U.S. patent application number 11/580632 was filed with the patent office on 2007-10-18 for helicobacter pylori proteins useful for vaccines and diagnostics.
Invention is credited to Massimo Bugnoli, Antonello Covacci, Giovanni Macchia, Rino Rappuoli, John Telford.
Application Number | 20070243204 11/580632 |
Document ID | / |
Family ID | 35460801 |
Filed Date | 2007-10-18 |
United States Patent
Application |
20070243204 |
Kind Code |
A1 |
Covacci; Antonello ; et
al. |
October 18, 2007 |
Helicobacter pylori proteins useful for vaccines and
diagnostics
Abstract
This invention provides polypeptides of Helicobacter Pylori
cytotoxin associated immunodominant (CAI) antigen. The invention
also provides prophylactic and therapeutic vaccines comprising
polypeptides of Helicobacter pylori CAI antigen, and methods for
preparation. The invention also provides methods of treatment of
Helicobacter pylori infection using these vaccines.
Inventors: |
Covacci; Antonello; (Siena,
IT) ; Bugnoli; Massimo; (Monteriggioni, IT) ;
Telford; John; (Monteriggioni, IT) ; Rappuoli;
Rino; (Sienna, IT) ; Macchia; Giovanni;
(Voorburg, NL) |
Correspondence
Address: |
WOODCOCK WASHBURN LLP
CIRA CENTRE, 12TH FLOOR
2929 ARCH STREET
PHILADELPHIA
PA
19104-2891
US
|
Family ID: |
35460801 |
Appl. No.: |
11/580632 |
Filed: |
October 12, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09360685 |
Jul 26, 1999 |
7141244 |
|
|
11580632 |
Oct 12, 2006 |
|
|
|
08471491 |
Jun 6, 1995 |
6090611 |
|
|
09360685 |
Jul 26, 1999 |
|
|
|
08256848 |
Oct 21, 1994 |
|
|
|
PCT/EP93/00472 |
Mar 2, 1993 |
|
|
|
08471491 |
Jun 6, 1995 |
|
|
|
Current U.S.
Class: |
424/190.1 ;
435/7.1; 530/350; 536/22.1 |
Current CPC
Class: |
A61K 39/105 20130101;
A61K 39/00 20130101; C07K 14/205 20130101; C07K 14/195 20130101;
Y10S 530/825 20130101 |
Class at
Publication: |
424/190.1 ;
435/007.1; 530/350; 536/022.1 |
International
Class: |
A61K 39/02 20060101
A61K039/02; C07H 21/00 20060101 C07H021/00; C07K 1/00 20060101
C07K001/00; G01N 33/53 20060101 G01N033/53 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 2, 1992 |
IT |
FI 92 A 000052 |
Claims
1. An isolated polypeptide selected from the group consisting of:
(a) a Helicobacter pylori cytotoxin associated immunodominant
antigen having the amino acid sequence shown in SEQ ID NO:5
modified by one or more conservative amino acid substitutions; (b)
a Helicobacter pylori cytotoxin associated immunodominant antigen
comprising the amino acid sequence SEQ ID NO:25; (c) a polypeptide
that is immunologically identifiable by an antibody which reacts
specifically with the Helicobacter pylori cytotoxin associated
immunodominant antigen having the amino acid sequence of SEQ ID
NO:5; (d) a Helicobacter pylori cytotoxin associated immunodominant
antigen comprising two repeats of the amino acid sequence of SEQ ID
NO:12; (e) a protein comprising a fragment of the amino acid
sequence of SEQ ID NO:5, wherein said fragment comprises at least
11 amino acids of SEQ ID NO:5; (f) the protein of (a), (b), (c),
(d) or (e), comprising amino acid sequence SEQ ID NO:9; (g) the
protein of (a), (b), (c), (d) or (e), comprising amino acid
sequence SEQ ID NO 10; and (h) the protein of (a), (b), (c), (d) or
(e), comprising amino acid sequence SEQ ID NO:23.
2. The polypeptide of claim 1, which is conjugated to a detectable
label
3. The polypeptide of claim 1, which is coupled to a solid
support.
4. An immunogenic composition comprising the polypeptide of claim 1
and a pharmaceutically acceptable carrier.
5. The immunogenic composition of claim 4, wherein said carrier is
an adjuvant.
6. The immunogenic composition of claim 4 wherein said polypeptide
comprises the amino acid sequence of SEQ ID NO:5.
7. The immunogenic composition of claim 4 wherein said polypeptide
comprises the amino acid sequence of SEQ ID NO:25.
8. The immunogenic composition of claim 4 wherein said polypeptide
comprises the amino acid sequence of SEQ ID NO:12.
9. The immunogenic composition of claim 4 wherein said polypeptide
comprises at least 11 consecutive amino acids of SEQ ID NO:5 and
wherein said polypeptide comprises at least one amino acid sequence
selected from the group consisting of SEQ ID NO:9, SEQ ID NO:10 and
SEQ ID NO:23.
10. The immunogenic composition of claim 4 further comprising at
least one of: (i) a Helicobacter pylori cytotoxic protein or
precursor thereof; (ii) a recombinant Helicobacter pylori heat
shock protein; (iii) a Helicobacter pylori urease.
11. A therapeutic composition comprising the polypeptide of claim 1
and a pharmaceutically acceptable carrier.
12. The therapeutic composition of claim 11 wherein said
polypeptide comprises the amino acid sequence of SEQ ID NO:5.
13. The therapeutic composition of claim 11 wherein said
polypeptide comprises the amino acid sequence of SEQ ID NO:25.
14. The therapeutic composition of claim 11 wherein said
polypeptide comprises the amino acid sequence of SEQ ID NO:12.
16. The therapeutic composition of claim 11 wherein said
polypeptide comprises at least 11 consecutive amino acids of SEQ ID
NO:5 and wherein said polypeptide comprises at least one amino acid
sequence selected from the group consisting of SEQ ID NO:9, SEQ ID
NO:10 and SEQ ID NO:23.
17. The therapeutic composition of claim 11 further comprising at
least one of: (i) a Helicobacter pylori cytotoxic protein or
precursor thereof; (ii) a recombinant Helicobacter pylori heat
shock protein; (iii) a Helicobacter pylori urease.
18. A method for the preparation of an immunogenic composition
according to claim 4 comprising bringing one or more of said
polypeptides into association with a pharmaceutically acceptable
carrier and, optionally, an adjuvant.
19. A method for the preparation of a therapeutic composition
according to claim 11 comprising bringing one or more of said
polypeptides into association with a pharmaceutically acceptable
carrier and, optionally, an adjuvant.
20. A method for treating Helicobacter pylori infection comprising
administering to a subject having a Helicobacter pylori infection a
therapeutic amount of the composition of claim 11.
21. The method of claim 20 wherein said composition comprises a
polypeptide comprising the amino acid sequence of SEQ ID NO:5.
22. The method of claim 20 wherein said composition comprises a
polypeptide comprising the amino acid sequence of SEQ ID NO:25.
23. The method of claim 20 wherein said composition comprises a
polypeptide comprising the amino acid sequence of SEQ ID NO:12.
24. The method of claim 20 wherein said composition comprises a
polypeptide comprising at least 11 consecutive amino acids of SEQ
ID NO:5 and wherein said polypeptide comprises at least one amino
acid sequence selected from the group consisting of SEQ ID NO:9,
SEQ ID NO:10 and SEQ ID NO:23.
25. The method of claim 20 wherein said composition further
comprising at least one of: (i) a Helicobacter pylori cytotoxic
protein or precursor thereof; (ii) a recombinant Helicobacter
pylori heat shock protein; (iii) a Helicobacter pylori urease.
26. A method of eliciting an immune response to a Helicobacter
pylori protein comprising administering to a subject an immunogenic
amount of a protein of claim 1.
27. The method of claim 26 wherein said protein comprises the amino
acid sequence of SEQ ID NO:5.
28. The method of claim 26 wherein said protein comprises the amino
acid sequence of SEQ ID NO:25.
29. The method of claim 26 wherein said protein comprises the amino
acid sequence of SEQ ID NO:12.
30. The method of claim 26 wherein said protein comprises at least
11 contiguous amino acids of SEQ ID NO:5 and comprising at least
one amino acid sequence selected from the group consisting of SEQ
ID NO:9, SEQ ID NO:10 and SEQ ID NO:23.
31. A method for diagnosing the presence of Helicobacter pylori in
a sample comprising contacting a sample with an antibody that
specifically binds to a protein of claim 1 and detecting the
binding of said antibody, wherein detection of specific binding of
said antibody indicates the presence of Helicobacter pylori in said
sample.
32. The method of claim 31 wherein said antibody specifically binds
a protein having an amino acid sequence of SEQ ID NO:5.
33. The method of claim 31 wherein said antibody specifically binds
a protein comprising the amino acid sequence of SEQ ID NO:25.
34. The method of claim 31 wherein said antibody specifically binds
a protein comprising the amino acid sequence of SEQ ID NO:12.
35. The method of claim 31 wherein said antibody specifically binds
a protein comprising at least 11 contiguous amino acids of SEQ ID
NO:5 and having the at least one amino acid sequence selected from
the group consisting of SEQ ID NO:9; SEQ ID NO:10; and SEQ ID
NO:23.
36. An in vitro immunodiagnostic assay comprising at least one step
involving as at least one binding partner a protein according to
claim 1.
37. The immunodiagnostic assay of claim 36 wherein said protein is
conjugated to a label or coupled to a solid support.
38. A kit for an immunodiagnostic assay, comprising at least one
protein according to claim 1.
39. A polynucleotide comprising a nucleotide sequence that encodes
a protein according to claim 1.
40. The polynucleotide of claim 39, comprising the nucleotide
sequence of SEQ ID NO:5, or a fragment thereof.
41. A polynucleotide probe comprising at least 8 contiguous
nucleotides of (a) the polynucleotide of claim 39 or claim 40, or
(b) the complement of (a).
42. The probe of claim 41, comprising at least 14 contiguous
nucleotides of (a) or (b).
43. A nucleic acid detection assay wherein at least one step
comprises contacting a sample with the probe of claim 39 or 40.
44. A polynucleotide amplification process for amplifying a
Helicobacter pylori protein-encoding nucleic acid comprising
contacting a sample with a plurality of polynucleotide primers
wherein at least one primer is a polynucleotide comprising at least
14 contiguous nucleotides of (a) the polynucleotide of claim 39 or
claim 40, or (b) the complement of (a).
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 09/360,685, filed Jul. 26, 1999 which is a divisional of U.S.
application Ser. No. 08/471,491, filed Jun. 6, 1995, now U.S. Pat.
No. 6,090,611, which is a divisional of U.S. application Ser. No.
08/256,848, filed Oct. 21, 1994, now abandoned, which is a U.S.
national phase application of PCT/EP93/00472, filed Mar. 2, 1993
and PCT/EP93/00158, filed Jan. 25, 1993, which two PCT applications
claimed priority benefit of Italian application Serial No. FI 92 A
000052, filed Mar. 2, 1992, the entire contents of each application
is incorporated by reference herein.
BACKGROUND OF THE INVENTION
1. Field of the Disclosure
[0002] The present invention relates generally to certain
Helicobacter pylori proteins, to the genes which express these
proteins, and to the use of these proteins for diagnostic and
vaccine applications.
[0003] Helicobacter pylori is a curved, microaerophilic, gram
negative bacterium that has been isolated for the first time in
1982 from stomach biopsies of patients with chronic gastritis,
Warren et al., Lancet i:1273-75 (1983). Originally named
Campylobacter pylori, it has been recognized to be part of a
separate genus named Helicobacter, Goodwin et al., Int. 3. Syst.
Bacteriol. 39:397-405 (1989). The bacterium colonizes the human
gastric mucosa, and infection can persist for decades. During the
last few years, the presence of the bacterium has been associated
with chronic gastritis type B, a condition that may remain
asymptomatic in most infected persons but increases considerably
the risk of peptic ulcer and gastric adenocarcinoma. The most
recent studies strongly suggest that H. pylori infection may be
either a cause or a cofactor of type B gastritis, peptic ulcers,
and gastric tumors, see e.g., Blaser, Gastroenterology 93:371-83
(1987); Dooley et al., New Engl. J. Med. 321:1562-66 (1989);
Parsonnet et al., New Engl. J. Med. 325:1127-31 (1991). H. pylori
is believed to be transmitted by the oral route, Thomas et al.,
Lancet i:340, 1194 (1992), and the risk of infection increases with
age, Graham et al., Gastroenterology 100: 1495-1501 (1991), and is
facilitated by crowding, Drumm et al., New Engl. J. Med.
4322:359-63 (1990); Blaser, Clin. Infect. Dis. 15:386-93 (1992). In
developed countries, the presence of antibodies against H. pylori
antigens increases from less than 20% to over 50% in people 30 and
60 years old respectively, Jones et al., Med. Microbio. 22:57-62
(1986); Morris at al., N.Z. Med. J. 99:657-59 (1986), while in
developing countries over 80% of the population are already
infected by the age of 20, Graham et al., Digestive Diseases and
Sciences 36:1084-88 (1991).
[0004] The nature and the role of the virulence factors of H.
pylori are still poorly understood. The factors that have been
identified so far include the flagella that are probably necessary
to move across the mucus layer, see e.g., Leying et al., Mol.
Microbiol. 6:2863-74 (1992); the urease that is necessary to
neutralize the acidic environment of the stomach and to allow
initial colonization, see e.g., Cussac et al., J. Bacteriol.
174:2466-73 (1992); Perez-Perez et al., J. Infect. Immun.
60:3658-3663 (1992); Austin et al., J. Bacteriol. 174:7470-73
(1992); PCT Publ. No. WO 90/04030; and a high molecular weight
cytotoxic protein formed by monomers allegedly having a molecular
weight of 87 kDa that causes formation of vacuoles in eukaryotic
epithelial cells and is produced by H. pylori strains associated
with disease, see e.g., Cover et al., J. Bio. Chem. 267:10570-75
(1992) (referencing a "vacuolating toxin" with a specified 23 amino
acid N-terminal sequence); Cover et al., J. Clin. Invest. 90:913-18
(1992); Leunk, Rev. Infect. Dis. 13:5686-89 (1991). Additionally,
the following is also known.
[0005] H. pylori culture supernatants have been shown by different
authors to contain an antigen with a molecular weight of 120, 128,
or 130 kDa, Apel at al., Aentralblat fur Bakteriol. Microb. und
Hygiene 268:271-76 (1988); Crabtree et al., J. Clin. Pathol
45:733-34 (1992); Cover et al., Infect. Immun. 58:603-10 (1990);
Figura et al., H. pylori, gastritis and peptic ulcer (ads.
Malfrtheiner et al.), Springer Verlag, Berlin (1990). Whether the
difference in size of the antigen described was due to
interlaboratory differences in estimating the molecular weight of
the same protein, to the size variability of the same antigen, or
to actual different proteins was not clear. No nucleotide or amino
acid sequence information was given about the protein. This protein
is very immunogenic in infected humans because specific antibodies
are detected in sera of virtually all patients infected with H.
pylori, Gerstenecker et al., Eur. J. Clin. Microbiol. 11:595-601
(1992).
[0006] H. pylori heat shock proteins (hsp) have been described,
Evans et al., Infect. Immun. 60:2125-27 (1992) (44 amino acid
N-terminal sequence and a molecular weight of about 62 kDa); Dunn
et al., Infect. Immun. 60:1946-51 (1992) (33 amino acids found in
the N-terminal sequence and a molecular weight of about 54 kDa);
Austin et al., J. Bacterial. 174:7470-73 (1992) (37 amino acids
found in the N-terminal sequence and a molecular weight of about 60
kDa). Austin et al. suggest that these are, in fact, the same
protein with identical amino acid sequences at their
N-terminus.
[0007] For examples of diagnostic tests based on H. pylori lysates
or semipurified antigens, see Evans et al., Gastroenterology
96:1004-08 (1989); U.S. Pat. No. 4,882,271; PCT Publ. No. WO
89/08843 (all relating to compositions and assays containing the
same having high molecular weight antigens (300-700 kDa) from the
outer membrane surface with urease activity); EPO Publ. No. 329 570
(relating to antigenic compositions for detecting H. pylori
antibodies having fragments of at least one fragment from the group
63, 57, 45, and 31 kDa).
[0008] The percentage of people infected by H. pylori, either in a
symptomatic or an asymptomatic form, is very high in both
developing and developed countries, and the cost of hospitalization
and therapy makes desirable the development of both H. pylori
vaccines and further diagnostic tests for this disease.
SUMMARY OF THE INVENTION
[0009] The present invention describes nucleotide and amino acid
sequences for three major H. pylori proteins. Specifically, these
are the cytotoxin, the "Cytotoxin Associated Immunodominant" (CAI)
antigen, and the heat shock protein. None of the complete amino
acid sequences for these proteins has been known, nor have their
genes been identified. The present invention pertains to not only
these purified proteins and their genes, but also recombinant
materials associated therewith, such as vectors and host cells. The
present invention provides cytotoxin polypeptides that exhibit
substantially no toxicity or substantially reduced toxicity. The
present invention also provides CAI and heat shock polypeptides
that exhibit no functional contribution to toxicity, or a
substantially reduced functional contribution to toxicity. The
understanding at the molecular level of the nature and the role of
these proteins and the availability of recombinant production has
important implications for the development of new diagnostics for
H. pylori and for the design of vaccines that may prevent H. pylori
infection and treat disease.
[0010] As such, these proteins can be used in both vaccine and
diagnostic applications. The present invention includes methods for
treating and diagnosing those diseases associated with H. pylori.
As H. pylori has been associated with type B gastritis, peptic
ulcers, and gastric adenocarcinoma, it is hoped that the present
invention will assist in early detection and alleviation of these
disease states. Currently, diagnosis relies mostly on endoscopy and
histological staining of biopsies; existing immunoassays are based
on H. pylori lysates or semipurified antigens. Given the
heterogeneity found in such assays, correlation with disease state
is not yet well established. Thus, the potential for recombinant
antigen-based immunoassays, as well as nucleic acid assays for
disease detection, is great. At present, there is no commercial
vaccine for H. pylori infection or treatment. A recombinant vaccine
is thus an object of the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] FIGS. 1A, 1B, and 1C (SEQ ID NO:2) comprise the nucleotide
sequence for the cytotoxin (CT) protein.
[0012] FIG. 2 (SEQ ID NO:3) is the amino acid sequence for the
cytotoxin (CT) protein.
[0013] FIG. 3 is a map of the cai gene for the CAI protein and
summary of the clones used to identify and sequence this gene. In
the middle of FIG. 3, upstream of the D3 box, two short peptide
sequences are shown: "NEPIYA" (SEQ ID NO:29) and "EEPIYA" (SEQ ID
NO:30). At the bottom of the FIG. 3, the nucleotide (SEQ ID NO: 11)
and deduced amino acid sequence (SEQ ID NO: 12) of the cloned
segment is shown with peptides D1 (SEQ ID NO: 14), D2 (SEQ ID NO:
16) and D3 (SEQ ID NO: 17) shown boxed.
[0014] FIGS. 4A through 4F (SEQ ID NO:4 and SEQ ID NO:5) comprise
the nucleotide and amino acid sequences of the CAI antigen. The
numbers along the left hand margins of FIGS. 4A, 4C and 4E
designate the amino acid positions, and the numbers along the
right-hand margins of FIGS. 4B, 4D, and 4F designate the nucleotide
positions. Shown boxed in FIG. 4C-D are two repeats of the peptide
EFKNGKNKDFSK (SEQ ID NO:9), which are encoded by the nucleic acid
sequence of SEQ ID NO: 19. Also shown boxed in FIG. 4C-D are two
repeats of the peptide EPIYA (SEQ ID NO: 10), the first of which is
encoded by the nucleic acid sequence of SEQ ID NO:20, the second of
which is encoded by the nucleic acid sequence of SEQ ID NO:21. Also
shown boxed in FIG. 4C-D is the peptide FPLKRHDKVDDLSKV (SEQ ID
NO:28), which is encoded by the nucleic acid sequence of SEQ ID
NO:22.
[0015] FIGS. 5A, 5B and 5C (SEQ ID NO:7 and SEQ ID NO:6) comprise
the nucleotide and amino acid sequences of the heat shock protein
(hsp).
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
A. General Methodology
[0016] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular biology,
microbiology, recombinant DNA, and immunology, which are within the
skill of the art. Such techniques are explained fully in the
literature. See e.g., Sambrook, et al., MOLECULAR CLONING; A
LABORATORY MANUAL, SECOND EDITION (1989); DNA CLONING, VOLUMES I
AND II (D. N Glover ed. 1985); OLIGONUCLEOTIDE SYNTHESIS (M. J.
Gait ed, 1984); NUCLEIC ACID HYBRIDIZATION (B. D. Hames & S. J.
Higgins eds. 1984); TRANSCRIPTION AND TRANSLATION (B. D. Hames
& S. J. Higgins eds. 1984); ANIMAL CELL CULTURE (R. I. Freshney
ed. 1986); IMMOBILIZED CELLS AND ENZYMES (IRL Press, 1986); B.
Perbal, A PRACTICAL GUIDE TO MOLECULAR CLONING (1984); the series,
METHODS IN ENZYMOLOGY (Academic Press, Inc.); GENE TRANSFER VECTORS
FOR MAMMALIAN CELLS (J. H. Miller and M. P. Calos eds. 1987, Cold
Spring Harbor Laboratory), Methods in Enzymology Vol. 154 and Vol.
155 (Wu and Grossman, and Wu, eds., respectively), Mayer and
Walker, eds. (1987), IMMUNOCHEMICAL METHODS IN CELL AND MOLECULAR
BIOLOGY (Academic Press, London), Scopes, (1987), PROTEIN
PURIFICATION: PRINCIPLES AND PRACTICE, Second Edition
(Springer-Verlag, N.Y.), and HANDBOOK OF EXPERIMENTAL IMMUNOLOGY,
VOLUMES I-IV (D. M. Weir and C. C. Blackwell eds 1986).
[0017] Standard abbreviations for nucleotides and amino acids are
used in this specification. All publications, patents, and patent
applications cited herein are incorporated by reference.
B. Definitions
[0018] "Cytotoxin" or "toxin" of H. pylori refers to the protein,
and fragments thereof, whose nucleotide sequence and amino acid
sequences are shown in FIGS. 1 and 2, respectively, and their
derivatives, and whose molecular weight is about 140 kDa. This
protein serves as a precursor to a protein having an approximate
weight of 100 kDa and having cytoxic activity. The cytotoxin causes
vacuolation and death of a number of eukaryotic cell types and has
been purified from H. pylori culture supernatants. Additionally,
the cytotoxin is proteinaceous and has an apparent molecular mass
determined by gel filtration of approximately 950-972 kDa.
Denaturing gel electrophoresis of purified material previously
revealed that the principal component of the 950-972 kDa molecule
was allegedly a polypeptide of apparent molecular mass of 87 kDa,
Cover et al., J. Biol. Chem. 267:10570-75 1992). It is suggested
herein, however, that The previously described 87 kDa results from
either the further processing of the 100 kDa protein or from
proteolytic degradation of a larger protein during
purification.
[0019] The "Cytotoxin Associated Immunodominant" (CAI) antigen
refers to that protein, and fragments thereof, whose amino acid
sequence is described in FIG. 4 and derivatives thereof. The CAI
antigen is about 130 kDa as determined by SDS/polyacrylamide gel
electrophoresis and comprises the following amino acid sequence
(SEQ ID NO:25): TABLE-US-00001 1
LysAsnGlyLysAsnLysAspPheSerLysValThrGlnAlaLysSerAspLeuGluAsn 20 21
SerValLysAspValIleIleAsnGlnLysValThrAspLysValAspAsnLeuAsnGln 40 41
AlaValSerValAlaLysAlaThrGlyAspPheSerArgValGluGlnAlaLeuAlaAsp 60 61
LeuLysAsnPheSerLysGluGlnLeuAlaGlnGlnAlaGlnLysAsnGluSerLeuAsn 80 81
AlaArgLysLysSerGluIleTyrGlnSerValLysAsnGlyValAsnGlyThrLeuVal 100
101 GlyAsnGlyLeuSerGlnAlaGluAlaThrThrLeuSerLysAsnPheSerAspIleLys
120 121
LysGluLeuAsnAlaLysLeuGlyAsnPheAsnAsnAsnAsnAsnAsnGlyLeuLysAsn 140
141 GluProIleTyrAlaLysValAsnLysLysLysAlaGlyGlnAlaAlaSerLeuGluGlu
160 161
ProIleTyrAlaGlnValAlaLysLysValAsnAlaLysIleAspArgLeuAsnGlnIle 180
181 AlaSerGlyLeuGlyValValGlyGlnAlaAlaGlyPheProLeuLysArgHisAspLys
200 201
ValAspAspLeuSerLysValGlyLeuSerArgAsnGlnGluLeuAlaGlnLysIleAsp 220
221 AsnLeuAsnGlnAlaValSerGlu 228
[0020] SEQ ID NO:25 is the protein encoded by the nucleotides 7 to
691 of the sequenced DNA having the following nucleotide sequence
of SEQ ID NO:27, wherein the uppercase letters represent the cloned
nucleotide sequence of SEQ ID NO:26 and the lowercase letters
represent the EcoRI site: TABLE-US-00002 1
gaattcAAAAATGGCAAAAATAAGGATTTCAGCAAGGTAACGCAAGCAAAAAGCGACCTT 60 61
GAAAATTCCGTTAAAGATGTGATCATCAATCAAAAGGTAACGGATAAAGTTGATAATCTC 120
121 AATCAAGCGGTATCAGTGGCTAAAGCAACGGGTGATTTCAGTAGGGTAGAGCAAGCGTTA
180 181
GCCGATCTCAAAAATTTCTCAAAGGAGCAATTGGCCCAACAAGCTCAAAAAAATGAAAGT 240
241 CTCAATGCTAGAAAAAAATCTGAAATATATCAATCCGTTAAGAATGGTGTGAATGGAACC
300 301
CTAGTCGGTAATGGGTTATCTCAAGCAGAAGCCACAACTCTTTCTAAAAACTTTTCGGAC 360
361 ATCAAGAAAGAGTTGAATGCAAAACTTGGAAATTTCAATAACAATAACAATAATGGACTC
420 421
AAAAACGAACCCATTTATGCTAAAGTTAATAAAAAGAAAGCAGGGCAAGCAGCTAGCCTT 480
481 GAAGAACCCATTTACGCTCAAGTTGCTAAAAAGGTAAATGCAAAAATTGACCGACTCAAT
540 541
CAAATAGCAAGTGGTTTGGGTGTTGTAGGGCAAGCAGCGGGCTTCCCTTTGAAAAGGCAT 600
601 GATAAAGTTGATGATCTCAGTAAGGTAGGGCTTTCAAGGAATCAAGAATTGGCTCAGAAA
660 661 ATTGACAATCTCAATCAAGCGGTATCAGAAGccgaattc 699
[0021] "Heat shock protein" (hsp) refers to the H. pylori protein,
and fragments thereof, whose amino acid sequence is given in FIG. 5
and derivatives thereof, and whose molecular weight is in the range
of 54-62 kDa, preferably about 58-60 kDa. This hsp belongs to the
group of Gram negative bacteria heat shock proteins, hsp60. In
general, hsp are among the most conserved proteins in all living
organisms, either prokaryotic and eukaroytic, animals and plants,
and the conservation is spread along the whole sequence. This high
conservation suggests a participation of the whole sequence at the
functional structure of the protein that can be hardly modified
without impairing its activity.
[0022] Examples of proteins that can be used in the present
invention include polypeptides with minor amino acid variations
from the natural amino acid sequence of the protein; in particular,
conservative amino acid replacements are contemplated. Conservative
replacements are those that take place within a family of amino
acids that are related in their side chains. Genetically encoded
amino acids are generally divided into four families: (1)
acidic=aspartate, glutamate; (2) basic=lysine, arginine, histidine;
(3) non-polar=alanine, valine, leucine, isoleucine, proline,
phenylalanine, methionine, tryptophan; and (4) uncharged
polar=glycine, asparagine, glutamine, cysteine, serine, threonine,
tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes
classified jointly as aromatic amino acids. For example, it is
reasonably predictable that an isolated replacement of a leucine
with an isoleucine or valine, an aspartate with a glutamate, a
threonine with a serine, or a similar conservative replacement of
an amino acid with a structurally related amino acid will not have
a major effect on the biological activity. Polypeptide molecules
having substantially the same amino acid sequence as the protein
but possessing minor amino acid substitutions that do not
substantially affect the functional aspects are within the
definition of the protein.
[0023] A significant advantage of producing the protein by
recombinant DNA techniques rather than by isolating and purifying a
protein from natural sources is that equivalent quantities of the
protein can be produced by using less starting material than would
be required for isolating the protein from a natural source.
Producing the protein by recombinant techniques also permits the
protein to be isolated in the absence of some molecules normally
present in cells. Indeed, protein compositions entirely free of any
trace of human protein contaminants can readily be produced because
the only human protein produced by the recombinant non-human host
is the recombinant protein at issue. Potential viral agents from
natural sources and viral components pathogenic to humans are also
avoided.
[0024] The term "recombinant polynucleotide" as used herein intends
a polynucleotide of genomic, cDNA, semisynthetic, or synthetic
origin which, by virtue of its origin or manipulation: (1) is not
associated with all or a portion of a polynucleotide with which it
is associated in nature, (2) is linked to a polynucleotide other
than that to which it is linked in nature, or (3) does not occur in
nature. Thus, This term also encompasses the situation wherein the
H. pylori bacterium genome is genetically modified (e.g., through
mutagenesis) to produce one or more altered polypeptides.
[0025] The term "polynucleotide" as used herein refers to a
polymeric form of a nucleotide of any length, preferably
deoxyribonucleotides, and is used interchangeably herein with the
terms "oligonucleotide" and "oligomer." The term refers only to the
primary structure of the molecule. Thus, this term includes double-
and single-stranded DNA, as well as antisense polynucleotides. It
also includes known types of modifications, for example, the
presence of labels which are known in the art, methylation, end
"caps," substitution of one or more of the naturally occurring
nucleotides with an analog, internucleotide modifications such as,
for example, replacement with certain types of uncharged linkages
(e.g., methyl phosphonates, phosphotriesters, phosphoamidates,
carbamates, etc.) or charged linkages (e.g., phosphorothioates,
phosphorodithioates, etc.), introduction of pendant moieties, such
as, for example, proteins (including nucleases, toxins, antibodies,
signal peptides, poly-L-lysine, etc.), intercalators (e.g.,
acridine, psoralen, etc.), chelators (e.g., metals, radioactive
species, boron, oxidative moieties, etc.), alkylators (e.g., alpha
anomeric nucleic acids, etc.).
[0026] By "genomic" is meant a collection or library of DNA
molecules which are derived from restriction fragments that have
been cloned in vectors. This may include all or part of the genetic
material of an organism.
[0027] By "cDNA" is meant a complimentary mRNA sequence that
hybridizes to a complimentary strand of mRNA.
[0028] As used herein, the term "oligomer" refers to both primers
and probes and is used interchangeably herein with the term
"polynucleotide." The term oligomer does not connote the size of
the molecule. However, typically oligomers are no greater than 1000
nucleotides, more typically are no greater than 500 nucleotides,
even more typically are no greater than 250 nucleotides; they may
be no greater than 100 nucleotides, and may be no greater than 75
nucleotides, and also may be no greater than 50 nucleotides in
length.
[0029] The term "primer" as used herein refers to an oligomer which
is capable of acting as a point of initiation of synthesis of a
polynucleotide strand when used under appropriate conditions. The
primer will be completely or substantially complementary to a
region of the polynucleotide strand to be copied. Thus, under
conditions conducive to hybridization, the primer will anneal to
the complementary region of the analyte strand. Upon addition of
suitable reactants, (e.g., a polymerase, nucleotide triphosphates,
and the like), the primer will be extended by the polymerizing
agent to form a copy of the analyte strand. The primer may be
single-stranded or alternatively may be partially or fully
double-stranded.
[0030] The terms "analyte polynucleotide" and "analyte strand"
refer to a single- or double-stranded nucleic acid molecule which
is suspected of containing a target sequence, and which may be
present in a biological sample.
[0031] As used herein, the term "probe" refers to a structure
comprised of a polynucleotide which forms a hybrid structure with a
target sequence, due to complementarily of at least one sequence in
the probe with a sequence in the target region. The polynucleotide
regions of probes may be composed of DNA, and/or RNA, and/or
synthetic nucleotide analogs. Included within probes are "capture
probes" and "label probes".
[0032] As used herein, the term "target region" refers to a region
of the nucleic acid which is to be amplified and/or detected. The
term "target sequence" refers to a sequence with which a probe or
primer will form a stable hybrid under desired conditions.
[0033] The term "capture probe" as used herein refers to a
polynucleotide probe comprised of a single-stranded polynucleotide
coupled to a binding partner. The single-stranded polynucleotide is
comprised of a targeting polynucleotide sequence, which is
complementary to a target sequence in a target region to be
detected in the analyte polynucleotide. This complementary region
is of sufficient length and complementarily to the target sequence
to afford a duplex of stability which is sufficient to immobilize
the analyte polynucleotide to a solid surface (via the binding
partners). The binding partner is specific for a second binding
partner; the second binding partner can be bound to the surface of
a solid support, or may be linked indirectly via other structures
or binding partners to a solid support.
[0034] The term "targeting polynucleotide sequence" as used herein
refers to a polynucleotide sequence which is comprised of
nucleotides which are complementary to a target nucleotide
sequence; the sequence is of sufficient length and complementarily
with the target sequence to form a duplex which has sufficient
stability for the purpose intended.
[0035] The term "binding partner" as used herein refers to a
molecule capable of binding a ligand molecule with high
specificity, as for example an antigen and an antibody specific
therefor. In general, the specific binding partners must bind with
sufficient affinity to immobilize the analyte copy/complementary
strand duplex (in the case of capture probes) under the isolation
conditions. Specific binding partners are known in the art, and
include, for example, biotin and avidin or streptavidin, IgG and
protein A, the numerous known receptor-ligand couples, and
complementary polynucleotide strands. In the case of complementary
polynucleotide binding partners, the partners are normally at least
about 15 bases in length, and may be at least 40 bases in length;
in addition, they have a content of Gs and Cs of at least about 40%
and as much as about 60%. The polynucleotides may be composed of
DNA, RNA, or synthetic nucleotide analogs.
[0036] The term "coupled" as used herein refers to attachment by
covalent bonds or by strong non-covalent interactions (e.g.,
hydrophobic interactions, hydrogen bonds, etc.). Covalent bonds may
be, for example, ester, ether, phosphoester, amide, peptide, imide,
carbon-sulfur bonds, carbon-phosphorus bonds, and the like.
[0037] The term "support" refers to any solid or semi-solid surface
to which a desired binding partner may be anchored. Suitable
supports include glass, plastic, metal, polymer gels, and the like,
and may take the form of beads, wells, dipsticks, membranes, and
the like.
[0038] The term "label" as used herein refers to any atom or moiety
which can be used to provide a detectable (preferably quantifiable)
signal, and which can be attached to a polynucleotide or
polypeptide.
[0039] As used herein, the term "label probe" refers to a
polynucleotide probe which is comprised of a targeting
polynucleotide sequence which is complementary to a target sequence
to be detected in the analyte polynucleotide. This complementary
region is of sufficient length and complementarily to the target
sequence to afford a duplex comprised of the "label probe" and the
"target sequence" to be detected by the label. The label probe is
coupled to a label either directly, or indirectly via a set of
ligand molecules with high specificity for each other, including
multimers.
[0040] The term "multimer," as used herein, refers to linear or
branched polymers of the same repeating single-stranded
polynucleotide unit or different single-stranded polynucleotide
units. At least one of the units has a sequence, length, and
composition that permits it to hybridize specifically to a first
single-stranded nucleotide sequence of interest, typically an
analyte or a polynucleotide probe (e.g., a label probe) bound to an
analyte. In order to achieve such specificity and stability, this
unit will normally be at least about 15 nucleotides in length,
typically no more than about 50 nucleotides in length, and
preferably about 30 nucleotides in length; moreover, the content of
Gs and Cs will normally be at least about 40%, and at most about
60%. In addition to such unit(s), the multimer includes a
multiplicity of units that are capable of hybridizing specifically
and stably to a second single-stranded nucleotide of interest,
typically a labeled polynucleotide or another multimer. These units
are generally about the same size and composition as the multimers
discussed above. When a multimer is designed to be hybridized to
another multimer, the first and second oligonucleotide units are
heterogeneous (different), and do not hybridize with each other
under the conditions of the selected assay. Thus multimers may be
label probes, or may be ligands which couple the label to the
probe.
[0041] A "replicon" is any genetic element, e.g., a plasmid, a
chromosome, a virus, a cosmid, etc. that behaves as an autonomous
unit of polynucleotide replication within a cell; i.e., capable of
replication under its own control. This may include selectable
markers.
[0042] "PCR" refers to the technique of polymerase chain reaction
as described in Saiki, et al., Nature 324:163 (1986); and Scharf et
al., Science (1986) 233:1076-1078; and U.S. Pat. No. 4,683,195; and
U.S. Pat. No. 4,683,202.
[0043] As used herein, x is "heterologous" with respect to y if x
is not naturally associated with y in the identical manner; i.e., x
is not associated with y in nature or x is not associated with y in
the same manner as is found in nature.
[0044] "Homology" refers to the degree of similarity between x and
y. The correspondence between the sequence from one form to another
can be determined by techniques known in the art. For example, they
can be determined by a direct comparison of the sequence
information of the polynucleotide. Alternatively, homology can be
determined by hybridization of the polynucleotides under conditions
which form stable duplexes between homologous regions (for example,
those which would be used prior to S1 digestion), followed by
digestion with single-stranded specific nuclease(s), followed by
size determination of the digested fragments.
[0045] A "vector" is a replicon in which another polynucleotide
segment is attached, so as to bring about the replication and/or
expression of the attached segment.
[0046] "Control sequence" refers to polynucleotide sequences which
are necessary to effect the expression of coding sequences to which
they are ligated. The nature of such control sequences differs
depending upon the host organism; in prokaryotes, such control
sequences generally include promoter, ribosomal binding site, and
transcription termination sequence; in eukaryotes, generally, such
control sequences include promoters and transcription termination
sequence. The term "control sequences" is intended to include, at a
minimum, all components whose presence is necessary for expression,
and may also include additional components whose presence is
advantageous, for example, leader sequences and fusion partner
sequences.
[0047] "Operably linked" refers to a juxtaposition wherein the
components so described are in a relationship permitting them to
function in their intended manner. A control sequence "operably
linked" to a coding sequence is ligated in such a way that
expression of the coding sequence is achieved under conditions
compatible with the control sequences.
[0048] An "open reading frame" (ORF) is a region of a
polynucleotide sequence which encodes a polypeptide; this region
may represent a portion of a coding sequence or a total coding
sequence.
[0049] A "coding sequence" is a polynucleotide sequence which is
translated into a polypeptide, usually via mRNA, when placed under
the control of appropriate regulatory sequences. The boundaries of
the coding sequence are determined by a translation start codon at
the 5'-terminus and a translation stop codon at the 3'-terminus. A
coding sequence can include, but is not limited to, cDNA, and
recombinant polynucleotide sequences.
[0050] As used herein, the term "polypeptide" refers to a polymer
of amino acids and does not refer to a specific length of the
product; thus, peptides, oligopeptides, and proteins are included
within the definition of polypeptide. This term also does not refer
to or exclude post expression modifications of the polypeptide, for
example, glycosylations, acetylations, phosphorylations and the
like. Included within the definition are, for example, polypeptides
containing one or more analogs of an amino acid (including, for
example, unnatural amino acids, etc.), polypeptides with
substituted linkages, as well as other modifications known in the
art, both naturally occurring and non-naturally occurring.
[0051] A polypeptide or amino acid sequence "derived from" a
designated nucleic acid sequence refers to a polypeptide having an
amino acid sequence identical to that of a polypeptide encoded in
the sequence, or a portion thereof wherein the portion consists of
at least 3-5 amino acids, and more preferably at least 8-10 amino
acids, and even more preferably at least 11-15 amino acids, or
which is immunologically identifiable with a polypeptide encoded in
the sequence. This terminology also includes a polypeptide
expressed from a designated nucleic acid sequence.
[0052] "Immunogenic" refers to the ability of a polypeptide to
cause a humoral and/or cellular immune response, whether alone or
when linked to a carrier, in the presence or absence of an
adjuvant. "Neutralization" refers to an immune response that blocks
the infectivity, either partially or fully, of an infectious
agent.
[0053] "Epitope" refers to an antigenic determinant of a peptide,
polypeptide, or protein; an epitope can comprise 3 or more amino
acids in a spatial conformation unique to the epitope. Generally,
an epitope consists of at least 5 such amino acids and, more
usually, consists of at least 8-10 such amino acids. Methods of
determining spatial conformation of amino acids are known in the
art and include, for example, x-ray crystallography and
2-dimensional nuclear magnetic resonance. Antibodies that recognize
the same epitope can be identified in a simple immunoassay showing
the ability of one antibody to block the binding of another
antibody to a target antigen.
[0054] "Treatment," as used herein, refers to prophylaxis and/or
therapy (i.e., the modulation of any disease symptoms). An
"individual" indicates an animal that is susceptible to infection
by H. pylori and includes, but is not limited to, primates,
including humans. A "vaccine" is an immunogenic, or otherwise
capable of eliciting protection against H. pylori, whether partial
or complete, composition useful for treatment of an individual.
[0055] The H. pylori proteins may be used for producing antibodies,
either monoclonal or polyclonal, specific to the proteins. The
methods for producing these antibodies are known in the art.
[0056] "Recombinant host cells", "host cells," "cells," "cell
cultures," and other such terms denote, for example,
microorganisms, insect cells, and mammalian cells, that can be, or
have been, used as recipients for recombinant vector or other
transfer DNA, and include the progeny of the original cell which
has been transformed. It is understood that the progeny of a single
parental cell may not necessarily be completely identical in
morphology or in genomic or total DNA complement as the original
parent, due to natural, accidental, or deliberate mutation.
Examples for mammalian host cells include Chinese hamster ovary
(CHO) and monkey kidney (COS) cells.
[0057] Specifically, as used herein, "cell line," refers to a
population of cells capable of continuous or prolonged growth and
division in vitro. Often, cell lines are clonal populations derived
from a single progenitor cell. It is further known in the art that
spontaneous or induced changes can occur in karyotype during
storage or transfer of such clonal populations. Therefore, cells
derived from the cell line referred to may not be precisely
identical to the ancestral cells or cultures, and the cell line
referred to includes such variants. The term "cell lines" also
includes immortalized cells. Preferably, cell lines include
nonhybrid cell lines or hybridomas to only two cell types.
[0058] As used herein, the term "microorganism" includes
prokaryotic and eukaryotic microbial species such as bacteria and
fungi, the latter including yeast and filamentous fungi.
[0059] "Transformation", as used herein, refers to the insertion of
an exogenous polynucleotide into a host cell, irrespective of the
method used for the insertion, for example, direct uptake,
transduction, f-mating or electroporation. The exogenous
polynucleotide may be maintained as a non-integrated vector, for
example, a plasmid, or alternatively, may be integrated into the
host genome.
[0060] By "purified" and "isolated" is meant, when referring to a
polypeptide or nucleotide sequence, that the indicated molecule is
present in the substantial absence of other biological
macromolecules of the same type. The term "purified" as used herein
preferably means at least 75% by weight, more preferably at least
85% by weight, more preferably still at least 95% by weight, and
most preferably at least 98% by weight, of biological
macromolecules of the same type present (but water, buffers, and
other small molecules, especially molecules having a molecular
weight of less than 1000, can be present).
C. Nucleic Acid Assays
[0061] Using as a basis the genome of H. pylori, polynucleotide
probes of approximately 8 nucleotides or more can be prepared which
hybridize with the positive strand(s) of the RNA or its complement,
as well as to cDNAs. These polynucleotides serve as probes for the
detection, isolation and/or labeling of polynucleotides which
contain nucleotide sequences, and/or as primers for the
transcription and/or replication of the targeted sequences. Each
probe contains a targeting polynucleotide sequence, which is
comprised of nucleotides which are complementary to a target
nucleotide sequence; the sequence is of sufficient length and
complementarily with the sequence to form a duplex which has
sufficient stability for the purpose intended. For example, if the
purpose is the isolation, via immobilization, of an analyte
containing a target sequence, the probes will contain a
polynucleotide region which is of sufficient length and
complementarily to the targeted sequence to afford sufficient
duplex stability to immobilize the analyte on a solid surface under
the isolation conditions. For example, also, if the polynucleotide
probes are to serve as primers for the transcription and/or
replication of target sequences, the probes will contain a
polynucleotide region of sufficient length and complementarily to
the targeted sequence to allow for replication. For example, also,
if the polynucleotide probes are to be used as label probes, or are
to bind to multimers, the targeting polynucleotide region would be
of sufficient length and complementarily to form stable hybrid
duplex structures with the label probes and/or multimers to allow
detection of the duplex. The probes may contain a minimum of about
4 contiguous nucleotides which are complementary to the targeted
sequence; usually the oligomers will contain a minimum of about 8
continuous nucleotides which are complementary to the targeted
sequence, and preferably will contain a minimum of about 14
contiguous nucleotides which are complementary to the targeted
sequence.
[0062] The probes, however, need not consist only of the sequence
which is complementary to the targeted sequence. They may contain
additional nucleotide sequences or other moieties. For example, if
the probes are to be used as primers for the amplification of
sequences via PCR, they may contain sequences which, when in
duplex, form restriction enzyme sites which facilitate the cloning
of the amplified sequences. For example, also, if the probes are to
be used as "capture probes" in hybridization assays, they will be
coupled to a "binding partner" as defined above. Preparation of the
probes is by means known in the art, including, for example, by
methods which include excision, transcription or chemical
synthesis.
D. Expression Systems
[0063] Once the appropriate H. pylori coding sequence is isolated,
it can be expressed in a variety of different expression systems;
for example those used with mammalian cells, baculoviruses,
bacteria, and yeast.
[0064] i. Mammalian Systems
[0065] Mammalian expression systems are known in the art. A
mammalian promoter is any DNA sequence capable of binding mammalian
RNA polymerase and initiating the downstream (3') transcription of
a coding sequence (e.g. structural gene) into mRNA. A promoter will
have a transcription initiating region, which is usually placed
proximal to the 5' end of the coding sequence, and a TATA box,
usually located 25-30 base pairs (bp) upstream of the transcription
initiation site. The TATA box is thought to direct RNA polymerase
II to begin RNA synthesis at the correct site. A mammalian promoter
will also contain an upstream promoter element, usually located
within 100 to 200 bp upstream of the TATA box. An upstream promoter
element determines the rate at which transcription is initiated and
can act in either orientation, Sambrook et al., Molecular Cloning:
A Laboratory Manual. 2nd ed (1989).
[0066] Mammalian viral genes are often highly expressed and have a
broad host range; therefore sequences encoding mammalian viral
genes provide particularly useful promoter sequences. Examples
include the SV40 early promoter, mouse mammary tumor virus LTR
promoter, adenovirus major late promoter (Ad MLP), and herpes
simplex virus promoter. In addition, sequences derived from
non-viral genes, such as the murine metallothionein gene, also
provide useful promoter sequences. Expression may be either
constitutive or regulated (inducible), depending on the promoter
can be induced with glucocorticoid in hormone-responsive cells.
[0067] The presence of an enhancer element (enhancer), combined
with the promoter elements described above, will usually increase
expression levels. An enhancer is a regulatory DNA sequence that
can stimulate transcription up to 1000-fold when linked to
homologous or heterologous promoters, with synthesis beginning at
the normal RNA start site. Enhancers are also active when they are
placed upstream or downstream from the transcription initiation
site, in either normal or flipped orientation, or at a distance of
more than 1000 nucleotides from the promoter, Maniatis et al.,
Science 236:1237 (1989); Alberts et al. Molecular Biology of the
Cell, 2nd ed (1989). Enhancer elements derived from viruses may be
particularly useful, because they usually have a broader host
range. Examples include the SV40 early gene enhancer, Dijkema et al
(1985) EMBO J. 4:761, and the enhancer/promoters derived from the
long terminal repeat (LTR) of the Rous Sarcoma Virus, Gorman et al.
(1982) Proc. Natl. Acad. Sci. 79:6777, and from human
cytomegalovirus, Boshart et al. (1985) Cell 41:5221. Additionally,
some enhancers are regulatable and become active only in the
presence of an inducer, such as a hormone or metal ion,
Sassone-Corsi et al. (1986) Trends Genet. 2:215; Maniatis et al.
(1987) Science 236:1237.
[0068] A DNA molecule may be expressed intracellularly in mammalian
cells. A promoter sequence may be directly linked with the DNA
molecule, in which case the first amino acid at the N-terminus of
the recombinant protein will always be a methionine, which is
encoded by the ATG start codon. If desired, the N-terminus may be
cleaved from the protein by in vitro incubation with cyanogen
bromide.
[0069] Alternatively, foreign proteins can also be secreted from
the cell into the growth media by creating chimeric DNA molecules
that encode a fusion protein comprised of a leader sequence
fragment that provides for secretion of the foreign protein in
mammalian cells. Preferably, there are processing sites encoded
between the leader fragment and the foreign gene that can be
cleaved either in vivo or in vitro. The leader sequence fragment
usually encodes a signal peptide comprised of hydrophobic amino
acids which direct the secretion of the protein from the cell. The
adenovirus tripartite leader is an example of a leader sequence
that provides for secretion of a foreign protein in mammalian
cells.
[0070] Usually, transcription termination and polyadenylation
sequences recognized by mammalian cells are regulatory regions
located 3' to the translation stop codon and thus, together with
the promoter elements, flank the coding sequence. The 3' terminus
of the mature mRNA is formed by site-specific post-transcriptional
cleavage and polyadenylation, Birnstiel et al. (1985) Cell 41:349;
Proudfoot and Whitelaw (1988) "Termination and 3' end processing of
eukaryotic RNA. In Transcription and splicing (ed. B. D. Hames and
D. M. Glover); Proudfoot (1989) Trends Biochem. Sci. 14:105. These
sequences direct the transcription of an mRNA which can be
translated into the polypeptide encoded by the DNA. Examples of
transcription terminator/polyadenylation signals include those
derived from SV40, Sambrook et al (1989), Molecular Cloning: A
Laboratory Manual.
[0071] Some genes may be expressed more efficiently when introns
(also called intervening sequences) are present. Several cDNAs,
however, have been efficiently expressed from vectors that lack
splicing signals (also called splice donor and acceptor sites), see
e.g., Gething and Sambrook (1981) Nature 293:620. Introns are
intervening noncoding sequences within a coding sequence that
contain splice donor and acceptor sites. They are removed by a
process called "splicing," following polyadenylation of the primary
transcript, Nevins (1983) Annu. Rev. Biochem. 52:441; Green (1986)
Annu. Rev. Genet. 20:671; Padgett et al. (1986) Annu. Rev. Biochem.
55:1119; Krainer and Maniatis (1988) "RNA splicing," In
Transcription and splicing (ed. B. D. Hames and D. M. Glover).
[0072] Usually, the above-described components, comprising a
promoter, polyadenylation signal, and transcription termination
sequence are put together into expression constructs. Enhancers,
introns with functional splice donor and acceptor sites, and leader
sequences may also, be included in an expression construct, if
desired. Expression constructs are often maintained in a replicon,
such as an extrachromosomal element (e.g., plasmids) capable of
stable maintenance in a host, such as mammalian cells or bacteria.
Mammalian replication systems include those derived from animal
viruses, which require trans-acting factors to replicate. For
example, plasmids containing the replication systems of
papovaviruses, such as SV40, Gluzman (1981) Cell 23:175, or
polyomavirus, replicate to extremely high copy number in the
presence of the appropriate viral T antigen. Additional examples of
mammalian replicons include those derived from bovine
papillomavirus and Epstein-Barr virus. Additionally, the replicon
may have two replication systems, Thus allowing it to be
maintained, for example, in mammalian cells for expression and in a
procaryotic host for cloning and amplification. Examples of such
mammalian-bacteria shuttle vectors include pMT2, Kaufman et al.
(1989) Mol. Cell. Biol. 9:946, and pHEBO, Shimizu et al. (1986)
Mol. Cell. Biol. 6:1074.
[0073] The transformation procedure used depends upon the host to
be transformed. Methods for introduction of heterologous
polynucleotides into mammalian cells are known in the art and
include dextran-mediated transfection, calcium phosphate
precipitation, polybrene mediated transfection, protoplast fusion,
electroporation, encapsulation of the polynucleotide(s) in
liposomes, and direct microinjection of the DNA into nuclei.
[0074] Mammalian cell lines available as hosts for expression are
known in the art and include many immortalized cell lines available
from the American Type Culture Collection (ATCC), including but not
limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby
hamster kidney (BHK) cells, monkey kidney cells (COS), human
hepatocellular carcinoma cells (e.g., Hep G2), and a number of
other cell lines.
[0075] ii. Baculovirus Systems
[0076] The polynucleotide encoding the protein can also be inserted
into a suitable insect expression vector, and is operably linked to
the control elements within that vector. Vector construction
employs techniques which are known in the art.
[0077] Generally, the components of the expression system include a
transfer vector, usually a bacterial plasmid, which contains both a
fragment of the baculovirus genome, and a convenient restriction
site for insertion of the heterologous gene or genes to be
expressed; a wild type baculovirus with a sequence homologous to
the baculovirus-specific fragment in the transfer vector (this
allows for the homologous recombination of the heterologous gene in
to the baculovirus genome); and appropriate insect host cells and
growth media.
[0078] After inserting the DNA sequence encoding the protein into
the transfer vector, the vector and the wild type viral genome are
transfected into an insect host cell where the vector and viral
genome are allowed to recombine. The packaged recombinant virus is
expressed and recombinant plaques are identified and purified.
Materials and methods for baculovirus/insect cell expression
systems are commercially available in kit form from, inter alia,
Invitrogen, San Diego Calif. ("MaxBac" kit). These techniques are
generally known to those skilled in the art and fully described in
Summers and Smith, Texas Agricultural Experiment Station Bulletin
No. 1555 (1987) (hereinafter "Summers and Smith").
[0079] Prior to inserting the DNA sequence encoding the protein
into the baculovirus genome, the above-described components,
comprising a promoter, leader (if desired), coding sequence of
interest, and transcription termination sequence, are usually
assembled into an intermediate transplacement construct (transfer
vector). This construct may contain a single gene and operably
linked regulatory elements; multiple genes, each with its owned set
of operably linked regulatory elements; or multiple genes,
regulated by the same set of regulatory elements. Intermediate
transplacement constructs are often maintained in a replicon, such
as an extrachromosomal element (e.g., plasmids) capable of stable
maintenance in a host, such as a bacterium. The replicon will have
a replication system, thus allowing it to be maintained in a
suitable host for cloning and amplification.
[0080] Currently, the most commonly used transfer vector for
introducing foreign genes into AcNPV is pAc373. Many other vectors,
known to those of skill in the art, have also been designed. These
include, for example, pVL985 (which alters the polyhedrin start
codon from ATG to ATT, and which introduces a BamHI cloning site 32
basepairs downstream from the ATT; see Luckow and Summers, Virology
(1989) 17:31.
[0081] The plasmid usually also contains the polyhedron
polyadenylation signal (Miller at al. (1988) Ann. Rev. Microbiol.,
42:177) and a procaryotic ampicillin-resistance (amp) gene and
origin of replication for selection and propagation in E. coli.
[0082] Baculovirus transfer vectors usually contain a baculovirus
promoter. A baculovirus promoter is any DNA sequence capable of
binding a baculovirus RNA polymerase and initiating the downstream
(5' to 3') transcription of a coding sequence (e.g. structural
gene) into mRNA. A promoter will have a transcription initiation
region which is usually placed proximal to the 5' end of the coding
sequence. This transcription initiation region usually includes an
RNA polymerase binding site and a transcription initiation site. A
baculovirus transfer vector may also have a second domain called an
enhancer, which, if present, is usually distal to the structural
gene. Expression may be either regulated or constitutive.
[0083] Structural genes, abundantly transcribed at late times in a
viral infection cycle, provide particularly useful promoter
sequences. Examples include sequences derived from the gene
encoding the viral polyhedron protein, Friesen at al., (1986) "The
Regulation of Baculovirus Gene Expression," in: The Molecular
Biology of Baculoviruses (ed. Walter Doerfler); EPO Publ. Nos. 127
839 and 155 476; and the gene encoding the p10 protein, Vlak et
al., (1988), J. Gen. Virol. 69:765.
[0084] DNA encoding suitable signal sequences can be derived from
genes for secreted insect or baculovirus proteins, such as the
baculovirus polyhedrin gene (Carbonell et al. (1988) Gene, 73:409).
Alternatively, since the signals for mammalian cell
posttranslational modifications (such as signal peptide cleavage,
proteolytic cleavage, and phosphorylation) appear to be recognized
by insect cells, and the signals required for secretion and nuclear
accumulation also appear to be conserved between the invertebrate
cells and vertebrate cells, leaders of non-insect origin, such as
those derived from genes encoding human alpha-interferon, Maeda et
al., (1985), Nature 315:592; human gastrin-releasing peptide,
Lebacq-Verheyden et al., (1988), Molec. Cell. Biol. 8:3129; human
IL-2, Smith et al., (1985) Proc. Nat'l Acad. Sci. USA, 82:8404;
mouse IL-3, (Miyajima et al., (1987) Gene 58:273; and human
glucocerebrosidase, Martin et al. (1988) DNA 7:99, can also be used
to provide for secretion in insects.
[0085] A recombinant polypeptide or polyprotein may be expressed
intracellularly or, if it is expressed with the proper regulatory
sequences, it can be secreted. Good intracellular expression of
nonfused foreign proteins usually requires heterologous genes that
ideally have a short leader sequence containing suitable
translation initiation signals preceding an ATG start signal. If
desired, methionine at the N-terminus may be cleaved from the
mature protein by in vitro incubation with cyanogen bromide.
[0086] Alternatively, recombinant polyproteins or proteins which
are not naturally secreted can be secreted from the insect cell by
creating chimeric DNA molecules that encode a fusion protein
comprised of a leader sequence fragment that provides for secretion
of the foreign protein in insects. The leader sequence fragment
usually encodes a signal peptide comprised of hydrophobic amino
acids which direct the translocation of the protein into the
endoplasmic reticulum.
[0087] After insertion of the DNA sequence and/or the gene encoding
the expression product precursor of the protein, an insect cell
host is co-transformed with the heterologous DNA of the transfer
vector and the genomic DNA of wild type baculovirus--usually by
co-transfection. The promoter and transcription termination
sequence of the construct will usually comprise a 2-5 kb section of
the baculovirus genome. Methods for introducing heterologous DNA
into the desired site in the baculovirus virus are known in the
art. (See Summers and Smith; Ju et al. (1987); Smith et al., Mol.
Cell. Biol. (1983) 3:2156; and Luckow and Summers (1989)). For
example, the insertion can be into a gene such as the polyhedrin
gene, by homologous double crossover recombination; insertion can
also be into a restriction enzyme site engineered into the desired
baculovirus gene. Miller et al., (1989), Bioessays 4:91.
[0088] The DNA sequence, when cloned in place of the polyhedrin
gene in the expression vector, is flanked both 5' and 3' by
polyhedrin-specific sequences and is positioned downstream of the
polyhedrin promoter.
[0089] The newly formed baculovirus expression vector is
subsequently packaged into an infectious recombinant baculovirus.
Homologous recombination occurs at low frequency (between about 1%
and about 5%); thus, the majority of the virus produced after
cotransfection is still wild-type virus. Therefore, a method is
necessary to identify recombinant viruses. An advantage of the
expression system is a visual screen allowing recombinant viruses
to be distinguished. The polyhedrin protein, which is produced by
the native virus, is produced at very high levels in the nuclei of
infected cells at late times after viral infection. Accumulated
polyhedrin protein forms occlusion bodies that also contain
embedded particles. These occlusion bodies, up to 15 .mu.m in size,
are highly refractile, giving them a bright shiny appearance that
is readily visualized under the light microscope. Cells infected
with recombinant viruses lack occlusion bodies. To distinguish
recombinant virus from wild-type virus, the transfection
supernatant is plagued onto a monolayer of insect cells by
techniques known to those skilled in the art. Namely, the plaques
are screened under the light microscope for the presence
(indicative of wild-type virus) or absence (indicative of
recombinant virus) of occlusion bodies. "Current Protocols in
Microbiology" Vol. 2 (Ausubel et al. eds) at 16.8 (Supp. 10, 1990);
Summers and Smith; Miller et al. (1989).
[0090] Recombinant baculovirus expression vectors have been
developed for infection into several insect cells. For example,
recombinant baculoviruses have been developed for, inter alia:
Aedes aegypti, Autographa californica, Bombyx mori, Drosophila
melanogaster, Spodoptera frugiperda, and Trichoplusia ni (PCT Pub.
No. WO 89/046699; Carbonell et al., (1985) J. Virol. 56:153; Wright
(1986) Nature 321:718; Smith et al., (1983) Mol. Cell. Biol.
3:2156; and see generally, Fraser, et al. (1989) In vitro Cell.
Dev. Biol. 25:225).
[0091] Cells and cell culture media are commercially available for
both direct and fusion expression of heterologous polypeptides in a
baculovirus/expression system; cell culture technology is generally
known to those skilled in the art. See, e.g., Summers and
Smith.
[0092] The modified insect cells may then be grown in an
appropriate nutrient medium, which allows for stable maintenance of
the plasmid(s) present in the modified insect host. Where the
expression product gene is under inducible control, the host may be
grown to high density, and expression induced. Alternatively, where
expression is constitutive, the product will be continuously
expressed into the medium and the nutrient medium must be
continuously circulated, while removing the product of interest and
augmenting depleted nutrients. The product may be purified by such
techniques as chromatography, e.g., HPLC, affinity chromatography,
ion exchange chromatography, etc.; electrophoresis; density
gradient centrifugation; solvent extraction, or the like. As
appropriate, the product may be further purified, as required, so
as to remove substantially any insect proteins which are also
secreted in the medium or result from lysis of insect cells, so as
to provide a product which is at least substantially free of host
debris, e.g., proteins, lipids and polysaccharides.
[0093] In order to obtain protein expression, recombinant host
cells derived from the transformants are incubated under conditions
which allow expression of the recombinant protein encoding
sequence. These conditions will vary, dependent upon the host cell
selected. However, the conditions are readily ascertainable to
those of ordinary skill in the art, based upon what is known in the
art.
[0094] iii. Bacterial Systems
[0095] Bacterial expression techniques are known in the art. A
bacterial promoter is any DNA sequence capable of binding bacterial
RNA polymerase and initiating the downstream (3'') transcription of
a coding sequence (e.g. structural gene) into mRNA. A promoter will
have a transcription initiation region which is usually placed
proximal to the 5' end of the coding sequence. This transcription
initiation region usually includes an RNA polymerase binding site
and a transcription initiation site. A bacterial promoter may also
have a second domain called an operator, that may overlap an
adjacent RNA polymerase binding site at which RNA synthesis begins.
The operator permits negative regulated (inducible) transcription,
as a gene repressor protein may bind the operator and thereby
inhibit transcription of a specific gene. Constitutive expression
may occur in the absence of negative regulatory elements, such as
the operator. In addition, positive regulation may be achieved by a
gene activator protein binding sequence, which, if present is
usually proximal (5') to the RNA polymerase binding sequence. An
example of a gene activator protein is the catabolite activator
protein (CAP), which helps initiate transcription of the lac operon
in E. coli, Raibaud et al. (1984) Annu. Rev. Genet. 18:173.
Regulated expression may therefore be either positive or negative,
thereby either enhancing or reducing transcription.
[0096] Sequences encoding metabolic pathway enzymes provide
particularly useful promoter sequences. Examples include promoter
sequences derived from sugar metabolizing enzymes, such as
galactose, lactose (lac), Chang et al. (1977) Nature 198:1056, and
maltose. Additional examples include promoter sequences derived
from biosynthetic enzymes such as tryptophan (trp), Goeddel et al.
(1980) Nuc. Acids Res. 8:4057; Yelverton et al. (1981) Nucl. Acids
Res, 9:731; U.S. Pat. No. 4,738,921; EPO Publ. Nos. 036 776 and 121
775. The g-lactamase (bla) promoter system, Weissmann (1981) "The
cloning of interferon and other mistakes." In Interferon 3 (ed. I.
Gresser), bacteriophage lambda PL, Shimatake et al. (1981) Nature
292:128, and T5, U.S. Pat. No. 4,689,406, promoter systems also
provide useful promoter sequences.
[0097] In addition, synthetic promoters which do not occur in
nature also function as bacterial promoters. For example,
transcription activation sequences of one bacterial or
bacteriophage promoter may be joined with the operon sequences of
another bacterial or bacteriophage promoter, creating a synthetic
hybrid promoter, U.S. Pat. No. 4,551,433. For example, the tac
promoter is a hybrid trp-lac promoter comprised of both trp
promoter and lac operon sequences that is regulated by the lac
repressor, Amann et al. (1983) Gene 25:167; de Boer et al. (1983)
Proc. Natl. Acad. Sci. 80:21. Furthermore, a bacterial promoter can
include naturally occurring promoters of non-bacterial origin that
have the ability to bind bacterial RNA polymerase and initiate
transcription. A naturally occurring promoter of non-bacterial
origin can also be coupled with a compatible RNA polymerase to
produce high levels of expression of some genes in prokaryotes. The
bacteriophage T7 RNA polymerase/promoter system is an example of a
coupled promoter system, Studier et al. (1986) J. Mol. Biol.
189:113; Tabor et al. (1985) Proc Natl. Acad. Sci. 82:1074. In
addition, a hybrid promoter can also be comprised of a
bacteriophage promoter and an E. coli operator region (EPO. Publ.
No. 267 851).
[0098] In addition to a functioning promoter sequence, an efficient
ribosome binding site is also useful for the expression of foreign
genes in prokaryotes. In E. coli, the ribosome binding site is
called the Shine-Dalgarno (SD) sequence and includes an initiation
codon (ATG) and a sequence 3-9 nucleotides in length located 3-11
nucleotides upstream of the initiation codon, Shine et al. (1975)
Nature 254:34. The SD sequence is thought to promote binding of
mRNA to the ribosome by the pairing of bases between the SD
sequence and the 3' and of E. coli 16S rRNA, Steitz et al. (1979)
"Genetic signals and nucleotide sequences in messenger RNA." In
Biological Regulation and Development: Gene Expression (ed. R. F.
Goldberger). To express eukaryotic genes and prokaryotic genes with
weak ribosome-binding site, Sambrook et al. (1989), Molecular
Cloning: A Laboratory Manual.
[0099] A DNA molecule may be expressed intracellularly. A promoter
sequence may be directly linked with the DNA molecule, in which
case the first amino acid at the N-terminus will always be a
methionine, which is encoded by the ATG start codon. If desired,
methionine at the N-terminus may be cleaved from the protein by in
vitro incubation with cyanogen bromide or by either in vivo on in
vitro incubation with a bacterial methionine N-terminal peptidase
(EPO Publ. No. 219 237).
[0100] Fusion proteins provide an alternative to direct expression.
Usually, a DNA sequence encoding the N-terminal portion of an
endogenous bacterial protein, or other stable protein, is fused to
the 5' end of heterologous coding sequences. Upon expression, this
construct will provide a fusion of the two amino acid sequences.
For example, the bacteriophage lambda cell gene can be linked at
the 5' terminus of a foreign gene and expressed in bacteria. The
resulting fusion protein preferably retains a site for a processing
enzyme (factor Xa) to cleave the bacteriophage protein from the
foreign gene, Nagai et al. (1984) Nature 309:810. Fusion proteins
can also be made with sequences from the lacZ, Jia et al. (1987)
Gene 60:197, trpE, Allen et al. (1987) J. Biotechnol. 5:93; Makoff
et al. (1989) J. Gen. Microbiol. 135:11, and EPO Publ. No. 324 647,
genes. The DNA sequence at the junction of the two amino acid
sequences may or may not encode a cleavable site. Another example
is a ubiquitin fusion protein. Such a fusion protein is made with
the ubiquitin region that preferably retains a site for a
processing enzyme (e.g. ubiquitin specific processing-protease) to
cleave the ubiquitin from the foreign protein. Through this method,
native foreign protein can be isolated. Miller et al. (1989)
Bio/Technology 7:698.
[0101] Alternatively, foreign proteins can also be secreted from
the cell by creating chimeric DNA molecules that encode a fusion
protein comprised of a signal peptide sequence fragment that
provides for secretion of the foreign protein in bacteria, U.S.
Pat. No. 4,336,336. The signal sequence fragment usually encodes a
signal peptide comprised of hydrophobic amino acids which direct
the secretion of the protein from the cell. The protein is either
secreted into the growth media (gram-positive bacteria) or into the
periplasmic space, located between the inner and outer membrane of
the cell (gram-negative bacteria). Preferably there are processing
sites, which can be cleaved either in vivo or in vitro encoded
between the signal peptide fragment and the foreign gene.
[0102] DNA encoding suitable signal sequences can be derived from
genes for secreted bacterial proteins, such as the E. coli outer
membrane protein gene (ompA). Masni et al. (1983), in: Experimental
Manipulation of Gene Expression; Ghrayeb et al. (1984) EMBO J.
3:2437 and the E. coli alkaline phosphatase signal sequence (phoA),
Oka et al. (1985) Proc. Natl. Acad. Sci. 82:7212. As an additional
example, the signal sequence of the alpha-amylase gene from various
Bacillus strains can be used to secrete heterologous proteins from
B. subtilis. Palva et al. (1982) Proc. Natl. Acad. Sci. USA
79:5582; EPO Publ. No. 244 042.
[0103] Usually, transcription termination sequences recognized by
bacteria are regulatory regions located 3' to the translation stop
codon, and thus together with the promoter flank the coding
sequence. These sequences direct the transcription of an mRNA which
can be translated into the polypeptide encoded by the DNA.
Transcription termination sequences frequently include DNA
sequences of about 50 nucleotides capable of forming stem loop
structures that aid in terminating transcription. Examples include
transcription termination sequences derived from genes with strong
promoters, such as the trp gene in E. coli as well as other
biosynthetic genes.
[0104] Usually, the above-described components, comprising a
promoter, signal sequence (if desired), coding sequence of
interest, and transcription termination sequence, are put together
into expression constructs. Expression constructs are often
maintained in a replicon, such as an extrachromosomal element
(e.g., plasmids) capable of stable maintenance in a host, such as
bacteria. The replicon will have a replication system, thus
allowing it to be maintained in a procaryotic host either for
expression or for cloning and amplification. In addition, a
replicon may be either a high or low copy number plasmid. A high
copy number plasmid will generally have a copy number ranging from
about 5 to about 200, and usually about 10 to about 150. A host
containing a high copy number plasmid will preferably contain at
least about 10, and more preferably at least about 20 plasmids.
Either a high or low copy number vector may be selected, depending
upon the effect of the vector and the foreign protein on the
host.
[0105] Alternatively, the expression constructs can be integrated
into the bacterial genome with an integrating vector. Integrating
vectors usually contain at least one sequence homologous to the
bacterial chromosome that allows the vector to integrate.
Integrations appear to result from recombinations between
homologous DNA in the vector and the bacterial chromosome. For
example, integrating vectors constructed with DNA from various
Bacillus strains integrate into the Bacillus chromosome (EPO Publ.
No. 127 328). Integrating vectors may also be comprised of
bacteriophage or transposon sequences.
[0106] Usually, extrachromosomal and integrating expression
constructs may contain selectable markers to allow for the
selection of bacterial strains that have been transformed.
Selectable markers can be expressed in the bacterial host and may
include genes which render bacteria resistant to drugs such as
ampicillin, chloramphenicol, erythromycin, kanamycin (neomycin),
and tetracycline. Davies et al. (1978) Annu. Rev. Microbiol.
32:469. Selectable markers may also include biosynthetic genes,
such as those in the histidine, tryptophan, and leucine
biosynthetic pathways.
[0107] Alternatively, some of the above-described components can be
put together in transformation vectors. Transformation vectors are
usually comprised of a selectable marker that is either maintained
in a replicon or developed into an integrating vector.
[0108] Expression and transformation vectors, either
extra-chromosomal replicons or integrating vectors, have been
developed for transformation into many bacteria. For example,
expression vectors have been developed for, inter alia, the
following bacteria: Bacillus subtilis, Palv et al. (1982) Proc.
Natl. Acad. Sci. USA 79:5582; EPO Publ. Nos. 036 259 and 063 953;
PCT Publ. No. WO 84/04541; E. coli, Shimatake at al. (1981) Nature
292:128; Amann et al. (1985) Gene 40:183; Studier at al. (1986) J.
Mol. Biol. 189:113; EPO Publ. Nos. 036 776, 136 829 and 136 907;
Streptococcus cremoris, Powell et al. (1988) Appl. Environ.
Microbiol. 54:655; Streptococcus lividans, Powell et al. (1988)
Appl. Environ. Microbiol. 54:655; and Streptomyces lividans, U.S.
Pat. No. 4,745,056.
[0109] Methods of introducing exogenous DNA into bacterial hosts
are well-known in the art, and usually include either the
transformation of bacteria treated with CaCl2 or other agents, such
as divalent cations and DMSO. DNA can also be introduced into
bacterial cells by electroporation. Transformation procedures
usually vary with the bacterial species to be transformed. See,
e.g., Masson at al. (1989) FEMS Microbiol. Lett. 60:273; Palva at
al. (1982) Proc. Natl. Acad. Sci. USA 79:5582; EPO Publ. Nos. 036
259 and 063 953; PCT Publ. No. WO 84/04541, for Bacillus; Miller at
al. (1988) Proc. Natl. Acad. Sci. 85:856; Wang et al. (1990) J.
Bacteriol. 172:949, for Campylobacter; Cohen et al. (1973) Proc.
Natl. Acad. Sci. 69:2110; Dower et al. (1988) Nucleic Acids Res.
16:6127; Kushner (1978) "An improved method for transformation of
E. coli with ColE1-derived plasmids," In Genetic Engineering:
Proceedings of the International Symposium on Genetic Engineering
(eds. H. W. Boyer and S, Nicosia); Mandel et al. (1970) J. Mol.
Biol. 53:159; Taketo (1988) Biochim. Biophys. Acta 949:318, for
Escherichia; Chassy et al. (1987) FEMS Microbiol. Lett. 44:173, for
Lactobacillus; Fiedler et al. (1988) Anal. Biochem 170:38, for
Pseudomonas; Augustin et al. (1990) FEMS Microbiol. Lett. 66:203,
for Staphylococcus; Barany et al. (1980) J. Bacteriol. 144:698;
Harlander (1987) "Transformation of Streptococcus lactis by
electroporation, in: Streptococcal Genetics (ed. J. Ferretti and R.
Curtiss III); Perry et al. (1981) Infec. Immun. 32:1295; Powell et
al. (1988) Appl. Environ. Microbiol. 54:655; Somkuti et al. (1987)
Proc. 4th Evr. Cong. Biotechnology 1:412, for Streptococcus.
[0110] iv. Yeast Expression
[0111] Yeast expression systems are also known to one of ordinary
skill in the art. A yeast promoter is any DNA sequence capable of
binding yeast RNA polymerase and initiating the downstream (3')
transcription of a coding sequence (e.g. structural gene) into
mRNA. A promoter will have a transcription initiation region which
is usually placed proximal to the 5' end of the coding sequence.
This transcription initiation region usually includes an RNA
polymerase binding site (the "TATA Box") and a transcription
initiation site. A yeast promoter may also have a second domain
called an upstream activator sequence (UAS), which, if present, is
usually distal to the structural gene. The UAS permits regulated
(inducible) expression. Constitutive expression occurs in the
absence of a UAS. Regulated expression may be either positive or
negative, thereby either enhancing or reducing transcription.
[0112] Yeast is a fermenting organism with an active metabolic
pathway, therefore sequences encoding enzymes in the metabolic
pathway provide particularly useful promoter sequences. Examples
include alcohol dehydrogenase (ADH) (EPO Publ. No. 284 044),
enolase, glucokinase, glucose-6-phosphate isomerase,
glyceraldehyde-3-phosphate-dehydrogenase (GAP or GAPDH),
hexokinase, phosphofructokinase, 3-phosphoglycerate mutase, and
pyruvate kinase (PyK) (EPO Publ. No. 329 203). The yeast PHO5 gene,
encoding acid phosphatase, also provides useful promoter sequences,
Myanohara et al. (1983) Proc. Natl. Acad. Sci. USA 80:1.
[0113] In addition, synthetic promoters which do not occur in
nature also function as yeast promoters. For example, UAS sequences
of one yeast promoter may be joined with the transcription
activation region of another yeast promoter, creating a synthetic
hybrid promoter. Examples of such hybrid promoters include the ADH
regulatory sequence linked to the GAP transcription activation
region (U.S. Pat. No. 4,876,197 and U.S. Pat. No. 4,880,734). Other
examples of hybrid promoters include promoters which consist of the
regulatory sequences of either the ADH2, GAL4, GAL10, or PHO5
genes, combined with the transcriptional activation region of a
glycolytic enzyme gene such as GAP or PyK (EPO Publ. No. 164 556).
Furthermore, a yeast promoter can include naturally occurring
promoters of non-yeast origin that have the ability to bind yeast
RNA polymerase and initiate transcription. Examples of such
promoters include, inter alia, Cohen at al. (1980) Proc. Natl.
Acad. Sci. USA 77:1078; Henikoff at al. (1981) Nature 283:835;
Hollenberg et al. (1981) Curr. Topics Microbiol. Immunol. 96:119;
Hollenberg at al. (1979) "The Expression of Bacterial Antibiotic
Resistance Genes in the Yeast Saccharomyces cerevisiae," in:
Plasmids of Medical, Environmental and Commercial Importance (eds.
K. N. Timmis and A. Puhler); Mercerau-Puigalon et al. (1980) Gene
11:163; Panthier et al. (1980) Curr. Genet. 2:109.
[0114] A DNA molecule may be expressed intracellularly in yeast. A
promoter sequence may be directly linked with the DNA molecule, in
which case the first amino acid at the N-terminus of the
recombinant protein will always be a methionine, which is encoded
by the ATG start codon. If desired, methionine at the N-terminus
may be cleaved from the protein by in vitro incubation with
cyanogen bromide.
[0115] Fusion proteins provide an alternative for yeast expression
systems, as well as in mammalian, baculovirus, and bacterial
expression systems. Usually, a DNA sequence encoding the N-terminal
portion of an endogenous yeast protein, or other stable protein, is
fused to the 5' end of heterologous coding sequences. Upon
expression, this construct will provide a fusion of the two amino
acid sequences. For example, the yeast or human superoxide
dismutase (SOD) gene, can be linked at the 5' terminus of a foreign
gene and expressed in yeast. The DNA sequence at the junction of
the two amino acid sequences may or may not encode a cleavable
site. See e.g., EPO Publ. No. 196 056. Another example is a
ubiquitin fusion protein. Such a fusion protein is made with the
ubiquitin region that preferably retains a site for a processing
enzyme (e.g. ubiquitin-specific processing protease) to cleave the
ubiquitin from the foreign protein. Through this method, therefore,
native foreign protein can be isolated (see, e.g., PCT Publ. No. WO
88/024066).
[0116] Alternatively, foreign proteins can also be secreted from
the cell into the growth media by creating chimeric DNA molecules
that encode a fusion protein comprised of a leader sequence
fragment that provide for secretion in yeast of the foreign
protein. Preferably, there are processing sites encoded between the
leader fragment and the foreign gene that can be cleaved either in
vivo or in vitro. The leader sequence fragment usually encodes a
signal peptide comprised of hydrophobic amino acids which direct
the secretion of the protein from the cell.
[0117] DNA encoding suitable signal sequences can be derived from
genes for secreted yeast proteins, such as the yeast invertase gene
(EPO Publ. No. 012 873; JPO Publ. No. 62,096,086) and the A-factor
gene (U.S. Pat. No. 4,588,684). Alternatively, leaders of non-yeast
origin, such as an interferon leader, exist that also provide for
secretion in yeast (EPO Publ. No. 060 057).
[0118] A preferred class of secretion leaders are those that employ
a fragment of the yeast alpha-factor gene, which contains both a
"pre" signal sequence, and a "pro" region. The types of
alpha-factor fragments that can be employed include the full-length
pre-pro alpha factor leader (about 83 amino acid residues) as well
as truncated alpha-factor leaders (usually about 25 to about 50
amino acid residues) (U.S. Pat. No. 4,546,083 and U.S. Pat. No.
4,870,008; EPO Publ. No. 324 274). Additional leaders employing an
alpha-factor leader fragment that provides for secretion include
hybrid alpha-factor leaders made with a presequence of a first
yeast, but a pro-region from a second yeast alpha factor. (See
e.g., PCT Publ. No. WO 89/02463.)
[0119] Usually, transcription termination sequences recognized by
yeast are regulatory regions located 3' to the translation stop
codon, and thus together with the promoter flank the coding
sequence. These sequences direct the transcription of an mRNA which
can be translated into the polypeptide encoded by the DNA. Examples
of transcription terminator sequence and other yeast-recognized
termination sequences, such as those coding for glycolytic
enzymes.
[0120] Usually, the above-described components, comprising a
promoter, leader (if desired), coding sequence of interest, and
transcription termination sequence, are put together into
expression constructs. Expression constructs are often maintained
in a replicon, such as an extrachromosomal element (e.g., plasmids)
capable of stable maintenance in a host, such as yeast or bacteria.
The replicon may have two replication systems, thus allowing it to
be maintained, for example, in yeast for expression and in a
procaryotic host for cloning and amplification. Examples of such
yeast-bacteria shuttle vectors include YEp24, Botstein et al.
(1979) Gene 8:17-24; pCI/1, Brake et al. (1984) Proc. Natl. Acad.
Sci. USA 81:4642-4646; and YRp17, Stinchcomb et al. (1982) J. Mol.
Biol. 158:157. In addition, a replicon may be either a high or low
copy number plasmid. A high copy number plasmid will generally have
a copy number ranging from about 5 to about 200, and usually about
10 to about 150. A host containing a high copy number plasmid will
preferably have at least about 10, and more preferably at least
about 20. A high or low copy number vector may be selected,
depending upon the effect of the vector and the foreign protein on
the host.
[0121] Alternatively, the expression constructs can be integrated
into the yeast genome with an integrating vector. Integrating
vectors usually contain at least one sequence homologous to a yeast
chromosome that allows the vector to integrate, and preferably
contain two homologous sequences flanking the expression construct.
Integrations appear to result from recombinations between
homologous DNA in the vector and the yeast chromosome, Orr-Weaver
et al. (1983) Methods in Enzymol. 101:228-245. An integrating
vector may be directed to a specific locus in yeast by selecting
the appropriate homologous sequence for inclusion in the vector.
One or more expression construct may integrate, possibly affecting
levels of recombinant protein produced, Rine et al. (1983) Proc.
Natl. Acad. Sci. USA 80:6750. The chromosomal sequences included in
the vector can occur either as a single segment in the vector,
which results in the integration of the entire vector, or two
segments homologous to adjacent segments in the chromosome and
flanking the expression construct in the vector, which can result
in the stable integration of only the expression construct.
[0122] Usually, extrachromosomal and integrating expression
constructs may contain selectable markers to allow for the
selection of yeast strains that have been transformed. Selectable
markers may include biosynthetic genes that can be expressed in the
yeast host, such as ADE2, HIS4, LEU2, TRP1, and ALG7, and the G418
resistance gene, which confer resistance in yeast cells to
tunicamycin and G418, respectively. In addition, a suitable
selectable marker may also provide yeast with the ability to grow
in the presence of toxic compounds, such as metal. For example, the
presence of CUP1 allows yeast to grow in the presence of copper
ions. Butt at al. (1987) Microbiol, Rev. 51:351.
[0123] Alternatively, some of the above-described components can be
put together into transformation vectors. Transformation vectors
are usually comprised of a selectable marker that is either
maintained in a replicon or developed into an integrating
vector.
[0124] Expression and transformation vectors, either
extrachromosomal replicons or integrating vectors, have been
developed for transformation into many yeasts. For example,
expression vectors have been developed for, inter alia, the
following yeasts: Candida albicans, Kurtz, et al. (1986) Mol. Cell.
Biol. 6:142; Candida maltosa, Kunze, et al. (1985) J. Basic
Microbiol. 25:141; Hansenula polymorpha, Gleeson, at al. (1986) J.
Gen. Microbiol. 132:3459; Roggenkamp et al. (1986) Mol. Gen. Genet.
202:302; Kluyveromyces fragilis, Das, at al. (1984) J. Bacteriol.
158:1165; Kluyveromyces lactis, De Louvencourt et al. (1983) J.
Bacteriol. 154:737; Van den Berg et al. (1990) Bio/Technology
8:135; Pichia guillerimondii, Kunze et al. (1985) J. Basic
Microbiol. 25:141; Pichia pastoris, Cregg, et al. (1985) Mol. Cell.
Biol. 5:3376; U.S. Pat. No. 4,837,148 and U.S. Pat. No. 4,929,555;
Saccharomyces cerevisiae, Hinnen et al. (1978) Proc. Natl. Acad.
Sci. USA 75:1929; Ito et al. (1983) J. Bacteriol. 153:163;
Schizosaccharomyces pombe, Beach et al. (1981) Nature 300:706; and
Yarrowia lipolytica, Davidow, et al. (1985) Curr. Genet. 10:380471
Gaillardin, et al. (1985) Curr. Genet. 10:49.
[0125] Methods of introducing exogenous DNA into yeast hosts are
well-known in the art, and usually include either the
transformation of spheroplasts or of intact yeast cells treated
with alkali cations. Transformation procedures usually vary with
the yeast species to be transformed. See e.g., Kurtz et al. (1986)
Mol. Cell. Biol. 6:142; Kunze et al. (1985) J. Basic Microbiol.
25:141, for Candida; Gleeson et al. (1986) J. Gen. Microbiol.
132:3459; Roggenkamp et al. (1986) Mol. Gen. Genet. 202:302, for
Hansenula; Das et al. (1984) J. Bacterial. 158:1165; De Louvencourt
et al. (1983) J. Bacteriol. 154:1165; Van den Berg et al. (1990)
Bio/Technology 8:135, for Kluyveromyces; Cregg et al. (1985) Mol.
Cell. Biol. 5:3376; Kunze et al. (1985) J. Basic Microbiol. 25:141;
U.S. Pat. No. 4,837,148 and U.S. Pat. No. 4,929,555, for Pichia;
Hinnen et al. (1978) Proc. Natl. Acad. Sci. USA 75; 1929; Ito et
al. (1983) J. Bacteriol. 153:163, for Saccharomyces; Beach et al.
(1981) Nature 300:706, for Schizosaccharomyces; Davidow et al.
(1985) Curr. Genet. 10:39; Gaillardin et al. (1985) Curr. Genet.
10:49, for Yarrowia.
E. Vaccines
[0126] Each of the H. pylori proteins discussed herein may be used
as a sole vaccine candidate or in combination with one or more
other antigens, the latter either from H. pylori or other
pathogenic sources. Preferred are "cocktail" vaccines comprising,
for example, the cytotoxin (CT) antigen, the CAI protein, and the
urease. Additionally, the hsp can be added to one or more of these
components. These vaccines may either be prophylactic (to prevent
infection) or therapeutic (to treat disease after infection).
[0127] Such vaccines comprise H. pylori antigen or antigens,
usually in combination with "pharmaceutically acceptable carriers",
which include any carrier that does not itself induce the
production of antibodies harmful to the individual receiving the
composition. Suitable carriers are typically large, slowly
metabolized macromolecules such as proteins, polysaccharides,
polylactic acids, polyglycolic acids, polymeric amino acids, amino
acid copolymers, lipid aggregates (such as oil droplets or
liposomes), and inactive virus particles. Such carriers are well
known to those of ordinary skill in the art. Additionally, these
carriers may function as immunostimulating agents ("adjuvants").
Furthermore, the antigen may be conjugated to a bacterial toxoid,
such as a toxoid from diphtheria, tetanus, cholera, H. pylori, etc.
pathogens.
[0128] Preferred adjuvants to enhance effectiveness of the
composition include, but are not limited to: (1) aluminum salts
(alum), such as aluminum hydroxide, aluminum phosphate, aluminum
sulfate, etc; (2) oil-in-water emulsion formulations (with or
without other specific immunostimulating agents such as muramyl
peptides (see below) or bacterial cell wall components), such as
for example (a) MF59 (PCT Publ. No. WO 90/14837), containing 5%
Squalene.RTM., 0.5% Tween 800, and 0.5% Span 85.RTM. (optionally
containing various amounts of MTP-PE (see below), although not
required) formulated into submicron particles using a
microfluidizer such as Model 110Y microfluidizer (Microfluidics,
Newton, Mass.), (b) SAF, containing 10% Squalene, 0.4% Tween
80.RTM., 5% pluronic-blocked polymer L121, and thr-MDP (see below)
either microfluidized into a submicron emulsion or vortexed to
generate a larger particle size emulsion, and (c) Ribi.TM. adjuvant
system (RAS), (Ribi Immunochem, Hamilton, Mont.) containing 2%
Squalene.RTM., 0.2% Tween 80.RTM., and one or more bacterial cell
wall components from the group consisting of monophosphorylipid A
(MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS),
preferably MPL+CWS (Detox.TM.); (3) saponin adjuvants, such as
Stimulon.TM. (Cambridge Bioscience, Worcester, Mass.) may be used
or particles generated therefrom such as ISCOMs (immunostimulating
complexes); (4) Complete Freunds Adjuvant (CFA) and Incomplete
Freunds Adjuvant (IFA); (5) cytokines, such as interleukins (IL-1,
IL-2, etc.), macrophage colony stimulating factor (M-CFS), tumor
necrosis factor (TNF), etc; and (6) other substances that act as
immunostimulating agents to enhance the effectiveness of the
composition. Alum and MF59 are preferred.
[0129] As mentioned above, muramyl peptides include, but are not
limited to, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP),
N-acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP),
N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-s-
n-glycero-3-huydroxyphosphoryloxy)-ethylamine (MTP-PE), etc.
[0130] The immunogenic compositions (e.g., the antigen,
pharmaceutically acceptable carrier, and adjuvant) typically will
contain diluents, such as water, saline, glycerol, ethanol, etc.
Additionally, auxiliary substances, such as wetting or emulsifying
agents, pH buffering substances, and the like, may be present in
such vehicles.
[0131] Typically, the immunogenic compositions are prepared as
injectables, either as liquid solutions or suspensions; solid forms
suitable for solution in, or suspension in, liquid vehicles prior
to injection may also be prepared. The preparation also may be
emulsified or encapsulated in liposomes for enhanced adjuvant
effect, as discussed above under pharmaceutically acceptable
carriers.
[0132] Immunogenic compositions used as vaccines comprise an
immunologically effective amount of the antigenic polypeptides, as
well as any other of the above-mentioned components, as needed. By
"immunologically effective amount", it is meant that the
administration of that amount to an individual, either in a single
dose or as part of a series, is effective for treatment or
prevention. This amount varies depending upon the health and
physical condition of the individual to be treated, the taxonomic
group of individual to be treated (e.g., nonhuman primate, primate,
etc.), the capacity of the individual's immune system to synthesize
antibodies, the degree of protection desired, the formulation of
the vaccine, the treating doctor's assessment of the medical
situation, and other relevant factors. It is expected that the
amount will fall in a relatively broad range that can be determined
through routine trials.
[0133] The immunogenic compositions are conventionally administered
parenterally, e.g., by injection, either subcutaneously or
intramuscularly. Additional formulations suitable for other modes
of administration include oral and pulmonary formulations,
suppositories, and transdermal applications. Oral formulations are
most preferred for the H. pylori proteins. Dosage treatment may be
a single dose schedule or a multiple dose schedule. The vaccine may
be administered in conjunction with other immunoregulatory
agents.
F. Immunodiagnostic Assays
[0134] H. pylori antigens can be used in immunoassays to detect
antibody levels (or conversely H. pylori antibodies can be used to
detect antigen levels) and correlation can be made with
gastroduodenal disease and with duodenal ulcer in particular.
Immunoassays based on well defined, recombinant antigens can be
developed to replace the invasive diagnostics methods that are used
today. Antibodies to H. pylori proteins within biological samples,
including for example, blood or serum samples, can be detected.
Design of the immunoassays is subject to a great deal of variation,
and a variety of these are known in the art. Protocols for the
immunoassay may be based, for example, upon competition, or direct
reaction, or sandwich type assays. Protocols may also, for example,
use solid supports, or may be by immunoprecipitation. Most assays
involve the use of labeled antibody or polypeptide; the labels may
be, for example, fluorescent, chemiluminescent, radioactive, or dye
molecules. Assays which amplify the signals from the probe are also
known; examples of which are assays which utilize biotin and
avidin, and enzyme-labeled and mediated immunoassays, such as ELISA
assays.
[0135] Kits suitable for immunodiagnosis and containing the
appropriate labeled reagents are constructed by packaging the
appropriate materials, including the compositions of the invention,
in suitable containers, along with the remaining reagents and
materials (for example, suitable buffers, salt solutions, etc.)
required for the conduct of the assay, as well as suitable set of
assay instructions.
G. EXAMPLES
[0136] The examples presented below are provided as a further guide
to the practitioner of ordinary skill in the art and are not to be
construed as limiting the invention in any way.
[0137] i. H. pylori cytotoxin (CT) antigen
1. Materials and Methods
[0138] For general materials and methods relating to H. pylori
growth and DNA isolation, see sections ii and iii below, relating
to CAI antigen and hsp, respectively.
a. Cloning
[0139] Two mixtures of degenerate oligonucleotides were synthesized
using an Applied Biosystems model 380B DNA synthesizer. These
mixtures were used at a concentration of 4 micromolar in a 100
microliter polymerase chain reaction with 200 nanograms of purified
DNA using the Genamp PCR kit according to the manufacturers
instructions. The reaction was incubated for 1 minute at 94 degrees
centigrade, 2 minutes at 48.degree. C. and 2 minutes at 56.degree.
C. The reaction mix was subjected to 30 cycles of these
conditions.
[0140] Analysis of the products of this reaction by agarose gel
electrophoresis revealed a prominent approximately 87 bp DNA
fragment. After digestion with the restriction enzymes XbaI and
EcoRI, the fragment was ligated to the Bluscript SK+ (Stratgene)
plasmid which had previously also been digested with XbaI and
EcoRI. The ligation mixture was used to transform competent E. coli
by electroporation at 2000V and 25 microfarads using (200 OMEGA) a
BioRad Gene Pulser (California). Transformed E. coli were selected
for growth on L-agar plates containing 100 micrograms per
milliliter ampicillin. Plasmid DNA was extracted from positive E.
coli isolates and subjected to sequence analysis using the
Sequenase 2 (United States Biochemical Corporation) DNA sequencing
kit according to the manufacturers instructions.
b. Preparation of Libraries
[0141] (1) Library of HindIII Fragments
[0142] Seven micrograms of purified DNA were digested to completion
with the restriction enzyme HindIII. Three micrograms of Bluescript
SK+ plasmid DNA were digested to completion with HindIII then
treated with calf intestinal phosphatase. Both DNA mixtures were
purified by agitation with a water saturated phenol then
precipitated by addition of ethyl alcohol to 67% V/V. Both DNAs
were resuspended in 50 microliters of water. 0.7 micrograms of DNA
fragments were mixed with 0.3 micrograms of Bluescript DNA in 50
microliters of a solution containing 25 mM Tris ph 7.5, 10 mM
MgCl.sub.2 and 5 units of T4 DNA ligase. This mix was incubated at
15.degree. C. for 20 hours after which the DNA was extracted with
water saturated phenol and precipitated from ethyl alcohol. The DNA
was subsequently resuspended in 50 .mu.L of water. Introduction of
1 .mu.L of this DNA into E. coli by electroporation resulted in
approximately 3000-10,000 ampicillin resistant bacterial
colonies.
[0143] (2) Library of EcoRI Fragments.
[0144] About 0.7 .mu.g of EcoRI digested DNA was purified and mixed
with 0.45 micrograms of Bluescript SK+ plasmid which had been
previously digested with EcoRI and treated with calf intestinal
phosphatase. The fragments were ligated in 50 .mu.L of solution.
After purification and precipitation, the DNA was resuspended in 50
.mu.L of water. Electroporation of E. coli with 1 .mu.L of this
solution resulted in approximately 200 ampicillin resistant
bacterial colonies.
[0145] In order to identify suitable restriction fragments from the
genome for further cloning, the plasmid was uniformly labeled with
.sup.32P and used as a probe to analyze DNA from the strain CCUG
digested with various restriction enzymes, separated on agarose gel
electrophoresis and transferred to nitrocellulose filter. The probe
revealed a unique approximately 3.5 kb HindIII restriction
fragment. A library of HindIII digested DNA fragments was prepared
and cloned in the Bluescript plasmid vector. This library was
screened with 32P labeled DNA corresponding to the 87 bp fragment
previously cloned. Two clones containing identical approximately
3.3 kbp HindIII fragments were identified. DNA sequencing of these
HindIII fragments revealed sequences capable of coding for the 23
amino acids corresponding to the amino terminus of the previously
described 87 kDa cytotoxin. These sequences comprised part of an
open reading frame of approximately 300 nucleotides which
terminated at the extremity of the fragment delimited by a HindIII
restriction site. The sequence also revealed the existence of an
EcoRI restriction site within the putative open reading frame 120
bp away from the HindIII site.
[0146] A 32P labeled probe corresponding to the sequences between
the EcoRI site and the HindIII site was used to screen a library of
EcoR fragments from DNA cloned in the Bluescript SK vector. This
probe revealed two clones containing approximately 7.3 kbp
fragments. DNA sequencing of these fragments revealed a continuous
open reading frame which overlapped with the sequences determined
from the 3.2 kbp HindIII fragments. The DNA sequence of these
overlapping fragments and the conceptual translation of the single
long open reading frame contained are shown in FIGS. 1 and 2,
respectively.
[0147] It should be noted that these clones were found to be
extremely unstable. The initial colonies identified in the
screening were so small as to be difficult to detect. Expansion of
these clones by traditional methods of subculturing for 16-18 hours
resulted in very heterogeneous populations of plasmids due to DNA
rearrangement and deletion. Sufficient quantities of these clones
were grown by subculturing for 8-10 hours in the absence of
antibiotic selection. In this fashion, although yields of plasmid
were relatively low, selection and outgrowth of bacteria containing
viable rearranged plasmid were avoided.
c. Screening of DNA Libraries
[0148] The product of the PCR reaction which contained the
predominant 87 bp fragment was labeled with 32p by the random
priming method using the Prime-a-gene kit (Promega). This labeled
probe was used in a hybridization reaction with DNA from
approximately 3000 bacterial clones immobilized on nitrocellulose
filters. The hybridization reaction was carried out at 60 degrees
centigrade in a solution of 0.3M NaCl. A positive bacterial clone
was expanded and plasmid DNA was prepared. The plasmid contained an
insert of approximately 3.3 kb of DNA and was designated
TOXHH1.
[0149] A 120 bp fragment containing the sequences between position
292 and 410 shown in FIG. 1 was derived from the plasmid TOXHH1 and
used to screen approximately 400 colonies of the library of EcoRI
fragments. A positive clone was isolated which contained
approximately 7.3 kb of DNA sequences and was designated
TOXEE1.
[0150] The nucleotide sequence shown in FIG. 1 was derived from the
clones TOXHH1 and TOXEE1 using the Sequenase 2 sequencing kit. The
nucleotides between position 1 and 410 in FIG. 1 were derived from
TOXHH1 and those between 291 and 3507 were derived from TOXEE1. E.
coli containing plasmids TOXHH1 and TOXEE1 have been deposited with
the American Type Culture Collection, see below.
d. Preparation of Antisera Against the Cytotoxin
[0151] A DNA fragment corresponding to nucleotides 116-413 of the
sequence shown in FIG. 1 was cloned into the bacterial expression
vector pex 34 A, such that on induction of the bacterial promoter,
a fusion protein was produced which contained a part of the MS2
polymerase polypeptide fused to the amino acids of the cytotoxin
polypeptide and including the 23 amino acids previously identified.
Approximately 200 micrograms of this fusion protein were partially
purified by acrylamide gel electrophoresis and used to immunize
rabbits by standard procedures.
[0152] Antisera from these rabbits taken after 3 immunizations
spaced 1 month apart was used to probe protein extracts from a
cytotoxin positive and a cytotoxin negative strain of H. pylori in
standard immunoblotting experiments. The antisera revealed a
polypeptide which migrated on denaturing polyacrylamide gel
electrophoresis with an apparent molecular mass of 100 kDa. This
polypeptide was detected in protein extracts of the cytotoxin
positive but not the cytotoxin negative strain. Serum collected
prior to immunization did not react with this polypeptide.
e. Partial Purification of Vacuolating Activity
[0153] Total H. pylori membranes at a concentration of 6 mg/ml were
solubilized in a solution of 1% CHAPS, 0.5 M NaCl, 10 mM Hepes pH
7.4, 2.5 mM EDTA, 20% sucrose for 1 hour at 4.degree. C. This
mixture was then applied to a discontinuous sucrose gradient
containing steps of 30%, 35%, 40% and 55% sucrose and subjected to
ultracentrifugation for 17 hours at 20000.times.g. The gradient was
fractionated and each fraction was tested for vacuolating activity
and for urease activity. Vacuolating activity associated with
unease activity was found in several fractions of the gradient. A
peak of vacuolating activity was also found in the topmost
fractions of the gradient and these fractions were essentially free
of urease activity.
[0154] This urease-independent vacuolating activity was further
fractionated by stepwise precipitation with ammonium sulphate
between concentrations of 20% to 34%. Denaturing polyacrylamide gel
electrophoresis of the proteins precipitated at different
concentrations of ammonium sulfate revealed a predominant
polypeptide of about 100 kDa which co-purified with the vacuolating
activity. This polypeptide was recognised by the rabbit antisera
raised against the recombinant fusion protein described above.
2. Results
[0155] Two overlapping fragments corresponding to about 10 kbp of
the H. pylori genome have been cloned. These clones contain a gene,
consisting of 3960 bp (shown in FIG. 1) which is capable of coding
for a polypeptide of 1296 amino acids (shown in FIG. 2). The
molecular weight of this putative polypeptide is 139.8 kd. The
nucleotide sequence AGGAAG 9 bp upstream of the methionine codon at
position 18 in FIG. 1 resembles closely the consensus
Shine-Dalgarno sequence and supports the hypothesis that this
methionine represents the initiator methionine for synthesis of the
polypeptide. A 30 bp nucleotide sequence which begins 10 bp
downstream of the putative stop codon at position 3906 in FIG. 1
resembles closely the structure of prokaryotic transcription
terminators and is likely to represent the end of the messenger RNA
coding sequences.
[0156] The cytotoxin gene is defined as coding for a polypeptide
precursor of the H. pylori vacuolating activity by the following
criteria:
[0157] (i) The putative polypeptide contains the 23 amino acid
sequence (FIG. 2, positions 34-56) identified as the amino terminus
of the previously described 87 kDa vaculating protein, Clover et
al., J. Biol. Chem. 267:10570-75 (1992). This sequence is preceded
by 33 amino acids which resemble prokaryotic leader sequences;
thus, this sequence is likely to represent the amino terminus of a
mature protein;
[0158] (ii) Rabbit antisera specific for a 100 amino acid fragment
of the putative polypeptide containing the proposed amino terminus
recognized a 100 kDa polypeptide in a cytotoxin positive but not a
cytotoxin negative strain of H. pylori. This 100 kDa polypeptide
co-purifies with vacuolating activity from H. pylori membranes.
[0159] In sum, the gene described herein codes for an approximately
140 kDa polypeptide which is processed to a 100 kDa polypeptide
involved in H. pylori cytotoxic activity. The 87 kDa polypeptide
previously described must result from either further processing of
the 100 kDa polypeptide or from proteolytic degradation during
purification.
[0160] ii. H. pylori CAI Antigen
1. Materials and Methods
a. Origin of Materials
[0161] Clones A1, 64/4, G5, A17, 24 and 57/D were obtained from the
lambda gt11 library. Clone B1 was obtained from a genomic plasmid
library of HindIII fragments. 007 was obtained by PCR. The H.
pylori strains producing the cytotoxin were: G10, G27, G29, G32,
G33, G39, G56, G65, G105, G113A. The noncytotoxic strains were:
G12, G21, G25, G47, G50, G204. They were isolated from endoscopy
biopsy specimens at the Grosseto Hospital, (Tuscany, Italy). The
strain CCUG 17874 (cytotoxin positive), was obtained from the
Culture Collection of the University of Gotheborg. The noncytotoxic
strains Pylo 2U+ (urease positive) and Pylo 2U- (urease negative)
were obtained from F. Negraud, Centre Hospitalier, Bordeaux
(France). E. coli strains DH10B (Bethesda Research Laboratories),
TG1, K12 delta H1 delta trp, Y1088, Y1089, Y1090 are known in the
art. Plasmid Bluescript SK+ (Stratagene, La Jolla, Calif.) was used
as a cloning vector. The pEx34 a, b, C plasmids for the expression
of MS2 fusion proteins have been previously described. The lambda
gt11 phage vector used for the expression library is from the
lambda gt11 cloning system kit (Bethesda Research Laboratories). E.
coli strains were cultured in LB medium (24). H. pylori strains
were plated onto selective media (5% horse blood, Columbia agar
base with Dent or Skirrow's antibiotic supplement, 0.2%
cyclodextrin) or in Brucella broth liquid medium containing 5%
fetal bovine serum (6) or 0.2% cyclodextrin (25).
b. Growth of H. pylori and DNA Isolation
[0162] H. pylori strains were cultured in solid or liquid media for
3 days at 37.degree. C., both in microaerophilic atmosphere using
Oxoid (Basingstoke, England) or Becton and Dickinson (Cockeysville,
Md.) gas pack generators or in an incubator containing air
supplemented with 5% CO.sub.2, (26). The bacteria were harvested
and resuspended in STE (NaCl 0.1M, Tris-HCl 10 mM pH 8, EDTA 1 mM
pH 8) containing lysozyme at a final concentration of 100
micrograms/ml and incubated at room temperature for 5 min. To lyse
the bacteria SDS was added to a final concentration 1% and heated
at 65.degree. C. After the addition of proteinase K at final
concentration of 25 micrograms/ml the solution was incubated at
50.degree. for 2 hours. The DNA was purified by CsCl gradient in
the presence of ethidium bromide, precipitated with 77% ethanol and
recovered with a sealed glass capillary.
c. Construction and Screening of a Lambda gt11 Expression
Library
[0163] To generate the lambda gt11 expression library, genomic DNA
from the CCUG 17874 strain partially digested with the restriction
enzymes HaeIII and AluI was used. After fractionation on 0.8%
agarose gel, the DNA between 0.6 and 8 Kb in size was eluted using
a Costar Spin-X (0.22 micron) microcentrifuge filter. The products
from each digestion were combined, and used to construct the
expression library, using the lambda gt11 cloning system kit
(Bethesda Research Laboratories) and the Gigapack II Gold packaging
kit (Stratagene, La Jolla, Calif.). The library that contained
0.8-1.times.106 recombinant phages was amplified in E. coli Y1088,
obtaining 150 ml of a lysate with a titer of 109 phages/ml, 85% of
which were recombinant and had an average insert size of 900 base
pairs. Immunological screening was performed by standard
procedures, using the Protoblot system (Promega, Madison,
Wis.).
d. Construction of Plasmid Libraries
[0164] Attempts to make complete genomic libraries of partially
digested chromosomal DNA, using standard vectors such as EMBL4 or
lambda Dash encountered the difficulties described also by many
authors in cloning H. pylori DNA and failed to give satisfactory
libraries. Therefore, partial libraries were obtained using genomic
DNA from strains CCUG 17874, G39 and G50 digested with the
restriction enzyme HindIII, cloned in the Bluescript SK+. DNA
ligation, electroporation of E. coli DH 10B, screening, and library
amplification have been performed. Libraries ranging from 70000 to
85000 colonies with a background not exceeding the 10% were
obtained.
e. DNA Manipulation and Nucleotide Sequencing
[0165] DNA manipulation was performed using standard procedures.
DNA sequencing was performed using Sequenase 2.0 (USB) and the DNA
fragments shown in FIG. 3 subcloned in Bluscript KS+. Each strand
was sequenced at least three times. The region between nucleotides
1533 and 2289, for which a DNA clone was not available, was
amplified by PCR and sequenced using asymmetric PCR, and direct
sequencing of amplified products. The overlapping of this region,
was confirmed by one and double side anchored PCR: an external
universal anchor (5'-GCAAGCTTATCGATGTCGACTCGAGCT-3' (SEQ ID
NO:1)/5'-GACTCGAGTCGACATCGA-3') (SEQ ID NO:8) containing a
protruding 5' HindIII sequence, and the recognition sites of ClaI,
SalI, XhoI, was ligated to primer-extended DNA and amplified. A
second round of PCR using nested primers was then used to obtain
fragments of DNA suitable for cloning and sequencing. DNA sequence
data were assembled and analyzed with the GCG package (Genetics
Computer Group, Inc., Madison, Wis.) running on a VAX 3900 under
VMS. The GenBank and EMBL databases were examined using the EMBL
VAXcluster.
f. Protein Preparation and ELISA
[0166] Protein extracts were obtained by treating H. pylori pellets
with 6 M guanidine. Western blotting, SDS-PAGE, electroelution were
performed by standard procedures. Fusion proteins were induced and
purified by electrocution or by ion exchange chromatography.
Purified proteins were used to immunize rabbits and to coat
microtiter plates for ELISA assays. Sera from people with normal
mucosa, blood donors and patients were obtained from A. Ponzetto
(Torino, Italy) Clinical diagnosis was based on histology of
gastric biopsies. Vacuolating activity of samples was tested on
HeLa cells as described by Cover et al. Infect. Immun. 59:1264-70
(1991).
2. Results
a. Immunodominance and Cytotoxicity
[0167] Western blots of H. pylori guanidine extracts probed with
sera from patients with gastroduodenal disease showed that a
protein of 130 kDa that is a minor component in the Coomassie blue
stained gel was strongly recognized by all sera tested. The CAI
protein was electroeluted and used to raise a mouse serum that in a
Western blot recognized only this protein. This serum was then used
to detect by Western blotting the CAI protein in extracts of the H.
pylori strains. The antigen was present in the all 10 strains that
had vacuolizing activity on HeLa cells while it was absent in the
eight strains that did not have such activity; in addition, the
size of the protein varied slightly among the strains. The CAI
antigen was not detected by western blotting in the other species
tested such as Campylobacter jejuni, Helicobacter mustelae, E.
coli, and Bordetella pertussis.
b. Structure of the cai Gene
[0168] 106 clones of the lambda gt11 expression library were
screened using the mouse serum specific for the CAI antigen and
with a pool of sera from patients with gastroduodenal diseases. The
mouse serum detected positive clones at a frequency of
3.times.10-3. Sequence analysis of 8 clones revealed that they were
all partially overlapping with clone A1 shown in FIG. 3. The pool
of human sera identified many clones containing different regions
of the cai gene, including clones 57/D, 64/4 and 24 and several
clones overlapping clone A1.
[0169] In FIG. 3, clones A1, 64/4, G5, A17, 24, and 57/D were
obtained from the lambda gt11 library. Clone B1 was obtained from a
plasmid library of HindIII fragments. E. coli containing plasmids
57/D, 64/4, B1 (B/1), and P1-24 (the latter most plasmid from
nucleotide 2150 to 2650) have been deposited with the American Type
Culture Collection (ATCC), see below. 007 was obtained by PCR. The
open-reading frame is shown at the bottom of FIG. 3. Arrows
indicate the position and direction of the synthetic
oligonucleotides used as primers for sequencing, and the position
of insertion of the repeated sequence of G39 is shown. The
nucleotide and amino acid sequence of one of the repeated sequences
found in strain G39 is also shown. The capital letters indicate the
sequences D1, D2, and D3 duplicated from the cai gene, the small
letters indicate the nucleotide and amino acid linkers, P=promoter,
and T=terminator.
[0170] The nucleotide sequence of the entire region was determined
using the clones derived from the lambda gt11 library, the clone B1
isolated from the HindIII plasmid library, and the fragment 007
that was obtained by PCR of the chromosomal DNA. Computer analysis
of the 5925 nucleotide sequence revealed a long open reading frame
spanning nucleotides 535 to 3977 that was in frame with the fusion
proteins deriving from the lambda gt11 clones 64/4, 24 and A1 and
A17. Clone 57/D contained an open reading frame only in the 3' end
of cloned fragment and therefore could not make a gene fusion with
the beta galactosidase gene of lambda gt11. The presence of an
immunoreactive protein in the lambda gt11 clone 57/D could only be
explained by the presence of an endogenous promoter driving the
expression of a non fused protein. This hypothesis was proven to be
true by subcloning in both direction the insert 57/4 into the
Bluescript plasmid vector and showing that an immunoreactive
protein was obtained in both cases. A conclusive evidence that the
gene identified was indeed coding for the CAI antigen was obtained
by subcloning the inserts A17 and 64/4 in the pEx 34B plasmid
vectors to obtain fusion proteins that were purified and used to
immunize rabbits. The sera obtained, recognized specifically the
CAI antigen band in cytotoxic H. pylori strains.
[0171] The cai gene coded for a putative protein of 1147 amino
acids, with predicted molecular weight of 128012.73 Daltons and an
isoelectric point of 9.72. The basic properties of the purified
protein were confirmed by two dimensional gel electrophoresis. The
codon usage and the GC content (37%) of the gene were similar to
that described for other H. pylori genes (13, 26). A putative
ribosome binding site: AGGAG, was identified 5 base pairs upstream
from the proposed ATG starting codon. Computer search for promoter
sequences of the region upstream from the ATG start codon,
identified sequences resembling either -10 or -35 regions, however,
a region with good consensus to an E. coli promoter, or resembling
published H. pylori promoter sequences was not found. Primer
extension analysis of purified H. pylori RNA showed that 104 and
214 base pairs upstream from the ATG start codon there are two
transcriptional start sites. Canonical promoters could not be
identified upstream from either transcriptional initiation sites.
The expression of a portion of the CAI antigen by clone 57/D
suggests that E. coli is also recognizing a promoter in this
region, however, it is not clear whether E. coli recognizes the
same promoters of H. pylori or whether the H. pylori DNA that is
rich in A-T provides E. coli with regions that may act as
promoters. A rho independent terminator was identified downstream
from the stop codon. In FIG. 4, the AGGAG ribosome binding site and
terminator are underlined, and the repeated sequence and motif
containing 6 asparagines are boxed. The CAI antigen was very
hydrophilic, and did not show obvious leader peptide or
transmembrane sequences. The most hydrophilic region was from amino
acids 600 to 900, where also a number of unusual features can be
observed: the repetition of the sequences EFKNGKNKDFSK (SEQ ID
NO:9) and EPIYA (SEQ ID NO:10), and the presence of a stretch of
six contiguous asparagines (boxed in FIG. 4).
c. Diversity of the cai Gene
[0172] Diversity of the gene appears to be generated by internal
duplications. To find out the mechanism of size heterogeneity of
the CAI proteins in different strains, the structure of one of the
strains with a larger CAI protein (G39) was analyzed using Southern
blotting, PCR and DNA sequencing. The results showed that the cai
gene of G39 and CCUG 17874 were identical in size until position
3406, where the G39 strain was found to contain an insertion of 204
base pairs, made by two identical repeats of 102 base pairs. Each
repeat was found to contain sequences deriving from the duplication
of 3 segments of DNA (sequences D1 (SEQ ID NO:13), D2 (SEQ ID
NO:15) and D3 (SEQ ID NO:18) in FIG. 3) coming from the same region
of the cai gene and connected by small linker sequences. A
schematic representation of the region where the insertion occurred
and of the insertion itself is shown in FIG. 3. The nucleotide
sequence of the insertion shown (SEQ ID NO:11) has the deduced
amino acid sequence shown (SEQ ID NO:12).
d. cai Gene Absent in Noncytotoxic Strains
[0173] To investigate why the CAI antigen was absent in the
noncytotoxic strains, DNA from two of them (G50 and G21), was
digested with EcoRI, HindIII and HaeIII restriction enzymes, and
tested by Southern blotting using two probes internal to the cai
gene, spanning nucleotides 520-1840 and 2850-4331 respectively.
Both probes recognized strongly hybridizing bands in strains CCUG
17874 and G39. The bands varied in size in the two strains, in
agreement with the gene diversity. However, neither probe
hybridized the G50 and G21 DNA. This showed that the noncytotoxic
strains tested do not contain the cai gene.
e. Serum Antibodies
[0174] The presence of serum antibodies against the CAI antigen
correlated with gastroduodenal diseases. To study the quantitative
antibody response to the CAI antigen, the fusion protein produced
by the A17 fragment subcloned in pEx34 was purified to homogeneity
and used to coat microtiter plates for an ELISA test. In this
assay, the patients with gastroduodenal pathologies had an average
ELISA titer that was significantly higher than that found in
randomly selected blood donors and people with normal gastric
mucosa. To evaluate whether the antibody titer correlated with a
particular gastroduodenal disease, the sera from patients with
known histological diagnosis were tested in the ELISA assay.
Patients with duodenal ulcer had an average antibody titer
significantly higher than all the other diseases. Altogether, the
ELISA was found to be able to predict 75.3% of the patients with
any gastroduodenal disease and 100% of the patients with duodenal
ulcer.
[0175] In one particular ELISA, a recombinant protein containing
230 amino acids deriving from CAI antigen was identified by
screening an expression library of H. pylori DNA using an antiserum
specific for the protein. The recombinant antigen was expressed as
a fusion protein in E. coli, purified to homogeneity, and used to
coat microtiter plates. The plates were then incubated for 90
minutes with a 1/2000 dilution of goat anti-human IgG alkaline
phosphatase conjugate. Following washing, the enzyme substrate was
added to the plates and the optical density at 405 nm was read 30
minutes later. The cutoff level was determined by the mean
absorbance plus two standard deviations, using sera from 20
individuals that had neither gastric disease nor detectable anti-H.
pylori antibodies in Western blotting. The ELISA assay was tested
on the peripheral blood samples of eighty-two dyspeptic patients
(mean age 50.6+/-13.4 years, ranging from 28 to 80) undergoing
routine upper gastrointestinal endoscopy examination. The gastric
antral mucosa of patients was obtained for histology and Giemsa
strain. Twenty of the patients had duodenal ulcer, 5 had gastric
ulcer, 43 had chronic active gastritis type B, 8 had duodenitis and
6 had a normal histology of gastric mucosa. All of the patients
with duodenal ulcer had an optical density value above the cutoff
level. The patients with duodenitis, gastric ulcer, and chronic
gastritis, had a positive ELISA value in 75%, 80% and 53.9% of the
cases, respectively. The agreement between ELISA and histological
Giemsa staining was 95% in duodenal ulcer, 98% in duodenitis, 80%
in gastric ulcer and 55.8% in chronic gastritis. This assay gives
an excellent correlation with duodenal ulcer disease
(p<0.0005).
[0176] iii. Heat Shock Protein (hsp)
1. Materials and Methods
a. H. pylori Strains and Growth Conditions
[0177] H. pylori strains used were: CCUG 17874, G39 and G33
(isolated from gastric biopsies in the hospital of Grosseto,
Italy), Pylo 2U+ and Pylo 2U- (provided by F. Megraud, hospital
Pellegzin, Bordeaux, France), BA96 (isolated by gastric biopsies at
the University of Siena, Italy). Strain Pylo 2U+ is noncytotoxic;
strain Pylo 2U- is noncytotoxic and urease-negative. All strains
were routinely grown on Columbia agar containing 0.2% of
cyclodextrin, 5 .mu.g/ml of cefsulodin and 5 .mu.g/ml of
amphotenicin B under microaerophilic conditions for 5-6 days at
37.degree. C. Cells were harvested and washed with PBS. The pellets
were resuspended in Laemmli sample buffer and lysed by boiling.
[0178] Sera of patients affected by gastritis and ulcers (provided
by A. Ponzetto, hospital "Le Molinette", Tonino, Italy) and sera of
patients with gastric carcinoma (provided by F. Roviello,
University of Siena, Italy) were used.
b. Immunoscreening of the Library
[0179] Five hundred thousand plaques of a lambda gt11 H. pylori DNA
expression library were mixed with 5 ml of a suspension of E. coli
strain Y1090 grown O/N in LB with 0.2% Maltose and 10 mM
MgSO.sub.4, and resuspended in 10 mM MgSO.sub.4 at 0.5 O.D. After
10 minutes incubation at 37.degree. C., 75 ml of melted TopAgarose
were poured in the bacterial/phage mix and the whole was plated on
BBL plates (50,000 plaques/plate). After 3.5 hrs incubation of the
plated library at 42.degree. C., nitrocellulose filters (Schleicher
and Schuell, Dassel, Germany), previously wet with 10 mM IPTG, were
set on plates and incubation was prolonged for 3.5 hrs at
37.degree. C. and then O/N at 4.degree. C. Lifted filters with
lambda proteins were rinse in PBS, and saturated in 5% nonfat dried
milk dissolved in TBST (10 mM TRIS pH 8, 100 mM NaCl, 5M MgCl2) for
20'. The first hybridization step was performed with the sera of
patients; to develop and visualize positive plaques we used an anti
human Ig antibody alkaline phosphatase conjugated (Cappel, West
Chester, Pa.) and the NBT/BCIP kit (Promega, Madison, Wis.) in AP
buffer (100 mM Tris pH 9.5, 100 mM NaCl, 5 mM MgCl2) according to
the manufacturer instructions.
c. Recombinant DNA Procedures
[0180] Reagents and restriction enzymes used were from Sigma (St.
Louis, Mo.) and Boehringer (Mannheim, Germany). Standard techniques
were used for molecular cloning, single-stranded DNA purification,
transformation in E. coli, radioactive labeling of probes, colony
screening of the H. pylori DNA genomic library, Southern blot
analysis, PAGE and Western blot analysis.
d. DNA Sequence Analysis
[0181] The DNA fragments were subcloned in Bluescript SK+
(Stratagene, San Diego, Calif.). Single-stranded DNA sequencing was
performed by using [33P].alpha.dATP (New England Nuclear, Boston,
Mass.) and the Sequenase kit (U.S. Biochemical Corp., Cleveland,
Ohio) according to the manufacturer instructions. The sequence was
determined in both strands and each strand was sequenced, on
average, twice. Computer sequence analysis was performed using the
GCG package.
e. Recombinant Proteins
[0182] MS2 polymerase fusion proteins were produced using the
vector pEX34A, a derivative of pEX31. Insert Hp67 (from nucleotide
445 to nucleotide 1402 in FIG. 5), and the EcoRI linkers were
cloned in frame into the i EcoRI site of the vector. In order to
confirm the location of the stop codon, the HpG3' HindIII fragment
was cloned in frame into the HindIII site of pEX34A. Recombinant
plasmids were transformed in E. coli K12 H1 .DELTA.trp. In both
cases after induction, a fusion protein of the expected molecular
weight was produced. In the case of the EcoRI/EcoRI fragment, the
fusion protein obtain after induction was electroeluted to immunize
rabbits using standard protocols.
2. Results
a. Screening of an Expression Library and Cloning of H. pylori
hsp
[0183] In order to find a serum suitable for the screening of an H.
pylori DNA expression library, sonicated extracts of H. pylori
strain CCUG 17874 were tested in Western blot analysis against sera
of patients affected by different forms of gastritis. The pattern
of antigen recognition by different sera was variable, probably due
to differences in the individual immune response as well as to the
differences in the antigens expressed by the strains involved in
the infection.
[0184] Serum No 19 was selected to screen a lambda gt11 H. pylori
DNA expression library to identify H. pylori specific antigens,
expressed in vivo during bacterial growth. Following screening of
the library with this serum, many positive clones were isolated and
characterized. The nucleotide sequence of one of these, called
Hp67, revealed an open-reading frame of 958 base-pairs, coding for
a protein with high homology to the hsp60 family of heat-shock
proteins, Ellis, Nature 358:191-92 (1992). In order to obtain the
entire coding region, we used fragment Hp67 as a probe on Southern
blot analysis of H. pylori DNA digested with different restriction
enzymes. Probe Hp67 recognized two HindIII bands of approximately
800 and 1000 base-pairs, respectively. A genomic H. pylori library
of HindIII-digested DNA was screened with probe Hp67 and two
positive clones (HpG5' and HpG3') of the expected molecular weight
were obtained. E. coli containing plasmids pHp60G2 (approximately
nucleotides 1 to 829) and pHp60G5 (approximately nucleotides 824 to
1838) were deposited with the American Type Culture Collection
(ATCC).
b. Sequence Analysis
[0185] The nucleotide sequence analysis revealed an open-reading
frame of 1638 base-pairs, with a putative ribosome binding site 6
base-pairs upstream the starting ATG. FIG. 5 shows the nucleotide
and amino acid sequences of H. pylori hsp. The putative
ribosome-binding and the internal HindIII site are underlined.
Cytosine in position 445 and guanine in position 1402 are the first
and last nucleotide, respectively, in fragment Hp67. Thymine 1772
was identified as the last putative nucleotide transcribed using an
algorithm for the localization of factor-independent terminator
regions. The open-reading frame encoded for a protein of 546 amino
acids, with a predicted molecular weight of 58.3 KDa and a
predicted pI of 5.37. The codon preference of this gene is in
agreement with the H. pylori codon usage.
[0186] The analysis of the hydrophylicity profiles revealed a
protein mostly hydrophilic, without a predicted leader peptide or
other transmembrane domains. The amino terminal sequence showed
100% homology to the sequence of 30 amino acids determined by Dunn
et al., Infect. Immun. 60:1946-51 (1992) on the purified protein
and differed by only on reside (Ser42 instead of Lys) from the
sequence of 44 amino acids published by Evans et al, Infect. Immun.
60:2125-27 (1992). (Evans et al., 1992). The N-terminal sequence of
the mature hsp protein did not contain the starting methionine,
indicating that this had been removed after translation.
c. Homology with hsp60 Family
[0187] The amino acid sequence analysis showed a very strong
homology with the family of heat-shock proteins hsp60, whose
members are present in every living organism. Based on the degree
of homology between hsp60 proteins of different species, H. pylori
hsp belongs to the subgroup of hsp60 proteins of Gram negative
bacteria; however, the degree of homology to the other proteins of
the hsp60 family is very high (at least 54% identity).
d. Expression of Recombinant Proteins and Production of a
Polyclonal Antiserum
[0188] The inserts of clone Hp67 and of clone HpG3' were subcloned
in the expression vector pEX34A in order to express these
open-reading frames fused to the amino terminus of the MS2
polymerase. The clones produced recombinant proteins of the
expected size and were recognized by the human serum used for the
initial screening. The fused protein derived from clone Hp67 was
electroeluted and used to immunize rabbits in order to obtain
anti-hsp specific polyclonal antisera. The antiserum obtained
recognized both fusion proteins, and a protein of 58 KDa on
whole-cell extracts of several strains of H. pylori tested,
including a urease-negative strain and noncytotoxic strains.
[0189] Hsp has been shown to be expressed by all the H. pylori
strains tested and its expression is not associated with the
presence of the urease or with the cytotoxicity. The protein
recognized by the anti-hsp antiserum was found in the water soluble
extracts of H. pylori and co-purified with the urease subunits.
This suggests a weak association of this protein with the outer
bacterial membrane. Thus, hsp can be described as urease-associated
and surface exposed. The cellular surface localization is
surprising as most of the hsp homologous proteins are localized in
the cytoplasm or in mitochondria and plastids. The absence of a
leader peptide in hsp suggests that this is either exported to the
membrane by a peculiar export system, or that the protein is
released from the cytoplasm and is passively adsorbed by the
bacterial membrane after death of the bacterium.
[0190] Hsp60 proteins have been shown to act as molecular chaperons
assisting the correct folding, assembly and translocation of either
oligomeric or multimeric proteins. The cellular localization of H.
pylori hsp and its weak association with urease suggest that hsp
may play a role in assisting the folding and/or assembly of
proteins exposed on the membrane surface and composed of multiple
subunits such as the urease, whose final quaternary structure is
A6B6. Austin et al., J. Bacteriol. 174:7470-73 (1992) showed that
the H. pylori hsp ultrastructure is composed of seven subunits
assembled in a disk-shaped particle that further stack side by side
in groups of four. This structure resembles the shape and dimension
of the urease macromolecule and this could explain the common
properties of these two macromolecules that lead to their
co-purification. H. pylori hsp gene, however, is not part of the
urease operon. In agreement with the gene structure of other
bacterial hsp60 proteins, it should be part of a dicistronic
operon.
e. Presence of Anti-hsp Antibodies in Patients with Gastroduodenal
Diseases
[0191] The purified fusion protein was tested by Western blot using
sera of patients infected by H. pylori and affected by atrophic and
superficial gastritis, and patients with duodenal and gastric
ulcers: most of the sera recognized the recombinant protein.
However, the degree of recognition greatly varied between different
individuals and the antibody levels did not show any obvious
correlation with the type of disease. In addition, antibodies
against H. pylori antigens and in particular against hsp protein
were found in most of the 12 sera of patients affected by gastric
carcinoma that were tested. Although H. pylori hsp recognition
could not be put in relation with a particular clinical state of
the disease given the high conservation between H. pylori hsp and
its human homolog, it is possible that this protein may induce
autoimmune antibodies cross-reacting with the human counterpart.
This class of homologous proteins has been implicated in the
induction of autoimmune disorders in different systems. The
presence of high titers of anti-H. pylori hsp antibodies,
potentially cross-reacting with the human homolog in dispeptic
patients, suggests that this protein has a role in gastroduodenal
disease. This autoreactivity could play a role in the tissue damage
that occurs in H. pylori-induced gastritis, thus increasing the
pathogenic mechanisms involved in the infection of this
bacterium.
[0192] The high levels of antibodies against such a conserved
protein is somewhat unusual; due to the high homology between
members of the hsp60 family, including the human one, this protein
should be very well tolerated by the host immune system. The strong
immune response observed in many patients may be explained in two
different ways: (1) the immune response is directed only against
epitopes specific for H. pylori hsp; (2) the immune response is
directed against epitopes which are in common between H. pylori hsp
and human homolog.
H. Deposit of Biological Materials
[0193] The following materials were deposited on Dec. 15, 1992 and
Jan. 22, 1993 by Bioscine Sclavo, S.p.A. with the American Type
Culture Collection (ATCC), 10801 University Boulevard, Manassas,
Va. 20110-2209, phone (703) 365-2700, under the terms of the
Budapest Treaty on the International Recognition of the Deposit of
Microorganisms for Purposes of Patent Procedure. For the cytotoxin
protein (CT):
[0194] ATCC No.: 69157 E. coli TG1 containing the plasmid
TOXHH1
[0195] ATCC No.: n/a E. coli TG1 containing the plasmid TOXEE1
[0196] For the CAI protein:
[0197] ATCC No. 69158 E. coli TG1 containing the plasmid 57/D
[0198] ATCC No. 69159 E. coli TG1 containing the plasmid 64/4
[0199] ATCC No. 69160 E. coli TG1 containing the plasmid P1-24
[0200] ATCC No. 69161 E. coli TG1 containing the plasmid B/1
[0201] For the heat shock protein (hsp):
[0202] ATCC No. 69155 E. coli TG1 containing the plasmid
pHp60G2
[0203] ATCC No. 69156 E. coli TG1 containing the plasmid
pHp605.
[0204] These deposits are provided as convenience to those of skill
in the art, and are not an admission that a deposit is required
under 35 U.S.C. 112. The nucleic acid sequences of these deposits,
as well as the amino acid sequences of the polypeptides encoded
thereby, are incorporated herein by reference and should be
referred to in the event of any error in the sequences described
herein as compared with the sequences of the deposits. A license
may be required to make, use, or sell the deposited materials, and
no such license is granted hereby.
Sequence CWU 1
1
30 1 27 DNA Artificial Sequence primer oligonucleotide 1 gcaagcttat
cgatgtcgac tcgagct 27 2 3960 DNA Helicobacter pylori 2 aaaaagaaag
gaagaaaatg gaaatacaac aaacacaccg caaaatcaat cgccctctgg 60
tttctctcgc tttagtagga gcattagtca gcatcacacc gcaacaaagt catgccgcct
120 ttttcacaac cgtgatcatt ccagccattg ttgggggtat cgctacaggc
accgctgtag 180 gaacggtctc agggcttctt agctgggggc tcaaacaagc
cgaagaagcc aataaaaccc 240 cagataaacc cgataaagtt tggcgcattc
aagcaggaaa aggctttaat gaattcccta 300 acaaggaata cgacttatac
agatcccttt tatccagtaa gattgatgga ggttgggatt 360 gggggaatgc
cgctaggcat tattgggtca aaggcgggca acagaataag cttgaagtgg 420
atatgaaaga cgctgtaggg acttatacct tatcagggct tagaaacttt actggtgggg
480 atttagatgt caatatgcaa aaagccactt tacgcttggg ccaattcaat
ggcaattctt 540 ttacaagcta taaggatagt gctgatcgca ccacgagagt
ggatttcaac gctaaaaata 600 tctcaattga taattttgta gaaatcaaca
atcgtgtggg ttctggagcc gggaggaaag 660 ccagctctac ggttttgact
ttgcaagctt cagaagggat cactagcgat aaaaacgctg 720 aaatttctct
ttatgatggt gccacgctca atttggcttc aagcagcgtt aaattaatgg 780
gtaatgtgtg gatgggccgt ttgcaatacg tgggagcgta tttggcccct tcatacagca
840 cgataaacac ttcaaaagta acaggggaag tgaattttaa ccacctcact
gttggcgata 900 aaaacgccgc tcaagcgggc attatcgcta ataaaaagac
taatattggc acactggatt 960 tgtggcaaag cgccgggtta aacattatcg
ctcctccaga aggtggctat aaggataaac 1020 ccaataatac cccttctcaa
agtggtgcta aaaacgacaa aaatgaaagc gctaaaaacg 1080 acaaacaaga
gagcagtcaa aataatagta acactcaggt cattaaccca cccaatagtg 1140
cgcaaaaaac agaagttcaa cccacgcaag tcattgatgg gccttttgcg ggcggcaaag
1200 acacggttgt caatatcaac cgcatcaaca ctaacgctga tggcacgatt
agagtgggag 1260 ggtttaaagc ttctcttacc accaatgcgg ctcatttgca
tatcggcaaa ggcggtgtca 1320 atctgtccaa tcaagcgagc gggcgctctc
ttatagtgga aaatctaact gggaatatca 1380 ccgttgatgg gcctttaaga
gtgaataatc aagtgggtgg ctatgctttg gcaggatcaa 1440 gcgcgaattt
tgagtttaag gctggtacgg ataccaaaaa cggcacagcc acttttaata 1500
acgatattag tctgggaaga tttgtgaatt taaaggtgga tgctcataca gctaatttta
1560 aaggtattga tacgggtaat ggtggtttca acaccttaga ttttagtggc
gttacagaca 1620 aagtcaatat caacaagctc attacggctt ccactaatgt
ggccgttaaa aacttcaaca 1680 ttaatgaatt gattgttaaa accaatggga
taagtgtggg ggaatatact cattttagcg 1740 aagatatagg cagtcaatcg
cgcatcaata ccgtgcgttt ggaaactggc actaggtcac 1800 ttttctctgg
gggtgttaaa tttaaaggtg gcgaaaaatt ggttatagat gagttttact 1860
atagcccttg gaattatttt gacgctagaa atattaaaaa tgttgaaatc accaataaac
1920 ttgcttttgg acctcaagga agtccttggg gcacatcaaa acttatgttc
aataatctaa 1980 ccctaggtca aaatgcggtc atggattata gccaattttc
aaatttaacc attcaagggg 2040 atttcatcaa caatcaaggc actatcaact
atctggtccg aggtgggaaa gtggcaacct 2100 taagcgtagg caatgcagca
gctatgatgt ttaataatga tatagacagc gcgaccggat 2160 tttacaaacc
gctcatcaag attaacagcg ctcaagatct cattaaaaat acagaacatg 2220
ttttattgaa agcgaaaatc attggttatg gtaatgtttc tacaggtacc aatggcatta
2280 gtaatgttaa tctagaagag caattcaaag agcgcctagc cctttataac
aacaataacc 2340 gcatggatac ttgtgtggtg cgaaatactg atgacattaa
agcatgcggt atggctatcg 2400 gcgatcaaag catggtgaac aaccctgaca
attacaagta tcttatcggt aaggcatgga 2460 aaaatatagg gatcagcaaa
acagctaatg gctctaaaat ttcggtgtat tatttaggca 2520 attctacgcc
tactgagaat ggtggcaata ccacaaattt acccacaaac accactagca 2580
atgcacgttc tgccaacaac gcccttgcac aaaacgctcc tttcgctcaa cctagtgcta
2640 ctcctaattt agtcgctatc aatcagcatg attttggcac tattgaaagc
gtgtttgaat 2700 tggctaaccg ctctaaagat attgacacgc tttatgctaa
ctcaggcgct caaggcaggg 2760 atctcttaca aaccttattg attgatagcc
atgatgcggg ttatgccaga aaaatgattg 2820 atgctacaag cgctaatgaa
atcaccaagc aattgaatac ggccactacc actttaaaca 2880 acatagccag
tttagagcat aaaaccagcg gcttacaaac tttgagcttg agtaatgcga 2940
tgattttaaa ttctcgttta gtcaatctct ccaggagaca caccaaccat attgactcgt
3000 tcgccaaacg cttacaagct ttaaaagacc aaaaattcgc ttctttagaa
agcgcggcag 3060 aagtgttgta tcaatttgcc cctaaatatg aaaaacctac
caatgtttgg gctaacgcta 3120 ttgggggaac gagcttgaat aatggctcta
acgcttcatt gtatggcaca agcgcgggcg 3180 tagacgctta ccttaacggg
caagtggaag ccattgtggg cggttttgga agctatggtt 3240 atagctcttt
taataatcgt gcgaactccc ttaactctgg ggccaataac actaattttg 3300
gcgtgtatag ccgtattttt gccaaccagc atgaatttga ctttgaagct caaggggcac
3360 tagggagcga tcaatcaagc ttgaatttca aaagcgctct attacaagat
ttgaatcaaa 3420 gctatcatta cttagcctat agcgctgcaa caagagcgag
ctatggttat gacttcgcgt 3480 tttttaggaa cgctttagtg ttaaaaccaa
gcgtgggtgt gagctataac catttaggtt 3540 caaccaactt taaaagcaac
agcaccaatc aagtggcttt gaaaaatggc tctagcagtc 3600 agcatttatt
caacgctagc gctaatgtgg aagcgcgcta ttattatggg gacacttcat 3660
acttctacat gaatgctgga gttttacaag agttcgctca tgttggctct aataacgccg
3720 cgtctttaaa cacctttaaa gtgaatgccg ctcgcaaccc tttaaatacc
catgccagag 3780 tgatgatggg tggggaatta aaattagcta aagaagtgtt
tttgaatttg ggcgttgttt 3840 atttgcacaa tttgatttcc aatataggcc
atttcgcttc caatttagga atgaggtata 3900 gtttctaaat accgctctta
aacccatgct caaagcatgg gtttgaaatc ttacaaaaca 3960 3 1296 PRT
Helicobacter pylori 3 Met Glu Ile Gln Gln Thr His Arg Lys Ile Asn
Arg Pro Leu Val Ser 1 5 10 15 Leu Ala Leu Val Gly Ala Leu Val Ser
Ile Thr Pro Gln Gln Ser His 20 25 30 Ala Ala Phe Phe Thr Thr Val
Ile Ile Pro Ala Ile Val Gly Gly Ile 35 40 45 Ala Thr Gly Thr Ala
Val Gly Thr Val Ser Gly Leu Leu Ser Trp Gly 50 55 60 Leu Lys Gln
Ala Glu Glu Ala Asn Lys Thr Pro Asp Lys Pro Asp Lys 65 70 75 80 Val
Trp Arg Ile Gln Ala Gly Lys Gly Phe Asn Glu Phe Pro Asn Lys 85 90
95 Glu Tyr Asp Leu Tyr Arg Ser Leu Leu Ser Ser Lys Ile Asp Gly Gly
100 105 110 Trp Asp Trp Gly Asn Ala Ala Arg His Tyr Trp Val Lys Gly
Gly Gln 115 120 125 Gln Asn Lys Leu Glu Val Asp Met Lys Asp Ala Val
Gly Thr Tyr Thr 130 135 140 Leu Ser Gly Leu Arg Asn Phe Thr Gly Gly
Asp Leu Asp Val Asn Met 145 150 155 160 Gln Lys Ala Thr Leu Arg Leu
Gly Gln Phe Asn Gly Asn Ser Phe Thr 165 170 175 Ser Tyr Lys Asp Ser
Ala Asp Arg Thr Thr Arg Val Asp Phe Asn Ala 180 185 190 Lys Asn Ile
Ser Ile Asp Asn Phe Val Glu Ile Asn Asn Arg Val Gly 195 200 205 Ser
Gly Ala Gly Arg Lys Ala Ser Ser Thr Val Leu Thr Leu Gln Ala 210 215
220 Ser Glu Gly Ile Thr Ser Asp Lys Asn Ala Glu Ile Ser Leu Tyr Asp
225 230 235 240 Gly Ala Thr Leu Asn Leu Ala Ser Ser Ser Val Lys Leu
Met Gly Asn 245 250 255 Val Trp Met Gly Arg Leu Gln Tyr Val Gly Ala
Tyr Leu Ala Pro Ser 260 265 270 Tyr Ser Thr Ile Asn Thr Ser Lys Val
Thr Gly Glu Val Asn Phe Asn 275 280 285 His Leu Thr Val Gly Asp Lys
Asn Ala Ala Gln Ala Gly Ile Ile Ala 290 295 300 Asn Lys Lys Thr Asn
Ile Gly Thr Leu Asp Leu Trp Gln Ser Ala Gly 305 310 315 320 Leu Asn
Ile Ile Ala Pro Pro Glu Gly Gly Tyr Lys Asp Lys Pro Asn 325 330 335
Asn Thr Pro Ser Gln Ser Gly Ala Lys Asn Asp Lys Asn Glu Ser Ala 340
345 350 Lys Asn Asp Lys Gln Glu Ser Ser Gln Asn Asn Ser Asn Thr Gln
Val 355 360 365 Ile Asn Pro Pro Asn Ser Ala Gln Lys Thr Glu Val Gln
Pro Thr Gln 370 375 380 Val Ile Asp Gly Pro Phe Ala Gly Gly Lys Asp
Thr Val Val Asn Ile 385 390 395 400 Asn Arg Ile Asn Thr Asn Ala Asp
Gly Thr Ile Arg Val Gly Gly Phe 405 410 415 Lys Ala Ser Leu Thr Thr
Asn Ala Ala His Leu His Ile Gly Lys Gly 420 425 430 Gly Val Asn Leu
Ser Asn Gln Ala Ser Gly Arg Ser Leu Ile Val Glu 435 440 445 Asn Leu
Thr Gly Asn Ile Thr Val Asp Gly Pro Leu Arg Val Asn Asn 450 455 460
Gln Val Gly Gly Tyr Ala Leu Ala Gly Ser Ser Ala Asn Phe Glu Phe 465
470 475 480 Lys Ala Gly Thr Asp Thr Lys Asn Gly Thr Ala Thr Phe Asn
Asn Asp 485 490 495 Ile Ser Leu Gly Arg Phe Val Asn Leu Lys Val Asp
Ala His Thr Ala 500 505 510 Asn Phe Lys Gly Ile Asp Thr Gly Asn Gly
Gly Phe Asn Thr Leu Asp 515 520 525 Phe Ser Gly Val Thr Asp Lys Val
Asn Ile Asn Lys Leu Ile Thr Ala 530 535 540 Ser Thr Asn Val Ala Val
Lys Asn Phe Asn Ile Asn Glu Leu Ile Val 545 550 555 560 Lys Thr Asn
Gly Ile Ser Val Gly Glu Tyr Thr His Phe Ser Glu Asp 565 570 575 Ile
Gly Ser Gln Ser Arg Ile Asn Thr Val Arg Leu Glu Thr Gly Thr 580 585
590 Arg Ser Leu Phe Ser Gly Gly Val Lys Phe Lys Gly Gly Glu Lys Leu
595 600 605 Val Ile Asp Glu Phe Tyr Tyr Ser Pro Trp Asn Tyr Phe Asp
Ala Arg 610 615 620 Asn Ile Lys Asn Val Glu Ile Thr Asn Lys Leu Ala
Phe Gly Pro Gln 625 630 635 640 Gly Ser Pro Trp Gly Thr Ser Lys Leu
Met Phe Asn Asn Leu Thr Leu 645 650 655 Gly Gln Asn Ala Val Met Asp
Tyr Ser Gln Phe Ser Asn Leu Thr Ile 660 665 670 Gln Gly Asp Phe Ile
Asn Asn Gln Gly Thr Ile Asn Tyr Leu Val Arg 675 680 685 Gly Gly Lys
Val Ala Thr Leu Ser Val Gly Asn Ala Ala Ala Met Met 690 695 700 Phe
Asn Asn Asp Ile Asp Ser Ala Thr Gly Phe Tyr Lys Pro Leu Ile 705 710
715 720 Lys Ile Asn Ser Ala Gln Asp Leu Ile Lys Asn Thr Glu His Val
Leu 725 730 735 Leu Lys Ala Lys Ile Ile Gly Tyr Gly Asn Val Ser Thr
Gly Thr Asn 740 745 750 Gly Ile Ser Asn Val Asn Leu Glu Glu Gln Phe
Lys Glu Arg Leu Ala 755 760 765 Leu Tyr Asn Asn Asn Asn Arg Met Asp
Thr Cys Val Val Arg Asn Thr 770 775 780 Asp Asp Ile Lys Ala Cys Gly
Met Ala Ile Gly Asp Gln Ser Met Val 785 790 795 800 Asn Asn Pro Asp
Asn Tyr Lys Tyr Leu Ile Gly Lys Ala Trp Lys Asn 805 810 815 Ile Gly
Ile Ser Lys Thr Ala Asn Gly Ser Lys Ile Ser Val Tyr Tyr 820 825 830
Leu Gly Asn Ser Thr Pro Thr Glu Asn Gly Gly Asn Thr Thr Asn Leu 835
840 845 Pro Thr Asn Thr Thr Ser Asn Ala Arg Ser Ala Asn Asn Ala Leu
Ala 850 855 860 Gln Asn Ala Pro Phe Ala Gln Pro Ser Ala Thr Pro Asn
Leu Val Ala 865 870 875 880 Ile Asn Gln His Asp Phe Gly Thr Ile Glu
Ser Val Phe Glu Leu Ala 885 890 895 Asn Arg Ser Lys Asp Ile Asp Thr
Leu Tyr Ala Asn Ser Gly Ala Gln 900 905 910 Gly Arg Asp Leu Leu Gln
Thr Leu Leu Ile Asp Ser His Asp Ala Gly 915 920 925 Tyr Ala Arg Lys
Met Ile Asp Ala Thr Ser Ala Asn Glu Ile Thr Lys 930 935 940 Gln Leu
Asn Thr Ala Thr Thr Thr Leu Asn Asn Ile Ala Ser Leu Glu 945 950 955
960 His Lys Thr Ser Gly Leu Gln Thr Leu Ser Leu Ser Asn Ala Met Ile
965 970 975 Leu Asn Ser Arg Leu Val Asn Leu Ser Arg Arg His Thr Asn
His Ile 980 985 990 Asp Ser Phe Ala Lys Arg Leu Gln Ala Leu Lys Asp
Gln Lys Phe Ala 995 1000 1005 Ser Leu Glu Ser Ala Ala Glu Val Leu
Tyr Gln Phe Ala Pro Lys 1010 1015 1020 Tyr Glu Lys Pro Thr Asn Val
Trp Ala Asn Ala Ile Gly Gly Thr 1025 1030 1035 Ser Leu Asn Asn Gly
Ser Asn Ala Ser Leu Tyr Gly Thr Ser Ala 1040 1045 1050 Gly Val Asp
Ala Tyr Leu Asn Gly Gln Val Glu Ala Ile Val Gly 1055 1060 1065 Gly
Phe Gly Ser Tyr Gly Tyr Ser Ser Phe Asn Asn Arg Ala Asn 1070 1075
1080 Ser Leu Asn Ser Gly Ala Asn Asn Thr Asn Phe Gly Val Tyr Ser
1085 1090 1095 Arg Ile Phe Ala Asn Gln His Glu Phe Asp Phe Glu Ala
Gln Gly 1100 1105 1110 Ala Leu Gly Ser Asp Gln Ser Ser Leu Asn Phe
Lys Ser Ala Leu 1115 1120 1125 Leu Gln Asp Leu Asn Gln Ser Tyr His
Tyr Leu Ala Tyr Ser Ala 1130 1135 1140 Ala Thr Arg Ala Ser Tyr Gly
Tyr Asp Phe Ala Phe Phe Arg Asn 1145 1150 1155 Ala Leu Val Leu Lys
Pro Ser Val Gly Val Ser Tyr Asn His Leu 1160 1165 1170 Gly Ser Thr
Asn Phe Lys Ser Asn Ser Thr Asn Gln Val Ala Leu 1175 1180 1185 Lys
Asn Gly Ser Ser Ser Gln His Leu Phe Asn Ala Ser Ala Asn 1190 1195
1200 Val Glu Ala Arg Tyr Tyr Tyr Gly Asp Thr Ser Tyr Phe Tyr Met
1205 1210 1215 Asn Ala Gly Val Leu Gln Glu Phe Ala His Val Gly Ser
Asn Asn 1220 1225 1230 Ala Ala Ser Leu Asn Thr Phe Lys Val Asn Ala
Ala Arg Asn Pro 1235 1240 1245 Leu Asn Thr His Ala Arg Val Met Met
Gly Gly Glu Leu Lys Leu 1250 1255 1260 Ala Lys Glu Val Phe Leu Asn
Leu Gly Val Val Tyr Leu His Asn 1265 1270 1275 Leu Ile Ser Asn Ile
Gly His Phe Ala Ser Asn Leu Gly Met Arg 1280 1285 1290 Tyr Ser Phe
1295 4 5925 DNA Helicobacter pylori 4 ctccatttta agcaactcca
tagaccacta aagaaacttt ttttgaggct atctttgaaa 60 atctgtccta
ttgatttgtt ttccattttg tttcccatgt ggatcttgtg gatcacaaac 120
gcttaattat acatgctata gtaagcatga cacacaaacc aaactatttt tagaacgctt
180 catgtgctca ccttgactaa ccatttctcc aaccatactt tagcgttgca
tttgatttct 240 tcaaaaagat tcatttctta tttcttgttc ttattaaagt
tctttcattt tagcaaattt 300 ttgttaattg tgggtaaaaa tgtgaatcgt
cctagccttt agacgcctgc aacgatcggg 360 cttttttcaa tattaataat
gattaatgaa aaaaaaaaaa aatgcttgat attgttgtat 420 aatgagaatg
ttcaaagaca tgaattgact actcaagcgt gtagcgattt ttagcagtct 480
ttgacactaa caagataccg ataggtatga aactaggtat agtaaggaga aacaatgact
540 aacgaaacca ttgaccaaca accacaaacc gaagcggctt ttaacccgca
gcaatttatc 600 aataatcttc aagtagcttt tcttaaagtt gataacgctg
tcgcttcata cgatcctgat 660 caaaaaccaa tcgttgataa gaacgatagg
gataacaggc aagcttttga aggaatctcg 720 caattaaggg aagaatactc
caataaagcg atcaaaaatc ctaccaaaaa gaatcagtat 780 ttttcagact
ttatcaataa gagcaatgat ttaatcaaca aagacaatct cattgatgta 840
gaatcttcca caaagagctt tcagaaattt ggggatcagc gttaccgaat tttcacaagt
900 tgggtgtccc atcaaaacga tccgtctaaa atcaacaccc gatcgatccg
aaattttatg 960 gaaaatatca tacaaccccc tatccttgat gataaagaga
aagcggagtt tttgaaatct 1020 gccaaacaat cttttgcagg aatcattata
gggaatcaaa tccgaacgga tcaaaagttc 1080 atgggcgtgt ttgatgagtc
cttgaaagaa aggcaagaag cagaaaaaaa tggagagcct 1140 actggtgggg
attggttgga tatttttctc tcatttatat ttgacaaaaa acaatcttct 1200
gatgtcaaag aagcaatcaa tcaagaacca gttccccatg tccaaccaga tatagccact
1260 accaccaccg acatacaagg cttaccgcct gaagctagag atttacttga
tgaaaggggt 1320 aatttttcta aattcactct tggcgatatg gaaatgttag
atgttgaggg agtcgctgac 1380 attgatccca attacaagtt caatcaatta
ttgattcaca ataacgctct gtcttctgtg 1440 ttaatgggga gtcataatgg
catagaacct gaaaaagttt cattgttgta tgggggcaat 1500 ggtggtcctg
gagctaggca tgattggaac gccaccgttg gttataaaga ccaacaaggc 1560
aacaatgtgg ctacaataat taatgtgcat atgaaaaacg gcagtggctt agtcatagca
1620 ggtggtgaga aagggattaa caaccctagt ttttatctct acaaagaaga
ccaactcaca 1680 ggctcacaac gagcattaag tcaagaagag atccaaaaca
aaatagattt catggaattt 1740 cttgcacaaa ataatgctaa attagacaac
ttgagcgaga aagagaagga aaaattccga 1800 actgagatta aagatttcca
aaaagactct aaggcttatt tagacgccct agggaatgat 1860 cgtattgctt
ttgtttctaa aaaagacaca aaacattcag ctttaattac tgagtttggt 1920
aatggggatt tgagctacac tctcaaagat tatgggaaaa aagcagataa agctttagat
1980 agggagaaaa atgttactct tcaaggtagc ctaaaacatg atggcgtgat
gtttgttgat 2040 tattctaatt tcaaatacac caacgcctcc aagaatccca
ataagggtgt aggcgttacg 2100 aatggcgttt cccatttaga agtaggcttt
aacaaggtag ctatctttaa tttgcctgat 2160 ttaaataatc tcgctatcac
tagtttcgta aggcggaatt tagaggataa actaaccact 2220 aaaggattgt
ccccacaaga agctaataag cttatcaaag attttttgag cagcaacaaa 2280
gaattggttg gaaaaacttt aaacttcaat aaagctgtag ctgacgctaa aaacacaggc
2340 aattatgatg aagtgaaaaa agctcagaaa gatcttgaaa aatctctaag
gaaacgagag 2400 catttagaga aagaagtaga gaaaaaattg gagagcaaaa
gcggcaacaa aaataaaatg 2460 gaagcaaaag ctcaagctaa cagccaaaaa
gatgagattt ttgcgttgat caataaagag 2520 gctaatagag acgcaagagc
aatcgcttac gctcagaatc ttaaaggcat caaaagggaa 2580 ttgtctgata
aacttgaaaa tgtcaacaag aatttgaaag actttgataa atcttttgat 2640
gaattcaaaa atggcaaaaa taaggatttc agcaaggcag aagaaacact aaaagccctt
2700 aaaggttcgg tgaaagattt aggtatcaat ccagaatgga tttcaaaagt
tgaaaacctt 2760 aatgcagctt tgaatgaatt caaaaatggc aaaaataagg
atttcagcaa ggtaacgcaa 2820 gcaaaaagcg accttgaaaa ttccgttaaa
gatgtgatca tcaatcaaaa ggtaacggat 2880 aaagttgata atctcaatca
agcggtatca gtggctaaag caacgggtga tttcagtagg 2940 gtagagcaag
cgttagccga tctcaaaaat ttctcaaagg agcaattggc ccaacaagct 3000
caaaaaaatg aaagtctcaa tgctagaaaa aaatctgaaa tatatcaatc cgttaagaat
3060 ggtgtgaatg gaaccctagt cggtaatggg ttatctcaag cagaagccac
aactctttct 3120 aaaaactttt cggacatcaa gaaagagttg aatgcaaaac
ttggaaattt caataacaat 3180 aacaataatg gactcaaaaa cgaacccatt
tatgctaaag ttaataaaaa gaaagcaggg 3240 caagcagcta gccttgaaga
acccatttac gctcaagttg ctaaaaaggt aaatgcaaaa 3300 attgaccgac
tcaatcaaat agcaagtggt ttgggtgttg tagggcaagc agcgggcttc 3360
cctttgaaaa ggcatgataa agttgatgat ctcagtaagg tagggctttc aaggaatcaa
3420 gaattggctc agaaaattga caatctcaat caagcggtat cagaagctaa
agcaggtttt 3480 tttggcaatc tagagcaaac gatagacaag ctcaaagatt
ctacaaaaca caatcccatg 3540 aatctatggg ttgaaagtgc aaaaaaagta
cctgctagtt tgtcagcgaa actagacaat 3600 tacgctacta acagccacat
acgcattaat agcaatatca aaaatggagc aatcaatgaa 3660 aaagcgaccg
gcatgctaac gcaaaaaaac cctgagtggc tcaagctcgt gaatgataag 3720
atagttgcgc ataatgtagg aagcgttcct ttgtcagagt atgataaaat tggcttcaac
3780 cagaagaata tgaaagatta ttctgattcg ttcaagtttt ccaccaagtt
gaacaatgct 3840 gtaaaagaca ctaattctgg ctttacgcaa tttttaacca
atgcattttc tacagcatct 3900 tattactgct tggcgagaga aaatgcggag
catggaatca agaacgttaa tacaaaaggt 3960 ggtttccaaa aatcttaaag
gattaaggaa taccaaaaac gcaaaaacca ccccttgcta 4020 aaagcgaggg
gttttttaat actccttagc agaaatccca atcgtcttta gtatttggga 4080
tgaatgctac caattcatgg tatcatatcc ccatacattc gtatctagcg taggaagtgt
4140 gcaaagttac gcctttggag atatgatgtg tgagacctgt agggaatgcg
ttggagctca 4200 aactctgtaa aatccctatt atagggacac agagtgagaa
ccaaactctc cctacgggca 4260 acatcagcct aggaagccca atcgtcttta
gcggttgggc acttcacctt aaaatatccc 4320 gacagacact aacgaaaggc
tttgttcttt aaagtctgca tggatatttc ctaccccaaa 4380 aagacttaac
cctttgctta aaattaagtt tgattgtgct agtgggttcg tgctatagtg 4440
cgaaaattaa ttaagggtta taaagagagc ataaactaga aaaaacaagt agctataaca
4500 aagatcaagt tcaaaaaatc atagagcttt tagagcaaat tgatcgcgct
cttaaccaaa 4560 gaaaaatcag aaaaaccata ggaattatca caccttataa
tgcccaaaaa agacgcttgc 4620 gatcagaagt ggaaaaatac ggcttcaaga
attttgatga gctcaaaata gacactgtgg 4680 atgcctttca aggtgaagag
gcagatatta ttatttattc caccgtgaaa acttgtggta 4740 atctttcttt
cttgctagat tctaaacgct tgaatgtggc tatttctagg gcaaaagaaa 4800
atctcatttt tgtgggtaaa aagtctttct ttgagaattt atgaagcgat gagaagaata
4860 tctttagcgc tattttgcaa gtctgtagat aggtaatctt ttccaaagat
aatcattaga 4920 cattcttcgc ttcaaaacgc tttcataaat ctctctaaag
cgctttataa tcaacacaat 4980 acccttatag tgtgagctat agcccctttt
tgggaattga gttattttga ctttaaattt 5040 ttattagcgt tacaatttga
gccattcttt agcttgtttt tctagccaga tcacatcgcc 5100 gctcgcatga
aattccactt tagggaatgc gtgtgcattt tttttaaggg cgtatttttg 5160
ctgcaaatat cctacaatag catcgcccga atggatgagt agggggggtg ttgaaagggc
5220 aaaatgctcc ataaaatagc cctcaatttt ttgagcgatt aagggaaaat
gcgtgcaacc 5280 taaaataatc acttcgggaa aatctttaag ggagtgaaat
aataacgcat gcaagtttct 5340 aacaattcgc cctctaaaat actttcttca
atcaaaggca caaaaagaga agtggctaaa 5400 tgcgaaacat tcaaatagcc
ttgttgtttc agggcattgt cataagcgtt ggattggatc 5460 gtcgcttttg
tccctagcac taaaataggg gcgtttttat cttttacttg tcgcttgatc 5520
gctaaaatgc ttggctcaat cacgcccaca atagggattt tggaatgctt ttgcatctct
5580 tctaaagcta gagcgctcgc tgtgttgcat gccacaatca ataattcaat
ctggtgcggt 5640 ttgaaaaaat ccaaagcctc taagccaaat tgcttgatcg
tagtggggtc tttagtgcca 5700 taaggcactc tagccgtatc gccataatag
atgatttcat caaataattg cgcttttaaa 5760 aggcttttta aaacgctaaa
ccctcccaca ccgctatcaa aaacgcctat tttcatgaca 5820 cttttttaat
ttaatgggat taattaggga ttttattttt cattcattaa gtttaaaaat 5880
tcttcattgt ccttagtttg ttgcatttta gaatagacaa agctt 5925 5 1147 PRT
Helicobacter pylori 5 Met Thr Asn Glu Thr Ile Asp Gln Gln Pro Gln
Thr Glu Ala Ala Phe 1 5 10 15 Asn Pro Gln Gln Phe Ile Asn Asn Leu
Gln Val Ala Phe Leu Lys Val 20 25 30 Asp Asn Ala Val Ala Ser Tyr
Asp Pro Asp Gln Lys Pro Ile Val Asp 35 40 45 Lys Asn Asp Arg Asp
Asn Arg Gln Ala Phe Glu Gly Ile Ser Gln Leu 50 55 60 Arg Glu Glu
Tyr Ser Asn Lys Ala Ile Lys Asn Pro Thr Lys Lys Asn 65 70 75 80 Gln
Tyr Phe Ser Asp Phe Ile Asn Lys Ser Asn Asp Leu Ile Asn Lys 85 90
95 Asp Asn Leu Ile Asp Val Glu Ser Ser Thr Lys Ser Phe Gln Lys Phe
100 105 110 Gly Asp Gln Arg Tyr Arg Ile Phe Thr Ser Trp Val Ser His
Gln Asn 115 120 125 Asp Pro Ser Lys Ile Asn Thr Arg Ser Ile Arg Asn
Phe Met Glu Asn 130 135 140 Ile Ile Gln Pro Pro Ile Leu Asp Asp Lys
Glu Lys Ala Glu Phe Leu 145 150 155 160 Lys Ser Ala Lys Gln Ser Phe
Ala Gly Ile Ile Ile Gly Asn Gln Ile 165 170 175 Arg Thr Asp Gln Lys
Phe Met Gly Val Phe Asp Glu Ser Leu Lys Glu 180 185 190 Arg Gln Glu
Ala Glu Lys Asn Gly Glu Pro Thr Gly Gly Asp Trp Leu 195 200 205 Asp
Ile Phe Leu Ser Phe Ile Phe Asp Lys Lys Gln Ser Ser Asp Val 210 215
220 Lys Glu Ala Ile Asn Gln Glu Pro Val Pro His Val Gln Pro Asp Ile
225 230 235 240 Ala Thr Thr Thr Thr Asp Ile Gln Gly Leu Pro Pro Glu
Ala Arg Asp 245 250 255 Leu Leu Asp Glu Arg Gly Asn Phe Ser Lys Phe
Thr Leu Gly Asp Met 260 265 270 Glu Met Leu Asp Val Glu Gly Val Ala
Asp Ile Asp Pro Asn Tyr Lys 275 280 285 Phe Asn Gln Leu Leu Ile His
Asn Asn Ala Leu Ser Ser Val Leu Met 290 295 300 Gly Ser His Asn Gly
Ile Glu Pro Glu Lys Val Ser Leu Leu Tyr Gly 305 310 315 320 Gly Asn
Gly Gly Pro Gly Ala Arg His Asp Trp Asn Ala Thr Val Gly 325 330 335
Tyr Lys Asp Gln Gln Gly Asn Asn Val Ala Thr Ile Ile Asn Val His 340
345 350 Met Lys Asn Gly Ser Gly Leu Val Ile Ala Gly Gly Glu Lys Gly
Ile 355 360 365 Asn Asn Pro Ser Phe Tyr Leu Tyr Lys Glu Asp Gln Leu
Thr Gly Ser 370 375 380 Gln Arg Ala Leu Ser Gln Glu Glu Ile Gln Asn
Lys Ile Asp Phe Met 385 390 395 400 Glu Phe Leu Ala Gln Asn Asn Ala
Lys Leu Asp Asn Leu Ser Glu Lys 405 410 415 Glu Lys Glu Lys Phe Arg
Thr Glu Ile Lys Asp Phe Gln Lys Asp Ser 420 425 430 Lys Ala Tyr Leu
Asp Ala Leu Gly Asn Asp Arg Ile Ala Phe Val Ser 435 440 445 Lys Lys
Asp Thr Lys His Ser Ala Leu Ile Thr Glu Phe Gly Asn Gly 450 455 460
Asp Leu Ser Tyr Thr Leu Lys Asp Tyr Gly Lys Lys Ala Asp Lys Ala 465
470 475 480 Leu Asp Arg Glu Lys Asn Val Thr Leu Gln Gly Ser Leu Lys
His Asp 485 490 495 Gly Val Met Phe Val Asp Tyr Ser Asn Phe Lys Tyr
Thr Asn Ala Ser 500 505 510 Lys Asn Pro Asn Lys Gly Val Gly Val Thr
Asn Gly Val Ser His Leu 515 520 525 Glu Val Gly Phe Asn Lys Val Ala
Ile Phe Asn Leu Pro Asp Leu Asn 530 535 540 Asn Leu Ala Ile Thr Ser
Phe Val Arg Arg Asn Leu Glu Asp Lys Leu 545 550 555 560 Thr Thr Lys
Gly Leu Ser Pro Gln Glu Ala Asn Lys Leu Ile Lys Asp 565 570 575 Phe
Leu Ser Ser Asn Lys Glu Leu Val Gly Lys Thr Leu Asn Phe Asn 580 585
590 Lys Ala Val Ala Asp Ala Lys Asn Thr Gly Asn Tyr Asp Glu Val Lys
595 600 605 Lys Ala Gln Lys Asp Leu Glu Lys Ser Leu Arg Lys Arg Glu
His Leu 610 615 620 Glu Lys Glu Val Glu Lys Lys Leu Glu Ser Lys Ser
Gly Asn Lys Asn 625 630 635 640 Lys Met Glu Ala Lys Ala Gln Ala Asn
Ser Gln Lys Asp Glu Ile Phe 645 650 655 Ala Leu Ile Asn Lys Glu Ala
Asn Arg Asp Ala Arg Ala Ile Ala Tyr 660 665 670 Ala Gln Asn Leu Lys
Gly Ile Lys Arg Glu Leu Ser Asp Lys Leu Glu 675 680 685 Asn Val Asn
Lys Asn Leu Lys Asp Phe Asp Lys Ser Phe Asp Glu Phe 690 695 700 Lys
Asn Gly Lys Asn Lys Asp Phe Ser Lys Ala Glu Glu Thr Leu Lys 705 710
715 720 Ala Leu Lys Gly Ser Val Lys Asp Leu Gly Ile Asn Pro Glu Trp
Ile 725 730 735 Ser Lys Val Glu Asn Leu Asn Ala Ala Leu Asn Glu Phe
Lys Asn Gly 740 745 750 Lys Asn Lys Asp Phe Ser Lys Val Thr Gln Ala
Lys Ser Asp Leu Glu 755 760 765 Asn Ser Val Lys Asp Val Ile Ile Asn
Gln Lys Val Thr Asp Lys Val 770 775 780 Asp Asn Leu Asn Gln Ala Val
Ser Val Ala Lys Ala Thr Gly Asp Phe 785 790 795 800 Ser Arg Val Glu
Gln Ala Leu Ala Asp Leu Lys Asn Phe Ser Lys Glu 805 810 815 Gln Leu
Ala Gln Gln Ala Gln Lys Asn Glu Ser Leu Asn Ala Arg Lys 820 825 830
Lys Ser Glu Ile Tyr Gln Ser Val Lys Asn Gly Val Asn Gly Thr Leu 835
840 845 Val Gly Asn Gly Leu Ser Gln Ala Glu Ala Thr Thr Leu Ser Lys
Asn 850 855 860 Phe Ser Asp Ile Lys Lys Glu Leu Asn Ala Lys Leu Gly
Asn Phe Asn 865 870 875 880 Asn Asn Asn Asn Asn Gly Leu Lys Asn Glu
Pro Ile Tyr Ala Lys Val 885 890 895 Asn Lys Lys Lys Ala Gly Gln Ala
Ala Ser Leu Glu Glu Pro Ile Tyr 900 905 910 Ala Gln Val Ala Lys Lys
Val Asn Ala Lys Ile Asp Arg Leu Asn Gln 915 920 925 Ile Ala Ser Gly
Leu Gly Val Val Gly Gln Ala Ala Gly Phe Pro Leu 930 935 940 Lys Arg
His Asp Lys Val Asp Asp Leu Ser Lys Val Gly Leu Ser Arg 945 950 955
960 Asn Gln Glu Leu Ala Gln Lys Ile Asp Asn Leu Asn Gln Ala Val Ser
965 970 975 Glu Ala Lys Ala Gly Phe Phe Gly Asn Leu Glu Gln Thr Ile
Asp Lys 980 985 990 Leu Lys Asp Ser Thr Lys His Asn Pro Met Asn Leu
Trp Val Glu Ser 995 1000 1005 Ala Lys Lys Val Pro Ala Ser Leu Ser
Ala Lys Leu Asp Asn Tyr 1010 1015 1020 Ala Thr Asn Ser His Ile Arg
Ile Asn Ser Asn Ile Lys Asn Gly 1025 1030 1035 Ala Ile Asn Glu Lys
Ala Thr Gly Met Leu Thr Gln Lys Asn Pro 1040 1045 1050 Glu Trp Leu
Lys Leu Val Asn Asp Lys Ile Val Ala His Asn Val 1055 1060 1065 Gly
Ser Val Pro Leu Ser Glu Tyr Asp Lys Ile Gly Phe Asn Gln 1070 1075
1080 Lys Asn Met Lys Asp Tyr Ser Asp Ser Phe Lys Phe Ser Thr Lys
1085 1090 1095 Leu Asn Asn Ala Val Lys Asp Thr Asn Ser Gly Phe Thr
Gln Phe 1100 1105 1110 Leu Thr Asn Ala Phe Ser Thr Ala Ser Tyr Tyr
Cys Leu Ala Arg 1115 1120 1125 Glu Asn Ala Glu His Gly Ile Lys Asn
Val Asn Thr Lys Gly Gly 1130 1135 1140 Phe Gln Lys Ser 1145 6 546
PRT Helicobacter pylori 6 Met Ala Lys Glu Ile Lys Phe Ser Asp Ser
Ala Arg Asn Leu Leu Phe 1 5 10 15 Glu Gly Val Arg Gln Leu His Asp
Ala Val Lys Val Thr Met Gly Pro 20 25 30 Arg Gly Arg Asn Val Leu
Ile Gln Lys Ser Tyr Gly Ala Pro Ser Ile 35 40 45 Thr Lys Asp Gly
Val Ser Val Ala Lys Glu Ile Glu Leu Ser Cys Pro 50 55 60 Val Ala
Asn Met Gly Ala Gln Leu Val Lys Glu Val Ala Ser Lys Thr 65 70 75 80
Ala Asp Ala Ala Gly Asp Gly Thr Thr Thr Ala Thr Val Leu Ala Tyr 85
90 95 Ser Ile Phe Lys Glu Gly Leu Arg Asn Ile Thr Ala Gly Ala Asn
Pro 100 105 110 Ile Glu Val Lys Arg Gly Met Asp Lys Ala Ala Glu Ala
Ile Ile Asn 115 120 125 Glu Leu Lys Lys Ala Ser Lys Lys Val Gly Gly
Lys Glu Glu Ile Thr 130 135 140 Gln Val Ala Thr Ile Ser Ala Asn Ser
Asp His Asn Ile Gly Lys Leu 145 150 155 160 Ile Ala Asp Ala Met Glu
Lys Val Gly Lys Asp Gly Val Ile Thr Val 165 170 175 Glu Glu Ala Lys
Gly Ile Glu Asp Glu Leu Asp Val Val Glu Gly Met 180 185 190 Gln Phe
Asp Arg Gly Tyr Leu Ser Pro Tyr Phe Val Thr Asn Ala Glu 195 200 205
Lys Met Thr Ala Gln Leu Asp Asn Ala Tyr Ile Leu Leu Thr Asp Lys 210
215 220 Lys Ile Ser Ser Met Lys Asp Ile Leu Pro Leu Leu Glu Lys Thr
Met 225 230 235 240 Lys Glu Gly Lys Pro Leu Leu Ile Ile Ala Glu Asp
Ile Glu Gly Glu 245 250 255 Ala Leu Thr Thr Leu Val Val Asn Lys Leu
Arg Gly Val Leu Asn Ile 260 265 270 Ala Ala Val Lys Ala Pro Gly Phe
Gly Asp Arg Arg Lys Glu Met Leu 275 280 285 Lys Asp Ile Ala Ile Leu
Thr Gly Gly Gln Val Ile Ser Glu Glu Leu 290 295 300 Gly Leu Ser Leu
Glu Asn Ala Glu Val Glu Phe Leu Gly Lys Ala Gly 305 310 315 320 Arg
Ile Val Ile Asp Lys Asp Asn Thr Thr Ile Val Asp Gly Lys Gly 325 330
335 His Ser Asp Asp Val Lys Asp Arg Val Ala Gln Ile Lys Thr Gln Ile
340 345 350 Ala Ser Thr Thr Ser Asp Tyr Asp Lys Glu Lys Leu Gln Glu
Arg Leu 355 360 365 Ala Lys Leu Ser Gly Gly Val Ala Val Ile Lys Val
Gly Ala Ala Ser 370 375 380 Glu Val Glu Met Lys Glu Lys Lys Asp Arg
Val Asp Asp Ala Leu Ser 385 390 395 400 Ala Thr Lys Ala Ala Val Glu
Glu Gly Ile Val Ile Gly Gly Gly Ala 405 410 415 Ala Leu Ile Arg Ala
Ala Gln Lys Val His Leu Asn Leu His Asp Asp 420 425 430 Glu Lys Val
Gly Tyr Glu Ile Ile Met Arg Ala Ile Lys Ala Pro Leu 435 440 445 Ala
Gln Ile Ala Ile Asn Ala Gly Tyr Asp Gly Gly Val Val Val Asn 450 455
460 Glu Val Glu Lys His Glu Gly His Phe Gly Phe Asn Ala Ser Asn Gly
465 470 475 480 Lys Tyr Val Asp Met Phe Lys Glu Gly Ile Ile Asp Pro
Leu Lys Val 485 490 495 Glu Arg Ile Ala Leu Gln Asn Ala Val Ser Val
Ser Ser Leu Leu Leu 500 505 510 Thr Thr Glu Ala Thr Val His Glu Ile
Lys Glu Glu Lys Ala Thr Pro 515 520 525 Ala Met Pro Asp Met Gly Gly
Met Gly Gly Met Gly Gly Met Gly Gly 530 535 540 Met Met 545 7 1838
DNA Helicobacter pylori 7 aagcttgctg tcatgatcac aaaaaacact
aaaaaacatt attattaagg atacaaaatg 60 gcaaaagaaa tcaaattttc
agatagtgcg agaaaccttt tatttgaagg cgtgaggcaa 120 ctccatgacg
ctgtcaaagt aaccatgggg ccaagaggca ggaatgtatt gatccaaaaa 180
agctatggcg ctccaagcat caccaaagac ggcgtgagcg tggctaaaga gattgaatta
240 agttgcccag tagctaacat gggcgctcaa ctcgttaaag aagtagcgag
caaaaccgct 300 gatgctgccg gcgatggcac gaccacagcg accgtgctag
cttatagcat ttttaaagaa 360 ggtttgagga atatcacggc tggggctaac
cctattgaag tgaaacgagg catggataaa 420 gctgctgaag cgatcattaa
tgagcttaaa aaagcgagca aaaaagtagg cggtaaagaa 480 gaaatcaccc
aagtggcgac catttctgca aactccgatc acaatatcgg gaaactcatc 540
gctgacgcta tggaaaaagt gggtaaagac ggcgtgatca ccgttgagga agctaagggc
600 attgaagatg aattggatgt cgtagaaggc atgcaatttg atagaggcta
cctctcccct 660 tattttgtaa cgaacgctga gaaaatgacc gctcaattgg
ataatgctta catcctttta 720 acggataaaa aaatctctag catgaaagac
attctcccgc tactagaaaa aaccatgaaa 780 gagggcaaac cgcttttaat
catcgctgaa gacattgagg gcgaagcttt aacgactcta 840 gtggtgaata
aattaagagg cgtgttgaat atcgcagcgg ttaaagctcc aggctttggg 900
gacagaagaa aagaaatgct caaagacatc gctattttaa ccggcggtca agtcattagc
960 gaagaattgg gcttgagtct agaaaacgct gaagtggagt ttttaggcaa
agctggaagg 1020 attgtgattg acaaagacaa caccacgatc gtagatggca
aaggccatag cgatgatgtt 1080 aaagacagag tcgcgcagat caaaacccaa
attgcaagta cgacaagcga ttatgacaaa 1140 gaaaaattgc aagaaagatt
ggctaaactc tctggcggtg tggctgtgat taaagtgggc 1200 gctgcgagtg
aagtggaaat gaaagagaaa aaagaccggg tggatgacgc gttgagcgcg 1260
actaaagcgg cggttgaaga aggcattgtg attggtggcg gtgcggctct cattcgcgcg
1320 gctcaaaaag tgcatttgaa tttgcacgat gatgaaaaag tgggctatga
aatcatcatg 1380 cgcgccatta aagccccatt agctcaaatc gctatcaacg
ctggttatga tggcggtgtg 1440 gtcgtgaatg aagtagaaaa acacgaaggg
cattttggtt ttaacgctag caatggcaag 1500 tatgtggata
tgtttaaaga aggcattatt gaccccttaa aagtagaaag gatcgctcta 1560
caaaatgcgg tttcggtttc aagcctgctt ttaaccacag aagccaccgt gcatgaaatc
1620 aaagaagaaa aagcgactcc ggcaatgcct gatatgggtg gcatgggcgg
tatgggaggc 1680 atgggcggca tgatgtaagc ccgcttgctt tttagtataa
tctgctttta aaatcccttc 1740 tctaaatccc cccctttcta aaatctcttt
tttggggggg tgctttgata aaaccgctcg 1800 cttgtaaaaa catgcaacaa
aaaatctctg ttaagctt 1838 8 18 DNA Artificial Sequence primer
oligonucleotide 8 gactcgagtc gacatcga 18 9 12 PRT Helicobacter
pylori 9 Glu Phe Lys Asn Gly Lys Asn Lys Asp Phe Ser Lys 1 5 10 10
5 PRT Helicobacter pylori 10 Glu Pro Ile Tyr Ala 1 5 11 102 DNA
Helicobacter pylori 11 gggcgatcgg ttagccctga acccatttat gctacgattg
atgatctccg gcggaccttt 60 ccctttgaaa ggcatgataa agttgatgat
ctcagtaagg ta 102 12 34 PRT Helicobacter pylori 12 Gly Arg Ser Val
Ser Pro Glu Pro Ile Tyr Ala Thr Ile Asp Asp Leu 1 5 10 15 Gly Gly
Pro Phe Pro Leu Lys Arg His Asp Lys Val Asp Asp Leu Ser 20 25 30
Lys Val 13 18 DNA Helicobacter pylori 13 cctgaaccca tttatgct 18 14
6 PRT Helicobacter pylori 14 Glu Pro Ile Tyr Ala Thr 1 5 15 9 DNA
Helicobacter pylori 15 gatgatctc 9 16 3 PRT Helicobacter pylori 16
Asp Leu Gly 1 17 13 PRT Helicobacter pylori 17 Leu Lys Arg His Asp
Lys Val Asp Asp Leu Ser Lys Val 1 5 10 18 45 DNA Helicobacter
pylori 18 tttccctttg aaaggcatga taaagttgat gatctcagta aggta 45 19
36 DNA Helicobacter pylori 19 gaattcaaaa atggcaaaaa taaggatttc
agcaag 36 20 15 DNA Helicobacter pylori 20 gaacccattt atgct 15 21
15 DNA Helicobacter pylori 21 gaacccattt acgct 15 22 45 DNA
Helicobacter pylori 22 ttccctttga aaaggcatga taaagttgat gatctcagta
aggta 45 23 6 PRT Helicobacter pylori 23 Asn Asn Asn Asn Asn Asn 1
5 24 18 DNA Helicobacter pylori 24 aataacaata acaataat 18 25 228
PRT Helicobacter pylori 25 Lys Asn Gly Lys Asn Lys Asp Phe Ser Lys
Val Thr Gln Ala Lys Ser 1 5 10 15 Asp Leu Glu Asn Ser Val Lys Asp
Val Ile Ile Asn Gln Lys Val Thr 20 25 30 Asp Lys Val Asp Asn Leu
Asn Gln Ala Val Ser Val Ala Lys Ala Thr 35 40 45 Gly Asp Phe Ser
Arg Val Glu Gln Ala Leu Ala Asp Leu Lys Asn Phe 50 55 60 Ser Lys
Glu Gln Leu Ala Gln Gln Ala Gln Lys Asn Glu Ser Leu Asn 65 70 75 80
Ala Arg Lys Lys Ser Glu Ile Tyr Gln Ser Val Lys Asn Gly Val Asn 85
90 95 Gly Thr Leu Val Gly Asn Gly Leu Ser Gln Ala Glu Ala Thr Thr
Leu 100 105 110 Ser Lys Asn Phe Ser Asp Ile Lys Lys Glu Leu Asn Ala
Lys Leu Gly 115 120 125 Asn Phe Asn Asn Asn Asn Asn Asn Gly Leu Lys
Asn Glu Pro Ile Tyr 130 135 140 Ala Lys Val Asn Lys Lys Lys Ala Gly
Gln Ala Ala Ser Leu Glu Glu 145 150 155 160 Pro Ile Tyr Ala Gln Val
Ala Lys Lys Val Asn Ala Lys Ile Asp Arg 165 170 175 Leu Asn Gln Ile
Ala Ser Gly Leu Gly Val Val Gly Gln Ala Ala Gly 180 185 190 Phe Pro
Leu Lys Arg His Asp Lys Val Asp Asp Leu Ser Lys Val Gly 195 200 205
Leu Ser Arg Asn Gln Glu Leu Ala Gln Lys Ile Asp Asn Leu Asn Gln 210
215 220 Ala Val Ser Glu 225 26 685 DNA Helicobacter pylori 26
aaaaatggca aaaataagga tttcagcaag gtaacgcaag caaaaagcga ccttgaaaat
60 tccgttaaag atgtgatcat caatcaaaag gtaacggata aagttgataa
tctcaatcaa 120 gcggtatcag tggctaaagc aacgggtgat ttcagtaggg
tagagcaagc gttagccgat 180 ctcaaaaatt tctcaaagga gcaattggcc
caacaagctc aaaaaaatga aagtctcaat 240 gctagaaaaa aatctgaaat
atatcaatcc gttaagaatg gtgtgaatgg aaccctagtc 300 ggtaatgggt
tatctcaagc agaagccaca actctttcta aaaacttttc ggacatcaag 360
aaagagttga atgcaaaact tggaaatttc aataacaata acaataatgg actcaaaaac
420 gaacccattt atgctaaagt taataaaaag aaagcagggc aagcagctag
ccttgaagaa 480 cccatttacg ctcaagttgc taaaaaggta aatgcaaaaa
ttgaccgact caatcaaata 540 gcaagtggtt tgggtgttgt agggcaagca
gcgggcttcc ctttgaaaag gcatgataaa 600 gttgatgatc tcagtaaggt
agggctttca aggaatcaag aattggctca gaaaattgac 660 aatctcaatc
aagcggtatc agaag 685 27 699 DNA Helicobacter pylori 27 gaattcaaaa
atggcaaaaa taaggatttc agcaaggtaa cgcaagcaaa aagcgacctt 60
gaaaattccg ttaaagatgt gatcatcaat caaaaggtaa cggataaagt tgataatctc
120 aatcaagcgg tatcagtggc taaagcaacg ggtgatttca gtagggtaga
gcaagcgtta 180 gccgatctca aaaatttctc aaaggagcaa ttggcccaac
aagctcaaaa aaatgaaagt 240 ctcaatgcta gaaaaaaatc tgaaatatat
caatccgtta agaatggtgt gaatggaacc 300 ctagtcggta atgggttatc
tcaagcagaa gccacaactc tttctaaaaa cttttcggac 360 atcaagaaag
agttgaatgc aaaacttgga aatttcaata acaataacaa taatggactc 420
aaaaacgaac ccatttatgc taaagttaat aaaaagaaag cagggcaagc agctagcctt
480 gaagaaccca tttacgctca agttgctaaa aaggtaaatg caaaaattga
ccgactcaat 540 caaatagcaa gtggtttggg tgttgtaggg caagcagcgg
gcttcccttt gaaaaggcat 600 gataaagttg atgatctcag taaggtaggg
ctttcaagga atcaagaatt ggctcagaaa 660 attgacaatc tcaatcaagc
ggtatcagaa gccgaattc 699 28 15 PRT Helicobacter pylori 28 Phe Pro
Leu Lys Arg His Asp Lys Val Asp Asp Leu Ser Lys Val 1 5 10 15 29 6
PRT Helicobacter pylori 29 Asn Glu Pro Ile Tyr Ala 1 5 30 6 PRT
Helicobacter pylori 30 Glu Glu Pro Ile Tyr Ala 1 5
* * * * *