U.S. patent application number 11/698566 was filed with the patent office on 2007-11-15 for human pellino polypeptides.
This patent application is currently assigned to Immunex Corporation. Invention is credited to Timothy A. Bird, David J. Cosman.
Application Number | 20070264711 11/698566 |
Document ID | / |
Family ID | 22740715 |
Filed Date | 2007-11-15 |
United States Patent
Application |
20070264711 |
Kind Code |
A1 |
Bird; Timothy A. ; et
al. |
November 15, 2007 |
Human pellino polypeptides
Abstract
There are disclosed novel polypeptides referred to as Pellino
polypeptides, as well as fragments thereof, including immunogenic
peptides. DNAs encoding such polypeptides as well as methods of
using such DNAs and polypeptides are also disclosed.
Inventors: |
Bird; Timothy A.;
(Bainbridge Island, WA) ; Cosman; David J.;
(Bainbridge Island, WA) |
Correspondence
Address: |
IMMUNEX CORPORATION;LAW DEPARTMENT
1201 AMGEN COURT WEST
SEATTLE
WA
98119
US
|
Assignee: |
Immunex Corporation
Thousand Oaks
CA
|
Family ID: |
22740715 |
Appl. No.: |
11/698566 |
Filed: |
January 25, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10258703 |
Jul 29, 2003 |
7169891 |
|
|
PCT/US01/13676 |
Apr 27, 2001 |
|
|
|
11698566 |
Jan 25, 2007 |
|
|
|
60200198 |
Apr 28, 2000 |
|
|
|
Current U.S.
Class: |
435/375 ;
530/387.1; 530/387.9; 530/388.1; 530/388.15 |
Current CPC
Class: |
C07K 2319/43 20130101;
C07K 16/18 20130101; C07K 14/47 20130101; C07K 2319/23 20130101;
C07H 21/04 20130101; C07K 2319/00 20130101 |
Class at
Publication: |
435/375 ;
530/387.1; 530/387.9; 530/388.1; 530/388.15 |
International
Class: |
C07K 16/18 20060101
C07K016/18; C12N 5/06 20060101 C12N005/06 |
Claims
1. An isolated antibody that binds to a polypeptide of SEQ ID
NO:8.
2. The antibody of claim 54 wherein the antibody is a monoclonal
antibody.
3. The antibody of claim 55 wherein the antibody is a human
antibody.
4. The antibody of claim 55 wherein the antibody is a humanized
antibody.
5. An isolated antibody that inhibits the activity of a polypeptide
of SEQ ID NO:8.
6. A method for inhibiting NF-kB-dependent transcription comprising
providing at least one compound selected from the group consisting
of a polypeptide of SEQ ID NO:8 and agonists of said polypeptide.
Description
[0001] This application is a divisional of U.S. patent application
Ser. No. 10/258,703, which is a national stage application filed
pursuant to 35 U.S.C. .sctn. 371 of international application
PCT/US01/13676, filed on Apr. 27, 2001, which claims the benefit
under 35 U.S.C. .sctn. 119(e) of provisional application U.S.
60/200,198, filed Apr. 28, 2000. The entire disclosures of these
applications are relied upon and incorporated by reference
herein.
FIELD OF THE INVENTION
[0002] The invention is directed to molecules that are members of a
polypeptide family referred to as Pellino (also called Conserved
Inflammatory Signal Target (CIST)). More particularly, the present
invention includes Pellino polypeptides and fragments thereof, the
nucleic acids encoding such polypeptides, and fragments thereof,
processes for production of recombinant forms of such polypeptides,
antibodies generated against these polypeptides, transgenic and
knockout cells and animals, and uses thereof.
BACKGROUND OF THE INVENTION
[0003] The Interleukin-1 (IL-1) pathway is a cellular signaling
pathway is that plays a crucial role in the mammalian inflammatory
response. Several different receptors and ligands are involved in
this pathway, including the ligands IL-1 alpha, IL-1 beta and IL-1
receptor antagonist (IL-Ira), and two IL-1 receptors referred to as
IL-1 receptor Type I (IL-1RI) and IL-1 receptor Type II (IL-1 RII);
a soluble form of the latter also exists. Of these, it appears that
IL-1RI is the signaling receptor, whereas IL-1RII does not
transduce signal to a cell, but instead may be involved in
regulating an IL-1-mediated response (Colotta et al., Immunol.
Today 15:562; 1994). Signaling via the IL-1 pathway is complex,
requiring a number of accessory molecules in addition to IL-1RI,
including a receptor-associated kinase (IRAK). A serine/threonine
kinase with homology to IRAK, referred to as Pelle, is found in
Drosophila (for review, see Belvin and Armstrong, Annu. Rev. Cell
Dev. Biol. 12:393; 1996). Another Drosophila protein, Pellino, has
been reported to interact with Pelle (Grosshans et al., Mech. Dev.
81:127; 1999).
[0004] Dorsal-ventral polarization in Drosophila embryos depends
upon the establishment of a gradient of nuclear localization of the
Rel-like transcription factor Dorsal. The transcriptional program
mediated by Dorsal results from a signaling cascade triggered by
binding of an extracellular ligand Spaetzle to its receptor Toll.
Intermediates of this signaling cascade include the adaptor protein
Tube, the serine/threonine kinase Pelle, and Cactus, a cytosolic
binding partner of Dorsal. Signals transmitted by Toll result in
the degradation of Cactus, and thereby permit the nuclear
importation of Dorsal. The similarity between the cytosolic domains
of Toll and the mammalian interleukin-1 receptor IL1-R1 was first
noted by Gay and Keith (Gay, N., and Keith, F., 1991, Nature 351:
355-356), and the number of proteins which contain the homologous
regions, called the Toll/IL-1R (TIR) domain has subsequently been
extended to include a larger family of receptors and intracellular
signaling molecules from a variety of organisms. Those with
leucine-rich repeats in their extracellular domains are broadly
involved in innate immune responses and include at least ten
mammalian toll-like receptors (TLRs) which initiate inflammatory
responses to microbial pathogens such as peptidoglycan, bacterial
lipopeptides, bacterial lipopolysaccharides, zymosan, CpG DNA,
flagellin, lipoteichoic acids, and Respiratory Syncytial Virus
proteins; and plant proteins such as the N resistance gene product
which mediate disease resistance. Furthermore, it is now clear that
an important function of Toll signaling in adult Drosophila is in
controlling responses to fungal infections.
[0005] Downstream components of the Toll signaling pathway have
also been evolutionarily conserved in mammalian TLR and
interleukin-1 receptor signaling pathways which culminate in
nuclear translocation of the transcription factor Nuclear Factor
kappa B (NF-kB). Protein kinases IRAK-1 and IRAK2, close homologues
of Pelle, are recruited to the activated IL-1R or TLR receptor
complexes through the adaptor protein MyD88 and undergo
autophosphorylation reactions. Although MyD88 is not a strict
analog of Tube, both proteins contain a so-called death domain, and
Tube likely serves to mediate signal transmission between Toll and
Pelle, to which it binds. IRAK subsequently interacts with another
adaptor molecule TRAF-6, which is homologous to the recently
described D-TRAF. Signals downstream of TRAF appear to be
divergent, and not all of them are fully understood, but one
consequence, in mammalian cells, is the activation of the IkB
kinase (IKK) complex which directly phosphorylates the inhibitory
Cactus homolog IkB at two N-terminal serine residues causing its
ubiquitination and degradation. Released from a cytoplasmic
association with IkB, NF-kB migrates into the nucleus. Recently, a
candidate for an additional intermediate in Tube-Pelle interactions
was found by yeast two-hybrid screening with Pelle as a bait
sequence. This protein, called Pellino, was shown to interact with
catalytically-competent Pelle, but not with a mutant form of Pelle
that lacked kinase activity. Although a function for Pellino was
not addressed in this study, it was suggested that it could either
stabilize the activated form of Pelle, or mediate an interaction
with downstream Pelle substrates.
[0006] IL-1 and other pro-inflammatory cytokines have been
implicated in a variety of diseases and conditions, including
rheumatoid arthritis, multiple myeloma, osteoporosis, endotoxemia
and sepsis, osteoarthritis, inflammatory bowel disease, and
allergy. Inhibition of the signaling of IL-1 using soluble forms of
IL-1Rs, and the IL-Ira, have been shown to be useful in treating or
ameliorating disease characterized by excess levels of IL-1
(Rosenwasser, J. Allergy Clin. Immunol. 102:344; 1998). Other parts
of the IL-1 signaling pathway and other pro-inflammatory MAP
kinase-activated pathways have also been the target of attempts to
identify additional molecules that can be used therapeutically to
intervene in conditions related to IL-1 and pro-inflammatory
cytokines generally. Thus, there is a need in the art to identify
novel molecules involved in the IL-1 and MAP kinase-activated
pro-inflammatory signaling pathways, both as tools with which to
investigate cell signaling and for use in identifying inhibitors of
pro-inflammatory signaling. Of particular interest are novel
polypeptides that are involved in stimulation of multiple
pro-inflammatory signaling pathways, as inhibition of such
polypeptides would more effectively inhibit inflammatory effects
than inhibition of a pathway-specific polypeptide.
SUMMARY OF THE INVENTION
[0007] The present invention is based upon the discovery of new
murine and human Pellino polypeptides, murine Pellino-1 and -2, and
human Pellino-1, -2, and -3.
[0008] The invention provides an isolated polypeptide capable of
stimulating MAP kinase-activated signaling pathways consisting of,
consisting essentially of, or more preferably, comprising an amino
acid sequence selected from the group consisting of: [0009] (a) an
amino acid sequence selected from the group consisting of SEQ ID
NO:4, SEQ ID NO:8, and SEQ ID NO: 12; [0010] (b) an amino acid
sequence selected from the group consisting of: amino acids x1 to
x2 of SEQ ID NO:4, wherein x1 is any of amino acids 130 through 134
of SEQ ID NO:4, and x2 is any of amino acids 187 through 191 of SEQ
ID NO:4; amino acids x1 to x2 of SEQ ID NO:8, wherein x1 is any of
the amino acids 132 through 136 of SEQ ID NO:8, and x2 is any of
amino acids 189 through 193 of SEQ ID NO:8; and amino acids x1 to
x2 of SEQ ID NO:12, wherein x1 is any of the amino acids 155
through 160 of SEQ ID NO:12, and x2 is any of amino acids 212
through 217 of SEQ ID NO: 12; [0011] (c) an amino acid sequence
selected from the group consisting of: amino acids x1 to x2 of SEQ
ID NO:4, wherein x1 is any of amino acids 1 through 10 of SEQ ID
NO:4, and x2 is any of amino acids 409 through 418 of SEQ ID NO:4;
amino acids x1 to x2 of SEQ ID NO:8, wherein x1 is any of amino
acids 1 through 10 of SEQ ID NO:8, and x2 is any of amino acids 410
through 419 of SEQ ID NO:8; and amino acids x1 to x2 of SEQ ID
NO:12, wherein x1 is any of amino acids 1 through 10 of SEQ ID NO:
12, and x2 is any of amino acids 435 through 445 of SEQ ID NO: 12;
[0012] (d) an allelic variant of any of (a)-(c) above; [0013] (e) a
fragment of the amino acid sequences of any of (a)-(d) comprising
at least 20 contiguous amino acids; [0014] (f) a fragment of the
amino acid sequences of any of (a)-(d), wherein a polypeptide
consisting of said fragment is capable of stimulating
NF-kB-dependent or p38-dependent transcription; [0015] (g) a
fragment of the amino acid sequences of any of (a)-(d) comprising
RING-finger-like domain amino acid sequences; [0016] (h) an amino
acid sequence comprising at least 20 amino acids and sharing amino
acid identity with the amino acid sequences of any of (a)-(g),
wherein the percent amino acid identity is selected from the group
consisting of: at least 75%, at least 80%, at least 85%, at least
90%, at least 95%, at least 97.5%, at least 99%, and at least
99.5%; [0017] (i) an amino acid sequence of (h), wherein a
polypeptide comprising said amino acid sequence of (h) binds to an
antibody that also binds to a polypeptide comprising an amino acid
sequence of any of (a)-(g); and [0018] (j) an amino acid sequence
of (h) or (i) capable of stimulating NF-kB-dependent or
p38-dependent transcription.
[0019] Other aspects of the invention are isolated nucleic acids
encoding polypeptides of the invention, with a preferred embodiment
being an isolated nucleic acid consisting of, or more preferably,
comprising a nucleotide sequence selected from the group consisting
of: [0020] (a) SEQ ID NO:3; [0021] (b) SEQ ID NO:7; [0022] (c) SEQ
ID NO: 1; [0023] (d) an allelic variant of (a)-(c); [0024] (e) a
nucleic acid, having a length of at least 15 nucleotides, that
hybridizes under conditions of moderate stringency to the nucleic
acid of any of claims (a) through (d); [0025] (f) a nucleic acid
comprising a nucleotide sequence that shares nucleotide sequence
identity with the nucleotide sequences of the nucleic acids of any
of (a)-(e), wherein the percent nucleotide sequence identity is
selected from the group consisting of: at least 70%, at least 75%,
at least 80%, at least 85%, at least 90%, at least 95%, at least
97.5%, at least 99%, and at least 99.5%.
[0026] The invention provides an isolated polypeptide capable of
inhibiting MAP kinase activated signaling pathways consisting of,
consisting essentially of, or more preferably, comprising an amino
acid sequence selected from the group consisting of: [0027] (a) an
amino acid sequence selected from the group consisting of SEQ ID
NO:4, SEQ ID NO:8, and SEQ ID NO:12, wherein amino acids 1 through
x1 have been deleted from said sequence, and wherein x1 is any of
amino acids 50 though 98 of said sequence; [0028] (b) SEQ ID NO:4,
wherein amino acids x1 through x2 have been deleted from said
sequence, and wherein x1 is any amino acid from 99 through 178 and
x2 is any amino acid from 100 through 179; [0029] (c) SEQ ID NO:8,
wherein amino acids x1 through x2 have been deleted from said
sequence, and wherein x1 is any amino acid from 1 through 180 and
x2 is any amino acid from 2 through 181; [0030] (d) SEQ ID NO:12,
wherein amino acids x1 through x2 have been deleted from said
sequence, and wherein x1 is any amino acid from 1 through 206 and
x2 is any amino acid from 2 through 207; [0031] (e) an amino acid
sequence selected from the group consisting of SEQ ID NO:4, SEQ ID
NO:8, and SEQ ID NO: 12, wherein one or more cysteine residues of
the RING-finger-like domain have been deleted or replaced by
non-cysteine residues; [0032] (f) an allelic variant of (a)-(e);
[0033] (g) fragments of the amino acid sequences of any of (a)-(d)
and (f) comprising RING-finger-like domain amino acid sequences;
[0034] (h) a fragment of the amino acid sequences of any of
(a)-(g), wherein a polypeptide consisting of said fragment is
capable of inhibiting NF-kB-dependent or p38-dependent
transcription; [0035] (i) amino acid sequences comprising at least
20 amino acids and sharing amino acid identity with the amino acid
sequences of any of (a)-(h), wherein the percent amino acid
identity is selected from the group consisting of: at least 70%, at
least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
at least 97.5%, at least 99%, and at least 99.5%; [0036] (j) an
amino acid sequence of (i), wherein a polypeptide comprising said
amino acid sequence of (i) binds to an antibody that also binds to
a polypeptide comprising an amino acid sequence of any of (a)-(h);
and [0037] (k) an amino acid sequence of (i) or (j) capable of
inhibiting NF-kB-dependent or p38-dependent transcription.
[0038] The invention also provides an isolated genomic nucleic acid
corresponding to the nucleic acids of the invention.
[0039] Other aspects of the invention are isolated nucleic acids
encoding polypeptides of the invention, allelic variants of these
nucleic acids, and isolated nucleic acids, preferably having a
length of at least 15 nucleotides, that hybridize under conditions
of moderate stringency to the nucleic acids encoding polypeptides
of the invention. In preferred embodiments of the invention, such
nucleic acids encode a polypeptide having Pellino polypeptide
activity or Pellino dominant-negative activity, or comprise a
nucleotide sequence that shares nucleotide sequence identity with
the nucleotide sequences of the nucleic acids of the invention,
wherein the percent nucleotide sequence identity is selected from
the group consisting of: at least 70%, at least 75%, at least 80%,
at least 85%, at least 90%, at least 95%, at least 97.5%, at least
99%, and at least 99.5%.
[0040] Further provided by the invention are expression vectors and
recombinant host cells comprising at least one nucleic acid of the
invention, and preferred recombinant host cells wherein said
nucleic acid is integrated into the host cell genome.
[0041] Also provided is a process for producing a polypeptide
encoded by the nucleic acids of the invention, comprising culturing
a recombinant host cell under conditions promoting expression of
said polypeptide, wherein the recombinant host cell comprises at
least one nucleic acid of the invention. A preferred process
provided by the invention further comprises purifying said
polypeptide. In another aspect of the invention, the polypeptide
produced by said process is provided.
[0042] Further aspects of the invention are isolated antibodies
that bind to the polypeptides of the invention, preferably
monoclonal antibodies, also preferably humanized antibodies or
humanized antibodies, and preferably wherein the antibody inhibits
the activity of said polypeptides.
[0043] The invention additionally provides a method of designing an
inhibitor of the polypeptides of the invention, the method
comprising the steps of determining the three-dimensional structure
of any such polypeptide, analyzing the three-dimensional structure
for the likely binding sites of substrates, synthesizing a molecule
that incorporates a predicted reactive site, and determining the
polypeptide-inhibiting activity of the molecule.
[0044] In a further aspect of the invention, methods are provided
for identifying compounds that alter Pellino polypeptide activity
(or Pellino dominant-negative activity) comprising [0045] (a)
mixing a test compound with a polypeptide of the invention; and
[0046] (b) determining whether the test compound alters the Pellino
polypeptide activity (or Pellino dominant-negative activity) of
said polypeptide.
[0047] In another aspect of the invention, a method is provided
identifying compounds that inhibit the binding activity of Pellino
polypeptides comprising [0048] (a) mixing a test compound with a
polypeptide of the invention and a binding partner of said
polypeptide; and [0049] (b) determining whether the test compound
inhibits the binding activity of said polypeptide.
[0050] In preferred embodiments, the binding partner is an
intracellular signaling pathway molecule; more preferably, the
binding partner is selected from the group consisting of TRAF2,
TRAF6, IRAK, TRAF1, and TRAFs 3, 4, and 5.
[0051] The invention also provides methods for stimulating
NF-kB-dependent or p38-dependent transcription, or for stimulating
a cellular response to an intercellular signal molecule, comprising
providing at least one compound selected from the group consisting
of the polypeptides of the invention and agonists of said
polypeptides; with a preferred embodiment of the method further
comprising increasing said activities in a patient by administering
at least one polypeptide of the invention. Preferably, the
intercellular signal molecule is selected from the group consisting
of interleukin-1 (IL-1), TNF-alpha, IL-18, phorbol 12-myristate
13-acetate (PMA), peptidoglycan, bacterial lipopeptides, bacterial
lipopolysaccharides, zymosan, CpG DNA, flagellin, lipoteichoic
acids, and Respiratory Syncytial Virus proteins. Also preferably,
the cellular response is translocation of NF-kB to the cell
nucleus, an increase in NF-kB-dependent transcription, or an
increase in p38-dependent transcription.
[0052] Further provided by the invention is a method for inhibiting
NF-kB-dependent or p38-dependent transcription, comprising
providing at least one antagonist of the polypeptides of the
invention; with a preferred embodiment of the method further
comprising decreasing said activities in a patient by administering
at least one antagonist of the polypeptides of the invention, and
with a further preferred embodiment wherein the antagonist is an
antibody that inhibits the activity of any of said
polypeptides.
[0053] The invention additionally provides methods for preventing
or treating infection by a pathogen, or for inhibiting apoptosis,
comprising administering at least one compound selected from the
group consisting of the polypeptides of the invention and agonists
of said polypeptides; with a preferred embodiment wherein the
pathogen is selected from the group consisting of prions, viruses,
bacteria, fungi, algae, and protozoa.
[0054] In other aspects of the invention, methods are provided for
treating cancer or an inflammatory condition comprising
administering an antagonist of wild-type Pellino polypeptides of
the invention; with a preferred embodiment wherein the inflammatory
condition is selected from the group consisting of asthma,
rheumatoid arthritis, inflammatory bowel disease, Crohn's disease,
ulcerative colitis, atherosclerosis, and Alzheimer's disease.
[0055] A further embodiment of the invention provides a use for the
"dominant-negative" Pellino polypeptides of the invention in the
preparation of a medicament for treating an inflammatory condition;
with a preferred embodiment wherein the inflammatory condition is
selected from the group consisting of asthma, rheumatoid arthritis,
inflammatory bowel disease, Crohn's disease, ulcerative colitis,
atherosclerosis, and Alzheimer's disease.
[0056] Also comprehended within the scope of the instant invention
are fusion proteins comprising any of the aforementioned
polypeptides and a polypeptide selected from the group consisting
of an immunoglobulin Fc domain, a FLAG peptide, a peptide
comprising at least about 6 His residues, a leucine zipper, a GFP
peptide, a PkA peptide, a birA peptide, and a GST peptide. Nucleic
acid molecules that encode such fusion proteins are also included
within the instant invention, as are recombinant expression vectors
comprising any of the aforementioned DNAs, host cells transformed
or transfected with such expression vectors, and processes for
preparing polypeptides, comprising culturing such host cells under
conditions promoting expression, and recovering the polypeptides.
The invention further provides transgenic or knockout animals
generated by using the inventive DNAs. The invention further
provides antibodies that specifically binds the inventive
polypeptides, including monoclonal antibodies and human antibodies.
Assays for identification of small molecules that regulate IL-1
signaling, utilizing an inventive peptide, are also provided.
DETAILED DESCRIPTION OF THE INVENTION
[0057] We have identified murine and human Pellino-1 and -2, and
human Pellino-3, new Pellino polypeptides having structural
features characteristic of the Pellino polypeptide family. By
expression of one of these mammalian Pellino isoforms in COS cells,
murine Pellino-1, we show that various inducers of NF-kB
specifically cause Pellino-1 to be proteolytically processed into
an insoluble form. Furthermore, we demonstrate that expression of
Pellino polypeptides such as Pellino-1 and Pellino-2 strongly
activates NF-kB-dependent reporter genes and augments Jun
N-terminal kinase, p38 kinase, and ERK signaling mediated by IL-1,
and that mutant forms of Pellino, lacking conserved motifs,
suppress basal and cytokine-induced NF-kB activation, and also
p38-dependent transcription. The molecules of this invention have
utility as, or lead to, anti-inflammatory therapies. The discovery
of the polynucleotides of the invention enables the construction of
expression vectors comprising DNA that encodes polypeptides; host
cells transfected or transformed with the expression vectors;
development of transgenic and knockout cells and animals; isolated
and purified polypeptides and fragments thereof; the use of the
polynucleotides thereof as probes or primers to identify DNA
encoding proteins having Pellino activity, the use of
single-stranded sense or antisense oligonucleotides from the
nucleic acids to inhibit expression and/or function of
polynucleotide encoded by the Pellino genes; the use of such
polynucleotides or polypeptides to identify small molecule
inhibitors of protein association or function of Pellino; the use
of such polynucleotides or polypeptides to identify other molecules
involved in IL-1 signaling; the use of such polypeptides and
fragments thereof to generate antibodies; and the use of such
antibodies to purify the Pellino polypeptide.
[0058] The amino acid sequences of murine and human Pellino-1,
murine and human Pellino-2, and human Pellino-3 polypeptide are
provided in SEQ ID NOs 2, 4, 6, 8, and 12, respectively, and an
alignment showing the sequence similarities between murine and
human Pellino-1 and -2, human Pellino-3, and other Pellino
polypeptides is presented in Table 1 in Example 1 below. The
Pellino polypeptide family is remarkably well conserved, with the
human family members highly similar to each other, and extremely
similar to homologous Pellino family members from other species
such as Mus musculus.
[0059] Typical structural elements common to members of the Pellino
polypeptide family include a particularly well-conserved central
domain, extending from amino acid 132 through amino acid 193 in
Pellino-1 (SEQ ID NOs 2 and 4; which corresponds to amino acids 134
through 195 in SEQ ID NO:8 and amino acids 158 through 219 in SEQ
ID NO: 12); an absolutely conserved motif from residue 245 through
residue 254 of SEQ ID NOs 2 and 4 (which corresponds to amino acids
247 through 256 in SEQ ID NO:8 and amino acids 271 through 280 in
SEQ ID NO:12); and a domain ("the RING-finger-like domain"),
similar to the C3HC4 RING-finger subfamily of Zinc-finger domains,
from amino acid 333 through amino acid 398 of SEQ ID NOs 2 and 4
(which corresponds to amino acids 335 through 400 in SEQ ID NO:8
and amino acids 360 through 425 in SEQ ID NO:12). There are certain
key cysteine residues within the RING-finger-like domain, such that
substitutions of those residues are likely be associated with an
altered function or lack of that function for Pellino polypeptides.
The conserved cysteine residues within the Pellino polypeptides are
located at positions 333, 336, 367, 371, 395, and 398 of SEQ ID NOs
2 and 4 (and at positions 335, 338, 369, 373, 397, and 400 of SEQ
ID NO:8 and the corresponding positions in SEQ ID NO:6, and at
positions 360, 363, 394, 398, 422, and 425 of SEQ ID NO:12). The
skilled artisan will recognize that the boundaries of the regions
of murine and human Pellino-1 and -2, and human Pellino-3
polypeptides described above are approximate and that the precise
boundaries of such domains can also differ from member to member
within the Pellino polypeptide family. However, it is clear from
the above and from Table 1 that murine and human Pellino-1 and -2
and human Pellino-3 polypeptides each have an overall structure
consistent with each other and with other Pellino polypeptides.
[0060] Biological activities or functions associated with murine
and human Pellino-1 and -2, and human Pellino-3 polypeptides,
include stimulation of MAP kinase-activated signaling pathways,
such as pro-inflammatory signaling pathways, and in particular
stimulation of transcription from downstream promoters such as
NF-kB- and p38-dependent promoters. The ability of murine and human
Pellino-1 and -2 and human Pellino-3 polypeptides to stimulate MAP
kinase-activated signaling pathways is associated with many domains
of the Pellino polypeptides (such as the N-terminal, central
conserved domain, the RING-finger-like domain, and the C-terminal
domain) or with the polypeptides in their entirety, as deletions of
N- or C-terminal domains and certain modifications of key residues
within murine Pellino-1 have been shown either to abolish this
stimulatory activity, or to generate "dominant negative" Pellino-1
mutants which inhibit MAP kinase-activated signaling pathways. The
ability of murine and human Pellino-1 and -2 and human Pellino-3
polypeptides to stimulate MAP kinase-activated signaling pathways
can be determined, for example, in an assay that measures the
transcription of reporter genes, such as the luciferase coding
sequence or the chloramphenicol acetyltransferase (CAT) coding
sequence, from downstream promoters, cush as the NF-kB-dependent
IL-8 promoter or the p38-dependent CHOP promoter. Pellino
polypeptides that stimulate MAP kinase-activated signaling pathways
preferably have at least 10% (more preferably, at least 25%, and
most preferably, at least 50%) of this stimulatory activity as
compared to that of murine Pellino-1 measured in the
NF-kB-dependent IL-8 promoter-luciferase reporter gene assays of
Example 2.
[0061] Murine and human Pellino-1 and -2, and human Pellino-3
polypeptides, are also substrates for proteases, such as
chymotrypsin-like serine proteases, and demonstrate a change in
solubility in response to stimulation of cells by stimulatory
molecules such as TNF-alpha and PMA. The protease-substrate
activity is associated with the central domain of murine and human
Pellino-1 and -2 and human Pellino-3 polypeptides, this central
domain comprising residues 154 and 165 of SEQ ID NO:2 (or the
corresponding residues of other Pellino polypeptides),
substitutions to which have been shown to reduce the cleavage of
Pellino-1. Thus, for uses requiring Pellino protease-substrate
activity, preferred murine and human Pellino-1 and -2 and human
Pellino-3 polypeptides include those comprising residues 154 and
165 of SEQ ID NO:2 (or the corresponding residues of other Pellino
polypeptides) or having the conserved central domain, and
exhibiting proteolytic cleavage in response to appropriate cell
stimuli, such as treatment with TNF-alpha or PMA. Preferred murine
and human Pellino-1 and -2 and human Pellino-3 polypeptides further
include oligomers or fusion polypeptides comprising at least one
conserved central domain of one or more murine and human Pellino-1
and -2 and human Pellino-3 polypeptides, and fragments of any of
these polypeptides, exhibiting proteolytic cleavage in response to
appropriate cell stimuli, such as treatment with TNF-alpha or PMA.
The protease-substrate activity of murine and human Pellino-1 and
-2 and human Pellino-3 polypeptides can be determined, for example,
in an assay that measures the extent of Pellino polypeptide
cleavage as described in Examples 3 and 4 below. Pellino
polypeptides having protease-substrate activity preferably have at
least 10% (more preferably, at least 25%, and most preferably, at
least 50%) of the protease-substrate activity of murine
Pellino-1-FLAG as measured in the assays of Examples 3 and 4.
[0062] Biological activities or functions associated with certain
mutant or altered forms of murine and human Pellino-1 and -2, and
human Pellino-3 polypeptides, include inhibition of MAP
kinase-activated signaling pathways, such as pro-inflammatory
signaling pathways, and in particular inhibition of transcription
from downstream promoters such as NF-kB- and p38-dependent
promoters. The ability of these mutant murine and human Pellino-1
and -2 and human Pellino-3 polypeptides to inhibit MAP
kinase-activated signaling pathways is associated with alterations
to certain domains of the Pellino polypeptides such as the
N-terminal region, central conserved domain, and the
RING-finger-like domain, as deletions of 50 or 99 N-terminal amino
acids and certain modifications to the central conserved domain or
the RING-finger-like domain within murine Pellino-1 have been shown
to generate "dominant negative" Pellino-1 mutants which inhibit MAP
kinase-activated signaling pathways (see Example 2, below). The
ability of altered murine and human Pellino-1 and -2 and human
Pellino-3 polypeptides to inhibit MAP kinase-activated signaling
pathways can be determined, for example, in an assay that measures
the transcription of reporter genes, such as the luciferase coding
sequence or the chloramphenicol acetyltransferase (CAT) coding
sequence, from downstream promoters, such as the NF-kB-dependent
IL-8 promoter or the p38-dependent CHOP promoter. Pellino
polypeptides that inhibit MAP kinase-activated signaling pathways
preferably have at least 10% (more preferably, at least 25%, and
most preferably, at least 50%) of this inhibitory activity as
compared to that of the murine Pellino-1-FLAG "d133-156-FLAG"
mutant as measured in the NF-kB-dependent IL-8 promoter-luciferase
reporter gene assays of Example 2.
[0063] The term "Pellino polypeptide activity," as used herein,
includes any one or more of the following: stimulation of MAP
kinase-activated signaling pathways, protease-substrate activity,
and host defensive activity against pathogens, as well as the ex
vivo and in vivo activities of wild type Pellino polypeptides. The
term "Pellino polypeptide dominant-negative activity," as used
herein, includes inhibition of MAP kinase-activated signaling
pathways, anti-inflammatory activity, and the ability to sequester
binding partners in the insoluble cell fraction, as well as the ex
vivo and in vivo activities of mutant Pellino polypeptides that
demonstrate such inhibitory activities in reporter gene assays. The
degree to which individual members of the Pellino polypeptide
family and fragments and other derivatives of these polypeptides
exhibit these activities can be determined by standard assay
methods, particularly assays such as those described in Examples 2,
3, and 4 below. Exemplary assays are disclosed herein; those of
skill in the art will appreciate that other, similar types of
assays can be used to measure Pellino polypeptide biological
activities.
[0064] Another aspect of the biological activity of Pellino
polypeptides is their ability to interact with particular
intracellular signaling pathway molecules such as TRAF2, TRAF6,
IRAK, TRAF1, and TRAFs 3, 4, and 5, with the RING-finger-like
domain of Pellino polypeptides likely involved in binding to such
binding partners. The conserved central domain of Pellino
polypeptides interacts with a chymotrypsin-like serine protease
that cleaves Pellino polypeptides, and the N-terminal portion of
Pellino polypeptides is believed to bind a factor involved in
localizing Pellino peptides in, or transporting them to, the
portion of the cellular environment that becomes the soluble
fraction upon cell lysis. Thus, when the N-terminal portion of
Pellino-1 is deleted, this Pellino polypeptide becomes
constitutively localized in the insoluble fraction, but is still be
able to inhibit MAP kinase-activated signaling pathways, likely by
binding signaling pathway polypeptides via its RING-finger-like
domain. The term "binding partner," as used herein, includes
ligands, receptors, substrates, antibodies, other Pellino
polypeptides, the same Pellino polypeptide (in the case of
homotypic interactions), and any other molecule that interacts with
a Pellino polypeptide through contact or proximity between
particular portions of the binding partner and the Pellino
polypeptide. Because the RING-finger-like domain of Pellino
polypeptides is believed to bind to a signaling pathway binding
partner, the RING-finger-like domain when expressed as a separate
fragment from the rest of a Pellino polypeptide, but with enough of
the N-terminal domain to allow the Pellino polypeptide to localize
to the insoluble fraction, is expected to disrupt the binding of
wild-type Pellino polypeptides to their binding partners.
Particularly suitable assays to detect or measure the binding
between Pellino polypeptides and their binding partners include the
bioluminescence resonance energy transfer (BRET), which uses a
bioluminescent luciferase that is genetically fused to one
candidate protein, such as a Pellino polypeptide, and a green
fluorescent protein mutant fused to another protein of interest,
such as TRAF2, IRAK, TRAF6, or other potential binding partners.
Interactions between the two fusion proteins can bring the
luciferase and green fluorescent protein close enough for resonance
energy transfer to occur, thus changing the color of the
bioluminescent emission. Most preferably, the partner-binding
activities of Pellino polypeptides can be determined using
protein-fragment complementation assays, as described in Remy and
Michnick, 1999, Proc Natl Acad Sci USA 96: 5394-5399 and in WO
01/00866.
[0065] Pellino polypeptides such as murine and human Pellino-1 and
-2 and human Pellino-3 polypeptides with the ability to stimulate
MAP kinase-activated pathways are believed to play a role in
protection of the host against viral, bacterial, fungal, and other
types of pathogens (innate immune responses). In addition, Pellino
polypeptides are involved in immune and/or inflammatory diseases or
conditions, that share as a common feature stimulation of MAP
kinase-activated pathways and NF-kB- and/or p38-dependent
transcription in their etiology. The therapeutic effect of
stimulation of MAP kinase-activated pathways, for example by
administration of a Pellino polypeptide with wild-type activity, or
fragments or fusion polypeptides with wild-type activity, or
agonists thereof, is shown by the following examples of conditions
in which the stimulation of NF-kB-dependent transcription is
beneficial (Yamamoto and Gaynor, 2001, J Clin Invest 107: 135-142).
The NF-kB pathway modulates B-lymphocyte survival,
mitogen-dependent cell proliferation, and isotype switching, which
lead to the differentiation of B lymphocytes into plasma cells. In
addition, NF-kB regulates IL-2 production, which increases the
proliferation and differentiation of T lymphocytes, and increases
the development of Th1-type helper T cells, promoting cell-mediated
immunity. Thus, activation of NF-kB leads to the induction of
multiple genes that regulate the immune response. The NF-kB pathway
is also a key mediator of genes involved in the control of the
cellular proliferation and apoptosis. Antiapoptotic genes that are
directly activated by NF-kB include the cellular inhibitors of
apoptosis (c-IAP1, c-IAP2, and IXAP), the TNF receptor-associated
factors (TRAF1 and TRAF2), the Bcl-2 homologue A1/Bfl-1, and
IEX-IL. These antiapoptotic proteins block the activation of
caspase-8, an initiator protease, involved at an early step in
stimulating the apoptotic pathway, and induction of A1/Bfl-1
expression by NF-kB prevents cytochrome c release from mitochondria
and activation of caspase-3. By increasing the expression of
antiapoptotic cellular proteins, NF-kB activation can thus reduce
apoptosis in response to treatment with different chemotherapeutic
agents. In addition, NF-kB is involved in protecting cells from
undergoing apoptosis in response to DNA damage or cytokine
treatment.
[0066] The therapeutic effect of inhibition of MAP kinase-activated
pathways, for example by administration of a Pellino polypeptide
with "dominant-negative" inhibitory activity, or fragments or
fusion polypeptides thereof having "dominant-negative" inhibitory
activity, or other antagonists of Pellino polypeptides having
wild-type activity, is shown by the following examples of
conditions in which the inhibition of NF-kB-dependent transcription
is beneficial (Yamamoto and Gaynor, 2001, J Clin Invest 107:
135-142). NF-kB regulates host inflammatory responses by increasing
the expression of specific cellular genes, including genes encoding
at least 27 different cytokines and chemokines. Cytokines that are
stimulated by NF-kB, such as IL-1beta and TNF-alpha, can also
directly activate the NF-kB pathway, thus establishing a positive
autoregulatory loop that can amplify the inflammatory response and
increase the duration of chronic inflammation. NF-kB also
stimulates the expression of enzymes whose products contribute to
the pathogenesis of the inflammatory process, including the
inducible form of nitric oxide synthase (iNOS), which generates
nitric oxide (NO), and the inducible cyclooxygenase (COX-2), which
generates prostanoids. Activation of the NF-kB pathway is involved
in the pathogenesis of chronic inflammatory diseases, such as
asthma, rheumatoid arthritis, and inflammatory bowel disease, and
other diseases in which inflammation plays a role, such as
atherosclerosis and Alzheimer's disease. Several lines of evidence
suggest that NF-kB activation of cytokine genes is an important
contributor to the pathogenesis of asthma, which is characterized
by the infiltration of inflammatory cells and the dysregulation of
many cytokines and chemokines in the lung. Cytokines, such as
TNF-alpha, that activate NF-kB are elevated in the synovial fluid
of patients with rheumatoid arthritis and contribute to the chronic
inflammatory changes and synovial hyperplasia seen in the joints of
these patients. Increases in the production of proinflammatory
cytokines by both lymphocytes and macrophages has also been
implicated in the pathogenesis of inflammatory bowel diseases,
including Crohn's disease and ulcerative colitis. NF-kB activation
is seen in mucosal biopsy specimens from patients with active
Crohn's disease and ulcerative colitis. Treatment of patients with
inflammatory bowel diseases with steroids decreases NF-kB activity
in biopsy specimens and reduces clinical symptoms. These results
suggest that stimulation of the NF-kB pathway may be involved in
the enhanced inflammatory response associated with these diseases.
Atherosclerosis is triggered by numerous insults to the endothelium
and smooth muscle of the damaged vessel wall. A large number of
growth factors, cytokines, and chemokines released from endothelial
cells, smooth muscle, macrophages, and lymphocytes are involved in
this chronic inflammatory and fibroproliferative process.
Regulation of genes involved in the inflammatory response and in
the control of cellular proliferation by NF-kB likely plays an
important role in the initiation and progression of
atherosclerosis. Abnormalities in the regulation of the NF-kB
pathway may be involved in the pathogenesis of Alzheimer's disease.
For example, NF-kB immunoreactivity is found predominantly in and
around early neuritic plaque types in Alzheimer's disease, whereas
mature plaque types show vastly reduced NF-kB activity. Thus, NF-kB
activation may be involved in the initiation of neuritic plaques
and neuronal apoptosis during the early phases of Alzheimer's
disease. Other conditions in which inflammation plays a role and
which are expected to be ameliorated by decreases in MAP
kinase-activated pro-inflammatory signaling pathways include
osteoporosis, stroke, multiple sclerosis, and multiple myeloma.
Additional examples of diseases involving inflammation and/or
inflammatory cellular responses are described U.S. Pat. No.
6,204,261 at column 206, line 25, through column 207, line 44; this
material from U.S. Pat. No. 6,204,261 is incorporated by reference
herein. In addition to a role in the pathogenesis of diseases
characterized by increases in the host inflammatory response,
constitutive activation of the NF-kB pathway has also been
implicated in the pathogenesis of some human cancers. Abnormalities
in the regulation of the NF-kB pathway are frequently seen in a
variety of human malignancies including leukemias, lymphomas, and
solid tumors. These abnormalities result in constitutively high
levels of NF-kB in the nucleus of a variety of tumors including
breast, ovarian, prostate, and colon cancers. The majority of these
changes are likely due to alterations in regulatory proteins that
activate signaling pathways that lead to activation of the NF-kB
pathway. Preventing, blocking, and/or inhibiting the interactions
between Pellino polypeptides and their binding partners is an
aspect of the invention and provides methods for treating or
ameliorating these diseases and conditions through the use of
inhibitors of wild-type Pellino activities such as stimulation of
NF-kB-dependent transcription.
Polynucleotide Molecules
[0067] In a particular embodiment, the invention relates to certain
isolated polynucleotide molecules that are free from contaminating
endogenous material. "Polynucleotide molecule" refers to
polynucleotide molecules in the form of separate fragments or as a
component of larger polynucleotide constructs. The polynucleotide
molecules have preferably been derived from DNA or RNA isolated at
least once in substantially pure form and in a quantity or
concentration enabling identification, manipulation, and recovery
of its component nucleotide sequences by standard biochemical
methods (such as those outlined in Sambrook et al., Molecular
Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y. (1989)). Such sequences are
preferably provided and/or constructed in the form of an open
reading frame uninterrupted by internal non-translated sequences,
or introns, that are typically present in eukaryotic genes.
Sequences of non-translated DNA can be present 5' or 3' from an
open reading frame, where the same do not interfere with
manipulation or expression of the coding region.
[0068] Polynucleotide molecules of the invention include DNA in
both single-stranded and double-stranded form, as well as the
corresponding complementary sequences. DNA includes, for example,
cDNA, genomic DNA, chemically synthesized DNA, DNA amplified by
PCR, and combinations thereof. Genomic DNA may be isolated by
conventional techniques, e.g., using the cDNA of SEQ ID NOs:1, 3,
5, or 7, or a suitable fragment thereof, as a probe. The DNA
molecules of the invention include DNAs encoding full length
Pellino polypeptides as well as polynucleotides and fragments
thereof. The polynucleotides of the invention are preferentially
derived from human sources, but the invention includes those
derived from non-human species, as well.
[0069] The present invention encompasses murine Pellino-1 DNA
having the polynucleotide sequence of SEQ ID NO:1 and the
polypeptide encoded by the DNA of SEQ ID NO:1 having the amino acid
sequence of SEQ ID NO:2. The polypeptide having amino acids 132
through 189 of SEQ ID NO:2 is a target site for protease action for
a member of the chymotrypsin family of proteases. The present
invention further encompasses human Pellino-1 DNA having the
polynucleotide sequence of SEQ ID NO:3 and the polypeptide encoded
by the DNA of SEQ ID NO:3 having the amino acid sequence of SEQ ID
NO:4. A specific protease target site is also found in this
polypeptide, corresponding to amino acids 132 through 189 of SEQ ID
NO:4. Further encompassed by the present invention is the DNA of
murine Pellino-2 and having the polynucleotide sequence of SEQ ID
NO:5, and polypeptide encoded by SEQ ID NO:5 shown in SEQ ID NO:6.
The protease target site is located between amino acids 133 and 190
of murine Pellino-2. Similarly, the protease target site of human
Pellino-2 is likely to be between amino acids 134 and 191 of SEQ ID
NO:8. The above described protease target sequences of SEQ ID NO:2,
SEQ ID NO:4, and SEQ ID NO:6 may vary by one or more amino acids.
Thus, the amino terminus of the protease target region for SEQ ID
NO:2 and SEQ ID NO:4 may occur from amino acid 130 through 134 and
the carboxy terminus of the target region from amino acid 187
through 191. Similarly, for SEQ ID NO:6, the amino terminus of the
protease target region occurs from amino acid 131 through amino
acid 135 (amino acids 132 through 136 of SEQ ID NO:8) and the
carboxy terminus from amino acid 188 through 192 (amino acids 189
through 193 of SEQ ID NO:8).
[0070] Due to the known degeneracy of the genetic code, wherein
more than one codon can encode the same amino acid, a DNA can vary
from that shown in SEQ ID NO:1, and still encode a polypeptide
having the amino acid sequence of SEQ ID NO:2. Such variant DNAs
can result from silent mutations that occur naturally, or during
PCR amplification, or they can be the product of deliberate
mutagenesis of a native sequence. The same is true for the DNAs
depicted in SEQ ID NOs: 3, 5 and 7.
[0071] The invention thus provides isolated DNAs encoding
polypeptides of the invention, selected from: (a) a DNA comprising
the nucleotide sequence of SEQ ID NO:1; (b) a DNA comprising the
nucleotide sequence of SEQ ID NO:3; (c) a DNA comprising the
nucleotide sequence of SEQ ID NO:5; (d) a DNA encoding the
polypeptides encoded by the DNA of (a), (b) or (c); (e) a DNA
capable of hybridization to the DNA of (a), (b) or (c) under
conditions of moderate stringency and which encodes a polypeptide
of the invention; (f) a DNA capable of hybridization to the DNA of
(a), (b), or (c) under conditions of high stringency and which
encodes a polypeptide of the invention, and (g) a DNA which is
degenerate as a result of the genetic code to a DNA defined in (a),
(b), (c), (d), (e), or (f) and which encodes a polypeptide of the
invention.
[0072] The basic parameters affecting the choice of hybridization
conditions and guidance for devising suitable conditions are set
forth by Sambrook et al., 1989. As used herein, conditions of
moderate stringency can be readily determined by those having
ordinary skill in the art based on, for example, the length and/or
base composition of the DNA. For hybridizing probes longer than
about 100 nucleotides with filter-bound target DNA or RNA, one way
of achieving moderately stringent conditions involves the use of a
prewashing solution containing 5.times.SSC, 0.5% SDS, 1.0 mM EDTA
(pH 8.0), hybridization buffer of about 50% formamide, 6.times.SSC,
and a hybridization temperature of about 42.degree. C. (or other
similar hybridization solutions, such as one containing about 50%
formamide, with a hybridization temperature of about 42.degree.
C.), and washing conditions of about 60.degree. C., in
0.5.times.SSC, 0.1% SDS. Conditions of high stringency can also be
readily determined by the skilled artisan based on, for example,
the length and base composition of the DNA. Generally, such
conditions are defined as hybridization conditions as above, but
with washing at approximately 68.degree. C., 0.2.times.SSC, 0.1%
SDS. It should be understood that the wash temperature and wash
salt concentration can be adjusted as necessary to achieve a
desired degree of stringency by applying the basic principles that
govern hybridization reactions and duplex stability, as known to
those skilled in the art (see, e.g., Sambrook et al., 1989). It
should be further understood that hybridization conditions for
oligonucleotide probes of defined length and sequence can be
designed by applying formulae known in the art (e.g., see Sambrook
et al., 1989, at 11.4511.47).
[0073] Also included as an embodiment of the invention is DNA
encoding polypeptide fragments that have at least one activity of
Pellino polypeptides, and DNA encoding polypeptides of at least
about 16 amino acids, or of at least about 32 amino acids, which
polypeptides are useful as immunogens. DNAs encoding polypeptides
comprising inactivated N-glycosylation site(s), inactivated
protease processing site(s), or conservative amino acid
substitution(s), are also included, as described below. For
example, the IL-1R-homologous domain may be useful as a dominant
negative regulator of IL-1R signaling, or in an assay to identify
small molecules that can inhibit or otherwise regulate IL-1
signaling.
[0074] In another embodiment, the DNA molecules of the invention
also comprise polynucleotides that are at least 80% identical to a
native sequence, and polynucleotide molecules that are at least 85%
identical to a native molecule. Also contemplated are embodiments
in which a DNA molecule is at least 90% identical, at least 95%
identical, at least 98% identical, at least 99% identical, or at
least 99.9% identical to a native sequence. Percent identity is
defined as the number of aligned symbols, i.e. nucleotides or amino
acids, which are identical, divided by the total number of symbols
in the shorter of the two sequences. The degree of homology
(percent identity) between two sequences may be determined by using
the alignment method of Needleman and Wunsch (J. Mol. Biol. 48:443,
1970) as revised by Smith and Waterman (Adv. Appl. Math 2:482,
1981), with a unary comparison matrix (containing a value of 1 for
identities and 0 for nonidentities) for nucleotides, and the
weighted comparison matrix of Gribskov and Burgess (Nucl. Acids.
Res. 14:6745, 1986) as described by Schwartz and Dayhoff (Atlas of
Protein Sequence and Structure, National Biomedical Research
Foundation, pp. 353-358, 1979) for amino acids. Preferably, the
comparison is done using a computer program. An exemplary,
preferred computer program is the Genetics Computer Group (GCG;
Madison, Wis.) Wisconsin package version 10.0 program, `GAP.` The
preferred default parameters for the `GAP` program includes: (1)
The GCG implementation of the previously stated comparison matrixes
for nucleotides and amino acids; (2) a penalty of 30 for each gap
and an additional penalty of 1 for each symbol in each gap for
amino acid sequences, or penalty of 50 for each gap and an
additional penalty of 3 for each symbol in each gap for nucleotide
sequences; (3) no penalty for end gaps; and (4) no maximum penalty
for long gaps. Other programs used by one skilled in the art of
sequence comparison may also be used.
[0075] Similarly, the DNAs of the invention include variants that
differ from a native DNA sequence because of one or more deletions,
insertions or substitutions, but that encode a biologically active
polypeptide. In addition, DNAs that encode various additions or
substitutions of amino acid residues or sequences, or deletions of
terminal or internal residues or sequences are encompassed by the
invention.
[0076] Examples of such DNAs include those that have been modified
to facilitate expression of a polypeptide with an altered N-linked
glycosylation site or KEX-2 protease site, as well as those in
which codons that encode Cys residues that are not necessary for
biological activity are eliminated or altered to encode another
amino acid. These and other variant peptides are disclosed herein;
DNAs encoding them are also encompassed by the invention.
[0077] The invention also provides isolated DNAs useful in the
production of polypeptides. Such polypeptides may be prepared by
any of a number of conventional techniques. A DNA sequence encoding
a Pellino polypeptide, or desired fragment thereof may be subcloned
into an expression vector for production of the polypeptide or
fragment. The DNA sequence advantageously is fused to a sequence
encoding a suitable leader or signal peptide.
[0078] The desired DNA fragment may be chemically synthesized using
known techniques. DNA fragments also may be produced by restriction
endonuclease digestion of a full length cloned DNA sequence, and
isolated by electrophoresis on agarose gels. If necessary,
oligonucleotides that reconstruct the 5' or 3' terminus to a
desired point may be ligated to a DNA fragment generated by
restriction enzyme digestion. Such oligonucleotides may
additionally contain a restriction endonuclease cleavage site
upstream of the desired coding sequence, and position an initiation
codon (ATG) at the N-terminus of the coding sequence.
[0079] The well-known polymerase chain reaction (PCR) procedure
also may be employed to isolate and amplify a DNA encoding a
desired protein or fragment thereof. Oligonucleotides that define
the desired termini of the DNA fragment are employed as 5' and 3'
primers. The oligonucleotides may additionally contain recognition
sites for restriction endonucleases, to facilitate insertion of the
amplified DNA fragment into an expression vector. PCR techniques
are described in Saiki et al., Science 239:487 (1988); Recombinant
DNA Methodology, Wu et al., eds., Academic Press, Inc., San Diego
(1989), pp. 189-196; and PCR Protocols: A Guide to Methods and
Applications, Innis et al., eds., Academic Press, Inc. (1990).
[0080] The present invention also provides genes corresponding to
the nucleic acid sequences disclosed herein. "Corresponding genes"
or "corresponding genomic nucleic acids" are the regions of the
genome that are transcribed to produce the mRNAs from which cDNA
nucleic acid sequences are derived and can include contiguous
regions of the genome necessary for the regulated expression of
such genes. Corresponding genes can therefore include but are not
limited to coding sequences, 5' and 3' untranslated regions,
alternatively spliced exons, introns, promoters, enhancers, and
silencer or suppressor elements. Corresponding genomic nucleic
acids can include 10000 basepairs (more preferably, 5000 basepairs,
still more preferably, 2500 basepairs, and most preferably, 1000
basepairs) of genomic nucleic acid sequence upstream of the first
nucleotide of the genomic sequence corresponding to the initiation
codon of the Pellino polypeptide coding sequence, and 10000
basepairs (more preferably, 5000 basepairs, still more preferably,
2500 basepairs, and most preferably, 1000 basepairs) of genomic
nucleic acid sequence downstream of the last nucleotide of the
genomic sequence corresponding to the termination codon of the
Pellino polypeptide coding sequence. The corresponding genes or
genomic nucleic acids can be isolated in accordance with known
methods using the sequence information disclosed herein. Such
methods include the preparation of probes or primers from the
disclosed sequence information for identification and/or
amplification of genes in appropriate genomic libraries or other
sources of genomic materials. An "isolated gene" or "an isolated
genomic nucleic acid" is a genomic nucleic acid that has been
separated from the adjacent genomic sequences present in the genome
of the organism from which the genomic nucleic acid was
isolated.
Polypeptides and Fragments Thereof
[0081] The invention encompasses polypeptides and fragments thereof
in various forms, including those that are naturally occurring or
produced through various techniques such as procedures involving
recombinant DNA technology. Such forms include, but are not limited
to, derivatives, variants, and oligomers, as well as fusion
proteins or fragments thereof.
[0082] The polypeptides of the invention include full length
proteins encoded by the nucleic acid sequences set forth above.
Full length polypeptides comprise an amino acid sequence as
depicted in SEQ ID NOs: 2, 4, and 6, with useful fragments
comprising amino acids 132 to 289 of SEQ ID NOs:2 and 4, and amino
acids 133 to 190 of SEQ ID NO:6. As mentioned above, the N-terminal
and C-terminal amino acids of these and other fragments can vary
about two amino acids from those given (i.e., the N-terminus can
vary from amino acids 130 to 134 of SEQ ID NOs:2 and 4 and 131 to
135 of SEQ ID NO:6; and the C-terminus can vary from amino acids
187 to 191 of SEQ ID NOs:2 and 4 and 188 to 192 of SEQ ID
NO:6).
[0083] The inventive peptides and fragments thereof may be
recombinantly expressed as an intracellular polypeptide, preferably
in non-mammalian cells. Such peptides may be obtained by isolating
cells that express the polypeptide from the culture medium (e.g.,
by centrifugation or filtration), solubilizing the cells, and
isolating the peptide from the solubilized cells. Choice of
solubilization techniques will depend on the cells used for
expression. Purification of the polypeptide from recombinant host
cells is facilitated by expression of the polypeptide as a fusion
protein with a tag protein as discussed herein.
[0084] The inventive peptides and fragments thereof may also be
recombinantly expressed as a soluble polypeptide capable of being
secreted from the cells in which it is made. Such soluble peptides
may be obtained by separating intact cells that express the soluble
polypeptide from the culture medium (e.g., by centrifugation or
filtration), and isolating the soluble peptide from the medium
(supernatant). Purification of the polypeptides from recombinant
host cells is facilitated by expression of the polypeptide as a
secreted protein, which can be useful in obtaining large amounts of
the soluble polypeptide as a therapeutic or diagnostic agent, or
for use in assays. Because the N-terminus and C-terminus of
recombinantly expressed polypeptides may vary by several amino
acids, including from about 1 amino acid to about 10 amino acids,
the polypeptides of this invention can vary accordingly.
[0085] The inventive polypeptides thus include, but are not limited
to: (a) polypeptides comprising amino acids x1 to x2, wherein x1 is
any of the amino acids in positions 1 through 10 of SEQ ID NO:2,
and x2 is any of the amino acids in positions 408 through 418 of
SEQ ID NO:2; (b) polypeptides comprising amino acids x1 to x2,
wherein x1 is any of the amino acids in positions 1 through 10 of
SEQ ID NO:4, and x2 is any of the amino acids in positions 408
through 418 of SEQ ID NO:4; and (c) polypeptides comprising amino
acids x1 to x2, wherein x1 is any of the amino acids in positions 1
through 10 of SEQ ID NO:6, and x2 is any of the amino acids in
positions 409 through 419 of SEQ ID NO:6. Polypeptides similar to
any of the foregoing may also be derived from SEQ ID NO:8.
[0086] Other embodiments include polypeptides comprising: (a) amino
acids x1 to x2, wherein x1 is any of the amino acids in positions 1
through 10 of SEQ ID NO:2, and x2 is any of the amino acids in
positions 187 through 191 of SEQ ID NO:2; (b) amino acids x1 to x2,
wherein x1 is any of the amino acids in positions 1 through 10 of
SEQ ID NO:4, and x2 is any of the amino acids in positions 187
through 191 of SEQ ID NO:4; and (c) amino acids x1 to x2, wherein
x1 is any of the amino acids in positions 1 through 10 of SEQ ID
NO:6, and x2 is any of the amino acids in positions 188 through 192
of SEQ ID NO:6.
[0087] The invention also comprehends polypeptides comprising: (a)
amino acids x1 to x2, wherein x1 is any of the amino acids in
positions 1 through 10 of SEQ ID NO:2, and x2 is any of the amino
acids in positions 130 through 134 of SEQ ID NO:2; (b) amino acids
x1 to x2, wherein x1 is any of the amino acids in positions 1
through 10 of SEQ ID NO:4, and x2 is any of the amino acids in
positions 130 through 134 of SEQ ID NO:4; and (c) amino acids x1 to
x2, wherein x1 is any of the amino acids in positions 1 through 10
of SEQ ID NO:6, and x2 is any of the amino acids in positions 129
through 133 of SEQ D NO:6.
[0088] Additional embodiments include polypeptides comprising: (a)
amino acids x1 to x2, wherein x1 is any of the amino acids in
positions 130 through 134 of SEQ ID NO:2, and x2 is any of the
amino acids in positions 408 through 418 of SEQ ID NO:2; (b) amino
acids x1 to x2, wherein x1 is any of the amino acids in positions
130 through 134 of SEQ ID NO:4, and x2 is any of the amino acids in
positions 408 through 418 of SEQ ID NO:4; and (c) amino acids x1 to
x2, wherein x1 is any of the amino acids in positions 129 through
133 of SEQ ID NO:6, and x2 is any of the amino acids in positions
409 through 419 of SEQ ID NO:6.
[0089] Also included within the scope of the invention are
polypeptides comprising: (a) amino acids x1 to x2, wherein x1 is
any of the amino acids in positions 187 through 191 of SEQ ID NO:2,
and x2 is any of the amino acids in positions 408 through 418 of
SEQ ID NO:2; (b) amino acids x1 to x2, wherein x1 is any of the
amino acids in positions 187 through 191 of SEQ ID NO:4, and x2 is
any of the amino acids in positions 408 through 418 of SEQ ID NO:4;
and (c) amino acids x1 to x2, wherein x1 is any of the amino acids
in positions 188 through 192 of SEQ ID NO:6, and x2 is any of the
amino acids in positions 409 through 419 of SEQ ID NO:6.
Polypeptides similar to any of the foregoing may also be derived
from SEQ ID NO:8.
[0090] The invention also provides Pellino polypeptides and
fragments thereof that retain a desired activity. Particular
embodiments are directed to polypeptide fragments that retain the
ability to bind a member of the chymotrypsin family of proteases.
Such a fragment may be a soluble polypeptide, as described above.
In another embodiment, the polypeptides and fragments
advantageously include regions that are conserved in the Pellino
family as described above.
[0091] Also provided herein are polypeptide fragments comprising at
least 8, 12, 16, or at least 32, contiguous amino acids of the
sequence of SEQ ID NO:2. Such polypeptide fragments may be employed
as immunogens in generating antibodies, as small molecule agonists
or antagonists of Pellino activity, and in various assays for
Pellino activity.
[0092] Naturally occurring variants as well as derived variants of
the polypeptides and fragments are provided herein. Variants may
exhibit amino acid sequences that are at least 80% identical, or at
least about 85% identical, to the native polypeptide disclosed
herein. Also contemplated are embodiments in which a polypeptide or
fragment comprises an amino acid sequence that is at least 90%
identical, at least 95% identical, at least 98% identical, at least
99% identical, or at least 99.9% identical to the preferred
polypeptide or fragment thereof. Percent identity may be determined
as described previously herein.
[0093] The variants of the invention include, for example, those
that result from alternate mRNA splicing events or from proteolytic
cleavage. Alternate splicing of mRNA may, for example, yield a
truncated but biologically active protein, such as a naturally
occurring, shortened form of the protein. As mentioned above,
variations attributable to proteolysis include, for example,
differences in the N- or C-termini upon expression in different
types of host cells, due to proteolytic removal of one or more
terminal amino acids from the protein (generally from about one to
about five terminal amino acids) or other differences in protein
expression. Proteins in which differences in amino acid sequence
are attributable to genetic polymorphism (allelic variation among
individuals producing the protein) are also contemplated
herein.
[0094] Other variants include fusion proteins, such as those
prepared by expression in recombinant culture as N-terminal or
C-terminal fusions. Examples of fusion proteins include fusion
proteins that will form oligomers, such as a Pellino/Fc fusion
protein (for example, as described in U.S. Pat. No. 5,962,406,
issued Oct. 5, 1999), or a zipper fusion protein (U.S. Pat. No.
5,716,805, issued Feb. 10, 1998). Further, fusion proteins can
comprise peptides added to facilitate purification and
identification (often referred to as tag proteins). Such peptides
include, for example, poly-His or the antigenic identification
peptides described in U.S. Pat. No. 5,011,912 and in Hopp et al.,
Bio/Technology 6:1204, 1988. Additional, useful tag proteins
include green fluorescent protein (GFP; Chalfie et al., Science
263:802, 1994), an N-terminal peptide that contains recognition
sites for a monoclonal antibody, a specific endopeptidase, and a
site-specific protein kinase (PKA; Blanar and Rutter, Science
256:1014, 1992), birA (Altman et al., Science 274:94, 1996) and
glutathione S transferase (GST: Smith and Johnson, Gene 67:31,
1988).
[0095] One such tag peptide is the FLAG peptide, which is highly
antigenic and provides an epitope reversibly bound by a specific
monoclonal antibody, enabling rapid assay and facile purification
of expressed recombinant protein. A murine hybridoma designated
4E11 produces a monoclonal antibody that binds the FLAG peptide in
the presence of certain divalent metal cations, as described in
U.S. Pat. No. 5,011,912, hereby incorporated by reference. The 4E11
hybridoma cell line has been deposited with the American Type
Culture Collection under accession no. HB 9259. Monoclonal
antibodies that bind the FLAG peptide are available from Eastman
Kodak Co., Scientific Imaging Systems Division, New Haven,
Conn.
[0096] Another useful tag peptide is the GST peptide, which binds
glutathione, also facilitating purification of expressed
recombinant protein. Recombinant protein can be purified by
affinity chromatography using a suitable chromatography matrix to
which has been attached glutathione, as described in Smith and
Johnson, supra, hereby incorporated by reference. Suitable
chromatography matrixes include Glutathione-Agarose beads
(Pharmacia). Recombinant protein can be eluted with an excess of
glutathione. Alternatively, a specific enzymatic cleavage site
(such as a thrombin cleavage site) can be included n the
recombinant fusion protein, and the desired polypeptide removed
from the affinity matrix by treatment with the enzyme that cleaves
the fusion protein at the cleavage site.
[0097] Among the variant polypeptides provided herein are variants
of native polypeptides that retain the native biological activity
or the substantial equivalent thereof. One example is a variant
that binds a binding partner with essentially the same binding
affinity as does the native form. Binding affinity can be measured
by conventional procedures, e.g., as described in U.S. Pat. No.
5,512,457 and as set forth below. Variants include polypeptides
that are substantially homologous to the native form, but which
have an amino acid sequence different from that of the native form
because of one or more deletions, insertions or substitutions.
Particular embodiments include, but are not limited to,
polypeptides that comprise from one to ten deletions, insertions or
substitutions of amino acid residues, when compared to a native
sequence. A given amino acid may be replaced, for example, by a
residue having similar physiochemical characteristics. Examples of
such physiochemically conservative substitutions include
substitution of one aliphatic residue for another, such as Ile,
Val, Leu, or Ala for one another; substitutions of one polar
residue for another, such as between Lys and Arg, Glu and Asp, or
Gln and Asn; or substitutions of one aromatic residue for another,
such as Phe, Trp, or Tyr for one another. Other substitutions,
e.g., involving substitutions of entire regions having similar
hydrophobicity characteristics, are well known.
[0098] The invention further includes polypeptides of the invention
with or without associated native-pattern glycosylation.
Polypeptides expressed in yeast or mammalian expression systems
(e.g., CHO or COS-7 cells) can be similar to or significantly
different from a native polypeptide in molecular weight and
glycosylation pattern, depending upon the choice of expression
system. Further, a given preparation may include multiple
differentially glycosylated species of the protein. Expression of
polypeptides of the invention in bacterial expression systems, such
as E. coli, provides non-glycosylated molecules. Glycosyl groups
can also be removed through conventional chemical or enzymatic
methods, in particular those utilizing glycopeptidase. In general,
glycosylated polypeptides of the invention can be incubated with a
molar excess of glycopeptidase (Boehringer Mannheim). Recombinant
technology can also be applied to reduce glycosylation that occurs
in eukaryotic expression systems, for example, as described in U.S.
Pat. No. 5,071,972 and EP 276,846, hereby incorporated by
reference. Other variants are prepared by modification of adjacent
dibasic amino acid residues, to enhance expression in yeast systems
in which KEX2 protease activity is present, as disclosed in EP
212,914. In another example of variants, sequences encoding Cys
residues that are not essential for biological activity can be
altered to cause the Cys residues to be deleted or replaced with
other amino acids, as disclosed in U.S. Pat. No. 5,962,406, issued
Oct. 5, 1999.
[0099] Additional variants within the scope of the invention
include polypeptides that may be modified to create derivatives
thereof by forming covalent or aggregative conjugates with other
chemical moieties, such as glycosyl groups, lipids, phosphate,
acetyl groups and the like. Covalent derivatives may be prepared by
linking the chemical moieties to functional groups on amino acid
side chains or at the N-terminus or C-terminus of a polypeptide.
Conjugates comprising diagnostic (detectable) or therapeutic agents
attached thereto are contemplated herein, as discussed in more
detail below.
Production of Polypeptides and Fragments Thereof
[0100] The present invention also provides recombinant cloning and
expression vectors containing DNA, as well as host cell containing
the recombinant vectors. Expression vectors comprising DNA may be
used to prepare the polypeptides or fragments of the invention
encoded by the DNA. A method for producing polypeptides comprises
culturing host cells transformed with a recombinant expression
vector encoding the polypeptide, under conditions that promote
expression of the polypeptide, then recovering the expressed
polypeptides from the culture. The skilled artisan will recognize
that procedures for producing and purifying the expressed
polypeptides will vary according to such factors as the type of
host cells employed, and whether the polypeptide is membrane-bound
or a soluble polypeptide that is secreted from the host cell.
[0101] Any suitable expression system may be employed. The vectors
include a DNA encoding a polypeptide or fragment of the invention,
operably linked to suitable transcriptional or translational
regulatory nucleotide sequences, such as those derived from a
mammalian, microbial, viral, or insect gene. Examples of regulatory
sequences include transcriptional promoters, operators, or
enhancers, an mRNA ribosomal binding site, and appropriate
sequences which control transcription and translation initiation
and termination. An origin of replication that confers the ability
to replicate in the desired host cells, and a selection gene by
which transformants are identified, are generally incorporated into
the expression vector. Nucleotide sequences are operably linked
when the regulatory sequence functionally relates to the DNA
sequence. Thus, a promoter nucleotide sequence is operably linked
to a DNA sequence if the promoter nucleotide sequence controls the
transcription of the DNA sequence.
[0102] In addition, a sequence encoding an appropriate signal
peptide (native or heterologous) can be incorporated into
expression vectors. A DNA sequence for a signal peptide (secretory
leader) may be fused in frame to the nucleic acid sequence of the
invention so that the DNA is initially transcribed, and the mRNA
translated, into a fusion protein comprising the signal peptide. A
signal peptide that is functional in the intended host cells
promotes extracellular secretion of the polypeptide. The signal
peptide is cleaved from the polypeptide upon secretion of
polypeptide from the cell.
[0103] The skilled artisan will also recognize that the position(s)
at which the signal peptide is cleaved may differ from that
predicted by computer program, and may vary according to such
factors as the type of host cells employed in expressing a
recombinant polypeptide. Accordingly, a protein preparation may
include a mixture of protein molecules having different N-terminal
amino acids, resulting from cleavage of the signal peptide at more
than one site.
[0104] Suitable host cells for expression of polypeptides include
prokaryotes, yeast or higher eukaryotic cells. Appropriate cloning
and expression vectors for use with bacterial, fungal, yeast, and
mammalian cellular hosts are described, for example, in Pouwels et
al. Cloning Vectors: A Laboratory Manual, Elsevier, N.Y., (1985).
Cell-free translation systems could also be employed to produce
polypeptides using RNAs derived from DNA constructs disclosed
herein.
[0105] Mammalian or insect host cell culture systems also may be
employed to express recombinant polypeptides. Bacculovirus systems
for production of heterologous proteins in insect cells are
reviewed by Luckow and Summers, Bio/Technology 6:47 (1988).
Established cell lines of mammalian origin also may be employed.
Examples of suitable mammalian host cell lines include the COS-7
line of monkey kidney cells (ATCC CRL 1651) (Gluzman et al., Cell
23:175, 1981), L cells, C127 cells, 3T3 cells (ATCC CCL 163),
Chinese hamster ovary (CHO) cells, HeLa cells, and BHK (ATCC CRL
10) cell lines, and the CV1/EBNA cell line derived from the African
green monkey kidney cell line CV1 (ATCC CCL 70) as described by
McMahan et al. (EMBO J. 10: 2821, 1991).
[0106] A commonly used cell line is dihydrofolate reductase (DHFR)-
CHO cells which are auxotrophic for glycine, thymidine and
hypoxanthine, and can be transformed to the DHFR+ phenotype using
DHFR cDNA as an amplifiable dominant marker. One such DHFR- CHO
cell line, DXB II, was described by Urlaub and Chasin (Proc. Natl.
Acad. Sci. USA 77:4216, 1980). Another exemplary DHFR- CHO cell
line is DG44 (see, for example, Kaufman, R. J., Meth. Enzymology
185:537 (1988). Other cell lines developed for specific selection
or amplification schemes will also be useful with the
invention.
[0107] Several transfection protocols are known in the art, and are
reviewed in Kaufman, R. J., supra. The transfection protocol chosen
will depend on the host cell type and the nature of the gene of
interest, and can be chosen based upon routine experimentation. The
basic requirements of any such protocol are first to introduce DNA
encoding the protein of interest into a suitable host cell, and
then to identify and isolate host cells which have incorporated the
heterologous DNA in a stable, expressible manner. Other useful
transfection protocols are discussed in U.S. Pat. No. 6,027,915,
issued Feb. 22, 2000. Transfection of cells with heterologous DNA
and selection for cells that have taken up the heterologous DNA and
express the selectable marker results in a pool of transfected
cells. Individual cells in these pools will vary in the amount of
DNA incorporated and in the chromosomal location of the transfected
DNA. To generate stable cell lines, individual cells can be
isolated from the pools and cultured (a process referred to as
cloning).
[0108] A method of amplifying the gene of interest is also
desirable for expression of the recombinant protein, and typically
involves the use of a selection marker (reviewed in Kaufman, R. J.,
supra). Resistance to cytotoxic drugs is the characteristic most
frequently used as a selection marker, and can be the result of
either a dominant trait (i.e., can be used independent of host cell
type) or a recessive trait (i.e., useful in particular host cell
types that are deficient in whatever activity is being selected
for). Several amplifiable markers are suitable for use in the
inventive expression vectors (for example, as described in
Maniatis, Molecular Biology: A Laboratory Manual, Cold Spring
Harbor Laboratory, NY, 1989; pgs 16.9-16.14).
[0109] Useful selectable markers for gene amplification in
drug-resistant mammalian cells are shown in Table 1 of Kaufman, R.
J., supra (1988), and include DHFR-MTX resistance, P-glycoprotein
and multiple drug resistance (MDR)-various lipophilic cytoxic
agents (i.e., adriamycin, colchicine, vincristine), and adenosine
deaminase (ADA)-Xyl-A or adenosine and 2'-deoxycoformycin. Other
dominant selectable markers are discussed in U.S. Pat. No.
6,027,915, issued Feb. 22, 2000).
[0110] Useful regulatory elements, described previously, can also
be included in the plasmids or expression vectors used to transfect
mammalian cells. The transfection protocol chosen, and the elements
selected for use therein, will depend on the type of host cell
used. Those of skill in the art are aware of numerous different
protocols and host cells, and can select an appropriate system for
expression of a desired protein, based on the requirements of their
selected cell culture system(s).
[0111] A useful high expression vector, pCAVNOT, has been described
by Mosley et al., Cell 59:335-348, 1989. Other expression vectors
for use in mammalian host cells can be constructed as disclosed by
Okayama and Berg (Mol. Cell. Biol. 3:280, 1983). A useful system
for stable high level expression of mammalian cDNAs in C 127 murine
mammary epithelial cells can be constructed substantially as
described by Cosman et al. (Mol. Immunol. 23:935, 1986). A useful
high expression vector, PMLSV N1/N4, described by Cosman et al.,
Nature 312:768, 1984, has been deposited as ATCC 39890. Additional
useful mammalian expression vectors are described in EP-A-0367566,
and in WO 91/18982, incorporated by reference herein. In yet
another alternative, the vectors can be derived from
retroviruses.
[0112] Additional useful expression vectors, pFLAG and pDC311, can
also be used. FLAG technology is centered on the fusion of a low
molecular weight (1 kD), hydrophilic, FLAG marker peptide to the
N-terminus of a recombinant protein expressed by pFLAG expression
vectors. pDC311 is another specialized vector used for expressing
proteins in CHO cells. pDC311 is characterized by a bicistronic
sequence containing the gene of interest and a dihydrofolate
reductase (DHFR) gene with an internal ribosome binding site for
DHFR translation, an expression augmenting sequence element (EASE),
the human CMV promoter, a tripartite leader sequence, and a
polyadenylation site.
[0113] A signal peptide may be employed to facilitate secretion of
the protein, if desired. The choice of signal peptide or leader may
depend on factors such as the type of host cells in which the
recombinant polypeptide is to be produced. To illustrate, examples
of heterologous signal peptides that are functional in mammalian
host cells include the signal sequence for interleukin-7 (IL-7)
described in U.S. Pat. No. 4,965,195; the signal sequence for
interleukin-2 receptor described in Cosman et al., Nature 312:768
(1984); the interleukin-4 receptor signal peptide described in EP
367,566; the type I interleukin-1 receptor signal peptide described
in U.S. Pat. No. 4,968,607; and the type II interleukin-1 receptor
signal peptide described in EP 460,846.
Purification
[0114] The "isolated" polypeptides or fragments thereof encompassed
by this invention are polypeptides or fragments that are not in an
environment identical to an environment in which it or they can be
found in nature. The "purified" polypeptides or fragments thereof
encompassed by this invention are essentially free of association
with other cellular components, such as unrelated proteins or
polypeptides, lipids and DNA or RNA, for example, as a purification
product of recombinant expression systems such as those described
above or as a purified product from a non-recombinant source such
as naturally occurring cells and/or tissues.
[0115] In one embodiment, the purification of recombinant
polypeptides or fragments can be accomplished by expressing the
inventive polypeptide(s) as a fusion protein with a peptide (often
referred to as a tag peptide) for which an affinity purification
scheme is known in the art. Such fusion partners can include the
poly-His or other tag peptides described above as well as an Fc
moiety or a zipper moiety.
[0116] With respect to purification, as is known to the skilled
artisan, procedures for purifying a recombinant polypeptide or
fragment will vary according to such factors as the type of host
cells employed and whether or not the recombinant polypeptide or
fragment is secreted into the culture medium. In general, the
recombinant polypeptide or fragment can be isolated from the host
cells if not secreted, or from the medium or supernatant if soluble
and secreted, followed by one or more concentration, salting-out,
ion exchange, hydrophobic interaction, affinity purification or
size exclusion chromatography steps.
[0117] As to specific ways to accomplish these steps, the culture
medium first can be concentrated using a commercially available
protein concentration filter, for example, an Amicon or Millipore
Pellicon ultrafiltration unit. Following the concentration step,
the concentrate can be applied to a purification matrix such as a
gel filtration medium. Alternatively, an anion exchange resin can
be employed, for example, a matrix or substrate having pendant
diethylaminoethyl (DEAE) groups. The matrices can be acrylamide,
agarose, dextran, cellulose or other types commonly employed in
protein purification.
[0118] Alternatively, a cation exchange step can be employed.
Suitable cation exchangers include various insoluble matrices
comprising sulfopropyl or carboxymethyl groups. In addition, a
chromatofocusing step can be employed. Alternatively, a hydrophobic
interaction chromatography step can be employed. Suitable matrices
can be phenyl or octyl moieties bound to resins. In addition,
affinity chromatography with a matrix which selectively binds the
recombinant protein can be employed. Examples of such resins
employed are lectin columns, dye columns, and metal-chelating
columns.
[0119] Finally, one or more reversed-phase high performance liquid
chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media,
(e.g., silica gel or polymer resin having pendant methyl, octyl,
octyldecyl or other aliphatic groups) can be employed to further
purify the polypeptides. Some or all of the foregoing purification
steps, in various combinations, are well known and can be employed
to provide an isolated and purified recombinant protein.
[0120] It is also possible to utilize an affinity column comprising
a polypeptide-binding protein of the invention, such as a
monoclonal antibody generated against polypeptides of the
invention, to affinity-purify expressed polypeptides. In this
aspect of the invention, binding proteins, such as antibodies
against Pellino or other molecules that bind Pellino can be bound
to a solid phase support such as a column chromatography matrix or
a similar substrate suitable for identifying, separating, or
purifying Pellino. Adherence of Pellino to a solid phase contacting
surface can be accomplished by any means, for example, magnetic
microspheres can be coated with Pellino binding proteins (or other
Pellino-binding molecules) and held in the incubation vessel
through a magnetic field.
[0121] Solutions containing Pellino polypeptides are contacted with
the solid phase under conditions promoting binding of Pellino
polypeptides to the binding partner; unbound material is then
washed away. Methods of releasing positively selected peptides from
the solid phase are known in the art and encompass, for example,
use of a high salt elution buffer followed by dialysis into a lower
salt buffer, or by changing pH (or other characteristics depending
on the affinity matrix utilized), or competitive removal using a
naturally occurring substrate of the affinity moiety. The methods
are preferably non-injurious to the Pellino polypeptides.
[0122] In one exemplary method, solutions containing Pellino
polypeptides of the invention first can be incubated with a
biotinylated Pellino binding partner. Incubation periods are
typically at least one hour in duration to ensure sufficient
binding to polypeptides of the invention. The resulting mixture
then is passed through a column packed with avidin-coated beads,
whereby the high affinity of biotin for avidin provides the binding
of the Pellino polypeptides to the beads. Use of avidin-coated
beads is known in the art. See Berenson, et al. J. Cell. Biochem.,
10D:239 (1986). Washing of unbound material and the release of the
bound cells are performed using conventional methods.
[0123] The desired degree of purity depends on the intended use of
the protein. A relatively high degree of purity is desired when the
polypeptide is to be administered in vivo, for example. In such a
case, the polypeptides are purified such that no protein bands
corresponding to other proteins are detectable upon analysis by
SDS-polyacrylamide gel electrophoresis (SDS-PAGE). It will be
recognized by one skilled in the pertinent field that multiple
bands corresponding to the polypeptide may be visualized by
SDS-PAGE, due to differential glycosylation, differential
post-translational processing, and the like. Most preferably, the
polypeptide of the invention is purified to substantial
homogeneity, as indicated by a single protein band upon analysis by
SDS-PAGE. The protein band may be visualized by silver staining,
Coomassie blue staining, or (if the protein is radiolabeled) by
autoradiography.
Uses of Pellino Nucleic Acid or Oligonucleotides
[0124] Among the uses of nucleic acids of the invention is the use
of fragments as probes or primers. Such fragments generally
comprise at least about 17 contiguous nucleotides of a DNA
sequence. In other embodiments, a DNA fragment comprises at least
30, or at least 60, contiguous nucleotides of a DNA sequence.
[0125] Because homologs of Pellino proteins from other mammalian
species are contemplated herein, probes based on the DNA sequence
of SEQ ID NOs:1, 3, 5, 7, or 11 may be used to screen cDNA
libraries derived from other mammalian species, using conventional
cross-species hybridization techniques.
[0126] Using knowledge of the genetic code in combination with the
amino acid sequences set forth above, sets of degenerate
oligonucleotides can be prepared. Such oligonucleotides are useful
as primers, e.g., in polymerase chain reactions (PCR), whereby DNA
fragments are isolated and amplified.
[0127] All or a portion of the nucleic acids of SEQ ID NOs:1, 3, 5,
7, or 11, including oligonucleotides, can be used by those skilled
in the art using well-known techniques to identify the human
chromosome, and the specific locus thereof, that contains the DNA
of a Pellino family member. Useful techniques include, but are not
limited to, using the sequence or portions, including
oligonucleotides, as a probe in various well-known techniques such
as radiation hybrid mapping (high resolution), in situ
hybridization to chromosome spreads (moderate resolution), and
Southern blot hybridization to hybrid cell lines containing
individual human chromosomes (low resolution).
[0128] For example, chromosomes can be mapped by radiation
hybridization, using primers that lie within a putative exon of the
gene of interest and which amplify a product from human genomic
DNA, but do not amplify genomic DNA from other species. The results
of the PCR are converted into a data vector that is scored and the
chromosomal assignment and placement relative to known Sequence Tag
Site (STS) markers on the radiation hybrid map is determined. Human
Pellino-1 maps to chromosome 2, places 7.15 cR from WI-6130.
[0129] The nucleic acid of SEQ ID NOs 1, 3, 5, 7, or 11, or a
fragment thereof can be used by one skilled in the art using
well-known techniques to analyze abnormalities associated with gene
mapping to a chromosome that comprises a gene encoding Pellino.
This enables one to distinguish conditions in which this marker is
rearranged or deleted. In addition, nucleotides of SEQ ID NOs:1, 3,
5, 7, or 11, or a fragment thereof can be used as a positional
marker to map other genes of unknown location.
[0130] The DNA may be used in developing treatments for any
disorder mediated (directly or indirectly) by defective, or
insufficient amounts of, the genes corresponding to the nucleic
acids of the invention. Disclosure herein of native nucleotide
sequences permits the detection of defective genes, and the
replacement or supplementation thereof with normal genes, by
various gene therapy techniques that are known in the art.
Defective genes may be detected in in vitro diagnostic assays, and
by comparison of a native nucleotide sequence disclosed herein with
that of a gene derived from a person suspected of harboring a
defect in this gene.
[0131] Other useful fragments of the nucleic acids include
antisense or sense oligonucleotides comprising a single-stranded
nucleic acid sequence (either RNA or DNA) capable of binding to
target mRNA (sense) or DNA (antisense) sequences. Antisense or
sense oligonucleotides, according to the present invention,
comprise a fragment of DNA of SEQ ID NOs:1, 3, 5, 7, or 11. Such a
fragment generally comprises at least about 17 nucleotides,
preferably from about 17 to about 30 nucleotides. The ability to
derive an antisense or a sense oligonucleotide, based upon a cDNA
sequence encoding a given protein is described in, for example,
Stein and Cohen (Cancer Res. 48:2659, 1988) and van der Krol et al.
(BioTechniques 6:958, 1988). Binding of antisense or sense
oligonucleotides to target nucleic acid sequences results in the
formation of complexes that block or inhibit protein expression by
one of several means, as discussed in U.S. Pat. No. 5,783,665,
issued Jul. 21, 1998. Organic moieties and other moieties that
increases affinity of the oligonucleotide for a target nucleic acid
sequence, or intercalating agents, may be attached to sense or
antisense oligonucleotides to modify binding specificities of the
antisense or sense oligonucleotide for the target nucleotide
sequence. The antisense or sense oligonucleotides may be introduced
into a cell containing the target nucleic acid sequence by any gene
transfer method, including, for example, lipofection,
CaPO4-mediated DNA transfection, electroporation, or by using gene
transfer vectors such as Epstein-Barr virus. Sense or antisense
oligonucleotides also may be introduced into a cell containing the
target nucleotide sequence by formation of a conjugate with a
ligand binding molecule, as described in WO 91/04753.
Alternatively, a sense or an antisense oligonucleotide may be
introduced into a cell containing the target nucleic acid sequence
by formation of an oligonucleotide-lipid complex, as described in
WO 90/10448.
[0132] The inventive DNAs will also be useful in the development of
transgenic and/or knockout cells and animals. Those of ordinary
skill in the art are aware of various methods by which such cells
or animals can be prepared; an exemplary method is given in U.S.
Pat. No. 5,565,321, issued Oct. 15, 1996. The techniques described
therein can be used with the inventive sequences by the application
of routine experimentation.
Uses of Pellino Polypeptides
[0133] Because Pellino proteins are homologous to the Pellino
proteins of Drosophila, an important molecule in the signaling
cascade for the IL-1R/Toll family of receptors, small molecule
inhibitors of its function or protein associations (or antisense or
other inhibitors of its synthesis) may be useful in treating
autoimmune and/or inflammatory disorders. Accordingly, the Pellino
polypeptides of the present invention may be used in a screening
assay to identify compounds and small molecules which inhibit
(antagonize) or enhance (agonize) activation of the polypeptides of
the instant invention.
[0134] Thus, for example, polypeptides of the invention may be used
to identify antagonists and agonists from cells, cell-free
preparations, chemical libraries, and natural product mixtures. The
antagonists and agonists may be natural or modified substrates,
ligands, enzymes, receptors, etc. of the polypeptides of the
instant invention, or may be structural or functional mimetics of
the polypeptides. Potential antagonists of the instant invention
may include small molecules, peptides and antibodies that bind to
and occupy a binding site of the inventive polypeptides or a
binding partner thereof, causing them to be unavailable to bind to
their natural binding partners and therefore preventing normal
biological activity. Potential agonists include small molecules,
peptides and antibodies which bind to the instant polypeptides or
binding partners thereof, and elicit the same or enhanced biologic
effects as those caused by the binding of the polypeptides of the
instant invention.
[0135] Small molecule agonists and antagonists are usually less
than 10K molecular weight and may possess a number of
physicochemical and pharmacological properties which enhance cell
penetration, resist degradation and prolong their physiological
half-lives (Gibbs, J., Pharmaceutical Research in Molecular
Oncology, Cell, Vol. 79 (1994)). Antibodies, which include intact
molecules as well as fragments such as Fab and F(ab')2 fragments,
as well as recombinant molecules derived therefrom, may be used to
bind to and inhibit the polypeptides of the instant invention by
blocking the propagation of a signaling cascade. It is preferable
that the antibodies are humanized, and more preferable that the
antibodies are human. The antibodies of the present invention may
be prepared by any of a variety of well-known methods.
[0136] Specific screening methods are known in the art and along
with integrated robotic systems and collections of chemical
compounds/natural products are extensively incorporated in high
throughput screening so that large numbers of test compounds can be
tested for antagonist or agonist activity within a short amount of
time. These methods include homogeneous assay formats such as
fluorescence resonance energy transfer, fluorescence polarization,
time-resolved fluorescence resonance energy transfer, scintillation
proximity assays, reporter gene assays, fluorescence quenched
enzyme substrate, chromogenic enzyme substrate and
electrochemiluminescence, as well as more traditional heterogeneous
assay formats such as enzyme-linked immunosorbant assays (ELISA) or
radioimmunoassays.
[0137] Homogeneous assays are "mix and read" assays that are very
amenable to robotic application, whereas heterogeneous assays
require separation of bound analyte from free by more complex unit
operations such as filtration, centrifugation or washing. These
assays are utilized to detect a wide variety of specific
biomolecular interactions and the inhibition thereof by small
organic molecules, including protein-protein, receptor-ligand,
enzyme-substrate, etc. These assay methods and techniques are well
known in the art and are described more fully in the following:
High Throughput Screening: The Discovery of Bioactive Substances,
John P. Devlin (ed.), Marcel Dekker, New York, 1997, ISBN:
0-8247-0067-8; and the internet sites of lab-robotics.org and
sbsonline.org. The screening assays of the present invention are
amenable to high throughput screening of chemical libraries and are
suitable for the identification of small molecule drug candidates,
antibodies, peptides and other antagonists and/or agonists.
[0138] One embodiment of a method for identifying molecules which
inhibit or antagonize the polypeptides involves adding a candidate
molecule to a medium which contains cells that express the
polypeptides of the instant invention; changing the conditions of
said medium so that, but for the presence of the candidate
molecule, the polypeptides would be bound to their natural ligands,
substrates or effector molecules, and observing the binding and
stimulation or inhibition of a functional response. The activity of
the cells which were contacted with the candidate molecule may then
be compared with the identical cells which were not contacted and
antagonists and agonists of the polypeptides of the instant
invention may be identified. The measurement of biological activity
may be performed by a number of well-known methods such as
measuring the amount of protein present (e.g. an ELISA) or of the
proteins activity. A decrease in biological stimulation or
activation would indicate an antagonist. An increase would indicate
an agonist.
[0139] Screening assays can further be designed to find molecules
that mimic the biological activity of the polypeptides of the
instant invention. Molecules which mimic the biological activity of
a polypeptide may be useful for enhancing the biological activity
of the peptide. To identify compounds for therapeutically active
agents that mimic the biological activity of a polypeptide, it must
first be determined whether a candidate molecule binds to the
polypeptide. A binding candidate molecule is then added to a
biological assay to determine its biological effects. The
biological effects of the candidate molecule are then compared to
those of the polypeptide(s).
[0140] Another embodiment of the invention relates to uses of
Pellino polypeptides to study cell signal transduction. Cellular
signaling often involves a molecular activation cascade, during
which a receptor propagates a ligand-receptor mediated signal by
specifically activating intracellular kinases which phosphorylate
target substrates. These substrates can themselves be kinases which
become activated following phosphorylation. Alternatively, they can
be adaptor molecules that facilitate down stream signaling through
protein-protein interaction following phosphorylation. Accordingly,
these novel Pellino polypeptides can be used as reagents to
identify novel molecules involved in signal transduction
pathways.
[0141] The inventive polypeptides are involved in IL-1 signaling,
and as such can be used as inhibitors of the IL-1 signaling
pathway. Accordingly, they find utility in in vitro screening
assays and in vivo therapeutics. As therapeutics that are cell
membrane permeable, the Pellino polypeptides and fragments thereof
can be administered to agonize or antagonize IL-1R mediated
signaling pathways, thus providing useful immunoregulators. Various
liposome-based compositions of the inventive polypeptides are
envisioned herein.
[0142] Compositions of the present invention may contain a
polypeptide in any form described herein, such as native proteins,
variants, derivatives, oligomers, and biologically active
fragments. In particular embodiments, the composition comprises a
soluble polypeptide or an oligomer comprising soluble Pellino
polypeptides.
[0143] Compositions comprising an effective amount of a polypeptide
of the present invention, in combination with other components such
as a physiologically acceptable diluent, carrier, or excipient, are
provided herein. The polypeptides can be formulated according to
known methods used to prepare pharmaceutically useful compositions.
They can be combined in admixture, either as the sole active
material or with other known active materials suitable for a given
indication, with pharmaceutically acceptable diluents (e.g.,
saline, Tris-HCl, acetate, and phosphate buffered solutions),
preservatives (e.g., thimerosal, benzyl alcohol, parabens),
emulsifiers, solubilizers, adjuvants and/or carriers. Suitable
formulations for pharmaceutical compositions include those
described in Remington's Pharmaceutical Sciences, 16th ed. 1980,
Mack Publishing Company, Easton, Pa.
[0144] In addition, such compositions can be complexed with
polyethylene glycol (PEG), metal ions, or incorporated into
polymeric compounds such as polyacetic acid, polyglycolic acid,
hydrogels, dextran, etc., or incorporated into liposomes,
microemulsions, micelles, unilamellar or multilamellar vesicles,
erythrocyte ghosts or spheroblasts. Such compositions will
influence the physical state, solubility, stability, rate of in
vivo release, and rate of in vivo clearance, and are thus chosen
according to the intended application.
[0145] The compositions of the invention can be administered in any
suitable manner, e.g., topically, parenterally, or by inhalation.
The term "parenteral" includes injection, e.g., by subcutaneous,
intravenous, or intramuscular routes, also including localized
administration, e.g., at a site of disease or injury (for example,
intracoronary or intra tumor administration or injection into a
joint undergoing an inflammatory reaction). Sustained release from
implants is also contemplated. One skilled in the pertinent art
will recognize that suitable dosages will vary, depending upon such
factors as the nature of the disorder to be treated, the patient's
body weight, age, and general condition, and the route of
administration. Preliminary doses can be determined according to
animal tests, and the scaling of dosages for human administration
is performed according to art-accepted practices.
[0146] The polypeptide of the instant invention may also be
administered by the method of protein transduction. In this method,
the Pellino polypeptide is covalently linked to a
protein-transduction domain (PTD) such as, but not limited to, TAT,
Antp, or VP22 (Schwarze et al., 2000, Cell Biology 10: 290-295).
The PTD-linked Pellino polypeptides can then be transduced into
cells by adding them to tissue-culture media containing the cells
(Schwarze et al., 1999, Science 285: 1569; Lindgren et al., 2000,
TiPS 21: 99; Derossi et al., 1998, Cell Biology 8: 84; WO 00/34308;
WO 99/29721; and WO 99/10376). Moreover, it has been found that DNA
encoding a polypeptide can be administered to a mammal in such a
way that it is taken up by cells, and expressed. The resultant
protein will then be available to exert a therapeutic effect.
Accordingly, compositions comprising nucleic acids in
physiologically acceptable formulations are also contemplated. DNA
may be formulated for injection, for example.
Antibodies
[0147] Antibodies that are immunoreactive with the polypeptides of
the invention are provided herein. Such antibodies specifically
bind to the polypeptides via the antigen-binding sites of the
antibody (as opposed to non-specific binding). Thus, the
polypeptides, fragments, variants, fusion proteins, etc., as set
forth above may be employed as "immunogens" in producing antibodies
immunoreactive therewith. More specifically, the polypeptides,
fragment, variants, fusion proteins, etc. contain antigenic
determinants or epitopes that elicit the formation of
antibodies.
[0148] These antigenic determinants or epitopes can be either
linear or conformational (discontinuous). Linear epitopes are
composed of a single section of amino acids of the polypeptide,
while conformational or discontinuous epitopes are composed of
amino acids sections from different regions of the polypeptide
chain that are brought into close proximity upon protein folding
(C. A. Janeway, Jr. and P. Travers, Immuno Biology 3:9 (Garland
Publishing Inc., 2nd ed. 1996)). Because folded proteins have
complex surfaces, the number of epitopes available is quite
numerous; however, due to the conformation of the protein and
steric hindrances, the number of antibodies that actually bind to
the epitopes is less than the number of available epitopes (C. A.
Janeway, Jr. and P. Travers, Immuno Biology 2:14 (Garland
Publishing Inc., 2nd ed. 1996)). Epitopes may be identified by any
of the methods known in the art.
[0149] Thus, one aspect of the present invention relates to the
antigenic epitopes of the polypeptides of the invention. Such
epitopes are useful for raising antibodies, in particular
monoclonal antibodies, as described in more detail below.
Additionally, epitopes from the polypeptides of the invention can
be used as research reagents, in assays, and to purify specific
binding antibodies from substances such as polyclonal sera or
supernatants from cultured hybridomas. Such epitopes or variants
thereof can be produced using techniques well known in the art such
as solid-phase synthesis, chemical or enzymatic cleavage of a
polypeptide, or using recombinant DNA technology.
[0150] As to the antibodies that can be elicited by the epitopes of
the polypeptides of the invention, whether the epitopes have been
isolated or remain part of the polypeptides, both polyclonal and
monoclonal antibodies may be prepared by conventional techniques.
See, for example, Monoclonal Antibodies, Hybridomas: A New
Dimension in Biological Analyses, Kennet et al. (eds.), Plenum
Press, New York (1980); and Antibodies: A Laboratory Manual, Harlow
and Land (eds.), Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., (1988).
[0151] Hybridoma cell lines that produce monoclonal antibodies
specific for the polypeptides of the invention are also
contemplated herein. Such hybridomas may be produced and identified
by conventional techniques. One method for producing such a
hybridoma cell line comprises immunizing an animal with a
polypeptide or a DNA encoding a polypeptide; harvesting spleen
cells from the immunized animal; fusing said spleen cells to a
myeloma cell line, thereby generating hybridoma cells; and
identifying a hybridoma cell line that produces a monoclonal
antibody that binds the polypeptide. The monoclonal antibodies may
be recovered by conventional techniques.
[0152] The monoclonal antibodies of the present invention include
chimeric antibodies, e.g., humanized versions of murine monoclonal
antibodies. Such humanized antibodies may be prepared by known
techniques and offer the advantage of reduced immunogenicity when
the antibodies are administered to humans. In one embodiment, a
humanized monoclonal antibody comprises the variable region of a
murine antibody (or just the antigen binding site thereof) and a
constant region derived from a human antibody. Alternatively, a
humanized antibody fragment may comprise the antigen binding site
of a murine monoclonal antibody and a variable region fragment
(lacking the antigen-binding site) derived from a human antibody.
Procedures for the production of chimeric and further engineered
monoclonal antibodies include those described in Riechmann et al.
(Nature 332:323, 1988), Liu et al. (Proc. Natl. Acad. Sci. USA
84:3439, 1987), Larrick et al. (Bio/Technology 7:934, 1989), and
Winter and Harris (TIPS 14:139, May, 1993). Procedures to generate
antibodies transgenically can be found in GB 2,272,440, U.S. Pat.
Nos. 5,569,825 and 5,545,806 and related patents claiming priority
therefrom, all of which are incorporated by reference herein.
[0153] Antigen-binding fragments of the antibodies, which may be
produced by conventional techniques, are also encompassed by the
present invention. Examples of such fragments include, but are not
limited to, Fab and F(ab')2 fragments. Antibody fragments and
derivatives produced by genetic engineering techniques are also
provided.
[0154] In one embodiment, the antibodies are specific for the
polypeptides of the present invention and do not cross-react with
other proteins. Screening procedures by which such antibodies may
be identified are well known, and may involve immunoaffinity
chromatography, for example.
[0155] The antibodies of the invention can be used in assays to
detect the presence of the polypeptides or fragments of the
invention, either in vitro or in vivo. The antibodies also may be
employed in purifying polypeptides or fragments of the invention by
immunoaffinity chromatography.
[0156] The following examples are provided to further illustrate
particular embodiments of the invention, and are not to be
construed as limiting the scope of the present invention.
EXAMPLE 1
Identification of Pellino Nucleic Acid and Polypeptide
Sequences
[0157] The polynucleotide sequences of ESTs isolated from murine
dendritic cells identified two clones containing open reading
frames with a high degree of similarity to the Drosophila protein
Pellino (Grosshans et al., supra). Appropriate flanking PCR primers
were designed, and a novel nucleic acid was amplified from a murine
cDNA library and cloned; the nucleotide sequence and encoded amino
acid sequence of this clone, which is called Pellino-1 (previously
referred to as Conserved Inflammatory Signal Target-1), are shown
in SEQ ID NO:1 and SEQ ID NO:2, respectively. Human sequences from
the high-throughput genomic (HTG) and EST divisions of the public
GenBank database were compared with murine Pellino-1, and an open
reading frame for the human Pellino-1 homolog was assembled. PCR
primers were designed based upon this human sequence, and a cDNA
clone was isolated by PCR amplification from a human dermal
fibroblast cDNA library. The nucleotide and amino acid sequence of
this protein are shown in SEQ ID NO:3 and SEQ ID NO:4,
respectively. Subsequently, Rich et al. published the coding and
amino acid sequences of "human Pellino" (GenBank Accession Numbers
AJ278859 and CAC04320, 23 August 2000); the amino acid sequence of
the "human Pellino" polypeptide is identical to that of human
Pellino-1 (SEQ ID NO:4) except for a Ser to Phe substitution at
position 11. The difference between the human Pellino and SEQ ID
NO:4 amino acid sequences may represent a naturally occurring
allelic variation between nucleic acids encoding these amino acid
sequences within the human population. Partial Pellino-1 amino acid
sequences have also been published in WO 2000/58350; EP 1 074 617;
and WO 2001/09318.
[0158] By querying public EST databases, a portion of a second,
related gene, referred to as Pellino-2, was identified in the mouse
and human. Pellino-2 amino acid sequences are 80% identical to
their respective Pellino-1 counterparts. Appropriate primers were
designed, and murine Pellino-2 DNA was cloned substantially as
described for Pellino-1; the nucleotide and amino acid sequence of
murine Pellino-2 is shown in SEQ ID NO:5 and SEQ ID NO:6,
respectively. The predicted nucleotide and amino acid sequence of
human Pellino-2 is shown in SEQ ID NOs:7 and 8.
[0159] A data set was received from Celera Genomics (Rockville,
Md.) containing a listing of amino acid sequences predicted to be
encoded by the human genome. This data set was searched with a
BLAST algorithm to identify Pellino polypeptide sequences and
several partial amino acid sequences were found that appeared to be
related to a new human Pellino polypeptide, Pellino-3. Comparison
of these partial Pellino-3 amino acid sequences to genomic and cDNA
sequences allowed the predicted human Pellino-3 nucleotide and
amino acid sequences, SEQ ID NO:11 and SEQ ID NO:12, respectively,
to be assembled. Two possible allelic variations have been detected
within the human Pellino-3 amino acid sequence (SEQ ID NO:12): a
deletion of the Leu residue at position 96, and an Arg to Ala
substitution at residue 353.
[0160] The amino acid sequences of murine ("Mm") and human ("Hs")
Pellino-1 and Pellino-2 polypeptides, and human Pellino-3
polypeptide (SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8,
and SEQ ID NO:12) were compared with the amino acid sequences of
Pellino-related Pellino polypeptides from other species (Drosophila
melanogaster, "Dm", SEQ ID NO:13; Ciona intestinalis, "Ci", SEQ ID
NO:14; and Caenorhabditis elegans, "Ce", SEQ ID NO:15) using the
GCG "pretty" multiple sequence alignment program, with amino acid
similarity scoring matrix=blosum62, gap creation penalty=8, and gap
extension penalty=2. The alignment of these sequences is shown in
Table 1, and indicates consensus amino acid residues which are
identical among at least three of the amino acid sequences in the
alignment. The capitalized residues in the alignment are those
which match the consensus residues. Pellino-1 and -2 share 82%
identity at the amino acid level, and the degree of conservation
between human and mouse is extremely high; only one amino acid is
different between human and mouse Pellino-1, and Pellino-2 is 95%
conserved between these species. The predicted Pellino-3 amino acid
sequence is 70% and 71% identical to human Pellino-1 and -2,
respectively. There is a surprising degree of similarity between
human Pellino-1, for example, and the homologous protein from C.
elegans (SEQ ID NO:15), which share 44% amino acid identity and 53%
amino acid similarity. It is evident from a cursory inspection of
the alignment that sequence conservation is not concentrated in any
particular part of the Pellino protein, but extends throughout.
This, and the fact that all the Pellino polypeptides (except for
Drosophila Pellino and human Pellino-3, which contain small
N-terminal extensions) are of a very similar size, suggest that (1)
all parts of the protein are involved in its wild-type function and
(2) few or no amino acids extraneous to that wild-type function
exist in the polypeptides. There is a particularly well-conserved
central domain, extending from amino acid 132 through amino acid
193 in Pellino-1 (SEQ ID NOs 2 and 4; which corresponds to amino
acids 134 through 195 in SEQ ID NO:8 and amino acids 158 through
219 in SEQ ID NO:12), and an absolutely conserved motif from
residue 245 through residue 254 of SEQ ID NOs 2 and 4 (which
corresponds to amino acids 247 through 256 in SEQ ID NO:8 and amino
acids 271 through 280 in SEQ ID NO: 12). The C-terminal portions of
Pellino polypeptides are interspersed by a series of short,
invariant motifs, in which cysteine, proline, histidine and large
hydrophobic residues are prevalent. The arrangement of some of the
conserved sequences, including a Cys-Gly-His triplet and two
Cys-Pro-X-Cys motifs, is reminiscent of the structure of the C3HC4
RING-finger subfamily of Zinc-finger domains, which mediate
protein-protein and protein-DNA interactions in a diverse group of
proteins, including tumor suppressors, proto-oncogenes, and
signaling molecules including the TRAFs, with specific examples of
polypeptides containing similar RING-finger domains including human
ring finger protein-1 (hRING1, GenBank NP.sub.--002922); chicken
ring finger protein (C-RZF, GenBank 1589724); human proto-oncogene
CBL (hC-CBL, GenBank P22681); murine TNFR2-TRAF signaling complex
protein (mc-IAP1, GenBank AAC42078); human TRAF-interacting protein
(hTRIP, GenBank NP.sub.--005870); human TNF receptor-associated
factor 3 (hTRAF3, GenBank NP.sub.--003291); human TNF
receptor-associated factor 2 (hTRAF2, GenBank NP.sub.--066961); and
Drosophila neuralized protein (neu, GenBank S35371). The Pellino
RING-finger-like domains comprise the following amino acid
sequences: amino acid 333 through amino acid 398 of SEQ ID NOs 2
and 4; amino acids 335 through 400 in SEQ ID NO:8 and the
corresponding region of SEQ ID NO:6; and amino acids 360 through
425 in SEQ ID NO:12. There are conserved cysteine residues within
the Pellino polypeptide RING-finger-like domains, located at
positions 333, 336, 367, 371, 395, and 398 of SEQ ID NOs 2 and 4
(and at positions 335, 338, 369, 373, 397, and 400 of SEQ ID NO:8
and the corresponding positions in SEQ ID NO:6, and at positions
360, 363, 394, 398, 422, and 425 of SEQ ID NO:12). In Pellino
polypeptides the conserved cysteine and histidine residues are more
widely separated than would be typical for a classical RING-finger
domain, in which the intervening sequences form the finger-like
loops. The first cysteine following the conserved histidine of the
canonical RING-finger domain is missing in Pellino, but we note
that there is an almost invariant histidine at position 362 of SEQ
ID NOs 2 and 4 (and at position 364 of SEQ ID NO:8 and the
corresponding position in SEQ ID NO:6, and at positions 389 of SEQ
ID NO:12) which might be available for co-ordination to a metal
ion. A second, invariant Cys-Gly-His triplet at residues 311-313 of
SEQ ID NOs 2 and 4 (and at amino acids 313 through 315 of SEQ ID
NO:8 and the corresponding residues in SEQ ID NO:6, and at amino
acids 338 through 340 of SEQ ID NO:12) extends the zinc-finger
resemblance further toward the N-terminus. Therefore, the
C-terminal region of Pellino polypeptides appears to contain a
novel type of Zinc fingerlike domain.
[0161] Regions of amino acid similarity have also been identified
between Pellino polypeptides and an insect pox virus gene,
Melanoplus sanguinipes Entomopoxvirus (MsEPV) ORF244, which is
believed to play a role in circumventing host immune defenses by
blocking host defensive protein interactions (Rich et al., 2000,
Immunogenetics 52: 145-149).
[0162] Amino acid substitutions and other alterations (deletions,
insertions, etc.) to the Pellino amino acid sequences (SEQ ID NO:2,
SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, and SEQ ID NO:12) are
predicted to be more likely to alter or disrupt Pellino polypeptide
activities if they result in changes to the capitalized residues of
the amino acid sequences as shown in Table 1, and particularly if
those changes do not substitute a residue present in other Pellino
polypeptides at that position in the alignment shown in Table 1.
Conversely, if a change is made to the Pellino amino acid sequence
resulting in substitution of one or more Table 1 consensus sequence
residue(s) for the Pellino residue(s) at those positions, it is
less likely that such an alteration will affect Pellino polypeptide
function. Embodiments of the invention include Pellino polypeptides
and fragments of Pellino polypeptides comprising altered amino acid
sequences. Altered Pellino polypeptide sequences share at least
30%, or more preferably at least 40%, or more preferably at least
50%, or more preferably at least 55%, or more preferably at least
60%, or more preferably at least 65%, or more preferably at least
70%, or more preferably at least 75%, or more preferably at least
80%, or more preferably at least 85%, or more preferably at least
90%, or more preferably at least 95%, or more preferably at least
97.5%, or more preferably at least 99%, or most preferably at least
99.5% amino acid identity with the Pellino amino acid sequences of
SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, and SEQ ID
NO:12. TABLE-US-00001 TABLE 1 Amino Acid Sequence Comparison
between Pellino Polypeptides from Different Species SEQ ID NO: 1 50
Hs Pellino-1 4
.about..about..about..about..about..about..about..about..about..about.
.about..about..about..about..about..about..about..about..about..about.
.about..about..about..about..about..about..about..about..about..about.
.about.MFSPdQEnH ..PsKaPVKY Mm Pellino-1 2
.about..about..about..about..about..about..about..about..about..about.
.about..about..about..about..about..about..about..about..about..about.
.about..about..about..about..about..about..about..about..about..about.
.about.MFSPdQEnH ..PsKaPVKY Hs Pellino-2 8
.about..about..about..about..about..about..about..about..about..about.
.about..about..about..about..about..about..about..about..about..about.
.about..about..about..about..about..about..about..about..about..about.
.about.MFSPGQEeH cAPnKEPVKY Mm Pellino-2 6
.about..about..about..about..about..about..about..about..about..about.
.about..about..about..about..about..about..about..about..about..about.
.about..about..about..about..about..about..about..about..about..about.
.about.MFSPGQEep sAPnKEPVKY Hs Pellino-3 12
.about..about..about..about.mvlegn pevgsprtsd lqhrgnkgsc vlsSPGed..
aqPgeEPiKY Dm Pellino 13
.about..about..about..about..about..about..about..about..about..about.
.about..about..about..about..about..about..about..about..about.m
vkrtdgtesp ilaedGgdgH dkpr...lrY Ci Pellino 14 mkqegmdvsa
spalavaggm pmdiqfeaga syhnfsQEda pkedegdiiY Ce Pellino 15
.about..about..about..about..about..about..about..about..about..about.
.about..about..about..about..about..about..about..about..about..about.
.about.mvdeselen gtpSPpaysn eAildddi.Y consensus
.about..about..about..about..about..about..about..about..about.-
.about.
.about..about..about..about..about..about..about..about..about..ab-
out.
.about..about..about..about..about..about..about..about..about..about-
. .about.MFSPGQE-H -AP-KEPVKY 51 100 Hs Pellino-1 4 GELIVLGYNG
sLPNGDRGRR .KSRFALfKR PKANGVKPST VHIacTPQA. Mm Pellino-1 2
GELIVLGYNG sLPNGDRGRR .KSRFALfKR PKANGVKPST VHIacTPQA. Hs Pellino-2
8 GELvVLGYNG aLPNGDRGRR .KSRFALyKR PKANGVKPST VHviSTPQA. Mm
Pellino-2 6 GELvVLGYNG aLPNGDRGRR .KSRFALyKR tyAsGVKPST iHmVSTPQA.
Hs Pellino-3 12 GELIVLGYNG cLasGDkGRR .rSRlALsrR shANGVKPdv
mHhiSTPlv. Dm Pellino 13 GELviLGYNG yLPqGDRGRR .rSkFvLhKR
teAsGVKrSk hyIVqsPQt. Ci Pellino 14 GqLIVLGtNG qLPtGDkGRR
.rScFtLrrk rKAtGVKPSd qHqVyqkash Ce Pellino 15 GELIlLGfNG
qaeNratskR yltekvLrrR dsANGiKkcT VHnVST..sd consensus GELIVLGYNG
-LPNGDRGRR -KSRFAL-KR PKANGVKPST VHTVSTPQA- 101 150 Hs Pellino-1 4
aKAISNKdQH SISYTLSRaQ TVVVEYTHDS nTDMFQIGRS TESPIDFVVT Mm Pellino-1
2 aKAISNKdQH SISYTLSRaQ TVVVEYTHDS nTDMFQIGRS TESPIDFVVT Hs
Pellino-2 8 SKAIScKgQH SISYTLSRnQ TVVVEYTHDk dTDMFQvGRS TESPIDFVVT
Mm Pellino-2 6 SKAISsrghH SISYTLSRsQ TVVVEYTEDk dTDMFQvGRS
TESPIDFVVT Hs Pellino-3 12 SKAlSNrgQH SISYTLSRsh sViVEYTHDS
dTDMFQIGRS TEnmIDFVVT Dm Pellino 13 SKAIldanQH SISYTLSRnQ
aViVEYkeDt eTDMFQvGRS sESPIDFVVm Ci Pellino 14 SetflsKdhH
SvSYTLpRs. vVVVpYvHDd nsDMFQIGRS TEePIDFVlm Ce Pellino 15
tKltkdKarH tvSfhsdsnk sVViEYaaDp skDMFQIGRa sddqIDFtVi consensus
SKAISNK-QH SISYTLSR-Q TVVVEYTHDS -TDMFQIGRS TESPIDFVVT 151 200 Hs
Pellino-1 4 DT....VPGS ....QsnsDt QSvQ.....S TISRFACRIi CeRNpPfTAR
Mm Pellino-1 2 DT....VPGS ....QsnsDt QSvQ.....S TISRFACRIi
CeRspPfTAR Hs Pellino-2 8 DT....isGS ....Qntdea QitQ.....S
TISRFACRIv CDRNePYTAR Mm Pellino-2 6 DT....VsGg ....Qned.a
QitQ.....S TISRFACRIv CDRNePYTAR Hs Pellino-3 12 DT....sPGg
.....gaaeg pSaQ.....S TISRyACRIl CDRrpPYTAR Dm Pellino 13
DT....lPGd ....kk..Da kvmQ.....S TISRFACRIl vnRcePakAR Ci Pellino
14 Di....eaGS siptnhkpqt QpkQ.....S TISRFACRIv CDRehPYTsR Ce
Pellino 15 DTwmflpehS daavparpqi dvlekgdrtS TISRFACRIl iDRensnkAy
consensus DT----VPGS ----Q---D- QS-Q-----S TISRFACRI- CDRN-PYTAR
201 250 Hs Pellino-1 4 IYAAGFDSSK NIFLGEKAAK WKT.sDGq.. MDGLTTNGVL
VMHPRnGFT. Mm Pellino-1 2 IYAAGFDSSK NIFLGEKAAK WKT.sDGq..
MDGLTTNGVL VMHPRnGFT. Hs Pellino-2 8 IfAAGFDSSK NIFLGvKAAK
WKn.pDGh.. MDGLTTNGVL VMHPRGGFT. Mm Pellino-2 6 IfAAGFDSSK
NIFLGEKAAK WKn.pDGh.. MDGLTTNGVL VMHPqGGFT. Hs Pellino-3 12
IYAAGFDaSs NIFLGErAAK WrT.pDGl.. MDGLTTNGVL VMHPaGGFs. Dm Pellino
13 IfAAGFDSSr NIFLGEKAtK Wqd..nve.. iDGLTTNGVL iMHPkGsFcg Ci
Pellino 14 IYAAGFDtSm NIiLGEKApK WtTeqnGkki iDGLTTNGVL iMqPknGFs.
Ce Pellino 15 lYAAGFDahq NIsinkKslK W.TksnGe.. vDGLTTNGVL
llHPnkddll consensus IYAAGFDSSK NIFLGEKAAK WKT--DG--- MDGLTTNGVL
VMHPRGGFT- 251 300 Hs Pellino-1 4 EDS..KPGi. WREISVCGnV fsLRETRSAQ
QRGKmVEiET NqLQDGSLID Mm Pellino-1 2 EDS..KPGi. WREISVCGnV
fsLRETRSAQ QRGKmVEiET NqLQDGSLID Hs Pellino-2 8 EeS..qPGV.
WREISVCGdV YtLRETRSAQ QRGKLVEsET NVLQDGSLID Mm Pellino-2 6
EeS..qPGV. WREISVCGdV YtLRETRSAQ QRGKLVEsET NVLQDGSLID Hs Pellino-3
12 EDS..aPGV. WREISVCGnV YtLRdsRSAQ QRGKLVEnEs NVLQDGSLID Dm
Pellino 13 gna..KcGl. WREcSVgGdV fsLREsRSAQ QkGqpiydEc NiLQDGtLID
Ci Pellino 14 EsS..tPtq. WkEtSVCGni YqLREsRSAQ lpGirmpedn
NVLvnGtLID Ce Pellino 15 dDtvdKPmyk WREvSinGdV YepRvTRSss
akGvfVpewT NmLQDGtLID consensus EDS--KPGV- WREISVCG-V Y-LRETRSAQ
QRGKLVE-ET NVLQDGSLID 301 350 Hs Pellino-1 4 LCGATLLWRT AeGLsHTPTv
KHLEALRQEI NAARPQCPVG fNTLAFPSmk Mm Pellino-1 2 LCGATLLWRT
AeGLsHTPTv KHLEALRQEI NAARPQCPVG fNTLAFPSmk Hs Pellino-2 8
LCGATLLWRT AdGLfHTPTq KHiEALRQEI NAARPQCPVG LNTLAFPSin Mm Pellino-2
6 LCGATLLWRT AdGLfHaPTq KHiEALRQEI NAARPQCPVG LNTLAFPSin Hs
Pellino-3 12 LCGATLLWRT paGLlraPTl KqLEAqRQEa NAARPQCPVG LsTLAFPSpa
Dm Pellino 13 LCGATLLWRs AeGLqHsPTk hdLEkLidaI NAgRPQCPVG
LNTLviPrkv Ci Pellino 14 LCGATLLWRs sshercmPTp lHideLihkl
NlgRPQCPVG LtTLAFPrrs Ce Pellino 15 LCGATiLWRT AdGLersPkm
reLEmaldrl SAgRPQCPVn LNTLviPkkr consensus LCGATLLWRT A-GL-HTPT-
KHLEALRQEI NAARPQCPVG LNTLAFPS-- 351 400 Hs Pellino-1 4 R.KDVVDEKQ
PWVYLNCGHV HGYHNWGnkE ERdgkdRECP MCRSVGP.YV Mm Pellino-1 2
R.KDVVDEKQ PWVYLNCGHV HGYHNWGnkE ERdgkdRECP MCRSVGP.YV Hs Pellino-2
8 R.KeVVeEKQ PWaYLsCGHV HGYHNWGhRs dteAnERECP MCRtVGP.YV Mm
Pellino-2 6 R.KeVVeEKQ PWaYLsCGHV HGYHsWGhRs daeAnERECP MCRtVGP.YV
Hs Pellino-3 12 RgrtapDkqQ PWVYvrCGHV HGYHgWGcRr ERGpqERECP
lCRlVGP.YV Dm Pellino 13 nigDqVn..Q PyVYLNCGHV qGhHdWGqdE
ntGA..RrCP MClelGP.vV Ci Pellino 14 katket.EKQ PWVYLqCGHV
HGrieWGyqg E...eERiCP lCRSVGk.YV Ce Pellino 15 ngrq.inrrQ
PyVYLqCGHV qGrHeWGvqE nsGqrsgkCP iClveseriV consensus R-KDVVDEKQ
PWVYLNCGHV HGYHNWG-RE ERGA-ERECP MCRSVGP-YV 401 500 Hs Pellino-1 4
PLWLGCEAGF YVDAGPPTHA FsPCGHVCSE KTtaYWSQIP LPHGTHtFHA Mm Pellino-1
2 PLWLGCEAGF YVDAGPPTHA FsPCGHVCSE KTtaYWSQIP LPHGTHtFHA Hs
Pellino-2 8 PLWLGCEAGF YVDAGPPTHA FtPCGHVCSE KsAKYWSQIP LPHGTHAFHA
Mm Pellino-2 6 PLWLGCEAGF YVDAGPPTHA FtPCGHVCSE KsAKYWSQIP
LPHGTHAFHA Hs Pellino-3 12 PLWLGqEAGl clDpGPPsHA FaPCGHVCSE
KTArYWaQtP LPHGTHAFHA Dm Pellino 13 tLcmGlEpaF YVDvGaPTyA
FnPCGHmatE KTvKYWanve iPHGTngFqA Ci Pellino 14 PLWvGgEpaF
YVDiGPPsyc FvPCGHVCSq KTAiYWSQta LPHGTqAysA Ce Pellino 15
qLsmGmEpsF hlDsGvldHt FnPCGHmaSk qTvlYWSrIP LPqGTcrydp consensus
PLWLGCEAGF YVDAGPPTHA F-PCGHVCSE KTAKYWSQIP LPHGTHAFHA 451 486 Hs
Pellino-1 4 ACPFCAhQLA GEQGYIrLIF
QGPLD*.about..about..about..about.
.about..about..about..about..about..about. Mm Pellino-1 2
ACPFCAhQLA GEQGYIrLIF QGPLD*.about..about..about..about.
.about..about..about..about..about..about. Hs Pellino-2 8
ACPFCATQLv GEQncIkLIF QGPiD*.about..about..about..about.
.about..about..about..about..about..about. Mm Pellino-2 6
ACPFCATQLv GEQnCIkLIF QGPvD*.about..about..about..about.
.about..about..about..about..about..about. Hs Pellino-3 12
ACPFCgawLt GEhGcvrLIF QGPLD*.about..about..about..about.
.about..about..about..about..about..about. Dm Pellino 13 vCPFCATpLd
GatGYIkLIF QdnLD.about..about..about..about..about.
.about..about..about..about..about..about. Ci Pellino 14 ACPFCATpLe
GdlGYkkLIF QqPLD.about..about..about..about..about.
.about..about..about..about..about..about. Ce Pellino 15 vCPFCyqlLA
tErpfvrLIF Qdncfdddti rfsnea consensus ACPFCATQLA GEQGYI-LIF
QGPLD.about..about..about..about..about.
.about..about..about..about..about..about.
[0163] The human Pellino-1, -2, and -3 coding sequences were
compared with publicly available preliminary human genomic DNA
sequences, and the following chromosome 2, 14, and 11 contigs were
identified as containing human Pellino-1, -2, and -3 coding
sequences, respectively: AC013466.3 (Pellino-1), AL138995.4 and
AL355073.4 (Pellino-2), and AC027270.3 (Pellino-3). The approximate
positions of the exons containing Pellino-1, -2, and -3 coding
sequences in the above contigs are shown in the table below, along
with their locations relative to SEQ ID NOs 3, 7, and 11; note that
the 5' and 3' untranslated regions may extend further along the
contig sequence beyond those portions that correspond to SEQ ID NOs
3, 7, and 11, as indicated by the parentheses around the contig
endpoints in the table. Note also that the positions of exon
boundaries are very highly conserved within the human Pellino-1,
-2, and -3 coding sequences, with the differences in exon size
primarily occurring in Exon 1, with Pellino-2 having two additional
codons in Exon 1 relative to Pellino-1, and Pellino-3 having 27
additional codons in Exon 1 relative to Pellino-1. Due to the
preliminary sequence and assembly of the contig sequence, the exons
within the contig are not always in the right order or orientation
with respect to each other, and may contain sequence variations due
to inaccurate sequence data or allelic polymorphism. For example,
the genomic contig AC013466.3 has two copies of the Pellino-1 Exon
2 sequence present in opposite orientations with respect to each
other, as indicated in the table below.
[0164] Corresponding positions of Pellino-1, -2, and -3 gene exons
in human contigs and in cDNA sequences: TABLE-US-00002 Position of
Pellino-1 exons in AC013466.3 Position in SEQ ID NO: 3 Exon 1
(32275)-32205 .sup. 1-71 Exon 2 28794-28666; 74461-74589 72-201
Exon 3 78789-78890 202-303 Exon 4 82682-82879 304-501 Exon 5
82979-83167 502-690 Exon 6 .sup. 84024-(84590) 691-1257 Position of
Pellino-2 exons in AL138995.4 Position in SEQ ID NO: 7 Exon 1
(81889)-81965 .sup. 1-77 Exon 2 141562-141691 78-207 Position of
Pellino-2 exons in AL355073.4 Position in SEQ ID NO: 7 Exon 3
81379-81480 208-309 Exon 4 90140-90337 310-507 Exon 5 91971-92159
508-696 Exon 6 .sup. 98303-(98869) 697-1263 Position of Pellino-3
exons in AC027270.3 Position in SEQ ID NO: 11 Exon 1 (16496)-16646
.sup. 1-152 Exon 2 19608-19737 153-282 Exon 3 75962-76063 283-384
Exon 4 76834-77027 385-579 Exon 5 77329-77521 580-772 Exon 6 .sup.
79193-(79754) 773-1338
[0165] The genomic sequences comprising human Pellino-1 exons map
to the 2p13.3 region of human chromosome 2. Human Pellino nucleic
acids such as SEQ ID NO:3 and fragments thereof are useful for the
cytological identification of this chromosomal region, and for the
genomic mapping of human genetic disorders such as the following
disorders that have been mapped to this region:
Preeclampsia/Eclampsia gene 1, Alstrom Syndrome, Parkinson Disease
gene 3, Orofacial Cleft gene 2, and Welander Distal Myopathy. The
genomic sequences comprising human Pellino-2 exons map to the
14q24.3 region of human chromosome 14. Human Pellino nucleic acids
such as SEQ ID NO:7 and fragments thereof are useful for the
cytological identification of this chromosomal region, and for the
genomic mapping of human genetic disorders such as the following
disorders that have been mapped to this region: Achromatopsia gene
1, Hereditary Benign Chorea, Multinodular Goiter, Myopathy
(Distal), Tyrosinemia Type I B, and Alzheimer's Disease gene 3. The
genomic sequences comprising human Pellino-3 exons map to a region
of human chromosome 11 between 11p11.1 and 11q13, and are believed
to map most closely to the 11q12.1 region. Human Pellino nucleic
acids such as SEQ ID NO:3 and fragments thereof are useful for the
cytological identification of this chromosomal region, and for the
genomic mapping of human genetic disorders such as the following
disorders that have been mapped to this region:
Osteoporosis-Pseudoglioma Syndrome and Spinocerebellar Ataxia gene
5. Given a recent report (Schmitt-John et al., 2000, "Mouse
Homologue of the Drosophila pellino Gene, Pli on Chr 11 is Affected
in the Wobbler Mutant", Abstract B12 posted at
imgs.org/abstracts/2000abstracts/toc_b.html) suggests that murine
Pellino-1 may be the protein affected in the Wobbler mutant, which
exhibits degeneration of spinal motoneurons, it is intriguing that
all three of the human Pellino genes map near human genetic loci
involving neuromuscular defects: Welander Distal Myopathy; Myopathy
(Distal); and Spinocerebellar Ataxia gene 5 (which involves failure
of muscular coordination and/or irregularity of muscular action),
suggesting that these human genetic defects may involve defects in
human Pellino.polypeptide activity.
EXAMPLE 2
Reporter Gene Assays of Pellino Polypeptide Activity
[0166] The murine Pellino-1 coding sequence DNA was fused, in frame
at the 3' end, to DNA encoding the FLAG epitope, followed by an
in-frame stop codon. This construct was cloned into the mammalian
expression vector pDC304 (identical to pDC302, described in U.S.
Pat. No. 5,599,905, issued Feb. 4, 1997, except that the early
splice region, consisting of splice donor and acceptor sites of the
SV40 viral element, has been removed); and transfected into an
IL-1-responsive line of COS-7 cells by the DEAE-dextran method.
[0167] In order to assay the effect of the Pellino-1-FLAG
polypeptide and other forms of Pellino polypeptides on reporter
gene activity, a method essentially as described in Born et al.,
1998, J. Biol. Chem. 273: 29445-29450 (which is incorporated by
reference herein) can be used. As one example of this method, Cos7
cells were transiently transfected by the DEAE-dextran method as
described (Cosman et al., 1984, Nature 312: 768-771, which is
incorporated by reference herein), using 150 ng of the Pellino
polypeptide expression construct and 700 ng of the reporter plasmid
per 45,000 cells. Two days post-transfection, cells were stimulated
with 10 ng/ml IL-1 or 40 ng/ml IL-18 (PeproTech, Inc.) for 4 hours.
Cells were lysed and luciferase activity assessed using Reporter
Lysis Buffer and Luciferase Assay Reagent (Promega Corp.). IL 8
promoter-reporter and NFkB-dependent reporter constructs may be
used as reporter plasmids. Alternatively, the effect of Pellino
polypeptide expression may be assayed in COS-1 cells. In an
alternative preferred method, COS7 cells were grown in 12-well
dishes as described above. The cells were transiently transfected
with Pellino test plasmid, 50 ng of reporter plasmid DNA, and empty
vector, as required, to a total of 1 micrograms of total DNA per
well. After 24 hours, stimulating agents were added in a small
amount (less than 0.5% final volume) of medium or dimethyl
sulfoxide, and the cells were re-incubated for 5 hours. Cells were
lysed in luciferase Reporter Lysis Buffer (Promega, Madison Wis.,
0.25 ml per well) and luciferase activity was measured in a
EG&G/Berthold luminometer after addition of Luciferase Assay
Reagent (Promega) according to the supplier's instructions. All
results were normalized to total protein content of the lysates as
measured using the micro-BCA assay (Pierce, Rockford, Ill.).
[0168] In a preliminary experiment, expression of murine
Pellino-1-FLAG in this manner was found to partially inhibit
IL-1-induced NFkB-dependent reporter gene activity. This inhibitory
effect of Pellino-1-FLAG may have been due to over-expression of
the Pellino polypeptide, as transfecting COS cells with high
concentrations of a Pellino-1- or Pellino-2-expressing construct
has been demonstrated to have an inhibitory effect on
NFkB-dependent reporter gene activity, possibly through the
formation of homodimers or higher multimers of Pellino polypeptides
that could have inhibitory effects in contrast to stimulatory
effects of moderate concentrations of Pellino polypeptide monomers.
Other possibilities for the inhibitory effect of a preparation of
Pellino-1-FLAG on NFkB-dependent reporter gene activity are the
presence of mutated forms of the polypeptide as described below, or
the relative presence or absence of a yet-to-be-characterized
factor in a particular cell line.
[0169] However, in later experiments with a murine Pellino-1-FLAG
construct that was confirmed to comprise a wild-type Pellino-1
amino acid sequence, the wild-type Pellino-1-FLAG polypeptide had a
stimulatory effect on IL-1-induced NF-kB-dependent reporter gene
activity (see Table 2, below); wild-type Pellino-1-FLAG also
moderately augmented Jun N-terminal kinase, p38 kinase, and ERK
signaling mediated by IL-1. When expressed in COS-1 cells,
wild-type Pellino-1 polypeptide stimulates IL-8 promoter-reporter
gene activity and NF-kB-dependent reporter activity in both the
presence and absence of treatment with TNF-alpha, as compared to a
vector-only control. In similar experiments, transfection of COS
cells with moderate amounts of construct expressing wild-type
Pellino-2 polypeptide also stimulates NF-kB-dependent reporter gene
activity.
[0170] To define regions of Pellino that determine its response to
pro-inflammatory mediators, a number of mutant Pellino expression
vectors were constructed. The apparent Mr of FLAG-Pellino-1 on
SDS-PAGE gels is close to the value of 47,224 daltons calculated
from the primary sequence, indicating a lack of extensive
post-translational modification. It is therefore possible to
predict the approximate point in the primary sequence of Pellino-1
where cleavage should occur in order to generate a 30-kDa
N-terminal product. The closest residue to this theoretical point
is Phe-158; cleavage of the peptide bond preceding this residue
would result in a polypeptide with a mass of 30,044 daltons. This
region of Pellino-1 polypeptide was therefore chosen for mutation,
since it might be expected that some of the resulting mutants would
be resistant to cleavage, or otherwise altered in their response to
pro-inflammatory stimuli. Cleavage of Pellino is sensitive to a
chymotrypsin inhibitor, TPCK, and chymotrypsin has a requirement
for a large, aromatic residue on one side of its cleavage site.
Reasoning that the Pellino-cleaving enzyme might share the same
specificity determinants, we chose to mutate four of the aromatic
amino acids that are invariably found in this region in the
mammalian Pellino polypeptides. The two internal deletion mutants
were chosen to flank the predicted cleavage site, and also to
include highly conserved residues. In addition, a series of
truncation mutants, deleting residues from both amino- and
carboxyl-termini, and mutants lacking conserved cysteine residues
in the RING-finger-like domain, were constructed as follows. To
make a series of N-terminal deletions, short sense-strand
oligonucleotide primers were synthesized in which a sequence
containing a KpnI restriction site and a methionine codon was fused
to murine Pellino-1 sequences beginning with the codons for Gly-51,
Phe-100, Asp-181, and Val-231. These were used with an antisense
FLAG-BglII-adapted primer to amplify PCR fragments from murine
Pellino-1-FLAG template DNA. These fragments were re-cloned into
pDC304 vector to generate, respectively, the constructs encoding
the dN50-FLAG, dN99-FLAG, dN180-FLAG, and dN230-FLAG mutants. A
similar strategy was used to construct a series of mutants
progressively truncated at the C-terminus; antisense
oligonucleotides terminating with the codons for Thr-150, Thr-250,
and Glu-350 were synthesized in tandem with a sequence containing a
stop codon and a BglII restriction site. These primers were used to
generate PCR fragments which were subsequently cloned into pDC304
and referred to as encoding the 1-150, 1-250, and 1-350 mutants,
respectively. The constructs encoding the single amino-acid
substitutions F137L-FLAG, Y154A-FLAG, F158A-FLAG, and F165L-FLAG
were constructed using the QuickChange site-directed mutagenesis
kit (Stratagene, LaJolla, Calif.). To construct the internal
deletion mutants, d133-156-FLAG and d155-158-FLAG, we made, in each
case, a pair of PCR fragments containing a restriction site
introduced to flank the sequence to be deleted. Following
restriction digestion and purification of the PCR fragment pairs,
they were three-way ligated into pDC304 vector. A mutant was also
constructed in which four RING-finger-like domain amino acids from
Cys-333 through Cys-336 were replaced by the two-amino-acid
sequence Gly-Ser; this mutant is referred to as
C333-C336GS-FLAG.
[0171] In contrast to the effect of wild-type Pellino-1, mutant
forms of Pellino-1 polypeptides with amino acids 133-156 or amino
acids 155-158 of SEQ ID NO:2 deleted, or with 50 or 99 amino acids
of the N-terminal region of the polypeptide deleted, or with
substitutions in the RING-finger-like domain that remove cysteine
residues, inhibited IL-8 promoter-reporter gene activity in both
the presence and absence of treatment with TNF-alpha, and the
mutant form of Pellino-1 with amino acids 155-158 deleted inhibited
NF-kB-dependent reporter activity in both the presence and absence
of treatment with PMA, as compared to a vector-only control.
Stimulation of the activity of these reporter genes is consistent
with a stimulatory effect on a pro-inflammatory regulatory cascade,
while inhibition of the activity of these reporter genes is
consistent with an inhibitory effect on a pro-inflammatory
regulatory cascade. A summary of the effects of wild-type and
mutant forms of murine Pellino-1 on NF-kB-dependent reporter gene
activity is summarized in Table 2; all amino acid positions are in
reference to the amino acid sequence of SEQ ID NO:2. The "Soluble
or Insoluble" and "Cleaved?" results are described in Examples 3
and 4 below.
[0172] It can be seen from the Table below that deleting some of
the N-terminal region of the Pellino-1 polypeptide (i.e. deleting
the N-terminal 50 or 99 amino acids) generates mutants having
inhibitory activity on MAP kinase-activated signaling pathways (as
demonstrated for example by inhibition of NF-kB-dependent
transcription), but deleting more substantial portions (i.e. the
N-terminal 180 or 230 amino acids) abolishes the ability of
Pellino-1 to stimulate or to inhibit reporter gene activity.
Therefore, it should be possible to make additional N-terminal
deletion mutants of Pellino polypeptides having inhibitory activity
on NF-kB-dependent transcription, for example, a mutant in which
N-terminal amino acids corresponding to the 105, 110, 115, 120,
125, 130, 135, 140, 145, 150, 155, 160, 165, 170, or 175 N-terminal
amino acids of SEQ ID NO:2 are deleted, but which still retains
inhibitory activity. Alternatively, other residues within the
N-terminal amino acids of Pellino polypeptides corresponding to the
180 N-terminal amino acids of SEQ ID NO:2 may be deleted in order
to generate mutant forms of Pellino polypeptides having inhibitory
activity on NF-kB-dependent transcription. Similarly, mutants in
which deletions (of one to 50 amino acids and more preferably one
to 30 amino acids) are made within the central conserved domain and
the RING-finger-like domain may also exhibit inhibitory activity on
NF-kB-dependent transcription. All such mutants can be readily
tested for activity using the reporter gene assays described
herein. TABLE-US-00003 TABLE 2 Soluble or Effect on Form of
Pellino-1 Description Insoluble Cleaved? Reporter Gene
wild-type-FLAG unaltered Pellino-1 Soluble + Stimulatory
d133-156-FLAG amino acids 133-156 deleted Insoluble + Inhibitory
d155-158-FLAG amino acids 155-158 deleted Insoluble + Inhibitory
dN50-FLAG N-terminal 50 amino acids deleted Insoluble + Inhibitory
dN99-FLAG N-terminal 99 amino acids deleted Insoluble + Inhibitory
dN180-FLAG N-terminal 180 amino acids deleted Insoluble n/a
inactive dN230-FLAG N-terminal 230 amino acids deleted Insoluble
n/a inactive 1-250 only amino acids 1-250 present Insoluble +
inactive 1-350 only amino acids 1-350 present Soluble + inactive
F137L-FLAG Phe to Leu substitution at residue 137 Soluble + not
tested Y154A-FLAG Tyr to Ala substitution at residue 154 Soluble
+/- Stimulatory F158A-FLAG Phe to Ala substitution at residue 158
Soluble + Slightly Stimulatory F165L-FLAG Phe to Leu substitution
at residue 165 Soluble - Stimulatory C333-C336GS- replacement of
Cys-333 through Cys- not tested not tested Inhibitory FLAG 336 with
Gly-Ser
[0173] In similar experiments using COS cells transfected with a
reporter construct including CHOP, a p38-dependent promoter, the
d155-158-FLAG mutant form of Pellino-1 inhibited TNF-alpha
stimulation of the CHOP reporter gene activity. This result is
significant because it demonstrates that mutant forms of Pellino
polypeptides are able to inhibit multiple MAP kinase-activated
pro-inflammatory signaling pathways, as indicated by their
inhibition of both NF-kB-dependent transcription and p38-dependent
transcription. Because wild-type forms of Pellino polypeptides have
stimulatory effects on key components of the four major MAP
kinase-activated signaling pathways--stimulation of Jun N-terminal
kinase, p38 kinase, and ERK signaling, and stimulation of
NF-kB-dependent transcription--the "dominant-negative" mutant forms
of Pellino polypeptides are expected to inhibit the Jun kinase and
ERK MAP kinase-activated signaling pathways in a similar fashion to
the inhibition of the p38 and NF-kB MAP kinase-activated signaling
pathways.
EXAMPLE 3
Intracellular Localization of Pellino Polypeptides
[0174] This example describes a method for monitoring the
regulation by IL-1 (or other cytokine or molecule) of the
intracellular localization of Pellino-1 in cells. COS-7 cells
(which express an endogenous IL-1 receptor) are transfected with an
expression vector comprising FLAG-Pellino-1 as described in Example
2. Cells may also be transfected at the same time with other cDNAs
encoding proteins which mediate inflammatory signaling, such as
IL-1 Receptor-associated kinase (IRAK; GenBank NP001560).
Transfected cells are cultured for about 48 hours. IL-1 (20 ng/ml),
or another cytokine or molecule at an appropriate concentration, is
added to the culture medium for the last 15 minutes (short-term
stimulation) or 24 hours (prolonged stimulation) of this culture
period.
[0175] The cell cultures are washed with ice-cold
phosphate-buffered saline (PBS), and cell lysates are prepared by
scraping the cells into lysis buffer (a buffer containing 50 mM
Tris-chloride pH 8.0 supplemented with 1% nonidet (NP-40), 0.5%
sodium deoxycholate, 0.1 mM sodium orthovanadate, 30 mM
para-nitrophenol phosphate, 30 mM beta-glycerophosphate, 140 mM
NaCl, 5 mM dithiothreitol, 2 mM EDTA, 10 mM leupeptin, 10 mM
pepstatin A and 1 mM phenymethylsulfonyl fluoride; chemicals
purchased from Sigma, St. Louis, Mo.). Solubilization of the
cellular proteins can be facilitated by passage of the lysates
several times through 25-gauge hypodermic needles. The lysate is
centrifuged at 13,000.times.G at 4.degree. C. The supernatant at
this stage is referred to as the "soluble fraction." The remaining
pellet is solubilized in 1.times.SDS-PAGE sample buffer (Laemmli et
al., Nature 227:680; 1970); this material is referred to as the
"insoluble fraction."
[0176] In an alternate, preferred, procedure for obtaining soluble
and insoluble fractions comprising Pellino polypeptides, COS7
(monkey kidney) cells were maintained in Dulbecco's modified Eagles
medium containing 5% fetal bovine serum and supplemented with 100
units/ml penicillin and 100 micrograms/ml streptomycin at
35.degree. C. in 5% CO.sub.2. Plasmids encoding Pellino-FLAG, or
other expression plasmids, were transiently transfected into
confluent COS7 cells in 6-well tissue culture dishes (Costar) using
DEAE-dextran. At various times after transfection, cells were
scraped into 0.4 ml of an lysis/extraction buffer consisting of 50
mM Tris-HCl pH 7.8, 1% NP-40, 0.15M NaCl, 2 mM EGTA, 5 microM NaF,
30 mM .beta.-glycerophosphate, 1 mM sodium orthovanadate, 1 mM
dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 10
micrograms/ml leupeptin, and 10 micrograms/ml pepstatin A. The cell
suspensions were allowed to lyse on ice for 15 minutes and were
centrifuged (13000 rpm for 10 minutes at 4 degrees C.) in a
microcentrifuge. The supernatants were carefully removed to fresh
tubes and diluted with one-third volume of 4.times.-concentrated
SDS-PAGE sample buffer containing 2-mercaptoethanol. The
supernatant samples (`detergent-soluble` fraction) were boiled for
5 minutes. The pellets were re-extracted by resuspending them in
one half the original volume of 1.times.-concentrated SDS-PAGE
sample buffer, vortexing, and then boiling them.
[0177] Matched aliquots of soluble fraction and insoluble fraction
may then be analyzed by gel electrophoresis on 4-20% gradient
SDS-polyacrylamide gels (Novex, Invitrogen Corp., Carlsbad Calif.),
and transferred to nitrocellulose membranes, and assayed by western
immunoblotting using anti-FLAG antibodies (i.e., FLAG M2) to bind
to the protein products of the transfected cDNAs. Proteins are
visualized by incubation of western blots with
horseradish-peroxidase-conjugated anti-mouse IgG (BioRad, San
Diego, Calif.) followed by detection using the ECL system
(Amersham; Arlington Heights, Ill.).
EXAMPLE 4
Effect of Cell Stimulation on Pellino Polypeptide Localization and
Cleavage
[0178] This example describes the effect of stimulation of COS-7
cells transfected with an expression vector encoding FLAG-Pellino-1
with IL-1 or other molecules. Transfected cells are prepared
substantially as described above. In some instances, the cells are
co-transfected with a pDC304 vector containing a cDNA insert coding
for human IRAK with a tandem 3' FLAG and poly-His `tail.` In
further instances, the cells are co-transfected with a
catalytically inactive human FLAGpolyHis-IRAK expression vector in
which lysine residue 293 in the ATP-binding pocket of IRAK is
replaced with an alanine. As Drosophila Pellino was identified by
its ability to associate with Pelle, experiments in which Pellino
is coexpressed with IRAK have been performed to determine if
mammalian Pellino interacted with IRAK, the presumptive mammalian
counterpart of Pelle.
[0179] Analysis indicated that in the absence of over-expressed,
active IRAK, FLAG-Pellino-1 is largely present in the soluble
fraction as a polypeptide close to the predicted size of 46 kDa.
When IRAK is over expressed, FLAG-Pellino-1 is largely found in the
insoluble fraction, and a significant portion of the Pellino in the
insoluble fraction appeared on Western blots as a 30-kDa species.
Since it was reactive with anti-Flag antibody, the 30-kDa species
presumably consists of an amino-terminal fragment. In some
experiments, in which larger amounts of expression plasmid cDNA
were used, an additional Pellino N-terminal cleavage product of 17
kDa was detected. The 30-kDa insoluble form of Pellino-1 present in
cells transfected with wild-type IRAK migrated slightly slower than
that from cells co-transfected with kinase-inactive IRAK, which
might indicate that the 30-kDa Pellino-1 fragment was differently
phosphorylated, or perhaps modified in some other way. Similarly,
there was an overall shift in the mobility of wild-type IRAK
evident in cells which were co-transfected with Pellino-1,
consistent with a model in which both kinase-inactive IRAK and
Pellino are involved in the regulation of the state of the other's
post-translational modifications (modifications such as
phosphorylation, ubiquitinylation, myristoylation, farnesylation,
and geranylgeranylation), but kinase-inactive IRAK can neither
affect modifications to Pellino-1 nor be affected in this way by
Pellino-1. In contrast, the cleavage of Pellino-1 and relocation to
the insoluble fraction do not require the kinase activity of
IRAK.
[0180] To determine if the observed redistribution and proteolytic
processing of Pellino-1 specifically required IRAK,
Pellino-1-transfected cells were stimulated with agents that
activate NF-kB by IRAK-independent pathways such as phorbol
myristate acetate (PMA, 100 ng/ml), which is known to promote many
of the same intracellular signals as IL-1, and TNF-alpha (20
ng/ml). TNF-alpha activates NF-kB through a mechanism involving the
adaptor protein TRADD, the kinase RIP, and TRAF2, while PMA
stimulates the activity of protein kinase C which is known to
cross-talk with the NF-kB pathway. Both agents caused a
time-dependent increase in the redistribution of Pellino-1 into the
insoluble fraction, where it was mostly present as the 30-kDa
cleavage product. In both cases, 2 to 3 hours of exposure to the
stimulus was required before significant Pellino cleavage was seen.
The total amount of detectable Pellino-1 polypeptide (the sum of
soluble and insoluble fractions) was increased in the presence of
PMA or TNF-alpha, which presumably reflects a change in the net
rates of Pellino-1 synthesis and/or degradation. However,
incubation with various growth factors (epidermal growth factor
(EGF), basic fibroblast growth factor, transforming growth
factor-beta, or platelet-derived growth factor) had little or no
effect on Pellino-1; only epidermal growth factor was very weakly
active. EGF has been reported in some cells to activate NF-kB
through the induction of IkB-alpha degradation. These results are
consistent with Pellino-1 cleavage and redistribution occurring
specifically in response to stimuli which activate NF-kB, including
those with signaling mechanisms not involving IRAK. Time-course
experiments demonstrated that the cleavage and relocation of
Pellino-1 began at about two hours after induction with PMA, and at
about three hours after induction with TNF-alpha, whereas
TNF-alpha-mediated NF-kB activation is maximal in COS7 cells after
15 minutes, suggesting that cleavage and changes in the solubility
of Pellino-1 are more likely to be part of the cellular effects of
NF-kB activation than to be causally involved in the activation
process, and indicating that Pellino-1 cleavage and relocation
might depend upon de novo protein synthesis. This observation was
supported by experiments in which pretreatment of
FLAG-Pellino-1-transfected cells with the protein synthesis
inhibitor cycloheximide largely prevented the ability of PMA to
subsequently induce Pellino-1 cleavage and relocation.
[0181] In an effort to determine which protease might be involved
in the regulation of Pellino-1 cleavage, COS7 cells transfected
with a Pellino-1-expressing construct were treated with PMA
together with inhibtors of different classes of proteinases as
shown in Table 3 below. TABLE-US-00004 TABLE 3 Effects of Various
Protease Inhibitors on Pellino-1 Cleavage and Relocation Inhibitor
Enzyme Inhibited Effect Lactacystin (20 microM) 20S proteasome none
MG132 (10 microM) 26S proteasome none Z-VAD-FMK (20 microM)
Caspases 1, 3, 4, 7 none Z-DEVD-FMK (20 microM) Caspases 3, 6, 7,
8, 10 none ALLN (20 microM) Calpains 1 & 2, none Cathepsins B
& L, Neutral cysteine proteases Cycloheximide (40 microM)
Protein synthesis inhibition TPCK (20 microM) Serine proteases
inhibition (Chymotrypsins)
[0182] These results indicated that a member of the
chymotrypsin-like serine protease family was involved in the
cleavage and relocation of Pellino-1. This is in contrast to other,
known pathways of IL-1 and/or TNF-alpha signaling, which were shown
to involve caspase activation (for example, TNF-induced apoptosis;
Rath et al., J. Clin. Immunol. 19:350, 1990), or the proteasome
(for example, IL-1-induced degradation of IkB; Karin et al., Semin.
Immunol. 2000. 12:85, 2000). The slow kinetics of Pellino-1
processing would be consistent with a requirement for de novo
protein synthesis, consistent with this, treatment of COS7 cells
with the protein synthesis inhibitor cycloheximide completely
prevented its PMA-induced cleavage. It is therefore possible that
PMA induces the synthesis of a proteinase which cleaves Pellino, or
the synthesis of some accessory factor for a
constitutively-expressed proteinase. These results have additional
important implications for the mechanism involved in Pellino
polypeptide processing. MG-132 (26) and ALLN (27, 28), through
their ability to prevent the proteasome-mediated degradation of
IkB, are both potent inhibitors of NF-kB activation. It follows
that Pellino processing, which is insensitive to MG132 and ALLN,
cannot be dependent upon cellular events downstream of IkB
degradation. Although TPCK is also well-established as an inhibitor
of IkB degradation, the fact that the other proteasome inhibitors
do not block Pellino-1 cleavage, as discussed above, excludes this
as the underlying mechanism for TPCK's effectiveness.
[0183] For a 30 kDa Pellino-1 fragment to be generated, proteolytic
cleavage would be predicted to occur within the region of amino
acids 132 to 189 of SEQ ID NO:2. Examination of the amino acid
sequence of Pellino-1 shows it has been extremely well conserved in
those species for which EST sequence data is available (murine and
human Pellino-1 and Pellino-2, disclosed herein; Drosophila
pellino, GenBank accession number AF091624; and the F25B4.2 gene
product of Caenorhabditis elegans, GenBank accession number
U64842). A number of conserved phenylalanine and tyrosine residues
are present in this region, any of which might serve as the
recognition site for a chymotypsin-like serine protease.
EXAMPLE 5
GST-Pellino Fusion Polypeptides
[0184] This example describes the construction and expression of a
recombinant Glutathione S-transferase (GST)-Pellino-1 fusion
protein. PCR primers were synthesized having the sequences
ATATTCACTGAATTCTGATGTTTTCTCCTGATCAA (Primer 1; SEQ ID NO:9) and
AGTGAATATGAATTCCTACTTATCATCGTCATCTTTG (Primer 2; SEQ ID NO:10), for
the sense and antisense primers, respectively. These were designed
for use with a Pellino-1-FLAG template, and add a EcoRI site to
each end of the amplified product. This PCR product was ligated
into the unique EcoRI cloning site of the vector pGEX2T (described
in EP 0293249-A) such that the coding sequences of the glutathione
S-transferase gene and FLAG-Pellino-1 were in the same frame. E
coli strain DH10B were transformed with the resultant vector and a
one-liter culture was grown. Transcription of the
GST-Pellino-1-FLAG gene was induced by addition of IPTG (0.1 mM) to
the bacterial culture for three hours. Bacterial cells were
harvested and lysed according to methods well known in the art
(see, for example, Smith D. B., Johnson K. S.; Gene
67:31-40(1988)). The lysate containing solubilized
GST-Pellino-1-FLAG was purified on 1 ml of Glutathione-Agarose
beads (Pharmacia), according to the directions supplied by the
manufacturer.
EXAMPLE 6
Anti-Pellino Monoclonal Antibodies
[0185] This example illustrates the preparation of monoclonal
antibodies against Pellino polypeptides. Preparations of purified
recombinant Pellino polypeptides, for example, or transfected cells
expressing high levels of Pellino polypeptides, are employed to
generate monoclonal antibodies against Pellino polypeptides using
conventional techniques, such as those disclosed in U.S. Pat. No.
4,411,993. DNA encoding Pellino polypeptides can also be used as an
immunogen, for example, as reviewed by Pardoll and Beckerleg in
Immunity 3:165, 1995. Such antibodies are likely to be useful as
components of diagnostic or research assays for Pellino or Pellino
activity, or in affinity purification of Pellino polypeptides.
[0186] To immunize rodents, Pellino immunogen (for example, a
Pellino-1 peptide comprising amino acids 2 through 20, amino acids
118 through 131, or amino acids 318 through 340 of SEQ ID NOs 2 and
4), preferably coupled to an immunogenic molecule such as keyhole
limpet hemocyanin, is emulsified in an adjuvant (such as complete
or incomplete Freund's adjuvant, alum, or another adjuvant, such as
Ribi adjuvant R700 (Ribi, Hamilton, Mont.), and injected in amounts
ranging from 10-100 micrograms subcutaneously into a selected
rodent, for example, BALB/c mice or Lewis rats. DNA may be given
intradermally (Raz et al., Proc. Natl. Acad. Sci. USA 91:9519,
1994) or intramuscularly (Wang et al., Proc. Natl. Acad. Sci. USA
90:4156, 1993); saline has been found to be a suitable diluent for
DNA-based antigens. Ten days to three weeks days later, the
immunized animals are boosted with additional immunogen and
periodically boosted thereafter on a weekly, biweekly or every
third week immunization schedule.
[0187] Serum samples are periodically taken by retro-orbital
bleeding or tail-tip excision for testing by dot-blot assay
(antibody sandwich), ELISA (enzyme-linked immunosorbent assay),
immunoprecipitation, or other suitable assays, including FACS
analysis. Following detection of an appropriate antibody titer,
positive animals are given an intravenous injection of antigen in
saline. Three to four days later, the animals are sacrificed,
splenocytes harvested, and fused to a murine myeloma cell line
(e.g., NSI or preferably Ag 8.653 [ATCC CRL [580]). Hybridoma cell
lines generated by this procedure are plated in multiple microtiter
plates in a selective medium (for example, one containing
hypoxanthine, aminopterin, and thymidine, or HAT) to inhibit
proliferation of non-fused cells, myeloma-myeloma hybrids, and
splenocyte-splenocyte hybrids.
[0188] Hybridoma clones thus generated can be screened by ELISA for
reactivity with Pellino polypeptides, for example, by adaptations
of the techniques disclosed by Engvall et al., Immunochem. 8:871
(1971) and in U.S. Pat. No. 4,703,004. A preferred screening
technique is the antibody capture technique described by Beckman et
al., J. Immunol. 144:4212 (1990). Positive clones are then injected
into the peritoneal cavities of syngeneic rodents to produce
ascites containing high concentrations (>1 mg/ml) of
anti-Pellino monoclonal antibody. The resulting monoclonal antibody
can be purified by ammonium sulfate precipitation followed by gel
exclusion chromatography. Alternatively, affinity chromatography
based upon binding of antibody to protein A or protein G can also
be used, as can affinity chromatography based upon binding to
Pellino polypeptide.
EXAMPLE 7
Northern Blot Analysis of Pellino-1 Expression
[0189] A 234-bp PCR fragment corresponding to the predicted 3' end
of the human Pellino-1 mRNA was generated by standard amplification
methods. The PCR fragment was purified (Qiagen PCR purification
kit) and labeled by the Gibco Random Prime Oligonucleotide DNA
Labeling kit. The cDNA riboprobe was denatured at 100 degrees C.
for 5 minutes and placed on ice. The cDNA probe was denatured at
100 degrees C. for 5 minutes before being added to the
hybridization solution. A multi-tissue northern blot containing RNA
from human tissues--brain, heart, skeletal muscle, colon (no
mucosa), thymus, spleen, kidney, liver, small intestine, placenta,
lung, and peripheral blood leukocytes--was purchased from Clonetech
(Palo Alto, Calif.). The blot was blocked in 5 mL ExpressHyb
Solution for 30 minutes at 68 degrees C. Fresh ExpressHyb solution
containing the denatured radiolabeled cDNA probe was added to the
membrane and incubated at 68 degrees C. for 1 hour with continuous
shaking. The blot was rinsed in 2.times.SSC, 0.05% SDS with four
changes at room temperature for 40 minutes, followed by a wash in
0.1.times.SSC, 0.1% SDS with two changes for 40 minutes at 50
degrees C. The riboprobe for Pellino-1 hybridized to the Northern
blot with a major band at 4.4 kilobases in all tissues represented,
with an increased level of expression evident in peripheral blood
leukocytes, lung, placenta, liver, kidney, skeletal muscle, and
brain. The message appears to be more highly expressed in
peripheral blood leukocytes, and in this tissue there seems to be
two additional bands at 7.5 and 9.5 kb which do not appear in the
lanes for the other tissues. The cDNA for human Pellino-1 is
predicted to include 1251 base pairs in the coding region and 1931
base pairs in the 3' untranslated region, and no evidence for
alternative splicing has yet been identified.
[0190] The specification is most thoroughly understood in light of
the teachings of the references cited within the specification
which are hereby incorporated by reference. The embodiments within
the specification provide an illustration of embodiments of the
invention and should not be construed to limit the scope of the
invention. The skilled artisan readily recognizes that many other
embodiments are encompassed by the invention. The relevant
disclosures of references cited herein are specifically
incorporated by reference.
[0191] Sequences Presented in the Sequence Listing TABLE-US-00005
Sequence SEQ ID NO Type Description SEQ ID NO: 1 Nucleotide Murine
(Mus musculus) Pellino-1 coding sequence SEQ ID NO: 2 Amino acid
Murine (Mus musculus) Pellino-1 amino acid sequence SEQ ID NO: 3
Nucleotide Human (Homo sapiens) Pellino-1 coding sequence SEQ ID
NO: 4 Amino acid Human (Homo sapiens) Pellino-1 amino acid sequence
SEQ ID NO: 5 Nucleotide Murine (Mus musculus) Pellino-2 coding
sequence SEQ ID NO: 6 Amino acid Murine (Mus musculus) Pellino-2
amino acid sequence SEQ ID NO: 7 Nucleotide Human (Homo sapiens)
Pellino-2 coding sequence SEQ ID NO: 8 Amino acid Human (Homo
sapiens) Pellino-2 amino acid sequence SEQ ID NO: 9 Nucleotide PCR
primer SEQ ID NO: 10 Nucleotide PCR primer SEQ ID NO: 11 Nucleotide
Human (Homo sapiens) Pellino-3 coding sequence SEQ ID NO: 12 Amino
acid Human (Homo sapiens) Pellino-3 amino acid sequence SEQ ID NO:
13 Amino acid Fruit fly (Drosophila melanogaster) Pellino (GenBank
AAC96298 ) SEQ ID NO: 14 Amino acid Ascidian (Sea squirt, Ciona
intestinalis) Pellino (GenBank BAB00628) SEQ ID NO: 15 Amino acid
Nematode (Caenorhabditis elegans) Pellino (GenBank CAB97346 )
[0192]
Sequence CWU 1
1
15 1 1257 DNA Mus musculus 1 atgttttctc ctgatcaaga aaatcatcct
tccaaagccc cagtaaaata tggcgaactc 60 attgtcttag gatataatgg
atctctccca aacggtgata gaggaaggag gaaaagtagg 120 tttgctttgt
ttaaaagacc taaggcaaat ggggtgaagc ctagcaccgt gcacattgca 180
tgtactcctc aggctgccaa ggcaataagc aacaaggacc agcatagcat atcatatact
240 ttatctcgag cccagacggt ggtggttgaa tatactcatg acagcaacac
tgatatgttt 300 cagattggtc ggtcaactga aagtcctatt gattttgtag
taactgacac cgttcctgga 360 agtcagagta attccgacac gcagtcagta
caaagcacta tatcaagatt tgcctgtagg 420 atcatatgtg agcgcagtcc
cccctttaca gctcggattt atgctgcagg gtttgattca 480 tcaaaaaaca
tctttcttgg ggagaaggct gccaagtgga agacatctga tgggcagatg 540
gatggcttga ccactaatgg agttcttgtg atgcatccac gtaatgggtt cacagaagac
600 tccaaacctg gaatatggag agaaatatca gtatgtggga atgtcttcag
tctgcgtgaa 660 accagatcag ctcagcagag aggaaagatg gtggaaattg
aaaccaatca gctacaagat 720 ggctccttaa ttgacctttg tggtgcaacc
ttgctgtggc gtactgcaga aggcctttcc 780 catactccta ctgtgaagca
cttagaagct ttaagacagg agatcaatgc agctcggccg 840 cagtgccctg
tagggttcaa cacactagcc ttccccagta tgaagaggaa ggatgttgta 900
gatgaaaagc aaccatgggt atatctaaac tgcggccatg tccatggtta tcataactgg
960 ggaaacaaag aagaacgtga cggcaaagat cgtgaatgtc ctatgtgtag
gtctgttggt 1020 ccctatgtcc ctctgtggct tggatgtgaa gctggatttt
atgtggacgc cggccctccc 1080 acccatgcct ttagcccctg tgggcacgtg
tgttcagaaa agacaacggc ttactggtcc 1140 cagatcccac ttcctcatgg
tacgcacact tttcatgcag cctgcccctt ctgtgcacat 1200 cagttggctg
gtgaacaagg ctatatcaga cttattttcc aaggaccttt agactag 1257 2 418 PRT
Mus musculus 2 Met Phe Ser Pro Asp Gln Glu Asn His Pro Ser Lys Ala
Pro Val Lys 1 5 10 15 Tyr Gly Glu Leu Ile Val Leu Gly Tyr Asn Gly
Ser Leu Pro Asn Gly 20 25 30 Asp Arg Gly Arg Arg Lys Ser Arg Phe
Ala Leu Phe Lys Arg Pro Lys 35 40 45 Ala Asn Gly Val Lys Pro Ser
Thr Val His Ile Ala Cys Thr Pro Gln 50 55 60 Ala Ala Lys Ala Ile
Ser Asn Lys Asp Gln His Ser Ile Ser Tyr Thr 65 70 75 80 Leu Ser Arg
Ala Gln Thr Val Val Val Glu Tyr Thr His Asp Ser Asn 85 90 95 Thr
Asp Met Phe Gln Ile Gly Arg Ser Thr Glu Ser Pro Ile Asp Phe 100 105
110 Val Val Thr Asp Thr Val Pro Gly Ser Gln Ser Asn Ser Asp Thr Gln
115 120 125 Ser Val Gln Ser Thr Ile Ser Arg Phe Ala Cys Arg Ile Ile
Cys Glu 130 135 140 Arg Ser Pro Pro Phe Thr Ala Arg Ile Tyr Ala Ala
Gly Phe Asp Ser 145 150 155 160 Ser Lys Asn Ile Phe Leu Gly Glu Lys
Ala Ala Lys Trp Lys Thr Ser 165 170 175 Asp Gly Gln Met Asp Gly Leu
Thr Thr Asn Gly Val Leu Val Met His 180 185 190 Pro Arg Asn Gly Phe
Thr Glu Asp Ser Lys Pro Gly Ile Trp Arg Glu 195 200 205 Ile Ser Val
Cys Gly Asn Val Phe Ser Leu Arg Glu Thr Arg Ser Ala 210 215 220 Gln
Gln Arg Gly Lys Met Val Glu Ile Glu Thr Asn Gln Leu Gln Asp 225 230
235 240 Gly Ser Leu Ile Asp Leu Cys Gly Ala Thr Leu Leu Trp Arg Thr
Ala 245 250 255 Glu Gly Leu Ser His Thr Pro Thr Val Lys His Leu Glu
Ala Leu Arg 260 265 270 Gln Glu Ile Asn Ala Ala Arg Pro Gln Cys Pro
Val Gly Phe Asn Thr 275 280 285 Leu Ala Phe Pro Ser Met Lys Arg Lys
Asp Val Val Asp Glu Lys Gln 290 295 300 Pro Trp Val Tyr Leu Asn Cys
Gly His Val His Gly Tyr His Asn Trp 305 310 315 320 Gly Asn Lys Glu
Glu Arg Asp Gly Lys Asp Arg Glu Cys Pro Met Cys 325 330 335 Arg Ser
Val Gly Pro Tyr Val Pro Leu Trp Leu Gly Cys Glu Ala Gly 340 345 350
Phe Tyr Val Asp Ala Gly Pro Pro Thr His Ala Phe Ser Pro Cys Gly 355
360 365 His Val Cys Ser Glu Lys Thr Thr Ala Tyr Trp Ser Gln Ile Pro
Leu 370 375 380 Pro His Gly Thr His Thr Phe His Ala Ala Cys Pro Phe
Cys Ala His 385 390 395 400 Gln Leu Ala Gly Glu Gln Gly Tyr Ile Arg
Leu Ile Phe Gln Gly Pro 405 410 415 Leu Asp 3 1257 DNA Homo sapiens
3 atgttttctc ctgatcaaga aaatcatcca tctaaagcac cagtaaaata tggtgaactc
60 attgtcttag gatataatgg atctctccca aacggtgata gaggaaggag
gaaaagtagg 120 tttgctttgt ttaaaagacc taaggcaaat ggggtgaagc
ccagcactgt gcatattgct 180 tgtactcctc aggctgcaaa ggcaataagc
aacaaagacc agcatagcat atcatatact 240 ttatctcggg cccagactgt
ggtggttgaa tatactcatg acagcaacac cgatatgttt 300 cagattggcc
ggtcgactga aagccccatt gattttgtag taactgacac ggttcctgga 360
agtcaaagta attctgatac acagtcagta caaagcacta tatcaagatt tgcctgcaga
420 atcatatgtg aacggaatcc tccctttaca gcacggattt atgctgcagg
gtttgactca 480 tcaaaaaaca tctttcttgg ggagaaggct gccaaatgga
agacatcaga tggacagatg 540 gatggcttga ccactaatgg tgttcttgtg
atgcatccac gcaatgggtt cacagaagac 600 tccaagcctg gaatatggag
agaaatatcg gtgtgtggga atgtatttag cctacgtgaa 660 accagatcgg
ctcagcagag aggaaaaatg gtggaaattg aaaccaatca gttacaagat 720
ggctcgttaa ttgacctctg tggtgcaaca ttgttatggc gtactgcaga aggcctttcc
780 cacactccta ccgtgaagca tttagaagct ttaagacagg aaatcaatgc
agcacgacct 840 cagtgccctg tagggttcaa cacactagca tttcctagta
tgaagaggaa agacgttgta 900 gatgaaaaac aaccatgggt atatctaaac
tgcggccatg tacatggcta tcataactgg 960 ggaaacaaag aagaacgtga
tggcaaagat cgtgaatgtc ctatgtgtag gtctgttggt 1020 ccctatgttc
ctctgtggct tggatgtgaa gctggatttt atgtggacgc cggccctcca 1080
acccatgcgt ttagcccgtg tgggcatgtg tgttcagaaa agacaactgc ctattggtcc
1140 cagatcccac ttcctcatgg tactcatact tttcatgcag cctgtccctt
ttgtgcacat 1200 cagttggctg gtgaacaagg ctacatcaga cttatttttc
aaggacctct agactaa 1257 4 418 PRT Homo sapiens 4 Met Phe Ser Pro
Asp Gln Glu Asn His Pro Ser Lys Ala Pro Val Lys 1 5 10 15 Tyr Gly
Glu Leu Ile Val Leu Gly Tyr Asn Gly Ser Leu Pro Asn Gly 20 25 30
Asp Arg Gly Arg Arg Lys Ser Arg Phe Ala Leu Phe Lys Arg Pro Lys 35
40 45 Ala Asn Gly Val Lys Pro Ser Thr Val His Ile Ala Cys Thr Pro
Gln 50 55 60 Ala Ala Lys Ala Ile Ser Asn Lys Asp Gln His Ser Ile
Ser Tyr Thr 65 70 75 80 Leu Ser Arg Ala Gln Thr Val Val Val Glu Tyr
Thr His Asp Ser Asn 85 90 95 Thr Asp Met Phe Gln Ile Gly Arg Ser
Thr Glu Ser Pro Ile Asp Phe 100 105 110 Val Val Thr Asp Thr Val Pro
Gly Ser Gln Ser Asn Ser Asp Thr Gln 115 120 125 Ser Val Gln Ser Thr
Ile Ser Arg Phe Ala Cys Arg Ile Ile Cys Glu 130 135 140 Arg Asn Pro
Pro Phe Thr Ala Arg Ile Tyr Ala Ala Gly Phe Asp Ser 145 150 155 160
Ser Lys Asn Ile Phe Leu Gly Glu Lys Ala Ala Lys Trp Lys Thr Ser 165
170 175 Asp Gly Gln Met Asp Gly Leu Thr Thr Asn Gly Val Leu Val Met
His 180 185 190 Pro Arg Asn Gly Phe Thr Glu Asp Ser Lys Pro Gly Ile
Trp Arg Glu 195 200 205 Ile Ser Val Cys Gly Asn Val Phe Ser Leu Arg
Glu Thr Arg Ser Ala 210 215 220 Gln Gln Arg Gly Lys Met Val Glu Ile
Glu Thr Asn Gln Leu Gln Asp 225 230 235 240 Gly Ser Leu Ile Asp Leu
Cys Gly Ala Thr Leu Leu Trp Arg Thr Ala 245 250 255 Glu Gly Leu Ser
His Thr Pro Thr Val Lys His Leu Glu Ala Leu Arg 260 265 270 Gln Glu
Ile Asn Ala Ala Arg Pro Gln Cys Pro Val Gly Phe Asn Thr 275 280 285
Leu Ala Phe Pro Ser Met Lys Arg Lys Asp Val Val Asp Glu Lys Gln 290
295 300 Pro Trp Val Tyr Leu Asn Cys Gly His Val His Gly Tyr His Asn
Trp 305 310 315 320 Gly Asn Lys Glu Glu Arg Asp Gly Lys Asp Arg Glu
Cys Pro Met Cys 325 330 335 Arg Ser Val Gly Pro Tyr Val Pro Leu Trp
Leu Gly Cys Glu Ala Gly 340 345 350 Phe Tyr Val Asp Ala Gly Pro Pro
Thr His Ala Phe Ser Pro Cys Gly 355 360 365 His Val Cys Ser Glu Lys
Thr Thr Ala Tyr Trp Ser Gln Ile Pro Leu 370 375 380 Pro His Gly Thr
His Thr Phe His Ala Ala Cys Pro Phe Cys Ala His 385 390 395 400 Gln
Leu Ala Gly Glu Gln Gly Tyr Ile Arg Leu Ile Phe Gln Gly Pro 405 410
415 Leu Asp 5 1260 DNA Mus musculus 5 atgttttccc cgggccagga
ggaacccagc gcccccaaca aggagccggt gaaatacggg 60 gagctggtgg
tcctggggta caatggtgct ttacctaatg gtgacagggg caggaggaaa 120
agcagatttg ccctctataa gcggacctac gccagtggtg tcaaacccag cacaatccac
180 atggtctcca caccacaggc gtccaaggcc atcagctcca gaggacatca
cagcatatcg 240 tacacgttgt cacggagcca gacggtagtg gtggagtaca
cacacgataa agacacggac 300 atgtttcagg tgggcaggtc aacagaaagc
cccattgact tcgtggtcac agacacggtt 360 tccggcggtc agaacgaaga
tgcccagatc acacagagca ccatctctag gttcgcatgc 420 aggatcgtgt
gtgacaggaa cgagccatat acagcacgca tattcgcggc aggattcgat 480
tcttccaaaa atatctttct tggagagaaa gcagcaaaat ggaaaaaccc tgatggacac
540 atggatggac tcactaccaa tggtgtccta gtgatgcacc cgcaaggagg
cttcaccgag 600 gaatcccagc ctggagtctg gagagagatc tctgtctgtg
gggatgtgta caccttgcga 660 gagaccaggt cggcccagca gaggggaaag
ctggtggaaa gtgagaccaa cgtcctgcaa 720 gacggctccc tcattgacct
gtgtggggcc actctcctct ggagaaccgc agatggcctt 780 tttcacgctc
ctactcagaa gcacatagaa gccctccggc aggagatcaa tgcagcccga 840
ccccagtgcc ccgtgggcct taacaccctg gccttcccca gcatcaaccg gaaggaagtg
900 gtggaagaga agcagccctg ggcatacctg agctgcggcc atgtgcacgg
ctaccacagc 960 tggggccatc ggagcgacgc ggaagccaac gagagggagt
gtcccatgtg caggactgtg 1020 ggcccctacg tccctctctg gctgggctgt
gaggcaggat tttatgtcga tgcgggaccc 1080 ccaactcacg ctttcacccc
ctgcgggcac gtctgttcag aaaagtctgc caagtactgg 1140 tcgcagatcc
cactgcccca cggaacgcac gcgtttcatg ccgcctgtcc gttctgcgcc 1200
acgcagctgg ttggtgaaca gaactgcatc aaattgattt tccaaggtcc agtggactga
1260 6 419 PRT Mus musculus 6 Met Phe Ser Pro Gly Gln Glu Glu Pro
Ser Ala Pro Asn Lys Glu Pro 1 5 10 15 Val Lys Tyr Gly Glu Leu Val
Val Leu Gly Tyr Asn Gly Ala Leu Pro 20 25 30 Asn Gly Asp Arg Gly
Arg Arg Lys Ser Arg Phe Ala Leu Tyr Lys Arg 35 40 45 Thr Tyr Ala
Ser Gly Val Lys Pro Ser Thr Ile His Met Val Ser Thr 50 55 60 Pro
Gln Ala Ser Lys Ala Ile Ser Ser Arg Gly His His Ser Ile Ser 65 70
75 80 Tyr Thr Leu Ser Arg Ser Gln Thr Val Val Val Glu Tyr Thr His
Asp 85 90 95 Lys Asp Thr Asp Met Phe Gln Val Gly Arg Ser Thr Glu
Ser Pro Ile 100 105 110 Asp Phe Val Val Thr Asp Thr Val Ser Gly Gly
Gln Asn Glu Asp Ala 115 120 125 Gln Ile Thr Gln Ser Thr Ile Ser Arg
Phe Ala Cys Arg Ile Val Cys 130 135 140 Asp Arg Asn Glu Pro Tyr Thr
Ala Arg Ile Phe Ala Ala Gly Phe Asp 145 150 155 160 Ser Ser Lys Asn
Ile Phe Leu Gly Glu Lys Ala Ala Lys Trp Lys Asn 165 170 175 Pro Asp
Gly His Met Asp Gly Leu Thr Thr Asn Gly Val Leu Val Met 180 185 190
His Pro Gln Gly Gly Phe Thr Glu Glu Ser Gln Pro Gly Val Trp Arg 195
200 205 Glu Ile Ser Val Cys Gly Asp Val Tyr Thr Leu Arg Glu Thr Arg
Ser 210 215 220 Ala Gln Gln Arg Gly Lys Leu Val Glu Ser Glu Thr Asn
Val Leu Gln 225 230 235 240 Asp Gly Ser Leu Ile Asp Leu Cys Gly Ala
Thr Leu Leu Trp Arg Thr 245 250 255 Ala Asp Gly Leu Phe His Ala Pro
Thr Gln Lys His Ile Glu Ala Leu 260 265 270 Arg Gln Glu Ile Asn Ala
Ala Arg Pro Gln Cys Pro Val Gly Leu Asn 275 280 285 Thr Leu Ala Phe
Pro Ser Ile Asn Arg Lys Glu Val Val Glu Glu Lys 290 295 300 Gln Pro
Trp Ala Tyr Leu Ser Cys Gly His Val His Gly Tyr His Ser 305 310 315
320 Trp Gly His Arg Ser Asp Ala Glu Ala Asn Glu Arg Glu Cys Pro Met
325 330 335 Cys Arg Thr Val Gly Pro Tyr Val Pro Leu Trp Leu Gly Cys
Glu Ala 340 345 350 Gly Phe Tyr Val Asp Ala Gly Pro Pro Thr His Ala
Phe Thr Pro Cys 355 360 365 Gly His Val Cys Ser Glu Lys Ser Ala Lys
Tyr Trp Ser Gln Ile Pro 370 375 380 Leu Pro His Gly Thr His Ala Phe
His Ala Ala Cys Pro Phe Cys Ala 385 390 395 400 Thr Gln Leu Val Gly
Glu Gln Asn Cys Ile Lys Leu Ile Phe Gln Gly 405 410 415 Pro Val Asp
7 1263 DNA Homo sapiens 7 atgttttccc ctggccagga ggaacactgc
gcccccaata aggagccagt gaaatacggg 60 gagctggtgg tgctcgggta
caatggtgct ttacccaatg gagatagagg acggaggaaa 120 agtagatttg
ccctctacaa gcggcccaag gcaaatggtg tcaaacccag caccgtccat 180
gtgatatcca cgccccaggc atccaaggct atcagctgca aaggtcaaca cagtatatcc
240 tacactttgt caaggaatca gactgtggtg gtggagtaca cacatgataa
ggatacggat 300 atgtttcagg tgggcagatc aacagaaagc cctatcgact
tcgttgtcac agacacgatt 360 tctggcagcc agaacacgga cgaagcccag
atcacacaga gcaccatatc caggttcgcc 420 tgcaggatcg tgtgcgacag
gaatgaacct tacacagcac ggatattcgc cgccggattt 480 gactcttcca
aaaacatatt tcttggagta aaggcagcaa agtggaaaaa ccccgacggc 540
cacatggatg ggctcactac taatggcgtc ctggtgatgc atccacgagg gggcttcacc
600 gaggagtccc agcccggggt ctggcgcgag atctctgtct gtggagatgt
gtacaccttg 660 cgagaaacca ggtcggccca gcaacgagga aagctggtgg
aaagtgagac caacgtcctg 720 caggacggct ccctcattga cctgtgtggg
gccactctcc tctggagaac agcagatggg 780 ctttttcata ctccaactca
gaagcacata gaagccctcc ggcaggagat taacgccgcc 840 cggcctcagt
gtcctgtggg gctcaacacc ctggccttcc ccagcatcaa caggaaagag 900
gtggtggagg agaagcagcc ctgggcatat ctcagttgtg gccacgtgca cgggtaccac
960 aactggggcc atcggagtga cacggaggcc aacgagaggg agtgtcccat
gtgcaggact 1020 gtgggcccct atgtgcctct ctggcttggc tgtgaggcag
gattttatgt agacgcagga 1080 ccgccaactc atgctttcac tccctgtgga
cacgtgtgct cggagaagtc tgcaaaatac 1140 tggtctcaga tcccgttgcc
tcatggaact catgcatttc acgctgcttg ccctttctgt 1200 gctacacagc
tggttgggga gcaaaactgc atcaaattaa ttttccaagg tccaattgac 1260 tga
1263 8 420 PRT Homo sapiens 8 Met Phe Ser Pro Gly Gln Glu Glu His
Cys Ala Pro Asn Lys Glu Pro 1 5 10 15 Val Lys Tyr Gly Glu Leu Val
Val Leu Gly Tyr Asn Gly Ala Leu Pro 20 25 30 Asn Gly Asp Arg Gly
Arg Arg Lys Ser Arg Phe Ala Leu Tyr Lys Arg 35 40 45 Pro Lys Ala
Asn Gly Val Lys Pro Ser Thr Val His Val Ile Ser Thr 50 55 60 Pro
Gln Ala Ser Lys Ala Ile Ser Cys Lys Gly Gln His Ser Ile Ser 65 70
75 80 Tyr Thr Leu Ser Arg Asn Gln Thr Val Val Val Glu Tyr Thr His
Asp 85 90 95 Lys Asp Thr Asp Met Phe Gln Val Gly Arg Ser Thr Glu
Ser Pro Ile 100 105 110 Asp Phe Val Val Thr Asp Thr Ile Ser Gly Ser
Gln Asn Thr Asp Glu 115 120 125 Ala Gln Ile Thr Gln Ser Thr Ile Ser
Arg Phe Ala Cys Arg Ile Val 130 135 140 Cys Asp Arg Asn Glu Pro Tyr
Thr Ala Arg Ile Phe Ala Ala Gly Phe 145 150 155 160 Asp Ser Ser Lys
Asn Ile Phe Leu Gly Val Lys Ala Ala Lys Trp Lys 165 170 175 Asn Pro
Asp Gly His Met Asp Gly Leu Thr Thr Asn Gly Val Leu Val 180 185 190
Met His Pro Arg Gly Gly Phe Thr Glu Glu Ser Gln Pro Gly Val Trp 195
200 205 Arg Glu Ile Ser Val Cys Gly Asp Val Tyr Thr Leu Arg Glu Thr
Arg 210 215 220 Ser Ala Gln Gln Arg Gly Lys Leu Val Glu Ser Glu Thr
Asn Val Leu 225 230 235 240 Gln Asp Gly Ser Leu Ile Asp Leu Cys Gly
Ala Thr Leu Leu Trp Arg 245 250 255 Thr Ala Asp Gly Leu Phe His Thr
Pro Thr Gln Lys His Ile Glu Ala 260 265 270 Leu Arg Gln Glu Ile Asn
Ala Ala Arg Pro Gln Cys Pro Val Gly Leu 275 280 285 Asn Thr Leu Ala
Phe Pro Ser Ile Asn Arg Lys Glu Val Val Glu Glu 290 295 300 Lys Gln
Pro Trp Ala Tyr Leu Ser Cys Gly His Val His Gly Tyr His 305 310 315
320 Asn Trp Gly His Arg Ser Asp Thr Glu Ala Asn Glu Arg Glu Cys Pro
325 330 335 Met Cys Arg Thr
Val Gly Pro Tyr Val Pro Leu Trp Leu Gly Cys Glu 340 345 350 Ala Gly
Phe Tyr Val Asp Ala Gly Pro Pro Thr His Ala Phe Thr Pro 355 360 365
Cys Gly His Val Cys Ser Glu Lys Ser Ala Lys Tyr Trp Ser Gln Ile 370
375 380 Pro Leu Pro His Gly Thr His Ala Phe His Ala Ala Cys Pro Phe
Cys 385 390 395 400 Ala Thr Gln Leu Val Gly Glu Gln Asn Cys Ile Lys
Leu Ile Phe Gln 405 410 415 Gly Pro Ile Asp 420 9 35 DNA Artificial
Sequence olignonucleotide primer 9 atattcactg aattctgatg ttttctcctg
atcaa 35 10 37 DNA Artificial Sequence oligonucleotide primer 10
agtgaatatg aattcctact tatcatcgtc atctttg 37 11 1338 DNA Homo
sapiens misc_feature (513)..(513) unsure 11 atggtgctgg aaggaaaccc
tgaagtgggg tccccccgaa cctcagacct ccagcaccgg 60 gggaacaagg
gctcttgcgt tctctcctct cccggtgaag atgcgcagcc aggcgaggag 120
cccatcaagt atggtgaact catcgtcctg ggctacaatg gttgtctggc aagtggggac
180 aagggccgcc ggcgaagccg cctggcactg agccgccggt cgcacgccaa
cggggtgaag 240 ccagacgtca tgcaccacat ctccacgccg ctcgtctcca
aggcactgag taaccgtggt 300 cagcacagca tctcgtatac actgtcccgg
agccactcgg tcatagtgga gtatacacat 360 gatagcgaca cagacatgtt
ccagattggc cgctccacag agaacatgat tgacttcgtg 420 gtaacagaca
cgtcccctgg aggaggggct gccgagggcc cttctgccca gagcaccatc 480
tcccgctatg cctgccgcat cctctgtgac cgncggccac cctatactgc ccgcatctat
540 gccgctggct tcgatgcctc tagcaacatc ttccttggag agcgagcggc
caaatggcgg 600 accccagatg gcctgatgga tggactgacc accaatggag
tcctggtgat gcacccggca 660 ggcggcttct ccgaggactc agccccgggt
gtctggcggg agatctcggt ctgtgggaat 720 gtgtacacat tgcgggacag
ccgctcagcc cagcagcggg gcaagctggt agaaaacgag 780 tccaacgtgc
tgcaggacgg ctctctcatc gacctgtgtg gggccacact gctgtggcgc 840
acaccggcgg ggctgctgcg ggctcccaca ctgaagcaac tggaggccca gcggcaggag
900 gcaaatgcag cgcgccccca gtgccccgtg ggcctcagca ctctggcctt
ccccagccca 960 gcccgtggcc gcacagcgcc cgacaaacag cagccctggg
tctacgtccg ctgcgggcac 1020 gtccatggct accacggctg gggctgccgg
cgggagcggg gcccccagga gcgcgaatgt 1080 cctctctgcc gccttgtggg
gccttatgtg cctctatggc ttggccagga ggccggcctc 1140 tgcctggacc
ctgggccgcc tagccatgcc tttgcacctt gcggccacgt ctgctctgag 1200
aagactgccc gctactgggc ccagacacca ctgccccacg gcacccatgc tttccatgcc
1260 gcctgcccct tttgcggggc ctggcttacc ggcgagcatg gctgcgtccg
cctcattttc 1320 cagggcccgc tggattag 1338 12 445 PRT Homo sapiens 12
Met Val Leu Glu Gly Asn Pro Glu Val Gly Ser Pro Arg Thr Ser Asp 1 5
10 15 Leu Gln His Arg Gly Asn Lys Gly Ser Cys Val Leu Ser Ser Pro
Gly 20 25 30 Glu Asp Ala Gln Pro Gly Glu Glu Pro Ile Lys Tyr Gly
Glu Leu Ile 35 40 45 Val Leu Gly Tyr Asn Gly Cys Leu Ala Ser Gly
Asp Lys Gly Arg Arg 50 55 60 Arg Ser Arg Leu Ala Leu Ser Arg Arg
Ser His Ala Asn Gly Val Lys 65 70 75 80 Pro Asp Val Met His His Ile
Ser Thr Pro Leu Val Ser Lys Ala Leu 85 90 95 Ser Asn Arg Gly Gln
His Ser Ile Ser Tyr Thr Leu Ser Arg Ser His 100 105 110 Ser Val Ile
Val Glu Tyr Thr His Asp Ser Asp Thr Asp Met Phe Gln 115 120 125 Ile
Gly Arg Ser Thr Glu Asn Met Ile Asp Phe Val Val Thr Asp Thr 130 135
140 Ser Pro Gly Gly Gly Ala Ala Glu Gly Pro Ser Ala Gln Ser Thr Ile
145 150 155 160 Ser Arg Tyr Ala Cys Arg Ile Leu Cys Asp Arg Arg Pro
Pro Tyr Thr 165 170 175 Ala Arg Ile Tyr Ala Ala Gly Phe Asp Ala Ser
Ser Asn Ile Phe Leu 180 185 190 Gly Glu Arg Ala Ala Lys Trp Arg Thr
Pro Asp Gly Leu Met Asp Gly 195 200 205 Leu Thr Thr Asn Gly Val Leu
Val Met His Pro Ala Gly Gly Phe Ser 210 215 220 Glu Asp Ser Ala Pro
Gly Val Trp Arg Glu Ile Ser Val Cys Gly Asn 225 230 235 240 Val Tyr
Thr Leu Arg Asp Ser Arg Ser Ala Gln Gln Arg Gly Lys Leu 245 250 255
Val Glu Asn Glu Ser Asn Val Leu Gln Asp Gly Ser Leu Ile Asp Leu 260
265 270 Cys Gly Ala Thr Leu Leu Trp Arg Thr Pro Ala Gly Leu Leu Arg
Ala 275 280 285 Pro Thr Leu Lys Gln Leu Glu Ala Gln Arg Gln Glu Ala
Asn Ala Ala 290 295 300 Arg Pro Gln Cys Pro Val Gly Leu Ser Thr Leu
Ala Phe Pro Ser Pro 305 310 315 320 Ala Arg Gly Arg Thr Ala Pro Asp
Lys Gln Gln Pro Trp Val Tyr Val 325 330 335 Arg Cys Gly His Val His
Gly Tyr His Gly Trp Gly Cys Arg Arg Glu 340 345 350 Arg Gly Pro Gln
Glu Arg Glu Cys Pro Leu Cys Arg Leu Val Gly Pro 355 360 365 Tyr Val
Pro Leu Trp Leu Gly Gln Glu Ala Gly Leu Cys Leu Asp Pro 370 375 380
Gly Pro Pro Ser His Ala Phe Ala Pro Cys Gly His Val Cys Ser Glu 385
390 395 400 Lys Thr Ala Arg Tyr Trp Ala Gln Thr Pro Leu Pro His Gly
Thr His 405 410 415 Ala Phe His Ala Ala Cys Pro Phe Cys Gly Ala Trp
Leu Thr Gly Glu 420 425 430 His Gly Cys Val Arg Leu Ile Phe Gln Gly
Pro Leu Asp 435 440 445 13 424 PRT Drosophila melanogaster 13 Met
Val Lys Arg Thr Asp Gly Thr Glu Ser Pro Ile Leu Ala Glu Asp 1 5 10
15 Gly Gly Asp Gly His Asp Lys Pro Arg Leu Arg Tyr Gly Glu Leu Val
20 25 30 Ile Leu Gly Tyr Asn Gly Tyr Leu Pro Gln Gly Asp Arg Gly
Arg Arg 35 40 45 Arg Ser Lys Phe Val Leu His Lys Arg Thr Glu Ala
Ser Gly Val Lys 50 55 60 Arg Ser Lys His Tyr Ile Val Gln Ser Pro
Gln Thr Ser Lys Ala Ile 65 70 75 80 Leu Asp Ala Asn Gln His Ser Ile
Ser Tyr Thr Leu Ser Arg Asn Gln 85 90 95 Ala Val Ile Val Glu Tyr
Lys Glu Asp Thr Glu Thr Asp Met Phe Gln 100 105 110 Val Gly Arg Ser
Ser Glu Ser Pro Ile Asp Phe Val Val Met Asp Thr 115 120 125 Leu Pro
Gly Asp Lys Lys Asp Ala Lys Val Met Gln Ser Thr Ile Ser 130 135 140
Arg Phe Ala Cys Arg Ile Leu Val Asn Arg Cys Glu Pro Ala Lys Ala 145
150 155 160 Arg Ile Phe Ala Ala Gly Phe Asp Ser Ser Arg Asn Ile Phe
Leu Gly 165 170 175 Glu Lys Ala Thr Lys Trp Gln Asp Asn Val Glu Ile
Asp Gly Leu Thr 180 185 190 Thr Asn Gly Val Leu Ile Met His Pro Lys
Gly Ser Phe Cys Gly Gly 195 200 205 Asn Ala Lys Cys Gly Leu Trp Arg
Glu Cys Ser Val Gly Gly Asp Val 210 215 220 Phe Ser Leu Arg Glu Ser
Arg Ser Ala Gln Gln Lys Gly Gln Pro Ile 225 230 235 240 Tyr Asp Glu
Cys Asn Ile Leu Gln Asp Gly Thr Leu Ile Asp Leu Cys 245 250 255 Gly
Ala Thr Leu Leu Trp Arg Ser Ala Glu Gly Leu Gln His Ser Pro 260 265
270 Thr Lys His Asp Leu Glu Lys Leu Ile Asp Ala Ile Asn Ala Gly Arg
275 280 285 Pro Gln Cys Pro Val Gly Leu Asn Thr Leu Val Ile Pro Arg
Lys Val 290 295 300 Asn Ile Gly Asp Gln Val Asn Gln Pro Tyr Val Tyr
Leu Asn Cys Gly 305 310 315 320 His Val Gln Gly His His Asp Trp Gly
Gln Asp Glu Asn Thr Gly Ala 325 330 335 Arg Arg Cys Pro Met Cys Leu
Glu Leu Gly Pro Val Val Thr Leu Cys 340 345 350 Met Gly Leu Glu Pro
Ala Phe Tyr Val Asp Val Gly Ala Pro Thr Tyr 355 360 365 Ala Phe Asn
Pro Cys Gly His Met Ala Thr Glu Lys Thr Val Lys Tyr 370 375 380 Trp
Ala Asn Val Glu Ile Pro His Gly Thr Asn Gly Phe Gln Ala Val 385 390
395 400 Cys Pro Phe Cys Ala Thr Pro Leu Asp Gly Ala Thr Gly Tyr Ile
Lys 405 410 415 Leu Ile Phe Gln Asp Asn Leu Asp 420 14 455 PRT
Ciona intestinalis 14 Met Lys Gln Glu Gly Met Asp Val Ser Ala Ser
Pro Ala Leu Ala Val 1 5 10 15 Ala Gly Gly Met Pro Met Asp Ile Gln
Phe Glu Ala Gly Ala Ser Tyr 20 25 30 His Asn Phe Ser Gln Glu Asp
Ala Pro Lys Glu Asp Glu Gly Asp Ile 35 40 45 Ile Tyr Gly Gln Leu
Ile Val Leu Gly Thr Asn Gly Gln Leu Pro Thr 50 55 60 Gly Asp Lys
Gly Arg Arg Arg Ser Cys Phe Thr Leu Arg Arg Lys Arg 65 70 75 80 Lys
Ala Thr Gly Val Lys Pro Ser Asp Gln His Gln Val Tyr Gln Lys 85 90
95 Ala Ser His Ser Glu Thr Phe Leu Ser Lys Asp His His Ser Val Ser
100 105 110 Tyr Thr Leu Pro Arg Ser Val Val Val Val Pro Tyr Val His
Asp Asp 115 120 125 Asn Ser Asp Met Phe Gln Ile Gly Arg Ser Thr Glu
Glu Pro Ile Asp 130 135 140 Phe Val Leu Met Asp Ile Glu Ala Gly Ser
Ser Ile Pro Thr Asn His 145 150 155 160 Lys Pro Gln Thr Gln Pro Lys
Gln Ser Thr Ile Ser Arg Phe Ala Cys 165 170 175 Arg Ile Val Cys Asp
Arg Glu His Pro Tyr Thr Ser Arg Ile Tyr Ala 180 185 190 Ala Gly Phe
Asp Thr Ser Met Asn Ile Ile Leu Gly Glu Lys Ala Pro 195 200 205 Lys
Trp Thr Thr Glu Gln Asn Gly Lys Lys Ile Ile Asp Gly Leu Thr 210 215
220 Thr Asn Gly Val Leu Ile Met Gln Pro Lys Asn Gly Phe Ser Glu Ser
225 230 235 240 Ser Thr Pro Thr Gln Trp Lys Glu Thr Ser Val Cys Gly
Asn Ile Tyr 245 250 255 Gln Leu Arg Glu Ser Arg Ser Ala Gln Leu Pro
Gly Ile Arg Met Pro 260 265 270 Glu Asp Asn Asn Val Leu Val Asn Gly
Thr Leu Ile Asp Leu Cys Gly 275 280 285 Ala Thr Leu Leu Trp Arg Ser
Ser Ser His Glu Arg Cys Met Pro Thr 290 295 300 Pro Leu His Ile Asp
Glu Leu Ile His Lys Leu Asn Leu Gly Arg Pro 305 310 315 320 Gln Cys
Pro Val Gly Leu Thr Thr Leu Ala Phe Pro Arg Arg Ser Lys 325 330 335
Ala Thr Lys Glu Thr Glu Lys Gln Pro Trp Val Tyr Leu Gln Cys Gly 340
345 350 His Val His Gly Arg Ile Glu Trp Gly Tyr Gln Gly Glu Glu Glu
Arg 355 360 365 Ile Cys Pro Leu Cys Arg Ser Val Gly Lys Tyr Val Pro
Leu Trp Val 370 375 380 Gly Gly Glu Pro Ala Phe Tyr Val Asp Ile Gly
Pro Pro Ser Tyr Cys 385 390 395 400 Phe Val Pro Cys Gly His Val Cys
Ser Gln Lys Thr Ala Ile Tyr Trp 405 410 415 Ser Gln Thr Ala Leu Pro
His Gly Thr Gln Ala Tyr Ser Ala Ala Cys 420 425 430 Pro Phe Cys Ala
Thr Pro Leu Glu Gly Asp Leu Gly Tyr Lys Lys Leu 435 440 445 Ile Phe
Gln Gln Pro Leu Asp 450 455 15 458 PRT Caenorhabditis elegans 15
Met Val Asp Glu Ser Glu Leu Glu Asn Gly Thr Pro Ser Pro Pro Ala 1 5
10 15 Tyr Ser Asn Glu Ala Ile Leu Asp Asp Asp Ile Tyr Gly Glu Leu
Ile 20 25 30 Leu Leu Gly Phe Asn Gly Gln Ala Glu Asn Arg Ala Thr
Ser Lys Arg 35 40 45 Tyr Leu Thr Glu Lys Val Leu Arg Arg Arg Asp
Ser Ala Asn Gly Ile 50 55 60 Lys Lys Cys Thr Val His Asn Val Ser
Thr Ser Asp Thr Lys Leu Thr 65 70 75 80 Lys Asp Lys Ala Arg His Thr
Val Ser Phe His Ser Asp Ser Asn Lys 85 90 95 Ser Val Val Ile Glu
Tyr Ala Ala Asp Pro Ser Lys Asp Met Phe Gln 100 105 110 Ile Gly Arg
Ala Ser Asp Asp Gln Ile Asp Phe Thr Val Ile Asp Thr 115 120 125 Trp
Met Phe Leu Pro Glu His Ser Asp Ala Ala Val Pro Ala Arg Pro 130 135
140 Gln Ile Asp Val Leu Glu Lys Gly Asp Arg Thr Ser Thr Ile Ser Arg
145 150 155 160 Phe Ala Cys Arg Ile Leu Ile Asp Arg Glu Asn Ser Asn
Lys Ala Tyr 165 170 175 Leu Tyr Ala Ala Gly Phe Asp Ala His Gln Asn
Ile Ser Ile Asn Lys 180 185 190 Lys Ser Leu Lys Trp Thr Lys Ser Asn
Gly Glu Val Asp Gly Leu Thr 195 200 205 Thr Asn Gly Val Leu Leu Leu
His Pro Asn Lys Asp Asp Leu Leu Asp 210 215 220 Asp Thr Val Asp Lys
Pro Met Tyr Lys Trp Arg Glu Val Ser Ile Asn 225 230 235 240 Gly Asp
Val Tyr Glu Pro Arg Val Thr Arg Ser Ser Ser Ala Lys Gly 245 250 255
Val Phe Val Pro Glu Trp Thr Asn Met Leu Gln Asp Gly Thr Leu Ile 260
265 270 Asp Leu Cys Gly Ala Thr Ile Leu Trp Arg Thr Ala Asp Gly Leu
Glu 275 280 285 Arg Ser Pro Lys Met Arg Glu Leu Glu Met Ala Leu Asp
Arg Leu Ser 290 295 300 Ala Gly Arg Pro Gln Cys Pro Val Asn Leu Asn
Thr Leu Val Ile Pro 305 310 315 320 Lys Lys Arg Asn Gly Arg Gln Ile
Asn Arg Arg Gln Pro Tyr Val Tyr 325 330 335 Leu Gln Cys Gly His Val
Gln Gly Arg His Glu Trp Gly Val Gln Glu 340 345 350 Asn Ser Gly Gln
Arg Ser Gly Lys Cys Pro Ile Cys Leu Val Glu Ser 355 360 365 Glu Arg
Ile Val Gln Leu Ser Met Gly Met Glu Pro Ser Phe His Leu 370 375 380
Asp Ser Gly Val Leu Asp His Thr Phe Asn Pro Cys Gly His Met Ala 385
390 395 400 Ser Lys Gln Thr Val Leu Tyr Trp Ser Arg Ile Pro Leu Pro
Gln Gly 405 410 415 Thr Cys Arg Tyr Asp Pro Val Cys Pro Phe Cys Tyr
Gln Leu Leu Ala 420 425 430 Thr Glu Arg Pro Phe Val Arg Leu Ile Phe
Gln Asp Asn Cys Phe Asp 435 440 445 Asp Asp Thr Ile Arg Phe Ser Asn
Glu Ala 450 455
* * * * *