U.S. patent application number 11/713579 was filed with the patent office on 2007-10-18 for epigenetic modification of the loci for camta1 and/or foxp3 as a marker for cancer treatment.
Invention is credited to Sven Olek.
Application Number | 20070243161 11/713579 |
Document ID | / |
Family ID | 38039185 |
Filed Date | 2007-10-18 |
United States Patent
Application |
20070243161 |
Kind Code |
A1 |
Olek; Sven |
October 18, 2007 |
Epigenetic modification of the loci for CAMTA1 and/or FOXP3 as a
marker for cancer treatment
Abstract
The present invention relates to a method, in particular an in
vitro method, for pan-cancer diagnostics, comprising identifying
the amount and/or proportion of stable regulatory T cells in a
patient suspected of having cancer through analyzing the
methylation status of at least one CpG position in the gene foxp3
and/or the gene camta1 or orthologous or paralogous genes thereof,
wherein an increased amount and/or proportion of stable regulatory
T cells in said patient is indicative for an unspecific cancerous
disease. In a second aspect thereof, the present invention relates
to a method for diagnosing the survival of a cancer patient,
comprising identifying the amount and/or proportion of stable
regulatory T cells in said cancer patient through analyzing the
methylation status of at least one CpG position in the gene foxp3
and/or the gene camta1 or orthologous or paralogous genes thereof,
wherein a demethylation in the gene foxp3 and/or the gene camta1 or
orthologous or paralogous genes thereof, is indicative of a stable
regulatory T cell, and wherein an increased amount and/or
proportion of stable regulatory T cells in said cancer patient is
indicative for a shorter survival for said cancer patient.
Furthermore, the present invention relates to an improved treatment
of cancers based on the inventive methods, and a kit for performing
the above methods as well as respective uses.
Inventors: |
Olek; Sven; (Berlin,
DE) |
Correspondence
Address: |
SALIWANCHIK LLOYD & SALIWANCHIK;A PROFESSIONAL ASSOCIATION
PO BOX 142950
GAINESVILLE
FL
32614-2950
US
|
Family ID: |
38039185 |
Appl. No.: |
11/713579 |
Filed: |
February 28, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60777631 |
Feb 28, 2006 |
|
|
|
Current U.S.
Class: |
424/85.2 ;
424/158.1; 435/6.12; 514/44A |
Current CPC
Class: |
C12Q 2600/154 20130101;
C12Q 2600/118 20130101; A61P 35/00 20180101; C12Q 1/6886
20130101 |
Class at
Publication: |
424/085.2 ;
424/158.1; 435/006; 514/044 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61K 31/7052 20060101 A61K031/7052; A61P 35/00
20060101 A61P035/00; C12Q 1/68 20060101 C12Q001/68; A61K 38/20
20060101 A61K038/20 |
Claims
1. A method for pan-cancer diagnostics, comprising identifying the
amount and/or proportion of stable regulatory T cells in a patient
suspected of having cancer through analysing the methylation status
of at least one CpG position in the gene foxp3 and/or camta1 or
orthologous or paralogous genes thereof, wherein an increased
amount and/or proportion of stable regulatory T cells in said
patient is indicative for an unspecific cancerous disease.
2. The method according to claim 1, further comprising the analysis
of at least one cancer- and/or tissue-specific marker.
3. The method according to claim 1, wherein said stable regulatory
T cell is a CD25.sup.+CD4.sup.+ regulatory T cell.
4. The method according to claim 1, further comprising the step of
analysing the packaging of the chromatin structure in the region of
the gene foxp3 and/or camta1 or orthologous or paralogous genes
thereof, wherein an open chromatin structure in the region of the
gene foxp3 and/or camta1 or orthologous or paralogous genes thereof
is indicative of a stable regulatory T cell.
5. The method according to claim 1, wherein said analysis of the
methylation status comprises analysing the methylation status of at
least one CpG position in the 5' region upstream from the
transcription start, promoter regions, introns, and/or exon/intron
borders of the gene foxp3 and/or camta1.
6. The method according to claim 1, wherein said analysis of the
methylation status of foxp3 comprises amplification with at least
one of the primer pairs selected from SEQ ID NO: 1 and 2; SEQ ID
NO: 3 and 4, and orthologous or paralogous primer pairs
thereof.
7. The method according to claim 1, wherein said analysis of the
methylation status comprises a method selected from methylation
specific enzymatic digests, bisulphite sequencing, MSP,
HeavyMethyl, MethyLight, Ms-SNuPE or other methods relying on a
detection of amplified DNA.
8. The method according to claim 1, wherein the analysis of the
packaging of the chromatin structure comprises chromatin
immunoprecipitation.
9. The method according to claim 8, wherein said
immunoprecipitation comprises using antibodies against acylated
histones
10. The method according to claim 9, wherein said histones are H3
and/or H4.
11. The method according to claim 1, wherein said patient is a
human.
12. The method according to claim 1, wherein said cancer is
selected from solid tumors, breast cancer, ovarian cancer, prostate
cancer, and lung cancer.
13. The method according to claim 1, wherein the amount and/or
proportion of stable regulatory T cells is identified in a blood or
tissue sample obtained from said human.
14. The method according to claim 1, wherein the amount and/or
proportion of stable regulatory T cells is identified through a
comparison with the methylation status of at least one CpG position
in the gene foxp3 and/or camta1 or orthologous or paralogous genes
thereof in samples selected from all cells as present in said
sample, all T-cells as present in said sample, and the number of
stable regulatory T cells in a healthy patient.
15. The method according to claim 1, wherein an amount of
regulatory T-cells corresponds to a demethylation of the CpG
positions as analyzed to at least about 80%.
16. The method according to claim 1, wherein an amount of
regulatory T-cells corresponds to a demethylation of the CpG
positions as analyzed to at least about 90%.
17. The method according to claim 1, wherein an amount of
regulatory T-cells corresponds to a demethylation of the CpG
positions as analyzed to at least about 95%.
18. The method according to claim 1, wherein a demethylation and/or
open chromatin structure in the region of the gene foxp3 and/or
camta1 or orthologous or paralogous genes thereof corresponds to at
least 10-fold of DNA relative to input for Me.sub.3K4.
19. The method according to claim 1, further comprising the step of
providing a treatment for said cancer patient wherein said
treatment reduces the amount and/or proportion of stable regulatory
T cells in said cancer patient.
20. The method according to claim 19, wherein said treatment is
selected from providing chemical and/or biological substances that
selectively kill regulatory T-cells in said patient, or a treatment
that reduces the expression of the gene foxp3 and/or camta1 or
inhibits the biological activity of FoxP3 and/or Camta1 in said
regulatory T-cells in said patient.
21. The method according to claim 19, wherein said substance is
selected from an antibody that is selective for regulatory T-cells,
such as an anti-CD25-antibody, a cytotoxic substance that is
selective for regulatory T-cells, such as denileukin diftitox
(Ontak.RTM.), antisense nucleic acids against the expression of the
gene foxp3, and methylating agents.
22. The method according to claim 20, wherein said substance is
selected from an antibody that is selective for regulatory T-cells,
such as an anti-CD25-antibody, a cytotoxic substance that is
selective for regulatory T-cells, such as denileukin diftitox
(Ontak.RTM.), antisense nucleic acids against the expression of the
gene foxp3, and methylating agents.
23. The method according to claim 19, further comprising measuring
and/or monitoring the amount of said regulatory T cells in response
to chemical and/or biological substance.
24. The method according to claim 20, further comprising measuring
and/or monitoring the amount of said regulatory T cells in response
to chemical and/or biological substance.
25. The method according to claim 21, further comprising measuring
and/or monitoring the amount of said regulatory T cells in response
to chemical and/or biological substance.
26. A kit for diagnosing the survival of a cancer patient,
comprising materials for performing a method according to claim
1.
27. A method for diagnosing the survival of a cancer patient,
comprising identifying the amount and/or proportion of stable
regulatory T cells in said cancer patient through analysing the
methylation status of at least one CpG position in the gene foxp3
and/or camta1 or orthologous or paralogous genes thereof, wherein a
demethylation in the gene foxp3 and/or camta1 or orthologous or
paralogous genes thereof, is indicative of a stable regulatory T
cell, and wherein an increased amount and/or proportion of stable
regulatory T cells in said cancer patient is indicative for a
shorter survival for said cancer patient.
28. The method according to claim 27, wherein said stable
regulatory T cell is a CD25.sup.+CD4.sup.+ regulatory T cell.
29. The method according to claim 27, further comprising the step
of analysing the packaging of the chromatin structure in the region
of the gene foxp3 and/or camta1 or orthologous or paralogous genes
thereof, wherein an open chromatin structure in the region of the
gene foxp3 and/or camta1 or orthologous or paralogous genes thereof
is indicative of a stable regulatory T cell.
30. The method according to claim 27, wherein said analysis of the
methylation status comprises analysing the methylation status of at
least one CpG position in the 5' region upstream from the
transcription start, promoter regions, introns, and/or exon/intron
borders of the gene foxp3 and/or camta1.
31. The method according to claim 27, wherein said analysis of the
methylation status of foxp3 comprises amplification with at least
one of the primer pairs selected from SEQ ID NO: 1 and 2; SEQ ID
NO: 3 and 4, and orthologous or paralogous primer pairs
thereof.
32. The method according to claim 27, wherein said analysis of the
methylation status comprises a method selected from methylation
specific enzymatic digests, bisulphite sequencing, MSP,
HeavyMethyl, MethyLight, Ms-SNuPE or other methods relying on a
detection of amplified DNA.
33. The method according to claim 27, wherein the analysis of the
packaging of the chromatin structure comprises chromatin
immunoprecipitation.
34. The method according to claim 33, wherein said
immunoprecipitation comprises using antibodies against acylated
histones
35. The method according to claim 34, wherein said histones are H3
and/or H4.
36. The method according to claim 27, wherein said patient is a
human.
37. The method according to claim 27 wherein said cancer is
selected from solid tumors, breast cancer, ovarian cancer, prostate
cancer, and lung cancer.
38. The method according to claim 27, wherein the amount and/or
proportion of stable regulatory T cells is identified in a blood or
tissue sample obtained from said human.
39. The method according to claim 27, wherein the amount and/or
proportion of stable regulatory T cells is identified through a
comparison with the methylation status of at least one CpG position
in the gene foxp3 and/or camta1 or orthologous or paralogous genes
thereof in samples selected from all cells as present in said
sample, all T-cells as present in said sample, and the number of
stable regulatory T cells in a healthy patient.
40. The method according to claim 27, wherein an amount of
regulatory T-cells corresponds to a demethylation of the CpG
positions as analyzed to at least about 80%.
41. The method according to claim 27, wherein an amount of
regulatory T-cells corresponds to a demethylation of the CpG
positions as analyzed to at least about 90%.
42. The method according to claim 27, wherein an amount of
regulatory T-cells corresponds to a demethylation of the CpG
positions as analyzed to at least about 95%.
43. The method according to claim 27, wherein a demethylation
and/or open chromatin structure in the region of the gene foxp3
and/or camta1 or orthologous or paralogous genes thereof
corresponds to at least 10-fold of DNA relative to input for
Me.sub.3K4.
44. The method according to claim 27, further comprising the step
of providing a treatment for said cancer patient wherein said
treatment reduces the amount and/or proportion of stable regulatory
T cells in said cancer patient.
45. The method according to claim 44, wherein said treatment is
selected from providing chemical and/or biological substances that
selectively kill regulatory T-cells in said patient, or a treatment
that reduces the expression of the gene foxp3 and/or camta1 or
inhibits the biological activity of FoxP3 and/or Camta1 in said
regulatory T-cells in said patient.
46. The method according to claim 44, wherein said substance is
selected from an antibody that is selective for regulatory T-cells,
such as an anti-CD25-antibody, a cytotoxic substance that is
selective for regulatory T-cells, such as denileukin diftitox
(Ontak.RTM.), antisense nucleic acids against the expression of the
gene foxp3, and methylating agents.
47. The method according to claim 45, wherein said substance is
selected from an antibody that is selective for regulatory T-cells,
such as an anti-CD25-antibody, a cytotoxic substance that is
selective for regulatory T-cells, such as denileukin diftitox
(Ontak.RTM.), antisense nucleic acids against the expression of the
gene foxp3, and methylating agents.
48. The method according to claim 44, further comprising measuring
and/or monitoring the amount of said regulatory T cells in response
to chemical and/or biological substance.
49. The method according to claim 45, further comprising measuring
and/or monitoring the amount of said regulatory T cells in response
to chemical and/or biological substance.
50. The method according to claim 46, further comprising measuring
and/or monitoring the amount of said regulatory T cells in response
to chemical and/or biological substance.
51. A kit for diagnosing the survival of a cancer patient,
comprising materials for performing a method according to claim 27.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of U.S. Provisional
Application Ser. No. 60/777,631, filed Feb. 28, 2006, which is
hereby incorporated by reference in its entirety, including any
figures, tables, nucleic acid sequences, and amino acid
sequences.
BACKGROUND OF THE INVENTION
[0002] Regulatory T cells play an important role for the
maintenance of immunological tolerance by suppressing the action of
autoreactive effector cells, making them interesting targets for
therapeutic applications. Therefore, these cells are critically
involved in preventing the development of autoimmune reactions
(Sakaguchi, Nat Immunol 6:345-352, 2005).
[0003] Regulatory T cells (Tregs), which have been shown to play a
pivotal role in the maintenance of self-tolerance within the immune
system, were described originally as CD4+ T cells constitutively
expressing CD25 (Sakaguchi, S. Naturally arising CD4+ regulatory T
cells for immunologic self-tolerance and negative control of immune
responses. Annu Rev Immunol 22, 531-562 (2004)). More recently, the
forkhead transcription factor Foxp3 has been shown to be
specifically expressed in Tregs and to be a central control element
in Treg development and function (Fontenot, J. D. and Rudensky, A.
Y. A well adapted regulatory contrivance: regulatory T cell
development and the forkhead family transcription factor Foxp3. Nat
Immunol 6, 331-7 (2005)). Mutation or deletion of the gene encoding
Foxp3 causes severe autoimmune disease in mice and humans, due to a
failure to generate CD25+CD4+ Tregs (Bennett, C. L. et al. The
immune dysregulation, polyendocrinopathy, enteropathy, X-linked
syndrome (IPEX) is caused by mutations of FOXP3. Nat Genet 27, 20-1
(2001). Fontenot, J. D., Gavin, M. A. and Rudensky, A. Y. Foxp3
programs the development and function of CD4+CD25+ regulatory T
cells. Nat Immunol 4, 330-6 (2003)), whereas ectopic expression of
Foxp3 in conventional T cells confers suppressive activity
(Fontenot, J. D., Gavin, M. A. and Rudensky, A. Y. Foxp3 programs
the development and function of CD4+CD25+ regulatory T cells. Nat
Immunol 4, 330-6 (2003). Hori, S., Nomura, T. and Sakaguchi, S.
Control of regulatory T cell development by the transcription
factor Foxp3. Science 299, 1057-61 (2003)).
[0004] These findings provided compelling evidence that Foxp3 acts
as a master switch controlling the development and function of
Tregs; however, the molecular mechanisms leading to its induction
remain largely unknown. Recently, an initial characterization of
the human FOXP3 promoter revealed a basal, T cell-specific promoter
containing several NF-AT and AP-1 binding sites, which are
positively regulating FOXP3 expression after triggering of the TCR
(Mantel, P. Y. et al. Molecular Mechanisms Underlying FOXP3
Induction in Human T Cells. J Immunol 176, 3593-602 (2006)).
[0005] Occurrence of autoimmunity in thymectomized mice provided
initial evidence that Foxp3+CD25+CD4+ Tregs are generated as an
individual lineage within the thymus 1. Using mice harbouring a
GFP-Foxp3 fusion protein-reporter knockin allele, Fontenot et al.
could show that Foxp3 expression becomes prominent in CD4 single
positive (SP) thymocytes (.about.83% of Foxp3.sup.gfP+ thymocytes)
(Fontenot, J. D. et al. Regulatory T cell lineage specification by
the forkhead transcription factor foxp3. Immunity 22, 329-41
(2005). Fontenot, J. D., Dooley, J. L., Farr, A. G. and Rudensky,
A. Y. Developmental regulation of Foxp3 expression during ontogeny.
J Exp Med 202, 901-6 (2005)). In addition to the thymic generation
of Foxp3+ Tregs, peripheral conversion of Foxp3-CD25-CD4+ T cells
into Foxp3+ Tregs has recently been demonstrated by tolerogenic
antigen application in vivo (Thorstenson, K. M. and Khoruts, A.
Generation of anergic and potentially immunoregulatory CD25+CD4 T
cells in vivo after induction of peripheral tolerance with
intravenous or oral antigen. J Immunol 167, 188-95. (2001).
Apostolou, I. and von Boehmer, H. In vivo instruction of suppressor
commitment in naive T cells. J Exp Med 199, 1401-8 (2004).
Kretschmer, K. et al. Inducing and expanding regulatory T cell
populations by foreign antigen. Nat Immunol 12, 1219-27 (2005)) or
upon activation in the presence of TGF-.beta. in vitro (Chen, W. et
al. Conversion of peripheral CD4+CD25- naive T cells to CD4+CD25+
regulatory T cells by TGF-beta induction of transcription factor
Foxp3. J Exp Med 198, 1875-86 (2003). Park, H. B., Paik, D. J.,
Jang, E., Hong, S. and Youn, J. Acquisition of anergic and
suppressive activities in transforming growth
factor-beta-costimulated CD4+CD25- T cells. Int Immunol 16, 1203-13
(2004). Fu, S. et al. TGF-beta induces Foxp3+ T-regulatory cells
from CD4+CD25- precursors. Am J Transplant 4, 1614-27 (2004).
Fantini, M. C. et al. Cutting edge: TGF-beta induces a regulatory
phenotype in CD4+CD25- T cells through Foxp3 induction and
down-regulation of Smad7. J Immunol 172, 5149-53 (2004). Wan, Y. Y.
and Flavell, R. A. Identifying Foxp3-expressing suppressor T cells
with a bicistronic reporter. Proc Natl Acad Sci USA 102, 5126-31
(2005). Fantini, M. C. et al. TGF-{beta} induced Foxp3+ regulatory
T cells suppress Th1-mediated experimental colitis. Gut (2005)). To
what extent these induced populations of Tregs acquire a stable
phenotype corresponding to that of natural, thymus-derived Tregs
is, however, unclear.
[0006] An emerging paradigm in understanding the development of
stable cellular lineages emphasizes the role of epigenetic
mechanisms for the permanent, heritable fixation of distinct gene
expression patterns. Molecular mechanisms of epigenetic imprinting
include selective demethylation of CpG motifs and histone
modifications as shown for cytokine genes (Ansel, K. M., Lee, D. U.
and Rao, A. An epigenetic view of helper T cell differentiation.
Nat Immunol 4, 616-23 (2003). Reiner, S. L. Epigenetic control in
the immune response. Hum Mol Genet 14 Spec No 1, R41-6 (2005).
Tykocinski, L. O. et al. A critical control element for
interleukin-4 memory expression in T helper lymphocytes. J Biol
Chem 280, 28177-85 (2005)).
[0007] WO 02/090600 describes isolated nucleic acid molecules which
encode Fkhsf, as well as mutant forms thereof. Also described are
expression vectors suitable for expressing such nucleic acid
molecules, and host cells containing such expression vectors. Also
described are pharmaceutical compounds and methods of identifying
such compounds that can modulate the immune system. In addition are
provided methods for identifying proteins regulated by Scurfin and
proteins that induce or inhibit Foxp3 expression.
[0008] Chen et al. (Chen L, Cohen A C, Lewis D B. Impaired
Allogeneic Activation and T-helper 1 Differentiation of Human Cord
Blood Naive CD4 T Cells. Biol Blood Marrow Transplant. 2006
February; 12 (2):160-71.) describe FoxP3 protein expression as a
marker for regulatory CD25(high) CD4 T cells.
[0009] Bouche et al. (in Bouche, N., Scharlat, A., Snedden, W.,
Bouchez, D. and Fromm, H. A novel family of calmodulin-binding
transcription activators in multicellular organisms J. Biol. Chem.
277 (24), 21851-21861 (2002)) describe two human proteins
designated HsCAMTA1 and HsCAMTA2 as members of a conserved family
of transcription factors in a wide range of multicellular
eukaryotes, which possibly respond to calcium signaling by direct
binding of calmodulin.
[0010] Henrich et al. (in K. O. Henrich, M. Fischer, D. Mertens, A.
Benner, R. Wiedemeyer, B. Brors, A. Oberthuer, F. Berthold, J. S.
Wei, J. Khan, M. Schwab, and F. Westermann. Reduced expression of
CAMTA1 correlates with adverse outcome in neuroblastoma patients.
Clin Cancer Res, 12(1):131-138, January 2006.) describe that the
reduced expression of CAMTA1 correlates with adverse outcome in
neuroblastoma patients.
[0011] Even though almost all cells in an individual contain the
exact same complement of DNA code, higher organisms must impose and
maintain different patterns of gene expression in the various
tissue types. Most gene regulation is transitory, depending on the
current state of the cell and changes in external stimuli.
Persistent regulation, on the other hand, is a primary role of
epigenetics--heritable regulatory patterns that do not alter the
basic genetic coding of the DNA. DNA methylation is the
archetypical form of epigenetic regulation; it serves as the stable
memory for cells and performs a crucial role in maintaining the
long-term identity of various cell types.
[0012] The primary target of methylation is the two-nucleotide
sequence Cytosine-Guanine (a `CpG site`); within this context
cytosine (C) can undergo a simple chemical modification to become
5-methyl-cytosine. In the human genome, the CG sequence is much
rarer than expected except in certain relatively dense clusters
called `CpG islands`. CpG islands are frequently associated with
gene promoters, and it has been estimated that more than half of
the human genes have CpG islands (Antequera and Bird, Proc Natl
Acad Sci USA. 90:11995-9, 1993).
[0013] Aberrant methylation of DNA frequently accompanies the
transformation from healthy to cancerous cells. Among the observed
effects are genome-wide hypomethylation, increased methylation of
tumour suppressor genes and hypomethylation of many oncogenes
(reviewed by Jones and Laird, Nature Genetics 21:163-167, 1999;
Esteller, Oncogene 21:5427-5440, 2002; Laird, Nature Reviews/Cancer
3:253-266, 2003). Methylation profiles have been recognised to be
tumour specific (i.e., changes in the methylation pattern of
particular genes or even individual CpGs are diagnostic of
particular tumour types) and there is now an extensive collection
of diagnostic markers for bladder, breast, colon, esophagus,
stomach, liver, lung, and prostate cancers (summarised by Laird,
Nature Reviews/Cancer 3:253-266, 2003).
[0014] Epigenetic control by methylation is essential for early
development including embryogenesis, X-chromosome inactivation and
imprinting (monoallelic silencing) of either the paternal or
maternal allele (Erlich, J Cellular Chem 88:899-910, 2003). There
is also a class of genes that is active in the germ line, but is
silenced by methylation in somatic cells (Bird, Genes and Dev
16:6-21, 2002; Li, Nature Reviews/Genetics 3:662-673, 2002).
[0015] Tissue-specific methylation also serves in regulating adult
cell types/stages, and in some cases a causal relationship between
methylation and gene expression has been established. The following
is a partial list of genes, for which methylation changes are
strongly implicated in controlling gene expression in
tissue-specific manner: Lactate dehydrogenase C (testes); Oxytocin
receptor (blood and liver); Tyrosine aminotransferase (liver); GFAP
(astrocytes); and Leukosialin (leukocytes). In other cases,
methylation may be a by-product of some other primary regulation,
or it is required to lock the gene in the "off" state (Erlich, J
Cellular Chem 88:899-910, 2003). For the present applications
(cell/tissue identification), a causal relationship is not
required, merely a strong correlation between methylation patterns
and cell types.
[0016] A previously published example for such a cell type and cell
status specific modification of certain gene regions is found
during the lineage commitment of T cells to helper T cells (Th1 or
Th2). Naive (unstimulated) CD4.sup.+ T cells become activated upon
encountering an antigen and can be committed to alternative cell
fates through further stimulation by interleukins. The two types of
helper T cells show reciprocal patterns of gene expression; Th1
produces Interferon-gamma (IFN-.gamma.) and silences IL-4, while
Th2 produces IL-4 and silences IFN-.gamma. (Ansel et al., Nature
Immunol 4:616-623, 2003). For both alternative cell fates, the
expression of these genes is inversely correlated with methylation
of proximal CpG sites. In Th2 and naive T cells the IFN-.gamma.
promoter is methylated, but not in Th1 cells where IFN-.gamma. is
expressed (Attwood et al., CMLS 59:241-257, 2002). Conversely, the
entire transcribed region of IL-4 becomes demethylated under
Th2-inducing conditions, which strongly correlates with efficient
transcription of IL-4. In Th1 cells, this extensive demethylation
does not occur, rather particular untranscribed regions gradually
become heavily methylated and IL-4 is not expressed (Lee et al.,
Immunity 16:649-660, 2002). Furthermore, Bruniquel and Schwartz
(Nat Immunol. 4:235-40, 2003) have demonstrated that in naive T
cells, the IL-2 promoter is heavily methylated and inactive, but
after activation of the naive T cell, the IL-2 gene undergoes rapid
and specific demethylation at six consecutive CpGs. This alteration
in methylation patterns occurs concomitantly with cell
differentiation and increased production of the IL-2 product.
[0017] Dietl et al. (in Dietl J, Engel J B, Wischhusen J. The role
of regulatory T cells in ovarian cancer. Int J Gynecol Cancer. 2007
Feb. 14) describe that an increased mortality rate is associated
with the presence of a high number of intratumoral regulatory
T-cells. Tumor infiltration by non-regulatory T-cells, on the other
hand, is predictive for a substantially longer patient survival.
The article further reviews clinical and experimental findings on
Tregs in ovarian cancer, with special regard to potential
therapeutic implications, which may result from the existing
evidence.
[0018] Curiel et al. (in Curiel T J, Coukos G, Zou L, Alvarez X,
Cheng P, Mottram P, Evdemon-Hogan M, Conejo-Garcia J R, Zhang L,
Burow M, Zhu Y, Wei S, Kryczek I, Daniel B, Gordon A, Myers L,
Lackner A, Disis M L, Knutson K L, Chen L, Zou W. Specific
recruitment of regulatory T cells in ovarian carcinoma fosters
immune privilege and predicts reduced survival. Nat Med. 2004
September; 10(9):942-9. Epub 2004 Aug. 22) show in studies of
CD4(+)CD25(+)FOXP3(+) T(reg) cells in 104 individuals affected with
ovarian carcinoma, that human tumor T(reg) cells suppress
tumor-specific T cell immunity and contribute to growth of human
tumors in vivo. Blocking T(reg) cell migration or function is
proposed in order to help to defeat human cancer.
[0019] Kobayashi et al. (in Kobayashi N, Hiraoka N, Yamagami W,
Ojima H, Kanai Y, Kosuge T, Nakajima A, Hirohashi S. FOXP3+
regulatory T cells affect the development and progression of
hepatocarcinogenesis. Clin Cancer Res. 2007 Feb. 1; 13(3):902-11)
describe that CD4+CD25+FOXP3+ regulatory T cells (Tregs) suppress
the immune reaction, and the clinicopathologic significance and
roles of Tregs and CD8+ T cells during hepatocarcinogenesis was
examined. The patient group with a high prevalence of Tregs
infiltrating HCC showed a significantly lower survival rate
(P=0.007). Multivariate analysis revealed that the prevalence of
Tregs infiltrating HCC was an independent prognostic factor. A high
prevalence of Tregs infiltrating HCC is described to be an
unfavorable prognostic indicator.
[0020] It is an object of the present invention, to provide an
improved method of cancer diagnostics based on the DNA methylation
analysis and, optionally, packaging of the chromatin structure as a
superior tool that can supplement or replace conventional
methodologies, in order to reliably identify FoxP3-positive
regulatory T cells, preferably CD25.sup.+CD4.sup.+ regulatory T
cells, of a mammal and/or in a mammal. Based on the presence or
absence of said FoxP3-positive regulatory T cells, preferably
CD25.sup.+CD4.sup.+ regulatory T cells, improved options for the
treatment of cancerous diseases can be provided and employed.
BRIEF SUMMARY OF THE INVENTION
[0021] The present invention relates to a method, in particular an
in vitro method, for pan-cancer diagnostics, comprising identifying
the amount and/or proportion of stable regulatory T cells in a
patient suspected of having cancer through analyzing the
methylation status of at least one CpG position in the gene foxp3
and/or the gene camta1 or orthologous or paralogous genes thereof,
wherein an increased amount and/or proportion of stable regulatory
T cells in said patient is indicative for an unspecific cancerous
disease. In a second aspect thereof, the present invention relates
to a method for diagnosing the survival of a cancer patient,
comprising identifying the amount and/or proportion of stable
regulatory T cells in said cancer patient through analyzing the
methylation status of at least one CpG position in the gene foxp3
and/or the gene camta1 or orthologous or paralogous genes thereof,
wherein a demethylation in the gene foxp3 and/or the gene camta1 or
orthologous or paralogous genes thereof, is indicative of a stable
regulatory T cell, and wherein an increased amount and/or
proportion of stable regulatory T cells in said cancer patient is
indicative for a shorter survival for said cancer patient.
Furthermore, the present invention relates to an improved treatment
of cancers based on the inventive methods, and a kit for performing
the above methods as well as respective uses.
[0022] For the purpose of the present invention all references as
cited herein as well as the sequence listing are incorporated by
reference in their entireties.
BRIEF DESCRIPTION OF SEQUENCES
[0023] SEQ ID NO: 1 to SEQ ID NO: 10 show preferred
oligonucleotides as used in the present examples for foxp3.
[0024] SEQ ID NO: 11 shows the nucleic acid sequence of camta1.
BRIEF DESCRIPTION OF DRAWINGS
[0025] The file of this patent contains at least one drawing
executed in color. Copies of this patent with the color drawing
will be provided by the Patent and Trademark Office upon request
and payment of the necessary fee.
[0026] FIG. 1 shows the stable Foxp3 expression in CD25+CD4+ Tregs.
CD25+CD4+ Tregs were isolated ex vivo, labelled with CFSE and
transferred into syngeneic recipients (2.times.10.sup.6/mouse).
Before transfer, sorted cells were analyzed for intracellular Foxp3
expression by FACS. Fourteen days after transfer, splenocytes of
recipient mice were stained for CD4, CD25 and Foxp3 and analyzed by
FACS. Representative dot and histogram plots from four
independently analyzed mice were selected. Numbers display
frequency of cells within indicated populations. Comparable results
were obtained for cells isolated from peripheral or mesenteric
LNs.
[0027] FIGS. 2A and 2B show the selectively demethylated CpG motifs
within the foxp3 locus in CD25+CD4+ Tregs isolated from secondary
lymphoid organs. (FIG. 2A) Schematic view on the foxp3 locus
depicts exon-intron structure and position of selected amplicons
(Amp 1-4). Shown is the distribution and position of individual CpG
motifs within the amplicons. (FIG. 2B) CD25+CD4+ and CD25-CD4+ T
cells were sorted from spleens and lymph nodes pooled from 20 male
BALB/c mice. FACS analysis shows the sort purity (upper panel) and
Foxp3 expression in sorted subsets (lower panel). Numbers display
frequency of cells within indicated populations. (C) Methylation
pattern of selected amplicons of the foxp3 locus in CD25+CD4+ Tregs
and conventional CD25-CD4+ T cells. The amplicons are subdivided by
horizontal lines each representing an individual CpG motif. ESME
software is used for normalisation and quantification of
methylation signals from sequencing data by calculating ratios of T
and C signals at CpG sites. Data are condensed to methylation
information at CpG positions forming matrices of consecutive CpGs.
The methylation status of individual CpG motifs within the four
amplicons is gray-coded according to the degree of methylation at
that site. The color code ranges from yellow (0% methylation) to
blue (100% methylation) according to the gray scale on the right.
CpG motifs from amplicon 2 overlapping with motifs in amplicon 1
were excluded. Due to sequencing problems, the CpG motif 37 from
amplicon 4 is not listed. One representative out of two individual
experiments is shown.
[0028] FIG. 3 shows the increased histone acetylation and K4
trimethylation in CD25+CD4+ Tregs. ChIP assays were performed with
CD25+CD4+ Tregs (black bars) and conventional CD25-CD4+ T cells
(open bars) sorted from spleens and lymph nodes pooled from 20 male
BALB/c mice. DNA fragments binding to acetylated or trimethylated
histones were immunoprecipitated using antibodies directed against
acetylated histone H3, acetylated histone H4 or trimethylated
histone H3 at position K4. A rabbit isotype IgG served as control.
Precipitated DNA was quantified by real-time PCR with primers
specific for the differentially methylated region of the foxp3
locus. Sample PCR products were set in relation to input DNA. One
representative out of two individual experiments is shown.
[0029] FIGS. 4A and 4B show the demethylated CpG motifs within the
foxp3 locus in CD25+CD4 SP thymocytes. (FIG. 4A) CD25+CD4+CD8- and
CD25-CD4+CD8- subsets were sorted from thymocytes pooled from 30
male BALB/c mice. FACS analysis shows purity of sorted subsets
(upper panel) and Foxp3 expression in gated CD25- and CD25+ subsets
of CD4+ SP thymocytes (lower panel). Numbers display frequency of
cells within indicated populations. (FIG. 4B) Methylation pattern
of selected amplicons of the foxp3 locus in CD25+ and CD25-CD4 SP
thymocytes. The methylation status of individual CpG motifs within
the four amplicons is color-coded as described in FIG. 2. One
representative out of two individual experiments is shown.
[0030] FIGS. 5A and 5B show that TGF-.beta.-induced Tregs harbour
partially demethylated CpG motifs within the foxp3 locus. (FIG. 5A)
CD25-CD4+ T cells sorted from spleens and lymph nodes pooled from
20 male BALB/c mice were cultured for 6 days in the presence of
TGF-.beta.. Cells cultured under Th1 conditions were used as
control. Within the starting population, <1% of the cells were
Foxp3+ (not shown). On day 6, cultured cells were FACS-sorted for
CD25+ cells. FACS analysis shows the purity of sorted subsets
(upper panel) and Foxp3 expression in gated CD25+ cells derived
from indicated cultures (lower panel). Numbers display frequency of
cells within indicated populations. (FIG. 5B) Methylation pattern
of selected amplicons of the foxp3 locus in sorted CD25+ cells
derived from indicated cultures. The methylation status of
individual CpG motifs within the four amplicons is color-coded as
described in FIG. 2 (n.a., not analyzed). One representative out of
two individual experiments is shown.
[0031] FIGS. 6A and 6B show that TGF-.beta.-induced Foxp3+ Tregs
loose Foxp3 expression upon restimulation. (FIG. 6A) CD25-CD4+ T
cells were cultured for 6 days in the presence of TGF-.beta. as
described in FIG. 5. On day 6, cultured cells were FACS-sorted for
CD25+ cells and analyzed for intracellular Foxp3 expression by FACS
(upper panel). Sorted CD25+ cells from the same
TGF-.quadrature.-cultures were restimulated for another 6 days in
the absence of TGF-.beta.. On day 6, cultured cells were analyzed
for intracellular Foxp3 expression by FACS (lower panel). Numbers
display frequency of cells within indicated populations. (FIG. 6B)
Ex vivo isolated CD25+CD4+ Tregs were analyzed for intracellular
Foxp3 expression by FACS (upper panel) and expanded by in vitro
stimulation for 6 days. On day 6, expanded Tregs were analyzed for
intracellular Foxp3 expression by FACS (lower panel). Numbers
display frequency of cells within indicated populations. One
representative out of two individual experiments is shown.
[0032] FIG. 7 shows CpG motifs and transcription factor binding
sites within conserved region of the foxp3 locus. Alignment of
mouse (upper row) and human (lower row) genomic sequences
corresponding to amplicons 1 and 2 of the foxp3 locus identified a
highly conserved 374-bp region, which is depicted in bold letters.
Individual CpG motifs are shown underlined and putative
transcription factor binding site core elements, which were
identified using the TRANSFAC.RTM. database and the search tool
MATCH.RTM., are illustrated in bold.
[0033] FIG. 8 shows the differential methylation of the gene for
CAMTA1 between regulatory T-cells and 9 types of blood cells. The
basis for the gene is CAMTA1: Calmodulin-binding transcription
activator 1; Ensembl Human Gene: ENSG00000171735. On the left side,
the CpG-positions of the amplicon as analyzed (amplicon 869) are
indicated. The abbreviations for the types of blood cells are as
follows:
TREG CD4+CD25+FOXP3+ regulatory T-cells;
BCST18 CD15+ granulocytes;
BCST19 CD14+ monocytes;
BCST20 CD56+ NK-cells;
BCST21 CD4+CD27+CD45RA+ naive T-cells;
BCST22 CD4+CD27+CD45RA- memory T-cells;
BCST23 CD8+CD27+CD45RA+ naive cytotoxic T-cells;
BCST24 CD8+CD27+CD45RA- memory cytotoxic T-cells;
BCST25 CD19+ naive B-cells; and
BCST26 memory B-cells.
DETAILED DISCLOSURE OF THE INVENTION
[0034] According to a first aspect thereof, the present invention
solves the above object by providing a method for pan-cancer
diagnostics, comprising identifying the amount and/or proportion of
stable regulatory T cells in a patient suspected of having cancer
through analysing the methylation status of at least one CpG
position in the gene foxp3 and/or the gene camta1 or orthologous or
paralogous genes thereof, wherein an increased amount and/or
proportion of stable regulatory T cells in said patient is
indicative for an unspecific cancerous disease.
[0035] As used herein, the term "patient suspected of having
cancer" refers to a subject that presents one or more symptoms
indicative of a cancer (e.g., a noticeable lump or mass). A patient
suspected of having cancer may also have on or more risk factors. A
patient suspected of having cancer has generally not been tested
for cancer. However, a "patient suspected of having cancer"
encompasses an individual who has received an initial diagnosis
(e.g., a CT scan showing a mass) but for whom the sub-type or stage
of cancer is not known. The term further includes patients who once
had cancer (e.g., an individual in remission).
[0036] The analysis of foxp3 and/or camta1 as a so-called
"pan-cancer markers" has the advantage that they can be very
sensitive and specific for a kind of "cancer-yes/no" information,
but at the same time need not to give a clear indication about the
localization of the cancer (e.g. need not to be tissue- and/or
cell-specific). Thus, this allows for a simplified generation of
qualitative and improved diagnostic marker panels for proliferative
diseases, since a sensitive and, for example, a very
tissue-specific marker can be combined in such a diagnostic marker
panel. Nevertheless, the present method according to the invention,
in particular in embodiments for following-up (monitoring) of once
identified proliferative diseases, can also include a quantitative
analysis of the expression and/or the methylation of the markers as
employed. A preferred embodiment of the method according to the
invention thus further comprises the analysis of at least one
cancer- and/or tissue-specific marker. Respective markers are well
known in the literature. Thus, for a localization of the
cancer/determination of the type of cancer, a detection of specific
tissue markers based on, e.g., nucleic acid-analysis is performed,
and the two results of the marker analyses are combined in order to
provide a localization of the cancer/determination of the type of
cancer (characterization thereof).
[0037] The term "pan-cancer marker" refers to a marker (in the
present case, foxP3 and/or camta1) that may be detectable if
present in blood, serum or other bodily fluids, or preferably in
tissues that is reflective of the presence of proliferative
disease. Pan-cancer markers are characterized by the fact that they
reflect the possibility of the presence of more than one,
preferably a multitude of, proliferative diseases in organs or
tissues of the patient and/or subject. Thus, pan-cancer markers are
not specific for a single proliferative disease being present in an
organ or tissue, but are specific for more than one proliferative
disease for said patient. The term may alternately refer to a
specific characteristic of said marker, such as, but not limited
to, a specific methylation pattern, making the marker
distinguishable from otherwise identical markers. Typically, this
marker is derived from the tumor itself.
[0038] According to a another important aspect thereof, the present
invention solves the above object by providing a method for
diagnosing the survival of a cancer patient, comprising identifying
the amount and/or proportion of stable regulatory T cells in said
cancer patient through analysing the methylation status of at least
one CpG position in the gene foxp3 or an orthologous or paralogous
gene thereof, wherein a demethylation in the gene foxp3 and/or
camta1 or orthologous or paralogous genes thereof, is indicative of
a stable regulatory T cell, and wherein an increased amount and/or
proportion of stable regulatory T cells in said cancer patient is
indicative for a shorter survival for said cancer patient.
[0039] Preferably, said stable regulatory T cell is a
CD25.sup.+CD4.sup.+ regulatory T cell.
[0040] In the context of the present invention, it was surprisingly
found that the methylation status of at least one CpG position in
the gene camta1 is indicative of a stable regulatory T cell. Thus,
according to a second aspect thereof, the present invention solves
the above object by providing a method for identifying
Camta1-positive regulatory T cells, preferably CD25.sup.+CD4.sup.+
regulatory T cells of a mammal, comprising analysing the
methylation status of at least one CpG position in the gene camta1
or an orthologous or paralogous gene thereof. Said method can be
performed in vitro and/or in vivo. Preferred is a method according
to the invention, wherein said Camta1-positive regulatory T cells,
preferably CD25.sup.+CD4.sup.+ regulatory T cells are stable
Camta1-positive regulatory T cells, preferably stable
CD25.sup.+CD4.sup.+ regulatory T cells. The analysis of the
accessibility of the Camta1 locus provides additional information,
besides the mere expression of Camta1, to what extent a permanent
conversion into a regulatory T cell lineage has occurred.
[0041] More preferably, said analysis of the methylation status
according to the invention comprises analysing the methylation
status of at least one CpG position in the 5' region upstream from
the transcription start, promoter regions, introns, and/or
exon/intron borders of the gene foxp3 and/or camta1.
[0042] The inventors have identified particular regions within the
Foxp3 and the Camta1 gene, which are functionally involved in the
regulation of stable Foxp3 and Camta1 expression, respectively, in
regulatory T cells. These regions contain many CpG motifs, which
display a differential methylation status when cells expressing
Camta1 and/or Foxp3 (preferably CD25.sup.+CD4.sup.+) compared with
cells not expressing Camta1 and/or Foxp3 (preferably
CD25.sup.-CD4.sup.+), if, for example, the bisulphite sequencing
method is used. The inventors could demonstrate that in Foxp3.sup.+
and/or Camta1.sup.+ cells the CpG motifs are almost completely
demethylated (i.e. to more than 70%, preferably 80%, preferably,
more than 90% and most preferred more than 95%), whereas the same
motifs are completely methylated in Foxp3.sup.- and/or Camta1.sup.-
cells. The differential methylation of the CpG motifs within the
aforementioned region strongly correlates with Foxp3 and/or Camta1
expression. Thus, determination of the methylation status of the
foxp3 and/or camta1 loci could become a valuable tool to identify
stable populations of regulatory T cells required for clinical
application in the treatment of cancer, autoimmune disease,
transplant rejection or allergy.
[0043] Further preferred is an analysis of the methylation status
according to the invention that comprises analysing the methylation
status of at least one CpG position in the 5' region upstream from
the transcription start, promoter regions, introns, and/or
exon/intron borders of the gene foxp3 and/or camta1.
[0044] Whether Treg differentiation also involves elements of
epigenetic regulation has not been studied thus far. The inventors
therefore investigated whether epigenetic alterations such as DNA
methylation and histone modifications of the foxp3 and/or camta1
loci correlate with Foxp3 and Camta1 expression, respectively. The
selective association of chromatin remodelling with a stable Treg
phenotype established a role of epigenetic imprinting in the
establishment of a committed regulatory cell type.
[0045] The inventors have identified particular regions within the
Foxp3 and Camta1 gene, which are functionally involved in the
regulation of stable Foxp3 or Camta1 expression in regulatory T
cells. This region contains many CpG motifs, which display a
differential methylation status when cells expressing Foxp3 and/or
Camta1 (preferably CD25.sup.+CD4.sup.+) compared with cells not
expressing Foxp3 and/or Camta1 (preferably CD25.sup.-CD4.sup.+),
if, for example, the bisulphite sequencing method is used. The
inventors could demonstrate that in Foxp3.sup.+ and Camta1.sup.+
cells the CpG motifs are almost completely demethylated (i.e. to
more than 70%, preferably 80%, preferably, more than 90% and most
preferred more than 95%), whereas the same motifs are completely
methylated in Foxp3.sup.- and/or Camta1.sup.- cells. The
differential methylation of the CpG motifs within the
aforementioned region strongly correlates with Foxp3 and/or Camta1
expression. Thus, determination of the methylation status of the
foxp3 and/or the camta1 locus could become a valuable tool to
identify the amount and/or proportion of stable regulatory T cells
in order to diagnose the survival of a cancer patient.
[0046] Preferred is a combined analysis of both markers according
to the present invention.
[0047] In the context of the present invention, the term "gene"
shall mean a region of the chromosomal DNA that encodes for a
certain protein, such as FoxP3 or Camta1, and contains other
genetic elements that are responsible for the regulation of said
gene. Thus, a gene includes also introns, enhancers, promoter
sequences and the 5' untranslated region of the gene. In the
present case, the gene will not only include the sequence as given
in Brunkow et al. (Brunkow M E, Jeffery E W, Hjerrild K A, Paeper
B, Clark L B, Yasayko S A, Wilkinson J E, Galas D, Ziegler S F,
Ramsdell F. Disruption of a new forkhead/winged-helix protein,
scurfin, results in the fatal lymphoproliferative disorder of the
scurfy mouse. Nat Genet. 2001 January; 27(1):68-73. Accession
number AF277993) or Bouche et al. (Bouche, N., Scharlat, A.,
Snedden, W., Bouchez, D. and Fromm, H. A novel family of
calmodulin-binding transcription activators in multicellular
organisms J. Biol. Chem. 277 (24), 21851-21861 (2002), Accession
number NP.sub.--056030), but also includes the untranslated regions
upstream and downstream thereof, as depicted in FIGS. 2 and 7, and
as available in the database under Accession number
NC.sub.--000023.
[0048] In the context of the present invention, this fact is
described by the terms "orthologous" or "paralogous" gene. An
"ortholog" is a gene in two or more species that has evolved from a
common ancestor, and is also called an orthologous gene. In the
context of the present invention, Homo sapiens FoxP3 (forkhead box
P3) is therefore an ortholog of the Mus musculus Foxp3 (forkhead
box P3) gene and/or protein. Other orthologs are C. familiaris
LOC491876 (similar to Forkhead box protein P3), and R. norvegicus
LOC317382 (similar to scurfin). "Paralogs" are genes related by
duplication within a genome and are also called a paralogous gene.
Orthologs retain the same function in the course of evolution,
whereas paralogs evolve new functions, even if these are related to
the original one. Included in the term "paralog" is a "pseudogene"
that is a nucleotide sequences that is similar to a normal gene,
but does not produce a functional final product. There are two
variants of pseudogenes. The first requires the final product to be
a protein. The second allows the final product to be an RNA.
[0049] Based on the information as given herein, the person of
skill will be readily able, to compare the orthologous or
paralogous genes (for example using a computer program in order to
align the sequences, such as the fasta program), and to identify
regions and/or CpG positions that can be found in the same regions
and/or even at the same equivalent positions in the (both) genes.
According to the present invention, these regions and/or CpG
positions are regarded as orthologous or paralogous. Usually, an
alignment is based on the level of sequence identity between the
two (or more) DNA fragments that are analyzed. As a preferred
example for foxp3 according to the present invention, a 384-bp
stretch that is differentially methylated in the region as covered
by amplicons 1 and 2 (as described herein), but not the region
covered by amplicons 3 and 4 is highly conserved between mice and
men (80.7% sequence identity), suggesting that in both mammals
functionally important parts can be found that are both subject to
epigenetic regulation. Other levels of sequence identity for the
markers are preferably about 75%, more preferably about 80%, and
most preferred about 90% of a given fragment.
[0050] In a preferred embodiment of the method according to the
present invention, said analysis of the methylation status for
foxp3 comprises amplification with at least one of the primer pairs
selected from SEQ ID NO: 1 and 2; SEQ ID NO: 3 and 4, and
orthologous or paralogous primer pairs thereof.
[0051] Preferably, the amplification involves a polymerase enzyme,
a PCR or chemical amplification reaction, or other amplification
methods as known to the person of skill as described below, e.g. in
the context of MSP, HeavyMethyl, or MethyLight. With the
amplification, amplicons 1 and 2 (as described herein exemplary for
foxp3) or orthologs or paralogs thereof are produced that are
particularly preferred "tools" for performing the method(s)
according to the present invention. Consequently, an oligomer
according to any of SEQ ID NO: 1 to 4 or an amplicon as amplified
by a primer pair selected from SEQ ID NO: 1 and 2, SEQ ID NO: 3 and
4, or orthologous or paralogous oligomers or amplicons constitute
preferred embodiments of the present invention. The same applies
for camta1.
[0052] Based on the above information and the data as obtained from
the murine and/or human system, orthologous or paralogous primer
pairs can be designed by the person of skill having a sequence
identity with the above primers of preferably about 75%, more
preferably about 80%, and most preferred about 90%.
[0053] Even more preferred is a method according to the present
invention, wherein said analysis of the methylation status for
foxp3 comprises analysing the methylation status of at least one
CpG position selected from the group consisting of positions 38,
74, 90, 124, 151, 156, 205, 224, 228, 236, 298, and 368 of the
amplicon as amplified by the primer pair SEQ ID NO: 1 and 2,
positions 158, 180, 308, 344, 360, 394, 421, and 426 of the
amplicon as amplified by the primer pair SEQ ID NO: 3 and 4, and
orthologous or paralogous CpG positions thereof (as also can be
taken from FIG. 2).
[0054] The person of skill will furthermore be able to select
specific subsets of CpG positions in both genes in order to
minimise the amount of sites to be analyzed, for example all sites
as present on amplicon 1 or all sites as present on amplicon 2 or
orthologous or paralogous CpG positions thereof.
[0055] In order to analyze the methylation status of CpG positions,
any known method to analyse DNA methylation can be used. In a
preferred embodiment of the method according to the present
invention, the analysis of the methylation status comprises a
method selected from methylation specific enzymatic digests,
bisulphite sequencing, analysis selected from promoter methylation,
CpG island methylation, MSP, HeavyMethyl, MethyLight, Ms-SNuPE or
other methods relying on a detection of amplified DNA. These
methods are well known to the person of skill, and can be found in
the respective literature.
[0056] Furthermore, preferred is a method according to the
invention, further comprising the step of analysing the packaging
of the chromatin structure in the region of the gene foxp3 or an
orthologous or paralogous gene thereof, wherein an open chromatin
structure in the region of the gene foxp3 and/or camta1 or
orthologous or paralogous genes thereof, is indicative of a stable
regulatory T cell. In order to analyze the packaging of the
chromatin structure, any known method to analyse packaging of the
chromatin structure can be used. In a preferred embodiment of the
method according to the present invention, the analysis of the
packaging of the chromatin structure comprises chromatin
immunoprecipitation (ChIP), in particular using antibodies against
acetylated histones, in particular H3 and/or H4, as described
herein below.
[0057] The method according to the present invention can be
performed with any mammal having the foxp3 and/or camta1 gene or
orthologs or paralogs thereof, preferred is a method according to
the present invention, wherein said mammal is a mouse, rat, monkey
or human, preferably a human.
[0058] The method according to the present invention can be
performed with any mammal having the foxp3 and/or camta1 gene or
orthologs or paralogs thereof, preferred is a method according to
the present invention, wherein said cancer is selected from solid
tumors, breast cancer, ovarian cancer, prostate cancer, and lung
cancer.
[0059] Further preferred is a method, wherein the amount of
regulatory T-cells corresponds to a demethylation of the CpG
positions as analyzed to at least 80%, preferably 90%, and more
preferably 95%.
[0060] Further preferred is a method, wherein the amount of
regulatory T-cells corresponds to a demethylation as above, and an
open chromatin structure in the region of the gene foxp3 and/or
camta1 or orthologous or paralogous genes thereof corresponds to at
least 10-fold of DNA relative to input for Me.sub.3K4.
[0061] The method(s) according to the present invention can be
performed in vitro and/or in vivo. In general, all biological
samples can be used, as long as they contain suitable T-cells.
Preferred is a method, wherein said sample is selected from a
tissue sample and/or a tumour sample (containing, e.g.,
infiltrating T-cells), a blood sample, a sample of blood
lymphocytes or a fraction thereof.
[0062] Further preferred is a method, wherein the amount and/or
proportion of stable regulatory T cells is identified through a
comparison with the methylation status of at least one CpG position
in the gene foxp3 and/or camta1 or orthologous or paralogous genes
thereof in samples selected from all cells as present in said
sample, all T-cells as present in said sample, and the number of
stable regulatory T cells in a healthy patient.
[0063] In one aspect of this particular method, the total
population of T cells in a sample (containing regulatory and
non-regulatory T-cells) is analyzed for their methylation status
and, optionally, the chromatin packaging in the foxp3 and/or camta1
gene. Based on the result of the overall methylation frequency of
the sites and the chromatin packaging, the ratio and/or amount of
regulatory T cells inside the analyzed population can be
determined. From said result, it can be concluded on the immune
status and/or T cell status of the mammal as diagnosed. Preferred
is a method, wherein an amount of regulatory T-cells corresponds to
a demethylation of the CpG positions as analyzed to at least 80%,
preferably 90%, and more preferably 95%.
[0064] Another important aspect of the present invention then
relates to a method according to the present invention, which
further comprises the step of providing a treatment for said cancer
patient wherein said treatment reduces the amount and/or proportion
of stable regulatory T cells in said cancer patient. Preferred is a
method according to the present invention, wherein said treatment
is selected from providing chemical and/or biological substances
that selectively kill regulatory T-cells in said patient, or a
treatment that reduces the expression of the gene foxp3 or inhibits
the biological activity of FoxP3 and/or Camta1 in said regulatory
T-cells in said patient. Preferred examples of such treatments are
selected from an antibody that is selective for regulatory T-cells,
such as an anti-CD25-antibody, a cytotoxic substance that is
selective for regulatory T-cells, such as denileukin diftitox
(Ontak.RTM.), antisense nucleic acids against the expression of the
gene foxp3 and/or camta1, and methylating agents that provide for
an increased methylation of the gene foxp3 and/or camta1.
[0065] Even further preferred is a method according to the
invention which further comprises measuring and/or monitoring the
amount or ratio of said regulatory T cells in response to the
chemical and/or biological substances as mentioned above. That is,
changes in the amount or ratio of regulatory T cells that are
caused by, for example, the treatment of a disease (e.g. as
described herein), and the success and/or progress of said
treatment in terms of an effect on regulatory T cells can be
followed using this method. A follow-up of the methylation pattern
and, optionally, the chromatin structure of T cells based on the
marker herein will point to changes in the cells that are due to a
response to said chemical and/or biological substances, in some
cases even before a phenotypic change can be observed.
[0066] In yet another aspect of the present invention, the present
invention provides a method for identifying chemical and/or
biological substances that selectively kill or revert foxp3 and/or
camta1 expressing regulatory T cells, comprising contacting one or
more of said chemical and/or biological substance with said T cell,
and detecting, whether said chemical and/or biological substance
modulates the methylation of the CpG positions as analyzed and/or,
optionally, opening of the chromatin structure in the region of the
gene foxp3 and/or camta1 or orthologous or paralogous genes
thereof, and/or whether said one or more of said chemical and/or
biological substance selectively kills (or inhibits) foxp3 and/or
camta1 expressing regulatory T cells.
[0067] The method can be performed in vitro and/or in vivo. In this
aspect, the present invention provides a method, sometimes called a
"screening-method", that seeks to identify chemical and/or
biological substances modulating foxp3 and/or camta1 expression
that can be used as starting points for the development of
regulatory T cell specific medication and respective pharmaceutical
compositions. The present method is based on the fact that it is
well accepted that the foxp3 and/or camta1 gene plays a central
role for the development of regulatory T cells. Therefore, factors
preventing Foxp3 and/or Camta1 expression are interesting for the
treatment of tumour patients, where Foxp3.sup.+ regulatory T cells
have been shown to prevent a strong anti tumour response. Such
factors, which lead to a stable modification of Foxp3 and/or Camta1
expression, can be detected with the method described in this
invention.
[0068] Chemical and/or biological substances that are suitable as
screening compounds are known to the person of skill and, for
example, include small molecules, peptides and proteins, and
antibodies or fragments thereof. Furthermore, the screening can be
done using a commercially compound library, optimally together with
suitable automation, such as a robot. In one preferred embodiment
of the method for identifying chemical and/or biological
substances, said substance provides a remethylation of the CpG
positions as analyzed to at least 80%, preferably 90%, and more
preferably 95%, and/or an closing of the chromatin structure in the
region of the gene foxp3 and/or camta1 or orthologous or paralogous
genes thereof.
[0069] In yet another aspect of the present invention, the present
invention provides a kit for kit for diagnosing the survival of a
cancer patient, comprising materials for performing a method
according to the invention as above. The person of skill will
furthermore be able to select materials for specific subsets of CpG
positions in order to minimise the amount of sites to be analyzed,
for example all sites as present on amplicon 1 or all sites as
present on amplicon 2 or orthologous or paralogous CpG positions
thereof. The same applies to the analysis of camta1. The kit can be
a diagnostic kit.
[0070] The kits according to the present invention may also
contain: 1. Chemicals (bisulfite, etc.) for processing the cell
samples; 2. Procedure protocols; 3. Oligonucleotide probes,
amplicons, blockers or extension primers according to the present
invention that will detect markers relevant to a particular cell
type. The oligonucleotides would be constructed to generate a
signal on a commonly available detection platform, such as Real
Time-PCR (RT-PCR) or Single Base Extension (SBE). Each signal
indicates the level of methylation at a particular target site in
the sample. As an alternative, probes according to the described
nucleic acids could be produced for usage on a chip; 4. A
bioinformatic tool to process the results. This, e.g., software
might normalise the signals from the raw data, contain a result
matrix for interpretation of the read-out, or implement various
algorithms that calculate, for example, cell type proportions, or
potency predictions, and 5. Materials to analyse the chromatin
structure of the Foxp3 gene, in particular for ChIP-analysis.
[0071] Yet another preferred aspect of the present invention
relates to an improved method of treatment of diseases that are
related to Foxp3 and/or Camta1 expression, such as immunological
diseases and/or tumorous diseases, in particular ovarian cancer,
comprising a method as described herein above. The term "treatment"
also includes a prevention of said Foxp3 and/or Camta1 expression
related diseases.
[0072] The analysis of the methylation status and the chromatin
packaging of the region within the foxp3 and/or camta1 loci allows
an improved prediction whether the cell population will stably
express the FoxP3 and/or Camta1 gene or not.
[0073] Both Camta1 and the forkhead box transcription factor Foxp3
have been identified as a specific molecular marker for Tregs and
its expression is essential for programming Treg development and
function (for Foxp3, Fontenot, J. D. and Rudensky, A. Y. A well
adapted regulatory contrivance: regulatory T cell development and
the forkhead family transcription factor Foxp3. Nat Immunol 6,
331-7 (2005)). Although it is widely accepted that Foxp3+ Tregs
represent a stable population mainly generated as a separate
lineage in the thymus, conclusive data on the molecular mechanisms
maintaining stable Foxp3 expression are not available. The
inventors here provide first evidence that epigenetic modifications
of the foxp3 and/or camta1 loci are required to enable long-term
identity of Foxp3.sup.+ and/or Camta1.sup.+ Tregs.
[0074] The inventors have identified an element within the 5'
untranslated region of the foxp3 locus, which displays demethylated
CpG motifs both in developing thymic as well as in mature,
peripheral Foxp3+CD25+CD4+ Tregs. Interestingly, a 374-bp stretch
of the differentially methylated element is highly conserved
between mice and humans (85.8% sequence identity), but not the
region covered by amplicons 3 and 4, which essentially showed no
signs of differential DNA methylation. Preliminary analyses using
cells from human peripheral blood also showed a differential
methylation of CpG motifs within the conserved element of the foxp3
locus when conventional CD25-CD4+ T cells and CD25.sup.highCD4+
Tregs were compared, implying that this region and its epigenetic
regulation is of functional importance. Similar considerations
apply for Camta1.
[0075] In addition to DNA demethylation, also acetylated histones
H3 and H4 as well as trimethylated histone H3 were associated with
the conserved region in CD25+CD4+ Tregs, but not in conventional
CD25-CD4+ T cells. Similar histone modifications have frequently
been reported to concur with DNA demethylation, e.g. as described
for the loci encoding the active cytokines IFN-.gamma. and IL-4 in
differentiated Th1 and Th2 cells, respectively (Reiner, S. L.
Epigenetic control in the immune response. Hum Mol Genet 14 Spec No
1, R41-6 (2005), Tykocinski, L. O. et al. A critical control
element for interleukin-4 memory expression in T helper
lymphocytes. J Biol Chem 280, 28177-85 (2005)). These data suggest
that in terminally differentiated Tregs epigenetic modifications of
the foxp3 locus allow persistent expression of Foxp3. In silico
analysis of the conserved region predicts a number of binding sites
for transcription factors, including ATF/CREB, Elk-1, Ets-1, Evi-1,
Foxp3, NFATc, NF-.kappa.B, SMAD-4 and STAT-1 (see FIG. 7),
indicating that these factors might be involved in the induction of
Foxp3 expression in CD25+CD4+ Tregs. Although the human FOXP3
promoter has recently been mapped to the putative 5' end of exon
-2b, 6.1 kb upstream from the first coding exon6, other studies
have reported promoter activity upstream from exon -1 close to the
evolutionarily conserved region analyzed in the current study
(Bassuny, W. M. et al. A functional polymorphism in the
promoter/enhancer region of the FOXP3/Scurfin gene associated with
type 1 diabetes. Immunogenetics 55, 149-56 (2003), Baratelli, F. et
al. Prostaglandin E2 induces FOXP3 gene expression and T regulatory
cell function in human CD4+ T cells. J Immunol 175, 1483-90 (2005))
corresponding to the Foxp3 mRNA species AY357712 and AY357713.
Similar considerations apply for Camta1.
[0076] These data suggest that the evolutionarily conserved element
might belong to an alternative TATA-less promoter, which
contributes to the regulation of Foxp3 expression. The differential
methylation status of the foxp3 locus in Tregs appears to be a new
example for epigenetic regulation of cell lineage differentiation.
Even though almost all cells in an individual contain the same
complement of DNA code, higher organisms must impose and maintain
different patterns of gene expression in the various types of
differentiated cells. Most gene regulation is transitory, depending
on the current state of the cell and changes in external stimuli.
Persistent regulation, on the other hand, is a primary role of
epigenetics--heritable regulatory patterns that do not alter the
basic genetic coding of the DNA. DNA methylation is the
archetypical form of epigenetic regulation; it serves as the stable
memory for cells and performs a crucial role in maintaining the
long-term identity of various cell types. The inventors' finding
that evolutionarily conserved sequences within the foxp3 locus are
completely and selectively demethylated upon differentiation in
persistent Tregs suggests an important role of epigenetic fixation
for this phenotype.
[0077] Moreover, this seems to be the first report that a
transcription factor acting as master switch for a certain
subpopulation is by itself subject to epigenetic control. The role
of transcription factors such as T-bet or GATA-3 for the
polarization of Th1 and Th2 cells, respectively, has been carefully
studied and their interplay with epigenetically regulated regions
in the respective cytokine genes is seen as a major factor in the
acquisition of cytokine memory (Ansel, K. M., Lee, D. U. and Rao,
A. An epigenetic view of helper T cell differentiation. Nat Immunol
4, 616-23 (2003), Reiner, S. L. Epigenetic control in the immune
response. Hum Mol Genet 14 Spec No 1, R41-6 (2005)).
[0078] However, foxp3 appears to be the first known example, at
least in the immune system, where the transcriptional regulation of
a master transcription factor itself involves epigenetic
mechanisms. Another example appears to be camta1.
[0079] A crucial finding of this study is that chromatin
remodelling of the foxp3 locus does not merely correlate with Foxp3
expression. Rather, the inventors' current data provide first
experimental evidence that the completely demethylated status of
the evolutionarily conserved region is only confined to stable Treg
populations, such as the naturally occurring, thymus-derived
CD25+CD4+ cells, and might indeed be a prerequisite for the
permanent commitment to the suppressor cell lineage. This
assumption is based on the analysis of TGF-.beta.-induced Tregs,
which in spite of Foxp3 expression and suppressive properties have
not acquired a terminally differentiated phenotype and have lost
Foxp3 expression upon restimulation in the absence of TGF-.beta.
This indicates that the recently postulated positive autoregulatory
loop involving upregulation of endogenous TGF-.beta. expression and
subsequent Foxp3-dependent downregulation of Smad7, a negative
regulator of TGF-.beta. signalling, is not sufficient to induce
stable Foxp3 expression in vitro (Fantini, M. C. et al. Cutting
edge: TGF-beta induces a regulatory phenotype in CD4+CD25- T cells
through Foxp3 induction and down-regulation of Smad7. J Immunol
172, 5149-53 (2004)). As TGF-.beta.-induced Tregs display only
weakly demethylated CpG motifs within the conserved region of the
foxp3 locus, a more complete CpG demethylation might be the key for
a stable Foxp3 expression, similar to what has recently been
reported for IL-2 (Bruniquel, D. and Schwartz, R. H. Selective,
stable demethylation of the interleukin-2 gene enhances
transcription by an active process. Nat Immunol 4, 235-40
(2003)).
[0080] The findings of this study have important implications with
respect to clinical applications, as the detection of demethylated
foxp3 and/or camta1 sequences might allow the development of novel
diagnostic tools for the quantification of Tregs in blood or
tissues.
[0081] An increased number of Tregs was observed in patients with a
variety of malignant cancers (Schaefer, C. et al. Characteristics
of CD4+CD25+ regulatory T cells in the peripheral circulation of
patients with head and neck cancer. Br J Cancer 92, 913-20 (2005),
Ormandy, L. A. et al. Increased populations of regulatory T cells
in peripheral blood of patients with hepatocellular carcinoma.
Cancer Res 65, 2457-64 (2005), Roncador, G. et al. FOXP3, a
selective marker for a subset of adult T-cell leukaemia/lymphoma.
Leukemia 19, 2247-53 (2005)) and is involved in tumour progression
(Curiel, T. J. et al. Specific recruitment of regulatory T cells in
ovarian carcinoma fosters immune privilege and predicts reduced
survival. Nat Med 10, 942-9 (2004), Wolf, D. et al. The expression
of the regulatory T cell-specific forkhead box transcription factor
FoxP3 is associated with poor prognosis in ovarian cancer. Clin
Cancer Res 11, 8326-31 (2005), Beyer, M. et al. In vivo peripheral
expansion of naive CD4+CD25high FOXP3+ regulatory T cells in
patients with multiple myeloma. Blood (2006)).
[0082] Most notably, the presence of Tregs, as defined by the gene
expression of FOXP3, has been shown to constitute a significant
predictive parameter for the clinical outcome in ovarian cancer
patients (Curiel, T. J. et al. Specific recruitment of regulatory T
cells in ovarian carcinoma fosters immune privilege and predicts
reduced survival. Nat Med 10, 942-9 (2004), Wolf, D. et al. The
expression of the regulatory T cell-specific forkhead box
transcription factor FoxP3 is associated with poor prognosis in
ovarian cancer. Clin Cancer Res 11, 8326-31 (2005)). However, the
analytical value of flow cytometry, immunohistological and mRNA
expression analysis of CD25 and Foxp3 as an accurate diagnostic
tool is blurred by both the ambiguity of the markers and the
instability of the biological materials.
[0083] Measurement of the methylation status of the foxp3 and/or
camta1 loci could present more reliable and objective criteria for
the identification and quantification of Tregs. Moreover, DNA
methylation is intrinsically a more stable parameter than mRNA
expression or protein synthesis and can be accurately quantified
(Baron, U. et al. DNA Methylation Analysis as a Tool for Cell
Typing. Epigenetics 1, 55-60 (2006)). Therefore, the inventors
believe that establishment of a measurement system for the
methylation status of the human foxp3 and/or camta1 loci provides a
novel diagnostic tool in tumour patients.
[0084] The present invention shall now be further described in the
following examples without being limited thereto. It should be
noted that the present examples have been performed with foxp3,
nevertheless, the person of skill will be readily able to modify
the examples in order to adopt these to camta1-analysis. In the
accompanying Figures and Sequences,
[0085] Table 1 shows the methylation status of individual CpG
motifs within the foxp3 locus. Summary of all DNA methylation
analyses performed for indicated subsets. Shown is the degree of
methylation (in %) for individual CpG motifs (n.a., not analyzed).
CpG motifs from amplicon 2 overlapping with motifs in amplicon 1
were excluded.
EXAMPLES
Mice
[0086] BALB/c mice were bred at the BfR (Bundesinstitut fuer
Risikobewertung, Berlin, Germany) and used at 6-12 wk of age. All
animal experiments were performed under specific pathogen free
conditions and in accordance with institutional, state and federal
guidelines.
Antibodies, Staining Reagents and Cytokines
[0087] The following antibodies were produced in the inventors'
laboratory: anti FcR II/III (2.4G2), anti CD4 (GK1.5), anti CD3
(145.2C11), anti CD28 (37.51) and anti IL-4 (11B11). The following
antibodies and secondary reagents were purchased from BD
PharMingen: anti CD4 (RM4-5), anti CD19 (1D3), anti CD25 (7D4),
anti CD8 (53-6.7), anti CD25 (PC6.1), anti CD62L (Mel-14),
streptavidin, and appropriate isotype controls. The PE anti-mouse
Foxp3 staining set was purchased from eBioscience. All microbeads
were obtained from Miltenyi Biotec and all cytokines from RandD
systems.
Flow Cytometry
[0088] Cytometric analysis was performed as previously described
(Huehn, J. et al. Developmental stage, phenotype and migration
distinguish naive- and effector/memory-like CD4+ regulatory T
cells. J Exp Med 199, 303-313 (2004)) using a FACS Calibur or a
LSRII (BD Biosciences) and the CellQuest.TM. software. Dead cells
were excluded by PI (propidium iodide) or DAPI
(diamidophenylindole) staining (Sigma). Intracellular Foxp3
staining was performed with the PE anti-mouse Foxp3 staining set
according to the manufacturers instructions.
Ex Vivo Cell Sorting
[0089] CD4+ T cells were isolated from pooled spleen and lymph node
(LN) single cell suspensions by using anti CD4-FITC plus anti FITC
multisort microbeads and the AutoMACS magnetic separation system
(Miltenyi Biotec). After release of beads according to the
manufacturer's instructions, CD25+ and CD25- cells were separated
using anti CD25-APC plus anti APC microbeads. Thymic single cell
suspensions were sorted for CD8+ and CD8- cells using anti CD8
microbeads and the AutoMACS magnetic separation system. MACS-sorted
CD8-thymocytes were subsequently stained using anti CD4-FITC, anti
CD25-APC and anti CD19-PE and sorted into CD25+ and CD25- subsets
of CD4 SP thymocytes as well as into CD19-DN thymocytes by FACS
(Aria, BD Bioscience). MACS-sorted CD8+ thymocytes were stained
using anti CD4-FITC and anti CD8-PerCP and sorted into DP
thymocytes by FACS. All subsets were sorted to a purity of
>98%.
Adoptive Transfer of Sorted CD25+CD4+ T cells
[0090] Sorted CD25+CD4+ T cells were labeled with CFSE (Molecular
Probes) as described before (Siegmund, K. et al. Migration matters:
regulatory T cell compartmentalization determines suppressive
activity in vivo. Blood 106, 3097-3104 (2005)). 2.times.10.sup.6
CFSE-labeled cells were adoptively transferred into syngeneic
recipients. Fourteen days after transfer, single cell suspensions
of spleen, peripheral and mesenteric LNs were prepared and stained
for CD4, CD25 and Foxp3 as described above.
TGF-.beta.-Induced Tregs
[0091] D4+ T cells were isolated from pooled spleen and LN single
cell suspensions by using anti CD4-FITC plus anti FITC multisort
microbeads and the AutoMACS magnetic separation system (Miltenyi
Biotec). After release of beads according to the manufacturer's
instructions, CD25+ cells were depleted by using anti CD25-APC plus
anti APC microbeads. To avoid the expansion of pre-committed Foxp3+
Tregs, the inventors excluded the majority of residual Foxp3+ Tregs
from the CD25-CD4+ T cell fraction by sorting for CD62L.sup.high
cells using anti CD62L microbeads. MACS-sorted
CD62L.sup.highCD25-CD4+ T cells were stimulated for 3 days using
plate bound anti CD3 (6 .mu.g/ml) and anti CD28 (4 .mu.g/ml). For
Th1 cultures 5 .mu.g/ml anti-IL-4, 20 ng/ml IFN-.gamma. and 5 ng/ml
IL-12 was added to the medium. For TGF-.beta. cultures 5 ng/ml
TGF-.beta. and 10 ng/ml IL-2 was used. After 3 days, cells were
removed from the stimulus, transferred to non-coated plates and
cultured for another 3 days. All cell culture was done with RPMI
1640 (Gibco) supplemented with 10% FCS (Sigma). On day 6, cultured
cells were stained using anti CD25-APC and sorted for CD25+ cells
by FACS (Aria). Foxp3 expression of sorted CD25+ cells was analyzed
by intracellular staining. For restimulation experiments sorted
CD25+ cells were stimulated for 3 days using plate bound anti CD3
(6 .mu.g/ml) and anti CD28 (4 .mu.g/ml) plus IL-2 (10 ng/ml). After
3 days, cells were removed from the stimulus, transferred to
non-coated plates and cultured for another 3 days. On day 6,
cultured cells were stained for CD25 and Foxp3 as described
above.
Expansion of CD25+CD4+ Tregs
[0092] CD25+ cells were enriched from pooled spleen and LN single
cell suspensions by using anti CD25-FITC, anti FITC microbeads and
the AutoMACS magnetic separation system (Miltenyi Biotec).
MACS-enriched CD25+ T cells were subsequently stained using anti
CD4-PerCP and anti CD62L-APC and sorted for CD62L.sup.highCD25+CD4+
Tregs by FACS (Aria, BD Bioscience). CD62L.sup.high Tregs were used
to avoid the expansion of Foxp3-CD25+ effector T cells. FACS-sorted
CD62L.sup.highCD25+CD4+ Tregs were stimulated for 3 days using
plate bound anti CD3 (6 .mu.g/ml) and anti CD28 (4 .mu.g/ml) plus
IL-2 (40 ng/ml) followed by transfer to non-coated plates and
culture for another 3 days. On day 6, cultured cells were stained
for CD25 and Foxp3 as described above.
Bisulphite Sequencing
[0093] Genomic DNA was isolated from purified T cells using the
DNeasy tissue kit (Qiagen) following the supplier's
recommendations. Sodium bisulphite treatment of genomic DNA was
performed according to Olek et al. (Olek, A., Oswald, J. and
Walter, J. A modified and improved method for bisulphite based
cytosine methylation analysis. Nucleic Acids Res 24, 5064-6 (1996))
with minor modifications, resulting in the deamination of
unmethylated cytosines to uracil, whereas methylated cytosines
remain unchanged. In a subsequent PCR amplification uracils were
replicated as thymidines. Thus, detection of a "C" in sequencing
reactions reflects methylation of the genomic DNA at that site.
Detection of a "T" at the same site instead reflects the absence of
a methyl modification of the genomic cytosine.
[0094] PCRs were performed on MJ Research thermocyclers (Waltham)
in a final volume of 25 .mu.l containing 1.times.PCR Buffer, 1 U
Taq DNA polymerase (Qiagen), 200 .mu.M dNTPs, 12.5 pmol each of
forward and reverse primers, and 7 ng of bisulphite-treated genomic
DNA. The amplification conditions were 95.degree. C. for 15 min and
40 cycles of 95.degree. C. for 1 min, 55.degree. C. for 45 sec and
72.degree. C. for 1 min and a final extension step of 10 min at
72.degree. C. PCR products were purified using ExoSAP-IT USB Corp.)
and sequenced in both directions applying the PCR primers and the
ABI Big Dye Terminator v1.1 cycle sequencing chemistry (Applied
Biosystems) followed by capillary electrophoresis on an ABI 3100
genetic analyzer. Trace files were interpreted using ESME, which
normalizes sequence traces, corrects for incomplete bisulphite
conversion and allows for quantification of methylation signals
(Lewin, J., Schmitt, A. O., Adorjan, P., Hildmann, T. and
Piepenbrock, C. Quantitative DNA methylation analysis based on
four-dye trace data from direct sequencing of PCR amplificates.
Bioinformatics 20, 3005-12 (2004)). For each sample both PCR
amplification and sequencing was repeated once. The following
primers (5' to 3' direction) were used for both PCR amplification
of bisulphite converted genomic DNA and sequence reactions:
TABLE-US-00001 Amp1 (fw: AGGAAGAGAAGGGGGTAGATA; SEQ ID NO: 1; rev:
AAACTAACATTCCAAAACCAAC; SEQ ID No. 2) Amp2 (fw:
ATTTGAATTGGATATGGTTTGT; SEQ ID NO: 3; rev: AACCTTAAACCCCTCTAACATC;
SEQ ID No. 4) Amp3 (fw: AGAGGTTGAAGGAGGAGTATTT; SEQ ID NO: 5; rev:
ACTATCTATCCAATTCCCCAAC; SEQ ID No. 6) Amp4 (fw:
TGGTTGTTTTGGAGTTTAGTGT; SEQ ID NO: 7; rev: CACTTTTCTACCTTCCACAAAT;
SEQ ID No. 8)
Chromatin Immunoprecipitation (ChIP)
[0095] ChIP analysis was carried out according to the
manufacturer's protocol (Upstate). Cells (1-5.times.10.sup.6) were
fixed with 1% formaldehyde and chromatin was fragmented by
ultrasound. For all ChIP samples, sheared chromatin was precleared
by incubation with ProteinA/agarose/salmon sperm DNA (Upstate).
Subsequently, chromatin was immunoprecipitated by overnight
incubation at 4.degree. C. with 4 .mu.g antibodies (rabbit isotype,
#2027, Santa Cruz; anti acetyl-histone H3, #06-599, Upstate; anti
acetyl-histone H4, #06-866, Upstate; anti trimethyl-K4-histone H3,
#07-473, Upstate) followed by incubation with Protein
A-agarose/salmon sperm DNA for 1 h. Precipitates were defixed and
DNA was purified by using the NucleoSpin.RTM. Extract II kit
(Macherey-Nagel). The amount of immunoprecipitated DNA was
quantified by real-time PCR with LightCycler (Roche Applied
Science) using SYBR Green and the following primer pair (5' to 3'
direction): TABLE-US-00002 Foxp3 (331 bp) fw: GACTCAAGGGGGTCTCA;
SEQ ID NO: 9; rev: TTGGGCTTCATCGGCAA; SEQ ID NO: 10.
[0096] Sample PCR products were set in relation to the input DNA
using the following equation: E ([DNA.sub.input]-[DNA.sub.IP]).
Bioinformatics
[0097] enomic sequences spanning the foxp3 locus were analyzed
using the alignment software vista
(http://pipeline.lbl.gov/servlet/vgb2/), allowing the
identification of conserved regions. Transcription factor binding
sites were identified using the TRANSFAC.RTM. database (Matys, V.
et al. TRANSFAC and its module TRANSCompel: transcriptional gene
regulation in eukaryotes. Nucleic Acids Res 34, D108-10 (2006)) and
the search tool MATCH.RTM. (Kel, A. E. et al. MATCH: A tool for
searching transcription factor binding sites in DNA sequences.
Nucleic Acids Res 31, 3576-9 (2003)).
CD25+CD4+ Tregs Display a Stable Foxp3 Expression
[0098] It is assumed that Foxp3+CD25+CD4+ Tregs represent an
individual lineage exhibiting a stable phenotype. To prove
experimentally the stability of Foxp3 expression in natural Tregs
on a cellular level, the inventors adoptively transferred sorted
CD25+CD4+ T cells after CFSE-labeling into syngeneic recipients.
Fourteen days after transfer, >95% of CFSE+ cells, including
those which had divided once or twice according to loss of CFSE,
were still Foxp3+ (FIG. 1), supporting data from a recent
publication using a lymphopenic transfer model (Suffia, I. J.,
Reckling, S. K., Piccirillo, C. A., Goldszmid, R. S. and Belkaid,
Y. Infected site-restricted Foxp3+ natural regulatory T cells are
specific for microbial antigens. J Exp Med 203, 777-88 (2006)).
Having shown that Foxp3 is stably expressed in CD25+CD4+ Tregs, the
inventors next asked whether epigenetic modifications of the foxp3
locus might account for the maintenance of the long-term identity
of Foxp3+ Tregs.
Epigenetic Modifications of the Foxp3 Locus in Foxp3+CD25+CD4+
Tregs
[0099] The lymphoproliferative disorder of scurfy mice is
completely rescued by transgenic complementation with a 30.8-kb
genomic fragment containing the foxp3 gene from wild type mice
(Brunkow, M. E. et al. Disruption of a new forkhead/winged-helix
protein, scurfin, results in the fatal lymphoproliferative disorder
of the scurfy mouse. Nat Genet 27, 68-73 (2001)). This indicates
that all regulatory elements required for proper Foxp3 expression
are located within the transgene including the entire gene, as well
as 12.5 kb and 2.8 kb of 5' and 3' flanking sequences,
respectively. The inventors therefore focused the inventors'
analysis of epigenetic modifications on sequences from the 30.8-kb
region and selected specific regions for methylation analysis based
on CpG density (FIG. 2A): Overlapping amplicons 1 and 2 map
upstream from exon -1, amplicon 3 and 4 align to the 7th intron. No
CpG-rich regions were observed within the Foxp3 promoter located at
the putative 5' end of exon -2b, 6.1 kb upstream from the first
coding exon (Mantel, P. Y. et al. Molecular Mechanisms Underlying
FOXP3 Induction in Human T Cells. J Immunol 176, 3593-602 (2006),
Brunkow, M. E. et al. Disruption of a new forkhead/winged-helix
protein, scurfin, results in the fatal lymphoproliferative disorder
of the scurfy mouse. Nat Genet 27, 68-73 (2001)).
[0100] The inventors sorted CD25+CD4+ Tregs and conventional
CD25-CD4+ T cells from secondary lymphoid organs of male mice. Male
mice were chosen to avoid potential artifacts due to random X
chromosome inactivation since Foxp3 is encoded on the X-chromosome
(Brunkow, M. E. et al. Disruption of a new forkhead/winged-helix
protein, scurfin, results in the fatal lymphoproliferative disorder
of the scurfy mouse. Nat Genet 27, 68-73 (2001)). As expected, the
vast majority of sorted CD25+CD4+ Tregs were Foxp3+, whereas <1%
of CD25-CD4+ T cells expressed Foxp3 (FIG. 2B).
[0101] The methylation status of the foxp3 locus was analyzed by
bisulphite sequencing (see Methods). Interestingly, striking
differences between CD25+CD4+ Tregs and conventional CD25-CD4+ T
cells could be observed. CpG motifs within amplicons 1 and 2
displayed a high degree of methylation (.about.100%) within
conventional CD25-CD4+ T cells, but were almost completely
demethylated within CD25+CD4+ Tregs (FIG. 2C and see Supplementary
Table 1 online). No significant differences were observed for
amplicons 3 and 4, showing that the demethylation process is not a
random event, but is confined to defined regions as was recently
found for the IL-2 promoter (Bruniquel, D. and Schwartz, R. H.
Selective, stable demethylation of the interleukin-2 gene enhances
transcription by an active process. Nat Immunol 4, 235-40 (2003)).
Together, the inventors' findings suggest that demethylation of CpG
motifs within selected elements of the foxp3 locus enable stable
Foxp3 expression in CD25+CD4+ Tregs.
Histone Modifications Indicate Opening of the Foxp3 Locus in
CD25+CD4+ Tregs
[0102] DNA demethylation is often linked to acetylation or
methylation of histones, other key features of chromatin
remodelling (Dobosy, J. R. and Selker, E. U. Emerging connections
between DNA methylation and histone acetylation. Cell Mol Life Sci
58, 721-7 (2001)). To investigate whether this also holds true for
the aforementioned region of the foxp3 locus, the inventors
performed chromatin immunoprecipitation (ChIP) experiments using
antibodies specific for acetylated histone H3, acetylated histone
H4 and trimethylated lysine 4 of histone H3 (H3K4). Subsequently,
the precipitated DNA was used as a template for amplifying the
differentially methylated region of the foxp3 locus by quantitative
real-time PCR. Indeed, in CD25+CD4+ Tregs the region of interest
showed a stronger association with modified histones when compared
with conventional CD25-CD4+ T cells (FIG. 3). Major differences
were observed for the acetylated and trimethylated histone H3,
whereas minor differences were found for the acetylated histone H4.
Together, the ChIP data disclose that within conventional CD25-CD4+
T cells the foxp3 locus is packed in a more condensed, inaccessible
chromatin structure whereas it is located within open euchromatin
in CD25+CD4+ Tregs.
Demethylated CpG Motifs in Developing Foxp3+ Thymocytes
[0103] Having shown that peripheral CD25+CD4+ Tregs display a
characteristic methylation status of the foxp3 locus, the inventors
next sought to determine whether this also could be observed in
developing Tregs. Generation of Foxp3+ cells in the thymus occurs
preferentially at the CD4 SP stage or during transition to this
stage (Fontenot, J. D., Dooley, J. L., Farr, A. G. and Rudensky, A.
Y. Developmental regulation of Foxp3 expression during ontogeny. J
Exp Med 202, 901-6 (2005)). The inventors therefore isolated CD25+
and CD25- subsets of CD4 SP thymocytes from male mice. As expected,
.about.80% of CD25+CD4 SP thymocytes were Foxp3+, whereas <1% of
CD25-CD4 SP thymocytes expressed Foxp3 (FIG. 4A). Only CD25+ but
not CD25-CD4 SP thymocytes displayed demethylated CpG motifs within
the regions covered by amplicons 1 and 2, whereas CpG motifs in
amplicons 3 and 4 were again fully methylated in both subsets (FIG.
4B and see Table 1). As expected, in double-negative (DN) and
double-positive (DP) thymocytes, which show hardly any Foxp3
expression (Fontenot, J. D. et al. Regulatory T cell lineage
specification by the forkhead transcription factor foxp3. Immunity
22, 329-41 (2005), Fontenot, J. D., Dooley, J. L., Farr, A. G. and
Rudensky, A. Y. Developmental regulation of Foxp3 expression during
ontogeny. J Exp Med 202, 901-6 (2005)), CpG motifs within the
regions covered by amplicons 1 and 2 were completely methylated
(see Table 1), supporting the inventors' assumption that Foxp3
expression is developmentally regulated and requires an opening of
the foxp3 locus.
[0104] When compared to peripheral CD25+CD4+ Tregs, in which the
CpG motifs within amplicons 1 and 2 were almost completely
demethylated (mean degree of methylation <3%), CD25+CD4 SP
thymocytes showed a clearly reduced degree of demethylated DNA
(mean degree of methylation .about.50%) with individual CpG motifs
being even completely methylated (see Table 1). These stark
differences cannot simply be explained by the fact that, among
CD25+CD4 SP thymocytes, only 80% are Foxp3+ compared to 95% within
the peripheral counterpart (FIGS. 2B and 4A). Rather it indicates
that the locus does not become fully opened until completion of
maturation and exit from the thymus.
Weak CpG Demethylation Correlates with Poor Foxp3 Stability in
TGF-.beta.-Induced Tregs
[0105] A critical issue for application of Tregs in therapeutic
approaches is the availability of large numbers of cells. Recent
publications have reported that conventional CD25-CD4+ T cells can
be converted into Foxp3.sup.+ Tregs by stimulation in the presence
of TGF-.beta. (Chen, W. et al. Conversion of peripheral CD4+CD25-
naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction
of transcription factor Foxp3. J Exp Med 198, 1875-86 (2003), Park,
H. B., Paik, D. J., Jang, E., Hong, S. and Youn, J. Acquisition of
anergic and suppressive activities in transforming growth
factor-beta-costimulated CD4+CD25-T cells. Int Immunol 16, 1203-13
(2004), Fu, S. et al. TGF-beta induces Foxp3+ T-regulatory cells
from CD4+CD25- precursors. Am J Transplant 4, 1614-27 (2004),
Fantini, M. C. et al. Cutting edge: TGF-beta induces a regulatory
phenotype in CD4+CD25- T cells through Foxp3 induction and
down-regulation of Smad7. J Immunol 172, 5149-53 (2004), Wan, Y. Y.
and Flavell, R. A. Identifying Foxp3-expressing suppressor T cells
with a bicistronic reporter. Proc Natl Acad Sci USA 102, 5126-31
(2005), Fantini, M. C. et al. TGF-{beta} induced Foxp3+ regulatory
T cells suppress Th1-mediated experimental colitis. Gut (2005)).
However, the stability and in vivo efficacy of these cells have not
been thoroughly tested so far. Analysis of the accessibility of the
foxp3 locus might provide an additional clue, aside from the mere
expression of Foxp3, as to the extent to which a permanent
conversion into a Treg lineage did occur. The inventors therefore
analyzed the methylation status of the foxp3 locus from CD25-CD4+ T
cells, which had been activated and cultured for 6 days in the
presence of TGF-.beta.. On day 6, >98% of TGF-.beta.-cultured
cells were Foxp3+, whereas control cells cultured under Th1
conditions showed only .about.1% Foxp3 expression (FIG. 5A).
[0106] As expected, within cultured Th1 cells all analyzed CpG
motifs were completely methylated (FIG. 5B and Table 1). In
contrast, cell culture in the presence of TGF-.beta. led to a
clearly visible demethylation of CpG motifs within the region
covered by amplicons 1 and 2, whereas CpG motifs in amplicons 3 and
4 again were fully methylated. However, the degree of demethylation
was far less pronounced compared to naturally occurring, peripheral
CD25+CD4+ Tregs (FIG. 2C). This prompted us to investigate whether
such a weak degree of CpG demethylation might correlate with
persistent expression of Foxp3 in TGF-.beta.-induced Tregs.
Therefore, the inventors restimulated TGF-.beta.-cultured Foxp3+
cells for another 6 days in the absence of TGF-.beta. followed by
the analysis of intracellular Foxp3 expression. As a control, the
inventors cultured ex vivo isolated Foxp3+CD25+CD4+ Tregs under
comparable conditions. Whereas ex vivo CD25+CD4+ Tregs maintained
high Foxp3 levels, the vast majority of TGF-.beta.-induced Tregs
have lost Foxp3 expression during the 6-day restimulation period
(FIG. 6). Both cultures displayed comparable proliferation rates,
making selective outgrowth of Foxp3- cells from the
TGF-.beta.-cultured cells unlikely. Viewed as a whole, the
inventors' data strongly suggest that complete demethylation of CpG
motifs within the foxp3 locus is required to allow for a stable
Foxp3 expression.
[0107] It should be understood that the examples and embodiments
described herein are for illustrative purposes only and that
various modifications or changes in light thereof will be suggested
to persons skilled in the art and are to be included within the
spirit and purview of this application and the scope of the
appended claims. In addition, any elements or limitations of any
invention or embodiment thereof disclosed herein can be combined
with any and/or all other elements or limitations (individually or
in combination) or any other invention or embodiment thereof
disclosed herein, and all such combinations are contemplated with
the scope of the invention without limitation thereto.
TABLE-US-00003 TABLE 1 thymus periphery CD4 SP in vitro amplicon
CD25.sup.- CD25.sup.+ CD25.sup.- CD25.sup.+ TGF-.beta. (CpG
position) exp. 1 exp. 2 exp. 1 exp. 2 exp. 1 exp. 2 exp. 1 exp. 2
DP DN Th1 exp. 1 exp. 2 1 (158) 100 100 4.5 0 100 100 29 44 100 100
100 100 100 1 (180) 100 100 3.5 12 100 100 40.5 47 100 100 100 92
93 1 (308) 100 100 0 0 100 100 20 33 100 100 100 63 75 1 (344) 100
100 0 0 100 100 38.5 37.5 100 100 100 41 41 1 (360) 100 100 5 0 100
100 34.5 37.5 98 100 100 60 70 1 (394) 100 100 0 6 100 100 12 24.5
100 100 100 28 38 1 (421) 96 100 5 1.5 100 100 23.5 0 100 100 100
42 n.a. 1 (426) 100 96.5 4 2 100 100 29 12 93 100 100 48 n.a. 2
(205) 98.5 100 0 0 100 98 87 36.5 95 100 100 74 67.5 2 (224) 98 100
0 0 100 96 85 95 100 100 100 72 75 2 (228) 100 100 13.5 15 100 100
100 100 100 100 100 100 90 2 (236) 100 100 0 0 100 100 83 73 100
100 100 75 66 2 (298) 98.5 100 0 0 100 100 69.5 50 93.5 100 100 64
43 2 (368) 100 100 0 3.5 100 100 64 47 91.5 100 100 39 50 3 (93)
100 98 57 79.5 100 100 85 100 100 100 92.5 100 n.a. 3 (170) 100 100
50 100 100 100 100 100 100 100 100 100 100 3 (173) 100 100 100 100
100 100 92 100 100 100 100 100 100 3 (176) 100 100 100 100 100 100
100 100 100 100 100 100 100 3 (281) 100 100 87 91.5 100 100 100 100
100 100 100 100 96 4 (37) n.a. n.a. n.a. n.a. 100 n.a. n.a. 100
n.a. n.a. 100 n.a. n.a. 4 (69) n.a. 100 n.a. 80 100 100 90 95 95
100 100 100 100 4 (311) 100 100 100 100 100 100 100 100 100 100 100
100 100 4 (315) 100 100 100 100 100 100 100 100 100 100 100 100 100
4 (319) 100 100 100 100 100 100 100 100 100 100 100 100 100 4 (338)
100 100 75 82.5 100 100 100 94.5 100 100 100 90 100 4 (371) 100 100
100 100 100 100 100 97 94 100 100 100 100
[0108]
Sequence CWU 1
1
11 1 21 DNA Mus musculus 1 aggaagagaa gggggtagat a 21 2 22 DNA Mus
musculus 2 aaactaacat tccaaaacca ac 22 3 22 DNA Mus musculus 3
atttgaattg gatatggttt gt 22 4 22 DNA Mus musculus 4 aaccttaaac
ccctctaaca tc 22 5 22 DNA Mus musculus 5 agaggttgaa ggaggagtat tt
22 6 22 DNA Mus musculus 6 actatctatc caattcccca ac 22 7 22 DNA Mus
musculus 7 tggttgtttt ggagtttagt gt 22 8 22 DNA Mus musculus 8
cacttttcta ccttccacaa at 22 9 17 DNA Mus musculus 9 gactcaaggg
ggtctca 17 10 17 DNA Mus musculus 10 ttgggcttca tcggcaa 17 11 8457
DNA Homo sapiens 11 gacgctcctc ccggagagta gtgagacccc tggtgcgggg
cgattggcgg cgggagcgat 60 gagtggcagc cgcacggccc aacgggagct
gtgcgtgggc cgcggggcgg ggccagggcg 120 ggtgcgcggc ggcggcgggg
tggctgggcc ggcggcggcg gcggtacgag gcgcgcgctc 180 ggggtcccgg
tcgcgaggag gaggaggatg tggcgcgcgg aggggaaatg gctgccgaaa 240
acaagccgga agagcgtttc ccaaagtgta ttctgcggaa ctagcaccta ctgtgttctc
300 aacaccgtgc cacctataga agatgatcat gggaacagca atagtagtca
tgtaaaaatc 360 tttttaccga aaaagctgct tgaatgtctg ccgaaatgtt
caagtttacc aaaagagagg 420 caccgctgga acactaatga ggaaattgca
gcttatttaa taacatttga gaaacacgaa 480 gaatggctaa ccacctcccc
taagacaaga ccacagaatg gctcaatgat actctacaac 540 aggaagaaag
tgaaatacag gaaagatggg tattgctgga aaaagaggaa agatgggaaa 600
acgaccagag aggaccacat gaaactcaag gtccagggag tggagtgctt gtacggctgc
660 tatgtccatt cctccatcat ccccaccttc caccggaggt gctactggct
ccttcagaac 720 cccgacatcg tcctggtgca ctacctgaac gtgccggcca
tcgaggactg cggcaagcct 780 tgcggcccca tcctctgctc catcaacacc
gacaagaagg agtgggcgaa atggacgaaa 840 gaagagctca tcgggcagct
gaaacccatg ttccatggca tcaagtggac ctgcagcaat 900 gggaacagca
gctcaggctt ctcggtggaa cagctggtgc agcagatcct cgacagccac 960
cagaccaagc cccagccgcg gacccacaac tgcctctgca ccggcagcct gggagctggc
1020 ggcagcgtgc atcacaagtg taacagcgcc aaacaccgca tcatctcgcc
caaggtggag 1080 ccacggacag gggggtacgg gagccactcg gaggtgcagc
acaatgacgt gtcggagggc 1140 aagcacgagc acagccacag caagggctcc
agccgtgaga agaggaacgg caaggtggcc 1200 aagcccgtgc tcctgcacca
gagcagcacc gaggtctcct ccaccaacca ggtggaagtc 1260 cccgacacca
cccagagctc ccctgtgtcc atcagcagcg ggctcaacag cgacccggac 1320
atggtggaca gcccggtggt cacaggtgtg tccggtatgg cggtggcctc tgtgatgggg
1380 agcttgtccc agagcgccac ggtgttcatg tcagaggtca ccaatgaggc
cgtgtacacc 1440 atgtccccca ccgctggccc caaccaccac ctcctctcac
ctgacgcctc tcagggcctc 1500 gtcctggccg tgagctctga tggccacaag
ttcgcctttc ccaccacggg cagctcagag 1560 agcctgtcca tgctgcccac
caacgtgtcc gaagagctgg tcctctccac caccctcgac 1620 ggtggccgga
agattccaga aaccaccatg aactttgacc ccgactgttt ccttaataac 1680
ccaaagcagg gccagacgta cgggggtgga ggcctgaaag ccgagatggt cagctccaac
1740 atccggcact cgccacccgg ggagcggagc ttcagcttta ccaccgtcct
caccaaggag 1800 atcaagaccg aggacacctc cttcgagcag cagatggcca
aagaagcgta ctcctcctcc 1860 gcggcggctg tggcagccag ctccctcacc
ctgaccgccg gctccagcct cctgccgtcg 1920 ggcggcggcc tgagtcccag
caccaccctg gagcagatgg acttcagcgc catcgactcc 1980 aacaaggact
acacgtccag cttcagccag acgggccaca gcccccacat ccaccagacc 2040
ccctccccga gcttcttcct gcaggacgcc agcaaacccc tccccgtcga gcagaacacc
2100 cacagcagcc tgagtgactc tgggggcacc ttcgtgatgc ccacggtgaa
aacggaggcc 2160 tcgtcccaaa ccagctcctg cagcggtcac gtggagacgc
ggatcgagtc cacttcctcc 2220 ctccacctca tgcagttcca ggccaacttc
caggccatga cggcagaagg ggaggtcacc 2280 atggagacct cgcaggcggc
ggaagggagc gaggtcctgc tcaagtctgg ggagctgcag 2340 gcttgcagct
ctgagcacta cctgcagccg gagaccaacg gggtaatccg aagcgccggc 2400
ggcgtcccca tcctcccggg caacgtggtg cagggactct accccgtggc ccagcccagc
2460 ctcggcaacg cctccaacat ggagctcagc ctggaccact ttgacatctc
cttcagcaac 2520 cagttctccg acctgatcaa cgacttcatc tccgtggagg
ggggcagcag caccatctat 2580 gggcaccagc tggtgtcggg ggacagcacg
gcgctctcac agtcagagga cggggcgcgg 2640 gcccccttca cccaggcaga
gatgtgcctc ccctgctgta gcccccagca gggtagcctg 2700 cagctgagca
gctcggaggg cggggccagc accatggcct acatgcacgt cgccgaggtg 2760
gtctcggccg cctcggccca gggcacccta ggcatgctgc agcagagcgg acgggtgttc
2820 atggtgaccg actactcccc agagtggtct tacccagagg gaggagtgaa
ggtcctcatc 2880 acaggcccgt ggcaagaagc cagcaataac tacagctgcc
tgtttgacca gatctcagtg 2940 cctgcatccc tgattcagcc tggggtgctg
cgctgctact gcccagccca tgacactggt 3000 cttgtgaccc tacaagttgc
cttcaacaac cagatcatct ccaactcggt ggtgtttgag 3060 tacaaagccc
gggctctgcc cacgctccct tcctcccagc acgactggct gtcgttggac 3120
gataaccagt tcaggatgtc catcctggaa cgactggagc agatggagag gaggatggcc
3180 gagatgacgg ggtcccagca gcacaaacag gcgagcggag gcggcagcag
tggaggcggc 3240 agcgggagcg ggaatggagg gagccaggca cagtgtgctt
ctgggactgg ggccttgggg 3300 agctgctttg agagccgtgt ggtcgtggta
tgcgagaaga tgatgagccg agcctgctgg 3360 gcgaagtcca agcacttgat
ccactcaaag actttccgcg gaatgaccct actccacctg 3420 gccgctgccc
agggctatgc caccctaatc cagaccctca tcaaatggcg tacaaagcac 3480
gcggatagca ttgacctgga actggaagtt gaccccttga atgtggacca cttctcctgt
3540 actcctctga tgtgggcgtg tgccctaggg cacttggaag ctgccgtcgt
gctgtacaag 3600 tgggaccgtc gggccatctc gattcccgac tctctaggaa
ggctgccttt gggaattgcc 3660 aggtcacggg gtcatgtgaa attagcagag
tgtctggagc acctgcagag agatgagcag 3720 gctcagctgg gacagaaccc
cagaatccac tgtcctgcaa gcgaagagcc cagcacagag 3780 agctggatgg
cccagtggca cagcgaagcc atcagctctc cagaaatacc caagggagtc 3840
actgttattg caagcaccaa cccagagctg agaagacctc gttctgaacc ctctaattac
3900 tacagcagtg agagccacaa agattatccg gctcccaaaa agcataaatt
gaaccctgag 3960 tacttccaga caaggcagga gaagctgctt cccactgcac
tgagtctgga agagccaaat 4020 atcaggaagc aaagccctag ttctaagcag
tctgtccccg agacactcag ccccagtgaa 4080 ggagtgaggg acttcagccg
ggaactctcc cctcccactc cagagactgc agcatttcaa 4140 gcctctggat
ctcagcctgt aggaaagtgg aattccaaag atctttacat tggtgtgtct 4200
acagtacagg tgactggaaa tccgaagggg accagtgtag gaaaggaggc agcaccttca
4260 caggtgcgtc cacgggaacc aatgagtgtc ctgatgatgg ctaacagaga
ggtggtgaat 4320 acagagctgg ggtcctaccg tgatagtgca gaaaatgaag
aatgcggcca gcccatggat 4380 gacatacagg tgaacatgat gaccttggca
gaacacatta ttgaagccac acctgaccga 4440 atcaagcagg agaattttgt
gcccatggag tcctcaggat tggaaagaac agaccctgcc 4500 accattagca
gtacaatgag ctggctggcc agttatctag cggatgctga ctgccttccc 4560
agtgctgccc agatccgaag tgcatataac gagcctctaa ccccttcttc taataccagc
4620 ttgagccctg ttggctctcc cgtcagtgaa atcgctttcg agaaacctaa
ccttccctcc 4680 gccgcggatt ggtcagaatt cctgagtgca tctaccagtg
agaaggtaga gaatgagttt 4740 gctcagctca ctctgtctga tcatgaacag
agagaactct atgaggctgc caggcttgtc 4800 cagacagctt tccggaaata
caagggccga cccttgcggg aacagcaaga agtagctgct 4860 gctgttattc
agcgttgtta cagaaaatat aaacagtacg cactttataa aaagatgaca 4920
caggctgcca tccttatcca gagcaaattc cgaagttact atgaacaaaa aaaattccag
4980 cagagccgac gggctgctgt gctcatccaa aagtactacc gaagttataa
gaaatgtggc 5040 aaaagacggc aggctcgccg gacggctgtg attgtacaac
agaaactcag gagcagtttg 5100 ctaaccaaaa agcaggatca agctgctcga
aaaataatga ggtttcttcg ccgctgtcgc 5160 cacagccccc tggtggacca
taggctgtac aaaaggagtg aaagaattga aaaaggccaa 5220 ggaacttgaa
gacatacagc agcatccctt agcaatgtga cattgctttt cagactgttt 5280
tcatttctgt ttttagcaga gacatgcaac aacaacacac acgcacacac gcacacacac
5340 acacgtacac acacatacaa aatccctctg cagttttggg gagatcagct
gcaggatttt 5400 aacaggaatg ttttggtcat tgcatttgca ctttcatgga
caacttttaa tttgatcagc 5460 aagacatctt ggaactcaat cttctgttgg
atcacgggaa atcaagacac ccaggaggaa 5520 ttgaaagagg cttcctcttc
tcaggaagaa gccatttcct tctcatatag ggctgtattc 5580 aaacatcgtg
tggaactgta caaatattta taccaaaaat atagataaga aaaggtgggg 5640
ctatactagc aacaaaaaaa gaatgctgtt cctgcacctg ccggttattt ccaagaagct
5700 gaatctttgg gactgattct cagtggaggg cttagatcat acaaaaatct
ttattgggtc 5760 cgtgtgttct catttccttc actgtttatt tttgtttgtt
tgtttgtttg ttttaatctc 5820 tacagcacat ttaatgcaac ttttgaaatc
tgcaggtttt taatgtcttg tggaaatttg 5880 cagaggggca ggtgtgtggt
aaacgggtaa tgcatgggaa ataatgagaa gcagctcaca 5940 gagtttaaac
tattttcttg tccccaccac cttccaagaa cctgcgaggg tagtaatcat 6000
cttgtcccct ttttcatgtt cagcacttta atttttttgc cttactttca tgtgcaatga
6060 gaattactta agaattggta acgcatgtag ccttttttag taaccttgga
agctgtagta 6120 attctaagga atcatgaacc ttgcctggac atttgccacc
taaacgatca gtgtggtgct 6180 gcgttctggc cagtaaattc catgtttttg
gctatatctc atccaaactg agcagtttct 6240 gtgtatatat agaaggtaga
aatgaaaagt gagaaaatat ttgaaaggga ttatattaat 6300 tgctaaatat
tttattcaca aaggtcaata acatggcaag ataaaattat ttgtatagtt 6360
ttgtctgaat gagcgagaaa aatgtggatg tactgtttgt atatattgta tatattaaaa
6420 cagagatatg tgcatgaaat caagaaaaaa gaaatgaaca aaagcaaagc
attagtggct 6480 atggtctgta aaatgaaaca aaaaaacttt atttcactat
aagagtactt tattttaaat 6540 gttctttagg agaacatttt gctaaagcat
gactaaactg caaaaaaaaa aaaagagcta 6600 ctgtatttag acttaggaaa
aaaggcagag taacattact taaaaaaaaa aggatatgtt 6660 tacatttaat
tttggctacc aggagtttag tttattttat ttaaaatttt tttgccaatg 6720
gtgccaagta atgtgaatgc taatactgct taagaaaatt aagttacttt tgcaaaacag
6780 ataatcataa gatgaatcag tatgtagctt aacaccatcc actcactcca
acaaagaaca 6840 cttagaatga taaaaaaaaa aaaaaaaaac ctgacaaaag
aaatagtatg aaaagtagaa 6900 aaatgtcacg tttccatatc tcctgctgga
aatcagaaaa tataataaaa ttgcacaaaa 6960 aaaaaaatga aaaagatgca
gactggtctt ttagagacgg catggtatat tactatttcc 7020 acataatgag
gagccaaaga aatctgatgt ttttaacaat taaactgcta atgttaaatt 7080
gagagaataa agttcgtatt tgctgatgcc agtttaaaat tcccaggtta cgtctgagga
7140 tcagttggtg taaagctgag atgttttttc ttggttctgg ctgccaactg
tgagttaaaa 7200 ctcaaggctt gttgtgaagc ctaaaaatat tcacaaataa
gcttttaaac tggtgtcttt 7260 ggaaggaagg tagatacaaa aagattgtgg
taaaaactgg ggtcagtgct cttggtgcct 7320 tttctataat tgtacttgtt
ttttaattac ttcctttcac tgccaacctc gaattactgt 7380 acagtatatg
tctttctgct tgtgatcagc tttgacaaca gtgacagccc cacaactagt 7440
agccacctgt acatttgtaa actgacctga ctccattttg tttttaaatg tgtgggttat
7500 gttgcagctg ttgcagtccc ccagatacct attattttac acaatttgac
ctataggagg 7560 acactgagta atttacaaac acaactgcat tcataaatgg
gaatagaacg tgaaagccag 7620 ctctttcaga atatcctcta ttaatactga
atttagatat ctttattcca tttattatgg 7680 tacaaataac tgatgtttta
accagagtaa tgacctcagt ggatttgctt taaccctcac 7740 attttttttt
taatgtttca catgttacat tattagctga atacgttaga aaatgacaga 7800
tggtagagac ttccatagaa ttaagagggt tctcatggag gggataggaa gtaggtttaa
7860 agcctaccag tgtaacctac cagtacaact gtgaatccta ggcgaggcaa
aaatgcactt 7920 ccactgaaac gaagcatttc tgaccgcttt ttcttggtta
tgaatcttaa tttcgaatat 7980 aagatgatag gtaagcgcag ctttcttgga
taatctgaat tcccaagtgc caggagtagg 8040 atttcattat aaaattaata
gctaatctta ttctatctcc tgaagattta attgctattg 8100 ttacccattc
gaaatcagct gtactgtgtg aacgaaataa agacaataat acgaacccct 8160
ctctggctgc acggtcgctt atggcagttc cacacagtag ttggcgccca atggggggtc
8220 cctgagactt gcatgtaaaa ctagtctaga tgtcttcttt ttttgtaagt
tttatttttg 8280 taattgtgca tgtaaagcat cattgaatca atggatctgt
tgaagaactc agctgctgga 8340 aaccatgcaa aatgttttga attgccctta
aaatatggaa aatgttttct gaatgcttta 8400 tattctttct gctgtaaatt
aaaaatgaag aaaatttccc caaaaaaaaa aaaaaaa 8457
* * * * *
References