U.S. patent application number 11/735328 was filed with the patent office on 2007-10-18 for tetramerizing polypeptides and methods of use.
Invention is credited to James W. West.
Application Number | 20070243584 11/735328 |
Document ID | / |
Family ID | 38610411 |
Filed Date | 2007-10-18 |
United States Patent
Application |
20070243584 |
Kind Code |
A1 |
West; James W. |
October 18, 2007 |
TETRAMERIZING POLYPEPTIDES AND METHODS OF USE
Abstract
The present invention relates to a method of preparing a
tetrameric protein comprising culturing a host cell transformed or
transfected with an expression vector encoding a fusion protein
comprising a vasodialator-stimulated phosphoprotein (VASP) domain
and a heterologous protein. In one embodiment, the heterologous
protein is a membrane protein, the portion of the heterologous
protein that included in the fusion protein is the extracellular
domain of that protein, and the resulting fusion protein is
soluble. The method can be used to produced homo- and
hetero-tetrameric proteins. The present invention also encompasses
DNA molecules, expression vectors, and host cells used in the
present method and fusion proteins produced by the present
method.
Inventors: |
West; James W.; (Seattle,
WA) |
Correspondence
Address: |
ZYMOGENETICS, INC.;INTELLECTUAL PROPERTY DEPARTMENT
1201 EASTLAKE AVENUE EAST
SEATTLE
WA
98102-3702
US
|
Family ID: |
38610411 |
Appl. No.: |
11/735328 |
Filed: |
April 13, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60791627 |
Apr 13, 2006 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/325; 435/69.7; 530/352 |
Current CPC
Class: |
C07K 14/47 20130101;
C07K 14/00 20130101; C07K 2319/00 20130101; C07K 14/70532 20130101;
C12N 15/62 20130101 |
Class at
Publication: |
435/69.1 ;
435/320.1; 435/325; 530/352; 435/69.7 |
International
Class: |
C07K 14/705 20060101
C07K014/705; C12P 21/06 20060101 C12P021/06; C12P 21/04 20060101
C12P021/04 |
Claims
1. A method of preparing a tetrameric protein comprising culturing
a host cell transformed or transfected with an expression vector
encoding a fusion protein comprising a vasodialator-stimulated
phosphoprotein (VASP) domain and a heterologous protein.
2. The method of claim 1 wherein the heterologous protein comprises
the extracellular domain of the protein.
3. The method of claim 1 wherein the fusion protein is soluble.
4. The method of claim 1 wherein the VASP domain is derived from
the human VASP gene.
5. The method of claim 4 wherein the VASP domain comprises amino
acids 5 to 38 of SEQ ID NO:2.
6. The method of claim 1 wherein the fusion protein further
comprises a linker sequence.
7. A fusion protein produced by the method of claim 1.
8. A fusion protein comprising a VASP domain and a heterologous
protein.
9. The protein of claim 8 wherein the heterologous protein is a
member of the B7 family.
10. The protein of claim 9 wherein the heterologous protein is the
extracellular domain of B7H1.
11. A method of increasing the avidity or affinity of a
heterologous protein for a ligand comprising formation of a fusion
protein comprising a VASP domain resulting in a terameric form of
the heterologous protein.
12. The method of claim 11 wherein the heterologous protein
comprises the extracellular domain of the protein.
13. The method of claim 11 wherein the fusion protein is
soluble.
14. The method of claim 11 wherein the VASP domain is derived from
the human VASP gene.
15. The method of claim 14 wherein the VASP domain comprises amino
acids 5 to 38 of SEQ ID NO:2.
16. The method of claim 11 wherein the fusion protein further
comprises a linker sequence.
17. The method of claim 11 wherein the heterologous protein is a
member of the B7 family.
18. The protein of claim 12 wherein the heterologous protein is the
extracellular domain of B7H1.
Description
RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application Ser. No. 60/791,627, filed Apr. 13, 2006, which is
herein incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] The present invention relates to polypeptides able to form
multimers, particularly tetramers, and the manufacture and use of
such polypeptides.
[0003] A. Coiled-Coils
[0004] A basic component of the quaternary structure of the present
multimerizing polypeptides is the coiled-coil (reviewed in Muller
et al., (2000) Meth. Enzymol. 328: 261-283). Coiled-coils are
protein domains that take the shape of gently twisted, ropelike
bundles. The bundles contain two to five .alpha. helices in
parallel or antiparallel orientation. The essential feature of many
coiled-coil sequences is a seven-residue, or heptad, repeat
(commonly labeled (abcdefg).sub.n) with the first (a) and fourth
(d) positions usually occupied by hydrophobic amino acids. The
remaining amino acids of the coiled-coil structure are generally
polar, where proline is usually excluded due to its disruptive
effect on helical architecture.
[0005] This characteristic heptad repeat (also known as a 3,4
hydrophobic repeat) is what forms the structure of the coiled-coil
domain, with each residue sweeping about 100.degree.. This results
in the seven residues of the heptad repeat falling short of two
full turns by about 27.degree.. The lag forms a gentle, left-handed
hydrophobic stripe of residues running down the .alpha. helix and
the coiled-coil structure forms when these hydrophobic stripes
associate. Deviations from the regular 3,4 spacing of nonpolar
residues changes the angle of the hydrophobic stripe with respect
to the .alpha. helix axis, altering the crossing angle of the
helices and destabilizing the quaternary structure. In other words,
supercoiling (either left or right) results when helixes containing
hydrophobic patches that occur at less than or greater than full
turns associate with each other. With heptad repeats, the
hydrophobic patches are just short of two full turns and result in
left-handed supercoiling upon association.
[0006] Although heptad repeats are by far the most common length of
repeat structure found and studied in coiled-coil sequences, other
repeats lengths are also possible. Specifically, 11 residue repeats
have been found in the tetrabrachion protein from the
micro-organism Staphylohtherms marins (Peters et al. (1996) J. Mol.
Biol. 257: 1031). This protein has a parallel four-stranded
coiled-coil with slight right-handed supercoiling. A still larger
repeat has been observed in a domain of the vasodilator-stimulated
phosphoprotein (VASP) which includes 15 residue repeats within the
region of the protein responsible for forming tetramers. (Kuhnel et
al. (2004) Proc. Natl. Acad. Sci. 101: 17027). In contrast to the
common heptad repeat coiled-coil structures, the supercoiling for
the 15-residue repeat is right handed, rather than left handed, but
it is of a similar degree.
[0007] Coiled-coil domain sequences have been fused to other
heterologous protein sequences to achieve diverse experimental
goals. One common use is the replacement of natural oligomerization
domains with a heterologous sequence to alter oligomerization
state, stability, and/or avidity. Low affinity monomers that do not
naturally associate can be oligomerized in order to bind effectly
to other multimeric targets. Additionally, the oligmerization
domain fusion can be used to mimic the activated state of the
native protein that is difficult to achieve with recombinant
protein production (see, e.g., Pullen et al. (1999) Biochem.
94:6032). This approach has been particularly effective when
producing only specific domains, such as the extracellular
(cytoplasmic) or intracellular portion of a protein of interest.
Commonly, coiled-coils are genetically fused to the protein of
interested via a flexible linker that will provide access for the
fusion to a large three-dimensional space. Direct fusions are used
for experimental goals that require more rigid molecules, such as
those used for crystallization.
[0008] A number of model coiled-coil systems have been developed
based on the structural information of large structural proteins,
such as myosin and tropomyosin (TM43, Lau et al. J Biol Chem; 259:
13253-13261), a group of proteins known as collectins (Hoppe et al.
(1994) Protein Sci; 3:1143-1158), or of the dimerization region of
DNA regulatory proteins, such as the yeast transcriptional
activator protein GCN4-p1 (Landschulz et al. (1988) Science;
240:1759-1764). This last structure is often referred to as a
"leucine zipper" or LZ. Derivative model systems from the TM43 have
been made, specifically where one leucine per heptad has been
switched to phenylalanine. This structure is known as a
"phenylalanine zipper" or FZ (Thomas et al. Prog Colloid Polymer
Sci; 99: 24-30). A third type of well-known derivative of the LZ is
the isoleucine zipper (IZ) (Harbury et al. (1994) Nature
371:80-83).
[0009] An important constraint of model coiled-coils is the ability
to be produced in the expression host. The lack of disulfide bonds
in coiled-coil structures aids their production in heterologous
expression systems. However, de novo designed sequences tend to be
sensitive to proteolysis. Even if effectively expressed, the
relative lack of effectiveness as compared to natural sequences
reflects the gaps in the current knowledge about all variables
involved in protein interaction (Arndt et al. (2002) Structure 10:
1235-1248). Additionally, the use of model sequences is problematic
when the goal of the fusion protein produced is a biologically
functional protein.
[0010] B. Vasodialator-Stimulated Phosphoprotein (VASP)
[0011] As mentioned above, this protein has been shown through
crystallization to include a tetramerization region comprising 15
residue (quindecad) repeats that result in a parallel right-handed
coiled-coil structure that has a similar degree of supercoiling as
the left handed coiled coils that result from heptad repeats (see
FIG. 2). This structure is further stabilized with salt bridges,
particularly strong hydrogen bonds that form between two charged
amino acid residues.
[0012] In more detail, two consecutive 15 repeats are seen within
the protein, where seven (positions a, b, d, e, f, j, and o) are
identical between the two repeats and four (positions c, h, i, and
l) are conservative changes that preserve either the charge and/or
the hydrophobicity of the substituted amino acid residue. The
15-residue repeat has a pronounced pattern of repeated hydrophobic
residues in positions a, d, h, and 1. These residues plus the
aliphatic portion of the lysine in the e position make up the
hydrophobic core of the VASP tetramerizing domain. For a 15 residue
repeat, the .alpha. helical phase increment overshoots four full
turns by about 44.degree. which means when the hydrophobic regions
of this protein associate, it results in a right-handed superhelix
not dissimilar in degree to the left-handed superhelix of heptad
repeat containing .alpha. helixes. A comparison between the VASP
structure and a common leucine zipper (GCN4-pLI) is shown in FIG.
2.
[0013] Another way to express the structure of this domain is that
it is one heptad repeat with two four residue stutters. One or more
stutters (a term of art for an insertion) are found in many
coiled-coils comprising heptads and can cause an "unwinding" of the
left-handed coiled-coil or even a local area of right-handed twist
(see, e.g. Brown et al. (1996) Proteins 26:134). So the VASP
tetramerizing domain can be described as a heptad repeat with
regularly repeated four amino acid stutters that flank it. The
stutters result in right handed supercoiling. Thus, if a heptad is
called a 3, 4 hydrophobic repeat, the VASP domain can be called a
4, 3, 4, 4 hydrophobic repeat, the middle 3, 4 representing the
heptad portion.
[0014] There remains a need in the art to adapt natural
tetramerization sequences for use in the production of biologically
active, recombinant fusion proteins. Accordingly, the present
application describes the screening, discovery, and development of
appropriate natural genetic sequences for tetramerization in the
recombinant protein art.
SUMMARY OF THE INVENTION
[0015] The present invention relates to a method of preparing a
multimeric protein, preferably a tetrameric protein, comprising
culturing a host cell transformed or transfected with an expression
vector encoding a fusion protein comprising a
vasodialator-stimulated phosphoprotein (VASP) domain and a
heterologous protein. In one embodiment, the heterologous protein
is a membrane protein, the portion of the heterologous protein that
included in the fusion protein is the extracellular domain of that
protein, and the resulting fusion protein is soluble. One such
embodiment is made with the extracellular domain of the
transmembrane co-stimulatory molecule, B7H1 (also known as
programmed cell death 1 ligand 1 or PCD1L1). In a further
embodiment, the fusion protein comprises a linker sequence. In
still another embodiment of the present invention, the VASP domain
can be used to identify sequences having similar protein structure
patterns and those similar domains are used to make a fusion
protein that multimerizes a heterologous protein or protein
domain.
[0016] A further embodiment of the present invention is a method of
preparing a soluble, homo- or hetero-tetrameric protein by
culturing a host cell transformed or transfected with at least one,
but up to four different expression vectors encoding a fusion
protein comprising a VASP domain and a heterologous protein or
protein domain. In this embodiment, the four VASP domains
preferentially form a homo- or hetero-tetramer. This culturing can
occur in the same or different host cells. The VASP domains can be
the same or different and the fusion protein can further comprise a
linker sequence. In one particular embodiment, the protein used to
form the homo-tetrameric protein is the extracellular domain of
B7H1 (PCD1L1). The present invention also encompasses DNA
sequences, expression vectors, and transformed host cells utilized
in the present method and fusion proteins produced by the present
method.
[0017] These and other aspects of the invention will become
apparent to those persons skilled the art upon reading the details
of the invention as more fully described below.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1 is a graphic representation of the structure of
coiled-coil proteins and the interaction between residues within
the coil and the residues between coils.
[0019] FIG. 2 is a pictoral representation of the supercoiling
present in a leucine zipper and in the VASP tetramerizing domain
(derived from Kuhnel et al, supra).
[0020] FIG. 3 is a graph documenting the binding of the B7H1-VASP
fusion protein to cells expressing PD-1.
[0021] FIG. 4 shows the competition of the binding of the B7H1-VASP
fusion protein and PD-1 expressing cells with other PD-1 ligands,
but not with non-PD-1 binding B7 family members.
[0022] FIG. 5 illustrates the competition of the binding of labeled
B7H1-VASP fusion protein to PD-1 expressing cells with unlabeled
B7H1-Ig.
DETAILED DESCRIPTION OF THE INVENTION
[0023] The present invention provides a method of preparing a
multimeric, preferably tetrameric, protein by culturing a host cell
transformed or transfected with an expression vector encoding a
fusion protein comprising a vasodialator-stimulated phosphoprotein
(VASP) domain and a heterologous protein. The invention is based on
the finding that tetramerization sequences derived from certain
proteins result in highly bioactive fusion proteins. This
observation allowed the development of a fusion protein production
method that can be utilized to produce homo- or hetero-tetrameric
proteins that retain their biological activity.
[0024] Before the present invention is described, it is to be
understood that this invention is not limited to particular
embodiments described, as such may, of course, vary. It is also to
be understood that the terminology used herein is for the purpose
of describing particular embodiments only, and is not intended to
be limiting, since the scope of the present invention will be
limited only by the appended claims.
[0025] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, the preferred methods and materials are now described.
All publications mentioned herein are incorporated herein by
reference to disclose and describe the methods and/or materials in
connection with which the publications are cited.
[0026] It must be noted that as used herein and in the appended
claims, the singular forms "a", "and", and "the" include plural
referents unless the context clearly dictates otherwise. Thus, for
example, reference to "a polymorphism includes a plurality of such
polymorphisms, reference to "a nucleic acid molecule" includes a
plurality of such nucleic acid molecules, and reference to "the
method" includes reference to one or more methods, method steps,
and equivalents thereof known to those skilled in the art, and so
forth.
[0027] The publications discussed herein are provided solely for
their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an admission that
the present invention is not entitled to antedate such publication
by virtue of prior invention. Further, the dates of publication
provided may be different from the actual publication dates which
may need to be independently confirmed.
Definitions
[0028] In the present patent application, the term "fusion protein"
is used herein to describe a protein whose sequences derive from at
least two different gene sources. The sequences are genetically
engineered to be transcribed and translated into one protein that
comprises sequences from at least two different genes. For the
present invention, one gene source is a 15 residue repeat sequence
(known as the vasodialator-stimulated phosphoprotein or VASP
domain) and the additional gene source or sources are one or more
heterologous genes. The fusion protein can also comprise a linker
sequence which will generally be located between the VASP domain
and the heterologous protein sequence.
[0029] The term "heterologous" is used to describe a polynucleotide
or protein that is not naturally encoded or expressed with the 15
residue repeat sequence of the VASP domain. The VASP domain can be
derived from the human sequence or be an equivalent sequence from
another species, and any gene source outside of this protein is
considered heterologous. A heterologous protein can be a full
length protein or a particular domain of a protein. The
heterologous proteins of the present invention encompass both
membrane bound proteins and soluble proteins and domains
thereof.
[0030] The terms "polynucleotide" and "nucleic acid molecule" are
used interchangeably herein to refer to polymeric forms of
nucleotides of any length. The polynucleotides may contain
deoxyribonucleotides, ribonucleotides, and/or their analogs.
Nucleotides may have any three-dimensional structure, and may
perform any function, known or unknown. The term "polynucleotide"
includes single-, double-stranded and triple helical molecules.
"Oligonucleotide" generally refers to polynucleotides of between
about 5 and about 100 nucleotides of single- or double-stranded
DNA. However, for the purposes of this disclosure, there is no
upper limit to the length of an oligonucleotide. Oligonucleotides
are also known as oligomers or oligos and may be isolated from
genes, or chemically synthesized by methods known in the art.
[0031] The following are non-limiting embodiments of
polynucleotides: a gene or gene fragment, exons, introns, mRNA,
tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched
polynucleotides, plasmids, vectors, isolated DNA of any sequence,
isolated RNA of any sequence, nucleic acid probes, and primers. A
nucleic acid molecule may also comprise modified nucleic acid
molecules, such as methylated nucleic acid molecules and nucleic
acid molecule analogs. Analogs of purines and pyrimidines are known
in the art. Nucleic acids may be naturally occurring, e.g. DNA or
RNA, or may be synthetic analogs, as known in the art. Such analogs
may be preferred for use as probes because of superior stability
under assay conditions. Modifications in the native structure,
including alterations in the backbone, sugars or heterocyclic
bases, have been shown to increase intracellular stability and
binding affinity. Among useful changes in the backbone chemistry
are phosphorothioates; phosphorodithioates, where both of the
non-bridging oxygens are substituted with sulfur;
phosphoroamidites; alkyl phosphotriesters and boranophosphates.
Achiral phosphate derivatives include 3'-O'-5'-S-phosphorothioate,
3'-S-5'-O-phosphorothioate, 3'-CH2-5'-O-phosphonate and
3'-NH-5'-O-phosphoroamidate. Peptide nucleic acids replace the
entire ribose phosphodiester backbone with a peptide linkage.
[0032] Sugar modifications are also used to enhance stability and
affinity. The .alpha.-anomer of deoxyribose may be used, where the
base is inverted with respect to the natural .beta.-anomer. The
2'-OH of the ribose sugar may be altered to form 2'-O-methyl or
2'-O-allyl sugars, which provides resistance to degradation without
comprising affinity.
[0033] Modification of the heterocyclic bases must maintain proper
base pairing. Some useful substitutions include deoxyuridine for
deoxythymidine; 5-methyl-2'-deoxycytidine and
5-bromo-2'-deoxycytidine for deoxycytidine.
5-propynyl-2'-deoxyuridine and 5-propynyl-2'-deoxycytidine have
been shown to increase affinity and biological activity when
substituted for deoxythymidine and deoxycytidine, respectively.
[0034] The terms "polypeptide" and "protein", used interchangebly
herein, refer to a polymeric form of amino acids of any length,
which can include coded and non-coded amino acids, chemically or
biochemically modified or derivatized amino acids, and polypeptides
having modified peptide backbones. The term includes fusion
proteins, including, but not limited to, fusion proteins with a
heterologous amino acid sequence, fusions with heterologous and
homologous leader sequences, with or without N-terminal methionine
residues; immunologically tagged proteins; and the like.
[0035] A "substantially isolated" or "isolated" polynucleotide is
one that is substantially free of the sequences with which it is
associated in nature. By substantially free is meant at least 50%,
preferably at least 70%, more preferably at least 80%, and even
more preferably at least 90% free of the materials with which it is
associated in nature. As used herein, an "isolated" polynucleotide
also refers to recombinant polynucleotides, which, by virtue of
origin or manipulation: (1) are not associated with all or a
portion of a polynucleotide with which it is associated in nature,
(2) are linked to a polynucleotide other than that to which it is
linked in nature, or (3) does not occur in nature.
[0036] Hybridization reactions can be performed under conditions of
different "stringency". Conditions that increase stringency of a
hybridization reaction of widely known and published in the art.
See, for example, Sambrook et al. (1989). Examples of relevant
conditions include (in order of increasing stringency): incubation
temperatures of 25.degree. C., 37.degree. C., 50.degree. C. and
68.degree. C.; buffer concentrations of 10.times.SSC, 6.times.SSC,
1.times.SSC, 0.1.times.SSC (where SSC is 0.15 M NaCl and 15 mM
citrate buffer) and their equivalents using other buffer systems;
formamide concentrations of 0%, 25%, 50%, and 75%; incubation times
from 5 minutes to 24 hours; 1, 2, or more washing steps; wash
incubation times of 1, 2, or 15 minutes; and wash solutions of
6.times.SSC, 1.times.SSC, 0.1.times.SSC, or deionized water.
Examples of stringent conditions are hybridization and washing at
50.degree. C. or higher and in 0.1 .times.SSC (9 mM NaCl/0.9 mM
sodium citrate).
[0037] "T.sub.m" is the temperature in degrees Celsius at which 50%
of a polynucleotide duplex made of complementary strands hydrogen
bonded in anti-parallel direction by Watson-Crick base pairing
dissociates into single strands under conditions of the experiment.
T.sub.m may be predicted according to a standard formula, such
as:
[0038] where [X.sup.+] is the cation concentration (usually sodium
ion, Na.sup.+) in mol/L; (% G/C) is the number of G and C residues
as a percentage of total residues in the duplex; (% F) is the
percent formamide in solution (wt/vol); and L is the number of
nucleotides in each strand of the duplex.
[0039] Stringent conditions for both DNA/DNA and DNA/RNA
hybridization are as described by Sambrook et al. Molecular
Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989, herein
incorporated by reference. For example, see page 7.52 of Sambrook
et al.
[0040] The term "host cell" includes an individual cell or cell
culture which can be or has been a recipient of any recombinant
vector(s) or isolated polynucleotide of the invention. Host cells
include progeny of a single host cell, and the progeny may not
necessarily be completely identical (in morphology or in total DNA
complement) to the original parent cell due to natural, accidental,
or deliberate mutation and/or change. A host cell includes cells
tranfected or infected in vivo or in vitro with a recombinant
vector or a polynucleotide of the invention. A host cell which
comprises a recombinant vector of the invention is a "recombinant
host cell".
[0041] The term "secretory signal sequence" denotes a DNA sequence
that encodes a polypeptide (a "secretory peptide") that, as a
component of a larger polypeptide, directs the larger polypeptide
through a secretory pathway of a cell in which it is synthesized.
The larger peptide is commonly cleaved to remove the secretory
peptide during transit through the secretory pathway.
[0042] The term "affinity tag" is used herein to denote a
polypeptide segment that can be attached to a second polypeptide to
provide for purification or detection of the second polypeptide or
provide sites for attachment of the second polypeptide to a
substrate. In principal, any peptide or protein for which an
antibody or other specific binding agent is available can be used
as an affinity tag. Affinity tags include a poly-histidine tract,
protein A (Nilsson et al., EMBO J. 4:1075, 1985; Nilsson et al.,
Methods Enzymol. 198:3, 1991), glutathione S transferase (Smith and
Johnson, Gene 67:31, 1988), Glu-Glu affinity tag (Grussenmeyer et
al., Proc. Natl. Acad. Sci. USA 82:7952-4, 1985), substance P,
Flag.TM. peptide (Hopp et al., Biotechnology 6:1204-10, 1988),
streptavidin binding peptide, or other antigenic epitope or binding
domain. See, in general, Ford et al., Protein Expression and
Purification 2: 95-107, 1991. DNAs encoding affinity tags are
available from commercial suppliers (e.g., Pharmacia Biotech,
Piscataway, N.J.).
[0043] The terms "amino-terminal" (N-terminal) and
"carboxyl-terminal" (C-terminal) are used herein to denote
positions within polypeptides. Where the context allows, these
terms are used with reference to a particular sequence or portion
of a polypeptide to denote proximity or relative position. For
example, a certain sequence positioned carboxyl-terminal to a
reference sequence within a polypeptide is located proximal to the
carboxyl terminus of the reference sequence, but is not necessarily
at the carboxyl terminus of the complete polypeptide.
[0044] As used herein, the terms "treatment", "treating", and the
like, refer to obtaining a desired pharmacologic and/or physiologic
effect. The effect may be prophylactic in terms of completely or
partially preventing a disease or symptom thereof and/or may be
therapeutic in terms of a partial or complete cure for a disease
and/or adverse affect attributable to the disease. "Treatment", as
used herein, covers any treatment of a disease in a mammal,
particularly in a human, and includes: (a) preventing the disease
from occurring in a subject which may be predisposed to the disease
but has not yet been diagnosed as having it; (b) inhibiting the
disease, i.e., arresting its development; and (c) relieving the
disease, i.e., causing regression of the disease.
[0045] The terms "individual," "subject," and "patient," used
interchangeably herein, refer to a mammal, including, but not
limited to, murines, simians, humans, mammalian farm animals,
mammalian sport animals, and mammalian pets.
The Vasodialator-Stimulated Phosphoprotein (VASP) Domain
[0046] The present invention is a method of producing a multimeric,
preferably tetrameric, protein that comprises a fusion protein
comprising a VASP domain and a herterologous protein domain. VASP
domains are derived from the VASP gene present in many species.
Sequences are selected for their anticipated ability to form
coiled-coil protein structure, as this structure is important for
the ability to form multimeric protein forms. Particularly desired
for the present invention is the ability of coiled-coil proteins to
produce tetrameric protein structures. A particularly preferred
embodiment utilizes amino acids 343 to 376 of the human VASP
sequence (amino acids 5 to 38 of SEQ ID NO:2). The full length DNA
sequence of this protein is SEQ ID NO: 16 and the full length
polypeptide sequence of this protein is SEQ ID NO:17.
[0047] Work with other types of multimerizing sequences, for
examples, the leucine zipper, has shown that a limited number of
conservative amino acid substitutions (even at the d residue) can
be often be tolerated in zipper sequences without the loss of the
ability of the molecules to multimerize (Landschultz et al.,
(1989), supra;). Thus, conservative changes from the native
sequence for the VASP domain are contemplated within the scope of
the invention. Table 1 shows the conservative changes that are
anticipated to tolerated by the coiled-coil structure.
TABLE-US-00001 TABLE 1 Conservative amino acid substitutions Basic:
arginine lysine histidine Acidic: glutamic acid aspartic acid
Polar: glutamine asparagine Hydrophobic: leucine isoleucine valine
methionine Aromatic: phenylalanine tryptophan tyrosine Small:
glycine alanine serine threonine methionine
[0048] If more than one fusion protein is being used to produce
hetero-multimeric proteins, for example, heterotetramers, the VASP
domain that is used can be the same domain for both fusion proteins
or different VASP domains, as long as the domains have the ability
to associate with each other and form multimeric proteins.
[0049] The VASP domain can be put at either the N or C terminus of
the heterologous protein of interest, based on considerations of
function (i.e., whether the heterologous protein is a type I or
type II membrane protein) and ease of construction of the
construct. Additionally, the VASP domain can be located in the
middle of the protein, effectively creating a double fusion protein
with one heterologous sequence, a VASP domain, and a second
heterologous sequence. The two heterologous sequences for the
double fusion protein can be the same or different.
Heterologous Proteins--Proteins of Interest
[0050] A heterologous protein of interest is selected primarily
based on a desire to produce a multimeric, particularly tetrameric,
version of the protein. Additionally, by utilizing only a soluble
domain of the heterologous protein, a transmembrane protein can be
produced in soluble form. Of particular interest with the present
invention is the production of biologically active proteins of
interest. One family of proteins that commonly utilizes multimers,
such as tetramers, for activity is the B7 family, reviewed in
Carino et al., Annu. Rev. Immunol. (2002) 20: 29 and, more
recently, in Greenwald et al., Annu. Rev. Immunol. (2005) 23: 515.
The genes involved in these families have key roles in the immune
system, regulating T cell activation and tolerance. The genetic
relationships in this family are complicated in that both positive
(activating) and downregulation (deactivating) signals are
present.
[0051] A key member of this family is the protein B7H1 (also known
as PCD1L1 or PD-L1) which is expressed on B-cells, macrophages,
dendritic cells, and T-cells. It is also expressed outside the
lymphoid cells in endothelial tissues and on many kinds of tumor
cells. This protein, and its interaction with it cross-receptor
PD-1 has been implicated in several disease states including
autoimmune disease, asthma, infectious disease, transplantation,
and tumor immunity. It is a type I membrane protein with 290 amino
acids and its sequence is reported in Dong et al. (1999) Nature
Med. 5: 1365. The structure includes an 18 amino acid signal
sequence, a 221 amino acid extracellular domain, a 21 amino acid
transmembrane region, and a 31 amino acid cytoplasmic region. The
full length DNA sequence of this protein is SEQ ID NO: 13 and the
full length polypeptide sequence is SEQ ID NO:14. The ability to
produce large quantities of these proteins while maintaining their
function is a rate-limiting step in the full understanding the
precise function of this family of proteins in normal and diseased
tissues.
Linker Sequences, Affinity Tag Sequences, and Signal Peptides
[0052] A protein of interest may be linked directly to another
protein to form a fusion protein; alternatively, the proteins maybe
separated by a distance sufficient to ensure the proteins form
proper secondary and tertiary structure needed for biological
activity. Suitable linker sequences will adopt a flexible extended
confirmation and will not exhibit a propensity for developing an
ordered secondary structure which could interact with the function
domains of the fusions proteins, and will have minimal hydrophobic
or charged character which could also interfere with the function
of fusion domains. Linker sequences should be constructed with the
15 residue repeat in mind, as it may not be in the best interest of
producing a biologically active protein to tightly constrict the N
or C terminus of the heterologous sequence. Beyond these
considerations, the length of the linker sequence may vary without
significantly affecting the biological activity of the fusion
protein. Linker sequences can be used between any and all
components of the fusion protein (or expression construct)
including affinity tags and signal peptides. An example linker is
the GSGG sequence (SEQ ID NO: 11).
[0053] A further component of the fusion protein can be an affinity
tag. Such tags do not alter the biological activity of fusion
proteins, are highly antigenic, and provides an epitope that can be
reversibly bound by a specific binding molecule, such as a
monoclonal antibody, enabling repaid detection and purification of
an expressed fusion protein. Affinity tages can also convey
resistance to intracellular degradation if proteins are produced in
bacteria, like E. coli. An exemplary affinity tag is the FLAG Tag
(SEQ ID NO: 15) or the HIS.sub.6 Tag (SEQ ID NO: 12). Methods of
producing fusion proteins utilizing this affinity tag for
purification are described in U.S. Pat. No. 5,011,912.
[0054] A still further component of the fusion protein can be a
signal sequence or leader sequence. These sequences are generally
utilized to allow for secretion of the fusion protein from the host
cell during expression and are also known as a leader sequence,
prepro sequence or pre sequence. The secretory signal sequence may
be that of the heterologous protein being produced, if it has such
a sequence, or may be derived from another secreted protein (e.g.,
t-PA) or synthesized de novo. The secretory signal sequence is
operably linked to fusion protein DNA sequence, i.e., the two
sequences are joined in the correct reading frame and positioned to
direct the newly synthesized polypeptide into the secretory pathway
of the host cell. Secretory signal sequences are commonly
positioned 5' to the DNA sequence encoding the polypeptide of
interest, although certain signal sequences may be positioned
elsewhere in the DNA sequence of interest (see, e.g., Welch et al.,
U.S. Pat. No. 5,037,743; Holland et al., U.S. Pat. No.
5,143,830).
Preparation of Polynucleotides encoding VASP-Heterologous Fusion
Proteins
[0055] The nucleic acid compositions of the present invention find
use in the preparation of all or a portion of the VASP-Heterologous
fusion proteins, as described above. The subject polynucleotides
(including cDNA or the full-length gene) can be used to express a
partial or complete gene product. Constructs comprising the subject
polynucleotides can be generated synthetically. Alternatively,
single-step assembly of a gene and entire plasmid from large
numbers of oligodeoxyribonucleotides is described by, e.g., Stemmer
et al., Gene (Amsterdam) (1995) 164(1):49-53. In this method,
assembly PCR (the synthesis of long DNA sequences from large
numbers of oligodeoxyribonucleotides (oligos)) is described. The
method is derived from DNA shuffling (Stemmer, Nature (1994)
370:389-391), and does not rely on DNA ligase, but instead relies
on DNA polymerase to build increasingly longer DNA fragments during
the assembly process. Appropriate polynucleotide constructs are
purified using standard recombinant DNA techniques as described in,
for example, Sambrook et al., Molecular Cloning: A Laboratory
Manual, 2nd Ed., (1989) Cold Spring Harbor Press, Cold Spring
Harbor, N.Y., and under current regulations described in United
States Dept. of HHS, National Institute of Health (NIH) Guidelines
for Recombinant DNA Research.
[0056] Polynucleotide molecules comprising a polynucleotide
sequence provided herein are propagated by placing the molecule in
a vector. Viral and non-viral vectors are used, including plasmids.
The choice of plasmid will depend on the type of cell in which
propagation is desired and the purpose of propagation. Certain
vectors are useful for amplifying and making large amounts of the
desired DNA sequence. Other vectors are suitable for expression in
cells in culture. Still other vectors are suitable for transfer and
expression in cells in a whole animal or person. The choice of
appropriate vector is well within the skill of the art. Many such
vectors are available commercially. The partial or full-length
polynucleotide is inserted into a vector typically by means of DNA
ligase attachment to a cleaved restriction enzyme site in the
vector. Alternatively, the desired nucleotide sequence can be
inserted by homologous recombination in vivo. Typically this is
accomplished by attaching regions of homology to the vector on the
flanks of the desired nucleotide sequence. Regions of homology are
added by ligation of oligonucleotides, or by polymerase chain
reaction using primers comprising both the region of homology and a
portion of the desired nucleotide sequence, for example.
[0057] For expression, an expression cassette or system may be
employed. The gene product encoded by a polynucleotide of the
invention is expressed in any convenient expression system,
including, for example, bacterial, yeast, insect, amphibian and
mammalian systems. Suitable vectors and host cells are described in
U.S. Pat. No. 5,654,173. In the expression vector, the heterologous
protein encoding polynucleotide (such as the extracellular domain
of B7H1) is linked to a regulatory sequence as appropriate to
obtain the desired expression properties. These can include
promoters (attached either at the 5' end of the sense strand or at
the 3' end of the antisense strand), enhancers, terminators,
operators, repressors, and inducers. The promoters can be regulated
or constitutive. In some situations it may be desirable to use
conditionally active promoters, such as tissue-specific or
developmental stage-specific promoters. These are linked to the
desired nucleotide sequence using the techniques described above
for linkage to vectors. Any techniques known in the art can be
used. In other words, the expression vector will provide a
transcriptional and translational initiation region, which may be
inducible or constitutive, where the coding region is operably
linked under the transcriptional control of the transcriptional
initiation region, and a transcriptional and translational
termination region. These control regions may be native to the DNA
encoding the VASP-heterologous fusion protein, or may be derived
from exogenous sources.
[0058] Expression vectors generally have convenient restriction
sites located near the promoter sequence to provide for the
insertion of nucleic acid sequences encoding heterologous proteins.
A selectable marker operative in the expression host may be
present. Expression vectors may be used for the production of
fusion proteins, where the exogenous fusion peptide provides
additional functionality, i.e. increased protein synthesis,
stability, reactivity with defined antisera, an enzyme marker, e.g.
.beta.-galactosidase, etc.
[0059] Expression cassettes may be prepared comprising a
transcription initiation region, the gene or fragment thereof, and
a transcriptional termination region. Of particular interest is the
use of sequences that allow for the expression of functional
epitopes or domains, usually at least about 8 amino acids in
length, more usually at least about 15 amino acids in length, to
about 25 amino acids, and up to the complete open reading frame of
the gene. After introduction of the DNA, the cells containing the
construct may be selected by means of a selectable marker, the
cells expanded and then used for expression.
[0060] VASP-Heterologous fusion proteins may be expressed in
prokaryotes or eukaryotes in accordance with conventional ways,
depending upon the purpose for expression. For large scale
production of the protein, a unicellular organism, such as E. coli,
B. subtilis, S. cerevisiae, insect cells in combination with
baculovirus vectors, or cells of a higher organism such as
vertebrates, particularly mammals, e.g. COS 7 cells, HEK 293, CHO,
Xenopus Oocytes, etc., may be used as the expression host cells. In
some situations, it is desirable to express a polymorphic VASP
nucleic acid molecule in eukaryotic cells, where the polymorphic
VASP protein will benefit from native folding and
post-translational modifications. Small peptides can also be
synthesized in the laboratory. Polypeptides that are subsets of the
complete VASP sequence may be used to identify and investigate
parts of the protein important for function.
[0061] Specific expression systems of interest include bacterial,
yeast, insect cell and mammalian cell derived expression systems.
Representative systems from each of these categories is are
provided below:
[0062] Bacteria. Expression systems in bacteria include those
described in Chang et al., Nature (1978) 275:615; Goeddel et al.,
Nature (1979) 281:544; Goeddel et al., Nucleic Acids Res. (1980)
8:4057; EP 0 036,776; U.S. Pat. No. 4,551,433; DeBoer et al., Proc.
Natl. Acad. Sci. (USA) (1983) 80:21-25; and Siebenlist et al., Cell
(1980) 20:269.
[0063] Yeast. Expression systems in yeast include those described
in Hinnen et al., Proc. Natl. Acad. Sci. (USA) (1978) 75:1929; Ito
et al., J. Bacteriol. (1983) 153:163; Kurtz et al., Mol. Cell.
Biol. (1986) 6:142; Kunze et al., J. Basic Microbiol. (1985)
25:141; Gleeson et al., J. Gen. Microbiol. (1986) 132:3459;
Roggenkamp et al., Mol. Gen. Genet. (1986) 202:302; Das et al., J.
Bacteriol. (1984) 158:1165; De Louvencourt et al., J. Bacteriol.
(1983) 154:737; Van den Berg et al., Bio/Technology (1990) 8:135;
Kunze et al., J. Basic Microbiol. (1985) 25:141; Cregg et al., Mol.
Cell. Biol. (1985) 5:3376; U.S. Pat. Nos. 4,837,148 and 4,929,555;
Beach and Nurse, Nature (1981) 300:706; Davidow et al., Curr.
Genet. (1985) 10:380; Gaillardin et al., Curr. Genet. (1985) 10:49;
Ballance et al., Biochem. Biophys. Res. Commun. (1983) 112:284-289;
Tilburn et al., Gene (1983) 26:205-221; Yelton et al., Proc. Natl.
Acad. Sci. (USA) (1984) 81:1470-1474; Kelly and Hynes, EMBO J.
(1985) 4:475479; EP 0 244,234; and WO 91/00357.
[0064] Insect Cells. Expression of heterologous genes in insects is
accomplished as described in U.S. Pat. No. 4,745,051; Friesen et
al., "The Regulation of Baculovirus Gene Expression", in: The
Molecular Biology Of Baculoviruses (1986) (W. Doerfler, ed.); EP 0
127,839; EP 0 155,476; and Vlak et al., J. Gen. Virol. (1988)
69:765-776; Miller et al., Ann. Rev. Microbiol. (1988) 42:177;
Carbonell et al., Gene (1988) 73:409; Maeda et al., Nature (1985)
315:592-594; Lebacq-Verheyden et al., Mol. Cell. Biol. (1988)
8:3129; Smith et al., Proc. Natl. Acad. Sci. (USA) (1985) 82:8844;
Miyajima et al., Gene (1987) 58:273; and Martin et al., DNA (1988)
7:99. Numerous baculoviral strains and variants and corresponding
permissive insect host cells from hosts are described in Luckow et
al., Bio/Technology (1988) 6:47-55, Miller et al., Generic
Engineering (1986) 8:277-279, and Maeda et al., Nature (1985)
315:592-594.
[0065] Mammalian Cells. Mammalian expression is accomplished as
described in Dijkema et al., EMBO J. (1985) 4:761, Gorman et al.,
Proc. Natl. Acad. Sci. (USA) (1982) 79:6777, Boshart et al., Cell
(1985) 41:521 and U.S. Pat. No. 4,399,216. Other features of
mammalian expression are facilitated as described in Ham and
Wallace, Meth. Enz. (1979) 58:44, Barnes and Sato, Anal. Biochem.
(1980) 102:255, U.S. Pat. Nos. 4,767,704, 4,657,866, 4,927,762,
4,560,655, WO 90/103430, WO 87/00195, and U.S. Pat. No. RE
30,985.
[0066] When any of the above host cells, or other appropriate host
cells or organisms, are used to replicate and/or express the
polynucleotides or nucleic acids of the invention, the resulting
replicated nucleic acid, RNA, expressed protein or polypeptide, is
within the scope of the invention as a product of the host cell or
organism. The product is recovered by any appropriate means known
in the art.
[0067] Once the gene corresponding to a selected polynucleotide is
identified, its expression can be regulated-in the cell to which
the gene is native. For example, an endogenous gene of a cell can
be regulated by an exogenous regulatory sequence inserted into the
genome of the cell at location sufficient to at least enhance
expressed of the gene in the cell. The regulatory sequence may be
designed to integrate into the genome via homologous recombination,
as disclosed in U.S. Pat. Nos. 5,641,670 and 5,733,761, the
disclosures of which are herein incorporated by reference, or may
be designed to integrate into the genome via non-homologous
recombination, as described in WO 99/15650, the disclosure of which
is herein incorporated by reference.
Vectors and Host Cells Comprising the Polynucleotides of the
Invention
[0068] The invention further provides recombinant vectors and host
cells comprising polynucleotides of the invention. In general,
recombinant vectors and host cells of the invention are isolated;
however, a host cell comprising a polynucleotide of the invention
may be part of a genetically modified animal.
[0069] Recombinant vectors. The present invention further provides
recombinant vectors ("constructs") comprising a polynucleotide of
the invention. Recombinant vectors include vectors used for
propagation of a polynucleotide of the invention, and expression
vectors. Vectors useful for introduction of the polynucleotide
include plasmids and viral vectors, e.g. retroviral-based vectors,
adenovirus vectors, etc. that are maintained transiently or stably
in mammalian cells. A wide variety of vectors can be employed for
transfection and/or integration of the gene into the genome of the
cells. Alternatively, micro-injection may be employed, fusion, or
the like for introduction of genes into a suitable host cell.
[0070] Expression vectors generally have convenient restriction
sites located near the promoter sequence to provide for the
insertion of nucleic acid sequences encoding heterologous proteins.
A selectable marker operative in the expression host may be
present. Expression vectors may be used for the production of
fusion proteins, where the exogenous fusion peptide provides
additional functionality, i.e. increased protein synthesis,
stability, reactivity with defined antisera, an enzyme marker, e.g.
.beta.-galactosidase, etc.
[0071] Expression cassettes may be prepared comprising a
transcription initiation region, the gene or fragment thereof, and
a transcriptional termination region. Of particular interest is the
use of sequences that allow for the expression of functional
epitopes or domains, usually at least about 8 amino acids in
length, more usually at least about 15 amino acids in length, at
least about 25 amino acids, at least about 45 amino acids, and up
to the complete open reading frame of the gene. After introduction
of the DNA, the cells containing the construct may be selected by
means of a selectable marker, the cells expanded and then used for
expression.
[0072] The expression cassettes may be introduced into a variety of
vectors, e.g. plasmid, BAC, YAC, bacteriophage such as lambda, P1,
M13, etc., animal or plant viruses, and the like, where the vectors
are normally characterized by the ability to provide selection of
cells comprising the expression vectors. The vectors may provide
for extrachromosomal maintenance, particularly as plasmids or
viruses, or for integration into the host chromosome. Where
extrachromosomal maintenance is desired, an origin sequence is
provided for the replication of the plasmid, which may be low- or
high copy-number. A wide variety of markers are available for
selection, particularly those which protect against toxins, more
particularly against antibiotics. The particular marker that is
chosen is selected in accordance with the nature of the host, where
in some cases, complementation may be employed with auxotrophic
hosts. Introduction of the DNA construct may use any convenient
method, e.g. conjugation, bacterial transformation,
calcium-precipitated DNA, electroporation, fusion, transfection,
infection with viral vectors, biolistics, etc.
[0073] Genetically Modified Cells. The present invention further
provides host cells, which may be isolated host cells, comprising
polymorphic VASP nucleic acid molecules of the invention. Suitable
host cells include prokaryotes such as E. coli, B. subtilis,
eukaryotes, including insect cells in combination with baculovirus
vectors, yeast cells, such as Saccharomyces cerevisiae, or cells of
a higher organism such as vertebrates, including amphibians (e.g.,
Xenopus laevis oocytes), and mammals, particularly humans, e.g. COS
cells, CHO cells, HEK293 cells, and the like, may be used as the
host cells. Host cells can be used for the purposes of propagating
a polymorphic VASP nucleic acid molecule, for production of a
polymorphic VASP polypeptide, or in cell-based methods for
identifying agents which modulate a level of VASP mRNA and/or
protein and/or biological activity in a cell.
[0074] Primary or cloned cells and cell lines may be modified by
the introduction of vectors comprising a DNA encoding the
VASP-heterologous fusion protein polymorphism(s). The isolated
polymorphic VASP nucleic acid molecule may comprise one or more
variant sequences, e.g., a haplotype of commonly occurring
combinations. In one embodiment of the invention, a panel of two or
more genetically modified cell lines, each cell line comprising a
VASP polymorphism, are provided for substrate and/or expression
assays. The panel may further comprise cells genetically modified
with other genetic sequences, including polymorphisms, particularly
other sequences of interest for pharmacogenetic screening, e.g.
other genes/gene mutations associated with obesity, a number of
which are known in the art.
[0075] Transgenic animals. The subject nucleic acids can be used to
generate genetically modified non-human animals or site specific
gene modifications in cell lines. The term "transgenic" is intended
to encompass genetically modified animals having the addition of
DNA encoding the VASP-heterologous fusion protein or having an
exogenous DNA encoding the VASP-heterologous fusion protein that is
stably transmitted in the host cells. Transgenic animals may be
made through homologous recombination. Alternatively, a nucleic
acid construct is randomly integrated into the genome. Vectors for
stable integration include plasmids, retroviruses and other animal
viruses, YACs, and the like. Of interest are transgenic mammals,
e.g. cows, pigs, goats, horses, etc., and particularly rodents,
e.g. rats, mice, etc.
[0076] DNA constructs for homologous recombination will comprise at
least a portion of the DNA encoding the VASP-heterologous fusion
protein and will include regions of homology to the target locus.
Conveniently, markers for positive and negative selection are
included. Methods for generating cells having targeted gene
modifications through homologous recombination are known in
the-art. For various techniques for transfecting mammalian cells,
see Known et al. (1990) Methods in Enzymology 185:527-537.
[0077] For embryonic stem (ES) cells, an ES cell line may be
employed, or ES cells may be obtained freshly from a host, e.g.
mouse, rat, guinea pig, etc. Such cells are grown on an appropriate
fibroblast-feeder layer or grown in the presence of leukemia
inhibiting factor (LIF). When ES cells have been transformed, they
may be used to produce transgenic animals. After transformation,
the cells are plated onto a feeder layer in an appropriate medium.
Cells containing the construct may be detected by employing a
selective medium. After sufficient time for colonies to grow, they
are picked and analyzed for the occurrence of homologous
recombination. Those colonies that show homologous recombination
may then be used for embryo manipulation and blastocyst injection.
Blastocysts are obtained from. 4 to 6 week old superovulated
females. The ES cells are trypsinized, and the modified cells are
injected into the blastocoel of the blastocyst. After injection,
the blastocysts are returned to each uterine horn of pseudopregnant
females. Females are then allowed to go to term and the resulting
litters screened for mutant cells having the construct. By
providing for a different phenotype of the blastocyst and the ES
cells, chimeric progeny can be readily detected. The chimeric
animals are screened for the presence of the DNA encoding the
VASP-heterologous fusion protein and males and females having the
modification are mated to produce homozygous progeny. The
transgenic animals may be any non-human mammal, such as laboratory
animals, domestic animals, etc. The transgenic animals may be used
to determine the effect of a candidate drug in an in vivo
environment.
Production of Homo- or Hetero-Tetrameric Proteins Utilizing VASP
Constructs
[0078] The present invention is a method of preparing a soluble,
homo- or hetero-trimeric protein by culturing a host cell
transformed or transfected with at least one or up to four
different expression vectors encoding a fusion protein comprising a
VASP domain and a heterologous protein. In order to produce a
biologically functioning protein, the four VASP domains
preferentially form a homo- or hetero-tetramers. The culturing can
also occur in the same host cell, if efficient production can be
maintained, and homo- or hetero-tetrameric proteins are then
isolated from the medium. Ideally, the four heterologous proteins
are differentially labeled with various tag sequences (i.e., His
tag, FLAG tag, and Glu-Glu tag) to allow analysis of the
composition or purification of the resulting molecules.
Alternatively, the four components can be produced separately and
combined in deliberate ratios to result in the hetero-tetrameric
molecules desired. The VASP domains utilized in making these
hetero-trimeric molecules can be the same or different and the
fusion protein(s) can further comprise a linker sequence. In one
particular embodiment, the heterologous proteins used to form the
homo-tetrameric protein is the soluble domain of B7H1.
[0079] One result of the use of the VASP tetramerization domain of
the present invention is the ability to increase the affinity and
avidity of the heterologous protein for its ligand or binding
partner through the formation of the terameric form. By avidity, it
is meant the strength of binding of multiple molecules to a larger
molecule, a situation exemplified but not limited to the binding of
a complex antigen by an antibody. Such a characteristic would be
improved or formed for many heterologous proteins, for example, by
the formation of multiple binding sites for its ligand or ligands
through the tetramerization of the heterologous receptor using the
VASP domain. By affinity, it is meant the strength of binding of a
simple receptor-ligand system. Such a characteristic would be
improved for a subset of heterologous proteins using the
tetramerization domain of the present invention, for example, by
forming a binding site with better binding characteristics for a
single ligand through the tetramerization of the receptor. Avidity
and affinity can be measured using standard assays well known to
one of ordinary skill, for example, the methods described in
Example 3. An improvement in affinity or avidity occurs when the
affinity or avidity value (for example, affinity constant or
K.sub.a) for the tetramerization domain-heterologous protein fusion
and its ligand is higher than for the heterologous protein alone
and its ligand. An alternative means of measuring these
characteristics is the equilibrium constant (K.sub.d) where a
decrease would be observed with the improvement in affinity or
avidity using the VASP tetermerization domain of the present
invention.
Biological Activity of the VASP-Heterologous Fusion Proteins
[0080] Biological activity of recombinant VASP-heterologous fusion
proteins is mediated by binding of the recombinant fusion protein
to a cognate molecule, such as a receptor or cross-receptor. A
cognate molecule is defined as a molecule which binds the
recombinant fusion protein in a non-covalent interaction based upon
the proper conformation of the recombinant fusion protein and the
cognate molecule. For example, for a recombinant fusion protein
comprising an extracellular region of a receptor, the cognate
molecule comprises a ligand which binds the extracellular region of
the receptor. Conversely, for a recombinant soluble fusion protein
comprising a ligand, the cognate molecule comprises a receptor (or
binding protein) which binds the ligand.
[0081] Binding of a recombinant fusion protein to a cognate
molecule is a marker for biological activity. Such binding activity
may be determined, for example, by competition for binding to the
binding domain of the cognate molecule (i.e. competitive binding
assays). One configuration of a competitive binding assay for a
recombinant fusion protein comprising a ligand uses a radiolabeled,
soluble receptor, and intact cells expressing a native form of the
ligand. Similarly, a competitive assay for a recombinant fusion
protein comprising a receptor uses a radiolabeled, soluble ligand,
and intact cells expressing a native form of the receptor. Such an
assay is described in Example 3. Instead of intact cells expressing
a native form of the cognate molecule, one could substitute
purified cognate molecule bound to a solid phase. Competitive
binding assays can be performed using standard methodology.
Qualitative or semi-quantitative results can be obtained by
competitive autoradiographic plate binding assays, or fluorescence
activated cell sorting, or Scatchard plots may be utilized to
generate quantitative results.
[0082] Biological activity may also be measured using bioassays
that are known in the art, such as a cell proliferation assay. An
exemplary bioassay is described in Example 4. The type of cell
proliferation assay used will depend upon the recombinant soluble
fusion protein. For example, a bioassay for a recombinant soluble
fusion protein that in its native form acts upon T cells will
utilize purified T cells obtained by methods that are known in the
art. Such bioassays include costimulation assays in which the
purified T cells are incubated in the presence of the recombinant
soluble fusion protein and a suboptimal level of a mitogen such as
Con A or PHA. Similarly, purified B cells will be used for a
recombinant soluble fusion protein that in its native form acts
upon B cells. Other types of cells may also be selected based upon
the cell type upon which the native form of the recombinant soluble
fusion protein acts. Proliferation is determined by measuring the
incorporation of a radiolabeled substance, such as 3H thymidine,
according to standard methods.
[0083] Yet another type assay for determining biological activity
is induction of secretion of secondary molecules. For example,
certain proteins induce secretion of cytokines by T cells. T cells
are purified and stimulated with a recombinant soluble fusion
protein under the conditions required to induce cytokine secretion
(for example, in the presence of a comitogen). Induction of
cytokine secretion is determined by bioassay, measuring the
proliferation of a cytokine dependent cell line. Similarly,
induction of immunoglobulin secretion is determined by measuring
the amount of immunoglobulin secreted by purified B cells
stimulated with a recombinant soluble fusion protein that acts on B
cells in its native form, using a quantitative (or
semi-quantitative) assay such as an enzyme immunoassay.
[0084] If the binding partner for a particular heterologous protein
is unknown, the VASP-fusion protein can be used in a binding assay
to seek out that binding partner. One method of doing this, called
a secretion trap assay, is described in Example 5, although other
methods of using a VASP-fusion protein to identify binding partners
are well known to one of ordinary skill.
Treatment Methods
[0085] For pharmaceutical use, the fusion proteins of the present
invention are formulated for parenteral, particularly intravenous
or subcutaneous, administration according to conventional methods.
Intravenous administration will be by bolus injection or infusion
over a typical period of one to several hours. In general,
pharmaceutical formulations will include a VASP-heterologous fusion
protein in combination with a pharmaceutically acceptable vehicle,
such as saline, buffered saline, 5% dextrose in water or the like.
Formulations may further include one or more excipients,
preservatives, solubilizers, buffering agents, albumin to prevent
protein loss on vial surfaces, etc. Methods of formulation are well
known in the art and are disclosed, for example, in Remington's
Pharmaceutical Sciences, Gennaro, ed., Mack Publishing Co., Easton
Pa., 1990, which is incorporated herein by reference. Therapeutic
doses will generally be in the range of 0.1 to 100 .mu.g/kg of
patient weight per day, preferably 0.5-20 .mu.g/kg per day, with
the exact dose determined by the clinician according to accepted
standards, taking into account the nature and severity of the
condition to be treated, patient traits, etc. Determination of dose
is within the level of ordinary skill in the art. The proteins may
be administered for acute treatment, over one week or less, often
over a period of one to three days or may be used in chronic
treatment, over several months or years. In general, a
therapeutically effective amount of VASP-heterologous fusion
protein is an amount sufficient to produce a clinically significant
change in the symptoms characteristics of the lack of heterologous
protein function. Alternatively, if the VASP-heterologous fusion
protein is to act as an antagonist, a therapeutically effective
amount is that which produces a clinically significant change in
symptoms characteristic of an over-abundance of heterologous
protein function. VASP fusions to the extracellular domains of the
following receptors.
[0086] Using essentially the methods described in the Examples that
follow VASP fusion proteins have been made to the extracellular
domains of these B7 family members: pb7H1 (see Examples), pb7H3,
pb7H4, pb7DC, pG6B, pNKp30, pNFAM, pHHLA2, and pPVR as well as
murine pNFAM. The resulting proteins were expressed well in CHO
cells or BHK cells as tetrameric oligomers.
EXAMPLES
[0087] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention nor are they intended to represent that the
experiments below are all or the only experiments performed.
Efforts have been made to ensure accuracy with respect to numbers
used (e.g. amounts, temperature, etc.) but some experimental errors
and deviations should be accounted for. Unless indicated otherwise,
parts are parts by weight, molecular weight is weight average
molecular weight, temperature is in degrees Celsius, and pressure
is at or near atmospheric.
Example 1
Cloning and Construction of VASP Expression Vector
[0088] Human vasodialator-activated phosphoprotein (VASP) is
described by Kuhnel, et al., (2004) Proc. Nat'l. Acad. Sci. 101:
17027. VASP nucleotide and amino acid sequences are provided as SEQ
ID NOS. 1 and 2. Two overlapping oligonucleotides, which encoded
both sense and antisense strands of the tetramerization domain of
human VASP protein, were synthesized by solid phased synthesis: 5'
ACGCTTCCGT AGATCTGGTT CCGGAGGCTC CGGTGGCTCC GACCTACAGA GGGTGAAACA
GGAGCTTCTG GAAGAGGTGA AGAAGGAATT GCAGAAGTGA AAG 3' (zc50629, SEQ ID
NO:3); 5' AAGGCGCGCC TCTAGATCAG TGATGGTGAT GGTGATGGCC ACCGGAACCC
CTCAGCTCCT GGACGAAGGC TTCAATGATT TCCTCTTTCA CTTTCTGCAA TTC 3' (ZC
50630, SEQ ID NO:4). The oligonucleotides zc50629 and zc50630 were
annealed at 55.degree. C., and amplified by PCR with the
olignucleotide primers zc50955 (5' CTCAGCCAGG AAATCCATGC CGAGTTGAGA
CGCTTCCGTA GATCTGG 3') (SEQ ID NO:5) and zc50956 (5' GGGGTGGGGT
ACAACCCCAG AGCTGTTTTA AGGCGCGCCT CTAGATC 3') (SEQ ID NO:6).
[0089] The amplified DNA was fractionated on 1.5% agarose gel and
then isolated using a Qiagen gel isolation kit according to
manufacturer's protocol (Qiagen, Valiencia, Calif.). The isolated
DNA was inserted into BglII cleaved pzmp21 vector by yeast
recombination. DNA sequencing confirmed the expected sequence of
the vector, which was designated pzmp21VASP-His.sub.6
Construction of an Expression Vector for Tetrameric
B7H1VASP-His.sub.6
[0090] The extracellular domain of B7H1 was amplified by PCR with
oligonucleotide primers zc51310
(5'CCACAGGTGTCCAGGGAATTCGCAAGATGAGGATATTTGCTGTC 3') (SEQ ID NO:7)
and zc51312 (5'CTCCGGAACCAGATCTTTCATTTGGAGGATGTGC 3') (SEQ ID
NO:8). The amplified DNA was fractionated on 1.5% agarose gel and
then isolated using a Qiagen gel isolation kit according to
manufacturer's protocol (Qiagen, Valiencia, Calif.). The isolated
DNA was inserted into BglII and EcoR1 cleaved pzmp21VASP-His.sub.6
vector by in fusion according to the manufacturers instruction (BD
Biosciences, San Diego, Calif.). DNA sequencing confirmed the
expected sequence of the vector, which was designated
pzmp21B7H1VASP-His.sub.6, the B7H1-VASP-His.sub.6 portion is
disclosed herein as SEQ ID NO: 9, with the resulting polypeptide
sequence being SEQ ID NO: 10.
[0091] This vector includes the coding sequence for the B7H1
extracellular domain comprising amino acids 1 to 239 of the full
length gene (amino acids 1 to 239 of SEQ ID NO: 13) (this includes
the gene's native signal sequence of the first 18 amino acids), the
flexible linker GSGG (amino acids 1 to 4 of SEQ ID NO:2 or SEQ ID
NO: 11), the VASP tetramerization domain (amino acids 5 to 38 of
SEQ ID NO: 2), the flexible linker GSGG (amino acids 39 to 42 of
SEQ ID NO: 2 or SEQ ID NO: 1), and the His.sub.6 tag amino acid
residues (amino acids 43 to 48 of SEQ ID NO: 2 or SEQ ID NO:
12).
Example 2
Expression and Purification of B7H1VASP-HIS.sub.6
[0092] The pzmp21B7H1VASP-His.sub.6 vector was transfected into
BHK570 cells using Lipofectamine 2000 according to manufacturer's
protocol (Invitrogen, Carlsbad, Calif.) and the cultures were
selected for transfectants resistance to 10 .mu.M methotrexate.
Resistant colonies were transferred to tissue culture dishes,
expanded and analyzed for secretion of B7H1VASP-His.sub.6 by
western blot analysis with Anti-His (C-terminal) Antibody
(Invitrogen, Carlsbad, Calif.). The resulting cell line,
BHK.B7H1VASP-His.sub.6.2, was expanded.
A) Purification of B7H1VASP-His.sub.6 from BHK Cells
[0093] The purification was performed at 4.degree. C. About 2 L of
conditioned media from BHK:B7H1VASP-His.sub.6.2 was concentrated to
0.2 L using Pellicon-2 5 k filters (Millipore, Bedford, Mass.),
then buffer-exchanged tenfold with 20 mM NaPO.sub.4, 0.5M NaCl, 15
mM Imidazole, pH 7.5. The final 0.2L sample was passed-through a
0.2 mm filter (Millipore, Bedford, Mass.).
[0094] A Talon (BD Biosciences, San Diego, Calif.) column with a 20
mL bed-volume was packed and equilibrated with 20 mM NaPi, 15 mM
Imidazole, 0.5 M NaCl, pH 7.5. The media was loaded onto the column
at a flow-rate of 0.2-0.4 mL/min then washed with 5-6 CV of the
equilibration buffer. B7H1VASP-His.sub.6 was eluted from the column
with 20 mM NaPO.sub.4, 0.5 M NaCl, 0.5 M Imidazole, pH 7.5 at a
flow-rate of 4 mL/min. 10 mL fractions were collected and analyzed
for the presence of B7H1VASP-His.sub.6 by Coomassie-stained
SDS-PAGE.
[0095] A combined pool of Talon eluates obtained from three
identical runs as described above was concentrated from 60 mL to 3
mL using an Amicon Ultra 5 k centrifugal filter (Millipore,
Bedford, Mass.). A Superdex 200 column with a bed-volume of 318 mL
was equilibrated with 50 mM NaPi, 110 mM NaCl, pH 7.3, and the 3 mL
sample was injected into the column at a flow-rate of 0.5 mL/min.
Two 280 nm absorbance peaks were observed eluting from the column,
one at 0.38 CV and the other at 0.44 CV. The fractions eluting
around 0.44 CV, believed to contain tetrameric B7H1VASP-His.sub.6,
were pooled and concentrated, sterile-filtered through a 0.2 mm
Acrodisc filter (Pall Corporation, East Hills, N.Y.), and stored at
-80.degree. C. Concentration of the final sample was determined by
BCA (Pierce, Rockford, Ill.).
B) SEC-MALS Analysis of B7H1VASP--CH.sub.6
[0096] The purpose of size exclusion chromatography (SEC) is to
separate molecules on the basis of size for estimation of molecular
weight (M.sub.W). If static light scattering detection is added to
a SEC system, absolute measurements of molecular weight can be
made. This is possible because the intensity of light scattered by
the analyte is directly proportional to its mass and concentration,
and is completely independent of SEC elution position, conformation
or interaction with the column matrix. Additionally, by combining
SEC, multi-angle laser light scattering (MALS) and refractive index
detection (RI), the molecular mass, association state, and degree
of glycosylation can be determined. The limit of accuracy of these
measurements for a sample that is monodisperse with respect to
M.sub.W is .+-.2%.
[0097] The molecular mass of monomeric B7H1VASP--CH.sub.6,
predicted from primary amino acid sequence is 31 kDa. The predicted
molecular mass of tetrameric B7H1VASP--CH.sub.6 would be 124 Kda.
The measured molecular mass of B7H1VASP--CH.sub.6 measured by
SEC-MALS was 155 KDa. Subtraction of 35 Kda of molecular mass due
to carbohydrate leaves 120 KDa as the mass of the core protein,
consistent with a tetrameric state in solution.
Example 3
Test of Binding Activity of".sup.125I-VASP-B7H1 Fusion Protein to
Cell Lines
A) Saturation Binding
[0098] 25 mg of purified B7H1VASP-His.sub.6 was labeled with 2mCi
125, using IODO-TUBES (Pierce, Rockford, Ill.) according to
manufacturer's instructions. This labeled protein was used to asses
binding to transfected BHK 570 cells expressing PD-1, the ligand
for B7H1 (ref), with untransfected BHK-570 cells as control.
1.times.10.sup.5 cells were plated in 24 well dishes and cultured
for two days. Concentrations of .sup.125I-B7H1VASP-His.sub.6, from
22.5 nM to 10.3 pM, with or without 100 fold excess of unlabeled
B7H1VASP-His.sub.6, was added to triplicate wells of cells. The
binding reactions were incubated for one hour on ice, and then the
cells were washed 3.times. with ice cold binding buffer. Bound
proteins were extracted with 1 M NaOH and quantitated on the
COBRAII Auto-gamma counter (Packard Instruments Co., Meriden,
Conn.) Analysis of the binding was done using GraphPad, Prism 4
(GraphPad Software, Inc., San Diego, Calif.). The results of this
experiment are reported in FIG. 3.
[0099] Saturation binding and inhibition by unlabeled protein
revealed high affinity (Kd 50 nM) binding of tetrameric
B7H1VASP-His.sub.6 to cell surface PD-1. This is 10 fold higher
affinity than that reported for B7H1IgG (Freeman et al., (2000) J.
Exp. Med. 192: 1027).
B) Binding Specificity
[0100] 1.times.10.sup.5 cells were plated in 24 well dishes and
cultured for two days. 250 pM of .sup.125I-B7H1VASP-His.sub.6 with
or without 100 fold excess of unlabeled B7H1VASP-His.sub.6,
B7H1IgG, B7DCIgG (R & D Systems, Minneapolis, Minn.), zB7R1IgG,
or pG6BIgG was added to triplicate wells of cells. The binding
reactions were incubated for one hour on ice, and then the cells
were washed 3.times. with ice cold binding buffer. Bound proteins
were extracted with 1 M NaOH and quantitated on the COBRAII
Auto-gamma counter (Packard Instruments Co., Meriden, Conn.)
Analysis of the binding was done using GraphPad, Prism 4 (GraphPad
Software, Inc., San Diego, Calif.). .sup.125I-B7H1VASP-His.sub.6
binds only to transfected BHK cells expressing PD-1 and not to
untransfected cells. The specificity of the interaction of
zB7H1VASP is demonstrated by the ability of PD-1 ligands to inhibit
binding, while other B7 family members, that do not interact with
PD-1, do not affect binding. A graph showing the results of this
experiment is in FIG. 4.
C) Competition of .sup.125I-B7H1VASP-His.sub.6 binding by
B7H1VASP-His.sub.6 or B7H1IgG.
[0101] 1.times.10.sup.5 cells were plated in 24 well dishes and
cultured for two days. 250 pM of 125I-B7H1VASP-His.sub.6, without
or with increasing concentration of unlabeled B7H1VASP-His.sub.6,
or B7H1IgG (R & D Systems, Minneapolis, Minn.), was added to
triplicate wells of cells. The binding reactions were incubated for
one hour on ice, and then the cells were washed 3.times. with ice
cold binding buffer. Bound proteins were extracted with 1 M NaOH
and quantitated on the COBRAII Auto-gamma counter (Packard
Instruments Co., Meriden, Conn.) Analysis of the binding was done
using GraphPad, Prism 4 (GraphPad Software, Inc., SanDiego,
Calif.). The 10 fold greater affinity of B7H1VASP, as compared to
B7H1IgG, is demonstrated by the shift in competition for
.sup.125I7H1VASP-His.sub.6 binding to lower concentration. A graph
illustrating this result is in FIG. 5.
Example 4
Testing the Biological Activity of the B7H1-VASP Fusion Protein
[0102] T-cells are isolated from peripheral blood by negative
selection (Mitenyi Biotec, Auburn, Calif.). T-cells are plated into
each well of a 96 well dish that had been pre-coated with anti-CD3
(BD Bioscience, San Diego, Calif.). Anti-CD28 (BD Bioscience, San
Diego, Calif.), and increasing concentration of B7H1VASP are added
to appropriate wells. The cultures are incubated at 37.degree. C.
for 4 days and then labeled overnight with 1 .mu.Ci [.sup.3H]
thymidine per well. Proliferation is measured as [.sup.3H]
thymidine incorporated, and culture cytokine content is quantitated
using Luminex (Austen, Tex.). B7H1VASP is expected to potently
inhibit both T-cell proliferation and cytokine release (Dong et
al., Nature Med. 5: 1365-1369, 1999).
Example 5
Use of VASP-Protein Fusion to Screen for Ligands
A) Screening of the cDNA Library:
[0103] A secretion trap assay is used to pair VASP-protein fusions
to putative ligands or binding partners. A soluble VASP fusion
protein that has been biotinylated is used as a binding reagent in
a secretion trap assay. A cDNA library from cells of interest, for
example, stimulated mouse bone marrow (mBMDC) is transiently
transfected into COS cells in pools of clones. Commonly, about 800
clones are produced for the initial transfection. The binding of
the biotinylated VASP-protein fusion to transfected COS cells is
carried out using the secretion trap assay described below.
Positive binding is seen in a subset of the pools screened. One of
these pools is selected and electroporated into a bacterial host
such as DH10B. 400 single colonies are picked into 1.2 mls LB+100
ug/ml ampicillin in deep well 96-well blocks, grown overnight
followed by DNA isolation from each plate. After transfection and
secretion trap probe, positive wells are identified from this
breakdown and submitted to sequencing and are identified through
comparison to known sequences. The purified cDNA is transfected and
probed with biotinylated VASP-protein fusion along with additional
controls to verify that the identified protein specifically and
reproducibly binds to the VASP-fusion protein but not other VASP
chimeras.
B) COS Cell Transfections
[0104] The COS cell transfection is performed as follows: Mix 1 ug
pooled DNA in 25 ul of serum free DMEM media (500 mls DMEM with 5
mls non-essential amino acids) and 1 ul Cosfectin.TM. in 25 ul
serum free DMEM media. The diluted DNA and cosfectin are then
combined followed by incubating at room temperature for 30 minutes.
Add this 50 ul mixture onto 8.5.times.10.sup.5 COS cells/well that
have been plated on the previous day in 12-well tissue culture
plates and incubate overnight at 37.degree. C.
C) Secretion Trap Assay
[0105] The secretion trap is performed as follows: Media is
aspirated from the wells and then the cells are fixed for 15
minutes with 1.8% formaldehyde in PBS. Cells are then washed with
TNT (0.1M Tris-HCL, 0.15M NaCl, and 0.05% Tween-20 in H.sub.2O),
and permeabilized with 0.1% Triton-X in PBS for 15 minutes, and
again washed with TNT. Cells are blocked for 1 hour with TNB (0.1M
Tris-HCL, 0.15M NaCl and 0.5% Blocking Reagent (NEN Renaissance
TSA-Direct Kit) in H.sub.2O), and washed again with TNT. The cells
are incubated for 1 hour with 2 .mu.g/ml soluble biotinylated
VASP-fusion protein. Cells are then washed with TNT. Cells are
fixed a second time for 15 minutes with 1.8% formaldehyde in PBS.
After washing with TNT, cells are incubated for another hour with
1:1000 diluted streptavidin HRP. Again cells are washed with
TNT.
[0106] Positive binding is detected with fluorescein tyramide
reagent diluted 1:50 in dilution buffer (NEN kit) and incubated for
5 minutes, and washed with TNT. Cells are preserved with
Vectashield Mounting Media (Vector Labs Burlingame, Calif.) diluted
1:5 in TNT. Cells are visualized using a FITC filter on fluorescent
microscope.
Sequence CWU 1
1
171147DNAArtificial SequenceVASP-His6 tetramerizing domain
1ggctccggtg gctccgacct acagagggtg aaacaggagc ttctggaaga ggtgaagaag
60gaattgcaga aagtgaaaga ggaaatcatt gaagccttcg tccaggagct gaggggttcc
120ggtggccatc accatcacca tcactga 147248PRTArtificial
SequenceVASP-His6 tetramerizing domain 2Gly Ser Gly Gly Ser Asp Leu
Gln Arg Val Lys Gln Glu Leu Leu Glu 1 5 10 15Glu Val Lys Lys Glu
Leu Gln Lys Val Lys Glu Glu Ile Ile Glu Ala 20 25 30Phe Val Gln Glu
Leu Arg Gly Ser Gly Gly His His His His His His 35 40
453103DNAArtificial Sequenceprimer 3acgcttccgt agatctggtt
ccggaggctc cggtggctcc gacctacaga gggtgaaaca 60ggagcttctg gaagaggtga
agaaggaatt gcagaagtga aag 1034103DNAArtificial Sequenceprimer
4aaggcgcgcc tctagatcag tgatggtgat ggtgatggcc accggaaccc ctcagctcct
60ggacgaaggc ttcaatgatt tcctctttca ctttctgcaa ttc
103547DNAArtificial Sequenceprimer 5ctcagccagg aaatccatgc
cgagttgaga cgcttccgta gatctgg 47647DNAArtificial Sequenceprimer
6ggggtggggt acaaccccag agctgtttta aggcgcgcct ctagatc
47744DNAArtificial Sequenceprimer 7ccacaggtgt ccagggaatt cgcaagatga
ggatatttgc tgtc 44834DNAArtificial Sequenceprimer 8ctccggaacc
agatctttca tttggaggat gtgc 349873DNAArtificial
SequenceB7H1-VASP-His6 9atgaggatat ttgctgtctt tatattcatg acctactggc
atttgctgaa cgcatttact 60gtcacggttc ccaaggacct atatgtggta gagtatggta
gcaatatgac aattgaatgc 120aaattcccag tagaaaaaca attagacctg
gctgcactaa ttgtctattg ggaaatggag 180gataagaaca ttattcaatt
tgtgcatgga gaggaagacc tgaaggttca gcatagtagc 240tacagacaga
gggcccggct gttgaaggac cagctctccc tgggaaatgc tgcacttcag
300atcacagatg tgaaattgca ggatgcaggg gtgtaccgct gcatgatcag
ctatggtggt 360gccgactaca agcgaattac tgtgaaagtc aatgccccat
acaacaaaat caaccaaaga 420attttggttg tggatccagt cacctctgaa
catgaactga catgtcaggc tgagggctac 480cccaaggccg aagtcatctg
gacaagcagt gaccatcaag tcctgagtgg taagaccacc 540accaccaatt
ccaagagaga ggagaagctt ttcaatgtga ccagcacact gagaatcaac
600acaacaacta atgagatttt ctactgcact tttaggagat tagatcctga
ggaaaaccat 660acagctgaat tggtcatccc agaactacct ctggcacatc
ctccaaatga aagatctggt 720tccggaggct ccggtggctc cgacctacag
agggtgaaac aggagcttct ggaagaggtg 780aagaaggaat tgcagaaagt
gaaagaggaa atcattgaag ccttcgtcca ggagctgagg 840ggttccggtg
gccatcacca tcaccatcac tga 87310290PRTArtificial
SequenceB7H1-VASP-His6 10Met Arg Ile Phe Ala Val Phe Ile Phe Met
Thr Tyr Trp His Leu Leu 1 5 10 15Asn Ala Phe Thr Val Thr Val Pro
Lys Asp Leu Tyr Val Val Glu Tyr 20 25 30Gly Ser Asn Met Thr Ile Glu
Cys Lys Phe Pro Val Glu Lys Gln Leu 35 40 45Asp Leu Ala Ala Leu Ile
Val Tyr Trp Glu Met Glu Asp Lys Asn Ile 50 55 60Ile Gln Phe Val His
Gly Glu Glu Asp Leu Lys Val Gln His Ser Ser65 70 75 80Tyr Arg Gln
Arg Ala Arg Leu Leu Lys Asp Gln Leu Ser Leu Gly Asn 85 90 95Ala Ala
Leu Gln Ile Thr Asp Val Lys Leu Gln Asp Ala Gly Val Tyr 100 105
110Arg Cys Met Ile Ser Tyr Gly Gly Ala Asp Tyr Lys Arg Ile Thr Val
115 120 125Lys Val Asn Ala Pro Tyr Asn Lys Ile Asn Gln Arg Ile Leu
Val Val 130 135 140Asp Pro Val Thr Ser Glu His Glu Leu Thr Cys Gln
Ala Glu Gly Tyr145 150 155 160Pro Lys Ala Glu Val Ile Trp Thr Ser
Ser Asp His Gln Val Leu Ser 165 170 175Gly Lys Thr Thr Thr Thr Asn
Ser Lys Arg Glu Glu Lys Leu Phe Asn 180 185 190Val Thr Ser Thr Leu
Arg Ile Asn Thr Thr Thr Asn Glu Ile Phe Tyr 195 200 205Cys Thr Phe
Arg Arg Leu Asp Pro Glu Glu Asn His Thr Ala Glu Leu 210 215 220Val
Ile Pro Glu Leu Pro Leu Ala His Pro Pro Asn Glu Arg Ser Gly225 230
235 240Ser Gly Gly Ser Gly Gly Ser Asp Leu Gln Arg Val Lys Gln Glu
Leu 245 250 255Leu Glu Glu Val Lys Lys Glu Leu Gln Lys Val Lys Glu
Glu Ile Ile 260 265 270Glu Ala Phe Val Gln Glu Leu Arg Gly Ser Gly
Gly His His His His 275 280 285His His 290114PRTArtificial
Sequencelinker 11Gly Ser Gly Gly 1126PRTArtificial Sequencetag
12His His His His His His 1 513873DNAHomo sapiens 13atgaggatat
ttgctgtctt tatattcatg acctactggc atttgctgaa cgcatttact 60gtcacggttc
ccaaggacct atatgtggta gagtatggta gcaatatgac aattgaatgc
120aaattcccag tagaaaaaca attagacctg gctgcactaa ttgtctattg
ggaaatggag 180gataagaaca ttattcaatt tgtgcatgga gaggaagacc
tgaaggttca gcatagtagc 240tacagacaga gggcccggct gttgaaggac
cagctctccc tgggaaatgc tgcacttcag 300atcacagatg tgaaattgca
ggatgcaggg gtgtaccgct gcatgatcag ctatggtggt 360gccgactaca
agcgaattac tgtgaaagtc aatgccccat acaacaaaat caaccaaaga
420attttggttg tggatccagt cacctctgaa catgaactga catgtcaggc
tgagggctac 480cccaaggccg aagtcatctg gacaagcagt gaccatcaag
tcctgagtgg taagaccacc 540accaccaatt ccaagagaga ggagaagctt
ttcaatgtga ccagcacact gagaatcaac 600acaacaacta atgagatttt
ctactgcact tttaggagat tagatcctga ggaaaaccat 660acagctgaat
tggtcatccc agaactacct ctggcacatc ctccaaatga aaggactcac
720ttggtaattc tgggagccat cttattatgc cttggtgtag cactgacatt
catcttccgt 780ttaagaaaag ggagaatgat ggatgtgaaa aaatgtggca
tccaagatac aaactcaaag 840aagcaaagtg atacacattt ggaggagacg taa
87314290PRTHomo sapiens 14Met Arg Ile Phe Ala Val Phe Ile Phe Met
Thr Tyr Trp His Leu Leu 1 5 10 15Asn Ala Phe Thr Val Thr Val Pro
Lys Asp Leu Tyr Val Val Glu Tyr 20 25 30Gly Ser Asn Met Thr Ile Glu
Cys Lys Phe Pro Val Glu Lys Gln Leu 35 40 45Asp Leu Ala Ala Leu Ile
Val Tyr Trp Glu Met Glu Asp Lys Asn Ile 50 55 60Ile Gln Phe Val His
Gly Glu Glu Asp Leu Lys Val Gln His Ser Ser65 70 75 80Tyr Arg Gln
Arg Ala Arg Leu Leu Lys Asp Gln Leu Ser Leu Gly Asn 85 90 95Ala Ala
Leu Gln Ile Thr Asp Val Lys Leu Gln Asp Ala Gly Val Tyr 100 105
110Arg Cys Met Ile Ser Tyr Gly Gly Ala Asp Tyr Lys Arg Ile Thr Val
115 120 125Lys Val Asn Ala Pro Tyr Asn Lys Ile Asn Gln Arg Ile Leu
Val Val 130 135 140Asp Pro Val Thr Ser Glu His Glu Leu Thr Cys Gln
Ala Glu Gly Tyr145 150 155 160Pro Lys Ala Glu Val Ile Trp Thr Ser
Ser Asp His Gln Val Leu Ser 165 170 175Gly Lys Thr Thr Thr Thr Asn
Ser Lys Arg Glu Glu Lys Leu Phe Asn 180 185 190Val Thr Ser Thr Leu
Arg Ile Asn Thr Thr Thr Asn Glu Ile Phe Tyr 195 200 205Cys Thr Phe
Arg Arg Leu Asp Pro Glu Glu Asn His Thr Ala Glu Leu 210 215 220Val
Ile Pro Glu Leu Pro Leu Ala His Pro Pro Asn Glu Arg Thr His225 230
235 240Leu Val Ile Leu Gly Ala Ile Leu Leu Cys Leu Gly Val Ala Leu
Thr 245 250 255Phe Ile Phe Arg Leu Arg Lys Gly Arg Met Met Asp Val
Lys Lys Cys 260 265 270Gly Ile Gln Asp Thr Asn Ser Lys Lys Gln Ser
Asp Thr His Leu Glu 275 280 285Glu Thr 290158PRTArtificial
Sequencetag 15Asp Tyr Lys Asp Asp Asp Asp Lys 1 5162207DNAHomo
sapiens 16ccccttcctg tggggttcat tggggcatcc cctttctgct gcaggaacct
ctcatcagac 60cgcctgaggg aagcggcgcc cggagacccg ccccggcccg gtccacattc
tccccaggaa 120gccggactct atggggcggg accctggggg agcctgagcc
gagcccggag ccagccccga 180acccctgaac ctccagccag gggcgccccg
ggagcagcca gcccgtgggc gagccgcccg 240cccgccgagc agccatgagc
gagacggtca tctgttccag ccgggccact gtgatgcttt 300atgatgatgg
caacaagcga tggctccctg ctggcacggg tccccaggcc ttcagccgcg
360tccagatcta ccacaacccc acggccaatt cctttcgcgt cgtgggccgg
aagatgcagc 420ccgaccagca ggtggtcatc aactgtgcca tcgtccgggg
tgtcaagtat aaccaggcca 480cccccaactt ccatcagtgg cgcgacgctc
gccaggtctg gggcctcaac ttcggcagca 540aggaggatgc ggcccagttt
gccgccggca tggccagtgc cctagaggcg ttggaaggag 600gtgggccccc
tccaccccca gcacttccca cctggtcggt cccgaacggc ccctccccgg
660aggaggtgga gcagcagaaa aggcagcagc ccggcccgtc ggagcacata
gagcgccggg 720tctccaatgc aggaggccca cctgctcccc ccgctggggg
tccaccccca ccaccaggac 780ctccccctcc tccaggtccc cccccacccc
caggtttgcc cccttcgggg gtcccagctg 840cagcgcacgg agcaggggga
ggaccacccc ctgcaccccc tctcccggca gcacagggcc 900ctggtggtgg
gggagctggg gccccaggcc tggccgcagc tattgctgga gccaaactca
960ggaaagtcag caagcaggag gaggcctcag gggggcccac agcccccaaa
gctgagagtg 1020gtcgaagcgg aggtggggga ctcatggaag agatgaacgc
catgctggcc cggagaagga 1080aagccacgca agttggggag aaaaccccca
aggatgaatc tgccaatcag gaggagccag 1140aggccagagt cccggcccag
agtgaatctg tgcggagacc ctgggagaag aacagcacaa 1200ccttgccaag
gatgaagtcg tcttcttcgg tgaccacttc cgagacccaa ccctgcacgc
1260ccagctccag tgattactcg gacctacaga gggtgaaaca ggagcttctg
gaagaggtga 1320agaaggaatt gcagaaagtg aaagaggaaa tcattgaagc
cttcgtccag gagctgagga 1380agcggggttc tccctgacca cagggaccca
gaagacccgc ttctcctttc cgcacacccg 1440gcctgtcacc ctgctttccc
tgcctctact tgacttggaa ttggctgaag acacaggaat 1500gcatcgttcc
cactccccat cccacttgga aaactccaag ggggtgtggc ttccctgctc
1560acacccacac tggctgctga ttggctgggg aggcccccgc ccttttctcc
ctttggtcct 1620tcccctctgc catccccttg gggccggtcc ctctgctggg
gatgcaccaa tgaaccccac 1680aggaaggggg aaggaaggag ggaatttcac
attcccttgt tctagattca ctttaacgct 1740taatgccttc aaagttttgg
tttttttaag aaaaaaaaat atatatatat ttgggttttg 1800ggggaaaagg
gaaatttttt tttctctttg gttttgataa aatgggatgt gggagttttt
1860aaatgctata gccctgggct tgccccattt ggggcagcta tttaagggga
ggggatgtct 1920caccgggctg ggggtgagat atccccccac cccagggact
ccccttccct ctggctcctt 1980ccccttttct atgaggaaat aagatgctgt
aactttttgg aacctcagtt ttttgatttt 2040ttatttgggt aggttttggg
gtccaggcca ttttttttac cccttggagg aaataagatg 2100agggagaaag
gagaagggga ggaaacttct cccctcccac cttcaccttt agcttcttga
2160aaatgggccc ctgcagaata aatctgccag tttttataaa aaaaaaa
220717380PRTHomo sapiens 17Met Ser Glu Thr Val Ile Cys Ser Ser Arg
Ala Thr Val Met Leu Tyr 1 5 10 15Asp Asp Gly Asn Lys Arg Trp Leu
Pro Ala Gly Thr Gly Pro Gln Ala 20 25 30Phe Ser Arg Val Gln Ile Tyr
His Asn Pro Thr Ala Asn Ser Phe Arg 35 40 45Val Val Gly Arg Lys Met
Gln Pro Asp Gln Gln Val Val Ile Asn Cys 50 55 60Ala Ile Val Arg Gly
Val Lys Tyr Asn Gln Ala Thr Pro Asn Phe His65 70 75 80Gln Trp Arg
Asp Ala Arg Gln Val Trp Gly Leu Asn Phe Gly Ser Lys 85 90 95Glu Asp
Ala Ala Gln Phe Ala Ala Gly Met Ala Ser Ala Leu Glu Ala 100 105
110Leu Glu Gly Gly Gly Pro Pro Pro Pro Pro Ala Leu Pro Thr Trp Ser
115 120 125Val Pro Asn Gly Pro Ser Pro Glu Glu Val Glu Gln Gln Lys
Arg Gln 130 135 140Gln Pro Gly Pro Ser Glu His Ile Glu Arg Arg Val
Ser Asn Ala Gly145 150 155 160Gly Pro Pro Ala Pro Pro Ala Gly Gly
Pro Pro Pro Pro Pro Gly Pro 165 170 175Pro Pro Pro Pro Gly Pro Pro
Pro Pro Pro Gly Leu Pro Pro Ser Gly 180 185 190Val Pro Ala Ala Ala
His Gly Ala Gly Gly Gly Pro Pro Pro Ala Pro 195 200 205Pro Leu Pro
Ala Ala Gln Gly Pro Gly Gly Gly Gly Ala Gly Ala Pro 210 215 220Gly
Leu Ala Ala Ala Ile Ala Gly Ala Lys Leu Arg Lys Val Ser Lys225 230
235 240Gln Glu Glu Ala Ser Gly Gly Pro Thr Ala Pro Lys Ala Glu Ser
Gly 245 250 255Arg Ser Gly Gly Gly Gly Leu Met Glu Glu Met Asn Ala
Met Leu Ala 260 265 270Arg Arg Arg Lys Ala Thr Gln Val Gly Glu Lys
Thr Pro Lys Asp Glu 275 280 285Ser Ala Asn Gln Glu Glu Pro Glu Ala
Arg Val Pro Ala Gln Ser Glu 290 295 300Ser Val Arg Arg Pro Trp Glu
Lys Asn Ser Thr Thr Leu Pro Arg Met305 310 315 320Lys Ser Ser Ser
Ser Val Thr Thr Ser Glu Thr Gln Pro Cys Thr Pro 325 330 335Ser Ser
Ser Asp Tyr Ser Asp Leu Gln Arg Val Lys Gln Glu Leu Leu 340 345
350Glu Glu Val Lys Lys Glu Leu Gln Lys Val Lys Glu Glu Ile Ile Glu
355 360 365Ala Phe Val Gln Glu Leu Arg Lys Arg Gly Ser Pro 370 375
380
* * * * *