U.S. patent application number 11/317680 was filed with the patent office on 2007-11-08 for directed evolution of enzymes and antibodies.
Invention is credited to Gang Chen, Patrick S. Daugherty, George Georgiou, Brent Iverson, Mark J. Olsen.
Application Number | 20070258954 11/317680 |
Document ID | / |
Family ID | 26946702 |
Filed Date | 2007-11-08 |
United States Patent
Application |
20070258954 |
Kind Code |
A1 |
Iverson; Brent ; et
al. |
November 8, 2007 |
Directed evolution of enzymes and antibodies
Abstract
The invention relates to methods of selecting proteins, out of
large libraries, having desirable characteristics. Exemplified are
methods of expressing enzymes and antibodies on the surface of host
cells and selecting for desired activities. These methods have the
advantage of speed and ease of operation when compared with current
methods. They also provide, without additional cloning, a source of
significant quantities of the protein of interest.
Inventors: |
Iverson; Brent; (Austin,
TX) ; Georgiou; George; (Austin, TX) ; Chen;
Gang; (Austin, TX) ; Olsen; Mark J.; (Austin,
TX) ; Daugherty; Patrick S.; (Austin, TX) |
Correspondence
Address: |
FULBRIGHT & JAWORSKI L.L.P.
600 CONGRESS AVE.
SUITE 2400
AUSTIN
TX
78701
US
|
Family ID: |
26946702 |
Appl. No.: |
11/317680 |
Filed: |
December 22, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09813444 |
Mar 20, 2001 |
|
|
|
11317680 |
Dec 22, 2005 |
|
|
|
09782672 |
Feb 12, 2001 |
|
|
|
09813444 |
Mar 20, 2001 |
|
|
|
08447402 |
May 23, 1995 |
5866344 |
|
|
09782672 |
Feb 12, 2001 |
|
|
|
08258543 |
Jun 10, 1994 |
|
|
|
08447402 |
May 23, 1995 |
|
|
|
07794731 |
Nov 15, 1991 |
5348867 |
|
|
08258543 |
Jun 10, 1994 |
|
|
|
Current U.S.
Class: |
424/93.4 ;
435/252.1; 435/7.32; 530/387.1 |
Current CPC
Class: |
C07K 2317/622 20130101;
C40B 40/02 20130101; C07K 2317/565 20130101; C07K 14/245 20130101;
C12N 9/16 20130101; C07K 2319/035 20130101; C07K 16/16 20130101;
C07K 16/00 20130101; C12N 9/86 20130101; C07K 2319/00 20130101;
C12N 15/1037 20130101; C07K 2317/92 20130101; C07K 16/44 20130101;
C12N 15/625 20130101 |
Class at
Publication: |
424/093.4 ;
435/252.1; 435/007.32; 530/387.1 |
International
Class: |
G01N 33/554 20060101
G01N033/554; C07K 16/00 20060101 C07K016/00; C12N 1/00 20060101
C12N001/00 |
Claims
1. A method for selecting a polypeptide from a plurality of
candidate proteins, the method comprising the steps of: (a)
obtaining a library of vectors that encode a plurality of distinct
candidate polypeptides, wherein said vector provides for the cell
surface expression of said candidate polypeptides; (b) expressing
each of said plurality of candidate polypeptides on the surface of
a host cell; and (c) selecting a host cell that expresses a desired
polypeptide.
2. The method of claim 1, wherein said host cell is a Gram negative
bacterium.
3. The method of claim 2, wherein said host cell is E. coli.
4. The method of claim 1, wherein said polypeptide is selected from
the group consisting of an antibody or antibody fragment, an
enzyme, a cytokine, a transcription factor, a clotting factor, a
chelating agent, a hormone and a receptor.
5. The method of claim 4, wherein said polypeptide is an antibody
or antibody fragment.
6. The method of claim 5, wherein selecting a host cell that
expresses a desired antibody comprises the steps of: (a) contacting
said antibody- or antibody fragment-expressing cells with a
selected antigen; and (b) identifying a host cell that binds to
said selected antigen.
7. The method of claim 6, wherein the antigen is labeled.
8. The method of claim 7, wherein the label is a fluorescent or
chemilluminescent label.
9. The method of claim 6, wherein said selected antigen is located
on the surface of a cell other than said host cell, and said host
cell that binds to said selected antigen is identified by a method
comprising the steps of: (a) contacting said host cell with said
cell expressing or having conjugated thereto said selected antigen;
and (b) identifying a host cell bound to said cell expressing or
having conjugate thereto said selected antigen.
10. The method of claim 9, further comprising size sorting of bound
cells following the step of contacting said host cell with said
cell expressing or having conjugated thereto said selected
antigen.
11. The method of claim 6, wherein said vector library is obtained
by a method comprising the steps of: (a) administering to an animal
an immunologically effective amount of a composition comprising a
selected antigen; (b) obtaining from the animal a plurality of
distinct DNA segments that encode distinct antibodies or antibody
fragments; and (c) incorporating said plurality of DNA segments
into a plurality of expression vectors, the vectors expressing
antibodies or antibody fragments on the outer membrane surface of a
Gram negative host cell.
12. The method of claim 11, wherein said plurality of DNA segments
are obtained by a method comprising the steps of: (a) isolating
mRNA from antibody-producing cells of said animal; (b) amplifying a
plurality of distinct RNA segments using a set of nucleic acid
primers having sequences complementary to antibody constant region
or antibody framework region nucleic acid sequences; and (c)
preparing a plurality of distinct DNA segments having sequences
complementary to said amplified RNA segments.
13. The method of claim 1, wherein said vector library is obtained
by a method comprising the steps of: (a) obtaining a DNA segment
that encodes a selected polypeptide; (b) mutagenizing said DNA
segment to provide a plurality of DNA segments that encode a
plurality of polypeptides; and (c) incorporating said plurality of
DNA segments into a plurality of expression vectors, the vectors
expressing a plurality of polypeptides on the surface of a Gram
negative host cell.
14. The method of claim 13, wherein said polypeptide is an antibody
or an antibody fragment.
15. The method of claim 14, wherein said selected cells that
express a desired antibody are subjected to cleavage to release the
selected antibody or antibody fragment from the surface of the
outer membrane.
16. The method of claim 13, wherein selecting a host cell that
expresses a desired antibody comprises the steps of: (a) contacting
said antibody- or antibody fragment-expressing cells with a
selected antigen; and (b) identifying a host cell that binds to
said selected antigen.
17. The method of claim 16, wherein said selected antigen is linked
to a detectable label.
18. The method of claim 17, wherein said selected antigen is linked
to a a fluorescent label, a chemilluminescent label, a radioactive
label, biotin, avidin, a magnetic bead or an enzyme that generates
a colored product upon contact with a chromogenic substrate.
19. The method of claim 18, wherein said cells that bind to said
selected antigen are identified by a method comprising the steps
of: (a) contacting said plurality of cells with said detectably
labeled antigen under conditions effective to allow specific
antigen-antibody binding; (b) removing non-specifically bound
antigen from said cells; and (c) identifying the antibody- or
antibody fragment-expressing cells by detecting the presence of the
bound detectable label.
20. The method of claim 19, wherein said cells that bind to said
selected antigen are identified by a method comprising the steps
of: (c) contacting said plurality of cells with a fluorescently
labeled antigen under conditions effective to allow specific
antigen-antibody binding; (d) subjecting said cells to automated
cell sorting; and (e) identifying the desired antibody or antibody
fragment by detecting the fluorescently labeled sorted cells.
21. The method of claim 20, wherein said cells are subjected to
sorting by flow cytometry.
22. The method of claim 20, wherein said cells are subjected to a
first and a second round of automated cell sorting.
23. The method of claim 22, wherein regrowth of sorted cells is
conducted between said first and said second rounds of cell
sorting.
24. The method of claim 22, wherein said cells are subjected to a
third and a fourth round of automated cell sorting.
25. The method of claim 18, wherein said selected antigen is linked
to a magnetic bead.
26. The method of claim 25, wherein cells that band said antigen
are selected are identified by a method comprising the steps of:
(a) contacting said plurality of cells with said magnetic bead
labeled antigen under conditions effective to allow specific
antigen-antibody binding; (b) subjecting said cells to magnetic
sorting; and (c) identifying the desired antibody- or antibody
fragment by detecting the magentic bead labeled sorted cells.
27. The method of claim 4, wherein said polypeptide is an
enzyme.
28. The method of claim 27, wherein said cells expressing a desired
enzyme are selected on the basis of enzyme activity.
29. The method of claim 28, wherein said enzyme activity is
substrate cleavage.
30. The method of claim 29, wherein cleavage of said substrate
results in loss of quenching of a detectable signal.
31. The method of claim 28, wherein said enzyme activity is
substrate binding.
32. The method of claim 31, wherein said binding results in the
quenching of a detectable signal.
33. The method of claim 31, wherein said binding results in the
generation of a unique signal not found in the absence of
binding.
34. The method of claim 28, wherein said enzyme activity results in
the association of a detectable signal with said host cell.
35. The method of claim 34, further comprising sorting said host
cell by flow cytometry.
36. The method of claim 35, wherein said cells are subjected to a
second round of automated cell sorting.
37. The method of claim 36, wherein regrowth of sorted cells is
conducted between said first and said second rounds of cell
sorting.
38. A method for catalyzing a chemical reaction, comprising the
steps of: (d) obtaining a host cell that expresses an enzyme or
catalytic antibody on the surface of the outer membrane; and (e)
contacting said host cell with a sample containing the necessary
substrates for said chemical reaction.
39. The method of claim 38, wherein said host cell is a Gram
negative host cell.
40. A method for stimulating an immune response, comprising
administering to an animal a pharmaceutical composition comprising
an immunologically effective amount of a host cell that expresses
an antibody or antigen-combining antibody fragment on the surface
of the outer membrane.
41. The method of claim 40, further comprising the step of
obtaining from said animal an antibody.
42. The method of claim 41, wherein said host cell is a Gram
negative host cell.
43. An isolated an purified antibody, or fragment thereof, that
binds immunologically to digoxin, but does not bind immunologically
to digitoxin.
44. A single-chain antibody that binds immunologically to digoxin,
but does not bind immunologically to digitoxin
45. A host cell that expresses, on its cell surface, a single-chain
antibody that binds immunologically to a digoxin, but does not bind
immunologically to digitoxin.
Description
[0001] The present application is a continuation of copending U.S.
patent application Ser. No. 09/813,444, filed Mar. 20, 2001, which
is a continuation of copending U.S. patent application Ser. No.
09/782,672, filed Feb. 12, 2001, which is a continuation-in-part of
U.S. Pat. No. 5,866,344 filed May 23, 1995 and issued Feb. 2, 1999,
which is a continuation-in-part of U.S. Ser. No. 08/258,543, filed
Jun. 10, 1994 is abandoned, which is a divisional of U.S. Pat. No.
5,348,867 issued Sep. 20, 1994. The entire text of each of the
above-referenced applications and patents are specifically
incorporated by reference herein without disclaimer. The government
owns rights in the present invention pursuant to grant number
BCS-9412502 from the National Science Foundation.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates generally to the fields of
biochemistry, immunology and molecular biology. More particularly,
it concerns the use of rapid selection techniques to identify
specific polypeptides having desirable characteristics out of large
libraries of polypeptides.
[0004] 2. Description of Related Art
[0005] There is considerable interest in the discovery of new
enzymes with catalytic and stability characteristics superior to
what can be obtained from the pool of naturally-occurring enzymes
in the biological world. For practical purposes, it is desirable to
identify proteins that (i) can catalyze reactions (e.g.,
Diels-Alder condensation) that are important for chemical
processing but do not occur in the biological world; (ii) exhibit
unnatural chemical or stereoselectivity; (iii) can catalyze
reactions in the presence of organic solvents or organic-aqueous
mixtures that are typically used in chemical syntheses; and (iv)
have an appreciable half-life at elevated temperatures and under
other conditions of interest. Presently, methods for identifying
these molecules are not readily available.
[0006] The development of enzymes with improved characteristics not
only has important scientific ramifications, in terms of aiding the
understanding of protein structure-function, but also is of great
commercial value. In addition, most established pharmaceutical and
biotechnology companies have extensive research efforts in place
for enzyme engineering and optimization.
[0007] Antibodies also are of increasing importance in human
therapy, assay procedures and diagnostic methods. Therefore,
another area of interest lies in the identification of antibodies
with particular binding functions, as well as other activities.
However, methods of identifying antibodies and production of
antibodies is often expensive, particularly where monoclonal
antibodies are required. Hybridoma technology has traditionally
been employed to produce monoclonal antibodies, but these methods
are time-consuming and result in isolation and production of
limited numbers of specific antibodies. Additionally, relatively
small amounts of antibody are produced; consequently, hybridoma
methods have not been developed for a large number of antibodies.
This is unfortunate as the potential repertoire of immunoglobulins
produced in an immunized animal is quite high, on the order of
>10.sup.10, yet hybridoma technology is too complicated and time
consuming to adequately screen and develop large number of useful
antibodies.
[0008] Selective pressure, i.e., cell cultivation under conditions
that allow growth only if a certain enzyme is active, has been used
for many years to isolate mutants with desirable characteristics.
The most successful approach is to mutagenize in vitro the gene for
a desired enzyme, introduce the mutagenized DNA into cells to
create a library and finally select for cells that produce active
enzyme by growing under restrictive conditions. In one notable
example, Liad et al. (1986) reported the isolation of thermostable
variants of the E. coli kanamycin nucleotidyl transferase by
introducing the gene in a thermophilic bacillus and selecting for
mutants that could grow at a temperature above the inactivation
temperature of the thermostable enzyme. More recently Palzkill et
al. constructed sets of large libraries in which blocks of several
residues in .beta.-lactamase were randomized by in vitro
techniques. The .beta.-lactamase mutant genes were transformed into
E. coli and cells capable of growing in the presence of
.beta.-lactam antibiotics that are normally poor .beta.-lactamase
substrates were isolated (Venkatachalam et al., 1994; Petrosino and
Palzkill, 1996).
[0009] A variety of techniques including chemical mutagenesis of
isolated DNA, gene amplification by error prone PCR.TM. and
oligonucleotide mutagenesis have been employed to generate
libraries of mutant genes containing a desired range of nucleotide
substitutions. Often multiple rounds of selection and mutagenesis
are employed to select increasingly improved enzymes. It is
desirable to be able to combine the beneficial effects of mutations
that exhibit an additive effect on function. For this purpose
Stemmer (1994a and 1994b) devised a simple technique of DNA
shuffling for allowing the combination of beneficial mutations in
different parts of a gene. DNA shuffling is a powerful technique
for the generation of combinatorial libraries in turn can allow
drastic improvements in enzyme function. As demonstrated by Stemmer
(1994a) DNA shuffling allowed a rapid isolation of a
.beta.-lactamase variant with a 32,000-fold higher activity towards
the antibiotic cefotaxime.
[0010] The selection of improved enzymes from in vitro constructed
libraries is a very powerful approach for biocatalyst design
provided that the enzyme sought confers an essential function for
the cell. Unfortunately in many cases of commercial interest it is
not possible to design a selection strategy. In fact it is
impossible to design selection strategies for reactions (such as
Diels Alder condensation) that do not take place in biological
systems. The other limitation of mutant selection strategies is
that under selective conditions cells can evolve mechanisms of
survival that bypass the reaction catalyzed by the enzyme that is
to be optimized. The ability of cellular adaptation mechanisms to
respond to selective pressure has frustrated efforts to direct the
evolution of efficient antibody catalysts designed to complement
mutations in essential pathways within microorganisms (Tang et al.,
1991; Smiley and Benkovic, 1994).
[0011] For enzymatic reactions where the design of a selection
strategy is not possible, libraries of mutants have to be screened
by direct assay. This involves growing individual clones either as
colonies on agar plates or, alternatively in 96-well plates, and
measuring enzymatic activity usually by a chromogenic assay. A
popular and convenient screening format is to determine the
enzymatic activity of single colonies growing on agar plates.
Sequential cycles of random mutagenesis and plate screening are
increasingly employed for the directed evolution of enzyme
activities. Using this approach Moore and Arnold (1996) isolated a
mutant paranitrobenzyl esterase that exhibits 16-fold higher
activity in 30% DMF relative to the parent enzyme. At least one
other enzyme has been engineered successfully by random mutagenesis
and screening (Yu and Arnold, 1996).
[0012] However, the isolation of clones producing desired enzymes
by plate-screening is tedious and is not suitable when a drastic
change in protein function or stability is sought. It is
impractical to screen more than 10.sup.5 clones by plate assays
(even with automated techniques) and therefore only a relative
small set of mutants can be analyzed. Screening of much larger
libraries of mutants, typically comprising of at least 1,000-fold
larger number of clones (i.e., 10.sup.8) is necessary if there is
to be any hope for completely changing enzyme activity or reversing
its substrate specificity.
[0013] The screening of colonies using plate assays suffers form
three additional limitations. First, plate assays can be devised
for a limited range of reactions. Second, because the vast majority
of proteins are not released from E. coli bacteria (by far the most
preferred host organism for "directed evolution" studies), the
substrate must be able to readily diffuse into the cell and it must
not be toxic. Third, plate assays, even those that utilize
fluorescent molecules have at best moderate specificity. In recent
years there have been many efforts to find rapid assay screening
methods that can circumvent the limitations inherent with plate
assays. Perhaps the most innovative approach is the Catalytic ELISA
(CatELISA) technique developed by Tawfik et al. (1993). However,
neither CatELISA nor any of the other assay recent techniques can
be applied to the screening of larger libraries of mutants.
[0014] Thus despite the intense interest in discovering new enzymes
and antibodies, there remain a significant technical hurdles that
have made it difficult to exploit this considerable wealth of
biological power. Thus, there remains a great need for improved
methods of handling the synthesis and identification of the vast
number of possible active polypeptides.
SUMMARY OF THE INVENTION
[0015] The present invention addresses these and other drawbacks
inherent in the prior art by providing new methods of screening of
polypeptide libraries. For the first time it is possible to rapidly
screen polypeptide libraries for potential enzymes and antibodies;
often in a matter of hours. The disclosed methods allow production
of large quantities of these polypeptides, potentially on a
kilogram scale, from microorganism cultures. And, because selected
proteins can be displayed on the surface of a host cell, assays can
be conducted with remarkable rapidity.
[0016] In one aspect of the invention, expression libraries are
prepared such that an expressed protein is displayed on the surface
of a cell. Typically, the polypeptides will be surface expressed in
a host cell such as bacterial, yeast, insect, eukaryotic or
mammalian cells. Surface expression of a polypeptide on a cell
surface is achieved using a recombinant vector that promotes
display on the outer membrane of a host cell. Vectors are such as
those of the general construction described in U.S. Pat. No.
5,348,867, incorporated herein by reference. Generally the vectors
will be appropriate for a bacterial host cell and will include at
least three DNA segments as part of a chimeric gene. One segment is
a DNA sequence encoding a polypeptide that targets and anchors a
fusion polypeptide to a host cell outer membrane. A second DNA
segment encodes a membrane-transversing amino acid sequence, i.e.,
a polypeptide that transports a heterologous or homologous
polypeptide through the host cell outer membrane. The third DNA
segment encodes any of a number of desired polypeptides. Such
vectors will display fusion polypeptides at the exterior of a host
cell. These recombinant vectors include a functional promoter
sequence.
[0017] Screening for antibodies employing the methods of the
present invention allows one to select an antibody or antibody
fragment from a plurality of candidate antibodies that have been
expressed on the surface of a host cell. In most instances the host
cell will be a bacterial cell, preferably E. coli. The antibodies
are obtained from an expression vector library that may be prepared
from DNAs encoding antibodies or antibody fragments. One source of
such DNAs could be from an animal immunized with a selected
antigen; alternatively, antibody genes from other sources can be
used, such as those produced by hybridomas or produced by
mutagenesis of a known antibody gene. One preferred method of
obtaining DNA segments is to isolate mRNA from antibody cells of an
immunized animal. The mRNA may be amplified, for example by PCR,
and used to prepare DNA segments to include in the vectors. One may
also employ DNA segments that have been mutagenized from one or
more DNAs that encode a selected antibody or antibody fragment.
[0018] In a second embodiment, the present invention provides
methods for the rapid screening of enzyme libraries. The libraries
represent mutagenized version of an enzyme to permit for the
"directed" evolution of the enzyme's sequence, and hence function.
Again, vectors will comprise a DNA sequence encoding the enzyme, an
anchor fused to the enzyme coding region that results in expression
of the host cell outer membrane and any other regulatory sequences
necessary for the propagation of the vectors and the expression of
the enzyme. Standard mutagenic procedures will be applied to
various regions of the enzyme coding region, including those
regions that encode binding pockets and active sites. Other sites
of interest, including residues critical for conformation and
post-translational modification also may be targeted.
[0019] Once generated, expression libraries are transferred, by
standard methodologies, into appropriate host cells. Expression of
the antibodies, enzymes or other polypeptides on the surface of
host cells permits the rapid and efficient screening of libraries
for the appropriate binding specificity, enzyme function or other
desirable characteristic. In addition, use of appropriate label
systems and substrates permits the sorting of host cells expressing
proteins of interest by flow cytometery methodology (e.g.,
FACS).
[0020] Other objects, features and advantages of the present
invention will become apparent from the following detailed
description. It should be understood, however, that the detailed
description and the specific examples, while indicating preferred
embodiments of the invention, are given by way of illustration
only, since various changes and modifications within the spirit and
scope of the invention will become apparent to those skilled in the
art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein:
[0022] FIG. 1A and FIG. 1B. FIG. IA Western blot analysis of total
membrane fractions from E. coli JM109 cells containing pTX101
(Lanes 2 and 4); JM109/pTX152 (Lanes 3 and 5) and probed with
anti-OmpA antibodies at 1:5000 dilution; Lanes 4 and 5 were probed
with monoclonal anti-HSV antibodies at 1:5000 dilution. Arrowheads
indicate the Lpp-OmpA-.beta.-lactamase fusion (lane 2) and the
Lpp-OmpA-scFv(digoxin) fusion (lane 3). The 32 kDa band in lanes 2
and 3 corresponds to OmpA. Lane 1, molecular mass markers (in kDa).
FIG. 1B. Lysate and whole cell ELISAs of JM109 cells containing
plasmid pTX101 (solid) or pTX152 (hatched). Samples were incubated
on microtiter wells coated with digoxin-conjugated BSA and probed
with anti-.beta.-lactamase (pTX101) or anti-HSV (pTX152)
antibodies. Absorbance readings were referenced to wells that were
untreated with either lysates or whole cells.
[0023] FIG. 2A and FIG. 2B. Phase contrast micrograph of
JM109/pTX152 cells after 1 hr of incubation with 10.sup.-7 M
digoxin-FITC. FIG. 2B. Micrographs of the same field as in FIG. 2A
of JM109/pTX152 cells after a 1 hour incubation with 10.sup.-7M
digoxin-FITC.
[0024] FIGS. 3A-3G. Histogram data from FACS. The bar in each graph
represents the sorting gate or the fluorescence intensity defined
as a positive event. The sorting gate was chosen to maximize the
number of positive events while minimizing the number of negative
events within the window. All samples were labeled with 10.sup.-7 M
digoxin FITC. FIG. 3A. JM109/pTX152 sample used as a negative
control. FIG. 3B. JM109/pTX152 sample used as a positive control.
FIG. 3C. JM109/pTX152 pretreated with 0.2 mg/ml trypsin. FIG. 3D.
JM109/pTX152 pretreated with free digoxin. FIG. 3E. A 100,000:1
mixture of JM109/pTX101:JM109/pTX152 prior to the first cell
sorting run. FIG. 3F. A 100,000:1 mixture after growing cells
recovered from the first cell sorting run. FIG. 3G. A 100,000:1
mixture after growing cells recovered from the second cell sorting
run.
[0025] FIG. 4. Whole cell immunoassay using 0.5 nM FITC labeled
digoxin.
[0026] FIG. 5A and 5B: FIG. 5A. Antibody mutants displaying
different affinity for the antigen can be distinguished by display
on the cell surface and fluorescence activated cell sorting. A.
Fluorescence histogram comparing the fluorescence distribution of
bacterial cells displaying mutants of the svFv (digoxin) antibody
on their surface. FIG. 5B. Relative binding affinity of the
corresponding purified antibodies measured by ELISA.
[0027] FIG. 6A and 6B Immunoassay for the determination of the
equilibrium constant for antigen binding for surface displayed scFv
antibodies. Cells displaying scFv(digoxin) antibodies on their
surface were incubated with different concentrations of
BODIPY-digoxin for one hour with gentle shaking. Following
incubation, the fluorescence distribution of the cells (50,000
events) was determined by flow cytometry.
[0028] FIG. 7: Single chain antibody surface display plasmid vector
pSD192
[0029] FIG. 8: Procedure for the isolation of single-chain
antibodies by surface display and FACS.
[0030] FIG. 9A-9F: Isolation of high affinity antibodies from
libraries displayed on the bacterial cell surface and screened by
FACS. FIG. 9A-9C: Plots of Forward Scatter (a measure of the cell
size) as a function of fluorescence intensity for cell populations
displaying a library of scFv antibodies and incubated with
different concentrations of fluorescent hapten (BODIPY-digoxin).
The library was constructed by randomizing the heavy chain residues
99, 100, 100a and 100b as described in Example 7. Cells were
incubated with Bodipy-digoxin at different concentrations, shown in
FIG. 9A-9C, for one hour. Each point represents one event detected
by the flow cytometer and a total of 50,000 events (i.e. cells) are
shown for clarity. FIG. 9D-9F. Isolation of scFv antibodies from a
library. The library was constructed by randomizing the heavy chain
residues 99, 100, 100a and 100b as described in Example 7. Cells
were incubated with 70 nM BODIPY-digoxin and high fluorescence
clones were isolated by FACS. The corresponding fluorescence
histogram is shown in FIG. 9D. Sorted cells were grown overnight,
incubated with 15 nM BODIPY-digoxin and sorted. The fluorescence
distribution of the cells is shown in FIG. 9E. As can be seen,
after one round of sorting and growth, cells having high
fluorescence are greatly enriched over the starting cell
population. Finally, FIG. 9F shows the fluorescence distribution of
the cell population obtained after growing the positive cells
isolated in the first round. The large majority of the cells bind
the BODIPY-digoxin conjugate and thus have a high fluorescence.
[0031] FIG. 10: Chemical Structure of the OmpT substrate
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
A. Identifying Polypeptides With Desirable Properties
[0032] As stated above, the natural diversity of biologically
active polypeptides, in terms of both function and specificity, is
immense. The problem lies in tapping this vast reservoir of
potential reagents in a sufficiently expedient fashion. In other
words, how does one identify the few polypeptides out of the almost
infinite number of possibilities that function as desired?
Automated selection technologies may speed up the process, but the
real obstacle remains the sheer number of possibilities--how they
can be generated and how they can be expressed in order for the
selection to take place. The present invention is designed to
address this particular problem, as described in greater detail
below.
[0033] Enzymes
[0034] Efforts to engineer improved enzymes rely upon molecular
biology techniques and involve two basic approaches. The first
involves cloning and expression of enzyme libraries from organisms
that cannot be cultivated and typically are isolated from extreme
environments. This approach, pioneered by Recombinant Biocatalysis
(Brennan, 1996), relies on the construction expression libraries by
extracting DNA from samples and gene amplification by PCR.TM.. The
expression libraries are then screened by brute force approaches
that rely heavily on robotics. This technology promises to begin to
tap the unexplored diversity of function in the natural world.
However, it is intrinsically limited to catalytic activities that
serve a biological function. Also, it is limited by the ability to
employ genes from unknown sources to direct the synthesis of
functional properties in commonly used host organisms such as E.
coli or Saccharomyces cerevisiae.
[0035] A second approach relies on selecting antibodies with the
appropriate enzymatic or catalytic characteristics. The principle
underlying catalytic antibodies is straightforward--binding of an
antibody to its cognizant antigen results in a free energy
decrease. An antibody that is highly complementary to the
rate-limiting species of a chemical reaction (i.e., the transition
state complex) will lower the energy of that species. This decrease
in the free energy of formation of the transition state translates
into a higher rate of reaction. In general terms, catalytic
antibodies are produced via immunization with a molecule (a hapten)
that is designed to mimic certain features of the transition state
complex for the reaction of interest (Lemer et al., 1991). An
impressive array of different reactions now have been catalyzed by
antibodies. Moreover, as expected for a catalyst based on antibody
recognition, catalytic antibodies display precise substrate
selectivity. That is, only substrates that are similar in structure
to the hapten used to elicit the catalytic antibodies are accepted
in the catalytic reaction.
[0036] Unfortunately, catalytic antibodies have not yet fulfilled
initial expectations. A number of reasons are at the root of the
slow progression. First, the generation of catalytic antibodies is
technically difficult and prohibitively expensive. Second,
production costs are uneconomical. Despite impressive advances in
hybridoma culture scale-up, the cost-effective production of
monoclonal antibodies remains a serious challenge. Third, poor
kinetic properties are common. Typically, rates of reaction and
acceleration with catalytic antibodies (i.e., rate of catalyzed
reaction over uncatalyzed reaction) are between 10.sup.4-10.sup.5,
although a few examples of higher rates have been reported (Janda
et al., 1988; however also see Hollfelder et al., 1996). For
comparison, rates of reaction acceleration for enzymes are usually
around 10.sup.7-10.sup.8. Fourth, transition state mimics must be
immunogenic and stable in vivo. Animal immunization with the
transition state analog is the first step in the production of
monoclonal antibodies with catalytic activity. The need for
immunization poses two serious constraints on the transition state
analog; it must be recognized by the immune response and it must be
stable in the animal.
[0037] Antibodies
[0038] Currently, the most widely used approach for screening
polypeptide libraries is to display polypeptides on the surface of
filamentous bacteriophage (Smith, 1991; Smith, 1992). The
polypeptides are expressed as fusions to the N-terminus of a coat
protein. As the phage assembles, the fusion proteins are
incorporated in the viral coat so that the polypeptides become
displayed on the bacteriophage surface. Each polypeptide produced
is displayed on the surface of one or more of the bacteriophage
particles and subsequently tested for specific ligand interactions.
While this approach appears attractive, there are numerous
problems, including difficulties of enriching positive clones from
phage libraries. Enrichment procedures are based on selective
binding and elution onto a solid surface such as an immobilized
receptor. Unfortunately, avidity effects arise due to multivalent
binding of the phage and the general tendency of phage to contain
two or more copies of the displayed polypeptide. The binding to the
receptor surface therefore does not depend solely on the strength
of interaction between the receptor and the displayed polypeptide.
This causes difficulties in the identification of clones with high
affinity for the receptor; thus, there remain distinct deficiencies
in the methods used to isolate and screen polypeptides,
particularly antibodies, even in view of the development of phage
libraries.
[0039] Previous Attempts to Develop Engineered Polypeptides
[0040] An approach to the antibody selection problem has been the
development of library screening methods for the isolation of
antibodies (Huse et al, 1989; McCafferty et al., 1990; Chiswell
& McCafferty, 1992; Chiswell & Clackson, 1992; Clackson,
1991). Functional antibody fragments have been produced in E. coli
cells (Skerra & Pluckthun, 1988; Better et al., 1988; Orlandi
et al., 1989; Sastry et al., 1989) as "libraries" of recombinant
immunoglobulins containing both heavy and light variable domains
(Huse et al, 1989). The expressed proteins have antigen-binding
affinity comparable to the corresponding natural antibodies.
However, it is difficult to isolate high binding populations of
antibodies from such libraries and where bacterial cells are used
to express specific antibodies, isolation and purification
procedures are usually complex and time-consuming.
[0041] Combinatorial antibody libraries generated from phage lambda
(Huse et al, 1989) typically include millions of genes of different
antibodies but require complex procedures to screen the library for
a selected clone. Ladner et al., (U.S. Pat. No. 5,403,484,
specifically incorporated herein by reference) reported the display
of proteins on the outer surface of a chosen bacterial cell, spore
or phage, in order to identify and characterize binding proteins.
Certain elements of Ladner may be used advantageously, for example,
methods of generating and expressing single chain antibodies,
proteinaceous binding domains other than a single chain antibody,
carrier protein and the like, in combination with the present
invention.
[0042] Methods have been reported for the production of human
antibodies using the combinatorial library approach in filamentous
bacteriophage. A major disadvantage of such methods is the need to
rely on initial isolation of the antibody DNA from peripheral human
blood to prepare the library.
[0043] One way of approaching enzyme selection relies on the
possibility of obtaining accurate 3-dimensional structures for
polypeptides, which then can be employed to identify amino acid
substitutions that can alter or enhance function. Structure-guided
mutagenesis in protein chemistry is best exemplified by the elegant
and extensive studies of Matthews and coworkers using the T4
lysozyme as a model (Matthews, 1995). Over the years his group
constructed, characterized and solved the crystal structure of over
100 T4 mutants. These studies have provided valuable information on
the determinants of protein stability. A few mutants with markedly
increased thermostability have been isolated. However, structure
guided mutagenesis is not likely to become a general route to the
isolation of new biocatalysts because, (i) the three dimensional
structure of a protein is required as a starting point, and the
three dimensional structure is not available for most polypeptides
and (ii) while the prediction of amino acid substitutions that
affect stability has been met with some success, mutations that
increase or dramatically alter catalytic activity have been very
difficult to predict.
B. The Present Invention
[0044] It is proposed, according to the present invention, to
provide a general approach for the efficient screening of very
large libraries of virtually any polypeptide for desirable
activity. This approach employs directed evolution for the
selection of enzymes and, further, can be applied to the screening
of antibody libraries. This provides an extremely powerful tool for
the selection of such polypeptides. Moreover, the development of
methods that achieve stable anchoring and polypeptide display on
the surface of a bacterial cell such as E. coli, has provided the
basis for new methods of rapid and efficient selection of
polypeptides from libraries expressed in the host cells. With the
polypeptide on the surface, exposed directly to the aqueous media,
the activity of the polypeptide can be assayed directly, without
having to worry about transport of assay reagents into cells.
[0045] The methods disclosed herein are particularly advantageous
because they allow unprecedented rapid and efficient selection,
purification and screening of polypeptide libraries from bacterial
host cell surfaces, providing several advantages over phage
libraries. Unlike most other methods used for screening and assay,
the disclosed methods are well-suited for commercial adaptation.
Assay procedures are greatly facilitated because of the cell
surface display aspect, permitting the use of simple centrifugation
to remove the cells from an assay sample. Assays thus are very
rapid and inexpensive as they do not require complex or expensive
equipment.
[0046] In a first embodiment, relating to directed enzyme
evolution, the invention comprises the following approach. A target
enzyme (or catalytic antibody) which is to be subjected to
mutagenesis is first displayed on the surface of E. coli bacteria
as a fusion to a surface-targeting vehicle. This technology was
developed by Georgiou and coworkers and has been used to display a
number of proteins on the bacterial surface (Francisco et al.,
1992; 1993a; 1993b; Georgiou et al., 1996). By displaying the
target enzyme on the bacterial surface it will be fully accessible
to molecules in the extracellular fluid. Thus, the enzyme is free
to react with any substrate added to the cells without any of the
limitations that are imposed when intracellular enzymes are
studied.
[0047] Expression of recombinant proteins on cell surfaces of
Gram-negative bacteria is achieved by fusion to segments of a major
lipoprotein and OmpA; however, fusion to protein domains other than
those derived from the major lipoprotein and OmpA is also
envisioned, provided that these domains can function for the
expression of the desired polypeptide on the cell surface.
Generally, the desired polypeptide is fused to an amino acid
sequence that includes the signals for localization to the outer
membrane and for translocation across the outer membrane. The amino
acid sequences responsible for localization and for translocation
across the outer membrane may be derived either from the same
bacterial protein or from different proteins of the same or
different bacterial species. Examples of proteins that may serve as
sources of localization signal domains are shown in Table 1.
TABLE-US-00001 TABLE 1 EXAMPLES OF OUTER MEMBRANE TARGETING
SEQUENCES Organism Lpp E. coli (or functional equivalent in
Salmonella) TraT E. coli (or functional equivalent in Salmonella)
OsmB E. coli (or functional equivalent in Salmonella) N1pB E. coli
(or functional equivalent in Salmonella) BlaZ E. coli (or
functional equivalent in Salmonella) Lpp1 Pseudomonas aeruginosa
PA1 Haemophilus influenza OprI E. coli 17 kDa lpp Riokettsia
riokettsii H.8 protein Neisseria gonorrhea
[0048] In addition a sequence that allows display of the
polypeptide on the cell surface is required. Appropriate examples
are shown in Table 2. TABLE-US-00002 TABLE 2 EXAMPLES OF
TRANSMEMBRANE SEQUENCES OmpA E. coli or functional equivalent in
Salmonella LamB E. coli or functional equivalent in Salmonella PhoE
E. coli or functional equivalent in Salmonella OmpC E. coli or
functional equivalent in Salmonella OmpF E. coli or functional
equivalent in Salmonella OmpT E. coli or functional equivalent in
Salmonella FepA E. coli or functional equivalent in Salmonella
[0049] Several fusion protein strategies for the display of
relatively short peptides on the surface of Gram-negative bacteria
have been described (Table 3). Short peptides of less than 60 amino
acids residues can be displayed on the cell surface when fused into
surface exposed loops of outer membrane proteins (OMPs) from
enteric bacteria (Hofnung et al., 1991; Charbitt et al., 1988;
Agterberg et al. 1990; Su et al., 1992; Wong et al., 1995; Newton
et al., 1996). Hofnung and coworkers were the first to demonstrate
that peptides inserted within permissive sites of the E. coli outer
membrane protein LamB are displayed on the cell surface, accessible
to antibodies in the extracellular fluid and have thus been
exploited extensively for practical applications Hofnung et al.,
1991; Brown, 1992; O'Callaghan et al., 1990; Sousa et al., 1996).
However, it was quickly realized that the insertion of peptides
longer than 60 amino acids perturbs the overall conformation and
assembly of the carrier, interfering with the localization of the
fusion proteins (Hofnung et al., 1991; Charbitt et al., 1988;
Agterberg et al. 1990). Moreover, the positioning and length of the
peptide insert plays a critical role in the efficient surface
display and recognition of the inserted epitope (Su et al., 1992;
Wong et al., 1995; Newton et al., 1996). TABLE-US-00003 TABLE 3
Expression Systems for protein display in E. coli Carrier Type of
Fusion Localization of Passenger Passenger Polypeptide Applications
E. coli LamB sandwich fusion cell surface variety of viral peptide
vaccines, peptide libraries, antigen cellular absorbants E. coli
PhoE sandwich fusion cell surface epitope from hsp65 of M. vaccines
tuberculosis Pseudomonas OprF sandwich fusion cell surface 4 aa
epitope from malaria vaccines parasite E. coli or other C-terminal
or periplasmic side of outer scFv antibodies; 11 aa CE lipid tagged
antibodies, Gram-negative sandwich fusions membrane/cell surface
epitope of polio virus vaccines lipoprotein E. coli Lpp-OmpA
C-terminal fusion cell surface scFv antibodies; .beta.-
peptide/antibody libraries, lactamase; protein A; cellular
adsorbents, cellulose binding protein immunoassays Shigella
VirG.sub.8 N-terminal fusion cell surface alkaline phosphatase
Neisseria IgA.sub.8 N-terminal fusion cell surface cholera toxin B
subunit vaccines peptide libraries E. coli Flagellin sandwich
fusion cell surface thioredoxin; peptides peptide libraries (Flic)
inserted within thioredoxin Salmonella sandwich fusion cell surface
18 aa epitope from HIV1 vaccines Flagellin (FliC) gp41 protein E.
coli FimH (Type sandwich fusion cell surface 52 aa sequence from
the vaccines I pili) preS2 hepatitis B antigen E. coli PapA
sandwich fusion cell surface 58 aa domain from cellular adsorbents
Staphylococcus protein A Klebsiella PulA C-terminal fusion cell
surface/extracellular fluid B-lactamase
[0050] In a different approach, Fiers and colleagues expressed the
immunoglobulin G-binding domain of protein A of Staphylococcus
aureus on the surface of E. coli using PapA, the major subunit of
the Pap pilus (Steidler et al., 1993). Other groups have used
flagellum or pilus subunits to develop expression systems for the
surface presentation of antigenic/immunogenic epitopes derived from
pathogens, suitable for the development of live recombinant
vaccines (Newton et al., 1995; Pallesen et al., 1995; Van Die et
al., 1990).
[0051] For reasons that are not fully understood, subunits of
cellular appendages and outer membrane porins are not suitable for
the surface display of large polypeptides. To overcome this problem
it has been necessary to use surface display carrier proteins that
are exported via more specialized mechanisms (Salmong et al.,
1993). For example, the targeting of many lipoproteins from
Gram-negative bacteria onto the outer membrane is determined only
by the presence of a short N-terminal sequence. Because of this
property, several lipoproteins have been tested as potential
carriers for surface display (Taylor et al., 1990; Laukkanen et
al., 1993; Fuchs et al., 1991; Cornellis et al., 1996).
Unfortunately, lipoprotein fusions have been found to be either
detrimental to the integrity of the cell envelope causing extensive
cell lysis, or to be tethered to the interior face of the outer
membrane, in which case they are not exposed to the extracellular
fluid (Laukkanen et al., 1993;Cornellis et al., 1996).
[0052] These limitations have been addressed by constructing an
Lpp-OmpA hybrid display vehicle consisting of the N-terminal outer
membrane localization signal from the major lipoprotein (Lpp) fused
to a domain from the outer membrane protein OmpA (Franscisco et
al., 1992). OmpA mediates the display of passenger proteins fused
to the C-terminal of the Lpp-OmpA hybrid. Lpp-OmpA fusions have
been used to successfully display on the surface of E. coli several
proteins varying in size between 20 and 54 kDa (Stathopoulos et
al., 1996). Among the proteins that have been tested thus far only
the dimeric bacterial enzyme alkaline phosphatase (phoA) could not
be displayed on the cell surface (Stathopoulos et al., 1996).
[0053] The IgA proteases of Neisseria gonorrhoeae and Hemophilus
influenzae use a variation of the most common, Type II secretion
pathway (Salmong et al., 1993), to achieve extracellular export
independent of any other gene products (Klauser et al., 1993).
Specifically, the C-terminal domain of the IgA protease forms a
channel in the outer membrane that mediates the export of the
N-terminal domain across the membrane which in turn becomes
transiently displayed on the external surface of the bacteria. This
export mechanism is used by a number of extracellular proteins from
pathogenic bacteria (Klauser et al., 1993; Jose et al., 1995;
Suzuki et al., 1995; Provence et al., 1997; St. Geme et al., 1994).
Replacement of the native N-terminal domain of IgA protease or VirG
with the cholera toxin B subunit or the periplasmic E. colic
protein MalE, respectively, resulted in the surface presentation of
the passenger polypeptides (Suzuki et al., 1995; Klauser et al.,
1990).
[0054] Unlike the IgA protease, the lipoprotein pullulanase (PulA)
of Klebsiella pneumoniae, which is also exported via a type Ii
secretion mechanism, requires 14 genes for its translocation across
the outer membrane (Salmong et al., 1993). Pugsley and coworkers
have shown that the lipoprotein pullulanase (PulA) can facilitate
translocation of the periplasmic enzyme 13-lactamase across the
outer membrane. However, pullulanase hybrids remain only
temporarily attached to the bacterial surface and are subsequently
released into the medium (Komacker et al., 1990). Although the lack
of permanent association with the cell wall is not detrimental for
vaccine development, it is a serious limitation in other
applications such as library screening.
[0055] Expression systems for the display of proteins in
Gram-positive bacteria have also been developed (Fischetti, 1996).
Uhlen and colleagues used fusions to the cell-wall bound, X-domain
of protein A, for the display of foreign peptides up to 88 amino
acids long to the surface of Staphylococcus strains (Hansson et
al., 1992; Samuelson et al., 1995). In other studies, the fibrillar
M6 protein of Streptococcus pyogenes was employed as a carrier for
antigen deliver in Streptococcus cells (Pozzi et al., 1992).
[0056] Protein display applications has also spurred the
development of suitable expression systems for yeast cells. Surface
display expression systems for yeast have relied primarily on the
fusion of passenger proteins to agglutinin, a protein involved in
cell adhesion (Schreuder et al., 1993; Schreuder et al., 1996;
Schreuder et al., 1996; Boder and Wittrup et al 1996). The
AG.alpha.1 agglutinin is tightly bound to the cell wall through its
C-terminus. N-terminal fusions to the cell wall domain of AGA1 are
stably anchored on the cell surface. This system has been used for
the surface expression of a variety of enzymes and binding proteins
(Schreuder et al., 1996). Mating-type a cells use the two subunit
agglutinin a for cell adhesion. Recently the second subunit of
agglutinin a (Aga2p) was used as a vehicle for the surface display
of antibodies and peptides (Boder and Wittrup et al., 1996). In
this case, the passenger polypeptide is fused to the C-terminus of
AGA2 which, in turn, is linked to the AGA1 via disulfide bonds.
[0057] The gene encoding the target enzyme is mutagenized by
conventional techniques to generate a library of mutants. The
library of mutants will be screened using a highly sensitive single
cell assay. Cells exhibiting the desired activity will be isolated.
This will involve the following: (i) design of a fluorescent
substrate for the desired reaction; and may involve immobilization
of the cells onto micron-size particles; and (ii) screening and
isolation of fluorescent microparticles either by fluorescent
activated cell sorting or by using a micromanipulator.
[0058] In a second embodiment, the present invention relies on the
same cell surface display of polypeptides as described above,
except that the polypeptide to be expressed on the host cell
surface is an antibody. The screening methods are practiced by
first constructing an antibody library, using any of several
well-known techniques for library construction. For example, after
selecting an immunogen, one may immunize a mammal by conventional
means and collect antiserum. mRNA from spleen may be used as
template for PCR amplification; for example employing primers
complementary to constant and variable domain framework regions of
different antibody subclasses. Alternatively, DNA from polyclonal
populations of antibodies may be amplified, fragmented if desired,
ligated into pTX101 or a similar vector as described in U.S. Pat.
No. 5,348,867, incorporated herein by reference, and transformed
into a host cell.
C. Expression Libraries and Mutagenesis
[0059] The present invention involves the display of polypeptides
on the surface of a bacteria. U.S. Pat. No. 5,348,867, addressing
this topic, is specifically incorporated by reference. As used
herein, the term polypeptide refers to any protein and includes
antibodies, antibody fragments, receptors, enzymes, cytokines,
transcription factors, clotting factors, chelating agents and
hormones.
[0060] Genes for polypeptides of interest are fused to the 3' of a
sequence that encodes a cell surface targeting domain. The cell
envelope of E. coli and other gram-negative bacteria consists of
the inner membrane (cytoplasmic membrane), the peptidoglycan cell
wall and the outer membrane. Although the latter normally serves as
a barrier to protein secretion, a targeting sequence has been
developed that, when fused to normally soluble proteins, can direct
them to the cell surface (Francisco et al., 1992; 1993). The
surface targeting domain includes the first nine amino acids of
Lpp, the major lipoprotein of E. coli fused to amino acid 46-159 of
the Outer Membrane Protein A (OmpA). The function of the former is
to direct the chimera to the outer membrane whereas the OmpA
sequence mediates the display of proteins at the C-terminal of
OmpA. Lpp-OmpA(46-159) fusions have been used to anchor a variety
of proteins such as .beta.-lactamase, a cellulose binding protein
and alkaline phosphatase on the E. coli surface. However, other
analogous surface targeting domains may be employed to stably
anchor the recombinant polypeptides on the cell surface.
[0061] Methods for the display of virtually any polypeptide on the
surface E. coli are described in U.S. Pat. No. 5,348,867. Any
library encoding a set of related polypeptide sequences may be
displayed on the surface of E. coli. Examples of such libraries
include, libraries derived by mutagenesis of a homologous or
heterologous protein, random peptide libraries, epitope libraries
and libraries of recombinant antibody fragments, all of which may
be created by methods known to those skilled in the art.
[0062] Exemplary of the surface expression method is an Lpp-OmpA
(46-159)-antibody fusion expressed in a gram-negative bacterium.
Due to the presence of the Lpp-OmpA(46-159) sequence, the fusion is
localized on the outer membrane such that the N-terminal domain is
embedded in the bilayer and the antibody sequence is fully exposed
on the cell surface. Recombinant antibodies expressed on the cell
surface as Lpp-OmpA(46-159) fusions are functional and bind to
antigens with high affinity. Such fusions, manipulated as described
below, will constitute preferred forms of the expression libraries
of the present invention.
[0063] Mutagenesis
[0064] Where employed (i.e., directed evolution), mutagenesis will
be accomplished by a variety of standard, random mutagenic
procedures. Mutation is the process whereby changes occur in the
quantity or structure of an organism. Mutation can involve
modification of the nucleotide sequence of a single gene, blocks of
genes or whole chromosome. Changes in single genes may be the
consequence of point mutations which involve the removal addition
or substitution of a single nucleotide base within a DNA sequence,
or they may be the consequence of changes involving the insertion
or deletion of large numbers of nucleotides.
[0065] Mutations can arise spontaneously as a result of events such
as errors in the fidelity of DNA replication or the movement of
transposable genetic elements (transposons) within the genome. They
are also induced following exposure to chemical or physical
mutagens. Such mutation-inducing agents include ionizing
radiations, ultraviolet light and a diverse array of chemical such
as alkylating agents and polycyclic aromatic hydrocarbons all of
which are capable of interacting either directly or indirectly
(generally following some metabolic biotransformations) with
nucleic acids. The DNA lesions induced by such environmental agents
may lead to modifications of bas e sequence when the affected DNA
is replicated or repaired and thus to a mutation.
[0066] Insertional Mutagenesis
[0067] Insertional mutagenesis is based on the inactivation of a
gene via insertion of a known DNA fragment. Because it involves the
insertion of some type of DNA fragment, the mutations generated are
generally loss-of-function rather than gain-of-function mutations.
However, there are several examples of insertions generating
gain-of-function mutations (Moncz et al. 1990; Oppenheimer et al.
1991). Insertion mutagenesis has been very successful in bacteria
and Drosophila (Cooley et al. 1988) and recently has become a
powerful tool in several plant species (corn; e.g., Schmidt et al.
1987); Arabidopsis; e.g., Herman and Marks 1989; Koncz et al. 1990;
Antirrhinum: e.g., Sommer et al. 1990).
[0068] Transposable genetic elements are DNA sequences that can
move (transpose) from one place to another in the genome of a cell.
The first transposable elements to be recognized were the
Activator/Dissociation elements of Zea mays (McClintock, 1957).
Since then they have been identified in a wide range of organisms,
both prokaryotic and eukaryotic (Berg and Howe 1989).
[0069] Transposable elements in the genome are characterized by
being flanked by direct repeats of a short sequence of DNA that has
been duplicated during transposition and is called a target site
duplication. Virtually all transposable elements whatever their
type, and mechanism of transposition, make such duplications at the
site of their insertion. In some cases the number of bases
duplicated is constant, in other cases it may vary with each
transposition event. Most transposable elements have inverted
repeat sequences at their termini these terminal inverted repeats
may be anything from a few bases to a few hundred bases long and in
many cases they are known to be necessary for transposition.
[0070] Prokaryotic transposable elements have been most studied in
E. coli and Gram negative bacteria but are also present in Gram
positive bacteria. They are generally termed insertion sequences if
they are less than about 2 kilobases long or transposons if they
are longer. Bacteriophages such as mu and D108 which replicate by
transposition make up a third type of transposable element elements
of each type encode at least one polypeptide a transposase,
required for their own transposition. Transposons further often
include genes coding for function unrelated to transposition and
often carry antibiotic resistance genes.
[0071] Transposons can be divided into two classes according to
their structure. Firstly, compound or composite transposons have
copies of an insertion sequence element at each end usually in an
inverted orientation. These transposons require transposases to be
encoded by one of their terminal IS elements. The second class of
transposon have terminal repeats of about 30 base pairs and do not
contain sequences from IS elements.
[0072] Transposition is usually either conservative or replicative
although in some cases it can be both. In replicative transposition
one copy of the transposing element remains at the donor site and
another is inserted at the target site. Conservative transposition
the transposing element is excised from one site and inserted at
another.
[0073] Eukaryotic elements can also be classified according to
their structure and mechanism of transportation. The primary
distinction is between elements that transpose via an RNA
intermediate and elements that transpose directly from DNA to
DNA.
[0074] Elements that transpose via an RNA intermediate are often
referred to as retrotransposons and their most characteristic
feature is that they encode polypeptides that are believed to have
reverse transcriptionase activity. There are two types of
retrotransposon: some resemble the integrated proviral DNA of a
retrovirus in that they have long direct repeat sequences, long
terminal repeats (LTRs), at each end. The similarity between these
retrotransposons and proviruses extends to their coding capacity.
They contain sequences related to the gag and pol genes of a
retrovirus, suggesting that they transpose by a mechanism related
to a retroviral life cycle. Retrotransposons of the second type
have no terminal repeats. They also code for gag- and pol-like
polypeptides and transpose by reverse transcription of RNA
intermediates but do so by a mechanism that differs from that or
retrovirus-like elements. Transposition by reverse transcription is
a replicative process and does not require excision of an element
from a donor site.
[0075] Transposable elements are an important source of spontaneous
mutations and must have influenced the ways in which genes and
genomes have evolved. They can inactivate genes by inserting within
them and can cause gross chromosomal rearrangements either directly
through the activity of their transposases or indirectly as a
result of recombination between copies of an element scattered
around the genome. Transposable elements that excise often do so
imprecisely and may produce alleles coding for altered gene
products if the number of bases added or deleted is a multiple of
three.
[0076] Transposable elements themselves may evolve in unusual ways.
If they were inherited like other DNA sequences then copies of an
element in one species would be more like copies in closely related
species than copies in more distant species. This is not always the
case, suggesting that transposable elements are occasionally
transmitted horizontally from one species to another.
[0077] Chemical Mutagenesis
[0078] Chemical mutagenesis offers certain advantages, the ability
to find a full range of mutant alleles with degrees of phenotypic
severity, and is facile and inexpensive to perform. The majority of
chemical carcinogens produce mutations in DNA. Benzo[a]pyrene,
N-acetoxy-2-acetyl aminofluorene and aflotoxin B1 cause GC to TA
transversions in bacteria and mammalian cells . Benzo[a]pyrene also
can produce base substitutions such as AT to TA. N-nitroso
compounds produce GC to AT transitions. Alkylation of the O4
position of thymine induced by exposure to n-nitrosoureas results
in TA to CG transitions.
[0079] A high correlation between mutagenicity and carcinogenity is
the underlying assumption behind the Ames test (McCann et al., 1975
incorporated herein by reference) which speedily assays for mutants
in a bacterial system, together with an added rat liver homogenate,
which contains the microsomal cytochrome P450, to provide the
metabolic activation of the mutagens where needed.
[0080] In vertebrates several carcinogens have been found to
produce mutation in the ras proto-oncogene. N-nitroso-N-methyl urea
induces mammary, prostate and other carcinomas in rats with the
majority of the tumors showing a G to A transition at the second
position in codon 12 of the Ha-ras oncogene. Benzo[a]pyrene-induced
skin tumors contain A to T transformation in the second codon of
the Ha-ras gene.
[0081] Radiation Mutagenesis
[0082] The integrity of biological molecules is degraded by the
ionizing radiation. Adsorption of the incident energy leads to the
formation of ions and free radicals, and breakage of some covalent
bonds. Susceptibility to radiation damage appears quite variable
between molecules, and between different crystalline forms of the
same molecule. It depends on the total accumulated dose, and also
the dose rate (as once free radicals are present, the molecular
damage they cause depends on their natural diffusion rate and thus
upon real time). Damage is reduced and controlled by making the
sample as cold as possible.
[0083] Ionizing radiation causes DNA damage and cell killing,
generally proportional to the dose rate. Ionizing radiation has
been postulated to induce multiple biological effects by direct
interaction with DNA or through the formation of free radical
species leading to DNA damage (Hall, 1988). These effects include
gene mutations, malignant transformation, and cell killing.
Although ionizing radiation has been demonstrated to induce
expression of certain DNA repair genes in some prokaryotic and
lower eukaryotic cells, little is known about the effects of
ionizing radiation on the regulation of mammalian gene expression
(Borek, 1985). Several studies have described changes in the
pattern of protein synthesis observed after irradiation of
mammalian cells. For example, ionizing radiation treatment of human
malignant melanoma cells is associated with induction of several
unidentified proteins (Boothman, et al., 1989). Synthesis of cyclin
and co-regulated polypeptides is suppressed by ionizing radiation
in rat REF52 cells but not in oncogene-transformed REF52 cell lines
(Lambert and Borek, 1988). Other studies have demonstrated that
certain growth factors or cytokines may be involved in
x-ray-induced DNA damage. In this regard, platelet-derived growth
factor is released from endothelial cells after irradiation (Witte,
et al., 1989).
[0084] In the present invention, the term "ionizing radiation"
means radiation comprising particles or photons that have
sufficient energy or can produce sufficient energy via nuclear
interactions to produce ionization (gain or loss of electrons). An
exemplary and preferred ionizing radiation is an x-radiation. The
amount of ionizing radiation needed in a given cell generally
depends upon the nature of that cell. Typically, an effective
expression-inducing dose is less than a dose of ionizing radiation
that causes cell damage or death directly. Means for determining an
effective amount of radiation are well known in the art.
[0085] In a certain embodiments, an effective expression inducing
amount is from about 2 to about 30 Gray (Gy) administered at a rate
of from about 0.5 to about 2 Gy/minute. Even more preferably, an
effective expression inducing amount of ionizing radiation is from
about 5 to about 15 Gy. In other embodiments, doses of 2-9 Gy are
used in single doses. An effective dose of ionizing radiation may
be from 10 to 100 Gy, with 15 to 75 Gy being preferred, and 20 to
50 Gy being more preferred.
[0086] Any suitable means for delivering radiation to a tissue may
be employed in the present invention in addition to external means.
For example, radiation may be delivered by first providing a
radiolabeled antibody that immunoreacts with an antigen of the
tumor, followed by delivering an effective amount of the
radiolabeled antibody to the tumor. In addition, radioisotopes may
be used to deliver ionizing radiation to a tissue or cell.
[0087] Random and In Vitro Scanning Mutagenesis
[0088] Random mutagenesis may also be introduced using error prone
PCR (Cadwell and Joyce, 1992). The rate of mutagenesis may be
increased by performing PCR in multiple tubes with dilutions of
templates.
[0089] Structure-guided site-specific mutagenesis represents a
powerful tool for the dissection and engineering of protein-ligand
interactions (Wells, 1996, Braisted and Wells, 1996). One
particularly useful mutagenesis technique is alanine scanning
mutagenesis in which a number of residues are substituted
individually with the amino acid alanine so that the effects of
losing side-chain interactions can be determined, while minimizing
the risk of large-scale perturbations in protein conformation
(Cunningham et al., 1989).
[0090] Comprehensive information on the functional significance and
information content of a given residue of an antibody can best be
obtained by saturation mutagenesis in which all 19 amino acid
substitutions are examined. The shortcoming of this approach is
that the logistics of multiresidue saturation mutagenesis are
daunting (Warren et al., 1996, Brown et al., 1996; Harrison et al.,
1996; Burton and Barbas, 1994; Yelton et al., 1995; Jackson et al.,
1995; Short et al., 1995; Wong et al., 1996; Hilton et al., 1996).
Hundreds, and possibly even thousands, of site specific mutants
must be studies. For each mutant protein, the appropriate gene
construct must be made, the DNA must be transformed into a host
organism, transformants need to be selected and screened for
expression of the protein, the cells have to be grown to produce
the protein, and finally the recombinant mutant protein must be
isolated. There have been only a handful of studies where one, or
at most a few, residues in an antibody have been subjected to
saturation mutagenesis. Even in those studies, only some of the
mutants were examined in detail (Ito et al., 1996, Chen et al.,
1995, Brumell et al., 1993).
[0091] In recent years, techniques for estimating the equilibrium
constant for ligand binding using minuscule amounts of protein have
been developed (Parker, 1978; Blackburn et al., 1991; U.S. Pat.
Nos. 5,221,605 and 5,238,808.). The inventors own work however, has
shown that the ability to perform functional assays with small
amounts of material can be exploited to develop highly efficient,
in vitro methodologies for the saturation mutagenesis of
antibodies. The inventors bypassed cloning steps by combining PCR
mutagenesis with coupled in vitro transcription/translation for the
high throughput generation of protein mutants. Here, the PCR
products are used directly as the template for the in vitro
transcription/translation of the mutant single chain antibodies.
Because of the high efficiency with which all 19 amino acid
substitutions can be generated and analyzed in this way, it is now
possible to perform saturation mutagenesis on numerous residues of
interest, a process that can be described as in vitro scanning
saturation mutagenesis (Burks et al., 1997).
[0092] In vitro scanning saturation mutagenesis provides a rapid
method for obtaining a large amount of structure-function
information including: (i) identification of residues that modulate
ligand binding specificity, (ii) a better understanding of ligand
binding based on the identification of those amino acids that
retain activity and those that abolish activity at a given
location, (iii) an evaluation of the overall plasticity of an
active site or protein subdomain, (iv) identification of amino acid
substitutions that result in increased binding.
[0093] The surface-displayed antibodies molecules may further be
presented as fusion proteins that include reporter molecules, e.g.
alkaline phosphatase, luciferase, .beta.-lactamase, green
fluorescent protein and others.
[0094] Enzyme Constructs
[0095] In addition to the fusion constructions described above,
vectors for enzyme expression require that appropriate signals be
provided for the synthesis of mRNA and polypeptides, and include
various regulatory elements such as enhancers/promoters from both
bacterial and eukaryotic systems that drive expression of the
enzymes of interest in the appropriate host cells. Elements
designed to optimize messenger RNA stability and translatability in
host cells also are defined. The conditions for the use of a number
of dominant drug selection markers for establishing permanent,
stable cell clones expressing the products are also provided, as is
an element that links expression of the drug selection markers to
expression of the polypeptide.
[0096] (i) Regulatory Elements
[0097] Throughout this application, the term "expression construct"
is meant to include any type of genetic construct containing a
nucleic acid coding for a gene product in which part or all of the
nucleic acid encoding sequence is capable of being transcribed. In
preferred embodiments, the nucleic acid encoding a gene product is
under transcriptional control of a promoter. A "promoter" refers to
a DNA sequence recognized by the synthetic machinery of the cell,
or introduced synthetic machinery, required to initiate the
specific transcription of a gene. The phrase "under transcriptional
control" means that the promoter is in the correct location and
orientation in relation to the nucleic acid to control RNA
polymerase initiation and expression of the gene.
[0098] The term promoter will be used here to refer to a group of
transcriptional control modules that are clustered around the
initiation site for RNA polymerase II. Much of the thinking about
how promoters are organized derives from analyses of several viral
promoters, including those for the HSV thymidine kinase (tk) and
SV40 early transcription units. These studies, augmented by more
recent work, have shown that promoters are composed of discrete
functional modules, each consisting of approximately 7-20 bp of
DNA, and containing one or more recognition sites for
transcriptional activator or repressor proteins.
[0099] In prokaryotic gene expression, unlike eukaryotic systems
the DNA is not separated from the cytoplasm by a nuclear membrane.
There are also many other differences in mRNA processing of
prokaryotes and eukaryotes. The first control point of prokaryotic
gene expression is initiation of transcription. Transcription is
initiated at positions defined precisely by promoters. Analysis of
more than 100 promoters in E. coli has identified two consensus
sequences positioned 350 and 10 base pairs upstream of the point in
the DNA sequence where transcription begins. These sequences are
involved in polymerase recognition and binding.
[0100] The topology of promoter DNA is also important, numerous
bacterial promoters are known to those of skill in the art
(Makrides, 1996, incorporated herein by reference). The coiling of
the double helix brings the two sequence motifs into the correct
position for efficient recognition and binding of RNA polymerase.
In some promoters, initiation of transcription is regulated by
changes in the degree of supercoiling of the DNA (Lilley and
Higgins, 1991). The RNA polymerase is a multi-subunit enzyme; the
core enzyme is capable of transcriptional elongation on its own but
requires the addition of a further subunit (.sigma.) in order to
bind specifically to promoter sites and initiate transcription. The
synthesis of .sigma. factors in prokaryotes allows the polymerase
to be directed to different sets of promoters (Helmann and
Chamberlain, 1988). In B. subtilis, for example, several different
.sigma. factors are produced at different stages so that different
sets of genes can be turned on at each stage.
[0101] In the absence of ancillary proteins the rate of initiation
varies by up to a factor of at least a 1000 over the whole range of
promoters in E. coli. The efficiency of initiation is related to
the sequence and topology of the promoter region. Gene expression
occurring in the absence of regulatory factors is known as
constitutive. At many promoters, transcriptional initiation may be
increase by binding to specific regulatory proteins.
[0102] A feature of gene organization common to prokaryotes but
rare in eukaryotes is the grouping of functionally related genes
into operons. In an operon, genes encoding, for example the
different enzymes of a metabolic pathway are clustered and are
transcribed together into a polycistronic transcript, under the
control of a single promoter. This transcript is then translated to
give individual proteins. Operons enable the rapid and efficient
coordinate expression of a set of genes required to respond to a
change in the external or internal environment of the
microorganism. Premature termination plays a part in the regulation
of expression of operons.
[0103] The termination of transcription occurs at specific sites.
There are two types of termination events. The first (factor
independent termination) occurs at sites defined by a series of U
residues preceded by an inverted repeat that forms a stem-loop
structure at the 3' end of the RNA transcript. This structure
interferes with the polymerase action and leads to the release of
the RNA. Factor dependent termination is dependent on the
interaction of protein factor rho p with the RNA polymerase.
[0104] In eukaryotic systems, at least one module in each promoter
functions to position the start site for RNA synthesis. The best
known example of this is the TATA box, but in some promoters
lacking a TATA box, such as the promoter for the mammalian terminal
deoxynucleotidyl transferase gene and the promoter for the SV40
late genes, a discrete element overlying the start site itself
helps to fix the place of initiation.
[0105] Additional promoter elements regulate the frequency of
transcriptional initiation. Typically, these are located in the
region 30-110 bp upstream of the start site, although a number of
promoters have recently been shown to contain functional elements
downstream of the start site as well. The spacing between promoter
elements frequently is flexible, so that promoter function is
preserved when elements are inverted or moved relative to one
another. In the thymidine kinase promoter, the spacing between
promoter elements can be increased to 50 bp apart before activity
begins to decline. Depending on the promoter, it appears that
individual elements can function either co-operatively or
independently to activate transcription.
[0106] The particular promoter employed to control the expression
of a nucleic acid sequence of interest is not believed to be
important, so long as it is capable of direction the expression of
the nucleic acid in the targeted cell. Thus, where a human cell is
targeted, it is preferable to position the nucleic acid coding
region adjacent to and under the control of a promoter that is
capable of being expressed in a human cell. Generally speaking,
such a promoter might include either a human or viral promoter.
[0107] In various embodiments, the human cytomegalovirus (CMV)
immediate early gene promoter, the SV40 early promoter, the Rous
sarcoma virus long terminal repeat, rat insulin promoter and
glyceraldehyde-3-phosphate dehydrogenase can be used to obtain
high-level expression of the coding sequence of interest. The use
of other viral or mammalian cellular promoters which are well-known
in the art to achieve expression of a coding sequence of interest
is contemplated as well, provided that the levels of expression are
sufficient for a given purpose.
[0108] By employing a promoter with well-known properties, the
level and pattern of expression of the protein of interest
following transfection or transformation can be optimized. Further,
selection of a promoter that is regulated in response to specific
physiologic signals can permit inducible expression of the gene
product. Tables 2 and 3 list several elements/promoters which may
be employed, in the context of the present invention, to regulate
the expression of the gene of interest. This list is not intended
to be exhaustive of all the possible elements involved in the
promotion of gene expression but, merely, to be exemplary
thereof.
[0109] One may include a polyadenylation signal to effect proper
polyadenylation of the gene transcript in eukaryotic cells. The
nature of the polyadenylation signal is not believed to be crucial
to the successful practice of the invention, and any such sequence
may be employed such as human growth hormone and SV40
polyadenylation signals. Also contemplated as an element of the
expression cassette is a terminator. These elements can serve to
enhance message levels and to minimize read through from the
cassette into other sequences.
[0110] (ii) Selectable Markers
[0111] In certain embodiments of the invention, the cells contain
nucleic acid constructs of the present invention, a cell may be
identified in vitro or in vivo by including a marker in the
expression construct. Such markers would confer an identifiable
change to the cell permitting easy identification of cells
containing the expression construct. Usually the inclusion of a
drug selection marker aids in cloning and in the selection of
transformants, for example, genes that confer resistance to
ampicillin, tetracycline, neomycin, puromycin, hygromycin, DHFR,
GPT, zeocin and histidinol are useful selectable markers.
Alternatively, enzymes such as herpes simplex virus.
[0112] (iii) Multigene Constructs and IRES
[0113] In certain embodiments of the invention, the use of internal
ribosome binding sites (IRES) elements are used to create
multigene, or polycistronic, messages. IRES elements are able to
bypass the ribosome scanning model of 5' methylated Cap dependent
translation and begin translation at internal sites (Pelletier and
Sonenberg, 1988). IRES elements from two members of the picanovirus
family (polio and encephalomyocarditis) have been described
(Pelletier and Sonenberg, 1988), as well an IRES from a mammalian
message (Macejak and Sarnow, 1991). IRES elements can be linked to
heterologous open reading frames. Multiple open reading frames can
be transcribed together, each separated by an IRES, creating
polycistronic messages. By virtue of the IRES element, each open
reading frame is accessible to ribosomes for efficient translation.
Multiple genes can be efficiently expressed using a single promoter
to transcribe a single message.
[0114] Any heterologous open reading frame can be linked to IRES
elements. This includes genes for secreted proteins, multi-subunit
proteins, encoded by independent genes, intracellular or
membrane-bound proteins and selectable markers. In this way,
expression of several proteins can be simultaneously engineered
into a cell with a single construct and a single selectable
marker.
[0115] Antibody and Antibody Fragment Constructs
[0116] Using the fusion technology described above, the present
invention also contemplates the generation of host cells
expressing, on their surface, antibodies or antibody fragments
representing a library of antibodies produced in response to one or
more immunogens. "Antibody" or "antibody fragment" refers to any
immunologic binding agent such as IgG, IgM, IgA, IgD and IgE or any
antibody-like molecule that has an antigen binding region, and
includes antibody fragments such as Fab', Fab, F(ab').sub.2, single
domain antibodies (DABs), Fv, scFv (single chain Fv) and the like.
The techniques for preparing and using various antibody-based
constructs and fragments are well known in the art.
[0117] The specificity of an antibody is determined by the
complementarity determining regions (CDRs) within the light chain
variable regions (V.sub.L) and heavy chain variable regions
(V.sub.H). The F.sub.ab fragment of an antibody, which is about
one-third the size of a complete antibody contains the heavy and
light chain variable regions, the complete light chain constant
region and a portion of the heavy chain constant region. F.sub.ab
molecules are stable and associate well due to the contribution of
the constant region sequences. However, the yield of functional
F.sub.ab expressed in bacterial systems is lower than that of the
smaller F.sub.v fragment which contains only the variable regions
of the heavy and light chains. The F.sub.v fragment is the smallest
portion of an antibody that still retains a functional antigen
binding site. The F.sub.v fragment has the same binding properties
as the F.sub.ab, however without the stability conferred by the
constant regions, the two chains of the F.sub.v can dissociate
relatively easily in dilute conditions.
[0118] To overcome this problem, V.sub.H and V.sub.L regions may be
fused via a polypeptide linker (Huston et al., 1991) to stabilize
the antigen binding site. This single polypeptide F.sub.v fragment
is known as a single chain antibody (scF.sub.v). The V.sub.H and
V.sub.L can be arranged with either domain first. The linker joins
the carboxy terminus of the first chain to the amino terminus of
the second chain.
[0119] While the present invention has been illustrated with
display of single chain Fv molecules on the surface of the
bacteria, one of skill in the art will recognize that heavy or
light chain Fv or Fab fragments may also be used with this system.
A heavy or light chain can be displayed on the surface followed by
the addition of the complementary chain to the solution. The two
chains are then allowed to combine on the surface of the bacteria
to form a functional antibody fragment. Addition of random
non-specific light or heavy chain sequences allows for the
production of a combinatorial system to generate a library of
diverse members.
[0120] Antibody and Antibody Fragment Gene Isolation
[0121] To accomplish construction of antibodies and antibody
fragments, the encoding genes are isolated and then modified to
permit cloning into the expression vector. Although methods can be
used such as probing the DNA for V.sub.H and V.sub.L from hybridoma
cDNA (Maniatis et al., 1982) or constructing a synthetic gene for
V.sub.H and V.sub.L (Barbas et al., 1992), a convenient mode is to
use template directed methods to amplify the antibody sequences. A
diverse population of antibody genes can be amplified from a
template sample by designing primers to the conserved sequences at
the 3' and 5' ends of the variable region known as the framework or
to the constant regions of the antibody (Iverson et al, 1989).
Within the primers, restriction sites can be placed to facilitate
cloning into an expression vector. By directing the primers to
these conserved regions, the diversity of the antibody population
is maintained to allow for the construction of diverse libraries.
The specific species and class of antibody can be defined by the
selection of the primer sequences as illustrated by the large
number of sequences for all types of antibodies given in Kabat et
al., 1987, hereby incorporated by reference.
[0122] Messenger RNA isolated from the spleen or peripheral blood
of an animal can be used as the template for the amplification of
an antibody library. In certain circumstances, where it is
desirable to display a homogeneous population of antibody fragments
on the cell surface, mRNA may be isolated from a population of
monoclonal antibodies. Messenger RNA from either source can be
prepared by standard methods and used directly or for the
preparation of a cDNA template. Generation of mRNA for cloning
antibody purposes is readily accomplished by following the
well-known procedures for preparation and characterization of
antibodies (see, e.g., Antibodies: A Laboratory Manual, 1988;
incorporated herein by reference).
[0123] Method of Producing Monoclonal Antibodies
[0124] Generation of monoclonal antibodies (MAbs) follows generally
the same procedures as those for preparing polyclonal antibodies.
Briefly, a polyclonal antibody is prepared by immunizing an animal
with an immunogenic composition in accordance and collecting
antisera from that immunized animal. A wide range of animal species
can be used for the production of antisera. Typically the animal
used for production of anti-antisera is a rabbit, a mouse, a rat, a
hamster, a guinea pig or a goat. Because of the relatively large
blood volume of rabbits, rabbits are usually preferred for
production of polyclonal antibodies.
[0125] Immunogenic compositions often vary in immunogenicity. It is
often necessary therefore to boost the host immune system, as may
be achieved by coupling a peptide or polypeptide immunogen to a
carrier. Exemplary and preferred carriers are keyhole limpet
hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins
such as ovalbumin, mouse serum albumin or rabbit serum albumin can
also be used as carriers. Recognized means for conjugating a
polypeptide to a carrier protein are well known and include
glutaraldehyde, m-maleimidobenzoyl-N-hydroxysuccinimide ester,
carbodiimides and bis-diazotized benzidine.
[0126] The immunogenicity of a particular immunogen composition may
be enhanced by the use of non-specific stimulators of the immune
response, known as adjuvants. Exemplary and preferred adjuvants
include complete Freund's adjuvant (a non-specific stimulator of
the immune response containing killed Mycobacterium tuberculosis),
incomplete Freund's adjuvants and aluminum hydroxide adjuvant.
[0127] The amount of immunogen composition used in the production
of polyclonal antibodies varies upon the nature of the immunogen as
well as the animal used for immunization. A variety of routes can
be used to administer the immunogen (subcutaneous, intramuscular,
intradermal, intravenous and intraperitoneal). The production of
polyclonal antibodies may be monitored by sampling blood of the
immunized animal at various points following immunization. A
second, booster injection, may also be given. The process of
boosting and titering is repeated until a suitable titer is
achieved. When a desired level of immunogenicity is obtained, the
immunized animal can be bled and the serum isolated, stored and the
spleen harvested for the isolation of mRNA from the polyclonal
response or the animal can be used to generate MAbs for the
isolation of mRNA from a homogeneous antibody population.
[0128] MAbs may be readily prepared through use of well-known
techniques, such as those exemplified in U.S. Pat. No. 4,196,265,
incorporated herein by reference. Typically, this technique
involves immunizing a suitable animal with a selected immunogen
composition, e.g. a small molecule hapten conjugated to a carrier,
a purified or partially purified protein, polypeptide or peptide.
The immunizing composition is administered in a manner effective to
stimulate antibody producing cells. Rodents such as mice and rats
are frequently used animals; however, the use of rabbit, sheep frog
cells is also possible. The use of rats may provide certain
advantages (Goding, pp. 60-61, 1986), but mice are preferred,
particularly the BALB/c mouse as this is most routinely used and
generally gives a higher percentage of stable fusions.
[0129] Following immunization, somatic cells with the potential for
producing antibodies, specifically B lymphocytes (B cells), are
selected for use in the MAb generating protocol. These cells may be
obtained from biopsied spleens, tonsils or lymph nodes, or from
blood samples. Spleen cells and blood cells are preferable, the
former because they are a rich source of antibody-producing cells
that are in the dividing plasmablast stage, and the latter because
blood is easily accessible. Often, a panel of animals will have
been immunized and the spleen of animal with the highest antibody
titer will be removed and the spleen lymphocytes obtained by
homogenizing the spleen with a syringe. Typically, a spleen from an
immunized mouse contains approximately 5.times.10.sup.7 to
2.times.10.sup.8 lymphocytes.
[0130] The antibody-producing B lymphocytes from the immunized
animal are then fused with cells of an immortal myeloma cell,
generally one of the same species as the animal that was immunized.
Myeloma cell lines suited for use in hybridoma-producing fusion
procedures preferably are non-antibody-producing, have high fusion
efficiency, and enzyme deficiencies that render then incapable of
growing in certain selective media which support the growth of only
the desired fused cells (hybridomas).
[0131] Any one of a number of myeloma cells may be used, as are
known to those of skill in the art (Goding, pp. 65-66, 1986;
Campbell, 1984). For example, where the immunized animal is a
mouse, one may use P3-X63/Ag8, X63-Ag8.653, NS1/1.Ag 4 1,
Sp210-Ag14, FO, NSO/U, MPC-11, MPC11-X45-GTG 1.7 and S194/5XX0 Bul;
for rats, one may use R210.RCY3, Y3-Ag 1.2.3, IR983F and 4B210; and
U-266, GM1500-GRG2, LICR-LON-HMy2 and UC729-6 are all useful in
connection with human cell fusions.
[0132] One preferred murine myeloma cell is the NS-1 myeloma cell
line (also termed P3-NS-1-Ag4-1), which is readily available from
the NIGMS Human Genetic Mutant Cell Repository by requesting cell
line repository number GM3573. Another mouse myeloma cell line that
may be used is the 8-azaguanine-resistant mouse murine myeloma
SP2/0 non-producer cell line.
[0133] Methods for generating hybrids of antibody-producing spleen
or lymph node cells and myeloma cells usually comprise mixing
somatic cells with myeloma cells in a 2:1 proportion, though the
proportion may vary from about 20:1 to about 1:1, respectively, in
the presence of an agent or agents (chemical or electrical) that
promote the fusion of cell membranes. Fusion methods using Sendai
virus have been described by Kohler & Milstein (1975; 1976),
and those using polyethylene glycol (PEG), such as 37% (v/v) PEG,
by Gefter et al., 1977). The use of electrically induced fusion
methods is also appropriate (Goding pp. 71-74, 1986).
[0134] Fusion procedures usually produce viable hybrids at low
frequencies, about 1.times.10.sup.-6 to 1.times.10.sup.-8. However,
this does not pose a problem, as the viable, fused hybrids are
differentiated from the parental, unfused cells (particularly the
unfused myeloma cells that would normally continue to divide
indefinitely) by culturing in a selective medium. The selective
medium is generally one that contains an agent that blocks the de
novo synthesis of nucleotides in the tissue culture media.
Exemplary and preferred agents are aminopterin, methotrexate, and
azaserine. Aminopterin and methotrexate block de novo synthesis of
both purines and pyrimidines, whereas azaserine blocks only purine
synthesis. Where aminopterin or methotrexate is used, the media is
supplemented with hypoxanthine and thymidine as a source of
nucleotides (HAT medium). Where azaserine is used, the media is
supplemented with hypoxanthine.
[0135] The preferred selection medium is HAT. Only cells capable of
operating nucleotide salvage pathways are able to survive in HAT
medium. The myeloma cells are defective in key enzymes of the
salvage pathway, e.g., hypoxanthine phosphoribosyl transferase
(HPRT), and they cannot survive. The B cells can operate this
pathway, but they have a limited life span in culture and generally
die within about two weeks. Therefore, the only cells that can
survive in the selective media are those hybrids formed from
myeloma and B cells.
[0136] This culturing provides a population of hybridomas from
which specific hybridomas are selected. Typically, selection of
hybridomas is performed by culturing the cells by single-clone
dilution in microtiter plates, followed by testing the individual
clonal supernatants (after about two to three weeks) for the
desired reactivity. Simple and rapid assays include
radioimmunoassays, enzyme immunoassays, cytotoxicity assays, plaque
assays, dot immunobinding assays, and the like.
[0137] The selected hybridomas are serially diluted and cloned into
individual antibody-producing cell lines from which clones can then
be propagated indefinitely to provide MAbs. The cell lines may be
exploited for MAb production in two basic ways. A sample of the
hybridoma can be injected (often into the peritoneal cavity) into a
histocompatible animal of the type that was used to provide the
somatic and myeloma cells for the original fusion. The injected
animal develops tumors secreting the specific monoclonal antibody
produced by the fused cell hybrid. The body fluids of the animal,
such as serum or ascites fluid, can then be tapped to provide MAbs
in high concentration. The individual cell lines could also be
cultured in vitro, where the MAbs are naturally secreted into the
culture medium from which they can be readily obtained in high
concentrations. MAbs produced by either means may be further
purified, if desired, using filtration, centrifugation and various
chromatographic methods such as HPLC or affinity
chromatography.
[0138] Following the isolation and characterization of the desired
monoclonal antibody, the mRNA can be isolated using techniques well
known in the art and used as a template for amplification of the
target sequence.
[0139] Amplification of Gene Fragments
[0140] A number of template dependent processes are available to
amplify the target sequences present in a given template sample.
One of the best known amplification methods is the polymerase chain
reaction (PCR.TM.), which is described in detail in U.S. Pat. Nos.
4,683,195, 4,683,202 and 4,800,159, and in Innis et al. (1990),
each of which is incorporated herein by reference in its entirety.
Briefly, in PCR.TM., two primer sequences are prepared which are
complementary to regions on opposite complementary strands of the
target sequence. An excess of deoxynucleoside triphosphates are
added to a reaction mixture along with a DNA polymerase, e.g., Taq
polymerase. If the target sequence is present in a sample, the
primers will bind to the target and the polymerase will cause the
primers to be extended along the target sequence by adding on
nucleotides. By raising and lowering the temperature of the
reaction mixture, the extended primers will dissociate from the
target to form reaction products, excess primers will bind to the
target and to the reaction products and the process is repeated.
Preferably a reverse transcriptase PCR.TM. amplification procedure
may be performed in order to quantify the amount of target
amplified. Polymerase chain reaction methodologies are well known
in the art.
[0141] Another method for amplification is the ligase chain
reaction ("LCR"), disclosed in EPA No. 320 308, incorporated herein
by reference in its entirety. In LCR, two complementary probe pairs
are prepared, and in the presence of the target sequence, each pair
will bind to opposite complementary strands of the target such that
they abut. In the presence of a ligase, the two probe pairs will
link to form a single unit. By temperature cycling, as in PCR.TM.,
bound ligated units dissociate from the target and then serve as
"target sequences" for ligation of excess probe pairs. U.S. Pat.
No. 4,883,750 describes a method similar to LCR for binding probe
pairs to a target sequence.
[0142] Qbeta Replicase, described in PCT Application No.
PCT/US87/00880, may also be used as an amplification method. In
this method, a replicative sequence of RNA which has a region
complementary to that of a target is added to a sample in the
presence of an RNA polymerase. The polymerase will copy the
replicative sequence which can then be detected.
[0143] An isothermal amplification method, in which restriction
endonucleases and ligases are used to achieve the amplification of
target molecules that contain nucleotide
5'-[alpha-thio]-triphosphates in one strand of a restriction site
may also be useful in the amplification of nucleic acids (Walker et
al., 1992).
[0144] Strand Displacement Amplification (SDA) is another method of
carrying out isothermal amplification of nucleic acids which
involves multiple rounds of strand displacement and synthesis,
i.e., nick translation. A similar method, called Repair Chain
Reaction (RCR) involves annealing several probes throughout a
region targeted for amplification, followed by a repair reaction in
which only two of the four bases are present. The other two bases
can be added as biotinylated derivatives for easy detection. A
similar approach is used in SDA. Target specific sequences can also
be detected using a cyclic probe reaction (CPR). In CPR, a probe
having a 3' and 5' sequences of non-specific DNA and middle
sequence of specific RNA is hybridized to DNA which is present in a
sample. Upon hybridization, the reaction is treated with RNaseH,
and the products of the probe identified as distinctive products
which are released after digestion. The original template is
annealed to another cycling probe and the reaction is repeated.
[0145] Other amplification methods are described in GB Application
No. 2 202 328, and in PCT Application No. PCT/US89/01025, each of
which is incorporated herein by reference in its entirety, may be
used in accordance with the present invention. In the former
application, "modified" primers are used in a PCR.TM. like,
template and enzyme dependent synthesis. The primers may be
modified by labeling with a capture moiety (e.g., biotin) and/or a
detector moiety (e.g., enzyme). In the latter application, an
excess of labeled probes is added to a sample. In the presence of
the target sequence, the probe binds and is cleaved catalytically.
After cleavage, the target sequence is released intact to be bound
by excess probe. Cleavage of the labeled probe signals the presence
of the target sequence.
[0146] Other nucleic acid amplification procedures include
transcription-based amplification systems (TAS), including nucleic
acid sequence based amplification (NASBA) and 3SR (Kwoh et al.,
1989). In NASBA, the nucleic acids can be prepared for
amplification by standard phenol/chloroform extraction, heat
denaturation of a clinical sample, treatment with lysis buffer and
minispin columns for isolation of DNA and RNA or guanidinium
chloride extraction of RNA. These amplification techniques involve
annealing a primer which has target specific sequences. Following
polymerization, DNA/RNA hybrids are digested with RNase H while
double stranded DNA molecules are heat denatured again. In either
case the single stranded DNA is made fully double stranded by
addition of second target specific primer, followed by
polymerization. The double stranded DNA molecules are then multiply
transcribed by a polymerase such as T7 or SP6. In an isothermal
cyclic reaction, the RNAs are reverse transcribed into double
stranded DNA, and transcribed once against with a polymerase such
as T7 or SP6. The resulting products, whether truncated or
complete, indicate target specific sequences.
[0147] Davey et al., EPA No. 329 822 (incorporated herein by
reference in its entirety) disclose a nucleic acid amplification
process involving cyclically synthesizing single-stranded RNA
("ssRNA"), ssDNA, and double-stranded DNA (dsDNA), which may be
used in accordance with the present invention. The ssRNA is a first
template for a first primer oligonucleotide, which is elongated by
reverse transcriptase (RNA-dependent DNA polymerase). The RNA is
then removed from the resulting DNA:RNA duplex by the action of
ribonuclease H (RNase H, an RNase specific for RNA in duplex with
either DNA or RNA). The resultant ssDNA is a second template for a
second primer, which also includes the sequences of an RNA
polymerase promoter (exemplified by T7 RNA polymerase) 5' to its
homology to the template. This primer is then extended by DNA
polymerase (exemplified by the large "Klenow" fragment of E. coli
DNA polymerase I), resulting as a double-stranded DNA ("dsDNA")
molecule, having a sequence identical to that of the original RNA
between the primers and having additionally, at one end, a promoter
sequence. This promoter sequence can be used by the appropriate RNA
polymerase to make many RNA copies of the DNA. These copies can
then re-enter the cycle leading to very swift amplification. With
proper choice of enzymes, this amplification can be done
isothermally without addition of enzymes at each cycle. Because of
the cyclical nature of this process, the starting sequence can be
chosen to be in the form of either DNA or RNA.
[0148] Miller et al., PCT Application WO 89/06700 (incorporated
herein by reference in its entirety) disclose a nucleic acid
sequence amplification scheme based on the hybridization of a
promoter/primer sequence to a target single-stranded DNA ("ssDNA")
followed by transcription of many RNA copies of the sequence. This
scheme is not cyclic, i.e., new templates are not produced from the
resultant RNA transcripts. Other amplification methods include
"race" and "one-sided PCR" (Frohman, 1990; O'Hara et al.,
1989).
[0149] Methods based on ligation of two (or more) oligonucleotides
in the presence of nucleic acid having the sequence of the
resulting "di-oligonucleotide", thereby amplifying the
di-oligonucleotide, may also be used in the amplification step (Wu
et al., 1989).
[0150] Amplification products may be analyzed by agarose,
agarose-acrylamide or polyacrylamide gel electrophoresis using
standard methods (see, e.g., Maniatis et al. 1982). For example,
one may use a 1% agarose gel stained with ethidium bromide and
visualized under UV light. Alternatively, the amplification
products may be integrally labeled with radio- or
fluorometrically-labeled nucleotides. Gels can then be exposed to
x-ray film or visualized under the appropriate stimulating spectra,
respectively.
[0151] Semisynthetic Antibody Gene Fragments and Preparation of
Mutants
[0152] Genes for antibody fragments also may be generated by
semisynthetic methods known in the art (Barbas et al., 1992). Using
the conserved regions of an antibody fragment as a framework,
variable regions can be inserted in random combinations one or more
at a time to alter the specificity of the antibody fragment and
generate novel binding sites, especially in the generation of
antibodies to antigens not conducive to immunization such as toxic
or labile compounds. Along the same lines a known antibody sequence
may be varied by introducing mutations randomly or site
specifically. This may be accomplished by methods well known in the
art such as mutagenesis with mismatched primers or error-prone
PCR.TM. (Innir, 1990).
D. Host Cells, Methods of Producing Host Cells and "Dead Man"
Selection
[0153] Virtually any cell may be used as a host cell, but the ease
with which bacterial cell are handled makes these a preferred
embodiment, at least where eukaryotic modification events
(glycosylation, etc.) are not necessary. For example, mammalian
cells, plant cells and yeast cells all may be employed. Preferred
bacterial hosts include Gram negative bacterial cells, particularly
E. coli, although Salmonella, Klebsiella, Erwinia, Pseudomonas
aeruginosa, Haemophilus influenza, Rickettsia rickettsii, Neisseria
gonorrhea, etc. also are suitable.
[0154] Bacterial cells in which polypeptides are expressed may be
readily immobilized, thus allowing rapid recovery and efficient
removal from the system. One may use membranes, dipsticks or beads
through a chemically promoted coupling reaction in addition to
other well-known immobilization matrices. In this manner, the cells
can be separated from the solution without the need for a
centrifugation step.
[0155] Bacterial cultures may be supplied in forms that have an
indefinite shelf life and yet can be readily prepared for use; for
example as "stab cultures" or lyophilized preparations; the user
may prepare large amounts in liquid culture as needed. The reagent
is thus renewable as compared with other polypeptide reagents that
are "used up" and must be replaced continually. Bacterial cultures
may be prepared fresh without concern about shelf-life of reagents
that must be stored until use.
[0156] Selection
[0157] Growth studies of bacteria have demonstrated that the
viability of positive bacteria cells (with fusion proteins) and
negative cells (without fusion proteins or with truncated fusion
proteins) vary significantly. The quantity of negative cells
overwhelm the positive cells after the required 12 to 24 hours
growth. For example, the percentage of positive cells in a library
may decrease 10 to 100 fold during the growth period. Since most
FACS are optimally designed for sorting mammalian cells which are
10 to 100 times larger than bacterial cell, even using the most
stringent selection mode, the negative cells may be selected along
with the positive cells.
[0158] Elimination of these negative cells in a presort library is
a very important step for a successful sorting experiment. A number
of approaches may be used to eliminate negative cells.
[0159] Negative Selection Systems
[0160] The blue-white screening system has been widely used for
library screening in molecular biology. In this system, a
.beta.-galactosidase enzyme is used as a reporter protein
(Maniatis, 1989), and a multiple cloning site (MCS) is located in
the middle of the .beta.-galactosidase gene. An insertion of DNA
into the MCS may result in the interruption of the
.beta.-galactosidase gene. Thus, these cells with the DNA insert
will not be able to produce an active .beta.-galactosidase, and
consequently cannot convert the substrate (X-gal) into a colored
product, while the cells without an insert can produce
.beta.-galactosidase and hydrolyze the substrate into the indigo
colored product. This allows for selection of colorless colonies
which usually have an insert are picked and streaked onto a new
plate. The process is repeated until a plasmid carrying a DNA
insert is confirmed. Finding a positive colony with the right
insert may require several rounds of selections. Since the
selection is performed on an agar plate, the speed of screening is
not suitable for high throughput screening (for example, millions
of colonies per day).
[0161] Positive Selection Systems
[0162] The direct selection of an antibody with enhanced catalytic
activity or altered specificity is possible when the reaction of
interest can be coupled to the growth or survival of a cell, such
as the release of an essential nutrient or cofactor. However, many
reactions of interest do not easily lend themselves to such a
selection scheme. In addition, prokaryote metabolism is very
complex, and bacteria are usually capable of adapting to new
metabolic pathways, resulting in a large number of false positives
(Lesley, 1993).
[0163] A variety of positive selection vectors have been developed
to prevent the existence of the cells carrying non-insert plasmids.
All the strategies rely on the inactivation of either a lethal gene
(O'Connor 1982, Henrich 1986, Kuhn 1986, Arakawa 1991, Bernard
1994), a lethal site (Hagan 1982), a dominant function conferring
cell sensitivity to metabolites (Dean 1981, Burns 1984, Pierce
1992, Gossen 1992) or a repressor of an antibiotic-resistance
function (Robert 1980, Nikolnikov 1984). Most of these strategies
are not well adapted for general use due to their large size, the
limited number of cloning sites, or the need of special host strain
and special culture medium. Another problem of these systems is
that they are not an expression system, and the inserted gene
cannot be expressed unless it carries a complete promoter and
operator sequence.
[0164] Seehaus has fused scFv DNA into the gene encoding
.beta.-lactamase (Bla) at the 3'-terminus of the signal sequence.
Only those clones carrying inserts that are in frame with Bla gene
can survive ampicillin selection, while others that carry
out-of-frame deletions or internal stop codons are eliminated. This
strategy can be applied to the Georgiou/Iverson system, however,
the size of the fusion protein Bla (58 to 60 Kda) creates another
problem when the strategy is implemented. Only small proteins
(<53 Kda) can be displayed on the surface of E. coli and still
retain significant activity (Stathopulos 1996). A 1pp-OmpA-scFv-Bla
Fusion protein is too big to be displayed on the surface of
bacteria. Nevertheless, this general resistance fusion strategy can
be modified for our purposes.
[0165] The inventors have employed new positive ("dead man")
selection systems in the present invention using two approaches to
eliminate negative cells. In the first approach, the target gene is
fused with part of an antibiotic gene and used as an insert.
Without the insert, the cloning vector does not process the
specific antibiotic resistance, and the cells having the
self-ligated vectors are eliminated by antibiotic selection. Two
different plasmids were constructed with two antibiotic markers,
penicillin resistance and chloramphenicol resistance, as well as
the surface expression 1pp-OmpA machinery (same as pTX152 which can
express the scFv on the surface of E. coli).
[0166] In one embodiment a plasmid was constructed to eliminate
cells without surface-expressed scFv. A restriction site was
introduced in the middle of the chloramphenicol acetyl transferase
(CAT) gene and in the middle of scFv gene. The N-terminal part of
CAT (200bps) was fused to the end of scFv gene by overlapping PCR,
while the cloning vector carried the C-terminal part of antibiotic
gene. The cells that contain a plasmid without the appropriate
insert (for example, antibody gene and N-terminal part of CAT)
cannot express functional CAT protein, so they are eliminated in a
chloramphenicol medium.
[0167] In another embodiment, a plasmid is constructed to eliminate
cells that carry a advertition stop codon in the middle of the scFv
gene. The promoter and ribosome binding site (rbs) for CAT are
eliminated, and both surface expression 1pp-OmpA-scFv gene and CAT
gene are under control of a single promoter and operator. Thus, the
CAT gene can be transcribed but cannot be translated due to the
lack of a rbs. The scFv gene and the CAT gene are fused in such a
way that the stop codon of the scFv and the start codon of the CAT
are arranged in the order of TAATG. When the ribosome stop at the
TAA of scFV gene, it can frameshift a certain fraction of the time
to the adjacent ATG codon thus restart the translation of CAT gene
(Benhar). The stop codons caused by an unexpected mutation in the
middle of the scFv gene will force the ribosome to fall off the
mRNA early, so it will not be able to translate the CAT gene. As a
result, the cells that carry the stop codon(s) in the middle of
scFv gene do not have chloramphenicol resistance and are not able
to survive in chloramphenicol medium.
[0168] It is envisioned that analogous cloning vectors also might
improve the construction and screening of phage display libraries
by reducing the number of non-insert plasmids in the presort
antibody libraries, and thereby reduce the number of selection
rounds required.
[0169] Of course, it is understood that other antibiotic resistance
genes such as the ampicillin resistance gene and kanamycin
resistance gene can be fused to the antibody gene in this system.
Furthermore, any gene product that is essential for bacterial
growth may be used.
[0170] Gene Transfer
[0171] Technology for introduction of DNA into cells is well-known
to those of skill in the art. Four general methods for delivering a
gene into cells have been described: (i) chemical methods such as
calcium phosphate precipitation (Graham et al., 1973; Zatloukal et
al., 1992); (ii) physical methods such as protoplast fusion,
microinjection (Capecchi, 1980), electroporation (Wong et al.,
1982; Fromm et al., 1985; U. S. Patent No. 5,384,253) and the gene
gun (Johnston et al., 1994; Fynan et al., 1993); (iii) viral
vectors (Clapp, 1993; Lu et al., 1993; Eglitis et al., 1988a;
1988b); and (iv) receptor-mediated mechanisms (Curiel et al., 1991;
1992; Wagner et al., 1992).
E. Methods For Detecting Analytes Using Cells Displaying Scfv
Antibodies
[0172] For the first time, a competitive immunoassay has been
developed that takes advantage of anti-analyte binding antibodies
immobilized on a bacterial cell surface. Several advantages of the
disclosed immunoassay include generally the convenience, wide
applicability and the simplicity, rapidity and sensitivity of the
assay. In addition, selected host cells displaying an polypeptide
of interest may be used to stimulate an immune response.
[0173] The first step in the development of whole cells suitable
for the detection of analytes is the screening of antibody
libraries displayed on the cell surface. Cells displaying
antibodies having affinity for a desired analyte are isolated.
First, a library of cell surface displayed proteins is prepared as
described elsewhere in the specification. For example a library of
surface displayed scFv antibodies can be prepared as described in
Example 7. Once an expression library has been prepared, the
selected antigen for which one desires to identify and isolate
specific antibody or antibodies is labeled with a detectable label.
There are many types of detectable labels, including fluorescent
labels, the latter being preferred in that they are easily handled,
inexpensive and non-toxic. The labeled antigen is contacted with
the cells displaying the antibody expression library under
conditions that allow specific antigen-antibody binding. Conditions
can be varied so that only very tightly binding interactions occur;
for example, by using very low concentrations of labeled
antigen.
[0174] Identifying the antibody or antibody fragment expressing
cells may be accomplished by methods that depend on detecting the
presence of the bound detectable label. A particularly preferred
method for identification and isolation is cell sorting or flow
cytometry. One aspect of this method is fluorescence activated cell
sorting (FACS).
[0175] Following selection of high affinity clones, the production
of soluble antibodies can be achieved easily without the need for
further subcloning steps. Thus, the clones may be maintained under
standard culture conditions and employed to produce the selected
antibody. Production of antibody is limited only to the scaleup of
the cultures.
[0176] The invention further includes competitive binding assays
using cells with antibodies or analyte-combining antibody fragments
expressed on the outer cell surface. As used in the context of the
present invention, analyte is defined as a species that interacts
with a non-identical molecule to form a tightly bound, stable
complex. For practical purposes, the binding affinity is usually
greater than about 10.sup.6 M.sup.-1 and is preferably in the range
of 10.sup.9-10.sup.15 M.sup.-1. The analyte may be any of several
types of organic molecules, including alicyclic hydrocarbons,
polynuclear aromatics, halogenated compounds, benzenoids,
polynuclear hydrocarbons, nitrogen heterocyclics, sulfur
heterocyclics, oxygen heterocyclics, and alkane, alkene alkyne
hydrocarbons, etc. Biological molecules are of particular interest,
including amino acids, peptides, proteins, lipids, saccharides,
nucleic acids and combinations thereof. Of course it will be
understood that these are by way of example only and that the
disclosed immunoassay methods are applicable to detecting an
extraordinarily wide range of compounds, so long as one can obtain
an antibody that binds with the analyte of interest.
[0177] The disclosed whole cell immunoassay methods allow rapid
detection of a wide range of analytes and are particularly useful
for determination of polypeptides. The methods have been developed
to take advantage of the binding characteristics of bacterial cell
surface exposed anti-analyte antibodies. Such surface displayed
antibodies are stable and bind readily with specific analytes. This
unique form of protein expression and immobilization thus has
provided the basis of an extremely rapid competitive assay that may
be performed in a single reaction vessel in an "add and measure"
format. Such assays can be described as "one-pot" reactions that
make possible in situ detection of an analyte.
[0178] A particular advantage of cell surface expressed
antigen-binding antibodies is that the antibody is attached to the
outer membrane of the cell. The cells therefore act as a solid
support during the assay, thereby eliminating many of the
manipulations typically required in preparing reagents required for
existing immunoassay techniques. Optionally, cells with the
antibody displayed on the surface may themselves be attached to a
solid support such as a membrane, dipstick or beads to further
facilitate removal of the cells following the assay.
[0179] The immunoassays of the present invention may be used to
quantitate a wide range of analytes. Generally, one first obtains
the appropriate host cell culture where the anti-analyte antibody
is displayed on the host cell surface, calibrates with standard
samples of analyte, then runs the assay with a measured volume of
unknown concentration of analyte.
[0180] In conducting a competitive immunoassay in accordance with
the disclosed methods, one first obtains a host cell that expresses
an analyte binding antibody. The host cell is then contacted with a
standard analyte sample that contains a known amount of an analyte
linked to a detectable label employing conditions effective for
forming an immune complex. Once calibration is completed, the same
procedure is used with a second host cell that has the same
antibody or analyte-combining fragment expressed on its surface,
except that in addition to the standard labeled analyte sample, a
test sample in which an unknown amount of analyte is to be
determined is added. One is not limited to using the same host cell
in this procedure.
[0181] In the actual assay, a known amount of the antibody-covered
cells are placed in a solution of a known concentration of the
analyte-conjugate along with an unknown concentration of the
analyte (the test solution). The analyte conjugate competes with
free analyte in solution for binding to the antibody molecules on
the cell surface. The higher the concentration of analyte conjugate
in the solution, the fewer molecules of fluorescein analyte
conjugate bind on the surface of the cells, and vice versa.
[0182] The mixture is centrifuged to pellet the cells, and the
fluorescence of the supernatant is measured. The assay is
quantitative because the amount of observed fluorescence is
proportional to the concentration of analyte in the test sample,
i.e., if there is a very low concentration of analyte to compete
with the fluorescein conjugate, then most of the conjugate will
bind to the cells and will be removed from solution. The more
molecules of analyte in solution, the more molecules of analyte
bind to the antibodies thereby preventing the conjugate from
binding. In this case, more fluorescein conjugate remains in the
supernatant to give a stronger fluorescence signal. The assay can
be calibrated to generate a quantitative measurement of the unknown
concentration of analyte. The entire assay requires less than one
hour. Fluorescence determinations may be made with a basic
fluorimeter.
[0183] The present invention involves a novel method of carrying
out competitive immunoassays using antibodies attached to the
surface of cells. The disclosed immunoassays are useful for
binding, purifying, removing, quantifying or otherwise generally
detecting analytes. Antibodies expressed on bacterial cell surfaces
have been shown surprisingly adaptable for use in competitive
immunoassay procedures. In a particular example, the analyte
digoxin, a cardiac glycoside, was determined using
fluorescein-digoxin conjugate. The assay was quantitative with a
sensitivity in the nanomolar range.
[0184] Cells expressing an antibody fragment on their surface may
also be linked to a solid support, such as in the form of beads,
membrane or a column matrix, and the sample suspected of containing
the unwanted antigenic component applied to the immobilized
antibody. A purged or purified sample is then obtained free from
the unwanted antigen simply by collecting the sample from the
column and leaving the antigen immunocomplexed to the immobilized
antibody.
[0185] Detection of immunocomplex formation is well known in the
art and may be achieved through the application of numerous
approaches. These approaches are typically based upon the detection
of a label or marker, such as any of the radioactive, fluorescent,
chemiluminescent, electrochemiluminescent, biological or enzymatic
tags or labels known in the art. U.S. patents concerning the use of
such labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350;
3,996,345; 4,277,437; 4,275,149 and 4,366,241, each incorporated
herein by reference. Of course, one may find additional advantages
through the use of a secondary binding ligand such as a second
antibody or a biotin/avidin ligand binding arrangement, as is known
in the art.
[0186] The first added component that becomes bound within the
primary immune complexes may be detected by means of a second
binding ligand that has binding affinity for the surface expressed
antibody. In these cases, the second binding ligand may be linked
to a detectable label. The second binding ligand is itself often an
antibody, which may thus be termed a "secondary" antibody. The
primary immune complexes are contacted with the labeled, secondary
binding ligand, or antibody, under conditions effective and for a
period of time sufficient to allow the formation of secondary
immune complexes. The secondary immune complexes are then generally
washed to remove any non-specifically bound labeled secondary
antibodies or ligands, and the remaining label in the secondary
immune complexes is then detected.
[0187] Further methods include the detection of primary immune
complexes by a two step approach. A second binding ligand, such as
an antibody, that has binding affinity for the surface expressed
antibody is used to form secondary immune complexes, as described
above. After washing, the secondary immune complexes are contacted
with a third binding ligand or antibody that has binding affinity
for the second antibody, again under conditions effective and for a
period of time sufficient to allow the formation of immune
complexes (tertiary immune complexes). The third ligand or antibody
is linked to a detectable label, allowing detection of the tertiary
immune complexes thus formed. This system may provide for signal
amplification if this is desired.
[0188] The competitive immunoassay discussed above requires one to
set up a control sample. This sample comprises a second host cell
expressing an analyte binding antibody. This is contacted with a
known amount of analyte linked to a detectable label and a known
amount of unlabeled analyte, i.e. the analyte to be detected or
determined in the assay. After formation of the immunocomplexes,
one measures the free label in solution after the cells have been
separated. This measures the amount of residual detectable label as
the decrease in, e.g., fluorescence emission, from which the amount
of unknown analyte may be determined. A preferred fluorescent label
is fluorescein. The inventors have found that measurement of the
amount of residual label that is not bound to antibodies is
proportional to the amount of analyte label in solution. This
provides the basis for quantitative measure in that the increase in
the amount of label is directly proportional to the analyte.
Alternatively, the label may be measured in the complexes. In this
type of measurement, the analyte is inversely proportional to the
amount of label.
[0189] Of course fluorescence labeling, while preferred, does not
preclude the use of other detectable agents such as
chemiluminescent agents, electrochemiluminescent agents,
radioactive labels, enzymatic labels that form a colored product
with a chromogenic substrate as well as other fluorescent
compounds. A preferred fluorescent label is fluorescein while
Ru(bpy).sub.3.sup.2+ is preferred for use as an
electrochemiluminescent agent.
[0190] The invention is readily adaptable to the determination of
multiple analytes. This is achieved using two or more different
analyte-binding antibodies expressed in separate host cells. It is
also possible to surface express more than one antibody on the
surface of a particular host cell; however, this may cause
interference in binding. One will, in these situations, use
different detecting agents; for example, two different fluorescent
labels, each with distinct emissions, such as fluorescein which
emits at 520 nm and Texas Red which emits at 620 nm.
[0191] In certain uses of the assay, cells containing antibodies on
the surface are produced as described previously. Antibodies known
to bind tightly and specifically to a molecule of interest are
employed. The molecule could be a medically relevant molecule, a
marker molecule used in a scientific study, a pesticide of
environmental concern in groundwater, etc. A covalent conjugate of
the molecule with a fluorescent moiety such as fluorescein is
synthesized for use as a probe in binding. Other detection agents
include radioactive compounds, enzyme conjugates, chemiluminescent
reagents such as luciferase and electrochemiluminescent reagents
such as Ru(bpy).sub.3.sup.2+. (Yang et al., 1994; Blackburn et al,
1991). The assay may also be carried out using tritium as the
labeling agent for the antigen and performing a radioimmunoassay.
The radioactivity may be detected using a scintillation counter to
measure binding constants up to 10.sup.-8 or 10.sup.-1.
[0192] To perform the preferred assay, a known amount of the
antibody-covered cells are placed in a solution of a known
concentration of the molecule-fluorescein conjugate along with an
unknown concentration of the molecule. The molecule-fluorescein
conjugate competes with free molecules in solution for binding to
the antibody on the cell surface. The higher the concentration of
the molecule in the solution, the fewer molecules of
fluorescein-molecule conjugate will bind to the surface of the
cells, while lower concentrations of the molecule will result in
more of the conjugate bound to the cell surface.
[0193] Before measuring residual fluorescence, the cells are
removed from the solution, most conveniently by pelleting, and the
fluorescence of the supernatant measured. The assay is quantitative
because the amount of observed fluorescence is proportional to the
concentration of the molecule in the unknown sample. If there is a
very low concentration of the molecule to compete with the
fluorescein conjugate, most of the conjugate will bind to the cells
and will be removed from the solution. The higher the concentration
of the molecule in solution, the more molecules bind to the
antibodies thereby preventing the conjugate from binding. In this
case, more fluorescein conjugate remains in the supernatant to give
a stronger fluorescent signal. The assay can be calibrated to
generate a quantitative measurement of the unknown concentration of
the molecule. The entire assay takes less than an hour and requires
only a basic fluorimeter.
[0194] As part of the invention, immunoassay kits are also
envisioned comprising a container having suitably aliquoted
reagents for performing the foregoing methods. For example, the
containers may include one or more bacterial cells with particular
surface expressed analyte-binding antibodies. Suitable containers
might be vials made of plastic or glass, various tubes such as test
tubes, metal cylinders, ceramic cups or the like. Containers may be
prepared with a wide range of suitable aliquots, depending on
applications and on the scale of the preparation. Generally, this
will be an amount in conveniently handled form, such as
freeze-dried preparations, and sufficient to allow rapid growth of
the bacterial cells as required.
[0195] Such kits may optionally include surface-expressed
antibodies in host cells that are immobilized on surfaces
appropriate for the intended use. One may for example, provide the
cells attached to the surface of microtiter plates, adsorbent
resins, cellulose (e.g. filter paper), polymers, glass beads,
etc.
F. Methods for Screening Libraries of Surface Displayed
Polypeptides for the Isolation of Polypeptides Capable of Binding
to desired Target Molecules
[0196] The present invention discloses general methods for the
screening of polypeptide libraries for the isolation of
polypeptides that recognize and binding to desired target molecules
with high affinity. Cell expressing such high affinity polypeptides
can then be readily employed for immunoassays as described in
section E. of the specification.
[0197] The screening of combinatorial libraries of polypeptides is
greatly facilitated by the display of the polypeptides on the
surface of host cells. Simply, a cell population where each cell
displays a different polypeptide is contacted with a desired
ligand. The ligand is labeled such that it can allow the facile
separation of cells that display polypeptides capable of binding
the ligand. Examples of labels suitable for the purposes of this
invention include fluorescent dyes and magnetic particles.
Alternatively the desired target molecule can be immobilized on a
suitable solid support. Cells producing surface displayed
polypeptides capable of binding the desired target molecule thus
adhere to the immobilized support and can be readily separated from
cells that do not bind to the immobilized support.
[0198] FACS Separation of Desired Cells Libraries of
surface-displayed polypeptides are rapidly and efficiently sorted
using fluorescence activated cell sorting techniques (FACS). FACS
permits the separation of subpopulations of cells initially on the
basis of their light scatter properties as they pass through a
laser beam. Since cells are tagged with fluorescent-labeled
product, they can are characterized by fluorescence intensity and
positive and negative windows set on the FACS to collect
label.sup.+ (bright fluorescence) and label.sup.- (low
fluorescence) cells. Positive and negative windows are set to
collect label.sup.+ and label.sup.-1 cells, respectively. Cells are
sorted at a flow rate of about 3000 cells per second and collected
in positive and negative cells.
[0199] Identification of antibody-expressing bacteria by FACS is
directly based on the affinity for the soluble hapten thus
eliminating artifacts due to binding on solid surfaces. This means
only the high affinity antibodies are recovered by sorting
following binding of low concentrations of fluorescently labeled
antigen. There is no analogous method for specifically selecting
phage with very high affinity. Additionally, the sorting of
positive clones is essentially quantitative. It is limited only by
the accuracy of the flow cytometer, which is on the order of 95%.
In contrast with phage technology, the efficiency of selection is
not limited by avidity effects because screening does not depend on
binding to a surface having multiple antigens and thus the
potential for multivalent attachment sites.
[0200] Magnetic Separation of Desired Cells E. Coli cells with
surface expressed polypeptides can be incubated with paramagnetic
particles (e.g. Miltenyi Biotec, Bergisch Gladbach) that themselves
are coated with an antigen of interest (Radbuch et al. 1994).
Paramagnetic particles are available with a variety of surface
derivatization chemistries to allow for the covalent attachment of
a wide range of antigens. Bacteria having polypeptides with high
affinity for the antigen remain bound to the magnetic particles,
and the complexes isolated following washing steps in a strong
magnetic field that retains the paramagnetic beads. Alternatively,
cells labeled with paramagnetic particles can be separated in a
continuous magnetic separator.
[0201] Separation of Cells by Adsorption onto Supports with
Immobilized Target Molecules In another embodiment of the present
invention, cells displaying polypeptides that bind to the desired
target molecule may be isolated via selective adsorption onto solid
matrices. In this case the cell population displaying the
polypeptide library is contacted with a solid support in which the
antigen is covalently immobilized via standard chemical
immobilization methodologies. Cells that display polypeptides
capable of interacting with the immobilized target molecules are
retained on the solid support and can be separated from non-binding
cells. Following several washes with buffer to remove
non-specifically adsorbed cells, the cells that are bound via
specific interactions are employed for further studies. Such
specifically-bound cells can be dissociated from the solid support
either by adding large concentrations of the soluble desired
molecule to serve as a competitor or, alternatively by adding
growth media to allow the cells to grow. In the latter case the
progeny of the bound cells is released from the solid support.
G. Methods for the Selection of Evolved Enzymes
[0202] The immobilization onto micron sized particles generally
involves bacteria being entrapped within agarose gel microdroplets
(AGMs). This method involves entrapping microorganisms in AGMs (10
to 100 microns in diameter) which are surrounded by a hydrophobic
(low dielectric) fluid, subsequently distinguishing occupied and
unoccupied AGMs with colorimetric or fluorescence indicators,
counting both occupied and unoccupied AGMs and applying statistical
analyses to arrive at enumeration. It is possible to use a single
preparation of AGMs containing a range of AGM sizes, to
simultaneously provide a viable enumeration of growing and
non-growing cells.
[0203] The microdroplets are produced by first emulsifying a
solution containing bacteria and melted agarose. This results in
the formation of liquid microdroplets suspended in oil. By lowering
the temperature at which the agarose is made to polymerize, thus
forming micron sized droplets containing bacterial cells. AGMs of
approximately 10 .mu.M in diameter have been made using standard
procedure. The conditions for making AGMs that are occupied by one
cell are well known to those of skill in the art (Weaver et al.,
1991).
[0204] This technique starts with a conventional cell suspension
and generates a large number (10.sup.6) of AGMs/ml by adding the
cells to molten agarose and dispersing into mineral oil. This
suspension of AGMs is then transiently cooled to a gelation state
(Weaver et al., 1984; Weaver, 1986; Williams et al., 1987; Weaver
et al., 1988). Poisson statistics allow the measurement of size of
those AGMs that have a high probability of containing zero or one
initial cell or colony forming units. The AGMs can be transferred
out of the mineral oil into a suitable growth medium and incubated
to allow for the formation of microcolonies. These can then be
stained with fluorescent dyes for one or more generic indicators of
biomass, for example, nucleic acids (stained with propidium iodide)
or proteins (stained with FITC) and then measured using flow
cytometry generally with single cell resolution. DNA staining may
also be used and are well known to those of skill in the art
(Bliss, 1990; Powell, 1989).
[0205] This assay method is applicable to any cell type which is
amenable to being cultured in a gel-like matrix. The assay method
has been successfully demonstrated on mammalian, fungal and
bacterial cells (Weaver et al., 1991). The method is sensitive to
subpopulations with different growth rates and may be used for
working with a mixed population of cells without the need for
strain specific stains and is applicable to any growth based
assay.
[0206] For growth based assays the use of AGMs for the isolation of
individual cells within AGMs thereby allowing both monoculture and
mixed cell populations to be assayed. Further AGMs provide
confinement of progeny of individual cells within AGMs, rapid
measurement of large numbers of individual microcolonies by flow
cytometry and a hybrid of plating and cell suspension culture.
Other fundamental advantages include the extreme permeability of
AGMs allowing convenient and rapid changes in culture conditions.
AGMs respond rapidly to changes in physical conditions (heat,
electric field, light ionizing radiation), and they are small and
robust enough to be handled in a manner similar to the handling of
cells i.e. suspension, pipetting centrifuging and the like. It is
possible to add additional matrix components (separately or in
combination with agarose) to approximate a natural, complex
extracellular environment and support the growth of cells which do
not grow in agarose alone (Scott, 1987; Nilsson et al., 1987;
Akporiaye et al., 1988)
[0207] A variety of substrates can be used to assay the activity
of, and ultimately select for, desirable mutant enzymes out of
surface-expressed mutant enzyme libraries. Here the gene for an
enzyme to be mutated is expressed on the surface of bacteria such
as E. coli by cloning the gene for the enzyme into a
surface-expression vehicle such as the LPP-OmpA system (Francisco
et al., 1992, 1993). Mutant enzyme libraries can be created from
these gene constructs using known methods such as chemical
mutagenesis, error-prone PCR or amplification in a mutator strain.
Identification of mutant enzymes with desirable properties such as
novel substrate selectivity or remarkable catalytic activity can be
achieved using substrates that change an assayable property, i.e.
fluorescence intensity, ratio of multiple fluorophore emissions,
antibody detectable structural changes etc., upon catalytic action
of the enzyme.
[0208] Numerous formats can be used to create the substrates with
assayable properties. For example, when assaying hydrolytic enzymes
(lipases, esterases, phosphatases, etc.), a substrate can be
synthesized that has a fluorophore (fluorescein, bodipy, etc.) and
a quencher (eosin, tetramethyl rhodamine, etc.) attached on either
side of the hydrolyzed bond. Enzymatic cleavage will result in
separation of the fluorophore from the quencher leading to an
assayable increase in fluorophore fluorescence.
[0209] For an enzyme that synthesizes a single product from two or
more substrates (ligases, aldolases, kinases, various biosynthetic
enzymes), different fluorophores or chromophores can be attached to
the different individual substrates. The ratio of the emissions can
be determined, and a one-to-one ratio would indicate enzymatic
reaction. Alternatively, only one substrate could contain the
fluorophore, and the presence of fluorophore emission on a product
that is preferentially retained (see below) would indicate
enzymatic reaction. Additional formats could be envisioned in which
quenchers are attached to one of the substrates and a fluorophore
is attached to another, so that reaction leads to quenching of
emission.
[0210] Finally, antibodies could be created that bind only
products, not reactants, analogous to the detection used for
cat-ELISA experiments (Tawfik et al. (1993)). Here the
product-specific antibodies could be labeled with a fluorophore.
The retention of the fluorophore emission would indicate the
presence of product and hence an enzymatic reaction. This antibody
labeling method should be applicable to almost any enzymatic
process, regardless of reaction type, as long an antibodies could
be found that can discriminate between substrates and products.
[0211] Since the mutant enzymes will be displayed on the surface of
the bacteria, there is no impediment to diffusion of the assayable
substrate to the mutant enzymes. This direct substrate access will
allow substrates of virtually any size or shape to be used to assay
for catalytic activity, including polymeric species such as nucleic
acids or peptides, that would not reliably diffuse into cells.
[0212] An essential element of the experimental design is that the
spectroscopically identifiable product must remain associated with
the bacterium having the surface-expressed enzyme. This can be
accomplished by either of two methods.
[0213] In the first method, the product is electrostatically
trapped on the bacterial surface. Bacteria such as E. Coli have
negatively charged surfaces so that molecules with positive overall
charge are retained on the cellular surface. Substrate systems in
which the product(s) of the enzymatic reactions posses
substantially more positive charge than substrate(s) will have
product preferentially retained on the bacterium harboring the
surface expressed mutant enzyme that carried out the reaction. By
using low salt media, even after washing steps, the product can be
retained on the bacteria long enough for screening and selection of
the bacterial library using FACS. Here the gate of the FACS could
be set to select for any number of parameters such as the presence
of an unquenched fluorescent signal, the proper ratio between two
fluorophores of different emission wavelengths, the specific
retention of a single fluorophore, or the presence of product
specific antibodies with covalently attached fluorophores. One or
several rounds of mutagenesis and/or FACS selection could be used
for enrichment of bacteria expressing desired mutants, and the
selected bacteria can be plated directly for screening of
individual colonies, or regrown in liquid media in preparation for
further rounds of FACS selection.
[0214] In the second method, the enzymatic reaction with substrate
is carried out in AGM's (Weaver et al., 1991) with enclosed
bacteria from the surface-expressed enzyme library. A solvent is
chosen, such as mineral oil, to suspend the AGM's such that the
product of the enzyme reaction is only soluble in the aqueous
environment of the AGM surrounding the cell, not the mineral oil.
This will ensure that the AGM with the most active enzyme will
accumulate the most product. If the product fluorescence can be
distinguished from substrate, i.e. via unquenching (hydrolysis of a
fluorophore/quencher substrate) or quenching (synthesis of a
product with both a fluorophore and a quencher from substrates that
contained only one or the other) then the AGM's with desired enzyme
activities could be isolated by FACS or via fluorescence microscopy
using a micromanipulator.
[0215] For any of the previously mentioned selection strategies,
the substrates can be changed dramatically all at once, or
incrementally over the course of several rounds of selection.
Either way, enzymes with dramatically different activities compared
to wild type will be isolated.
I. EXAMPLES
[0216] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
Example 1
Surface Expression of Anti-digoxin Single Chain Fv Antibodies
[0217] E. coli strain JM109 [endA1 recA1 gyrA thi-1 hsdR17
(r.sub.k.sub.-, M.sub.k+) relA1 supE44 .DELTA.(lac-proAB)/F'
traD36proAB lacl.sup.q lacZ.DELTA.M15] was used for all studies.
pTX101 codes for an Lpp-OmpA-.beta.-lactamase fusion (Francisco et
al., 1992). pTX152 codes for an Lpp-OmpA-scF.sub.v(digoxin) fusion,
where the scF.sub.v(digoxin) is an anti-digoxin single chain
F.sub.v consisting of the heavy- and light-chain variable regions
(V.sub.H and V.sub.L). The V.sub.H and V.sub.L, joined by a 15
amino acid [(Gly).sub.4Ser].sub.3 linker (Huston et al., 1988),
were amplified from messenger RNA isolated from two separate
anti-digoxin hybridomas. An 11 amino acid peptide from the Herpes
Simplex Virus glycoprotein (Novagen) was introduced at the
C-terminus of the scF.sub.v for analytical purposes. The presence
of the HSV peptide allowed detection of the scF.sub.v(digoxin)
protein by reaction with a monoclonal antibody specific for the 11
amino acid epitope. The sequence of the single chain F.sub.v
antibody fragment is disclosed in SEQ ID NO: 2. pTX152 was
constructed by first removing the bla from pTX101 by digestion with
EcoRI and BamHI. The amplified gene coding for the anti-digoxin
scF.sub.v was then digested with EcoRI and BamHI and ligated into
pTX101. Both pTX101 and pTX152 carried the chloramphenicol
resistance gene. Cultures were grown in LB medium (Difco)
supplemented with 0.2% glucose and chloramphenicol (50 .mu.g/ml) at
a temperature of either 24.degree. C. or 37.degree. C.
[0218] Overnight cultures grown at 24.degree. C. were harvested,
resuspended in PBS at OD.sub.600=2.0 and lysed by passage through a
French pressure cell at 20,000 psi. The lysates were then diluted
with 1 volume of phosphate buffered saline containing 2.0% bovine
serum albumin (PBS/2% BSA) and 5 mM of the protease inhibitor
phenylmethylsulfonyl fluoride (PMSF). 96 well microtiter plates
were incubated overnight at 37.degree. C. with 100 .mu.l of 100
.mu.g/ml of either bovine serum albumin (BAS) or digoxin-conjugated
BSA (digoxin-BSA) in 0.1 M sodium carbonate buffer (pH 9.2). All
subsequent steps were carried out at room temperature. The wells
were fixed for 5 min with 100 .mu.l methanol and were then blocked
for 45 min with 200 .mu.l of pBS/1% BSA. After removing the
blocking solution, the wells were incubated for 2 hr with 100 .mu.l
of lysates, washed 3 times with 200 .mu.l PBS/0.1% Tween 20 and
incubated for 1 hr with 100 .mu.l/well of monoclonal antibodies
against the HSV peptide or antiserum against .beta.-lactamase. The
wells were again washed 3 times with PBS/0.1% Tween, incubated for
1 hr with 100 .mu.l of the appropriate secondary antibodies
conjugated with horseradish peroxidase and were finally washed 5
times with PBS/0.1% Tween and 2 times with PBS. After addition of
the substrate 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid)
(Pierce, Rockford, Ill.) the absorbance of each well was measured
at 410 nm.
[0219] Whole cell ELISAs were performed as described above except
that 100 .mu.l samples of overnight cultures that had been
resuspended in PBS/1% BSA at OD.sub.600=1.0 were used instead of
cell lysates.
[0220] For fluorescence microscopy, overnight cultures grown at
24.degree. C. were harvested, resuspended at OD.sub.600=0.5 in PBS
containing 10.sup.-7 M fluorescein-conjugated digoxin
(digoxin-FITC; ILS LTD, London) and were incubated at room
temperature for 1 hr. Prior to microscopy the cells were washed
once with PBS and resuspended in equal volumes of PBS and
Vectashield mounting medium (Vector Laboratories) at an OD.sub.600
of approximately 2.0.
[0221] The protein composition of whole cell membrane fractions
isolated from overnight cultures was analyzed by SDS-PAGE on 12%
acrylamide gels and by Western blotting using anti-HSV monoclonal
antibodies obtained from Novagen Inc. (Madison, Wis.), and
anti-OmpA antiserum. Whole membrane fractions were prepared as
described in Francisco et al. (1992).
[0222] Cells were grown in liquid culture at 37.degree. C. and used
to isolate total membranes. The presence of a band of the expected
size (42 kDa) was detected in Western blots of whole cell membranes
probed with antibodies specific for OmpA and for the HSV peptide
(FIG. 1A). Cells containing pTX152 produced a protein which reacted
with both the HSV-specific and the OmpA specific sera, as expected
for the Lpp-OmpA-scF.sub.v(digoxin) fusion. Control cells
containing pTX101 reacted only with OmpA antiserum. The lower
molecular weight band in lanes 1 and 2 corresponds to the intact
OmpA protein of E. coli.
[0223] The near absence of lower molecular weight bands
crossreacting with either the anti-HSV or the anti-OmpA antibodies
indicated that the scF.sub.v(digoxin) was not subjected to
proteolysis ostensibly because it was anchored on the cell surface
and consequently is physically separated from intracellular
proteases. The intensity of the Lpp-OmpA(46-159)-scF.sub.v(digoxin)
band in FIG. 1A is comparable to that of the native OmpA band. The
latter is a highly expressed protein that is present in the E. coli
outer membrane at about 100,000 copies per cell (Lugtenberg &
Van Alphen, 1983). The level of expression
Lpp-OmpA(46-159)-scF.sub.v(digoxin) is on the order of
50,000-100,000 copies per cell.
[0224] The scF.sub.v domain of the Lpp-OmpA-scF.sub.v(digoxin)
fusion protein encoded by pTX152 was shown by ELISA to bind
specifically to the hapten digoxin. Whole cell lysates from
JM109/pTX152 and from JM109/pTX101 as control were incubated on
microtiter wells that had been coated with either
digoxin-conjugated BSA (digoxin-BSA) or unconjugated BSA.
Subsequently, the wells were treated with antibodies against the
HSV peptide or .beta.-lactamase to detect
Lpp-OmpA(46-159)-scF.sub.v(digoxin) or
Lpp-OmpA(46-159)-.beta.-lactamase, respectively. FIG. 1A shows that
lysates from JM198/pTX152 bound specifically to wells coated with
digoxin-BSA but not to unconjugated BSA, whereas the lysates from
the control strain, JM109/pTX101, did not give a signal with
either. Thus, Lpp-OmpA(46-159)-scF.sub.v(digoxin) is active and can
bind to the hapten specifically.
[0225] FIG. 1B shows the results of ELISAs using intact cells.
Samples containing the same number of cells were used in all the
studies. Cells containing the control plasmid, pTX101, gave the
same low signal when incubated on microtiter wells coated with
either unconjugated BSA or with digoxin-BSA. A similar weak signal
was detected with JM109/pTX152 incubated on BSA-coated wells and is
presumably due to non-specific binding. In contrast, a much higher
absorbance was evident in wells coated with the digoxin-BSA
conjugate indicating that there are active fusion protein molecules
on the cell surface.
[0226] The display of the active scF.sub.v antibody on the cell
surface was confirmed by fluorescence microscopy (FIG. 2B).
JM109/pTX152 cells were grown overnight at 24.degree. C., incubated
with a 1.times.10.sup.-7 M solution of a digoxin-FITC conjugate for
1 hour and washed. As shown in FIG. 2A and FIG. 2B, all of the
cells visible with phase contrast microscopy gave a strong
fluorescence signal. In control studies, when JM109/pTX101 cells
were incubated with the same concentration of digoxin-FITC and then
washed, none of the cells became fluorescently labeled.
Furthermore, protease treatment drastically reduced the ability of
the cells to bind fluorescein-digoxin judging from the generation
of a signal detectable by FACS.
[0227] The intensity of the fluorescence signal from JM109/pTX152
was dependent on the cell growth temperature and was much higher
for cultures grown at 24.degree. C. instead of 37.degree. C. This
was consistent with previous results showing that the amount of
proteins expressed on the surface of E. coli by fusion to
Lpp-OmpA(46-159) increased as the temperature is decreased
(Francisco et al., 1992; 1993). Assuming that the efficiency of
surface display in this case is similar to that of .beta.-lactamase
(Francisco et al., 1992), then at 24.degree. C. virtually all the
scF.sub.v antibody chains must be accessible on the cell
surface.
[0228] Samples of 10.sup.8 cells per ml from cultures grown at
24.degree. C. were incubated with digoxin-FITC at 10.sup.-7 M,
washed in buffer and diluted to 3.times.10.sup.6 cells per ml prior
to sorting. The samples were then analyzed using a FACSort flow
cytometer. FIG. 3A and FIG. 3B show that the fluorescence intensity
of JM101/pTX152 cells expressing a surface displayed recombinant
antibody specific for digoxin was substantially higher than the
intrinsic background signal of control E. coli cells. JM101/pTX101
expressing Lpp-OmpA(46-159)-.beta.-lactamase is used as a
control.
[0229] When JM109/pTX152 cells were preincubated with an excess of
free digoxin prior to incubation with the digoxin-FITC conjugate,
the fluorescence intensity of the cells was the same as for the
background (FIG. 3D). This specific inhibition was also seen using
fluorescence microscopy, and demonstrates that the surface
expressed scF.sub.v(digoxin) specifically binds the fluorescently
labeled hapten in the binding site and is not the result of
nonspecific interactions.
[0230] Treatment of intact cells with trypsin prior to incubation
with digoxin-FITC almost completely eliminated the population of
fluorescently labeled cells detected by flow cytometry (FIG. 3C).
In gram-negative bacteria, the outer membrane serves as a barrier
to preclude the diffusion of large extracellular molecules such as
proteins. The action of trypsin is limited to the proteolysis of
proteins exposed on the external surface of E. coli (Kornacker
& Pugsley, 1990). Thus, the above result provides further
evidence that the active scFv(digoxin) is indeed accessible on the
outer surface, free to interact with molecules in solution.
[0231] The scF.sub.v(digoxin) binding sites appeared to be fully
saturated at concentrations of digoxin-FITC above 10.sup.-7 M.
Appreciable fluorescent signal was clearly detected even at
digoxin-FITC concentrations of 10.sup.-9 M. These results are
consistent with a binding constant that is at least within an order
of magnitude of the reported affinity of a soluble anti-digoxin
scF.sub.v antibody (Huston et al., 1988).
Example 2
Enrichment of Cells Displaying scF.sub.v Antibodies by FACS
[0232] Antibody expressing cells were sorted essentially
quantitatively from an excess of control E. Coli in a single step.
Specifically, in mixtures containing JM109/pTX101 control cells at
an excess of either 100:1 or 1,000:1, the fraction of the total
population that was sorted in the high fluorescence intensity
window was 1.1% and 0.1% respectively (after subtracting the
background), as expected from the ratio of input cells.
[0233] The use of FACS for isolating rare clones from a very large
excess of background was also demonstrated. JM109/pTX101 (cells
displaying an unrelated protein on the cell surface) and
JM101/pTX152 (cells displaying the scFv(digoxin) antibodies) were
mixed at a ratio of 100,000:1 and labeled with digoxin-FITC.
Following washing to remove any non-specific binding of the
digoxin-fluorescein conjugate on the control E. Coli, 500,000 cells
were run through the FACSort flow cytometer. A wide sorting gate,
i.e., the minimum fluorescence required for acceptance of an
individual cell, was selected such that up to 0.2% of the control
cells fell within the sorting window. This ensured that all the
scF.sub.v(digoxin) expressing cells would be recovered. The cells
having an allowable fluorescence signal were collected and grown in
fresh media at 37.degree. C.
[0234] An aliquot from that culture was used to inoculate fresh
media and incubated at 24.degree. C. Cells grown at this lower
temperature were used for FACS because of the higher extent of
surface display of the scF.sub.v(digoxin) antibody on the surface
of cells grown at 24.degree. C. 500,000 cells from this culture
were run again through the FACSort and those with a fluorescence
within the allowable window were collected automatically under
sterile conditions. The sorted population was grown first at
37.degree. C. and then subcultures at 24.degree. C. and was
subjected to a final round of sorting as above.
[0235] To ensure the complete absence of artifacts due to
non-specific cell adhesion in the flow path of the FACSort, each
run was followed by extensive washing with bleach. FIG. 3E, FIG. 3F
and FIG. 3G show the cell fluorescence distribution for the sorting
runs. After only two rounds of growth and sorting, the fluorescence
intensity of 79% of the cell population fell within the positive
window. A similar enrichment was reproducibly obtained in three
independent studies. These results were not due to a growth
advantage of the cells expressing
Lpp-OmpA(46-159)-scF.sub.v(digoxin), since successive regrowth of
the input cell mixture in the absence of sorting did not result in
any detectable enrichment.
[0236] To verify that the cells with the increased fluorescent
signal after the final sorting step were indeed JM109/pTX152, a
sample of cells from the final round of FACS was plated on
chloramphenicol plates and then replica plated on plates containing
100 .mu.g/ml ampicillin. The pTX152 plasmid confers resistance only
to chloramphenicol whereas the plasmid pTX101 which is present in
the control cells also confers resistance to ampicillin. Over 95%
of all the colonies examined were chloramphenicol resistant and
ampicillin sensitive (cm.sup.+, amp.sup.-), consistent with the
phenotype expected for JM101/pTX152 cells. As an additional test,
plasmid DNA was isolated from eight cm.sup.+, amp-colonies and the
presence of pTX152 was confirmed by restriction analysis.
[0237] The above results demonstrate that E. Coli displaying a
recombinant antibody on its surface can be recovered from at least
a 10.sup.5-fold excess of control E. coli simply by incubation with
a fluorescent hapten and fluorescent activated cell sorting. Only
two rounds of sorting and regrowth of the sorted cell population
are needed for enrichment from a large excess of background.
Example 3
Surface Expression of Anti-Digoxin Antibody Incorporating Protease
Cleavage Site
[0238] A construct similar to that used for surface expression of
scF.sub.v (digoxin) can be modified to incorporate a protease
cleavage site. For example, the recognition sequence of
enterokinase [(Asp).sub.4-Ile-Arg] can be introduced in the
Lpp-OmpA(46-159)-scF.sub.v between the OmpA(46-159) and the
scF.sub.v domains. The protease cleavage site at the N-terminal of
the scF.sub.v antibody domain of the fusion protein is then used to
release the scF.sub.v antibody in soluble form following treatment
of the cells with the appropriate proteolytic enzyme. Because the
outer membrane of E. coli serves as a protective barrier to the
action of externally added proteases, very few contaminating
proteins will be present in the culture supernatant. A single
colony expressing a desired single chain F.sub.v antibody can be
grown in liquid media and harvested by centrifugation after
overnight growth at 24.degree. C. The cells are resuspended in
buffer to maintain the pH approximately neutral. Protease added at
appropriate concentrations to the fusion protein to be treated and
incubated at least 4 hours at 4.degree. C. will release the soluble
single chain F.sub.v. Subsequently the cell suspension is
centrifuged and the supernatant containing the solubilized single
chain F.sub.v antibody is collected.
[0239] To separate the cleaved, soluble scF.sub.v antibody from the
protease, as well as any E. coli trace contaminants, a His.sub.6
sequence may be introduced at the C-terminus of the scF.sub.v using
PCR amplification with the appropriate primers. Polyhistidine tails
bind strongly to metals so that the fusion protein can be purified
by immobilized metal-ion affinity chromatography (IMAC). The
separation of the cleaved scF.sub.v antibody using is carried out
as described by Georgiou et al. (1994).
[0240] Lpp-OmpA(46-159) fusions are typically expressed at a high
level, typically around 5.times.10.sup.4 per cell. Thus the yield
after protease treatment and IMAC is at least 2-3 mg of antibody
per liter of shake flask culture.
Example 4
Solid Phase Immunoassays
[0241] This example illustrates a solid phase immunoassay using E.
coli with anti-digoxin single chain F.sub.v displayed on the
surface. This immunoassay is demonstrated to be a sensitive and
quantitative technique. To facilitate the removal of the surface
expressed antibody following the reaction with antigen, the cells
may be attached to a solid support such as a membrane, dipstick or
beads.
[0242] Digoxin-FITC (The Binding Site Inc. (San Diego, Calif.) was
diluted to a concentration of 20 nM in PBS. Digoxin (Sigma, St.
Louis, Mo.) was brought to a concentration of 1 .mu.M in PBS. The
pTX152/JM109 cells were grown in LB overnight at 37.degree. C. then
subcultured into fresh LB and grown overnight at room temperature.
The cells were harvested and resuspended in PBS pH 7.4 at a
concentration of 10.sup.10 cells/ml, based on the O.D..sub.600 to
form a cell stock. Some cells were also resuspended in 15%
glycerol/water and stored at 70.degree. C. Frozen cells yielded the
same results as freshly prepared cells.
[0243] The following reagents were transferred to a 1.5 ml
microcentrifuge tube, 25 .mu.l of 20 nM digoxin-FITC solution,
0.5-50 .mu.l of 1 .mu.M digoxin and PBS to a final volume of 950
.mu.l. The mixture was vortexed briefly and pulsed in an Eppendorf
microcentrifuge. A 25 .mu.l or 100 .mu.l aliquot of the cell stock
(10.sup.10 cells/ml) was added to the mixture and allowed to
incubate for 1 hour at room temperature. Following this incubation
the cells were spun in a microcentrifuge for 5 minutes at 5,000 rpm
and the supernatant collected. The fluorescence of the digoxin-FITC
in the supernatant was measured using a fluorimeter.
[0244] This immunoassay was also performed with the cells attached
to a solid support. The solid support was Fisher filter paper P5
was cut into strips approximately 0.5 cm.times.2 cm, and dampened
in PBS by submerging one end of the filter paper and allowing it to
move upward. The filter paper was allowed to dry slightly and 10
.mu.l of a solution containing 6.times.10.sup.9 cells/ml was
applied to the filter paper. The cells were fixed to the paper with
a solution of 6-PLP, 8% PFA and NaIO.sub.4. The 6-PLP solution is
10 mM 6-PLP, 200 mM MES, 700 mM NaCl, 50 mM KCl, 700 mM Lysine-HCl,
50 mM MgCl.sub.2, and 70 nM EGTA followed by 0.01M MgCl.sub.2 and
8% PFA. The 8% PFA was prepared by addition of 4 g of PFA into 50
ml of water, followed by heating the solution to 70.degree. C. with
constant stirring. Approximately 2 drops of a 1M solution of NaOH
was added to the solution until it became clear. The solution was
then filtered through Whatman filter paper #1, allowed to cool and
stored at 4.degree. C. until use. The final fixative solution was
produced by mixing the components A, B and C to a final volume of
10 ml just prior to use, where A is 1 ml 6-PLP, 04 g sucrose and
3.03 ml water; B is 21.4 mg NaIO.sub.4; and C is 4.62 ml 8% PFA.
The fixative was applied dropwise to one end of the filter paper
and allowed to soak upwards. The excess fixative was allowed to
drain and the filter paper was washed twice with a solution of 100
mM NH.sub.4Cl. The filter paper can then be stored in a solution of
PBS until use.
[0245] The assay was performed by removing the filter paper with
the cells attached and then measuring fluorescence of the
solution.
[0246] Essentially quantitative assays for an antigen can be run
using a mixture of a known amount of labeled antigen combined with
an unknown amount of unlabeled antigen. In one exemplary study,
pTX152/JM109 with antidigoxin antibody displayed on the surface
were grown in LB overnight at 37.degree. C., subcultured into fresh
LB and grown overnight at room temperature. The cells were pelleted
and resuspended in PBS to form a stock solution of cells at a
concentration of 1.times.10.sup.10 cells/ml. A mixture of 25 .mu.l
of 20 nm digoxin-FITC and an amount of 1 .mu.M free digoxin in the
range of 0.5-50 .mu.l, was prepared and brought to a final volume
of 950 .mu.l with PBS. A 25 .mu.l or a 100 .mu.l aliquot of the
cell stock solution was added to the mixture to give a total of
0.25.times.10.sup.9 or 1.times.10.sup.9 cells. The mixture was then
allowed to incubate at room temperature for 1 hour. The cells were
pelleted and the fluorescence of the supernatant was measured for
each sample.
[0247] FIG. 4 shows a plot of the residual fluorescence observed
with the indicated amount of free digoxin, 0.5 nM digoxin-FITC
conjugate and either 250 million or 1 billion cells expressing the
antidigoxin single chain antibody on their surface.
[0248] To facilitate the removal of the surface expressing antibody
cells following the reaction, the cells may be attached to a solid
support. In this example the solid support consisted of a membrane
however many other supports would work as well such as dipsticks or
beads.
[0249] Strips of filter paper were moistened with PBS and allowed
to dry slightly. A 10 .mu.l aliquot of a 6.times.10.sup.9 cells/ml
of a cell suspension containing pTX152/JM109 cells displaying
anti-digoxin antibodies on their surface was applied to the strips
of pre-moistened filter paper. The cells were then fixed to the
paper using a mixture of 6-PLP, PFA and NaIO.sub.4, as described in
the materials and methods, and washed twice with a solution of 100
mM NH.sub.4Cl. Following the incubation no centrifugation is
necessary the filter paper is simply removed from the solution and
the residual fluorescence measured as described previously.
[0250] The assays described in this example use fluorescence as the
indicator of binding; however, other indicator reactions may be
used such as radioactivity, enzyme conjugates and when the surface
expressed antibody is catalytic, an assay for catalytic activity
may be used.
Example 5
Discrimination of Surface Displayed Antibody Affinity by Flow
Cytometry
[0251] This example demonstrates that the display of antibodies on
the surface of microorganisms constitutes the basis for
discriminating between antibodies of different affinities. By
adjusting the fluorescent antigen concentration, it is possible to
discriminate binders of high affinity from those with moderate
affinity.
[0252] The heavy-chain residue Y33 of the scFv(digoxin) antibody is
known to be critical for antigen binding (Short et al., 1995). The
following mutants of the scFv (digoxin) antibody: Y33N, Y33C, Y33S,
Y33G, Y33STOP were constructed by overlap extension PCR.TM. (Ho,
1989). The large fragment from EcoR I digested pSD192 was purified
and religated to yield pSD195 (AmpR). Primers Y33C.s, Y33N.s,
Y33S.s Y33G.s, and Y33Stop.s along with 3' primer CMI.5 were used
to amplify 3' fragments for mutant constructions. The 5' overlap
fragment was produced with primers #4 and #3 and overlapped with
the mutant fragments using primers #4 and CMI.5. The resulting
products were digested with EcoRI and ligated into pSDI95, and
electroplated into JM109 to yield Cm resistant mutants pY33N,
pY33C, pY33S, pY33G, and pY33STOP. Overnight cultures were grown at
37.degree. C. and subcultured 1:100 at 25 .degree. C. for 20 hrs.
cells (200 ml) were harvested into 1 ml PBS pH 7.1-7.4, pelleted by
centrifugation at 3000.times. g for 4 min, and resuspended in 1.5
ml PBS. Cells were aliquoted into a clean eppendorf tube and
fluorescein-conjugated digoxin (The Binding Site, Eugene, Oreg.)
was added to 1.times.10.sup.-7 M. Cells were incubated at room
temperature (22-24.degree. C.) for 1 hr with gentle shaking,
pelleted and resuspended in I ml and analyzed by flow cytometry. At
least 10,000 events were acquired on a Becton Dickinson (San Jose,
Calif.) FACSort. Parameters were set in LOG mode as follows: FSC
threshold 80, FSC preamp E01, FL1 800, SSC 400. Debris and other
particulate material were excluded by defining an appropriate
FSC-SSC around the cell population.
[0253] The relative affinity of the mutants constructed were, as
determined by in vitro ELISA data, Y33N (moderate), Y33S (low),
Y33G (background), and Y33Stop (background). The flow cytometry
data and previously obtained ELISA results (Burks et al., 1997),
are shown in FIG. 5A and FIG. 5B, respectively. Importantly, the
flow cytometry data for individual Y33 mutants correlate with ELISA
data. In particular, the mean fluorescence signals vary in the
manner WT>Y33N>Y33S>Y33G_Y33Stop. The results further
demonstrate that the high affinity wild-type scFv may be
discriminated from the low affinity Y33S, and to a lesser extent,
from the moderate affinity Y33N at concentrations of
fluorescent-digoxin approximately 20-fold greater than the
dissociation constant.
Example 6
Flow Cytometric Assay for the Determination of Antigen Binding
Affinities of Antibodies Displayed on Cell Surfaces
[0254] The availability of a fluorescent-antigen conjugate affords
a simple and rapid method for flow cytometric affinity estimation
of antibodies displayed on the cell surface. In this example cell
aliquots were incubated with various concentrations of
BODIPY-digoxin, diluted in PBS, and the mean total fluorescence was
determined by flow cytometry. For detailed flow cytometric
analysis, 20 ml were added directly from a 24 hr, 25.degree. C.
culture to 180 ml BODIPY-digoxin at 10, 5, 2.5, 1. 25, 0.62 and 0
nM in 96-well -plate, and allowed to incubate 1 hr with gentle
shaking. Cell samples were diluted 1:5 in PBS for flow cytometric
analysis. Mean fluorescence was recorded for each sample, and the
resulting data were used to plot a saturation curve and calculate
the relative dissociation constant. Fluorescence histograms for the
wild-type antibody expressing cells over a range of concentrations
is shown in FIG. 6A. Normalized saturation curves for three mutants
with apparent affinities within 1.5 fold of the wild type are shown
in FIG. 6B.
Example 7
Screening Antibody Libraries by Cell Surface Display and
Fluorescence-Activated Cell Sorting
Vector Construction for Surface Expression of scFv Libraries.
[0255] The successful construction and screening of polypeptide
libraries displayed on the cell surface it was found to be
important to construct novel vectors that eliminate the probability
of contamination of the library with wild-type plasmid
molecules.
[0256] Thus, pSD195 containing only the N-terminal portion of the
cat gene immediately downstream of the scFv to be expressed at the
cell surface, was constructed. Two Pst I restriction sites were
introduced, by silent mutagenesis, into the vector to simplify
library construction. The first site was created just upstream of
the scFv LCDR3 to be randomized and the second was introduced
within the chloramphenicol resistance gene, (CmR). Removal of the
Pst I insert followed by religation generated pSDI95, which does
not allow host growth in the presence of chloramphenicol (Cm),
since cat is functionally inactivated. Thus, after library ligation
and transformation, only clones that contain the correct PCR.TM.
generated insert, in the correct orientation, will restore Cm
resistance, and consequently, growth in the presence of Cm.
[0257] All DNA manipulations were as described elsewhere (Maniatis,
1996). Restriction enzymes were from Promega (Madison, Wis.), and
Pfu polymerase from Stratagene (La Jolla, Calif.). Escherichia coli
strain JM109 was used for all cloning steps and library
experiments. Oligonucleotides for PCR.TM. reaction are shown in
Table 4. Overnight cultures were grown at 37.degree. C. in LB media
supplemented with 0.2% glucose, ampicillin (100 .mu.g/ml) and
chloramphenicol (30 .mu.g/ml), and subcultured 1:100 at 25.degree.
C. for a specified duration. pTX152 was digested with Pvu I and
BamH I, and the small fragment from pTX152 was ligated into
similarly digested pET-22b to yield pGC183. The chloramphenicol
acetyl transferase gene (cat) was amplified from pBR325 with
primers CM.1.s and CM.2.as, digested with EcoR I and Sph I and
ligated into similarly digested pGC183 to yield pGC185. Finally,
the digoxin scFv was reintroduced into pGC185 by ligating the EcoR
I-BamH I fragment from pTX152 with similarly digested pGC185 to
yield the pGC182 (ampR, cmR). Subsequently, the Pst I site was
removed from pGC182 by replacing the AlwN I/Pvu I fragment with
that from pUC18 giving rise to pSD 182. Pst I sites were introduced
upstream of the light-chain CDR3 and within the cat gene by silent
mutagenesis. Primers #4 and PIA.1as (Rxn1), PIA.2s and PIB.1as
(Rxn2), and PIB.2s and SphI.2.as (Rxn3) were used to amplify the
corresponding fragments from pTX152, pSD182, and pBR322
respectively. Products from Rxn2 and Rxn3 were amplified with PIA.2
and Sph1.2as and the resulting product was overlapped with the Rxn
I product using primers #4 and SphI.2as, digested with EcoR I and
Sph I and ligated into similarly digested pSD182 to yield pSD192
(FIG. 7). TABLE-US-00004 TABLE 4 OLIGONUCLEOTIDE PRIMERS FOR
LIBRARY CONSTRUCTION #4 TGGACCAACAACATCGGT SEQ ID NO:3 CMI5
CCCATATCACCAGCTCACCGTCTTTC SEQ ID NO:4 CMI4
GACCCCGAGGACTAACGTCTTCGAATA SEQ ID NO:5 AATAC CM.1
CCGAATTCGTTTGAACATGCCTAAC SEQ ID NO:6 CM.2
CGGAATTCGTGCGCAACACGATGAAGC SEQ ID NO:7 TC SPH1.2.AS
AGGGCATGCAAGGGCACCAATAACTGC SEQ ID NO:8 CTTA P1A.1.AS
TTGGCTGCAGTAATATATTGCAGCAT SEQ ID NO:9 P1A.2.S
TGCAATATATTACTGCAGCCAAACTAC SEQ ID NO:10 GCAT P1B.2.S
CGGCAGTTTCTGCAGATATATTCGCAA SEQ ID NO:11 GAT P1B.1.AS
CTTGCGAATATATCTGCAGAAACTGCC SEQ ID NO:12 GGAA P1B.AS
ACGCCACATCTTGCGAATATATCTGCA SEQ ID NO:13 GAAACTGCCGGAA #3
CAGGGTACATTTTCACCG SEQ ID NO:14 LCDR3.S AACTGCAGCCAANNBACGCATNNBCCA
SEQ ID NO:15 NNBACGTTCGGCTCGGGGA HCDR3.1.S
GTATACTATTGCGCCGGCTCCTCTGGT SEQ ID NO:16
AACNNSNNSNNSNNSGATTATTGGGGT CATGGTGCT H2.AS
GTTACCAGAGGAGCCGGCGCAATAGTA SEQ ID NO:17 TAC Y33N.S
TACATTTTCACCGACTTCAATATGAAT SEQ ID NO:18 TGGGTTCGC Y33C.S
TACATTTTCACCGACTTCTGCATGAAT SEQ ID NO:19 TGGGTTCGC Y33S.S
TACATTTTCACCGACTTCTCTATGAAT SEQ ID NO:20 TGGGTTCGC Y33G.S
TACATTTTCACCGACTTCGGGATGAAT SEQ ID NO:21 TGGGTTCGC Y33STOP.S
TACATTTTCACCGACTTCTAAATGAAT SEQ ID NO:22 TGGGTTCGC
[0258] Construction of Cell Surface Displayed scFv Libraries
[0259] The digoxin scFv light-chain codons for T91, V94, and P96
were chosen for randomization. Both T91 and P96 form important
contacts with digoxin in the Fab crystal structure (Jeffrey et al.,
1993), suggesting that they play an important role in determining
the antibody affinity.
[0260] Light-chain residues T91, V94 and P96 were randomized by
PCR.TM. with Pfu polymerase (Stratagene, La Jolla, Calif.). Primers
(Genosys, The Woodlands, Tex.) LCDR.3.s and CMI.5 were used to
amplify the LCDR3-cmR 700bp fragment encoding the antibody LCDR3
and cat gene fragment with non-Pst I containing pSD182 as a
template to prevent wild-type contamination. The resulting PCR.TM.
product was digested with Pst I, purified by gel electrophoresis
and electroelution and ligated into Pst I digested, phosphatase
treated pSDI95. The resulting plasmid library was electroporated
into JM109 to yield 2.times.10.sup.5 transformants. After an 8 hr
growth in liquid media, light-chain library plasmid DNA was
prepared to provide a stock for subsequent library screening
experiments. The probability that each amino acid sequence is
represented in the library pool may be calculated, using a Poisson
distribution (Lowman et al., 1991), to be greater than 85%. Flow
cytometric analysis of ten randomly picked clones showed 1/10 to
weakly bind fluorescein-digoxin and 9/10 clones exhibited no
binding.
[0261] A second library was created by randomizing heavy-chain
residues H99.K, H100.W, H100a.A, and H100b.M) using the NNS (S=G or
C) randomization scheme by overlap extension PCR (Ho, 1989). pSD182
was digested with Xba I and the large fragment was purified by gel
electrophoresis, and religated to yield pSD181. pSD181 was digested
with Xba I and Apa I, and the small fragment was gel purified and
used as a template to produce the 3' mutagenic antibody-cat
fragment. The 5' fragment was amplified from pTX152 with primers
EcoRI.s and H3.as. After gel purification, 5' and 3' fragments were
subjected to overlap extension PCR with primers #4 and PIB.as. PCR
master mix (150 ml 10.times. Pfu buffer, 200 .mu.M dNTPs, 8 ng/uL
each primer, 1 ng/uL 5' and 3' template fragments and Pfu (0.03
u/mL and water to 1.5 ml) was transferred in 100 ml aliquots into
thin-wall eppendorf tubes and amplified as follows: 1 cycle 3 min
(94.degree. C.), 3.5 min (49.degree. C.). 3 min (76.degree. C.), 30
cycles 2 min, 3.5 min, 3.5 min, 1 cycle 7 min (76.degree. C.).
Products were combined, precipitated with ethanol, resuspended in
500 uL TrisHCl (10 mM) pH=8.5, and purified by gel electrophoresis
and electroelution. HC PCR DNA was digested with Pst I,
precipitated, digested with Sal I, gel purified and electroeluted.
pSD195 was digested with Sal I and Pst I Gel purified and
electroeluted. Ligations (12 ug pSD195 Sal I/Pst I, 3.6 ug HC PCR
Sal I/Pst I, 40 .mu.l ligase, 80 .mu.l 10.times., water to 800
.mu.l) were incubated 20 hr at 16.degree. C., heat inactivated 10
min at 70.degree. C., ethanol precipitated, and resuspended in 60
ul Tris-HCl. Four aliquots of 15 ul were individually
electroporated into 300 ul electrocompetant JM109 cells.
Electroporation cuvettes were washed with 3 ml of SOC media, and
incubated for 1 hr at 37.degree. C. in a total volume of 60 ml.
Prewarned LB media (500 ml) supplemented with 0.4% glucose, and 75
mg/ml ampicillin was added and 1:10 and 1:100 dilutions were plated
on LB plates supplemented with Cm (30 .mu.g/ml) and Amp (100
.mu.g/ml). Plating of dilutions revealed the library to contain
4.times.10.sup.6 individual transformants. After 7 hrs of growth
the culture was subcultured 1:50 into 500 ml LB, Amp (100), Cm
(30), 0.2% glucose, and grown for 8 hr. Plasmid DNA was isolated to
provide as a stock for HC library experiments. Flow cytometric
analysis of the same twenty clones showed weak binding for three
clones at 100 nM fluorescein-digoxin, and 17/20 clones displayed
levels of fluorescence consistent with background or
autofluorescence.
[0262] Clones that bind to the hapten digoxin were isolated from
the library in a single step. This procedure is outlined in FIG. 8.
Following incubation of a library aliquot with fluorescein-digoxin,
cells displaying a total fluorescence greater than threshold value,
which the user may gradually decrease to reduce selection
stringency, were sorted and recovered by vacuum filtration onto a
0.2 .mu.m membrane (Millipore, Bedford, Mass.). The membrane was
transferred to an agar plate containing the appropriate antibiotics
and incubated overnight at 37.degree. C. Individual colonies were
then grown in liquid media and assayed for high-affinity antigen
binding by flow cytometry. Light-chain library DNA (3 .mu.L) was
transformed into JM109 by electroporation. Following a 12 hr
subculture at 25.degree. C., 200 ul of the library culture was
diluted into 1 ml of sterile PBS, pelleted in an microcentrifuge at
3000 g for 5 min, and resuspended in 1.5 ml PBS. Library aliquots
were incubated in the dark, with shaking, at 25.degree. C. with
fluorescein-digoxin tracer (10.sup.-7, 10.sup.-8, 10.sup.-9 M) for
1 hr, pelleted and resuspended in PBS at approximately 10.sup.8
cells/ml for flow cytometric analysis or sorting. 20,000 events
were acquired for each concentration (FIG. 9A-FIG. 9F). Highly
fluorescent cells were asceptically sorted in exclusion mode and
filtered onto a 0.2 .mu.m cellulose acetate membrane (Millipore,
Bedford, Mass.). The filter was transferred to an agar plate and
incubated overnight at 37.degree. C. Individual colonies were
picked and grown at 37.degree. C. to saturation, subcultured at
25.degree. C. and grown 18 hr post selection analysis. Cells were
labeled as described above with fluorescent digoxin tracer
(1.times.10.sup.-7 M) and analyzed by flow cytometry. The amino
acid sequences of clones displaying high fluorescence were
determined by DNA sequencing and the affinity was characterized by
flow cytometry. The combined results of two library sorting
experiments are summarized in Table 5. TABLE-US-00005 TABLE 5 ScFv
(dig) VARIANTS ISOLATED FROM A LIGHT-CHAIN LIBRARY BY FACS Relative
Clone LCDR3 Fluorescence WT SQTTHVPPT SEQ ID NO:23 +++ LC1-1
SQATHMPGT SEQ ID NO:24 +++ LC1-2 SQTTHFPVT SEQ ID NO:25 +++ LC1-3
SQATHYPTT SEQ ID NO:26 +++ LC2-3 SQCTHWPVT SEQ ID NO:27 +++ LC2-4
SQTTHVPPT SEQ ID NO:28 ++ LC2-2 SQATHYPST SEQ ID NO:29 +++ LC2-6
SQATHSPST SEQ ID NO:30 +++ PRESORT LC-1 SQVTHGPRT SEQ ID NO:31 +
LC-2 SQGTHRPYT SEQ ID NO:32 + LC-3 SQITHVPKT SEQ ID NO:33 + LC-4
SQLTHLPRT SEQ ID NO:34 LC-5 SQPTHVPPT SEQ ID NO:35 LC-6 SQVTHKPGT
SEQ ID NO:36 - LC-7 SQLTHWPST SEQ ID NO:37 - LC-8* SQLTHGPRT SEQ ID
NO:38 - LC-9* SQLTHGPRT SEQ ID NO:39 + LC-10 SQZTHGPFT SEQ ID NO:40
- *LC-8 and LC-9 are unique at the DNA level +++ = 100 < mean
fluorescence (10.sup.-7 M) ++ = 60 < mean fluorescence < 100
+ = 30 < mean fluorescence < 60 - = < mean fluorescence
< 30
[0263] The heavy-chain library was first screened in a single pass
essentially as described for the light-chain library, to
demonstrate that high affinity scFv(dig) variants could be selected
from large libraries using only a single FACS step. HCDR3 library
DNA (3 ml) was electroporated into JM109 and grown 8 hr to
saturation at 37.degree. C. After a 14 hr subculture at 25.degree.
C., 160 .mu.l cells were harvested into 640 .mu.l of 100, 15, and 0
nM BODIPY-digoxin in PBS. Cells were incubated with gentle shaking
for 45 min. Propidium iodide was added to a final concentration of
5 .mu.g/ml and cell were incubated 15 min. Cells were washed twice
with PBS and resuspended to give a FACSort event rate of 1000
s.sup.-1. Data from 50,000 events was acquired for each
concentration (FIG. 10A). After sterilization of the FACSort with
70% ethanol, a total of 10.sup.7 cells were sorted in recovery mode
and 405 events were collected. Sorted cells were filtered onto a
0.7 .mu.m membrane (Millipore, Bedford, Mass.) and transferred to a
petri dish containing a sterile presoaked petri pad (Millipore,
Bedford, Mass.) and allowed to incubate overnight at 37.degree. C.
192 colonies were picked with a pipette tip and grown in 200 .mu.l
in 96-well plates overnight. Cells were subcultured 1:100 and grown
at 22-24.degree. C. for 20 hr. In a fresh 96-well plates 10 .mu.l
cells was added to 90.mu.l of 18 nM BODIPY-digoxin. Cells were
incubated 1 hr and diluted into 500 ml PBS total for flow
cytometric analysis. A total of 400 selected clones were picked and
grown in 96-well plates for a preliminary flow cytometric analysis.
95/190 exhibited mean fluorescence greater than 100. Six clones did
not grow. Plasmid DNA was purified from 40 clones exhibiting the
highest levels of fluorescence (mean fluorescence intensity
>150). Plasmid DNA was digested with Nco I to prevent
unnecessary analysis of clones possessing the wild-type restriction
site CGGATC. DNA sequencing results are shown in Table 6.
TABLE-US-00006 TABLE 6 HEAVY-CHAIN LIBRARY SCREENING RESULTS Clone
HCDR3 K.sub.d/K.sub.Dwt WT SSGNKWAMDY SEQ ID NO:41 1 HC1.4
SSGNYRALDY SEQ ID NO:42 2.8 HC10.3 SSGNRRAWDY SEQ ID NO:43 1.3
HC10.2 SSGNRRALDY SEQ ID NO:44 1.2 HC8.1 SSGNGRAWDY SEQ ID NO:45
1.1 HC1.3 SSGNISALDY SEQ ID NO:46 >10 HC2.1 SSGNQRKMDY SEQ ID
NO:47 >5
[0264] TABLE-US-00007 TABLE 7 LCDR3 LIBRARY SPECIFICITY SORT
SEQUENCES Clone LCDR3 Relative FL1 WT SQTTHVPPT SEQ ID NO:48 +++
LC2-5 SQVTHRPLT SEQ ID NO:49 + LC2-7 SQVTHDPGT SEQ ID NO:50 + LC3-1
SQVTHCPST SEQ ID NO:51 ++ LC3-7 SQVTHWPPT SEQ ID NO:52 +++ LC3-10
SQVTHYPVT SEQ ID NO:53 + +++ = 100 < mean fluorescence
(10.sup.-7 M) ++ = 60 < mean fluorescence < 100 + = 30 <
mean fluorescence < 60 - = < mean fluorescence < 30
[0265] The heavy-chain library was also screened using a
multiple-step FACS process to enrich high-affinity antibody
expressing cells. A library aliquot was labeled with BODIPY-digoxin
at 70 nM, and sorted at 1200 s.sup.-1. Cells were sorted directly
into supplemented LB media and grown with shaking at 37.degree. C.
for 15 hrs. Cells were subcultured for 14 hrs and relabeled with 5
nM BODIPY-digoxin. Cells were sorted a second time in exclusion
mode and again amplified by growth. The final population was
relabled with 5 nM BODIPY-digoxin and analyzed by flow cytometry.
Fluorescence histograms for pre-enriched, as well as single and
double-enriched populations are shown in FIG. 10B.
[0266] Selection for Altered Specificity
[0267] Selection based upon specificity was accomplished by
preincubating the light chain library with the digoxin analog,
digitoxin, and then subsequently labeling the preincubated cells
with fluorescein-digoxin. An aliquot of the LCDR3 library was
incubated with digitoxin (5.times.10.sup.-6 M) for 30 min at
25.degree. C. with steady gentle inversion. Fluorescein-digoxin was
added to 10.sup.-7 M and cells were incubated an additional hour.
Cells were pelleted by centrifugation and resuspended to give a
FACS event rate of 1000 s.sup.-1. A total of 10.sup.6 cells were
screened and cells displaying high fluorescence were collected by
FACS. Colonies were picked grown for FACS analysis. Plasmid DNA was
prepared from clones displaying a mean fluorescence greater than 50
for DNA sequencing analysis. Sequencing analysis of five clones
displaying high fluorescence showed a total consensus for the amino
acid valine at wild-type position L91 (Table 5). Ten of ten clones
selected in the absence of digitoxin preincubation did not have a
valine residue at that position.
Example 8
Isolation Of Cells Displaying Enzymes From A Vast Excess Of Cells
That Do Not Express An Active Enzyme
[0268] This example demonstrates that the enzymatic activity,
rather than a ligand binding activity, of a surface displayed
polypeptide can be used to isolate cells producing such a surface
enzymatic activity from a vast excess of cells that do not express
enzymatically active polypeptides. The example specifically
demonstrates how E. coli cells that express the protease OmpT on
their surface can be distinguished from cells that do not produce
OmpT or produce inactive OmpT.
[0269] A substrate that becomes fluorescent upon cleavage by OmpT
was designed by conjugating a fluorescent dye (BODIPY) and a
quenching group (trimethylrhodamine) at the opposite ends of the
secile bond. Enzymatic cleavage releases the quenching group into
the medium resulting in the production of a fluorescent product.
The fluorescent product was designed to have several positive
charges to allow its binding to the surface of the cells via
electrostatic interactions with the negatively charged
lipopolysaccharide molecules that comprises the outer layer of the
E. coli surface. The chemical structure of the substrate is shown
in FIG. 10.
[0270] The peptide moiety was synthesized at the University of
Texas, Austin peptide facility using standard FMOC coupling
conditions. The thiol of the cysteine was alkylated with
trimethylrhodamine iodoacetamide and this product was acylated with
BODIPY-FL succinamidyl ester (Molecular Probes). The crude product
was purified by preparative HPLC.
[0271] Different strains of bacteria were exposed to the substrate
for 10 min. and examined by FACS. The OmpT.sup.- negative E. coli
mutant UT5600, shows no fluorescence (FIG. 11A). However, UT5600
cells expressing OmpT from a multicopy plasmid (pML19), showed a
much larger increase in fluorescence, which continued to increase
for over 20 minutes. The mean fluorescence intensity of the
OmpT.sup.+ cells was over 30 times higher than that of the cells
without the plasmid (i.e., OmpT.sup.- cells). Such a difference in
OmpT fluorescence is more than sufficient to allow the sorting of
cells expressing active enzyme from cells that do not express OmpT
(FIG. 11).
[0272] It was demonstrated that inactive OmpT mutants exhibit
increased fluorescence upon incubation with the substrate. For this
purpose, an OmpT mutant was produced in which the conserved His212
residue (which is thought to be part of the catalytic triad) was
converted to Ala by site-directed mutagenesis (Maniatis et al.
1989). The His212->Ala mutant was confirmed to have no OmpT
activity. UT5600 cells expressing the His212->Ala produce the
same amount of OmpT as cells transformed with a plasmid encoding
the wild type enzyme. When UT5600 cells expressing the inactive
OmpT mutant were incubated with the substrate and examined by FACS
they exhibited a background fluorescence that could be clearly
distinguished from that of OmpT positive cells.
[0273] In other studies it was demonstrated that OmpT.sup.+ cells
can be readily isolated from a population containing a huge excess
of OmpT.sup.- cells. Specifically, OmpT.sup.+ cells were mixed with
OmpT.sup.- cells at a 5,000-fold excess. The cell mixture was
incubated with the substrate, passed through the fluorescence
activated cell sorter and cells exhibiting a high fluorescence
intensity were isolated. Nine out of nine sorted clones that were
isolated produce OmpT. These studies showed that the OmpT.sup.+
cells can be readily isolated by FACS from a huge excess of
background cells solely on the basis of the enzymatic activity of
the OmpT protease (FIG. 12).
Example 9
Isolation Of Clones Expressing Desired Enzymes From Combinatorial
Polypeptide Libraries Displayed On The Cell Surface
[0274] This example illustrates how libraries of polypeptides
displayed on the cell surface can be screened to isolate clones
that produce polypeptides having a desired enzymatic activity.
Specifically this example teaches the screening of libraries of
OmpT mutant polypeptides to isolate novel enzymes that can
hydrolyze peptide sequences not recognized by the wild-type OmpT
enzyme.
[0275] The ompT gene will first be subjected to random mutagenesis
using established techniques such as error-prone PCR, chemical
mutagenesis or mutator strains. For error-prone PCR or chemical
mutagenesis the ompT gene is first excised from the high copy
plasmid pML19 by digestion with appropriate restriction
endonucleases and mutagenized according to standard procedures
known to those skilled in the art (Maniatis et al. 1989, Innis et
al. 1990). Following mutagenesis, the ompT DNA will be ligated back
to restriction-enzyme digested pML19 and the ligation mixture will
be electroporated into E. Coli UT5600. Transformants will be grown
in LB broth containing ampicillin (100 .mu.g/ml) and glucose at
0.2% w/v at 37.degree. C. Cultures will be grown to saturation to
ensure maximal expression of OmpT. Subsequently, the cells will be
harvested by centrifugation, washed with PBS and resuspended in 1
mM Tris buffer, pH 7.0, in the presence of a substrate having a
structure similar to the one shown in FIG. 10 except that the
Arg-Arg dipetide that is recognized by the wild type OmpT is
substituted with other dipeptide sequences, for example Arg-His,
Arg-Ala, His-His, etc. Cells expressing OmpT capable of hydrolyzing
the substrate allow the release of the trimethylrhodamine quencher
into the solution while the N-terminal cleavage product containing
the BODIPY fluorophore is electrostatically retained by the cells.
As a result, cells displaying mutant OmpT proteins capable of
hydrolyzing the substrate will become fluorescent and can thus be
isolated by fluorescent activated cell sorting (FACS). For the
isolation of enzymatically active cells by FACS, a gate is set such
that only cells exhibiting high fluorescence are sorted in the
positive window. Cells will be sorted at an event rate of at least
1000 s.sup.-1. A total of 10.sup.6 cells will be screened and cells
displaying high fluorescence will be collected by FACS. Isolated
colonies will be then screened for product hydrolysis by FACS
analysis. Finally, the DNA sequence of the mutant ompT genes
encoding enzymes with altered substrate specificity will be
determined by DNA sequencing.
[0276] All of the composition and methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the compositions and methods and in
the steps or in the sequence of steps of the method described
herein without departing from the concept, spirit and scope of the
invention. More specifically, it will be apparent that certain
agents which are both chemically and physiologically related may be
substituted for the agents described herein while the same or
similar results would be achieved. All such similar substitutes and
modifications apparent to those skilled in the art are deemed to be
within the spirit, scope and concept of the invention as defined by
the appended claims.
J. References
[0277] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by reference.
[0278] Agterberg, et al., "Outer-membrane PhoE protein of
Escherichia coli K-12 as an exposure vector: possibilities and
limitations", Gene 88:37-45, 1990 [0279] Aiyar & Leis,
"Modification of the Megaprimer Method of PCR Mutagenesis: Improved
Amplification of the Final Product," BioTechniques, 14:366-369,
1993 [0280] Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory, 1988 [0281] Baneyx and Georgiou, J. Bacteriol.,
172:491-494, 1990. [0282] Barbas et al., "Assembly of combinatorial
antibody libraries on phage surfaces: The gene III site," Proc.
Natl. Acad. Sci. USA, 88:7978-7982, 1991 [0283] Barbas et al.,
"Semisynthetic combinatorial antibody libraries: A chemical
solution to the diversity problem," Proc. Natl. Acad. Sci. USA,
89:4457-4461, 1992 [0284] Better et al., "Escherichia coli
Secretion of an Active Chimeric Antibody Fragment," Science,
240:1041-1043, 1988 [0285] Blackburn et al.,
"Electrochemiluminescence Detection for Development of Immunoassays
and DNA Probe Assays for Clinical Diagnostics," Clinical Chemistry,
37(9):1534-1539, 1991 [0286] Boder, E. T. and Wittrup, K. D.,
"Surface display of a functional single chain Fv antibody in
Saccharomyces cerevisiae" Submitted 1996 [0287] Brennan, Chemical
and Eng. News, 74:31033, 1996 [0288] Brown, S., "Engineered iron
oxide-adhesion mutants of the Escherichia coli phage .lamda.
receptor", Proc. Natl. Acad. Sci. USA 89:8651-8655, 1992 [0289]
Burks, E. A., Chen, G., Georgiou, G., Iverson, B. L. "In vitro
Scanning Saturation Mutagenesis of an Antibody Binding Pocket,"
Proc. Natl. Acad. Sci. 94:412-7 (1997). [0290] Cadwell and Joyce,
PCR Meth. Appl.:2, 28, 1992 [0291] Campbell, in: Monoclonal
Antibody Technology Laboratory Techniques in Biochemistry and
Molecular Biology, Vol. 13, Burden & Von Knippenberg,
Amsterdam, Elseview, pp. 75-83, 1984 [0292] Charbit, et al.,
"Versatility of a vector for expressing foreign polypeptides at the
surface of Gram-negative bacteria", Gene 70:181-189, 1988 [0293]
Chiswell & Clackson, 1992 [0294] Chiswell & McCafferty,
"Phage antibodies: will new `coliclonal` antibodies replace
monoclonal antibodies?" TIBTECH, 10:80-84, 1992 [0295] Chou &
Fasman, "Conformational Parameters for Amino Acids in Helical,
.beta.-Sheet, and Random Coil Regions Calculated from Proteins,"
Biochemistry, 13(2):211-222, 1974b [0296] Chou & Fasman,
"Empirical Predictions of Protein Conformation," Ann. Rev.
Biochem., 47:251-276, 1978b [0297] Chou & Fasman, "Prediction
of .beta.-Turns," Biophys. J., 26:367-384. 1979 [0298] Chou &
Fasman, "Prediction of protein conformation," Biochemistry,
13(2):222-245, 1974a [0299] Chou & Fasman, "Prediction of the
Secondary Structure of Proteins from Their Amino Acid Sequence,"
Adv. Enzymol. Relat. Areas Mol. Biol., 47:45-148, 1978a [0300]
Clackson et al., "Making antibody fragments using phage display
libraries," Nature, 352:624-628, 1991 [0301] Cornellis, et al.,
"Development of new cloning vectors for the production of
immunogenic outer membrane fusion proteins in Escherichia coli.",
Bio/Technology 14:203-208, 1996 [0302] Fischetti, V. A.,
"Gram-positive commensal bacteria deliver antigens to elicit
mucosal and systemic immunity", ASM News 62:405-410, 1996 [0303]
Francisco et al., "Production and fluorescence-activated cell
sorting of Escherichia coli expressing a functional antibody
fragment on the external surface," Proc. Natl. Acad. Sci. USA,
90:10444-10448, 1993 [0304] Francisco et al., Proc. Natl. Acad.
Sci. USA, 89:2713-2717, 1992 [0305] Francisco, Earhart, Georgiou,
Proc. Nat'l Acad. Sci. USA, 89:2713-2718, 1992 [0306] Francisco, et
al., "Transport and anchoring of .beta.-lactamase to the external
surface of Escherichia coli.", Proc. Natl. Acad. Sci. USA
89:2713-2717, 1992. [0307] Francisco, et al., Bio/Technology,
11:491-496, 1993 [0308] Frohman, In: PCR Protocols: A Guide to
Methods and Applications, Academic Press, N.Y., 1990 [0309] Fuchs,
et al., "Targeting recombinant antibodies to the surface of
Escherichia coli: fusion to a peptido-glycan-associated
lipoprotein", Bio/Technology 9:1369-1372, 1991 [0310] Gefter et
al., Somatic Cell Genet., 3:231-236, 1977 [0311] Georgiou, et al.,
"Display of heterologous Molecules on the Surface of
Microorganisms: From the Screening of Combinatorial Libraries to
Live Bacterial Vaccines," Nature Biotechnol. 15:29-35 1997. [0312]
Georgiou, et al, "Practical applications of engineering
Gram-negative bacterial cell surfaces", Trends Biotechnol. 11:6-10,
1993. [0313] Georgiou, G. et al, "folding and Aggregation of TEM
.beta.-lactamase: Analogies with the Formation of Inclusion Bodies
in Escherichia coli", Protein Science, 3:1953-60, 1994. [0314]
Georgiou, Stephens, Stathopoulos, Poetschle, Mendenhall, Earhart,
Protein Engineer., 9:239-247, 1996. [0315] Goding, in: Monoclonal
Antibodies: Principles and Practice, 2nd Ed., Orlando, Fla.,
Academic Press pp. 60-61, 65-66, 71-74, 1986 [0316] Hansson, et
al., "Expression of recombinant proteins on the surface of the
coagulase-negative bacterium Staphylococcus xylosus ", J.
Bacteriol. 174:4239-4245, 1992 [0317] Harlow & Lane (Eds.),
Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1988 [0318] Helmann and
Chamberlain, "Structure and function of bacterial sigma factors."
Ann. Rev. Biochem. 57: 839-872, 1988. [0319] Ho et al., 1989 [0320]
Hofnung, M., "Expression of foreign polypeptides at the Escherichia
coli cell surface", Methods Cell Biol. 34:77-105, 1991 [0321]
Hollfelder, Kirby, Tawfik, Nature, 383:60-63, 1996 [0322] Huse et
al., "Generation of A Large Combinatorial Library of the
Immunoglobulin Repertoire in Phage Lambda," Science, 246:1275-1281,
1989 [0323] Huston et al., 1989 [0324] Huston et al., Methods in
Enzymology, "Molecular Design and Modeling: Concepts and
Applications," Abelson & Simon, Academic Press, Inc., San
Diego, pp. 46-99, 1991 [0325] Huston, et. al., "Protein engineering
of antibody binding sites: Recovery of specific activity in an
anti-digoxin single-chain Fv analogue produced in Escherichia
coli," Proc. Natl. Acad. Sci. USA, 85:5879-5883, 1988 [0326] Innis
et al., PCR Protocols, Academic Press, Inc., San Diego Calif., 1990
[0327] Iverson et al., "A Combinatorial System for Cloning and
Expressing the Catalytic Antibody Repertoire in Escherichia coli,"
Cold Spring Harbor Symposia on Quantitative Biology, 54:273-281,
1989 [0328] Jameson & Wolf, "The Antigenic Index: A Novel
Algorithm for Predicting Antigenic Determinants," Comput. Appl.
Biosci., 4(1):181-186, 1988 [0329] Janda, et al., J. Am. Chem.
Soc., 110:835-4837, 1988 [0330] Jeffrey, P. D., Strong, R. K.,
Sieker, L. C., Chang, C. Y., Campbell, R. L., Petsko, G. A., Haber,
E., Margolies, M. N. & Sheriff, S. 26-10 Fab-digoxin complex:
affinity and specificity due to surface complementarity. Proc.
Nat'l Acad. of Sci. 90, 10310-4 1993. [0331] Jose, et al., "Common
structural features of IgA1 protease-like outer membrane protein",
Mol. Microbiol. 18:378-380, 1995 [0332] Kabat et al., Sequences of
Proteins of Immunological Interest, U.S. Dept. of Health and Human
Services, U.S. Government Printing Office, 1987 [0333] Kang et al.,
"Linkage of recognition and replication functions by assembling
combinatorial antibody Fab libraries along phage surfaces," Proc.
Natl. Acad. Sci. USA, 88:4363-4366, 1991 [0334] Klauser, et al.,
"Extracellular transport of cholera toxin B subunit using Neisseria
IgA protease .beta.-domain: conformation-dependent outer membrane
translocation", EMBO J. 9:1991-1999, 1990 [0335] Klauser, et al.,
"The secretion pathway of IgA protease-type proteins in
Gram-negative bacteria", Bioessays 15:799-805, 1993 [0336] Kohler
& Milstein, Eur. J Immunol., 6:511-519, 1976 [0337] Kohler
& Milstein, Nature, 256:495-497, 1975 [0338] Kornacker &
Pugsley, Mol. Microbiol, 4:1101-1109, 1990 [0339] Kornacker, et
al., "The normally periplasmic enzyme .beta.-lactamase is
specifically and efficiently translocated through the Escherichia
coli outer membrane when it is fused to the cell-surface enzyme
pullulanase", Mol. Microbiol. 4:1101-1109, 1990 [0340] Kuby, J.
"Immunology", W.H. Freeman and Co., New York (1990) [0341] Kwoh et
al., "Transcription-based amplification system and detection of
amplified human immunodeficiency virus type I with a bead-based
sandwich hybridization format," Proc. Nat. Acad. Sci. USA,
86:1173-1177, 1989 [0342] Laukkanen, et al., "Lipid-tagged
antibodies: bacterial expression and characterization of a
lipoprotein-single-chain antibody fusion protein", Protein Engineer
6:449-454, 1993 [0343] Lerner, Benkovic, Schultz, Science,
252:659-667, 1991 [0344] Liad, MvKenzie, Hageman, Proc. Nat'l Acad.
Sci. USA, 83:576-580, 1986 [0345] Lilley and Higgins, "Local DNA
topology and gene expression: the case of the leu-500 promoter."
Mol. Microbiol. 5, 779-783. [0346] Lu, et al., "Expression of
thioredoxin random peptide libraries on the Escherichia coli cell
surface as functional fusions to flagellin: A system designed for
exploring protein-protein interactions", Bio/Technology 13:366-372,
1995 [0347] Lugtenberg & Van Alphen, "Molecular architecture
and functioning of the outer membrane of Escherichia coli and other
gram-negative bacteria," Biochem. Biophys. Acta, 737:51-115, 1983
[0348] Makrides S C, Microbiol. Rev. Vol. 60(3):512-538, 1996.
[0349] Mangel, Toledo, Brown, Worzalla, Lee, Dunn, Methods Enzymol,
244:384-399, 1994 [0350] Maniatis et al., Molecular Cloning: A
Laboratory Manual, Cold Springs Harbor Laboratories, Cold Springs
Harbor, N.Y., 1982 [0351] Maniatis et al., Molecular Cloning: A
Laboratory Manual, Cold Springs Harbor Laboratories, Cold Springs
Harbor, N.Y., 1989 [0352] Matthews, Adv. Prot. Chem., 46:249-278,
1995. [0353] McCafferty et al., "Phage antibodies: filamentous
phage displaying antibody variable domains," Nature, 348:552-554,
1990 [0354] Moore and Arnold, Nature Biotechnol., 14:458-467, 1996
[0355] Morrison & Desrosiers, "A PCR-Based Strategy for
Extensive Mutagenesis of a Target DNA Sequence," BioTechniques,
14:454-457, 1993 [0356] Mullinax et al., "Identification of a human
antibody fragment clones specific for tetanus toxoid in a
bacteriophage .lamda. immunoexpression library," Proc. Natl. Acad.
Sci. USA, 87:8095-8099, 1990 [0357] Nakamura et al., Enzyme
Immunoassays: Heterogeneous and Homogeneous Systems, Ch. 27, 1987
[0358] Newton, et al., "Expression and immunogenicity of an
18-residue epitope of HIVI gp41 inserted in the flagellar protein
of a Salmonella live vaccine, Res. Microbiol. 146: 203-216 [0359]
Newton, et al., "Topology of the membrane protein LamB by epitope
tagging and a comparison with the X-ray model", J. Bacteriol.
178:3447-3456, 1996 [0360] O'Callaghan, et al., "Immunogenicity of
foreign peptide epitopes expressed in bacterial envelope proteins",
Res. Microbiol. 141:963-969, 1990 [0361] O'Hara, et al., "One-sided
polymerase chain reaction: The amplification of cDNA," Proc. Nat'l
Acad. Sci. USA, 86:5673-5677, 1989 [0362] Orlandi et al., "Cloning
immunoglobulin variable domains for expression by the polymerase
chain reaction," Proc. Nat. Acad. Sci. USA, 86:3833-3837, 1989
[0363] Osuna, Flores, Sobeon, Crit. Rev. Microbiol., 20:107-116,
1994 [0364] Pallesen, et. al., "Chimeric FimH adhesin of type I
fimbriae: a bacterial surface display system for heterologous
sequences", Microbology 141:2839-2848, 1995 [0365] Palzkill et al.,
"Selection of functional signal peptide cleavage sites from a
library of random sequences." J Bacteriol, 176 (3) p563-8, 1994
[0366] Parmley & Smith, "Antibody-selectable filamentous fd
phage vectors: affinity purification of target genes," Gene,
73:305-318, 1988 [0367] Persson et al., "Generation of diverse
high-affinity human monoclonal antibodies by repertoire cloning,"
Proc. Natl. Acad. Sci. USA, 88:2432-2436, 1991 [0368] Petrosino and
Palzkill, J. Bacteriol., 178:1821-1828, 1996 [0369] Pozzi, et al.,
"Delivery and expression of a heterologous antigen on the surface
of streptococci", Infect. Immun. 60:1902-1907, 1992 [0370]
Provence, et al., "Analysis of the extracellular secretion of the
putative hemagglutinin Tsh of an avian pathogenic Escherchia coli
strain: evidence for an autonomous IgA protease-type secretion", In
Preparation, 1997 [0371] Salmong, G. P. C. and Reeves, P. J.,
"Membrane traffic wardens and protein secretion in Gram-negative
bacteria", Trends Biol. Sci. 18:7-12, 1993 [0372] Samuelson, et
al., "Cell surface display of recombinant proteins on
Staphylococcus carnosus", J. Bacteriol. 177:1470-1476, 1995 [0373]
Sastry et al., "Cloning of the immunological repertoire in
Escherichia coli for generation of monoclonal catalytic antibodies:
Construction of a heavy chain variable region-specific cDNA
library," Proc. Natl. Acad. Sci. USA, 86:5728-5732, 1989 [0374]
Schildbach et al., Protein Science, 2:206-214, 1993 [0375]
Schreuder, et al., "Immobilizing proteins on the surface of yeast
cells", Trends Biotechnol. 14:115-120, 1996 [0376] Schreuder, et
al., "Yeast expressing hepatitis B virus surface antigen
determinants on its surface: implications for a possible oral
vaccine", Vaccine 14:383-388, 1996 [0377] Schreuder, et. al.,
"Targeting of a heterologous protein to the cell wall of
Saccharomyces cerevisiae ", Yeast 9:399-409, 1993 [0378] Scott
& Smith, "Searching for Peptide Ligands with an Epitope
Library," Science, 249:386-390, 1990 [0379] Skerra & Pluckthun,
"Assembly of a Functional Immunoglobulin F.sub.v Fragment in
Escherichia coli," Science, 240:1038-1041, 1988 [0380] Smiley and
Benkovic, "Selection of catalytic antibodies for a biosynthetic
reaction from a combinatorial cDNA library by complementation of an
auxotrophic Escherichia coli: antibodies for orotate
decarboxylation." Proc Nat'l Acad Sci., 91 (18) p 8319-23, 1994.
[0381] Smith "Surface presentation of protein epitopes using
bacteriophage expression systems." Curr. Opin. Biotechnol. 2 (5) p
668-73, 1991., 1991 [0382] Smith et al., 1992 [0383] Sousa, et al.,
"Enhanced metalloadsorption of bacterial cells displaying poly-His
peptides", Nature Biotech. 14:1017-1020, 1996 [0384] St. Geme, et
al., "A Haemophilus influenzae IgA protease-like protein promotes
intimate interaction with human epithelial cells", Mol. Microbiol.
14:217-233, 1994 [0385] Stathopoulos et al., Appl. Microbiol.
Biotechnol. 45:112-119, 1996 [0386] Stathopoulos, et al.,
"Characterization of Escherichia coli expressing an
Lpp'OmpA(46-159)-PhoA fusion protein localized in the outer
membrane", Appl. Microbiol. Biotechnol. 45:112-119, 1996 [0387]
Steidler, et al., "Pap pili as a vector system for surface for
surface exposition of an immunoglobulin G-binding domain of protein
A of
Staphylococcus aureus in Escherichia coli. ", J. Bacteriol.
175:7639-7643, 1993 [0388] Stemmer, Nature, 370:389-391, 1994
[0389] Stemmer, Proc. Nat'l Acad. Sci. USA, 91:10747-10751, 1994
[0390] Su, et al., "Construction of stable LamB-Shiga toxin B
subunit hybrids: analysis of expression in Salmonella typhimurium
aroA strains and stimulation of B subunit-specific mucosal and
serum antibody responses", Infect. Immun. 60:3345-3359, 1992 [0391]
Suzuki, et al., "Extracellular transport of VirG protein in
Shigella", J. Biol. Chem. 270:30874-30880, 1995 [0392] Tang, Hicks,
Hilvert, Proc. Nat'l Acad. Sci. USA, 88:8784-8786, 1991 [0393]
Tanke & van der Keur, Trends Biotechnol., 11:55-62, 1992 [0394]
Tawfik, Green, Chap, Sela, Eshhar, Proc. Nat'l Acad. Sci. USA,
90:373-377, 1993 [0395] Taylor, et al., "The TraT lipoprotein as a
vehicle for the transport of foreign antigenic determinants to the
cell surface of Escherichia coli K12: structure-function
relationship in the TraT protein", Mol. Microbiol. 4:1259-1268,
1990 [0396] van Die, et al., "Expression of foreign epitopes in
P-fimbriae of Escherichia coli.", Mol. Gen. Genet. 222:297-303,
1990 [0397] Venkatachalam, Huang, Larocco, Palzkill, J. Biol.
Chem., 269:23444-23450, 1994 [0398] Walker et al., "Isothermal in
vitro amplification of DNA by a restriction enzyme/DNA polymerase
system," Proc. Nat'l Acad. Sci. USA, 89:392-396, 1992 [0399] White,
Chen, Kenyon, Babbitt, J. Biol. Chem., 270:12990-12994, 1995 [0400]
Winter & Milstein, "Man-made antibodies," Nature, 349:293-299,
1991 [0401] Wolf et al., "An Integrated Family of Amino Acid
Sequence Analysis Programs," Comput. Appl. Biosci., 4(1):187-191,
1988 [0402] Wong, et al., "Pseudomonas aeruginosa outer membrane
protein OprF as an expression vector for foreign epitopes: the
effects of positioning and length on the antigenicity of the
epitope", Gene 158:55-60, 1995 [0403] Wu et al., "The Ligation
Amplification Reaction (LAR)--Amplification of Specific DNA
Sequences Using Sequential Rounds of Template-Dependent Ligation,"
Genomics, 4:560-569, 1989 [0404] Yang et al.,
"Electrochemiluminescence: A New Diagnostic and Research Tool,"
Bio/Technology, 12:193-194, 1994 [0405] Yu and Arnold, Protein.
Eng., 9:77-83, 1996.
Sequence CWU 1
1
53 1 780 DNA Artificial Sequence CDS (1)..(780) Description of
Artificial Sequence Synthetic Primer 1 gaa gtt caa ctg caa cag tct
ggt cct gaa ttg gtt aaa cct ggc gcc 48 Glu Val Gln Leu Gln Gln Ser
Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 tct gtg cgc atg tcc
tgc aaa tcc tca ggg tac att ttc acc gac ttc 96 Ser Val Arg Met Ser
Cys Lys Ser Ser Gly Tyr Ile Phe Thr Asp Phe 20 25 30 tac atg aat
tgg gtt cgc cag tct cat ggt aag tct cta gac tac atc 144 Tyr Met Asn
Trp Val Arg Gln Ser His Gly Lys Ser Leu Asp Tyr Ile 35 40 45 ggg
tac att tcc cca tac tct ggg gtt acc ggc tac aac cag aag ttt 192 Gly
Tyr Ile Ser Pro Tyr Ser Gly Val Thr Gly Tyr Asn Gln Lys Phe 50 55
60 aaa ggt aag gcc acc ctt act gtc gac aaa tct tcc tca act gct tac
240 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr
65 70 75 80 atg gag ctg cgt tct ttg acc tct gag gac tcc gcg gta tac
tat tgc 288 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr
Tyr Cys 85 90 95 gcc ggc tcc tct ggt aac aaa tgg gcc atg gat tat
tgg ggt cat ggt 336 Ala Gly Ser Ser Gly Asn Lys Trp Ala Met Asp Tyr
Trp Gly His Gly 100 105 110 gct agc gtt act gtg agc tct ggt ggc ggt
ggc tcg ggc ggt ggt ggg 384 Ala Ser Val Thr Val Ser Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly 115 120 125 tcg ggt ggc ggc gga tca gac ata
gta ctg acc cag tct cca gct tct 432 Ser Gly Gly Gly Gly Ser Asp Ile
Val Leu Thr Gln Ser Pro Ala Ser 130 135 140 ttg gct gtg tct cta gga
caa agg gcc acg ata tcc tgc cga tcc agc 480 Leu Ala Val Ser Leu Gly
Gln Arg Ala Thr Ile Ser Cys Arg Ser Ser 145 150 155 160 caa agt ctc
gta cat tct aat ggt aat act tat ctg aac tgg tac caa 528 Gln Ser Leu
Val His Ser Asn Gly Asn Thr Tyr Leu Asn Trp Tyr Gln 165 170 175 cag
aaa cca gga cag cca ccc aag ctt ctc atc tat aag gta tcc aac 576 Gln
Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn 180 185
190 cga ttc tct gga gtc cct gcc agg ttc agt ggc agt ggg tct gag tca
624 Arg Phe Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Glu Ser
195 200 205 gac ttc acc ctc acc atc gat cct gtg gag gaa gat gat gct
gca ata 672 Asp Phe Thr Leu Thr Ile Asp Pro Val Glu Glu Asp Asp Ala
Ala Ile 210 215 220 tat tac tgt agc caa act acg cat gtt cca ccc acg
ttc ggc tcg ggg 720 Tyr Tyr Cys Ser Gln Thr Thr His Val Pro Pro Thr
Phe Gly Ser Gly 225 230 235 240 acc aag ctg gag ctg aaa cgt gct agc
cag cca gaa ctc gcc ccg gaa 768 Thr Lys Leu Glu Leu Lys Arg Ala Ser
Gln Pro Glu Leu Ala Pro Glu 245 250 255 gac ccc gag gac 780 Asp Pro
Glu Asp 260 2 260 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 2 Glu Val Gln Leu Gln Gln Ser Gly Pro
Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Arg Met Ser Cys Lys
Ser Ser Gly Tyr Ile Phe Thr Asp Phe 20 25 30 Tyr Met Asn Trp Val
Arg Gln Ser His Gly Lys Ser Leu Asp Tyr Ile 35 40 45 Gly Tyr Ile
Ser Pro Tyr Ser Gly Val Thr Gly Tyr Asn Gln Lys Phe 50 55 60 Lys
Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70
75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr
Cys 85 90 95 Ala Gly Ser Ser Gly Asn Lys Trp Ala Met Asp Tyr Trp
Gly His Gly 100 105 110 Ala Ser Val Thr Val Ser Ser Gly Gly Gly Gly
Ser Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly Ser Asp Ile Val
Leu Thr Gln Ser Pro Ala Ser 130 135 140 Leu Ala Val Ser Leu Gly Gln
Arg Ala Thr Ile Ser Cys Arg Ser Ser 145 150 155 160 Gln Ser Leu Val
His Ser Asn Gly Asn Thr Tyr Leu Asn Trp Tyr Gln 165 170 175 Gln Lys
Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn 180 185 190
Arg Phe Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Glu Ser 195
200 205 Asp Phe Thr Leu Thr Ile Asp Pro Val Glu Glu Asp Asp Ala Ala
Ile 210 215 220 Tyr Tyr Cys Ser Gln Thr Thr His Val Pro Pro Thr Phe
Gly Ser Gly 225 230 235 240 Thr Lys Leu Glu Leu Lys Arg Ala Ser Gln
Pro Glu Leu Ala Pro Glu 245 250 255 Asp Pro Glu Asp 260 3 18 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 3 tggaccaaca acatcggt 18 4 26 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 4 cccatatcac
cagctcaccg tctttc 26 5 32 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 5 gaccccgagg actaacgtct
tcgaataaat ac 32 6 25 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 6 ccgaattcgt ttgaacatgc ctaac
25 7 29 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 7 cggaattcgt gcgcaacacg atgaagctc 29 8 31 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 8 agggcatgca agggcaccaa taactgcctt a 31 9 26 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 9
ttggctgcag taatatattg cagcat 26 10 31 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 10 tgcaatatat
tactgcagcc aaactacgca t 31 11 30 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 11 cggcagtttc
tgcagatata ttcgcaagat 30 12 31 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Primer 12 cttgcgaata tatctgcaga
aactgccgga a 31 13 40 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 13 acgccacatc ttgcgaatat
atctgcagaa actgccggaa 40 14 18 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Primer 14 cagggtacat tttcaccg 18
15 46 DNA Artificial Sequence modified_base (13)..(29) n = a, c, g
or t/u Description of Artificial Sequence Synthetic Primer 15
aactgcagcc aannbacgca tnnbccannb acgttcggct cgggga 46 16 63 DNA
Artificial Sequence modified_base (31)..(41) n = a, c, g or t/u
Description of Artificial Sequence Synthetic Primer 16 gtatactatt
gcgccggctc ctctggtaac nnsnnsnnsn nsgattattg gggtcatggt 60 gct 63 17
30 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 17 gttaccagag gagccggcgc aatagtatac 30 18 36 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 18 tacattttca ccgacttcaa tatgaattgg gttcgc 36 19 36 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 19 tacattttca ccgacttctg catgaattgg gttcgc 36 20 36 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 20 tacattttca ccgacttctc tatgaattgg gttcgc 36 21 36 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 21 tacattttca ccgacttcgg gatgaattgg gttcgc 36 22 36 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
Primer 22 tacattttca ccgacttcta aatgaattgg gttcgc 36 23 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 23 Ser Gln Thr Thr His Val Pro Pro Thr 1 5 24 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 24 Ser Gln Ala Thr His Met Pro Gly Thr 1 5 25 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 25 Ser Gln Thr Thr His Phe Pro Val Thr 1 5 26 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 26 Ser Gln Ala Thr His Tyr Pro Thr Thr 1 5 27 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 27 Ser Gln Cys Thr His Trp Pro Val Thr 1 5 28 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 28 Ser Gln Thr Thr His Val Pro Pro Thr 1 5 29 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 29 Ser Gln Ala Thr His Tyr Pro Ser Thr 1 5 30 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 30 Ser Gln Ala Thr His Ser Pro Ser Thr 1 5 31 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 31 Ser Gln Val Thr His Gly Pro Arg Thr 1 5 32 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 32 Ser Gln Gly Thr His Arg Pro Tyr Thr 1 5 33 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 33 Ser Gln Ile Thr His Val Pro Lys Thr 1 5 34 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 34 Ser Gln Leu Thr His Leu Pro Arg Thr 1 5 35 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 35 Ser Gln Pro Thr His Val Pro Pro Thr 1 5 36 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 36 Ser Gln Val Thr His Lys Pro Gly Thr 1 5 37 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 37 Ser Gln Leu Thr His Trp Pro Ser Thr 1 5 38 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 38 Ser Gln Leu Thr His Gly Pro Arg Thr 1 5 39 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 39 Ser Gln Leu Thr His Gly Pro Arg Thr 1 5 40 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 40 Ser Gln Glx Thr His Gly Pro Phe Thr 1 5 41 10 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 41 Ser Ser Gly Asn Lys Trp Ala Met Asp Tyr 1 5 10 42 10 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 42 Ser Ser Gly Asn Tyr Arg Ala Leu Asp Tyr 1 5 10 43 10 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 43 Ser Ser Gly Asn Arg Arg Ala Trp Asp Tyr 1 5 10 44 10 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 44 Ser Ser Gly Asn Arg Arg Ala Leu Asp Tyr 1 5 10 45 10 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 45 Ser Ser Gly Asn Gly Arg Ala Trp Asp Tyr 1 5 10 46 10 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 46 Ser Ser Gly Asn Ile Ser Ala Leu Asp Tyr 1 5 10 47 10 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 47 Ser Ser Gly Asn Gln Arg Lys Met Asp Tyr 1 5 10 48 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 48 Ser Gln Thr Thr His Val Pro Pro Thr 1 5 49 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 49 Ser Gln Val Thr His Arg Pro Leu Thr 1 5 50 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 50 Ser Gln Val Thr His Asp Pro Gly Thr 1 5 51 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 51 Ser Gln Val Thr His Cys Pro Ser Thr 1 5 52 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 52 Ser Gln Val Thr His Trp Pro Pro Thr 1 5 53 9 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 53 Ser Gln Val Thr His Tyr Pro Val Thr 1 5
* * * * *