U.S. patent application number 11/656921 was filed with the patent office on 2007-11-01 for rational evolution of cytokines for higher stability, the cytokines and encoding nucleic acid molecules.
Invention is credited to Lila Drittanti, Rene Gantier, Thierry Guyon, Manuel Vega.
Application Number | 20070254838 11/656921 |
Document ID | / |
Family ID | 31981642 |
Filed Date | 2007-11-01 |
United States Patent
Application |
20070254838 |
Kind Code |
A1 |
Gantier; Rene ; et
al. |
November 1, 2007 |
Rational evolution of cytokines for higher stability, the cytokines
and encoding nucleic acid molecules
Abstract
Compositions of modified cytokines and uses thereof generated
using processes and systems for the high throughput directed
evolution of peptides and proteins, particularly cytokines that act
in complex biological settings, are provided. Also provided are
modified cytokines formulated for oral delivery and uses thereof to
treat diseases and conditions mediated by cytokines.
Inventors: |
Gantier; Rene; (Elancourt,
FR) ; Vega; Manuel; (Vigneux-sur-Seine, FR) ;
Drittanti; Lila; (Vigneux-sur-Seine, FR) ; Guyon;
Thierry; (Palaiseau, FR) |
Correspondence
Address: |
FISH & RICHARDSON, PC
P.O. BOX 1022
MINNEAPOLIS
MN
55440-1022
US
|
Family ID: |
31981642 |
Appl. No.: |
11/656921 |
Filed: |
January 22, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10658834 |
Sep 8, 2003 |
|
|
|
11656921 |
Jan 22, 2007 |
|
|
|
60457135 |
Mar 21, 2003 |
|
|
|
60409898 |
Sep 9, 2002 |
|
|
|
Current U.S.
Class: |
536/23.51 ;
435/243; 435/320.1; 435/325; 435/69.4; 514/15.4; 514/19.3; 514/7.7;
530/351 |
Current CPC
Class: |
A61P 1/16 20180101; C07K
14/575 20130101; A61P 3/10 20180101; A61P 31/00 20180101; A61P
35/00 20180101; A61P 7/00 20180101; C07K 14/555 20130101; A61P
11/00 20180101; C07K 14/475 20130101; C07K 14/54 20130101; A61P
3/00 20180101; C07K 14/53 20130101; A61P 25/16 20180101; A61P 9/00
20180101; C07K 14/61 20130101; A61P 37/00 20180101; C07K 14/505
20130101; C07K 14/52 20130101; A61P 25/28 20180101; C07K 14/535
20130101; A61K 38/00 20130101; A61P 37/08 20180101; A61P 19/02
20180101 |
Class at
Publication: |
514/012 ;
435/243; 435/320.1; 435/325; 435/069.4; 530/351; 536/023.51 |
International
Class: |
A61K 38/19 20060101
A61K038/19; A61P 11/00 20060101 A61P011/00; A61P 3/00 20060101
A61P003/00; A61P 7/00 20060101 A61P007/00; C07H 21/00 20060101
C07H021/00; C07K 14/52 20060101 C07K014/52; C12N 1/21 20060101
C12N001/21; C12N 15/19 20060101 C12N015/19; C12N 15/63 20060101
C12N015/63; C12N 5/16 20060101 C12N005/16 |
Claims
1. A modified erythropoietin cytokine, comprising one or more amino
acid replacements in its sequence of amino acid residues, wherein:
the modified erythropoietin cytokine exhibits increased resistance
to proteolysis compared to the unmodified erythropoietin cytokine
that does not comprise the one or more amino acid replacements; the
one or more amino acid replacements and positions thereof are
selected from among replacement of: D by Q at position 43; K by Q
at position 45; K by N at position 45; F by V at position 48; Y by
H at position 49; Y by I at position 49; K by N at position 52; R
by H at position 53; R by Q at position 53; E by Q at position 55;
E by N at position 55; E by H at position 55; E by Q at position
72; E by N at position 72; E by H at position 72; L by V at
position 75; L by I at position 75; R by H at position 76; P by S
at position 121; P by A at position 121; P by S at position 122; P
by A at position 122; D by Q at position 123; D by N at position
123; P by S at position 129; P by A at position 129; L by V at
position 130; L by I at position 130; R by H at position 131; R by
Q at position 131; R by H at position 162; R by Q at position 162;
D by Q at position 165; and D by N at position 165; and the one or
more amino acid replacements occur in a mature erythropoietin
cytokine having the sequence set forth in SEQ ID NO: 201 or in a
sequence-related erythropoietin cytokine at corresponding amino
acid position(s) relative to SEQ ID NO: 201.
2. The modified erythropoietin cytokine of claim 1, wherein the
unmodified erythropoietin cytokine contains the amino acids
residues having the sequence set forth in SEQ ID NO: 201.
3. The erythropoietin cytokine of claim 1 that comprises 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more
of the amino acid replacements in its sequence of amino acid
residues.
4. The erythropoietin cytokine of claim 1 that comprises 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more
amino acid replacements in its sequence of amino acid residues.
5. The erythropoietin cytokine of claim 1, further comprising one
or more additional amino acid replacements in its sequence of amino
acids, wherein: the one or more amino acid replacements and
positions thereof are selected from among replacement of: D by Q at
position 43; D by N at position 43; K by Q at position 45; K by N
at position 45; F by I at position 48; F by V at position 48; Y by
H at position 49; Y by I at position 49; K by Q at position 52; K
by N at position 52; R by H at position 53; R by Q at position 53;
E by Q at position 55; E by N at position 55; E by H at position
55; E by Q at position 72; E by N at position 72; E by H at
position 72; L by V at position 75; L by I at position 75; R by H
at position 76; R by Q at position 76; P by S at position 121; P by
A at position 121; P by S at position 122; P by A at position 122;
D by Q at position 123; D by N at position 123; P by S at position
129; P by A at position 129; L by V at position 130; L by I at
position 130; R by H at position 131; R by Q at position 131; R by
H at position 162; R by Q at position 162; D by Q at position 165;
and D by N at position 165; and the one or more amino acid
replacements occur in a mature erythropoietin cytokine having the
sequence set forth in SEQ ID NO: 201 or in a sequence-related
erythropoietin cytokine at corresponding amino acid position(s)
relative to SEQ ID NO: 201.
6. The erythropoietin cytokine of claim 1, wherein only the primary
amino acid sequence is modified, and the erythropoietin cytokine
exhibits increased resistance to proteolysis.
7. An erythropoietin cytokine of claim 1, wherein the cytokine
comprises the sequence of amino acids set forth in any of SEQ ID
NOS: 940, 942, 943, 945, 946, 947, 949, 950, 951, 952, 953, 954,
955, 956, 957, 958, 959, 960, 962, 963, 964, 965, 966, 967, 968,
969, 970, 971, 972, 973, 974, 975, 976, and 977.
8. The erythropoietin cytokine of claim 1 that exhibits increased
stability compared to the unmodified erythropoietin cytokine.
9. The erythropoietin cytokine of claim 8, wherein the
erythropoietin cytokine exhibits increased stability to proteases,
human blood lysate or human serum.
10. The erythropoietin cytokine of claim 1 that exhibits increased
protein half-life in vitro or in vivo compared to the unmodified
erythropoietin cytokine.
11. The erythropoietin cytokine of claim 1 that exhibits increased
resistance to proteolysis by a protease of the gastrointestinal
tract.
12. The erythropoietin cytokine of claim 1 that exhibits increased
resistance to proteolysis by a protease in the serum.
13. The erythropoietin cytokine of claim 1, wherein increased
resistance to proteolysis is due to replacement of one or more
amino acids at target positions in an unmodified erythropoietin
cytokine that increase resistance of the erythropoietin cytokine to
digestion by a protease.
14. The erythropoietin cytokine of claim 1 that exhibits increased
biological activity compared to the unmodified erythropoietin
cytokine.
15. The erythropoietin cytokine of claim 1 that exhibits decreased
biological activity compared to the unmodified erythropoietin
cytokine.
16. A nucleic acid molecule encoding an erythropoietin cytokine of
claim 1.
17. A vector, comprising a nucleic acid molecule of claim 16.
18. A eukaryotic cell, comprising the nucleic acid molecule of
claim 16.
19. A eukaryotic cell, comprising the vector of claim 17.
20. A collection of nucleic acid molecules, comprising a plurality
of the molecules of claim 16.
21. A collection of nucleic acid molecules, comprising a plurality
of the vectors of claim 17.
22. A method for expression of an erythropoietin cytokine,
comprising: introducing a nucleic acid of claim 16 into a host
cell; and culturing the cell under conditions, whereby the encoded
erythropoietin cytokine is expressed.
23. The method of claim 22, further comprising isolating the
erythropoietin cytokine.
24. The method of claim 22, wherein the host cell is a eukaryotic
cell or a bacterial cell.
25. A pharmaceutical composition, comprising an erythropoietin
cytokine of claim 1.
26. The pharmaceutical composition of claim 25, further comprising
a pharmaceutically acceptable carrier or excipient.
27. The pharmaceutical composition of claim 26, wherein the
pharmaceutically acceptable carrier or excipient is selected from
among a binding agent, a filler, a lubricant, a disintegrant, and a
wetting agent.
28. The pharmaceutical composition of claim 25, further comprising
a pharmaceutically acceptable additive.
29. The pharmaceutical composition of claim 28, wherein the
pharmaceutically acceptable additive is selected from among a
suspending agent, an emulsifying agent, a non-aqueous vehicle, and
a preservative.
30. The pharmaceutical composition of claim 25, wherein the
composition is in the form of a liquid, a solution, a suspension,
an aerosol, a tablet, a lozenge or a capsule.
31. The pharmaceutical composition of claim 25, formulated for
oral, parenteral, intravenous, intradermal, subcutaneous, buccal,
inhalation, intramuscular, rectal or topical administration.
32. The pharmaceutical composition of claim 31, formulated for oral
administration.
33. The pharmaceutical composition of claim 32, wherein the
pharmaceutical composition is formulated for oral administration to
the mouth or gastrointestinal tract.
34. The pharmaceutical composition of claim 25, wherein the
pharmaceutical composition is formulated for controlled-release of
the erythropoietin cytokine.
35. A pharmaceutical composition formulated for oral
administration, comprising an erythropoietin cytokine that contains
one or more amino acid modification(s), whereby the erythropoietin
cytokine exhibits increased protease resistance compared to an
erythropoietin cytokine that does not contain the
modification(s).
36. The pharmaceutical composition of claim 35, wherein the
modified erythropoietin cytokine has been modified by an insertion,
a deletion and/or a replacement of one or more amino acid residues,
whereby the cytokine is rendered resistant to proteolysis.
37. The pharmaceutical composition of claim 35, wherein: the
modified erythropoietin cytokine comprises one or more amino acid
replacements at one or more amino acid target positions in the
unmodified cytokine.
38. The pharmaceutical composition of claim 37, wherein: the
modified erythropoietin cytokine comprises one or more amino acid
replacements selected from among replacement of: D by Q at position
43; D by N at position 43; K by Q at position 45; K by N at
position 45; F by I at position 48; F by V at position 48; Y by H
at position 49; Y by I at position 49; K by Q at position 52; K by
N at position 52; R by H at position 53; R by Q at position 53; E
by Q at position 55; E by N at position 55; E by H at position 55;
E by Q at position 72; E by N at position 72; E by H at position
72; L by V at position 75; L by I at position 75; R by H at
position 76; R by Q at position 76; P by S at position 121; P by A
at position 121; P by S at position 122; P by A at position 122; D
by Q at position 123; D by N at position 123; P by S at position
129; P by A at position 129; L by V at position 130; L by I at
position 130; R by H at position 131; R by Q at position 131; R by
H at position 162; R by Q at position 162; D by Q at position 165;
and D by N at position 165; and the one or more amino acid
replacements occur in a mature erythropoietin cytokine having the
sequence set forth in SEQ ID NO: 201 or in a sequence-related
erythropoietin cytokine at corresponding amino acid position(s)
relative to SEQ ID NO: 201.
39. The pharmaceutical composition of claim 35, further comprising
a pharmaceutically acceptable carrier or excipient.
40. The pharmaceutical composition of claim 39, wherein the
pharmaceutically acceptable carrier or excipient is selected from
among a binding agent, a filler, a lubricant, a disintegrant, and a
wetting agent.
41. The pharmaceutical composition of claim 35, further comprising
a pharmaceutically acceptable additive.
42. The pharmaceutical composition of claim 41, wherein the
pharmaceutically acceptable additive is selected from among a
suspending agent, an emulsifying agent, a non-aqueous vehicle and a
preservative.
43. The pharmaceutical composition of claim 35, wherein the
composition is in the form of a liquid, a solution, a suspension,
an aerosol, a tablet, a lozenge or a capsule.
44. The pharmaceutical composition of claim 35, wherein the
pharmaceutical composition is formulated for controlled-release of
the erythropoietin cytokine.
45. The pharmaceutical composition of claim 35, wherein the
erythropoietin cytokine has been modified by removing proteolytic
digestion sites in the erythropoietin cytokine.
46. The pharmaceutical composition of claim 35, wherein the
erythropoietin cytokine has an increased half-life compared to the
unmodified erythropoietin cytokine.
47. The pharmaceutical composition of claim 35, wherein the
erythropoietin cytokine exhibits increased resistance to
proteolysis by a protease of the gastrointestinal tract.
48. The pharmaceutical composition of claim 35, wherein the
erythropoietin cytokine exhibits increased biological activity
compared to the unmodified erythropoietin cytokine.
49. The pharmaceutical composition of claim 35, wherein the
erythropoietin cytokine exhibits decreased biological activity
compared to the unmodified erythropoietin cytokine.
50. A pharmaceutical composition, comprising a nucleic acid
molecule of claim 16.
51. A method, comprising treating a subject by administering the
pharmaceutical composition of claim 25, wherein the subject has a
disease or condition that is treated by administration of an
erythropoietin cytokine.
52. The method of claim 51, wherein in the disease or condition is
selected from among hypoxia, myocardial ischemia, or anemia
associated with renal failure, or cancer.
53. A method, comprising treating a subject by orally administering
the pharmaceutical composition of claim 35, wherein the subject has
a disease or condition that is treated by administration of an
erythropoietin cytokine.
54. The method of claim 53, wherein in the disease or condition is
selected from among hypoxia, myocardial ischemia, or anemia
associated with renal failure, or cancer.
55. A method, comprising treating a subject by administering the
pharmaceutical composition of claim 50, wherein the subject has a
disease or condition that is treated by administration of an
erythropoietin cytokine.
56. The method of claim 55, wherein in the disease or condition is
selected from among hypoxia, myocardial ischemia, or anemia
associated with renal failure, or cancer.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of copending U.S.
application Ser. No. 10/658,834, entitled, "RATIONAL EVOLUTION OF
CYTOKINES FOR HIGHER STABILITY, THE CYTOKINES AND ENCODING NUCLEIC
ACID MOLECULES," filed Sep. 8, 2003, which claims the benefit of
priority under 35 U.S.C. 119(e) to U.S. provisional application
Ser. No. 60/457,135, entitled "RATIONAL EVOLUTION OF CYTOKINES FOR
HIGHER STABILITY, ENCODING NUCLEIC ACID MOLECULES AND RELATED
APPLICATIONS," filed Mar. 21, 2003, and U.S. provisional
application Ser. No. 60/409,898, entitled "RATIONAL EVOLUTION OF
CYTOKINES FOR HIGHER STABILITY, ENCODING NUCLEIC ACID MOLECULES AND
RELATED APPLICATIONS," filed Sep. 9, 2002, each to Rene Gantier,
Thierry Guyon, Manuel Vega and Lila Drittanti.
[0002] This application is related to U.S. application Ser.
No.11/176,830, filed Jul. 6, 2005, which is a continuation of U.S.
application Ser. No. 10/658,834, filed Sep. 8, 2003. This
application is also related to PCT Application No. PCT/IB03/004347,
entitled, "RATIONAL EVOLUTION OF CYTOKINES FOR HIGHER STABILITY,
THE CYTOKINES AND ENCODING NUCLEIC ACID MOLECULES," to Rene
Gantier, Thierry Guyon, Manuel Vega and Lila Drittanti. This
application also is related to U.S. application Ser. No.
10/658,355, filed Sep. 08, 2003, entitled "RATIONAL DIRECTED
PROTEIN EVOLUTION USING TWO-DIMENSIONAL RATIONAL MUTAGENESIS
SCANNING," and to U.S. provisional application Ser. No. 60/457,063,
entitled "RATIONAL DIRECTED PROTEIN EVOLUTION USING TWO-DIMENSIONAL
RATIONAL MUTAGENESIS SCANNING," filed Mar. 21, 2003, and to U.S.
provisional application Ser. No. 60/410,258, entitled "RATIONAL
DIRECTED PROTEIN EVOLUTION USING TWO-DIMENSIONAL RATIONAL
MUTAGENESIS SCANNING," filed Sep. 9, 2002, each to Rene Gantier,
Thierry Guyon, Hugo Cruz Ramos, Manuel Vega and Lila Drittanti.
This application also is related to co-pending U.S. application
Ser. No. 10/022,249, filed Dec. 17, 2001, entitled "HIGH THROUGHPUT
DIRECTED EVOLUTION BY RATIONAL MUTAGENESIS," to Manuel Vega and
Lila Drittanti.
[0003] The subject matter of each of the above-noted applications,
international applications and provisional applications is
incorporated by reference in its entirety.
INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED ON COMPACT
DISCS
[0004] An electronic version on compact disc (CD-R) of the Sequence
Listing is filed herewith in duplicate (labeled Copy #1 and Copy
#2), the contents of which are incorporated by reference in their
entirety. The computer-readable file on each of the aforementioned
compact discs, created on Jan. 17, 2007 is identical, 1,843
kilobytes in size, and titled 922ESEQ.001.txt.
FIELD OF INVENTION
[0005] Modified cytokine proteins having selected modified
properties compared to the unmodified or wild type proteins, and
nucleic acid molecules encoding these proteins are provided. The
proteins can be used for treatment and diagnosis.
BACKGROUND
[0006] The delivery of therapeutic proteins for clinical use is a
major challenge to pharmaceutical science. Once in the blood
stream, these proteins are constantly eliminated from circulation
within a short time by different physiological processes, involving
metabolism as well as clearance using normal pathways for protein
elimination, such as (glomerular) filtration in the kidneys or
proteolysis in blood. The latter is often the limiting process
affecting the half-life of proteins used as therapeutic agents in
per-oral administration and either intravenous or intramuscular
injection. The problems associated with these routes of
administration of proteins are well known and various strategies
have been used in attempts to solve them.
[0007] A protein family, which has been the focus of much clinical
work, and efforts to improve its administration and
bio-assimilation, is the cytokine family, including the interferon
family. Interferon molecules are grouped in the heterogeneous
family of cytokines, originally identified on the basis of their
ability to induce cellular resistance to viral infections (Diaz et
al., J. Interferon Cytokine Res., 16:179-180, 1996). Type I
interferons, referred to as interferons .alpha./.beta., include
many members of the interferon .alpha. family (interferon .alpha.1,
.alpha.2, .omega. and .tau.) as well as interferon .beta.. The type
II interferon .gamma. is different from type I in its particular
mechanisms that regulate its production. Whereas the production of
interferons .alpha./.beta. is most efficiently induced in many
types of cells upon viral infection, interferon-.gamma. is produced
mainly in cells of hemopoietic system, such as T-cells or natural
killer cells, upon stimulation by antigens or cytokines,
respectively. These two interferon systems are functionally
non-redundant in the antiviral defense host.
[0008] Interferon a, hereinafter "interferon alpha-2b," or
"interferon .alpha.-2b" or "IFN.alpha.-2b," used interchangeably,
has a broad spectrum of biological effects, including antiviral
effects. Antiviral effects include antiproliferative and
immuno-modulatory actions (Stark et al., Annu. Rev. Biochem., 67:
227-264, 1998). As well as eliciting strong antiviral activities in
target cells, interferons .alpha./.beta. also activate effector
cells of the innate immune system such as natural killer cells and
macrophages (Pestka et al., Annu. Rev. Biochem., 56: 727-777, 1987:
Biron et al., Annu. Rev. Immunol., 17:189-220, 1999). As part of
its immuno-modulatory action, interferon type I protects
T-lymphocytes from apoptosis (Scheel-Toeller et al., Eur. J.
Immunol., 29:2603-2612, 1999: Marrack et al., J. Exp. Med.,
189:521-530, 1999) and growth enhancing factors (Robert et al.,
Hematol. Oncol., 4:113-120, 1986: Morikawa et al., J. Immunol.,
139:761-766, 1987). The biological effects of interferons
.alpha./.beta. are initiated upon binding to the IFN type I
receptor, which results in activation of several downstream
effector molecules (Hibbert and Foster, J Interferon Cytokine Res.,
19:309-318, 1999).
[0009] Interferons as well as many cytokines are important
therapeutics. Since naturally occurring variants have not evolved
as therapeutics, they often have undesirable side-effects as well
as the above-noted problems of short-half life, administration and
bioavailability. Hence, there is a need to improve properties of
cytokines, including interferons, for use as therapeutic agents.
Therefore, among the objects herein, it is an object to provide
cytokines that have improved therapeutic properties.
SUMMARY
[0010] Provided herein are methods for directed evolution of
families of proteins and resulting families of modified proteins. A
family, such as the cytokine protein family, is initially
identified. A property or phenotype for modification, such as
resistance to proteolysis for increased stability in blood, is
selected for modification. A representative member or members of
the family, such as members of the interferon a family, such as
IFN.alpha.-2b or IFN.alpha.-2a, or interferon .beta. family, is
(are) selected. It is modified using any directed evolution method
and protein(s) with a desired phenotype are screened and
identified. In addition, the 3-dimensional structure of the protein
can be mapped to topologically and spatially identify the loci that
are modified to achieve the phenotypic change. 3-dimensional
structures of other members of the family are generated or obtained
and compared with the modified family member. Loci in the other
family members that correspond on the protein to those modified in
the original protein are identified and modified. The resulting
proteins can be tested to confirm that they exhibit the modified
phenotype.
[0011] Provided herein are methods for generating modified
cytokines based on structural homology (3D scanning). These methods
are based on the spatial and topological structure; they are not
based on their underlying sequences of amino acid residues. The
methods are used for identification of target sites for
mutagenesis, particularly in families of target proteins. The
targets are identified through comparison of patterns of protein
backbone folding between and among structurally related proteins.
The methods are exemplified herein for cytokines. Families of the
modified cytokines also are provided herein.
[0012] Any protein known or otherwise available to those of skill
in the art is suitable for modification, such as optimization or
improvement of a selected property, using the directed evolution
methods provided herein, including cytokines (e.g., IFN.alpha.,
including IFN.alpha.-2b and IFN.alpha.-2a, and IFN.beta.) or any
other proteins that have already been mutated or optimized.
[0013] Provided herein are modified cytokines that exhibit
increased resistance to proteolysis as assessed in vivo or in
vitro. Typically the increase in resistance is a least 5%,
generally 8%, 10% or more. The modified cytokines provided herein
include those designed by 3D scanning using the interferon
.alpha.'s that were modified based upon 2D scanning methods
herein.
[0014] Also provided herein are modified (mutant) cytokine
proteins, such as variants of IFN.beta. and IFN.alpha., including
IFN.alpha.-2b and IFN.alpha.-2a proteins and IFN.beta. proteins,
that have altered, particularly, improved therapeutic properties,
including higher stability compared to the unmodified forms. In
particular, exemplary modified cytokines provided herein have
increased stability, which, for example, improves their use as
therapeutics. Among the modified cytokines provided herein are
those that exhibit increased resistance to proteolysis compared to
the unmodified cytokine. In particular, such resistance is at least
10%, 20%, 30%, 40%, 50%, 70%, 100% or more resistant to proteolysis
compared to the unmodified cytokine. Also provided are cytokines
that have increased anti-proliferative and/or antiviral activity
and/or resistance to proteolysis compared to an unmodified
cytokine.
[0015] Exemplary of the modified cytokines provided herein are
modified interferons that exhibit higher stability compared to
unmodified forms. Such modified interferons can be used for
treating conditions in humans that are responsive to treatment with
interferons, such, but are not limited to, as viral infections,
cancer or tumors, undesired cell proliferation and for
immuno-modulation.
[0016] Exemplary of proteins that can be modified by the 2D and 3D
scanning methods provided herein are cytokines from the
interferons/interleukin-10 family. This family includes, for
example, interleukin-10 (IL-10: SEQ ID NO:200, interferon beta
(IFN.beta.; SEQ ID NO: 196), interferon alpha-2a (IFN.alpha.-2a;
SEQ ID NO: 182), interferon alpha-2b (IFN.alpha.-2b; SEQ ID NO: 1),
and interferon gamma (IFN-.gamma.; SEQ ID NO: 199). The long-chain
cytokine protein family includes, among others, granulocyte colony
stimulating factor (G-CSF; SEQ ID NO: 210), leukemia inhibitory
factor (LIF; SEQ ID NO: 213), growth hormone (hGH; SEQ ID NO: 216),
ciliary neurotrophic factor (CNTF; SEQ ID NO: 212), leptin (SEQ ID
NO: 211), oncostatin M (SEQ ID NO: 214), interleukin-6 (IL-6: SEQ
ID NO: 217) and interleukin-12 (IL-12: SEQ ID NO: 215). The
short-chain cytokine protein family includes, among others,
erythropoietin (EPO; SEQ ID NO: 201), granulocyte-macrophage colony
stimulating factor (GM-CSF; SEQ ID NO: 202), interleukin-2 (IL-2:
SEQ ID NO: 204), interleukin-3 (IL-3: SEQ ID NO: 205),
interleukin-4 (IL-4: SEQ ID NO: 207), interleukin-5 (IL-5: SEQ ID
NO: 208), interleukin-13 (IL-13: SEQ ID NO: 209), Flt3 ligand (SEQ
ID NO: 203) and stem cell factor (SCF; SEQ ID NO: 206). Modified
forms of each that have increased resistance to proteolysis are
provided. They were generated by comparison among the 3D-structures
to identify residues that improve resistance to proteolysis.
[0017] Pharmaceutical compositions containing each modified
cytokine and uses and methods of treatment are provided.
[0018] The modified cytokines have use as therapeutics. Each
cytokine has improved biological and or therapeutic activity,
compared to the know activity of the unmodified cytokine.
Accordingly, uses of the cytokines for treatment of
cytokine-mediated diseases and diseases for which immunotherapy is
employed are provided. Methods of treatment using the modified
cytokines for diseases also are provided. Each cytokine has a known
therapeutic use, and such use is contemplated herein. Cytokines
provided herein have improved properties, such as increased
bioavailability, improved stability, particularly in vivo, and/or
greater efficacy.
BRIEF DESCRIPTION OF THE FIGURES
[0019] FIG. 1(A) displays the sequence of the mature IFN.alpha.-2b
(SEQ ID NO: 1). Residues targeted by a mixture of proteases,
including .alpha.-chymotrypsin (F, L, M, W, and Y), endoproteinase
Arg-C (R), endoproteinase Asp-N (D), endoproteinase Glu-C (E),
endoproteinase Lys-C (K), and trypsin (K, and R), are underlined
and in bold lettering.
[0020] FIG. 1(B) displays the structure of IFN.alpha.-2b obtained
from the NMR structure of IFN.alpha.-2a (PDB code 1ITF) in ribbon
representation. Surface residues exposed to the action of the
proteases considered in FIG. 1A are in space filling
representation.
[0021] FIG. 2 depicts the "Percent Accepted Mutation" (PAM250)
matrix Values given to identical residues are shown in gray
squares. Highest values in the matrix are shown in black squares
and correspond to the highest occurrence of substitution between
two residues.
[0022] FIG. 3 presents the scores obtained from PAM250 analysis for
the amino acid substitutions (replacing amino acids on the vertical
axis; amino acid position on the horizontal axis) aimed at
introducing resistance to proteolysis into the IFN.alpha.-2b at the
protease target sequences. The two best replacing residues for each
target amino acid according to the highest substitution scores are
shown in black rectangles.
[0023] FIGS. 4(A)-4(C) provide graphs of experiments indicating the
levels of protection against in vitro proteolysis for IFN.alpha.-2b
variants produced in mammalian cells. In FIGS. 4(B) and 4(C), the
vertical axis indicates the relative level of non-proteolyzed
protein and the horizontal axis indicates time in hours.
[0024] FIG. 5 displays the characterization of several
IFN.alpha.-2b variants, produced in mammalian cells, treated with
.alpha.-chymotrypsin.
[0025] FIG. 6(A) shows the characterization of the E113H
IFN.alpha.-2b variant when treated with .alpha.-chymotrypsin. The
percent of residual (anti-viral) activity for the variant (black
line and white circles) after treatment with .alpha.-chymotrypsin
was compared to the treated wild-type IFN.alpha.-2b (dashed line
and black squares). For this experiment, the E113H IFN.alpha.-2b
variant was produced in mammalian cells.
[0026] FIG. 6(B) shows the characterization of the E113H
IFN.alpha.-2b variant treated with a mixture of proteases. The
percent of residual (anti-viral) activity for the variant (black
line and white circles) after treatment with protease mixture was
compared to the treated wild-type IFN.alpha.-2b (dashed line and
black squares). For this experiment, the E113H IFN.alpha.-2b
variant was produced in mammalian cells.
[0027] FIG. 6(C) presents the characterization of the E113H
IFN.alpha.-2b variant treated with blood lysate. The percent of
residual (anti-viral) activity for the variant (black line and
white circles) after treatment with blood lysate was compared to
the treated wild-type IFN.alpha.-2b (dashed line and black
squares). For this experiment, the E113H IFN.alpha.-2b variant was
produced in mammalian cells.
[0028] FIG. 6(D) presents the characterization of the E113H
IFN.alpha.-2b variant treated with serum. The percent of residual
(anti-viral) activity for the variant (black line and white
circles) after treatment with serum was compared to the treated
wild-type IFN.alpha.-2b (dashed line and black squares). For this
experiment, the E113H IFN.alpha.-2b variant was produced in
mammalian cells.
[0029] FIGS. 6(E) and 6(F) provide graphs indicating the levels of
protection against in vitro proteolysis for IFN.alpha.-2b variants
produced in bacteria. In FIGS. 6(E) and 6(F), the vertical axis
indicates the relative level of non-proteolyzed protein and the
horizontal axis indicates time in hours. The percent of residual
(anti-viral) activity for the variants (gray circles with
continuous lines) after treatment were compared to the treated
wild-type IFN.alpha.-2b (solid circles with dashed lines).
[0030] FIG. 6(G) provides graphs indicating the in vitro potency
for antiviral activity, for IFN.alpha.-2b variants produced in
bacteria. The vertical axis indicates the level of antiviral
activity and the horizontal axis indicates concentration of the
variants at which each level of activity is achieved. The activity
for the variants (continuous line with gray circles) was compared
to that of the wild-type IFN.alpha.-2b (black triangles with dashed
lines). The potency for each variant was calculated from the graphs
as the concentration at the inflection point of the respective
curves. FIG. 6(T) shows the value of potency obtained for each
variant tested compared to the wild type IFN.alpha..
[0031] FIG. 6(H) provides the in vitro potency for
anti-proliferation activity, for IFN.alpha.-2b variants produced in
bacteria. The activity for the variants was compared to that of the
wild-type IFN.alpha.-2b in serial dilution experiments where the
anti-proliferation activity was measured for a number of dilutions
for each variant. Potency was calculated from the graphs as the
concentration at the inflection point of the respective curves. The
figure shows the value of potency obtained for each variant tested
and in comparison to the wild type IFN.alpha..
[0032] FIGS. 6(I) to 6(N) provide graphs indicating the
pharmacokinetics in mice following subcutaneous injection of
IFN.alpha.-2b variants produced in bacteria. The vertical axis
indicates the level of antiviral activity in blood and the
horizontal axis indicates the time after injection at which the
level of antiviral activity is determined. The pharmacokinetics of
the variants (in gray solid circles with gray continuous lines) was
compared to that of the wild-type IFN.alpha.-2b (in black with
dashed lines) and of a pegylated derivative (Pegasys, Roche) (36
.mu.g/ml open triangles with continuous black lines; and 18
.mu.g/ml open circles with continuous black lines); and vehicle
(gray solid triangles with continuous gray lines. The Area Under
the Curve (AUC) for each variant was calculated from the graphs and
is shown in 6(U).
[0033] FIG. 6(O) provides graphs indicating the levels of
protection against in vitro proteolysis for IFN.beta. variants
produced in mammalian cells. FIG. 6(N), the vertical axis indicates
the relative level of non-proteolyzed protein and the horizontal
axis indicates time in hours. The percent of residual (anti-viral)
activity for the variants after treatment were compared to the
treated wild-type IFN.beta..
[0034] FIGS. 6(P) to 6(S) provide graphs indicating the in vitro
potency for either antiviral activity (6(P) and 6(Q)) or
anti-proliferative activity (6(R) and 6(S), for a number of
IFN.beta. variants produced in mammalian cells. The vertical axis
indicates the level of (antiviral or anti-proliferation) activity
and the horizontal axis indicates the concentration of the variants
at which each level of activity is achieved. The activity for the
variants (6(Q) and (6(S)) was compared to that of the wild-type
IFN.beta. (6(P) and (6(R)). The activity obtained with either no
previous treatment or by treating the variants with proteases prior
to the activity test is shown.
[0035] FIG. 6(T) provides a comparison of antiviral activity
(potency), anti-proliferation activity (potency), number of
mutations present and AUC (from PK) for a number of IFN.alpha.-2b
and in comparison with the wild-type IFN.alpha.-2b.
[0036] FIG. 6(U) provides IFN units injected and protein injected
(.mu.g/ml) for the data in FIG. 6(T).
[0037] FIG. 7(A) depicts a top view ribbon representation of
IFN.alpha.-2b structure obtained from the NMR structure of
IFN.alpha.-2a (PDB code 1ITF). Residues represented in "space
filling" define (1) the "receptor binding region" based on either
our "alanine scanning" analysis or on studies by Piehier et al., J
Biol. Chem., 275:40425-40433, 2000, and Roisman et al., Proc. Natl.
Acad. Sci. USA, 98:13231-13236, 2001 (in light-gray and dark-gray,
respectively), and (2) replacing residues (LEADs) for resistance to
proteolysis (in black).
[0038] FIG. 7(B) depicts a side view ribbon representation of
IFN.alpha.-2b structure (PDB code 1ITF). Residue representation is
as in FIG. 7A.
[0039] FIG. 8(A) schematizes the identification of homologous amino
acid positions between a number of cytokines and the LEAD mutants
of IFN.alpha.-2b using 3-dimensional scanning (also referred to
herein as based on "structure-based homolgy" methods or "structural
homology" methods).
[0040] FIG. 8(B) illustrates a structural overlapping between human
interferon .alpha.-2b obtained from the NMR structure of
IFN.alpha.-2a (PDB code 1ITF) and human interferon .beta. (PDB code
1AU1) using Swiss PDB Viewer.
[0041] FIG. 8(C) illustrates a structural overlapping between human
interferon .alpha.-2b obtained from the NMR structure of
IFN.alpha.-2a (PDB code 1ITF) and erythropoietin (PDB code 1BUY)
using Swiss PDB Viewer.
[0042] FIG. 8(D) illustrates a structural overlapping between human
interferon .alpha.-2b obtained from the NMR structure of
IFN.alpha.-2a (PDB code 1ITF) and granulocyte-colony stimulating
factor (PDB code 1CD9) using Swiss PDB Viewer.
[0043] FIG. 9 illustrates a structural alignment of a number of
cytokines and interferon .alpha.-2b sequences (SEQ ID NO: 1
(IFN-a2b); SEQ ID NO: 196 (IFN-.beta.; SEQ ID NO: 201 (EPO); and
SEQ ID NO: 210 (G-CSF)). Bold underlined residues define the region
on each cytokine sequence that based on structural homology
comparison corresponds to the structurally-related mutations found
on the LEADs for protease resistance of IFN.alpha.-2b.
[0044] FIG. 10(A) shows the antiviral activity of interferon
.alpha.-2b mutants generated by alanine-scanning analysis used for
protein redesign. Plotted symbols for wild type and variants of
interferon .alpha.-2b are indicated in the inset.
[0045] FIG. 10(B) displays cell proliferation after treatment with
interferon .alpha.-2b mutants obtained by alanine-scanning
analysis. Plotted symbols for wild type and variants of interferon
.alpha.-2b are indicated in the inset.
[0046] FIG. 10(C) displays the correlation between the antiviral
activity and cell proliferation activity of interferon .alpha.-2b
mutants obtained by alanine-scanning analysis.
[0047] FIG. 11 Candidate glycosylation sites for interferon
.alpha.-2b stabilization and redesign thereof.
[0048] FIG. 12(A) shows a representative number of the is-HIT
residue positions and type of replacing amino acids selected to
generate modified protein sequences of interferon .beta.
(corresponding to SEQ ID Nos: 233-289, 989-1015, and 1016-1302)
compared to the wild-type sequence (SEQ ID NO: 196), based on
3D-scanning (structural homology method), including PAM250
analysis.
[0049] FIG. 12(B) displays the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of interferon gamma (corresponding to SEQ ID Nos:
290-311) compared to residues 1-100 of the wild-type sequence (SEQ
ID NO: 199), based on structural homology and PAM250 analysis.
[0050] FIG. 12(C) shows the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of interleukin-10 (corresponding to SEQ ID Nos: 312-361)
compared to residues 1-100 of the wild-type sequence (SEQ ID NO:
200), based on structural homology and PAM250 analysis.
[0051] FIG. 12(D) displays the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of ciliary neurotrophic factor (corresponding to SEQ ID
Nos: 684-728) compared to residues 51-188 of the wild-type sequence
(SEQ ID NO: 212), based on structural homology and PAM250
analysis.
[0052] FIG. 12(E) shows the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of granulocyte-colony stimulating factor (corresponding
to SEQ ID Nos: 631-662) compared to residues 51-177 of the
wild-type sequence (SEQ ID NO: 210), based on structural homology
and PAM250 analysis.
[0053] FIG. 12(F) displays the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of human growth hormone (corresponding to SEQ ID Nos:
850-895) compared to residues 51-191 of the wild-type sequence (SEQ
ID NO: 216), based on structural homology and PAM250 analysis.
[0054] FIG. 12(G) shows the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of interleukin-12 (corresponding to SEQ ID Nos: 794-849)
compared to residues 51-197 of the wild-type sequence (SEQ ID NO:
215), based on structural homology and PAM250 analysis.
[0055] FIG. 12(H) displays the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of interleukin-6 (corresponding to SEQ ID Nos: 896-939)
compared to residues 51-183 of the wild-type sequence (SEQ ID NO:
217), based on structural homology and PAM250 analysis.
[0056] FIG. 12(I) shows the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of leptin (corresponding to SEQ ID Nos: 663-683) compared
to the wild-type sequence (SEQ ID NO: 211), based on structural
homology and PAM250 analysis.
[0057] FIG. 12(J) displays the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of leukemia inhibitory factor (corresponding to SEQ ID
Nos: 729-760) compared to residues 51-180 of the wild-type sequence
(SEQ ID NO: 213), based on structural homology and PAM250
analysis.
[0058] FIG. 12(K) shows the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of oncostatin M (corresponding to SEQ ID Nos: 761-793)
compared to residues 51-150 of the wild-type sequence (SEQ ID NO:
214), based on structural homology and PAM250 analysis.
[0059] FIG. 12(L) displays the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of erythropoietin (corresponding to SEQ ID Nos: 940-977)
compared to the wild-type sequence (SEQ ID NO: 201), based on
structural homology and PAM250 analysis.
[0060] FIG. 12(M) shows the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of Flt3 ligand (corresponding to SEQ ID Nos: 401-428)
compared to residues 1-100 of the wild-type sequence (SEQ ID NO:
203), based on structural homology and PAM250 analysis.
[0061] FIG. 12(N) displays the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of granulocyte-macrophage colony-stimulating factor
(corresponding to SEQ ID Nos: 362-400) compared to the wild-type
sequence (SEQ ID NO: 202), based on structural homology and PAM250
analysis.
[0062] FIG. 12(O) shows the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of interleukin-13 (corresponding to SEQ ID Nos: 603-630)
compared to the wild-type sequence (SEQ ID NO: 209), based on
structural homology and PAM250 analysis.
[0063] FIG. 12(P) displays the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of interleukin-2 (corresponding to SEQ ID Nos: 429-476)
compared to the wild-type sequence (SEQ ID NO: 204), based on
structural homology and PAM250 analysis.
[0064] FIG. 12(Q) shows the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of interleukin-3 (corresponding to SEQ ID Nos: 477-498)
compared to the wild-type sequence (SEQ ID NO: 205), based on
structural homology and PAM250 analysis.
[0065] FIG. 12(R) displays the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of interleukin-4 (corresponding to SEQ ID Nos: 543-567)
compared to the wild-type sequence (SEQ ID NO: 207), based on
structural homology and PAM250 analysis.
[0066] FIG. 12(S) shows the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of interleukin-5 (corresponding to SEQ ID Nos: 568-602)
compared to the wild-type sequence (SEQ ID NO: 208), based on
structural homology and PAM250 analysis.
[0067] FIG. 12(T) displays the is-HIT residue positions and type of
replacing amino acids selected to generate modified protein
sequences of stem cell factor (corresponding to SEQ ID Nos:
499-542) compared to residues 1-141 of the wild-type sequence (SEQ
ID NO: 206), based on structural homology and PAM250 analysis.
[0068] TABLE-US-00001 DETAILED DESCRIPTION A. Definitions B.
Directed Evolution 1. Pure Random Mutagenesis 2. Restricted Random
Mutagenesis 3. Non-Restricted Rational Mutagenesis C. 2-Dimensional
Rational Scanning (2D Scanning) 1. Identifying In-silico HITS 2.
Identifying Replacing Amino Acids a. Percent Accepted Mutation
(PAM) i. PAM Analysis ii. PAM250 b. Jones et al. and Gonnet et al.
c. Fitch and Feng et al. d. McLachlan, Grantham and Miyata e. Rao
f. Risler et al. g. Johnson et al. h. Block Substitution Matrix
(BLOSUM) 3. Physical Construction of Mutant Proteins and Biological
Assays D. 2-Dimensional Scanning of Proteins for Increased
Resistance to Proteolysis E. Rational Evolution of IFN.alpha.-2b
For Increased Resistance to Proteolysis 1. Modified IFN.alpha.-2b
Proteins with Single Amino Acid Substitutions (is-HITs) 2. LEAD
identification 3. N-glycosylation Site Addition F. Protein Redesign
G. 3D-scanning and Its Use for Modifying Cytokines 1. Homology 2.
3D-Scanning (Structural Homology) Methods 3. Application of the
3D-Scanning Method to Cytokines a. Structurally Homologous
Interferon Mutants b. Structurally Homologous Cytokine Mutants H.
Rational Evolution of IFN.beta. For Increased Resistance to
Proteolysis and/or Higher Conformational Stability I. Super-LEADs
and Additive Directional Mutagenesis (ADM). 1. Additive Directional
Mutagenesis 2. Multi-Overlapped Primer Extensions J. Uses of the
Mutant IFN.alpha. and IFN.beta. Genes and Cytokines in Therapeutic
Methods 1. Fusion Proteins 2. Nucleic Acid Molecules for Expression
3. Formulation of Optimized Cytokines and Methods of Treatment K.
Examples
A. Definitions
[0069] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as is commonly understood by one
of skill in the art to which the invention(s) belong. All patents,
patent applications, published applications and publications,
Genbank sequences, websites and other published materials referred
to throughout the entire disclosure herein, unless noted otherwise,
are incorporated by reference in their entirety. In the event that
there is a plurality of definitions for terms herein, those in this
section prevail. Where reference is made to a URL or other such
identifier or address, it understood that such identifiers can
change and particular information on the internet can come and go,
but equivalent information can be found by searching the internet.
Reference thereto evidences the availability and public
dissemination of such information.
[0070] As used herein, biological activity of a protein refers to
any activity manifested by the protein in vivo.
[0071] As used herein, "a directed evolution method" refers to
methods that "adapt" either natural proteins, synthetic proteins or
protein domains to work in new or existing natural or artificial
chemical or biological environments and/or to elicit new functions
and/or to increase or decrease a given activity, and/or to modulate
a given feature. Exemplary directed evolution methods include pure
random mutagenesis methods; restricted random mutagenesis methods;
and non-restricted rational mutagenesis methods, such as the
rational directed evolution method described in co-pending U.S.
application Ser. No. 10/022,249: and the 2-dimensional rational
scanning method provided herein.
[0072] As used herein, two dimensional rational mutagenesis
scanning (2D scanning) refers to the processes provided herein in
which two dimensions of a particular protein sequence are scanned:
(1) one dimension is to identify specific amino acid residues along
the protein sequence to replace with different amino acids,
referred to as is-HIT target positions, and (2) the second
dimension is the amino acid type selected for replacing the
particular is-HIT target, referred to as the replacing amino
acid.
[0073] As used herein, in silico refers to research and experiments
performed using a computer. In silico methods include, but are not
limited to, molecular modeling studies, and biomolecular docking
experiments.
[0074] As used herein, "is-HIT" refers to an in silico identified
amino acid position along a target protein sequence that has been
identified based on i) the particular protein properties to be
evolved, ii) the protein's amino acid sequence, and/or iii) the
known properties of the individual amino acids. These is-HIT loci
on the protein sequence are identified without use of experimental
biological methods. For example, once the protein feature(s) to be
optimized is (are) selected, diverse sources of information or
previous knowledge (i.e., protein primary, secondary or tertiary
structures, literature, patents) are exploited to determine those
amino acid positions that may be amenable to improved protein
fitness by replacement with a different amino acid. This step
utilizes protein analysis "in silico." All possible candidate amino
acid positions along a target protein's primary sequence that might
be involved in the feature being evolved are referred to herein as
"in silico HITs" ("is-HITs"). The collection (library), of all
is-HITs identified during this step represents the first dimension
(target residue position) of the two-dimensional scanning methods
provided herein.
[0075] As used herein, "amenable to providing the evolved
predetermined property or activity," in the context of identifying
is-HITs, refers to an amino acid position on a protein that is
contemplated, based on in silico analysis, to possess properties or
features that when replaced would result in the desired activity
being evolved. The phrase "amenable to providing the evolved
predetermined property or activity," in the context of identifying
replacement amino acids, refers to a particular amino acid type
that is contemplated, based on in silico analysis, to possess
properties or features that when used to replace the original amino
acid in the unmodified starting protein would result in the desired
activity being evolved.
[0076] As used herein, high-throughput screening (HTS) refers to
processes that test a large number of samples, such as samples of
test proteins or cells containing nucleic acids encoding the
proteins of interest to identify structures of interest or the
identify test compounds that interact with the variant proteins or
cells containing them. HTS operations are amenable to automation
and are typically computerized to handle sample preparation, assay
procedures and the subsequent processing of large volumes of
data.
[0077] As used herein, the term "restricted," when used in the
context of the identification of is-HIT amino acid positions along
the protein sequence selected for amino acid replacement and/or the
identification of replacing amino acids, means that fewer than all
amino acids on the protein-backbone are selected for amino acid
replacement; and/or fewer than all of the remaining 19 amino acids
available to replace the original amino acid present in the
unmodified starting protein are selected for replacement. In
particular embodiments of the methods provided herein, the is-HIT
amino acid positions are restricted, such that fewer than all amino
acids on the protein-backbone are selected for amino acid
replacement. In other embodiments, the replacing amino acids are
restricted, such that fewer than all of the remaining 19 amino
acids available to replace the native amino acid present in the
unmodified starting protein are selected as replacing amino acids.
In a particular embodiment, both of the scans to identify is-HIT
amino acid positions and the replacing amino acids are restricted,
such that fewer than all amino acids on the protein-backbone are
selected for amino acid replacement and fewer than all of the
remaining 19 amino acids available to replace the native amino acid
are selected for replacement.
[0078] As used herein, "candidate LEADs," are mutant proteins that
are contemplated as potentially having an alteration in any
attribute, chemical, physical or biological property in which such
alteration is sought. In the methods herein, candidate LEADs are
generally generated by systematically replacing is-HITS loci in a
protein or a domain thereof with typically a restricted subset, or
all, of the remaining 19 amino acids, such as obtained using PAM
analysis. Candidate LEADs can be generated by other methods known
to those of skill in the art tested by the high throughput methods
herein.
[0079] As used herein, "LEADs" are "candidate LEADs" whose activity
has been demonstrated to be optimized or improved for the
particular attribute, chemical, physical or biological property.
For purposes herein a "LEAD" typically has activity with respect to
the function of interest that differs by at least 10%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more from the
unmodified and/or wild type (native) protein. In certain
embodiments, the change in activity is at least about 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, of the activity of the
unmodified target protein. In other embodiments, the change in
activity is not more than about 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90% or 100%, of the activity of the unmodified target protein.
In yet other embodiments, the change in activity is at least about
2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9
times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times,
70 times, 80 times, 90 times, 100 times, 200 times, 300 times, 400
times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000
times, or more greater than the activity of the unmodified target
protein. The desired alteration, which can be either an increase or
a reduction in activity, will depend upon the function or property
of interest (e.g., .+-.10%, .+-.20%, etc.). The LEADs may be
further optimized by replacement of a plurality (2 or more) of
"is-HIT" target positions on the same protein molecule to generate
"super-LEADs."
[0080] As used herein, the term "super-LEAD" refers to protein
mutants (variants) obtained by combining the single mutations
present in two or more of the LEAD molecules into a single protein
molecule. Accordingly, in the context of the modified proteins
provided herein, the phrase "proteins comprising one or more single
amino acid replacements" encompasses any combination of two or more
of the mutations described herein for a respective protein. For
example, the modified proteins provided herein having one or more
single amino acid replacements can have can have any combination of
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20
or more of the amino acid replacements at the disclosed replacement
positions. The collection of super-LEAD mutant molecules is
generated, tested and phenotypically characterized one-by-one in
addressable arrays. Super-LEAD mutant molecules are such that each
molecule contains a variable number and type of LEAD mutations.
Those molecules displaying further improved fitness for the
particular feature being evolved, are referred to as super-LEADs.
Super-LEADs can be generated by other methods known to those of
skill in the art and tested by the high throughput methods herein.
For purposes herein a super-LEAD typically has activity with
respect to the function of interest that differs from the improved
activity of a LEAD by a desired amount, such as at least 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more from at
least one of the LEAD mutants from which it is derived. As with
LEADs, the change in the activity for super-LEADs is dependent upon
the activity that is being "evolved." The desired alteration, which
can be either an increase or a reduction in activity, will depend
upon the function or property of interest.
[0081] As used herein, a recitation that modified protein has more
antiviral activity (or other activity) than antiproliferative
activity (or another activity) compared to the unmodified cytokine,
is comparing the absolute value of the change in each activity
compared to wild type.
[0082] As used herein, the phrase "altered loci" refers to the
is-HIT amino acid positions in the LEADs or super-LEADs that are
replaced with different replacing amino acids, resulting in the
desired altered phenotype or activity.
[0083] As used herein, an exposed residue presents more than 15% of
its surface exposed to the solvent.
[0084] As used herein, the phrase "structural homology" refers to
the degree of coincidence in space between two or more protein
backbones. Protein backbones that adopt the same protein structure,
fold and show similarity upon three-dimensional structural
superposition in space can be considered structurally homologous.
Structural homology is not based on sequence homology, but rather
on three-dimension homology. Two amino acids in two different
proteins said to be homologous based on structural homology between
those proteins, do not necessarily need to be in sequence-based
homologous regions. For example, protein backbones that have a root
mean squared (RMS) deviation of less than 3.5, 3.0, 2.5, 2.0, 1.7
or 1.5 angstroms (.ANG.) at a given space position or defined
region between each other can be considered to be structurally
homologous in that region, and are referred to herein as having a
"high coincidence" between their backbones. It is contemplated
herein that substantially equivalent (e.g., "structurally related")
amino acid positions that are located on two or more different
protein sequences that share a certain degree of structural
homology will have comparable functional tasks; also referred to
herein as "structurally homologous loci." These two amino acids
than can be said to be "structurally similar" or "structurally
related" with each other, even if their precise primary linear
positions on the amino acid sequences, when these sequences are
aligned, do not match with each other. Amino acids that are
"structurally related" can be far away from each other in the
primary protein sequences, when these sequences are aligned
following the rules of classical sequence homology.
[0085] As used herein, a structural homolog is a protein that is
generated by structural homology.
[0086] As used herein, the phrase "unmodified target protein,"
"unmodified protein" or "unmodified cytokine," or grammatical
variations thereof, refers to a starting protein that is selected
for modification using the methods provided herein. The starting
unmodified target protein can be the naturally occurring, wild type
form of a protein. In addition, the starting unmodified target
protein may have previously been altered or mutated, such that it
differs from the native wild type isoform, but is nonetheless
referred to herein as a starting unmodified target protein relative
to the subsequently modified proteins produced herein. Thus,
existing proteins known in the art that have previously been
modified to have a desired increase or decrease in a particular
biological activity compared to an unmodified reference protein can
be selected and used herein as the starting "unmodified target
protein." For example, a protein that has been modified from its
native form by one or more single amino acid changes and possesses
either an increase or decrease in a desired activity, such as
resistance to proteolysis, can be utilized with the methods
provided herein as the starting unmodified target protein for
further modification of either the same or a different biological
activity.
[0087] Likewise, existing proteins known in the art that have
previously been modified to have a desired increase or decrease in
a particular biological activity compared to an unmodified
reference protein can be selected and used herein for
identification of structurally homologous loci on other
structurally homologous target proteins. For example, a protein
that has been modified by one or more single amino acid changes and
possesses either an increase or decrease in a desired activity,
such as resistance to proteolysis, can be utilized with the methods
provided herein to identify on structurally homologous target
proteins, corresponding structurally homologous loci that can be
replaced with suitable replacing amino acids and tested for either
an increase or decrease in the desired biological activity.
[0088] As used herein, the phrase "only one amino acid replacement
occurs on each target protein" refers to the modification of a
target protein, such that it differs from the unmodified form of
the target protein by a single amino acid change. For example, in
one embodiment, mutagenesis is performed by the replacement of a
single amino acid residue at only one is-HIT target position on the
protein backbone (e.g., "one-by-one" in addressable arrays), such
that each individual mutant generated is the single product of each
single mutagenesis reaction. The single amino acid replacement
mutagenesis reactions are repeated for each of the replacing amino
acids selected at each of the is-HIT target positions. Thus, a
plurality of mutant protein molecules are produced, whereby each
mutant protein contains a single amino acid replacement at only one
of the is-HIT target positions.
[0089] As used herein, the phrase "pseudo-wild type," in the
context of single or multiple amino acid replacements, are those
amino acids that, while different from the original, such as
native, amino acid at a given amino acid position, can replace the
native one at that position without introducing any measurable
change in a particular protein activity. A population of sets of
nucleic acid molecules encoding a collection of mutant molecules is
generated and phenotypically characterized such that proteins with
amino acid sequences different from the original amino acid, but
that still elicit substantially the same level (i.e., at least 10%,
50%, 70%, 90%, 95%, 100%, depending upon the protein) and type of
desired activity as the original protein are selected.
[0090] As used herein, biological and pharmacological activity
includes any activity of a biological pharmaceutical agent and
includes, but is not limited to, resistance to proteolysis,
biological efficiency, transduction efficiency, gene/transgene
expression, differential gene expression and induction activity,
titer, progeny productivity, toxicity, cytotoxicity,
immunogenicity, cell proliferation and/or differentiation activity,
anti-viral activity, morphogenetic activity, teratogenetic
activity, pathogenetic activity, therapeutic activity, tumor
suppressor activity, ontogenetic activity, oncogenetic activity,
enzymatic activity, pharmacological activity, cell/tissue tropism
and delivery.
[0091] As used herein, a "small region" on a polypeptide is
relative term depending upon the size of the polypeptide, but
typically refers to a region that is less than about 10%, 15%, 25%
of the protein. A large region is greater than about 10%, 15% or
25% of the protein.
[0092] As used herein, "output signal" refers to parameters that
can be followed over time and, if desired, quantified. For example,
when a recombinant protein is introduced into a cell, the cell
containing the recombinant protein undergoes a number of changes.
Any such change that can be monitored and used to assess the
transformation or transfection, is an output signal, and the cell
is referred to as a reporter cell; the encoding nucleic acid is
referred to as a reporter gene, and the construct that includes the
encoding nucleic acid is a reporter construct. Output signals
include, but are not limited to, enzyme activity, fluorescence,
luminescence, amount of product produced and other such signals.
Output signals include expression of a gene or gene product,
including heterologous genes (transgenes) inserted into the plasmid
virus. Output signals are a function of time ("t") and are related
to the amount of protein used in the composition. For higher
concentrations of protein, the output signal can be higher or
lower. For any particular concentration, the output signal
increases as a function of time until a plateau is reached. Output
signals can also measure the interaction between cells, expressing
heterologous genes, and biological agents.
[0093] As used herein, the activity of an IFN.alpha.-2b or
IFN.alpha.-2a protein refers to any biological activity that can be
assessed. In particular, herein, the activity assessed for the
IFN.alpha.-2b or IFN.alpha.-2a proteins is resistance to
proteolysis, antiviral activity and cell proliferation
activity.
[0094] As used herein, the Hill equation is a mathematical model
that relates the concentration of a drug (i.e., test compound or
substance) to the response measured y = y max .function. [ D ] x [
D ] n + [ D 50 ] n ##EQU1## where y is the variable measured, such
as a response, signal, y.sub.max is the maximal response
achievable, [D] is the molar concentration of a drug, [D50] is the
concentration that produces a 50% maximal response to the drug, n
is the slope parameter, which is 1 if the drug binds to a single
site and with no cooperativity between or among sites. A Hill plot
is log.sub.10 of the ratio of ligand-occupied receptor to free
receptor vs. log [D] (M). The slope is n, where a slope of greater
than 1 indicates cooperativity among binding sites, and a slope of
less than 1 can indicate heterogeneity of binding. This general
equation has been employed for assessing interactions in complex
biological systems (see, published International PCT application
No. WO 01/44809 based on PCT No. PCT/FR00/03503, see also, the
EXAMPLES).
[0095] As used herein, in the Hill-based analysis (published
International PCT application No. WO 01/44809 based on PCT No.
PCT/FR00/03503), the parameters, .pi., .kappa., .tau., .epsilon.,
.eta., .theta., are as follows:
[0096] .pi. is the potency of the biological agent acting on the
assay (cell-based) system;
[0097] .eta. is the constant of resistance of the assay system to
elicit a response to a biological agent;
[0098] .epsilon. is the global efficiency of the process or
reaction triggered by the biological agent on the assay system;
[0099] .tau. is the apparent titer of the biological agent;
[0100] .theta. is the absolute titer of the biological agent;
and
[0101] .eta. is the heterogeneity of the biological process or
reaction.
[0102] In particular, as used herein, the parameters .pi. (potency)
or .kappa. (constant of resistance) are used to respectively assess
the potency of a test agent to produce a response in an assay
system and the resistance of the assay system to respond to the
agent.
[0103] As used herein, .epsilon. (efficiency), is the slope at the
inflexion point of the Hill curve (or, in general, of any other
sigmoidal or linear approximation), to assess the efficiency of the
global reaction (the biological agent and the assay system taken
together) to elicit the biological or pharmacological response.
[0104] As used herein, .tau. (apparent titer) is used to measure
the limiting dilution or the apparent titer of the biological
agent.
[0105] As used herein, .theta. (absolute titer), is used to measure
the absolute limiting dilution or titer of the biological
agent.
[0106] As used herein, .eta. (heterogeneity) measures the existence
of discontinuous phases along the global reaction, which is
reflected by an abrupt change in the value of the Hill coefficient
or in the constant of resistance.
[0107] As used herein, a population of sets of nucleic acid
molecules encoding a collection (library) of mutants refers to a
collection of plasmids or other vehicles that carry (encode) the
gene variants, such that individual plasmids or other individual
vehicles carry individual gene variants. Each element (member) of
the collection is physically separated from the others, such as
individually in an appropriate addressable array, and has been
generated as the single product of an independent mutagenesis
reaction. When a collection (library) of such proteins is
contemplated, it will be so-stated.
[0108] As used herein, a "reporter cell" is the cell that
"reports," i.e., undergoes the change, in response to a condition,
such as, for example, exposure to a protein or a virus or to a
change it its external or internal environment.
[0109] As used herein, "reporter" or "reporter moiety" refers to
any moiety that allows for the detection of a molecule of interest,
such as a protein expressed by a cell. Reporter moieties include,
but are not limited to, for example, fluorescent proteins, such as
red, blue and green fluorescent proteins; LacZ and other detectable
proteins and gene products. For expression in cells, nucleic acid
encoding the reporter moiety can be expressed as a fusion protein
with a protein of interest or under to the control of a promoter of
interest.
[0110] As used herein, phenotype refers to the physical,
physiological or other manifestation of a genotype (a sequence of a
gene). In methods herein, phenotypes that result from alteration of
a genotype are assessed.
[0111] As used herein, "activity" means in the largest sense of the
term any change in a system (either biological, chemical or
physical system) of any nature (changes in the amount of product in
an enzymatic reaction, changes in cell proliferation, in
immunogenicity, in toxicity) caused by a protein or protein mutant
when they interact with that system. In addition, the term
"activity," "higher activity" or "lower activity" as used herein in
reference to resistance to proteases, proteolysis, incubation with
serum or with blood, means the ratio or residual biological
(antiviral) activity between "after" protease/blood or serum
treatment and "before" protease/blood or serum treatment.
[0112] As used herein, activity refers to the function or property
to be evolved. An active site refers to a site(s) responsible or
that participates in conferring the activity or function. The
activity or active site evolved (the function or property and the
site conferring or participating in conferring the activity) can
have nothing to do with natural activities of a protein. For
example, it could be an "active site" for conferring immunogenicity
(immunogenic sites or epitopes) on a protein.
[0113] As used herein, treatment means any manner in which the
symptoms of a condition, disorder or disease are ameliorated or
otherwise beneficially altered. Treatment also encompasses any
pharmaceutical use of the modified cytokines and compositions
provided herein.
[0114] As used herein, cytokine-mediated or cytokine-involved
diseases refer to diseases in which cytokines potentiate, cause or
are involved in the disease process or to diseases in which
administration of a cytokine is ameliorative of a disease or
symptoms thereof. Cytokines can be used in immunotherapeutic
therapies or protocols.
[0115] As used herein, the amino acids, which occur in the various
amino acid sequences appearing herein, are identified according to
their known, three-letter or one-letter abbreviations (see, Table
1). The nucleotides, which occur in the various nucleic acid
fragments, are designated with the standard single-letter
designations used routinely in the art.
[0116] As used herein, amino acid residue refers to an amino acid
formed upon chemical digestion (hydrolysis) of a polypeptide at its
peptide linkages. The amino acid residues described herein are
presumed to be in the "L" isomeric form. Residues in the "D"
isomeric form, which are so-designated, can be substituted for any
L-amino acid residue, as long as the desired functional property is
retained by the polypeptide. NH.sub.2 refers to the free amino
group present at the amino terminus of a polypeptide. COOH refers
to the free carboxy group present at the carboxyl terminus of a
polypeptide. In keeping with standard polypeptide nomenclature
described in J Biol. Chem., 243:3552-3559, 1969, and adopted at 37
C.F.R. .sctn..sctn. 1.821-1.822, abbreviations for amino acid
residues are shown in Table 1: TABLE-US-00002 TABLE 1 Table of
Correspondence SYMBOL 1-Letter 3-Letter AMINO ACID Y Tyr tyrosine G
Gly glycine F Phe phenylalanine M Met methionine A Ala alanine S
Ser serine I Ile isoleucine L Leu leucine T Thr threonine V Val
valine P Pro proline K Lys lysine H His histidine Q Gln glutamine E
Glu glutamic acid Z Glx Glu and/or Gln W Trp tryptophan R Arg
arginine D Asp aspartic acid N Asn asparagine B Asx Asn and/or Asp
C Cys cysteine X Xaa Unknown or other
[0117] It should be noted that all amino acid residue sequences
represented herein by formulae have a left to right orientation in
the conventional direction of amino-terminus to carboxyl-terminus.
In addition, the phrase "amino acid residue" is broadly defined to
include the amino acids listed in the Table of Correspondence
(Table I) and modified and unusual amino acids, such as those
referred to in 37 C.F.R. .sctn..sctn. 1.821-1.822, and incorporated
herein by reference. Furthermore, it should be noted that a dash at
the beginning or end of an amino acid residue sequence indicates a
peptide bond to a further sequence of one or more amino acid
residues or to an amino-terminal group such as NH2 or to a
carboxyl-terminal group such as COOH.
[0118] As used herein, nucleic acids include DNA, RNA and analogs
thereof, including protein nucleic acids (PNA) and mixtures
thereof. Nucleic acids can be single or double stranded. When
referring to probes or primers, optionally labeled, with a
detectable label, such as a fluorescent or radiolabel,
single-stranded molecules are contemplated. Such molecules are
typically of a length such that they are statistically unique of
low copy number (typically less than 5, generally less than 3) for
probing or priming a library. Generally a probe or primer contains
at least 14, 16 or 30 contiguous of sequence complementary to or
identical a gene of interest. Probes and primers can be 10, 14, 16,
20, 30, 50, 100 or more nucleic acid bases long.
[0119] Therefore, as used herein, the term "identity" represents a
comparison between a test and a reference polypeptide or
polynucleotide. For example, a test polypeptide can be defined as
any polypeptide that is 90% or more identical to a reference
polypeptide.
[0120] As used herein, "corresponding structurally-related"
positions on two or more proteins, such as the IFN.alpha.-2b
protein and other cytokines, refers those amino acid positions
determined based upon structural homology to maximize
tri-dimensional overlapping between proteins.
[0121] As used herein, the term at least "90% identical to" refers
to percent identities from 90 to 100% relative to the reference
polypeptides. Identity at a level of 90% or more is indicative of
the fact that, assuming for exemplification purposes a test and
reference polypeptide length of 100 amino acids are compared. No
more than 10% (i.e., 10 out of 100) amino acids in the test
polypeptide differ from that of the reference polypeptides. Similar
comparisons can be made between a test and reference
polynucleotides. Such differences can be represented as point
mutations randomly distributed over the entire length of an amino
acid sequence or they can be clustered in one or more locations of
varying length up to the maximum allowable, e.g., 10/100 amino acid
difference (approximately 90% identity). Differences are defined as
nucleic acid or amino acid substitutions, or deletions.
[0122] As used herein, the phrase "sequence-related proteins"
refers to proteins that have at least 50%, at least 60%, at least
70%, at least 80%, at least 90%, at least 95% amino acid identity
or homology with each other.
[0123] As used herein, families of non-related proteins or
"sequence-non-related proteins" refers to proteins that have less
than 50%, less than 40%, less than 0%, less than 20% amino acid
identity or homology with each other.
[0124] As used herein, it also is understood that the terms
"substantially identical" or "similar" varies with the context as
understood by those skilled in the relevant art.
[0125] As used herein, heterologous or foreign nucleic acid, such
as DNA and RNA, are used interchangeably and refer to DNA or RNA
that does not occur naturally as part of the genome in which it is
present or which is found in a location or locations in the genome
that differ from that in which it occurs in nature. Heterologous
nucleic acid is generally not endogenous to the cell into which it
is introduced, but has been obtained from another cell or prepared
synthetically. Generally, although not necessarily, such nucleic
acid encodes RNA and proteins that are not normally produced by the
cell in which it is expressed. Heterologous DNA herein encompasses
any DNA or RNA that one of skill in the art would recognize or
consider as heterologous or foreign to the cell in which it is
expressed. Heterologous DNA and RNA can also encode RNA or proteins
that mediate or alter expression of endogenous DNA by affecting
transcription, translation, or other regulatable biochemical
processes. Examples of heterologous nucleic acid include, but are
not limited to, nucleic acid that encodes traceable marker
proteins, such as a protein that confers drug resistance, nucleic
acid that encodes therapeutically effective substances, such as
anti-cancer agents, enzymes and hormones, and DNA that encodes
other types of proteins, such as antibodies.
[0126] Hence, herein heterologous DNA or foreign DNA, includes a
DNA molecule not present in the exact orientation and position as
the counterpart DNA molecule found in the genome. It can also refer
to a DNA molecule from another organism or species (i.e.,
exogenous).
[0127] As used herein, a therapeutically effective dose refers to
that amount of the compound sufficient to result in amelioration of
symptoms of disease.
[0128] As used herein, isolated with reference to a nucleic acid
molecule or polypeptide or other biomolecule means that the nucleic
acid or polypeptide has separated from the genetic environment from
which the polypeptide or nucleic acid were obtained. It can also
mean altered from the natural state. For example, a polynucleotide
or a polypeptide naturally present in a living animal is not
"isolated," but the same polynucleotide or polypeptide separated
from the coexisting materials of its natural state is "isolated,"
as the term is employed herein. Thus, a polypeptide or
polynucleotide produced and/or contained within a recombinant host
cell is considered isolated. Also intended as an "isolated
polypeptide" or an "isolated polynucleotide" are polypeptides or
polynucleotides that have been purified, partially or
substantially, from a recombinant host cell or from a native
source. For example, a recombinantly produced version of a compound
can be substantially purified by the one-step method described in
Smith et al., Gene, 67:31-40, 1988. The terms isolated and purified
are sometimes used interchangeably.
[0129] Thus, by "isolated" is meant that the nucleic is free of the
coding sequences of those genes that, in the naturally-occurring
genome of the organism (if any) immediately flank the gene encoding
the nucleic acid of interest. Isolated DNA can be single-stranded
or double-stranded, and can be genomic DNA, cDNA, recombinant
hybrid DNA, or synthetic DNA. It can be identical to a starting DNA
sequence, or can differ from such sequence by the deletion,
addition, or substitution of one or more nucleotides.
[0130] Isolated or purified as it refers to preparations made from
biological cells or hosts means any cell extract containing the
indicated DNA or protein including a crude extract of the DNA or
protein of interest. For example, in the case of a protein, a
purified preparation can be obtained following an individual
technique or a series of preparative or biochemical techniques and
the DNA or protein of interest can be present at various degrees of
purity in these preparations. The procedures can include for
example, but are not limited to, ammonium sulfate fractionation,
gel filtration, ion exchange change chromatography, affinity
chromatography, density gradient centrifugation and
electrophoresis.
[0131] A preparation of DNA or protein that is "substantially pure"
or "isolated" should be understood to mean a preparation free from
naturally occurring materials with which such DNA or protein is
normally associated in nature. "Essentially pure" should be
understood to mean a "highly" purified preparation that contains at
least 95% of the DNA or protein of interest.
[0132] A cell extract that contains the DNA or protein of interest
should be understood to mean a homogenate preparation or cell-free
preparation obtained from cells that express the protein or contain
the DNA of interest. The term "cell extract" is intended to include
culture media, especially spent culture media from which the cells
have been removed.
[0133] As used herein, "a targeting agent" refers to any molecule
that can bind another target-molecule, such as an antibody,
receptor, or ligand.
[0134] As used herein, receptor refers to a biologically active
molecule that specifically binds to (or with) other molecules. The
term "receptor protein" can be used to more specifically indicate
the proteinaceous nature of a specific receptor.
[0135] As used herein, recombinant refers to any progeny formed as
the result of genetic engineering.
[0136] As used herein, a promoter region refers to the portion of
DNA of a gene that controls transcription of the DNA to which it is
operatively linked. The promoter region includes specific sequences
of DNA that are sufficient for RNA polymerase recognition, binding
and transcription initiation. This portion of the promoter region
is referred to as the promoter. In addition, the promoter region
includes sequences that modulate this recognition, binding and
transcription initiation activity of the RNA polymerase. These
sequences can be cis acting or can be responsive to trans acting
factors. Promoters, depending upon the nature of the regulation,
can be constitutive or regulated.
[0137] As used herein, the phrase "operatively linked" generally
means the sequences or segments have been covalently joined into
one piece of DNA, whether in single or double stranded form,
whereby control or regulatory sequences on one segment control or
permit expression or replication or other such control of other
segments. The two segments are not necessarily contiguous. For gene
expression a DNA sequence and a regulatory sequence(s) are
connected in such a way to control or permit gene expression when
the appropriate molecular, e.g., transcriptional activator
proteins, are bound to the regulatory sequence(s).
[0138] As used herein, production by recombinant means by using
recombinant DNA methods means the use of the well known methods of
molecular biology for expressing proteins encoded by cloned DNA,
including cloning expression of genes and methods, such as gene
shuffling and phage display with screening for desired
specificities.
[0139] As used herein, a splice variant refers to a variant
produced by differential processing of a primary transcript of
genomic DNA that results in more than one type of mRNA.
[0140] As used herein, a composition refers to any mixture of two
or more products or compounds. It can be a solution, a suspension,
liquid, powder, a paste, aqueous, non-aqueous or any combination
thereof.
[0141] As used herein, a combination refers to any association
between two or more items.
[0142] As used herein, substantially identical to a product means
sufficiently similar so that the property of interest is
sufficiently unchanged so that the substantially identical product
can be used in place of the product.
[0143] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. One type of exemplary vector is an episome, i.e.,
a nucleic acid capable of extra-chromosomal replication. Exemplary
vectors are those capable of autonomous replication and/or
expression of nucleic acids to which they are linked. Vectors
capable of directing the expression of genes to which they are
operatively linked are referred to herein as "expression vectors."
In general, expression vectors of utility in recombinant DNA
techniques are often in the form of "plasmids" which refer
generally to circular double stranded DNA loops which, in their
vector form are not bound to the chromosome. "Plasmid" and "vector"
are used interchangeably as the plasmid is the most commonly used
form of vector. Other such other forms of expression vectors that
serve equivalent functions and that become known in the art
subsequently hereto.
[0144] As used herein, vector also is used interchangeable with
"virus vector" or "viral vector. In this case, which will be clear
from the context, the "vector" is not self-replicating. Viral
vectors are engineered viruses that are operatively linked to
exogenous genes to transfer (as vehicles or shuttles) the exogenous
genes into cells.
[0145] As used herein, transduction refers to the process of gene
transfer into and expression in mammalian and other cells mediated
by viruses. Transfection refers to the process when mediated by
plasmids.
[0146] As used herein, transformation refers to the process of gene
transfer into and expression in bacterial cells mediated by
plasmids.
[0147] As used herein, "allele," which is used interchangeably
herein with "allelic variant" refers to alternative forms of a gene
or portions thereof. Alleles occupy the same locus or position on
homologous chromosomes. When a subject has two identical alleles of
a gene, the subject is said to be homozygous for the gene or
allele. When a subject has two different alleles of a gene, the
subject is said to be heterozygous for the gene. Alleles of a
specific gene can differ from each other in a single nucleotide, or
several nucleotides, and can include substitutions, deletions, and
insertions of nucleotides. An allele of a gene also can be a form
of a gene containing a mutation.
[0148] As used herein, the term "gene" or "recombinant gene" refers
to a nucleic acid molecule comprising an open reading frame and
including at least one exon and (optionally) an intron sequence. A
gene can be either RNA or DNA. Genes can include regions preceding
and following the coding region (leader and trailer).
[0149] As used herein, "intron" refers to a DNA sequence present in
a given gene which is spliced out during mRNA maturation.
[0150] As used herein, "nucleotide sequence complementary to the
nucleotide sequence set forth in SEQ ID NO:" refers to the
nucleotide sequence of the complementary strand of a nucleic acid
strand having the particular SEQ ID NO:. The term "complementary
strand" is used herein interchangeably with the term "complement."
The complement of a nucleic acid strand can be the complement of a
coding strand or the complement of a non-coding strand. When
referring to double stranded nucleic acids, the complement of a
nucleic acid having a particular SEQ ID NO: refers to the
complementary strand of the strand set forth in the particular SEQ
ID NO: or to any nucleic acid having the nucleotide sequence of the
complementary strand of the particular SEQ ID NO:. When referring
to a single stranded nucleic acid having a nucleotide sequence
corresponding to a particular SEQ ID NO:, the complement of this
nucleic acid is a nucleic acid having a nucleotide sequence which
is complementary to that of the particular SEQ ID NO:.
[0151] As used herein, the term "coding sequence" refers to that
portion of a gene that encodes an amino acid sequence of a
protein.
[0152] As used herein, the term "sense strand" refers to that
strand of a double-stranded nucleic acid molecule that has the
sequence of the mRNA that encodes the amino acid sequence encoded
by the double-stranded nucleic acid molecule.
[0153] As used herein, the term "antisense strand" refers to that
strand of a double-stranded nucleic acid molecule that is the
complement of the sequence of the mRNA that encodes the amino acid
sequence encoded by the double-stranded nucleic acid molecule.
[0154] As used herein, an "array" refers to a collection of
elements, such as nucleic acid molecules, containing three or more
members. An addressable array is one in which the members of the
array are identifiable, typically by position on a solid phase
support or by virtue of an identifiable or detectable label, such
as by color, fluorescence, electronic signal (i.e., RF, microwave
or other frequency that does not substantially alter the
interaction of the molecules of interest), bar code or other
symbology, chemical or other such label. In certain embodiments,
the members of the array are immobilized to discrete identifiable
loci on the surface of a solid phase or directly or indirectly
linked to or otherwise associated with the identifiable label, such
as affixed to a microsphere or other particulate support (herein
referred to as beads) and suspended in solution or spread out on a
surface.
[0155] As used herein, a "support" (also referred to as a matrix
support, a matrix, an insoluble support or solid support) refers to
any solid or semisolid or insoluble support to which a molecule of
interest, typically a biological molecule, organic molecule or
biospecific ligand is linked or contacted. Such materials include
any materials that are used as affinity matrices or supports for
chemical and biological molecule syntheses and analyses, such as,
but are not limited to: polystyrene, polycarbonate, polypropylene,
nylon, glass, dextran, chitin, sand, pumice, agarose,
polysaccharides, dendrimers, buckyballs, polyacryl-amide, silicon,
rubber, and other materials used as supports for solid phase
syntheses, affinity separations and purifications, hybridization
reactions, immunoassays and other such applications. The matrix
herein can be particulate or can be in the form of a continuous
surface, such as a microtiter dish or well, a glass slide, a
silicon chip, a nitrocellulose sheet, nylon mesh, or other such
materials. When particulate, typically the particles have at least
one dimension in the 5-10 mm range or smaller. Such particles,
referred collectively herein as "beads," are often, but not
necessarily, spherical. Such reference, however, does not constrain
the geometry of the matrix, which can be any shape, including
random shapes, needles, fibers, and elongated. Roughly spherical
"beads," particularly microspheres that can be used in the liquid
phase, also are contemplated. The "beads" can include additional
components, such as magnetic or paramagnetic particles (see, e.g.,
Dynabeads (Dynal, Oslo, Norway)) for separation using magnets, as
long as the additional components do not interfere with the methods
and analyses herein.
[0156] As used herein, a "matrix" or "support particles" refers to
matrix materials that are in the form of discrete particles. The
particles have any shape and dimensions, but typically have at
least one dimension that is 100 mm or less, 50 mm or less, 10 mm or
less, 1 mm or less, 100 .mu.m or less, 50 .mu.m or less and
typically have a size that is 100 mm.sup.3 or less, 50 mm.sup.3 or
less, 10 mm.sup.3 or less, and 1 mm.sup.3 or less, 100 .mu.m.sup.3
or less and can be order of cubic microns. Such particles are
collectively called "beads."
[0157] As used herein, the abbreviations for any protective groups,
amino acids and other compounds, are, unless indicated otherwise,
in accord with their common usage, recognized abbreviations, or the
IUPAC-IUB Commission on Biochemical Nomenclature (see, Biochem.,
11:942-944 (1972)).
B. Directed Evolution
[0158] To date, there have been three general approaches described
for protein directed evolution based on mutagenesis.
[0159] 1. Pure Random Mutagenesis
[0160] Random mutagenesis methodology requires that the amino acids
in the starting protein sequence are replaced by all (or a group)
of the 20 amino acids. Either single or multiple replacements at
different amino acid positions are generated on the same molecule,
at the same time. The random mutagenesis method relies on a direct
search for fitness improvement based on random amino acid
replacement and sequence changes at multiple amino acid positions.
In this approach neither the amino acid position (first dimension)
nor the amino acid type (second dimension) are restricted; and
everything possible is generated and tested. Multiple replacements
can randomly happen at the same time on the same molecule. For
example, random mutagenesis methods are widely used to develop
antibodies with higher affinity for its ligand, by the generation
of random-sequence libraries of antibody molecules, followed by
expression and screening using filamentous phages.
[0161] 2. Restricted Random Mutagenesis
[0162] Restricted random mutagenesis methods introduce either all
of the 20 amino acids or DNA-biased residues. The bias is based on
the sequence of the DNA and not on that of the protein, in a
stochastic or semi-stochastic manner, respectively, within
restricted or predefined regions of the protein, known in advance
to be involved in the biological activity being "evolved." This
method relies on a direct search for fitness improvement based on
random amino acid replacement and sequence changes at either
restricted or multiple amino acid positions. In this approach the
scanning can be restricted to selected amino acid positions and/or
amino acid types, while material changes continue to be random in
position and type. For example, the amino acid position can be
restricted by prior selection of the target region to be mutated
(selection of target region is based upon prior knowledge on
protein structure/function); while the amino acid type is not
primarily restricted as replacing amino acids are stochastically or
at most "semi-stochastically" chosen. As an example, this method is
used to optimize known binding sites on proteins, including
hormone-receptor systems and antibody-epitope systems.
[0163] 3. Non-Restricted Rational Mutagenesis
[0164] Rational mutagenesis is a two-step process and is described
in co-pending U.S. application Ser. No. 10/022,249. Briefly, the
first step requires amino acid scanning where all and each of the
amino acids in the starting protein sequence are replaced by a
third amino acid of reference (e.g., alanine). Only a single amino
acid is replaced on each protein molecule at a time. A collection
of protein molecules having a single amino acid replacement is
generated such that molecules differ from each other by the amino
acid position at which the replacement has taken place. Mutant DNA
molecules are designed, generated by mutagenesis and cloned
individually, such as in addressable arrays, such that they are
physically separated from each other and such that each one is the
single product of an independent mutagenesis reaction. Mutant
protein molecules derived from the collection of mutant nucleic
acid molecules also are physically separated from each other, such
as by formatting in addressable arrays. Activity assessment on each
protein molecule allows for the identification of those amino acid
positions that result in a drop in activity when replaced, thus
indicating the involvement of that particular amino acid position
in the protein's biological activity and/or conformation that leads
to fitness of the particular feature being evolved. Those amino
acid positions are referred to as HITs. At the second step, a new
collection of molecules is generated such that each molecule
differs from each of the others by the amino acid present at the
individual HIT positions identified in step 1. All 20 amino acids
(19 remaining) are introduced at each of the HIT positions
identified in step 1: while each individual molecule contains, in
principle, one and only one amino acid replacement. Mutant DNA
molecules are designed, generated by mutagenesis and cloned
individually, such as in addressable arrays, such that they are
physically separated from each other and such that each one is the
single product of an independent mutagenesis reaction. Mutant
protein molecules derived from the collection of mutant DNA
molecules also are physically separated from each other, such as by
formatting in addressable arrays. Activity assessment then is
individually performed on each individual mutant molecule. The
newly generated mutants that lead to a desired alteration (such as
an improvement) in a protein activity are referred to as LEADs.
This method permits an indirect search for activity alteration,
such as improvement, based on one rational amino acid replacement
and sequence change at a single amino acid position at a time, in
search of a new, unpredicted amino acid sequence at some
unpredicted regions along a protein to produce a protein that
exhibits a desired activity or altered activity, such as better
performance than the starting protein.
[0165] In this approach, neither the amino acid position nor the
replacing amino acid type are restricted. Full length protein
scanning is performed during the first step to identify HIT
positions, and then all 20 amino acids are tested at each of the
HIT positions, to identify LEAD sequences; while, as a starting
point, only one amino acid at a time is replaced on each molecule.
The selection of the target region (HITs and surrounding amino
acids) for the second step is based upon experimental data on
activity obtained in the first step. Thus, no prior knowledge of
protein structure and/or function is necessary. Using this
approach, LEAD sequences have been found on proteins that are
located at regions of the protein not previously known to be
involved in the particular biological activity being optimized;
thus emphasizing the power of this approach to discover
unpredictable regions (HITs) as targets for fitness
improvement.
C. 2-Dimensional Rational Scanning (2D Scanning)
[0166] The 2-Dimensional rational scanning (or "2-dimensional
scanning") methods for protein rational evolution provided herein
(see, also copending U.S. application Ser. No.10/658,355, filed the
same day herewith, based on U.S. provisional application Ser. Nos.
60/457,063 and 60/410,258) are based on scanning over two
dimensions. The first dimension scanned is amino acid position
along the protein sequence to identify is-HIT target positions, and
the second dimension is the amino acid type selected for replacing
a particular is-HIT amino acid position. An advantage of the
2-dimensional scanning methods provided herein is that at least
one, and typically both, of the amino acid position scan and/or the
replacing amino acid scan can be restricted such that fewer than
all amino acids on the protein-backbone are selected for amino acid
replacement; and/or fewer than all of the remaining 19 amino acids
available to replace an original, such as native, amino acid are
selected for replacement.
[0167] In particular embodiments, based on i) the particular
protein properties to be evolved, ii) the protein's amino acid
sequence, and iii) the known properties of the individual amino
acids, a number of target positions along the protein sequence are
selected, in silico, as "is-HIT target positions." This number of
is-HIT target positions is as large as possible such that all
reasonably possible target positions for the particular feature
being evolved are included. In particular, embodiments where a
restricted number of is-HIT target positions are selected for
replacement, the amino acids selected to replace the is-HIT target
positions on the particular protein being optimized can be either
all of the remaining 19 amino acids or, more frequently, a more
restricted group comprising selected amino acids that are
contemplated to have the desired effect on protein activity. In
another embodiment, so long as a restricted number of replacing
amino acids are used, all of the amino acid positions along the
protein backbone can be selected as is-HIT target positions for
amino acid replacement. Mutagenesis then is performed by the
replacement of single amino acid residues at specific is-HIT target
positions on the protein backbone (e.g., "one-by-one," such as in
addressable arrays), such that each individual mutant generated is
the single product of each single mutagenesis reaction. Mutant DNA
molecules are designed, generated by mutagenesis and cloned
individually, such as in addressable arrays, such that they are
physically separated from each other and that each one is the
single product of an independent mutagenesis reaction. Mutant
protein molecules derived from the collection of mutant DNA
molecules also are physically separated from each other, such as by
formatting in addressable arrays. Thus, a plurality of mutant
protein molecules are produced. Each mutant protein contains a
single amino acid replacement at only one of the is-HIT target
positions. Activity assessment is then individually performed on
each individual protein mutant molecule, following protein
expression and measurement of the appropriate activity. An example
of practice of this method is shown in the Example in which mutant
IFN.alpha. molecules and IFN.beta. molecules are produced.
[0168] The newly generated proteins that lead to altered, typically
improvement, in a target protein activity are referred to as LEADs.
This method relies on an indirect search for protein improvement
for a particular activity, such as increased resistance to
proteolysis, based on a rational amino acid replacement and
sequence change at single or, in another embodiment, a limited
number of amino acid positions at a time. As a result, optimized
proteins that have new amino acid sequences at some regions along
the protein that perform better (at a particular target activity or
other property) than the starting protein are identified and
isolated.
[0169] 1. Identifying in-silico HITs
[0170] Provided herein is a method for directed evolution that
includes identifying and selecting (using in silico analysis)
specific amino acids and amino acid positions (referred to herein
as is-HITs) along the protein sequence that are contemplated to be
directly or indirectly involved in the feature being evolved. As
noted, the 2-dimensional scanning methods provided include the
following two-steps. The first step is an in silico search of a
target protein's amino acid sequence to identify all possible amino
acid positions that potentially can be targets for the activity
being evolved. This is effected, for example, by assessing the
effect of amino acid residues on the property(ies) to be altered on
the protein, using any known standard software. The particulars of
the in silico analysis is a function of the property to be
modified. For example, in the example herein, a property that is
altered resistance of the protein to proteolysis. To determine
amino acid residues that are potential targets as is-HITs, in this
example, all possible target residues for proteases were first
identified. The 3-dimensional structure of the protein was then
considered in order to identify surface residues. Comparison of
exposed residues with proteolytically cleavable residues yields
residues that are targets for change.
[0171] Once identified, these amino acid positions or target
sequences are referred to as "is-HITs" (in silico HITs). In silico
HITs are defined as those amino acid positions (or target
positions) that potentially are involved in the "evolving" feature,
such as increased resistance to proteolysis. In one embodiment, the
discrimination of the is-HITs among all the amino acid positions in
a protein sequence is made based on i) the amino acid type at each
position in addition to, whenever available but not necessarily,
ii) the information on the protein secondary or tertiary structure.
In silico HITs constitute a collection of mutant molecules such
that all possible amino acids, amino acid positions or target
sequences potentially involved in the evolving feature are
represented. No strong theoretical discrimination among amino acids
or amino acid positions is made at this stage.
[0172] In silico HIT positions are spread over the full length of
the protein sequence. In one embodiment, only a single is-HIT amino
acid at a time is replaced on the target protein. In another
embodiment, a limited number of is-HIT amino acids are replaced at
the same time on the same target protein molecule. The selection of
target regions (is-HITs and surrounding amino acids) for the second
step is based upon rational assumptions and predictions. No prior
knowledge of protein structure/function is necessary. Hence, the
2-dimensional scanning methodology provided herein does not require
any previous knowledge of the 3-dimensional conformational
structure of the protein.
[0173] Any protein known or otherwise available to those of skill
in the art is suitable for modification using the directed
evolution methods provided herein, including cytokines (e.g.,
IFN.alpha.-2b) or any other proteins that have previously been
mutated or optimized.
[0174] A variety of parameters can be analyzed to determine whether
or not a particular amino acid on a protein might be involved in
the evolving feature. For example, the information provided by
crystal structures of proteins can be rationally exploited in order
to perform a computer-assisted (in silico) analysis towards the
prediction of variants with desired features. In a particular
embodiment, a limited number of initial premises (typically no more
than 2) are used to determine the in silico HITs. In other
embodiments, the number of premises used to determine the in silico
hits can range from 1 to 10 premises, including no more than 9, no
more than 8, no more than 7, no more than 6, no more than 5, no
more than 4, no more than 3, but are typically no more than 2
premises. It is important to the methods provided herein that the
number of initial premises be kept to a minimum, so as to maintain
the number of potential is-HITs at a maximum (here is where the
methods provided are not limited by too much prediction based on
theoretical assumptions). When two premises are employed, the first
condition is typically the amino acid type itself, which is
directly linked to the nature of the evolving feature. For example,
if the goal were to change the optimum pH for an enzyme, then the
replacing amino acids selected at this step for the replacement of
the original sequence would be only those with a certain pKa value.
The second premise is typically related to the specific position of
those amino acids along the protein structure. For example, some
amino acids might be discarded if they are not expected to be
exposed enough to the solvent, even when they might have
appropriate pKa values.
[0175] During the first step of identification of is-HITs according
to the methods provided herein, each individual amino acid along
the protein sequence is considered individually to assess whether
it is a candidate for is-HIT. This search is done one-by-one and
the decision on whether the amino acid is considered to be a
candidate for a is-HIT is based on (1) the amino acid type itself;
(2) the position on the amino acid sequence and protein structure
if known; and (3) the predicted interaction between that amino acid
and its neighbors in sequence and space.
[0176] Using the 3D-scanning methods provided herein, once one
protein within a family of proteins (e.g., IFN.alpha.-2b within the
cytokine family) is optimized using the methods provided herein for
generating LEAD mutants, is-HITs can be identified on other or all
proteins within a particular family by identifying the
corresponding amino acid positions therein using structural
homology analysis (based upon comparisons of the 3-D structures of
the family members with original protein to identify corresponding
residues for replacement) as described hereinafter. The is-HITs on
family identified in this manner then can be subjected to the next
step of identifying replacing amino acids and further assayed to
obtain LEADs or super-LEADs as described herein.
[0177] 2. Identifying Replacing Amino Acids
[0178] Once the is-HITs target positions are selected, the next
step is identifying those amino acids that will replace the
original, such as native, amino acid at each is-HIT position to
alter the activity level for the particular feature being evolved.
The set of replacing amino acids to be used to replace the
original, such as native, amino acid at each is-HIT position can be
different and specific for the particular is-HIT position. The
choice of the replacing amino acids takes into account the need to
preserve the physicochemical properties such as hydrophobicity,
charge and polarity, of essential (e.g., catalytic, binding, etc.)
residues. The number of replacing amino acids, of the remaining 19
non-native (or non-original) amino acids, that can be used to
replace a particular is-HIT target position ranges from 1 up to
about 19, from 1 up to about 15, from 1 up to about 10, from 1 up
to about 9, from 1 up to about 8, from 1 up to about 7, from 1 up
to about 6, from 1 up to about 5, from 1 up to about 4, from 1 up
to about 3, or from 1 to 2 amino acid replacements.
[0179] Numerous methods of selecting replacing amino acids (also
referred to herein as "replacement amino acids") are well known in
the art. Protein chemists determined that certain amino acid
substitutions commonly occur in related proteins from different
species. As the protein still functions with these substitutions,
the substituted amino acids are compatible with protein structure
and function. Often, these substitutions are to a chemically
similar amino acid, but other types of changes, although relatively
rare, can also occur.
[0180] Knowing the types of changes that are most and least common
in a large number of proteins can assist with predicting alignments
and amino acid substitutions for any set of protein sequences.
Amino acid substitution matrices are used for this purpose.
[0181] In amino acid substitution matrices, amino acids are listed
across the top of a matrix and down the side, and each matrix
position is filled with a score that reflects how often one amino
acid would have been paired with the other in an alignment of
related protein sequences. The probability of changing amino acid A
into amino acid B is assumed to be identical to the reverse
probability of changing B into A. This assumption is made because,
for any two sequences, the ancestor amino acid in the phylogenetic
tree is usually not known. Additionally, the likelihood of
replacement should depend on the product of the frequency of
occurrence of the two amino acids and on their chemical and
physical similarities. A prediction of this model is that amino
acid frequencies will not change over evolutionary time (Dayhoffet
al., Atlas of Protein Sequence and Structure, 5(3):345-352, 1978).
Below are several exemplary amino acid substitution matrices,
including, but not limited to block substitution matrix (BLOSUM),
Jones, Gonnet, Fitch, Feng, McLachlan, Grantham, Miyata, Rao,
Risler, Johnson and percent accepted mutation (PAM). Any such
method known to those of skill in the art can be employed.
a. Percent Accepted Mutation (PAM)
[0182] Dayhoff and coworkers developed a model of protein evolution
that resulted in the development of a set of widely used
replacement matrices (Dayhoff et al., Atlas of protein Sequence and
Structure, 5(3):345-352, 1978) termed percent accepted mutation
matrices (PAM). In deriving these matrices, each change in the
current amino acid at a particular site is assumed to be
independent of previous mutational events at that site. Thus, the
probability of change of any amino acid A to amino acid B is the
same, regardless of the previous changes at that site and also
regardless of the position of amino acid A in a protein
sequence.
[0183] In the Dayhoff approach, replacement rates are derived from
alignments of protein sequences that are at least 85% identical;
this constraint ensures that the likelihood of a particular
mutation being the result of a set of successive mutations is low.
Because these changes are observed in closely related proteins,
they represent amino acid substitutions that do not significantly
change the function of the protein. Hence, they are called
"accepted mutations," as defined as amino acid changes that are
accepted by natural selection.
i. PAM Analysis
[0184] In particular embodiments of the methods provided herein,
"Percent Accepted Mutation" (PAM; Dayhoff et al., Atlas of Protein
Sequence and Structure, 5(3):345-352, 1978 FIG. 2) PAM values are
used to select an appropriate group of replacement amino acids. PAM
matrices were originally developed to produce alignments between
protein sequences based evolutionary distances. Because, in a
family of proteins or homologous (related) sequences, identical or
similar amino acids (85% similarity) are shared, conservative
substitutions for, or allowed point mutations of the corresponding
amino acid residues can be determined throughout an aligned
reference sequence. Conservative substitutions of a residue in a
reference sequence are those substitutions that are physically and
functionally similar to the corresponding reference residues, e.g.,
that have a similar size, shape, electric charge, chemical
properties, including the ability to form bonds such as covalent
and hydrogen bonds. Particularly suitable conservative amino acid
substitutions are those that show the highest scores and fulfill
the PAM matrix criteria in the form of "accepted point mutations."
For example, by comparing a family of scoring matrices, Dayhoff et
al., Atlas of protein Sequence and Structure, 5(3):345-352, 1978,
found a consistently higher score significance when using PAM250
matrix to analyze a variety of proteins, known to be distantly
related.
ii. PAM 250
[0185] In a particular embodiment, the PAM250 matrix set forth in
FIG. 2 is used for determining the replacing amino acids based on
similarity criteria. The PAM250 matrix uses data obtained directly
from natural evolution to facilitate the selection of replacing
amino acids for the is-HITs to generate conservative mutations
without much affecting the overall protein function. By using the
PAM250 matrix, candidate replacing amino acids are identified from
related proteins from different organisms.
b. Jones et al. and Gonnet et al.
[0186] This method (see, e.g., Jones et al., Comput. Appl. Biosci.,
8:275-282, 1992 and Gonnet et al., Science, 256:1433-1445, 1992)
uses much of the same methodology as Dayhoff (see below), but with
modern databases. The matrix of Jones et al., is extracted from
Release 15.0 of the SWISS-PROT protein sequence database. Point
mutations totaling 59,160 from 16,130 protein sequences were used
to calculate a PAM250 (see below) matrix.
[0187] The matrix published by Gonnet et al., Science,
256:1433-1445, 1992, was built from a sequence database of
8,344,353 amino acid residues. Each sequence was compared against
the entire database, such that 1.7.times.10.sup.6 subsequent
matches resulted for the significant alignments. These matches were
then used to generate a matrix with a PAM distance of 250.
c. Fitch and Feng et al.
[0188] Fitch, J. Mol. Evol., 16(1): 9-16, 1966, used an exchange
matrix that contained for each pair (A, B) of amino acid types the
minimum number of nucleotides that must be changed to encode amino
acid A instead of amino acid B. Feng et al., J. Mol. Evol., 21:
112-125, 1985, used an enhanced version of Fitch, J. Mol. Evol.,
16(1): 9-16, 1966, to build a Structure-Genetic matrix. In addition
to considering the minimum number of base changes required to
encode amino acid B instead of A, this method also considers the
structural similarity of the amino acids.
d. McLachlan, Grantham and Miyata
[0189] McLachlan, J. Mol. Biol., 61:409-424 1971, used 16 protein
families, each with 2 to 14 members. The 89 sequences were aligned
and the pairwise exchange frequency, observed in 9280
substitutions, was used to generate an exchange matrix with values
varying from 0 to 9.
[0190] Grantham, Science, 185:862-864, 1974, considers composition,
polarity and molecular volume of amino acid side-chains, properties
that were highly correlated to the relative substitution
frequencies tabulated by McLachlan, J. Mol. Biol., 61:409-424,
1971, to build the matrix.
[0191] Miyata, J. Mol. Evol., 12:219-236, 1979, uses the volume and
polarity values of amino acids published by Grantham, Science,
185:862-864, 1974. For every amino acid type pair, the difference
for both properties was calculated and divided by the standard
deviation of all the differences. The square root of the sum of
both values is then used in the matrix.
e. Rao
[0192] Rao, J. Pept. Protein Res., 29:276-281, 1987, employs five
amino acid properties to create a matrix; namely, alpha-helical,
beta-strand and reverse-turn propensities as well as polarity and
hydrophobicity. The standardized properties were summed and the
matrix rescaled to the same average as that for PAM (Dayhoff et
al., Atlas of Protein Sequence and Structure, 5(3):345-352,
1978).
f. Risler et al.
[0193] Risler et al., J. Mol. Biol., 204:1019-1029, 1988, aligned
32 three-dimensional structures from 11 protein families by
rigid-body superposition of the backbone topology. Only
substitutions were considered where at least three adjacent and
equivalent main-chain C.alpha. atom pairs in the compared
structures were each not more than 1.2 .ANG. apart. A total of 2860
substitutions were considered and used to build a matrix based on
.chi..sup.2 distance calculations.
g. Johnson et al.
[0194] Johnson et al., J. Mol. Biol., 233:716-738, 1993, derived
their matrix from the tertiary structural alignment of 65 families
in a database of 235 structures created with the method of Sali et
al., J. Mol. Biol., 212:403-428, 1990. Their examination of the
substitutions was based on the expected and observed ratios of
occurrences and the final matrix values were taken as log 10 of the
ratios.
h. Block Substitution Matrix (BLOSUM)
[0195] One empirical approach (Henikoff et al., Proc. Natl. Acad.
Sci. USA, 89:10915-10919, 1992) uses local, ungapped alignments of
distantly related sequences to derive the blocks amino acid
substitution matrix (BLOSUM) series of matrices. The matrix values
are based on the observed amino acid substitutions in a larger set
of about 2000 conserved amino acid patterns, termed blocks. These
blocks act as signatures of families of related proteins. Matrices
of this series are identified by a number after the matrix (e.g.,
BLOSUM50), which refers to the minimum percentage identity of the
blocks of multiple aligned amino acids used to construct the
matrix. It is noteworthy that these matrices are directly
calculated without extrapolations, and are analogous to transition
probability matrices P(T) for different values of T, estimated
without reference to any rate matrix Q.
[0196] The outcome of these two steps set forth above, which is
performed in silico is that: (1) the amino acid positions that will
be the target for mutagenesis are identified; these positions are
referred to as is-HITs; (2) the replacing amino acids for the
original, such as native, amino acids at the is-HITs are
identified, to provide a collection of candidate LEAD mutant
molecules that are expected to perform different from the native
one. These are assayed for a desired optimized (or improved or
altered) biological activity.
[0197] 3. Physical Construction of Mutant Proteins and Biological
Assays
[0198] Once is-HITs are selected as set forth above, replacing
amino acids are introduced. Mutant proteins typically are prepared
using recombinant DNA methods and assessed in appropriate
biological assays for the particular biological activity (feature)
optimized (see, e.g., Example 1). An exemplary method of preparing
the mutant proteins is by mutagenesis of the original, such as
native, gene using methods well known in the art. Mutant molecules
are generated one-by-one, such as in addressable arrays, such that
each individual mutant generated is the single product of each
single and independent mutagenesis reaction. Individual mutagenesis
reactions are conducted separately, such as in addressable arrays
where they are physically separated from each other. Once a
population of sets of nucleic acid molecules encoding the
respective mutant proteins is prepared, each is separately
introduced one-by-one into appropriate cells for the production of
the corresponding mutant proteins. This can also be performed, for
example, in addressable arrays where each set of nucleic acid
molecules encoding a respective mutant protein is introduced into
cells confined to a discrete location, such as in a well of a
multi-well microtiter plate. Each individual mutant protein is
individually phenotypically characterized and performance is
quantitatively assessed using assays appropriate for the feature
being optimized (i.e., feature being evolved). Again, this step can
be performed in addressable arrays. Those mutants displaying a
desired increased or decreased performance compared to the
original, such as native molecules are identified and designated
LEADs. From the beginning of the process of generating the mutant
DNA molecules up through the readout and analysis of the
performance results, each candidate LEAD mutant is generated,
produced and analyzed individually, such as from its own address in
an addressable array. The process is amenable to automation.
D. 2-Dimensional Scanning of Proteins for Increased Resistance to
Proteolysis
[0199] The methods of 2-dimensional scanning permit preparation of
proteins modified for a selected trait, activity or other
phenotype. Among modifications of interest for therapeutic proteins
are those that increase protection against protease digestion while
maintaining the requisite biological activity. Such changes are
useful for producing longer-lasting therapeutic proteins.
[0200] The delivery of stable peptide and protein drugs to patients
is a major challenge for the pharmaceutical industry. These types
of drugs in the human body are constantly eliminated or taken out
of circulation by different physiological processes including
internalization, glomerular filtration and proteolysis. The latter
is often the limiting process affecting the half-life of proteins
used as therapeutic agents in per-oral administration and either
intravenous or intramuscular injections.
[0201] The 2-dimensional scanning process for protein evolution is
used to effectively improve protein resistance to proteases and
thus increase protein half-life in vitro and, ultimately in vivo.
As noted, the methods provided herein for designing and generating
highly stable, longer lasting proteins, or proteins having a longer
half-life include: i) identifying some or all possible target sites
on the protein sequence that are susceptible to digestion by one or
more specific proteases (these sites are referred to herein as
is-HITs); ii) identifying appropriate replacing amino acids,
specific for each is-HIT, such that upon replacement of one or more
of the original, such as native, amino acids at that specific
is-HIT, they can be expected to increase the is-HIT's resistance to
digestion by protease while at the same time, maintaining or
improving the requisite biological activity of the protein (these
proteins with replaced amino acids are the "candidate LEADs"); iii)
systematically introducing the specific replacing amino acids
(candidate LEADs) at every specific is-HIT target position to
generate a collection containing the corresponding mutant candidate
lead molecules. Mutants are generated, produced and phenotypically
characterized one-by-one, such as in addressable arrays, such that
each mutant molecule contains initially an amino acid replacement
at only one is-HIT site.
[0202] In particular embodiments, such as in subsequent rounds,
mutant molecules also can be generated that contain one or more
amino acids at one or more is-HIT sites that have been replaced by
candidate LEAD amino acids. Those mutant proteins carrying one or
more mutations at one or more is-HITs, and that display improved
protease resistance are called LEADs (one mutation at one is-HIT)
and super-LEADs (mutations at more than one is-HIT).
[0203] The first step of the process takes into consideration
existing knowledge from different domains:
[0204] (1) About the galenic and the delivery environment (tissue,
organ or corporal fluid) of the particular therapeutic protein in
order to establish a list of proteases more likely to be found in
that environment. For example, a therapeutic protein in per-oral
application is likely to encounter typical proteases of the luminal
gastrointestinal tract. In contrast, if this protein were injected
in the blood circulation, serum proteases would be implicated in
the proteolysis. Based on the specific list of proteases involved,
the complete list of all amino acid sequences that potentially
could be targeted by the proteases in the list is determined.
[0205] (2) Since protease mixtures in the body are quite complex in
composition, almost all the residues in any target protein
potentially are targeted for proteolysis (FIG. 1A). Nevertheless,
proteins form specific tri-dimensional structures where residues
are more or less exposed to the environment and protease action. It
can be assumed that those residues constituting the core of a
protein are inaccessible to proteases, while those more "exposed"
to the environment are better targets for proteases. The
probability for every specific amino acid to be "exposed" and then
to be accessible to proteases can be taken into account to reduce
the number of is-HIT. Consequently, the methods herein consider the
analysis with respect to solvent "exposure" or "accessibility" for
each individual amino acid in the protein sequence. Solvent
accessibility of residues can alternatively be estimated,
regardless of any previous knowledge of specific protein structural
data, by using an algorithm derived from empirical amino acid
probabilities of accessibility, which is expressed in the following
equation (Boger et al., Reports of the Sixth International Congress
in Immunology, p. 250, 1986): A .function. ( i ) = [ j = 1 6
.times. _.delta. .times. _ .times. i + 4 - j ] * [ 0.62 ] - 6 .
##EQU2## Briefly, these are fractional probabilities (.delta._(i))
determined for an amino acid (i) found on the surface of a protein,
which are based upon structural data from a set of several
proteins. It is thus possible to calculate the solvent
accessibility (A) of an amino acid (A(i)) at sequence position (i-2
to i+3, onto a sliding window of length equal to 6) that is within
an average surface accessible to solvent of >20 square angstroms
(.ANG..sup.2).
[0206] The protease accessible target amino acids along the protein
sequence, i.e., the amino acids to be replaced, are thus identified
and are referred to herein as in silico HITs (is-HITs).
[0207] Amino acids at the is-HITs then are replaced by residues
that render the sequence less vulnerable (by a factor, for example,
of 1%, 10%, 20%, 30%, 40%, 50%, . . . 100% depending upon the
protein) or invulnerable (substantially no detectable digestion
within a set time period) to protease digestion, while at the same
time maintain a biological activity or activities of interest of
the protein. The choice of the replacing amino acids is complicated
by (1) the broad target specificity of certain proteases and (2)
the need to preserve the physicochemical properties such as
hydrophobicity, charge and polarity, of essential (e.g., catalytic,
binding and/or other activities depending upon the protein)
residues. For use in the methods herein, the "Percent Accepted
Mutation" values (PAM values; see, Dayhoff et al., Atlas of Protein
Sequence and Structure, 5(3):345-352, 1978), FIG. 2) can be used as
described herein. PAM values, originally developed to produce
alignments between protein sequences, are available in the form of
probability matrices, which reflect an evolutionary distance.
Since, in a family of proteins or homologous (related) sequences,
identical or similar amino acids (85% similarity) are shared,
conservative substitutions for, or "allowed point mutations" of the
corresponding amino acid residues can be determined throughout an
aligned reference sequence. As noted, conservative substitutions of
a residue in a reference sequence are those substitutions that are
physically and functionally similar to the corresponding reference
residues e.g., that have a similar size, shape, electric charge,
chemical properties, including the ability to form bonds such as
covalent and hydrogen bonds. For example, conservative
substitutions can be those that exhibit the highest scores and
fulfill the PAM matrix criteria in the form of "accepted point
mutations."
[0208] By comparing a family of scoring matrices, Dayhoff et al.,
Atlas of Protein Sequence and Structure, 5(3):345-352, 1978), found
consistently higher score significance when using PAM250 matrix to
analyze a variety of proteins, known to be distantly related. For
methods herein, the PAM250 matrix was selected for use. The PAM250
matrix is used, by learning directly from natural evolution, to
find replacing amino acids for the is-HITs to generate conservative
mutations without affecting the protein function. By using PAM250,
candidate replacing amino acids are identified from related
proteins from different organisms.
[0209] An exemplary class of proteins that can be optimized
according to the methods provided herein are the cytokines. For
example, 2D-scanning methods provided herein can be used to modify
the following cytokines to increase their stability as assessed by
an increased resistance to proteolysis resulting in an increased
protein half-life in the bloodstream or any other desired
biological activity of the selected protein. Exemplary cytokines,
include, but are not limited to: interleukin-10 (IL-10; SEQ ID NO:
200), interferon beta (IFN-.beta.; SEQ ID NO: 196), interferon
alpha-2a (IFN.alpha.-2a; SEQ ID NO: 182), interferon alpha-2b
(IFN.alpha.-2b; SEQ ID NO: 1), and interferon gamma (IFN-.gamma.;
SEQ ID NO: 199), granulocyte colony stimulating factor (G-CSF; SEQ
ID NO: 210), leukemia inhibitory factor (LIF; SEQ ID NO: 213),
growth hormone (hGH; SEQ ID NO: 216), ciliary neurotrophic factor
(CNTF; SEQ ID NO: 212), leptin (SEQ ID NO: 211), oncostatin M (SEQ
ID NO: 214), interleukin-6 (IL-6; SEQ ID NO: 217), interleukin-12
(IL-12; SEQ ID NO: 215), erythropoietin (EPO; SEQ ID NO: 201),
granulocyte-macrophage colony stimulating factor (GM-CSF; SEQ ID
NO: 202), interleukin-2 (IL-2; SEQ ID NO: 204), interleukin-3
(IL-3; SEQ ID NO: 205), interleukin-4 (IL-4; SEQ ID NO: 207),
interleukin-5 (IL-5; SEQ ID NO: 208), interleukin-13 (IL-13; SEQ ID
NO: 209), Flt3 ligand (SEQ ID NO: 203) and stem cell factor (SCF;
SEQ ID NO: 206).
[0210] Accordingly, provided herein are modified cytokines that
exhibit increased resistance to proteolysis compared to the
unmodified cytokine. The modified cytokines can be selected from
among a member of the interferons/interleukin-10 protein family, a
member of the long-chain cytokine family; and a member of the
short-chain cytokine family. In particular embodiments, the
modified cytokines provided herein are selected from among:
interleukin-10 (IL-10), interferon beta (IFN.beta.), interferon
alpha-2a (IFN.alpha.-2a), interferon alpha-2b (IFN.alpha.-2b), and
interferon gamma (IFN-.gamma.), granulocyte colony stimulating
factor (G-CSF), leukemia inhibitory factor (LIF), human growth
hormone (hGH), ciliary neurotrophic factor (CNTF), leptin,
oncostatin M, interleukin-6 (IL-6) and interleukin-12 (IL-12),
erythropoietin (EPO), granulocyte-macrophage colony stimulating
factor (GM-CSF), interleukin-2 (IL-2), interleukin-3 (IL-3),
interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-13 (IL-13),
Flt3 ligand and stem cell factor (SCF). In one embodiment, the
modified cytokine is an interferon, including modified interferon
.alpha.-2b (IFN.alpha.-2b).
E. Rational Evolution of IFN.alpha.-2b For Increased Resistance to
Proteolysis
[0211] IFN.alpha.-2b is used for a variety of applications.
Typically it is used for treatment of type B and C chronic
hepatitis. Additional indications include, but are not limited to,
melanomas, herpes infections, Kaposi sarcomas and some leukemia and
lymphoma cases. Patients receiving interferon are subject to
frequent repeat applications of the drug. Since such frequent
injections generate uncomfortable physiological as well as
undesirable psychological reactions in patients, increasing the
half-life of interferons and thus decreasing the necessary
frequency of interferon injections, would be extremely useful to
the medical community. For example, after injection of native human
IFN.alpha.-2b injection in mice, as a model system, its presence
can be detected in the serum between 3 and 10 hours with a
half-life of only around 4 hours. The IFN.alpha.-2b completely
disappears to undetectable levels by 18-24 hours after injection.
Provided herein are mutant variants of the IFN.alpha.-2b protein
that display altered properties including: (a) highly improved
stability as assessed by resistance to proteases in vitro and by
pharmacokinetics studies in mice; and (b) at least comparable
biological activity as assessed by antiviral and antiproliferative
action compared to both the unmodified and wild type native
IFN.alpha.-2b protein and to at least one pegylated derivative of
the wild type native IFN.alpha.. As a result, the IFN.alpha.-2b
mutant proteins provided herein confer a higher half-life and at
least comparable antiviral and antiproliferation activity
(sufficient for a therapeutic effect) with respect to the native
sequence and to the pegylated derivatives molecules currently being
used for the clinical treatment of hepatitis C infection. See FIGS.
6(A)-6(N), 6(T) and 6(U). Thus, the optimized IFN.alpha.-2b protein
mutants that possess increased resistance to proteolysis and/or
glomerular filtration provided herein result in a decrease in the
frequency of injections needed to maintain a sufficient drug level
in serum, leading to i) higher comfort and acceptance by patients,
ii) lower doses necessary to achieve comparable biological effects,
and iii) as a consequence of (ii), an attenuation of the
(dose-dependent) secondary effects observed in humans.
[0212] In particular embodiments, the half-life of the
IFN.alpha.-2b and IFN.alpha.-2a mutants provided herein is
increased by an amount selected from at least 10%, at least 20%, at
least 30%, at least 40%, at least 50%, at least 60%, at least 70%,
at least 80%, at least 90%, at least 100%, at least 150%, at least
200%, at least 250%, at least 300%, at least 350%, at least 400%,
at least 450%, at least 500% or more, when compared to the
half-life of native human IFN.alpha.-2b and IFN.alpha.-2a in either
human blood, human serum or an in vitro mixture containing one or
more proteases. In other embodiments, the half-life of the
IFN.alpha.-2b and IFN.alpha.-2a mutants provided herein is
increased by an amount selected from at least 6 times, 7 times, 8
times, 9 times, 10 times, 20 times, 30 times, 40 times, 50 times,
60 times, 70 times, 80 times, 90 times, 100 times, 200 times, 300
times, 400 times, 500 times, 600 times, 700 times, 800 times, 900
times, 1000 times, or more, when compared to the half-life of
native human IFN.alpha.-2b and IFN.alpha.-2a in either human blood,
human serum or an in vitro mixture containing one or more
proteases.
[0213] Two methodologies were used herein to increase the stability
of IFN.alpha.-2b by amino acid replacement: i) amino acid
replacement that leads to higher resistance to proteases by direct
destruction of the protease target residue or sequence, while
either maintaining or improving the requisite biological activity
(e.g., antiviral activity, antiproliferation activity), and/or ii)
amino acid replacement that leads to a different pattern of
N-glycosylation, thus decreasing both glomerular filtration and
sensitivity to proteases, while either improving or maintaining the
requisite biological activity (e.g., antiviral activity,
antiproliferation activity).
[0214] The 2D-scanning methods provided herein were used to
identify the amino acid changes on IFN.alpha.-2b that lead to an
increase in stability when challenged either with proteases, human
blood lysate or human serum. Increasing protein stability to
proteases, human blood lysate or human serum, and/or increasing the
molecular size is contemplated herein to provide a longer in vivo
half-life for the particular protein molecules, and thus to a
reduction in the frequency of necessary injections into patients.
The biological activities that were measured for the IFN.alpha.-2b
molecules are i) their capacity to inhibit virus replication when
added to permissive cells previously infected with the appropriate
virus, and ii) their capacity to stimulate cell proliferation when
added to the appropriate cells. Prior to the measurement of
biological activity, IFN.alpha.-2b molecules were challenged with
proteases, human blood lysate or human serum during different
incubation times. The biological activity measured, corresponds
then to the residual biological activity following exposure to the
protease-containing mixtures.
[0215] As set forth above, provided herein are methods for the
development of IFN.alpha.-2b and IFN.alpha.-2a molecules that,
while maintaining the requisite biological activity intact, have
been rendered less susceptible to digestion by blood proteases and
therefore display a longer half-life in blood circulation. In this
particular example, the method used included the following specific
steps as set forth in Example 2:
[0216] 1) Identifying some or all possible target sites on the
protein sequence that are susceptible to digestion by one or more
specific proteases (these sites are the is-HITs) and
[0217] 2) Identifying appropriate replacing amino acids, specific
for each is-HIT, such that if used to replace one or more of the
original amino acids at that specific is-HIT, they can be expected
to increase the is-HIT's resistance to digestion by protease while
at the same time, keeping the biological activity of the protein
unchanged (these replacing amino acids are the "candidate
LEADs").
[0218] As set forth in Example 2, the 3-dimensional structure of
IFN.alpha.-2b obtained from the NMR structure of IFN.alpha.-2a (PDB
code 1ITF) was used to select only those residues exposed to
solvent from a list of residues along the IFN.alpha.-2b and
IFN.alpha.-2a sequence which can be recognized as a substrate for
different enzymes present in the serum. Residue 1 corresponds to
the first residue of the mature peptide IFN.alpha.-2b (SEQ ID NO:1)
encoded by nucleotides 580-1074 of sequence accession No. J00207.
Using this approach, the following 42 amino acid target positions
were identified as is-HITs on IFN.alpha.-2b or IFN.alpha.-2a, which
numbering is that of the mature protein (SEQ ID NO:1 or SEQ ID
NO:182, respectively): L3, P4, R12, R13, M16, R22, K23 or R23, F27,
L30, K31, R33, E41, K49, E58, K70, E78, K83, Y89, E96, E107, P109,
L110, M111, E113, L117, R120, K121, R125, L128, K131, E132, K133,
K134, Y135, P137, M148, R149, E159, L161, R162, K164, and E165.
Each of these positions was replaced by residues defined as
compatible by the substitution matrix PAM250 while at the same time
not generating any new substrates for proteases. For these 42
is-HITs, the residue substitutions determined by PAM250 analysis
were as follows:
[0219] R to H, Q
[0220] E to H,Q
[0221] K to Q, T
[0222] L to V, I
[0223] M to I, V
[0224] P to A, S
[0225] Y to I, H.
[0226] 1. Modified IFN.alpha.-2b Proteins with Single Amino Acid
Substitutions (is-HITS)
[0227] Among the mutant proteins provided herein, are mutant
IFN.alpha.-2b proteins that have increased resistance proteolysis
compared to the unmodified, typically wild-type, protein. The
mutant IFN.alpha.-2b proteins include those selected from among
proteins containing more single amino acid replacements in SEQ ID
NO:1, corresponding to: L by V at position 3; L by I at position 3;
.beta. by S at position 4; .beta. by A at position 4; R by H at
position 12; R by Q at position 12; R by H at position 13; R by Q
at position 13; M by V at position 16; M by I at position 16; R by
H at position 22; R by Q at position 22; R by H at position 23; R
by Q at position 23; F by I at position 27; F by V at position 27;
L by V at position 30; L by I at position 30; K by Q at position
31; K by T at position 31; R by H at position 33; R by Q at
position 33; E by Q at position 41; E by H at position 41; K by Q
at position 49; K by T at position 49; E by Q at position 58; E by
H at position 58; K by Q at position 70; K by T at position 70; E
by Q at position 78; E by H at position 78; K by Q at position 83;
K by T at position 83; Y by H at position 89; Y by I at position
89; E by Q at position 96; E by H at position 96; E by Q at
position 107; E by H at position 107; .beta. by S at position 109;
P by A at position 109; L by V at position 110; L by I at position
110; M by V at position 111; M by I at position 111; E by Q at
position 113; E by H at position 113; L by V at position 117; L by
I at position 117; R by H at position 120; R by Q at position 120;
K by Q at position 121; K by T at position 121; R by H at position
125; R by Q at position 125; L by V at position 128; L by I at
position 128; K by Q at position 131; K by T at position 131; E by
Q at position 132; E by H at position 132; K by Q at position 133;
K by T at position 133; K by Q at position 134; K by T at position
134; Y by H at position 135; Y by I at position 135; .beta. by S at
position 137; P by A at position 137; M by V at position 148; M by
I at position 148; R by H at position 149; R by Q at position 149;
E by Q at position 159; E by H at position 159; L by V at position
161; L by I at position 161; R by H at position 162; R by Q at
position 162; K by Q at position 164; K by T at position 164; E by
Q at position 165; and E by H at position 165.
[0228] 2. LEAD Identification
[0229] Next the specific replacing amino acids (candidate LEADs)
are systematically introduced at every specific is-HIT position to
generate a collection containing the corresponding mutant
IFN.alpha.-2b DNA molecules, as set forth in Example 2. The mutant
DNA molecules were used to produce the corresponding mutant
IFN.alpha.-2b protein molecules by transformation or transfection
into the appropriate cells. These protein mutants were assayed for
(i) protection against proteolysis, (ii) antiviral and
antiproliferation activity in vitro, (iii) pharmacokinetics in
mice. Of particular interest are mutations that increase these
activities of the IFN.alpha.-2b mutant proteins compared to
unmodified wild type IFN.alpha.-2b protein and to pegylated
derivates of the wild type protein. Based on the results obtained
from these assays, each individual IFN.alpha.-2b variant was
assigned a specific activity. Those variant proteins displaying the
highest stability and/or resistance to proteolysis were selected as
LEADs. The candidate LEADs that possessed at least as much residual
antiviral activity following protease treatment as the control,
native IFN.alpha.-2b, before protease treatment were selected as
LEADs. The results are set forth in Table 2 of Example 2.
[0230] Using this method, the following mutants selected as LEADs
are provided herein and correspond to the group of proteins
containing one or more single amino acid replacements in SEQ ID
NO:1, corresponding to: F by V at position 27; R by H at position
33; E by Q at position 41; E by H at position 41; E by Q at
position 58; E by H at position 58; E by Q at position 78; E by H
at position 78; Y by H at position 89; E by Q at position 107; E by
H at position 107; P by A at position 109; L by V at position 110;
M by Vat position 111; E by Q at position 113; E by H at position
113; L by V at position 117; L by I at position 117; K by Q at
position 121; K by T at position 121; R by H at position 125; R by
Q at position 125; K by Q at position 133; K by T at position 133;
and E by Q at position 159; E by H at position 159. Among these are
mutations that can have multiple effects. For example, among
mutations described herein, are mutations that result in an
increase of the IFN.alpha.-2b activity as assessed by detecting the
requisite biological activity.
[0231] Also provided are IFN.alpha.-2b proteins that contain a
plurality of mutations based on the LEADs (see, e.g., Tables 6 and
7, EXAMPLE 5, which lists candidate LEADs and LEAD sites), are
generated. These IFN.alpha.-2b proteins have activity that is
further optimized. Examples of such proteins are described in the
EXAMPLES. Other combinations of mutations can be prepared and
tested as described herein to identify other LEADs of interest,
particularly those that have further increased IFN.alpha.-2b
antiviral activity or further increased resistance to
proteolysis.
[0232] Also provided herein are modified IFN.alpha.-2b or
IFN.alpha.-2a cytokines selected from among proteins comprising one
or more single amino acid replacements in SEQ ID NOS:1 or 182,
corresponding to the replacement of: N by D at position 45; D by G
at position 94; G by R at position 102; A by G at position 139; or
any combination thereof. These particular proteins have also been
found herein to have increased resistance to proteolysis.
[0233] In another embodiment, IFN.alpha.-2b and IFN.alpha.-2a
proteins that contain a plurality of mutations based on the LEADs
(see Tables in the EXAMPLES, listing the candidate LEADs and LEAD
sites), are produced to produce IFN.alpha.-2b and IFN.alpha.-2a
proteins that have activity that is further optimized. Examples of
such proteins are described herein. Other combinations of mutations
can be prepared and tested as described herein to identify other
LEADs of interest, particularly those that have further increased
IFN.alpha.-2b and IFN.alpha.-2a antiviral activity or further
increased resistance to proteolysis.
[0234] 3. N-glycosylation Site Addition
[0235] In additional embodiments, N-glycosylation sites can be
added to increase resistance to proteolysis while maintaining or
improving the requisite biological activity. Exemplary
N-glycosylation mutants containing duo-amino acid replacements
corresponding to the N-X-S or N-X-T consensus sequences are set
forth in Example 3. Accordingly, provided herein are IFN.alpha.-2b
and IFN.alpha.-2a mutant proteins having an increased resistance to
proteolysis compared to unmodified IFN.alpha.-2b and IFN.alpha.-2a,
selected from among proteins comprising one or more sets of
duo-amino acid replacements in SEQ ID NO: 1, corresponding to:
[0236] D by N at position 2 and P by S at position 4; [0237] D by N
at position 2 and P by T at position 4; [0238] L by N at position 3
and Q by S at position 5; [0239] L by N at position 3 and Q by T at
position 5; [0240] P by N at position 4 and T by S at position 6;
[0241] P by N at position 4 and T by T at position 6; [0242] Q by N
at position 5 and H by S at position 7; [0243] Q by N at position 5
and H by T at position 7; [0244] T by N at position 6 and S by S at
position 8; [0245] T by N at position 6 and S by T at position 8;
[0246] H by N at position 7 and L by S at position 9; [0247] H by N
at position 7 and L by T at position 9; [0248] S by N at position 8
and G by S at position 10; [0249] S by N at position 8 and G by T
at position 10; [0250] L by N at position 9 and S by S at position
11; [0251] L by N at position 9 and S by T at position 11; [0252] M
by N at position 21 and K by S at position 23; [0253] M by N at
position 21 and K by T at position 23; [0254] R by N at position 22
and I by S at position 24; [0255] R by N at position 22 and I by T
at position 24; [0256] K or R by N at position 23 and S by S at
position 25; [0257] K or R by N at position 23 and S by T at
position 25; [0258] I by N at position 24 and L by S at position
26; [0259] I by N at position 24 and L by T at position 26; [0260]
S by N at position 25 and F by S at position 27; [0261] S by N at
position 25 and F by T at position 27; [0262] L by N at position 26
and S by S at position 28; [0263] L by N at position 26 and S by T
at position 28; [0264] S by N at position 28 and L by S at position
30; [0265] S by N at position 28 and L by T at position 30; [0266]
L by N at position 30 and D by S at position 32; [0267] L by N at
position 30 and D by T at position 32; [0268] K by N at position 31
and R by S at position 33; [0269] K by N at position 31 and R by T
at position 33; [0270] D by N at position 32 and H by S at position
34; [0271] D by N at position 32 and H by T at position 34; [0272]
R by N at position 33 and D by S at position 35; [0273] R by N at
position 33 and D by T at position 35; [0274] H by N at position 34
and F by S at position 36; [0275] H by N at position 34 and F by T
at position 36; [0276] D by N at position 35 and G by S at position
37; [0277] D by N at position 35 and G by T at position 37; [0278]
F by N at position 36 and F by S at position 38; [0279] F by N at
position 36 and F by T at position 38; [0280] G by N at position 37
and P by S at position 39; [0281] G by N at position 37 and P by T
at position 39; [0282] F by N at position 38 and Q by S at position
40; [0283] F by N at position 38 and Q by T at position 40; [0284]
P by N at position 39 and E by S at position 41; [0285] P by N at
position 39 and E by T at position 41; [0286] Q by N at position 40
and E by S at position 42; [0287] Q by N at position 40 and E by T
at position 42; [0288] E by N at position 41 and F by S at position
43; [0289] E by N at position 41 and F by T at position 43; [0290]
E by N at position 42 and G by S at position 44; [0291] E by N at
position 42 and G by T at position 44; [0292] F by N at position 43
and N by S at position 45; [0293] F by N at position 43 and N by T
at position 45; [0294] G by N at position 44 and Q by S at position
46; [0295] G by N at position 44 and Q by T at position 46; [0296]
N by N at position 45 and F by S at position 47; [0297] N by N at
position 45 and F by T at position 47; [0298] Q by N at position 46
and Q by S at position 48; [0299] Q by N at position 46 and Q by T
at position 48; [0300] F by N at position 47 and K by S at position
49; [0301] F by N at position 47 and K by T at position 49; [0302]
Q by N at position 48 and A by S at position 50; [0303] Q by N at
position 48 and A by T at position 50; [0304] K by N at position 49
and E by S at position 51; [0305] K by N at position 49 and E by T
at position 51; [0306] A by N at position 50 and T by S at position
52; [0307] A by N at position 50 and T by T at position 52; [0308]
S by N at position 68 and K by S at position 70; [0309] S by N at
position 68 and K by T at position 70; [0310] K by N at position 70
and S by S at position 72; [0311] K by N at position 70 and S by T
at position 72; [0312] A by N at position 75 and D by S at position
77; [0313] A by N at position 75 and D by T at position 77; [0314]
D by N at position 77 and T by S at position 79; [0315] D by N at
position 77 and T by T at position 79; [0316] I by N at position
100 and G by S at position 102; [0317] I by N at position 100 and G
by T at position 102; [0318] Q by N at position 101 and V by S at
position 103; [0319] Q by N at position 101 and V by T at position
103; [0320] G by N at position 102 and G by S at position 104;
[0321] G by N at position 102 and G by T at position 104; [0322] V
by N at position 103 and V by S at position 105; [0323] V by N at
position 103 and V by T at position 105; [0324] G by N at position
104 and T by S at position 106; [0325] G by N at position 104 and T
by T at position 106; [0326] V by N at position 105 and E by S at
position 107; [0327] V by N at position 105 and E by T at position
107; [0328] T by N at position 106 and T by S at position 108;
[0329] T by N at position 106 and T by T at position 108; [0330] E
by N at position 107 and P by S at position 109; [0331] E by N at
position 107 and P by T at position 109; [0332] T by N at position
108 and I by S at position 110; [0333] T by N at position 108 and I
by T at position 110; [0334] K by N at position 134 and S by S at
position 136; [0335] K by N at position 134 and S by T at position
136; [0336] S by N at position 154 and N by S at position 156;
[0337] S by N at position 154 and N by T at position 156; [0338] T
by N at position 155 and L by S at position 157; [0339] T by N at
position 155 and L by T at position 157; [0340] N by N at position
156 and Q by S at position 158; [0341] N by N at position 156 and Q
by T at position 158; [0342] L by N at position 157 and E by S at
position 159; [0343] L by N at position 157 and E by T at position
159; [0344] Q by N at position 158 and S by S at position 160;
[0345] Q by N at position 158 and S by T at position 160; [0346] E
by N at position 159 and L by S at position 161; [0347] E by N at
position 159 and L by T at position 161; [0348] S by N at position
160 and R by S at position 162; [0349] S by N at position 160 and R
by T at position 162; [0350] L by N at position 161 and S by S at
position 163; [0351] L by N at position 161 and S by T at position
163; [0352] R by N at position 162 and K by S at position 164;
[0353] R by N at position 162 and K by T at position 164; [0354] S
by N at position 163 and E by S at position 165; and [0355] S by N
at position 163 and E by T at position 165,
[0356] where residue 1 corresponds to residue 1 of the mature
IFN.alpha.-2b or IFN.alpha.-2a protein set forth in SEQ ID NO:1 or
SEQ ID NO:182, respectively. In particular embodiments, the
IFN.alpha.-2b or IFN.alpha.-2a mutant protein has increased
resistance to proteolysis compared to unmodified IFN.alpha.-2b or
IFN.alpha.-2a, and is selected from among proteins comprising one
or more sets of duo-amino acid replacements in SEQ ID NO:1,
corresponding to: [0357] Q by N at position 5 and H by S at
position 7; [0358] P by N at position 39 and E by S at position 41;
[0359] P by N at position 39 and E by T at position 41; [0360] Q by
N at position 40 and E by S at position 42; [0361] Q by N at
position 40 and E by T at position 42; [0362] E by N at position 41
and F by S at position 43; [0363] E by N at position 41 and F by T
at position 43; [0364] F by N at position 43 and N by S at position
45; [0365] G by N at position 44 and Q by T at position 46; [0366]
N by N at position 45 and F by S at position 47; [0367] N by N at
position 45 and F by T at position 47; [0368] Q by N at position 46
and Q by S at position 48; [0369] F by N at position 47 and K by S
at position 49; [0370] F by N at position 47 and K by T at position
49; [0371] I by N at position 100 and G by S at position 102;
[0372] I by N at position 100 and G by T at position 102; [0373] V
by N at position 105 and E by S at position 107; [0374] V by N at
position 105 and E by T at position 107; [0375] T by N at position
106 and T by S at position 108; [0376] T by N at position 106 and T
by T at position 108; [0377] E by N at position 107 and P by S at
position 109; [0378] E by N at position 107 and P by T at position
109; [0379] L by N at position 157 and E by S at position 159;
[0380] L by N at position 157 and E by T at position 159; [0381] E
by N at position 159 and L by S at position 161; and [0382] E by N
at position 159 and L by T at position 161. F. Protein Redesign
[0383] Provided herein are methods for designing and generating new
versions of native or modified cytokines, such as IFN.alpha.-2b and
IFN.alpha.-2a. Using these methods, 30 the redesigned cytokine
maintains either sufficient, typically equal or improved levels of
a selected phenotype, such as a biological activity, of the
original protein, while at the same time its amino acid sequence is
changed by replacement of up to: at least 1%, at least 2%, at least
3%, at least 4%, at least 5%, at least 6%, at least 7%, at least
8%, at least 9%, at least 10%, at least 12%, at least 14%, at least
16%, at least 18%, at least 20%, at least 30%, at least 40% up to
50% or more of its native amino acids by the appropriate
pseudo-wild type amino acids. Pseudo-wild type amino acids are
those amino acids such that when they replace an original, such as
native, amino acid at a given position on the protein sequence, the
resulting protein displays substantially the same levels of
biological activity (or sufficient activity for its therapeutic or
other use) compared to the original, such as native, protein. In
other embodiments, pseudo-wild type amino acids are those amino
acids such that when they replace an original, such as native,
amino acid at a given position on the protein sequence, the
resulting protein displays the same phenotype, such as levels of
biological activity, compared to an original, typically a native,
protein. Pseudo-wild type amino acids and the appropriate replacing
positions can be detected and identified by any analytical or
predictive means; such as for example, by performing an
alanine-scanning. Any other amino acid, particularly another amino
acid that has a neutral effect on structure, such as Gly or Ser,
also can be used for the scan. All those replacements of original,
such as native, amino acids by Ala that do not lead to the
generation of a HIT (a protein that has lost the desired biological
activity), have either led to the generation of a LEAD (a protein
with increased biological activity); or the replacement by Ala will
be a neutral replacement, i.e., the resulting protein will display
comparable levels of biological activity compared to the original,
such as native, protein. The methods provided herein for protein
redesign of cytokines, such as IFN.alpha.-2b and IFN.alpha.-2a, are
intended to design and generate "artificial" (versus naturally
existing) proteins, such that they consist of amino acid sequences
not existing in nature, but that display biological activities
characteristic of the original, such as native, protein. These
redesigned proteins are contemplated herein to be useful for
avoiding potential side effects that might otherwise exist in other
forms of cytokines in treatment of disease. Other uses of
redesigned proteins provided herein are to establish cross-talk
between pathways triggered by different proteins; to facilitate
structural biology by generating mutants that can be crystallized
while maintaining activity; and to destroy an activity of a protein
without changing a second activity or multiple additional
activities.
[0384] In one embodiment, a method for obtaining redesigned
proteins includes i) identifying some or all possible target sites
on the protein sequence that are susceptible to amino acid
replacement without losing protein activity (protein activity in a
largest sense of the term: enzymatic, binding, hormone, etc.)
(These sites are the pseudo-wild type, .psi.-wt sites); ii)
identifying appropriate replacing amino acids (.psi.-wt amino
acids), specific for each .psi.-wt site, such that if used to
replace the native amino acids at that specific .psi.-wt site, they
can be expected to generate a protein with comparable biological
activity compared to the original, such as native, protein, thus
keeping the biological activity of the protein substantially
unchanged; iii) systematically introducing the specific .psi.-wt
amino acids at every specific .psi.-wt position so as to generate a
collection containing the corresponding mutant molecules. Mutants
are generated, produced and phenotypically characterized
one-by-one, in addressable arrays, such that each mutant molecule
contains initially amino acid replacements at only one .psi.-wt
site. In subsequent rounds mutant molecules also can be generated
such that they contain one or more .psi.-wt amino acids at one or
more .psi.-wt sites. Those mutant proteins carrying several
mutations at a number of .psi.-wt sites, and that display
comparable or improved biological activity are called redesigned
proteins or .psi.-wt proteins. In particular embodiments, at least
1%, at least 2%, at least 3%, at least 4%, at least 5%, at least
6%, at least 7%, at least 8%, at least 9%, at least 10%, at least
15%, at least 20%, at least 25%, or more of the amino acid residue
positions on a particular cytokine, such as IFN.alpha.-2b and
IFN.alpha.-2a are replaced with an appropriate pseudo-wild type
amino acid.
[0385] The first step is an amino acid scan over the full length of
the protein. At this step, each and every one of the amino acids in
the protein sequence is replaced by a selected reference amino
acid, such as alanine. This permits the identification of
"redesign-HIT" positions, i.e., positions that are sensitive to
amino acid replacement. All of the other positions that are not
redesign-HIT positions (i.e., those at which the replacement of the
original, such as native, amino acid by the replacing amino acid,
for example Ala, does not lead to a drop in protein fitness or
biological activity) are referred to herein as "pseudo-wild type"
positions. When the replacing amino acid, for example Ala, replaces
the original, such as native, amino acid at a non-HIT position,
then the replacement is neutral, in terms of protein activity, and
the replacing amino acid is said to be a pseudo-wild type amino
acid at that position. Pseudo-wild type positions appear to be less
sensitive than redesign-HIT positions since they tolerate the amino
acid replacement without affecting the protein activity that is
being either maintained or improved. Amino acid replacement at the
pseudo-wild type positions, result in a non-change in the protein
fitness (e.g., possess substantially the same biological activity),
while at the same time to a divergence in the resulting protein
sequence compared to the original, such as native, sequence.
[0386] To first identify those amino acid positions on the
IFN.alpha.-2b and IFN.alpha.-2a protein that are involved or not
involved in IFN.alpha.-2b and IFN.alpha.-2a protein activity, such
as binding activity of IFN.alpha.-2b and IFN.alpha.-2a to its
receptor, an Ala-scan was performed on the IFN.alpha.-2b sequence
as set forth in Example 4. For this purpose, each amino acid in the
IFN.alpha.-2b protein sequence was individually changed to Alanine.
Any other amino acid, particularly another amino acid that has a
neutral effect on structure, such as Gly or Ser, also can be used.
Each resulting mutant IFN.alpha.-2b protein was then expressed and
the activity of the interferon molecule was then assayed. These
particular amino acid positions, referred to herein as HITs would
in principle not be suitable targets for amino acid replacement to
increase protein stability, because of their involvement in the
recognition of IFN-receptor or in the downstream pathways involved
in IFN activity. For the Ala-scanning, the biological activity
measured for the IFN.alpha.-2b molecules was: i) their capacity to
inhibit virus replication when added to permissive cells previously
infected with the appropriate virus and, ii) their capacity to
stimulate cell proliferation when added to the appropriate cells.
The relative activity of each individual mutant compared to the
native protein is indicated in FIG. 10A through C. HITs are those
mutants that produce a decrease in the activity of the protein (in
the example: all the mutants with activities below about 30% of the
native activity.
[0387] In addition, the alanine-scan was used to identify the amino
acid residues on IFN.alpha.-2b that when replaced with alanine
correspond to "pseudo-wild type" activity, i.e., those that can be
replaced by alanine without leading to a decrease in biological
activity. Knowledge of these amino acids is useful for the
re-design of the IFN.alpha.-2b and IFN.alpha.-2a proteins. The
results are set forth in Table 5, and include pseudo-wild type
amino acid positions of IFN.alpha.-2b corresponding to SEQ ID NO:1,
amino acid residues: 9, 10, 17, 20, 24, 25, 35, 37, 41, 52, 54, 56,
57, 58, 60, 63, 64, 65, 76, 89, and 90.
[0388] Accordingly, provided herein are IFN.alpha.-2b and
IFN.alpha.-2a mutant proteins comprising one or more pseudo-wild
type mutations at amino acid positions of IFN.alpha.-2b or
IFN.alpha.-2a corresponding to SEQ ID NO:1 or SEQ ID NO:182,
respectively, amino acid residues: 9, 10, 17, 20, 24, 25, 35, 37,
41, 52, 54, 56, 57, 58, 60, 63, 64, 65, 76, 89, and 90. The
mutations can be either one or more of insertions, deletions and/or
replacements of the native amino acid residue(s). In one
embodiment, the pseudo-wild type replacements are mutations with
alanine at each position. In another embodiment, the pseudo-wild
type replacements are one or more mutations in SEQ ID NO:1
corresponding to:
[0389] L by A at position 9, L by A at position 17,
[0390] Q by A at position 20, I by A at position 24,
[0391] S by A at position 25, D by A at position 35,
[0392] G by A at position 37, E by A at position 41,
[0393] T by A at position 52, P by A at position 54,
[0394] L by A at position 56, H by A at position 57,
[0395] E by A at position 58, I by A at position 60,
[0396] I by A at position 63, F by A at position 64,
[0397] N by A at position 65, W by A at position 76,
[0398] Y by A at position 89, and Q by A at position 90.
[0399] In addition, the IFN.alpha.-2b alanine scan revealed the
following redesign-HITs having decreased antiviral activity at
amino acid positions of IFN.alpha.-2b corresponding to SEQ ID NO:1,
amino acid residues: 2, 7, 8, 11, 13, 15, 16, 23, 26, 28, 29, 30,
31, 32, 33, 53, 69, 91, 93, 98, and 101. Accordingly, in particular
embodiments where it is desired to decrease the anti-viral activity
of IFN.alpha.-2b or IFN.alpha.-2a, either one or more of
insertions, deletions and/or replacements of the native amino acid
residue(s) can be carried out at one or more of amino acid
positions of IFN.alpha.-2b or IFN.alpha.-2a corresponding to SEQ ID
NO:1, amino acid residues: 2, 7, 8, 11, 13, 15, 16, 23, 26, 28, 29,
30, 31, 32, 33, 53, 69, 91, 93, 98, and 101.
[0400] Each of the redesign mutations set forth above can be
combined with one or more of the IFN.alpha.-2b or IFN.alpha.-2a
candidate LEAD mutations or one or more of the IFN.alpha.-2b or
IFN.alpha.-2a LEAD mutants provided herein.
G. 3D-Scanning and Its Use for Modifying Cytokines
[0401] Also provided herein is a method of structural homology
analysis for comparing proteins regardless of their underlying
amino acid sequences. For a subset of proteins families, such as
the family of human cytokines, this information is rationally
exploited to produce modified proteins. This method of structural
homology analysis can be applied to proteins that are evolved by
any method, including the 2D scanning method described herein. When
used with the 2D method in which a particular phenotype, activity
or characteristic of a protein is modified by 2D analysis, the
method is referred to as 3D-scanning.
[0402] The use of "structural homology" analysis in combination
with the directed evolution methods provided herein provides a
powerful technique for identifying and producing various new
protein mutants, such as cytokines, having desired biological
activities, such as increased resistance to proteolysis. For
example, the analysis of the "structural homology" between an
optimized mutant version of a given protein and "structurally
homologous" proteins allows identification of the corresponding
structurally related or structurally similar amino acid positions
(also referred to herein as "structurally homologous loci") on
other proteins. This permits identification of mutant versions of
the latter that have a desired optimized feature(s) (biological
activity, phenotype) in a simple, rapid and predictive manner
(regardless of amino acid sequence and sequence homology). Once a
mutant version of a protein is developed, then, by applying the
rules of structural homology, the corresponding structurally
related amino acid positions (and replacing amino acids) on other
"structurally homologous" proteins readily are identified, thus
allowing a rapid and predictive discovery of the appropriate mutant
versions for the new proteins.
[0403] 3-dimensionally structurally equivalent or similar amino
acid positions that are located on two or more different protein
sequences that share a certain degree of structural homology, have
comparable functional tasks (activities and phenotypes). These two
amino acids that occupy substantially equivalent 3-dimensional
structural space within their respective proteins than can be said
to be "structurally similar" or "structurally related" with each
other, even if their precise positions on the amino acid sequences,
when these sequences are aligned, do not match with each other. The
two amino acids also are said to occupy "structurally homologous
loci." "Structural homology" does not take into account the
underlying amino acid sequence and solely compares 3-dimensional
structures of proteins. Thus, two proteins can be said to have some
degree of structural homology whenever they share conformational
regions or domains showing comparable structures or shapes with
3-dimensional overlapping in space. Two proteins can be said to
have a higher degree of structural homology whenever they share a
higher amount of conformational regions or domains showing
comparable structures or shapes with 3-dimensional overlapping in
space. Amino acids positions on one or more proteins that are
"structurally homologous" can be relatively far way from each other
in the protein sequences, when these sequences are aligned
following the rules of primary sequence homology. Thus, when two or
more protein backbones are determined to be structurally
homologous, the amino acid residues that are coincident upon
three-dimensional structural superposition are referred to as
"structurally similar" or "structurally related" amino acid
residues in structurally homologous proteins (also referred to as
"structurally homologous loci"). Structurally similar amino acid
residues are located in substantially equivalent spatial positions
in structurally homologous proteins.
[0404] For example, for proteins of average size (approximately 180
residues), two structures with a similar fold will usually display
rms deviations not exceeding 3 to 4 angstroms. For example,
structurally similar or structurally related amino acid residues
can have backbone positions less than 3.5, 3.0, 2.5, 2.0, 1.7 or
1.5 angstrom from each other upon protein superposition. RMS
deviation calculations and protein superposition can be carried out
using any of a number of methods known in the art. For example,
protein superposition and RMS deviation calculations can be carried
out using all peptide backbone atoms (e.g., N, C, C(C.dbd.O), O and
CA (when present)). As another example, protein superposition can
be carried out using just one or any combination of peptide
backbone atoms, such as, for example, N, C, C(C.dbd.O), O and CA
(when present). In addition, one skilled in the art will recognize
that protein superposition and RMS deviation calculations generally
can be performed on only a subset of the entire protein structure.
For example, if the protein superposition is carried out using one
protein that has many more amino acid residues than another
protein, protein superposition can be carried out on the subset
(e.g., a domain) of the larger protein that adopts a structure
similar to the smaller protein. Similarly, only portions of other
proteins can be suitable for superimposition. For example, if the
position of the C-terminal residues from two structurally
homologous proteins differ significantly, the C-terminal residues
can be omitted from the structural superposition or RMS deviation
calculations.
[0405] Accordingly, provided herein are methods of rational
evolution of proteins based on the identification of potential
target sites for mutagenesis (is-HITs) through comparison of
patterns of protein backbone folding between structurally related
proteins, irrespective of the underlying sequences of the compared
proteins. Once the structurally related amino acid positions are
identified on the new protein, then suitable amino acid replacement
criteria, such as PAM analysis, can be employed to identify
candidate LEADs for construction and screening as described
herein.
[0406] For example, analysis of "structural homology" between and
among a number of related cytokines was used to identify on various
members of the cytokine family, other than interferon alpha, those
amino acid positions and residues that are structurally similar or
structurally related to those found in the IFN.alpha.-2b mutants
provided herein that have been optimized for improved stability.
The resulting modified cytokines are provided. This method can be
applied to any desired phenotype using any protein, such as a
cytokine, as the starting material to which an evolution procedure,
such as the rational directed evolution procedure of U.S.
application Ser. No. 10/022,249 or the 2-dimensional scanning
method provided herein, is applied. The structurally corresponding
residues are then altered on members of the family to produce
additional cytokines with similar phenotypic alterations.
[0407] 1. Homology
[0408] Typically, homology between proteins is compared at the
level of their amino acid sequences, based on the percent or level
of coincidence of individual amino acids, amino acid per amino
acid, when sequences are aligned starting from a reference,
generally the residue encoded by the start codon. For example, two
proteins are said to be "homologous" or to bear some degree of
homology whenever their respective amino acid sequences show a
certain degree of matching upon alignment comparison. Comparative
molecular biology is primarily based on this approach. From the
degree of homology or coincidence between amino acid sequences,
conclusions can be made on the evolutionary distance between or
among two or more protein sequences and biological systems.
[0409] The concept of "convergent evolution" is applied to describe
the phenomena by which phylogenetically unrelated organisms or
biological systems have evolved to share features related to their
anatomy, physiology and structure as a response to common forces,
constraints, and evolutionary demands from the surrounding
environment and living organisms. Alternatively, "divergent
evolution," is applied to describe the phenomena by which strongly
phylogenetically related organisms or biological systems have
evolved to diverge from identity or similarity as a response to
divergent forces, constraints, and evolutionary demands from the
surrounding environment and living organisms.
[0410] In the typical traditional analysis of homologous proteins
there are two conceptual biases corresponding to: i) "convergent
evolution," and ii) "divergent evolution." Whenever the aligned
amino acid sequences of two proteins do not match well with each
other, these proteins are considered "not related" or "less
related" with each other and have different phylogenetic origins.
There is no (or low) homology between these proteins and their
respective genes are not homologous (or show little homology). If
these two "non-homologous" proteins under study share some common
functional features (e.g., interaction with other specific
molecules, activity), they are determined to have arisen by
"convergent evolution," i.e., by evolution of their non-homologous
amino acid sequences, in such a way that they end up generating
functionally "related" structures.
[0411] On the other hand, whenever the aligned amino acid sequences
of two proteins do match with each other to a certain degree, these
proteins are considered to be "related" and to share a common
phylogenetic origin. A given degree of homology is assigned between
these two proteins and their respective genes likewise share a
corresponding degree of homology. During the evolution of their
initial highly homologous amino acid sequence, enough changes can
be accumulated in such a way that they end up generating
"less-related" sequences and less related function. The divergence
from perfect matching between these two "homologous" proteins under
study is said come from "divergent evolution."
[0412] 2. 3D-Scanning (Structural Homology) Methods
[0413] Structural homology refers to homology between the topology
and three-dimensional structure of two proteins. Structural
homology is not necessarily related to "convergent evolution" or to
"divergent evolution," nor is it related to the underlying amino
acid sequence. Rather, structural homology is likely driven
(through natural evolution) by the need of a protein to fit
specific conformational demands imposed by its environment.
Particular structurally homologous "spots" or "loci" would not be
allowed to structurally diverge from the original structure, even
when its own underlying sequence does diverge. This structural
homology is exploited herein to identify loci for mutation.
[0414] Within the amino acid sequence of a protein resides the
appropriate biochemical and structural signals to achieve a
specific spatial folding in either an independent or a
chaperon-assisted manner. Indeed, this specific spatial folding
ultimately determines protein traits and activity. Proteins
interact with other proteins and molecules in general through their
specific topologies and spatial conformations. In principle, these
interactions are not based solely on the precise amino acid
sequence underlying the involved topology or conformation. If
protein traits, activity (behavior and phenotypes) and interactions
rely on protein topology and conformation, then evolutionary forces
and constraints acting on proteins can be expected to act on
topology and conformation. Proteins sharing similar functions will
share comparable characteristics in their topology and
conformation, despite the underlying amino acid sequences that
create those topologies and conformations.
[0415] 3. Application of the 3D-Scanning Methods to Cytokines
[0416] The method based on structural homology, including the
3D-scanning method provided herein can be applied to any related
proteins. For exemplary purposes herein it is applied to cytokines.
In exemplary embodiments, methods for altering phenotypes of
members of families of cytokines by altering one member such as by
employing the 2-dimensional rational scanning method are provided.
As provided herein, other members of these cytokine families then
can be similarly modified by identifying and changing structurally
homologous residues to similarly alter the phenotypes of such
proteins.
[0417] In an exemplary embodiment herein, IFN.alpha.-2b mutants
with increased resistance to proteolysis are generated by the
2-dimensional rational scanning method; IFN.beta. mutants also were
generated. The corresponding residues on members of cytokine
families that possess structural homology to IFN.alpha.-2b were
identified and the identified residues on the other cytokines were
similarly modified to produce cytokines with increased resistance
to proteolysis. Hence also provided herein are cytokine mutants
that display increased resistance to proteolysis and/or glomerular
filtration containing one or more amino acid replacements.
[0418] Provided herein are mutant (modified) cytokines that display
altered features and properties, such as a resistance to
proteolysis. Methods for producing such modified cytokines also are
provided.
[0419] Also provided herein is a method of structural homology
analysis for comparing proteins regardless their underlying amino
acid sequences. For a subset of proteins families, such as the
family of human cytokines, this information is rationally exploited
herein. Human cytokines all share a common helix bundle fold, which
is used to structurally define the 4-helical cytokine superfamily
in the structural classification of the protein database
SCOP.COPYRGT. (Structural Classification of Proteins; see, e.g.,
Murzin et al., J. Mol. Biol., 247:536-540, 1995 and
"scop.mrc-lmb.cam.ac.uk/scop/"). This superfamily includes three
different families: 1) the interferons/interleukin-10 protein
family (SEQ ID NOS: 1 and 182-200); 2) the long-chain cytokine
family (SEQ ID NOS: 210-217); and 3) the short-chain cytokine
family (SEQ ID NOS: 201-209).
[0420] For example, a distinct feature of cytokines from the
interferons/interleukin-10 family is an additional (fifth) helix.
This family includes interleukin-10 (IL-10; SEQ ID NO:200,
interferon beta (IFN.beta.; SEQ ID NO: 196), interferon alpha-2a
(IFN.alpha.-2a; SEQ ID NO: 182), interferon alpha-2b
(IFN.alpha.-2b; SEQ ID NO:1), and interferon gamma (IFN-.gamma.;
SEQ ID NO: 199). The long-chain cytokine protein family includes,
among others, granulocyte colony stimulating factor (G-CSF; SEQ ID
NO: 210), leukemia inhibitory factor (LIF; SEQ ID NO: 213), growth
hormone (hGH; SEQ ID NO: 216), ciliary neurotrophic factor (CNTF;
SEQ ID NO: 212), leptin (SEQ ID NO: 211), oncostatin M (SEQ ID NO:
214), interleukin-6 (IL-6; SEQ ID NO: 217) and interleukin-12
(IL-12; SEQ ID NO: 215). The short-chain cytokine protein family
includes, among others, erythropoietin (EPO; SEQ ID NO: 201),
granulocyte-macrophage colony stimulating factor (GM-CSF; SEQ ID
NO: 202), interleukin-2 (IL-2; SEQ ID NO: 204), interleukin-3
(IL-3; SEQ ID NO: 205), interleukin-4 (IL-4; SEQ ID NO: 207),
interleukin-5 (IL-5; SEQ ID NO: 208), interleukin-13 (IL-13; SEQ ID
NO: 209), Flt3 ligand (SEQ ID NO: 203) and stem cell factor (SCF;
SEQ ID NO: 206).
[0421] Although the degree of similarity among the underlying amino
acid sequences of these cytokines does not appear high, their
corresponding 3-dimensional structures present a high level of
similarity (see, e.g., FIGS. 8B through D). Effectively, the best
structural similarity is obtained between two 3-dimensional protein
structures of the same family in the 4-helical cytokine
superfamily.
[0422] The methods provided herein for producing mutant cytokines
are exemplified with reference to production of cytokines that
display a substantially equivalent increase in resistance to
proteolysis relative to the optimized IFN.alpha.-2b mutants. It is
understood that this method can be applied to other families of
proteins and for other phenotypes.
[0423] In one embodiment, proteins of the 4-helical cytokine
superfamily are provided herein that are structurally homologous
IFN.alpha.-2b LEAD mutants set forth herein. For example, by virtue
of the knowledge of the 3-dimensional structural amino acid
positions within the LEAD IFN.alpha.-2b mutants provided herein
that confer higher resistance to a challenge with either proteases
or blood lysate or serum, while maintaining or improving the
requisite biological activity, the corresponding structurally
related (e.g., structurally similar) amino acid residues on a
variety of other cytokines are identified (FIG. 9).
[0424] Numerous methods are well known in the art for identifying
structurally related amino acid positions with 3-dimensionally
structurally homologous proteins. Exemplary methods include, but
are not limited to: CATH (Class, Architecture, Topology and
Homologous superfamily) which is a hierarchical classification of
protein domain structures based on four different levels (Orengo et
al., Structure, 5(8):1093-1108 (1997)); CE (Combinatorial Extension
of the optimal path), which is a method that calculates pairwise
structure alignments (Shindyalov et al., Protein Engineering,
11(9):739-747 (1998)); FSSP (Fold classification based on
Structure-Structure alignment of Proteins), which is a database
based on the complete comparison of all 3-dimensional protein
structures that currently reside in the Protein Data Bank (PDB)
(Holm et al., Science, 273:595-602 (1996)); SCOP.RTM. (Structural
Classification of Proteins), which provides a descriptive database
based on the structural and evolutionary relationships between all
proteins whose structure is known (Murzin et al., J. Mol. Biol.,
247:536-540 (1995)); and VAST (Vector Alignment Search Tool), which
compares newly determined 3-dimensional protein structure
coordinates to those found in the MMDB/PDB database (Gibrat et al.,
Current Opinion in Structural Biology, 6:377-385 (1995)).
[0425] In an exemplary embodiment, the step-by-step process
including the use of a program referred to as TOP (see FIG. 8A and
Lu, G., J Appl. Cryst., 33:176-189 (2000)); publicly available, for
example, at bioinfo1.mbfys.lu.se/TOP is used for protein structure
comparison. This program runs two steps for each protein structure
comparison. In the first step topology of secondary structure in
the two structures is compared. The program uses two points to
represent each secondary structure element (alpha helices or beta
strands) then systematically searches all the possible
super-positions of these elements in 3-dimensional space (defined
as the root mean square deviation-rmsd, the angle between the two
lines formed by the two points and the line-line distance). The
program searches to determine whether additional secondary
structure elements can fit by the same superposition operation. If
secondary structures that can fit each other exceed a given number,
the program identifies the two structures as similar. The program
gives as an output a comparison score called "Structural Diversity"
that considers the distance between matched .alpha.-carbon atoms
and the number of matched residues. The lower the "Structural
Diversity" score, the more the two structures are similar. In
various embodiments herein, the Structural Diversity scores range
from 0 up to about 67.
[0426] In the exemplified embodiment, all the cytokines were first
structurally aligned against the IFN.alpha.-2b structure. For the
proteins within the same family as IFN.alpha.-2b (e.g., the
interferons/interleukin-10 cytokine family), this alignment was
directly used to identify the structurally related is-HIT target
amino acid positions and/or regions corresponding to the
structurally homologous positions and/or regions on IFN.alpha.-2b
where LEAD mutants were found (FIG. 8B). For the other cytokines,
the protein of the family (either long- or short-chain cytokines)
with the best 3-dimensional structural alignment with IFN.alpha.-2b
was selected using the lowest "Structural Diversity" score as the
representative for that family. From the short-chain cytokine
protein family, erythropoietin (EPO; see FIG. 8C) was identified as
the best structural homologue of IFN.alpha.-2b (rmsd=1.9 angstroms;
number of aligned residues=62; Structural Diversity=13.8). From the
long-chain cytokine protein family, granulocyte-colony stimulating
factor (G-CSF; see FIG. 8D) was identified as the best structural
homologue of IFN.alpha.-2b (rmsd=1.7 angstroms; number of aligned
residues=77; Structural Diversity=7.8).
[0427] Next, the amino acid positions and/or regions corresponding
to the LEAD mutant regions on IFN.alpha.-2b were identified on
these two proteins. These two best structural homologues of
IFN.alpha.-2b (e.g., EPO and G-CSF; see FIGS. 12L and 12E,
respectively) were structurally aligned to each of the other
cytokines within their respective cytokine protein families. As a
result, protein regions likely to be targets for serum protease
resistance were identified on all cytokines (see FIGS. 12A through
T). Amino acids in these target regions were then checked for their
exposure to the solvent and their susceptibility to be protease
substrate. Exposed and substrate residues are then subjected to
PAM250 analysis as set forth above, so that a group of
non-substrate and functionally conservative amino acid residues are
selected as replacements. The results of the above structural
homology analysis for each of the cytokines provided herein are set
forth in FIGS. 12A through T.
[0428] Accordingly, provided herein are modified cytokines that
exhibit greater resistance to proteolysis compared to the
unmodified cytokine protein, comprising one or more amino acid
replacements at one or more target positions on the cytokine
corresponding to a structurally-related modified amino acid
position within the 3-dimensional structure of an IFN.alpha.-2b
modified protein provided herein. The resistance to proteolysis can
be measured by mixing it with a protease in vitro, incubation with
blood or incubation with serum. Also provided herein are cytokine
structural homologues of an IFN.alpha.-2b modified protein provided
herein, comprising one or more amino acid replacements in the
cytokine structural homologue at positions corresponding to the
3-dimensional-structurally-similar modified positions within the
3-dimensional structure of the modified IFN.alpha.-2b. In one
embodiment, the cytokine homologue has increased resistance to
proteolysis compared to its unmodified and/or wild type cytokine
counterpart. Resistance to proteolysis can be measured by mixture
with a protease in vitro, incubation with blood, or incubation with
serum.
a. Structurally Homologous Interferon Mutants
[0429] Also provided herein are modified cytokines or cytokine
structural homologues of IFN.alpha.-2b that are IFN.alpha.
cytokines. These IFN.alpha. cytokines include, but are not limited
to, IFN.alpha.-2a, IFN.alpha.-c, IFN.alpha.-2c, IFN.alpha.-d,
IFN.alpha.-5, IFN.alpha.-6, IFN.alpha.-4, IFN.alpha.-4b,
IFN.alpha.-1, IFN.alpha.-J, IFN.alpha.-H, IFN.alpha.-F,
IFN.alpha.-8 and IFN.alpha.-consensus cytokine (see, SEQ ID No.
232). Accordingly, among the modified IFN.alpha. cytokines provided
herein are those with one or more amino acid replacements at one or
more target positions in either IFN.alpha.-2a, IFN.alpha.-c,
IFN.alpha.-2c, IFN.alpha.-d, IFN.alpha.-5, IFN.alpha.-6,
IFN.alpha.-4, IFN.alpha.-4b, IFN.alpha.-I, IFN.alpha.-J,
IFN.alpha.-H, IFN.alpha.-F, IFN.alpha.-8, or IFN.alpha.-consensus
cytokine corresponding to a structurally-related modified amino
acid position within the 3-dimensional structure of the
IFN.alpha.-2b modified proteins provided herein. The replacements
lead to greater resistance to proteases, as assessed by incubation
with a protease or a with a blood lysate or by incubation with
serum, compared to the unmodified IFN.alpha.-2a.
[0430] In particular embodiments, the modified IFN.alpha. cytokines
are selected from among:
[0431] the modified IFN.alpha.-2a that is human and is selected
from among proteins comprising one or more single amino acid
replacements in SEQ ID NO: 182, corresponding to amino acid
positions: 41, 58, 78, 107, 117, 125, 133 and 159;
[0432] the modified IFN.alpha.-c that is human and is selected from
among proteins comprising one or more single amino acid
replacements in SEQ ID NO: 183, corresponding to amino acid
positions: 41, 59, 79, 108, 118, 126, 134 and 160;
[0433] the modified IFN.alpha.-2c cytokine that is human and is
selected from among cytokines comprising one or more single amino
acid replacements in SEQ ID NO: 185, corresponding to amino acid
positions: 41, 58, 78, 107, 117, 125, 133 and 159;
[0434] the IFN.alpha.-d modified protein that is human and is
selected from among proteins comprising one or more single amino
acid replacements in SEQ ID NO: 186, corresponding to amino acid
positions: 41, 59, 79, 108, 118, 126, 134 and 160;
[0435] the IFN.alpha.-5 modified protein that is human and is
selected from among proteins comprising one or more single amino
acid replacements in SEQ ID NO: 187, corresponding to amino acid
positions: 41, 59, 79, 108, 118, 126, 134 and 160;
[0436] the IFN.alpha.-6 modified protein that is human and is
selected from among proteins comprising one or more single amino
acid replacements in SEQ ID NO: 188, corresponding to amino acid
positions: 41, 59, 79, 108, 118, 126, 134 and 160;
[0437] the IFN.alpha.-4 modified protein that is human and is
selected from among proteins comprising one or more single amino
acid replacements in SEQ ID NO: 189, corresponding to amino acid
positions: 41, 59, 79, 108, 118, 126, 134 and 160;
[0438] the IFN.alpha.-4b modified protein that is human and is
selected from among proteins comprising one or more single amino
acid replacements in SEQ ID NO: 190, corresponding to amino acid
positions: 41, 59, 79, 108, 118, 126, 134 and 160;
[0439] the IFN.alpha.-I modified protein that is human and is
selected from among proteins comprising one or more single amino
acid replacements in SEQ ID NO: 191, corresponding to amino acid
positions: 41, 59, 79, 108, 118, 126, 134 and 160;
[0440] the IFN.alpha.-J modified protein that is human and is
selected from among proteins comprising one or more single amino
acid replacements in SEQ ID NO: 192, corresponding to amino acid
positions: 41, 59, 79, 108, 118, 126, 134 and 160;
[0441] the IFN.alpha.-H modified protein that is human and is
selected from among proteins comprising one or more single amino
acid replacements in SEQ ID NO: 193, corresponding to amino acid
positions: 41, 59, 79, 108, 118, 126, 134 and 160;
[0442] the IFN.alpha.-F modified protein that is human and is
selected from among proteins comprising one or more single amino
acid replacements in SEQ ID NO: 194, corresponding to amino acid
positions: 41, 59, 79, 108, 118, 126, 134 and 160;
[0443] the IFN.alpha.-8 modified protein that is human and is
selected from among proteins comprising one or more single amino
acid replacements in SEQ ID NO: 195, corresponding to amino acid
positions: 41, 59, 79, 108, 118, 126, 134 and 160; and
[0444] the IFN.alpha.-consensus modified protein that is human and
is selected from among proteins that contain one or more single
amino acid replacements in SEQ ID NO: 232, corresponding to amino
acid positions: 41, 58, 78, 107, 117, 125, 133 and 159.
b. Structurally Homologous Cytokine Mutants
[0445] As set forth above, provided herein are modified cytokines
that contain one or more amino acid replacements at one or more
target positions in either interleukin-10 (IL-10), interferon beta
(IFN.beta.), IFN.beta.-1, IFN.beta.-2a, interferon gamma
(IFN-.gamma.), granulocyte colony stimulating factor (G-CSF), and
human erythropoietin (EPO); corresponding to a structurally-related
modified amino acid position within the 3-dimensional structure of
the IFN.alpha.-2b modified proteins provided herein. The
replacements lead to greater resistance to proteases, as assessed
by incubation with a protease or a with a blood lysate or by
incubation with serum, compared to the unmodified cytokine.
[0446] Also provided herein are modified cytokines that contain one
or more amino acid replacements at one or more target positions in
either granulocyte-macrophage colony stimulating factor (GM-CSF),
interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4),
interleukin-5 (IL-5), interleukin-13 (IL-13), Flt3 ligand and stem
cell factor (SCF); corresponding to a structurally-related modified
amino acid position within the 3-dimensional structure of the human
EPO modified proteins provided herein. The replacements lead to
greater resistance to proteases, as assessed by incubation with a
protease or a with a blood lysate or by incubation with serum,
compared to the unmodified cytokine.
[0447] Also provided herein are modified cytokines that contain one
or more amino acid replacements at one or more target positions in
either interleukin-10 (IL-10), interferon beta (IFN.beta.),
interferon gamma (IFN-.gamma.), human granulocyte colony
stimulating factor (G-CSF), leukemia inhibitory factor (LIF), human
growth hormone (hGH), ciliary neurotrophic factor (CNTF), leptin,
oncostatin M, interleukin-6 (IL-6) and interleukin-12 (IL-12);
corresponding to a structurally-related modified amino acid
position within the 3-dimensional structure of the human G-CSF
modified proteins provided herein. The replacements lead to greater
resistance to proteases, as assessed by incubation with a protease
or a with a blood lysate or by incubation with serum, compared to
the unmodified cytokine.
[0448] In particular embodiments, the modified cytokines are
selected from the following:
[0449] A modified IFN.beta. cytokine, comprising mutations at one
or more amino acid residues of IFN.beta. corresponding to SEQ ID
NO: 196: 39, 42, 45, 47, 52, 67, 71, 73, 81, 107, 108, 109, 110,
111, 113, 116, 120, 123, 124, 128, 130, 134, 136, 137, 163 and 165.
The mutations include insertions, deletions and replacements of the
native amino acid residue(s). In particular embodiments, the
replacements are selected from among amino acid substitutions in
SEQ ID NO: 196 set forth in FIG. 12A corresponding to SEQ ID NOS:
233-289, where the first amino acid indicated is substituted by the
second at the position indicated for all of the substitutions set
forth in FIG. 12A through T.
[0450] A modified IFN-gamma cytokine, comprising mutations at one
or more amino acid residues of IFN-gamma corresponding to SEQ ID
NO: 199: 33, 37, 40, 41, 42, 58, 61, 64, 65 and 66. The mutations
include insertions, deletions and replacements of the native amino
acid residue(s). In particular embodiments, the replacements are
selected from among amino acid substitutions in SEQ ID NO:199 set
forth in FIG. 12B corresponding to SEQ ID NOS: 290-311.
[0451] A modified IL-10 cytokine, comprising mutations at one or
more amino acid residues of IL-10 corresponding to SEQ ID NO:200:
49, 50, 52, 53, 54, 55, 56, 57, 59, 60, 67, 68, 71, 72, 74, 75, 78,
81, 84, 85, 86, and 88. The mutations include insertions, deletions
and replacements of the native amino acid residue(s). In exemplary
embodiments, replacements are selected from among amino acid
substitutions in SEQ ID NO:200 set forth in FIG. 12C corresponding
to SEQ ID NOS: 312-361.
[0452] A modified erythropoietin cytokine, comprising mutations at
one or more amino acid residues of erythropoietin corresponding to
SEQ ID NO:201: 43, 45, 48, 49, 52, 53, 55, 72, 75, 76, 123, 129,
130, 131, 162, and 165. The mutations include insertions, deletions
and replacements of the native amino acid residue(s). In exemplary
embodiments, the replacements are selected from among amino acid
substitutions in SEQ ID NO: 201 set forth in FIG. 12L corresponding
to SEQ ID NOS: 940-977.
[0453] A modified GM-CSF cytokine, comprising mutations at one or
more amino acid residues of GM-CSF corresponding to SEQ ID NO: 202:
38, 41, 45, 46, 48, 49, 51, 60, 63, 67, 92, 93, 119, 120, 123, and
124. The mutations include insertions, deletions and replacements
of the native amino acid residue(s). In exemplary embodiments, the
replacements are selected from among amino acid substitutions in
SEQ ID NO: 202 set forth in FIG. 12N corresponding to SEQ ID NOS:
362-400.
[0454] A modified Flt3 ligand cytokine, comprising mutations at one
or more amino acid residues of Flt3 ligand corresponding to SEQ ID
NO: 203: 3, 40, 42, 43, 55, 58, 59, 61, 89, 90, 91, 95, and 96. The
mutations include insertions, deletions and replacements of the
native amino acid residue(s). In exemplary embodiments, the
replacements are selected from among amino acid substitutions in
SEQ ID NO: 203 set forth in FIG. 12M corresponding to SEQ ID NOS:
401-428.
[0455] A modified IL-2 cytokine, comprising mutations at one or
more amino acid residues of IL-2 corresponding to SEQ ID NO: 204 at
positions 43, 45, 48, 49, 52, 53, 60, 61, 65, 67, 68, 72, 100, 103,
104, 106, 107, 109, 110, and 132. The mutations include insertions,
deletions and replacements of the native amino acid residue(s). In
exemplary embodiments, the replacements are selected from among
amino acid substitutions in SEQ ID NO: 204 set forth in FIG. 12P
and SEQ ID NOS: 429-476.
[0456] A modified IL-3 cytokine, comprising mutations at one or
more amino acid residues of IL-3 corresponding to SEQ ID NO: 205:
37, 43, 46, 59, 63, 66, 96, 100, 101, and 103. The mutations
include insertions, deletions and replacements of the native amino
acid residue(s). In exemplary embodiments, the replacements are
selected from among amino acid substitutions in SEQ ID NO:205 set
forth in FIG. 12Q corresponding to SEQ ID NOS: 477-498.
[0457] A modified SCF cytokine, comprising mutations at one or more
amino acid residues of SCF corresponding to SEQ ID NO: 206: 27, 31,
34, 37, 54, 58, 61, 62, 63, 96, 98, 99, 100, 102, 103, 106, 107,
108, 109, 134, and 137. The mutations include insertions, deletions
and replacements of the native amino acid residue(s). In exemplary
embodiments, the replacements are selected from among amino acid
substitutions in SEQ ID NO: 206 set forth in FIG. 12T corresponding
to SEQ ID NOS: 499-542.
[0458] A modified IL-4 cytokine, comprising mutations at one or
more amino acid residues of IL-4 corresponding to SEQ ID NO: 207:
26, 37, 53, 60, 61, 64, 66, 100, 102, 103, and 126. The mutations
include insertions, deletions and replacements of the native amino
acid residue(s). In exemplary embodiments, the replacements are
selected from among amino acid substitutions in SEQ ID NO: 207 set
forth in FIG. 12R corresponding to SEQ ID NOS: 543-567.
[0459] A modified IL-5 cytokine, comprising mutations at one or
more amino acid residues of IL-5 corresponding to SEQ ID NO: 208:
32, 34, 39, 46, 47, 56, 84, 85, 88, 89, 90, 102, 110, and 111. The
mutations include insertions, deletions and replacements of the
native amino acid residue(s). In exemplary embodiments, the
replacements are selected from among amino acid substitutions in
SEQ ID NO: 208 set forth in FIG. 12S corresponding to SEQ ID NOS:
568-602.
[0460] A modified IL-13 cytokine, comprising mutations at one or
more amino acid residues of IL-13 corresponding to SEQ ID NO: 209:
32, 34, 38, 48, 79, 82, 85, 86, 88, 107, 108, 110, and 111. The
mutations include insertions, deletions and replacements of the
native amino acid residue(s). In exemplary embodiments, the
replacements are selected from among amino acid substitutions in
SEQ ID NO: 209 set forth in FIG. 12O corresponding to SEQ ID NOS:
603-630.
[0461] A modified G-CSF cytokine, comprising mutations at one or
more amino acid residues of G-CSF corresponding to SEQ ID NO: 210:
61, 63, 68, 72, 86, 96, 100, 101, 131, 133, 135, 147, 169, 172, and
177. The mutations include insertions, deletions and replacements
of the native amino acid residue(s). In exemplary embodiments, the
replacements are selected from among amino acid substitutions in
SEQ ID NO: 210 set forth in FIG. 12E corresponding to SEQ ID NOS:
631-662.
[0462] A modified leptin cytokine, comprising mutations at one or
more amino acid residues of leptin corresponding to SEQ ID NO: 211:
43, 49, 99, 100, 104, 105, 107, 108, 141 and 142. The mutations
include insertions, deletions and replacements of the native amino
acid residue(s). In exemplary embodiments, the replacements are
selected from among amino acid substitutions in SEQ ID NO: 211 set
forth in FIG. 12I corresponding to SEQ ID NOS: 663-683.
[0463] A modified CNTF cytokine, comprising mutations at one or
more amino acid residues of CNTF corresponding to SEQ ID NO: 212:
62, 64, 66, 67, 86, 89, 92, 100, 102, 104, 131, 132, 133, 135, 136,
138, 140, 143, 148, and 151. The mutations include insertions,
deletions and replacements of the native amino acid residue(s). In
exemplary embodiments, the replacements are selected from among
amino acid substitutions in SEQ ID NO: 212 set forth in FIG. 12D
corresponding to SEQ ID NOS: 684-728.
[0464] A modified LIF cytokine, comprising mutations at one or more
amino acid residues of LIF corresponding to SEQ ID NO: 213: 69, 70,
85, 99, 102, 104, 106, 109, 137, 143, 146, 148, 149, 153, 154, and
156. The mutations include insertions, deletions and replacements
of the native amino acid residue(s). In exemplary embodiments, the
replacements are selected from among amino acid substitutions in
SEQ ID NO: 213 set forth in FIG. 12J corresponding to SEQ ID NOS:
729-760.
[0465] A modified oncostatin M cytokine, comprising mutations at
one or more amino acid residues of oncostatin M corresponding to
SEQ ID NO: 214: 59, 60, 63, 65, 84, 87, 89, 91, 94, 97, 99, 100,
103, and 106. The mutations include insertions, deletions and
replacements of the native amino acid residue(s). In exemplary
embodiments, the replacements are selected from among amino acid
substitutions in SEQ ID NO: 214 set forth in FIG. 12K corresponding
to SEQ ID NOS: 761-793.
[0466] A modified IL-12 cytokine, comprising mutations at one or
more amino acid residues of IL-12 corresponding to SEQ ID NO: 215:
56, 61, 66, 67, 68, 70, 72, 75, 78, 79, 82, 89, 92, 93, 107, 110,
111, 115, 117, 124, 125, 127, 128, 129, and 189. The mutations
include insertions, deletions and replacements of the native amino
acid residue(s). In exemplary embodiments, the replacements are
selected from among amino acid substitutions in SEQ ID NO: 215 set
forth in FIG. 12G corresponding to SEQ ID NOS: 794-849.
[0467] A modified hGH cytokine, comprising mutations at one or more
amino acid residues of hGH corresponding to SEQ ID NO: 216: 56, 59,
64, 65, 66, 88, 92, 94, 101, 129, 130, 133, 134, 140, 143, 145,
146, 147, 183, and 186. The mutations include insertions, deletions
and replacements of the native amino acid residue(s). In exemplary
embodiments, the replacements are selected from among amino acid
substitutions in SEQ ID NO: 216 set forth in FIG. 12F corresponding
to SEQ ID NOS: 850-895.
[0468] A modified IL-6 cytokine, comprising mutations at one or
more amino acid residues of IL-6 corresponding to SEQ ID NO: 217:
64, 65, 66, 68, 69, 75, 77, 92, 98, 103, 105, 108, 133, 138, 139,
140, 149, 156, 178, and 181. The mutations include insertions,
deletions and replacements of the native amino acid residue(s). In
exemplary embodiments, the replacements are selected from among
amino acid substitutions in SEQ ID NO: 217 set forth in FIG. 12H
corresponding to SEQ ID NOS: 896-939.
[0469] In certain embodiments, the modified cytokines provided
herein possess increased stability compared to the unmodified
cytokine. Stability can be assessed by any in vitro or in vivo
method, such as by measuring residual inhibition of viral
replication or to stimulation of cell proliferation in appropriate
cells, after incubation with either mixtures of proteases,
individual proteases, blood lysate or serum.
[0470] In other embodiments, the modified cytokines provided herein
possess decreased stability compared to the unmodified cytokine.
Stability can be assessed by any in vitro or in vivo method, such
as by measuring residual inhibition of viral replication or to
stimulation of cell proliferation in appropriate cells, after
incubation with either mixtures of proteases, individual proteases,
blood lysate or serum.
[0471] In other embodiments, the modified cytokines provided herein
possess increased activity compared to the unmodified cytokine.
Stability can be assessed by any in vitro or in vivo method, such
as by measuring residual inhibition of viral replication or to
stimulation of cell proliferation in appropriate cells, after
incubation with either mixtures of proteases, individual proteases,
blood lysate or serum.
H. Rational Evolution of IFN.beta. for Increased Resistance to
Proteolysis and/or Higher Conformational Stability
[0472] Treatment with interferon .beta. (IFN.beta.) is a well
established therapy. Typically it is used for treatment of multiple
sclerosis (MS). Patients receiving interferon .beta. are subject to
frequent repeat applications of the drug. The instability of
IFN.beta. in the blood stream and under the storage conditions is
well known. Hence it would be useful to increasing stability
(half-life) of IFN.beta. in serum and also in vitro would improve
it as a drug.
[0473] The 2D-scanning method and the 3D-scanning method (using
structural homology) provided herein (see, copending U.S.
application Ser. No. 10/658,355, filed the same day herewith, based
on U.S. provisional application Ser. Nos. 60/457,063 and
60/410,258) were each applied to interferon .beta.. Provided herein
are mutant variants of the IFN.beta. protein that display improved
stability as assessed by resistance to proteases (thereby
possessing increased protein half-life) and at least comparable
biological activity as assessed by antiviral or antiproliferation
activity compared to the unmodified and wild type native IFN.beta.
protein (SEQ ID NO: 196). The IFN.beta. mutant proteins provided
herein confer a higher half-life and at least comparable biological
activity with respect to the native sequence. Thus, the optimized
IFN.beta. protein mutants provided herein that possess increased
resistance to proteolysis result in a decrease in the frequency of
injections needed to maintain a sufficient drug level in serum,
thus leading to, for example: i) higher comfort and acceptance by
patients, ii) lower doses necessary to achieve comparable
biological effects, and iii) as a consequence of (ii), likely
attenuation of any secondary effects.
[0474] In exemplary embodiments, the half-life of the IFN.beta.
mutants provided herein is increased by an amount selected from at
least 10%, at least 20%, at least 30%, at least 40%, at least 50%,
at least 60%, at least 70%, at least 80%, at least 90%, at least
100%, at least 150%, at least 200%, at least 250%, at least 300%,
at least 350%, at least 400%, at least 450%, at least 500% or more,
when compared to the half-life of native human IFN.beta. in either
human blood, human serum or an in vitro mixture containing one or
more proteases. In other embodiments, the half-life of the
IFN.beta. mutants provided herein is increased by an amount
selected from at least 6 times, 7 times, 8 times, 9 times, 10
times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times,
80 times, 90 times, 100 times, 200 times, 300 times, 400 times, 500
times, 600 times, 700 times, 800 times, 900 times, 1000 times, or
more, when compared to the half-life of native human IFN.beta. in
either human blood, human serum or an in vitro mixture containing
one or more proteases.
[0475] Two approaches were used herein to increase the stability of
IFN.beta. by amino acid replacement: i) Resistance to proteases:
amino acid replacement that leads to higher resistance to proteases
by direct destruction of the protease target residue or sequence,
while either maintaining or improving the requisite biological
activity (e.g., antiviral and anti-proliferation activity), and/or
ii) conformational stability: amino acid replacement that leads to
an increase in conformational stability (i.e. half-life at room
temperature or at 37.degree. C.), while either improving or
maintaining the requisite biological activity (e.g., antiviral and
anti-proliferation activity).
[0476] Two methodologies were used to address the improvements
described above: (a) 2D-scanning methods were used to identify
amino acid changes that lead to improvement in protease resistance
and to improvement in conformational stability, and (b)
3D-scanning, which employs structural homology methods also were
used to identify amino acid changes that lead to improvement in
protease resistance. The 2D-scanning and 3D-scanning methods each
were used to identify the amino acid changes on IFN.beta. that lead
to an increase in stability when challenged either with proteases,
human blood lysate or human serum. Increasing protein stability to
proteases, human blood lysate or human serum is contemplated herein
to provide a longer in vivo half-life for the particular protein
molecules, and thus a reduction in the frequency of necessary
injections into patients. The biological activities that have been
measured for the IFN.beta. molecules are i) their capacity to
inhibit virus replication when added to permissive cells previously
infected with the appropriate virus, and ii) their capacity to
stimulate cell proliferation when added to the appropriate cells.
Prior to the measurement of biological activity, IFN.beta.
molecules were challenged with proteases, human blood lysate or
human serum during different incubation times. The biological
activity measured, corresponds then to the residual biological
activity following exposure to the proteolytic mixtures.
[0477] As set forth above, provided herein are methods for the
generating IFN.beta. molecules (or any target protein, particularly
cytokines) that, while maintaining a requisite biological activity
without substantial change (sufficient for therapeutic
application(s)), have been rendered less susceptible to digestion
by blood proteases and therefore display a longer half-life in
blood circulation. In this particular example, the method used
included the following specific steps as exemplified in the
Examples:
For the improvement of resistance to proteases, by 2D-scanning, the
method included:
[0478] 1) Identifying some or all possible target sites on the
protein sequence that are susceptible to digestion by one or more
specific proteases (these sites are the is-HITs); and
[0479] 2) Identifying appropriate replacing amino acids, specific
for each is-HIT, such that if used to replace one or more of the
original amino acids at that specific is-HIT, they can be expected
to increase the is-HIT's resistance to digestion by protease while
at the same time, keeping the biological activity of the protein
unchanged (these replacing amino acids are the candidate
LEADs).
For the improvement of resistance to proteases, by 3D-scanning
(structural homology):
[0480] 1) Identifying some or all possible target sites (is-HITS)
on the protein sequence that display an acceptable degree of
structural homology around the amino acid positions mutated in the
LEAD molecules previously obtained for IFN.alpha. using
2D-scanning, and that are susceptible to digestion by one or more
specific proteases; and
[0481] 2) Identifying appropriate replacing amino acids, specific
for each is-HIT, such that if used to replace one or more of the
original amino acids at that specific is-HIT, they can be expected
to increase the is-HIT's resistance to digestion by protease while
at the same time, keeping the biological activity of the protein
unchanged (these replacing amino acids are the candidate
LEADs).
[0482] For the improvement of conformational stability, by
2D-scanning, as provided herein: [0483] 1) Identifying some or all
possible target sites on the protein sequence that are susceptible
to being directly involved in the intramolecular flexibility and
conformational change (these sites are the is-HITs); and [0484] 2)
Identifying appropriate replacing amino acids, specific for each
is-HIT, such that if used to replace one or more of the original
amino acids at that specific is-HIT, they can be expected to
increase the thermal stability of the molecule while at the same
time, keeping the biological activity of the protein unchanged
(these replacing amino acids are the candidate LEADs). See FIGS.
6(O)-6(S) and FIG. 8(A).
[0485] Using the 2D-scanning and 3D-scanning methods and the
3-dimensional structure of IFN.beta., the following amino acid
target positions were identified as is-HITs on IFN.beta., which
numbering is that of the mature protein (SEQ ID NO:196):
[0486] By 3D-scanning (see, SEQ ID Nos.: 234-289, 989-1015): D by Q
at position 39, D by H at position 39, D by G at position 39, E by
Q at position 42, E by H at position 42, K by Q at position 45, K
by T at position 45, K by S at position 45, K by H at position 45,
L by V at position 47, L by I at position 47, L by T at position
47, L by Q at position 47, L by H at position 47, L by A at
position 47, K by Q at position 52, K by T at position 52, K by S
at position 52, K by H at position 52, F by I at position 67, F by
V at position 67, R by H at position 71, R by Q at position 71, D
by H at position 73, D by G at position 73, D by Q at position 73,
E by Q at position 81, E by H at position 81, E by Q at position
107, E by H at position 107, K by Q at position 108, K by T at
position 108, K by S at position 108, K by H at position 108, E by
Q at position 109, E by H at position 109, D by Q at position 110,
D by H at position 110, D by G at position 110, F by I at position
111, F by V at position 111, R by H at position 113, R by Q at
position 113, L by V at position 116, L by I at position 116, L by
T at position 116, L by Q at position 116, L by H at position 116,
L by A at position 116, L by V at position 120, L by I at position
120, L by T at position 120, L by Q at position 120, L by H at
position 120, L by A at position 120, K by Q at position 123, K by
T at position 123, K by S at position 123, K by H at position 123,
R by H at position 124, R by Q at position 124, R by H at position
128, R by Q at position 128, L by V at position 130, L by I at
position 130, L by T at position 130, L by Q at position 130, L by
H at position 130, L by A at position 130, K by Q at position 134,
K by T at position 134, K by S at position 134, K by H at position
134, K by Q at position 136, K by T at position 136, K by S at
position 136, K by H at position 136, E by Q at position 137, E by
H at position 137, Y by H at position 163, Y by I at position 163,
R by H at position 165, R by Q at position 165.
[0487] By 2D-scanning (see SEQ ID Nos.: 1016-1302): M by V at
position 1, M by I at position 1, M by T at position 1, M by Q at
position 1, M by A at position 1, L by V at position 5, L by I at
position 5, L by T at position 5, L by Q at position 5, L by H at
position 5, L by A at position 5, F by I at position 8, F by V at
position 8, L by V at position 9, L by I at position 9, L by T at
position 9, L by Q at position 9, L by H at position 9, L by A at
position 9, R by H at position 11, R by Q at position 11, F by I at
position 15, F by V at position 15, K by Q at position 19, K by T
at position 19, K by S at position 19, K by H at position 19, W by
S at position 22, W by H at position 22, N by H at position 25, N
by S at position 25, N by Q at position 25, R by H position 27, R
by Q position 27, L by V at position 28, L by I at position 28, L
by T at position 28, L by Q at position 28, L by H at position 28,
L by A at position 28, E by Q at position 29, E by H at position
29, Y by H at position 30, Y by I at position 30, L by V at
position 32, L by I at position 32, L by T at position 32, L by Q
at position 32, L by H at position 32, L by A at position 32, K by
Q at position 33, K by T at position 33, K by S at position 33, K
by H at position 33, R by H at position 35, R by Q at position 35,
M by V at position 36, M by I at position 36, M by T at position
36, M by Q at position 36, M by A at position 36, D by Q at
position 39, D by H at position 39, D by G at position 39, E by Q
at position 42, E by H at position 42, K by Q at position 45, K by
T at position 45, K by S at position 45, K by H at position 45, L
by V at position 47, L by I at position 47, L by T at position 47,
L by, Q at position 47, L by H at position 47, L by A at position
47, K by Q at position 52, K by T at position 52, K by S at
position 52, K by H at position 52, F by I at position 67, F by V
at position 67, R by H at position 71, R by Q at position 71, D by
Q at position 73, D by H at position 73, D by G at position 73, E
by Q at position 81, E by H at position 81, E by Q at position 85,
E by H at position 85, Y by H at position 92, Y by I at position
92, K by Q at position 99, K by T at position 99, K by S at
position 99, K by H at position 99, E by Q at position 103, E by H
at position 103, E by Q at position 104, E by H at position 104, K
by Q at position 105, K by T at position 105, K by S at position
105, K by H at position 105, E by Q at position 107, E by H at
position 107, K by Q at position 108, K by T at position 108, K by
S at position 108, K by H at position 108, E by Q at position 109,
E by H at position 109, D by Q at position 110, D by H at position
110, D by G at position 110, F by I at position 111, F by V at
position 111, R by H at position 113, R by Q at position 113, L by
V at position 116, L by I at position 116, L by T at position 116,
L by Q at position 116, L by H at position 116, L by A at position
116, L by V at position 120, L by I at position 120, L by T at
position 120, L by Q at position 120, L by H at position 120, L by
A at position 120, K by Q at position 123, K by T at position 123,
K by S at position 123, K by H at position 123, R by H at position
124, R by Q at position 124, R by H at position 128, R by Q at
position 128, L by V at position 130, L by I at position 130, L by
T at position 130, L by Q at position 130, L by H at position 130,
L by A at position 130, K by Q at position 134, K by T at position
134, K by S at position 134, K by H at position 134, K by Q at
position 136, K by T at position 136, K by S at position 136, K by
H at position 136, E by Q at position 137, E by H at position 137,
Y by H at position 138, Y by I at position 138, R by H at position
152, R by Q at position 152, Y by H at position 155, Y by I at
position 155, R by H at position 159, R by Q at position 159, Y by
H at position 163, Y by I at position 163, R by H at position 165,
R by Q at position 165, M by D at position 1, M by E at position 1,
M by K at position 1, M by N at position 1, M by R at position 1, M
by S at position 1, L by D at position 5, L by E at position 5, L
by K at position 5, L by N at position 5, L by R at position 5, L
by S at position 5, L by D at position 6, L by E at position 6, L
by K at position 6, L by N at position 6, L by R at position 6, L
by S at position 6, L by Q at position 6, L by T at position 6, F
by E at position 8, F by K at position 8, F by R at position 8, F
by D at position 8, L by D at position 9, L by E at position 9, L
by K at position 9, L by N at position 9, L by R at position 9, L
by S at position 9, Q by D at position 10, Q by E at position 10, Q
by K at position 10, Q by N at position 10, Q by R at position 10,
Q by S at position 10, Q by T at position 10, S by D at position
12, S by E at position 12, S by K at position 12, S by R at
position 12, S by D at position 13, S by E at position 13, S by K
at position 13, S by R at position 13, S by N at position 13, S by
Q at position 13, S by T at position 13, N by D at position 14, N
by E at position 14, N by K at position 14, N by Q at position 14,
N by R at position 14, N by S at position 14, N by T at position
14, F by D at position 15, F by E at position 15, F by K at
position 15, F by R at position 15, Q by D at position 16, Q by E
at position 16, Q by K at position 16, Q by N at position 16, Q by
R at position 16, Q by S at position 16, Q by T at position 16, C
by D at position 17, C by E at position 17, C by K at position 17,
C by N at position 17, C by Q at position 17, C by R at position
17, C by S at position 17, C by T at position 17, L by N at
position 20, L by Q at position 20, L by R at position 20, L by S
at position 20, L by T at position 20, L by D at position 20, L by
E at position 20, L by K at position 20, W by D at position 22, W
by E at position 22, W by K at position 22, W by R at position 22,
Q by D at position 23, Q by E at position 23, Q by K at position
23, Q by R at position 23, L by D at position 24, L by E at
position 24, L by K at position 24, L by R at position 24, W by D
at position 79, W by E at position 79, W by K at position 79, W by
R at position 79, N by D at position 80, N by E at position 80, N
by K at position 80, N by R at position 80, T by D at position 82,
T by E at position 82, T by K at position 82, T by R at position
82, I by D at position 83, I by E at position 83, I by K at
position 83, I by R at position 83, I by N at position 83, I by Q
at position 83, I by S at position 83, I by T at position 83, N by
D at position 86, N by E at position 86, N by K at position 86, N
by R at position 86, N by Q at position 86, N by S at position 86,
N by T at position 86, L by D at position 87, L by E at position
87, L by K at position 87, L by R at position 87, L by N at
position 87, L by Q at position 87, L by S at position 87, L by T
at position 87, A by D at position 89, A by E at position 89, A by
K at position 89, A by R at position 89, N by D at position 90, N
by E at position 90, N by K at position 90, N by Q at position 90,
N by R at position 90, N by S at position 90, N by T at position
90, V by D at position 91, V by E at position 91, V by K at
position 91, V by N at position 91, V by Q at position 91, V by R
at position 91, V by S at position 91, V by T at position 91, Q by
D at position 94, Q by E at position 94, Q by Q at position 94, Q
by N at position 94, Q by R at position 94, Q by S at position 94,
Q by T at position 94, I by D at position 95, I by E at position
95, I by K at position 95, I by N at position 95, I by Q at
position 95, I by R at position 95, I by S at position 95, I by T
at position 95, H by D at position 97, H by E at position 97, H by
K at position 97, H by N at position 97, H by Q at position 97, H
by R at position 97, H by S at position 97, H by T at position 97,
L by D at position 98, L by E at position 98, L by K at position
98, L by N at position 98, L by Q at position 98, L by R at
position 98, L by S at position 98, L by T at position 98, V by D
at position 101, V by E at position 101, V by K at position 101, V
by N at position 101, V by Q at position 101, V by R at position
101, V by S at position 101, V by T at position 101, M by C at
position 1, L by C at position 6, Q by C at position 10, S by C at
position 13, Q by C at position 16, L by C at position 17, V by C
at position 101, L by C at position 98, H by C at position 97, Q by
C at position 94, V by C at position 91, N by C at position 90.
TABLE-US-00003 SEQ ID NO. Mutant SEQ ID No 1016 (M1V) SEQ ID No
1017 (M1I) SEQ ID No 1018 (M1T) SEQ ID No 1019 (M1A) SEQ ID No 1020
(L5V) SEQ ID No 1021 (L5I) SEQ ID No 1022 (L5T) SEQ ID No 1023
(L5Q) SEQ ID No 1024 (L5H) SEQ ID No 1025 (L5A) SEQ ID No 1026
(F8I) SEQ ID No 1027 (F8V) SEQ ID No 1028 (L9V) SEQ ID No 1029
(L9I) SEQ ID No 1030 (L9T) SEQ ID No 1031 (L9Q) SEQ ID No 1032
(L9H) SEQ ID No 1033 (L9A) SEQ ID No 1034 (R11H) SEQ ID No 1035
(R11Q) SEQ ID No 1036 (F15I) SEQ ID No 1037 (F15V) SEQ ID No 1038
(K19Q) SEQ ID No 1039 (K19T) SEQ ID No 1040 (K19S) SEQ ID No 1041
(K19H) SEQ ID No 1042 (W22S) SEQ ID No 1043 (W22H) SEQ ID No 1044
(N25H) SEQ ID No 1045 (N25S) SEQ ID No 1046 (N25Q) SEQ ID No 1047
(R27H) SEQ ID No 1048 (R27Q) SEQ ID No 1049 (L28V) SEQ ID No 1050
(L28I) SEQ ID No 1051 (L28T) SEQ ID No 1052 (L28Q) SEQ ID No 1053
(L28H) SEQ ID No 1054 (L28A) SEQ ID No 1055 (E29Q) SEQ ID No 1056
(E29H) SEQ ID No 1057 (Y30H) SEQ ID No 1058 (Y30I) SEQ ID No 1059
(L32V) SEQ ID No 1060 (L32I) SEQ ID No 1061 (L32T) SEQ ID No 1062
(L32Q) SEQ ID No 1063 (L32H) SEQ ID No 1064 (L32A) SEQ ID No 1065
(M1Q) SEQ ID No 1066 (K33Q) SEQ ID No 1067 (K33T) SEQ ID No 1068
(K33S) SEQ ID No 1069 (K33H) SEQ ID No 1070 (R35H) SEQ ID No 1071
(R35Q) SEQ ID No 1072 (M36V) SEQ ID No 1073 (M36I) SEQ ID No 1074
(M36T) SEQ ID No 1075 (M36Q) SEQ ID No 1076 (M36A) SEQ ID No 1077
(E85Q) SEQ ID No 1078 (E85H) SEQ ID No 1079 (Y92H) SEQ ID No 1080
(Y92I) SEQ ID No 1081 (K99Q) SEQ ID No 1082 (K99T) SEQ ID No 1083
(K99S) SEQ ID No 1084 (K99H) SEQ ID No 1085 (E103Q) SEQ ID No 1086
(E103H) SEQ ID No 1087 (E104Q) SEQ ID No 1088 (E104H) SEQ ID No
1089 (K105Q) SEQ ID No 1090 (K105T) SEQ ID No 1091 (K105S) SEQ ID
No 1092 (K105H) SEQ ID No 1093 (Y138H) SEQ ID No 1094 (Y138I) SEQ
ID No 1095 (R152H) SEQ ID No 1096 (R152Q) SEQ ID No 1097 (Y155H)
SEQ ID No 1098 (Y155I) SEQ ID No 1099 (R159H) SEQ ID No 1100
(R159Q) SEQ ID No 1101 (M1D) SEQ ID No 1102 (M1E) SEQ ID No 1103
(M1K) SEQ ID No 1104 (M1N) SEQ ID No 1105 (M1R) SEQ ID No 1106
(M1S) SEQ ID No 1107 (L5D) SEQ ID No 1108 (L5E) SEQ ID No 1109
(L5K) SEQ ID No 1110 (L5R) SEQ ID No 1111 (L5N) SEQ ID No 1112
(L5S) SEQ ID No 1113 (L6D) SEQ ID No 1114 (L6E) SEQ ID No 1115
(L6K) SEQ ID No 1116 (L6N) SEQ ID No 1117 (L6Q) SEQ ID No 1118
(L6R) SEQ ID No 1119 (L6S) SEQ ID No 1120 (L6T) SEQ ID No 1121
(F8D) SEQ ID No 1122 (F8E) SEQ ID No 1123 (F8K) SEQ ID No 1124
(F8R) SEQ ID No 1125 (L9D) SEQ ID No 1126 (L9E) SEQ ID No 1127
(L9K) SEQ ID No 1128 (L9N) SEQ ID No 1129 (L9R) SEQ ID No 1130
(L9S) SEQ ID No 1131 (Q10D) SEQ ID No 1132 (Q10E) SEQ ID No 1133
(Q10K) SEQ ID No 1134 (Q10N) SEQ ID No 1135 (Q10R) SEQ ID No 1136
(Q10S) SEQ ID No 1137 (Q10T) SEQ ID No 1138 (S12D) SEQ ID No 1139
(S12E)
SEQ ID No 1140 (S12K) SEQ ID No 1141 (S12R) SEQ ID No 1142 (S13D)
SEQ ID No 1143 (S13E) SEQ ID No 1144 (S13K) SEQ ID No 1145 (S13N)
SEQ ID No 1146 (S13Q) SEQ ID No 1147 (S13R) SEQ ID No 1148 (S13T)
SEQ ID No 1149 (N14D) SEQ ID No 1150 (N14E) SEQ ID No 1151 (N14K)
SEQ ID No 1152 (N14Q) SEQ ID No 1153 (N14R) SEQ ID No 1154 (N14S)
SEQ ID No 1155 (N14T) SEQ ID No 1156 (F15D) SEQ ID No 1157 (F15E)
SEQ ID No 1158 (F15K) SEQ ID No 1159 (F15R) SEQ ID No 1160 (Q16D)
SEQ ID No 1161 (Q16E) SEQ ID No 1162 (Q16K) SEQ ID No 1163 (Q16N)
SEQ ID No 1164 (Q16R) SEQ ID No 1165 (Q16S) SEQ ID No 1166 (Q16T)
SEQ ID No 1167 (C17D) SEQ ID No 1168 (C17E) SEQ ID No 1169 (C17K)
SEQ ID No 1170 (C17N) SEQ ID No 1171 (C17Q) SEQ ID No 1172 (C17R)
SEQ ID No 1173 (C17S) SEQ ID No 1174 (C17T) SEQ ID No 1175 (L20N)
SEQ ID No 1176 (L20Q) SEQ ID No 1177 (L20R) SEQ ID No 1178 (L20S)
SEQ ID No 1179 (L20T) SEQ ID No 1180 (L20D) SEQ ID No 1181 (L20E)
SEQ ID No 1182 (L20K) SEQ ID No 1183 (W22D) SEQ ID No 1184 (W22E)
SEQ ID No 1185 (W22K) SEQ ID No 1186 (W22R) SEQ ID No 1187 (Q23D)
SEQ ID No 1188 (Q23E) SEQ ID No 1189 (Q23K) SEQ ID No 1190 (Q23R)
SEQ ID No 1191 (L24D) SEQ ID No 1192 (L24E) SEQ ID No 1193 (L24K)
SEQ ID No 1194 (L24R) SEQ ID No 1195 (G78D) SEQ ID No 1196 (G78E)
SEQ ID No 1197 (G78K) SEQ ID No 1198 (G78R) SEQ ID No 1199 (W79D)
SEQ ID No 1200 (W79E) SEQ ID No 1201 (W79K) SEQ ID No 1202 (W79R)
SEQ ID No 1203 (N80D) SEQ ID No 1204 (N80E) SEQ ID No 1205 (N80K)
SEQ ID No 1206 (N80R) SEQ ID No 1207 (T82D) SEQ ID No 1208 (T82E)
SEQ ID No 1209 (T82K) SEQ ID No 1210 (T82R) SEQ ID No 1211 (I83D)
SEQ ID No 1212 (I83E) SEQ ID No 1213 (I83K) SEQ ID No 1214 (I83R)
SEQ ID No 1215 (I83N) SEQ ID No 1216 (I83Q) SEQ ID No 1217 (I83S)
SEQ ID No 1218 (I83T) SEQ ID No 1219 (N86D) SEQ ID No 1220 (N86E)
SEQ ID No 1221 (N86K) SEQ ID No 1222 (N86R) SEQ ID No 1223 (N86Q)
SEQ ID No 1224 (N86S) SEQ ID No 1225 (N86T) SEQ ID No 1226 (L87D)
SEQ ID No 1227 (L87E) SEQ ID No 1228 (L87K) SEQ ID No 1229 (L87R)
SEQ ID No 1230 (L87N) SEQ ID No 1231 (L87Q) SEQ ID No 1232 (L87S)
SEQ ID No 1233 (L87T) SEQ ID No 1234 (A89D) SEQ ID No 1235 (A89E)
SEQ ID No 1236 (A89K) SEQ ID No 1237 (A89R) SEQ ID No 1238 (N90D)
SEQ ID No 1239 (N90E) SEQ ID No 1240 (N90K) SEQ ID No 1241 (N90Q)
SEQ ID No 1242 (N90R) SEQ ID No 1243 (N90S) SEQ ID No 1244 (N90T)
SEQ ID No 1245 (V91D) SEQ ID No 1246 (V91E) SEQ ID No 1247 (V91K)
SEQ ID No 1248 (V91N) SEQ ID No 1249 (V91Q) SEQ ID No 1250 (V91R)
SEQ ID No 1251 (V91S) SEQ ID No 1252 (V91T) SEQ ID No 1253 (Q94D)
SEQ ID No 1254 (Q94E) SEQ ID No 1255 (Q94K) SEQ ID No 1256 (Q94N)
SEQ ID No 1257 (Q94R) SEQ ID No 1258 (Q94S) SEQ ID No 1259 (Q94T)
SEQ ID No 1260 (I95D) SEQ ID No 1261 (I95E) SEQ ID No 1262 (I95K)
SEQ ID No 1263 (I95N) SEQ ID No 1264 (I95Q) SEQ ID No 1265 (I95R)
SEQ ID No 1266 (I95S) SEQ ID No 1267 (I95T) SEQ ID No 1268 (H97D)
SEQ ID No 1269 (H97E) SEQ ID No 1270 (H97K) SEQ ID No 1271 (H97N)
SEQ ID No 1272 (H97Q) SEQ ID No 1273 (H97R) SEQ ID No 1274 (H97S)
SEQ ID No 1275 (H97T) SEQ ID No 1276 (L98D) SEQ ID No 1277 (L98E)
SEQ ID No 1278 (L98K) SEQ ID No 1279 (L98N) SEQ ID No 1280 (L98Q)
SEQ ID No 1281 (L98R) SEQ ID No 1282 (L98S) SEQ ID No 1283 (L98T)
SEQ ID No 1284 (V101D) SEQ ID No 1285 (V101E) SEQ ID No 1286
(V101K) SEQ ID No 1287 (V101N) SEQ ID No 1288 (V101Q) SEQ ID No
1289 (V101R) SEQ ID No 1290 (V101S) SEQ ID No 1291 (V101T) SEQ ID
No 1292 (M1C) SEQ ID No 1293 (V101C) SEQ ID No 1294 (L6C) SEQ ID No
1295 (L98C) SEQ ID No 1296 (Q10C) SEQ ID No 1297 (H97C) SEQ ID No
1298 (S13C) SEQ ID No 1299 (Q94C) SEQ ID No 1300 (Q16C) SEQ ID No
1301 (N90C) SEQ ID No 1302 (V91C)
I. Super-LEADs and Additive Directional Mutagenesis (ADM)
[0488] Also provided herein are super-LEAD mutant proteins
comprising a combination of single amino acid mutations present in
two or more of the respective LEAD mutant proteins. Thus, the
super-LEAD mutant proteins have two of more of the single amino
acid mutations derived from two or more of the respective LEAD
mutant proteins. As described herein, LEAD mutant proteins provided
herein are defined as mutants whose performance or fitness has been
optimized with respect to the native protein. LEADs typically
contain one single mutation relative to its respective native
protein. This mutation represents an appropriate amino acid
replacement that takes place at one is-HIT position. Further
super-LEAD mutant proteins are created such that they carry on the
same protein molecule, more than one LEAD mutation, each at a
different is-HIT position. Once the LEAD mutant proteins have been
identified using the 2D-scanning methods provided herein,
super-LEADs can be generated by combining two or more individual
LEAD mutant mutations using methods well-known in the art, such as
recombination, mutagenesis and DNA shuffling, and by methods, such
as additive directional mutagenesis and Multi-Overlapped Primer
Extensions, provided herein.
[0489] 1. Additive Directional Mutagenesis
[0490] Also provided herein are methods for assembling on a single
mutant protein multiple mutations present on the individual LEAD
molecules, so as to generate super-LEAD mutant proteins. This
method is referred to herein as "Additive Directional Mutagenesis"
(ADM). ADM is a repetitive multi-step process where at each step
after the creation of the first LEAD mutant protein a new LEAD
mutation is added onto the previous LEAD mutant protein to create
successive super-LEAD mutant proteins. ADM is not based on genetic
recombination mechanisms, nor on shuffling methodologies; instead
it is a simple one-mutation-at-a-time process, repeated as many
times as necessary until the total number of desired mutations is
introduced on the same molecule. To avoid the exponentially
increasing number of all possible combinations that can be
generated by putting together on the same molecule a given number
of single mutations, a method is provided herein that, although it
does not cover all the combinatorial possible space, still captures
a big part of the combinatorial potential. The word "combinatorial"
is used here in its mathematical meaning (i.e., subsets of a group
of elements, containing some of the elements in any possible order)
and not in the molecular biological or directed evolution meaning
(i.e., generating pools, or mixtures, or collections of molecules
by randomly mixing their constitutive elements).
[0491] A population of sets of nucleic acid molecules encoding a
collection of new super-LEAD mutant molecules is generated, tested
and phenotypically characterized one-by-one in addressable arrays.
super-LEAD mutant molecules are such that each molecule contains a
variable number and type of LEAD mutations. Those molecules
displaying further improved fitness for the particular feature
being evolved, are referred to as super-LEADs. Super-LEADs may be
generated by other methods known to those of skill in the art and
tested by the high throughput methods herein. For purposes herein a
super-LEAD typically has activity with respect to the function or
biological activity of interest that differs from the improved
activity of a LEAD by a desired amount, such as at least 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more from at
least one of the LEAD mutants from which it is derived. In yet
other embodiments, the change in activity is at least about 2
times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9
times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times,
70 times, 80 times, 90 times, 100 times, 200 times, 300 times, 400
times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000
times, or more greater than at least one of the LEAD molecules from
which it is derived. As with LEADs, the change in the activity for
super-LEADs is dependent upon the activity that is being "evolved."
The desired alteration, which can be either an increase or a
reduction in activity, will depend upon the function or property of
interest.
[0492] In one embodiment provided herein, the ADM method employs a
number of repetitive steps, such that at each step a new mutation
is added on a given molecule. Although numerous different ways are
possible for combining each LEAD mutation onto a super-LEAD
protein, an exemplary way the new mutations (e.g., mutation 1 (m1),
mutation 2 (m2), mutation 3 (m3), mutation 4 (m4), mutation 5 (m5),
mutation n (mn)) can be added corresponds to the following
diagram:
[0493] m1
[0494] m1+m2
[0495] m1+m2+m3
[0496] m1+m2+m3+m4
[0497] m1+m2+m3+m4+m5
[0498] m1+m2+m3+m4+m5+ . . . +mn
[0499] m1+m2+m4
[0500] m1+m2+m4+m5
[0501] m1+m2+m4+m5+ . . . +mn
[0502] m1+m2+m5
[0503] m1+m2+m5+ . . . +mn
[0504] m2
[0505] m2+m3
[0506] m2+m3+m4
[0507] m2+m3+m4+m5
[0508] m2+m3+m4+m5+ . . . +mn
[0509] m2+m4
[0510] m2+m4+m5
[0511] m2+m4+m5+ . . . +mn
[0512] m2+m5
[0513] m2+m5+ . . . +mn
[0514] . . . , etc. . . .
[0515] 2. Multi-Overlapped Primer Extensions
[0516] In another embodiment, provided herein is a method for the
rational evolution of proteins using oligonucleotide-mediated
mutagenesis referred to as "multi overlapped primer extensions."
This method can be used for the rational combination of mutant
LEADs to form super-LEADS. This method allows the simultaneous
introduction of several mutations throughout a small protein or
protein-region of known sequence. Overlapping oligonucleotides of
typically around 70 bases in length (since longer oligonucleotides
lead to increased error) are designed from the DNA sequence (gene)
encoding the mutant LEAD proteins in such a way that they overlap
with each other on a region of typically around 20 bases. These
overlapping oligonucleotides (including or not point mutations) act
as both template and primers in a first step of PCR (using a
proofreading polymerase, e.g., Pfu DNA polymerase, to avoid
unexpected mutations) to create small amounts of full-length gene.
The full-length gene resulting from the first PCR is then
selectively amplified in a second step of PCR using flanking
primers, each one tagged with a restriction site in order to
facilitate subsequent cloning. One multi overlapped extension
process yields a full-length (multi-mutated) nucleic acid molecule
encoding a candidate super-LEAD protein having multiple mutations
therein derived from LEAD mutant proteins.
[0517] Although typically about 70 bases are used to create the
overlapping oligonucleotides, the length of additional overlapping
oligonucleotides for use herein can range from about 30 bases up to
about 100 bases, from about 40 bases up to about 90 bases, from
about 50 bases up to about 80 bases, from about 60 bases up to
about 75 bases, and from about 65 bases up to about 75 bases. As
set forth above, typically about 70 bases are used herein.
[0518] Likewise, although typically the overlapping region of the
overlapping oligonucleotides is about 20 bases, the length of other
overlapping regions for use herein can range from about 5 bases up
to about 40 bases, from about 10 bases up to about 35 bases, from
about 15 bases up to about 35 bases, from about 15 bases up to
about 25 bases, from about 16 bases up to about 24 bases, from
about 17 bases up to about 23 bases, from about 18 bases up to
about 22 bases, and from about 19 bases up to about 21 bases. As
set forth above, typically about 20 bases are used herein for the
overlapping region.
J. Uses of the Mutant IFN.alpha. and IFN.beta. Genes and Cytokines
in Therapeutic Methods
[0519] The optimized cytokines provided herein, such as the
IFN.alpha.-2b and IFN.beta. proteins and other modified cytokines,
are intended for use in various therapeutic as well as diagnostic
methods. These include all methods for which the unmodified
proteins are used. By virtue of their improved phenotypes and
activities, the proteins provided herein should exhibit improvement
in the corresponding in vivo phenotype.
[0520] In particular, the optimized cytokines, such as the
IFN.alpha.-2b and IFN.beta. proteins, are intended for use in
therapeutic methods in which cytokines have been used for
treatment. Such methods include, but are not limited to, methods of
treatment of infectious diseases, allergies, microbial diseases,
pregnancy related diseases, bacterial diseases, heart diseases,
viral diseases, histological diseases, genetic diseases, blood
related diseases, fungal diseases, adrenal diseases, cancers, liver
diseases, autoimmune diseases, growth disorders, diabetes,
neurodegenerative diseases, including multiple sclerosis,
Parkinson's disease and Alzheimer's disease.
[0521] 1. Fusion Proteins
[0522] Fusion proteins containing a targeting agent and mutant
IFN.alpha., including IFN.alpha.-2b and IFN.alpha.-2a, and
IFN.beta. mutant proteins, or cytokine protein also are provided.
Pharmaceutical compositions containing such fusion proteins
formulated for administration by a suitable route are provided.
Fusion proteins are formed by linking in any order the mutant
protein and an agent, such as an antibody or fragment thereof,
growth factor, receptor, ligand and other such agent for directing
the mutant protein to a targeted cell or tissue. Linkage can be
effected directly or indirectly via a linker. The fusion proteins
can be produced recombinantly or chemically by chemical linkage,
such as via heterobifunctional agents or thiol linkages or other
such linkages. The fusion proteins can contain additional
components, such as E. coli maltose binding protein (MBP) that aid
in uptake of the protein by cells (see, International PCT
application No. WO 01/32711).
[0523] 2. Nucleic Acid Molecules for Expression
[0524] Nucleic acid molecules encoding the mutant cytokines
including the mutant IFN.beta. proteins and IFN.alpha. proteins,
such as the IFN.alpha.-2b and IFN.alpha.-2a proteins, provided
herein, or the fusion protein operably linked to a promoter, such
as an inducible promoter for expression in mammalian cells also are
provided. Such promoters include, but are not limited to, CMV and
SV40 promoters; adenovirus promoters, such as the E2 gene promoter,
which is responsive to the HPV E7 oncoprotein; a PV promoter, such
as the PBV p89 promoter that is responsive to the PV E2 protein;
and other promoters that are activated by the HIV or PV or
oncogenes.
[0525] The mutant cytokines including the mutant interferons
(IFN.alpha.'s and IFN.beta.'s) proteins provided herein, also can
be delivered to the cells in gene transfer vectors. The transfer
vectors also can encode additional other therapeutic agent(s) for
treatment of the disease or disorder, such cancer or HIV infection,
for which the cytokine is administered.
[0526] 3. Formulation of Optimized Cytokines and Methods of
Treatment
[0527] Pharmaceutical compositions containing an optimized cytokine
produced herein, such as IFN.alpha.-2b, IFN.alpha.-2a and
IFN.beta., fusion proteins or encoding nucleic acid molecules can
be formulated in any conventional manner by mixing a selected
amount of an optimized cytokine with one or more physiologically
acceptable carriers or excipients. Selection of the carrier or
excipient depends upon the mode of administration (i.e., systemic,
local, topical or any other mode) and disorder treated. The
pharmaceutical compositions provided herein can be formulated for
single dosage administration. The concentrations of the compounds
in the formulations are effective for delivery of an amount, upon
administration, that is effective for the intended treatment.
Typically, the compositions are formulated for single dosage
administration. To formulate a composition, the weight fraction of
a compound or mixture thereof is dissolved, suspended, dispersed or
otherwise mixed in a selected vehicle at an effective concentration
such that the treated condition is relieved or ameliorated.
Pharmaceutical carriers or vehicles suitable for administration of
the compounds provided herein include any such carriers known to
those skilled in the art to be suitable for the particular mode of
administration.
[0528] In addition, the compounds may be formulated as the sole
pharmaceutically active ingredient in the composition or may be
combined with other active ingredients. Liposomal suspensions,
including tissue-targeted liposomes, may also be suitable as
pharmaceutically acceptable carriers. These may be prepared
according to methods known to those skilled in the art. For
example, liposome formulations may be prepared as described in U.S.
Pat. No. 4,522,811.
[0529] The active compound is included in the pharmaceutically
acceptable carrier in an amount sufficient to exert a
therapeutically useful effect in the absence of undesirable side
effects on the patient treated. The therapeutically effective
concentration may be determined empirically by testing the
compounds in known in vitro and in vivo systems, such as the assays
provided herein. The active compounds can be administered by any
appropriate route, for example, orally, parenterally,
intravenously, intradermally, subcutaneously, or topically, in
liquid, semi-liquid or solid form and are formulated in a manner
suitable for each route of administration.
[0530] The optimized cytokine and physiologically acceptable salts
and solvates can be formulated for administration by inhalation
(either through the mouth or the nose) or for oral, buccal,
parenteral or rectal administration. For administration by
inhalation, the optimized cytokine can be delivered in the form of
an aerosol spray presentation from pressurized packs or a
nebulizer, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluorethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit can be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g., gelatin for use in an inhaler or insuffliator
can be formulated containing a powder mix of a therapeutic compound
and a suitable powder base such as lactose or starch.
[0531] For oral administration, the pharmaceutical compositions can
take the form of, for example, tablets or capsules prepared by
conventional means with pharmaceutically acceptable excipients such
as binding agents (e.g., pregelatinized maize starch,
polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers
(e.g., lactose, microcrystalline cellulose or calcium hydrogen
phosphate); lubricants (e.g., magnesium stearate, talc or silica);
disintegrants (e.g., potato starch or sodium starch glycolate); or
wetting agents (e.g., sodium lauryl sulphate). The tablets can be
coated by methods well known in the art. Liquid preparations for
oral administration can take the form of, for example, solutions,
syrups or suspensions, or they can be presented as a dry product
for constitution with water or other suitable vehicle before use.
Such liquid preparations can be prepared by conventional means with
pharmaceutically acceptable additives such as suspending agents
(e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible
fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous
vehicles (e.g., almond oil, oily esters, ethyl alcohol or
fractionated vegetable oils); and preservatives (e.g., methyl or
propyl-p-hydroxybenzoates or sorbic acid). The preparations can
also contain buffer salts, flavoring, coloring and sweetening
agents as appropriate.
[0532] Preparations for oral administration can be suitably
formulated to give controlled release of the active compound. For
buccal administration the compositions can take the form of tablets
or lozenges formulated in conventional manner.
[0533] The optimized cytokine can be formulated for parenteral
administration by injection e.g., by bolus injection or continuous
infusion. Formulations for injection can be presented in unit
dosage form e.g., in ampules or in multi-dose containers, with an
added preservative. The compositions can take such forms as
suspensions, solutions or emulsions in oily or aqueous vehicles,
and can contain formulatory agents such as suspending, stabilizing
and/or dispersing agents. Alternatively, the active ingredient can
be in powder-lyophilized form for constitution with a suitable
vehicle, e.g., sterile pyrogen-free water, before use.
[0534] In addition to the formulations described previously, the
optimized cytokine also can be formulated as a depot preparation.
Such long acting formulations can be administered by implantation
(for example, subcutaneously or intramuscularly) or by
intramuscular injection. Thus, for example, the therapeutic
compounds can be formulated with suitable polymeric or hydrophobic
materials (for example as an emulsion in an acceptable oil) or ion
exchange resins, or as sparingly soluble derivatives, for example,
as a sparingly soluble salt.
[0535] The active agents can be formulated for local or topical
application, such as for topical application to the skin and mucous
membranes, such as in the eye, in the form of gels, creams, and
lotions and for application to the eye or for intracisternal or
intraspinal application. Such solutions, particularly those
intended for ophthalmic use, can be formulated as 0.01% -10%
isotonic solutions, pH about 5-7, with appropriate salts. The
compounds can be formulated as aerosols for topical application,
such as by inhalation (see, e.g., U.S. Pat. Nos. 4,044,126,
4,414,209, and 4,364,923, which describe aerosols for delivery of a
steroid useful for treatment inflammatory diseases, particularly
asthma).
[0536] The concentration of active compound in the drug composition
will depend on absorption, inactivation and excretion rates of the
active compound, the dosage schedule, and amount administered as
well as other factors known to those of skill in the art. For
example, the amount that is delivered is sufficient to treat the
symptoms of hypertension.
[0537] The compositions, if desired, can be presented in a package,
in kit or a dispenser device, that can contain one or more unit
dosage forms containing the active ingredient. The package, for
example, contains metal or plastic foil, such as a blister pack.
The pack or dispenser device can be accompanied by instructions for
administration. The compositions containing the active agents can
be packaged as articles of manufacture containing packaging
material, an agent provided herein, and a label that indicates the
disorder for which the agent is provided.
[0538] Methods of treatment of cytokine-mediated or
cytokine-involved diseases and immunotherapeutic methods are
provided. The modified cytokines can be used in any method of
treatment for which the unmodified cytokine is used. Hence the
modified cytokines can be used for treatment of all disorders noted
herein for the respective cytokines and for those known to those of
skill in the art for each of the others, such as immunotherapeutic
treatment (interleukins) and red blood cell expansion and stem cell
expansion. The following table summarizes exemplary uses in
addition to those noted herein of exemplary modified cytokines
provided herein: TABLE-US-00004 Cytokine Exemplary Uses, Diseases
and Treatment IL-10 anti-inflammatory treatment of chronic liver
injury and disease; myeloma Interferon-gamma
Interstitial/idiopathic pulmonary fibrosis; adjunctive
immunotherapy for immunosuppressed patients Granulocyte colony
Crohn's disease; cardiac disease; acquired and stimulating factor
congenital neutropenias; asthma Leukemia inhibitory myocardial
infarction; multiple sclerosis; factor prevention of axonal
atrophy; olfactory epithelium replacement stimulation Human growth
growth hormone deficiency; acromegaly hormone Ciliary neurotrophic
retinal degeneration treatments; factor neurodegenerative diseases
such as Huntington's; auditory degenerative diseases Leptin
obesity; pancreatitis; endometriosis Oncostatin M chronic
inflammatory diseases; rheumatoid arthritis; multiple sclerosis;
tissue damage suppression Interleukin-6 Protection from liver
injury; Crohn's disease; hematopoietic associated diseases
Interleukin-12 coxsackievirus treatment; neuroblastoma; melanoma,
renal cell carcinoma; mucosal immunity induction Erythropoietin
hypoxia; myocardial ischemia; anemia with renal failure and cancer
treatments Granulocyte- stimulate antigen presenting cells;
anti-tumor macrophage colony activity for leukemia, melanoma, and
breast, liver stimulating factor and renal cell carcinomas;
adjunctive immunotherapy for immunosuppressed patients; autoimmune
disease Interleukin-2 immune reactivation after chemotherapy;
melanoma; colon carcinoma Interleukin-3 leukemia cell targeting;
motor neuropathy; amyotrophic lateral sclerosis; asthma
Interleukin-4 allergic asthma; lupus Interleukin-5 treatment for
parasites; asthma; allergic diseases accompanied by eosinophilia
Interleukin-13 intracellular infections; B-cell cancers; asthma
Flt3 ligand prostate cancer; myeloid leukemia; engraftment of
allogenic hematopoietic stem cells Stem cell factor hepatic injury;
asthma; hematopoietic engraftment
[0539] Treatment can be effected by any suitable route of
administration using suitable formulations. If necessary, a
particular dosage and duration and treatment protocol can be
empirically determined or extrapolated.
K. EXAMPLES
[0540] The following examples are included for illustrative
purposes only and are not intended to limit the scope of the
invention. The specific methods exemplified can be practiced with
other species. The examples are intended to exemplify generic
processes.
Example 1
[0541] This example describes a plurality of chronological steps
including steps from (i) to (viii): [0542] (i) cloning of
IFN.alpha. cDNA in a mammalian cell expression plasmid (section
A.1) [0543] (ii) generation of a collection of targeted mutants on
the IFN.alpha. cDNA in the mammalian cell expression plasmid
(section B) [0544] (iii) production of IFN.alpha. mutants in
mammalian cells (section C.1) [0545] (iv) screening and partial in
vitro characterization of IFN.alpha. mutants produced in mammalian
cells in search of lead mutants (section D) [0546] (v) cloning of
the lead mutants into a bacterial cell expression plasmid (section
A.2) [0547] (vi) expression of lead mutants in bacterial cells
(section C.2) [0548] (vii) in vitro characterization of lead
mutants produced in bacteria (section D) [0549] (viii) in vivo
characterization of lead mutants produced in bacteria (section E).
A. Cloning of IFN.alpha.-2b Encoding cDNA
[0550] A.1. Cloning of IFN.alpha.-2b cDNA in a Mammalian Cell
Expression Plasmid
[0551] The IFN.alpha.-2b cDNA was first cloned into a mammalian
expression vector, prior to the generation of the selected
mutations. A collection of mutants was then generated such that
each individual mutant was created and processed individually,
physically separated from each other and in addressable arrays. The
mammalian expression vector pSSV9 CMV 0.3 pA was engineered as
follows:
[0552] The pSSV9 CMV 0.3 pA was cut by PvuII and religated (this
step gets rid of the ITR functions), prior to the introduction of a
new EcoRI restriction site by Quickchange mutagenesis (Stratagene).
The oligonucleotides primers were: TABLE-US-00005 EcoRI forward
primer (SEQ ID NO:218)
5'-GCCTGTATGATTTATTGGATGTTGGAATTCCCTGATGCGGTATTTTC TCCTTACG-3'
EcoRI reverse primer (SEQ ID NO:219)
5'-CGTAAGGAGAAAATACCGCATCAGGGAATTCCAACATCCAATAAATC ATACAGGC-3'.
[0553] The construct sequence was confirmed by using the following
oligonucleotides: TABLE-US-00006 Seq ClaI forward primer: (SEQ ID
NO:220) 5'-CTGATTATCAACCGGGGTACATATGATTGAC-ATGC-3' Seq XmnI reverse
primer (SEQ ID NO:221) 5'-TACGGGATAATACCGCGCCACATAGCAGAA-C-3'.
[0554] Then, the XmnI-ClaI fragment containing the newly introduced
EcoRI site was cloned into pSSV9 CMV 0.3 pA (SSV9 is a clone
containing the entire adeno-associated virus (AAV) genome inserted
into the PvuI site of plasmid pEMBL (see, Du et al. (1996) Gene
Ther 3:254-261)) to replace the corresponding wild-type fragment
and produce construct pSSV9-2EcoRI.
[0555] The DNA sequence of the IFN.alpha.-2b cDNA, which was
inserted into the mammalian vector pDG6 (ATCC accession No. 53169),
was confirmed using a pair of internal primers. The sequences of
the IFN.alpha.-2b-related oligonucleotides for sequencing follow:
TABLE-US-00007 Seq forward primer: (SEQ ID NO:222)
5'-CCTGATGAAGGAGGACTC-3' Seq reverse primer: (SEQ ID NO:223)
5'-CCAAGCAGCAGATGAGTC-3'.
[0556] Since the beginning of the IFN.alpha.-2b encoding cDNA (the
signal peptide encoding sequence) is absent in pDG6, it was added
using the oligonucleotide (see below) to the amplified gene. First,
the IFN.alpha.-2b cDNA was amplified by PCR using pDG6 as template
using the following oligonucleotides as primers: TABLE-US-00008
IFN.alpha.-2b 5' primer (SEQ ID NO:224)
5'-TCAGCTGCAAGTCAAGCTGCTCTGTGGGCTG-3' IFN.alpha.-2b 3' primer (SEQ
ID NO:225) 5'-GCTCTAGATCATTCCTTACTTCTTAAACTTTCTTGCAAGTTTGTTGA
C-3'
[0557] The PCR product was then used in an overlapping PCR using
the following oligonucleotide sequences, having Hind III or XbaI
restriction sites (underlined) or the DNA sequence missing in pDG6
(underlined): TABLE-US-00009 IFN.alpha.-2b HindIII primer (SEQ ID
NO:226) 5'-CCCAAGCTTATGGCCTTGACCTTTGCTTTACT-GGTG-3' IFN.alpha.-2b
XbaI primer (SEQ ID NO:227)
5'-GCTCTAGATCATTCCTTACTTCTTAAACTTTC-TTGCAAGTTTGTTG AC-3'
IFN.alpha.-2b 80 bp 5' primer (SEQ ID NO:228)
5'-CCCAAGCTTATGGCCTTGACCTTTGCTTTA-CTGGTGGCCCTCCTGG
TGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTG-3'.
[0558] The entire IFN.alpha.-2b cDNA was cloned into the pTOPO-TA
vector (Invitrogen). After checking gene sequence by automatic DNA
sequencing, the HindIII-XbaI fragment containing the gene of
interest was subcloned into the corresponding sites of pSSV9-2EcoRI
to produce pAAV-EcoRI-IFNalpha-2b (pNB-AAV-IFN alpha-2b).
[0559] A.2 Cloning of the IFN .alpha.-2b Leads in an E. coli
Expression Plasmid
A.2.1 Characterization of the Bacterial Cells
[0560] BL21-CodonPlus(DE3)-RP.RTM. competent Escherichia coli cells
are derived from Stratagene's high-performance BL21-Gold competent
cells. These cells enable efficient high-level expression of
heterologous proteins in E. coli. Efficient production of
heterologous proteins in E. coli is frequently limited by the
rarity, in E. coli, of certain tRNAs that are abundant in the
organisms from which the heterologous proteins are derived.
Availability of tRNAs allows high-level expression of many
heterologous recombinant genes in BL2 1-Codon Plus cells that are
poorly expressed in conventional BL21
strains.BL21-CodonPLus(DE3)-RP cells contain a ColE1-compatible,
pACYC-based plasmid containing extra copies of the argu and proL
tRNA genes.
A.2.2 Cloning of Wild-Type IFN .alpha.
[0561] To express IFN.alpha.-2b in E. coli cDNA encoding the mature
form of IFN.alpha.-2b was finally cloned into the plasmid pET-11
(Novagen). Briefly, this cDNA fragment was amplified by PCR using
the primers SEQ ID Nos. 1306 and 1305, respectively: TABLE-US-00010
FOR-IFNA- 5' AACATATGTGTGATCTGCCTCAAACCCACAGCCTGGGTAGC 3' REV-IFNA-
5' AAGGATCCTCATTCCTTACTTCTTAAACTTTCTTGCAAGTTTGTT G 3',
from pSSV9-EcoRI-IFN .alpha.-2b (see above), which contains
full-length IFN-2 alpha cDNA as a matrix, using Herculase
DNA-polymerase (Stratagene). The PCR fragment was subcloned into
pTOPO-TA vector (Invitrogen) yielding pTOPO-IFN .alpha.-2b. The
sequence was verified by sequencing. pET11 IFN .alpha.-2b was
prepared by insertion of the NdeI-Bam HI (Biolabs) fragment from
pTOPO-IFN .alpha.-2b into the NdeI-Bam HI sites of pET 11. The DNA
sequence of the resulting pET 11-IFN .alpha.-2b construct was
verified by sequencing and the plasmid was used for IFN .alpha.-2b
expression in E. coli.
A.2.3 Cloning of IFN .alpha.-2b Mutants from the Mammalian
Expression Plasmid into the E. coli Expression Plasmid
[0562] Lead mutants of Interferon alpha were first generated in the
pSSV9-IFN.alpha.-EcoRI plasmid. With the only exception of E159H
and E159Q, all mutants were amplified using the primers below.
Primers contained NdeI (in Forward) and BamHI (in Reverse)
restriction sites: TABLE-US-00011 FOR-IFNA- (SEQ ID No. 1306 5'
AACATATGTGTGATCTGCCTCAAACCCACAGCCTGGGTAGC 3'; and REV-IFNA- (SEQ ID
No. 1305) 5' AAGGATCCTCATTCCTTACTTCTTAAACTTTCTTGCAAGTTTGTT G
3'.
[0563] Mutants E159H and E159Q were amplified using the following
primers on reverse side (primer forward was the same than described
above): TABLE-US-00012 REV-IFNA-E159H- SEQ ID No. 1304 5'
AAGGATCCTCATTCCTTACTTCTTAAACTGTGTTGCAAGTTTGTT G 3' above; and
REV-IFNA-E159Q- SEQ ID No. 1305 5'
AAGGATCCTCATTCCTTACTTCTTAAACTCTGTTGCAAGTTTGTT G 3'.
Mutants were amplified with Pfu Turbo Polymerase (Stratagene). PCR
products were cloned into pTOPO plasmid (Zero Blunt TOPO PCR
cloning kit, Invitrogen). The presence of the desired mutations was
checked by automatic sequencing. The NdeI+BamHI fragment of the
pTOPO-IFN.alpha. positive clones was then cloned into NdeI+BamHI
sites of the pET11 plasmid. B. Construction of a Collection of
IFN.alpha.-2b Mutants in a Mammalian Expression Plasmid
[0564] A series of mutagenic primers was designed to generate the
appropriate site-specific mutations in the IFN.alpha.-2b cDNA.
Mutagenesis reactions were performed with the Chameleon mutagenesis
kit (Stratagene) using pNB-AAV-IFN.alpha.-2b as the template. Each
individual mutagenesis reaction was designed to generate one single
mutant protein. Each individual mutagenesis reaction contains one
and only one mutagenic primer. For each reaction, 25 pmoles of each
(phosphorylated) mutagenic primer were mixed with 0.25 pmoles of
template, 25 pmoles of selection primer (introducing a new
restriction site), and 2 .mu.l of 10.times. mutagenesis buffer (100
mM Tris-acetate pH 7.5; 100 mM MgOAc; 500 mM KOAc pH 7.5) into each
well of 96 well-plates. To allow DNA annealing, PCR plates were
incubated at 98.degree. C. during 5 min and immediately placed 5
min on ice, before incubating at room temperature during 30 min.
Elongation and ligation reactions were allowed by addition of 7
.mu.l of nucleotide mix (2.86 mM each nucleotide; 1.43.times.
mutagenesis buffer) and 3 .mu.l of a freshly prepared enzyme
mixture of dilution buffer (20 mM Tris HCl pH7.5; 10 mM KCl; 10 mM
.beta.-mercaptoethanol; 1 mM DTT; 0.1 mM EDTA; 50% glycerol),
native T7 DNA polymerase (0.025 U/.mu.l), and T4 DNA ligase (1
.mu.l) in a ratio of 1:10, respectively. Reactions were incubated
at 37.degree. C. for 1 h before inactivation of T4 DNA ligase at
72.degree. C. during 15 min. In order to eliminate the parental
plasmid, 30 .mu.l of a mixture containing 1.times. enzyme buffer
and 10 U of restriction enzyme was added to the mutagenic reactions
followed by incubation at 37.degree. C. for at least 3 hours. Next,
90 .mu.l aliquots of XLmutS competent cells (Stratagene) containing
25 mM .beta.-mercaptoethanol were place in ice-chilled deep-well
plates. Then, plates were incubated on ice for 10 min with gentle
vortex every 2 min. Transformation of competent cells was performed
by adding aliquots of the restriction reactions ( 1/10 of reaction
volume) and incubating on ice for 30 min. A heat pulse was
performed in a 42.degree. C. water bath for 45 s, followed by
incubation on ice for 2 minutes. Preheated SOC medium (0.45 ml) was
added to each well and plates were incubated at 37.degree. C. for 1
h with shaking. In order to enrich for mutated plasmids, 1 ml of
2.times.YT broth medium supplemented with 100 .mu.g/ml ampicillin
was added to each transformation mixture followed by overnight
incubation at 37.degree. C. with shaking. Plasmid DNA isolation was
performed by alkaline lysis using Nucleospin Multi-96 Plus Plasmid
Kit (Macherey-Nagel) according to the manufacturer's instructions.
Selection of mutated plasmids was performed by digesting 500 .mu.g
of plasmid preparation with 10 U of selection endonuclease in an
overnight incubation at 37.degree. C. A fraction of the digested
reactions ( 1/10 of the total volume) was transformed into 40 .mu.l
of Epicurian coli XL1-Blue competent cells (Stratagene)
supplemented with 25 mM .beta.-mercaptoethanol.
[0565] Transformation was performed was as described above.
Transformants were selected on LB-ampicillin agar plates incubated
overnight at 37.degree. C. Isolated colonies were picked up and
grown overnight at 37.degree. C. into deep-well plates. Four clones
per reaction were screened by endonuclease digestion of a new
restriction site introduced by the selection primer. Finally, each
mutation that was introduced to produce this collection of
candidate LEAD IFN.alpha.-2b mutant plasmids encoding the proteins
set forth in Table 2 of Example 2 was confirmed by automatic DNA
sequencing.
C. Production of IFN.alpha.-2b Mutants
[0566] C.1 In Mammalian Cells
[0567] IFN.alpha.-2b mutants were produced in 293 human embryo
kidney (HEK) cells (obtained from ATCC), using Dulbecco's modified
Eagle's medium supplemented with glucose (4.5 g/L; Gibco-BRL) and
fetal bovine serum (10%, Hyclone). Cells were transiently
transfected with the plasmids encoding the IFN.alpha.-2b mutants as
follows: 0.6.times.10.sup.5 cells were seeded into 6 well-plates
and grown for 36 h before transfection. Confluent cells at about
70%, were supplemented with 2.5 .mu.g of plasmid (IFN.alpha.-2b
mutants) and 10 mM poly-ethylene-imine (25 KDa PEI, Sigma-Aldrich).
After gently shaking, cells were incubated for 16 h. Then, the
culture medium was changed with 1 ml of fresh medium supplemented
with 1% of serum. IFN.alpha.-2b was measured on culture
supernatants obtained 40 h after transfection and stored in
aliquots at -80.degree. C. until use.
[0568] Supernatants containing IFN.alpha.-2b from transfected cells
were screened following sequential biological assays as follows.
Normalization of IFN.alpha.-2b concentration from culture
supernatants was performed by enzyme-linked immunoabsorbent assay
(ELISA) using a commercial kit (R & D) and following the
manufacturer's instructions. This assay includes plates coated with
an IFN.alpha.-2b monoclonal antibody that can be developed by
coupling a secondary antibody conjugated to the horseradish
peroxidase (HRP). IFN.alpha.-2b concentrations on samples
containing (i) wild type IFN.alpha.-2b produced under comparable
conditions as the mutants, (ii) the IFN.alpha.-2b mutants and (iii)
control samples(produced from cells expressing GFP) were estimated
by using an international reference standard provided by the NIBSC,
UK.
[0569] C.2 In Bacteria
[0570] A volume of 200 ml of culture medium
(LB/Ampicillin/Chloramphenicol) was inoculated with 5 ml of
pre-culture BL21-pCodon+-pET-IFN .alpha.-2b muta overnight at
37.degree. C. with constant shaking (225 rpm). The production of
IFN .alpha.-2b was induced by the addition of 50 .mu.l of 2M IPTG
at DO.sub.600 nm.about.0.6.
[0571] The culture was continued for 3 additional hours and was
centrifuged at 4.degree. C. and 5000 g for 15 minutes. The
supernatant (culture medium) was discarded and bacteria were lysed
in 8 ml of lysis buffer by thermal shock (freezing - thawing:
37.degree. C.-15 min; -80.degree. C.-10 min; 37.degree. C.-15 min;
-80.degree. C.-10 min; 37.degree. C.-15 min). After centrifugation
(10000 g, 15 min, 4.degree. C.), the supernatant (soluble proteins
fraction) was discarded, and the precipitated material (insoluble
protein fraction containing the IFN .alpha.-2b protein as inclusion
bodies) was purified.
[0572] C.3 Pre-purification of IFN .alpha.-2b as Inclusion Bodies
in E. coli
C.3.1 Washing of Inclusion Bodies by Sonication
[0573] Pellets containing the inclusion bodies were suspended in 10
ml of buffer and sonicated (80 watts) on ice, 1 second "on," 1
second "off" for a total of 4 min. Suspensions were then
centrifuged (4.degree. C., 10000 g, 15 min), and supernatants were
recovered. Pellets were resuspended in 10 ml of buffer for a new
sonication/centrifugation cycle. Triton X-100 was then eliminated
by two additional cycles of sonication/centrifugation with buffer.
Pellets containing the inclusion bodies were recovered and
dissolved. The washed supernatants were stored at 4.degree. C.
C.3.2 Solubilization of Inclusion Bodies by Denaturation
[0574] Once washed, the inclusion bodies were solubilized in buffer
at a concentration estimated in 0.3 mg/ml measuring the OD280
(considering the coefficient of molar extinction of IFN
.alpha.-2b). Solubilization was carried out overnight at 4.degree.
C., under shaking.
C.3.3 Renaturation of IFN .alpha.-2b by Dialysis of GdnHCl
[0575] Samples contained 1 mg of protein at 0.3 mg/ml (5 ml in
total) in buffer. The GdnHCl (Guanidium hydrochloride) present in
the samples was eliminated by dialysis (minimum membrane cut=10
kDa) overnight at 4.degree. C. against buffer (1 litre) (final
concentration of GdnHCl: 43 mM). Next, samples were further
dialysed against 1 litre of buffer during 2.5 h. This step was
repeated two additional times. After dialysis, very little
precipitate was visible.
D. Screening and in vitro Characterization of IFN .alpha.-2b
Mutants
[0576] Two activities were measured directly on IFN samples:
antiviral and antiproliferation activities. Dose
(concentration)-response (activity) experiments for antiviral or
antiproliferation activity permitted calculation of the "potency"
for antiviral and antiproliferation activities, respectively.
Antiviral and antiproliferation activities also were measured after
incubation with proteolytic samples, such as specific proteases,
mixtures of selected proteases, human serum or human blood.
Assessment of activity following incubation with proteolytic
samples allowed to determine the residual (antiviral or
antiproliferation) activity and the respective kinetics of
half-life upon exposure to proteases.
[0577] D.1. Antiviral Activity
[0578] IFN.alpha.-2b protects cells against viral infection by a
complex mechanism devoted to create an unfavorable environment for
viral proliferation. Cellular antiviral response due to
IFN.alpha.-2b (IFN anti-viral assay) was assessed using an
interferon-sensitive HeLa cell line (ATCC accession no. CCL-2)
treated with the encephalomyocarditis virus (EMCV). The assessment
of either the virus-induced cytopathic effects (CPE) or the amount
of EMCV mRNA in extracts of infected cells by RT-PCR was used to
determine IFN.alpha. activity in samples.
D.1.1 Antiviral Activity--Measure by RT-PCR
[0579] Confluent cells were trypsinized and plated at density
2.times.10.sup.4 cells/well in DMEM 5% SVF medium (Day 0). Cells
were incubated with IFN .alpha.-2b (at a concentration of 500 U/ml)
to get 500 pg/mI and 150 pg/well (100 .mu.l of IFN solution),
during 24 h at 37.degree. C. prior to be challenged with EMCV
(1/1000 dilution; MOI 100). After an incubation of 16 h, when
virus-induced CPE was near maximum in untreated cells, the number
of EMCV particles in each well was determined by RT-PCR
quantification of EMCV mRNA, using lysates of infected cells. RNA
from cell extracts was purified after a DNAse/proteinase K
treatment (Applied Biosystems). The CPE was evaluated using both
Uptibleu (Interchim) and MTS (Promega) methods, which are based on
detecting bio-reductions produced by the metabolic activity of
cells in a flourometric and calorimetric manner, respectively. In
order to produce a standard curve for EMCV quantification, a 22 bp
DNA fragment of the capsid protein-cDNA was amplified by PCR and
cloned into pTOPO-TA vector (Invitrogen). Next, RT-PCR
quantification of known amounts of pTOPO-TA-EMCV capsid gene was
performed using the One-step RT-PCR kit (Applied Biosystems) and
the following EMCV-related (cloning) oligonucleotides and probe:
TABLE-US-00013 EMCV forward primer (SEQ ID NO:229)
5'-CCCCTACATTGAGGCATCCA-3' EMCV reverse primer (SEQ ID NO:230)
5'-CAGGAGCAGGACAAGGTCACT-3' EMCV probe (SEQ ID NO:231)
5'-(FAM)CAGCCGTCAAGACCCAACCGCT(TAMR A)-3'.
D.1.2 Antiviral Activity--Measure by CPE
[0580] Antiviral activity of IFN .alpha.-2b was determined by the
capacity of the cytokine to protect HeLa cells against EMC (mouse
encephalomyocarditis) virus-induced cytopathic effects. The day
before, HeLa cells (2.times.10.sup.5 cells/ml) were seeded in
flat-bottomed 96-well plates containing 100 .mu.l/well of
Dulbecco's MEM-Glutamaxl-sodium pyruvate medium supplemented with
5% SVF and 0.2% of gentamicin. Cells were growth at 37.degree. C.
in an atmosphere of 5% CO.sub.2 for 24 hours.
[0581] Two-fold serial dilutions of interferon samples were made
with MEM complete media into 96-Deep-Well plates with final
concentration ranging from 1600 to 0.6 pg/ml. The medium was
aspirated from each well and 100 .mu.l of interferon dilutions were
added to HeLa cells. Each interferon sample dilution was assessed
in triplicate. The two last rows of the plates were filled with 100
.mu.l of medium without interferon dilution samples in order to
serve as controls for cells with and without virus.
[0582] After 24 hours of growth, a 1/1000 EMC virus dilution
solution was placed in each well except for the cell control row.
Plates were returned to the CO.sub.2 incubator for 48 hours. Then,
the medium was aspirated and the cells were stained for 1 hour with
100 .mu.l of Blue staining solution to determine the proportion of
intact cells. Plates were washed in a distilled water bath. The
cell bound dye was extracted using 100 .mu.l of ethylene-glycol
mono-ethyl-ether (Sigma). The absorbance of the dye was measured
using an Elisa plate reader (Spectramax). The antiviral activity of
IFN .alpha.-2b samples (expressed as number of IU/mg of proteins)
was determined as the concentration needed for 50% protection of
the cells against EMC virus-induced cytopathic effects. For
proteolysis experiments, each point of for the kinetic measurements
was assessed at 500 and 166 pg/ml in triplicate.
[0583] D.2 Antiproliferation Activity
[0584] Anti-proliferative activity of interferon.alpha.-2b was
determined by the capacity of the cytokine to inhibit proliferation
of Daudi cells. Daudi cells (1.times.10.sup.4 cells) were seeded in
flat-bottomed 96-well plates containing 50 .mu.l/well of RPMI 1640
medium supplemented with 10% SVF, 1.times. glutamine and 1 ml of
gentamicin. No cell was added to the last row ("H" row) of the
flat-bottomed 96-well plates in order to evaluate background
absorbance of culture medium.
[0585] At the same time, two-fold serial dilutions of interferon
samples were made with RPMI 1640 complete media into 96-Deep-Well
plates with final concentration ranging from 6000 to 2.9 pg/ml.
Interferon dilutions (50 .mu.l) were added to each well containing
50 .mu.l of Daudi cells. The total volume in each well should now
be 100 .mu.l. Each interferon sample dilution was assessed in
triplicate. Each well of the "G" row of the plates was filled with
50 .mu.l of RPMI 1640 complete media in order to be used as
positive control. The plates are incubated for 72 hours at
37.degree. C. in a humidified, 5% CO.sub.2 atmosphere.
[0586] After 72 hours of growth, 20 .mu.l of Cell titer 96 Aqueous
one solution reagent (Promega) was added to each well and incubated
1H30 at 37.degree. C. in an atmosphere of 5% CO.sub.2. To measure
the amount of colored soluble formazan produced by cellular
reduction of the MTS, the absorbance of the dye was measured using
an Elisa plate reader (Spectramax) at 490 nm.
[0587] The corrected absorbances ("H" row background value
subtracted) obtained at 490 nm were plotted versus concentration of
cytokine. The ED50 value was calculated by determining the X-axis
value corresponding to one-half the difference between the maximum
and minimum absorbance values. (ED50=the concentration of cytokine
necessary to give one-half the maximum response).
[0588] D.3 Treatment of IFN .alpha.-2b with Proteolytic
Preparations
[0589] Mutants were treated with proteases in order to identify
resistant molecules. The resistance of the mutant IFN .alpha.-2b
molecules compared to wild-type IFN .alpha.-2b against enzymatic
cleavage (30 min, 25.degree. C.) by a mixture of proteases
(containing 1.5 .mu.g of each of the following proteases (1% wt/wt,
Sigma): .alpha.-chymotrypsin, carboxypeptidase, endoproteinase
Arg-C, endoproteinase Asp-N, endoproteinase Glu-C, endoproteinase
Lys-C, and trypsin) was determined. At the end of the incubation
time, 10 .mu.l of anti-proteases complete, mini EDTA free, Roche
(one tablet was dissolved in 10 ml of DMEM and then diluted to
1/1000) was added to each reaction in order to inhibit protease
activity. Treated samples were then used to determine residual
antiviral or antiproliferation activities.
[0590] D.4 Protease Resistance--Kinetic Analysis
[0591] The percent of residual IFN .alpha.-2b activity over time of
exposure to proteases was evaluated by a kinetic study using either
(a) 15 pg of chymotrypsin (10% wt/wt), (b) a lysate of human blood
at dilution 1/100, (c) 1.5 pg of protease mixture, or (d) human
serum. Incubation times were: 0 h, 0.5 h, 1 h, 4 h, 8 h, 16 h, 24 h
and 48 h. Briefly, 20 .mu.l of each proteolytic sample (proteases,
serum, blood) was added to 100 .mu.l of IFN .alpha.-2b at 1500
pg/ml (500 U/ml) and incubated for variable times, as indicated. At
the appropriate time points, 10 .mu.l of anti-proteases mixture,
mini EDTA free, Roche (one tablet was dissolved in 10 ml of DMEM
and then diluted to 1/500) was added to each well in order to stop
proteolysis reactions. Biological activity assays were then
performed as described for each sample in order to determine the
residual activity at each time point.
[0592] D.5 Performance
[0593] The various biological activities, protease resistance and
potency of each individual mutant were analyzed using a
mathematical model and algorithm (NautScanTM; described in French
Patent No. 9915884; (published as International PCT application No.
WO 01/44809 based on PCT no PCT/FR00/03503). Data was processed
using a Hill equation-based model that uses key feature indicators
of the performance of each individual mutant. Mutants were ranked
based on the values of their individual performance and those on
the top of the ranking list were selected as leads.
E. Pharmacokinetics of Selected Lead Mutants in Mice
[0594] IFN.alpha.-2b mutants selected on the basis of their overall
performance in vitro, were tested for pharmacokinetics in mice in
order to have an indication of their half-life in blood in vivo.
Mice were treated by subcutaneous (SC) injection with aliquots of
each of a number of selected lead mutants. Blood was collected at
increasing time points between 0.5 and 48 hours after injection.
Immediately after collection, 20 ml of anti-protease solution were
added to each blood sample. Serum was obtained for further
analysis. Residual IFN-A activity in blood was determined using the
tests described in the precedent sections for in vitro
characterization. Wild-type IFN .alpha. (that had been produced in
bacteria under comparable conditions as the lead mutants) as well
as a pegylated derivative of IFN .alpha., Pegasys (Roche), also
were tested for pharmacokinetics in the same experiments.
Example 2
[0595] This example demonstrates the 2-dimensional (2D)scanning of
IFN.alpha.-2b for increased resistance to proteolysis. For results,
see FIGS. 6(A)-6(N), 6(T) and 6(U). [0596] A) Identifying some or
all possible target sites on the protein sequence that are
susceptible to digestion by one or more specific proteases (these
sites are the is-HITs).
[0597] Because IFN.alpha.-2b is administered as a therapeutic
protein in the blood stream, a set of proteases was identified that
were expected to broadly mimic the protease contents in serum. From
that list of proteases, a list of the corresponding target amino
acids was identified (shown in parenthesis) as follows:
.alpha.-chymotrypsin (F, L, M, W, and Y), endoproteinase Arg-C (R),
endoproteinase Asp-N (D), endoproteinase Glu-C (E), endoproteinase
Lys-C (K), and trypsin (K and R) Carboxypeptidase Y, which cleaves
non-specifically from the carboxy-terminal ends of proteins, was
also included in the protease mixture. The distribution of the
target amino acids over the protein sequence spreads over the
complete length of the protein, suggesting that the protein is
potentially sensitive to protease digestion all over its sequence
(FIG. 1A). In order to restrict the number of is-HITs to a lower
number of candidate positions, the 3-dimensional structure of the
IFN.alpha.-2b molecule (PDB code 1RH2) was used to identify and
select only those residues exposed on the surface, while discarding
from the candidate list those which remain buried in the structure,
and therefore stay less susceptible to proteolysis (FIG. 1B).
[0598] B) Identifying appropriate replacing amino acids, specific
for each is-HIT, such that if used to replace one or more of the
original, such as native, amino acids at that specific is-HIT, they
can be expected to increase the is-HIT amino acid position's
resistance to digestion by protease while at the same time,
maintaining or improving the requisite biological activity of the
protein (these replacing amino acids are the candidate LEADs).
[0599] To select the candidate replacing amino acids for each
is-HIT position, PAM250 matrix based analysis was used (FIG. 2). In
one embodiment, the two highest values in PAM250 matrix,
corresponding to the highest occurrence of substitutions between
residues ("conservative substitutions" or "accepted point
mutations"), were chosen (FIG. 3). Whenever only a conservative
substitution was available for a given high value of the PAM250,
the following higher value was selected and the totality of
conservative substitutions for this value was considered. The
replacement of amino acids that are exposed on the surface by
cysteine residues (as shown in FIG. 3, while replacing Y by H or I)
was explicitly avoided, since this change would potentially lead to
the formation of intermolecular disulfide bonds.
[0600] Thus, based on the nature of the challenging proteases, and
on evolutionary considerations as well as protein structural
analysis, a strategy was defined for the rational design of human
IFN.alpha.-2b mutants having increased resistance to proteolysis
which could produce therapeutic proteins having a longer half-life.
By using the algorithm PROTEOL (see, e.g., infobiogen.fr), a list
of residues along the IFN.alpha.-2b sequence was established, which
can be recognized as a substrate for different enzymes present in
the serum. Because the number of residues in this particular list
was high, the 3-dimensional structure of IFN.alpha.-2b obtained
from the NMR structure of IFN.alpha.-2a (PDB code 1ITF) was used to
select only those residues exposed to the solvent. Using this
approach, 42 positions were identified, which numbering is that of
the mature protein (SEQ ID NO:1): L3, P4, R12, R13, M16, R22, K23,
F27, L30, K31, R33, E41, K49, E58, K70, E78, K83, Y89, E96, E107,
P109, L110, E113, L117, R120, K121, R125, L128, K131, E132, K133,
K134, Y135, P137, M148, R149, E159, L161, R162, K164, and E165.
Each ofthese positions was replaced by amino acid residues, such
that they are defined -as compatible by the substitution matrix
PAM250 while at the same time the replacement amino acids do not
generate new sites for proteases.
[0601] The list of performed residue substitutions as determined by
PAM250 analysis is as follows:
[0602] R to H, Q
[0603] E to H, Q
[0604] K to Q, T
[0605] L to V, I
[0606] M to I, V
[0607] P to A, S
[0608] Y to I, H. [0609] C) Systematically introducing the specific
replacing amino acids (candidate LEADs) at every specific is-HIT
position to generate a collection containing the corresponding
mutant molecules.
[0610] The individual IFN.alpha.-2b mutants are generated, produced
and phenotypically characterized one-by-one, in addressable arrays
as set forth in Example 1, such that each mutant molecule contains
initially amino acid replacements at only one is-HIT site. LEAD
positions were obtained in IFN.alpha.-2b variants after a screening
for protection against proteases, and comparing protease-untreated
and protease-treated variant preparations with the corresponding
conditions for the wild-type IFN.alpha.-2b. The percent of residual
(anti-viral) activity for the IFN.alpha.-2b E113H variant after
treatment with chymotrypsin, protease mixture, blood lysate or
serum was compared to the treated wild-type IFN.alpha.-2b. Selected
IFN.alpha.-2b LEADs are shown in Table 2.
[0611] A top and side view of IFN.alpha.-2b structure in ribbon
representation (obtained from NMR structure of IFN.alpha.-2b, PDB
code 1ITF) depict residues in "space filling" defining (1) the
"receptor binding region" as deduced either by "alanine scanning"
data and studies by Piehler et al., J. Biol. Chem.,
275:40425-40433, 2000, and Roisman et al., Proc. NatL. Acad. Sci
USA, 98:13231-13236, 2001, and (2) replacing residues (LEADs) for
resistance to proteolysis. TABLE-US-00014 TABLE 2 Selected LEADs of
IFN.alpha.-2b following protease resistance SEQ ID Proteolysis IFN
antiviral Mutant No. protection activity F27V 83 Pseudo wt Pseudo
wt R33H 86 Pseudo wt Pseudo wt E41Q 87 Increased Increased E41H 88
Pseudo wt Increased E58Q 89 Increased Pseudo wt E58H 90 Increased
Increased E78Q 92 Increased Increased E78H 93 Increased Increased
Y89H 1303 Pseudo wt Pseudo wt E107Q 95 Increased Pseudo wt E107H 96
Increased Pseudo wt P109A 97 Pseudo wt Pseudo wt L110V 98 Pseudo wt
Pseudo wt M111V 978 Pseudo wt Pseudo wt E113H 101 Increased Pseudo
wt L117V 102 Increased Pseudo wt L117I 103 Increased Pseudo wt
K121Q 104 Increased Pseudo wt R125H 106 Increased Increased R125Q
107 Increased Increased K133Q 114 Increased Increased E159H 125
Increased Pseudo wt E159Q 124 Increased Pseudo wt
Example 3
Stabilization of IFN.alpha.-2b by Creation of N-Glycosylation
Sites
[0612] The creation of N-glycosylation sites on the protein was a
second strategy that was used to stabilize IFN.alpha.-2b. Natural
human IFN.alpha.-2b contains a unique O-glycosylation site at
position 129 (the numbering corresponds to the mature protein; SEQ
ID NO:1), however, no N-glycosylation sites are found in this
sequence. N-glycosylation sites are defined by the N-X-S or N-X-T
consensus sequences. Glycosylation has been found to play a role in
protein stability. For example, glycosylation has been found to
increase bioavailability via higher metabolic stability and reduced
clearance. In order to generate more stable IFN.alpha.-2b variants,
the N-glycosylation consensus sequences indicated above were
introduced in the IFN.alpha.-2b sequence by mutagenesis. Variants
of IFN.alpha.-2b carrying new glycosylation sites were assessed as
previously described.
[0613] The structure of IFN.alpha.-2b is characterized by a helix
bundle composed of 5 helices (A, B, C, D and E) connected with each
other by a series of loops (a large AB loop and three shorter BC,
CD, DE loops). The helices are joined together by two disulfide
bridges between residues 1/98 and 29/138 of SEQ ID NO:1. The loops
are contemplated herein to represent preferential sites for
glycosylation given their exposure. Therefore, N-glycosylation
sites (N-X-S or N-X-T) were created in each of the loop sequences
(Table 3). Selected LEADs and pseudo wild-type IFNa-2b mutants
after screening for addition of glycosylation sites are shown in
Table 4. TABLE-US-00015 TABLE 3 In silico HITs for addition of
glycosylation sites on IFN.alpha.-2b Codon No. SEQ ID No. N-X-S SEQ
ID No. N-X-T c2-4 D2N/P4S D2N/P4T c3-5 L3N/Q5S L3N/Q5T c4-6 P4N/T6S
P4N/T6T c5-7 127 Q5N/H7S 128 Q5N/H7T c6-8 129 T6N/S8S T6N/S8T c7-9
H7N/L9S H7N/L9T c8-10 130 S8N/G10S 131 S8N/G10T c9-11 L9N/S11S
L9N/S11T c10-12 132 M21N/R23S M21N/R23T c22-24 R22N/I24S R22N/I24T
c23-25 R23N/S25S 133 R23N/S25T c24-26 134 I24N/L26S I24N/L26T
c25-27 135 S25N/F27S 136 S25N/F27T c26-28 137 L26N/S28S 138
L26N/S28T c28-30 S28N/L30S S28N/L30T c30-32 139 L30N/D32S L30N/D32T
c31-33 K31N/R33S K31N/R33T c32-34 D32N/H34S D32N/H34T c33-35 140
R33N/D35S 141 R33N/D35T c34-36 142 H34N/F36S 143 H34N/F36T c35-37
144 D35N/G37S D35N/G37T c36-38 145 F36N/F38S 146 F36N/F38T c37-39
G37N/P39S 147 G37N/P39T c38-40 148 F38N/Q40S 149 F38N/Q40T c39-41
150 P39N/E41S 151 P39N/E41T c40-42 152 Q40N/E42S 153 Q40N/E42T
c41-43 E41N/F43S 155 E41N/F43T c42-44 E42N/G44S E42N/G44T c43-45
F43N/N45S F43N/N45T c44-46 156 G44N/Q46S 157 G44N/Q46T c45-47 158
N45N/F47S 159 N45N/F47T c46-48 160 Q46N/Q48S 161 Q46N/Q48T c47-49
162 F47N/K49S 163 F47N/K49T c48-50 Q48N/A50S Q48N/A50T c49-51 164
K49N/E51S K49N/E51T c50-52 A50N/T52S A50N/T52T c68-70 S68N/K70S
S68N/K70T c70-72 K70N/S72S K70N/S72T c75-77 165 A75N/D77S A75N/D77T
c77-79 D77N/T79S D77N/T79T C100-102 166 I100N/G102S 167 I100N/G102T
C101-103 Q101N/V103S Q101N/V103T C102-104 G102N/G104S G102N/G104T
C103-105 168 V103N/V105S 169 V103N/V105T C104-106 G104N/T106S 170
G104N/T106T C105-107 171 V105N/E107S V105N/E107T C10--108 172
T106N/T108S 173 T106N/T108T C107-109 174 E107N/P109S 175
E107N/P109T C108-110 T108N/I110S T108N/I110T C134-136 K134N/S136S
176 K134N/S136T C154-156 S154N/N156S S154N/N156T C155-157
T155N/L157S T155N/L157T C156-158 N156N/Q158S N156N/Q158T C157-159
177 L157N/E159S 178 L157N/E159T C158-160 Q158N/S160S 179
Q158N/S160T C159-161 180 E159N/L161S 181 E159N/L161T C160-162
S160N/R162S S160N/R162T C161-163 L161N/S163S L161N/S163T C162-164
R162N/K164S R162N/K164T C163-165 S163N/E165S S163N/E165T
[0614] TABLE-US-00016 TABLE 4 Selected LEADs and pseudo wild-type
IFN.alpha.-2b mutants after screening for addition of glycosylation
sites Proteolysis IFN antiviral Mutant SEQ ID No. protection
activity Q5N/H7S 127 Increased Pseudo wt Q5N/H7T 128 ND* ND
P39N/E41S 150 Increased Pseudo wt P39N/E41T 151 Increased Pseudo wt
Q40N/E42S 152 Increased Pseudo wt Q40N/E42T 153 Increased Pseudo wt
E41N/F43S 154 Increased Pseudo wt E41N/F43T 155 Increased Pseudo wt
F43N/N45S Increased Pseudo wt F43N/N45T ND ND G44N/Q46S 156 ND ND
G44N/Q46T 157 Increased Pseudo wt N45N/F47S 158 Increased Pseudo wt
N45N/F47T 159 Increased Pseudo wt Q46N/Q48S 160 Increased Pseudo wt
Q46N/Q48T 161 ND ND F47N/K49S 162 Increased Pseudo wt F47N/K49T 163
Increased Pseudo wt I100N/G102S 166 Pseudo wt Increased I100N/G102T
167 Pseudo wt Increased V105N/E107S 171 Pseudo wt Increased
V105N/E107T Pseudo wt Increased T106N/T108S 172 Pseudo wt Increased
T106N/T108T 173 Pseudo wt Increased E107N/P109S 174 Pseudo wt
Increased E107N/P109T 175 Pseudo wt Increased L157N/E159S 177
Pseudo wt Increased L157N/E159T 178 Pseudo wt Increased E159N/L161S
180 Pseudo wt Increased E159N/L161T 181 Pseudo wt Increased *ND,
not determined
Example 4
Redesign of Interferon .alpha.-2b Proteins
[0615] The use of the protein redesign approach provided herein
permits the generation of proteins such that they maintain
requisite levels and types of biological activity compared to the
native protein while their underlying amino acid sequences have
been significantly changed by amino acid replacement. To first
identify those amino acid positions on the IFN.alpha.-2b protein
that are involved or not involved IFN.alpha.-2b protein activity,
such as binding activity of IFN.alpha.-2b to its receptor, an
Ala-scan was performed on the IFN.alpha.-2b sequence. For this
purpose, each amino acid in the IFN.alpha.-2b protein sequence was
individually changed into Alanine. Any other amino acid,
particularly another amino acid that has a neutral effect on
structure, such as Gly or Ser, also can be used. Each resulting
mutant IFN.alpha.-2b protein was then expressed and the antiviral
activity of the individual mutants was assayed. The particular
amino acid positions that are sensitive to replacement by Ala,
referred to herein as HITs would in principle not be suitable
targets for amino acid replacement to increase protein stability,
because of their involvement in the activity of the molecule. For
the Ala-scanning, the biological activity measured for the
IFN.alpha.-2b molecules was: i) their capacity to inhibit virus
replication when added to permissive cells previously infected with
the appropriate virus and, ii) their capacity to stimulate cell
proliferation when added to the appropriate cells. The relative
activity of each individual mutant compared to the native protein
was assayed. HITS are those mutants that produce a decrease in the
activity of the protein (e.g., in this example, all the mutants
with activities below about 30% of the native activity).
[0616] In addition, to identify the HIT positions, the Alanine-scan
was used to identify the amino acid residues on IFN.alpha.-2b that
when replaced with alanine lead to a `pseudo-wild type` activity,
i.e., those that can be replaced by alanine without leading to a
decrease in biological activity.
[0617] A collection of mutant molecules was generated and
phenotypically characterized such that IFN.alpha.-2b proteins with
amino acid sequences different from the native ones but that still
elicit the same level and type of activity as the native protein
were selected. HITs and pseudo wild-type amino acid positions are
shown in Table 5. TABLE-US-00017 TABLE 5 HITs and pseudo wild-type
positions to IFN.alpha.-2b redesign HITs (viral Pseudo wt (viral
Mutants SEQ ID No. activity) activity) D2A 2 Decreased P4A 3 Pseudo
wt Q5A 4 Pseudo wt T6A 5 Pseudo wt H7A 6 Decreased S8A 7 Decreased
L9A 8 Pseudo wt G10A 9 Pseudo wt S11A 10 Decreased R12A 11
Decreased R13A 12 Decreased T14A 13 Decreased L15A 14 Decreased
M16A 15 Decreased L17A 16 Pseudo wt Q20A 17 Pseudo wt R23A 18
Decreased I24A 19 Pseudo wt S25A 20 Pseudo wt L26A 21 Decreased
S28A 22 Decreased C29A 23 Decreased L30A 24 Decreased K31A 25
Decreased D32A 26 Decreased R33A 27 Decreased D35A 28 Pseudo wt
G37A 29 Pseudo wt G39A 30 Pseudo wt E41A 31 Pseudo wt E42A 32
Pseudo wt F43A 33 Decreased N45A 34 Decreased F47A 35 Decreased
E51A 36 Pseudo wt T52A 37 Pseudo wt I53A 38 Decreased P54A 39
Pseudo wt V55A 40 Pseudo wt L56A 41 Pseudo wt H57A 42 Pseudo wt
E58A 43 Pseudo wt M59A 44 Decreased I60A 45 Pseudo wt I63A 46
Pseudo wt F64A 47 Pseudo wt N65A 48 Pseudo wt L66A 49 Decreased
F67A 50 Decreased T69A 51 Decreased K70A 52 Decreased D71A 53
Decreased S72A 54 Decreased W76A 55 Pseudo wt D77A 56 Pseudo wt
E78A 57 Pseudo wt L81A 58 Pseudo wt D82A 59 Decreased K83A 60
Decreased F84A 61 Decreased Y85A 62 Pseudo wt Y89A 63 Pseudo wt
Q90A 64 Pseudo wt Q91A 65 Decreased N93A 66 Decreased D94A 67
Decreased C98A 68 Decreased V99A 69 Decreased Q101A Decreased G104A
70 Pseudo wt L110A 71 Pseudo wt S115A 72 Pseudo wt Y122A 73
Decreased W140A 74 Decreased E146A 75 Pseudo wt
Example 5
[0618] Super LEADS of Interferon .alpha.-2b Protein by Additive
Directional Mutagenesis
[0619] The use of an additive directional mutagenesis approach
provided a method for the assembly of multiple mutations previously
present on the individual LEAD molecules in a single mutant protein
thereby generating super-LEAD mutant proteins. In this method, a
collection of nucleic acid molecules encoding a library of new
mutant molecules is generated, tested and phenotypically
characterized one-by-one in addressable arrays. Super-LEAD mutant
molecules are such that each molecule contains a variable number
and type of LEAD mutations
[0620] Using the LEADs obtained in Example 2, six series of mutant
molecules were generated with more than one mutation per molecule
as shown in Table 6. Some SuperLEAD mutant molecules were
phenotypically characterized and the results are shown in Table 7.
As shown in the table not all SuperLEADS have improved activity
compared with the original Leads; some showed decreased activity of
some type. TABLE-US-00018 TABLE 6 Schema of LEADs position for
SuperLEADS generation Series 1 m1 = E41H m1 + m2 = E41H + Y89H
Series 2 m1 = E58Q m1 + m2 = E58Q + F27V Series 3 m1 = R125H m1 +
m2 = R125H + M111V Series 4 m1 = E159H m1 + m2 = E159H + Y89H
Series 5 m1 = K121Q m1 + m2 = K121Q + P109A m1 + m2 + m3 = K121Q +
P109A + K133Q Series 6 m1 = E78H m1 + m2 = E78H + R33H m1 + m2 + m3
= E78H + R33H + E58H m1 + m2 + m3 + m4 = E78H + R33H + E58H +
L11OV
[0621] TABLE-US-00019 TABLE 7 SuperLEADs of IFN.alpha.-2b multiple
mutants Proteolysis IFN antiviral Mutant SEQ ID No. protection
activity E41H 88 Pseudo wt Increased Y89H 1303 Pseudo wt Pseudo wt
E41H/Y89H/N45D 979 Increased Increased E58Q 89 Increased Pseudo wt
F27V 83 Pseudo wt Pseudo wt E58Q/F27V 981 Increased Pseudo wt R125H
106 Increased Increased M111V 978 Pseudo wt Pseudo wt R125H/M111V
986 Increased Increased E159H 125 Y89H 1303 E159H/Y89H 987 K121Q
104 Increased Pseudo wt P109A 97 Pseudo wt Pseudo wt K133Q 114
Increased Increased K121Q/P109A 983 Increased Pseudo wt
K121Q/P109A/ 984 Increased Increased K133Q/G102R E78H 93 Increased
Increased R33H 86 Pseudo wt Pseudo wt E58H 90 Increased Increased
L110V 98 Pseudo wt Pseudo wt E78H/R33H/ 982 Decreased Decreased
E58H/L110V
Four mutants with mutations in addition to those selected by the
rational mutagenesis were generated in the E. coli MutS strain and
were detected by sequencing. The mutants were the following:
E41Q/D94G; L117V/A139G; E41H/Y89H/N45D; and
K121Q/P109A/K133Q/G102R.
Example 6
[0622] Cloning of IFN .beta. in pNAUT, a Mammalian Cell Expression
Plasmid
[0623] The cDNA encoding IFN .beta. (see, SEQ ID No. 196) was
cloned into a mammalian expression vector, prior to the generation
of the selected mutations (see, FIGS. 6(O)-6(S) and 8(A). A
collected of predesigned, targeted mutants was then generated such
that each individual mutant was created and processed individually,
physically separated form each other and in addressable arrays. The
mammalian expression vector pSSV9 CMV 0.3 pA (see, Example 1) was
engineered as follows:
[0624] The pSSV9 CMV 0.3 pA was cut by PvuII and religated (this
step gets rid of the ITR functions), prior to the introduction of a
new EcoRI restriction site by Quickchange mutagenesis (Stratagene).
The oligonucleotide sequences used, follow: TABLE-US-00020 EcoRI
forward primer: (SEQ ID NO:218)
5'-GCCTGTATGATTTATTGGATGTTGGAATTCCCTGATGCGGTATTTTC TCCTTACG-3'
EcoRI reverse prime: (SEQ ID NO:219)
5'-CGTAAGGAGAAAATACCGCATCAGGGAATTCCAACATCCAATAAATC ATACAGGC-3'
[0625] The construct sequence was confirmed by using the following
oligonucleotides: TABLE-US-00021 Seq ClaI forward primer: (SEQ ID
NO: 220) 5'- CTGATTATCAACCGGGGTACATATGATTGACATGC-3' Seq XmnI
reverse primer (SEQ ID NO: 221) 5'-TACGGGATAATACCGCGCCACATAGCAGAAC-
3'.
[0626] Then, the XmnI-ClaI fragment containing the newly introduced
EcoRI site was cloned into pSSV9 CMV 0.3 pA to replace the
corresponding wild-type fragment and produce construct
pSSV9-2EcoRI.
[0627] The IFN .beta.-cDNA was obtained from the pIFN.beta.1 (ATCC)
construct. The sequence of the IFN .beta.-cDNA was confirmed by
sequencing using the primers below: TABLE-US-00022 Seq forward
primer: 5'-CCTGATGAAGGAGGACTC-3' (SEQ ID NO: 222) Seq reverse
primer: 5'-CCAAGCAGCAGATGAGTC-3'. (SEQ ID NO: 223)
[0628] The verified IFN .beta.-encoding cDNA first was cloned into
the pTOPO-TA vector (Invitrogen). After checking of the cDNA
sequence by automatic DNA sequencing, the HindIII-XbaI fragment
containing the IFN cDNA was subcloned into the corresponding sites
of pSSV9-2EcoRI, leading to the construct pAAV-EcoRI-IFNbeta
(pNB-AAV-IFN beta) Finally the fragment Pvu II of plasmid
pNB-AAV-IFN beta was subcloned in PvuII site of pUC 18 leading the
final construct pUC-CMVIFNbetapA called pNAUT-IFNbeta.
Production and Normalization of IFN.beta. in Mammalian Cells
[0629] IFN .beta. was produced in CHO Chinese Hamster Ovarian cells
(obtained from ATCC), using Dulbecco's modified Eagle's medium
supplemented with glucose (4.5 g/L; Gibco-BRL) and fetal bovine
serum (5%, Hyclone). Cells were transiently transfected as follows:
0.6.times.10.sup.5 cells were seeded into 6 well plates and grown
for 24 h before transfection. Confluent cells at about 70%, were
supplemented with 1.0 .mu.g of plasmid (from the library of IFN
.beta. mutants) by Lipofectamine Plus reagent (Invitrogen). After
gently shaking, cells were incubated for 24 h with 1 ml of culture
medium supplemented with 1% of serum. IFN .beta. was obtained from
culture supernatants 24 h after transfection and stored in aliquots
at -80.degree. C. until use.
[0630] Preparations of IFN .beta. produced from transfected cells
were screened following sequential biological assays as follows.
Normalization of IFN .beta. concentration from culture supernatants
was performed by ELISA. IFN .beta. concentrations from wild type,
and mutant samples were estimated by using an international
reference standard provided by the NIBSC, UK.
Screening and in vitro Characterization of IFN p Mutants
[0631] Two activities were measured directly on IFN samples:
antiviral and antiproliferation activities. Dose
(concentration)--response (activity) experiments for antiviral or
antiproliferation activity allowed for the calculation of the
"potency" for antiviral and antiproliferation activities,
respectively. Antiviral and antiproliferation activities also were
measured after incubation with proteolytic samples such as specific
proteases, mixtures of selected proteases, human serum or human
blood. Assessment of activity following incubation with proteolytic
samples allowed to determine the residual (antiviral or
antiproliferation) activity and the respective kinetics of
half-life upon exposure to proteases.
Antiviral Activity--Measured by Cytopathic Effects (CPE)
[0632] Antiviral activity of IFN .beta. was determined by the
capacity of the cytokine to protect HeLa cells against EMC (mouse
encephalomyocarditis) virus-induced cytopathic effects. The day
before, HeLa cells (2.times.10.sup.5 cells/ml) were seeded in
flat-bottomed 96-well plates containing 100 .mu.l/well of
Dulbecco's MEM-Glutamaxl-sodium pyruvate medium supplemented with
5% SVF and 0.2% of gentamicin. Cells were growth at 37.degree. C.
in an atmosphere of 5% CO.sub.2 for 24 hours.
[0633] Two-fold serial dilutions of interferon samples were made
with MEM complete media into 96-Deep-Well plates with final
concentration ranging from 1600 to 0.6 pg/ml. The medium was
aspirated from each well and 100 .mu.l of interferon dilutions were
added to HeLa cells. Each interferon sample dilution was assessed
in triplicate. The two last rows of the plates were filled with 100
.mu.l of medium without interferon dilution samples in order to
serve as controls for cells with and without virus.
[0634] After 24 hours of growth, a 1/1000 EMC virus dilution
solution was placed in each well, except for the cell control row.
Plates were returned to the CO.sub.2 incubator for 48 hours. Then,
the medium was aspirated and the cells were stained for 1 hour with
100 .mu.l of Blue staining solution to determine the proportion of
intact cells. Plates were washed in a distilled water bath. The
cell bound dye was extracted using 100 .mu.l of ethylene-glycol
mono-ethyl-ether (Sigma). The absorbance of the dye was measured
using an Elisa plate reader (Spectramax). The antiviral activity of
IFN .beta. samples (expressed as number of IU/mg of proteins) was
determined as the concentration needed for 50% protection of the
cells against EMC virus-induced cytopathic effects. For proteolysis
experiments, each point of the kinetic was assessed at 800 and 400
pg/ml in triplicate.
Anti-proliferative Activity
[0635] Anti-proliferative activity of IFN .beta. was determined by
assessing the capacity of the cytokine to inhibit proliferation of
Daudi cells. Daudi cells (1.times.10.sup.4 cells) were seeded in
flat-bottomed 96-well plates containing 50 .mu.l/well of RPMI 1640
medium supplemented with 10% SVF, 1.times. glutamine and 1 ml of
gentamicin. No cell was added to the last row ("H" row) of the
flat-bottomed 96-well plates in order to evaluate background
absorbance of culture medium.
[0636] At the same time, two-fold serial dilutions of interferon
samples were made with RPMI 1640 complete media into 96-Deep-Well
plates with final concentration ranging from 6000 to 2.9 pg/ml.
Interferon dilutions (50 .mu.l) were added to each well containing
50 .mu.l of Daudi cells. The total volume in each well should now
be 100 .mu.l. Each interferon sample dilution was assessed in
triplicate. Each well of the "G" row of the plates was filled with
50 .mu.l of RPMI 1640 complete media in order to be used as
positive control. The plates were incubated for 72 hours at
37.degree. C. in a humidified, 5% CO.sub.2 atmosphere.
[0637] After 72 hours of growth, 20 .mu.l of Cell titer 96 Aqueous
one solution reagent (Promega) was added to each well and incubated
1H30 at 37.degree. C. in an atmosphere of 5% CO.sub.2. To measure
the amount of colored soluble formazan produced by cellular
reduction of the MTS, the absorbance of the dye was measured using
an Elisa plate reader (Spectramax) at 490 nm.
[0638] The corrected absorbances ("H" row background value
subtracted) obtained at 490 nm were plotted versus concentration of
cytokine. The ED50 value was calculated by determining the X-axis
value corresponding to one-half the difference between the maximum
and minimum absorbance values. (ED50=the concentration of cytokine
necessary to give one-half the maximum response).
Treatment of IFN p with Proteolytic Preparations
[0639] Mutants were treated with proteases in order to identify
resistant molecules. The resistance of the mutant IFN .beta.
molecules compared to wild-type IFN .beta. against enzymatic
cleavage (120 min, 25.degree. C.) by a mixture of proteases
(containing 1.5 pg of each of the following proteases (1% wt/wt,
Sigma): .alpha.-chymotrypsin, carboxypeptidase, endoproteinase
Arg-C, endoproteinase Asp-N, endoproteinase Glu-C, endoproteinase
Lys-C, and trypsin) was determined. At the end of the incubation
time, 10 .mu.l of anti-proteases complete, mini EDTA free, Roche
(one tablet was dissolved in 10 ml of DMEM and then diluted to
1/1000) was added to each reaction in order to inhibit protease
activity. Treated samples were then used to determine residual
antiviral or antiproliferation activities.
Protease Rresistance--Kinetic Analysis
[0640] The percent of residual IFN .beta. activity over time of
exposure to proteases was evaluated by a kinetic study using 1.5 pg
of protease mixture. Incubation times were: 0 h, 0.5 h, 2 h, 4 h, 8
h, 12 h, 24 h and 48 h. Briefly, 20 .mu.l of each proteolytic
sample (proteases, serum, blood) was added to 100 .mu.l of IFN
.beta. at 400 and 800 pg/ml and incubated for variable times, as
indicated. At the appropriate time points, 10 .mu.l of
anti-proteases mixture, mini EDTA free, Roche (one tablet was
dissolved in 10 ml of DMEM and then diluted to 1/500) was added to
each well in order to stop proteolysis reactions. Biological
activity assays were then performed as described for each sample in
order to determine the residual activity at each time point.
Performance
[0641] The various biological activities, protease resistance and
potency of each individual mutant were analyzed using a
mathematical model and algorithm (NautScanTM; Fr. Patent No.
9915884; see, also published International PCT application No. WO
01/44809 based on PCT no PCT/FR00/03503). Data was processed using
a Hill equation-based model that uses key feature indicators of the
performance of each individual mutant. Mutants were ranked based on
the values of. their individual performance and those on the top of
the ranking list were selected as leads.
[0642] Using the 2D-scanning and 3D-scanning methods described
above in addition to the 3-dimensional structure of IFN.beta., the
following amino acid target positions were identified as is-HITs on
IFN.beta., which numbering is that of the mature protein (SEQ ID
NO:196):
[0643] By 3D-scanning (see, SEQ ID Nos. 234-289, 989-1015): D by Q
at position 39, D by H at position 39, D by G at position 39, E by
Q at position 42, E by H at position 42, K by Q at position 45, K
by T at position 45, K by S at position 45, K by H at position 45,
L by V at position 47, L by I at position 47, L by T at position
47, L by Q at position 47, L by H at position 47, L by A at
position 47, K by Q at position 52, K by T at position 52, K by S
at position 52, K by H at position 52, F by I at position 67, F by
V at position 67, R by H at position 71, R by Q at position 71, D
by H at position 73, D by G at position 73, D by Q at position 73,
E by Q at position 81, E by H at position 81, E by Q at position
107, E by H at position 107, K by Q at position 108, K by T at
position 108, K by S at position 108, K by H at position 108, E by
Q at position 109, E by H at position 109, D by Q at position 110,
D by H at position 110, D by G at position 110, F by I at position
111, F by V at position 111, R by H at position 113, R by Q at
position 113, L by V at position 116, L by I at position 116, L by
T at position 116, L by Q at position 116, L by H at position 116,
L by A at position 116, L by V at position 120, L by I at position
120, L by T at position 120, L by Q at position 120, L by H at
position 120, L by A at position 120, K by Q at position 123, K by
T at position 123, K by S at position 123, K by H at position 123,
R by H at position 124, R by Q at position 124, R by H at position
128, R by Q at position 128, L by V at position 130, L by I at
position 130, L by T at position 130, L by Q at position 130, L by
H at position 130, L by A at position 130, K by Q at position 134,
K by T at position 134, K by S at position 134, K by H at position
134, K by Q at position 136, K by T at position 136, K by S at
position 136, K by H at position 136, E by Q at position 137, E by
H at position 137, Y by H at position 163, Y by I at position 163,
R by H at position 165, R by Q at position 165.
[0644] By 2D-scanning (see, SEQ ID Nos.1016-1302, and table above):
M by V at position 1, M by I at position 1, M by T at position 1, M
by Q at position 1, M by A at position 1, L by V at position 5, L
by I at position 5, L by T at position 5, L by Q at position 5, L
by H at position 5, L by A at position 5, F by I at position 8, F
by V at position 8, L by V at position 9, L by I at position 9, L
by T at position 9, L by Q at position 9, L by H at position 9, L
by A at position 9, R by H at position 11, R by Q at position 11, F
by I at position 15, F by V at position 15, K by Q at position 19,
K by T at position 19, K by S at position 19, K by H at position
19, W by S at position 22, W by H at position 22, N by H at
position 25, N by S at position 25, N by Q at position 25, R by H
position 27, R by Q position 27, L by V at position 28, L by I at
position 28, L by T at position 28, L by Q at position 28, L by H
at position 28, L by A at position 28, E by Q at position 29, E by
H at position 29, Y by H at position 30, Y by I at position 30, L
by V at position 32, L by I at position 32, L by T at position 32,
L by Q at position 32, L by H at position 32, L by A at position
32, K by Q at position 33, K by T at position 33, K by S at
position 33, K by H at position 33, R by H at position 35, R by Q
at position 35, M by V at position 36, M by I at position 36, M by
T at position 36, M by Q at position 36, M by A at position 36, D
by Q at position 39, D by H at position 39, D by G at position 39,
E by Q at position 42, E by H at position 42, K by Q at position
45, K by T at position 45, K by S at position 45, K by H at
position 45, L by V at position 47, L by I at position 47, L by T
at position 47, L by, Q at position 47, L by H at position 47, L by
A at position 47, K by Q at position 52, K by T at position 52, K
by S at position 52, K by H at position 52, F by I at position 67,
F by V at position 67, R by H at position 71, R by Q at position
71, D by Q at position 73, D by H at position 73, D by G at
position 73, E by Q at position 81, E by H at position 81, E by Q
at position 85, E by H at position 85, Y by H at position 92, Y by
I at position 92, K by Q at position 99, K by T at position 99, K
by S at position 99, K by H at position 99, E by Q at position 103,
E by H at position 103, E by Q at position 104, E by H at position
104, K by Q at position 105, K by T at position 105, K by S at
position 105, K by H at position 105, E by Q at position 107, E by
H at position 107, K by Q at position 108, K by T at position 108,
K by S at position 108, K by H at position 108, E by Q at position
109, E by H at position 109, D by Q at position 110, D by H at
position 110, D by G at position 110, F by I at position 111, F by
V at position 111, R by H at position 113, R by Q at position 113,
L by V at position 116, L by I at position 116, L by T at position
116, L by Q at position 116, L by H at position 116, L by A at
position 116, L by V at position 120, L by I at position 120, L by
T at position 120, L by Q at position 120, L by H at position 120,
L by A at position 120, K by Q at position 123, K by T at position
123, K by S at position 123, K by H at position 123, R by H at
position 124, R by Q at position 124, R by H at position 128, R by
Q at position 128, L by V at position 130, L by I at position 130,
L by T at position 130, L by Q at position 130, L by H at position
130, L by A at position 130, K by Q at position 134, K by T at
position 134, K by S at position 134, K by H at position 134, K by
Q at position 136, K by T at position 136, K by S at position 136,
K by H at position 136, E by Q at position 137, E by H at position
137, Y by H at position 138, Y by I at position 138, R by H at
position 152, R by Q at position 152, Y by H at position 155, Y by
I at position 155, R by H at position 159, R by Q at position 159,
Y by H at position 163, Y by I at position 163, R by H at position
165, R by Q at position 165, M by D at position 1, M by E at
position 1, M by K at position 1, M by N at position 1, M by R at
position 1, M by S at position 1, L by D at position 5, L by E at
position 5, L by K at position 5, L by N at position 5, L by R at
position 5, L by S at position 5, L by D at position 6, L by E at
position 6, L by K at position 6, L by N at position 6, L by R at
position 6, L by S at position 6, L by Q at position 6, L by T at
position 6, F by E at position 8, F by K at position 8, F by R at
position 8, F by D at position 8, L by D at position 9, L by E at
position 9, L by K at position 9, L by N at position 9, L by R at
position 9, L by S at position 9, Q by D at position 10, Q by E at
position 10, Q by K at position 10, Q by N at position 10, Q by R
at position 10, Q by S at position 10, Q by T at position 10, S by
D at position 12, S by E at position 12, S by K at position 12, S
by R at position 12, S by D at position 13, S by E at position 13,
S by K at position 13, S by R at position 13, S by N at position
13, S by Q at position 13, S by Tat position 13, N by D at position
14, N by E at position 14, N by K at position 14, N by Q at
position 14, N by R at position 14, N by S at position 14, N by T
at position 14, F by D at position 15, F by E at position 15, F by
K at position 15, F by R at position 15, Q by D at position 16, Q
by E at position 16, Q by K at position 16, Q by N at position 16,
Q by R at position 16, Q by S at position 16, Q by T at position
16, C by D at position 17, C by E at position 17, C by K at
position 17, C by N at position 17, C by Q at position 17, C by R
at position 17, C by S at position 17, C by T at position 17, L by
N at position 20, L by Q at position 20, L by R at position 20, L
by S at position 20, L by T at position 20, L by D at position 20,
L by E at position 20, L by K at position 20, W by D at position
22, W by E at position 22, W by K at position 22, W by R at
position 22, Q by D at position 23, Q by E at position 23, Q by K
at position 23, Q by R at position 23, L by D at position 24, L by
E at position 24, L by K at position 24, L by R at position 24, W
by D at position 79, W by E at position 79, W by K at position 79,
W by R at position 79, N by D at position 80, N by E at position
80, N by K at position 80, N by R at position 80, T by D at
position 82, T by E at position 82, T by K at position 82, T by R
at position 82, I by D at position 83, I by E at position 83, I by
K at position 83, I by R at position 83, I by N at position 83, I
by Q at position 83, I by S at position 83, I by T at position 83,
N by D at position 86, N by E at position 86, N by K at position
86, N by R at position 86, N by Q at position 86, N by S at
position 86, N by T at position 86, L by D at position 87, L by E
at position 87, L by K at position 87, L by R at position 87, L by
N at position 87, L by Q at position 87, L by S at position 87, L
by T at position 87, A by D at position 89, A by E at position 89,
A by K at position 89, A by R at position 89, N by D at position
90, N by E at position 90, N by K at position 90, N by Q at
position 90, N by R at position 90, N by S at position 90, N by T
at position 90, V by D at position 91, V by E at position 91, V by
K at position 91, V by N at position 91, V by Q at position 91, V
by R at position 91, V by S at position 91, V by T at position 91,
Q by D at position 94, Q by E at position 94, Q by Q at position
94, Q by N at position 94, Q by R at position 94, Q by S at
position 94, Q by T at position 94, I by D at position 95, I by E
at position 95, I by K at position 95, I by N at position 95, I by
Q at position 95, I by R at position 95, I by S at position 95, I
by T at position 95, H by D at position 97, H by E at position 97,
H by K at position 97, H by N at position 97, H by Q at position
97, H by R at position 97, H by S at position 97, H by T at
position 97, L by D at position 98, L by E at position 98, L by K
at position 98, L by N at position 98, L by Q at position 98, L by
R at position 98, L by S at position 98, L by T at position 98, V
by D at position 101, V by E at position 101, V by K at position
101, V by N at position 101, V by Q at position 101, V by R at
position 101, V by S at position 101, V by T at position 101, M by
C at position 1, L by C at position 6, Q by C at position 10, S by
C at position 13, Q by C at position 16, L by C at position 17, V
by C at position 101, L by C at position 98, H by C at position 97,
Q by C at position 94, V by C at position 91, N by C at position
90.
[0645] Since modifications will be apparent to those of skill in
this art, it is intended that this invention be limited only by the
scope of the appended claims.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20070254838A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20070254838A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References