleaved
5-lipoxygenase RNA can be analyzed by agarose gel electrophoresis
and hybridization with radiolabeled DNA probes or by other standard
methods.
[0281] C. Diagnostics
[0282] The oligonucleotides of the invention will also be useful in
diagnostic applications, particularly for the determination of the
expression of specific mRNA species in various tissues or the
expression of abnormal or mutant RNA species. In this example,
while the macromolecules target a abnormal mRNA by being designed
complementary to the abnormal sequence, they would not hybridize to
normal mRNA. Tissue samples can be homogenized, and RNA extracted
by standard methods. The crude homogenate or extract can be treated
for example to effect cleavage of the target RNA. The product can
then be hybridized to a solid support which contains a bound
oligonucleotide complementary to a region on the 5' side of the
cleavage site. Both the normal and abnormal 5' region of the mRNA
would bind to the solid support. The 3' region of the abnormal RNA,
which is cleaved, would not be bound to the support and therefore
would be separated from the normal mRNA.
[0283] Targeted mRNA species for modulation relates to
5-lipoxygenase; however, persons of ordinary skill in the art will
appreciate that the present invention is not so limited and it is
generally applicable. The inhibition or modulation of production of
the enzyme 5-lipoxygenase is expected to have significant
therapeutic benefits in the treatment of disease. In order to
assess the effectiveness of the compositions, an assay or series of
assays is required.
[0284] D. In Vitro Assays
[0285] The cellular assays for 5-lipoxygenase preferably use the
human promyelocytic leukemia cell line HL-60. These cells can be
induced to differentiate into either a monocyte like cell or
neutrophil like cell by various known agents. Treatment of the
cells with 1.3% dimethyl sulfoxide, DMSO, is known to promote
differentiation of the cells into neutrophils. It has now been
found that basal HL-60 cells do not synthesize detectable levels of
5-lipoxygenase protein or secrete leukotrienes (a downstream
product of 5-lipoxygenase). Differentiation of the cells with DMSO
causes an appearance of 5-lipoxygenase protein and leukotriene
biosynthesis 48 hours after addition of DMSO. Thus induction of
5-lipoxygenase protein synthesis can be utilized as a test system
for analysis of oligonucleotides which interfere with
5-lipoxygenase synthesis in these cells.
[0286] A second test system for oligonucleotides makes use of the
fact that 5-lipoxygenase is a "suicide" enzyme in that it
inactivates itself upon reacting with substrate. Treatment of
differentiated HL-60 or other cells expressing 5 lipoxygenase, with
10 .mu.M A23187, a calcium ionophore, promotes translocation of
5-lipoxygenase from the cytosol to the membrane with subsequent
activation of the enzyme. Following activation and several rounds
of catalysis, the enzyme becomes catalytically inactive. Thus,
treatment of the cells with calcium ionophore inactivates
endogenous 5-lipoxygenase. It takes the cells approximately 24
hours to recover from A23187 treatment as measured by their ability
to synthesize leukotriene B.sub.4. Macromolecules directed against
5-lipoxygenase can be tested for activity in two HL-60 model
systems using the following quantitative assays. The assays are
described from the most direct measurement of inhibition of
5-lipoxygenase protein synthesis in intact cells to more downstream
events such as measurement of 5-lipoxygenase activity in intact
cells.
[0287] A direct effect which oligonucleotides can exert on intact
cells and which can be easily be quantitated is specific inhibition
of 5-lipoxygenase protein synthesis. To perform this technique,
cells can be labeled with .sup.35S-methionine (50 .mu.Ci/mL) for 2
hours at 37.degree. C. to label newly synthesized protein. Cells
are extracted to solubilize total cellular proteins and
5-lipoxygenase is immunoprecipitated with 5-lipoxygenase antibody
followed by elution from protein A Sepharose beads. The
immunoprecipitated proteins are resolved by SDS-polyacrylamide gel
electrophoresis and exposed for autoradiography. The amount of
immunoprecipitated 5-lipoxygenase is quantitated by scanning
densitometry.
[0288] A predicted result from these experiments would be as
follows. The amount of 5-lipoxygenase protein immunoprecipitated
from control cells would be normalized to 100%. Treatment of the
cells with 1 .mu.M, 10 .mu.M, and 30 .mu.M of the macromolecules of
the invention for 48 hours would reduce immunoprecipitated
5-lipoxygenase by 5%, 25% and 75% of control, respectively.
[0289] Measurement of 5-lipoxygenase enzyme activity in cellular
homogenates could also be used to quantitate the amount of enzyme
present which is capable of synthesizing leukotrienes. A
radiometric assay has now been developed for quantitating
5-lipoxygenase enzyme activity in cell homogenates using reverse
phase HPLC. Cells are broken by sonication in a buffer containing
protease inhibitors and EDTA. The cell homogenate is centrifuged at
10,000.times.g for 30 min and the supernatants analyzed for
5-lipoxygenase activity. Cytosolic proteins are incubated with 10
.mu.M .sup.14C-arachidonic acid, 2 mM ATP, 50 .mu.M free calcium,
100 .mu.g/mL phosphatidylcholine, and 50 mM bis-Tris buffer, pH
7.0, for 5 min at 37.degree. C. The reactions are quenched by the
addition of an equal volume of acetone and the fatty acids
extracted with ethyl acetate. The substrate and reaction products
are separated by reverse phase HPLC on a Novapak C18 column (Waters
Inc., Millford, Mass.). Radioactive peaks are detected by a Beckman
model 171 radiochromatography detector. The amount of arachidonic
acid converted into di-HETE's and mono-HETE's is used as a measure
of 5-lipoxygenase activity.
[0290] A predicted result for treatment of DMSO differentiated
HL-60 cells for 72 hours with effective the macromolecules of the
invention at 1 .mu.M, 10 .mu.M, and 30 .mu.M would be as follows.
Control cells oxidize 200 .mu.mol arachidonic acid/5 min/10.sup.6
cells. Cells treated with 1 .mu.M, 10 .mu.M, and 30 .mu.M of an
effective oligonucleotide would oxidize 195 pmol, 140 pmol, and 60
pmol of arachidonic acid/5 min/10.sup.6 cells respectively.
[0291] A quantitative competitive enzyme linked immunosorbant assay
(ELISA) for the measurement of total 5-lipoxygenase protein in
cells has been developed. Human 5-lipoxygenase expressed in E. coli
and purified by extraction, Q-Sepharose, hydroxyapatite, and
reverse phase HPLC is used as a standard and as the primary antigen
to coat microtiter plates. Purified 5-lipoxygenase (25 ng) is bound
to the microtiter plates overnight at 4.degree. C. The wells are
blocked for 90 min with 5% goat serum diluted in 20 mM Tris!HCL
buffer, pH 7.4, in the presence of 150 mM NaCl (TBS). Cell extracts
(0.2% Triton X-100, 12,000.times.g for 30 min.) or purified
5-lipoxygenase were incubated with a 1:4000 dilution of
5-lipoxygenase polyclonal antibody in a total volume of 100 .mu.L
in the microtiter wells for 90 min. The antibodies are prepared by
immunizing rabbits with purified human recombinant 5-lipoxygenase.
The wells are washed with TBS containing 0.05% tween 20 (TBST),
then incubated with 100 .mu.L of a 1:1000 dilution of peroxidase
conjugated goat anti-rabbit IgG (Cappel Laboratories, Malvern, Pa.)
for 60 min at 25.degree. C. The wells are washed with TBST and the
amount of peroxidase labeled second antibody determined by
development with tetramethylbenzidine.
[0292] Predicted results from such an assay using a 30 mer
oligonucleotide at 1 .mu.M, 10 .mu.M, and 30 .mu.M would be 30 ng,
18 ng and 5 ng of 5-lipoxygenase per 10.sup.6 cells, respectively
with untreated cells containing about 34 ng 5-lipoxygenase.
[0293] A net effect of inhibition of 5-lipoxygenase biosynthesis is
a diminution in the quantities of leukotrienes released from
stimulated cells. DMSO-differentiated HL-60 cells release
leukotriene B4 upon stimulation with the calcium ionophore A23187.
Leukotriene B4 released into the cell medium can be quantitated by
radioimmunoassay using commercially available diagnostic kits (New
England Nuclear, Boston, Mass.). Leukotriene B4 production can be
detected in HL-60 cells 48 hours following addition of DMSO to
differentiate the cells into a neutrophil-like cell. Cells
(2.times.10.sup.5 cells/mL) will be treated with increasing
concentrations of the macromolecule for 48-72 hours in the presence
of 1.3% DMSO. The cells are washed and resuspended at a
concentration of 2.times.10.sup.6 cell/mL in Dulbecco's phosphate
buffered saline containing 1% delipidated bovine serum albumin.
Cells are stimulated with 10 .mu.M calcium ionophore A23187 for 15
min and the quantity of LTB4 produced from 5.times.10.sup.5 cell
determined by radioimmunoassay as described by the
manufacturer.
[0294] Using this assay the following results would likely be
obtained with an oligonucleotide directed to the 5-LO mRNA. Cells
will be treated for 72 hours with either 1 .mu.M, 10 .mu.M or 30
.mu.M of the macromolecule in the presence of 1.3% DMSO. The
quantity of LTB.sub.4 produced from 5.times.10.sup.5 cells would be
expected to be about 75 pg, 50 pg, and 35 pg, respectively with
untreated differentiated cells producing 75 pg LTB.sub.4.
[0295] E. In Vivo Assay
[0296] Inhibition of the production of 5-lipoxygenase in the mouse
can be demonstrated in accordance with the following protocol.
Topical application of arachidonic acid results in the rapid
production of leukotriene B.sub.4, leukotriene C.sub.4 and
prostaglandin E.sub.2 in the skin followed by edema and cellular
infiltration. Certain inhibitors of 5-lipoxygenase have been known
to exhibit activity in this assay. For the assay, 2 mg of
arachidonic acid is applied to a mouse ear with the contralateral
ear serving as a control. The polymorphonuclear cell infiltrate is
assayed by myeloperoxidase activity in homogenates taken from a
biopsy 1 hour following the administration of arachidonic acid. The
edematous response is quantitated by measurement of ear thickness
and wet weight of a punch biopsy. Measurement of leukotriene
B.sub.4 produced in biopsy specimens is performed as a direct
measurement of 5-lipoxygenase activity in the tissue.
Oligonucleotides will be applied topically to both ears 12 to 24
hours prior to administration of arachidonic acid to allow optimal
activity of the compounds. Both ears are pretreated for 24 hours
with either 0.1 .mu.mol, 0.3 .mu.mol, or 1.0 .mu.mol of the
macromolecule prior to challenge with arachidonic acid. Values are
expressed as the mean for three animals per concentration.
Inhibition of polymorphonuclear cell infiltration for 0.1 .mu.mol,
0.3 .mu.mol, and 1 .mu.mol is expected to be about 10%, 75% and 92%
of control activity, respectively. Inhibition of edema is expected
to be about 3%, 58% and 90%, respectively while inhibition of
leukotriene B.sub.4 production would be expected to be about 15%,
79% and 99%, respectively.
Example 63
5'-O-DMT-2'-deoxy-2'-methylene-5-methyl
uridine-3'-(2-cyanoethyl-N,N-dilsoproppyl) phosphorarmidite
[0297] 2'-Deoxy-2'-methylene-3',5'-O-(tetraisopropyl
disiloxane-1,3,diyl)-5-methyl uridine is synthesized following the
procedures reported for the corresponding uridine derivative
(Hansske, F.; Madej, D.; Robins, M. J. Tetrahedron (1984) 40, 125;
Matsuda, A.; Takenusi, K.;, Tanaka, S.; Sasaki, T.; Ueda, T. J.
Med. Chem. (1991) 34, 812; See also Cory, A. H.; Samano, V.;
Robins, M. J.; Cory, J. G. 2'-Deoxy-2'-methylene derivatives of
adenosine, guanosine, tubercidin, cytidine and uridine as
inhibitors of L1210 cell growth in culture. Biochem. Pharmacol.
(1994), 47(2), 365-71.)
[0298] It is treated with IM TBAF in THF to give
2'-deoxy-2'-methylene-5-methyl uridine. It is dissolved in pyridine
and treated with DMT-Cl and stirred to give the
5'-O-DMT-2'-deoxy-2'-methylene-5-methyl uridine. This compound is
treated with 2-cyanoethyl-N,N-diisopropyl phosphoramidite and
diisopropylaminotetrazolide. In a similar manner the corresponding
N-6 benzoyl adenosine, N-4-benzoyl cytosine, N-2-isobutyryl
guanosine phosphoramidite derivatives are synthesized.
Example 63
Synthesis of 3'-O-4'-C-methyleneribonucleoside
[0299] 5'-O-DMT-3'-O-4'-C-methylene uridine and 5-methyl uridine
are synthesized and phosphitylated according to the procedure of
Obika et al. (Obika et al. Bioorg. Med. Chem. Lett. (1999) 9,
515-158). The amidites are incorporated into oligonucleotides using
the protocols described above.
Example 64
Synthesis of 2'-methylene phosphoramidites
[0300]
5'-O-DMT-2'-(methyl)-3'-O-(2-cyanoethyl-N,N-diisopropylamine)-5-me-
thyluridine-phosphoramidite, 5'-O-DMT-2'-(methyl)-N-6-benzoyl
adenosine (3'-O-2-cyanoethyl-N,N-diisopropylamino) phosphoramidite,
5'-O-DMT-2'-(methyl)-N2-isoburytyl
guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite
and 5'-O-DMT-2'-(methyl)-N-4-benzoyl
cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites
were obtained by the phosphitylation of the corresponding
nucleosides. The nucleosides were synthesized according to the
procedure described by Iribarren, Adolfo M.; Cicero, Daniel O.;
Neuner, Philippe J. Resistance to degradation by nucleases of
(2'S)-2'-deoxy-2'-C-methyloligonucleotides, novel potential
antisense probes. Antisense Res. Dev., (1994), 4(2), 95-8; Schmit,
Chantal; Bevierre, Marc-Olivier; De Mesmaeker, Alain; Altmann,
Karl-Heinz. "The effects of 2'- and 3'-alkyl substituents on
oligonucleotide hybridization and stability". Bioorg. Med. Chem.
Lett. (1994), 4(16), 1969-74.
[0301] The phosphitylation is carried out by using the bisamidite
procedure.
Example 65
Synthesis of 2'-S-methyl phosphoramidites
[0302]
5'-O-DMT-2'-S-(methyl)-3'-O-(2-cyanoethyl-N,N-diisopropylamine)-5--
methyl uridine-phosphoramidite, 5'-O-DMT-2'-S(methyl)-N-6-benzoyl
adenosine (3'-O-2-cyanoethyl-N,N-diisopropylamino) phosphoramidite,
5'-O-DMT-2'-S-(methyl)-N2-isoburytyl
guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite
and 5'-O-DMT-2'-S-(methyl)-N-4-benzoyl
cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites
were obtained by the phosphitylation of the corresponding
nucleosides. The nucleosides were synthesized according to the
procedure described by Fraser et al. (Fraser, A.; Wheeler, P.;
Cook, P. D.; Sanghvi, Y. S. J. Heterocycl. Chem. (1993) 31,
1277-1287). The phosphitylation is carried out by using the
bisamidite procedure.
Example 66
Synthesis of 2'-O-methy-.beta.-D-arabinofuranosyl compounds
[0303] 2'-O-Methyl-.beta.-D-arabinofuranosyl-thymidine containing
oligonucleotides were synthesized following the procedures of
Gotfredson et. al. (Gotfredson, C. H. et. al. Tetrahedron Lett.
(1994) 35, 6941-6944;Gotfredson, C. H. et. al. Bioorg. Med. Chem.
(1996) 4, 1217-1225).
5'-O-DMT-2'-ara-(O-methyl)-3'-O-(2-cyanoethyl-N,N-diisopropylamine)-5-met-
hyl uridine-phosphoramidite, 5'-O-DMT-2'-ara-(O-methyl)-N-6-benzoyl
adenosine (3'-O-2-cyanoethyl-N,N-diisopropylamino) phosphoramidite,
5'-O-DMT-2'-ara-(O-methyl)-N2-isoburytyl
guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite
and 5'-O-DMT-2'-ara-(O-methyl)-N-4-benzoyl
cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites
are obtained by the phosphitylation of the corresponding
nucleosides. The nucleosides are synthesized according to the
procedure described by Gotfredson, C. H. et. al. Tetrahedron Lett.
(1994) 35, 6941-6944; Gotfredson, C. H. et. al. Bioorg. Med. Chem.
(1996) 4, 1217-1225. The phosphitylation is carried out by using
the bisamidite procedure.
Example 67
Synthesis of 2'-fluoro-.beta.-D-arabinofuranosyl compounds
[0304] 2'-Fluoro-.beta.-D-arabinofuranosyl oligonucleotides are
synthesized following the procedures by Kois,P. et al., Nucleosides
Nucleotides 12, 1093, 1993 and Damha et al., J. Am. Chem. Soc.,
120, 12976, 1998 and references sited therin.
5'-O-DMT-2'-ara-(fluoro)-3'-O-(2-cyanoethyl-N,N-diisopropylamine)-5-methy-
l uridine-phosphoramidite, 5'-O-DMT-2'-ara-(fluoro)-N-6-benzoyl
adenosine (3'-O-2-cyanoethyl-N,N-diisopropylamino) phosphoramidite,
5'-O-DMT-2'-ara-(fluoro)-N2-isoburytyl
guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite
and 5'-O-DMT-2'-ara-(fluoro)-N-4-benzoyl
cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites
are obtained by the phosphitylation of the corresponding
nucleosides. The nucleosides are synthesized according to the
procedure described by Kois,P. et al., Nucleosides Nucleotides 12,
1093, 1993 and Damha et al., J. Am. Chem. Soc., 120, 12976, 1998.
The phosphitylation is carried out by using the bisamidite
procedure.
Example 68
Synthesis of 2'-hydroxyl-.beta.-D-arabinofuranosyl compounds
[0305] 2'-Hydroxyl-D-arabinofuranosyl oligonucleotides are
synthesized following the procedures by Resmini and Pfleiderer
Helv. Chim. Acta, 76, 158,1993; Schmit et al., Bioorg. Med. Chem.
Lett. 4, 1969, 1994 Resmini, M.; Pfleiderer, W. Synthesis of
arabinonucleic acid (tANA). Bioorg. Med. Chem. Lett. (1994), 16,
1910.; Resmini, Matthias; Pfleiderer, W. Nucleosides. Part LV.
Efficient synthesis of arabinoguanosine building blocks (Helv.
Chim. Acta, (1994), 77, 429-34; and Damha et al., J. Am. Chem.
Soc., 1998, 120, 12976, and references cited therein).
[0306]
5'-O-DMT-2'-ara-(hydroxy)-3'-O-(2-cyanoethyl-N,N-diisopropylamine)-
-5-methyl uridine-phosphoramidite,
5'-O-DMT-2'-ara-(hydroxy)-N-6-benzoyl adenosine
(3'-O-2-cyanoethyl-N,N-diisopropylamino) phosphoramidite,
5'-O-DMT-2'-ara-(hydroxy)-N2-isoburytyl
guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite
and 5'-O-DMT-2'-ara-(hydroxy)-N-4-benzoyl
cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites
are obtained by the phosphitylation of the corresponding
nucleosides. The nucleosides are synthesized according to the
procedure described by Kois,P. et al., Nucleosides Nucleotides 12,
1093, 1993 and Damha et al., J. Am. Chem. Soc., 120, 12976, 1998.
The phosphitylation is carried out by using the bisamidite
procedure.
Example 69
Synthesis of Difluoromethylene Compounds
[0307]
5'-O-DMT-2'-deoxy-2'-difluoromethylene-5-methyluridine-3'-(2-cyano-
ethyl-N,N-diisopropyl phosphoramidite),
5'-O-DMT-2'-deoxy-2'-difluoromethylene-N-4-benzoyl-cytidine,
5'-O-DMT-2'-deoxy-2'-diflyoromethylene-N-6-benzoyl adenosine, and
5'-O-DMT-2'-deoxy-2'-difluoroethylene-N.sub.2-isobutyryl guanosine
are synthesized following the protocols described by Usman et. al.
(U.S. Pat. No. 5,639,649, Jun. 17, 1997).
Example 70
Synthesis of
5'-O-DMT-2'-deoxy-2'-.beta.-(O-acetyl)-2'-.alpha.-methyl-N6-
benzopyl-adenosine-3'-(2-cyanoethyl-N,N-diisopropyl
phosphoramidite
[0308] 5'-O-DMT-2'-deoxy-2'-(OH)-2'-.alpha.-methyl-adenosine is
synthesized from the compound 5'-3'-protected-2'-keto-adenosine
(Rosenthal, Sprinzl and Baker, Tetrahedron Lett. 4233, 1970; see
also Nucleic acid related compounds. A convenient procedure for the
synthesis of 2'- and 3'-ketonucleosides is shown Hansske et al.,
Dep. Chem., Univ. Alberta, Edmonton, Can., Tetrahedron Lett.
(1983), 24(15), 1589-92.) by Grigand addition of MeMgI in THF
solvent, followed by seperation of the isomers. The 2-(OH) is
protected as acetate. 5'-3'-acetal group is removed, 5'-position
dimethoxy, tritylated, N-6 position is benzoylated and then
3'-position is phosphitylated to give
5'-O-DMT-2'-deoxy-2'-.beta.-(O-acetyl)-2'-.alpha.-methyl-N6-benzoyl-adeno-
sine-3'-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite.
Example 71
Synthesis of
5'-O-DMT-2'-.alpha.-ethynyl-N6-benzoyl-adenosine-3'-(2-cyanoethyl-N,N-dii-
sopropyl phosphoramidite
[0309] 5'-O-DMT-2'-deoxy-2'-O--(OH)-2'-ethynyl-adenosine is
synthesized from the compound 5'-3'-protected-2'-keto-adenosine
(Rosenthal, Sprinzl and Baker, Tetrahedron Lett. 4233, 1970) by
Grigand addition of Ethynyl-MgI in THF solvent, followed by
seperation of the isomers. The 2'-(OH) is removed by Robins'
deoxygenation procedure (Robins et al., J. Am. Chem. Soc. (1983),
105, 4059-65. 5'-3'-acetal group is removed, 5'-position
dimethoxytritylated, N-6 position is benzoylated and then
3'-position is phosphitylated to give the title compound.
Example 72
2'-O-(guaiacolyl)-5-methyluridine
[0310] 2-Methoxyphenol (6.2 g, 50 mmol) was slowly added to a
solution of borane in tetrahydrofuran (1 M, 10 mL, 10 mmol) with
stirring in a 100 mL bomb. Hydrogen gas evolved as the solid
dissolved O-2,2'-anhydro-5-methyluridine (1.2 g, 5 mmol), and
sodium bicarbonate (2.5 mg) were added and the bomb was sealed,
placed in an oil bath and heated to 155.degree. C. for 36 hours.
The bomb was cooled to room temperature and opened. The crude
solution was concentrated and the residue partitioned between water
(200 mL) and hexanes (200 mL). The excess phenol was extracted into
hexanes. The aqueous layer was extracted with ethyl acetate
(3.times.200 mL) and the combined organic layer was washed once
with water, dried over anhydrous sodium sulfate and concentrated.
The residue was purified by silica gel flash column chromatography
using methanol:methylene chloride ( 1/10, v/v) as the eluent.
Fractions were collected and the target fractions were concentrated
to give 490 mg of pure product as a white solid. Rf=0.545 in
CH.sub.2Cl.sub.2/CH.sub.3OH (10:1). MS/ES for
C.sub.l7H.sub.20N.sub.2O.sub.7, 364.4; Observed 364.9.
Example 73
5'-Dimethoxytrityl-2'-O-(2-methoxyphenyl)-5-methyluridine-3'-O-(2-cyanoeth-
yl-N,N-diisopropylamino) phosphoramidite
[0311] 2'-O-(guaiacolyl)-5-methyl-uridine is treated with 1.2
equivalents of dimethoxytrityl chloride (DMT-Cl) in pyridine to
yield the 5'-O-dimethoxy tritylated nucleoside. After evaporation
of the pyridine and work up (CH.sub.2Cl.sub.2/saturated NaHCO.sub.3
solution) the compound is purified in a silica gel column. The
5'-protected nucleoside is dissolved in anhydrous methylene
chloride and under argon atmosphere,
N,N-diisopropylaminohydro-tetrazolide (0.5 equivalents) and
bis-N,N-diisopropylamino-2-cyanoethyl-phosphoramidite (2
equivalents) are added via syringe over 1 min. The reaction mixture
is stirred under argon at room temperature for 16 hours and then
applied to a silica column. Elution with hexane:ethylacetate
(25:75) gives the title compound.
Example 74
5'-Dimethoxytrityl-2'-O-(2-methoxyphenyl)-5-methyluridine-3'-O-succinate
[0312] The 5'-protected nucleoside from Example 73 is treated with
2 equivalents of succinic anhydride and 0.2 equivalents of
4-N,N-dimethylaminopyridine in pyridine. After 2 hours the pyridine
is evaporated, the residue is dissolved in CH.sub.2Cl.sub.2 and
washed three times with 100 mL of 10% citric acid solution. The
organic layer is dried over anhydrous MgSO.sub.4 to give the
desired succinate. The succinate is then attached to controlled
pore glass (CPG) using established procedures (Pon, R. T., Solid
phase supports for oligonucleotide synthesis, in Protocols for
Oligonucleotides and Analogs, S. Agrawal (Ed.), Humana Press:
Totawa, N.J., 1993, 465-496).
Example 75
5'-Dimethoxytrityl-2'-O-(trans-2-methoxycyclohexyl)-5-methyl
uridine
[0313] 2'-3'-O-Dibutylstannyl-5-methyl uridine (Wagner et al., J.
Org. Chem., 1974, 39, 24) is alkylated with
trans-2-methoxycyclohexyl tosylate at 70.degree. C. in DMF. A 1:1
mixture of 2'-O- and
3'-O-(trans-2-methoxycyclohexyl)-5-methyluridine is obtained in
this reaction. After evaporation of the DMF solvent, the-crude
mixture is dissolved in pyridine and treated with
dimethoxytritylchloride (DMT-Cl) (1.5 equivalents). The resultant
mixture is purified by silica gel flash column chromatography to
give the title compound.
Example 76
5'-Dimethoxytrityl-2'-O-(trans-2-methoxycyclohexyl)-5-methyluridine-3'-O-(-
2-cyanoethyl-N,N-diisopropylamino) phosphoramidite
[0314] 5'-Dimethoxytrityl-2'-O-(trans-2-methoxycyclohexyl)-5-methyl
uridine is phosphitylated according to the procedure described
above to give the required phosphoramidite.
Example 77
5'-Dimethoxytrityl-2'-O-(trans-2-methoxycyclohexyl)-5-methyluridine-3'-O-(-
succinyl-amino) CPG
[0315] 5'-Dimethoxytrityl-2'-O-(trans-2-methoxycyclohexyl)-5-methyl
uridine is succinylated and attached to controlled pore glass to
give the solid support bound nucleoside.
Example 78
Trans-2-ureido-cyclohex
[0316] Trans-2-amino-cyclohexanol (Aldrich) is treated with
triphosgene in methylene chloride (1/3 equivalent). To the
resulting solution, excess ammonium hydroxide is added to give
after work up the title compound.
Example 79
2'-O-(trans-2-uriedo-cyclohexyl)-5-methyl uridine
[0317] Trans-2-uriedo-cyclohexanol (50 mmol) is added to a solution
of borane in tetrahydrofuran (1 M, 10 mL, 10 mmol) while stirring
in a 10 mL bomb. Hydrogen gas evolves as the reactant dissolves.
O2,2'-Anhydro-5-methyluridine (5 mmol) and sodium bicarbonate (2.5
mg) are added to the bomb and sealed. Then it is heated to 140 for
72 hrs. The bomb is cooled to room temperature and opened. The
crude material was worked up as illustrated above followed by
purification by silica gel flash column chromatography to give the
title compound.
Example 80
5'-O-(Dimethoxytrityl)-2'-O-(trans-2-uriedo-cyclohexyl)
3'-O-(2-cyanoethyl, N,N,-diisopropyl) uridine phosphoramidite
[0318] 2'-O-(trans-2-uriedo-cyclohexyl)-5-methyl uridine tritylated
at the 5'-OH and phosphitylated at the 3'-OH following the
procedures illustrated in example 2 to give the title compound.
Example 81
5'-O-dimethoxytrityl-2'-O-(trans-2-uriedo-cyclohexyl)-5-methyl-3'-O-(succi-
nyl)-amino CPG uridine
[0319]
5'-O-dimethoxytrityl-2'-O-(trans-2-uriedo-cyclohexyl)-5-methyl
uridine is succinylated and attached to CPG as illustrated
above.
Example 82
2'-O-(trans-2-methoxy-cyclohexyl) adenosine
[0320] Trans-2-methoxycyclopentanol, trans-2-methoxycylcohexanol,
trans-2-methoxy-cyclopentyl tosylate and trans-2-methoxy-cyclohexyl
tosylate are prepared according to reported procedures (Roberts, D.
D., Hendrickson, W., J. Org. Chem., 1967, 34, 2415-2417; J. Org.
Chem., 1997, 62, 1857-1859). A solution of adenosine (42.74 g, 0.16
mol) in dry dimethylformamide (800 mL) at 5.degree. C. is treated
with sodium hydride (8.24 g, 60% in oil prewashed thrice with
hexanes, 0.21 mol). After stirring for 30 min,
trans-2-methoxycyclohexyl tosylate (0.16 mol) is added over 20
minutes at 5.degree. C. The reaction is stirred at room temperature
for 48 hours, then filtered through Celite. The filtrate is
concentrated under reduced pressure followed by coevaporation with
toluene (2.times.100 mL) to give the title compound.
Example 83
N.sup.6-Benzoyl-2'-O-(trans-2-methoxycyclohexyl) adenosine
[0321] A solution of 2'-O-(trans-2-methoxy-cyclohexyl) adenosine
(0.056 mol) in pyridine (100 mL) is evaporated under reduced
pressure to dryness. The residue is redissolved in pyridine (560
mL) and cooled in an ice water bath. Trimethylsilyl chloride (36.4
mL, 0.291 mol) is added and the reaction is stirred at 5.degree. C.
for 30 minutes. Benzoyl chloride (33.6 mL, 0.291 mol) is added and
the reaction is allowed to warm to 25.degree. C. for 2 hours and
then cooled to 5.degree. C. The reaction is diluted with cold water
(112 mL) and after stirring for 15 min, concentrated ammonium
hydroxide (112 mL). After 30 min, the reaction is concentrated
under reduced pressure (below 30.degree. C.) followed by
coevaporation with toluene (2.times.100 mL). The residue is
dissolved in ethyl acetate-methanol (400 mL, 9:1) and the undesired
silyl by-products are removed by filtration. The filtrate is
concentrated under reduced pressure and purified by silica gel
flash column chromatography (800 g, chloroform-methanol 9:1).
Selected fractions are combined, concentrated under reduced
pressure and dried at 25.degree. C./0.2 mmHg for 2 h to give the
title compound.
Example 84
N.sup.6-Benzoyl-5'-O-(dimethoxytrityl)-2'-O-(trans-2-methoxycyclohexyl)
adenosine
[0322] A solution of
N.sup.6-benzoyl-2'-O-(trans-2-methoxycyclohexyl) adenosine (0.285
mol) in pyridine (100 mL) is evaporated under reduced pressure to
an oil. The residue is redissolved in dry pyridine (300 mL) and
4,4'-dimethoxytriphenylmethyl chloride (DMT-Cl, 10.9 g, 95%, 0.31
mol) added. The mixture is stirred at 25.degree. C. for 16 h and
then poured onto a solution of sodium bicarbonate (20 g) in ice
water (500 mL). The product is extracted with ethyl acetate
(2.times.150 mL). The organic layer is washed with brine (50 mL),
dried over sodium sulfate (powdered) and evaporated under reduced
pressure (below 40.degree. C.). The residue is chromatographed on
silica gel (400 g, ethyl acetate-hexane 1:1. Selected fractions
were combined, concentrated under reduced pressure and dried at
25.degree. C./0.2 mmHg to give the title compound.
Example 85
[N.sup.6-Benzoyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-(trans-2-methoxycyclohex-
yl) adenosine-3'-O-yl]-N,N-diisopropylamino-cyanoethoxy
phosphoramidite
[0323] Phosphitylation of
N.sup.6-benzoyl-5'-O-(dimethoxytrityl)-2'-O-(trans-2-methoxycyclohexyl)
adenosine was performed as illustrated above to give the title
compound.
Example 86
General procedures for chimeric C3'-endo and C2'-endo modified
oligonucleotide synthesis
[0324] Oligonucleotides are synthesized on a PerSeptive Biosystems
Expedite 8901 Nucleic Acid Synthesis System. Multiple 1-mmol
syntheses are performed for each oligonucleotide. The 3'-end
nucleoside containing solid support is loaded into the column.
Trityl groups are removed with trichloroacetic acid (975 mL over
one minute) followed by an acetonitrile wash. The oligonucleotide
is built using a modified diester (P.dbd.O) or thioate (P.dbd.S)
protocol.
[0325] Phosphodiester Protocol
[0326] All standard amidites (0.1 M) are coupled over a 1.5 minute
time frame, delivering 105 .mu.L material. All novel amidites are
dissolved in dry acetonitrile (100 mg of amidite/1 mL acetonitrile)
to give approximately 0.08-0.1 M solutions. The 2'-modified
amidites (both ribo and arabino monomers) are double coupled using
210 .mu.L over a total of 5 minutes. Total coupling time is
approximately 5 minutes (210 mL of amidite delivered).
1-H-tetrazole in acetonitrile is used as the activating agent.
Excess amidite is washed away with acetonitrile.
(1S)-(+)-(10-camphorsulfonyl) oxaziridine (CSO, 1.0 g CSO/8.72 mL
dry acetonitrile) is used to oxidize (3 minute wait step)
delivering approximately 375 .mu.L of oxidizer. Standard amidites
are delivered (210 .mu.L) over a 3-minute period.
[0327] Phosphorothioate Protocol
[0328] The 2'-modified amidite is double coupled using 210 .mu.L
over a total of 5 minutes. The amount of oxidizer,
3H-1,2-benzodithiole-3-one-1,1-dioxide (Beaucage reagent, 3.4 g
Beaucage reagent/200 mL acetonitrile), is 225 .mu.L (one minute
wait step). The unreacted nucleoside is capped with a 50:50 mixture
of tetrahydrofuran/acetic anhydride and
tetrahydrofuran/pyridine/1-methyl imidazole. Trityl yields are
followed by the trityl monitor during the duration of the
synthesis. The final DMT group is left intact. After the synthesis,
the contents of the synthesis cartridge (1 mmole) is transferred to
a Pyrex vial and the oligonucleotide is cleaved from the controlled
pore glass (CPG) using 30% ammonium hydroxide (NH.sub.4OH, 5 mL)
for approximately 16 hours at 55.degree. C.
[0329] Oligonucleotide Purification
[0330] After the deprotection step, the samples are filtered from
CPG using Gelman 0.45 .mu.m nylon acrodisc syringe filters. Excess
NH.sub.4OH is evaporated away in a Savant AS160 automatic speed
vac. The crude yield is measured on a Hewlett Packard 8452A Diode
Array Spectrophotometer at 260 nm. Crude samples are then analyzed
by mass spectrometry (MS) on a Hewlett Packard electrospray mass
spectrometer. Trityl-on oligonucleotides are purified by reverse
phase preparative high performance liquid chromatography (HPLC).
HPLC conditions are as follows: Waters 600E with 991 detector;
Waters Delta Pak C4 column (7.8.times.300 mm); Solvent A: 50 mM
triethylammonium acetate (TEA-Ac), pH 7.0; Solvent B: 100%
acetonitrile; 2.5 mL/min flow rate; Gradient: 5% B for first five
minutes with linear increase in B to 60% during the next 55
minutes. Fractions containing the desired product/s (retention
time=41 minutes for DMT-ON-16314; retention time=42.5 minutes for
DMT-ON-16315) are collected and the solvent is dried off in the
speed vac. Oligonucleotides are detritylated in 80% acetic acid for
approximately 60 minutes and lyophilized again. Free trityl and
excess salt are removed by passing detritylated oligonucleotides
through Sephadex G-25 (size exclusion chromatography) and
collecting appropriate samples through a Pharmacia fraction
collector. The solvent is again evaporated away in a speed vac.
Purified oligonucleotides are then analyzed for purity by CGE, HPLC
(flow rate: 1.5 mL/min; Waters Delta Pak C4 column, 3.9.times.300
mm), and MS. The final yield is determined by spectrophotometer at
260 nm.
Example 87
Rapid amplification of 5'-cDNA end (5'-RACE) and 3'-cDNA end
(3'-RACE)
[0331] An internet search of the XREF database in the National
Center of Biotechnology Information (NCBI) yielded a 361 base pair
(bp) human expressed sequenced tag (EST, GenBank accession
#H28861), homologous to yeast RNase H (RNH1) protein sequenced tag
(EST, GenBank accession #Q04740) and its chicken homologue
(accession #D26340). Three sets of oligonucleotide primers encoding
the human RNase H EST sequence were synthesized. The sense primers
were ACGCTGGCCGGGAGTCGAAATGCTTC (H1: SEQ ID NO: 6),
CTGTTCCTGGCCCACAGAGTCGCCTTGG (H3: SEQ ID NO: 7) and
GGTCTTTCTGACCTGGAATGAGTGCAGAG (H5: SEQ ID NO: 8). The antisense
primers were CTTGCCTGGTTTCGCCCTCCGATTCTTGT (H2: SEQ ID NO: 9),
TTGATTTTCATGCCCTTCTGAAACTTCCG (H4; SEQ ID NO: 10) and
CCTCATCCTCTATGGCAAACTTCTTAAATCTGGC (H6; SEQ ID NO: 11). The human
RNase H 3' and 5' cDNAs derived from the EST sequence were
amplified by polymerase chain reaction (PCR), using human liver or
leukemia (lymphoblastic Molt-4) cell line Marathon ready cDNA as
templates, H1 or H3/AP1 as well as H4 or H6/AP2 as primers
(Clontech, Palo Alto, Calif.). The fragments were subjected to
agarose gel electrophoresis and transferred to nitrocellulose
membrane (Bio-Rad, Hercules Calif.) for confirmation by Southern
blot, using .sup.32P-labeled H2 and H1 probes (for 3' and 5' RACE
products, respectively, in accordance with procedures described by
Ausubel et al., Current Protocols in Molecular Biology, Wiley and
Sons, New York, N.Y., 1988. The confirmed fragments were excised
from the agarose gel and purified by gel extraction (Qiagen,
Germany), then subcloned into Zero-blunt vector (Invitrogen,
Carlsbad, Calif.) and subjected to DNA sequencing.
Example 88
Screening of the cDNA Library, DNA Sequencing and Sequence
Analysis
[0332] A human liver cDNA lambda phage Uni-ZAP library (Stratagene,
La Jolla, Calif.) was screened using the RACE products as specific
probes. The positive cDNA clones were excised into the pBluescript
phagemid (Stratagene, La Jolla Calif.) from lambda phage and
subjected to DNA sequencing with an automatic DNA sequencer
(Applied Biosystems, Foster City, Calif.) by Retrogen Inc. (San
Diego, Calif.). The overlapping sequences were aligned and combined
by the assembling programs of MacDNASIS v3.0 (Hitachi Software
Engineering America, South San Francisco, Calif.). Protein
structure and subsequence analysis were performed by the program of
MacVector 6.0 (Oxford Molecular Group Inc., Campbell, Calif.). A
homology search was performed on the NCBI database by internet
E-mail.
Example 89
Northern Blot and Southern Blot Analysis
[0333] Total RNA from different human cell lines (ATCC, Rockville,
Md.) was prepared and subjected to formaldehyde agarose gel
electrophoresis in accordance with procedures described by Ausubel
et al., Current Protocols in Molecular Biology, Wiley and Sons, New
York, N.Y., 1988, and transferred to nitrocellulose membrane
(Bio-Rad, Hercules Calif.). Northern blot hybridization was carried
out in QuickHyb buffer (Stratagene, La Jolla, Calif.) with
.sup.32P-labeled probe of full length RNase H cDNA clone or primer
H1/H2 PCR-generated 322-base N-terminal RNase H cDNA fragment at
68.degree. C. for 2 hours. The membranes were washed twice with
0.1% SSC/0.1% SDS for 30 minutes and subjected to auto-radiography.
Southern blot analysis was carried out in 1.times.
pre-hybridization/hybridization buffer (BRL, Gaithersburg, Md.)
with a .sup.32P-labeled 430 bp C-terminal restriction enzyme
PstI/PvuII fragment or 1.7 kb full length cDNA probe at 60.degree.
C. for 18 hours. The membranes were washed twice with 0.1% SSC/0.1%
SDS at 60.degree. C. for 30 minutes, and subjected to
autoradiography.
Example 90
Expression and Purification of the Cloned RNase Protein
[0334] The cDNA fragment coding the full RNase H protein sequence
was amplified by PCR using 2 primers, one of which contains
restriction enzyme NdeI site adapter and six histidine (his-tag)
codons and 22 bp protein N terminal coding sequence. The fragment
was cloned into expression vector pETI 7b (Novagen, Madison, Wis.)
and confirmed by DNA sequencing. The plasmid was transfected into
E.coli BL21 (DE3) (Novagen, Madison, Wis.). The bacteria were grown
in M9ZB medium at 32EC and harvested when the OD.sub.600 of the
culture reached 0.8, in accordance with procedures described by
Ausubel et al., Current Protocols in Molecular Biology, Wiley and
Sons, New York, N.Y., 1988. Cells were lysed in 8M urea solution
and recombinant protein was partially purified with Ni-NTA agarose
(Qiagen, Germany). Further purification was performed with C4
reverse phase chromatography (Beckman, System Gold, Fullerton,
Calif.) with 0.1% TFA water and 0.1% TFA acetonitrile gradient of
0% to 80% in 40 minutes as described by Deutscher, M. P., Guide to
Protein Purification, Methods in Enzymology 182, Academic Press,
New York, N.Y., 1990. The recombinant proteins and control samples
were collected, lyophilized and subjected to 12% SDS-PAGE as
described by Ausubel et al. (1988) Current Protocols in Molecular
Biology, Wiley and Sons, New York, N.Y. The purified protein and
control samples were resuspended in 6 M urea solution containing 20
mM Tris HCl, pH 7.4, 400 mM NaCl, 20% glycerol, 0.2 mM PMSF, 5 mM
DTT, 10 .mu.g/ml aprotinin and leupeptin, and refolded by dialysis
with decreasing urea concentration from 6 M to 0.5 M as well as DTT
concentration from 5 mM to 0.5 mM as described by Deutscher, M. P.,
Guide to Protein Purification, Methods in Enzymology 182, Academic
Press, New York, N.Y., 1990. The refolded proteins were
concentrated (10 fold) by Centricon (Amicon, Danvers, Mass.) and
subjected to RNase H activity assay.
Example 91
RNase H Activity Assay
[0335] .sup.32P-end-labeled 17-mer RNA, GGGCGCCGTCGGTGTGG (SEQ ID
NO: 12) described by Lima, W. F. and Crooke, S. T., Biochemistry,
1997 36, 390-398, was gel-purified as described by Ausubel et al.,
Current Protocols in Molecular Biology, Wiley and Sons, New York,
N.Y., 1988 and annealed with a tenfold excess of its complementary
17-mer oligodeoxynucleotide or a 5-base DNA gapmer, i.e., a 17 mer
oligonucleotide which has a central portion of 5 deoxynucleotides
(the "gap") flanked on both sides by 6 2'-methoxynucleotides.
Annealing was done in 10 mM Tris HCl, pH 8.0, 10 mM MgCl, 50 mM KCl
and 0.1 mM DTT to form one of three different substrates: (a)
single strand (ss) RNA probe, (b) full RNA/DNA duplex and (c)
RNA/DNA gapmer duplex. Each of these substrates was incubated with
protein samples at 37.degree. C. for 5 minutes to 2 hours at the
same conditions used in the annealing procedure and the reactions
were terminated by adding EDTA in accordance with procedures
described by Lima, W. F. and Crooke, S. T., Biochemistry, 1997, 36,
390-398. The reaction mixtures were precipitated with TCA
centrifugation and the supernatant was measured by liquid
scintillation counting (Beckman LS6000IC, Fullerton, Calif.). An
aliquot of the reaction mixture was also subjected to denaturing (8
M urea) acrylamide gel electrophoresis in accordance with
procedures described by Lima, W. F. and Crooke, S. T.,
Biochemistry, 1997, 36, 390-398 and Ausubel et al., Current
Protocols in Molecular Biology, Wiley and Sons, New York, N.Y.,
1988.
Example 92
Effects of Phosphorothioate Substitution and Substrate Length on
Digestion by Human RNase H1 (See Table 4)
[0336] Oligoribonucleotides were preannealed with the complementary
antisense oligodeoxynucleotide at 10 nM and 20 nM respectively and
subjected to digestion by Human RNase H1. The 17 mer (RNA no.1) and
25 mer (RNA no.3) RNA sequences are derived from Harvy-RAS oncogen
51) and the 25 mer RNA contains the 17 mer sequence. The 20 mer
(RNA no.2) sequence is derived from human hepatitis C virus core
protein coding sequence (52). The initial rates were determined as
described in Materials and Methods, 1A: Comparison of the initial
rates of cleavage of an RNA:phosphodiester (P.dbd.O) and an
RNA:phosphorothioate (P.dbd.S) duplexes, and 1B: Comparison among
duplexes of different sequences and lengths.
Example 93
Effects of 2'-Substitution and Deoxy-Gap Size on Digestion Rates by
Human RNase H1 (See Table 5)
[0337] Substrate duplexes were hybridized and initial rates were
determined as shown in Table 4 and described in Material and
Methods. The 17 mer RNA is the same used in Table 4, and the 20 mer
RNA (UGGUGGGCAAUGGGCGUGUU, RNA no.4) is derived from the protein
kinase C-zeta (53) sequence. The 17 mer and 20 mer P.dbd.S
oligonucleotides were full deoxyphosphorothioate containing no
2'-modifications. The 9, 7, 5, 4 and 3 deoxy gap oligonucleotides
were 17 mer oligonucleotide with a central portion consisting of
nine, seven, five and four deoxynucleotides flanked on both sides
by 2'-methoexynucleotides (also see FIG. 2). Boxed sequences
indicate the position of the 2'-methoxy-modified residues.
Dash-boxed sequence indicates the position of the
2'-propoxy-modified residues.
Example 94
Kinetic Constants for RNase H1 Cleavage of RNA:DNA Duplexes (See
Table 6)
[0338] The RNA:DNA duplexes in Table 4 were used to determine Km
and Vmax of Human and E.coli RNase H1 as described in the Materials
and Methods section.
Example 95
Binding Constants and Specificity of RNase H's (See Table 7)
[0339] K.sub.d's were determined as described in Materials and
methods. The K.sub.d's for E. coli RNase H1 was derived from
previously reported data (21). The competing substrates
(competitive inhibitors) used in the binding study are divided into
two categories: single-strand (ss) oligonucleotides and
oligonucleotide duplexes all with the 17 mer sequence as in Table 4
(RNA No. 1). The single-strand oligonucleotides included: ssRNA,
ssDNA, ss fully modified 2'-methoxy phosphodiester oligonucleotide
(ss 2'-O-Me) and ss full phosphorothioate deoxyoligonucleotide (ss
DNA, P.dbd.S). The duplex substrates include: DNA:DNA duplex,
RNA:RNA duplex, DNA:fully modified 2' fluoro or fully modified
2'-methoxy oligonucleotide (DNA: 2'-F or 2'-O-Me), RNA: 2'-F or
2'-O-Me duplex. Dissociation constants are derived from 3 slopes of
Lineweaver-Burk and /or Augustisson analysis. Estimated errors for
the dissociation constants are 2 fold. Specificity is defined by
dividing the K.sub.d for a duplex by the K.sub.d for an RNA:RNA
duplex. TABLE-US-00014 TABLE 4 A RNA Anitsense Initial Rate 1
GGGCGCCGUCGGUGU 17 mer 1050 .+-. 203 GG P.dbd.O 1 GGGCGCCGUCGGUGU
17 mer 4034 .+-. 266 GG P.dbd.S B Initial Rate RNA Antisense (pmol
No. RNA DNA L.sup.-1 min.sup.-1) 1 GGGCGCCGUCGGUGUGG 17 mer 1050
.+-. 203 (SEQ ID NO: 21) P.dbd.O 2 ACUCCACCAUAGUACACUCC 20 mer 1015
.+-. 264 (SEQ ID NO: 22) P.dbd.O 3 UGGUGGGCGCCGUCGGUGUGGCAA 25 mer
1502 .+-. 182 (SEQ ID NO: 23) P.dbd.O
[0340] TABLE-US-00015 TABLE 5 Initial Rate RNA (pmol No. RNA
Antisense DNA L.sup.-1 min.sup.-1) 1 17 mer CCACACCGACGGCGCCC 4034
.+-. 266 (SEQ ID NO: 24) 17 mer CCACACCGACGGCGCCC 1081 .+-. 168 17
mer CCACACCGACGGCGCCC 605 .+-. 81 17 mer CCACACCGACGGCGCCC 330 .+-.
56 17 mer CCACACCGACGGCGCCC 0 17 mer CCACACCGACGGCGCCC 0 17 mer
CCACACCGACGGCGCCC 0 4* 20 mer AACACGCCCATTGCCCACCA 3400 .+-. 384
(SEQ ID NO: 25) 20 mer AACACGCCCATTGCCCACCA 0 *Table legend for
sequence
[0341] TABLE-US-00016 TABLE 6 E. coli Human RNase H1 RNase H Vmax
Km (nmol Km (nmol Substrates (nM) L.sup.-1 min.sup.-1) (nM)
L.sup.-1 min.sup.-1) 25 mer Ras 35.4 1.907 (RNA no.3): DNA
(P.dbd.O) 17 mer Ras 56.1 1.961 385 38.8 (RNA no.1): DNA (P.dbd.O)
17 mer Ras 13.9 1.077 (RNA no.1): DNA (P.dbd.S)
[0342] TABLE-US-00017 TABLE 7 Human RNase H E. Coli RNase H1
Inhibitors Kd(nM) Specificity Kd(nM) Specificity DNA: 2'-O-Me 458
5.8 3400 2.1 RNA: 2'-O-Me 409 5.2 3100 1.9 RNA: RNA 79 1.0 1600 1.0
RNA: 2'-F 76 1.0 DNA: 2'-F 99 1.3 DNA: DNA 3608 45.7 176000 110.0
ssRNA 1400 17.7 ssDNA 1506 19.6 942000 588.8 ss2'-O-Me 2304 29.2
118000 73.8 ssDNA, P.dbd.S 36 0.5 14000 8.8
Procedures Procedure 1 ICAM-1 Expression
[0343] Oligonucleotide Treatment of HUVECs
[0344] Cells were washed three times with Opti-MEM (Life
Technologies, Inc.) prewarmed to 37.degree. C. Oligonucleotides
were premixed with 10 g/mL Lipofectin (Life Technologies, Inc.) in
Opti-MEM, serially diluted to the desired concentrations, and
applied to washed cells. Basal and untreated (no oligonucleotide)
control cells were also treated with Lipofectin. Cells were
incubated for 4 h at 37.degree. C., at which time the medium was
removed and replaced with standard growth medium with or without 5
mg/mL TNF-7 & D Systems). Incubation at 37.degree. C. was
continued until the indicated times.
[0345] Quantitation of ICAM-1 Protein Expression by
Fluorescence-activated Cell Sorter
[0346] Cells were removed from plate surfaces by brief
trypsinization with 0.25% trypsin in PBS. Trypsin activity was
quenched with a solution of 2% bovine serum albumin and 0.2% sodium
azide in PBS (+Mg/Ca). Cells were pelleted by centrifugation (1000
rpm, Beckman GPR centrifuge), resuspended in PBS, and stained with
3 1/10.sup.5 cells of the ICAM-1 specific antibody, CD54-PE
(Pharmingin). Antibodies were incubated with the cells for 30 min
at 4C in the dark, under gently agitation. Cells were washed by
centrifugation procedures and then resuspended in 0.3 mL of
FacsFlow buffer (Becton Dickinson) with 0.5% formaldehyde
(Polysciences). Expression of cell surface ICAM-1 was then
determined by flow cytometry using a Becton Dickinson FACScan.
Percentage of the control ICAM-1 expression was calculated as
follows: [(oligonucleotide-treated ICAM-1 value)--(basal ICAM-1
value)/(non-treated ICAM-1 value)--(basal ICAM-1 value)]. (Baker,
Brenda, et. al. 2'-O-(2-Methoxy)ethyl-modified Anti-intercellular
Adhesion Molecule 1 (ICAM-1) Oligonucleotides Selectively Increase
the ICAM-1 mRNA Level and Inhibit Formation of the ICAM-1
Translation Initiation Complex in Human Umbilical Vein Endothelial
Cells, The Journal of Biological Chemistry, 272, 11994-12000,
1997.)
[0347] ICAM-1 expression of chimeric C3'-endo and C2'-endo modified
oligonucleotides of the invention is measured by the reduction of
ICAM-1 levels in treated HUVEC cells. The oligonucleotides are
believed to work by RNase H cleavage mechanism. Appropriate
scrambled control oligonucleotides are used as controls. They have
the same base composition as the test sequence.
[0348] Sequences that contain the chimeric C3'-endo (2'-MOE)and
C2'-endo (one of the following modifications: 2'-S-Me, 2'-Me,
2'-ara-F,2'-ara-OH, 2'-ara-O-Me) as listed in Table X below are
prepared and tested in the above assay. SEQ ID NO: 43, a C-raf
targeted oligonucleotide, is used as a control. TABLE-US-00018
TABLE X Oligonucleotides Containing chimeric 2'-O-(2-methoxyethyl)
and 2'-S-(methyl) modifications. SEQ ID NO: Sequence (5'-3') Target
43 AsTsGs C.sup.msAsTs TsCs.sup.mTs GsCs.sub.m mouse Cs.sup.m
Cs.sup.mC.sup.msC.sup.ms AsAsGs GsA C-raf 44 GsC.sup.msC.sup.ms
C.sup.msAsAs GsC.sup.msTs Human GsGsC.sup.ms ASTsC.sup.mS
C.sup.msGSTs ICAM-1 C.sup.mSA All nucleosides in bold are
2'-O-(methoxyethyl); subscript s indicates a phosphorothioate
linkage; underlined nucleosides indicate 2'-S-Me- modification.
superscript m on C (Cm)indicates a 5-methyl-C.
[0349] TABLE-US-00019 TABLE XI Oligonucleotides Containing chimeric
2'-O-(2-methoxyethyl) and 2'-O-(methyl) modifications SEQ ID NO:
Sequence (5'-3') Target 43 AsTsGs C.sup.msAsTs TsCs.sup.mTs Mouse
GsCs.sup.mCs.sup.m Cs.sup.mC.sup.msC.sup.ms AsAsGs C-raf GsA 44
GsC.sup.msC.sup.ms C.sup.msAsAs GsC.sup.msTs Human GsGsC.sup.ms
ASTsC.sup.mS C.sup.msGSTs ICAM-1 C.sup.mSA All nucleosides in bold
are 2'-O-(methoxyethyl); subscript s indicates a phosphorothioate
linkage; underlined nucleosides indicate 2'-Methyl modification.
Superscript m on C (Cm)indicates a 5-methyl-C.
[0350] TABLE-US-00020 TABLE XII Oligonucleotides Containing
chimeric 2'-O-(2-methoxyethyl) and 2'-ara-(fluoro) modifications
SEQ ID NO: Sequence (5'-3') Target 43 AsTsGs C.sup.msAsTs
TsCs.sup.mTs mouse GsCs.sup.mCs.sup.m Cs.sup.mC.sup.msC.sup.ms
AsAsGs C-raf GsA 44 GsC.sup.msC.sup.ms C.sup.msAsAs GsC.sup.msTs
human GsGsC.sup.ms ASTsC.sup.mS C.sup.msGSTs ICAM-1 C.sup.mSA All
nucleosides in bold are 2'-O-(methoxyethyl); subscript s indicates
a phosphorothioate linkage; underlined nucleosides indicate
2'-ara-(fluoro) modification. superscript m on C (Cm)indicates a
5-methyl-C.
[0351] TABLE-US-00021 TABLE XIII Oligonucleotides Containing
chimeric 2'-O-(2-methoxyethyl) and 2'-ara-(OH) modifications SEQ ID
NO: Sequence (5'-3') Target 43 AsTsGs C.sup.msAsTs TsCs.sup.mTs
mouse GsCs.sup.mCs.sup.m Cs.sup.mC.sup.msC.sup.ms AsAsGs C-raf GsA
44 GsC.sup.msC.sup.ms C.sup.msAsAs GsC.sup.msTs human GsGsC.sup.ms
ASTsC.sup.mS C.sup.msGSTs ICAM-1 C.sup.mSA All nucleosides in bold
are 2=-O-(methoxyethyl); subscript s indicates a phosphorothioate
linkage; underlined nucleosides indicate 2'-ara-(OH) modification.
superscript m on C (Cm)indicates a 5-methyl-C.
[0352] TABLE-US-00022 TABLE XIV Oligonucleotides Containing
chimeric 2'-O-(2-methoxyethyl) and 2'-ara-(OMe) modifications SEQ
ID NO: Sequence (5'-3') Target 43 AsTsGs C.sup.msAsTs TsCs.sup.mTs
mouse GsCs.sup.mCs.sup.m Cs.sup.mC.sup.msC.sup.ms AsAsGs C-raf GsA
44 GsC.sup.msC.sup.ms C.sup.msAsAs GsC.sup.msTs human GsGsC.sup.ms
ASTsC.sup.mS C.sup.msGSTs ICAM-1 C.sup.mSA All nucleosides in bold
are 2=-O-(methoxyethyl); subscript S indicates a phosphorothioate
linkage; underlined nucleosides indicate 2'-ara-(OMe) modification.
superscript m on C (C.sup.m)indicates a 5-methyl-C.
Procedure 2 Enzymatic Degradation of 2'-O-Modified
Oligonucleotides
[0353] Three oligonucleotides are synthesized incorporating the
modifications shown in Table 2 below at the 3'-end. These modified
oligonucleotides are subjected to snake venom phosphodiesterase
action.
[0354] Oligonucleotides (30 nanomoles) are dissolved in 20 mL-of
buffer containing 50 mM Tris-HCl pH 8.5, 14 mM MgCl.sub.2, and 72
mM NaCl. To this solution 0.1 units of snake-venom
phosphodiesterase (Pharmacia, Piscataway, N.J.), 23 units of
nuclease P1 (Gibco LBRL, Gaithersberg, Md.), and 24 units of calf
intestinal phosphatase (Boehringer Mannheim, Indianapolis, Ind.)
are added and the reaction mixture is incubated at 37C for 100
hours. HPLC analysis is carried out using a Waters model 715
automatic injector, model 600E pump, model 991 detector, and an
Alltech (Alltech Associates, Inc., Deerfield, Ill.)
nucleoside/nucleotide column (4.6.times.250 mm). All analyses are
performed at room temperature. The solvents used are A: water and
B: acetonitrile. Analysis of the nucleoside composition is
accomplished with the following gradient: 0-5 min., 2% B
(isocratic); 5-20 min., 2% B to 10% B (linear); 20-40 min., 10% B
to 50% B. The integrated area per nanomole is determined using
nucleoside standards. Relative nucleoside ratios are calculated by
converting integrated areas to molar values and comparing all
values to thymidine, which is set at its expected value for each
oligomer. TABLE-US-00023 TABLE XV Relative Nuclease Resistance of
2'-Modified Chimeric Oligonucleotides 5'-TTT TTT TTT TTT TTT
T*T*T*T*-3' SEQ ID NO 45 (Uniform phosphodiester) T* = 2'-modified
T -S-Me -Me -2'-ara-(F) -2'-ara-(OH) -2'-ara-(OMe)
Procedure 3 General Procedure for the Evaluation of Chimeric
C3'-Endo and C2'-Endo Modified Oligonucleotides Targeted to
Ha-ras
[0355] Different types of human tumors, including sarcomas,
neuroblastomas, leukemias and lymphomas, contain active oncogenes
of the ras gene family. Ha-ras is a family of small molecular
weight GTPases whose function is to regulate cellular proliferation
and differentiation by transmitting signals resulting in
constitutive activation of ras are associated with a high
percentage of diverse human cancers. Thus, ras represents an
attractive target for anticancer therapeutic strategies.
[0356] SEQ ID NO: 46 is a 20-base phosphorothioate
oligodeoxynucleotide targeting the initiation of translation region
of human Ha-ras and it is a potent isotype-specific inhibitor of
Ha-ras in cell culture based on screening assays (IC.sub.50=45 nm).
Treatment of cells in vitro with SEQ ID NO: 46 results in a rapid
reduction of Ha-ras mRNA and protein synthesis and inhibition of
proliferation of cells containing an activating Ha-ras mutation.
When administered at doses of 25 mg/kg or lower by daily
intraperitoneal injection (IP), SEQ ID NO: 46 exhibits potent
antitumor activity in a variety of tumor xenograft models, whereas
mismatch controls do not display antitumor activity. SEQ ID NO: 46
has been shown to be active against a variety of tumor types,
including lung, breast, bladder, and pancreas in mouse xenograft
studies (Cowsert, L. M. Anti-cancer drug design, 1997, 12,
359-371). A second-generation analog of SEQ ID NO: 46, where the 5'
and 3' termini ("wings") of the sequence are modified with
2'-methoxyethyl (MOE) modification and the backbone is kept as
phosphorothioate (Table XV, SEQ ID NO: 52), exhibits IC.sub.50 of
15 nm in cell culture assays. thus, a 3-fold improvement in
efficacy is observed from this chimeric analog. Because of the
improved nuclease resistance of the 2'-MOE phosphorothioate, SEQ ID
NO: 52 increases the duration of antisense effect in vitro. This
will relate to frequency of administration of this drug to cancer
patients. SEQ ID NO: 52 is currently under evaluation in ras
dependent tumor models (Cowsert, L. M. Anti-cancer drug design,
1997, 12, 359-371). The parent compound, SEQ ID NO: 46, is in Phase
I clinical trials against solid tumors by systemic infusion.
[0357] Antisense oligonucleotides having the 2'-Me modification are
prepared and tested in the aforementioned assays in the manner
described to determine activity.
[0358] Ha-ras Antisense Oligonucleotides With chimeric C3'-endo and
C2'-endo modifications and Their Controls. TABLE-US-00024 TABLE XV
Ha-ras Antisense Oligonucleotides With chimeric C3'-endo and
C2'-endo modifications and Their Controls. Back- 2'- SEQ Sequence
ID NO: bone Modif. Comments 46 5'-TsCsCs GsTsCs P.dbd.S 2'-H parent
AsTsCs GsCsTs CsCsTs CsAsGs GsG-3' 47 5'-TsCsAs GsTsAs AsTsAs
P.dbd.S 2'-H mismatch GsGsCs CsCsAs CsAsTs control GsG-3' 48
5'-ToToCo GsTsCs AsTsCs P.dbd.O/ 2'-O-Moe Parent GsCsTs CoCoTo
CoAoGo P.dbd.S/ in wings Gapmer GoG-3' P.dbd.O (Mixed back- bone)
49 5'-TsCsCs GsTsCs AsTsCs P.dbd.S 2'-O-MOE Parent GsCsTs CsCsTs
CsAsGs in wings Gapmer GsG-3' as Uniform thioate 50 5'-ToCoAo
GsTsAs AsTsAs P.dbd.O/ 2'-O-MOE Parent GsCsCs GsCsCs GsCoCo
P.dbd.S/ in wings Gapmer CoCoAo CoAoTo GoG-3' P.dbd.O (mixed Back-
bone) 51 5'-TsCsAs GsTsAs AsTs P.dbd.S 2'-O-MOE Control As GsCsCs
GsCsCs in wings Gapmer CsCsAs CsAsTs GsC-3' as Uniform Thioate 52
5'-TsCsCs GsTsCs AsTsCs P.dbd.S 2'-O-MOE Control GsCsTs CsCsTs
CsAsGs in wings Gapmer GsG-3' With MOE Control 53 5'-TsCsAs GsTsAs
AsTsAs P.dbd.S 2'-O-MOE Control GsCsCs GsCsCs CsCsAs in wings
Gapmer CsAsTs GsC-3' With MOE Control All underlined portions of
sequences are 2'-Me.
Procedure 7 In vivo Nuclease Resistance
[0359] The in vivo Nuclease Resistance of chimeric C3'-endo and
C2'-endo modified oligonucleotides is studied in mouse plasma and
tissues (kidney and liver). For this purpose, the C-raf
oligonucleotide series SEQ ID NO: 54 are used and the following
five oligonucleotides listed in the Table below will be evaluated
for their relative nuclease resistance. TABLE-US-00025 TABLE XVI
Study of in vivo Nuclease Resistance of chimeric C3'-endo
(2'-O-MOE) and C2'-endo (2'-S-Me) modified oligonucleotides with
and without nuclease resistant caps (2'-5'-phosphate or
phosphorothioate linkage with 3'-O-MOE in cap ends). SEQ ID Back-
NO: Sequence bone Description 54 5'-ATG CAT TCT GCC P.dbd.S,
(control) CCA AGGA-3' 2'-H rodent C-raf antisense oligo 55 AoToGo
CoAsTs TsCsTs P.dbd.O/ 2'-MOE/2'-S-Me/ GsCsCs CsCsAo AoGoGo
P.dbd.S/ 2'-MOE A P.dbd.O 56 AsTsGs CsAsTs TsCsTs P.dbd.S
2'-MOE/2'-S-Me/ GsCsCs CsCsAs AsGsGs 2'-MOE A 57 Ao*ToGo CoAsTs
TsCsTs P.dbd.O/ In asterisk, GsCsCs CsCsAo AoGoGo P.dbd.S/ 2'-5'
linkage with *A P.dbd.O 3'-O-MOE; 2'-O-MOE/ 2'-S-Me/2'-O-MOE/ 2'-5'
linkage with 3'-O-MOE in asterisk 58 As*TsGs CsAsTs TsCsTs P.dbd.S
In asterisk, GsCsCs CsCsAs AsGsGs 2'-5' linkage with *A 3'-O-MOE;
2'-O-MOE/ 2'-S-Me/2'-O-MOE/ 2'-5' linkage with 3'-O-MOE in
asterisk
[0360] TABLE-US-00026 TABLE XVII Study of in vivo Nuclease
Resistance of chimeric C3'-endo (2'-O-MOE) and C2'-endo (2'-Me)
modified oligonucleotides with and without nuclease resistant caps
(2'-5'-phosphate or phosphoro- thioate linkage with 3'-O-MOE in cap
ends). SEQ ID Back- NO: Sequence bone Description 54 5'-ATG CAT TCT
GCC P.dbd.S, (control) CCA AGGA-3' 2'-H rodent C-raf antisense
oligo 55 AoToGo CoAsTs TsCsTs P.dbd.O/ 2'-MOE/2'-Me/ GsCsCs CsCsAo
AoGoGo P.dbd.S/ 2'-MOE A' P.dbd.O 56 AsTsGs CsAsTs TsCsTs P.dbd.S
2'-MOE/2'-Me/ GsCsCs CsCsAs AsGsGs 2'-MOE A 57 Ao*ToGo CoAsTs
P.dbd.O/ In asterisk, TsCsTs GsCsCs CsCsAo P.dbd.S/ 2'-5' linkage
with AoGoGo *A P.dbd.O 3'-O-MOE; 2'-O-MOE/ 2'-Me/2'-O-MOE/ 2'-5'
linkage with 3'-O-MOE in asterisk 58 As*TsGs CsAsTs P.dbd.S In
asterisk, TsCsTs GsCsCs CsCsAs 2'-5' linkage with AsGsGs *A
3'-O-MOE; 2'-O-MOE/ 2'-Me/2'-O-MOE/ 2'-5' linkage with 3'-O-MOE in
asterisk
[0361] TABLE-US-00027 TABLE XVIII Study of in vivo Nuclease
Resistance of chimeric C3'-endo (2'-O-MOE) and C2'-endo (2'-ara-F)
modified oligonucleotides with and without nuclease resistant caps
(2'-5'-phosphate or phosphorothioate linkage with 3'-O-MOE in cap
ends). SEQ ID Back- NO: Sequence bone Description 54 5'-ATG CAT TCT
GCC P.dbd.S, (control) CCA AGGA-3' 2'-H rodent C-raf antisense
oligo 55 AoToGo CoAsTs TsCsTs P.dbd.O/ 2'-MOE/2'-ara-F/ GsCsCs
CsCsAo AoGoGo P.dbd.S/ 2'-MOE A' P.dbd.O 56 AsTsGs CsAsTs TsCsTs
P.dbd.S 2'-MOE/2'-ara-F/ GsCsCs CsCsAs AsGsGs 2'-MOE A 57 Ao*ToGo
CoAsTs TsCsTs P.dbd.O/ In asterisk, GsCsCs CsCsAo AoGoGo P.dbd.S/
2'-5' linkage with *A P.dbd.O 3'-O-MOE; 2'-O-MOE/
2'-ara-F/2'-O-MOE/ 2'-5' linkage with 3'-O-MOE in asterisk 58
As*TsGs CsAsTs TsCsTs P.dbd.S In asterisk, GsCsCs CsCsAs AsGsGs
2'-5' linkage with *A 3'-O-MOE; 2'-O-MOE/ 2'-ara-F/2'-O-MOE/ 2'-5'
linkage with 3'-O-MOE in asterisk
[0362] TABLE-US-00028 TABLE XIX Study of in vivo Nuclease
Resistance of chimeric C3'-endo (2'-O-MOE) and C2'-endo (2'-ara-OH)
modified oligonucleotides with and without nuclease resistant caps
(2'-5'-phosphate or phosphorothioate linkage with 3'-O-MOE in cap
ends). SEQ ID Back- NO: Sequence bone Description 54 5'-ATG CAT TCT
GCC P.dbd.S, (control) CCA AGGA-3' 2'-H rodent C-raf antisense
oligo 55 AoToGo CoAsTs TsCsTs P.dbd.O/ 2'-MOE/2'-ara-OH/ GsCsCs
CsCsAo AoGoGo P.dbd.S/ 2'-MOE A' P.dbd.O 56 AsTsGs CsAsTs TsCsTs
P.dbd.S 2'-MOE/2'-ara-OH/ GsCsCs CsCsAs AsGsGs 2'-MOE A 57 Ao*ToGo
CoAsTs TsCsTs P.dbd.O/ In asterisk, GsCsCs CsCsAo AoGoGo P.dbd.S/
2'-5' linkage with *A P.dbd.O 3'-O-MOE; 2'-O-MOE/
2'-ara-OH/2'-O-MOE/ 2'-5' linkage with 3'-O-MOE in asterisk 58
As*TsGs CsAsTs TsCsTs P.dbd.S In asterisk, GsCsCs CsCsAs AsGsGs
2'-5' linkage with *A 3'-O-MOE; 2'-O-MOE/ 2'-ara-OH/2'-O-MOE/ 2'-5'
linkage with 3'-O-MOE in asterisk
[0363] TABLE-US-00029 TABLE XX Study of in vivo Nuclease Resistance
of chimeric C3'-endo (2'-O-MOE) and C2'-endo (2'-ara-OMe) modified
oligonucleotides with and without nuclease resistant caps
(2'-5'-phosphate or phosphorothioate linkage with 3'-O-MOE in cap
ends). SEQ ID Back- NO: Sequence bone Description 54 5'-ATG CAT TCT
GCC P.dbd.S, (control) CCA AGGA-3' 2'-H rodent C-raf antisense
oligo 55 AoToGo CoAsTs TsCsTs P.dbd.O/ 2'-MOE/2'-ara-OMe/ GsCsCs
CsCsAo AoGoGo P.dbd.S/ 2'-MOE A' P.dbd.O 56 AsTsGs CsAsTs TsCsTs
P.dbd.S 2'-MOE/2'-ara-OMe/ GsCsCs CsCsAs AsGsGs 2'-MOE A 57 Ao*ToGo
CoAsTs TsCsTs P.dbd.O/ In asterisk, GsCsCs CsCsAo AoGoGo P.dbd.S/
2'-5' linkage with *A P.dbd.O 3'-O-MOE; 2'-O-MOE/ 2'-ara-OMe/2'-O-
MOE/2'-5' linkage with 3'-O-MOE in asterisk 58 As*TsGs CsAsTs
TsCsTs P.dbd.S In asterisk, GsCsCs CsCsAs AsGsGs 2'-5' linkage with
*A 3'-O-MOE; 2'-O-MOE/ 2'-ara-OMe/2'-O- MOE/2'-5' linkage with
3'-O-MOE in asterisk
Procedure 8 Animal Studies for in vivo Nuclease Resistance
[0364] For each oligonucleotide to be studied, 9 male BALB/c mice
(Charles River, Wilmington, Mass.), weighing about 25 g are used
(Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923).
Following a 1-week acclimation, the mice receive a single tail vein
injection of oligonucleotide (5 mg/kg) administered in phosphate
buffered saline (PBS), pH 7.0. The final concentration of
oligonucleotide in the dosing solution is (5 mg/kg) for the PBS
formulations. One retro-orbital bleed (either 0.25, 9.05, 2 or 4
post dose) and a terminal bleed (either 1, 3, 8 or 24 h post dose)
is collected from each group. The terminal bleed (approximately
0.6-0.8 mL) is collected by cardiac puncture following
ketamine/xylazine anesthesia. The blood is transferred to an
EDTA-coated collection tube and centrifuged to obtain plasma. At
termination, the liver and kidneys will be collected from each
mouse. Plasma and tissues homogenates will be used for analysis for
determination of intact oligonucleotide content by CGE. All samples
are immediately frozen on dry ice after collection and stored at
-80C until analysis.
Procedure 9
RNase H Studies with Chimeric C3'-Endo and C2'-Endo Modifled
Oligonucleotides with and without Nuclease Resistant Caps
[0365] .sup.32p Labeling of Oligonucleotides
[0366] The oligoribonucleotide (sense strand) was 5'-end labeled
with 32P using [.sup.32P]ATP, T4 polynucleotide kinase, and
standard procedures (Ausubel, F. M., Brent, R., Kingston, R. E.,
Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K., in
Current Protocols in Molecular Biology, John Wiley, New York
(1989)). The labeled RNA was purified by electrophoresis on 12%
denaturing PAGE (Sambrook, J., Frisch, E. F., and Maniatis, T.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Plainview (1989)). The specific activity of the
labeled oligonucleotide was approximately 6000 cpm/fmol.
[0367] Determination of RNase H Cleavage Patterns
[0368] Hybridization reactions were prepared in 120 .mu.L of
reaction buffer [20 mM Tris-HC (pH 7.5), 20 mM KCl, 10 mM
MgCl.sub.2, 0.1 mM DTT] containing 750 nM antisense
oligonucleotide, 500 nM sense oligoribonucleotide, and 100,000 cpm
.sup.32P-labeled sense oligoribonucleotide. Reactions were heated
at 90.degree. C. for 5 min and 1 unit of Inhibit-ACE was added.
Samples were incubated overnight at 37.degree. C. degrees.
Hybridization reactions were incubated at 37.degree. C. with
1.5.times.10.8.sup.-8 mg of E. coli RNase H enzyme for initial rate
determinations and then quenched at specific time points. Samples
were analyzed by trichloroacetic acid (TCA) assay or by denaturing
polyacrylamide gel electrophoresis as previously described [Crooke,
S. T., Lemonidis, K. M., Neilson, L., Griffey, R., Lesnik, E. A.,
and Monia, B. P., Kinetic characteristics of Escherichia coli RNase
H1: cleavage of various antisense oligonucleotide-RNA duplexes,
Biochem J., 312, 599 (1995); Lima, W. F. and Crooke, S. T.,
Biochemistry 36, 390-398, 1997].
[0369] Those skilled in the art will appreciate that numerous
changes and modifications can be made to the preferred embodiments
of the invention and that such changes and modifications can be
made without departing from the spirit of the invention. It is
therefore intended that the appended claims cover all such
equivalent variations as fall within the true spirit and scope of
the invention.
Sequence CWU 1
1
72 1 286 PRT Human 1 Met Ser Trp Leu Leu Phe Leu Ala His Arg Val
Ala Leu Ala Ala Leu 1 5 10 15 Pro Cys Arg Arg Gly Ser Arg Gly Phe
Gly Met Phe Tyr Ala Val Arg 20 25 30 Arg Gly Arg Lys Thr Gly Val
Phe Leu Thr Trp Asn Glu Cys Arg Ala 35 40 45 Gln Val Asp Arg Phe
Pro Ala Ala Arg Phe Lys Lys Phe Ala Thr Glu 50 55 60 Asp Glu Ala
Trp Ala Phe Val Arg Lys Ser Ala Ser Pro Glu Val Ser 65 70 75 80 Glu
Gly His Glu Asn Gln His Gly Gln Glu Ser Glu Ala Lys Pro Gly 85 90
95 Lys Arg Leu Arg Glu Pro Leu Asp Gly Asp Gly His Glu Ser Ala Gln
100 105 110 Pro Tyr Ala Lys His Met Lys Pro Ser Val Glu Pro Ala Pro
Pro Val 115 120 125 Ser Arg Asp Thr Phe Ser Tyr Met Gly Asp Phe Val
Val Val Tyr Thr 130 135 140 Asp Gly Cys Cys Ser Ser Asn Gly Arg Arg
Lys Pro Arg Ala Gly Ile 145 150 155 160 Gly Val Tyr Trp Gly Pro Gly
His Pro Leu Asn Val Gly Ile Arg Leu 165 170 175 Pro Gly Arg Gln Thr
Asn Gln Arg Ala Glu Ile His Ala Ala Cys Lys 180 185 190 Ala Ile Glu
Gln Ala Lys Thr Gln Asn Ile Asn Lys Leu Val Leu Tyr 195 200 205 Thr
Asp Ser Met Phe Thr Ile Asn Gly Ile Thr Asn Trp Val Gln Gly 210 215
220 Trp Lys Lys Asn Gly Trp Lys Thr Ser Ala Gly Lys Glu Val Ile Asn
225 230 235 240 Lys Glu Asp Phe Val Ala Leu Glu Arg Leu Thr Gln Gly
Met Asp Ile 245 250 255 Gln Trp Met His Val Pro Gly His Ser Gly Phe
Ile Gly Asn Glu Glu 260 265 270 Ala Asp Arg Leu Ala Arg Glu Gly Ala
Lys Gln Ser Glu Asp 275 280 285 2 293 PRT Chicken 2 Met Leu Arg Trp
Leu Val Ala Leu Leu Ser His Ser Cys Phe Val Ser 1 5 10 15 Lys Gly
Gly Gly Met Phe Tyr Ala Val Arg Lys Gly Arg Gln Thr Gly 20 25 30
Val Tyr Arg Thr Trp Ala Glu Cys Gln Gln Gln Val Asn Arg Phe Pro 35
40 45 Ser Ala Ser Phe Lys Lys Phe Ala Thr Glu Lys Glu Ala Trp Ala
Phe 50 55 60 Val Gly Ala Gly Pro Pro Asp Gly Gln Gln Ser Ala Pro
Ala Glu Thr 65 70 75 80 His Gly Ala Ser Ala Val Ala Gln Glu Asn Ala
Ser His Arg Glu Glu 85 90 95 Pro Glu Thr Asp Val Leu Cys Cys Asn
Ala Cys Lys Arg Pro Tyr Glu 100 105 110 Gln Ser Thr Asn Glu Glu His
Thr Val Arg Arg Ala Lys His Asp Glu 115 120 125 Glu Gln Ser Thr Pro
Val Val Ser Glu Ala Lys Phe Ser Tyr Met Gly 130 135 140 Glu Phe Ala
Val Val Tyr Thr Asp Gly Cys Cys Ser Gly Asn Gly Arg 145 150 155 160
Asn Arg Ala Arg Ala Gly Ile Gly Val Tyr Trp Gly Pro Gly His Pro 165
170 175 Leu Asn Ile Ser Glu Arg Leu Pro Gly Arg Gln Thr Asn Gln Arg
Ala 180 185 190 Glu Ile His Ala Ala Cys Lys Ala Ile Glu Gln Ala Lys
Ser Gln Asn 195 200 205 Ile Lys Lys Leu Ile Ile Tyr Thr Asp Ser Lys
Phe Thr Ile Asn Gly 210 215 220 Ile Thr Ser Trp Val Glu Asn Trp Lys
Thr Asn Gly Trp Arg Thr Ser 225 230 235 240 Ser Gly Gly Ser Val Ile
Asn Lys Glu Asp Phe Gln Lys Leu Asp Ser 245 250 255 Leu Ser Lys Gly
Ile Glu Ile Gln Trp Met His Ile Pro Gly His Ala 260 265 270 Gly Phe
Gln Gly Asn Glu Glu Ala Asp Arg Leu Ala Arg Glu Gly Ala 275 280 285
Ser Lys Gln Lys Leu 290 3 348 PRT Yeast 3 Met Ala Arg Gln Gly Asn
Phe Tyr Ala Val Arg Lys Gly Arg Glu Thr 1 5 10 15 Gly Ile Tyr Asn
Thr Trp Asn Glu Cys Lys Asn Gln Val Asp Gly Tyr 20 25 30 Gly Gly
Ala Ile Tyr Lys Lys Phe Asn Ser Tyr Glu Gln Ala Lys Ser 35 40 45
Phe Leu Gly Gln Pro Asn Thr Thr Ser Asn Tyr Gly Ser Ser Thr His 50
55 60 Ala Gly Gly Gln Val Ser Lys Pro His Thr Thr Gln Lys Arg Val
His 65 70 75 80 Arg Arg Asn Arg Pro Leu His Tyr Ser Ser Leu Thr Ser
Ser Ser Ala 85 90 95 Cys Ser Ser Leu Ser Ser Ala Asn Thr Asn Thr
Phe Tyr Ser Val Lys 100 105 110 Ser Asn Val Pro Asn Ile Glu Ser Lys
Ile Phe Asn Asn Trp Lys Asp 115 120 125 Cys Gln Ala Tyr Val Lys His
Lys Arg Gly Ile Thr Phe Lys Lys Phe 130 135 140 Glu Asp Gln Leu Ala
Ala Glu Asn Phe Ile Ser Gly Met Ser Ala His 145 150 155 160 Asp Tyr
Lys Leu Met Asn Ile Ser Lys Glu Ser Phe Glu Ser Lys Tyr 165 170 175
Lys Leu Ser Ser Asn Thr Met Tyr Asn Lys Ser Met Asn Val Tyr Cys 180
185 190 Asp Gly Ser Ser Phe Gly Asn Gly Thr Ser Ser Ser Arg Ala Gly
Tyr 195 200 205 Gly Ala Tyr Phe Glu Gly Ala Pro Glu Glu Asn Ile Ser
Glu Pro Leu 210 215 220 Leu Ser Gly Ala Gln Thr Asn Asn Arg Ala Glu
Ile Glu Ala Val Ser 225 230 235 240 Glu Ala Leu Lys Lys Ile Trp Glu
Lys Leu Thr Asn Glu Lys Glu Lys 245 250 255 Val Asn Tyr Gln Ile Lys
Thr Asp Ser Glu Tyr Val Thr Lys Leu Leu 260 265 270 Asn Asp Arg Tyr
Met Thr Tyr Asp Asn Lys Lys Leu Glu Gly Leu Pro 275 280 285 Asn Ser
Asp Leu Ile Val Pro Leu Val Gln Arg Phe Val Lys Val Lys 290 295 300
Lys Tyr Tyr Glu Leu Asn Lys Glu Cys Phe Lys Asn Asn Gly Lys Phe 305
310 315 320 Gln Ile Glu Trp Val Lys Gly His Asp Gly Asp Pro Gly Asn
Glu Met 325 330 335 Ala Asp Phe Leu Ala Lys Lys Gly Ala Ser Arg Arg
340 345 4 155 PRT E.coli 4 Met Leu Lys Gln Val Glu Ile Phe Thr Asp
Gly Ser Cys Leu Gly Asn 1 5 10 15 Pro Gly Pro Gly Gly Tyr Gly Ala
Ile Leu Arg Tyr Arg Gly Arg Glu 20 25 30 Lys Thr Phe Ser Ala Gly
Tyr Thr Arg Thr Thr Asn Asn Arg Met Glu 35 40 45 Leu Met Ala Ala
Ile Val Ala Leu Glu Ala Leu Lys Glu His Cys Glu 50 55 60 Val Ile
Leu Ser Thr Asp Ser Gln Tyr Val Arg Gln Gly Ile Thr Gln 65 70 75 80
Trp Ile His Asn Trp Lys Lys Arg Gly Trp Lys Thr Ala Asp Lys Lys 85
90 95 Pro Val Lys Asn Val Asp Leu Trp Gln Arg Leu Asp Ala Ala Leu
Gly 100 105 110 Gln His Gln Ile Lys Trp Glu Trp Val Lys Gly His Ala
Gly His Pro 115 120 125 Glu Asn Glu Arg Cys Asp Glu Leu Ala Arg Ala
Ala Ala Met Asn Pro 130 135 140 Thr Leu Glu Asp Thr Gly Tyr Gln Val
Glu Val 145 150 155 5 216 PRT Mouse EST 5 Gly Ile Cys Gly Leu Gly
Met Phe Tyr Ala Val Arg Arg Gly Arg Arg 1 5 10 15 Pro Gly Val Phe
Leu Ser Trp Ser Glu Cys Lys Ala Gln Val Asp Arg 20 25 30 Phe Pro
Ala Ala Arg Phe Lys Lys Phe Ala Thr Glu Asp Glu Ala Trp 35 40 45
Ala Phe Val Arg Ser Ser Ser Ser Pro Asp Gly Ser Lys Gly Gln Glu 50
55 60 Ser Ala His Glu Gln Lys Ser Gln Ala Lys Thr Ser Lys Arg Pro
Arg 65 70 75 80 Glu Pro Leu Val Val Val Tyr Thr Asp Gly Cys Cys Ser
Ser Asn Gly 85 90 95 Arg Lys Arg Ala Arg Ala Gly Ile Gly Val Tyr
Trp Gly Pro Gly His 100 105 110 Pro Leu Asn Val Arg Ile Arg Leu Pro
Gly Arg Gln Thr Asn Gln Arg 115 120 125 Ala Glu Ile His Ala Ala Cys
Lys Ala Val Met Gln Ala Lys Ala Gln 130 135 140 Asn Ile Ser Lys Leu
Val Leu Tyr Thr Asp Ser Met Phe Thr Ile Asn 145 150 155 160 Gly Ile
Thr Asn Trp Val Gln Gly Trp Lys Lys Asn Gly Trp Arg Thr 165 170 175
Ser Thr Gly Lys Asp Val Ile Asn Lys Glu Asp Phe Met Glu Leu Asp 180
185 190 Glu Leu Thr Gln Gly Met Asp Ile Gln Trp Met His Ile Pro Gly
His 195 200 205 Ser Gly Phe Val Gly Asn Glu Glu 210 215 6 26 DNA
Artificial Sequence Oligonucleotide Primer 6 acgctggccg ggagtcgaaa
tgcttc 26 7 28 DNA Artificial Sequence Oligonucleotide Primer 7
ctgttcctgg cccacagagt cgccttgg 28 8 29 DNA Artificial Sequence
Oligonucleotide Primer 8 ggtctttctg acctggaatg agtgcagag 29 9 29
DNA Artificial Sequence Oligonucleotide Primer 9 cttgcctggt
ttcgccctcc gattcttgt 29 10 29 DNA Artificial Sequence
Oligonucleotide Primer 10 ttgattttca tgcccttctg aaacttccg 29 11 34
DNA Artificial Sequence Oligonucleotide Primer 11 cctcatcctc
tatggcaaac ttcttaaatc tggc 34 12 17 DNA Artificial Sequence
Oligonucleotide Primer 12 gggcgccgtc ggtgtgg 17 13 20 DNA
Artificial Sequence Oligonucleotide Primer misc_feature (1)..(20)
P=S misc_feature (20)..(20) 3'-O-(2-methoxyethyl) 13 atgcattctg
cccccaagga 20 14 20 DNA Artificial Sequence Oligonucleotide Primer
misc_feature (1)..(20) P=S misc_feature (19)..(20)
3'-O-(2-methoxyethyl) 14 atgcattctg cccccaagga 20 15 20 DNA
Artificial Sequence Oligonucleotide Primer misc_feature (1)..(17)
P=S misc_feature (18)..(20) P=O misc_feature (19)..(20)
3'-O-(2-methoxyethyl) 15 atgcattctg cccccaagga 20 16 20 DNA
Artificial Sequence Oligonucleotide Primer misc_feature (1)..(1)
3'-O-(2-methoxyethyl) misc_feature (1)..(20) P=S misc_feature
(20)..(20) 3'-O-(2-methoxyethyl) 16 atgcattctg cccccaagga 20 17 20
DNA Artificial Sequence Oligonucleotide Primer misc_feature
(1)..(20) P=S misc_feature (1)..(1) 3'-O-(2-methoxyethyl)
misc_feature (19)..(20) 3'-O-(2-methoxyethyl) 17 atgcattctg
cccccaagga 20 18 20 DNA Artificial Sequence Oligonucleotide Primer
misc_feature (1)..(1) P=O misc_feature (1)..(1)
3'-O-(2-methoxyethyl) misc_feature (2)..(17) P=S misc_feature
(18)..(20) P=O misc_feature (19)..(20) 3'-O-(2-methoxyethyl) 18
atgcattctg ccaaaaagga 20 19 20 DNA Artificial Sequence
Oligonucleotide Primer misc_feature (1)..(2) 3'-O-(2-methoxyethyl)
misc_feature (1)..(20) P=S misc_feature (19)..(20)
3'-O-(2-methoxyethyl) 19 atgcattctg ccaaaaagga 20 20 20 DNA
Artificial Sequence Oligonucleotide Primer misc_feature (1)..(2)
3'-O-(2-methoxyethyl) misc_feature (1)..(2) P=O misc_feature
(3)..(17) P=S misc_feature (18)..(20) P=O misc_feature (19)..(20)
3'-O-(2-methoxyethyl) 20 atgcattctg ccaaaaagga 20 21 12 DNA
Artificial Sequence Oligonucleotide Primer misc_feature (1)..(12)
3'-O-(2-methoxyethyl) misc_feature (1)..(12) P=O 21 cgcgaattcg gg
12 22 20 DNA Artificial Sequence Oligonucleotide Primer
misc_feature (1)..(20) P=S 22 atgcattctg cccccaagga 20 23 11 DNA
Artificial Sequence Oligonucleotide Primer misc_feature (6)..(6)
2'-aminolinker 23 ggctguctgc g 11 24 19 DNA Artificial Sequence
Oligonucleotide Primer misc_feature (1)..(19) P=O misc_feature
(16)..(19) 3'-O-(2-methoxyethyl) 24 tttttttttt ttttttttt 19 25 19
DNA Artificial Sequence Oligonucleotide Primer misc_feature
(1)..(19) P=O misc_feature (16)..(19) 2'-O-(2-methoxyethyl) 25
tttttttttt ttttttttu 19 26 19 DNA Artificial Sequence
Oligonucleotide Primer misc_feature (1)..(19) P=S misc_feature
(16)..(19) 3'-O-(2-methoxyethyl) 26 tttttttttt ttttttttt 19 27 19
DNA Artificial Sequence Oligonucleotide Primer misc_feature
(1)..(19) P=S misc_feature (16)..(19) 2'-O-(2-methoxyethyl) 27
tttttttttt ttttttttu 19 28 19 DNA Artificial Sequence
Oligonucleotide Primer misc_feature (1)..(14) P=S misc_feature
(15)..(19) P=O misc_feature (16)..(19) 3'-O-(2-methoxyethyl) 28
tttttttttt ttttttttt 19 29 19 DNA Artificial Sequence
Oligonucleotide Primer misc_feature (1)..(14) P=S misc_feature
(15)..(19) P=O misc_feature (16)..(19) 2'-O-(2-methoxyethyl) 29
tttttttttt ttttttttu 19 30 20 DNA Artificial Sequence
Oligonucleotide Primer misc_feature (1)..(20) P=S misc_feature
(1)..(1) 3'-aminopropyl-A misc_feature (20)..(20) 3'-aminopropyl-A
30 atgcattctg cccccaagga 20 31 20 DNA Artificial Sequence
Oligonucleotide Primer misc_feature (1)..(20) P=S misc_feature
(1)..(1) 3'-aminopropyl-A misc_feature (2)..(5) 2'-O-methoxyethyl
misc_feature (16)..(19) 2'-O-methoxyethyl misc_feature (20)..(20)
3'-aminopropyl-A 31 atgcattctg cccccaagga 20 32 20 DNA Artificial
Sequence Oligonucleotide Primer misc_feature (1)..(1)
3'-aminopropyl-A misc_feature (1)..(4) P=O misc_feature (2)..(5)
2'-O-methoxyethyl misc_feature (5)..(15) P=S misc_feature
(16)..(20) P=O misc_feature (16)..(19) 2'-O-methoxyethyl
misc_feature (20)..(20) 3'-aminopropyl-A 32 atgcattctg cccccaagga
20 33 20 DNA Artificial Sequence Oligonucleotide Primer
misc_feature (1)..(1) 2'-aminopropyl-A misc_feature (1)..(4) P=O
misc_feature (2)..(5) 2'-O-methoxyethyl misc_feature (5)..(15) P=S
misc_feature (16)..(20) P=O misc_feature (16)..(19)
2'-O-methoxyethyl misc_feature (20)..(20) 2'-aminopropyl-A 33
atgcattctg cccccaagga 20 34 20 DNA Artificial Sequence
Oligonucleotide Primer misc_feature (1)..(1) 2'-aminopropyl-A
misc_feature (1)..(20) P=S misc_feature (2)..(5) 2'-O-methoxyethyl
misc_feature (16)..(19) 2'-O-methoxyethyl misc_feature (20)..(20)
2'-aminopropyl-A 34 atgcattctg cccccaagga 20 35 20 DNA Artificial
Sequence Oligonucleotide Primer misc_feature (1)..(1)
3'-aminopropyl-A misc_feature (1)..(20) P=S misc_feature (20)..(20)
3'-aminopropyl-A 35 atgcattctg cccccaagga 20 36 20 DNA Artificial
Sequence Oligonucleotide Primer misc_feature (1)..(20) P=S
misc_feature (19)..(19) Bis-2'-OMe-MMI 36 tgcatccccc aggccaccat 20
37 20 DNA Artificial Sequence Oligonucleotide Primer misc_feature
(1)..(1) Bis-2'-OMe-MMI misc_feature (1)..(20) P=S misc_feature
(19)..(19) Bis-2'-OMe-MMI 37 tgcatccccc aggccaccat 20 38 20 DNA
Artificial Sequence Oligonucleotide Primer misc_feature (1)..(20)
P=S 38 tgcatccccc aggcgaccat 20 39 20 DNA Artificial Sequence
Oligonucleotide Primer misc_feature (1)..(20) P=S 39 tgcatccccc
aggccaccat 20 40 20 RNA Artificial Sequence Oligonucleotide Primer
40 uggugggcaa ugggcguguu 20 41 17 RNA Artificial Sequence
Oligonucleotide Primer misc_feature (1)..(17) P=O 41 gggcgccguc
ggugugg 17 42 17 RNA Artificial Sequence Oligonucleotide Primer
misc_feature (1)..(17) P=S 42 gggcgccguc ggugugg 17 43 20 DNA
Artificial Sequence Oligonucleotide Primer misc_feature (1)..(20)
phosphorothioate linkage misc_feature (1)..(6) 2'-O-(methoxyethyl)
misc_feature (4)..(4) 5-methyl-C misc_feature (8)..(8) 5-methyl-C
misc_feature (11)..(15) 5-methyl-C misc_feature (15)..(20)
2'-O-(methoxyethyl) 43 atgcattctg cccccaagga 20 44 20 DNA
Artificial Sequence
Oligonucleotide Primer misc_feature (1)..(20) phosphorothioate
linkage misc_feature (2)..(4) 5-methyl-C misc_feature (8)..(8)
5-methyl-C misc_feature (12)..(12) 5-methyl-C misc_feature
(15)..(16) 5-methyl-C misc_feature (19)..(19) 5-methyl-C 44
gcccaagctg gcatccgtca 20 45 19 DNA Artificial Sequence
Oligonucleotide Primer misc_feature (16)..(19) 2'-modified T 45
tttttttttt ttttttttt 19 46 20 DNA Artificial Sequence
Oligonucleotide Primer misc_feature (1)..(20) P=S 46 tccgtcatcg
ctcctcaggg 20 47 20 DNA Artificial Sequence Oligonucleotide Primer
misc_feature (1)..(20) P=S 47 tcagtaatag gcccacatgg 20 48 20 DNA
Artificial Sequence Oligonucleotide Primer misc_feature (1)..(3)
P=O misc_feature (4)..(12) P=S misc_feature (4)..(12) 2'-Me
misc_feature (13)..(20) P=O 48 ttcgtcatcg ctcctcaggg 20 49 20 DNA
Artificial Sequence Oligonucleotide Primer misc_feature (1)..(20)
P=S misc_feature (4)..(12) 2'-Me 49 tccgtcatcg ctcctcaggg 20 50 26
DNA Artificial Sequence Oligonucleotide Primer misc_feature
(1)..(3) P=O misc_feature (4)..(16) P=S misc_feature (4)..(16)
2'-Me misc_feature (17)..(26) P=O 50 tcagtaatag ccgccgcccc acatgg
26 51 23 DNA Artificial Sequence Oligonucleotide Primer
misc_feature (1)..(23) P=S misc_feature (4)..(12) 2'-Me 51
tcagtaatag ccgccccaca tgc 23 52 20 DNA Artificial Sequence
Oligonucleotide Primer misc_feature (1)..(20) P=S misc_feature
(4)..(12) 2'-Me 52 tccgtcatcg ctcctcaggg 20 53 23 DNA Artificial
Sequence Oligonucleotide Primer misc_feature (1)..(20) P=S
misc_feature (4)..(12) 2'-Me 53 tcagtaatag ccgccccaca tgc 23 54 19
DNA Artificial Sequence Oligonucleotide Primer misc_feature
(1)..(19) P=S 54 atgcattctg ccccaagga 19 55 19 DNA Artificial
Sequence Oligonucleotide Primer misc_feature (1)..(4) P=O
misc_feature (5)..(14) P=S misc_feature (15)..(19) P=O 55
atgcattctg ccccaagga 19 56 19 DNA Artificial Sequence
Oligonucleotide Primer misc_feature (1)..(19) P=S 56 atgcattctg
ccccaagga 19 57 19 DNA Artificial Sequence Oligonucleotide Primer
misc_feature (1)..(4) P=O misc_feature (1)..(1) 2'-5' linkage with
3'-O-MOE misc_feature (1)..(4) 2'-O-MOE misc_feature (5)..(14) P=S
misc_feature (5)..(14) 2'-S-Me misc_feature (15)..(19) P=O
misc_feature (15)..(19) 2'-O-MOE misc_feature (19)..(19) 2'-5'
linkage with 3'-O-MOE 57 atgcattctg ccccaagga 19 58 19 DNA
Artificial Sequence Oligonucleotide Primer misc_feature (1)..(19)
P=S misc_feature (1)..(1) 2'-5' linkage with 3'-O-MOE misc_feature
(1)..(19) 2'-O-MOE misc_feature (1)..(19) 2'-S-Me misc_feature
(19)..(19) 2'-5' linkage with 3'-O-MOE 58 atgcattctg ccccaagga 19
59 20 RNA Artificial Sequence Oligonucleotide Primer misc_feature
(1)..(20) P=O 59 acuccaccau aguacacucc 20 60 25 RNA Artificial
Sequence Oligonucleotide Primer misc_feature (1)..(25) P=O 60
uggugggcgc cgucggugug ggcaa 25 61 17 DNA Artificial Sequence
Oligonucleotide Primer 61 ccacaccgac ggcgccc 17 62 20 DNA
Artificial Sequence Oligonucleotide Primer 62 aacacgccca ttgcccacca
20 63 13 RNA Artificial Sequence Oligonucleotide Primer 63
gccgucggug ugg 13 64 34 RNA Artificial Sequence Oligonucleotide
Primer 64 gggcgccguc gguguggccc gcggcagcca cacc 34 65 25 RNA
Artificial Sequence Oligonucleotide Primer 65 uggugggcgc cgucggugug
ggcaa 25 66 20 RNA Artificial Sequence Oligonucleotide Primer 66
acuccaccau aguacacucc 20 67 20 RNA Artificial Sequence
Oligonucleotide Primer 67 uggugggcaa ugggcguguu 20 68 17 RNA
Artificial Sequence Oligonucleotide Primer 68 gggcgccguc ggugugg 17
69 47 RNA Artificial Sequence Oligonucleotide Primer 69 ggugguggug
ggcgccgucg gugugggcaa gagugcgcug accaucc 47 70 17 RNA Artificial
Sequence Oligonucleotide Primer 70 gggcgccguc ggugugg 17 71 17 RNA
Artificial Sequence Oligonucleotide Primer 71 gggcgccguc ggugugg 17
72 12 RNA Artificial Sequence Oligonucleotide Primer 72 cgcgaauucg
cg 12
* * * * *