U.S. patent application number 10/919423 was filed with the patent office on 2007-12-20 for corn event pv-zmgt32(nk603) and compositions and methods for detection thereof.
Invention is credited to Carl Frederick Behr, Gregory R. Heck, Catherine Hironaka, Jinsong You.
Application Number | 20070292854 10/919423 |
Document ID | / |
Family ID | 27395887 |
Filed Date | 2007-12-20 |
United States Patent
Application |
20070292854 |
Kind Code |
A1 |
Behr; Carl Frederick ; et
al. |
December 20, 2007 |
Corn event PV-ZMGT32(nk603) and compositions and methods for
detection thereof
Abstract
The present invention provides a DNA construct that confers
tolerance to transgenic corn plant. Also provided are assays for
detecting the presence of the PV-ZMGT32(nk603) corn event based on
the DNA sequence of the recombinant construct inserted into the
corn genome and of genomic sequences flanking the insertion
site.
Inventors: |
Behr; Carl Frederick;
(Wildwood, MO) ; Heck; Gregory R.; (Crystal Lake
Park, MO) ; Hironaka; Catherine; (Dublin, CA)
; You; Jinsong; (Ballwin, MO) |
Correspondence
Address: |
MONSANTO COMPANY
800 N. LINDBERGH BLVD.
ATTENTION: GAIL P. WUELLNER, IP PARALEGAL, (E2NA)
ST. LOUIS
MO
63167
US
|
Family ID: |
27395887 |
Appl. No.: |
10/919423 |
Filed: |
August 16, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09872051 |
Jun 1, 2001 |
6825400 |
|
|
10919423 |
Aug 16, 2004 |
|
|
|
60213567 |
Jun 22, 2000 |
|
|
|
60240014 |
Oct 13, 2000 |
|
|
|
60241215 |
Oct 13, 2000 |
|
|
|
Current U.S.
Class: |
435/6.15 ;
536/23.1; 536/24.1; 536/24.33; 800/278; 800/298; 800/320.1 |
Current CPC
Class: |
C12Q 2600/13 20130101;
C12Q 2600/158 20130101; C12N 15/8275 20130101; C12N 15/8221
20130101; A01H 5/10 20130101; C12N 15/8216 20130101; C12Q 1/6895
20130101 |
Class at
Publication: |
435/006 ;
536/023.1; 536/024.1; 536/024.33; 800/278; 800/298; 800/320.1 |
International
Class: |
C12N 15/87 20060101
C12N015/87; A01H 5/00 20060101 A01H005/00; C12Q 1/68 20060101
C12Q001/68; C07H 21/02 20060101 C07H021/02 |
Claims
1. A DNA construct comprising: a first and a second expression
cassette, wherein said first expression cassette in operable
linkage comprises (i) a rice actin 1 promoter; (ii) a rice actin 1
intron; (iii) a chloroplast transit peptide encoding DNA molecule;
(iv) a glyphosate tolerant EPSPS encoding DNA molecule; and (v) a
transcriptional terminator DNA molecule; and said second expression
cassette comprising in operable linkage (a) a CaMV 35S promoter;
(b) a Hsp70 intron; (c) a chloroplast transit peptide encoding DNA
molecule; (d) a glyphosate tolerant EPSPS encoding DNA molecule;
and (e) a transcriptional terminator DNA molecule.
2. A DNA construct of claim 1, wherein the glyphosate tolerant
EPSPS encoding DNA molecule consists of an AGRTU.aroA:CP4 DNA
molecule.
3. A plant comprising the DNA construct of claim 2.
4. A plant of claim 3, wherein said plant is a corn plant.
5. A corn plant provided by ATCC seed deposit PTA-2478, progeny
seeds and plants or parts thereof.
6. A DNA molecule comprising a nucleotide sequence identified as
SEQ ID NO:7 or SEQ ID NO:8.
7. A pair of DNA molecules comprising: a first DNA molecule and a
second DNA molecule, wherein the DNA molecules are of sufficient
length of contiguous nucleotides of SEQ ID NO:7 or its complement
to function as DNA primers or probes diagnostic for DNA extracted
from corn plant PV-ZMGT32(nk603) or progeny thereof.
8. A pair of DNA molecules comprising: a first DNA molecule and a
second DNA molecule, wherein the DNA molecules are of sufficient
length of contiguous nucleotides of SEQ ID NO:8 or its complement
to function as DNA primers or probes diagnostic for DNA extracted
from corn plant PV-ZMGT32(nk603) or progeny thereof.
9. A method of detecting the presence of a DNA molecule in a corn
plant provided by ATCC seed deposit PTA-2478 or progeny thereof,
the method comprising: (a) extracting a DNA sample from said corn
plant provided by ATCC seed deposit PTA-2478 or progeny seeds and
plants or parts thereof; (b) contacting the DNA sample with a DNA
primer pair comprising DNA primer molecules of sufficient length of
contiguous nucleotides of SEQ ID NO:7 or its complement, or SEQ ID
NO:8 or its complement; (c) providing a nucleic acid amplification
reaction condition; (d) performing said nucleic acid amplification
reaction, thereby producing a DNA amplicon molecule comprising the
DNA molecules selected from the group consisting of SEQ ID NO:9,
SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12; and (e) detecting the
DNA amplicon molecule.
10. A corn plant when analyzed by a method of claim 9 produced an
amplicon comprising the DNA molecules selected from the group
consisting of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID
NO:12.
11. In the method of claim 9, the DNA amplicon molecule comprising
the DNA molecules selected from the group consisting of SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.
12. A method of detecting the presence of a DNA molecule selected
from the group consisting of SEQ ID NO:7 and SEQ ID NO:8 in a DNA
sample, the method comprising: (a) extracting a DNA sample from a
corn plant; (b) contacting the DNA sample with a DNA molecule
identified as SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID
NO:12, wherein said DNA molecule is a DNA probe that hybridizes
under stringent hybridization conditions with the DNA molecule
selected from the group consisting of SEQ ID NO:7 or SEQ ID NO:8,
and does not hybridize under the stringent hybridization conditions
with a DNA sample not containing the DNA molecule identified as SEQ
ID NO:7 or SEQ ID NO:8; (c) subjecting the sample and probe to
stringent hybridization conditions; and detecting hybridization of
the probe to the DNA.
13. A DNA molecule selected from the group consisting of SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, and complements
thereof.
14. A method of breeding a glyphosate tolerant trait into corn
plants comprising a) extracting a DNA sample from progeny corn
plants; b) contacting the DNA sample with a marker nucleic acid
molecule selected from the group consisting of SEQ ID NO:9, SEQ ID
NO:10, SEQ ID NO:11, SEQ ID NO:12, and complements thereof. c)
performing a marker assisted breeding method for the glyphosate
tolerant trait, wherein the glyphosate tolerant trait is
genetically linked to a complement of the marker nucleic acid
molecule;
15. A method of producing a corn plant that tolerates application
of glyphosate herbicide comprising: (a) transforming a corn cell
with the DNA construct of claim 1; (b) selecting said corn cell for
tolerance to application of glyphosate; (c) growing said corn cell
into a fertile corn plant;
16. A DNA detection kit comprising: at least one DNA molecule of
sufficient length of contiguous nucleotides homologous or
complementary to SEQ ID NO:7 or SEQ ID NO:8 that functions as a DNA
primer or probe specific for corn event PV-ZMGT32(nk603) and its
progeny.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to the field of plant
molecular biology, specifically the invention relates to a DNA
construct for conferring glyphosate tolerance to a plant. The
invention more specifically relates to a glyphosate tolerant corn
plant PV-ZMGT32(nk603) and to assays for detecting the presence of
corn plant PV-ZMGT32(nk603) DNA in a sample and compositions
thereof.
BACKGROUND OF THE INVENTION
[0002] This invention relates to the glyphosate herbicide tolerant
corn (Zea mays) plant PV-ZMGT32(nk603) and to the DNA plant
expression construct of corn plant PV-ZMGT32(nk603) and the
detection of the transgene/genomic insertion region in corn
PV-ZMGT32(nk603) and progeny thereof.
[0003] Corn is an important crop and is a primary food source in
many areas of the world. The methods of biotechnology have been
applied to corn for improvement of the agronomic traits and the
quality of the product. One such agronomic trait is herbicide
tolerance, in particular, tolerance to glyphosate herbicide. This
trait in corn has been conferred by the expression of a transgene
in the corn plants (U.S. Pat. No. 6,040,497).
[0004] The expression of foreign genes in plants is known to be
influenced by their chromosomal position, perhaps due to chromatin
structure (e.g., heterochromatin) or the proximity of
transcriptional regulation elements (e.g., enhancers) close to the
integration site (Weising et al., Ann. Rev. Genet 22:421-477,
1988). For this reason, it is often necessary to screen a large
number of events in order to identify an event characterized by
optimal expression of a introduced gene of interest. For example,
it has been observed in plants and in other organisms that there
may be a wide variation in levels of expression of an introduced
genes among events. There may also be differences in spatial or
temporal patterns of expression, for example, differences in the
relative expression of a transgene in various plant tissues, that
may not correspond to the patterns expected from transcriptional
regulatory elements present in the introduced gene construct. For
this reason, it is common to produce hundreds to thousands of
different events and screen those events for a single event that
has desired transgene expression levels and patterns for commercial
purposes. An event that has desired levels or patterns of transgene
expression is useful for introgressing the transgene into other
genetic backgrounds by sexual outcrossing using conventional
breeding methods. Progeny of such crosses maintain the transgene
expression characteristics of the original transformant. This
strategy is used to ensure reliable gene expression in a number of
varieties that are well adapted to local growing conditions.
[0005] It would be advantageous to be able to detect the presence
of a particular event in order to determine whether progeny of a
sexual cross contain a transgene of interest. In addition, a method
for detecting a particular event would be helpful for complying
with regulations requiring the premarket approval and labeling of
foods derived from recombinant crop plants, for example. It is
possible to detect the presence of a transgene by any well known
nucleic acid detection method such as the polymerase chain reaction
(PCR) or DNA hybridization using nucleic acid probes. These
detection methods generally focus on frequently used genetic
elements, such as promoters, terminators, marker genes, etc. As a
result, such methods may not be useful for discriminating between
different events, particularly those produced using the same DNA
construct unless the DNA sequence of chromosomal DNA adjacent to
the inserted DNA ("flanking DNA") is known. An event-specific PCR
assay is discussed, for example, by Windels et al. (Med. Fac.
Landbouww, Univ. Gent 64/5b:459-462, 1999), who identified
glyphosate tolerant soybean event 40-3-2 by PCR using a primer set
spanning the junction between the insert and flanking DNA,
specifically one primer that included sequence from the insert and
a second primer that included sequence from flanking DNA.
SUMMARY OF THE INVENTION
[0006] According to one aspect of the invention, a DNA construct is
provided that when expressed in plant cells and plants confers
tolerance to glyphosate herbicide. This invention relates
preferably to the methods for producing and selecting a glyphosate
tolerant monocot crop plant. The DNA construct consists of two
transgene expression cassettes. The first expression cassette
comprising a DNA molecule of a rice (Oryzae sativa) actin 1
promoter and rice actin 1 intron operably joined to a DNA molecule
encoding a chloroplast transit peptide sequence, operably connected
to a DNA molecule encoding a glyphosate resistant
5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS), operably
connected to a DNA molecule comprising a 3' transcriptional
terminator. The second transgene expression cassette of the DNA
construct comprising a DNA molecule of the cauliflower mosaic virus
(CaMV) 35S promoter, operably connected to a DNA molecule
comprising a Hsp70 intron, operably connected to a DNA molecule
encoding a chloroplast transit peptide sequence, operably connected
to a DNA molecule encoding a glyphosate resistant
5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS), operably
connected to a DNA molecule comprising a 3' transcriptional
terminator.
[0007] More specifically, a DNA construct is provided that when
expressed in plant cells and plants confers tolerance to glyphosate
herbicide. This invention relates preferably to the methods for
producing and selecting a glyphosate tolerant corn plant. The DNA
construct consists of two transgene expression cassettes. The first
expression cassette consisting of a DNA molecule of a rice (Oryzae
sativa) actin 1 promoter and rice actin 1 intron operably joined to
a DNA molecule encoding an Arabidopsis EPSPS chloroplast transit
peptide sequence, operably connected to a DNA molecule encoding a
glyphosate resistant 5-enol-pyruvylshikimate-3-phosphate synthase
(EPSPS) isolated from Agrobacterium tumefaciens sp. strain CP4,
operably connected to a DNA molecule consisting of a nopaline
synthase transcriptional terminator. The second transgene
expression cassette consisting of a DNA molecule of the cauliflower
mosaic virus (CaMV) 35S promoter containing a tandem duplication of
the enhancer region, operably connected to a DNA molecule
consisting of a Zea mays Hsp70 intron, operably connected to a DNA
molecule encoding an Arabidopsis EPSPS chloroplast transit peptide
sequence, operably connected to a DNA molecule encoding a
glyphosate resistant 5-enol-pyruvylshikimate-3-phosphate synthase
(EPSPS) isolated from Agrobacterium tumefaciens sp. strain CP4,
operably connected to a DNA molecule consisting of a nopaline
synthase transcriptional terminator.
[0008] According to another aspect of the invention, compositions
and methods are provided for detecting the presence of the
transgene/genomic insertion region from a novel corn plant
designated PV-ZMGT32(nk603). DNA molecules are provided that
comprise at least one junction sequence of PV-ZMGT32(nk603)
selected from the group consisting of 5' TGTAGCGGCCCACGCGTGGT 3'
(SEQ ID NO:9), 5' TACCACGCGACACACTTC 3' (SEQ ID NO: 10), and 5'
TGCTGTTCTGCTGACTTT 3' (SEQ ID NO:11) and complements thereof;
wherein a junction sequence spans the junction between heterologous
DNA inserted into the genome and the DNA from the corn cell
flanking the insertion site and is diagnostic for the event. The
corn plant and seed comprising these molecules is an aspect of this
invention.
[0009] A novel DNA molecule 5'ACCAAGCTTTTATAATAG 3' (SEQ ID NO:12)
and the complement thereof, wherein this DNA molecule is novel in
PV-ZMGT32(nk603) and its progeny. The corn plant and seed
comprising this molecule is an aspect of this invention.
[0010] According to another aspect of the invention, DNA molecules
that comprise the novel transgene/genomic insertion region, SEQ ID
NO:7 and SEQ ID NO:8 and are homologous or complementary to SEQ
NO:7 and SEQ ID NO:8 are an aspect of this invention.
[0011] DNA molecules that comprise a sufficient length of a
transgene portion of the DNA sequence of SEQ ID NO:7 and a similar
sufficient length of a 5' flanking corn DNA sequence of SEQ ID
NO:7; or a similar sufficient length of a transgene portion of the
DNA sequence of SEQ ID NO:8 and a similar sufficient length of a 3'
DNA sequence flanking the transgene, wherein these DNA molecules
are useful as DNA primers in DNA amplification methods so as to
provide a DNA amplicon product specifically produced from
PV-ZMGT32(nk603) DNA and its progeny are another aspect of the
invention. DNA primers homologous or complementary to a length of
SEQ ID NO:7 and SEQ ID NO:8 are an aspect of the invention. The
amplicons produced using DNA primers that are diagnostic for corn
event PV-ZMGT32(nk603) and its progeny are a subject of this
invention.
[0012] According to another aspect of the invention, methods of
detecting the presence of DNA corresponding to the corn event
PV-ZMGT32(nk603) event in a sample are provided. Such methods
comprise: (a) contacting the sample comprising DNA with a DNA
primer set, that when used in a nucleic acid amplification reaction
with genomic DNA extracted from corn event PV-ZMGT32 (nk603)
produces an amplicon that is diagnostic for corn event
PV-ZMGT32(nk603); (b) performing a nucleic acid amplification
reaction, thereby producing the amplicon; and (c) detecting the
amplicon. A pair of DNA molecules comprising a DNA primer set that
are homologous or complementary to SEQ ID NO:7 or SEQ ID NO:8 that
function in a nucleic acid amplification reaction to produce an
amplicon DNA molecule diagnostic for PV-ZMGT329nk603). More
specifically, a pair of DNA molecules comprising a DNA primer set,
wherein the DNA molecules are identified as SEQ ID NO: 13 or
complements thereof and SEQ ID NO: 14 or complements thereof; SEQ
ID NO: 15 or complements thereof and SEQ ID NO: 16 or complements
thereof. The amplicon comprising the DNA molecules of SEQ ID NO: 13
and SEQ ID NO: 14. The amplicon comprising the DNA molecules of SEQ
ID NO: 15 and SEQ ID NO: 16. The amplicon produce by the afore
described method that can hybridize under stringent conditions to
SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:11, or SEQ ID NO: 12.
[0013] According to another aspect of the invention, methods of
detecting the presence of a DNA molecule corresponding to the
PV-ZMGT32(nk603) event in a sample, such methods comprising: (a)
contacting the sample comprising DNA extracted from a corn plant
with a DNA probe molecule that hybridizes under stringent
hybridization conditions with genomic DNA from corn event
PV-ZMGT32(nk603) and does not hybridize under the stringent
hybridization conditions with a control corn plant DNA; (b)
subjecting the sample and probe to stringent hybridization
conditions; and (c) detecting hybridization of the probe to the
DNA. More specifically, a method for detecting the presence of a
DNA molecule corresponding to the PV-ZMGT32(nk603) event in a
sample, such methods, consisting of (a) contacting the sample
comprising DNA extracted from a corn plant with a DNA probe
molecule that consists of SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 1,
or SEQ ID NO: 12, wherein said DNA probe molecule hybridizes under
stringent hybridization conditions with genomic DNA from corn event
PV-ZMGT32(nk603) and does not hybridize under the stringent
hybridization conditions with a control corn plant DNA; (b)
subjecting the sample and probe to stringent hybridization
conditions; and (c) detecting hybridization of the probe to the
DNA.
[0014] According to another aspect of the invention, methods of
producing a corn plant that tolerates application of glyphosate are
provided that comprise the steps of: (a) sexually crossing a first
parental corn line comprising the expression cassettes of the
present invention, which confers tolerance to application of
glyphosate, and a second parental corn line that lacks the
glyphosate tolerance, thereby producing a plurality of progeny
plants; and (b) selecting a progeny plant that tolerates
application of glyphosate. Such methods may optionally comprise the
further step of back-crossing the progeny plant to the second
parental corn line to producing a true-breeding corn plant that
tolerates application of glyphosate.
[0015] According to another aspect of the invention, a method is
provided to select for glyphosate tolerant corn plants of the
present invention and progeny thereof comprising extracting DNA
from a plant sample, contacting a DNA with a marker nucleic acid
molecule selected from the group consisting of SEQ ID NO:9, SEQ ID
NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12, or complements thereof,
detecting the hybridization of said marker nucleic acid molecule to
the DNA, and performing a marker assisted breeding analysis for the
genetic linkage of the glyphosate tolerant trait to the marker
nucleic acid molecule.
[0016] The present invention provides a method of producing a corn
plant tolerant to glyphosate herbicide comprising transforming a
corn cell with the DNA construct (pMON25496), selecting the corn
cell for tolerance to the treatment with an effective dose of
glyphosate, and growing the corn cell into a fertile corn plant.
The fertile corn plant can be self pollinated or crossed with
compatible corn varieties to produce glyphosate tolerant
progeny.
[0017] The invention further relates to a DNA detection kit
comprising at least one DNA molecule of sufficient length of
contiguous nucleotides homologous or complementary to SEQ ID NO:7
or SEQ ID NO:8 that functions as a DNA primer or probe specific for
corn event PV-ZMGT32(nk603) or its progeny.
[0018] This invention further relates to the plants and seeds of
glyphosate tolerant corn (Zea mays) PV-ZMGT32 (nk603) having ATCC
Accession No. PTA-2478 and the progeny derived thereof. The corn
plant or its parts produced by growing of the glyphosate tolerant
corn plant PV-ZMGT32(nk603), the pollen and ovules of the corn
plant PV-ZMGT32(nk603). The nuclei of vegetative cells, the nuclei
of pollen cells, and the nuclei of egg cells of the corn plant
PV-ZMGT32 (nk603) and the progeny derived thereof. The corn plant
and seed PV-ZMGT32(nk603) from which the DNA primer molecules of
the present invention provide a specific amplicon product is an
aspect of the invention.
[0019] The foregoing and other aspects of the invention will become
more apparent from the following detailed description and
accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] FIG. 1. Plasmid map of pMON25496
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0021] This application claims the benefit of U.S. Provisional
Application No. 60/213,567, filed Jun. 22, 2000; U.S. Provisional
Application No. 60/241,215, filed Oct. 13, 2000; and U.S.
Provisional Application No. 60/240,014, filed Oct. 13, 2000. The
following definitions and methods are provided to better define the
present invention and to guide those of ordinary skill in the art
in the practice of the present invention. Unless otherwise noted,
terms are to be understood according to conventional usage by those
of ordinary skill in the relevant art. Definitions of common terms
in molecular biology may also be found in Rieger et al., Glossary
of Genetics: Classical and Molecular, 5th edition, Springer-Verlag:
New York, 1991; and Lewin, Genes V, Oxford University Press: New
York, 1994. The nomenclature for DNA bases as set forth at 37 CFR
.sctn. 1.822 is used.
[0022] As used herein, the term "corn" means Zea mays or maize and
includes all plant varieties that can be bred with corn, including
wild maize species.
[0023] As used herein, the term "comprising" means "including but
not limited to".
[0024] "Glyphosate" refers to N-phosphonomethylglycine and its
salts, Glyphosate is the active ingredient of Roundup.RTM.
herbicide (Monsanto Co.). Treatments with "glyphosate herbicide"
refer to treatments with the Roundup.RTM., Roundup Ultra.RTM.,
Roundup UltraMax.RTM. herbicide or any other herbicide formulation
containing glyphosate. The selection of application rates for a
glyphosate formulation that constitute a biologically effective
dose is within the skill of the ordinary agricultural
technician.
[0025] A DNA construct is an assembly of DNA molecules linked
together that provide one or more expression cassettes. The DNA
construct is preferably a plasmid that is enabled for self
replication in a bacterial cell and contains various endonuclease
enzyme restriction sites that are useful for introducing DNA
molecules that provide functional genetic elements, i.e.,
promoters, introns, leaders, coding sequences, 3' termination
regions, among others. The expression cassettes contained within a
DNA construct comprise the necessary genetic elements to provide
transcription of a messenger RNA. The expression cassettes can be
designed to express in prokaryote cells or eukaryotic cells. The
expression cassettes of the present invention are designed to
express most preferably in plant cells.
[0026] A transgenic "event" is produced by transformation of plant
cells with heterologous DNA construct, including a nucleic acid
expression cassette that comprises a transgene of interest, the
regeneration of a population of plants resulting from the insertion
of the transgene into the genome of the plant, and selection of a
particular plant characterized by insertion into a particular
genome location. The term "event" refers to the original
transformant and progeny of the transformant that include the
heterologous DNA. The term "event" also refers to progeny produced
by a sexual outcross between the transformant and another variety
that include the heterologous DNA. Even after repeated
back-crossing to a recurrent parent, the inserted DNA and flanking
DNA from the transformed parent is present in the progeny of the
cross at the same chromosomal location. The term "event" also
refers to DNA from the original transformant comprising the
inserted DNA and flanking genomic sequence immediately adjacent to
the inserted DNA that would be expected to be transferred to a
progeny that receives inserted DNA including the transgene of
interest as the result of a sexual cross of one parental line that
includes the inserted DNA (e.g., the original transformant and
progeny resulting from selfing) and a parental line that does not
contain the inserted DNA. A glyphosate tolerant corn plant
PV-ZMGT32 (nk603) can be breed by first sexually crossing a first
parental corn plant consisting of a corn plant grown from the
transgenic corn plant PV-ZMGT32 (nk603) having ATCC Accession No.
PTA-2478 and progeny thereof derived from transformation with the
expression cassettes of the present invention that tolerates
application of glyphosate herbicide, and a second parental corn
plant that lacks the tolerance to glyphosate herbicide, thereby
producing a plurality of first progeny plants; and then selecting a
first progeny plant that is tolerant to application of glyphosate
herbicide; and selfing the first progeny plant, thereby producing a
plurality of second progeny plants; and then selecting from the
second progeny plants a glyphosate herbicide tolerant plant. These
steps can further include the back-crossing of the first glyphosate
tolerant progeny plant or the second glyphosate tolerant progeny
plant to the second parental corn plant or a third parental corn
plant, thereby producing a corn plant that tolerates the
application of glyphosate herbicide.
[0027] It is also to be understood that two different transgenic
plants can also be mated to produce offspring that contain two
independently segregating added, exogenous genes. Selfing of
appropriate progeny can produce plants that are homozygous for both
added, exogenous genes. Back-crossing to a parental plant and
out-crossing with a non-transgenic plant are also contemplated, as
is vegetative propagation. Descriptions of other breeding methods
that are commonly used for different traits and crops can be found
in one of several references, e.g., Fehr, in Breeding Methods for
Cultivar Development, Wilcox J. ed., American Society of Agronomy,
Madison Wis. (1987).
[0028] A "probe" is an isolated nucleic acid to which is attached a
conventional detectable label or reporter molecule, e.g., a
radioactive isotope, ligand, chemiluminescent agent, or enzyme.
Such a probe is complementary to a strand of a target nucleic acid,
in the case of the present invention, to a strand of genomic DNA
from corn event PV-ZMGT32(nk603) whether from a corn plant or from
a sample that includes DNA from the event. Probes according to the
present invention include not only deoxyribonucleic or ribonucleic
acids but also polyamides and other probe materials that bind
specifically to a target DNA sequence and can be used to detect the
presence of that target DNA sequence.
[0029] "Primers" are isolated nucleic acids that are annealed to a
complementary target DNA strand by nucleic acid hybridization to
form a hybrid between the primer and the target DNA strand, then
extended along the target DNA strand by a polymerase, e.g., a DNA
polymerase. Primer pairs of the present invention refer to their
use for amplification of a target nucleic acid sequence, e.g., by
the polymerase chain reaction (PCR) or other conventional
nucleic-acid amplification methods.
[0030] Probes and primers are of sufficient nucleotide length to
bind to the target DNA sequence specifically in the hybridization
conditions or reaction conditions determined by the operator. This
length may be of any length that is of sufficient length to be
useful in the detection method of choice. Generally, 11 nucleotides
or more in length, preferably 18 nucleotides or more, more
preferably 24 nucleotides or more, and most preferably 30
nucleotides or more are used. Such probes and primers hybridize
specifically to a target sequence under high stringency
hybridization conditions. Preferably, probes and primers according
to the present invention have complete DNA sequence similarity of
contiguous nucleotides with the target sequence, although probes
differing from the target DNA sequence and that retain the ability
to hybridize to target DNA sequences may be designed by
conventional methods.
[0031] Methods for preparing and using probes and primers are
described, for example, in Molecular Cloning: A Laboratory Manual,
2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989 (hereinafter,
"Sambrook et al., 1989"); Current Protocols in Molecular Biology,
ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New
York, 1992 (with periodic updates) (hereinafter, "Ausubel et al.,
1992"); and Innis et al., PCR Protocols: A Guide to Methods and
Applications, Academic Press: San Diego, 1990. PCR-primer pairs can
be derived from a known sequence, for example, by using computer
programs intended for that purpose such as Primer (Version 0.5,
@1991, Whitehead Institute for Biomedical Research, Cambridge,
Mass.).
[0032] Primers and probes based on the flanking DNA and insert
sequences disclosed herein can be used to confirm (and, if
necessary, to correct) the disclosed sequences by conventional
methods, e.g., by re-cloning and sequencing such sequences.
[0033] The nucleic acid probes and primers of the present invention
hybridize under stringent conditions to a target DNA sequence. Any
conventional nucleic acid hybridization or amplification method can
be used to identify the presence of DNA from a transgenic event in
a sample. Nucleic acid molecules or fragments thereof are capable
of specifically hybridizing to other nucleic acid molecules under
certain circumstances. As used herein, two nucleic acid molecules
are said to be capable of specifically hybridizing to one another
if the two molecules are capable of forming an anti-parallel,
double-stranded nucleic acid structure. A nucleic acid molecule is
said to be the "complement" of another nucleic acid molecule if
they exhibit complete complementarity. As used herein, molecules
are said to exhibit "complete complementarity" when every
nucleotide of one of the molecules is complementary to a nucleotide
of the other. Two molecules are said to be "minimally
complementary" if they can hybridize to one another with sufficient
stability to permit them to remain annealed to one another under at
least conventional "low-stringency" conditions. Similarly, the
molecules are said to be "complementary" if they can hybridize to
one another with sufficient stability to permit them to remain
annealed to one another under conventional "high-stringency"
conditions. Conventional stringency conditions are described by
Sambrook et al., 1989, and by Haymes et al., In: Nucleic Acid
Hybridization, A Practical Approach, IRL Press, Washington, D.C.
(1985), Departures from complete complementarity are therefore
permissible, as long as such departures do not completely preclude
the capacity of the molecules to form a double-stranded structure.
In order for a nucleic acid molecule to serve as a primer or probe
it need only be sufficiently complementary in sequence to be able
to form a stable double-stranded structure under the particular
solvent and salt concentrations employed.
[0034] As used herein, a substantially homologous sequence is a
nucleic acid molecule that will specifically hybridize to the
complement of the nucleic acid molecule to which it is being
compared under high stringency conditions. Appropriate stringency
conditions which promote DNA hybridization, for example, 6.0.times.
sodium chloride/sodium citrate (SSC) at about 45.degree. C.,
followed by a wash of 2.0.times.SSC at 50.degree. C., are known to
those skilled in the art or can be found in Current Protocols in
Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
For example, the salt concentration in the wash step can be
selected from a low stringency of about 2.0.times.SSC at 50.degree.
C. to a high stringency of about 0.2.times.SSC at 50.degree. C. In
addition, the temperature in the wash step can be increased from
low stringency conditions at room temperature, about 22.degree. C.,
to high stringency conditions at about 65.degree. C. Both
temperature and salt may be varied, or either the temperature or
the salt concentration may be held constant while the other
variable is changed. In a preferred embodiment, a nucleic acid of
the present invention will specifically hybridize to one or more of
the nucleic acid molecules set forth in SEQ ID NO: 9, 10, 11 and 12
or complements thereof or fragments of either under moderately
stringent conditions, for example at about 2.0.times.SSC and about
65.degree. C. In a particularly preferred embodiment, a nucleic
acid of the present invention will specifically hybridize to one or
more of the nucleic acid molecules set forth in SEQ ID NO:9 through
SEQ ID NO:12 or complements or fragments of either under high
stringency conditions. In one aspect of the present invention, a
preferred marker nucleic acid molecule of the present invention has
the nucleic acid sequence set forth in SEQ ID NO:9 through SEQ ID
NO: 12 or complements thereof or fragments of either. In another
aspect of the present invention, a preferred marker nucleic acid
molecule of the present invention shares between 80% and 100% or
90% and 100% sequence identity with the nucleic acid sequence set
forth in SEQ ID NO:9 through SEQ ID NO:12 or complement thereof or
fragments of either. In a further aspect of the present invention,
a preferred marker nucleic acid molecule of the present invention
shares between 95% and 100% sequence identity with the sequence set
forth in SEQ ID NO:9 through SEQ ID NO: 12 or complement thereof or
fragments of either. SEQ ID NO:9 through SEQ IN NO:12 may be used
as markers in plant breeding methods to identify the progeny of
genetic crosses similar to the methods described for simple
sequence repeat DNA marker analysis, in "DNA markers: Protocols,
applications, and overviews: (1997) 173-185, Cregan, et al., eds.,
Wiley-Liss N.Y.; all of which is herein incorporated by reference
in its' entirely. The hybridization of the probe to the target DNA
molecule can be detected by any number of methods known to those
skilled in the art, these can include, but are not limited to,
fluorescent tags, radioactive tags, antibody based tags, and
chemiluminescent tags.
[0035] Regarding the amplification of a target nucleic acid
sequence (e.g., by PCR) using a particular amplification primer
pair, "stringent conditions" are conditions that permit the primer
pair to hybridize only to the target nucleic-acid sequence to which
a primer having the corresponding wild-type sequence (or its
complement) would bind and preferably to produce a unique
amplification product, the amplicon, in a DNA thermal amplification
reaction.
[0036] The term "specific for (a target sequence)" indicates that a
probe or primer hybridizes under stringent hybridization conditions
only to the target sequence in a sample comprising the target
sequence.
[0037] As used herein, "amplified DNA" or "amplicon" refers to the
product of nucleic-acid amplification of a target nucleic acid
sequence that is part of a nucleic acid template. For example, to
determine whether the corn plant resulting from a sexual cross
contains transgenic event genomic DNA from the corn plant of the
present invention, DNA extracted from a corn plant tissue sample
may be subjected to nucleic acid amplification method using a DNA
primer pair that includes a first primer derived from flanking
sequence in the genome of the plant adjacent to the insertion site
of inserted heterologous DNA, and a second primer derived from the
inserted heterologous DNA to produce an amplicon that is diagnostic
for the presence of the event DNA. The amplicon is of a length and
has a sequence that is also diagnostic for the event. The amplicon
may range in length from the combined length of the primer pairs
plus one nucleotide base pair, preferably plus about fifty
nucleotide base pairs, more preferably plus about two hundred-fifty
nucleotide base pairs, and even more preferably plus about four
hundred-fifty nucleotide base pairs. Alternatively, a primer pair
can be derived from flanking sequence on both sides of the inserted
DNA so as to produce an amplicon that includes the entire insert
nucleotide sequence (e.g., the Mlu1 DNA fragment of the pMON25496
expression construct, FIG. 1, approximately 6706 nucleotide base
pairs). A member of a primer pair derived from the plant genomic
sequence may be located a distance from the inserted DNA sequence,
this distance can range from one nucleotide base pair up to the
limits of the amplification reaction, or about twenty thousand
nucleotide base pairs. The use of the term "amplicon" specifically
excludes primer dimers that may be formed in the DNA thermal
amplification reaction.
[0038] Nucleic-acid amplification can be accomplished by any of the
various nucleic-acid amplification methods known in the art,
including the polymerase chain reaction (PCR). A variety of
amplification methods are known in the art and are described, inter
alia, in U.S. Pat. Nos. 4,683,195 and 4,683,202 and in PCR
Protocols: A Guide to Methods and Applications, ed. Innis et al.,
Academic Press, San Diego, 1990. PCR amplification methods have
been developed to amplify up to 22 kb of genomic DNA and up to 42
kb of bacteriophage DNA (Cheng et al., Proc. Natl. Acad. Sci. USA
91:5695-5699, 1994). These methods as well as other methods known
in the art of DNA amplification may be used in the practice of the
present invention. The sequence of the heterologous DNA insert or
flanking DNA sequence from corn event PV-ZMGT32(nk603) can be
verified (and corrected if necessary) by amplifying such sequences
from DNA extracted from the ATCC deposit Accession No. PTA-2478
seed or plants using DNA primers derived from the sequences
provided herein followed by standard DNA sequencing of the PCR
amplicon or of the cloned DNA.
[0039] The amplicon produced by these methods may be detected by a
plurality of techniques. One such method is Genetic Bit Analysis
(Nikiforov, et al. Nucleic Acid Res. 22:41674175, 1994) where an
DNA oligonucleotide is designed which overlaps both the adjacent
flanking genomic DNA sequence and the inserted DNA sequence. The
oligonucleotide is immobilized in wells of a microwell plate.
Following PCR of the region of interest (using one primer in the
inserted sequence and one in the adjacent flanking genomic
sequence), a single-stranded PCR product can be hybridized to the
immobilized oligonucleotide and serve as a template for a single
base extension reaction using a DNA polymerase and labelled ddNTPs
specific for the expected next base. Readout may be fluorescent or
ELISA-based. A signal indicates presence of the insert/flanking
sequence due to successful amplification, hybridization, and single
base extension.
[0040] Another method is the Pyrosequencing technique as described
by Winge (Innov. Pharma. Tech. 00:18-24, 2000). In this method an
oligonucleotide is designed that overlaps the adjacent genomic DNA
and insert DNA junction. The oligonucleotide is hybridized to
single-stranded PCR product from the region of interest (one primer
in the inserted sequence and one in the flanking genomic sequence)
and incubated in the presence of a DNA polymerase, ATP,
sulfurylase, luciferase, apyrase, adenosine 5' phosphosulfate and
luciferin. DNTPs are added individually and the incorporation
results in a light signal which is measured. A light signal
indicates the presence of the transgene insert/flanking sequence
due to successful amplification, hybridization, and single or
multi-base extension.
[0041] Fluorescence Polarization as described by Chen, et al.,
(Genome Res. 9:492-498, 1999) is a method that can be used to
detect the amplicon of the present invention. Using this method an
oligonucleotide is designed which overlaps the genomic flanking and
inserted DNA junction. The oligonucleotide is hybridized to
single-stranded PCR product from the region of interest (one primer
in the inserted DNA and one in the flanking genomic DNA sequence
and incubated in the presence of a DNA polymerase and a
fluorescent-labeled ddNTP. Single base extension results in
incorporation of the ddNTP. Incorporation can be measured as a
change in polarization using a fluorometer. A change in
polarization indicates the presence of the transgene
insert/flanking sequence due to successful amplification,
hybridization, and single base extension.
[0042] Taqman.RTM. (PE Applied Biosystems, Foster City, Calif.) is
described as a method of detecting and quantifying the presence of
a DNA sequence and is fully understood in the instructions provided
by the manufacturer. Briefly, a FRET oligonucleotide probe is
designed which overlaps the genomic flanking and insert DNA
junction. The FRET probe and PCR primers (one primer in the insert
DNA sequence and one in the flanking genomic sequence) are cycled
in the presence of a thermostable polymerase and dNTPs.
Hybridization of the FRET probe results in cleavage and release of
the fluorescent moiety away from the quenching moiety on the FRET
probe. A fluorescent signal indicates the presence of the
flanking/transgene insert sequence due to successful amplification
and hybridization.
[0043] Molecular Beacons have been described for use in sequence
detection as described in Tyangi, et al. (Nature Biotech.
14:303-308, 1996) Briefly, a FRET oligonucleotide probe is designed
that overlaps the flanking genomic and insert DNA junction. The
unique structure of the FRET probe results in it containing
secondary structure that keeps the fluorescent and quenching
moieties in close proximity. The FRET probe and PCR primers (one
primer in the insert DNA sequence and one in the flanking genomic
sequence) are cycled in the presence of a thermostable polymerase
and dNTPs. Following successful PCR amplification, hybridization of
the FRET probe to the target sequence results in the removal of the
probe secondary structure and spatial separation of the fluorescent
and quenching moieties. A fluorescent signal results. A fluorescent
signal indicates the presence of the flanking/transgene insert
sequence due to successful amplification and hybridization.
[0044] The following examples are included to demonstrate examples
of certain preferred embodiments of the invention. It should be
appreciated by those of skill in the art that the techniques
disclosed in the examples that follow represent approaches the
inventors have found function well in the practice of the invention
and thus can be considered to constitute examples of preferred
modes for its practice. However, those of skill in the art should,
in light of the present disclosure, appreciate that many changes
can be made in the specific embodiments that are disclosed and
still obtain a like or similar result without departing from the
spirit and scope of the invention.
EXAMPLES
Example 1
[0045] The PV-ZMGT32(nk603) (hence forth referred to as nk603)
transgenic corn event was generated by microprojectile bombardment
of maize embryos (Songstad et al., In Vitro Cell Plant 32:179-183,
1996) using a linear Mlu1 DNA fragment derived from pMON25496 (FIG.
1). This DNA fragment contains two transgene expression cassettes
that collectively confer corn plant tolerance to glyphosate. The
first cassette is composed of the rice actin 1 promoter and intron
(P-Os.Act1 and I-Os.Act1, U.S. Pat. No. 5,641,876), operably
connected to an Arabidopsis EPSPS chloroplast transit peptide
(TS-At.EPSPS:CTP2, Klee et al., Mol. Gen. Genet. 210:47-442, 1987),
operably connected to a glyphosate tolerant
5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) from
Agrobacterium sp. strain CP4 (AGRTU.aroA:CP4, U.S. Pat. No.
5,633,435) and operably connected to a nopaline synthase
transcriptional terminator (T-AGRTU.nos, Fraley et al. Proc. Natl.
Acad. Sci. USA 80:4803-4807, 1983). The second transgene expression
cassette consists of the cauliflower mosaic virus 35S promoter
containing a tandem duplication of the enhancer region (P-CaMV.35S,
Kay et al. Science 236:1299-1302, 1987; U.S. Pat. No. 5,164,316),
operably connected to a Zea mays Hsp70 intron (I-Zm.Hsp70, U.S.
Pat. No. 5,362,865), operably connected to an Arabidopsis EPSPS
chloroplast transit peptide (TS-At.EPSPS:CTP2, Klee et al., Mol.
Gen. Genet. 210:47442, 1987), operably connected to a glyphosate
tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) from
Agrobacterium sp. strain CP4 (AGRTU.aroA:CP4, U.S. Pat. No.
5,633,435) and operably connected to a nopaline synthase
transcriptional terminator (T-AGRTU.nos, Fraley et al. Proc. Natl.
Acad. Sci. USA 80:4803-4807, 1983). Post-bombardment,
glyphosate-tolerant transgenic calli were selected on media
containing 3 mM glyphosate and plants were subsequently
regenerated. Three hundred-four plants from 91 independent
transgenic events were produced, nk603 was selected from this
population based on a superior combination of characteristics
including glyphosate tolerance, agronomic performance, and single
transgenic insertion. Greenhouse and field evaluations of the nk603
event and its derived progeny indicated this transgenic insertion
confers tolerance that exceeds commercial specifications for full
vegetative and reproductive tolerance to 340 g glyphosate/acre (840
g glyphosate/hectare; 32 oz Roundup Ultra/acre) when applied at the
V4 and V8 leaf stages.
Example 2
[0046] The glyphosate tolerant nk603 corn event was compared to the
current commercial standard, GA21 (U.S. Pat. No. 6,040,497), for
tolerance to glyphosate vegetative injury and effect on yield. GA21
contains at least 3 transgene expression cassettes arranged in
tandem in the genome of GA21 event (SCP/GMO/232-Final, European
Commission Health & Consumer Protection Directorate-General).
The transgene cassette of GA21 consists of a rice actin 1 promoter
and intron linked to a ribulose 1,5-bisphosphate carboxylase
chloroplast transit peptide linked to a modified maize glyphosate
resistant EPSPS and a 3' nopaline synthase transcription
termination region. Plants of nk603 and GA21 were planted in rows
in replicated field plots. The treatments were 1) unsprayed, 2)
sprayed at a 64 ounces/acre rate of Roundup Ultra.RTM.(at V4 leaf
stage and again with 64 ounces/acre Roundup Ultra.RTM.(at V8 leaf
stage, 3) sprayed at a 96 ounces/acre rate of Roundup Ultra.RTM. at
V4 leaf stage and again with 96 ounces/acre Roundup Ultra.RTM. at
V8 leaf stage. Vegetative tolerance was measured as percent
vegetative injury determined by the amount of leaf malformation
observed 10 days after the herbicide treatment at the V8 leaf
stage. The yield of each plot was measured in bushels/acre and the
percent reduction in yield determined for each herbicide treatment
relative to the unsprayed treatment. The results shown in Table 1
illustrates that nk603 shows a lower percent vegetative injury
level than the GA21 plants and the observed percent yield reduction
is also less for the nk603 event. A low incidence of vegetative
injury was observed in the unsprayed plots, this observation is
attributable to various environmental factors other than glyphosate
herbicide exposure. The double expression cassette of pMON25496 in
nk603 was compared to vegetative injury and fertility rating of 3
independent corn events obtained from only the CaMV.35S promoter
driving expression of the glyphosate tolerance gene
(AGRTU.aroA:CP4). It was observed that the double expression
cassette conferred a higher level of vegetative tolerance and
reproductive tolerance than three independent corn events (ev 1, ev
2, and ev 3) containing only the expression cassette where the
glyphosate tolerance gene expression was driven by the CaMV.35S
promoter. A higher level of vegetative tolerance to glyphosate
herbicide injury was observed for nk603 plus 3 additional corn
events derived from pMON25496 when compared to the average injury
of 6 corn events derived from a construct where the glyphosate
tolerance gene expression was driven only by the rice actin
promoter and intron (P-Os.Act1/I-Os.Act1). The plants transformed
with the double expression cassette possessed a higher level of
glyphosate tolerance to vegetative and fertility injury than plants
derived from transformation with the single expression cassettes
this resulted in improved resistance to yield loss due to
glyphosate herbicide application. The pMON25496 construct provides
two plant expression cassettes at a single location in nk603 that
confers a higher lever of glyphosate tolerance than the triple
tandem insertion occurring in the commercial standard, GA21.
TABLE-US-00001 TABLE 1 Glyphosate Tolerance of nk603-Vegetative
injury, Yield, and Fertility Rating % Veg Yield % Yield Event
Treatment injury* (bushels/acre) red. GA21 Unsprayed 0.3 142.2 64
oz Roundup Ultra .RTM. at 5.3 134.1 5.7 V4 followed by 64 oz at V8
96 oz Roundup Ultra .RTM. at 8.3 129.1 9.2 V4 followed by 96 oz at
V8 nk603 Unsprayed 0.9 145.6 64 oz Roundup Ultra .RTM. at 2.9 138.5
4.9 V4 followed by 64 oz at V8 96 oz Roundup Ultra .RTM. at 4.7
140.1 3.8 V4 followed by 96 oz at V8 Fertility Treatment Rating**
nk603 64 oz Roundup .RTM. Ultra at V8 4.5 CaMV.35S ev 1 64 oz
Roundup .RTM. Ultra at V8 2.0 CaMV.35S ev 2 64 oz Roundup .RTM.
Ultra at V8 2.2 CaMV.35S ev 3 64 oz Roundup .RTM. Ultra at V8 2.4
ave. % Veg Treatment injury* nk603 plus 3 additional 128 oz Roundup
.RTM. Ultra at V4 22.9 pMON25496 events followed by 128 oz at V8
Six P--Os.Act1 128 oz Roundup .RTM. Ultra at V4 28.9 single
cassette events followed by 128 oz at V8 *Veg injury is observed 10
days after V8 treatment is one measure taken to assess vegetative
injury in response to glyphosate treatment. **Male fertility
rating: 4-5 = fully fertile; 3 = significantly reduced pollen shed;
0-2 = completely sterile-highly sterile, not suitable for
commercial use.
Example 3
[0047] The corresponding flanking DNA molecule from nk603 was
cloned by using ligated adapters and nested PCR as described in the
Genome Walker.TM. kit (catalog #K1807-1, CloneTech Laboratories,
Inc, Palo Alto, Calif.). First, genomic DNA from the nk603 event
was purified by the CTAB purification method (Rogers et al., Plant
Mol. Biol. 5:69-76, 1985). The genomic DNA libraries for
amplification were prepared according to manufacturer's
instructions (Genome Walker.TM., CloneTech Laboratories, Inc, Palo
Alto, Calif.). In separate reactions, genomic DNA was digested
overnight at 37.degree. C. with the following blunt-end restriction
endonucleases: EcoRV, ScaI, DraI, PvuII, and StuI (CloneTech
Laboratories, Inc, Palo Alto, Calif.). The reaction mixtures were
extracted with phenol:chloroform, the DNA was precipitated by the
addition of ethanol to the aqueous phase, pelleted by
centrifugation, then resuspended in Tris-EDTA buffer (10 mM
Tris-.HCl, pH 8.0, 1 mM EDTA). The purified blunt-ended genomic DNA
fragments were ligated to the Genome Walker.TM. adapters according
to the manufacturer's protocol. After ligation, each reaction was
heat treated (70.degree. C. for 5 min) to terminate the reaction
and then diluted 10-fold in Tris-EDTA buffer. One .mu.l of each
respective ligation was then amplified in a 50 .mu.M reaction that
included 1 .mu.l of respective adapter-ligated library, 1 .mu.l of
10 .mu.M Genome Walker.TM. adapter primer AP1
(5'GTATATCGACTCACTATAGGGC 3', SEQ ID NO: 1), 1 .mu.l of 10 .mu.M
nk603 transgene-specific oligonucleotide (5'
TGACGTATCAAAGTACCGACAAAAACATCC 3' SEQ ID NO:2), 1 .mu.l 10 mM
deoxyribonucleotides, 2.5 .mu.l dimethyl sulfoxide, 5 .mu.l of
10.times.PCR buffer containing MgCl.sub.2, 0.5 .mu.l (2.5 units) of
Amplitaq thermostable DNA polymerase (PE Applied Biosystems, Foster
City, Calif.), and H.sub.2O to 50 .mu.l. The reactions were
performed in a thermocycler using calculated temperature control
and the following cycling conditions: 1 cycle of 95.degree. C. for
9 min; 7 cycles of 94.degree. C. for 2 s, 70.degree. C. for 3 min;
36 cycles of 94.degree. C. for 2 s, 65.degree. C. for 3 min; 1
cycle of 65.degree. C. for 4 min. One .mu.l of each primary
reaction was diluted 50-fold with water and amplified in a
secondary reaction (1 .mu.l of respective diluted primary reaction,
1 .mu.l of 10 .mu.M Genome Walker.TM. nested adapter primer AP2
(5'ACTATAGGGCACGCGTGGT 3', SEQ ID NO:3, supplied by manufacturer),
1 .mu.l of 10 .mu.M nk603 transgene-specific nested oligonucleotide
(5'CTTTGTTTATTTTGGACTATCCCGACTC 3', SEQ ID NO:4), 1 .mu.l 10 mM
deoxyribonucleotides, 2.5 RI dimethyl sulfoxide, 5 .mu.l of
10.times.PCR buffer containing MgCl.sub.2, 0.5 .mu.l (2.5 units) of
Amplitaq thermostable DNA polymerase (PE Applied Biosystems, Foster
City, Calif.), and H.sub.2O to 50 .mu.l] using the following
cycling conditions: 1 cycle of 95.degree. C. for 9 min; 5 cycles of
94.degree. C. for 2 s, 70.degree. C. for 3 min; 24 cycles of
94.degree. C. for 2 s, 65.degree. C. for 3 min; 1 cycle of
65.degree. C. for 4 min.
[0048] PCR products, representing 5' regions that span the junction
between the nk603 transgenic insertion and the neighboring flanking
corn DNA were purified by agarose gel electrophoresis followed by
purification from the agarose matrix using the QIAquick Gel
Extraction Kit (catalog #28704, Qiagen Inc., Valencia, Calif.) and
direct cloning into the pGEM-T Easy vector (catalog. # A1360,
Promega, Madison, Wis.). The identity of the cloned PCR products
and relationship to the Mlu I fragment of pMON25496 was confirmed
by DNA sequence analysis (ABI Prism 377, PE Biosystems, Foster
City, Calif. and DNASTAR sequence analysis software, DNASTAR Inc.,
Madison, Wis.).
[0049] Similarly, the nk603 3' flanking corn DNA sequence was
amplified and cloned using nested gene specific primers, such as,
SEQ ID NO:5 (5' AGATTGAATCCTGTTGCCGGTCTTGC 3') and SEQ ID NO:6 (5'
GCGGTGTCATCTATGTTACTAGATCGGG 3') that anneal to the T-AGRTU.nos
transcriptional terminator. Two T-AGRTU.nos transcriptional
terminators are present in the nk603 transgenic/genomic insertion,
one internal in the construct and one at the 3' end of the
construct adjacent to corn genomic DNA. The PCR products produced
in this reaction were sequenced and the DNA sequence that spans the
junction between transgene and flanking sequence was distinguished
from products of the internal T-AGRTU.nos by comparison to the
known genetic element sequences of the pMON25496 construct as
previously described.
[0050] Corn DNA sequence flanking both sides of the transgenic
insertion was determined for nk603 by sequencing the Genome
Walker.TM.-derived amplification products and alignment to known
transgene sequence. At the 5' end of the transgenic insertion, the
sequence of a 498 bp segment around the insertion junction was
determined (SEQ ID NO:7). This consisted of 304 base pairs (bp) of
the flanking maize genomic DNA sequence (nucleotides 1-304 of SEQ
ID NO:7), 45 bp of pMON25496 construct DNA sequence (nucleotides
305-349 of SEQ ID NO:7) and 149 bp of DNA sequence from the 5' end
of P-Os.Act1 (nucleotides 350-498 of SEQ ID NO:7).
[0051] The DNA sequence was determined for a 1183 bp segment around
the 3' insertion junction (SEQ ID NO:8), that begins with 164 bp of
the T-AGRTU.nos transcriptional terminator (nucleotides 1-164 of
SEQ ID NO:8), 217 bp of pMON25496 construct DNA sequence
(nucleotides 165-381 of SEQ ID NO:8), 305 bp of the maize plastid
genes, rpsll and rpoA (partial segments of each gene corresponding
to bases 63-363 of Genbank accession X07810, corresponding to bases
382-686 of SEQ ID NO:8), and the remaining DNA sequence consisting
of maize genomic DNA sequence flanking the integration site
(corresponding to bases 687-1183 of SEQ ID NO:8).
[0052] The junction DNA molecules, SEQ ID NO:9, 10, 11, and 12 are
novel DNA molecules in nk603 and are diagnostic for corn plant
nk603 and its progeny. The junction molecules in SEQ ID NO:9, 10,
and 11 represent about 9 nucleotides on each side of an insertion
site of a transgene DNA fragment and corn genomic DNA. SEQ ID NO:9
is found at nucleotide positions 295-314 of SEQ ID NO:7. The
junction sequences SEQ ID NO: 10 and 11 are located at nucleotide
positions 373-390 and 678-695, respectively, of SEQ ID NO:8,
representing a junction DNA molecule of construct DNA sequence with
corn plastid DNA sequence (SEQ ID NO:10) and construct sequence
with corn genomic DNA sequence (SEQ ID NO: 11). SEQ ID NO: 12 is
located at nucleotide position 156-173 of SEQ ID NO:8 and
represents a novel DNA molecule in nk603 due to it being a fusion
of the T-AGRTU.nos terminator sequence with an inverted fragment of
the rice actin promoter DNA sequence.
Example 4
[0053] DNA event primer pairs are used to produce an amplicon
diagnostic for nk603. These event primer pairs include but are not
limited to SEQ ID NO: 13 and SEQ ID NO: 14 for the 5' amplicon DNA
molecule and SEQ ID NO: 15 and SEQ ID NO: 16 for the 3' amplicon
DNA molecule. In addition to these primer pairs, any primer pair
derived from SEQ ID NO:7 and SEQ ID NO:8 that when used in a DNA
amplification reaction produces a DNA amplicon diagnostic for nk603
is an aspect of the present invention. The amplification conditions
for this analysis is illustrated in Table 2 and Table 3 for the 5'
transgene insert/genomic junction region. The same method is
applied for amplification of the 3' amplicon DNA molecule using
primer DNA molecules SEQ ID NO: 15 and SEQ ID NO: 16, however, any
modification of these methods that use DNA molecules or complements
thereof to produce an amplicon DNA molecule diagnostic for nk603 is
within the ordinary skill of the art. In addition, a control primer
pair (SEQ ID NO:17 and 18) for amplification of an endogenous corn
gene is included as an internal standard for the reaction
conditions. The analysis of nk603 plant tissue DNA extract sample
should include a positive tissue DNA extract control from nk603, a
negative DNA extract control from a corn plant that is not nk603,
and a negative control that contains no template corn DNA extract.
Additional DNA primer molecules of sufficient length can be
selected from SEQ ID NO:7 and SEQ ID NO:8 by those skilled in the
art of DNA amplification methods, and conditions optimized for the
production of an amplicon that may differ from the methods shown in
Table 2 and Table 3 but result in an amplicon diagnostic for nk603.
The use of these DNA primer sequences with modifications to the
methods of Table 2 and 3 are within the scope of the invention. The
amplicon wherein at least one DNA primer molecule of sufficient
length derived from SEQ ID NO:7 and SEQ ID NO:8 that is diagnostic
for nk603 is an aspect of the invention. The amplicon wherein at
least one DNA primer of sufficient length derived from any of the
genetic elements of pMON25496 that is diagnostic for nk603 is an
aspect of the invention. The assay for the nk603 amplicon can be
performed by using a Stratagene Robocycler, MJ Engine, Perkin-Elmer
9700, or Eppendorf Mastercycler Gradient thermocycler as shown in
Table 3, or by methods and apparatus known to those skilled in the
art. TABLE-US-00002 TABLE 2 PCR procedure and reaction mixture for
the confirmation of nk603 5' transgene insert/genomic junction
region. Step Reagent Amount Comments 1 Nuclease-free water add to
final -- volume of 20 .mu.l 2 10.times. reaction 2.0 .mu.l 1.times.
final buffer (with MgCl.sub.2) concentration of buffer, 1.5 mM
final concentration of MgCl.sub.2 3 10 mM solution 0.4 .mu.l 200
.mu.M final of dATP, dCTP, concentration of dGTP, and dTTP each
dNTP 4 event primer 0.4 .mu.l 0.2 .mu.M final (SEQ ID NO: 13)
concentration (resuspended in 1.times. TE buffer or nuclease-free
water to a concentration of 10 .mu.M) 5 event primer 0.4 .mu.l 0.2
.mu.M final (SEQ ID NO: 14) concentration (resuspended in 1.times.
TE buffer or nuclease-free water to a concentration of 10 .mu.M) 6
control primer 0.2 .mu.l 0.1 .mu.M final (SEQ ID NO: 17)
concentration (resuspended in 1.times. TE buffer or nuclease-free
water to a concentration of 10 .mu.M) 7 control primer 0.2 .mu.l
0.1 .mu.M final (SEQ ID NO: 18) concentration (resuspended in
1.times. TE buffer or nuclease-free water to a concentration of 10
.mu.M) 8 RNase, DNase 0.1 .mu.l 50 ng/reaction free (500 ng/.mu.l)
9 REDTaq DNA 1.0 .mu.l 1 unit/reaction polymerase (recommended (1
unit/.mu.l) to switch pipets prior to next step) 10 Extracted DNA
-- (template): Samples to be analyzed individual 10-200 ng of
leaves genomic DNA pooled leaves 200 ng of (maximum of genomic DNA
50 leaves/pool) Negative 50 ng of corn control genomic DNA
(notnk603) Negative no template DNA control Positive 50 ng of nk603
control genomic DNA
[0054] TABLE-US-00003 TABLE 3 Suggested PCR parameters for
different thermocyclers Gently mix and, if needed (no hot top on
thermocycler), add 1-2 drops of mineral oil on top of each
reaction. Proceed with the PCR in a Stratagene Robocycler, MJ
Engine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient
thermocycler using the following cycling parameters. Cycle No.
Settings: Stratagene Robocycler 1 94.degree. C. 3 minutes 38
94.degree. C. 1 minute 60.degree. C. 1 minute 72.degree. C. 1
minute and 30 seconds 1 72.degree. C. 10 minutes Cycle No.
Settings: MJ Engine or Perkin-Elmer 9700 1 94.degree. C. 3 minutes
38 94.degree. C. 10 seconds 60.degree. C. 30 seconds 72.degree. C.
1 minute 1 72.degree. C. 10 minutes Cycle No. Settings: Eppendorf
Mastercycler Gradient 1 94.degree. C. 3 minutes 38 94.degree. C. 15
seconds 60.degree. C. 15 seconds 72.degree. C. 1 minute 1
72.degree. C. 10 minutes Note: The MJ Engine or Eppendorf
Mastercycler Gradient thermocycler should be run in the calculated
mode. Run the Perkin-Elmer 9700 thermocycler with the ramp speed
set at maximum.
[0055] A deposit of the Monsanto Company, corn seed of event
PV-ZMGT32(nk603) disclosed above has been made under the Budapest
Treaty with the American Type Culture Collection (ATCC), 10801
University Boulevard, Manassas, Va. 20110. The ATCC accession
number is PTA-2478. The deposit will be maintained in the
depository for a period of 30 years, or 5 years after the last
request, or for the effective life of the patent, whichever is
longer, and will be replaced as necessary during that period.
[0056] Having illustrated and described the principles of the
present invention, it should be apparent to persons skilled in the
art that the invention can be modified in arrangement and detail
without departing from such principles. We claim all modifications
that are within the spirit and scope of the appended claims.
[0057] All publications and published patent documents cited in
this specification are incorporated herein by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
Sequence CWU 1
1
16 1 22 DNA Artificial Sequence misc_feature (1)..(22) fully
synthetic DNA 1 gtatatcgac tcactatagg gc 22 2 30 DNA Artificial
Sequence misc_feature (1)..(30) fully synthetic DNA 2 tgacgtatca
aagtaccgac aaaaacatcc 30 3 19 DNA Artificial Sequence misc_feature
(1)..(19) fully synthetic DNA 3 actatagggc acgcgtggt 19 4 29 DNA
Artificial Sequence misc_feature (1)..(29) fully synthetic DNA 4
ctttgtttta ttttggacta tcccgactc 29 5 26 DNA Artificial Sequence
misc_feature (1)..(26) fully synthetic DNA 5 agattgaatc ctgttgccgg
tcttgc 26 6 28 DNA Artificial Sequence misc_feature (1)..(28) fully
synthetic DNA 6 gcggtgtcat ctatgttact agatcggg 28 7 498 DNA
Artificial Sequence misc_feature (1)..(498) Chimeric DNA of Zea
mays genomic DNA and Oryzae sativa Act 1 promoter DN 7 aatcgatcca
aaatcgcgac tgaaatggtg gaagaaagag agaacagaga gcctcacgtt 60
tccagggtga agtatcagag gatttaccgc ccatgccttt tatggagaca agaaggggag
120 gaggtaaaca gatcagcatc agcgctcgaa agtttcgtca aaggatgcgg
aactgtttcc 180 agccgccgtc gccattcggc cagactcctc ctctctcggc
atgagccgat cttttctctg 240 gcatttccaa ccctagagac gtgcgtccct
ggtgggctgc tcggccagca agccttgtag 300 cggcccacgc gtggtaccaa
gcttgatatc cctagggcgg ccgcgttaac aagcttactc 360 gaggtcattc
atatgcttga gaagagagtc gggatagtcc aaaataaaac aaaggtaaga 420
ttaccggtca aaagtgaaaa catcagttaa aaggtgtata aagtaaaata tcggtaataa
480 aaggtggccc aaagtgaa 498 8 1183 DNA Artificial Sequence
misc_feature (1)..(1183) Chimeric DNA of Agrobacterium tumefaciens
nos termination region and Zea mays plastid DNA and Zea mays
genomic DNA 8 gacgttattt atgagatggg tttttatgat tagagtcccg
caattataca tttaatacgc 60 gatagaaaac aaaatatagc gcgcaaacta
ggataaatta tcgcgcgcgg tgtcatctat 120 gttactagat cggggatatc
cccggggaat tcggtaccaa gcttttataa tagtagaaaa 180 gagtaaattt
cactttgggc caccttttat taccgatatt ttactttata ccacctttta 240
actgatgttt tcacttttga ccaggtaatc ttacctttgt tttattttgg actatcccga
300 ctctcttctc aagcatatga atgacctcga gtaagcttgt taacgcggcc
gccctaggga 360 tatcaagctt ggtaccacgc gacacacttc cactctagtg
tttgagtgga tcctgttatc 420 tcttctcgaa ccataacaga ctagtattat
ttgatcattg aatcgtttat ttctcttgaa 480 agcggtttca ttttttttta
cagacgtctt tttttaggag gtcgacatcc attatgcggc 540 ataggtgtta
catcgcgtat acaacttaac cgtacaccac ttttagcaat ggctcgtaat 600
gcggcatctc ttccgctacc agcacctttt accataactt ctgctcgttg caaacccact
660 gtacgaatag catctactgc tgttctgctg actttatttt ttttaataaa
gtgaaaaacc 720 ataaaatgga caacaacacc ctgcccttca ctaccggtcg
gagcgacgcc gaagatgggg 780 ttcaacacgg tcgcgacacg gatgcaacgg
accctccaag ccaatactcg aggccggacc 840 gacgacgtag gcaggggtgg
ccataacgac ggtggcggca tccaacttgt tctttccctt 900 tctctgtctt
caacttgcgc cggcagtctg ctagacccag gggatgctgt gtggaggaga 960
ggtcgcgggg cccgattttt atagcctggg cgaggacgag cttggccgaa ccgatccaga
1020 gctctgcgca aatcacgaag aaccagtggg gccgctcgcg cctagcccac
cgccaggagc 1080 ggggcttgtt gcgagccgta gcgtcgggaa ggggacgacc
cgctaggggg gcccatgctc 1140 cagcgcccag agagaaaaaa agaaaggaag
gcgcgagatg atg 1183 9 19 DNA Artificial Sequence misc_feature
(1)..(19) Chimeric DNA of Zea mays genomic DNA and transgene insert
DNA 9 tgtagcggcc cacgcgtgg 19 10 18 DNA Artificial Sequence
misc_feature (1)..(18) Chimeric DNA of transgene insert DNA and Zea
mays plastid DNA 10 taccacgcga cacacttc 18 11 18 DNA Artificial
Sequence misc_feature (1)..(18) Chimeric DNA of Zea mays plastid
DNA and transgene insert DNA 11 tgctgttctg ctgacttt 18 12 18 DNA
Artificial Sequence misc_feature (1)..(18) Chimeric DNA of
Agrobacterium tumefaciens nos termination region DNA and Oryzae
sativa Act1 promoter DN 12 accaagcttt tataatag 18 13 22 DNA
Artificial Sequence misc_feature (1)..(22) fully synthetic DNA 13
aatcgatcca aaatcgcgac tg 22 14 22 DNA Artificial Sequence
misc_feature (1)..(22) fully synthetic DNA 14 ttcactttgg gccacctttt
at 22 15 22 DNA Artificial Sequence misc_feature (1)..(22) fully
synthetic DNA 15 gacgttattt atgagatggg tt 22 16 22 DNA Artirficial
Sequence misc_feature (1)..(22) fully synthetic DNA 16 catcatctcg
cgccttcctt tc 22
* * * * *