Use Of Proteins And Peptides Encoded By The Genome Of A Novel Sars-Associated Coronavirus Strain

Abstract

The invention relates to the use of proteins and peptides coded by the genome of the isolated or purified strain of severe acute respiratory syndrome (SARS)-associated coronavirus, resulting from sample reference number 031589 and, in particular, to the use of protein S and the derivative antibodies thereof as diagnostic reagents and as a vaccine.

Description

[0001] The present invention relates to a novel strain of severe acute respiratory syndrome (SARS)-associated coronavirus derived from a sample recorded under No. 031589 and collected in Hanoi (Vietnam), to nucleic acid molecules derived from its genome, to the proteins and peptides encoded by said nucleic acid molecules and to their applications, in particular as diagnostic reagents and/or as vaccine.

[0002] Coronavirus is a virus containing single-stranded RNA, of positive polarity, of approximately 30 kilobases which replicates in the cytoplasm of the host cells; the 5' end of the genome has a capped structure and the 3' end contains a polyA tail. This virus is enveloped and comprises, at its surface, peplomeric structures called spicules.

[0003] The genome comprises the following open reading frames or ORFs, from its 5' end to its 3' end: ORF1a and ORF1b corresponding to the proteins of the transcription-replication complex, and ORF-S, ORF-E, ORF-M and ORF-N corresponding to the structural proteins S, E, M and N. It also comprises ORFs corresponding to proteins of unknown function encoded by: the region situated between ORF-S and ORF-E and overlapping the latter, the region situated between ORF-M and ORF-N, and the region included in ORF-N.

[0004] The S protein is a membrane glycoprotein (200-220 kDa) which exists in the form of spicules or spikes emerging from the surface of the viral envelope. It is responsible for the attachment of the virus to the receptors of the host cell and for inducing the fusion of the viral envelope with the cell membrane.

[0005] The small envelope protein (E), also called sM (small membrane), which is a nonglycosylated transmembrane protein of about 10 kDa, is the protein present in the smallest quantity in the virion. It plays a powerful role in the coronavirus budding process which occurs at the level of the intermediate compartment in the endoplasmic reticulum and the Golgi apparatus.

[0006] The M protein or matrix protein (25-30 kDa) is a more abundant membrane glycoprotein which is integrated into the viral particle by an M/E interaction, whereas the incorporation of S into the particles is directed by an S/M interaction. It appears to be important for the viral maturation of coronaviruses and for the determination of the site where the viral particles are assembled.

[0007] The N protein or nucleocapsid protein (45-50 kDa) which is the most conserved among the coronavirus structural proteins is necessary for encapsidating the genomic RNA and then for directing its incorporation into the virion. This protein is probably also involved in the replication of the RNA.

[0008] When the host cell is infected, the reading frame (ORF) situated in 5' of the viral genome is translated into a polyprotein which is cleaved by the viral proteases and then releases several nonstructural proteins such as the RNA-dependent RNA polymerase (Rep) and the ATPase helicase (Hel). These two proteins are involved in the replication of the viral genome and in the generation of transcripts which are used in the synthesis of the viral proteins. The mechanisms by which these subgenomic mRNAs are produced are not completely understood; however, recent facts indicate that the sequences for regulation of transcription at the 5' end of each gene represent signals which regulate the discontinuous transcription of the subgenomic mRNAs.

[0009] The proteins of the viral membrane (S, E and M proteins) are inserted into the intermediate compartment, whereas the replicated RNA (+ strand) is assembled with the N (nucleocapsid) protein. This protein-RNA complex then combines with the M protein contained in the membranes of the endoplasmic reticulum and the viral particles form when the nucleocapsid complex buds into the endoplasmic reticulum. The virus then migrates across the Golgi complex and eventually leaves the cell, for example by exocytosis. The site of attachment of the virus to the host cell is at the level of the S protein.

[0010] Coronaviruses are responsible for 15 to 30% of colds in humans and for respiratory and digestive infections in animals, especially cats (FIPV: Feline infectious peritonitis virus), poultry (IBV: Avian infectious bronchitis virus), mice (MHV: Mouse hepatitis virus), pigs (TGEV: Transmissible gastroenterititis virus, PEDV: Porcine Epidemic diarrhea virus, PRCoV: Porcine Respiratory Coronavirus, HEV: Hemagglutinating encephalomyelitis Virus) and bovines (BCoV: Bovine coronavirus).

[0011] In general, each coronavirus affects only one species; in immunocompetent individuals, the infection induces optionally neutralizing antibodies and cell immunity, capable of destroying the infected cells.

[0012] An epidemy of atypical pneumonia, called severe acute respiratory syndrome (SARS) has spread in various countries (Vietnam, Hong Kong, Singapore, Thailand and Canada) during the first quarter of 2003, from an initial focus which appeared in China in the last quarter of 2002. The severity of this disease is such that its mortality rate is about 3 to 6%. The determination of the causative agent of this disease is underway by numerous laboratories worldwide.

[0013] In March 2003, a new coronavirus (SARS-CoV or SARS virus) was isolated, in association with cases of severe acute respiratory syndrome (T. G. KSIAZEK et al., The New England Journal of Medicine, 2003, 348, 1319-1330; C. DROSTEN et al., The New England Journal of Medicine, 2003, 348, 1967-1976; Peiris et al., Lancet, 2003, 361, 1319).

[0014] Genomic sequences of this new coronavirus have thus been obtained, in particular those of the Urbani isolate (Genbank accession No. AY274119.3 and A. MARRA et al., Science, May 1, 2003, 300, 1399-1404) and the Toronto isolate (Tor2, Genbank accession No. AY278741 and A. ROTA et al., Science, 2003, 300, 1394-1399).

[0015] The organization of the genome is comparable with that of other known coronaviruses, thus making it possible to confirm that SARS-CoV belongs to the Coronaviridae family; open reading frames ORF1a and 1b and open reading frames corresponding to the S, E, M and N proteins, and to proteins encoded by: the region situated between ORF-S and ORF-E (ORF3), the region situated between ORF-S and ORF-E and overlapping ORF-E (ORF4), the region situated between ORF-M and ORF-N (ORF7 to ORF11) and the region corresponding to ORF-N (ORF13 and ORF14), have in particular been identified.

[0016] Seven differences have been identified between the sequences of the Tor2 and Urbani isolates; 3 correspond to silent mutations (c/t at position 16622 and a/g at position 19064 of ORF1b, t/c at position 24872 of ORF-S) and 4 modify the amino acid sequence of respectively: the proteins encoded by ORF1a (c/t at position 7919 corresponding to the A/V mutation), the S protein (g/t at position 23220 corresponding to the A/S mutation), the protein encoded by ORF3 (a/g at position 25298 corresponding to the R/G mutation) and the M protein (t/c at position 26857 corresponding to the S/P mutation).

[0017] In addition, phylogenetic analysis shows that SARS-CoV is distant from other coronaviruses and that it did not appear by mutation of human respiratory coronaviruses nor by recombination between known coronaviruses (for a review, see Holmes, J. C. I., 2003, 111, 1605-1609).

[0018] The determination and the taking into account of new variants are important for the development of reagents for the detection and diagnosis of SARS which are sufficiently sensitive and specific, and immunogenic compositions capable of protecting populations against epidemics of SARS.

[0019] The inventors have now identified another strain of SARS-associated coronavirus which is distinguishable from the Tor2 and Urbani isolates.

[0020] The subject of the present invention is therefore an isolated or purified strain of severe acute respiratory syndrome-associated human coronavirus, characterized in that its genome has, in the form of complementary DNA, a serine codon at position 23220-23222 of the gene for the S protein or a glycine codon at position 25298-25300 of the gene for ORF3, and an alanine codon at position 7918-7920 of ORF1a or a serine codon at position 26857-26859 of the gene for the M protein, said positions being indicated in terms of reference to the Genbank sequence AY274119.3.

[0021] According to an advantageous embodiment of said strain, the DNA equivalent of its genome has a sequence corresponding to the sequence SEQ ID No: 1; this coronavirus strain is derived from the sample collected from the bronchoaleveolar washings from a patient suffering from SARS, recorded under the No. 031589 and collected at the Hanoi (Vietnam) French hospital.

[0022] In accordance with the invention, said sequence SEQ ID No: 1 is that of the deoxyribonucleic acid corresponding to the ribonucleic acid molecule of the genome of the isolated coronavirus strain as defined above.

[0023] The sequence SEQ ID No: 1 is distinguishable from the Genbank sequence AY274119.3 (Tor2 isolate) in that it possesses the following mutations: [0024] g/t at position 23220; the alanine codon (gct) at position 577 of the amino acid sequence of the Tor2 S protein is replaced by a serine codon (tct), [0025] a/g at position 25298; the arginine codon (aga) at position 11 of the amino acid sequence of the protein encoded by the Tor2 ORF3 is replaced by a glycine codon (gga).

[0026] In addition, the sequence SEQ ID No: 1 is distinguishable from the Genbank sequence AY278741 (Urbani isolate) in that it possesses the following mutations: [0027] t/c at position 7919; the valine codon (gtt) in position 2552 of the amino acid sequence of the protein encoded by ORF1a is replaced by an alanine codon (gct), [0028] t/c at position 16622: this mutation does not modify the amino acid sequence of the proteins encoded by ORF1b (silent mutation), [0029] g/a at position 19064: this mutation does not modify the amino acid sequence of the proteins encoded by ORF1b (silent mutation), [0030] c/t at position 24872: this mutation does not modify the amino acid sequence of the S protein, and c/t at position 26857: the proline codon (ccc) at position 154 of the amino acid sequence of the M protein is replaced by a serine codon (tcc).

[0031] Unless otherwise stated, the positions of the nucleotide and peptide sequences are indicated with reference to the Genbank sequence AY274119.3.

[0032] The subject of the present invention is also an isolated or purified polynucleotide, characterized in that its sequence is that of the genome of the isolated coronavirus strain as defined above.

[0033] According to an advantageous embodiment of said polynucleotide, it has the sequence SEQ ID No: 1.

[0034] The subject of the present invention is also an isolated or purified polynucleotide, characterized in that its sequence hybridizes under high stringency conditions with the sequence of the polynucleotide as defined above.

[0035] The terms "isolated or purified" mean modified "by the hand of humans" from the natural state; in other words if an object exists in nature, it is said to be isolated or purified if it is modified or extracted from its natural environment or both. For example, a polynucleotide or a protein/peptide naturally present in a living organism is neither isolated nor purified; on the other hand, the same polynucleotide or protein/peptide separated from coexisting molecules in its natural environment, obtained by cloning, amplification and/or chemical synthesis is isolated for the purposes of the present invention. Furthermore, a polynucleotide or a protein/peptide which is introduced into an organism by transformation, genetic manipulation or by any other method, is "isolated" even if it is present in said organism. The term purified as used in the present invention means that the proteins/peptides according to the invention are essentially free of association with the other proteins or polypeptides, as is for example the product purified from the culture of recombinant host cells or the product purified from a nonrecombinant source.

[0036] For the purposes of the present invention, high stringency hybridization conditions are understood to mean temperature and ionic strength conditions chosen such that they make it possible to maintain the specific and selective hybridization between complementary polynucleotides.

[0037] By way of illustration, high stringency conditions for the purposes of defining the above polynucleotides are advantageously the following: the DNA-DNA or DNA-RNA hybridization is performed in two steps: (1) prehybridization at 42.degree. C. for 3 hours in phosphate buffer (20 mM, pH 7.5) containing 5.times.SSC (1.times.SSC corresponds to a 0.15 M NaCl+0.015 M sodium citrate solution), 50% formamide, 7% sodium dodecyl sulfate (SDS), 10.times.Denhardt's, 5% dextran sulfate and 1% salmon sperm DNA; (2) hybridization for 20 hours at 42.degree. C. followed by 2 washings of 20 minutes at 20.degree. C. in 2.times.SSC+2% SDS, 1 washing of 20 minutes at 20.degree. C. in 0.1.times.SSC+0.1% SDS. The final washing is performed in 0.1.times.SSC+0.1% SDS for 30 minutes at 60.degree. C.

[0038] The subject of the present invention is also a representative fragment of the polynucleotide as defined above, characterized in that it is capable of being obtained either by the use of restriction enzymes whose recognition and cleavage sites are present in said polynucleotide as defined above, or by amplification with the aid of oligonucleotide primers specific for said polynucleotide as defined above, or by transcription in vitro, or by chemical synthesis.

[0039] According to an advantageous embodiment of said fragment, it is selected from the group consisting of: the cDNA corresponding to at least one open reading frame (ORF) chosen from: ORF1a, ORF1b, ORF-S, ORF-E, ORF-M, ORF-N, ORF3, ORF4, ORF7 to ORF11, ORF13 and ORF14 and the cDNA corresponding to the noncoding 5' or 3' ends of said polynucleotide.

[0040] According to an advantageous feature of this embodiment, said fragment has a sequence selected from the group consisting of: [0041] the sequences SEQ ID NO: 2 and 4 representing the cDNA corresponding to the ORF-S which encodes the S protein, [0042] the sequences SEQ ID NO: 13 and 15 representing the cDNA corresponding to the ORF-E which encodes the E protein, [0043] the sequences SEQ ID NO: 1-6 and 18 representing the cDNA corresponding to the ORF-M which encodes the M protein, [0044] the sequences SEQ ID NO: 36 and 38 representing the cDNA corresponding to the ORF-N which encodes the N protein, [0045] the sequences representing the cDNA corresponding respectively: to ORF1a and ORF1b (ORF1ab, SEQ ID NO: 31), to ORF3 and ORF4 (SEQ ID NO: 7, 8), to ORF7 to 11 (SEQ ID NO: 19, 20) to ORF13 (SEQ ID NO: 32) and to ORF14 (SEQ ID NO: 34), and [0046] the sequences representing the cDNAs corresponding respectively to the noncoding 5' (SEQ ID NO: 39 and 72) and 3' (SEQ ID NO: 40, 73) ends of said polynucleotide.

[0047] The subject of the present invention is also a cDNA fragment encoding the S protein, as defined above, characterized in that it has a sequence selected from the group consisting of the sequences SEQ ID NO: 5 and 6 (Sa and Sb fragments).

[0048] The subject of the present invention is also a cDNA fragment corresponding to ORF1a and ORF1b as defined above, characterized in that it has a sequence selected from the group consisting of the sequences SEQ ID NO: 41 to 54 (L0 to L12 fragments).

[0049] The subject of the present invention is also a polynucleotide fragment as defined above, characterized in that it has at least 15 consecutive bases or base pairs of the sequence of the genome of said strain including at least one of those situated in position 7979, 16622, 19064, 23220, 24872, 25298 and 26857. Preferably this is a fragment of 20 to 2500 bases or base pairs, preferably from 20 to 400.

[0050] According to an advantageous embodiment of said fragment, it includes at least one pair of bases or base pairs corresponding to the following positions: 7919 and 23220, 7919 and 25298, 16622 and 23220, 19064 and 23220, 16622 and 25298, 19064 and 25298, 23220 and 24872, 23220 and 26857, 24872 and 25298, 25298 and 26857.

[0051] The subject of the present invention is also primers of at least 18 bases capable of amplifying a fragment of the genome of a SARS-associated coronavirus or of the DNA equivalent thereof.

[0052] According to an embodiment of said primers, they are selected from the group consisting of: [0053] the pair of primers No. 1 corresponding respectively to positions 28507 to 28522 (sense primer, SEQ ID NO: 60) and 28774 to 28759 (antisense primer, SEQ ID NO: 61) of the sequence of the polynucleotide as defined above, [0054] the pair of primers No. 2 corresponding respectively to positions 28375 to 28390 (sense primer, SEQ ID NO: 62) and 28702 to 28687 (antisense primer, SEQ ID NO: 63) of the sequence of the polynucleotide as defined above, and [0055] the pair of primers consisting of the primers SEQ ID Nos: 55 and 56.

[0056] The subject of the present invention is also a probe capable of detecting the presence of the genome of a SARS-associated coronavirus or of a fragment thereof, characterized in that it is selected from the group consisting of: the fragments as defined above and the fragments corresponding to the following positions of the polynucleotide sequence as defined above: 28561 to 28586, 28588 to 28608, 28541 to 28563 and 28565 to 28589 (SEQ ID NO: 64 to 67).

[0057] The probes and primers according to the invention may be labeled directly or indirectly with a radioactive or nonradioactive compound by methods well known to persons skilled in the art so as to obtain a detectable and/or quantifiable signal. Among the radioactive isotopes used, there may be mentioned .sup.32P, .sup.33P, .sup.35S, .sup.3H or .sup.125I. The nonradioactive entities are selected from ligands such as biotin, avidin, streptavidin, digoxygenin, haptens, dyes, luminescent agents such as radioluminescent, chemoluminescent, bioluminescent, fluorescent and phosphorescent agents.

[0058] The invention encompasses the labeled probes and primers derived from the preceding sequences.

[0059] Such probes and primers are useful for the diagnosis of infection by a SARS-associated coronavirus.

[0060] The subject of the present invention is also a method for the detection of a SARS-associated coronavirus, from a biological sample, which method is characterized in that it comprises at least:

[0061] (a) the extraction of nucleic acids present in said biological sample,

[0062] (b) the amplification of a fragment of ORF-N by RT-PCR with the aid of a pair of primers as defined above, and

[0063] (c) the detection, by any appropriate means, of the amplification products obtained in (b).

[0064] The amplification products (amplicons) in (b) are 268 bp for the pair of primers No. 1 and 328 bp for the pair of primers No. 2.

[0065] According to an advantageous embodiment of said method, the step (b) of detection is carried out with the aid of at least one probe corresponding to positions 28561 to 28586, 28588 to 28608, 28541 to 28563 and 28565 to 28589 of the sequence of the polynucleotide as defined above.

[0066] Preferably, the SARS-associated coronavirus genome is detected and optionally quantified by PCR in real time with the aid of the pair of primers No. 2 and probes corresponding to positions 28541 to 28563 and 28565 to 28589 labeled with different compounds, in particular different fluorescent agents.

[0067] The real time RT-PCR which uses this pair of primers and this probe is very sensitive since it makes it possible to detect 102 copies of RNA and up to 10 copies of RNA; it is in addition reliable and reproducible.

[0068] The invention encompasses the single-stranded, double-stranded and triple-stranded polydeoxyribonucleotides and polyribonucleotides corresponding to the sequence of the genome of the isolated strain of coronavirus and its fragments as defined above, and to their sense or antisense complementary sequences, in particular the RNAs and cDNAs corresponding to the sequence of the genome and of its fragments as defined above.

[0069] The present invention also encompasses the amplification fragments obtained with the aid of primers specific for the genome of the purified or isolated strain as defined above, in particular with the aid of primers or pairs of primers as defined above, the restriction fragments formed by or comprising the sequence of fragments as defined above, the fragments obtained by transcription in vitro from a vector containing the sequence SEQ ID NO: 1 or a fragment as defined above, and fragments obtained by chemical synthesis. Examples of restriction fragments are deduced from the restriction map of the sequence SEQ ID NO: 1 illustrated by FIG. 13. In accordance with the invention, said fragments are either in the form of isolated fragments, or in the form of mixtures of fragments. The invention also encompasses fragments modified, in relation to the preceding ones, by removal or addition of nucleotides in a proportion of about 15%, relative to the length of the above fragments and/or modified in terms of the nature of the nucleotides, as long as the modified nucleotide fragments retain a capacity for hybridization with the genomic or antigenomic RNA sequences of the isolate as defined above.

[0070] The nucleic acid molecules according to the invention are obtained by conventional methods, known per se, following standard protocols such as those described in Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley and son Inc., Library of Congress, USA). For example, they may be obtained by amplification of a nucleic sequence by PCR or RT-PCR or alternatively by total or partial chemical synthesis.

[0071] The subject of the present invention is also a DNA or RNA chip or filter, characterized in that it comprises at least one polynucleotide or one of its fragments as defined above.

[0072] The DNA or RNA chips or filters according to the invention are prepared by conventional methods, known per se, such as for example chemical or electrochemical grafting of oligonucleotides on a glass or nylon support.

[0073] The subject of the present invention is also a recombinant cloning and/or expression vector, in particular a plasmid, a virus, a viral vector or a phage comprising a nucleic acid fragment as defined above. Preferably, said recombinant vector is an expression vector in which said nucleic acid fragment is placed under the control of appropriate elements for regulating transcription and translation. In addition, said vector may comprise sequences (tags) fused in phase with the 5' and/or 3' end of said insert, which are useful for the immobilization and/or detection and/or purification of the protein expressed from said vector.

[0074] These vectors are constructed and introduced into host cells by conventional recombinant DNA and genetic engineering methods which are known per se. Numerous vectors into which a nucleic acid molecule of interest may be inserted in order to introduce it and to maintain it in a host cell are known per se; the choice of an appropriate vector depends on the use envisaged for this vector (for example replication of the sequence of interest, expression of this sequence, maintenance of the sequence in extrachromosomal form or alternatively integration into the chromosomal material of the host), and on the nature of the host cell.

[0075] In accordance with the invention, said plasmid is selected in particular from the following plasmids: [0076] the plasmid, called SARS-S, contained in the bacterial strain deposited under the No. I-3059, on Jun. 20, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA sequence encoding the S protein of the SARS-CoV strain derived from the sample recorded under the No. 031589, said sequence corresponding to the nucleotides at positions 21406 to 25348 (SEQ ID NO: 4), with reference to the Genbank sequence AY274119.3, [0077] the plasmid, called SARS-S1, contained in the bacterial strain deposited under the No. I-3020, on May 12, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains a 5' fragment of the cDNA sequence encoding the S protein of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above, said fragment corresponding to the nucleotides at positions 21406 to 23454 (SEQ ID NO: 5), with reference to the Genbank sequence AY274119.3 Tor2, [0078] the plasmid, called SARS-S2, contained in the bacterial strain deposited under the No. I-3019, on May 12, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains a 3' fragment of the cDNA sequence encoding the S protein of the SARS-CoV strain derived from the sample recorded under the number No. 031589, as defined above, said fragment corresponding to the nucleotides at positions 23322 to 25348 (SEQ ID NO: 6), with reference to the Genbank sequence accession No. AY274119.3, [0079] the plasmid, called SARS-SE, contained in the bacterial strain deposited under the No. I-3126, on Nov. 13, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA corresponding to the region situated between ORF-S and ORF-E and overlapping ORF-E of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above, said region corresponding to the nucleotides at positions 25110 to 26244 (SEQ ID NO: 8), with reference to the Genbank sequence accession No. AY274119.3, [0080] the plasmid, called SARS-E, contained in the bacterial strain deposited under the No. I-3046, on May 28, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA sequence encoding the E protein of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above, said sequence corresponding to the nucleotides at positions 26082 to 26413 (SEQ ID NO: 15), with reference to the Genbank sequence accession No. AY274119.3, [0081] the plasmid, called SARS-M, contained in the bacterial strain deposited under the No. I-3047, on May 28, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA sequence encoding the M protein of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above; said sequence corresponding to the nucleotides at positions 26330 to 27098 (SEQ ID NO: 18), with reference to the Genbank sequence accession No. AY274119.3, [0082] the plasmid, called SARS-MN, contained in the bacterial sequence deposited under the No. I-3125, on Nov. 13, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA sequence corresponding to the region situated between ORF-M and ORF-N of the SARS-CoV strain derived from the sample recorded under the No. 031589 and collected in Hanoi, as defined above, said sequence corresponding to the nucleotides at positions 26977 to 28218 (SEQ ID NO: 20), with reference to the Genbank accession No. AY274119.3, [0083] the plasmid, called SARS-N, contained in the bacterial strain deposited under the No. I-3048, on Jun. 5, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA encoding the N protein of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above, said sequence corresponding to the nucleotides at positions 28054 to 29430 (SEQ ID NO: 38), with reference to the Genbank sequence accession No. AY274119.3; thus, this plasmid comprises an insert of sequence SEQ ID NO: 38 and is contained in a bacterial strain which was deposited under the No. I-3048, on Jun. 5, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15, [0084] the plasmid, called SARS-5'NC, contained in the bacterial strain deposited under the No. I-3124, on Nov. 7, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA corresponding to the noncoding 5' end of the genome of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above, said sequence corresponding to the nucleotides at positions 1 to 204 (SEQ ID NO: 39), with reference to the Genbank sequence accession No. AY274119.3, [0085] the plasmid called SARS-3'NC, contained in the bacterial strain deposited under the No. I-3123 on Nov. 7, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA sequence corresponding to the noncoding 3' end of the genome of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above, said sequence corresponding to that situated between the nucleotide and position 28933 to 29727 (SEQ ID NO: 40), with reference to the Genbank sequence accession No. AY274119.3, ends with a series of nucleotides a., [0086] the expression plasmid, called pIV2.3N, containing a cDNA fragment encoding a C-terminal fusion of the N protein (SEQ ID NO: 37) with a polyhistidine tag, [0087] the expression plasmid, called pIV2.3S.sub.C, containing a cDNA fragment encoding a C-terminal fusion of the fragment corresponding to positions 475 to 1193 of the amino acid sequence of the S protein (SEQ ID NO: 3) with a polyhistidine tag, [0088] the expression plasmid, pIV2.3S.sub.L, containing a cDNA fragment encoding a C-terminal fusion of the fragment corresponding to positions 14 to 1193 of the amino acid sequence of the S protein (SEQ ID NO: 3) with a polyhistidine tag, [0089] the expression plasmid, called pIV2.4N, containing a cDNA fragment encoding a N-terminal fusion of the N protein (SEQ ID NO: 3) with a polyhistidine tag, [0090] the expression plasmid, called pIV2.4S.sub.C or pIV2.4S.sub.1, containing an insert encoding a N-terminal fusion of the fragment corresponding to positions 475 to 1193 of the amino acid sequence of the S protein (SEQ ID NO: 3) with a polyhistidine tag, and [0091] the expression plasmid, called pIV2.4S.sub.L, containing a cDNA fragment encoding an N-terminal fusion of the fragment corresponding to positions 14 to 1193 of the amino acid sequence of the S protein (SEQ ID NO: 3) with a polyhistidine tag.

[0092] According to an advantageous feature of the expression plasmid as defined above, it is contained in a bacterial strain which was deposited under the No. I-3117, on Oct. 23, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15.

[0093] According to another advantageous feature of the expression plasmid as defined above, it is contained in a bacterial strain which was deposited under the No. I-3118, on Oct. 23, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15.

[0094] According to another feature of the expression plasmid as defined above, it is contained in a bacterial strain which was deposited at the CNCM, 25 rue du Docteur Roux, 75724 Paris Cedex 15 under the following numbers: [0095] a) strain No. I-3118, deposited on Oct. 23, 2003, [0096] b) strain No. I-3019, deposited on May 12, 2003, [0097] c) strain No. I-3020, deposited on May 12, 2003, [0098] d) strain No. I-3059, deposited on Jun. 20, 2003, [0099] e) strain No. I-3323, deposited on Nov. 22, 2004, [0100] f) strain No. I-3324, deposited on Nov. 22, 2004, [0101] g) strain No. I-3326, deposited on Dec. 1, 2004, [0102] h) strain No. I-3327, deposited on Dec. 1, 2004, [0103] i) strain No. I-3332, deposited on Dec. 1, 2004, [0104] j) strain No. I-3333, deposited on Dec. 1, 2004, [0105] k) strain No. I-3334, deposited on Dec. 1, 2004, [0106] l) strain No. I-3335, deposited on Dec. 1, 2004, [0107] m) strain No. I-3336, deposited on Dec. 1, 2004, [0108] n) strain No. I-3337, deposited on Dec. 1, 2004, [0109] o) strain No. I-3338, deposited on Dec. 2, 2004, [0110] p) strain No. I-3339, deposited on Dec. 2, 2004, [0111] q) strain No. I-3340, deposited on Dec. 2, 2004, [0112] r) strain No. I-3341, deposited on Dec. 2, 2004.

[0113] The subject of the present invention is also a nucleic acid insert of viral origin, characterized in that it is contained in any of the strains as defined above in a)-r).

[0114] The subject of the present invention is also a nucleic acid containing a synthetic gene allowing optimized expression of the S protein in eukaryotic cells, characterized in that it possesses the sequence SEQ ID NO: 140.

[0115] The subject of the present invention is also an expression vector containing a nucleic acid containing a synthetic gene allowing optimized expression of the S protein, which vector is contained in the bacterial strain deposited at the CNCM, on Dec. 1, 2004, under the No. I-3333.

[0116] According to one embodiment of said expression vector, it is a viral vector, in the form of a viral particle or in the form of a recombinant genome.

[0117] According to an advantageous feature of this embodiment, this is a recombinant viral particle or a recombinant viral genome capable of being obtained by transfection of a plasmid according to paragraphs g), h) and k) to r) as defined above, in an appropriate cellular system, that is to say, for example, cells transfected with one or more other plasmids intended to transcomplement certain functions of the virus that are deleted in the vector and that are necessary for the formation of the viral particles.

[0118] The expression "S protein family" is understood here to mean the complete S protein, its ectodomain and fragments of this ectodomain which are preferably produced in a eukaryotic system.

[0119] The subject of the present invention is also a lentiviral vector encoding a polypeptide of the S protein family, as defined above.

[0120] The subject of the present invention is also a recombinant measles virus encoding a polypeptide of the S protein family, as defined above.

[0121] The subject of the present invention is also a recombinant vaccinia virus encoding a polypeptide of the S protein family, as defined above.

[0122] The subject of the present invention is also the use of a vector according to paragraphs e) to r) as defined above, or of a vector containing a synthetic gene for the S protein, as defined above, for the production, in a eukaryotic system, of the SARS-associated coronavirus S protein or of a fragment of this protein.

[0123] The subject of the present invention is also a method for producing the S protein in a eukaryotic system, comprising a step of transfecting eukaryotic cells in culture with a vector chosen from the vectors contained in the bacterial strains mentioned in paragraphs e) to r) above or a vector containing a synthetic gene allowing optimized expression of the S protein.

[0124] The subject of the present invention is also a cDNA library characterized in that it comprises fragments as defined above, in particular amplification fragments or restriction fragments, cloned into a recombinant vector, in particular an expression vector (expression library).

[0125] The subject of the present invention is also cells, in particular prokaryotic cells, modified by a recombinant vector as defined above.

[0126] The subject of the present invention is also a genetically modified eukaryotic cell expressing a protein or a polypeptide as defined above. Quite obviously, the terms "genetically modified eukaryotic cell" do not denote a cell modified with a wild-type virus.

[0127] According to an advantageous embodiment of said cell, it is capable of being obtained by transfection with any of the vectors mentioned in paragraphs K) to N) above.

[0128] According to an advantageous feature of this embodiment, this is the cell FRhK4-Ssol-30, deposited at the CNCM on Nov. 22, 2004, under the No. I-3325.

[0129] The recombinant vectors as defined above and the cells transformed with said expression vectors are advantageously used for the production of the corresponding proteins and peptides. The expression libraries derived from said vectors, and the cells transformed with said expression libraries are advantageously used to identify the immunogenic epitopes (B and T epitopes) of the SARS-associated coronavirus proteins.

[0130] The subject of the present invention is also the purified or isolated proteins and peptides, characterized in that they are encoded by the polynucleotide or one of its fragments as defined above.

[0131] According to an advantageous embodiment of the invention, said protein is selected from the group consisting of: [0132] the S protein having the sequence SEQ ID NO: 3 or its ectodomain [0133] the E protein having the sequence SEQ ID NO: 14 [0134] the M protein having the sequence SEQ ID NO: 17 [0135] the N protein having the sequence SEQ ID NO: 37 [0136] the proteins encoded by the ORFs: ORF1a, ORF1b, ORF3, ORF4 and ORF7 to ORF11, ORF13 and ORF14 and having the respective sequence, SEQ ID NO: 74, 75, 10, 12, 22, 24, 26, 28, 30, 33 and 35.

[0137] The terms "ectodomain of the S protein" and "soluble form of the S protein" will be used interchangeably below.

[0138] According to an advantageous embodiment of the invention, said polypeptide consists of the amino acids corresponding to positions 1 to 1193 of the amino acid sequence of the S protein.

[0139] According to another advantageous embodiment of the invention, said peptide is selected from the group consisting of:

[0140] a) the peptides corresponding to positions 14 to 1193 and 475 to 1193 of the amino acid sequence of the S protein,

[0141] b) the peptides corresponding to positions 2 to 14 (SEQ ID NO: 69) and 100 to 221 of the amino acid sequence of the M protein; these peptides correspond respectively to the ectodomain and to the endodomain of the M protein, and

[0142] c) the peptides corresponding to positions 1 to 12 (SEQ ID NO: 70) and 53 to 76 (SEQ ID NO: 71) of the amino acid sequence of the E protein; these peptides correspond respectively to the ectodomain and to the C-terminal end of the E protein, and

[0143] d) the peptides of 5 to 50 consecutive amino acids, preferably of 10 to 30 amino acids, inclusive or partially or completely overlapping the sequence of the peptides as defined in a), b) or c).

[0144] The subject of the present invention is also a peptide, characterized in that it has a sequence of 7 to 50 amino acids including an amino acid residue selected from the group consisting of: [0145] the alanine situated at position 2552 of the amino acid sequence of the protein encoded by ORF1a, [0146] the serine situated at position 577 of the amino acid sequence of the S protein of the SARS-CoV strain as defined above, [0147] the glycine at position 11 of the amino acid sequence of the protein encoded by ORF3 of the SARS-CoV strain as defined above, [0148] the serine at position 154 of the amino acid sequence of the M protein of the SARS-CoV strain as defined above.

[0149] The subject of the present invention is also an antibody or a polyclonal or monoclonal antibody fragment which can be obtained by immunization of an animal with a recombinant vector as defined above, a cDNA library as defined above or alternatively a protein or a peptide as defined above, characterized in that it binds to at least one of the proteins encoded by SARS-CoV as defined above.

[0150] The invention encompasses the polyclonal antibodies, the monoclonal antibodies, the chimeric antibodies such as the humanized antibodies, and fragments thereof (Fab, Fv, scFv).

[0151] A subject of the present invention is also a hybridoma producing a monoclonal antibody against the N protein, characterized in that it is chosen from the following hybridomas: [0152] the hybridoma producing the monoclonal antibody 87, deposited at the CNCM on Dec. 1, 2004 under the number I-3328, [0153] the hybridoma producing the monoclonal antibody 86, deposited at the CNCM on Dec. 1, 2004 under the number I-3329, [0154] the hybridoma producing the monoclonal antibody 57, deposited at the CNCM on Dec. 1, 2004 under the number I-3330, and [0155] the hybridoma producing the monoclonal antibody 156, deposited at the CNCM on Dec. 1, 2004 under the number I-3331.

[0156] The subject of the present invention is also a polyclonal or monoclonal antibody or antibody fragment directed against the N protein, characterized in that it is produced by a hybridoma as defined above.

[0157] For the purposes of the present invention, the expression chimeric antibody is understood to mean, in relation to an antibody of a particular animal species or of a particular class of antibody, an antibody comprising all or part of a heavy chain and/or of a light chain of an antibody of another animal species or of another class of antibody.

[0158] For the purposes of the present invention, the expression humanized antibody is understood to mean a human immunoglobulin in which the residues of the CDRs (Complementary Determining Regions) which form the antigen-binding site are replaced by those of a nonhuman monoclonal antibody possessing the desired specificity, affinity or activity. Compared with the nonhuman antibodies, the humanized antibodies are less immunogenic and possess a prolonged half-life in humans because they possess only a small proportion of nonhuman sequences given that practically all the residues of the FR (Framework) regions and of the constant (Fc) region of these antibodies are those of a consensus sequence of human immunoglobulins.

[0159] A subject of the present invention is also a protein chip or filter, characterized in that it comprises a protein, a peptide or alternatively an antibody as defined above.

[0160] The protein chips according to the invention are prepared by conventional methods known per se. Among the appropriate supports on which proteins may be immobilized, there may be mentioned those made of plastic or glass, in particular in the form of microplates.

[0161] The subject of the present invention is also reagents derived from the isolated strain of SARS-associated coronavirus, derived from the sample recorded under the No. 031589, which are useful for the study and diagnosis of the infection caused by a SARS-associated coronavirus, said reagents are selected from the group consisting of: [0162] (a) a pair of primers, a probe or a DNA chip as defined above, [0163] (b) a recombinant vector or a modified cell as defined above, [0164] (c) an isolated coronavirus strain or a polynucleotide as defined above, [0165] (d) a protein or a peptide as defined above, [0166] (e) an antibody or an antibody fragment as defined above, and [0167] (f) a protein chip as defined above.

[0168] These various reagents are prepared and used according to conventional molecular biology and immunology techniques following standard protocols such as those described in Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley and Son Inc., Library of Congress, USA), in Current Protocols in Immunology (John E. Cologan, 2000, Wiley and Son Inc., Library of Congress, USA) and in Antibodies: A Laboratory Manual (E. Howell and D. Lane, Cold Spring Harbor Laboratory, 1988).

[0169] The nucleic acid fragments according to the invention are prepared and used according to conventional techniques as defined above. The peptides and proteins according to the invention are prepared by recombinant DNA techniques, known to persons skilled in the art, in particular with the aid of the recombinant vectors as defined above. Alternatively, the peptides according to the invention may be prepared by conventional techniques of solid or liquid phase synthesis, known to persons skilled in the art.

[0170] The polyclonal antibodies are prepared by immunizing an appropriate animal with a protein or a peptide as defined above, optionally coupled to KLH or to albumin and/or combined with an appropriate adjuvant such as (complete or incomplete) Freund's adjuvant or aluminum hydroxide; after obtaining a satisfactory antibody titer, the antibodies are harvested by collecting serum from the immunized animals and enriched with IgG by precipitation, according to conventional techniques, and then the IgGs specific for the SARS-CoV proteins are optionally purified by affinity chromatography on an appropriate column to which said peptide or said protein is attached, as defined above, so as to obtain a monospecific IgG preparation.

[0171] The monoclonal antibodies are produced from hybridomas obtained by fusion of B lymphocytes from an animal immunized with a protein or a peptide as defined above with myelomas, according to the Kohler and Milstein technique (Nature, 1975, 256, 495-497); the hybridomas are cultured in vitro, in particular in fermenters or produced in vivo, in the form of ascites; alternatively, said monoclonal antibodies are produced by genetic engineering as described in American patent U.S. Pat. No. 4,816,567.

[0172] The humanized antibodies are produced by general methods such as those described in International application WO 98/45332.

[0173] The antibody fragments are produced from the cloned V.sub.H and V.sub.L regions, from the mRNAs of hybridomas or splenic lymphocytes of an immunized mouse; for example, the Fv, scFv or Fab fragments are expressed at the surface of filamentous phages according to the Winter and Milstein technique (Nature, 1991, 349, 293-299); after several selection steps, the antibody fragments specific for the antigen are isolated and expressed in an appropriate expression system, by conventional techniques for cloning and expression of recombinant DNA.

[0174] The antibodies or fragments thereof as defined above are purified by conventional techniques known to persons skilled in the art, such as affinity chromatography.

[0175] The subject of the present invention is additionally the use of a product selected from the group consisting of: a pair of primers, a probe, a DNA chip, a recombinant vector, a modified cell, an isolated coronavirus strain, a polynucleotide, a protein or a peptide, an antibody or an antibody fragment and a protein chip as defined above, for the preparation of a reagent for the detection and optionally genotyping/serotyping of a SARS-associated coronavirus.

[0176] The proteins and peptides according to the invention, which are capable of being recognized and/or of inducing the production of antibodies specific for the SARS-associated coronavirus, are useful for the diagnosis of infection with such a coronavirus; the infection is detected, by an appropriate technique--in particular EIA, ELISA, RIA, immunofluorescence--, in a biological sample collected from an individual capable of being infected.

[0177] According to an advantageous feature of said use, said proteins are selected from the group consisting of the S, E, M and/or N proteins and the peptides as defined above.

[0178] The S, E, M and/or N proteins and the peptides derived from these proteins as defined above, for example the N protein, are used for the indirect diagnosis of a SARS-associated coronavirus infection (serological diagnosis; detection of an antibody specific for SARS-CoV), in particular by an immunoenzymatic method (ELISA).

[0179] The antibodies and antibody fragments according to the invention, in particular those directed against the S, E, M and/or N proteins and the derived peptides as defined above, are useful for the direct diagnosis of a SARS-associated coronavirus infection; the detection of the protein(s) of SARS-CoV is carried out by an appropriate technique, in particular EIA, ELISA, RIA, immunofluorescence, in a biological sample collected from an individual capable of being infected.

[0180] The subject of the present invention is also a method for the detection of a SARS-associated coronavirus, from a biological sample, which method is characterized in that it comprises at least: [0181] (a) bringing said biological sample into contact with at least one antibody or one antibody fragment, one protein, one peptide or alternatively one protein or peptide chip or filter as defined above, and [0182] (b) visualizing by any appropriate means antigen-antibody complexes formed in (a), for example by EIA, ELISA, RIA, or by immunofluorescence.

[0183] According to one advantageous embodiment of said process, step (a) comprises: [0184] (a.sub.1) bringing said biological sample into contact with at least a first antibody or an antibody fragment which is attached to an appropriate support, in particular a microplate, [0185] (a.sub.2) washing the solid phase, and [0186] (a.sub.3) adding at least a second antibody or an antibody fragment, different from the first, said antibody or antibody fragment being optionally appropriately labeled.

[0187] This method, which makes it possible to capture the viral particles present in the biological sample, is also called immunocapture method.

[0188] For example: [0189] step (a.sub.1) is carried out with at least a first monoclonal or polyclonal antibody or a fragment thereof, directed against the S, M and/or E protein, and/or a peptide corresponding to the ectodomain of one of these proteins (M2-14 or E1-12 peptides) [0190] step (a.sub.3) is carried out with at least one antibody or an antibody fragment directed against another epitope of the same protein or preferably against another protein, preferably against an inner protein such as the N nucleoprotein or the endodomain of the E or M protein, more preferably still these are antibodies or antibody fragments directed against the N protein which is very abundant in the viral particle; when an antibody or an antibody fragment directed against an inner protein (N) or against the endodomain of the E or M proteins is used, said antibody is incubated in the presence of detergent, such as Tween 20 for example, at concentrations of the order of 0.1%. [0191] step (b) for visualizing the antigen-antibody complexes formed is carried out, either directly with the aid of a second antibody labeled for example with biotin or an appropriate enzyme such as peroxidase or alkaline phosphatase, or indirectly with the aid of an anti-immunoglobulin serum labeled as above. The complexes thus formed are visualized with the aid of an appropriate substrate.

[0192] According to a preferred embodiment of this aspect of the invention, the biological sample is mixed with the visualizing monoclonal antibody prior to its being brought into contact with the capture monoclonal antibodies. Where appropriate, the serum-visualizing antibody mixture is incubated for at least 10 minutes at room temperature before being applied to the plate.

[0193] The subject of the present invention is also an immunocapture test intended to detect an infection by the SARS-associated coronavirus by detecting the native nucleoprotein (N protein), in particular characterized in that the antibody used for the capture of the native viral nucleoprotein is a monoclonal antibody specific for the central region and/or for a conformational epitope.

[0194] According to one embodiment of said test, the antibody used for the capture of the N protein is the monoclonal antibody mAb87, produced by the hybridoma deposited at the CNCM on Dec. 1, 2004 under the number I-3328.

[0195] According to another embodiment of said immunocapture test, the antibody used for the capture of the N protein is the monoclonal antibody mAb86, produced by the hybridoma deposited at the CNCM on Dec. 1, 2004 under the number I-3329.

[0196] According to another embodiment of said immunocapture test, the monoclonal antibodies mAb86 and mAb87 are used for the capture of the N protein.

[0197] In the immunocapture tests according to the invention, it is possible to use, for visualizing the N protein, the monoclonal antibody mAb57, produced by the hybridoma deposited at the CNCM on Dec. 1, 2004 under the number I-3330, said antibody being conjugated with a visualizing molecule or particle.

[0198] In accordance with said immunocapture test, a combination of the antibodies mAb57 and mAb87, conjugated with a visualizing molecule or particle, is used for the visualization of the N protein.

[0199] A visualizing molecule may be a radioactive atom, a dye, a fluorescent molecule, a fluorophore, an enzyme; a visualizing particle may be for example: colloidal gold, a magnetic particle or a latex bead.

[0200] The subject of the present invention is also a reagent for detecting a SARS-associated coronavirus, characterized in that it is selected from the group consisting of: [0201] (a) a pair of primers or a probe as defined above, [0202] (b) a recombinant vector as defined above or a modified cell as defined above, [0203] (c) an isolated coronavirus strain as defined above or a polynucleotide as defined above, [0204] (d) an antibody or an antibody fragment as defined above, [0205] (e) a combination of antibodies comprising the monoclonal antibodies mAb86 and/or mAb87, and the monoclonal antibody mAb57, as defined above, [0206] (f) a chip or a filter as defined above.

[0207] The subject of the present invention is also a method for the detection of a SARS-associated coronavirus infection, from a biological sample, by indirect IgG ELISA using the N protein, which method is characterized in that the plates are sensitized with an N protein solution at a concentration of between 0.5 and 4 .mu.g/ml, preferably to 2 .mu.g/ml, in a 10 mM PBS buffer pH 7.2, phenol red at 0.25 ml/l.

[0208] The subject of the present invention is additionally a method for the detection of a SARS-associated coronavirus infection, from a biological sample, by double epitope ELSA, characterized in that the serum to be tested is mixed with the visualizing antigen, said mixture then being brought into contact with the antigen attached to a solid support.

[0209] According to one variant of the tests for detecting SARS-associated coronaviruses, these tests combine an ELSA using the N protein, and another ELSA using the S protein, as described below.

[0210] The subject of the present invention is also an immune complex formed of a polyclonal or monoclonal antibody or antibody fragment as defined above, and of a SARS-associated coronavirus protein or peptide.

[0211] The subject of the present invention is additionally a SARS-associated coronavirus detection kit, characterized in that it comprises at least one reagent selected from the group consisting of: a pair of primers, a probe, a DNA or RNA chip, a recombinant vector, a modified cell, an isolated coronavirus strain, a polynucleotide, a protein or a peptide, an antibody, and a protein chip as defined above.

[0212] The subject of the present invention is additionally an immunogenic composition, characterized in that it comprises at least one product selected from the group consisting of: [0213] a) a protein or a peptide as defined above, [0214] b) a polynucleotide of the DNA or RNA type or one of its representative fragments as defined above, having a sequence chosen from: [0215] (i) the sequence SEQ ID NO: 1 or its RNA equivalent [0216] (ii) the sequence hybridizing under high stringency conditions with the sequence SEQ ID NO: 1, [0217] (iii) the sequence complementary to the sequence SEQ ID NO: 1 or to the sequence hybridizing under high stringency conditions with the sequence SEQ ID NO: 1, [0218] (iv) the nucleotide sequence of a representative fragment of the polynucleotide as defined in (i), (ii) or (iii), [0219] (v) the sequence as defined in (i), (ii), (iii) or (iv), modified, and [0220] c) a recombinant expression vector comprising a polynucleotide as defined in b), and [0221] d) a cDNA library as defined above, said immunogenic composition being capable of inducing protective humoral or cellular immunity specific for the SARS-associated coronavirus, in particular the production of an antibody directed against a specific epitope of the SARS-associated coronavirus.

[0222] The proteins and peptides as defined above, in particular the S, M, E and/or N proteins and the derived peptides, and the nucleic acid (DNA or RNA) molecules encoding said proteins or said peptides are good candidate vaccines and may be used in immunogenic compositions for the production of a vaccine against the SARS-associated coronavirus.

[0223] According to an advantageous embodiment of the compositions according to the invention, they additionally contain at least one pharmaceutically acceptable vehicle and optionally carrier substances and/or adjuvants.

[0224] The pharmaceutically acceptable vehicles, the carrier substances and the adjuvants are those conventionally used.

[0225] The adjuvants are advantageously chosen from the group consisting of oily emulsions, saponin, mineral substances, bacterial extracts, aluminum hydroxide and squalene.

[0226] The carrier substances are advantageously selected from the group consisting of unilamellar liposomes, multilamellar liposomes, micelles of saponin or solid microspheres of a saccharide or auriferous nature.

[0227] The compositions according to the invention are administered by the general route, in particular by the intramuscular or subcutaneous route or alternatively by the local, in particular nasal (aerosol) route.

[0228] The subject of the present invention is also the use of an isolated or purified protein or peptide having a sequence selected from the group consisting of the sequences SEQ ID NO: 3, 10, 12, 14, 17, 22, 24, 26, 28, 30, 33, 35, 37, 69, 70, 71, 74 and 75 to form an immune complex with an antibody specifically directed against an epitope of the SARS-associated coronavirus.

[0229] The subject of the present invention is also an immune complex consisting of an isolated or purified protein or peptide having a sequence selected from the group consisting of the sequences SEQ ID NO: 3, 10, 12, 14, 17, 22, 24, 26, 28, 30, 33, 35, 37, 69, 70, 71, 74 and 75, and of an antibody specifically directed against an epitope of the SARS-associated coronavirus.

[0230] The subject of the present invention is also the use of an isolated or purified protein or peptide having a sequence selected from the group consisting of the sequences SEQ ID NO: 3, 10, 12, 14, 17, 22, 24, 26, 28, 30, 33, 35, 37, 69, 70, 71, 74 and 75 to induce the production of an antibody capable of specifically recognizing an epitope of the SARS-associated coronavirus.

[0231] The subject of the present invention is also the use of an isolated or purified polynucleotide having a sequence selected from the group consisting of the sequences SEQ ID NO: 1, 2, 4, 7, 8, 13, 15, 16, 18, 19, 20, 31, 36 and 38 to induce the production of an antibody directed against the protein encoded by said polynucleotide and capable of specifically recognizing an epitope of the SARS-associated coronavirus.

[0232] The subject of the present invention is also monoclonal antibodies recognizing the native S protein of a SARS-associated coronavirus.

[0233] The subject of the present invention is also the use of a protein or a polypeptide of the S protein family, as defined above, or of an antibody recognizing the native S protein, as defined above, to detect an infection by a SARS-associated coronavirus, in a biological sample.

[0234] The subject of the present invention is also a method for detecting an infection by a SARS-associated coronavirus, in a biological sample, characterized in that the detection is carried out by ELISA using the recombinant S protein, expressed in a eukaryotic system.

[0235] According to an advantageous embodiment of said method, it is a double epitope ELISA method, and the serum to be tested is mixed with the visualizing antigen, said mixture then being brought into contact with the antigen attached to a solid support.

[0236] The subject of the present invention is also an immune complex consisting of a monoclonal antibody or antibody fragment recognizing the native S protein, and of a protein or a peptide of the SARS-associated coronavirus.

[0237] The subject of the present invention is also an immune complex consisting of a protein or a polypeptide of the S protein family, as defined above, and of an antibody specifically directed against an epitope of the SARS-associated coronavirus.

[0238] The subject of the present invention is additionally a SARS-associated coronavirus detection kit or box, characterized in that it comprises at least one reagent selected from the group consisting of: a protein or polypeptide of the S protein family, as defined above, a nucleic acid encoding a protein or peptide of the S protein family, as defined above, a cell expressing a protein or polypeptide of the S protein family, as defined above, or an antibody recognizing the native S protein of a SARS-associated coronavirus.

[0239] The subject of the present invention is an immunogenic and/or vaccine composition, characterized in that it comprises a polypeptide or a recombinant protein of the S protein family, as defined above, obtained in a eukaryotic expression system.

[0240] The subject of the present invention is also an immunogenic and/or vaccine composition, characterized in that it comprises a vector or recombinant virus, expressing a protein or a polypeptide of the S protein family, as defined above.

[0241] In addition to the preceding features, the invention further comprises other features, which will emerge from the description which follows, which refers to examples of use of the polynucleotide representing the genome of the SARS-CoV strain derived from the sample recorded under the number 031589, and derived cDNA fragments which are the subject of the present invention, and to Table I presenting the sequence listing: TABLE-US-00001 TABLE I Sequence listing Deposit Position number at of the the CNCM cDNA with of the reference to correspond- Identification Genbank ing number Sequence AY274119.3 plasmid SEQ ID NO: 1 genome of the -- -- strain derived from the sample 031589 SEQ ID NO: 2 ORF-S* 21406-25348 -- SEQ ID NO: 3 S protein -- -- SEQ ID NO: 4 ORF-S** 21406-25348 I-3059 SEQ ID NO: 5 Sa fragment 21406-23454 I-3020 SEQ ID NO: 6 Sb fragment 23322-25348 I-3019 SEQ ID NO: 7 ORF-3 + ORF-4* 25110-26244 -- SEQ ID NO: 8 ORF-3 + ORF-4** 25110-26244 I-3126 SEQ ID NO: 9 ORF3 -- -- SEQ ID NO: 10 ORF-3 protein -- -- SEQ ID NO: 11 ORF4 -- -- SEQ ID NO: 12 ORF-4 protein -- -- SEQ ID NO: 13 ORF-E* 26082-26413 -- SEQ ID NO: 14 E protein -- -- SEQ ID NO: 15 ORF-E** 26082-26413 I-3046 SEQ ID NO: 16 ORF-M* 26330-27098 -- SEQ ID NO: 17 M protein -- -- SEQ ID NO: 18 ORF-M** 26330-27098 I-3047 SEQ ID NO: 19 ORF7 to 11* 26977-28218 -- SEQ ID NO: 20 ORF7 to 11** 26977-28218 I-3125 SEQ ID NO: 21 ORF7 -- -- SEQ ID NO: 22 ORF7 protein -- -- SEQ ID NO: 23 ORF8 -- -- SEQ ID NO: 24 ORF8 protein -- -- SEQ ID NO: 25 ORF9 -- -- SEQ ID NO: 26 ORF9 protein -- -- SEQ ID NO: 27 ORF10 -- -- SEQ ID NO: 28 ORF10 protein -- -- SEQ ID NO: 29 ORF11 -- -- SEQ ID NO: 30 ORF11 protein -- -- SEQ ID NO: 31 OrF1ab 265-21485 -- SEQ ID NO: 32 ORF13 28130-28426 -- SEQ ID NO: 33 ORF13 protein -- -- SEQ ID NO: 34 ORF14 -- -- SEQ ID NO: 35 ORF14 protein 28583-28795 -- SEQ ID NO: 36 ORF-N* 28054-29430 SEQ ID NO: 37 N protein -- -- SEQ ID NO: 38 ORF-N** 28054-29430 I-3048 SEQ ID NO: 39 noncoding 5'** 1-204 I-3124 SEQ ID NO: 40 noncoding 3'** 28933-29727 I-3123 SEQ ID NO: 41 ORF1ab 30-500 -- Fragment L0 SEQ ID NO: 42 Fragment L1 211-2260 -- SEQ ID NO: 43 Fragment L2 2136-4187 -- SEQ ID NO: 44 Fragment L3 3892-5344 -- SEQ ID NO: 45 Fragment L4b 4932-6043 -- SEQ ID NO: 46 Fragment L4 5305-7318 -- SEQ ID NO: 47 Fragment L5 7275-9176 -- SEQ ID NO: 48 Fragment L6 9032-11086 -- SEQ ID NO: 49 Fragment L7 10298-10982 -- SEQ ID NO: 50 Fragment L8 12815-14854 -- SEQ ID NO: 51 Fragment L9 14745-16646 -- SEQ ID NO: 52 Fragment L10 16514-18590 -- SEQ ID NO: 53 Fragment L11 18500-20602 -- SEQ ID NO: 54 Fragment L12 20319-22224 -- SEQ ID NO: 55 Sense N primer -- -- SEQ ID NO: 56 Antisense -- -- N primer SEQ ID NO: 57 Sense S.sub.C primer -- -- SEQ ID NO: 58 Sense S.sub.L primer -- -- SEQ ID NO: 59 Antisense S.sub.C -- -- and S.sub.L primer SEQ ID NO: 60 Sense primer 28507-28522 -- series 1 SEQ ID NO: 61 Antisense primer 28774-28759 series 1 SEQ ID NO: 62 Sense primer 28375-28390 -- series 2 SEQ ID NO: 63 Antisense primer 28702-28687 -- series 2 SEQ ID NO: 64 Probe 1/series 1 28561-28586 -- SEQ ID NO: 65 Probe 2/series 1 28588-28608 -- SEQ ID NO: 66 Probe 1/series 2 28541-28563 -- SEQ ID NO: 67 Probe 2/series 2 28565-28589 -- SEQ ID NO: 68 Anchor primer 14T SEQ ID NO: 69 Peptide M2-14 -- -- SEQ ID NO: 70 Peptide E1-12 -- -- SEQ ID NO: 71 Peptide E53-76 -- -- SEQ ID NO: 72 Noncoding 5'* 1-204 -- SEQ ID NO: 73 Noncoding 3'* 28933-29727 -- SEQ ID NO: 74 ORF1a protein -- -- SEQ ID NO: 75 ORF1b protein -- -- SEQ ID NO: 76-139 Primers SEQ ID NO: 140 Pseudogene of S SEQ ID NO: 141-148 Primers SEQ ID NO: 149 Aa1-13 of S SEQ ID NO: 150 Polypeptide SEQ ID NO: 151-158 Primers *PCR amplification product (amplicon) **Insert cloned into the plasmid deposited at the CNCM and to the appended drawings in which:

[0242] FIG. 1 illustrates Western-blot analysis of the expression in vitro of the recombinant proteins N, S.sub.C and S.sub.L from the expression vectors pIVEX. Lane 1: pIV2.3N. Lane 2: pIV2.3S.sub.C. Lane 3: pIV2.3S.sub.L. Lane 4: pIV2.4N. Lane 5: pIV2.4S.sub.1 or pIV2.4S.sub.C. Lane 6: pIV2.4S.sub.L. The expression of the GFP protein expressed from the same vector is used as a control.

[0243] FIG. 2 illustrates the analysis, by polyacrylamide gel electrophoresis under denaturing conditions (SDS-PAGE) and staining with Coomassie blue, of the expression in vivo of the N protein from the expression vectors pIVEX. The E. coli BL21(DE3)pDIA17 strain transformed with the recombinant vectors pIVEX is cultured at 30.degree. C. in LB medium, in the presence or in the absence of inducer (IPTG 1 mM). Lane 1: pIV2.3N. Lane 2: pIV2.4N.

[0244] FIG. 3 illustrates the analysis, by polyacrylamide gel electrophoresis under denaturing conditions (SDS-PAGE) and staining with Coomassie blue, of the expression in vivo of the S.sub.L and S.sub.C polypeptides from the expression vectors pIVEX. The E. coli BL21(DE3)pDIA17 strain transformed with the recombinant vectors pIVEX is cultured at 30.degree. C. in LB medium, in the presence or in the absence of inducer (IPTG 1 mM). Lane 1: pIV2.3S.sub.C. Lane 2: pIV2.3S.sub.L. Lane 3: pIV2.4S.sub.1. Lane 4: pIV2.4S.sub.L.

[0245] FIG. 4 illustrates the antigenic activity of the recombinant N, S.sub.L and S.sub.C proteins produced in the E. coli BL21(DE3)pDIA17 strain transformed with the recombinant vectors pIVEX. A: electrophoresis (SDS-PAGE) of the bacterial lysates. B and C: Western-blot with the sera, obtained from the same patient infected with SARS-CoV, collected 8 days (B: serum M12) and 29 days (C: serum M13) respectively after the onset of the SARS symptoms. Lane 1: pIV2.3N. Lane 2: pIV2.4N. Lane 3: pIV2.3S.sub.C. Lane 4: pIV2.4S.sub.1. Lane 5: pIV2.3S.sub.L. Lane 6: pIV2.4S.sub.L.

[0246] FIG. 5 illustrates the purification on an Ni-NTA agarose column of the recombinant N protein produced in the E. coli BL21(DE3)pDIA17 strain from the vector pIV2.3N. Lane 1: total bacterial extract. Lane 2: soluble extract. Lane 3: insoluble extract. Lane 4: extract deposited on the Ni-NTA column. Lane 5: unbound proteins. Lane 6: fractions of peak 1. Lane 7: fractions of peak 2.

[0247] FIG. 6 illustrates the purification of the recombinant S.sub.C protein from the inclusion bodies produced in the E. coli BL21(DE3)pDIA17 strain transformed with pIV2.4S.sub.1. A. Treatment with Triton X-100 (2%): Lane 1: total bacterial extract. Lane 2: soluble extract. Lane 3: insoluble extract. Lane 4: supernatant after treatment with Triton X-100 (2%). Lanes 5 and 6: pellet after treatment with Triton X-100 (2%). B: Treatment with 4 M, 5 M, 6 M and 7 M urea of the soluble and insoluble extracts.

[0248] FIG. 7 represents the immunoblot produced with the aid of a lysate of cells infected with SARS-CoV and a serum from a patient suffering from atypical pneumopathy.

[0249] FIG. 8 represents immunoblots produced with the aid of a lysate of cells infected with SARS-CoV and rabbit immunosera specific for the nucleoprotein N (A) and for the spicule protein S (B). I.S.: immune serum. p.i.: preimmune serum. The anti-N immune serum was used at 1/50 000 and the anti-S immune serum at 1/10 000.

[0250] FIG. 9 illustrates the ELISA reactivity of the rabbit monospecific polyclonal sera directed against the N protein or the short fragment of the S protein (S.sub.C), toward the corresponding recombinant proteins used for immunization. A: rabbits P13097, P13081 and P13031 immunized with the purified recombinant N protein. B: rabbits P11135, P13042 and P14001 immunized with a preparation of inclusion bodies corresponding to the short fragment of the S protein (S.sub.C). I.S.: immune serum. p.i.: preimmune serum.

[0251] FIG. 10 illustrates the ELISA reactivity of the purified recombinant N protein, toward sera from patients suffering from atypical pneumonia caused by SARS-CoV. FIG. 10a: ELISA plates prepared with the N protein at the concentration of 4 .mu.g/ml and 2 .mu.g/ml. FIG. 10B: ELISA plate prepared with the N protein at the concentration of 1 .mu.g/ml. The sera designated A, B, D, E, F, G, H correspond to those of Table IV.

[0252] FIG. 11 illustrates the amplification by RT-PCR of decreasing quantities of synthetic RNA of the SARS-CoV N gene (10.sup.7 to 1 copy), with the aid of pairs of primers No. 1 (N/+/28507, N/-/28774) (A) and No. 2 (N/+/28375, N/-/28702) (B). T: amplification performed in the absence of RNA. MW: DNA marker.

[0253] FIG. 12 illustrates the amplification by RT-PCR in real time of synthetic RNA for the SARS-CoV N gene: decreasing quantities of synthetic RNA as replica (repli.; lanes 16 to 29) and of viral RNA diluted 1/20.times.10.sup.-4 (lane 32) were amplified by RT-PCR in real time with the aid of the kit "Light Cycler RNA Amplification Kit Hybridization Probes" and pairs of primers and probes of the No. 2 series, under the conditions described in Example 8.

[0254] FIG. 13 (FIGS. 13.1 to 13.7) represents the restriction map of the sequence SEQ ID NO: 1 corresponding to the DNA equivalent of the genome of the SARS-CoV strain derived from the sample recorded under the number 031589.

[0255] FIG. 14 shows the result of the SARS serology test by indirect N ELISA (1.sup.st series of sera tested).

[0256] FIG. 15 shows the result of the SARS serology test by indirect N ELISA (2.sup.nd series of sera tested).

[0257] FIG. 16 presents the result of the SARS serology test by double epitope N ELISA (1.sup.st series of sera tested).

[0258] FIG. 17 shows the result of the SARS serology test by double epitope N ELISA (2.sup.nd series of sera tested).

[0259] FIG. 18 illustrates the test of reactivity of the anti-N monoclonal antibodies by ELISA on the native nucleoprotein N of SARS-CoV. The antibodies were tested in the form of hybridoma culture supernatants by indirect ELISA using an irradiated lysate of VeroE6 cells infected with SARS-CoV as antigen (SARS lysate curves). A negative control for reactivity is performed for each antibody on a lysate of uninfected VeroE6 cells (negative lysate curves). Several monoclonal antibodies of known specificity were used as negative control antibodies: para1-3 directed against the antigens of the parainfluenza viruses type 1-3 (Bio-Rad) and influenza B directed against the antigens of the influenza virus type B (Bio-Rad).

[0260] FIG. 19 illustrates the test of reactivity of the anti-N of SARS-CoV monoclonal antibodies by ELISA on the native antigens of the human coronavirus 229E (HCoV-229E). The antibodies were tested in the form of hybridoma culture supernatants by an indirect ELISA test using a lysate of MRC-5 cells infected with the human coronavirus 229E as antigen (229E lysate curves). A negative control for immunoreactivity was performed for each antibody on a lysate of noninfected MRC-5 cells (negative lysate curves). The monoclonal antibody 5-11H.6 directed against the S protein of the human coronavirus 229E (Sizun et al. 1998, J. Virol. Met. 72: 145-152) is used as positive control antibody. The antibodies para1-3 directed against the antigens of the parainfluenza virus type 1-3 (Bio-Rad) and influenza B directed against the antigens of the influenza virus type B (Bio-Rad) were added to the panel of monoclonal antibodies tested.

[0261] FIG. 20 shows a test of reactivity of the anti-N of SARS-CoV monoclonal antibodies by Western blotting on the denatured native nucleoprotein N of SARS-CoV. A lysate of VeroE6 cells infected with SARS-CoV was prepared in the loading buffer according to Laemmli and caused to migrate in a 12% SDS polyacrylamide gel and then the proteins were transferred onto PVDF membrane. The anti-N monoclonal antibodies tested were used for the immunoassay at the concentration of 0.05 .mu.g/ml. The visualization is carried out with anti-mouse IgG(H+L) antibodies coupled to peroxidase (NA931V, Amersham) and the ECL+ system. Two monoclonal antibodies were used as negative controls for reactivity: influenza B directed against the antigens of the influenza virus type B (Bio-Rad) and para1-3 directed against the antigens of the parainfluenza virus type 1-3 (Bio-Rad).

[0262] FIG. 21 presents the plasmids for expression in mammalian cells of the SARS-CoV S protein. The cDNA for the SARS-CoV S was inserted between the BamHI and Xho1 sites of the expression plasmid pcDNA3.1(+) (Clontech) in order to obtain the plasmid pcDNA-S and between the Nhe1 and Xho1 sites of the expression plasmid pCI (Promega) in order to obtain the plasmid pCI-S. The WPRE and CTE sequences were inserted between each of the two plasmids pcDNA-S and pCI-S between the Xho1 and Xba1 sites in order to obtain the plasmids pcDNA-S-CTE, pcDNA-S-WPRE, pCI-S-CTE and pCI-S-WPRE, respectively. [0263] SP: signal peptide predicted (aa 1-13) with the software signalP v2.0 (Nielsen et al., 1997, Protein Engineering, 10:1-6) [0264] TM: transmembrane region predicted (aa 1196-1218) with the software TMHMM v2.0 (Sonnhammer et al., 1998, Proc. of Sixth Int. Conf. on Intelligent Systems for Molecular Biology, pp. 175-182, AAAI Press). It should be noted that the amino acids W1194 and P1195 are possibly part of the transmembrane region with the respective probabilities of 0.13 and 0.42 [0265] P-CMV: cytomegalovirus immediate/early promoter. BGH pA: polyadenylation signal of the bovine growth hormone gene [0266] SV40 late pA: SV40 virus late polyadenylation signal [0267] SD/SA: splice donor and acceptor sites [0268] WPRE: sequences of the "Woodchuck Hepatitis Virus posttranscriptional regulatory element" of the woodchuck hepatitis virus [0269] CTE: sequences of the "constitutive transport element" of the Mason-Pfizer simian retrovirus

[0270] FIG. 22 illustrates the expression of the S protein after transfection of VeroE6 cells. Cellular extracts were prepared 48 hours after transfection of VeroE6 cells with the plasmids pcDNA, pcDNA-S, pCI and pCI-S. Cellular extracts were also prepared 18 hours after infection with the recombinant vaccinia virus VV-TF7.3 and transfection with the plasmids pcDNA or pcDNA-S. As a control, extracts of VeroE6 cells were prepared 8 hours after infection with SARS-CoV at a multiplicity of infection of 3. They were separated on an 8% SDS acrylamide gel and analyzed by Western blotting with the aid of an anti-S rabbit polyclonal antibody and an anti-rabbit IgG(H+L) polyclonal antibody coupled to peroxidase (NA934V, Amersham). A molecular mass ladder (kDa) is presented in the figure. [0271] SARS-CoV: extract of VeroE6 cells infected with SARS-CoV [0272] Mock: control extract of noninfected cells

[0273] FIG. 23 illustrates the effect of the CTE and WPRE sequences on the expression of the S protein after transfection of VeroE6 and 293T cells. Cellular extracts were prepared 48 hours after transfection of VeroE6 cells (A) or 293T cells (B) with the plasmids pcDNA, pcDNA-S, pcDNA-S-CTE, pcDNA-S-WPRE, pCI-S, pCI-S-CTE and pCI-S-WPRE separated on 8% SDS polyacrylamide gel and analyzed by Western blotting with the aid of an anti-S rabbit polyclonal antibody and an anti-rabbit IgG(H+L) polyclonal antibody coupled to peroxidase (NA934V, Amersham). A molecular mass ladder (kDa) is presented in the figure. [0274] SARS-CoV: extract of VeroE6 cells prepared 8 hours after infection with SARS-CoV at a multiplicity of infection of 3. [0275] Mock: control extract of noninfected VeroE6 cells

[0276] FIG. 24 presents defective lentiviral vectors with central DNA flap for the expression of SARS-CoV S. The cDNA for the SARS-CoV S protein was cloned in the form of a BamH1-Xho1 fragment into the plasmid pTRIP.DELTA.U3-CMV containing a defective lentiviral vector TRIP with central DNA flap (Sirven et al., 2001, Mol. Ther., 3: 438-448) in order to obtain the plasmid pTRIP-S. The optimum expression cassettes consisting of the CMV virus immediate/early promoter, a splice signal, cDNA for S and either of the posttranscriptional signals CTE or WPRE were substituted for the cassette EF1.alpha.-EGFP of the defective lentiviral expression vector with central DNA flap TRIP.DELTA.U3-EF1.alpha. (Sirven et al., 2001, Mol. Ther., 3: 438-448) in order to obtain the plasmids pTRIP-SD/SA-S-CTE and pTRIP-SD/SA-S-WPRE. [0277] SP: signal peptide [0278] TM: transmembrane region [0279] P-CMV: cytomegalovirus immediate/early promoter [0280] P-EF1.alpha.: EF1.alpha. gene promoter [0281] SD/SA: splice donor and acceptor sites [0282] WPRE: sequences of the "Woodchuck Hepatitis Virus posttranscriptional regulatory element" of the woodchuck hepatitis virus [0283] CTE: sequences of the "constitutive transport element" of the Mason-Pfizer simian retrovirus [0284] LTR: long terminal repeat [0285] .DELTA.U3: LTR deleted for the "promoter/enhancer" sequences [0286] cPPT: "polypurine tract cis-active sequence" [0287] CTS: "central termination sequence"

[0288] FIG. 25 shows the Western-blot analysis of the expression of the SARS-CoV S by cell lines transduced with the lentiviral vectors TRIP-SD/SA-S-WPRE and TRIP-SD/SA-S-CTE. Cellular extracts were prepared from established lines FrhK4-S-CTE and FrhK4-S-WPRE after transduction with the lentiviral vectors TRIP-SD/SA-S-CTE and TRIP-SD/SA-S-WPRE respectively. They were separated on an 8% SDS acrylamide gel and analyzed by Western blotting with the aid of an anti-S rabbit polyclonal antibody and an anti-rabbit IgG(H+L) conjugate coupled to peroxidase. A molecular mass ladder (kDa) is presented in the figure. [0289] T-: control extract of FrhK-4 cells [0290] T+: extract of FrhK-4 cells prepared 24 hours after infection with SARS-CoV at a multiplicity of infection of 3.

[0291] FIG. 26 relates to the analysis of the expression of Ssol polypeptide by cell lines transduced with the lentiviral vectors TRIP-SD/SA-Ssol-WPRE and TRIP-SD/SA-Ssol-CTE. The secretion of the Ssol polypeptide was determined in the supernatant of a series of cell clones isolated after transduction of FrhK-4 cells with the lentiviral vectors TRIP-SD/SA-Ssol-WPRE and TRIP-SD/SA-Ssol-CTE. 5 .mu.l of supernatant, diluted 1/2 in loading buffer according to Laemmli, were analyzed by Western blotting, visualized with an anti-FLAG monoclonal antibody (M2, Sigma) and an anti-mouse IgG(H+L) conjugate coupled to peroxidase. T-: supernatant of the parental FRhK-4 line. T+: supernatant of BHK cells infected with a recombinant vaccinia virus expressing the Ssol polypeptide. The solid arrow indicates the Ssol polypeptide, while the empty arrow indicates a cross reaction with a protein of cellular origin.

[0292] FIG. 27 shows the results relating to the analysis of the purified Ssol polypeptide

[0293] A. 8, 2, 0.5 and 0.125 .mu.g of recombinant Ssol polypeptide purified by anti-FLAG affinity chromatography and gel filtration (G75) were separated on 8% SDS polyacrylamide gel. The Ssol polypeptide and variable quantities of molecular mass markers (MM) were visualized by staining with silver nitrate (Gelcode SilverSNAP stain kit II, Pierce).

B. Standard markers for analysis by SELDI-TOF mass spectrometry

[0294] IgG: bovine IgG of MM 147300 [0295] ConA: conalbumin of MM 77490 [0296] HRP: horseradish peroxidase analyzed as a control and of MM 43240 C. Analysis by mass spectrometry (SELDI-TOF) of the recombinant Ssol polypeptide.

[0297] The peaks A and B correspond to the single and double charged Ssol polypeptide.

D. Sequencing of the N-terminal end of the recombinant Ssol polypeptide. 5 Edman degradation cycles in liquid phase were carried out on an ABI494 sequencer (Applied Biosystems).

[0298] FIG. 28 illustrates the influence of a splicing signal and of the CTE and WPRE sequences on the efficacy of the gene immunization with the aid of plasmid DNA encoding the SARS-CoV S

A. Groups of 7 BALB/c mice were immunized twice at 4 weeks' interval with the aid of 50 .mu.g of plasmid DNA of pCI, pcDNA-S, pCI-S, pcDNA-N and pCI-HA.

B. Groups of 6 BALB/c mice were immunized twice at 4 weeks' interval with the aid of 2 .mu.g, 10 .mu.g or 50 .mu.g of plasmid DNA of pCI, pCI-S, pCI-S-CTE and pCI-S-WPRE.

[0299] The immune sera collected 3 weeks after the second immunization were analyzed by indirect ELISA using a lysate of VeroE6 cells infected with SARS-CoV as antigen. The anti-SARS-CoV antibody titers are calculated as the reciprocal of the dilution producing a specific OD of 0.5 after visualization with an anti-mouse IgG polyclonal antibody coupled to peroxidase (NA931V, Amersham) and TMB (KPL).

[0300] FIG. 29 shows the seroneutralization of the infectivity of SARS-CoV with the antibodies induced in mice after gene immunization with the aid of plasmid DNA encoding SARS-CoV S. Pools of immune sera collected 3 weeks after the second immunization were prepared for each of the groups of experiments described in FIG. 28 and evaluated for their capacity to seroneutralize the infectivity of 100 TCID50 of SARS-CoV on FRhK-4 cells. 4 points are produced for each of the 2-fold dilutions tested from 1/20. The seroneutralizing titer is calculated according to the Reed and Munsch method as the reciprocal of the dilution neutralizing the infectivity of 2 wells out of 4.

A. Groups by BALB/c mice immunized twice at 4 weeks' interval with the aid of 50 .mu.g of plasmid DNA of pCI, pcDNA-S, pCI-S, pcDNA-N and pCI-HA. .quadrature.: preimmune serum. .box-solid.: immune serum.

B. Groups of BALB/c mice immunized twice at 4 weeks' interval with the aid of 2 .mu.g, 10 .mu.g or 50 .mu.g of plasmid DNA of pCI, pCI-S, pCI-S-CTE and pCI-S-WPRE.

[0301] FIG. 30 illustrates the immunoreactivity of the recombinant Ssol polypeptide toward sera from patients suffering from SARS. The reactivity of sera from patients was analyzed by indirect ELISA test against solid phases prepared with the aid of the purified recombinant Ssol polypeptide. The antibodies from patients reacting with the solid phase at a dilution of 1/400 are visualized with a human anti-IgG(H+L) polyclonal antibody coupled to peroxidase (Amersham NA933V) and TMB plus H202 (KPL). The sera of probable SARS cases are identified by a National Reference Center for Influenza Viruses serial number and by the initials of the patient and the number of days elapsed since the onset of symptoms, where appropriate. The TV sera are control sera from subjects which were collected in France before the SARS epidemic which occurred in 2003.

[0302] FIG. 31 shows the induction of antibodies directed against SARS-CoV after immunization with the recombinant Ssol polypeptide. Two groups of 6 mice were immunized at 3 weeks' interval with 10 .mu.g of recombinant Ssol polypeptide (Ssol group) adjuvanted with aluminum hydroxide or, as a control, of adjuvant alone (mock group). Three successive immunizations were performed and the immune sera were collected 3 weeks after each of the three immunizations (IS1, IS2, IS3). The immune sera were analyzed per pool for each of the 2 groups by indirect ELISA using a lysate of VeroE6 cells infected with SARS-CoV as antigen. The anti-SARS-CoV antibody titers are calculated as the reciprocal of the dilution producing a specific OD of 0.5 after visualization with an anti-mouse IgG polyclonal antibody coupled to peroxidase (Amersham) and TMB (KPL).

[0303] FIG. 32 presents the nucleotide alignment of the sequences of the synthetic gene 040530 with the sequence of the wild-type gene of the SARS-CoV isolate 031589. I-3059 corresponds to nucleotides 21406-25348 of the SARS-CoV isolate 031589 deposited at the C.N.C.M. under the number I-3059 (SEQ ID NO: 4, plasmid pSARS-S)S-040530 is the sequence of the synthetic gene 040530.

[0304] FIG. 33 illustrates the use of a synthetic gene for the expression of the SARS-CoV S. Cellular extracts prepared 48 hours after transfection of VeroE6 cells (A) or 293T cells (B) with the plasmids pCI, pCI-S, pCI-S-CTE, pCI-S-WPRE and pCI-Ssynth were separated on 8% SDS acrylamide gel and analyzed by Western blotting with the aid of an anti-S rabbit polyclonal antibody and an anti-rabbit IgG(H+L) polyclonal antibody coupled to peroxidase (NA934V, Amersham). The Western blot is visualized by luminescence (ECL+, Amersham) and acquisition on a digital imaging device (Fluor S, BioRad). The levels of expression of the S protein were measured by quantifying the 2 predominant bands identified on the image.

[0305] FIG. 34 presents a diagram for the construction of recombinant vaccinia viruses VV-TG-S, VV-TG-Ssol, VV-TN-S and W-TN-Ssol

A. The cDNAs for the S protein and the Ssol polypeptide of SARS-CoV were inserted between the BamH1 and Sma1 sites of the transfer plasmid pTG186 in order to obtain the plasmids pTG-S and pTG-Ssol.

[0306] B. The sequences of the synthetic promoter 480 were then substituted for those of the 7.5 promoter by exchange of the Nde1-Pst1 fragments of the plasmids pTG186poly, pTG-S and pTG-Ssol in order to obtain the transfer plasmids pTN480, pTN-S and pTN-Ssol.

[0307] C. Sequence of the synthetic promoter 480 as contained between the Nde1 and Pst1 sites of the transfer plasmids of the pTN series. An Asc1 site was inserted in order to facilitate subsequent handling. The restriction sites and the promoter sequence are underlined.

D. The recombinant vaccinia viruses are obtained by double homologous recombination in vivo between the TK cassette of the transfer plasmids of the pTG and pTN series and the TK gene of the Copenhagen strain of the vaccinia virus.

[0308] SP: signal peptide predicted (aa 1-13) with the software signalP v2.0 (Nielsen et al., 1997, Protein Engineering, 10:1-6) [0309] TM: transmembrane region predicted (aa 1196-1218) with the software TMHMM v2.0 (Sonnhammer et al., 1998, Proc. of Sixth Int. Conf. on Intelligent Systems for Molecular Biology, pp. 175-182, AAAI Press). It should be noted that the amino acids W1194 and P1195 possibly form part of the transmembrane region with respective probabilities of 0.13 and 0.42. [0310] TK-L, TK-R: left- and right-hand parts of the vaccinia virus thymidine kinase gene [0311] MCS: multiple cloning site [0312] PE: early promoter [0313] PL: late promoter [0314] PL synth: synthetic late promoter 480

[0315] FIG. 35 illustrates the expression of the S protein by recombinant vaccinia viruses, analyzed by Western blotting. Cellular extracts were prepared 18 hours after infection of CV1 cells with the recombinant vaccinia viruses VV-TG, VV-TG-S and VV-TN-S at an M.O.I. of 2 (A). As a control, extracts of VeroE6 cells were prepared 8 hours after infection with SARS-CoV at a multiplicity of infection of 2. Cellular extracts were also prepared 18 hours after infection of CV1 cells with the recombinant vaccinia viruses VV-TG-S, VV-TG-Ssol, VV-TN, VV-TN-S and VV-TN-Ssol (B). They were separated on 8% SDS acrylamide gels and analyzed by Western blotting with the aid of an anti-S rabbit polyclonal antibody and an anti-rabbit IgG(H+L) polyclonal antibody coupled to peroxidase (NA934V, Amersham). "1 .mu.l" and "10 .mu.l" indicates the quantities of cellular extracts deposited on the gel. A molecular mass ladder (kDa) is presented in the figure. [0316] SARS-CoV: extract of VeroE6 cells infected with SARS-CoV [0317] Mock: control extract of noninfected cells

[0318] FIG. 36 shows the result of a Western-blot analysis of the secretion of the Ssol polypeptide by the recombinant vaccinia viruses.

A. Supernatants of CV1 cells infected with the recombinant vaccinia virus VV-TN, various clones of the VV-TN-Ssol virus and with the viruses VV-TG-Ssol or VV-TN-Sflag were harvested 18 hours after infection of CV1 cells at an M.O.I. of 2.

[0319] B. Supernatants of 293T, FRhK-4, BHK-21 and CV1 cells infected in duplicate (1.2) with the recombinant vaccinia virus VV-TN-Ssol at an M.O.I. of 2 were harvested 18 hours after infection. The supernatant of CV1 cells infected with the virus VV-TN was also harvested as a control (M).

[0320] All the supernatants were separated on 8% SDS acrylamide gel according to Laemmli and analyzed by Western blotting with the aid of an anti-FLAG mouse monoclonal antibody and an anti-mouse IgG(H+L) polyclonal antibody coupled to peroxidase (NA931V, Amersham) (A) or with the aid of an anti-S rabbit polyclonal antibody and an anti-rabbit IgG(H+L) polyclonal antibody coupled to peroxidase (NA934V, Amersham) (B).

[0321] A molecular mass ladder (kDa) is presented in the figure.

[0322] FIG. 37 shows the analysis of the Ssol polypeptide, purified on SDS polyacrylamide gel

[0323] 10, 5 and 211 of recombinant Ssol polypeptide purified by anti-FLAG affinity chromatography were separated on 4 to 15% gradient SDS polyacrylamide gel. The Ssol polypeptide and variable quantities of molecular mass markers (MM) were visualized by staining with silver nitrate (Gelcode SilverSNAP stain kit II, Pierce).

[0324] FIG. 38 illustrates the immunoreactivity of the recombinant Ssol polypeptide produced by the recombinant vaccinia virus VV-TN-Ssol toward sera of patients suffering from SARS. The reactivity of sera from patients was analyzed by indirect ELISA test against solid phases prepared with the aid of the purified recombinant Ssol polypeptide. The antibodies from patients reacting with the solid phase at a dilution of 1/100 and 1/400 are visualized with a human anti-IgG(H+L) polyclonal antibody coupled to peroxidase (Amersham NA933V) and TMB plus H202 (KPL). The sera of probable SARS cases are identified by a National Reference Center for Influenza Virus serial number and by the initials of the patient and the number of days elapsed since the onset of symptoms, where appropriate. The TV sera are control sera from subjects which were collected in France before the SARS epidemic which occurred in 2003.

[0325] FIG. 39 shows the anti-SARS-CoV antibody response in mice after immunization with the recombinant vaccinia viruses. Groups of 7 BALB/c mice were immunized by the i.v. route twice at 4 weeks' interval with 106 pfu of recombinant vaccinia viruses VV-TG, VV-TG-HA, VV-TG-S, VV-TG-Ssol, W-TN, W-TN-S, VV-TN-Ssol.

[0326] A. Pools of immune sera collected 3 weeks after each of the two immunizations were prepared for each of the groups and were analyzed by indirect ELISA using a lysate of VeroE6 cells infected with SARS-CoV as antigen. The anti-SARS-CoV antibody titers are calculated as the reciprocal of the dilution producing a specific OD of 0.5 after visualization with an anti-mouse IgG polyclonal antibody coupled to peroxidase (NA931V, Amersham) and TMB (KPL).

[0327] B. The pools of immune sera were evaluated for their capacity to seroneutralize the infectivity of 100 TCID50 of SARS-CoV on FRhK-4 cells. 4 points are produced for each of the 2-fold dilutions tested from 1/20. The seroneutralizing titer is calculated according to the Reed and Munsch method as the reciprocal of the dilution neutralizing the infectivity of 2 wells out of 4.

[0328] FIG. 40 describes the construction of the recombinant viruses MVSchw2-SARS-S and MVSchw2-SARS-Ssol.

[0329] A. The measles vector is a complete genome of the Schwarz vaccine strain of the measles virus (MV) into which an additional transcription unit has been introduced (Combredet, 2003, Journal of Virology, 77: 11546-11554). The expression of the additional open reading frames (ORF) is controlled by cis-acting elements necessary for the transcription, for the formation of the cap and for the polyadenylation of the transgene which were copied from the elements present at the N/P junction. 2 different vectors allow the insertion between the P (phosphoprotein) and M (matrix) genes on the one hand and the H (hemagglutinin) and L (polymerase) genes on the other hand.

[0330] B. The recombinant genomes MVSchw2-SARS-S and MVSchw2-SARS-Ssol of the measles virus were constructed by inserting the ORFs of the S protein and of the Ssol polypeptide into an additional transcription unit located between the P and M genes of the vector.

[0331] The various genes of the measles virus (MV) are indicated: N (nucleoprotein), PVC (V/C phosphoprotein and protein), M (matrix), F (fusion), H (hemagglutinin), L (polymerase). T7=T7 RNA polymerase promoter, hh=hammerhead ribozyme, T7t=T7 phage RNA polymerase terminator sequence, 6=ribozyme of the hepatitis .delta. virus, (2), (3)=additional transcription units (ATU). [0332] Size of the MV genome: 15 894 nt. [0333] SP: signal peptide [0334] TM: transmembrane region [0335] FLAG: FLAG tag

[0336] FIG. 41 illustrates the expression of the S protein by the recombinant measles viruses, analyzed by Western blotting.

[0337] Cytoplasmic extracts were prepared after infection of Vero cells by different passages of the viruses MVSchw2-SARS-S and MVSchw2-SARS-Ssol and the wild-type virus MWSchw as control. Cellular extracts in loading buffer according to Laemmli were also prepared 8 hours after infection of VeroE6 cells with SARS-CoV at a multiplicity of infection of 3. They were separated on 8% SDS acrylamide gel and analyzed by Western blotting with the aid of an anti-S rabbit polyclonal antibody and an anti-rabbit IgG(H+L) polyclonal antibody coupled to peroxidase (NA934V, Amersham).

[0338] A molecular mass ladder (kDa) is presented in the figure. [0339] Pn: nth passage of the virus after coculture of 293-3-46 and Vero cells [0340] SARS-CoV: extract of VeroE6 cells infected with SARS-CoV [0341] Mock: control extract of noninfected VeroE6 cells

[0342] FIG. 42 shows the expression of the S protein by the recombinant measles viruses, analyzed by immunofluorescence

[0343] Vero cells in monolayers on glass slides were infected with the wild-type virus MWSchw (A) or the viruses MVSchw2-SARS-S (B) and MVSchw2-SARS-Ssol (C). When the syncytia have reached 30 to 40% confluence (A., B.) or 90-100% (C), the cells were fixed, permeabilized and labeled with anti-SARS-CoV rabbit polyclonal antibodies and an anti-rabbit IgG(H+L) conjugate coupled to FITC (Jackson).

[0344] FIG. 43 illustrates the Western-blot analysis of the immunoreactivity of rabbit sera directed against the peptides E1-12, E53-76 and M2-14. The rabbit 20047 was immunized with the peptide E1-12 coupled to KLH. The rabbits 22234 and 22240 were immunized with the peptide E53-76 coupled to KLH. The rabbits 20013 and 20080 were immunized with the peptide M2-14 coupled to KLH. The immune sera were analyzed by Western blotting with the aid of extracts of cells infected with SARS-CoV (B) or with the aid of extracts of cells infected with a recombinant vaccinia virus expressing the protein E (A) or M (C) of the SARS-CoV 031589 isolate. The immunoblots were visualized with the aid of an anti-rabbit IgG(H+L) conjugate coupled to peroxidase (NA934V, Amersham).

[0345] The position of the E and M proteins is indicated by an arrow.

[0346] A molecular mass ladder (kDa) is presented in the figure.

[0347] It should be understood, however, that these examples are given solely by way of illustration of the subject of the invention, and do not constitute in any manner a limitation thereto.

EXAMPLE 1

Cloning and Sequencing of the Genome of the SARS-CoV Strain Derived from the Sample Recorded Under the Number 031589

[0348] The RNA of the SARS-CoV strain was extracted from the sample of bronchoalveolar washing recorded under the number 031589, performed on a patient at the Hanoi (Vietnam) French hospital suffering from SARS.

[0349] The isolated RNA was used as template to amplify the cDNAs corresponding to the various open reading frames of the genome (ORF1a, ORF1b, ORF-S, ORF-E, ORF-M, ORF-N (including ORF-13 and ORF-14), ORF3, ORF4, ORF7 to ORF11), and at the noncoding 5' and 3' ends. The sequences of the primers and of the probes used for the amplification/detection were defined based on the available SARS-CoV nucleotide sequence.

[0350] In the text which follows, the primers and the probes are identified by: the letter S, followed by a letter which indicates the corresponding region of the genome (L for the 5' end including ORF1a and ORF1b; S, M and N for ORF-S, ORF-M, ORF-N, SE and MN for the corresponding intergene regions), and then optionally by Fn, Rn, with n between 1 and 6 corresponding to the primers used for the nested PCR (F1+R1 pair for the first amplification, F2+R2 pair for the second amplication, and the like), and then by /+/or /-/ corresponding to a sense or antisense primer and finally by the positions of the primers with reference to the Genbank sequence AY27411.3; for the sense and antisense S and N primers and the other sense primers only, when a single position is indicated, it corresponds to that of the 5' end of a probe or of a primer of about 20 bases; for the antisense primers other than the S and N primers, when a single position is indicated, it corresponds to that of the 3' end of a probe or of a primer of about 20 bases.

[0351] The amplification products thus generated were sequenced with the aid of specific primers in order to determine the complete sequence of the genome of the SARS-CoV strain derived from the sample recorded under the number 031589. These amplification products, with the exception of those corresponding to ORF1a and ORF1b, were then cloned into expression vectors in order to produce the corresponding viral proteins and the antibodies directed against these proteins, in particular by DNA-based immunization.

1. Extraction of the RNAs

[0352] The RNAs were extracted with the aid of the QIamp viral RNA extraction mini kit (QIAGEN) according to the manufacturer's recommendations. More specifically: 14011 of the sample and 560 .mu.l of AVL buffer were vigorously mixed for 15 seconds, incubated for 10 minutes at room temperature and then briefly centrifuged at maximum speed. 560 .mu.l of 100% ethanol were added to the supernatant and the mixture thus obtained was very vigorously stirred for 15 sec. 630 .mu.l of the mixture were then deposited on the column.

[0353] The column was placed on a 2 ml tube, centrifuged for 1 min at 8000 rpm, and then the remainder of the preceding mixture was deposited on the same column, centrifuged again, for 1 min at 8000 rpm, and the column was transferred over a clean 2 ml tube. Next, 500 .mu.l of AW1 buffer were added to the column, and then the column was centrifuged for 1 min at 8000 rpm and the eluate was discarded. 500 .mu.l of AW2 buffer were added to the column which was then centrifuged for 3 min at 14 000 rpm and transferred onto a 1.5 ml tube. Finally, 60 .mu.l of AVE buffer were added to the column which was incubated for 1 to 2 min at room temperature and then centrifuged for 1 min at 8000 rpm. The eluate corresponding to the purified RNA was recovered and frozen at -20.degree. C.

2. Amplification, Sequencing and Cloning of the cDNAs

2.1) cDNA Encoding the S Protein

[0354] The RNAs extracted from the sample were subjected to reverse transcription with the aid of random sequence hexameric oligonucleotides (pdN6), so as to produce cDNA fragments.

[0355] The sequence encoding the SARS-CoV S glycoprotein was amplified in the form of two overlapping DNA fragments: 5' fragment (SARS-Sa, SEQ ID NO: 5) and 3' fragment (SARS-Sb, SEQ ID NO: 6), by carrying out two successive amplifications with the aid of nested primers. The amplicons thus obtained were sequenced, cloned into the PCR plasmid vector 2.1-TOPO.TM. (INVITROGEN), and then the sequence of the cloned cDNAs was determined.

a) Cloning and Sequencing of the Sa and Sb Fragments

a.1) Synthesis of the cDNA

[0356] The reaction mixture containing: RNA (5 .mu.l), H.sub.2O for injection (3.5 .mu.l), 5.times. reverse transcriptase buffer (4 .mu.l), 5 mM dNTP (2 .mu.l), pdN6 100 .mu.g/ml (4 .mu.l), RNasin 40 IU/.mu.l (0.5 .mu.l) and reverse transcriptase AMV-RT, 10 IU/.mu.l, PROMEGA (1 .mu.l) was incubated in a thermocycler under the following conditions: 45 min at 42.degree. C., 15 min at 55.degree. C., 5 min at 95.degree. C., and then the cDNA obtained was kept at +4.degree. C.

a.2) First PCR Amplification

[0357] The 5' and 3' ends of the S gene were respectively amplified with the pairs of primers S/F1/+/21350-21372 and S/R1/-/23518-23498, S/F3/+/23258-23277 and S/R3/-/25382-25363. The 50 .mu.l reaction mixture containing: cDNA (2 .mu.l), 50 .mu.M primers (0.5 .mu.l), 10.times. buffer (5 .mu.l), 5 mM dNTP (2 .mu.l), Taq Expand High Fidelity, Roche (0.75 .mu.l) and H.sub.2O (39, 75 .mu.l) was amplified in a thermocycler, under the following conditions: an initial step of denaturation at 94.degree. C. for 2 min was followed by 40 cycles comprising: a step of denaturation at 94.degree. C. for 30 sec, a step of annealing at 55.degree. C. for 30 sec and then a step of extension at 72.degree. C. for 2 min 30 sec, with 10 sec of additional extension at each cycle, and then a final step of extension at 72.degree. C. for 5 min.

a.3) Second PCR Amplification

[0358] The products of the first PCR amplification (5' and 3' amplicons) were subjected to a second PCR amplification step (nested PCR) under conditions identical to those of the first amplification, with the pairs of primers S/F2/+/21406-21426 and S/R2/-/23454-23435 and S/F4/+/23322-23341 and S/R4/-/25348-25329, respectively for the 5' amplicon and the 3' amplicon.

a.4) Cloning and Sequencing of the Sa and Sb Fragments

[0359] The Sa (5' end) and Sb (3' end) amplicons thus obtained were purified with the aid of the QIAquick PCR purification kit (QIAGEN), following the manufacturer's instructions, and then they were cloned into the vector PCR2.1-TOPO (Invitrogen kit), to give the plasmids called SARS-S1 and SARS-S2.

[0360] The DNA of the Sa and Sb clones was isolated and then the corresponding insert was sequenced with the aid of the Big Dye kit, Applied Biosystem.RTM. and universal primers M13 forward and M13 reverse, and primers: S/S/+/21867, S/S/+/22353, S/S/+/22811, S/S/+/23754, S/S/+/24207, S/S/+/24699, S/S/+/24348, S/S/-/24209, S/S/-/23630, S/S/-/23038, S/S/-/22454, S/S/-/21815, S/S/-/24784, S/S/+/21556, S/S/+/23130 and S/S/+/24465 following the manufacturer's instructions; the sequences of the Sa and Sb fragments thus obtained correspond to the sequences SEQ ID NO: 5 and SEQ ID NO: 6 in the sequence listing appended as an annex.

[0361] The plasmid, called SARS-S1, was deposited under the No. I-3020, on May 12, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains a 5' fragment of the sequence of the S gene of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above, said fragment called Sa corresponding to the nucleotides at positions 21406 to 23454 (SEQ ID NO: 5), with reference to the Genbank sequence AY274119.3 Tor2.

[0362] The plasmid, called TOP10F'-SARS-S2, was deposited under the No. I-3019, on May 12, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains a 3' fragment of the sequence of the S gene of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above, said fragment called Sb corresponding to the nucleotides at positions 23322 to 25348 (SEQ ID NO: 6), with reference to the Genbank sequence accession No. AY274119.3.

b) Cloning and Sequencing of the Complete cDNA (SARS-S Clone of 4 kb)

[0363] The complete S cDNA was obtained from the abovementioned clones SARS-S1 and SARS-S2, in the following manner:

[0364] 1) A PCR amplification reaction was carried out on a SARS-S2 clone in the presence of the above-mentioned primer S/R4/-/25348-25329 and of the primer S/S/+/24696-24715: an amplicon of 633 bp was obtained,

[0365] 2) Another PCR amplification reaction was carried out on another SARS-S2 clone, in the presence of the primers S/F4/+/23322-23341 mentioned above and S/S/-/24803-24784: an amplicon of 1481 bp was obtained.

[0366] The amplification reaction was carried out under the conditions as defined above for the amplification of the Sa and Sb fragments, with the exception that 30 amplification cycles comprising a step of denaturation at 94.degree. C. for 20 sec and a step of extension at 72.degree. C. for 2 min 30 sec were carried out.

[0367] 3) The 2 amplicons (633 bp and 1481 bp) were purified under the conditions as defined above for the Sa and Sb fragments.

[0368] 4) Another PCR amplification reaction with the aid of the abovementioned primers S/F4/+/23322-23341 and S/R4/-/25348-25329 was carried out on the purified amplicons obtained in 3). The amplification reaction was carried out under the conditions as defined above for the amplification of the Sa and Sb fragments, except that 30 amplification cycles were performed.

[0369] The 2026 bp amplicon thus obtained was purified, cloned into the vector PCR2.1-TOPO and then sequenced as above, with the aid of the primers as defined above for the Sa and Sb fragments. The clone thus obtained was called clone 3'.

[0370] 5) The clone SARS-S1 obtained above and the clone 3' were digested with EcoR I, the bands of about 2 kb thus obtained were gel purified and then amplified by PCR with the abovementioned primers S/F2/+/21406-21426 and S/R4/-/25348-25329. The amplification reaction was carried out under the conditions as defined above for the amplification of the Sa and Sb fragments, except that 30 amplification cycles were performed. The amplicon of about 4 kb was purified and sequenced. It was then cloned into the vector PCR2.1-TOPO in order to give the plasmid, called SARS-S, and the insert obtained in this plasmid was sequenced as above, with the aid of the primers as defined above for the Sa and Sb fragments. The cDNA sequences of the insert and of the amplicon encoding the S protein correspond respectively to the sequences SEQ ID NO: 4 and SEQ ID NO: 2 in the sequence listing appended as an annex, they encode the S protein (SEQ ID NO: 3).

[0371] The sequence of the amplicon corresponding to the cDNA encoding the S protein of the SARS-CoV strain derived from the sample No. 031589 has the following two mutations compared with the corresponding sequences of respectively the Tor2 and Urbani isolates, the positions of the mutations being indicated with reference to the complete sequence of the genome of the Tor2 isolate (Genbank AY274119.3): [0372] g/t in position 23220; the alanine codon (gct) in position 577 of the amino acid sequence of the S protein of Tor2 is replaced with a serine codon (tct), [0373] c/t in position 24872: this mutation does not modify the amino acid sequence of the S protein, and the plasmid, called SARS-S, was deposited under the No. I-3059, on Jun. 20, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA sequence encoding the S protein of the SARS-CoV strain derived from the sample recorded under the No. 031589, said sequence corresponding to the nucleotides at positions 21406 to 25348 (SEQ ID NO: 4), with reference to the Genbank sequence AY274119.3. 2.2) cDNA Encoding the M and E Proteins

[0374] The RNAs derived from the sample 031589, extracted as above, were subjected to a reverse transcription, combined, during the same step (Titan One Step RT-PCR.RTM. kit, Roche), with a PCR amplification reaction, with the aid of the pairs of primers: [0375] S/E/F1/+/26051-26070 and S/E/R1/-/26455-26436 in order to amplify ORF-E, and [0376] S/M/F1/+/26225-26244 and S/M/R1/-/27148-27129 in order to amplify ORF-M.

[0377] A first reaction mixture containing: 8.6 .mu.l of H.sub.2O for injection, 1 .mu.l of dNTP (5 mM), 0.2 .mu.l of each of the primers (50 .mu.M), 1.25 .mu.l of DTT (100 mM) and 0.25 .mu.l of RNAsin (40 IU/.mu.l) was combined with a second reaction mixture containing: 1 .mu.l of RNA, 7 .mu.l of H.sub.2O for injection, 5 .mu.l of 5.times.RT-PCR buffer and 0.5 .mu.l of enzyme mixture and the combined mixtures were incubated in a thermocycler under the following conditions: 30 min at 42.degree. C., 10 min at 55.degree. C., 2 min at 94.degree. C. followed by 40 cycles comprising a step of denaturation at 94.degree. C. for 10 sec, a step of annealing at 55.degree. C. for 30 sec and a step of extension at 68.degree. C. for 45 sec, with 3 sec increment per cycle and finally a step of terminal extension at 68.degree. C. for 7 min.

[0378] The amplification products thus obtained (M and E amplicons) were subjected to a second PCR amplification (nested PCR) using the Expand High-Fi.RTM. kit, Roche), with the aid of the pairs of primers: [0379] S/E/F2/+/26082-26101 and S/E/R2/-/26413-26394 for the amplicon E, and [0380] S/M/F2/+/26330-26350 and S/M/R2/-/27098-27078 for the amplicon M.

[0381] The reaction mixture containing: 2 .mu.l of the product of the first PCR, 39.25 .mu.l of H.sub.2O for injection, 5 .mu.l of 10.times. buffer containing MgCl.sub.2, 2 .mu.l of dNTP (5 mM), 0.5 .mu.l of each of the primers (50 .mu.M) and 0.75 .mu.l of enzyme mixture was incubated in a thermocycler under the following conditions: a step of denaturation at 94.degree. C. for 2 min was followed by 30 cycles comprising a step of denaturation at 94.degree. C. for 15 sec, a step of annealing at 60.degree. C. for 30 sec and a step of extension at 72.degree. C. for 45 sec, with 3 sec increment per cycle, and finally a step of terminal extension at 72.degree. C. for 7 min. The amplification products obtained corresponding to the cDNAs encoding the E and M proteins were sequenced as above, with the aid of the primers: S/E/F2/+/26082 and S/E/R2/-/26394, S/M/F2/+/26330, S/M/R2/-/27078 cited above and the primers S/M/+/26636-26655 and S/M/-/26567-26548. They were then cloned, as above, in order to give the plasmids called SARS-E and SARS-M. The DNA of these clones was then isolated and sequenced with the aid of the universal primers M13 forward and M13 reverse and the primers S/M/+/26636 and S/M/-/26548 mentioned above.

[0382] The sequence of the amplicon representing the cDNA encoding the E protein (SEQ ID NO: 13) of the SARS-CoV strain derived from the sample No. 031589 does not contain differences in relation to the corresponding sequences of the isolates AY274119.3-Tor2 and AY278741-Urbani. The sequence of the E protein of the SARS-CoV 031589 strain corresponds to the sequence SEQ ID NO: 14 in the sequence listing appended as an annex.

[0383] The plasmid, called SARS-E, was deposited under the No. I-3046, on May 28, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA sequence encoding the E protein of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above, said sequence corresponding to the nucleotides at positions 26082 to 26413 (SEQ ID NO: 15), with reference to the Genbank sequence accession No. AY274119.3.

[0384] The sequence of the amplicon representing the cDNA encoding M (SEQ ID NO: 16) from the SARS-CoV strain derived from the sample No. 031589 does not contain differences in relation to the corresponding sequence of the isolate AY274119.3-Tor2. By contrast, at position 26857, the isolate AY278741-Urbani contains a c and the sequence of the SARS-CoV strain derived from the sample recorded under the No. 031589 contains a t. This mutation results in a modification of the amino acid sequence of the corresponding protein: at position 154, a proline (AY278741-Urbani) is changed to serine in the SARS-CoV strain derived from the sample recorded under the No. 031589. The sequence of the M protein of the SARS-CoV strain derived from the sample recorded under the No. 031589 corresponds to the sequence SEQ ID NO: 17 in the sequence listing appended as an annex.

[0385] The plasmid, called SARS-M, was deposited under the No. I-3047, on May 28, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA sequence encoding the M protein of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above; said sequence corresponding to the nucleotides at positions 26330 to 27098 (SEQ ID NO: 18), with reference to the Genbank sequence accession No. AY274119.3.

2.3) cDNA Corresponding to ORF3, ORF4, ORF7 to ORF11

[0386] The same amplification, cloning and sequencing strategy was used to obtain the cDNA fragments corresponding respectively to the following ORFs: ORF3, ORF4, ORF7, ORF8, ORF9, ORF10 and ORF11. The pairs of primers used for the first amplification are: [0387] ORF3 and ORF4: S/SE/F1/+/25069-25088 and S/SE/R1/-/26300-26281 [0388] ORF7 to ORF11: S/MN/F1/+/26898-26917 and S/MN/R1/-/28287-28266

[0389] The pairs of primers used for the second amplification are: [0390] ORF3 and ORF4: S/SE/F2/+/25110-25129 and S/SE/R2/-/26244-26225 [0391] ORF7 to ORF11: S/MN/F2/+/26977-26996 and S/MN/R2/-/28218-28199

[0392] The conditions for the first amplification (RT-PCR) are the following: 45 min at 42.degree. C., 10 min at 55.degree. C., 2 min at 94.degree. C. followed by 40 cycles comprising a step of denaturation at 94.degree. C. for 15 sec, a step of annealing at 58.degree. C. for 30 sec and a step of extension at 68.degree. C. for 1 min, with 5 sec increment per cycle and finally a step of terminal extension at 68.degree. C. for 7 min.

[0393] The conditions for the nested PCR are the following: a step of denaturation at 94.degree. C. for 2 min was followed by 40 cycles comprising a step of denaturation at 94.degree. C. for 20 sec. a step of annealing at 58.degree. C. for 30 sec and a step of extension at 72.degree. C. for 50 sec, with 4 sec increment per cycle and finally a step of terminal extension at 72.degree. C. for 7 min.

[0394] The amplification products obtained corresponding to the cDNAs containing respectively ORF3 and 4 and ORF7 to 11 were sequenced with the aid of the primers: S/SE/+/25363, S/SE/+/25835, S/SE/-/25494, S/SE/-/25875, S/MN/+/27839, S/MN/+/27409, S/MN/-/27836, S/MN/-/27799 and cloned as above for the other ORFs, to give the plasmids called SARS-SE and SARS-MN. The DNA of these clones was isolated and sequenced with the aid of these same primers and of the universal primers M13 sense and M13 antisense.

[0395] The sequence of the amplicon representing the cDNA of the region containing OFR3 and ORF4 (SEQ ID NO: 7) of the SARS-CoV strain derived from the sample No. 031589 contains a nucleotide difference in relation to the corresponding sequence of the isolate AY274119-Tor2. This mutation at position 25298 results in a modification of the amino acid sequence of the corresponding protein (ORF3): at position 11, an arginine (AY274119-Tor2) is changed to glycine in the SARS-CoV strain derived from the sample No. 031589. By contrast, no mutation was identified in relation to the corresponding sequence of the isolate AY278741-Urbani. The sequences of ORF3 and 4 of the SARS-CoV strain derived from the sample No. 031589 correspond respectively to the sequences SEQ ID NO: 10 and 12 in the sequence listing appended as an annex.

[0396] The plasmid, called SARS-SE, was deposited under the No. I-3126, on Nov. 13, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA corresponding to the region situated between ORF-S and ORF-E and overlapping ORF-E of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above, said region corresponding to the nucleotides at positions 25110 to 26244 (SEQ ID NO: 8), with reference to the Genbank sequence accession No. AY274119.3.

[0397] The sequence of the amplicon representing the cDNA corresponding to the region containing ORF7 to ORF11 (SEQ ID NO: 19) of the SARS-CoV strain derived from the sample No. 031589 does not contain differences in relation to the corresponding sequences of the isolates AY274119-Tor2 and AY278741-Urbani. The sequences of ORF7 to 11 of the SARS-CoV strain derived from the sample No. 031589 correspond respectively to the sequences SEQ ID NO: 22, 24, 26, 28 and 30 in the sequence listing appended as an annex.

[0398] The plasmid, called SARS-MN, was deposited under the No. I-3125, on Nov. 13, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA sequence corresponding to the region situated between ORF-M and ORF-N of the SARS-CoV strain derived from the sample recorded under the No. 031589 and collected in Hanoi, as defined above, said sequence corresponding to the nucleotides at positions 26977 to 28218 (SEQ ID NO: 20), with reference to the Genbank sequence accession No. AY274119.3.

[0399] The sequence of the amplicon representing the cDNA corresponding to the region containing ORF7 to ORF11 (SEQ ID NO: 19) of the SARS-CoV strain derived from the sample No. 031589 does not contain differences in relation to the corresponding sequences of the isolates AY274119-Tor2 and AY278741-Urbani. The sequences of ORF7 to 11 of the SARS-CoV strain derived from the sample No. 031589 correspond respectively to the sequences SEQ ID NO: 22, 24, 26, 28 and 30 in the sequence listing appended as an annex.

2.4) cDNA Encoding the N Protein and Including ORF13 and ORF14

[0400] The cDNA was synthesized and amplified as described above for the fragments Sa and Sb. More specifically, the reaction mixture containing: 5 .mu.l of RNA, 5 .mu.l of H.sub.2O for injection, 4 .mu.l of 5.times. reverse transcriptase buffer, 2 .mu.l of dNTP (5 mM), 2 .mu.l of oligo 20T (5 .mu.M), 0.5 .mu.l of RNasin (40 IU/.mu.l) and 1.5 .mu.l of AMV-RT (10 IU/.mu.l Promega) was incubated in a thermocycler under the following conditions: 45 min at 42.degree. C., 15 min at 55.degree. C., 5 min at 95.degree. C., and it was then kept at +4.degree. C.

[0401] A first PCR amplification was performed with the pair of primers S/N/F3/+/28023 and S/N/R3/-/29480.

[0402] The reaction mixture as above for the amplification of the S1 and S2 fragments was incubated in a thermo-cycler, under the following conditions: an initial step of denaturation at 94.degree. C. for 2 min was followed by 40 cycles comprising a step of denaturation at 94.degree. C. for 20 sec, a step of annealing at 55.degree. C. for 30 sec and then a step of extension at 72.degree. C. for 1 min 30 sec with 10 sec of additional extension at each cycle, and then a final step of extension at 72.degree. C. for 5 min.

[0403] The amplicon obtained at the first PCR amplification was subjected to a second PCR amplification step (nested PCR) with the pairs of primer S/N/F4/+/28054 and S/N/R4/-/29430 under conditions identical to those of the first amplification.

[0404] The amplification product obtained, corresponding to the cDNA encoding the N protein of the SARS-CoV strain derived from the sample No. 031589, was sequenced with the aid of the primers: S/N/F4/+/28054, S/N/R4/-/29430, S/N/+/28468, S/N/+/28918 and S/N/-/28607 and cloned as above for the other ORFs, to give the plasmid called SARS-N. The DNA of these clones was isolated and sequenced with the aid of the universal primers M13 sense and M13 antisense, and the primers S/N/+/28468, S/N/+/28918 and S/N/-/28607.

[0405] The sequence of the amplicon representing the cDNA corresponding to ORF-N and including ORF13 and ORF14 (SEQ ID NO: 36) of the SARS-CoV strain derived from the sample No. 031589 does not contain differences in relation to the corresponding sequences of the isolates AY274119.3-Tor2 and AY278741-Urbani. The sequence of the N protein of the SARS-CoV strain derived from the sample No. 031589 corresponds to the sequence SEQ ID NO: 37 in the sequence listing appended as an annex.

[0406] The sequences of ORF13 and 14 of the SARS-CoV strain derived from the sample No. 031589 correspond respectively to the sequences SEQ ID NO: 32 and 34 in the sequence listing appended as an annex.

[0407] The plasmid, called SARS-N, was deposited under the No. I-3048, on Jun. 5, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA encoding the N protein of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above, said sequence corresponding to the nucleotides at positions 28054 to 29430 (SEQ ID NO: 38), with reference to the Genbank sequence accession No. AY274119.3.

2.5) Noncoding 5' and 3' Ends

a) Noncoding 5' end (5'NC)

a.sub.1) Synthesis of the cDNA

[0408] The RNAs derived from the sample 031589, extracted as above, were subjected to reverse transcription under the following conditions:

[0409] The RNA (15 .mu.l) and the primer S/L/-/443 (3 .mu.l at the concentration of 5 .mu.m) were incubated for 10 min at 75.degree. C.

[0410] Next, the 5.times. reverse transcriptase buffer (6 .mu.l, INVITROGEN), 10 Mm dNTP (1 .mu.l), 0.1 M DTT (3 .mu.l) were added and the mixture was incubated at 50.degree. C. for 3 min.

[0411] Finally, the reverse transcriptase (3 .mu.l of Superscript.RTM., INVITROGEN) was added to the preceding mixture which was incubated at 50.degree. C. for 1 h 30 min and then at 90.degree. C. for 2 min.

[0412] The cDNA thus obtained was purified with the aid of the QIAquick PCR purification kit (QIAGEN), according to the manufacturer's recommendations.

b.sub.1) Terminal Transferase Reaction (TdT)

[0413] The cDNA (10 .mu.l) is incubated for 2 min at 100.degree. C., stored in ice, and the following are then added: H.sub.2O (2.5 .mu.l), 5.times.TdT buffer (4 .mu.l, AMERSHAM), 5 mM dATP (2 .mu.l) and TdT (1.5 .mu.l, AMERSHAM). The mixture thus obtained is incubated for 45 min at 37.degree. C. and then for 2 min at 65.degree. C.

[0414] The product obtained is amplified by a first PCR reaction with the aid of the primers: S/L/-225-206 and anchor 14T: 5'-AGATGAATTCGGTACCTTTTTTTTTTTTTT-3' (SEQ ID NO: 68). The amplification conditions are the following: an initial step of denaturation at 94.degree. C. for 2 min is followed by 10 cycles comprising a step of denaturation at 94.degree. C. for 10 sec, a step of annealing at 45.degree. C. for 30 sec and then a step of extension at 72.degree. C. for 30 sec and then by 30 cycles comprising a step of denaturation at 94.degree. C. for 10 sec, a step of annealing at 50.degree. C. for 30 sec and then a step of extension at 72.degree. C. for 30 sec, and then a final step of extension at 72.degree. C. for 5 min.

[0415] The product of the first PCR amplification was subjected to a second amplification step with the aid of the primers: S/L/-/204-185 and anchor 14T mentioned above under conditions identical to those of the first amplification. The amplicon thus obtained was purified, sequenced with the aid of the primer S/L/-/182-163 and it was then cloned as above for the different ORFs, to give the plasmid called SARS-5'NC. The DNA of this clone was isolated and sequenced with the aid of the universal primers M13 sense and M13 antisense and the primer S/L/-/182-163 mentioned above.

[0416] The amplicon representing the cDNA corresponding to the 5'NC end of the SARS-CoV strain derived from the sample recorded under the No. 031589 corresponds to the sequence SEQ ID NO: 72 in the sequence listing appended as an annex; this sequence does not contain differences in relation to the corresponding sequences of the isolates AY274119.3-Tor2 and AY278741-Urbani.

[0417] The plasmid, called SARS-5'NC, was deposited under the No. I-3124, on Nov. 7, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA corresponding to the noncoding 5' end of the genome of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above, said sequence corresponding to the nucleotides at positions 1 to 204 (SEQ ID NO: 39), with reference to the Genbank sequence accession No. AY274119.3.

b) Noncoding 3' End (3'NC)

a.sub.1) Synthesis of the cDNA

[0418] The RNAs derived from the sample 031589, extracted as above, were subjected to reverse transcription, according to the following protocol: the reaction mixture containing: RNA (5 .mu.l), H.sub.2O (5 .mu.l), 5.times. reverse transcriptase buffer (4 .mu.l), 5 mM dNTP (2 .mu.l), 5 .mu.M Oligo 20T (2 .mu.l), 40 U/.mu.l RNasin (0.5 .mu.l) and 10 IU/.mu.l RT-AMV (1.5 .mu.l, PROMEGA) was incubated in a thermo-cycler, under the following conditions: 45 min at 42.degree. C., 15 min at 55.degree. C., 5 min at 95.degree. C., and it was then kept at +4.degree. C.

[0419] The cDNA obtained was amplified by a first PCR reaction with the aid of the primers S/N/+/28468-28487 and anchor 14T mentioned above. The amplification conditions are the following: an initial step of denaturation at 94.degree. C. for 2 min is followed by 10 cycles comprising a step of denaturation at 94.degree. C. for 20 sec, a step of annealing at 45.degree. C. for 30 sec and then a step of extension at 72.degree. C. for 50 sec and then 30 cycles comprising a step of denaturation at 94.degree. C. for 20 sec, a step of annealing at 50.degree. C. for 30 sec and then a step of extension at 72.degree. C. for 50 sec, and then a final step of extension at 72.degree. C. for 5 min.

[0420] The product of the first PCR amplification was subjected to a second amplification step with the aid of the primers S/N/+/28933-28952 and anchor 14T mentioned above, under conditions identical to those of the first amplification. The amplicon thus obtained was purified, sequenced with the aid of the primer S/N/+/29257-29278 and cloned as above for the different ORFs, to give the plasmid called SARS-3'NC. The DNA of this clone was isolated and sequenced with the aid of the universal primers M13 sense and M13 antisense and the primer S/N/+/29257-29278 mentioned above.

[0421] The amplicon representing the cDNA corresponding to the 3'NC end of the SARS-CoV strain derived from the sample recorded under the No. 031589 corresponds to the sequence SEQ ID NO: 73 in the sequence listing appended as an annex; this sequence does not contain differences in relation to the corresponding sequences of the isolates AY274119.3-Tor2 and AY278741-Urbani.

[0422] The plasmid called SARS-3'NC was deposited under the No. I-3123 on Nov. 7, 2003, at the Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, 75724 Paris Cedex 15; it contains the cDNA sequence corresponding to the noncoding 3' end of the genome of the SARS-CoV strain derived from the sample recorded under the No. 031589, as defined above, said sequence corresponding to that situated between the nucleotide at positions 28933 to 29727 (SEQ ID NO: 40), with reference to the Genbank sequence accession No. AY274119.3, ends with a series of nucleotides a.

2.6) ORF1a and ORF1b

[0423] The amplification of the 5' region containing ORF1a and ORF1b of the SARS-CoV genome derived from the sample 031589 was performed by carrying out RT-PCR reactions followed by nested PCRs according to the same principles as those described above for the other ORFs. The amplified fragments overlap over several tenths of bases, thus allowing computer reconstruction of the complete sequence of this part of the genome. On average, the amplified fragments are of two kilobases.

[0424] 14 overlapping fragments, called L0 to L12, were thus amplified with the aid of the following primers: TABLE-US-00002 TABLE II Primers used for the amplification of the 5' region (ORF1a and ORF1b) REGION AMPLIFIED AND SEQUENCED (does not include RT-PCR RT-PCR Nested PCR Nested PCR the primers) sense primer antisense primer sense primer antisense primer L0 S/L0/F1/+30 S/L0/R1/-481 50-480 L1 S/L1/F1/+147 S/L1/R1/-2338 S/L1/F2/+211 S/L1/R2/-2241 231-2240 L2 S/L2/F1/+2033 S/L2/R1/-4192 S/L2/F2/+2136 S/L2/R2/-4168 2156-4167 L3 S/L3bis/F1/+3850 S/L3bis/R1/-5365 S/L3bis/F2/+3892 S/L3bis/R2/-5325 3913-5324 L4b S/L4b/F1/+4878 S/L4b/R1/-6061 S/L4b/F2/+4932 S/L4b/R2/-6024 4952-6023 L4 S/L4/F1/+5272 S/L4/R1/-7392 S/L4/F2/+5305 S/L4/R2/-7323 5325-7318 L5 S/L5/F1/+7111 S/L5/R1/-9253 S/L5/F2/+7275 S/L5/R2/-9157 7296-9156 L6 S/L6/F1/+8975 S/L6/R1/-11151 S/L6/F2/+9032 S/L6/R2/-11067 9053-11066 L7 S/L7/F1/+10883 S/L7/R1/-13050 S/L7/F2/+10928 S/L7/R2/-12963 10928-12962 L8 S/L8/F1/+12690 S/L8/R1/-14857 S/L8/F2/+12815 S/L8/R2/-14835 12835-14834 L9 S/L9/F1/+14688 S/L9/R1/-16678 S/L9/F2/+14745 S/L9/R2/-16625 14765-16624 L10 S/L10/F1/+16451 S/L10/R1/-18594 S/L10/F2/+16514 S/L10/R2/-18571 16534-18570 L11 S/L11/F1/+18441 S/L11/R1/-20612 S/L11/F2/+18500 S/L11/R2/-20583 18521-20582 L12 S/L12/F1/+20279 S/L12/R1/-22229 S/L12/F2/+20319 S/L12/R2/-22206 20338-22205.

[0425] All the fragments were amplified under the following conditions, except fragment L0 which was amplified as described above for ORF-M: [0426] RT-PCR: 30 min at 42.degree. C., 15 min at 55.degree. C., 2 min at 94.degree. C., and then the cDNA obtained is amplified under the following conditions: 40 cycles comprising: a step of denaturation at 94.degree. C. for 15 sec, a step of annealing at 58.degree. C. for 30 sec and then a step of extension at 68.degree. C. for 1 min 30 sec, with 5 sec additional extension at each cycle, and then a final step of extension at 68.degree. C. for 7 min. [0427] Nested PCR: An initial step of denaturation at 94.degree. C. for 2 min is followed by 35 cycles comprising: a step of denaturation at 94.degree. C. for 15 sec, a step of annealing at 60.degree. C. for 30 sec and then a step of extension at 72.degree. C. for 1 min 30 sec, with 5 sec of additional extension at each cycle, and then a final step of extension at 72.degree. C. for 7 min.

[0428] The amplification products were sequenced with the aid of the primers defined in table III below: TABLE-US-00003 TABLE III Primers used for the sequencing of the 5' region (ORF1a and ORF1b) Sequences Names (SEQ ID NO: 76 to 139) S/L3/+/4932 5'-CCACACACAGCTTGTGGATA-3' S/L4/+/6401 5'-CCGAAGTTGTAGGCAATGTC-3' S/L4/+/6964 5'-TTTGGTGCTCCTTCTTATTG-3' S/L4/-/6817 5'-CCGGCATCCAAACATAATTT-3' S/L5/-/7633 5'-TGGTCAGTAGGGTTGATTGG-3' S/L5/-/8127 5'-CATCCTTTGTGTCAACATCG-3' S/L5/-/8633 5'-GTCACGAGTGACACCATCCT-3' S/L5/+/7839 5'-ATGCGACGAGTCTGCTTCTA-3' S/L5/+/8785 5'-TTCATAGTGCCTGGCTTACC-3' S/L5/+/8255 5'-ATCTTGGCGCATGTATTGAC-3' S/L6/-/9422 5'-TGCATTAGCAGCAACAACAT-3' S/L6/-/9966 5'-TCTGCAGAACAGCAGAAGTG-3' S/L6/-/10542 5'-CCTGTGCAGTTTGTCTGTCA-3' S/L6/+/10677 5'-CCTTGTGGCAATGAAGTACA-3' S/L6/+/10106 5'-ATGTCATTTGCACAGCAGAA-3' S/L6/+/9571 5'-CTTCAATGGTTTGCCATGTT-3' S/L7/-/11271 5'-TGCGAGCTGTCATGAGAATA-3' S/L7/-/11801 5'-AACCGAGAGCAGTACCACAG-3' S/L7/-/12383 5'-TTTGGCTGCTGTAGTCAATG-3' S/L7/+/12640 5'-CTACGACAGATGTCCTGTGC-3' S/L7/+/12088 5'-GAGCAGGCTGTAGCTAATGG-3' S/L7/+/11551 5'-TTAGGCTATTGTTGCTGCTG-3' S/L8/-13160 5'-CAGACAACATGAAGCACCAC-3' S/L8/-/13704 5'-CGCTGACGTGATATATGTGG-3' S/L8/-14284 5'-TGCACAATGAAGGATACACC-3' S/L8/+/14453 5'-ACATAGCTCGCGTCTCAGTT-3' S/L8/+/13968 5'-GGCATTGTAGGCGTACTGAC-3' S/L8/+/13401 5'-GTTTGCGGTGTAAGTGCAG-3' S/L9/-15098 5'-TAGTGGCGGCTATTGACTTC-3' S/L9/-15677 5'-CTAAACCTTGAGCCGCATAG-3' S/L9/-16247 5'-CATGGTCATAGCAGCACTTG-3' S/L9/+16323 5'-CCAGGTTGTGATGTCACTGAT-3' S/L9/+15858 5'-CCTTACCCAGATCCATCAAG-3' S/L9/+15288 5'-CGCAAACATAACACTTGCTG-3' S/L10/-16914 5'-AGTGTTGGGTACAAGCCAGT-3' S/L10/-17466 5'-GTTCCAAGGAACATGTCTGG-3' S/L10/-18022 5'-AGGTGCCTGTGTAGGATGAA-3' S/L10/+18245 5'-GGGCTGTCATGCAACTAGAG-3' S/L10/+17663 5'-TCTTACACGCAATCCTGCTT-3' S/L10/+17061 5'-TACCCATCTGCTCGCATAGT-3' S/L11/-/18877 5'-GCAAGCAGAATTAACCCTCA-3' S/L11/-19396 5'-AGCACCACCTAAATTGCATC-3' S/L11/-20002 5'-TGGTCCCTTTGAAGGTGTTA-3' S/L11/+20245 5'-TCGAACACATCGTTTATGGA-3' S/L11/+/19611 5'-GAAGCACCTGTTTCCATCAT-3' S/L11/+/19021 5'-ACGATGCTCAGCCATGTAGT-3' SARS/L1/F3/+800 5'-GAGGTGCAGTCACTCGCTAT-3' SARS/L1/F4/+1391 5'-CAGAGATTGGACCTGAGCAT-3' SARS/L1/F5/+1925 5'-CAGCAAACCACTCAATTCCT-3' SARS/L1/R3/-1674 5'-AAATGATGGCAACCTCTTCA-3' SARS/L1/R4/-1107 5'-CACGTGGTTGAATGACTTTG-3' SARS/L1/R5/-520 5'-ATTTCTGCAACCAGCTCAAC-3' SARS/L2/F3/+2664 5'-CGCATTGTCTCCTGGTTTAC-3' SARS/L2/F4/+3232 5'-GAGATTGAGCCAGAACCAGA-3' SARS/L2/F5/+3746 5'-ATGAGCAGGTTGTCATGGAT-3' SARS/L2/R3/-3579 5'-CTGCCTTAAGAAGCTGGATG-3' SARS/L2/R4/-2991 5'-TTTCTTCACCAGCATCATCA-3' SARS/L2/R5/-2529 5'-CACCGTTCTTGAGAACAACC-3' SARS/L3/F3/+4708 5'-TCTTTGGCTGGCTCTTACAG-3' SARS/L3/F4/+5305 5'-GCTGGTGATGCTGCTAACTT-3' SARS/L3/F5/+5822 5'-CCATCAAGCCTGTGTCGTAT-3' SARS/L3/R3/-5610 5'-CAGGTGGTGCAGACATCATA-3' SARS/L3/R4/-4988 5'-AACATCAGCACCATCCAAGT-3' SARS/L3/R5/-4437 5'-ATCGGACACCATAGTCAACG-3'

[0429] The sequences of the fragments L0 to L12 of the SARS-CoV strain derived from the sample recorded under the No. 031589 correspond respectively to the sequences SEQ ID NO: 41 to SEQ ID NO: 54 in the sequence listing appended as an annex. Among these sequences, only that corresponding to the fragments L5 contains a nucleotide difference in relation to the corresponding sequence of the isolate AY278741-Urbani. This t/c mutation at position 7919 results in a modification of the amino acid sequence of the corresponding protein, encoded by ORF1a: at position 2552, a valine (gtt codon; AY278741) is changed to alanine (gct codon) in the SARS-CoV strain 031589. By contrast, no mutation was identified in relation to the corresponding sequence of the isolate AY274119.3-Urbani. The other fragments do not exhibit differences in relation to the corresponding sequences of the isolates Tor2 and Urbani.

EXAMPLE 2

Production and Purification of the Recombinant N and S Proteins of the SARS-CoV Strain Derived from the Sample Recorded Under the Number 031589

[0430] The entire N protein and two polypeptide fragments of the S protein of the SARS-CoV strain derived from the sample recorded under the number 031589 were produced in E. coli, in the form of fusion proteins comprising an N- or C-terminal polyhistidine tag. In the two S polypeptides, the N- and C-terminal hydrophobic sequences of the S protein (signal peptide: positions 1 to 13 and transmembrane helix: positions 1196 to 1218) were deleted whereas the .beta. helix (positions 565 to 687) and the two motifs of the coiled-coil type (positions 895 to 980 and 1155 to 1186) of the S protein were preserved. These two polypeptides consist of: a long fragment (S.sub.L) corresponding to positions 14 to 1193 of the amino acid sequence of the S protein and a short fragment (S.sub.C) corresponding to positions 475 to 1193 of the amino acid sequence of the S protein.

1) Cloning of the cDNAS N, S.sub.L and S.sub.C into the Expression Vectors pIVEX2.3 and pIVEX2.4

[0431] The cDNAs corresponding to the N protein and to the S.sub.L and S.sub.C fragments were amplified by PCR under standard conditions, with the aid of the DNA polymerase Platinum Pfx.RTM. (INVITROGEN). The plasmids SRAS-N and SRAS-S were used as template and the following oligo-nucleotides as primers: TABLE-US-00004 5'-CCCATATGTCTGATAATGGACCCCAATCAAAC-3' (N sense, SEQ ID NO: 55) 5'-CCCCCGGGTGCCTGAGTTGAATCAGCAGAAGC-3' (N antisense, SEQ ID NO: 56) 5'-CCCATATGAGTGACCTTGACCGGTGCACCAC-3' (S.sub.c sense, SEQ ID NO: 57) 5'-CCCATATGAAACCTTGCACCCCACCTGCTC-3' (S.sub.L sense, SEQ ID NO: 58) 5'-CCCCCGGGTTTAATATATTGCTCATATTTTCCC-3' (S.sub.c and S.sub.L antisense, SEQ ID NO: 29).

[0432] The sense primers introduce an NdeI site (underlined) while the antisense primers introduce an XmaI or SmaI site (underlined). The 3 amplification products were column purified (QIAquick PCR Purification kit, QIAGEN) and cloned into an appropriate vector. The plasmid DNA purified from the 3 constructs (QIAFilter Midi Plasmid kit, QIAGEN) was verified by sequencing and digested with the enzymes NdeI and XmaI. The 3 fragments corresponding to the cDNAs N, S.sub.L and S.sub.C were purified on agarose gel and then inserted into the plasmids pIVEX2.3MCS(C-terminal polyhistidine tag) and pIVEX2.4d (N-terminal polyhistidine tag) digested beforehand with the same enzymes. After verification of the constructs, the 6 expression vectors thus obtained (pIV2.3N, pIV2.3S.sub.C, pIV2.3S.sub.L, pIV2.4N, pIV2.4S.sub.C also called pIV2.4S.sub.1, pIV2.4S.sub.L) were then used, on the one hand to test the expression of the proteins in vitro, and on the other hand to transform the bacterial strain BL21(DE3)pDIA17 (NOVAGEN). These constructs encode proteins whose expected molecular mass is the following: pIV2.3N (47174 Da), pIV2.3S.sub.C (82897 Da), pIV2.3S.sub.L (132056 Da), pIV2.4N (48996 Da), pIV2.4S.sub.1 (81076 Da) and pIV2.4S.sub.L (133877 Da). Bacteria transformed with pIV2.3N were deposited at the CNCM on Oct. 23, 2003, under the number I-3117, and bacteria transformed with pIV2.4S.sub.1 were deposited at the CNCM on Oct. 23, 2003, under the number I-3118.

2) Analysis of the Expression of the Recombinant Proteins In Vitro and In Vivo

[0433] The expression of recombinant proteins from the 6 recombinant vectors was tested, in a first instance, in a system in vitro (RTS100, Roche). The proteins produced in vitro, after incubation of the recombinant vectors pIVEX for 4 h at 30.degree. C., in the RTS100 system, were analyzed by Western blotting with the aid of an anti-(his).sub.6 antibody coupled to peroxidase. The result of expression in vitro (FIG. 1) shows that only the N protein is expressed in large quantities, regardless of the position, N- or C-terminal, of the polyhistidine tag. In a second step, the expression of the N and S proteins was tested in vivo at 30.degree. C. in LB medium in the presence or in the absence of inducer (1 mM IPTG). The N protein is very well produced in this bacterial The sequences of the fragments L0 to L12 of the SARS-CoV strain derived from the sample recorded under the No. 031589 correspond respectively to the sequences SEQ ID NO: 41 to SEQ ID NO: 54 in the sequence listing appended as an annex. Among these sequences, only that corresponding to the fragments L5 contains a nucleotide difference in relation to the corresponding sequence of the isolate AY278741-Urbani. This t/c mutation at position 7919 results in a modification of the amino acid sequence of the corresponding protein, encoded by ORF1a: at position 2552, a valine (gtt codon; AY278741) is changed to alanine (gct codon) in the SARS-CoV strain 031589. By contrast, no mutation was identified in relation to the corresponding sequence of the isolate AY274119.3-Urbani. The other fragments do not exhibit differences in relation to the corresponding sequences of the isolates Tor2 and Urbani.

EXAMPLE 2

Production and Purification of the Recombinant N and S Proteins of the SARS-CoV Strain Derived from the Sample Recorded Under the Number 031589

[0434] The entire N protein and two polypeptide fragments of the S protein of the SARS-CoV strain derived from the sample recorded under the number 031589 were produced in E. coli, in the form of fusion proteins comprising an N- or C-terminal polyhistidine tag. In the two S polypeptides, the N- and C-terminal hydrophobic sequences of the S protein (signal peptide: positions 1 to 13 and transmembrane helix: positions 1196 to 1218) were deleted whereas the .beta. helix (positions 565 to 687) and the two motifs of the coiled-coil type (positions 895 to 980 and 1155 to 1186) of the S protein were preserved. These two polypeptides consist of: a long fragment (S.sub.L) corresponding to positions 14 to 1193 of the amino acid sequence of the S protein and a short fragment (S.sub.C) corresponding to positions 475 to 1193 of the amino acid sequence of the S protein.

1) Cloning of the cDNAS N, S.sub.L and S.sub.C into the Expression Vectors pIVEX2.3 and pIVEX2.4

[0435] The cDNAs corresponding to the N protein and to the S.sub.L and S.sub.C fragments were amplified by PCR under standard conditions, with the aid of the DNA polymerase Platinum Pfx.RTM. (INVITROGEN). The plasmids SRAS-N and SRAS-S were used as template and the following oligo-nucleotides as primers: TABLE-US-00005 5'-CCCATATGTCTGATAATGGACCCCAATCAAAC-3' (N sense, SEQ ID NO: 55) 5'-CCCCCGGGTGCCTGAGTTGAATCAGCAGAAGC-3' (N antisense, SEQ ID NO: 56) 5'-CCCATATGAGTGACCTTGACCGGTGCACCAC-3' (S.sub.c sense, SEQ ID NO: 57) 5'-CCCATATGAAACCTTGCACCCCACCTGCTC-3' (S.sub.L sense, SEQ ID NO: 58) 5'-CCCCCGGGTTTAATATATTGCTCATATTTTCCC-3' (S.sub.c and S.sub.L antisense, SEQ ID NO: 29).

[0436] The sense primers introduce an NdeI site (underlined) while the antisense primers introduce an XmaI or SmaI site (underlined). The 3 amplification products were column purified (QIAquick PCR Purification kit, QIAGEN) and cloned into an appropriate vector. The plasmid DNA purified from the 3 constructs (QIAFilter Midi Plasmid kit, QIAGEN) was verified by sequencing and digested with the enzymes NdeI and XmaI. The 3 fragments corresponding to the cDNAs N, S.sub.L and S.sub.C were purified on agarose gel and then inserted into the plasmids pIVEX2.3MCS(C-terminal polyhistidine tag) and pIVEX2.4d (N-terminal polyhistidine tag) digested beforehand with the same enzymes. After verification of the constructs, the 6 expression vectors thus obtained (pIV2.3N, pIV2.3S.sub.C, pIV2.3S.sub.L, pIV2.4N, pIV2.4S.sub.C also called pIV2.4S.sub.1, pIV2.4S.sub.L) were then used, on the one hand to test the expression of the proteins in vitro, and on the other hand to transform the bacterial strain BL21(DE3)pDIA17 (NOVAGEN). These constructs encode proteins whose expected molecular mass is the following: pIV2.3N (47174 Da), pIV2.3S.sub.C (82897 Da), pIV2.3S.sub.L (132056 Da), pIV2.4N (48996 Da), pIV2.4S.sub.1 (81076 Da) and pIV2.4S.sub.L (133877 Da). Bacteria transformed with pIV2.3N were deposited at the CNCM on Oct. 23, 2003, under the number I-3117, and bacteria transformed with pIV2.4S.sub.1 were deposited at the CNCM on Oct. 23, 2003, under the number I-3118.

2) Analysis of the Expression of the Recombinant Proteins In Vitro and In Vivo

[0437] The expression of recombinant proteins from the 6 recombinant vectors was tested, in a first instance, in a system in vitro (RTS100, Roche). The proteins produced in vitro, after incubation of the recombinant vectors pIVEX for 4 h at 30.degree. C., in the RTS100 system, were analyzed by Western blotting with the aid of an anti-(his).sub.6 antibody coupled to peroxidase. The result of expression in vitro (FIG. 1) shows that only the N protein is expressed in large quantities, regardless of the position, N- or C-terminal, of the polyhistidine tag. In a second step, the expression of the N and S proteins was tested in vivo at 30.degree. C. in LB medium in the presence or in the absence of inducer (1 mM IPTG). The N protein is very well produced in this bacterial system (FIG. 2) and is found mainly in a soluble fraction after lysis of the bacteria. By contrast, the long version of S (S.sub.L) is very weakly produced and is completely insoluble (FIG. 3). The short version (S.sub.C) also exhibits a very weak solubility, but an expression level that is much higher than that of the long version. Moreover, the construct S.sub.C fused with a polyhistidine tag at the C-terminal position has a smaller size than that expected. An immunodetection experiment with an anti-polyhistidine antibody has shown that this construct was incomplete. In conclusion, the two constructs, pIV2.3N and pIV2.4S.sub.1, which express respectively the entire N protein fused with the C-terminal polyhistidine tag and the short S protein fused with the N-terminal polyhistidine tag, were selected in order to produce the two proteins in a large quantity so as to purify them. The plasmids pIV2.3N and pIV2.4S.sub.1 were deposited respectively under the No. I-3117 and I-3118 at the CNCM, 25 rue du Docteur Roux, 75724 PARIS 15, on Oct. 23, 2003.

3) Analysis of the Antigenic Activity of the Recombinant Proteins

[0438] The antigenic activity of the N, S.sub.L and S.sub.C proteins was tested by Western blotting with the aid of two serum samples, obtained from the same patient infected with SARS-CoV, collected 8 days (M12) and 29 days (M13) after the onset of the SARS symptoms. The experimental protocol is as described in example 3. The results illustrated by FIG. 4 show (i) the seroconversion of the patient, and (ii) that the N protein possesses a higher antigenic reactivity than the short S protein.

4) Purification of the N Protein from pIV2.3N

[0439] Several experiments for purifying the N protein, produced from the vector pIV2.3N, were carried out according to the following protocol. The bacteria BL21(DE3)pDIA17, transformed with the expression vector pIV2.3N, were cultured at 30.degree. C. in 1 liter of culture medium containing 0.1 mg/ml of ampicillin, and induced with 1 mM IPTG when the cell density equivalent to A.sub.600=0.8 is reached (about 3 hours). After 2 hours of culture in the presence of inducer, the cells were recovered by centrifugation (10 min at 5000 rpm), resuspended in the lysis buffer (50 mM NaH.sub.2PO.sub.4, 0.3 M NaCl, 20 mM imidazole, pH 8, containing the mixture of protease inhibitors Complete.RTM., Roche), and lysed with the French press (12 000 psi). After centrifugation of the bacterial lysate (15 min at 12 000 rpm), the supernatant (50 ml) was deposited at a flow rate of 1 ml/min on a metal chelation column (15 ml) (Ni-NTA superflow, Qiagen), equilibrated with the lysis buffer. After washing the column with 200 ml of lysis buffer, the N protein was eluted with an imidazole gradient (20.fwdarw.250 mM) in 10 column volumes. The fractions containing the N protein were assembled and analyzed by polyacrylamide gel electrophoresis under denaturing conditions followed by staining with Coomassie blue. The results illustrated by FIG. 5 show that the protocol used makes it possible to purify the N protein with a very satisfactory homogeneity (95%) and a mean yield of 15 mg of protein per liter of culture.

5) Purification of the S.sub.C Protein from pIV2.4S.sub.C (pIV2.4S.sub.1)

[0440] The protocol followed for purifying the short S protein is very different from that described above because the protein is highly aggregated in the bacterial system (inclusion bodies). The bacteria BL21(DE3)pDIA17, transformed with the expression vector pIV2.4S.sub.1, were cultured at 30.degree. C. in 1 liter of culture medium containing 0.1 mg/ml of ampicillin, and induced with 1 mM IPTG when the cell density equivalent to A.sub.600=0.8 is reached (about 3 hours). After 2 hours of culture in the presence of inducer, the cells were recovered by centrifugation (10 min at 5000 rpm), resuspended in the lysis buffer (0.1 M Tris-HCl, 1 mM EDTA, pH 7.5), and lysed with the French press (1200 psi). After centrifugation of the bacterial lysate (15 min at 12 000 rpm), the pellet was resuspended in 25 ml of lysis buffer containing 2% Triton X100 and 10 mM .beta.-mercaptoethanol, and then centrifuged for 20 min at 12 000 rpm. The pellet was resuspended in 10 mM Tris-HCl buffer containing 7 M urea, and gently stirred for 30 min at room temperature. This final washing of the inclusion bodies with 7 M urea is necessary in order to remove most of the E. coli membrane proteins which co-sediment with the aggregated S.sub.C protein. After a final centrifugation for 20 min at 12 000 rpm, the final pellet is resuspended in the 10 mM Tris-HCl buffer. The electrophoretic analysis of this preparation (FIG. 6) shows that the short S protein may be purified with a satisfactory homogeneity (about 90%) from the inclusion bodies (insoluble extract).

EXAMPLE 3

Immunodominance of the N Protein

[0441] The reactivity of the antibodies present in the serum of patients suffering from atypical pneumopathy caused by the SARS-associated coronavirus (SARS-CoV), toward the various proteins of this virus, was analyzed by Western blotting under the conditions described below.

1) Materials

a) Lysate of Cells Infected with SARS-CoV

[0442] Vero E6 cells (2.times.10.sup.6) were infected with SARS-CoV (isolate recorded under the number FFM/MA104) at a multiplicity of infection (M.O.I.) of 10.sup.-1 or 10.sup.-2 and then incubated in DMEM medium containing 2% FCS, at 35.degree. C. in an atmosphere containing 5% CO.sub.2. 48 hours later, the cellular lawn was washed with PBS and then lysed with 500 .mu.l of loading buffer prepared according to Laemmli and containing .beta.-mercaptoethanol. The samples were then boiled for 10 minutes and then sonicated for 3 times 20 seconds.

b) Antibodies

b.sub.1) Serum from a Patient Suffering from Atypical Pneumopathy

[0443] The serum designated by a reference at the National Reference Center for Influenza Viruses (Northern region) under the No. 20033168 is that from a French patient suffering from atypical pneumopathy caused by SARS-CoV collected on day 38 after the onset of the symptoms; the diagnosis of SARS-CoV infection was performed by nested RT-PCR and quantitative PCR.

b.sub.2) Monospecific Rabbit Polyclonal Sera Directed Against the N Protein or the S Protein

[0444] The sera are those produced from the recombinant N and S.sub.C proteins (example 2), according to the immunization protocol described in example 4; they are the rabbit P13097 serum (anti-N serum) and the rabbit P11135 serum (anti-S serum).

2) Method

[0445] 20 .mu.l of lysate of cells infected with SARS-CoV at M.O.I. values of 10.sup.-1 and 10.sup.-2 and, as a control, 20 .mu.l of a lysate of noninfected cells (mock) were separated on 10% SDS polyacrylamide gel and then transferred onto a nitrocellulose membrane. After blocking in a solution of PBS/5% milk/0.1% Tween and washing in PBS/0.1% Tween, this membrane was hybridized overnight at 4.degree. C. with: (i) the immune serum No. 20033168 diluted 1/300, 1/1000 and 1/3000 in the buffer PBS/1% BSA/0.1% Tween, (ii) the rabbit P13097 serum (anti-N serum) diluted 1/50 000 in the same buffer and (iii) the rabbit P11135 serum (anti-S serum) diluted 1/10 000 in the same buffer. After washing in PBS/Tween, a secondary hybridization was performed with the aid of either sheep polyclonal antibodies directed against the heavy and light chains of human G immunoglobulins and coupled with peroxidase (NA933V, Amersham), or of donkey polyclonal antibodies directed against the heavy and light chains of the rabbit G immunoglobulins and coupled with peroxidase (NA934V, Amersham). The bound antibodies were visualized with the aid of the ECL+ kit (Amersham) and of Hyperfilm MP autoradiography films (Amersham). A molecular mass ladder (kDa) is presented in the figure.

3) Results

[0446] FIG. 7 shows that three polypeptides of apparent molecular mass 35, 55 and 200 kDa are specifically detected in the extracts of cells infected with SARS-CoV.

[0447] In order to identify these polypeptides, two other immunoblots (FIG. 8) were prepared on the same samples and under the same conditions with rabbit polyclonal antibodies specific for the nucleoprotein N (rabbit P13097, FIG. 8A) and for the spicule protein S (rabbit P11135, FIG. 8B). This experiment shows that the 200 kDa polypeptide corresponds to the SARS-CoV spicule glycoprotein S, that the 55 kDa polypeptide corresponds to the nucleoprotein N while the 35 kDa polypeptide probably represents a truncated or degraded form of N.

[0448] The data presented in FIG. 7 therefore show that the serum 20033168 strongly reacts with N and a lot more weakly with the SARS-CoV S since the 35 and 55 kDa polypeptides are visualized in the form of intense bands for 1/300, 1/1000 and 1/3000 dilutions of the immunoserum whereas the 200 kDa polypeptide is only weakly visualized for a dilution of 1/300. It is also possible to note that no other SARS-CoV polypeptide is detected for dilutions greater than 1/300 of the serum 20033168.

[0449] This experiment indicates that the antibody response specific for the SARS-CoV N dominates the antibody responses specific for the other SARS-CoV polypeptides and in particular the antibody response directed against the S glycoprotein. It indicates an immuno-dominance of the nucleoprotein N during human infections with SARS-CoV.

EXAMPLE 4

Preparation of Monospecific Polyclonal Anti-Bodies Directed Against the SARS-Associated Coronavirus (SARS-CoV) N and S Proteins

1) Materials and Method

[0450] Three rabbits (P13097, P13081, P13031) were immunized with the purified recombinant polypeptide corresponding to the entire nucleoprotein (N), prepared according to the protocol described in example 2. After a first injection of 0.35 mg per rabbit of protein emulsified in complete Freund's adjuvant (intradermal route), the animals received 3 booster injections at 3 and then 4 weeks' interval, of 0.35 mg of recombinant protein emulsified in incomplete Freund's adjuvant.

[0451] Three rabbits (P11135, P13042, P14001) were immunized with the recombinant polypeptide corresponding to the short fragment of the S protein (S.sub.C) produced as described in example 2. As this polypeptide is found mainly in the form of inclusion bodies in the bacterial cytoplasm, the animals received 4 intradermal injections at 3-4 weeks' interval of a preparation of inclusion bodies corresponding to 0.5 mg of recombinant protein emulsified in incomplete Freund's adjuvant. The first 3 injections were made with a preparation of inclusion bodies prepared according to the protocol described in example 2, while the fourth injection was made with a preparation of inclusion bodies which were prepared according to the protocol described in example 2 and then purified on sucrose gradient and washed in 2% Triton X100.

[0452] For each rabbit, a preimmune (p.i.) serum was prepared before the first immunization and an immune serum (I.S.) 5 weeks after the fourth immunization.

[0453] In a first instance, the reactivity of the sera was analyzed by ELISA test on preparations of recombinant proteins similar to those used for the immunizations; the ELISA tests were carried out according to the protocol and with the reagents as described in example 6.

[0454] In a second instance, the reactivity of the sera was analyzed by preparing an immunoblot (Western blot) of a lysate of cells infected with SARS-CoV, according to the protocol as described in example 3.

2) Results

[0455] The ELISA tests (FIG. 9) demonstrate that the preparations of recombinant N protein and of inclusion bodies of the short fragment of the S protein (S.sub.C) are immunogenic in animals and that the titer of the immune sera is high (more than 1/25 000).

[0456] The immunoblot (FIG. 8) shows that the rabbit P13097 immune serum recognizes two polypeptides present in the lysates of cells infected with SARS-CoV: a polypeptide whose apparent molecular mass (50-55 kDa based on experiments) is compatible with that of the nucleo-protein N (422 residues, predicted molecular mass of 46 kDa) and a polypeptide of 35 kDa, which probably represents a truncated or degraded form of N.

[0457] This experiment also shows that the rabbit P11135 serum mainly recognizes a polypeptide whose apparent molecular mass (180-220 kDa based on experiments) is compatible with a glycosylated form of S (1255 residues, nonglycosylated polypeptide chain of 139 kDa), as well as lighter polypeptides, which probably represent truncated and/or nonglycosylated forms of S.

[0458] In conclusion, all these experiments demonstrate that the recombinant polypeptides expressed in E. coli and corresponding to the SARS-CoV N and S proteins make it possible to induce, in animals, polyclonal antibodies capable of recognizing the native forms of these proteins.

EXAMPLE 5

Preparation of Monospecific Polyclonal Anti-Bodies Directed Against the SARS-Associated Coronavirus (SARS-CoV) M and E Proteins

1) Analysis of the Structure of the M and E Proteins

a) E Protein

[0459] The structure of the SARS-CoV E protein (76 amino acids) was analyzed in silico, with the aid of various software packages such as signalP v1.1, NetNGlyc 1.0, THMM 1.0 and 2.0 (Krogh et al., 2001, J. Mol. Biol., 305(3):567-580) or alternatively TOPPRED (von Heijne, 1992, J. Mol. Biol. 225, 487-494). The analysis shows that this nonglycosylated polypeptide is a type 1 membrane protein, containing a single transmembrane helix (aa 12-34 according to THMM), and in which the majority of the hydrophilic domain (42 residues) is located at the C-terminal end and probably inside the viral particle (endodomain). It is possible to note an inversion in the topology predicted by versions 1.0 (N-ter is external) and 2.0 (N-ter is internal) of the THMM software, but that other algorithms, in particular TOPPRED and THUMBUP (Zhou et Zhou, 2003, Protein Science 12:1547-1555) confirm an external location of the N-terminal end of E.

b) M Protein

[0460] A similar analysis carried out on the SARS-CoV M protein (221 amino acids) shows that this polypeptide does not possess a signal peptide (according to the software signalP v1.1) but three transmembrane domains (residues 15-37, 50-72, 77-99 according to THMM 2.0) and a large hydrophilic domain (aa 100-221) located inside the viral particle (endodomain). It is probably glycosylated on the asparagine at position 4 (according to NetNGlyc 1.0).

[0461] Thus, in agreement with the experimental data known for the other coronaviruses, it is remarkable that the two M and E proteins exhibit endodomains corresponding to the majority of the polypeptides and of the ectodomains that are very small in size. [0462] The ectodomain of E probably corresponds to residues 1 to 11 or 1 to 12 of the protein: MYSFVSEETGT(L), SEQ ID NO: 70. Indeed, the probability associated with the transmembrane location of residue 12 is intermediate (0.56 according to THMM 2.0). [0463] The ectodomain of M probably corresponds to residues 2 to 14 of the protein: ADNGTITVEELKQ, SEQ ID NO: 69. Indeed, the N-terminal methionine of M is very probably cleaved from the mature polypeptide because the residue at position 2 is an alanine (Varshavsky, 1996, 93:12142-12149).

[0464] Moreover, the analysis of the hydrophobicity (Kyte & Doolittle, Hopp & Woods) of the E protein demonstrates that the C-terminal end of the endodomain of E is hydrophilic and therefore probably exposed at the surface of this domain. Thus, a synthetic peptide corresponding to this end is a good immunogenic candidate for inducing, in animals, antibodies directed against the endodomain of E. Consequently, a peptide corresponding to 24 C-terminal residues of E was synthesized.

2) Preparation of Antibodies Directed Against the Ectodomain of the M and E Proteins and the Endodomain of the E Protein

[0465] The peptides M2-14 (ADNGTITVEELKQ, SEQ ID NO: 69), E1-12 (MYSFVSEETGTL, SEQ ID NO: 70) and E53-76 (KPTVYVYSRV KNLNSSEGVP DLLV, SEQ ID NO: 71) were synthesized by Neosystem. They were coupled with KLH (Keyhole Limpet Hemocyanin) with the aid of MBS (m-maleimido-benzoyl-N-hydroxysuccinimide ester) via a cysteine added during the synthesis either at the N-terminus of the peptide (case for E53-76) or at the C-terminus (case of M2-14 and E1-12).

[0466] Two rabbits were immunized with each of the conjugates, according to the following immunization protocol: after a first injection of 0.5 mg of peptide coupled with KLH and emulsified in complete Freund's adjuvant (intra-dermal route), the animals receive 2 to 4 booster injections at 3 or 4 weeks' interval of 0.25 mg of peptide coupled to KLH and emulsified in incomplete Freund's adjuvant.

[0467] For each rabbit, a preimmune (p.i.) serum was prepared before the first immunization and an immune serum (I.S.) is prepared 3 to 5 weeks after the booster injections.

[0468] The reactivity of the sera was analyzed by Western blotting with the aid of extracts of cells infected with SARS-CoV (FIG. 43B) or with the aid of extracts of cells infected with a recombinant vaccinia virus expressing the protein E (VV-TG-E, FIG. 43A) or M (VV-TN-M, FIG. 43C) of the SARS-CoV 031589 isolate.

[0469] The immune sera of the rabbits 22234 and 22240, immunized with the conjugate KLH-E53-76, recognize a polypeptide of about 9 to 10 kD, which is present in the extracts of cells infected with SARS-CoV but absent from the extracts of noninfected cells (FIG. 43B). The apparent mass of this polypeptide is compatible with the predicted mass of the E protein, which is 8.4 kD. Similarly, the immune serum of the rabbit 20047, immunized with the conjugate KLH-E1-12, recognizes a polypeptide present in the extracts of cells infected with the VV-TG-E virus, whose apparent molar mass is compatible with that of the E protein (FIG. 43A).

[0470] The immune serum of the rabbits 20013 and 20080, immunized with the conjugate KLH-M2-14, recognizes a polypeptide present in the extracts of cells infected with the VV-TN-M virus (FIG. 43C), whose apparent molar mass (about 18 kD) is compatible with that of the glycoprotein M, which is 25.1 kD and has a high iso-electric point (9.1 for the naked polypeptide).

[0471] These results demonstrate that the peptides E1-12 and E53-76, on the one hand, and the peptide M2-14, on the other hand, make it possible to induce, in animals, polyclonal antibodies capable of recognizing the native forms of the SARS-CoV E and M proteins, respectively.

EXAMPLE 6

Analysis of the ELISA Reactivity of the Recombinant N Protein Toward Sera from Patients Suffering from SARS

1) Materials

[0472] The antigen used to prepare the solid phases is the purified recombinant nucleoprotein N prepared according to the protocol described in example 2.

[0473] The sera to be tested (table IV) were chosen on the basis of the results of analysis of their reactivity by immunofluorescence (IF-SARS titer), toward cells infected with SARS-CoV. TABLE-US-00006 TABLE IV Sera tested by ELISA Serum Date of the IF-SARS Reference No. Type of serum serum*** titer 3050 A Control na* nt** 3048 B Control na nt 033168 D Patient 1-SARS Apr. 27, 2003 (D38) 320 033397 E Patient-1 SARS May 11, 2005 (D52) 320 032632 F Patient-2 SARS Mar. 21, 2003 (D17) 2500 032791 G Patient-3 SARS Apr. 04, 2003 (D3) <40 033258 H Patient-3 SARS Apr. 28, 2003 (D27) 160 *na: not applicable. **nt: not tested. ***the dates indicated correspond to the number of days after the onset of the SARS symptoms.

2) Method

[0474] The N protein (100 .mu.l) diluted at various concentrations in 0.1 M carbonate buffer, pH 9.6 (1, 2 or 4 .mu.g/ml) is distributed into the wells of ELISA plates, and then the plates are incubated overnight at laboratory temperature. The plates are washed with PBS-Tween buffer saturated with PBS-skimmed milk-sucrose (5%) buffer. The test sera (100 .mu.l), diluted beforehand ( 1/50, 1/100, 1/200, 1/400, 1/800, 1/1600 and 1/3200) are added and then the plates are incubated for 1 h at 37.degree. C. After 3 washings, the peroxidase-labeled anti-human IgG conjugate (reference 209-035-098, JACKSON) diluted 1/18 000 is added and then the plates are incubated for 1 h at 37.degree. C. After 4 washings, the chromogen (TMB) and the substrate (H.sub.2O.sub.2) are added and the plates are incubated for 30 min at room temperature, protected from light. The reaction is then stopped and then the absorbance at 450 nm is measured with the aid of an automated reader.

3) Results

[0475] The ELISA tests (FIG. 10) demonstrate that the recombinant N protein preparation is specifically recognized by the antibodies of sera from patients suffering from SARS collected in the late phase of the infection (.gtoreq.17 days after the onset of the symptoms) whereas it is not significantly recognized by the antibodies of a patient's serum collected in the early phase of the infection (3 days after the onset of the symptoms) or by control sera from subjects not suffering from SARS.

EXAMPLE 7

ELISA Tests Prepared for a Very Specific and Sensitive Detection of a SARS-Associated Coronavirus Infection, from Sera of Patients

1) Indirect ELISA IgG Test

a) Reagents

Preparation of the Plates

[0476] The plates are sensitized with a solution of N protein at 2 .mu.g/ml in a 10 mM PBS buffer, pH 7.2, phenol red at 0.25 ml/l. 100 .mu.l of solution are deposited in the wells and left to incubate at room temperature overnight. Saturation is obtained by prewashing in 10 mM PBS/0.1% Tween buffer, followed by washing with a saturation solution PBS, 25% milk/sucrose.

Diluent Sera

[0477] Buffer 0.48 g/l TRIS, 10 mM PBS, 3.7 g/l EDTA, 15% v/v milk, pH 6.7

Diluent Conjugate

[0478] Citrate buffer (15 g/l), 0.5% Tween, 25% bovine serum, 12% NaCl, 6% v/v skimmed milk pH 6.5

Conjugate

[0479] 50.times. anti-human IgG conjugate, marketed by Bio-Rad: Platelia H. pylori kit ref 72778

Other Solutions:

[0480] Washing solution R2, solutions for visualizing with TMB R8 diluent, R9 chromogen, R10 stopping solution: reagents marketed by Bio-Rad (e.g.: Platelia pylori kit, ref 72778)

b) Procedure

[0481] Dilute the sera 1/200 in the sample diluent

[0482] Distribute 100 .mu.l/well

[0483] Incubation 1 h at 37.degree. C.

[0484] 3 washings in 10.times. WASHING solution R2 diluted before-hand 10-fold in demineralized water (i.e., 1.times. washing solution)

[0485] Distribute 100 .mu.l of conjugate (50.times. conjugate to be diluted immediately before use in the diluent conjugate provided)

[0486] Incubation 1 h at 37.degree. C.

[0487] 4 washings in 1.times. washing solution

[0488] Distribute 200 .mu.l/well of visualization solution (to be diluted immediately before use e.g.: 1 ml of R9 in 10 ml of R8)

[0489] Incubation for 30 min at room temperature in the dark

[0490] Stop the reaction with 100 .mu.l/well of R10

[0491] READING at 450/620 nm

[0492] The results can be interpreted by taking a THRESHOLD serum giving a response above which the sera tested would be considered as positive. This serum is chosen and diluted so as to give a significantly higher signal than the background noise.

2) Double Epitope Elisa Test

a) Reagents

Preparation of the Plates

[0493] The plates are sensitized with a solution of N protein at 1 g/ml in a 10 mM PBS buffer, pH 7.2, phenol red at 0.25 ml/l. 100 .mu.l of solution are deposited in the wells and left to incubate at room temperature overnight. Saturation is obtained by prewashing in 10 mM PBS/0.1% Tween buffer, followed by washing with a saturation solution 10 mM PBS, 25% (V/V) milk.

Diluent Sera and Conjugate

[0494] Buffer 50 mM TRIS saline, pH 8, 2% milk

Conjugate

[0495] This is the purified recombinant N protein coupled with peroxidase according to the Nakane protocol (Nakane P. K. and Kawaoi A.; (1974): Peroxydase-labeled antibody, a new method of conjugation. The Journal of Histochemistry and Cytochemistry Vol. 22, N) 23, pp. 1084-1091), in respective molar ratios 1/2. This ProtN POD conjugate is used at a concentration of 2 .mu.g/ml in serum/conjugate diluent.

Other Solutions:

[0496] Washing solution R2, solutions for visualization with TMB R8, diluent, R9 chromogen, R10 stopping solution: reagents marketed by Bio-Rad (e.g. Platelia pylori kit, ref 72778).

b) Procedure

[0497] 1st step in "predilution" plate [0498] Dilute each serum 1/5 in the predilution plate [0499] (48 .mu.l of diluent+12 .mu.l of serum). [0500] After having diluted all the sera, distribute 60 .mu.l of conjugate. [0501] Where appropriate, the serum+conjugate mix is left to incubate.

[0502] 2nd step in "reaction" plate [0503] Transfer 100 .mu.l of mixture/well into the reaction plate [0504] Incubation 1 h 37.degree. C. [0505] 5 washings in 10.times. WASHING solution R2 diluted 10-fold beforehand in demineralized water (.fwdarw.1.times. washing solution) [0506] Distribute 200 .mu.l/well of visualization solution (to be diluted immediately before use e.g.: 1 ml of R9 in 10 ml of R8) [0507] Incubation 30 min at room temperature and protected from light [0508] Stop the reaction with 100 .mu.l/well of R10 [0509] READING at 450/620 nm

[0510] Likewise as for the indirect ELISA test, the results can be interpreted using a "threshold value" serum. Any serum having a response greater than the threshold value serum will be considered as positive.

2) Results

[0511] The sera of patients classified as probable cases of SARS from the French hospital of Hanoi, Vietnam or in relation with the French hospital of Hanoi (JYK) were analyzed using the indirect IgG-N test and the double epitope N test.

[0512] The results of the indirect IgG-N test (FIGS. 14 and 15) and double epitope N test (FIGS. 16 and 17) show an excellent correlation between them and with an indirect ELISA test comparing the reactivity of the sera toward a lysate of VeroE6 cells infected or not infected with SARS-CoV (ELISA-SARS-CoV lysate; see table V below). All the sera collected 12 days or more after the onset of the symptoms were found to be positive, including in patients for whom it had not been possible to document the SARS-CoV virus infection by analyzing respiratory samples by RT-PCR, probably because of a sample being collected too late during the infection (.gtoreq.D12). In the case of the patient TTH for whom a nasal sample collected on D7 was found to be negative by RT-PCR, the quality of the sample may be in question.

[0513] Some sera were found to be negative whereas the presence of SARS-CoV was detected by RT-PCR. They are in all cases early sera collected less than 10 days after the onset of the symptoms (e.g.: serum # 032637). In the case of a patient PTTH (serum # 032673), only a suspicion of SARS was raised at the time the samples were collected.

[0514] In conclusion, the indirect IgG-N and N-double epitope serological tests make it possible to document the SARS-CoV infection in all the patients for the sera collected 12 days or more after the infection. TABLE-US-00007 TABLE V Results of the ELISA tests ELISA Sample PCR-SARS SARS-CoV IgG-N 2Xepitope Num Patient Day (1) lysate (2) (2nd series) (2nd series) 033168 JYK 38 POS +++ >5000 NT 033597 JYK 74 POS NT .apprxeq.5000 NT 032552 VTT 8 NEG- NEG <200 <5 D3&D8&D12 032544 CTP 16 NEG ++ >5000 >>20 D16&D20 032546 CJF 15 NEG ++ >5000 >>20 D15&D19 032548 PTL 17 NEG ++ >5000 >>20 D17&D21 032550 NTH 17 NEG-D17&D21 ++ >5000 >>20 032553 VTT 8 NEG- NEG <200 <5 D3&D8&D12 032554 NTBV 4 POS NEG <200 <5 032555 NTBV 4 POS NEG <200 032564 NTP 15 POS ++ >5000 >>20 032629 NVH 4 POS NEG <200 <5 032631 BTTX 9 POS NEG <200 <5 032635 NHH 4 POS NEG <200 <5 032637 NHB 10 POS NEG <200 <5 032642 BTTX 9 POS NEG <200 <5 032643 LTDH 1 POS NEG <200 <5 032644 NTBV 4 POS NEG <200 <5 032646 TTH 12 NEG ++ >5000 >>20 D7&D12&D16 032647 DTH 17 NEG ++ >5000 >>20 D17&D21 032648 NNT 15 NEG ++ >5000 >>20 D15&D19 032649 PTH 17 NEG ++ >5000 >>20 D17&D21 032672 LVV 16 NEG + >5000 >>20 D16&D20 032673 PTTH NA NEG NEG <200 <5 032674 PNB 17 NEG ++ >5000 >>20 D17&D21 032682 VTH 12 NEG ++ >5000 >>20 D12&D16 032683 DTV 17 NEG + >1000 >>20 D17&D21

Remarks:

[0515] (1): The RT-PCR analyses were carried out by nested RT-PCR BNI, LC Artus and LC-N on nasal or pharyngeal swabs; POS means that at least one sample was found to be positive in this patient.

[0516] (2): The reactivity of the sera in the ELISA test using a lysate of cells infected with SARS-CoV was classified as very highly reactive (+++), highly reactive (++), reactive (+) and negative according to the OD value obtained at the dilutions tested.

EXAMPLE 8

Detection of SARS-Associated Coronavirus (SARS-CoV) by RT-PCR

1) Real Time Development of RT-PCR Conditions with the Aid of Primers Specific for the Gene for the Nucleocapsid Protein--"Light Cycler N" Test

a) Design of the Primers and Probes

[0517] The primers and probes were designed from the sequence of the genome of the SARS-CoV strain derived from the sample recorded under the number 031589, with the aid of the programme "Light Cycler Probe Design (Roche)". Thus, the following two series of primers and probes were selected: TABLE-US-00008 series 1 (SEQ ID NO: 60, 61, 64, 65): sense primer: N/+/28507: 5'-GGC ATC GTA TGG GTT G-3' [28507-28522] antisense primer: N/-/28774: 5'-CAG TTT CAC CAC CTC C-3' [28774-28759] probe 1: 5'-GGC ACC CGC AAT CCT AAT AAC AAT GC- fluorescein 3' [28561-28586] probe 2: 5' Red705-GCC ACC GTG CTA CAA CTT CCT-phosphate [28588-28608] series 2 (SEQ ID NO: 62, 63, 66, 67) sense primer: N/+/28375: 5'-GGC TAC TAC CGA AGA G-3' [28375-28390] antisense primer: N/-/28702: 5'-AAT TAC CGC GAC TAC G-3' [28702-28687] probe 1: SARS/N/FL: 5'-ATA CAC CCA AAG ACC ACA TTG GC-fluorescein 3' [28541-28563] probe 2: SARS/N/LC705: 5' Red705-CCC GCA ATC CTA ATA ACA ATG CTG C- phosphate 3' [28565-28589]

b) Analysis of the Efficacy of the Two Primer Pairs

[0518] In order to test the respective efficacy of the two pairs of primers, an RT-PCR amplification was carried out on a synthetic RNA corresponding to nucleotides 28054-29430 of the genome of the SARS-CoV strain derived from the sample recorded under the number 031589 and containing the sequence of the N gene.

[0519] More specifically:

[0520] This synthetic RNA was prepared by in vitro transcription with the aid of the T7 phage RNA polymerase, of a DNA template obtained by linearization of the plasmid SRAS-N with the enzyme Bam H1. After eliminating the DNA template by digestion with the aid of DNAse 1, the synthetic RNAs are purified by a phenol-chloroform extraction, followed by two successive precipitations in ammonium acetate and isopropanol. They are then quantified by measuring the absorbance at 260 nm and their quality is checked by the ratio of the absorbances at 260 and 280 nm and by agarose gel electrophoresis. Thus, the concentration of the synthetic RNA preparation used for these studies is 1.6 mg/ml, which corresponds to 2.1.times.10.sup.15 copies/ml of RNA.

[0521] Decreasing quantities of synthetic RNA were amplified by RT-PCR with the aid of the "Superscript.TM. One-Step RT-PCR with Platinum.RTM. Taq" kit and the pairs of primers No. 1 (N/+/28507, N/-/28774) (FIG. 1A) and No. 2 (N/+/28375, N/-/28702) (FIG. 1B), according to the supplier's instructions. The amplification conditions used are the following: the cDNA was synthesized by incubation for 30 min at 45.degree. C., 15 min at 55.degree. C. and then 2 min at 94.degree. C. and it was then amplified by 5 cycles comprising: a step of denaturation at 94.degree. C. for 15 sec, a step of annealing at 45.degree. C. for 30 sec and then a step of extension at 72.degree. C. for 30 sec, followed by 35 cycles comprising: a step of denaturation at 94.degree. C. for 15 sec, a step of annealing at 55.degree. C. for 30 sec and then a step of extension at 72.degree. C. for 30 sec, with 2 sec of additional extension at each cycle, and a final step of extension at 72.degree. C. for 5 min. The amplification products obtained were then kept at 10.degree. C.

[0522] The results presented in FIG. 11 show that the pair of primers No. 2 (N/+/28375, N/-/28702) makes it possible to detect up to 10 copies of RNA (band of weak intensity) or 10.sup.2 copies (band of good intensity) against 10.sup.4 copies for the pair of primers No. 1 (N/+/28507, N/-/28774). The amplicons are respectively 268 bp (pair 1) and 328 bp (pair 2).

c) Development of Real Time RT-PCR

[0523] A real time RT-PCR was developed with the aid of the pair of primers No. 2 and of the pair of probes consisting of SRAS/N/FL and SRAS/N/LC705 (FIG. 2).

[0524] The amplification was carried out on a LightCycler.TM. (Roche) with the aid of the "Light Cycler RNA Amplification Kit Hybridization Probes" kit (reference 2 015 145, Roche) under the following optimized conditions. A reaction mixture containing: H.sub.2O (6.8 .mu.l), 25 mM MgCl.sub.2 (0.8 .mu.l, 4 .mu.M Mg2+ final), 5.times. reaction mixture (4 .mu.l), 3 .mu.m probe SRAS/N/FL (0.5 .mu.l, 0.075 .mu.M final), 3 .mu.M probe SRAS/N/LC705 (0.5 .mu.l, 0.075 .mu.M final), 10 .mu.M primer N/+/28375 (1 .mu.l, 0.5 .mu.M final), 10 .mu.M primer N/-/28702 (1 .mu.l, 0.5 .mu.M final), enzyme mixture (0.4 .mu.l) and sample (viral RNA, 5 .mu.l) was amplified according to the following program: TABLE-US-00009 Reverse transcription: 50.degree. C. 10:00 min analysis mode: none Denaturation: 95.degree. C. 30 sec .times. 1 analysis mode: none Amplification: 95.degree. C. 2 sec 50.degree. C. 15 sec analysis mode: quantification* {close oversize brace} .times.45 72.degree. C. 13 sec thermal ramp 2.0.degree. C./sec Annealing: 40.degree. C. 30 sec .times. 1 analysis mode: none *The fluorescence is measured at the end of the annealing and at each cycle (in SINGLE mode).

[0525] The results presented in FIG. 12 show that this real time RT-PCR is very sensitive since it makes it possible to detect 102 copies of synthetic RNA in 100% of the 5 samples analyzed (29/29 samples in 8 experiments) and up to 10 copies of RNA in 100% of the 5 samples analyzed (40/45 samples in 8 experiments). It also shows that this RT-PCR makes it possible to detect the presence of the SARS-CoV genome in a sample and to quantify the number of genomes present. By way of example, the viral RNA of a SARS-CoV stock cultured on Vero E6 cells was extracted with the aid of the "Qiamp viral RNA extraction" kit (Qiagen), diluted to 0.05.times.10.sup.-14 and analyzed by real time RT-PCR according to the protocol described above; the analysis presented in FIG. 12 shows that this virus stock contains 6.5.times.10.sup.9 genome-equivalents/ml (geq/ml), which is entirely similar to the 1.0.times.10.sup.10 geq/ml value measured with the aid of the "RealArt.TM. HPA-Coronavirus LC RT PCR Reagents" kit marketed by Artus.

2) Development of Nested RT-PCR Conditions Targeting the Gene for RNA Polymerase--"CDC (Centers for Disease Control and Prevention)/IP Nested RT-PCR" Test

a) Extraction of the Viral RNA

[0526] Clinical sample: QIAmp viral RNA Mini Kit (QIAGEN) according to the manufacturer's instructions, or an equivalent technique. The RNA is eluted in a volume of 60 .mu.l.

b) "SNE/SAR" Nested RT-PCR

First Step: "SNE" Coupled RT-PCR

[0527] The Invitrogen "Superscript.TM. One-Step RT-PCR with Platinum.RTM. Taq" kit was used, but the "Titan" kit from Roche Boehringer can be used in its place with similar results. TABLE-US-00010 Oligonucleotides: SNE-S1 5' GGT TGG GAT TAT CCA AAA TGT GA 3' SNE-AS1 5' GCA TCA TCA GAA AGA ATC ATC ATG 3' .fwdarw. Expected size: 440 bp

[0528] 1. Prepare a mix: TABLE-US-00011 H2O 6.5 .mu.l Reaction mix 2X 12.5 .mu.l Oligo SNE-S1 50 .mu.M 0.2 .mu.l Oligo SNE-AS1 50 .mu.M 0.2 .mu.l RNAsin 40 U/.mu.l 0.12 .mu.l RT/Platinum Taq mix 0.5 .mu.l

[0529] 2. To 20 .mu.l of the mix, add 5 .mu.l of RNA and carry out the amplification on a thermocycler (ABI 9600 conditions): TABLE-US-00012 2.1 45.degree. C. 30 min. 55.degree. C. 15 min. 94.degree. C. 2 min. 2.2. 94.degree. C. 15 sec. 45.degree. C. 30 sec. {close oversize brace} .times.5 cycles 72.degree. C. 30 sec. 2.3. 94.degree. C. 15 sec. 55.degree. C. 30 sec. {close oversize brace} .times.35 cycles 72.degree. C. 30 sec. + 2 sec./cycle 2.4. 72.degree. C. 5 min. 2.5 10.degree. C. .infin. Storage at +4.degree. C..

[0530] The RNAsin (N2511/N2515) from Promega was used as RNase inhibitors.

[0531] Synthetic RNAs served as positive control. As the control, 10.sup.3, 10.sup.2 and 10 copies of synthetic RNA R.sub.SNE were amplified in each experiment.

[0532] Second Step: "SAR" Nested PCR TABLE-US-00013 Oligonucleotides: SAR1-S 5' CCT CTC TTG TTC TTG CTC GCA 3' SAR1-AS 5' TAT AGT GAG CCG CCA CAC ATG 3' .fwdarw. Expected size: 121 bp

[0533] 1. Prepare a mix: TABLE-US-00014 H2O 35.8 .mu.l Taq buffer 10X 5 .mu.l MgCl.sub.2 25 mM 4 .mu.l Mix dNTPs 5 mM 2 .mu.l Oligo SAR1-S 50 .mu.M 0.5 .mu.l Oligo SAR1-AS 50 .mu.M 0.5 .mu.l Taq DNA pol 5 U/.mu.l 0.25 .mu.l

[0534] AmpliTaq DNA Pol from Applied Biosystems was used (10.times. buffer without MgCl.sub.2, ref 27216601).

[0535] 2. To 48 .mu.l of the mix, add 2 .mu.l of the product from the first PCR and carry out the amplification (ABI 9600 conditions): TABLE-US-00015 2.1. 94.degree. C. 2 min. 2.2. 94.degree. C. 30 sec. 45.degree. C. 45 sec. {close oversize brace} .times.5 cycles 72.degree. C. 30 sec. 2.3. 94.degree. C. 30 sec. 55.degree. C. 30 sec. {close oversize brace} .times.35 cycles 72.degree. C. 30 sec. + 1 sec./cycle 2.4. 72.degree. C. 5 min. 2.5 10.degree. C. .infin.

[0536] 3. Analyze 10 .mu.l of the reaction product on "low-melting" gel (Seakem GTG type) containing 3% agarose.

[0537] The sensitivity of the nested test is routinely, under the conditions described, 10 copies of RNA.

[0538] 4. The fragments can then be purified on QIAquick PCR kit (QIAGEN) and sequenced with the oligos SAR1-S and SAR1-AS.

3) Detection of the SARS-CoV RNA by PCR from Respiratory Samples

a) First Comparative Study

[0539] A comparative study was carried out on a series of respiratory samples received by the National Reference Center for the Influenza Virus (Northern region) and likely to contain SARS-CoV. To do this, the RNA was extracted from the samples with the aid of the "Qiamp viral RNA extraction" kit (Qiagen) and analyzed by real time RT-PCR, on the one hand with the aid of the pairs of primers and probes of the No. 2 series under the conditions described above on the one hand, and on the other hand with the aid of the kit "LightCycler SARS-CoV quantification kit" marketed by Roche (reference 03 604 438). The results are summarized in table VI below. They show that 18 of the 26 samples are negative and 5 of the 26 samples are positive for the two kits, while one sample is positive for the Roche kit alone and two for the "series 2" N reagents alone., Additionally, for 3 samples (20032701, 20032712, 20032714) the quantities of RNA detected are markedly higher with the reagents (probes and primers) of the No. 2 series. These results indicate that the "series 2" N primers and probes are more sensitive for the detection of the SARS-CoV genome in biological samples than those of the kit currently available. TABLE-US-00016 TABLE VI Real time RT-PCR analysis of the RNAs extracted from a series of samples from 5 patients with the aid of the pairs of primers and probes of the No. 2 series ("series 2" N) or of the kit "Lightcycler SARS- CoV quantification kit" (Roche). The type of sample is indicated as well as the number of copies of viral genome measured in each of the two tests. NEG: negative RT-PCR. ROCHE Sample No. Patient Type of sample KIT "Series 2" N 20033082 K nasal NEG NEG 20033083 K pharyngeal NEG NEG 20033086 K nasal NEG NEG 20033087 K pharyngeal NEG NEG 20032802 M nasal NEG NEG 20032803 M expectoration NEG NEG 20032806 M nasal or pharyngeal NEG NEG 20031746ARN2 C pharyngeal NEG NEG 20032711 C nasal or pharyngeal 39 NEG 20032910 B nasal NEG NEG 20032911 B pharyngeal NEG NEG 20033356 V expectoration NEG NEG 20033357 V expectoration NEG NEG 20031725 K endotracheal asp. NEG 150 20032657 K endotracheal asp. NEG NEG 20032698 K endotracheal asp. NEG NEG 20032720 K endotracheal asp. 3 5 20033074 K stools 115 257 20032701 M pharyngeal 443 1676 20032702 M expectoration NEG 249 20031747ARN2 C pharyngeal NEG NEG 20032712 C unknown 634 6914 20032714 C pharyngeal 17 223 20032800 B nasal NEG NEG 20033353 V nasal NEG NEG 20033384 V nasal NEG NEG

b) Second Comparative Study

[0540] The performance of various nested RT-PCR and real time RT-PCR methods were then compared for 121 respiratory samples from possible cases of SARS at the French hospital in Hanoi, Vietnam, taken between the 4th and the 17th day after the onset of the symptoms. Among these samples, 14 were found to be positive during a first test using the nested RT-PCR method targeting ORF1b (encoding replicase) as described initially by Bernhard Nocht Institute (BNI nested RT-PCR). Information relating to this test is available on the internet, at the address http://www15.bni-hamburg.de/bni2/neu2/getfile.acgi?area_eng1=diagnostics&- pid=4112.

[0541] The various tests compared in this study are: [0542] the quantitative RT-PCR method according to the invention, with the "series 2" N primers and probes described above (LightCycler N column), [0543] the nested RT-PCR test targeting the RNA polymerase gene described above, developed by the CDC, BNI and Institut Pasteur (CDC/IP nested RT-PCR), [0544] the ARTUS kit with the reference "HPA Corona LC RT-PCR Kit # 5601-02", which is a real time RT-PCR test targeting the ORF1b gene, [0545] the BNI nested RT-PCR test, also targeting the RNA polymerase gene mentioned above.

[0546] The inventors observed:

[0547] 1) an inter-test variability for the same technique, linked to the degradation of the RNA preparation during repeated thawing, in particular for the samples containing the lowest quantities of RNA,

[0548] 2) a reduced sensitivity of the CDC/IP nested RT-PCR compared with the BNI nested RT-PCR, and

[0549] 3) a comparable sensitivity of the quantitative RT-PCR test according to the invention (LightCycler N) compared with the Artus LightCycler (LC) test.

[0550] These results, which are presented in table VII below, show that the quantitative RT-PCR test according to the invention constitutes an excellent addition--or an alternative--to the tests currently available. Indeed, the SARS-linked coronavirus is an emergent virus which is capable of changing rapidly. In particular, the gene for the RNA polymerase of the SARS-linked coronavirus, which is targeted in most of the tests currently available, can recombine with that of other coronaviruses not linked to SARS. The use of a test targeting this gene exclusively could then lead to the production of false-negatives.

[0551] The quantitative RT-PCR test according to the invention does not target the same genomic region as the ARTUS kit since it targets the gene encoding the N protein. By carrying out a diagnostic test targeting two different genes of the SARS-linked coronavirus, it can therefore be hoped to avoid false-negative type results which could be due to the genetic evolution of the virus.

[0552] Furthermore, it appears particularly advantageous to target the gene for the nucleocapsid protein because it is very stable because of the high selection pressure linked to the high structural constraints regarding this protein. TABLE-US-00017 TABLE VII Comparison of various methods of analysis by gene amplification, from 121 samples of probable cases of SARS at the French hospital in Hanoi, Vietnam (epidemic 2003) Artus Sample Sample CDC/IP BNI Light Light type collection nested nested Cycler Cycler NRC No. (1) day Patient RT-PCR RT-PCR kit N (IP) 107 N and P Negative Negative Negative Negative samples 032529 P 10 NHB Negative Positive Negative Negative 032530 N 10 NHB Positive Positive 3.10E+01 4.20E+01 032531 P 7 LP Positive Positive 7.70E+00 3.10E+00 032534 N 15 BND Positive Positive 1.60E+00 Negative 032600 P 4 NHH Negative Positive Negative 0.30E+02 032612 P 17 NTS Negative Positive Negative Negative 032688 P 9 BTX Positive Positive Negative Negative 032689 N 4 NVH Positive Positive 1.20E+01 2.30E+02 032690 P 4 NVH Negative Positive 1.60E+00 Negative 032727 P 8 NVH Positive Positive 2.30E+02 4.00E+02 032728 N 8 NVH Positive Positive 1.10E+03 1.60E+04 032729 P 14 NHB Positive Positive 5.90E+00 3.40E+01 032730 N 14 NHB Positive Positive 1.30E+02 4.80E+02 032741 P 8 NHH Positive Positive 2.10E+02 1.30E+02 positives 10 14 10 9 fraction detected from the 14 positives 71.4% 100.0% 71.4% 64.3% (1) P = pharyngeal swab N = nasal swab

EXAMPLE 9

Production and Characterization of Monoclonol Antibodies Directed Against the N Protein

[0553] Balb C mice were immunized with the purified recombinant N protein and their spleen cells fused with an appropriate murine myeloma according to the Kohler and Milstein techniques.

[0554] Nineteen anti-N antibody secreting hybridomas were preselected and their immunoreactivities determined. These antibodies do indeed recognize the recombinant N protein (in ELISA) with variable intensities, and the natural viral N protein in ELISA and/or in Western blotting. FIGS. 18 to 20 show the results of these tests for 15 of these 19 monoclonal antibodies.

[0555] The highly reactive clones 12, 17, 28, 57, 72, 76, 86, 87, 98, 103, 146, 156, 166, 170, 199, 212, 218, 219 and 222 were subcloned. Specificity studies were carried out with the appropriate tools in order to determine the epitopes recognized and verify the absence of reactivity toward other human coronaviruses and certain respiratory viruses.

[0556] Epitope mapping studies (performed on spot membrane with the aid of overlapping peptides of 15 aa) and additional studies performed on the natural N protein in Western blotting revealed the existence of 4 groups of monoclonal antibodies:

[0557] 1. Monoclonal antibodies specific for a major linear epitope at the N-ter position (75-81, sequence: INTNSVP).

[0558] The representative of this group is antibody 156. The hybridoma producing this antibody was deposited at the Collection Nationale de Cultures de Microorganismes (CNCM) of the Institut Pasteur (Paris, France) on Dec. 1, 2004, under the number I-3331. This same epitope is also recognized by a rabbit serum (anti-N polyclonal) obtained by conventional immunization with the aid of this same N protein.

[0559] 2. Monoclonal antibodies specific for a major linear epitope located in a central position (position 217-224, sequence: ETALALL); the representatives of this group are the monoclonal antibodies 87 and 166. The hybridoma producing antibody 87 was deposited at the CNCM on Dec. 1, 2004, under the number I-3328.

[0560] 3. Monoclonal antibodies specific for a major linear epitope located at the C-terminal position (position 403-408, sequence: DFFRQL), the representatives of this group are the antibodies 28, 57 and 143. The hybridoma producing antibody 57 was deposited at the CNCM on Dec. 1, 2004, under the number I-3330.

[0561] 4. Monoclonal antibodies specific for a discontinuous conformational epitope. This group of antibodies does not recognize any of the peptides spanning the sequence of the N protein, but react strongly on the non-denatured natural protein. The representative of this final group is the antibody 86. The hybridoma producing this antibody was deposited at the CNCM on Dec. 1, 2004, under the number I-3329.

[0562] Table VIII below summarizes the epitope mapping results obtained: TABLE-US-00018 TABLE VIII Epitope mapping of the monoclonal antibodies Antibody Epitope Position Region 28 DFSRQL Q 403 . . . 408 C-Ter. 143 DFSRQL Q 76 DFSRQL Q 57 DFSRQL Q 315 . . . 319 146 LPQRQ 383 . . . 387 166 ETALALLLL 217 . . . 224 central 87 ETALALL 217 . . . 224 156 75 . . . 81 N-Ter. 86 Conformational 212 Conformational 170 Conformational

[0563] In addition, as illustrated in particular in FIGS. 18 and 19, these antibodies exhibit no reactivity in ELISA and/or in WB toward the N protein of the human corona-virus 229 E.

EXAMPLE 10

Combinations of the Monoclonal Antibodies for the Development of a Sensitive Immunocapture Test Specific for the Viral N Antigen in the Serum or Biological Fluids of Patients Infected with the SARS-CoV Virus

[0564] The antibodies listed below were selected because of their very specific properties for an additional capture and detection study of the viral N protein, in the serum of the subjects or patients.

[0565] These antibodies were produced in ascites on mice, purified by affinity chromatography and used alone or in combination, as capture antibodies and as signal antibodies.

[0566] List of the antibodies selected: [0567] Ab anti-C-ter region (No. 28, 57, 143) [0568] Ab anti-central region (No. 87, 166) [0569] Ab anti-N-ter region (No. 156) [0570] Ab anti-discontinuous conformational epitope (86) 1) Preparation of the Reagents: a) Immunocapture ELISA Plates

[0571] The plates are sensitized with the antibody solutions at 5 .mu.g/ml in 0.1 M carbonate buffer, pH 9.6. The (monovalent or plurivalent) solutions are deposited in a volume of 100 .mu.l in the wells and incubated overnight at room temperature. These plates are then washed with PBS buffer (10 mM pH 7.4 supplemented with 0.1% Tween 20) and then saturated with a PBS solution supplemented with 0.3% BSA and 5% sucrose). The plates are then dried and then packaged in a bag in the presence of a desiccant. They are ready to use.

b) Conjugates

[0572] The purified antibodies were coupled with peroxidase according to the Nakane protocol (Nakane et al.--1974, J. of Histo and cytochemistry, vol. 22, pp. 1084-1091) in a ratio of one molecule of IgG per 3 molecules of peroxidase. These conjugates were purified by exclusion chromatography and stored concentrated (concentration between 1 and 2 mg/ml) in the presence of 50% glycerol and at -20.degree. C. They are diluted for their use in the assays at the final concentration of 1 or 2 .mu.g/ml in PBS buffer (pH 7.4) supplemented with 1% BSA.

c) Other Reagents

[0573] Human sera negative for all the serum markers for the HIV, HBV, HCV and THLV viruses Pool of negative human sera supplemented with 0.5% Triton X 100 [0574] Inactivated viral Ag: viral culture supernatant inactivated by irradiation and inactivation verified after placing in culture on sensitive cells--titer of the suspension before inactivation about 10.sup.7 infectious particles per ml or alternatively about 5.times.10.sup.9 physical viral particles per ml of antigen [0575] The Ag samples diluted in negative human serum: these samples were prepared by diluting 1:100 and then by 5-fold serial dilution. [0576] These noninfectious samples mimic human samples thought to contain low to very low concentrations of viral nucleoprotein N. Such samples are not available for routine work. [0577] Washing solution R2, solution for visualization TMB R8, chromogen R9 and stop solution R10, are the generic reagents marketed by Bio-Rad in its ELISA kits (e.g.: Platelia pylori kit ref. 72778). 2) Procedure

[0578] The samples of human sera overloaded with inactivated viral Ag are distributed in an amount of 100 .mu.l per well, directly in the ready-to-use sensitized plates, and then incubated for 1 hour at 37.degree. C. (Bio-Rad IPS incubation).

[0579] The material not bound to the solid phase is removed by 3 washings (washing with dilute R2 solution, automatic LP 35 washer).

[0580] The appropriate conjugates, diluted to the final concentration of 1 or 2 .mu.g/ml, are distributed in an amount of 100 .mu.l per well and the plates are again incubated for one hour at 37.degree. C. (IPS incubation).

[0581] The excess conjugate is removed by 4 successive washings (dilute R2 solution--LP 35 washer).

[0582] The presence of conjugate attached to the plates is visualized after adding 100 .mu.l of visualization solution prepared before use (1 ml of R9 and 10 ml of R8) and after incubation for 30 minutes, at room temperature and protected from light.

[0583] The enzymatic reaction is finally blocked by adding 100 .mu.l of R10 reagent (1 N H.sub.2SO.sub.4) to all the wells.

[0584] The reading is carried out with the aid of an appropriate microplate reader at double wavelength (450/620 nm).

[0585] The results can be interpreted by using, as provisional threshold value, the mean of at least two negative controls multiplied by a factor of 2 or alternatively the mean of 100 negative sera supplemented with an increment corresponding to 6 SD (standard deviation calculated on the 100 individual measurements).

3) Results

[0586] Various capture antibody and signal antibody combinations were tested based on the properties of the antibodies selected, and avoiding the combinations of antibodies specific for the same epitopes in solid phase and as conjugates.

[0587] The best results were obtained with the 4 combinations listed below. These results are reproduced in table IX below.

1. Combination F/28

[0588] Solid phase (Ab 166+87 central region): conjugate antibody 28 (C-ter)

2. Combination G/28

[0589] Solid phase (Ab 86--conformational epitope): conjugate antibody 28 (C-ter)

3. Combination H/28

[0590] Solid phase (Ab 86, 166 and 87 central region and conformational epitope): conjugate antibody 28 (C-ter)

4. Combination H/28+87

[0591] Solid phase (Ab 86, 166 and 87 central region and conformational epitope): mixed conjugate antibodies 28 (C-ter) and 87 (central)

5. Combination G/87

[0592] Solid phase (Ab 86--conformational epitope): conjugate antibody 87 (central region)

[0593] The first 4 combinations exhibit equivalent and reproduced performance levels, greater than the other combinations used (such as for example the combination G/87). Of course, in these combinations, a monoclonal antibody may be replaced with another antibody recognizing the same epitope. Thus, the following variants may be mentioned:

6. Variant of the Combination F/28

[0594] Solid phase (Ab 87 only): conjugate antibody 57 (C-ter)

7. Variant of the Combination G/28

[0595] Solid phase (Ab 86--conformational epitope): conjugate antibody 57 (C-ter)

8. Variant of the Combination H/28

[0596] Solid phase (Ab 86 and 87 central region and conformational epitope): conjugate antibody 57 (C-ter)

9. Variant of the Combination H/28+87

[0597] Solid phase (Ab 86 and 87 central region and conformational epitope): mixed conjugate antibodies 57 (C-ter) and 87 (central) TABLE-US-00019 TABLE IX Test of immunoreactivity of the anti-SARS-CoV nucleoprotein Abs: optical densities measured with each combination of antibodies according to the dilutions of the inactivated viral antigen. No. Dilution F/28 G/28 G/87 H/28 H/28 + 87 0 1/100 5 5 3.495 3.900 5 1 1/500 3.795 3.814 1.379 3.702 3.804 2 1/2 500 2.815 2.950 0.275 3.268 2.680 3 1/12 500 0.987 1.038 0.135 1.374 0.865 4 1/62 500 0.404 0.348 0.125 0.480 0.328 5 1/312 500 0.285 0.211 0.123 0.240 0.215 6 Control 0.210 0.200 0.098 0.186 0.156 7 Control 0.269 0.153 0.104 0.193 0.202

[0598] The detection limit for these 4 experimental trials corresponds to the antigen dilution in negative serum 1:62 500. A rapid extrapolation suggests the detection of less than 10.sup.3 infectious particles per ml of sera.

[0599] From this study, it is evident that the most appropriate antibodies for the capture of the native viral nucleoprotein are the antibodies specific for the central region and/or for a conformational epitope, both being antibodies also selected for their high affinity for the native antigen.

[0600] Having determined the best antibodies for the composition of the solid phase, the antibodies to be selected as a priority for the detection of the antigens attached to the solid phase are the complementary antibodies specific for a dominant epitope in the C-ter region. The use of any other complementary antibody specific for epitopes located in the N-ter region of the protein leads to average or poor results.

EXAMPLE 11

Eukaryotic Expression Systems for the SARS-Associated Coronavirus (SARS-CoV) spicule (S) Protein

1) Optimization of the Conditions for Expression of the SARS-CoV S in Mammalian Cells

[0601] The conditions for transient expression of the SARS-CoV spicule (S) protein were optimized in mammalian cells (293T, VeroE6).

[0602] For that, a DNA fragment containing the cDNA for SARS-CoV S was amplified by PCR with the aid of the oligo-nucleotides 5'-ATAGGATCCA CCATGTTTAT TTTCTTATTA TTTCTTACTC TCACT-3' and 5'-ATACTCGAGTT ATGTGTAATG TAATTTGACA CCCTTG-3' from the plasmid pSARS-S(C.N.C.M. No. I-3059) and then inserted between the BamHI and Xho1 sites of the plasmid pTRIP.DELTA.U3-CMV containing a lentiviral vector TRIP (Sirven, 2001, Mol. Ther., 3, 438-448) in order to obtain the plasmid pTRIP-S. The BamH1 and Xho1 fragment containing the cDNA for S was then subcloned between BamH1 and Xho1 of the eukaryotic expression plasmid pcDNA3.1(+) (Clontech) in order to obtain the plasmid pcDNA-S. The Nhe1 and Xho1 fragment containing the cDNA for S was then subcloned between the corresponding sites of the expression plasmid pCI (Promega) in order to obtain the plasmid pCI-S. The WPRE sequences of the woodchuck hepatitis virus ("Woodchuck Hepatitis Virus posttranscriptional regulatory element") and the CTE sequences ("constitutive transport element") of the simian retro-virus from Mason-Pfizer were inserted into each of the two plasmids pcDNA-S and pCI-S between the Xho1 and Xba1 sites in order to obtain respectively the plasmids pcDNA-S-CTE, pcDNA-S-WPRE, pCI-S-CTE and pCI-S-WPRE (FIG. 21). The plasmid pCI-S-WPRE was deposited at the CNCM, on Nov. 22, 2004, under the number I-3323. All the inserts were sequenced with the aid of a BigDye Terminator v1.1 kit (Applied Biosystems) and an automated sequencer ABI377.

[0603] The capacity of the plasmid constructs to direct the expression of SARS-CoV S in mammalian cells was assessed after transfection of VeroE6 cells (FIG. 22). In this experiment, monolayers of 5.times.10.sup.5 VeroE6 cells in 35 mm Petri dishes were transfected with 2 .mu.g of plasmids pcDNA (as control), pcDNA-S, pCI and pCI-S and 6 .mu.l of Fugene6 reagent according to the manufacturer's instructions (Roche). After 48 hours of incubation at 37.degree. C. and under 5% CO.sub.2, cellular extracts were prepared in loading buffer according to Laemmli, separated on 8% SDS polyacrylamide gel, and then transferred onto a PVDF membrane (BioRad). The detection of this immunoblot (Western blot) was carried out with the aid of an anti-S rabbit polyclonal serum (immune serum from the rabbit P11135: cf. example 4 above) and donkey polyclonal antibodies directed against rabbit IgGs and coupled with peroxidase (NA934V, Amersham). The bound antibodies were visualized by luminescence with the aid of the ECL+ kit (Amersham) and autoradiography films Hyperfilm MP (Amersham).

[0604] This experiment (FIG. 22) shows that the plasmid pcDNA-S does not make it possible to direct the expression of SARS-CoV S at detectable levels whereas the plasmid pCI-S allows a weak expression, close to the limit of detection, which may be detected when the film is overexposed. Similar results were obtained when the expression of S was sought by immunofluorescence (data not shown). This impossibility to detect effective expression of S cannot be attributed to the detection techniques used since the S protein can be detected at the expected size (180 kDa) in an extract of cells infected with SARS-CoV or in an extract of VeroE6 cells infected with the recombinant vaccinia virus VV-TF7.3 and transfected with the plasmid pcDNA-S. In this latter experiment, the virus VV-TF7.3 expresses the RNA polymerase of the T7 phage and allows the cytoplasmic transcription of an uncapped RNA capable of being efficiently translated. This experiment suggests that the expression defects described above are due to an intrinsic inability of the cDNA for S to be efficiently expressed when the step for transcription to messenger RNA is carried out at the nuclear level.

[0605] In a second experiment, the effect of the CTE and WPRE signals on the expression of S was assessed after transfection of VeroE6 (FIG. 23A) and 293T (FIG. 23B) cells and according to a protocol similar to that described above. Whereas the expression of S cannot be detected after transfection of the plasmids pcDNA-S-CTE and pcDNA-S-WPRE derived from pcDNA-S, the insertion of the WPRE and CTE signals greatly improves the expression of S in the context of the expression plasmid pCI-S.

[0606] To specify this result, a second series of experiments were carried out where the immunoblot is quantitatively visualized by luminescence and acquisition on a digital imaging device (Fluor S, BioRad). The analysis of the results obtained with the QuantityOne v4.2.3 software (BioRad) shows that the WPRE and CTE sequences increase respectively the expression of S by a factor of 20 to 42 and 10 to 26 in Vero E6 cells (table X). In 293T cells (table X), the effect of the CTE sequence is more moderate (4 to 5 times) whereas that of the WPRE sequence remains high (13 to 28 times). TABLE-US-00020 TABLE X Quantitative analysis of the effect of the CTE and WPRE signals on the expression of SARS-CoV S: Cellular extracts were prepared 48 hours after transfection of VeroE6 or 293T cells with the plasmid pCI, pCI-S, pCI-S-CTE and pCI-S-WPRE and analyzed by Western blotting as described in the legend to FIG. 22. The Western blot is visualized by luminescence (ECL+, Amersham) and acquisition on a digital imaging device (FluorS, BioRad). The expression levels are indicated according to an arbitrary scale where the value of 1 represents the level measured after transfection of the plasmid pCI-S. Two independent experiments were carried out for each of the two cell types. In experiment 1 on VeroE6 cells, the transfections were carried out in duplicate and the results are indicated in the form of the mean and standard deviation values for the expression levels measured. Plasmid cell exp. 1 exp. 2 PCI VeroE6 0.0 0.0 pCI-S VeroE6 1.0 .+-. 0.1 1.0 pCI-S-CTE VeroE6 9.8 .+-. 0.9 26.4 pCI-S-WPRE VeroE6 20.1 .+-. 2.0 42.3 PCI 293T 0.0 0.0 PCI-S 293T 1.0 1.0 PCI-S-CTE 293T 4.6 4.0 PCI-S-WPRE 293T 27.6 12.8

[0607] In summary, all these results show that the expression, in mammalian cells, of the cDNA for the SARS-CoV S under the control of the RNA polymerase II promoter sequences requires, to be efficient, the expression of a splice signal and of either of the sequences WPRE and CTE.

2) Production of Stable Lines Allowing the Expression of SARS-CoV S

[0608] The cDNA for the SARS-CoV S protein was cloned in the form of a BamH1-Xho1 fragment into the plasmid pTRIP.DELTA.U3-CMV containing a defective lentiviral vector TRIP with central DNA flap (Sirven et al., 2001, Mol. Ther., 3: 438-448) in order to obtain the plasmid pTRIP-S (FIG. 24). Transient cotransfection according to Zennou et al. (2000, Cell, 101: 173-185) of this plasmid, of an encapsidation plasmid (p8.2) and of a plasmid for expression of the VSV envelope glycoprotein G (pHCMV-G) in 293T cells allowed the preparation of retroviral pseudoparticles containing the vector TRIP-S and pseudotyped with the envelope protein G. These pseudotyped TRIP-S vectors were used to translate 293T and FRhK-4 cells: no expression of the S protein could be detected by Western blotting and immunofluorescence in the transduced cells (data not presented).

[0609] The optimum expression cassettes consisting of the CMV virus immediate/early promoter, a splice signal, cDNA for S and either of the posttranscriptional signals WPRE or CTE described above were then substituted for the EF1.alpha.-EGFP cassette of the defective lentiviral expression vector with central DNA flap TRIP.DELTA.U3-EF1.alpha. (Sirven et al., 2001, Mol. Ther., 3: 438-448) (FIG. 25). These substitutions were carried out by a series of successive subclonings of the S expression cassettes which were excised from the plasmids pCT-S-CTE (BglII-Apa1) or respectively pCI-S-WPRE (BglII-Sal1) and then inserted between the Mlu1 and Kpn1 sites or respectively Mlu1 or Xho1 sites of the plasmid TRIP.DELTA.U3-EF1.alpha. in order to obtain the plasmids pTRIP-SD/SA-S-CTE and pTRIP-SD/SA-S-WPRE, deposited at the CNCM, on Dec. 1, 2004, under the numbers I-3336 and I-3334, respectively. Pseudotyped vectors were produced according to Zennou et al. (2000, Cell, 101: 173-185) and used to transduce 293T cells (10 000 cells) and FRhK-4 cells (15 000 cells) according to a series of 5 successive transduction cycles with a quantity of vectors corresponding to 25 ng (TRIP-SD/SA-S-CTE) or 22 ng TRIP-SD/SA-S-WPRE) of p24 per cycle.

[0610] The transduced cells were cloned by limiting dilution and a series of clones were qualitatively analyzed for the expression of SARS-CoV S by immunofluorescence (data not shown), and then quantitatively by Western blotting (FIG. 25) with the aid of an anti-S rabbit polyclonal serum. The results presented in FIG. 25 show that clones 2 and 15 of FrhK4-s-CTE cells transduced with TRIP-SD/SA-S-CTE and clones 4, 9 and 12 of FRhK4-S-WPRE cells transduced with TRIP-SD/SA-S-WPRE allow the expression of the SARS-CoV S at respectively low or moderate levels if they are compared to those which can be observed during infection with SARS-CoV.

[0611] In summary, the vectors TRIP-SD/SA-S-CTE and TRIP-SD/SA-S-WPRE allow the production of stable clones of FRhK-4 cells and similarly 293T cells expressing SARS-CoV S, whereas the assays carried out with the "parent" vector TRIP-S remained unsuccessful, which demonstrates the need for a splice signal and for either of the sequences CTE and WPRE for the production of stable cell clones expressing the S protein.

[0612] In addition, these modifications of the vector TRIP (insertion of a splice signal and of a post-transcriptional signal like CTE and WPRE) could prove advantageous for improving the expression of other cDNAs than that for S.

[0613] 3) Production of stable lines allowing the expression of a soluble form of SARS-CoV S. Purification of this recombinant antigen.

[0614] A cDNA encoding a soluble form of the S protein (Ssol) was obtained by fusing the sequences encoding the ecto-domain of the protein (amino acids 1 to 1193) with those of a tag (FLAG:DYKDDDDK) via a BspE1 linker encoding the SG dipeptide. Practically, in order to obtain the plasmid pcDNA-Ssol, a DNA fragment encoding the ectodomain of SARS-CoV S was amplified by PCR with the aid of the oligonucleotides 5'-ATAGGATCCA CCATGTTTAT TTTCTTATTA TTTCTTACTC TCACT-3' and 5'-ACCTCCGGAT TTAATATATT GCTCATATTT TCCCAA-3' from the plasmid pcDNA-S, and then inserted between the unique BamH1 and BspE1 sites of a modified eukaryotic expression plasmid pcDNA3.1(+) (Clontech) containing the tag sequence FLAG between its BamH1 and Xho1 sites: TABLE-US-00021 // GGATCC ...nnn... TCC GGA GAT TAT AAA GAT GAC BamH1 S G D Y K D D GAC GAT AAA TAA CTCGAG // D D K ter Xhol

[0615] The Nhe1-Xho1 and BamH1-Xho1 fragments, containing the cDNA for S, were then excised from the plasmid pcDNA-Ssol, and subcloned between the corresponding sites of the plasmid pTRIP-SD/SA-S-CTE and of the plasmid pTRIP-SD-SA-S-WPRE, respectively, in order to obtain the plasmids pTRIP-SD/SA-Ssol-CTE and pTRIP-SD/SA-Ssol-WPRE, deposited at the CNCM, on Dec. 1, 2004, under the numbers I-3337 and I-3335, respectively.

[0616] Pseudotyped vectors were produced according to Zennou et al. (2000, Cell, 101:173-185) and used to transduce FRhK-4 cells (15 000 cells) according to a series of 5 successive transduction cycles (15 000 cells) with a quantity of vector corresponding to 24 ng (TRIP-SD/SA-Ssol-CTE) or 40 ng (TRIP-SD/SA-Ssol-WPRE) of p24 per cycle. The transduced cells were cloned by limiting dilution and a series of 16 clones transduced with TRIP-SD/SA-Ssol-CTE and of 15 clones with TRIP-SD/SA-Ssol-WPRE were analyzed for the expression of the Ssol polypeptide by Western blotting visualized with an anti-FLAG monoclonal antibody (FIG. 26 and data not presented), and by capture ELISA specific for the Ssol polypeptide which was developed for this purpose (table XI and data not presented). Part of the process for selecting the best secretory clones is shown in FIG. 26. Capture ELISA is based on the use of solid phases coated with polyclonal antibodies of rabbits immunized with purified and inactivated SARS-CoV. These solid phases allow the capture of the Ssol polypeptide secreted into the cellular supernatants, whose presence is then visualized with a series of steps successively involving the attachment of an anti-FLAG monoclonal antibody (M2, SIGMA), of anti-mouse IgG(H+L) biotinylated rabbit polyclonal antibodies (Jackson) and of a streptavidin-peroxidase conjugate (Amersham) and then the addition of chromogen and substrate (TMB+H.sub.2O.sub.2, KPL). TABLE-US-00022 TABLE XI Analysis of the expression of the Ssol polypeptide by cell lines transduced with the lentiviral vectors TRIP-SD/SA-Ssol-WPRE and TRIP-SD/SA- Ssol-CTE. The secretion of the Ssol polypeptide was assessed in the supernatant of a series of cell clones isolated after transduction of FRhK-4 cells with the lentiviral vectors TRIP-SD/SA-Ssol-WPRE and TRIP-SD/SA- Ssol-CTE. The supernatants diluted 1/50 were analyzed by a capture ELISA test specific for SARS-CoV S. Vector Clone OD (450 nm) Control -- 0.031 TRIP-SD/SA-Ssol- CTE2 0.547 CTE CTE3 0.668 CTE9 0.171 CTE12 0.208 CTE13 0.133 TRIP-SD/SA-Ssol- WPRE1 0.061 WPRE WPRE10 0.134

[0617] The cell line secreting the highest quantities of Ssol polypeptide in the culture supernatant is the FRhK4-Ssol-CTE3 line. It was subjected to a second series of 5 cycles of transduction with the vector TRIP-SD/SA-Ssol-CTE under conditions similar to those described above and then cloned. The subclone secreting the highest quantities of Ssol was selected by a combination of Western blot and capture ELISA analysis: it is the subclone FRhK4-Ssol-30, which was deposited at the CNCM, on Nov. 22, 2004, under the name I-3325.

[0618] The FRhK4-Ssol-30 line allows the quantitative production and purification of the recombinant Ssol polypeptide. In a typical experiment where the experimental conditions for growth, production and purification were optimized, the cells of the FRhK4-Ssol-30 line are inoculated in standard culture medium (pyruvate-free DMEM containing 4.5 g/l of glucose and supplemented with 5% FCS, 100 U/ml of penicillin and 100 .mu.g/ml of streptomycin) in the form of a subconfluent monolayer (1 million cells per each 100 cm.sup.2 in 20 ml of medium). At confluence, the standard medium is replaced with the secretion medium where the quantity of FCS is reduced to 0.5% and the quantity of medium reduced to 16 ml per each 100 cm.sup.2. The culture supernatant is removed after 4 to 5 days of incubation at 35.degree. C. and under 5% CO.sub.2. The recombinant polypeptide Ssol is purified from the supernatant by the succession of steps of filtration on 0.1 .mu.m polyethersulfone (PES) membrane, concentration by ultrafiltration on a PES membrane with a 50 kD cut-off, affinity chromatography on anti-FLAG matrix with elution with a solution of FLAG peptide (DYKDDDDK) at 100 .mu.g/ml in TBS (50 mM tris, pH 7.4, 150 mM NaCl) and then gel filtration chromatography in TBS on sephadex G-75 beads (Pharmacia). The concentration of the purified recombinant Ssol polypeptide was determined by micro-BCA test (Pierce) and then its biochemical characteristics analyzed.

[0619] Analysis by 8% SDS acrylamide gel stained with silver nitrate demonstrates a predominant polypeptide whose molecular mass is about 180 kD and whose degree of purity may be evaluated at 98% (FIG. 27A). Two main peaks are detected by SELDI-TOF mass spectrometry (Cyphergen): they correspond to single and double charged forms of a predominant polypeptide whose molecular mass is thus determined at 182.6.+-.3.7 kD (FIGS. 27B and C). After transfer onto Prosorb membrane and rinsing in 0.1% TFA, the N-terminal end of the Ssol polypeptide was sequenced in liquid phase by Edman degradation on 5 residues (ABI494, Applied Biosystems) and determined as being SDLDR (FIG. 27D). This demonstrates that the signal peptide located at the N-terminal end of the SARS-CoV S protein, composed of aa 1 to 13 (MFIFLLFLTLTSG) according to an analysis carried out with the software signalP v2.0 (Nielsen et al., 1997, Protein Engineering, 10:1-6), is cleaved from the mature Ssol polypeptide. The recombinant Ssol polypeptide therefore consists of amino acids 14 to 1193 of the SARS-CoV S protein fused at the C-terminals with a sequence SGDYKDDDDK containing the sequence of the FLAG tag (underlined). The difference between the theoretical molar mass of the naked Ssol polypeptide (132.0 kD) and the real molar mass of the mature polypeptide (182.6 kD) suggests that the Ssol polypeptide is glycosylated.

[0620] A preparation of purified Ssol polypeptide, whose protein concentration was determined by micro-BCA test, makes it possible to prepare a calibration series in order to measure, with the aid of the capture ELISA test described above, the concentrations of Ssol present in the culture supernatants and to review the characteristics of the secretory lines. According to this test, the FRhK4-Ssol-CT3 line secretes 4 to 6 g/ml of polypeptide Ssol while the FRhK4-Ssol-30 line secretes 9 to 13 g/ml of Ssol after 4 to 5 days of culture at confluence. In addition, the purification scheme presented above makes it possible routinely to purify from 1 to 2 mg of Ssol polypeptide per liter of culture supernatant.

EXAMPLE 12

Gene Immunization Involving the SARS-Associated Corona Virus (SARS-CoV) Spicule (S) Protein

[0621] The effect of a splice signal and of the posttranscriptional signals WPRE and CTE was analyzed after gene immunization of BALB/c mice (FIG. 28).

[0622] For that, BALB/c mice were immunized at intervals of 4 weeks by injecting into the tibialis anterior a saline solution of 50 .mu.g of plasmid DNA of pcDNA-S and pCI-S and, as a control, 50 .mu.g of plasmid DNA of pcDNA-N (directing the expression of SARS-CoV N) or of pCI-HA (directing the expression of the HA of the influenza virus A/PR/8/34) and the immune sera collected 3 weeks after the 2.sup.nd injection. The presence of antibodies directed against the SARS-CoV S was assessed by indirect ELISA using as antigen a lysate of VeroE6 cells infected with SARS-CoV and, as a control, a lysate of noninfected VeroE6 cells. The anti-SARS-CoV antibody titers (TI) are calculated as the reciprocal of the dilution producing a specific OD of 0.5 (difference between OD measured on a lysate of infected cells and OD measured on a lysate of noninfected cells) after visualization with an anti-mouse IgG polyclonal antibody coupled with peroxidase (NA931V, Amersham) and TMB supplemented with H.sub.2O.sub.2 (KPL) (FIG. 28A).

[0623] Under these conditions, the expression plasmid pcDNA-S only allows the induction of low antibody titers directed against SARS-CoV S in 3 mice out of 6 (LOG.sub.10(TI)=1.9.+-.0.6) whereas the plasmid pcDNA-N allows the induction of anti-N antibodies at high titers (LOG.sub.10(TI)=3.9.+-.0.3) in all the animals, and the control plasmids (pCI, pCI-HA) do not result in any detectable antibody (LOG.sub.10(TI)<1.7). The plasmid pCI-S equipped with a splice signal allows the induction of antibodies at high titers (LOG.sub.10(TI)=3.7.+-.0.2), which are approximately 60 times higher than those observed after injection of the plasmid pcDNA-S (p<10.sup.-5).

[0624] The efficiency of the posttranscriptional signals was studied by carrying out a dose-response study of the anti-S antibody titers induced in the BALB/c mouse as a function of the quantity of plasmid DNA used as immunogen (2 .mu.g, 10 .mu.g and 50 .mu.g). This study (FIG. 28B) demonstrates that the posttranscriptional signal WPRE greatly improves the efficiency of gene immunization when small doses of DNA are used (p<10.sup.-5 for a dose of 2 .mu.g of DNA and p<10.sup.-2 for a dose of 10 .mu.g), whereas the effect of the CTE signal remains marginal (p=0.34 for a dose of 2 .mu.g of DNA).

[0625] Finally, the antibodies induced in mice after gene immunization neutralize the infectivity of SARS-CoV in vitro (FIGS. 29A and 29B) at titers which are consistent with the titers measured by ELISA.

[0626] In summary, the use of a splice signal and of the posttranscriptional signal WPRE of the woodchuck hepatitis virus considerably improves the induction of neutralizing antibodies directed against SARS-CoV after gene immunization with the aid of plasmid DNA directing the expression of the cDNA for SARS-CoV S.

EXAMPLE 13

Diagnostic Applications of the S Protein

[0627] The ELISA reactivity of the recombinant Ssol polypeptide was analyzed with respect to sera from patients suffering from SARS.

[0628] The sera from probable cases of SARS tested were chosen on the basis of the results (positive or negative) of analysis of their specific reactivity toward the native antigens of SARS-CoV by immunofluorescence test on VeroE6 cells infected with SARS-CoV and/or by indirect ELISA test using as antigen a lysate of VeroE6 cells infected with SARS-CoV. The sera of these patients are identified by a serial number of the National Reference Center for Influenza Viruses and by the initials of the patient and the number of days elapsed since the onset of the symptoms. All the sera of probable cases (cf. Table XII) recognize the native antigens of SARS-CoV, with the exception of the serum 032552 of the patient VTT for whom infection with SARS-CoV could not be confirmed by RT-PCR performed on respiratory samples of days 3, 8 and 12. A panel of control sera was used as control (TV sera): they are sera collected in France before the SARS epidemic that occurred in 2003. TABLE-US-00023 TABLE XII Sera of probable cases of SARS Sample collection Serum Patient day 031724 JYK 7 033168 JYK 38 033597 JYK 74 032632 NTM 17 032634 THA 15 032541 PHV 10 032542 NIH 17 032552 VTT 8 032633 PTU 16 032791 JLB 3 033258 JLB 27 032703 JCM 8 033153 JCM 29

[0629] Solid phases sensitized with the recombinant Ssol polypeptide were prepared by adsorption of a solution of purified Ssol polypeptide at 2 .mu.g/ml in PBS in the wells of an ELISA plate, and then the plates are incubated overnight at 4.degree. C. and washed with PBS-Tween buffer (PBS, 0.1% Tween 20). After saturating the ELISA plates with a solution of PBS-10% skimmed milk (weight/volume) and washing in PBS-Tween, the sera to be tested (100 .mu.l) are diluted 1/400 in PBS skimmed milk-Tween buffer (PBS, 3% skimmed milk, 0.1% Tween) and then added to the wells of the sensitized ELISA plate. The plates are incubated for 1 h at 37.degree. C. After 3 washings with PBS-Tween buffer, the anti-human IgG conjugate labeled with peroxidase (ref. NA933V, Amersham) diluted 1/4000 in PBS-skimmed milk-Tween buffer is added, and then the plates are incubated for 1 hour at 37.degree. C. After 6 washings with PBS-Tween buffer, the chromogen (TMB) and the substrate (H.sub.2O.sub.2) are added and the plates are incubated for 10 minutes protected from light. The reaction is stopped by adding a 1 N H.sub.3PO.sub.4 solution, and then the absorbance is measured at 450 nm with a reference at 620 nm.

[0630] The ELISA tests (FIG. 30) demonstrate that the recombinant Ssol polypeptide is specifically recognized by the serum antibodies of patients suffering from SARS collected at the medium or late phase of infection (.gtoreq.10 days after the onset of the symptoms) whereas it is not significantly recognized by the serum antibodies of 2 patients (JLB and JCM) collected in the early phase of infection (3 to 8 days after the onset of the symptoms) or by control sera of subjects not suffering from SARS. The serum antibodies of patients JLB and JCM show a seroconversion between days 3 and 27 for the first and 8 and 29 for the second after the onset of the symptoms, which confirms the specificity of the reactivity of these sera toward the Ssol polypeptide.

[0631] In conclusion, these results demonstrate that the recombinant Ssol polypeptide may be used as an antigen for the development of an ELISA test for serological diagnosis of infection with SARS-CoV.

EXAMPLE 14

Vaccine Applications of the Recombinant Soluble S Protein

[0632] The immunogenicity of the recombinant Ssol polypeptide was studied in mice.

[0633] For that, a group of 6 mice was immunized at 3 weeks' interval with 10 .mu.g of recombinant Ssol polypeptide adjuvanted with 1 mg of aluminum hydroxide (Alu-gel-S, Serva) diluted in PBS. Three successive immunizations were performed and the immune sera were collected 3 weeks after each of the immunizations (IS1, IS2, IS3). As a control, a group of mice (mock group) received aluminum hydroxide alone according to the same protocol.

[0634] The immune sera were analyzed per pool for each of the 2 groups by indirect ELISA using a lysate of VeroE6 cells infected with SARS-CoV as antigen and as a control a lysate of noninfected VeroE6 cells. The anti-SARS-CoV antibody titers are calculated as the reciprocal of the dilution producing a specific OD of 0.5 after visualization with an anti-mouse IgG(H+L) polyclonal antibody coupled with peroxidase (NA931V, Amersham) and TMB supplemented with H.sub.2O.sub.2 (KPL). This analysis (FIG. 31) shows that the immunization with the Ssol polypeptide induces in mice, from the first immunization, antibodies directed against the native form of the SARS-CoV spicule protein present in the lysate of infected VeroE6 cells. After 2 then 3 immunizations, the anti-S antibody titers become very high.

[0635] The immune sera were analyzed per pool for each of the two groups for their capacity to seroneutralize the infectivity of SARS-CoV. 4 points of seroneutralization on FRhK-4 cells (100 TCID50 of SARS-CoV) are produced for each of the 2-fold dilutions tested from 1/20. The seroneutralizing titer is calculated according to the Reed and Munsch method as the reciprocal of the dilution neutralizing the infectivity of 2 wells out of 4. This analysis shows that the antibodies induced in mice by the Ssol polypeptide are neutralizing: the titers observed are very high after 2 and then 3 immunizations (greater than 2560 and 5120 respectively, table XIII). TABLE-US-00024 TABLE XIII Induction of antibodies directed against SARS-CoV after immunization with the recombinant Ssol polypeptide. The immune sera were analyzed per pool for each of the two groups for their capacity to seroneutralize the infectivity of 100 TCID50 of SARS- CoV on FRhK-4 cells. 4 points are produced for each of the 2-fold dilutions tested from 1/20. The seroneutralizing titer is calculated according to the Reed and Munsch method as the reciprocal of the dilution neutralizing the infectivity of 2 wells out of 4. Group Sera Neutralizing Ab Mock pi <20 IS1 <20 IS2 <20 IS3 <20 Ssol pi <20 IS1 57 IS2 >2560 IS3 >5120

[0636] The neutralizing titers observed in mice immunized with the Ssol polypeptide reach levels far greater than the titers observed by Yang et al. in mice (2004, Nature, 428:561-564) and those observed by Buchholz in the hamster (2004, PNAS 101:9804-9809) which protect respectively mice and hamsters from infection with SARS-CoV. It is therefore probable that the neutralizing antibodies induced in mice after immunization with the Ssol polypeptide protect these animals against infection with SARS-CoV.

EXAMPLE 15

Optimized Synthetic Gene for the Expression in Mammalian Cells of the SARS-Associated Coronavirus (SARS-CoV) Spicule (S) Protein

1) Design of the Synthetic Gene

[0637] A synthetic gene encoding the SARS-CoV spicule protein was designed from the gene of the isolate 031589 (plasmid pSARS-S, C.N.C.M. No. I-3059) so as to allow high levels of expression in mammalian cells and in particular in cells of human origin.

[0638] For that: [0639] the use of codons of the wild-type gene of the isolate 031589 was modified so as to become close to the bias observed in humans and to improve the efficiency of translation of the corresponding mRNA [0640] the overall GC content of the gene was increased so as to extend the half-life of the corresponding mRNA [0641] the optionally cryptic motifs capable of interfering with an efficient expression of the gene were deleted (splice donor and acceptor sites, polyadenylation signals, sequences very rich (>80%) or very low (<30%) in GC, repeat sequences, sequences involved in the formation of secondary RNA structures, TATA boxes) [0642] a second STOP codon was added to allow efficient termination of translation.

[0643] In addition, CpG motifs were introduced into the gene so as to increase its immunogenicity as DNA vaccine. In order to facilitate the manipulation of the synthetic gene, two BamH1 and Xho1 restriction sites were placed on either side of the open reading frame of the S protein, and the BamH1, Xho1, Nhe1, Kpn1, BspE1 and Sal1 restriction sites were avoided in the synthetic gene.

[0644] The sequence of the synthetic gene designed (gene 040530) is given in SEQ ID No: 140.

[0645] An alignment of the synthetic gene 040530 with the sequence of the wild-type gene of the isolate 031589 of SARS-CoV deposited at the C.N.C.M. under the number I-3059 (SEQ ID No: 4, plasmid pSRAS-S) is presented in FIG. 32.

2) Plasmid Constructs

[0646] The synthetic gene SEQ ID No: 140 was assembled from synthetic oligonucleotides and cloned between the Kpn1 and Sac1 sites of the plasmid pUC-Kana in order to give the plasmid 040530pUC-Kana. The nucleotide sequence of the insert of the plasmid 040530pUC-Kana was verified by automated sequencing (Applied).

[0647] A Kpn1-Xho1 fragment containing the synthetic gene 040530 was excised from the plasmid 040530pUC-Kana and subcloned between the Nhe1 and Xho1 sites of the expression plasmic pCI (Promega) in order to obtain the plasmid pCI-SSYNTH, deposited at the CNCM on Dec. 1, 2004, under the number I-3333.

[0648] A synthetic gene encoding the soluble form of the S protein was then obtained by fusing the synthetic sequences encoding the ectodomain of the S protein (amino acids 1 to 1193) with those of the tag (FLAG:DYKDDDDK) via a linker BspE1 encoding the dipeptide SG. Practically, a DNA fragment encoding the ectodomain of the SARS-CoV S was amplified by PCR with the aid of the oligonucleotides 5'-ACTAGCTAGC GGATCCACCATGTTCATCTT CCTG-3' and 5'-AGTATCCGGAC TTG ATGTACT GCTCGTACTTGC-3' from the plasmid 040530pUC-Kana, digested with Nhe1 and BspE1 and then inserted between the unique Nhe1 and BspE1 sites of the plasmid pCI-Ssol, to give the plasmid pCI-SCUBE, deposited at the CNCM on Dec. 1, 2004, under the number I-3332. The plasmids pCI-Ssol, pCI-Ssol-CTE, and pCI-Ssol-WPRE (deposited at the CNCM, on Nov. 22, 2004, under the number I-3324) had been previously obtained by subcloning the Kpn1-Xho1 fragment excised from the plasmid pcDNA-Ssol (see technical note of DI 2004-106) between the Nhe1 and Xho1 sites of the plasmids pCI, pCI-S-CTE and pCI-S-WPRE respectively.)

[0649] The plasmids pCI-Scube and pCI-Ssol encode the same recombinant Ssol polypeptide.

3) Results

[0650] The capacity of the synthetic gene encoding the S protein to efficiently direct the expression of the SARS-CoV S in mammalian cells was compared with that of the wild-type gene after transient transfection of primate cells (VeroE6) and of human cells (293T).

[0651] In the experiment presented in FIG. 33 and in table XIV, monolayers of 5.times.10.sup.5 VeroE6 cells or 7.times.10.sup.5 293T cells in 35 mm Petri dishes were transfected with 2 g of plasmids pCI (as control), pCI-S, pCI-S-CTE, pCI-S-WPRE and pCI-S-Ssynth and 6 .mu.l of Fugene6 reagent according to the manufacturer's instructions (Roche). After 48 hours of incubation at 37.degree. C. and under 5% CO.sub.2, cell extracts were prepared in loading buffer according to Laemmli, separated on 8% SDS polyacrylamide gel and then transferred onto a PVDF membrane (BioRad). The detection of this immunoblot (Western blot) was carried out with the aid of an anti-S rabbit polyclonal serum (immune serum of the rabbit P11135: cf example 4 above) and of donkey polyclonal antibodies directed against rabbit IgGs and coupled with peroxidase (NA934V, Amersham). The immunoblot was quantitatively visualized by luminescence with the aid of the ECL+ kit (Amersham) and acquisition on a digital imaging device (Fluor S, BioRad).

[0652] The analysis of the results obtained with the software QuantityOne v4.2.3 (BioRad) shows that in this experiment, the plasmid pCI-Synth allows the transient expression of the S protein at high levels in the VeroE6 and 293T cells, whereas the plasmid pCI-S does not make it possible to induce expression at sufficient levels to be detected. The expression levels observed are of the order of twice as high as those observed with the plasmid pCI-S-WPRE. TABLE-US-00025 TABLE XIV Use of a synthetic gene for the expression of the SARS-CoV S. Cell extracts prepared 48 hours after transfection of VeroE6 or 293T cells with the plasmids pCI, pCI-S, pCI-S-CTE, pCI-S-WPRE and pCI-S- Ssynth were separated on 8% SDS acrylamide gel and analyzed by Western blotting with the aid of an anti-S rabbit polyclonal antibody and an anti-rabbit IgG (H + L) polyclonal antibody coupled with peroxidase (NA934V, Amersham). The Western blot is visualized by luminescence (ECL+, Amersham) and acquisition on a digital imaging device (FluorS, BioRad). The expression levels of the S protein were measured by quantifying the two predominant bands identified on the image (see FIG. 33) and are indicated according to an arbitrary scale where the value 1 represents the level measured after transfection of the plasmid pCI-S-WPRE. Plasmid VeroE6 293T pCI 0.0 0.0 pCI-S .ltoreq.0.1 .ltoreq.0.1 pCI-S-CTE 0.5 .ltoreq.0.1 pCI-S-WPRE 1.0 1.0 pCI-Ssynth 1.8 1.9

[0653] In a second instance, the capacity of the synthetic gene Scube to efficiently direct the synthesis and the secretion of the Ssol polypeptide by mammalian cells was compared with that of the wild-type gene after transient transfection of hamster cells (BHK-21) and of human cells (293T).

[0654] In the experiment presented in table XV, monolayers of 6.times.10.sup.5 BHK-21 cells and 7.times.10.sup.5 293T cells in 35 mm Petri dishes were transfected with 2 .mu.g of plasmids pCI (as control), pCI-Ssol, pCI-Ssol-CTE, pCI-Ssol-WPRE and pCI-Scube and 6 .mu.l of Fugene6 reagent according to the manufacturer's instructions (Roche). After 48 hours of incubation at 37.degree. C. and under 5% CO.sub.2, the cellular supernatants were collected and quantitatively analyzed for the secretion of the Ssol polypeptide by a capture ELISA test specific for the Ssol polypeptide.

[0655] Analysis of the results shows that, in this experiment, the plasmid pCI-Scube allows the expression of the Ssol polypeptide at levels 8 times (BHK-21 cells) to 20 times (293T cells) higher than the plasmid pCI-Ssol.

[0656] The levels of expression observed are of the order of twice (293T cells) to 5 times (BHK-21 cells) as high as those observed with the plasmid pCI-Ssol-WPRE. TABLE-US-00026 TABLE XV Use of a synthetic gene for the expression of the Ssol polypeptide. The supernatants were harvested 48 hours after transfection of BHK or 293T cells with the plasmids pCI, pCI-Ssol, pCI-Ssol-CTE, pCI-Ssol-WPRE and pCI-Scube and quantitatively analyzed for the secretion of the Ssol polypeptide by an ELISA test specific for the Ssol polypeptide. The transfections were carried out in duplicate and the results are presented in the form of means and standard deviations of the concentrations of Ssol polypeptide (ng/ml) measured in the supernatants. Plasmid BHK 293T pci <20 <20 pCI-Ssol <20 56 .+-. 10 pCI-Ssol-CTE <20 63 .+-. 8 pCI-Ssol-WPRE 28 .+-. 1 531 .+-. 15 pCI-Scube 152 .+-. 6 1140 .+-. 20

[0657] In summary, these results show that the expression, in mammalian cells, of the synthetic gene 040530 encoding SARS-CoV S under the control of RNA polymerase II promoter sequences is much more efficient than that of the wild-type gene of the 031589 isolate. This expression is even more efficient than that directed by the wild-type gene in the presence of the WPRE sequences of the woodchuck hepatitis virus.

4) Applications

[0658] The use of the synthetic gene 040530 encoding SARS-CoV S or its Scube variant encoding the polypeptide Ssol is capable of advantageously replacing the wild-type gene in numerous applications where the expression of S is necessary at high levels. In particular in order to: [0659] improve the efficiency of gene immunization with plasmids of the pCI-Ssynth or even pCI-Ssynth-CTE or pCI-Ssynth-WPRE type [0660] establish novel cell lines expressing higher quantities of the S protein or of the Ssol polypeptide with the aid of recombinant lentiviral vectors carrying the Ssynth gene or the Scube gene respectively [0661] improve the immunogenicity of the recombinant lentiviral vectors allowing the expression of the S protein or of the Ssol polypeptide [0662] improve the immunogenicity of live vectors allowing the expression of the S protein or of the Ssol polypeptide like recombinant vaccinia viruses or recombinant measles viruses (see examples 16 and 17 below)

EXAMPLE 16

Expression of the SARS-Associated Coronavirus (SARS-CoV) Spicule (S) Protein with the Aid of Recombinant Vaccinia Viruses

[0662] Vaccine Application

Application to the Production of a Soluble form of the Spicule (S) Protein and Design of a Serological Test for SARS

1) Introduction

[0663] The aim of this example is to evaluate the capacity of recombinant vaccinia viruses (VV) expressing various SARS-associated coronavirus (SARS-CoV) antigens to constitute novel vaccine candidates against SARS and a means of producing recombinant antigens in mammalian cells.

[0664] For that, the inventors focused on the SARS-CoV spicule (S) protein which makes it possible to induce, after gene immunization in animals, antibodies neutralizing the infectivity of SARS-CoV, and a soluble and secreted form of this protein, the Ssol polypeptide, which is composed of the ectodomain (aa 1-1193) of S fused at its C-ter end with a tag FLAG (DYKDDDDK) via a BspE1 linker encoding the SG dipeptide. This Ssol polypeptide exhibits an antigenicity similar to that of the S protein and allows, after injection into mice in the form of a purified protein adjuvanted with aluminum hydroxide, the induction of high neutralizing antibody titers against SARS-CoV.

[0665] The various forms of the S gene were placed under the control of the promoter of the 7.5K gene and then introduced into the thymidine kinase (TK) locus of the Copenhagen strain of the vaccinia virus by double homologous recombination in vivo. In order to improve the immunogenicity of the recombinant vaccinia viruses, a synthetic late promoter was chosen in place of the 7.5K promoter, in order to increase the production of S and Ssol during the late phases of the viral cycle.

[0666] After having isolated the recombinant vaccinia viruses and verified their capacity to express the SARS-CoV S antigen, their capacity to induce in mice an immune response against SARS was tested. After having purified the Ssol antigen from the supernatant of infected cells, an ELISA test for serodiagnosis of SARS was designed, and its efficiency was evaluated with the aid of sera from probable cases of SARS.

2) Construction of the Recombinant Viruses

[0667] Recombinant vaccinia viruses directing the expression of the S glycoprotein of the 031589 isolate of SARS-CoV and of a soluble and secreted form of this protein, the Ssol polypeptide, under the control of the 7.5K promoter were obtained. With the aim of increasing the levels of expression of S and Ssol, recombinant viruses in which the cDNAs for S and for Ssol are placed under the control of a late synthetic promoter were also obtained.

[0668] The plasmid pTG186poly is a transfer plasmid for the construction of recombinant vaccinia viruses (Kieny, 1986, Biotechnology, 4:790-795). As such, it contains the VV thymidine kinase gene into which the promoter of the 7.5K gene has been inserted followed by a multiple cloning site allowing the insertion of heterologous genes (FIG. 34A). The promoter of the 7.5K gene in fact contains a tandem of two promoter sequences that are respectively active during the early (P.sub.E) and late (P.sub.L) phases of the vaccinia virus replication cycle. The BamH1-Xho1 fragments were excised from the plasmids pTRIP-S and pcDNA-Ssol respectively and inserted between the BamH1 and Sma1 sites of the plasmid pTG186poly in order to give the plasmids pTG-S and pTG-Ssol (FIG. 34A). The plasmids pTG-S and pTG-Ssol were deposited at the CNCM, on Dec. 2, 2004, under the numbers I-3338 and I-3339, respectively.

[0669] The plasmids pTN480, pTN-S and pTN-Ssol were obtained from the plasmids pTG186poly, pTG-S and pTG-Ssol respectively, by substituting the Nde1-Pst1 fragment containing the 7.5K promoter by a DNA fragment containing the synthetic late promoter 480, which was obtained by hybridization of the oligonucleotides 5'-TATGAGCTTT TTTTTTTTTT TTTTTTTGGC ATATAAATAG ACTCGGCGCG CCATCTGCA-3' and 5'-GATGGCGCGCCGAGTCTATT TATATGCCAA AAAAAAAAAA AAAAAAAAGC TCA-3' (FIG. 34B). The insert was sequenced with the aid of a BigDye Terminator v1.1 kit (Applied Biosystems) and an automated sequencer ABI377. The sequence of the late synthetic promoter 480 as cloned into the transfer plasmids of the pTN series is indicated in FIG. 34C. The plasmids pTN-S and pTN-Ssol were deposited at the CNCM, on Dec. 2, 2004, under the numbers I-3340 and I-3341, respectively.

[0670] The recombinant vaccinia viruses were obtained by double homologous recombination in vivo between the TK cassette of the transfer plasmids of the series pTG and pTN and the TK gene of the Copenhagen strain of the vaccinia virus according to a procedure described by Kieny et al. (1984, Nature, 312:163-166). Briefly, CV-1 cells are transfected with the aid of DOTAP (Roche) with genomic DNA of the Copenhagen strain of the vaccinia virus and each of the transfer plasmids of the pTG and pTN series described above, and then superinfected with the helper vaccinia virus W-ts7 for 24 hours at 33.degree. C. The helper virus is counter-selected by incubation at 40.degree. C. for 2 days and then the recombinant viruses (TK-phenotype) selected by two cloning cycles under agar medium on 143Btk-cells in the presence of BuDr (25 .mu.g/ml). The 6 viruses VV-TG, VV-TG-S, VV-TG-Ssol, VV-TN, VV-TN-S, and VV-TN-Ssol are respectively obtained with the aid of the transfer plasmids pTG186poly, pTG-S, pTG-Ssol, pTN480, pTN-S, pTN-Ssol. The viruses VV-TG and VV-TN do not express any heterologous gene and were used as TK-control in the experiments. The preparations of recombinant viruses were performed on monolayers of CV-1 or BHK-21 cells and the titer in plaque forming units (p.f.u) determined on CV-1 cells according to Earl and Moss (1998, Current Protocols in Molecular Biology, 16.16.1-16.16.13).

3) Characterization of the Recombinant Viruses

[0671] The expression of the transgenes encoding the S protein and the Ssol polypeptide was assessed by Western blotting.

[0672] Monolayers of CV-1 cells were infected at a multiplicity of 2 with various recombinant vaccinia viruses VV-TG, VV-TG-S, VV-TG-Ssol, W-TN, W-TN-S and VV-TN-Ssol. After 18 hours of incubation at 37.degree. C. and under 5% CO2, cellular extracts were prepared in loading buffer according to Laemmli, separated on 8% SDS polyacrylamide gel and then transferred onto a PVDF membrane (BioRad). The detection of this immunoblot (Western blot) was performed with the aid of an anti-S rabbit polyclonal serum (immune serum from the rabbit P11135: cf. example 4) and donkey polyclonal antibodies directed against rabbit IgGs and coupled with peroxidase (NA934V, Amersham). The bound antibodies were visualized by luminescence with the aid of the ECL+ kit (Amersham) and autoradiography films Hyperfilm MP (Amersham).

[0673] As shown in FIG. 35A, the recombinant virus VV-TN-S directs the expression of the S protein at levels which are comparable to those which can be observed 8 h after infection with SARS-CoV but which are much higher than those which can be observed after infection with VV-TG-S. In a second experiment (FIG. 35B), the analysis of variable quantities of cellular extracts shows that the levels of expression observed after infection with viruses of the TN series (VV-TN-S and VV-TN-Ssol) are about 10 times as high as those observed with the viruses of the TG series (VV-TG-S and VV-TG-Ssol, respectively). In addition, the Ssol polypeptide is secreted into the supernatant of CV-1 cells infected with the VV-TN-Ssol virus more efficiently than in the supernatant of cells infected with VV-TG-Ssol (FIG. 36A). In this experiment, the VV-TN-Sflag virus was used as a control because it expresses the membrane form of the S protein fused at its C-ter end with the FLAG tag. The Sflag protein is not detected in the supernatant of cells infected with VV-TN-Sflag, demonstrating that the Ssol polypeptide is indeed actively secreted after infection with VV-TN-Ssol.

[0674] These results demonstrate that the recombinant vaccinia viruses are indeed carriers of the transgenes and allow the expression of the SRAS glycoprotein in its membrane form (S) or in a soluble or secreted form (Ssol). The vaccinia viruses carrying the synthetic promoter 480 allow the expression of S and the secretion of Ssol at levels much higher than the viruses carrying the promoter of the 7.5K gene.

4) Application to the Production of a Soluble Form of SARS-CoV S. Purification of this Recombinant Antigen and Diagnostic Applications

[0675] The BHK-21 line is the cell line which secretes the highest quantities of Ssol polypeptide after infection with the VV-TN-Ssol virus among the lines tested (BHK-21, CV1, 293T and FrhK-4, FIG. 36B); it allows the quantitative production and purification of the recombinant Ssol polypeptide. In a typical experiment where the experimental conditions for infection, production and purification were optimized, the BHK-21 cells are inoculated in standard culture medium (pyruvate-free DMEM containing 4.5 g/l of glucose and supplemented with 5% TPB, 5% FCS, 100 U/ml of penicillin and 100 .mu.g/ml of streptomycin) in the form of a subconfluent monolayer (10 million cells for each 100 cm.sup.2 in 25 ml of medium). After 24 h of incubation at 37.degree. C. under 5% CO.sub.2, the cells are infected at an M.O.I. of 0.03 and the standard medium replaced with the secretion medium where the quantity of FCS is reduced to 0.5% and the TPB eliminated. The culture supernatant is removed after 2.5 days of incubation at 35.degree. C. and under 5% CO.sub.2 and the vaccinia virus inactivated by addition of Triton X-100 (0.1%). After filtration on 0.1 .mu.m polyethersulfone (PES) membrane, the recombinant Ssol polypeptide is purified by affinity chromatography on an anti-FLAG matrix with elution with a solution of FLAG peptide (DYKDDDDK) at 100 .mu.g/ml in TBS (50 mM Tris, pH 7.4, 150 mM NaCl).

[0676] The analysis by 8% SDS acrylamide gel stained with silver nitrate identified a predominant polypeptide whose molecular mass is about 180 kD and whose degree of purity is greater than 90% (FIG. 37). The concentration of the purified Ssol recombinant polypeptide was determined by comparison with molecular mass markers and estimated at 24 ng/.mu.l.

[0677] This purified Ssol polypeptide preparation makes it possible to produce a calibration series in order to measure, with the aid of a capture ELISA test, the Ssol concentrations present in the culture supernatants. According to this test, the BHK-21 line secretes about 1 g/ml of Ssol polypeptide under the production conditions described above. In addition, the purification scheme presented makes it possible to purify of the order of 160 .mu.g of Ssol polypeptide per liter of culture supernatant.

[0678] The ELISA reactivity of the recombinant Ssol polypeptide was analyzed toward sera from patients suffering from SARS.

[0679] The sera of probable cases of SARS tested were chosen on the basis of the results (positive or negative) of analysis of their specific reactivity toward the native antigens of SARS-CoV by immunofluorescence test on VeroE6 cells infected with SARS-CoV and/or by indirect ELISA test using, as antigen, a lysate of VeroE6 cells infected with SARS-CoV. The sera of these patients are identified by a serial number of the National Reference Center for Influenza Viruses and by the patient's initials and the number of days elapsed since the onset of the symptoms. All the sera of probable cases (cf. table XVI) recognize the native antigens of SARS-CoV with the exception of the serum 032552 of the patient VTT, for which infection with SARS-CoV could not be confirmed by RT-PCR performed on respiratory samples of days 3, 8 and 12. A panel of control sera was used as control (TV sera): they are sera collected in France before the SARS epidemic which occurred in 2003. TABLE-US-00027 TABLE XVI Sera of probable cases of SARS Serum Patient Sample collection day 033168 JYK 38 033597 JYK 74 032632 NTM 17 032634 THA 15 032541 PHV 10 032542 NIH 17 032552 VTT 8 032633 PTU 16

[0680] Solid phases sensitized with the recombinant Ssol polypeptide were prepared by adsorption of a solution of purified Ssol polypeptide at 4 .mu.g/ml in PBS in the wells of an ELISA plate. The plates are incubated overnight at 4.degree. C. and then washed with PBS-Tween buffer (PBS, 0.1% Tween 20). After washing with PBS-Tween, the sera to be tested (100 .mu.l) are diluted 1/100 and 1/400 in PBS-skimmed milk-Tween buffer (PBS, 3% skimmed milk, 0.1% Tween) and then added to the wells of the sensitized ELISA plate. The plates are then incubated for 1 h at 37.degree. C. After 3 washings with PBS-Tween buffer, the anti-human IgG conjugate labeled with peroxidase (ref. NA933V, Amersham) diluted 1/4000 in PBS-skimmed milk-Tween buffer is added and then the plates are incubated for one hour at 37.degree. C. After 6 washings with PBS-Tween buffer, the chromogen (TMB) and the substrate (H.sub.2O.sub.2) are added and the plates are incubated for 10 minutes protected from light. The reaction is stopped by adding a 1M solution of H.sub.3PO.sub.4 and then the absorbance is measured at 450 nm with a reference at 620 nm.

[0681] The ELISA tests (FIG. 38) demonstrate that the recombinant Ssol polypeptide is specifically recognized by the serum antibodies of patients suffering from SARS, collected at the middle or late phase of infection (.gtoreq.10 days after the onset of the symptoms), whereas it is not significantly recognized by the serum antibodies of the control sera of subjects not suffering from SARS.

[0682] In conclusion, these results demonstrate that the recombinant Ssol polypeptide can be purified from the supernatant of mammalian cells infected with the recombinant vaccinia virus W-TN-Ssol and can be used as antigen for developing an ELISA test for serological diagnosis of infection with SARS-CoV.

5. Vaccine Applications

[0683] The immunogenicity of the recombinant vaccinia viruses was studied in mice.

[0684] For that, groups of 7 BALB/c mice were immunized by the i.v. route twice at 4 weeks' interval with 10.sup.6 p.f.u. of recombinant vaccinia viruses W-TG, VV-TG-S, W-TG-Ssol, VV-TN, VV-TN-S and W-TN-Ssol and, as a control, VV-TG-HA which directs the expression of hemagglutinin of the A/PR/8/34 strain of the influenza virus. The immune sera were collected 3 weeks after each of the immunizations (IS1, IS2).

[0685] The immune sera were analyzed per pool for each of the groups by indirect ELISA using a lysate of VeroE6 cells infected with SARS-CoV as antigen and, as control, a lysate of noninfected VeroE6 cells. The anti-SARS-CoV antibody titers (TI) are calculated as the reciprocal of the dilution producing a specific OD of 0.5 after visualization with an anti-mouse IgG(H+L) polyclonal antibody coupled with peroxidase (NA931V, Amersham) and TMB supplemented with H.sub.2O.sub.2 (KPL). This analysis (FIG. 39A) shows that immunization with the virus VV-TG-S and VV-TN-S induces in mice, from the first immunization, antibodies directed against the native form of the SARS-CoV spicule protein present in the lysate of infected VeroE6 cells. The responses induced by the VV-TN-S virus are higher than those induced by the VV-TG-S virus after the first (TI=740 and TI=270 respectively) and the second (TI=3230 and TI=600 respectively) immunization. The VV-TN-Ssol virus induces high anti-SARS-CoV antibody titers after two immunizations (TI=640), whereas the virus VV-TG-Ssol induces a response at the detection limit (TI=40).

[0686] The immune sera were analyzed per pool for each of the groups for their capacity to seroneutralize the infectivity of SARS-CoV. 4 seroneutralization points on FRhK-4 cells (100 TCID50 of SARS-CoV) are produced for each of the 2-fold dilutions tested from 1/20. The seroneutralizing titer is calculated according to the Reed and Munsch method as the reciprocal of the dilution neutralizing the infectivity of 2 wells out of 4. This analysis shows that the antibodies induced in mice by the vaccinia viruses expressing the S protein or the Ssol polypeptide are neutralizing and that the viruses with synthetic promoters are more efficient immunogens than the viruses carrying the 7.5K promoter: the highest titers (640) are observed after 2 immunizations with the virus VV-TN-S (FIG. 39B).

[0687] The protective power of the neutralizing antibodies induced in mice after immunization with the recombinant vaccinia viruses is evaluated with the aid of a challenge infection with SARS-CoV.

6) Other Applications

[0688] Third generation recombinant vaccinia viruses are constructed by substituting the wild-type sequences of the S and Ssol genes by synthetic genes optimized for the expression in mammalian cells, described above. These recombinant vaccinia viruses are capable of expressing larger quantities of S and Ssol antigens and therefore of exhibiting increased immunogenicity.

[0689] The recombinant vaccinia virus VV-TN-Ssol can be used for the quantitative production and purification of the Ssol antigen for diagnostic (serology by ELISA) and vaccine (subunit vaccine) applications.

EXAMPLE 17

Recombinant Measles Virus Expressing the SARS-Associated Coronavirus (SARS-CoV) Spicule (S) Protein. Vaccine Applications

1) Introduction

[0690] The measles vaccine (MV) induces a lasting protective immunity in humans after a single injection (Hilleman, 2002, Vaccine, 20: 651-665). The protection conferred is very robust and is based on the induction of an antibody response and of a CD4 and CD8 cell response. The MV genome is very stable and no reversion of the vaccine strains to virulence has ever been observed. The measles virus belongs to the genus Morbillivirus of the Paramyxoviridae family; it is an enveloped virus whose genome is a 16 kb single-stranded RNA of negative polarity (FIG. 40A) and whose exclusively cytoplasmic replication cycle excludes any possibility of integration into the genome of the host. The measles vaccine is thus one of the most effective and one of the safest live vaccines used in the human population. Frederic Tangy's team recently developed an expression vector on the basis of the Schwarz strain of the measles virus, which is the safest attenuated strain and the most widely used in humans as vaccine against measles. This vaccine strain may be isolated from an infectious molecular clone while preserving its immuno-genicity in primates and in mice that are sensitive to the infection. It constitutes, after insertion of additional transcription units, a vector for the expression of heterologous sequences (Combredet, 2003, J. Virol. 77: 11546-11554). In addition, a recombinant MV Schwarz expressing the envelope glycoprotein of the West Nile virus (WNV) induces an effective and lasting antibody response which protects mice from a lethal challenge infection with WNV (Despres et al., 2004, J. Infect. Dis., in press). All these characteristics make the attenuated Schwarz strain of the measles virus an extremely promising candidate vector for the construction of novel recombinant live vaccines.

[0691] The aim of this example is to evaluate the capacity of recombinant measles viruses (MV) expressing various SARS-associated coronavirus (SARS-CoV) antigens to constitute novel candidate vaccines against SARS.

[0692] The inventors focused on the SARS-CoV spicule (S) protein, which makes it possible to induce, after gene immunization in animals, antibodies neutralizing the infectivity of SARS-CoV, and on a soluble and secreted form of this protein, the Ssol polypeptide, which is composed of the ectodomain (aa 1-1193) of S fused at its C-ter end with a FLAG tag (DYKDDDDK) via a BspE1 linker encoding the SG dipeptide. This Ssol polypeptide exhibits a similar antigenicity to that of the S protein and allows, after injection into mice in the form of a purified protein adjuvanted with aluminum hydroxide, the induction of high neutralizing antibody titers against SARS-CoV.

[0693] The various forms of the S gene were introduced in the form of an additional transcription unit between the P (phosphoprotein) and M (matrix) genes into the cDNA of the Schwarz strain of Mv previously described (Combredet, 2003, J. Virol. 77: 11546-11554; EP application No. 02291551.6 of Jun. 20, 2002, and EP application No. 02291550.8 of Jun. 20, 2002). After having isolated the recombinant viruses MVSchw2-SARS-S and MVSchw2-SARS-Ssol and checked their capacity to express the SARS-CoV S antigen, their capacity to induce a protective immune response against SARS in mice and then in monkeys was tested.

2) Construction of the Recombinant Viruses

[0694] The plasmid pTM-MVSchw-ATU2 (FIG. 40B) contains an infectious cDNA corresponding to the antigenome of the Schwarz vaccine strain of the measles virus (MV) into which an additional transcription unit (ATU) has been introduced between the P (phosphoprotein) and M (matrix) genes (Combredet, 2003, Journal of Virology, 77: 11546-11554). Recombinant genomes MVSchw2-SARS-S and MVSchw2-SARS-Ssol of the measles virus were constructed by inserting ORFs of the S protein and of the Ssol polypeptide into the additional transcription unit of the MVSchw-ATU2 vector.

[0695] For that, a DNA fragment containing the SARS-CoV S cDNA was amplified by PCR with the aid of the oligo-nucleotides 5'-ATACGTACGA CCATGTTTAT TTTCTTATTA TTTCTTACTC TCACT-3' and 5'-ATAGCGCGCT CATTATGTGT AATGTAATTT GACACCCTTG-3' using the plasmid pcDNA-S as template and then inserted into the plasmid pCR.RTM.2.1-TOPO (Invitrogen) in order to obtain the plasmid pTOPO-S-MV. The two oligonucleotides used contain restriction sites BsiW1 and BssHII, so as to allow subsequent insertion into the measles vector, and were designed so as to generate a sequence of 3774 nt including the codons for initiation and termination, so as to observe the rule of 6 which stipulates that the length of the genome of a measles virus must be divisible by 6 (Calain & Roux, 1993, J. Virol., 67: 4822-4830; Schneider et al., 1997, Virology, 227: 314-322). The insert was sequenced with the aid of a BigDye Terminator v1.1 kit (Applied Biosystems) and an automated sequencer ABI377.

[0696] To express a soluble and secreted form of SARS-CoV S, a plasmid containing the cDNA of the Ssol polypeptide corresponding to the ectodomain (aa 1-1193) of SARS-CoV S fused at its C-ter end with the sequence of a FLAG tag (DYKDDDDK) via a BspE1 linker encoding the SG dipeptide was then obtained. For that, a DNA fragment was amplified with the aid of the oligonucleotides 5'-CCATTTCAAC AATTTGGCCG-3' and 5'-ATAGGATCCG CGCGCTCATT ATTTATCGTC GTCATCTTTA TAATC-3' from the plasmid pcDNA-Ssol and then inserted into the plasmid pTOPO-S-MV between the Sal1 and BamH1 sites in order to obtain the plasmid pTOPO-S-MV-SF. The sequence generated is 3618 nt long between the BsiW1 and BssHII sites and observes the rule of 6. The insert was sequenced as indicated above.

[0697] The BsiW1-BssHII fragments containing the cDNAs for the S protein and the Ssol polypeptide were then excised by digestion of the plasmids pTOPO-S-MV and pTOPO-S-MV-SF and then subcloned between the corresponding sites of the plasmid pTM-MVSchw-ATU2 in order to give the plasmids pTM-MVSchw2-SARS-S and pTM-MVSchw2-SARS-Ssol (FIG. 40B). These two plasmids were deposited at the C.N.C.M. on Dec. 1, 2004, under the numbers I-3326 and I-3327, respectively.

[0698] The recombinant measles viruses corresponding to the plasmids pTM-MVSchw2-SARS-S and pTM-MVSchw2-SARS-Ssol were obtained by reverse genetics according to the system based on the use of a helper cell line, described by Radecke et al. (1995, Embo J., 14: 5773-5784) and modified by Parks et al. (1999, J. Virol., 73: 3560-3566). Briefly, the helper cells 293-3-46 are transfected according to the calcium phosphate method with 5 .mu.g of the plasmids pTM-MVSchw2-SARS-S or pTM-MVSchw2-SARS-Ssol and 0.02 .mu.g of the plasmid pEMC-La directing the expression of the MV L polymerase (gift from M. A. Billeter). After incubating overnight at 37.degree. C., a heat shock is produced for 2 hours at 43.degree. C. and the transfected cells are transferred onto a monolayer of Vero cells. For each of the two plasmids, syncytia appeared after 2 to 3 days of coculture and were transferred successively onto monolayers of Vero cells at 70% confluence in 35 mm Petri dishes and then in 25 and 75 cm.sup.2 flasks. When the syncytia have reached 80-90% confluence, the cells are recovered with the aid of a scraper and then frozen and thawed once. After low-speed centrifugation, the supernatant containing the virus is stored in aliquots at -80.degree. C. The titers of the recombinant viruses MVSchw2-SARS-S and MVSchw2-SARS-Ssol were determined by limiting dilution on Vero cells and the titer as dose infecting 50% of the wells (TCID.sub.50) calculated according to the Karber method.

3) Characterization of the Recombinant Viruses

[0699] The expression of the transgenes encoding the S protein and the Ssol polypeptide was assessed by Western blotting and immunofluorescence.

[0700] Monolayers of Vero cells in T-25 flasks were infected at a multiplicity of 0.05 by various passages of the two viruses MVSchw2-SARS-S and MVSchw2-SARS-Ssol and the wild-type virus MWSchw as a control. When the syncytia had reached 80 to 90% confluence, cytoplasmic extracts were prepared in an extraction buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.2, 1% Triton X-100, 0.1% SDS, 1% DOC) and then diluted in loading buffer according to Laemmli, separated on 8% SDS polyacrylamide gel and transferred onto a PVDF membrane (BioRad). The detection of this immunoblot (Western blot) was carried out with the aid of an anti-S rabbit polyclonal serum (immune serum of the rabbit P11135: cf. example 4 above) and donkey polyclonal antibodies directed against rabbit IgGs and coupled with peroxidase (NA934V, Amersham). The bound antibodies were visualized by luminescence with the aid of the ECL+ kit (Amersham) and Hyperfilm MP autoradiography films (Amersham).

[0701] Vero cells in monolayers on glass slides were infected with the two viruses MVSchw2-SARS-S and MVSchw2-SARS-Ssol and the wild-type virus MWSchw as a control at multiplicities of infection of 0.05. When the syncytia had reached 90 to 100% (MVSchw2-SARS-Ssol virus) or 30 to 40% (MVSchw2-SARS-S, MWSchw) confluence, the cells were fixed in a 4% PBS-PFA solution, permeabilized with a PBS solution containing 0.2% Triton and then labeled with rabbit polyclonal antibodies hyperimmunized with purified and inactivated SARS-CoV virions and with an anti-rabbit IgG(H+L) goat antibody conjugate coupled with FITC (Jackson).

[0702] As shown in FIGS. 41 and 42, the recombinant viruses MVSchw2-SARS-S and MVSchw2-SARS-Ssol direct the expression of the S protein and the Ssol polypeptide respectively at levels comparable to those which can be observed 8 h after infection with SARS-CoV. The expression of these polypeptides is stable after 3 passages of the recombinant viruses in cell culture. These results demonstrate that the recombinant measles viruses are indeed carriers of the transgenes and allow the expression of the SARS glycoprotein in its membrane form (S) or in a soluble form (Ssol). The Ssol polypeptide is expected to be secreted by cells infected with the MVSchw2-SARS-Ssol virus as is the case when this same polypeptide is expressed in mammalian cells after transient transfection of the corresponding sequences (cf. example 11 above).

4) Applications

[0703] Having shown that the viruses MVSchw2-SARS-S and MVSchw2-SARS-Ssol allow the expression of the SARS-CoV S, their capacity to induce a protective immune response against SARS-CoV in CD46.sup.+/- IFN- .alpha..beta.R.sup.-/- mice, which is sensitive to infection by MV, is evaluated. The antibody response of the immunized mice is evaluated by ELISA test against the native antigens of SARS-CoV and for their capacity to neutralize the infectivity of SARS-CoV in vitro, using the methodologies described above. The protective power of the response will be evaluated by measuring the reduction in the pulmonary viral load 2 days after a nonlethal challenge infection with SARS-CoV.

[0704] Second generation recombinant measles viruses are constructed by substituting the wild-type sequences of the S and Sol genes by synthetic genes optimized for expression in mammalian cells, described in example 15 above. These recombinant measles viruses are capable of expressing larger quantities of the S and Ssol antigens and therefore of exhibiting increased immunogenicity.

[0705] Alternatively, the wild-type or synthetic genes encoding the S protein or the Ssol polypeptide may be inserted into the measles vector MVSchw-ATU3 in the form of an additional transcription unit located between the H and L genes, and then the recombinant viruses produced and characterized in a similar manner. This insertion is capable of generating recombinant viruses possessing different characteristics (multiplication of the virus, level of expression of the transgene) and possibly an improved immunogenicity compared with those obtained after insertion of the transgenes between the P and N genes.

[0706] The recombinant measles virus MVSchw2-SARS-Ssol may be used for the quantitative production and the purification of the Ssol antigen for diagnostic and vaccine applications.

EXAMPLE 18

Other Applications Linked to the S Protein

[0707] a) The lentiviral vectors allowing the expression of S or Ssol (or even of fragments of S) can constitute a recombinant vaccine against SARS-CoV, to be used in human or veterinary prophylaxis. In order to demonstrate the feasibility of such a vaccine, the immunogenicity of the recombinant lentiviral vectors TRIP-SD/SA-S-WPRE and TRIP-SD/SA-Ssol-WPRE is studied in mice.

[0708] b) Monoclonal antibodies are produced with the aid of the recombinant Ssol polypeptide. According to the results presented in example 14 above, these antibodies or at least the majority of them will recognize the native form of the SARS-CoV S and will be capable of diagnostic and/or prophylactic applications.

[0709] c) A serological test for SARS is developed with the Ssol polypeptide used as antigen and the double epitope methodology.

Sequence CWU 1

1

158 1 29746 DNA CORONAVIRUS 1 atattaggtt tttacctacc caggaaaagc caaccaacct cgatctcttg tagatctgtt 60 ctctaaacga actttaaaat ctgtgtagct gtcgctcggc tgcatgccta gtgcacctac 120 gcagtataaa caataataaa ttttactgtc gttgacaaga aacgagtaac tcgtccctct 180 tctgcagact gcttacggtt tcgtccgtgt tgcagtcgat catcagcata cctaggtttc 240 gtccgggtgt gaccgaaagg taagatggag agccttgttc ttggtgtcaa cgagaaaaca 300 cacgtccaac tcagtttgcc tgtccttcag gttagagacg tgctagtgcg tggcttcggg 360 gactctgtgg aagaggccct atcggaggca cgtgaacacc tcaaaaatgg cacttgtggt 420 ctagtagagc tggaaaaagg cgtactgccc cagcttgaac agccctatgt gttcattaaa 480 cgttctgatg ccttaagcac caatcacggc cacaaggtcg ttgagctggt tgcagaaatg 540 gacggcattc agtacggtcg tagcggtata acactgggag tactcgtgcc acatgtgggc 600 gaaaccccaa ttgcataccg caatgttctt cttcgtaaga acggtaataa gggagccggt 660 ggtcatagct atggcatcga tctaaagtct tatgacttag gtgacgagct tggcactgat 720 cccattgaag attatgaaca aaactggaac actaagcatg gcagtggtgc actccgtgaa 780 ctcactcgtg agctcaatgg aggtgcagtc actcgctatg tcgacaacaa tttctgtggc 840 ccagatgggt accctcttga ttgcatcaaa gattttctcg cacgcgcggg caagtcaatg 900 tgcactcttt ccgaacaact tgattacatc gagtcgaaga gaggtgtcta ctgctgccgt 960 gaccatgagc atgaaattgc ctggttcact gagcgctctg ataagagcta cgagcaccag 1020 acacccttcg aaattaagag tgccaagaaa tttgacactt tcaaagggga atgcccaaag 1080 tttgtgtttc ctcttaactc aaaagtcaaa gtcattcaac cacgtgttga aaagaaaaag 1140 actgagggtt tcatggggcg tatacgctct gtgtaccctg ttgcatctcc acaggagtgt 1200 aacaatatgc acttgtctac cttgatgaaa tgtaatcatt gcgatgaagt ttcatggcag 1260 acgtgcgact ttctgaaagc cacttgtgaa cattgtggca ctgaaaattt agttattgaa 1320 ggacctacta catgtgggta cctacctact aatgctgtag tgaaaatgcc atgtcctgcc 1380 tgtcaagacc cagagattgg acctgagcat agtgttgcag attatcacaa ccactcaaac 1440 attgaaactc gactccgcaa gggaggtagg actagatgtt ttggaggctg tgtgtttgcc 1500 tatgttggct gctataataa gcgtgcctac tgggttcctc gtgctagtgc tgatattggc 1560 tcaggccata ctggcattac tggtgacaat gtggagacct tgaatgagga tctccttgag 1620 atactgagtc gtgaacgtgt taacattaac attgttggcg attttcattt gaatgaagag 1680 gttgccatca ttttggcatc tttctctgct tctacaagtg cctttattga cactataaag 1740 agtcttgatt acaagtcttt caaaaccatt gttgagtcct gcggtaacta taaagttacc 1800 aagggaaagc ccgtaaaagg tgcttggaac attggacaac agagatcagt tttaacacca 1860 ctgtgtggtt ttccctcaca ggctgctggt gttatcagat caatttttgc gcgcacactt 1920 gatgcagcaa accactcaat tcctgatttg caaagagcag ctgtcaccat acttgatggt 1980 atttctgaac agtcattacg tcttgtcgac gccatggttt atacttcaga cctgctcacc 2040 aacagtgtca ttattatggc atatgtaact ggtggtcttg tacaacagac ttctcagtgg 2100 ttgtctaatc ttttgggcac tactgttgaa aaactcaggc ctatctttga atggattgag 2160 gcgaaactta gtgcaggagt tgaatttctc aaggatgctt gggagattct caaatttctc 2220 attacaggtg tttttgacat cgtcaagggt caaatacagg ttgcttcaga taacatcaag 2280 gattgtgtaa aatgcttcat tgatgttgtt aacaaggcac tcgaaatgtg cattgatcaa 2340 gtcactatcg ctggcgcaaa gttgcgatca ctcaacttag gtgaagtctt catcgctcaa 2400 agcaagggac tttaccgtca gtgtatacgt ggcaaggagc agctgcaact actcatgcct 2460 cttaaggcac caaaagaagt aacctttctt gaaggtgatt cacatgacac agtacttacc 2520 tctgaggagg ttgttctcaa gaacggtgaa ctcgaagcac tcgagacgcc cgttgatagc 2580 ttcacaaatg gagctatcgt tggcacacca gtctgtgtaa atggcctcat gctcttagag 2640 attaaggaca aagaacaata ctgcgcattg tctcctggtt tactggctac aaacaatgtc 2700 tttcgcttaa aagggggtgc accaattaaa ggtgtaacct ttggagaaga tactgtttgg 2760 gaagttcaag gttacaagaa tgtgagaatc acatttgagc ttgatgaacg tgttgacaaa 2820 gtgcttaatg aaaagtgctc tgtctacact gttgaatccg gtaccgaagt tactgagttt 2880 gcatgtgttg tagcagaggc tgttgtgaag actttacaac cagtttctga tctccttacc 2940 aacatgggta ttgatcttga tgagtggagt gtagctacat tctacttatt tgatgatgct 3000 ggtgaagaaa acttttcatc acgtatgtat tgttcctttt accctccaga tgaggaagaa 3060 gaggacgatg cagagtgtga ggaagaagaa attgatgaaa cctgtgaaca tgagtacggt 3120 acagaggatg attatcaagg tctccctctg gaatttggtg cctcagctga aacagttcga 3180 gttgaggaag aagaagagga agactggctg gatgatacta ctgagcaatc agagattgag 3240 ccagaaccag aacctacacc tgaagaacca gttaatcagt ttactggtta tttaaaactt 3300 actgacaatg ttgccattaa atgtgttgac atcgttaagg aggcacaaag tgctaatcct 3360 atggtgattg taaatgctgc taacatacac ctgaaacatg gtggtggtgt agcaggtgca 3420 ctcaacaagg caaccaatgg tgccatgcaa aaggagagtg atgattacat taagctaaat 3480 ggccctctta cagtaggagg gtcttgtttg ctttctggac ataatcttgc taagaagtgt 3540 ctgcatgttg ttggacctaa cctaaatgca ggtgaggaca tccagcttct taaggcagca 3600 tatgaaaatt tcaattcaca ggacatctta cttgcaccat tgttgtcagc aggcatattt 3660 ggtgctaaac cacttcagtc tttacaagtg tgcgtgcaga cggttcgtac acaggtttat 3720 attgcagtca atgacaaagc tctttatgag caggttgtca tggattatct tgataacctg 3780 aagcctagag tggaagcacc taaacaagag gagccaccaa acacagaaga ttccaaaact 3840 gaggagaaat ctgtcgtaca gaagcctgtc gatgtgaagc caaaaattaa ggcctgcatt 3900 gatgaggtta ccacaacact ggaagaaact aagtttctta ccaataagtt actcttgttt 3960 gctgatatca atggtaagct ttaccatgat tctcagaaca tgcttagagg tgaagatatg 4020 tctttccttg agaaggatgc accttacatg gtaggtgatg ttatcactag tggtgatatc 4080 acttgtgttg taataccctc caaaaaggct ggtggcacta ctgagatgct ctcaagagct 4140 ttgaagaaag tgccagttga tgagtatata accacgtacc ctggacaagg atgtgctggt 4200 tatacacttg aggaagctaa gactgctctt aagaaatgca aatctgcatt ttatgtacta 4260 ccttcagaag cacctaatgc taaggaagag attctaggaa ctgtatcctg gaatttgaga 4320 gaaatgcttg ctcatgctga agagacaaga aaattaatgc ctatatgcat ggatgttaga 4380 gccataatgg caaccatcca acgtaagtat aaaggaatta aaattcaaga gggcatcgtt 4440 gactatggtg tccgattctt cttttatact agtaaagagc ctgtagcttc tattattacg 4500 aagctgaact ctctaaatga gccgcttgtc acaatgccaa ttggttatgt gacacatggt 4560 tttaatcttg aagaggctgc gcgctgtatg cgttctctta aagctcctgc cgtagtgtca 4620 gtatcatcac cagatgctgt tactacatat aatggatacc tcacttcgtc atcaaagaca 4680 tctgaggagc actttgtaga aacagtttct ttggctggct cttacagaga ttggtcctat 4740 tcaggacagc gtacagagtt aggtgttgaa tttcttaagc gtggtgacaa aattgtgtac 4800 cacactctgg agagccccgt cgagtttcat cttgacggtg aggttctttc acttgacaaa 4860 ctaaagagtc tcttatccct gcgggaggtt aagactataa aagtgttcac aactgtggac 4920 aacactaatc tccacacaca gcttgtggat atgtctatga catatggaca gcagtttggt 4980 ccaacatact tggatggtgc tgatgttaca aaaattaaac ctcatgtaaa tcatgagggt 5040 aagactttct ttgtactacc tagtgatgac acactacgta gtgaagcttt cgagtactac 5100 catactcttg atgagagttt tcttggtagg tacatgtctg ctttaaacca cacaaagaaa 5160 tggaaatttc ctcaagttgg tggtttaact tcaattaaat gggctgataa caattgttat 5220 ttgtctagtg ttttattagc acttcaacag cttgaagtca aattcaatgc accagcactt 5280 caagaggctt attatagagc ccgtgctggt gatgctgcta acttttgtgc actcatactc 5340 gcttacagta ataaaactgt tggcgagctt ggtgatgtca gagaaactat gacccatctt 5400 ctacagcatg ctaatttgga atctgcaaag cgagttctta atgtggtgtg taaacattgt 5460 ggtcagaaaa ctactacctt aacgggtgta gaagctgtga tgtatatggg tactctatct 5520 tatgataatc ttaagacagg tgtttccatt ccatgtgtgt gtggtcgtga tgctacacaa 5580 tatctagtac aacaagagtc ttcttttgtt atgatgtctg caccacctgc tgagtataaa 5640 ttacagcaag gtacattctt atgtgcgaat gagtacactg gtaactatca gtgtggtcat 5700 tacactcata taactgctaa ggagaccctc tatcgtattg acggagctca ccttacaaag 5760 atgtcagagt acaaaggacc agtgactgat gttttctaca aggaaacatc ttacactaca 5820 accatcaagc ctgtgtcgta taaactcgat ggagttactt acacagagat tgaaccaaaa 5880 ttggatgggt attataaaaa ggataatgct tactatacag agcagcctat agaccttgta 5940 ccaactcaac cattaccaaa tgcgagtttt gataatttca aactcacatg ttctaacaca 6000 aaatttgctg atgatttaaa tcaaatgaca ggcttcacaa agccagcttc acgagagcta 6060 tctgtcacat tcttcccaga cttgaatggc gatgtagtgg ctattgacta tagacactat 6120 tcagcgagtt tcaagaaagg tgctaaatta ctgcataagc caattgtttg gcacattaac 6180 caggctacaa ccaagacaac gttcaaacca aacacttggt gtttacgttg tctttggagt 6240 acaaagccag tagatacttc aaattcattt gaagttctgg cagtagaaga cacacaagga 6300 atggacaatc ttgcttgtga aagtcaacaa cccacctctg aagaagtagt ggaaaatcct 6360 accatacaga aggaagtcat agagtgtgac gtgaaaacta ccgaagttgt aggcaatgtc 6420 atacttaaac catcagatga aggtgttaaa gtaacacaag agttaggtca tgaggatctt 6480 atggctgctt atgtggaaaa cacaagcatt accattaaga aacctaatga gctttcacta 6540 gccttaggtt taaaaacaat tgccactcat ggtattgctg caattaatag tgttccttgg 6600 agtaaaattt tggcttatgt caaaccattc ttaggacaag cagcaattac aacatcaaat 6660 tgcgctaaga gattagcaca acgtgtgttt aacaattata tgccttatgt gtttacatta 6720 ttgttccaat tgtgtacttt tactaaaagt accaattcta gaattagagc ttcactacct 6780 acaactattg ctaaaaatag tgttaagagt gttgctaaat tatgtttgga tgccggcatt 6840 aattatgtga agtcacccaa attttctaaa ttgttcacaa tcgctatgtg gctattgttg 6900 ttaagtattt gcttaggttc tctaatctgt gtaactgctg cttttggtgt actcttatct 6960 aattttggtg ctccttctta ttgtaatggc gttagagaat tgtatcttaa ttcgtctaac 7020 gttactacta tggatttctg tgaaggttct tttccttgca gcatttgttt aagtggatta 7080 gactcccttg attcttatcc agctcttgaa accattcagg tgacgatttc atcgtacaag 7140 ctagacttga caattttagg tctggccgct gagtgggttt tggcatatat gttgttcaca 7200 aaattctttt atttattagg tctttcagct ataatgcagg tgttctttgg ctattttgct 7260 agtcatttca tcagcaattc ttggctcatg tggtttatca ttagtattgt acaaatggca 7320 cccgtttctg caatggttag gatgtacatc ttctttgctt ctttctacta catatggaag 7380 agctatgttc atatcatgga tggttgcacc tcttcgactt gcatgatgtg ctataagcgc 7440 aatcgtgcca cacgcgttga gtgtacaact attgttaatg gcatgaagag atctttctat 7500 gtctatgcaa atggaggccg tggcttctgc aagactcaca attggaattg tctcaattgt 7560 gacacatttt gcactggtag tacattcatt agtgatgaag ttgctcgtga tttgtcactc 7620 cagtttaaaa gaccaatcaa ccctactgac cagtcatcgt atattgttga tagtgttgct 7680 gtgaaaaatg gcgcgcttca cctctacttt gacaaggctg gtcaaaagac ctatgagaga 7740 catccgctct cccattttgt caatttagac aatttgagag ctaacaacac taaaggttca 7800 ctgcctatta atgtcatagt ttttgatggc aagtccaaat gcgacgagtc tgcttctaag 7860 tctgcttctg tgtactacag tcagctgatg tgccaaccta ttctgttgct tgaccaagct 7920 cttgtatcag acgttggaga tagtactgaa gtttccgtta agatgtttga tgcttatgtc 7980 gacacctttt cagcaacttt tagtgttcct atggaaaaac ttaaggcact tgttgctaca 8040 gctcacagcg agttagcaaa gggtgtagct ttagatggtg tcctttctac attcgtgtca 8100 gctgcccgac aaggtgttgt tgataccgat gttgacacaa aggatgttat tgaatgtctc 8160 aaactttcac atcactctga cttagaagtg acaggtgaca gttgtaacaa tttcatgctc 8220 acctataata aggttgaaaa catgacgccc agagatcttg gcgcatgtat tgactgtaat 8280 gcaaggcata tcaatgccca agtagcaaaa agtcacaatg tttcactcat ctggaatgta 8340 aaagactaca tgtctttatc tgaacagctg cgtaaacaaa ttcgtagtgc tgccaagaag 8400 aacaacatac cttttagact aacttgtgct acaactagac aggttgtcaa tgtcataact 8460 actaaaatct cactcaaggg tggtaagatt gttagtactt gttttaaact tatgcttaag 8520 gccacattat tgtgcgttct tgctgcattg gtttgttata tcgttatgcc agtacataca 8580 ttgtcaatcc atgatggtta cacaaatgaa atcattggtt acaaagccat tcaggatggt 8640 gtcactcgtg acatcatttc tactgatgat tgttttgcaa ataaacatgc tggttttgac 8700 gcatggttta gccagcgtgg tggttcatac aaaaatgaca aaagctgccc tgtagtagct 8760 gctatcatta caagagagat tggtttcata gtgcctggct taccgggtac tgtgctgaga 8820 gcaatcaatg gtgacttctt gcattttcta cctcgtgttt ttagtgctgt tggcaacatt 8880 tgctacacac cttccaaact cattgagtat agtgattttg ctacctctgc ttgcgttctt 8940 gctgctgagt gtacaatttt taaggatgct atgggcaaac ctgtgccata ttgttatgac 9000 actaatttgc tagagggttc tatttcttat agtgagcttc gtccagacac tcgttatgtg 9060 cttatggatg gttccatcat acagtttcct aacacttacc tggagggttc tgttagagta 9120 gtaacaactt ttgatgctga gtactgtaga catggtacat gcgaaaggtc agaagtaggt 9180 atttgcctat ctaccagtgg tagatgggtt cttaataatg agcattacag agctctatca 9240 ggagttttct gtggtgttga tgcgatgaat ctcatagcta acatctttac tcctcttgtg 9300 caacctgtgg gtgctttaga tgtgtctgct tcagtagtgg ctggtggtat tattgccata 9360 ttggtgactt gtgctgccta ctactttatg aaattcagac gtgtttttgg tgagtacaac 9420 catgttgttg ctgctaatgc acttttgttt ttgatgtctt tcactatact ctgtctggta 9480 ccagcttaca gctttctgcc gggagtctac tcagtctttt acttgtactt gacattctat 9540 ttcaccaatg atgtttcatt cttggctcac cttcaatggt ttgccatgtt ttctcctatt 9600 gtgccttttt ggataacagc aatctatgta ttctgtattt ctctgaagca ctgccattgg 9660 ttctttaaca actatcttag gaaaagagtc atgtttaatg gagttacatt tagtaccttc 9720 gaggaggctg ctttgtgtac ctttttgctc aacaaggaaa tgtacctaaa attgcgtagc 9780 gagacactgt tgccacttac acagtataac aggtatcttg ctctatataa caagtacaag 9840 tatttcagtg gagccttaga tactaccagc tatcgtgaag cagcttgctg ccacttagca 9900 aaggctctaa atgactttag caactcaggt gctgatgttc tctaccaacc accacagaca 9960 tcaatcactt ctgctgttct gcagagtggt tttaggaaaa tggcattccc gtcaggcaaa 10020 gttgaagggt gcatggtaca agtaacctgt ggaactacaa ctcttaatgg attgtggttg 10080 gatgacacag tatactgtcc aagacatgtc atttgcacag cagaagacat gcttaatcct 10140 aactatgaag atctgctcat tcgcaaatcc aaccatagct ttcttgttca ggctggcaat 10200 gttcaacttc gtgttattgg ccattctatg caaaattgtc tgcttaggct taaagttgat 10260 acttctaacc ctaagacacc caagtataaa tttgtccgta tccaacctgg tcaaacattt 10320 tcagttctag catgctacaa tggttcacca tctggtgttt atcagtgtgc catgagacct 10380 aatcatacca ttaaaggttc tttccttaat ggatcatgtg gtagtgttgg ttttaacatt 10440 gattatgatt gcgtgtcttt ctgctatatg catcatatgg agcttccaac aggagtacac 10500 gctggtactg acttagaagg taaattctat ggtccatttg ttgacagaca aactgcacag 10560 gctgcaggta cagacacaac cataacatta aatgttttgg catggctgta tgctgctgtt 10620 atcaatggtg ataggtggtt tcttaataga ttcaccacta ctttgaatga ctttaacctt 10680 gtggcaatga agtacaacta tgaacctttg acacaagatc atgttgacat attgggacct 10740 ctttctgctc aaacaggaat tgccgtctta gatatgtgtg ctgctttgaa agagctgctg 10800 cagaatggta tgaatggtcg tactatcctt ggtagcacta ttttagaaga tgagtttaca 10860 ccatttgatg ttgttagaca atgctctggt gttaccttcc aaggtaagtt caagaaaatt 10920 gttaagggca ctcatcattg gatgctttta actttcttga catcactatt gattcttgtt 10980 caaagtacac agtggtcact gtttttcttt gtttacgaga atgctttctt gccatttact 11040 cttggtatta tggcaattgc tgcatgtgct atgctgcttg ttaagcataa gcacgcattc 11100 ttgtgcttgt ttctgttacc ttctcttgca acagttgctt actttaatat ggtctacatg 11160 cctgctagct gggtgatgcg tatcatgaca tggcttgaat tggctgacac tagcttgtct 11220 ggttataggc ttaaggattg tgttatgtat gcttcagctt tagttttgct tattctcatg 11280 acagctcgca ctgtttatga tgatgctgct agacgtgttt ggacactgat gaatgtcatt 11340 acacttgttt acaaagtcta ctatggtaat gctttagatc aagctatttc catgtgggcc 11400 ttagttattt ctgtaacctc taactattct ggtgtcgtta cgactatcat gtttttagct 11460 agagctatag tgtttgtgtg tgttgagtat tacccattgt tatttattac tggcaacacc 11520 ttacagtgta tcatgcttgt ttattgtttc ttaggctatt gttgctgctg ctactttggc 11580 cttttctgtt tactcaaccg ttacttcagg cttactcttg gtgtttatga ctacttggtc 11640 tctacacaag aatttaggta tatgaactcc caggggcttt tgcctcctaa gagtagtatt 11700 gatgctttca agcttaacat taagttgttg ggtattggag gtaaaccatg tatcaaggtt 11760 gctactgtac agtctaaaat gtctgacgta aagtgcacat ctgtggtact gctctcggtt 11820 cttcaacaac ttagagtaga gtcatcttct aaattgtggg cacaatgtgt acaactccac 11880 aatgatattc ttcttgcaaa agacacaact gaagctttcg agaagatggt ttctcttttg 11940 tctgttttgc tatccatgca gggtgctgta gacattaata ggttgtgcga ggaaatgctc 12000 gataaccgtg ctactcttca ggctattgct tcagaattta gttctttacc atcatatgcc 12060 gcttatgcca ctgcccagga ggcctatgag caggctgtag ctaatggtga ttctgaagtc 12120 gttctcaaaa agttaaagaa atctttgaat gtggctaaat ctgagtttga ccgtgatgct 12180 gccatgcaac gcaagttgga aaagatggca gatcaggcta tgacccaaat gtacaaacag 12240 gcaagatctg aggacaagag ggcaaaagta actagtgcta tgcaaacaat gctcttcact 12300 atgcttagga agcttgataa tgatgcactt aacaacatta tcaacaatgc gcgtgatggt 12360 tgtgttccac tcaacatcat accattgact acagcagcca aactcatggt tgttgtccct 12420 gattatggta cctacaagaa cacttgtgat ggtaacacct ttacatatgc atctgcactc 12480 tgggaaatcc agcaagttgt tgatgcggat agcaagattg ttcaacttag tgaaattaac 12540 atggacaatt caccaaattt ggcttggcct cttattgtta cagctctaag agccaactca 12600 gctgttaaac tacagaataa tgaactgagt ccagtagcac tacgacagat gtcctgtgcg 12660 gctggtacca cacaaacagc ttgtactgat gacaatgcac ttgcctacta taacaattcg 12720 aagggaggta ggtttgtgct ggcattacta tcagaccacc aagatctcaa atgggctaga 12780 ttccctaaga gtgatggtac aggtacaatt tacacagaac tggaaccacc ttgtaggttt 12840 gttacagaca caccaaaagg gcctaaagtg aaatacttgt acttcatcaa aggcttaaac 12900 aacctaaata gaggtatggt gctgggcagt ttagctgcta cagtacgtct tcaggctgga 12960 aatgctacag aagtacctgc caattcaact gtgctttcct tctgtgcttt tgcagtagac 13020 cctgctaaag catataagga ttacctagca agtggaggac aaccaatcac caactgtgtg 13080 aagatgttgt gtacacacac tggtacagga caggcaatta ctgtaacacc agaagctaac 13140 atggaccaag agtcctttgg tggtgcttca tgttgtctgt attgtagatg ccacattgac 13200 catccaaatc ctaaaggatt ctgtgacttg aaaggtaagt acgtccaaat acctaccact 13260 tgtgctaatg acccagtggg ttttacactt agaaacacag tctgtaccgt ctgcggaatg 13320 tggaaaggtt atggctgtag ttgtgaccaa ctccgcgaac ccttgatgca gtctgcggat 13380 gcatcaacgt ttttaaacgg gtttgcggtg taagtgcagc ccgtcttaca ccgtgcggca 13440 caggcactag tactgatgtc gtctacaggg cttttgatat ttacaacgaa aaagttgctg 13500 gttttgcaaa gttcctaaaa actaattgct gtcgcttcca ggagaaggat gaggaaggca 13560 atttattaga ctcttacttt gtagttaaga ggcatactat gtctaactac caacatgaag 13620 agactattta taacttggtt aaagattgtc cagcggttgc tgtccatgac tttttcaagt 13680 ttagagtaga tggtgacatg gtaccacata tatcacgtca gcgtctaact aaatacacaa 13740 tggctgattt agtctatgct ctacgtcatt ttgatgaggg taattgtgat acattaaaag 13800 aaatactcgt cacatacaat tgctgtgatg atgattattt caataagaag gattggtatg 13860 acttcgtaga gaatcctgac atcttacgcg tatatgctaa cttaggtgag cgtgtacgcc 13920 aatcattatt aaagactgta caattctgcg atgctatgcg tgatgcaggc attgtaggcg 13980 tactgacatt agataatcag gatcttaatg ggaactggta cgatttcggt gatttcgtac 14040 aagtagcacc aggctgcgga gttcctattg tggattcata ttactcattg ctgatgccca 14100 tcctcacttt gactagggca ttggctgctg agtcccatat ggatgctgat ctcgcaaaac 14160 cacttattaa gtgggatttg ctgaaatatg attttacgga agagagactt tgtctcttcg 14220 accgttattt taaatattgg gaccagacat accatcccaa ttgtattaac tgtttggatg 14280 ataggtgtat ccttcattgt gcaaacttta atgtgttatt ttctactgtg tttccaccta 14340 caagttttgg accactagta agaaaaatat ttgtagatgg tgttcctttt gttgtttcaa 14400 ctggatacca ttttcgtgag ttaggagtcg tacataatca ggatgtaaac ttacatagct 14460 cgcgtctcag tttcaaggaa cttttagtgt atgctgctga tccagctatg catgcagctt 14520 ctggcaattt attgctagat aaacgcacta catgcttttc agtagctgca ctaacaaaca 14580 atgttgcttt tcaaactgtc aaacccggta attttaataa agacttttat gactttgctg 14640 tgtctaaagg tttctttaag gaaggaagtt ctgttgaact aaaacacttc ttctttgctc 14700 aggatggcaa cgctgctatc agtgattatg actattatcg ttataatctg ccaacaatgt 14760 gtgatatcag acaactccta ttcgtagttg aagttgttga taaatacttt gattgttacg 14820 atggtggctg tattaatgcc aaccaagtaa tcgttaacaa tctggataaa tcagctggtt 14880 tcccatttaa taaatggggt aaggctagac tttattatga ctcaatgagt tatgaggatc 14940 aagatgcact tttcgcgtat actaagcgta atgtcatccc tactataact caaatgaatc 15000 ttaagtatgc cattagtgca aagaatagag ctcgcaccgt

agctggtgtc tctatctgta 15060 gtactatgac aaatagacag tttcatcaga aattattgaa gtcaatagcc gccactagag 15120 gagctactgt ggtaattgga acaagcaagt tttacggtgg ctggcataat atgttaaaaa 15180 ctgtttacag tgatgtagaa actccacacc ttatgggttg ggattatcca aaatgtgaca 15240 gagccatgcc taacatgctt aggataatgg cctctcttgt tcttgctcgc aaacataaca 15300 cttgctgtaa cttatcacac cgtttctaca ggttagctaa cgagtgtgcg caagtattaa 15360 gtgagatggt catgtgtggc ggctcactat atgttaaacc aggtggaaca tcatccggtg 15420 atgctacaac tgcttatgct aatagtgtct ttaacatttg tcaagctgtt acagccaatg 15480 taaatgcact tctttcaact gatggtaata agatagctga caagtatgtc cgcaatctac 15540 aacacaggct ctatgagtgt ctctatagaa atagggatgt tgatcatgaa ttcgtggatg 15600 agttttacgc ttacctgcgt aaacatttct ccatgatgat tctttctgat gatgccgttg 15660 tgtgctataa cagtaactat gcggctcaag gtttagtagc tagcattaag aactttaagg 15720 cagttcttta ttatcaaaat aatgtgttca tgtctgaggc aaaatgttgg actgagactg 15780 accttactaa aggacctcac gaattttgct cacagcatac aatgctagtt aaacaaggag 15840 atgattacgt gtacctgcct tacccagatc catcaagaat attaggcgca ggctgttttg 15900 tcgatgatat tgtcaaaaca gatggtacac ttatgattga aaggttcgtg tcactggcta 15960 ttgatgctta cccacttaca aaacatccta atcaggagta tgctgatgtc tttcacttgt 16020 atttacaata cattagaaag ttacatgatg agcttactgg ccacatgttg gacatgtatt 16080 ccgtaatgct aactaatgat aacacctcac ggtactggga acctgagttt tatgaggcta 16140 tgtacacacc acatacagtc ttgcaggctg taggtgcttg tgtattgtgc aattcacaga 16200 cttcacttcg ttgcggtgcc tgtattagga gaccattcct atgttgcaag tgctgctatg 16260 accatgtcat ttcaacatca cacaaattag tgttgtctgt taatccctat gtttgcaatg 16320 ccccaggttg tgatgtcact gatgtgacac aactgtatct aggaggtatg agctattatt 16380 gcaagtcaca taagcctccc attagttttc cattatgtgc taatggtcag gtttttggtt 16440 tatacaaaaa cacatgtgta ggcagtgaca atgtcactga cttcaatgcg atagcaacat 16500 gtgattggac taatgctggc gattacatac ttgccaacac ttgtactgag agactcaagc 16560 ttttcgcagc agaaacgctc aaagccactg aggaaacatt taagctgtca tatggtattg 16620 ccactgtacg cgaagtactc tctgacagag aattgcatct ttcatgggag gttggaaaac 16680 ctagaccacc attgaacaga aactatgtct ttactggtta ccgtgtaact aaaaatagta 16740 aagtacagat tggagagtac acctttgaaa aaggtgacta tggtgatgct gttgtgtaca 16800 gaggtactac gacatacaag ttgaatgttg gtgattactt tgtgttgaca tctcacactg 16860 taatgccact tagtgcacct actctagtgc cacaagagca ctatgtgaga attactggct 16920 tgtacccaac actcaacatc tcagatgagt tttctagcaa tgttgcaaat tatcaaaagg 16980 tcggcatgca aaagtactct acactccaag gaccacctgg tactggtaag agtcattttg 17040 ccatcggact tgctctctat tacccatctg ctcgcatagt gtatacggca tgctctcatg 17100 cagctgttga tgccctatgt gaaaaggcat taaaatattt gcccatagat aaatgtagta 17160 gaatcatacc tgcgcgtgcg cgcgtagagt gttttgataa attcaaagtg aattcaacac 17220 tagaacagta tgttttctgc actgtaaatg cattgccaga aacaactgct gacattgtag 17280 tctttgatga aatctctatg gctactaatt atgacttgag tgttgtcaat gctagacttc 17340 gtgcaaaaca ctacgtctat attggcgatc ctgctcaatt accagccccc cgcacattgc 17400 tgactaaagg cacactagaa ccagaatatt ttaattcagt gtgcagactt atgaaaacaa 17460 taggtccaga catgttcctt ggaacttgtc gccgttgtcc tgctgaaatt gttgacactg 17520 tgagtgcttt agtttatgac aataagctaa aagcacacaa ggataagtca gctcaatgct 17580 tcaaaatgtt ctacaaaggt gttattacac atgatgtttc atctgcaatc aacagacctc 17640 aaataggcgt tgtaagagaa tttcttacac gcaatcctgc ttggagaaaa gctgttttta 17700 tctcacctta taattcacag aacgctgtag cttcaaaaat cttaggattg cctacgcaga 17760 ctgttgattc atcacagggt tctgaatatg actatgtcat attcacacaa actactgaaa 17820 cagcacactc ttgtaatgtc aaccgcttca atgtggctat cacaagggca aaaattggca 17880 ttttgtgcat aatgtctgat agagatcttt atgacaaact gcaatttaca agtctagaaa 17940 taccacgtcg caatgtggct acattacaag cagaaaatgt aactggactt tttaaggact 18000 gtagtaagat cattactggt cttcatccta cacaggcacc tacacacctc agcgttgata 18060 taaagttcaa gactgaagga ttatgtgttg acataccagg cataccaaag gacatgacct 18120 accgtagact catctctatg atgggtttca aaatgaatta ccaagtcaat ggttacccta 18180 atatgtttat cacccgcgaa gaagctattc gtcacgttcg tgcgtggatt ggctttgatg 18240 tagagggctg tcatgcaact agagatgctg tgggtactaa cctacctctc cagctaggat 18300 tttctacagg tgttaactta gtagctgtac cgactggtta tgttgacact gaaaataaca 18360 cagaattcac cagagttaat gcaaaacctc caccaggtga ccagtttaaa catcttatac 18420 cactcatgta taaaggcttg ccctggaatg tagtgcgtat taagatagta caaatgctca 18480 gtgatacact gaaaggattg tcagacagag tcgtgttcgt cctttgggcg catggctttg 18540 agcttacatc aatgaagtac tttgtcaaga ttggacctga aagaacgtgt tgtctgtgtg 18600 acaaacgtgc aacttgcttt tctacttcat cagatactta tgcctgctgg aatcattctg 18660 tgggttttga ctatgtctat aacccattta tgattgatgt tcagcagtgg ggctttacgg 18720 gtaaccttca gagtaaccat gaccaacatt gccaggtaca tggaaatgca catgtggcta 18780 gttgtgatgc tatcatgact agatgtttag cagtccatga gtgctttgtt aagcgcgttg 18840 attggtctgt tgaataccct attataggag atgaactgag ggttaattct gcttgcagaa 18900 aagtacaaca catggttgtg aagtctgcat tgcttgctga taagtttcca gttcttcatg 18960 acattggaaa tccaaaggct atcaagtgtg tgcctcaggc tgaagtagaa tggaagttct 19020 acgatgctca gccatgtagt gacaaagctt acaaaataga ggaactcttc tattcttatg 19080 ctacacatca cgataaattc actgatggtg tttgtttgtt ttggaattgt aacgttgatc 19140 gttacccagc caatgcaatt gtgtgtaggt ttgacacaag agtcttgtca aacttgaact 19200 taccaggctg tgatggtggt agtttgtatg tgaataagca tgcattccac actccagctt 19260 tcgataaaag tgcatttact aatttaaagc aattgccttt cttttactat tctgatagtc 19320 cttgtgagtc tcatggcaaa caagtagtgt cggatattga ttatgttcca ctcaaatctg 19380 ctacgtgtat tacacgatgc aatttaggtg gtgctgtttg cagacaccat gcaaatgagt 19440 accgacagta cttggatgca tataatatga tgatttctgc tggatttagc ctatggattt 19500 acaaacaatt tgatacttat aacctgtgga atacatttac caggttacag agtttagaaa 19560 atgtggctta taatgttgtt aataaaggac actttgatgg acacgccggc gaagcacctg 19620 tttccatcat taataatgct gtttacacaa aggtagatgg tattgatgtg gagatctttg 19680 aaaataagac aacacttcct gttaatgttg catttgagct ttgggctaag cgtaacatta 19740 aaccagtgcc agagattaag atactcaata atttgggtgt tgatatcgct gctaatactg 19800 taatctggga ctacaaaaga gaagccccag cacatgtatc tacaataggt gtctgcacaa 19860 tgactgacat tgccaagaaa cctactgaga gtgcttgttc ttcacttact gtcttgtttg 19920 atggtagagt ggaaggacag gtagaccttt ttagaaacgc ccgtaatggt gttttaataa 19980 cagaaggttc agtcaaaggt ctaacacctt caaagggacc agcacaagct agcgtcaatg 20040 gagtcacatt aattggagaa tcagtaaaaa cacagtttaa ctactttaag aaagtagacg 20100 gcattattca acagttgcct gaaacctact ttactcagag cagagactta gaggatttta 20160 agcccagatc acaaatggaa actgactttc tcgagctcgc tatggatgaa ttcatacagc 20220 gatataagct cgagggctat gccttcgaac acatcgttta tggagatttc agtcatggac 20280 aacttggcgg tcttcattta atgataggct tagccaagcg ctcacaagat tcaccactta 20340 aattagagga ttttatccct atggacagca cagtgaaaaa ttacttcata acagatgcgc 20400 aaacaggttc atcaaaatgt gtgtgttctg tgattgatct tttacttgat gactttgtcg 20460 agataataaa gtcacaagat ttgtcagtga tttcaaaagt ggtcaaggtt acaattgact 20520 atgctgaaat ttcattcatg ctttggtgta aggatggaca tgttgaaacc ttctacccaa 20580 aactacaagc aagtcaagcg tggcaaccag gtgttgcgat gcctaacttg tacaagatgc 20640 aaagaatgct tcttgaaaag tgtgaccttc agaattatgg tgaaaatgct gttataccaa 20700 aaggaataat gatgaatgtc gcaaagtata ctcaactgtg tcaatactta aatacactta 20760 ctttagctgt accctacaac atgagagtta ttcactttgg tgctggctct gataaaggag 20820 ttgcaccagg tacagctgtg ctcagacaat ggttgccaac tggcacacta cttgtcgatt 20880 cagatcttaa tgacttcgtc tccgacgcag attctacttt aattggagac tgtgcaacag 20940 tacatacggc taataaatgg gaccttatta ttagcgatat gtatgaccct aggaccaaac 21000 atgtgacaaa agagaatgac tctaaagaag ggtttttcac ttatctgtgt ggatttataa 21060 agcaaaaact agccctgggt ggttctatag ctgtaaagat aacagagcat tcttggaatg 21120 ctgaccttta caagcttatg ggccatttct catggtggac agcttttgtt acaaatgtaa 21180 atgcatcatc atcggaagca tttttaattg gggctaacta tcttggcaag ccgaaggaac 21240 aaattgatgg ctataccatg catgctaact acattttctg gaggaacaca aatcctatcc 21300 agttgtcttc ctattcactc tttgacatga gcaaatttcc tcttaaatta agaggaactg 21360 ctgtaatgtc tcttaaggag aatcaaatca atgatatgat ttattctctt ctggaaaaag 21420 gtaggcttat cattagagaa aacaacagag ttgtggtttc aagtgatatt cttgttaaca 21480 actaaacgaa catgtttatt ttcttattat ttcttactct cactagtggt agtgaccttg 21540 accggtgcac cacttttgat gatgttcaag ctcctaatta cactcaacat acttcatcta 21600 tgaggggggt ttactatcct gatgaaattt ttagatcaga cactctttat ttaactcagg 21660 atttatttct tccattttat tctaatgtta cagggtttca tactattaat catacgtttg 21720 gcaaccctgt catacctttt aaggatggta tttattttgc tgccacagag aaatcaaatg 21780 ttgtccgtgg ttgggttttt ggttctacca tgaacaacaa gtcacagtcg gtgattatta 21840 ttaacaattc tactaatgtt gttatacgag catgtaactt tgaattgtgt gacaaccctt 21900 tctttgctgt ttctaaaccc atgggtacac agacacatac tatgatattc gataatgcat 21960 ttaattgcac tttcgagtac atatctgatg ccttttcgct tgatgtttca gaaaagtcag 22020 gtaattttaa acacttacga gagtttgtgt ttaaaaataa agatgggttt ctctatgttt 22080 ataagggcta tcaacctata gatgtagttc gtgatctacc ttctggtttt aacactttga 22140 aacctatttt taagttgcct cttggtatta acattacaaa ttttagagcc attcttacag 22200 ccttttcacc tgctcaagac atttggggca cgtcagctgc agcctatttt gttggctatt 22260 taaagccaac tacatttatg ctcaagtatg atgaaaatgg tacaatcaca gatgctgttg 22320 attgttctca aaatccactt gctgaactca aatgctctgt taagagcttt gagattgaca 22380 aaggaattta ccagacctct aatttcaggg ttgttccctc aggagatgtt gtgagattcc 22440 ctaatattac aaacttgtgt ccttttggag aggtttttaa tgctactaaa ttcccttctg 22500 tctatgcatg ggagagaaaa aaaatttcta attgtgttgc tgattactct gtgctctaca 22560 actcaacatt tttttcaacc tttaagtgct atggcgtttc tgccactaag ttgaatgatc 22620 tttgcttctc caatgtctat gcagattctt ttgtagtcaa gggagatgat gtaagacaaa 22680 tagcgccagg acaaactggt gttattgctg attataatta taaattgcca gatgatttca 22740 tgggttgtgt ccttgcttgg aatactagga acattgatgc tacttcaact ggtaattata 22800 attataaata taggtatctt agacatggca agcttaggcc ctttgagaga gacatatcta 22860 atgtgccttt ctcccctgat ggcaaacctt gcaccccacc tgctcttaat tgttattggc 22920 cattaaatga ttatggtttt tacaccacta ctggcattgg ctaccaacct tacagagttg 22980 tagtactttc ttttgaactt ttaaatgcac cggccacggt ttgtggacca aaattatcca 23040 ctgaccttat taagaaccag tgtgtcaatt ttaattttaa tggactcact ggtactggtg 23100 tgttaactcc ttcttcaaag agatttcaac catttcaaca atttggccgt gatgtttctg 23160 atttcactga ttccgttcga gatcctaaaa catctgaaat attagacatt tcaccttgct 23220 cttttggggg tgtaagtgta attacacctg gaacaaatgc ttcatctgaa gttgctgttc 23280 tatatcaaga tgttaactgc actgatgttt ctacagcaat tcatgcagat caactcacac 23340 cagcttggcg catatattct actggaaaca atgtattcca gactcaagca ggctgtctta 23400 taggagctga gcatgtcgac acttcttatg agtgcgacat tcctattgga gctggcattt 23460 gtgctagtta ccatacagtt tctttattac gtagtactag ccaaaaatct attgtggctt 23520 atactatgtc tttaggtgct gatagttcaa ttgcttactc taataacacc attgctatac 23580 ctactaactt ttcaattagc attactacag aagtaatgcc tgtttctatg gctaaaacct 23640 ccgtagattg taatatgtac atctgcggag attctactga atgtgctaat ttgcttctcc 23700 aatatggtag cttttgcaca caactaaatc gtgcactctc aggtattgct gctgaacagg 23760 atcgcaacac acgtgaagtg ttcgctcaag tcaaacaaat gtacaaaacc ccaactttga 23820 aatattttgg tggttttaat ttttcacaaa tattacctga ccctctaaag ccaactaaga 23880 ggtcttttat tgaggacttg ctctttaata aggtgacact cgctgatgct ggcttcatga 23940 agcaatatgg cgaatgccta ggtgatatta atgctagaga tctcatttgt gcgcagaagt 24000 tcaatggact tacagtgttg ccacctctgc tcactgatga tatgattgct gcctacactg 24060 ctgctctagt tagtggtact gccactgctg gatggacatt tggtgctggc gctgctcttc 24120 aaataccttt tgctatgcaa atggcatata ggttcaatgg cattggagtt acccaaaatg 24180 ttctctatga gaaccaaaaa caaatcgcca accaatttaa caaggcgatt agtcaaattc 24240 aagaatcact tacaacaaca tcaactgcat tgggcaagct gcaagacgtt gttaaccaga 24300 atgctcaagc attaaacaca cttgttaaac aacttagctc taattttggt gcaatttcaa 24360 gtgtgctaaa tgatatcctt tcgcgacttg ataaagtcga ggcggaggta caaattgaca 24420 ggttaattac aggcagactt caaagccttc aaacctatgt aacacaacaa ctaatcaggg 24480 ctgctgaaat cagggcttct gctaatcttg ctgctactaa aatgtctgag tgtgttcttg 24540 gacaatcaaa aagagttgac ttttgtggaa agggctacca ccttatgtcc ttcccacaag 24600 cagccccgca tggtgttgtc ttcctacatg tcacgtatgt gccatcccag gagaggaact 24660 tcaccacagc gccagcaatt tgtcatgaag gcaaagcata cttccctcgt gaaggtgttt 24720 ttgtgtttaa tggcacttct tggtttatta cacagaggaa cttcttttct ccacaaataa 24780 ttactacaga caatacattt gtctcaggaa attgtgatgt cgttattggc atcattaaca 24840 acacagttta tgatcctctg caacctgagc ttgactcatt caaagaagag ctggacaagt 24900 acttcaaaaa tcatacatca ccagatgttg atcttggcga catttcaggc attaacgctt 24960 ctgtcgtcaa cattcaaaaa gaaattgacc gcctcaatga ggtcgctaaa aatttaaatg 25020 aatcactcat tgaccttcaa gaattgggaa aatatgagca atatattaaa tggccttggt 25080 atgtttggct cggcttcatt gctggactaa ttgccatcgt catggttaca atcttgcttt 25140 gttgcatgac tagttgttgc agttgcctca agggtgcatg ctcttgtggt tcttgctgca 25200 agtttgatga ggatgactct gagccagttc tcaagggtgt caaattacat tacacataaa 25260 cgaacttatg gatttgttta tgagattttt tactcttgga tcaattactg cacagccagt 25320 aaaaattgac aatgcttctc ctgcaagtac tgttcatgct acagcaacga taccgctaca 25380 agcctcactc cctttcggat ggcttgttat tggcgttgca tttcttgctg tttttcagag 25440 cgctaccaaa ataattgcgc tcaataaaag atggcagcta gccctttata agggcttcca 25500 gttcatttgc aatttactgc tgctatttgt taccatctat tcacatcttt tgcttgtcgc 25560 tgcaggtatg gaggcgcaat ttttgtacct ctatgccttg atatattttc tacaatgcat 25620 caacgcatgt agaattatta tgagatgttg gctttgttgg aagtgcaaat ccaagaaccc 25680 attactttat gatgccaact actttgtttg ctggcacaca cataactatg actactgtat 25740 accatataac agtgtcacag atacaattgt cgttactgaa ggtgacggca tttcaacacc 25800 aaaactcaaa gaagactacc aaattggtgg ttattctgag gataggcact caggtgttaa 25860 agactatgtc gttgtacatg gctatttcac cgaagtttac taccagcttg agtctacaca 25920 aattactaca gacactggta ttgaaaatgc tacattcttc atctttaaca agcttgttaa 25980 agacccaccg aatgtgcaaa tacacacaat cgacggctct tcaggagttg ctaatccagc 26040 aatggatcca atttatgatg agccgacgac gactactagc gtgcctttgt aagcacaaga 26100 aagtgagtac gaacttatgt actcattcgt ttcggaagaa acaggtacgt taatagttaa 26160 tagcgtactt ctttttcttg ctttcgtggt attcttgcta gtcacactag ccatccttac 26220 tgcgcttcga ttgtgtgcgt actgctgcaa tattgttaac gtgagtttag taaaaccaac 26280 ggtttacgtc tactcgcgtg ttaaaaatct gaactcttct gaaggagttc ctgatcttct 26340 ggtctaaacg aactaactat tattattatt ctgtttggaa ctttaacatt gcttatcatg 26400 gcagacaacg gtactattac cgttgaggag cttaaacaac tcctggaaca atggaaccta 26460 gtaataggtt tcctattcct agcctggatt atgttactac aatttgccta ttctaatcgg 26520 aacaggtttt tgtacataat aaagcttgtt ttcctctggc tcttgtggcc agtaacactt 26580 gcttgttttg tgcttgctgc tgtctacaga attaattggg tgactggcgg gattgcgatt 26640 gcaatggctt gtattgtagg cttgatgtgg cttagctact tcgttgcttc cttcaggctg 26700 tttgctcgta cccgctcaat gtggtcattc aacccagaaa caaacattct tctcaatgtg 26760 cctctccggg ggacaattgt gaccagaccg ctcatggaaa gtgaacttgt cattggtgct 26820 gtgatcattc gtggtcactt gcgaatggcc ggacactccc tagggcgctg tgacattaag 26880 gacctgccaa aagagatcac tgtggctaca tcacgaacgc tttcttatta caaattagga 26940 gcgtcgcagc gtgtaggcac tgattcaggt tttgctgcat acaaccgcta ccgtattgga 27000 aactataaat taaatacaga ccacgccggt agcaacgaca atattgcttt gctagtacag 27060 taagtgacaa cagatgtttc atcttgttga cttccaggtt acaatagcag agatattgat 27120 tatcattatg aggactttca ggattgctat ttggaatctt gacgttataa taagttcaat 27180 agtgagacaa ttatttaagc ctctaactaa gaagaattat tcggagttag atgatgaaga 27240 acctatggag ttagattatc cataaaacga acatgaaaat tattctcttc ctgacattga 27300 ttgtatttac atcttgcgag ctatatcact atcaggagtg tgttagaggt acgactgtac 27360 tactaaaaga accttgccca tcaggaacat acgagggcaa ttcaccattt caccctcttg 27420 ctgacaataa atttgcacta acttgcacta gcacacactt tgcttttgct tgtgctgacg 27480 gtactcgaca tacctatcag ctgcgtgcaa gatcagtttc accaaaactt ttcatcagac 27540 aagaggaggt tcaacaagag ctctactcgc cactttttct cattgttgct gctctagtat 27600 ttttaatact ttgcttcacc attaagagaa agacagaatg aatgagctca ctttaattga 27660 cttctatttg tgctttttag cctttctgct attccttgtt ttaataatgc ttattatatt 27720 ttggttttca ctcgaaatcc aggatctaga agaaccttgt accaaagtct aaacgaacat 27780 gaaacttctc attgttttga cttgtatttc tctatgcagt tgcatatgca ctgtagtaca 27840 gcgctgtgca tctaataaac ctcatgtgct tgaagatcct tgtaaggtac aacactaggg 27900 gtaatactta tagcactgct tggctttgtg ctctaggaaa ggttttacct tttcatagat 27960 ggcacactat ggttcaaaca tgcacaccta atgttactat caactgtcaa gatccagctg 28020 gtggtgcgct tatagctagg tgttggtacc ttcatgaagg tcaccaaact gctgcattta 28080 gagacgtact tgttgtttta aataaacgaa caaattaaaa tgtctgataa tggaccccaa 28140 tcaaaccaac gtagtgcccc ccgcattaca tttggtggac ccacagattc aactgacaat 28200 aaccagaatg gaggacgcaa tggggcaagg ccaaaacagc gccgacccca aggtttaccc 28260 aataatactg cgtcttggtt cacagctctc actcagcatg gcaaggagga acttagattc 28320 cctcgaggcc agggcgttcc aatcaacacc aatagtggtc cagatgacca aattggctac 28380 taccgaagag ctacccgacg agttcgtggt ggtgacggca aaatgaaaga gctcagcccc 28440 agatggtact tctattacct aggaactggc ccagaagctt cacttcccta cggcgctaac 28500 aaagaaggca tcgtatgggt tgcaactgag ggagccttga atacacccaa agaccacatt 28560 ggcacccgca atcctaataa caatgctgcc accgtgctac aacttcctca aggaacaaca 28620 ttgccaaaag gcttctacgc agagggaagc agaggcggca gtcaagcctc ttctcgctcc 28680 tcatcacgta gtcgcggtaa ttcaagaaat tcaactcctg gcagcagtag gggaaattct 28740 cctgctcgaa tggctagcgg aggtggtgaa actgccctcg cgctattgct gctagacaga 28800 ttgaaccagc ttgagagcaa agtttctggt aaaggccaac aacaacaagg ccaaactgtc 28860 actaagaaat ctgctgctga ggcatctaaa aagcctcgcc aaaaacgtac tgccacaaaa 28920 cagtacaacg tcactcaagc atttgggaga cgtggtccag aacaaaccca aggaaatttc 28980 ggggaccaag acctaatcag acaaggaact gattacaaac attggccgca aattgcacaa 29040 tttgctccaa gtgcctctgc attctttgga atgtcacgca ttggcatgga agtcacacct 29100 tcgggaacat ggctgactta tcatggagcc attaaattgg atgacaaaga tccacaattc 29160 aaagacaacg tcatactgct gaacaagcac attgacgcat acaaaacatt cccaccaaca 29220 gagcctaaaa aggacaaaaa gaaaaagact gatgaagctc agcctttgcc gcagagacaa 29280 aagaagcagc ccactgtgac tcttcttcct gcggctgaca tggatgattt ctccagacaa 29340 cttcaaaatt ccatgagtgg agcttctgct gattcaactc aggcataaac actcatgatg 29400 accacacaag gcagatgggc tatgtaaacg ttttcgcaat tccgtttacg atacatagtc 29460 tactcttgtg cagaatgaat tctcgtaact aaacagcaca agtaggttta gttaacttta 29520 atctcacata gcaatcttta atcaatgtgt aacattaggg aggacttgaa agagccacca 29580 cattttcatc gaggccacgc ggagtacgat cgagggtaca gtgaataatg ctagggagag 29640 ctgcctatat ggaagagccc taatgtgtaa aattaatttt agtagtgcta tccccatgtg 29700 attttaatag cttcttagga gaatgacaaa aaaaaaaaaa aaaaaa 29746 2 3945 DNA CORONAVIRUS CDS (89)..(3853) 2 ttctcttctg gaaaaaggta ggcttatcat tagagaaaac aacagagttg tggtttcaag 60 tgatattctt gttaacaact aaacgaac atg ttt att ttc tta tta ttt ctt 112 Met Phe Ile Phe Leu Leu Phe Leu 1 5 act ctc act agt ggt agt gac ctt gac cgg tgc acc act ttt gat gat 160 Thr Leu Thr Ser Gly Ser Asp Leu Asp

Arg Cys Thr Thr Phe Asp Asp 10 15 20 gtt caa gct cct aat tac act caa cat act tca tct atg agg ggg gtt 208 Val Gln Ala Pro Asn Tyr Thr Gln His Thr Ser Ser Met Arg Gly Val 25 30 35 40 tac tat cct gat gaa att ttt aga tca gac act ctt tat tta act cag 256 Tyr Tyr Pro Asp Glu Ile Phe Arg Ser Asp Thr Leu Tyr Leu Thr Gln 45 50 55 gat tta ttt ctt cca ttt tat tct aat gtt aca ggg ttt cat act att 304 Asp Leu Phe Leu Pro Phe Tyr Ser Asn Val Thr Gly Phe His Thr Ile 60 65 70 aat cat acg ttt ggc aac cct gtc ata cct ttt aag gat ggt att tat 352 Asn His Thr Phe Gly Asn Pro Val Ile Pro Phe Lys Asp Gly Ile Tyr 75 80 85 ttt gct gcc aca gag aaa tca aat gtt gtc cgt ggt tgg gtt ttt ggt 400 Phe Ala Ala Thr Glu Lys Ser Asn Val Val Arg Gly Trp Val Phe Gly 90 95 100 tct acc atg aac aac aag tca cag tcg gtg att att att aac aat tct 448 Ser Thr Met Asn Asn Lys Ser Gln Ser Val Ile Ile Ile Asn Asn Ser 105 110 115 120 act aat gtt gtt ata cga gca tgt aac ttt gaa ttg tgt gac aac cct 496 Thr Asn Val Val Ile Arg Ala Cys Asn Phe Glu Leu Cys Asp Asn Pro 125 130 135 ttc ttt gct gtt tct aaa ccc atg ggt aca cag aca cat act atg ata 544 Phe Phe Ala Val Ser Lys Pro Met Gly Thr Gln Thr His Thr Met Ile 140 145 150 ttc gat aat gca ttt aat tgc act ttc gag tac ata tct gat gcc ttt 592 Phe Asp Asn Ala Phe Asn Cys Thr Phe Glu Tyr Ile Ser Asp Ala Phe 155 160 165 tcg ctt gat gtt tca gaa aag tca ggt aat ttt aaa cac tta cga gag 640 Ser Leu Asp Val Ser Glu Lys Ser Gly Asn Phe Lys His Leu Arg Glu 170 175 180 ttt gtg ttt aaa aat aaa gat ggg ttt ctc tat gtt tat aag ggc tat 688 Phe Val Phe Lys Asn Lys Asp Gly Phe Leu Tyr Val Tyr Lys Gly Tyr 185 190 195 200 caa cct ata gat gta gtt cgt gat cta cct tct ggt ttt aac act ttg 736 Gln Pro Ile Asp Val Val Arg Asp Leu Pro Ser Gly Phe Asn Thr Leu 205 210 215 aaa cct att ttt aag ttg cct ctt ggt att aac att aca aat ttt aga 784 Lys Pro Ile Phe Lys Leu Pro Leu Gly Ile Asn Ile Thr Asn Phe Arg 220 225 230 gcc att ctt aca gcc ttt tca cct gct caa gac att tgg ggc acg tca 832 Ala Ile Leu Thr Ala Phe Ser Pro Ala Gln Asp Ile Trp Gly Thr Ser 235 240 245 gct gca gcc tat ttt gtt ggc tat tta aag cca act aca ttt atg ctc 880 Ala Ala Ala Tyr Phe Val Gly Tyr Leu Lys Pro Thr Thr Phe Met Leu 250 255 260 aag tat gat gaa aat ggt aca atc aca gat gct gtt gat tgt tct caa 928 Lys Tyr Asp Glu Asn Gly Thr Ile Thr Asp Ala Val Asp Cys Ser Gln 265 270 275 280 aat cca ctt gct gaa ctc aaa tgc tct gtt aag agc ttt gag att gac 976 Asn Pro Leu Ala Glu Leu Lys Cys Ser Val Lys Ser Phe Glu Ile Asp 285 290 295 aaa gga att tac cag acc tct aat ttc agg gtt gtt ccc tca gga gat 1024 Lys Gly Ile Tyr Gln Thr Ser Asn Phe Arg Val Val Pro Ser Gly Asp 300 305 310 gtt gtg aga ttc cct aat att aca aac ttg tgt cct ttt gga gag gtt 1072 Val Val Arg Phe Pro Asn Ile Thr Asn Leu Cys Pro Phe Gly Glu Val 315 320 325 ttt aat gct act aaa ttc cct tct gtc tat gca tgg gag aga aaa aaa 1120 Phe Asn Ala Thr Lys Phe Pro Ser Val Tyr Ala Trp Glu Arg Lys Lys 330 335 340 att tct aat tgt gtt gct gat tac tct gtg ctc tac aac tca aca ttt 1168 Ile Ser Asn Cys Val Ala Asp Tyr Ser Val Leu Tyr Asn Ser Thr Phe 345 350 355 360 ttt tca acc ttt aag tgc tat ggc gtt tct gcc act aag ttg aat gat 1216 Phe Ser Thr Phe Lys Cys Tyr Gly Val Ser Ala Thr Lys Leu Asn Asp 365 370 375 ctt tgc ttc tcc aat gtc tat gca gat tct ttt gta gtc aag gga gat 1264 Leu Cys Phe Ser Asn Val Tyr Ala Asp Ser Phe Val Val Lys Gly Asp 380 385 390 gat gta aga caa ata gcg cca gga caa act ggt gtt att gct gat tat 1312 Asp Val Arg Gln Ile Ala Pro Gly Gln Thr Gly Val Ile Ala Asp Tyr 395 400 405 aat tat aaa ttg cca gat gat ttc atg ggt tgt gtc ctt gct tgg aat 1360 Asn Tyr Lys Leu Pro Asp Asp Phe Met Gly Cys Val Leu Ala Trp Asn 410 415 420 act agg aac att gat gct act tca act ggt aat tat aat tat aaa tat 1408 Thr Arg Asn Ile Asp Ala Thr Ser Thr Gly Asn Tyr Asn Tyr Lys Tyr 425 430 435 440 agg tat ctt aga cat ggc aag ctt agg ccc ttt gag aga gac ata tct 1456 Arg Tyr Leu Arg His Gly Lys Leu Arg Pro Phe Glu Arg Asp Ile Ser 445 450 455 aat gtg cct ttc tcc cct gat ggc aaa cct tgc acc cca cct gct ctt 1504 Asn Val Pro Phe Ser Pro Asp Gly Lys Pro Cys Thr Pro Pro Ala Leu 460 465 470 aat tgt tat tgg cca tta aat gat tat ggt ttt tac acc act act ggc 1552 Asn Cys Tyr Trp Pro Leu Asn Asp Tyr Gly Phe Tyr Thr Thr Thr Gly 475 480 485 att ggc tac caa cct tac aga gtt gta gta ctt tct ttt gaa ctt tta 1600 Ile Gly Tyr Gln Pro Tyr Arg Val Val Val Leu Ser Phe Glu Leu Leu 490 495 500 aat gca ccg gcc acg gtt tgt gga cca aaa tta tcc act gac ctt att 1648 Asn Ala Pro Ala Thr Val Cys Gly Pro Lys Leu Ser Thr Asp Leu Ile 505 510 515 520 aag aac cag tgt gtc aat ttt aat ttt aat gga ctc act ggt act ggt 1696 Lys Asn Gln Cys Val Asn Phe Asn Phe Asn Gly Leu Thr Gly Thr Gly 525 530 535 gtg tta act cct tct tca aag aga ttt caa cca ttt caa caa ttt ggc 1744 Val Leu Thr Pro Ser Ser Lys Arg Phe Gln Pro Phe Gln Gln Phe Gly 540 545 550 cgt gat gtt tct gat ttc act gat tcc gtt cga gat cct aaa aca tct 1792 Arg Asp Val Ser Asp Phe Thr Asp Ser Val Arg Asp Pro Lys Thr Ser 555 560 565 gaa ata tta gac att tca cct tgc tct ttt ggg ggt gta agt gta att 1840 Glu Ile Leu Asp Ile Ser Pro Cys Ser Phe Gly Gly Val Ser Val Ile 570 575 580 aca cct gga aca aat gct tca tct gaa gtt gct gtt cta tat caa gat 1888 Thr Pro Gly Thr Asn Ala Ser Ser Glu Val Ala Val Leu Tyr Gln Asp 585 590 595 600 gtt aac tgc act gat gtt tct aca gca att cat gca gat caa ctc aca 1936 Val Asn Cys Thr Asp Val Ser Thr Ala Ile His Ala Asp Gln Leu Thr 605 610 615 cca gct tgg cgc ata tat tct act gga aac aat gta ttc cag act caa 1984 Pro Ala Trp Arg Ile Tyr Ser Thr Gly Asn Asn Val Phe Gln Thr Gln 620 625 630 gca ggc tgt ctt ata gga gct gag cat gtc gac act tct tat gag tgc 2032 Ala Gly Cys Leu Ile Gly Ala Glu His Val Asp Thr Ser Tyr Glu Cys 635 640 645 gac att cct att gga gct ggc att tgt gct agt tac cat aca gtt tct 2080 Asp Ile Pro Ile Gly Ala Gly Ile Cys Ala Ser Tyr His Thr Val Ser 650 655 660 tta tta cgt agt act agc caa aaa tct att gtg gct tat act atg tct 2128 Leu Leu Arg Ser Thr Ser Gln Lys Ser Ile Val Ala Tyr Thr Met Ser 665 670 675 680 tta ggt gct gat agt tca att gct tac tct aat aac acc att gct ata 2176 Leu Gly Ala Asp Ser Ser Ile Ala Tyr Ser Asn Asn Thr Ile Ala Ile 685 690 695 cct act aac ttt tca att agc att act aca gaa gta atg cct gtt tct 2224 Pro Thr Asn Phe Ser Ile Ser Ile Thr Thr Glu Val Met Pro Val Ser 700 705 710 atg gct aaa acc tcc gta gat tgt aat atg tac atc tgc gga gat tct 2272 Met Ala Lys Thr Ser Val Asp Cys Asn Met Tyr Ile Cys Gly Asp Ser 715 720 725 act gaa tgt gct aat ttg ctt ctc caa tat ggt agc ttt tgc aca caa 2320 Thr Glu Cys Ala Asn Leu Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln 730 735 740 cta aat cgt gca ctc tca ggt att gct gct gaa cag gat cgc aac aca 2368 Leu Asn Arg Ala Leu Ser Gly Ile Ala Ala Glu Gln Asp Arg Asn Thr 745 750 755 760 cgt gaa gtg ttc gct caa gtc aaa caa atg tac aaa acc cca act ttg 2416 Arg Glu Val Phe Ala Gln Val Lys Gln Met Tyr Lys Thr Pro Thr Leu 765 770 775 aaa tat ttt ggt ggt ttt aat ttt tca caa ata tta cct gac cct cta 2464 Lys Tyr Phe Gly Gly Phe Asn Phe Ser Gln Ile Leu Pro Asp Pro Leu 780 785 790 aag cca act aag agg tct ttt att gag gac ttg ctc ttt aat aag gtg 2512 Lys Pro Thr Lys Arg Ser Phe Ile Glu Asp Leu Leu Phe Asn Lys Val 795 800 805 aca ctc gct gat gct ggc ttc atg aag caa tat ggc gaa tgc cta ggt 2560 Thr Leu Ala Asp Ala Gly Phe Met Lys Gln Tyr Gly Glu Cys Leu Gly 810 815 820 gat att aat gct aga gat ctc att tgt gcg cag aag ttc aat gga ctt 2608 Asp Ile Asn Ala Arg Asp Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu 825 830 835 840 aca gtg ttg cca cct ctg ctc act gat gat atg att gct gcc tac act 2656 Thr Val Leu Pro Pro Leu Leu Thr Asp Asp Met Ile Ala Ala Tyr Thr 845 850 855 gct gct cta gtt agt ggt act gcc act gct gga tgg aca ttt ggt gct 2704 Ala Ala Leu Val Ser Gly Thr Ala Thr Ala Gly Trp Thr Phe Gly Ala 860 865 870 ggc gct gct ctt caa ata cct ttt gct atg caa atg gca tat agg ttc 2752 Gly Ala Ala Leu Gln Ile Pro Phe Ala Met Gln Met Ala Tyr Arg Phe 875 880 885 aat ggc att gga gtt acc caa aat gtt ctc tat gag aac caa aaa caa 2800 Asn Gly Ile Gly Val Thr Gln Asn Val Leu Tyr Glu Asn Gln Lys Gln 890 895 900 atc gcc aac caa ttt aac aag gcg att agt caa att caa gaa tca ctt 2848 Ile Ala Asn Gln Phe Asn Lys Ala Ile Ser Gln Ile Gln Glu Ser Leu 905 910 915 920 aca aca aca tca act gca ttg ggc aag ctg caa gac gtt gtt aac cag 2896 Thr Thr Thr Ser Thr Ala Leu Gly Lys Leu Gln Asp Val Val Asn Gln 925 930 935 aat gct caa gca tta aac aca ctt gtt aaa caa ctt agc tct aat ttt 2944 Asn Ala Gln Ala Leu Asn Thr Leu Val Lys Gln Leu Ser Ser Asn Phe 940 945 950 ggt gca att tca agt gtg cta aat gat atc ctt tcg cga ctt gat aaa 2992 Gly Ala Ile Ser Ser Val Leu Asn Asp Ile Leu Ser Arg Leu Asp Lys 955 960 965 gtc gag gcg gag gta caa att gac agg tta att aca ggc aga ctt caa 3040 Val Glu Ala Glu Val Gln Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln 970 975 980 agc ctt caa acc tat gta aca caa caa cta atc agg gct gct gaa atc 3088 Ser Leu Gln Thr Tyr Val Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile 985 990 995 1000 agg gct tct gct aat ctt gct gct act aaa atg tct gag tgt gtt 3133 Arg Ala Ser Ala Asn Leu Ala Ala Thr Lys Met Ser Glu Cys Val 1005 1010 1015 ctt gga caa tca aaa aga gtt gac ttt tgt gga aag ggc tac cac 3178 Leu Gly Gln Ser Lys Arg Val Asp Phe Cys Gly Lys Gly Tyr His 1020 1025 1030 ctt atg tcc ttc cca caa gca gcc ccg cat ggt gtt gtc ttc cta 3223 Leu Met Ser Phe Pro Gln Ala Ala Pro His Gly Val Val Phe Leu 1035 1040 1045 cat gtc acg tat gtg cca tcc cag gag agg aac ttc acc aca gcg 3268 His Val Thr Tyr Val Pro Ser Gln Glu Arg Asn Phe Thr Thr Ala 1050 1055 1060 cca gca att tgt cat gaa ggc aaa gca tac ttc cct cgt gaa ggt 3313 Pro Ala Ile Cys His Glu Gly Lys Ala Tyr Phe Pro Arg Glu Gly 1065 1070 1075 gtt ttt gtg ttt aat ggc act tct tgg ttt att aca cag agg aac 3358 Val Phe Val Phe Asn Gly Thr Ser Trp Phe Ile Thr Gln Arg Asn 1080 1085 1090 ttc ttt tct cca caa ata att act aca gac aat aca ttt gtc tca 3403 Phe Phe Ser Pro Gln Ile Ile Thr Thr Asp Asn Thr Phe Val Ser 1095 1100 1105 gga aat tgt gat gtc gtt att ggc atc att aac aac aca gtt tat 3448 Gly Asn Cys Asp Val Val Ile Gly Ile Ile Asn Asn Thr Val Tyr 1110 1115 1120 gat cct ctg caa cct gag ctt gac tca ttc aaa gaa gag ctg gac 3493 Asp Pro Leu Gln Pro Glu Leu Asp Ser Phe Lys Glu Glu Leu Asp 1125 1130 1135 aag tac ttc aaa aat cat aca tca cca gat gtt gat ctt ggc gac 3538 Lys Tyr Phe Lys Asn His Thr Ser Pro Asp Val Asp Leu Gly Asp 1140 1145 1150 att tca ggc att aac gct tct gtc gtc aac att caa aaa gaa att 3583 Ile Ser Gly Ile Asn Ala Ser Val Val Asn Ile Gln Lys Glu Ile 1155 1160 1165 gac cgc ctc aat gag gtc gct aaa aat tta aat gaa tca ctc att 3628 Asp Arg Leu Asn Glu Val Ala Lys Asn Leu Asn Glu Ser Leu Ile 1170 1175 1180 gac ctt caa gaa ttg gga aaa tat gag caa tat att aaa tgg cct 3673 Asp Leu Gln Glu Leu Gly Lys Tyr Glu Gln Tyr Ile Lys Trp Pro 1185 1190 1195 tgg tat gtt tgg ctc ggc ttc att gct gga cta att gcc atc gtc 3718 Trp Tyr Val Trp Leu Gly Phe Ile Ala Gly Leu Ile Ala Ile Val 1200 1205 1210 atg gtt aca atc ttg ctt tgt tgc atg act agt tgt tgc agt tgc 3763 Met Val Thr Ile Leu Leu Cys Cys Met Thr Ser Cys Cys Ser Cys 1215 1220 1225 ctc aag ggt gca tgc tct tgt ggt tct tgc tgc aag ttt gat gag 3808 Leu Lys Gly Ala Cys Ser Cys Gly Ser Cys Cys Lys Phe Asp Glu 1230 1235 1240 gat gac tct gag cca gtt ctc aag ggt gtc aaa tta cat tac aca 3853 Asp Asp Ser Glu Pro Val Leu Lys Gly Val Lys Leu His Tyr Thr 1245 1250 1255 taaacgaact tatggatttg tttatgagat tttttactct tggatcaatt actgcacagc 3913 cagtaaaaat tgacaatgct tctcctgcaa gt 3945 3 1255 PRT CORONAVIRUS 3 Met Phe Ile Phe Leu Leu Phe Leu Thr Leu Thr Ser Gly Ser Asp Leu 1 5 10 15 Asp Arg Cys Thr Thr Phe Asp Asp Val Gln Ala Pro Asn Tyr Thr Gln 20 25 30 His Thr Ser Ser Met Arg Gly Val Tyr Tyr Pro Asp Glu Ile Phe Arg 35 40 45 Ser Asp Thr Leu Tyr Leu Thr Gln Asp Leu Phe Leu Pro Phe Tyr Ser 50 55 60 Asn Val Thr Gly Phe His Thr Ile Asn His Thr Phe Gly Asn Pro Val 65 70 75 80 Ile Pro Phe Lys Asp Gly Ile Tyr Phe Ala Ala Thr Glu Lys Ser Asn 85 90 95 Val Val Arg Gly Trp Val Phe Gly Ser Thr Met Asn Asn Lys Ser Gln 100 105 110 Ser Val Ile Ile Ile Asn Asn Ser Thr Asn Val Val Ile Arg Ala Cys 115 120 125 Asn Phe Glu Leu Cys Asp Asn Pro Phe Phe Ala Val Ser Lys Pro Met 130 135 140 Gly Thr Gln Thr His Thr Met Ile Phe Asp Asn Ala Phe Asn Cys Thr 145 150 155 160 Phe Glu Tyr Ile Ser Asp Ala Phe Ser Leu Asp Val Ser Glu Lys Ser 165 170 175 Gly Asn Phe Lys His Leu Arg Glu Phe Val Phe Lys Asn Lys Asp Gly 180 185 190 Phe Leu Tyr Val Tyr Lys Gly Tyr Gln Pro Ile Asp Val Val Arg Asp 195 200 205 Leu Pro Ser Gly Phe Asn Thr Leu Lys Pro Ile Phe Lys Leu Pro Leu 210 215 220 Gly Ile Asn Ile Thr Asn Phe Arg Ala Ile Leu Thr Ala Phe Ser Pro 225 230 235 240 Ala Gln Asp Ile Trp Gly Thr Ser Ala Ala Ala Tyr Phe Val Gly Tyr 245 250 255 Leu Lys Pro Thr Thr Phe Met Leu Lys Tyr Asp Glu Asn Gly Thr Ile 260 265 270 Thr Asp Ala Val Asp Cys Ser Gln Asn Pro Leu Ala Glu Leu Lys Cys 275 280 285 Ser Val Lys Ser Phe Glu Ile Asp Lys Gly Ile Tyr Gln Thr Ser Asn 290 295 300 Phe Arg Val Val Pro Ser Gly Asp Val Val Arg Phe Pro Asn Ile Thr 305 310 315 320 Asn Leu Cys Pro Phe Gly Glu Val Phe Asn Ala Thr Lys Phe Pro Ser 325 330 335 Val Tyr Ala Trp Glu Arg Lys Lys Ile Ser Asn Cys Val Ala Asp Tyr 340 345 350 Ser Val Leu Tyr Asn Ser Thr Phe Phe Ser Thr Phe Lys Cys Tyr Gly 355 360 365 Val Ser Ala Thr Lys Leu Asn Asp Leu Cys Phe Ser Asn Val Tyr Ala 370 375 380 Asp Ser Phe Val Val Lys Gly Asp Asp Val Arg Gln Ile Ala Pro Gly 385

390 395 400 Gln Thr Gly Val Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe 405 410 415 Met Gly Cys Val Leu Ala Trp Asn Thr Arg Asn Ile Asp Ala Thr Ser 420 425 430 Thr Gly Asn Tyr Asn Tyr Lys Tyr Arg Tyr Leu Arg His Gly Lys Leu 435 440 445 Arg Pro Phe Glu Arg Asp Ile Ser Asn Val Pro Phe Ser Pro Asp Gly 450 455 460 Lys Pro Cys Thr Pro Pro Ala Leu Asn Cys Tyr Trp Pro Leu Asn Asp 465 470 475 480 Tyr Gly Phe Tyr Thr Thr Thr Gly Ile Gly Tyr Gln Pro Tyr Arg Val 485 490 495 Val Val Leu Ser Phe Glu Leu Leu Asn Ala Pro Ala Thr Val Cys Gly 500 505 510 Pro Lys Leu Ser Thr Asp Leu Ile Lys Asn Gln Cys Val Asn Phe Asn 515 520 525 Phe Asn Gly Leu Thr Gly Thr Gly Val Leu Thr Pro Ser Ser Lys Arg 530 535 540 Phe Gln Pro Phe Gln Gln Phe Gly Arg Asp Val Ser Asp Phe Thr Asp 545 550 555 560 Ser Val Arg Asp Pro Lys Thr Ser Glu Ile Leu Asp Ile Ser Pro Cys 565 570 575 Ser Phe Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Ala Ser Ser 580 585 590 Glu Val Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Asp Val Ser Thr 595 600 605 Ala Ile His Ala Asp Gln Leu Thr Pro Ala Trp Arg Ile Tyr Ser Thr 610 615 620 Gly Asn Asn Val Phe Gln Thr Gln Ala Gly Cys Leu Ile Gly Ala Glu 625 630 635 640 His Val Asp Thr Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile 645 650 655 Cys Ala Ser Tyr His Thr Val Ser Leu Leu Arg Ser Thr Ser Gln Lys 660 665 670 Ser Ile Val Ala Tyr Thr Met Ser Leu Gly Ala Asp Ser Ser Ile Ala 675 680 685 Tyr Ser Asn Asn Thr Ile Ala Ile Pro Thr Asn Phe Ser Ile Ser Ile 690 695 700 Thr Thr Glu Val Met Pro Val Ser Met Ala Lys Thr Ser Val Asp Cys 705 710 715 720 Asn Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ala Asn Leu Leu Leu 725 730 735 Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala Leu Ser Gly Ile 740 745 750 Ala Ala Glu Gln Asp Arg Asn Thr Arg Glu Val Phe Ala Gln Val Lys 755 760 765 Gln Met Tyr Lys Thr Pro Thr Leu Lys Tyr Phe Gly Gly Phe Asn Phe 770 775 780 Ser Gln Ile Leu Pro Asp Pro Leu Lys Pro Thr Lys Arg Ser Phe Ile 785 790 795 800 Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp Ala Gly Phe Met 805 810 815 Lys Gln Tyr Gly Glu Cys Leu Gly Asp Ile Asn Ala Arg Asp Leu Ile 820 825 830 Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro Pro Leu Leu Thr 835 840 845 Asp Asp Met Ile Ala Ala Tyr Thr Ala Ala Leu Val Ser Gly Thr Ala 850 855 860 Thr Ala Gly Trp Thr Phe Gly Ala Gly Ala Ala Leu Gln Ile Pro Phe 865 870 875 880 Ala Met Gln Met Ala Tyr Arg Phe Asn Gly Ile Gly Val Thr Gln Asn 885 890 895 Val Leu Tyr Glu Asn Gln Lys Gln Ile Ala Asn Gln Phe Asn Lys Ala 900 905 910 Ile Ser Gln Ile Gln Glu Ser Leu Thr Thr Thr Ser Thr Ala Leu Gly 915 920 925 Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala Leu Asn Thr Leu 930 935 940 Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser Ser Val Leu Asn 945 950 955 960 Asp Ile Leu Ser Arg Leu Asp Lys Val Glu Ala Glu Val Gln Ile Asp 965 970 975 Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr Tyr Val Thr Gln 980 985 990 Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser Ala Asn Leu Ala Ala 995 1000 1005 Thr Lys Met Ser Glu Cys Val Leu Gly Gln Ser Lys Arg Val Asp 1010 1015 1020 Phe Cys Gly Lys Gly Tyr His Leu Met Ser Phe Pro Gln Ala Ala 1025 1030 1035 Pro His Gly Val Val Phe Leu His Val Thr Tyr Val Pro Ser Gln 1040 1045 1050 Glu Arg Asn Phe Thr Thr Ala Pro Ala Ile Cys His Glu Gly Lys 1055 1060 1065 Ala Tyr Phe Pro Arg Glu Gly Val Phe Val Phe Asn Gly Thr Ser 1070 1075 1080 Trp Phe Ile Thr Gln Arg Asn Phe Phe Ser Pro Gln Ile Ile Thr 1085 1090 1095 Thr Asp Asn Thr Phe Val Ser Gly Asn Cys Asp Val Val Ile Gly 1100 1105 1110 Ile Ile Asn Asn Thr Val Tyr Asp Pro Leu Gln Pro Glu Leu Asp 1115 1120 1125 Ser Phe Lys Glu Glu Leu Asp Lys Tyr Phe Lys Asn His Thr Ser 1130 1135 1140 Pro Asp Val Asp Leu Gly Asp Ile Ser Gly Ile Asn Ala Ser Val 1145 1150 1155 Val Asn Ile Gln Lys Glu Ile Asp Arg Leu Asn Glu Val Ala Lys 1160 1165 1170 Asn Leu Asn Glu Ser Leu Ile Asp Leu Gln Glu Leu Gly Lys Tyr 1175 1180 1185 Glu Gln Tyr Ile Lys Trp Pro Trp Tyr Val Trp Leu Gly Phe Ile 1190 1195 1200 Ala Gly Leu Ile Ala Ile Val Met Val Thr Ile Leu Leu Cys Cys 1205 1210 1215 Met Thr Ser Cys Cys Ser Cys Leu Lys Gly Ala Cys Ser Cys Gly 1220 1225 1230 Ser Cys Cys Lys Phe Asp Glu Asp Asp Ser Glu Pro Val Leu Lys 1235 1240 1245 Gly Val Lys Leu His Tyr Thr 1250 1255 4 3943 DNA CORONAVIRUS 4 ctcttctgga aaaaggtagg cttatcatta gagaaaacaa cagagttgtg gtttcaagtg 60 atattcttgt taacaactaa acgaacatgt ttattttctt attatttctt actctcacta 120 gtggtagtga ccttgaccgg tgcaccactt ttgatgatgt tcaagctcct aattacactc 180 aacatacttc atctatgagg ggggtttact atcctgatga aatttttaga tcagacactc 240 tttatttaac tcaggattta tttcttccat tttattctaa tgttacaggg tttcatacta 300 ttaatcatac gtttggcaac cctgtcatac cttttaagga tggtatttat tttgctgcca 360 cagagaaatc aaatgttgtc cgtggttggg tttttggttc taccatgaac aacaagtcac 420 agtcggtgat tattattaac aattctacta atgttgttat acgagcatgt aactttgaat 480 tgtgtgacaa ccctttcttt gctgtttcta aacccatggg tacacagaca catactatga 540 tattcgataa tgcatttaat tgcactttcg agtacatatc tgatgccttt tcgcttgatg 600 tttcagaaaa gtcaggtaat tttaaacact tacgagagtt tgtgtttaaa aataaagatg 660 ggtttctcta tgtttataag ggctatcaac ctatagatgt agttcgtgat ctaccttctg 720 gttttaacac tttgaaacct atttttaagt tgcctcttgg tattaacatt acaaatttta 780 gagccattct tacagccttt tcacctgctc aagacatttg gggcacgtca gctgcagcct 840 attttgttgg ctatttaaag ccaactacat ttatgctcaa gtatgatgaa aatggtacaa 900 tcacagatgc tgttgattgt tctcaaaatc cacttgctga actcaaatgc tctgttaaga 960 gctttgagat tgacaaagga atttaccaga cctctaattt cagggttgtt ccctcaggag 1020 atgttgtgag attccctaat attacaaact tgtgtccttt tggagaggtt tttaatgcta 1080 ctaaattccc ttctgtctat gcatgggaga gaaaaaaaat ttctaattgt gttgctgatt 1140 actctgtgct ctacaactca acattttttt caacctttaa gtgctatggc gtttctgcca 1200 ctaagttgaa tgatctttgc ttctccaatg tctatgcaga ttcttttgta gtcaagggag 1260 atgatgtaag acaaatagcg ccaggacaaa ctggtgttat tgctgattat aattataaat 1320 tgccagatga tttcatgggt tgtgtccttg cttggaatac taggaacatt gatgctactt 1380 caactggtaa ttataattat aaatataggt atcttagaca tggcaagctt aggccctttg 1440 agagagacat atctaatgtg cctttctccc ctgatggcaa accttgcacc ccacctgctc 1500 ttaattgtta ttggccatta aatgattatg gtttttacac cactactggc attggctacc 1560 aaccttacag agttgtagta ctttcttttg aacttttaaa tgcaccggcc acggtttgtg 1620 gaccaaaatt atccactgac cttattaaga accagtgtgt caattttaat tttaatggac 1680 tcactggtac tggtgtgtta actccttctt caaagagatt tcaaccattt caacaatttg 1740 gccgtgatgt ctctgatttc actgattccg ttcgagatcc taaaacatct gaaatattag 1800 acatttcacc ttgctctttt gggggtgtaa gtgtaattac acctggaaca aatgcttcat 1860 ctgaagttgc tgttctatat caagatgtta actgcactga tgtttctaca gcaatccatg 1920 cagatcaact cacaccagct tggcgcatat attctactgg aaacaatgta ttccagactc 1980 aagcaggctg tcttatagga gctgagcatg tcgacacttc ttatgagtgc gacattccta 2040 ttggagctgg catttgtgct agttaccata cagtttcttt attacgtagt actagccaaa 2100 aatctattgt ggcttatact atgtctttag gtgctgatag ttcaattgct tactctaata 2160 acaccattgc tatacctact aacttttcaa ttagcattac tacagaagta atgcctgttt 2220 ctatggctaa aacctccgta gattgtaata tgtacatctg cggagattct actgaatgtg 2280 ctaatttgct tctccaatat ggtagctttt gcacacaact aaatcgtgca ctctcaggta 2340 ttgctgctga acaggatcgc aacacacgtg aagtgttcgc tcaagtcaaa caaatgtaca 2400 aaaccccaac tttgaaatat tttggtggtt ttaatttttc acaaatatta cctgaccctc 2460 taaagccaac taagaggtct tttattgagg acttgctctt taataaggtg acactcgctg 2520 atgctggctt catgaagcaa tatggcgaat gcctaggtga tattaatgct agagatctca 2580 tttgtgcgca gaagttcaat gggcttacag tgttgccacc tctgctcact gatgatatga 2640 ttgctgccta cactgctgct ctagttagtg gtactgccac tgctggatgg acatttggtg 2700 ctggcgctgc tcttcaaata ccttttgcta tgcaaatggc atataggttc aatggcattg 2760 gagttaccca aaatgttctc tatgagaacc aaaaacaaat cgccaaccaa tttaacaagg 2820 cgattagtca aattcaagaa tcacttacaa caacatcaac tgcattgggc aagctgcaag 2880 acgttgttaa ccagaatgct caagcattaa acacacttgt taaacaactt agctctaatt 2940 ttggtgcaat ttcaagtgtg ctaaatgata tcctttcgcg acttgataaa gtcgaggcgg 3000 aggtacaaat tgacaggcta attacaggca gacttcaaag ccttcaaacc tatgtaacac 3060 aacaactaat cagggctgct gaaatcaggg cttctgctaa tcttgctgct actaaaatgt 3120 ctgagtgtgt tcttggacaa tcaaaaagag ttgacttttg tggaaagggc taccacctta 3180 tgtccttccc acaagcagcc ccgcatggtg ttgtcttcct acatgtcacg tatgtgccat 3240 cccaggagag gaacttcacc acagcgccag caatttgtca tgaaggcaaa gcatacttcc 3300 ctcgtgaagg tgtttttgtg tttaatggca cttcttggtt tattacacag aggaacttct 3360 tttctccaca aataattact acagacaata catttgtctc aggaaattgt gatgtcgtta 3420 ttggcatcat taacaacaca gtttatgatc ctctgcaacc tgagcttgac tcattcaaag 3480 aagagctgga caagtacttc aaaaatcata catcaccaga tgttgatctt ggcgacattt 3540 caggcattaa cgcttctgtc gtcaacattc aaaaagaaat tgaccgcctc aatgaggtcg 3600 ctaaaaattt aaatgaatca ctcattgacc ttcaagaatt gggaaaatat gagcaatata 3660 ttaaatggcc ttggtatgtt tggctcggct tcattgctgg actaattgcc atcgtcatgg 3720 ttacaatctt gctttgttgc atgactagtt gttgcagttg cctcaagggt gcatgctctt 3780 gtggttcttg ctgcaagttt gatgaggatg actctgagcc agttctcaag ggtgtcaaat 3840 tacattacac ataaacgaac ttatggattt gtttatgaga ttttttactc ttggatcaat 3900 tactgcacag ccagtaaaaa ttgacaatgc ttctcctgca agt 3943 5 2049 DNA CORONAVIRUS 5 ctcttctgga aaaaggtagg cttatcatta gagaaaacaa cagagttgtg gtttcaagtg 60 atattcttgt taacaactaa acgaacatgt ttattttctt attatttctt actctcacta 120 gtggtagtga ccttgaccgg tgcaccactt ttgatgatgt tcaagctcct aattacactc 180 aacatacttc atctatgagg ggggtttact atcctgatga aatttttaga tcagacactc 240 tttatttaac tcaggattta tttcttccat tttattctaa tgttacaggg tttcatacta 300 ttaatcatac gtttggcaac cctgtcatac cttttaagga tggtatttat tttgctgcca 360 cagagaaatc aaatgttgtc cgtggttggg tttttggttc taccatgaac aacaagtcac 420 agtcggtgat tattattaac aattctacta atgttgttat acgagcatgt aactttgaat 480 tgtgtgacaa ccctttcttt gctgtttcta aacccatggg tacacagaca catactatga 540 tattcgataa tgcatttaat tgcactttcg agtacatatc tgatgccttt tcgcttgatg 600 tttcagaaaa gtcaggtaat tttaaacact tacgagagtt tgtgtttaaa aataaagatg 660 ggtttctcta tgtttataag ggctatcaac ctatagatgt agttcgtgat ctaccttctg 720 gttttaacac tttgaaacct atttttaagt tgcctcttgg tattaacatt acaaatttta 780 gagccattct tacagccttt tcacctgctc aagacatttg gggcacgtca gctgcagcct 840 attttgttgg ctatttaaag ccaactacat ttatgctcaa gtatgatgaa aatggtacaa 900 tcacagatgc tgttgattgt tctcaaaatc cacttgctga actcaaatgc tctgttaaga 960 gctttgagat tgacaaagga atttaccaga cctctaattt cagggttgtt ccctcaggag 1020 atgttgtgag attccctaat attacaaact tgtgtccttt tggagaggtt tttaatgcta 1080 ctaaattccc ttctgtctat gcatgggaga gaaaaaaaat ttctaattgt gttgctgatt 1140 actctgtgct ctacaactca acattttttt caacctttaa gtgctatggc gtttctgcca 1200 ctaagttgaa tgatctttgc ttctccaatg tctatgcaga ttcttttgta gtcaagggag 1260 atgatgtaag acaaatagcg ccaggacaaa ctggtgttat tgctgattat aattataaat 1320 tgccagatga tttcatgggt tgtgtccttg cttggaatac taggaacatt gatgctactt 1380 caactggtaa ttataattat aaatataggt atcttagaca tggcaagctt aggccctttg 1440 agagagacat atctaatgtg cctttctccc ctgatggcaa accttgcacc ccacctgctc 1500 ttaattgtta ttggccatta aatgattatg gtttttacac cactactggc attggctacc 1560 aaccttacag agttgtagta ctttcttttg aacttttaaa tgcaccggcc acggtttgtg 1620 gaccaaaatt atccactgac cttattaaga accagtgtgt caattttaat tttaatggac 1680 tcactggtac tggtgtgtta actccttctt caaagagatt tcaaccattt caacaatttg 1740 gccgtgatgt ctctgatttc actgattccg ttcgagatcc taaaacatct gaaatattag 1800 acatttcacc ttgctctttt gggggtgtaa gtgtaattac acctggaaca aatgcttcat 1860 ctgaagttgc tgttctatat caagatgtta actgcactga tgtttctaca gcaatccatg 1920 cagatcaact cacaccagct tggcgcatat attctactgg aaacaatgta ttccagactc 1980 aagcaggctg tcttatagga gctgagcatg tcgacacttc ttatgagtgc gacattccta 2040 ttggagctg 2049 6 2027 DNA CORONAVIRUS 6 catgcagatc aactcacacc agcttggcgc atatattcta ctggaaacaa tgtattccag 60 actcaagcag gctgtcttat aggagctgag catgtcgaca cttcttatga gtgcgacatt 120 cctattggag ctggcatttg tgctagttac catacagttt ctttattacg tagtactagc 180 caaaaatcta ttgtggctta tactatgtct ttaggtgctg atagttcaat tgcttactct 240 aataacacca ttgctatacc tactaacttt tcaattagca ttactacaga agtaatgcct 300 gtttctatgg ctaaaacctc cgtagattgt aatatgtaca tctgcggaga ttctactgaa 360 tgtgctaatt tgcttctcca atatggtagc ttttgcacac aactaaatcg tgcactctca 420 ggtattgctg ctgaacagga tcgcaacaca cgtgaagtgt tcgctcaagt caaacaaatg 480 tacaaaaccc caactttgaa atattttggt ggttttaatt tttcacaaat attacctgac 540 cctctaaagc caactaagag gtcttttatt gaggacttgc tctttaataa ggtgacactc 600 gctgatgctg gcttcatgaa gcaatatggc gaatgcctag gtgatattaa tgctagagat 660 ctcatttgtg cgcagaagtt caatgggctt acagtgttgc cacctctgct cactgatgat 720 atgattgctg cctacactgc tgctctagtt agtggtactg ccactgctgg atggacattt 780 ggtgctggcg ctgctcttca aatacctttt gctatgcaaa tggcatatag gttcaatggc 840 attggagtta cccaaaatgt tctctatgag aaccaaaaac aaatcgccaa ccaatttaac 900 aaggcgatta gtcaaattca agaatcactt acaacaacat caactgcatt gggcaagctg 960 caagacgttg ttaaccagaa tgctcaagca ttaaacacac ttgttaaaca acttagctct 1020 aattttggtg caatttcaag tgtgctaaat gatatccttt cgcgacttga taaagtcgag 1080 gcggaggtac aaattgacag gttaattaca ggcagacttc aaagccttca aacctatgta 1140 acacaacaac taatcagggc tgctgaaatc agggcttctg ctaatcttgc tgctactaaa 1200 atgtctgagt gtgttcttgg acaatcaaaa agagttgact tttgtggaaa gggctaccac 1260 cttatgtcct tcccacaagc agccccgcat ggtgttgtct tcctacatgt cacgtatgtg 1320 ccatcccagg agaggaactt caccacagcg ccagcaattt gtcatgaagg caaagcatac 1380 ttccctcgtg aaggtgtttt tgtgtttaat ggcacttctt ggtttattac acagaggaac 1440 ttcttttctc cacaaataat tactacagac aatacatttg tctcaggaaa ttgtgatgtc 1500 gttattggcg tcattaacaa cacagtttat gatcctctgc aacctgagct tgactcattc 1560 aaagaagagc tggacaagta cttcaaaaat catacatcac cagatgttga tcttggcgac 1620 atttcaggca ttaacgcttc tgtcgtcaac attcaaaaag aaattgaccg cctcaatgag 1680 gtcgctaaaa atttaaatga atcactcatt gaccttcaag aattgggaaa atatgagcaa 1740 tatattaaat ggccttggta tgtttggctc ggcttcattg ctggactaat tgccatcgtc 1800 atggttacaa tcttgctttg ttgcatgact agttgttgca gttgcctcaa gggtgcatgc 1860 tcttgtggtt cttgctgcaa gtttgatgag gatgactctg agccagttct caagggtgtc 1920 aaattacatt acacataaac gaacttatgg atttgtttat gagatttttt actcttggat 1980 caattactgc acagccagta aaaattgaca atgcttctcc tgcaagt 2027 7 1096 DNA CORONAVIRUS 7 tcttgctttg ttgcatgact agttgttgca gttgcctcaa gggtgcatgc tcttgtggtt 60 cttgctgcaa gtttgatgag gatgactctg agccagttct caagggtgtc aaattacatt 120 acacataaac gaacttatgg atttgtttat gagatttttt actcttggat caattactgc 180 acagccagta aaaattgaca atgcttctcc tgcaagtact gttcatgcta cagcaacgat 240 accgctacaa gcctcactcc ctttcggatg gcttgttatt ggcgttgcat ttcttgctgt 300 ttttcagagc gctaccaaaa taattgcgct caataaaaga tggcagctag ccctttataa 360 gggcttccag ttcatttgca atttactgct gctatttgtt accatctatt cacatctttt 420 gcttgtcgct gcaggtatgg aggcgcaatt tttgtacctc tatgccttga tatattttct 480 acaatgcatc aacgcatgta gaattattat gagatgttgg ctttgttgga agtgcaaatc 540 caagaaccca ttactttatg atgccaacta ctttgtttgc tggcacacac ataactatga 600 ctactgtata ccatataaca gtgtcacaga tacaattgtc gttactgaag gtgacggcat 660 ttcaacacca aaactcaaag aagactacca aattggtggt tattctgagg ataggcactc 720 aggtgttaaa gactatgtcg ttgtacatgg ctatttcacc gaagtttact accagcttga 780 gtctacacaa attactacag acactggtat tgaaaatgct acattcttca tctttaacaa 840 gcttgttaaa gacccaccga atgtgcaaat acacacaatc gacggctctt caggagttgc 900 taatccagca atggatccaa tttatgatga gccgacgacg actactagcg tgcctttgta 960 agcacaagaa agtgagtacg aacttatgta ctcattcgtt tcggaagaaa caggtacgtt 1020 aatagttaat agcgtacttc tttttcttgc tttcgtggta ttcttgctag tcacactagc 1080 catccttact gcgctt 1096 8 1135 DNA CORONAVIRUS 8 attgccatcg tcatggttac aatcttgctt tgttgcatga ctagttgttg cagttgcctc 60 aagggtgcat gctcttgtgg ttcttgctgc aagtttgatg aggatgactc tgagccagtt 120 ctcaagggtg tcaaattaca ttacacataa acgaacttat ggatttgttt atgagatttt 180 ttactcttgg atcaattact gcacagccag taaaaattga caatgcttct cctgcaagta 240 ctgttcatgc tacagcaacg ataccgctac aagcctcact ccctttcgga tggcttgtta 300 ttggcgttgc atttcttgct gtttttcaga gcgctaccaa aataattgcg ctcaataaaa 360

gatggcagct agccctttat aagggcttcc agttcatttg caatttactg ctgctatttg 420 ttaccatcta ttcacatctt ttgcttgtcg ctgcaggtat ggaggcgcaa tttttgtacc 480 tctatgcctt gatatatttt ctacaatgca tcaacgcatg tagaattatt atgagatgtt 540 ggctttgttg gaagtgcaaa tccaagaacc cattacttta tgatgccaac tactttgttt 600 gctggcacac acataactat gactactgta taccatataa cagtgtcaca gatacaattg 660 tcgttactga aggtgacggc atttcaacac caaaactcaa agaagactac caaattggtg 720 gttattctga ggataggcac tcaggtgtta aagactatgt cgttgtacat ggctatttca 780 ccgaagttta ctaccagctt gagtctacac aaattactac agacactggt attgaaaatg 840 ctacattctt catctttaac aagcttgtta aagacccacc gaatgtgcaa atacacacaa 900 tcgacggctc ttcaggagtt gctaatccag caatggatcc aatttatgat gagccgacga 960 cgactactag cgtgcctttg taagcacaag aaagtgagta cgaacttatg tactcattcg 1020 tttcggaaga aacaggtacg ttaatagtta atagcgtact tctttttctt gctttcgtgg 1080 tattcttgct agtcacacta gccatcctta ctgcgcttcg attgtgtgcg tactg 1135 9 1096 DNA CORONAVIRUS CDS (137)..(958) 9 tcttgctttg ttgcatgact agttgttgca gttgcctcaa gggtgcatgc tcttgtggtt 60 cttgctgcaa gtttgatgag gatgactctg agccagttct caagggtgtc aaattacatt 120 acacataaac gaactt atg gat ttg ttt atg aga ttt ttt act ctt gga tca 172 Met Asp Leu Phe Met Arg Phe Phe Thr Leu Gly Ser 1 5 10 att act gca cag cca gta aaa att gac aat gct tct cct gca agt act 220 Ile Thr Ala Gln Pro Val Lys Ile Asp Asn Ala Ser Pro Ala Ser Thr 15 20 25 gtt cat gct aca gca acg ata ccg cta caa gcc tca ctc cct ttc gga 268 Val His Ala Thr Ala Thr Ile Pro Leu Gln Ala Ser Leu Pro Phe Gly 30 35 40 tgg ctt gtt att ggc gtt gca ttt ctt gct gtt ttt cag agc gct acc 316 Trp Leu Val Ile Gly Val Ala Phe Leu Ala Val Phe Gln Ser Ala Thr 45 50 55 60 aaa ata att gcg ctc aat aaa aga tgg cag cta gcc ctt tat aag ggc 364 Lys Ile Ile Ala Leu Asn Lys Arg Trp Gln Leu Ala Leu Tyr Lys Gly 65 70 75 ttc cag ttc att tgc aat tta ctg ctg cta ttt gtt acc atc tat tca 412 Phe Gln Phe Ile Cys Asn Leu Leu Leu Leu Phe Val Thr Ile Tyr Ser 80 85 90 cat ctt ttg ctt gtc gct gca ggt atg gag gcg caa ttt ttg tac ctc 460 His Leu Leu Leu Val Ala Ala Gly Met Glu Ala Gln Phe Leu Tyr Leu 95 100 105 tat gcc ttg ata tat ttt cta caa tgc atc aac gca tgt aga att att 508 Tyr Ala Leu Ile Tyr Phe Leu Gln Cys Ile Asn Ala Cys Arg Ile Ile 110 115 120 atg aga tgt tgg ctt tgt tgg aag tgc aaa tcc aag aac cca tta ctt 556 Met Arg Cys Trp Leu Cys Trp Lys Cys Lys Ser Lys Asn Pro Leu Leu 125 130 135 140 tat gat gcc aac tac ttt gtt tgc tgg cac aca cat aac tat gac tac 604 Tyr Asp Ala Asn Tyr Phe Val Cys Trp His Thr His Asn Tyr Asp Tyr 145 150 155 tgt ata cca tat aac agt gtc aca gat aca att gtc gtt act gaa ggt 652 Cys Ile Pro Tyr Asn Ser Val Thr Asp Thr Ile Val Val Thr Glu Gly 160 165 170 gac ggc att tca aca cca aaa ctc aaa gaa gac tac caa att ggt ggt 700 Asp Gly Ile Ser Thr Pro Lys Leu Lys Glu Asp Tyr Gln Ile Gly Gly 175 180 185 tat tct gag gat agg cac tca ggt gtt aaa gac tat gtc gtt gta cat 748 Tyr Ser Glu Asp Arg His Ser Gly Val Lys Asp Tyr Val Val Val His 190 195 200 ggc tat ttc acc gaa gtt tac tac cag ctt gag tct aca caa att act 796 Gly Tyr Phe Thr Glu Val Tyr Tyr Gln Leu Glu Ser Thr Gln Ile Thr 205 210 215 220 aca gac act ggt att gaa aat gct aca ttc ttc atc ttt aac aag ctt 844 Thr Asp Thr Gly Ile Glu Asn Ala Thr Phe Phe Ile Phe Asn Lys Leu 225 230 235 gtt aaa gac cca ccg aat gtg caa ata cac aca atc gac ggc tct tca 892 Val Lys Asp Pro Pro Asn Val Gln Ile His Thr Ile Asp Gly Ser Ser 240 245 250 gga gtt gct aat cca gca atg gat cca att tat gat gag ccg acg acg 940 Gly Val Ala Asn Pro Ala Met Asp Pro Ile Tyr Asp Glu Pro Thr Thr 255 260 265 act act agc gtg cct ttg taagcacaag aaagtgagta cgaacttatg 988 Thr Thr Ser Val Pro Leu 270 tactcattcg tttcggaaga aacaggtacg ttaatagtta atagcgtact tctttttctt 1048 gctttcgtgg tattcttgct agtcacacta gccatcctta ctgcgctt 1096 10 274 PRT CORONAVIRUS 10 Met Asp Leu Phe Met Arg Phe Phe Thr Leu Gly Ser Ile Thr Ala Gln 1 5 10 15 Pro Val Lys Ile Asp Asn Ala Ser Pro Ala Ser Thr Val His Ala Thr 20 25 30 Ala Thr Ile Pro Leu Gln Ala Ser Leu Pro Phe Gly Trp Leu Val Ile 35 40 45 Gly Val Ala Phe Leu Ala Val Phe Gln Ser Ala Thr Lys Ile Ile Ala 50 55 60 Leu Asn Lys Arg Trp Gln Leu Ala Leu Tyr Lys Gly Phe Gln Phe Ile 65 70 75 80 Cys Asn Leu Leu Leu Leu Phe Val Thr Ile Tyr Ser His Leu Leu Leu 85 90 95 Val Ala Ala Gly Met Glu Ala Gln Phe Leu Tyr Leu Tyr Ala Leu Ile 100 105 110 Tyr Phe Leu Gln Cys Ile Asn Ala Cys Arg Ile Ile Met Arg Cys Trp 115 120 125 Leu Cys Trp Lys Cys Lys Ser Lys Asn Pro Leu Leu Tyr Asp Ala Asn 130 135 140 Tyr Phe Val Cys Trp His Thr His Asn Tyr Asp Tyr Cys Ile Pro Tyr 145 150 155 160 Asn Ser Val Thr Asp Thr Ile Val Val Thr Glu Gly Asp Gly Ile Ser 165 170 175 Thr Pro Lys Leu Lys Glu Asp Tyr Gln Ile Gly Gly Tyr Ser Glu Asp 180 185 190 Arg His Ser Gly Val Lys Asp Tyr Val Val Val His Gly Tyr Phe Thr 195 200 205 Glu Val Tyr Tyr Gln Leu Glu Ser Thr Gln Ile Thr Thr Asp Thr Gly 210 215 220 Ile Glu Asn Ala Thr Phe Phe Ile Phe Asn Lys Leu Val Lys Asp Pro 225 230 235 240 Pro Asn Val Gln Ile His Thr Ile Asp Gly Ser Ser Gly Val Ala Asn 245 250 255 Pro Ala Met Asp Pro Ile Tyr Asp Glu Pro Thr Thr Thr Thr Ser Val 260 265 270 Pro Leu 11 1096 DNA CORONAVIRUS CDS (558)..(1019) 11 tcttgctttg ttgcatgact agttgttgca gttgcctcaa gggtgcatgc tcttgtggtt 60 cttgctgcaa gtttgatgag gatgactctg agccagttct caagggtgtc aaattacatt 120 acacataaac gaacttatgg atttgtttat gagatttttt actcttggat caattactgc 180 acagccagta aaaattgaca atgcttctcc tgcaagtact gttcatgcta cagcaacgat 240 accgctacaa gcctcactcc ctttcggatg gcttgttatt ggcgttgcat ttcttgctgt 300 ttttcagagc gctaccaaaa taattgcgct caataaaaga tggcagctag ccctttataa 360 gggcttccag ttcatttgca atttactgct gctatttgtt accatctatt cacatctttt 420 gcttgtcgct gcaggtatgg aggcgcaatt tttgtacctc tatgccttga tatattttct 480 acaatgcatc aacgcatgta gaattattat gagatgttgg ctttgttgga agtgcaaatc 540 caagaaccca ttacttt atg atg cca act act ttg ttt gct ggc aca cac 590 Met Met Pro Thr Thr Leu Phe Ala Gly Thr His 1 5 10 ata act atg act act gta tac cat ata aca gtg tca cag ata caa ttg 638 Ile Thr Met Thr Thr Val Tyr His Ile Thr Val Ser Gln Ile Gln Leu 15 20 25 tcg tta ctg aag gtg acg gca ttt caa cac caa aac tca aag aag act 686 Ser Leu Leu Lys Val Thr Ala Phe Gln His Gln Asn Ser Lys Lys Thr 30 35 40 acc aaa ttg gtg gtt att ctg agg ata ggc act cag gtg tta aag act 734 Thr Lys Leu Val Val Ile Leu Arg Ile Gly Thr Gln Val Leu Lys Thr 45 50 55 atg tcg ttg tac atg gct att tca ccg aag ttt act acc agc ttg agt 782 Met Ser Leu Tyr Met Ala Ile Ser Pro Lys Phe Thr Thr Ser Leu Ser 60 65 70 75 cta cac aaa tta cta cag aca ctg gta ttg aaa atg cta cat tct tca 830 Leu His Lys Leu Leu Gln Thr Leu Val Leu Lys Met Leu His Ser Ser 80 85 90 tct tta aca agc ttg tta aag acc cac cga atg tgc aaa tac aca caa 878 Ser Leu Thr Ser Leu Leu Lys Thr His Arg Met Cys Lys Tyr Thr Gln 95 100 105 tcg acg gct ctt cag gag ttg cta atc cag caa tgg atc caa ttt atg 926 Ser Thr Ala Leu Gln Glu Leu Leu Ile Gln Gln Trp Ile Gln Phe Met 110 115 120 atg agc cga cga cga cta cta gcg tgc ctt tgt aag cac aag aaa gtg 974 Met Ser Arg Arg Arg Leu Leu Ala Cys Leu Cys Lys His Lys Lys Val 125 130 135 agt acg aac tta tgt act cat tcg ttt cgg aag aaa cag gta cgt 1019 Ser Thr Asn Leu Cys Thr His Ser Phe Arg Lys Lys Gln Val Arg 140 145 150 taatagttaa tagcgtactt ctttttcttg ctttcgtggt attcttgcta gtcacactag 1079 ccatccttac tgcgctt 1096 12 154 PRT CORONAVIRUS 12 Met Met Pro Thr Thr Leu Phe Ala Gly Thr His Ile Thr Met Thr Thr 1 5 10 15 Val Tyr His Ile Thr Val Ser Gln Ile Gln Leu Ser Leu Leu Lys Val 20 25 30 Thr Ala Phe Gln His Gln Asn Ser Lys Lys Thr Thr Lys Leu Val Val 35 40 45 Ile Leu Arg Ile Gly Thr Gln Val Leu Lys Thr Met Ser Leu Tyr Met 50 55 60 Ala Ile Ser Pro Lys Phe Thr Thr Ser Leu Ser Leu His Lys Leu Leu 65 70 75 80 Gln Thr Leu Val Leu Lys Met Leu His Ser Ser Ser Leu Thr Ser Leu 85 90 95 Leu Lys Thr His Arg Met Cys Lys Tyr Thr Gln Ser Thr Ala Leu Gln 100 105 110 Glu Leu Leu Ile Gln Gln Trp Ile Gln Phe Met Met Ser Arg Arg Arg 115 120 125 Leu Leu Ala Cys Leu Cys Lys His Lys Lys Val Ser Thr Asn Leu Cys 130 135 140 Thr His Ser Phe Arg Lys Lys Gln Val Arg 145 150 13 332 DNA CORONAVIRUS CDS (36)..(263) 13 tgcctttgta agcacaagaa agtgagtacg aactt atg tac tca ttc gtt tcg 53 Met Tyr Ser Phe Val Ser 1 5 gaa gaa aca ggt acg tta ata gtt aat agc gta ctt ctt ttt ctt gct 101 Glu Glu Thr Gly Thr Leu Ile Val Asn Ser Val Leu Leu Phe Leu Ala 10 15 20 ttc gtg gta ttc ttg cta gtc aca cta gcc atc ctt act gcg ctt cga 149 Phe Val Val Phe Leu Leu Val Thr Leu Ala Ile Leu Thr Ala Leu Arg 25 30 35 ttg tgt gcg tac tgc tgc aat att gtt aac gtg agt tta gta aaa cca 197 Leu Cys Ala Tyr Cys Cys Asn Ile Val Asn Val Ser Leu Val Lys Pro 40 45 50 acg gtt tac gtc tac tcg cgt gtt aaa aat ctg aac tct tct gaa gga 245 Thr Val Tyr Val Tyr Ser Arg Val Lys Asn Leu Asn Ser Ser Glu Gly 55 60 65 70 gtt cct gat ctt ctg gtc taaacgaact aactattatt attattctgt 293 Val Pro Asp Leu Leu Val 75 ttggaacttt aacattgctt atcatggcag acaacggta 332 14 76 PRT CORONAVIRUS 14 Met Tyr Ser Phe Val Ser Glu Glu Thr Gly Thr Leu Ile Val Asn Ser 1 5 10 15 Val Leu Leu Phe Leu Ala Phe Val Val Phe Leu Leu Val Thr Leu Ala 20 25 30 Ile Leu Thr Ala Leu Arg Leu Cys Ala Tyr Cys Cys Asn Ile Val Asn 35 40 45 Val Ser Leu Val Lys Pro Thr Val Tyr Val Tyr Ser Arg Val Lys Asn 50 55 60 Leu Asn Ser Ser Glu Gly Val Pro Asp Leu Leu Val 65 70 75 15 332 DNA CORONAVIRUS 15 tgcctttgta agcacaagaa agtgagtacg aacttatgta ctcattcgtt tcggaagaaa 60 caggtacgtt aatagttaat agcgtacttc tttttcttgc tttcgtggta ttcttgctag 120 tcacactagc catccttact gcgcttcgat tgtgtgcgta ctgctgcaat attgttaacg 180 tgagtttagt aaaaccaacg gtttacgtct actcgcgtgt taaaaatctg aactcttctg 240 aaggagttcc tgatcttctg gtctaaacga actaactatt attattattc tgtttggaac 300 tttaacattg cttatcatgg cagacaacgg ta 332 16 708 DNA CORONAVIRUS CDS (41)..(703) 16 tattattatt attctgtttg gaactttaac attgcttatc atg gca gac aac ggt 55 Met Ala Asp Asn Gly 1 5 act att acc gtt gag gag ctt aaa caa ctc ctg gaa caa tgg aac cta 103 Thr Ile Thr Val Glu Glu Leu Lys Gln Leu Leu Glu Gln Trp Asn Leu 10 15 20 gta ata ggt ttc cta ttc cta gcc tgg att atg tta cta caa ttt gcc 151 Val Ile Gly Phe Leu Phe Leu Ala Trp Ile Met Leu Leu Gln Phe Ala 25 30 35 tat tct aat cgg aac agg ttt ttg tac ata ata aag ctt gtt ttc ctc 199 Tyr Ser Asn Arg Asn Arg Phe Leu Tyr Ile Ile Lys Leu Val Phe Leu 40 45 50 tgg ctc ttg tgg cca gta aca ctt gct tgt ttt gtg ctt gct gct gtc 247 Trp Leu Leu Trp Pro Val Thr Leu Ala Cys Phe Val Leu Ala Ala Val 55 60 65 tac aga att aat tgg gtg act ggc ggg att gcg att gca atg gct tgt 295 Tyr Arg Ile Asn Trp Val Thr Gly Gly Ile Ala Ile Ala Met Ala Cys 70 75 80 85 att gta ggc ttg atg tgg ctt agc tac ttc gtt gct tcc ttc agg ctg 343 Ile Val Gly Leu Met Trp Leu Ser Tyr Phe Val Ala Ser Phe Arg Leu 90 95 100 ttt gct cgt acc cgc tca atg tgg tca ttc aac cca gaa aca aac att 391 Phe Ala Arg Thr Arg Ser Met Trp Ser Phe Asn Pro Glu Thr Asn Ile 105 110 115 ctt ctc aat gtg cct ctc cgg ggg aca att gtg acc aga ccg ctc atg 439 Leu Leu Asn Val Pro Leu Arg Gly Thr Ile Val Thr Arg Pro Leu Met 120 125 130 gaa agt gaa ctt gtc att ggt gct gtg atc att cgt ggt cac ttg cga 487 Glu Ser Glu Leu Val Ile Gly Ala Val Ile Ile Arg Gly His Leu Arg 135 140 145 atg gcc gga cac tcc cta ggg cgc tgt gac att aag gac ctg cca aaa 535 Met Ala Gly His Ser Leu Gly Arg Cys Asp Ile Lys Asp Leu Pro Lys 150 155 160 165 gag atc act gtg gct aca tca cga acg ctt tct tat tac aaa tta gga 583 Glu Ile Thr Val Ala Thr Ser Arg Thr Leu Ser Tyr Tyr Lys Leu Gly 170 175 180 gcg tcg cag cgt gta ggc act gat tca ggt ttt gct gca tac aac cgc 631 Ala Ser Gln Arg Val Gly Thr Asp Ser Gly Phe Ala Ala Tyr Asn Arg 185 190 195 tac cgt att gga aac tat aaa tta aat aca gac cac gcc ggt agc aac 679 Tyr Arg Ile Gly Asn Tyr Lys Leu Asn Thr Asp His Ala Gly Ser Asn 200 205 210 gac aat att gct ttg cta gta cag taagt 708 Asp Asn Ile Ala Leu Leu Val Gln 215 220 17 221 PRT CORONAVIRUS 17 Met Ala Asp Asn Gly Thr Ile Thr Val Glu Glu Leu Lys Gln Leu Leu 1 5 10 15 Glu Gln Trp Asn Leu Val Ile Gly Phe Leu Phe Leu Ala Trp Ile Met 20 25 30 Leu Leu Gln Phe Ala Tyr Ser Asn Arg Asn Arg Phe Leu Tyr Ile Ile 35 40 45 Lys Leu Val Phe Leu Trp Leu Leu Trp Pro Val Thr Leu Ala Cys Phe 50 55 60 Val Leu Ala Ala Val Tyr Arg Ile Asn Trp Val Thr Gly Gly Ile Ala 65 70 75 80 Ile Ala Met Ala Cys Ile Val Gly Leu Met Trp Leu Ser Tyr Phe Val 85 90 95 Ala Ser Phe Arg Leu Phe Ala Arg Thr Arg Ser Met Trp Ser Phe Asn 100 105 110 Pro Glu Thr Asn Ile Leu Leu Asn Val Pro Leu Arg Gly Thr Ile Val 115 120 125 Thr Arg Pro Leu Met Glu Ser Glu Leu Val Ile Gly Ala Val Ile Ile 130 135 140 Arg Gly His Leu Arg Met Ala Gly His Ser Leu Gly Arg Cys Asp Ile 145 150 155 160 Lys Asp Leu Pro Lys Glu Ile Thr Val Ala Thr Ser Arg Thr Leu Ser 165 170 175 Tyr Tyr Lys Leu Gly Ala Ser Gln Arg Val Gly Thr Asp Ser Gly Phe 180 185 190 Ala Ala Tyr Asn Arg Tyr Arg Ile Gly Asn Tyr Lys Leu Asn Thr Asp 195 200 205 His Ala Gly Ser Asn Asp Asn Ile Ala Leu Leu Val Gln 210 215 220 18 769 DNA CORONAVIRUS 18 cctgatcttc tggtctaaac gaactaacta ttattattat tctgtttgga actttaacat 60 tgcttatcat ggcagacaac ggtactatta ccgttgagga gcttaaacaa ctcctggaac 120 aatggaacct agtaataggt ttcctattcc tagcctggat tatgttacta caatttgcct 180 attctaatcg gaacaggttt ttgtacataa taaagcttgt tttcctctgg ctcttgtggc 240 cagtaacact tgcttgtttt gtgcttgctg ctgtctacag aattaattgg gtgactggcg 300 ggattgcgat tgcaatggct tgtattgtag gcttgatgtg gcttagctac ttcgttgctt 360 ccttcaggct gtttgctcgt acccgctcaa tgtggtcatt caacccagaa acaaacattc 420 ttctcaatgt gcctctccgg gggacaattg tgaccagacc gctcatggaa agtgaacttg 480 tcattggtgc tgtgatcatt cgtggtcact tgcgaatggc cggacactcc ctagggcgct 540 gtgacattaa ggacctgcca aaagagatca ctgtggctac atcacgaacg ctttcttatt 600 acaaattagg agcgtcgcag cgtgtaggca ctgattcagg ttttgctgca tacaaccgct 660 accgtattgg

aaactataaa ttaaatacag accacgccgg tagcaacgac aatattgctt 720 tgctagtaca gtaagtgaca acagatgttt catcttgttg acttccagg 769 19 1231 DNA CORONAVIRUS 19 taccgtattg gaaactataa attaaataca gaccacgccg gtagcaacga caatattgct 60 ttgctagtac agtaagtgac aacagatgtt tcatcttgtt gacttccagg ttacaatagc 120 agagatattg attatcatta tgaggacttt caggattgct atttggaatc ttgacgttat 180 aataagttca atagtgagac aattatttaa gcctctaact aagaagaatt attcggagtt 240 agatgatgaa gaacctatgg agttagatta tccataaaac gaacatgaaa attattctct 300 tcctgacatt gattgtattt acatcttgcg agctatatca ctatcaggag tgtgttagag 360 gtacgactgt actactaaaa gaaccttgcc catcaggaac atacgagggc aattcaccat 420 ttcaccctct tgctgacaat aaatttgcac taacttgcac tagcacacac tttgcttttg 480 cttgtgctga cggtactcga catacctatc agctgcgtgc aagatcagtt tcaccaaaac 540 ttttcatcag acaagaggag gttcaacaag agctctactc gccacttttt ctcattgttg 600 ctgctctagt atttttaata ctttgcttca ccattaagag aaagacagaa tgaatgagct 660 cactttaatt gacttctatt tgtgcttttt agcctttctg ctattccttg ttttaataat 720 gcttattata ttttggtttt cactcgaaat ccaggatcta gaagaacctt gtaccaaagt 780 ctaaacgaac atgaaacttc tcattgtttt gacttgtatt tctctatgca gttgcatatg 840 cactgtagta cagcgctgtg catctaataa acctcatgtg cttgaagatc cttgtaaggt 900 acaacactag gggtaatact tatagcactg cttggctttg tgctctagga aaggttttac 960 cttttcatag atggcacact atggttcaaa catgcacacc taatgttact atcaactgtc 1020 aagatccagc tggtggtgcg cttatagcta ggtgttggta ccttcatgaa ggtcaccaaa 1080 ctgctgcatt tagagacgta cttgttgttt taaataaacg aacaaattaa aatgtctgat 1140 aatggacccc aatcaaacca acgtagtgcc ccccgcatta catttggtgg acccacagat 1200 tcaactgaca ataaccagaa tggaggacgc a 1231 20 1242 DNA CORONAVIRUS 20 gcatacaacc gctaccgtat tggaaactat aaattaaata cagaccacgc cggtagcaac 60 gacaatattg ctttgctagt acagtaagtg acaacagatg tttcatcttg ttgacttcca 120 ggttacaata gcagagatat tgattatcat tatgaggact ttcaggattg ctatttggaa 180 tcttgacgtt ataataagtt caatagtgag acagttattt aagcctctaa ctaagaagaa 240 ttattcggag ttagatgatg aagaacctat ggagttagat tatccataaa acgaacatga 300 aaattattct cttcctgaca ttgattgtat ttacatcttg cgagctatat cactatcagg 360 agtgtgttag aggtacgact gtactactaa aagaaccttg cccatcagga acatacgagg 420 gcaattcacc atttcaccct cttgctgaca ataaatttgc actaacttgc actagcacac 480 actttgcttt tgcttgtgct gacggtactc gacataccta tcagctgcgt gcaagatcag 540 tttcaccaaa acttttcatc agacaagagg aggttcaaca agagctctac tcgccacttt 600 ttctcattgt tgctgctcta gtatttttaa tactttgctt caccattaag agaaagacag 660 aatgaatgag ctcactttaa ttgacttcta tttgtgcttt ttagcctttc tgctattcct 720 tgttttaata atgcttatta tattttggtt ttcactcgaa atccaggatc tagaagaacc 780 ttgtaccaaa gtctaaacga acatgaaact tctcattgtt ttgacttgta tttctctatg 840 cagttgcata tgcactgtag tacagcgctg tgcatctaat aaacctcatg tgcttgaaga 900 tccttgtaag gtacaacact aggggtaata cttatagcac tgcttggctt tgtgctctag 960 gaaaggtttt accttttcat agatggcaca ctatggttca aacatgcaca cctaatgtta 1020 ctatcaactg tcaagatcca gctggtggtg cgcttatagc taggtgttgg taccttcatg 1080 aaggtcacca aactgctgca tttagagacg tacttgttgt tttaaataaa cgaacgaatt 1140 aaaatgtctg ataatggacc ccaatcaaac caacgtagtg ccccccgcat tacatttggt 1200 ggacccacag attcaactga caataaccag aatggaggac gc 1242 21 1231 DNA CORONAVIRUS CDS (86)..(274) 21 taccgtattg gaaactataa attaaataca gaccacgccg gtagcaacga caatattgct 60 ttgctagtac agtaagtgac aacag atg ttt cat ctt gtt gac ttc cag gtt 112 Met Phe His Leu Val Asp Phe Gln Val 1 5 aca ata gca gag ata ttg att atc att atg agg act ttc agg att gct 160 Thr Ile Ala Glu Ile Leu Ile Ile Ile Met Arg Thr Phe Arg Ile Ala 10 15 20 25 att tgg aat ctt gac gtt ata ata agt tca ata gtg aga caa tta ttt 208 Ile Trp Asn Leu Asp Val Ile Ile Ser Ser Ile Val Arg Gln Leu Phe 30 35 40 aag cct cta act aag aag aat tat tcg gag tta gat gat gaa gaa cct 256 Lys Pro Leu Thr Lys Lys Asn Tyr Ser Glu Leu Asp Asp Glu Glu Pro 45 50 55 atg gag tta gat tat cca taaaacgaac atgaaaatta ttctcttcct 304 Met Glu Leu Asp Tyr Pro 60 gacattgatt gtatttacat cttgcgagct atatcactat caggagtgtg ttagaggtac 364 gactgtacta ctaaaagaac cttgcccatc aggaacatac gagggcaatt caccatttca 424 ccctcttgct gacaataaat ttgcactaac ttgcactagc acacactttg cttttgcttg 484 tgctgacggt actcgacata cctatcagct gcgtgcaaga tcagtttcac caaaactttt 544 catcagacaa gaggaggttc aacaagagct ctactcgcca ctttttctca ttgttgctgc 604 tctagtattt ttaatacttt gcttcaccat taagagaaag acagaatgaa tgagctcact 664 ttaattgact tctatttgtg ctttttagcc tttctgctat tccttgtttt aataatgctt 724 attatatttt ggttttcact cgaaatccag gatctagaag aaccttgtac caaagtctaa 784 acgaacatga aacttctcat tgttttgact tgtatttctc tatgcagttg catatgcact 844 gtagtacagc gctgtgcatc taataaacct catgtgcttg aagatccttg taaggtacaa 904 cactaggggt aatacttata gcactgcttg gctttgtgct ctaggaaagg ttttaccttt 964 tcatagatgg cacactatgg ttcaaacatg cacacctaat gttactatca actgtcaaga 1024 tccagctggt ggtgcgctta tagctaggtg ttggtacctt catgaaggtc accaaactgc 1084 tgcatttaga gacgtacttg ttgttttaaa taaacgaaca aattaaaatg tctgataatg 1144 gaccccaatc aaaccaacgt agtgcccccc gcattacatt tggtggaccc acagattcaa 1204 ctgacaataa ccagaatgga ggacgca 1231 22 63 PRT CORONAVIRUS 22 Met Phe His Leu Val Asp Phe Gln Val Thr Ile Ala Glu Ile Leu Ile 1 5 10 15 Ile Ile Met Arg Thr Phe Arg Ile Ala Ile Trp Asn Leu Asp Val Ile 20 25 30 Ile Ser Ser Ile Val Arg Gln Leu Phe Lys Pro Leu Thr Lys Lys Asn 35 40 45 Tyr Ser Glu Leu Asp Asp Glu Glu Pro Met Glu Leu Asp Tyr Pro 50 55 60 23 1231 DNA CORONAVIRUS CDS (285)..(650) 23 taccgtattg gaaactataa attaaataca gaccacgccg gtagcaacga caatattgct 60 ttgctagtac agtaagtgac aacagatgtt tcatcttgtt gacttccagg ttacaatagc 120 agagatattg attatcatta tgaggacttt caggattgct atttggaatc ttgacgttat 180 aataagttca atagtgagac aattatttaa gcctctaact aagaagaatt attcggagtt 240 agatgatgaa gaacctatgg agttagatta tccataaaac gaac atg aaa att att 296 Met Lys Ile Ile 1 ctc ttc ctg aca ttg att gta ttt aca tct tgc gag cta tat cac tat 344 Leu Phe Leu Thr Leu Ile Val Phe Thr Ser Cys Glu Leu Tyr His Tyr 5 10 15 20 cag gag tgt gtt aga ggt acg act gta cta cta aaa gaa cct tgc cca 392 Gln Glu Cys Val Arg Gly Thr Thr Val Leu Leu Lys Glu Pro Cys Pro 25 30 35 tca gga aca tac gag ggc aat tca cca ttt cac cct ctt gct gac aat 440 Ser Gly Thr Tyr Glu Gly Asn Ser Pro Phe His Pro Leu Ala Asp Asn 40 45 50 aaa ttt gca cta act tgc act agc aca cac ttt gct ttt gct tgt gct 488 Lys Phe Ala Leu Thr Cys Thr Ser Thr His Phe Ala Phe Ala Cys Ala 55 60 65 gac ggt act cga cat acc tat cag ctg cgt gca aga tca gtt tca cca 536 Asp Gly Thr Arg His Thr Tyr Gln Leu Arg Ala Arg Ser Val Ser Pro 70 75 80 aaa ctt ttc atc aga caa gag gag gtt caa caa gag ctc tac tcg cca 584 Lys Leu Phe Ile Arg Gln Glu Glu Val Gln Gln Glu Leu Tyr Ser Pro 85 90 95 100 ctt ttt ctc att gtt gct gct cta gta ttt tta ata ctt tgc ttc acc 632 Leu Phe Leu Ile Val Ala Ala Leu Val Phe Leu Ile Leu Cys Phe Thr 105 110 115 att aag aga aag aca gaa tgaatgagct cactttaatt gacttctatt 680 Ile Lys Arg Lys Thr Glu 120 tgtgcttttt agcctttctg ctattccttg ttttaataat gcttattata ttttggtttt 740 cactcgaaat ccaggatcta gaagaacctt gtaccaaagt ctaaacgaac atgaaacttc 800 tcattgtttt gacttgtatt tctctatgca gttgcatatg cactgtagta cagcgctgtg 860 catctaataa acctcatgtg cttgaagatc cttgtaaggt acaacactag gggtaatact 920 tatagcactg cttggctttg tgctctagga aaggttttac cttttcatag atggcacact 980 atggttcaaa catgcacacc taatgttact atcaactgtc aagatccagc tggtggtgcg 1040 cttatagcta ggtgttggta ccttcatgaa ggtcaccaaa ctgctgcatt tagagacgta 1100 cttgttgttt taaataaacg aacaaattaa aatgtctgat aatggacccc aatcaaacca 1160 acgtagtgcc ccccgcatta catttggtgg acccacagat tcaactgaca ataaccagaa 1220 tggaggacgc a 1231 24 122 PRT CORONAVIRUS 24 Met Lys Ile Ile Leu Phe Leu Thr Leu Ile Val Phe Thr Ser Cys Glu 1 5 10 15 Leu Tyr His Tyr Gln Glu Cys Val Arg Gly Thr Thr Val Leu Leu Lys 20 25 30 Glu Pro Cys Pro Ser Gly Thr Tyr Glu Gly Asn Ser Pro Phe His Pro 35 40 45 Leu Ala Asp Asn Lys Phe Ala Leu Thr Cys Thr Ser Thr His Phe Ala 50 55 60 Phe Ala Cys Ala Asp Gly Thr Arg His Thr Tyr Gln Leu Arg Ala Arg 65 70 75 80 Ser Val Ser Pro Lys Leu Phe Ile Arg Gln Glu Glu Val Gln Gln Glu 85 90 95 Leu Tyr Ser Pro Leu Phe Leu Ile Val Ala Ala Leu Val Phe Leu Ile 100 105 110 Leu Cys Phe Thr Ile Lys Arg Lys Thr Glu 115 120 25 1231 DNA CORONAVIRUS CDS (650)..(781) 25 taccgtattg gaaactataa attaaataca gaccacgccg gtagcaacga caatattgct 60 ttgctagtac agtaagtgac aacagatgtt tcatcttgtt gacttccagg ttacaatagc 120 agagatattg attatcatta tgaggacttt caggattgct atttggaatc ttgacgttat 180 aataagttca atagtgagac aattatttaa gcctctaact aagaagaatt attcggagtt 240 agatgatgaa gaacctatgg agttagatta tccataaaac gaacatgaaa attattctct 300 tcctgacatt gattgtattt acatcttgcg agctatatca ctatcaggag tgtgttagag 360 gtacgactgt actactaaaa gaaccttgcc catcaggaac atacgagggc aattcaccat 420 ttcaccctct tgctgacaat aaatttgcac taacttgcac tagcacacac tttgcttttg 480 cttgtgctga cggtactcga catacctatc agctgcgtgc aagatcagtt tcaccaaaac 540 ttttcatcag acaagaggag gttcaacaag agctctactc gccacttttt ctcattgttg 600 ctgctctagt atttttaata ctttgcttca ccattaagag aaagacaga atg aat gag 658 Met Asn Glu 1 ctc act tta att gac ttc tat ttg tgc ttt tta gcc ttt ctg cta ttc 706 Leu Thr Leu Ile Asp Phe Tyr Leu Cys Phe Leu Ala Phe Leu Leu Phe 5 10 15 ctt gtt tta ata atg ctt att ata ttt tgg ttt tca ctc gaa atc cag 754 Leu Val Leu Ile Met Leu Ile Ile Phe Trp Phe Ser Leu Glu Ile Gln 20 25 30 35 gat cta gaa gaa cct tgt acc aaa gtc taaacgaaca tgaaacttct 801 Asp Leu Glu Glu Pro Cys Thr Lys Val 40 cattgttttg acttgtattt ctctatgcag ttgcatatgc actgtagtac agcgctgtgc 861 atctaataaa cctcatgtgc ttgaagatcc ttgtaaggta caacactagg ggtaatactt 921 atagcactgc ttggctttgt gctctaggaa aggttttacc ttttcataga tggcacacta 981 tggttcaaac atgcacacct aatgttacta tcaactgtca agatccagct ggtggtgcgc 1041 ttatagctag gtgttggtac cttcatgaag gtcaccaaac tgctgcattt agagacgtac 1101 ttgttgtttt aaataaacga acaaattaaa atgtctgata atggacccca atcaaaccaa 1161 cgtagtgccc cccgcattac atttggtgga cccacagatt caactgacaa taaccagaat 1221 ggaggacgca 1231 26 44 PRT CORONAVIRUS 26 Met Asn Glu Leu Thr Leu Ile Asp Phe Tyr Leu Cys Phe Leu Ala Phe 1 5 10 15 Leu Leu Phe Leu Val Leu Ile Met Leu Ile Ile Phe Trp Phe Ser Leu 20 25 30 Glu Ile Gln Asp Leu Glu Glu Pro Cys Thr Lys Val 35 40 27 1231 DNA CORONAVIRUS CDS (791)..(907) 27 taccgtattg gaaactataa attaaataca gaccacgccg gtagcaacga caatattgct 60 ttgctagtac agtaagtgac aacagatgtt tcatcttgtt gacttccagg ttacaatagc 120 agagatattg attatcatta tgaggacttt caggattgct atttggaatc ttgacgttat 180 aataagttca atagtgagac aattatttaa gcctctaact aagaagaatt attcggagtt 240 agatgatgaa gaacctatgg agttagatta tccataaaac gaacatgaaa attattctct 300 tcctgacatt gattgtattt acatcttgcg agctatatca ctatcaggag tgtgttagag 360 gtacgactgt actactaaaa gaaccttgcc catcaggaac atacgagggc aattcaccat 420 ttcaccctct tgctgacaat aaatttgcac taacttgcac tagcacacac tttgcttttg 480 cttgtgctga cggtactcga catacctatc agctgcgtgc aagatcagtt tcaccaaaac 540 ttttcatcag acaagaggag gttcaacaag agctctactc gccacttttt ctcattgttg 600 ctgctctagt atttttaata ctttgcttca ccattaagag aaagacagaa tgaatgagct 660 cactttaatt gacttctatt tgtgcttttt agcctttctg ctattccttg ttttaataat 720 gcttattata ttttggtttt cactcgaaat ccaggatcta gaagaacctt gtaccaaagt 780 ctaaacgaac atg aaa ctt ctc att gtt ttg act tgt att tct cta tgc 829 Met Lys Leu Leu Ile Val Leu Thr Cys Ile Ser Leu Cys 1 5 10 agt tgc ata tgc act gta gta cag cgc tgt gca tct aat aaa cct cat 877 Ser Cys Ile Cys Thr Val Val Gln Arg Cys Ala Ser Asn Lys Pro His 15 20 25 gtg ctt gaa gat cct tgt aag gta caa cac taggggtaat acttatagca 927 Val Leu Glu Asp Pro Cys Lys Val Gln His 30 35 ctgcttggct ttgtgctcta ggaaaggttt taccttttca tagatggcac actatggttc 987 aaacatgcac acctaatgtt actatcaact gtcaagatcc agctggtggt gcgcttatag 1047 ctaggtgttg gtaccttcat gaaggtcacc aaactgctgc atttagagac gtacttgttg 1107 ttttaaataa acgaacaaat taaaatgtct gataatggac cccaatcaaa ccaacgtagt 1167 gccccccgca ttacatttgg tggacccaca gattcaactg acaataacca gaatggagga 1227 cgca 1231 28 39 PRT CORONAVIRUS 28 Met Lys Leu Leu Ile Val Leu Thr Cys Ile Ser Leu Cys Ser Cys Ile 1 5 10 15 Cys Thr Val Val Gln Arg Cys Ala Ser Asn Lys Pro His Val Leu Glu 20 25 30 Asp Pro Cys Lys Val Gln His 35 29 1231 DNA CORONAVIRUS CDS (876)..(1127) 29 taccgtattg gaaactataa attaaataca gaccacgccg gtagcaacga caatattgct 60 ttgctagtac agtaagtgac aacagatgtt tcatcttgtt gacttccagg ttacaatagc 120 agagatattg attatcatta tgaggacttt caggattgct atttggaatc ttgacgttat 180 aataagttca atagtgagac aattatttaa gcctctaact aagaagaatt attcggagtt 240 agatgatgaa gaacctatgg agttagatta tccataaaac gaacatgaaa attattctct 300 tcctgacatt gattgtattt acatcttgcg agctatatca ctatcaggag tgtgttagag 360 gtacgactgt actactaaaa gaaccttgcc catcaggaac atacgagggc aattcaccat 420 ttcaccctct tgctgacaat aaatttgcac taacttgcac tagcacacac tttgcttttg 480 cttgtgctga cggtactcga catacctatc agctgcgtgc aagatcagtt tcaccaaaac 540 ttttcatcag acaagaggag gttcaacaag agctctactc gccacttttt ctcattgttg 600 ctgctctagt atttttaata ctttgcttca ccattaagag aaagacagaa tgaatgagct 660 cactttaatt gacttctatt tgtgcttttt agcctttctg ctattccttg ttttaataat 720 gcttattata ttttggtttt cactcgaaat ccaggatcta gaagaacctt gtaccaaagt 780 ctaaacgaac atgaaacttc tcattgtttt gacttgtatt tctctatgca gttgcatatg 840 cactgtagta cagcgctgtg catctaataa acctc atg tgc ttg aag atc ctt 893 Met Cys Leu Lys Ile Leu 1 5 gta agg tac aac act agg ggt aat act tat agc act gct tgg ctt tgt 941 Val Arg Tyr Asn Thr Arg Gly Asn Thr Tyr Ser Thr Ala Trp Leu Cys 10 15 20 gct cta gga aag gtt tta cct ttt cat aga tgg cac act atg gtt caa 989 Ala Leu Gly Lys Val Leu Pro Phe His Arg Trp His Thr Met Val Gln 25 30 35 aca tgc aca cct aat gtt act atc aac tgt caa gat cca gct ggt ggt 1037 Thr Cys Thr Pro Asn Val Thr Ile Asn Cys Gln Asp Pro Ala Gly Gly 40 45 50 gcg ctt ata gct agg tgt tgg tac ctt cat gaa ggt cac caa act gct 1085 Ala Leu Ile Ala Arg Cys Trp Tyr Leu His Glu Gly His Gln Thr Ala 55 60 65 70 gca ttt aga gac gta ctt gtt gtt tta aat aaa cga aca aat 1127 Ala Phe Arg Asp Val Leu Val Val Leu Asn Lys Arg Thr Asn 75 80 taaaatgtct gataatggac cccaatcaaa ccaacgtagt gccccccgca ttacatttgg 1187 tggacccaca gattcaactg acaataacca gaatggagga cgca 1231 30 84 PRT CORONAVIRUS 30 Met Cys Leu Lys Ile Leu Val Arg Tyr Asn Thr Arg Gly Asn Thr Tyr 1 5 10 15 Ser Thr Ala Trp Leu Cys Ala Leu Gly Lys Val Leu Pro Phe His Arg 20 25 30 Trp His Thr Met Val Gln Thr Cys Thr Pro Asn Val Thr Ile Asn Cys 35 40 45 Gln Asp Pro Ala Gly Gly Ala Leu Ile Ala Arg Cys Trp Tyr Leu His 50 55 60 Glu Gly His Gln Thr Ala Ala Phe Arg Asp Val Leu Val Val Leu Asn 65 70 75 80 Lys Arg Thr Asn 31 21221 DNA CORONAVIRUS 31 atggagagcc ttgttcttgg tgtcaacgag aaaacacacg tccaactcag tttgcctgtc 60 cttcaggtta gagacgtgct agtgcgtggc ttcggggact ctgtggaaga ggccctatcg 120 gaggcacgtg aacacctcaa aaatggcact tgtggtctag tagagctgga aaaaggcgta 180 ctgccccagc ttgaacagcc ctatgtgttc attaaacgtt ctgatgcctt aagcaccaat 240 cacggccaca aggtcgttga gctggttgca gaaatggacg gcattcagta cggtcgtagc 300 ggtataacac tgggagtact cgtgccacat gtgggcgaaa ccccaattgc ataccgcaat 360 gttcttcttc gtaagaacgg taataaggga gccggtggtc atagctatgg catcgatcta 420 aagtcttatg acttaggtga cgagcttggc actgatccca ttgaagatta tgaacaaaac 480 tggaacacta agcatggcag tggtgcactc cgtgaactca ctcgtgagct caatggaggt 540 gcagtcactc gctatgtcga caacaatttc tgtggcccag atgggtaccc tcttgattgc 600 atcaaagatt ttctcgcacg cgcgggcaag tcaatgtgca ctctttccga acaacttgat 660 tacatcgagt cgaagagagg tgtctactgc tgccgtgacc atgagcatga aattgcctgg 720 ttcactgagc gctctgataa gagctacgag caccagacac ccttcgaaat taagagtgcc 780 aagaaatttg acactttcaa aggggaatgc ccaaagtttg tgtttcctct taactcaaaa 840 gtcaaagtca ttcaaccacg tgttgaaaag

aaaaagactg agggtttcat ggggcgtata 900 cgctctgtgt accctgttgc atctccacag gagtgtaaca atatgcactt gtctaccttg 960 atgaaatgta atcattgcga tgaagtttca tggcagacgt gcgactttct gaaagccact 1020 tgtgaacatt gtggcactga aaatttagtt attgaaggac ctactacatg tgggtaccta 1080 cctactaatg ctgtagtgaa aatgccatgt cctgcctgtc aagacccaga gattggacct 1140 gagcatagtg ttgcagatta tcacaaccac tcaaacattg aaactcgact ccgcaaggga 1200 ggtaggacta gatgttttgg aggctgtgtg tttgcctatg ttggctgcta taataagcgt 1260 gcctactggg ttcctcgtgc tagtgctgat attggctcag gccatactgg cattactggt 1320 gacaatgtgg agaccttgaa tgaggatctc cttgagatac tgagtcgtga acgtgttaac 1380 attaacattg ttggcgattt tcatttgaat gaagaggttg ccatcatttt ggcatctttc 1440 tctgcttcta caagtgcctt tattgacact ataaagagtc ttgattacaa gtctttcaaa 1500 accattgttg agtcctgcgg taactataaa gttaccaagg gaaagcccgt aaaaggtgct 1560 tggaacattg gacaacagag atcagtttta acaccactgt gtggttttcc ctcacaggct 1620 gctggtgtta tcagatcaat ttttgcgcgc acacttgatg cagcaaacca ctcaattcct 1680 gatttgcaaa gagcagctgt caccatactt gatggtattt ctgaacagtc attacgtctt 1740 gtcgacgcca tggtttatac ttcagacctg ctcaccaaca gtgtcattat tatggcatat 1800 gtaactggtg gtcttgtaca acagacttct cagtggttgt ctaatctttt gggcactact 1860 gttgaaaaac tcaggcctat ctttgaatgg attgaggcga aacttagtgc aggagttgaa 1920 tttctcaagg atgcttggga gattctcaaa tttctcatta caggtgtttt tgacatcgtc 1980 aagggtcaaa tacaggttgc ttcagataac atcaaggatt gtgtaaaatg cttcattgat 2040 gttgttaaca aggcactcga aatgtgcatt gatcaagtca ctatcgctgg cgcaaagttg 2100 cgatcactca acttaggtga agtcttcatc gctcaaagca agggacttta ccgtcagtgt 2160 atacgtggca aggagcagct gcaactactc atgcctctta aggcaccaaa agaagtaacc 2220 tttcttgaag gtgattcaca tgacacagta cttacctctg aggaggttgt tctcaagaac 2280 ggtgaactcg aagcactcga gacgcccgtt gatagcttca caaatggagc tatcgttggc 2340 acaccagtct gtgtaaatgg cctcatgctc ttagagatta aggacaaaga acaatactgc 2400 gcattgtctc ctggtttact ggctacaaac aatgtctttc gcttaaaagg gggtgcacca 2460 attaaaggtg taacctttgg agaagatact gtttgggaag ttcaaggtta caagaatgtg 2520 agaatcacat ttgagcttga tgaacgtgtt gacaaagtgc ttaatgaaaa gtgctctgtc 2580 tacactgttg aatccggtac cgaagttact gagtttgcat gtgttgtagc agaggctgtt 2640 gtgaagactt tacaaccagt ttctgatctc cttaccaaca tgggtattga tcttgatgag 2700 tggagtgtag ctacattcta cttatttgat gatgctggtg aagaaaactt ttcatcacgt 2760 atgtattgtt ccttttaccc tccagatgag gaagaagagg acgatgcaga gtgtgaggaa 2820 gaagaaattg atgaaacctg tgaacatgag tacggtacag aggatgatta tcaaggtctc 2880 cctctggaat ttggtgcctc agctgaaaca gttcgagttg aggaagaaga agaggaagac 2940 tggctggatg atactactga gcaatcagag attgagccag aaccagaacc tacacctgaa 3000 gaaccagtta atcagtttac tggttattta aaacttactg acaatgttgc cattaaatgt 3060 gttgacatcg ttaaggaggc acaaagtgct aatcctatgg tgattgtaaa tgctgctaac 3120 atacacctga aacatggtgg tggtgtagca ggtgcactca acaaggcaac caatggtgcc 3180 atgcaaaagg agagtgatga ttacattaag ctaaatggcc ctcttacagt aggagggtct 3240 tgtttgcttt ctggacataa tcttgctaag aagtgtctgc atgttgttgg acctaaccta 3300 aatgcaggtg aggacatcca gcttcttaag gcagcatatg aaaatttcaa ttcacaggac 3360 atcttacttg caccattgtt gtcagcaggc atatttggtg ctaaaccact tcagtcttta 3420 caagtgtgcg tgcagacggt tcgtacacag gtttatattg cagtcaatga caaagctctt 3480 tatgagcagg ttgtcatgga ttatcttgat aacctgaagc ctagagtgga agcacctaaa 3540 caagaggagc caccaaacac agaagattcc aaaactgagg agaaatctgt cgtacagaag 3600 cctgtcgatg tgaagccaaa aattaaggcc tgcattgatg aggttaccac aacactggaa 3660 gaaactaagt ttcttaccaa taagttactc ttgtttgctg atatcaatgg taagctttac 3720 catgattctc agaacatgct tagaggtgaa gatatgtctt tccttgagaa ggatgcacct 3780 tacatggtag gtgatgttat cactagtggt gatatcactt gtgttgtaat accctccaaa 3840 aaggctggtg gcactactga gatgctctca agagctttga agaaagtgcc agttgatgag 3900 tatataacca cgtaccctgg acaaggatgt gctggttata cacttgagga agctaagact 3960 gctcttaaga aatgcaaatc tgcattttat gtactacctt cagaagcacc taatgctaag 4020 gaagagattc taggaactgt atcctggaat ttgagagaaa tgcttgctca tgctgaagag 4080 acaagaaaat taatgcctat atgcatggat gttagagcca taatggcaac catccaacgt 4140 aagtataaag gaattaaaat tcaagagggc atcgttgact atggtgtccg attcttcttt 4200 tatactagta aagagcctgt agcttctatt attacgaagc tgaactctct aaatgagccg 4260 cttgtcacaa tgccaattgg ttatgtgaca catggtttta atcttgaaga ggctgcgcgc 4320 tgtatgcgtt ctcttaaagc tcctgccgta gtgtcagtat catcaccaga tgctgttact 4380 acatataatg gatacctcac ttcgtcatca aagacatctg aggagcactt tgtagaaaca 4440 gtttctttgg ctggctctta cagagattgg tcctattcag gacagcgtac agagttaggt 4500 gttgaatttc ttaagcgtgg tgacaaaatt gtgtaccaca ctctggagag ccccgtcgag 4560 tttcatcttg acggtgaggt tctttcactt gacaaactaa agagtctctt atccctgcgg 4620 gaggttaaga ctataaaagt gttcacaact gtggacaaca ctaatctcca cacacagctt 4680 gtggatatgt ctatgacata tggacagcag tttggtccaa catacttgga tggtgctgat 4740 gttacaaaaa ttaaacctca tgtaaatcat gagggtaaga ctttctttgt actacctagt 4800 gatgacacac tacgtagtga agctttcgag tactaccata ctcttgatga gagttttctt 4860 ggtaggtaca tgtctgcttt aaaccacaca aagaaatgga aatttcctca agttggtggt 4920 ttaacttcaa ttaaatgggc tgataacaat tgttatttgt ctagtgtttt attagcactt 4980 caacagcttg aagtcaaatt caatgcacca gcacttcaag aggcttatta tagagcccgt 5040 gctggtgatg ctgctaactt ttgtgcactc atactcgctt acagtaataa aactgttggc 5100 gagcttggtg atgtcagaga aactatgacc catcttctac agcatgctaa tttggaatct 5160 gcaaagcgag ttcttaatgt ggtgtgtaaa cattgtggtc agaaaactac taccttaacg 5220 ggtgtagaag ctgtgatgta tatgggtact ctatcttatg ataatcttaa gacaggtgtt 5280 tccattccat gtgtgtgtgg tcgtgatgct acacaatatc tagtacaaca agagtcttct 5340 tttgttatga tgtctgcacc acctgctgag tataaattac agcaaggtac attcttatgt 5400 gcgaatgagt acactggtaa ctatcagtgt ggtcattaca ctcatataac tgctaaggag 5460 accctctatc gtattgacgg agctcacctt acaaagatgt cagagtacaa aggaccagtg 5520 actgatgttt tctacaagga aacatcttac actacaacca tcaagcctgt gtcgtataaa 5580 ctcgatggag ttacttacac agagattgaa ccaaaattgg atgggtatta taaaaaggat 5640 aatgcttact atacagagca gcctatagac cttgtaccaa ctcaaccatt accaaatgcg 5700 agttttgata atttcaaact cacatgttct aacacaaaat ttgctgatga tttaaatcaa 5760 atgacaggct tcacaaagcc agcttcacga gagctatctg tcacattctt cccagacttg 5820 aatggcgatg tagtggctat tgactataga cactattcag cgagtttcaa gaaaggtgct 5880 aaattactgc ataagccaat tgtttggcac attaaccagg ctacaaccaa gacaacgttc 5940 aaaccaaaca cttggtgttt acgttgtctt tggagtacaa agccagtaga tacttcaaat 6000 tcatttgaag ttctggcagt agaagacaca caaggaatgg acaatcttgc ttgtgaaagt 6060 caacaaccca cctctgaaga agtagtggaa aatcctacca tacagaagga agtcatagag 6120 tgtgacgtga aaactaccga agttgtaggc aatgtcatac ttaaaccatc agatgaaggt 6180 gttaaagtaa cacaagagtt aggtcatgag gatcttatgg ctgcttatgt ggaaaacaca 6240 agcattacca ttaagaaacc taatgagctt tcactagcct taggtttaaa aacaattgcc 6300 actcatggta ttgctgcaat taatagtgtt ccttggagta aaattttggc ttatgtcaaa 6360 ccattcttag gacaagcagc aattacaaca tcaaattgcg ctaagagatt agcacaacgt 6420 gtgtttaaca attatatgcc ttatgtgttt acattattgt tccaattgtg tacttttact 6480 aaaagtacca attctagaat tagagcttca ctacctacaa ctattgctaa aaatagtgtt 6540 aagagtgttg ctaaattatg tttggatgcc ggcattaatt atgtgaagtc acccaaattt 6600 tctaaattgt tcacaatcgc tatgtggcta ttgttgttaa gtatttgctt aggttctcta 6660 atctgtgtaa ctgctgcttt tggtgtactc ttatctaatt ttggtgctcc ttcttattgt 6720 aatggcgtta gagaattgta tcttaattcg tctaacgtta ctactatgga tttctgtgaa 6780 ggttcttttc cttgcagcat ttgtttaagt ggattagact cccttgattc ttatccagct 6840 cttgaaacca ttcaggtgac gatttcatcg tacaagctag acttgacaat tttaggtctg 6900 gccgctgagt gggttttggc atatatgttg ttcacaaaat tcttttattt attaggtctt 6960 tcagctataa tgcaggtgtt ctttggctat tttgctagtc atttcatcag caattcttgg 7020 ctcatgtggt ttatcattag tattgtacaa atggcacccg tttctgcaat ggttaggatg 7080 tacatcttct ttgcttcttt ctactacata tggaagagct atgttcatat catggatggt 7140 tgcacctctt cgacttgcat gatgtgctat aagcgcaatc gtgccacacg cgttgagtgt 7200 acaactattg ttaatggcat gaagagatct ttctatgtct atgcaaatgg aggccgtggc 7260 ttctgcaaga ctcacaattg gaattgtctc aattgtgaca cattttgcac tggtagtaca 7320 ttcattagtg atgaagttgc tcgtgatttg tcactccagt ttaaaagacc aatcaaccct 7380 actgaccagt catcgtatat tgttgatagt gttgctgtga aaaatggcgc gcttcacctc 7440 tactttgaca aggctggtca aaagacctat gagagacatc cgctctccca ttttgtcaat 7500 ttagacaatt tgagagctaa caacactaaa ggttcactgc ctattaatgt catagttttt 7560 gatggcaagt ccaaatgcga cgagtctgct tctaagtctg cttctgtgta ctacagtcag 7620 ctgatgtgcc aacctattct gttgcttgac caagctcttg tatcagacgt tggagatagt 7680 actgaagttt ccgttaagat gtttgatgct tatgtcgaca ccttttcagc aacttttagt 7740 gttcctatgg aaaaacttaa ggcacttgtt gctacagctc acagcgagtt agcaaagggt 7800 gtagctttag atggtgtcct ttctacattc gtgtcagctg cccgacaagg tgttgttgat 7860 accgatgttg acacaaagga tgttattgaa tgtctcaaac tttcacatca ctctgactta 7920 gaagtgacag gtgacagttg taacaatttc atgctcacct ataataaggt tgaaaacatg 7980 acgcccagag atcttggcgc atgtattgac tgtaatgcaa ggcatatcaa tgcccaagta 8040 gcaaaaagtc acaatgtttc actcatctgg aatgtaaaag actacatgtc tttatctgaa 8100 cagctgcgta aacaaattcg tagtgctgcc aagaagaaca acataccttt tagactaact 8160 tgtgctacaa ctagacaggt tgtcaatgtc ataactacta aaatctcact caagggtggt 8220 aagattgtta gtacttgttt taaacttatg cttaaggcca cattattgtg cgttcttgct 8280 gcattggttt gttatatcgt tatgccagta catacattgt caatccatga tggttacaca 8340 aatgaaatca ttggttacaa agccattcag gatggtgtca ctcgtgacat catttctact 8400 gatgattgtt ttgcaaataa acatgctggt tttgacgcat ggtttagcca gcgtggtggt 8460 tcatacaaaa atgacaaaag ctgccctgta gtagctgcta tcattacaag agagattggt 8520 ttcatagtgc ctggcttacc gggtactgtg ctgagagcaa tcaatggtga cttcttgcat 8580 tttctacctc gtgtttttag tgctgttggc aacatttgct acacaccttc caaactcatt 8640 gagtatagtg attttgctac ctctgcttgc gttcttgctg ctgagtgtac aatttttaag 8700 gatgctatgg gcaaacctgt gccatattgt tatgacacta atttgctaga gggttctatt 8760 tcttatagtg agcttcgtcc agacactcgt tatgtgctta tggatggttc catcatacag 8820 tttcctaaca cttacctgga gggttctgtt agagtagtaa caacttttga tgctgagtac 8880 tgtagacatg gtacatgcga aaggtcagaa gtaggtattt gcctatctac cagtggtaga 8940 tgggttctta ataatgagca ttacagagct ctatcaggag ttttctgtgg tgttgatgcg 9000 atgaatctca tagctaacat ctttactcct cttgtgcaac ctgtgggtgc tttagatgtg 9060 tctgcttcag tagtggctgg tggtattatt gccatattgg tgacttgtgc tgcctactac 9120 tttatgaaat tcagacgtgt ttttggtgag tacaaccatg ttgttgctgc taatgcactt 9180 ttgtttttga tgtctttcac tatactctgt ctggtaccag cttacagctt tctgccggga 9240 gtctactcag tcttttactt gtacttgaca ttctatttca ccaatgatgt ttcattcttg 9300 gctcaccttc aatggtttgc catgttttct cctattgtgc ctttttggat aacagcaatc 9360 tatgtattct gtatttctct gaagcactgc cattggttct ttaacaacta tcttaggaaa 9420 agagtcatgt ttaatggagt tacatttagt accttcgagg aggctgcttt gtgtaccttt 9480 ttgctcaaca aggaaatgta cctaaaattg cgtagcgaga cactgttgcc acttacacag 9540 tataacaggt atcttgctct atataacaag tacaagtatt tcagtggagc cttagatact 9600 accagctatc gtgaagcagc ttgctgccac ttagcaaagg ctctaaatga ctttagcaac 9660 tcaggtgctg atgttctcta ccaaccacca cagacatcaa tcacttctgc tgttctgcag 9720 agtggtttta ggaaaatggc attcccgtca ggcaaagttg aagggtgcat ggtacaagta 9780 acctgtggaa ctacaactct taatggattg tggttggatg acacagtata ctgtccaaga 9840 catgtcattt gcacagcaga agacatgctt aatcctaact atgaagatct gctcattcgc 9900 aaatccaacc atagctttct tgttcaggct ggcaatgttc aacttcgtgt tattggccat 9960 tctatgcaaa attgtctgct taggcttaaa gttgatactt ctaaccctaa gacacccaag 10020 tataaatttg tccgtatcca acctggtcaa acattttcag ttctagcatg ctacaatggt 10080 tcaccatctg gtgtttatca gtgtgccatg agacctaatc ataccattaa aggttctttc 10140 cttaatggat catgtggtag tgttggtttt aacattgatt atgattgcgt gtctttctgc 10200 tatatgcatc atatggagct tccaacagga gtacacgctg gtactgactt agaaggtaaa 10260 ttctatggtc catttgttga cagacaaact gcacaggctg caggtacaga cacaaccata 10320 acattaaatg ttttggcatg gctgtatgct gctgttatca atggtgatag gtggtttctt 10380 aatagattca ccactacttt gaatgacttt aaccttgtgg caatgaagta caactatgaa 10440 cctttgacac aagatcatgt tgacatattg ggacctcttt ctgctcaaac aggaattgcc 10500 gtcttagata tgtgtgctgc tttgaaagag ctgctgcaga atggtatgaa tggtcgtact 10560 atccttggta gcactatttt agaagatgag tttacaccat ttgatgttgt tagacaatgc 10620 tctggtgtta ccttccaagg taagttcaag aaaattgtta agggcactca tcattggatg 10680 cttttaactt tcttgacatc actattgatt cttgttcaaa gtacacagtg gtcactgttt 10740 ttctttgttt acgagaatgc tttcttgcca tttactcttg gtattatggc aattgctgca 10800 tgtgctatgc tgcttgttaa gcataagcac gcattcttgt gcttgtttct gttaccttct 10860 cttgcaacag ttgcttactt taatatggtc tacatgcctg ctagctgggt gatgcgtatc 10920 atgacatggc ttgaattggc tgacactagc ttgtctggtt ataggcttaa ggattgtgtt 10980 atgtatgctt cagctttagt tttgcttatt ctcatgacag ctcgcactgt ttatgatgat 11040 gctgctagac gtgtttggac actgatgaat gtcattacac ttgtttacaa agtctactat 11100 ggtaatgctt tagatcaagc tatttccatg tgggccttag ttatttctgt aacctctaac 11160 tattctggtg tcgttacgac tatcatgttt ttagctagag ctatagtgtt tgtgtgtgtt 11220 gagtattacc cattgttatt tattactggc aacaccttac agtgtatcat gcttgtttat 11280 tgtttcttag gctattgttg ctgctgctac tttggccttt tctgtttact caaccgttac 11340 ttcaggctta ctcttggtgt ttatgactac ttggtctcta cacaagaatt taggtatatg 11400 aactcccagg ggcttttgcc tcctaagagt agtattgatg ctttcaagct taacattaag 11460 ttgttgggta ttggaggtaa accatgtatc aaggttgcta ctgtacagtc taaaatgtct 11520 gacgtaaagt gcacatctgt ggtactgctc tcggttcttc aacaacttag agtagagtca 11580 tcttctaaat tgtgggcaca atgtgtacaa ctccacaatg atattcttct tgcaaaagac 11640 acaactgaag ctttcgagaa gatggtttct cttttgtctg ttttgctatc catgcagggt 11700 gctgtagaca ttaataggtt gtgcgaggaa atgctcgata accgtgctac tcttcaggct 11760 attgcttcag aatttagttc tttaccatca tatgccgctt atgccactgc ccaggaggcc 11820 tatgagcagg ctgtagctaa tggtgattct gaagtcgttc tcaaaaagtt aaagaaatct 11880 ttgaatgtgg ctaaatctga gtttgaccgt gatgctgcca tgcaacgcaa gttggaaaag 11940 atggcagatc aggctatgac ccaaatgtac aaacaggcaa gatctgagga caagagggca 12000 aaagtaacta gtgctatgca aacaatgctc ttcactatgc ttaggaagct tgataatgat 12060 gcacttaaca acattatcaa caatgcgcgt gatggttgtg ttccactcaa catcatacca 12120 ttgactacag cagccaaact catggttgtt gtccctgatt atggtaccta caagaacact 12180 tgtgatggta acacctttac atatgcatct gcactctggg aaatccagca agttgttgat 12240 gcggatagca agattgttca acttagtgaa attaacatgg acaattcacc aaatttggct 12300 tggcctctta ttgttacagc tctaagagcc aactcagctg ttaaactaca gaataatgaa 12360 ctgagtccag tagcactacg acagatgtcc tgtgcggctg gtaccacaca aacagcttgt 12420 actgatgaca atgcacttgc ctactataac aattcgaagg gaggtaggtt tgtgctggca 12480 ttactatcag accaccaaga tctcaaatgg gctagattcc ctaagagtga tggtacaggt 12540 acaatttaca cagaactgga accaccttgt aggtttgtta cagacacacc aaaagggcct 12600 aaagtgaaat acttgtactt catcaaaggc ttaaacaacc taaatagagg tatggtgctg 12660 ggcagtttag ctgctacagt acgtcttcag gctggaaatg ctacagaagt acctgccaat 12720 tcaactgtgc tttccttctg tgcttttgca gtagaccctg ctaaagcata taaggattac 12780 ctagcaagtg gaggacaacc aatcaccaac tgtgtgaaga tgttgtgtac acacactggt 12840 acaggacagg caattactgt aacaccagaa gctaacatgg accaagagtc ctttggtggt 12900 gcttcatgtt gtctgtattg tagatgccac attgaccatc caaatcctaa aggattctgt 12960 gacttgaaag gtaagtacgt ccaaatacct accacttgtg ctaatgaccc agtgggtttt 13020 acacttagaa acacagtctg taccgtctgc ggaatgtgga aaggttatgg ctgtagttgt 13080 gaccaactcc gcgaaccctt gatgcagtct gcggatgcat caacgttttt aaacgggttt 13140 gcggtgtaag tgcagcccgt cttacaccgt gcggcacagg cactagtact gatgtcgtct 13200 acagggcttt tgatatttac aacgaaaaag ttgctggttt tgcaaagttc ctaaaaacta 13260 attgctgtcg cttccaggag aaggatgagg aaggcaattt attagactct tactttgtag 13320 ttaagaggca tactatgtct aactaccaac atgaagagac tatttataac ttggttaaag 13380 attgtccagc ggttgctgtc catgactttt tcaagtttag agtagatggt gacatggtac 13440 cacatatatc acgtcagcgt ctaactaaat acacaatggc tgatttagtc tatgctctac 13500 gtcattttga tgagggtaat tgtgatacat taaaagaaat actcgtcaca tacaattgct 13560 gtgatgatga ttatttcaat aagaaggatt ggtatgactt cgtagagaat cctgacatct 13620 tacgcgtata tgctaactta ggtgagcgtg tacgccaatc attattaaag actgtacaat 13680 tctgcgatgc tatgcgtgat gcaggcattg taggcgtact gacattagat aatcaggatc 13740 ttaatgggaa ctggtacgat ttcggtgatt tcgtacaagt agcaccaggc tgcggagttc 13800 ctattgtgga ttcatattac tcattgctga tgcccatcct cactttgact agggcattgg 13860 ctgctgagtc ccatatggat gctgatctcg caaaaccact tattaagtgg gatttgctga 13920 aatatgattt tacggaagag agactttgtc tcttcgaccg ttattttaaa tattgggacc 13980 agacatacca tcccaattgt attaactgtt tggatgatag gtgtatcctt cattgtgcaa 14040 actttaatgt gttattttct actgtgtttc cacctacaag ttttggacca ctagtaagaa 14100 aaatatttgt agatggtgtt ccttttgttg tttcaactgg ataccatttt cgtgagttag 14160 gagtcgtaca taatcaggat gtaaacttac atagctcgcg tctcagtttc aaggaacttt 14220 tagtgtatgc tgctgatcca gctatgcatg cagcttctgg caatttattg ctagataaac 14280 gcactacatg cttttcagta gctgcactaa caaacaatgt tgcttttcaa actgtcaaac 14340 ccggtaattt taataaagac ttttatgact ttgctgtgtc taaaggtttc tttaaggaag 14400 gaagttctgt tgaactaaaa cacttcttct ttgctcagga tggcaacgct gctatcagtg 14460 attatgacta ttatcgttat aatctgccaa caatgtgtga tatcagacaa ctcctattcg 14520 tagttgaagt tgttgataaa tactttgatt gttacgatgg tggctgtatt aatgccaacc 14580 aagtaatcgt taacaatctg gataaatcag ctggtttccc atttaataaa tggggtaagg 14640 ctagacttta ttatgactca atgagttatg aggatcaaga tgcacttttc gcgtatacta 14700 agcgtaatgt catccctact ataactcaaa tgaatcttaa gtatgccatt agtgcaaaga 14760 atagagctcg caccgtagct ggtgtctcta tctgtagtac tatgacaaat agacagtttc 14820 atcagaaatt attgaagtca atagccgcca ctagaggagc tactgtggta attggaacaa 14880 gcaagtttta cggtggctgg cataatatgt taaaaactgt ttacagtgat gtagaaactc 14940 cacaccttat gggttgggat tatccaaaat gtgacagagc catgcctaac atgcttagga 15000 taatggcctc tcttgttctt gctcgcaaac ataacacttg ctgtaactta tcacaccgtt 15060 tctacaggtt agctaacgag tgtgcgcaag tattaagtga gatggtcatg tgtggcggct 15120 cactatatgt taaaccaggt ggaacatcat ccggtgatgc tacaactgct tatgctaata 15180 gtgtctttaa catttgtcaa gctgttacag ccaatgtaaa tgcacttctt tcaactgatg 15240 gtaataagat agctgacaag tatgtccgca atctacaaca caggctctat gagtgtctct 15300 atagaaatag ggatgttgat catgaattcg tggatgagtt ttacgcttac ctgcgtaaac 15360 atttctccat gatgattctt tctgatgatg ccgttgtgtg ctataacagt aactatgcgg 15420 ctcaaggttt agtagctagc attaagaact ttaaggcagt tctttattat caaaataatg 15480 tgttcatgtc tgaggcaaaa tgttggactg agactgacct tactaaagga cctcacgaat 15540 tttgctcaca gcatacaatg ctagttaaac aaggagatga ttacgtgtac ctgccttacc 15600 cagatccatc aagaatatta ggcgcaggct gttttgtcga tgatattgtc aaaacagatg 15660 gtacacttat gattgaaagg ttcgtgtcac tggctattga tgcttaccca cttacaaaac 15720 atcctaatca ggagtatgct gatgtctttc acttgtattt acaatacatt agaaagttac 15780 atgatgagct tactggccac atgttggaca tgtattccgt aatgctaact aatgataaca 15840 cctcacggta ctgggaacct gagttttatg aggctatgta cacaccacat acagtcttgc 15900 aggctgtagg tgcttgtgta ttgtgcaatt

cacagacttc acttcgttgc ggtgcctgta 15960 ttaggagacc attcctatgt tgcaagtgct gctatgacca tgtcatttca acatcacaca 16020 aattagtgtt gtctgttaat ccctatgttt gcaatgcccc aggttgtgat gtcactgatg 16080 tgacacaact gtatctagga ggtatgagct attattgcaa gtcacataag cctcccatta 16140 gttttccatt atgtgctaat ggtcaggttt ttggtttata caaaaacaca tgtgtaggca 16200 gtgacaatgt cactgacttc aatgcgatag caacatgtga ttggactaat gctggcgatt 16260 acatacttgc caacacttgt actgagagac tcaagctttt cgcagcagaa acgctcaaag 16320 ccactgagga aacatttaag ctgtcatatg gtattgccac tgtacgcgaa gtactctctg 16380 acagagaatt gcatctttca tgggaggttg gaaaacctag accaccattg aacagaaact 16440 atgtctttac tggttaccgt gtaactaaaa atagtaaagt acagattgga gagtacacct 16500 ttgaaaaagg tgactatggt gatgctgttg tgtacagagg tactacgaca tacaagttga 16560 atgttggtga ttactttgtg ttgacatctc acactgtaat gccacttagt gcacctactc 16620 tagtgccaca agagcactat gtgagaatta ctggcttgta cccaacactc aacatctcag 16680 atgagttttc tagcaatgtt gcaaattatc aaaaggtcgg catgcaaaag tactctacac 16740 tccaaggacc acctggtact ggtaagagtc attttgccat cggacttgct ctctattacc 16800 catctgctcg catagtgtat acggcatgct ctcatgcagc tgttgatgcc ctatgtgaaa 16860 aggcattaaa atatttgccc atagataaat gtagtagaat catacctgcg cgtgcgcgcg 16920 tagagtgttt tgataaattc aaagtgaatt caacactaga acagtatgtt ttctgcactg 16980 taaatgcatt gccagaaaca actgctgaca ttgtagtctt tgatgaaatc tctatggcta 17040 ctaattatga cttgagtgtt gtcaatgcta gacttcgtgc aaaacactac gtctatattg 17100 gcgatcctgc tcaattacca gccccccgca cattgctgac taaaggcaca ctagaaccag 17160 aatattttaa ttcagtgtgc agacttatga aaacaatagg tccagacatg ttccttggaa 17220 cttgtcgccg ttgtcctgct gaaattgttg acactgtgag tgctttagtt tatgacaata 17280 agctaaaagc acacaaggat aagtcagctc aatgcttcaa aatgttctac aaaggtgtta 17340 ttacacatga tgtttcatct gcaatcaaca gacctcaaat aggcgttgta agagaatttc 17400 ttacacgcaa tcctgcttgg agaaaagctg tttttatctc accttataat tcacagaacg 17460 ctgtagcttc aaaaatctta ggattgccta cgcagactgt tgattcatca cagggttctg 17520 aatatgacta tgtcatattc acacaaacta ctgaaacagc acactcttgt aatgtcaacc 17580 gcttcaatgt ggctatcaca agggcaaaaa ttggcatttt gtgcataatg tctgatagag 17640 atctttatga caaactgcaa tttacaagtc tagaaatacc acgtcgcaat gtggctacat 17700 tacaagcaga aaatgtaact ggacttttta aggactgtag taagatcatt actggtcttc 17760 atcctacaca ggcacctaca cacctcagcg ttgatataaa gttcaagact gaaggattat 17820 gtgttgacat accaggcata ccaaaggaca tgacctaccg tagactcatc tctatgatgg 17880 gtttcaaaat gaattaccaa gtcaatggtt accctaatat gtttatcacc cgcgaagaag 17940 ctattcgtca cgttcgtgcg tggattggct ttgatgtaga gggctgtcat gcaactagag 18000 atgctgtggg tactaaccta cctctccagc taggattttc tacaggtgtt aacttagtag 18060 ctgtaccgac tggttatgtt gacactgaaa ataacacaga attcaccaga gttaatgcaa 18120 aacctccacc aggtgaccag tttaaacatc ttataccact catgtataaa ggcttgccct 18180 ggaatgtagt gcgtattaag atagtacaaa tgctcagtga tacactgaaa ggattgtcag 18240 acagagtcgt gttcgtcctt tgggcgcatg gctttgagct tacatcaatg aagtactttg 18300 tcaagattgg acctgaaaga acgtgttgtc tgtgtgacaa acgtgcaact tgcttttcta 18360 cttcatcaga tacttatgcc tgctggaatc attctgtggg ttttgactat gtctataacc 18420 catttatgat tgatgttcag cagtggggct ttacgggtaa ccttcagagt aaccatgacc 18480 aacattgcca ggtacatgga aatgcacatg tggctagttg tgatgctatc atgactagat 18540 gtttagcagt ccatgagtgc tttgttaagc gcgttgattg gtctgttgaa taccctatta 18600 taggagatga actgagggtt aattctgctt gcagaaaagt acaacacatg gttgtgaagt 18660 ctgcattgct tgctgataag tttccagttc ttcatgacat tggaaatcca aaggctatca 18720 agtgtgtgcc tcaggctgaa gtagaatgga agttctacga tgctcagcca tgtagtgaca 18780 aagcttacaa aatagaggaa ctcttctatt cttatgctac acatcacgat aaattcactg 18840 atggtgtttg tttgttttgg aattgtaacg ttgatcgtta cccagccaat gcaattgtgt 18900 gtaggtttga cacaagagtc ttgtcaaact tgaacttacc aggctgtgat ggtggtagtt 18960 tgtatgtgaa taagcatgca ttccacactc cagctttcga taaaagtgca tttactaatt 19020 taaagcaatt gcctttcttt tactattctg atagtccttg tgagtctcat ggcaaacaag 19080 tagtgtcgga tattgattat gttccactca aatctgctac gtgtattaca cgatgcaatt 19140 taggtggtgc tgtttgcaga caccatgcaa atgagtaccg acagtacttg gatgcatata 19200 atatgatgat ttctgctgga tttagcctat ggatttacaa acaatttgat acttataacc 19260 tgtggaatac atttaccagg ttacagagtt tagaaaatgt ggcttataat gttgttaata 19320 aaggacactt tgatggacac gccggcgaag cacctgtttc catcattaat aatgctgttt 19380 acacaaaggt agatggtatt gatgtggaga tctttgaaaa taagacaaca cttcctgtta 19440 atgttgcatt tgagctttgg gctaagcgta acattaaacc agtgccagag attaagatac 19500 tcaataattt gggtgttgat atcgctgcta atactgtaat ctgggactac aaaagagaag 19560 ccccagcaca tgtatctaca ataggtgtct gcacaatgac tgacattgcc aagaaaccta 19620 ctgagagtgc ttgttcttca cttactgtct tgtttgatgg tagagtggaa ggacaggtag 19680 acctttttag aaacgcccgt aatggtgttt taataacaga aggttcagtc aaaggtctaa 19740 caccttcaaa gggaccagca caagctagcg tcaatggagt cacattaatt ggagaatcag 19800 taaaaacaca gtttaactac tttaagaaag tagacggcat tattcaacag ttgcctgaaa 19860 cctactttac tcagagcaga gacttagagg attttaagcc cagatcacaa atggaaactg 19920 actttctcga gctcgctatg gatgaattca tacagcgata taagctcgag ggctatgcct 19980 tcgaacacat cgtttatgga gatttcagtc atggacaact tggcggtctt catttaatga 20040 taggcttagc caagcgctca caagattcac cacttaaatt agaggatttt atccctatgg 20100 acagcacagt gaaaaattac ttcataacag atgcgcaaac aggttcatca aaatgtgtgt 20160 gttctgtgat tgatctttta cttgatgact ttgtcgagat aataaagtca caagatttgt 20220 cagtgatttc aaaagtggtc aaggttacaa ttgactatgc tgaaatttca ttcatgcttt 20280 ggtgtaagga tggacatgtt gaaaccttct acccaaaact acaagcaagt caagcgtggc 20340 aaccaggtgt tgcgatgcct aacttgtaca agatgcaaag aatgcttctt gaaaagtgtg 20400 accttcagaa ttatggtgaa aatgctgtta taccaaaagg aataatgatg aatgtcgcaa 20460 agtatactca actgtgtcaa tacttaaata cacttacttt agctgtaccc tacaacatga 20520 gagttattca ctttggtgct ggctctgata aaggagttgc accaggtaca gctgtgctca 20580 gacaatggtt gccaactggc acactacttg tcgattcaga tcttaatgac ttcgtctccg 20640 acgcagattc tactttaatt ggagactgtg caacagtaca tacggctaat aaatgggacc 20700 ttattattag cgatatgtat gaccctagga ccaaacatgt gacaaaagag aatgactcta 20760 aagaagggtt tttcacttat ctgtgtggat ttataaagca aaaactagcc ctgggtggtt 20820 ctatagctgt aaagataaca gagcattctt ggaatgctga cctttacaag cttatgggcc 20880 atttctcatg gtggacagct tttgttacaa atgtaaatgc atcatcatcg gaagcatttt 20940 taattggggc taactatctt ggcaagccga aggaacaaat tgatggctat accatgcatg 21000 ctaactacat tttctggagg aacacaaatc ctatccagtt gtcttcctat tcactctttg 21060 acatgagcaa atttcctctt aaattaagag gaactgctgt aatgtctctt aaggagaatc 21120 aaatcaatga tatgatttat tctcttctgg aaaaaggtag gcttatcatt agagaaaaca 21180 acagagttgt ggtttcaagt gatattcttg ttaacaacta a 21221 32 297 DNA CORONAVIRUS 32 atggacccca atcaaaccaa cgtagtgccc cccgcattac atttggtgga cccacagatt 60 caactgacaa taaccagaat ggaggacgca atggggcaag gccaaaacag cgccgacccc 120 aaggtttacc caataatact gcgtcttggt tcacagctct cactcagcat ggcaaggagg 180 aacttagatt ccctcgaggc cagggcgttc caatcaacac caatagtggt ccagatgacc 240 aaattggcta ctaccgaaga gctacccgac gagttcgtgg tggtgacggc aaaatga 297 33 98 PRT CORONAVIRUS 33 Met Asp Pro Asn Gln Thr Asn Val Val Pro Pro Ala Leu His Leu Val 1 5 10 15 Asp Pro Gln Ile Gln Leu Thr Ile Thr Arg Met Glu Asp Ala Met Gly 20 25 30 Gln Gly Gln Asn Ser Ala Asp Pro Lys Val Tyr Pro Ile Ile Leu Arg 35 40 45 Leu Gly Ser Gln Leu Ser Leu Ser Met Ala Arg Arg Asn Leu Asp Ser 50 55 60 Leu Glu Ala Arg Ala Phe Gln Ser Thr Pro Ile Val Val Gln Met Thr 65 70 75 80 Lys Leu Ala Thr Thr Glu Glu Leu Pro Asp Glu Phe Val Val Val Thr 85 90 95 Ala Lys 34 213 DNA CORONAVIRUS 34 atgctgccac cgtgctacaa cttcctcaag gaacaacatt gccaaaaggc ttctacgcag 60 agggaagcag aggcggcagt caagcctctt ctcgctcctc atcacgtagt cgcggtaatt 120 caagaaattc aactcctggc agcagtaggg gaaattctcc tgctcgaatg gctagcggag 180 gtggtgaaac tgccctcgcg ctattgctgc tag 213 35 70 PRT CORONAVIRUS 35 Met Leu Pro Pro Cys Tyr Asn Phe Leu Lys Glu Gln His Cys Gln Lys 1 5 10 15 Ala Ser Thr Gln Arg Glu Ala Glu Ala Ala Val Lys Pro Leu Leu Ala 20 25 30 Pro His His Val Val Ala Val Ile Gln Glu Ile Gln Leu Leu Ala Ala 35 40 45 Val Gly Glu Ile Leu Leu Leu Glu Trp Leu Ala Glu Val Val Lys Leu 50 55 60 Pro Ser Arg Tyr Cys Cys 65 70 36 1377 DNA CORONAVIRUS CDS (67)..(1335) 36 atgaaggtca ccaaactgct gcatttagag acgtacttgt tgttttaaat aaacgaacaa 60 attaaa atg tct gat aat gga ccc caa tca aac caa cgt agt gcc ccc 108 Met Ser Asp Asn Gly Pro Gln Ser Asn Gln Arg Ser Ala Pro 1 5 10 cgc att aca ttt ggt gga ccc aca gat tca act gac aat aac cag aat 156 Arg Ile Thr Phe Gly Gly Pro Thr Asp Ser Thr Asp Asn Asn Gln Asn 15 20 25 30 gga gga cgc aat ggg gca agg cca aaa cag cgc cga ccc caa ggt tta 204 Gly Gly Arg Asn Gly Ala Arg Pro Lys Gln Arg Arg Pro Gln Gly Leu 35 40 45 ccc aat aat act gcg tct tgg ttc aca gct ctc act cag cat ggc aag 252 Pro Asn Asn Thr Ala Ser Trp Phe Thr Ala Leu Thr Gln His Gly Lys 50 55 60 gag gaa ctt aga ttc cct cga ggc cag ggc gtt cca atc aac acc aat 300 Glu Glu Leu Arg Phe Pro Arg Gly Gln Gly Val Pro Ile Asn Thr Asn 65 70 75 agt ggt cca gat gac caa att ggc tac tac cga aga gct acc cga cga 348 Ser Gly Pro Asp Asp Gln Ile Gly Tyr Tyr Arg Arg Ala Thr Arg Arg 80 85 90 gtt cgt ggt ggt gac ggc aaa atg aaa gag ctc agc ccc aga tgg tac 396 Val Arg Gly Gly Asp Gly Lys Met Lys Glu Leu Ser Pro Arg Trp Tyr 95 100 105 110 ttc tat tac cta gga act ggc cca gaa gct tca ctt ccc tac ggc gct 444 Phe Tyr Tyr Leu Gly Thr Gly Pro Glu Ala Ser Leu Pro Tyr Gly Ala 115 120 125 aac aaa gaa ggc atc gta tgg gtt gca act gag gga gcc ttg aat aca 492 Asn Lys Glu Gly Ile Val Trp Val Ala Thr Glu Gly Ala Leu Asn Thr 130 135 140 ccc aaa gac cac att ggc acc cgc aat cct aat aac aat gct gcc acc 540 Pro Lys Asp His Ile Gly Thr Arg Asn Pro Asn Asn Asn Ala Ala Thr 145 150 155 gtg cta caa ctt cct caa gga aca aca ttg cca aaa ggc ttc tac gca 588 Val Leu Gln Leu Pro Gln Gly Thr Thr Leu Pro Lys Gly Phe Tyr Ala 160 165 170 gag gga agc aga ggc ggc agt caa gcc tct tct cgc tcc tca tca cgt 636 Glu Gly Ser Arg Gly Gly Ser Gln Ala Ser Ser Arg Ser Ser Ser Arg 175 180 185 190 agt cgc ggt aat tca aga aat tca act cct ggc agc agt agg gga aat 684 Ser Arg Gly Asn Ser Arg Asn Ser Thr Pro Gly Ser Ser Arg Gly Asn 195 200 205 tct cct gct cga atg gct agc gga ggt ggt gaa act gcc ctc gcg cta 732 Ser Pro Ala Arg Met Ala Ser Gly Gly Gly Glu Thr Ala Leu Ala Leu 210 215 220 ttg ctg cta gac aga ttg aac cag ctt gag agc aaa gtt tct ggt aaa 780 Leu Leu Leu Asp Arg Leu Asn Gln Leu Glu Ser Lys Val Ser Gly Lys 225 230 235 ggc caa caa caa caa ggc caa act gtc act aag aaa tct gct gct gag 828 Gly Gln Gln Gln Gln Gly Gln Thr Val Thr Lys Lys Ser Ala Ala Glu 240 245 250 gca tct aaa aag cct cgc caa aaa cgt act gcc aca aaa cag tac aac 876 Ala Ser Lys Lys Pro Arg Gln Lys Arg Thr Ala Thr Lys Gln Tyr Asn 255 260 265 270 gtc act caa gca ttt ggg aga cgt ggt cca gaa caa acc caa gga aat 924 Val Thr Gln Ala Phe Gly Arg Arg Gly Pro Glu Gln Thr Gln Gly Asn 275 280 285 ttc ggg gac caa gac cta atc aga caa gga act gat tac aaa cat tgg 972 Phe Gly Asp Gln Asp Leu Ile Arg Gln Gly Thr Asp Tyr Lys His Trp 290 295 300 ccg caa att gca caa ttt gct cca agt gcc tct gca ttc ttt gga atg 1020 Pro Gln Ile Ala Gln Phe Ala Pro Ser Ala Ser Ala Phe Phe Gly Met 305 310 315 tca cgc att ggc atg gaa gtc aca cct tcg gga aca tgg ctg act tat 1068 Ser Arg Ile Gly Met Glu Val Thr Pro Ser Gly Thr Trp Leu Thr Tyr 320 325 330 cat gga gcc att aaa ttg gat gac aaa gat cca caa ttc aaa gac aac 1116 His Gly Ala Ile Lys Leu Asp Asp Lys Asp Pro Gln Phe Lys Asp Asn 335 340 345 350 gtc ata ctg ctg aac aag cac att gac gca tac aaa aca ttc cca cca 1164 Val Ile Leu Leu Asn Lys His Ile Asp Ala Tyr Lys Thr Phe Pro Pro 355 360 365 aca gag cct aaa aag gac aaa aag aaa aag act gat gaa gct cag cct 1212 Thr Glu Pro Lys Lys Asp Lys Lys Lys Lys Thr Asp Glu Ala Gln Pro 370 375 380 ttg ccg cag aga caa aag aag cag ccc act gtg act ctt ctt cct gcg 1260 Leu Pro Gln Arg Gln Lys Lys Gln Pro Thr Val Thr Leu Leu Pro Ala 385 390 395 gct gac atg gat gat ttc tcc aga caa ctt caa aat tcc atg agt gga 1308 Ala Asp Met Asp Asp Phe Ser Arg Gln Leu Gln Asn Ser Met Ser Gly 400 405 410 gct tct gct gat tca act cag gca taa acactcatga tgaccacaca 1355 Ala Ser Ala Asp Ser Thr Gln Ala 415 420 aggcagatgg gctatgtaaa cg 1377 37 422 PRT CORONAVIRUS 37 Met Ser Asp Asn Gly Pro Gln Ser Asn Gln Arg Ser Ala Pro Arg Ile 1 5 10 15 Thr Phe Gly Gly Pro Thr Asp Ser Thr Asp Asn Asn Gln Asn Gly Gly 20 25 30 Arg Asn Gly Ala Arg Pro Lys Gln Arg Arg Pro Gln Gly Leu Pro Asn 35 40 45 Asn Thr Ala Ser Trp Phe Thr Ala Leu Thr Gln His Gly Lys Glu Glu 50 55 60 Leu Arg Phe Pro Arg Gly Gln Gly Val Pro Ile Asn Thr Asn Ser Gly 65 70 75 80 Pro Asp Asp Gln Ile Gly Tyr Tyr Arg Arg Ala Thr Arg Arg Val Arg 85 90 95 Gly Gly Asp Gly Lys Met Lys Glu Leu Ser Pro Arg Trp Tyr Phe Tyr 100 105 110 Tyr Leu Gly Thr Gly Pro Glu Ala Ser Leu Pro Tyr Gly Ala Asn Lys 115 120 125 Glu Gly Ile Val Trp Val Ala Thr Glu Gly Ala Leu Asn Thr Pro Lys 130 135 140 Asp His Ile Gly Thr Arg Asn Pro Asn Asn Asn Ala Ala Thr Val Leu 145 150 155 160 Gln Leu Pro Gln Gly Thr Thr Leu Pro Lys Gly Phe Tyr Ala Glu Gly 165 170 175 Ser Arg Gly Gly Ser Gln Ala Ser Ser Arg Ser Ser Ser Arg Ser Arg 180 185 190 Gly Asn Ser Arg Asn Ser Thr Pro Gly Ser Ser Arg Gly Asn Ser Pro 195 200 205 Ala Arg Met Ala Ser Gly Gly Gly Glu Thr Ala Leu Ala Leu Leu Leu 210 215 220 Leu Asp Arg Leu Asn Gln Leu Glu Ser Lys Val Ser Gly Lys Gly Gln 225 230 235 240 Gln Gln Gln Gly Gln Thr Val Thr Lys Lys Ser Ala Ala Glu Ala Ser 245 250 255 Lys Lys Pro Arg Gln Lys Arg Thr Ala Thr Lys Gln Tyr Asn Val Thr 260 265 270 Gln Ala Phe Gly Arg Arg Gly Pro Glu Gln Thr Gln Gly Asn Phe Gly 275 280 285 Asp Gln Asp Leu Ile Arg Gln Gly Thr Asp Tyr Lys His Trp Pro Gln 290 295 300 Ile Ala Gln Phe Ala Pro Ser Ala Ser Ala Phe Phe Gly Met Ser Arg 305 310 315 320 Ile Gly Met Glu Val Thr Pro Ser Gly Thr Trp Leu Thr Tyr His Gly 325 330 335 Ala Ile Lys Leu Asp Asp Lys Asp Pro Gln Phe Lys Asp Asn Val Ile 340 345 350 Leu Leu Asn Lys His Ile Asp Ala Tyr Lys Thr Phe Pro Pro Thr Glu 355 360 365 Pro Lys Lys Asp Lys Lys Lys Lys Thr Asp Glu Ala Gln Pro Leu Pro 370 375 380 Gln Arg Gln Lys Lys Gln Pro Thr Val Thr Leu Leu Pro Ala Ala Asp 385 390 395 400 Met Asp Asp Phe Ser Arg Gln Leu Gln Asn Ser Met Ser Gly Ala Ser 405 410 415 Ala Asp Ser Thr Gln Ala 420 38 1377 DNA CORONAVIRUS 38 atgaaggtca ccaaactgct gcatttagag acgtacttgt tgttttaaat aaacgaacaa 60 attaaaatgt ctgataatgg accccaatca aaccaacgta gtgccccccg cattacattt 120 ggtggaccca cagattcaac tgacaataac cagaatggag gacgcaatgg ggcaaggcca 180 aaacagcgcc gaccccaagg tttacccaat aatactgcgt cttggttcac agctctcact 240 cagcatggca aggaggaact tagattccct cgaggccagg gcgttccaat caacaccaat 300 agtggtccag atgaccaaat tggctactac cgaagagcta cccgacgagt tcgtggtggt 360 gacggcaaaa tgaaagagct cagccccaga tggtacttct attacctagg aactggccca 420 gaagcttcac ttccctacgg cgctaacaaa gaaggcatcg tatgggttgc aactgaggga 480 gccttgaata cacccaaaga ccacattggc acccgcaatc ctaataacaa tgctgccacc 540 gtgctacaac ttcctcaagg aacaacattg ccaaaaggct tctacgcaga gggaagcaga 600 ggcggcagtc aagcctcttc tcgctcctca tcacgtagtc gcggtaattc aagaaattca 660 actcctggca gcagtagggg aaattctcct gctcgaatgg ctagcggagg tggtgaaact 720 gccctcgcgc tattgctgct agacagattg aaccagcttg agagcaaagt ttctggtaaa 780 ggccaacaac aacaaggcca aactgtcact aagaaatctg ctgctgaggc atctaaaaag 840 cctcgccaaa aacgtactgc cacaaaacag tacaacgtca ctcaagcatt tgggagacgt 900 ggtccagaac aaacccaagg aaatttcggg gaccaagacc taatcagaca aggaactgat 960 tacaaacatt ggccgcaaat tgcacaattt gctccaagtg cctctgcatt ctttggaatg 1020 tcacgcattg gcatggaagt cacaccttcg ggaacatggc tgacttatca tggagccatt 1080

aaattggatg acaaagatcc acaattcaaa gacaacgtca tactgctgaa caagcacatt 1140 gacgcataca aaacattccc accaacagag cctaaaaagg acaaaaagaa aaagactgat 1200 gaagctcagc ctttgccgca gagacaaaag aagcagccca ctgtgactct tcttcctgcg 1260 gctgacatgg atgatttctc cagacaactt caaaattcca tgagtggagc ttctgctgat 1320 tcaactcagg cataaacact catgatgacc acacaaggca gatgggctat gtaaacg 1377 39 204 DNA CORONAVIRUS 39 atattaggtt tttacctacc caggaaaagc caaccaacct cgatctcttg tagatctgtt 60 ctctaaacga actttaaaat ctgtgtagct gtcgctcggc tgcatgccta gtgcacctac 120 gcagtataaa caataataaa ttttactgtc gttgacaaga aacgagtaac tcgtccctct 180 tctgcagact gcttacggtt tcgt 204 40 809 DNA CORONAVIRUS 40 actcaagcat ttgggagacg tggtccagaa caaacccaag gaaatttcgg ggaccaagac 60 ctaatcagac aaggaactga ttacaaacat tggccgcaaa ttgcacaatt tgctccaagt 120 gcctctgcat tctttggaat gtcacgcatt ggcatggaag tcacaccttc gggaacatgg 180 ctgacttatc atggagccat taaattggat gacaaagatc cacaattcaa agacaacgtc 240 atactgctga acaagcacat tgacgcatac aaaacattcc caccaacaga gcctaaaaag 300 gacaaaaaga aaaagactga tgaagctcag cctttgccgc agagacaaaa gaagcagccc 360 actgtgactc ttcttcctgc ggctgacatg gatgatttct ccagacaact tcaaaattcc 420 atgagtggag cttctgctga ttcaactcag gcataaacac tcatgatgac cacacaaggc 480 agatgggcta tgtaaacgtt ttcgcaattc cgtttacgat acatagtcta ctcttgtgca 540 gaatgaattc tcgtaactaa acagcacaag taggtttagt taactttaat ctcacatagc 600 aatctttaat caatgtgtaa cattagggag gacttgaaag agccaccaca ttttcatcga 660 ggccacgcgg agtacgatcg agggtacagt gaataatgct agggagagct gcctatatgg 720 aagagcccta atgtgtaaaa ttaattttag tagtgctatc cccatgtgat tttaatagct 780 tcttaggaga atgacaaaaa aaaaaaaaa 809 41 448 DNA CORONAVIRUS 41 aatgaacaca tagggctgtt caagctgggg cagtacgcct ttttccagct ctactagacc 60 acaagtgcca tttttgaggt gttcacgtgc ctccgatagg gcctcttcca cagagtcccc 120 gaagccacgc actagcacgt ctctaacctg aaggacaggc aaactgagtt ggacgtgtgt 180 tttctcgttg acaccaagaa caaggctctc catcttacct ttcggtcaca cccggacgaa 240 acctaggtat gctgatgatc gactgcaaca cggacgaaac cgtaagcagt ctgcagaaga 300 gggacgagtt actcgtttct tgtcaacgac agtaaaattt attattgttt atactgcgta 360 ggtgcactag gcatgcagcc gagcgacagc tacacagatt ttaaagttcg tttagagaac 420 agatctacaa gagatcgagg ttggttgg 448 42 2033 DNA CORONAVIRUS 42 atacctaggt ttcgtccggg tgtgaccgaa aggtaagatg gagagccttg ttcttggtgt 60 caacgagaaa acacacgtcc aactcagttt gcctgtcctt caggttagag acgtgctagt 120 gcgtggcttc ggggactctg tggaagaggc cctatcggag gcacgtgaac acctcaaaaa 180 tggcacttgt ggtctagtag agctggaaaa aggcgtactg ccccagcttg aacagcccta 240 tgtgttcatt aaacgttctg atgccttaag caccaatcac ggccacaagg tcgttgagct 300 ggttgcagaa atggacggca ttcagtacgg tcgtagcggt ataacactgg gagtactcgt 360 gccacatgtg ggcgaaaccc caattgcata ccgcaatgtt cttcttcgta agaacggtaa 420 taagggagcc ggtggtcata gctatggcat cgatctaaag tcttatgact taggtgacga 480 gcttggcact gatcccattg aagattatga acaaaactgg aacactaagc atggcagtgg 540 tgcactccgt gaactcactc gtgagctcaa tggaggtgca gtcactcgct atgtcgacaa 600 caatttctgt ggcccagatg ggtaccctct tgattgcatc aaagattttc tcgcacgcgc 660 gggcaagtca atgtgcactc tttccgaaca acttgattac atcgagtcga agagaggtgt 720 ctactgctgc cgtgaccatg agcatgaaat tgcctggttc actgagcgct ctgataagag 780 ctacgagcac cagacaccct tcgaaattaa gagtgccaag aaatttgaca ctttcaaagg 840 ggaatgccca aagtttgtgt ttcctcttaa ctcaaaagtc aaagtcattc aaccacgtgt 900 tgaaaagaaa aagactgagg gtttcatggg gcgtatacgc tctgtgtacc ctgttgcatc 960 tccacaggag tgtaacaata tgcacttgtc taccttgatg aaatgtaatc attgcgatga 1020 agtttcatgg cagacgtgcg actttctgaa agccacttgt gaacattgtg gcactgaaaa 1080 tttagttatt gaaggaccta ctacatgtgg gtacctacct actaatgctg tagtgaaaat 1140 gccatgtcct gcctgtcaag acccagagat tggacctgag catagtgttg cagattatca 1200 caaccactca aacattgaaa ctcgactccg caagggaggt aggactagat gttttggagg 1260 ctgtgtgttt gcctatgttg gctgctataa taagcgtgcc tactgggttc ctcgtgctag 1320 tgctgatatt ggctcaggcc atactggcat tactggtgac aatgtggaga ccttgaatga 1380 ggatctcctt gagatactga gtcgtgaacg tgttaacatt aacattgttg gcgattttca 1440 tttgaatgaa gaggttgcca tcattttggc atctttctct gcttctacaa gtgcctttat 1500 tgacactata aagagtcttg attacaagtc tttcaaaacc attgttgagt cctgcggtaa 1560 ctataaagtt accaagggaa agcccgtaaa aggtgcttgg aacattggac aacagagatc 1620 agttttaaca ccactgtgtg gttttccctc acaggctgct ggtgttatca gatcaatttt 1680 tgcgcgcaca cttgatgcag caaaccactc aattcctgat ttgcaaagag cagctgtcac 1740 catacttgat ggtatttctg aacagtcatt acgtcttgtc gacgccatgg tttatacttc 1800 agacctgctc accaacagtg tcattattat ggcatatgta actggtggtc ttgtacaaca 1860 gacttctcag tggttgtcta atcttttggg cactactgtt gaaaaactca ggcctatctt 1920 tgaatggatt gaggcgaaac ttagtgcagg agttgaattt ctcaaggatg cttgggagat 1980 tctcaaattt ctcattacag gtgtttttga catcgtcaag ggtcaaatac agg 2033 43 2018 DNA CORONAVIRUS 43 ggattgaggc gaaacttagt gcaggagttg aatttctcaa ggatgcttgg gagattctca 60 aatttctcat tacaggtgtt tttgacatcg tcaagggtca aatacaggtt gcttcagata 120 acatcaagga ttgtgtaaaa tgcttcattg atgttgttaa caaggcactc gaaatgtgca 180 ttgatcaagt cactatcgct ggcgcaaagt tgcgatcact caacttaggt gaagtcttca 240 tcgctcaaag caagggactt taccgtcagt gtatacgtgg caaggagcag ctgcaactac 300 tcatgcctct taaggcacca aaagaagtaa cctttcttga aggtgattca catgacacag 360 tacttacctc tgaggaggtt gttctcaaga acggtgaact cgaagcactc gagacgcccg 420 ttgatagctt cacaaatgga gctatcgttg gcacaccagt ctgtgtaaat ggcctcatgc 480 tcttagagat taaggacaaa gaacaatact gcgcattgtc tcctggttta ctggctacaa 540 acaatgtctt tcgcttaaaa gggggtgcac caattaaagg tgtaaccttt ggagaagata 600 ctgtttggga agttcaaggt tacaagaatg tgagaatcac atttgagctt gatgaacgtg 660 ttgacaaagt gcttaatgaa aagtgctctg tctacactgt tgaatccggt accgaagtta 720 ctgagtttgc atgtgttgta gcagaggctg ttgtgaagac tttacaacca gtttctgatc 780 tccttaccaa catgggtatt gatcttgatg agtggagtgt agctacattc tacttatttg 840 atgatgctgg tgaagaaaac ttttcatcac gtatgtattg ttccttttac cctccagatg 900 aggaagaaga ggacgatgca gagtgtgagg aagaagaaat tgatgaaacc tgtgaacatg 960 agtacggtac agaggatgat tatcaaggtc tccctctgga atttggtgcc tcagctgaaa 1020 cagttcgagt tgaggaagaa gaagaggaag actggctgga tgatactact gagcaatcag 1080 agattgagcc agaaccagaa cctacacctg aagaaccagt taatcagttt actggttatt 1140 taaaacttac tgacaatgtt gccattaaat gtgttgacat cgttaaggag gcacaaagtg 1200 ctaatcctat ggtgattgta aatgctgcta acatacacct gaaacatggt ggtggtgtag 1260 caggtgcact caacaaggca accaatggtg ccatgcaaaa ggagagtgat gattacatta 1320 agctaaatgg ccctcttaca gtaggagggt cttgtttgct ttctggacat aatcttgcta 1380 agaagtgtct gcatgttgtt ggacctaacc taaatgcagg tgaggacatc cagcttctta 1440 aggcagcata tgaaaatttc aattcacagg acatcttact tgcaccattg ttgtcagcag 1500 gcatatttgg tgctaaacca cttcagtctt tacaagtgtg cgtgcagacg gttcgtacac 1560 aggtttatat tgcagtcaat gacaaagctc tttatgagca ggttgtcatg gattatcttg 1620 ataacctgaa gcctagagtg gaagcaccta aacaagagga gccaccaaac acagaagatt 1680 ccaaaactga ggagaaatct gtcgtacaga agcctgtcga tgtgaagcca aaaattaagg 1740 cctgcattga tgaggttacc acaacactgg aagaaactaa gtttcttacc aataagttac 1800 tcttgtttgc tgatatcaat ggtaagcttt accatgattc tcagaacatg cttagaggtg 1860 aagatatgtc tttccttgag aaggatgcac cttacatggt aggtgatgtt atcactagtg 1920 gtgatatcac ttgtgttgta ataccctcca aaaaggctgg tggcactact gagatgctct 1980 caagagcttt gaagaaagtg ccagttgatg agtatata 2018 44 1442 DNA CORONAVIRUS 44 ttgatgaggt taccacaaca ctggaagaaa ctaagtttct taccaataag ttactcttgt 60 ttgctgatat caatggtaag ctttaccatg attctcagaa catgcttaga ggtgaagata 120 tgtctttcct tgagaaggat gcaccttaca tggtaggtga tgttatcact agtggtgata 180 tcacttgtgt tgtaataccc tccaaaaagg ctggtggcac tactgagatg ctctcaagag 240 ctttgaagaa agtgccagtt gatgagtata taaccacgta ccctggacaa ggatgtgctg 300 gttatacact tgaggaagct aagactgctc ttaagaaatg caaatctgca ttttatgtac 360 taccttcaga agcacctaat gctaaggaag agattctagg aactgtatcc tggaatttga 420 gagaaatgct tgctcatgct gaagagacaa gaaaattaat gcctatatgc atggatgtta 480 gagccataat ggcaaccatc caacgtaagt ataaaggaat taaaattcaa gagggcatcg 540 ttgactatgg tgtccgattc ttcttttata ctagtaaaga gcctgtagct tctattatta 600 cgaagctgaa ctctctaaat gagccgcttg tcacaatgcc aattggttat gtgacacatg 660 gttttaatct tgaagaggct gcgcgctgta tgcgttctct taaagctcct gccgtagtgt 720 cagtatcatc accagatgct gttactacat ataatggata cctcacttcg tcatcaaaga 780 catctgagga gcactttgta gaaacagttt ctttggctgg ctcttacaga gattggtcct 840 attcaggaca gcgtacagag ttaggtgttg aatttcttaa gcgtggtgac aaaattgtgt 900 accacactct ggagagcccc gtcgagtttc atcttgacgg tgaggttctt tcacttgaca 960 aactaaagag tctcttatcc ctgcgggagg ttaagactat aaaagtgttc acaactgtgg 1020 acaacactaa tctccacaca cagcttgtgg atatgtctat gacatatgga cagcagtttg 1080 gtccaacata cttggatggt gctgatgtta caaaaattaa acctcatgta aatcatgagg 1140 gtaagacttt ctttgtacta cctagtgatg acacactacg tagtgaagct ttcgagtact 1200 accatactct tgatgagagt tttcttggta ggtacatgtc tgctttaaac cacacaaaga 1260 aatggaaatt tcctcaagtt ggtggtttaa cttcaattaa atgggctgat aacaattgtt 1320 atttgtctag tgttttatta gcacttcaac agcttgaagt caaattcaat gcaccagcac 1380 ttcaagaggc ttattataga gcccgtgctg gtgatgctgc taacttttgt gcactcatac 1440 tc 1442 45 1050 DNA CORONAVIRUS 45 atatgtctat gacatatgga cagcagtttg gtccaacata cttggatggt gctgatgtta 60 caaaaattaa acctcatgta aatcatgagg gtaagacttt ctttgtacta cctagtgatg 120 acacactacg tagtgaagct ttcgagtact accatactct tgatgagagt tttcttggta 180 ggtacatgtc tgctttaaac cacacaaaga aatggaaatt tcctcaagtt ggtggtttaa 240 cttcaattaa atgggctgat aacaattgtt atttgtctag tgttttatta gcacttcaac 300 agcttgaagt caaattcaat gcaccagcac ttcaagaggc ttattataga gcccgtgctg 360 gtgatgctgc taacttttgt gcactcatac tcgcttacag taataaaact gttggcgagc 420 ttggtgatgt cagagaaact atgacccatc ttctacagca tgctaatttg gaatctgcaa 480 agcgagttct taatgtggtg tgtaaacatt gtggtcagaa aactactacc ttaacgggtg 540 tagaagctgt gatgtatatg ggtactctat cttatgataa tcttaagaca ggtgtttcca 600 ttccatgtgt gtgtggtcgt gatgctacac aatatctagt acaacaagag tcttcttttg 660 ttatgatgtc tgcaccacct gctgagtata aattacagca aggtacattc ttatgtgcga 720 atgagtacac tggtaactat cagtgtggtc attacactca tataactgct aaggagaccc 780 tctatcgtat tgacggagct caccttacaa agatgtcaga gtacaaagga ccagtgactg 840 atgttttcta caaggaaaca tcttacacta caaccatcaa gcctgtgtcg tataaactcg 900 atggagttac ttacacagag attgaaccaa aattggatgg gtattataaa aaggataatg 960 cttactatac agagcagcct atagaccttg taccaactca accattacca aatgcgagtt 1020 ttgataattt caaactcaca tgttctaaca 1050 46 1995 DNA CORONAVIRUS 46 tttgtgcact catactcgct tacagtaata aaactgttgg cgagcttggt gatgtcagag 60 aaactatgac ccatcttcta cagcatgcta atttggaatc tgcaaagcga gttcttaatg 120 tggtgtgtaa acattgtggt cagaaaacta ctaccttaac gggtgtagaa gctgtgatgt 180 atatgggtac tctatcttat gataatctta agacaggtgt ttccattcca tgtgtgtgtg 240 gtcgtgatgc tacacaatat ctagtacaac aagagtcttc ttttgttatg atgtctgcac 300 cacctgctga gtataaatta cagcaaggta cattcttatg tgcgaatgag tacactggta 360 actatcagtg tggtcattac actcatataa ctgctaagga gaccctctat cgtattgacg 420 gagctcacct tacaaagatg tcagagtaca aaggaccagt gactgatgtt ttctacaagg 480 aaacatctta cactacaacc atcaagcctg tgtcgtataa actcgatgga gttacttaca 540 cagagattga accaaaattg gatgggtatt ataaaaagga taatgcttac tatacagagc 600 agcctataga ccttgtacca actcaaccat taccaaatgc gagttttgat aatttcaaac 660 tcacatgttc taacacaaaa tttgctgatg atttaaatca aatgacaggc ttcacaaagc 720 cagcttcacg agagctatct gtcacattct tcccagactt gaatggcgat gtagtggcta 780 ttgactatag acactattca gcgagtttca agaaaggtgc taaattactg cataagccaa 840 ttgtttggca cattaaccag gctacaacca agacaacgtt caaaccaaac acttggtgtt 900 tacgttgtct ttggagtaca aagccagtag atacttcaaa ttcatttgaa gttctggcag 960 tagaagacac acaaggaatg gacaatcttg cttgtgaaag tcaacaaccc acctctgaag 1020 aagtagtgga aaatcctacc atacagaagg aagtcataga gtgtgacgtg aaaactaccg 1080 aagttgtagg caatgtcata cttaaaccat cagatgaagg tgttaaagta acacaagagt 1140 taggtcatga ggatcttatg gctgcttatg tggaaaacac aagcattacc attaagaaac 1200 ctaatgagct ttcactagcc ttaggtttaa aaacaattgc cactcatggt attgctgcaa 1260 ttaatagtgt tccttggagt aaaattttgg cttatgtcaa accattctta ggacaagcag 1320 caattacaac atcaaattgc gctaagagat tagcacaacg tgtgtttaac aattatatgc 1380 cttatgtgtt tacattattg ttccaattgt gtacttttac taaaagtacc aattctagaa 1440 ttagagcttc actacctaca actattgcta aaaatagtgt taagagtgtt gctaaattat 1500 gtttggatgc cggcattaat tatgtgaagt cacccaaatt ttctaaattg ttcacaatcg 1560 ctatgtggct attgttgtta agtatttgct taggttctct aatctgtgta actgctgctt 1620 ttggtgtact cttatctaat tttggtgctc cttcttattg taatggcgtt agagaattgt 1680 atcttaattc gtctaacgtt actactatgg atttctgtga aggttctttt ccttgcagca 1740 tttgtttaag tggattagac tcccttgatt cttatccagc tcttgaaacc attcaggtga 1800 cgatttcatc gtacaagcta gacttgacaa ttttaggtct ggccgctgag tgggttttgg 1860 catatatgtt gttcacaaaa ttcttttatt tattaggtct ttcagctata atgcaggtgt 1920 tctttggcta ttttgctagt catttcatca gcaattcttg gctcatgtgg tttatcatta 1980 gtattgtaca aatgg 1995 47 1884 DNA CORONAVIRUS 47 aattcttggc tcatgtggtt tatcattagt attgtacaaa tggcacccgt ttctgcaatg 60 gttaggatgt acatcttctt tgcttctttc tactacatat ggaagagcta tgttcatatc 120 atggatggtt gcacctcttc gacttgcatg atgtgctata agcgcaatcg tgccacacgc 180 gttgagtgta caactattgt taatggcatg aagagatctt tctatgtcta tgcaaatgga 240 ggccgtggct tctgcaagac tcacaattgg aattgtctca attgtgacac attttgcact 300 ggtagtacat tcattagtga tgaagttgct cgtgatttgt cactccagtt taaaagacca 360 atcaacccta ctgaccagtc atcgtatatt gttgatagtg ttgctgtgaa aaatggcgcg 420 cttcacctct actttgacaa ggctggtcaa aagacctatg agagacatcc gctctcccat 480 tttgtcaatt tagacaattt gagagctaac aacactaaag gttcactgcc tattaatgtc 540 atagtttttg atggcaagtc caaatgcgac gagtctgctt ctaagtctgc ttctgtgtac 600 tacagtcagc tgatgtgcca acctattctg ttgcttgacc aagctcttgt atcagacgtt 660 ggagatagta ctgaagtttc cgttaagatg tttgatgctt atgtcgacac cttttcagca 720 acttttagtg ttcctatgga aaaacttaag gcacttgttg ctacagctca cagcgagtta 780 gcaaagggtg tagctttaga tggtgtcctt tctacattcg tgtcagctgc ccgacaaggt 840 gttgttgata ccgatgttga cacaaaggat gttattgaat gtctcaaact ttcacatcac 900 tctgacttag aagtgacagg tgacagttgt aacaatttca tgctcaccta taataaggtt 960 gaaaacatga cgcccagaga tcttggcgca tgtattgact gtaatgcaag gcatatcaat 1020 gcccaagtag caaaaagtca caatgtttca ctcatctgga atgtaaaaga ctacatgtct 1080 ttatctgaac agctgcgtaa acaaattcgt agtgctgcca agaagaacaa catacctttt 1140 agactaactt gtgctacaac tagacaggtt gtcaatgtca taactactaa aatctcactc 1200 aagggtggta agattgttag tacttgtttt aaacttatgc ttaaggccac attattgtgc 1260 gttcttgctg cattggtttg ttatatcgtt atgccagtac atacattgtc aatccatgat 1320 ggttacacaa atgaaatcat tggttacaaa gccattcagg atggtgtcac tcgtgacatc 1380 atttctactg atgattgttt tgcaaataaa catgctggtt ttgacgcatg gtttagccag 1440 cgtggtggtt catacaaaaa tgacaaaagc tgccctgtag tagctgctat cattacaaga 1500 gagattggtt tcatagtgcc tggcttaccg ggtactgtgc tgagagcaat caatggtgac 1560 ttcttgcatt ttctacctcg tgtttttagt gctgttggca acatttgcta cacaccttcc 1620 aaactcattg agtatagtga ttttgctacc tctgcttgcg ttcttgctgc tgagtgtaca 1680 atttttaagg atgctatggg caaacctgtg ccatattgtt atgacactaa tttgctagag 1740 ggttctattt cttatagtga gcttcgtcca gacactcgtt atgtgcttat ggatggttcc 1800 atcatacagt ttcctaacac ttacctggag ggttctgtta gagtagtaac aacttttgat 1860 gctgagtact gtagacatgg taca 1884 48 2020 DNA CORONAVIRUS 48 cactcgttat gtgcttatgg atggttccat catacagttt cctaacactt acctggaggg 60 ttctgttaga gtagtaacaa cttttgatgc tgagtactgt agacatggta catgcgaaag 120 gtcagaagta ggtatttgcc tatctaccag tggtagatgg gttcttaata atgagcatta 180 cagagctcta tcaggagttt tctgtggtgt tgatgcgatg aatctcatag ctaacatctt 240 tactcctctt gtgcaacctg tgggtgcttt agatgtgtct gcttcagtag tggctggtgg 300 tattattgcc atattggtga cttgtgctgc ctactacttt atgaaattca gacgtgtttt 360 tggtgagtac aaccatgttg ttgctgctaa tgcacttttg tttttgatgt ctttcactat 420 actctgtctg gtaccagctt acagctttct gccgggagtc tactcagtct tttacttgta 480 cttgacattc tatttcacca atgatgtttc attcttggct caccttcaat ggtttgccat 540 gttttctcct attgtgcctt tttggataac agcaatctat gtattctgta tttctctgaa 600 gcactgccat tggttcttta acaactatct taggaaaaga gtcatgttta atggagttac 660 atttagtacc ttcgaggagg ctgctttgtg tacctttttg ctcaacaagg aaatgtacct 720 aaaattgcgt agcgagacac tgttgccact tacacagtat aacaggtatc ttgctctata 780 taacaagtac aagtatttca gtggagcctt agatactacc agctatcgtg aagcagcttg 840 ctgccactta gcaaaggctc taaatgactt tagcaactca ggtgctgatg ttctctacca 900 accaccacag acatcaatca cttctgctgt tctgcagagt ggttttagga aaatggcatt 960 cccgtcaggc aaagttgaag ggtgcatggt acaagtaacc tgtggaacta caactcttaa 1020 tggattgtgg ttggatgaca cagtatactg tccaagacat gtcatttgca cagcagaaga 1080 catgcttaat cctaactatg aagatctgct cattcgcaaa tccaaccata gctttcttgt 1140 tcaggctggc aatgttcaac ttcgtgttat tggccattct atgcaaaatt gtctgcttag 1200 gcttaaagtt gatacttcta accctaagac acccaagtat aaatttgtcc gtatccaacc 1260 tggtcaaaca ttttcagttc tagcatgcta caatggttca ccatctggtg tttatcagtg 1320 tgccatgaga cctaatcata ccattaaagg ttctttcctt aatggatcat gtggtagtgt 1380 tggttttaac attgattatg attgcgtgtc tttctgctat atgcatcata tggagcttcc 1440 aacaggagta cacgctggta ctgacttaga aggtaaattc tatggtccat ttgttgacag 1500 acaaactgca caggctgcag gtacagacac aaccataaca ttaaatgttt tggcatggct 1560 gtatgctgct gttatcaatg gtgataggtg gtttcttaat agattcacca ctactttgaa 1620 tgactttaac cttgtggcaa tgaagtacaa ctatgaacct ttgacacaag atcatgttga 1680 catattggga cctctttctg ctcaaacagg aattgccgtc ttagatatgt gtgctgcttt 1740 gaaagagctg ctgcagaatg gtatgaatgg tcgtactatc cttggtagca ctattttaga 1800 agatgagttt acaccatttg atgttgttag acaatgctct ggtgttacct tccaaggtaa 1860 gttcaagaaa attgttaagg gcactcatca ttggatgctt ttaactttct tgacatcact 1920 attgattctt gttcaaagta cacagtggtc actgtttttc tttgtttacg agaatgcttt 1980 cttgccattt actcttggta ttatggcaat tgctgcatgt 2020 49 2040 DNA CORONAVIRUS 49 agcatttcca gcctgaagac gtactgtagc agctaaactg cccagcacca tacctctatt 60 taggttgttt aagcctttga tgaagtacaa gtatttcact ttaggccctt ttggtgtgtc 120 tgtaacaaac ctacaaggtg gttccagttc tgtgtaaatt gtacctgtac catcactctt 180 agggaatcta gcccatttga gatcttggtg gtctgatagt aatgccagca caaacctacc 240 tcccttcgaa

ttgttatagt aggcaagtgc attgtcatca gtacaagctg tttgtgtggt 300 accagccgca caggacatct gtcgtagtgc tactggactc agttcattat tctgtagttt 360 aacagctgag ttggctctta gagctgtaac aataagaggc caagccaaat ttggtgaatt 420 gtccatgtta atttcactaa gttgaacaat cttgctatcc gcatcaacaa cttgctggat 480 ttcccagagt gcagatgcat atgtaaaggt gttaccatca caagtgttct tgtaggtacc 540 ataatcaggg acaacaacca tgagtttggc tgctgtagtc aatggtatga tgttgagtgg 600 aacacaacca tcacgcgcat tgttgataat gttgttaagt gcatcattat caagcttcct 660 aagcatagtg aagagcattg tttgcatagc actagttact tttgccctct tgtcctcaga 720 tcttgcctgt ttgtacattt gggtcatagc ctgatctgcc atcttttcca acttgcgttg 780 catggcagca tcacggtcaa actcagattt agccacattc aaagatttct ttaacttttt 840 gagaacgact tcagaatcac cattagctac agcctgctca taggcctcct gggcagtggc 900 ataagcggca tatgatggta aagaactaaa ttctgaagca atagcctgaa gagtagcacg 960 gttatcgagc atttcctcgc acaacctatt aatgtctaca gcaccctgca tggatagcaa 1020 aacagacaaa agagaaacca tcttctcgaa agcttcagtt gtgtcttttg caagaagaat 1080 atcattgtgg agttgtacac attgtgccca caatttagaa gatgactcta ctctaagttg 1140 ttgaagaacc gagagcagta ccacagatgt gcactttacg tcagacattt tagactgtac 1200 agtagcaacc ttgatacatg gtttacctcc aatacccaac aacttaatgt taagcttgaa 1260 agcatcaata ctactcttag gaggcaaaag cccctgggag ttcatatacc taaattcttg 1320 tgtagagacc aagtagtcat aaacaccaag agtaagcctg aagtaacggt tgagtaaaca 1380 gaaaaggcca aagtagcagc agcaacaata gcctaagaaa caataaacaa gcatgataca 1440 ctgtaaggtg ttgccagtaa taaataacaa tgggtaatac tcaacacaca caaacactat 1500 agctctagct aaaaacatga tagtcgtaac gacaccagaa tagttagagg ttacagaaat 1560 aactaaggcc cacatggaaa tagcttgatc taaagcatta ccatagtaga ctttgtaaac 1620 aagtgtaatg acattcatca gtgtccaaac acgtctagca gcatcatcat aaacagtgcg 1680 agctgtcatg agaataagca aaactaaagc tgaagcatac ataacacaat ccttaagcct 1740 ataaccagac aagctagtgt cagccaattc aagccatgtc atgatacgca tcacccagct 1800 agcaggcatg tagaccatat taaagtaagc aactgttgca agagaaggta acagaaacaa 1860 gcacaagaat gcgtgcttat gcttaacaag cagcatagca catgcagcaa ttgccataat 1920 accaagagta aatggcaaga aagcattctc gtaaacaaag aaaaacagtg accactgtgt 1980 actttgaaca agaatcaata gtgatgtcaa gaaagttaaa agcatccaat gatgagtgca 2040 50 2012 DNA CORONAVIRUS 50 cttgtaggtt tgttacagac acaccaaaag ggcctaaagt gaaatacttg tacttcatca 60 aaggcttaaa caacctaaat agaggtatgg tgctgggcag tttagctgct acagtacgtc 120 ttcaggctgg aaatgctaca gaagtacctg ccaattcaac tgtgctttcc ttctgtgctt 180 ttgcagtaga ccctgctaaa gcatataagg attacctagc aagtggagga caaccaatca 240 ccaactgtgt gaagatgttg tgtacacaca ctggtacagg acaggcaatt actgtaacac 300 cagaagctaa catggaccaa gagtcctttg gtggtgcttc atgttgtctg tattgtagat 360 gccacattga ccatccaaat cctaaaggat tctgtgactt gaaaggtaag tacgtccaaa 420 tacctaccac ttgtgctaat gacccagtgg gttttacact tagaaacaca gtctgtaccg 480 tctgcggaat gtggaaaggt tatggctgta gttgtgacca actccgcgaa cccttgatgc 540 agtctgcgga tgcatcaacg tttttaaacg ggtttgcggt gtaagtgcag cccgtcttac 600 accgtgcggc acaggcacta gtactgatgt cgtctacagg gcttttgata tttacaacga 660 aaaagttgct ggttttgcaa agttcctaaa aactaattgc tgtcgcttcc aggagaagga 720 tgaggaaggc aatttattag actcttactt tgtagttaag aggcatacta tgtctaacta 780 ccaacatgaa gagactattt ataacttggt taaagattgt ccagcggttg ctgtccatga 840 ctttttcaag tttagagtag atggtgacat ggtaccacat atatcacgtc agcgtctaac 900 taaatacaca atggctgatt tagtctatgc tctacgtcat tttgatgagg gtaattgtga 960 tacattaaaa gaaatactcg tcacatacaa ttgctgtgat gatgattatt tcaataagaa 1020 ggattggtat gacttcgtag agaatcctga catcttacgc gtatatgcta acttaggtga 1080 gcgtgtacgc caatcattat taaagactgt acaattctgc gatgctatgc gtgatgcagg 1140 cattgtaggc gtactgacat tagataatca ggatcttaat gggaactggt acgatttcgg 1200 tgatttcgta caagtagcac caggctgcgg agttcctatt gtggattcat attactcatt 1260 gctgatgccc atcctcactt tgactagggc attggctgct gagtcccata tggatgctga 1320 tctcgcaaaa ccacttatta agtgggattt gctgaaatat gattttacgg aagagagact 1380 ttgtctcttc gaccgttatt ttaaatattg ggaccagaca taccatccca attgtattaa 1440 ctgtttggat gataggtgta tccttcattg tgcaaacttt aatgtgttat tttctactgt 1500 gtttccacct acaagttttg gaccactagt aagaaaaata tttgtagatg gtgttccttt 1560 tgttgtttca actggatacc attttcgtga gttaggagtc gtacataatc aggatgtaaa 1620 cttacatagc tcgcgtctca gtttcaagga acttttagtg tatgctgctg atccagctat 1680 gcatgcagct tctggcaatt tattgctaga taaacgcact acatgctttt cagtagctgc 1740 actaacaaac aatgttgctt ttcaaactgt caaacccggt aattttaata aagactttta 1800 tgactttgct gtgtctaaag gtttctttaa ggaaggaagt tctgttgaac taaaacactt 1860 cttctttgct caggatggca acgctgctat cagtgattat gactattatc gttataatct 1920 gccaacaatg tgtgatatca gacaactcct attcgtagtt gaagttgttg ataaatactt 1980 tgattgttac gatggtggct gtattaatgc ca 2012 51 1877 DNA CORONAVIRUS 51 gtacttcgcg tacagtggca ataccatatg acagcttaaa tgtttcctca gtggctttga 60 gcgtttctgc tgcgaaaagc ttgagtctct cagtacaagt gttggcaagt atgtaatcgc 120 cagcattagt ccaatcacat gttgctatcg cattgaagtc agtgacattg tcactgccta 180 cacatgtgtt tttgtataaa ccaaaaacct gaccattagc acataatgga aaactaatgg 240 gaggcttatg tgacttgcaa taatagctca tacctcctag atacagttgt gtcacatcag 300 tgacatcaca acctggggca ttgcaaacat agggattaac agacaacact aatttgtgtg 360 atgttgaaat gacatggtca tagcagcact tgcaacatag gaatggtctc ctaatacagg 420 caccgcaacg aagtgaagtc tgtgaattgc acaatacaca agcacctaca gcctgcaaga 480 ctgtatgtgg tgtgtacata gcctcataaa actcaggttc ccagtaccgt gaggtgttat 540 cattagttag cattacggaa tacatgtcca acatgtggcc agtaagctca tcatgtaact 600 ttctaatgta ttgtaaatac aagtgaaaga catcagcata ctcctgatta ggatgttttg 660 taagtgggta agcatcaata gccagtgaca cgaacctttc aatcataagt gtaccatctg 720 ttttgacaat atcatcgaca aaacagcctg cgcctaatat tcttgatgga tctgggtaag 780 gcaggtacac gtaatcatct ccttgtttaa ctagcattgt atgctgtgag caaaattcgt 840 gaggtccttt agtaaggtca gtctcagtcc aacattttgc ctcagacatg aacacattat 900 tttgataata aagaactgcc ttaaagttct taatgctagc tactaaacct tgagccgcat 960 agttactgtt atagcacaca acggcatcat cagaaagaat catcatggag aaatgtttac 1020 gcaggtaagc gtaaaactca tccacgaatt catgatcaac atccctattt ctatagagac 1080 actcatagag cctgtgttgt agattgcgga catacttgtc agctatctta ttaccatcag 1140 ttgaaagaag tgcatttaca ttggctgtaa cagcttgaca aatgttaaag acactattag 1200 cataagcagt tgtagcatca ccggatgatg ttccacctgg tttaacatat agtgagccgc 1260 cacacatgac catctcactt aatacttgcg cacactcgtt agctaacctg tagaaacggt 1320 gtgataagtt acagcaagtg ttatgtttgc gagcaagaac aagagaggcc attatcctaa 1380 gcatgttagg catggctctg tcacattttg gataatccca acccataagg tgtggagttt 1440 ctacatcact gtaaacagtt tttaacatat tatgccagcc accgtaaaac ttgcttgttc 1500 caattaccac agtagctcct ctagtggcgg ctattgactt caataatttc tgatgaaact 1560 gtctatttgt catagtacta cagatagaga caccagctac ggtgcgagct ctattctttg 1620 cactaatggc atacttaaga ttcatttgag ttatagtagg gatgacatta cgcttagtat 1680 acgcgaaaag tgcatcttga tcctcataac tcattgagtc ataataaagt ctagccttac 1740 cccatttatt aaatgggaaa ccagctgatt tatccagatt gttaacgatt acttggttgg 1800 cattaataca gccaccatcg taacaatcaa agtatttatc aacaacttca actacgaata 1860 ggagttgtct gatatca 1877 52 2051 DNA CORONAVIRUS 52 tcaggtccaa tcttgacaaa gtacttcatt gatgtaagct caaagccatg cgcccaaagg 60 acgaacacga ctctgtctga caatcctttc agtgtatcac tgagcatttg tactatctta 120 atacgcacta cattccaggg caagccttta tacatgagtg gtataagatg tttaaactgg 180 tcacctggtg gaggttttgc attaactctg gtgaattctg tgttattttc agtgtcaaca 240 taaccagtcg gtacagctac taagttaaca cctgtagaaa atcctagctg gagaggtagg 300 ttagtaccca cagcatctct agttgcatga cagccctcta catcaaagcc aatccacgca 360 cgaacgtgac gaatagcttc ttcgcgggtg ataaacatat tagggtaacc attgacttgg 420 taattcattt tgaaacccat catagagatg agtctacggt aggtcatgtc ctttggtatg 480 cctggtatgt caacacataa tccttcagtc ttgaacttta tatcaacgct gaggtgtgta 540 ggtgcctgtg taggatgaag accagtaatg atcttactac agtccttaaa aagtccagtt 600 acattttctg cttgtaatgt agccacattg cgacgtggta tttctagact tgtaaattgc 660 agtttgtcat aaagatctct atcagacatt atgcacaaaa tgccaatttt tgcccttgtg 720 atagccacat tgaagcggtt gacattacaa gagtgtgctg tttcagtagt ttgtgtgaat 780 atgacatagt catattcaga accctgtgat gaatcaacag tctgcgtagg caatcctaag 840 atttttgaag ctacagcgtt ctgtgaatta taaggtgaga taaaaacagc ttttctccaa 900 gcaggattgc gtgtaagaaa ttctcttaca acgcctattt gaggtctgtt gattgcagat 960 gaaacatcat gtgtaataac acctttgtag aacattttga agcattgagc tgacttatcc 1020 ttgtgtgctt ttagcttatt gtcataaact aaagcactca cagtgtcaac aatttcagca 1080 ggacaacggc gacaagttcc aaggaacatg tctggaccta ttgttttcat aagtctgcac 1140 actgaattaa aatattctgg ttctagtgtg cctttagtca gcaatgtgcg gggggctggt 1200 aattgagcag gatcgccaat atagacgtag tgttttgcac gaagtctagc attgacaaca 1260 ctcaagtcat aattagtagc catagagatt tcatcaaaga ctacaatgtc agcagttgtt 1320 tctggcaatg catttacagt gcagaaaaca tactgttcta gtgttgaatt cactttgaat 1380 ttatcaaaac actctacgcg cgcacgcgca ggtatgattc tactacattt atctatgggc 1440 aaatatttta atgccttttc acatagggca tcaacagctg catgagagca tgccgtatac 1500 actatgcgag cagatgggta atagagagca agtccgatgg caaaatgact cttaccagta 1560 ccaggtggtc cttggagtgt agagtacttt tgcatgccga ccttttgata atttgcaaca 1620 ttgctagaaa actcatctga gatgttgagt gttgggtaca agccagtaat tctcacatag 1680 tgctcttgtg gcactagagt aggtgcacta agtggcatta cagtgtgaga tgtcaacaca 1740 aagtaatcac caacattcaa cttgtatgtc gtagtacctc tgtacacaac agcatcacca 1800 tagtcacctt tttcaaaggt gtactctcca atctgtactt tactattttt agttacacgg 1860 taaccagtaa agacatagtt tctgttcaat ggtggtctag gttttccaac ctcccatgaa 1920 agatgcaatt ctctgtcaga gagtacttcg cgtacagtgg caataccata tgacagctta 1980 aatgtttcct cagtggcttt gagcgtttct gctgcgaaaa gcttgagtct ctcagtacaa 2040 gtgttggcaa g 2051 53 2075 DNA CORONAVIRUS 53 tgcttgtagt tttgggtaga aggtttcaac atgtccatcc ttacaccaaa gcatgaatga 60 aatttcagca tagtcaattg taaccttgac cacttttgaa atcactgaca aatcttgtga 120 ctttattatc tcgacaaagt catcaagtaa aagatcaatc acagaacaca cacattttga 180 tgaacctgtt tgcgcatctg ttatgaagta atttttcact gtgctgtcca tagggataaa 240 atcctctaat ttaagtggtg aatcttgtga gcgcttggct aagcctatca ttaaatgaag 300 accgccaagt tgtccatgac tgaaatctcc ataaacgatg tgttcgaagg catagccctc 360 gagcttatat cgctgtatga attcatccat agcgagctcg agaaagtcag tttccatttg 420 tgatctgggc ttaaaatcct ctaagtctct gctctgagta aagtaggttt caggcaactg 480 ttgaataatg ccgtctactt tcttaaagta gttaaactgt gtttttactg attctccaat 540 taatgtgact ccattgacgc tagcttgtgc tggtcccttt gaaggtgtta gacctttgac 600 tgaaccttct gttattaaaa caccattacg ggcgtttcta aaaaggtcta cctgtccttc 660 cactctacca tcaaacaaga cagtaagtga agaacaagca ctctcagtag gtttcttggc 720 aatgtcagtc attgtgcaga cacctattgt agatacatgt gctggggctt ctcttttgta 780 gtcccagatt acagtattag cagcgatatc aacacccaaa ttattgagta tcttaatctc 840 tggcactggt ttaatgttac gcttagccca aagctcaaat gcaacattaa caggaagtgt 900 tgtcttattt tcaaagatct ccacatcaat accatctacc tttgtgtaaa cagcattatt 960 aatgatggaa acaggtgctt cgccggcgtg tccatcaaag tgtcctttat taacaacatt 1020 ataagccaca ttttctaaac tctgtaacct ggtaaatgta ttccacaggt tataagtatc 1080 aaattgtttg taaatccata ggctaaatcc agcagaaatc atcatattat atgcatccaa 1140 gtactgtcgg tactcatttg catggtgtct gcaaacagca ccacctaaat tgcatcgtgt 1200 aatacacgta gcagatttga gtggaacata atcaatatcc gacactactt gtttgccatg 1260 agactcacaa ggactatcag aatagtaaaa gaaaggcaat tgctttaaat tagtaaatgc 1320 acttttatcg aaagctggag tgtggaatgc atgcttattc acatacaaac taccaccatc 1380 acagcctggt aagttcaagt ttgacaagac tcttgtgtca aacctacaca caattgcatt 1440 ggctgggtaa cgatcaacgt tacaattcca aaacaaacaa acaccatcag tgaatttatc 1500 gtgatgtgta gcataagaat agaagagttc ctctattttg taagctttgt cactacatgg 1560 ctgagcatcg tagaacttcc attctacttc agcctgaggc acacacttga tagcctttgg 1620 atttccaatg tcatgaagaa ctggaaactt atcagcaagc aatgcagact tcacaaccat 1680 gtgttgtact tttctgcaag cagaattaac cctcagttca tctcctataa tagggtattc 1740 aacagaccaa tcaacgcgct taacaaagca ctcatggact gctaaacatc tagtcatgat 1800 agcatcacaa ctagccacat gtgcatttcc atgtacctgg caatgttggt catggttact 1860 ctgaaggtta cccgtaaagc cccactgctg aacatcaatc ataaatgggt tatagacata 1920 gtcaaaaccc acagaatgat tccagcaggc ataagtatct gatgaagtag aaaagcaagt 1980 tgcacgtttg tcacacagac aacacgttct ttcaggtcca atcttgacaa agtacttcat 2040 tgatgtaagc tcaaagccat gcgcccaaag gacga 2075 54 1891 DNA CORONAVIRUS 54 aagattcacc acttaaatta gaggatttta tccctatgga cagcacagtg aaaaattact 60 tcataacaga tgcgcaaaca ggttcatcaa aatgtgtgtg ttctgtgatt gatcttttac 120 ttgatgactt tgtcgagata ataaagtcac aagatttgtc agtgatttca aaagtggtca 180 aggttacaat tgactatgct gaaatttcat tcatgctttg gtgtaaggat ggacatgttg 240 aaaccttcta cccaaaacta caagcaagtc aagcgtggca accaggtgtt gcgatgccta 300 acttgtacaa gatgcaaaga atgcttcttg aaaagtgtga ccttcagaat tatggtgaaa 360 atgctgttat accaaaagga ataatgatga atgtcgcaaa gtatactcaa ctgtgtcaat 420 acttaaatac acttacttta gctgtaccct acaacatgag agttattcac tttggtgctg 480 gctctgataa aggagttgca ccaggtacag ctgtgctcag acaatggttg ccaactggca 540 cactacttgt cgattcagat cttaatgact tcgtctccga cgcagattct actttaattg 600 gagactgtgc aacagtacat acggctaata aatgggacct tattattagc gatatgtatg 660 accctaggac caaacatgtg acaaaagaga atgactctaa agaagggttt ttcacttatc 720 tgtgtggatt tataaagcaa aaactagccc tgggtggttc tatagctgta aagataacag 780 agcattcttg gaatgctgac ctttacaagc ttatgggcca tttctcatgg tggacagctt 840 ttgttacaaa tgtaaatgca tcatcatcgg aagcattttt aattggggct aactatcttg 900 gcaagccgaa ggaacaaatt gatggctata ccatgcatgc taactacatt ttctggagga 960 acacaaatcc tatccagttg tcttcctatt cactctttga catgagcaaa tttcctctta 1020 aattaagagg aactgctgta atgtctctta aggagaatca aatcaatgat atgatttatt 1080 ctcttctgga aaaaggtagg cttatcatta gagaaaacaa cagagttgtg gtttcaagtg 1140 atattcttgt taacaactaa acgaacatgt ttattttctt attatttctt actctcacta 1200 gtggtagtga ccttgaccgg tgcaccactt ttgatgatgt tcaagctcct aattacactc 1260 aacatacttc atctatgagg ggggtttact atcctgatga aatttttaga tcagacactc 1320 tttatttaac tcaggattta tttcttccat tttattctaa tgttacaggg tttcatacta 1380 ttaatcatac gtttggcaac cctgtcatac cttttaagga tggtatttat tttgctgcca 1440 cagagaaatc aaatgttgtc cgtggttggg tttttggttc taccatgaac aacaagtcac 1500 agtcggtgat tattattaac aattctacta atgttgttat acgagcatgt aactttgaat 1560 tgtgtgacaa ccctttcttt gctgtttcta aacccatggg tacacagaca catactatga 1620 tattcgataa tgcatttaat tgcactttcg agtacatatc tgatgccttt tcgcttgatg 1680 tttcagaaaa gtcaggtaat tttaaacact tacgagagtt tgtgtttaaa aataaagatg 1740 ggtttctcta tgtttataag ggctatcaac ctatagatgt agttcgtgat ctaccttctg 1800 gttttaacac tttgaaacct atttttaagt tgcctcttgg tattaacatt acaaatttta 1860 gagccattct tacagccttt tcacctgctc a 1891 55 32 DNA artificial sequence N sens primer 55 cccatatgtc tgataatgga ccccaatcaa ac 32 56 32 DNA artificial sequence N antisens primer 56 cccccgggtg cctgagttga atcagcagaa gc 32 57 31 DNA artificial sequence Sc sens primer 57 cccatatgag tgaccttgac cggtgcacca c 31 58 30 DNA artificial sequence SL sens primer 58 cccatatgaa accttgcacc ccacctgctc 30 59 33 DNA Sc and SL antisens primer 59 cccccgggtt taatatattg ctcatatttt ccc 33 60 16 DNA Sens set 1 primer 60 ggcatcgtat gggttg 16 61 16 DNA Antisens set 2 (28774-28759) primer 61 cagtttcacc acctcc 16 62 16 DNA Sens set 2 (28375-28390) primer 62 ggctactacc gaagag 16 63 16 DNA Antisens set 2 (28702-28687)primer 63 aattaccgcg actacg 16 64 26 DNA Probe 1/set 1 (28561-28586) 64 ggcacccgca atcctaataa caatgc 26 65 21 DNA Probe 2/set 1 (28588-28608) 65 gccaccgtgc tacaacttcc t 21 66 23 DNA Probe 1/set 2 /probe N/FL (28541-28563) 66 atacacccaa agaccacatt ggc 23 67 25 DNA Probe 2/set 2/probe SARS/N/LC705 (28565-28589) 67 cccgcaatcc taataacaat gctgc 25 68 30 DNA artificial sequence Anchor primer 14T 68 agatgaattc ggtacctttt tttttttttt 30 69 13 PRT artificial sequence M2-14 peptide 69 Ala Asp Asn Gly Thr Ile Thr Val Glu Glu Leu Lys Gln 1 5 10 70 12 PRT artificial sequence E1-12 peptide 70 Met Tyr Ser Phe Val Ser Glu Glu Thr Gly Thr Leu 1 5 10 71 24 PRT artificial sequence E53-72 peptide 71 Lys Pro Thr Val Tyr Val Tyr Ser Arg Val Lys Asn Leu Asn Ser Ser 1 5 10 15 Glu Gly Val Pro Asp Leu Leu Val 20 72 153 DNA CORONAVIRUS 72 gatattaggt ttttacctac ccaggaaaag ccaaccaacc tcgatctctt gtagatctgt 60 tctctaaacg aactttaaaa tctgtgtagc tgtcgctcgg ctgcatgcct agtgcaccta 120 cgcagtataa acaataataa attttactgt cgt 153 73 410 DNA CORONAVIRUS 73 ttctccagac aacttcaaaa ttccatgagt ggagcttctg ctgattcaac tcaggcataa 60 acactcatga tgaccacaca aggcagatgg gctatgtaaa cgttttcgca attccgttta 120 cgatacatag tctactcttg tgcagaatga attctcgtaa ctaaacagca caagtaggtt 180 tagttaactt taatctcaca tagcaatctt taatcaatgt gtaacattag ggaggacttg 240 aaagagccac cacattttca tcgaggccac gcggagtacg atcgagggta cagtgaataa 300 tgctagggag agctgcctat atggaagagc cctaatgtgt aaaattaatt ttagtagtgc 360 tatccccatg tgattttaat agcttcttag gagaatgaca aaaaaaaaaa 410 74 4382 PRT CORONAVIRUS 74 Met Glu Ser Leu Val Leu Gly Val Asn Glu Lys Thr His Val Gln Leu 1 5 10 15 Ser Leu Pro Val Leu Gln Val Arg Asp Val Leu Val Arg Gly Phe Gly 20 25 30 Asp Ser Val Glu Glu Ala Leu Ser Glu Ala Arg Glu His Leu Lys Asn 35 40 45 Gly Thr Cys Gly Leu Val Glu Leu Glu Lys Gly Val Leu Pro Gln Leu 50 55 60 Glu Gln Pro Tyr Val Phe Ile Lys Arg Ser Asp Ala Leu Ser Thr Asn 65 70 75 80 His Gly His Lys Val Val Glu Leu Val Ala Glu Met Asp Gly Ile Gln 85 90

95 Tyr Gly Arg Ser Gly Ile Thr Leu Gly Val Leu Val Pro His Val Gly 100 105 110 Glu Thr Pro Ile Ala Tyr Arg Asn Val Leu Leu Arg Lys Asn Gly Asn 115 120 125 Lys Gly Ala Gly Gly His Ser Tyr Gly Ile Asp Leu Lys Ser Tyr Asp 130 135 140 Leu Gly Asp Glu Leu Gly Thr Asp Pro Ile Glu Asp Tyr Glu Gln Asn 145 150 155 160 Trp Asn Thr Lys His Gly Ser Gly Ala Leu Arg Glu Leu Thr Arg Glu 165 170 175 Leu Asn Gly Gly Ala Val Thr Arg Tyr Val Asp Asn Asn Phe Cys Gly 180 185 190 Pro Asp Gly Tyr Pro Leu Asp Cys Ile Lys Asp Phe Leu Ala Arg Ala 195 200 205 Gly Lys Ser Met Cys Thr Leu Ser Glu Gln Leu Asp Tyr Ile Glu Ser 210 215 220 Lys Arg Gly Val Tyr Cys Cys Arg Asp His Glu His Glu Ile Ala Trp 225 230 235 240 Phe Thr Glu Arg Ser Asp Lys Ser Tyr Glu His Gln Thr Pro Phe Glu 245 250 255 Ile Lys Ser Ala Lys Lys Phe Asp Thr Phe Lys Gly Glu Cys Pro Lys 260 265 270 Phe Val Phe Pro Leu Asn Ser Lys Val Lys Val Ile Gln Pro Arg Val 275 280 285 Glu Lys Lys Lys Thr Glu Gly Phe Met Gly Arg Ile Arg Ser Val Tyr 290 295 300 Pro Val Ala Ser Pro Gln Glu Cys Asn Asn Met His Leu Ser Thr Leu 305 310 315 320 Met Lys Cys Asn His Cys Asp Glu Val Ser Trp Gln Thr Cys Asp Phe 325 330 335 Leu Lys Ala Thr Cys Glu His Cys Gly Thr Glu Asn Leu Val Ile Glu 340 345 350 Gly Pro Thr Thr Cys Gly Tyr Leu Pro Thr Asn Ala Val Val Lys Met 355 360 365 Pro Cys Pro Ala Cys Gln Asp Pro Glu Ile Gly Pro Glu His Ser Val 370 375 380 Ala Asp Tyr His Asn His Ser Asn Ile Glu Thr Arg Leu Arg Lys Gly 385 390 395 400 Gly Arg Thr Arg Cys Phe Gly Gly Cys Val Phe Ala Tyr Val Gly Cys 405 410 415 Tyr Asn Lys Arg Ala Tyr Trp Val Pro Arg Ala Ser Ala Asp Ile Gly 420 425 430 Ser Gly His Thr Gly Ile Thr Gly Asp Asn Val Glu Thr Leu Asn Glu 435 440 445 Asp Leu Leu Glu Ile Leu Ser Arg Glu Arg Val Asn Ile Asn Ile Val 450 455 460 Gly Asp Phe His Leu Asn Glu Glu Val Ala Ile Ile Leu Ala Ser Phe 465 470 475 480 Ser Ala Ser Thr Ser Ala Phe Ile Asp Thr Ile Lys Ser Leu Asp Tyr 485 490 495 Lys Ser Phe Lys Thr Ile Val Glu Ser Cys Gly Asn Tyr Lys Val Thr 500 505 510 Lys Gly Lys Pro Val Lys Gly Ala Trp Asn Ile Gly Gln Gln Arg Ser 515 520 525 Val Leu Thr Pro Leu Cys Gly Phe Pro Ser Gln Ala Ala Gly Val Ile 530 535 540 Arg Ser Ile Phe Ala Arg Thr Leu Asp Ala Ala Asn His Ser Ile Pro 545 550 555 560 Asp Leu Gln Arg Ala Ala Val Thr Ile Leu Asp Gly Ile Ser Glu Gln 565 570 575 Ser Leu Arg Leu Val Asp Ala Met Val Tyr Thr Ser Asp Leu Leu Thr 580 585 590 Asn Ser Val Ile Ile Met Ala Tyr Val Thr Gly Gly Leu Val Gln Gln 595 600 605 Thr Ser Gln Trp Leu Ser Asn Leu Leu Gly Thr Thr Val Glu Lys Leu 610 615 620 Arg Pro Ile Phe Glu Trp Ile Glu Ala Lys Leu Ser Ala Gly Val Glu 625 630 635 640 Phe Leu Lys Asp Ala Trp Glu Ile Leu Lys Phe Leu Ile Thr Gly Val 645 650 655 Phe Asp Ile Val Lys Gly Gln Ile Gln Val Ala Ser Asp Asn Ile Lys 660 665 670 Asp Cys Val Lys Cys Phe Ile Asp Val Val Asn Lys Ala Leu Glu Met 675 680 685 Cys Ile Asp Gln Val Thr Ile Ala Gly Ala Lys Leu Arg Ser Leu Asn 690 695 700 Leu Gly Glu Val Phe Ile Ala Gln Ser Lys Gly Leu Tyr Arg Gln Cys 705 710 715 720 Ile Arg Gly Lys Glu Gln Leu Gln Leu Leu Met Pro Leu Lys Ala Pro 725 730 735 Lys Glu Val Thr Phe Leu Glu Gly Asp Ser His Asp Thr Val Leu Thr 740 745 750 Ser Glu Glu Val Val Leu Lys Asn Gly Glu Leu Glu Ala Leu Glu Thr 755 760 765 Pro Val Asp Ser Phe Thr Asn Gly Ala Ile Val Gly Thr Pro Val Cys 770 775 780 Val Asn Gly Leu Met Leu Leu Glu Ile Lys Asp Lys Glu Gln Tyr Cys 785 790 795 800 Ala Leu Ser Pro Gly Leu Leu Ala Thr Asn Asn Val Phe Arg Leu Lys 805 810 815 Gly Gly Ala Pro Ile Lys Gly Val Thr Phe Gly Glu Asp Thr Val Trp 820 825 830 Glu Val Gln Gly Tyr Lys Asn Val Arg Ile Thr Phe Glu Leu Asp Glu 835 840 845 Arg Val Asp Lys Val Leu Asn Glu Lys Cys Ser Val Tyr Thr Val Glu 850 855 860 Ser Gly Thr Glu Val Thr Glu Phe Ala Cys Val Val Ala Glu Ala Val 865 870 875 880 Val Lys Thr Leu Gln Pro Val Ser Asp Leu Leu Thr Asn Met Gly Ile 885 890 895 Asp Leu Asp Glu Trp Ser Val Ala Thr Phe Tyr Leu Phe Asp Asp Ala 900 905 910 Gly Glu Glu Asn Phe Ser Ser Arg Met Tyr Cys Ser Phe Tyr Pro Pro 915 920 925 Asp Glu Glu Glu Glu Asp Asp Ala Glu Cys Glu Glu Glu Glu Ile Asp 930 935 940 Glu Thr Cys Glu His Glu Tyr Gly Thr Glu Asp Asp Tyr Gln Gly Leu 945 950 955 960 Pro Leu Glu Phe Gly Ala Ser Ala Glu Thr Val Arg Val Glu Glu Glu 965 970 975 Glu Glu Glu Asp Trp Leu Asp Asp Thr Thr Glu Gln Ser Glu Ile Glu 980 985 990 Pro Glu Pro Glu Pro Thr Pro Glu Glu Pro Val Asn Gln Phe Thr Gly 995 1000 1005 Tyr Leu Lys Leu Thr Asp Asn Val Ala Ile Lys Cys Val Asp Ile 1010 1015 1020 Val Lys Glu Ala Gln Ser Ala Asn Pro Met Val Ile Val Asn Ala 1025 1030 1035 Ala Asn Ile His Leu Lys His Gly Gly Gly Val Ala Gly Ala Leu 1040 1045 1050 Asn Lys Ala Thr Asn Gly Ala Met Gln Lys Glu Ser Asp Asp Tyr 1055 1060 1065 Ile Lys Leu Asn Gly Pro Leu Thr Val Gly Gly Ser Cys Leu Leu 1070 1075 1080 Ser Gly His Asn Leu Ala Lys Lys Cys Leu His Val Val Gly Pro 1085 1090 1095 Asn Leu Asn Ala Gly Glu Asp Ile Gln Leu Leu Lys Ala Ala Tyr 1100 1105 1110 Glu Asn Phe Asn Ser Gln Asp Ile Leu Leu Ala Pro Leu Leu Ser 1115 1120 1125 Ala Gly Ile Phe Gly Ala Lys Pro Leu Gln Ser Leu Gln Val Cys 1130 1135 1140 Val Gln Thr Val Arg Thr Gln Val Tyr Ile Ala Val Asn Asp Lys 1145 1150 1155 Ala Leu Tyr Glu Gln Val Val Met Asp Tyr Leu Asp Asn Leu Lys 1160 1165 1170 Pro Arg Val Glu Ala Pro Lys Gln Glu Glu Pro Pro Asn Thr Glu 1175 1180 1185 Asp Ser Lys Thr Glu Glu Lys Ser Val Val Gln Lys Pro Val Asp 1190 1195 1200 Val Lys Pro Lys Ile Lys Ala Cys Ile Asp Glu Val Thr Thr Thr 1205 1210 1215 Leu Glu Glu Thr Lys Phe Leu Thr Asn Lys Leu Leu Leu Phe Ala 1220 1225 1230 Asp Ile Asn Gly Lys Leu Tyr His Asp Ser Gln Asn Met Leu Arg 1235 1240 1245 Gly Glu Asp Met Ser Phe Leu Glu Lys Asp Ala Pro Tyr Met Val 1250 1255 1260 Gly Asp Val Ile Thr Ser Gly Asp Ile Thr Cys Val Val Ile Pro 1265 1270 1275 Ser Lys Lys Ala Gly Gly Thr Thr Glu Met Leu Ser Arg Ala Leu 1280 1285 1290 Lys Lys Val Pro Val Asp Glu Tyr Ile Thr Thr Tyr Pro Gly Gln 1295 1300 1305 Gly Cys Ala Gly Tyr Thr Leu Glu Glu Ala Lys Thr Ala Leu Lys 1310 1315 1320 Lys Cys Lys Ser Ala Phe Tyr Val Leu Pro Ser Glu Ala Pro Asn 1325 1330 1335 Ala Lys Glu Glu Ile Leu Gly Thr Val Ser Trp Asn Leu Arg Glu 1340 1345 1350 Met Leu Ala His Ala Glu Glu Thr Arg Lys Leu Met Pro Ile Cys 1355 1360 1365 Met Asp Val Arg Ala Ile Met Ala Thr Ile Gln Arg Lys Tyr Lys 1370 1375 1380 Gly Ile Lys Ile Gln Glu Gly Ile Val Asp Tyr Gly Val Arg Phe 1385 1390 1395 Phe Phe Tyr Thr Ser Lys Glu Pro Val Ala Ser Ile Ile Thr Lys 1400 1405 1410 Leu Asn Ser Leu Asn Glu Pro Leu Val Thr Met Pro Ile Gly Tyr 1415 1420 1425 Val Thr His Gly Phe Asn Leu Glu Glu Ala Ala Arg Cys Met Arg 1430 1435 1440 Ser Leu Lys Ala Pro Ala Val Val Ser Val Ser Ser Pro Asp Ala 1445 1450 1455 Val Thr Thr Tyr Asn Gly Tyr Leu Thr Ser Ser Ser Lys Thr Ser 1460 1465 1470 Glu Glu His Phe Val Glu Thr Val Ser Leu Ala Gly Ser Tyr Arg 1475 1480 1485 Asp Trp Ser Tyr Ser Gly Gln Arg Thr Glu Leu Gly Val Glu Phe 1490 1495 1500 Leu Lys Arg Gly Asp Lys Ile Val Tyr His Thr Leu Glu Ser Pro 1505 1510 1515 Val Glu Phe His Leu Asp Gly Glu Val Leu Ser Leu Asp Lys Leu 1520 1525 1530 Lys Ser Leu Leu Ser Leu Arg Glu Val Lys Thr Ile Lys Val Phe 1535 1540 1545 Thr Thr Val Asp Asn Thr Asn Leu His Thr Gln Leu Val Asp Met 1550 1555 1560 Ser Met Thr Tyr Gly Gln Gln Phe Gly Pro Thr Tyr Leu Asp Gly 1565 1570 1575 Ala Asp Val Thr Lys Ile Lys Pro His Val Asn His Glu Gly Lys 1580 1585 1590 Thr Phe Phe Val Leu Pro Ser Asp Asp Thr Leu Arg Ser Glu Ala 1595 1600 1605 Phe Glu Tyr Tyr His Thr Leu Asp Glu Ser Phe Leu Gly Arg Tyr 1610 1615 1620 Met Ser Ala Leu Asn His Thr Lys Lys Trp Lys Phe Pro Gln Val 1625 1630 1635 Gly Gly Leu Thr Ser Ile Lys Trp Ala Asp Asn Asn Cys Tyr Leu 1640 1645 1650 Ser Ser Val Leu Leu Ala Leu Gln Gln Leu Glu Val Lys Phe Asn 1655 1660 1665 Ala Pro Ala Leu Gln Glu Ala Tyr Tyr Arg Ala Arg Ala Gly Asp 1670 1675 1680 Ala Ala Asn Phe Cys Ala Leu Ile Leu Ala Tyr Ser Asn Lys Thr 1685 1690 1695 Val Gly Glu Leu Gly Asp Val Arg Glu Thr Met Thr His Leu Leu 1700 1705 1710 Gln His Ala Asn Leu Glu Ser Ala Lys Arg Val Leu Asn Val Val 1715 1720 1725 Cys Lys His Cys Gly Gln Lys Thr Thr Thr Leu Thr Gly Val Glu 1730 1735 1740 Ala Val Met Tyr Met Gly Thr Leu Ser Tyr Asp Asn Leu Lys Thr 1745 1750 1755 Gly Val Ser Ile Pro Cys Val Cys Gly Arg Asp Ala Thr Gln Tyr 1760 1765 1770 Leu Val Gln Gln Glu Ser Ser Phe Val Met Met Ser Ala Pro Pro 1775 1780 1785 Ala Glu Tyr Lys Leu Gln Gln Gly Thr Phe Leu Cys Ala Asn Glu 1790 1795 1800 Tyr Thr Gly Asn Tyr Gln Cys Gly His Tyr Thr His Ile Thr Ala 1805 1810 1815 Lys Glu Thr Leu Tyr Arg Ile Asp Gly Ala His Leu Thr Lys Met 1820 1825 1830 Ser Glu Tyr Lys Gly Pro Val Thr Asp Val Phe Tyr Lys Glu Thr 1835 1840 1845 Ser Tyr Thr Thr Thr Ile Lys Pro Val Ser Tyr Lys Leu Asp Gly 1850 1855 1860 Val Thr Tyr Thr Glu Ile Glu Pro Lys Leu Asp Gly Tyr Tyr Lys 1865 1870 1875 Lys Asp Asn Ala Tyr Tyr Thr Glu Gln Pro Ile Asp Leu Val Pro 1880 1885 1890 Thr Gln Pro Leu Pro Asn Ala Ser Phe Asp Asn Phe Lys Leu Thr 1895 1900 1905 Cys Ser Asn Thr Lys Phe Ala Asp Asp Leu Asn Gln Met Thr Gly 1910 1915 1920 Phe Thr Lys Pro Ala Ser Arg Glu Leu Ser Val Thr Phe Phe Pro 1925 1930 1935 Asp Leu Asn Gly Asp Val Val Ala Ile Asp Tyr Arg His Tyr Ser 1940 1945 1950 Ala Ser Phe Lys Lys Gly Ala Lys Leu Leu His Lys Pro Ile Val 1955 1960 1965 Trp His Ile Asn Gln Ala Thr Thr Lys Thr Thr Phe Lys Pro Asn 1970 1975 1980 Thr Trp Cys Leu Arg Cys Leu Trp Ser Thr Lys Pro Val Asp Thr 1985 1990 1995 Ser Asn Ser Phe Glu Val Leu Ala Val Glu Asp Thr Gln Gly Met 2000 2005 2010 Asp Asn Leu Ala Cys Glu Ser Gln Gln Pro Thr Ser Glu Glu Val 2015 2020 2025 Val Glu Asn Pro Thr Ile Gln Lys Glu Val Ile Glu Cys Asp Val 2030 2035 2040 Lys Thr Thr Glu Val Val Gly Asn Val Ile Leu Lys Pro Ser Asp 2045 2050 2055 Glu Gly Val Lys Val Thr Gln Glu Leu Gly His Glu Asp Leu Met 2060 2065 2070 Ala Ala Tyr Val Glu Asn Thr Ser Ile Thr Ile Lys Lys Pro Asn 2075 2080 2085 Glu Leu Ser Leu Ala Leu Gly Leu Lys Thr Ile Ala Thr His Gly 2090 2095 2100 Ile Ala Ala Ile Asn Ser Val Pro Trp Ser Lys Ile Leu Ala Tyr 2105 2110 2115 Val Lys Pro Phe Leu Gly Gln Ala Ala Ile Thr Thr Ser Asn Cys 2120 2125 2130 Ala Lys Arg Leu Ala Gln Arg Val Phe Asn Asn Tyr Met Pro Tyr 2135 2140 2145 Val Phe Thr Leu Leu Phe Gln Leu Cys Thr Phe Thr Lys Ser Thr 2150 2155 2160 Asn Ser Arg Ile Arg Ala Ser Leu Pro Thr Thr Ile Ala Lys Asn 2165 2170 2175 Ser Val Lys Ser Val Ala Lys Leu Cys Leu Asp Ala Gly Ile Asn 2180 2185 2190 Tyr Val Lys Ser Pro Lys Phe Ser Lys Leu Phe Thr Ile Ala Met 2195 2200 2205 Trp Leu Leu Leu Leu Ser Ile Cys Leu Gly Ser Leu Ile Cys Val 2210 2215 2220 Thr Ala Ala Phe Gly Val Leu Leu Ser Asn Phe Gly Ala Pro Ser 2225 2230 2235 Tyr Cys Asn Gly Val Arg Glu Leu Tyr Leu Asn Ser Ser Asn Val 2240 2245 2250 Thr Thr Met Asp Phe Cys Glu Gly Ser Phe Pro Cys Ser Ile Cys 2255 2260 2265 Leu Ser Gly Leu Asp Ser Leu Asp Ser Tyr Pro Ala Leu Glu Thr 2270 2275 2280 Ile Gln Val Thr Ile Ser Ser Tyr Lys Leu Asp Leu Thr Ile Leu 2285 2290 2295 Gly Leu Ala Ala Glu Trp Val Leu Ala Tyr Met Leu Phe Thr Lys 2300 2305 2310 Phe Phe Tyr Leu Leu Gly Leu Ser Ala Ile Met Gln Val Phe Phe 2315 2320 2325 Gly Tyr Phe Ala Ser His Phe Ile Ser Asn Ser Trp Leu Met Trp 2330 2335 2340 Phe Ile Ile Ser Ile Val Gln Met Ala Pro Val Ser Ala Met Val 2345 2350 2355 Arg Met Tyr Ile Phe Phe Ala Ser Phe Tyr Tyr Ile Trp Lys Ser 2360 2365 2370 Tyr Val His Ile Met Asp Gly Cys Thr Ser Ser Thr Cys Met Met 2375 2380 2385 Cys Tyr Lys Arg Asn Arg Ala Thr Arg Val Glu Cys Thr Thr Ile 2390 2395 2400 Val Asn Gly Met Lys Arg Ser Phe Tyr Val Tyr Ala Asn Gly Gly 2405 2410 2415 Arg Gly Phe Cys Lys Thr His Asn Trp Asn Cys Leu Asn Cys Asp 2420 2425 2430 Thr Phe Cys Thr Gly Ser Thr Phe Ile Ser Asp Glu Val Ala Arg 2435 2440 2445 Asp Leu Ser Leu Gln Phe Lys Arg Pro Ile Asn Pro Thr Asp Gln 2450 2455 2460 Ser Ser Tyr Ile Val Asp Ser Val Ala Val Lys Asn Gly Ala Leu 2465 2470 2475 His Leu Tyr Phe Asp Lys Ala Gly Gln Lys Thr Tyr Glu Arg His 2480 2485 2490 Pro Leu Ser His Phe Val Asn Leu Asp Asn Leu Arg Ala Asn Asn 2495 2500 2505 Thr Lys Gly Ser Leu Pro

Ile Asn Val Ile Val Phe Asp Gly Lys 2510 2515 2520 Ser Lys Cys Asp Glu Ser Ala Ser Lys Ser Ala Ser Val Tyr Tyr 2525 2530 2535 Ser Gln Leu Met Cys Gln Pro Ile Leu Leu Leu Asp Gln Ala Leu 2540 2545 2550 Val Ser Asp Val Gly Asp Ser Thr Glu Val Ser Val Lys Met Phe 2555 2560 2565 Asp Ala Tyr Val Asp Thr Phe Ser Ala Thr Phe Ser Val Pro Met 2570 2575 2580 Glu Lys Leu Lys Ala Leu Val Ala Thr Ala His Ser Glu Leu Ala 2585 2590 2595 Lys Gly Val Ala Leu Asp Gly Val Leu Ser Thr Phe Val Ser Ala 2600 2605 2610 Ala Arg Gln Gly Val Val Asp Thr Asp Val Asp Thr Lys Asp Val 2615 2620 2625 Ile Glu Cys Leu Lys Leu Ser His His Ser Asp Leu Glu Val Thr 2630 2635 2640 Gly Asp Ser Cys Asn Asn Phe Met Leu Thr Tyr Asn Lys Val Glu 2645 2650 2655 Asn Met Thr Pro Arg Asp Leu Gly Ala Cys Ile Asp Cys Asn Ala 2660 2665 2670 Arg His Ile Asn Ala Gln Val Ala Lys Ser His Asn Val Ser Leu 2675 2680 2685 Ile Trp Asn Val Lys Asp Tyr Met Ser Leu Ser Glu Gln Leu Arg 2690 2695 2700 Lys Gln Ile Arg Ser Ala Ala Lys Lys Asn Asn Ile Pro Phe Arg 2705 2710 2715 Leu Thr Cys Ala Thr Thr Arg Gln Val Val Asn Val Ile Thr Thr 2720 2725 2730 Lys Ile Ser Leu Lys Gly Gly Lys Ile Val Ser Thr Cys Phe Lys 2735 2740 2745 Leu Met Leu Lys Ala Thr Leu Leu Cys Val Leu Ala Ala Leu Val 2750 2755 2760 Cys Tyr Ile Val Met Pro Val His Thr Leu Ser Ile His Asp Gly 2765 2770 2775 Tyr Thr Asn Glu Ile Ile Gly Tyr Lys Ala Ile Gln Asp Gly Val 2780 2785 2790 Thr Arg Asp Ile Ile Ser Thr Asp Asp Cys Phe Ala Asn Lys His 2795 2800 2805 Ala Gly Phe Asp Ala Trp Phe Ser Gln Arg Gly Gly Ser Tyr Lys 2810 2815 2820 Asn Asp Lys Ser Cys Pro Val Val Ala Ala Ile Ile Thr Arg Glu 2825 2830 2835 Ile Gly Phe Ile Val Pro Gly Leu Pro Gly Thr Val Leu Arg Ala 2840 2845 2850 Ile Asn Gly Asp Phe Leu His Phe Leu Pro Arg Val Phe Ser Ala 2855 2860 2865 Val Gly Asn Ile Cys Tyr Thr Pro Ser Lys Leu Ile Glu Tyr Ser 2870 2875 2880 Asp Phe Ala Thr Ser Ala Cys Val Leu Ala Ala Glu Cys Thr Ile 2885 2890 2895 Phe Lys Asp Ala Met Gly Lys Pro Val Pro Tyr Cys Tyr Asp Thr 2900 2905 2910 Asn Leu Leu Glu Gly Ser Ile Ser Tyr Ser Glu Leu Arg Pro Asp 2915 2920 2925 Thr Arg Tyr Val Leu Met Asp Gly Ser Ile Ile Gln Phe Pro Asn 2930 2935 2940 Thr Tyr Leu Glu Gly Ser Val Arg Val Val Thr Thr Phe Asp Ala 2945 2950 2955 Glu Tyr Cys Arg His Gly Thr Cys Glu Arg Ser Glu Val Gly Ile 2960 2965 2970 Cys Leu Ser Thr Ser Gly Arg Trp Val Leu Asn Asn Glu His Tyr 2975 2980 2985 Arg Ala Leu Ser Gly Val Phe Cys Gly Val Asp Ala Met Asn Leu 2990 2995 3000 Ile Ala Asn Ile Phe Thr Pro Leu Val Gln Pro Val Gly Ala Leu 3005 3010 3015 Asp Val Ser Ala Ser Val Val Ala Gly Gly Ile Ile Ala Ile Leu 3020 3025 3030 Val Thr Cys Ala Ala Tyr Tyr Phe Met Lys Phe Arg Arg Val Phe 3035 3040 3045 Gly Glu Tyr Asn His Val Val Ala Ala Asn Ala Leu Leu Phe Leu 3050 3055 3060 Met Ser Phe Thr Ile Leu Cys Leu Val Pro Ala Tyr Ser Phe Leu 3065 3070 3075 Pro Gly Val Tyr Ser Val Phe Tyr Leu Tyr Leu Thr Phe Tyr Phe 3080 3085 3090 Thr Asn Asp Val Ser Phe Leu Ala His Leu Gln Trp Phe Ala Met 3095 3100 3105 Phe Ser Pro Ile Val Pro Phe Trp Ile Thr Ala Ile Tyr Val Phe 3110 3115 3120 Cys Ile Ser Leu Lys His Cys His Trp Phe Phe Asn Asn Tyr Leu 3125 3130 3135 Arg Lys Arg Val Met Phe Asn Gly Val Thr Phe Ser Thr Phe Glu 3140 3145 3150 Glu Ala Ala Leu Cys Thr Phe Leu Leu Asn Lys Glu Met Tyr Leu 3155 3160 3165 Lys Leu Arg Ser Glu Thr Leu Leu Pro Leu Thr Gln Tyr Asn Arg 3170 3175 3180 Tyr Leu Ala Leu Tyr Asn Lys Tyr Lys Tyr Phe Ser Gly Ala Leu 3185 3190 3195 Asp Thr Thr Ser Tyr Arg Glu Ala Ala Cys Cys His Leu Ala Lys 3200 3205 3210 Ala Leu Asn Asp Phe Ser Asn Ser Gly Ala Asp Val Leu Tyr Gln 3215 3220 3225 Pro Pro Gln Thr Ser Ile Thr Ser Ala Val Leu Gln Ser Gly Phe 3230 3235 3240 Arg Lys Met Ala Phe Pro Ser Gly Lys Val Glu Gly Cys Met Val 3245 3250 3255 Gln Val Thr Cys Gly Thr Thr Thr Leu Asn Gly Leu Trp Leu Asp 3260 3265 3270 Asp Thr Val Tyr Cys Pro Arg His Val Ile Cys Thr Ala Glu Asp 3275 3280 3285 Met Leu Asn Pro Asn Tyr Glu Asp Leu Leu Ile Arg Lys Ser Asn 3290 3295 3300 His Ser Phe Leu Val Gln Ala Gly Asn Val Gln Leu Arg Val Ile 3305 3310 3315 Gly His Ser Met Gln Asn Cys Leu Leu Arg Leu Lys Val Asp Thr 3320 3325 3330 Ser Asn Pro Lys Thr Pro Lys Tyr Lys Phe Val Arg Ile Gln Pro 3335 3340 3345 Gly Gln Thr Phe Ser Val Leu Ala Cys Tyr Asn Gly Ser Pro Ser 3350 3355 3360 Gly Val Tyr Gln Cys Ala Met Arg Pro Asn His Thr Ile Lys Gly 3365 3370 3375 Ser Phe Leu Asn Gly Ser Cys Gly Ser Val Gly Phe Asn Ile Asp 3380 3385 3390 Tyr Asp Cys Val Ser Phe Cys Tyr Met His His Met Glu Leu Pro 3395 3400 3405 Thr Gly Val His Ala Gly Thr Asp Leu Glu Gly Lys Phe Tyr Gly 3410 3415 3420 Pro Phe Val Asp Arg Gln Thr Ala Gln Ala Ala Gly Thr Asp Thr 3425 3430 3435 Thr Ile Thr Leu Asn Val Leu Ala Trp Leu Tyr Ala Ala Val Ile 3440 3445 3450 Asn Gly Asp Arg Trp Phe Leu Asn Arg Phe Thr Thr Thr Leu Asn 3455 3460 3465 Asp Phe Asn Leu Val Ala Met Lys Tyr Asn Tyr Glu Pro Leu Thr 3470 3475 3480 Gln Asp His Val Asp Ile Leu Gly Pro Leu Ser Ala Gln Thr Gly 3485 3490 3495 Ile Ala Val Leu Asp Met Cys Ala Ala Leu Lys Glu Leu Leu Gln 3500 3505 3510 Asn Gly Met Asn Gly Arg Thr Ile Leu Gly Ser Thr Ile Leu Glu 3515 3520 3525 Asp Glu Phe Thr Pro Phe Asp Val Val Arg Gln Cys Ser Gly Val 3530 3535 3540 Thr Phe Gln Gly Lys Phe Lys Lys Ile Val Lys Gly Thr His His 3545 3550 3555 Trp Met Leu Leu Thr Phe Leu Thr Ser Leu Leu Ile Leu Val Gln 3560 3565 3570 Ser Thr Gln Trp Ser Leu Phe Phe Phe Val Tyr Glu Asn Ala Phe 3575 3580 3585 Leu Pro Phe Thr Leu Gly Ile Met Ala Ile Ala Ala Cys Ala Met 3590 3595 3600 Leu Leu Val Lys His Lys His Ala Phe Leu Cys Leu Phe Leu Leu 3605 3610 3615 Pro Ser Leu Ala Thr Val Ala Tyr Phe Asn Met Val Tyr Met Pro 3620 3625 3630 Ala Ser Trp Val Met Arg Ile Met Thr Trp Leu Glu Leu Ala Asp 3635 3640 3645 Thr Ser Leu Ser Gly Tyr Arg Leu Lys Asp Cys Val Met Tyr Ala 3650 3655 3660 Ser Ala Leu Val Leu Leu Ile Leu Met Thr Ala Arg Thr Val Tyr 3665 3670 3675 Asp Asp Ala Ala Arg Arg Val Trp Thr Leu Met Asn Val Ile Thr 3680 3685 3690 Leu Val Tyr Lys Val Tyr Tyr Gly Asn Ala Leu Asp Gln Ala Ile 3695 3700 3705 Ser Met Trp Ala Leu Val Ile Ser Val Thr Ser Asn Tyr Ser Gly 3710 3715 3720 Val Val Thr Thr Ile Met Phe Leu Ala Arg Ala Ile Val Phe Val 3725 3730 3735 Cys Val Glu Tyr Tyr Pro Leu Leu Phe Ile Thr Gly Asn Thr Leu 3740 3745 3750 Gln Cys Ile Met Leu Val Tyr Cys Phe Leu Gly Tyr Cys Cys Cys 3755 3760 3765 Cys Tyr Phe Gly Leu Phe Cys Leu Leu Asn Arg Tyr Phe Arg Leu 3770 3775 3780 Thr Leu Gly Val Tyr Asp Tyr Leu Val Ser Thr Gln Glu Phe Arg 3785 3790 3795 Tyr Met Asn Ser Gln Gly Leu Leu Pro Pro Lys Ser Ser Ile Asp 3800 3805 3810 Ala Phe Lys Leu Asn Ile Lys Leu Leu Gly Ile Gly Gly Lys Pro 3815 3820 3825 Cys Ile Lys Val Ala Thr Val Gln Ser Lys Met Ser Asp Val Lys 3830 3835 3840 Cys Thr Ser Val Val Leu Leu Ser Val Leu Gln Gln Leu Arg Val 3845 3850 3855 Glu Ser Ser Ser Lys Leu Trp Ala Gln Cys Val Gln Leu His Asn 3860 3865 3870 Asp Ile Leu Leu Ala Lys Asp Thr Thr Glu Ala Phe Glu Lys Met 3875 3880 3885 Val Ser Leu Leu Ser Val Leu Leu Ser Met Gln Gly Ala Val Asp 3890 3895 3900 Ile Asn Arg Leu Cys Glu Glu Met Leu Asp Asn Arg Ala Thr Leu 3905 3910 3915 Gln Ala Ile Ala Ser Glu Phe Ser Ser Leu Pro Ser Tyr Ala Ala 3920 3925 3930 Tyr Ala Thr Ala Gln Glu Ala Tyr Glu Gln Ala Val Ala Asn Gly 3935 3940 3945 Asp Ser Glu Val Val Leu Lys Lys Leu Lys Lys Ser Leu Asn Val 3950 3955 3960 Ala Lys Ser Glu Phe Asp Arg Asp Ala Ala Met Gln Arg Lys Leu 3965 3970 3975 Glu Lys Met Ala Asp Gln Ala Met Thr Gln Met Tyr Lys Gln Ala 3980 3985 3990 Arg Ser Glu Asp Lys Arg Ala Lys Val Thr Ser Ala Met Gln Thr 3995 4000 4005 Met Leu Phe Thr Met Leu Arg Lys Leu Asp Asn Asp Ala Leu Asn 4010 4015 4020 Asn Ile Ile Asn Asn Ala Arg Asp Gly Cys Val Pro Leu Asn Ile 4025 4030 4035 Ile Pro Leu Thr Thr Ala Ala Lys Leu Met Val Val Val Pro Asp 4040 4045 4050 Tyr Gly Thr Tyr Lys Asn Thr Cys Asp Gly Asn Thr Phe Thr Tyr 4055 4060 4065 Ala Ser Ala Leu Trp Glu Ile Gln Gln Val Val Asp Ala Asp Ser 4070 4075 4080 Lys Ile Val Gln Leu Ser Glu Ile Asn Met Asp Asn Ser Pro Asn 4085 4090 4095 Leu Ala Trp Pro Leu Ile Val Thr Ala Leu Arg Ala Asn Ser Ala 4100 4105 4110 Val Lys Leu Gln Asn Asn Glu Leu Ser Pro Val Ala Leu Arg Gln 4115 4120 4125 Met Ser Cys Ala Ala Gly Thr Thr Gln Thr Ala Cys Thr Asp Asp 4130 4135 4140 Asn Ala Leu Ala Tyr Tyr Asn Asn Ser Lys Gly Gly Arg Phe Val 4145 4150 4155 Leu Ala Leu Leu Ser Asp His Gln Asp Leu Lys Trp Ala Arg Phe 4160 4165 4170 Pro Lys Ser Asp Gly Thr Gly Thr Ile Tyr Thr Glu Leu Glu Pro 4175 4180 4185 Pro Cys Arg Phe Val Thr Asp Thr Pro Lys Gly Pro Lys Val Lys 4190 4195 4200 Tyr Leu Tyr Phe Ile Lys Gly Leu Asn Asn Leu Asn Arg Gly Met 4205 4210 4215 Val Leu Gly Ser Leu Ala Ala Thr Val Arg Leu Gln Ala Gly Asn 4220 4225 4230 Ala Thr Glu Val Pro Ala Asn Ser Thr Val Leu Ser Phe Cys Ala 4235 4240 4245 Phe Ala Val Asp Pro Ala Lys Ala Tyr Lys Asp Tyr Leu Ala Ser 4250 4255 4260 Gly Gly Gln Pro Ile Thr Asn Cys Val Lys Met Leu Cys Thr His 4265 4270 4275 Thr Gly Thr Gly Gln Ala Ile Thr Val Thr Pro Glu Ala Asn Met 4280 4285 4290 Asp Gln Glu Ser Phe Gly Gly Ala Ser Cys Cys Leu Tyr Cys Arg 4295 4300 4305 Cys His Ile Asp His Pro Asn Pro Lys Gly Phe Cys Asp Leu Lys 4310 4315 4320 Gly Lys Tyr Val Gln Ile Pro Thr Thr Cys Ala Asn Asp Pro Val 4325 4330 4335 Gly Phe Thr Leu Arg Asn Thr Val Cys Thr Val Cys Gly Met Trp 4340 4345 4350 Lys Gly Tyr Gly Cys Ser Cys Asp Gln Leu Arg Glu Pro Leu Met 4355 4360 4365 Gln Ser Ala Asp Ala Ser Thr Phe Leu Asn Gly Phe Ala Val 4370 4375 4380 75 2695 PRT CORONAVIRUS 75 Arg Val Cys Gly Val Ser Ala Ala Arg Leu Thr Pro Cys Gly Thr Gly 1 5 10 15 Thr Ser Thr Asp Val Val Tyr Arg Ala Phe Asp Ile Tyr Asn Glu Lys 20 25 30 Val Ala Gly Phe Ala Lys Phe Leu Lys Thr Asn Cys Cys Arg Phe Gln 35 40 45 Glu Lys Asp Glu Glu Gly Asn Leu Leu Asp Ser Tyr Phe Val Val Lys 50 55 60 Arg His Thr Met Ser Asn Tyr Gln His Glu Glu Thr Ile Tyr Asn Leu 65 70 75 80 Val Lys Asp Cys Pro Ala Val Ala Val His Asp Phe Phe Lys Phe Arg 85 90 95 Val Asp Gly Asp Met Val Pro His Ile Ser Arg Gln Arg Leu Thr Lys 100 105 110 Tyr Thr Met Ala Asp Leu Val Tyr Ala Leu Arg His Phe Asp Glu Gly 115 120 125 Asn Cys Asp Thr Leu Lys Glu Ile Leu Val Thr Tyr Asn Cys Cys Asp 130 135 140 Asp Asp Tyr Phe Asn Lys Lys Asp Trp Tyr Asp Phe Val Glu Asn Pro 145 150 155 160 Asp Ile Leu Arg Val Tyr Ala Asn Leu Gly Glu Arg Val Arg Gln Ser 165 170 175 Leu Leu Lys Thr Val Gln Phe Cys Asp Ala Met Arg Asp Ala Gly Ile 180 185 190 Val Gly Val Leu Thr Leu Asp Asn Gln Asp Leu Asn Gly Asn Trp Tyr 195 200 205 Asp Phe Gly Asp Phe Val Gln Val Ala Pro Gly Cys Gly Val Pro Ile 210 215 220 Val Asp Ser Tyr Tyr Ser Leu Leu Met Pro Ile Leu Thr Leu Thr Arg 225 230 235 240 Ala Leu Ala Ala Glu Ser His Met Asp Ala Asp Leu Ala Lys Pro Leu 245 250 255 Ile Lys Trp Asp Leu Leu Lys Tyr Asp Phe Thr Glu Glu Arg Leu Cys 260 265 270 Leu Phe Asp Arg Tyr Phe Lys Tyr Trp Asp Gln Thr Tyr His Pro Asn 275 280 285 Cys Ile Asn Cys Leu Asp Asp Arg Cys Ile Leu His Cys Ala Asn Phe 290 295 300 Asn Val Leu Phe Ser Thr Val Phe Pro Pro Thr Ser Phe Gly Pro Leu 305 310 315 320 Val Arg Lys Ile Phe Val Asp Gly Val Pro Phe Val Val Ser Thr Gly 325 330 335 Tyr His Phe Arg Glu Leu Gly Val Val His Asn Gln Asp Val Asn Leu 340 345 350 His Ser Ser Arg Leu Ser Phe Lys Glu Leu Leu Val Tyr Ala Ala Asp 355 360 365 Pro Ala Met His Ala Ala Ser Gly Asn Leu Leu Leu Asp Lys Arg Thr 370 375 380 Thr Cys Phe Ser Val Ala Ala Leu Thr Asn Asn Val Ala Phe Gln Thr 385 390 395 400 Val Lys Pro Gly Asn Phe Asn Lys Asp Phe Tyr Asp Phe Ala Val Ser 405 410 415 Lys Gly Phe Phe Lys Glu Gly Ser Ser Val Glu Leu Lys His Phe Phe 420 425 430 Phe Ala Gln Asp Gly Asn Ala Ala Ile Ser Asp Tyr Asp Tyr Tyr Arg 435 440 445 Tyr Asn Leu Pro Thr Met Cys Asp Ile Arg Gln Leu Leu Phe Val Val 450 455 460 Glu Val Val Asp Lys Tyr Phe Asp Cys Tyr Asp Gly Gly Cys Ile Asn 465 470 475 480 Ala Asn Gln Val Ile Val Asn Asn Leu Asp Lys Ser Ala Gly Phe Pro 485 490 495 Phe Asn Lys Trp Gly Lys Ala Arg Leu Tyr Tyr Asp Ser Met Ser Tyr 500 505 510 Glu Asp Gln Asp Ala Leu Phe Ala Tyr Thr Lys Arg Asn Val Ile Pro 515 520 525 Thr Ile Thr Gln Met Asn Leu Lys Tyr Ala Ile Ser

Ala Lys Asn Arg 530 535 540 Ala Arg Thr Val Ala Gly Val Ser Ile Cys Ser Thr Met Thr Asn Arg 545 550 555 560 Gln Phe His Gln Lys Leu Leu Lys Ser Ile Ala Ala Thr Arg Gly Ala 565 570 575 Thr Val Val Ile Gly Thr Ser Lys Phe Tyr Gly Gly Trp His Asn Met 580 585 590 Leu Lys Thr Val Tyr Ser Asp Val Glu Thr Pro His Leu Met Gly Trp 595 600 605 Asp Tyr Pro Lys Cys Asp Arg Ala Met Pro Asn Met Leu Arg Ile Met 610 615 620 Ala Ser Leu Val Leu Ala Arg Lys His Asn Thr Cys Cys Asn Leu Ser 625 630 635 640 His Arg Phe Tyr Arg Leu Ala Asn Glu Cys Ala Gln Val Leu Ser Glu 645 650 655 Met Val Met Cys Gly Gly Ser Leu Tyr Val Lys Pro Gly Gly Thr Ser 660 665 670 Ser Gly Asp Ala Thr Thr Ala Tyr Ala Asn Ser Val Phe Asn Ile Cys 675 680 685 Gln Ala Val Thr Ala Asn Val Asn Ala Leu Leu Ser Thr Asp Gly Asn 690 695 700 Lys Ile Ala Asp Lys Tyr Val Arg Asn Leu Gln His Arg Leu Tyr Glu 705 710 715 720 Cys Leu Tyr Arg Asn Arg Asp Val Asp His Glu Phe Val Asp Glu Phe 725 730 735 Tyr Ala Tyr Leu Arg Lys His Phe Ser Met Met Ile Leu Ser Asp Asp 740 745 750 Ala Val Val Cys Tyr Asn Ser Asn Tyr Ala Ala Gln Gly Leu Val Ala 755 760 765 Ser Ile Lys Asn Phe Lys Ala Val Leu Tyr Tyr Gln Asn Asn Val Phe 770 775 780 Met Ser Glu Ala Lys Cys Trp Thr Glu Thr Asp Leu Thr Lys Gly Pro 785 790 795 800 His Glu Phe Cys Ser Gln His Thr Met Leu Val Lys Gln Gly Asp Asp 805 810 815 Tyr Val Tyr Leu Pro Tyr Pro Asp Pro Ser Arg Ile Leu Gly Ala Gly 820 825 830 Cys Phe Val Asp Asp Ile Val Lys Thr Asp Gly Thr Leu Met Ile Glu 835 840 845 Arg Phe Val Ser Leu Ala Ile Asp Ala Tyr Pro Leu Thr Lys His Pro 850 855 860 Asn Gln Glu Tyr Ala Asp Val Phe His Leu Tyr Leu Gln Tyr Ile Arg 865 870 875 880 Lys Leu His Asp Glu Leu Thr Gly His Met Leu Asp Met Tyr Ser Val 885 890 895 Met Leu Thr Asn Asp Asn Thr Ser Arg Tyr Trp Glu Pro Glu Phe Tyr 900 905 910 Glu Ala Met Tyr Thr Pro His Thr Val Leu Gln Ala Val Gly Ala Cys 915 920 925 Val Leu Cys Asn Ser Gln Thr Ser Leu Arg Cys Gly Ala Cys Ile Arg 930 935 940 Arg Pro Phe Leu Cys Cys Lys Cys Cys Tyr Asp His Val Ile Ser Thr 945 950 955 960 Ser His Lys Leu Val Leu Ser Val Asn Pro Tyr Val Cys Asn Ala Pro 965 970 975 Gly Cys Asp Val Thr Asp Val Thr Gln Leu Tyr Leu Gly Gly Met Ser 980 985 990 Tyr Tyr Cys Lys Ser His Lys Pro Pro Ile Ser Phe Pro Leu Cys Ala 995 1000 1005 Asn Gly Gln Val Phe Gly Leu Tyr Lys Asn Thr Cys Val Gly Ser 1010 1015 1020 Asp Asn Val Thr Asp Phe Asn Ala Ile Ala Thr Cys Asp Trp Thr 1025 1030 1035 Asn Ala Gly Asp Tyr Ile Leu Ala Asn Thr Cys Thr Glu Arg Leu 1040 1045 1050 Lys Leu Phe Ala Ala Glu Thr Leu Lys Ala Thr Glu Glu Thr Phe 1055 1060 1065 Lys Leu Ser Tyr Gly Ile Ala Thr Val Arg Glu Val Leu Ser Asp 1070 1075 1080 Arg Glu Leu His Leu Ser Trp Glu Val Gly Lys Pro Arg Pro Pro 1085 1090 1095 Leu Asn Arg Asn Tyr Val Phe Thr Gly Tyr Arg Val Thr Lys Asn 1100 1105 1110 Ser Lys Val Gln Ile Gly Glu Tyr Thr Phe Glu Lys Gly Asp Tyr 1115 1120 1125 Gly Asp Ala Val Val Tyr Arg Gly Thr Thr Thr Tyr Lys Leu Asn 1130 1135 1140 Val Gly Asp Tyr Phe Val Leu Thr Ser His Thr Val Met Pro Leu 1145 1150 1155 Ser Ala Pro Thr Leu Val Pro Gln Glu His Tyr Val Arg Ile Thr 1160 1165 1170 Gly Leu Tyr Pro Thr Leu Asn Ile Ser Asp Glu Phe Ser Ser Asn 1175 1180 1185 Val Ala Asn Tyr Gln Lys Val Gly Met Gln Lys Tyr Ser Thr Leu 1190 1195 1200 Gln Gly Pro Pro Gly Thr Gly Lys Ser His Phe Ala Ile Gly Leu 1205 1210 1215 Ala Leu Tyr Tyr Pro Ser Ala Arg Ile Val Tyr Thr Ala Cys Ser 1220 1225 1230 His Ala Ala Val Asp Ala Leu Cys Glu Lys Ala Leu Lys Tyr Leu 1235 1240 1245 Pro Ile Asp Lys Cys Ser Arg Ile Ile Pro Ala Arg Ala Arg Val 1250 1255 1260 Glu Cys Phe Asp Lys Phe Lys Val Asn Ser Thr Leu Glu Gln Tyr 1265 1270 1275 Val Phe Cys Thr Val Asn Ala Leu Pro Glu Thr Thr Ala Asp Ile 1280 1285 1290 Val Val Phe Asp Glu Ile Ser Met Ala Thr Asn Tyr Asp Leu Ser 1295 1300 1305 Val Val Asn Ala Arg Leu Arg Ala Lys His Tyr Val Tyr Ile Gly 1310 1315 1320 Asp Pro Ala Gln Leu Pro Ala Pro Arg Thr Leu Leu Thr Lys Gly 1325 1330 1335 Thr Leu Glu Pro Glu Tyr Phe Asn Ser Val Cys Arg Leu Met Lys 1340 1345 1350 Thr Ile Gly Pro Asp Met Phe Leu Gly Thr Cys Arg Arg Cys Pro 1355 1360 1365 Ala Glu Ile Val Asp Thr Val Ser Ala Leu Val Tyr Asp Asn Lys 1370 1375 1380 Leu Lys Ala His Lys Asp Lys Ser Ala Gln Cys Phe Lys Met Phe 1385 1390 1395 Tyr Lys Gly Val Ile Thr His Asp Val Ser Ser Ala Ile Asn Arg 1400 1405 1410 Pro Gln Ile Gly Val Val Arg Glu Phe Leu Thr Arg Asn Pro Ala 1415 1420 1425 Trp Arg Lys Ala Val Phe Ile Ser Pro Tyr Asn Ser Gln Asn Ala 1430 1435 1440 Val Ala Ser Lys Ile Leu Gly Leu Pro Thr Gln Thr Val Asp Ser 1445 1450 1455 Ser Gln Gly Ser Glu Tyr Asp Tyr Val Ile Phe Thr Gln Thr Thr 1460 1465 1470 Glu Thr Ala His Ser Cys Asn Val Asn Arg Phe Asn Val Ala Ile 1475 1480 1485 Thr Arg Ala Lys Ile Gly Ile Leu Cys Ile Met Ser Asp Arg Asp 1490 1495 1500 Leu Tyr Asp Lys Leu Gln Phe Thr Ser Leu Glu Ile Pro Arg Arg 1505 1510 1515 Asn Val Ala Thr Leu Gln Ala Glu Asn Val Thr Gly Leu Phe Lys 1520 1525 1530 Asp Cys Ser Lys Ile Ile Thr Gly Leu His Pro Thr Gln Ala Pro 1535 1540 1545 Thr His Leu Ser Val Asp Ile Lys Phe Lys Thr Glu Gly Leu Cys 1550 1555 1560 Val Asp Ile Pro Gly Ile Pro Lys Asp Met Thr Tyr Arg Arg Leu 1565 1570 1575 Ile Ser Met Met Gly Phe Lys Met Asn Tyr Gln Val Asn Gly Tyr 1580 1585 1590 Pro Asn Met Phe Ile Thr Arg Glu Glu Ala Ile Arg His Val Arg 1595 1600 1605 Ala Trp Ile Gly Phe Asp Val Glu Gly Cys His Ala Thr Arg Asp 1610 1615 1620 Ala Val Gly Thr Asn Leu Pro Leu Gln Leu Gly Phe Ser Thr Gly 1625 1630 1635 Val Asn Leu Val Ala Val Pro Thr Gly Tyr Val Asp Thr Glu Asn 1640 1645 1650 Asn Thr Glu Phe Thr Arg Val Asn Ala Lys Pro Pro Pro Gly Asp 1655 1660 1665 Gln Phe Lys His Leu Ile Pro Leu Met Tyr Lys Gly Leu Pro Trp 1670 1675 1680 Asn Val Val Arg Ile Lys Ile Val Gln Met Leu Ser Asp Thr Leu 1685 1690 1695 Lys Gly Leu Ser Asp Arg Val Val Phe Val Leu Trp Ala His Gly 1700 1705 1710 Phe Glu Leu Thr Ser Met Lys Tyr Phe Val Lys Ile Gly Pro Glu 1715 1720 1725 Arg Thr Cys Cys Leu Cys Asp Lys Arg Ala Thr Cys Phe Ser Thr 1730 1735 1740 Ser Ser Asp Thr Tyr Ala Cys Trp Asn His Ser Val Gly Phe Asp 1745 1750 1755 Tyr Val Tyr Asn Pro Phe Met Ile Asp Val Gln Gln Trp Gly Phe 1760 1765 1770 Thr Gly Asn Leu Gln Ser Asn His Asp Gln His Cys Gln Val His 1775 1780 1785 Gly Asn Ala His Val Ala Ser Cys Asp Ala Ile Met Thr Arg Cys 1790 1795 1800 Leu Ala Val His Glu Cys Phe Val Lys Arg Val Asp Trp Ser Val 1805 1810 1815 Glu Tyr Pro Ile Ile Gly Asp Glu Leu Arg Val Asn Ser Ala Cys 1820 1825 1830 Arg Lys Val Gln His Met Val Val Lys Ser Ala Leu Leu Ala Asp 1835 1840 1845 Lys Phe Pro Val Leu His Asp Ile Gly Asn Pro Lys Ala Ile Lys 1850 1855 1860 Cys Val Pro Gln Ala Glu Val Glu Trp Lys Phe Tyr Asp Ala Gln 1865 1870 1875 Pro Cys Ser Asp Lys Ala Tyr Lys Ile Glu Glu Leu Phe Tyr Ser 1880 1885 1890 Tyr Ala Thr His His Asp Lys Phe Thr Asp Gly Val Cys Leu Phe 1895 1900 1905 Trp Asn Cys Asn Val Asp Arg Tyr Pro Ala Asn Ala Ile Val Cys 1910 1915 1920 Arg Phe Asp Thr Arg Val Leu Ser Asn Leu Asn Leu Pro Gly Cys 1925 1930 1935 Asp Gly Gly Ser Leu Tyr Val Asn Lys His Ala Phe His Thr Pro 1940 1945 1950 Ala Phe Asp Lys Ser Ala Phe Thr Asn Leu Lys Gln Leu Pro Phe 1955 1960 1965 Phe Tyr Tyr Ser Asp Ser Pro Cys Glu Ser His Gly Lys Gln Val 1970 1975 1980 Val Ser Asp Ile Asp Tyr Val Pro Leu Lys Ser Ala Thr Cys Ile 1985 1990 1995 Thr Arg Cys Asn Leu Gly Gly Ala Val Cys Arg His His Ala Asn 2000 2005 2010 Glu Tyr Arg Gln Tyr Leu Asp Ala Tyr Asn Met Met Ile Ser Ala 2015 2020 2025 Gly Phe Ser Leu Trp Ile Tyr Lys Gln Phe Asp Thr Tyr Asn Leu 2030 2035 2040 Trp Asn Thr Phe Thr Arg Leu Gln Ser Leu Glu Asn Val Ala Tyr 2045 2050 2055 Asn Val Val Asn Lys Gly His Phe Asp Gly His Ala Gly Glu Ala 2060 2065 2070 Pro Val Ser Ile Ile Asn Asn Ala Val Tyr Thr Lys Val Asp Gly 2075 2080 2085 Ile Asp Val Glu Ile Phe Glu Asn Lys Thr Thr Leu Pro Val Asn 2090 2095 2100 Val Ala Phe Glu Leu Trp Ala Lys Arg Asn Ile Lys Pro Val Pro 2105 2110 2115 Glu Ile Lys Ile Leu Asn Asn Leu Gly Val Asp Ile Ala Ala Asn 2120 2125 2130 Thr Val Ile Trp Asp Tyr Lys Arg Glu Ala Pro Ala His Val Ser 2135 2140 2145 Thr Ile Gly Val Cys Thr Met Thr Asp Ile Ala Lys Lys Pro Thr 2150 2155 2160 Glu Ser Ala Cys Ser Ser Leu Thr Val Leu Phe Asp Gly Arg Val 2165 2170 2175 Glu Gly Gln Val Asp Leu Phe Arg Asn Ala Arg Asn Gly Val Leu 2180 2185 2190 Ile Thr Glu Gly Ser Val Lys Gly Leu Thr Pro Ser Lys Gly Pro 2195 2200 2205 Ala Gln Ala Ser Val Asn Gly Val Thr Leu Ile Gly Glu Ser Val 2210 2215 2220 Lys Thr Gln Phe Asn Tyr Phe Lys Lys Val Asp Gly Ile Ile Gln 2225 2230 2235 Gln Leu Pro Glu Thr Tyr Phe Thr Gln Ser Arg Asp Leu Glu Asp 2240 2245 2250 Phe Lys Pro Arg Ser Gln Met Glu Thr Asp Phe Leu Glu Leu Ala 2255 2260 2265 Met Asp Glu Phe Ile Gln Arg Tyr Lys Leu Glu Gly Tyr Ala Phe 2270 2275 2280 Glu His Ile Val Tyr Gly Asp Phe Ser His Gly Gln Leu Gly Gly 2285 2290 2295 Leu His Leu Met Ile Gly Leu Ala Lys Arg Ser Gln Asp Ser Pro 2300 2305 2310 Leu Lys Leu Glu Asp Phe Ile Pro Met Asp Ser Thr Val Lys Asn 2315 2320 2325 Tyr Phe Ile Thr Asp Ala Gln Thr Gly Ser Ser Lys Cys Val Cys 2330 2335 2340 Ser Val Ile Asp Leu Leu Leu Asp Asp Phe Val Glu Ile Ile Lys 2345 2350 2355 Ser Gln Asp Leu Ser Val Ile Ser Lys Val Val Lys Val Thr Ile 2360 2365 2370 Asp Tyr Ala Glu Ile Ser Phe Met Leu Trp Cys Lys Asp Gly His 2375 2380 2385 Val Glu Thr Phe Tyr Pro Lys Leu Gln Ala Ser Gln Ala Trp Gln 2390 2395 2400 Pro Gly Val Ala Met Pro Asn Leu Tyr Lys Met Gln Arg Met Leu 2405 2410 2415 Leu Glu Lys Cys Asp Leu Gln Asn Tyr Gly Glu Asn Ala Val Ile 2420 2425 2430 Pro Lys Gly Ile Met Met Asn Val Ala Lys Tyr Thr Gln Leu Cys 2435 2440 2445 Gln Tyr Leu Asn Thr Leu Thr Leu Ala Val Pro Tyr Asn Met Arg 2450 2455 2460 Val Ile His Phe Gly Ala Gly Ser Asp Lys Gly Val Ala Pro Gly 2465 2470 2475 Thr Ala Val Leu Arg Gln Trp Leu Pro Thr Gly Thr Leu Leu Val 2480 2485 2490 Asp Ser Asp Leu Asn Asp Phe Val Ser Asp Ala Asp Ser Thr Leu 2495 2500 2505 Ile Gly Asp Cys Ala Thr Val His Thr Ala Asn Lys Trp Asp Leu 2510 2515 2520 Ile Ile Ser Asp Met Tyr Asp Pro Arg Thr Lys His Val Thr Lys 2525 2530 2535 Glu Asn Asp Ser Lys Glu Gly Phe Phe Thr Tyr Leu Cys Gly Phe 2540 2545 2550 Ile Lys Gln Lys Leu Ala Leu Gly Gly Ser Ile Ala Val Lys Ile 2555 2560 2565 Thr Glu His Ser Trp Asn Ala Asp Leu Tyr Lys Leu Met Gly His 2570 2575 2580 Phe Ser Trp Trp Thr Ala Phe Val Thr Asn Val Asn Ala Ser Ser 2585 2590 2595 Ser Glu Ala Phe Leu Ile Gly Ala Asn Tyr Leu Gly Lys Pro Lys 2600 2605 2610 Glu Gln Ile Asp Gly Tyr Thr Met His Ala Asn Tyr Ile Phe Trp 2615 2620 2625 Arg Asn Thr Asn Pro Ile Gln Leu Ser Ser Tyr Ser Leu Phe Asp 2630 2635 2640 Met Ser Lys Phe Pro Leu Lys Leu Arg Gly Thr Ala Val Met Ser 2645 2650 2655 Leu Lys Glu Asn Gln Ile Asn Asp Met Ile Tyr Ser Leu Leu Glu 2660 2665 2670 Lys Gly Arg Leu Ile Ile Arg Glu Asn Asn Arg Val Val Val Ser 2675 2680 2685 Ser Asp Ile Leu Val Asn Asn 2690 2695 76 20 DNA Artificial sequence S/L3/+/4932 primer 76 ccacacacag cttgtggata 20 77 20 DNA Artificial sequence S/L4/+/6401 primer 77 ccgaagttgt aggcaatgtc 20 78 20 DNA Artificial sequence S/L4/+/6964 primer 78 tttggtgctc cttcttattg 20 79 20 DNA Artificial sequence S/L4/-/6817 primer 79 ccggcatcca aacataattt 20 80 20 DNA Artificial sequence S/L5/-/7633 primer 80 tggtcagtag ggttgattgg 20 81 20 DNA Artificial sequence S/L5/-/8127 primer 81 catcctttgt gtcaacatcg 20 82 20 DNA Artificial sequence S/L5/-/8633 primer 82 gtcacgagtg acaccatcct 20 83 20 DNA Artificial sequence S/L5/+/7839 primer 83 atgcgacgag tctgcttcta 20 84 20 DNA Artificial sequence S/L5/+/8785 primer 84 ttcatagtgc ctggcttacc 20 85 20 DNA Artificial sequence S/L5/+/8255 primer 85 atcttggcgc atgtattgac 20 86 20 DNA Artificial sequence S/L6/-/9422 primer 86 tgcattagca gcaacaacat 20 87 20 DNA Artificial sequence S/L6/-/9966 primer 87 tctgcagaac agcagaagtg 20 88 20 DNA Artificial sequence S/L6/-/10542 primer 88 cctgtgcagt ttgtctgtca 20 89 20 DNA Artificial sequence S/L6/+/10677 primer 89 ccttgtggca atgaagtaca 20 90 20 DNA Artificial sequence S/L6/+/10106 primer 90 atgtcatttg cacagcagaa

20 91 20 DNA Artificial sequence S/L6/+/9571 primer 91 cttcaatggt ttgccatgtt 20 92 20 DNA Artificial sequence S/L7/-/11271 primer 92 tgcgagctgt catgagaata 20 93 20 DNA Artificial sequence S/L7/-/11801 primer 93 aaccgagagc agtaccacag 20 94 20 DNA Artificial sequence S/L7/-/12383 primer 94 tttggctgct gtagtcaatg 20 95 20 DNA Artificial sequence S/L7/+/12640 primer 95 ctacgacaga tgtcctgtgc 20 96 20 DNA Artificial sequence S/L7/+/12088 primer 96 gagcaggctg tagctaatgg 20 97 20 DNA Artificial sequence S/L7/+/11551 primer 97 ttaggctatt gttgctgctg 20 98 20 DNA Artificial sequence S/L8/-/13160 primer 98 cagacaacat gaagcaccac 20 99 20 DNA Artificial sequence S/L8/-/13704 primer 99 cgctgacgtg atatatgtgg 20 100 20 DNA Artificial sequence S/L8/-/14284 primer 100 tgcacaatga aggatacacc 20 101 20 DNA Artificial sequence S/L8/+/14453 primer 101 acatagctcg cgtctcagtt 20 102 20 DNA Artificial sequence S/L8/+/13968 primer 102 ggcattgtag gcgtactgac 20 103 19 DNA Artificial sequence S/L8/+/13401 primer 103 gtttgcggtg taagtgcag 19 104 20 DNA Artificial sequence S/L9/-/15098 primer 104 tagtggcggc tattgacttc 20 105 20 DNA Artificial sequence S/L9/-/15677 primer 105 ctaaaccttg agccgcatag 20 106 20 DNA Artificial sequence S/L9/-/16247 primer 106 catggtcata gcagcacttg 20 107 21 DNA Artificial sequence S/L9/+/16323 primer 107 ccaggttgtg atgtcactga t 21 108 20 DNA Artificial sequence S/L9/+/15858 primer 108 ccttacccag atccatcaag 20 109 20 DNA Artificial sequence S/L9/+/15288 primer 109 cgcaaacata acacttgctg 20 110 20 DNA Artificial sequence S/L10/-/16914 primer 110 agtgttgggt acaagccagt 20 111 20 DNA Artificial sequence S/L10/-/17466 primer 111 gttccaagga acatgtctgg 20 112 20 DNA Artificial sequence S/L10/-/18022 primer 112 aggtgcctgt gtaggatgaa 20 113 20 DNA Artificial sequence S/L10/+/18245 primer 113 gggctgtcat gcaactagag 20 114 20 DNA Artificial sequence S/L10/+/17663 primer 114 tcttacacgc aatcctgctt 20 115 20 DNA Artificial sequence S/L10/+/17061 primer 115 tacccatctg ctcgcatagt 20 116 20 DNA Artificial sequence S/L11/-/18877 primer 116 gcaagcagaa ttaaccctca 20 117 20 DNA Artificial sequence S/L11/-/19396 primer 117 agcaccacct aaattgcatc 20 118 20 DNA Artificial sequence S/L11/-/20002 primer 118 tggtcccttt gaaggtgtta 20 119 20 DNA Artificial sequence S/L11/+/20245 primer 119 tcgaacacat cgtttatgga 20 120 20 DNA Artificial sequence S/L11/+/19611 primer 120 gaagcacctg tttccatcat 20 121 20 DNA Artificial sequence S/L11/+/19021 primer 121 acgatgctca gccatgtagt 20 122 20 DNA Artificial sequence SARS/L1/F3/+/800 primer 122 gaggtgcagt cactcgctat 20 123 20 DNA Artificial sequence SARS/L1/F4/+/1391 primer 123 cagagattgg acctgagcat 20 124 20 DNA Artificial sequence SARS/L1/F5/+/1925 primer 124 cagcaaacca ctcaattcct 20 125 20 DNA Artificial sequence SARS/L1/R3/-/1674 primer 125 aaatgatggc aacctcttca 20 126 20 DNA Artificial sequence SARS/L1/R4/-/1107 primer 126 cacgtggttg aatgactttg 20 127 20 DNA Artificial sequence SARS/L1/R5/-/520 primer 127 atttctgcaa ccagctcaac 20 128 20 DNA Artificial sequence SARS/L2/F3/+/2664 primer 128 cgcattgtct cctggtttac 20 129 20 DNA Artificial sequence SARS/L2/F4/+/3232 primer 129 gagattgagc cagaaccaga 20 130 20 DNA Artificial sequence SARS/L2/F5/+/3746 primer 130 atgagcaggt tgtcatggat 20 131 20 DNA Artificial sequence SARS/L2/R3/-/3579 primer 131 ctgccttaag aagctggatg 20 132 20 DNA Artificial sequence SARS/L2/R4/-/2991 primer 132 tttcttcacc agcatcatca 20 133 20 DNA Artificial sequence SARS/L2/R5/-/2529 primer 133 caccgttctt gagaacaacc 20 134 20 DNA Artificial sequence SARS/L3/F3/+/4708 primer 134 tctttggctg gctcttacag 20 135 20 DNA Artificial sequence SRAS/L3/F4/+/5305 primer 135 gctggtgatg ctgctaactt 20 136 20 DNA Artificial sequence SARS/L3/F5/+/5822 primer 136 ccatcaagcc tgtgtcgtat 20 137 20 DNA Artificial sequence SARS/L3/R3/-/5610 primer 137 caggtggtgc agacatcata 20 138 20 DNA Artificial sequence SARS/L3/R4/-/4988 primer 138 aacatcagca ccatccaagt 20 139 20 DNA Artificial sequence SARS/L3/R5/-/4437 primer 139 atcggacacc atagtcaacg 20 140 7788 DNA Artificial sequence synthetic S gene 140 tcaatattgg ccattagcca tattattcat tggttatata gcataaatca atattggcta 60 ttggccattg catacgttgt atctatatca taatatgtac atttatattg gctcatgtcc 120 aatatgaccg ccatgttggc attgattatt gactagttat taatagtaat caattacggg 180 gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc 240 gcctggctga ccgcccaacg acccccgccc attgacgtca ataatgacgt atgttcccat 300 agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc 360 ccacttggca gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga 420 cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact ttcctacttg 480 gcagtacatc tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacac 540 caatgggcgt ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt 600 caatgggagt ttgttttggc accaaaatca acgggacttt ccaaaatgtc gtaataaccc 660 cgccccgttg acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc 720 tcgtttagtg aaccgtcaga tcactagaag ctttattgcg gtagtttatc acagttaaat 780 tgctaacgca gtcagtgctt ctgacacaac agtctcgaac ttaagctgca gaagttggtc 840 gtgaggcact gggcaggtaa gtatcaaggt tacaagacag gtttaaggag accaatagaa 900 actgggcttg tcgagacaga gaagactctt gcgtttctga taggcaccta ttggtcttac 960 tgacatccac tttgcctttc tctccacagg tgtccactcc cagttcaatt acagctctta 1020 aggctagagt acttaatacg actcactata ggctagcgga tccaccatgt tcatcttcct 1080 gctgttcctg accctgacca gcggcagcga cctggaccgg tgcaccacct tcgacgacgt 1140 gcaggccccc aactacaccc agcacaccag cagcatgcgg ggcgtgtact accccgacga 1200 gatctttcgg agcgacaccc tgtacctgac ccaggacctg ttcctgccct tctacagcaa 1260 cgtgaccggc ttccacacca tcaaccacac cttcggcaac cccgtgatcc ccttcaagga 1320 cggcatctac ttcgccgcca ccgagaagag caacgtggtg cggggctggg tgttcggcag 1380 caccatgaac aacaagagcc agagcgtgat catcatcaac aacagcacca acgtggtgat 1440 ccgggcctgc aacttcgagc tgtgcgacaa ccccttcttc gccgtgtcca aacccatggg 1500 cacccagacc cacaccatga tcttcgacaa cgccttcaac tgcaccttcg agtacatcag 1560 cgacgccttc agcctggacg tgagcgagaa gagcggcaac ttcaagcacc tgcgggagtt 1620 cgtgttcaag aacaaggacg gcttcctgta cgtgtacaag ggctaccagc ccatcgacgt 1680 ggtgagagac ctgcccagcg gcttcaacac cctgaagccc atcttcaagc tgcccctggg 1740 catcaacatc accaacttcc gggccatcct gaccgccttt agccctgccc aggacatctg 1800 gggcaccagc gccgccgcct acttcgtggg ctacctgaag cctaccacct tcatgctgaa 1860 gtacgacgag aacggcacca tcaccgacgc cgtggactgc agccagaacc ccctggccga 1920 gctgaagtgc agcgtgaaga gcttcgagat cgacaagggc atctaccaga ccagcaactt 1980 cagagtggtg cctagcggcg atgtggtgcg gttccccaat atcaccaacc tgtgcccctt 2040 cggcgaagtg ttcaacgcca ccaagttccc cagcgtgtac gcctgggagc ggaagaagat 2100 cagcaactgc gtggccgact acagcgtgct gtacaactcc accttcttca gcaccttcaa 2160 gtgctacggc gtgagcgcca ccaagctgaa cgacctgtgc ttcagcaacg tgtacgccga 2220 cagcttcgtg gtgaagggcg acgacgtgag acagatcgcc cctggccaga ccggcgtgat 2280 cgccgactac aactacaagc tgcccgacga cttcatgggc tgcgtgctgg cctggaacac 2340 ccggaacatc gacgccacaa gcaccggcaa ctacaattac aagtaccgct acctgcggca 2400 cggcaagctg cggcccttcg agcgggacat ctccaacgtg cccttcagcc ccgacggcaa 2460 gccctgcacc ccccctgccc tgaactgcta ctggcccctg aacgactacg gcttctacac 2520 caccaccggc atcggctatc agccctacag agtggtggtg ctgagcttcg agctgctgaa 2580 cgcccctgcc accgtgtgcg gccccaagct gagcaccgac ctgatcaaga accagtgcgt 2640 gaacttcaac ttcaacggcc tgaccggcac cggcgtgctg acccccagca gcaagcgctt 2700 ccagcccttc cagcagttcg gccgggatgt gagcgacttc accgacagcg tgcgggaccc 2760 caagaccagc gagatcctgg acatcagccc ctgcagcttc ggcggcgtgt ccgtgatcac 2820 ccccggcacc aacgccagca gcgaagtggc cgtgctgtac caggacgtga actgcaccga 2880 cgtgagcacc gccatccacg ccgaccagct gacccccgcc tggcggatct acagcaccgg 2940 gaacaacgtg ttccagaccc aggccggctg cctgatcggc gccgagcacg tggacaccag 3000 ctacgagtgc gacatcccca ttggcgccgg aatctgcgcc agctaccaca ccgtgagcct 3060 gctgcggagc accagccaga agtccatcgt ggcctacacc atgagcctgg gcgccgacag 3120 cagcatcgcc tacagcaaca acaccatcgc catccccacc aacttcagca tctccatcac 3180 caccgaagtg atgcccgtga gcatggccaa gacaagcgtg gattgcaaca tgtacatctg 3240 cggcgacagc accgagtgcg ccaacctgct gctgcagtac ggcagcttct gcacccagct 3300 gaaccgggcc ctgagcggca tcgccgccga gcaggaccgg aacaccagag aagtgttcgc 3360 ccaagtgaag cagatgtata agacccccac cctgaagtac ttcgggggct tcaacttctc 3420 tcagatcctg cccgaccctc tgaagcccac caagcgctcc ttcatcgagg acctgctgtt 3480 caacaaagtg accctggccg acgccggctt tatgaagcag tacggcgagt gcctgggcga 3540 catcaacgcc cgggacctga tctgcgccca gaagtttaac gggctgaccg tgctgccccc 3600 cctgctgacc gacgacatga tcgccgccta tacagccgcc ctggtgagcg gcaccgccac 3660 cgccggctgg accttcggag ccggagccgc cctgcagatc cccttcgcca tgcagatggc 3720 ctaccggttc aacggcatcg gcgtgaccca gaacgtgctg tacgagaacc agaagcagat 3780 cgccaaccag ttcaacaagg ccatcagcca gatccaggag agcctgacca caaccagcac 3840 cgccctgggc aagctgcagg acgtggtgaa ccagaacgcc caggccctga acaccctggt 3900 gaagcagctg agcagcaact tcggcgccat cagctctgtg ctgaacgaca tcctgagcag 3960 gctggacaaa gtggaggccg aagtgcagat cgaccggctg atcaccggac gcctgcagtc 4020 cctgcagacc tacgtgaccc agcagctgat cagagccgcc gagatccggg ccagcgccaa 4080 tctggccgcc accaagatga gcgagtgcgt gctgggccag agcaagagag tggacttctg 4140 cggcaagggc tatcacctga tgagcttccc ccaggccgcc ccccacggcg tggtgttcct 4200 gcacgtgacc tacgtgccta gccaggagcg gaacttcacc accgccccag ccatctgcca 4260 cgagggcaag gcctacttcc cccgggaggg cgtgttcgtg tttaacggca ccagctggtt 4320 catcacccag cgcaacttct tcagccccca gatcatcacc acagacaaca ccttcgtgtc 4380 cggcaactgt gatgtggtga tcggcatcat caataacacc gtgtacgacc ccctgcagcc 4440 cgagctggac agcttcaagg aggagctgga caaatacttc aagaaccaca cctcccccga 4500 cgtggacctg ggcgatatca gcggcatcaa cgcctccgtg gtgaacatcc agaaggagat 4560 cgacagactg aacgaagtgg ccaagaacct gaacgagagc ctgatcgacc tgcaggagct 4620 gggcaagtac gagcagtaca tcaagtggcc ctggtacgtg tggctgggct tcatcgccgg 4680 cctgatcgcc atcgtgatgg tgaccatcct gctgtgctgc atgaccagct gctgtagctg 4740 cctgaaaggc gcctgcagct gtggcagctg ctgcaagttc gacgaggacg acagcgagcc 4800 cgtgctgaag ggcgtgaagc tgcactacac ctgataactc gagaattcac gcgtggtacc 4860 tctagagtcg acccgggcgg ccgcttcgag cagacatgat aagatacatt gatgagtttg 4920 gacaaaccac aactagaatg cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta 4980 ttgctttatt tgtaaccatt ataagctgca ataaacaagt taacaacaac aattgcattc 5040 attttatgtt tcaggttcag ggggagatgt gggaggtttt ttaaagcaag taaaacctct 5100 acaaatgtgg taaaatcgat aaggatccgg gctggcgtaa tagcgaagag gcccgcaccg 5160 atcgcccttc ccaacagttg cgcagcctga atggcgaatg gacgcgccct gtagcggcgc 5220 attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct 5280 agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg 5340 tcaagctcta aatcgggggc tccctttagg gttccgattt agagctttac ggcacctcga 5400 ccgcaaaaaa cttgatttgg gtgatggttc acgtagtggg ccatcgccct gatagacggt 5460 ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg 5520 aacaacactc aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc 5580 ggcctattgg ttaaaaaatg agctgattta acaaatattt aacgcgaatt ttaacaaaat 5640 attaacgttt acaatttcgc ctgatgcggt attttctcct tacgcatctg tgcggtattt 5700 cacaccgcat atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 5760 cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 5820 cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 5880 caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 5940 tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 6000 ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 6060 gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 6120 cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 6180 tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 6240 tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 6300 cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 6360 tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 6420 agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 6480 ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 6540 ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 6600 aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 6660 gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 6720 tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 6780 ttgctgataa atctggagcc ggtgagcgtg ggtctcgcgg tatcattgca gcactggggc 6840 cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 6900 atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 6960 cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 7020 ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 7080 cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 7140 ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 7200 tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 7260 taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 7320 caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 7380 agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 7440 gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 7500 gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 7560 ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 7620 acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 7680 tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 7740 ggttcctggc cttttgctgg ccttttgctc acatggctcg acagatct 7788 141 23 DNA Artificial sequence SNE-S1 primer 141 ggttgggatt atccaaaatg tga 23 142 24 DNA Artificial sequence SNE-AS1 primer 142 gcatcatcag aaagaatcat catg 24 143 21 DNA Artificial sequence SAR1-S primer 143 cctctcttgt tcttgctcgc a 21 144 21 DNA Artificial sequence SAR1-AS primer 144 tatagtgagc cgccacacat g 21 145 45 DNA Artificial sequence PCR primer 145 ataggatcca ccatgtttat tttcttatta tttcttactc tcact 45 146 37 DNA Artificial sequence PCR primer 146 atactcgagt tatgtgtaat gtaatttgac acccttg 37 147 45 DNA Artificial sequence PCR primer 147 ataggatcca ccatgtttat tttcttatta tttcttactc tcact 45 148 36 DNA Artificial sequence PCR primer 148 acctccggat ttaatatatt gctcatattt tcccaa 36 149 13 PRT Artificial sequence N-terminal end of SRAS-CoV S protein (amino acids 1 to 13) 149 Met Phe Ile Phe Leu Leu Phe Leu Thr Leu Thr Ser Gly 1 5 10 150 10 PRT Artificial sequence oligopeptide 150 Ser Gly Asp Tyr Lys Asp Asp Asp Asp Lys 1 5 10 151 34 DNA Artificial sequence PCR primer 151 actagctagc ggatccacca tgttcatctt cctg 34 152 33 DNA Artificial sequence PCR primer 152 agtatccgga cttgatgtac tgctcgtact tgc 33 153 59 DNA Artificial sequence oligonucleotid 153 tatgagcttt tttttttttt tttttttggc atataaatag actcggcgcg ccatctgca 59 154 53 DNA Artificial sequence oligonucleotid 154 gatggcgcgc cgagtctatt tatatgccaa aaaaaaaaaa aaaaaaaagc tca 53 155 45 DNA Artificial sequence PCR primer 155 atacgtacga ccatgtttat tttcttatta tttcttactc tcact 45 156 40 DNA Artificial sequence PCR primer 156 atagcgcgct cattatgtgt aatgtaattt gacacccttg

40 157 20 DNA Artificial sequence PCR primer 157 ccatttcaac aatttggccg 20 158 45 DNA Artificial sequence PCR primer 158 ataggatccg cgcgctcatt atttatcgtc gtcatcttta taatc 45

Claims

1. An isolated and purified protein or polypeptide, characterized in that it is the S protein having the sequence SEQ ID No: 3, its ectodomain or a fragment of its ectodomain.

2. The protein or polypeptide as claimed in claim 1, characterized in that it consists of the amino acids corresponding to positions 1 to 1193 of the amino acid sequence of the S protein.

3. The protein or polypeptide as claimed in claim 1, characterized in that it consists of the amino acids corresponding to positions 14 to 1193 of the amino acid sequence of the S protein.

4. The isolated protein or polypeptide as claimed in claim 1, characterized in that it consists of the amino acids corresponding to positions 475 to 1193 of the amino acid sequence of the S protein.

5. A nucleic acid encoding a protein or a polypeptide as claimed in any one of claims 1 to 4.

6. The nucleic acid as claimed in claim 5, characterized in that it comprises the sequence encoding SEQ ID No: 5 or the sequence encoding SEQ ID No: 6.

7. A recombinant expression vector, characterized in that it encodes a protein or a polypeptide as claimed in any one of claims 1 to 4.

8. The recombinant expression vector as claimed in claim 7, characterized in that it is chosen from the vectors contained in the following bacterial strains, deposited at the Collection Nationale de Cultures de Microorganismes (CNCM), 25 rue du Docteur Roux, 75724 Paris Cedex 15: a) strain No. I-3118, deposited on Oct. 23, 2003, b) strain No. I-3019, deposited on May 12, 2003, c) strain No. I-3020, deposited on May 12, 2003, d) strain No. I-3059, deposited on Jun. 20, 2003, e) strain No. I-3323, deposited on Nov. 22, 2004, f) strain No. I-3324, deposited on Nov. 22, 2004, g) strain No. I-3326, deposited on Dec. 1, 2004, h) strain No. I-3327, deposited on Dec. 1, 2004, i) strain No. I-3332, deposited on Dec. 1, 2004, j) strain No. I-3333, deposited on Dec. 1, 2004, k) strain No. I-3334, deposited on Dec. 1, 2004, l) strain No. I-3335, deposited on Dec. 1, 2004, m) strain No. I-3336, deposited on Dec. 1, 2004, n) strain No. I-3337, deposited on Dec. 1, 2004, o) strain No. I-3338, deposited on Dec. 2, 2004, p) strain No. I-3339, deposited on Dec. 2, 2004, q) strain No. I-3340, deposited on Dec. 2, 2004, and r) strain No. I-3341, deposited on Dec. 2, 2004.

9. A nucleic acid containing a synthetic gene allowing optimized expression of the S protein in eukaryotic cells, characterized in that it possesses the sequence SEQ ID No: 140.

10. An expression vector containing a nucleic acid as claimed in claim 9, characterized in that it is contained in the bacterial strain deposited at the CNCM, on Dec. 1, 2004, under the No. I-3333.

11. The expression vector as claimed in claim 7 or claim 9, characterized in that it is a viral vector, in the form of a viral particle or in the form of a recombinant genome.

12. The vector as claimed in claim 11, characterized in that it is a recombinant viral particle or a recombinant viral genome capable of being obtained by transfecting a plasmid according to paragraphs g), h) or k) to r) of claim 8, into an appropriate cellular system.

13. A lentiviral vector encoding a polypeptide as claimed in any one of claims 1 to 4.

14. A recombinant measles virus encoding a polypeptide as claimed in any one of claims 1 to 4.

15. A recombinant vaccinia virus encoding a polypeptide as claimed in any one of claims 1 to 4.

16. The use of a vector according to paragraphs d) to p) of claim 8, or of a vector as claimed in claim 10, for the production, in a eukaryotic system, of the SARS-associated coronavirus S protein or of a fragment of this protein.

17. A method for producing the S protein in a eukaryotic system, comprising a step of transfecting eukaryotic cells in culture with a vector chosen from the vectors contained in the bacterial strains mentioned in paragraphs d) to p) of claim 8, or in claim 10.

18. A genetically modified eukaryotic cell expressing a protein or a polypeptide as claimed in any one of claims 1 to 4.

19. The cell as claimed in claim 18, capable of being obtained by transfection with any one of the vectors mentioned in paragraphs k) to n) of claim 8.

20. The cell as claimed in claim 19, characterized in that it is the cell FRhK4-Ssol-30, deposited at the CNCM on Nov. 22, 2004, under the No. I-3325.

21. A monoclonal antibody recognizing the native S protein of a SARS-associated coronavirus.

22. The use of a protein or a polypeptide as claimed in any one of claims 1 to 4, or of an antibody as claimed in claim 21, for detecting a SARS-associated coronavirus infection, from a biological sample.

23. A method for detecting a SARS-associated coronavirus, from a biological sample, characterized in that the detection is carried out by ELISA using the recombinant S protein or its ectodomain, or a fragment of its ectodomain, expressed in a eukaryotic system.

24. The method of detection as claimed in claim 23, additionally comprising a step of detection by ELISA using the recombinant N protein.

25. The method as claimed in claim 23 or 24, characterized in that it is a double epitope ELISA method, and in that the serum to be tested is mixed with the visualizing antigen, said mixture then being brought into contact with the antigen attached to a solid support.

26. An immune complex formed of a monoclonal antibody or antibody fragment as claimed in claim 21, and of a SARS-associated coronavirus protein or peptide

27. An immune complex formed of a protein or a polypeptide as claimed in any one of claims 1 to 4, and of an antibody directed specifically against an epitope of the SARS-associated coronavirus.

28. A SARS-associated coronavirus detection kit or box, characterized in that it comprises at least one reagent selected from the group consisting of: a protein or polypeptide as claimed in any one of claims 1 to 4, a nucleic acid as claimed in either of claims 5 and 6, a cell as claimed in any one of claims 18 to 20, or an antibody as claimed in claim 21.

29. An immunogenic and/or vaccine composition, characterized in that it comprises a recombinant protein or polypeptide as claimed in any one of claims 1 to 4, obtained in a eukaryotic expression system.

30. An immunogenic and/or vaccine composition, characterized in that it comprises a recombinant vector or virus as claimed in any one of claims 7, 8, and 10 to 15.

31. A nucleic acid insert of viral origin, characterized in that it is contained in any one of the strains mentioned in paragraphs a) to h) and k) to r) of claim 8.