U.S. patent application number 11/554432 was filed with the patent office on 2007-12-06 for t1 receptor-like ligand ii and uses thereof.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Reiner L. Gentz, Jian Ni, Steven M. Ruben.
Application Number | 20070280903 11/554432 |
Document ID | / |
Family ID | 27487300 |
Filed Date | 2007-12-06 |
United States Patent
Application |
20070280903 |
Kind Code |
A1 |
Ni; Jian ; et al. |
December 6, 2007 |
T1 Receptor-Like Ligand II and Uses Thereof
Abstract
The present invention relates to a novel T1 Receptor (T1R)-like
ligand II protein. In particular, isolated nucleic acid molecules
are provided encoding the T1R-like ligand II protein. T1R-like
ligand II polypeptides are also provided, as are recombinant
vectors and host cells for expressing the same. This invention
further relates to pharmaceutical compositions and formulations
comprising T1R-like ligand II. Also provided are methods of using
T1R-like ligand II polynucleotides, polypeptides, antibodies or
agonists/antagonists for therapeutic and diagnostic purposes.
Diagnostic kits are further provided.
Inventors: |
Ni; Jian; (Germantown,
MD) ; Gentz; Reiner L.; (Gauting, DE) ; Ruben;
Steven M.; (Brookville, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC.;INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
27487300 |
Appl. No.: |
11/554432 |
Filed: |
October 30, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10439222 |
May 16, 2003 |
7128906 |
|
|
11554432 |
Oct 30, 2006 |
|
|
|
09731924 |
Dec 8, 2000 |
6605271 |
|
|
10439222 |
May 16, 2003 |
|
|
|
09317641 |
May 25, 1999 |
6667032 |
|
|
09731924 |
Dec 8, 2000 |
|
|
|
08916442 |
Aug 22, 1997 |
6586210 |
|
|
09317641 |
May 25, 1999 |
|
|
|
60024348 |
Aug 23, 1996 |
|
|
|
60169979 |
Dec 10, 1999 |
|
|
|
Current U.S.
Class: |
424/85.1 ;
435/375; 435/377; 435/6.16; 514/12.2; 514/13.3; 514/2.4; 514/3.7;
514/7.9 |
Current CPC
Class: |
G01N 33/57407 20130101;
A61K 48/00 20130101; G01N 33/6893 20130101; G01N 2800/24 20130101;
A61K 45/06 20130101; C12N 2799/026 20130101; C07K 14/54 20130101;
A61K 38/1709 20130101; G01N 2800/2821 20130101; G01N 2800/368
20130101; G01N 33/6896 20130101; G01N 33/564 20130101; A61K 38/20
20130101; G01N 33/57426 20130101 |
Class at
Publication: |
424/085.1 ;
435/375; 435/377; 435/006; 514/021 |
International
Class: |
A61K 38/19 20060101
A61K038/19; A61K 38/17 20060101 A61K038/17; C12Q 1/68 20060101
C12Q001/68; A61K 38/18 20060101 A61K038/18 |
Claims
1. A method of stimulating the proliferation and/or differentiation
of cells of hematopoietic origin, comprising contacting said cells
with the T1R-like ligand II or agonist thereof.
2. The method of claim 1, wherein said cells are selected from the
group consisting of: myeloid cells and lymphoid cells.
3. The method of claim 1, further comprising administering a
compound selected from the group consisting of: cytokines,
hematopoetic growth factors, antiviral agents, antibiotics,
anti-inflammatory agents, chemotherapeutic agents, chemokines,
angiogenic proteins, and fibroblast growth factors.
4. The method of claim 1, wherein said contacting occurs in
vitro.
5. The method of claim 1, wherein said contacting occurs in
vivo.
6. A method of inhibiting the proliferation and/or differentiation
of cells of hematopoietic origin, comprising contacting said cells
with the T1R-like ligand II or antagonist thereof.
7. The method of claim 6, wherein said cells are selected from the
group consisting of: myeloid cells or lymphoid cells.
8. The method of claim 6, further comprising administering a
compound selected from the group consisting of: cytokines,
hematopoetic growth factors, antiviral agents, antibiotics,
anti-inflammatory agents, chemotherapeutic agents, chemokines,
angiogenic proteins, and fibroblast growth factors.
9. The method of claim 6, wherein said contacting occurs in
vitro.
10. The method of claim 6, wherein said contacting occurs in
vivo.
11. A method useful during the diagnosis of a disorder, comprising:
(a) measuring the T1R-like ligand II gene expression level in cells
or body fluid of an individual; and (b) comparing the T1R-like
ligand II gene expression level of said individual with a standard
T1R-like ligand II gene expression level, whereby an increase or
decrease in the T1R-like ligand II gene expression level over said
standard is indicative of a T1R-like ligand II-related disorder.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a Divisional of U.S. application Ser.
No. 10/439,222, filed May 16, 2003,which is a Divisional of U.S.
application Ser. No. 09/731,924, filed Dec. 8, 2000 (now U.S. Pat.
No. 6,605,271, issued Aug. 12, 2003), which claims priority under
35 U.S.C. .sctn.119(e) to U.S. Provisional Application No.
60/169,979, filed Dec. 10, 1999; said U.S. application Ser. No.
09/731,924 is also a Continuation-in-Part of U.S. application Ser.
No. 09/317,641, filed May 25, 1999 (now U.S. Pat. No. 6,667,032,
issued Dec. 23, 2003), which is a Divisional of U.S. application
Ser. No. 08/916,442, filed Aug. 22, 1997 (now U.S. Pat. No.
6,586,210, issued Jul. 1, 2003), which claims priority under 35
U.S.C. .sctn.119(e) to U.S. Provisional Application No. 60/024,348,
filed Aug. 23, 1996; all of which are hereby incorporated by
reference in their entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to a novel T1 Receptor
(T1R)-like ligand II protein. In particular, isolated nucleic acid
molecules are provided encoding the T1R-like ligand II protein.
T1R-like ligand II polypeptides are also provided, as are
recombinant vectors and host cells for expressing the same. This
invention further relates to pharmaceutical compositions and
formulations comprising T1R-like ligand II. Also provided are
methods of using T1R-like ligand II polynucleotides, polypeptides,
antibodies or agonists/antagonists for therapeutic and diagnostic
purposes. Diagnostic kits are further provided.
BACKGROUND OF THE INVENTION
[0003] Interleukin-1 (IL-1). Interleukin-1 (IL-1.alpha. and
IL-1.beta.) is a "multifunctional" cytokine that affects nearly
every cell type, and often in concert with other cytokines or small
mediator molecules. (Dinarello, C. A., Blood 87:2095-2147 (Mar. 15,
1996).) There are three members of the IL-1 gene family:
IL-1.alpha., IL-1.beta., and IL-1 receptor antagonist (IL-1Ra).
IL-1.alpha. and IL-1.beta. are agonists and IL-1Ra is a specific
receptor antagonist. IL-1.alpha. and .beta. are synthesized as
precursors without leader sequences. The molecular weight of each
precursor is 31 kD. Processing of IL-1.alpha. or IL-1.beta. to
"mature" forms of 17 kD requires specific cellular proteases. In
contrast, IL-1Ra evolved with a signal peptide and is readily
transported out of the cells and termed secreted IL-1Ra
(sIL-1Ra).
[0004] IL-1 Receptor and Ligands. The receptors and ligands of the
IL-1 pathway have been well defined (for review, see Dinarello, C.
A., FASEB J. 8:1314-1325 (1994); Sims, J. E. et al., Interleukin-1
signal transduction: Advances in Cell and Molecular Biology of
Membranes and Organelles, Vol. 3, JAI Press, Inc., Greenwich, Conn.
(1994), pp. 197-222). Three ligands, IL-1.alpha., IL-1.beta., and
IL-1 receptor antagonist (IL-1Ra) bind three forms of IL-1
receptor, an 80-kDa type I IL-1 receptor (IL-1R1) (Sims, J. E. et
al., Science 241:585-589 (1988)), a 68-kDa type II IL-1 receptor
(IL-1RII) (McMahan, C. J. et al., EMBO J 10:2821-2832 (1991)), and
a soluble form of the type II IL-1R (sIL-1RII) (Colotta, F. et al.,
Science 261:472-475 (1993)).
[0005] The interactions between the IL-1 ligands and receptors play
an essential role in the stimulation and regulation of the
IL-1-mediated host response to injury and infection. Cells
expressing IL-1RI and treated with IL-1.alpha. or IL-1.beta.
respond in several specific ways, including stimulating nuclear
localization of the rel-related transcription factor,
NF-.kappa..beta. (for review, see Thanos, D. & Maniatis, T.,
Cell 80:529-532 (1996)), activation of protein kinases of the
mitogen-activated protein kinase superfamily that phosphorylate
residue threonine 669 (Thr-669) of the epidermal growth factor
receptor (EGFR) (Guy, G. R. et al., J. Biol. Chem. 267:1846-1852
(1992); Bird, T. A. et al., J. Biol. Chem. 268:22861-22870 (1991);
Bird, T. A. et al., J. Biol. Chem. 269:31836-31844 (1994)), and
stimulation of transcription of the IL-8 gene (Mukaida, N. et al.,
J. Biol. Chem. 265:21128-21133 (1990)).
[0006] IL-1RI-like family. Many proteins from diverse systems show
homology to the cytoplasmic domain of the IL-1RI. This expanding
IL-1RI-like family includes mammalian proteins, Drosophila
proteins, and a plant (tobacco) protein. (Gay, N. J. & Keith,
F. J., Nature 351:355-356 (1991); Hashimoto, C. et al., Cell
52:269-279 (1988); Schneider, D. S. et al., Genes & Dev.
5:797-807 (1991); Edon, E. et al., Development 120:885-899 (1994);
Mitchan, J. L. et al., J. Biol. Chem 271:5777-5782 (Mar. 8,
1996)).
[0007] The mammalian IL-1RI-like receptor family members include a
murine protein MyD88 (Lord, K. A. et al., Oncogene 5:1095-1097
(1990)) and a human gene, rsc786 (Nomura, N. et al., DNA Res.
1:27-35 (1994)). Another murine receptor member, T1/ST2, was
previously characterized as a novel primary response gene expressed
in BALB/c-3T3 cells (Klemenz, R. et al., Proc. Natl. Acad. Sci. USA
86:5708-5712 (1989); Tominaga, S., FEBS Lett. 258:301-304 (1989);
Tominga, S. et al., FEBS Lett. 318:83-87 (1993)). The transmembrane
protein mu1L-1R AcP (Greenfeder, S. A. et al., J. Biol. Chem.
270:13757-13765 (1995)) has homology to both the type I and type II
IL-1R. IL-1R AcP has recently been shown to increase the affinity
of IL-1RI for IL-1.beta. and maybe involved in mediating the IL-1
response.
[0008] T1 Receptors. T1/ST2 receptors (hereinafter, "T1
receptors"), as a member of the IL-1 receptor family (Bergers, G.,
et al., EMBO J. 13:1176 (1994)), have various homologs in different
species. In the rat, it is called Fit-1, an estrogen-inducible,
c-fos-dependent transmembrane protein that shares 26% to 29% amino
acid homology to the mouse IL-1RI and II, respectively. In the
mouse, the Fit-1 protein is called ST2 and in the human it is
called T1. The organization of the two IL-1 receptors and the
Fit-1/ST2/T1 genes indicates they are derived from a common
ancestor (Sims, J. E., et al., Cytokine 7:483 (1995)). Fit-1 exists
in two forms: a membrane form (Fit-1M) with a cytosolic domain
similarly to that of the IL-1RI and Fit-1S, which is secreted and
composed of the extracellular domain of Fit-M.
[0009] In many ways, these two forms of the Fit-1 protein are
similar to those of the membrane-bound and soluble IL-1RI. It has
been shown that the IL-1sRI is derived from proteolytic cleavage of
the cell-bound form (Sims, J. E., et al., Cytokine 7:483 (1995)).
On the other hand, the Fit-1 gene is under the control of two
promoters, which results in two isoforms coding for either the
membrane or soluble form of the receptor. Two RNA transcripts
result from alternative RNA splicing of the 3' end of the gene.
Although IL-1.beta. binds weakly to Fit-1 and does not transduce a
signal (Reikerstorger, A., et al., J. Biol. Chem. 270:17645
(1995)), a chimeric receptor consisting of the extracellular murine
IL-1RI fused to the cytosolic Fit-1 transduces an IL-1 signal
(Reikerstorger, A., et al., J. Biol. Chem. 270:17645 (1995)). The
cytosolic portion of Fit-1 align with GTPase-like sequences of
IL-1RI (Hopp, T. P., Protein Sci. 4:1851 (1995)) (see below).
[0010] IL-1 production in various disease states. Increased IL-1
production has been reported in patients with various viral,
bacterial, fungal, and parasitic infections; intravascular
coagulation; high-dose IL-2 therapy; solid tumors; leukemias;
Alzheimer's disease; HIV-1 infection; autoimmune disorders; trauma
(surgery); hemodialysis; ischemic diseases (myocardial infarction);
noninfectious hepatitis; asthma; UV radiation; closed head injury;
pancreatitis; periodontitis; graft-versus-host disease; transplant
rejection; and in healthy subjects after strenuous exercise. There
is an association of increased IL-1.beta. production in patients
with Alzheimer's disease and a possible role for IL-1 in the
release of the amyloid precursor protein (Vasilakos, J. P., et al.,
FEBS Lett. 354:289 (1994)). However, in most conditions, IL-1 is
not the only cytokine exhibiting increased production and hence the
specificity of the IL-1 findings as related to the pathogenesis of
any particular disease is lacking. In various disease states,
IL-1.beta., but not IL-1.alpha., is detected in the
circulation.
[0011] IL-1 in Therapy. Although IL-1 has been found to exhibit
many important biological activities, it is also found to be toxic
at doses that are close to therapeutic dosages (Dinarello, C. A.,
Blood 87:2095-2147 (Mar. 15, 1996)). In general, the acute
toxicities of either isoform of IL-1 were greater after intravenous
compared with subcutaneous injection. Subcutaneous injection was
associated with significant local pain, erythema, and swelling
(Kitamura, T., & Takaku, F., Exp. Med. 7:170 (1989); Laughlin,
M. J., Ann. Hematol. 67:267 (1993)). Patients receiving intravenous
IL-1 at doses of 100 ng/kg or greater experienced significant
hypotension. In patients receiving IL-1.beta. from 4 to 32 ng/kg
subcutaneously, there was only one episode of hypotension at the
highest dose level (Laughlin, M. J., Ann. Hematol. 67:267
(1993)).
[0012] Contrary to IL-1-associated myelostimulation in patients
with normal marrow reserves, patients with a plastic anemia treated
with 5 daily doses of IL-1.alpha. (30 to 100 ng/kg) had no
increases in peripheral blood counts or bone marrow cellularity
(Walsh, C. E., et al., Br. J. Haematol 80:106 (1992)). IL-1 has
been administered to patients undergoing various regiments of
chemotherapy to reduce the nadir of neutropenia and
thrombocytopenia.
[0013] Daily treatment with 40 ng/kg IL-1.alpha. from day 0 to day
13 of autologous bone marrow or stem cells resulted in an earlier
recovery of neutropenia (median, 12 days; P<0.001) (Weisdorf,
D., et al., Blood 84:2044 (1994)). After 14 days of treatment, the
bone marrow-was significantly enriched with committed myeloid
progenitor cells. Similar results were reported in patients with
AML receiving 50 ng/kg/d of IL-1.beta. for 5 days starting at the
time of transplantation with purged or nonpurged bone marrow
(Nemunaitis, J., et al., Blood 83:3473 (1994)). Injecting humans
with low doses of either IL-1.alpha. or IL-1.beta. confirms the
impressive pyrogenic and hypotension-inducing properties of the
molecules.
[0014] Amelioration of Disease Using Soluble IL-1 Receptors.
Administration of murine IL-1sRI to mice has increased the survival
of heterotopic heart allografts and reduced the hyperplastic lymph
node response to allogeneic cells (Fanslow, W. C., et al., Science
248:739 (1990)). In a rat model of antigen-induced arthritis, local
installation of the murine IL-1sRI reduced joint swelling and
tissue destruction (Dower, S. K., et al., Therapeutic Immunol.
1:113 (1994)). These data suggest that the amount of IL-1sRI
administered in the normal, contralateral joint was acting
systemically. In a model of experimental autoimmune encephalitits,
the IL-1sRI reduced the severity of this disease (Jacobs, C. A., et
al., J. Immunol. 146:2983 (1991)).
SUMMARY OF THE INVENTION
[0015] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding a human T1
receptor-(T1R-)like ligand II polypeptide having the amino acid
sequence in FIGS. 1A-B (SEQ ID NO:2). The T1R-like ligand II
contains an open reading frame encoding a polypeptide of about 229
amino acid residues including an N-terminal methionine, a leader
sequence of about 26 amino acid residues, an extracellular mature
domain of about 168 residues, a transmembrane domain of about 23
residues and an intracellular domain of about 12 amino acid
residues, and a deduced molecular weight of about 26 kDa. The 203
amino acid sequence of the expected mature T1R-like ligand II
protein is shown in SEQ ID NO:2 (amino acid residues 1-203).
[0016] The invention also provides isolated nucleic acid molecules
encoding an T1R-like ligand II having an amino acid sequence
encoded by the cDNA of the clone deposited as ATCC.TM. Deposit No.
97655 on Jul. 12, 1996. Preferably, the nucleic acid molecule will
encode the mature polypeptide encoded by the above-described
deposited cDNA.
[0017] Thus, one aspect of the invention provides an isolated
nucleic acid molecule comprising a polynucleotide having a
nucleotide sequence selected from the group consisting of: (a) a
nucleotide sequence encoding the T1R-like ligand II polypeptide
having the complete amino acid sequence in SEQ ID NO:2; (b) a
nucleotide sequence encoding the T1R-like ligand II polypeptide
having the complete amino acid sequence in SEQ ID NO:2 but minus
the N-terminal methionine residue; (c) a nucleotide sequence
encoding the mature T1R-like ligand II polypeptide having the amino
acid sequence at positions from about 1 to about 203 in SEQ ID
NO:2; (d) a nucleotide sequence encoding the T1R-like ligand II
polypeptide having the complete amino acid sequence encoded by the
cDNA clone contained in ATCC.TM. Deposit No. 97655; (e) a
nucleotide sequence encoding the mature T1R-like ligand II
polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC.TM. Deposit No. 97655; and (f) a nucleotide
sequence complementary to any of the nucleotide sequences in (a),
(b), (c), (d), or (e) above.
[0018] Further embodiments of the invention include isolated
nucleic acid molecules that comprise a polynucleotide having a
nucleotide sequence at least 90% identical, and more preferably at
least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide
sequences in (a), (b), (c), (d), (e), or (f), above, or a
polynucleotide which hybridizes under stringent hybridization
conditions to a polynucleotide in (a), (b), (c), (d), (e), or (f),
above. This polynucleotide which hybridizes does not hybridize
under stringent hybridization conditions to a polynucleotide having
a nucleotide sequence consisting of only A residues or of only T
residues. An additional nucleic acid embodiment of the invention
relates to an isolated nucleic acid molecule comprising a
polynucleotide which encodes the amino acid sequence of an
epitope-bearing portion of a T1R-like ligand II polypeptide having
an amino acid sequence in (a), (b), (c), (d), or (e), above.
[0019] The present invention also relates to recombinant vectors
which include the isolated nucleic acid molecules of the present
invention, host cells containing the recombinant vectors, and the
production of T1R-like ligand II polypeptides or fragments thereof
by recombinant techniques.
[0020] The invention further provides an isolated T1R-like ligand
II polypeptide having an amino acid sequence selected from the
group consisting of: (a) the amino acid sequence of the T1R-like
ligand II polypeptide having the complete 229 amino acid sequence,
including the leader sequence shown in SEQ ID NO:2; (b) the amino
acid sequence of the T1R-like ligand II polypeptide having the
complete 229 amino acid sequence, including the leader sequence
shown in SEQ ID NO:2 but minus the N-terminal methionine residue;
(c) the amino acid sequence of the mature T1R-like ligand II
polypeptide (without the leader) having the amino acid sequence at
positions 1 to 203 in SEQ ID NO:2; (d) the amino acid sequence of
the T1R-like ligand II polypeptide having the complete amino acid
sequence, including the leader, encoded by the cDNA clone contained
in ATCC.TM. Deposit No. 97655; and (e) the amino acid sequence of
the mature T1R-like ligand II polypeptide having the amino acid
sequence encoded by the cDNA clone contained in ATCC.TM. Deposit
No. 97655. The polypeptides of the present invention also include
polypeptides having an amino acid sequence at least 90% identical,
and more preferably 95%, 96%, 97%, 98% or 99% identical to those
above.
[0021] An additional embodiment of this aspect of the invention
relates to a peptide or polypeptide which has the amino acid
sequence of an epitope-bearing portion of a T1R-like ligand II
polypeptide having an amino acid sequence described in (a), (b),
(c), (d), or (e), above. Peptides or polypeptides having the amino
acid sequence of an epitope-bearing portion of a T1R-like ligand II
polypeptide of the invention include portions of such polypeptides
with at least six or seven, preferably at least nine, and more
preferably at least about 30 amino acids to about 50 amino acids,
although epitope-bearing polypeptides of any length up to and
including the entire amino acid sequence of a polypeptide of the
invention described above also are included in the invention. In
another embodiment, the invention provides an isolated antibody
that binds specifically to a T1R-like ligand II polypeptide having
an amino acid sequence described in (a), (b), (c), (d), or (e)
above.
[0022] The invention also relates to fragments of the
above-described polypeptides. Preferred polypeptide fragments
according to the present invention include a polypeptide
comprising: the mature polypeptide (amino acid residues from about
1 to about 203 in SEQ ID NO:2), the extracellular domain (amino
acid residues from about 1 to about 168 in SEQ ID NO:2), the
transmembrane domain (amino acid residues from about 169 to about
191 in SEQ ID NO:2), the intracellular domain (amino acid residues
from about 192 to about 203 in SEQ ID NO:2), or the extracellular
and intracellular domain with all or part of the transmembrane
domain deleted.
[0023] In addition, the invention provides for fusion polypeptides
of T1R-like ligand II which may be generated through the techniques
of gene-shuffling, motif-shuffling, exon-shuffling and/or
codon-shuffling.
[0024] The invention further provides for proteins containing
polypeptide sequences encoded by the polynucleotides of the
invention. The proteins maybe in the form of monomers or multimers.
The preparation of these proteins and compositions (preferably
pharmaceutical compositions) containing these proteins are also
provided.
[0025] In another embodiment, the invention provides transgenic
animals which express the polypeptides and proteins of the
invention.
[0026] In yet another embodiment, chromosome assays are provided
which allow for chromosome identification. Nucleic acids of the
invention can be used to specifically target and hybridize to a
particular location on an individual human chromosome. Once a
sequence has been mapped to a precise chromosome location, the
physical position of the sequence on the chromosome can be
correlated with genetic map data.
[0027] In another embodiment, the invention provides for antisense
and ribozyme antagonists of T1R-like ligand II.
[0028] It is believed that biological activities of the T1R-like
ligand II of the present invention maybe similar to the biological
activities of the T1R ligand and IL-1. Significantly, higher or
lower levels of T1R-like ligand II may be detected in tissues or
bodily fluids (e.g., serum, plasma, urine, synovial fluid or spinal
fluid) taken from an individual having a T1R ligand- or
IL-1-related disorder, relative to a "normal"T1R-like ligand II
gene expression level, i.e., the expression level in tissue or
bodily fluids from an individual not having the T1R ligand- or
IL-1-related disorder. Thus, detecting expression of T1R-like
ligand II gene expression according to the present invention is a
diagnostic marker. Accordingly, the invention provides for
diagnostic kits used to detect levels of T1R-like ligand II
expression.
[0029] The invention also provides methods for producing and
isolating antibodies that bind specifically to an T1R-like ligand
II polypeptide having an amino acid sequence as described herein.
Such antibodies are useful diagnostically or therapeutically as
described herein.
[0030] The invention is further related to a method for treating an
individual in need of an increased or decreased level of T1R-like
ligand II activity in the body, comprising administering to such an
individual a composition comprising a T1R-like ligand II
polypeptide or an inhibitor thereof.
[0031] As such, pharmaceutical compositions of T1R-like ligand II
are provided. Formulations of T1R-like ligand II are also provided
as are methods for administering therapeutic doses of T1R-like
ligand II polynucleotides, polypeptides, antibodies, agonists,
antagonists and/or fragments and variants thereof.
[0032] Finally, the invention provides for methods of using the
polynucleotides encoding T1R-like ligand II polypeptides,
antibodies, agonists, antagonists, and/or fragments and variants
thereof, in gene therapy.
BRIEF DESCRIPTION OF THE FIGURES
[0033] FIGS. 1A-B shows the nucleotide (SEQ ID NO:1) and deduced
amino acid (SEQ ID NO:2) sequences of the T1R-like ligand II
protein determined by sequencing the cDNA clone contained in
ATCC.TM. Deposit No. 97655. The protein has a leader sequence of
about 26 amino acid residues (first underlined sequence), an
extracellular mature domain of about 168 amino acid residues
(sequence between the first and second underlined sequences), a
transmembrane domain of about 23 amino acid residues (second
underlined sequence), and an intracellular domain of about 12 amino
acid residues (the remaining sequence).
[0034] FIG. 2 shows the regions of similarity between the amino
acid sequences of the T1R-like ligand II and the protein sequence
of GenBank accession No. U41804 (SEQ ID NO:3), showing an overall
56% identity.
[0035] FIG. 3 provides an analysis of the T1R-like ligand II amino
acid sequence. Alpha, beta, turn and coil regions; hydrophilicity
and hydrophobicity; amphipathic regions; flexible regions;
antigenic index and surface probability are shown.
[0036] FIG. 4 shows the effect of T1R-like ligand II containing
supernatant on CD34+ Bone Marrow Proliferation Assay.
DETAILED DESCRIPTION OF THE INVENTION
[0037] The present invention provides an isolated nucleic acid
molecule comprising a polynucleotide encoding a T1R-like ligand II
protein having an amino acid sequence shown in FIGS. 1A-B (SEQ ID
NO:2), which was determined by sequencing a cloned cDNA. The
T1R-like ligand II protein of the present invention shares sequence
homology with the T1R ligand (SEQ ID NO:3).
[0038] The nucleotide sequence in FIGS. 1A-B (SEQ ID NO:1) was
obtained by sequencing the HE9BK24 clone, which was deposited on
Jul. 12, 1996 at the American Type Culture Collection, Patent
Depository, 10801 University Boulevard, Manassas, Va. 20110-2209,
and given accession number 97655. The deposited clone is contained
in the pBluescript SK(-) plasmid (Stratagene, LaJolla, Calif.).
Nucleic Acid Molecules
[0039] Unless otherwise indicated, all nucleotide sequences
determined by sequencing a DNA molecule herein were determined
using an automated DNA sequencer (such as the Model 373 from
Applied Biosystems, Inc.), and all amino acid sequences of peptide,
polypeptides or proteins encoded by DNA molecules determined herein
were expected by translation of a DNA sequence determined as above.
Therefore, as is known in the art for any DNA sequence determined
by this automated approach, any nucleotide sequence determined
herein can contain some errors. Nucleotide sequences determined by
automation are typically at least about 90% identical, more
typically at least about 95% to at least about 99.9% identical to
the actual nucleotide sequence of the sequenced DNA molecule.
[0040] The actual sequence can be more precisely determined by
other approaches including manual DNA sequencing methods well known
in the art. As is also known in the art, a single insertion or
deletion in a determined nucleotide sequence compared to the actual
sequence will cause a frame shift in translation of the nucleotide
sequence such that the expected amino acid sequence encoded by a
determined nucleotide sequence will be completely different from
the amino acid sequence actually encoded by the sequenced DNA
molecule, beginning at the point of such an insertion or
deletion.
[0041] Unless otherwise indicated, each "nucleotide sequence" set
forth herein is presented as a sequence of deoxyribonucleotides
(abbreviated A, G, C and T). However, by "nucleotide sequence" of a
nucleic acid molecule or polynucleotide is intended, for a DNA
molecule or polynucleotide, a sequence of deoxyribonucleotides, and
for an RNA molecule or polynucleotide, the corresponding sequence
of ribonucleotides (A, G, C and U) where each thymidine
deoxynucleotide (T) in the specified deoxynucleotide sequence is
replaced by the ribonucleotide uridine (U). For instance, reference
to an RNA molecule having the sequence in SEQ ID NO:1 set forth
using deoxyribonucleotide abbreviations is intended to indicate an
RNA molecule having a sequence in which each deoxynucleotide A, G
or C in SEQ ID NO:1 has been replaced by the corresponding
ribonucleotide A, G or C, and each deoxynucleotide T has been
replaced by a ribonucleotide U.
[0042] By "isolated" nucleic acid molecule(s) is intended a nucleic
acid molecule, DNA or RNA, which has been removed from its native
environment. For example, recombinant DNA molecules contained in a
vector are considered isolated for the purposes of the present
invention. Further examples of isolated DNA molecules include
recombinant DNA molecules maintained in heterologous host cells or
purified (partially or substantially) DNA molecules in solution.
Isolated RNA molecules include in vivo or in vitro RNA transcripts
of the DNA molecules of the present invention. Isolated nucleic
acid molecules according to the present invention further include
such molecules produced synthetically.
[0043] Using the information provided herein, such as the
nucleotide sequence in FIGS. 1A-B (SEQ ID NO:1), a nucleic acid
molecule of the present invention encoding an T1R-like ligand II
polypeptide can be obtained using standard cloning and screening
procedures, such as those for cloning cDNAs using mRNA as starting
material. Illustrative of the invention, the nucleic acid molecule
described in FIGS. 1A-B (SEQ ID NO: 1) was discovered in a cDNA
library derived from nine week old human embryo tissue. Further,
the gene was also found in cDNA libraries derived from the
following types of human cells: prostate, anergic T-cell, TF274
stromal, WI 38, Soares breast, and Soares placenta.
[0044] The T1R-like ligand II cDNA contains an open reading frame
encoding a protein of about 229 amino acid residues whose
initiation codon is at positions 55-57 of the nucleotide sequence
shown in SEQ ID NO. 1; a predicted leader sequence of about 26
amino acid residues and a deduced molecular weight of about 26 kDa.
The amino acid sequence of the mature T1R-like ligand II protein is
shown in SEQ ID NO:2 from amino acid residue 1 to residue 203. The
mature T1R-like ligand II protein has three main structural
domains. These include the extracellular domain, from amino acid
residue about 1 to about 168 in SEQ ID NO:2; the transmembrane
domain, from amino acid residue about 169 to about 191 in SEQ ID
NO:2; and the intracellular domain, from amino acid residue about
192 to about 203 in SEQ ID NO:2. The T1R-like ligand II protein of
the present invention in SEQ ID NO:2 is about 56% identical and
about 75% similar to the T1R ligand, which can be accessed on
GenBank as Accession No. U41804.
[0045] As indicated, the present invention also provides the mature
form(s) of the T1R-like ligand II protein of the present invention.
According to the signal hypothesis, proteins secreted by mammalian
cells have a signal or secretory leader sequence which is cleaved
from the mature protein once export of the growing protein chain
across the rough endoplasmic reticulum has been initiated. Most
mammalian cells and even insect cells cleave secreted proteins with
the same specificity. However, in some cases, cleavage of a
secreted protein is not entirely uniform, which results in two or
more mature species on the protein. Further, it has long been known
that the cleavage specificity of a secreted protein is ultimately
determined by the primary structure of the complete protein, that
is, it is inherent in the amino acid sequence of the polypeptide.
Therefore, the present invention provides a nucleotide sequence
encoding the mature T1R-like ligand II polypeptides having the
amino acid sequence encoded by the cDNA clone contained in the host
identified as ATCC.TM. Deposit No. 97655 and as shown in SEQ ID
NO:2. By the mature T1R-like ligand II protein having the amino
acid sequence encoded by the cDNA clone contained in the host
identified as ATCC.TM. Deposit 97655 is meant the mature form(s) of
the T1R-like ligand II protein produced by expression in a
mammalian cell (e.g., COS cells, as described below) of the
complete open reading frame encoded by the human DNA sequence of
the clone contained in the vector in the deposited host. As
indicated below, the mature T1R-like ligand II having the amino
acid sequence encoded by the cDNA clone contained in ATCC.TM.
Deposit No. 97655 may or may not differ from the predicted "mature"
T1R-like ligand II protein shown in SEQ ID NO:2 (amino acids from
about 1 to about 203) depending on the accuracy of the predicted
cleavage site based on computer analysis.
[0046] Methods for predicting whether a protein has a secretory
leader as well as the cleavage point for that leader sequence are
available because it is known that much of the cleavage specificity
for a secretory protein resides in certain amino acid residues
within the signal sequence and the N-terminus of the mature
protein, particularly residues immediately surrounding the cleavage
site. For instance, the method of McGeoch (Virus Res. 3:271-286
(1985)) uses the information from a short N-terminal charged region
and a subsequent uncharged region of the complete (uncleaved)
protein. The method of von Heinje (Nucleic Acids Res. 14:4683-4690
(1986)) uses the information from the residues surrounding the
cleavage site, typically residues -13 to +2 where +1 indicates the
amino acid terminus of the mature protein. The accuracy of
predicting the cleavage points of known mammalian secretory
proteins for each of these methods is in the range of 75-80%. von
Heinje, supra. However, the two methods do not always produce the
same predicted cleavage point(s) for a given protein.
[0047] As one of ordinary skill would appreciate, due to the
possibilities of sequencing errors discussed above, as well as the
variability of cleavage sites for leaders in different known
proteins, the actual T1R-like ligand II encoded by the deposited
cDNA comprises about 229 amino acids, but can be anywhere in the
range of215-245 amino acids; and the deduced leader sequence of
this protein is about 26 amino acids, but can be anywhere in the
range of about 15 to about 30 amino acids. Further, for example,
the exact locations of the T1R-like ligand II protein
extracellular, intracellular and transmembrane domains in SEQ ID
NO:2 may vary slightly (e.g., the exact amino acid positions may
differ by about 1 to about 5 residues compared to that shown in SEQ
ID NO:2) depending on the criteria used to define the domain.
[0048] As indicated, nucleic acid molecules of the present
invention can be in the form of RNA, such as mRNA, or in the form
of DNA, including, for instance, cDNA and genomic DNA obtained by
cloning or produced synthetically. The DNA can be double-stranded
or single-stranded. Single-stranded DNA or RNA can be the coding
strand, also known as the sense strand, or it can be the non-coding
strand, also referred to as the anti-sense strand.
[0049] Isolated nucleic acid molecules of the present invention
include DNA molecules comprising an open reading frame (ORF) with
an initiation codon at positions 55-57 of the nucleotide sequence
shown in FIGS. 1A-B (SEQ ID NO:1) and further include DNA molecules
which comprise a sequence substantially different that all or part
of the ORF whose initiation codon is at position 55-57 of the
nucleotide sequence in FIGS. 1A-B (SEQ ID NO:1) but which, due to
the degeneracy of the genetic code, still encode the T1R-like
ligand II protein or a fragment thereof. Of course, the genetic
code is well known in the art. Thus, it would be routine for one
skilled in the art to generate the degenerate variants described
above.
[0050] In another aspect, the invention provides isolated nucleic
acid molecules encoding the T1R-like ligand II protein having an
amino acid sequence encoded by the cDNA clone contained in the
plasmid deposited as ATCC.TM. Deposit No. 97655 on Jul. 12, 1996.
Preferably, this nucleic acid molecule will encode the mature
polypeptide encoded by the above-described deposited cDNA
clone.
[0051] The invention further provides an isolated nucleic acid
molecule having the nucleotide sequence shown in FIGS. 1A-B (SEQ ID
NO:1) or the nucleotide sequence of the T1R-like ligand II cDNA
contained in the above-described deposited clone, or having a
sequence complementary to one of the above sequences. Such isolated
molecules, particularly DNA molecules, are useful as probes for
gene mapping by in situ hybridization with chromosomes and for
detecting expression of the T1R-like ligand II gene in human
tissue, for instance, by Northern blot analysis. As described in
detail herein, detecting altered T1R-like ligand II gene expression
in certain tissues may be indicative of certain disorders.
[0052] The present invention is further directed to fragments of
the isolated nucleic acid molecules described herein. By a fragment
of an isolated nucleic acid molecule having, for example, the
nucleotide sequence of the deposited cDNA ATCC.TM. No. 97655, a
nucleotide sequence encoding the polypeptide sequence encoded by
the deposited cDNA, a nucleotide sequence encoding the polypeptide
sequence depicted in FIGS. 1A-B (SEQ ID NO:2), the nucleotide
sequence shown in FIGS. 1A-B (SEQ ID NO: 1), or the complementary
strand thereto, is intended fragments at least 15 nt, and more
preferably at least about 20 nt, still more preferably at least 30
nt, and even more preferably, at least about 40, 50, 100, 150, 200,
250, 300, 325, 350, 375, 400, 450, 500, 550, 600 or 650 nt in
length. These fragments have numerous uses which include, but are
not limited to, diagnostic probes and primers as discussed herein.
Of course, larger fragments, such as those of 700-1244 nt in length
are also useful according to the present invention as are fragments
corresponding to most, if not all, of the nucleotide sequences of
the deposited cDNA ATCC.TM. No. 97655 or as shown in FIGS. 1A-B
(SEQ ID NO:1). By a fragment at least 20 nt in length, for example,
is intended fragments which include 20 or more contiguous bases
from, for example, the nucleotide sequence of the deposited cDNA,
or the nucleotide sequence as shown in FIGS. 1A-B (SEQ ID
NO:1).
[0053] Since the gene has been deposited and the nucleotide
sequence shown in FIGS. 1A-B (SEQ ID NO:1) is provided, generating
such DNA fragments would be routine to the skilled artisan. For
example, restriction endonuclease cleavage or shearing by
sonication could easily be used to generate fragments of various
sizes. Alternatively, such fragments could be generated
synthetically.
[0054] Representative examples of T1R-like ligand II polynucleotide
fragments of the invention include, for example, fragments that
comprise, or alternatively, consist of, a sequence from about
nucleotide 1 to 50, 51 to 100, 101 to 150, 151 to 200, 201 to 250,
251 to 300, 301 to 350, 351 to 400, 401 to 450, 451 to 500, 501 to
550, 551 to 600, 600 to 650, 651 to 700, 701 to 750, 751 to 800,
800 to 850, 851 to 900, 901 to 950, 951 to 1000, 1001 to 1050, 1051
to 1100, 1101 to 1150, and/or 1151 to 1210 of SEQ ID NO:1, or the
complementary strand thereto, or the cDNA contained in the
deposited plasmid. In this context "about" includes the
particularly recited ranges, larger or smaller by several (5, 4, 3,
2, or 1) nucleotides, at either terminus or at both termini.
[0055] Preferred nucleic acid fragments of the present invention
include nucleic acid molecules encoding: a polypeptide comprising
the T1R-like ligand II extracellular domain (amino acid residues
from about 1 to about 168 in SEQ ID NO:2); a polypeptide comprising
the T1R-like ligand II transmembrane domain (amino acid residues
from about 169 to about 191 in SEQ ID NO:2); a polypeptide
comprising the T1R-like ligand II intracellular domain (amino acid
residues from about 192 to about 203 in SEQ ID NO:2); and a
polypeptide comprising the T1R-like ligand II extracellular and
intracellular domains having all or part of the transmembrane
domain deleted. Further preferred nucleic acid fragments of the
present invention include nucleic acid molecules encoding
epitope-bearing portions of the T1R-like ligand II protein. In
particular, isolated nucleic acid molecules are provided encoding
polypeptides comprising the following amino acid residues in SEQ ID
NO:2, which the present inventors have determined are hydrophilic
regions of the T1R-like ligand II protein: a polypeptide comprising
amino acid residues from about 17 to about 26 in SEQ ID NO:2; a
polypeptide comprising amino acid residues from about 56 to about
72 in SEQ ID NO:2; a polypeptide comprising amino acid residues
from about 103 to about 120 in SEQ ID NO:2; a polypeptide
comprising amino acid residues from about 136 to about 149 in SEQ
ID NO:2; and a polypeptide comprising amino acid residues from
about 155 to about 171 in SEQ ID NO:2. Methods for determining
other such epitope-bearing portions of the T1R-like ligand II
protein are described in detail herein.
[0056] Preferably, the polynucleotide fragments of the invention
encode a polypeptide which demonstrates a T1R-like ligand II
functional activity. By a polypeptide demonstrating a T1R-like
ligand II "functional activity" is meant, a polypeptide capable of
displaying one or more known functional activities associated with
a fall-length (complete) or soluble T1R-like ligand II protein.
Such functional activities include, but are not limited to,
biological activity (e.g., ability to regulate (e.g., stimulate)
hematopoiesis in vitro or in vivo), antigenicity [ability to bind
(or compete with a T1R-like ligand II polypeptide for binding) to
an anti-T1R-like ligand II antibody], immunogenicity (ability to
generate antibody which binds to a T1R-like ligand II polypeptide),
ability to form multimers with T1R-like ligand II polypeptides of
the invention, and ability to bind to a receptor or ligand for a
T1R-like ligand II polypeptide.
[0057] The functional activity of T1R-like ligand II polypeptides,
and fragments, variants derivatives, and analogs thereof, can be
assayed by various methods.
[0058] For example, in one embodiment where one is assaying for the
ability to bind or compete with full-length T1R-like ligand II
polypeptide for binding to anti-T1R-like ligand II antibody,
various immunoassays known in the art can be used, including but
not limited to, competitive and non-competitive assay systems using
techniques such as radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoradiometric
assays, gel diffusion precipitation reactions, immunodiffusion
assays, in situ immunoassays (using colloidal gold, enzyme or
radioisotope labels, for example), western blots, precipitation
reactions, agglutination assays (e.g., gel agglutination assays,
hemagglutination assays), complement fixation assays,
immunofluorescence assays, protein A assays, and
immunoelectrophoresis assays, etc. In one embodiment,
antibodybinding is detected by detecting a label on the primary
antibody. In another embodiment, the primary antibody is detected
by detecting binding of a secondary antibody or reagent to the
primary antibody. In a further embodiment, the secondary antibody
is labeled. Many means are known in the art for detecting binding
in an immunoassay and are within the scope of the present
invention.
[0059] In another embodiment, where a T1R-like ligand II
polypeptide ligand is identified, or the ability of a polypeptide
fragment, variant or derivative of the invention to multimerize is
being evaluated, binding can be assayed, e.g., by means well-known
in the art, such as, for example, reducing and non-reducing gel
chromatography, protein affinity chromatography, and affinity
blotting. See generally, Phizicky, E., et al., 1995, Microbiol.
Rev. 59:94-123. In another embodiment, physiological correlates of
T1R-like ligand II binding to its substrates (signal transduction)
can be assayed.
[0060] In addition, assays described herein and otherwise known in
the art may routinely be applied to measure the ability of T1R-like
ligand II polypeptides and fragments, variants derivatives and
analogs thereof to elicit T1R-like ligand II related biological
activity [e.g., to regulate (e.g., to stimulate or inhibit)
hematopoiesis in vitro or in vivo]. For example, techniques known
in the art (such as for example assaying for thymidine
incorporation), may be applied or routinely modified to assay for
the ability of the compositions of the invention to inhibit
proliferation of hematopoietic cells.
[0061] Other methods will be known to the skilled artisan and are
within the scope of the invention.
[0062] In addition, the present inventors have identified nucleic
acid molecules having nucleotide sequences related to extensive
portions of SEQ ID NO:1 which have been determined from the
following related cDNA clone: HPVAA83R (SEQ ID NO:11).
[0063] The following public ESTs are related to extensive portions
of SEQ ID NO:1: GenBank accession No. AA013099 (SEQ ID NO:12),
GenBank accession No. AA251084 (SEQ ID NO:13), GenBank accession
No. R58562 (SEQ ID NO:14), GenBank accession No. N28878 (SEQ ID
NO:15), GenBank accession No. AA019348 (SEQ ID NO:16), GenBank
accession No. N49615 (SEQ ID NO:17), GenBank accession No. AA112675
(SEQ ID NO:18), GenBank accession No. AA082161 (SEQ ID NO: 19),
GenBank accession No. H03613 (SEQ ID NO:20), GenBank accession No.
R54717 (SEQ ID NO:21), GenBank accession No. H27167 (SEQ ID NO:22),
GenBank accession No. AA188741 (SEQ ID NO:23), GenBank accession
No. AA094735 (SEQ ID NO:24) and GenBank accession No. AA285143 (SEQ
ID NO:25).
[0064] In another aspect, the invention provides an isolated
nucleic acid molecule comprising a polynucleotide which hybridizes
under stringent hybridization conditions to a portion of the
polynucleotide in a nucleic acid molecule of the invention
described above, for instance, the cDNA clone contained in ATCC.TM.
Deposit 97655. By "stringent hybridization conditions" is intended
overnight incubation at 42.degree. C. in a solution comprising: 50%
formamide, 5.times.SSC (750 mM NaCl, 75 mM trisodium citrate), 50
mM sodium phosphate (pH 7.6), 5.times. Denhardt's solution, 10%
dextran sulfate, and 20 .mu.g/ml denatured, sheared salmon sperm
DNA, followed by washing the filters in 0.1.times.SSC at about
65.degree. C. By a polynucleotide which hybridizes to a "portion"
of a polynucleotide is intended a polynucleotide (either DNA or
RNA) hybridizing to at least about 15 nucleotides (nt), and more
preferably at least about 20 nt, still more preferably at least
about 30 nt, and even more preferably at least about 30-70 nt of
the reference polynucleotide. These are useful as diagnostic probes
and primers as discussed above and in more detail herein.
[0065] Of course, polynucleotides hybridizing to a larger portion
of the reference polynucleotide (e.g., the deposited cDNA clone),
for instance, a portion 100, 150, 200, 250, 300, 350, 400, 450,
500, 550, 600, or 650 nt in length, or even to the entire length of
the reference polynucleotide, also are useful as probes according
to the present invention, as are polynucleotides corresponding to
most, if not all, of the nucleotide sequence of the deposited cDNA
or the nucleotide sequence as shown in FIGS. 1A-B (SEQ ID NO:1). By
a portion of a polynucleotide of "at least 20 nt in length," for
example, is intended 20 or more contiguous nucleotides from the
nucleotide sequence of the reference polynucleotide, (e.g., the
deposited cDNA or the nucleotide sequence as shown in FIGS. 1A-B
(SEQ ID NO:1)). As indicated, such portions are useful
diagnostically either as a probe according to conventional DNA
hybridization techniques or as primers for amplification of a
target sequence by the polymerase chain reaction (PCR), as
described, for instance, in Sambrook, J. et al., eds., Molecular
Cloning, A Laboratory Manual, 2nd. edition, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989).
[0066] Since an T1R-like ligand II cDNA clone has been deposited
and its determined nucleotide sequence is provided in FIGS. 1A-B
(SEQ ID NO:1), generating polynucleotides which hybridize to a
portion of the T1R-like ligand II cDNA molecule would be routine to
the skilled artisan. For example, restriction endonuclease cleavage
or shearing by sonication of the T1R-like ligand II cDNA clone
could easily be used to generate DNA portions of various sizes
which are polynucleotides that hybridize to a portion of the
T1R-like ligand II cDNA molecule. Alternatively, the hybridizing
polynucleotides of the present invention could be generated
synthetically according to known techniques.
[0067] Of course, a polynucleotide which hybridizes only to a poly
A sequence (such as the 3' terminal poly(A) tract of the T1R-like
ligand II cDNA shown in FIGS. 1A-B (SEQ ID NO:1)), or to a
complementary stretch of T (or U) resides, would not be included in
a polynucleotide of the invention used to hybridize to a portion of
a nucleic acid of the invention, since such a polynucleotide would
hybridize to any nucleic acid molecule contain a poly (A) stretch
or the complement thereof (e.g., practically any double-stranded
cDNA clone).
[0068] As indicated, nucleic acid molecules of the present
invention which encode the T1R-like ligand II can include, but are
not limited to, those encoding the amino acid sequence of the
mature polypeptide, by itself; the coding sequence for the mature
polypeptide and additional sequences, such as those encoding the
about 26 amino acid leader sequence, such as a pre-, or pro- or
prepro-protein sequence; the coding sequence of the mature
polypeptide, with or without the aforementioned additional coding
sequences, together with additional, non-coding sequences,
including for example, but not limited to introns and non-coding 5'
and 3' sequences, such as the transcribed, non-translated sequences
that play a role in transcription, mRNA processing--including
splicing and polyadenylation signals, e.g., ribosome binding and
stability of mRNA; an additional coding sequence which codes for
additional amino acids, such as those which provide additional
functionalities. Thus, the sequence encoding the polypeptide can be
fused to a marker sequence, such as a sequence encoding a peptide
which facilitates purification of the fused polypeptide. In certain
preferred embodiments of this aspect of the invention, the marker
amino acid sequence is a hexa-histidine peptide, such as the tag
provided in a pQE vector (Qiagen, Inc.), among others, many of
which are publicly and/or commercially available. As described in
Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for
instance, hexa-histidine provides for convenient purification of
the fusion protein. The "HA" tag is another peptide useful for
purification which corresponds to an epitope derived from the
influenza hemagglutinin (HA) protein, which has been described by
Wilson et al., Cell 37:767 (1984). Other such fusion proteins
include the T1R-like ligand II protein or a fragment thereof fused
to Fc at the N- or C-terminus.
[0069] The present invention further relates to variants of the
nucleic acid molecules of the present invention, which encode
portions, analogs or derivatives of the T1R-like ligand II protein.
Variants can occur naturally, such as a natural allelic variant. By
an "allelic variant" is intended one of several alternate forms of
a gene occupying a given locus on a chromosome of an organism.
Non-naturally occurring variants may be produced using art-known
mutagenesis techniques, which include, but are not limited to
oligonucleotide mediated mutagenesis, alanine scanning, PCR
mutagenesis, site directed mutagenesis (see e.g., Carter et al.,
Nucl. Acids Res. 13:4331 (1986); and Zoller et al., Nucl. Acids
Res. 10:6487 (1982)), cassette mutagenesis (see e.g., Wells et al.,
Gene 34:315 (1985)), restriction selection mutagenesis (see e.g.,
Wells et al., Philos. Trans. R. Soc. London SerA 317:415
(1986)).
[0070] Such variants include those produced by nucleotide
substitutions, deletions or additions. The substitutions, deletions
or additions can involve one or more nucleotides. The variants can
be altered in coding or non-coding regions or both. Alterations in
the coding regions can produce conservative or non-conservative
amino acid substitutions, deletions or additions. Especially
preferred among these are silent substitutions, additions and
deletions, which do not alter the properties and activities of the
T1R-like ligand II or portions thereof. Also especially preferred
in this regard are conservative substitutions.
[0071] Further embodiments of the invention include isolated
nucleic acid molecules comprising a polynucleotide having a
nucleotide sequence at least 90% identical, and more preferably at
least 95%, 96%, 97%, 98% or 99% identical to (a) a nucleotide
sequence encoding the polypeptide having the amino acid sequence in
SEQ ID NO:2; (b) a nucleotide sequence encoding the polypeptide
having the amino acid sequence in SEQ ID NO:2, but lacking the
N-terminal methionine; (c) a nucleotide sequence encoding the
polypeptide having the amino acid sequence at positions from about
1 to about 203 in SEQ ID NO:2; (d) a nucleotide sequence encoding
the polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC.TM. Deposit No. 97655; (e) a nucleotide
sequence encoding the mature T1R-like ligand II polypeptide having
the amino acid sequence encoded by the cDNA clone contained in
ATCC.TM. Deposit No.97655; or (f) a nucleotide sequence
complementary to any of the nucleotide sequences in (a), (b), (c),
(d), or (e).
[0072] By a polynucleotide having a nucleotide sequence at least,
for example, 95% "identical" to a reference nucleotide sequence
encoding a T1R-like ligand II polypeptide is intended that the
nucleotide sequence of the polynucleotide is identical to the
reference sequence except that the polynucleotide sequence may
include up to five mutations per each 100 nucleotides of the
reference nucleotide sequence encoding the T1R-like ligand II
polypeptide. In other words, to obtain a polynucleotide having a
nucleotide sequence at least 95% identical to a reference
nucleotide sequence, up to 5% of the nucleotides in the reference
sequence can be deleted or substituted with another nucleotide, or
a number of nucleotides up to 5% of the total nucleotides in the
reference sequence may be inserted into the reference sequence.
These mismatches of the reference sequence can occur at the 5' or
3' terminal positions of the reference nucleotide sequence or
anywhere between those terminal positions, interspersed either
individually among nucleotides in the reference sequence or in one
or more contiguous groups within the reference sequence. The
reference (query) sequence may be the entire T1R-like ligand II
encoding nucleotide sequence shown in FIGS. 1A-B (SEQ ID NO:1) or
any T1R-like ligand II polynucleotide fragment (e.g., a
polynucleotide encoding the amino acid sequence of any of the
T1R-like ligand II--and/or C-terminal deletions described herein),
variant, derivative or analog, as described herein.
[0073] As a practical matter, whether any particular nucleic acid
molecule is at least 90%, 95%, 96%, 97%, 99% identical to, for
instance, the encoding nucleotide sequence shown in FIGS. 1A-B (SEQ
ID NO:1), or to the nucleotide sequence of the deposited cDNA
plasmid, can be determined conventionally using known computer
programs such as the BESTFIT.TM. program (Wisconsin Sequence
Analysis Package, Version 8 for Unix, Genetics Computer Group,
University Research Park, 575 Science Drive, Madison, Wis. 53711).
BESTFIT.TM. uses the local homology algorithm of Smith and
Waterman, Advances in Applied Mathematics 2:482-489 (1981), to find
the best segment of homology between two sequences. When using
BESTFIT.TM. or any other sequence alignment program to determine
whether a particular sequence is, for instance, 95% identical to a
reference sequence according to the present invention, the
parameters are set, of course, such that the percentage of identity
is calculated over the fall length of the reference nucleotide
sequence and that gaps in homology of up to 5% of the total number
of nucleotides in the reference sequence are allowed.
[0074] In a specific embodiment, the identity between a reference
(query) sequence (a sequence of the present invention) and a
subject sequence, also referred to as a global sequence alignment,
is determined using the FASTDB computer program based on the
algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)).
Preferred parameters used in a FASTDB alignment of DNA sequences to
calculate percent identity are: Matrix=Unitary, k-tuple=4, Mismatch
Penalty=1, Joining Penalty=30, Randomization Group Length=0, Cutoff
Score=1, Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or
the length of the subject nucleotide sequence, whichever is
shorter. According to this embodiment, if the subject sequence is
shorter than the query sequence because of 5' or 3' deletions, not
because of internal deletions, a manual correction is made to the
results to take into consideration the fact that the FASTDB program
does not account for 5' and 3' truncations of the subject sequence
when calculating percent identity. For subject sequences truncated
at the 5' or 3' ends, relative to the query sequence, the percent
identity is corrected by calculating the number of bases of the
query sequence that are 5' and 3' of the subject sequence, which
are not matched/aligned, as a percent of the total bases of the
query sequence.
[0075] A determination of whether a nucleotide is matched/aligned
is determined by results of the FASTDB sequence alignment. This
percentage is then subtracted from the percent identity, calculated
by the above FASTDB program using the specified parameters, to
arrive at a final percent identity score. This corrected score is
what is used for the purposes of this embodiment. Only bases
outside the 5' and 3' bases of the subject sequence, as displayed
by the FASTDB alignment, which are not matched/aligned with the
query sequence, are calculated for the purposes of manually
adjusting the percent identity score. For example, a 90 base
subject sequence is aligned to a 100 base query sequence to
determine percent identity. The deletions occur at the 5' end of
the subject sequence and therefore, the FASTDB alignment does not
show a matched/alignment of the first 10 bases at 5' end. The 10
unpaired bases represent 10% of the sequence (number ofbases at the
5' and 3' ends not matched/total number ofbases in the query
sequence) so 10% is subtracted from the percent identity score
calculated by the FASTDB program. If the remaining 90 bases were
perfectly matched the final percent identity would be 90%.
[0076] In another example, a 90 base subject sequence is compared
with a 100 base query sequence. This time the deletions are
internal deletions so that there are no bases on the 5' or 3' of
the subject sequence which are not matched/aligned with the query.
In this case the percent identity calculated by FASTDB is not
manually corrected. Once again, only bases 5' and 3' of the subject
sequence which are not matched/aligned with the query sequence are
manually corrected for. No other manual corrections are made for
the purposes of this embodiment.
[0077] The present application is directed to nucleic acid
molecules at least 90%, 95%, 96%, 97%, 98identical to the nucleic
acid sequences disclosed herein, (e.g., encoding a polypeptide
having the amino acid sequence of an N and/or C terminal deletion
disclosed herein, such as, for example, a nucleic acid molecule
encoding amino acids--26 to 203 of SEQ ID NO:2), irrespective of
whether they encode a polypeptide having T1R-like ligand II
functional activity. This is because even where a particular
nucleic acid molecule does not encode a polypeptide having T1R-like
ligand II functional activity, one of skill in the art would still
know how to use the nucleic acid molecule, for instance, as a
hybridization probe or a polymerase chain reaction (PCR)
primer.
[0078] Uses of the nucleic acid molecules of the present invention
that do not encode a polypeptide having T1R-like ligand II
functional activity include, inter alia, (1) isolating a T1R-like
ligand II gene or allelic or splice variants thereof in a cDNA
library; (2) in situ hybridization (e.g., "FISH") to metaphase
chromosomal spreads to provide precise chromosomal location of the
T1R-like ligand II gene, as described in Verma et al., Human
Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York
(1988); and (3) Northern Blot analysis for detecting T1R-like
ligand II mRNA expression in specific tissues.
[0079] Preferred, however, are nucleic acid molecules having
sequences at least 90%, 95%, 96%, 97%, 98% identical to thenucleic
acid sequences disclosed herein, which do, infact, encode
apolypeptide having T1R-like ligand II functional activity. By "a
polypeptide having T1R-like ligand II functional activity" is
intended polypeptides exhibiting activity similar, but not
necessarily identical, to a functional activity of the T1R-like
ligand II polypeptides of the present invention (e.g., complete
(full-length) T1R-like ligand II, mature T1 R-like ligand II and
soluble T1R-like Ligand II (e.g., having sequences contained in the
extracellular domain of T1R-like ligand II) as measured, for
example, in a particular immunoassay or biological assay. For
example, a T1R-like ligand II functional activity can routinely be
measured by determining the ability of a T1R-like ligand II
polypeptide to bind a T1R-like ligand II ligand. T1R-like ligand II
functional activity may also be measured by determining the ability
of a polypeptide, such as cognate ligand which is free or expressed
on a cell surface, to induce hematopoiesis in cells expressing the
polypeptide.
[0080] T1R-like ligand II activity can be further assayed using
known receptor binding assays (Mitchar, J. L. et al., J. Biol.
Chem. 271:5777-5783 (1996); and Gayle, M. A. et al., J. Biol. Chem.
271:5784-5789 (1996)). These assays include an NF-.kappa..beta. gel
shift assay, an in vitro Thr-669 kinase assay, and an IL-8 promoter
activation assay.
[0081] To perform these assays, it is first necessary to transfect
mammalian cells with an expression vector containing the cDNA for a
suitable receptor. For example, an expression vector containing the
cDNA for the T1/ST2 receptor can be used. This cDNA can be obtained
as described (Klemenz, R. et al., Proc. Natl. Acad. Sci. U.S.A.
86:5708-5712 (1989); Tominaga, S., FEBS Lett. 258:301-304; Bergers,
G. et al. EMBO J. 13:1176-1188)). Alternatively, T1/ST2 cDNA can be
amplified using the polymerase chain reaction. A commercially
available cDNA library, prepared from mRNA from a suitable tissue
or cell type (such as NIH-3T3 cells (Klemenz, R. et al., Proc.
Natl. Acad. Sci. U.S.A. 86:5708-5712 (1989)), can be used as
template. Using any of several transfection methods well known to
those of ordinary skill in the art, a suitable cell line (e.g., COS
7 cells) can be transfected with the T1/ST2 expression plasmid.
Expression of the receptor can be verified by radioimmunoassay (see
Mitcham, J. L. et al., J. Biol. Chem. 271:5777-5783 (1996)). One to
three days post-transfection, confluent transfected COS7 cells are
stimulated with 1-10 ng of T1R-like ligand II protein for 15
minutes to 20 hours. Duration of stimulation by T1R-like ligand II
protein will vary, depending on which assay is used, and can be
determined using only routine experimentation.
[0082] To perform the NF-.kappa..beta. assay, nuclear extracts from
transfected cells are prepared immediately after stimulation
(Ostrowski, J. et al., J. Biol. Chem. 266: 12722-12733 (1991)). A
double-stranded synthetic oligonucleotide probe containing the
NF-.kappa..beta. enhancer element from the immunoglobulin .kappa.
light chain is 5'-end labeled by phosphorylation with
[.gamma.-.sup.32P]ATP (5' TGACAGAGGGACTTTCCGAGAGGA 3' (SEQ ID
NO:10)). Nuclear extracts (10 .mu.g) are incubated with
radiolabeled probe for 20 minutes at room temperature, and
protein-DNA complexes are resolved by electrophoresis in a
0.5.times.TBE, 10% polyacrylamide gel.
[0083] To perform the in vitro Thr-669 kinase assay, cytoplasmic
extracts of transfected cells are prepared immediately after
stimulation (Bird, T. A. et al., Cytokine 4:429-440 (1992)). 10
.mu.l of cell extract is added to 20 .mu.l of reaction mixture
containing 20 mM HEPES buffer (pH 7.4), 15 mM MgCl.sub.2, 15 .mu.M
ATP, 75 .mu.Ci/ml [.gamma.-.sup.32P]ATP, and 750 .mu.M substrate
peptide (residues 663-673 of EGFR). Blanks are incubated with
distilled H.sub.2O in place of the peptide. After incubation at
30.degree. C. for 20 minutes, the reactions are terminated by
addition of formic acid. Reactions are cleared by centrifugation,
and 30 .mu.l of supernatant are spotted on phosphocellulose paper
discs. After washing (three times with 75 mM orthophosphoric acid)
and drying, peptide-incorporated counts are determined by
monitoring Cerenkov counts. Results are expressed as the ratio of
Thr-669 kinase activity detected in nonstimulated cells compared to
activity detected in stimulated cells.
[0084] To perform the IL-8 promoter activation assay, COS7 cells
(1.times.10.sup.5 cells per well in a multi-well tissue culture
plate) are cotransfected with the T1/ST2 receptor expression vector
and the pIL8p reporter plasmid (Mitcham, J. L. et al., J. Biol.
Chem. 271:5777-5783 (1996)). One day post-transfection, the medium
is changed and cells are either stimulated with 1 ng/ml IL-1.alpha.
or are left stimulated. 12-16 hours post-stimulation, cells are
washed twice with binding medium containing 5% (w/v) non-fat
drymilk (5% MBM) and blocked with 2 ml of 5% MBM at room
temperature for 30 minutes. Cells are then incubated at room
temperature for 60-90 minutes with 1.5 ml/well of 5% MBM containing
1 .mu.g/ml of an anti-IL-2R.alpha. antibody (R&D Systems,
Minneapolis, Minn.) with gentle rocking. Cells are washed once with
5% MBM and incubated with 1 ml/well of 5% MBM containing 1:100
dilution of .sup.125I-goat anti-mouse IgG (Sigma, St. Louis, Mo.)
for 60 minutes at room temperature. Wells are washed four times
with 5% MBM and twice with phosphate-buffered saline. Wells are
stripped by the addition of 1 ml of 0.5 M NaOH, and total counts
are determined. Results are expressed as total cpm averaged over
two duplicate or three triplicate wells.
[0085] Thus, "a polypeptide having T1R-like ligand II protein
activity" includes polypeptides that exhibit T1R-like ligand II
protein activity in at least one of the above-described assays.
[0086] Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that a large
number of the nucleic acid molecules having a sequence at least
90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid
sequence of the deposited cDNA, the nucleic acid sequence shown in
FIGS. 1A-B (SEQ ID NO:1), or fragments thereof, will encode
polypeptides "having T1R-like ligand II functional activity." In
fact, since degenerate variants of any of these nucleotide
sequences all encode the same polypeptide, in many instances, this
will be clear to the skilled artisan even without performing the
above described comparison assay. It will be further recognized in
the art that, for such nucleic acid molecules that are not
degenerate variants, a reasonable number will also encode a
polypeptide having T1R-like ligand II functional activity. This is
because the skilled artisan is fully aware of amino acid
substitutions that are either less likely or not likely to
significantly effect protein function (e.g., replacing one
aliphatic amino acid with a second aliphatic amino acid), as
further described herein.
[0087] For example, guidance concerning how to make phenotypically
silent amino acid substitutions is provided in Bowie, J. U. et al.,
Science 247:1306-1310 (1990), wherein the authors indicate that
there are two main approaches for studying the tolerance of an
amino acid sequence to change. The first method relies on the
process of evolution, in which mutations are either accepted or
rejected by natural selection. The second approach uses genetic
engineering to introduce amino acid changes at specific positions
of a cloned gene and selections or screens to identify sequences
that maintain functionality. As the authors state, these studies
have revealed that proteins are surprisingly tolerant of amino acid
substitutions. The authors further indicate which amino acid
changes are likely to be permissive at a certain position of the
protein. For example, most buried amino acid residues require
nonpolar side chains, whereas few features of surface side chains
are generally conserved. Other such phenotypically silent
substitutions are described in Bowie, J. U., et al., supra, and the
references cited therein.
Vectors and Host Cells
[0088] The present invention also relates to vectors which include
the isolated DNA molecules of the present invention, host cells
which are genetically engineered with the recombinant vectors, and
the production of T1R-like ligand II polypeptides or fragments
thereof by recombinant techniques.
[0089] Recombinant constructs may be introduced into host cells
using well known techniques such as infection, transduction,
transfection, transvection, electroporation and transformation. The
vector may be, for example, a phage, plasmid, viral or retroviral
vector. Retroviral vectors maybe replication competent or
replication defective. In the latter case, viral propagation
generally will occur only in complementing host cells.
[0090] The polynucleotides may be joined to a vector containing a
selectable marker for propagation in a host. Generally, a plasmid
vector is introduced in a precipitate, such as a calcium phosphate
precipitate, or in a complex with a charged lipid. If the vector is
a virus, it may be packaged in vitro using an appropriate packaging
cell line and then transduced into host cells.
[0091] Preferred are vectors comprising cis-acting control regions
to the polynucleotide of interest. Appropriate transacting factors
may be supplied by the host, supplied by a complementing vector or
supplied by the vector itself upon introduction into the host.
[0092] In certain preferred embodiments in this regard, the vectors
provide for specific expression, which may be inducible and/or cell
type-specific. Particularly preferred among such vectors are those
inducible by environmental factors that are easy to manipulate,
such as temperature and nutrient additives.
[0093] Expression vectors useful in the present invention include
chromosomal-, episomal- and virus-derived vectors, e.g., vectors
derived from bacterial plasmids, bacteriophage, yeast episomes,
yeast chromosomal elements, viruses such as baculoviruses, papova
viruses, vaccinia viruses, adenoviruses, fowl pox viruses,
pseudorabies viruses and retroviruses, and vectors derived from
combinations thereof, such as cosmids and phagemids.
[0094] The DNA insert should be operatively linked to an
appropriate promoter, such as the phage lambda PL promoter, the E.
coli lac, trp and tac promoters, the SV40 early and late promoters
and promoters of retroviral LTRs, to name a few. Other suitable
promoters will be known to the skilled artisan. The expression
constructs will further contain sites for transcription initiation,
termination and, in the transcribed region, a ribosome binding site
for translation. The coding portion of the mature transcripts
expressed by the constructs will include a translation initiating
AUG at the beginning and a termination codon appropriately
positioned at the end of the polypeptide to be translated.
[0095] As indicated, the expression vectors will preferably include
at least one selectable marker. Such markers include dihydrofolate
reductase or neomycin resistance for eukaryotic cell culture and
tetracycline or ampicillin resistance genes for culturing in E.
coli and other bacteria. Representative examples of appropriate
hosts include bacterial cells, such as E. coli, Streptomyces and
Salmonella typhimurium cells; fungal cells, such as yeast cells;
insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal
cells such as CHO, COS and Bowes melanoma cells; and plant cells.
Appropriate culture media and conditions for the above-described
host cells are known in the art.
[0096] Among vectors preferred for use in bacteria include pQE70,
pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript
vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A,
available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540,
pRIT5 available from Pharmacia. Among preferred eukaryotic vectors
are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene;
pSVK3, pBPV, pMSG and pSVL available from Pharmacia, and pA2
available from Qiagen. Other suitable vectors will be readily
apparent to the skilled artisan.
[0097] Among known bacterial promoters suitable for use in the
present invention include the E. coli lacI and lacZ promoters, the
T3 and T7 promoters, the gpt promoter, the lambda PR and PL
promoters and the trp promoter. Suitable eukaryotic promoters
include the CMV immediate early promoter, the HSV thymidine kinase
promoter, the early and late SV40 promoters, the promoters of
retroviral LTRs, such as those of the Rous sarcoma virus (RSV), and
metallothionein promoters, such as the mouse metallothionein-I
promoter.
[0098] Introduction of the construct into the host cell can be
effected by calcium phosphate transfection, DEAE-dextran mediated
transfection, cationic lipid-mediated transfection,
electroporation, transduction, infection or other methods. Such
methods are described in many standard laboratory manuals, such as
Davis et al., Basic Methods in Molecular Biology (1986).
[0099] In addition to encompassing host cells containing the vector
constructs discussed herein, the invention also encompasses
primary, secondary, and immortalized host cells of vertebrate
origin, particularly mammalian origin, that have been engineered to
delete or replace endogenous genetic material (e.g., T1R-like
ligand II coding sequence), and/or to include genetic material
(e.g., heterologous polynucleotide sequences) that is operably
associated with T1R-like ligand II polynucleotides of the
invention, and which activates, alters, and/or amplifies endogenous
T1R-like ligand II polynucleotides. For example, techniques known
in the art may be used to operably associate heterologous control
regions (e.g., promoter and/or enhancer) and endogenous T1R-like
ligand II polynucleotide sequences via homologous recombination
(see, e.g., U.S. Pat. No. 5,641,670; International Publication
Number WO 96/29411; International application publication number WO
94/12650; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935
(1989); and Zijlstra et al., Nature 342:435-438 (1989), the
disclosures of each of which are incorporated by reference in their
entireties).
[0100] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes may be increased by
inserting an enhancer sequence into the vector. Enhancers are
cis-acting elements of DNA, usually about from 10 to 300 bp that
act to increase transcriptional activity of a promoter in a given
host cell-type. Examples of enhancers include the SV40 enhancer,
which is located on the late side of the replication origin at bp
100 to 270, the cytomegalovirus early promoter enhancer, the
polyoma enhancer on the late side of the replication origin, and
adenovirus enhancers.
[0101] For secretion of the translated protein into the lumen of
the endoplasmic reticulum, into the periplasmic space or into the
extracellular environment, appropriate secretion signals may be
incorporated into the expressed polypeptide. The signals may be
endogenous to the polypeptide or they may be heterologous
signals.
[0102] In one embodiment, polynucleotides encoding T1R-like ligand
II polypeptides of the invention maybe fused to the pelB pectate
lyase signal sequence to increase the efficiency to expression and
purification of such polypeptides in Gram-negative bacteria. See,
U.S. Pat. Nos. 5,576,195 and 5,846,818, the contents of which are
herein incorporated by reference in their entireties.
[0103] Thus, the polypeptide may be expressed in a modified form,
such as a fusion protein, and may include not only secretion
signals but also additional heterologous functional regions. For
instance, a region of additional amino acids, particularly charged
amino acids, may be added to the N-terminus of the polypeptide to
improve stability and persistence in the host cell, during
purification or during subsequent handling and storage. Also,
peptide moieties may be added to the polypeptide to facilitate
purification. Such regions may be removed prior to final
preparation of the polypeptide. The addition of peptide moieties to
polypeptides to engender secretion or excretion, to improve
stability and to facilitate purification, among others, are
familiar and routine techniques in the art. A preferred fusion
protein comprises a heterologous region from immunoglobulin that is
useful to solubilize proteins.
[0104] For example, EP-A-O 464 533 (Canadian counterpart 2045869)
discloses fusion proteins comprising various portions of constant
region of immunoglobulin molecules together with another human
protein or part thereof. In many cases, the Fc part in a fusion
protein is thoroughly advantageous for use in therapy and diagnosis
and thus results, for example, in improved pharmacokinetic
properties (EP-A 0232 262). On the other hand, for some uses it
would be desirable to be able to delete the Fc part after the
fusion protein has been expressed, detected and purified in the
advantageous manner described. This is the case when Fc portion
proves to be a hindrance to use in therapy and diagnosis, for
example when the fusion protein is to be used as antigen for
immunizations. In drug discovery, for example, human proteins, such
as, hIL5-has been fused with Fc portions for the purpose of
high-throughput screening assays to identify antagonists of hIL-5.
See, D. Bennett et al., Journal of Molecular Recognition, Vol. 8
52-58 (1995) and K. Johanson et al., The Journal of Biological
Chemistry, Vol. 270, No. 16, pp 9459-9471 (1995).
[0105] The T1R-like ligand II can be recovered and purified from
recombinant cell cultures by well-known methods including ammonium
sulfate or ethanol precipitation, acid extraction, anion or cation
exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Most
preferably, high performance liquid chromatography ("HPLC") is
employed for purification.
[0106] In addition, proteins of the invention can be chemically
synthesized using techniques known in the art (e.g., see Creighton,
1983, Proteins: Structures and Molecular Principles, W.H. Freeman
& Co., N.Y., and Hunkapiller, M., et al., Nature 310:105-111
(1984)). For example, a peptide corresponding to a fragment of the
T1R-like ligand II polypeptides of the invention can be synthesized
by use of a peptide synthesizer. Furthermore, if desired,
nonclassical amino acids or chemical amino acid analogs can be
introduced as a substitution or addition into the T1R-like ligand
II polypeptide sequence. Non-classical amino acids include, but are
not limited to, to the D-isomers of the common amino acids,
2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric
acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic
acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid,
ornithine, norleucine, norvaline, hydroxyproline, sarcosine,
citrulline, homocitrulline, cysteic acid, t-butylglycine,
t-butylalanine, phenylglycine, cyclohexylalanine, b-alanine,
fluoro-amino acids, designer amino acids such as b-methyl amino
acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid
analogs in general. Furthermore, the amino acid can be D
(dextrorotary) or L (levorotary).
[0107] The T1R-like ligand II proteins of the invention may be
modified by either natural processes, such as posttranslational
processing, or by chemical modification techniques which are well
known in the art. It will be appreciated that the same type of
modification may be present in the same or varying degrees at
several sites in a given T1R-like ligand II polypeptide. T1R-like
ligand II polypeptides may be branched, for example, as a result of
ubiquitination, and they may be cyclic, with or without branching.
Cyclic, branched, and branched cyclic T1R-like ligand II
polypeptides may result from posttranslation natural processes or
may be made by synthetic methods.
[0108] Modifications include acetylation, acylation,
ADP-ribosylation, amidation, covalent attachment of flavin,
covalent attachment of a heme moiety, covalent attachment of a
nucleotide or nucleotide derivative, covalent attachment of a lipid
or lipid derivative, covalent attachment of phosphotidylinositol,
cross-linking, cyclization, disulfide bond formation,
demethylation, formation of covalent cross-links, formation of
cysteine, formation of pyroglutamate, formylation,
gamma-carboxylation, glycosylation, GPI anchor formation,
hydroxylation, iodination, methylation, myristoylation, oxidation,
pegylation, proteolytic processing, phosphorylation, prenylation,
racemization, selenoylation, sulfation, transfer-RNA mediated
addition of amino acids to proteins such as arginylation, and
ubiquitination. (See, for instance, PROTEINS--STRUCTURE AND
MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and
Company, New York (1993); POSTTRANSLATIONAL COVALENT MODIFICATION
OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York, pgs.
1-12 (1983); Seifter et al., Meth Enzymol 182:626-646 (1990);
Rattan et al., Ann NY Acad Sci 663:48-62 (1992).)
[0109] The invention additionally, encompasses T1R-like ligand II
polypeptides which are differentially modified during or after
translation, e.g., by glycosylation, acetylation, phosphorylation,
amidation, iodination, derivatization by known protecting/blocking
groups, proteolytic cleavage, linkage to an antibody molecule or
other cellular ligand, etc. Any of numerous chemical modifications
may be carried out by known techniques, including but not limited
to, specific chemical cleavage by cyanogen bromide, trypsin,
chymotrypsin, papain, V8 protease, NaBH.sub.4, acetylation,
formylation, oxidation, reduction, metabolic synthesis in the
presence of tunicamycin; etc.
[0110] Additional post-translational modifications encompassed by
the invention include, for example, N-linked or O-linked
carbohydrate chains, processing of N-terminal or C-terminal ends,
attachment of chemical moieties to the amino acid backbone,
chemical modifications of N-linked or O-linked carbohydrate chains,
and addition or deletion of an N-terminal methionine residue as a
result of procaryotic host cell expression. The polypeptides may
also be modified with a detectable label, such as an enzymatic,
fluorescent, isotopic or affinity label to allow for detection and
isolation of the protein.
[0111] Also provided by the invention are chemically modified
derivatives of T1R-like ligand II which may provide additional
advantages such as increased solubility, stability and circulating
time of the polypeptide, or decreased immunogenicity (see U.S. Pat.
No. 4,179,337). The chemical moieties for derivitization may be
selected from water soluble polymers such as polyethylene glycol,
ethylene glycol/propylene glycol copolymers,
carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
The polypeptides may be modified at random positions within the
molecule, or at predetermined positions within the molecule and may
include one, two, three or more attached chemical moieties.
[0112] The polymer maybe of any molecular weight, and maybe
branched or unbranched. For polyethylene glycol, the preferred
molecular weight is between about 1 kDa and about 100 kDa (the term
"about" indicating that in preparations of polyethylene glycol,
some molecules will weigh more, some less, than the stated
molecular weight) for ease in handling and manufacturing. Other
sizes may be used, depending on the desired therapeutic profile
(e.g., the duration of sustained release desired, the effects, if
any on biological activity, the ease in handling, the degree or
lack of antigenicity and other known effects of the polyethylene
glycol to a therapeutic protein or analog).
[0113] The polyethylene glycol molecules (or other chemical
moieties) should be attached to the protein with consideration of
effects on functional or antigenic domains of the protein. There
are a number of attachment methods available to those skilled in
the art, e.g., EP 0 401 384, herein incorporated by reference
(coupling PEG to G-CSF), see also Malik et al., Exp. Hematol.
20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl
chloride). For example, polyethylene glycol may be covalently bound
through amino acid residues via a reactive group, such as, a free
amino or carboxyl group. Reactive groups are those to which an
activated polyethylene glycol molecule may be bound. The amino acid
residues having a free amino group may include lysine residues and
the N-terminal amino acid residues; those having a free carboxyl
group may include aspartic acid residues glutamic acid residues and
the C-terminal amino acid residue. Sulflhydryl groups may also be
used as a reactive group for attaching the polyethylene glycol
molecules. Preferred for therapeutic purposes is attachment at an
amino group, such as attachment at the N-terminus or lysine
group.
[0114] One may specifically desire proteins chemically modified at
the N-terminus. Using polyethylene glycol as an illustration of the
present composition, one may select from a variety of polyethylene
glycol molecules (by molecular weight, branching, etc.), the
proportion of polyethylene glycol molecules to protein (or peptide)
molecules in the reaction mix, the type of pegylation reaction to
be performed, and the method of obtaining the selected N-terminally
pegylated protein. The method of obtaining the N-terminally
pegylated preparation (i.e., separating this moiety from other
monopegylated moieties if necessary) may be by purification of the
N-terminally pegylated material from a population of pegylated
protein molecules. Selective proteins chemically modified at the
N-terminus modification may be accomplished by reductive alkylation
which exploits differential reactivity of different types of
primary amino groups (lysine versus the N-terminal) available for
derivatization in a particular protein. Under the appropriate
reaction conditions, substantially selective derivatization of the
protein at the N-terminus with a carbonyl group containing polymer
is achieved.
[0115] Thus, polypeptides of the present invention include
naturally purified products, products of chemical synthetic
procedures, and products produced by recombinant techniques from a
prokaryotic or eukaryotic host, including, for example, bacterial,
yeast, higher plant, insect and mammalian cells. Depending upon the
host employed in a recombinant production procedure, the
polypeptides of the present invention may be glycosylated or may be
non-glycosylated. In addition, polypeptides of the invention may
also include an initial modified methionine residue, in some cases
as a result of host-mediated processes.
Polypeptides and Peptides of T1R-like Ligand II
[0116] The invention further provides an isolated T1R-like ligand
II polypeptide having the amino acid sequence encoded by the
deposited cDNA, or the amino acid sequence in FIGS. 1A-B (SEQ ID
NO:2), or a peptide or polypeptide comprising a portion of the
above polypeptides. The terms "peptide" and "oligopeptide" are
considered synonymous (as is commonly recognized) and each term can
be used interchangeably as the context requires to indicate a chain
of at least two amino acids coupled by peptidyl linkages. The word
"polypeptide" is used herein for chains containing more than ten
amino acid residues. All oligopeptide and polypeptide formulas or
sequences herein are written from left to right and in the
direction from amino terminus to carboxy terminus.
[0117] By "isolated" polypeptide or protein is intended a
polypeptide or protein removed from its native environment. For
example, recombinantly produced polypeptides and proteins expressed
in host cells are considered isolated for purposes of the invention
as are native or recombinant polypeptides and proteins which have
been substantially purified by any suitable technique such as, for
example, the one-step method described in Smith and Johnson, Gene
67:31-40 (1988).
[0118] It will be recognized in the art that some amino acid
sequence of the T1R-like ligand II can be varied without
significant effect on the structure or function of the protein. If
such differences in sequence are contemplated, it should be
remembered that there will be critical areas on the protein which
determine activity. In general, it is possible to replace residues
which form the tertiary structure, provided that residues
performing a similar function are used. In other instances, the
type of residue maybe completely unimportant if the alteration
occurs at a non-critical region of the protein.
[0119] Thus, the invention further includes variations of the
T1R-like ligand II which show substantial T1R-like ligand II
activity or which include regions of T1R-like ligand II such as the
protein portions discussed herein. Such mutants include deletions,
insertions, inversions, repeats, and type substitutions (for
example, substituting one hydrophilic residue for another, but not
strongly hydrophilic for strongly hydrophobic as a rule). Small
changes or such "neutral" amino acid substitutions will generally
have little effect on activity.
[0120] Typically seen as conservative substitutions are the
replacements, one for another, among the aliphatic amino acids Ala,
Val, Leu and Ile; interchange of the hydroxyl residues Ser and Thr,
exchange of the acidic residues Asp and Glu, substitution between
the amide residues Asn and Gln, exchange of the basic residues Lys
and Arg and replacements among the aromatic residues Phe, Tyr.
[0121] As indicated in detail above, further guidance concerning
which amino acid changes are likely to be phenotypically silent
(i.e., are not likely to have a significant deleterious effect on a
function) can be found in Bowie, J. U., et al., "Deciphering the
Message in Protein Sequences: Tolerance to Amino Acid
Substitutions," Science 247:1306-1310 (1990).
[0122] Thus, the fragment, derivative or analog of the polypeptide
of SEQ ID NO:2, or that encoded by the deposited cDNA, may be (i)
one in which one or more of the amino acid residues are substituted
with a conserved or non-conserved amino acid residue (preferably a
conserved amino acid residue) and such substituted amino acid
residue may or may not be one encoded by the genetic code, or (ii)
one in which one or more of the amino acid residues includes a
substituent group, or (iii) one in which the mature polypeptide is
fused with another compound, such as a compound to increase the
half-life of the polypeptide (for example, polyethylene glycol), or
(iv) one in which the additional amino acids are fused to the
mature polypeptide, such as an IgG Fc fusion region peptide or
leader or secretory sequence or a sequence which is employed for
purification of the mature polypeptide or a proprotein sequence.
Such fragments, derivatives and analogs are deemed to be within the
scope of those skilled in the art from the teachings herein.
[0123] Of particular interest are substitutions of charged amino
acids with another charged amino acid and with neutral or
negatively charged amino acids. The latter results in proteins with
reduced positive charge to improve the characteristics of the
T1R-like ligand II protein. The prevention of aggregation is highly
desirable. Aggregation of proteins not only results in a loss of
activity but can also be problematic when preparing pharmaceutical
formulations, because they can be immunogenic. (Pinckard et al.,
Clin Exp. Immunol. 2:331-340 (1967); Robbins et al., Diabetes
36:838-845 (1987); Cleland et al. Crit. Rev. Therapeutic Drug
Carrier Systems 10:307-377 (1993)).
[0124] The replacement of amino acids can also change the
selectivity of binding to cell surface receptors. Ostade et al.,
Nature 361:266-268 (1993) describes certain mutations resulting in
selective binding of TNF-.alpha. to only one of the two known types
of TNF receptors. Thus, the T1R-like ligand II of the present
invention may include one or more amino acid substitutions,
deletions or additions, either from natural mutations or human
manipulation.
[0125] As indicated, changes are preferably of a minor nature, such
as conservative amino acid substitutions that do not significantly
affect the folding or activity of the protein (see Table 1).
TABLE-US-00001 TABLE 1 Conservative Amino Acid Substitutions
Aromatic Phenylalanine Tryptophan Tyrosine Hydrophobic Leucine
Isoleucine Valine Polar Glutamine Asparagine Basic Arginine Lysine
Histidine Acidic Aspartic Acid Glutamic Acid Small Alanine Serine
Threonine Methionine Glycine
[0126] Of course, the number of amino acid substitutions a skilled
artisan would make depends on many factors, including those
described above. Generally speaking, the number of substitutions
for any given PAPAI polypeptide will not be more than 50, 40, 30,
20, 10, 5, or 3.
[0127] Amino acids in the T1R-like ligand II protein of the present
invention that are essential for function can be identified by
methods known in the art, such as site-directed mutagenesis or
alanine-scanning mutagenesis (Cunningham and Wells, Science
244:1081-1085 (1989)). The latter procedure introduces single
alanine mutations at every residue in the molecule. The resulting
mutant molecules are then tested for biological activity such as
receptor binding or in vitro, or in vivo proliferative activity.
Sites that are critical for ligand-receptor binding can also be
determined by structural analysis such as crystallization, nuclear
magnetic resonance or photoaffinity labeling (Smith et al., J. Mol.
Biol. 224:899-904 (1992) and de Vos et al. Science 255:306-312
(1992)).
[0128] The polypeptides of the present invention are preferably
provided in an isolated form. By "isolated polypeptide" is intended
a polypeptide removed from its native environment. Thus, a
polypeptide produced and/or contained within a recombinant host
cell is considered isolated for purposes of the present invention.
Also intended as an "isolated polypeptide" are polypeptides that
have been purified, partially or substantially, from a recombinant
host cell or a native source. For example, a recombinantly produced
version of the T1R-like ligand II polypeptide can be substantially
purified by the one-step method described in Smith and Johnson,
Gene 67:31-40 (1988).
[0129] The polypeptides of the present invention include the
polypeptide encoded by the deposited cDNA including the leader; the
mature polypeptide encoded by the deposited the cDNA minus the
leader (i.e., the mature protein); a polypeptide comprising amino
acids about -26 to about 203 in SEQ ID NO:2; a polypeptide
comprising amino acids about -25 to about 203 in SEQ ID NO:2; a
polypeptide comprising amino acids about 1 to about 203 in SEQ ID
NO:2; as well as polypeptides at least 90% identical, and more
preferably at least 95%, 96%, 97%, 98% or 99% identical to the
polypeptide encoded by the deposited cDNA, to the polypeptide of
SEQ ID NO:2, and also include portions of such polypeptides with at
least 30 amino acids and more preferably at least 50 amino
acids.
[0130] By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a reference amino acid sequence of a
T1R-like ligand II polypeptide is intended that the amino acid
sequence of the polypeptide is identical to the reference sequence
except that the polypeptide sequence may include up to five amino
acid alterations per each 100 amino acids of the reference amino
acid of a T1R-like ligand II. In other words, to obtain a
polypeptide having an amino acid sequence at least 95% identical to
a reference amino acid sequence, up to 5% of the amino acid
residues in the reference sequence may be deleted or substituted
with another amino acid, or a number of amino acids up to 5% of the
total amino acid residues in the reference sequence may be inserted
into the reference sequence. These alterations of the reference
sequence may occur at the amino or carboxy terminal positions of
the reference amino acid sequence or anywhere between those
terminal positions, interspersed either individually among residues
in the reference sequence or in one or more contiguous groups
within the reference sequence.
[0131] As a practical matter, whether any particular polypeptide is
at least 90%, 95%, 96%, 97%, 98% or 99 % identical to, for
instance, the amino acid sequence shown in FIGS. 1A-B (SEQ ID
NO:2), the amino acid sequence encoded by the deposited cDNA clone,
or fragments thereof, can be determined conventionally using known
computer programs such the BESTFIT.TM. program (Wisconsin Sequence
Analysis Package, Version 8 for Unix, Genetics Computer Group,
University Research Park, 575 Science Drive, Madison, Wis. 53711).
When using BESTFIT.TM. or any other sequence alignment program to
determine whether a particular sequence is, for instance, 95%
identical to a reference sequence according to the present
invention, the parameters are set, of course, such that the
percentage of identity is calculated over the full length of the
reference amino acid sequence and that gaps in homology of up to 5%
of the total number of amino acid residues in the reference
sequence are allowed.
[0132] In a specific embodiment, the identity between a reference
(query) sequence (a sequence of the present invention) and a
subject sequence, also referred to as a global sequence alignment,
is determined using the FASTDB computer program based on the
algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)).
Preferred parameters used in a FASTDB amino acid alignment are:
Matrix=PAM 0, k-tuple=2, Mismatch Penalty=1, Joining Penalty=20,
Randomization Group Length=0, Cutoff Score=1, Window Size=sequence
length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or
the length of the subject amino acid sequence, whichever is
shorter. According to this embodiment, if the subject sequence is
shorter than the query sequence due to N- or C-terminal deletions,
not because of internal deletions, a manual correction is made to
the results to take into consideration the fact that the FASTDB
program does not account for N- and C-terminal truncations of the
subject sequence when calculating global percent identity. For
subject sequences truncated at the N-- and C-termini, relative to
the query sequence, the percent identity is corrected by
calculating the number of residues of the query sequence that are
N- and C-terminal of the subject sequence, which are not
matched/aligned with a corresponding subject residue, as a percent
of the total bases of the query sequence. A determination of
whether a residue is matched/aligned is determined by results of
the FASTDB sequence alignment. This percentage is then subtracted
from the percent identity, calculated by the above FASTDB program
using the specified parameters, to arrive at a final percent
identity score. This final percent identity score is what is used
for the purposes of this embodiment. Only residues to the N- and
C-termini of the subject sequence, which are not matched/aligned
with the query sequence, are considered for the purposes of
manually adjusting the percent identity score. That is, only query
residue positions outside the farthest N- and C-terminal residues
of the subject sequence. For example, a 90 amino acid residue
subject sequence is aligned with a 100 residue query sequence to
determine percent identity. The deletion occurs at the N-terminus
of the subject sequence and therefore, the FASTDB alignment does
not show a matching/alignment of the first 10 residues at the
N-terminus. The 10 unpaired residues represent 10% of the sequence
(number of residues at the N- and C-termini not matched/total
number ofresidues in the query sequence) so 10% is subtracted from
the percent identity score calculated by the FASTDB program. If the
remaining 90 residues were perfectly matched the final percent
identity would be 90%. In another example, a 90 residue subject
sequence is compared with a 100 residue query sequence. This time
the deletions are internal deletions so there are no residues at
the N- or C-termini of the subject sequence which are not
matched/aligned with the query. In this case the percent identity
calculated by FASTDB is not manually corrected. Once again, only
residue positions outside the N- and C-terminal ends of the subject
sequence, as displayed in the FASTDB alignment, which are not
matched/aligned with the query sequence are manually corrected for.
No other manual corrections are made for the purposes of this
embodiment.
[0133] In another embodiment of the present invention, there are
provided fragments of the polypeptides described herein. Preferred
fragments include: the extracellular domain (amino acid residues
from about 1 to about 168 in SEQ ID NO: 2); the transmembrane
domain (amino acid residues from about 169 to about 191 in SEQ ID
NO: 2); the intracellular domain (amino acid residues from about
192 to about 203 in SEQ ID NO: 2); and the intracellular domain
with all or part of the transmembrane domain deleted.
[0134] For many proteins, it is well known in the art that one or
more amino acids maybe deleted from the N-terminus or C-terminus
without substantial loss of biological function. However, even if
deletion of one or more amino acids from the N-terminus or
C-terminus of a protein results in modification or loss of one or
more biological functions of the protein, other T1R-like Receptor
ligand functional activities (e.g., biological activities (e.g.,
ability to regulate hematopoiesis), ability to multimerize, ability
to bind T1R-like ligand II polypeptide ligand) may still be
retained. For example, the ability of shortened T1R-like ligand II
mutants to induce and/or bind to antibodies which recognize the
complete or mature forms of the polypeptides generally will be
retained when less than the majority of the residues of the
complete or mature polypeptide are removed from the N-terminus.
Whether a particular polypeptide lacking N-terminal residues of a
complete polypeptide retains such immunologic activities can
readily be determined by routine methods described herein and
otherwise known in the art. It is not unlikely that an T1R-like
ligand II mutant with a large number of deleted N-terminal amino
acid residues may retain some biological or immunogenic activities.
In fact, peptides composed of as few as six amino acid residues may
often evoke an immune response.
[0135] Accordingly, the present invention further provides
polypeptides having one or more residues deleted from the amino
terminus of the T1R-like ligand II amino acid sequence shown in
FIGS. 1A-B (i.e., SEQ ID NO:2), up to the Lys residue at position
number 198 and polynucleotides encoding such polypeptides.
[0136] In particular, the present invention provides polypeptides
comprising the amino acid sequence of residues n to 202 of SEQ ID
NO:2, where n is an integer from 2 to 198 corresponding to the
position of the amino acid residue in SEQ ID NO:2. Preferably,
N-terminal deletions of the T1R-like ligand II polypeptide of the
invention shown as SEQ ID NO:2 include polypeptides comprising, or
alternatively consisting of, an amino acid sequence selected from
amino acid residues: F-2 to T-203; T-3 to T-203; P-4 to T-203; S-5
to T-203; L-6 to T-203; D-7 to T-203; S-8 to T-203; D-9 to T-203;
F-10 to T-203; T-11 to T-203; F-12 to T-203; T-13 to T-203; L-14 to
T-203; P-15 to T-203; A-16 to T-203; G-17 to T-203; Q-18 to T-203;
K-19 to T-203; E-20 to T-203; C-21 to T-203; F-22 to T-203; Y-23 to
T-203; Q-24 to T-203; P-25 to T-203; M-26 to T-203; P-27 to T-203;
L-28 to T-203; K-29 to T-203; A-30 to T-203; S-31 to T-203; L-32 to
T-203; E-33 to T-203; I-34 to T-203; E-35 to T-203; Y-36 to T-203;
Q-37 to T-203; V-38 to T-203; L-39 to T-203; D-40 to T-203; G-41 to
T-203; A-42 to T-203; G-43 to T-203; L-44 to T-203; D-45 to T-203;
I-46 to T-203; D-47 to T-203; F-48 to T-203; H-49 to T-203; L-50 to
T-203; A-51 to T-203; S-52 to T-203; P-53 to T-203; E-54 to T-203;
G-55 to T-203; K-56 to T-203; T-57 to T-203; L-58 to T-203; V-59 to
T-203; F-60 to T-203; E-61 to T-203; Q-62 to T-203; R-63 to T-203;
K-64 to T-203; S-65 to T-203; D-66 to T-203; G-67 to T-203; V-68
T-203; H-69 to T-203; T-70 to T-203; V-71 to T-203; E-72 to T-203;
T-73 to T-203; E-74 to T-203; V-75 to T-203; G-76 to T-203; D-77 to
T-203; Y-78 to T-203; M-79 to T-203; F-80 to T-203; C-81 to T-203;
F-82 to T-203; D-83 to T-203; N-84 to T-203; T-85 to T-203; F-86 to
T-203; S-87 to T-203; T-88 to T-203; I-89 to T-203; S-90 to T-203;
E-91 to T-203; K-92 to T-203; V-93 to T-203; I-94 to T-203; F-95 to
T-203; F-96 to T-203; E-97 to T-203; L-98 to T-203; I-99 to T-203;
L-100 to T-203; D-101 to T-203; N-102 to T-203; M-103 to T-203;
G-104 to T-203; E-105 to T-203; Q-106 to T-203; A-107 to T-203;
Q-108 to T-203; E-109 to T-203; Q-110 to T-203; E-111 to T-203;
D-112 to T-203; W113 to T-203; K-114 to T-203; K-115 to T-203;
Y-116 to T-203; I-117 to T-203; T-118 to T-203; G-119 to T-203;
T-120 to T-203; D-121 to T-203; I-122 to T-203; L-123 to T-203;
D-124 to T-203; M-125 to T-203; K-126 to T-203; L-127 to T-203;
E-128 to T-203; D-129 to T-203; I-130 to T-203; L-131 to T-203;
E-132 to T-203; S-133 to T-203; I-134 to T-203; N-135 to T-203;
S-136 to T-203; I-137 to T-203; K-138 to T-203; S-139 to T-203;
R-140 to T-203; L-141 to T-203; S-142 to T-203; K-143 to T-203;
S-144 to T-203; G-145 to T-203; H-146 to T-203; I-147 to T-203;
Q-148 to T-203; T-149 to T-203; L-150 to T-203; L-151 to T-203;
R-152 to T-203; A-153 to T-203; F-154 to T-203; E-155 to T-203;
A-156 to T-203; R-157 to T-203; D-158 to T-203; R-159 to T-203;
N-160 to T-203; I-161 to T-203; Q-162 to T-203; E-163 to T-203;
S-164 to T-203; N-165 to T-203; F-166 to T-203; D-167 to T-203;
R-168 to T-203; V-169 to T-203; N-170 to T-203; F-171 to T-203;
W-172 to T-203; S-173 to T-203; M-174 to T-203; V-175 to T-203;
N-176 to T-203; L-177 to T-203; V-178 to T-203; V-179 to T-203;
M-180 to T-203; V-181 to T-203; V-182 to T-203; V-183 to T-203;
S-184 to T-203; A-185 to T-203; I-186 to T-203; Q-187 to T-203;
V-188 to T-203; Y-189 to T-203; M-190 to T-203; L-191 to T-203;
K-192 to T-203; S-193 to T-203; L-194 to T-203; F-195 to T-203;
E-196 to T-203; D-197 to T-203; and K-198 to T-203; of SEQ ID NO:2.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0137] Additionally, N-terminal deletions of the T1R-like ligand II
polypeptide of the invention shown as SEQ ID NO:2 also include
polypeptides comprising, or alternatively consisting of, an amino
acid sequence selected from amino acid residues: F-2 to R-168; T-3
to R-168; P-4 to R-168; S-5 to R-168; L-6 to R-168; D-7 to R-168;
S-8 to R-168; D-9 to R-168; F-10 to R-168; T-11 to R-168; F-12 to
R-168; T-13 to R-168; L-14 to R168; P-15 to R-168; A-16 to R-168;
G-17 to R-168; Q-18 to R-168; K-19 to R-168; E-20 to R-168; C-21 to
R-168; F-22 to R-168; Y-23 to R-168; Q-24 to R-168; P-25 to R-168;
M-26 to R-168; P-27 to R-168; L-28 to R-168; K-29 to R-168; A-30 to
R-168; S-31 to R-168; L-32 to R-168; E-33 to R-168; I-34 to R-168;
E-35 to R-168; Y-36 to R-168; Q-37 to R-168; V-38 to R-168; L-39 to
R-168; D-40 to R-168; G-41 to R-168; A-42 to R-168; G-43 to R-168;
L-44 to R-168; D-45 to R-168; I-46 to R-168; D-47 to R-168; F-48 to
R-168; H-49 to R-168; L-50 to R-168; A-51 to R-168; S-52 to R-168;
P-53 to R-168; E-54 to R-168; G-55 to R-168; K-56 to R-168; T-57 to
R-168; L-58 to R-168; V-59 to R-168; F-60 to R-168; E-61 to R-168;
Q-62 to R-168; R-63 to R-168; K-64 to R-168; S-65 to R-168; D-66 to
R-168; G-67 to R-168; V-68 to R-168; H-69 to R-168; T-70 to R-168;
V-71 to R-168; E-72 to R-168; T-73 to R-168; E-74 to R-168; V-75 to
R-168; G-76 to R-168; D-77 to R-168; Y-78 to R-168; M-79 to R-168;
F-80 to R-168; C-81 to R-168; F-82 to R-168; D-83 to R-168; N-84 to
R-168; T-85 to R-168; F-86 to R-168; S-87 to R-168; T-88 to R-168;
1-89 to R-168; S-90 to R-168; E-91 to R-168; K-92 to R-168; V-93 to
R-168; I-94 to R-168; F-95 to R-168; F-96 to R-168; E-97 to R-168;
L-98 to R-168; I-99 to R-168; L-100 to R-168; D-101 to R-168; N-102
to R-168; M-103 to R-168; G-104 to R-168; E-105 to R-168; Q-106 to
R-168; A-107 to R-168; Q-108 to R-168; E-109 to R-168; Q-110 to
R-168; E-111 to R-168; D-112 to R-168; W-113 to R-168; K-114 to
R-168; K-115 to R-168; Y-116 to R-168; I-117 to R-168; T-118 to
R-168; G-119 to R-168; T-120 to R-168; D-121 to R-68; I-122 to
R-168; L-123 to R-168; D-124 to R-168; M-125 to R-168; K-126 to
R-168; L-127 to R-168; E-128 to R-168; D-129 to R-168; I-130 to
R-168; L-131 to R-168; E-132 to R-168; S-133 to R-168; I-134 to
R-168; N-135 to R-168; S-136 to R-168; I-137 to R-168; K-138 to
R-168; S-139 to R-168; R-140 to R-168; L-141 to R-168; S-142 to
R-168; K-143 to R-168; S-144 to R-168; G-145 to R-168; H-146 to
R-168; I-147 to R-168; Q-148 to R-168; T-149 to R-168; L-150 to
R-168; L-151 to R-168; R-152 to R-168; A-153 to R-168; F-154 to
R-168; E-155 to R-168; A-156 to R-168; R-157 to R-168; D-158 to
R-168; R-159 to R-168; N-160 to R-168; I-161 to R-168; Q-162 to
R-168; and E-163 to R-168; of SEQ ID NO:2. Polynucleotides encoding
these polypeptides are also encompassed by the invention.
[0138] Also as mentioned above, even if deletion of one or more
amino acids from the C-terminus of a protein results in
modification of loss of one or more biological functions of the
protein, other functional activities (e.g., biological activities
(e.g., ability to regulate hematopoiesis), ability to multimerize,
ability to bind T1R-like ligand II polypeptide ligand) may still be
retained. For example the ability of the shortened T1R-like ligand
II mutant to induce and/or bind to antibodies which recognize the
complete or mature forms of the polypeptide generally will be
retained when less than the majority of the residues of the
complete or mature polypeptide are removed from the C-terminus.
Whether a particular polypeptide lacking C-terminal residues of a
complete polypeptide retains such immunologic activities can
readily be determined by routine methods described herein and
otherwise known in the art. It is not unlikely that an T1R-like
ligand II mutant with a large number of deleted C-terminal amino
acid residues may retain some biological or immunogenic activities.
In fact, peptides composed of as few as six amino acid residues may
often evoke an immune response.
[0139] Accordingly, the present invention further provides
polypeptides having one or more residues deleted from the carboxy
terminus of the amino acid sequence of the T1R-like ligand II
polypeptide shown in SEQ ID NO:2, up to the Leu residue at position
number 6, and polynucleotides encoding such polypeptides.
[0140] In particular, the present invention provides polypeptides
comprising the amino acid sequence of residues 1 to m of FIGS. 1A-B
(i.e., SEQ ID NO:2), where m is an integer from 6 to 202
corresponding to the position of the amino acid residue in SEQ ID
NO:2.
[0141] Preferably, C-terminal deletions of the T1R-like ligand II
polypeptide of the invention shown as SEQ ID NO:2 include
polypeptides comprising, or alternatively consisting of, an amino
acid sequence selected from amino acid residues: G-1 to R-202; G-1
to S-201; G-1 to K-200; G-1 to R-199; G-1 to K-198; G-1 to D-197;
G-1 to E-196; G-1 to F-195; G-1 to L-194; G-1 to S-193; G-1 to
K-192; G-1 to L-191; G-1 to M-190; G-1 to Y-189; G-1 to V-188; G-1
to Q-187; G-1 to I-186; G-1 to A-185; G-1 to S-184; G-1 to V-183;
G-1 to V-182; G-1 to V-181; G-1 to M-180; G-1 to V-179; G-1 to
V-178; G-1 to L-177; G-1 to N-176; G-1 to V-175; G-1 to M-174; G-1
to S-173; G-1 to W-172; G-1 to F-171; G-1 to N-170; G-1 to V-169;
G-1 to R-168; G-1 to D-167; G-1 to F-166; G-1 to N-165; G-1 to
S-164; G-1 to E-163; G-1 to Q-162; G-1 to I-161; G-1 to N-160; G-1
to R-159; G-1 to D-158; G-1 to R-157; G-1 to A-156; G-1 to E-155;
G-1 to F-154; G-1 to A-153; G-1 to R-152; G-1 to L-151; G-1 to
L-150; G-1 to T-149; G-1 to Q-148; G-1 to I-147; G-1 to H-146; G-1
to G-145; G-1 to S-144; G-1 to K-143; G-1 to S-142; G-1 to L-141;
G-1 to R-140; G-1 to S-139; G-1 to K-138; G-1 to I-137; G-1 to
S-136; G-1 to N-135; G-1 to I-134; G-1 to S-133; G-1 to E-132; G-1
to L-131; G-1 to I-130; G-1 to D-129; G-1 to E-128; G-1 to L-127;
G-1 to K-126; G-1 to M-125; G-1 to D-124; G-1 to L-123; G-1 to
I-122; G-1 to D-121; G-1 to T-120; G-1 to G-119; G-1 to T-118; G-1
to I-117; G-1 to Y-116; G-1 to K-115; G-1 to K-114; G-1 to W-113;
G-1 to D-112; G-1 to E-111; G-1 to Q-110; G-1 to E-109; G-1 to
Q-108; G-1 to A-107; G-1 to Q-106; G-1 to E-105; G-1 to G-104; G-1
to M-103; G-1 to N-102; G-1 to D-101; G-1 to L-100; G-1 to I-99;
G-1 to L-98; G-1 to E-97; G-1 to F-96; G-1 to F-95; G-1 to I-94;
G-1 to V-93; G-1 to K-92; G-1 to E-91; G-1 to S-90; G-1 to I-89;
G-1 to T-88; G-1 to S-87; G-1 to F-86; G-1 to T-85; G-1 to N-84;
G-1 to D-83; G-1 to F-82; G-1 to C-81; G-1 to F-80; G-1 to M-79;
G-1 to Y-78; G-1 to D-77; G-1 to G-76; G-1 to V-75; G-1 to E-74;
G-1 to T-73; G-1 to E-72; G-1 to V-71; G-1 to T-0; G-1 to H-69; G-1
to V-68; G-1 to G-67; G-1 to D-66; G-1 to S-65; G-1 to K-64; G-1 to
R-63; G-1 to Q-62; G-1 to E-61; G-1 to F-60; G-1 to V-59; G-1 to
L-58; G-1 to T-57; G-1 to K-56; G-1 to G-55; G-1 to E-54; G-1 to
P-53; G-1 to S-52; G-1 to A-51; G-1 to L-50; G-1 to H-49; G-1 to
F-48; G-1 to D-47; G-1 to I-46; G-1 to D-45; G-1 to L-44; G-1 to
G-43; G-1 to A-42; G-1 to G-41; G-1 to D-40; G-1 to L-39; G-1 to
V-38; G-1 to Q-37; G-1 to Y-36; G-1 to E-35; G-1 to I-34; G-1 to
E-33; G-1 to L-32; G-1 to S-31; G-1 to A-30; G-1 to K-29; G-1 to
L-28; G-1 to P-27; G-1 to M-26; G-1 to P-25; G-1 to Q-24; G-1 to
Y-23; G-1 to F-22; G-1 to C-21; G-1 to E-20; G-1 to K-19; G-1 to
Q-18; G-1 to G-17; G-1 to A-16; G-1 to P-15; G-1 to L-14; G-1 to
T-13; G-1 to F-12; G-1 to T-11; G-1 to F-10; G-1 to D-9; G-1 to
S-8; G-1 to D-7; and G-1 to L-6; of SEQ ID NO:2. Polynucleotides
encoding these polypeptides are also encompassed by the
invention.
[0142] The invention also provides polypeptides having one or more
amino acids deleted from both the amino and the carboxyl termini of
an T1R-like ligand II polypeptide, which may be described generally
as having residues n-m of SEQ ID NO:2, where n and m are integers
as described above.
[0143] The present application is also directed to proteins
containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99%
identical to the T1R-like ligand II polypeptide sequence set forth
herein as n to m. In preferred embodiments, the application is
directed to proteins containing polypeptides at least 90%, 95%,
96%, 97%, 98% or 99% identical to polypeptides having the amino
acid sequence of the specific T1R-like ligand II N- and C-terminal
deletions recited herein. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
[0144] In certain preferred embodiments, T1R-like ligand II
proteins of the invention comprise fusion proteins as described
above wherein the T1R-like ligand II polypeptides are those
described as n to m herein. In preferred embodiments, the
application is directed to nucleic acid molecules at least90%, 95%,
96%, 97%, 98% or 99% identical to to the nucleic acid sequences
encoding polypeptides having the amino acid sequence of the
specific N- and C-terminal deletions recited herein.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0145] Polypeptide fragments of the present invention include
polypeptides comprising or altematively, consisting of, an amino
acid sequence contained in SEQ ID NO:2, encoded by the cDNA
contained in the deposited plasmid, or encoded by nucleic acids
which hybridize (e.g., under stringent hybridization conditions) to
the nucleotide sequence contained in the deposited plasmid, or
shown in FIGS. 1A-B (SEQ ID NO: 1) or the complementary strand
thereto. Protein fragments may be "free-standing," or comprised
within a larger polypeptide of which the fragment forms a part or
region, most preferably as a single continuous region.
Representative examples of polypeptide fragments of the invention,
include, for example, fragments that comprise or alternatively,
consist of from about amino acid residues: -25 to -1, 1 to 50, 51
to 100, 101 to 130, 131 to 169, 170 to 191, and/or 192 to 203 of
SEQ ID NO:2. Moreover, polypeptide fragments can be at least 10,
20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 175
or 200 amino acids in length. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
[0146] Among the especially preferred fragments of the invention
are fragments characterized by structural or functional attributes
of T1R-like ligand II. Such fragments include amino acid residues
that comprise alpha-helix and alpha-helix forming regions
("alpha-regions"), beta-sheet and beta-sheet-forming regions
("beta-regions"), turn and turn-forming regions ("turn-regions"),
coil and coil-forming regions ("coil-regions"), hydrophilic
regions, hydrophobic regions, alpha amphipathic regions, beta
amphipathic regions, surface forming regions, and high antigenic
index regions (i.e., containing four or more contiguous amino acids
having an antigenic index of greater than or equal to 1.5, as
identified using the default parameters of the Jameson-Wolf
program) of complete (i.e., full-length) T1R-like ligand II (SEQ ID
NO:2). Certain preferred regions are those set out in FIG. 3 and
include, but are not limited to, regions of the aforementioned
types identified by analysis of the amino acid sequence depicted in
FIGS. 1A-B (SEQ ID NO:2), such preferred regions include;
Garnier-Robson predicted alpha-regions, beta-regions, turn-regions,
and coil-regions; Chou-Fasman predicted alpha-regions,
beta-regions, turn-regions, and coil-regions; Kyte-Doohittle
predicted hydrophilic and hydrophobic regions; Eisenberg alpha and
beta amphipathic regions; Emini surface-forming regions; and
Jameson-Wolf high antigenic index regions, as predicted using the
default parameters of these computer programs. Polynucleotides
encoding these polypeptides are also encompassed by the
invention.
[0147] In additional embodiments, the polynucleotides of the
invention encode functional attributes of T1 R-like ligand II.
Preferred embodiments of the invention in this regard include
fragments that comprise alpha-helix and alpha-helix forming regions
("alpha-regions"), beta-sheet and beta-sheet forming regions
("beta-regions"), turn and turn-forming regions ("turn-regions"),
coil and coil-forming regions ("coil-regions"), hydrophilic
regions, hydrophobic regions, alpha amphipathic regions, beta
amphipathic regions, flexible regions, surface-forming regions and
high antigenic index regions of T1R-like ligand II.
[0148] The data representing the structural or functional
attributes of T1R-like ligand II set forth in FIG. 3 and/or Table
2, as described herein, was generated using the various modules and
algorithms of the DNA*STAR set on default parameters. In a
preferred embodiment, the data presented in columns VIII, IX, XIII,
and XIV of Table I can be used to determine regions of T1R-like
ligand II which exhibit a high degree of potential for
antigenicity. Regions of high antigenicity are determined from the
data presented in columns VIII, IX, XIII, and/or XIV by choosing
values which represent regions of the polypeptide which are likely
to be exposed on the surface of the polypeptide in an environment
in which antigen recognition may occur in the process of initiation
of an immune response.
[0149] Certain preferred regions in these regards are set out in
FIG. 3, but may, as shown in Table 2, be represented or identified
by using tabular representations of the data presented in FIG. 3.
The DNA*STAR computer algorithm used to generate FIG. 3 (set on the
original default parameters) was used to present the data in FIG. 3
in a tabular format (See Table 2). The tabular format of the data
in FIG. 3 may be used to easily determine specific boundaries of a
preferred region.
[0150] The above-mentioned preferred regions set out in FIG. 3 and
in Table 2 include, but are not limited to, regions of the
aforementioned types identified by analysis of the amino acid
sequence set out in FIGS. 1A-B. As set out in FIG. 3 and in Table
2, such preferred regions include Garnier-Robson alpha-regions,
beta-regions, turn-regions, and coil-regions, Chou-Fasman
alpha-regions, beta-regions, and coil-regions, Kyte-Doolittle
hydrophilic regions and hydrophobic regions, Eisenberg alpha- and
beta-amphipathic regions, Karplus-Schulz flexible regions, Emini
surface-forming regions and Jameson-Wolf regions of high antigenic
index. TABLE-US-00002 TABLE 2 Res Position I II III IV V VI VII
VIII IX X XI XII XIII XIV Met 1 A . . . . T . 0.16 -0.67 * . . 2.03
1.23 Gly 2 . . . . T T . 0.26 -0.41 . . . 2.20 0.67 Asp 3 . . . . T
T . -0.17 0.07 . . . 1.38 0.55 Lys 4 . . B . . T . 0.01 0.33 * * .
0.76 0.46 Ile 5 . . B . . . . -0.30 0.14 * * . 0.34 0.72 Trp 6 . .
B . . . . 0.09 0.50 * * . -0.18 0.37 Leu 7 . . B . . T . -0.42 0.93
* . . -0.20 0.29 Pro 8 . . B . . T . -1.23 1.57 * * . -0.20 0.31
Phe 9 . . B . . T . -2.09 1.57 . * . -0.20 0.24 Pro 10 . . B . . T
. -2.01 1.34 . * . -0.20 0.24 Val 11 . A B . . . . -2.31 1.34 . . .
-0.60 0.13 Leu 12 . A B . . . . -2.09 1.41 . . . -0.60 0.15 Leu 13
. A B . . . . -2.69 1.13 . . . -0.60 0.10 Leu 14 . A B . . . .
-2.20 1.39 . . . -0.60 0.11 Ala 15 A A . . . . . -2.20 1.17 . . .
-0.60 0.20 Ala 16 . A B . . . . -2.20 0.91 . . . -0.60 0.38 Leu 17
. A B . . . . -2.20 0.87 . . . -0.60 0.34 Pro 18 . A B . . . .
-2.20 0.87 . . . -0.60 0.28 Pro 19 . . B . . . . -1.60 1.06 . . .
-0.40 0.23 Val 20 . . B . . . . -1.36 0.99 . . . -0.40 0.43 Leu 21
. . B . . . . -1.36 0.73 . . . -0.40 0.27 Leu 22 . . B . . T .
-1.13 0.80 . . . -0.20 0.18 Pro 23 . . B . . T . -1.27 0.87 . . .
-0.20 0.24 Gly 24 . . B . . T . -1.76 0.66 . . . -0.20 0.29 Ala 25
. . B . . T . -1.21 0.76 . . . -0.20 0.31 Ala 26 . . B B . . .
-0.61 0.56 . . . -0.60 0.29 Gly 27 . . B B . . . -0.10 0.56 . . .
-0.60 0.45 Phe 28 . . B B . . . -0.70 0.51 . * . -0.60 0.59 Thr 29
. . B . . T . -0.36 0.70 . * F 0.20 0.48 Pro 30 . . B . . T . -0.07
0.20 . * F 0.75 0.82 Ser 31 . . B . . T . 0.52 0.16 . * F 1.15 1.27
Leu 32 . . . . . T C 0.17 -0.63 . * F 2.50 1.46 Asp 33 . . . . T T
. 0.56 -0.33 . * F 2.50 0.82 Ser 34 . . . . . T C 0.17 -0.27 . * F
2.05 0.88 Asp 35 . . . . T T . 0.07 0.13 . * F 1.40 0.93 Phe 36 . .
B . . T . -0.44 -0.07 . * F 1.35 0.80 Thr 37 . . B B . . . 0.16
0.61 . * . -0.35 0.49 Phe 38 . . B B . . . -0.43 0.66 . * . -0.60
0.46 Thr 39 . . B B . . . -0.48 1.16 . * . -0.26 0.53 Leu 40 . . .
B . . C -0.48 0.80 . * . 0.28 0.37 Pro 41 . . . . . T C 0.27 0.71 .
* . 1.02 0.73 Ala 42 . . . . T T . 0.58 -0.07 . . F 2.76 1.01 Gly
43 . . . . T T . 0.61 -0.56 . . F 3.40 2.13 Gln 44 . . . . T T .
0.22 -0.67 . . F 2.91 0.74 Lys 45 . A . . T . . 0.79 -0.31 . . F
1.87 0.63 Glu 46 . A B . . . . 1.00 -0.06 . . F 1.28 1.00 Cys 47 .
A B . . . . 1.38 -0.09 . . . 0.79 1.00 Phe 48 . A B . . . . 1.12
-0.06 . . . 0.30 0.77 Tyr 49 . A B . . . . 0.91 0.56 . . . -0.60
0.44 Gln 50 . . B . . . . 0.06 0.99 . . . -0.25 1.27 Pro 51 . . B .
. . . 0.10 1.10 . * . -0.25 1.21 Met 52 A A . . . . . 0.18 0.31 . *
. -0.15 1.55 Pro 53 A A . . . . . 0.58 0.06 . * . -0.30 0.90 Leu 54
A A . . . . . 0.01 0.04 . * . -0.30 0.78 Lys 55 A A . . . . . 0.01
0.30 . * . -0.30 0.65 Ala 56 A A . . . . . -0.67 -0.31 . * . 0.30
0.73 Ser 57 A A . . . . . -0.07 -0.06 . * . 0.30 0.62 Leu 58 A A .
. . . . -0.10 -0.74 . * . 0.60 0.54 Glu 59 A A . . . . . 0.71 0.01
* * . -0.30 0.83 Ile 60 A A . . . . . -0.19 -0.09 * * . 0.45 1.08
Glu 61 A A . . . . . -0.41 0.17 * * . -0.30 0.97 Tyr 62 A A . . . .
. -0.11 0.17 * * . -0.30 0.46 Gln 63 . A B . . . . 0.36 0.17 * * .
-0.15 1.10 Val 64 A A . . . . . -0.23 -0.09 * * . 0.30 0.63 Leu 65
A A . . . . . 0.31 0.41 . . . -0.60 0.41 Asp 66 A A . . . . . -0.50
0.09 . . F -0.15 0.23 Gly 67 A . . . . T . -0.26 0.37 * . F 0.25
0.26 Ala 68 A . . . . T . -1.14 -0.27 * * F 0.85 0.52 Gly 69 A . .
. . T . -0.29 -0.27 . * . 0.70 0.22 Leu 70 A . . . . T . -0.18
-0.27 . * . 0.70 0.37 Asp 71 A A . . . . . -0.21 0.09 . * . -0.30
0.32 Ile 72 . A B . . . . -0.68 0.09 . * . -0.30 0.44 Asp 73 . A B
. . . . -0.68 0.34 . * . -0.30 0.44 Phe 74 . A B . . . . -0.63 0.16
. * . -0.30 0.26 His 75 A A . . . . . -0.03 0.54 . * . -0.60 0.50
Leu 76 A A . . . . . -0.03 0.29 . * . 0.04 0.47 Ala 77 . A . . . .
C 0.51 0.29 . * . 0.58 0.93 Ser 78 . . . . . T C 0.56 -0.07 . * F
2.07 0.68 Pro 79 . . . . . T C 0.94 -0.57 * . F 2.86 1.64 Glu 80 .
. . . T T . 0.17 -0.77 * . F 3.40 2.35 Gly 81 A . . . . T . 0.12
-0.59 . . F 2.66 1.45 Lys 82 A A . . . . . 0.01 -0.33 . . F 1.47
0.69 Thr 83 A A . . . . . 0.31 0.03 . . F 0.53 0.35 Leu 84 A A . .
. . . 0.52 0.03 . * . 0.04 0.61 Val 85 A A . . . . . 0.63 0.00 . .
. -0.30 0.53 Phe 86 A A . . . . . 1.02 0.00 * . . -0.30 0.71 Glu 87
A A . . . . . 0.68 -0.49 . . F 0.94 1.73 Gln 88 A A . . . . . 0.99
-0.79 . . F 1.58 3.13 Arg 89 A A . . . . . 1.46 -1.43 . . F 1.92
6.03 Lys 90 . . . . T T . 1.46 -1.79 . . F 3.06 3.44 Ser 91 . . . .
T T . 2.12 -1.14 * . F 3.40 1.48 Asp 92 . . . . T T . 1.81 -1.04 *
. F 3.06 1.03 Gly 93 . . . . . T C 0.96 -0.56 * . F 2.37 0.74 Val
94 . . . B . . C 0.84 0.09 . . . 0.58 0.41 His 95 . . B B . . .
0.49 -0.30 . . . 0.64 0.43 Thr 96 . . B B . . . 0.79 0.19 * * .
-0.30 0.62 Val 97 . . B B . . . -0.07 -0.24 * . . 0.45 1.45 Glu 98
. . B B . . . -0.07 -0.24 * . F 0.45 0.79 Thr 99 A . . . . . . 0.79
-0.31 * . F 0.65 0.54 Glu 100 A . . . . . . 0.58 -0.80 * . F 1.10
1.22 Val 101 A . . . . T . 0.29 -0.69 . . F 1.30 1.10 Gly 102 A . .
. . T . 0.44 -0.07 . . F 0.85 0.76 Asp 103 A . . . . T . -0.22 0.23
. . . 0.10 0.38 Tyr 104 A . B . . T . -0.61 0.80 . . . -0.20 0.27
Met 105 . . B . . . . -0.61 0.94 * . . -0.40 0.24 Phe 106 . . B . .
. . 0.24 0.51 * . . -0.40 0.24 Cys 107 . . B . . . . 0.28 0.91 * *
. -0.40 0.24 Phe 108 . . B . . . . -0.42 0.64 * * . -0.40 0.36 Asp
109 . . . . T . . -0.48 0.81 . . F 0.15 0.36 Asn 110 . . . . T T .
-0.19 0.41 * . F 0.35 0.89 Thr 111 . . . . . T C -0.38 0.33 * . F
0.60 1.49 Phe 112 . . . . . T C -0.01 0.23 * . F 0.45 0.62 Ser 113
. . . . . T C 0.69 0.61 * . F 0.15 0.52 Thr 114 A . . B . . . 0.73
0.21 * . F -0.15 0.62 Ile 115 A . . B . . . -0.12 -0.27 * . F 0.60
1.44 Ser 116 A . . B . . . -0.70 -0.41 * . F 0.45 0.80 Glu 117 A .
. B . . . -0.70 -0.11 * . F 0.45 0.39 Lys 118 A . . B . . . -1.10
0.19 . . F -0.15 0.48 Val 119 A . . B . . . -0.79 0.29 . . . -0.30
0.31 Ile 120 A . . B . . . -0.71 -0.10 . . . 0.30 0.31 Phe 121 A .
. B . . . -1.30 0.59 . . . -0.60 0.13 Phe 122 A . . B . . . -2.11
1.27 . . . -0.60 0.12 Glu 123 A . . B . . . -2.16 1.31 . . . -0.60
0.14 Leu 124 A . . B . . . -1.30 0.63 * . . -0.60 0.27 Ile 125 A .
. B . . . -1.01 0.24 * . . -0.30 0.51 Leu 126 A . . B . . . -0.66
0.07 * . . -0.30 0.29 Asp 127 A . . B . . . 0.04 0.50 * . . -0.60
0.35 Asn 128 A . . . . T . 0.04 -0.19 * . F 0.85 0.86 Met 129 A . .
. . T . 0.27 -0.47 * . F 1.00 1.81 Gly 130 A . . . . T . 1.16 -0.66
* . F 1.30 1.09 Glu 131 A . . . . T . 1.97 -0.26 * . F 1.00 1.18
Gln 132 A A . . . . . 1.97 -0.66 * . F 0.90 2.06 Ala 133 A A . . .
. . 1.97 -0.87 * . F 0.90 3.61 Gln 134 A A . . . . . 2.57 -1.30 . .
F 0.90 3.61 Glu 135 A A . . . . . 2.62 -1.30 . * F 0.90 3.48 Gln
136 A A . . . . . 2.67 -0.79 . . F 0.90 3.62 Glu 137 A A . . . . .
2.71 -1.29 . * F 0.90 4.18 Asp 138 A A . . . . . 3.06 -1.69 * * F
0.90 4.83 Trp 139 A A . . . . . 2.17 -0.93 * . F 0.90 4.37 Lys 140
A A . . . . . 1.86 -0.64 * . F 0.90 1.77 Lys 141 . A . . T . . 1.51
-0.16 * * F 1.00 1.53 Tyr 142 . A . . T . . 1.20 0.27 * . . 0.25
1.44 Ile 143 . . B . . . . 1.20 -0.16 . * F 0.97 1.04 Thr 144 . . B
. . . . 0.60 -0.16 * . F 0.99 0.87 Gly 145 . . B . . T . -0.26 0.53
* . F 0.46 0.39 Thr 146 . . B . . T . -0.30 0.46 . . F 0.63 0.46
Asp 147 . . B . . T . -0.66 -0.23 . . F 1.70 0.53 Ile 148 A . . . .
T . 0.28 -0.10 . * . 1.38 0.53 Leu 149 A A . . . . . -0.22 -0.53 *
* . 1.11 0.73 Asp 150 A A . . . . . 0.12 -0.33 * * . 0.64 0.36 Met
151 A A . . . . . 0.43 -0.33 * . . 0.47 0.89 Lys 152 A A . . . . .
-0.46 -1.01 * * . 0.75 1.81 Leu 153 A A . . . . . -0.38 -1.01 * * F
0.75 0.76 Glu 154 A A . . . . . 0.43 -0.33 * * F 0.45 0.63 Asp 155
A A . . . . . 0.13 -0.94 * * F 0.75 0.55 Ile 156 A A . . . . .
-0.16 -0.56 * * . 0.60 0.89 Leu 157 A A . . . . . -0.20 -0.56 * . .
0.60 0.36 Glu 158 A A . . . . . 0.31 -0.16 * . F 0.45 0.35 Ser 159
A . . . . T . -0.58 0.23 * . F 0.25 0.66 Ile 160 A . . . . T .
-0.53 0.23 * . F 0.25 0.56 Asn 161 A . . . . T . 0.06 -0.46 * * F
0.85 0.65 Ser 162 A . . . . T . 0.98 -0.07 * * F 0.85 0.65 Ile 163
A . . . . . . 0.17 -0.46 * * F 0.80 1.82 Lys 164 A . . . . . . 0.17
-0.46 * * F 0.99 0.93 Ser 165 . . B . . . . 1.10 -0.47 * * F 1.33
0.93 Arg 166 . . . . T . . 0.80 -0.86 * * F 2.52 2.66 Leu 167 . . B
. . . . 0.76 -1.16 * * F 2.46 1.78 Ser 168 . . . . T T . 1.61 -0.73
* * F 3.40 1.32 Lys 169 . . . . T T . 0.68 -0.61 . * F 2.91 0.91
Ser 170 . . . . . T C 0.98 0.07 * * F 1.47 0.78 Gly 171 . . . . T T
. 0.56 -0.21 . * F 2.08 1.00 His 172 . A B . . . . 0.56 -0.11 . . F
0.79 0.72 Ile 173 . A B . . . . 0.04 0.57 * * . -0.60 0.45 Gln 174
. A B . . . . 0.11 0.87 * * . -0.60 0.37 Thr 175 . A B . . . .
-0.18 0.44 * * . -0.60 0.53 Leu 176 . A B . . . . -0.53 0.44 * * .
-0.60 0.77 Leu 177 . A B . . . . -0.50 0.54 * * . -0.60 0.39 Arg
178 A A . . . . . -0.20 0.14 * * . -0.30 0.46 Ala 179 A A . . . . .
-0.09 0.16 * . . -0.30 0.57 Phe 180 A A . . . . . 0.22 -0.53 * * .
0.75 1.35 Glu 181 A A . . . . . 1.14 -1.21 * * . 0.75 1.15 Ala 182
A A . . . . . 1.96 -1.21 * . . 0.75 2.22 Arg 183 A A . . . . . 0.96
-1.31 * . F 0.90 4.13 Asp 184 A . . . . T . 1.54 -1.41 * * F 1.30
1.67 Arg 185 A . . . . T . 2.24 -1.01 * * F 1.30 2.87 Asn 186 A . .
. . T . 1.94 -1.51 . * F 1.30 2.54 Ile 187 A . . . . T . 2.53 -1.13
. . F 1.64 2.03 Gln 188 . . . . . . C 1.72 -0.73 . . F 1.98 1.67
Glu 189 . . B . . . . 1.72 0.06 . . F 1.07 0.90 Ser 190 . . . . . .
C 1.72 -0.34 * . F 2.36 2.14 Asn 191 . . . . T T . 0.87 -1.03 * . F
3.40 2.42 Phe 192 . . . . T T . 1.76 -0.79 . * F 3.06 1.04 Asp 193
. . . . T T . 1.06 -0.39 . . F 2.42 1.25 Arg 194 . . . . T T . 0.77
0.01 . . . 1.18 0.67 Val 195 . . . B T . . 0.77 0.53 . . . 0.14
0.81 Asn 196 . . . B T . . 0.17 0.13 . . . 0.10 0.65 Phe 197 . . .
B T . . 0.01 0.74 . * . -0.20 0.33 Trp 198 A . . B . . . 0.01 1.39
. * . -0.60 0.33 Ser 199 A . . B . . . -0.91 1.14 . * . -0.60 0.33
Met 200 A . . B . . . -0.91 1.43 * * . -0.60 0.31 Val 201 A . . B .
. . -1.77 1.29 * . . -0.60 0.22 Asn 202 . . B B . . . -1.67 1.01 *
. . -0.60 0.12 Leu 203 A . . B . . . -2.23 1.24 * . . -0.60 0.12
Val 204 . . B B . . . -2.79 1.27 . . . -0.60 0.12 Val 205 . . B B .
. . -3.04 1.27 . . . -0.60 0.06 Met 206 . . B B . . . -2.49 1.51 *
* . -0.60 0.05 Val 207 . . B B . . . -3.08 1.21 . . . -0.60 0.09
Val 208 . . B B . . . -3.16 1.07 * . . -0.60 0.13 Val 209 A . . B .
. . -2.30 1.11 * . . -0.60 0.09 Ser 210 A . . B . . . -2.30 0.90 .
. . -0.60 0.21 Ala 211 A . . B . . . -1.94 0.90 . . . -0.60 0.21
Ile 212 A . . B . . . -1.69 1.01 . . . -0.60 0.44 Gln 213 A . . B .
. . -1.64 0.99 . . . -0.60 0.32 Val 214 A . . B . . . -0.74 1.29 .
. . -0.60 0.26 Tyr 215 . . B B . . . -0.74 0.79 . . . -0.60 0.75
Met 216 . . B B . . . -0.97 0.49 . . . -0.60 0.58 Leu 217 A . . B .
. . -0.78 0.77 * * . -0.60 0.65 Lys 218 A . . B . . . -0.78 0.91 *
. . -0.60 0.36 Ser 219 A A . . . . . 0.08 0.16 * . . -0.30 0.63 Leu
220 A A . . . . . 0.37 -0.46 * . . 0.45 1.27 Phe 221 A A . . . . .
1.08 -1.14 * . . 0.75 1.27 Glu 222 A A . . . . . 1.93 -1.14 * . F
0.90 1.85 Asp 223 A A . . . . . 1.59 -1.53 * . F 1.21 4.50 Lys 224
A A . . . . . 2.00 -1.83 . . F 1.52 6.96 Arg 225 A . . . . T . 2.50
-2.61 . . F 2.23 7.87 Lys 226 A . . . . T . 2.81 -2.13 . * F 2.54
6.80 Ser 227 . . . . T T . 2.42 -1.70 * . . 3.10 4.35 Arg 228 A . .
. T T . 2.03 -1.27 * . . 2.79 2.84 Thr 229 . . B . . . . 1.60 -0.84
* . . 1.88 1.81
[0151] Among highly preferred fragments in this regard are those
that comprise regions of T1R-like ligand II that combine several
structural features, such as several of the features set out
above.
[0152] The polypeptide of the present invention could be used as a
molecular weight marker on SDS-PAGE gels or on molecular sieve gel
filtration columns using methods well known to those of skill in
the art.
[0153] As described in detail herein, the polypeptides of the
present invention can be used to raise polyclonal and monoclonal
antibodies, which are useful in diagnostic assays for detecting
T1R-like ligand II expression as described herein or as agonists
and antagonists capable of enhancing or inhibiting T1R-like ligand
II protein function. Further, such polypeptides can be used in the
yeast two-hybrid system to "capture" T1R-like ligand II binding
proteins which are also candidate agonist and antagonist according
to the present invention. The yeast two hybrid system is described
in Fields and Song, Nature 340:245-246 (1989).
[0154] The present invention encompasses polypeptides comprising,
or alternatively consisting of, an epitope of the polypeptide
having an amino acid sequence of SEQ ID NO: 2, or an epitope of the
polypeptide sequence encoded by a polynucleotide sequence contained
in ATCC.TM. deposit No.97655 or encoded by a polynucleotide that
hybridizes to the complement of the sequence of SEQ ID NO: 1 or
contained in ATCC.TM. deposit No. 97655 under stringent
hybridization conditions or lower stringency hybridization
conditions as defined herein. The present invention further
encompasses polynucleotide sequences encoding an epitope of a
polypeptide sequence of the invention (such as, for example, the
sequence disclosed in SEQ ID NO:2), polynucleotide sequences of the
complementary strand of a polynucleotide sequence encoding an
epitope of the invention, and polynucleotide sequences which
hybridize to the complementary strand under stringent hybridization
conditions or lower stringency hybridization conditions defined
herein.
[0155] The term "epitopes," as used herein, refers to portions of a
polypeptide having antigenic or immunogenic activity in an animal,
preferably a mammal, and most preferably in a human. In a preferred
embodiment, the present invention encompasses a polypeptide
comprising an epitope, as well as the polynucleotide encoding this
polypeptide. An "immunogenic epitope," as used herein, is defined
as a portion of a protein that elicits an antibody response in an
animal, as determined by any method known in the art, for example,
by the methods for generating antibodies described herein. (See,
for example, Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002
(1983)). The term "antigenic epitope," as used herein, is defined
as a portion of a protein to which an antibody can
immunospecifically bind its antigen as determined by any method
well known in the art, for example, by the immunoassays described
herein. Immunospecific binding excludes non-specific binding but
does not necessarily exclude cross-reactivity with other antigens.
Antigenic epitopes need not necessarily be immunogenic.
[0156] Immunogenic epitope-bearing peptides of the invention, i.e.,
those parts of a protein that elicit an antibody response when the
whole protein is the immunogen, are identified according to methods
known in the art. For instance, Geysen et al. (1984), supra,
discloses a procedure for rapid concurrent synthesis on solid
supports of hundreds of peptides of sufficient purity to react in
an enzyme-linked immunosorbent assay. Interaction of synthesized
peptides with antibodies is then easily detected without removing
them from the support. In this manner a peptide bearing an
immunogenic epitope of a desired protein may be identified
routinely by one of ordinary skill in the art.
[0157] For instance, the immunologically important epitope in the
coat protein of foot-and-mouth disease virus was located by Geysen
et al. with a resolution of seven amino acids by synthesis of an
overlapping set of all 208 possible hexapeptides covering the
entire 213 amino acid sequence of the protein. Then, a complete
replacement set of peptides in which all 20 amino acids were
substituted in turn at every position within the epitope were
synthesized, and the particular amimo acids conferring specificity
for the reaction with antibody were determined. Thus, peptide
analogs of the epitope-bearing peptides of the invention can be
made routinely by this method. U.S. Pat. No. 4,708,781 to Geysen
(1987) further describes this method of identifying a peptide
bearing an immunogenic epitope of a desired protein.
[0158] Further still, U.S. Pat. No. 5,194,392 to Geysen (1990)
describes a general method of detecting or determining the sequence
of monomers (amino acids or other compounds) which is a topological
equivalent of the epitope (i.e., a "mimotope") which is
complementary to a particular paratope (antigen binding site) of an
antibody of interest. More generally, U.S. Pat. No. 4,433,092 to
Geysen (1989) describes a method of detecting or determining a
sequence of monomers which is a topographical equivalent of a
ligand which is complementary to the ligand binding site of a
particular receptor of interest. Similarly, U.S. Pat. No. 5,480,971
to Houghten, R. A. et al. (1996) on Peralkylated Oligopeptide
Mixtures discloses linear C.sub.1-C.sub.7-alkyl peralkylated
oligopeptides and sets and libraries of such peptides, as well as
methods for using such oligopeptide sets and libraries for
determining the sequence of a peralkylated oligopeptide that
preferentially binds to an acceptor molecule of interest. Thus,
non-peptide analogs of the epitope-bearing peptides of the
invention also can be made routinely by these methods.
[0159] As to the selection of peptides or polypeptides bearing an
antigenic epitope (i.e., that contain a region of a protein
molecule to which an antibody can bind), it is well known in that
art that relatively short synthetic peptides that mimic part of a
protein sequence are routinely capable of eliciting an antiserum
that reacts with the partially mimicked protein. See, for instance,
Sutcliffe, J. G. et al., Science 219:660-666 (1983). Peptides
capable of eliciting protein-reactive sera are frequently
represented in the primary sequence of a protein, can be
characterized by a set of simple chemical rules, and are confined
neither to immunodominant regions of intact proteins (i.e.,
immunogenic epitopes) nor to the amino or carboxyl terminals.
[0160] Peptides that are extremelyhydrophobic and those of six or
fewer residues generally are ineffective at inducing antibodies
that bind to the mimicked protein; longer, soluble peptides,
especially those containing proline residues, usually are
effective. Sutcliffe et al., supra, at 661. For instance, 18 of 20
peptides designed according to these guidelines, containing 8-39
residues covering 75% of the sequence of the influenza virus
hemagglutinin HA1 polypeptide chain, induced antibodies that
reacted with the HA1 protein or intact virus; and 12/12 peptides
from the MuLV polymerase and 18/18 from the rabies glycoprotein
induced antibodies that precipitated the respective proteins.
[0161] In the present invention, antigenic epitopes preferably
contain a sequence of at least 4, at least 5, at least 6, at least
7, more preferably at least 8, at least 9, at least 10, at least
11, at least 12, at least 13, at least 14, at least 15, at least
20, at least 25, at least 30, at least 40, at least 50, and, most
preferably, between about 15 to about 30 amino acids. Preferred
polypeptides comprising immunogenic or antigenic epitopes are at
least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80,
85, 90, 95, or 100 amino acid residues in length. Additional
non-exclusive preferred antigenic epitopes include the antigenic
epitopes disclosed herein, as well as portions thereof. Antigenic
epitopes are useful, for example, to raise antibodies, including
monoclonal antibodies, that specifically bind the epitope.
Preferred antigenic epitopes include the antigenic epitopes
disclosed herein, as well as any combination of two, three, four,
five or more of these antigenic epitopes. Antigenic epitopes can be
used as the target molecules in immunoassays. (See, for instance,
Wilson et al., Cell 37:767-778 (1984); Sutcliffe et al., Science
219:660-666 (1983)).
[0162] Non-limiting examples of antigenic polypeptides that can be
used to generate T1R-like ligand II specific antibodies or
fragments, include the following: a polypeptide comprising amino
acid residues from about 17 to about 26 in SEQ ID NO:2; a
polypeptide comprising amino acid residues from about 56 to about
72 in SEQ ID NO:2; a polypeptide comprising amino acid residues
from about 103 to about 120 in SEQ ID NO:2; a polypeptide
comprising amino acid residues from about 136 to about 149 in SEQ
ID NO:2; and a polypeptide comprising amino acid residues from
about 155 to about 171 in SEQ ID NO:2. As indicated above, the
inventors have determined that the above polypeptide fragments are
antigenic regions of the T1R-like II protein.
[0163] Antigenic epitope-bearing peptides and polypeptides of the
invention are therefore useful to raise antibodies, including
monoclonal antibodies, that bind specifically to a polypeptide of
the invention. Thus, a high proportion of hybridomas obtained by
fusion of spleen cells from donors immunized with an antigen
epitope-bearing peptide generally secrete antibody reactive with
the native protein. Sutcliffe et al., supra, at 663. The antibodies
raised by antigenic epitope-bearing peptides or polypeptides are
useful to detect the mimicked protein, and antibodies to different
peptides may be used for tracking the fate of various regions of a
protein precursor which undergoes posttranslation processing. The
peptides and anti-peptide antibodies may be used in a variety of
qualitative or quantitative assays for the mimicked protein, for
instance in competition assays since it has been shown that even
short peptides (e.g., about 9 amino acids) can bind and displace
the larger peptides in immunoprecipitation assays. See, for
instance, Wilson, I. A. et al., Cell 37:767-778 (1984) at 777. The
anti-peptide antibodies of the invention also are useful for
purification of the mimicked protein, for instance, by adsorption
chromatography using methods well known in the art.
[0164] Similarly, immunogenic epitopes can be used, for example, to
induce antibodies according to methods well known in the art. (See,
for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow
et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle et al.,
J. Gen. Virol. 66:2347-2354 (1985). Preferred immunogenic epitopes
include the immunogenic epitopes disclosed herein, as well as any
combination of two, three, four, five or more of these immunogenic
epitopes. The polypeptides comprising one or more immunogenic
epitopes may be presented for eliciting an antibody response
together with a carrier protein, such as an albumin, to an animal
system (such as rabbit or mouse), or, if the polypeptide is of
sufficient length (at least about 25 amino acids), the polypeptide
may be presented without a carrier. However, immunogenic epitopes
comprising as few as 8 to 10 amino acids have been shown to be
sufficient to raise antibodies capable of binding to, at the very
least, linear epitopes in a denatured polypeptide (e.g., in Western
blotting).
[0165] The epitope-bearing peptides and polypeptides of the
invention may be produced by any conventional means for making
peptides or polypeptides including recombinant means using nucleic
acid molecules of the invention. (See, e.g., Houghten, Proc. Natl.
Acad. Sci. USA 82:5131-5135 (1985), further described in U.S. Pat.
No. 4,631,211). For instance, a short epitope-bearing amino acid
sequence may be fused to a larger polypeptide which acts as a
carrier during recombinant production and purification, as well as
during immunization to produce anti-peptide antibodies.
Epitope-bearing peptides also may be synthesized using known
methods of chemical synthesis.
[0166] For instance, Houghten has described a simple method for
synthesis of large numbers of peptides, such as 10-20 mg of 248
different 13 residue peptides representing single amino acid
variants of a segment of the HA1 polypeptide which were prepared
and characterized (by ELISA-type binding studies) in less than four
weeks. Houghten, R. A., Proc. Natl. Acad. Sci. USA 82:5131-5135
(1985). This "Simultaneous Multiple Peptide Synthesis (SMPS)"
process is further described in U.S. Pat. No. 4,631,211 to Houghten
et al. (1986). In this procedure the individual resins for the
solid-phase synthesis of various peptides are contained in separate
solvent-permeable packets, enabling the optimal use of the many
identical repetitive steps involved in solid-phase methods. A
completely manual procedure allows 500-1000 or more syntheses to be
conducted simultaneously. Houghten et al., supra, at 5134.
[0167] Epitope-bearing polypeptides of the present invention maybe
used to induce antibodies according to methods well known in the
art including, but not limited to, in vivo immunization, in vitro
immunization, and phage display methods. See, e.g., Sutcliffe et
al., supra; Wilson et al., supra, and Bittle et al., J. Gen.
Virol., 66:2347-2354 (1985). If in vivo immunization is used,
animals maybe immunized with free peptide; however, anti-peptide
antibody titer maybe boosted by coupling the peptide to a
macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or
tetanus toxoid.
[0168] For instance, peptides containing cysteine residues may be
coupled to a carrier using a linker such as
maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other
peptides may be coupled to carriers using a more general linking
agent such as glutaraldehyde. Animals such as rabbits, rats and
mice are immunized with either free or carrier-coupled peptides,
for instance, by intraperitoneal and/or intradermal injection of
emulsions containing about 100 .mu.g of peptide or carrier protein
and Freund's adjuvant or any other adjuvant known for stimulating
an immune response. Several booster injections may be needed, for
instance, at intervals of about two weeks, to provide a useful
titer of anti-peptide antibody which can be detected, for example,
by ELISA assay using free peptide adsorbed to a solid surface. The
titer of anti-peptide antibodies in serum from an immunized animal
may be increased by selection of anti-peptide antibodies, for
instance, by adsorption to the peptide on a solid support and
elution of the selected antibodies according to methods well known
in the art.
[0169] As one of skill in the art will appreciate, T1R-like ligand
II polypeptides of the present invention and the epitope-bearing
fragments thereof described above can be combined with parts of the
constant domain of immunoglobulins (IgG), resulting in chimeric
polypeptides. These fusion proteins facilitate purification and
show an increased half-life in vivo. This has been shown, e.g., for
chimeric proteins consisting of the first two domains of the human
CD4-polypeptide and various domains of the constant regions of the
heavy or light chains of mammalian immunoglobulins (EPA 394,827;
Traunecker et al., Nature 331:84-86 (1988)). Fusion proteins that
have a disulfide-linked dimeric structure due to the IgG part can
also be more efficient in binding and neutralizing other molecules
than the monomeric T1R-like ligand II protein or protein fragment
alone (Fountoulakis et al., J. Biochem. 270:3958-3964 (1995)).
[0170] The invention further provides for the proteins containing
T1R-like ligand II polypeptide sequences encoded by the
polynucleotides of the invention.
[0171] The T1R-like ligand II polypeptides of the invention may be
in monomers or multimers (i.e., dimers, trimers, tetramers, and
higher multimers). Accordingly, the present invention relates to
monomers and multimers of the T1R-like ligand II proteins of the
invention, their preparation, and compositions (preferably,
pharmaceutical compositions) containing them. In specific
embodiments, the polypeptides of the invention are monomers,
dimers, trimers or tetramers. In additional embodiments, the
multimers of the invention are at least dimers, at least trimers,
or at least tetramers.
[0172] Multimers encompassed by the invention maybe homomers or
heteromers. As used herein, the term homomer, refers to a multimer
containing only T1R-like ligand II proteins of the invention
(including T1R-like ligand II fragments, variants, and fusion
proteins, as described herein). These homomers may contain T1R-like
ligand II proteins having identical or different polypeptide
sequences. In a specific embodiment, a homomer of the invention is
a multimer containing only T1R-like ligand II proteins having an
identical polypeptide sequence. In another specific embodiment, a
homomer of the invention is a multimer containing T1R-like ligand
II proteins having different polypeptide sequences. In specific
embodiments, the multimer of the invention is a homodimer (e.g.,
containing T1R-like ligand II proteins having identical or
different polypeptide sequences) or a homotrirer (e.g., containing
T1R-like ligand II proteins having identical or different
polypeptide sequences). In additional embodiments, the homomeric
multimer of the invention is at least a homodimer, at least a
homotrimer, or at least a homotetramer.
[0173] As used herein, the term heteromer refers to a multimer
containing heterologous proteins (i.e., proteins containing only
polypeptide sequences that do not correspond to a polypeptide
sequences encoded by the T1R-like ligand II gene) in addition to
the T1R-like ligand II proteins of the invention. In a specific
embodiment, the multimer of the invention is a heterodimner, a
heterotrimer, or a heterotetramer. In additional embodiments, the
heteromeric multimer of the invention is at least a heterodimer, at
least a heterotrimer, or at least a heterotetramer.
[0174] Multimers of the invention may be the result of hydrophobic,
hydrophilic, ionic and/or covalent associations and/or may be
indirectly linked, by for example, liposome formation. Thus, in one
embodiment, multimers of the invention, such as, for example,
homodimers or homotrimers, are formed when proteins of the
invention contact one another in solution. In another embodiment,
heteromultimers of the invention, such as, for example,
heterotiriers or heterotetramers, are formed when proteins of the
invention contact antibodies to the polypeptides of the invention
(including antibodies to the heterologous polypeptide sequence in a
fusion protein of the invention) in solution. In other embodiments,
multimers of the invention are formed by covalent associations with
and/or between the T1R-like ligand II proteins of the invention.
Such covalent associations may involve one or more amino acid
residues contained in the polypeptide sequence of the protein
(e.g., the polypeptide sequence recited in SEQ ID NO:2 or the
polypeptide encoded by the deposited cDNA plasmid). In one
instance, the covalent associations are cross-linking between
cysteine residues located within the polypeptide sequences of the
proteins which interact in the native (i.e., naturally occurring)
polypeptide. In another instance, the covalent associations are the
consequence of chemical or recombinant manipulation. Alternatively,
such covalent associations may involve one or more amino acid
residues contained in the heterologous polypeptide sequence in a
T1R-like ligand II fusion protein. In one example, covalent
associations are between the heterologous sequence contained in a
fusion protein of the invention (see, e.g., U.S. Pat. No.
5,478,925). In a specific example, the covalent associations are
between the heterologous sequence contained in a T1R-like ligand
II-Fc fusion protein of the invention (as described herein). In
another specific example, covalent associations of fusion proteins
of the invention are between heterologous polypeptde sequences from
another protein Ithat is capable of forming covalently associated
multimers, such as for example, oseteoprotegerin (see, e.g.,
International Publication No. WO 98/49305, the contents of which
are herein incorporated by reference in its entirety).
[0175] In another embodiment, two or more T1R-like ligand II
polypeptides of the invention are joined through peptide linkers.
Examples include those peptide linkers described in U.S. Pat. No.
5,073,627 (hereby incorporated by reference). Proteins comprising
multiple T1R-like ligand II polypeptides separated by peptide
linkers may be produced using conventional recombinant DNA
technology.
[0176] Another method for preparing multimer T1R-like ligand II
polypeptides of the invention involves use of T1R-like ligand II
polypeptides fused to a leucine zipper or isoleucine zipper
polypeptide sequence. Leucine zipper and isoleucine zipper domains
are polypeptides that promote multimerization of the proteins in
which they are found. Leucine zippers were originally identified in
several DNA-binding proteins (Landschulz et al., Science 240:1759,
(1988)), and have since been found in a variety of different
proteins. Among the lmkwn leucine zippers are naturally occurring
peptides and derivatives thereof that dimerize or trimerize.
Examples of leucine zipper domains suitable for producing soluble
multimeric T1R-like ligand II proteins are those described in
International application publication number WO 94/10308, hereby
incorporated by reference. Recombinant fusion proteins comprising a
soluble T1R-like ligand II polypeptide fused to a peptide that
dimerizes or trimenzes in solution are expressed in suitable host
cells, and the resulting soluble multimeric T1R-like ligand II is
recovered from the culture supernatant using techniques known in
the art.
[0177] In another example, proteins of the invention are associated
by interactions between Flag(r) polypeptide sequence contained in
Flag(r)-T1R-like ligand II fusion proteins of the invention. In a
further embodiment, associations proteins of the invention are
associated by interactions between heterologous polypeptide
sequence contained in Flag(r)-T1R-like ligand II fusion proteins of
the invention and anti-Flag(r) antibody.
[0178] The multimers of the invention maybe generated using
chemical techniques known in the art. For example, proteins desired
to be contained in the multimers of the invention may be chemicay
cross-linked using linker molecules and linker molecule length
optimization techniques known in the art (see, e.g., U.S. Pat. No.
5,478,925, which is herein incorporated by reference in its
entirety). Additionally, multimers of the invention may be
generated using techniques known in the art to form one or more
inter-molecule cross-links between the cysteine residues located
within the polypeptide sequence of the proteins desired to be
contained in the multimer (see, e.g., U.S. Pat. No. 5,478,925,
which is herein incorporated by reference in its entirety).
[0179] Further, proteins of the invention may be routinely modified
by the addition of cysteine or biotin to the C terminus or
N-terminus of the polypeptide sequence of the protein and
techniques known in the art may be applied to generate multimers
containing one or more of these modified proteins (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). Additionally, techniques known in the art may be
applied to generate liposomes containing the protein components
desired to be contained in the multimer of the invention (see,
e.g., U.S. Pat. No. 5,478,925, which is herein incorporated by
reference in its entirety).
[0180] Alternatively, multimers of the invention maybe generated
using genetic engineering techniques known in the art. In one
embodiment, proteins contained in multimers of the invention are
produced recombinantly using fusion protein technology described
herein or otherwise known in the art (see, e.g., U.S. Pat. No.
5,478,925, which is herein incorporated by reference in its
entirety). In a specific embodiment, polynucleotides coding for a
homodimer of the invention are generated by ligating a
polynucleotide sequence encoding a polypeptide of the invention to
a sequence encoding a linker polypeptide and then further to a
synthetic polynucleotide encoding the translated product of the
polypeptide in the reverse orientation from the original C-terminus
to the N-terminus (lacking the leader sequence) (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). In another embodiment, recombinant techniques
described herein or otherwise known in the art are applied to
generate recombinant polypeptides of the invention which contain a
transmembrane domain and which can be incorporated by membrane
reconstitution techniques into liposomes (see, e.g., U.S. Pat. No.
5,478,925, which is herein incorporated by reference in its
entirety).
[0181] The entire disclosure of each document cited in this section
on "Polypeptides and Peptides" is hereby incorporated herein by
reference.
Fusion Polypeptides
[0182] As one of skill in the art will appreciate, and as discussed
above, the polypeptides of the present invention can be fused to
other polypeptide sequences. For example, the polypeptides of the
present invention may be fused with the constant domain of
immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CH1,
CH2, CH3, or any combination thereof and portions thereof)
resulting in chimeric polypeptides. Such fusion proteins may
facilitate purification and may increase half-life in vivo. This
has been shown for chimeric proteins consisting of the first two
domains of the human CD4-polypeptide and various domains of the
constant regions of the heavy or light chains of mammalian
immunoglobulins. See, e.g., EP 394,827; Traunecker et al., Nature,
331:84-86 (1988). Enhanced delivery of an antigen across the
epithelial barrier to the immnune system has been demonstrated for
antigens (e.g., insulin) conjugated to an FcRn binding partner such
as IgG orFc fragments (see, e.g., PCT Publications WO 96/22024 and
WO 99/04813). IgG Fusion proteins that have a disulfide-linked
dimeric structure due to the IgG portion disulfide bonds have also
been found to be more efficient in binding and neutralizing other
molecules than monomeric polypeptides or fragments thereof alone.
See, e.g., Fountoulakis et al., J. Biochem., 270:3958-3964 (1995).
Nucleic acids encoding the above epitopes can also be recombined
with a gene of interest as an epitope tag (e.g., the hemagglutinin
("HA") tag or flag tag) to aid in detection and purification of the
expressed polypeptide. For example, a system described by Janknecht
et al. allows for the ready purification of non-denatured fusion
proteins expressed inhuman cell lines (Janknecht et al., 1991,
Proc. Natl. Acad. Sci. USA 88:8972-897). In this system, the gene
of interest is subcloned into a vaccinia recombination plasmid such
that the open reading frame of the gene is translationally fused to
an amino-terminal tag consisting of six histidine residues. The tag
serves as a matrix binding domain for the fusion protein. Extracts
from cells infected with the recombinant vaccinia virus are loaded
onto Ni2+ nitriloacetic acid-agarose column and histidine-tagged
proteins can be selectively eluted with irnidazole-containing
buffers.
[0183] Additional fusion proteins of the invention may be generated
through the techniques of gene-shuffling, motif-shuffling,
exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA shuffling"). DNA shuffling may be employed to modulate the
activities of polypeptides of the invention, such methods can be
used to generate polypeptides with altered activity, as well as
modulating the activity of T1R-like ligand II agonists and
antagonists of the polypeptides. See, generally, U.S. Pat. Nos.
5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and
Patten et al., Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama,
Trends Biotechnol. 16 (2):76-82 (1998); Hansson, et al., J. Mol.
Biol. 287:265-76 (1999); and Lorenzo and Blasco, Biotechniques 24
(2):308-13 (1998) (each of these patents and publications are
hereby incorporated by reference in its entirety). In one
embodiment, alteration of polynucleotides corresponding to SEQ ID
NO:1 and the polypeptides encoded by these polynucleotides may be
achieved by DNA shuffling. DNA shuffling involves the assembly of
two or more DNA segments into a desired T1R-like ligand II molecule
by homologous or site-specific recombination to generate variation
in the polynucleotide sequence. In another embodiment,
polynucleotides of the invention, or the encoded polypeptides, may
be altered by being subjected to random mutagenesis by error-prone
PCR, random nucleotide insertion or other methods prior to
recombination. In another embodiment, one or more components,
motifs, sections, parts, domains, fragments, etc., of a
polynucleotide encoding a polypeptide of the invention may be
recombined with one or more components, motifs, sections, parts,
domains, fragments, etc. of one or more heterologous molecules. In
preferred embodiments, the heterologous molecules are members of
the IL-1R family, for example IL-1RI, IL-1RII, and sIL-1RII.
Transgenic Animals
[0184] The proteins of the invention can also be expressed in
transgenic animals. Animals of any species, including, but not
limited to, mice, rats, rabbits, hamsters, guinea pigs, pigs,
micro-pigs, goats, sheep, cows and non-human primates, e.g.,
baboons, monkeys, and chimpanzees may be used to generate
transgenic animals. In a specific embodiment, techniques described
herein or otherwise known in the art, are used to express
polypeptides of the invention in humans, as part of a gene therapy
protocol.
[0185] Any technique known in the art maybe used to introduce the
transgene (i.e., nucleic acids of the invention) into animals to
produce the founder lines of transgenic animals. Such techniques
include, but are not limited to, pronuclear microinjection
(Paterson et al., Appl. Microbiol. Biotechnol. 40:691-698 (1994);
Carver et al., Biotechnology (NY) 11:1263-1270 (1993); Wright et
al., Biotechnology (NY) 9:830-834 (1991); and Hoppe et al., U.S.
Pat. No. 4,873,191 (1989)); retrovirus mediated gene transfer into
germ lines (Van der Putten et al., Proc. Natl. Acad. Sci., USA
82:6148-6152 (1985)), blastocysts or embryos; gene targeting in
embryonic stem cells (Thompson et al., Cell 56:313-321 (1989));
electroporation of cells or embryos (Lo, Mol Cell. Biol.
3:1803-1814 (1983)); introduction of the polynucleotides of the
invention using a gene gun (see, e.g., Ulmer et al., Science
259:1745 (1993); introducing nucleic acid constructs into embryonic
pleuripotent stem cells and transferring the stem cells back into
the blastocyst; and sperm-mediated gene transfer (Lavitrano et al.,
Cell 57:717-723 (1989); etc. For a review of such techniques, see
Gordon, "Transgenic Animals," Intl. Rev. Cytol. 115:171-229 (1989),
which is incorporated by reference herein in its entirety. Further,
the contents of each of the documents recited in this paragraph is
herein incorporated by reference in its entirety.
[0186] Further techniques known in the art maybe used to introduce
the transgene (i.e., nucleic acids of the invention) into animals
include, for example, those techniques described in U.S. Pat. No.
5,464,764 (Capecchi et al., Positive-Negative Selection Methods and
Vectors); U.S. Pat. No. 5,631,153 (Capecchi et al., Cells and
Non-Human Organisms Containing Predetermined Genomic Modifications
and Positive-Negative Selection Methods and Vectors for Making
Same); U.S. Pat. No. 4,736,866 (Leder et al., Transgenic Non-Human
Animals); and U.S. Pat. No. 4,873,191 (Wagner et al., Genetic
Transformation of Zygotes); each of which is hereby incorporated by
reference in its entirety.
[0187] Any technique known in the art may be used to produce
transgenic clones containing polynucleotides of the invention, for
example, nuclear transfer into enucleated oocytes of nuclei from
cultured embryonic, fetal, or adult cells induced to quiescence
(Campell et al., Nature 380:64-66 (1996); Wilmut et al., Nature
385:810-813 (1997)), each of which is herein incorporated by
reference in its entirety).
[0188] The present invention provides for transgenic animals that
carry the transgene in all their cells, as well as animals which
carry the transgene in some, but not all their cells, i.e., mosaic
animals or chimeric animals. The transgene may be integrated as a
single transgene or as multiple copies such as in concatamers,
e.g., head-to-head tandems or head-to-tail tandems. The transgene
may also be selectively introduced into and activated in a
particular cell type by following, for example, the teaching of
Lasko et al. (Lasko et al., Proc. Natl. Acad. Sci. USA 89:6232-6236
(1992)). The regulatory sequences required for such a cell-type
specific activation will depend upon the particular cell type of
interest, and will be apparent to those of skill in the art. When
it is desired that the polynucleotide transgene be integrated into
the chromosomal site of the endogenous gene, gene targeting is
preferred. Briefly, when such a technique is to be utilized,
vectors containing some nucleotide sequences homologous to the
endogenous gene are designed for the purpose of integrating, via
homologous recombination with chromosomal sequences, into and
disrupting the function of the nucleotide sequence of the
endogenous gene. The transgene may also be selectively introduced
into a particular cell type, thus inactivating the endogenous gene
in only that cell type, by following, for example, the teaching of
Gu et al. (Gu et al., Science 265:103-106 (1994)). The regulatory
sequences required for such a cell-type specific inactivation will
depend upon the particular cell type of interest, and will be
apparent to those of skill in the art. The contents of each of the
documents recited in this paragraph is herein incorporated by
reference in its entirety.
[0189] Once transgenic animals have been generated, the expression
of the recombinant gene maybe assayed utilizing standard
techniques. Initial screening may be accomplished by Southern blot
analysis or PCR techniques to analyze animal tissues to verify that
integration of the transgene has taken place. The level of mRNA
expression of the transgene in the tissues of the transgenic
animals may also be assessed using techniques which include, but
are not limited to, Northern blot analysis of tissue samples
obtained from the animal, in situ hybridization analysis, and
reverse transcriptase-PCR (rt-PCR). Samples of transgenic
gene-expressing tissue may also be evaluated immunocytochemically
or immunohistochemically using antibodies specific for the
transgene product.
[0190] Once the founder animals are produced, they may be bred,
inbred, outbred, or crossbred to produce colonies of the particular
animal. Examples of such breeding strategies include, but are not
limited to: out breeding of founder animals with more than one
integration site in order to establish separate lines; inbreeding
of separate lines in order to produce compound transgenics that
express the transgene at higher levels because of the effects of
additive expression of each transgene; crossing of heterozygous
transgenic animals to produce animals homozygous for a given
integration site in order to both augment expression and eliminate
the need for screening of animals by DNA analysis; crossing of
separate homozygous lines to produce compound heterozygous or
homozygous lines; and breeding to place the transgene on a distinct
background that is appropriate for an experimental model of
interest.
[0191] Transgenic and "knock-out" animals of the invention have
uses which include, but are not limited to, animal model systems
useful in elaborating the biological function of T1R-like ligand II
polypeptides, studying conditions and/or disorders associated with
aberrant T1R-like ligand II expression, and in screening for
compounds effective in ameliorating such conditions and/or
disorders.
[0192] In further embodiments of the invention, cells that are
genetically engineered to express the proteins of the invention, or
alternatively, that are genetically engineered not to express the
proteins of the invention (e.g., knockouts) are administered to a
patient in vivo. Such cells may be obtained from the patient (i.e.,
animal, including human) or an MHC compatible donor and can
include, but are not limited to fibroblasts, bone marrow cells,
blood cells (e.g., lymphocytes), adipocytes, muscle cells,
endothelial cells, etc. The cells are genetically engineered in
vitro using recombinant DNA techniques to introduce the coding
sequence of polypeptides of the invention into the cells, or
alternatively, to disrupt the coding sequence and/or endogenous
regulatory sequence associated with the polypeptides of the
invention, e.g., by transduction (using viral vectors, and
preferably vectors that integrate the transgene into the cell
genome) or transfection procedures, including, but not limited to,
the use of plasmids, cosmids, YACs, naked DNA, electroporation,
liposomes, etc. The coding sequence of the polypeptides of the
invention can be placed under the control of a strong constitutive
or inducible promoter or promoter/enhancer to achieve expression,
and preferably secretion, of the polypeptides of the invention. The
engineered cells which express and preferably secrete the
polypeptides of the invention can be introduced into the patient
systemically, e.g., in the circulation, or intraperitoneally.
Alternatively, the cells can be incorporated into a matrix and
implanted in the body, e.g., genetically engineered fibroblasts can
be implanted as part of a skin graft; genetically engineered
endothelial cells can be implanted as part of a lymphatic or
vascular graft. (See, for example, Anderson et al. U.S. Pat. No.
5,399,349; and Mulligan & Wilson, U.S. Pat. No. 5,460,959, each
of which is incorporated by reference herein in its entirety).
[0193] When the cells to be administered are non-autologous or
non-MHC compatible cells, they can be administered using well known
techniques which prevent the development of a host immune response
against the introduced cells. For example, the cells maybe
introduced in an encapsulated form which, while allowing for an
exchange of components with the immediate extracellular
environment, does not allow the introduced cells to be recognized
by the host immune system.
T1R-like Ligand II Antibodies and Antibody Therapy
[0194] Further polypeptides of the invention relate to antibodies
and T-cell antigen receptors (TCR) which immunospecifically bind a
polypeptide, polypeptide fragment, or variant of SEQ ID NO:2,
and/or an epitope, of the present invention (as determined by
immunoassays well known in the art for assaying specific
antibody-antigen binding). Antibodies of the invention include, but
are not limited to, polyclonal, monoclonal, multispecific, human,
humanized or chimeric antibodies, single chain antibodies, Fab
fragments, F(ab') fragments, fragments produced by a Fab expression
library, anti-idiotypic (anti-Id) antibodies (including, e.g.,
anti-Id antibodies to antibodies of the invention), and
epitope-binding fragments of any of the above. The term "antibody,"
as used herein, refers to immunoglobulin molecules and
immunologically active portions of immunoglobulin molecules, i.e.,
molecules that contain an antigen binding site that
immunospecifically binds an antigen. The immunoglobulin molecules
of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA
and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or
subclass of immunoglobulin molecule.
[0195] Most preferably the antibodies are human antigen-binding
antibody fragments of the present invention and include, but are
not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv),
single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments
comprising either a VL or VH domain. Antigen-binding antibody
fragments, including single-chain antibodies, may comprise the
variable region(s) alone or in combination with the entirety or a
portion of the following: hinge region, CH1, CH2, and CH3 domains.
Also included in the invention are antigen-binding fragments also
comprising any combination of variable region(s) with a hinge
region, CH1, CH2, and CH3 domains. The antibodies of the invention
may be from any animal origin including birds and mammals.
Preferably, the antibodies are human, murine (e.g., mouse and rat),
donkey, ship rabbit, goat, guinea pig, camel, horse, or chicken. As
used herein, "human" antibodies include antibodies having the amino
acid sequence of a human immunoglobulin and include antibodies
isolated from human immunoglobulin libraries or from animals
transgenic for one or more human immunoglobulin and that do not
express endogenous immunoglobulns, as described herein and, for
example in, U.S. Pat. No. 5,939,598 by Kucherlapati et al.
[0196] The antibodies of the present invention may be monospecific,
bispecific, trispecific or of greater multispecificity.
Multispecific antibodies may be specific for different epitopes of
a polypeptide of the present invention or may be specific for both
a polypeptide of the present invention as well as for a
heterologous epitope, such as a heterologous polypeptide or solid
support material. See, e.g., PCT publications WO 93/17715; WO
92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol.
147:60-69 (1991); U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648;
5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148:1547-1553
(1992).
[0197] Antibodies of the present invention maybe described or
specified in terms of the epitope(s) or portion(s) of a polypeptide
of the present invention which they recognize or specifically bind.
The epitope(s) or polypeptide portion(s) may be specified as
described herein, e.g., by N-terminal and C-terminal positions, by
size in contiguous amino acid residues, or listed in the Tables and
Figures. Antibodies which specifically bind any epitope or
polypeptide of the present invention may also be excluded.
Therefore, the present invention includes antibodies that
specifically bind polypeptides of the present invention, and allows
for the exclusion of the same.
[0198] Antibodies of the present invention may also be described or
specified in terms of their cross-reactivity. Antibodies that do
not bind any other analog, ortholog, or homolog of a polypeptide of
the present invention are included. Antibodies that bind
polypeptides with at least 95%, at least 90%, at least 85%, at
least 80%, at least 75%, at least 70%, at least 65%, at least 60%,
at least 55%, and at least 50% identity (as calculated using
methods known in the art and described herein) to a polypeptide of
the present invention are also included in the present invention.
In specific embodiments, antibodies of the present invention
cross-react with murine, rat and/or rabbit homologs of human
proteins and the corresponding epitopes thereof. Antibodies that do
not bind polypeptides with less than 95%, less than 90%, less than
85%, less than 80%, less than 75%, less than 70%, less than 65%,
less than 60%, less than 55%, and less than 50% identity (as
calculated using methods known in the art and described herein) to
a polypeptide of the present invention are also included in the
present invention. In a specific embodiment, the above-described
cross-reactivity is with respect to any single specific antigenic
or immunogenic polypeptide, or combination(s) of 2, 3, 4, 5, or
more of the specific antigenic and/or immunogenic polypeptides
disclosed herein. Further included in the present invention are
antibodies which bind polypeptides encoded by polynucleotides which
hybridize to a polynucleotide of the present invention under
stringent hybridization conditions (as described herein).
Antibodies of the present invention may also be described or
specified in terms of their binding affinity to a polypeptide of
the invention. Preferred binding affinities include those with a
dissociation constant or K.sub.d ess than 5.times.10.sup.-2 M,
10.sup.-2 M, 5.times.10.sup.-3 M, 10.sup.-3 M, 5.times.10.sup.-4 M,
10.sup.-4 M, 5.times.10.sup.-5M, 10.sup.-5M, 5.times.10.sup.-6M,
10.sup.-6 M, 5.times.10.sup.-7 M, 10.sup.-7M, 5.times.10.sup.-8 M,
10.sup.-8 M, 5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10
M, 10.sup.-10 M, 5.times.10.sup.-11 M, 10.sup.-11 M,
5.times.10.sup.-12 M, 10.sup.-12 M, 5.times.10.sup.-13M, 10.sup.-13
M, 5.times.10.sup.-14 M, 10.sup.-14 M, 5.times.10.sup.-15 M, or
10.sup.-15 M.
[0199] The invention also provides antibodies that competitively
inhibit binding of an antibody to an epitope of the invention as
determined by any method known in the art for determining
competitive binding, for example, the immunoassays described
herein. In preferred embodiments, the antibody competitively
inhibits binding to the epitope by at least 95%, at least 90%, at
least 85%, at least 80%, at least 75%, at least 70%, at least 60%,
or at least 50%.
[0200] Antibodies of the present invention may act as agonists or
antagonists of the polypeptides of the present invention. For
example, the present invention includes antibodies which disrupt
the receptor/ligand interactions with the polypeptides of the
invention either partially or fully. Preferably, antibodies of the
present invention bind an antigenic epitope disclosed herein, or a
portion thereof. The invention features both receptor-specific
antibodies and ligand-specific antibodies. The invention also
features receptor-specific antibodies which do not prevent ligand
binding but prevent receptor activation. Receptor activation (i.e.,
signaling) may be determined by techniques described herein or
otherwise known in the art. For example, receptor activation can be
determined by detecting the phosphorylation (e.g., tyrosine or
serine/threonine) of the receptor or its substrate by
immunoprecipitation followed by western blot analysis (for example,
as described herein). In specific embodiments, antibodies are
provided that inhibit ligand activity or receptor activity by at
least 95%, at least 90%, at least 85%, at least 80%, at least 75%,
at least 70%, at least 60%, or at least 50% of the activity in
absence of the antibody.
[0201] The invention also features receptor-specific antibodies
which both prevent ligand binding and receptor activation as well
as antibodies that recognize the receptor-ligand complex, and,
preferably, do not specifically recognize the unbound receptor or
the unbound ligand. Likewise, included in the invention are
neutralizing antibodies which bind the ligand and prevent binding
of the ligand to the receptor, as well as antibodies which bind the
ligand, thereby preventing receptor activation, but do not prevent
the ligand from binding the receptor. Further included in the
invention are antibodies which activate the receptor. These
antibodies may act as receptor agonists, i.e., potentiate or
activate either all or a subset of the biological activities of the
ligand-mediated receptor activation, for example, by inducing
dimerization of the receptor. The antibodies may be specified as
agonists, antagonists or inverse agonists for biological activities
comprising the specific biological activities of the peptides of
the invention disclosed herein. The above antibody agonists can be
made using methods known in the art. See, e.g., PCT publication WO
96/40281; U.S. Pat. No. 5,811,097; Deng et al., Blood 92
(6):1981-1988 (1998); Chen et al., Cancer Res. 58 (16):3668-3678
(1998); Harrop et al., J. Immunol. 161 (4):1786-1794 (1998); Zhu et
al., Cancer Res. 58 (15):3209-3214 (1998); Yoon et al., J. Immunol.
160 (7):3170-3179 (1998); Prat et al., J. Cell. Sci. 111
(Pt2):237-247 (1998); Pitard et al., J. Immunol. Methods 205
(2):177-190 (1997); Liautard et al., Cytokine 9 (4):233-241 (1997);
Carlson et al., J. Immunol. 272 (17):11295-11301 (1997); Taryman et
al., Neuron 14 (4):755-762 (1995); Muller et al., Structure
6(9):1153-1167 (1998); Bartunek et al., Cytokine 8 (1):14-20 (1996)
(which are all incorporated by reference herein in their
entireties).
[0202] Antibodies of the present invention may be used, for
example, but not limited to, to purify, detect, and target the
polypeptides of the present invention, including both in vitro and
in vivo diagnostic and therapeutic methods. For example, the
antibodies have use in immunoassays for qualitatively and
quantitatively measuring levels of the polypeptides of the present
invention in biological samples. See, e.g., Harlow et al.,
Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory
Press, 2nd ed. 1988) (incorporated by reference herein in its
entirety).
[0203] As discussed in more detail herein, the antibodies of the
present invention may be used either alone or in combination with
other compositions. The antibodies may further be recombinantly
fused to a heterologous polypeptide at the N- or C-terminus or
chemically conjugated (including covalently and non-covalently
conjugations) to polypeptides or other compositions. For example,
antibodies of the present invention may be recombinantly fused or
conjugated to molecules useful as labels in detection assays and
effector molecules such as heterologous polypeptides, drugs,
radionuclides, or toxins. See, e.g., PCT publications WO 92/08495;
WO 91/14438; WO 89/12624; U.S. Pat. No. 5,314,995; and EP
396,387.
[0204] The antibodies of the invention include derivatives that are
modified, i.e, by the covalent attachment of any type of molecule
to the antibody such that covalent attachment does not prevent the
antibody from generating an anti-idiotypic response. For example,
but not by way of limitation, the antibody derivatives include
antibodies that have been modified, e.g., by glycosylation,
acetylation, pegylation, phosphylation, amidation, derivatization
by known protecting/blocking groups, proteolytic cleavage, linkage
to a cellular ligand or other protein, etc. Any of numerous
chemical modifications may be carried out by known techniques,
including, but not limited to specific chemical cleavage,
acetylation, formylation, metabolic synthesis of tunicamycin, etc.
Additionally, the derivative may contain one or more non-classical
amino acids.
[0205] The antibodies of the present invention may be generated by
any suitable method known in the art. Polyclonal antibodies to an
antigen-of-interest can be produced by various procedures well
known in the art. For example, a polypeptide of the invention can
be administered to various host animals including, but not limited
to, rabbits, mice, rats, etc. to induce the production of sera
containing polyclonal antibodies specific for the antigen. Various
adjuvants may be used to increase the immunological response,
depending on the host species, and include but are not limited to,
Freund's (complete and incomplete), mineral gels such as aluminum
hydroxide, surface active substances such as lysolecithin, pluronic
polyols, polyanions, peptides, oil emulsions, keyhole limpet
hemocyanins, dinitrophenol, and potentially useful human adjuvants
such as BCG (bacille Calmette-Guerin) and corynebacterium parvum.
Such adjuvants are also well known in the art.
[0206] Monoclonal antibodies can be prepared using a wide variety
of techniques known in the art including the use of hybridoma,
recombinant, and phage display technologies, or a combination
thereof. For example, monoclonal antibodies can be produced using
hybridoma techniques including those known in the art and taught,
for example, in Harlow et al., Antibodies: A Laboratory Manual,
(Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hanmerling, et
al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681
(Elsevier, N.Y.,1981) (said references incorporated by reference in
their entireties). The term "monoclonal antibody" as used herein is
not limited to antibodies produced through hybridoma technology.
The term "monoclonal antibody" refers to an antibody that is
derived from a single clone, including any eukaryotic, prokaryotic,
or phage clone, and not the method by which it is produced.
[0207] Methods for producing and screening for specific antibodies
using hybridoma technology are routine and well known in the art
and are discussed in detail in the Examples (e.g., Example 16). In
a non-limiting example, mice can be immunized with a polypeptide of
the invention or a cell expressing such peptide. Once an immune
response is detected, e.g., antibodies specific for the antigen are
detected in the mouse serunm, the mouse spleen is harvested and
splenocytes isolated. The splenocytes are then fused by well known
techniques to any suitable myeloma cells, for example cells from
cell line SP20 available from the ATCC.TM.. Hybridomas are selected
and cloned by limited dilution. The hybridoma clones are then
assayed by methods known in the art for cells that secrete
antibodies capable of binding a polypeptide of the invention.
Ascites fluid, which generally contains high levels of antibodies,
can be generated by immunizing mice with positive hybridoma
clones.
[0208] Accordingly, the present invention provides methods of
generating monoclonal antibodies as well as antibodies produced by
the method comprising culturing a hybridoma cell secreting an
antibody of the invention wherein, preferably, the hybridoma is
generated by fusing splenocytes isolated from a mouse immunized
with an antigen of the invention with myeloma cells and then
screening the hybridomas resulting from the fusion for hybridoma
clones that secrete an antibody able to bind a polypeptide of the
invention.
[0209] Antibody fragments which recognize specific epitopes may be
generated by known techniques. For example, Fab and F(ab')2
fragments of the invention may be produced by proteolytic cleavage
of immunoglobulin molecules, using enzymes such as papain (to
produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
F(ab')2 fragments contain the variable region, the light chain
constant region and the CH1 domain of the heavy chain.
[0210] For example, the antibodies of the present invention can
also be generated using various phage display methods known in the
art. In phage display methods, functional antibody domains are
displayed on the surface of phage particles which carry the
polynucleotide sequences encoding them. In a particular embodiment,
such phage can be utilized to display antigen binding domains
expressed from a repertoire or combinatorial antibody library
(e.g., human or murine). Phage expressing an antigen binding domain
that binds the antigen of interest can be selected or identified
with antigen, e.g., using labeled antigen or antigen bound or
captured to a solid surface or bead. Phage used in these methods
are typically filamentous phage including fd and M13 binding
domains expressed from phage with Fab, Fv or disulfide stabilized
Fv antibody domains recombinantly fused to either the phage gene
III or gene VIII protein.
[0211] Examples of phage display methods that can be used to make
the antibodies of the present invention include those disclosed in
Brinkman et al., J. Immunol. Methods 182:41-50 (1995); Ames et al.,
J. Immunol. Methods 184:177-186 (1995); Kettleborough et al., Eur.
J. Immunol. 24:952-958 (1994); Persic et al., Gene 187 9-18 (1997);
Burton et al., Advances in Immunology 57:191-280 (1994); PCT
application No. PCT/GB91/01134; PCT publications WO 90/02809; WO
91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO
95/20401; and U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484;
5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908;
5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of
which is incorporated herein by reference in its entirety.
[0212] As described in the above references, after phage selection,
the antibody coding regions from the phage can be isolated and used
to generate whole antibodies, including human antibodies, or any
other desired antigen binding fragment, and expressed in any
desired host, including mammalian cells, insect cells, plant cells,
yeast, and bacteria, e.g., as described in detail herein. For
example, techniques to recombinantly produce Fab, Fab' and F(ab')2
fragments can also be employed using methods known in the art such
as those disclosed in PCT publication WO 92/22324; Mullinax et al.,
BioTechniques 12 (6):864-869 (1992); and Sawai et al., AJRI
34:26-34 (1995); an Better et al., Science 240:1041-1043 (1988)
(said references incorporated by reference in their
entireties).
[0213] Examples of techniques which can be used to produce
single-chain Fvs and antibodies include those described in U.S.
Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in
Enzymology 203:46-88 (1991); Shu et al., PNAS 90:7995-7999 (1993);
and Skerra et al., Science 240:1038-1040 (1988). For some uses,
including in vivo use of antibodies in humans and in vitro
detection assays, it may be preferable to use chimeric, humanized,
or human antibodies. A chimeric antibody is a molecule in which
different portions of the antibody are derived from different
animal species, such as antibodies having a variable region derived
from a murine monoclonal antibody and a human immunoglobulin
constant region. Methods for producing chimeric antibodies are
known in the art. See e.g., Morrison, Science 229:1202 (1985); Oi
et al., BioTechniques 4:214 (1986); Gillies et al., (1989) J.
Immunol. Methods 125:191-202; U.S. Pat. Nos. 5,807,715; 4,816,567;
and 4,816,397, which are incorporated hereinby reference in their
entirety.
[0214] Humanized antibodies are antibody molecules from non-human
species antibody that binds the desired antigen having one or more
complementary determining regions (CDRs) from the non-human species
and a framework regions from a human immunoglobulin molecule.
Often, framework residues in the human framework regions will be
substituted with the corresponding residue from the CDR donor
antibody to alter, preferably improve, antigen binding. These
framework substitutions are identified by methods well known in the
art, e.g., by modeling of the interactions of the CDR and framework
residues to identify framework residues important for antigen
binding and sequence comparison to identify unusual framework
residues at particular positions. (See, e.g., Queen et al., U.S.
Pat. No. 5,585,089; Riechmann et al., Nature 332:323 (1988), which
are incorporated herein by reference in their entireties.)
Antibodies can be humanized using a variety of techniques known in
the art including, for example, CR-grafting (EP 239,400; PCT
publication WO 91/09967; U.S. Pat. Nos. 5,225,539; 5,530,101; and
5,585,089), veneering or resurfacing (EP 592,106; EP 519,596;
Padlan, Molecular Immunology 28 (4/5):489-498 (1991); Studnicka et
al., Protein Engineering 7 (6):805-814 (1994); Roguska. et al.,
PNAS 91:969-973 (1994)), and chain shuffling (U.S. Pat. No.
5,565,332).
[0215] Completely human antibodies are particularly desirable for
therapeutic treatment of human patients. Human antibodies can be
made by a variety of methods known in the art including phage
display methods described above using antibody libraries derived
from human immunoglobulin sequences. See also, U.S. Pat. Nos.
4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO
98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and
WO 91/10741; each of which is incorporated herein by reference in
its entirety.
[0216] Human antibodies can also be produced using transgenic mice
which are incapable of expressing functional endogenous
immunoglobulins, but which can express human immunoglobulin genes.
For example, the human heavy and light chain immunoglobulin gene
complexes may be introduced randomly or by homologous recombination
into mouse embryonic stem cells. Alternatively, the human variable
region, constant region, and diversity region may be introduced
into mouse embryonic stem cells in addition to the human heavy and
light chain genes. The mouse heavy and light chain immunoglobulin
genes may be rendered non-functional separately or simultaneously
with the introduction of human immunoglobulin loci by homologous
recombination. In particular, homozygous deletion of the JH region
prevents endogenous antibody production. The modified embryonic
stem cells are expanded and microinjected into blastocysts to
produce chimeric mice. The chimeric mice are then bred to produce
homozygous offspring which express human antibodies. The transgenic
mice are immunized in the normal fashion with a selected antigen,
e.g., all or a portion of a polypeptide of the invention.
[0217] Monoclonal antibodies directed against the antigen can be
obtained from the immunized, transgenic mice using conventional
hybridoma technology. The human immunoglobulin transgenes harbored
by the transgenic mice rearrange during B cell differentiation, and
subsequently undergo class switching and somatic mutation. Thus,
using such a technique, it is possible to produce therapeutically
useful IgG, IgA, IgM and IgE antibodies. For an overview of this
technology for producing human antibodies, see Lonberg and Huszar,
Int. Rev. Immunol. 13:65-93 (1995). For a detailed discussion of
this technology for producing human antibodies and human monoclonal
antibodies and protocols for producing such antibodies, see, e.g.,
PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO
96/33735; European Patent No. 0 598 877; U.S. Pat. Nos. 5,413,923;
5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318;
5,885,793; 5,916,771; and 5,939,598, which are incorporated by
reference herein in their entirety. In addition, companies such as
Abgenix, Inc. (Freemont, Calif.) and Genpharin (San Jose, Calif.)
can be engaged to provide human antibodies directed against a
selected antigen using technology similar to that described
above.
[0218] Completely human antibodies which recognize a selected
epitope can be generated using a technique referred to as "guided
selection." In this approach a selected non-human monoclonal
antibody, e.g., a mouse antibody, is used to guide the selection of
a completely human antibody recognizing the same epitope. (Jespers
et al., Bio/technology 12:899-903 (1988)).
[0219] Further, antibodies to the polypeptides of the invention
can, in turn, be utilized to generate anti-idiotype antibodies that
"mimic" polypeptides of the invention using techniques well known
to those skilled in the art. (See, e.g., Greenspan & Bona,
FASEB J. 7 (5):437-444; (1989) and Nissinoff, J. Immunol. 147
(8):2429-2438 (1991)). For example, antibodies which bind to and
competitively inhibit polypeptide multimerization and/or binding of
a polypeptide of the invention to a ligand can be used to generate
anti-idiotypes that "mimic" the polypeptide multimerization and/or
binding domain and, as a consequence, bind to and neutralize
polypeptide and/or its ligand. Such neutralizing anti-idiotypes or
Fab fragments of such anti-idiotypes can be used in therapeutic
regimens to neutralize polypeptide ligand. For example, such
anti-idiotypic antibodies can be used to bind a polypeptide of the
invention and/or to bind its ligands/receptors, and thereby block
its biological activity.
[0220] The invention further provides polynucleotides comprising a
nucleotide sequence encoding an antibody of the invention and
fragments thereof. The invention also encompasses polynucleotides
that hybridize under stringent or lower stringency hybridization
conditions, e.g., as defined herein, to polynucleotides that encode
an antibody, preferably, that specifically binds to a polypeptide
of the invention, preferably, an antibody that binds to a
polypeptide having the amino acid sequence of SEQ ID NO:2.
[0221] The polynucleotides maybe obtained, and the nucleotide
sequence of the polynucleotides determined, by any method known in
the art. For example, if the nucleotide sequence of the antibody is
known, a polynucleotide encoding the antibody may be assembled from
chemically synthesized oligonucleotides (e.g., as described in
Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly,
involves the synthesis of overlapping oligonucleotides containing
portions of the sequence encoding the antibody, annealing and
ligating of those oligonucleotides, and then amplification of the
ligated oligonucleotides by PCR.
[0222] Alternatively, a polynucleotide encoding an antibody may be
generated from nucleic acid from a suitable source. If a clone
containing a nucleic acid encoding a particular antibody is not
available, but the sequence of the antibody molecule is known, a
nucleic acid encoding the immunoglobulin may be chemically
synthesized or obtained from a suitable source (e.g., an antibody
cDNA library, or a cDNA library generated from, or nucleic acid,
preferably poly A+ RNA, isolated from, any tissue or cells
expressing the antibody, such as hybridoma cells selected to
express an antibody of the invention) by PCR amplification using
synthetic primers hybridizable to the 3' and 5' ends of the
sequence or by cloning using an oligonucleotide probe specific for
the particular gene sequence to identify, e.g., a cDNA clone from a
cDNA library that encodes the antibody. Amplified nucleic acids
generated by PCR may then be cloned into replicable cloning vectors
using any method well known in the art.
[0223] Once the nucleotide sequence and corresponding amino acid
sequence of the antibody is determined, the nucleotide sequence of
the antibody may be manipulated using methods well known in the art
for the manipulation of nucleotide sequences, e.g., recombinant DNA
techniques, site directed mutagenesis, PCR, etc. (see, for example,
the techniques described in Sambrook et al., 1990, Molecular
Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y. and Ausubel et al., eds.,
1998, Current Protocols in Molecular Biology, John Wiley &
Sons, NY, which are both incorporated by reference herein in their
entireties ), to generate antibodies having a different amino acid
sequence, for example to create amino acid substitutions,
deletions, and/or insertions.
[0224] In a specific embodiment, the amino acid sequence of the
heavy and/or light chain variable domains may be inspected to
identify the sequences of the complementary determining regions
(CDRs) by methods that are well know in the art, e.g., by
comparison to known amino acid sequences of other heavy and light
chain variable regions to determine the regions of sequence
hypervariability. Using routine recombinant DNA techniques, one or
more of the CDRs may be inserted within framework regions, e.g.,
into human framework regions to humanize a non-human antibody, as
described herein. The framework regions may be naturally occurring
or consensus framework regions, and preferably human framework
regions (see, e.g., Chothia et al., J. Mol. Biol. 278: 457-479
(1998) for a listing of human framework regions). Preferably, the
polynucleotide generated by the combination of the framework
regions and CDRs encodes an antibody that specifically binds a
polypeptide of the invention. Preferably, as discussed herein, one
or more amino acid substitutions may be made within the framework
regions, and, preferably, the amino acid substitutions improve
binding of the antibody to its antigen. Additionally, such methods
may be used to make amino acid substitutions or deletions of one or
more variable region cysteine residues participating in an
intrachain disulfide bond to generate antibody molecules lacking
one or more intrachain disulfide bonds. Other alterations to the
polynucleotide are encompassed by the present invention and within
the skill of the art.
[0225] In addition, techniques developed for the production of
"chimeric antibodies" (Morrison et al., Proc. Natl. Acad. Sci.
81:851-855 (1984); Neuberger et al., Nature 312:604-608 (1984);
Takeda et al., Nature 314:452-454 (1985)) by splicing genes from a
mouse antibody molecule of appropriate antigen specificity together
with genes from a human antibody molecule of appropriate biological
activity can be used. As described herein, a chimeric antibody is a
molecule in which different portions are derived from different
animal species, such as those having a variable region derived from
a murine mAb and a human immunoglobulin constant region, e.g.,
humanized antibodies.
[0226] Alternatively, techniques described for the production of
single chain antibodies (U.S. Pat. No. 4,946,778; Bird, Science
242:423-42 (1988); Huston et al., Proc. Natl. Acad. Sci. USA
85:5879-5883 (1988); and Ward et al., Nature 334:544-54 (1989)) can
be adapted to produce single chain antibodies. Single chain
antibodies are formed by linking the heavy and light chain
fragments of the Fv region via an amino acid bridge, resulting in a
single chain polypeptide. Techniques for the assembly of functional
Fv fragments in E. coli may also be used (Skerra et al., Science
242:1038-1041 (1988)).
[0227] The antibodies of the invention can be produced by any
method known in the art for the synthesis of antibodies, in
particular, by chemical synthesis or preferably, by recombinant
expression techniques.
[0228] Recombinant expression of an antibody of the invention, or
fragment, derivative or analog thereof, (e.g., a heavy or light
chain of an antibody of the invention or a single chain antibody of
the invention), requires construction of an expression vector
containing a polynucleotide that encodes the antibody. Once a
polynucleotide encoding an antibody molecule or a heavy or light
chain of an antibody, or portion thereof (preferably containing the
heavy or light chain variable domain), of the invention has been
obtained, the vector for the production of the antibody molecule
may be produced by recombinant DNA technology using techniques well
known in the art. Thus, methods for preparing a protein by
expressing a polynucleotide containing an antibody encoding
nucleotide sequence are described herein.
[0229] Methods which are well known to those sldlled in the art can
be used to construct expression vectors containing antibody coding
sequences and appropriate transcriptional and translational control
signals. These methods include, for example, in vitro recombinant
DNA techniques, synthetic techniques, and in vivo genetic
recombination. The invention, thus, provides replicable vectors
comprising a nucleotide sequence encoding an antibody molecule of
the invention, or a heavy or light chain thereof, or a heavy or
light chain variable domain, operably linked to a promoter. Such
vectors may include the nucleotide sequence encoding the constant
region of the antibody molecule (see, e.g., PCT Publication WO
86/05807; PCT Publication WO 89/01036; and U.S. Pat. No. 5,122,464)
and the variable domain of the antibody may be cloned into such a
vector for expression of the entire heavy or light chain.
[0230] The expression vector is transferred to a host cell by
conventional techniques and the transfected cells are then cultured
by conventional techniques to produce an antibody of the invention.
Thus, the invention includes host cells containing a polynucleotide
encoding an antibody of the invention, or a heavy or light chain
thereof, or a single chain antibody of the invention, operably
linked to a heterologous promoter. In preferred embodiments for the
expression of double-chained antibodies, vectors encoding both the
heavy and light chains may be co-expressed in the host cell for
expression of the entire immunoglobulin molecule, as detailed
herein.
[0231] A variety of host-expression vector systems maybe utilized
to express the antibody molecules of the invention. Such
host-expression systems represent vehicles by which the coding
sequences of interest may be produced and subsequently purified,
but also represent cells which may, when transformed or transfected
with the appropriate nucleotide coding sequences, express an
antibody molecule of the invention in situ. These include but are
not limited to microorganisms such as bacteria (e.g., E. coli, B.
subtilis) transformed with recombinant bacteriophage DNA, plasmid
DNA or cosmid DNA expression vectors containing antibody coding
sequences; yeast (e.g., Saccharomyces, Pichia) transformed with
recombinant yeast expression vectors containing antibody coding
sequences; insect cell systems infected with recombinant virus
expression vectors (e.g., baculovirus) containing antibody coding
sequences; plant cell systems infected with recombinant virus
expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco
mosaic virus, TMV) or transformed with recombinant plasmid
expression vectors (e.g., Ti plasmid) containing antibody coding
sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3
cells) harboring recombinant expression constructs containing
promoters derived from the genome of mammalian cells (e.g.,
metallothionein promoter) or from mammalian viruses (e.g., the
adenovirus late promoter; the vaccinia virus 7.5K promoter).
[0232] Preferably, bacterial cells such as Escherichia coli, and
more preferably, eukaryotic cells, especially for the expression of
whole recombinant antibody molecule, are used for the expression of
a recombinant antibody molecule. For example, mammalian cells such
as Chinese hamster ovary cells (CHO), in conjunction with a vector
such as the major intermediate early gene promoter element from
human cytomegalovirus is an effective expression system for
antibodies (Foecking et al., Gene 45:101 (1986); Cockett et al.,
Bio/Technology 8:2 (1990)).
[0233] In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the
antibody molecule being expressed. For example, when a large
quantity of such a protein is to be produced, for the generation of
pharmaceutical compositions of an antibody molecule, vectors which
direct the expression of high levels of fusion protein products
that are readily purified may be desirable. Such vectors include,
but are not limited, to the E. coli expression vector pUR278
(Ruther et al., EMBO J. 2:1791 (1983)), in which the antibody
coding sequence may be ligated individually into the vector in
frame with the lac Z coding region so that a fusion protein is
produced; pIN vectors (Inouye & Inouye, Nucleic Acids Res.
13:3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem.
24:5503-5509 (1989)); and the like. pGEX vectors may also be used
to express foreign polypeptides as fusion proteins with glutathione
S-transferase (GST). In general, such fusion proteins are soluble
and can easily be purified from lysed cells by adsorption and
binding to matrix glutathione-agarose beads followed by elution in
the presence of free glutathione. The pGEX vectors are designed to
include thrombin or factor Xa protease cleavage sites so that the
cloned target gene product can be released from the GST moiety.
[0234] In an insect system, Autographa californica nuclear
polyhedrosis virus (AcNPV) is used as a vector to express foreign
genes. The virus grows in Spodoptera frugiperda cells. The antibody
coding sequence may be cloned individually into non-essential
regions (for example the polyhedrin gene) of the virus and placed
under control of an AcNPV promoter (for example the polyhedrin
promoter).
[0235] In mammalian host cells, a number of viral-based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, the antibody coding sequence of interest may be
ligated to an adenovirus transcription/translation control complex,
e.g., the late promoter and tripartite leader sequence. This
chimeric gene may then be inserted in the adenovirus genome by in
vitro or in vivo recombination. Insertion in a non-essential region
of the viral genome (e.g., region E1 or E3) will result in a
recombinant virus that is viable and capable of expressing the
antibody molecule in infected hosts. (e.g., see Logan & Shenk,
Proc. Natl. Acad. Sci. USA 81:355-359 (1984)). Specific initiation
signals may also be required for efficient translation of inserted
antibody coding sequences. These signals include the ATG initiation
codon and adjacent sequences. Furthermore, the initiation codon
must be in phase with the reading frame of the desired coding
sequence to ensure translation of the entire insert. These
exogenous translational control signals and initiation codons can
be of a variety of origins, both natural and synthetic. The
efficiency of expression maybe enhanced by the inclusion of
appropriate transcription enhancer elements, transcription
terminators, etc. (see Bittner et al., Methods in Enzymol.
153:51-544 (1987)).
[0236] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products may be important for the function of the
protein. Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins and gene products. Appropriate cell lines or host
systems can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for
proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such mammalian
host cells include but are not limited to CHO, VERY, BHK, Hela,
COS, MDCK, 293, 3T3, WI38, and in particular, breast cancer cell
lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D, and
normal mammary gland cell line such as, for example, CRL7030 and
Hs578Bst.
[0237] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
which stably express the antibody molecule may be engineered.
Rather than using expression vectors which contain viral origins of
replication, host cells can be transformed with DNA controlled by
appropriate expression control elements (e.g., promoter, enhancer,
sequences, transcription terminators, polyadenylation sites, etc.),
and a selectable marker. Following the introduction of the foreign
DNA, engineered cells may be allowed to grow for 1-2 days in an
enriched media, and then are switched to a selective media. The
selectable marker in the recombinant plasmid confers resistance to
the selection and allows cells to stably integrate the plasmid into
their chromosomes and grow to form foci which in turn can be cloned
and expanded into cell lines. This method may advantageously be
used to engineer cell lines which express the antibody molecule.
Such engineered cell lines may be particularly useful in screening
and evaluation of compounds that interact directly or indirectly
with the antibody molecule.
[0238] A number of selection systems may be used, including but not
limited to the herpes simplex virus thymidine kinase (Wigler et
al., Cell 11:223 (1977)), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl.
Acad. Sci. USA 48:202 (1992)), and adenine
phosphoribosyltransferase (Lowy et al., Cell 22:817 (1980)) genes
can be employed in tk-, hgprt- or aprt-cells, respectively. Also,
antimetabolite resistance can be used as the basis of selection for
the following genes: dhfr, which confers resistance to methotrexate
(Wigler et al., Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al.,
Proc. Natl. Acad. Sci. USA 78:1527 (1981)); gpt, which confers
resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl.
Acad. Sci. USA 78:2072 (1981)); neo, which confers resistance to
the aminoglycoside G-418 Clinical Pharmacy 12:488-505; Wu and Wu,
Biotherapy3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol.
32:573-596 (1993); Mulligan, Science 260:926-932 (1993); and Morgan
and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May 1993, TIB
TECH 11 (5):155-215); and hygro, which confers resistance to
hygromycin (Santerre et al., Gene 30:147 (1984)). Methods commonly
known in the art of recombinant DNA technology may be routinely
applied to select the desired recombinant clone, and such methods
are described, for example, in Ausubel et al. (eds.), Current
Protocols in Molecular Biology, John Wiley & Sons, NY (1993);
Kriegler, Gene Transfer and Expression, A Laboratory Manual,
Stockton Press, NY (1990); and in Chapters 12 and 13, Dracopoli et
al. (eds), Current Protocols in Human Genetics, John Wiley &
Sons, NY (1994); Colberre-Garapin et al., J. Mol. Biol. 150:1
(1981), which are incorporated by reference herein in their
entireties.
[0239] The expression levels of an antibody molecule can be
increased by vector amplification (for a review, see Bebbington and
Hentschel, The use of vectors based on gene amplification for the
expression of cloned genes in mammalian cells in DNA cloning, Vol.
3. (Academic Press, New York, 1987)). When a marker in the vector
system expressing antibody is amplifiable, increase in the level of
inhibitor present in culture of host cell will increase the number
of copies of the marker gene. Since the amplified region is
associated with the antibody gene, production of the antibody will
also increase (Crouse et al., Mol. Cell. Biol. 3:257 (1983)).
[0240] The host cell may be co-transfected with two expression
vectors of the invention, the first vector encoding a heavy chain
derived polypeptide and the second vector encoding a light chain
derived polypeptide. The two vectors may contain identical
selectable markers which enable equal expression of heavy and light
chain polypeptides. Alternatively, a single vector may be used
which encodes, and is capable of expressing, both heavy and light
chain polypeptides. In such situations, the light chain should be
placed before the heavy chain to avoid an excess of toxic free
heavy chain (Proudfoot, Nature 322:52 (1986); Kohler, Proc. Natl.
Acad. Sci. USA 77:2197 (1980)). The coding sequences for the heavy
and light chains may comprise cDNA or genomic DNA.
[0241] Once an antibody molecule of the invention has been produced
by an animal, chemically synthesized, or recombinantly expressed,
it may be purified by any method known in the art for purification
of an immunoglobulin molecule, for example, by chromatography
(e.g., ion exchange, affity, particularly by affinity for the
specific antigen after Protein A, and sizing column
chromatography), centrifugation, differential solubility, or by any
other standard technique for the purification of proteins. In
addition, the antibodies of the present invention or fragments
thereof can be fused to heterologous polypeptide sequences
described herein or otherwise known in the art, to facilitate
purification.
[0242] The present invention encompasses antibodies recombinantly
fused or chemically conjugated (including both covalently and
non-covalently conjugations) to a polypeptide (or portion thereof,
preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino
acids of the polypeptide) of the present invention to generate
fusion proteins. The fusion does not necessarily need to be direct,
but may occur through linker sequences. The antibodies may be
specific for antigens other thanpolypeptides (or portion thereof,
preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino
acids of the polypeptide) of the present invention. For example,
antibodies may be used to target the polypeptides of the present
invention to particular cell types, either in vitro or in vivo, by
fusing or conjugating the polypeptides of the present invention to
antibodies specific for particular cell surface receptors.
Antibodies fused or conjugated to the polypeptides of the present
invention may also be used in in vitro immunoassays and
purification methods using methods known in the art. See e.g.,
Harbor et al., herein, and PCT publication WO 93/21232; EP 439,095;
Naramura et al., Immunol. Lett. 39:91-99 (1994); U.S. Pat. No.
5,474,981; Gillies et al., PNAS 89:1428-1432 (1992); Fell at al.,
J. Immunol. 146:2446-2452 (1991), which are incorporated by
reference in their entireties.
[0243] The present invention further includes compositions
comprising the polypeptides of the present invention fused or
conjugated to antibody domains other than the variable regions. For
example, the polypeptides of the present invention may be fused or
conjugated to an antibody Fc region, or portion thereof. The
antibody portion fused to a polypeptide of the present invention
may comprise the constant region, hinge region, CH1 domain, CH2
domain, and CH3 domain or any combination of whole domains or
portions thereof. The polypeptides may also be fused or conjugated
to the above antibody portions to form multimers. For example, Fc
portions fused to the polypeptides of the present invention can
form dimers through disulfide bonding between the Fc portions.
Higher multimeric forms can be made by fusing the polypeptides to
portions of IgA and IgM. Methods for fusing or conjugating the
polypeptides of the present invention to antibody portions are
known in the art. See, e.g., U.S. Pat. Nos. 5,336,603; 5,622,929;
5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307,434; EP 367,166;
PCT publications WO 96/04388; WO 91/06570; Ashkenazi et al., Proc.
Natl. Acad. Sci. USA 88:10535-10539 (1991); Zheng et al., J.
Immunol. 154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad.
Sci. USA 89:11337-11341 (1992) (said references incorporated by
reference in their entireties).
[0244] As discussed, herein, the polypeptides corresponding to a
polypeptide, polypeptide fragment, or a variant of SEQ ID NO:2 may
be fused or conjugated to the above antibody portions to increase
the in vivo half life of the polypeptides or for use in
immunoassays using methods known in the art. Further, the
polypeptides corresponding to SEQ ID NO:2 may be fused or
conjugated to the above antibody portions to facilitate
purification. One reported example describes chimeric proteins
consisting of the first two domains of the human CD4-polypeptide
and various domains of the constant regions of the heavy or light
chains of mammalian immunoglobulins. (EP 394,827; Traunecker et
al., Nature 331:84-86 (1988). The polypeptides of the present
invention fused or conjugated to an antibody having
disulfide-linked dimeric structures (due to the IgG) may also be
more efficient in binding and neutralizing other molecules, than
the monomeric secreted protein or protein fragment alone.
(Fountoulakis et al., J. Biochem. 270:3958-3964 (1995)). In many
cases, the Fc part in a fusion protein is beneficial in therapy and
diagnosis, and thus can result in, for example, improved
pharmacokinetic properties. (EP A 232,262). Alternatively, deleting
the Fc part after the fusion protein has been expressed, detected,
and purified, would be desired. For example, the Fc portion may
hinder therapy and diagnosis if the fusion protein is used as an
antigen for immunizations. In drug discovery, for example, human
proteins, such as hIL-5, have been fused with Fc portions for the
purpose of high-throughput screening assays to identify antagonists
of hIL-5. (See, Bennett et al., J. Molecular Recognition 8:52-58
(1995); Johanson et al., J. Biol. Chem. 270:9459-9471 (1995).
[0245] Moreover, the antibodies or fragments thereof of the present
invention can be fused to marker sequences, such as a peptide to
facilitate purification. In preferred embodiments, the marker amino
acid sequence is a hexa-histidine peptide, such as the tag provided
in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth,
Calif., 91311), among others, many of which are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA
86:821-824 (1989), for instance, hexa-histidine provides for
convenient purification of the fusion protein. Other peptide tags
useful for purification include, but are not limited to, the "HA"
tag, which corresponds to an epitope derived from the influenza
hemagglutinin protein (Wilson et al., Cell 37:767 (1984)) and the
"flag" tag.
[0246] The present invention further encompasses antibodies or
fragments thereof conjugated to a diagnostic or therapeutic agent.
The antibodies can be used diagnostically to, for example, monitor
the development or progression of a tumor as part of a clinical
testing procedure to, e.g., determine the efficacy of a given
treatment regimen. Detection can be facilitated by coupling the
antibody to a detectable substance. Examples of detectable
substances include various enzymes, prosthetic groups, fluorescent
materials, luminescent materials, bioluminescent materials,
radioactive materials, positron emitting metals using various
positron emission tomographies, and nonradioactive paramagnetic
metal ions. The detectable substance may be coupled or conjugated
either directly to the antibody (or fragment thereof) or
indirectly, through an intermediate (such as, for example, a linker
known in the art) using techniques known in the art. See, for
example, U.S. Pat. No. 4,741,900 for metal ions which can be
conjugated to antibodies for use as diagnostics according to the
present invention. Examples of suitable enzymes include horseradish
peroxidase, alkaline phosphatase, beta-galactosidase, or
acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidinibiotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin; and examples of suitable radioactive
material include 125I, 131I, 111In or 99Tc.
[0247] Further, an antibody or fragment thereof may be conjugated
to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or
cytocidal agent, a therapeutic agent or a radioactive metal ion,
e.g., alpha-emitters such as, for example, 213Bi. A cytotoxin or
cytotoxic agent includes any agent that is detrimental to cells.
Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium
bromide, emetine, mitomycin, etoposide, tenoposide, vincristine,
vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy
anthracin dione, mitoxantrone, mithramycin, actinomycin D,
1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, and puromycin and analogs or homologs
thereof. Therapeutic agents include, but are not limited to,
antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating
agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents'
(e.g., vincristine and vinblastine).
[0248] The conjugates of the invention can be used for modifying a
given biological response, the therapeutic agent or drug moiety is
not to be construed as limited to classical chemical therapeutic
agents. For example, the drug moiety may be a protein or
polypeptide possessing a desired biological activity. Such proteins
may include, for example, a toxin such as abrin, ricin A,
pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor
necrosis factor, a-interferon, a-interferon, nerve growth factor,
platelet derived growth factor, tissue plasminogen activator, an
apoptotic agent, e.g., TNF-alpha, TNF-beta, AIM I (See,
International Publication No. WO 97/33899), AIM II (See,
International Publication No. WO 97/34911), Fas Ligand (Takahashi
et al., Int. Immunol., 6:1567-1574 (1994)), VEGI (See,
International Publication No. WO 99/23105), a thrombotic agent or
an anti-angiogenic agent, e.g., angiostatin or endostatin; or,
biological response modifiers such as, for example, lymphokines,
interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6
("IL-6"), granulocyte macrophage colony stimulating factor
("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or
other growth factors.
[0249] Antibodies may also be attached to solid supports, which are
particularly useful for immunoassays or purification of the target
antigen. Such solid supports include, but are not limited to,
glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl
chloride or polypropylene.
[0250] Techniques for conjugating such therapeutic moiety to
antibodies are well known, see, e.g., Arnon et al., "Monoclonal
Antibodies For hnmunotargeting Of Drugs In Cancer Therapy", in
Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.),
pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies
For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson
et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe,
"Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al. (eds.), pp. 475-506 (1985);
"Analysis, Results, And Future Prospective Of The Therapeutic Use
Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal
Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.),
pp. 303-16 (Academic Press 1985), and Thorpe et al., "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev. 62:119-58 (1982).
[0251] Alternatively, an antibody can be conjugated to a second
antibody to form an antibody hetero conjugate as described by Segal
in U.S. Pat. No. 4,676,980, which is incorporated herein by
reference in its entirety.
[0252] An antibody, with or without a therapeutic moiety conjugated
to it, administered alone or in combination with cytotoxic
factor(s) and/or cytokine(s) can be used as a therapeutic.
[0253] The antibodies of the invention may be utilized for
immunophenotyping of cell lines and biological samples. The
translation product of the gene of the present invention may be
useful as a cell specific marker, or more specifically as a
cellular marker that is differentially expressed at various stages
of differentiation and/or maturation of particular cell types.
Monoclonal antibodies directed against a specific epitope, or
combination of epitopes, will allow for the screening of cellular
populations expressing the marker. Various techniques can be
utilized using monoclonal antibodies to screen for cellular
populations expressing the marker(s), and include magnetic
separation using antibody-coated magnetic beads, "panning" with
antibody attached to a solid matrix (i.e., plate), and flow
cytometry (See, e.g., U.S. Pat. No. 5,985,660; and Morrison et al.,
Cell, 96:737-49 (1999)).
[0254] These techniques allow for the screening of particular
populations of cells, such as might be found with hematological
malignancies (i.e. minimal residual disease (MRD) in acute leukemic
patients) and "non-self" cells in transplantations to prevent
Graft-versus-Host Disease (GVHD). Alternatively, these techniques
allow for the screening of hematopoietic stem and progenitor cells
capable of undergoing proliferation and/or differentiation, as
might be found in human umbilical cord blood.
[0255] The antibodies of the invention may be assayed for
immunospecific binding by any method known in the art. The
immunoassays which can be used include but are not limited to
competitive and non-competitive assay systems using techniques such
as westemblots, radioirurnunoassays, ELISA (enzyme linked
iminunosorbent assay), "sandwich" immunoassays, immunoprecipitation
assays, precipitin reactions, gel diffusion precipitin reactions,
immunodiffusion assays, agglutination assays, complement-fixation
assays, iminunoradiometric assays, fluorescent inmunoassays,
protein A immunoassays, to name but a few. Such assays are routine
and well known in the art (see, e.g., Ausubel et al, eds, 1994,
Current Protocols in Molecular Biology, Vol. 1, John Wiley &
Sons, Inc., New York, which is incorporated by reference herein in
its entirety). Exemplary immunoassays are described briefly herein
(but are not intended by way of limitation).
[0256] Immunoprecipitation protocols generally comprise lysing a
population of cells in a lysis buffer such as RIPA buffer (1% NP-40
or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl,
0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with
protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF,
aprotinin, sodium vanadate), adding the antibody of interest to the
cell lysate, incubating for a period of time (e.g., 1-4 hours) at
4o C, adding protein A and/or protein G sepharose beads to the cell
lysate, incubating for about an hour or more at 4o C, washing the
beads in lysis buffer and resuspending the beads in SDS/sample
buffer. The ability of the antibody of interest to
mimunoprecipitate a particular antigen can be assessed by, e.g.,
western blot analysis. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase
the binding of the antibody to an antigen and decrease the
background (e.g., pre-clearing the cell lysate with sepharose
beads). For further discussion regarding immunoprecipitation
protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at
10.16.1.
[0257] Western blot analysis generally comprises preparing protein
samples, electrophoresis of the protein samples in a polyacrylamide
gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the
antigen), transferring the protein sample from the polyacrylamide
gel to a membrane such as nitrocellulose, PVDF or nylon, blocking
the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat
milk), washing the membrane in washing buffer (e.g., PBS-Tween 20),
blocking the membrane with primary antibody (the antibody of
interest) diluted in blocking buffer, washing the membrane in
washing buffer, blocking the membrane with a secondary antibody
(which recognizes the primary antibody, e.g., an anti-human
antibody) conjugated to an enzymatic substrate (e.g., horseradish
peroxidase or alkaline phosphatase) or radioactive molecule (e.g.,
32P or 125I) diluted in blocking buffer, washing the membrane in
wash buffer, and detecting the presence of the antigen. One of
skill in the art would be knowledgeable as to the parameters that
can be modified to increase the signal detected and to reduce the
background noise. For further discussion regarding western blot
protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at
10.8.1.
[0258] ELISAs comprise preparing antigen, coating the well of a 96
well microtiter plate with the antigen, adding the antibody of
interest conjugated to a detectable compound such as an enzymatic
substrate (e.g., horseradish peroxidase or alkaline phosphatase) to
the well and incubating for a period of time, and detecting the
presence of the antigen. In ELISAs the antibody of interest does
not have to be conjugated to a detectable compound; instead, a
second antibody (which recognizes the antibody of interest)
conjugated to a detectable compound may be added to the well.
Further, instead of coating the well with the antigen, the antibody
may be coated to the well. In this case, a second antibody
conjugated to a detectable compound may be added following the
addition of the antigen of interest to the coated well. One of
skill in the art would be knowledgeable as to the parameters that
can be modified to increase the signal detected as well as other
variations of ELISAs known in the art. For further discussion
regarding ELISAs see, e.g., Ausubel et al, eds, 1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons,
Inc., New York at 11.2.1.
[0259] The binding affinity of an antibody to an antigen and the
off-rate of an antibody-antigen interaction can be determined by
competitive binding assays. One example of a competitive binding
assay is a radioimmunoassay comprising the incubation of labeled
antigen (e.g., 3H or 125I) with the antibody of interest in the
presence of increasing amounts of unlabeled antigen, and the
detection of the antibody bound to the labeled antigen. The
affinity of the antibody of interest for a particular antigen and
the binding off-rates can be determined from the data by scatchard
plot analysis. Competition with a second antibody can also be
determined using radioinrnunoassays. In this case, the antigen is
incubated with antibody of interest conjugated to a labeled
compound (e.g., 3H or 125I) in the presence of increasing amounts
of an unlabeled second antibody.
[0260] The present invention is further directed to antibody-based
therapies which involve administering antibodies of the invention
to an animal, preferably a mammal, and most preferably a human,
patient for treating one or more of the disclosed diseases,
disorders, or conditions. Therapeutic compounds of the invention
include, but are not limited to, antibodies of the invention
(including fragments, analogs and derivatives thereof as described
herein) and nucleic acids encoding antibodies of the invention
(including fragments, analogs and derivatives thereof and
anti-idiotypic antibodies as described herein). The antibodies of
the invention can be used to treat, inhibit or prevent diseases,
disorders or conditions associated with aberrant expression and/or
activity of a polypeptide of the invention, including, but not
limited to, any one or more of the diseases, disorders, or
conditions described herein. The treatment and/or prevention of
diseases, disorders, or conditions associated with aberrant
expression and/or activity of a polypeptide of the invention
includes, but is not limited to, alleviating symptoms associated
with those diseases, disorders or conditions. Antibodies of the
invention may be provided in pharmaceutically acceptable
compositions as known in the art or as described herein.
[0261] A summary of the ways in which the antibodies of the present
invention may be used therapeutically includes binding
polynucleotides or polypeptides of the present invention locally or
systemically in the body or by direct cytotoxicity of the antibody,
e.g. as mediated by complement (CDC) or by effector cells (ADCC).
Some of these approaches are described in more detail herein. Armed
with the teachings provided herein, one of ordinary skill in the
art will know how to use the antibodies of the present invention
for diagnostic, monitoring or therapeutic purposes without undue
experimentation.
[0262] The antibodies of this invention may be advantageously
utilized in combination with other monoclonal or chimeric
antibodies, or with lymphokines or hematopoietic growth factors
(such as, e.g., IL-2, IL-3 and IL-7), for example, which serve to
increase the number or activity of effector cells which interact
with the antibodies.
[0263] The antibodies of the invention maybe administered alone or
in combination with other types of treatments (e.g., radiation
therapy, chemotherapy, hormonal therapy, immunotherapy and
anti-tumor agents). Generally, administration of products of a
species origin or species reactivity (in the case of antibodies)
that is the same species as that of the patient is preferred. Thus,
in a preferred embodiment, human antibodies, fragments derivatives,
analogs, or nucleic acids, are administered to a human patient for
therapy or prophylaxis.
[0264] It is preferred to use high affinity and/or potent in vivo
inhibiting and/or neutralizing antibodies against polypeptides or
polynucleotides of the present invention, fragments or regions
thereof, for both immunoassays directed to and therapy of disorders
related to polynucleotides or polypeptides, including fragments
thereof, of the present invention. Such antibodies, fragments, or
regions, will preferably have an affinity for polynucleotides or
polypeptides of the invention, including fragments thereof.
Preferred binding affinities include those with a dissociation
constant or K.sub.d less than 5.times.10.sup.-2 M, 10.sup.-2M,
5.times.10.sup.-3 M, 10.sup.-3 M, 5.times.10.sup.-4 M, 10.sup.-4 M,
5.times.10.sup.-5 M, 10.sup.-5 M, 5.times.10.sup.-6 M, 10.sup.-6 M,
5.times.10.sup.31 7 M, 10.sup.-7M, 5.times.10.sup.-8M, 10.sup.-8 M,
5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10M, 10.sup.-10
M, 5.times.10.sup.-11 M, 10.sup.-11 M, 5.times.10.sup.-12 M,
10.sup.-12 M, 5.times.10.sup.-13M, 10.sup.-13 M, 5.times.10.sup.-14
M, 10.sup.-14 M, 5.times.10.sup.-15 M, or 10.sup.-15 M.
[0265] In a specific embodiment, nucleic acids comprising sequences
encoding antibodies or functional derivatives thereof, are
administered to treat, inhibit or prevent a disease or disorder
associated with aberrant expression and/or activity of a
polypeptide of the invention, by way of gene therapy. Gene therapy
refers to therapy performed by the administration to a subject of
an expressed or expressible nucleic acid. In this embodiment of the
invention, the nucleic acids produce their encoded protein that
mediates a therapeutic effect.
Gene Therapy
[0266] Any of the methods for gene therapy available in the art can
be used according to the present invention. Exemplary methods are
described below.
[0267] For general reviews of the methods of gene therapy, see
Goldspiel et al., Clinical Pharmacy 12:488-505 (1993); Wu and Wu,
Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol.
Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993);
and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May,
TIBTECH 11 (5):155-215 (1993). Methods commonly known in the art of
recombinant DNA technology which can be used are described in
Ausubel et al. (eds.), Current Protocols in Molecular Biology, John
Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and
Expression, A Laboratory Manual, Stockton Press, NY (1990).
[0268] In a preferred aspect, the compound comprises nucleic acid
sequences encoding a T1R-like ligand II polypeptide, antibody,
antagonist, agonist, or fragment or variant thereof, said nucleic
acid sequences being part of expression vectors that express the
T1R-like ligand II polypeptide, a polypeptide fragment, antibody,
antagonist, agonist, or variant thereof in a suitable host. In
particular, such nucleic acid sequences have promoters operably
linked to the coding region, said promoter being inducible or
constitutive, and, optionally, tissue-specific. In another
particular embodiment, nucleic acid molecules are used in which the
coding sequences and any other desired sequences are flanked by
regions that promote homologous recombination at a desired site in
the genome, thus providing for intrachromosomal expression of the
encoding nucleic acids (Koller and Smithies, Proc. Natl. Acad. Sci.
USA 86:8932-8935 (1989); Zijlstra et al., Nature 342:435-438
(1989). In specific embodiments, the expressed antibody molecule is
a single chain antibody; alternatively, the nucleic acid sequences
include sequences encoding both the heavy and light chains, or
fragments thereof, of the antibody. As mentioned previously,
polypeptides, polypeptide fragments, antagonists, agonists, and
variants thereof may also be expressed.
[0269] Delivery of the nucleic acids into a patient may be either
direct, in which case the patient is directly exposed to the
nucleic acid or nucleic acid-carrying vectors, or indirect, in
which case, cells are first transformed with the nucleic acids in
vitro, then transplanted into the patient. These two approaches are
known, respectively, as in vivo or ex vivo gene therapy.
[0270] In a specific embodiment, the nucleic acid sequences are
directly administered in vivo, where it is expressed to produce the
encoded product. This can be accomplished by any of numerous
methods known in the art, e.g., by constructing them as part of an
appropriate nucleic acid expression vector and administering it so
that they become intracellular, e.g., by infection using defective
or attenuated retrovirals or other viral vectors (see U.S. Pat. No.
4,980,286), or by direct injection of naked DNA, or by use of
microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or
coating with lipids or cell-surface receptors or transfecting
agents, encapsulation in liposomes, microparticles, or
microcapsules, or by administering them in linkage to a peptide
which is known to enter the nucleus, by administering it in linkage
to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu
and Wu, J. Biol. Chem. 262:4429-4432 (1987)) (which can be used to
target cell types specifically expressing the receptors), etc.
[0271] In another embodiment, nucleic acid-ligand complexes can be
formed in which the ligand comprises a fasogenic viral peptide to
disrupt endosomes, allowing the nucleic acid to avoid lysosomal
degradation. In yet another embodiment, the nucleic acid can be
targeted in vivo for cell specific uptake and expression, by
targeting a specific receptor (see, e.g., PCT Publications WO
92/06180; WO 92/22635; WO92/20316; WO93/14188, WO 93/20221).
Alternatively, the nucleic acid can be introduced intracellularly
and incorporated within host cell DNA for expression, by homologous
recombination (Koller and Smithies, Proc. Natl. Acad. Sci. USA
86:8932-8935 (1989); Zijlstra et al., Nature 342:435-438
(1989)).
[0272] In a specific embodiment, viral vectors that contains
nucleic acid sequences encoding a polypeptide of the invention are
used. For example, a retroviral vector can be used (see Miller et
al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors
contain the components necessary for the correct packaging of the
viral genome and integration into the host cell DNA. The nucleic
acid sequences encoding the polypeptide to be used in gene therapy
are cloned into one or more vectors, which facilitates delivery of
the gene into a patient. More detail about retroviral vectors can
be found in Boesen et al., Biotherapy 6:291-302 (1994), which
describes the use of a retroviral vector to deliver the mdr 1 gene
to hematopoietic stem cells in order to make the stem cells more
resistant to chemotherapy. Other references illustrating the use of
retroviral vectors in gene therapy are: Clowes et al., J. Clin.
Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994);
Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and
Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114
(1993).
[0273] Adenoviruses are other viral vectors that can be used in
gene therapy. Adenoviruses are especially attractive vehicles for
delivering genes to respiratory epithelia. Adenoviruses naturally
infect respiratory epithelia where they cause a mild disease. Other
targets for adenovimas-based delivery systems are liver, the
central nervous system, endothelial cells, and muscle. Adenoviruses
have the advantage of being capable of infecting non-dividing
cells. Kozarsky and Wilson, Current Opinion in Genetics and
Development 3:499-503 (1993) present a review of adenovirus-based
gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994)
demonstrated the use of adenovirus vectors to transfer genes to the
respiratory epithelia of rhesus monkeys. Other instances of the use
of adenoviruses in gene therapy can be found in Rosenfeld et al.,
Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155
(1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT
Publication WO94/12649; and Wang, et al., Gene Therapy 2:775-783
(1995). In a preferred embodiment, adenovirus vectors are used.
[0274] Adeno-associated virus (AAV) has also been proposed for use
in gene therapy (Walsh et al., Proc. Soc. Exp. Biol. Med.
204:289-300 (1993); U.S. Pat. No. 5,436,146).
[0275] Another approach to gene therapy involves transferring a
gene to cells in tissue culture by such methods as electroporation,
lipofection, calcium phosphate mediated transfection, or viral
infection. Usually, the method of transfer includes the transfer of
a selectable marker to the cells. The cells are then placed under
selection to isolate those cells that have taken up and are
expressing the transferred gene. Those cells are then delivered to
a patient.
[0276] In this embodiment, the nucleic acid is introduced into a
cell prior to administration in vivo of the resulting recombinant
cell. Such introduction can be carried out by any method known in
the art, including but not limited to transfection,
electroporation, microinjection, infection with a viral or
bacteriophage vector containing the nucleic acid sequences, cell
fusion, chromosome-mediated gene transfer, microcell-mediated gene
transfer, spheroplast fusion, etc. Numerous techniques are known in
the art for the introduction of foreign genes into cells (see,
e.g., Loeffler and Behr, Meth. Enzymol. 217:599-618 (1993); Cohen
et al., Meth. Enzymol. 217:618-644 (1993); Cline, Pharmac. Ther.
29:69-92m (1985) and may be used in accordance with the present
invention, provided that the necessary developmental and
physiological functions of the recipient cells are not disrupted.
The technique should provide for the stable transfer of the nucleic
acid to the cell, so that the nucleic acid is expressible by the
cell and preferably heritable and expressible by its cell
progeny.
[0277] The resulting recombinant cells can be delivered to a
patient by various methods known in the art. Recombinant blood
cells (e.g., hematopoietic stem or progenitor cells) are preferably
administered intravenously. The amount of cells envisioned for use
depends on the desired effect, patient state, etc., and can be
determined by one skilled in the art.
[0278] Cells into which a nucleic acid can be introduced for
purposes of gene therapy encompass any desired, available cell
type, and include but are not limited to epithelial cells,
endothelial cells, keratinocytes, fibroblasts, muscle cells,
hepatocytes; blood cells such as T lymphocytes, B lymphocytes,
monocytes, macrophages, neutrophils, eosinophils, megakaryocytes,
granulocytes; various stem or progenitor cells, in particular
hematopoietic stem or progenitor cells, e.g., as obtained from bone
marrow, umbilical cordblood, peripheralblood, fetal liver, etc.
Particularly preferred are CD34+ cells.
[0279] In a preferred embodiment, the cell used for gene therapy is
autologous to the patient.
[0280] In an embodiment in which recombinant cells are used in gene
therapy, nucleic acid sequences are introduced into the cells such
that they are expressible by the cells or their progeny, and the
recombinant cells are then administered in vivo for therapeutic
effect. In a specific embodiment, stem or progenitor cells are
used. Any stem and/or progenitor cells which can be isolated and
maintained in vitro can potentially be used in accordance with this
embodiment of the present invention (see e.g. PCT Publication WO
94/08598; Stemple and Anderson, Cell 71:973-985 (1992); Rheinwald,
Meth. Cell Bio. 21A:229 (1980); and Pittelkow and Scott, Mayo
Clinic Proc. 61:771 (1986)). Particularly preferred are CD 34+
cells.
[0281] In a specific embodiment, the nucleic acid to be introduced
for purposes of gene therapy comprises an inducible promoter
operably linked to the coding region, such that expression of the
nucleic acid is controllable by controlling the presence or absence
of the appropriate inducer of transcription.
Antisense and Ribozyme Antagonists
[0282] In specific embodiments, antagonists according to the
present invention are nucleic acids corresponding to the sequences
contained in T1R-like ligand II, or the complementary strand
thereof, and/or to nucleotide sequences contained in the deposited
plasmid ATCC.TM. Deposit No. 97655. In one embodiment, antisense
sequence is generated internally by the organism, in another
embodiment, the antisense sequence is separately administered (see,
for example, O'Connor, J., Neurochem. 56:560 (1991), and
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988). Antisense technology can be
used to control gene expression through antisense DNA or RNA, or
through triple-helix formation. Antisense techniques are discussed
for example, in Okano, J., Neurochem. 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988). Triple helix formation is
discussed in, for instance, Lee et al., Nucleic Acids Research
6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et
al., Science 251:1300 (1991). The methods are based on binding of a
polynucleotide to a complementary DNA or RNA.
[0283] For example, the 5' coding portion of a polynucleotide that
encodes the mature polypeptide of the present invention may be used
to design an antisense RNA oligonucleotide of from about 10 to 40
base pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in transcription
thereby preventing transcription and the production of the
receptor. The antisense RNA oligonucleotide hybridizes to the mRNA
in vivo and blocks translation of the mRNA molecule into receptor
polypeptide.
[0284] In one embodiment, the T1R-like ligand II antisense nucleic
acid of the invention is produced intracellularly by transcription
from an exogenous sequence. For example, a vector or a portion
thereof, is transcribed, producing an antisense nucleic acid (RNA)
of the invention. Such a vector would contain a sequence encoding
the T1R-like ligand II antisense nucleic acid. Such a vector can
remain episomal or become chromosomally integrated, as long as it
can be transcribed to produce the desired antisense RNA. Such
vectors can be constructed by recombinant DNA technology methods
standard in the art. Vectors can be plasmid, viral, or others Imow
in the art, used for replication and expression in vertebrate
cells. Expression of the sequence encoding T1R-like ligand II, or
fragments thereof, can be by any promoter known in the art to act
in vertebrate, preferably human cells. Such promoters can be
inducible or constitutive. Such promoters include, but are not
limited to, the SV40 early promoter region (Bemoist and Chambon,
Nature 29:304-310 (1981), the promoter contained in the 3' long
terminal repeat of Rous sarcoma virus (Yamamoto et al., Cell
22:787-797 (1980), the herpes thymidine promoter (Wagner et al.,
Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445 (1981), the regulatory
sequences of the metallothionein gene (Brinster, et al., Nature
296:39-42 (1982)), etc.
[0285] The antisense nucleic acids of the invention comprise a
sequence complementary to at least a portion of an RNA transcript
of a T1R-like ligand II gene. However, absolute complementary,
although preferred, is not required. A sequence "complementary to
at least a portion of an RNA," referred to herein, means a sequence
having sufficient complementary to be able to hybridize with the
RNA, forming a stable duplex; in the case of double stranded
T1R-like ligand II antisense nucleic acids, a single strand of the
duplex DNA may thus be tested, or triplex formation may be assayed.
The ability to hybridize will depend on both the degree of
complementary and the length of the antisense nucleic acid
Generally, the larger the hybridizing nucleic acid, the more base
mismatches with a T1R-like ligand II RNA it may contain and still
form a stable duplex (or triplex as the case may be). One skilled
in the art can ascertain a tolerable degree of mismatch by use of
standard procedures to determine the melting point of the
hybridized complex.
[0286] Oligonucleotides that are complementary to the 5' end of the
message, e.g., the 5' untranslated sequence up to and including the
AUG initiation codon, should work most efficiently at inhibiting
translation. However, sequences complementary to the 3'
untranslated sequences of mRNAs have been shown to be effective at
inhibiting translation of mRNAs as well. See generally, Wagner, R.,
1994, Nature 372:333-335. Thus, oligonucleotides complementary to
either the 5'- or 3' -non-translated, non-coding regions of the
T1R-like ligand II shown in FIGS. 1A-B could be used in an
antisense approach to inhibit translation of endogenous T1R-like
ligand II mRNA. Oligonucleotides complementary to the 5'
untranslated region of the mRNA should include the complement of
the AUG start codon. Antisense oligonucleotides complementary to
mRNA coding regions are less efficient inhibitors of translation
but could be used in accordance with the invention. Whether
designed to hybridize to the 5'-, 3'- or coding region of T1R-like
ligand II mRNA, antisense nucleic acids should be at least six
nucleotides in length, and are preferably oligonucleotides ranging
from 6 to about 50 nucleotides in length. In specific aspects the
oligonucleotide is at least 10 nucleotides, at least 17
nucleotides, at least 25 nucleotides or at least 50
nucleotides.
[0287] The polynucleotides of the invention can be DNA or RNA or
chimeric mixtures or derivatives or modified versions thereof,
single-stranded or double-stranded. The oligonucleotide can be
modified at the base moiety, sugar moiety, or phosphate backbone,
for example, to improve stability of the molecule, hybridization,
etc. The oligonucleotide may include other appended groups such as
peptides (e.g., for targeting host cell receptors in vivo), or
agents facilitating transport across the cell membrane (see, e.g.,
Letsinger et al., Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556
(1989); Lemaitre et al., Proc. Natl. Acad. Sci. 84:648-652 (1987);
PCT Publication No. WO88/09810) or the blood-brain barrier (see,
e.g., PCT Publication No. WO89/10134), hybridization-triggered
cleavage agents. (See, e.g., Krol et al., BioTechniques 6:958-976
(1988)) or intercalating agents. (See, e.g., Zon, Pharm. Res.
5:539-549 (1988)). To this end, the oligonucleotide may be
conjugated to another molecule, e.g., a peptide, hybridization
triggered cross-linking agent, transport agent,
hybridization-triggered cleavage agent, etc.
[0288] The antisense oligonucleotide may comprise at least one
modified base moiety which is selected from the group including,
but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xantine 4-acetylcytosine,
5-(carboxyhydroxylmethyl)uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine.
[0289] The antisense oligonucleotide may also comprise at least one
modified sugar moiety selected from the group including, but not
limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
[0290] In yet another embodiment, the antisense oligonucleotide
comprises at least one modifiedphosphate backbone selected from the
group including, but not limited to, a phosphorothioate, a
phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a
phosphordiamidate, a methylphosphonate, an alkyl phosphotriester,
and a formacetal or analog thereof.
[0291] In yet another embodiment, the antisense oligonucleotide is
an .alpha.-anomeric oligonucleotide. An .alpha.-anomeric
oligonucleotide forms specific double-stranded hybrids with
complementary RNA in which, contrary to the usual .beta.-units, the
strands run parallel to each other (Gautier et al., Nucl. Acids
Res. 15:6625-6641 (1987)). The oligonucleotide is a
2'-0-methylribonucleotide (Inoue et al., Nucl. Acids Res.
15:6131-6148 (1987)), or a chimeric RNA-DNA analogue (Inoue et al.,
FEBS Lett. 215:327-330 (1987)).
[0292] Polynucleotides of the invention may be synthesized by
standard methods known in the art, e.g. by use of an automated DNA
synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides may be synthesized by the method of Stein et al.
(Nucl. Acids Res. 16:3209 (1988)), methylphosphonate
oligonucleotides can be prepared by use of controlled pore glass
polymer supports (Sarin et al., Proc. Natl. Acad. Sci. U.S.A.
85:7448-7451 (1988)), etc.
[0293] While antisense nucleotides complementary to the T1R-like
ligand II coding region sequence could be used, those complementary
to the transcribed untranslated region are most preferred.
[0294] Potential antagonists according to the invention also
include catalytic RNA, or a ribozyme (See, e.g., PCT International
Publication WO 90/11364; Sarver et al, Science 247:1222-1225
(1990). While ribozymes that cleave mRNA at site specific
recognition sequences can be used to destroy T1R-like ligand II
mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead
ribozymes cleave mRNAs at locations dictated by flanking regions
that form complementary base pairs with the target mRNA. The sole
requirement is that the target mRNA have the following sequence of
two bases: 5'-UG-3'. The construction and production of hammerhead
ribozymes is well known in the art and is described more fully in
Haseloff and Gerlach, Nature 334:585-591 (1988). There are numerous
potential hammerhead ribozyme cleavage sites within the nucleotide
sequence of T1R-like ligand II (FIGS. 1A-B (SEQ ID NO: 1)).
Preferably, the ribozyme is engineered so that the cleavage
recognition site is located near the 5' end of the T1R-like ligand
II mRNA; i.e., to increase efficiency and minimize the
intracellular accumulation of non-functional mRNA transcripts.
[0295] As in the antisense approach, the ribozymes of the invention
can be composed of modified oligonucleotides (e.g. for improved
stability, targeting, etc.) and should be delivered to cells which
express T1R-like ligand II in vivo. DNA constructs encoding the
ribozyme may be introduced into the cell in the same manner as
described above for the introduction of antisense encoding DNA. A
preferred method of delivery involves using a DNA construct
"encoding" the ribozyme under the control of a strong constitutive
promoter, such as, for example, pol III or pol II promoter, so that
transfected cells will produce sufficient quantities of the
ribozyme to destroy endogenous T1R-like ligand II messages and
inhibit translation. Since ribozymes unlike antisense molecules,
are catalytic, a lower intracellular concentration is required for
efficiency.
[0296] Endogenous gene expression can also be reduced by
inactivating or "knocking out" the T1R-like ligand II gene and/or
its promoter using targeted homologous recombination. (E.g., see
Smithies et al., Nature 317:230-234 (1985); Thomas & Capecchi,
Cell 51:503-512 (1987); Thompson et al., Cell 5:313-321 (1989);
each of which is incorporated by reference herein in its entirety).
For example, a mutant, non-functional polynucleotide of the
invention (or a completely unrelated DNA sequence) flanked by DNA
homologous to the endogenous polynucleotide sequence (either the
coding regions or regulatory regions of the gene) can be used, with
or without a selectable marker and/or a negative selectable marker,
to transfect cells that express polypeptides of the invention in
vivo. In another embodiment, techniques known in the art are used
to generate knockouts in cells that contain, but do not express the
gene of interest. Insertion of the DNA construct, via targeted
homologous recombination, results in inactivation of the targeted
gene. Such approaches are particularly suited in research and
agricultural fields where modifications to embryonic stem cells can
be used to generate animal offspring with an inactive targeted gene
(e.g., see Thomas & Capecchi 1987 and Thompson 1989, supra).
However this approach can be routinely adapted for use in humans
provided the recombinant DNA constructs are directly administered
or targeted to the required site in vivo using appropriate viral
vectors that will be apparent to those of skill in the art. The
contents of each of the documents recited in this paragraph is
herein incorporated by reference in its entirety.
[0297] In other embodiments, antagonists according to the present
invention include soluble forms of T1R-like ligand II (e.g.,
fragments of the T1R-like ligand II shown in FIG. 2 (SEQ ID NO: 2)
that include the ligand binding domain from the extracellular
region of the full length receptor). Such soluble forms of the
T1R-like ligand II, which may be naturally occurring or synthetic,
antagonize T1R-like ligand II mediated signaling by competing with
the cell surface bound forms of the receptor for binding to
T1R-like ligand II ligands. Antagonists of the present invention
also include T1R-like ligand II Fc fusion proteins.
[0298] Antibodies according to the present invention may be
prepared by any of a variety of standard methods using T1R-like
ligand II receptor irounogens of the present invention. Such
T1R-like ligand II receptor irrunogens include the T1R-like ligand
II protein shown in FIGS. 1A-B (SEQ ID NO:2) (which may or may not
include a leader sequence) and polypeptide fragments of the
receptor comprising the ligand binding, extracellular,
transmembrane, the intracellular domains of T1R-like ligand II, or
any combination thereof.
[0299] Polyclonal and monoclonal antibody agonists or antagonists
according to the present invention can be raised according to the
methods disclosed herein and and/or known in the art, such as, for
example, those methods described in Tartaglia and Goeddel, J. Biol.
Chem. 267 (7):4304-4307 (1992)); Tartaglia et al., Cell 73:213-216
(1993)), and PCT Application WO 94/09137 (the contents of each of
these three applications are herein incorporated by reference in
their entireties), and are preferably specific to polypeptides of
the invention having the amino acid sequence of SEQ ID NO:2.
T1R-like Ligand II Related Disorder Diagnosis
[0300] For T1R-like ligand II related disorders, it is believed
that substantially altered (increased or decreased) levels of
T1R-like ligand II gene expression can be detected in tissue or
other cells or bodily fluids (e.g., sera, plasma, urine, synovial
fluid or spinal fluid) taken from an individual having such a
disorder, relative to a "standard" T1R-like ligand II gene
expression level, that is, the T1R-like ligand II gene expression
level in tissue or bodily fluids from an individual not having the
disorder. Thus, the invention provides a diagnostic method useful
during diagnosis of an T1R-like ligand II-related disorder, which
involves measuring the expression level of the gene encoding the
T1R-like ligand II in tissue or other cells or body fluid from an
individual and comparing the measured gene expression level with a
standard T1R-like ligand II gene expression level, whereby an
increase or decrease in the gene expression level compared to the
standard is indicative of an T1R-like ligand II related
disorder.
[0301] T1R-like ligand II-related disorders are believed to
include, but are not limited to, leukemia, lymphoma,
arteriosclerosis, autoimmune diseases, inflammatory diseases,
Alzheimer's disease, ophthalmic diseases, apoptosis, intrauterine
growth retardation, preeclampsia, pemphigus and psoriasis.
[0302] By individual is intended mammalian individuals, preferably
humans. By "measuring the expression level of the gene encoding the
T1R-like ligand II" is intended qualitatively or quantitatively
measuring or estimating the level of the T1R-like ligand II protein
or the level of the mRNA encoding the T1R-like ligand II protein in
a first biological sample either directly (e.g., by determining or
estimating absolute protein level or mRNA level) or relatively
(e.g., by comparing to the T1R-like ligand II protein level or mRNA
level in a secondbiological sample). Preferably, the T1R-like
ligand II protein level or mRNA level in the first biological
sample is measured or estimated and compared to a standard T1R-like
ligand II protein level or mRNA level, the standard being taken
from a second biological sample obtained from an individual not
having the disorder or being determined by averaging levels from a
population of individuals not having the disorder. As will be
appreciated in the art, once a standard T1R-like ligand II protein
level or mRNA level is known, it can be used repeatedly as a
standard for comparison.
[0303] By "biological sample" is intended any biological sample
obtained from an individual, body fluid, cell line, tissue culture,
or other source which contains T1R-like ligand II protein or mRNA.
As indicated, biological samples include body fluids (such as sera,
plasma, urine, synovial fluid and spinal fluid) which contain
secreted mature T1R-like ligand II, or tissue sources found to
express T1R-like ligand II protein. Methods for obtaining tissue
biopsies and body fluids from mammals are well known in the art.
Where the biological sample is to include mRNA, a tissue biopsy is
the preferred source.
[0304] Total cellular RNA can be isolated from a biological sample
using any suitable technique such as the single-step
guanidinium-thiocyanate-phenol-chloroforn method described in
Chomczynski and Sacchi, Anal. Biochem. 162:156-159 (1987). Levels
of mRNA encoding an T1R-like ligand II are then assayed using any
appropriate method. These include Northern blot analysis, S1
nuclease mapping, the polymerase chain reaction (PCR), reverse
transcription in combination with the polymerase chain reaction
(RT-PCR), and reverse transcription in combination with the ligase
chain reaction (RT-LCR).
[0305] Northern blot analysis can be performed as described in
Harada et al., Cell 63:303-312 (1990). Briefly, total RNA is
prepared from a biological sample as described above. For the
Northern blot, the RNA is denatured in an appropriate buffer (such
as glyoxal/dimethyl sulfoxide/sodium phosphate buffer), subjected
to agarose gel electrophoresis, and transferred onto a
nitrocellulose filter. After the RNAs have been linked to the
filter by a UV linker, the filter is prehybridized in a solution
containing formamide, SSC, Denhardt's solution, denatured salmon
sperm, SDS, and sodium phosphate buffer. T1R-like ligand II cDNA
labeled according to any appropriate method (such as the
.sup.32P-multiprimed DNA labeling system (Amersham)) is used as
probe. After hybridization overnight, the filter is washed and
exposed to x-ray film. cDNA for use as probe according to the
present invention is described in the sections above and will
preferably at least 15 bp in length.
[0306] S1 mapping can be performed as described in Fujita et al.,
Cell 49:357-367 (1987). To prepare probe DNA for use in S1 mapping,
the sense strand of above-described cDNA is used as a template to
synthesize labeled antisense DNA. The antisense DNA can then be
digested using an appropriate restriction endonuclease to generate
further DNA probes of a desired length. Such antisense probes are
useful for visualizing protected bands corresponding to the target
mRNA (i.e., mRNA encoding the T1R-like ligand II). Northern blot
analysis can be performed as described above.
[0307] Preferably, levels of mRNA encoding the T1R-like ligand II
are assayed using the RT-PCR method described in Makino et al.,
Technique 2:295-301 (1990). By this method, the radioactivities of
the "amplicons" in the polyacrylamide gel bands are linearly
related to the initial concentration of the target mRNA. Briefly,
this method involves adding total RNA isolated from a biological
sample in a reaction mixture containing a RT primer and appropriate
buffer. After incubating for primer annealing, the mixture can be
supplemented with a RT buffer, dNTPs, DTT, RNase inhibitor and
reverse transcriptase. After incubation to achieve reverse
transcription of the RNA, the RT products are then subject to PCR
using labeled primers. Alternatively, rather than labeling the
primers, a labeled dNTP can be included in the PCR reaction
mixture. PCR amplification can be performed in a DNA thermal cycler
according to conventional techniques. After a suitable number of
rounds to achieve amplification, the PCR reaction mixture is
electrophoresed on a polyacrylamide gel. After drying the gel, the
radioactivity of the appropriate bands (corresponding to the mRNA
encoding the T1R-like ligand II) is quantified using an imaging
analyzer. RT and PCR reaction ingredients and conditions, reagent
and gel concentrations, and labeling methods are well known in the
art. Variations on the RT-PCR method will be apparent to the
skilled artisan.
[0308] Any set of oligonucleotide primers which will amplify
reverse transcribed target mRNA can be used and can be designed as
described in the sections above.
[0309] Assaying T1R-like ligand II levels in a biological sample
can occur using any art-known method. Preferred for assaying
T1R-like ligand II levels in a biological sample are antibody-based
techniques. For example, T1R-like ligand II expression in tissues
can be studied with classical immunohistological methods. In these,
the specific recognition is provided by the primary antibody
(polyclonal or monoclonal) but the secondary detection system can
utilize fluorescent, enzyme, or other conjugated secondary
antibodies. As a result, an immunohistological staining of tissue
section for pathological examination is obtained. Tissues can also
be extracted, e.g., with urea and neutral detergent, for the
liberation of T1R-like ligand II for Western-blot or dot/slot assay
(Jalkanen, M., et al., J. Cell. Biol. 101:976-985 (1985); Jalkanen,
M., et al., J. Cell. Biol. 105:3087-3096 (1987)).
[0310] In this technique, which is based on the use of cationic
solid phases, quantitation of T1R-like ligand II can be
accomplished using isolated T1R-like ligand II as a standard. This
technique can also be applied to body fluids. With these samples, a
molar concentration of T1R-like ligand II will aid to set standard
values of T1R-like ligand II content for differentbody fluids, like
serum, plasma, urine, synovial fluid, spinal fluid, etc. The normal
appearance of T1R-like ligand II amounts can then be set using
values from healthy individuals, which can be compared to those
obtained from a test subject.
[0311] Other antibody-based methods useful for detecting T1R-like
ligand II levels include immunoassays, such as the enzyme linked
immunosorbent assay (ELISA) and the radioimmunoassay (RIA). For
example, T1R-like ligand II-specific monoclonal antibodies can be
used both as an immunoadsorbent and as an enzyme-labeled probe to
detect and quantify the T1R-like ligand II. The amount of T1R-like
ligand II present in the sample can be calculated by reference to
the amount present in a standard preparation using a linear
regression computer algorithm. Such an ELISA for detecting a tumor
antigen is described in Iacobelli et al., Breast Cancer Research
and Treatment 11:19-30 (1988). In another ELISA assay, two distinct
specific monoclonal antibodies can be used to detect T1R-like
ligand II in a body fluid. In this assay, one of the antibodies is
used as the immunoadsorbent and the other as the enzyme-labeled
probe.
[0312] The above techniques maybe conducted essentially as a
"one-step" or "two-step" assay. The "one-step" assay involves
contacting T1R-like ligand II with immobilized antibody and,
without washing, contacting the mixture with the labeled antibody.
The "two-step" assay involves washing before contacting the mixture
with the labeled antibody. Other conventional methods may also be
employed as suitable. It is usually desirable to immobilize one
component of the assay system on a support, thereby allowing other
components of the system to be brought into contact with the
component and readily removed from the sample.
[0313] Suitable enzyme labels include, for example, those from the
oxidase group, which catalyze the production of hydrogen peroxide
by reacting with substrate. Glucose oxidase is particularly
preferred as it has good stability and its substrate (glucose) is
readily available. Activity of an oxidase label may be assayed by
measuring the concentration of hydrogen peroxide formed by the
enzyme-labeled antibody/substrate reaction. Besides enzymes, other
suitable labels include radioisotopes, such as iodine (.sup.125I,
.sup.121I), carbon (.sup.14C), sulfur (.sup.35S), tritium
(.sup.3H), indium (.sup.112In), and technetium (.sup.99mTc), and
fluorescent labels, such as fluorescein and rhodamine, and
biotin.
[0314] In addition to assaying T1R-like ligand II levels in a
biological sample obtained from an individual, T1R-like ligand II
can also be detected in vivo by imaging. Antibody labels or markers
for in vivo imaging of T1R-like ligand II include those detectable
by X-radiography, NMR or ESR. For X-radiography, suitable labels
include radioisotopes such as barium or cesium, which emit
detectable radiation but are not overtly harmful to the subject.
Suitable markers for NMR and ESR include those with a detectable
characteristic spin, such as deuterium, which may be incorporated
into the antibody by labeling of nutrients for the relevant
hybridoma.
[0315] A T1R-like ligand II-specific antibody or antibody fragment
which has been labeled with an appropriate detectable imaging
moiety, such as a radioisotope (for example, .sup.131I, .sup.112In,
.sup.99mTc), a radio-opaque substance, or a material detectable by
nuclear magnetic resonance, is introduced (for example,
parenterally, subcutaneously or intraperitoneally) into the mammal
to be examined for a disorder. It will be understood in the art
that the size of the subject and the imaging system used will
determine the quantity of imaging moieties needed to produce
diagnostic images. In the case of a radioisotope moiety, for a
human subject, the quantity of radioactivity injected will normally
range from about 5 to 20 millicuries of .sup.99mTc. The labeled
antibody or antibody fragment will then preferentially accumulate
at the location of cells which contain T1R-like ligand II. In vivo
tumor imaging is described in S. W. Burchiel et al.,
"Immunopharmacokinetics of Radiolabeled Antibodies and Their
Fragments" (Chapter 13 in Tumor Imaging: The Radiochemical
Detection of Cancer, Burchiel, S. W. and Rhodes, B. A. eds., Masson
Publishing Inc., (1982)).
[0316] T1R-like ligand II specific antibodies for use in the
present invention can be raised against the intact T1R-like ligand
II or an antigenic polypeptide fragment thereof, which may
presented together with a carrier protein, such as an albumin, to
an animal system (such as rabbit or mouse) or, if it is long enough
(at least about 25 amino acids), without a carrier.
[0317] As used herein, the term "antibody" (Ab) or "monoclonal
antibody" (Mab) is meant to include intact molecules as well as
antibody fragments (such as, for example, Fab and F(ab').sub.2
fragments) which are capable of specifically binding to T1R-like
ligand II. Fab and F(ab').sub.2 fragments lack the Fc fragment of
intact antibody, clear more rapidly from the circulation, and may
have less non-specific tissue binding of an intact antibody (Wahl
et al., J. Nucl. Med. 24:316-325 (1983)). Thus, these portions are
preferred.
[0318] The antibodies of the present invention may be prepared by
any of a variety of methods. For example, cells expressing the
T1R-like ligand II or an antigenic fragment thereof can be
administered to an animal in order to induce the production of sera
containing polyclonal antibodies. In a preferred method, a
preparation of T1R-like ligand II protein is prepared and purified
as described above to render it substantially free of natural
contaminants. Such a preparation is then introduced into an animal
in order to produce polyclonal antisera of greater specific
activity.
[0319] In the most preferred method, the antibodies of the present
invention are monoclonal antibodies (or T1R-like ligand II binding
fragments thereof). Such monoclonal antibodies can be prepared
using hybridoma technology (Colligan, Current Protocols in
Immunology, Wiley Interscience, New York (1990-1996); Harlow &
Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Press,
Cold Spring Harbor, N.Y. (1988), Chapters 6-9, Current Protocols in
Molecular Biology, Ausubel, infra, Chapter 11, entirely
incorporated herein by reference). In general, such procedures
involve immunizing an animal (preferably a mouse) with an T1R-like
ligand II antigen or, more preferably, with an T1R-like ligand
II-expressing cell. Suitable cells can be recognized by their
capacity to bind anti-T1R-like ligand II antibody. Such cells may
be cultured in any suitable tissue culture medium; however, it is
preferable to culture cells in Earle's modified Eagle's medium
supplemented with 10% fetal bovine serum (inactivated at about
56.degree. C.), and supplemented with about 10 .mu.g/l of
nonessential amino acids, about 1,000 U/ml of penicillin, and about
100 .mu.g/ml of streptomycin.
[0320] The splenocytes of such mice are extracted and fused with a
suitable myeloma cell line. Any suitable myeloma cell line may be
employed in accordance with the present invention; however, it is
preferable to employ the parent myeloma cell line (SP.sub.2O),
available from the American Type Culture Collection (ATCC.TM.)
(Rockville, Md., USA). After fusion, the resulting hybridoma cells
are selectively maintained in HAT medium, and then cloned by
limiting dilution as described by Wands et al., Gastroenterology
80:225-232 (1981); Harlow & Lane, infra, Chapter 7. The
hybridoma cells obtained through such a selection are then assayed
to identify clones which secrete antibodies capable of binding the
T1R-like ligand II antigen.
[0321] Alternatively, additional antibodies capable of binding to
the T1R-like ligand II antigen may be produced in a two-step
procedure through the use of anti-idiotypic antibodies. Such a
method makes use of the fact that antibodies are themselves
antigens, and therefore it is possible to obtain an antibody which
binds to a second antibody. In accordance with this method,
T1R-like ligand II specific antibodies are used to immunize an
animal, preferably a mouse. The splenocytes of such an animal are
then used to produce hybridoma cells, and the hybridoma cells are
screened to identify clones which produce an antibody whose ability
to bind to the T1R-like ligand II-specific antibody can be blocked
by the T1R-like ligand II antigen. Such antibodies comprise
anti-idiotypic antibodies to the T1R-like ligand II-specific
antibody and can be used to immunize an animal to induce formation
of further T1R-like ligand II-specific antibodies.
[0322] It will be appreciated that Fab and F(ab').sub.2 and other
fragments of the antibodies of the present invention maybe used
according to the methods disclosed herein. Such fragments are
typically produced by proteolytic cleavage, using enzymes such as
papain (to produce Fab fragments) or pepsin (to produce
F(ab').sub.2 fragments). Alternatively, T1R-like ligand II-binding
fragments can be produced through the application of recombinant
DNA technology or through synthetic chemistry.
[0323] Where in vivo imaging is used to detect enhanced levels of
T1R-like ligand II for diagnosis in humans, it may be preferable to
use "humanized" chimeric monoclonal antibodies. Such antibodies can
be produced using genetic constructs derived from hybridoma cells
producing the monoclonal antibodies described above. Methods for
producing chimeric antibodies are known in the art. See, for
review, Morrison, Science 229:1202 (1985); Oi et al., BioTechniques
4:214 (1986); Cabilly et al., U.S. Pat. No. 4,816,567; Taniguchi et
al., EP 171496; Morrison et al., EP 173494; Neuberger et al., WO
8601533; Robinson et al., WO 8702671; Boulianne et al., Nature
312:643 (1984); Neuberger et al., Nature 314:268 (1985).
[0324] Further suitable labels for the T1R-like ligand II-specific
antibodies of the present invention are provided herein. Examples
of suitable enzyme labels include malate dehydrogenase,
staphylococcal nuclease, delta-5-steroid isomerase, yeast-alcohol
dehydrogenase, alpha-glycerol phosphate dehydrogenase, triose
phosphate isomerase, peroxidase, alkaline phosphatase,
asparaginase, glucose oxidase, beta-galactosidase, ribonuclease,
urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase,
and acetylcholine esterase.
[0325] Examples of suitable radioisotopic labels include .sup.3H,
.sup.111In, .sup.125I, .sup.131I, .sup.32P, .sup.35S, .sup.14C,
.sup.51Cr, .sup.57To, .sup.58Co, .sup.59Fe, .sup.75Se, .sup.152EU,
.sup.90Y, .sup.67Cu, .sup.217Ci, .sup.211At, .sup.212Pb, .sup.47Sc,
.sup.109Pd, etc. .sup.111In is a preferred isotope where in vivo
imaging is used since its avoids the problem of dehalogenation of
the .sup.125 or .sup.131I-labeled monoclonal antibody by the liver.
In addition, this radionucleotide has a more favorable gamma
emission energy for imaging (Perkins et al., Eur. J. Nucl. Med.
10:296-301 (1985); Carasquillo et al., J. Nucl. Med. 28:281-287
(1987)). For example, .sup.111In coupled to monoclonal antibodies
with 1-(P-isothiocyanatobenzyl)-DPTA has shown little uptake in
non-tumorous tissues, particularly the liver, and therefore
enhances specificity of tumor localization (Esteban et al., J.
Nucl. Med. 28:861-870 (1987)).
[0326] Examples of suitable non-radioactive isotopic labels include
.sup.157Gd, .sup.55Mn, .sup.162Dy, .sup.52Tr, and .sup.56Fe.
[0327] Examples of suitable fluorescent labels include an
.sup.152Eu label, a fluorescein label, an isothiocyanate label, a
rhodamine label, a phycoerythrin label, a phycocyanin label, an
allophycocyanin label, an o-phthaldehyde label, and a fluorescamine
label.
[0328] Examples of suitable toxin labels include diphtheria toxin,
ricin, and cholera toxin.
[0329] Examples of chemiluminescent labels include a luminal label,
an isoluminal label, an aromatic acridinium ester label, an
imidazole label, an acridinium salt label, an oxalate ester label,
a luciferin label, a luciferase label, and an aequorin label.
[0330] Examples of nuclear magnetic resonance contrasting agents
include heavy metal nuclei such as Gd, Mn, and Fe.
[0331] Typical techniques for binding the above-described labels to
antibodies are provided by Kennedy et al. (Clin. Chim. Acta 70:1-31
(1976)), and Schurs et al. (Clin. Chim. Acta 81:1-40 (1977)).
Coupling techniques mentioned in the latter are the glutaraldehyde
method, the periodate method, the dimaleimide method, the
m-maleimidobenzyl-N-hydroxy-succinmide ester method, all of which
methods are incorporated by reference herein.
Chromosome Assays
[0332] The nucleic acid molecules of the present invention are also
valuable for chromosome identification. The sequence is
specifically targeted to and can hybridize with a particular
location on an individual human chromosome. Moreover, there is a
current need for identifying particular sites on the chromosome.
Few chromosome marking reagents based on actual sequence data
(repeat polymorphisms) are presently available for marking
chromosomal location. The mapping of DNAs to chromosomes according
to the present invention is an important first step in correlating
those sequences with genes associated with disease.
[0333] In certain preferred embodiments in this regard, the cDNA
herein disclosed is used to clone genomic DNA of an T1R-like ligand
II gene. This can be accomplished using a variety of well known
techniques and libraries, which generally are available
commercially. The genomnic DNA then is used for in situ chromosome
mapping using well known techniques for this purpose. Typically, in
accordance with routine procedures for chromosome mapping, some
trial and error may be necessary to identify a genomic probe that
gives a good in situ hybridization signal.
[0334] In some cases, in addition, sequences can be mapped to
chromosomes by preparing PCR primers (preferably 15-25 bp) from the
cDNA. Computer analysis of the 3' untranslated region of the gene
is used to rapidly select primers that do not span more than one
exon in the genomic DNA, thus complicating the amplification
process. These primers are then used for PCR screening of somatic
cell hybrids containing individual human chromosomes. Only those
hybrids containing the human gene corresponding to the primer will
yield an amplified portion.
[0335] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of portions from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0336] Fluorescence in situ hybridization ("FISH") of a cDNA clone
to a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
probes from the cDNA as short as 50 or 60 bp. For a review of this
technique, see Verma et al., Human Chromosomes: A Manual of Basic
Techniques, Pergamon Press, New York (1988).
[0337] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man, available
on-line through Johns Hopkins University, Welch Medical Library.
The relationship between genes and diseases that have been mapped
to the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0338] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0339] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
Pharmaceutical Compositions and Therapeutic Administration
[0340] The present invention also provides pharmaceutical
compositions. Such compositions comprise a therapeutically
effective amount of a compound, and a pharmaceutically acceptable
carrier. In a specific embodiment, the term "pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and more
particularly in humans. The term "carrier" refers to a diluent,
adjuvant, excipient, or vehicle with which the therapeutic is
administered. Such pharmaceutical carriers can be sterile liquids,
such as water and oils, including those of petroleum, animal,
vegetable or synthetic origin, such as peanut oil, soybean oil,
mineral oil, sesame oil and the like. Water is a preferred carrier
when the pharmaceutical composition is administered intravenously.
Saline solutions and aqueous dextrose and glycerol solutions can
also be employed as liquid carriers, particularly for injectable
solutions. Suitable pharmaceutical excipients include starch,
glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, sodium stearate, glycerol monostearate, talc, sodium
chloride, dried skim milk, glycerol, propylene, glycol, water,
ethanol and the like.
[0341] The composition, if desired, can also contain minor amounts
of wetting or emulsifying agents, or pH buffering agents. These
compositions can take the form of solutions, suspensions, emulsion,
tablets, pills, capsules, powders, sustained-release formulations
and the like. The composition can be formulated as a suppository,
with traditional binders and carriers such as triglycerides. Oral
formulation can include standard carriers such as pharmaceutical
grades of mannitol, lactose, starch, magnesium stearate, sodium
saccharine, cellulose, magnesium carbonate, etc. Examples of
suitable pharmaceutical carriers are described in "Remington's
Pharmaceutical Sciences" by E. W. Martin. Such compositions will
contain a therapeutically effective amount of the compound,
preferably in purified form, together with a suitable amount of
carrier so as to provide the form for proper administration to the
patient. The formulation should suit the mode of
administration.
[0342] In a preferred embodiment, the composition is formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for intravenous administration to human beings. Typically,
compositions for intravenous administration are solutions in
sterile isotonic aqueous buffer. Where necessary, the composition
may also include a solubilizing agent and a local anesthetic such
as lignocaine to ease pain at the site of the injection. Generally,
the ingredients are supplied either separately or mixed together in
unit dosage form, for example, as a dry lyophilized powder or water
free concentrate in a hermetically sealed container such as an
ampoule or sachette indicating the quantity of active agent. Where
the composition is to be administered by infusion, it can be
dispensed with an infusion bottle containing sterile pharmaceutical
grade water or saline. Where the composition is administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients may be mixed prior to
administration.
[0343] The compounds of the invention can be formulated as neutral
or salt fonts. Pharmaceutically acceptable salts include those
formed with anions such as those derived from hydrochloric,
phosphoric, acetic, oxahc, tartaric acids, etc., and those formed
with cations such as those derived from sodium, potassium,
ammonium, calcium, ferric hydroxides, isopropylamine,
triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
[0344] The amount of the compound of the invention which will be
effective in the treatment, inhibition and prevention of a disease
or disorder associated with aberrant expression and/or activity of
a polypeptide of the invention can be determined by standard
clinical techniques. In addition, in vitro assays may optionally be
employed to help identify optimal dosage ranges. The precise dose
to be employed in the formulation will also depend on the route of
administration, and the seriousness of the disease or disorder, and
should be decided according to the judgment of the practitioner and
each patient's circumstances. Effective doses may be extrapolated
from dose-response curves derived from in vitro or animal model
test systems.
[0345] Various delivery systems are known and can be used to
administer a compound of the invention, e.g., encapsulation in
liposomes, microparticles, microcapsules, recombinant cells capable
of expressing the compound, receptor-mediated endocytosis (see,
e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)), construction
of a nucleic acid as part of a retroviral or other vector, etc.
Methods of introduction include but are not limited to intradermal,
intramuscular, intraperitoneal, intravenous, subcutaneous,
intranasal, epidural, and oral routes. The compounds or
compositions may be administered by any convenient route, for
example by infusion or bolus injection, by absorption through
epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and
intestinal mucosa, etc.) and may be administered together with
other biologically active agents. Administration can be systemic or
local. In addition, it may be desirable to introduce the
pharmaceutical compounds or compositions of the invention into the
central nervous system by any suitable route, including
intraventricular and intrathecal injection; intraventricular
injection may be facilitated by an intraventricular catheter, for
example, attached to a reservoir, such as an Ommaya reservoir.
Pulmonary administration can also be employed, e.g., by use of an
inhaler or nebulizer, and formulation with an aerosolizing
agent.
[0346] In a specific embodiment, it may be desirable to administer
the pharmaceutical compounds or compositions of the invention
locally to the area in need of treatment; this may be achieved by,
for example, and not by way of limitation, local infusion during
surgery, topical application, e.g., in conjunction with a wound
dressing after surgery, by injection, by means of a catheter, by
means of a suppository, or by means of an implant, said implant
being of a porous, non-porous, or gelatinous material, including
membranes, such as sialastic membranes, or fibers. Preferably, when
administering a protein, including an antibody, of the invention,
care must be taken to use materials to which the protein does not
absorb.
[0347] In another embodiment, the compound or composition can be
delivered in a vesicle, in particular a liposome (see Langer,
Science 249:1527-1533 (1990); Treat et al., in Liposomes in the
Therapy of Infectious Disease and Cancer, Lopez-Berestein and
Fidler (eds.), Liss, N.Y., pp. 353-365 (1989); Lopez-Berestein,
ibid., pp. 317-327; see generally ibid.)
[0348] In yet another embodiment, the compound or composition can
be delivered in a controlled release system. In one embodiment, a
pump may be used to deliver the compositions of the invention (see
Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987);
Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J.
Med. 321:574 (1989)). In another embodiment, polymeric materials
can be used (see Medical Applications of Controlled Release, Langer
and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Controlled
Drug Bioavailabilty, Drug Product Design and Performance, Smolen
and Ball (eds.), Wiley, N.Y. (1984); Ranger and Peppas, J.,
Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et
al., Science 228:190 (1985); During et al., Ann. Neurol. 25:351
(1989); Howard et al., J. Neurosurg. 71:105 (1989)). In yet another
embodiment, a controlled release system can be placed in proximity
of the therapeutic target, i.e., the brain, thus requiring only a
fraction of the systemic dose (see, e.g., Goodson, in Medical
Applications of Controlled Release, supra, vol. 2, pp. 115-138
(1984)).
[0349] Other controlled release systems are discussed in the review
by Langer (Science 249:1527-1533 (1990)).
[0350] T1R-Like ligand II compositions of the invention are also
suitably administered by sustained-release systems. Suitable
examples of sustained-release compositions include suitable
polymeric materials (such as, for example, semi-permeable polymer
matrices in the form of shaped articles, e.g., films, or
mirocapsules), suitable hydrophobic materials (for example as an
emulsion in an acceptable oil) or ion exchange resins, and
sparingly soluble derivatives (such as, for example, a sparingly
soluble salt).
[0351] Sustained-release matrices include polylactides (U.S. Pat.
No. 3,773,919; EP 58,481), copolymers of L-glutamic acid and
gamma-ethyl-L-glutamate (Sidman et al., Biopolymers 22:547-556
(1983)), poly(2-hydroxyethyl methacrylate) (Langer et al., J.
Biomed. Mater. Res. 15:167-277 (1981), and Langer, Chem. Tech.
12:98-105 (1982)), ethylene vinyl acetate (R. Langer et al., Id.)
or poly-D-(-)-3-hydroxybutyric acid (EP 133,988).
[0352] Sustained-release compositions also include liposomally
entrapped compositions of the invention (see generally, Langer,
Science 249:1527-1533 (1990); Treat et al., in Liposomes in the
Therapy of Infectious Disease and Cancer, Lopez-Berestein and
Fidler (eds.), Liss, N.Y., pp. 317-327 and 353-365 (1989)).
Liposomes containing T1R-Like ligand II polypeptide may be prepared
by methods known per se: DE 3,218,121; Epstein et al., Proc. Natl.
Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl.
Acad. Sci. (USA) 77:4030-4034 (1980); EP 52,322; EP 36,676; EP
88,046; EP 143,949; EP 142,641; Japanese Pat. Appl. 83-118008; U.S.
Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324. Ordinarily, the
liposomes are of the small (about 200-800 Angstroms) unilamellar
type in which the lipid content is greater than about 30 mol.
percent cholesterol, the selected proportion being adjusted for the
optimal T1R-Like ligand II polypeptide therapy.
[0353] In a specific embodiment where the compound of the invention
is a nucleic acid encoding a polypeptide, antibody, antagonist,
agonist, protein, or fragment or variant thereof, the nucleic acid
can be administered in vivo to promote expression of its encoded
protein, by constructing it as part of an appropriate nucleic acid
expression vector and administering it so that it becomes
intracellular, e.g., by use of a retroviral vector (see U.S. Pat.
No. 4,980,286), by direct injection, by use of microparticle
bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with
lipids or cell-surface receptors or transfecting agents, or by
administering it in linkage to a homeobox-like peptide which is
known to enter the nucleus (see e.g., Joliot et al., Proc. Natl.
Acad. Sci. USA 88:1864-1868 (1991)), etc. Alternatively, a nucleic
acid can be introduced intracellularly and incorporated within host
cell DNA for expression, by homologous recombination.
[0354] T1R-like ligand II polynucleotide, polypeptide, antibody,
antagonist, agonist, or fragment or variant thereof of the
invention may be administered using any method known in the art,
including, but not limited to, direct needle injection at the
delivery site, intravenous injection, topical administration,
catheter infusion, biolistic injectors, particle accelerators,
gelfoam sponge depots, other commercially available depot
materials, osmotic pumps, oral or suppositorial solid
pharmaceutical formulations, decanting or topical applications
during surgery, aerosol delivery. Such methods are known in the
art. T1R-like ligand II molecules of the invention may be
administered as part of a pharmaceutical composition, described in
more detail herein. Methods of delivering T1R-like ligand II
molecules of the invention are known in the art and described in
more detail herein.
[0355] The pharmaceutical compositions of the present invention
maybe administered, for example, by the parenteral, subcutaneous,
intravenous, intramuscular, intraperitoneal, transdermal, orbuccal
routes. Alternatively, or concurrently, administration may be oral.
The dosage administered will be dependent upon the age, health, and
weight of the recipient, kind of concurrent treatment, if any,
frequency of treatment, and the nature of the effect desired.
[0356] Compositions within the scope of this invention include all
compositions wherein a T1R-like ligand II polynucleotide,
polypeptide, antibody, agonist, antagonist or variant or fragment
thereof is contained in an amount effective to achieve its intended
purpose. While individual needs vary, determination of optimal
ranges of effective amounts of each component is within the skill
of the art. The effective dose is a function of the individual
T1R-like ligand II polynucleotide, polypeptide, antibody, agonist,
antagonist or fragment or variant thereof, the presence and nature
of a conjugated therapeutic agent (see herein), the patient and his
clinical status, and can vary from about 10 ng/kg body weight to
about 100 mg/kg body weight. The preferred dosages comprise 0.1 to
10 mg/kg body wt.
[0357] Preparations of a T1R-like ligand II polynucleotide,
polypeptide, antibody, agonist, antagonist or fragment or variant
thereof, for parenteral administration, such as in detectably
labeled form for imaging or in a free or conjugated form for
therapy, include sterile aqueous or non-aqueous solutions,
suspensions, and emulsions. Examples of non-aqueous solvents are
propyleneglycol, polyethyleneglycol, vegetable oil such as olive
oil, and injectable organic esters such as ethyloleate. Aqueous
carriers include water, alcoholic/aqueous solutions, emulsions or
suspensions, including saline and buffered media, parenteral
vehicles including sodium chloride solution, Ringer's dextrose,
dextrose and sodium chloride, lactated Ringer's, or fixed oils.
Intravenous vehicles include fluid and nutrient replenishers, such
as those based on Ringer's dextrose, and the like. Preservatives
and other additives may also be present, such as, for example,
antimicrobials, anti-oxidants, chelating agents, and inert gases
and the like. See, generally, Remington's Pharmaceutical Science,
16th ed., Mack Publishing Co., Easton, Pa., 1980.
[0358] As a general proposition, the total pharmaceutically
effective amount of a T1R-like ligand II administered parenterally
per dose will be in the range of about 0.01 ng/kg/day to 10
.mu.g/kg/day of patient body weight, although, as noted above, this
will be subject to therapeutic discretion. More preferably, this
dose is at least 1.0 ng/kg/day, and most preferably for humans
between about 1.0 to 100 ng/kg/day. If given continuously, the
T1R-like ligand II is typically administered at a dose rate of
about 0.01 ng/kg/hour to about 100 ng/kg/hour, either by 1-4
injections per day or by continuous subcutaneous infusions, for
example, using a mini-pump. An intravenous bag solution may also be
employed.
[0359] For antibodies, the dosage administered to a patient is
typically 0.1 mg/kg to 100 mg/kg of the patient's body weight.
Preferably, the dosage administered to a patient is between 0.1
mg/kg and 20 mg/kg of the patient's body weight, more preferably 1
mg/kg to 10 mg/kg of the patient's body weight. Generally, human
antibodies have a longer half-life within the human body than
antibodies from other species due to the immune response to the
foreign polypeptides. Thus, lower dosages of human antibodies and
less frequent administration is often possible. Further, the dosage
and frequency of administration of antibodies of the invention may
be reduced by enhancing uptake and tissue penetration (e.g., into
the brain) of the antibodies by modifications such as, for example,
lipidation.
[0360] A course of T1R-like ligand II polypeptide treatment to
affect the immune system appears to be optimal if continued longer
than a certain minimum number of days, 7 days in the case of the
mice. The length of treatment needed to observe changes and the
interval following treatment for responses to occur appears to vary
depending on the desired effect.
[0361] For parenteral administration, in one embodiment, the
T1R-like ligand II polypeptide is formulated generally by mixing it
at the desired degree of purity, in a unit dosage injectable form
(solution, suspension, or emulsion), with a pharmaceutically
acceptable carrier, i.e., one that is non-toxic to recipients at
the dosages and concentrations employed and is compatible with
other ingredients of the formulation. For example, the formulation
preferably does not include oxidizing agents and other compounds
that are known to be deleterious to polypeptides.
[0362] The term "parenteral" as used herein refers to modes of
administration which include intravenous, intramuscular,
intraperitoneal, intrastemal, subcutaneous and intraarticular
injection and infusion.
[0363] Generally, the formulations are prepared by contacting the
T1R-like ligand II polypeptide uniformly and intimately with liquid
carriers or fmely divided solid carriers or both. Then, if
necessary, the product is shaped into the desired formulation.
Preferably the carrier is a parenteral carrier, more preferably a
solution that is isotonic with the blood of the recipient. Examples
of such carrier vehicles include water, saline, Ringer's solution,
and dextrose solution. Non-aqueous vehicles such as fixed oils and
ethyl oleate are also useful herein, as well as liposomes.
[0364] The carrier suitably contains minor amounts of additives
such as substances that enhance isotonicity and chemical stability.
Such materials are non-toxic to recipients at the dosages and
concentrations employed, and include buffers such as phosphate,
citrate, succinate, acetic acid, and other organic acids or their
salts; antioxidants such as ascorbic acid; low molecular weight
(less than about ten residues) polypeptides, e.g., polyarginine or
tripeptides; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids, such as glycine, glutamic acid, aspartic acid, or
arginine; monosaccharides, disaccharides, and other carbohydrates
including cellulose or its derivatives, glucose, mannose, or
dextrins; chelating agents such as EDTA; sugar alcohols such as
mannitol or sorbitol; counterions such as sodium; and/or nonionic
surfactants such as polysorbates, poloxamers, or PEG.
[0365] The T1R-like ligand II is typically formulated in such
vehicles at a concentration of about 0.001 ng/ml to 500 ng/ml,
preferably 0.1-10ng/ml, at a pH of about 3 to 8. It will be
understood that the use of certain of the foregoing excipients,
carriers, or stabilizers will result in the formation of T1R-like
ligand II salts.
[0366] T1R-like ligand II to be used for therapeutic administration
must be sterile. Sterility is readily accomplished by filtration
through sterile filtration membranes (e.g., 0.2 micron membranes).
Therapeutic T1R-like ligand II compositions generally are placed
into a container having a sterile access port, for example, an
intravenous solution bag or vial having a stopper pierceable by a
hypodermic injection needle.
[0367] T1R-like ligand II ordinarily will be stored in unit or
multi-dose containers, for example, sealed ampoules or vials, as an
aqueous solution or as a lyophilized formulation for
reconstitution. As an example of a lyophilized formulation, 10-ml
vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous T1
R-like ligand II solution, and the resulting mixture is
lyophilized. The infusion solution is prepared by reconstituting
the lyophilized T1R-like ligand II using bacteriostatic
Water-for-Injection.
[0368] For example, satisfactory results are obtained by oral
administration of a polypeptide having T1R-like ligand II activity
in dosages on the order of from 0.05 to 5000 ng/kg/day, preferably
0.1 to 1000 ng/kg/day, more preferably 10 to 100 ng/kg/day,
administered once or, in divided doses, 1 to 4 times per day. On
administration parenterally, for example by i.v. drip or infusion,
dosages on the order of from 0.01 to 500 ng/kg/day, preferably 0.05
to 100 ng/kg/day and more preferably 0.1 to 50 ng/kg/day can be
used. Suitable daily dosages for patients are thus on the order of
from 2.5 ng to 250 .mu.g p.o., preferably 5 ng to 50 .mu.g p.o.,
more preferably 50 ng to 12.5 .mu.p.o., or on the order of from 0.5
ng to 25 .mu.g i.v., preferably 2.5 ng to 500 .mu.g i.v. and more
preferably 5 ng to 2.5 .mu.g i.v.
[0369] The compositions of the invention may be administered alone
or in combination with other therapeutic agents. Therapeutic agents
that may be administered in combination with the compositions of
the invention, include but not limited to, other members of the
IL-1, IL-1R or T1R-like ligand II family, chemotherapeutic agents,
antivirals, antibiotics, steroidal and non-steroidal
anti-inflammatories, conventional immunotherapeutic agents,
cytokines, chemokines and/or growth factors. Combinations may be
administered either concomitantly, e.g., as an admixture,
separately but simultaneously or concurrently; or sequentially.
This includes presentations in which the combined agents are
administered together as a therapeutic mixture, and also procedures
in which the combined agents are administered separately but
simultaneously, e.g., as through separate intravenous lines into
the same individual. Administration "in combination" further
includes the separate administration of one of the compounds or
agents given first, followed by the second.
[0370] The invention also encompasses combining the polynucleotides
and/or polypeptides of the invention (and/or agonists or
antagonists thereof) with other proposed or conventional
hematopoietic therapies. Thus, for example, the polynucleotides
and/or polypeptides of the invention (and/or agonists or
antagonists thereof) can be combined with compounds that singly
exhibit erythropoietic stimulatory effects, such as erythropoietin,
testosterone, progenitor cell stimulators, insulin-like growth
factor, prostaglandins, serotonin, cyclic AMP, prolactin, and
triiodothyzonine. Also encompassed are combinations of the
compositions of the invention with compounds generally used to
treat a plastic anemia, such as, for example, methenolene,
stanozolol, and nandrolone; to treat iron-deficiency anemia, such
as, for example, iron preparations; to treat malignant anemia, such
as, for example, vitamin B.sub.12 and/or folic acid; and to treat
hemolytic anemia, such as, for example, adrenocortical steroids,
e.g., corticoids. See e.g., Resegotti et al., Panminerva Medica,
23:243-248 (1981); Kurtz, FEBS Letters, 14a:105-108 (1982);
McGonigle et al., Kidney Int., 25:437-444 (1984); and
Pavlovic-Kantera, Expt. Hematol., 8 (supp. 8) 283-291 (1980), the
contents of each of which are hereby incorporated by reference in
their entireties.
[0371] Compounds that enhance the effects of or synergize with
erythropoietin are also useful as adjuvants herein, and include but
are not limited to, adrenergic agonists, thyroid hormones,
androgens, hepatic erythropoietic factors, erythrotropins, and
erythrogenins, See for e.g., Dunn, "Current Concepts in
Erythropoiesis", John Wiley and Sons (Chichester, England, 1983);
Kalmani, Kidney Int., 22:383-391 (1982); Shahidi, New Eng. J. Med.,
289:72-80 (1973); Urabe et al., J. Exp. Med., 149:1314-1325 (1979);
Billat et al., Expt. Hematol., 10:133-140 (1982); Naughton et al.,
Acta Haemat, 69:171-179 (1983); Cognote et al. in abstract 364,
Proceedings 7th Intl. Cong. of Endocrinology (Quebec City, Quebec,
Jul. 1-7, 1984); and Rothman et al., 1982, J. Surg. Oncol.,
20:105-108 (1982). Methods for stimulating hematopoiesis comprise
administering a hematopoietically effective amount (i.e., an amount
which effects the formation of blood cells) of a pharmaceutical
composition containing polynucleotides and/or poylpeptides of the
invention (and/or agonists or antagonists thereof) to a
patient.
[0372] The polynucleotides and/or polypeptides of the invention
and/or agonists or antagonists thereof is administered to the
patient by any suitable technique, including but not limited to,
parenteral, sublingual, topical, intrapulmonary and intranasal, and
those techniques further discussed herein. The pharmaceutical
composition optionally contains one or more members of the group
consisting of erythropoietin, testosterone, progenitor cell
stimulators, insulin-like growth factor, prostaglandins, serotonin,
cyclic AMP, prolactin, triiodothyzonine, methenolene, stanozolol,
and nandrolone, iron preparations, vitamin B.sub.12, folic acid
and/or adrenocortical steroids.
[0373] In additional prefered embodiments, the compositions of the
invention are administered in combination with hematopoietic growth
factors. Hematopoietic growth factors that may be administered with
the compositions of the invention included, but are not limited to
LEUKINE (SARGRAMOSTIM.TM.) and NEUPOGEN (FILGRASTIM.TM.).
[0374] In one embodiment, the compositions of the invention are
administered in combination with other members of the IL1- and
IL1R-like family. Molecules that may be administered with the
compositions of the invention include, but are not limited to,
IL-1.alpha., IL-1.beta., IL-1R and IL1-Ra.
[0375] Conventional nonspecific immunosuppressive agents, that may
be administered in combination with the compositions of the
invention include, but are not limited to, steroids, cyclosporine,
cyclosporine analogs, cyclophosphamide methylprednisone,
prednisone, azathioprine, FK-506, 15-deoxyspergualin, and other
immunosuppressive agents that act by suppressing the function of
responding T cells.
[0376] In a further embodiment, the compositions of the invention
are administered in combination with an antiviral agent. Antiviral
agents that may be administered with the compositions of the
invention include, but are not limited to, acyclovir, ribavirin,
amantadine, and remantidine.
[0377] In a further embodiment, the compositions of the invention
are administered in combination with an antibiotic agent.
Antibiotic agents that may be administered with the compositions of
the invention include, but are not limited to, amoxicillin,
aminoglycosides, beta-lactam (glycopeptide), beta-lactamases,
Clindamycin, chloramphenicol, cephalosporins, ciprofloxacin,
ciprofloxacin, erythromycin, fluoroquinolones, macrolides,
metronidazole, penicillins, quinolones, rifampin, streptomycin,
sulfonamide, tetracyclines, trimethoprim,
trimethoprim-sulfamthoxazole, and vancomycin.
[0378] In an additional embodiment, the compositions of the
invention are administered alone or in combination with an
anti-inflammatory agent. Anti-inflammatory agents that may be
administered with the compositions of the invention include, but
are not limited to, glucocorticoids and the nonsteroidal
anti-inflammatories, aminoarylcarboxylic acid derivatives,
arylacetic acid derivatives, arylbutyric acid derivatives,
arylcarboxylic acids, arylpropionic acid derivatives, pyrazoles,
pyrazolones, salicylic acid derivatives, thiazinecarboxamides,
e-acetamidocaproic acid, S-adenosylmethionine,
3-amino-4-hydroxybutyric acid, amixetrine, bendazac, benzydamine,
bucolome, difenpiramide, ditazol, emorfazone, guaiazulene,
nabumetone, nimesulide, orgotein, oxaceprol, paranyline, perisoxal,
pifoxime, proquazone, proxazole, and tenidap.
[0379] In another embodiment, compostions of the invention are
administered in combination with a chemotherapeutic agent.
Chemotherapeutic agents that may be administered with the
compositions of the invention include, but are not limited to,
antibiotic derivatives (e.g., doxorubicin, bleomycin, daunorabicin,
and dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites
(e.g., fluorouracil, 5-FU, methotrexate, floxuridine, interferon
alpha-2b, glutamic acid, plicamycin, mercaptopurine, and
6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU,
lomustine, CCNU, cytosine arabinoside, cyclophosphamide,
estramustine, hydroxyurea, procarbazine, mitomycin, busulfan,
cis-platin, and vincristine sulfate); hormones (e.g.,
medroxyprogesterone, estramustine phosphate sodium, ethinyl
estradiol, estradiol, megestrol acetate, methyltestosterone,
diethylstilbestrol diphosphate, chlorotrianisene, and
testolactone); nitrogen mustard derivatives (e.g., mephalen,
chorambucil, mechlorethamine (nitrogen mustard) and thiotepa);
steroids and combinations (e.g., bethamethasone sodium phosphate);
and others (e.g., dicarbazine, asparaginase, mitotane, vincristine
sulfate, vinblastine sulfate, and etoposide).
[0380] In an additional embodiment, the compositions of the
invention are administered in combination with cytokines. Cytolines
that may be administered with the compositions of the invention
include, but are not limited to, IL2, IL3, IL4, IL5, IL6, IL7,
IL10, IL12, IL13, IL15, anti-CD40, CD40L, IFN-gamma and
TNF-alpha.
[0381] In one embodiment, the compositions of the invention are
administered in combination with one or more chemokines. In
specific embodiments, the compositions of the invention are
administered in combination with an .alpha.(C.times.C) chemokine or
nucleic acid encoding an a chemokine selected from the group
consisting of .gamma. interferon inducible protein-10
(.gamma.IP-10), interleukin-8 (IL-8), platelet factor-4 (PF4),
neutrophil activating protein (NAP-2), GRO-.alpha., GRO-.beta.,
GRO-.gamma., neutrophil-activating peptide (ENA-78), granulocyte
chemoattractant protein-2 (GCP-2), and stromal cell-derived
factor-1 (SDF-1, or pre-B cell stimulatory factor (PBSF)); and/or a
.beta.(CC) chemoline or nucleic acid encoding a .beta. chemokine
selected from the group consisting of: RANTES (regulated on
activation, normal T expressed and secreted), macrophage
inflammatory protein-1.alpha. (MIP-1.alpha.), macrophage
inflammatory protein-1.beta. (MIP-1.beta.), monocyte chemotactic
protein-1 (MCP-1), monocyte chemotactic protein-2 (MCP-2), monocyte
chemotactic protein-3 (MCP-3), monocyte chemotactic protein-4
(MCP-4) macrophage inflammatory protein-1.gamma. (MIP-1.gamma.),
macrophage inflammatory protein-3.alpha. (MIP-3.alpha.), macrophage
inflammatory protein-3.beta. (MIP-3.beta.), macrophage inflammatory
protein-4 (MIP-4/DC-CK-1/PARC), eotaxin, Exodus, and I-309; and/or
the .gamma.(C) chemokine, or nucleic acid encoding the .gamma.
chemokine, lymphotactin.
[0382] In an additional embodiment, the compositions of the
invention are administered in combination with angiogenic proteins.
Angiogenic proteins that may be administered with the compositions
of the invention include, but are not limited to, Glioma Derived
Growth Factor (GDGF), as disclosed in European Patent Number
EP-399816; Platelet Derived Growth Factor-A (PDGF-A), as disclosed
in European Patent Number EP-682110; Platelet Derived
GrowthFactor-B (PDGF-B), as disclosed in European Patent Number
EP-282317; Placental GrowthFactor (P1GF), as disclosed in
International Publication Number WO 92/06194; Placental Growth
Factor-2 (P1GF-2), as disclosed in Hauser et al., Growth Factors,
4:259-268 (1993); Vascular Endothelial Growth Factor (VEGF), as
disclosed in International Publication Number WO 90/13649; Vascular
Endothelial Growth Factor-A (VEGF-A), as disclosed in European
Patent Number EP-506477; Vascular Endothelial Growth Factor-2
(VEGF-2), as disclosed in International Publication Number WO
96/39515; Vascular Endothelial Growth Factor B-186 (VEGF-B186), as
disclosed in International Publication Number WO 96/26736; Vascular
Endothelial Growth Factor-D (VEGF-D), as disclosed in International
Publication Number WO 98/02543; Vascular Endothelial Growth
Factor-D (VEGF-D), as disclosed in International Publication number
WO 98/07832; and Vascular Endothelial Growth Factor-E (VEGF-E), as
disclosed in German Patent Number DE19639601. The above mentioned
references are incorporated herein by reference herein.
[0383] In an additional embodiment, the compositions of the
invention are administered in combination with Fibroblast Growth
Factors. Fibroblast Growth Factors that may be administered with
the compositions of the invention include, but are not limited to,
FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9,
FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, and FGF-15.
[0384] Additionally, the compositions of the invention may be
administered alone or in combination with other therapeutic
regimens, including but not limited to, radiation therapy. Such
combinatorial therapy may be administered sequentially and/or
concomitantly.
Diagnostic Kits
[0385] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Optionally associated with such container(s) can be a notice in the
form prescribed by a governmental agency regulating the
manufacture, use or sale of pharmaceuticals or biological products,
which notice reflects approval by the agency of manufacture, use or
sale for human administration.
[0386] Labeled antibodies, and derivatives and analogs thereof
whichspecificallybindto a polypeptide of interest can be used for
diagnostic purposes to detect, diagnose, or monitor diseases and/or
disorders associated with the aberrant expression and/or activity
of a polypeptide of the invention. The invention provides for the
detection of aberrant expression of a polypeptide of interest,
comprising (a) assaying the expression of the polypeptide of
interest in cells or body fluid of an individual using one or more
antibodies specific to the polypeptide interest and (b) comparing
the level of gene expression with a standard gene expression level,
whereby an increase or decrease in the assayed polypeptide gene
expression level compared to the standard expression level is
indicative of aberrant expression.
[0387] The invention provides a diagnostic assay for diagnosing a
disorder, comprising (a) assaying the expression of the polypeptide
of interest in cells or body fluid of an individual using one or
more antibodies specific to the polypeptide interest and (b)
comparing the level of gene expression with a standard gene
expression level, whereby an increase or decrease in the assayed
polypeptide gene expression level compared to the standard
expression level is indicative of a particular disorder. With
respect to cancer, the presence of a relatively high amount of
transcript in biopsied tissue from an individual may indicate a
predisposition for the development of the disease, or may provide a
means for detecting the disease prior to the appearance of actual
clinical symptoms. A more definitive diagnosis of this type may
allow health professionals to employ preventative measures or
aggressive treatment earlier thereby preventing the development or
further progression of the cancer.
[0388] Antibodies of the invention can be used to assay protein
levels in a biological sample using classical irnumunohistological
methods known to those of skill in the art (e.g., see Jalkanen, et
al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, et al., J. Cell .
Biol. 105:3087-3096 (1987)). Other antibody-based methods useful
for detecting protein gene expression include immunoassays, such as
the enzyme linked immunosorbent assay (ELISA) and the
radioimmunoassay (RIA). Suitable antibody assay labels are known in
the art and include enzyme labels, such as, glucose oxidase;
radioisotopes, such as iodine (125I, 121I), carbon (14C), sulfur
(35S), tritium (3H), indium (112In), and technetium (99Tc);
luminescent labels, such as luminol; and fluorescent labels, such
as fluorescein and rhodamine, and biotin.
[0389] One aspect of the invention is the detection and diagnosis
of a disease or disorder associated with aberrant expression of a
polypeptide of interest in an animal, preferably a mammal and most
preferably a human. In one embodiment, diagnosis comprises: a)
administering (for example, parenterally, subcutaneously, or
intraperitoneally) to a subject an effective amount of a labeled
molecule which specifically binds to the polypeptide of interest;
b) waiting for a time interval following the administering for
permitting the labeled molecule to preferentially concentrate at
sites in the subject where the polypeptide is expressed (and for
unbound labeled molecule to be cleared to background level); c)
determining background level; and d) detecting the labeled molecule
in the subject, such that detection of labeled molecule above the
background level indicates that the subject has a particular
disease or disorder associated with aberrant expression of the
polypeptide of interest. Background level can be determined by
various methods including, comparing the amount of labeled molecule
detected to a standard value previously determined for a particular
system.
[0390] It will be understood in the art that the size of the
subject and the imaging system used will determine the quantity of
imaging moiety needed to produce diagnostic images. In the case of
a radioisotope moiety, for a human subject, the quantity of
radioactivity injected will normally range from about 5 to 20
millicuries of 99mTc. The labeled antibody or antibody fragment
will then preferentially accumulate at the location of cells which
contain the specific protein. In vivo tumor imaging is described in
S. W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled
Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging: The
Radiochemical Detection of Cancer, S. W. Burchiel and B. A. Rhodes,
eds., Masson Publishing Inc. (1982).
[0391] Depending on several variables, including the type of label
used and the mode of administration, the time interval following
the administration for permitting the labeled molecule to
preferentially concentrate at sites in the subject and for unbound
labeled molecule to be cleared to background level is 6 to 48 hours
or 6 to 24 hours or 6 to 12 hours. In another embodiment the time
interval following administration is 5 to 20 days or 5 to 10
days.
[0392] In an embodiment, monitoring of the disease or disorder is
carried out by repeating the method for diagnosing the disease or
disease, for example, one month after initial diagnosis, six months
after initial diagnosis, one year after initial diagnosis, etc.
[0393] Presence of the labeled molecule can be detected in the
patient using methods known in the art for in vivo scanning. These
methods depend upon the type of label used. Sldlled artisans will
be able to determine the appropriate method for detecting a
particular label. Methods and devices that may be used in the
diagnostic methods of the invention include, but are not limited
to, computed tomography (CT), whole body scan such as position
emission tomography (PET), magnetic resonance imaging (MRI), and
sonography.
[0394] In a specific embodiment, the molecule is labeled with a
radioisotope and is detected in the patient using a radiation
responsive surgical instrument (Thurston et al., U.S. Pat. No.
5,441,050). In another embodiment, the molecule is labeled with a
fluorescent compound and is detected in the patient using a
fluorescence responsive scanning instrument. In another embodiment,
the molecule is labeled with a positron emitting metal and is
detected in the patent using positron emission-tomography. In yet
another embodiment, the molecule is labeled with a paramagnetic
label and is detected in a patient using magnetic resonance imaging
(MRI).
[0395] The present invention provides kits that can be used in the
above methods. In one embodiment, a kit comprises an antibody of
the invention, preferably a purified antibody, in one or more
containers. In a specific embodiment, the kits of the present
invention contain a substantially isolated polypeptide comprising
an epitope which is specifically immunoreactive with an antibody
included in the kit. Preferably, the kits of the present invention
further comprise a control antibody which does not react with the
polypeptide of interest. In another specific embodiment, the kits
of the present invention contain a means for detecting the binding
of an antibody to a polypeptide of interest (e.g., the antibody may
be conjugated to a detectable substrate such as a fluorescent
compound, an enzymatic substrate, a radioactive compound or a
luminescent compound, or a second antibody which recognizes the
first antibody may be conjugated to a detectable substrate).
[0396] In another specific embodiment of the present invention, the
kit is a diagnostic kit for use in screening serum containing
antibodies specific against proliferative and/or cancerous
polynucleotides and polypeptides. Such a kit may include a control
antibody that does not react with the polypeptide of interest. Such
a kit may include a substantially isolated polypeptide antigen
comprising an epitope which is specifically immunoreactive with at
least one anti-polypeptide antigen antibody. Further, such a kit
includes means for detecting the binding of said antibody to the
antigen (e.g., the antibody may be conjugated to a fluorescent
compound such as fluorescein or rhodamine which can be detected by
flow cytometry). In specific embodiments, the kit may include a
recombinantly produced or chemically synthesized polypeptide
antigen. The polypeptide antigen of the kit may also be attached to
a solid support.
[0397] In a more specific embodiment the detecting means of the
above-described kit includes a solid support to which said
polypeptide antigen is attached. Such a kit may also include a
non-attached reporter-labeled anti-human antibody. In this
embodiment, binding of the antibody to the polypeptide antigen can
be detected by binding of the said reporter-labeled antibody.
[0398] In an additional embodiment, the invention includes a
diagnostic kit for use in screening serum containing antigens of
the polypeptide of the invention. The diagnostic kit includes a
substantially isolated antibody specifically immunoreactive with
polypeptide or polynucleotide antigens, and means for detecting the
binding of the polynucleotide or polypeptide antigen to the
antibody. In one embodiment, the antibody is attached to a solid
support. In a specific embodiment, the antibody may be a monoclonal
antibody. The detecting means of the kit may include a second,
labeled monoclonal antibody. Alternatively, or in addition, the
detecting means may include a labeled, competing antigen.
[0399] In one diagnostic configuration, test serumis reacted with a
solidphase reagent having a surface-bound antigen obtained by the
methods of the present invention. After binding with specific
antigen antibody to the reagent and removing unbound serum
components by washing, the reagent is reacted with reporter-labeled
anti-human antibody to bind reporter to the reagent in proportion
to the amount of bound anti-antigen antibody on the solid support.
The reagent is again washed to remove unbound labeled antibody, and
the amount of reporter associated with the reagent is determined.
Typically, the reporter is an enzyme which is detected by
incubating the solid phase in the presence of a suitable
fluorometric, luminescent or colorimetric substrate (Sigma, St.
Louis, Mo.).
[0400] The solid surface reagent in the above assay is prepared by
known techniques for attaching protein material to solid support
material, such as polymeric beads, dip sticks, 96-well plate or
filter material. These attachment methods generally include
non-specific adsorption of the protein to the support or covalent
attachment of the protein, typically through a free amine group, to
a chemically reactive group on the solid support, such as an
activated carboxyl, hydroxyl, or aldehyde group. Alternatively,
streptavidin coated plates can be used in conjunction with
biotinylated antigen(s).
[0401] Thus, the invention provides an assay system or kit for
carrying out this diagnostic method. The kit generally includes a
support with surface-bound recombinant antigens, and a
reporter-labeled anti-human antibody for detecting surface-bound
anti-antigen antibody.
Treatment of T1R-like Ligand II Disorders
[0402] The invention provides methods of treatment, inhibition and
prophylaxis by administration to a subject of an effective amount
of a compound or pharmaceutical composition of the invention. In a
preferred aspect, the compound is substantially purified (e.g.,
substantially free from substances that limit its effect or produce
undesired side-effects). The subject is preferably an animal,
including but not limited to animals such as cows, pigs, horses,
chickens, cats, dogs, etc., and is preferably a mammal, and most
preferably human.
[0403] It is believed by the present inventors that T1R-like ligand
II polypeptides of the present invention share biological
activities with interleukin-1 (IL-1) and the T1R ligand. Thus, the
T1R-like ligand II polypeptide, antibody, antagonist, agonist,
protein, or fragment or variant thereof, can be exogenously added
to cells, tissues, or the body of an individual to produce a
therapeutic effect. In particular, disorders caused by a decrease
in the standard level of T1R-like ligand II protein activity can be
treated by administering an effective amount of a T1R-like ligand
II polypeptide or agonist of the invention. Preferably, a
pharmaceutical composition is administered comprising an amount of
an isolated T1R-like ligand II polypeptide or agonist of the
invention effective to increase the T1R-like ligand II protein
activity. Disorders where such a therapy would likely be effective
are discussed above and herein.
[0404] As shown below in Example 18, T1R-like ligand II stimulates
proliferation of CD34+ cells. Thus, it is expected that T1R-like
ligand II will stimulate other hematopoietic stem cells and cells
originating from hematopoietic stem cells.
[0405] A hematopoietic stem cell is a developmentally multipotent
stem cell found in hematopoietic, or blood-forming tissue. It has
the potential to mature into a mature blood cell through synergism
between lineage-specific and multilineage growth factors. Tissues
containing hematopoietic cells are found in various body locations
including for example, bone marrow, spleen, and thymus. In the
process of hematopoiesis, distinct populations of progenitor cells
arise from more primitive, undifferentiated stem cells. Subsequent
developmental eventually results in differentiation of mature
classes of blood cells (for example, granulocytes, monocytes,
eosinophils, megakaryocytes, and mast cells) from progenitor
cells.
[0406] One of ordinary skill will appreciate that effective amounts
of a T1R-like ligand II polynucleotide, polypeptide, antibody,
antagonist, agonist, or fragment or variant thereof can be
determined empirically for each condition where administration of a
such is indicated. The polypeptide having T1R-like ligand II
activity or antibody, agonist, antagonist, or fragment or variant
thereof modulating such activity, can be administered in
pharmaceutical compositions in combination with one or more
pharmaceutically acceptable carriers, diluents and/or excipients.
It will be understood that, when administered to a human patient,
the total daily usage of the pharmaceutical compositions of the
present invention will be decided by the attending physician within
the scope of sound medical judgment. The specific therapeutically
effective dose level for any particular patient will depend upon a
variety of factors including the type and degree of the response to
be achieved; the specific composition an other agent, if any,
employed; the age, body weight, general health, sex and diet of the
patient; the time of administration, route of administration, and
rate of excretion of the composition; the duration of the
treatment; drugs (such as a chemotherapeutic agent) used in
combination or coincidental with the specific composition; and like
factors well known in the medical arts.
[0407] The T1R-like ligand II composition to be used in the therapy
will also be fornulated and dosed in a fashion consistent with good
medical practice, taking into account the clinical condition of the
individual patient (especially the side effects of treatment with
T1R-like ligand II alone), the site of delivery of the T1R-like
ligand II composition, the method of administration, the scheduling
of administration, and other factors known to practitioners. An
"effective amount" of a T1R-like ligand II polypeptide for purposes
herein is thus determined by such considerations. The composition,
if desired, can also contain minor amounts of wetting or
emulsifying agents, or pH buffering agents. These compositions can
take the form of solutions, suspensions, emulsion, tablets, pills,
capsules, powders, sustained-release formulations and the like.
[0408] T1R-Like ligand II polynucleotides and polypeptides of the
invention maybe used in developing treatments for any disorder
mediated (directly or indirectly) by defective, or insufficient
amounts of T1R-Like ligand II. T1R-Like ligand II polypeptides may
be administered to a patient (e.g., mammal, preferably human)
afflicted with such a disorder. Alternatively, a gene therapy
approach maybe applied to treat such disorders. Disclosure herein
of T1R-Like ligand II nucleotide sequences permits the detection of
defective T1R-Like ligand II genes, and the replacement thereof
with normal T1R-Like ligand II encoding genes. Defective genes may
be detected in in vitro diagnostic assays, and by comparison of the
T1R-Like ligand II nucleotide sequence disclosed herein with that
of a T1R-Like ligand II gene derived from a patient suspected of
harboring a defect in this gene.
[0409] In another embodiment, the polypeptides of the present
invention are used as a research tool for studying the biological
effects that result from inhibiting T1R-Like ligand II ligand
interactions on different cell types. T1R-Like ligand II
polypeptides also may be employed in in vitro assays for detecting
T1R-Like ligand II or T1R-Like ligand II ligand or the interactions
thereof.
[0410] T1R-Like ligand II polynucleotides or polypeptides, or
agonists or antagonists of T1R-Like ligand II, may be useful in
treating deficiencies or disorders of the immune system, by
activating or inhibiting the proliferation, differentiation, or
mobilization (chemotaxis) of immune cells. Immune cells develop
through a process called hematopoiesis, producing myeloid
(platelets, red blood cells, neutrophils, and macrophages) and
lymphoid (B and T lymphocytes) cells from pluripotent stem cells.
The etiology of these immune deficiencies or disorders may be
genetic, somatic, such as cancer or some autoimmune disorders,
acquired (e.g., by chemotherapy or toxins), or infectious.
Moreover, T1R-Like ligand JI polynucleotides or polypeptides, or
agonists or antagonists of T1R-Like ligand II, can be used as a
marker or detector of a particular immune system disease or
disorder. It is believed that T1R-like ligand II stimulates
proliferation and/or differentiation of cells of hematopoietic
origin, eg. myeloid (platelets, red blood cells, neutrophils, and
macrophages) and lymphoid (B and T lymphocytes) cells. As shown
below, T1R-like ligand II polypeptides can be used to stimulate the
proliferation of CD34+ cells.
[0411] By the invention, disorders caused by enhanced levels of
T1R-like ligand II protein activity can be treated by administering
an effective amount of an antagonist of a T1R-like ligand II
polypeptide of the invention. Therefore, antibodies (preferably
monoclonal) or antibody fragments that bind a T1R-like ligand II
polypeptide of the present invention are useful in treating
T1R-like ligand II-related disorders as are soluble T1R-like ligand
II proteins, such as the extracellular domain, which competes with
the intact protein for binding to the T1R-like ligand II receptor.
Such antibodies and/or soluble T1R-like ligand II proteins are
preferably provided in pharmaceutically acceptable
compositions.
[0412] The antibodies described herein may be advantageously
utilized in combination with other monoclonal or chimeric
antibodies, or with lymphokines or hemopoietic growth factors,
etc., which serve to increase the number or activity of effector
cells which interact with the antibodies.
[0413] T1R-Like ligand II polynucleotides or polypeptides, or
agonists or antagonists of T1R-Like ligand II, may be useful in
treating or detecting deficiencies or disorders of hematopoietic
cells. T1R-Like Ligand II polynucleotides or polypeptides, or
agonists or antagonists of T1R-Like Ligand II, could be used to
increase differentiation and proliferation of hematopoietic cells,
including the pluripotent stem cells, in an effort to treat those
disorders associated with a decrease in certain (or many) types
hematopoietic cells. Examples of immunologic deficiency syndromes
include, but are not limited to: blood protein disorders (e.g.
agammaglobulinemia, dysgammaglobulinemia), ataxia telangiectasia,
common variable immunodeficiency, Digeorge Syndrome, HIV infection,
HTLV-BLV infection, leulocyte adhesion deficiency syndrome,
lymphopenia, phagocyte bactericidal dysfunction, severe combined
immunodeficiency (SCIDs), Wiskott-Aldrich Disorder, anemia,
thrombocytopenia, or hemoglobinuria.
[0414] In a specific embodiment, polynucleotides and/or
polypeptides of the invention and/or angonists and/or antagonists
thereof may be used to increase the concentration of blood cells in
individuals in need of such increase (i.e., in hematopoietin
therapy). Conditions that may be ameliorated by administering the
compositions of the invention include, but are not limited to,
neutropenia, anemia, and thrombocytopenia.
[0415] In a specific embodiment, the polynucleotides and/or
polypeptides of the invention (and/or agonists or antagonists
thereof) are used in erythropoietin therapy, which is directed
toward supplementing the oxygen carrying capacity of blood.
Polynucleotides and/or polypeptides of the invention (and/or
agonists or antagonists thereof) maybe used to treat or prevent
diseases or conditions in patients generally requiring blood
transfusions, such as, for example, trauma victims, surgical
patients, dialysis patients, and patients with a variety of blood
composition-affecting disorders, such as, for example, hemophilia,
cystic fibrosis, pregnancy, menstrual disorders, early anemia of
prematurity, spinal cord injury, aging, various neoplastic disease
states, and the like. Examples of patient conditions that require
supplementation of the oxygen carrying capacity of blood and which
are within the scope of this invention, include, but are not
limited to: treatment of blood disorders characterized by low or
defective red blood cell production, anemia associated with chronic
renal failure, stimulation of reticulocyte response, development of
ferrokinetic effects (such as plasma iron turnover effects and
marrow transit time effects), erythrocyte mass changes, stimulation
of hemoglobin C synthesis, and increasing levels of hematocrit in
vertebrates. The invention also provides for treatment to enhance
the oxygen-carrying capacity of an individual, such as for example,
an individual encountering hypoxic environmental conditions.
[0416] As further described herein, the a polypeptide,
polynucleotide, agonist, or antagonist of the present invention may
be employed to stimulate growth and differentiation of
hematopoietic cells and bone marrow cells either when used alone or
when used in combination with other cytokines.
[0417] The polynucleotides and/or polypeptides of the invention
and/or agonists and/or antagonists thereof can also be employed to
inhibit the proliferation and differentiation of hematopoietic
cells and therefore may be employed to protect bone marrow stem
cells from chemotherapeutic agents during chemotherapy. This
antiproliferative effect may allow administration of higher doses
of chemotherapeutic agents and, therefore, more effective
chemotherapeutic treatment.
[0418] The polynucleotides and/or polypeptides of the invention
and/or agonists and/or antagonists thereof may also be employed for
the expansion of immature hematopoeitic progenitor cells, for
example, granulocytes, macrophages or monocytes, by temporarily
preventing their differentiation. These bone marrow cells may be
cultured in vitro. Thus, T1R-Like ligand II polypeptides,
polynucleotides, or agonists or antagonists thereof, may be useful
as a modulator of hematopoietic stem cells in vitro for the purpose
of bone marrow transplantation and/or gene therapy. Since stem
cells are rare and are most useful for introducing genes into for
gene therapy, T1R-Like ligand II can be used to isolate enriched
populations of stem cells. Stem cells can be enriched by culturing
cells in the presence of cytotoxins, such as 5-Fu, which kills
rapidly dividing cells, where as the stem cells will be protected
by T1R-Like Ligand II. These stem cells can be returned to a bone
marrow transplant patient or can then be used for transfection of
the desired gene for gene therapy. In addition, T1R-like ligand II
can be injected into animals which results in the release of stem
cells from the bone marrow of the animal into the peripheral blood.
These stem cells can be isolated for the purpose of autologous bone
marrow transplantation or manipulation for gene therapy. After the
patient has finished chemotherapy or radiation treatment, the
isolated stem cells can be returned to the patient.
[0419] T1R-like ligand II also may have a role in vesicle
trafficking, and thus may be associated with disorders of abnormal
vesicle trafficking, including endocrine, secretory, inflammatory,
and gastrointestinal disorders, and in the development of cancers,
particularly those involving secretory and gastrointestinal
tissues.
[0420] Therefore, in one embodiment, T1R-like ligand II
polynucleotides, polypeptides, antibodies, agonists, antagonists
and/or fragments or variants thereof may be administered to a
subject to treat disorders associated with abnormal vesicle
trafficking. Such disorders may include, but are not limited to,
glucose-galactose malabsorption syndrome, hypercholesterolemia,
diabetes insipidus, hyper- and hypoglycemia, goiter, Cushing's
disease; gastrointestinal disorders including ulcerative colitis,
gastric and duodenal ulcers; and other conditions associated with
abnormal vesicle trafficking including allergies including hay
fever; osteoarthritis; and Chediak-Higashi syndrome.
[0421] Cancer cells secrete excessive amounts of hormones or other
biologically active peptides. Therefore, in another embodiment,
polynucleotides, polypeptides, antibodies, agonists, antagonists
and/or fragments or variants thereof of T1R-like ligand II may be
administered to a subject to treat or prevent cancer, including,
but not limited to, cancers of glands, tissues, and organs involved
in secretion or absorption, including prostate, pancreas, lung,
tongue, brain, breast, bladder, adrenal gland, thyroid, liver,
uterus, kidney, testes, and organs of the gastrointestinal tract
including small intestine, colon, rectum, and stomach. In
particular, antibodies which are specific for T1R-like ligand II
may be used directly as an antagonist, or indirectly as a targeting
or delivery mechanism for bringing a pharmaceutical agent to cells
or tissue which express T1R-like ligand II. Additional preferred
embodiments of the invention include, but are not limited to, the
use of T1R-like ligand II polynucleotides, polypeptides, and
functional agonists thereof, in the following applications:
[0422] Administration to an animal (e.g., mouse, rat, rabbit,
hamster, guinea pig, pigs, micro-pig, chicken, camel, goat, horse,
cow, sheep, dog, cat, non-human primate, and human, most preferably
human) to boost the immune system to produce increased quantities
of one or more antibodies (e.g., IgG, IgA, IgM, and IgE), to induce
higher affinity antibody production (e.g., IgG, IgA, IgM, and IgE),
and/or to increase an immune response.
[0423] Administration to an animal (including, but not limited to,
those listed above, and also including transgenic animals)
incapable of producing functional endogenous antibody molecules or
having an otherwise compromised endogenous immune system, but which
is capable of producing human immunoglobulin molecules by means of
a reconstituted or partially reconstituted immune system from
another animal (see, e.g., published PCT Application Nos.
WO98/24893, WO/9634096, WO/9633735, and WO/9110741.
[0424] A vaccine adjuvant that enhances immune responsiveness to
specific antigen. In a specific embodiment, the vaccine adjuvant is
a polypeptide described herein. In another specific embodiment, the
vaccine adjuvant is a polynucleotide described herein (i.e., the
polynucleotide is a genetic vaccine adjuvant). As discussed herein,
polynucleotides may be administered using techniques known in the
art, including but not limited to, liposomal delivery, recombinant
vector delivery, injection of naked DNA, and gene gun delivery.
[0425] An adjuvant to enhance tumor-specific immune responses.
[0426] An adjuvant to enhance anti-viral immune responses.
Anti-viral immune responses that may be enhanced using the
compositions of the invention as an adjuvant, include virus and
virus associated diseases or symptoms described herein or otherwise
known in the art. In specific embodiments, the compositions of the
invention are used as an adjuvant to enhance an immune response to
a virus, disease, or symptom selected from the group consisting of:
AIDS, meningitis, Dengue, EBV, and hepatitis (e.g., hepatitis B).
In another specific embodiment, the compositions of the invention
are used as an adjuvant to enhance an immune response to a virus,
disease, or symptom selected from the group consisting of:
HIV/AIDS, Respiratory syncytial virus, Dengue, Rotavirus, Japanese
B encephalitis, Influenza A and B, Parainfluenza, Measles,
Cytomegalovirus, Rabies, Junin, Chikangunya, Rift Valley fever,
Herpes simplex, and yellow fever. In another specific embodiment,
the compositions of the invention are used as an adjuvant to
enhance an immune response to the HIV gp120 antigen.
[0427] An adjuvant to enhance anti-bacterial or anti-fungal immune
responses. Anti-bacterial or anti-fungal immune responses that may
be enhanced using the compositions of the invention as an adjuvant,
include bacteria or fungus and bacteria or fungus associated
diseases or symptoms described herein or otherwise known in the
art. In specific embodiments, the compositions of the invention are
used as an adjuvant to enhance an immune response to a bacteria or
fungus, disease, or symptom selected from the group consisting of:
tetanus, Diphtheria, botulism, and meningitis type B. In another
specific embodiment, the compositions of the invention are used as
an adjuvant to enhance an immune response to a bacteria or fungus,
disease, or symptom selected from the group consisting of: Vibrio
cholerae, Mycobacterium leprae, Salmonella typhi, Salmonella
paratyphi, Meisseria meningitidis, Streptococcus pneumoniae, Group
B streptococcus, Shigella spp., Enterotoxigenic Escherichia coli,
Enterohemorrhagic E. coli, Borrelia burgdorferi, and Plasmodium
(malaria).
[0428] An adjuvant to enhance anti-parasitic immune responses.
Anti-parasitic immune responses that may be enhanced using the
compositions of the invention as an adjuvant, include parasite and
parasite associated diseases or symptoms described herein or
otherwise known in the art. In specific embodiments, the
compositions of the invention are used as an adjuvant to enhance an
immune response to a parasite. In another specific embodiment, the
compositions of the invention are used as an adjuvant to enhance an
immune response to Plasmodium (malaria).
[0429] As a stimulator of B cell responsiveness to pathogens.
[0430] As an agent that elevates the immune status of an individual
prior to their receipt of immunosuppressive therapies.
[0431] As an agent to induce higher affinity antibodies.
[0432] As an agent to increase serum immunoglobulin
concentrations.
[0433] As an agent to accelerate recovery of immunocompromised
individuals.
[0434] As an agent to boost immunoresponsiveness among aged
populations.
[0435] As an immune system enhancer prior to, during, or after bone
marrow transplant and/or other transplants (e.g., allogeneic or
xenogeneic organ transplantation). With respect to transplantation,
compositions of the invention may be administered prior to,
concomitant with, and/or after transplantation. In a specific
embodiment, compositions of the invention are administered after
transplantation, prior to the beginning of recovery of T-cell
populations. In another specific embodiment, compositions of the
invention are first administered after transplantation after the
beginning of recovery of T cell populations, but prior to full
recovery of B cell populations.
[0436] As an agent to boost immunoresponsiveness among
immunodeficient individuals. B cell immunodeficiencies that may be
ameliorated or treated by administering the polypeptides or
polynucleotides of the invention, or agonists thereof, include, but
are not limited to, severe combined immunodeficiency (SCID)-X
linked, SCID-autosomal, adenosine deaminase deficiency (ADA
deficiency), X-linked agammaglobulinemia (XLA), Bruton's disease,
congenital agammaglobulinemia, X-linked infantile
agammaglobulinemia, acquired agammaglobulinemia, adult onset
agammaglobulinemia, late-onset agammaglobulinemia,
dysgammaglobulinemia, hypogammaglobulinemia, transient
hypogammaglobulinemia of infancy, unspecified
hypogammaglobulinemia, agammaglobulinemia, common variable
immunodeficiency (CVI) (acquired), Wiskott-Aldrich Syndrome (WAS),
X-linked immunodeficiency with hyper IgM, non X-linked
immunodeficiency with hyper IgM, selective IgA deficiency, IgG
subclass deficiency (with or without IgA deficiency), antibody
deficiency with normal or elevated Igs, immunodeficiency with
thymoma, Ig heavy chain deletions, kappa chain deficiency, B cell
lymphoproliferative disorder (BLPD), selective IgM
immunodeficiency, recessive agammaglobulinemia (Swiss type),
reticular dysgenesis, neonatal neutropenia, severe congenital
leukopenia, thymic alymophoplasia-aplasia or dysplasia with
immunodeficiency, ataxia-telangiectasia, short limbed dwarfism,
X-linked lymphoproliferative syndrome (XLP), Nezelof
syndrome-combined immunodeficiency with Igs, purine nucleoside
phosphorylase deficiency (PNP), MHC Class II deficiency (Bare
Lymphocyte Syndrome) and severe combined immunodeficiency.
[0437] In a specific embodiment, polypeptides or polynucleotides of
the invention, or agonists thereof is administered to treat or
ameliorate selective IgA deficiency. In another specific
embodiment, polypeptides or polynucleotides of the invention, or
agonists thereof, is administered to treat or ameliorate
ataxia-telangiectasia. In another specific embodiment, polypetides
or polynucleotides of the invention, or agonists thereof, is
administered to treat or ameliorate common variable
immunodeficiency. In another specific embodiment, polypeptides or
polynucleotides of the invention, or agonists thereof, is
administered to treat or ameliorate X-linked agammaglobulinemia. In
another specific embodiment, polypeptides or polynucleotides of the
invention, or agonists thereof, is administered to treat or
ameliorate severe combined immunodeficiency (SCID). In another
specific embodiment, polypeptides or polynucleotides of the
invention, or agonists thereof, is administered to treat or
ameliorate Wiskott-Aldrich syndrome. In another specific
embodiment, polypeptides or polynucleotides of the invention, or
agonists thereof, is administered to treat or ameliorate severe
combined immunodeficiency (SCID). In another specific embodiment,
polypeptides or polynucleotides of the invention, or agonists
thereof, is administered to treat or ameliorate X-linked Ig
deficiency with hyper IgM. T cell immunodeficiencies that may be
ameliorated or treated by administering the polypeptides or
polynucleotides of the invention, or agonists thereof, include, but
are not limited to, DiGeorge anomaly (thymic hypoplasia), chronic
mucocutaneous candidiasis, natural killer cell deficiency,
idiopathic CD4+ T4ymphocytopenia, immunodeficiency with predominant
T-cell defect, and unspecified immunodeficiency of cell mediated
immunity.
[0438] Phagocyte disorder related immunodeficiencies that may be
ameliorated or treated by administering the polypeptides or
polynucleotides of the invention, or agonists thereof, include, but
are not limited to, Hyperimmunoglobulinemia E syndrome (HIE),
leukocyte adhesion defect type 1, chronic granulomatous disease,
neutrophil G6PD deficiency, Chediak-Higashi syndrome, splenic
deficiency syndromes, and myeloperoxidase deficiency. Complement
disorder related immunodeficiencies that may be ameliorated or
treated by administering the polypeptides or polynucleotides o the
invention, or agonists thereof, include, but are not limited to, 1q
deficiency, C1-C9 deficiencies, and C2 deficiencies
[0439] As an agent to boost immunoresponsiveness among individuals
having an acquired loss of B cell and/or T cell function.
Conditions resulting in an acquired loss of B cell function that
may be ameliorated or treated by administering the polypeptides or
polynucleotides of the invention, or agonists thereof, include, but
are not limited to, HIV Infection, AIDS, bone marrow transplant,
and B cell chronic lymphocytic leukemia (CLL).
[0440] As an agent to boost immunoresponsiveness among individuals
having a temporary immune deficiency. Conditions resulting in a
temporary immune deficiency that may be ameliorated or treated by
administering the polypeptides or polynucleotides of the invention,
or agonists thereof, include, but are not limited to, recovery from
viral infections (e.g., influenza), conditions associated with
malnutrition, recovery from infectious mononucleosis, or conditions
associated with stress, recovery from measles, recovery from blood
transfusion, recovery from surgery.
[0441] As a regulator of antigen presentation by monocytes,
dendritic cells, T cells and/or B-cells. In one embodiment,
polypeptides (in soluble, membrane-bound or transmembrane forms) or
polynucleotides enhance antigen presentation or antagonize antigen
presentation in vitro or in vivo. Moreover, in related embodiments,
said enhancement or antagonization of antigen presentation may be
useful as an anti-tumor treatment or to modulate the immune
system.
[0442] As an agent to direct an individuals immune system towards
development of a humoral response (i.e. TH2) as opposed to a TH1
cellular response.
[0443] As a means to induce tumor proliferation and thus make it
more susceptible to anti-neoplastic agents. For example, multiple
myeloma is a slowly dividing disease and is thus refractory to
virtually all anti-neoplastic regimens. If these cells were forced
to proliferate more rapidly their susceptibility profile would
likely change.
[0444] As B cell, monocytic cell, and/or T cell specific binding
protein to which specific activators or inhibitors of cell growth
may be attached. The result would be to focus the activity of such
activators or inhibitors onto normal, diseased, or neoplastic cell
populations.
[0445] As a stimulator of B cell production in pathologies such as
AIDS, chronic lymphocyte disorder and/or Common Variable
Immunodificiency;
[0446] As a therapy for generation and/or regeneration of lymphoid
tissues following surgery, trauma or genetic defect.
[0447] As a gene-based therapy for genetically inherited disorders
resulting in immuno-incompetence such as observed among SCID
patients.
[0448] As an antigen for the generation of antibodies to inhibit or
enhance T1R-like ligand II mediated responses.
[0449] As a means of activating monocytes/macrophages to defend
against parasitic diseases that effect monocytes such as
Leshmania.
[0450] As pretreatment of bone marrow samples prior to transplant.
Such treatment would increase B cell and/or T cell representation
and thus accelerate recovery.
[0451] As a means of regulating secreted cytokines that are
elicited by T1R-like ligand II.
[0452] As a means to modulate IgE concentrations in vitro or in
vivo. Additionally, T1R-like ligand II polypeptides or
polynucleotides of the invention, or agonists thereof, may be used
to treat or prevent IgE-mediated allergic reactions. Such allergic
reactions include, but are not limited to, asthma, rhinitis, and
eczema.
[0453] All of the above described applications as they may apply to
veterinary medicine.
[0454] Antagonists of T1R-like ligand II include binding and/or
inhibitory antibodies, antisense nucleic acids, ribozymes or
soluble forms of the T1R-like ligand II receptor(s). These would be
expected to reverse many of the activities of the ligand described
above as well as find clinical or practical application as:
[0455] A means of blocking various aspects of immune responses to
foreign agents or self. Examples include autoimmune disorders such
as lupus, and arthritis, as well as immunoresponsiveness to skin
allergies, inflammation, bowel disease, injury and pathogens.
[0456] A therapy for preventing the B cell proliferation and/or Ig
secretion associated with autoimmune diseases such as idiopathic
thrombocytopenic purpura, systemic lupus erythramatosus and MS.
[0457] An inhibitor of graft versus host disease or transplant
rejection.
[0458] A therapy for B cell T cell and/or monocyitic malignancies,
such as, for example, ALL, Hodgkins disease, non-Hodgkins lymphoma,
Chronic lymphocyte leukemia, plasmacytomas, multiple myeloma,
Burditt's lymphoma, and EBV-transformed diseases.
[0459] A therapy for chronic hypergammaglobulinemeia evident in
such diseases as monoclonalgammopathy of undetermined significance
(MGUS), Waldenstrom's disease, related idiopathic
monoclonalgammopathies, and plasmacytomas.
[0460] A therapy for decreasing cellular proliferation of Large
B-cell Lymphomas.
[0461] A means of decreasing the involvement of B cells and Ig
associated with Chronic Myelogenous Leukemia.
[0462] An immunosuppressive agent(s).
[0463] T1R-like ligand II polypeptides or polynucleotides of the
invention, or antagonists maybe used to modulate IgE concentrations
in vitro or in vivo. In another embodiment, administration
ofpolypeptides or polynucleotides of the invention, or antagonists
thereof, may be used to treat or prevent IgE-mediated allergic
reactions including, but not limited to, asthma, rhinitis, and
eczema.
[0464] The above-recited applications have uses in a wide variety
of hosts. Such hosts include, but are not limited to, human,
murine, rabbit, goat, guinea pig, camel, horse, mouse, rat,
hamster, pig, micro-pig, chicken, goat, cow, sheep, dog, cat,
non-human primate, and human. In specific embodiments, the host is
a mouse, rabbit, goat, guinea pig, chicken, rat, hamster, pig,
sheep, dog or cat. In preferred embodiments, the host is a mammal.
In most preferred embodiments, the host is a human.
[0465] The agonists and antagonists may be employed in a
composition with a pharmaceutically acceptable carrier, e.g., as
described above.
[0466] The antagonists may be employed for instance to inhibit the
chemotaxis and activation of macrophages and their precursors, and
of neutrophils, basophils, B lymphocytes and some T-cell subsets,
e.g., activated and CD8 cytotoxic T cells and natural killer cells,
in certain auto-immune and chronic inflammatory and infective
diseases. Examples of auto-immune diseases include multiple
sclerosis, and insulin-dependent diabetes. The antagonists may also
be employed to treat infectious diseases including silicosis,
sarcoidosis, idiopathic pulmonary fibrosis by preventing the
recruitment and activation of mononuclear phagocytes. They may also
be employed to treat idiopathic hyper-eosinophilic syndrome by
preventing eosinophil production and migration. Endotoxic shock may
also be treated by the antagonists by preventing the migration of
macrophages and their production of the polypeptides of the present
invention. The antagonists may also be employed for treating
atherosclerosis, by preventing monocyte infiltration in the artery
wall. The antagonists may also be employed to treat
histamine-mediated allergic reactions and immunological disorders
including late phase allergic reactions, chronic urticaria, and
atopic dermatitis by inhibiting chemokine-induced mast cell and
basophil degranulation and release of histamine.
[0467] IgE-mediated allergic reactions such as allergic asthma,
rhinitis, and eczema may also be treated. The antagonists may also
be employed to treat chronic and acute inflammation by preventing
the attraction of monocytes to a wound area. They may also be
employed to regulate normal pulmonary macrophage populations, since
chronic and acute inflammatory pulmonary diseases are associated
with sequestration of mononuclear phagocytes in the lung.
Antagonists may also be employed to treat rheumatoid arthritis by
preventing the attraction of monocytes into synovial fluid in the
joints of patients. Monocyte influx and activation plays a
significant role in the pathogenesis of both degenerative and
inflammatory arthropathies. The antagonists may be employed to
interfere with the deleterious cascades attributed primarily to
IL-1 and TNF, which prevents the biosynthesis of other inflammatory
cytokines. In this way, the antagonists may be employed to prevent
inflammation. The antagonists may also be employed to inhibit
prostaglandin-independent fever induced by. The antagonists may
also be employed to treat cases of bone marrow failure, for
example, a plastic anemia and myelodysplastic syndrome. The
antagonists may also be employed to treat asthma and allergy by
preventing eosinophil accumulation in the lung. The antagonists may
also be employed to treat subepithelial basement membrane fibrosis
which is a prominent feature of the asthmatic lung. The antagonists
may also be employed to treat lymphomas (e.g., one or more of the
extensive, but not limiting, list of lymphomas provided
herein).
[0468] Moreover, T1R-Like Ligand II polynucleotides or
polypeptides, or agonists or antagonists of T1R-Like Ligand II, can
also be used to modulate hemostatic (the stopping of bleeding) or
thrombolytic activity (clot formation). For example, by increasing
hemostatic or thrombolytic activity, T1R-Like Ligand II
polynucleotides or polypeptides, or agonists or antagonists of
T1R-Like Ligand II, could be used to treat blood coagulation
disorders (e.g., afibrinogenemia, factor deficiencies), blood
platelet disorders (e.g. thrombocytopenia), or wounds resulting
from trauma, surgery, or other causes. Alternatively, T1R-Like
Ligand II polynucleotides or polypeptides, or agonists or
antagonists of T1R-Like Ligand II, that can decrease hemostatic or
thrombolytic activity could be used to inhibit or dissolve
clotting. These molecules could be important in the treatment of
heart attacks (infarction), strokes, or scarring.
[0469] T1R-Like Ligand II polynucleotides or polypeptides, or
agonists or antagonists of T1R-Like Ligand II, may also be useful
in treating or detecting autoimmune disorders. Many autoimmune
disorders result from inappropriate recognition of self as foreign
material by immune cells. This inappropriate recognition results in
an immune response leading to the destruction of the host tissue.
Therefore, the administration of T1R-Like Ligand II polynucleotides
or polypeptides, or agonists or antagonists of T1R-Like Ligand II,
that can inhibit an immune response, particularly the
proliferation, differentiation, or chemotaxis of T-cells, may be an
effective therapy in treating or preventing autoinmune disorders or
conditions associated with these disorders.
[0470] Examples of autoimmune disorders that can be treated,
prevented or detected using compositions of the invention include,
but are not limited, autoimmune diseases such as, for example,
autoimmune hemolytic anemia, autoimmune neonatal thrombocytopenia,
autoimmunocytopenia, hemolytic anemia, antiphospholipid syndrome,
dermatitis, allergic encephalomyelitis, glomerulonephritis,
Multiple Sclerosis, Neuritis, Ophthalmia, Polyendocrinopathies,
Purpura, Reiter's Disease, Stiff-Man Syndrome, Autoimmune Pulmonary
Inflammation, Guillain-Barre Syndrome, insulin dependent diabetes
mellitis, and autoimmune inflammatory eye disease.
[0471] Additional autoimmune disorders that can be treated, prevent
edordetectedusing compositions of the invention include, but are
not limited to, autoimmune thyroiditis (i.e., Hashimoto's
thyroiditis) (often characterized, e.g., by cell-mediated and
humoral thyroid cytotoxicity), systemic lupus erhthematosus (often
characterized, e.g., by circulating and locally generated immune
complexes), Goodpasture's syndrome (often characterized, e.g., by
anti-basement membrane antibodies), Pemphigus (often characterized,
e.g., by epidermal acantholytic antibodies), Receptor
autoimmunities such as, for example, (a) Graves' Disease (often
characterized, e.g., by TSH receptor antibodies), (b) Myasthenia
Gravis (often characterized, e.g., by acetylcholine receptor
antibodies), and (c) insulin resistance (often characterized, e.g.,
by insulin receptor antibodies), autoimmune hemolytic anemia (often
characterized, e.g., by phagocytosis of antibody-sensitized RBCs),
autoimmune thrombocytopenic purpura (often characterized, e.g., by
phagocytosis of antibody-sensitized platelets.
[0472] Additional autoimmune disorders that can be treated,
prevented or detected using compositions of the invention include,
but are not limited to, rheumatoid arthritis (often characterized,
e.g., by immune complexes in joints), scleroderma with
anti-collagen antibodies (often characterized, e.g., by nucleolar
and other nuclear antibodies), mixed connective tissue disease
(often characterized, e.g., by antibodies to extractable nuclear
antigens (e.g., ribonucleoprotein)), polymyositis (often
characterized, e.g., by nonhistone ANA), pernicious anemia (often
characterized, e.g., by antiparietal cell, microsomes, and
intrinsic factor antibodies), idiopathic Addison's disease (often
characterized, e.g., by humoral and cell-mediated adrenal
cytotoxicity, infertility (often characterized, e.g., by
antispermatozoal antibodies), glomerulonephritis (often
characterized, e.g., by glomerular basement membrane antibodies or
immune complexes), bullous pemphigoid (often characterized, e.g.,
by IgG and complement in basement membrane), Sjogren's syndrome
(often characterized, e.g., by multiple tissue antibodies, and/or a
specific nonhistone ANA (SS-B)), diabetes millitus (often
characterized, e.g., by cell-mediated and humoral islet cell
antibodies), and adrenergic drug resistance (including adrenergic
drug resistance with asthma or cystic fibrosis) (often
characterized, e.g., by beta-adrenergic receptor antibodies).
[0473] Additional autoimmune disorders that can be treated,
prevented or detected using compositions of the invention include,
but are not limited to, chronic active hepatitis (often
characterized, e.g., by smooth muscle antibodies), primary biliary
cirrhosis (often characterized, e.g., by mitchondrial antibodies),
other endocrine gland failure (often characterized, e.g., by
specific tissue antibodies in some cases), vitiligo (often
characterized, e.g., by melanocyte antibodies), vasculitis (often
characterized, e.g., by Ig and complement in vessel walls and/or
low serum complement), post-MI (often characterized, e.g., by
myocardial antibodies), cardiotomy syndrome (often characterized,
e.g., by myocardial antibodies), urticaria (often characterized,
e.g., by IgG and IgM antibodies to IgE), atopic dermatitis (often
characterized, e.g., by IgG and IgM antibodies to IgE), asthma
(often characterized, e.g., by IgG and IgM antibodies to IgE), and
many other inflammatory, granulamatous, degenerative, and atrophic
disorders.
[0474] In a preferred embodiment, the autoimmune diseases and
disorders and/or conditions associated with the diseases and
disorders recited above are treated, prevented, and/or diagnosed
using anti-T1R-Like Ligand II.
[0475] Similarly, allergic reactions and conditions, such as asthma
(particularly allergic asthma) or other respiratory problems, may
also be treated by T1R-Like Ligand II polynucleotides or
polypeptides, or agonists or antagonists of T1R-Like Ligand II.
Moreover, these molecules can be used to treat anaphylaxis,
hypersensitivity to an antigenic molecule, or blood group
incompatibility.
[0476] T1R-Like Ligand II polynucleotides or polypeptides, or
agonists or antagonists of T1R-Like Ligand II, may also be used to
treat and/or prevent organ rejection or graft-versus-host disease
(GVHD). Organ rejection occurs by host immune cell destruction of
the transplanted tissue through an immune response. Similarly, an
immune response is also involved in GVHD, but, in this case, the
foreign transplanted immune cells destroy the host tissues. The
administration of T1R-Like Ligand II polynucleotides or
polypeptides, or agonists or antagonists of T1R-Like Ligand II,
that inhibits an immune response, particularly the proliferation,
differentiation, or chemotaxis of T-cells, may be an effective
therapy in preventing organ rejection or GVHD.
[0477] Similarly, T1R-Like Ligand II polynucleotides or
polypeptides, or agonists or antagonists of T1R-Like Ligand II, may
also be used to modulate inflammation. For example, T1R-Like Ligand
II polynucleotides or polypeptides, or agonists or antagonists of
T1R-Like Ligand II, may inhibit the proliferation and
differentiation of cells involved in an inflammatory response.
These molecules can be used to treat inflammatory conditions, both
chronic and acute conditions, including chronic prostatitis,
granulomatous prostatitis and malacoplakia, inflammation associated
with infection (e.g., septic shock, sepsis, or systemic
inflammatory response syndrome (SIRS)), ischemia-reperfusion
injury, endotoxin lethality, arthritis, complement-mediated
hyperacute rejection, nephritis, cytokine or chemokine induced lung
injury, inflammatory bowel disease, Crohn's disease, or resulting
from over production of cytokines (e.g., TNF or IL-1.)
[0478] Diseases associated with increased cell proliferation,
survival, or the inhibition of apoptosis that could be treated or
detected by T1R-Like Ligand II polynucleotides or polypeptides, as
well as antagonists or agonists of T1R-Like Ligand II, include
cancers (such as follicular lymphomas, carcinomas with p53
mutations, and hormone-dependent tumors, including, but not limited
to colon cancer, cardiac tumors, pancreatic cancer, melanoma,
retinoblastoma, glioblastoma, lung cancer, intestinal cancer,
testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma,
lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma,
chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi's
sarcoma and ovarian cancer); autoimmune disorders (such as,
multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis,
biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis,
systemic lupus erythematosus and immune-related glomerulonephritis
and rheumatoid arthritis) and viral infections (such as herpes
viruses, pox viruses and adenoviruses), inflammation, graft v. host
disease, acute graft rejection, and chronic graft rejection.
[0479] Thus, in preferred embodiments T1R-Like Ligand II
polynucleotides or polypeptides of the invention, or agonists or
antagonists thereof, are used to treat, prevent, and/or diagnose
autoimmune diseases and/or inhibit the growth, progression, and/or
metastasis of cancers, including, but not limited to, those cancers
disclosed herein, such as, for example, lymphocytic leukemias
(including, for example, MLL and chronic lymphocytic leukemia
(CLL)) and follicular lymphomas. In another embodiment T1R-Like
Ligand II polynucleotides or polypeptides of the invention are used
to activate, differentiate or proliferate cancerous cells or tissue
(e.g., B cell lineage related cancers (e.g., CLL and MLL),
lymphocytic leukemia, or lymphoma) and thereby render the cells
more vulnerable to cancer therapy (e.g., chemotherapy or radiation
therapy).
[0480] Moreover, in preferred embodiments, T1R-Like Ligand II
polynucleotides, polypeptides, and/or antagonists of the invention
are used to inhibit growth, progression, and/or metasis of cancers,
in particular those listed above, and in the paragraphs that
follow.
[0481] Additional diseases or conditions associated with increased
cell survival that may be treated or detected by T1R-Like Ligand II
polynucleotides or polypeptides, or agonists or antagonists of
T1R-Like Ligand II, include, but are not limited to, progression,
and/or metastases of malignancies and related disorders such as
leukemia (including acute leukemias (e.g., acute lympsdhocytic
leukemia, acute myelocytic leukemia (including myeloblastic,
promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and
chronic leukemias (e.g., chronic myelocytic (granulocytic) leukemia
and chronic lymphocytic leukemia)), and solid tumors including, but
not limited to, polycythemia vera, lymphomas (e.g., Hodgkin's
disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's
macroglobulinemia, heavy chain disease, and solid tumors including,
but not limited to, sarcomas and carcinomas such as fibrosarcoma,
myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma,
chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma,
lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's
tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma,
pancreatic cancer, breast cancer, ovarian cancer, prostate cancer,
squamous cell carcinoma, basal cell carcinoma, adenocarcinoma,
sweat gland carcinoma, sebaceous gland carcinoma, papillary
carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary
carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma,
bile duct carcinoma, choriocarcinoma, seminoma, embryonal
carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung
carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial
carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma,
ependymoma, pinealoma, hemangioblastoma, acoustic neuroma,
oligodendroglioma, menangioma, melanoma, neuroblastoma, and
retinoblastoma.
[0482] Diseases associated with increased cell death and/or
decreased cell numbers that may be treated or detected by T1R-Like
Ligand II polynucleotides or polypeptides, or agonists or
antagonists of T1R-Like Ligand II, include, but are not limited to,
AIDS; neurodegenerative disorders (such as Alzheimer's disease,
Parkinson's disease, Amyotrophic lateral sclerosis, Retinitis
pigmentosa, Cerebellar degeneration); myelodysplastic syndromes
(such as a plastic anemia), ischemic injury (such as that caused by
myocardial infarction, stroke and reperfusion injury),
toxin-induced liver disease (such as that caused by alcohol),
septic shock, cachexia and anorexia. Thus, in preferred embodiments
T1R-Like Ligand II polynucleotides or polypeptides of the invention
are used to treat, prevent, and/or diagnose the diseases and
disorders listed above and/or medical conditions associated with
such disorders.
[0483] The present invention is useful for detecting cancer in
mammals. In particular the invention is useful during diagnosis of
pathological cell proliferative neoplasias which include, but are
not limited to: acute myelogenous leukemias including acute
monocytic leukemia, acute myeloblastic leukemia, acute
promyelocytic leukemia, acute myelomonocytic leukemia, acute
erythroleukemia, acute megakaryocytic leukemia, and acute
undifferentiated leukemia, etc.; and chronic myelogenous leukemias
including chronic myelomonocytic leukemia, chronic granulocytic
leukemia, etc. Preferred mammals include monkeys, apes, cats, dogs,
cows, pigs, horses, rabbits and humans. Particularly preferred are
humans.
[0484] T1R-Like Ligand II polynucleotides or polypeptides, or
agonists or antagonists thereof, can be used in the treatment of
infectious agents. For example, by increasing the immune response,
particularly increasing the proliferation and/or differentiation of
B and/or T cells, infectious diseases maybe treated. The immune
response may be increased by either enhancing an existing immune
response, or by initiating a new immune response. Alternatively,
polynucleotides or polypeptides, or agonists or antagonists of, may
also directly inhibit the infectious agent, without necessarily
eliciting an immune response.
[0485] Viruses are one example of an infectious agent that can
cause disease or symptoms that can be treated by polynucleotides or
polypeptides, or agonists of T1R-like ligand II. Examples of
viruses, include, but are not limited to the following DNA and RNA
viruses and viral families: Arbovirus, Adenoviridae, Arenaviridae,
Arterivirus, Birnaviridae, Bunyaviridae, Caliciviridae,
Circoviridae, Coronaviridae, Dengue, EBV, HIV, Flaviviridae,
Hepadnaviridae (Hepatitis), Herpesviridae (such as,
Cytomegalovirus, Herpes Simplex, Herpes Zoster), Mononegavirus
(e.g., Paramyxoviridae, Morbillivirus, Rhabdoviridae),
Orthomyxoviridae (e.g., Influenza A, Influenza B, and
parainfluenza), Papiloma virus, Papovaviridae, Parvoviridae,
Picomaviridae, Poxviridae (such as Smallpox or Vaccinia),
Reoviridae (e.g., Rotavirus), Retroviridae (HTLV-I, HTLV-II,
Lentivirus), and Togaviridae (e.g., Rubivirus). Viruses falling
within these families can cause a variety of diseases or symptoms,
including, but not limited to: arthritis, bronchiollitis,
respiratory syncytial virus, encephalitis, eye infections (e.g.,
conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A,
B, C, E, Chronic Active, Delta), Japanese B encephalitis, Junin,
Chikungunya, Rift Valley fever, yellow fever, meningitis,
opportunistic infections (e.g., AIDS), pneumonia, Burkitt's
Lymphoma, chickenpox, hemorrhagic fever, Measles, Mumps,
Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella,
sexually transmitted diseases, skin diseases (e.g., Kaposi's,
warts), and viremia. polynucleotides or polypeptides, or agonists
or antagonists of, can be used to treat or detect any of these
symptoms or diseases. In specific embodiments, T1R-like ligand II
polynucleotides, polypeptides, or agonists are used to treat:
meningitis, Dengue, EBV, and/or hepatitis (e.g., hepatitis B). In
an additional specific embodiment T1R-like ligand II
polynucleotides, polypeptides, or agonists are used to treat
patients non responsive to one or more other commercially available
hepatitis vaccines. In a further specific embodiment T1R-like
ligand II polynucleotides, polypeptides, or agonists are used to
treat AIDS.
[0486] Similarly, bacterial or fungal agents that can cause disease
or symptoms and that can be treated by polynucleotides or
polypeptides, or agonists or antagonists of, include, but not
limited to, the following Gram-Negative and Gram-positive bacteria
and bacterial families and fungi: Actinomycetales (e.g.,
Corynebacterium, Mycobacterium, Norcardia), Cryptococcus
neoformans, Aspergillosis, Bacillaceae (e.g., Anthrax,
Clostridium), Bacteroidaceae, Blastomycosis, Bordetella, Borrelia
(e.g., Borrelia burgdorferi, Brucellosis, Candidiasis,
Campylobacter, Coccidioidomycosis, Cryptococcosis, Dermatocycoses,
E. coli (e.g., Enterotoxigenic E. coli and Enterohemorrhagic E.
coli), Enterobacteriaceae (Klebsiella, Salmonella (e.g., Salmonella
typhi, and Salmonella paratyphi), Serratia, Yersinia),
Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis,
Listeria, Mycoplasmatales, Mycobacterium leprae, Vibrio cholerae,
Neisseriaceae (e.g., Acinetobacter, Gonorrhea, Menigococcal),
Meisseria meningitidis, Pasteurellacea Infections (e.g.,
Actinobacillus, Heamophilus (e.g., Heamophilus influenza type B),
Pasteurella), Pseudomonas, Rickettsiaceae, Chlamydiaceae, Syphilis,
Shigella spp., Staphylococcal, Meningiococcal, Pneumococcal and
Streptococcal (e.g., Streptococcus pneumoniae and Group B
Streptococcus). These bacterial or fungal families can cause the
following diseases or symptoms, including, but not limited to:
bacteremia, endocarditis, eye infections (conjunctivitis,
tuberculosis, uveitis), gingivitis, opportunistic infections (e.g.,
AIDS related infections), paronychia, prosthesis-related
infections, Reiter's Disease, respiratory tract infections, such as
Whooping Cough or Empyema, sepsis, Lyme Disease, Cat-Scratch
Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid,
pneumonia, Gonorrhea, meningitis (e.g., mengitis types A and B),
Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis,
Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo,
Rheumatic Fever, Scarlet Fever, sexually transmitted diseaes, skin
diseases (e.g., cellulitis, dermatocycoses), toxemia, urinary tract
infections, wound infections. polynucleotides or polypeptides, or
agonists or antagonists of, can be used to treat or detect any of
these symptoms or diseases. In specific embodiments, T1R-like
ligand II polynucleotides, polypeptides, or agonists thereof are
used to treat: tetanus, Diptheria, botulism, and/or meningitis type
B.
[0487] Moreover, parasitic agents causing disease or symptoms that
can be treated by polynucleotides or polypeptides, or agonists of,
include, but not limited to, the following families or class:
Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis,
Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis,
Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis, and
Trichomonas and Sporozoans (e.g., Plasmodium virax, Plasmodium
falciparium, Plasmodium malariae and Plasmodium ovale). These
parasites can cause a variety of diseases or symptoms, including,
but not limited to: Scabies, Trombiculiasis, eye infections,
intestinal disease (e.g., dysentery, giardiasis), liver disease,
lung disease, opportunistic infections (e.g., AIDS related),
malaria, pregnancy complications, and toxoplasmosis.
polynucleotides or polypeptides, or agonists or antagonists of, can
be used to treat or detect any of these symptoms or diseases. In
specific embodiments, T1R-like ligand lpolynucleotides,
polypeptides, or agonists thereof are used to treat malaria.
[0488] In another embodiment, the invention provides a method of
delivering compositions containing the polypeptides of the
invention (e.g., compositions containing polypeptides or
anti-T1R-like ligand II antibodies associated with heterologous
polypeptides, heterologous nucleic acids, toxins, orprodrugs) to
targeted cells, such as, for example, cells expressing T1R-Like
Ligand II receptor, or cells expressing the cell surface bound form
of T1R-Like Ligand II. T1R-Like Ligand II polypeptides or
anti-T1R-Like Ligand II antibodies of the invention maybe
associated with heterologous polypeptides, heterologous nucleic
acids, toxins, or prodrugs via hydrophobic, hydrophilic, ionic
and/or covalent interactions.
[0489] In one embodiment, the invention provides a method for the
specific delivery of compositions of the invention to cells by
administering polypeptides of the invention (e.g., polypeptides or
anti-T1R-like ligand II antibodies) that are associated with
heterologous polypeptides or nucleic acids. In one example, the
invention provides a method for delivering a therapeutic protein
into the targeted cell. In another example, the invention provides
a method for delivering a single stranded nucleic acid (e.g.,
antisense or ribozymes) or double stranded nucleic acid (e.g., DNA
that can integrate into the cell's genome or replicate episomally
and that can be transcribed) into the targeted cell.
[0490] In another embodiment, the invention provides a method for
the specific destruction of cells (e.g., the destruction of tumor
cells) by administering polypeptides of the invention (e.g.,
T1R-like ligand II polypeptides or anti-T1R-like ligand II
antibodies) in association with toxins or cytotoxic prodrugs.
[0491] In a specific embodiment, the invention provides a method
for the specific destruction of cells of B cell lineage (e.g., B
cell related leukemias or lymphomas) by administering anti-T1R-like
ligand II antibodies and/or soluble T1R-like ligand II in
association with toxins or cytotoxic prodrugs.
[0492] In a specific embodiment, the invention provides a method
for the specific destruction of cells of T cell lineage (e.g., T
cell related leukemias or lymphomas) by administering anti-T1R-like
ligand II antibodies and/or soluble T1R-like ligand II in
association with toxins or cytotoxic prodrugs.
[0493] In another specific embodiment, the invention provides a
method for the specific destruction of cells of monocytic lineage
(e.g., monocytic leukemias or lymphomas) by administering
anti-T1R-like ligand II antibodies and/or soluble T1R-like ligand
II in association with toxins or cytotoxic prodrugs.
[0494] By "toxin" is meant compounds that bind and activate
endogenous cytotoxic effector systems, radioisotopes, holotoxins,
modified toxins, catalytic subunits of toxins, or any molecules or
enzymes not normally present in or on the surface of a cell that
under defined conditions cause the cell's death. Toxins that may be
used according to the methods of the invention include, but are not
limited to, radioisotopes known in the art, compounds such as, for
example, antibodies (or complement fixing containing portions
thereof) that bind an inherent or induced endogenous cytotoxic
effector system, thymidine kinase, endonuclease, RNAse, alpha
toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin,
saporin, momordin, gelonin, pokeweed antiviral protein,
alpha-sarcin and cholera toxin. By "cytotoxic prodrug" is meant a
non-toxic compound that is converted by an enzyme, normally present
in the cell, into a cytotoxic compound. Cytotoxic prodrugs that may
be used according to the methods of the invention include, but are
not limited to, glutamyl derivatives of benzoic acid mustard
alkylating agent, phosphate derivatives of etoposide or mitomycin
C, cytosine arabinoside, daunorubisin, and phenoxyacetamide
derivatives of doxorubicin.
[0495] An additional condition, disease or symptom that can be
treated by polynucleotides or polypeptides, or agonists of, is
osteomyelitis.
[0496] Preferably, treatment using polynucleotides or polypeptides,
or agonists of T1R-like ligand II, could either be by administering
an effective amount of polypeptide to the patient, or by removing
cells from the patient, supplying the cells with polynucleotide,
and returning the engineered cells to the patient (ex vivo
therapy). Moreover, as further discussed herein, the polypeptide or
polynucleotide can be used as an adjuvant in a vaccine to raise an
immune response against infectious disease.
[0497] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed to maintain organs before
transplantation or for supporting cell culture of primary tissues.
A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed for inducing tissue of
mesodermal origin to differentiate in early embryos.
[0498] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also increase or decrease the differentiation
or proliferation of embryonic stem cells, besides, as discussed
above, hematopoietic lineage.
[0499] As an agent to direct an individuals immune system towards
development of a humoral response (i.e. TH2) as opposed to a TH1
cellular response.
Expected Pleiotropic Biologic Effects of T1R-Like Ligand II
[0500] The T1R-like ligand II polypeptides of the present invention
are expected to have pleiotropic biological effects including many
of those shown in Table 3 below. Similar biological effects have
been shown for IL-1, particularly those associated with pancreatic
endocrine tissue (Mandrup-Poulsen, T., et al., Cytokine 5:185
(1993)), thyroid glands (Rasmussen, A. K., Autoimmunity 16:141
(1993)), hypothalamic-pituitary-adrenal axis (Fantuzzi, G., &
Ghezzi, P., Mediator Inflamm. 2:263 (1993); Rivier, C., Ann. NY
Acad. Sci. 697:97 (1993); Rivier, C., & Rivest, S., Ciba.
Found. Symp. 172:204 (1993)), fever (Coceani, F., "Fever: Basic
Mechanisms and Management", New York, N.Y., Raven (1991) p. 59),
bone metabolism (Tatalis, D. N., J. Peridontol 64:416 (1993)),
destruction of cartilage in the pathogenesis of rheumatoid
arthritis (Arend, W. P., & Dayer, J. M., Arthritis Rheum 33:305
(1990); Krane, S. M., et al., Ann. NY Acad. Sci. 580:340 (1990)),
uterine implantation (Lewis, M. P., et al., Placenta 15:13 (1994)),
and loss of lean body mass (Roubenoff, R., et al., J. Clin. Invest.
93:2379 (1994)). TABLE-US-00003 TABLE 3 POSSIBLE BIOLOGIC EFFECTS
OF T1R-LIKE LIGAND II Effects of systemically injected T1R-like
ligand II Fever; increased slow wave sleep; social depression;
anorexia Hypotension; myocardial suppression; tachycardia; lactic
acidosis Increased circulating nitric oxide; hypoaminoacidemia
Hyperinsulinemia; hyperglycemia; hypoglycemia Stimulation of
hypothalamic-pituitary-adrenal axis Release of hypothalamic
monoamines and neuropeptides Neutrophilia; increased marrow
cellularity; increased platelets Increased hepatic acute phase
protein synthesis Hypoferremia; hypozincemia; increased sodium
excretion Hyperlipidemia; increased muscle protein breakdown
Hypoalbuminemia; decreased drug metabolism Increased metastases
Increased nonspecific resistance to infection (pretreatment)
Learning defects in offspring after maternal IL-1 treatment Effects
of locally injected T1R-like ligand II Infiltration of neutrophils
into rabbits knee joint Increased proteoglycan breakdown in rabbit
knee joint Induction of uveitis following intravitreal injection
Angiogenesis in anterior chamber of eye Cellular infiltrate and
cytokine induction in cerebral ventricles Neutrophil and albumin
influx into lungs after intratracheal instillation Changes in
immunologic responses Increased antibody production (adjuvant
effect) Increased lymphokine synthesis (IL-2, -3, -4, -5, -6, -7,
-10 and -12) Increased IL-2 (.beta.) receptor Development of type 2
human T-cell clones Inhibition of tolerance to protein antigens
Enhancement of spleen cell mitogenic response to LPS Effects of
T1R-like ligand II on cultured cells or tissues Increased
expression of ELAM-1, VCAM-1, ICAM-1 Cytotoxicity (apoptosis) of
insulin-producing islet .beta. cells Inhibition of thyroglobulin
synthesis in thyrocytes Cartilage breakdown, release of calcium
from bone Increased release of arachidonic acid, prostanoids, and
eicosanoids Increased mucus production and chloride flux in
intestinal cells Enhancement in chloride flux (GABAA receptor) in
brain synaptosomes Proliferation of fibroblasts, smooth muscle
cells, messangial cells Growth inhibition of hair follicles
Increased corticosterone synthesis by adrenals Increased HIV-1
expression
[0501] Assays used: pancreatic endocrine tissue (Mandrup-Poulsen,
T., et al., Cytokine 5:185 (1993)), thyroid gland (Rasmussen, A.
K., Autoinmmunity 16:141 (1993)), hypothalamic-pituitary-adrenal
axis (Fantuzzi, G., & Ghezzi, P., Mediator Inflamm. 2:263
(1993); Rivier, C., Ann. NY Acad. Sci. 697:97 (1993); Rivier, C.,
& Rivest, S., Ciba. Found. Symp. 172:204 (1993)), fever
(Coceani, F., "Fever: Basic Mechanisms and Management", New York,
N.Y., Raven (1991) p. 59), bone metabolism (Tatakis, D. N., J.
Peridontol 64:416 (1993)), destruction of cartilage in the
pathogenesis of rheumatoid arthritis (Arend, W. P., & Dayer, J.
M., Arthritis Rheum 33:305 (1990); Krane, S. M., et al., Ann. NY
Acad. Sci. 580:340 (1990)), uterine implantation (Lewis, M. P., et
al., Placenta 15:13 (1994)), and loss of lean body mass (Roubenoff,
R., et al., J. Clin. Invest. 93:2379 (1994).
[0502] Having generally described the invention, the same will be
more readily understood by reference to the following examples,
which are provided by way of illustration and are not intended as
limiting.
EXAMPLES
Example 1
Expression and Purification of T1R-Like Ligand II in E. coli
[0503] The DNA sequence encoding the mature, extracellular soluble
portion of T1R-like ligand II in the deposited cDNA clone is
amplified using PCR oligonucleotide primers specific to the amino
terminal sequences of the T1R-like ligand II and to vector
sequences 3' to the gene. Additional nucleotides containing
restriction sites to facilitate cloning are added to the 5' and 3'
sequences respectively.
[0504] One of ordinary skill in the art will understand that the
full-length, mature T1R-like ligand II protein (amino acid about 1
to about 203 in SEQ ID NO:2) can be expressed in E. coli using
suitable 5' and 3' oligonucleotide primers.
[0505] The cDNA sequence encoding the extracellular domain of the
full length T1R-like ligand II in the deposited clone is amplified
using PCR oligonucleotide primers corresponding to the 5' and 3'
sequences of the gene. The 5' primer contains the sequence 5' CGC
CCA TGG CCG GCT TCA CAC CTT CC 3' (SEQ ID NO:4) containing the
underlined Nco I site and 17 nucleotides (nucleotides 131-147) of
the T1R-like ligand II protein coding sequence in FIGS. 1A-B (SEQ
ID NO:1) beginning immediately after the signal peptide.
[0506] The 3' primer has the sequence 5' CGC AAG CTT TCA TCT ATC
AAA GTT GCT TTC 3' (SEQ ID NO:5) containing a Hind III restriction
site followed by a stop codon and 18 nucleotides reverse and
complementary to nucleotides 619-636 of the T1R-like ligand II
protein coding sequence in FIGS. 1A-B (SEQ ID NO:1).
[0507] The restriction sites are convenient to restriction enzyme
sites in the bacterial expression vector pQE60, which are used for
bacterial expression in M15/rep4 host cells in these examples.
(Qiagen, Inc., Chatsworth, Calif., 91311). pQE60 encodes ampicillin
antibiotic resistance ("Amp.sup.r") and contains a bacterial origin
of replication ("ori"), an IPTG inducible promoter, a ribosome
binding site ("RBS"), a 6-His tag and restriction enzyme sites.
[0508] The amplified T1R-like ligand II DNA and the vector pQE60
both are digested with Nco I and Hind III and the digested DNAs are
then ligated together. Insertion of the T1R-like ligand II DNA into
the restricted pQE60 vector placed the T1R-like ligand II coding
region downstream of and operably linked to the vector's
IPTG-inducible promoter and in-frame with an initiating AUG
appropriately positioned for translation of T1R-like ligand II.
[0509] The ligation mixture is transformed into competent E. coli
cells using standard procedures. Such procedures are described in
Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed.;
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989). E. coli strain M15/rep4, containing multiple copies of the
plasmnid pREP4, which expresses lac repressor and confers kanamycin
resistance ("Kan.sup.r"), is used in carrying out the illustrative
example described here. This strain, which is only one of many that
are suitable for expressing T1R-like ligand II, is available
commercially from Qiagen.
[0510] Transformants are identified by their ability to grow on LB
plates in the presence of ampicillin and kanamycin. Plasmid DNA is
isolated from resistant colonies and the identity of the cloned DNA
was confirmed by restriction analysis.
[0511] Clones containing the desired constructs are grown overnight
("O/N") in liquid culture in LB media supplemented with both
ampicillin (100 .mu.g/ml) and kanamycin (25 .mu.g/ml).
[0512] The O/N culture is used to inoculate a large culture, at a
dilution of approximately 1:100 to 1:250. The cells are grown to an
optical density at 600 nm ("OD600") of between 0.4 and 0.6.
Isopropyl-B-D-thiogalactopyranoside ("IPTG") is then added to a
final concentration of 1 mM to induce transcription from lac
repressor sensitive promoters, by inactivating the lacI repressor.
Cells subsequently are incubated further for 3 to 4 hours. Cells
then are harvested by centrifugation and disrupted, by standard
methods. Inclusion bodies are purified from the disrupted cells
using routine collection techniques, and protein is solubilized
from the inclusion bodies into 8M urea. The 8M urea solution
containing the solubilized protein is passed over a PD-10 column in
2.times. phosphate-buffered saline ("PBS"), thereby removing the
urea, exchanging the buffer and refolding the protein. The protein
is purified by a further step of chromatography to remove
endotoxin. Then, it is sterile filtered. The sterile filtered
protein preparation is stored in 2.times.PBS.
[0513] Analysis of the preparation by standard methods of
polyacrylamide gel electrophoresis reveals that the preparation
contains about 95% monomer T1R-like ligand II having the expected
molecular weight of approximately 26 kDa.
Example 2
Cloning and Expression of T1R-Like Ligand II in a Baculovirus
Expression System
[0514] The cDNA sequence encoding the full length T1R-like ligand
II in the deposited clone is amplified using PCR oligonucleotide
primers corresponding to the 5' and 3' sequences of the gene.
[0515] The 5' primer has the sequence 5' CGC GGA TCC GCC ATC ATG
GGC GAC AAG ATC TGG 3' (SEQ ID NO:6) containing the underlined
BamHI restriction enzyme site followed by 18 nucleotides
(nucleotides 55 to 72) of the sequence of the T1R-like ligand II
protein in FIGS. 1A-B (SEQ ID NO:1). Inserted into an expression
vector, as described herein, the 5' end of the amplified fragment
encoding T1R-like ligand II provides an efficient signal peptide.
An efficient signal for initiation of translation in eukaryotic
cells, as described by Kozak, M., J. Mol. Biol. 196:947-950 (1987)
is appropriately located in the vector portion of the
construct.
[0516] The 3' primer has the sequence 5' CGC GGT ACC TCA CAA TGT
TAC GTA CTC TAG 3' (SEQ ID NO:7) containing the underlined Asp 718
restriction site followed by a stop codon and 18 nucleotides
reverse and complementary to nucleotides 754-771 of the T1R-like
ligand II coding sequence set out in FIGS. 1A-B (SEQ ID NO:1).
[0517] The cDNA sequence encoding the extracellular domain of the
full length T1R-like ligand II in the deposited clone is amplified
using PCR oligonucleotide primers corresponding to the 5' and 3'
sequences of the gene.
[0518] The 5' primer has the sequence 5' CGC GGA TCC GCC ATC ATG
GGC GAC AAG ATC TGG 3' (SEQ ID NO:6) containing the underlined
BamHI restriction enzyme site followed by 18 nucleotides
(nucleotides 55-72) of the sequence encoding the T1R-like ligand II
protein set out in FIGS. 1A-B (SEQ ID NO:1). Inserted into an
expression vector, as described herein, the 5' end of the amplified
fragment encoding T1R-like ligand II provides an efficient signal
peptide. An efficient signal for initiation of translation in
eukaryotic cells, as described by Kozak, M., J. Mol. Biol. 196:
947-950 (1987) is appropriately located in the vector portion of
the construct.
[0519] The 3' primer has the sequence 5' CGC GGT ACC TCA TCT ATC
AAA GTT GCT TTC 3' (SEQ ID NO:8) containing the underlined Asp 718
restriction site followed by a stop codon and 18 nucleotides
complementary and reverse to nucleotides 619-636 of the T1R-like
ligand II coding sequence set out in FIGS. 1A-B (SEQ ID NO:1).
[0520] The amplified fragment is isolated from a 1% agarose gel
using a commercially available kit ("Geneclean," BIO 101 Inc., La
Jolla, Calif.). The fragment then is digested with BamH I and Asp
718 and again is purified on a 1% agarose gel. This fragment is
designated herein F2.
[0521] The vector pA2 is used to express the T1R-like ligand II
full length and extracellular domains of an T1R-like ligand II in
the baculovirus expression system, using standard methods, as
described in Summers et al., A Manual of Methods for Baculovirus
Vectors and Insect Cell Culture Procedures, Texas Agricultural
Experimental Station Bulletin No. 1555 (1987). The pA2 vector does
not contain a signal peptide coding region. Thus, the T1R-like
ligand II signal peptide is relied upon (nucleotides 55-132 in SEQ
ID NO:1; amino acids -26 to -1 SEQ ID NO:2).
[0522] If the T1R-like ligand II signal peptide does not result in
efficient expression of the T1 R-like ligand II protein, the pA2-GP
vector may be used instead of the pA2 vector. The signal peptide of
AcMNPV gp67, including the N-terminal methionine, is located just
upstream of a BamHI site. One of ordinary skill in the art will
understand that if the pA2-GP expression vector is used, the 5'
oligonucleotide used should not contain sequence coding for the
T1R-like ligand II signal peptide. Instead, the 5' oligonucleotide
should begin at nucleotide 131.
[0523] Both the pA2 and pA2-GP expression vectors contain the
strong polyhedrin promoter of the Autographa californica nuclear
polyhedrosis virus (AcMNPV) followed by convenient restriction
sites. The polyadenylation site of the simian virus 40 ("SV40") is
used for efficient polyadenylation. For an easy selection of
recombinant virus the beta-galactosidase gene from E. coli is
inserted in the same orientation as the polyhedrin promoter and is
followed by the polyadenylation signal of the polyhedrin gene. The
polyhedrin sequences are flanked at both sides by viral sequences
for cell-mediated homologous recombination with wild-type viral DNA
to generate viable virus that express the cloned
polynucleotide.
[0524] Many other baculovirus vectors could be used in place of pA2
or pA2-GP, such as pAc373, pVL941 and pAcIM1 provided, as those of
skill readily will appreciate, that construction provides
appropriately located signals for transcription, translation,
trafficking and the like, such as an in-frame AUG and a signal
peptide, as required. Such vectors are described in Luckow et al.,
Virology 170:31-39, among others.
[0525] The plasmid is digested with the restriction enzyme BamHI
and Asp 718 and then is dephosphorylated using calf intestinal
phosphatase, using routine procedures known in the art. The DNA is
then isolated from a 1% agarose gel using a commercially available
kit ("Geneclean" BIO 101 Inc., La Jolla, Calif.). This vector DNA
is designated herein "V2".
[0526] Fragment F2 and the dephosphorylated plasmid V2 are ligated
together with T4 DNA ligase. E. coli HB 101 cells are transformed
with ligation mix and spread on culture plates. Bacteria are
identified that contain the plasmid with the human T1R-like ligand
II gene by digesting DNA from individual colonies using BarnII and
Asp 718 and then analyzing the digestion product by gel
electrophoresis. The sequence of the cloned fragment is confirmed
by DNA sequencing. This plasmid is designated herein pBacT1R-like
ligand II.
[0527] 5 .mu.g of the plasmid pBacT1R-like ligand II is
co-transfected with 1.0 .mu.g of a commercially available
linearized baculovirus DNA ("BaculoGold.TM. baculovirus DNA",
Pharmingen, San Diego, Calif.), using the lipofection method
described by Felgner et al., Proc. Natl. Acad. Sci. USA 84:
7413-7417 (1987). 1 .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g
of the plasmid pBacT1R-like ligand II are mixed in a sterile well
of a microtiter plate containing 50 .mu.l of serum-free Grace's
medium (Life Technologies Inc., Gaithersburg, Md.). Afterwards 10
.mu.l Lipofectin plus 90 .mu.l Grace's medium are added, mixed and
incubated for 15 minutes at room temperature. Then the transfection
mixture is added drop-wise to Sf9 insect cells (ATCC.TM. CRL 1711)
seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum. The plate is rocked back and forth to mix the newly
added solution. The plate is then incubated for 5 hours at
27.degree. C. After 5 hours the transfection solution is removed
from the plate and 1 ml of Grace's insect medium supplemented with
10% fetal calf serum is added. The plate is put back into an
incubator and cultivation is continued at 27.degree. C. for four
days.
[0528] After four days the supernatant is collected and a plaque
assay is performed, as described by Summers and Smith, cited above.
An agarose gel with "Blue Gal" (Life Technologies Inc.,
Gaithersburg) is used to allow easy identification and isolation of
gal-expressing clones, which produce blue-stained plaques. (A
detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0529] Four days after serial dilution, the virus is added to the
cells. After appropriate incubation, blue stained plaques are
picked with the tip of an Eppendorf pipette. The agar containing
the recombinant viruses is then resuspended in an Eppendorf tube
containing 200 .mu.l of Grace's medium. The agar is removed by a
brief centrifugation and the supernatant containing the recombinant
baculovirus is used to infect Sf9 cells seeded in 35 mm dishes.
Four days later the supernatants of these culture dishes are
harvested and then they are stored at 4.degree. C. Clones
containing properly inserted T1R-like ligand II are identified by
DNA analysis including restriction mapping and sequencing. This is
designated herein as V-T1R-like ligand II.
[0530] Sf9 cells are grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells are infected with the recombinant
baculovirus V-T1R-like ligand II at a multiplicity of infection
("MOI") of about 2 (about 1 to about 3). Six hours later the medium
is removed and is replaced with SF900 II medium minus methionine
and cysteine (available from Life Technologies Inc., Gaithersburg).
42 hours later, 5 .mu.Ci of .sup.35S-methionine and 5 .mu.Ci
.sup.35S-cysteine (available from Amersham) are added. The cells
are further incubated for 16 hours and then they are harvested by
centrifugation, lysed and the labeled proteins are visualized by
SDS-PAGE and autoradiography.
Example 3
Cloning and Expression in Mammalian Cells
[0531] Most of the vectors used for the transient expression of the
T1R-like ligand II protein gene sequence in mammalian cells should
carry the SV40 origin of replication. This allows the replication
of the vector to high copy numbers in cells (e.g. COS cells) which
express the T antigen required for the initiation of viral DNA
synthesis. Any other mammalian cell line can also be utilized for
this purpose.
[0532] A typical mammalian expression vector contains the promoter
element, which mediates the initiation of transcription of mRNA,
the protein coding sequence, and signals required for the
termination of transcription and polyadenylation of the transcript.
Additional elements include enhancers, Kozak sequences and
intervening sequences flanked by donor and acceptor sites for RNA
splicing. Highly efficient transcription can be achieved with the
early and late promoters from SV40, the long terminal repeats
(LTRs) from Retroviruses, e.g. RSV, HTLV-I, HIV-I and the early
promoter of the cytomegalovirus (CMV). However, cellular signals
can also be used (e.g. human actin promoter). Suitable expression
vectors for use in practicing the present invention include, for
example, vectors such as pSVL and pMSG (Pharmacia, Uppsala,
Sweden), pRSVcat (ATCC.TM. 37152), pSV2dhfr (ATCC.TM. 37146) and
pBC12MI (ATCC.TM. 67109). Mammalian host cells that could be used
include, human Hela, 283, H9 and Jurkat cells, mouse NIH3T3 and
C127 cells, Cos 1, Cos 7 and CV1, African green monkey cells, quail
QC1-3 cells, mouse L cells and Chinese hamster ovary cells.
[0533] Alternatively, the gene can be expressed in stable cell
lines that contain the gene integrated into a chromosome. The
co-transfection with a selectable marker such as dhfr, gpt,
neomycin, hygromycin allows the identification and isolation of the
transfected cells.
[0534] The transfected gene can also be amplified to express large
amounts of the encoded protein. The DHFR (dihydrofolate reductase)
is a useful marker to develop cell lines that carry several hundred
or even several thousand copies of the gene of interest. Another
useful selection marker is the enzyme glutamine synthase (GS)
(Murphy et al., Biochem J. 227:277-279 (1991); Bebbington et al.,
Bio/Technology 10:169-175 (1992)). Using these markers, the
mammalian cells are grown in selective medium and the cells with
the highest resistance are selected. These cell lines contain the
amplified gene(s) integrated into a chromosome. Chinese hamster
ovary (CHO) cells are often used for the production of
proteins.
[0535] The expression vectors pC1 and pC4 contain the strong
promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular
and Cellular Biology, 438-4470 (March, 1985)) plus a fragment of
the CMV-enhancer (Boshart et al., Cell 41:521-530 (1985)). Multiple
cloning sites, e.g. with the restriction enzyme cleavage sites
BamHI, XbaI and Asp718, facilitate the cloning of the gene of
interest. The vectors contain in addition the 3' intron, the
polyadenylation and termination signal of the rat preproinsulin
gene.
Example 3(a)
Cloning and Expression in COS Cells
[0536] An expression plasmid is made by cloning a cDNA encoding
T1R-like ligand II into the expression vector pcDNAI/Amp (which can
be obtained from Invitrogen, Inc.).
[0537] The expression vector pcDNAI/amp contains: (Dower, Colotta,
F., et al., Immunol Today 15:562 (1994)) an E. coli origin of
replication effective for propagation in E. coli and other
prokaryotic cells; (Greenfeder, S. A., et al., J. Biol. Chem.
270:13757 (1995)) an ampicillin resistance gene for selection of
plasmid-containing prokaryotic cells; (Polan, M. L., et al., Am. J.
Obstet. Gynecol. 170:1000 (1994)) an SV40 origin of replication for
propagation in eukaryotic cells; (Carinci, Mora, M., et al., Prog.
Clin. Biol. Res. 349:205 (1990)) a CMV promoter, a polylinker, an
SV40 intron, and a polyadenylation signal arranged so that a cDNA
conveniently can be placed under expression control of the CMV
promoter and operably linked to the SV40 intron and the
polyadenylation signal by means of restriction sites in the
polylinker.
[0538] A DNA fragment encoding the entire T1R-like ligand II
precursor and an HA tag fused in frame to its 3' end is cloned into
the polylinker region of the vector so that recombinant protein
expression is directed by the CMV promoter. The HA tag corresponds
to an epitope derived from the influenza hemagglutinin protein
described by Wilson et al., Cell 37: 767 (1984). The fusion of the
HA tag to the target protein allows easy detection of the
recombinant protein with an antibody that recognizes the HA
epitope.
Plasmid Construction
[0539] The T1R-like ligand II cDNA of the deposited clone is
amplified using primers that contain convenient restriction sites,
much as described above regarding the construction of expression
vectors for expression of T1R-like ligand II in E. coli. To
facilitate detection, purification and characterization of the
expressed T1R-like ligand II, one of the primers contains a
hemagglutinin tag ("HA tag") as described above.
[0540] One of ordinary skill in the art will understand that the
full-length T1R-like ligand II protein (amino acid about -26 to
about 203 in SEQ ID NO:2) can be expressed in COS cells using
suitable 5' and 3' oligonucleotide primers.
[0541] The cDNA sequence encoding the extracellular domain of the
full length T1R-like ligand II in the deposited clone is amplified
using PCR oligonucleotide primers corresponding to the 5' and 3'
sequences of the gene. The 5' primer has the following sequence: 5'
CGC GGA TCC GCC ATC ATG GGC GAC AAG ATC TGG 3' (SEQ ID NO:6),
containing the underlined BamH1 site and 18 nucleotides
(nucleotides 55 to 72) of the T1R-like ligand II coding sequence
set out in FIGS. 1A-B (SEQ ID NO:1).
[0542] The 3' primer has the following sequence: 5' CGC TCT AGA TCA
AGC GTA GTC TGG GAC GTC GTA TGG GTA TCT ATC AAA GTT GCT TTC 3' (SEQ
ID NO:9), containing the underlined Xba I restriction site, a stop
codon, an HA tag, and 18 nucleotides reverse and complementary to
nucleotides 619-639 of the TR1-like ligand II coding sequence set
out in FIGS. 1A-B (SEQ ID NO:1).
[0543] The PCR amplified DNA fragment and the vector, pcDNAI/Amp,
are digested with BamHI and XbaI and then ligated. The ligation
mixture is transformed into E. coli strain SURE (available from
Stratagene Cloning Systems, 11099 North Torrey Pines Road, La
Jolla, Calif. 92037) and the transformed culture is plated on
ampicillin media plates which then are incubated to allow growth of
ampicillin resistant colonies. Plasmid DNA is isolated from
resistant colonies and examined by restriction analysis and gel
sizing for the presence of the T1R-like ligand II encoding
fragment.
[0544] For expression of recombinant T1R-like ligand II, COS cells
are transfected with an expression vector, as described above,
using DEAE-DEXTRAN, as described, for instance, in Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory
Press, Cold Spring Harbor, N.Y. (1989). Cells are incubated under
conditions for expression of T1R-like ligand II by the vector.
[0545] Expression of the T1R-like ligand II HA fusion protein is
detected by radiolabelling and immunoprecipitation, using methods
described in, for example Harlow et al., Antibodies: A Laboratory
Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. (1988). To this end, two days after transfection, the
cells are labeled by incubation in media containing
.sup.35S-cysteine for 8 hours. The cells and the media are
collected, and the cells are washed and the lysed with
detergent-containing RlPA buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS,
1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et
al. cited above. Proteins are precipitated from the cell lysate and
from the culture media using an HA-specific monoclonal antibody.
The precipitated proteins then are analyzed by SDS-PAGE gels and
autoradiography. An expression product of the expected size is seen
in the cell lysate, which is not seen in negative controls.
Example 3(b)
Cloning and Expression in CHO Cells
[0546] The vector pC4 is used for the expression of T1R-like ligand
protein. Plasmid pC4 is a derivative of the plasmid pSV2-dhfr
[ATCC.TM. Accession No.37146]. Both plasmids contain the mouse DHFR
gene under control of the SV40 early promoter. Chinese hamster
ovary- or other cells lacking dihydrofolate activity that are
transfected with these plasmids can be selected by growing the
cells in a selective medium (alpha minus MEM, Life Technologies)
supplemented with the chemotherapeutic agent methotrexate. The
amplification of the DHFR genes in cells resistant to methotrexate
(MTX) has been well documented (see, e.g., Alt, F. W., Kellems, R.
M., Bertino, J. R., and Schimke, R. T., 1978, J. Biol. Chem.
253:1357-1370, Hamlin, J. L. and Ma, C. 1990, Biochem. et Biophys.
Acta,1097:107-143, Page, M. J. and Sydenham, M. A. 1991,
Biotechnology Vol. 9:64-68). Cells grown in increasing
concentrations of MTX develop resistance to the drug by
overproducing the target enzyme, DHFR, as a result of amplification
of the DHFR gene. If a second gene is linked to the DHFR gene it is
usually co-amplified and over-expressed. It is state of the art to
develop cell lines carrying more than 1,000 copies of the genes.
Subsequently, when the methotrexate is withdrawn, cell lines
contain the amplified gene integrated into the chromosome(s).
[0547] Plasmid pC4 contains for the expression of the gene of
interest a strong promoter of the long terminal repeat (LTR) of the
Rouse Sarcoma Virus (Cullen, et al., Molecular and Cellular
biology, March 1985, 438-4470) plus a fragment isolated from the
enhancer of the immediate early gene of human cytomegalovirus (CMV)
(Boshart et al., Cell 41:521-530, 1985). Downstream of the promoter
are the following single restriction enzyme cleavage sites that
allow the integration of the genes: BamHI, Pvull, and Nrul. Behind
these cloning sites the plasmid contains translational stop codons
in all three reading frames followed by the 3' intron and the
polyadenylation site of the rat preproinsulin gene. Other highly
efficient promoters can also be used for the expression, e.g., the
human .beta.-actinpromoter, the SV40 early or late promoters or the
long terminal repeats from other retroviruses, e.g., HIV and HTLVI.
For the polyadenylation of the mRNA other signals, e.g., from the
human growth hormone or globin genes can be used as well.
[0548] Stable cell lines carrying a gene of interest integrated
into the chromosomes can also be selected upon co-transfection with
a selectable marker such as gpt, G418 or hygromycin. It is
advantageous to use more than one selectable marker in the
beginning, e.g. G418 plus methotrexate.
[0549] The plasmid pC4 is digested with the restriction enzyme
BarnHI and then dephosphorylated using calf intestinal phosphates
by procedures known in the art. The vector is then isolated from a
1% agarose gel.
[0550] The DNA sequence encoding T1R-like ligand II protein is
amplified using PCR oligonucleotide primers specific to the amino
terminal sequence of the T1R-like ligand II protein and to vector
sequences 3' to the gene. Additional nucleotides containing
restriction sites to facilitate cloning are added to the 5' and 3'
sequences respectively.
[0551] The cDNA sequence encoding the full length T1R-like ligand
II in the deposited clone is amplified using PCR oligonucleotide
primers corresponding to the 5' and 3' sequences of the gene. The
5' primer has the sequence 5' CGC GGA TCC GCC ATC ATG GGC GAC AAG
ATC TGG 3' (SEQ ID NO: 6), containing the underlined BamH I
restriction enzyme site followed 18 nucleotides (nucleotides 55-72)
of the sequence of T1R like ligand II in FIGS. 1A-B (SEQ ID NO:1).
Inserted into an expression vector, as described herein, the 5' end
of the amplified fragment encoding T1R-like ligand II provides an
efficient signal peptide. An efficient signal for initiation of
translation in eukaryotic cells, as described by Kozak, M., J. Mol.
Biol. 196: 947-950 (1987) is appropriately located in the vector
portion of the construct.
[0552] The 3' primer has the sequence 5' GCG GGT ACC TCA CAA TGT
TAC GTA CTC TAG 3 ' (SEQ ID NO: 7), containing the underlined Asp
718 restriction site followed by a stop codon and 18 nucleotides
reverse and complementary to nucleotides 754 to 771 of the T1R-like
ligand II coding sequence in FIGS. 1A-B (SEQ ID NO:1). The
restriction sites are convenient to restriction enzyme sites in the
CHO expression vector PC-4.
[0553] The cDNA sequence encoding the extracellular domain of the
full length T1R-like ligand II in the deposited clone is amplified
using PCR oligonucleotide primers corresponding to the 5' and 3'
sequences of the gene.
[0554] The 5' primer has the sequence 5' CGC GGA TCC GCC ATC ATG
GGC GAC AAG ATC TGG 3' (SEQ ID NO:6) containing the underlined
BamHI restriction enzyme site and 18 nucleotides (nucleotides 55 to
72) of the T1R-like ligand II coding sequence in FIGS. 1A-B (SEQ ID
NO:1). Inserted into an expression vector, as described herein, the
5' end of the amplified fragment encoding T1R-like ligand II
provides an efficient signal peptide. An efficient signal for
initiation of translation in eukaryotic cells, as described by
Kozak, M., J. Mol. Biol. 196: 947-950 (1987) is appropriately
located in the vector portion of the construct.
[0555] The 3' primer has the sequence 5' CGC GGT ACC TCA TCT ATC
AAA GTT GCT TTC 3' (SEQ ID NO:8) containing the underlined Asp 718
restriction site followed by a stop codon and 18 nucleotides
reverse and complementary to nucleotides 619-636 of the T1R-like
ligand II coding sequence set out in FIGS. 1A-B (SEQ ID NO:1).
[0556] The amplified T1R-like ligand II protein DNA are digested
with BamH I and Asp 718. The vector pC4 is digested with BamHI and
the digested DNAs are then ligated together. The isolated fragment
and the dephosphorylated vector are then ligated with T4 DNA
ligase. Insertion of the T1R like ligand II protein DNA into the
BamH I restricted vector places the T1R like ligand II protein
coding region downstream of and operably linked to the vector's
promoter. E. coli HB101 cells are then transformed and bacteria
identified that contained the plasmid pC4 inserted in the correct
orientation using the restriction enzyme BamHI. The ligation
mixture is transformed into competent E. coli cells using standard
procedures as described, for example, in Sambrook et al., MOLECULAR
CLONING: A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989). The transformed
culture is plated on ampicillin media plates which then are
incubated to allow growth of ampicillin resistant colonies. Plasmid
DNA is isolated from resistant colonies and examined by restriction
analysis and gel sizing for the presence of the T1R-like ligand
II-encoding fragment. The sequence of the inserted gene is
confirmed by DNA sequencing.
Example 3(c)
Transfection of CHO-DHFR-Cells
[0557] Chinese hamster ovary cells lacking an active DHFR enzyme
are used for transfection. 5 .mu.g of the expression plasmid C4 are
cotransfected with 0.5 .mu.g of the plasmid pSVneo using the
lipofecting method (Felgner et al., supra). The plasmid pSV2-neo
contains a dominant selectable marker, the gene neo from Tn5
encoding an enzyme that confers resistance to a group of
antibiotics including G418. The cells are seeded in alpha minus MEM
supplemented with 1 mg/ml G418. After 2 days, the cells are
trypsinized and seeded in hybridoma cloning plates (Greiner,
Germany) and cultivated from 10-14 days. After this period, single
clones are trypsinized and then seeded in 6-well petri dishes using
different concentrations of methotrexate (25 nM, 50 nM, 100 nM, 200
nM, 400 nM). Clones growing at the highest concentrations of
methotrexate are then transferred to new 6-well plates containing
even higher concentrations of methotrexate (500 nM, 1 .mu.M, 2
.mu.M, 5 .mu.M). The same procedure is repeated until clones grow
at a concentration of 100 .mu.M.
[0558] The expression of the desired gene product is analyzed by
Western blot analysis and SDS-PAGE. Expression of the T1R-like
ligand II fusion protein is detected by radio labelling and
immunoprecipitation, using methods described in, for example Harlow
et al., Antibodies: A Laboratory Manual, 2nd Ed.; Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1988). To this
end, two days after transfection, the cells are labeled by
incubation in media containing .sup.35S-cysteine for 8 hours. The
cells and the media are collected, and the cells are washed and the
lysed with detergent-containing RIPA buffer: 150 mM NaCl, 1% NP-40,
0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by
Wilson et al. cited above. Proteins are precipitated from the cell
lysate and from the culture media using an HA-specific monoclonal
antibody. The precipitated proteins then are analyzed by SDS-PAGE
gels and autoradiography. An expression product of the expected
size is seen in the cell lysate, which is not seen in negative
controls.
Example 4
Tissue Distribution of T1R-Like Ligand II Gene Expression
[0559] Northern blot analysis is carried out to examine expression
levels of the T1R-like ligand II gene in human tissues, using
methods described by, among others, Sambrook et al., cited above. A
cDNA probe containing the entire T1R-like ligand II nucleotide
sequence (SEQ ID NO:1) is labeled with .sup.32P using the
rediprime.TM. DNA labelling system (Amersham Life Science),
according to manufacturer's instructions. After labelling, the
probe is purified using a CHROMA SPIN-100.TM. column (Clontech
Laboratories, Inc.), according to manufacturer's protocol number
PT1200-1. The purified labelled probe is then used to examine
various human tissues for expression of the T1R-like ligand II
gene.
[0560] Multiple Tissue Northern (MTN) blots containing various
human tissues (H) and human immune system tissues (IM) are obtained
from Clontech and are examined with labelled probe using
ExpressHyb.TM. Hybridization Solution (Clontech) according to
manufacturer's protocol number PT1190-1. Following hybridization
and washing, the blots are mounted and exposed to film at
-70.degree. C. overnight, and films developed according to standard
procedures.
[0561] It will be clear that the invention may be practiced
otherwise than as particularly described in the foregoing
description and examples.
[0562] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, are within the scope of the appended claims.
[0563] The disclosures of all patents, patent applications, and
publications referred to herein are hereby entirely incorporated by
reference.
Example 5
Gene Therapy Using Endogenous T1R-Like Ligand II Gene
[0564] A method of gene therapy according to the present invention
involves operably associating the endogenous T1R-like ligand II
sequence with a promoter via homologous recombination as described,
for example, in U.S. Pat. No. 5,641,670, issued Jun. 24, 1997;
International Publication Number WO 96/29411, published Sep. 26,
1996; International Publication Number WO 94/12650, published Aug.
4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935
(1989); and Zijlstra et al., Nature 342:435-438 (1989). This method
involves the activation of a gene which is present in the target
cells, but which is not expressed in the cells, or is expressed at
a lower level than desired. Polynucleotide constructs are made
which contain a promoter and targeting sequences, which are
homologous to the 5' non-coding sequence of endogenous T1R-like
ligand II, flanking the promoter. The targeting sequence will be
sufficiently near the 5' end of T1R-like ligand II so the promoter
will be operably linked to the endogenous sequence upon homologous
recombination. The promoter and the targeting sequences can be
amplified using PCR. Preferably, the amplified promoter contains
distinct restriction enzyme sites on the 5' and3' ends. Preferably,
the 3' end of the first targeting sequence contains the same
restriction enzyme site as the 5' end of the amplified promoter and
the 5' end of the second targeting sequence contains the same
restriction site as the 3' end of the amplified promoter.
[0565] The amplified promoter and the amplified targeting sequences
are digested with the appropriate restriction enzymes and
subsequently treated with calf intestinal phosphatase. The digested
promoter and digested targeting sequences are added together in the
presence of T4 DNA ligase. The resulting mixture is maintained
under conditions appropriate for ligation of the two fragments. The
construct is size fractionated on an agarose gel then purified by
phenol extraction and ethanol precipitation.
[0566] In this Example, the polynucleotide constructs are
administered as naked polynucleotides via electroporation. However,
the polynucleotide constructs may also be administered with
transfection-facilitating agents, such as liposomes, viral
sequences, viral particles, precipitating agents, etc. Such methods
of delivery are known in the art.
[0567] Once the cells are transfected, homologous recombination
will take place which results in the promoter being operably linked
to the endogenous T1R-like ligand II sequence. This results in the
expression of T1R-like ligand II in the cell. Expression may be
detected by immunological staining, or any other method known in
the art.
[0568] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in DMEM+10% fetal calf serum.
Exponentially growing or early stationary phase fibroblasts are
trypsinized and rinsed from the plastic surface with nutrient
medium. An aliquot of the cell suspension is removed for counting,
and the remaining cells are subjected to centrifugation. The
supematant is aspirated and the pellet is resuspended in 5 ml of
electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KCl,
0.7 mM Na2 HPO4, 6 mM dextrose). The cells are recentrifuged, the
supernatant aspirated, and the cells resuspended in electroporation
buffer containing 1 mg/ml acetylated bovine serum albumin. The
final cell suspension contains approximately 3.times.106 cells/ml.
Electroporation should be performed immediately following
resuspension.
[0569] Plasmid DNA is prepared according to standard techniques.
For example, to construct a plasmid for targeting to the T1R-like
ligand II locus, plasmid pUC18 (MBI Fementas, Amherst, N.Y.) is
digested with HindIII. The CMV promoter is amplified by PCR with an
XbaI site on the 5' end and a BamHI site on the 3'end. Two T1R-like
ligand II non-coding sequences are amplified via PCR: one T1R-like
ligand II non-coding sequence (T1R-like ligand II fragment 1) is
amplified with a HindII site at the 5' end and an Xba site at the
3'end; the other T1R-like ligand II non-coding sequence (T1R-like
ligand II fragment 2) is amplified with a BamHI site at the 5' end
and a HindIII site at the 3'end. The CMV promoter and T1R-like
ligand II fragments are digested with the appropriate enzymes (CMV
promoter--XbaI and BamHI; T1R-like ligand II fragment 1--XbaI;
T1R-like ligand II fragment 2--BamHI) and ligated together. The
resulting ligation product is digested with HindIII, and ligated
with the HindIII-digested pUC18 plasmid.
[0570] Plasmid DNA is added to a sterile cuvette with a 0.4 cm
electrode gap (Bio-Rad). The final DNA concentration is generally
at least 120 .mu.g/ml. 0.5 ml of the cell suspension (containing
approximately 1.5..times.10.sup.6 cells) is then added to the
cuvette, and the cell suspension and DNA solutions are gently
mixed. Electroporation is performed with a Gene-Pulser apparatus
(Bio-Rad). Capacitance and voltage are set at 960 .mu.F and 250-300
V, respectively. As voltage increases, cell survival decreases, but
the percentage of surviving cells that stably incorporate the
introduced DNA into their genome increases dramatically. Given
these parameters, a pulse time of approximately 14-20 mSec should
be observed.
[0571] Electroporated cells are maintained at room temperature for
approximately 5 min, and the contents of the cuvette are then
gently removed with a sterile transfer pipette. The cells are added
directly to 10 ml of prewarmed nutrient media (DMEM with 15% calf
serum) in a 10 cm dish and incubated at 37.degree. C. The following
day, the media is aspirated and replaced with 10 ml of fresh media
and incubated for a further 16-24 hours.
[0572] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product. The fibroblasts can then be introduced into a patient as
described above.
Example 6
Protein Fusions of T1R-Like Ligand II
[0573] T1R-like ligand II polypeptides of the invention are
optionally fused to other proteins. These fusion proteins can be
used for a variety of applications. For example, fusion of T1R-like
ligand II polypeptides to His-tag, HA-tag, protein A, IgG domains,
and maltose binding protein facilitates purification. (See EP A
394,827; Traunecker, et al., Nature 331:84-86 (1988).) Similarly,
fusion to IgG-1, IgG-3, and albumin increases the halflife time in
vivo. Nuclear localization signals fused to T1R-Like Ligand II
polypeptides can target the protein to a specific subcellular
localization, while covalent heterodimer or homodimers can increase
or decrease the activity of a fusion protein. Fusion proteins can
also create chimeric molecules having more than one function.
Finally, fusion proteins can increase solubility and/or stability
of the fused protein compared to the non-fused protein. All of the
types of fusion proteins described above can be made using
techniques known in the art or by using or routinely modifying the
following protocol, which outlines the fusion of a polypeptide to
an IgG molecule.
[0574] Briefly, the human Fc portion of the IgG molecule can be PCR
amplified, using primers that span the 5' and 3' ends of the
sequence described herein. These primers also preferably contain
convenient restriction enzyme sites that will facilitate cloning
into an expression vector, preferably a mammalian expression
vector.
[0575] For example, if the pC4 (Accession No. 209646) expression
vector is used, the human Fc portion can be ligated into the BamHI
cloning site. Note that the 3' BamHI site should be destroyed.
Next, the vector containing the human Fc portion is re-restricted
with BamHI, linearizing the vector, and T1R-like ligand II
polynucleotide, isolated by the PCR protocol described in Example
1, is ligated into this BamHI site. Note that the polynucleotide is
cloned without a stop codon, otherwise a fusion protein will not be
produced.
[0576] If the naturally occurring signal sequence is used to
produce the secreted protein, pC4 does not need a second signal
peptide. Alternatively, if the naturally occurring signal sequence
is not used, the vector can be modified to include a heterologous
signal sequence. (See, e.g., WO 96/34891.)
[0577] Human IgG Fc region: TABLE-US-00004
GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAATTCGAGGG
(SEQ ID NO: 26)
TGCACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACTCCTGAGGTCA
CATGCGTGGTGGTGGACGTAAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGA
GGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTC
ACCGTCCTGCACGAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAA
CCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCC
ATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCAAGCGAC
ATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGAC
TCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCT
TCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGT
AAATGAGTGCGACGGCCGCGACTCTAGAGGAT
Example 7
Isolation of Antibody Fragments Directed Against Polypeptides of
the Present Invention from a Library of scFvs
[0578] Naturally occurring V-genes isolated from human PBLs are
constructed into a large library of antibody fragments which
contain reactivities against polypeptides of the present invention
to which the donor may or may not have been exposed (see e.g., U.S.
Pat. No. 5,885,793 incorporated herein in its entirety by
reference).
Rescue of the Library:
[0579] A library of scFvs is constructed from the RNA of human PBLs
as described in WO92/01047. To rescue phage displaying antibody
fragments, approximately 10.sup.9 E. coli harbouring the phagemid
are used to inoculate 50 ml of 2.times.TY containing 1% glucose and
100 .mu.g/ml of ampicillin (2.times.TY-AMP-GLU) and grown to an
O.D. of 0.8 with shaking. Five .mu.ml of this culture is used to
innoculate 50 ml of 2.times.TY-AMP-GLU, 2.times.10.sup.8 TU of
delta gene 3 helper phage (M13 .DELTA. gene III, see WO92/01047)
are added and the culture incubated at 37.degree. C. for 45 minutes
without shaking and then at 37.degree. C. for 45 minutes with
shaking. The culture is centrifuged at 4000 r.p.m. for 10 minutes
and the pellet resuspended in 2 liters of 2.times.TY containing 100
.mu.g/ml ampicillin and 50 .mu.g/ml kanamycin and grown overnight.
Phage are prepared as described in WO92/01047.
[0580] M13 .DELTA. gene III is prepared as follows: M13 .DELTA.
gene III helper phage does not encode gene III protein, hence the
phage(mid) displaying antibody fragments have a greater avidity of
binding to antigen. Infectious M13 .DELTA. gene III particles are
made by growing the helper phage in cells harboring a pUC19
derivative supplying the wild type gene III protein during phage
morphogenesis. The culture is incubated for 1 hour at 37.degree. C.
without shaking and then for a further hour at 37.degree. C. with
shaking. Cells are pelleted (IEC-Centra 8, 4000 revs/min for 10
min), resuspended in 300 ml 2.times.TY broth containing 100 .mu.g
ampicillin/ml and 25 .mu.g kanamycin/ml (2.times.TY-AMP-KAN) and
grown overnight, shaking at 37.degree. C. Phage particles are
purified and concentrated from the culture medium by two
PEG-precipitations (Sambrook et al., 1990), resuspended in 2 ml PBS
and passed through a 0.45 .mu.m filter (Minisart NML; Sartorius) to
give a final concentration of approximately 10.sup.13 transducing
units/ml (ampicillin-resistant clones).
Panning of the Library:
[0581] Immunotubes (Nunc) are coated overnight in PBS with 4 ml of
either 100 mg/ml or 10 mg/ml of a polypeptide of the present
invention. Tubes are blocked with 2% Marvel-PBS for 2 hours at
37.degree. C. and then washed 3 times in PBS. Approximately
10.sup.13 TU of phage are applied to the tube and incubated for 30
minutes at room temperature tumbling on an over and under turntable
and then left to stand for another 1.5 hours. Tubes are washed 10
times with PBS 0.1% Tween-20 and 10 times with PBS. Phage are
eluted by adding 1 ml of 100 mM triethylamine and rotating 15
minutes on an under and over turntable after which the solution is
immediately neutralized with 0.5 ml of 1.0M Tris-HCl, pH 7.4. Phage
are then used to infect 10 ml of mid-log E. coli TG1 by incubating
eluted phage with bacteria for 30 minutes at 37.degree. C. The E.
coli are then plated on TYE plates containing 1% glucose and 100
.mu.g/ml ampicillin. The resulting bacterial library is then
rescued with delta gene 3 helper phage as described above to
prepare phage for a subsequent round of selection. This process is
then repeated for a total of 4 rounds of affinity purification with
tube-washing increased to 20 times with PBS, 0.1% Tween-20 and 20
times with PBS for rounds 3 and 4.
Characterization of Binders:
[0582] Eluted phage from the 3rd and 4th rounds of selection are
used to infect E. coli HB 2151 and soluble scFv is produced (Marks,
et al., 1991) from single colonies for assay. ELISAs are performed
with microtitre plates coated with either 10 pg/ml of the
polypeptide of the present invention in 50 mM bicarbonate pH 9.6.
Clones positive in ELISA are further characterized by PCR
fingerprinting (see e.g., WO92/01047) and then by sequencing.
Example 8
Production of an Antibody
Hybridoma Technology:
[0583] The antibodies of the present invention can be prepared by a
variety of methods. (See, Current Protocols, Chapter 2.) As one
example of such methods, cells expressing T1R-like ligand II
polypeptide(s) are administered to an animal to induce the
production of sera containing polyclonal antibodies. In a preferred
method, a preparation of T1R-like ligand II polypeptide(s) is
prepared and purified to render it substantially free of natural
contaminants. Such a preparation is then introduced into an animal
in order to produce polyclonal antisera of greater specific
activity.
[0584] Monoclonal antibodies specific for T1R-like ligand II
polypeptide(s) are prepared using hybridoma technology. (Kohler et
al., Nature 256:495 (1975); Kohler et al., Eur. J. Immunol. 6:511
(1976); Kohler et al., Eur. J. Immunol. 6:292 (1976); Hammerling et
al., in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier,
N.Y., pp. 563-681 (1981)). In general, an animal (preferably a
mouse) is immunized with T1R-like ligand II polypeptide(s) or, more
preferably, with a secreted T1R-like ligand II
polypeptide-expressing cell. Such polypeptide-expressing cells are
cultured in any suitable tissue culture medium, preferably in
Earle's modified Eagle's medium supplemented with 10% fetal bovine
serum (inactivated at about 56.degree. C.), and supplemented with
about 10 g/l of nonessential amino acids, about 1,000 U/ml of
penicillin, and about 100 .mu.g/ml of streptomycin.
[0585] The splenocytes of such mice are extracted and fused with a
suitable myeloma cell line. Any suitable myeloma cell line may be
employed in accordance with the present invention; however, it is
preferable to employ the parent myeloma cell line (SP2O), available
from the ATCC.TM.. After fusion, the resulting hybridoma cells are
selectively maintained in HAT medium, and then cloned by limiting
dilution as described by Wands et al. (Gastroenterology 80:225-232
(1981)). The hybridoma cells obtained through such a selection are
then assayed to identify clones which secrete antibodies capable of
binding the T1R-like ligand II polypeptide(s).
[0586] Alternatively, additional antibodies capable of binding to
T1R-like ligand II polypeptide(s) can be produced in a two-step
procedure using anti-idiotypic antibodies. Such a method makes use
of the fact that antibodies are themselves antigens, and therefore,
it is possible to obtain an antibody which binds to a second
antibody. In accordance with this method, protein specific
antibodies are used to immunize an animal, preferably a mouse. The
splenocytes of such an animal are then used to produce hybridoma
cells, and the hybridoma cells are screened to identify clones
which produce an antibody whose ability to bind to the T1R-like
ligand II protein-specific antibody can be blocked by T1R-like
ligand II polypeptide(s). Such antibodies comprise anti-idiotypic
antibodies to the T1R-like ligand II protein-specific antibody and
are used to immunize an animal to induce formation of further
T1R-like ligand II protein-specific antibodies.
[0587] For in vivo use of antibodies in humans, an antibody is
"humanized". Such antibodies can be produced using genetic
constructs derived from hybridoma cells producing the monoclonal
antibodies described above. Methods for producing chimeric and
humanized antibodies are known in the art and are discussed herein.
(See, for review, Morrison, Science 229:1202 (1985); Oi et al.,
BioTechniques 4:214 (1986); Cabilly et al., U.S. Pat. No.
4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494;
Neuberger et al., WO 8601533; Robinson et al., WO 8702671;
Boulianne et al., Nature 312:643 (1984); Neuberger et al., Nature
314:268 (1985).)
Example 9
Method of Determining Alterations in the T1R-Like Ligand II
Gene
[0588] RNA is isolated from entire families or individual patients
presenting with a phenotype of interest (such as a disease). cDNA
is then generated from these RNA samples using protocols known in
the art. (See, Sambrook.) The cDNA is then used as a template for
PCR, employing primers surrounding regions of interest in SEQ ID
NO:1. Suggested PCR conditions consist of 35 cycles at 95.degree.
C. for 30 seconds; 60-120 seconds at 52-58.degree. C.; and 60-120
seconds at 70.degree. C., using buffer solutions described in
Sidransky, D., et al., Science 252:706 (1991).
[0589] PCR products are then sequenced using primers labeled at
their 5' end with T4 polynucleotide kinase, employing SequiTherm
Polymerase. (Epicentre Technologies). The intron-exon borders of
selected exons of T1R-Like Ligand II are also determined and
genomic PCR products analyzed to confirm the results. PCR products
harboring suspected mutations in T1R-Like Ligand II is then cloned
and sequenced to validate the results of the direct sequencing.
[0590] PCR products of T1R-Like Ligand II are cloned into T-tailed
vectors as described in Holton, T. A. and Graham, M. W., Nucleic
Acids Research, 19:1156 (1991) and sequenced with T7 polymerase
(United States Biochemical). Affected individuals are identified by
mutations in T1R-Like Ligand II not present in unaffected
individuals.
[0591] Genomic rearrangements are also observed as a method of
determining alterations in the T1R-Like Ligand II gene. Genomic
clones isolated using techniques known in the art are
nick-translated with digoxigenindeoxy-uridine 5'-triphosphate
(Boehringer Manheim), and FISH performed as described in Johnson,
Cg. et al., Methods Cell Biol. 35:73-99 (1991). Hybridization with
the labeled probe is carried out using a vast excess of human cot-1
DNA for specific hybridization to the T1R-Like Ligand II genomic
locus.
[0592] Chromosomes are counterstained with
4,6-diamino-2-phenylidole and propidium iodide, producing a
combination of C- and R-bands. Aligned images for precise mapping
are obtained using a triple-band filter set (Chroma Technology,
Brattleboro, Vt.) in combination with a cooled charge-coupled
device camera (Photometrics, Tucson, Ariz.) and variable excitation
wavelength filters. (Johnson, Cv. et al., Genet. Anal. Tech. Appl.,
8:75 (1991).) Image collection, analysis and chromosomal fractional
length measurements are performed using the ISee Graphical Program
System. (Inovision Corporation, Durham, N.C.) Chromosome
alterations of the genomic region of T1R-Like Ligand II (hybridized
by the probe) are identified as insertions, deletions, and
translocations. These T1R-Like Ligand II alterations are used as a
diagnostic marker for an associated disease.
Example 10
Method of Detecting Abnormal Levels of T1R-Like Ligand II in a
Biological Sample
[0593] T1R-Like Ligand II polypeptides can be detected in a
biological sample, and if an increased or decreased level of
T1R-Like Ligand II is detected, this polypeptide is a marker for a
particular phenotype. Methods of detection are numerous, and thus,
it is understood that one skilled in the art can modify the
following assay to fit their particular needs.
[0594] For example, antibody-sandwich ELISAs are used to detect
T1R-Like Ligand II in a sample, preferably a biological sample.
Wells of a microtiter plate are coated with specific antibodies to
T1R-Like Ligand II at a final concentration of 0.2 to 10 .mu.g/ml.
The antibodies are either monoclonal or polyclonal and are produced
using technique known in the art. The wells are blocked so that
non-specific binding of T1R-Like Ligand II to the well is
reduced.
[0595] The coated wells are then incubated for >2 hours at RT
with a sample containing T1R-Like Ligand II. Preferably, serial
dilutions of the sample should be used to validate results. The
plates are then washed three times with deionized or distilled
water to remove unbounded T1R-Like Ligand II.
[0596] Next, 50 .mu.l of specific antibody-alkaline phosphatase
conjugate, at a concentration of 25-400 ng, is added and incubated
for 2 hours at room temperature. The plates are again washed three
times with deionized or distilled water to remove unbounded
conjugate.
[0597] 75 .mu.l of 4-methylumbelliferyl phosphate (MUP) or
p-nitrophenyl phosphate (NPP) substrate solution is then added to
each well and incubated 1 hour at room temperature to allow
cleavage of the substrate and flourescence. The flourescence is
measured by a microtiter plate reader. A standard curve is prepared
using the experimental results from serial dilutions of a control
sample with the sample concentration plotted on the X-axis (log
scale) and fluorescence or absorbance on the Y-axis (linear scale).
The T1R-Like Ligand II polypeptide concentration in a sample is
then interpolated using the standard curve based on the measured
flourescence of that sample.
Example 11
Method of Treating Increased Levels of T1R-Like Ligand II Using an
Antagonist
[0598] The present invention relates to a method for treating an
individual in need of a decreased level of T1R-Like Ligand II
biological activity in the body comprising, administering to such
an individual a composition comprising a therapeutically effective
amount of T1R-Like Ligand II antagonist. Preferred antagonists for
use in the present invention are T1R-Like Ligand II specific
antibodies and antisense polynucleotides.
[0599] Antisense technology is used to inhibit production of
T1R-Like Ligand II. This technology is one example of a method of
decreasing levels of T1R-Like Ligand II polypeptide, preferably a
soluble and/or secreted form, due to a variety of etiologies, such
as cancer.
[0600] For example, a patient diagnosed with abnormally increased
levels of T1R-Like Ligand II is administered intravenously
antisense polynucleotides at 0.5, 1.0, 1.5, 2.0 and 3.0 mg/kg day
for 21 days. This treatment is repeated after a 7-day rest period
if the is determined to be well tolerated.
[0601] In another example, a patient with increased levels of
T1R-Like Ligand II polypeptide receives a daily dose 0.1-100
.mu.g/kg of an antagonist for six consecutive days. Preferably, the
antagonist is in a soluble and/or secreted form.
Example 12
Method of Treating Decreased Levels of T1R-Like Ligand II
[0602] The present invention also relates to a method for treating
an individual in need of an increased level of T1R-Like Ligand II
biological activity in the body comprising administering to such an
individual a composition comprising a therapeutically effective
amount of T1R-Like Ligand II or an agonist thereof.
[0603] For example, a patient with decreased levels of T1R-Like
Ligand II polypeptide receives a daily dose 0.1-100 .mu.g/kg of
agonist and/or polypeptide for six consecutive days. Preferably,
the agonist and/or polypeptide is in a soluble and/or secreted
form.
Example 13
Method of Treatment Using Gene Therapy--Ex Vivo
[0604] One method of gene therapy transplants fibroblasts, which
are capable of expressing soluble and/or mature T1R-Like Ligand II
polypeptides, onto a patient. Generally, fibroblasts are obtained
from a subject by skin biopsy. The resulting tissue is placed in
tissue-culture medium and separated into small pieces. Small chunks
of the tissue are placed on a wet surface of a tissue culture
flask, approximately ten pieces are placed in each flask. The flask
is turned upside down, closed tight and left at room temperature
over night. After 24 hours at room temperature, the flask is
inverted and the chunks of tissue remain fixed to the bottom of the
flask and fresh media (e.g., Ham's F12 media, with 10% FBS,
penicillin and streptomycin) is added. The flasks are then
incubated at 37.degree. C. for approximately one week.
[0605] At this time, fresh media is added and subsequently changed
every several days. After an additional two weeks in culture, a
monolayer of fibroblasts emerge. The monolayer is trypsinized and
scaled into larger flasks.
[0606] pMV-7 (Kirschmeier, P. T. et al., DNA, 7:219-25 (1988)),
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0607] The cDNA encoding T1R-Like Ligand II can be amplified using
PCR primers which correspond to the 5' and 3' end encoding
sequences respectively. Preferably, the 5' primer contains an EcoRI
site and the 3' primer includes a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the amplified
EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is then used to transform E. coli HB101, which are then plated onto
agar containing kanamycin for the purpose of confining that the
vector contains properly inserted T1R-Like Ligand II.
[0608] The amphoteric pA317 or GP+am12 packaging cells are grown in
tissue culture to confluent density in Dulbecco's Modified Eagles
Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the T1R-Like Ligand II gene
is then added to the media and the packaging cells transduced with
the vector. The packaging cells now produce infectious viral
particles containing the T1R-Like Ligand II gene (the packaging
cells are now referred to as producer cells).
[0609] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his. Once the
fibroblasts have been efficiently infected, the fibroblasts are
analyzed to determine whether T1R-Like Ligand II protein is
produced.
[0610] The engineered fibroblasts are then transplanted onto the
host, either alone or after having been grown to confluence on
cytodex 3 microcarrier beads.
Example 14
Method of Treatment Using Gene Therapy--In Vivo
[0611] Another aspect of the present invention is using in vivo
gene therapy methods to treat disorders, diseases and conditions.
The gene therapy method relates to the introduction of naked
nucleic acid (DNA, RNA, and antisense DNA or RNA) T1R-like ligand
II sequences into an animal to increase or decrease the expression
of the T1R-like ligand II polypeptide. The T1R-like ligand II
polynucleotide may be operatively linked to a promoter or any other
genetic elements necessary for the expression of the T1R-like
ligand II polypeptide by the target tissue. Such gene therapy and
delivery techniques and methods are known in the art, see, for
example, WO90/11092, WO98/11779; U.S. Pat. No. 5,693,622,
5,705,151, 5,580,859; Tabata H. et al., Cardiovasc. Res. 35:470-479
(1997); Chao J. et al., Pharmacol. Res. 35:517-522 (1997); Wolff J.
A. Neuromuscul. Disord. 7:314-318 (1997); Schwartz B. et al., Gene
Ther. 3:405-411 (1996); Tsurumi Y. et al., Circulation 94:3281-3290
(1996) (incorporated herein by reference).
[0612] The T1R-like ligand II polynucleotide constructs may be
delivered by any method that delivers injectable materials to the
cells of an animal, such as, injection into the interstitial space
of tissues (heart, muscle, slcin, lung, liver, intestine and the
like). The T1R-like ligand II polynucleotide constructs can be
delivered in a pharmaceutically acceptable liquid or aqueous
carrier.
[0613] The term "naked" polynucleotide, DNA or RNA, refers to
sequences that are free from any delivery vehicle that acts to
assist, promote, or facilitate entry into the cell, including viral
sequences, viral particles, liposome formulations, lipofectin or
precipitating agents and the like. However, the T1R-like ligand II
polynucleotides may also be delivered in liposome formulations
(such as those taught in Felgner P. L. et al. (1995) Ann. NY Acad.
Sci. 772:126-139 and Abdallah B. et al. (1995) Biol. Cell 85
(1):1-7) which can be preparedly methods well known to those
skilled in the art.
[0614] The T1R-like ligand II polynucleotide vector constructs used
in the gene therapy method are preferably constructs that will not
integrate into the host genome nor will they contain sequences that
allow for replication. Any strong promoter known to those skilled
in the art can be used for driving the expression of DNA. Unlike
other gene therapies techniques, one major advantage of introducing
naked nucleic acid sequences into target cells is the transitory
nature of the polynucleotide synthesis in the cells. Studies have
shown that non-replicating DNA sequences can be introduced into
cells to provide production of the desired polypeptide for periods
of up to six months.
[0615] The T1R-like ligand II polynucleotide construct can be
delivered to the interstitial space of tissues within the an
animal, including of muscle, skin, brain, lung, liver, spleen, bone
marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas,
kidney, gall bladder, stomach, intestine, testis, ovary, uterus,
rectum, nervous system, eye, gland, and connective tissue.
Interstitial space of the tissues comprises the intercellular
fluid, mucopolysaccharide matrix among the reticular fibers of
organ tissues, elastic fibers in the walls of vessels or chambers,
collagen fibers of fibrous tissues, or that same matrix within
connective tissue ensheathing muscle cells or in the lacunae of
bone. It is similarly the space occupied by the plasma of the
circulation and the lymph fluid of the lymphatic channels. Delivery
to the interstitial space of muscle tissue is preferred for the
reasons discussed herein. They may be conveniently delivered by
injection into the tissues comprising these cells. They are
preferably delivered to and expressed in persistent, non-dividing
cells which are differentiated, although delivery and expression
may be achieved in non-differentiated or less completely
differentiated cells, such as, for example, stem cells of blood or
skin fibroblasts. In vivo muscle cells are particularly competent
in their ability to take up and express polynucleotides.
[0616] For the naked T1R-like ligand II polynucleotide injection,
an effective dosage amount of DNA or RNA will be in the range of
from about 0.05 g/kg body weight to about 50 mg/kg body weight.
Preferably the dosage will be from about 0.005 mg/kg to about 20
mg/kg and more preferably from about 0.05 mg/kg to about 5 mg/kg.
Of course, as the artisan of ordinary skill will appreciate, this
dosage will vary according to the tissue site of injection. The
appropriate and effective dosage of nucleic acid sequence can
readily be determined by those of ordinary skill in the art and may
depend on the condition being treated and the route of
administration. The preferred route of administration is by the
parenteral route of injection into the interstitial space of
tissues. However, other parenteral routes may also be used, such
as, inhalation of an aerosol formulation particularly for delivery
to lungs or bronchial tissues, throat or mucous membranes of the
nose. In addition, naked T1R-like ligand II polynucleotide
constructs can be delivered to arteries during angioplasty by the
catheter used in the procedure.
[0617] The dose response effects of injected T1R-like ligand II
polynucleotide in muscle in vivo is determined as follows. Suitable
T1R-like ligand II template DNA for production of mRNA coding for
T1R-Like Ligand II polypeptide is prepared in accordance with a
standard recombinant DNA methodology. The template DNA, which may
be either circular or linear, is either used as naked DNA or
complexed with liposomes. The quadriceps muscles of mice are then
injected with various amounts of the template DNA.
[0618] Five to six week old female and male Balb/C mice are
anesthetized by intraperitoneal injection with 0.3 ml of 2.5%
Avertin. A 1.5 cm incision is made on the anterior thigh, and the
quadriceps muscle is directly visualized. The T1R-like ligand II
template DNA is injected in 0.1 ml of carrier in a 1 cc syringe
through a 27 gauge needle over one minute, approximately 0.5 cm
from the distal insertion site of the muscle into the knee and
about 0.2 cm deep. A suture is placed over the injection site for
future localization, and the skin is closed with stainless steel
clips.
[0619] After an appropriate incubation time (e.g., 7 days) muscle
extracts are prepared by excising the entire quadriceps. Every
fifth 15 .mu.m cross-section of the individual quadriceps muscles
is histochemically stained for T1R-like ligand II protein
expression. A tine course for T1R-like ligand II protein expression
maybe done in a similar fashion except that quadriceps from
different mice are harvested at different times. Persistence of
T1R-like ligand II DNA in muscle following injection may be
determined by Southern blot analysis after preparing total cellular
DNA and HIRT supernatants from injected and control mice. The
results of the above experimentation in mice can be use to
extrapolate proper dosages and other treatment parameters in humans
and other animals using T1R-like ligand II naked DNA.
Example 15
Bioassay for the Effect of T1R-Like Ligand II on Hematopoietic
Progenitor Cells and/or Differentiation
[0620] Mouse bone marrow cells are used as target cells to examine
the effect of T1R-like ligand II polypeptides of the invention on
hematopoietic progenitor cells and/or differentiation. Briefly,
unfractionated bone marrow cells are first washed 2.times. with a
serum-free IMDM that is supplemented with 10% (V/V) BIT (Bovine
serum albumin, Insulin and Transferrin supplement from Stem Cell
Technologies, Vancouver, Canada). The washed cells are then
resuspended in the same growth medium and plated in the 96-well
tissue culture plate (5.times.104 cells/well) in 0.2 ml of the
above medium in the presence or absence of cytokines and T1R-like
ligand II. Stem cell factor (SCF) and IL-3 are included as positive
mediators of cell proliferation. Cells are allowed to grow in a low
oxygen environment (5% CO.sub.2, 7% O.sub.2, and 88% N.sub.2)
tissue culture incubator for 6 days. On the sixth day, 0.5 .mu.Ci
of Tritiated thymidine is added to each well and incubation is
continued for an additional 16-18 hours, at which point the cells
are harvested. The level of radioactivity incorporated into
cellular DNA is determined by scintillation spectrometry and
reflects the amount of cell proliferation.
[0621] The studies described in this example test the activity of
T1R-like ligand II polypeptides of the invention. However, one
skilled in the art could easily modify the exemplified studies to
test the activity of T1R-like ligand II polynucleotides (e.g., gene
therapy), agonists, and/or antagonists of T1R-like Ligand II.
Potential agonists would be expected to inhibit hematopoietic cell
proliferation in the presence of SCF and/or IL3 and/or to increase
the inhibition of cell proliferation in the presence of cytokines
and T1R-like ligand II in this assay. Potential antagonists would
be expected to reduce the inhibition of cell proliferation in the
presence of cytokines and T1R-like ligand II in this assay.
Example 16
Bioassay for the Effect of T1R-Like Ligand II on IL-3 and SCF
Stimulated Proliferation and Differentiation of Hematopoietic
Progenitor Cells
[0622] To determine if T1R-like ligand II polypeptides of the
invention inhibit specific hematopoietic lineages, mouse bone
marrow cells are first washed 2.times. with a serum-free IMDM that
is supplemented with 10% (V/V) BIT (Bovine serum albumin, Insulin
and Transferrin supplement from Stem Cell Technologies, Vancouver,
Canada). The washed cells are then resuspended in the same growth
medium and plated in the 96-well tissue culture plate (5.times.104
cells/well) in 0.2 ml of the above medium in the presence of IL-3
(1 ng/ml) plus SCF (5 ng/ml) with or without T1R-like ligand II.
Cells are allowed to grow in a low oxygen environment (5% CO.sub.2,
7% O.sub.2, and 88% N.sub.2) tissue culture incubator, and after 7
days, analyzed for expression of differentiation antigens by
staining with various monoclonal antibodies and FACScan.
[0623] The studies described in this example test the activity of
T1R-like ligand II polypeptides of the invention. However, one
skilled in the art could easily modify the exemplified studies to
test the activity of T1R-like ligand II polynucleotides (e.g., gene
therapy), agonists, and/or antagonists of T1R-like Ligand II.
Potential agonists tested in this assay would be expected to
inhibit cell proliferation in the presence of cytokines and/or to
increase the inhibition of cell proliferation in the presence of
cytokines and T1R-like ligand II. Potential antagonists tested in
this assay would be expected to reduce the inhibition of cell
proliferation in the presence of cytokines and T1R-like ligand
II.
Example 17
Effect of T1R-Like Ligand II on IL-3 and SCF Stimulated
Proliferation and Differentiation of Iin-Population of Bone Marrow
Cells
[0624] A population of mouse bone marrow cells enriched in
primitive hematopoietic progenitors can be obtained using a
negative selection procedure, where the committed cells of most of
the lineages are removed using a panel of monoclonal antibodies
(anti cd11b, CD4, CD8, CD45R and Gr-1 antigens) and magnetic beads.
The resulting population of cells (lineage depleted cells) are
plated (5.times.104 cells/ml) in the presence or absence of
T1R-like ligand II polypeptide of the invention (in a range of
concentrations) in a growth medium supplemented with IL-3 (5 ng/ml)
plus SCF (100 ng/ml). After seven days of incubation at 37.degree.
C. in a humidified incubator (5% CO.sub.2, 7% O.sub.2, and 88%
N.sub.2 environment), cells are harvested and assayed for the
HPP-CFC, and immature progenitors. In addition, cells are analyzed
for the expression of certain differentiation antigens by FACScan.
Colony data is expressed as mean number of colonies +/-SD) and are
obtained from assays performed in six dishes for each population of
cells.
Example 18
T1R-Like Ligand II Stimulates the Proliferation of Bone Marrow
CD34+ Cells.
[0625] This assay was based on the ability of human CD34+ to
proliferate in presence of hematopoietic growth factors and
evaluated the ability of isolated T1R-like ligand II polypeptides
expressed in mammalian cells to stimulate proliferation of CD34+
cells.
[0626] It has been previously shown that only most mature
precursors will respond to a single signal. More immature
precursors require at least two signals to respond. Therefore, to
test the effect of T1 receptor-like ligand II polypeptides on
hematopoietic activity of a wide range of progenitor cells, the
assay contained T1R-like ligand II in presence or absence of other
hematopoietic growth factors. Isolated cells were cultured for 5
days in the presence of Stem Cell Factor (SCF) in combination with
tested supernatant. SCF alone has a very limited effect on the
proliferation of bone marrow (BM) cells, acting in such conditions
only as a "survival" factor. However, combined with any factor
exhibiting stimulatory effect on these cells (i.e. IL-3), SCF will
cause a synergistic effect. Therefore, if the tested polypeptide
has a stimulatory effect on hematopoietic progenitors, such
activity can be easily detected. Since normal BM cells have a low
level of cycling cells, it is likely that any inhibitory effect of
the polypeptides of the invention, or agonists or antagonists
thereof, might not be detected, accordingly, assays for an
inhibitory effect on progenitors is preferably tested in cells that
are first subjected to in vitro stimulation with SCF+IL+3, and then
contacted with the compound that is being evaluated for inhibition
of such induced proliferation.
[0627] Briefly, CD34+ cells were isolated using methods known in
the art. The cells were thawed and resuspended in medium (QBSF 60
serum-free medium with L-glutamine (500 ml) Quality Biological,
inc. Gaithersburg, Md., Cat# 160-204-101). After several gentle
centrifugation steps at 200.times.g, they were allowed to rest for
one hour. The cell count was then adjusted to 2.5.times.10.sup.5
cells/ml. During this time, 100 .mu.l of sterile water was added to
the peripheral wells of a 96-well plate. The cytokines that were
tested with T1 receptor-like ligand II in this assay were rhSCF
(R&D Systems, Minneapolis, Minn., Cat# 255-SC) at 50 ng/ml
alone and in combination with rhSCF and rhIL-3 (R&D Systems,
Minneapolis, Minn., Cat# 203-ML) at 30 ng/ml. After one hour, 10
.mu.l of prepared cytokines, 50 .mu.l SID (supernatants at 1:2
dilution=50 .mu.l) and 20 .mu.l of diluted cells were added to the
media which was already present in the wells to allow for a final
total volume of 100 .mu.l. The plates were then placed in a
37.degree. C./5% C0.sub.2 incubator for five days.
[0628] Eighteen hours before the assay was harvested, 0.5
.mu.Ci/well of [3H] Thymidine was added in a 10 .mu.l volume to
each well to determine the proliferation rate. The experiment was
terminated by harvesting the cells from each 96 well plate to a
filter mat using the Tomtec Harvester 96. After harvesting, the
filter mats were dried, trimmed and placed into OmniFilter
assemblies consisting of one OmniFilter plate and one OmniFilter
Tray. 60 .mu.l Microscint was added to each well and the plate
sealed with TopSeal-A press-on sealing film. A bar code 15 sticker
was affixed to the first plate for counting The sealed plates were
then loaded and the level of radioactivity determined via the
Packard Top Count and the printed data collected for analysis. The
level of radioactivity reflected the amount of cell
proliferation.
[0629] FIG. 4 shows the results of one such assay using isolated
T1R-like ligand II polypeptides expressed in mammalian cells. The
values were averaged and standard deviations calculated using
Microsoft 98 Excel. Hits are determined by averaging all of the
mean values for the SID Lite supernatants and controls and adding 1
SD to that value. Any SID Lite supernatants whose average value
exceeds this value are considered as hits.
[0630] The studies described in the above example test the activity
of T1R-like ligand II polypeptides of the invention. However, one
skilled in the art could easily modify the exemplified studies to
test the activity of T1R-like ligand II polynucleotides (e.g., gene
therapy), antibodies, agonists, and/or antagonists and fragments
and variants thereof. As a nonlimiting example, potential
antagonists tested in this assay would be expected to inhibit cell
proliferation in the presence of cytokines and/or to increase the
inhibition of cell proliferation in the presence of cytokines and
T1R-like ligand II. Potential agonists tested in this assay would
be expected to reduce the inhibition of cell proliferation in the
presence of cytokines and T1R-like ligand II.
* * * * *