U.S. patent application number 11/632740 was filed with the patent office on 2007-11-22 for pef-ts expression units.
This patent application is currently assigned to BASF Aktiengesellschaft. Invention is credited to Stefan Haefner, Corinna Klopprogge, Burkhard Kroger, Hartwig Schroder, Oskar Zelder.
Application Number | 20070269871 11/632740 |
Document ID | / |
Family ID | 35628646 |
Filed Date | 2007-11-22 |
United States Patent
Application |
20070269871 |
Kind Code |
A1 |
Zelder; Oskar ; et
al. |
November 22, 2007 |
Pef-Ts Expression Units
Abstract
The present invention relates to the use of nucleic acid
sequences for regulating the transcription and expression of genes,
the novel promoters and expression units themselves, methods for
altering or causing the transcription rate and/or expression rate
of genes, expression cassettes comprising the expression units,
genetically modified microorganisms with altered or caused
transcription rate and/or expression rate, and methods for
preparing biosynthetic products by cultivating the genetically
modified microorganisms.
Inventors: |
Zelder; Oskar; (Speyer,
DE) ; Klopprogge; Corinna; (Mannheim, DE) ;
Kroger; Burkhard; (Limburgerhof, DE) ; Schroder;
Hartwig; (Nussloch, DE) ; Haefner; Stefan;
(Ludwigshafen, DE) |
Correspondence
Address: |
LAHIVE & COCKFIELD, LLP
ONE POST OFFICE SQUARE
BOSTON
MA
02109-2127
US
|
Assignee: |
BASF Aktiengesellschaft
Ludwigshafen
DE
|
Family ID: |
35628646 |
Appl. No.: |
11/632740 |
Filed: |
July 16, 2005 |
PCT Filed: |
July 16, 2005 |
PCT NO: |
PCT/EP05/07752 |
371 Date: |
January 18, 2007 |
Current U.S.
Class: |
435/113 ;
435/243; 435/320.1; 435/471; 536/24.1 |
Current CPC
Class: |
C12N 15/77 20130101;
C12P 13/04 20130101; C07K 14/34 20130101; C12N 15/63 20130101 |
Class at
Publication: |
435/113 ;
435/243; 435/320.1; 435/471; 536/024.1 |
International
Class: |
C12P 13/12 20060101
C12P013/12; C07H 21/04 20060101 C07H021/04 |
Claims
1. A method of regulating the transcription of a gene comprising
introducing into a host cell the nucleic acid molecule of claim 5
or a nucleic acid molecule consisting of SEQ ID NO:1, wherein the
nucleic acid molecule has promoter activity.
2. A method of regulating the expression of a gene comprising
introducing into a host cell the expression unit of claim 6 or an
expression unit consisting of SEQ ID NO:2.
3. (canceled)
4. (canceled)
5. An isolated nucleic acid molecule having promoter activity,
selected from the group consisting of A) a nucleic acid molecule
comprising the nucleotide sequence of SEQ ID NO:1; B) a nucleic
acid molecule comprising a nucleotide sequence of at least 90%
identity to the entire nucleotide sequence of SEQ ID NO:1; C) a
nucleic acid molecule which hybridizes with the complement of the
nucleotide sequence of SEQ ID NO:1; and D) a nucleic acid molecule
comprising a fragment of the nucleic acid molecule of (A), (B) or
(C); wherein the nucleic acid molecule does not consist of SEQ ID
NO:1.
6. An expression unit comprising a nucleic acid molecule having
promoter activity according to claim 5, wherein said nucleic acid
molecule is functionally linked to a nucleic acid sequence which
ensures the translation of ribonucleic acids.
7. The expression unit according to claim 6, comprising an isolated
nucleic acid molecule selected from the group consisting of: E) a
nucleic acid molecule comprising the nucleotide sequence of SEQ ID
NO:2; F) a nucleic acid molecule comprising a nucleotide sequence
of at least 90% identity to the entire nucleotide sequence of SEQ
ID NO:2; G) a nucleic acid molecule which hybridizes with the
complement of the nucleotide sequence of SEQ ID NO:2; and H) a
nucleic acid molecule comprising a fragment of the nucleic acid
molecule of (E), (F) or (G), wherein the molecule has expression
activity; wherein the nucleic acid molecule does not consist of SEQ
ID NO:2.
8. A method for altering or causing the transcription rate of genes
in microorganisms compared with the wild type by a) altering the
specific promoter activity in the microorganism of endogenous
nucleic acids having promoter activity according to claim 1, which
regulate the transcription of endogenous genes, compared with the
wild type or b) regulating the transcription of genes in the
microorganism by nucleic acids having promoter activity according
to claim 1 or by nucleic acids having promoter activity according
to claim 1 with altered specific promoter activity according to
embodiment according to claim 1 with altered specific promoter
activity according to embodiment a), where the genes are
heterologous in relation to the nucleic acids having promoter
activity.
9. The method according to claim 8, wherein the regulation of the
transcription of genes in the microorganism by nucleic acids having
promoter activity according to claim 1 or by nucleic acids having
promoter activity according to claim 1 with altered specific
promoter activity according to embodiment a) is achieved by b1)
introducing one or more nucleic acids having promoter activity
according to claim 1, if appropriate with altered specific promoter
activity, into the genome of the microorganism so that
transcription of one or more endogenous genes takes place under the
control of the introduced nucleic acid having promoter activity
according to claim 1, if appropriate with altered specific promoter
activity, or b2) introducing one or more genes into the genome of
the microorganism so that transcription of one or more of the
introduced genes takes place under the control of the endogenous
nucleic acids having promoter activity according to claim 1, if
appropriate with altered specific promoter activity, or b3)
introducing one or more nucleic acid constructs comprising a
nucleic acid having promoter activity according to claim 1, if
appropriate with altered specific promoter activity, and
functionally linked one or more nucleic acids to be transcribed,
into the microorganism.
10. The method according to claim 8 or 9, wherein to increase or
cause the transcription rate of genes in microorganisms compared
with the wild type ah) the specific promoter activity in the
microorganism of endogenous nucleic acids having promoter activity
according to claim 1, or which regulate the transcription of
endogenous genes, is increased compared with the wild type, or bh)
the transcription of genes in the microorganism is regulated by
nucleic acids having promoter activity according to claim 1 or by
nucleic acids having increased specific promoter activity according
to embodiment a), where the genes are heterologous in relation to
the nucleic acids having promoter activity.
11. The method according to claim 10, wherein the regulation of the
transcription of genes in the microorganism by nucleic acids having
promoter activity according to claim 1 or by nucleic acids having
promoter activity according to claim 1 with increased specific
promoter activity according to embodiment a) is achieved by bh1)
introducing one or more nucleic acids having promoter activity
according to claim 1, if appropriate with increased specific
promoter activity, into the genome of the microorganism so that
transcription of one or more endogenous genes takes place under the
control of the introduced nucleic acid having promoter activity
according to claim 1, if appropriate with increased specific
promoter activity, or bh2) introducing one or more genes into the
genome of the microorganism so that transcription of one or more of
the introduced genes takes place under the control of the
endogenous nucleic acids having promoter activity according to
claim 1, if appropriate with increased specific promoter activity,
or bh3) introducing one or more nucleic acid constructs comprising
a nucleic acid having promoter activity according to claim 1, if
appropriate with increased specific promoter activity, and
functionally linked one or more nucleic acids to be transcribed,
into the microorganism.
12. The method according to claim 8 or 9, wherein to reduce the
transcription rate of genes in microorganisms compared with the
wild type ar) the specific promoter activity in the microorganism
of endogenous nucleic acids having promoter activity according to
claim 1, which regulate the transcription of endogenous genes, is
reduced compared with the wild type, or br) nucleic acids having
reduced specific promoter activity according to embodiment a) are
introduced into the genome of the microorganism so that the
transcription of endogenous genes takes place under the control of
the introduced nucleic acid having reduced promoter activity.
13. A method for altering or causing the expression rate of a gene
in microorganisms compared with the wild type by c) altering the
specific expression activity in the microorganism of endogenous
expression units according to claim 2, which regulate the
expression of the endogenous genes, compared with the wild type or
d) regulating the expression of genes in the microorganism by
expression units according to claim 2 or by expression units
according to claim 2 with altered specific expression activity
according to embodiment c), where the genes are heterologous in
relation to the expression units.
14. The method according to claim 13, wherein the regulation of the
expression of genes in the microorganism by expression units
according to claim 2 or by expression units according to claim 2
with altered specific expression activity according to embodiment
a) is achieved by d1) introducing one or more expression units
according to claim 2, if appropriate with altered specific
expression activity, into the genome of the microorganism so that
expression of one or more endogenous genes takes place under the
control of the introduced expression units, or d2) introducing one
or more genes into the genome of the microorganism so that
expression of one or more of the introduced genes takes place under
the control of the endogenous expression units according to claim
2, if appropriate with altered specific expression activity, or d3)
introducing one or more nucleic acid constructs comprising an
expression unit according to claim 2, if appropriate with altered
specific expression activity, and functionally linked one or more
nucleic acids to be expressed, into the microorganism.
15. The method according to claim 13 or 14, wherein to increase or
cause the expression rate of a gene in microorganisms compared with
the wild type ch) the specific expression activity in the
microorganism of endogenous expression units according to claim 2,
which regulate the expression of the endogenous genes, is increased
compared with the wild type, or dh) the expression of genes in the
microorganism is regulated by expression units according to claim 2
or by expression units according to claim 2 with increased specific
expression activity according to embodiment a), where the genes are
heterologous in relation to the expression units.
16. The method according to claim 15, wherein the regulation of the
expression of genes in the microorganism by expression units
according to claim 2 or by expression units according to claim 2
with increased specific expression activity according to embodiment
a) is achieved by dh1) introducing one or more expression units
according to claim 2, if appropriate with increased specific
expression activity, into the genome of the microorganism so that
expression of one or more endogenous genes takes place under the
control of the introduced expression units, if appropriate with
increased specific expression activity, or dh2) introducing one or
more genes into the genome of the microorganism so that expression
of one or more of the introduced genes takes place under the
control of the endogenous expression units according to claim 2, if
appropriate with increased specific expression activity, or dh3)
introducing one or more nucleic acid constructs comprising an
expression unit according to claim 2, if appropriate with increased
specific expression activity, and functionally linked one or more
nucleic acids to be expressed, into the microorganism.
17. The method according to claim 13 or 14, wherein to reduce the
expression rate of genes in microorganisms compared with the wild
type cr) the specific expression activity in the microorganism of
endogenous expression units according to claim 2, which regulate
the expression of the endogenous genes, is reduced compared with
the wild type, or dr) expression units with reduced specific
expression activity according to embodiment cr) are introduced into
the genome of the microorganism so that expression of endogenous
genes takes place under the control of the introduced expression
units with reduced expression activity.
18. The method according to claim 8, wherein the genes are selected
from the group of nucleic acids encoding a protein from the
biosynthetic pathway of proteinogenic and non-proteinogenic amino
acids, nucleic acids encoding a protein from the biosynthetic
pathway of nucleotides and nucleosides, nucleic acids encoding a
protein from the biosynthetic pathway of organic acids, nucleic
acids encoding a protein from the biosynthetic pathway of lipids
and fatty acids, nucleic acids encoding a protein from the
biosynthetic pathway of diols, nucleic acids encoding a protein
from the biosynthetic pathway of carbohydrates, nucleic acids
encoding a protein from the biosynthetic pathway of aromatic
compounds, nucleic acids encoding a protein from the biosynthetic
pathway of vitamins, nucleic acids encoding a protein from the
biosynthetic pathway of cofactors and nucleic acids encoding a
protein from the biosynthetic pathway of enzymes, where the genes
may, if appropriate comprise further regulatory elements.
19. The method according to claim 18, wherein the proteins from the
biosynthetic pathway of amino acids are selected from the group of
aspartate kinase, aspartate-semialdehyde dehydrogenase,
diaminopimelate dehydrogenase, diaminopimelate decarboxylase,
dihydrodipicolinate synthetase, dihydrodipicolinate reductase,
glyceraldehyde-3-phosphate dehydrogenase, 3-phosphoglycerate
kinase, pyruvate carboxylase, triosephosphate isomerase,
transcriptional regulator LuxR, transcriptional regulator LysR1,
transcriptional regulator LysR2, malate-quinone oxidoreductase,
glucose-6-phosphate dehydrogenase, 6-phosphogluconate
dehydrogenase, transketolase, transaldolase, homoserine
O-acetyltransferase, cystathionine gamma-synthase, cystathionine
beta-lyase, serine hydroxymethyltransferase, O-acetylhomoserine
sulfhydrylase, methylenetetrahydrofolate reductase, phosphoserine
aminotransferase, phosphoserine phosphatase, serine
acetyltransferase, homoserine dehydrogenase, homoserine kinase,
threonine synthase, threonine exporter carrier, threonine
dehydratase, pyruvate oxidase, lysine exporter, biotin ligase,
cysteine synthase I, cysteine synthase II, coenzyme B12-dependent
methionine synthase, coenzyme B12-independent methionine synthase,
sulfate adenylyltransferase subunit 1 and 2,
phosphoadenosine-phosphosulfate reductase, ferredoxin-sulfite
reductase, ferredoxin NADP reductase, 3-phosphoglycerate
dehydrogenase, RXA00655 regulator, RXN2910 regulator, arginyl-tRNA
synthetase, phosphoenolpyruvate carboxylase, threonine efflux
protein, serine hydroxymethyltransferase,
fructose-1,6-bisphosphatase, protein of sulfate reduction RXA077,
protein of sulfate reduction RXA248, protein of sulfate reduction
RXA247, protein OpcA, 1-phosphofructokinase and
6-phosphofructokinase.
20. An expression cassette comprising a) at least one expression
unit according to claim 6 and b) at least one further nucleic acid
sequence to be expressed, and c) if appropriate further genetic
control elements, where at least one expression unit and a further
nucleic acid sequence to be expressed are functionally linked
together, and the further nucleic acid sequence to be expressed is
heterologous in relation to the expression unit.
21. The expression cassette according to claim 20, wherein the
further nucleic acid sequence to be expressed is selected from the
group of nucleic acids encoding a protein from the biosynthetic
pathway of proteinogenic and non-proteinogenic amino acids, nucleic
acids encoding a protein from the biosynthetic pathway of
nucleotides and nucleosides, nucleic acids encoding a protein from
the biosynthetic pathway of organic acids, nucleic acids encoding a
protein from the biosynthetic pathway of lipids and fatty acids,
nucleic acids encoding a protein from the biosynthetic pathway of
diols, nucleic acids encoding a protein from the biosynthetic
pathway of carbohydrates, nucleic acids encoding a protein from the
biosynthetic pathway of aromatic compounds, nucleic acids encoding
a protein from the biosynthetic pathway of vitamins, nucleic acids
encoding a protein from the biosynthetic pathway of cofactors and
nucleic acids encoding a protein from the biosynthetic pathway of
enzymes.
22. The expression cassette according to claim 21, wherein the
proteins from the biosynthetic pathway of amino acids are selected
from the group of aspartate kinase, aspartate-semialdehyde
dehydrogenase, diaminopimelate dehydrogenase, diaminopimelate
decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinate
reductase, glyceraldehyde-3-phosphate dehydrogenase,
3-phosphoglycerate kinase, pyruvate carboxylase, triosephosphate
isomerase, transcriptional regulator LuxR, transcriptional
regulator LysR1, transcriptional regulator LysR2, malate-quinone
oxidoreductase, glucose-6-phosphate dehydrogenase,
6-phosphogluconate dehydrogenase, transketolase, transaldolase,
homoserine O-acetyltransferase, cystathionine gamma-synthase,
cystathionine beta-lyase, serine hydroxymethyltransferase,
O-acetylhomoserine sulfhydrylase, methylenetetrahydrofolate
reductase, phosphoserine aminotransferase, phosphoserine
phosphatase, serine acetyltransferase, homoserine dehydrogenase,
homoserine kinase, threonine synthase, threonine exporter carrier,
threonine dehydratase, pyruvate oxidase, lysine exporter, biotin
ligase, cysteine synthase I, cysteine synthase II, coenzyme
B12-dependent methionine synthase, coenzyme B12-independent
methionine synthase activity, sulfate adenylyltransferase subunit 1
and 2, phosphoadenosine-phosphosulfate reductase,
ferredoxin-sulfite reductase, ferredoxin NADP reductase,
3-phosphoglycerate dehydrogenase, RXA00655 regulator, RXN2910
regulator, arginyl-tRNA synthetase, phosphoenolpyruvate
carboxylase, threonine efflux protein, serine
hydroxymethyltransferase, fructose-1,6-bisphosphatase, protein of
sulfate reduction RXA077, protein of sulfate reduction RXA248,
protein of sulfate reduction RXA247, protein OpcA,
1-phosphofructokinase and 6-phosphofructokinase.
23. An expression vector comprising an expression cassette
according to claim 20.
24. A genetically modified microorganism, where the genetic
modification leads to an alteration or causing of the transcription
rate of at least one gene compared with the wild type, and is
dependent on a) altering the specific promoter activity in the
microorganism of at least one endogenous nucleic acid having
promoter activity according to claim 1, which regulates the
transcription of at least one endogenous gene, or b) regulating the
transcription of genes in the microorganism by nucleic acids having
promoter activity according to claim 1 or by nucleic acids having
promoter activity according to claim 1 with altered specific
promoter activity according to embodiment a), where the genes are
heterologous in relation to the nucleic acids having promoter
activity.
25. The genetically modified microorganism according to claim 24,
wherein the regulation of the transcription of genes in the
microorganism by nucleic acids having promoter activity according
to claim 1 or by nucleic acids having promoter activity according
to claim 1 with altered specific promoter activity according to
embodiment a), is achieved by b1) introducing one or more nucleic
acids having promoter activity according to claim 1, if appropriate
with altered specific promoter activity, into the genome of the
microorganism so that transcription of one or more endogenous genes
takes place under the control of the introduced nucleic acid having
promoter activity according to claim 1, if appropriate with altered
specific promoter activity, or b2) introducing one or more genes
into the genome of the microorganism so that transcription of one
or more of the introduced genes takes place under the control of
the endogenous nucleic acids having promoter activity according to
claim 1, if appropriate with altered specific promoter activity, or
b3) introducing one or more nucleic acid constructs comprising a
nucleic acid having promoter activity according to claim 1, if
appropriate with altered specific promoter activity, and
functionally linked one or more nucleic acids to be transcribed,
into the microorganism.
26. The genetically modified microorganism according to claim 24 or
25 having increased or caused transcription rate of at least one
gene compared with the wild type, wherein ah) the specific promoter
activity in the microorganism of endogenous nucleic acids having
promoter activity according to claim 1, which regulate the
transcription of endogenous genes, is increased compared with the
wild type, or bh) the transcription of genes in the microorganism
is regulated by nucleic acids having promoter activity according to
claim 1 or by nucleic acids having increased specific promoter
activity according to embodiment ah), where the genes are
heterologous in relation to the nucleic acids having promoter
activity.
27. The genetically modified microorganism according to claim 26,
wherein the regulation of the transcription of genes in the
microorganism by nucleic acids having promoter activity according
to claim 1 or by nucleic acids having promoter activity according
to claim 1 with increased specific promoter activity according to
embodiment a), is achieved by bh1) introducing one or more nucleic
acids having promoter activity according to claim 1, where
appropriate with increased specific promoter activity, into the
genome of the microorganism so that transcription of one or more
endogenous genes takes place under the control of the introduced
nucleic acid having promoter activity, where appropriate with
increased specific promoter activity, or bh2) introducing one or
more genes into the genome of the microorganism so that
transcription of one or more of the introduced genes takes place
under the control of the endogenous nucleic acids having promoter
activity according to claim 1, if appropriate with increased
specific promoter activity, or bh3) introducing one or more nucleic
acid constructs comprising a nucleic acid having promoter activity
according to claim 1, if appropriate with increased specific
promoter activity, and functionally linked one or more nucleic
acids to be transcribed, into the microorganism.
28. The genetically modified microorganism according to claim 24 or
25 having reduced transcription rate of at least one gene compared
with the wild type, wherein ar) the specific promoter activity in
the microorganism of at least one endogenous nucleic acid having
promoter activity according to claim 1, which regulates the
transcription of at least one endogenous gene, is reduced compared
with the wild type, or br) one or more nucleic acids having reduced
promoter activity according to embodiment a) are introduced into
the genome of the microorganism so that the transcription of at
least one endogenous gene takes place under the control of the
introduced nucleic acid having reduced promoter activity.
29. A genetically modified microorganism, where the genetic
modification leads to an alteration or causing of the expression
rate of at least one gene compared with the wild type, and is
dependent on c) altering the specific expression activity in the
microorganism of at least one endogenous expression unit according
to claim 2, which regulates the expression of at least one
endogenous gene, compared with the wild type or d) regulating the
expression of genes in the microorganism by expression units
according to claim 2 or by expression units according to claim 2
with altered specific expression activity according to embodiment
a), where the genes are heterologous in relation to the expression
units.
30. The genetically modified microorganism according to claim 29,
wherein the regulation of the expression of genes in the
microorganism by expression units according to claim 2 or by
expression units according to claim 2 with altered specific
expression activity according to embodiment a) is achieved by d1)
introducing one or more expression units according to claim 2, if
appropriate with altered specific expression activity, into the
genome of the microorganism so that expression of one or more
endogenous genes takes place under the control of the introduced
expression units according to claim 2, if appropriate with altered
specific expression activity, or d2) introducing one or more genes
into the genome of the microorganism so that expression of one or
more of the introduced genes takes place under the control of the
endogenous expression units according to claim 2, if appropriate
with altered specific expression activity, or d3) introducing one
or more nucleic acid constructs comprising an expression unit
according to claim 2, if appropriate with altered specific
expression activity, and functionally linked one or more nucleic
acids to be expressed, into the microorganism.
31. The genetically modified microorganism according to claim 29 or
30 with increased or caused expression rate of at least one gene
compared with the wild type, wherein ch) the specific expression
activity in the microorganism of at least one endogenous expression
unit according to claim 2, which regulates the expression of the
endogenous genes, is increased compared with the wild type, or dh)
the expression of genes in the microorganism is regulated by
expression units according to claim 2 or by expression units
according to claim 2 with increased specific expression activity
according to embodiment a), where the genes are heterologous in
relation to the expression units.
32. The genetically modified microorganism according to claim 31,
wherein the regulation of the expression of genes in the
microorganism by expression units according to claim 2 or by
expression units according to claim 2 with increased specific
expression activity according to embodiment a) is achieved by dh1)
introducing one or more expression units according to claim 2, if
appropriate with increased specific expression activity, into the
genome of the microorganism so that expression of one or more
endogenous genes takes place under the control of the introduced
expression units according to claim 2, if appropriate with
increased specific expression activity, or dh2) introducing one or
more genes into the genome of the microorganism so that expression
of one or more of the introduced genes takes place under the
control of the endogenous expression units according to claim 2, if
appropriate with increased specific expression activity, or dh3)
introducing one or more nucleic acid constructs comprising an
expression unit according to claim 2, if appropriate with increased
specific expression activity, and functionally linked one or more
nucleic acids to be expressed, into the microorganism.
33. The genetically modified microorganism according to claim 29 or
30 with reduced expression rate of at least one gene compared with
the wild type, wherein cr) the specific expression activity in the
microorganism of at least one endogenous expression unit according
to claim 2, which regulates the expression of at least one
endogenous gene, is reduced compared with the wild type, or dr) one
or more expression units according to claim 2 with reduced
expression activity are introduced into the genome of the
microorganism so that expression of at least one gene takes place
under the control of the introduced expression unit according to
claim 2 with reduced expression activity.
34. A genetically modified microorganism comprising an expression
unit according to claim 6 and functionally linked a gene to be
expressed, where the gene is heterologous in relation to the
expression unit.
35. The genetically modified microorganism according to claim 34,
comprising an expression cassette according to claim 20.
36. The genetically modified microorganism according to any of
claims 24 to 35, wherein the genes are selected from the group of
nucleic acids encoding a protein from the biosynthetic pathway of
proteinogenic and non-proteinogenic amino acids, nucleic acids
encoding a protein from the biosynthetic pathway of nucleotides and
nucleosides, nucleic acid encoding a protein from the biosynthetic
pathway of organic acids, nucleic acids encoding a protein from the
biosynthetic pathway of lipids and fatty acids, nucleic acids
encoding a protein from the biosynthetic pathway of diols, nucleic
acids encoding a protein from the biosynthetic pathway of
carbohydrates, nucleic acids encoding a protein from the
biosynthetic pathway of aromatic compounds, nucleic acids encoding
a protein from the biosynthetic pathway of vitamins, nucleic acids
encoding a protein from the biosynthetic pathway of cofactors and
nucleic acids encoding a protein from the biosynthetic pathway of
enzymes, where the genes may, if appropriate, comprise further
regulatory elements.
37. The genetically modified microorganism according to claim 36,
wherein the proteins from the biosynthetic pathway of amino acids
are selected from the group of aspartate kinase,
aspartate-semialdehyde dehydrogenase, diaminopimelate
dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate
synthetase, dihydrodipicolinate reductase,
glyceraldehyde-3-phosphate dehydrogenase, 3-phosphoglycerate
kinase, pyruvate carboxylase, triosephosphate isomerase,
transcriptional regulator LuxR, transcriptional regulator LysR1,
transcriptional regulator LysR2, malate-quinone oxidoreductase,
glucose-6-phosphate dehydrogenase, 6-phosphogluconate
dehydrogenase, transketolase, transaldolase, homoserine
O-acetyltransferase, cystathionine gamma-synthase, cystathionine
beta-lyase, serine hydroxymethyltransferase, O-acetylhomoserine
sulfhydrylase, methylenetetrahydrofolate reductase, phosphoserine
aminotransferase, phosphoserine phosphatase, serine
acetyltransferase, homoserine dehydrogenase, homoserine kinase,
threonine synthase, threonine exporter carrier, threonine
dehydratase, pyruvate oxidase, lysine exporter, biotin ligase,
cysteine synthase I, cysteine synthase II, coenzyme B12-dependent
methionine synthase, coenzyme B 12-independent methionine synthase,
sulfate adenylyltransferase subunit 1 and 2,
phosphoadenosine-phosphosulfate reductase, ferredoxin-sulfite
reductase, ferredoxin NADP reductase, 3-phosphoglycerate
dehydrogenase, RXA00655 regulator, RXN2910 regulator, arginyl-tRNA
synthetase, phosphoenolpyruvate carboxylase, threonine efflux
protein, serine hydroxymethyltransferase,
fructose-1,6-bisphosphatase, protein of sulfate reduction RXA077,
protein of sulfate reduction RXA248, protein of sulfate reduction
RXA247, protein OpcA, 1-phosphofructokinase and
6-phosphofructokinase.
38. A method for preparing biosynthetic products by cultivating
genetically modified microorganisms according to any of claims 24
to 37.
39. A method for preparing lysine by cultivating genetically
modified microorganisms according to any of claims 24, 25, 31 or
32, wherein the genes are selected from the group of nucleic acids
encoding an aspartate kinase, nucleic acids encoding an
aspartate-semialdehyde dehydrogenase, nucleic acids encoding a
diaminopimelate dehydrogenase, nucleic acids encoding a
diaminopimelate decarboxylase, nucleic acids encoding a
dihydrodipicolinate synthetase, nucleic acids encoding a
dihydrodipicolinate reductase, nucleic acids encoding a
glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a
3-phosphoglycerate kinase, nucleic acids encoding a pyruvate
carboxylase, nucleic acids encoding a triosephosphate isomerase,
nucleic acids encoding a transcriptional regulator LuxR, nucleic
acids encoding a transcriptional regulator LysR1, nucleic acids
encoding a transcriptional regulator LysR2, nucleic acids encoding
a malate-quinone oxidoreductase, nucleic acids encoding a
glucose-6-phosphate dehydrogenase, nucleic acids encoding a
6-phosphogluconate dehydrogenase, nucleic acids encoding a
transketolase, nucleic acids encoding a transaldolase, nucleic
acids encoding a lysine exporter, nucleic acids encoding a biotin
ligase, nucleic acids encoding an arginyl-tRNA synthetase, nucleic
acids encoding a phosphoenolpyruvate carboxylase, nucleic acids
encoding a fructose-1,6-bisphosphatase, nucleic acids encoding a
protein OpcA, nucleic acids encoding a 1-phosphofructokinase and
nucleic acids encoding a 6-phosphofructokinase.
40. The method according to claim 39, wherein the genetically
modified microorganisms have, compared with the wild type,
additionally an increased activity, of at least one of the
activities selected from the group of aspartate kinase activity,
aspartate-semialdehyde dehydrogenase activity, diaminopimelate
dehydrogenase activity, diaminopimelate decarboxylase activity,
dihydrodipicolinate synthetase activity, dihydrodipicolinate
reductase activity, glyceraldehyde-3-phosphate dehydrogenase
activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase
activity, triosephosphate isomerase activity, activity of the
transcriptional regulator LuxR, activity of the transcriptional
regulator LysR1, activity of the transcriptional regulator LysR2,
malate-quinone oxidoreductase activity, glucose-6-phosphate
dehydrogenase activity, 6-phosphogluconate dehydrogenase activity,
transketolase activity, transaldolase activity, lysine exporter
activity, arginyl-tRNA synthetase activity, phosphoenolpyruvate
carboxylase activity, fructose-1,6-bisphosphatase activity, protein
OpcA activity, 1-phosphofructokinase activity,
6-phosphofructokinase activity and biotin ligase activity.
41. The method according to claim 39 or 40, wherein the genetically
modified microorganisms have, compared with the wild type,
additionally a reduced activity, of at least one of the activities
selected from the group of threonine dehydratase activity,
homoserine O-acetyltransferase activity, O-acetylhomoserine
sulfhydrylase activity, phosphoenolpyruvate carboxykinase activity,
pyruvate oxidase activity, homoserine kinase activity, homoserine
dehydrogenase activity, threonine exporter activity, threonine
efflux protein activity, asparaginase activity, aspartate
decarboxylase activity and threonine synthase activity.
42. A method for preparing methionine by cultivating genetically
modified microorganisms according to any of claims 24, 25, 31 or
32, wherein the genes are selected from the group of nucleic acids
encoding an aspartate kinase, nucleic acids encoding an
aspartate-semialdehyde dehydrogenase, nucleic acids encoding a
homoserine dehydrogenase, nucleic acids encoding a
glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a
3-phosphoglycerate kinase, nucleic acids encoding a pyruvate
carboxylase, nucleic acids encoding a triosephosphate isomerase,
nucleic acids encoding a homoserine O-acetyltransferase, nucleic
acids encoding a cystathionine gamma-synthase, nucleic acids
encoding a cystathionine beta-lyase, nucleic acids encoding a
serine hydroxymethyltransferase, nucleic acids encoding an
O-acetylhomoserine sulfhydrylase, nucleic acids encoding a
methylenetetrahydrofolate reductase, nucleic acids encoding a
phosphoserine aminotransferase, nucleic acids encoding a
phosphoserine phosphatase, nucleic acids encoding a serine
acetyltransferase, nucleic acids encoding a cysteine synthase 1,
nucleic acids encoding a cysteine synthase II, nucleic acids
encoding a coenzyme B12-dependent methionine synthase, nucleic
acids encoding a coenzyme B12-independent methionine synthase,
nucleic acids encoding a sulfate adenylyltransferase, nucleic acids
encoding a phosphoadenosine phosphosulfate reductase, nucleic acids
encoding a ferredoxin-sulfite reductase, nucleic acids encoding a
ferredoxin NADPH-reductase, nucleic acids encoding a ferredoxin
activity, nucleic acids encoding a protein of sulfate reduction
RXA077, nucleic acids encoding a protein of sulfate reduction
RXA248, nucleic acids encoding a protein of sulfate reduction
RXA247, nucleic acids encoding an RXA0655 regulator and nucleic
acids encoding an RXN2910 regulator.
43. The method according to claim 42, wherein the genetically
modified microorganisms have, compared with the wild type,
additionally an increased activity, of at least one of the
activities selected from the group of aspartate kinase activity,
aspartate-semialdehyde dehydrogenase activity, homoserine
dehydrogenase activity, glyceraldehyde-3-phosphate dehydrogenase
activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase
activity, triosephosphate isomerase activity, homoserine
O-acetyltransferase activity, cystathionine gamma-synthase
activity, cystathionine beta-lyase activity, serine
hydroxymethyltransferase activity, O-acetylhomoserine sulfhydrylase
activity, methylenetetrahydrofolate reductase activity,
phosphoserine aminotransferase activity, phosphoserine phosphatase
activity, serine acetyltransferase activity, cysteine synthase I
activity, cysteine synthase II activity, coenzyme B12-dependent
methionine synthase activity, coenzyme B12-independent methionine
synthase activity, sulfate adenylyltransferase activity,
phosphoadenosine-phosphosulfate reductase activity,
ferredoxin-sulfite reductase activity, ferredoxin NADPH-reductase
activity, ferredoxin activity, activity of a protein of sulfate
reduction RXA077, activity of a protein of sulfate reduction
RXA248, activity of a protein of sulfate reduction RXA247, activity
of an RXA655 regulator and activity of an RXN2910 regulator.
44. The method according to claim 42 or 43, wherein the genetically
modified microorganisms have, compared with the wild type,
additionally a reduced activity, of at least one of the activities
selected from the group of homoserine kinase activity, threonine
dehydratase activity, threonine synthase activity,
meso-diaminopimelate D-dehydrogenase activity, phosphoenolpyruvate
carboxykinase activity, pyruvate oxidase activity,
dihydrodipicolinate synthase activity, dihydrodipicolinate
reductase activity and diaminopicolinate decarboxylase
activity.
45. A method for preparing threonine by cultivating genetically
modified microorganisms according to any of claims 24, 25, 31 or
32, wherein the genes are selected from the group of nucleic acids
encoding an aspartate kinase, nucleic acids encoding an
aspartate-semialdehyde dehydrogenase, nucleic acids encoding a
glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a
3-phosphoglycerate kinase, nucleic acids encoding a pyruvate
carboxylase, nucleic acids encoding a triosephosphate isomerase,
nucleic acids encoding a homoserine kinase, nucleic acids encoding
a threonine synthase, nucleic acids encoding a threonine exporter
carrier, nucleic acids encoding a glucose-6-phosphate
dehydrogenase, nucleic acids encoding a transaldolase, nucleic
acids encoding a transketolase, nucleic acids encoding a
malate-quinone oxidoreductase, nucleic acids encoding a
6-phosphogluconate dehydrogenase, nucleic acids encoding a lysine
exporter, nucleic acids encoding a biotin ligase, nucleic acids
encoding a phosphoenolpyruvate carboxylase, nucleic acids encoding
a threonine efflux protein, nucleic acids encoding a
fructose-1,6-bisphosphatase, nucleic acids encoding an OpcA
protein, nucleic acids encoding a 1-phosphofructokinase, nucleic
acids encoding a 6-phosphofructokinase, and nucleic acids encoding
a homoserine dehydrogenase.
46. The method according to claim 45, wherein the genetically
modified microorganisms have, compared with the wild type,
additionally an increased activity, of at least one of the
activities selected from the group of aspartate kinase activity,
aspartate-semialdehyde dehydrogenase activity,
glyceraldehyde-3-phosphate dehydrogenase activity,
3-phosphoglycerate kinase activity, pyruvate carboxylase activity,
triosephosphate isomerase activity, threonine synthase activity,
activity of a threonine export carrier, transaldolase activity,
transketolase activity, glucose-6-phosphate dehydrogenase activity,
malate-quinone oxidoreductase activity, homoserine kinase activity,
biotin ligase activity, phosphoenolpyruvate carboxylase activity,
threonine efflux protein activity, protein OpcA activity,
1-phosphofructokinase activity, 6-phosphofructokinase activity,
fructose-1-6-bisphosphatase activity, 6-phosphogluconate
dehydrogenase and homoserine dehydrogenase activity.
47. The method according to claim 45 or 46, wherein the genetically
modified microorganisms have, compared with the wild type,
additionally a reduced activity, of at least one of the activities
selected from the group of threonine dehydratase activity,
homoserine O-acetyltransferase activity, serine
hydroxymethyltransferase activity, O-acetylhomoserine sulfhydrylase
activity, meso-diaminopimelate D-dehydrogenase activity,
phosphoenolpyruvate carboxykinase activity, pyruvate oxidase
activity, dihydrodipicolinate synthetase activity,
dihydrodipicolinate reductase activity, asparaginase activity,
aspartate decarboxylase activity, lysine exporter activity,
acetolactate synthase activity, ketol-acid reductoisomerase
activity, branched chain aminotransferase activity, coenzyme
B12-dependent methionine synthase activity, coenzyme
B12-independent methionine synthase activity, dihydroxy-acid
dehydratase activity and diaminopicolinate decarboxylase
activity.
48. The method according to any of claims 38 to 47, wherein the
biosynthetic products are isolated and, where appropriate, purified
from the cultivation medium after and/or during the cultivation
step.
49. (canceled)
50. (canceled)
51. An expression unit which enables genes to be expressed in
bacteria of the genus Corynebacterium or Brevibacterium, comprising
the nucleic acid sequence of SEQ ID NO:21.
52. The expression unit according to claim 51, wherein the nucleic
acid sequence of SEQ ID NO:21 is used as a ribosome binding
site.
53. (canceled)
54. The expression unit according to claim 51, wherein one of the
nucleic acid sequences of SEQ ID NOs: 19 or 20 is used as a -10
region.
Description
[0001] The present invention relates to the use of nucleic acid
sequences for regulating the transcription and expression of genes,
the novel promoters and expression units themselves, methods for
altering or causing the transcription rate and/or expression rate
of genes, expression cassettes comprising the expression units,
genetically modified microorganisms with altered or caused
transcription rate and/or expression rate, and methods for
preparing biosynthetic products by cultivating the genetically
modified microorganisms.
[0002] Various biosynthetic products such as, for example, fine
chemicals, such as, inter alia, amino acids, vitamins, but also
proteins, are produced in cells by natural metabolic processes and
are used in many branches of industry, including the foodstuffs,
feedstuffs, cosmetics, feed, food and pharmaceutical industries.
These substances, which are referred to collectively as fine
chemicals/proteins, comprise inter alia organic acids, both
proteinogenic and non-proteinogenic amino acids, nucleotides and
nucleosides, lipids and fatty acids, diols, carbohydrates, aromatic
compounds, vitamins and cofactors, and proteins and enzymes. Their
production takes place most expediently on the industrial scale by
culturing bacteria which have been developed in order to produce
and secrete large quantities of the particular desired substance.
Organisms particularly suitable for this purpose are coryneform
bacteria, Gram-positive non-pathogenic bacteria.
[0003] It is known that amino acids are prepared by fermentation of
strains of coryneform bacteria, especially Corynebacterium
glutamicum. Because of the great importance, continuous work is
done on improving the production processes. Process improvements
may relate to fermentation technique measures such as, for example,
stirring and oxygen supply, or the composition of the nutrient
media, such as, for example, the sugar concentration during the
fermentation, or the working up to give the product, for example by
ion exchange chromatography or else spray drying, or the intrinsic
performance properties of the microorganism itself.
[0004] Methods of recombinant DNA technology have likewise been
employed for some years for strain improvement of Corynebacterium
strains producing fine chemicals/proteins, by amplifying individual
genes and investigating the effect on the production of fine
chemicals/proteins.
[0005] Other ways for developing a process for producing fine
chemicals, amino acids or proteins, or for increasing or improving
the productivity of a pre-existing process for producing fine
chemicals, amino acids or proteins, are to increase or to alter the
expression of one or more genes, and/or to influence the
translation of an mRNA by suitable polynucleotide sequences. In
this connection, influencing may include increasing, reducing, or
else other parameters of the expression of genes, such as
chronological expression patterns.
[0006] Various constituents of bacterial regulatory sequences are
known to the skilled worker. A distinction is made between the
binding sites for regulators, also called operators, the binding
sites for RNA polymerase holoenzymes, also called -35 and -10
regions, and the binding site for ribosomal 16S RNA, also called
ribosome binding site or else Shine-Dalgarno sequence.
[0007] The sequence of a ribosome binding site, also called
Shine-Dalgarno sequence, means for the purposes of this invention
polynucleotide sequences which are located up to 20 bases upstream
of the translation initiation codon.
[0008] In the literature (E. coli and S. typhimurium, Neidhardt F.
C. 1995 ASM Press) it is reported that both the composition of the
polynucleotide sequence of the Shine-Dalgarno sequence, the
sequence string of the bases, but also the distance of a
polynucleotide sequence comprised in the Shine-Dalgarno sequence
from has a considerable influence on the translation initiation
rate.
[0009] Nucleic acid sequences having promoter activity can
influence the formation of mRNA in various ways. Promoters whose
activities are independent of the physiological growth phase of the
organism are called constitutive. Other promoters in turn respond
to external chemical, such as physical stimuli such as oxygen,
metabolites, heat, pH, etc. Others in turn show a strong dependence
of their activity in different growth phases. For example,
promoters showing a particularly pronounced activity during the
exponential growth phase of microorganisms, or else precisely in
the stationary phase of microbial growth, are described in the
literature. Both characteristics of promoters may have a beneficial
effect on productivity for a production of fine chemicals and
proteins, depending on the metabolic pathway.
[0010] For example, promoters which switch off the expression of a
gene during growth, but switch it on after an optimal growth, can
be used to regulate a gene which controls the production of a
metabolite. The modified strain then displays the same growth
parameters as the starting strain but produces more product per
cell. This type of modification may increase both the titer (g of
product/liter) and the C yield (g of product/g of C source).
[0011] It has already been possible to isolate in Corynebacterium
species those nucleotide sequences which can be used to increase or
diminish gene expression. These regulated promoters may increase or
reduce the rate at which a gene is transcribed, depending on the
internal and/or external conditions of the cell. In some cases, the
presence of a particular factor, known as inducer, can stimulate
the rate of transcription from the promoter. Inducers may influence
transcription from the promoter either directly or indirectly.
Another class of factors, known as suppressors, is able to reduce
or else inhibit the transcription from the promoter. Like the
inducers, the suppressors can also act directly or indirectly.
However, temperature-regulated promoters are also known. Thus, the
level of transcription of such promoters can be increased or else
diminished for example by increasing the growth temperature above
the normal growth temperature of the cell.
[0012] A small number of promoters from C. glutamicum have been
described to date. The promoter of the malate synthase gene from C.
glutamicum was described in DE 4440118. This promoter was inserted
upstream of a structural gene coding for a protein. After
transformation of such a construct into a coryneform bacterium
there is regulation of the expression of the structural gene
downstream of the promoter. Expression of the structural gene is
induced as soon as an appropriate inducer is added to the
medium.
[0013] Reinscheid et al., Microbiology 145:503 (1999) described a
transcriptional fusion between the pta-ack promoter from C.
glutamicum and a reporter gene (chloramphenicol acetyltransferase).
Cells of C. glutamicum comprising such a transcriptional fusion
exhibited increased expression of the reporter gene on growth on
acetate-containing medium. By comparison with this, transformed
cells which grew on glucose showed no increased expression of this
reporter gene.
[0014] Pa'tek et al., Microbiology 142:1297 (1996) describe some
DNA sequences from C. glutamicum which are able to enhance the
expression of a reporter gene in C. glutamicum cells. These
sequences were compared together in order to define consensus
sequences for C. glutamicum promoters.
[0015] Further DNA sequences from C. glutamicum which can be used
to regulate gene expression have been described in the patent WO
02/40679. These isolated polynucleotides represent expression units
from Corynebacterium glutamicum which can be used either to
increase or else to reduce gene expression. This patent
additionally describes recombinant plasmids on which the expression
units from Corynebacterium glutamicum are associated with
heterologous genes. The method described herein, of fusing a
promoter from Corynebacterium glutamicum with a heterologous gene,
can be employed inter alia for regulating the genes of amino acid
biosynthesis.
[0016] It was an object of the present invention to provide further
promoters and/or expression units with advantageous properties.
[0017] Accordingly, we have found that nucleic acids having
promoter activity, comprising [0018] A) the nucleic acid sequence
SEQ. ID. NO. 1 or B) a sequence derived from this sequence by
substitution, insertion or deletion of nucleotides and having an
identity of at least 90% at the nucleic acid level with the
sequence SEQ. ID. NO. 1, or [0019] C) a nucleic acid sequence which
hybridizes with the nucleic acid sequence SEQ. ID. NO. 1 under
stringent conditions, or [0020] D) functionally equivalent
fragments of the sequences of A), B) or C) can be used for the
transcription of genes.
[0021] "Transcription" means according to the invention the process
by which a complementary RNA molecule is produced starting from a
DNA template. Proteins such as RNA polymerase, so-called sigma
factors and transcriptional regulator proteins are involved in this
process. The synthesized RNA is then used as template in the
translation process, which then leads to the biosynthetically
active protein.
[0022] The formation rate with which a biosynthetically active
protein is produced is a product of the rate of transcription and
of translation. Both rates can be influenced according to the
invention, and thus influence the rate of formation of products in
a microorganism.
[0023] A "promoter" or a "nucleic acid having promoter activity"
means according to the invention a nucleic acid which, in a
functional linkage to a nucleic acid to be transcribed, regulates
the transcription of this nucleic acid.
[0024] A "functional linkage" means in this connection for example
the sequential arrangement of one of the nucleic acids of the
invention having promoter activity and a nucleic acid sequence to
be transcribed and, if appropriate, further regulatory elements
such as, for example, nucleic acid sequences which ensure the
transcription of nucleic acids, and for example a terminator, in
such a way that each of the regulatory elements is able to fulfill
its function in the transcription of the nucleic acid sequence. A
direct linkage in the chemical sense is not absolutely necessary
therefor. Genetic control sequences, such as, for example, enhancer
sequences, are able to exercise their function on the target
sequence even from more remote positions or even from other DNA
molecules.
[0025] Arrangements in which the nucleic acid sequence to be
transcribed is positioned behind (i.e. at the 3' end) of the
promoter sequence of the invention, so that the two sequences are
covalently connected together, are preferred. In this connection,
the distance between the promoter sequence and the nucleic acid
sequence to be expressed transgenically is preferably fewer than
200 base pairs, particularly preferably fewer than 100 base pairs,
very particularly preferably fewer than 50 base pairs.
[0026] "Promoter activity" means according to the invention the
quantity of RNA formed by the promoter in a particular time, that
is to say the transcription rate.
[0027] "Specific promoter activity" means according to the
invention the quantity of RNA formed by the promoter in a
particular time for each promoter.
[0028] The term "wild type" means according to the invention the
appropriate starting microorganism.
[0029] Depending on the context, the term "microorganism" means the
starting microorganism (wild type) or a genetically modified
microorganism of the invention, or both.
[0030] Preferably, and especially in cases where the microorganism
or the wild type cannot be unambiguously assigned, "wild type"
means for the alteration or causing of the promoter activity or
transcription rate, for the alteration or causing of the expression
activity or expression rate and for increasing the content of
biosynthetic products in each case a reference organism.
[0031] In a preferred embodiment, this reference organism is
Corynebacterium glutamicum ATCC 13032.
[0032] In a preferred embodiment, the starting microorganisms used
are already able to produce the desired fine chemical. Particular
preference is given in this connection among the particularly
preferred microorganisms of bacteria of the genus Corynebacterium
and the particularly preferred fine chemicals L-lysine,
L-methionine and L-threonine to those starting microorganisms
already able to produce L-lysine, L-methionine and/or L-threonine.
These are particularly preferably corynebacteria in which, for
example, the gene coding for an aspartokinase (ask gene) is
deregulated or the feedback inhibition is abolished or reduced.
Such bacteria have, for example, a mutation leading to a reduction
or abolition of the feedback inhibition, such as, for example, the
mutation T311I, in the ask gene.
[0033] In the case of a "caused promoter activity" or transcription
rate in relation to a gene compared with the wild type, therefore,
compared with the wild type the formation of an RNA which was not
present in this way in the wild type is caused.
[0034] In the case of an altered promoter activity or transcription
rate in relation to a gene compared with the wild type, therefore,
compared with the wild type the quantity of RNA produced in a
particular time is altered.
[0035] "Altered" means in this connection preferably increased or
reduced.
[0036] This can take place for example by increasing or reducing
the specific promoter activity of the endogenous promoter of the
invention, for example by mutating the promoter or by stimulating
or inhibiting the promoter.
[0037] A further possibility is to achieve the increased promoter
activity or transcription rate for example by regulating the
transcription of genes in the microorganism by nucleic acids of the
invention having promoter activity or by nucleic acids with
increased specific promoter activity, where the genes are
heterologous in relation to the nucleic acids having promoter
activity.
[0038] The regulation of the transcription of genes in the
microorganism by nucleic acids of the invention having promoter
activity or by nucleic acids with increased specific promoter
activity is preferably achieved by
[0039] introducing one or more nucleic acids of the invention
having promoter activity, if appropriate with altered specific
promoter activity, into the genome of the microorganism so that
transcription of one or more endogenous genes takes place under the
control of the introduced nucleic acid of the invention having
promoter activity, if appropriate with altered specific promoter
activity, or
[0040] introducing one or more genes into the genome of the
microorganism so that transcription of one or more of the
introduced genes takes place under the control of the endogenous
nucleic acids of the invention having promoter activity, if
appropriate with altered specific promoter activity, or
[0041] introducing one or more nucleic acid constructs comprising a
nucleic acid of the invention having promoter activity, if
appropriate with altered specific promoter activity, and
functionally linked one or more nucleic acids to be transcribed,
into the microorganism.
[0042] The nucleic acids of the invention having promoter activity
comprise [0043] A) the nucleic acid sequence SEQ. ID. NO. 1 or
[0044] B) a sequence derived from this sequence by substitution,
insertion or deletion of nucleotides and having an identity of at
least 90% at the nucleic acid level with the sequence SEQ. ID. NO.
1, or [0045] C) a nucleic acid sequence which hybridizes with the
nucleic acid sequence SEQ. ID. NO. 1 under stringent conditions, or
[0046] D) functionally equivalent fragments of the sequences of A),
B) or C).
[0047] The nucleic acid sequence SEQ. ID. NO. 1 represents the
promoter sequence of the elongation factor TS (P.sub.EF-TS) from
Corynebacterium glutamicum. SEQ. ID. NO. 1 corresponds to the
promoter sequence of the wild type.
[0048] The invention additionally relates to nucleic acids having
promoter activity comprising a sequence derived from this sequence
by substitution, insertion or deletion of nucleotides and having an
identity of at least 90% at the nucleic acid level with the
sequence SEQ. ID. NO. 1.
[0049] Further natural examples of the invention for promoters of
the invention can easily be found for example from various
organisms whose genomic sequence is known, by identity comparisons
of the nucleic acid sequences from databases with the sequence SEQ
ID NO: 1 described above.
[0050] Artificial promoter sequences of the invention can easily be
found starting from the sequence SEQ ID NO: 1 by artificial
variation and mutation, for example by substitution, insertion or
deletion of nucleotides.
[0051] The term "substitution" means in the description the
replacement of one or more nucleotides by one or more nucleotides.
"Deletion" is the replacement of a nucleotide by a direct linkage.
Insertions are insertions of nucleotides into the nucleic acid
sequence, with formal replacement of a direct linkage by one or
more nucleotides.
[0052] Identity between two nucleic acids means the identity of the
nucleotides over the complete length of the nucleic acid in each
case, in particular the identity calculated by comparison with the
aid of the vector NTI Suite 7.1 software from Informax (USA) using
the Clustal method (Higgins D G, Sharp P M. Fast and sensitive
multiple sequence alignments on a microcomputer. Comput Appl.
Biosci. 1989 April; 5(2):151-1), setting the following
parameters:
Multiple Alignment Parameter:
Gap opening penalty 10
Gap extension penalty 10
Gap separation penalty range 8
Gap separation penalty off
% identity for alignment delay 40
Residue specific gaps off
Hydrophilic residue gap off
Transition weighing 0
Pairwise Alignment Parameter:
FAST algorithm on
K-tuplesize 1
Gap penalty 3
Window size 5
Number of best diagonals 5
[0053] A nucleic acid sequence having an identity of at least 90%
with the sequence SEQ ID NO: 1 accordingly means a nucleic acid
sequence which, on comparison of its sequence with the sequence SEQ
ID NO: 1, in particular in accordance with the above programming
algorithm with the above parameter set, shows an identity of at
least 90%.
[0054] Particularly preferred promoters show an identity of 91%,
more preferably 92%, 93%, 94%, 95%, 96%, 97%, 98%, particularly
preferably 99%, with the nucleic acid sequence SEQ. ID. NO. 1.
[0055] Further natural examples of promoters can moreover easily be
found starting from the nucleic acid sequences described above, in
particular starting from the sequence SEQ ID NO: 1 from various
organisms whose genomic sequence is unknown, by hybridization
techniques in a manner known per se.
[0056] A further aspect of the invention therefore relates to
nucleic acids having promoter activity comprising a nucleic acid
sequence which hybridizes with the nucleic acid sequence SEQ. ID.
No. 1 under stringent conditions. This nucleic acid sequence
comprises at least 10, more preferably more than 12, 15, 30, 50 or
particularly preferably more than 150, nucleotides.
[0057] The hybridization takes place according to the invention
under stringent conditions. Such hybridization conditions are
described for example in Sambrook, J., Fritsch, E. F., Maniatis,
T., in: Molecular Cloning (A Laboratory Manual), 2nd edition, Cold
Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current
Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989),
6.3.1-6.3.6:
[0058] Stringent Hybridization Conditions Mean in Particular:
[0059] incubation at 42.degree. C. overnight in a solution
consisting of 50% formamide, 5.times.SSC (750 mM NaCl, 75 mM
trisodium citrate), 50 mM sodium phosphate (pH 7.6),
5.times.Denhardt's solution, 10% dextran sulfate and 20 g/ml
denatured, sheared salmon sperm DNA, followed by washing the
filters with 0.1.times.SSC at 65.degree. C.
[0060] A "functionally equivalent fragment" means for nucleic acid
sequences having promoter activity fragments which have
substantially the same or a higher specific promoter activity than
the starting sequence.
[0061] "Essentially identical" means a specific promoter activity
which displays at least 50%, preferably 60%, more preferably 70%,
more preferably 80%, more preferably 90%, particularly preferably
95% of the specific promoter activity of the starting sequence.
[0062] "Fragments" mean partial sequences of the nucleic acids
having promoter activity which are described by embodiment A), B)
or C). These fragments preferably have more than 10, but more
preferably more than 12, 15, 30, 50 or particularly preferably more
than 150, connected nucleotides of the nucleic acid sequence SEQ.
ID. NO. 1.
[0063] It is particularly preferred to use the nucleic acid
sequence SEQ. ID. NO. 1 as promoter, i.e. for transcription of
genes.
[0064] SEQ. ID. NO. 1 has been described without assignment of
function in the Genbank entry AP005283. The invention therefore
further relates to the novel nucleic acid sequences of the
invention having promoter activity.
[0065] The invention relates in particular to a nucleic acid having
promoter activity, comprising [0066] A) the nucleic acid sequence
SEQ. ID. NO. 1 or [0067] B) a sequence derived from this sequence
by substitution, insertion or deletion of nucleotides and having an
identity of at least 90% at the nucleic acid level with the
sequence SEQ. ID. NO. 1, or [0068] C) a nucleic acid sequence which
hybridizes with the nucleic acid sequence SEQ. ID. NO. 1 under
stringent conditions, or [0069] D) functionally equivalent
fragments of the sequences of A), B) or C), with the proviso that
the nucleic acid having the sequence SEQ. ID. NO. 1 is
excluded.
[0070] All the nucleic acids having promoter activity which are
mentioned above can additionally be prepared in a manner known per
se by chemical synthesis from the nucleotide building blocks such
as, for example, by fragment condensation of individual overlapping
complementary nucleic acid building blocks of the double helix. The
chemical synthesis of oligonucleotides can take place for example
in known manner by the phosphoramidite method (Voet, Voet, 2nd
edition, Wiley Press New York, pp. 896-897). Addition of synthetic
oligonucleotides and filling in of gaps using the Klenow fragment
of DNA polymerase and ligation reactions, and general cloning
methods, are described in Sambrook et al. (1989), Molecular
cloning: A laboratory manual, Cold Spring Harbor Laboratory
Press.
[0071] The invention further relates to the use of an expression
unit comprising one of the nucleic acids of the invention having
promoter activity and additionally functionally linked a nucleic
acid sequence which ensures the translation of ribonucleic acids
for the expression of genes.
[0072] An expression unit means according to the invention a
nucleic acid having expression activity, i.e a nucleic acid which,
in functional linkage to a nucleic acid to be expressed, or gene,
regulates the expression, i.e. the transcription and the
translation of this nucleic acid or of this gene.
[0073] A "functional linkage" means in this connection for example
the sequential arrangement of one of the expression units of the
invention and of a nucleic acid sequence which is to be expressed
transgenically and, if appropriate, further regulatory elements
such as, for example, a terminator in such a way that each of the
regulatory elements can fulfill its function in the transgenic
expression of the nucleic acid sequence. A direct linkage in the
chemical sense is not absolutely necessary for this. Genetic
control sequences, such as, for example, enhancer sequences, can
exercise their function on the target sequence also from more
remote positions or even from different DNA molecules. Arrangements
in which the nucleic acid sequence to be expressed transgenically
is positioned behind (i.e. at the 3' end) the expression unit
sequence of the invention, so that the two sequences are covalently
connected together, are preferred. It is preferred in this case for
the distance between the expression unit sequence and the nucleic
acid sequence to be expressed transgenically to be fewer than 200
base pairs, particularly preferably fewer than 100 base pairs, very
particularly preferably fewer than 50 base pairs.
[0074] "Expression activity" means according to the invention the
quantity of protein produced in a particular time by the expression
unit, i.e. the expression rate.
[0075] "Specific expression activity" means according to the
invention the quantity of protein produced by the expression unit
in a particular time for each expression unit.
[0076] In the case of a "caused expression activity" or expression
rate in relation to a gene compared with the wild type, therefore,
compared with the wild type the production of a protein which was
not present in this way in the wild type is caused.
[0077] In the case of an "altered expression activity" or
expression rate in relation to a gene compared with the wild type,
therefore, compared with the wild type the quantity of protein
produced in a particular time is altered.
[0078] "Altered" preferably means in this connection increased or
decreased.
[0079] This can take place for example by increasing or reducing
the specific activity of the endogenous expression unit, for
example by mutating the expression unit or by stimulating or
inhibiting the expression unit.
[0080] The increased expression activity or expression rate can
moreover be achieved for example by regulating the expression of
genes in the microorganism by expression units of the invention or
by expression units with increased specific expression activity,
where the genes are heterologous in relation to the expression
units.
[0081] The regulation of the expression of genes in the
microorganism by expression units of the invention or by expression
units of the invention with increased specific expression activity
is preferably achieved by
[0082] introducing one or more expression units of the invention,
if appropriate with altered specific expression activity, into the
genome of the microorganism so that expression of one or more
endogenous genes takes place under the control of the introduced
expression units of the invention, if appropriate with altered
specific expression activity, or
[0083] introducing one or more genes into the genome of the
microorganism so that expression of one or more of the introduced
genes takes place under the control of the endogenous expression
units of the invention, if appropriate with altered specific
expression activity, or
introducing one or more nucleic acid constructs comprising an
expression unit of the invention, if appropriate with altered
specific expression activity, and functionally linked one or more
nucleic acids to be expressed, into the microorganism.
[0084] The expression units of the invention comprise a nucleic
acid of the invention, described above, having promoter activity
and additionally functionally linked a nucleic acid sequence which
ensures the translation of ribonucleic acids.
[0085] This nucleic acid sequence which ensures the translation of
ribonucleic acids preferably comprises the nucleic acid sequence
SEQ. ID. NO. 42 as ribosome binding site.
[0086] In a preferred embodiment, the expression unit of the
invention comprises: [0087] E) the nucleic acid sequence SEQ. ID.
NO. 2 or [0088] F) a sequence derived from this sequence by
substitution, insertion or deletion of nucleotides and having an
identity of at least 90% at the nucleic acid level with the
sequence SEQ. ID. NO. 2, or [0089] G) a nucleic acid sequence which
hybridizes with the nucleic acid sequence SEQ. ID. NO. 2 under
stringent conditions, or [0090] H) functionally equivalent
fragments of the sequences of E), F) or G).
[0091] The nucleic acid sequence SEQ. ID. NO. 2 represents the
nucleic acid sequence of the expression unit of the elongation
factor TS (P.sub.EF-TS) from Corynebacterium glutamicum. SEQ. ID.
NO. 2 corresponds to the sequence of the expression unit of the
wild type.
[0092] The invention further relates to expression units comprising
a sequence which is derived from this sequence by substitution,
insertion or deletion of nucleotides and which have an identity of
at least 90% at the nucleic acid level with the sequence SEQ. ID.
NO. 2.
[0093] Further natural examples of the invention for expression
units of the invention can easily be found for example from various
organisms whose genomic sequence is known, by identity comparisons
of the nucleic acid sequences from databases with the sequence SEQ
ID NO: 2 described above.
[0094] Artificial sequences of the invention of the expression
units can easily be found starting from the sequence SEQ ID NO: 2
by artificial variation and mutation, for example by substitution,
insertion or deletion of nucleotides.
[0095] A nucleic acid sequence having an identity of at least 90%
with the sequence SEQ ID NO: 2 accordingly means a nucleic acid
sequence which, on comparison of its sequence with the sequence SEQ
ID NO: 2, in particular in accordance with the above programming
algorithm with the above parameter set, shows an identity of at
least 90%.
[0096] Particularly preferred expression units show an identity of
91%, more preferably 92%, 93%, 94%, 95%, 96%, 97%, 98%,
particularly preferably 99%, with the nucleic acid sequence SEQ.
ID. NO. 2.
[0097] Further natural examples of expression units can moreover
easily be found starting from the nucleic acid sequences described
above, in particular starting from the sequence SEQ ID NO: 2 from
various organisms whose genomic sequence is unknown, by
hybridization techniques in a manner known per se.
[0098] A further aspect of the invention therefore relates to
expression units comprising a nucleic acid sequence which
hybridizes with the nucleic acid sequence SEQ. ID. No. 2 under
stringent conditions. This nucleic acid sequence comprises at least
10, more preferably more than 12, 15, 30, 50 or particularly
preferably more than 150, nucleotides.
[0099] "Hybridization" means the ability of a poly- or
oligonucleotide to bind under stringent conditions to a virtually
complementary sequence, while nonspecific bindings between
non-complementary partners do not occur under these conditions. For
this, the sequences ought preferably to be 90-100% complementary.
The property of complementary sequences being able to bind
specifically to one another is made use of for example in the
Northern or Southern blotting technique or in primer binding in PCR
or RT-PCR.
[0100] The hybridization takes place according to the invention
under stringent conditions. Such hybridization conditions are
described for example in Sambrook, J., Fritsch, E. F., Maniatis,
T., in: Molecular Cloning (A Laboratory Manual), 2nd edition, Cold
Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current
Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989),
6.3.1-6.3.6:
Stringent Hybridization Conditions Mean in Particular:
[0101] incubation at 42.degree. C. overnight in a solution
consisting of 50% formamide, 5.times.SSC (750 mM NaCl, 75 mM
trisodium citrate), 50 mM sodium phosphate (pH 7.6),
5.times.Denhardt's solution, 10% dextran sulfate and 20 g/ml
denatured, sheared salmon sperm DNA, followed by washing the
filters with 0.1.times.SSC at 65.degree. C.
[0102] The nucleotide sequences of the invention further make it
possible to produce probes and primers which can be used for
identifying and/or cloning homologous sequences in other cell types
and microorganisms. Such probes and primers normally comprise a
nucleotide sequence region which hybridizes under stringent
conditions onto at least approximately 12, preferably at least
approximately 25, such as, for example, approximately 40, 50 or 75
consecutive nucleotides of a sense strand of a nucleic acid
sequence of the invention or of a corresponding antisense
strand.
[0103] Also comprised according to the invention are nucleic acid
sequences which comprise so-called silent mutations or are modified
in accordance with the codon usage of a specific original or host
organism compared with a specifically mentioned sequence, as well
as naturally occurring variants such as, for example, splice
variants or allelic variants, thereof.
[0104] A "functionally equivalent fragment" means for expression
units fragments which have substantially the same or a higher
specific expression activity than the starting sequence.
[0105] "Essentially identical" means a specific expression activity
which displays at least 50%, preferably 60%, more preferably 70%,
more preferably 80%, more preferably 90%, particularly preferably
95% of the specific expression activity of the starting
sequence.
[0106] "Fragments" mean partial sequences of the expression units
which are described by embodiment E), F) or G). These fragments
preferably have more than 10, but more preferably more than 12, 15,
30, 50 or particularly preferably more than 150, connected
nucleotides of the nucleic acid sequence SEQ. ID. NO. 1.
[0107] It is particularly preferred to use the nucleic acid
sequence SEQ. ID. NO. 2 as expression unit, i.e. for expression of
genes.
[0108] The invention further relates to the novel expression units
of the invention.
[0109] The invention relates in particular to an expression unit
comprising a nucleic acid of the invention having promoter activity
and additionally functionally linked a nucleic acid sequence which
ensures the translation of ribonucleic acids.
[0110] The invention particularly preferably relates to an
expression unit comprising [0111] E) the nucleic acid sequence SEQ.
ID. NO. 2 or [0112] F) a sequence derived from this sequence by
substitution, insertion or deletion of nucleotides and having an
identity of at least 90% at the nucleic acid level with the
sequence SEQ. ID. NO. 2, or [0113] G) a nucleic acid sequence which
hybridizes with the nucleic acid sequence SEQ. ID. NO. 2 under
stringent conditions, or [0114] H) functionally equivalent
fragments of the sequences of E), F) or G), with the proviso that
the nucleic acid having the sequence SEQ. ID. NO. 2 is
excluded.
[0115] The expression units of the invention comprise one or more
of the following genetic elements: a minus 10 ("-10") sequence; a
minus 35 ("-35") sequence; a transcription sequence start, an
enhancer region; and an operator region.
[0116] These genetic elements are preferably specific for species
of corynebacteria, especially for Corynbacterium glutamicum.
[0117] All the expression units which are mentioned above can
additionally be prepared in a manner known per se by chemical
synthesis from the nucleotide building blocks such as, for example,
by fragment condensation of individual overlapping complementary
nucleic acid building blocks of the double helix. The chemical
synthesis of oligonucleotides can take place for example in known
manner by the phosphoramidite method (Voet, Voet, 2nd edition,
Wiley Press New York, pp. 896-897). Addition of synthetic
oligonucleotides and filling in of gaps using the Klenow fragment
of DNA polymerase and ligation reactions, and general cloning
methods, are described in Sambrook et al. (1989), Molecular
cloning: A laboratory manual, Cold Spring Harbor Laboratory
Press.
[0118] The methods and techniques used for the inventions in this
patent are known to the skilled worker trained in microbiological
and recombinant DNA techniques. Methods and techniques for growing
bacterial cells, inserting isolated DNA molecules into the host
cell, and isolating, cloning and sequencing isolated nucleic acid
molecules etc. are examples of such techniques and methods. These
methods are described in many standard literature sources: Davis et
al., Basic Methods In Molecular Biology (1986); J. H. Miller,
Experiments in Molecular Genetics, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y. (1972); J. H. Miller, A Short
Course in Bacterial Genetics, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. (1992); M. Singer and P. Berg, Genes &
Genomes, University Science Books, Mill Valley, Calif. (1991); J.
Sambrook, E. F. Fritsch and T. Maniatis, Molecular Cloning: A
Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. (1989); P. B. Kaufmann et al., Handbook of
Molecular and Cellular Methods in Biology and Medicine, CRC Press,
Boca Raton, Fla. (1995); Methods in Plant Molecular Biology and
Biotechnology, B. R. Glick and J. E. Thompson, eds., CRC Press,
Boca Raton, Fla. (1993); and P. F. Smith-Keary, Molecular Genetics
of Escherichia coli, The Guilford Press, New York, N.Y. (1989).
[0119] All nucleic acid molecules of the present invention are
preferably in the form of an isolated nucleic acid molecule. An
"isolated" nucleic acid molecule is separated from other nucleic
acid molecules which are present in the natural source of the
nucleic acid, and may additionally be substantially free of other
cellular material or culture medium if it is prepared by
recombinant techniques, or free of chemical precursors or other
chemicals if it is chemically synthesized.
[0120] The invention additionally includes the nucleic acid
molecules complementary to the specifically described nucleotide
sequences, or a section thereof.
[0121] The promoters and/or expression units of the invention can
for example be used particularly advantageously in improved methods
for the preparation of biosynthetic products by fermentation as
described hereinafter.
[0122] The promoters and/or expression units of the invention have
in particular the advantage that they are induced in microorganisms
by stress. It is possible by suitable control of the fermentation
process to control this stress induction specifically for an
increase in the transcription/expression rate of desired genes. In
the production of L-lysine in particular, this stress phase is
reached very early, so that in this case an increased
transcription/expression rate of desired genes can be achieved very
early.
[0123] The nucleic acids of the invention having promoter activity
can be used to alter, i.e. to increase or reduce, or to cause the
transcription rate of genes in microorganisms compared with the
wild type.
[0124] The expression units of the invention can be used to alter,
i.e. to increase or reduce, or to cause the expression rate of
genes in microorganisms compared with the wild type.
[0125] The nucleic acids of the invention having promoter activity
and the expression units of the invention can also serve to
regulate and enhance the production of various biosynthetic
products such as, for example, fine chemicals, proteins, in
particular amino acids, in microorganisms, in particular in
Corynebacterium species.
[0126] The invention therefore relates to a method for altering or
causing the transcription rate of genes in microorganisms compared
with the wild type by [0127] a) altering the specific promoter
activity in the microorganism of endogenous nucleic acids of the
invention having promoter activity, which regulate the
transcription of endogenous genes, compared with the wild type or
[0128] b) regulating transcription of genes in the microorganism by
nucleic acids of the invention having promoter activity or by
nucleic acids with altered specific promoter activity according to
embodiment a), where the genes are heterologous in relation to the
nucleic acids having promoter activity.
[0129] According to embodiment a), the alteration or causing of the
transcription rate of genes in the microorganism compared with the
wild type can take place by altering, i.e. increasing or reducing,
the specific promoter activity in the microorganism. This can take
place for example by targeted mutation of the nucleic acid sequence
of the invention having promoter activity, i.e. by targeted
substitution, deletion or insertion of nucleotides. An increased or
reduced promoter activity can be achieved by replacing nucleotides
in the RNA polymerase holoenzyme binding sites (known to the
skilled worker also as -10 region and -35 region). Additionally by
reducing or enlarging the distance of the described RNA polymerase
holoenzyme binding sites from one another by deleting nucleotides
or inserting nucleotides. Additionally by placing binding sites
(also known to the skilled worker as -operators) for regulatory
proteins (known to the skilled worker as repressors and activators)
in the spatial vicinity of the binding sites of the RNA polymerase
holoenzyme so that, after binding to a promoter sequence, these
regulators diminish or enhance the binding and transcription
activity of the RNA polymerase holoenzyme, or else place it under a
new regulatory influence.
[0130] The nucleic acid sequence SEQ. ID. NO. 21 preferably
represents the ribosome binding site of the expression units of the
invention, and the sequences SEQ. ID. NO. 19 or 20 represent the
-10 region of the expression units of the invention. Alterations in
the nucleic acid sequence in these regions lead to an alteration in
the specific expression activity.
[0131] The invention therefore relates to the use of the nucleic
acid sequence SEQ. ID. NO. 21 as ribosome binding site in
expression units which enable genes to be expressed in bacteria of
the genus Corynebacterium or Brevibacterium.
[0132] The invention further relates to the use of the nucleic acid
sequences SEQ. ID. NO. 19 or 20 as -10 region in expression units
which enable genes to be expressed in bacteria of the genus
Corynebacterium or Brevibacterium.
[0133] The invention relates in particular to an expression unit
which enables genes to be expressed in bacteria of the genus
Corynebacterium or Brevibacterium, comprising the nucleic acid
sequence SEQ. ID. NO. 21. In this case, the nucleic acid sequence
SEQ. ID. NO. 21 is preferably used as ribosome binding site.
[0134] The invention further relates to an expression unit which
enables genes to be expressed in bacteria of the genus
Corynebacterium or Brevibacterium, comprising at least one of the
nucleic acid sequences SEQ. ID. NO. 19 or 20. In this case, one of
the nucleic acid sequences SEQ. ID. NO. 19 or 20 is preferably used
as -10 region.
[0135] In relation to the "specific promoter activity", an increase
or reduction compared with the wild type means an increase or
reduction in the specific activity compared with the nucleic acid
of the invention having promoter activity of the wild type, i.e.
for example compared with SEQ. ID. NO. 1.
[0136] According to embodiment b), the alteration or causing of the
transcription rate of genes in microorganisms compared with the
wild type can take place by regulating the transcription of genes
in the microorganism by nucleic acids of the invention having
promoter activity or by nucleic acids with altered specific
promoter activity according to embodiment a), where the genes are
heterologous in relation to the nucleic acids having promoter
activity.
[0137] This is preferably achieved by [0138] b1) introducing one or
more nucleic acids of the invention having promoter activity, if
appropriate with altered specific promoter activity, into the
genome of the microorganism so that transcription of one or more
endogenous genes takes place under the control of the introduced
nucleic acid having promoter activity, if appropriate with altered
specific promoter activity, or [0139] b2) introducing one or more
genes into the genome of the microorganism so that transcription of
one or more of the introduced genes takes place under the control
of the endogenous nucleic acids of the invention having promoter
activity, if appropriate with altered specific promoter activity,
or [0140] b3) introducing one or more nucleic acid constructs
comprising a nucleic acid of the invention having promoter
activity, if appropriate with altered specific promoter activity,
and functionally linked one or more nucleic acids to be
transcribed, into the microorganism.
[0141] It is thus possible to alter, i.e. to increase or to reduce,
the transcription rate of an endogenous gene of the wild type
by
[0142] according to embodiment b1), introducing one or more nucleic
acids of the invention having promoter activity, if appropriate
with altered specific promoter activity, into the genome of the
microorganism so that transcription of one or more endogenous genes
takes place under the control of the introduced nucleic acid having
promoter activity, if appropriate with altered specific promoter
activity, or
[0143] according to embodiment b2), introducing one or more
endogenous genes into the genome of the microorganism so that
transcription of one or more of the introduced endogenous genes
takes place under the control of the endogenous nucleic acids of
the invention having promoter activity, if appropriate with altered
specific promoter activity, or
[0144] according to embodiment b3), introducing one or more nucleic
acid constructs comprising a nucleic acid of the invention having
promoter activity, if appropriate with altered specific promoter
activity, and functionally linked one or more endogenous nucleic
acids to be transcribed, into the microorganism.
[0145] It is thus further possible to cause the transcription rate
of an exogenous gene compared with the wild type by
[0146] according to embodiment b2), introducing one or more
exogenous genes into the genome of the microorganism so that
transcription of one or more of the introduced exogenous genes
takes place under the control of the endogenous nucleic acids of
the invention having promoter activity, if appropriate with altered
specific promoter activity, or
[0147] according to embodiment b3), introducing one or more nucleic
acid constructs comprising a nucleic acid of the invention having
promoter activity, if appropriate with altered specific promoter
activity, and functionally linked one or more exogenous nucleic
acids to be transcribed, into the microorganism.
[0148] The insertion of genes according to embodiment b2) can
moreover take place by integrating a gene into coding regions or
noncoding regions. Insertion preferably takes place into noncoding
regions.
[0149] Insertion of nucleic acid constructs according to embodiment
b3) may moreover take place chromosomally or extrachromosomally.
There is preferably chromosomal insertion of the nucleic acid
constructs. A "chromosomal" integration is the insertion of an
exogenous DNA fragment into the chromosome of a host cell. This
term is also used for homologous recombination between an exogenous
DNA fragment and the appropriate region on the chromosome of the
host cell.
[0150] In embodiment b) there is preferably also use of nucleic
acids of the invention with altered specific promoter activity in
accordance with embodiment a). In embodiment b), as described in
embodiment a), these may be present or be prepared in the
microorganism, or be introduced in isolated form into the
microorganism.
[0151] "Endogenous" means genetic information, such as, for
example, genes, which is already present in the wild-type
genome.
[0152] "Exogenous" means genetic information, such as, for example,
genes, which is not present in the wild-type genome.
[0153] The term "genes" in relation to regulation of transcription
by the nucleic acids of the invention having promoter activity
preferably means nucleic acids which comprise a region to be
transcribed, i.e. for example a region which regulates the
translation, and a coding region and, if appropriate, further
regulatory elements such as, for example, a terminator.
[0154] The term "genes" in relation to the regulation, described
hereinafter, of expression by the expression units of the invention
preferably means nucleic acids which comprise a coding region and,
if appropriate, further regulatory elements such as, for example, a
terminator.
[0155] A "coding region" means a nucleic acid sequence which
encodes a protein.
[0156] "Heterologous" in relation to nucleic acids having promoter
activity and genes means that the genes used are not in the wild
type transcribed under the regulation of the nucleic acids of the
invention having promoter activity, but that a new functional
linkage which does not occur in the wild type is produced, and the
functional combination of nucleic acid of the invention having
promoter activity and specific gene does not occur in the wild
type.
[0157] "Heterologous" in relation to expression units and genes
means that the genes used are not in the wild type expressed under
the regulation of the expression units of the invention having
promoter activity, but that a new functional linkage which does not
occur in the wild type is produced, and the functional combination
of expression unit of the invention and specific gene does not
occur in the wild type.
[0158] The invention further relates in a preferred embodiment to a
method for increasing or causing the transcription rate of genes in
microorganisms compared with the wild type by [0159] ah) increasing
the specific promoter activity in the microorganism of endogenous
nucleic acids of the invention having promoter activity, which
regulate the transcription of endogenous genes, compared with the
wild type, or [0160] bh) regulating the transcription of genes in
the microorganism by nucleic acids of the invention having promoter
activity or by nucleic acids with increased specific promoter
activity according to embodiment a), where the genes are
heterologous in relation to the nucleic acids having promoter
activity.
[0161] The regulation of the transcription of genes in the
microorganism by nucleic acids of the invention having promoter
activity or by nucleic acids of the invention with increased
specific promoter activity according to embodiment ah) is
preferably achieved by [0162] bh1) introducing one or more nucleic
acids of the invention having promoter activity, if appropriate
with increased specific promoter activity, into the genome of the
microorganism so that transcription of one or more endogenous genes
takes place under the control of the introduced nucleic acid of the
invention having promoter activity, if appropriate with increased
specific promoter activity, or [0163] bh2) introducing one or more
genes into the genome of the microorganism so that transcription of
one or more of the introduced genes takes place under the control
of the endogenous nucleic acids of the invention having promoter
activity, if appropriate with increased specific promoter activity,
or [0164] bh3) introducing one or more nucleic acid constructs
comprising a nucleic acid of the invention having promoter
activity, if appropriate with increased specific promoter activity,
and functionally linked one or more nucleic acids to be
transcribed, into the microorganism.
[0165] The invention further relates in a preferred embodiment to a
method for reducing the transcription rate of genes in
microorganisms compared with the wild type by [0166] ar) reducing
the specific promoter activity in the microorganism of endogenous
nucleic acids of the invention having promoter activity, which
regulate the transcription of the endogenous genes, compared with
the wild type, or [0167] br) introducing nucleic acids with reduced
specific promoter activity according to embodiment a) into the
genome of the microorganism so that transcription of endogenous
genes takes place under the control of the introduced nucleic acid
with reduced promoter activity.
[0168] The invention further relates to a method for altering or
causing the expression rate of a gene in microorganisms compared
with the wild type by [0169] c) altering the specific expression
activity in the microorganism of endogenous expression units of the
invention, which regulate the expression of the endogenous genes,
compared with the wild type, or [0170] d) regulating the expression
of genes in the microorganism by expression units of the invention
or by expression units of the invention with altered specific
expression activity according to embodiment c), where the genes are
heterologous in relation to the expression units.
[0171] According to embodiment c), the alteration or causing of the
expression rate of genes in microorganisms compared with the wild
type can take place by altering, i.e. increasing or reducing, the
specific expression activity in the microorganism. This can take
place for example by targeted mutation of the nucleic acid sequence
of the invention having promoter activity, i.e. by targeted
substitution, deletion or insertion of nucleotides. For example,
extending the distance between Shine-Dalgarno sequence and the
translation start codon usually leads to a change, a diminution or
else an enhancement of the specific expression activity. An
alteration of the specific expression activity can also be achieved
by either shortening or extending the distance of the sequence of
the Shine-Dalgarno region (ribosome binding site) from the
translation start codon through deletions or insertions of
nucleotides. But also by altering the sequence of the
Shine-Dalgarno region in such a way that the homology to
complementary 3' side 16S rRNA is either enhanced or else
diminished.
[0172] In relation to the "specific expression activity", an
increase or reduction compared with the wild type means an increase
or reduction of the specific activity compared with the expression
unit of the invention of the wild type, i.e. for example compared
with SEQ. ID. NO. 2.
[0173] According to embodiment d), the alteration or causing of the
expression rate of genes in microorganisms compared with the wild
type can take place by regulating the expression of genes in the
microorganism by expression units of the invention or by expression
units of the invention with altered specific expression activity
according to embodiment c), where the genes are heterologous in
relation to the expression units.
[0174] This is preferably achieved by [0175] d1) introducing one or
more expression units of the invention, if appropriate with altered
specific expression activity, into the genome of the microorganism
so that expression of one or more endogenous genes takes place
under the control of the introduced expression units, or [0176] d2)
introducing one or more genes into the genome of the microorganism
so that expression of one or more of the introduced genes takes
place under the control of the endogenous expression units of the
invention, if appropriate with altered specific expression
activity, or [0177] d3) introducing one or more nucleic acid
constructs comprising an expression unit of the invention, if
appropriate with altered specific expression activity, and
functionally linked one or more nucleic acids to be expressed, into
the microorganism.
[0178] It is thus possible to alter, i.e. to increase or to reduce,
the expression rate of an endogenous gene of the wild type by
[0179] according to embodiment d1) introducing one or more
expression units of the invention, if appropriate with altered
specific expression activity, into the genome of the microorganism
so that expression of one or more endogenous genes takes place
under the control of the introduced expression units, or
[0180] according to embodiment d2) introducing one or more genes
into the genome of the microorganism so that expression of one or
more of the introduced genes takes place under the control of the
endogenous expression units of the invention, if appropriate with
altered specific expression activity, or
[0181] according to embodiment d3) introducing one or more nucleic
acid constructs comprising an expression unit of the invention, if
appropriate with altered specific expression activity, and
functionally linked one or more nucleic acids to be expressed, into
the microorganism.
[0182] It is thus further possible to cause the expression rate of
an endogenous gene compared with the wild type by
[0183] according to embodiment d2) introducing one or more
exogenous genes into the genome of the microorganism so that
expression of one or more of the introduced genes takes place under
the control of the endogenous expression units of the invention, if
appropriate with altered specific expression activity, or
[0184] according to embodiment d3) introducing one or more nucleic
acid constructs comprising an expression unit of the invention, if
appropriate with altered specific expression activity, and
functionally linked one or more exogenous nucleic acids to be
expressed, into the microorganism.
[0185] The insertion of genes according to embodiment d2) can
moreover take place by integrating a gene into coding regions or
noncoding regions. Insertion preferably takes place into noncoding
regions.
[0186] Insertion of nucleic acid constructs according to embodiment
d3) may moreover take place chromosomally or extrachromosomally.
There is preferably chromosomal insertion of the nucleic acid
constructs.
[0187] The nucleic acid constructs are also referred to hereinafter
as expression cassettes.
[0188] In embodiment d) there is preferably also use of expression
units of the invention with altered specific expression activity in
accordance with embodiment c). In embodiment d), as described in
embodiment c), these may be present or be prepared in the
microorganism, or be introduced in isolated form into the
microorganism.
[0189] The invention further relates in a preferred embodiment to a
method for increasing or causing the expression rate of a gene in
microorganisms compared with the wild type by
ch) increasing the specific expression activity in the
microorganism of endogenous expression units of the invention,
which regulate the expression of the endogenous genes, compared
with the wild type, or
[0190] dh) regulating the expression of genes in the microorganism
by expression units of the invention or by expression units with
increased specific expression activity according to embodiment c),
where the genes are heterologous in relation to the expression
units.
[0191] The regulation of the expression of genes in the
microorganism by expression units of the invention or by expression
units with increased specific expression activity according to
embodiment c) is preferably achieved by [0192] dh1) introducing one
or more expression units of the invention, if appropriate with
increased specific expression activity, into the genome of the
microorganism so that expression of one or more endogenous genes
takes place under the control of the introduced expression units,
if appropriate with increased specific expression activity, or
[0193] dh2) introducing one or more genes into the genome of the
microorganism so that expression of one or more of the introduced
genes takes place under the control of the endogenous expression
units of the invention, if appropriate with increased specific
expression activity, or [0194] dh3) introducing one or more nucleic
acid constructs comprising an expression unit of the invention, if
appropriate with increased specific expression activity, and
functionally linked one or more nucleic acids to be expressed, into
the microorganism.
[0195] The invention further relates to a method for reducing the
expression rate of genes in microorganisms compared with the wild
type by
cr) reducing the specific expression activity in the microorganism
of endogenous expression units of the invention, which regulate the
expression of the endogenous genes, compared with the wild type,
or
[0196] dr) introducing expression units with reduced specific
expression activity according to embodiment cr) into the genome of
the microorganism so that expression of endogenous genes takes
place under the control of the introduced expression units with
reduced expression activity.
[0197] In a preferred embodiment of the methods of the invention
described above for altering or causing the transcription rate
and/or expression rate of genes in microorganisms, the genes are
selected from the group of nucleic acids encoding a protein from
the biosynthetic pathway of fine chemicals, where the genes may, if
appropriate, comprise further regulatory elements.
[0198] In a particularly preferred embodiment of the methods of the
invention described above for altering or causing the transcription
rate and/or expression rate of genes in microorganisms, the genes
are selected from the group of nucleic acids encoding a protein
from the biosynthetic pathway of proteinogenic and
non-proteinogenic amino acids, nucleic acids encoding a protein
from the biosynthetic pathway of nucleotides and nucleosides,
nucleic acids encoding a protein from the biosynthetic pathway of
organic acids, nucleic acids encoding a protein from the
biosynthetic pathway of lipids and fatty acids, nucleic acids
encoding a protein from the biosynthetic pathway of diols, nucleic
acids encoding a protein from the biosynthetic pathway of
carbohydrates, nucleic acids encoding a protein from the
biosynthetic pathway of aromatic compounds, nucleic acids encoding
a protein from the biosynthetic pathway of vitamins, nucleic acids
encoding a protein from the biosynthetic pathway of cofactors and
nucleic acids encoding a protein from the biosynthetic pathway of
enzymes, where the genes may, if appropriate, comprise further
regulatory elements.
[0199] In a particularly preferred embodiment, the proteins from
the biosynthetic pathway of amino acids are selected from the group
of
[0200] aspartate kinase, aspartate-semialdehyde dehydrogenase,
diaminopimelate dehydrogenase, diaminopimelate decarboxylase,
dihydrodipicolinate synthetase, dihydrodipicolinate reductase,
glyceraldehyde-3-phosphate dehydrogenase, 3-phosphoglycerate
kinase, pyruvate carboxylase, triosephosphate isomerase,
transcriptional regulator LuxR, transcriptional regulator LysR1,
transcriptional regulator LysR2, malate-quinone oxidoreductase,
glucose-6-phosphate deydrogenase, 6-phosphogluconate dehydrogenase,
transketolase, transaldolase, homoserine O-acetyltransferase,
cystathionine gamma-synthase, cystathionine beta-lyase, serine
hydroxymethyltransferase, O-acetylhomoserine sulfhydrylase,
methylenetetrahydrofolate reductase, phosphoserine
aminotransferase, phosphoserine phosphatase, serine
acetyltransferase, homoserine dehydrogenase, homoserine kinase,
threonine synthase, threonine exporter carrier, threonine
dehydratase, pyruvate oxidase, lysine exporter, biotin ligase,
cysteine synthase 1, cysteine synthase II, coenzyme B12-dependent
methionine synthase, coenzyme B12-independent methionine synthase
activity, sulfate adenylyltransferase subunit 1 and 2,
phosphoadenosine-phosphosulfate reductase, ferredoxin-sulfite
reductase, ferredoxin NADP reductase, 3-phosphoglycerate
dehydrogenase, RXA00655 regulator, RXN2910 regulator, arginyl-tRNA
synthetase, phosphoenolpyruvate carboxylase, threonine efflux
protein, serine hydroxymethyltransferase,
fructose-1,6-bisphosphatase, protein of sulfate reduction RXA077,
protein of sulfate reduction RXA248, protein of sulfate reduction
RXA247, protein OpcA, 1-phosphofructokinase and
6-phosphofructokinase.
[0201] Preferred proteins and nucleic acids encoding these proteins
of the proteins described above from the biosynthetic pathway of
amino acids are respectively protein sequences and nucleic acid
sequences of microbial origin, preferably from bacteria of the
genus Corynebacterium or Brevibacterium, preferably from coryneform
bacteria, particularly preferably from Corynebacterium
glutamicum.
[0202] Examples of particularly preferred protein sequences and the
corresponding nucleic acid sequences encoding these proteins from
the biosynthetic pathway of amino acids, the document referring
thereto, and the designation thereof in the reference document are
listed in Table 1: TABLE-US-00001 TABLE 1 SEQ. ID. NO. Nucleic acid
Reference in reference Protein encoding protein document document
Aspartate kinase ask or lysC EP1108790 DNA: 281 Protein: 3781
Aspartate-semialdehyde dehydrogenase asd EP1108790 DNA: 331
Protein: 3831 Dihydrodipicolinate synthetase dapA WO 0100843 DNA:
55 Protein: 56 Dihydrodipicolinate reductase dapB WO 0100843 DNA:
35 Protein: 36 meso-Diaminopimelate D-dehydrogenase ddh EP1108790
DNA: 3494 Protein: 6944 Diaminopicolinate decarboxylase lysA
EP1108790 DNA: 3451 Prot.: 6951 Lysine exporter lysE EP1108790 DNA:
3455 Prot.: 6955 Arginyl-tRNA synthetase argS EP1108790 DNA: 3450
Prot.: 6950 Glucose-6-phosphate dehydrogenase zwf WO 0100844 DNA:
243 Prot.: 244 Glyceraldehyde-3-phosphate dehydrogenase gap WO
0100844 DNA: 187 Prot.: 188 3-Phosphoglycerate kinase pgk WO
0100844 DNA: 69 Prot.: 70 Pyruvate carboxylase pycA EP1108790 DNA:
765 Prot.: 4265 Triosephosphate isomerase tpi WO 0100844 DNA: 61
Prot.: 62 Biotin ligase birA EP1108790 DNA: 786 Prot.: 4286 PEP
carboxylase pck EP1108790 DNA: 3470 Prot.: 6970 Homoserine kinase
thrB WO 0100843 DNA: 173 Prot.: 174 Threonine synthase thrC WO
0100843 DNA: 175 Prot.: 176 Threonine export carrier thrE WO
0251231 DNA: 41 Prot.: 42 Threonine efflux protein RXA2390 WO
0100843 DNA: 7 Prot.: 8 Threonine dehydratase ilvA EP 1108790 DNA:
2328 Prot.: 5828 Homoserine O-acetyltransferase metA EP 1108790
DNA: 727 Prot: 4227 Cystathionine gamma-synthase metB EP 1108790
DNA: 3491 Prot: 6991 Cystathionine beta-lyase metC EP 1108790 DNA:
2535 Prot: 6035 Coenzyme B12-dependent metH EP 1108790 DNA: 1663
methionine synthase, - Prot: 5163 O-Acetylhomoserine sulfhydrylase
metY EP 1108790 DNA: 726 Prot: 4226 Methylenetetrahydrofolate
reductase metF EP 1108790 DNA: 2379 Prot: 5879 D-3-Phosphoglycerate
dehydrogenase serA EP 1108790 DNA: 1415 Prot: 4915 Phosphoserine
phosphatase 1 serB WO 0100843 DNA: 153 Prot.: 154 Phosphoserine
phosphatase 2 serB EP 1108790 DNA: 467 Prot: 3967 Phosphoserine
phosphatase 3 serB EP 1108790 DNA: 334 Prot.: 3834 Phosphoserine
aminotransferase serC WO 0100843 DNA: 151 Prot.: 152 Serine
acetyltransferase cysE WO 0100843 DNA: 243 Prot.: 244 Cysteine
synthase I cysK EP 1108790 DNA: 2817 Prot.: 6317 Cysteine synthase
II CysM EP 1108790 DNA: 2338 Prot.: 5838 Homoserine dehydrogenase
hom EP 1108790 DNA: 3452 Prot.: 6952 Coenzyme B12-independent metE
WO 0100843 DNA: 755 methionine synthase Prot.: 756 Serine
hydroxymethyltransferase glyA WO 0100843 DNA: 143 Prot.: 144
Protein in sulfate reduction RXA247 EP 1108790 DNA: 3089 Prot.:
6589 Protein in sulfate reduction RXA248 EP 1108790 DNA: 3090
Prot.: 6590 Sulfate adenyltransferase CysN EP 1108790 DNA: 3092
subunit 1 Prot.: 6592 Sulfate adenyltransferase CysD EP 1108790
DNA: 3093 subunit 2 Prot.: 6593 Phosphoadenosine-phosphosulfate
CysH WO 02729029 DNA: 7 reductase Prot.: 8 Ferredoxin-sulfite
reductase RXA073 WO 0100842 DNA: 329 Prot.: 330 Ferredoxin
NADP-reductase RXA076 WO 0100843 DNA: 79 Prot.: 80 Transcriptional
regulator LuxR luxR WO 0100842 DNA: 297 Protein: 298
Transcriptional regulator LysR1 lysR1 EP 1108790 DNA: 676 Protein:
4176 Transcriptional regulator LysR2 lysR2 EP 1108790 DNA: 3228
Protein: 6728 Transcriptional regulator LysR3 lysR3 EP 1108790 DNA:
2200 Protein: 5700 Malate-quinone oxidoreductase mqo WO 0100844
DNA: 569 Protein: 570 Transketolase RXA2739 EP 1108790 DNA: 1740
Prot: 5240 Transaldolase RXA2738 WO 0100844 DNA: 245 Prot: 246 OpcA
opcA WO 0100804 DNA: 79 Prot: 80 1-Phosphofructokinase 1 pfk1
WO0100844 DNA: 55 Protein: 56 1-Phosphofructokinase 2 pfk2
WO0100844 DNA: 57 Protein: 58 6-Phosphofructokinase 1 6-pfk1 EP
1108790 DNA: 1383 Protein: 4883 6-Phosphofructokinase 2 6-pfk2 DE
10112992 DNA: 1 Protein: 2 Fructose-1,6-bisphosphatase 1 fbr1
EP1108790 DNA: 1136 Protein: 4636 Pyruvate oxidase poxB WO 0100844
DNA: 85 Protein: 86 RXA00655 regulator RXA655 US2003162267.2 DNA: 1
Prot.: 2 RXN02910 regulator RXN2910 US2003162267.2 DNA: 5 Prot.: 6
6-phosphogluconolactonase RXA2735 WO 0100844 DNA: 1 Prot.: 2
[0203] A further example of a particularly preferred protein
sequence and the corresponding nucleic acid sequence encoding this
protein from the biosynthetic pathway of amino acids is the
sequence of fructose-1,6-bisphosphatase 2, also called fbr2, (SEQ.
ID. NO. 23) and the corresponding nucleic acid sequence encoding a
fructose-1,6-bisphosphatase 2 (SEQ. ID. NO. 22).
[0204] A further example of a particularly preferred protein
sequence and the corresponding nucleic acid sequence encoding this
protein from the biosynthetic pathway of amino acids is the
sequence of the protein in sulfate reduction, also called RXA077,
(SEQ. ID. NO. 3) and the corresponding nucleic acid sequence
encoding a protein in sulfate reduction (SEQ. ID. NO. 4).
[0205] Further particularly preferred protein sequences from the
biosynthetic pathway of amino acids have in each case the amino
acid sequence indicated in Table 1 for this protein, where the
respective protein has, in at least one of the amino acid positions
indicated in Table 2/column 2 for this amino acid sequence, a
different proteinogenic amino acid than the respective amino acid
indicated in Table 2/column 3 in the same line. In a further
preferred embodiment, the proteins have, in at least one of the
amino acid positions indicated in Table 2/column 2 for the amino
acid sequence, the amino acid indicated in Table 2/column 4 in the
same line. The proteins indicated in Table 2 are mutated proteins
of the biosynthetic pathway of amino acids, which have particularly
advantageous properties and are therefore particularly suitable for
expressing the corresponding nucleic acids through the promoter of
the invention and for producing amino acids. For example, the
mutation T311I leads to the feedback inhibition of ask being
switched off.
[0206] The corresponding nucleic acids which encode a mutated
protein described above from Table 2 can be prepared by
conventional methods.
[0207] A suitable starting point for preparing the nucleic acid
sequences encoding a mutated protein is, for example, the genome of
a Corynebacterium glutamicum strain which is obtainable from the
American Type Culture Collection under the designation ATCC 13032,
or the nucleic acid sequences referred to in Table 1. For the
back-translation of the amino acid sequence of the mutated proteins
into the nucleic acid sequences encoding these proteins, it is
advantageous to use the codon usage of the organism into which the
nucleic acid sequence is to be introduced or in which the nucleic
acid sequence is present. For example, it is advantageous to use
the codon usage of Corynebacterium glutamicum for Corynebacterium
glutamicum. The codon usage of the particular organism can be
ascertained in a manner known per se from databases or patent
applications which describe at least one protein and one gene which
encodes this protein from the desired organism.
[0208] The information in Table 2 is to be understood in the
following way:
[0209] In column 1 "identification", an unambiguous designation for
each sequence in relation to Table 1 is indicated.
[0210] In column 2 "AA-POS", the respective number refers to the
amino acid position of the corresponding polypeptide sequence from
Table 1. A "26" in the column "AA-POS" accordingly means amino acid
position 26 of the correspondingly indicated polypeptide sequence.
The numbering of the position starts at +1 at the N terminus.
[0211] In column 3 "AA wild type", the respective letter designates
the amino acid represented in one-letter code--at the position
indicated in column 2 in the corresponding wild-type strain of the
sequence from Table 1."
[0212] In column 4 "M mutant", the respective letter designates the
amino acid--represented in one-letter code--at the position
indicated in column 2 in the corresponding mutant strain.
[0213] In column 5 "function", the physiological function of the
corresponding "polypeptide sequence is indicated.
[0214] For mutated protein with a particular function (column 5)
and a particular initial amino acid sequence (Table 1), columns 2,
3 and 4 describe at least one mutation, and a plurality of
mutations for some sequences. This plurality of mutations always
refers to the closest initial amino acid sequence above in each
case (Table 1). The term "at least one of the amino acid positions"
of a particular amino acid sequence preferably means at least one
of the mutations described for this amino acid sequence in columns
2, 3 and 4.
[0215] One-letter code for proteinogenic amino acids:
A alanine
C cysteine
D aspartate
E glutamate
F phenylalanine
G glycine
H histidine
I isoleucine
K lysine
L leucine
M methionine
N asparagine
P proline
Q glutamine
R arginine
S serine
T threonine
V valine
W tryptophan
[0216] Y tyrosine TABLE-US-00002 TABLE 2 Column 1 Column 2 Column 3
Column 4 Column 5 Identification AA position AA wild type AA mutant
Function ask 317 S A aspartate kinase 311 T I 279 A T asd 66 D G
aspartate-semialdehyde dehydrogenase 234 R H 272 D E 285 K E 20 L F
dapA 2 S A dihydrodipicolinate synthetase 84 K N 85 L V dapB 91 D A
dihydrodipicolinate reductase 83 D N ddh 174 D E
meso-diaminopimelate D-dehydrogenase 235 F L 237 S A lysA 265 A D
diaminopicolinate decarboxylase 320 D N 332 I V argS 355 G D
arginyl-tRNA synthetase 156 A S 513 V A 540 H R zwf 8 S T
glucose-6-phosphate dehydrogenase 150 T A 321 G S gap 264 G S
glyceraldehyde-3-phosphate dehydrogenase pycA 7 S L pyruvate
carboxylase 153 E D 182 A S 206 A S 227 H R 455 A G 458 P S 639 S T
1008 R H 1059 S P 1120 D E pck 162 H Y PEP carboxylase 241 G D 829
T R thrB 103 S A homoserine kinase 190 T A 133 A V 138 P S thrC 69
G R threonine synthase 478 T I RXA330 85 I M threonine efflux
protein 161 F I 195 G D hom 104 V I homoserine dehydrogenase 116 T
I 148 G A 59 V A 270 T S 345 R P 268 K N 61 D H 72 E Q lysR1 80 R H
transcriptional regulator LysR1 lysR3 142 R W transcriptional
regulator LysR3 179 A T RXA2739 75 N D transketolase 329 A T 332 A
T 556 V I RXA2738 242 K M transaldolase opcA 107 Y H OpcA 219 K N
233 P S 261 Y H 312 S F 65 G R aspartate-1-decarboxylase 33 G S
6-phosphogluconolactonase
[0217] In the methods of the invention described above for altering
or causing the transcription rate and/or expression rate of genes
in microorganisms, and the methods described hereinafter for
producing genetically modified microorganisms, the genetically
modified microorganisms described hereinafter and the methods
described hereinafter for producing biosynthetic products, the
introduction of the nucleic acids of the invention having promoter
activity, of the expression units of the invention, of the genes
described above and of the nucleic acid constructs or expression
cassettes described above into the microorganism, in particular
into coryneform bacteria, preferably takes place by the SacB
method.
[0218] The SacB method is known to the skilled worker and described
for example in Schafer A, Tauch A, Jager W, Kalinowski J, Thierbach
G, Puhler A.; Small mobilizable multi-purpose cloning vectors
derived from the Escherichia coli plasmids pK18 and pK19: selection
of defined deletions in the chromosome of Corynebacterium
glutamicum, Gene. 1994 Jul. 22; 145(1):69-73 and Blomfield I C,
Vaughn V, Rest R F, Eisenstein B I.; Allelic exchange in
Escherichia coli using the Bacillus subtilis sacB gene and a
temperature-sensitive pSC101 replicon; Mol. Microbiol. 1991 June;
5(6):1447-57.
[0219] In a preferred embodiment of the methods of the invention
described above, the alteration or causing of the transcription
rate and/or expression rate of genes in microorganisms takes place
by introducing nucleic acids of the invention having promoter
activity or expression units of the invention into the
microorganism.
[0220] In a further preferred embodiment of the methods of the
invention described above, the alteration or causing of the
transcription rate and/or expression rate of genes in
microorganisms takes place by introducing the nucleic acid
constructs or expression cassettes described above into the
microorganism.
[0221] The invention therefore also relates to an expression
cassette comprising
at least one expression unit of the invention
at least one further nucleic acid sequence to be expressed, i.e. a
gene to be expressed and
if appropriate further genetic control elements such as, for
example, a terminator,
where at least one expression unit and a further nucleic acid
sequence to be expressed are functionally linked together, and the
further nucleic acid sequence to be expressed is heterologous in
relation to the expression unit.
[0222] The nucleic acid sequence to be expressed is preferably at
least one nucleic acid encoding a protein from the biosynthesis
pathway of fine chemicals.
[0223] The nucleic acid sequence to be expressed is particularly
preferably selected from the group of nucleic acids encoding a
protein from the biosynthetic pathway of proteinogenic and
non-proteinogenic amino acids, nucleic acids encoding a protein
from the biosynthetic pathway of nucleotides and nucleosides,
nucleic acids encoding a protein from the biosynthetic pathway of
organic acids, nucleic acids encoding a protein from the
biosynthetic pathway of lipids and fatty acids, nucleic acids
encoding a protein from the biosynthetic pathway of diols, nucleic
acids encoding a protein from the biosynthetic pathway of
carbohydrates, nucleic acids encoding a protein from the
biosynthetic pathway of aromatic compounds, nucleic acids encoding
a protein from the biosynthetic pathway of vitamins, nucleic acids
encoding a protein from the biosynthetic pathway of cofactors and
nucleic acids encoding a protein from the biosynthetic pathway of
enzymes.
[0224] Preferred proteins from the biosynthetic pathway of amino
acids are described above and examples thereof are described in
Tables 1 and 2.
[0225] The physical location of the expression unit relative to the
gene to be expressed in the expression cassettes of the invention
is chosen so that the expression unit regulates the transcription
and preferably also the translation of the gene to be expressed,
and thus enables one or more proteins to be produced. "Enabling
production" includes in this connection a constitutive increase in
the production, diminution or blocking of production under specific
conditions and/or increasing the production under specific
conditions. The "conditions" comprise in this connection: (1)
addition of a component to the culture medium, (2) removal of a
component from the culture medium, (3) replacement of one component
in the culture medium by a second component, (4) increasing the
temperature of the culture medium, (5) reducing the temperature of
the culture medium, and (6) regulating the atmospheric conditions
such as, for example, the oxygen or nitrogen concentration in which
the culture medium is kept.
[0226] The invention further relates to an expression vector
comprising an expression cassette of the invention described
above.
[0227] Vectors are well known to the skilled worker and can be
found in "Cloning Vectors" ("Pouwels P. H. et al., editors,
Elsevier, Amsterdam-New York-Oxford, 1985). Apart from plasmids,
vectors also mean all other vectors known to the skilled worker,
such as, for example, phages, transposons, IS elements, phasmids,
cosmids, and linear or circular DNA. These vectors may undergo
autonomous replication in the host organism or chromosomal
replication.
[0228] Suitable and particularly preferred plasmids are those which
are replicated in coryneform bacteria. Numerous known plasmid
vectors such as, for example, pZ1 (Menkel et al., Applied and
Environmental Microbiology (1989) 64: 549-554), pEKEx1 (Eikmanns et
al., Gene 102: 93-98 (1991)) or pHS2-1 (Sonnen et al., Gene 107:
69-74 (1991)) are based on the cryptic plasmids pHM1519, pBL1 or
pGA1. Other plasmid vectors such as, for example, pCLiK5MCS, or
those based on pCG4 (U.S. Pat. No. 4,489,160) or pNG2
(Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124
(1990)) or pAG1 (U.S. Pat. No. 5,158,891), can be used in the same
way.
[0229] Also suitable are those plasmid vectors with the aid of
which the method of gene amplification by integration into the
chromosome can be used, as described for example by Reinscheid et
al. (Applied and Environmental Microbiology 60, 126-132 (1994)) for
the duplication and amplification of the hom-thrB operon. In this
method the complete gene is cloned into a plasmid vector which is
able to replicate in a host (typically E. coli) but not in C.
glutamicum. Examples of suitable vectors are pSUP301 (Simon et al.,
Bio/Technology 1, 784-791 (1983)), pK18mob or pK19mob (Schafer et
al., Gene 145, 69-73 (1994)), Bernard et al., Journal of Molecular
Biology, 234: 534-541 (1993)), pEM1 (Schrumpf et al. 1991, Journal
of Bacteriology 173: 4510-4516) or pBGS8 (Spratt et al., 1986, Gene
41: 337-342). The plasmid vector which comprises the gene to be
amplified is subsequently transferred by transformation into the
desired strain of C. glutamicum. Methods for transformation are
described for example in Thierbach et al. (Applied Microbiology and
Biotechnology 29, 356-362 (1988)), Dunican and Shivnan
(Biotechnology 7, 1067-1070 (1989)) and Tauch et al. (FEMS
Microbiological Letters 123, 343-347 (1994)).
[0230] The invention further relates to a genetically modified
microorganism where the genetic modification leads to an alteration
or causing of the transcription rate of at least one gene compared
with the wild type, and is dependent on
a) altering the specific promoter activity in the microorganism of
at least one endogenous nucleic acid having promoter activity
according to claim 1, which regulates the transcription of at least
one endogenous gene, or
[0231] b) regulating the transcription of genes in the
microorganism by nucleic acids having promoter activity according
to claim 1 or by nucleic acids having promoter activity according
to claim 1 with altered specific promoter activity according to
embodiment a), where the genes are heterologous in relation to the
nucleic acids having promoter activity.
[0232] As described above for the methods, the regulation of the
transcription of genes in the microorganism by nucleic acids having
promoter activity according to claim 1 or by nucleic acids having
promoter activity according to claim 1 with altered specific
promoter activity according to embodiment a), is achieved by
[0233] b1) introducing one or more nucleic acids having promoter
activity according to claim 1, if appropriate with altered specific
promoter activity, into the genome of the microorganism so that
transcription of one or more endogenous genes takes place under the
control of the introduced nucleic acid having promoter activity
according to claim 1, if appropriate with altered specific promoter
activity, or
[0234] b2) introducing one or more genes into the genome of the
microorganism so that transcription of one or more of the
introduced genes takes place under the control of the endogenous
nucleic acids having promoter activity according to claim 1, if
appropriate with altered specific promoter activity, or
[0235] b3) introducing one or more nucleic acid constructs
comprising a nucleic acid having promoter activity according to
claim 1, if appropriate with altered specific promoter activity,
and functionally linked one or more nucleic acids to be
transcribed, into the microorganism.
[0236] The invention further relates to a genetically modified
microorganism having elevated or caused transcription rate of at
least one gene compared with the wild type, where
ah) the specific promoter activity in the microorganism of
endogenous nucleic acids having promoter activity according to
claim 1, which regulate the transcription of endogenous genes, is
increased compared with the wild type, or
[0237] bh) the transcription of genes in the microorganism is
regulated by nucleic acids having promoter activity according to
claim 1 or by nucleic acids having increased specific promoter
activity according to embodiment ah), where the genes are
heterologous in relation to the nucleic acids having promoter
activity.
[0238] As described above for the methods, the regulation of the
transcription of genes in the microorganism by nucleic acids having
promoter activity according to claim 1 or by nucleic acids having
promoter activity according to claim 1 with increased specific
promoter activity according to embodiment a), is achieved by
[0239] bh1) introducing one or more nucleic acids having promoter
activity according to claim 1, if appropriate with increased
specific promoter activity, into the genome of the microorganism so
that transcription of one or more endogenous genes takes place
under the control of the introduced nucleic acid having promoter
activity, if appropriate with increased specific promoter activity,
or
[0240] bh2) introducing one or more genes into the genome of the
microorganism so that transcription of one or more of the
introduced genes takes place under the control of the endogenous
nucleic acids having promoter activity according to claim 1, if
appropriate with increased specific promoter activity, or
[0241] bh3) introducing one or more nucleic acid constructs
comprising a nucleic acid having promoter activity according to
claim 1, if appropriate with increased specific promoter activity,
and functionally linked one or more nucleic acids to be
transcribed, into the microorganism.
[0242] The invention further relates to a genetically modified
microorganism with reduced transcription rate of at least one gene
compared with the wild type, where
[0243] ar) the specific promoter activity in the microorganism of
at least one endogenous nucleic acid having promoter activity
according to claim 1, which regulates the transcription of at least
one endogenous gene, is reduced compared with the wild type, or
[0244] br) one or more nucleic acids having reduced promoter
activity according to embodiment a) are introduced into the genome
of the microorganism so that the transcription of at least one
endogenous gene takes place under the control of the introduced
nucleic acid having reduced promoter activity.
[0245] The invention further relates to a genetically modified
microorganism, where the genetic modification leads to an
alteration or causing of the expression rate of at least one gene
compared with the wild type, and is dependent on
c) altering the specific expression activity in the microorganism
of at least one endogenous expression unit according to claim 2 or
3, which regulates the expression of at least one endogenous gene,
compared with the wild type or
[0246] d) regulating the expression of genes in the microorganism
by expression units according to claim 2 or 3 or by expression
units according to claim 2 or 3 with altered specific expression
activity according to embodiment a), where the genes are
heterologous in relation to the expression units.
[0247] As described above for the methods, the regulation of the
expression of genes in the microorganism by expression units
according to claim 2 or 3 or by expression units according to claim
2 or 3 with altered specific expression activity according to
embodiment a) is achieved by
[0248] d1) introducing one or more expression units according to
claim 2 or 3, if appropriate with altered specific expression
activity, into the genome of the microorganism so that expression
of one or more endogenous genes takes place under the control of
the introduced expression units according to claim 2 or 3, if
appropriate with altered specific expression activity, or
[0249] d2) introducing one or more genes into the genome of the
microorganism so that expression of one or more of the introduced
genes takes place under the control of the endogenous expression
units according to claim 2 or 3, if appropriate with altered
specific expression activity, or
[0250] d3) introducing one or more nucleic acid constructs
comprising an expression unit according to claim 2 or 3, if
appropriate with altered specific expression activity, and
functionally linked one or more nucleic acids to be expressed, into
the microorganism.
[0251] The invention further relates to a genetically modified
microorganism with increased or caused expression rate of at least
one gene compared with the wild type, where
ch) the specific expression activity in the microorganism of at
least one endogenous expression unit according to claim 2 or 3,
which regulates the expression of the endogenous genes, is
increased compared with the wild type, or
[0252] dh) the expression of genes in the microorganism is
regulated by expression units according to claim 2 or 3 or by
expression units according to claim 2 or 3 with increased specific
expression activity according to embodiment a), where the genes are
heterologous in relation to the expression units.
[0253] As described above for the methods, the regulation of the
expression of genes in the microorganism by expression units
according to claim 2 or 3 or by expression units according to claim
2 or 3 with increased specific expression activity according to
embodiment a) is achieved by
[0254] dh1) introducing one or more expression units according to
claim 2 or 3, if appropriate with increased specific expression
activity, into the genome of the microorganism so that expression
of one or more endogenous genes takes place under the control of
the introduced expression units according to claim 2 or 3, if
appropriate with increased specific expression activity, or
[0255] dh2) introducing one or more genes into the genome of the
microorganism so that expression of one or more of the introduced
genes takes place under the control of the endogenous expression
units according to claim 2 or 3, if appropriate with increased
specific expression activity, or
[0256] dh3) introducing one or more nucleic acid constructs
comprising an expression unit according to claim 2 or 3, if
appropriate with increased specific expression activity, and
functionally linked one or more nucleic acids to be expressed, into
the microorganism.
[0257] The invention further relates to a genetically modified
microorganism with reduced expression rate of at least one gene
compared with the wild type, where
cr) the specific expression activity in the microorganism of at
least one endogenous expression unit according to claim 2 or 3,
which regulates the expression of at least one endogenous gene, is
reduced compared with the wild type, or
[0258] dr) one or more expression units according to claim 2 or 3
with reduced expression activity are introduced into the genome of
the microorganism so that expression of at least one endogenous
gene takes place under the control of the introduced expression
unit according to claim 2 or 3 with reduced expression
activity.
[0259] The invention further relates to a genetically modified
microorganism comprising an expression unit according to claim 2 or
3 and functionally linked a gene to be expressed, where the gene is
heterologous in relation to the expression unit.
[0260] This genetically modified microorganism particularly
preferably comprises an expression cassette of the invention.
[0261] The present invention particularly preferably relates to
genetically modified microorganisms, in particular coryneform
bacteria, which comprise a vector, in articular shuttle vector or
plasmid vector, which harbors at least one recombinant nucleic acid
construct as defined according to the invention.
[0262] In a preferred embodiment of the genetically modified
microorganisms, the genes described above are at least one nucleic
acid encoding a protein from the biosynthetic pathway of fine
chemicals.
[0263] In a particularly preferred embodiment of the genetically
modified microorganisms, the genes described above are selected
from the group of nucleic acids encoding a protein from the
biosynthetic pathway of proteinogenic and non-proteinogenic amino
acids, nucleic acids encoding a protein from the biosynthetic
pathway of nucleotides and nucleosides, nucleic acids encoding a
protein from the biosynthetic pathway of organic acids, nucleic
acids encoding a protein from the biosynthetic pathway of lipids
and fatty acids, nucleic acids encoding a protein from the
biosynthetic pathway of diols, nucleic acids encoding a protein
from the biosynthetic pathway of carbohydrates, nucleic acids
encoding a protein from the biosynthetic pathway of aromatic
compounds, nucleic acids encoding a protein from the biosynthetic
pathway of vitamins, nucleic acids encoding a protein from the
biosynthetic pathway of cofactors and nucleic acids encoding a
protein from the biosynthetic pathway of enzymes, where the genes
may, if appropriate comprise further regulatory elements.
[0264] Preferred proteins from the biosynthetic pathway of amino
acids are selected from the group of aspartate kinase,
aspartate-semialdehyde dehydrogenase, diaminopimelate
dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate
synthetase, dihydrodipicolinate reductase,
glyceraldehyde-3-phosphate dehydrogenase, 3-phosphoglycerate
kinase, pyruvate carboxylase, triosephosphate isomerase,
transcriptional regulator LuxR, transcriptional regulator LysR1,
transcriptional regulator LysR2, malate-quinone oxidoreductase,
glucose-6-phosphate deydrogenase, 6-phosphogluconate dehydrogenase,
transketolase, transaldolase, homoserine O-acetyltransferase,
cystathionine gamma-synthase, cystathionine beta-lyase, serine
hydroxymethyltransferase, O-acetylhomoserine sulfhydrylase,
methylenetetrahydrofolate reductase, phosphoserine
aminotransferase, phosphoserine phosphatase, serine
acetyltransferase, homoserine dehydrogenase, homoserine kinase,
threonine synthase, threonine exporter carrier, threonine
dehydratase, pyruvate oxidase, lysine exporter, biotin ligase,
cysteine synthase I, cysteine synthase II, coenzyme B12-dependent
methionine synthase, coenzyme B12-independent methionine synthase
activity, sulfate adenylyltransferase subunit 1 and 2,
phosphoadenosine-phosphosulfate reductase, ferredoxin-sulfite
reductase, ferredoxin NADP reductase, 3-phosphoglycerate
dehydrogenase, RXA00655 regulator, RXN2910 regulator, arginyl-tRNA
synthetase, phosphoenolpyruvate carboxylase, threonine efflux
protein, serine hydroxymethyltransferase,
fructose-1,6-bisphosphatase, protein of sulfate reduction RXA077,
protein of sulfate reduction RXA248, protein of sulfate reduction
RXA247, protein OpcA, 1-phosphofructokinase and
6-phosphofructokinase.
[0265] Particularly preferred examples of the proteins and genes
from the biosynthetic pathway of amino acids are described above in
Table 1 and Table 2.
[0266] Preferred microorganisms or genetically modified
microorganisms are bacteria, algae, fungi or yeasts.
[0267] Particularly preferred microorganisms are, in particular,
coryneform bacteria.
[0268] Preferred coryneform bacteria are bacteria of the genus
Corynebacterium, in particular of the species Corynebacterium
glutamicum, Corynebacterium acetoglutamicum, Corynebacterium
acetoacidophilum, Corynebacterium thermoaminogenes, Corynebacterium
melassecola and Corynebacterium efficiens or of the genus
Brevibacterium, in particular of the species Brevibacterium flavum,
Brevibacterium lactofermentum and Brevibacterium divaricatum.
[0269] Particularly preferred bacteria of the genera
Corynebacterium and Brevibacterium are selected from the group of
Corynebacterium glutamicum ATCC 13032, Corynebacterium
acetoglutamicum ATCC 15806, Corynebacterium acetoacidophilum ATCC
13870, Corynebacterium thermoaminogenes FERM BP-1539,
Corynebacterium melassecola ATCC 17965, Corynebacterium efficiens
DSM 44547, Corynebacterium efficiens DSM 44548, Corynebacterium
efficiens DSM 44549, Brevibacterium flavum ATCC 14067,
Brevibacterium lactofermentum ATCC 13869, Brevibacterium
divaricatum ATCC 14020, Corynebacterium glutamicum KFCC10065 and
Corynebacterium glutamicum ATCC21608.
[0270] The abbreviation KFCC means the Korean Federation of Culture
Collection, the abbreviation ATCC the American type strain culture
collection and the abbreviation DSM the Deutsche Sammlung von
Mikroorganismen.
[0271] Further particularly preferred bacteria of the genera
Corynebacterium and Brevibacterium are listed in Table 3:
TABLE-US-00003 Bacterium Deposition number Genus species ATCC FERM
NRRL CECT NCIMB CBS NCTC DSMZ Brevibacterium ammoniagenes 21054
Brevibacterium ammoniagenes 19350 Brevibacterium ammoniagenes 19351
Brevibacterium ammoniagenes 19352 Brevibacterium ammoniagenes 19353
Brevibacterium ammoniagenes 19354 Brevibacterium ammoniagenes 19355
Brevibacterium ammoniagenes 19356 Brevibacterium ammoniagenes 21055
Brevibacterium ammoniagenes 21077 Brevibacterium ammoniagenes 21553
Brevibacterium ammoniagenes 21580 Brevibacterium ammoniagenes 39101
Brevibacterium butanicum 21196 Brevibacterium divaricatum 21792
P928 Brevibacterium flavum 21474 Brevibacterium flavum 21129
Brevibacterium flavum 21518 Brevibacterium flavum B11474
Brevibacterium flavum B11472 Brevibacterium flavum 21127
Brevibacterium flavum 21128 Brevibacterium flavum 21427
Brevibacterium flavum 21475 Brevibacterium flavum 21517
Brevibacterium flavum 21528 Brevibacterium flavum 21529
Brevibacterium flavum B11477 Brevibacterium flavum B11478
Brevibacterium flavum 21127 Brevibacterium flavum B11474
Brevibacterium healii 15527 Brevibacterium ketoglutamicum 21004
Brevibacterium ketoglutamicum 21089 Brevibacterium ketosoreductum
21914 Brevibacterium lactofermentum 70 Brevibacterium
lactofermentum 74 Brevibacterium lactofermentum 77 Brevibacterium
lactofermentum 21798 Brevibacterium lactofermentum 21799
Brevibacterium lactofermentum 21800 Brevibacterium lactofermentum
21801 Brevibacterium lactofermentum B11470 Brevibacterium
lactofermentum B11471 Brevibacterium lactofermentum 21086
Brevibacterium lactofermentum 21420 Brevibacterium lactofermentum
21086 Brevibacterium lactofermentum 31269 Brevibacterium linens
9174 Brevibacterium linens 19391 Brevibacterium linens 8377
Brevibacterium paraffinolyticum 11160 Brevibacterium spec. 717.73
Brevibacterium spec. 717.73 Brevibacterium spec. 14604
Brevibacterium spec. 21860 Brevibacterium spec. 21864
Brevibacterium spec. 21865 Brevibacterium spec. 21866
Brevibacterium spec. 19240 Corynebacterium acetoacidophilum 21476
Corynebacterium acetoacidophilum 13870 Corynebacterium
acetoglutamicum B11473 Corynebacterium acetoglutamicum B11475
Corynebacterium acetoglutamicum 15806 Corynebacterium
acetoglutamicum 21491 Corynebacterium acetoglutamicum 31270
Corynebacterium acetophilum B3671 Corynebacterium ammoniagenes 6872
2399 Corynebacterium ammoniagenes 15511 Corynebacterium fujiokense
21496 Corynebacterium glutamicum 14067 Corynebacterium glutamicum
39137 Corynebacterium glutamicum 21254 Corynebacterium glutamicum
21255 Corynebacterium glutamicum 31830 Corynebacterium glutamicum
13032 Corynebacterium glutamicum 14305 Corynebacterium glutamicum
15455 Corynebacterium glutamicum 13058 Corynebacterium glutamicum
13059 Corynebacterium glutamicum 13060 Corynebacterium glutamicum
21492 Corynebacterium glutamicum 21513 Corynebacterium glutamicum
21526 Corynebacterium glutamicum 21543 Corynebacterium glutamicum
13287 Corynebacterium glutamicum 21851 Corynebacterium glutamicum
21253 Corynebacterium glutamicum 21514 Corynebacterium glutamicum
21516 Corynebacterium glutamicum 21299 Corynebacterium glutamicum
21300 Corynebacterium glutamicum 39684 Corynebacterium glutamicum
21488 Corynebacterium glutamicum 21649 Corynebacterium glutamicum
21650 Corynebacterium glutamicum 19223 Corynebacterium glutamicum
13869 Corynebacterium glutamicum 21157 Corynebacterium glutamicum
21158 Corynebacterium glutamicum 21159 Corynebacterium glutamicum
21355 Corynebacterium glutamicum 31808 Corynebacterium glutamicum
21674 Corynebacterium glutamicum 21562 Corynebacterium glutamicum
21563 Corynebacterium glutamicum 21564 Corynebacterium glutamicum
21565 Corynebacterium glutamicum 21566 Corynebacterium glutamicum
21567 Corynebacterium glutamicum 21568 Corynebacterium glutamicum
21569 Corynebacterium glutamicum 21570 Corynebacterium glutamicum
21571 Corynebacterium glutamicum 21572 Corynebacterium glutamicum
21573 Corynebacterium glutamicum 21579 Corynebacterium glutamicum
19049 Corynebacterium glutamicum 19050 Corynebacterium glutamicum
19051 Corynebacterium glutamicum 19052 Corynebacterium glutamicum
19053 Corynebacterium glutamicum 19054 Corynebacterium glutamicum
19055 Corynebacterium glutamicum 19056 Corynebacterium glutamicum
19057 Corynebacterium glutamicum 19058 Corynebacterium glutamicum
19059 Corynebacterium glutamicum 19060 Corynebacterium glutamicum
19185 Corynebacterium glutamicum 13286 Corynebacterium glutamicum
21515 Corynebacterium glutamicum 21527 Corynebacterium glutamicum
21544 Corynebacterium glutamicum 21492 Corynebacterium glutamicum
B8183 Corynebacterium glutamicum B8182 Corynebacterium glutamicum
B12416 Corynebacterium glutamicum B12417 Corynebacterium glutamicum
B12418 Corynebacterium glutamicum B11476 Corynebacterium glutamicum
21608 Corynebacterium lilium P973 Corynebacterium nitrilophilus
21419 11594 Corynebacterium spec. P4445 Corynebacterium spec. P4446
Corynebacterium spec. 31088 Corynebacterium spec. 31089
Corynebacterium spec. 31090 Corynebacterium spec. 31090
Corynebacterium spec. 31090 Corynebacterium spec. 15954 20145
Corynebacterium spec. 21857 Corynebacterium spec. 21862
Corynebacterium spec. 21863
[0272] The abbreviations have the following meaning:
ATCC: American Type Culture Collection, Rockville, Md., USA
FERM: Fermentation Research Institute, Chiba, Japan
NRRL: ARS Culture Collection, Northern Regional Research
Laboratory, Peoria, Ill., USA
CECT: Coleccion Espanola de Cultivos Tipo, Valencia, Spain
NCIMB: National Collection of Industrial and Marine Bacteria Ltd.,
Aberdeen, UK
CBS: Centraalbureau voor Schimmelcultures, Baarn, NL
NCTC: National Collection of Type Cultures, London, UK
DSMZ: Deutsche Sammlung von Mikroorganismen und Zellkulturen,
Brunswick, Germany
[0273] Through the nucleic acids of the invention having promoter
activity and the expression units of the invention it is possible
with the aid of the methods of the invention described above to
regulate the metabolic pathways in the genetically modified
microorganisms of the invention described above to specific
biosynthetic products.
[0274] For this purpose, for example, metabolic pathways which lead
to a specific biosynthetic product are enhanced by causing or
increasing the transcription rate or expression rate of genes of
this biosynthetic pathway in which the increased quantity of
protein leads to an increased total activity of these proteins of
the desired biosynthetic pathway and thus to an enhanced metabolic
flux toward the desired biosynthetic product.
[0275] In addition, metabolic pathways which diverge from a
specific biosynthetic product can be diminished by reducing the
transcription rate or expression rate of genes of this divergent
biosynthetic pathway in which the reduced quantity of protein leads
to a reduced total activity of these proteins of the unwanted
biosynthetic pathway and thus additionally to an enhanced metabolic
flux toward the desired biosynthetic product.
[0276] The genetically modified microorganisms of the invention are
able for example to produce biosynthetic products from glucose,
sucrose, lactose, fructose, maltose, molasses, starch, cellulose or
from glycerol and ethanol.
[0277] The invention therefore relates to a method for producing
biosynthetic products by cultivating genetically modified
microorganisms of the invention.
[0278] Depending on the desired biosynthetic product, the
transcription rate or expression rate of various genes must be
increased or reduced. Ordinarily, it is advantageous to alter the
transcription rate or expression rate of a plurality of genes, i.e.
to increase the transcription rate or expression rate of a
combination of genes and/or to reduce the transcription rate or
expression rate of a combination of genes.
[0279] In the genetically modified microorganisms of the invention,
at least one altered, i.e. increased or reduced, transcription rate
or expression rate of a gene is attributable to a nucleic acid of
the invention having promoter activity or expression unit of the
invention.
[0280] Further, additionally altered, i.e. additionally increased
or additionally reduced, transcription rates or expression rates of
further genes in the genetically modified microorganism may, but
need not, derive from the nucleic acids of the invention having
promoter activity or the expression units of the invention.
[0281] The invention therefore further relates to a method for
producing biosynthetic products by cultivating genetically modified
microorganisms of the invention.
[0282] Preferred biosynthetic products are fine chemicals.
[0283] The term "fine chemical" is known in the art and includes
compounds which are produced by an organism and are used in various
branches of industry such as, for example but not restricted to,
the pharmaceutical industry, the agriculture, cosmetics, food and
feed industries. These compounds include organic acids such as, for
example, tartaric acid, itaconic acid and "diaminopimelic acid, and
proteinogenic and non-proteinogenic amino acids, purine bases and
pyrimidine bases, nucleosides and nucleotides (as described for
example in Kuninaka, A. (1996) Nucleotides and related compounds,
pp. 561-612, in Biotechnology vol. 6, Rehm et al., editors, VCH:
Weinheim and the references present therein), lipids, saturated and
unsaturated fatty acids (e.g. arachidonic acid), diols (e.g.
propanediol and butanediol), carbohydrates (e.g. hyaluronic acid
and trehalose), aromatic compounds (e.g. aromatic amines, vanillin
and indigo), vitamins and cofactors (as described in Ullmann's
Encyclopedia of Industrial Chemistry, vol. A27, "Vitamins", pp.
443-613 (1996) VCH: Weinheim and the references present therein;
and Ong, A. S., Niki, E. and Packer, L. (1995) "Nutrition, Lipids,
Health and Disease" Proceedings of the UNESCO/Confederation of
Scientific and Technological Associations in Malaysia and the
Society for Free Radical Research--Asia, held on Sep. 1-3, 1994 in
Penang, Malaysia, AOCS Press (1995)), enzymes and all other
chemicals described by Gutcho (1983) in Chemicals by Fermentation,
Noyes Data Corporation, ISBN: 0818805086 and the references
indicated therein. The metabolism and the uses of certain fine
chemicals are explained further below.
I. Amino Acid Metabolism and Uses
[0284] The amino acids comprise the fundamental structural units of
all proteins and are thus essential for normal cell functions. The
term "amino acid" is known in the art. The proteinogenic amino
acids, of which there are 20 types, serve as structural units for
proteins, in which they are linked together by peptide bonds,
whereas the non-proteinogenic amino acids (of which hundreds are
known) usually do not occur in proteins (see Ullmann's Encyclopedia
of Industrial Chemistry, vol. A2, pp. 57-97 VCH: Weinheim (1985)).
The amino acids may be in the D or L configuration, although
L-amino acids are usually the only type found in naturally
occurring proteins.
[0285] Biosynthetic and degradation pathways of each of the 20
proteinogenic amino acids are well characterized both in
prokaryotic and in eukaryotic cells (see, for example, Stryer, L.
Biochemistry, 3rd edition, pp. 578-590 (1988)). The "essential"
amino acids (histidine, isoleucine, leucine, lysine, methionine,
phenylalanine, threonine, tryptophan and valine), so-called because
they must, owing to the complexity of their biosynthesis, be taken
in with the diet, are converted by simple biosynthetic pathways
into the other 11 "nonessential" amino acids (alanine, arginine,
asparagine, aspartate, cysteine, glutamate, glutamine, glycine,
proline, serine and tyrosine). Higher animals have the ability to
synthesize some of these amino acids, but the essential amino acids
must be taken in with the food in order for normal protein
synthesis to take place.
[0286] Apart from their function in protein biosynthesis, these
amino acids are chemicals of interest per se, and it has been found
that many have uses in various applications in the foodstuffs,
feedingstuffs, chemicals, cosmetics, agriculture and pharmaceutical
industries. Lysine is an important amino acid not only for human
nutrition but also for monogastric species such as poultry and
pigs. Glutamate is used most frequently as flavor additive
(monosodium glutamate, MSG) and widely in the food industry, as
well as aspartate, phenylalanine, glycine and cysteine. Glycine,
L-methionine and tryptophan are all used in the pharmaceutical
industry. Glutamine, valine, leucine, isoleucine, histidine,
arginine, proline, serine and alanine are used in the
pharmaceutical industry and the cosmetics industry. Threonine,
tryptophan and D-/L-methionine are widely used feed additives
(Leuchtenberger, W. (1996) Amino acids technical production and
use, pp. 466-502 in Rehm et al., (editors) Biotechnology vol. 6,
chapter 14a, VCH: Weinheim). It has been found that these amino
acids are additionally suitable as precursors for synthesizing
synthetic amino acids and proteins such as N-acetylcysteine,
S-carboxymethyl-L-cysteine, (S)-5-hydroxytryptophan and other
substances described in Ullmann's Encyclopedia of Industrial
Chemistry, vol. A2, pp. 57-97, VCH, Weinheim, 1985.
[0287] The biosynthesis of these natural amino acids in organisms
able to produce them, for example bacteria, has been well
characterized (for a review of bacterial amino acid biosynthesis
and its regulation, see Umbarger, H. E. (1978) Ann. Rev. Biochem.
47: 533-606). Glutamate is synthesized by reductive amination of
.alpha.-ketoglutarate, an intermediate in the citric acid cycle.
Glutamine, proline and arginine are each generated successively
from glutamate. Biosynthesis of serine takes place in a three-step
method and starts with 3-phosphoglycerate (an intermediate of
glycolysis) and yields this amino acid after oxidation,
transamination and hydrolysis steps. Cysteine and glycine are each
produced from serine, the former by condensation of homocysteine
with serine, and the latter by transfer of the side-chain
.beta.-carbon atom to tetrahydrofolate in a reaction catalyzed by
serine transhydroxymethylase. Phenylalanine and tyrosine are
synthesized from the precursors of the glycolysis and pentose
phosphate pathways, erythrose 4-phosphate and phosphenolpyruvate in
a 9-step biosynthetic pathway which differs only in the last two
steps after the synthesis of prephenate. Tryptophan is likewise
produced from these two starting molecules, but its synthesis takes
place in an 11-step pathway. Tyrosine can also be produced from
phenylalanine in a reaction catalyzed by phenylalanine hydroxylase.
Alanine, valine and leucine are each biosynthetic products of
pyruvate, the final product of glycolysis. Aspartate is formed from
oxalacetate, an intermediate of the citrate cycle. Asparagine,
methionine, threonine and lysine are each produced by conversion of
aspartate. Isoleucine is formed from threonine. Histidine is formed
in a complex 9-step pathway from 5-phosphoribosyl 1-pyrophosphate,
an activated sugar.
[0288] Amino acids whose quantity exceeds the protein biosynthesis
requirement of the cell cannot be stored and are instead degraded,
so that intermediates are provided for the main metabolic pathways
of the cell (for a review, see Stryer, L., Biochemistry, 3rd
edition, chapter 21 "Amino Acid Degradation and the Urea Cycle";
pp. 495-516 (1988)). Although the cell is able to convert unwanted
amino acids into useful metabolic intermediates, amino acid
production is costly in terms of the energy, the precursor
molecules and the enzymes required for their synthesis. It is
therefore not surprising that amino acid biosynthesis is regulated
by feedback inhibition, where the presence of a particular amino
acid slows down or entirely terminates its own production (for a
review of the feedback mechanism in amino acid biosynthetic
pathways, see Stryer, L., Biochemistry, 3rd edition, chapter 24,
"Biosynthesis of Amino Acids and Heme", pp. 575-600 (1988)). The
output of a particular amino acid is therefore restricted by the
quantity of this amino acid in the cell.
II. Vitamins, Cofactors and Nutraceutical Metabolism, and Uses
[0289] Vitamins, cofactors and nutraceuticals comprise a further
group of molecules. Higher animals have lost the ability to
synthesize these and therefore need to take them in, although they
are easily synthesized by other organisms such as bacteria. These
molecules are either biologically active molecules per se or
precursors of biologically active substances which serve as
electron carriers or intermediates in a number of metabolic
pathways. These compounds have, besides their nutritional value,
also a significant industrial value as coloring agents,
antioxidants and catalysts or other processing aids. (For a review
of the structure, activity and industrial applications of these
compounds, see, for example, Ullmann's Encyclopedia of Industrial
Chemistry, "Vitamins", vol. A27, pp. 443-613, VCH: Weinheim, 1996).
The term "vitamin" is known in the art and includes nutrients which
are required by an organism for normal functioning, but cannot be
synthesized by this organism itself. The group of vitamins may
include cofactors and nutraceutical compounds. The term "cofactor"
comprises non-protein compounds which are necessary for the
occurrence of normal enzymic activity. These compounds may be
organic or inorganic; the cofactor molecules of the invention are
preferably organic. The term "nutraceutical" comprises food
additives which promote health in plants and animals, especially in
humans. Examples of such molecules are vitamins, antioxidants and
likewise certain lipids (e.g. polyunsaturated fatty acids).
[0290] Biosynthesis of these molecules in organisms able to produce
them, such as bacteria, has been characterized in detail (Ullmann's
Encyclopedia of Industrial Chemistry, "Vitamins", vol. A27, pp.
443-613, VCH: Weinheim, 1996, Michal, G. (1999) Biochemical
Pathways An Atlas of Biochemistry and Molecular Biology, John Wiley
& Sons; Ong, A. S., Niki, E. and Packer, L. (1995) "Nutrition,
Lipids, Health and Disease" Proceedings of the UNESCO/Confederation
of Scientific and Technological Associations in Malaysia and the
Society for free Radical Research--Asia, held on Sep. 1-3, 1994, in
Penang, Malaysia, AOCS Press, Champaign, Ill. X, 374 S).
[0291] Thiamine (vitamin B.sub.1) is formed by chemical coupling of
pyrimidine and thiazole units. Riboflavin (vitamin B.sub.2) is
synthesized from guanosine 5'-triphosphate (GTP) and ribose
5-phosphate. Riboflavin in turn is employed for the synthesis of
flavin mononucleotide (FMN) and flavin-adenine dinucleotide (FAD).
The family of compounds referred to jointly as "vitamin" B6" (e.g.
pyridoxine, pyridoxamine, pyridoxal 5'-phosphate and the
commercially used pyridoxine hydrochloride) are all derivatives of
the common structural unit 5-hydroxy-6-methylpyridine. Pantothenate
(pantothenic acid,
R-(+)-N-(2,4-dihydroxy-3,3-dimethyl-1-oxobutyl)-.beta.-alanine) can
be produced either by chemical synthesis or by fermentation. The
last steps in pantothenate biosynthesis consist of ATP-driven
condensation of .beta.-alanine and pantoic acid. The enzymes
responsible for the biosynthetic steps for conversion into pantoic
acid, into .beta.-alanine and for condensation to pantothenic acid
are known. The metabolically active form of pantothenate is
coenzyme A, whose biosynthesis proceeds through 5 enzymatic steps.
Pantothenate, pyridoxal 5-phosphate, cysteine and ATP are the
precursors of coenzyme A. These enzymes catalyze not only the
formation of pantothenate but also the production of (R)-pantoic
acid, (R)-pantolactone, (R)-panthenol (provitamin B.sub.5),
pantethein (and its derivatives) and coenzyme A.
[0292] The biosynthesis of biotin from the precursor molecule
pimeloyl-CoA in microorganisms has been investigated in detail, and
several of the genes involved have been identified. It has emerged
that many of the corresponding proteins are involved in Fe cluster
synthesis and belong to the class of nifS proteins. Lipoic acid is
derived from octanoic acid and serves as coenzyme in energy
metabolism, where it becomes a constituent of the pyruvate
dehydrogenase complex and of the .alpha.-ketoglutarate
dehydrogenase complex. The folates are a group of substances which
are all derived from folic acid, which in turn is derived from
L-glutamic acid, p-aminobenzoic acid and 6-methylpterin. The
biosynthesis of folic acid and its derivatives starting from the
metabolic intermediates guanosine 5'-triphosphate (GTP), L-glutamic
acid and p-aminobenzoic acid has been investigated in detail in
certain microorganisms.
[0293] Corrinoids (such as the cobalamins and in particular vitamin
B.sub.12) and the porphyrins belong to a group of chemicals which
are distinguished by a tetrapyrrole ring system. The biosynthesis
of vitamin B.sub.12 is so complex that it has not yet been
completely characterized, but most of the enzymes and substrates
involved are now known. Nicotinic acid (nicotinate) and
nicotinamide are pyridine derivatives, which are also referred to
as "niacin". Niacin is the precursor of the important coenzymes NAD
(nicotinamide-adenine dinucleotide) and NADP (nicotinamide-adenine
dinucleotide phosphate) and their reduced forms.
[0294] The production of these compounds on the industrial scale is
based for the most part on cell-free chemical syntheses, although
some of these chemicals have likewise been produced by large-scale
culturing of microorganisms, such as riboflavin, vitamin B.sub.6,
pantothenate and biotin. Only vitamin B.sub.12 is produced solely
by fermentation, because of the complexity of its synthesis. In
vitro methods require a considerable expenditure of materials and
time and frequently of high costs.
III. Purine, Pyrimidine, Nucleoside and Nucleotide Metabolism and
Uses
[0295] Genes for purine and pyrimidine metabolism and their
corresponding proteins are important targets for the therapy of
neoplastic diseases and viral infections. The term "purine" or
"pyrimidine" comprises nitrogenous bases which are a constituent of
nucleic acids, coenzymes and nucleotides. The term "nucleotide"
comprises the fundamental structural units of nucleic acid
molecules, which include a nitrogenous base, a pentose sugar (the
sugar in RNA is ribose, and the sugar in DNA is D-deoxyribose) and
phosphoric acid. The term "nucleoside" comprises molecules which
serve as precursors of nucleotides but which, in contrast to
nucleotides, have no phosphoric acid unit. It is possible by
inhibiting the biosynthesis of these molecules or their
mobilization for formation of nucleic acid molecules to inhibit RNA
and DNA synthesis; targeted inhibition of this activity in
carcinogenic cells allows the ability of tumor cells to divide and
replicate to be inhibited.
[0296] There are also nucleotides which do not form nucleic acid
molecules but serve as energy stores (i.e. AMP) or as coenzymes
(i.e. FAD and NAD).
[0297] Several publications have described the use of these
chemicals for these medical indications, where purine and/or
pyrimidine metabolism is influenced (e.g. Christopherson, R. I. and
Lyons, S. D. (1990) "Potent inhibitors of de novo pyrimidine and
purine biosynthesis as chemotherapeutic agents", Med. Res. Reviews
10: 505-548). Investigations on enzymes involved in purine and
pyrimidine metabolism have concentrated on the development of novel
medicaments which can be used for example as immunosuppressants or
antiproliferatives (Smith, J. L. "Enzymes in Nucleotide Synthesis"
Curr. Opin. Struct. Biol. 5 (1995) 752-757; Biochem. Soc. Transact.
23 (1995) 877-902). Purine and pyrimidine bases, nucleosides and
nucleotides have, however, also other possible uses: as
intermediates in the biosynthesis of various fine chemicals (e.g.
thiamine, S-adenosylmethionine, folates or riboflavin), as energy
carriers for the cell (e.g. ATP or GTP) and for chemicals
themselves, are commonly used as flavor enhancers (e.g. IMP or GMP)
or for many medical applications (see, for example, Kuninaka, A.,
(1996) "Nucleotides and Related Compounds" in Biotechnology, vol.
6, Rehm et al., editors VCH: Weinheim, pp. 561-612). Enzymes
involved in purine, pyridine, nucleoside or nucleotide metabolism
are also increasingly serving as targets for the development of
chemicals for crop protection, including fungicides, herbicides and
insecticides.
[0298] The metabolism of these compounds in bacteria has been
characterized (for reviews, see, for example, Zalkin, H. and Dixon,
J. E. (1992) "De novo purine nucleotide biosynthesis" in Progress
in Nucleic Acids Research and Molecular Biology, vol. 42, Academic
Press, pp. 259-287; and Michal, G. (1999) "Nucleotides and
Nucleosides"; chapter 8 in: Biochemical Pathways: An Atlas of
Biochemistry and Molecular Biology, Wiley, New York). Purine
metabolism, which is the subject of intensive research, is
essential for normal functioning of the cell. Impaired purine
metabolism in higher animals may cause severe disorders, e.g. gout.
The purine nucleotides are synthesized over a number of steps via
the intermediate compound inosine 5'-phosphate (IMP) from ribose
5-phosphate, leading to production of guanosine 5'-monophosphate
(GMP) or adenosine 5'-monophosphate (AMP), from which the
triphosphate forms, which are used as nucleotides, can easily be
prepared. These compounds are also used as energy stores, so that
their degradation provides energy for many different biochemical
processes in the cell. Pyrimidine biosynthesis takes place via the
formation of uridine 5'-monophosphate (UMP) from ribose
5-phosphate. UMP in turn is converted into cytidine 5'-triphosphate
(CTP). The deoxy forms of all nucleotides are prepared in a
one-step reduction reaction from the diphosphate ribose form of the
nucleotide to give the diphosphate deoxyribose form of the
nucleotide. After phosphorylation, these molecules are able to take
part in DNA synthesis.
IV. Trehalose Metabolism and Uses
[0299] Trehalose consists of two glucose molecules which are linked
together via an .alpha.,.alpha.-1,1 linkage. It is commonly used in
the food industry as sweetener, as additive to dried or frozen
foods and in beverages. However, it is also used in the
pharmaceutical industry, the cosmetics and biotechnology industry
(see, for example, Nishimoto et al., (1998) U.S. Pat. No.
5,759,610; Singer, M. A. and Lindquist, S. Trends Biotech. 16
(1998) 460-467; Paiva, C. L. A. and Panek, A. D. Biotech Ann. Rev.
2 (1996) 293-314; and Shiosaka, M. J. Japan 172 (1997) 97-102).
Trehalose is produced by enzymes of many microorganisms and is
released in a natural way into the surrounding medium, from which
it can be isolated by methods known in the art.
[0300] Particularly preferred biosynthetic products are selected
from the group of organic acids, proteins, nucleotides and
nucleosides, both proteinogenic and non-proteinogenic amino acids,
lipids and fatty acids, diols, carbohydrates, aromatic compounds,
vitamins and cofactors, enzymes and proteins.
[0301] Preferred organic acids are tartaric acid, itaconic acid and
diaminopimelic acid.
[0302] Preferred nucleosides and nucleotides are described for
example in Kuninaka, A. (1996) Nucleotides and related compounds,
pp. 561-612, in Biotechnology, vol. 6, Rehm et al., editors VCH:
Weinheim and references present therein.
[0303] Preferred biosynthetic products are additionally lipids,
saturated and unsaturated fatty acids such as, for example,
arachidonic acid, diols such as, for example, propanediol and
butanediol, carbohydrates such as, for example, hyaluronic acid and
trehalose, aromatic compounds such as, for example, aromatic
amines, vanillin and indigo, vitamins and cofactors as described
for example in Ullmann's Encyclopedia of Industrial Chemistry, vol.
A27, "Vitamins", pp. 443-613 (1996) VCH: Weinheim and the
references present therein; and Ong, A. S., Niki, E. and Packer, L.
(1995) "Nutrition, Lipids, Health and Disease" Proceedings of the
UNESCO/Confederation of Scientific and Technological Associations
in Malaysia and the Society for Free Radical Research--Asia, held
on Sep. 1-3, 1994 in Penang, Malaysia, AOCS Press (1995)), enzymes,
polyketides (Cane et al. (1998) Science 282: 63-68) and all other
chemicals described by Gutcho (1983) in Chemicals by Fermentation,
Noyes Data Corporation, ISBN: 0818805086 and the references
indicated therein.
[0304] Particularly preferred biosynthetic products are amino
acids, particularly preferably essential amino acids, in particular
L-glycine, L-alanine, L-leucine, L-methionine, L-phenylalanine,
L-tryptophan, L-lysine, L-glutamine, L-glutamic acid, L-serine,
L-proline, L-valine, L-isoleucine, L-cysteine, L-tyrosine,
L-histidine, L-arginine, L-asparagine, L-aspartic acid and
L-threonine, L-homoserine, especially L-lysine, L-methionine and
L-threonine. An amino acid such as, for example, lysine, methionine
and threonine means hereinafter both in each case the L and the D
form of the amino acid, preferably the L form, i.e. for example
L-lysine, L-methionine and L-threonine.
[0305] The invention relates in particular to a method for
producing lysine by cultivating genetically modified microorganisms
with increased or caused expression rate of at least one gene
compared with the wild type, where
ch) the specific expression activity in the microorganism of at
least one endogenous expression unit of the invention, which
regulates the expression of the endogenous genes, is increased
compared with the wild type, or
[0306] dh) the expression of genes in the microorganism is
regulated by expression units of the invention or by expression
units with increased specific expression activity according to
embodiment ch), where the genes are heterologous in relation to the
expression units,
[0307] and where the genes are selected from the group of nucleic
acids encoding an aspartate kinase, nucleic acids encoding an
aspartate-semialdehyde dehydrogenase, nucleic acids encoding a
diaminopimelate dehydrogenase, nucleic acids encoding a
diaminopimelate decarboxylase, nucleic acids encoding a
dihydrodipicolinate synthetase, nucleic acids encoding a
dihydrodipicolinate reductase, nucleic acids encoding a
glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a
3-phosphoglycerate kinase, nucleic acids encoding a pyruvate
carboxylase, nucleic acids encoding a triosephosphate isomerase,
nucleic acids encoding a transcriptional regulator LuxR, nucleic
acids encoding a transcriptional regulator LysR1, nucleic acids
encoding a transcriptional regulator LysR2, nucleic acids encoding
a malate-quinone oxidoreductase, nucleic acids encoding a
glucose-6-phosphate dehydrogenase, nucleic acids encoding a
6-phosphogluconate dehydrogenase, nucleic acids encoding a
transketolase, nucleic acids encoding a transaldolase, nucleic
acids encoding a lysine exporter, nucleic acids encoding a biotin
ligase, nucleic acids encoding an arginyl-tRNA synthetase, nucleic
acids encoding a phosphoenolpyruvate carboxylase, nucleic acids
encoding a fructose-1,6-bisphosphatase, nucleic acids encoding a
protein OpcA, nucleic acids encoding a 1-phosphofructokinase and
nucleic acids encoding a 6-phosphofructokinase.
[0308] As described above for the methods, the regulation of the
expression of these genes in the microorganism by expression units
of the invention or by expression units of the invention with
increased specific expression activity in accordance with
embodiment ch) is achieved by
[0309] dh1) introducing one or more expression units of the
invention, if appropriate with increased specific expression
activity, into the genome of the microorganism so that expression
of one or more endogenous genes takes place under the control of
the introduced expression units of the invention, if appropriate
with increased specific expression activity, or
[0310] dh2) introducing one or more of these genes into the genome
of the microorganism so that expression of one or more of the
introduced genes takes place under the control of the endogenous
expression units of the invention, if appropriate with increased
specific expression activity, or
[0311] dh3) introducing one or more nucleic acid constructs
comprising an expression unit of the invention, if appropriate with
increased specific expression activity, and functionally linked one
or more nucleic acids to be expressed, into the microorganism.
[0312] A further preferred embodiment of the method described above
for preparing lysine comprises the genetically modified
microorganisms, compared with the wild type, having additionally an
increased activity, of at least one of the activities selected from
the group of aspartate kinase activity, aspartate-semialdehyde
dehydrogenase activity, diaminopimelate dehydrogenase activity,
diaminopimelate decarboxylase activity, dihydrodipicolinate
synthetase activity, dihydrodipicolinate reductase activity,
glyceraldehyde-3-phosphate dehydrogenase activity,
3-phosphoglycerate kinase activity, pyruvate carboxylase activity,
triosephosphate isomerase activity, activity of the transcriptional
regulator LuxR, activity of the transcriptional regulator LysR1,
activity of the transcriptional regulator LysR2, malate-quinone
oxidoreductase activity, glucose-6-phosphate dehydrogenase
activity, 6-phosphogluconate dehydrogenase activity, transketolase
activity, transaldolase activity, lysine exporter activity,
arginyl-tRNA synthetase activity, phosphoenolpyruvate carboxylase
activity, fructose-1,6-bisphosphatase activity, protein OpcA
activity, 1-phosphofructokinase activity, 6-phosphofructokinase
activity and biotin ligase activity.
[0313] A further particularly preferred embodiment of the method
described above for preparing lysine comprises the genetically
modified microorganisms having, compared with the wild type,
additionally a reduced activity, of at least one of the activities
selected from the group of threonine dehydratase activity,
homoserine O-acetyltransferase activity, O-acetylhomoserine
sulfhydrylase activity, phosphoenolpyruvate carboxykinase activity,
pyruvate oxidase activity, homoserine kinase activity, homoserine
dehydrogenase activity, threonine exporter activity, threonine
efflux protein activity, asparaginase activity, aspartate
decarboxylase activity and threonine synthase activity.
[0314] These additional increased or reduced activities of at least
one of the activities described above may, but need not, be caused
by a nucleic acid of the invention having promoter activity and/or
an expression unit of the invention.
[0315] The invention further relates to a method for producing
methionine by cultivating genetically modified microorganisms with
increased or caused expression rate of at least one gene compared
with the wild type, where
ch) the specific expression activity in the microorganism of at
least one endogenous expression unit of the invention, which
regulates the expression of the endogenous genes, is increased
compared with the wild type, or
[0316] dh) the expression of genes in the microorganism is
regulated by expression units of the invention or by expression
units of the invention with increased specific expression activity
according to embodiment ch), where the genes are heterologous in
relation to the expression units,
[0317] and where the genes are selected from the group of nucleic
acids encoding an aspartate kinase, nucleic acids encoding an
aspartate-semialdehyde dehydrogenase, nucleic acids encoding a
homoserine dehydrogenase, nucleic acids encoding a
glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a
3-phosphoglycerate kinase, nucleic acids encoding a pyruvate
carboxylase, nucleic acids encoding a triosephosphate isomerase,
nucleic acids encoding a homoserine O-acetyltransferase, nucleic
acids encoding a cystathionine gamma-synthase, nucleic acids
encoding a cystathionine beta-lyase, nucleic acids encoding a
serine hydroxymethyltransferase, nucleic acids encoding an
O-acetylhomoserine sulfhydrylase, nucleic acids encoding a
methylenetetrahydrofolate reductase, nucleic acids encoding a
phosphoserine aminotransferase, nucleic acids encoding a
phosphoserine phosphatase, nucleic acids encoding a serine
acetyltransferase, nucleic acids encoding a cysteine synthase I
activity, nucleic acids encoding a cysteine synthase II activity,
nucleic acids encoding a coenzyme B12-dependent methionine synthase
activity, nucleic acids encoding a coenzyme B12-independent
methionine synthase activity, nucleic acids encoding a sulfate
adenylyltransferase activity, nucleic acids encoding a
phosphoadenosine phosphosulfate reductase activity, nucleic acids
encoding a ferredoxin-sulfite reductase activity, nucleic acids
encoding a ferredoxin NADPH-reductase activity, nucleic acids
encoding a ferredoxin activity, nucleic acids encoding a protein of
sulfate reduction RXA077, nucleic acids encoding a protein of
sulfate reduction RXA248, nucleic acids encoding a protein of
sulfate reduction RXA247, nucleic acids encoding an RXA0655
regulator and nucleic acids encoding an RXN2910 regulator.
[0318] As described above for the methods, the regulation of the
expression of these genes in the microorganism by expression units
of the invention or by expression units of the invention with
increased specific expression activity according to embodiment ch)
is achieved by
[0319] dh1) introducing one or more expression units of the
invention, if appropriate with increased specific expression
activity, into the genome of the microorganism so that expression
of one or more of these endogenous genes takes place under the
control of the introduced expression units of the invention, if
appropriate with increased specific expression activity, or
[0320] dh2) introducing one or more genes into the genome of the
microorganism so that expression of one or more of the introduced
genes takes place under the control of the endogenous expression
units of the invention, if appropriate with increased specific
expression activity, or
[0321] dh3) introducing one or more nucleic acid constructs
comprising an expression unit of the invention, if appropriate with
increased specific expression activity, and functionally linked one
or more nucleic acids to be expressed, into the microorganism.
[0322] A further preferred embodiment of the method described above
for preparing methionine comprises the genetically modified
microorganisms having, compared with the wild type, additionally an
increased activity, of at least one of the activities selected from
the group of aspartate kinase activity, aspartate-semialdehyde
dehydrogenase activity, homoserine dehydrogenase activity,
glyceraldehyde-3-phosphate dehydrogenase activity,
3-phosphoglycerate kinase activity, pyruvate carboxylase activity,
triosephosphate isomerase activity, homoserine O-acetyltransferase
activity, cystathionine gamma-synthase activity, cystathionine
beta-lyase activity, serine hydroxymethyltransferase activity,
O-acetylhomoserine sulfhydrylase activity,
methylenetetrahydrofolate reductase activity, phosphoserine
aminotransferase activity, phosphoserine phosphatase activity,
serine acetyltransferase activity, cysteine synthase I activity,
cysteine synthase II activity, coenzyme B12-dependent methionine
synthase activity, coenzyme B12-independent methionine synthase
activity, sulfate adenylyltransferase activity,
phosphoadenosine-phosphosulfate reductase activity,
ferredoxin-sulfite reductase activity, ferredoxin NADPH-reductase
activity, ferredoxin activity, activity of a protein of sulfate
reduction RXA077, activity of a protein of sulfate reduction
RXA248, activity of a protein of sulfate reduction RXA247, activity
of an RXA655 regulator and activity of an RXN2910 regulator.
[0323] A further particularly preferred embodiment of the method
described above for preparing methionine comprises the genetically
modified microorganisms having, compared with the wild type,
additionally a reduced activity, of at least one of the activities
selected from the group of homoserine kinase activity, threonine
dehydratase activity, threonine synthase activity,
meso-diaminopimelate D-dehydrogenase activity, phosphoenolpyruvate
carboxykinase activity, pyruvate oxidase activity,
dihydrodipicolinate synthase activity, dihydrodipicolinate
reductase activity and diaminopicolinate decarboxylase
activity.
[0324] These additional increased or reduced activities of at least
one of the activities described above may, but need not, be caused
by a nucleic acid of the invention having promoter activity and/or
an expression unit of the invention.
[0325] The invention further relates to a method for preparing
threonine by cultivating genetically modified microorganisms with
increased or caused expression rate of at least one gene compared
with the wild type, where
ch) the specific expression activity in the microorganism of at
least one endogenous expression unit of the invention, which
regulates the expression of the endogenous genes, is increased
compared with the wild type, or
[0326] dh) the expression of genes in the microorganism is
regulated by expression units of the invention or by expression
units of the invention with increased specific expression activity
according to embodiment ch), where the genes are heterologous in
relation to the expression units,
[0327] and where the genes are selected from the group of nucleic
acids encoding an aspartate kinase, nucleic acids encoding an
aspartate-semialdehyde dehydrogenase, nucleic acids encoding a
glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a
3-phosphoglycerate kinase, nucleic acids encoding a pyruvate
carboxylase, nucleic acids encoding a triosephosphate isomerase,
nucleic acids encoding a homoserine kinase, nucleic acids encoding
a threonine synthase, nucleic acids encoding a threonine exporter
carrier, nucleic acids encoding a glucose-6-phosphate
dehydrogenase, nucleic acids encoding a transaldolase, nucleic
acids encoding a transketolase, nucleic acids encoding a
malate-quinone oxidoreductase, nucleic acids encoding a
6-phosphogluconate dehydrogenase, nucleic acids encoding a lysine
exporter, nucleic acids encoding a biotin ligase, nucleic acids
encoding a phosphoenolpyruvate carboxylase, nucleic acids encoding
a threonine efflux protein, nucleic acids encoding a
fructose-1,6-bisphosphatase, nucleic acids encoding an OpcA
protein, nucleic acids encoding a 1-phosphofructokinase, nucleic
acids encoding a 6-phosphofructokinase, and nucleic acids encoding
a homoserine dehydrogenase.
[0328] As described above for the methods, the regulation of the
expression of these genes in the microorganism by expression units
of the invention or by expression units of the invention with
increased specific expression activity according to embodiment ch)
is achieved by
[0329] dh1) introducing one or more expression units of the
invention, if appropriate with increased specific expression
activity, into the genome of the microorganism so that expression
of one or more of these endogenous genes takes place under the
control of the introduced expression units of the invention, if
appropriate with increased specific expression activity, or
[0330] dh2) introducing one or more of these genes into the genome
of the microorganism so that expression of one or more of the
introduced genes takes place under the control of the endogenous
expression units of the invention, if appropriate with increased
specific expression activity, or
[0331] dh3) introducing one or more nucleic acid constructs
comprising an expression unit of the invention, if appropriate with
increased specific expression activity, and functionally linked one
or more nucleic acids to be expressed, into the microorganism.
[0332] A further preferred embodiment of the method described above
for preparing threonine comprises the genetically modified
microorganisms having, compared with the wild type, additionally an
increased activity, of at least one of the activities selected from
the group of aspartate kinase activity, aspartate-semialdehyde
dehydrogenase activity, glyceraldehyde-3-phosphate dehydrogenase
activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase
activity, triosephosphate isomerase activity, threonine synthase
activity, activity of a threonine export carrier, transaldolase
activity, transketolase activity, glucose-6-phosphate dehydrogenase
activity, malate-quinone oxidoreductase activity, homoserine kinase
activity, biotin ligase activity, phosphoenolpyruvate carboxylase
activity, threonine efflux protein activity, protein OpcA activity,
1-phosphofructokinase activity, 6-phosphofructokinase activity,
fructose-1,6-bisphosphatase activity, 6-phosphogluconate
dehydrogenase and homoserine dehydrogenase activity.
[0333] A further particularly preferred embodiment of the method
described above for preparing threonine comprises the genetically
modified microorganisms having, compared with the wild type,
additionally a reduced activity, of at least one of the activities
selected from the group of threonine dehydratase activity,
homoserine O-acetyltransferase activity, serine
hydroxymethyltransferase activity, O-acetylhomoserine sulfhydrylase
activity, meso-diaminopimelate D-dehydrogenase activity,
phosphoenolpyruvate carboxykinase activity, pyruvate oxidase
activity, dihydrodipicolinate synthetase activity,
dihydrodipicolinate reductase activity, asparaginase activity,
aspartate decarboxylase activity, lysine exporter activity,
acetolactate synthase activity, ketol-acid reductoisomerase
activity, branched chain aminotransferase activity, coenzyme
B12-dependent methionine synthase activity, coenzyme
B12-independent methionine synthase activity, dihydroxy-acid
dehydratase activity and diaminopicolinate decarboxylase
activity.
[0334] These additional increased or reduced activities of at least
one of the activities described above may, but need not, be caused
by a nucleic acid of the invention having promoter activity and/or
an expression unit of the invention.
[0335] The term "activity" of a protein means in the case of
enzymes the enzymic activity of the corresponding protein, and in
the case of other proteins, for example structural or transport
proteins, the physiological activity of the proteins
[0336] The enzymes are ordinarily able to convert a substrate into
a product or catalyze this conversion step.
[0337] Accordingly, the "activity" of an enzyme means the quantity
of substrate converted by the enzyme, or the quantity of product
formed, in a particular time.
[0338] Thus, where an activity is increased compared with the wild
type, the quantity of the substrate converted by the enzyme, or the
quantity of product formed, in a particular time is increased
compared with the wild type.
[0339] This increase in the "activity" preferably amounts, for all
activities described hereinbefore and hereinafter, to at least 5%,
further preferably at least 20%, further preferably at least 50%,
further preferably at least 100%, more preferably at least 300%,
even more preferably at least 500%, especially at least 600% of the
"activity of the wild type".
[0340] Thus, where an activity is reduced compared with the wild
type, the quantity of substrate converted by the enzyme, or the
quantity of product formed, in a particular time is reduced
compared with the wild type.
[0341] A reduced activity preferably means the partial or
substantially complete suppression or blocking, based on various
cell biological mechanisms, of the functionality of this enzyme in
a microorganism.
[0342] A reduction in the activity comprises a quantitative
decrease in an enzyme as far as substantially complete absence of
the enzyme (i.e. lack of detectability of the corresponding
activity or lack of immunological detectability of the enzyme). The
activity in the microorganism is preferably reduced, compared with
the wild type, by at least 5%, further preferably by at least 20%,
further preferably by at least 50%, further preferably by 100%.
"Reduction" also means in particular the complete absence of the
corresponding activity.
[0343] The activity of particular enzymes in genetically modified
microorganisms and in the wild type, and thus the increase or
reduction in the enzymic activity, can be measured by known methods
such as, for example, enzyme assays.
[0344] For example, a pyruvate carboxylase means a protein which
exhibits the enzymatic activity of converting pyruvate into
oxaloacetate.
[0345] Correspondingly, a pyruvate carboxylase activity means the
quantity of pyruvate converted by the pyruvate carboxlyase protein,
or quantity of oxaloacetate formed, in a particular time.
[0346] Thus, where a pyruvate carboxylase activity is increased
compared with the wild type, the quantity of pyruvate converted by
the pyruvate carboxylase protein, or the quantity of oxaloacetate
formed, in a particular time is increased compared with the wild
type.
[0347] This increase in the pyruvate carboxylase activity is
preferably at least 5%, further preferably at least 20%, further
preferably at least 50%, further preferably at least 100%, more
preferably at least 300%, even more preferably at least 500%, in
particular at least 600%, of the pyruvate carboxylase activity of
the wild type.
[0348] In addition, for example a phosphoenolpyruvate carboxykinase
activity means the enzymic activity of a phosphoenolpyruvate
carboxykinase.
[0349] A phosphoenolpyruvate carboxykinase means a protein which
exhibits the enzymatic activity of converting oxaloacetate into
phosphoenolpyruvate.
[0350] Correspondingly, phosphoenolpyruvate carboxykinase activity
means the quantity of oxaloacetate converted by the
phosphoenolpyruvate carboxykinase protein, or quantity of
phosphoenolpyruvate formed, in a particular time.
[0351] When the phosphoenolpyruvate carboxykinase activity is
reduced compared with the wild type, therefore, the quantity of
oxaloacetate converted by the phosphoenolpyruvate carboxykinase
protein, or the quantity of phosphoenolpyruvate formed, in a
particular time, is reduced compared with the wild type.
[0352] A reduction in phosphoenolpyruvate carboxykinase activity
comprises a quantitative decrease in a phosphoenolpyruvate
carboxykinase as far as a substantially complete absence of
phosphoenolpyruvate carboxykinase (i.e. lack of detectability of
phosphoenolpyruvate carboxykinase activity or lack of immunological
detectability of phosphoenolpyruvate carboxykinase). The
phosphoenolpyruvate carboxykinase activity is preferably reduced,
compared with the wild type, by at least 5%, further preferably by
at least 20%, further preferably by at least 50%, further
preferably by 100%. In particular, "reduction" also means the
complete absence of phosphoenolpyruvate carboxykinase activity.
[0353] The additional increasing of activities can take place in
various ways, for example by switching off inhibitory regulatory
mechanisms at the expression and protein level or by increasing
gene expression of nucleic acids encoding the proteins described
above compared with the wild type.
[0354] Increasing the gene expression of the nucleic acids encoding
the proteins described above compared with the wild type can
likewise take place in various ways, for example by inducing the
gene by activators or, as described above, by increasing the
promoter activity or increasing the expression activity or by
introducing one or more gene copies into the microorganism.
[0355] Increasing the gene expression of a nucleic acid encoding a
protein also means according to the invention manipulation of the
expression of endogenous proteins intrinsic to the
microorganism.
[0356] This can be achieved for example, as described above, by
altering the promoter and/or expression unit sequences of the
genes. Such an alteration, which results in an increased expression
rate of the gene, can take place for example by deletion or
insertion of DNA sequences.
[0357] It is possible, as described above, to alter the expression
of endogenous proteins by applying exogenous stimuli. This can take
place through particular physiological conditions, i.e. through the
application of foreign substances.
[0358] The skilled worker may have recourse to further different
procedures, singly or in combination, to achieve an increase in
gene expression. Thus, for example, the copy number of the
appropriate genes can be increased, or the promoter and regulatory
region or the ribosome binding site located upstream of the
structural gene can be mutated. It is additionally possible to
increase the expression during fermentative production through
inducible promoters. Procedures to prolong the lifespan of the mRNA
likewise improve expression. Enzymic activity is likewise enhanced
also by preventing degradation of enzyme protein. The genes or gene
constructs may be either present in plasmids with varying copy
number or integrated and amplified in the chromosome. It is also
possible as an alternative to achieve overexpression of the
relevant genes by altering the composition of the media and
management of the culture.
[0359] The skilled worker can find guidance on this inter alia in
Martin et al. (Biotechnology 5, 137-146 (1987)), in Guerrero et al.
(Gene 138, 35-41 (1994)), Tsuchiya and Morinaga (Bio/Technology 6,
428-430 (1988)), in Eikmanns et al. (Gene 102, 93-98 (1991)), in
European patent 0472869, in U.S. Pat. No. 4,601,893, in Schwarzer
and Puhler (Biotechnology 9, 84-87 (1991), in Reinscheid et al.
(Applied and Environmental Microbiology 60, 126-132 (1994), in
LaBarre et al. (Journal of Bacteriology 175, 1001-1007 (1993)), in
the patent application WO 96/15246, in Malumbres et al. (Gene 134,
15-24 (1993)), in the Japanese published specification
JP-A-10-229891, in Jensen and Hammer (Biotechnology and
Bioengineering 58, 191-195 (1998)), in Makrides (Microbiological
Reviews 60: 512-538 (1996) and in well-known textbooks of genetics
and molecular biology.
[0360] It may additionally be advantageous for the production of
biosynthetic products, especially L-lysine, L-methionine and
L-threonine, besides the expression or enhancement of a gene, to
eliminate unwanted side reactions (Nakayama: "Breeding of Amino
Acid Producing Microorganisms", in: Overproduction of Microbial
Products, Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London,
UK, 1982).
[0361] In a preferred embodiment, gene expression of a nucleic acid
encoding one of the proteins described above is increased by
introducing at least one nucleic acid encoding a corresponding
protein into the microorganism. The introduction of the nucleic
acid can take place chromosomally or extrachromosomally, i.e.
through increasing the copy number on the chromosome and/or a copy
of the gene on a plasmid which replicates in the host
microorganism.
[0362] The introduction of the nucleic acid, for example in the
form of an expression cassette comprising the nucleic acid,
preferably takes place chromosomally, in particular by the SacB
method described above.
[0363] It is possible in principle to use for this purpose any gene
which encodes one of the proteins described above.
[0364] In the case of genomic nucleic acid sequences from
eukaryotic sources which comprise introns, if the host
microorganism is unable or cannot be made able to express the
corresponding proteins it is preferred to use nucleic acid
sequences which have already been processed, such as the
corresponding cDNAs.
[0365] Examples of the corresponding genes are listed in Table 1
and 2.
[0366] The activities described above in microorganisms are
preferably reduced by at least one of the following methods: [0367]
introduction of at least one sense ribonucleic acid sequence for
inducing cosuppression or of an expression cassette ensuring
expression thereof [0368] introduction of at least one DNA- or
protein-binding factor against the corresponding gene, RNA or
protein or of an expression cassette ensuring expression thereof
[0369] introduction of at least one viral nucleic acid sequence
which causes RNA degradation, or of an expression cassette ensuring
expression thereof [0370] introduction of at least one construct to
produce a loss of function, such as, for example, generation of
stop codons or a shift in the reading frame, of a gene, for example
by producing an insertion, deletion, inversion or mutation in a
gene. It is possible and preferred to generate knockout mutants by
targeted insertion into the desired target gene through homologous
recombination or introduction of sequence-specific nucleases
against the target gene. [0371] introduction of a promoter with
reduced promoter activity or of an expression unit with reduced
expression activity.
[0372] The skilled worker is aware that further methods can also be
employed within the scope of the present invention for reducing its
activity or function. For example, the introduction of a dominant
negative variant of a protein or of an expression cassette ensuring
expression thereof may also be advantageous.
[0373] It is moreover possible for each single one of these methods
to bring about a reduction in the quantity of protein, quantity of
mRNA and/or activity of a protein. A combined use is also
conceivable. Further methods are known to the skilled worker and
may comprise impeding or suppressing the processing of the protein,
of the transport of the protein or its mRNA, inhibition of ribosome
attachment, inhibition of RNA splicing, induction of an
RNA-degrading enzyme and/or inhibition of translation elongation or
termination.
[0374] In the method of the invention for producing biosynthetic
products, the step of cultivation of the genetically modified
microorganisms is preferably followed by an isolation of
biosynthetic products from the microorganisms or/or from the
fermentation broth. These steps may take place at the same time
and/or preferably after the cultivation step.
[0375] The genetically modified microorganisms of the invention can
be cultivated to produce biosynthetic products, in particular
L-lysine, L-methionine and L-threonine, continuously or
discontinuously in a batch method (batch cultivation) or in the fed
batch or repeated fed batch method. A summary of known cultivation
methods is to be found in the textbook by Chmiel
(Bioproze.beta.technik 1. Einfuhrung in die Bioverfahrenstechnik
(Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by
Storhas (Bioreaktoren und periphere Einrichtungen (Vieweg Verlag,
Brunswick/Wiesbaden, 1994)).
[0376] The culture medium to be used must satisfy in a suitable
manner the demands of the respective strains. There are
descriptions of culture media for various microorganisms in the
handbook "Manual of Methods for General Bacteriology" of the
American Society for Bacteriology (Washington D.C., USA, 1981).
[0377] These media which can be employed according to the invention
usually comprise one or more carbon sources, nitrogen sources,
inorganic salts, vitamins and/or trace elements.
[0378] Preferred carbon sources are sugars such as mono-, di- or
polysaccharides. Examples of very good carbon sources are glucose,
fructose, mannose, galactose, ribose, sorbose, ribulose, lactose,
maltose, sucrose, raffinose, starch or cellulose. Sugars can be put
in the media also via complex compounds such as molasses, or other
by-products of sugar refining. It may also be advantageous to add
mixtures of various carbon sources. Other possible carbon sources
are oils and fats such as, for example, soybean oil, sunflower oil,
peanut oil and coconut fat, fatty acids such as, for example,
palmitic acid, stearic acid or linoleic acid, alcohols such as, for
example, glycerol, methanol or ethanol and organic acids such as,
for example, acetic acid or lactic acid.
[0379] Nitrogen sources are usually organic or inorganic nitrogen
compounds or materials comprising these compounds. Examples of
nitrogen sources include ammonia gas or ammonium salts such as
ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium
carbonate or ammonium nitrate, nitrates, urea, amino acids or
complex nitrogen sources such as corn steep liquor, soybean flour,
soybean protein, yeast extract, meat extract and others. The
nitrogen sources may be used singly or as mixtures.
[0380] Inorganic salt compounds which may be present in the media
comprise the chloride, phosphoric or sulfate salts of calcium,
magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc,
copper and iron.
[0381] For producing fine chemicals, especially methionine, it is
possible to use as sulfur source inorganic compounds such as, for
example, sulfates, sulfites, dithionites, tetrathionates,
thiosulfates, sulfides, but also organic sulfur compounds such as
mercaptans and thiols.
[0382] It is possible to use as phosphorus source phosphoric acid,
potassium dihydrogenphosphate or dipotassium hydrogenphosphate or
the corresponding sodium-containing salts.
[0383] Chelating agents can be added to the medium in order to keep
the metal ions in solution. Particularly suitable chelating agents
comprise dihydroxyphenols such as catechol or protocatechuate, or
organic acids such as citric acid.
[0384] The fermentation media employed according to the invention
normally also comprise other growth factors such as vitamins or
growth promoters, which include for example biotin, riboflavin,
thiamine, folic acid, nicotinic acid, pantothenate and pyridoxine.
Growth factors and salts are frequently derived from complex
components of the media, such as yeast extract, molasses, corn
steep liquor and the like. Suitable precursors may also be added to
the culture medium. The exact composition of the compounds in the
media depends greatly on the particular experiment and will be
decided individually for each specific case. Information on
optimization of media is obtainable from the textbook "Applied
Microbiol. Physiology, A Practical Approach" (editors P. M. Rhodes,
P. F. Stanbury, IRL Press (1997) pp. 53-73, ISBN 0 19 963577 3).
Growth media can also be purchased from commercial suppliers, such
as Standard 1 (Merck) or BHI (Brain heart infusion, DIFCO) and the
like.
[0385] All the components of the media are sterilized either by
heat (20 min at 1.5 bar and 121.degree. C.) or by sterilizing
filtration. The components can be sterilized either together or, if
necessary, separately. All the components of the media may be
present at the start of culturing or optionally be added
continuously or batchwise.
[0386] The temperature of the culture is normally between
15.degree. C. and 45.degree. C., preferably at 25.degree. C. to
40.degree. C. and can be kept constant or changed during the
experiment. The pH of the medium should be in the range from 5 to
8.5, preferably around 7.0. The pH for the culturing can be
controlled during the culturing by adding basic compounds such as
sodium hydroxide, potassium hydroxide, ammonia or aqueous ammonia
or acidic compounds such as phosphoric acid or sulfuric acid. The
development of foam can be controlled by employing antifoams such
as, for example, fatty acid polyglycol esters. The stability of
plasmids can be maintained by adding to the medium suitable
substances with a selective action, such as, for example,
antibiotics. Aerobic conditions are maintained by introducing
oxygen or oxygen-containing gas mixtures such as, for example,
ambient air into the culture. The temperature of the culture is
normally 20.degree. C. to 45.degree. C. The culture is continued
until formation of the desired product is at a maximum. This aim is
normally reached within 10 hours to 160 hours.
[0387] The dry matter content of the fermentation broths obtained
in this way is normally from 7.5 to 25% by weight.
[0388] It is additionally advantageous also to run the fermentation
with sugar limitation at least at the end, but in particular over
at least 30% of the fermentation time. This means that the
concentration of utilizable sugar in the fermentation medium is
kept at 0 to 3 g/l, or is reduced, during this time.
[0389] Biosynthetic products are isolated from the fermentation
broth and/or the microorganisms in a manner known per se in
accordance with the physical/chemical properties of the required
biosynthetic product and the biosynthetic by-products.
[0390] The fermentation broth can then be processed further for
example. Depending on the requirement, the biomass can be removed
wholly or partly from the fermentation broth by separation methods
such as, for example, centrifugation, filtration, decantation or a
combination of these methods, or left completely in it.
[0391] The fermentation broth can then be concentrated by known
methods such as, for example, with the aid of a rotary evaporator,
thin-film evaporator, falling-film evaporator, by reverse osmosis
or by nanofiltration. This concentrated fermentation broth can then
be worked up by freeze drying, spray drying, spray granulation or
by other methods.
[0392] However, it is also possible to purify the biosynthetic
products, especially L-lysine, L-methionine and L-threonine,
further. For this purpose, the product-containing broth is
subjected, after removal of the biomass, to a chromatography using
a suitable resin, with the desired product or the impurities being
retained wholly or partly on the chromatography resin. These
chromatographic steps can be repeated if required, using the same
or different chromatography resins. The skilled worker is
proficient in the selection of suitable chromatography resins and
their most effective use. The purified product can be concentrated
by filtration or ultrafiltration and be stored at a temperature at
which the stability of the product is a maximum.
[0393] The biosynthetic products may result in various forms, for
example in the form of their salts or esters.
[0394] The identity and purity of the isolated compound(s) can be
determined by prior art techniques. These comprise high performance
liquid chromatography (HPLC), spectroscopic methods, staining
methods, thin-layer chromatography, NIRS, enzyme assay or
microbiological assays. These analytical methods are summarized in:
Patek et al. (1994) Appl. Environ. Microbiol. 60:133-140; Malakhova
et al. (1996) Biotekhnologiya 11 27-32; and Schmidt et al. (1998)
Bioprocess Engineer. 19:67-70. Ullmann's Encyclopedia of Industrial
Chemistry (1996) vol. A27, VCH: Weinheim, pp. 89-90, pp. 521-540,
pp. 540-547, pp. 559-566, 575-581 and pp. 581-587; Michal, G (1999)
Biochemical Pathways: An Atlas of Biochemistry and Molecular
Biology, John Wiley and Sons; Fallon, A. et al. (1987) Applications
of HPLC in Biochemistry in: Laboratory Techniques in Biochemistry
and Molecular Biology, vol. 17.
[0395] The invention is now described in more detail by means of
the following nonlimiting examples:
EXAMPLE 1
Preparation of the Vector pCLiK5MCS
[0396] Firstly, the ampicillin resistance and origin of replication
of the vector pBR322 were amplified by the polymerase chain
reaction (PCR) using the oligonucleotide primers SEQ ID NO: 5 and
SEQ ID NO: 6. TABLE-US-00004 SEQ ID NO 5:
5'-CCCGGGATCCGCTAGCGGCGCGCCGGCCGGCCCGGTGTGAAATACCG CACAG-3' SEQ ID
NO 6: 5'-TCTAGACTCGAGCGGCCGCGGCCGGCCTTTAAATTGAAGACGAAAGG
GCCTCG-3'
[0397] Besides the sequences complementary to pBR322, the
oligonucleotide primer SEQ ID NO: 5 comprises in the 5'-3'
direction the cleavage sites for the restriction endonucleases
SmaI, BamHI, NheI and AscI and the oligonucleotide primer SEQ ID
NO: 6 comprises in the 5'-3' direction the cleavage sites for the
restriction endonucleases XbaI, XhoI, NotI and DraI. The PCR
reaction was carried out with PfuTurbo polymerase (Stratagene, La
Jolla, USA) by a standard method such as Innis et al. (PCR
Protocols. A Guide to Methods and Applications, Academic Press
(1990)). The resulting DNA fragment with a size of approximately
2.1 kb was purified using the GFX.TM.PCR, DNA and Gel Band
Purification Kit (Amersham Pharmacia, Freiburg) in accordance with
the manufacturer's instructions. The blunt ends of the DNA fragment
were ligated together using the Rapid DNA Ligation Kit (Roche
Diagnostics, Mannheim) in accordance with the manufacturer's
instructions, and the ligation mixture was transformed into
competent E. coli XL-1 Blue (Stratagene, La Jolla, USA) by standard
methods as described in Sambrook et al. (Molecular Cloning. A
Laboratory Manual, Cold Spring Harbor (1989)). Plasmid-harboring
cells were selected by plating out on LB agar (Lennox, 1955,
Virology, 1:190) containing ampicillin (50 .mu.g/ml).
[0398] The plasmid DNA of an individual clone was isolated using
the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) in accordance with
the manufacturer's instructions and checked by restriction
digestions. The plasmid obtained in this way is called pCLiK1.
[0399] Starting from the plasmid pWLT1 (Liebl et al., 1992) as
template for a PCR reaction, a kanamycin resistance cassette was
amplified using the oligonucleotide primers SEQ ID NO: 7 and SEQ ID
NO: 8. TABLE-US-00005 SEQ ID NO: 7:
5'-GAGATCTAGACCCGGGGATCCGCTAGCGGGCTGCTAAAGGAAGCGG A-3' SEQ ID NO: 8
5'-GAGAGGCGCGCCGCTAGCGTGGGCGAAGAACTCCAGCA-3'
[0400] Besides the sequences complementary to pWLT1, the
oligonucleotide primer SEQ ID NO: 7 comprises in the 5'-3'
direction the cleavage sites for the restriction endonucleases
XbaI, SmaI, BamHI, NheI and the oligonucleotide primer SEQ ID NO: 8
contains in the 5'-3' direction the cleavage sites for the
restriction endonucleases AscI and NheI. The PCR reaction was
carried out with PfuTurbo polymerase (Stratagene, La Jolla, USA) by
standard methods such as Innis et al. (PCR Protocols. A Guide to
Methods and Applications, Academic Press (1990)). The resulting DNA
fragment with a size of approximately 1.3 kb was purified using the
GFX.TM.PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia,
Freiburg) in accordance with the manufacturer's instructions. The
DNA fragment was cut with the restriction endonucleases XbaI and
AscI (New England Biolabs, Beverly, USA) and subsequently again
purified using the GFX.TM.PCR, DNA and Gel Band Purification Kit
(Amersham Pharmacia, Freiburg) in accordance with the
manufacturer's instructions. The vector pCLiK1 was likewise cut
with the restriction endonucleases XbaI and AscI and
dephosphorylated with alkaline phosphatase (I (Roche Diagnostics,
Mannheim)) in accordance with the manufacturer's instructions.
After electrophoresis in a 0.8% agarose gel, the linearized vector
(approx. 2.1 kb) was isolated using the GFX.TM.PCR, DNA and Gel
Band Purification Kit (Amersham Pharmacia, Freiburg) in accordance
with the manufacturer's instructions. This vector fragment was
ligated with the cut PCR fragment using the Rapid DNA Ligation Kit
(Roche Diagnostics, Mannheim) in accordance with the manufacturer's
instructions, and the ligation mixture was transformed into
competent E. coli XL-1 Blue (Stratagene, La Jolla, USA) by standard
methods as described in Sambrook et al. (Molecular Cloning. A
Laboratory Manual, Cold Spring Harbor, (1989)). Plasmid-harboring
cells were selected by plating out on LB agar (Lennox, 1955,
Virology, 1:190) containing ampicillin (50 .mu.g/ml) and kanamycin
(20 .mu.g/ml).
[0401] The plasmid DNA of an individual clone was isolated using
the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) in accordance with
the manufacturer's instructions and checked by restriction
digestions. The plasmid obtained in this way is called pCLiK2.
[0402] The vector pCLiK2 was cut with the restriction endonuclease
DraI (New England Biolabs, Beverly, USA). After electrophoresis in
a 0.8% agarose gel, a vector fragment approx. 2.3 kb in size was
isolated using the GFX.TM.PCR, DNA and Gel Band Purification Kit
(Amersham Pharmacia, Freiburg) in accordance with the
manufacturer's instructions. This vector fragment was religated
using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) in
accordance with the manufacturer's instructions, and the ligation
mixture was transformed into competent E. coli XL-1 Blue
(Stratagene, La Jolla, USA) by standard methods as described in
Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold
Spring Harbor, (1989)). Plasmid-harboring cells were selected by
plating out on LB agar (Lennox, 1955, Virology, 1:190) containing
kanamycin (20 .mu.g/ml).
[0403] The plasmid DNA of an individual clone was isolated using
the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) in accordance with
the manufacturer's instructions and checked by restriction
digestions. The plasmid obtained in this way is called pCLiK3.
[0404] Starting from the plasmid pWLQ2 (Liebi et al., 1992) as
template for a PCR reaction, the origin of replication pHM1519 was
amplified using the oligonucleotide primers SEQ ID NO: 9 and SEQ ID
NO: 10. TABLE-US-00006 SEQ ID NO: 9:
5'-GAGAGGGCGGCCGCGCAAAGTCCCGCTTCGTGAA-3' SEQ ID NO: 10:
5'-GAGAGGGCGGCCGCTCAAGTCGGTCAAGCCACGC-3'
[0405] Besides the sequences complementary to pWLQ2, the
oligonucleotide primers SEQ ID NO: 9 and SEQ ID NO: 10 comprise
cleavage sites for the restriction endonuclease NotI. The PCR
reaction was carried out with PfuTurbo polymerase (Stratagene, La
Jolla, USA) by a standard method such as Innis et al. (PCR
Protocols. A Guide to Methods and Applications, Academic Press
(1990)). The resulting DNA fragment with a size of approximately
2.7 kb was purified using the GFX.TM.PCR, DNA and Gel Band
Purification Kit (Amersham Pharmacia, Freiburg) in accordance with
the manufacturer's instructions. The DNA fragment was cut with the
restriction endonuclease NotI (New England Biolabs, Beverly, USA)
and then purified again with the GFX.TM.PCR, DNA and Gel Band
Purification Kit (Amersham Pharmacia, Freiburg) in accordance with
the manufacturer's instructions. The vector pCLiK3 was likewise cut
with the restriction endonuclease NotI and dephosphorylated with
alkaline phosphatase (I (Roche Diagnostics, Mannheim)) in
accordance with the manufacturer's instructions. After
electrophoresis in a 0.8% agarose gel, the linearized vector
(approx. 2.3 kb) was isolated with the GFX.TM.PCR, DNA and Gel Band
Purification Kit (Amersham Pharmacia, Freiburg) in accordance with
the manufacturer's instructions. This vector fragment was ligated
with the cut PCR fragment using the Rapid DNA Ligation Kit (Roche
Diagnostics, Mannheim) in accordance with the manufacturer's
instructions, and the ligation mixture was transformed into
competent E. coli XL-1 Blue (Stratagene, La Jolla, USA) by standard
methods as described in Sambrook et al. (Molecular Cloning. A
Laboratory Manual, Cold Spring Harbor, (1989)). Plasmid-harboring
cells were selected by plating out on LB agar (Lennox, 1955,
Virology, 1:190) containing kanamycin (20 .mu.g/ml).
[0406] The plasmid DNA of an individual clone was isolated using
the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) in accordance with
the manufacturer's instructions and checked by restriction
digestions. The plasmid obtained in this way is called pCLiK5.
[0407] To extend pCLiK5 by a multiple cloning site (MCS), the two
synthetic, very substantially complementary oligonucleotides SEQ ID
NO: 11 and SEQ ID NO: 12, which comprise cleavage sites for the
restriction endonucleases SwaI, XhoI, AatI, ApaI, Asp718, MluI,
NdeI, SpeI, EcoRV, SalI, ClaI, BamHI, XbaI and SmaI, were combined
by heating together at 95.degree. C. and slow cooling to give a
double-stranded DNA fragment. TABLE-US-00007 SEQ ID NO: 11:
5'-TCGAATTTAAATCTCGAGAGGCCTGACGTCGGGCCCGGTACCACGCG
TCATATGACTAGTTCGGACCTAGGGATATCGTCGACATCGATGCTCTTCT
GCGTTAATTAACAATTGGGATCCTCTAGACCCGGGATTTAAAT-3' SEQ ID NO: 12:
5'-GATCATTTAAATCCCGGGTCTAGAGGATCCCAATTGTTAATTAACGC
AGAAGAGCATCGATGTCGACGATATCCCTAGGTCCGAACTAGTCATATGA
CGCGTGGTACCGGGCCCGACGTCAGGCCTCTCGAGATTTAAAT-3'
[0408] The vector pCLiK5 was cut with the restriction endonucleases
XhoI and BamHI (New England Biolabs, Beverly, USA) and
dephosphorylated with alkaline phosphatase (I (Roche Diagnostics,
Mannheim)) in accordance with the manufacturer's instructions.
After electrophoresis in a 0.8% agarose gel, the linearized vector
(approx. 5.0 kb) was isolated with the GFX.TM.PCR, DNA and Gel Band
Purification Kit (Amersham Pharmacia, Freiburg) in accordance with
the manufacturer's instructions. This vector fragment was ligated
to the synthetic double-stranded DNA fragment using the Rapid DNA
Ligation Kit (Roche Diagnostics, Mannheim) in accordance with the
manufacturer's instructions, and the ligation mixture was
transformed into competent E. coli XL-1 Blue (Stratagene, La Jolla,
USA) by standard methods as described in Sambrook et al. (Molecular
Cloning. A Laboratory Manual, Cold Spring Harbor, (1989)).
Plasmid-harboring cells were selected by plating out on LB agar
(Lennox, 1955, Virology, 1:190) containing kanamycin (20
.mu.g/ml).
[0409] The plasmid DNA of an individual clone was isolated using
the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) in accordance with
the manufacturer's instructions and checked by restriction
digestions. The plasmid obtained in this way is called
pCLiK5MCS.
[0410] Sequencing reactions were carried out as described by Sanger
et al. (1977) Proceedings of the National Academy of Sciences USA
74:5463-5467. The sequencing reactions were fractionated and
evaluated using an ABI prism 377 (PE Applied Biosystems,
Weiterstadt).
[0411] The resulting plasmid pCLiK5MCS is listed as SEQ ID NO:
13.
EXAMPLE 2
Preparation of the Plasmid P EF-TS metA
[0412] Chromosomal DNA from C. glutamicum ATCC 13032 was prepared
as described by Tauch et al. (1995) Plasmid 33:168-179 or Eikmanns
et al. (1994) Microbiology 140:1817-1828. The meta gene which codes
for homoserine O-acetyltransferase, was amplified by the polymerase
chain reaction (PCR) by standard methods as described in Innis et
al. (1990) PCR Protocols. A Guide to Methods and Applications,
Academic Press, using the oligonucleotide primers BK 1849 SEQ ID
NO: 14 and BK 1862 SEQ ID NO: 15 33, the chromosomal DNA as
template and Pfu Turbo polymerase (from Stratagene). TABLE-US-00008
BK 1849 SEQ ID NO 14 5'-gtgtgtcgacttagatgtagaactcgatgtag -3' and BK
1862 SEQ ID NO 15 5'-atgcccaccctcgcgcc -3'
[0413] The resulting DNA fragment with a size of approx. 1134 bp
was purified using the GFX.TM.PCR, DNA and Gel Band Purification
Kit (Amersham Pharmacia, Freiburg) in accordance with the
manufacturer's instructions.
[0414] The expression unit of the gene (SEQ ID NO 2), which codes
for the elongation factor TS, was amplified by the polymerase chain
reaction (PCR) by standard methods as described in Innis et al.
(1990) PCR Protocols. A Guide to Methods and Applications, Academic
Press, using the oligonucleotide primers Haf 26 SEQ ID NO 16 and
Haf 27 SEQ ID NO 17, the chromosomal DNA as template and Pfu Turbo
polymerase (from Stratagene). TABLE-US-00009 Haf 26 SEQ ID NO 16
5'-gagaggatcccccccacgacaatggaac-3' and Haf 27 SEQ ID NO 17
5'-cctgaaggcgcgagggtgggcattacggggcgatcctccttatg-3'
[0415] The resulting DNA fragment with a size of approx. 195 bp was
purified using the GFX.TM.PCR, DNA and Gel Band Purification Kit
(Amersham Pharmacia, Freiburg) in accordance with the
manufacturer's instructions.
[0416] The primers Haf 27 and BK 1862 comprise an overlapping
sequence and are homologous to one another at their 5' ends.
[0417] The PCR products obtained above were employed as templates
for a further PCR in which the primers BK 1849 (SEQ. ID. NO. 14)
and Haf 26 (SEQ. ID. NO. 16) were employed.
[0418] Using this approach, it was possible to amplify a DNA
fragment which corresponded to the expected size of 1329 bp. This P
EF-TS/metA fusion was then cloned into the vector pClik 5a MCS
(SEQ. ID. NO. 13) by the restriction cleavage sites BamHI and
SalI.
[0419] The vector fragment was ligated together with the PCR
fragment using the Rapid DNA Ligation Kit (Roche Diagnostics,
Mannheim) in accordance with the manufacturer's instructions, and
the ligation mixture was transformed into competent E. coli XL-1
Blue (Stratagene, La Jolla, USA) by standard methods as described
in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold
Spring Harbor, (1989)). Plasmid-harboring cells were selected by
plating out on LB agar (Lennox, 1955, Virology, 1:190) containing
kanamycin (20 .mu.g/ml).
[0420] The plasmid DNA was prepared by methods and using materials
from Qiagen. Sequencing reactions were carried out as described by
Sanger et al. (1977) Proceedings of the National Academy of
Sciences USA 74:5463-5467. The sequencing reactions were
fractionated and evaluated using an ABI prism 377 (PE Applied
Biosystems, Weiterstadt).
[0421] The resulting plasmid was named pClik 5a MCS P EF-TS meta
(SEQ. ID. NO. 18).
EXAMPLE 3
MetA Activities
[0422] The strain Corynebacterium glutamicum ATCC13032 was
transformed with each of the plasmids pClik5 MCS, pClik MCS EF-TS
meta by the method described (Liebl, et al. (1989) FEMS
Microbiology Letters 53:299-303). The transformation mixture was
plated on CM plates which additionally comprised 20 mg/l kanamycin
in order to select for plasmid-containing cells. Resulting
Kan-resistant clones were picked and isolated.
[0423] C. glutamicum strains which comprised one of these plasmid
constructs were cultured in MMA medium (40 g/l sucrose, 20 g/l
(NH.sub.4).sub.2SO.sub.4, 1 g/l KH.sub.2PO.sub.4, 1 g/l
K.sub.2HPO.sub.4, 0.25 g/l MgSO.sub.4.times.7H.sub.2O, 54 g Aces, 1
ml CaCl.sub.2 (10 g/l), 1 ml protocatechuate (300 mg/10 ml), 1 ml
trace element solution (10 g/l FeSO.sub.4.times.7H.sub.2O, 10 g/l
MnSO.sub.4.times.H.sub.2O, 2 g/l ZnSO.sub.4.times.7H.sub.2O, 0.2
g/l CuSO.sub.4, 0.02 g/l NiCl.sub.2.times.6H.sub.2O), 100 .mu.g/l
vitamin B.sub.12, 0.3 mg/l thiamine, 1 mM leucine, 1 mg/l pyridoxal
HCl, 1 ml biotin (100 mg/I), pH 7.0) at 30.degree. C. overnight.
The cells were spun down at 4.degree. C. and then washed twice with
cold Tris-HCl buffer (0.1%, pH 8.0). After renewed centrifugation,
the cells were taken up in cold Tris-HCl buffer (0.1%, pH 8.0) and
adjusted to an OD.sub.600 of 160. For cell disruption, 1 ml of this
cell suspension was transferred into 2 ml Ribolyser tubes from
Hybaid and lysed in a Ribolyser from Hybaid with a rotation setting
of 6.0 three times for 30 sec each time. The lysate was clarified
by centrifugation at 15 000 rpm and 4.degree. C. in an Eppendorf
centrifuge for 30 minutes, and the supernatant was transferred into
a new Eppendorf cup. The protein content was determined as
described by Bradford, M. M. (1976) Anal. Biochem. 72:248-254.
[0424] The enzymatic activity of meta was measured as follows. The
1 ml reaction mixtures comprised 100 mM potassium phosphate buffer
(pH 7.5), 5 mM MgCl.sub.2, 100 .mu.M acetyl-CoA, 5 mM L-homoserine,
500 .mu.M DTNB (Ellman's reagent) and cell extract. The assay was
started by adding the respective protein lysate and incubated at
room temperature. Kinetics were then recorded at 412 nm for 10
min.
[0425] The results are shown in Table 4. TABLE-US-00010 TABLE 4
Specific activity Strain [nmol/mg/min] ATCC 13032 pClik5MCS 12.6
ATCC 13032 pClik5MCS P EF-TS metA 2339.1
[0426] It was possible to increase MetA activity considerably by
using the heterologous expression unit P.sub.EF-TS.
Sequence CWU 1
1
23 1 178 DNA Corynebacterium glutamicum Promoter (1)..(178) 1
cccccacgac aatggaactt tgacttttaa aatttcatcg ccgtgggggc tttttgggca
60 gccagcccgc cgtgtcgcaa cgtaatcgac tgaatacctg tacgatcact
ttttagacgg 120 gcgggtaggg ctactgtgcc ctaacctaag cttgtaaagc
attaattatc catacata 178 2 195 DNA Corynebacterium glutamicum
misc_feature (1)..(195) Expression unit 2 cccccacgac aatggaactt
tgacttttaa aatttcatcg ccgtgggggc tttttgggca 60 gccagcccgc
cgtgtcgcaa cgtaatcgac tgaatacctg tacgatcact ttttagacgg 120
gcgggtaggg ctactgtgcc ctaacctaag cttgtaaagc attaattatc catacataag
180 gaggatcgcc ccgta 195 3 1365 DNA Corynebacterium glutamicum CDS
(1)..(1365) 3 atg aat gat gag aat att caa agc tcc aac tat cag cca
ttc ccg agt 48 Met Asn Asp Glu Asn Ile Gln Ser Ser Asn Tyr Gln Pro
Phe Pro Ser 1 5 10 15 ttt gac gat tgg aaa cag atc gag gtg tcg ctc
tta gat gtc atc gaa 96 Phe Asp Asp Trp Lys Gln Ile Glu Val Ser Leu
Leu Asp Val Ile Glu 20 25 30 tcc tca cgc cat ttt tct gat ttg aaa
gat agc act gat cgt tct gcg 144 Ser Ser Arg His Phe Ser Asp Leu Lys
Asp Ser Thr Asp Arg Ser Ala 35 40 45 tta gat gct gcg cta gag aga
gca aaa aga gct gcc gca gtt gat acc 192 Leu Asp Ala Ala Leu Glu Arg
Ala Lys Arg Ala Ala Ala Val Asp Thr 50 55 60 aat gcc ata gaa gga
atc ttc caa act gat cgc ggt ttt acc cat aca 240 Asn Ala Ile Glu Gly
Ile Phe Gln Thr Asp Arg Gly Phe Thr His Thr 65 70 75 80 gtt gca acg
cag gta ggg gct tgg gag caa caa atg gcg atg aaa ggc 288 Val Ala Thr
Gln Val Gly Ala Trp Glu Gln Gln Met Ala Met Lys Gly 85 90 95 aaa
cat gtt aag cct gcg ttt gac gat act cta gaa ggc ttt gag tat 336 Lys
His Val Lys Pro Ala Phe Asp Asp Thr Leu Glu Gly Phe Glu Tyr 100 105
110 gtt ctc gat gca gta act ggt aga act cca atc tct cag caa tgg att
384 Val Leu Asp Ala Val Thr Gly Arg Thr Pro Ile Ser Gln Gln Trp Ile
115 120 125 aga aat ttg cac gcc gtc att ctg cgg agc caa gaa agc cac
gag gtt 432 Arg Asn Leu His Ala Val Ile Leu Arg Ser Gln Glu Ser His
Glu Val 130 135 140 ttt aca gcc gtt gga gtc caa aat cag gcg ctt cag
aaa ggc gag tat 480 Phe Thr Ala Val Gly Val Gln Asn Gln Ala Leu Gln
Lys Gly Glu Tyr 145 150 155 160 aaa act cag cca aat agt cca cag cgc
tca gat gga tct gta cat gca 528 Lys Thr Gln Pro Asn Ser Pro Gln Arg
Ser Asp Gly Ser Val His Ala 165 170 175 tac gcc cca gtt gaa gat act
cct gct gaa atg gct aga ttt att tca 576 Tyr Ala Pro Val Glu Asp Thr
Pro Ala Glu Met Ala Arg Phe Ile Ser 180 185 190 gaa ctt gaa tct aag
gaa ttc tta gca gcc gag aag gtt att caa gct 624 Glu Leu Glu Ser Lys
Glu Phe Leu Ala Ala Glu Lys Val Ile Gln Ala 195 200 205 gcc tat gcc
cac tat gct ttc gta tgt att cat cct ttt gca gat ggg 672 Ala Tyr Ala
His Tyr Ala Phe Val Cys Ile His Pro Phe Ala Asp Gly 210 215 220 aat
gga cga gtt gca cga gcc ttg gct agt gtt ttt cta tac aaa gat 720 Asn
Gly Arg Val Ala Arg Ala Leu Ala Ser Val Phe Leu Tyr Lys Asp 225 230
235 240 cct ggt gtc cct ctc gta atc tac caa gat caa cgc aga gat tac
atc 768 Pro Gly Val Pro Leu Val Ile Tyr Gln Asp Gln Arg Arg Asp Tyr
Ile 245 250 255 cat gct cta gaa gca gcg gac aag aat aac ccg ctc ctg
ctg att aga 816 His Ala Leu Glu Ala Ala Asp Lys Asn Asn Pro Leu Leu
Leu Ile Arg 260 265 270 ttc ttt gct gaa cga gtg acc gat act att aac
tct att atc gtt gat 864 Phe Phe Ala Glu Arg Val Thr Asp Thr Ile Asn
Ser Ile Ile Val Asp 275 280 285 ctc act acc ccg atc gcg ggt aaa tct
ggt tcg gct aag ctt tcg gat 912 Leu Thr Thr Pro Ile Ala Gly Lys Ser
Gly Ser Ala Lys Leu Ser Asp 290 295 300 gcg cta cgc ccc act cgc gta
tta cca gaa tta cat gat gct gca cat 960 Ala Leu Arg Pro Thr Arg Val
Leu Pro Glu Leu His Asp Ala Ala His 305 310 315 320 agg ctc caa gaa
agt tta ttt aca gaa atc cga tct cga ttg gat gaa 1008 Arg Leu Gln
Glu Ser Leu Phe Thr Glu Ile Arg Ser Arg Leu Asp Glu 325 330 335 gaa
gga aaa agg aat ggg ttg gag ttt cta ctt caa cgg att ttt atc 1056
Glu Gly Lys Arg Asn Gly Leu Glu Phe Leu Leu Gln Arg Ile Phe Ile 340
345 350 ggt tcc cca ttc aat ctg cca gag ggc tat aac gct ttc cct gat
agc 1104 Gly Ser Pro Phe Asn Leu Pro Glu Gly Tyr Asn Ala Phe Pro
Asp Ser 355 360 365 tat tgt ctg acc tta gct ttc aat agc aac tct cca
aaa caa atc ttc 1152 Tyr Cys Leu Thr Leu Ala Phe Asn Ser Asn Ser
Pro Lys Gln Ile Phe 370 375 380 cac ccg cta tcc ata gta ata gca gct
cga gat ggg aaa aga gcg agc 1200 His Pro Leu Ser Ile Val Ile Ala
Ala Arg Asp Gly Lys Arg Ala Ser 385 390 395 400 agc gac ctc gtg gca
gct act tct att gga tac aac ttt cac gct tac 1248 Ser Asp Leu Val
Ala Ala Thr Ser Ile Gly Tyr Asn Phe His Ala Tyr 405 410 415 gga cgt
gaa gtc gag cct gtt gtt act gaa agc ttt cga gaa cgt gtg 1296 Gly
Arg Glu Val Glu Pro Val Val Thr Glu Ser Phe Arg Glu Arg Val 420 425
430 aaa att tac gcc gac ggg att gta gat cac ttc tta acc gaa ctg gct
1344 Lys Ile Tyr Ala Asp Gly Ile Val Asp His Phe Leu Thr Glu Leu
Ala 435 440 445 aaa aag ttt caa cag aat taa 1365 Lys Lys Phe Gln
Gln Asn 450 4 454 PRT Corynebacterium glutamicum 4 Met Asn Asp Glu
Asn Ile Gln Ser Ser Asn Tyr Gln Pro Phe Pro Ser 1 5 10 15 Phe Asp
Asp Trp Lys Gln Ile Glu Val Ser Leu Leu Asp Val Ile Glu 20 25 30
Ser Ser Arg His Phe Ser Asp Leu Lys Asp Ser Thr Asp Arg Ser Ala 35
40 45 Leu Asp Ala Ala Leu Glu Arg Ala Lys Arg Ala Ala Ala Val Asp
Thr 50 55 60 Asn Ala Ile Glu Gly Ile Phe Gln Thr Asp Arg Gly Phe
Thr His Thr 65 70 75 80 Val Ala Thr Gln Val Gly Ala Trp Glu Gln Gln
Met Ala Met Lys Gly 85 90 95 Lys His Val Lys Pro Ala Phe Asp Asp
Thr Leu Glu Gly Phe Glu Tyr 100 105 110 Val Leu Asp Ala Val Thr Gly
Arg Thr Pro Ile Ser Gln Gln Trp Ile 115 120 125 Arg Asn Leu His Ala
Val Ile Leu Arg Ser Gln Glu Ser His Glu Val 130 135 140 Phe Thr Ala
Val Gly Val Gln Asn Gln Ala Leu Gln Lys Gly Glu Tyr 145 150 155 160
Lys Thr Gln Pro Asn Ser Pro Gln Arg Ser Asp Gly Ser Val His Ala 165
170 175 Tyr Ala Pro Val Glu Asp Thr Pro Ala Glu Met Ala Arg Phe Ile
Ser 180 185 190 Glu Leu Glu Ser Lys Glu Phe Leu Ala Ala Glu Lys Val
Ile Gln Ala 195 200 205 Ala Tyr Ala His Tyr Ala Phe Val Cys Ile His
Pro Phe Ala Asp Gly 210 215 220 Asn Gly Arg Val Ala Arg Ala Leu Ala
Ser Val Phe Leu Tyr Lys Asp 225 230 235 240 Pro Gly Val Pro Leu Val
Ile Tyr Gln Asp Gln Arg Arg Asp Tyr Ile 245 250 255 His Ala Leu Glu
Ala Ala Asp Lys Asn Asn Pro Leu Leu Leu Ile Arg 260 265 270 Phe Phe
Ala Glu Arg Val Thr Asp Thr Ile Asn Ser Ile Ile Val Asp 275 280 285
Leu Thr Thr Pro Ile Ala Gly Lys Ser Gly Ser Ala Lys Leu Ser Asp 290
295 300 Ala Leu Arg Pro Thr Arg Val Leu Pro Glu Leu His Asp Ala Ala
His 305 310 315 320 Arg Leu Gln Glu Ser Leu Phe Thr Glu Ile Arg Ser
Arg Leu Asp Glu 325 330 335 Glu Gly Lys Arg Asn Gly Leu Glu Phe Leu
Leu Gln Arg Ile Phe Ile 340 345 350 Gly Ser Pro Phe Asn Leu Pro Glu
Gly Tyr Asn Ala Phe Pro Asp Ser 355 360 365 Tyr Cys Leu Thr Leu Ala
Phe Asn Ser Asn Ser Pro Lys Gln Ile Phe 370 375 380 His Pro Leu Ser
Ile Val Ile Ala Ala Arg Asp Gly Lys Arg Ala Ser 385 390 395 400 Ser
Asp Leu Val Ala Ala Thr Ser Ile Gly Tyr Asn Phe His Ala Tyr 405 410
415 Gly Arg Glu Val Glu Pro Val Val Thr Glu Ser Phe Arg Glu Arg Val
420 425 430 Lys Ile Tyr Ala Asp Gly Ile Val Asp His Phe Leu Thr Glu
Leu Ala 435 440 445 Lys Lys Phe Gln Gln Asn 450 5 52 DNA Artificial
sequence Primer (1)..(52) Primer 5 cccgggatcc gctagcggcg cgccggccgg
cccggtgtga aataccgcac ag 52 6 53 DNA Artificial sequence Primer
(1)..(53) Primer 6 tctagactcg agcggccgcg gccggccttt aaattgaaga
cgaaagggcc tcg 53 7 47 DNA Artificial sequence Primer (1)..(47)
Primer 7 gagatctaga cccggggatc cgctagcggg ctgctaaagg aagcgga 47 8
38 DNA Artificial sequence Primer (1)..(38) Primer 8 gagaggcgcg
ccgctagcgt gggcgaagaa ctccagca 38 9 34 DNA Artificial Sequence
Primer (1)..(34) Primer 9 gagagggcgg ccgcgcaaag tcccgcttcg tgaa 34
10 34 DNA Artificial sequence Primer (1)..(34) Primer 10 gagagggcgg
ccgctcaagt cggtcaagcc acgc 34 11 140 DNA Artificial sequence Primer
(1)..(140) Primer 11 tcgaatttaa atctcgagag gcctgacgtc gggcccggta
ccacgcgtca tatgactagt 60 tcggacctag ggatatcgtc gacatcgatg
ctcttctgcg ttaattaaca attgggatcc 120 tctagacccg ggatttaaat 140 12
140 DNA Artificial sequence Primer (1)..(140) Primer 12 gatcatttaa
atcccgggtc tagaggatcc caattgttaa ttaacgcaga agagcatcga 60
tgtcgacgat atccctaggt ccgaactagt catatgacgc gtggtaccgg gcccgacgtc
120 aggcctctcg agatttaaat 140 13 5091 DNA Artificial sequence
misc_feature (15091)..() Plasmid 13 tcgatttaaa tctcgagagg
cctgacgtcg ggcccggtac cacgcgtcat atgactagtt 60 cggacctagg
gatatcgtcg acatcgatgc tcttctgcgt taattaacaa ttgggatcct 120
ctagacccgg gatttaaatc gctagcgggc tgctaaagga agcggaacac gtagaaagcc
180 agtccgcaga aacggtgctg accccggatg aatgtcagct actgggctat
ctggacaagg 240 gaaaacgcaa gcgcaaagag aaagcaggta gcttgcagtg
ggcttacatg gcgatagcta 300 gactgggcgg ttttatggac agcaagcgaa
ccggaattgc cagctggggc gccctctggt 360 aaggttggga agccctgcaa
agtaaactgg atggctttct tgccgccaag gatctgatgg 420 cgcaggggat
caagatctga tcaagagaca ggatgaggat cgtttcgcat gattgaacaa 480
gatggattgc acgcaggttc tccggccgct tgggtggaga ggctattcgg ctatgactgg
540 gcacaacaga caatcggctg ctctgatgcc gccgtgttcc ggctgtcagc
gcaggggcgc 600 ccggttcttt ttgtcaagac cgacctgtcc ggtgccctga
atgaactgca ggacgaggca 660 gcgcggctat cgtggctggc cacgacgggc
gttccttgcg cagctgtgct cgacgttgtc 720 actgaagcgg gaagggactg
gctgctattg ggcgaagtgc cggggcagga tctcctgtca 780 tctcaccttg
ctcctgccga gaaagtatcc atcatggctg atgcaatgcg gcggctgcat 840
acgcttgatc cggctacctg cccattcgac caccaagcga aacatcgcat cgagcgagca
900 cgtactcgga tggaagccgg tcttgtcgat caggatgatc tggacgaaga
gcatcagggg 960 ctcgcgccag ccgaactgtt cgccaggctc aaggcgcgca
tgcccgacgg cgaggatctc 1020 gtcgtgaccc atggcgatgc ctgcttgccg
aatatcatgg tggaaaatgg ccgcttttct 1080 ggattcatcg actgtggccg
gctgggtgtg gcggaccgct atcaggacat agcgttggct 1140 acccgtgata
ttgctgaaga gcttggcggc gaatgggctg accgcttcct cgtgctttac 1200
ggtatcgccg ctcccgattc gcagcgcatc gccttctatc gccttcttga cgagttcttc
1260 tgagcgggac tctggggttc gaaatgaccg accaagcgac gcccaacctg
ccatcacgag 1320 atttcgattc caccgccgcc ttctatgaaa ggttgggctt
cggaatcgtt ttccgggacg 1380 ccggctggat gatcctccag cgcggggatc
tcatgctgga gttcttcgcc cacgctagcg 1440 gcgcgccggc cggcccggtg
tgaaataccg cacagatgcg taaggagaaa ataccgcatc 1500 aggcgctctt
ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga 1560
gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca
1620 ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa
ggccgcgttg 1680 ctggcgtttt tccataggct ccgcccccct gacgagcatc
acaaaaatcg acgctcaagt 1740 cagaggtggc gaaacccgac aggactataa
agataccagg cgtttccccc tggaagctcc 1800 ctcgtgcgct ctcctgttcc
gaccctgccg cttaccggat acctgtccgc ctttctccct 1860 tcgggaagcg
tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc 1920
gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta
1980 tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc
actggcagca 2040 gccactggta acaggattag cagagcgagg tatgtaggcg
gtgctacaga gttcttgaag 2100 tggtggccta actacggcta cactagaagg
acagtatttg gtatctgcgc tctgctgaag 2160 ccagttacct tcggaaaaag
agttggtagc tcttgatccg gcaaacaaac caccgctggt 2220 agcggtggtt
tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa 2280
gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg
2340 attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa
ggccggccgc 2400 ggccgcgcaa agtcccgctt cgtgaaaatt ttcgtgccgc
gtgattttcc gccaaaaact 2460 ttaacgaacg ttcgttataa tggtgtcatg
accttcacga cgaagtacta aaattggccc 2520 gaatcatcag ctatggatct
ctctgatgtc gcgctggagt ccgacgcgct cgatgctgcc 2580 gtcgatttaa
aaacggtgat cggatttttc cgagctctcg atacgacgga cgcgccagca 2640
tcacgagact gggccagtgc cgcgagcgac ctagaaactc tcgtggcgga tcttgaggag
2700 ctggctgacg agctgcgtgc tcggccagcg ccaggaggac gcacagtagt
ggaggatgca 2760 atcagttgcg cctactgcgg tggcctgatt cctccccggc
ctgacccgcg aggacggcgc 2820 gcaaaatatt gctcagatgc gtgtcgtgcc
gcagccagcc gcgagcgcgc caacaaacgc 2880 cacgccgagg agctggaggc
ggctaggtcg caaatggcgc tggaagtgcg tcccccgagc 2940 gaaattttgg
ccatggtcgt cacagagctg gaagcggcag cgagaattat cgcgatcgtg 3000
gcggtgcccg caggcatgac aaacatcgta aatgccgcgt ttcgtgtgcc gtggccgccc
3060 aggacgtgtc agcgccgcca ccacctgcac cgaatcggca gcagcgtcgc
gcgtcgaaaa 3120 agcgcacagg cggcaagaag cgataagctg cacgaatacc
tgaaaaatgt tgaacgcccc 3180 gtgagcggta actcacaggg cgtcggctaa
cccccagtcc aaacctggga gaaagcgctc 3240 aaaaatgact ctagcggatt
cacgagacat tgacacaccg gcctggaaat tttccgctga 3300 tctgttcgac
acccatcccg agctcgcgct gcgatcacgt ggctggacga gcgaagaccg 3360
ccgcgaattc ctcgctcacc tgggcagaga aaatttccag ggcagcaaga cccgcgactt
3420 cgccagcgct tggatcaaag acccggacac ggagaaacac agccgaagtt
ataccgagtt 3480 ggttcaaaat cgcttgcccg gtgccagtat gttgctctga
cgcacgcgca gcacgcagcc 3540 gtgcttgtcc tggacattga tgtgccgagc
caccaggccg gcgggaaaat cgagcacgta 3600 aaccccgagg tctacgcgat
tttggagcgc tgggcacgcc tggaaaaagc gccagcttgg 3660 atcggcgtga
atccactgag cgggaaatgc cagctcatct ggctcattga tccggtgtat 3720
gccgcagcag gcatgagcag cccgaatatg cgcctgctgg ctgcaacgac cgaggaaatg
3780 acccgcgttt tcggcgctga ccaggctttt tcacataggc tgagccgtgg
ccactgcact 3840 ctccgacgat cccagccgta ccgctggcat gcccagcaca
atcgcgtgga tcgcctagct 3900 gatcttatgg aggttgctcg catgatctca
ggcacagaaa aacctaaaaa acgctatgag 3960 caggagtttt ctagcggacg
ggcacgtatc gaagcggcaa gaaaagccac tgcggaagca 4020 aaagcacttg
ccacgcttga agcaagcctg ccgagcgccg ctgaagcgtc tggagagctg 4080
atcgacggcg tccgtgtcct ctggactgct ccagggcgtg ccgcccgtga tgagacggct
4140 tttcgccacg ctttgactgt gggataccag ttaaaagcgg ctggtgagcg
cctaaaagac 4200 accaagggtc atcgagccta cgagcgtgcc tacaccgtcg
ctcaggcggt cggaggaggc 4260 cgtgagcctg atctgccgcc ggactgtgac
cgccagacgg attggccgcg acgtgtgcgc 4320 ggctacgtcg ctaaaggcca
gccagtcgtc cctgctcgtc agacagagac gcagagccag 4380 ccgaggcgaa
aagctctggc cactatggga agacgtggcg gtaaaaaggc cgcagaacgc 4440
tggaaagacc caaacagtga gtacgcccga gcacagcgag aaaaactagc taagtccagt
4500 caacgacaag ctaggaaagc taaaggaaat cgcttgacca ttgcaggttg
gtttatgact 4560 gttgagggag agactggctc gtggccgaca atcaatgaag
ctatgtctga atttagcgtg 4620 tcacgtcaga ccgtgaatag agcacttaag
gtctgcgggc attgaacttc cacgaggacg 4680 ccgaaagctt cccagtaaat
gtgccatctc gtaggcagaa aacggttccc ccgtagggtc 4740 tctctcttgg
cctcctttct aggtcgggct gattgctctt gaagctctct aggggggctc 4800
acaccatagg cagataacgt tccccaccgg ctcgcctcgt aagcgcacaa ggactgctcc
4860 caaagatctt caaagccact gccgcgactg ccttcgcgaa gccttgcccc
gcggaaattt 4920 cctccaccga gttcgtgcac acccctatgc caagcttctt
tcaccctaaa ttcgagagat 4980 tggattctta ccgtggaaat tcttcgcaaa
aatcgtcccc tgatcgccct tgcgacgttg 5040 gcgtcggtgc cgctggttgc
gcttggcttg accgacttga tcagcggccg c 5091 14 32 DNA Artificial
sequence Primer (1)..(32) Primer 14 gtgtgtcgac ttagatgtag
aactcgatgt ag 32 15 17 DNA Artificial sequence Primer (1)..(17)
Primer 15 atgcccaccc tcgcgcc 17 16 28 DNA Artificial sequence
Primer (1)..(28) Primer 16 gagaggatcc cccccacgac aatggaac 28 17 44
DNA Artificial sequence Primer (1)..(44) Primer 17 cctgaaggcg
cgagggtggg cattacgggg cgatcctcct tatg 44 18 6389 DNA Artificial
sequence misc_feature (1)..(6389) Plasmid 18 tcgatttaaa tctcgagagg
cctgacgtcg ggcccggtac cacgcgtcat atgactagtt 60 cggacctagg
gatatcgtcg acttagatgt agaactcgat gtaggtcgaa gggttgtctt 120
cgtctgggga gatgaggctg aagaagttcc tcacgatgcg atccatttgg cggctttcgg
180 tgaggaaagc atcgtggccg acaggggata cgatttttgc cattgccagt
agatttccca 240 ggtttctgga gaggtgttct tgctggtggt aggggtacaa
aatatcggta tctacgcctg 300 cgacaaggac tggaactttg atggattcga
gtgccttgtt gaggcctccg cggtcgcgac 360 caatgtcgtg
gcggttgagg gcgtcggtga gcaagacgta ggagccggcg tcgaaacgct 420
gtactagctt gtctgcttgg tagtccaagt aggattccac ggcgaagcgc tggtcgggct
480 tgcggtaggg accgagtggg ttttcgttct tttgggcttt ggtgccgaag
cgttcgtcga 540 tttctagttc gccacggtag gtgaggtggg cgatgcgtcg
ggcggcgccg agtccggtgg 600 ctgggttgca gccggattcg tagtagttgc
cttcgtgcca gtggtggtcg ttttcaatcg 660 ccttaatttg ggcggattga
atgccgattt gccaggcgct ggcgcgtgca gaaactgcaa 720 gaacagcagc
tgcgccaaca gtttctgggt acattgcggc ccactctagg gtgcgggcac 780
cacccatgga accaccaagt actgcggcga ccgtggtgat gccgagtgcg tcgaggaatt
840 gtttttcggc gtttacctga tcacgaatgg acgtggcggg gaagcgatta
ccccagaaat 900 ttccatctgg atgcatggag ccaggtccgg tggaaccgtt
gcaaccaccg atgacgttgg 960 tacagatcac gcagtaaata tcagtgttga
tggctttgcc gggaccgagc aagtcagccc 1020 accaatcggc tgcgttggaa
tctccagtga gggcgtgttc gatgagaacg acattgctgc 1080 gtccttcttt
atctacgcgg tattcacccc agcggtgata ggcgatttca gcgtttgtaa 1140
tgattgctcc ggcttcggtg gagacatcac cgatcgcttg gatttcaagt tgacctgaag
1200 gcgcgagggt gggcattacg gggcgatcct ccttatgtat ggataattaa
tgctttacaa 1260 gcttaggtta gggcacagta gccctacccg cccgtctaaa
aagtgatcgt acaggtattc 1320 agtcgattac gttgcgacac ggcgggctgg
ctgcccaaaa agcccccacg gcgatgaaat 1380 tttaaaagtc aaagttccat
tgtcgtgggg gggatcctct agacccggga tttaaatcgc 1440 tagcgggctg
ctaaaggaag cggaacacgt agaaagccag tccgcagaaa cggtgctgac 1500
cccggatgaa tgtcagctac tgggctatct ggacaaggga aaacgcaagc gcaaagagaa
1560 agcaggtagc ttgcagtggg cttacatggc gatagctaga ctgggcggtt
ttatggacag 1620 caagcgaacc ggaattgcca gctggggcgc cctctggtaa
ggttgggaag ccctgcaaag 1680 taaactggat ggctttcttg ccgccaagga
tctgatggcg caggggatca agatctgatc 1740 aagagacagg atgaggatcg
tttcgcatga ttgaacaaga tggattgcac gcaggttctc 1800 cggccgcttg
ggtggagagg ctattcggct atgactgggc acaacagaca atcggctgct 1860
ctgatgccgc cgtgttccgg ctgtcagcgc aggggcgccc ggttcttttt gtcaagaccg
1920 acctgtccgg tgccctgaat gaactgcagg acgaggcagc gcggctatcg
tggctggcca 1980 cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac
tgaagcggga agggactggc 2040 tgctattggg cgaagtgccg gggcaggatc
tcctgtcatc tcaccttgct cctgccgaga 2100 aagtatccat catggctgat
gcaatgcggc ggctgcatac gcttgatccg gctacctgcc 2160 cattcgacca
ccaagcgaaa catcgcatcg agcgagcacg tactcggatg gaagccggtc 2220
ttgtcgatca ggatgatctg gacgaagagc atcaggggct cgcgccagcc gaactgttcg
2280 ccaggctcaa ggcgcgcatg cccgacggcg aggatctcgt cgtgacccat
ggcgatgcct 2340 gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg
attcatcgac tgtggccggc 2400 tgggtgtggc ggaccgctat caggacatag
cgttggctac ccgtgatatt gctgaagagc 2460 ttggcggcga atgggctgac
cgcttcctcg tgctttacgg tatcgccgct cccgattcgc 2520 agcgcatcgc
cttctatcgc cttcttgacg agttcttctg agcgggactc tggggttcga 2580
aatgaccgac caagcgacgc ccaacctgcc atcacgagat ttcgattcca ccgccgcctt
2640 ctatgaaagg ttgggcttcg gaatcgtttt ccgggacgcc ggctggatga
tcctccagcg 2700 cggggatctc atgctggagt tcttcgccca cgctagcggc
gcgccggccg gcccggtgtg 2760 aaataccgca cagatgcgta aggagaaaat
accgcatcag gcgctcttcc gcttcctcgc 2820 tcactgactc gctgcgctcg
gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg 2880 cggtaatacg
gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag 2940
gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc
3000 gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga
aacccgacag 3060 gactataaag ataccaggcg tttccccctg gaagctccct
cgtgcgctct cctgttccga 3120 ccctgccgct taccggatac ctgtccgcct
ttctcccttc gggaagcgtg gcgctttctc 3180 atagctcacg ctgtaggtat
ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg 3240 tgcacgaacc
ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt 3300
ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca
3360 gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac
tacggctaca 3420 ctagaaggac agtatttggt atctgcgctc tgctgaagcc
agttaccttc ggaaaaagag 3480 ttggtagctc ttgatccggc aaacaaacca
ccgctggtag cggtggtttt tttgtttgca 3540 agcagcagat tacgcgcaga
aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg 3600 ggtctgacgc
tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa 3660
aaaggatctt cacctagatc cttttaaagg ccggccgcgg ccgcgcaaag tcccgcttcg
3720 tgaaaatttt cgtgccgcgt gattttccgc caaaaacttt aacgaacgtt
cgttataatg 3780 gtgtcatgac cttcacgacg aagtactaaa attggcccga
atcatcagct atggatctct 3840 ctgatgtcgc gctggagtcc gacgcgctcg
atgctgccgt cgatttaaaa acggtgatcg 3900 gatttttccg agctctcgat
acgacggacg cgccagcatc acgagactgg gccagtgccg 3960 cgagcgacct
agaaactctc gtggcggatc ttgaggagct ggctgacgag ctgcgtgctc 4020
ggccagcgcc aggaggacgc acagtagtgg aggatgcaat cagttgcgcc tactgcggtg
4080 gcctgattcc tccccggcct gacccgcgag gacggcgcgc aaaatattgc
tcagatgcgt 4140 gtcgtgccgc agccagccgc gagcgcgcca acaaacgcca
cgccgaggag ctggaggcgg 4200 ctaggtcgca aatggcgctg gaagtgcgtc
ccccgagcga aattttggcc atggtcgtca 4260 cagagctgga agcggcagcg
agaattatcg cgatcgtggc ggtgcccgca ggcatgacaa 4320 acatcgtaaa
tgccgcgttt cgtgtgccgt ggccgcccag gacgtgtcag cgccgccacc 4380
acctgcaccg aatcggcagc agcgtcgcgc gtcgaaaaag cgcacaggcg gcaagaagcg
4440 ataagctgca cgaatacctg aaaaatgttg aacgccccgt gagcggtaac
tcacagggcg 4500 tcggctaacc cccagtccaa acctgggaga aagcgctcaa
aaatgactct agcggattca 4560 cgagacattg acacaccggc ctggaaattt
tccgctgatc tgttcgacac ccatcccgag 4620 ctcgcgctgc gatcacgtgg
ctggacgagc gaagaccgcc gcgaattcct cgctcacctg 4680 ggcagagaaa
atttccaggg cagcaagacc cgcgacttcg ccagcgcttg gatcaaagac 4740
ccggacacgg agaaacacag ccgaagttat accgagttgg ttcaaaatcg cttgcccggt
4800 gccagtatgt tgctctgacg cacgcgcagc acgcagccgt gcttgtcctg
gacattgatg 4860 tgccgagcca ccaggccggc gggaaaatcg agcacgtaaa
ccccgaggtc tacgcgattt 4920 tggagcgctg ggcacgcctg gaaaaagcgc
cagcttggat cggcgtgaat ccactgagcg 4980 ggaaatgcca gctcatctgg
ctcattgatc cggtgtatgc cgcagcaggc atgagcagcc 5040 cgaatatgcg
cctgctggct gcaacgaccg aggaaatgac ccgcgttttc ggcgctgacc 5100
aggctttttc acataggctg agccgtggcc actgcactct ccgacgatcc cagccgtacc
5160 gctggcatgc ccagcacaat cgcgtggatc gcctagctga tcttatggag
gttgctcgca 5220 tgatctcagg cacagaaaaa cctaaaaaac gctatgagca
ggagttttct agcggacggg 5280 cacgtatcga agcggcaaga aaagccactg
cggaagcaaa agcacttgcc acgcttgaag 5340 caagcctgcc gagcgccgct
gaagcgtctg gagagctgat cgacggcgtc cgtgtcctct 5400 ggactgctcc
agggcgtgcc gcccgtgatg agacggcttt tcgccacgct ttgactgtgg 5460
gataccagtt aaaagcggct ggtgagcgcc taaaagacac caagggtcat cgagcctacg
5520 agcgtgccta caccgtcgct caggcggtcg gaggaggccg tgagcctgat
ctgccgccgg 5580 actgtgaccg ccagacggat tggccgcgac gtgtgcgcgg
ctacgtcgct aaaggccagc 5640 cagtcgtccc tgctcgtcag acagagacgc
agagccagcc gaggcgaaaa gctctggcca 5700 ctatgggaag acgtggcggt
aaaaaggccg cagaacgctg gaaagaccca aacagtgagt 5760 acgcccgagc
acagcgagaa aaactagcta agtccagtca acgacaagct aggaaagcta 5820
aaggaaatcg cttgaccatt gcaggttggt ttatgactgt tgagggagag actggctcgt
5880 ggccgacaat caatgaagct atgtctgaat ttagcgtgtc acgtcagacc
gtgaatagag 5940 cacttaaggt ctgcgggcat tgaacttcca cgaggacgcc
gaaagcttcc cagtaaatgt 6000 gccatctcgt aggcagaaaa cggttccccc
gtagggtctc tctcttggcc tcctttctag 6060 gtcgggctga ttgctcttga
agctctctag gggggctcac accataggca gataacgttc 6120 cccaccggct
cgcctcgtaa gcgcacaagg actgctccca aagatcttca aagccactgc 6180
cgcgactgcc ttcgcgaagc cttgccccgc ggaaatttcc tccaccgagt tcgtgcacac
6240 ccctatgcca agcttctttc accctaaatt cgagagattg gattcttacc
gtggaaattc 6300 ttcgcaaaaa tcgtcccctg atcgcccttg cgacgttggc
gtcggtgccg ctggttgcgc 6360 ttggcttgac cgacttgatc agcggccgc 6389 19
6 DNA Corynebacterium glutamicum Promoter (1)..(6) -10 region 19
ttaatt 6 20 6 DNA Corynebacterium glutamicum Promoter (1)..(6) -10
region 20 taagct 6 21 7 DNA Corynebacterium glutamicum Promoter
(1)..(7) Ribosome binding site 21 aggagga 7 22 1005 DNA
Corynebacterium glutamicum CDS (1)..(1005) 22 atg aac cta aag aac
ccc gaa acg cca gac cgt aac ctt gct atg gag 48 Met Asn Leu Lys Asn
Pro Glu Thr Pro Asp Arg Asn Leu Ala Met Glu 1 5 10 15 ctg gtg cga
gtt acg gaa gca gct gca ctg gct tct gga cgt tgg gtt 96 Leu Val Arg
Val Thr Glu Ala Ala Ala Leu Ala Ser Gly Arg Trp Val 20 25 30 gga
cgt ggc atg aag aat gaa ggc gac ggt gcc gct gtt gac gcc atg 144 Gly
Arg Gly Met Lys Asn Glu Gly Asp Gly Ala Ala Val Asp Ala Met 35 40
45 cgc cag ctc atc aac tca gtg acc atg aag ggc gtc gtt gtt atc ggc
192 Arg Gln Leu Ile Asn Ser Val Thr Met Lys Gly Val Val Val Ile Gly
50 55 60 gag ggc gaa aaa gac gaa gct cca atg ctg tac aac ggc gaa
gag gtc 240 Glu Gly Glu Lys Asp Glu Ala Pro Met Leu Tyr Asn Gly Glu
Glu Val 65 70 75 80 gga acc ggc ttt gga cct gag gtt gat atc gca gtt
gac cca gtt gac 288 Gly Thr Gly Phe Gly Pro Glu Val Asp Ile Ala Val
Asp Pro Val Asp 85 90 95 ggc acc acc ctg atg gct gag ggt cgc ccc
aac gca att tcc att ctc 336 Gly Thr Thr Leu Met Ala Glu Gly Arg Pro
Asn Ala Ile Ser Ile Leu 100 105 110 gca gct gca gag cgt ggc acc atg
tac gat cca tcc tcc gtc ttc tac 384 Ala Ala Ala Glu Arg Gly Thr Met
Tyr Asp Pro Ser Ser Val Phe Tyr 115 120 125 atg aag aag atc gcc gtg
gga cct gag gcc gca ggc aag atc gac atc 432 Met Lys Lys Ile Ala Val
Gly Pro Glu Ala Ala Gly Lys Ile Asp Ile 130 135 140 gaa gct cca gtt
gcc cac aac atc aac gcg gtg gca aag tcc aag gga 480 Glu Ala Pro Val
Ala His Asn Ile Asn Ala Val Ala Lys Ser Lys Gly 145 150 155 160 atc
aac cct tcc gac gtc acc gtt gtc gtg ctt gac cgt cct cgc cac 528 Ile
Asn Pro Ser Asp Val Thr Val Val Val Leu Asp Arg Pro Arg His 165 170
175 atc gaa ctg atc gca gac att cgt cgt gca ggc gca aag gtt cgt ctc
576 Ile Glu Leu Ile Ala Asp Ile Arg Arg Ala Gly Ala Lys Val Arg Leu
180 185 190 atc tcc gac ggc gac gtt gca ggt gca gtt gca gca gct cag
gat tcc 624 Ile Ser Asp Gly Asp Val Ala Gly Ala Val Ala Ala Ala Gln
Asp Ser 195 200 205 aac tcc gtg gac atc atg atg ggc acc ggc gga acc
cca gaa ggc atc 672 Asn Ser Val Asp Ile Met Met Gly Thr Gly Gly Thr
Pro Glu Gly Ile 210 215 220 atc act gcg tgc gcc atg aag tgc atg ggt
ggc gaa atc cag ggc atc 720 Ile Thr Ala Cys Ala Met Lys Cys Met Gly
Gly Glu Ile Gln Gly Ile 225 230 235 240 ctg gcc cca atg aac gat ttc
gag cgc cag aag gca cac gac gct ggt 768 Leu Ala Pro Met Asn Asp Phe
Glu Arg Gln Lys Ala His Asp Ala Gly 245 250 255 ctg gtt ctt gat cag
gtt ctg cac acc aac gat ctg gtg agc tcc gac 816 Leu Val Leu Asp Gln
Val Leu His Thr Asn Asp Leu Val Ser Ser Asp 260 265 270 aac tgc tac
ttc gtg gca acc ggt gtg acc aac ggt gac atg ctc cgt 864 Asn Cys Tyr
Phe Val Ala Thr Gly Val Thr Asn Gly Asp Met Leu Arg 275 280 285 ggc
gtt tcc tac cgc gca aac ggc gca acc acc cgt tcc ctg gtt atg 912 Gly
Val Ser Tyr Arg Ala Asn Gly Ala Thr Thr Arg Ser Leu Val Met 290 295
300 cgc gca aag tca ggc acc atc cgc cac atc gag tct gtc cac cag ctg
960 Arg Ala Lys Ser Gly Thr Ile Arg His Ile Glu Ser Val His Gln Leu
305 310 315 320 tcc aag ctg cag gaa tac tcc gtg gtt gac tac acc acc
gcg acc 1005 Ser Lys Leu Gln Glu Tyr Ser Val Val Asp Tyr Thr Thr
Ala Thr 325 330 335 23 335 PRT Corynebacterium glutamicum 23 Met
Asn Leu Lys Asn Pro Glu Thr Pro Asp Arg Asn Leu Ala Met Glu 1 5 10
15 Leu Val Arg Val Thr Glu Ala Ala Ala Leu Ala Ser Gly Arg Trp Val
20 25 30 Gly Arg Gly Met Lys Asn Glu Gly Asp Gly Ala Ala Val Asp
Ala Met 35 40 45 Arg Gln Leu Ile Asn Ser Val Thr Met Lys Gly Val
Val Val Ile Gly 50 55 60 Glu Gly Glu Lys Asp Glu Ala Pro Met Leu
Tyr Asn Gly Glu Glu Val 65 70 75 80 Gly Thr Gly Phe Gly Pro Glu Val
Asp Ile Ala Val Asp Pro Val Asp 85 90 95 Gly Thr Thr Leu Met Ala
Glu Gly Arg Pro Asn Ala Ile Ser Ile Leu 100 105 110 Ala Ala Ala Glu
Arg Gly Thr Met Tyr Asp Pro Ser Ser Val Phe Tyr 115 120 125 Met Lys
Lys Ile Ala Val Gly Pro Glu Ala Ala Gly Lys Ile Asp Ile 130 135 140
Glu Ala Pro Val Ala His Asn Ile Asn Ala Val Ala Lys Ser Lys Gly 145
150 155 160 Ile Asn Pro Ser Asp Val Thr Val Val Val Leu Asp Arg Pro
Arg His 165 170 175 Ile Glu Leu Ile Ala Asp Ile Arg Arg Ala Gly Ala
Lys Val Arg Leu 180 185 190 Ile Ser Asp Gly Asp Val Ala Gly Ala Val
Ala Ala Ala Gln Asp Ser 195 200 205 Asn Ser Val Asp Ile Met Met Gly
Thr Gly Gly Thr Pro Glu Gly Ile 210 215 220 Ile Thr Ala Cys Ala Met
Lys Cys Met Gly Gly Glu Ile Gln Gly Ile 225 230 235 240 Leu Ala Pro
Met Asn Asp Phe Glu Arg Gln Lys Ala His Asp Ala Gly 245 250 255 Leu
Val Leu Asp Gln Val Leu His Thr Asn Asp Leu Val Ser Ser Asp 260 265
270 Asn Cys Tyr Phe Val Ala Thr Gly Val Thr Asn Gly Asp Met Leu Arg
275 280 285 Gly Val Ser Tyr Arg Ala Asn Gly Ala Thr Thr Arg Ser Leu
Val Met 290 295 300 Arg Ala Lys Ser Gly Thr Ile Arg His Ile Glu Ser
Val His Gln Leu 305 310 315 320 Ser Lys Leu Gln Glu Tyr Ser Val Val
Asp Tyr Thr Thr Ala Thr 325 330 335
* * * * *