U.S. patent application number 11/200525 was filed with the patent office on 2007-12-06 for production of polyketides.
Invention is credited to Robert L. Arslanian.
Application Number | 20070281343 11/200525 |
Document ID | / |
Family ID | 38828434 |
Filed Date | 2007-12-06 |
United States Patent
Application |
20070281343 |
Kind Code |
A9 |
Arslanian; Robert L. |
December 6, 2007 |
PRODUCTION OF POLYKETIDES
Abstract
Recombinant Myxococcus host cells can be used to produce
polyketides, including epothilone and epothilone analogs that can
be purified from the fermentation broth and crystallized.
Inventors: |
Arslanian; Robert L.;
(Pacifica, CA) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER
EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20070092954 A1 |
April 26, 2007 |
|
|
Family ID: |
38828434 |
Appl. No.: |
11/200525 |
Filed: |
August 8, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09957483 |
Sep 19, 2001 |
6998256 |
|
|
11200525 |
Aug 8, 2005 |
|
|
|
PCT/US01/13793 |
Apr 26, 2001 |
|
|
|
09957483 |
Sep 19, 2001 |
|
|
|
09825856 |
Apr 3, 2001 |
6489314 |
|
|
PCT/US01/13793 |
Apr 26, 2001 |
|
|
|
09825857 |
Apr 5, 2001 |
|
|
|
PCT/US01/13793 |
Apr 26, 2001 |
|
|
|
09560367 |
Apr 28, 2000 |
6410301 |
|
|
PCT/US01/13793 |
Apr 26, 2001 |
|
|
|
60269020 |
Feb 13, 2001 |
|
|
|
60257517 |
Dec 21, 2000 |
|
|
|
60232696 |
Sep 14, 2000 |
|
|
|
Current U.S.
Class: |
435/117 ;
548/181 |
Current CPC
Class: |
C07D 417/06 20130101;
C12P 17/181 20130101; C12P 17/167 20130101 |
Class at
Publication: |
435/117 ;
548/181 |
International
Class: |
C12P 17/00 20060101
C12P017/00; C07D 417/02 20060101 C07D417/02 |
Claims
1-47. (canceled)
48. Crystalline epothilone D.
Description
FIELD OF THE INVENTION
[0001] The present invention provides recombinant methods and
materials for producing polyketides in recombinant host cells;
recombinant host cells that produce polyketides; novel polyketides
related in structure to the epothilones; methods for purifying
epothilones; and crystalline forms of epothilone D. In a preferred
embodiment, the recombinant host cells of the invention are from
the suborder Cystobacterineae, preferably from the genera
Myxococcus and Stigmatella, which have been transformed with
recombinant DNA expression vectors of the invention that encode
modular or iterative polyketide synthase (PKS) genes. The
recombinant host cells produce known and novel polyketides,
including but not limited to epothilone and epothilone derivatives.
The invention relates to the fields of agriculture, chemistry,
medicinal chemistry, medicine, molecular biology, and
pharmacology.
BACKGROUND OF THE INVENTION
[0002] Polyketides constitute a class of structurally diverse
compounds synthesized, at least in part, from two carbon unit
building block compounds through a series of Claisen type
condensations and subsequent modifications. Polyketides include
antibiotics such as tetracycline and erythromycin, anticancer
agents such as the epothilones and daunomycin, and
immunosuppressants such as FK506, FK520, and rapamycin. Polyketides
occur naturally in many types of organisms, including fungi and
mycelial bacteria. Polyketides are synthesized in vivo by
polyketide synthase enzymes commonly referred to as PKS enzymes.
Two major types of PKS are known that differ in their structure and
the manner in which they synthesize polyketides. These two types
are commonly referred to as Type I or modular and Type II or
iterative (aromatic) PKS enzymes.
[0003] The present invention provides methods and recombinant
expression vectors and host cells for the production of modular and
iterative PKS enzymes and the polyketides produced by those
enzymes. Modular PKS enzymes are typically multi-protein complexes
in which each protein contains multiple active sites, each of which
is used only once during carbon chain assembly and modification.
Iterative PKS enzymes are typically multi-protein complexes in
which each protein contains only one or at most two active sites,
each of which is used multiple times during carbon chain assembly
and modification. As described in more detail below, a large number
of the genes for both modular and aromatic PKS enzymes have been
cloned.
[0004] Modular PKS genes are composed of coding sequences organized
to encode a loading module, a number of extender modules, and a
releasing domain. As described more fully below, each of these
domains and modules corresponds to a polypeptide with one or more
specific functions. Generally, the loading module is responsible
for binding the first building block used to synthesize the
polyketide and transferring it to the first extender module. The
building blocks used to form complex polyketides are typically
acylthioesters, most commonly acetyl, propionyl, malonyl,
methylmalonyl, hydroxymalonyl, methoxymalonyl, and ethylmalonyl
CoA. Other building blocks include amino acid and amino acid-like
acylthioesters. PKSs catalyze the biosynthesis of polyketides
through repeated, decarboxylative Claisen condensations between the
acylthioester building blocks. Each module is responsible for
binding a building block, performing one or more functions on that
building block, and transferring the resulting compound to the next
module. The next module, in turn, is responsible for attaching the
next building block and transferring the growing compound to the
next module until synthesis is complete. At that point, the
releasing domain, often an enzymatic thioesterase (TE) activity,
cleaves the polyketide from the PKS.
[0005] The polyketide known as 6-deoxyerythronolide B (6-dEB) is
synthesized by a prototypical modular PKS enzyme. The genes, known
as eryAI, eryAII, and eryAIII, that code for the multi-subunit
protein known as deoxyerythronolide B synthase or DEBS (each
subunit is known as DEBS1, DEBS2, or DEBS3) that synthesizes 6-dEB
are described in U.S. Pat. Nos. 5,672,491, 5,712,146 and 5,824,513,
each of which is incorporated herein by reference.
[0006] The loading module of the DEBS PKS consists of an
acyltransferase (AT) and an acyl carrier protein (ACP). The AT of
the DEBS loading module recognizes propionyl CoA (other loading
module ATs can recognize other acyl-CoAs, such as acetyl, malonyl,
methylmalonyl, or butyryl CoA) and transfers it as a thioester to
the ACP of the loading module. Concurrently, the AT on each of the
six extender modules of DEBS recognizes a methylmalonyl CoA (other
extender module ATs can recognize other CoAs, such as malonyl or
alpha-substituted malonyl CoAs, i.e., malonyl, ethylmalonyl, and
2-hydroxymalonyl CoA) and transfers it to the ACP of that module to
form a thioester. Once DEBS is primed with propionyl- and
methylmalonyl-ACPs, the acyl group of the loading module migrates
to form a thioester (trans-esterification) at the KS of the first
extender module; at this stage, module one possesses an acyl-KS
adjacent to a methylmalonyl ACP. The acyl group derived from the
DEBS loading module is then covalently attached to the alpha-carbon
of the extender group to form a carbon-carbon bond, driven by
concomitant decarboxylation, and generating a new acyl-ACP that has
a backbone two carbons longer than the loading unit (elongation or
extension). The growing polyketide chain is transferred from the
ACP to the KS of the next module of DEBS, and the process
continues.
[0007] The polyketide chain, growing by two carbons for each module
of DEBS, is sequentially passed as a covalently bound thioester
from module to module, in an assembly line-like process. The carbon
chain produced by this process alone would possess a ketone at
every other carbon atom, producing a polyketone, from which the
name polyketide is derived. Commonly, however, additional enzymatic
activities modify the beta keto group of the polyketide chain to
which the two-carbon unit has been added before the chain is
transferred to the next module. Thus, in addition to the minimal
module containing KS, AT, and ACP necessary to form the
carbon-carbon bond, modules may contain a ketoreductase (KR) that
reduces the beta-keto group to an alcohol. Modules may also contain
a KR plus a dehydratase (DH) that dehydrates the alcohol to a
double bond. Modules may also contain a KR, a DH, and an
enoylreductase (ER) that converts the double bond to a saturated
single bond using the beta carbon as a methylene function. The DEBS
modules include those with only a KR domain, only an inactive KR
domain, and with all three KR, DH, and ER domains.
[0008] Once a polyketide chain traverses the final module of a PKS,
it encounters the releasing domain, typically a thioesterase, found
at the carboxyl end of most modular PKS enzymes. Here, the
polyketide is cleaved from the enzyme and, for many but not all
polyketides, cyclized. The polyketide can be further modified by
tailoring or modification enzymes; these enzymes add carbohydrate
groups or methyl groups, or make other modifications, i.e.,
oxidation or reduction, on the polyketide core molecule and/or
substituents thereon. For example, 6-dEB is hydroxylated and
glycosylated (glycosidated), and one of the glycosyl substituents
methylated to yield the well known antibiotic erythromycin A in the
Saccharopolyspora erythraea cells in which it is naturally
produced.
[0009] While the above description applies generally to modular PKS
enzymes and specifically to DEBS, there are a number of variations
that exist in nature. For example, many PKS enzymes comprise
loading modules that, unlike the loading module of DEBS, comprise
an "inactive" KS domain that functions as a decarboxylase. This
inactive KS is in most instances called KS.sup.Q, where the
superscript is the single-letter abbreviation for the amino acid
(glutamine) that is present instead of the active site cysteine
required for ketosynthase activity. The epothilone PKS loading
module contains a KS.sup.Y domain in which tyrosine is present
instead of the active site cysteine. Moreover, the synthesis of
other polyketides begins with starter units that are unlike those
bound by the DEBS or epothilone loading modules. The enzymes that
bind such starter units can include, for example, an AMP ligase
such as that employed in the biosynthesis of FK520, FK506, and
rapamycin, a non-ribosomal peptide synthase (NRPS) such as that
employed in the biosynthesis of leinamycin, or a soluble CoA
ligase.
[0010] Other important variations in PKS enzymes relate to the
types of building blocks incorporated as extender units. As for
starter units, some PKS enzymes incorporate amino acid like
acylthioester building blocks using one or more NRPS modules as
extender modules. The epothilone PKS, for example, contains an NRPS
module. Another such variation is found in the FK506, FK520, and
rapamycin PKS enzymes, which contain an NRPS that incorporates a
pipecolate residue and also serves as the releasing domain of the
PKS. Yet another variation relates to additional activities in an
extender module. For example, one module of the epothilone PKS
contains a methyltransferase (MT) domain, which incorporates a
methyl group into the polyketide.
[0011] Recombinant methods for manipulating modular and iterative
PKS genes are described in U.S. Pat. Nos. 5,962,290; 5,672,491;
5,712,146; 5,830,750; and 5,843,718; and in PCT patent publication
Nos. 98/49315 and 97/02358, each of which is incorporated herein by
reference. These and other patents describe recombinant expression
vectors for the heterologous production of polyketides as well as
recombinant PKS genes assembled by combining parts of two or more
different PKS genes or gene clusters that produce novel
polyketides. To date, such methods have been used to produce known
or novel polyketides in organisms such as Streptomyces, which
naturally produce polyketides, and E. coli and yeast, which do not
naturally produce polyketides (see U.S. Pat. No. 6,033,883,
incorporated herein by reference). In the latter hosts, polyketide
production is dependent on the heterologous expression of a
phosphopantetheinyl transferase, which activates the ACP domains of
the PKS (see PCT publication No. 97/13845, incorporated herein by
reference).
[0012] While such methods are valuable and highly useful, certain
polyketides are expressed only at very low levels in, or are toxic
to, the heterologous host cell employed. As an example, the
anticancer agents epothilones A, B, C, and D were produced in
Streptomyces by heterologous expression of the epothilone PKS genes
(Tang et al., 28 Jan. 00, Cloning and heterologous expression of
the epothilone gene cluster, Science, 287: 640-642, and PCT Pub.
No. 00/031247, each of which is incorporated herein by reference).
Epothilones A and B were produced at less than about 50 to 100
.mu.g/L and appeared to have a deleterious effect on the producer
cells.
[0013] Epothilones A and B were first identified as an antifungal
activity extracted from the myxobacterium Sorangium cellulosum (see
Gerth et al., 1996, J. Antibiotics 49: 560-563 and Germany Patent
No. DE 41 38 042, each of which is incorporated herein by
reference) and later found to have activity in a tubulin
polymerization assay (see Bollag et al., 1995, Cancer Res.
55:2325-2333, incorporated herein by reference). Epothilones A and
B and certain naturally occurring and synthetic derivatives have
since been extensively studied as potential antitumor agents for
the treatment of cancer. The chemical structures of the epothilones
produced by Sorangium cellulosum strain So ce 90 were described in
Hofle et al., 1996, Epothilone A and B-novel 16-membered macrolides
with cytotoxic activity: isolation, crystal structure, and
conformation in solution, Angew. Chem. Int. Ed. Engl. 35(13/14):
1567-1569, incorporated herein by reference. Epothilones A
(R.dbd.H) and B (R.dbd.CH.sub.3) have the structure shown below and
show broad cytotoxic activity against eukaryotic cells and
noticeable activity and selectivity against breast and colon tumor
cell lines. ##STR1##
[0014] The desoxy counterparts of epothilones A and B, also known
as epothilones C(R.dbd.H) and D (R.dbd.CH.sub.3), have been
chemically synthesized de novo but are also present as minor
products in fermentations of S. cellulosum. Epothilones C and D are
less cytotoxic than epothilones A and B; their structures are shown
below. ##STR2##
[0015] Other naturally occurring epothilones have been described.
These include epothilones E and F., in which the methyl side chain
of the thiazole moiety of epothilones A and B has been hydroxylated
to yield epothilones E and F, respectively, as well as many other
epothilone compounds (see PCT Pub. No. 99/65913, incorporated
herein by reference).
[0016] Because of the potential for use of the epothilones as
anticancer agents, and because of the low levels of epothilone
produced by the native So ce 90 strain, a number of research teams
undertook the effort to synthesize the epothilones. As noted above,
this effort has been successful (see Balog et al., 1996, Total
synthesis of (-)-epothilone A, Angew. Chem. Int. Ed. Engl.
35(23/24): 2801-2803; Su et al., 1997, Total synthesis of
(-)-epothilone B: an extension of the Suzuki coupling method and
insights into structure-activity relationships of the epothilones,
Angew. Chem. Int. Ed. Engl. 36(7): 757-759; Meng et al., 1997,
Total syntheses of epothilones A and B, JACS 119(42): 10073-10092;
and Balog et al., 1998, A novel aldol condensation with
2-methyl-4-pentenal and its application to an improved total
synthesis of epothilone B, Angew. Chem. Int. Ed. Engl. 37(19):
2675-2678, each of which is incorporated herein by reference).
Despite the success of these efforts, the chemical synthesis of the
epothilones is tedious, time-consuming, and expensive. Indeed, the
methods have been characterized as impractical for the full-scale
pharmaceutical development of any epothilone as an anticancer
agent.
[0017] A number of epothilone derivatives, as well as epothilones
A-D, have been studied in vitro and in vivo (see Su et al., 1997,
Structure-activity relationships of the epothilones and the first
in vivo comparison with paclitaxel, Angew. Chem. Int. Ed. Engl.
36(19): 2093-2096; and Chou et al., August 1998, Desoxyepothilone
B: an efficacious microtubule-targeted antitumor agent with a
promising in vivo profile relative to epothilone B, Proc. Natl.
Acad. Sci. USA 95: 9642-9647, each of which is incorporated herein
by reference). Additional epothilone derivatives and methods for
synthesizing epothilones and epothilone derivatives are described
in PCT Pub. Nos. 00/23452, 00/00485, 99/67253, 99/67252, 99/65913,
99/54330, 99/54319, 99/54318, 99/43653, 99/43320, 99/42602,
99/40047, 99/27890, 99/07692, 99/02514, 99/01124, 98/25929,
98/22461, 98/08849, and 97/19086; U.S. Pat. No. 5,969,145; and
Germany patent publication No. DE 41 38 042, each of which is
incorporated herein by reference.
[0018] There remains a need for economical means to produce not
only the naturally occurring epothilones but also the derivatives
or precursors thereof, as well as new epothilone derivatives with
improved properties. There remains a need for a host cell that
produces epothilones or epothilone derivatives that is easier to
manipulate and ferment than the natural producer Sorangium
cellulosum and that produces more of the desired polyketide
product. The present invention meets these needs by providing host
cells that produce polyketides at high levels and are useful in the
production of not only epothilones, including new epothilone
derivatives described herein, but also other polyketides.
SUMMARY OF THE INVENTION
[0019] In one embodiment, the present invention provides
recombinant host cells of the suborder Cystobacterineae containing
recombinant expression vectors that encode heterologous PKS genes
and produce polyketides synthesized by the PKS enzymes encoded by
the genes on those vectors. In a preferred embodiment, the host
cells are from the genus Myxococcus or the genus Stigmatella. In
especially preferred embodiments, the host cells are selected from
the group consisting of M. stipitatus, M. fulvus, M. xanthus, M.
virescens, S. erecta, and S. aurantiaca.
[0020] In another embodiment, the present invention provides
recombinant DNA vectors capable of chromosomal integration or
extrachromosomal replication in the host cells of the invention.
The vectors of the invention comprise at least a portion of a PKS
coding sequence and are capable of directing expression of a
functional PKS enzyme in the host cells of the invention. In a
related embodiment, the present invention provides vectors and host
cells that comprise the genes and gene products required to produce
a substrate for polyketide biosynthesis that is either not produced
or is produced in low abundance in a host cell of the invention. In
one embodiment, the genes and gene products catalyze the synthesis
of ethylmalonyl CoA. In another embodiment, the genes and gene
products catalyze the synthesis of butyryl CoA.
[0021] In another embodiment, the present invention provides a
method for producing a polyketide in a host cell of the suborder
Cystobacterineae, which polyketide is not naturally produced in
said host cell, said method comprising culturing the host cell
transformed with a recombinant DNA vector of the invention under
conditions such that a PKS gene encoded on the vector is expressed
and said polyketide is produced. In a related embodiment, the
present invention provides methods for fermenting the host cells of
the invention that result in the production of polyketides in high
yied.
[0022] In a preferred embodiment, the recombinant host cell of the
invention produces epothilone or an epothilone derivative. Thus,
the present invention provides recombinant host cells that produce
a desired epothilone or epothilone derivative. In a preferred
embodiment, the host cell produces one or more epothilones at equal
to or greater than 10 mg/L. In one embodiment, the invention
provides host cells that produce one or more epothilones at levels
higher than the levels produced in a naturally occurring organism
that produces epothilones. In another embodiment, the invention
provides host cells that produce mixtures of epothilones that are
less complex than the mixtures produced by a naturally occurring
host cell that produces epothilones. The recombinant host cells of
the invention also include host cells that produce only one desired
epothilone or epothilone derivative as a major product.
[0023] In a related preferred embodiment, the invention provides
recombinant DNA expression vectors that encode all or a portion of
the epothilone PKS. Thus, the present invention provides
recombinant DNA expression vectors that encode the proteins
required to produce epothilones A, B, C, and D in the host cells of
the invention. The present invention also provides recombinant DNA
expression vectors that encode portions of these proteins. The
present invention also provides recombinant DNA compounds that
encode a hybrid protein, which hybrid protein includes all or a
portion of a protein involved in epothilone biosynthesis and all or
a portion of a protein involved in the biosynthesis of another
polyketide or non-ribosomal-derived peptide.
[0024] In another embodiment, the present invention provides novel
epothilone derivative compounds in substantially pure form useful
in agriculture, veterinary practice, and medicine. These compounds
include the 16-desmethyl; 14-methyl; 13-oxo; 13-oxo-11,12-dehydro;
12-ethyl; 13-hydroxy-10,11-dehydro; 11-oxo; 11-hydroxy; 10-methyl;
10,11-dehydro; 9-oxo; 9-hydroxy; 8-desmethyl; 6-desmethyl; and
2-methyl analogs of epothilones A, B, C, and D, and a variety of
analogs in which the methylthiazole moiety of the naturally
occurring epothilones has been replaced with another moiety. In one
embodiment, the compounds are useful as fungicides. In another
embodiment, the compounds are useful in cancer chemotherapy as
anticancer agents. In a preferred embodiment, the compound is an
epothilone derivative that is at least as potent against tumor
cells as epothilone B or D. In another embodiment, the compounds
are useful as immunosuppressants. In another embodiment, the
compounds are useful in the manufacture of another compound. In a
preferred embodiment, the compounds are formulated in a mixture or
solution for administration to a human or animal.
[0025] In another embodiment, the present invention provides
methods for purifying an epothilone. In a preferred embodiment, the
epothilone is purified from fermentation broth.
[0026] In another embodiment, the present invention provides an
epothilone compound in a highly purified form. In a preferred
embodiment, the epothilone is more than 95% pure. In a more
preferred embodiment, the epothilone is more than 99% pure. In an
especially preferred embodiment, the invention provides an
epothilone in crystalline form. In one especially preferred
embodiment, the invention provides crystalline epothilone D.
[0027] In another embodiment, the present invention provides a
method of treating cancer, which method comprises administering a
therapeutically effective amount of a novel epothilone compound of
the invention. The compounds and compositions of the invention are
also useful in the treatment of other hyperproliferative diseases
and conditions, including, but not limited to, psoriasis and
inflammation.
[0028] These and other embodiments of the invention are described
in more detail in the following description, the examples, and
claims set forth below.
BRIEF DESCRIPTION OF THE FIGURES
[0029] FIG. 1 shows a number of precursor compounds to N-acetyl
cysteamine thioester derivatives that can be supplied to an
epothilone PKS of the invention in which the NRPS-like module one
or module two KS domain has been inactivated to produce a novel
epothilone derivative. A general synthetic procedure for making
such compounds is also shown.
[0030] FIG. 2 shows restriction site and function maps of plasmids
pKOS35-82.1 and pKOS35-82.2.
[0031] FIG. 3 shows restriction site and function maps of plasmids
pKOS35-154 and pKOS90-22.
[0032] FIG. 4 shows a schematic of a protocol for introducing the
epothilone PKS and modification enzyme genes into the chromosome of
a Myxococcus xanthus host cell as described in Example 2.
[0033] FIG. 5 shows a map of pBeloBACII as described in Example
2.
[0034] FIG. 6 shows the baseline performance of Myxococcus xanthus
strain K111-40-1 in a simple production medium consisting only of 5
g/L casitone (a pancreatic casein digest) and 2 g/L magnesium
sulfate. Legend: Growth (.cndot.), production (.box-solid.), and
ammonia generation (.tangle-solidup.) profiles for the basal CTS
medium in a batch process; culture conditions were as described in
Materials and Methods in Example 3.
[0035] FIG. 7 shows the effect of XAD-16 resin on the fermentation
performance of Myxococcus xanthus strain K111-40-1 in CTS
production medium. Legend: Growth (.cndot.) and production
(.box-solid.) profiles with the incorporation of 20 g/L XAD-16
resin to the CTS production medium in a batch process.
[0036] FIG. 8 shows the influence of casitone on growth and product
yield. Legend: Effect of casitone concentration on growth
(.cndot.), production (.box-solid.), and specific productivity
(.tangle-solidup.).
[0037] FIG. 9 shows the influence of trace elements and higher
methyl oleate concentrations on growth and product yield. Legend:
Effect of methyl oleate (.cndot.) and trace elements (.box-solid.)
on production.
[0038] FIG. 10A shows the growth and production of the M. xanthus
strain in the presence of optimal concentrations of methyl oleate
and trace elements in a batch fermentation process. Exponential
growth of the occurred during the first two days after inoculation.
Production of epothilone D began at the onset of the stationary
phase and ceased when cell lysis occurred with the depletion of
methyl oleate on day 5. FIG. 10B shows the time courses
corresponding to the consumption of methyl oleate and generation of
ammoniaduring the growth and proudction of the M. xanthus strain in
the presence of optimal concentrations of methyl oleate and trace
elements in a batch fermentation process. Legend: A.) Growth
(.cndot.) and production (.box-solid.) profiles with the addition
of optimal concentrations of methyl oleate (7 mL/L) and trace
elements (4 mL/L) to the CTS production medium in a batch process.
B.) Time courses corresponding to the consumption of methyl oleate
(.cndot.) and the generation of ammonia (.box-solid.).
[0039] FIG. 11A shows the influence of intermittent fed-batch
process on the growth and production of the M. xanthus strain.
Legend: Growth (.cndot.) and production (.box-solid.) profiles for
the intermittent fed-batch process in shake-flasks. The casitone
and methyl oleate feed rates were 2 g/L/day and 3 mL/L/day,
respectively. FIG. 11B shows the constant rates of consumption of
methyl oleate and generation of ammonia during the course of the
fermentation. Legend: Time courses corresponding to the total
addition of methyl oleate to the cultures (.cndot.), the total
consumption of methyl oleate (.box-solid.), and the generation of
ammonia (.tangle-solidup.).
[0040] FIG. 12 shows the production profile for the intermittent
fed-batch process in a 5-L bioreactor. The casitone and methyl
oleate feed rates were 2 g/L/day and 3 mL/L/day, respectively.
[0041] FIG. 13A shows the impact of continous feeds on growth and
production. Legend: Growth (.cndot.) and production (.box-solid.)
profiles for the continuous fed-batch process in a 5-L bioreactor.
The casitone and methyl oleate feed rates were 2 g/L/day and 3
mL/L/day, respectively. FIG. 13B shows the time course of methyl
oleate addition and consumption as well as the generation of
ammonia during the continuous fed-batch process. Legend: Time
courses corresponding to the total addition of methyl oleate to the
cultures (.cndot.), the total consumption of methyl oleate
(.box-solid.), and the generation of ammonia (.tangle-solidup.);
culture conditions were as described in Materials and Methods
DETAILED DESCRIPTION OF THE INVENTION
[0042] Statements regarding the scope of the present invention and
definitions of terms used herein are listed below. The definitions
apply to the terms as they are used throughout this specification,
unless otherwise limited in specific instances, either individually
or as part of a larger group.
[0043] All stereoisomers of the inventive compounds are included
within the scope of the invention, as pure compounds as well as
mixtures thereof. Individual enantiomers, diastereomers, geometric
isomers, and combinations and mixtures thereof are all encompassed
by the present invention. Furthermore, some of the crystalline
forms for the compounds may exist as polymorphs and as such are
included in the present invention. In addition, some of the
compounds may form solvates with water (i.e., hydrates) or common
organic solvents, and such solvates are also encompassed within the
scope of this invention.
[0044] Protected forms of the inventive compounds are included
within the scope of the present invention. A variety of protecting
groups are disclosed, for example, in T. H. Greene and P. G. M.
Wuts, Protective Groups in Organic Synthesis, Third Edition, John
Wiley & Sons, New York (1999), which is incorporated herein by
reference in its entirety. For example, a hydroxy protected form of
the inventive compounds are those where at least one of the
hydroxyl groups is protected by a hydroxy protecting group.
Illustrative hydroxylprotecting groups include but not limited to
tetrahydropyranyl; benzyl; methylthiomethyl; ethylthiomethyl;
pivaloyl; phenylsulfonyl; triphenylmethyl; trisubstituted silyl
such as trimethyl silyl, triethylsilyl, tributylsilyl,
tri-isopropylsilyl, t-butyldimethylsilyl, tri-t-butylsilyl,
methyldiphenylsilyl, ethyldiphenylsilyl, t-butyldiphenylsilyl and
the like; acyl and aroyl such as acetyl, pivaloylbenzoyl,
4-methoxybenzoyl, 4-nitrobenzoyl and aliphatic acylaryl and the
like. Keto groups in the inventive compounds may similarly be
protected.
[0045] The present invention includes within its scope prodrugs of
the compounds of this invention. In general, such prodrugs are
functional derivatives of the compounds that are readily
convertible in vivo into the required compound. Thus, in the
methods of treatment of the present invention, the term
"administering" shall encompass the treatment of the various
disorders described with the compound specifically disclosed or
with a compound which may not be specifically disclosed, but which
converts to the specified compound in vivo after administration to
a subject in need thereof. Conventional procedures for the
selection and preparation of suitable prodrug derivatives are
described, for example, in "Design of Prodrugs", H. Bundgaard ed.,
Elsevier, 1985.
[0046] As used herein, the term "aliphatic" refers to saturated and
unsaturated straight chained, branched chain, cyclic, or polycyclic
hydrocarbons that may be optionally substituted at one or more
positions. Illustrative examples of aliphatic groups include alkyl,
alkenyl, alkynyl, cycloalkyl, cycloalkenyl, and cycloalkynyl
moieties. The term "alkyl" refers to straight or branched chain
saturated hydrocarbon substituent. "Alkenyl" refers to a straight
or branched chain hydrocarbon substituent with at least one
carbon-carbon double bond. "Alkynyl" refers to a straight or
branched chain hydrocarbon substituent with at least one
carbon-carbon triple bound.
[0047] The term "aryl" refers to monocyclic or polycyclic groups
having at least one aromatic ring structure that optionally include
one ore more heteroatoms and preferably include three to fourteen
carbon atoms. Aryl substituents may optionally be substituted at
one or more positions. Illustrative examples of aryl groups include
but are not limited to: furanyl, imidazolyl, indanyl, indenyl,
indolyl, isooxazolyl, isoquinolinyl, naphthyl, oxazolyl,
oxadiazolyl, phenyl, pyrazinyl, pyridyl, pyrimidinyl, pyrrolyl,
pyrazolyl, quinolyl, quinoxalyl, tetrahydronaphththyl, tetrazoyl,
thiazoyl, thienyl, thiophenyl, and the like.
[0048] The aliphatic (i.e., alkyl, alkenyl, etc.) and aryl moieties
may be optionally substituted with one or more substituents,
preferably from one to five substituents, more preferably from one
to three substituents, and most preferably from one to two
substituents. The definition of any substituent or variable at a
particular location in a molecule is independent of its definitions
elsewhere in that molecule. It is understood that substituents and
substitution patterns on the compounds of this invention can be
selected by one of ordinary skill in the art to provide compounds
that are chemically stable and that can be readily synthesized by
techniques known in the art as well as those methods set forth
herein. Examples of suitable substituents include but are not
limited to: alkyl, alkenyl, alkynyl, aryl, halo; trifluoromethyl;
trifluoromethoxy; hydroxy; alkoxy; cycloalkoxy; heterocyclooxy;
oxo; alkanoyl (--C(.dbd.O)-alkyl which is also referred to as
"acyl")); aryloxy; alkanoyloxy; amino; alkylamino; arylamino;
aralkylamino; cycloalkylamino; heterocycloamino; disubstituted
amines in which the two amino substituents are selected from alkyl,
aryl, or aralkyl; alkanoylamino; aroylamino; aralkanoylamino;
substituted alkanoylamino; substituted arylamino; substituted
aralkanoylamino; thiol; alkylthio; arylthio; aralkylthio;
cycloalkylthio; heterocyclothio; alkylthiono; arylthiono;
aralkylthiono; alkylsulfonyl; arylsulfonyl; aralkylsulfonyl;
sulfonamido (e.g., SO.sub.2NH.sub.2); substituted sulfonamido;
nitro; cyano; carboxy; carbamyl (e.g., CONH.sub.2); substituted
carbamyl (e.g., --C(.dbd.O)NRR' where R and R' are each
independently hydrogen, alkyl, aryl, aralkyl and the like);
alkoxycarbonyl, aryl, substituted aryl, guanidino, and heterocyclo
such as indoyl, imidazolyl, furyl, thienyl, thiazolyl, pyrrolidyl,
pyridyl, pyrimidyl and the like. Where applicable, the substituent
may be further substituted such as with, alkyl, alkoxy, aryl,
aralkyl, halogen, hydroxy and the like.
[0049] The terms "alkylaryl" or "arylalkyl" refer to an aryl group
with an aliphatic substituent that is bonded to the compound
through the aliphatic group. An illustrative example of an
alkylaryl or arylalkyl group is benzyl, a phenyl with a methyl
group that is bonded to the compound through the methyl group
(--CH.sub.2Ph where Ph is phenyl).
[0050] The term "acyl" refers to --C(.dbd.O)R where R is an
aliphatic group, preferably a C.sub.1-C.sub.6 moiety.
[0051] The term "alkoxy" refers to --OR wherein O is oxygen and R
is an aliphatic group.
[0052] The term "aminoalkyl" refers to --RNH.sub.2 where R is an
aliphatic moiety.
[0053] The terms "halogen," "halo", or "halide" refer to fluorine,
chlorine, bromine and iodine.
[0054] The term "haloalkyl" refers to --RX where R is an aliphatic
moiety and X is one or more halogens.
[0055] The term "hydroxyalkyl" refers to --ROH where R is an
aliphatic moiety.
[0056] The term "oxo" refers to a carbonyl oxygen (.dbd.O).
[0057] In addition to the explicit substitutions at the
above-described groups, the inventive compounds may include other
substitutions where applicable. For example, the lactone or lactam
backbone or backbone substituents may be additionally substituted
(e.g., by replacing one of the hydrogens or by derivatizing a
non-hydrogen group) with one or more substituents such as
C.sub.1-C.sub.5 aliphatic, C.sub.1-C.sub.5 alkoxy, aryl, or a
functional group. Illustrative examples of suitable functional
groups include but are not limited to: acetal, alcohol, aldehyde,
amide, amine, boronate, carbamate, carboalkoxy, carbonate,
carbodiimide, carboxylic acid, cyanohydrin, disulfide, enamine,
ester, ether, halogen, hydrazide, hydrazone, imide, imido, imine,
isocyanate, ketal, ketone, nitro, oxime, phosphine, phosphonate,
phosphonic acid, quaternary ammonium, sulfenyl, sulfide, sulfone,
sulfonic acid, thiol, and the like.
[0058] The term "isolated" as used herein to refer to a compound of
the present invention, means altered "by human intervention from
its natural state. For example, if the compound occurs in nature,
it has been changed or removed from its original environment, or
both. In other words, a compound naturally present in a living
organism is not "isolated," but the same compound separated from
the coexisting materials of its natural state is "isolated", as the
term is employed herein. The term "isolated" can also mean a
compound that is in a preparation that is substantially free of
contaminating or undesired materials. With respect to compounds
found in nature, substantially free of the materials with which
that compound or composition is associated in its natural
state.
[0059] The term "purified" as it refers to a compound means that
the compound is in a preparation in which the compound forms a
major component of the preparation, such as constituting about 50%,
about 60%, about 70%, about 80%, about 90%, about 95% or more by
weight of the components in the preparation.
[0060] The term "subject" as used herein, refers to an animal,
preferably a mammal, who has been the object of treatment,
observation or experiment and most preferably a human who has been
the object of treatment and/or observation.
[0061] The term "therapeutically effective amount" as used herein,
means that amount of active compound or pharmaceutical agent that
elicits the biological or medicinal response in a tissue system,
animal or human that is being sought by a researcher, veterinarian,
medical doctor or other clinician, which includes alleviation of
the symptoms of the disease or disorder being treated.
[0062] The term "composition" is intended to encompass a product
comprising the specified ingredients in the specified amounts, as
well as any product that results, directly or indirectly, from
combinations of the specified ingredients in the specified
amounts.
[0063] The term "pharmaceutically acceptable salt" is a salt of one
or more of the inventive compounds. Suitable pharmaceutically
acceptable salts of the compounds include acid addition salts which
may, for example, be formed by mixing a solution of the compound
with a solution of a pharmaceutically acceptable acid such as
hydrochloric acid, sulfuric acid, fumaric acid, maleic acid,
succinic acid, acetic acid, benzoic acid, citric acid, tartaric
acid, carbonic acid or phosphoric acid. Furthermore, where the
compounds of the invention carry an acidic moiety, suitable
pharmaceutically acceptable salts thereof may include alkali metal
salts (e.g., sodium or potassium salts); alkaline earth metal salts
(e.g., calcium or magnesium salts); and salts formed with suitable
organic ligands (e.g., ammonium, quaternary ammonium and amine
cations formed using counteranions such as halide, hydroxide,
carboxylate, sulfate, phosphate, nitrate, alkyl sulfonate and aryl
sulfonate). Illustrative examples of pharmaceutically acceptable
salts include but are not limited to: acetate, adipate, alginate,
ascorbate, aspartate, benzenesulfonate, benzoate, bicarbonate,
bisulfate, bitartrate, borate, bromide, butyrate, calcium edetate,
camphorate, camphorsulfonate, camsylate, carbonate, chloride,
citrate, clavulanate, cyclopentanepropionate, digluconate,
dihydrochloride, dodecylsulfate, edetate, edisylate, estolate,
esylate, ethanesulfonate, formate, fumarate, gluceptate,
glucoheptonate, gluconate, glutamate, glycerophosphate,
glycolylarsanilate, hemisulfate, heptanoate, hexanoate,
hexylresorcinate, hydrabamine, hydrobromide, hydrochloride,
hydroiodide, 2-hydroxy-ethanesulfonate, hydroxynaphthoate, iodide,
isothionate, lactate, lactobionate, laurate, lauryl sulfate,
malate, maleate, malonate, mandelate, mesylate, methanesulfonate,
methylsulfate, mucate, 2-naphthalenesulfonate, napsylate,
nicotinate, nitrate, N-methylglucamine ammonium salt, oleate,
oxalate, pamoate (embonate), palmitate, pantothenate, pectinate,
persulfate, 3-phenylpropionate, phosphate/diphosphate, picrate,
pivalate, polygalacturonate, propionate, salicylate, stearate,
sulfate, subacetate, succinate, tannate, tartrate, teoclate,
tosylate, triethiodide, undecanoate, valerate, and the like.
[0064] The term "pharmaceutically acceptable carrier" is a medium
that is used to prepare a desired dosage form of the inventive
compound. A pharmaceutically acceptable carrier includes solvents,
diluents, or other liquid vehicle; dispersion or suspension aids;
surface active agents; isotonic agents; thickening or emulsifying
agents, preservatives; solid binders; lubricants and the like.
Remington's Pharmaceutical Sciences, Fifteenth Edition, E. W.
Martin (Mack Publishing Co., Easton, Pa., 1975) and Handbook of
Pharmaceutical Excipients, Third Edition, A. H. Kibbe, ed. (Amer.
Pharmaceutical Assoc. 2000), both of which are incorporated herein
by reference in their entireties, disclose various carriers used in
formulating pharmaceutical compositions and known techniques for
the preparation thereof.
[0065] The term "pharmaceutically acceptable ester" is an ester
that hydrolzyes in vivo into a compound of the present invention or
a salt thereof. Illustrative examples of suitable ester groups
include, for example, those derived from pharmaceutically
acceptable aliphatic carboxylic acids such as formates, acetates,
propionates, butyrates, acrylates, and ethylsuccinates.
[0066] The present invention provides recombinant methods and
materials for producing polyketides in recombinant host cells;
recombinant host cells that produce polyketides; novel polyketides
related in structure to the epothilones; methods for purifying
epothilones; and crystalline forms of epothilone D.
[0067] In one embodiment, the present invention provides
recombinant host cells of the suborder Cystobacterineae containing
recombinant expression vectors that encode heterologous PKS genes
and produce polyketides synthesized by the PKS enzymes encoded on
those vectors. As used herein, the term recombinant refers to a
cell, compound, or composition produced by human intervention,
typically by specific and directed manipulation of a gene or
portion thereof. The suborder Cystobacterineae is one of two (the
other is Sorangineae, which includes the epothilone producer
Sorangium cellulosum) in the order Myxococcales. The suborder
Cystobacterineae includes the family Myxococcaceae and the family
Cystobacteraceae. The family Myxococcacceae includes the genus
Angiococcus (i.e., A. disciformis), the genus Myxococcus, and the
genus Corallococcus (i.e., C. macrosporus, C. corralloides, and C.
exiguus). The family Cystobacteraceae includes the genus
Cystobacter (i.e., C. fuscus, C. ferrugineus, C. minor, C. velatus,
and C. violaceus), the genus Melittangium (i.e., M. boletus and M.
lichenicola), the genus Stigmatella (i.e., S. erecta and S.
aurantiaca), and the genus Archangium (i.e., A. gephyra).
Especially preferred host cells of the invention are those that
produce a polyketide at equal to or greater than 10 to 20 mg/L,
more preferably at equal to or greater than 100 to 200 mg/L, and
most preferably at equal to or greater than 1 to 2 g/L.
[0068] In a preferred embodiment, the host cells of the invention
are from the genus Myxococcus or the genus Stigmatella. In
especially preferred embodiments, the host cells are selected from
the group consisting of M. stipitatus, M. fulvus, M. xanthus, M.
virescens, S. erecta, and S. aurantiaca. Especially preferred
Myxococcus host cells of the invention are those that produce a
polyketide at equal to or greater than 10 to 20 mg/L, more
preferably at equal to or greater than 100 to 200 mg/L, and most
preferably at equal to or greater than 1 to 2 g/L. Especially
preferred are M. xanthus host cells that produce at these levels.
M. xanthus host cells that can be employed for purposes of the
invention include, but are not limited to, the DZ1 cell line
(Campos et al., 1978, J. Mol. Biol. 119: 167-178, incorporated
herein by reference), the TA-producing cell line ATCC 31046, the
DK1219 cell line (Hodgkin and Kaiser, 1979, Mol. Gen. Genet. 171:
177-191, incorporated herein by reference), and the DK1622 cell
line (Kaiser, 1979, Proc. Natl. Acad. Sci. USA 76: 5952-5956,
incorporated herein by reference).
[0069] The host cells of the invention comprise a recombinant DNA
expression vector, and in another embodiment, the present invention
provides recombinant DNA vectors capable of chromosomal integration
or extrachromosomal replication in these host cells. The vectors of
the invention comprise at least a portion of a PKS coding sequence
and are capable of directing expression of a functional PKS enzyme
in the host cells of the invention. As used herein, the term
expression vector refers to any nucleic acid that can be introduced
into a host cell. An expression vector can be maintained stably or
transiently in a cell, whether as part of the chromosomal or other
DNA in the cell or in any cellular compartment, such as a
replicating vector in the cytoplasm. An expression vector also
comprises a gene that serves to direct the synthesis of RNA that is
translated into a polypeptide in the cell or cell extract. Thus,
the vector either includes a promoter to enhance gene expression or
is integrated into a site in the chromosome such that gene
expression is obtained. Furthermore, expression vectors typically
contain additional functional elements, such as
resistance-conferring genes to act as selectable markers and
regulatory genes to enhance promoter activity.
[0070] Typically, the expression vector will comprise one or more
marker genes by which host cells containing the vector can be
identified and/or selected. Illustrative antibiotic resistance
conferring genes for use in vectors of the invention include the
ermE (confers resistance to erythromycin and lincomycin), tsr
(confers resistance to thiostrepton), aadA (confers resistance to
spectinomycin and streptomycin), aacC4 (confers resistance to
apramycin, kanamycin, gentamicin, geneticin (G418), and neomycin),
hyg (confers resistance to hygromycin), and vph (confers resistance
to viomycin) resistance conferring genes. Selectable markers for
use in Myxococcus xanthus include kanamycin, tetracycline,
chloramphenicol, zeocin, spectinomycin, and streptomycin resistance
conferring genes.
[0071] The various components of an expression vector can vary
widely, depending on the intended use of the vector. In particular,
the components depend on the host cell(s) in which the vector will
be used and the manner in which it is intended to function. For
example, certain preferred vectors of the invention are integrating
vectors: the vectors integrate into the chromosomal DNA of the host
cell. Such vectors can comprise a phage attachment site or DNA
segments complementary to segments of the host cell chromosomal DNA
to direct integration. Moreover, and as exemplified herein, a
series of such vectors can be used to build the PKS gene cluster in
the host cell, with each vector comprising only a portion of the
complete PKS gene cluster. Thus, the recombinant DNA expression
vectors of the invention may comprise only a portion of a PKS gene
or gene cluster. Homologous recombination can also be used to
delete, disrupt, or alter a gene, including a heterologous PKS gene
previously introduced into the host cell.
[0072] In a preferred embodiment, the present invention provides
expression vectors and recombinant Myxococcus, preferably M.
xanthus, host cells containing those expression vectors that
produce a polyketide. Presently, vectors that replicate
extrachromosomally in M. xanthus have not been published, although
there is an unpublished report of an artificial plasmid based on
the Mx4 phage replicon. There are, however, a number of phage known
to integrate into M. xanthus chromosomal DNA, including Mx8, Mx9,
Mx81, and Mx82. The integration and attachment functions of these
phages can be placed on plasmids to create phage-based expression
vectors that integrate into the M. xanthus chromosomal DNA. Of
these, phage Mx9 and Mx8 are preferred for purposes of the present
invention. Plasmid pPLH343, described in Salmi et al., February
1998, Genetic determinants of immunity and integration of temperate
Myxococcus xanthus phage Mx8, J. Bact. 180(3): 614-621, is a
plasmid that replicates in E. coli and comprises the phage Mx8
genes that encode the attachment and integration functions.
[0073] A wide variety of promoters are available for use in the
preferred Myxococcus expression vectors of the invention. See
Example 8, below. For example, the promoter of the Sorangium
cellulosum epothilone PKS gene (see PCT Pub. No. 00/031247,
incorporated herein by reference) functions in M. xanthus host
cells. The epothilone PKS gene promoter can be used to drive
expression of one or more epothilone PKS genes or another PKS gene
product in recombinant host cells. Another preferred promoter for
use in M. xanthus host cells for purposes of expressing a
recombinant PKS of the invention is the promoter of the pilA gene
of M. xanthus. This promoter, as well as two M. xanthus strains
that express high levels of gene products from genes controlled by
the pilA promoter, a pilA deletion strain and a pilS deletion
strain, are described in Wu and Kaiser, December 1997, Regulation
of expression of the pilA gene in Myxococcus xanthus, J. Bact.
179(24):7748-7758, incorporated herein by reference. The present
invention also provides recombinant Myxococcus host cells
comprising both the pilA and pilS deletions. Another preferred
promoter is the starvation dependent promoter of the sdeK gene.
[0074] The present invention provides preferred expression vectors
for use in preparing the recombinant Myxococcus xanthus expression
vectors and host cells of the invention. These vectors, designated
plasmids pKOS35-82.1 and pKOS35-82.2 (FIG. 2), are able to
replicate in E. coli host cells as well as integrate into the
chromosomal DNA of M. xanthus. The vectors comprise the Mx8
attachment and integration genes as well as the pilA promoter with
restriction enzyme recognition sites placed conveniently
downstream. The two vectors differ from one another merely in the
orientation of the pilA promoter on the vector and can be readily
modified to include the epothilone PKS and modification enzyme
genes of the invention or other PKS and modification enzyme genes.
The construction of the vectors is described in Example 1.
[0075] In another embodiment, the present invention provides a
method for producing a polyketide in a host cell of the suborder
Cystobacterineae, which polyketide is not naturally produced in
said host cell, said method comprising culturing the host cell
transformed with a recombinant DNA vector of the invention under
conditions such that a PKS gene encoded on the vector is expressed
and said polyketide is produced. With this method, any of the
diverse members of the polyketides produced by modular or iterative
PKS enzymes can be prepared. In addition, novel polyketides derived
from hybrid or other recombinant PKS genes can also be prepared
using this method. In a preferred embodiment, the PKS genes encode
a hybrid modular PKS.
[0076] A large number of modular PKS genes have been cloned and are
immediately available for use in the vectors and methods of the
invention. The polyketides produced by PKS enzymes are often
further modified by polyketide modification enzymes, also called
tailoring enzymes, that hydroxylate, epoxidate, methylate, and/or
glycosylate the polyketide product of the PKS. In accordance with
the methods of the invention, these genes can also be introduced
into the host cell to prepare a modified polyketide of interest.
The following Table lists references describing illustrative PKS
genes and corresponding PKS enzymes that can be utilized in the
construction of the recombinant PKSs and the corresponding DNA
compounds that encode them of the invention. Also presented are
various references describing polyketide tailoring and modification
enzymes and corresponding genes that can be employed to make the
recombinant DNA compounds of the present invention.
PKS and Polyketide Tailoring Enzyme Genes
Avermectin
[0077] U.S. Pat. No. 5,252,474; U.S. Pat. No. 4,703,009; and EP
Pub. No. 118,367 to Merck.
[0078] MacNeil et al., 1993, Industrial Microorganisms: Basic and
Applied Molecular Genetics, Baltz, Hegeman, & Skatrud, eds.
(ASM), pp. 245-256, A Comparison of the Genes Encoding the
Polyketide Synthases for Avermectin, Erythromycin, and
Nemadectin.
[0079] MacNeil et al., 1992, Gene 115: 119-125, Complex
Organization of the Streptomyces avermitilis genes encoding the
avermectin polyketide synthase.
[0080] Ikeda and Omura, 1997, Chem. Res. 97: 2599-2609, Avermectin
biosynthesis.
Candicidin (FR008)
[0081] Hu et al., 1994, Mol. Microbiol. 14: 163-172.
Epothilone
[0082] PCT Pub. No. 99/66028 to Novartis.
[0083] PCT Pub. No. 00/031247 to Kosan.
Erythromycin
[0084] PCT Pub. No. 93/13663; U.S. Pat. No. 6,004,787; and U.S.
Pat. No. 5,824,513 to Abbott.
[0085] Donadio et al., 1991, Science 252:675-9.
[0086] Cortes et al., 8 Nov. 1990, Nature 348:176-8, An unusually
large multifunctional polypeptide in the erythromycin producing
polyketide synthase of Saccharopolyspora erythraea.
Glycosylation Enzymes
[0087] PCT Pub. No. 97/23630 and U.S. Pat. No. 5,998,194 to
Abbott.
FK-506
[0088] Motamedi et al., 1998, The biosynthetic gene cluster for the
macrolactone ring of the immunosuppressant FK-506, Eur. J. biochem.
256: 528-534.
[0089] Motamedi et al., 1997, Structural organization of a
multifunctional polyketide synthase involved in the biosynthesis of
the macrolide immunosuppressant FK-506, Eur. J. Biochem. 244:
74-80.
Methyltransferase
[0090] U.S. Pat. No. 5,264,355 and U.S. Pat. No. 5,622,866 to
Merck.
[0091] Motamedi et al., 1996, Characterization of methyltransferase
and hydroxylase genes involved in the biosynthesis of the
immunosuppressants FK-506 and FK-520, J. Bacteriol. 178:
5243-5248.
FK-520
[0092] PCT Pub. No. 00/20601 to Kosan.
[0093] Nielsen et al., 1991, Biochem. 30:5789-96.
Lovastatin
[0094] U.S. Pat. No. 5,744,350 to Merck.
Nemadectin
[0095] MacNeil et al., 1993, supra.
Niddamycin
[0096] PCT Pub. No. 98/51695 to Abbott.
[0097] Kakavas et al., 1997, Identification and characterization of
the niddamycin polyketide synthase genes from Streptomyces
caelestis, J. Bacteriol. 179: 7515-7522.
Oleandomycin
[0098] Swan et al., 1994, Characterisation of a Streptomyces
antibioticus gene encoding a type I polyketide synthase which has
an unusual coding sequence, Mol. Gen. Genet. 242: 358-362.
[0099] PCT Pub. No. 00/026349 to Kosan.
[0100] Olano et al., 1998, Analysis of a Streptomyces antibioticus
chromosomal region involved in oleandomycin biosynthesis, which
encodes two glycosyltransferases responsible for glycosylation of
the macrolactone ring, Mol. Gen. Genet. 259(3): 299-308.
[0101] PCT Pub. No. 99/05283 to Hoechst.
Picromycin
[0102] PCT Pub. No. 99/61599 to Kosan.
[0103] PCT Pub. No. 00/00620 to the University of Minnesota.
[0104] Xue et al., 1998, Hydroxylation of macrolactones YC-17 and
narbomycin is mediated by the pikC-encoded cytochrome P450 in
Streptomyces venezuelae, Chemistry & Biology 5(11):
661-667.
[0105] Xue et al., October 1998, A gene cluster for macrolide
antibiotic biosynthesis in Streptomyces venezuelae: Architecture of
metabolic diversity, Proc. Natl. Acad. Sci. USA 95:12111 12116.
Platenolide
[0106] EP Pub. No. 791,656; and U.S. Pat. No. 5,945,320 to
Lilly.
Rapamycin
[0107] Schwecke et al., August 1995, The biosynthetic gene cluster
for the polyketide rapamycin, Proc. Natl. Acad. Sci. USA
92:7839-7843.
[0108] Aparicio et al., 1996, Organization of the biosynthetic gene
cluster for rapamycin in Streptomyces hygroscopicus: analysis of
the enzymatic domains in the modular polyketide synthase, Gene 169:
9-16.
Rifamycin
[0109] PCT Pub. No. 98/07868 to Novartis.
[0110] August et al., 13 Feb. 1998, Biosynthesis of the ansamycin
antibiotic rifamycin: deductions from the molecular analysis of the
nf biosynthetic gene cluster of Amycolatopsis mediterranei S669,
Chemistry & Biology, 5(2): 69-79.
Sorangium PKS
[0111] U.S. Pat. No. 6,090,601 to Kosan.
Soraphen
[0112] U.S. Pat. No. 5,716,849 to Novartis.
[0113] Schupp et al., 1995, J. Bacteriology 177: 3673-3679. A
Sorangium cellulosum (Myxobacterium) Gene Cluster for the
Biosynthesis of the Macrolide Antibiotic Soraphen A: Cloning,
Characterization, and Homology to Polyketide Synthase Genes from
Actinomycetes.
Spinocyn
[0114] PCT Pub. No. 99/46387 to DowElanco.
Spiramycin
[0115] U.S. Pat. No. 5,098,837 to Lilly.
[0116] Activator Gene
[0117] U.S. Pat. No. 5,514,544 to Lilly.
Tylosin
[0118] U.S. Pat. No. 5,876,991; U.S. Pat. No. 5,672,497; U.S. Pat.
No. 5,149,638; EP Pub. No. 791,655; and EP Pub. No. 238,323 to
Lilly.
[0119] Kuhstoss et al., 1996, Gene 183:231-6, Production of a novel
polyketide through the construction of a hybrid polyketide
synthase.
[0120] Tailoring enzymes
[0121] Merson-Davies and Cundliffe, 1994, Mol. Microbiol. 13:
349-355. Analysis of five tylosin biosynthetic genes from the tylBA
region of the Streptomyces fradiae genome.
[0122] Any of the above genes, with or without the genes for
polyketide modification, if any, can be employed in the recombinant
DNA expression vectors of the invention. Moreover, the host cells
of the invention can be constructed by transformation with multiple
vectors, each containing a portion of the desired PKS and
modification enzyme gene cluster; see U.S. Pat. No. 6,033,883,
incorporated herein by reference.
[0123] For improved production of a polyketide in a host cell of
the invention, including Myxococcus host cells, one can also
transform the cell to express a heterologous phosphopantetheinyl
transferase. PKS proteins require phosphopantetheinylation of the
ACP domains of the loading and extender modules as well as of the
PCP domain of any NRPS. Phosphopantetheinylation is mediated by
enzymes called phosphopantetheinyl transferases (PPTases). To
produce functional PKS enzyme in host cells that do not naturally
express a PPTase able to act on the desired PKS enzyme or to
increase amounts of functional PKS enzyme in host cells in which
the PPTase is limiting, one can introduce a heterologous PPTase,
including but not limited to Sfp, as described in PCT Pub. Nos.
97/13845 and 98/27203, and U.S. Pat. No. 6,033,883, each of which
is incorporated herein by reference. Another suitable PPTase that
can be used for this purpose is MtaA from Stigmatella
aurantiaca.
[0124] Another method provided by the present invention to improve
polyketide production in any organism, including but not limited to
Myxococcus, Streptomyces, and Sorangium host cells, is to select
cells that are resistant to streptomycin, rifampicin, and/or
gentamycin. In a preferred embodiment, the polyketide producing
host cell is successively challenged with each of these compounds
(or compounds similar in structure thereto), and resistant cells
with increased polyketide production ability are isolated and used
in the next round of selection. In this manner, one can obtain, for
example and without limitation, a Myxococcus xanthus host cell that
produces epothilone or an epothilone derivative at high levels and
is resistant to streptomycin, rifampicin, and gentamycin.
[0125] The host cells of the invention can be used not only to
produce a polyketide found in nature but also to produce
polyketides produced by the products of recombinant PKS genes and
modification enzymes. In one important embodiment, the present
invention provides recombinant DNA expression vectors that comprise
a hybrid PKS. For purposes of the present invention a hybrid PKS is
a recombinant PKS that comprises all or part of one or more
extender modules, loading module, and thioesterase/cyclase domain
of a first PKS and all or part of one or more extender modules,
loading module, and thioesterase/cyclase domain of a second
PKS.
[0126] Those of skill in the art will recognize that all or part of
either the first or second PKS in a hybrid PKS of the invention
need not be isolated from a naturally occurring source. For
example, only a small portion of an AT domain determines its
specificity. See PCT Pub. No. 00/001838, incorporated herein by
reference. The state of the art in DNA synthesis allows the artisan
to construct de novo DNA compounds of size sufficient to construct
a useful portion of a PKS module or domain. For purposes of the
present invention, such synthetic DNA compounds are deemed to be a
portion of a PKS.
[0127] As the above Table illustrates, there are a wide variety of
PKS genes that serve as readily available sources of DNA and
sequence information for use in constructing the hybrid
PKS-encoding DNA compounds of the invention. Methods for
constructing hybrid PKS-encoding DNA compounds are described in
U.S. Pat. Nos. 6,022,731; 5,962,290; 5,672,491; and 5,712,146 and
PCT Pub. Nos. 98/49315; 99/61599; and 00/047724, each of which is
incorporated herein by reference. The hybrid PKS-encoding DNA
compounds of the invention can be hybrids of more than two PKS
genes. Even where only two genes are used, there are often two or
more modules in the hybrid gene in which all or part of the module
is derived from a second PKS gene. Those of skill in the art will
appreciate that a hybrid PKS of the invention includes, but is not
limited to a PKS of any of the following types: (i) a PKS that
contains a module in which at least one of the domains is from a
heterologous module; (ii) a PKS that contains a module from a
heterologous PKS; (iii) a PKS that contains a protein from a
heterologous PKS; and (iv) combinations of the foregoing.
[0128] Hybrid PKS enzymes of the invention are often constructed by
replacing coding sequences for one or more domains of a module from
a first PKS with coding sequences for one or more domains of a
module from a second PKS to construct a recombinant coding
sequence. Generally, any reference herein to inserting or replacing
a KR, DH, and/or ER domain includes the replacement of the
associated KR, DH, or ER domains in that module, typically with
corresponding domains from the module from which the inserted or
replacing domain is obtained. The KS and/or ACP of any module can
also be replaced, if desired or beneficial, with another KS and/or
ACP. For example, if the production of an epothilone derivative
compound is low due to an alteration in a module, production may be
improved by altering the KS and/or ACP domains of the succeeding
module. In each of these replacements or insertions, the
heterologous KS, AT, DH, KR, ER, or ACP coding sequence can
originate from a coding sequence from another module of the same or
different PKS or from chemical synthesis to obtain the hybrid PKS
coding sequence.
[0129] While an important embodiment of the present invention
relates to hybrid PKS genes, the present invention also provides
recombinant PKS genes in which there is no second PKS gene sequence
present but which differ from a naturally occurring PKS gene by one
or more mutations and/or deletions. The deletions can encompass one
or more modules or domains and/or can be limited to a deletion
within one or more modules or domains. When a deletion encompasses
an entire extender module (other than an NRPS module), the
resulting polyketide derivative is at least two carbons shorter
than the compound produced from the PKS from which the deleted
version was derived. The deletion can also encompass an NRPS module
and/or a loading module. When a deletion is within a module, the
deletion may encompass only a single domain, typically a KR, DH, or
ER domain, or more than one domain, such as both DH and ER domains,
or both KR and DH domains, or all three KR, DH, and ER domains. A
domain of a PKS can also be "deleted" functionally by mutation,
such as by random or site-specific mutagenesis. Thus, as
exemplified herein, a KR domain can be rendered non-functional or
less than fully functional by mutation. Moreover, the specificity
of an AT domain can also be altered by mutation, such as by random
or site-specific mutagenesis.
[0130] To construct any PKS of the invention, one can employ a
technique, described in PCT Pub. No. 98/27203 and U.S. Pat. No.
6,033,883, each of which is incorporated herein by reference, in
which the various genes of the PKS and optionally genes for one or
more polyketide modification enzymes are divided into two or more,
often three, segments, and each segment is placed on a separate
expression vector (see also PCT Pub. No. 00/063361, both of which
are incorporated herein by reference). In this manner, the full
complement of genes can be assembled and manipulated more readily
for heterologous expression, and each of the segments of the gene
can be altered, and various altered segments can be combined in a
single host cell to provide a recombinant PKS gene of the
invention. This technique makes more efficient the construction of
large libraries of recombinant PKS genes, vectors for expressing
those genes, and host cells comprising those vectors. In this and
other contexts, the genes encoding the desired PKS not only can be
present on two or more vectors, but also can be ordered or arranged
differently from that which exists in the native producer organism
from which the genes were derived.
[0131] In a preferred and illustrative embodiment, the recombinant
host cell of the invention produces epothilone or an epothilone
derivative. The naturally occurring epothilones (including
epothilone A, B, C, D, E, and F) and non-naturally occurring
compounds structurally related thereto (epothilone derivatives or
analogs) are potent cytotoxic agents specific for eukaryotic cells.
These compounds have application as anti-fungals, cancer
chemotherapeutics, and immunosuppressants, and generally for the
treatment of inflammation or any hyperproliferative disease, such
as psoriasis, multiple sclerosis, atherosclerosis, and blockage of
stents. The epothilones are produced at very low levels in the
naturally occurring Sorangium cellulosum cells in which they have
been identified. Moreover, S. cellulosum is very slow growing, and
fermentation of S. cellulosum strains is difficult and
time-consuming. One important benefit conferred by the present
invention is the ability simply to produce an epothilone or
epothilone derivative in a non-S. cellulosum host cell. Another
advantage of the present invention is the ability to produce the
epothilones at higher levels and in greater amounts in the
recombinant host cells provided by the invention than possible in
the naturally occurring epothilone producer cells. Yet another
advantage is the ability to produce an epothilone derivative in a
recombinant host cell. Thus, the present invention provides
recombinant host cells that produce a desired epothilone or
epothilone derivative. In a preferred embodiment, the host cell
produces the epothilone or epothilone derivative at equal to or
greater than 10 mg/L. In one embodiment, the invention provides
host cells that produce one or more of the epothilones or
epothilone derivatives at higher levels than produced in the
naturally occurring organisms that produce epothilones. In another
embodiment, the invention provides host cells that produce mixtures
of epothilones that are less complex than the mixtures produced by
naturally occurring host cells that produce epothilones.
[0132] In an especially preferred embodiment, the host cells of the
invention produce less complex mixtures of epothilones than do
naturally occurring cells that produce epothilones. As one example,
certain host cells of the invention can produce epothilone D in a
less complex mixture than is produced by a naturally occurring
Sorangium cellulosum, because epothilone D is a major product in
the former and a minor product in the latter. Naturally occurring
Sorangium cellulosum cells that produce epothilones typically
produce a mixture of epothilones A, B, C, D, E, F, and other very
minor products, with only epothilones A and B present as major
products. The Table 1 below summarizes the epothilones produced in
different illustratrive host cells of the invention. TABLE-US-00001
TABLE 1 Epothilones Not Cell Type Epothilones Produced Produced* 1
A, B, C, D E, F 2 A, C B, D, E, F 3 B, D A, C, E, F 4 A, B C, D 5
C, D A, B 6 B A, C, D, E, F 7 D A, B, C, E, F *or produced only as
minor products
[0133] Thus, the recombinant host cells of the invention also
include host cells that produce as a major product only one desired
epothilone or epothilone derivative.
[0134] Based solely on an analysis of the domains of the epothilone
PKS, one could predict that the PKS enzyme catalyzes the production
of epothilones arbitrarily designated "G" and "H", the structures
of which are shown below: ##STR3##
[0135] These compounds differ from one another in that epothilone G
has a hydrogen at C-12 and epothilone H has a methyl group at that
position. The variance at the C-12 position is predicted to arise
from the ability of the corresponding AT domain (extender module 4)
of the PKS to bind either malonyl CoA, leading to hydrogen, or
methylmalonyl CoA, leading to methyl. However, epothilones G and H
have not been observed in nature or in the recombinant host cells
of the invention. Instead, the products of the PKS are believed to
be epothilones C and D, which differ from epothilones G and H,
respectively, by having a C-12 to C-13 double bond and lacking a
C-13 hydroxyl substituent. Based on the expression of the
epothilone PKS genes in heterologous host cells and the products
produced by genetic alteration of those genes, as described more
fully below, the dehydration reaction that forms the C12-C13 double
bond in epothilones C and D is believed to be carried out by the
epothilone PKS itself. Epothilones A and B are formed from
epothilones C and D, respectively, by epoxidation of the C-12 to
C-13 double bond by the epoK gene product. Epothilones E and F may
be formed from epothilones A and B, respectively, by hydroxylation
of the C-21 methyl group or by incorporation of a hydroxymalonyl
CoA instead of a malonyl CoA by the loading module of the
epothilone PKS, as discussed further below.
[0136] Thus expression of the epothilone PKS genes and the epoK
gene in a host cell of the invention leads to the production of
epothilones A, B, C, and D. If the epoK gene is not present or is
rendered inactive or partially inactive by mutation, then
epothilones C and D are produced as major products. If the AT
domain of extender module 4 is replaced by an AT domain specific
for malonyl CoA, then epothilones A and C are produced, and if
there is no functional epoK gene, then epothilone C is produced as
the major product. If the AT domain of extender module 4 is
replaced by an AT domain specific for methylmalonyl Co A, then
epothilones B and D are produced as major products, and if there is
no functional epoK gene, then epothilone D is produced as the major
product.
[0137] The epothilone PKS and modification enzyme genes were cloned
from the epothilone producing strain, Sorangium cellulosum SMP44.
Total DNA was prepared from this strain using the procedure
described by Jaoua et al., 1992, Plasmid 28: 157-165, incorporated
herein by reference. A cosmid library was prepared from S.
cellulosum genomic DNA in pSupercos (Stratagene). The entire PKS
and modification enzyme gene cluster was isolated in four
overlapping cosmid clones (deposited on Feb. 17, 1999, under the
terms of the Budapest Treaty with the American Type Culture
Collection (ATCC), 10801 University Blvd., Manassas, Va.,
20110-2209 USA, and assigned ATCC accession numbers as follows:
pKOS35-70.1A2 (ATCC 203782), pKOS35-70.4 (ATCC 203781),
pKOS35-70.8A3 (ATCC 203783), and pKOS35-79.85 (ATCC 203780)) and
the DNA sequence determined, as described in PCT Pub. No.
00/031237, incorporated herein by reference. DNA sequence analysis
revealed a PKS gene cluster with a loading module and nine extender
modules. Downstream of the PKS sequence is an open reading frame
(ORF), designated epoK, that shows strong homology to cytochrome
P450 oxidase genes and encodes the epothilone epoxidase
modification enzyme.
[0138] The PKS genes are organized in 6 ORFs. At the polypeptide
level, the loading module and extender modules 1 (an NRPS), 2, and
9 appear on individual polypeptides; their corresponding genes are
designated epoA, epoB, epoC, and epoF respectively. Modules 3, 4,
5, and 6 are contained on a single polypetide whose gene is
designated epoD, and modules 7 and 8 are on another polypeptide
whose gene is designated epoE. The spacing between ORFs suggests
that epoC, epoD, epoE and epoF constitute an operon. The epoA,
epoB, and epoK gene may be also part of this large operon, but
there are spaces of approximately 100 bp between epoB and epoC and
115 bp between epoF and epoK that could contain a promoter. The
epothilone PKS gene cluster is shown schematically below in Scheme
1. ##STR4##
[0139] Immediately downstream of epoK, the P450 epoxidase gene, is
ORF1, which encodes a polypeptide that appears to include membrane
spanning domains and may be involved in epothilone transport. This
ORF is followed by a number of ORFs that include genes that may
encode proteins involved in transport and regulation.
[0140] A detailed examination of the modules shows an organization
and composition consistent with the biosynthesis of epothilone. The
description that follows is at the polypetide level. The sequence
of the AT domain in the loading module and in extender modules 3,
4, 5, and 9 shows similarity to the consensus sequence for malonyl
loading modules, consistent with the presence of an H side chain at
C-14, C-12 (epothilones A and C), C-10, and C-2, respectively, as
well as the loading module. The AT domains in modules 2,6,7, and 8
resemble the consensus sequence for methylmalonyl specifying AT
domains, again consistent with the presence of methyl side chains
at C-16, C-8, C-6, and C4 respectively.
[0141] The loading module contains a KS domain in which the
cysteine residue usually present at the active site is instead a
tyrosine. This domain is designated as KS.sup.y and serves as a
decarboxylase, which is part of its normal function, but cannot
function as a condensing enzyme. Thus, the loading module is
expected to load malonyl CoA, move it to the ACP, and decarboxylate
it to yield the acetyl residue required for condensation with
cysteine. Extender module 1 is the non-ribosomal peptide synthetase
that activates cysteine and catalyzes the condensation with acetate
on the loading module. The sequence contains segments highly
similar to ATP-binding and ATPase domains, required for activation
of amino acids, a phosphopantetheinylation site, an oxidation
domain, a cyclization domain, and an elongation domain. Extender
module 2 determines the structure of epothilone at C-15-C-17. The
presence of the DH domain in module 2 yields the C-16-17 dehydro
moiety in the molecule. The domains in module 3 are consistent with
the structure of epothilone at C-14 and C-15; the OH that comes
from the action of the KR is employed in the lactonization of the
molecule. Extender module 4 controls the structure at C-12 and C-13
where a double bond is found in epothilones C and D. Although the
sequence of the AT domain appears to resemble those that specify
malonate loading, it can also load methylmalonate, thereby
accounting in part for the mixture of epothilones found in the
fermentation broths of the naturally producing organisms.
[0142] A significant departure from the expected array of functions
was found in extender module 4. This module was expected to contain
a DH domain, thereby directing the synthesis of epothilones C and D
as the products of the PKS. Analysis revealed that the space
between the AT and KR domains of module 4 was not large enough to
accommodate a functional DH domain. Thus, the extent of reduction
at module 4 appears not to proceed beyond the ketoreduction of the
beta-keto formed after the condensation directed by extender module
4. As shown herein, the epothilone PKS genes alone are sufficient
to confer the ability to produce epothilones C and D to the host
cells of the invention. The heterologous production of epothilones
C and D demonstrates that there must be a dehydratase function that
introduces the double bond. Based on heterologous expression of the
epothilone PKS genes and the products produced by altered
epothilone PKS genes, the dehydration reaction that forms this
double bond is believed to be mediated by the DH domain of extender
module 5 of the epothilone PKS and the generation of a conjugated
diene precursor prior to reduction by the ER domain of module
5.
[0143] Extender modules 5 and 6 each have the full set of reduction
domains (KR, DH and ER) to yield the methylene functions at C-11
and C-9. Extender modules 7 and 9 have KR domains to yield the
hydroxyls at C-7 and C-3, and extender module 8 does not have a
functional KR domain, consistent with the presence of the keto
group at C-5. Extender module 8 also contains a methyltransferase
(MT) domain that results in the presence of the geminal dimethyl
function at C-4. Extender module 9 also has a thioesterase domain
that terminates polyketide synthesis and catalyzes ring
closure.
[0144] The genes, proteins, modules, and domains of the epothilone
PKS are summarized in the following Table 2. TABLE-US-00002 TABLE 2
Gene Protein Modules Domains Present epoA EpoA Load KS.sup.Y mAT ER
ACP epoB EpoB 1 NRPS, condensation, heterocyclization, adenylation,
thiolation, PCP epoC EpoC 2 KS mmAT DH KR ACP epoD EpoD 3-6 KS mAT
KR ACP; KS mAT KR ACP; KS mAT DH ER KR ACP; KS mmAT DH ER KR ACP
epoE EpoE 7-8 KS mmAT KR ACP; KS mmAT MT DH* KR* A epoF EpoF 9 KS
mAT KR DH* ER* ACP TE NRPS - non-ribosomal peptide synthetase; KS -
ketosynthase; mAT - malonyl CoA specifying acyltransferase; mmAT -
methylmalonyl CoA specifying acyltransferase; DH - dehydratase; ER
- enoylreductase; KR - ketoreductase; MT - methyltransferase; TE
thioesterase; *inactive domain.
[0145] Inspection of the sequence has revealed translational
coupling between epoA and epoB (loading module and the extender
module 1 NRPS) and between epoC and epoD. Very small gaps are seen
between epoD and epoE and epoE and epoF but gaps exceeding 100 bp
are found between epoB and epoC and epoF and epoK. These intergenic
regions may contain promoters.
[0146] Thus, the epothilone PKS is a multiprotein complex composed
of the gene products of the epoA, epoB, epoC, epoD, epoE, and epoF
genes. To confer the ability to produce epothilones to a host cell,
one provides the host cell with the recombinant epoA, epoB, epoC,
epoD, epoE, and epoF genes of the present invention, and optionally
other genes, such as epoK, capable of expression in that host cell.
Those of skill in the art will appreciate that, while the
epothilone and other PKS enzymes may be referred to as a single
entity herein, these enzymes are typically multisubunit proteins.
Thus, one can make a derivative PKS (a PKS that differs from a
naturally occurring PKS by deletion or mutation) or hybrid PKS (a
PKS that is composed of portions of two different PKS enzymes) by
altering one or more genes that encode one or more of the multiple
proteins that constitute the PKS.
[0147] The post-PKS modification or tailoring of epothilone
includes multiple steps mediated by multiple enzymes. These enzymes
are referred to herein as tailoring or modification enzymes.
Expression of the epothilone PKS genes epoA, epoB, epoC, epoD,
epoE, and epoF in host cells of the invention that do not express
epoK leads to the production of epothilones C and D as major
products, which lack the C-12-C-13 epoxide of epothilones A and B,
having instead a C-12-C-13 double bond. Thus, epothilones C and D
are converted to epothilones A and B by an epoxidase encoded by the
epoK gene. Epothilones A and B may be converted to epothilones E
and F by a hydroxylase gene, which may be encoded by a gene
associated with the epothilone PKS gene cluster or by another gene
endogenous to Sorangium cellulosum. Alternatively, these compounds
may be formed by the loading module binding a starter unit other
than malonyl CoA (such as hydroxymalonyl CoA). Thus, one can
produce an epothilone or epothilone derivative modified as desired
in a host cell by providing that host cell with one or more
recombinant modification enzyme genes provided by the invention or
by utilizing a host cell that naturally expresses (or does not
express) the modification enzyme and/or by providing starter units
other than malonyl CoA.
[0148] Thus, the present invention provides a wide variety of
recombinant DNA compounds and host cells for expressing the
naturally occurring epothilones A, B, C, and D and derivatives
thereof. The invention also provides recombinant host cells that
produce epothilone derivatives modified in a manner similar to
epothilones E and F. Moreover, any epothilone or epothilone
derivative of the invention can be converted to the corresponding
epothilone E or F derivative in accordance with the methods
described in PCT Pat. Pub. No. 00/039276, incorporated herein by
reference.
[0149] The present invention also provides a wide variety of
recombinant DNA compounds and host cells that make epothilone
derivatives. As used herein, the phrase epothilone derivative
refers to a compound that is produced by a recombinant epothilone
PKS in which at least one domain has been inserted or in which a
domain has either been rendered inactive by deletion or mutation,
mutated to alter its catalytic function, or replaced by a domain
with a different function. In any event, the epothilone derivative
PKS so produced functions to produce a compound that differs in
structure from a naturally occurring epothilone selected from the
group consisting of epothilones A, B, C, D, E, and F. To faciliate
a better understanding of the recombinant DNA compounds and host
cells provided by the invention, a detailed discussion of the
loading module and each of the modules of the epothilone PKS, as
well as novel recombinant derivatives thereof, is provided
below.
[0150] The loading module of the epothilone PKS includes an
"inactive" KS domain, designated KS.sup.Y, that, due to the
presence of a tyrosine (Y) residue in place of the cysteine residue
found in "active" KS domains, is unable to perform the condensation
reaction mediated by active KS domains. The KSY domain does carry
out the decarboxylation reaction mediated by KS domains. Such
"inactive" KS domains are found in other PKS enzymes, usually with
a glutamine (Q) residue in place of the active site cysteine, and
are called KS.sup.Q domains. The KSQ domain in rat fatty acid
synthase has been shown to be unable to perform condensation but
exhibits a 2 order magnitude increase in decarboxylation. See
Witkowski et al., 7 Sep. 1999, Biochem. 38(36): 11643-11650,
incorporated herein by reference. A KS.sup.Q domain may be more
efficient at decarboxylation than a KS.sup.Y domain, so the
replacement of the KS.sup.Y domain in the epothilone PKS with a
KS.sup.Q domain may increase the efficiency of epothilone
biosynthesis in some host cells or under certain culture
conditions. This can be accomplished merely by changing the codon
from a tyrosine to a glutamine codon, as described in Example 6,
below. This can also be accomplished by replacing the KS.sup.Y
domain with a KS.sup.Q domain of another PKS, such as the
oleandolide PKS or the narbonolide PKS (see the references cited in
the Table above in connection with the oleandomycin, narbomycin,
and picromycin PKS and modification enzymes).
[0151] The epothilone loading module also contains an AT domain
specific for malonyl CoA (which is believed to be decarboxylated by
the KS.sup.Y domain to yield an acetyl group), and an ACP domain.
The present invention provides recombinant epothilone derivative
loading modules or their encoding DNA sequences in which the
malonyl specific AT domain or its encoding sequence has been
changed to another specificity, such as methylmalonyl CoA,
ethylmalonyl CoA, and 2-hydroxymalonyl CoA. When expressed with the
other proteins of the epothilone PKS, such loading modules lead to
the production of epothilones in which the methyl substituent of
the thiazole ring of epothilone is replaced with, respectively,
ethyl, propyl, and hydoxymethyl. The present invention provides
recombinant PKS enzymes comprising such loading modules and host
cells for producing such enzymes and the polyketides produced
thereby. When the AT domain is changed to specify 2-hydroxymalonyl
CoA, the correspoding epothilone PKS derivative will produce
epothilone E and F derivatives. An AT domain specific for
2-hydroxymalonyl CoA will result in a polyketide with a hydroxyl
group at the corresponding location in the polyketide produced; the
hydroxyl group can be methylated to yield a methoxy group by
polyketide modification enzymes. See, e.g., the references cited in
connection with the FK-520 PKS in the Table above. Consequently,
reference to a PKS that has a 2-hydroxymalonyl specific AT domain
herein similarly refers to polyketides produced by that PKS that
have either a hydroxyl or methoxyl group at the corresponding
location in the polyketide.
[0152] The loading module of the epothilone PKS also comprises an
ER domain. While, this ER domain may be involved in forming one of
the double bonds in the thiazole moiety in epothilone (in the
reverse of its normal reaction), it may be non-functional. In
either event, the invention provides recombinant DNA compounds that
encode the epothilone PKS loading module with and without the ER
region, as well as hybrid loading modules that contain an ER domain
from another PKS (either active or inactive, with or without
accompanying KR and DH domains) in place of the ER domain of the
epothilone loading module. The present invention also provides
recombinant PKS enzymes comprising such loading modules and host
cells for producing such enzymes and the polyketides produced
thereby.
[0153] The loading module of the epothilone PKS can also be
replaced with a loading module from a heterologous PKS to form a
hybrid PKS that makes an epothilone derivative. In one embodiment,
the loading module of the epothilone PKS is replaced with a NRPS,
as described in the examples below.
[0154] The loading module of the epothilone PKS is followed by the
first extender module of the PKS, which is an extender NRPS module
specific for cysteine. This NRPS module is naturally expressed as a
discrete protein, the product of the epoB gene. In one embodiment,
a portion of the NRPS module coding sequence is utilized in
conjunction with a heterologous coding sequence. In this
embodiment, the invention provides, for example, changing the
specificity of the NRPS module of the epothilone PKS from a
cysteine to another amino acid. This change is accomplished by
constructing a coding sequence in which all or a portion of the
epothilone PKS NRPS module coding sequences have been replaced by
those coding for an NRPS module of a different specificity.
[0155] In one illustrative embodiment, the specificity of the
epothilone NRPS module is changed from cysteine to serine or
threonine. When the thus modified NRPS module is expressed with the
other proteins of the epothilone PKS, the recombinant PKS produces
an epothilone derivative in which the thiazole moiety of epothilone
(or an epothilone derivative) is changed to an oxazole or
5-methyloxazole moiety, respectively. Thus, in an illustrative
embodiment, the present invention provides host cells, vectors, and
recombinant epothilone PKS enzymes in which the NRPS domain has
been altered by replacement of the adenylation domain of the
epothilone NRPS with the adenylation domain of the NRPS encoded by
the entf gene (for serine). In another illustrative embodiment, the
present invention provides host cells, vectors, and recombinant
epothilone PKS enzymes in which the NRPS domain has been altered by
replacement of the adenylation domain of the epothilone NRPS with
the adenylation domain of the NRPS encoded by the vibf gene (for
threonine). In one embodiment, these NRPS replacements are made in
an epothilone PKS that also contains an extender module 2 that
binds malonyl CoA instead of methylmalonyl CoA to produce the
16-desmethyl derivatives of the oxazole and methyloxazole
epothilone derivatives.
[0156] Alternatively, the present invention provides recombinant
PKS enzymes composed of the products of the epoA, epoC, epoD, epoE,
and epoF genes (or modified versions thereof) without an NRPS
module or with an NRPS module from a heterologous PKS. The
heterologous NRPS module can be expressed as a discrete protein or
as a fusion protein with either the epoA or epoC genes. In
replacing one module of a PKS with another, it may be important to
ensure that compatible intermodular linker sequences are maintained
or otherwise utilized. See PCT Pub. No. 00/047724, incorporated
herein by reference.
[0157] In another embodiment, the invention provides recombinant
epothilone PKS enzymes and corresponding recombinant DNA compounds
and vectors in which the NRPS module has been inactivated or
deleted. Inactive NRPS module proteins and the coding sequences
therefore provided by the invention include those in which the PCP
domain has been wholly or partially deleted or otherwise rendered
inactive by changing the active site serine (the site for
phosphopantetheinylation) to another amino acid, such as alanine,
or the adenylation domains have been deleted or otherwise rendered
inactive. In one embodiment, both the loading module and the NRPS
have been deleted or rendered inactive. In any event, the resulting
epothilone PKS can then function only if provided a substrate that
binds to the KS domain of extender module 2 (or a subsequent
module) of the epothilone PKS or a PKS for an epothilone
derivative. In a method provided by the invention, the thus
modified cells are then fed activated acylthioesters that are bound
by preferably the second, but potentially any subsequent, extender
module and processed into novel epothilone derivatives. The host
cell is fed activated acylthioesters to produce novel epothilone
derivatives of the invention. The host cells expressing, or cell
free extracts containing, the PKS can be fed or supplied with
N-acylcysteamine thioesters (NACS) of novel precursor molecules to
prepare epothilone derivatives. See PCT Pub. Nos. US99/03986 and
00/044717, both of which are incorporated herein by reference, and
Examples 9 and 10, below.
[0158] The second (first non-NRPS) extender module of the
epothilone PKS includes a KS, an AT specific for methylmalonyl CoA,
a DH, a KR, and an ACP. The second extender module of the
epothilone PKS is produced as a discrete protein by the epoC gene.
All or only a portion of the second extender module coding sequence
can be utilized in conjunction with other PKS coding sequences to
create a hybrid module. In this embodiment, the invention provides,
for example, either replacing the methylmalonyl CoA specific AT
with a malonyl CoA, ethylmalonyl CoA, or 2-hydroxymalonyl CoA
specific AT; deleting either the DH or KR or both; replacing the DH
or KR or both with a DH or KR or both that specifies a different
stereochemistry; and/or inserting an ER. The resulting heterologous
second extender module coding sequence can be coexpressed with the
other proteins that constitute a PKS that synthesizes epothilone,
an epothilone derivative, or another polyketide. Alternatively, one
can delete or replace the second extender module of the epothilone
PKS with a module from a heterologous PKS, which can be expressed
as a discrete protein or as a fusion protein fused to either the
epoB or epoD gene product.
[0159] Illustrative recombinant PKS genes of the invention include
those in which the AT domain encoding sequences for the second
extender module of the epothilone PKS have been altered or replaced
to change the AT domain encoded thereby from a methylmalonyl
specific AT to a malonyl specific AT. Such malonyl specific AT
domain encoding nucleic acids can be isolated, for example and
without limitation, from the PKS genes encoding the narbonolide
PKS, the soraphen PKS, the rapamycin PKS (i.e., extender modules 2
and 12), and the FK-520 PKS (i.e., extender modules 3, 7, and 8).
When such a hybrid second extender module is coexpressed with the
other proteins constituting the epothilone PKS, the resulting
epothilone derivative produced is a 16-desmethyl epothilone. In one
embodiment, the hybrid PKS also contains a methylmalonyl CoA
specific AT domain in extender module 4 and is epressed in a host
cell lacking a functional epoK gene such that the compound produced
is 16-desmethyl epothilone D. In another embodiment, the hybrid PKS
also contains an altered NRPS that is specific for threonine,
leading to the production of the
5-methyloxazole-16-desmethylepothilones.
[0160] In addition, the invention provides DNA compounds and
vectors encoding recombinant epothilone PKS enzymes and the
corresponding recombinant proteins in which the KS domain of the
second (or subsequent) extender module has been inactivated or
deleted, as described in Example 9, below. In a preferred
embodiment, this inactivation is accomplished by changing the codon
for the active site cysteine to an alanine codon. As with the
corresponding variants described above for the NRPS module, the
resulting recombinant epothilone PKS enzymes are unable to produce
an epothilone or epothilone derivative unless supplied a precursor
that can be bound and extended by the remaining domains and modules
of the recombinant PKS enzyme. Illustrative precursor compounds are
described in Example 10, below. Alternatively, one could simply
provide such precursors to a host cell that expresses only the
epoD, epoE, and epoF genes.
[0161] The third extender module of the epothilone PKS includes a
KS, an AT specific for malonyl CoA, a KR, and an ACP. The third
extender module of the epothilone PKS is expressed as a protein,
the product of the epoD gene, which also contains modules 4,5, and
6. To make a recombinant epothilone PKS that produces an epothilone
derivative due to an alteration in any of extender modules 3
through 6, one typically expresses a protein comprising all four
extender modules. In one embodiment, all or a portion of the third
extender module coding sequence is utilized in conjunction with
other PKS coding sequences to create a hybrid module. In this
embodiment, the invention provides, for example, either replacing
the malonyl CoA specific AT with a methylmalonyl CoA, ethylmalonyl
CoA, or 2-hydroxymalonyl CoA specific AT; deleting the KR;
replacing the KR with a KR that specifies a different
stereochemistry; and/or inserting a DH or a DH and an ER. The
resulting heterologous third extender module coding sequence can be
utilized in conjunction with a coding sequence for a PKS that
synthesizes epothilone, an epothilone derivative, or another
polyketide.
[0162] Illustrative recombinant PKS genes of the invention include
those in which the AT domain encoding sequences for the third
extender module of the epothilone PKS have been altered or replaced
to change the AT domain encoded thereby from a malonyl specific AT
to a methylmalonyl specific AT. Such methylmalonyl specific AT
domain encoding nucleic acids can be isolated, for example and
without limitation, from the PKS genes encoding DEBS, the
narbonolide PKS, the rapamycin PKS, and the FK-520 PKS. When
coexpressed with the remaining modules and proteins of the
epothilone PKS or an epothilone PKS derivative, the recombinant PKS
produces the 14-methyl epothilone derivatives of the invention.
[0163] Those of skill in the art will recognize that the KR domain
of the third extender module of the PKS is responsible for forming
the hydroxyl group involved in cyclization of epothilone.
Consequently, abolishing the KR domain of the third extender module
or adding a DH or DH and ER domains will interfere with the
cyclization, leading either to a linear molecule or to a molecule
cyclized at a different location than epothilones A, B, C, D, E,
and F.
[0164] The fourth extender module of the epothilone PKS includes a
KS, an AT that can bind either malonyl CoA or methylmalonyl CoA, a
KR, and an ACP. In one embodiment, all or a portion of the fourth
extender module coding sequence is utilized in conjunction with
other PKS coding sequences to create a hybrid module. In this
embodiment, the invention provides, for example, either replacing
the malonyl CoA and methylmalonyl specific AT with a malonyl CoA,
methylmalonyl CoA, ethylmalonyl CoA, or 2-hydroxymalonyl CoA
specific AT; deleting the KR; and/or replacing the KR, including,
optionally, to specify a different stereochemistry; and/or
inserting a DH or a DH and ER. The resulting heterologous fourth
extender module coding sequence is incorporated into a protein
subunit of a recombinant PKS that synthesizes epothilone, an
epothilone derivative, or another polyketide. Alternatively, the
invention provides recombinant PKS enzymes for epothilones and
epothilone derivatives in which the entire fourth extender module
has been deleted or replaced by a module from a heterologous
PKS.
[0165] In a preferred embodiment, the invention provides
recombinant DNA compounds comprising the coding sequence for the
fourth extender module of the epothilone PKS modified to encode an
AT that binds methylmalonyl CoA and not malonyl CoA (or that binds
malonyl CoA and not methylmalonyl CoA). In one embodiment, this
change in specificity is accomplished by mutation of the coding
sequence for the extender module 4 AT domain. Such mutation can be
accomplished randomly using a mutagenizing agent, such as UV light,
or by site-specific mutagenesis. In another embodiment, this change
in specificity is accomplished by replacing all or a portion of the
extender module 4 AT domain coding sequence with coding sequences
for a heterologous AT domain. Thus, the invention provides
recombinant DNA compounds and expression vectors and the
corresponding recombinant PKS in which the hybrid fourth extender
module with a methylmalonyl specific AT has been incorporated. The
methylmalonyl specific AT coding sequence can originate, for
example and without limitation, from coding sequences for the
oleandolide PKS, DEBS, the narbonolide PKS, the rapamycin PKS, or
any other PKS that comprises a methylmalonyl specific AT
domain.
[0166] In accordance with the invention, the hybrid fourth extender
module expressed from this coding sequence can be incorporated into
the epothilone PKS (or the PKS for an epothilone derivative),
typically as a derivative epoD gene product that comprises the
modified fourth extender module as well as extender modules 3,5,
and 6, any one or more of which can optionally be in derivative
form, of the epothilone PKS. The recombinant methylmalonyl specific
epothilone fourth extender module coding sequences provided by the
invention thus provide alternative methods for producing desired
epothilone compounds in host cells. In particular, such compounds
will be epothilones D, B, and F, with the production of epothilone
B being dependent on whether a functional epoK gene is present, or
derivatives thereof.
[0167] The invention also provides recombinant DNA compounds
comprising the coding sequence for the fourth extender module of
the epothilone PKS modified to encode an AT that binds malonyl CoA
and not methylmalonyl CoA. The invention provides recombinant DNA
compounds and vectors and the corresponding recombinant PKS in
which this hybrid fourth extender module has been incorporated into
a derivative epoD gene product. When incorporated into the
epothilone PKS (or the PKS for an epothilone derivative), the
resulting recombinant epothilone PKS produces epothilones C, A, and
E, with production of epothilone A being dependent on whether a
functional epoK gene is present.
[0168] In another embodiment, the present invention provides
recombinant host cells for producing
12-desmethyl-12-ethyl-epothilone D. In this embodiment, the present
invention provides a host cell that expresses a recombinant
epothilone PKS derivative in which the AT domain of extender module
4 has been replaced by an ethylmalonyl CoA-specific extender module
from, for example, the FK520 or niddamycin PKS enzymes. In one
embodiment, the host cell is a recombinant host cell that expresses
crotonyl CoA reductase encoded by a gene (a ccr gene) from a
heterologous host cell or under the control of a heterologous
promoter to enhance the production of ethylmalonyl CoA. In one
embodiment, the host cell is a Myxococcus host cell that expresses
a ccr gene isolated from a Streptomyces host cell. In another
embodiment, the host cell has been modified to express or
overexpress the E. coli atoA, D, and E genes that transport
butyrate and convert it to butyryl CoA, which is converted to
ethylmalonyl CoA.
[0169] In addition to the replacement of the endogenous AT coding
sequence with a coding sequence for an AT specific for
methylmalonyl Co A, one can also replace the KR domain coding
sequences with coding sequences for another KR, a DH and KR (from,
for example and without limitation, module 10 of the rapamycin PKS
or modules 1 or 5 of the FK-520 PKS), or a DH, KR, and ER. If one
replaces the KR for another KR or for a KR and a DH, and no changes
are made in extender module 5 (or elsewhere in the PKS), then the
recombinant epothilone PKS produces epothilones C and D, because
the DH domain of extender module 5 mediates the formation of the
C-12-C-13 double bond in epothilones C and D. If one replaces the
KR with a KR, DH, and ER, and no changes are made in extender
module 5 (or elsewhere in the PKS), then the recombinant epothilone
PKS produces 12,13-dihydro-epothilones C and D. If one replaces the
KR with an inactive KR or otherwise inactivates the KR, then the
recombinant epothilone PKS produces
13-oxo-11,12-dehydro-epothilones C and D.
[0170] Thus, the present invention provides a recombinant
epothilone PKS in which the KR domain of extender module 4 has been
rendered inactive by mutation, deletion, or replacement with a
non-functional KR domain from another PKS. This recombinant PKS
produces primarily 13-oxo-11,12-dehydro epothilone B; the C-11-C-12
double bond observed in the compounds produced by this organism is
believed to originate due to migration of the double bond formed in
the nascent polyketide chain by the DH domain of extender module 5
prior to reduction by the ER domain of that module. The present
invention also provides host cells that produce this novel
polyketide. For example, Myxococcus xanthus strain K122-56 (this
strain was deposited in compliance with the Budapest Treaty with
the American Type Culture Collection, 10801 University Blvd.
Manassas, Va. 20110-2209 USA on Nov. 21, 2000, and is available
under accession No. PTA-2714) contains epothilone PKS genes in
which the KR domain of module 4 has been rendered inactive by
deletion and which produces 13-oxo epothilones A and B and dehydro
derivatives thereof (primarily 13-oxo-11,12-dehydro epothilone B).
The present invention also provides the novel epothilone
derivatives produced by this strain.
[0171] The fifth extender module of the epothilone PKS includes a
KS, an AT that binds malonyl CoA, a DH, an ER, a KR, and an ACP
domain. In one embodiment, a DNA compound comprising a sequence
that encodes the fifth extender module of the epothilone PKS is
inserted into a DNA compound that comprises coding sequences for
the epothilone PKS or a recombinant epothilone PKS that produces an
epothilone derivative. In another embodiment, a portion of the
fifth extender module coding sequence is utilized in conjunction
with other PKS coding sequences to create a hybrid module coding
sequence and the hybrid module encoded thereby. In this embodiment,
the invention provides, for example, either replacing the malonyl
CoA specific AT with a methylmalonyl CoA, ethylmalonyl CoA, or
2-hydroxymalonyl CoA specific AT; deleting any one, two, or all
three of the ER, DH, and KR; and/or replacing any one, two, or all
three of the ER, DH, and KR with either a KR, a DH and KR, or a KR,
DH, and ER, including, optionally, to specify a different
stereochemistry. The resulting hybrid fifth extender module coding
sequence can be utilized in conjunction with a coding sequence for
a PKS that synthesizes epothilone, an epothilone derivative, or
another polyketide. Alternatively, the fifth extender module of the
epothilone PKS can be deleted or replaced in its entirety by a
module of a heterologous PKS to produce a protein that in
combination with the other proteins of the epothilone PKS or
derivatives thereof constitutes a PKS that produces an epothilone
derivative.
[0172] Illustrative recombinant PKS genes of the invention include
recombinant epoD gene derivatives in which the AT domain encoding
sequences for the fifth extender module of the epothilone PKS have
been altered or replaced to change the AT domain encoded thereby
from a malonyl specific AT to a methylmalonyl specific AT. Such
methylmalonyl specific AT domain encoding nucleic acids can be
isolated, for example and without limitation, from the PKS genes
encoding DEBS, the narbonolide PKS, the rapamycin. PKS, and the
FK-520 PKS. When such recombinant epoD gene derivatives are
coexpressed with the epoA, epoB, epoC, epoE, epoF, and/or epoK
genes (or derivatives thereof), the PKS composed thereof produces
the 10-methyl epothilones or derivatives thereof. Another
recombinant epoD gene derivative provided by the invention includes
not only this altered module 5 coding sequence but also module 4
coding sequences that encode an AT domain that binds only
methylmalonyl CoA. When incorporated into a PKS with the epoA,
epoB, epoC, epoE, epoF, and/or epoK genes, the recombinant epoD
gene derivative product leads to the production of 10-methyl
epothilone B and/or D derivatives.
[0173] Other illustrative recombinant epoD gene derivatives of the
invention include those in which one or more of the ER, DH, and KR
domain encoding sequences for the fifth extender module of the
epothilone PKS have been either replaced or mutated to provide: (i)
no functional ER, DH, or KR domains; (ii) only a functional KR
domain; (iii) only functional KR and DH domains; or (iv) functional
ER, DH, or KR domains from another PKS. The discovery that the DH
domain of extender module 5 is responsible for the formation of the
C-12-C-13 double bond in epothilones C and D provides a novel
method of the invention for making epothilones and epothilone
derivatives in any organism, including Sorangium cellulosum and
recombinant host cells, that contain the epothilone PKS genes.
Moreover, it has now been discovered that the DH domain of extender
module 6 can also act on the beta-carbonyl of the nascent
polyketide bound to the preceding module, which can be exploited in
accordance with the methods of the present invention to make novel
epothilone derivatives.
[0174] Thus, when all three extender module 5 KR, DH, and ER
domains are deleted or otherwise inactivated, the recombinant
epothilone PKS produces the 13-hydroxy-11-oxo analogs of
epothilones A and B. When the DH and ER domains are deleted or
otherwise inactivated, the recombinant epothilone PKS produces the
13-hydroxy-10,11-dehydro-epothilones, primarily
13-hydroxy-10,11-dehydro-epothilone D. The present invention also
provides host cells that produce this novel polyketide. For
example, Myxococcus xanthus strain K122-148 (this strain was
deposited in accordance with the terms of the Budapest Treaty with
the American Type Culture Collection, 10801 University Blvd.
Manassas, Va. 20110-2209 USA on Nov. 21, 2000, and is available
under accession No. PTA-2711) contains epothilone PKS genes in
which the DH, KR, and ER domains of extender module 5 have been
replaced with only a KR domain and which produces
13-hydroxy-10,11-dehydro-epothilone D. The present invention also
provides the novel epothilone derivatives produced by this strain.
When only the ER domain is deleted or otherwise inactivated, the
recombinant epothilone PKS produces the 10,11-dehydro analogs of
epothilones C and D, primarily 10,11-dehydro epothilone. Thus, in
one aspect, the present invention provides a recombinant epothilone
PKS in which the ER domain of extender module 5 has been deleted or
rendered inactive by mutation and which produces
10,11-dehydro-epothilone D. In another embodiment, the present
invention provides a Sorangium cellulosum host cell that produces
10,11-dehydro-epothilone D due to a mutation in the coding sequence
for the ER domain of extender module 5 of the epothilone PKS.
[0175] These recombinant epoD gene derivatives of the invention are
coexpressed with the epoA, epoB, epoC, epoE, and epoF genes or with
recombinant epo genes containing other alterations (and can
themselves contain additional alterations) to produce a PKS that
makes the corresponding epothilone derivatives. For example, one
recombinant epoD gene derivative provided by the invention also
includes module 4 coding sequences that encode an AT domain that
binds only methylmalonyl CoA. As noted above, functionally similar
epoD genes for producing the epothilone C-11 derivatives can also
be made by inactivation of one, two, or all three of the ER, DH,
and KR domains of the epothilone fifth extender module. Another
mode for altering such domains in any module is by replacement with
the complete set of desired domains taken from another module of
the same or a heterologous PKS coding sequence. In this manner, the
natural architecture of the PKS is conserved. Also, when present,
KR and DH or KR, DH, and ER domains that function together in a
native PKS are preferably used in the recombinant PKS. Illustrative
replacement domains for the substitutions described above include,
for example and without limitation, the inactive KR domain from the
rapamycin PKS extender module 3, the KR domain from the rapamycin
PKS extender module 5, and the KR and DH domains from the rapamycin
PKS extender module 4. Other such inactive KR, active KR, and
active KR and DH domain encoding nucleic acids can be isolated
from, for example and without limitation, the PKS genes encoding
DEBS, the narbonolide PKS, and the FK-520 PKS. Each of the
resulting PKS enzymes produces a polyketide compound that can be
further derivatized in vitro by standard chemical methodology to
yield semi-synthetic epothilone derivatives of the invention.
[0176] The sixth extender module of the epothilone PKS includes a
KS, an AT that binds methylmalonyl CoA, a DH, an ER, a KR, and an
ACP. In one embodiment, a portion of the sixth extender module
coding sequence is utilized in conjunction with other PKS coding
sequences to create a hybrid module. In this embodiment, the
invention provides, for example, either replacing the methylmalonyl
CoA specific AT with a malonyl CoA, ethylmalonyl CoA, or
2-hydroxymalonyl CoA specific AT; deleting any one, two, or all
three of the ER, DH, and KR; and/or replacing any one, two, or all
three of the ER, DH, and KR with either a KR, a DH and KR, or a KR,
DH, and ER, including, optionally, to specify a different
stereochemistry. The resulting heterologous sixth extender module
coding sequence can be utilized in conjunction with a coding
sequence for a protein subunit of a PKS that makes epothilone, an
epothilone derivative, or another polyketide. Alternatively, the
sixth extender module of the epothilone PKS can be deleted or
replaced in its entirety by a module from a heterologous PKS to
produce a PKS for an epothilone derivative.
[0177] Illustrative recombinant PKS genes of the invention include
those in which the AT domain encoding sequences for the sixth
extender module of the epothilone PKS have been altered or replaced
to change the AT domain encoded thereby from a methylmalonyl
specific AT to a malonyl specific AT. Such malonyl specific AT
domain encoding nucleic acids can be isolated from, for example and
without limitation, the PKS genes encoding the narbonolide PKS, the
rapamycin PKS, and the FK-520 PKS. When a recombinant epoD gene of
the invention encoding such a hybrid module 6 is coexpressed with
the other epothilone PKS genes, the recombinant PKS makes the
8-desmethyl epothilone derivatives. This recombinant epoD gene
derivative can also be coexpressed with recombinant epo gene
derivatives containing other alterations or can itself be further
altered to produce a PKS that makes the corresponding 8-desmethyl
epothilone derivatives. For example, one recombinant epoD gene
provided by the invention also includes module 4 coding sequences
that encode an AT domain that binds only methylmalonyl CoA. When
incorporated into a PKS with the epoA, epoB, epoC, epoE, and epoF
genes, the recombinant epoD gene product leads to the production of
the 8-desmethyl derivatives of epothilones B (if a functional epoK
gene is present) and D.
[0178] Other illustrative recombinant epoD gene derivatives of the
invention include those in which the ER, DH, and KR domain encoding
sequences for the sixth extender module of the epothilone PKS have
been replaced with those that encode (i) a KR and DH domain; (ii) a
KR domain; and (iii) an inactive KR domain. These recombinant epoD
gene derivatives of the invention, when coexpressed with the other
epothilone PKS genes make the corresponding (i) C-9 alkene, (ii)
C-9 hydroxy (both epimers, only one of which may be processed by
downstream modules, unless additional KS and/or ACP replacements
are made in the next module), and (iii) C-9 keto (C-9-oxo)
epothilone derivatives. Functionally equivalent sixth extender
modules can also be made by inactivation of one, two, or all three
of the ER, DH, and KR domains of the epothilone sixth extender
module. For example, the present invention provides Myxococcus
xanthus strain K39-164 (this strain was deposited in accordance
with the terms of the Budapest Treaty with the American Type
Culture Collection, 10801 University Blvd. Manassas, Va. 20110-2209
USA on Nov. 21, 2000, and is available under accession No.
PTA-2711), which contains epothilone PKS genes in which the KR
domain of extender module 6 has been rendered inactive by mutation
and which produces 9-keto-epothilone D. The present invention also
provides the novel epothilone derivative produced by this
strain.
[0179] Thus, the recombinant epoD gene derivatives can also be
coexpressed with other recombinant epo gene derivatives containing
other alterations or can themselves be further altered to produce a
PKS that makes the corresponding C-9 epothilone derivatives. For
example, one recombinant epoD gene derivative provided by the
invention also includes module 4 coding sequences that encode an AT
domain that binds only methylmalonyl CoA. When incorporated into a
PKS with the epoA, epoB, epoC, epoE, and epoF genes, the
recombinant epoD gene product leads to the production of the C-9
derivatives of epothilones B and D, depending on whether a
functional epoK gene is present.
[0180] Illustrative replacement domains for the substitutions
described above include but are not limited to the inactive KR
domain from the rapamycin PKS module 3 to form the ketone, the KR
domain from the rapamycin PKS module 5 to form the alcohol, and the
KR and DH domains from the rapamycin PKS module 4 to form the
alkene. Other such inactive KR, active KR, and active KR and DH
domain encoding nucleic acids can be isolated from for example and
without limitation the PKS genes encoding DEBS, the narbonolide
PKS, and the FK-520 PKS. Each of the resulting PKSs produces a
polyketide compound that comprises a functional group at the C-9
position that can be further derivatized in vitro by standard
chemical methodology to yield semi-synthetic epothilone derivatives
of the invention.
[0181] The seventh extender module of the epothilone PKS includes a
KS, an AT specific for methylmalonyl CoA, a KR, and an ACP. The
seventh extender module of the epothilone PKS is contained in the
gene product of the epoE gene, which also contains the eighth
extender module. In one embodiment, a DNA compound comprising a
sequence that encodes the seventh extender module of the epothilone
PKS is expressed to form a protein that, together with other
proteins, constitutes the epothilone PKS or a PKS that produces an
epothilone derivative. In these and related embodiments, the
seventh and eighth extender modules of the epothilone PKS or a
derivative thereof are typically expressed as a single protein and
coexpressed with the epoA, epoB, epoC, epoD, and epoF genes or
derivatives thereof to constitute the PKS. In another embodiment, a
portion or all of the seventh extender module coding sequence is
utilized in conjunction with other PKS coding sequences to create a
hybrid module. In this embodiment, the invention provides, for
example, either replacing the methylmalonyl CoA specific AT with a
malonyl CoA, ethylmalonyl CoA, or 2-hydroxymalonyl CoA specific AT;
deleting the KR; replacing the KR with a KR that specifies a
different stereochemistry; and/or inserting a DH or a DH and an ER.
The resulting heterologous seventh extender module coding sequence
is utilized, optionally in conjunction with other coding sequences,
to express a protein that together with other proteins constitutes
a PKS that synthesizes epothilone, an epothilone derivative, or
another polyketide. Alternatively, the coding sequences for the
seventh extender module in the epoE gene can be deleted or replaced
by those for a heterologous module to prepare a recombinant epoE
gene derivative that, together with the epoA, epoB, epoC, epoD, and
epoF genes, can be expressed to make a PKS for an epothilone
derivative.
[0182] Illustrative recombinant epoE gene derivatives of the
invention include those in which the AT domain encoding sequences
for the seventh extender module of the epothilone PKS have been
altered or replaced to change the AT domain encoded thereby from a
methylmalonyl specific AT to a malonyl specific AT. Such malonyl
specific AT domain encoding nucleic acids can be isolated from for
example and without limitation the PKS genes encoding the
narbonolide PKS, the rapamycin PKS, and the FK-520 PKS. When
coexpressed with the other epothilone PKS genes, epoA, epoB, epoC,
epoD, and epoF, or derivatives thereof, a PKS for an epothilone
derivative with a C-6 hydrogen, instead of a C-6 methyl, is
produced. Thus, if the genes contain no other alterations, the
compounds produced are the 6-desmethyl epothilones.
[0183] The eighth extender module of the epothilone PKS includes a
KS, an AT specific for methylmalonyl CoA, inactive KR and DH
domains, a methyltransferase (MT) domain, and an ACP. In one
embodiment, a DNA compound comprising a sequence that encodes the
eighth extender module of the epothilone PKS is coexpressed with
the other proteins constituting the epothilone PKS or a PKS that
produces an epothilone derivative. In another embodiment, a portion
or all of the eighth extender module coding sequence is utilized in
conjunction with other PKS coding sequences to create a hybrid
module. In this embodiment, the invention provides, for example,
either replacing the methylmalonyl CoA specific AT with a malonyl
CoA, ethylmalonyl CoA, or 2-hydroxymalonyl CoA specific AT;
deleting the inactive KR and/or the inactive DH; replacing the
inactive KR and/or DH with an active KR and/or DH; and/or inserting
an ER. The resulting heterologous eighth extender module coding
sequence is expressed as a protein that is utilized in conjunction
with the other proteins that constitute a PKS that synthesizes
epothilone, an epothilone derivative, or another polyketide.
Alternatively, the coding sequences for the eighth extender module
in the epoE gene can be deleted or replaced by those for a
heterologous module to prepare a recombinant epoE gene that,
together with the epoA, epoB, epoC, epoD, and epoF genes, can be
expressed to make a PKS for an epothilone derivative.
[0184] The eighth extender module of the epothilone PKS also
comprises a methylation or methyltransferase (MT) domain with an
activity that methylates the epothilone precursor. This function
can be deleted to produce a recombinant epoD gene derivative of the
invention, which can be expressed with the other epothilone PKS
genes or derivatives thereof that makes an epothilone derivative
that lacks one or both methyl groups, depending on whether the AT
domain of the eighth extender module has been changed to a malonyl
specific AT domain, at the corresponding C-4 position of the
epothilone molecule.
[0185] The ninth extender module of the epothilone PKS includes a
KS, an AT specific for malonyl CoA, a KR, an inactive DH, and an
ACP. The ninth extender module of the epothilone PKS is expressed
as a protein, the product of the epoF gene, which also contains the
TE domain of the epothilone PKS. In one embodiment, a DNA compound
comprising a sequence that encodes the ninth extender module of the
epothilone PKS is expressed as a protein together with other
proteins to constitute an epothilone PKS or a PKS that produces an
epothilone derivative. In these embodiments, the ninth extender
module is typically expressed as a protein that also contains the
TE domain of either the epothilone PKS or a heterologous PKS. In
another embodiment, a portion or all of the ninth extender module
coding sequence is utilized in conjunction with other PKS coding
sequences to create a hybrid module. In this embodiment, the
invention provides, for example, either replacing the malonyl CoA
specific AT with a methylmalonyl CoA, ethylmalonyl CoA, or
2-hydroxy malonyl CoA specific AT; deleting the KR; replacing the
KR with a KR that specifies a different stereochemistry; and/or
inserting a DH or a DH and an ER. For example, replacement of the
AT domain of extender module 9 with an AT domain specific for
methylmalonyl CoA results in a recombinant epothilone PKS that
produces 2-methyl-epothilones A, B, C, and D in the recombinant
Myxococcus host cells of the invention. The resulting heterologous
ninth extender module coding sequence is coexpressed with the other
proteins constituting a PKS that synthesizes epothilone, an
epothilone derivative, or another polyketide. Alternatively, the
present invention provides a PKS for an epothilone or epothilone
derivative in which the ninth extender module has been replaced by
a module from a heterologous PKS or has been deleted in its
entirety. In the latter embodiment, the TE domain is expressed as a
discrete protein or fused to the eighth extender module.
[0186] In another embodiment, the present invention provides a host
cell of the invention that comprises a heterologous PKS gene
cluster (a PKS gene cluster that is not present in an unmodified,
naturally occurring host cell of the same type) as well as a gene
that encodes a thioesterase type II protein ("TE II"). In a
preferred embodiment, the TE II gene is heterologous to the PKS
gene cluster--the TE II gene is not derived from the same gene
cluster as the PKS. As one example, the recombinant host cells of
the invention in one embodiment comprise the genes that code for
the expression of the epothilone PKS or an epothilone PKS
derivative. In accordance with this aspect of the invention, the
host cells are modified to contain a TE II gene isolated from a PKS
gene cluster other than the epothilone PKS gene cluster.
Illustrative embodiments include, for example, the TE II gene from
the picromycin PKS gene cluster of Streptomyces venezuelae and the
TE II gene from the tmbA PKS gene cluster of Sorangium cellulosum
(this PKS gene cluster is described in U.S. Pat. No. 6,090,601;
U.S. patent application Ser. No. 144,085, filed 31 Aug. 1998; and
provisional U.S. patent application Ser. No. 60/271,245, filed 15
Feb. 2001, each of which is incorporated herein by reference).
[0187] Illustrative examples of recombinant epothilone derivative
PKS genes of the invention, which are identified by listing the
altered specificities of the hybrid modules (the other modules
having the same specificity as the epothilone PKS), include:
(a) module 4 with methylmalonyl specific AT (mmAT) and a KR and
module 2 with a malonyl specific AT (mAT) and a KR;
(b) module 4 with mmAT and module 3 with mmAT;
(c) module 4 with mmAT and module 5 with mmAT;
(d) module 4 with mmAT and module 5 with mmAT and only a DH and
KR;
(e) module 4 with mmAT and module 5 with mmAT and only a KR;
(f) module 4 with mmAT and module 5 with mmAT and only an inactive
KR;
(g) module 4 with mmAT and module 6 with mAT;
(h) module 4 with mmAT and module 6 with mAT and only a DH and
KR;
(i) module 4 with mmAT and module 6 with mAT and only a KR;
(j) module 4 with mmAT and module 6 with mAT and only an inactive
KR;
(k) module 4 with mmAT and module 7 with mAT;
(l) hybrids (d) through (f), except that module 5 has an mAT;
(m) hybrids (h) through (O) except that module 6 has an mmAT;
and
(n) hybrids (a) through (m) except that module 4 has an mAT.
[0188] The above list is illustrative only and should not be
construed as limiting the invention, which includes other
recombinant epothilone PKS genes and enzymes with not only two
hybrid modules other than those shown but also with three or more
hybrid modules.
[0189] The host cells of the invention can be grown and fermented
under conditions known in the art for other purposes to produce the
compounds of the invention. The present invention also provides
novel methods for fermenting the host cells of the invention. The
compounds of the invention can be isolated from the fermentation
broths of these cultured cells and purified by methods such as
those in Example 3, below.
[0190] The present invention provides a number of methods relating
to the fermentation of Myxococcus strains for production of
polyketides and other products. Prior to the present invention,
fermentation of Myxococcus has not been conducted for production
purposes for any polyketides other than TA and saframycin, which
are produced naturally by certain Myxococcus strains. Thus, in one
aspect, the present invention enables the use of Myxococcus as a
production host for the production by fermentation of useful
bioactive compounds, including, but not limited to, polyketides,
non-ribosomal peptides, epothilones, lipases, proteases, other
proteins, lipids, glycolipids, rhamnolipids, and
polyhydroxyalkanoates.
[0191] Among the methods provided by the invention are methods for
preparing and storing cell banks and methods for adapting a
Myxococcus strain to a fermentation medium. These methods are
important, because prior to the present invention, frozen cell
banks of Myxococcus strains adapted for production in oil-based
fermentation medium have not been made, and in the absence of
adaptation, Myxococcus strains frequently die, especially in
oil-based fermentation medium.
[0192] The present invention also provides a fermentation method
for growing Myxococcus and a fermentation medium useful in the
method. Surprisingly, Myxococcus xanthus and other Myxococcus
strains cannot utilize carbohydrates, glycerol, alcohol, or TCA
cycle intermediates as a carbon source. Prior to the present
invention, M. xanthus fermentations were carried out in protein
based media. However, NH.sub.4 builds up to levels toxic to growth
in protein based media and so limits fermentation. In accordance
with the present invention, Myxococcus strains are fermented in a
medium that contains oil and/or fatty acids as a carbon source.
[0193] Illustrative oils and fatty acids useful in the method
include, but are not limited to, methyl oleate; oils derived from
coconut, lard, rapeseed, sesame, soy, and sunflower; salad oil;
self emulsifying oils such as Agrimul CoS2, R5O5, and R5O3;
glycerol oleate, including glycerol mono oleate and glycerol tri
oleate; odd chain esters such as methyl heptadecanoate, methyl
nonadecanoate, and methyl pelargonate; ester chains such as propyl
oleate and ethyl oleate; vegetable methyl oleate; methyl stearate;
methyl linoleate; oleic acid; and phosphatidyl choline, whether
pure or derived from soy or egg yolk. Thus, any plant or grain
derived oil, such as sunflower or soy oil, any animal derived oil,
such as lard oil, free and esterified fatty acids of any chain
length both saturated or unsaturated, natural and synthetic fatty
acid mixtures such as phosphatidyl choline or methyl pelargonate,
respectively, and industrial fermentation oils, such as Cognis
Corporation's Agrimul series, can be employed in the method. In a
preferred embodiment, the fermentation medium utilizes methyl
oleate as the carbon source. Generally, oils that are liquid at
room temperature are more preferred than solid oils, primarily
primarily due to the ease of dispersion. Other important components
of the fermentation medium include trace metals such as Fe and Cu,
which improve growth and production in complex and defined media
and in batch and fed batch processes. A medium containing methyl
oleate and trace metals is preferred for the production of
epothilones.
[0194] In one embodiment, the present invention provides a
fermentation medium for host cells of the invention that contains
reduced or no amounts of animal-derived materials. Due to the
potential for contamination by infectious agents, such as viruses
and prions, the use of animal by-products in fermentation processes
for the production of compounds to be administered to humans or
animals, one may prefer to use a fermentation medium that contains
reduced or no amounts of animal-derived materials. Such media is
provided for use in the methods of the invention. The oils or fatty
acids contained in the fermentation medium can be derived from a
non-animal source, such as a plant. For example, vegetable-derived
methyl oleate can be obtained commercially. Moreover, one can
replace an animal-derived material with an equivalent but
non-identical material derived from a non-animal source. For
example, casitone, which is a pancreatic digest of casein, a milk
protein, can be replaced with a hydrolysate of a protein from a
non-animal source, including but not limited to a plant, such as a
vegetable-derived protein hydrolysate.
[0195] Generally, fed-batch processes are preferred for
fermentation. Feeds force the cells to use nutrients efficiently
(for example, the cells metabolize carbon down to CO.sub.2 and
H.sub.2O instead of generating toxic organic acids). High nutrient
levels can repress secondary metabolism, and if the fermentation
feeds nutrients at rate below the threshold of inhibition,
production can be higher.
[0196] The fermentation methods of the invention also include
methods related specifically to the production of epothilones and
fermentation media useful in those methods. As one example,
propionate and acetate can be used to influence the epothilone D:C
(or B:A) ratio and the titers of epothilones obtained. While this
effect is minimal in the preferred methyl oleate/trace metals
fermentation medium, the effect can be quite significant effect in
other media, such as CTS medium. Increasing amounts of acetate in
the fermentation media can increase Myxococcus growth and
epothilone production. Acetate alone increases epothilone C (or
epothilone A) titers dramatically, and reduces epothilone D (or
epothilone A) titers. Propionate alone does not increase epothilone
titers and at high concentrations can reduce titers. However,
propionate and acetate together can shifts the production from
epothilone C (or epothilone A) to epothilone D (or epothilone B).
One preferred medium for the production of epothilone D contains
casitone, 10 mM acetate, and 30 mM propionate. Media containing odd
chain fatty acids can reduce production of epothilone C in
fermentations of Myxococcus xanthus cells that produce epothilones
C and D. Trace metals can also enhance epothilone D production and
increase epothilone D:C ratios in the presence of acetate and
without any oil in the fermentation media.
[0197] The present invention also provides methods for purifying
epothilones from fermentation media and for preparing crystalline
forms of epothilone. In general, the purification method involves
capture of the epothilone onto XAD resin during fermentation,
elution from the resin, solid phase extraction, chromatography, and
crystallization. The method is described in detail in Example 3,
and while the method is preferred and exemplified for epothilone D,
the method can be used to prepare crystalline epothilones
generally, including but not limited to other naturally occurring
epothilones, and the epothilone analogs produced by the host cells
of the invention.
[0198] Thus, in another embodiment, the present invention provides
novel epothilone derivative compounds in isolated and purified
forms useful in agriculture, veterinary practice, and medicine. In
one embodiment, the compounds are useful as fungicides. In another
embodiment, the compounds are useful in cancer chemotherapy. In
another embodiment, the compounds are useful for the prevention of
undesired cell growth, including but not limited to the treatement
of hyperproliferative diseases such as inflammation, autoimmune
disease, and psoriasis, and to the prevention of cell growth in
stents. In a preferred embodiment, the compound is an epothilone
derivative that is at least as potent against tumor cells as
epothilone B or D. In another embodiment, the compounds are useful
as immunosuppressants. In another embodiment, the compounds are
useful in the manufacture of another compound. In a preferred
embodiment, the compounds are formulated in a mixture or solution
for administration to a human or animal.
[0199] The novel epothilone analogs of the present invention, as
well as the epothilones produced by the host cells of the
invention, can be derivatized and formulated as described in PCT
patent publication Nos. 93/10121, 97/19086, 98/08849, 98/22461,
98/25929, 99/01124, 99/02514, 99/07692, 99/27890, 99/39694,
99/40047, 99/42602, 99/43320, 99/43653, 99/54318, 99/54319,
99/54330, 99/65913, 99/67252, 99/67253, and 00/00485, and U.S. Pat.
No. 5,969,145, each of which is incorporated herein by
reference.
[0200] Compounds of the invention include the 14-methyl epothilone
derivatives (made by utilization of the hybrid module 3 of the
invention that has an AT that binds methylmalonyl CoA instead of
malonyl CoA); the 8,9-dehydro epothilone derivatives (made by
utilization of the hybrid module 6 of the invention that has a DH
and KR instead of an ER, DH, and KR); the 10-methyl epothilone
derivatives (made by utilization of the hybrid module 5 of the
invention that has an AT that binds methylmalonyl CoA instead of
malonyl CoA); the 9-hydroxy epothilone derivatives (made by
utilization of the hybrid module 6 of the invention that has a KR
instead of an ER, DH, and KR); the 8-desmethyl-14-methyl epothilone
derivatives (made by utilization of the hybrid module 3 of the
invention that has an AT that binds methylmalonyl CoA instead of
malonyl CoA and a hybrid module 6 that binds malonyl CoA instead of
methylmalonyl CoA); the 8-desmethyl-8,9-dehydro epothilone
derivatives (made by utilization of the hybrid module 6 of the
invention that has a DH and KR instead of an ER, DH, and KR and an
AT that specifies malonyl CoA instead of methylmalonyl CoA); and
9-oxo-epothilone D. Other preferred novel epothilones of the
invention include those described in Example 11 and below.
[0201] In one aspect of the present invention, compounds of the
following formula ##STR5## are provided wherein:
[0202] R.sup.1, R.sup.2, R.sup.3, R.sup.5, R.sup.11, and R.sup.12
are each independently hydrogen, methyl or ethyl;
[0203] R.sup.4, R.sup.6 and R.sup.9 are each independently
hydrogen, hydroxyl, or oxo; alternatively
[0204] R.sup.5 and R.sup.6 together form a carbon carbon double
bond;
[0205] R.sup.7 is hydrogen, methyl, or ethyl;
[0206] R.sup.8 and R.sup.10 are both hydrogen or together form a
carbon carbon double bond or an epoxide;
[0207] Ar is aryl; and,
[0208] W is O or NR.sup.13 where R.sup.13 is hydrogen,
C.sub.1-C.sub.10 aliphatic, aryl or alkylaryl. In another
embodiment, compounds of formula I are provided wherein R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8,
R.sup.9, R.sup.10, R.sup.11, R.sup.12, R.sup.13, Ar and W are as
described previously provided that at least one of R.sup.1,
R.sup.4, R.sup.5, R.sup.6, R.sup.9 and R.sup.11 is not
hydrogen.
[0209] In another embodiment, compounds of formula I are provided
wherein
[0210] R.sup.1, R.sup.2, R.sup.3, and R.sup.11 are each
independently hydrogen or methyl;
[0211] R.sup.4 and R.sup.9 are each independently hydrogen,
hydroxyl, or oxo;
[0212] R.sup.5 and R.sup.6 are both hydrogen or together form a
carbon carbon double bond;
[0213] R.sup.7 and R.sup.12 are both methyl;
[0214] R.sup.8 and R.sup.10 are both hydrogen or together form a
carbon carbon double bond;
[0215] Ar is heteroaryl; and,
[0216] W is O or NR.sup.13 where R.sup.13 is hydrogen or
C.sub.1-C.sub.5 alkyl, provided that at least one of R.sup.1,
R.sup.4, R.sup.5, R.sup.6, R.sup.9 and R.sup.11 is not
hydrogen.
[0217] In another aspect of the present invention, compounds of the
formula ##STR6##
[0218] R.sup.4, R.sup.6 and R.sup.9 are each independently
hydrogen, hydroxyl, or oxo;
[0219] R.sup.5, R.sup.11, R.sup.12 are each independently hydrogen,
methyl or ethyl; alternatively,
[0220] R.sup.5 and R.sup.6 together form a carbon carbon double
bond;
[0221] R.sup.7 is hydrogen, methyl, or ethyl;
[0222] R.sup.8 and R.sup.10 are both hydrogen or together form a
carbon carbon double bond or an epoxide;
[0223] Ar is aryl; and,
[0224] W is O or NR.sup.13 where R.sup.13 is hydrogen or
C.sub.1-C.sub.5 alkyl. In another embodiment, compounds of formula
II are provided wherein R.sup.4, R.sup.5, R.sup.6, R.sup.7,
R.sup.8, R.sup.9, R.sup.10, R.sup.12, R.sup.13, Ar and W are as
described previously provided that at least one of R.sup.4,
R.sup.5, R.sup.6 and R.sup.9 is not hydrogen.
[0225] In another embodiment, compounds of formula II are provided
wherein
[0226] R.sup.4 and R.sup.9 are each independently hydrogen,
hydroxyl, or oxo;
[0227] R.sup.5 and R.sup.6 are each hydrogen or together form a
carbon carbon double bond;
[0228] R.sup.7 and R.sup.12 are both methyl;
[0229] R.sup.8 and R.sup.10 are both hydrogen or together form a
carbon carbon double bond;
[0230] Ar is 2-methyl-1,3-thiazolinyl, 2-methyl-1,3-oxazolinyl,
2-hydroxymethyl-1,3-thiazolinyl, or 2-hydroxymethyl-1,3-oxazolinyl;
and,
[0231] W is O or NH provided that at least one of R.sup.4, R.sup.5,
R.sup.6, and R.sup.9 is not hydrogen.
[0232] In another aspect of the present invention, compounds of the
formula ##STR7## are provided wherein
[0233] R.sup.1, R.sup.2, R.sup.3, R.sup.5, R.sup.11, R.sup.12 are
each independently hydrogen, methyl or ethyl;
[0234] R.sup.6 is hydrogen; alternatively
[0235] R.sup.5 and R.sup.6 together form a carbon carbon double
bond;
[0236] R.sup.7 is hydrogen, methyl, or ethyl;
[0237] Ar is aryl; and,
[0238] W is O or NR.sup.13 where R.sup.13 is hydrogen or
C.sub.1-C.sub.5 alkyl. In another embodiment, compounds of formula
III are provided wherein R.sup.1, R.sup.2, R.sup.3, R.sup.5,
R.sup.6, R.sup.7, R.sup.11, R.sup.12, R.sup.13, Ar and W are as
described previously provided that at least one of R.sup.1,
R.sup.5, R.sup.6, and R.sup.11 is not hydrogen.
[0239] In another embodiment, compounds of formula III are provided
wherein
[0240] R.sup.1, R.sup.2, R.sup.3, R.sup.11 are each independently
hydrogen, methyl or ethyl;
[0241] R.sup.5 and R.sup.6 are both hydrogen or together form a
carbon carbon double bond;
[0242] R.sup.7 and R.sup.12 are both methyl;
[0243] Ar is 2-methyl-1,3-thiazolinyl, 2-methyl-1,3-oxazolinyl,
2-hydroxymethyl-1,3-thiazolinyl, or 2-hydroxymethyl-1,3-oxazolinyl;
and,
[0244] W is O or NH provided that at least one of R.sup.1, R.sup.5,
R.sup.6, and R.sup.11 is not hydrogen.
[0245] In another aspect of the present invention, compounds of the
formula ##STR8## are provided wherein
[0246] R.sup.4 is hydrogen or oxo;
[0247] R.sup.5 and R.sup.6 are both hydrogen or together form a
carbon carbon double bond;
[0248] R.sup.7 is hydrogen or methyl;
[0249] R.sup.9 is hydrogen or hydroxyl;
[0250] R.sup.8 and R.sup.10 are both hydrogen or together form a
carbon carbon double bond or an expoxide;
[0251] W is O or NH;
[0252] X is O or S; and
[0253] R.sup.14 is methyl or hydroxymethyl.
[0254] In another aspect of the present invention, compounds are of
the formula ##STR9##
[0255] R.sup.4 is hydrogen or oxo;
[0256] R.sup.5 and R.sup.7 are each independently hydrogen or
methyl;
[0257] R.sup.6 is hydrogen;
[0258] R.sup.8 and R.sup.10 are both hydrogen or together form a
carbon carbon double bond or an epoxide; alternatively, R.sup.6 and
R.sup.8 together form a double bond; [0259] R.sup.9 is hydrogen,
hydroxyl or oxo;
[0260] W is O or NH;
[0261] X is O or S; and
[0262] R.sup.14 is methyl or hydroxymethyl.
[0263] In another aspect of the present invention, the following
compounds are provided: ##STR10## ##STR11##
[0264] The compounds of the present invention are cytotoxic agents
and may be used in any suitable manner including but not limited to
as anti-cancer agents. An illustrative assay for assessing the
degree of cytotoxicy and tubulin polyermization is described in
Example 12.
[0265] The compounds of the present invention can be made using a
number of methods. In one aspect of the present invention, the
compounds are produced by recombinant host cells that express an
epothilone PKS. In one embodiment, compounds of the formula
##STR12## (where R.sup.1 through R.sup.12 are as previously
described for formula I) are made by altering the AT specificity at
one or more modules and/or altering the enzymatic domains at one or
more modules. Example 11 describes the types of modifications and
specific compounds that may be made using this method.
[0266] In another embodiment of the present invention, oxazole
counterparts of formula V can be made by modulating the
fermentation conditions of the host cells that would normally make
compounds of formula V. The thiazole moiety of compounds of formula
V is derived from the binding of cysteine at the NRPS. Epothilones
H.sub.1 and H.sub.2, which are the oxazole counterparts to
epothilones C and D, is made by host cells in trace quantities and
is believed to occur from the occasional binding of serine instead
of cysteine at the epothilone NRPS.
[0267] The present method takes advantage of the apparent
competition of serine with cysteine at the NRPS binding site of the
epothilone PKS and uses fermentation conditions to favor the
binding of serine instead of cysteine at the epothilone NRPS. It
has been found that by growing host cells in medium that is
supplemented with serine (e.g. 50 fold increase above basal levels)
results in the production of mostly oxazole-containing compounds
instead of the thiazole-containing compounds that are normally
produced. Consequently, recombinant host cells that are engineered
to make a particular epothilone compound or compounds of formula V
can be grown in medium that is supplemented with serine so that
these same cells now favor the production of oxazole counterparts,
the compounds of formula VI: ##STR13##
[0268] In other words, the present method is a simple and elegant
way of obtaining two compounds, one corresponding to formula V and
its counterpart corresponding to formula VI for the price of one.
The serine supplementation method for making oxazole-containing
compounds is described in greater detail in Example 13. This
example describes the conditions that were used to decrease the
levels of epothilones D and C that is normally produced by strain
K111-40-1 to favor the production of epothilones H.sub.2 and
H.sub.1, the oxazole counterparts to epothilones D and C
respectively. Other recombinant constructs that make other
compounds of formula V of the invention can be grown using similar
conditions to make compounds of formula VI.
[0269] In another aspect of the present invention, compounds are
produced using a method referred to as chemobiosynthesis. This
method uses an epothilone PKS that has been altered in such a way
so that the PKS accepts and binds a synthetic precursor at a
designated site. The synthetic precursor is then processed by the
PKS in the normal manner from that point forward.
[0270] An illustrative example of the types of alteration required
for chemobiosynthesis is described in Example 9 which describes the
construction of a KS2 knockout version of a M. xanthus strain that
normally produces epothilones A, B, C, and D as major products. A
KS2 knockout refers to an inactivation of the KS domain of extender
module 2 so that the resulting PKS is unable to load and process
the product of the previous modules, the loading domain and the
NRPS (which is considered extender module 1). Consequently, the
PKS-directed synthesis stalls at the ACP of extender module 2 and
no epothilone product is made by such a strain in the absence of a
synthetic precursor. However, when the strain is provided with a
synthetic precursor, it mimics the product of the loading domain
and extender module 1 so that the ACP of extender module 2 binds
the precursor and the PKS processes the precursor from that point
forward. For example, providing the knockout strain of Example 9
with the synthetic precursor ##STR14## results in the production of
epothilones B and D (epothilones A and B are also produced but in
trace quantities) as described in greater detail in Example 10. See
also FIG. 1. In another example providing the knockout strain of
Example 9 with the synthetic precursors, for example, ##STR15##
where R is hydrogen, hydroxy, halogen, amino, C.sub.1-C.sub.5
alkyl, C.sub.1-C.sub.5 hydroxyalkyl, C.sub.1-C.sub.5 alkoxy, and
C.sub.1-C.sub.5 aminoalkyl, more preferably hydrogen or methyl,
results in the following epothilone compounds ##STR16## and their
12, 13-epoxide counterparts respectively.
[0271] Thus, by varying the synthetic precursor, a single KS2
knockout strain can be used to make a wide variety of compounds. In
fact, the strain described in Example 9 can be used to make
compounds of the formulas ##STR17## where Ar is aryl and R.sup.7 is
hydrogen or methyl by providing it with synthetic precursors of the
formula ##STR18## Illustrative examples of suitable Ar groups
include but are not limited to ##STR19##
[0272] where R is hydrogen, hydroxy, halogen, amino,
C.sub.1-C.sub.5 alkyl, C.sub.1-C.sub.5 hydroxyalkyl,
C.sub.1-C.sub.5 alkoxy, and C.sub.1-C.sub.5 aminoalkyl. In more
preferable embodiments, R is hydrogen or methyl. Example 10
describes the synthesis of various precursors and their use in
chemobiosynthesis and their 12, 13-epoxide counterparts
respectively.
[0273] In another embodiment, a loading domain knockout is used to
make certain compounds of the present invention. For example, a
loading domain knockout of the starting material used in Example 9
can also be used to make compounds of formulas VII and VIII by
providing synthetic precursors of the formula ##STR20##
[0274] In other embodiments, KS2 or loading domain knockouts of
other strains of the invention are made including but not limited
to those strains described in Example 11 and used to make compounds
having aryl moieties other than 2-methyl thiazole. For example,
feeding synthetic precursors of formula IX to a KS2 knockout of a
construct that makes predominantly 9-oxo-epothilone D will result
in compounds of the formula ##STR21## where Ar is aryl.
[0275] In another aspect of the present invention, compounds made
from host cells expressing an epothilone PKS can be further
modified using biological and/or synthetic methods. In one
embodiment, compounds of formula I where Ar is ##STR22## can be
hydroxylated at the C-21 carbon using a microbially-derived
hydroxylase. Protocols for effectuating such a transformation are
described for example by PCT Publication No. WO 00/39276 which is
incorporated herein in its entirety by reference, and by Example 14
herein.
[0276] In another embodiment, compounds of the invention having a
carbon-carbon double bond at the positions corresponding to C-12
and C-13 of epothilones A-D can be epoxidated using EpoK or another
P450 epoxidase. A general method for using EpoK for epoxidation is
described by Example 5 of PCT publication WO 00/31247 which is
incorporated herein by reference, and by Example 15 herein.
Alternatively, the epoxidation reaction can occur by contacting an
epothilone compound containing a double bond at a position that
corresponds to the bond between carbon-12 and carbon 13 to a
culture of cells that expresses a functional Epo K. Such cells
include the myxobacterium Sorangium cellulosum. In particularly
preferred embodiments, the Sorangium cellulosum expresses Epo K but
does not contain a functional epothilone polyketide synthase
("PKS") gene. Such strains may be made by mutagenesis where one or
more mutations in the epothilone PKS gene render it inoperative.
Such mutants can occur naturally (which may be found by screening)
or can be directed using either mutagens such as chemicals or
irradation or by genetic manipulation. A particularly effective
strategy for making strains with an inoperative epothilone PKS is
homologous recombination as described by PCT publication WO
00/31247.
[0277] In another embodiment, the epoxidation reaction can occur
using synthetic methods. For example, as shown by Scheme 2, desoxy
compounds of the invention can be transformed to the epoxy
counterparts by reacting the desoxy compounds with
dimethyldioxirane. ##STR23## Example 16 describes this synthetic
method in greater detail.
[0278] In another embodiment, the macrolactones of the invention
can be converted into macrolactams of the invention. As illustrated
by Scheme3, a desoxy macrolactone of the invention is epoxidated
using dimethyldioxirane as previously described by Scheme 2 to
provide the oxycounterpart. ##STR24## The oxy-macrolactone is
treated with sodium azide and tetrakis(triphenylphosline) palladium
to open the ring and form the azido acid. The azide is then reduced
with trimethylphosphine to form the amino carboxyacid.
[0279] Epoxy-compounds of the invention where W is NH can be made
from the macrolactamization of the amino carboxyacid. ##STR25## As
shown by Scheme 4, the amino carboxyacid is treated with
1-(3-dimethylaminopropyl)-3-ethyl-carbodiimide and
1-hydroxybenzotriazole to form the epoxy-macrolactam. The
desoxy-macrolactam can be made by treating the epoxy-macrolactam
with tungsten hexachloride and butyllithium.
[0280] Epoxy-compounds of the invention where W is NR.sup.13 and
R.sup.13 is not hydrogen can be made by treating the amino
carboxyacid with an aldehyde and sodium cyanoborohydride prior to
macrolactamization. ##STR26## As shown by Scheme 5, the amino
carboxyacid is treated with aldehyde, R.sup.13HO, and sodium
cyanoborohydride to form a substituted amino acid which is then
macrolactamized and optionally deoxygenated as described previously
in Scheme 4 to provide the epoxy and desoxy macrolactams where
R.sup.13 is not hydrogen.
[0281] The synthetic methods for making the macrolactams of the
invention are also described in greater detail by the Examples
17-19. Example 17 describes the formation of the amino acid using
9-oxo-epothilone D as an illustrative starting material. Examples
18 and 19 describe the formation of the epoxy and desoxy
macrolactam versions of 9-oxo-epothilone D respectively. Examples
20 and 21 describe the formation of the epoxy and desoxy
substituted macrolactam versions of 9-oxo-epothilone D
respectively.
[0282] A composition of the present invention generally comprises
an inventive compound and a pharmaceutically acceptable carrier.
The inventive compound may be free form or where appropriate as
pharmaceutically acceptable derivatives such as prodrugs, and salts
and esters of the inventive compound.
[0283] The composition may be in any suitable form such as solid,
semisolid, or liquid form. See Pharmaceutical Dosage Forms and Drug
Delivery Systems, 5.sup.th edition, Lippicott Williams &
Wilkins (1991) which is incorporated herein by reference. In
general, the pharmaceutical preparation will contain one or more of
the compounds of the invention as an active ingredient in admixture
with an organic or inorganic carrier or excipient suitable for
external, enteral, or parenteral application. The active ingredient
may be compounded, for example, with the usual non-toxic,
pharmaceutically acceptable carriers for tablets, pellets,
capsules, suppositories, pessaries, solutions, emulsions,
suspensions, and any other form suitable for use. The carriers that
can be used include water, glucose, lactose, gum acacia, gelatin,
mannitol, starch paste, magnesium trisilicate, talc, corn starch,
keratin, colloidal silica, potato starch, urea, and other carriers
suitable for use in manufacturing preparations, in solid,
semi-solid, or liquified form. In addition, auxiliary stabilizing,
thickening, and coloring agents and perfumes may be used.
[0284] In one embodiment, the compositions containing an inventive
compound are Cremophor.RTM.-free. Cremophor.RTM. (BASF
Aktiengesellschaft) is a polyethoxylated castor oil which is
typically used as a surfactant in formulating low soluble drugs.
However, because Cremophor.RTM. can case allergic reactions in a
subject, compositions that minimize or eliminate Cremophor.RTM. are
preferred. Formulations of epothilone A or B that eliminate
Cremophor.RTM. are described for example by PCT Publication WO
99/39694 which is incorporated herein by reference and may be
adapted for use with the inventive compounds.
[0285] Where applicable, the inventive compounds may be formulated
as microcapsules and nanoparticles. General protocols are described
for example, by Microcapsules and Nanoparticles in Medicine and
Pharmacy by Max Donbrow, ed., CRC Press (1992) and by U.S. Pat.
Nos. 5,510,118; 5,534,270; and 5,662,883 which are all incorporated
herein by reference. By increasing the ratio of surface area to
volume, these formulations allow for the oral delivery of compounds
that would not otherwise be amenable to oral delivery.
[0286] The inventive compounds may also be formulated using other
methods that have been previously used for low solubility drugs.
For example, the compounds may form emulsions with vitamin E or a
PEGylated derivative thereof as described by WO 98/30205 and
00/71163 which are incorporated herein by reference. Typically, the
inventive compound is dissolved in an aqueous solution containing
ethanol (preferably less than 1% w/v). Vitamin E or a
PEGylated-vitamin E is added. The ethanol is then removed to form a
pre-emulsion that can be formulated for intravenous or oral routes
of administration. Another strategy involves encapsulating the
inventive compounds in liposomes. Methods for forming liposomes as
drug delivery vehicles are well known in the art. Suitable
protocols include those described by U.S. Pat. Nos. 5,683,715;
5,415,869, and 5,424,073 which are incorporated herein by reference
relating to another relatively low solubility cancer drug taxol and
by PCT Publication WO 01/10412 which is incorporated herein by
reference relating to epothilone B. Of the various lipids that may
be used, particularly preferred lipids for making
epothilone-encapsulated liposomes include phosphatidylcholine and
polyethyleneglycol-derivitized distearyl phosphatidylethanolamine.
Example 22 provides an illustrative protocol for making liposomes
containing 9-oxo-epothilone D, the general method which can be
readily adapted to make liposomes containing other compounds of the
present invention.
[0287] Yet another method involves formulating the inventive
compounds using polymers such as polymers such as biopolymers or
biocompatible (synthetic or naturally occurring) polymers.
Biocompatible polymers can be categorized as biodegradable and
non-biodegradable. Biodegradable polymers degrade in vivo as a
function of chemical composition, method of manufacture, and
implant structure. Illustrative examples of synthetic polymers
include polyanhydrides, polyhydroxyacids such as polylactic acid,
polyglycolic acids and copolymers thereof, polyesters polyamides
polyorthoesters and some polyphosphazenes. Illustrative examples of
naturally occurring polymers include proteins and polysaccharides
such as collagen, hyaluronic acid, albumin, and gelatin.
[0288] Another method involves conjugating the compounds of the
present invention to a polymer that enhances aqueous solubility.
Examples of suitable polymers include polyethylene glycol,
poly-(d-glutamic acid), poly-(1-glutamic acid), poly-(1-glutamic
acid), poly-(d-aspartic acid), poly-(1-aspartic acid),
poly-(1-aspartic acid) and copolymers thereof. Polyglutamic acids
having molecular weights between about 5,000 to about 100,000 are
preferred, with molecular weights between about 20,000 and 80,000
being more preferred and with molecular weights between about
30,000 and 60,000 being most preferred. The polymer is conjugated
via an ester linkage to one or more hydroxyls of an inventive
epothilone using a protocol as essentially described by U.S. Pat.
No. 5,977,163 which is incorporated herein by reference, and by
Example 23. Preferred conjugation sites include the hydroxyl off
carbon-21 in the case of 21-hydroxy-derivatives of the present
invention. Other conjugation sites include the hydroxyl off carbon
3 and the hydroxyl off carbon 7.
[0289] In another method, the inventive compounds are conjugated to
a monoclonal antibody. This strategy allows the targeting of the
inventive compounds to specific targets. General protocols for the
design and use of conjugated antibodies are described in Monoclonal
Antibody-Based Therapy of Cancer by Michael L. Grossbard, ed.
(1998) which is incorporated herein by reference.
[0290] The amount of active ingredient that may be combined with
the carrier materials to produce a single dosage form will vary
depending upon the subject treated and the particular mode of
administration. For example, a formulation for intravenous use
comprises an amount of the inventive compound ranging from about 1
mg/mL to about 25 mg/mL, preferably from about 5 mg/mL to 15 mg/mL,
and more preferably about 10 mg/mL. Intravenous formulations are
typically diluted between about 2 fold and about 30 fold with
normal saline or 5% dextrose solution prior to use.
[0291] In one aspect of the present invention, the inventive
compounds are used to treat cancer. In one embodiment, the
compounds of the present invention are used to treat cancers of the
head and neck which include tumors of the head, neck, nasal cavity,
paranasal sinuses, nasopharynx, oral cavity, oropharynx, larynx,
hypopharynx, salivary glands, and paragangliomas. In another
embodiment, the compounds of the present invention are used to
treat cancers of the liver and biliary tree, particularly
hepatocellular carcinoma. In another embodiment, the compounds of
the present invention are used to treat intestinal cancers,
particularly colorectal cancer. In another embodiment, the
compounds of the present invention are used to treat ovarian
cancer. In another embodiment, the compounds of the present
invention are used to treat small cell and non-small cell lung
cancer. In another embodiment, the compounds of the present
invention are used to treat breast cancer. In another embodiment,
the compounds of the present invention are used to treat sarcomas
which includes fibrosarcoma, malignant fibrous histiocytoma,
embryonal rhabdomysocarcoma, leiomysosarcoma, neurofibrosarcoma,
osteosarcoma, synovial sarcoma, liposarcoma, and alveolar soft part
sarcoma. In another embodiment, the compounds of the present
invention are used to treat neoplasms of the central nervous
systems, particularly brain cancer. In another embodiment, the
compounds of the present invention are used to treat lymphomas
which include Hodgkin's lymphoma, lymphoplasmacytoid lymphoma,
follicular lymphoma, mucosa-associated lymphoid tissue lymphoma,
mantle cell lymphoma, B-lineage large cell lymphoma, Burkitt's
lymphoma, and T-cell anaplastic large cell lymphoma.
[0292] The method comprises administering a therapeutically
effective amount of an inventive compound to a subject suffering
from cancer. The method may be repeated as necessary either to
contain (i.e. prevent further growth) or to eliminate the cancer.
Clinically, practice of the method will result in a reduction in
the size or number of the cancerous growth and/or a reduction in
associated symptoms (where applicable). Pathologically, practice of
the method will produce at least one of the following: inhibition
of cancer cell proliferation, reduction in the size of the cancer
or tumor, prevention of further metastasis, and inhibition of tumor
angiogenesis.
[0293] The compounds and compositions of the present invention can
be used in combination therapies. In other words, the inventive
compounds and compositions can be administered concurrently with,
prior to, or subsequent to one or more other desired therapeutic or
medical procedures. The particular combination of therapies and
procedures in the combination regimen will take into account
compatibility of the therapies and/or procedures and the desired
therapeutic effect to be achieved.
[0294] In one embodiment, the compounds and compositions of the
present invention are used in combination with another anti-cancer
agent or procedure. Illustrative examples of other anti-cancer
agents include but are not limited to: (i) alkylating drugs such as
mechlorethamine, chlorambucil, Cyclophosphanide, Melphalan,
Ifosfamide; (ii) antimetabolites such as methotrexate; (iii)
microtubule stabilizing agents such as vinblastin, paclitaxel,
docetaxel, and discodermolide; (iv) angiogenesis inhibitors; (v)
and cytotoxic antibiotics such as doxorubicon (adriamycin),
bleomycin, and mitomycin. Illustrative examples of other
anti-cancer procedures include: (i) surgery; (ii) radiotherapy; and
(iii) photodynamic therapy.
[0295] In another embodiment, the compounds and compositions of the
present invention are used in combination with an agent or
procedure to mitigate potential side effects from the inventive
compound or composition such as diarrhea, nausea and vomiting.
Diarrhea may be treated with antidiarrheal agents such as opioids
(e.g. codeine, diphenoxylate, difenoxin, and loeramide), bismuth
subsalicylate, and octreotide. Nausea and vomiting may be treated
with antiemetic agents such as dexamethasone, metoclopramide,
diphenyhydramine, lorazepam, ondansetron, prochlorperazine,
thiethylperazine, and dronabinol. For those compositions that
includes polyethoxylated castor oil such as Cremophor.RTM.,
pretreatment with corticosteroids such as dexamethasone and
methylprednisolone and/or H.sub.1 antagonists such as
diphenylhydramine HCl and/or H.sub.2 antagonists may be used to
mitigate anaphylaxis. Illustrative formulations for intravenous use
and pretreatment regiments are described by Examples 24 and 25
respectively.
[0296] In another aspect of the present invention, the inventive
compounds are used to treat non-cancer disorders that are
characterized by cellular hyperproliferation. In one embodiment,
the compounds of the present invention are used to treat psoriasis,
a condition characterized by the cellular hyperproliferation of
keratinocytes which builds up on the skin to form elevated, scaly
lesions. The method comprises administering a therapeutically
effective amount of an inventive compound to a subject suffering
from psoriasis. The method may be repeated as necessary either to
decrease the number or severity of lesions or to eliminate the
lesions. Clinically, practice of the method will result in a
reduction in the size or number of skin lesions, diminution of
cutaneous symptoms (pain, burning and bleeding of the affected
skin) and/or a reduction in associated symptoms (e.g., joint
redness, heat, swelling, diarrhea. abdominal pain). Pathologically,
practice of the method will result in at least one of the
following: inhibition of keratinocyte proliferation, reduction of
skin inflammation (for example, by impacting on: attraction and
growth factors, antigen presentation, production of reactive oxygen
species and matrix metalloproteinases), and inhibition of dermal
angiogenesis.
[0297] In another embodiment, the compounds of the present
invention are used to treat multiple sclerosis, a condition
characterized by progressive demyelination in the brain. Although
the exact mechanisms involved in the loss of myelin are not
understood, there is an increase in astrocyte proliferation and
accumulation in the areas of myelin destruction. At these sites,
there is macrophage-like activity and increased protease activity
which is at least partially responsible for degradation of the
myelin sheath. The method comprises administering a therapeutically
effective amount of an inventive compound to a subject suffering
from multiple sclerosis. The method may be repeated as necessary to
inhibit astrocyte proliferation and/or lessen the severity of the
loss of motor function and/or prevent or attenuate chronic
progression of the disease. Clinically, practice of the method will
result in in improvement in visual symptoms (visual loss,
diplopia), gait disorders (weakness, axial instability, sensory
loss, spasticity, hyperreflexia, loss of dexterity), upper
extremity dysfunction (weakness, spasticity, sensory loss), bladder
dysfunction (urgency, incontinence, hesitancy, incomplete
emptying), depression, emotional lability, and cognitive
impairment. Pathologically, practice of the method will result in
the reduction of one or more of the following, such as myelin loss,
breakdown of the blood-brain barrier, perivascular infiltration of
mononuclear cells, immunologic abnormalities, gliotic scar
formation and astrocyte proliferation, metalloproteinase
production, and impaired conduction velocity.
[0298] In another embodiment, the compounds of the present
invention are used to treat rheumatoid arthritis, a multisystem
chronic, relapsing, inflammatory disease that sometimes leads to
destruction and ankyiosis of affected joints. Rheumatoid arthritis
is characterized by a marked thickening of the synovial membrane
which forms villous projections that extend into the joint space,
multilayering of the synoviocyte lining (synoviocyte
proliferation), infiltration of the synovial membrane with white
blood cells (macrophages, lymphocytes, plasma cells, and lymphoid
follicles; called an "inflammatory synovitis"), and deposition of
fibrin with cellular necrosis within the synovium. The tissue
formed as a result of this process is called pannus and, eventually
the pannus grows to fill the joint space. The pannus develops an
extensive network of new blood vessels through the process of
angiogenesis that is essential to the evolution of the synovitis.
Release of digestive enzymes (matrix metalloproteinases (e.g.,
collagenase, stromelysin)) and other mediators of the inflammatory
process (e.g., hydrogen peroxide, superoxides, lysosomal enzymes,
and products of arachadonic acid metabolism) from the cells of the
pannus tissue leads to the progressive destruction of the cartilage
tissue. The pannus invades the articular cartilage leading to
erosions and fragmentation of the cartilage tissue. Eventually
there is erosion of the subchondral bone with fibrous ankylosis and
ultimately bony ankylosis, of the involved joint.
[0299] The method comprises administering a therapeutically
effective amount of an inventive compound to a subject suffering
from rheumatoid arthritis. The method may be repeated as necessary
to accomplish to inhibit synoviocyte proliferation and/or lessen
the severity of the loss of movement of the affected joints and/or
prevent or attenuate chronic progression of the disease.
Clinically, practice of the present invention will result in one or
more of the following: (i) decrease in the severity of symptoms
(pain, swelling and tenderness of affected joints; morning
stiffness. weakness, fatigue. anorexia, weight loss); (ii) decrease
in the severity of clinical signs of the disease (thickening of the
joint capsule. synovial hypertrophy, joint effusion, soft tissue
contractures, decreased range of motion, ankylosis and fixed joint
deformity); (iii) decrease in the extra-articular manifestations of
the disease (rheumatic nodules, vasculitis, pulmonary nodules,
interstitial fibrosis, pericarditis, episcleritis, iritis, Felty's
syndrome, osteoporosis); (iv) increase in the frequency and
duration of disease remission/symptom-free periods; (v) prevention
of fixed impairment and disability; and/or (vi)
prevention/attenuation of chronic progression of the disease.
Pathologically, practice of the present invention will produce at
least one of the following: (i) decrease in the inflammatory
response; (ii) disruption of the activity of inflammatory cytokines
(such as IL-1, TNFa, FGF, VEGF); (iii) inhibition of synoviocyte
proliferation; (iv) inhibition of matrix metalloproteinase
activity, and/or (v) inhibition of angiogenesis.
[0300] In another embodiment, the compounds of the present
invention are used to threat atherosclerosis and/or restenosis,
particularly in patients whose blockages may be treated with an
endovascular stent. Atheroschlerosis is a chronic vascular injury
in which some of the normal vascular smooth muscle cells ("VSMC")
in the artery wall, which ordinarily control vascular tone
regulating blood flow, change their nature and develop
"cancer-like" behavior. These VSMC become abnormally proliferative,
secreting substances (growth factors, tissue-degradation enzymes
and other proteins) which enable them to invade and spread into the
inner vessel lining, blocking blood flow and making that vessel
abnormally susceptible to being completely blocked by local blood
clotting. Restenosis, the recurrence of stenosis or artery
stricture after corrective procedures, is an accelerated form of
atherosclerosis.
[0301] The method comprises coating a therapeutically effective
amount of an inventive compound on a stent and delivering the stent
to the diseased artery in a subject suffering from atherosclerosis.
Methods for coating a stent with a compound are described for
example by U.S. Pat. Nos. 6,156,373 and 6,120, 847. Clinically,
practice of the present invention will result in one or more of the
following: (i) increased arterial blood flow; (ii) decrease in the
severity of clinical signs of the disease; (iii) decrease in the
rate of restenosis; or (iv) prevention/attenuation of the chronic
progression of atherosclerosis. Pathologically, practice of the
present invention will produce at least one of the following at the
site of stent implanataion: (i) decrease in the inflammatory
response, (ii) inhibition of VSMC secretion of matrix
metalloproteinases; (iii) inhibition of smooth muscle cell
accumulation; and (iv) inhibition of VSMC phenotypic
dedifferentiation.
[0302] In one embodiment, dosage levels that are administered to a
subject suffering from cancer or a non-cancer disorder
characterized by cellular proliferation are of the order from about
1 mg/m.sup.2 to about 200 mg/m.sup.2 which may be administered as a
bolus (in any suitable route of administration) or a continuous
infusion (e.g. 1 hour, 3 hours, 6 hours, 24 hours, 48 hours or 72
hours) every week, every two weeks, or every three weeks as needed.
It will be understood, however, that the specific dose level for
any particular patient depends on a variety of factors. These
factors include the activity of the specific compound employed; the
age, body weight, general health, sex, and diet of the subject; the
time and route of administration and the rate of excretion of the
drug; whether a drug combination is employed in the treatment; and
the severity of the condition being treated.
[0303] In another embodiment, the dosage levels are from about 10
mg/m.sup.2 to about 150 mg/m.sup.2, preferably from about 10 to
about 75 mg/m.sup.2 and more preferably from about 15 mg/m.sup.2 to
about 50 mg/m.sup.2 once every three weeks as needed and as
tolerated. In another embodiment, the dosage levels are from about
1 mg to about 150 mg/m.sup.2, preferably from about 10 mg/m.sup.2
to about 75 mg/m.sup.2 and more preferably from about 25 mg/m.sup.2
to about 50 mg/m.sup.2 once every two weeks as needed and as
tolerated. In another embodiment, the dosage levels are from about
1 mg/m.sup.2 to about 100 mg/m.sup.2, preferably from about 5
mg/m.sup.2 to about 50 mg/m.sup.2 and more preferably from about 10
mg/m.sup.2 to about 25 mg/m.sup.2 once every week as needed and as
tolerated. In another embodiment, the dosage levels are from about
0.1 to about 25 mg/m.sup.2, preferably from about 0.5 to about 15
mg/m.sup.2 and more preferably from about 1 mg/m.sup.2 to about 10
mg/m.sup.2 once daily as needed and tolerated.
[0304] A detailed description of the invention having been provided
above, the following examples are given for the purpose of
illustrating the present invention and shall not be construed as
being a limitation on the scope of the invention or claims.
EXAMPLE 1
Construction of a Myxococcus xanthus Expression Vector
[0305] The DNA providing the integration and attachment function of
phage Mx8 was inserted into commercially available pACYC184 (New
England Biolabs). An .about.2360 bp MfeI-SmaI from plasmid pPLH343,
described in Salmi et al., February 1998, J. Bact. 180(3): 614-621,
was isolated and ligated to the large EcoRI-XmnI restriction
fragment of plasmid pACYC184. The circular DNA thus formed was
.about.6 kb in size and called plasmid pKOS35-77.
[0306] Plasmid pKOS35-77 serves as a convenient plasmid for
expressing recombinant PKS genes of the invention under the control
of the epothilone PKS gene promoter. In one illustrative
embodiment, the entire epothilone PKS gene with its homologous
promoter is inserted in one or more fragments into the plasmid to
yield an expression vector of the invention.
[0307] The present invention also provides expression vectors in
which the recombinant PKS genes of the invention are under the
control of a Myxococcus xanthus promoter. To construct an
illustrative vector, the promoter of the pilA gene of M. xanthus
was isolated as a PCR amplification product. Plasmid pSWU357, which
comprises the pilA gene promoter and is described in Wu and Kaiser,
December 1997, J. Bact. 179(24):7748-7758, was mixed with PCR
primers Seq1 and Mxpil1 primers: TABLE-US-00003 Seq1:
5'-AGCGGATAACAATTTCACACAGGAAACAGC-3'; and Mxpil1:
5'-TTAATTAAGAGAAGGTTGCAACGGGGGGC-3',
and amplified using standard PCR conditions to yield an .about.800
bp fragment. This fragment was cleaved with restriction enzyme KpnI
and ligated to the large KpnI-EcoR V restriction fragment of
commercially available plasmid pLitmus 28 (New England Biolabs).
The resulting circular DNA was designated plasmid pKOS35-71B.
[0308] The promoter of the pilA gene from plasmid pKOS35-71B was
isolated as an .about.800 bp EcoRV-SnaBI restriction fragment and
ligated with the large MscI restriction fragment of plasmid
pKOS35-77 to yield a circular DNA .about.6.8 kb in size. Because
the .about.800 bp fragment could be inserted in either one of two
orientations, the ligation produced two plasmids of the same size,
which were designated as plasmids pKOS35-82.1 and pKOS35-82.2.
Restriction site and function maps of these plasmids are presented
in FIG. 2.
[0309] Plasmids pKOS35-82.1 and pKOS35-82.2 serve as convenient
starting materials for the vectors of the invention in which a
recombinant PKS gene is placed under the control of the Myxococcus
xanthus pilA gene promoter. These plasmids comprise a single PacI
restriction enzyme recognition sequence placed immediately
downstream of the transcription start site of the promoter. In one
illustrative embodiment, the entire epothilone PKS gene without its
homologous promoter is inserted in one or more fragments into the
plasmids at the PacI site to yield expression vectors of the
invention.
[0310] The sequence of the pilA promoter in these plasmids is shown
below. TABLE-US-00004
CGACGCAGGTGAAGCTGCTTCGTGTGCTCCAGGAGCGGAAGGTGAAGCCG
GTCGGCAGCGCCGCGGAGATTCCCTTCCAGGCGCGTGTCATCGCGGCAAC
GAACCGGCGGCTCGAAGCCGAAGTAAAGGCCGGACGCTTTCGTGAGGACC
TCTTCTACCGGCTCAACGTCATCACGTTGGAGCTGCCTCCACTGCGCGAG
CGTTCCGGCGACGTGTCGTTGCTGGCGAACTACTTCCTGTCCAGACTGTC
GGAGGAGTTGGGGCGACCCGGTCTGCGTTTCTCCCCCGAGACACTGGGGC
TATTGGAGCGCTATCCCTTCCCAGGCAACGTGCGGCAGCTGCAGAACATG
GTGGAGCGGGCCGCGACCCTGTCGGATTCAGACCTCCTGGGGCCCTCCAC
GCTTCCACCCGCAGTGCGGGGCGATACAGACCCCGCCGTGCGTCCCGTGG
AGGGCAGTGAGCCAGGGCTGGTGGCGGGCTTCAACCTGGAGCGGCATCTC
GACGACAGCGAGCGGCGCTATCTCGTCGCGGCGATGAAGCAGGCCGGGGG
CGTGAAGACCCGTGCTGCGGAGTTGCTGGGCCTTTCGTTCCGTTCATTCC
GCTACCGGTTGGCCAAGCATGGGCTGACGGATGACTTGGAGCCCGGGAGC
GCTTCGGATGCGTAGGCTGATCGACAGTTATCGTCAGCGTCACTGCCGAA
TTTTGTCAGCCCTGGACCCATCCTCGCCGAGGGGATTGTTCCAAGCCTTG
AGAATTGGGGGGTTGGAGTGCGCACCTGGGTTGGCATGCGTAGTGCTAAT
CCCATCCGCGGGCGCAGTGCCCCCCGTTGCAACCTTCTCTTAATTAA
[0311] To make the recombinant Myxococcus xanthus host cells of the
invention, M. xanthus cells are grown in CYE media (Campos and
Zusman, 1975, Regulation of development in Myxococcus xanthus:
effect of 3':5'-cyclic AMP, ADP, and nutrition, Proc. Natl. Acad.
Sci. USA 72: 518-522) to a Klett of 100 at 30.degree. C. at 300
rpm. The remainder of the protocol is conducted at 25.degree. C.
unless otherwise indicated. The cells are then pelleted by
centrifugation (8000 rpm for 10 min. in an SS34 or SA600 rotor) and
resuspended in deionized water. The cells are again pelleted and
resuspended in 1/100th of the original volume.
[0312] DNA (one to two .mu.L) is electroporated into the cells in a
0.1 cm cuvette at room temperature at 400 ohm, 25 .mu.FD, 0.65 V
with a time constant in the range of 8.8-9.4. The DNA is free of
salts and is resuspended in distilled and deionized water or
dialyzed on a 0.025 .mu.m Type VS membrane (Millipore). For low
efficiency electroporations, the DNA is spot dialyzed, and
outgrowth is in CYE. Immediately after electroporation, 1 mL of CYE
is added, and the cells in the cuvette pooled with an additional
1.5 mL of CYE previously added to a 50 mL Erlenmeyer flask (total
volume 2.5 ml). The cells are grown for four to eight hours (or
overnight) at 30 to 32.degree. C. at 300 rpm to allow for
expression of the selectable marker. Then, the cells are plated in
CYE soft agar on plates with selection. With kanamycin as the
selectable marker, typical yields are 10.sup.3 to 10.sup.5 per
.mu.g of DNA. With streptomycin as the selectable marker, it is
included in the top agar, because it binds agar.
[0313] With this procedure, the recombinant DNA expression vectors
of the invention are electroporated into Myxococcus host cells that
express recombinant PKSs of the invention and produce the
epothilone, epothilone derivatives, and other novel polyketides
encoded thereby.
EXAMPLE 2
Chromosomal Integration and a Bacterial Artificial Chromosome (BAC)
for Expression of Epothilone in Myxococcus xanthus
[0314] To express the epothilone PKS and modification enzyme genes
in a heterologous host to produce epothilones by fermentation,
Myxococcus xanthus, which is closely related to Sorangium
cellulosum and for which a number of cloning vectors are available,
is employed in accordance with the methods of the invention. M.
xanthus and S. cellulosum are myxobacteria and so may share common
elements of gene expression, translational control, and post
translational modification. M. xanthus has been developed for gene
cloning and expression: DNA can be introduced by electroporation,
and a number of vectors and genetic markers are available for the
introduction of foreign DNA, including those that permit its stable
insertion into the chromosome. M. xanthus can be grown with
relative ease in complex media in fermentors and can be subjected
to manipulations to increase gene expression, if required.
[0315] To introduce the epothilone gene cluster into Myxococcus
xanthus, one can build the epothilone cluster into the chromosome
by using homologous recombination to assemble the complete gene
cluster. Alternatively, the complete epothilone gene cluster can be
cloned on a bacterial artificial chromosome (BAC) and then moved
into M. xanthus for integration into the chromosome.
[0316] To assemble the gene cluster from cosmids pKOS35-70.1A2, and
pKOS35-79.85, small regions (.about.2 kb or larger) of homology
from these cosmids are introduced into Myxococcus xanthus to
provide recombination sites for larger pieces of the gene cluster.
As shown in FIG. 3, plasmids pKOS35-154 and pKOS90-22 are created
to introduce these recombination sites. The strategy for assembling
the epothilone gene cluster in the M. xanthus chromosome is shown
in FIG. 4. Initially, a neutral site in the bacterial chromosome is
chosen that does not disrupt any genes or transcriptional units.
One such region is downstream of the devS gene, which has been
shown not to affect the growth or development of M. xanthus. The
first plasmid, pKOS35-154, is linearized with DraI and
electroporated into M. xanthus. This plasmid contains two regions
of the dev locus flanking two fragments of the epothilone gene
cluster. Inserted in between the epo gene regions is a cassette
composed of a kanamycin resistance marker and the E. coli galK
gene. See Ueki et al., 1996, Gene 183: 153-157, incorporated herein
by reference. Kanamycin resistance arises in colonies if the DNA
recombines into the dev region by a double recombination using the
dev sequence as regions of homology.
[0317] This strain, K35-159, contains small (.about.2.5 kb) regions
of the epothilone gene cluster that will allow for recombination of
pKOS35-79.85. Because the resistance markers on pKOS35-79.85 are
the same as that in K35-159, a tetracycline transposon was
transposed into the cosmid, and cosmids that contain the transposon
inserted into the kanamycin marker were selected. This cosmid,
pKOS90-23, was electroporated into K35-159, and oxytetracycline
resistant colonies were selected to create strain K35-174. To
remove the unwanted regions from the cosmid and leave only the
epothilone genes, cells were plated on CYE plates containing 1%
galactose. The presence of the galK gene makes the cells sensitive
to 1% galactose. Galactose resistant colonies of K35-174 represent
cells that have lost the galK marker by recombination or by a
mutation in the galK gene. If the recombination event occurs, then
the galactose resistant strain is sensitive to kanamycin and
oxytetracycline. Strains sensitive to both antibiotics are verified
by Southern blot analysis. The correct strain is identified and
designated K35-175 and contains the epothilone gene cluster from
module 7 to 4680 bp downstream of the stop codon of epoK.
[0318] To introduce modules 1 through module 7, the above process
is repeated once more. The plasmid pKOS90-22 is linearized with
DraI and electroporated into K35-175 to create K111-13.2. This
strain is electroporated with the tetracycline resistant version of
pKCS35-70.1A2, pKOS90-38, and colonies resistant to oxytetracycline
are selected. This creates strain K111-13.23. Recombinants that now
have the whole epothilone gene cluster are selected by resistance
to 1% galactose. This results in clones K111-32.25, K111-32.26, and
K111-32.35. Strain K111-32.25 was deposited Apr. 14, 2000, with the
American Type Culture Collection, Manassas, Va. 20110-2209, USA, in
compliance with the Budapest Treaty and is available under
accession No. PTA-1700. This strain contains all the epothilone
genes and their promoter(s).
[0319] Fermentation was performed by inoculating strains into 5 mL
of CYE (10 g casitone, 5 g yeast extract, and 1 g
MgSO.sub.4.7H.sub.2O per liter) in a 50 mL flask and growing
overnight until the culture was in mid log growth phase. A 100
.mu.L aliquot was spread onto a CTS plate, and the plate incubated
at 32.degree. C. for 4 to 5 days. To extract epothilones, the agar
and cells from the plate was macerated, put in a 50 mL conical
tube, and acetone added to fill the tube. The solution was
incubated with rocking for 4 to 5 hours, the acetone evaporated,
and the remaining liquid extracted twice with an equal volume of
ethyl acetate. The water was removed from the ethyl acetate extract
by adding magnesium sulfate. The magnesium sulfate was filtered
out, and the liquid was evaporated to dryness. The epothilones were
resuspended in 200 .mu.L of acetonitrile and analyzed by LC/MS. The
analysis showed that the strain produced epothilones A and B, with
epothilone B present at about 0.1 mg/L in the culture, and
epothilone A at 5 to 10-fold lower levels.
[0320] This strain can also be used to produce epothilones in
liquid culture. A flask containing CYE is inoculated with an
epothilone producing strain. The next day, while the cells are in
mid-log growth phase, a 5% inoculum is added to a flask containing
0.5% CMM (0.5% casitone, 0.2% MgSO.sub.4.7H.sub.2O, 10 mM MOPS
pH7.6) along with 1 mg/mL serine, alanine, and glycine and 0.1%
sodium puyruvate. The sodium pyruvate can be added to 0.5% to
increase epothilone B production but causes a decrease in the ratio
of epothilone B to epothilone A. The culture is grown at 30.degree.
C. for 60-72 hours. Longer incubations result in a decrease in
titers of epothilones. To recover epothilones, the cultures are
centrifuged at 10,000 rpm for 10 minutes in an SS34 rotor. The
supernatants are extracted twice with ethyl acetate and rotary
evaporated ("rotavaped") to dryness. Liquid cultures produced 2 to
3 mg/L of epothilones A and B, with ratios similar to that observed
with plate cultures. If XAD (0.5-2%) was added to the culture,
epothilones C and D were observed, with epothilone D present at 0.1
mg/L and epothilone C present at 5 to 10-fold lower levels.
[0321] To clone the whole gene cluster as one fragment, a bacterial
artifical chromosome (BAC) library is constructed. First, SMP44
cells are embedded in agarose and lysed according to the BIO-RAD
genomic DNA plug kit. DNA plugs are partially digested with
restriction enzyme, such as Sau3AI or HindIII, and electrophoresed
on a FIGE or CHEF gel. DNA fragments are isolated by electroeluting
the DNA from the agarose or using gelase to degrade the agarose.
The method of choice to isolate the fragments is electroelution, as
described in Strong et al., 1997, Nucleic Acids Res. 19: 3959-3961,
incorporated herein by reference. The DNA is ligated into the BAC
(pBeloBACII) cleaved with the appropriate enzyme. A map of
pBeloBACII is shown in FIG. 5.
[0322] The DNA is electroporated into DH10B cells by the method of
Sheng et al., 1995, Nucleic Acids Res. 23: 1990-1996, incorporated
herein by reference, to create a Sorangium cellulosum genomic
library. Colonies are screened using a probe from the NRPS region
of the epothilone cluster. Positive clones are picked and DNA is
isolated for restriction analysis to confirm the presence of the
complete gene cluster. This positive clone is designated
pKOS35-178.
[0323] To create a strain that can be used to introduce pKOS35-178,
a plasmid, pKOS35-164, is constructed that contains regions of
homology that are upstream and downstream of the epothilone gene
cluster flanked by the dev locus and containing the kanamycin
resistance galK cassette, analogous to plasmids pKOS90-22 and
pKOS35-154. This plasmid is linearized with DraI and electroporated
into Myxococcus xanthus, in accordance with the method of Kafeshi
et al., 1995, Mol. Microbiol. 15: 483494, to create K35-183. The
plasmid pKOS35-178 can be introduced into K35-183 by
electroporation or by transduction with bacteriophage P1, and
chloramphenicol resistant colonies are selected. Alternatively, a
version of pKOS35-178 that contains the origin of conjugative
transfer from pRP4 can be constructed for transfer of DNA from E.
coli to K35-183. This plasmid is made by first constructing a
transposon containing the oriT region from RP4 and the tetracycline
resistance maker from pACYC184 and then transposing the transposon
in vitro or in vivo onto pKOS35-178. This plasmid is transformed
into S17-1 and conjugated into M. xanthus. This strain, K35-190, is
grown in the presence of 1% galactose to select for the second
recombination event. This strain contains all the epothilone genes
as well as all potential promoters. This strain is fermented and
tested for the production of epothilones A and B.
[0324] Alternatively, the transposon can be recombined into the BAC
using either the temperature sensitive plasmid pMAK705 or pKO3 by
transposing the transposon onto either pMAK705 or pKO3, selecting
for tetr and camS plasmids; the recombination is accomplished as
described in Hamilton et al., September 1989, J. Bact. 171(9):
46174622 and Link et al., October 1997, J. Bact. 179(20):
6228-6237, each of which is incorporated herein by reference.
[0325] Besides integrating pKOS35-178 into the dev locus, it can
also be integrated into a phage attachment site using integration
functions from myxophages Mx8 or Mx9. A transposon is constructed
that contains the integration genes and att site from either Mx8 or
Mx9 along with the tetracycline gene from pACYC184. Alternative
versions of this transposon may have only the attachment site. In
this version, the integration genes are then supplied in trans by
coelectroporation of a plasmid containing the integrase gene or
having the integrase protein expressed in the electroporated strain
from any constitutive promoter, such as the mgl promoter (see
Magrini et al., July 1999, J. Bact. 181(13): 4062-4070,
incorporated herein by reference). Once the transposon is
constructed, it is transposed onto pKOS35-178 to create pKOS35-191.
This plasmid is introduced into Myxococcus xanthus as described
above. This strain contains all the epothilone genes as well as all
potential promoters. This strain is fermented and tested for the
production of epothilones A and B. Alternatively, a strain that
contains the att site and the oriT region can be transposed onto
the BAC and the resulting BAC conjugated into M. xanthus.
[0326] Once the epothilone genes have been established in a strain
of Myxococcus xanthus, manipulation of any part of the gene
cluster, such as changing promoters or swapping modules, can be
performed using the kanamycin resistance and galk cassette, as
described below. Cultures of Myxococcus xanthus containing the epo
genes are grown in a number of media and examined for production of
epothilones. If the levels of production of epothilones (in
particular B or D) are low, then the M. xanthus-producing clones
are subjected to media development and mutation based strain
improvement, as described in the following example.
EXAMPLE 3
Processes for the Production and Purification of Epothilones
A. Optimizing the Heterologous Production of Epothilone D in
Myxococcus xanthus
[0327] The heterologous production of epothilone D in Myxococcus
xanthus was improved by 140-fold from an initial titer of 0.16 mg/L
with the incorporation of an adsorber resin, the identification of
a suitable carbon source, and the implementation of a fed-batch
process.
[0328] To reduce the degradation of epothilone D in the basal
medium, XAD-16 (20 g/L) was added to stabilize the extracellular
product. This greatly facilitated its recovery and enhanced the
yield by three-fold. The use of oils as a carbon source for cell
growth and product formation was also evaluated. From a screen of
various oils, methyl oleate was shown to have the greatest impact.
At the optimal concentration of 7 mL/L in a batch process, the
maximum cell density was increased from 0.4 g dry cell weight
(DCW)/L to 2 g DCW/L. Product yield depended on the presence of
trace elements in the production medium. With an exogenous
supplement of trace metals to the basal medium, the peak epothilone
D titer was enhanced eight-fold, demonstrating the significant role
of metal ions in cell metabolism and in epothilone biosynthesis. To
increase the product yield further, a continuous fed-batch process
was employed to promote a higher cell density and to maintain an
extended production period. The optimized fed-batch cultures
consistently yielded a cell density of 7 g DCW/L and an average
production titer of 23 mg/L.
[0329] Epothilones are secondary metabolites that are naturally
produced by various strains of the myxobacterium Sorangium
cellulosum (Gerth et al., 1996; Gerth et al., 2001; references
cited in this example are listed at the end of this section and are
incorporated herein by reference). They are potent inhibitors of
microtubule depolymerization, with a mechanism of action similar to
that of the anti-cancer drug Taxol (Bollag et al., 1995). Their
cytotoxic effect against multiple-drug resistant tumor cell lines
expressing the P-glycoprotein renders them potential therapeutic
compounds with great commercial value (Su et al., 1997; Kowalski et
al., 1997). Their comparatively high solubility in water also
facilitates their formulation for clinical evaluation.
[0330] Epothilones A and B are the major fermentation products of
the natural host (Gerth et al., 1996). The macrocyclic core of
these polyketide molecules is formed by the successive
decarboxylative condensations of acetate and propionate units
(Gerth et al., 2000). Epothilones A and B differ by a single methyl
group at the C-12 position of their carbon skeleton. This
structural variance results from the incorporation of an acetate in
the assembly of epothilone A and a propionate in that of epothilone
B. Epothilones C and D are intermediates in the biosynthetic
pathway of epothilones A and B, respectively (Tang et al., 2000;
Molnar et al., 2000). They are excreted as minor products during
the fermentation process, with a combined yield of about 0.4 mg/L.
Because preliminary in vivo studies revealed epothilone D to be the
most promising of the four compounds as an anti-tumor drug (Chou et
al., 1998), it is of considerable interest to produce this molecule
on a large scale.
[0331] The gene cluster responsible for the biosynthesis of the
epothilones has been sequenced (Tang et al., 2000; Molnar et al.,
2000) and used to produce these compounds in Myxococcus xanthus, a
microbial host closely-related to S. cellulosum but more amenable
to genetic manipulation. To foster the production of epothilone D,
a deletion mutant of this recombinant strain (described in Example
4, below) was constructed to inactivate the P450 epoxidase that
catalyzes the conversion of epothilones C and D to epothilones A
and B, respectively (Tang et al., 2000). This genetic alteration
effectively promoted the secretion of epothilones C and D as sole
products of the M. xanthus fermentation, with an epothilone D to C
ratio of 4 to 1. The resulting mutant offers a distinct advantage
over the natural host in the recovery and purification of the
desired product. In this example, improvements in media composition
and fermentation strategy are described that result in a 140-fold
increase in the production of epothilone D in M. xanthus.
[0332] Adsorber resins have been used in the fermentations of
myxobacteria for the continuous capture of biologically active
molecules produced at low quantities (Reichenbach and Hofle, 1993).
To facilitate the isolation of epothilone D, the hydrophobic resin
XAD-16 was added to the culture medium. Because the bound product
can readily be eluted from the resin with an appropriate solvent,
its recovery was greatly simplified. Moreover, the use of XAD-16
minimized epothilone degradation through product stabilization.
[0333] Myxococcus xanthus has been traditionally cultivated in
media consisting primarily of enzymatic hydrolysates of casein,
such as peptone and casitone, relying on amino acids as the sole
carbon and nitrogen source (Reichenbach and Dworkin, 1991).
Consequently, ammonia is accumulated in the fermentation broth as a
result of amino acid degradation. It was demonstrated by Gerth et
al. (1986) that an extracellular ammonia concentration of 3542 mM
in a Myxococcus virescens culture corresponded to a surprisingly
high ammonia concentration of 80-140 mM within the cells. More
importantly, it was shown that by continuously removing the excess
ammonia to below 8 mM with an in situ membrane process, both cell
mass and secondary metabolite production dramatically increased
(Hecht et al., 1990). Because the generation of high levels of
ammonia is speculated to be inhibitory to the growth of M. xanthus
and epothilone D production, an alternative carbon source to reduce
the consumption of amino acids is desirable.
[0334] Although an adaptation process was required, methyl oleate
was identified from an extensive screen of different oils as a
substrate that can be metabolized by M. xanthus. With the addition
of an exogenous trace element solution to the growth medium,
epothilone D production was enhanced 8-fold, with a yield of 3.3
mg/L in a simple batch fermentation. To optimize the process
further, a fed-batch approach using intermittent or continuous
feeds of casitone and methyl oleate was adopted to prolong the
production phase of the cells. A comparison of the results obtained
with the two different feed strategies is reported in this
example.
Materials and Methods
Inoculum Preparation
[0335] For the production of epothilone D in culture media without
methyl oleate, 1 mL of frozen cells of the Myxococcus xanthus
strain K11140.1 in 20% (v/v) glycerol was inoculated into 3 mL of
CYE medium consisting of 10 g/L casitone (Difco), 5 g/L yeast
extract (Difco), 1 g/L MgSO.sub.4.7H.sub.2O, and 50 mM HEPES, pH
7.6, in a 50-mL glass culture tube. The HEPES buffer solution was
titrated to pH 7.6 with potassium hydroxide. The cells were
incubated at 30.degree. C. and 175 rpm on a rotary shaker for 3
days. They were then transferred to a 250-mL Erlenmeyer flask
containing 50 mL of CYE medium and grown for 2 days under the same
conditions. The resulting seed culture was used to inoculate 50-mL
production flasks at an inoculum size of 5% (v/v).
[0336] For the cultivation of M. xanthus in media containing methyl
oleate, the cells had to be adapted to growth in the presence of
the oil. One seed vial of frozen cells was inoculated into 3 mL of
CYE medium that was supplemented with 3 .mu.L of methyl oleate
(Emerest 2301) (Cognis Corp.). The cells were grown in a glass
culture tube for 2-6 days at 30.degree. C. and 175 rpm until the
culture was sufficiently dense under a microscope. They were then
transferred into a 250 mL Erlenmeyer flask containing 50 mL of
CYE-MOM medium consisting of 10 g/L casitone (Difco), 5 g/L yeast
extract (Difco), 1 g/L MgSO.sub.4.7H.sub.2O, 2 mL/L methyl oleate,
and 50 mM HEPES, pH 7.6. After 2 days of growth, the cells were
frozen and stored at -80.degree. C. as 1 mL aliquots in 20% (v/v)
glycerol.
[0337] For the production of epothilone D in media containing
methyl oleate, 1 mL of the frozen oil-adapted cells was inoculated
into 3 mL of CYE-MOM medium in a glass culture tube. The cells were
incubated at 30.degree. C. and 175 rpm for 2 days and transferred
to a 250 mL Erlenmeyer flask containing 50 mL of CYE-MOM medium.
The resulting seed culture was grown for 2 days under the same
conditions and was used to inoculate 50 mL production flasks at an
inoculum size of 5% (v/v).
[0338] In preparing the inoculum for 5-L fermentations, 25 mL of
the oil-adapted seed culture were transferred into a 2.8 L Fembach
flask containing 475 mL of CYE-MOM medium. The cells were grown at
30.degree. C. and 175 rpm for 2 days. Subsequently, 250 mL of this
secondary seed culture was inoculated into 5-L fermentors
containing 4.75 L of production medium to yield a final inoculum
concentration of 5% (v/v).
Shake Flask Production
[0339] Batch cultivations of M. xanthus K111-40-1 in the absence of
methyl oleate were prepared as follows. One gram of XAD-16 resin
(Rohm and Haas) was autoclaved at 121.degree. C. for 30 min in a
250-mL Erlenmeyer flask with 5 mL of deionized water. The excess
water was then removed from the flask, and 50 mL of CTS medium
consisting of 5 g/L casitone, 2 g/L MgSO.sub.4.7H.sub.2O, and 50 mM
HEPES, pH 7.6, were added. Because autoclaving of the adsorber
resin in the presence of the production medium led to the binding
of essential nutrients required by the cells, the resin and medium
components were sterilized separately. The production flasks were
inoculated with 2.5 mL of seed culture and incubated at 30.degree.
C. and 175 rpm for 6 days.
[0340] Batch cultivations in the presence of methyl oleate were
prepared as described above. In addition, the production medium was
supplemented with 7 mL/L of methyl oleate and 4 mL/L of a
filter-sterilized trace element solution that was composed of 10
mL/L concentrated H.sub.2SO.sub.4, 14.6 g/L FeCl.sub.3.6H.sub.2O,
2.0 g/L ZnCl.sub.3, 1.0 g/L MnCl.sub.2.4H.sub.2O, 0.43 g/L
CuCl.sub.2.2H.sub.2O, 0.31 g/L H.sub.3BO.sub.3, 0.24 g/L
CaCl.sub.2.6H.sub.2O, and 0.24 g/L Na.sub.2MO.sub.4.2H.sub.2O. The
production flasks were then inoculated with 2.5 mL of the
oil-adapted seed culture and grown at 30.degree. C. and 175 rpm for
5 days.
[0341] Fed-batch cultures with intermittent feeds of casitone and
methyl oleate were prepared as follows. One gram of XAD-16 resin
was autoclaved at 121.degree. C. for 30 min. in a 250 mL Erlenmeyer
flask with 5 mL of deionized water. After sterilization, the excess
water was removed from the flask, and 50 mL of CTS medium
supplemented with 2 mL/L methyl oleate, 4 mL/L trace element
solution, and 50 mM HEPES, pH 7.6, were added. The production
flasks were inoculated with 2.5 mL of the oil-adapted seed culture
and incubated at 30.degree. C. and 175 rpm. Two days after
inoculation, 2 g/L of casitone and 3 mL/L of methyl oleate were
added to the culture medium at 24 h intervals. The casitone feed
was prepared as a concentrated 100 g/L solution. The cultures were
grown for 10-12 days until substantial cell lysis was observed.
[0342] All the production cultures can be grown on a 500-mL scale
in 2.8-L Fembach flasks under the same growth conditions.
Fementor Production
[0343] Fed-batch fermentations on a 5-L scale with intermittent or
continuous feeds of casitone and methyl oleate were prepared as
follows. Twenty grams per liter of XAD-16 and 2 g/L of
MgSO.sub.4.7H.sub.2O was autoclaved at 121.degree. C. for 30 min in
a 5-L fermentor (B. Braun) with 4.75 L of deionized water. After
sterilization, a concentrated casitone solution (150 g/L), methyl
oleate, and trace elements were added to the bioreactor aseptically
to attain a final casitone, methyl oleate, and trace element
concentration of 5 g/L, 2 mL/L, and 4 mL/L, respectively. The
medium was then inoculated with 250 mL of the oil-adapted seed
culture. The fermentation was performed at 30.degree. C. with an
aeration rate of 0.4-0.5 v/v/m and an initial agitation rate of 400
rpm. The dissolved oxygen was controlled at 50% of saturation by a
stirring cascade between 400-700 rpm. Cultivation pH was maintained
at 7.4 by the automated addition of 2.5 N KOH and 2.5 M
H.sub.2SO.sub.4. Twenty-four hours after inoculation, casitone (150
g/L) and methyl oleate were added to the production medium at a
feed rate of 2 g/L/day casitone and 3 mL/L/day methyl oleate. The
feeds were delivered either as a single bolus every 24 h or
continuously with peristaltic pumps (W. Marlow). The cells were
allowed to grow for 10-12 days until considerable cell lysis was
noted.
Epothilone Quantitation
[0344] Prior to the use of the XAD-16 resin in the fermentations, 1
mL of culture broth was sampled from the production flasks or
bioreactors and centrifuged at 13,000 g for 10 min. Quantitation of
the epothilone products in the supernatant was carried out using a
Hewlett Packard 1090 HPLC with UV detection at 250 nm. Five hundred
microliters of the supernatant were injected across a 4.6.times.10
mrn guard column (Inertsil, ODS-3, 5 .mu.m). An online extraction
was then performed at a flow rate of 1 mL/min. with a 100% water
wash for 0.5 min., followed by a gradient to 50% acetonitrile over
1.5 min. The eluant was diverted to waste for the first two minutes
and was passed onto a longer separation column (4.6.times.150 mm,
Inertsil, ODS-3, 5 .mu.m) thereafter. Separation of epothilones C
and D was performed with a gradient from 50% to 100% acetonitrile
over 8 min, followed by a 100% acetonitrile wash for 3 min. Under
these conditions, epothilone C eluted at 9.4 minutes and epothilone
D eluted at 9.8 minutes.
[0345] With the use of the XAD-16 resin, 5-50 mL of well-mixed
culture broth and resin were sampled from the production flasks or
bioreactors. After the resin was settled by gravity, the culture
broth was decanted. The resin was washed with 5-50 mL of water and
allowed to settle by gravity again. The aqueous mixture was
completely removed, and the epothilone products were extracted from
the resin with 100% methanol. The amount of solvent used was
equivalent to 50% of the sample volume. Quantitation of epothilones
C and D was carried out by HPLC analysis with UV detection at 250
nm. Fifty microliters of the methanol extract were injected across
two 4.6.times.10 mm guard columns (Inertsil, ODS-3, 5 .mu.m) and a
longer 4.6.times.150 mm column (Inertsil, ODS-3, 5 .mu.m). The
assay method was isocratic, eluting with 60% acetonitrile and 40%
water for 18 min at a flow rate of 1 mL/min. Under these
conditions, epothilone C was detected at 10.3 minutes and
epothilone D was detected at 13.0 minutes. Standards were prepared
using purified epothilone D.
Cell Growth Determination
[0346] Cell growth in the absence of methyl oleate was monitored by
measuring the optical density (OD) at 600 nm. Samples were diluted
with water until the final OD values were less than 0.4. Because
the addition of methyl oleate to culture medium results in the
formation of an emulsion that has a strong absorbance at 600 nm,
cell growth in the presence of methyl oleate was determined by dry
cell weight (DCW). Forty milliliters of culture broth were
centrifuged at 4200 g for 20 min in preweighed test tubes. The
pellets were then washed with 40 mL of water and dried for 2 days
at 80.degree. C. before weighing.
Ammonia Determination
[0347] One milliliter of fermentation broth was clarified by
centrifugation at 13,000 g for 5 min. The supernatant was then used
for ammonia analysis with an ammonia assay kit (Sigma). Samples
were diluted 20-100 fold with water until the final concentrations
were less than 880 .mu.M.
Methyl Oleate Determination
[0348] The residual methyl oleate in 1-mL of fermentation broth was
extracted with 5 mL of acetonitrile. The mixture was vortexed and
clarified by centrifugation at 4200 g for 20 min. Quantitation of
methyl oleate was carried out by HPLC analysis with UV detection at
210 nm. Fifty microliters of the supernatant were injected across
two 4.6.times.10 mm guard columns (Inertsil, ODS-3, 5 .mu.m) and a
longer 4.6.times.150 mm column (Inertsil, ODS-3, 5 .mu.m). The
column was washed with acetonitrile-water (1:1) for 2 min. at a
flow rate of 1 mL/min. It was then eluted with a gradient of 50% to
100% acetonitrile over 24 min., followed by a 100% acetonitrile
wash for 5 min. Because of the heterogeneity of the carbon chain
lengths of commercial methyl oleate, this compound was eluted as
two main peaks that were detected at 25.3 minutes and 27.1 minutes.
Methyl oleate bound to the XAD-16 resin was quantitated from the
methanol extract using the same HPLC method. Standards of methyl
oleate were prepared in 83.3% acetonitrile. Consumption of methyl
oleate by the cells was calculated as: (total methyl oleate
added)-(residual methyl oleate in medium)-(methyl oleate bound to
resin).
Results
[0349] The Myxococcus xanthus strain K111-40-1 was initially
cultivated in a batch fermentation process with a simple production
medium consisting only of 5 g/L casitone (a pancreatic casein
digest) and 2 g/L magnesium sulfate. The baseline performance of
the cells is shown in FIG. 6.
[0350] Maximum cell density and epothilone D production were
attained three days after inoculation at an OD.sub.600 of 1.6 and a
corresponding titer of 0.16 mg/L. Both cell density and product
yield decreased substantially thereafter. With the consumption of
casitone by the cells, a gradual accumulation of ammonium was also
detected in the production medium. The final ammonia concentration
approached 20 mM at the end of the 5-day fermentation.
Effect of XAD-16 on Product Stability
[0351] To prevent the rapid degradation of epothilone D, the
hydrophobic adsorber resin, XAD-16, was added to the production
medium to bind and stabilize the excreted product. XAD-16 is a
polyaromatic resin that had previously been used by Gerth et al.
(1996) for the isolation of epothilones A and B from fermentations
of the microbial producer, Sorangium cellulosum So ce90. As shown
in FIG. 7, the presence of the adsorber resin did not affect the
growth of the cells. However, it effectively reduced the loss of
epothilone D in the fermentation broth, which led to a three-fold
enhancement in the recovery of this product.
Media Development
[0352] In an effort to develop a medium that can support higher
cell density and epothilone production, the influence of casitone
on growth and product yield was evaluated by varying its
concentration from 1 g/L to 40 g/L in the production medium.
Although cell growth was stimulated with increasing casitone
concentrations, the specific productivity of the cells declined
significantly, as shown in FIG. 8. The optimal casitone
concentration for epothilone D production was reached at 5 g/L,
with higher concentrations resulting in decreased titers.
[0353] Because media improvements were limited with the use of
casitone, alternative substrates were evaluated as supplements to
the basal production medium. From a detailed screen of different
oils, methyl oleate was identified as a carbon source that promoted
the greatest increase in epothilone D production, as summarized in
Table 3. TABLE-US-00005 TABLE 3 Epothilone D production relative to
Oil (7 mL/L) control with no oil supplements (%) Methyl Oleate 780
Ethyl Oleate 740 Coconut Oil 610 Lard 470 Propyl Oleate 420 Sesame
Oil 380 Glycerol Tri-oleate 370 Salad Oil 360 Sunflower Oil 330 Soy
Oil 290 Methyl Heptadecanoate 190 No Oil (Control) 100 Methyl
Nonadecanoate 96 Methyl Pelargoante 40 Rapeseed Oil 40
[0354] However, the direct addition of methyl oleate to the
production medium resulted in premature cell lysis. Therefore, the
seed cultures were grown in the presence of methyl oleate prior to
the production fermentations. Interestingly, this adaptation
process rendered the cells less susceptible to lysis. As shown in
Table 4 (Improvements in Growth and Production Compared to Baseline
Performance in CTS Medium in Batch Fermentation), a peak biomass
concentration of 2.1 g/L and an epothilone D titer of 3.3 mg/L were
achieved with a methyl oleate concentration of 7 mL/L and a trace
elements concentration of 4 mL/L. TABLE-US-00006 TABLE 4 Maximum
Cell Maximum Density Epothilone D Fermentation Conditions (g DCW/L)
Production (mg/L) CTS medium with no XAD-16 in 0.44 .+-. 0.04 0.16
.+-. 0.03 batch process CTS medium with XAD-16 in 0.44 .+-. 0.04
0.45 .+-. 0.09 batch process CTS medium with 7 mL/L methyl 1.2 .+-.
0.1 0.12 .+-. 0.02 oleate in batch process CTS medium with 7 mL/L
methyl 2.1 .+-. 0.2 3.3 .+-. 0.7 oleate and 4 mL/L trace elements
in batch process Intermittent fed-batch process 6.3 .+-. 0.6 9.8
.+-. 2.0 Continuous fed-batch process 7.3 .+-. 0.7 23 .+-. 4.6
[0355] Further titer improvements were not observed at higher
methyl oleate concentrations, as shown in FIG. 9.
[0356] In addition to demonstrating the significance of methyl
oleate on cell growth and production, the above graph also
emphasizes the importance of trace elements in the production
medium. In anticipation that the nutrients supplied by casitone may
not be sufficient for vigorous cell growth, an exogenous addition
of trace metals was added in conjunction with the methyl oleate.
Surprisingly, this supplement was found to be essential for both
growth and production enhancement. In its absence, the maximum
biomass concentration and epothilone D titer were only 1.2 g/L and
0.12 mg/L, respectively. This low titer was comparable to that
obtained with the basal medium.
Fed-Batch Development
[0357] In the presence of optimal concentrations of methyl oleate
and trace elements in a batch fermentation process, exponential
growth of the M. xanthus strain occurred during the first two days
after inoculation. Production of epothilone D began at the onset of
the stationary phase and ceased when cell lysis occurred with the
depletion of methyl oleate on day 5, as shown in FIGS. 10A and 10B.
The time courses for methyl oleate consumption and ammonia
generation are also shown. The concentration of ammonia in the
production medium was <4 mM throughout the course of the
fermentation.
[0358] To extend the production period of the cells in the flask
cultures, casitone and methyl oleate were added to the medium once
a day at a rate of 2 g/L/day and 3 mL/L/day, respectively. The
substrate feeds were initiated 48 h after inoculation, and the
cells grew exponentially for three days thereafter. As shown in
FIG. 11A, the biomass concentration began to plateau on day 5 and
reached a maximum at 6.3 g/L on day 10. Again, epothilone D
production coincided with the stationary growth phase, and a final
yield of 9.8 mg/L was attained at the end of day 12. As shown in
the FIG. 11B, both the consumption of methyl oleate and the
generation of ammonia increased at constant rates over the course
of the fermentation.
[0359] Methyl oleate was depleted at the same rate it was fed to
the bioreactor, and ammonia accumulated at a rate of 3.2 mM/day.
Lower feed rates of casitone or methyl oleate greatly reduced the
epothilone D titer, while higher feed rates led to the premature
lysis of the cells before significant production was achieved.
[0360] To test the effectiveness of the fed-batch process on a
larger scale, casitone and methyl oleate were added intermittently
at 24-h intervals to a 5-L fermentation in a bioreactor. As shown
in FIG. 12, the resulting production curve closely resembled that
for the flask cultures. The substrate feeds were initiated 24 h
after inoculation, and the production of epothilone began on day 4.
A peak epothilone D titer of 9.2 mg/L was obtained ten days after
inoculation.
[0361] To assess the impact of a more refined feeding strategy on
growth and production, the dual feeds were delivered continuously
to the bioreactor. As illustrated in FIG. 13A, the implementation
of the continuous feeds did not affect the growth of the cells, but
it increased their productivity by nearly three-fold. A final
epothilone D titer of 27 mg/L was achieved 10 days after
inoculation. As shown in FIG. 13B, methyl oleate was consumed at
the same rate it was added to the production medium, and ammonia
was released at a steady rate of 6.4 mM/day over the course of the
fermentation.
Discussion
[0362] Although the chemical synthesis of epothilone D has recently
been achieved (Harris et al., 1999; Meng et al., 1998; Sinha et
al., 1998), the complex 20-step process is not an economically
viable method for the large-scale production of the compound. While
the initial production yield for epothilone D in Myxococcus xanthus
strain was 0.16 mg/L, the improved fermentation processes of the
invention substantially increased the production level to 23
mg/L.
[0363] One of the major barriers to attaining a higher epothilone D
titer was rapid degradation of the product in the fermentation
broth. This problem was alleviated with the incorporation of an
adsorber resin to the culture medium. The addition of XAD-16 did
not affect the growth of the cells but minimized the loss of the
excreted product and increased its recovery by three-fold.
[0364] Another obstacle to enhancing the production yield is the
limited improvement in titer with the use of casitone as the
primary carbon and nitrogen source. Although growth of the M.
xanthus strain was stimulated with increasing casitone
concentrations, a concentration that exceeded 5 g/L resulted in a
dramatic decrease in titer. This inhibitory effect in secondary
metabolite production at high concentrations of peptone or casitone
has previously been demonstrated in several other myxobacterial
fermentations and has been attributed to the accumulation of
ammonia in the culture medium.
[0365] Because M. xanthus is incapable of metabolizing
polysaccharides and sugars (Reichenbach and Dworkin, 1991), its
ability to utilize oils as a carbon source was examined. Oils are
attractive carbon substrates, because the oxidation of fatty acids
not only can serve as a source of energy for the cells, but the
formation of acetyl-CoA as a degradation product can also provide
precursors for epothilone biosynthesis. The addition of oils to the
fermentation of Saccharopolyspora erythraea, Streptomyces fradiae,
and Streptomyces hygroscopicus has been shown to enhance the
production of polyketide molecules, such as erythromycin, tylosin,
and the immunoregulant L-683590, respectively (Mirjalili et al.,
1999; Choi et al., 1998; Junker et al., 1998).
[0366] From a screen of different oils, methyl oleate was
identified as the leading candidate in promoting cell growth and
epothilone D production. These improvements, however, were observed
only with the simultaneous addition of trace metals to the
production medium. The sole addition of methyl oleate at 7 mL/L
increased the maximum cell density from 0.4 g DCW/L to 1.2 g DCW/L,
but the production remained at the baseline level. With the
exogenous supplement of 4 mL/L of trace elements, the peak biomass
concentration increased to 2.1 g DCW/L, and the epothilone D titer
was boosted from 0.45 mg/L to 3.3 mg/L. These findings indicate
that nutritional components deficient in casitone may be important
for the growth of M. xanthus and the formation of epothilones.
[0367] With the establishment of optimal concentrations of methyl
oleate and trace elements for a batch process, efforts were made to
develop a feeding strategy to maintain vigorous cell growth and to
prolong the production period. Intermittent and continuous feeds of
casitone and methyl oleate at constant rates were evaluated, and
both methods resulted in similar improvements in the growth
profiles. With optimal feeds of the two substrates, maximum cell
densities of about 6.8 g DCW/L were obtained. In both cases, methyl
oleate was depleted as it was added to the fermentation medium.
[0368] In contrast to cell growth and methyl oleate consumption,
epothilone production and ammonia generation were greatly
influenced by the choice of the feeding strategy. In the continuous
fed-batch culture, a peak epothilone D titer of 23 mg/L was
obtained. This was nearly 2.5 times the titer obtained for the
intermittent fed-batch culture. With the continuous feeds, the rate
at which ammonia was released by the cells was also twice as high,
suggesting a higher rate of casitone consumption. Together, these
results indicate that the lower titers associated with the
intermittent fed-batch process may have been caused by catabolite
repression and not ammonia accumulation. Moreover, they suggest
that the productivity of the M. xanthus strain is sensitive to the
amount of substrates present in the culture medium and may be
maximal under substrate-limiting conditions. This is also
consistent with the observation that increasing casitone
concentration in the production medium results in higher cell
densities but lower titers.
[0369] Compared to the batch cultures with the basal medium, the
continuous fed-batch cultures yielded a 17-fold increase in cell
density and a 140-fold increase in titer. This process has been
scaled from 5-L to 1000-L and shown to perform equivalently. The
results shown for producing epothilone D on a manufacturing scale
demonstrate that M. xanthus can be used as a host for the
production of other biologically active molecules from
myxobacteria.
REFERENCES
[0370] Bollag et al. 1995. Epothilones, a new class of
microtubule-stabilizing agents with a taxol-like mechanism of
action. Cancer Res 55:2325-2333. [0371] Choi et al. 1998. Effects
of rapeseed oil on activity of methylmalonyl-CoA
carboxyltransferase in culture of Streptomyces fradiae. Biosci
Biotechnol Biochem 62:902-906. [0372] Chou et al. 1998.
Desoxyepothilone B: An efficacious microtubule-targeted antitumor
agent with a promising in vivo profile relative to epothilone B.
Proc Natl Acad Sci USA 95:9642-9647. [0373] Gerth et al. 1996.
Epothilons A and B: Antifungal and cytotoxic compounds from
Sorangium cellulosum (myxobacteria)-production, physico-chemical,
and biological properties. J Antibiot (Tokyo) 49:560-563. [0374]
Gerth et al. 2000. Studies on the biosynthesis of epothilones: the
biosynthetic origin of the carbon skeleton. J Antibiot (Tokyo)
53:1373-1377. [0375] Gerth et al. 2001. Studies on the biosynthesis
of epothilones: The PKS and epothilone C/D monooxygenase. J
Antibiot (Tokyo) 54:144-148. [0376] Harris et al. 1999. New
chemical synthesis of the promising cancer chemotherapeutic agent
12,13-desoxyepothilone B: Discovery of a surprising long-range
effect on the diastereoselectivity of an aldol condensation. J Am
Chem Soc 12:7050-7062. [0377] Hecht et al. 1990. Hollow fiber
supported gas membrane for in situ removal of ammonium during an
antibiotic fermentation. Biotechnol Bioeng 35:1042-1050. [0378]
Junker et al. 1998. Use of soybean oil and ammonium sulfate
additions to optimize secondary metabolite production. Biotechnol
Bioeng 60:580-588. [0379] Kowalski et al. 1997. Activities of the
microtubule-stabilizing agents epothilones A and B with purified
tubulin and in cells resistant to paclitaxel. J Biol Chem
272:253441. [0380] Meng et al. 1997. Remote effects in macrolide
formation through ring-forming olefin metathesis: An application to
the synthesis of fully active epothilone congeners. J Am Chem Soc
119:2733-2734. [0381] Mirjalili et al. 1999. The effect of rapeseed
oil uptake on the production of erythromycin and triketide lactone
by Saccharopolyspora erythraea. Biotechnol Prog 15:911-918. [0382]
Molnar et al. 2000. The biosynthetic gene cluster for the
microtubule-stabilizing agents epothilones A and B from Sorangium
cellulosum So ce90. Chem Biol 7:97-109. [0383] Reichenbach et al.
The Prokaryotes II Eds. New York: Springer-Verlag. p 3417-3487.
[0384] Reichenbach et al. 1993. Production of Bioactive Secondary
Metabolites. In: Dworkin M, Kaiser D, editor. Myxobacteria II.
Washington, D.C.: American Society for Microbiology. p 347-397.
[0385] Sinha et al. 1998. The antibody catalysis route to the total
synthesis of epothilones. Proc Natl Acad Sci USA 95:14603-14608.
[0386] Su et al. 1997. Structure-activity relationships of the
epothilones and the first in vivo comparison with paclitaxel. Angew
Chem Int Ed Engl 36:2093-2096. [0387] Tang et al. 2000. Cloning and
heterologous expression of the epothilone gene cluster. Science
287:640-642. B. Production of Epothilone B Flasks
[0388] A 1 mL vial of the K111-32-25 strain is thawed and the
contents transferred into 3 mL of CYE seed media in a glass tube.
This culture is incubated for 72.+-.12 hours at 30.degree. C.,
followed by the subculturing of 3 mL of this tube culture into 50
mL of CYE media within a 250 mL baffled Erlenmeyer flask. This CYE
flask is incubated for 24.+-.8 hours at 30.degree. C., and 2.5 mL
of this seed (5% v/v) used to inoculate the epothilone production
flasks (50 mL of CTS-TA media in a 250 mL baffled Erlenmeyer
flask). These flasks are then incubated at 30.degree. C. for
48.+-.12 hours, with a media pH at the beginning of 7.4.
Fermentors
[0389] A similar inoculum expansion of K111-32-25 as described
above is used, with the additional step that 25 mL of the 50 mL CYE
seed is subcultured into 500 mL of CYE. This secondary seed is used
to inoculate a 10 L fermentor containing 9.5 L of CTS-TA, and 1 g/L
of sodium pyruvate. The process parameter setpoints for this
fermentation are: pH--7.4; agitation--400 rpm; sparge rate--0.15
vvm. These parameters were sufficient to maintain the DO at greater
than 80% of saturation. The pH control is provided by addition of
2.5 N sulfuric acid and sodium hydroxide to the cultures. Peak
epothilone titers are achieved at 48.+-.8 hours.
C. Production of Epothilone D
Flasks
[0390] A 1 mL vial of the K111-40-1 strain (described in Example 4)
is thawed and the contents transferred into 3 mL of CYE seed media
in a glass tube. This culture is incubated for 72.+-.12 hours at
30.degree. C., followed by the subculturing of 3 mL of this tube
culture into 50 mL of CYE media within a 250 mL baffled Erlenmeyer
flask. This CYE flask is incubated for 24.+-.8 hours at 30.degree.
C., and 2.5 mL of this seed (5% v/v) used to inoculate the
epothilone production flasks (50 mL of 1.times. wheat gluten media
in a 250 mL baffled Erlenmeyer flask). These flasks are then
incubated at 30.degree. C. for 48.+-.12 hours, with a media pH at
the beginning of 7.4.
Fermentors
[0391] A similar inoculum expansion of K111-40-1 as described above
is used, with the additional step that 25 mL of the 50 mL CYE seed
is subcultured into 500 mL of CYE. 250 mL of this secondary seed is
used to inoculate a 5 L fermentor containing 4.5 L of CTS-TA, with
a 1 g/L daily feed of sodium pyruvate. The process parameter
setpoints for this fermentation are: pH--7.4; agitation--400 rpm;
sparge rate--0.15 vvm. These parameters were sufficient to maintain
the DO at greater than 80% of saturation. The pH control is
provided by addition of 2.5 N sulfuric acid and sodium hydroxide to
the cultures. Peak epothilone titers are achieved at 36.+-.8 hours.
The peak epothilone C titer is 0.5 mg/L, and the peak epothilone D
titer is 1.6 mg/L.
[0392] Table 5 is a summary of the media that were used and their
respective components. TABLE-US-00007 TABLE 5 Component
Concentration CYE Seed Media Casitone (Difco) 10 g/L Yeast Extract
(Difco) 5 g/L MgSO.sub.4.7H.sub.20 (EM Science) 1 g/L HEPES buffer
50 mM CTS-TA Production Casitone (Difco) 5 g/L Media
MgSO.sub.4.7H.sub.20 (EM Science) 2 g/L L-alanine, L-serine,
glycine 1 mg/L HEPES buffer 50 mM 1x Wheat Gluten Wheat Gluten
(Sigma) 5 g/L Production Media MgSO.sub.4.7H.sub.20 (EM Science) 2
g/L HEPES buffer 50 mM
The CYE seed media and the CTS-TA production media are sterizlied
by autoSterilized autoclaving for 30 minutes at 121.degree. C. The
wheat gluten production media is sterilized by autoclaving for 45
minutes at at 121.degree. C. D. Production of Epothilone C and D
from Myxococcus xanthus
[0393] In one aspect, the present invention provides an improved
fermentation process for Myxococcus strains, including but not
limited to M. xanthus K111-40-1, in which the fermentation media
provides carbon sources that can be utilized without generation of
ammonia. In one preferred embodiment, the carbon source is an oil,
such as methyl oleate or a similar oil. In shake flask tests with a
variety of feed ratios, these methods resulted in the production of
epothilones C and D, predominantly epothilone D, at levels ranging
from 15 to 25 mg/L, as described below.
Seed Culture
[0394] A frozen 1 mL vial of M. xanthus K111-40-1 cells that had
been grown in 50 mL of CYE medium with 2 mL/L methyl oleate was
used to inoculate 3 mL of fresh CYE medium with 1 mL/L methyl
oleate in a sterile glass tube. The tube was incubated at
30.degree. C. in a 250 RPM shaker for 24 hrs. The inoculum in the
glass tube was then transferred into a 250 mL unbaffled flask that
contained 50 mL of fresh CYE medium with 2 mL/L methyl oleate. The
flask was incubated at 30.degree. C. in a 250 RPM shaker for 48
hrs.
Production Flask
[0395] 1 g of Amberlite XAD-16 was sterilized in a 250-mL unbaffled
flask by autoclaving at 121.degree. C. for 30 min. 50 mL of sterile
production media were then added to the flask. The flask was
inoculated with 5% (v/v) of the seed culture and was placed in an
incubator shaker operating at 250 RPM and 30.degree. C. A 3
mL/L/day feed of sterile methyl oleate was initiated two days after
the time of inoculation, and a 2 g/L/day feed of casitone was
initiated one day after the time of inoculation.
Product Extraction
[0396] After 14 days, the XAD resin in the production flask was
transferred into a 50 mL centrifuge tube. Excess medium in the tube
was decanted without removing any of the resin. The XAD resin was
then washed with 25 mL of water and allowed to settle. The water in
the tube was decanted without removing any of the resin, and 20 mL
of methanol were added to the tube. The centrifuge tube was placed
on a shaker at 175 RPM for 20-30 min. to extract the epothilone
products from the resin. The methanol extract was transferred to a
new centrifuge tube for storage and LC/MS analysis.
[0397] Table 6 is a summary of the media that were used and their
respective components. TABLE-US-00008 TABLE 6 Component
Concentration CYE Media Casitone (Difco) 10 g/L Yeast Extract
(Difco) 5 g/L MgSO.sub.4.7H.sub.20 (EM 1 g/L Science) Production
Media Casitone (Difco) .5 g/L MgSO.sub.4.7H.sub.20 (EM 2 g/L
Science) Added to Production 1000x Trace Element 4 mL/L Media after
autoclaving Solution Methyl Oleate 2 mL/L
The CYE media and the production media are sterizlied by
autoSterilized autoclaving for 30 minutes at 121.degree. C. The
trace element solution is filter-sterilized; the methyl oleate is
autoclaved separately.
[0398] Trace element solution is made by combining all of the
components in Table 7, adding 10 mL/L concentrated H.sub.2SO.sub.4
to the solution and brining the final volume to 1 L. TABLE-US-00009
TABLE 7 1000x Trace Element Solution Component Concentration
FeCl.sub.3 8.6 g/L ZnCl.sub.2 2.0 g/L MnCl.sub.2.4H.sub.2O 1.0 g/L
CuCl.sub.2.2H.sub.2O 0.43 g/L H.sub.3BO.sub.3 0.31 g/L
CaCl.sub.2.6H.sub.2O 0.24 g/L Na.sub.2MoO.sub.4.2H.sub.2O 0.24
g/L
The resulting solution is filtered sterilized. E. Fermentation,
Production, and Purification of Epothilones from Myxococcus xanthus
Description of M. xanthus Strains
[0399] Strain K111-25-1 is the epothilone B producing strain, which
also produces epothilone A. Strain K111-40-1 is the epothilone D
producing strain, which also produces epothilone C.
Maintainance of M. xanthus on Plates
[0400] The M. xanthus strains are maintained on CYE agar plates
(see Table 8 for plate composition). Colonies appear approximately
3 days after streaking out on the plates. Plates are incubated at
32.degree. C. for the desired level of growth and then stored at
room temperature for up to 3 weeks (storage at 4.degree. C. on
plates can kill the cells). TABLE-US-00010 TABLE 8 CYE Agar Plates*
Component Concentration Hydrolyzed casein 10 g/L (pancreatic
digest) Yeast extract 5 g/L Agar 15 g/L MgSO.sub.4 1 g/L 1 M MOPS
buffer solution 10 mL/L (pH 7.6) *1 L agar media batches are
autoclaved for 45 minutes, then poured out into petri dishes.
Oil Adaptation of M. xanthus for Cell Banking
[0401] Transfer a non-oil adapted colony from a CYE plate or a
frozen vial of cells into a 50 mL glass culture tube containing 3
mL of CYE seed media and 1 drop of methyl oleate from a 100 .mu.L
pipet. Allow cells to grow for 2-6 days (30.degree. C., 175 rpm)
until the culture appears dense under a microscope. Start several
(5-7) tubes in parallel, as these cells do not always adapt well to
the oil.
Cell Banking Procedure (Master Cell Bank)
[0402] Start an oil-adapted tube culture as described above. When
the tube culture is sufficiently dense (OD=5+/-1), transfer the
entire contents of the tube into a sterile 250 mL shake flask
containing 50 mL of CYE-MOM seed media (see table below for media
composition). After 48.+-.12 hours of growth in a shaker incubator
(30.degree. C., 175 rpm), transfer 5 mL of this seed culture into
100 mL of CYE-MOM in a 500 mL shake flask. Allow this culture to
grow for 1 day in a shaker incubator (30.degree. C., 175 rpm).
Check culture microscopically for appropriate growth and lack of
contamination.
[0403] Combine 80 mL of this seed culture and 24 mL of sterile 90%
glycerol in a sterile 250 mL shake flask. Swirl to thoroughly mix,
and aliquot 1 mL of this mixture into 100 sterile, prelabeled
cryovials. Slow freeze vials by placing them in a -80.degree. C.
freezer.
Cell Banking Procedure (Working Cell Bank)
[0404] Start a tube culture by thawing one of the master cell bank
vials produced as described above at room temperature, then
depositing its entire contents into a glass tube containing 3 mL of
CYE-MOM seed media. When this tube culture is sufficiently dense
(OD=5+/-1), transfer the entire contents of the tube into a sterile
250 mL shake flask containing 50 mL of CYE-MOM seed media. After
48.+-.12 hours of growth (at 30.degree. C., 175 rpm), transfer 5 mL
of this seed culture into 100 mL of CYE-MOM in a 500 mL shake
flask. Allow this to grow for 1 day (30.degree. C., 175 rpm). Check
microscopically for growth and contamination.
[0405] Combine 80 mL of this seed culture and 24 mL of sterile 90%
glycerol in a sterile 250 mL shake flask. Swirl to thoroughly mix,
and aliquot 1 mL of this mixture into 100 sterile, prelabeled
cryovials. Slow freeze vials by placing them in a -80.degree. C.
freezer.
Composition of Seed Media
[0406] The same seed media as described by Table 9 is used for cell
banking and the expansion of the cell bank vials up to any required
volume. TABLE-US-00011 TABLE 9 CYE-MOM Seed Medium* Component
Concentration Hydrolyzed casein (pancreatic 10 g/L digest) - Difco
Yeast extract - Difco 5 g/L MgSO.sub.4.7H.sub.2O - EM Science 1 g/L
Methyl Oleate - Cognis 2 mL/L *Note: the methyl oleate is added
after the other ingredients, as it forms an emulsion in the
casitone and does not completely mix with the other components.
Inocula Scaleup for Shake Flask, 5 L, and 1000 L Fermentations
[0407] Thaw a frozen working cell bank vial of the methyl oleate
adapted cells. Transfer the entire contents of the vial into a 50
mL glass culture tube, containing 3 mL of the CYE-MOM seed media.
Place tube in a shaker (30.degree. C., 175 rpm), and grow for
48.+-.24 hours. Transfer the entire contents of the culture tube
into a 250 mL shake flask containing 50 mL of CYE-MOM seed media.
Place flask in a shaker (30.degree. C., 175 rpm) and grow for
48.+-.24 hours. For use in shake flask experiments, expand this
seed by subculturing 10 mL of this culture into 40 mL of fresh
CYE-MOM in 5 new seed flasks. Incubate seed flasks in shaker
(30.degree. C., 175 rpm) for 24.+-.12 hours for use as an inoculum
for flask volume (30-100 mL) production cultures. Inoculate
production flasks at 4.5% of the combined (seed and production
media) initial volume.
[0408] To prepare seeds for small scale (5-10 L) fermentations,
subculture the entire contents of one of these 50 mL seed flasks
into a sterile 2.8 L fernbach flask containing 500 mL of CYE-MOM.
Incubate this fernbach flask in a shaker (30.degree. C., 175 rpm)
for 48.+-.24 hours for use as the fermentor inoculum. Inoculate the
production fermentation at about 5% of the combined initial
volume.
[0409] Further seed expansion is required for large scale (1000 L)
fermentations. Here, 1 L of the fernbach flask seed is used to
inoculate (5% by volume) a 10 L seed fermentor containing 9 L of
CYE-MOM. The fermentor pH is controlled at 7.4 by addition of 2.5 N
potassium hydroxide and 2.5 N sulfuric acid. The temperature is set
at 30.degree. C. The dissolved oxygen is maintained at or above 50%
of saturation by cascading of the stir rate between 400-700 rpm.
The initial agitation rate is set at 400 rpm, and the sparging rate
was maintained at 0.1 v/v/m. After 24.+-.12 hours of growth in the
10 L fermentor, the entire culture is transferred into a 150 L
fermentor containing 90 L CYE-MOM. The pH is once again controlled
at 7.4 with 2.5 N potassium hydroxide and 2.5 N sulfuric acid. The
temperature is set at 30.degree. C. The dissolved oxygen is
maintained at or above 50% of saturation by cascading of the stir
rate between 400-700 rpm. The initial agitation rate is set at 400
rpm, and the sparging rate is maintained at 0.1 v/v/m.
XAD-16 Resin Preparation for Fermentations
[0410] Transfer the required amount of XAD-16 resin (Rohm &
Haas) into a methanol safe container with a minimum volume of 3
times the weight of XAD-16 resin (i.e., 1.2 kg of resin requires a
container of at least 3.6 L). Wash the resin thoroughly with 100%
methanol to remove any monomers present on the virgin resin. Add
two times the amount of methanol in liters as the weight of the
resin in kilograms (i.e. 6 liters of methanol for 3 kilograms of
XAD-16). Mix the methanol and XAD slurry for 5 minutes to remove
any monomers present on the XAD-16. Stir the slurry gently while
mixing to minimize resin fragmentation. Stop mixing, and allow the
resin to gravity settle for not less than 15 minutes. Drain the
methanol from the container, leaving a 0.5 to 1 inch layer of
methanol above the XAD bed. Transfer the XAD and methanol from the
mixing container to an Amicon VA250 column. Attach the top bed
support to the column and seal the bed support by turning the seal
adjust knob clockwise. Wash the XAD in the column with not less
than 5 column volumes of methanol at 300.+-.50 cm/hr. Collect
methanol flow through in the solvent waste receptacle. Wash the XAD
in the column with not less than 10 column volumes of deionized
water at 300.+-.50 cm/hr.
[0411] The composition of the epothilone production media is
described in Table 10. TABLE-US-00012 TABLE 10 CTS-MOM Production
Media Component Concentration Casitone (Difco) 5 g/L
MgSO.sub.4.7H.sub.20 (EM 2 g/L Science) XAD-16 20 g/L Added after
autoclaving 1000x Trace Element 4 mL/L Solution Methyl Oleate 2
mL/L *Note: the methyl oleate is added after the other ingredients,
as it forms an emulsion in the casitone and does not completely mix
with the other components. Trace Element Solution is as described
in Table 7.
Preparation and Flask-Scale (50 mL) Epothilone Production
Fermentation
[0412] Autoclave 1 g of XAD-16 in a 250 mL shake flask with
sufficient deionized water (.about.3 mL) to cover the resin. Flasks
are sterilized by autoclaving for 30 minutes at 121.degree. C. Add
the following media components to the flask aseptically: 50 mL of
CTS-MOM production medium, and 2.5 mL of 1 M HEPES buffer (titrated
to a pH of 7.6 with potassium hydroxide). Inoculate the cultures
with 2.5 mL of the CYE seed flask (4.5% volume/volume inoculum).
Incubate the production flasks on a shaker at 30.degree. C. and 175
rpm.
[0413] Start the casitone and methyl oleate feeds 24.+-.6 hours
after inoculation. At this point, and every 24.+-.6 hours
thereafter, feed 1 mL of a 100 g/L casitone solution and 150 .mu.L
of methyl oleate. Continue this feeding regimen for up to 13 days
following the initial feed, or until cells are observed to begin
lysis (day 11-14). To determine epothilone production kinetics, a
representative 5 mL sample of well-mixed fermentation broth and XAD
can be sampled. Additionally, a small (0.25-0.5 mL) sample of broth
without the XAD can be taken daily to check on the status of the
culture growth visually. When massive cell lysis is observed, the
remainder of the culture volume should be harvested.
Preparation and 5 L-Scale Epothilone Production Fermentation
[0414] 100 g XAD and 8 g MgO.sub.4-7H.sub.2O are combined with 3.9
L of deionized water, and sterilized (90 minutes, 121.degree. C.)
in a 5 L B-Braun bioreactor. A sufficient volume (133 mL) of a
presterilized casitone/deionized water solution (150 g/L) is pumped
in aseptically to attain a final casitone concentration of 5 g/L in
the fermentor. An initial methyl oleate concentration of 2 mL/L is
achieved by addition of 10 mL of this oil. Finally, 16 mL of a
presterilized trace elements solution are added aseptically prior
to inoculation. The fermentor is then inoculated with 200 mL of the
CYE seed culture (4.8% volume/volume) and permitted to grow for
24.+-.6 hours. At this point, the casitone (2 g/L/day, continuous
feed) and methyl oleate (3 mL/L/day total, fed semi-continuously
every 90 minutes) feeds are initiated. Airflow is held constant in
the bioreactor at 0.4-0.5 vvm (the increasing fermentation volume
as the feeds progress causes this variation). The dissolved oxygen
concentration is controlled at 50% of saturation by a stirring
cascade (400-700 rpm). The 100% of saturation dissolved oxygen
calibration point is established by setting the initial agitation
at 400 rpm, and the initial airflow at 0.5 vvm. The pH setpoint of
7.4 is maintained by automated addition of 2.5N H.sub.2SO.sub.4 and
2.5N KOH. Epothilone production continues for 11-14 days following
inoculation, with the bioreactor is harvested when cell lysis is
apparent in the broth samples and the demand for oxygen (as
indicated by the agitation rate) abruptly decreases. Epothilone D
titers generally reach 18-25 mg/L in this fermentation process.
Preparation and 1000 L-Scale Epothilone Production Fermentation
[0415] The 1000 L fermentor was prepared for epothilone production
as follows. 600 L of water and 18 L (11.574 kg) of XAD-16 was
sterilized (45 minutes, 121.degree. C.) in the fermentor. Trace
metals and MgSO.sub.4 were filter sterilized (through a
presterilized 0.2 micron polyethersulfone membrane capsule filter)
directly into the fermentation vessel. 2.9 L of the trace elements
solution as well as a sufficient quantity of a concentrated
MgSO.sub.4 solution (to 2 g/L final concentration in the fermentor)
were added through the same capsule filter. About 200 L of a
mixture of 117 g/L casitone and 175 mL/L methyl oleate was
sterilized in a 260 L feed tank. About 32 L of this sterile mixture
was added to the 1000 L fermentor. Water was filtered into the
vessel (through the same capsule filter) to bring final volume to
710 L. Agitation was 100 rpm. Backpressure was maintained at
100-300 mbar. When the dissolved oxygen (DO) reached 50% after
inoculation, agitation was increased to 150 rpm. When the DO again
reached 50%, agitation was increased to 200 rpm. DO was controlled
at 50% of saturation by cascading the airflow (0 Lpm-240 Lpm). The
pH setpoint was maintained at 7.4 by automated addition of 2.5 M
KOH and 2.5 N H.sub.2SO.sub.4. The fermentor was inoculated with 38
L seed from the 150 L fermentor (5% volume/volume).
[0416] Addition of 0.570 L/hour of the casitone-methyl oleate feed
solution began after the DO reached 50% (for the second time, about
10.+-.5 hours after inoculation) and continued until the fermentor
was harvested. The bioreactor was harvested 10 days following
inoculation. Final epothilone D titers were determined to be about
20.+-.5 mg/L.
Fermentation Sampling Procedure
[0417] For kinetic experiments in flasks, 5-50 mL of thoroughly
mixed broth and XAD resin were sampled with a 25 mL pipet and
deposited in a 10 or 50 mL conical tube. For bioreactor samples, a
50 mL sample of the mixed broth and resin was deposited in a 50 mL
conical tube. The conical tube was then permitted to sit for 10
minutes to permit the XAD to settle to the bottom of the tube. The
broth at this point can be decanted from the XAD resin. If the XAD
does not settle, then one can remove the broth using a 10-25 mL
pipette.
Methanol Extraction of XAD Resin for Epothilone Titer
Quantitation
[0418] After the XAD resin has gravity settled to the bottom of the
sample tube (as per the sampling procedure), all of the supernatant
is transferred to a new 50 mL conical tube. Wash the XAD resin once
by adding water back to the 50 mL mark, mix thoroughly by
inversion, and let the XAD resin gravity settle again. Decant the
aqueous mixture from the tube, without pouring out the XAD. The
last few mL of water can be removed by using a 1 mL pipetman with
the tip pushed down into the base of the tube. Add methanol to the
tube up to the 25 mL point, and cap the tube. Place the conical
tube horizontally on a shaker for 30 minutes (at 20-30.degree. C.)
to thoroughly extract all of the epothilone from the XAD resin.
HPLC Procedure for Epothilone Quantitation
[0419] Analysis of epothilones C and D is carried out using a
Hewlett Packard 1090 HPLC with UV detection at 250 nm. The
methanol-extracted solution from the XAD resin (50 .mu.L) was
injected across two 4.6.times.10 mm guard columns (Inertsil, C18 OD
53,5 .mu.m), and a longer column of the same material for
chromatographic separation (4.6.times.150 mm). The method was
isocratic with 60% acetonitrile and 40% water over an 18 minute
run. With this method, epothilone D eluted at 13 minutes and
epothilone C eluted at 10.3 minutes. Standards were prepared using
epothilone D purified from fermentation broth.
Dry Cell Weight Procedure for Growth Curve
[0420] Set the temperature on a Sorvall RC5B centrifuge (with the
SH-3000 bucket rotor) to 20.degree. C. Weigh a 50 mL conical tube
that has been in the 80.degree. C. oven for at least a day. Record
the tare weight and fermentation sample identification on the side
of the tube. Pour or pipet 40 mL of broth (containing no XAD) into
the tared tube. Spin the conical tube at 4700 RPM (4200 g) for 30
minutes. After sedimentation, pour off the supernatant, and
resuspend the cell pellet in 40 mL of deionized water to wash the
pellet. Spin the tube again (4200 g, 30 minutes). Decant the
supernatant, and place tube in an 80.degree. C. drying oven for at
least 2 days. Weigh tube, and record the final weight on the tube.
The dried cell weight (DCW) can then be calculated by the following
equation: DCW (g/L)=(Final tube weight (g)-Tare tube weight
(g))/0.04 L Determination of Ammonium Ion Concentration
[0421] The ammonia concentration of the fermentation broth is
routinely assayed in the epothilone fermentations. One mL of
fermentation broth is clarified by centrifugation in a
microcentrifuge (5 minutes, 12000 rpm). An ammonia assay kit from
Sigma (Catalog #171-UV) is used for quantitation, with the
clarified fermentation broth substituted in place of the blood
plasma described in the kit protocol. As the linear response range
of this colorimetric assay is only 0.01176-0.882 mmoles/L, the
clarified fermentation samples are typically diluted 20-100 fold in
deionized water to assay ammonium concentrations within this
range.
Determination of Residual Methyl Oleate Concentration
[0422] The amount of residual methyl oleate present in the
fermentation broth can be estimated by extracting fermentation
broth samples with methanol, and running these extracted broth
samples on an HPLC. Quantitation of the methyl oleate concentration
was carried out using a Hewlett Packard 1090 HPLC with UV detection
at 210 nm. Whole broth samples (1-4 mL) were extracted with an
equivalent volume of methanol and centrifuged at 12,000 g to
sediment any insoluble components. The clarified supernatant (50
.mu.L) was injected onto a 4.6.times.10 mm extraction column
(Inertsil, C18 OD 53,5 .mu.m), washed with 50% acetonitrile for 2
minutes, then eluted onto the main column (4.6.times.150 mm, same
stationary phase and flow rate) with a 24 minute gradient starting
at 50% acetonitrile and ending at 100% acetonitrile. The 100%
acetonitrile column flow was maintained for 5 minutes. Due to its
heterogeneous nature, the methyl oleate elutes as a number of
disparate peaks, instead of as single pure compound. However,
approximately 64-67% of the total methyl oleate extractables appear
in two primary peaks that elute at 25.3.+-.0.2 and 27.1.+-.0.2
minutes, respectively. Methyl oleate in methanol extracted
fermentation samples can be estimated by quantitating the summed
area of these two peaks, then calibrating them against the summed
area of these two peaks in methyl oleate standards prepared in a
50% water/methanol solution.
Purification and Crystallization of Epothilone D
[0423] The present invention provides a purification process for
epothilones and epothilone D and highly purified preparations of
epothlone D, including epothilone D in crystalline form. The
advantages of the present process include initial purification
steps that require only alcohol (such as methanol) and water, which
allows for efficient use of product pools and minimizes the
necessity for time-consuming and labor-intensive evaporation steps.
The present method requires only a single evaporation step, which
requires the evaporation of 1 L of ethanol for every 10-15 g of
epothilone. In the process, a column packed with synthetic
polystyrene-divinylbenzene resin such as HP20SS is used to remove
both polar and lipophilic impurities. This column generates an
intermediate product that contains 10% epothilones and eliminates
the need for liquid/liquid extractions that use either highly
flammable or toxic solvents.
[0424] Another improvement relates to the use of a C18 resin with a
40-60 micron particle distribution, such as Bakerbond C18, that
allows the use of low pressure columns and pumps (less than 50
psi), which reduces cost significantly. The starting material for
the C18 chromatography step is solution loaded in a dilute loading
solvent. The solvent is weak enough so that epothilones stick at
the top of the column in a highly concentrated, tight band, which
allows the column to perform well under heavy loading (2-5 g
epothilone/L resin). Because typical column loading is 1 g/l or
less, and chromatography is usually the most expensive step in
purification, this improvement-results in significant cost savings.
Moreover, the present method allows for the use of an alcohol, such
as methanol, instead of acetonitrile in the chromatography step.
The pool containing the epothilone is crystallized from a binary
solvent system in which water is the forcing solvent to provide the
epothilone in crystalline form.
[0425] The purification process, in one embodiment, consists of the
following steps and materials. The XAD resin in the fermentation
broth is (1) collected in a filter basket, and (2) eluted to
provide an XAD extract, which is (3) diluted with water, and (4)
passed through an HP20SS column to provide the HP20SS pool. The
HP20SS pool is (5) diluted with water, and (6) subjected to C18
chromatography to provide an epothilone pool, which is (7) diluted
with water, and (8) subjected to solvent exchange to provide a
concentrated epothilone pool. The concentrated epothilone pool is
(9) subjected to charcoal filtration, (10) evaporated, and (11)
crystallized to provide highly purified material.
[0426] A total of 11 g of epothilone D was isolated and purified to
a white crystalline powder from two 1000-L Myxococcus xanthus
fermentation runs (1031001K and 1117001K). The purity of the final
product was >95%, and the recovery of epothilone D was 71%.
[0427] Table 11 summarizes the HPLC Methods used during
purification. TABLE-US-00013 TABLE 11 Epo1 Method Column Inertsil
ODS3, 5 .mu.m, 4.6 .times. 150 mm Flow rate 1 ml/min Column Oven
50.degree. C. Run Time 15 minutes Detection UV at 250 nm Gradient 0
min; 60:40 ACN/H.sub.20 12 min; 100:0 ACN/H.sub.20 12.1 min; 60:40
ACN/H.sub.20 Epo78 Method Column Inertsil ODS3, 5 .mu.m, 4.6
.times. 150 mm Flow rate 1 ml/min Column Oven 50.degree. C. Run
Time 5 minutes Detection UV at 250 nm Gradient 0 min; 78:22
ACN/H.sub.20
[0428] The Materials used in this section are as follows. HP20SS
resin was purchased from Mitsubishi. The C18 resin was purchased
from Bakerbond C18 40 g and the methanol was puchased from Fisher
Bulk (55 gal). Deionized water was used.
Fermentation Run 1031001K
Step 1 XAD Elution (K125-173)
[0429] Seventeen liters (17 L) of XAD-16 resin were filtered from
the fermentation culture using a Mainstream filtration unit with a
thirteen-liter 150 .mu.m capture basket. The captured XAD resin was
packed into an Amicon VA250 column and was washed with 65 L (3.8
column volumes) of water at 1.0 L/min. The epothilone D product was
then eluted from the resin using 230 L of 80% methanol in
water.
Step 2 Solid Phase Extraction (K125-175)
[0430] Seventy-seven liters (77 L) of water were added to the step
1 product pool (230 L) to dilute the loading solvent to 60%
methanol in water. The resulting suspension (307 L) was mixed and
loaded onto an Amicon VA180 column packed with 5 L of HP20SS resin
that had previously been equilibrated with 5 column volumes of 60%
methanol. The loading flow rate was 1 L/min. After loading, the
column was washed with 13 L of 60% methanol and eluted with 77 L of
75% methanol at a flow rate of 325 mL/min. Thirty-one 2.5-L
fractions were collected. Fractions 10-26 (42.5 L) were found to
contain epothilone D, and these fractions were pooled together.
Step 3 Chromatography (K125-179)
[0431] The step 2 product pool was evaporated to an oil using two
20-L rotovaps. During evaporation it was necessary to add ethanol
in order to minimize foaming. The dried material was re-suspended
in 1.0 L of methanol and diluted with 0.67 L of water to make 1.67
L of a 60% methanol solution. The resulting solution was loaded
onto a 1-L C18 chromatography column (55.times.4.8 cm) that had
previously been equilibrated with 3 column volumes of 60% methanol.
The loading flow rate averaged at 64 mL/min. The loaded column was
washed with one liter of 60% methanol, and elution of the
epothilone D product was carried out isocratically using 70%
methanol at a flow rate of 33 mL/min. A total of 27 fractions were
collected, with the first fraction containing 3.8 L by volume. This
was followed by three 500-mL fractions and twenty-three 250-mL
fractions. Fractions 5-20 were taken as the best pool (K125-179-D),
containing 4.8 g of epothilone D. Fractions 34 (K125-179-C)
contained 1.4 g of epothilone D. Because this pool also contained
high concentrations of epothilone C, it was set aside for re-work
(Step 3b).
Step 4 Chromatography (K119-153)
[0432] Epothilone D fractions that also contained high
concentrations of the C analog were re-chromatographed on C18 resin
as follows. A 2.5.times.50 cm column was packed with C18 resin,
washed with 1 L of 100% methanol, and equilibrated with 1 L of 55%
methanol in water at a flow rate of 20 mL/min. The pressure drop
was 125 psi. The starting material (K125-179-C, 1040 mL) was
diluted with 260 mL of water so that the loading solution contained
55% methanol in water. The resulting solution (1300 mL) was loaded
onto the resin, and an additional 250 mL of 55% methanol was passed
through the column. The column was first eluted with 5 L of 65%
methanol, followed by 3 L of 70% methanol in water. During the 65%
methanol elution, a total of forty-eight 100-mL fractions were
collected. After switching to 70% methanol, a total of ten 250-mL
fractions were collected. The best epothilone D pool (K119-153-D),
consisting of Fractions 50-58, contained 1.0 g of the desired
product.
Step 5a Crystallization (K119-158)
[0433] The starting material for this step was a combination of
chromatography products from step 3 and 4. Initially, 120 mL of
ethanol was added to 7.9 g of solids containing 5.5 g of epothilone
D. With gentle mixing, the solids were completely dissolved, and
the solution was transferred to a 400-mL beaker that was placed on
a stir plate in a fume hood. A 1'' stir bar was added, and the
solution was rapidly stirred. Meanwhile, 100 mL of water were
slowly added over a period of about 5 minutes. When the formation
of small white crystals were observed, the solution was stirred for
15 more minutes until the solution became thick with white solids.
The beaker was then removed from the stir plate, covered with
aluminum foil, and placed in a refrigerator (2.degree. C.) for 12
hours. The white solids were filtered using Whatman #50 filter
paper, and no additional wash was performed on this first crop. The
solids were placed to a crystallization dish and dried in a vacuum
oven (40.degree. C. at 15 mbar) for 1 hour. Subsequently, the
material was removed from the oven, made into finer particles, and
dried in the vacuum oven for another four hours. This
crystallization process yielded 3.41 g of off white solids. The
Epo1 HPLC method was used to determine the chromatographic purity
of the final product. The HPLC results, along with the
corresponding .sup.1H and .sup.13C NMR data, all confirmed that the
dried material contained >95% epothilone D. The recovery for
this first crop was 58%.
Step 5b Crystallization (K119-167)
[0434] The starting material for this step was the evaporated
mother liquor from step 5a Initially, 70 mL of ethanol and 30 mL of
water were added to 3.4 g of solids containing 2.1 g of epothilone
D. This clear solution was transferred to a beaker, and 1 g of
decolorizing charcoal was added to it. The mixture was stirred on a
medium setting for 10 min. and was then filtered using a Whatman
#50 filter paper. The charcoal was washed with two 10-mL aliquots
of ethanol and was filtered again. The combined filtrate was
brought to dryness using a rotovap, and the solids were
re-suspended in 50 mL of ethanol. The resulting solution was placed
in a 250-mL beaker, and with good stirring, 50 mL of water was
slowly added. To promote crystal formation, a small amount of seed
crystal (1 mg) was added to the mixture. After several minutes of
stirring, the formation of additional white solids was observed. A
stream of nitrogen was set to gently blow over the mixture while
the stirring continued. After 15 minutes, the beaker was placed in
the refrigerator at 2.degree. C. for 36 hours. The mixture was
filtered using a Whatman #50 filter paper to capture the crystals,
and an additional 7 mL of 50:50 ethanol: water was used to wash the
solids. The crystals were subsequently dried in the vacuum oven for
4 hours. This crystallization step yielded 1.46 g of white
crystals, which contain >95% epothilone D.
Fermentation Run 1117001K
[0435] Step 1 XAD Elution (K125-182)
[0436] Seventeen liters (17 L) of XAD-16 resin were filtered from
the fermentation culture using a Mainstream filtration unit with a
thirteen-liter 150 .mu.m capture basket. The captured XAD resin was
packed into an Amicon VA250 column and was washed with 58 L (3.4
column volumes) of water at 1.0 L/min. The epothilone D product was
then eluted from the resin using 170 L of 80% methanol in water.
During the water wash and the first column volume of elution, the
column backpressure increased steadily to above 3 bars with a final
flow rate of under 300 mL/min. Therefore, the XAD resin was removed
from the column and repacked into an alternate Amicon VA250 column.
After the exchange, the backpressure decreased below 1 bar and the
flow rate was maintained at 1.0 L/min. A single 170-L fraction was
collected in a 600-L stainless steel tank. Based on HPLC analysis,
the step 1 product pool was found to contain 8.4 g of epothilone
D.
Step 2 Solid Phase Extraction (K145-150)
[0437] Fifty-seven liters (57 L) of water were added to the step 1
product pool (170 L) to dilute the loading solvent to 60% methanol
in water. The resulting suspension (227 L) was stirred with an
overhead lightning mixer and loaded onto an Amicon VA180 column
packed with 6.5-L of HP20SS resin that had previously been
equilibrated with 5 column volumes of 60% methanol. The loading
flow rate was 1 L/min. After loading, the column was washed with 16
L of 60% methanol and eluted with 84 L of 75% methanol at a flow
rate of 300 mL/min. Seven fractions were collected with volumes of
18 L, 6 L, 6 L, 6 L, 36 L, 6 L, and 6 L, respectively. Fractions 4
and 5, which contained a total of 8.8 g of epothilone D, were
pooled together.
Step 3 Chromatography (K145-160)
[0438] The step 2 product pool was evaporated to an oil using two
20-L rotovaps. To minimize foaming during the evaporation process,
10 L of ethanol were added to the mixture. The dried material was
resuspended in 2.8 L of methanol and diluted with 3.4 L of water to
make 6.2 L of a 45% methanol solution. The resulting solution was
pumped onto a 1-L C18 chromatography column (55.times.4.8 cm) that
had previously been equilibrated with 5 column volumes of 45%
methanol. The loading flow rate averaged at 100 mL/min. The loaded
column was washed with one liter of 60% methanol, and the
epothilone D product was eluted from the resin using a step
gradient at a flow rate of 100 mL/min. The column was eluted with 5
L of 55% methanol, 11.5 L of 60% methanol, and 13.5 L of 65%
methanol. During the 55% methanol elution, a total of ten 500-mL
fractions were collected. After switching to 60% methanol, a total
of twenty-three 500-mL fractions were collected. During the final
65% methanol elution, eleven 500-mL fractions were collected,
followed by eight 1-L fractions. The best epothilone D pool
(K145-160-D), consisting of Fractions 28-50, contained 8.3 g of the
desired product. Fractions 26-27 (K145-160-C), which were
contaminated with 0.4 g of the epothilone C, contained 0.2 g of
epothilone D. All of these 25 fractions were combined.
[0439] To dilute product pool to 40% methanol in water, 9.5 L of
water was added to 15.8 L of the loading solution. The resulting
solution (25.3 L) was then pumped onto a 700-mL C18 chromatography
column (9.times.10 cm) that had previously been equilibrated with 4
column volumes of 40% methanol. The loading flow rate averaged at
360 mL/min. The loaded column was washed with one liter of 40%
methanol, and the epothilone D product was eluted from the resin
with 3.75 L of 100% ethanol. The eluant was evaporated to dryness
using a rotovap. The solids were resuspended in 100 mL of acetone,
and the undissolved material was filtered from the solution using a
Whatman #2 filter paper. The filtered particles were washed with an
additional 115 mL of acetone and filtered once more. Following the
acetone extraction, 2 g of decolorizing charcoal were added to the
combined filtrate. The mixture was stirred on a medium setting for
1 hour and was filtered using a Whatman #50 filter paper. The
charcoal was washed with 180 mL of ethanol and was filtered again.
The filtrates were pooled together and rotovaped to dryness.
Step 4 Chromatography (K119-174)
[0440] The dried material from step 3 was resuspended in 5.0 L of
50% methanol in water and was loaded onto a 1-L C18 chromatography
column (55.times.4.8 cm) that had previously been equilibrated with
3 column volumes of 50% methanol. The loading flow rate averaged at
80 mL/min. The column was subsequently washed with one liter of 50%
methanol, and the epothilone D product was eluted isocratically
from the resin using 70% methanol at the same flow rate. A total of
48 fractions were collected, with the first 47 fractions containing
240 mL and the last fraction containing 1 L. Fractions 25-48 were
taken as the best pool (K119-174-D), containing 7.4 g of epothilone
D. Fractions 21-24 (K119-174-C) contained 1.1 g of epothilone D.
Because this pool also contained high concentrations of epothilone
C, it was set aside for re-work.
Step 5 Crystallization (K119-177)
[0441] To perform a solvent exchange prior to the crystallization
step, 3.9 L of water was added to 6.4 L of the best epothilone D
pool (K119-174-D) from step 5 to dilute the loading solution to 40%
methanol in water. The resulting solution was then loaded onto a
200-mL C18 chromatography column (2.5.times.10 cm) that had
previously been equilibrated with 3 column volumes of 40% methanol.
The loaded column was washed with 200 mL of 40% methanol, and the
epothilone D product was eluted from the resin with 1 L of 100%
ethanol. The eluant was evaporated to dryness using a rotovap, and
the solids were re-suspended with 150 mL of 100% ethanol. The clear
solution was transferred to a beaker and with good stirring, 175 mL
of water was slowly added. A small (1 mg) seed crystal was also
added to the solution to promote crystal formation. When the
formation of small white crystals were observed, the solution was
stirred for 15 more minutes until the solution became thick with
white solids. The beaker was then removed from the stir plate,
covered with aluminum foil, and placed in a refrigerator (2.degree.
C.) for 12 hours. The white solids were filtered using Whatman #50
filter paper, and no additional wash was performed on this first
crop. The solids were placed to a crystallization dish and dried in
a vacuum oven (40.degree. C. at 15 mbar) for 6 hours. This
crystallization process yielded 6.2 g of white solids, which
contained >95% epothilone D. The recovery for this first crop
was 74%.
Results
[0442] The epothilone D recovery for run 1031001K was 4.8 g of
crystalline material at a purity of about 97.5-98.8%. The
epothilone D recovery for run 1117001K was 6.2 g of crystalline
material at a purity of about 97.7%. The impurity profiles for
these runs are shown in Table 12. TABLE-US-00014 TABLE 12 Step
Product Epo C Epo490 Epo D 1031001K run 2 SPE 23 4 74 3-4 Total
Chrom 0.7 0.7 90.6 5a Crystallization 1.0 1.0 97.5 5b
Crystallization 0.7 0.5 98.8 1117001K run 2 SPE 18 2 60 3 C18 Chrom
5.2 1.6 81.4 4 C18 Chrom 1.6 1.8 96.6 5 Crystallization 0.8 1.4
97.7 "Epo490" is a novel epothilone compound of the invention,
10,11-dehydro-epothilone D, that is produced by the Myxococcus host
cells.
[0443] This purification methodology arose out of efforts to
scale-up modifications made to the epothilone D purification
process to accommodate the use of methyl oleate in the fermentation
medium. The elution of the epothilone D product from the XAD resin
was carried out in a straightforward manner. Instead of using 100%
methanol, 10 column volumes of 80% methanol were used to elute the
product from the beads in a column. During the XAD elution step, it
was noted that the presence of lysed cells in the fermentation
broth may contribute to the clogging of the purification columns.
The harvest of the 103100-1K fermentation run had occurred before
significant cell lysis had taken place, while the 111700-1K
fermentation run was harvested only after considerable cell lysis
had occurred. However, a high backpressure and a low flow rate were
observed only for the latter run during the elution process.
Therefore, it is likely that the lysed cells in this run may have
aggregated and subsequently fouled the column filter.
[0444] These purification runs show that epothilone D is stable at
room temperature in 80% methanol for at least one day. Based on
HPLC analysis, degradation of the product under these conditions is
not detectable. This finding allowed storage of the 170-L product
pool from the XAD elution step in a 600-L stainless steel tank
overnight without refrigeration. To further improve the process, a
solvent-exchange column was employed, which is much less
time-consuming and labor-intensive than the use of a rotovap in
concentrating the volume of the product pools. Therefore, one can
replace large-scale rotovaping with a solvent-exchange step.
[0445] Although a significant amount oil remained bound to the
resin during the XAD elution step, a sizable amount was still
present in the eluant. Even after the HP20SS solid phase
extraction, oil droplets were clearly visible in the product pool
and proved to problematic during the C18 chromatography. For
optimal chromatography performance, the concentration of epothilone
D in the loading solution should be kept below 2 g/L. At higher
concentrations, the starting material has a tendency to oil out on
the column.
[0446] Crystallization was not possible when feed material
contained more than 3% of either epothilone C or epo490. This was
the case during the purification of 1117001K. The first
chromatography step gave a product that contained 5% epothilone C.
After numerous attempts, crystallization of this material was not
achieved. However, taking this material through a second
chromatography step reduced epothilone C to 1% and generated a feed
material that was easily crystallized.
EXAMPLE 4
Construction of a Myxococcus Strain with a Non-Functional epoK
Gene
[0447] Strain K111-40-1 was constructed from strain K111-32.25 by
insertional inactivation of the epoK gene. To construct this epoK
mutant, a kanamycin resistance cassette was inserted into the epoK
gene. This was done by isolating the 4879 bp fragment from
pKOS35-79.85, which contains epoK, and ligating it into the NotI
site of pBluescriptSKII+. This plasmid, pKOS35-83.5, was partially
cleaved with ScaI, and the 7.4 kb fragment was ligated with the 1.5
kb EcoRI-BamHI fragment containing the kanamycin resistance gene
from pBJ180-2, which had the DNA ends made blunt with the Klenow
frangment of DNA polymerase I, to yield plasmid pKOS90-55. Finally,
the .about.400 bp RP4 oriT fragment from pBJ183 was ligated into
the XbaI and EcoRI sites to create pKOS90-63. This plasmid was
linearized with DraI and electroporated into the Myxococcus xanthus
strain K111-32.25, and transformants selected to provide M. xanthus
strain K11140.1. Strain K111-40.1 was deposited in compliance with
the Budapest Treaty with the American Type Culture Collection,
Manassas, Va. 20110-2209, USA on Nov. 21, 2000, and is available
under accession No. PTA-2712.
[0448] To create a markerless epoK mutation, pKOS35-83.5 was
cleaved with ScaI and the 2.9 kb and 4.3 kb fragments were ligated
together. This plasmid, pKOS90-101, has an in-frame deletion in
epoK. Next, the 3 kb BamHI and NdeI fragment from KG2, which had
the DNA ends made blunt with the Klenow fragment of polymerase I
and contains the kanamycin resistance and galK genes, was ligated
into the DraI site of pKOS90-101 to create pKOS90-105. This plasmid
was electroporated into K111-32.25 and kanamycin resistant
electroporants were selected. To replace the wild type copy of epoK
with the deletion, the second recombination event was selected by
growth on galactose plates. These galactose resistant colonies are
tested for production of epothilone C and D, and a producing strain
was designated K111-72.4.4 and deposited in compliance with the
Budapest Treaty with the American Type Culture Collection,
Manassas, Va. 20110-2209, USA on Nov. 21, 2000, and is available
under accession No. PTA-2713.
EXAMPLE 5
Addition of matBC
[0449] The matBC genes encode a malonyl-CoA synthetase and a
dicarboxylate carrier protein, respectively. See An and Kim, 1998,
Eur. J. Biochem. 257: 395402, incorporated herein by reference.
These two proteins are responsible for the conversion of exogenous
malonate to malonyl-CoA inside the cell. The products of the two
genes can transport dicarboxylic acids and convert them to CoA
derivatives (see PCT patent application No. US00/28573,
incorporated herein by reference). These two genes can be inserted
into the chromosome of Myxococcus xanthus to increase the cellular
concentrations of malonyl-CoA and methymalonyl-CoA to increase
polyketide production. This is accomplished by cleaving pMATOP-2
with BglII and SpeI and ligating it into the BglII and SpeI sites
of pKOS35-82.1, which contains the tetracycline resistance
conferring gene, the Mx8 att site and the M. xanthus pilA promoter
to drive expression of matBC. This plasmid can be electroporated
into M. xanthus. Because the pilA promoter is highly transcribed,
it may be necessary to insert a weaker promoter in the event that
too much MatB and MatC affect cell growth. Alternative promoters
include the promoter of the kanamycin resistance conferring
gene.
EXAMPLE 6
Mutation of the KS.sup.Y in the Loading Module
[0450] The proposed mechanism of initiation of epothilone
biosynthesis is the binding of malonate to the ACP of the loading
domain and the subsequent decarboxylation by the loading KS domain.
The loading KS domain contains a tyrosine at the active site
cysteine (KS.sup.Y) which renders it unable to perform the
condensation reaction. However, it is believed to still perform the
decarboxylation reaction. Experiments with rat fatty acid synthase
has shown that a KS domain that contains a glutamine in the active
site cysteine (KS.sup.Q) increases the decarboxylation by two
orders of magnatude whereas changing this amino acid to serine,
alanine, asparagine, glycine or threonine resulted in no increase
relative to wild type. Therefore, changing the KS.sup.Y to KS.sup.Q
may increase the priming of epothilone resulting in an increase in
epothilone production. To make the change in strain K111-32.25, the
plasmid pKOS39-148 was constructed that has .about.850 bp of the
epothilone KS loading module coding sequence. The KS.sup.Q mutation
was created in this plasmid by site directed mutagenesis. To
perform a gene replacement in K111-32.25, the kanamycin resistance
and galK genes from KG2 were inserted into the DraI sites of
pKOS39-148 to create plasmids pKOS111-56.2A and pKOS111-56.2B. The
plasmids differ in their orientation of the kanamycin-galK
cassette. These plasmids were electroporated into K111-32.25 and
kanamycin resistant colonies were selected to create strain
K111-63. To replace the wild type loading module KS, K111-63 was
plated on CYE galactose plates, and colonies were screened for the
presence of the KS.sup.Q mutation by PCR and sequencing.
EXAMPLE 7
Addition of mtaA
[0451] To increase the levels of phosphopantetheinyl transferase
(PPTase) protein, the PPTase from Stigmatella aurantiaca strain DW4
can be added to K111-32.25. This is done by PCR amplification of
mtaA from DW4 chromosomal DNA using the primers 11144.1
(AAAAGCTTCGGGGCACCTCCTGGCTGTCGGC) and 11144.4
(GGTTAATTAATCACCCTCCTCCCACCCCGGGCAT). See Silakowski et al., 1999,
J. Biol. Chem. 274(52):37391-37399, incorporated herein by
reference. The .about.800 bp fragment was cleaved with NcoI and
ligated into the pUHE24-2B that had been cleaved with PstI, the DNA
ends made blunt with the Klenow fragment of DNA polymerase I, and
cleaved with NcoI. This plasmid is designated pKOS111-54. The mtaA
gene is transfered to plasmid pKOS35-82.1, which contains the
tetracycline resistance conferring gene, the Mx8 att site and the
Myxococcus xanthus pilA promoter to drive expression of mtaA. This
plasmid is introduced into M. xanthus and integrated into the Mx8
phage attachment site.
EXAMPLE 8
Construction of Promoter Replacement Plasmids
[0452] To improve epothilone production levels and to illustrate
the wide variety of promoters that can be used to express PKS genes
in host cells of the invention, a series of vectors and host cells
can be constructed to replace the Sorangium cellulosum epothilone
PKS gene promoter with other suitable promoters, as described in
this example.
A. Construction of Plasmid with Downstream Flanking Region
[0453] Cosmid pKOS35-70.8A3 was cut with NsiI and AvrII. The 9.5 kb
fragment was ligated with pSL1190 cut with PstI and AvrII to yield
pKOS90-13. Plasmid pKOS90-13 is .about.12.9 kb. Plasmid pKOS90-13
was cut with EcoRI/AvrII. The 5.1 kb fragment was ligated with
pBluescript digested with EcoRI/SpeI to create pKOS90-64
(.about.8.1 kb). This plasmid contains the downstream flanking
region for the promoter (epoA and some sequence upstream of the
start codon). The EcoRI site is .about.220 bp upstream from the
start codon for the epoA gene. The AvrII site is 5100 bp downstream
from the EcoRI site.
B. Cloning of Upstream Flanking Region
[0454] Primers 90-66.1 and 90-67 (shown below) were used to clone
the upstream flanking region. Primer 90-67 is at the 5' end of the
PCR fragment and 90-66.1 is at the 3' end of the PCR fragment. The
fragment ends 2481 bp before the start codon for the epoA gene. The
.about.2.2 kb fragment was cut with HindIII. Klenow polymerase was
added to blunt the HindIII site. This fragment was ligated into the
HincII site of pNEB193. Clones with the proper orientation, those
with the EcoRI site at the downstream end of the insert and HindIII
at the upstream end of the insert, were selected and named
pKOS90-90. TABLE-US-00015 90-66.1: 5' GCGGG AAGCTT
TCACGGCGCAGGCCCTCGTGGG 3' | | linker HindIII primer 90-67: 5' GC
GGTACC TTCAACAGGCAGGCCGTCTCATG 3' | | linker KpnI primer
C. Construction of Final Plasmid
[0455] Plasmid pKOS90-90 was cut with EcoRI and HindIII. The 2.2 kb
fragment was ligated with pKOS90-64 digested with EcoRI/HindIII to
create pKOS 90-91 (10.3 kb). Plasmid pKOS90-91 contains the
upstream flanking region of the promoter followed by the downstream
flanking region in pBluescript. There is a Pad site between the two
flanking regions to clone promoters of interest. The galK/kan.sup.r
cassette was then inserted to enable recombination into Myxococcus
xanthus. Plasmid pKOS90-91 was cut with DraI. DraI cuts once in the
amp gene and twice in the vector (near the amp gene). Plasmid KG-2
was cut with BamHI/NdeI and Klenow polymerase added to blunt the
fragment. The 3 kb fragment (containing galK/kan.sup.r genes) was
ligated with the .about.9.8 kb DraI fragment of pKOS90-91 to create
pKOS90-102 (12.8 kb).
D. Construction of Plasmid with Alternative Leader
[0456] The native leader region of the epothilone PKS genes can be
replaced a leader with a different ribosome binding site. Plasmid
pKOS39-136 (described in U.S. patent application Ser. No.
09/443,501, filed 19 Nov. 1999) was cut with PacI/AscI. The 3 kb
fragment containing the leader sequence and part of epoA was
isolated and ligated with the 9.6 kb PacI/AscI fragment of
pKOS90-102 to create pKOS90-106 (.about.12.7 kb).
E. Construction of Promoter Replacement Plasmids
I. MTA (myxothiazol) Promoter
[0457] The myxothiazol promoter was PCR amplified from Stigmatella
aurantiaca chromosomal DNA (strain DW4) using primers 111-44.3 and
111-44.5 (shown below). The .about.554 bp band was cloned into the
HincII site of pNEB193 to create pKOS90-107. Plasmid pKOS90-107 was
cut with PstI and XbaI and Klenow filled-in. The 560 bp band was
cloned into pKOS90-102 and pKOS90-106 cut with PacI and Klenow
filled-in (PacI cuts only once in pKOS90-102 and pKOS90-106).
Plasmids were screened for the correct orientation. The MTA
promoter/pKOS90-102 plasmid was named pKOS90-114 (13.36 kb) and MTA
promoter/pKOS90-106 plasmid was named pKOS90-113 (13.26 kb).
TABLE-US-00016 111-44.3 5'AA AAGCTT AGGCGGTATTGCTTTCGTTGCACT 3' | |
linker HindIII primer 111-44.5 5'GG TTAATTAA
GGTCAGCACACGGTCCGTGTGCAT 3' | | linker PacI primer
[0458] These plasmids are electroporated into Myxococcus host cells
containing the epothilone PKS genes, and kanamycin resistant
transformants selected to identify the single crossover
recombinants. These transformants are selected for galactose
resistance to identify the double crossover recombinants, which are
screened by Southern analysis and PCR to identify those containing
the desired recombination event. The desired recombinants are grown
and tested for epothilone production.
II. TA Promoter
[0459] The putative promoter for TA along with taA, which encodes a
putative transcriptional anti-terminator, was PCR amplified from
strain TA using primers 111-44.8 (AAAGATCTCTCCCGATGCGGGAAGGC) and
111-44.9 (GGGGATCCAATGGAAGGGGATGTCCGCGGAA). The ca. 1.1 kb fragment
was cleaved with BamHI and BglII and ligated into pNEB193 cleaved
with BamHI. This plasmid is designated pKOS111-56.1. The plasmid
pKOS111-56.1 was cut with EcoRI and HindIII and Klenow filled-in.
The .about.1.1 kb band was cloned into pKOS90-102 and pKOS90-106
cut with PacI and Klenow filled-in (PacI cuts only once in
pKOS90-102 and pKOS90-106). Plasmids were screened for the correct
orientation. The TA promoter/90-102 plasmid was named pKOS90-115
(13.9 kb), and the TA promoter/pKOS90-106 plasmid was named
pKOS90-111 (13.8 kb).
[0460] These plasmids are electroporated into Myxococcus host cells
containing the epothilone PKS genes, and kanamycin resistant
transformants selected to identify the single crossover
recombinants. These transformants are selected for galactose
resistance to identify the double crossover recombinants, which are
screened by Southern analysis and PCR to identify those containing
the desired recombination event. The desired recombinants are grown
and tested for epothilone production.
III. pilA Promoter
[0461] Plasmid pKOS35-71B was cut with EcoRI and Klenow filled-in.
The 800 bp fragment was cloned into pKOS90-102 and pKOS90-106 cut
with Pad and Kienow filled-in. Plasmids were screened for the
correct orientation. The pilA promoter/pKOS90-102 plasmid was named
pKOS90-120 (13.6 kb), and the pilA promoter/pKOS90-106 plasmid was
named pKOS90-121 (13.5 kb).
[0462] These plasmids are electroporated into Myxococcus host cells
containing the epothilone PKS genes, and kanamycin resistant
transformants selected to identify the single crossover
recombinants. These transformants are selected for galactose
resistance to identify the double crossover recombinants, which are
screened by Southern analysis and PCR to identify those containing
the desired recombination event. The desired recombinants are grown
and tested for epothilone production.
IV. kan Promoter
[0463] Plasmid pBJ180-2 was cut with BamHI/BglII and Klenow
filled-in. The 350 bp fragment was cloned into pKOS90-102 and
pKOS90-106 cut with PacI and Klenow filled-in. Plasmids were
screened for the correct orientation. The kan promoter/pKOS90-102
plasmid was named pKOS90-126 (13.15 kb), and the kan promoter
pKOS/90-106 plasmid was named pKOS90-122 (13.05 kb).
[0464] These plasmids are electroporated into Myxococcus host cells
containing the epothilone PKS genes, and kanamycin resistant
transformants selected to identify the single crossover
recombinants. These transformants are selected for galactose
resistance to identify the double crossover recombinants, which are
screened by Southern analysis and PCR to identify those containing
the desired recombination event. The desired recombinants are grown
and tested for epothilone production.
V. So ce90 Promoter
[0465] The So ce90 promoter was amplified from So ce90 chromosomal
DNA using primers 111-44.6 and 111-44.7 (shown below). The
.about.900 bp band was cut with PacI and cloned into pNEB193 cut
with PacI to create pKOS90-125. Plasmid pKOS90-125 was cut with
PacI. The 924 bp band was cloned into pKOS90-102 and pKOS90-106 cut
with Pad. Plasmids were screened for the correct orientation. The
Soce90 promoter/pKOS90-102 plasmid was named pKOS90-127 (13.6 kb),
and the Soce90 promoter/pKOS90-106 plasmid was named pKOS90-128
(13.7 kb).
[0466] These plasmids are electroporated into Myxococcus host cells
containing the epothilone PKS genes, and kanamycin resistant
transformants selected to identify the single crossover
recombinants. These transformants are selected for galactose
resistance to identify the double crossover recombinants, which are
screened by Southern analysis and PCR to identify those containing
the desired recombination event. The desired recombinants are grown
and tested for epothilone production. TABLE-US-00017 111-44.6 5'GG
TTAATTAA CATCGCGCTATCAGCAGCGCTGAG 3' | | linker PacI primer
111-44.7 5'GG TTAATTAA TCCTCAGCGGCTGACCCGCTCGCG 3' | | linker PacI
primer
EXAMPLE 9
[0467] Construction of a KS2 Knockout Strain
[0468] This example describes the construction of an epothilone PKS
derivative in which the KS domain of extender module 2 is rendered
inactive by a mutation changing the active site cysteine codon to
an alanine codon. The resulting derivative PKS can be provided with
synthetic precursors (as described in the following Example) to
make epothilone derivatives of the invention.
[0469] The downstream-flanking region of the epothilone PKS gene
was PCR amplified using primers 90-103
(5'-AAAAAATGCATCTACCTCGCTCGTGGCGGTT-3') and 90-107.1 (5'-CCCCC
TCTAGA ATAGGTCGGCAGCGGTACCCG-3') from plasmid pKOS35-78.2. The
.about.2 kb PCR product was cut with NsiI/XbaI and ligated with
pSL1190 digested with NsiI and SpeI to create pKOS90-123
(.about.5.4 kb). A .about.2 kb PCR fragment amplified with primers
90-105 (5'-T=ATGATGCATGCGGCAGTTTGAACGG-AGATGCT-3') and 90-106
(5'-CCCCCGAATTCTCCCGGAAGGCACACGGAGAC-3') from pKOS35-78.2 DNA was
cut with NsiI and ligated with pKOS90-123 digested with NsiI/EcoRV
to create pKOS90-130 (.about.7.5 kb). When this plasmid is cut with
NsiI, and the DNA ends made blunt with the Klenow fragment of DNA
polymerase I and religated, plasmid pKOS90-131 is created. To clone
the galK/kan.sup.r cassette into this plasmid, plasmid KG-2 is cut
with BamHI/NdeI and made blunt with the Klenow fragment of DNA
polymerase I. The 3 kb fragment is cloned into the DraI site of
pKOS90-131 (DraI cuts three times in the vector) to create plasmid
pKOS90-132 (10.5 kb). The NsiI site is used for the purpose of
creating the desired change from cysteine to alanine to effect the
KS2 knockout. When pKOS90-130 is cut with NsiI, made blunt with the
Klenow fragment from DNA polymerase I and re-ligated, the codon for
cysteine is replaced with a codon for alanine. The resulting
plasmid can be introduced into Myxococcus xanthus strains of the
invention in accordance with the protocols described above to
create the desired strains.
[0470] Myxococcus xanthus strain K90-132.1.1.2 was constructed by
this procedure (using the epothilone A, B, C, and D producer
K111-32.25) and deposited under the terms of the Budapest Treaty
with the American Type Culture Collection, Manassas, Va.
20110-2209, USA, on Nov. 21, 2000, from which it can be obtained
under accession No. PTA-2715. To demonstrate that the resulting PKS
produced by the strain could synthesize epothilones when provided
the appropriate "diketide" starter unit, strain K90-132.1.1.2 was
grown in 50 mL of CTS plus 20% XAD for three days at 30.degree. C.
and then provided 200 mg/mL of the thiazole diketide shown below:
##STR27## The strain was cultured for an additional five days, and
the XAD was collected and the epothilones extracted with 10%
methanol. The extract was dried and resuspended in 0.2 mL of
acetonitrile, and an 0.05 mL sample analyzed by LC/MS, which showed
the presence of epothilones B and D, as expected. As discussed in
the following example, this system can be used to produce a variety
of epothilone analogs.
EXAMPLE 10
Modified Epothilones from Chemobiosynthesis
[0471] This Example describes a series of thioesters for production
of epothilone derivatives via chemobiosynthesis. The DNA sequence
of the biosynthetic gene cluster for epothilone from Sorangium
cellulosum indicates that priming of the PKS involves a mixture of
polyketide and amino acid components. Priming involves loading of
the PKS-like portion of the loading module with malonyl CoA
followed by decarboxylation and loading of the extender module one
NRPS with cysteine, then condensation to form enzyme-bound
N-acetylcysteine. Cyclization to form a thiazoline is followed by
oxidation to form enzyme bound 2-methylthiazole-4-carboxylate, the
product of the loading module and NRPS. Subsequent condensation
with methylmalonyl CoA by the ketosynthase of module two provides
the equivalent of a diketide, as shown in Scheme 6. ##STR28##
[0472] The present invention provides methods and reagents for
chemobiosynthesis to produce epothilone derivatives in a manner
similar to that described to make 6-dEB and erythromycin analogs in
PCT Pub. Nos. 99/03986 and 97/02358. Two types of feeding
substrates are provided: analogs of the NRPS product, and analogs
of the diketide equivalent. The NRPS product analogs are used with
PKS enzymes with a mutated NRPS-like domain, and the diketide
equivalents are used with PKS enzymes with a mutated KS domain in
module two (as described in Example 9). In the structures in
Schemes 7 and 8 below, R, R.sub.1 and R.sub.2 can be independently
selected from the group consisting of methyl, ethyl, lower alkyl
(C.sub.1-C.sub.6), and substituted lower alkyl.
[0473] Scheme 7 shows illustrative loading module analogs.
##STR29## The loading module analogs are prepared by activation of
the corresponding carboxylic acid and treatment with
N-acetylcysteamine. Activation methods include formation of the
acid chloride, formation of a mixed anhydride, or reaction with a
condensing reagent such as a carbodiimide.
[0474] Scheme 8 shows illustrative diketide equivalents. ##STR30##
The diketide equivalents are prepared in a three-step process.
First, the corresponding aldehyde is treated with a Wittig reagent
or equivalent to form the substituted acrylic ester. The ester is
saponified to the acid, which is then activated and treated with
N-acetylcysteamine.
[0475] Illustrative reaction schemes for making loading module
product analogs and diketide equivalents follow. Additional
compound suitable for making diketide equivalents are shown in FIG.
1 as carboxylic acids (or aldehydes that can be converted to
carboxylic acids) that are converted to the N-acylcysteamides for
supplying to the host cells of the invention.
A. Thiophene-3-carboxylate N-acetylcysteamine thioester
[0476] A solution of thiophene-3-carboxylic acid (128 mg) in 2 mL
of dry tetrahydrofuran under inert atmosphere was treated with
triethylamine (0.25 mL) and diphenylphosphoryl azide (0.50 mL).
After 1 hour, N-acetylcysteamine (0.25 mL) was added, and the
reaction was allowed to proceed for 12 hours. The mixture was
poured into water and extracted three times with equal volumes of
ethyl acetate. The organic extracts were combined, washed
sequentially with water, 1 N HCl, sat. CuSO.sub.4, and brine, then
dried over MgSO.sub.4, filtered, and concentrated under vacuum.
Chromatography on SiO.sub.2 using ether followed by ethyl acetate
provided pure product, which crystallized upon standing.
B. Furan-3-carboxylate N-acetylcysteamine thioester
[0477] A solution of furan-3-carboxylic acid (112 mg) in 2 mL of
dry tetrahydrofuran under inert atmosphere was treated with
triethylamine (0.25 mL) and diphenylphosphoryl azide (0.50 mL).
After 1 hour, N-acetylcysteamine (0.25 mL) was added and the
reaction was allowed to proceed for 12 hours. The mixture was
poured into water and extracted three times with equal volumes of
ethyl acetate. The organic extracts were combined, washed
sequentially with water, 1 N HCl, sat. CuSO.sub.4, and brine, then
dried over MgSO.sub.4, filtered, and concentrated under vacuum.
Chromatography on SiO.sub.2 using ether followed by ethyl acetate
provided pure product, which crystallized upon standing.
C Pyrrole-2-carboxylate N-acetylcysteamine thioester
[0478] A solution of pyrrole-2-carboxylic acid (112 mg) in 2 mL of
dry tetrahydrofuran under inert atmosphere was treated with
triethylamine (0.25 mL) and diphenylphosphoryl azide (0.50 mL).
After 1 hour, N-acetylcysteamine (0.25 mL) was added and the
reaction was allowed to proceed for 12 hours. The mixture was
poured into water and extracted three times with equal volumes of
ethyl acetate. The organic extracts were combined, washed
sequentially with water, 1 N HCl, sat. CUSO.sub.4, and brine, then
dried over MgSO.sub.4, filtered, and concentrated under vacuum.
Chromatography on SiO.sub.2 using ether followed by ethyl acetate
provided pure product, which crystallized upon standing.
D. 2-Methyl-3-(3-thienyl)acrylate N-acetylcysteamine thioester
[0479] (1) Ethyl 2-methyl-3-(3-thienyl)acrylate: A mixture of
thiophene-3-carboxaldehyde (1.12 g) and
(carbethoxyethylidene)triphenylphosphorane (4.3 g) in dry
tetrahydrofuran (20 mL) was heated at reflux for 16 hours. The
mixture was cooled to ambient temperature and concentrated to
dryness under vacuum. The solid residue was suspended in 1:1
ether/hexane and filtered to remove triphenylphosphine oxide. The
filtrate was filtered through a pad of SiO.sub.2 using 1:1
ether/hexane to provide the product (1.78 g, 91%) as a pale yellow
oil.
[0480] (2) 2-Methyl-3-(3-thienyl)acrylic acid: The ester from (1)
was dissolved in a mixture of methanol (5 mL) and 8 N KOH (5 mL)
and heated at reflux for 30 minutes. The mixture was cooled to
ambient temperature, diluted with water, and washed twice with
ether. The aqueous phase was acidified using 1N HCl then extracted
3 times with equal volumes of ether. The organic extracts were
combined, dried with MgSO.sub.4, filtered, and concentrated to
dryness under vacuum. Crystallization from 2:1 hexane/ether
provided the product as colorless needles.
[0481] (3) 2-Methyl-3-(3-thienyl)acrylate N-acetylcysteamine
thioester: A solution of 2-Methyl-3-(3-thienyl)acrylic acid (168
mg) in 2 mL of dry tetrahydrofuran under inert atmosphere was
treated with triethylamine (0.56 mL) and diphenylphosphoryl azide
(0.45 mL). After 15 minutes, N-acetylcysteamine (0.15 mL) is added
and the reaction is allowed to proceed for 4 hours. The mixture is
poured into water and extracted three times with equal volumes of
ethyl acetate. The organic extracts are combined, washed
sequentially with water, 1 N HCl, sat. CuSO.sub.4, and brine, then
dried over MgSO.sub.4, filtered, and concentrated under vacuum.
Chromatography on SiO.sub.2 using ethyl acetate provided pure
product, which crystallized upon standing.
[0482] The above compounds are supplied to cultures of host cells
containing a recombinant epothilone PKS of the invention in which
either the NRPS or the KS domain of extender module 2 has been
inactivated by mutation to prepare the corresponding epothilone
derivative of the invention.
EXAMPLE 11
Production of Epothilone Analogs
A. Production of 13-keto-epothilone Analogs
[0483] Inactivation of the KR domain in extender moduler 4 of the
epothilone PKS results in a hybrid PKS of the invention useful in
the production of 13-keto epothilones. The extender module 4 KR
domain was modified by replacing the wild-type gene with various
deleted versions as described below. First, fragments were
amplified using plasmid pKOS39-118B (a subclone of the epoD gene
from cosmid pKOS35-70.4) as a template. The oligonucleotide primers
for forming the left side of the deletion were TL3 and TL4, shown
below: TABLE-US-00018 TL3: 5'-ATGAATTCATGATGGCCCGAGCAGCG; and TL4:
5'-ATCTGCAGCCAGTACCGCTGCCGCTGCCA.
[0484] The oligonucleotide primers for forming the right side of
the deletion were TL5 and TL6, shown below: TABLE-US-00019 TL5:
5'-GCTCTAGAACCCGGAACTGGCGTGGCCTGT; and TL6:
5-GCAGATCTACCGCGTGAGGACACGGCCTT.
[0485] The PCR fragments were cloned into vector Litmus 39 and
sequenced to verify that the desired fragments were obtained. Then,
the clone containing the TL3/TL4 fragment was digested with
restriction enzymes PstI and BamHI, and the .about.4.6 kb fragment
was isolated. The 2.0 kb PCR fragment obtained using primers
TL5/TL6 was treated with restriction enzymes BglII and XbaI and
then ligated to either (i) the "short" KR linkers TL23 and TL24
(that are annealed together to form a double-stranded linker with
single-stranded overhangs) to yield pKOS122-29; or (ii) the "long"
(epoDH3*) linker, obtained by PCR using primers TL33+TL34 and then
treatment with restriction enzymes NsiI and SpeI, to yield plasmid
pKOS122-30. The sequences of these oligonucleotide linkers and
primers are shown below: TABLE-US-00020 TL23:
5'-GGCGCCGGCCAAGAGCGCCGCGCCGGTCGGCGGGCCAGCCGGGGACG GGT; TL24:
5'-CTAGACCCGTCCCCGGCTGGCCCGCCGACCGGCGCGGCGCTCTTGGC CGGCGCCTGCA;
TL33: 5'-GGATGCATGCGCCGGCCGAAGGGCTCGGA; and TL34:
5'-TCACTAGTCAGCGACACCGGCGCTGCGTTT.
[0486] The plasmids containing the desired substitution were
confirmed by sequencing and then digested with restriction enzyme
DraI. Then, the large fragment of each clone was ligated with the
kanamycin resistance and galK gene (KG or kan-gal) cassette to
provide the delivery plasmids. The delivery plasmids were
transformed into epothilone B producer Myxococcus xanthus
K111-32.25 by electroporation. The transformants were screened and
kanamycin-sensitive, galactose-resistant survivors were selected to
identify clones that had eliminated the KG genes. Confirmation of
the KG elimination and the desired gene replacement for the
recombinant strains was performed by PCR. The recombinant strains
were fermented in flasks with 50 mL of CTS medium and 2% XAD-16 for
5 days, and epothilone analogs were eluted from XAD with 10 mL of
methanol. Structure determination was based on the LC/MS spectrum
and NMR. One such strain, designated K122-56, was deposited with
the American Type Culture Collection, Manassa, Va. 20110-2209, USA,
on Nov. 21, 2000, under the terms of the Budapest Treaty and is
available under accession No. PTA-2714. The K122-56 strain (derived
from plasmid pKOS122-29) produces 13-keto-11,12-dehydro-epothilone
D as a major product whose structure is shown below ##STR31##
[0487] The K122-56 strain also produces 13-keto-epothilones C and D
as minor products whose respective structures are shown below
##STR32##
[0488] Similar results were obtained from strain K122-30, derived
from plasmid pKOS122-30. These compounds and the strains and PKS
enzymes that produce them are novel compounds, strains, and PKS
enzymes of the invention.
[0489] Other strains of the invention that produce the
13-keto-11,12-dehydroepothilones include those in which the KR
domain is rendered inactive by one or more point mutations. For
example, mutating the constitutive tyrosine residue in the KR
domain to a phenylalanine results in about a 10% decrease in KR
activity and results in some production of 13-keto-epothilones.
Additional mutations in the KR domain can eliminate more or all of
the KR activity but can also lead to decreased epothilone
production.
B. Production of 13-hydroxy-epothilone Analogs
[0490] Replacement of the extender module 5 KR, DH, and ER domains
of the epothilone PKS with a heterologous KR domain, such as the KR
domain from extender module 2 of the rapamycin PKS or extender
module 3 of the FK520 PKS, results in a hybrid PKS of the invention
useful in the production of 13-hydroxy epothilones. This
construction is carried out in a manner similar to that described
in part A of this example. The oligonucleotide primers for
amplifying the desired portions of the epoD gene, using plasmid
pKOS39-118B as a template, were: TABLE-US-00021 TL7:
5'-GCGCTCGAGAGCGCGGGTATCGCT; TL8: 5'-GAGATGCATCCAATGGCGCTCACGCT;
TL9: 5'-GCTCTAGAGCCGCGCGCCTTGGGGCGCT; and TL10:
5-GCAGATCTTGGGGCGCTGCCTGTGGAA.
[0491] The PCR fragment generated from primers TL7/TL8 was cloned
into vector LITMUS 28, and the resulting clone was digested with
restriction enzymes NsiI and BglII, and the 5.1 kb fragment was
isolated and ligated with the 2.2 kb PCR fragment generated from
TL9/TL10 treated with restriction enzymes BglII and XbaI and
ligated to the KR cassettes. The KR cassette from the FK520 PKS was
generated by PCR using primers TL31 and TL32 and then digestion
with restriction enzymes XbaI and PstI. These primers are shown
below: TABLE-US-00022 TL31: 5'-GGCTGCAGACCCAGACCGCGGGCGACGC; and
TL32: 5'-GCTCTAGAGGTGGCGCCGGCCGCCCGGCG.
[0492] The remainder of the strain construction proceeded
analogously to that described in part A of this Example, except
that Myxococcus xanthus K111-72.4.4 was used as the recipient. The
strain in which the KR domain of extender module 3 of the FK520 PKS
replaced the KR, DH, and ER domains of extender module 5 of the
epothilone PKS was designated K122-148 and deposited with the
American Type Culture Collection, Manassas, Va. 20110-2209, USA, on
Nov. 21, 2000, under the terms of the Budapest Treaty and is
available under accession No. PTA-2711. Strain K122-148 produces
.beta.-hydroxy-10,11-dehydro epothilone D as a major product and
the C derivative as a minor product whose structures are shown
below ##STR33##
[0493] A similar strain, designated K122-52, in which the KR domain
of extender module 2 of the rapamycin PKS was used for the
replacement, produced the same compounds. These compounds and the
strains and PKS enzymes that produce them are novel compounds,
strains, and PKS enzymes of the invention.
C. Production of 9-keto-epothilone Analogs
[0494] Inactivation of the KR domain of extender module 6 of the
epothilone PKS results in a novel PKS of the invention capable of
producing the 9-keto-epothilones. The KR domain can be inactivated
by site-specific mutagenesis by altering one or more conversed
residues. The DNA and amino acid sequence of the KR domain of
extender module 6 of the epothilone PKS is shown below:
TABLE-US-00023 36710 36720 36730 36740 36750
GACGGCACCTACCTCGTGACCGGCGGTCTGGGTGGGCTCGGTCTGA D G T Y L V T G G L
G G L G L> 36760 36770 36780 36790 36800
GCGTGGCTGGATGGCTGGCCGAGCAGGGGGCTGGGCATCTGGTGCTGGTG S V A G W L A E
Q G A G H L V L V> 36810 36820 36830 36840 36850
GGCCGCTCCGGTGCGGTGAGCGCGGAGCAGCAGACGGCTGTCGCCGCGCT G R S G A V S A
E Q Q T A V A A L> 36860 36870 36880 36890 36900
CGAGGCGCACGGCGCGCGTGTCACGGTAGCGAGGGCAGACGTCGCCGATC E A H G A R V T
V A R A D V A D> 36910 36920 36930 36940 36950
GGGCGCAGATCGAGCGGATCCTCCGCGAGGTTACCGCGTCGGGGATGCCG R A Q I E R I L
R E V T A S G M P> 36960 36970 36980 36990 37000
CTCCGCGGCGTCGTTCATGCGGCCGGTATCCTGGACGACGGGCTGCTGAT L R G V V H A A
G I L D D G L L M> 37010 37020 37030 37040 37050
GCAGCAAACCCCCGCGCGGTTCCGCGCGGTCATGGCGCCCAAGGTCCGAG Q Q T P A R F R
A V M A P K V R> 37060 37070 37080 37090 37100
GGGCCTTGCACCTGCATGCGTTGACACGCGAAGCGCCGCTCTCCTTCTTC G A L H L H A L
T R E A P L S F F> 37110 37120 37130 37140 37150
GTGCTGTACGCTTCGGGAGCAGGGCTCTTGGGCTCGCCGGGCCAGGGCAA V L Y A S C A G
L L C S P G Q G N> 37160 37170 37180 37190 37200
CTACGCCGCGGCCAACACGTTCCTCGACGCTCTGGCACACCACCGGAGGG Y A A A N T F L
D A L A H H R R> 37210 37220 37230 37240 37250
CGCAGGGGCTGCCAGCATTGAGCATCGACTGGGGCCTGTTCGCGGACGTG A Q G L P A L S
I D W G L F A D V> GGTTTG G L>
[0495] The DNA and amino acid sequence of the mutated and inactive
KR domain of extender module 6 of the novel 9-keto-epothilone PKS
provided by the present invention is shown below: TABLE-US-00024
36710 36720 36730 36740 36750
GACGGCACCTACCTCGTGACCGGCGCTCTGGGTGGGCTCGGTCTGA D G T Y L V T G A L
G G L G L> 36760 36770 36780 36790 36800
GCGTGGCTGGATGGCTGGCCGAGCAGGGGGCTGGGCATCTGGTGCTGGTG S V A G W L A E
Q G A G H L V L V> 36810 36820 36830 36840 36850
GGCCGCTCCGGTGCGGTGAGCGCGGAGCAGCAGACGGCTGTCGCCGCGCT G R S G A V S A
E Q Q T A V A A L> 36860 36870 36880 36890 36900
CGAGGCGCACGGCGCGCGTGTCACGGTAGCGAGGGCAGACGTCGCCGATC E A H G A R V T
V A R A D V A D> 36910 36920 36930 36940 36950
GGGCGCAGATCGAGCGGATCCTCCGCGAGGTTACCGCGTCGGGGATGCCG R A Q I E R I L
R E V T A S G M P> 36960 36970 36980 36990 37000
CTCCGCGGCGTCGTTCATGCGGCCGGTATCCTGGACGACGGGCTGCTGAT L R G V V H A A
G I L D D G L L M> 37010 37020 37030 37040 37050
GCAGCAAACCCCCGCGCGGTTCCGCGCGGTCATGGCGCCCAAGGTCCGAG Q Q T P A R F R
A V M A P K V R> 37060 37070 37080 37090 37100
GGGCCTTGCACCTGCATGCGTTGACACGCGAAGCGCCGCTCTCCTTCTTC G A L H L H A L
T R E A P L S F F> 37110 37120 37130 37140 37150
GTGCTGTACGCTTCGGGAGCAGGGCTCTTGGGCTCGCCGGGCCAGGGCAA V L Y A S G A G
L L G S P G Q G N> 37160 37170 37180 37190 37200
CTTCGCCACGGCCAACACGTTCCTCGACGCTCTGGCACACCACCGGAGGG F A T A N T F L
D A L A H H R R> 37210 37220 37230 37240 37250
CGCAGGGGCTGCCAGCATTGAGCATCGACTGGGGCCTGTTCGCGGACGTG A Q G L P A L S
I D W G L F A D V> GGTTTG G L>
[0496] The strain comprising this mutated KR domain coding sequence
was constructed generally as described in part A of this Example,
except that Myxococcus xanthus K111-72.4.4 was used as the
recipient. The strain in which the KR domain of extender module 6
was inactivated was designated K39-164 and deposited with the
American Type Culture Collection, Manassas, Va. 20110-2209, USA, on
Nov. 21, 2000, under the terms of the Budapest Treaty and is
available under accession No. PTA-2716. Strain K39-164 produces
9-keto-epothilone D as a major product and the C derivative as a
minor product whose structures are shown below ##STR34## These
compounds and the strain and PKS enzymes that produce them are
novel compounds, strain, and PKS enzymes of the invention. D.
Production of 2-methyl-epothilone Analogs
[0497] The 2-methyl-epothilone analogs of epothilones A, B, C, and
D can be constructed by replacing the coding sequence for the
extender module 9 AT domain ("epoAT9") with coding sequences for an
AT domain specific for methylmalonyl CoA. Suitable replacement AT
domain coding sequences can thus be obtained from, for example, the
genes that encode extender module 2 of the FK520 PKS ("FKAT2"; see
PCT Pub. No. 00/020601, incorporated herein by reference); extender
module 2 of the epothilone PKS ("epoAT2"); and extender module 3 of
the PKS encoded by the tmbA genes ("tmbAT3"; see U.S. Pat. No.
6,090,601 and U.S. patent application Ser. No. 60/271,245, filed 15
Feb. 2001, each of which is incorporated herein by reference). The
replacements are performed generally as described above, and the
particular epothilones produced depend merely upon what epothilones
are produced by the Myxococcus host in which the replacement is
conducted.
[0498] Thus, the epoAT9 coding sequence (from nucleotide 50979 to
nucleotide 52026) is replaced by either epoAT2 (nucleotide 12251 to
nucleotide 13287) or FKAT2, or tmbAT3 coding sequences with
engineered BglII (AGATCT) and NsiI (ATGCAT) restriction enzyme
recognition sequences at junctions.
[0499] A first PCR is used to generate an .about.1.6 kb fragment
from pKOS39-125 DNA used as template. The PCR fragment is subcloned
into vector LITMUS28 at the HindIII and BglII sites and sequenced;
a plasmid with the desired sequence is designated P1. The
oligonucleotides used in this PCR are: TABLE-US-00025 TLII-1:
5'-ACAAGCTTGCGAAAAAGAACGCGTCT; and TLII-2:
5'-CGAGATCTGCCGGGCGAGGAAGCGGCCCTG.
[0500] A second PCR is used to generate an .about.1.9 kb fragment
using pKOS39-125 DNA as template. The PCR fragment is subcloned
into vector LITMUS28 at the NsiI and SpeI sites and sequenced; a
plasmid with the desired sequence is designated P2. The
oligonucleotides used in this PCR are: TABLE-US-00026 TLII-3B:
5'-GCATGCATGCGCCGGTCGATGGTGAG; and TLII-4:
5'-AGACTAGTCACCGGCTGGCCCACCACAAGG.
[0501] Plasmid P1 is then digested with restriction enzymes BglII
and SpeI, and the 4.5 kb fragment is isolated and ligated with the
.about.1.9 kb NsiI-SpeI restriction fragment from plasmid P2 and
with one of the three replacement AT fragments (FKAT2, epoAT2,
tmbAT3) isolated as NsiI-BglII restriction fragments to obtain
plasmids P3.1, P3.2, and P3.3. The replacement AT fragments are
generated by PCR using the following oligonucleotide primers:
[0502] for FKAT2: TABLE-US-00027 for FKAT2: TLII-20:
5'-GCATGCATCCAGTAGCGGTCACGGCGGA; and TLII-21:
5'-CGAGATCTGTGTTCGCGTTCCCCGGGCAG; for tmbAT3: TLII-13:
5'-GCATGCATCCAGTAGCGCTGCCGCTGGAAT; and TLII-14:
5'-GCAGATCTGTGTTCGTGTTCCCCGGCCA; and for epoAT2: TLII-17:
5'-GCATGCATCCAGTACCGCTCGCGCTG; and TLII-18:
5'-CGAGATCTGTCTTCGTCTTTCCCGGCCAG.
[0503] Plasmids P3.1, P3.2, and P3.3 are then modified by insertion
at the DraI site of the kan-gal cassete. The resulting plasmids are
transformed into an epothilone-producing Myxococcus xanthus host
cell of the invention (i.e., K111-72.4.4), and the cells are
cultured and selected for the double-crossover recombination event
as described above. Selected colonies are screened by PCR. Colonies
exhibiting the desired recombination event are cultured in 50 mL
cultures and screened by LC/MS for production of the desired
compound. The expected products are 2-methyl-epothilone D and
2-methyl-epothilone C whose structures are shown below. ##STR35##
E. Production of 6-desmethyl-epothilone Analogs
[0504] The 6-desmethyl-epothilone analogs of epothilones A, B, C,
and D can be constructed by replacing the coding sequence for the
extender module 7 AT domain ("epoAT7") with coding sequences for an
AT domain specific for malonyl CoA. Suitable replacement AT domain
coding sequences can thus be obtained from, for example, the genes
that encode extender module 3 of the FK520 PKS; extender module 5
of the epothilone PKS ("epoAT5"); and extender module 4 of the PKS
encoded by the tmbA genes, each of which is incorporated herein by
reference). The replacements are performed generally as described
above, and the particular epothilones produced depend merely upon
what epothilones are produced by the Myxococcus host in which the
replacement is conducted.
[0505] Thus, the epoAT7 coding sequence (from nucleotide 39585 to
nucleotide 40626) is replaced by either epoAT5 (nucleotide 26793 to
nucleotide 27833) or FKAT3, or tmbAT4 coding sequences with
engineered BglII (AGATC7) and NsiI (ATGCAT) restriction enzyme
recognition sequences at junctions.
[0506] A first PCR is used to generate an .about.1.8 kb fragment
from pKOS39-125 DNA used as template. The PCR fragment is subcloned
into vector LITMUS28 at the NsiI and SpeI sites and sequenced; a
plasmid with the desired sequence is designated P4. The
oligonucleotides used in this PCR are: TABLE-US-00028 TLII-5:
5'-GGATGCATGTCGAGCCTGACGCCCGCCG; and TLII-6:
5'-GCACTAGTGATGGCGATCTCGTCATCCGCCGCCAC.
[0507] A second PCR is used to generate an .about.2.1 kb fragment
using pKOSO39-118B DNA as template. The oligonucleotides used in
this PCR are: TABLE-US-00029 TL16: ACAGATCTCGGCGCGCTGCCGCCGGAG; and
TL15: GGTCTAGACTCGAACGGCTCGCCACCGC.
[0508] The PCR fragment is subcloned into LITMUS 28 at the EcoRV
restriction site, and a plasmid with the desired sequence is
identified by sequencing and designated as plasmid pKOS122-4.
Plasmid pKOS122-4 is then digested with restriction enzymes BglII
and SpeI, and the 4.8 kb fragment is isolated and ligated with the
.about.1.8 kb NsiI-SpeI restriction fragment from plasmid P4 and
with one of the three replacement AT fragments (FKAT3, epoAT5,
tmbAT4) isolated as NsiI-BglII restriction fragments to obtain
plasmids P5.1, P5.2, and P5.3. The replacement AT fragments are
generated by PCR using the following oligonucleotide primers:
[0509] for FKAT3: TABLE-US-00030 for FKAT3: TLII-11:
5'-GTATGCATCCAGTAGCGGACCCGCTCGA; and TLII-12:
5'-GCAGATCTGTGTGGCTCTTCTCCGGACA; for tmbAT4: TLII-15;
5'-GCATGCATCCAGTAGCGCTGCCGCTGGAAC; and TLII-16;
5'-GGAGATCTGCGGTGCTGTTCACGGGGCA; and for PCR epoAT5: TLII-19;
5'-GTAGATCTGCTTTCCTGTTCACCGGACA; and TL8 (see part B of this
Example).
[0510] Plasmids P5.1, P5.2, and P5.3 are then modified by insertion
at the DraI site of the kan-gal cassete. The resulting plasmids are
transformed into an epothilone-producing Myxococcus xanthus host
cell of the invention (i.e., K11-72.4.4), and the cells are
cultured and selected for the double-crossover recombination event
as described above. Selected colonies are screened by PCR. Colonies
exhibiting the desired recombination event are cultured in 50 mL
cultures and screened by LC/MS for production of the desired
compound. The expected compounds are 6-desmethyl-epothilone D and
6-desmethyl-epothilone C whose structures are shown below.
##STR36## F. Production of 10-methyl-epothilone Analogs
[0511] The 10-methyl-epothilone analogs of epothilones A, B, C, and
D can be constructed by replacing the coding sequence for the
extender module 5 AT domain ("epoAT5") with coding sequences for an
AT domain specific for methylmalonyl CoA. Suitable replacement AT
domain coding sequences can thus be obtained from, for example, the
genes that encode extender module 2 of the FK520 PKS, incorporated
herein by reference); extender module 2 of the epothilone PKS
("epoAT2"); and extender module 3 of the PKS encoded by the tmbA
genes. The replacements are performed generally as described above,
and the particular epothilones produced depend merely upon what
epothilones are produced by the Myxococcus host in which the
replacement is conducted.
[0512] Thus, the epoAT5 coding sequence (from nucleotide 26793 to
nucleotide 27833) is replaced by either epoAT2 (nucleotide 12251 to
nucleotide 13287) or FKAT2, or tmbAT3 coding sequences with
engineered BglII (AGATCT) and NsiI (ATGCAT) restriction enzyme
recognition sequences at junctions.
[0513] The PCR fragment generated from primers TL11 and TL12 using
plasmid pKOS39-118B as a template is cloned into vector LITMUS 28.
The PCR primers used are: TABLE-US-00031 TL11:
5'-GGATGCATCTCACCCCGCGAAGCG; and TL12:
5'-GTACTAGTCAAGGGCGCTGCGGAGG.
[0514] A plasmid containing the desired insert is identified by DNA
sequencing. This plasmid is then digested with restriction enzymes
NsiI and XbaI, and the 4.6 kb fragment isolated. This fragment is
ligated with the 2.0 kb PCR fragment obtained from primers TL5 and
TL6 (described in Section A of this Example) that has been digested
with restriction enzymes BglII and XbaI and with one of the three
replacement AT fragments (FKAT2, epoAT2, tmbAT3) isolated as
NsiI-BglII restriction fragments to obtain plasmids P6.1, P6.2, and
P6.3. These latter three plasmids are then modified by insertion at
the DraI site of the kan-gal cassete. The resulting plasmids are
transformed into an epothilone-producing Myxococcus xanthus host
cell of the invention (i.e., K111-72.4.4), and the cells are
cultured and selected for the double-crossover recombination event
as described above. Selected colonies are screened by PCR. Colonies
exhibiting the desired recombination event are cultured in 50 mL
cultures and screened by LC/MS for production of the desired
compound. The expected compounds are 10-methyl-epothiklone D and
10-methyl-epothilone C whose structures are shown below ##STR37##
G. Production of 14-methyl-epothilone Analogs
[0515] The 14-methyl-epothilone analogs of epothilones A, B, C, and
D can be constructed by replacing the coding sequence for the
extender module 3 AT domain ("epoAT3") with coding sequences for an
AT domain specific for methylmalonyl CoA. Suitable replacement AT
domain coding sequences can thus be obtained from, for example, the
genes that encode extender module 2 of the FK520 PKS; extender
module 2 of the epothilone PKS ("epoAT2"); and extender module 3 of
the PKS encoded by the tmbA genes. The replacements are performed
generally as described above, and the particular epothilones
produced depend merely upon what epothilones are produced by the
Myxococcus host in which the replacement is conducted.
[0516] Thus, the epoAT3 coding sequence (from nucleotide 17817 to
nucleotide 18858) is replaced by either epoAT2 (nucleotide 12251 to
nucleotide 13287) or FKAT2, or tmbAT3 coding sequences with
engineered BglII (AGATCT) and NsiI (ATGCAT) restriction enzyme
recognition sequences at junctions.
[0517] A first PCR is used to generate an .about.1.8 kb fragment
from pKOS39-124 DNA used as template. The PCR fragment is subcloned
into vector LITMUS28 at the XbaI and BglII sites and sequenced; a
plasmid with the desired sequence is designated P9. The
oligonucleotides used in this PCR are: TABLE-US-00032 TLII-7:
5'-GCAGATCTGCCGCGCGAGGAGCTCGCGAT; and TLII-8:
5'-CATCTAGAGCCGCTCCTGTGGAGTCAC.
[0518] A second PCR is used to generate an 1.9 kb fragment using
pKOS39-124 DNA used as template. The PCR fragment is subcloned into
vector LITMUS28 at the NsiI and SpeI sites and sequenced; a plasmid
with the desired sequence is designated P10. The oligonucleotides
used in this PCR are: TABLE-US-00033 TLII-9B:
5'-GGATGCATGCGCCGGCCGAAGGGCTCGGAG; and TLII-10:
5'-GCACTAGTGATGGCGATCGGGTCCTCTGTCGC.
[0519] Plasmid P9 is then digested with restriction enzymes BglII
and SpeI, and the 4.5 kb fragment is isolated and ligated with the
.about.1.9 kb NsiI-SpeI restriction fragment from plasmid P10 and
with one of the three replacement AT fragments (FKAT2, epoAT2,
tmbAT3) isolated as NsiI-BglII restriction fragments to obtain
plasmids P11.1, P11.2, and P11.3. These latter three plasmids are
then modified by insertion at the DraI site of the kan-gal cassete.
The resulting plasmids are transformed into an epothilone-producing
Myxococcus xanthus host cell of the invention (i.e., K111-72.4.4),
and the cells are cultured and selected for the double-crossover
recombination event as described above. Selected colonies are
screened by PCR. Colonies exhibiting the desired recombination
event are cultured in 50 mL cultures and screened by LC/MS for
production of the desired compound. The expected compounds are
14-methyl-epothilone D and 14-methyl-epothilone C whose structures
are shown below ##STR38## H. Production of 10,11-dehydro-epothilone
Analogs
[0520] In one embodiment, the present invention provides a novel
epothilone, 10,11-dehydro-epothilone D, and a recombinant host
cells that produces this compound. The structure of 10,
11-dehydro-epothilone D is shown below. ##STR39##
[0521] In another embodiment, the present invention provides a
method for making any 10,11-dehydro-epothilone analogs by
inactivation of the ER domain of extender module 5 of the
epothilone PKS that produces the corresponding epothilone.
[0522] In one embodiment, a strain that produces 10,
11-dehydroepothilone D is constructed by inactivating the enoyl
reductase (ER) domain of extender module 5. In one embodiment, the
ER inactivation is accomplished by changing the two glycines
(-Gly-Gly-) in the NADPH binding region to an alanine and serine
(-Ala-Ser-). The 2.5 kb BbvCI-HindIII fragment from plasmid
pKOS39-118B (a subclone of the epoD gene from cosmid pKOS35-70.4)
has been cloned into pLitmus28 as pTL7 which is used as a template
for site directed mutagenesis. The oligonucleotide primers for
introducing the -Gly-Gly- to -Ala-Ser-mutations into the NADPH
binding domain are: TABLE-US-00034 TLII-22,
5'-TGATCCATGCTGCGGCCGGCGTGGGCATGGCCGC. TLII-23,
5'-GCGGCCATGCCCACGCCGGCCGCAGCATGGATCA.
[0523] The PCR clones containing the substitutions are confirmed by
sequencing and are digested with the restriction enzyme DraI and
treated with shrimp alkaline phosphatase. Then, the large fragment
of each clone is ligated with the kanamycin resistance and galK
gene (KG or kan-gal) cassette to provide the delivery plasmids. The
delivery plasmids are transformed into the epothilone D producer M.
xanthus K111-72-4.4 or K111-40-1 by electroporation. The
transformants are screened and kanamycin-sensitive,
galactose-resistant survivors are selected to identify clones from
which the KG genes have been eliminated. Confirmation of the KG
elimination and the desired gene replacement for the recombinant
strains is performed by PCR. The recombinant strains are fermented
in flasks with 50 mL of CTS medium (casitone, 5 g/L; MgSO4, 2 g/L;
L-alanine, 1 mg/L; L-serine, 1 mg/L; glycine, 1 mg/L; and HEPES
buffer, 50 mM) and 2% XAD-16 for 7 days, and
10,11-dehydro-epothilone D is eluted from the XAD resin with 10 mL
of methanol.
I. Production of Oxazole-Containing Epothilones by Fermentation
[0524] In one embodiment, the present invention provides a method
for obtaining the oxazole containing epothilones (in which the
thiazole moiety of the corresponding epothilone is replaced by an
oxazole) by fermenting an epothilone producing strain, such as a
Sorangium cellulosum strain or a Myxococcus strain provided by the
present invention, in media supplemented with L-serine.
[0525] To illustrate this aspect of the invention, a cultures of
Myxococcus xanthus strain K11140.1 or K111-72.4.4 is fermented in
accordance with the methods of Example 3, except that L-serine is
present at 11.times., 51.times., 101.times., and 201.times. the
basal serine concentration in the batch media (2.3 mM). The batch
media-containing 50 mL cultures thus contain: 20 g/L XAD-16; 5 g/L
casitone; 2 g/L MgSO4; 7 mL/L methyl oleate; and 4 mL/L trace
metals solution, and an appropriate concentration of a
filter-sterilized 1.25 M solution of L-serine is added. The batch
titers observed in basal media were: Epo C, 0.4 mg/L, Epo D: 2
mg/L, Epo H1 (the C analog of the oxazole): Not detectable, and Epo
H2 (the D analog of the oxazole): 0.02 mg/L. Increasing the serine
concentration decreased the epoC and epoD concentrations (almost to
undetectable levels at 51.times. supplementation). Thus, the batch
titers in 51.times. supplementation of L-serine in basal media
were: Epo C, 0.03 mg/L, Epo D: 0.05 mg/L, Epo H1:0.12 mg/L, and Epo
H2:0.13 mg/L. A fed-batch protocol could increase the observed
titers by about 10 fold.
J. Construction of Epothilone Analogs
[0526] In one embodiment, the present invention provides
epothilones and epothilone derivatives produced by recombinant
epothilone PKS enzymes of the invention in which (i) the
specificity of the extender module 1 NRPS has been changed from
cysteine to another amino acid; (ii) the loading domain has been
changed to an NRPS or CoA ligase; or (iii) both (i) and (ii). This
example describes how such recombinant epothilone PKS enzymes of
the invention are constructed; references cited in this example are
listed at the end of this example and are referred to in the text
by a citation number and are incorporated herein by reference.
[0527] Epothilones contain the amino acid cysteine that has been
cyclized and oxidized to form the thiazole. Two other amino acids,
serine and threonine, can undergo similar cyclization and oxidation
to yield an oxazole and methyloxazole, respectively. For example,
the oxazole and methyloxazole derivatives of epothilone D are shown
below ##STR40##
[0528] To construct analogs of epothilone with either the oxazole
or methyloxazole, engineering of extender module 1, the NRPS
module, can be performed. NRPS modules that extend a growing
molecule are minimally composed of a domain that activates an amino
acid, the adenylation domain, a PCP or peptidyl carrier protein
domain, which tethers the amino acid to the NRPS, and a
condensation domain, which condenses the amino acid to a carboxyl
group of the growing molecule to form a peptide bond (5, 7). The
recognition sequence for determining the specificity of the amino
acid is found within the adenylation domain, specifically between
the A4 and A5 consensus sequence (4). Analysis of the region has
shown that key amino acids in this protein region can predict which
amino acid will be used by the NRPS (2, 8). Experiments have been
performed that exchange the complete NRPS adenylation region for
that of another, which results in a hybrid NRPS that has the amino
acid specificity of the new adenylation domain (6, 9). Experiments
using smaller regions of the adenylation region, such as the one
between the A4 and A5 consensus sequence have not been reported. In
one embodiment, a hybrid PKS of the invention is constructed by
replacing the region between the A4 and A5 consensus region of the
adenylation domain from epoB with those from vibF and blm VII,
which utilize threonine, and with the NRPS4 region from blm VI of
the bleomycin gene cluster, which utilizes serine (3).
[0529] Recent experiments suggest that the condensation domain may
be able to detect if an incorrect amino acid has been attached to
the PCP (1). Once an incorrect amino acid is detected the
efficiency of the condensation reaction is reduced. To avoid this,
in addition to swapping the adenylation domain, one can also bring
along the cognate condensation domain in order to change the
specificity of the adenylation domain and engineer a fully active
NRPS.
[0530] The present invention also provides recombinant epothilone
PKS enzymes that produce the 16 desmethyl derivatives of the
oxazole and methyloxazole forms of epothilone. Such enzymes are
constructed by changing the AT domain of extender module 2, epoC,
from methymalonyl specific to malonyl specific. AT domains that can
be used to make the constructs include those from extender module 5
and 9 of the epothilone cluster and extender modules 2 and 4 from
the soraphen gene cluster.
[0531] The present invention also provides recombinant PKS enzymes
in which the EpoA protein has been replaced by an NRPS. The present
invention also provides the novel epothilones produced by such
enzymes. Epothilone biosynthesis begins by the loading of malonate
onto the ACP of the loading module, EpoA. This malonate is
subsequently decarboxylated by the KS domain and then transferred
as an acetyl moiety to EpoB, the NRPS module. After the molecule
has been acted on by EpoB, the resulting compound is
2-methylthiazole.
[0532] To make analogs that have an amino acid attached at the 2
position on the thiazole, deletion of epoA and the insertion of a
NRPS module are needed. Any NRPS module can be used; however, to
make the most conservative change, one can employ an NRPS module to
replace epoA that naturally communicates with a downstream NRPS
module. Moreover, because the NRPS replacing epoA is the loading
module, it does not need a condensation domain. This can be done by
taking an extender NRPS module and removing the condensation domain
or using an NRPS that is naturally a loading module and thus lacks
the condensation domain. An illustrative NRPS loading module is the
one from safB, which utilizes alanine and is from a M. xanthus.
[0533] In constructing M. xanthus strains that contain the sajB
loading module in the place of epoA, one can determine the optimum
boundaries for the new loading module and epoB. The linker region
between PKS proteins is often critical for "communication" between
those proteins. One can construct three different strains to
examine the optimum linker. In the first, the ACP domain of EpoA is
fused to the adenylation domain of loading domain of safB. This
construct requires that the ACP of EpoA function as a PCP. Although
PCP and ACP domains are functionally similar, they do not show high
sequence identity and thus may be restricted on what they can
recognize and bind. The second construct fuses the last several
amino acids of EpoA downstream of the PCP domain of the SafB
loading module, thus providing the necessary linker region for the
hybrid loading module to "communicate" with EpoB. Finally, a fusion
of the SafB loading module with EpoB will be constructed. Because
SafB is composed of two modules, it is possible to take all of the
loading module of SafB and fuse it directly to EpoB to give a
fusion protein, which should optimal for communication between the
SafB loading module and EpoB.
[0534] Once SafB or any another loading NRPS domain has been used
to replace the 2-methyl on the thiazole of epothilone with an amino
acid, then changes can be made in the new loading NRPS module so
that any amino acid could be used to start the synthesis of the
epothilone analogs. A comprehensive list of potential amino acids
and their corresponding NRPS modules that could be used for these
swaps are provide by Challis et al. (2).
[0535] All of the replacements can be made in K111-32.25, the M.
xanthus strain that contains the epothilone genes, or K111-40-1,
the M. xanthus strain that contains the epothilones genes and in
which the epoK gene does not produce a functional product, or any
other epothilone producing strain of the invention or in Sorangium
cellulosum. In Myxococcus, the appropriate constructs can be made
on plasmids and, using the galK and kanamycin selection, used to
replace the wild type genes with the engineered ones. For example,
a replacement of the NRPS in K111-40-1 with an NRPS specific for
serine is expected to make the 2-methyl-oxazole derivative of
epothilone D and 2-methyl-oxazole derivative of epothilone C as the
major and minor products respectively. The structure of these
compounds are shown below ##STR41##
[0536] Replacement of the NRPS in K111-40-1 with an NRPS specific
for threonine is expected to the the following compounds and the
major and minor products respectively ##STR42##
[0537] Replacement of the NRPS in K111-40-1 with an NRPS specific
for glycine, alanine, glutamic acid, aspartic acid, phenylalanine,
histidine, isoleucine, leucine, methionine, asparagine, glutamine,
arginine, valine, and tyrosine are each expected to make the
following compounds as the major and minor products respectively
##STR43## where R' corresponds to the specific side chain in the
amino acid (for example, R' is H in the general amino acid formula
NH.sub.2--CHR'COOH for glycine and is methyl for alanine and so
on).
[0538] Replacement of the NRPS in K111-40-1 with an NRPS specific
for proline is expected to make the following compounds as the
major and minor products respectively ##STR44##
[0539] The references cited in this subsection are as follows.
[0540] 1 Belshaw et al. 1999. Aminoacyl-CoAs as probes of
condensation domain selectivity in nonribosomal peptide synthesis
Science. 284:486-9. [0541] 2. Challis et al. 2000. Predictive,
structure-based model of amino acid recognition by nonribosomal
peptide synthetase adenylation domains Chem Biol. 7:211-24. [0542]
3. Du et al. 2000. The biosynthetic gene cluster for the antitumor
drug bleomycin from Streptomyces verticillus ATCC15003 supporting
functional interactions between nonribosomal peptide synthetases
and a polyketide synthase Chem Biol. 7:623-42. [0543] 4. Konz et
al. 1999. How do peptide synthetases generate structural diversity?
Chem Biol. 6:R39-48. [0544] 5. Marahiel et al. 1997. Modular
peptide synthetases involved in non-ribosomal peptide synthesis
Chem. Rev. 97:2651-2673. [0545] 6. Schneider et al. 1998. Targeted
alteration of the substrate specificity of peptide synthetases by
rational module swapping Mol Gen Genet. 257:308-18. [0546] 7.
Stachelhaus et al. 1995. Modular structure of peptide synthetases
revealed by dissection of the multifunctional enzyme GrsA J Biol
Chem. 270:6163-9. [0547] 8. Stachelhaus et al. 1999. The
specificity-conferring code of adenylation domains in nonribosomal
peptide synthetases Chem Biol. 6:493-505. [0548] 9. Stachelhaus et
al. 1995. Rational design of peptide antibiotics by targeted
replacement of bacterial and fungal domains Science. 269:69-72.
EXAMPLE 12
Biological Activity
[0549] 10,11-dehydroepothilone D was screened for anticancer
activity in four different human tumor cell lines using
sulforhodamine B (SRB) assay. 10,11-dehydroepothilone D shows
growth inhibitory effect on all four cell lines with IC.sub.50s
ranging from 28 nM to 40 nM. The mechanism of action was determined
by a cell-based tubulin polymerization assay which revealed that
the compound promotes tubulin polymerization. Human cancer cell
lines MCF-7 (breast), NCI/ADR-Res (breast, MDR), SF-268 (glioma),
NCI-H460 (lung) were obtained from National Cancer Institute. The
cells were maintained in a 5% CO2-humidified atmosphere at 37
degree in RPMI 1640 medium (Life Technology) supplemented with 10%
fetal bovine serum (Hyclone) and 2 mM L-glutamine.
[0550] Cytotoxicity of 10, 11-dehydroepothilone D was determined by
SRB assay (Skehan et al., J. Natl. Cancer Inst. 82: 1107-1112
(1990) which is incorporated herein by reference). Cultured cells
were trypsinized, counted and diluted to the following
concentrations per 100 .mu.l with growth medium: MCF-7, 5000;
NCI/ADR-Res, 7500; NCI-H460, 5000; and, SF-268, 7500. The cells
were seeded at 100 .mu.l/well in 96-well microtiter plates. Twenty
hours later, 100 .mu.l of 10, 11-dehydroepothilone D (ranging from
1000 nM to 0.001 nM diluted in growth medium) were added to each
well. After incubation with the compound for 3 days, the cells were
fixed with 100 .mu.l of 10% trichloric acid ("TCA") at 4 degree for
1 hour, and stained with 0.2% SRB/1% acetic acid at room
temperature for 20 minutes. The unbound dye was rinsed away with 1%
acetic acid, and the bound SRB was then extracted by 200 .mu.l of
10 mM Tris base. The amount of bound dye was determined by OD 515
nm, which correlates with the total cellular protein contents. The
data were then analyzed using Kaleida Graph program and the
IC.sub.50's calculated. Epothione D that was chemically synthesized
was tested in parallel for comparison.
[0551] For tubulin polymerization assay, MCF-7 cells were grown to
confluency in 35 mm-culture dishes and treated with 1 .mu.M of
either 10, 11-dehydroepothilone D or epothilone D for 0, 1 or 2
hours at 37 degree (Giannakakou et al., J. Biol. Chem.
271:17118-17125 (1997); Int. J. Cancer 75: 57-63 (1998) which are
incorporated herein by reference). After washing the cells twice
with 2 ml of PBS without calcium or magnesium, the cells were lysed
at room temperature for 5-10 minutes with 300 .mu.l of lysis buffer
(20 mM Tris, PH 6.8, 1 mM MgCl.sub.2, 2 mM EGTA, 1% Triton X-100,
plus protease inhibitors). The cells were scraped and the lysates
transferred to 1.5-ml Eppendof tubes. The lysates were then
centrifuged at 18000 g for 12 minutes at room temperature. The
supernatant containing soluble or unpolymerized (cytosolic) tubulin
were separated from pellets containing insoluble or polymerized
(cytoskeletal) tubulin and transferred to new tubes. The pellets
were then resuspended in 300 .mu.l of lysis buffer. Changes in
tubulin polymerization in the cell were determined by analyzing
same volume of aliquots of each sample with SDS-PAGE, followed by
immunoblotting using an anti-tubulin antibody (Sigma).
[0552] The results of several experiments showed that 10,
11-dehydroepothilone D (designated as "Epo490") has an IC.sub.50 in
the range of 28 nM to 40 nM against four different human tumor
cells lines. TABLE-US-00035 TABLE 13 EpoD (nM) Epo490 (nM) Cell
lines N = 3 N = 2 MCF-7 21 .+-. 10 28 .+-. 8 NCI/ADR 40 .+-. 12 35
.+-. 9 SF-268 34 .+-. 8 40 .+-. 5 NCI-H460 30 .+-. 2 34 .+-. 1
Tubulin polymerization assays reveal that 10, 11-dehydroepothilone
D has the same mechanism of action as epothilone D. In MCF-7 cells,
10, 11-dehydroepothilone D strongly promoted tubulin polymerization
at the conditions tested, with similar kinetics and effect as
epothilone D. Other compounds of the invention may be tested in a
similar manner by replacing the compound of interest for 10,
11-dehydroepothilone D.
EXAMPLE 13
Oxazole Derivatives
[0553] This example describes modulating the types of epothilone
compounds produced by host cells using fermentation conditions. By
supplementing host cells with excess serine, the compounds normally
produced by host cells are modulated in such a way to favor the
production of the oxazole counterparts. For example, cells that
predominantly produce a compound or compounds of formula V can be
made to favor the production of oxazole counterparts corresponding
to compounds of formula VI.
[0554] In one embodiment, M. xanthus strain K111-40-1, a strain
that predominantly makes epothilones C and D is made to
significantly increase the production of epothilones H.sub.1 and
H.sub.2, the oxazole counterparts to epothilones C and D. Strain
K111-40-1 (PTA-2712) was deposited in the American Type Culture
Collection ("ATCC"), 10801 University Blvd., Manassas, Va.,
20110-2209 USA on Nov. 21, 2000. Strain K111-40-1 was grown in
medium that was either supplemented or not supplemented with
additional serine. The final concentrations of the components in
unsupplemented medium were: hydrolyzed casein (pancreatic digest,
purchased from Difco under the brand name Casitone), 5 g/L;
MgSO4.7H.sub.2O, 2 g/L; XAD-16, 20 g/L; trace elements solution 4
mL/L; methyl oleate 7 ml/L; and Hepes buffer, 40 mM (titrated to a
pH of 7.6 with KOH). Trace elements solution comprises:
concentrated H.sub.2SO.sub.4, 10 mL/L; FeCl.sub.3.6H.sub.2O, 14.6
g/L; ZnCl.sub.2, 2.0 g/L; MnCl.sub.2.4H.sub.2O, 1.0 g/L;
CuCl.sub.2.2H.sub.2O, 0.42 g/L; H.sub.3BO.sub.3, 0.31 g/L;
CaCl.sub.2.6H.sub.2O, 0.24 g/L; and Na.sub.2MoO.sub.4.2H.sub.2O,
0.24 g/L. The basal level of serine was taken as 4.82% w/w, the
value determined by Difco' amino acid analysis of the particular
lot of Casitone. Consequently, the basal serine concentration was
2.3 mM, a value calculated from the final concentration of 5 g/L of
Casitone in the medium. Serine supplemented medium contained a
fifty fold higher concentration of serine, 117 mM.
[0555] Cells were grown in flasks at 30.degree. C. for 120 hours on
a coffin shaker at 250 rpm. Compounds produced by the strains
during fermentation were extracted by capturing the resin, washing
the resin once in water, and the extracting the compounds in the
resin for 30 minutes in 20 mL of methanol. The samples were
analyzed on HPLC and by mass spectroscopy.
[0556] Analysis of the compounds produced by cells showed that a
fifty fold increase in serine levels resulted in a 30 fold increase
in the production of epothilone H.sub.1 (0.12 mg/L) and a 5 fold
increase in the production of epothilone H.sub.2 (0.12 mg/L) over
that produced by cells grown in medium that was not supplemented
with serine. Notably, the cells produced almost undetectable
quantities of epothilones C and D (<50 .mu.g/L).
[0557] The concomitant increase in oxazole-containing compounds and
the decrease in thiazole-containing compounds from serine feeding
provides a way to obtain the oxazole compounds from host cells that
normally would make the thiazole-containing counterparts. For
example, the recombinant construct to make 9-oxo epothilone D (as
decribed in subpart C of Example 11) can be grown in conditions
similar to that described above to make
17-des(2-methyl-4-thiazolyl)-17-(2-methyl-4-oxazolyl)-9-oxo-epothilone
D, the oxazole-counterpart to 9-oxo-epothilone D. Similarly, other
recombinant constructs of the invention including those described
by Example 11 can be grown with excess serine to provide the
corresponding oxazole compounds.
EXAMPLE 14
Microbial Transformation of C-21 Methyl to C-21 Hydroxymethyl
[0558] This example describes the microbial transformation of C-21
methyl to C-21 hydroxymethyl of compounds of formula I where Ar is
##STR45## A frozen vial (approximately 2 ml) of Amycolata
autotrophica ATCC 35203 or Actinomyces sp. strain PTA-XXX as
described by PCT Publication No. WO 00/39276 is used to inoculate 1
500 ml flask containing 100 mL of medium. The vegetative medium
consists of 10 g of dextrose, 10 g of malt extract, 10 g of yeast
extract, and 1 g of peptone in liter of deionized water. The
vegetative culture is incubated for three days at 28.degree. C. on
a rotary shaker operating at 250 rpm. One mL of the resulting
culture is added to each of sixty-two 500 mL flasks containing the
transformation medium which as the same composition as the
vegetative medium. The cultures are incubated at 28.degree. C. and
250 rpm for 24 hours. A suitable compound of the invention is
dissolved in 155 ml of ethanol and the solution is distributed to
the sixty-two flasks. The flasks are then returned to the shaker
and incubated for an additional 43 hours at 28.degree. C. and 250
rpm. The reaction culture is then processed to recover 21-hydroxy
counterpart of the starting compound.
EXAMPLE 15
Epoxidation Using EpoK
[0559] This example describes the enzymatic epoxidation of
compounds of formula I where R.sup.8 and R.sup.10 together form a
carbon carbon double bond (desoxy compounds of the invention). The
epoK gene product was expressed in E. coli as a fusion protein with
a polyhistidine tag (his tag) and purified as described by PCT
publication, WO 00/31247 which is incorporated herein by reference.
The reaction consists of 50 mM Tris (pH7.5), 21 .mu.M spinach
ferredoxin, 0.132 units of spinach ferredoxin: NADP.sup.+
oxidoreductase, 0.8 units of glucose-6-phosphate dehydrogenase, 1.4
mM NADP, and 7.1 mM glucose-6-phosphate, 100 .mu.M or 200 .mu.M
desoxy compound of the present invention, and 1.7 .mu.M amino
terminal histidine tagged EpoK or 1.6 .mu.M carboxy terminal
histidine tagged EpoK in a 100 .mu.L volume. The reactions are
incubated at 30.degree. C. for 67 minutes and stopped by heating at
90.degree. C. for 2 minutes. The insoluble material is removed by
centrifugation, and 50 .mu.L of the supernatant containing the
desired product is analyzed by LC/MS.
EXAMPLE 16
Chemical Epoxidation
[0560] This example describes the chemical epoxidation of a
compound of formula I where R.sup.8 and R.sup.10 together form a
carbon carbon double bond (desoxy compound of the invention). A
solution of dimethyldioxirane (0.1 M in acetone, 17 mL) is added
dropwise to a solution of a desoxy compound of the invention (505
mg) in 10 mL of CH.sub.2Cl.sub.2 at -78.degree. C. The mixture is
warmed to -50.degree. C., kept for 1 hour, and then another portion
of dimethyldioxirane solution (5 mL) is added and the reaction is
continued for an additional 1.5 hour at -50.degree. C. The reaction
is then dried under a stream of N.sub.2 at -50.degree. C. The
product is purified by flash chromatography on SiO.sub.2.
EXAMPLE 17
(3S,6R,7S,8R,12R, 13S, 15S,
16E)-15-amino-3,7-dihydroxy-5,9-dioxo-2,13-epoxy-4,4,6,8,12,16-hexamethyl-
-17-(2-methylthiazol-4-yl)-16-heptadecenoic acid
[0561] ##STR46##
[0562] Step 1. 9-oxoepothilone B. A solution of dimethyldioxirane
(0.1 M in acetone, 17 mL) is added dropwise to a solution of
9-oxoepothilone D (505 mg) in 10 mL of CH.sub.2Cl.sub.2 at
-78.degree. C. The mixture is warmed to -50.degree. C., kept for 1
hour, and then another portion of dimethyldioxirane solution (5 mL)
is added and the reaction is continued for an additional 1.5 hour
at -50.degree. C. The reaction is then dried under a stream of
N.sub.2 at -50.degree. C. The product is purified by flash
chromatography on SiO.sub.2.
[0563] Step 2. (3S,6R,75,8R, 12R, 13S, 15S,
16E)-15-azido-3,7-dihydroxy-5,9-dioxo-12,13-epoxy-4,4,6,8,12,16-hexamethy-
l-17-(2-methylthiazol-4-yl)-16-heptadecenoic acid.
[0564] A solution of 9-oxoepothilone B (2.62 g) and sodium azide
(0.49 g) in 55 mL of degassed tetrahydrofuran/water (10:1 v/v) is
treated with tetrakis(triphenylphosphine)palladium (0.58 g) under
an argon atmosphere. The mixture is kept at 45.degree. C. for 1
hour, then diluted with 50 mL of water and extracted with ethyl
acetate. The extract is washed with brine, dried over
Na.sub.2SO.sub.4, filtered, and evaporated. The product is purified
by flash chromatography on SiO.sub.2.
[0565] Step 3. (35,6R,7S,8R,12R,
13S,15S,16E)-15-amino-3,7-dihydroxy-5,9-dioxo-12,13-epoxy-4,4,6,8,12,16-h-
examethyl-17-(2-methylthiazol-4-yl)-16-heptadecenoic acid. A
solution of
(3S,6R,7S,8R,12R,13S,15S,16E)-15-azido-3,7-dihydroxy-5,9-dioxo-12,13-epox-
y-4,4,6,8,12,16-hexamethyl-17-(2-methylthiazol-4-yl)-16-heptadecenoic
acid (565 mg) in 15 mL of THF/water (10:1 v/v) is treated with a
1.0 M solution of trimethylphosphine in toluene (3 mL) under argon
for 2 hours at ambient temperature. The mixture is concentrated,
and the product is purified by flash chromatography on
SiO.sub.2.
EXAMPLE 18
(4S,7R,8S,9R, 13R,
14S,16S)-13,14-epoxy-4,8-dihydroxy-2,6,10-trioxo-5,5,7,9,13-pentamethyl-1-
6-(1-(2-methylthiazol-4-yl)propen-2-yl)-1-aza-11-cyclohexadecene
[0566] ##STR47##
[0567] A solution of
(3S,6R,7S,8R,12R,13S,15S,16E)-15-amino-3,7-dihydroxy-5,9-dioxo-12,13-epox-
y-4,4,6,8,12,16-hexamethyl-17-(2-methylthiazol-4-yl)-16-heptadecenoic
acid (540 mg) in acetonitrile/dimethylformamide (20:1 v/v, 150 mL)
is cooled to 0.degree. C. and treated sequentially with
1-hydroxybenzotriazole (0.135 g) and
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.5
g). The mixture is warmed to ambient temperature and kept for 12
hours, then diluted with water and extracted with ethyl acetate.
The extract is washed sequentially with water, sat. NaHCO.sub.3,
and brine, then dried over Na.sub.2SO.sub.4, filtered, and
evaporated. The product is purified by flash chromatography on
SiO.sub.2.
EXAMPLE 19
[0568]
(4S,7R,8S,9R,13Z,16S)-4,8-dihydroxy-2,6,10-trioxo-5,5,7,9,13-13-pe-
ntamethyl-16-(1-(2-methylthiazol-4-yl)propen-2-yl)-1-aza-11-cyclohexadecen-
e ##STR48##
[0569] A solution of tungsten hexachloride (0.76 g) in
tetrahydrofuran (20 mL) at -78.degree. C. is treated with a 1.6 M
solution of n-butyllithium in hexane (2.5 mL). The mixture is
allowed to warm to ambient temperature over 20 minutes. A 13.8 mL
portion of the resulting green solution is added to a solution of
(4S,7R,8S,9R,13R, 14S,
16S)-4,8-dihydroxy-13,14-epoxy-2,6,10-trioxo-5,5,7,9,13-pentamethyl-16-(1-
-(2-methylthiazol-4-yl)propen-2-yl)-1-aza-11-cyclohexadecene (360
mg) in 2 mL of tetrahydrofuran at ambient temperature. After 30
min, the reaction is cooled to 0.degree. C. and treated with sat.
NaHCO.sub.3 (10 mL). The mixture is diluted with water and
extracted with CH.sub.2Cl.sub.2. The extract is dried over
Na.sub.2SO.sub.4, filtered, and evaporated. The product is purified
by flash chromatography on SiO.sub.2.
EXAMPLE 20
(4S,7R,8S,9R,13R,14S,16S)-13,14-epoxy-4,8-dihydroxy-2,6,10-trioxo-1,5,5,7,-
9,13-hexamethyl-16-(1-(2-methylthiazol-4-yl)propen-2-yl)-1-aza-11-cyclohex-
adecene
[0570] ##STR49##
[0571] Step 1.
(3S,6R,7S,8R,12R,13S,15S,16E)-3,7-dihydroxy-5,9-dioxo-12,13-epoxy-4,4,6,8-
,12,16-hexamethyl-15-(methylamino)-17-(2-methylthiazol-4-yl)-16-heptadecen-
oic acid. A solution of
(3S,6R,7S,8R,12R,13S,15S,16E)-15-amino-3,7-dihydroxy-5,9-dioxo-12,13-epox-
y-4,4,6,8,12,16-hexamethyl-17-(2-methylthiazol-4-yl)-16-heptadecenoic
acid (540 mg) in 10 mL of methanol is treated with 37% aqueous
formaldehyde (1 mL), acetic acid (25 uL), and sodium
cyanoborohydride (100 mg). After 1 hour, then mixture is treated
with 1N HCl then diluted with ethyl acetate and water. The aqueous
phase is extracted with ethyl acetate, and the organic phases are
combined, dried over Na.sub.2SO.sub.4, filtered, and evaporated.
The product is purified by flash chromatography on SiO.sub.2.
[0572] Step 2.
(4S,7R,8S,9R,13R,14S,16S)-13,14-epoxy-4,8-dihydroxy-2,6,10-trioxo-1,5,5,7-
,9,13-hexamethyl-16-(1-(2-methylthiazol-4-yl)propen-2-yl)-1-aza-11-cyclohe-
xadecene. A solution of
(3S,6R,7S,8R,12R,13S,15S,16E)-3,7-dihydroxy-5,9-dioxo-12,13-epoxy-4,4,6,8-
,12,16-hexamethyl-15-(methylamino)-17-(2-methylthiazol-4-yl)-16-heptadecen-
oic acid (554 mg) in acetonitrile/dimethylformamide (20:1 v/v, 150
mL) is cooled to 0.degree. C. and treated sequentially with
1-hydroxybenzotriazole (0.135 g) and
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.5
g). The mixture is warmed to ambient temperature and kept for 12
hours, then diluted with water and extracted with ethyl acetate.
The extract is washed sequentially with water, sat. NaHCO.sub.3,
and brine, then dried over Na.sub.2SO.sub.4, filtered, and
evaporated. The product is purified by flash chromatography on
SiO.sub.2.
EXAMPLE 21
(4S,7R,8S,9R, 13Z,
16S)-4,8-dihydroxy-2,6,10-trioxo-1,5,5,7,9,13-hexamethyl-16-(1-(2-methylt-
hiazol-4-yl)propen-2-yl)-1-aza-11-cyclohexadecene
[0573] ##STR50##
[0574] A solution of tungsten hexachloride (0.76 g) in
tetrahydrofuran (20 mL) at -78.degree. C. is treated with a 1.6 M
solution of n-butyllithium in hexane (2.5 mL). The mixture is
allowed to warm to ambient temperature over 20 minutes. A 13.8 mL
portion of the resulting green solution is added to a solution of
(4S,7R,8S,9R, 13R, 14S,
16S)-13,14-epoxy-4,8-dihydroxy-2,6,10-trioxo-1,5,5,7,9,13-hexamethyl-16-(-
1-(2-methylthiazol-4-yl)propen-2-yl)-1-aza-11-cyclohexadecene (370
mg) in 2 mL of tetrahydrofuran at ambient temperature. After 30
min, the reaction is cooled to 0.degree. C. and treated with sat.
NaHCO.sub.3 (10 mL). The mixture is diluted with water and
extracted with CH.sub.2Cl.sub.2. The extract is dried over
Na.sub.2SO.sub.4, filtered, and evaporated. The product is purified
by flash chromatography on SiO.sub.2.
EXAMPLE 22
Liposomal Composition
[0575] This example describes liposomal compositions containing
9-oxo epothilone. A mixture of lipids and 9-oxo-epothilone D are
dissolved in ethanol and the solution is dried as a thin film by
rotation under reduced pressure. The resultant lipid film is
hydrated by addition of the aqueous phase and the particle size of
the epothilone-derivative containing liposomes is adjusted to the
desired range. Preferably, the mean particle diameter is less than
10 microns, preferably from about 0.5 to about 4 microns. The
particle size may be reduced to the desired level, for example, by
using mills (e.g., air-jet mill, ball mill, or vibrator mill),
microprecipitation, spray-drying, lyophillization, high-pressure
homogenization, recrystrytallization from supercritical media, or
by extruding an aqueous suspension of the liposomes through a
series of membranes (e.g., polycarbonate membranes) having a
selected uniform pore size. In one embodiment, the liposomal
composition comprises: an inventive compound (1.00 mg);
phosphatidylcholine (16.25 mg); cholesterol (3.75 mg);
polyethyleneglycol derivatized distearyl phosphatidylethanolamine
(5.00 mg); lactose (80.00 mg); citric acid (4.20 mg); tartaric acid
(6.00 mg); NaOH (5.44 mg); water (up to 1 mL). In another
embodiment, the liposomal composition comprises: an inventive
compound (1.00 mg); phosphatidylcholine (19.80 mg); cholesterol
(3.75 mg); distearyl phosphatidylcholine (1.45 mg); lactose (80.00
mg); citric acid (4.20 mg); tartaric acid (6.00 mg); NaOH (5.44
mg); water (up to 1 mL). In yet another embodiment, the liposomal
composition comprises: an inventive compound (1.00 mg);
1-palmitoyl-2-oleyl-sn-glycero-3-phosphocholine (17.50 mg);
1-palmitoyl-2-oleyl-sn-glycero-3-phosphoglycerol, Na (7.50 mg);
lactose (80.mg); citric acid (4.20 mg); tartaric acid (6.00 mg);
NaOH (5.44 mg); water (up to 1 mL). Liposomal compositions
containing other compounds of the present invention are prepared
using conditions similar to those described above.
EXAMPLE 23
Polyglutamic Acid Conjugate
[0576] This example describes the preparation of a poly-glutamic
acid-21-hydroxy-9-oxo-epothilone D conjugate. Poly(1-glutamic acid)
("PG") sodium salt (MW 34 K, Sigma, 0.35 g) is dissolved in water.
The pH of the queous solution is adjusted to 2 using 0.2 M HCl. The
precipitate is collected, dialyzed against distilled water, and
lyophilized to yile 0.29 g of PG. To a solution of PG (75 mg,
repeating unit FW 170, 0.44 mmol) in dry DMF (1.5 mL) is added 20
mg of 21-hydroxy-9-oxo-epothilone D, 15 mg of
dicyclohexylcarbodiimide ("DCC") and a trace amount of
dimethylaminopyridine. The reaction is allowed to proceed at room
temperature for four hours or until completed as indicated by thin
layer chromatography. The reaction mixture is poured into
chloroform and the resulting precipitate is collected and dried in
a vacuum to yield approximately 65 mg of
PG-21-hydroxy-9-oxo-epothilone D conjugate. Changing the weight
ratio of inventive compound to PG in the starting materials results
in polymeric conjugates of various concentrations of
21-hydroxyl-10, 11-dehydroepothilone D. Conjugates of other
compounds of the present invention are prepared using conditions
similar to those described above.
EXAMPLE 24
Intravenous Formulaion
[0577] This example describes an intravenous formuation of
9-oxo-epothilone D. The formulation contains 10 mg/mL of
9-oxo-epothilone D in a vehicle containing 30% propylene glycol,
20% Creomophor EL, and 50% ethanol. The vehicle is prepared by
measuring ethanol (591.8 g) to a beaker containing a stir bar;
adding Creomophor EL (315.0 g) to the solution and mixing for ten
minutes; and then adding propylene glycol (466.2 g) to the solution
and mixing for another ten minutes. 9-oxo-epothilone D (1 g) is
added to a 1 L volumetric flask containing 400-600 mL of the
vehicle and mixed for five minutes. After 10, 11-dehydroepothilone
D is in solution, the volume is brought to 1 L; allowed to mix for
another ten minutes; and filtered through a 0.22 .mu.m Millipore
Millipak filter. The resulting solution is used to aseptically fill
sterile 5 mL vials using a metered peristaltic pump to a targeted
fill volume of 5.15 mL/vial. The filled vials are immediately
stoppered and crimped.
[0578] The vial containing 10 mg/mL of 9-oxo-epothilone D is
diluted in normal saline or 5% dextrose solution for administration
to patients and administered in non-PVC, non-DEHP bags and
administration sets. The product is infused over a one to six hour
period to deliver the desired dose.
[0579] In one embodiment, the formulation is diluted twenty fold in
sterile saline prior to intravenous infusion. The final infusion
concentration is 0.5 mg/mL of the inventive compound, 1.5%
propylene glycol, 1% Chremophor EL, and 2.5% ethanol which is
infused over a one to six hour period to deliver the desired
dose.
[0580] Intravenous formulations containing other compounds of the
present invention may be prepared and used in a similar manner.
EXAMPLE 25
Pretreatment for Cremophor.RTM. Toxicity
[0581] This example describes a pretreatement regiment for for
Cremophor.RTM. toxicity. Formulations of a compound of the
invention that includes Cremophor.RTM. may cause toxicity in
patients. Pretreatment with steroids can be used to prevent
anaphylaxis. Any suitable corticosterioid or combination of
corticosteroid with H.sub.1 antagonists and/or H.sub.2 antagonists
may be used. In one embodiment, a subject is premedicated with an
oral dose of 50 mg of diphenylhydramine and 300 mg of cimetidine
one hour prior to treatment with the inventive compound in a
Cremophor.RTM. containing formulation. In another embodiment, the
subject is premedicated with an intravenous administration of 20 mg
of dexamethasone at least one half hour prior to treatment with the
inventive compound in a Cremophor.RTM. containing formulation. In
another embodiment, the subject is premedicated with an intravenous
administration of 50 mg of diphenylhydramine, 300 mg of cimetidine
and 20 mg of dexamethasone at least one half hour prior to
treatment with the inventive compound in a Cremophor.RTM.
containing formulation. In yet another embodiment, the weight of
the subject is taken into account and the subject is pretreated
with an administration of diphenylhydramine (5 mg/kg, i.v.);
cimetidine (5 mg/kg, i.v).; and dexamethasone (1 mg/kg, i.m.) at
least one half hour prior to the treatment with the inventive
compound in a Cremophor.RTM. containing formulation
[0582] All scientific and patent publications referenced herein are
hereby incorporated by reference. The invention having now been
described by way of written description and example, those of skill
in the art will recognize that the invention can be practiced in a
variety of embodiments, that the foregoing description and example
is for purposes of illustration and not limitation of the following
claims.
Sequence CWU 1
1
62 1 30 DNA Artificial Sequence Primer Seq1 1 agcggataac aatttcacac
aggaaacagc 30 2 29 DNA Artificial Sequence Primer Mxpil1 2
ttaattaaga gaaggttgca acggggggc 29 3 848 DNA Artificial Sequence
Sequence of the pilA promoter 3 cgacgcaggt gaagctgctt cgtgtgctcc
aggagcggaa ggtgaagccg gtcggcagcg 60 ccgcggagat tcccttccag
gcgcgtgtca tcgcggcaac gaaccggcgg ctcgaagccg 120 aagtaaaggc
cggacgcttt cgtgaggacc tcttctaccg gctcaacgtc atcacgttgg 180
agctgcctcc actgcgcgag cgttccggcg acgtgtcgtt gctggcgaac tacttcctgt
240 ccagactgtc ggaggagttg gggcgacccg gtctgcgttt ctcccccgag
acactggggc 300 tattggagcg ctatcccttc ccaggcaacg tgcggcagct
gcagaacatg gtggagcggg 360 ccgcgaccct gtcggattca gacctcctgg
ggccctccac gcttccaccc gcagtgcggg 420 gcgatacaga ccccgccgtg
cgtcccgtgg agggcagtga gccagggctg gtggcgggct 480 tcaacctgga
gcggcatctc gacgacagcg agcggcgcta tctcgtcgcg gcgatgaagc 540
aggccggggg cgtgaagacc cgtgctgcgg agttgctggg cctttcgttc cgttcattcc
600 gctaccggtt ggccaagcat gggctgacgg atgacttgga gcccgggagc
gcttcggatg 660 cgtaggctga tcgacagtta tcgtcagcgt cactgccgaa
ttttgtcagc cctggaccca 720 tcctcgccga ggggattgtt ccaagccttg
agaattgggg ggcttggagt gcgcacctgg 780 gttggcatgc gtagtgctaa
tcccatccgc gggcgcagtg ccccccgttg caaccttctc 840 ttaattaa 848 4 31
DNA Artificial Sequence Primer 111-44.1 4 aaaagcttcg gggcacctcc
tggctgtcgg c 31 5 34 DNA Artificial Sequence Primer 111-44.4 5
ggttaattaa tcaccctcct cccaccccgg gcat 34 6 33 DNA Artificial
Sequence Primer 90-66.1 6 gcgggaagct ttcacggcgc aggccctcgt ggg 33 7
31 DNA Artificial Sequence Insert 90-67 7 gcggtacctt caacaggcag
gccgtctcat g 31 8 32 DNA Artificial Sequence Insert 111-44.3 8
aaaagcttag gcggtattgc tttcgttgca ct 32 9 34 DNA Artificial Sequence
Insert 111-44.5 9 ggttaattaa ggtcagcaca cggtccgtgt gcat 34 10 26
DNA Artificial Sequence Primer 111-44.8 10 aaagatctct cccgatgcgg
gaaggc 26 11 31 DNA Artificial Sequence Primer 111-44.9 11
ggggatccaa tggaagggga tgtccgcgga a 31 12 34 DNA Artificial Sequence
Insert 111-44.6 12 ggttaattaa catcgcgcta tcagcagcgc tgag 34 13 34
DNA Artificial Sequence Insert 111-44.7 13 ggttaattaa tcctcagcgg
ctgacccgct cgcg 34 14 31 DNA Artificial Sequence Primer 90-103 14
aaaaaatgca tctacctcgc tcgtggcggt t 31 15 32 DNA Artificial Sequence
Primer 90-107.1 15 ccccctctag aataggtcgg cagcggtacc cg 32 16 34 DNA
Artificial Sequence Primer 90-105 16 tttttatgca tgcggcagtt
tgaacggaga tgct 34 17 32 DNA Artificial Sequence Primer 90-106 17
cccccgaatt ctcccggaag gcacacggag ac 32 18 26 DNA Artificial
Sequence Primer TL3 18 atgaattcat gatggcccga gcagcg 26 19 29 DNA
Artificial Sequence Primer TL4 19 atctgcagcc agtaccgctg ccgctgcca
29 20 30 DNA Artificial Sequence Primer TL5 20 gctctagaac
ccggaactgg cgtggcctgt 30 21 29 DNA Artificial Sequence Primer TL6
21 gcagatctac cgcgtgagga cacggcctt 29 22 50 DNA Artificial Sequence
Primer TL23 22 ggcgccggcc aagagcgccg cgccggtcgg cgggccagcc
ggggacgggt 50 23 58 DNA Artificial Sequence Primer TL24 23
ctagacccgt ccccggctgg cccgccgacc ggcgcggcgc tcttggccgg cgcctgca 58
24 29 DNA Artificial Sequence Primer TL33 24 ggatgcatgc gccggccgaa
gggctcgga 29 25 30 DNA Artificial Sequence Primer TL34 25
tcactagtca gcgacaccgg cgctgcgttt 30 26 24 DNA Artificial Sequence
Primer TL7 26 gcgctcgaga gcgcgggtat cgct 24 27 26 DNA Artificial
Sequence Primer TL8 27 gagatgcatc caatggcgct cacgct 26 28 28 DNA
Artificial Sequence Primer TL9 28 gctctagagc cgcgcgcctt ggggcgct 28
29 27 DNA Artificial Sequence Primer TL10 29 gcagatcttg gggcgctgcc
tgtggaa 27 30 28 DNA Artificial Sequence Primer TL31 30 ggctgcagac
ccagaccgcg ggcgacgc 28 31 29 DNA Artificial Sequence Primer TL32 31
gctctagagg tggcgccggc cgcccggcg 29 32 552 DNA Artificial sequence
KR domain of extender module 6 of the epothilone PKS CDS
(1)...(552) 32 gac ggc acc tac ctc gtg acc ggc ggt ctg ggt ggg ctc
ggt ctg agc 48 Asp Gly Thr Tyr Leu Val Thr Gly Gly Leu Gly Gly Leu
Gly Leu Ser 1 5 10 15 gtg gct gga tgg ctg gcc gag cag ggg gct ggg
cat ctg gtg ctg gtg 96 Val Ala Gly Trp Leu Ala Glu Gln Gly Ala Gly
His Leu Val Leu Val 20 25 30 ggc cgc tcc ggt gcg gtg agc gcg gag
cag cag acg gct gtc gcc gcg 144 Gly Arg Ser Gly Ala Val Ser Ala Glu
Gln Gln Thr Ala Val Ala Ala 35 40 45 ctc gag gcg cac ggc gcg cgt
gtc acg gta gcg agg gca gac gtc gcc 192 Leu Glu Ala His Gly Ala Arg
Val Thr Val Ala Arg Ala Asp Val Ala 50 55 60 gat cgg gcg cag atc
gag cgg atc ctc cgc gag gtt acc gcg tcg ggg 240 Asp Arg Ala Gln Ile
Glu Arg Ile Leu Arg Glu Val Thr Ala Ser Gly 65 70 75 80 atg ccg ctc
cgc ggc gtc gtt cat gcg gcc ggt atc ctg gac gac ggg 288 Met Pro Leu
Arg Gly Val Val His Ala Ala Gly Ile Leu Asp Asp Gly 85 90 95 ctg
ctg atg cag caa acc ccc gcg cgg ttc cgc gcg gtc atg gcg ccc 336 Leu
Leu Met Gln Gln Thr Pro Ala Arg Phe Arg Ala Val Met Ala Pro 100 105
110 aag gtc cga ggg gcc ttg cac ctg cat gcg ttg aca cgc gaa gcg ccg
384 Lys Val Arg Gly Ala Leu His Leu His Ala Leu Thr Arg Glu Ala Pro
115 120 125 ctc tcc ttc ttc gtg ctg tac gct tcg gga gca ggg ctc ttg
ggc tcg 432 Leu Ser Phe Phe Val Leu Tyr Ala Ser Gly Ala Gly Leu Leu
Gly Ser 130 135 140 ccg ggc cag ggc aac tac gcc gcg gcc aac acg ttc
ctc gac gct ctg 480 Pro Gly Gln Gly Asn Tyr Ala Ala Ala Asn Thr Phe
Leu Asp Ala Leu 145 150 155 160 gca cac cac cgg agg gcg cag ggg ctg
cca gca ttg agc atc gac tgg 528 Ala His His Arg Arg Ala Gln Gly Leu
Pro Ala Leu Ser Ile Asp Trp 165 170 175 ggc ctg ttc gcg gac gtg ggt
ttg 552 Gly Leu Phe Ala Asp Val Gly Leu 180 33 184 PRT Artificial
Sequence KR domain of extender module 6 of the epothilone PKS 33
Asp Gly Thr Tyr Leu Val Thr Gly Gly Leu Gly Gly Leu Gly Leu Ser 1 5
10 15 Val Ala Gly Trp Leu Ala Glu Gln Gly Ala Gly His Leu Val Leu
Val 20 25 30 Gly Arg Ser Gly Ala Val Ser Ala Glu Gln Gln Thr Ala
Val Ala Ala 35 40 45 Leu Glu Ala His Gly Ala Arg Val Thr Val Ala
Arg Ala Asp Val Ala 50 55 60 Asp Arg Ala Gln Ile Glu Arg Ile Leu
Arg Glu Val Thr Ala Ser Gly 65 70 75 80 Met Pro Leu Arg Gly Val Val
His Ala Ala Gly Ile Leu Asp Asp Gly 85 90 95 Leu Leu Met Gln Gln
Thr Pro Ala Arg Phe Arg Ala Val Met Ala Pro 100 105 110 Lys Val Arg
Gly Ala Leu His Leu His Ala Leu Thr Arg Glu Ala Pro 115 120 125 Leu
Ser Phe Phe Val Leu Tyr Ala Ser Gly Ala Gly Leu Leu Gly Ser 130 135
140 Pro Gly Gln Gly Asn Tyr Ala Ala Ala Asn Thr Phe Leu Asp Ala Leu
145 150 155 160 Ala His His Arg Arg Ala Gln Gly Leu Pro Ala Leu Ser
Ile Asp Trp 165 170 175 Gly Leu Phe Ala Asp Val Gly Leu 180 34 552
DNA Artificial Sequence Mutated and inactive KR domain of extender
module 6 of the novel 9-keto- epothilone PKS CDS (1)...(552) 34 gac
ggc acc tac ctc gtg acc ggc gct ctg ggt ggg ctc ggt ctg agc 48 Asp
Gly Thr Tyr Leu Val Thr Gly Ala Leu Gly Gly Leu Gly Leu Ser 1 5 10
15 gtg gct gga tgg ctg gcc gag cag ggg gct ggg cat ctg gtg ctg gtg
96 Val Ala Gly Trp Leu Ala Glu Gln Gly Ala Gly His Leu Val Leu Val
20 25 30 ggc cgc tcc ggt gcg gtg agc gcg gag cag cag acg gct gtc
gcc gcg 144 Gly Arg Ser Gly Ala Val Ser Ala Glu Gln Gln Thr Ala Val
Ala Ala 35 40 45 ctc gag gcg cac ggc gcg cgt gtc acg gta gcg agg
gca gac gtc gcc 192 Leu Glu Ala His Gly Ala Arg Val Thr Val Ala Arg
Ala Asp Val Ala 50 55 60 gat cgg gcg cag atc gag cgg atc ctc cgc
gag gtt acc gcg tcg ggg 240 Asp Arg Ala Gln Ile Glu Arg Ile Leu Arg
Glu Val Thr Ala Ser Gly 65 70 75 80 atg ccg ctc cgc ggc gtc gtt cat
gcg gcc ggt atc ctg gac gac ggg 288 Met Pro Leu Arg Gly Val Val His
Ala Ala Gly Ile Leu Asp Asp Gly 85 90 95 ctg ctg atg cag caa acc
ccc gcg cgg ttc cgc gcg gtc atg gcg ccc 336 Leu Leu Met Gln Gln Thr
Pro Ala Arg Phe Arg Ala Val Met Ala Pro 100 105 110 aag gtc cga ggg
gcc ttg cac ctg cat gcg ttg aca cgc gaa gcg ccg 384 Lys Val Arg Gly
Ala Leu His Leu His Ala Leu Thr Arg Glu Ala Pro 115 120 125 ctc tcc
ttc ttc gtg ctg tac gct tcg gga gca ggg ctc ttg ggc tcg 432 Leu Ser
Phe Phe Val Leu Tyr Ala Ser Gly Ala Gly Leu Leu Gly Ser 130 135 140
ccg ggc cag ggc aac ttc gcc acg gcc aac acg ttc ctc gac gct ctg 480
Pro Gly Gln Gly Asn Phe Ala Thr Ala Asn Thr Phe Leu Asp Ala Leu 145
150 155 160 gca cac cac cgg agg gcg cag ggg ctg cca gca ttg agc atc
gac tgg 528 Ala His His Arg Arg Ala Gln Gly Leu Pro Ala Leu Ser Ile
Asp Trp 165 170 175 ggc ctg ttc gcg gac gtg ggt ttg 552 Gly Leu Phe
Ala Asp Val Gly Leu 180 35 184 PRT Artificial Sequence Mutated and
inactive KR domain of extender module 6 of the novel 9-keto-
epothilone PKS 35 Asp Gly Thr Tyr Leu Val Thr Gly Ala Leu Gly Gly
Leu Gly Leu Ser 1 5 10 15 Val Ala Gly Trp Leu Ala Glu Gln Gly Ala
Gly His Leu Val Leu Val 20 25 30 Gly Arg Ser Gly Ala Val Ser Ala
Glu Gln Gln Thr Ala Val Ala Ala 35 40 45 Leu Glu Ala His Gly Ala
Arg Val Thr Val Ala Arg Ala Asp Val Ala 50 55 60 Asp Arg Ala Gln
Ile Glu Arg Ile Leu Arg Glu Val Thr Ala Ser Gly 65 70 75 80 Met Pro
Leu Arg Gly Val Val His Ala Ala Gly Ile Leu Asp Asp Gly 85 90 95
Leu Leu Met Gln Gln Thr Pro Ala Arg Phe Arg Ala Val Met Ala Pro 100
105 110 Lys Val Arg Gly Ala Leu His Leu His Ala Leu Thr Arg Glu Ala
Pro 115 120 125 Leu Ser Phe Phe Val Leu Tyr Ala Ser Gly Ala Gly Leu
Leu Gly Ser 130 135 140 Pro Gly Gln Gly Asn Phe Ala Thr Ala Asn Thr
Phe Leu Asp Ala Leu 145 150 155 160 Ala His His Arg Arg Ala Gln Gly
Leu Pro Ala Leu Ser Ile Asp Trp 165 170 175 Gly Leu Phe Ala Asp Val
Gly Leu 180 36 26 DNA Artificial Sequence Primer TLII-1 36
acaagcttgc gaaaaagaac gcgtct 26 37 30 DNA Artificial Sequence
Primer TLII-2 37 cgagatctgc cgggcgagga agcggccctg 30 38 26 DNA
Artificial Sequence Primer TLII-3B 38 gcatgcatgc gccggtcgat ggtgag
26 39 30 DNA Artificial Sequence Primer TLII-4 39 agactagtca
ccggctggcc caccacaagg 30 40 28 DNA Artificial Sequence Primer
TLII-20 40 gcatgcatcc agtagcggtc acggcgga 28 41 29 DNA Artificial
Sequence Primer TLII-21 41 cgagatctgt gttcgcgttc cccgggcag 29 42 30
DNA Artificial Sequence Primer TLII-13 42 gcatgcatcc agtagcgctg
ccgctggaat 30 43 28 DNA Artificial Sequence Primer TLII-14 43
gcagatctgt gttcgtgttc cccggcca 28 44 26 DNA Artificial Sequence
Primer TLII-17 44 gcatgcatcc agtaccgctc gcgctg 26 45 29 DNA
Artificial Sequence Primer TLII-18 45 cgagatctgt cttcgtcttt
cccggccag 29 46 28 DNA Artificial Sequence Primer TLII-5 46
ggatgcatgt cgagcctgac gcccgccg 28 47 35 DNA Artificial Sequence
Primer TLII-6 47 gcactagtga tggcgatctc gtcatccgcc gccac 35 48 27
DNA Artificial Sequence Primer TL16 48 acagatctcg gcgcgctgcc
gccggag 27 49 28 DNA Artificial Sequence Primer TL15 49 ggtctagact
cgaacggctc gccaccgc 28 50 28 DNA Artificial Sequence Primer TLII-11
50 gtatgcatcc agtagcggac ccgctcga 28 51 28 DNA Artificial Sequence
Primer TLII-12 51 gcagatctgt gtggctcttc tccggaca 28 52 30 DNA
Artificial Sequence Primer TLII-15 52 gcatgcatcc agtagcgctg
ccgctggaac 30 53 28 DNA Artificial Sequence Primer TLII-16 53
ggagatctgc ggtgctgttc acggggca 28 54 28 DNA Artificial Sequence
Primer TLII-19 54 gtagatctgc tttcctgttc accggaca 28 55 24 DNA
Artificial Sequence Primer TL11 55 ggatgcatct caccccgcga agcg 24 56
25 DNA Artificial Sequence Primer TL12 56 gtactagtca agggcgctgc
ggagg 25 57 29 DNA Artificial Sequence Primer TLII-7 57 gcagatctgc
cgcgcgagga gctcgcgat 29 58 27 DNA Artificial Sequence Primer TLII-8
58 catctagagc cgctcctgtg gagtcac 27 59 30 DNA Artificial Sequence
Primer TLII-9B 59 ggatgcatgc gccggccgaa gggctcggag 30 60 32 DNA
Artificial Sequence Primer TLII-10 60 gcactagtga tggcgatcgg
gtcctctgtc gc 32 61 37 DNA Artificial Sequence Primer TLII-22 61
tgatccatgc tgcggccgct agcgtgggca tggccgc 37 62 37 DNA Artificial
Sequence Primer TLII-23 62 gcggccatgc ccacgctagc ggccgcagca tggatca
37
* * * * *