U.S. patent application number 11/727930 was filed with the patent office on 2007-10-11 for method for enhancing enzyme activity at elevated temperature.
This patent application is currently assigned to The Institute of Physical and Chemical Research. Invention is credited to Yoshihide Hayashizaki.
Application Number | 20070238158 11/727930 |
Document ID | / |
Family ID | 16356039 |
Filed Date | 2007-10-11 |
United States Patent
Application |
20070238158 |
Kind Code |
A1 |
Hayashizaki; Yoshihide |
October 11, 2007 |
Method for enhancing enzyme activity at elevated temperature
Abstract
A method for enhancing activity of enzyme at an elevated
temperature which comprises adding a substance exhibiting chaperone
function such as a saccharide to a reaction mixture containing the
enzyme. The method can improve activity of enzymes more easily and
more effectively and hence afford increased enzyme activity at an
elevated temperature.
Inventors: |
Hayashizaki; Yoshihide;
(Ibaraki, JP) |
Correspondence
Address: |
BUCHANAN, INGERSOLL & ROONEY PC
POST OFFICE BOX 1404
ALEXANDRIA
VA
22313-1404
US
|
Assignee: |
The Institute of Physical and
Chemical Research
Wako-Shi
JP
351-01
|
Family ID: |
16356039 |
Appl. No.: |
11/727930 |
Filed: |
March 29, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10117222 |
Apr 8, 2002 |
|
|
|
11727930 |
Mar 29, 2007 |
|
|
|
08899393 |
Jul 23, 1997 |
6458556 |
|
|
10117222 |
Apr 8, 2002 |
|
|
|
Current U.S.
Class: |
435/183 |
Current CPC
Class: |
C12N 9/22 20130101; C12N
9/96 20130101; C12N 9/1252 20130101; C12N 9/1276 20130101 |
Class at
Publication: |
435/183 |
International
Class: |
C12N 9/00 20060101
C12N009/00 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 25, 1996 |
JP |
196330/1996 |
Claims
1. A method for enhancing activity of enzyme in a liquid reaction
mixture at a temperature of 45.degree. C. to 110.degree. C.,
comprising: (a) providing a liquid reaction mixture comprising an
enzyme; and (b) adding to said liquid reaction mixture one or more
substances exhibiting chaperone function, wherein: (i) said one or
more substances exhibiting chaperone function are selected from the
group consisting of: maltose, glucose, sucrose, lactose, xylobiose,
agarobiose, cellobiose, levanbiose, quitobiose,
2-.beta.-glucuronosylglucuronic acid, allose, altrose, galactose,
gulose, idose, mannose, talose, sorbitol, levulose, xylitol and
arabitol; and (ii) said activity enhancement is indicated by the
presence of activity measured at a temperature at which said enzyme
would normally be heat-inactivated and said activity being higher
than the activity that said enzyme would show at a temperature at
which said enzyme would normally not be inactivated wherein the
reaction is conducted at a temperature of 45.degree. C. to
110.degree. C., and wherein the activity of the enzyme is measured
and a substrate is present at a temperature of 45.degree. C. to
110.degree. C.
2. The method of claim 1, wherein the one or more substances
exhibiting chaperone function are selected from the group
consisting of: sorbitol, levulose, xylitol or arabitol.
3. The method of claim 1, wherein one or more polyalcohols are
added to the liquid reaction mixture.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of application Ser. No.
10/117,222, filed Apr. 8, 2002, which is a divisional of
application Ser. No. 08/899,393, filed Jul. 23, 1997, which claims
priority to JP 196330/1996, filed Jul. 25, 1996; the entire
contents of each application are incorporated by reference
herein.
BACKGROUND OF THE INVENTION
[0002] The present invention relates to a method for enhancing
enzyme activity at an elevated temperature by using a substance
exhibiting chaperone function.
[0003] In general, enzymes exhibit lower activity at a temperature
above their optimum temperature than the activity at their optimum
temperature. It is also known that their activity is lost when they
are exposed to a temperature higher than a certain level. Depending
on the kind of enzyme, a temperature at which such heat
inactivation occurs may vary. However, most of enzymes having
optimum temperature of ordinary temperature are inactivated when
heated to around 50.degree. C. Enzymes stable at an elevated
temperature are also known and such heat-resistant enzymes
generally have a higher optimum temperature.
[0004] Depending on the conditions where enzymes are used, it is
often desirable to use enzymes at an elevated temperature. In such
a case, a heat-resistant enzyme as mentioned above is generally
used. Examples of such a heat-resistant enzyme include Taq
polymerase, which is frequently used for PCR. However, in many
cases, a suitable heat-resistant enzyme may not be known, or even
if a possible heat-resistant enzyme is known, other conditions to
be used may not meet the enzyme.
[0005] For example, Superscript II is known as a reverse
transcriptase (RNA-dependent DNA polymerase) which can afford a
cDNA from a mRNA in vitro. Superscript II is a heat-labile enzyme
exhibiting an optimum temperature of 42.degree. C. and completely
inactivated at a temperature above 50.degree. C. within 10 minutes.
Although Tth DNA polymerase is an enzyme having heat resistance and
reverse transcription activity, it requires manganese ions for
exerting the enzyme activity. If cDNAs are produced from mRNAs at a
higher temperature using the Tth DNA polymerase, mRNAs are
fragmented by manganese ions presented in a reaction system and
therefore it becomes difficult to obtain full length cDNAs.
[0006] Magnesium ions required by a heat-labile reverse
transcriptase such as Superscript II mentioned above may also cause
the fragmentation of mRNA in a certain buffer or water at an
elevated temperature. According to the present inventor's
researches, manganese ions exhibit stronger fragmentation activity
than magnesium ions and control of the fragmentation due to
manganese ions is difficult even using a chelating agent.
[0007] Taq polymerase is known as an inherently heat-resistant
enzyme. However, it shows reduction of activity during 25 to 30
cycles or more generally used in PCR. Therefore, if the reduction
of Taq polymerase activity can be prevented, higher amplification
effect and higher cycle number can be realized with fewer units of
the enzyme.
[0008] In some cases, reverse transcription may be required to be
performed at a temperature above 50.degree. C. for some reasons.
For example, in order to obtain full length cDNAs, it is desirable
to preform reverse transcription while preventing the formation of
secondary structure of mRNAs.
[0009] However, a heat-resistant enzyme having reverse
transcription activity such as Tth DNA polymerase cannot afford
full length cDNAs. Therefore, it is necessary to utilize a
currently available reverse transcriptase which is used at an
ambient temperature.
[0010] Similar situation may be frequently found in other enzymes
not only polymerases but also restriction enzymes.
[0011] For some enzymes, it has been known that an enzyme
exhibiting a higher optimum temperature can be obtained by
introducing a mutation through genetic engineering. However, such
improvement of heat-resistance is not always possible and has not
been known so long as reverse transcriptase concerns.
[0012] If an enzyme can exhibit higher activity at a higher
temperature, its utility may be enhanced even though it is known as
a heat resistant enzyme.
[0013] Therefore, the object of the present invention is to provide
a method for easily and efficiently improving heat resistance of
enzyme to obtain high enzyme activity at an elevated
temperature.
DESCRIPTION OF THE INVENTION
[0014] The present invention provides a method for enhancing
activity of enzyme which comprises adding a substance exhibiting
chaperone function to a reaction mixture containing the enzyme.
[0015] FIG. 1 is a photograph showing the results of agarose gel
electrophoresis obtained in Example 1. .lamda.=Lambda HinDIII
marker, 1) standard "optimized" buffer condition (reaction
temperature: 42.degree. C.), 2) buffer containing trehalose (20%)
and glycerol (20%) (reaction temperature: 42.degree. C.), 3) buffer
containing trehalose (20%) and glycerol (20%) (reaction
temperature: 42.degree. C.), 4) buffer containing trehalose (20%),
glycerol (20%), and Triton X-100 (0.05%) (reaction temperature:
60.degree. C.), 5) buffer containing trehalose (20%), glycerol
(20%), and BSA (125 ng/.mu.l) (reaction temperature: 60.degree.
C.).
[0016] FIG. 2 is a photograph showing the results of agarose gel
electrophoresis obtained in Example 4 in which betaine was used.
Lanes 1, 17: .lamda. HinDIII, Lanes 2-4: reaction temperature of
37.degree. C. with 0 M, 0.2 M, and 0.6 M betaine, respectively;
Lanes 5-7: reaction temperature of 45.degree. C. with 0 M, 0.2 M,
and 0.6 M betaine, respectively; Lanes 8-10: reaction temperature
of 50.degree. C. with 0 M, 0.2 M, and 0.6 M betaine, respectively;
Lanes 11-13: reaction temperature of 55.degree. C. with 0 M, 0.2 M,
and 0.6 M betaine, respectively; Lanes 14-16: reaction temperature
of 60.degree. C. with 0 M, 0.2 M, and 0.6 M betaine,
respectively.
[0017] FIG. 3 is a photograph showing the results of agarose gel
electrophoresis obtained in Example 4 in which sarcosine was used.
Lane 1: .lamda. HinDIII marker; Lanes 2-7: reaction temperature of
37.degree. C. with 0 M, 0.2 M, 0.6 M, 1.2 M, 2.4 M, and 3.6 M
sarcosine respectively; Lanes 8-13: reaction temperature of
45.degree. C. with 0 M, 0.2 M, 0.6 M, 1.2 M, 2.4 M, and 3.6 M
sarcosine respectively; Lanes 14-19: reaction temperature of
50.degree. C. with 0 M, 0.2 M, 0.6 M, 1.2 M, 2.4 M, and 3.6 M
sarcosine respectively; Lanes 20-25: reaction temperature of
55.degree. C. with 0 M, 0.2 M, 0.6 M, 1.2 M, 2.4 M, and 3.6 M
sarcosine, respectively.
[0018] FIG. 4 presents relative activity of Sty I tested in Example
4 in which betain was used.
[0019] FIG. 5 presents relative activity of Sty I tested in Example
4 in which sarcosine was used.
[0020] In the method of the present invention, the objective enzyme
is not particularly limited and may be an enzyme which is not
inactivated and exhibits its activity at an elevated temperature.
It may be possible to enhance an activity of enzyme at a higher
temperature by applying the method of the present invention to an
enzyme which is not permanently inactivated but exhibit
substantially no activity or which is inactivated at an elevated
temperature under ordinary conditions, so long as they are in a
condition where activation at an elevated temperature is
possible.
[0021] Typical examples of the enzyme to which the method of the
present invention is applicable include polymerases and restriction
enzymes. Examples of polymerases include DNA polymerases,
RNA-dependent DNA polymerases (reverse transcriptases), DNA
replicases, terminal deoxytransferases, poly A polymerases and
telomerases. However, the enzyme is not limited to these.
[0022] Examples of the DNA polymerase include Sequencease Ver.2, T7
DNA polymerase, T4 DNA polymerase, DNA polymerase I and the like.
Examples of the heat-resistant DNA polymerase include Taq
polymerase, Vent DNA polymerase, pfu polymerase, Tth polymerase,
Thermosequenes and the like. Heat resistance of these heat
resistant DNA polymerases can be further enhanced by the method of
the present invention and therefore amplification ratio and cycle
number of PCR can be increased to improve stability of PCR.
[0023] Examples of the RNA-dependent DNA polymerase (reverse
transcriptase) include Seperscript II, AMV reverse transcriptase,
MuIV reverse transcriptase and the like.
[0024] In addition to such polymerases as mentioned above, some
restriction enzymes such as Taq I are not inactivated and exhibit
substantial activity at an elevated temperature. Such enzymes may
also be stabilized at an elevated temperature by the method of the
present invention. Examples of restriction enzymes to which the
method of the present invention is applicable include Sty I, Eco
RI, Mlu I, Nco I, DNase I, Rnase I, Nde I, Pvu II, Pst I, Dra I,
Hin DIII and Hin cII. However, the enzyme is not limited to
these.
[0025] In the method of the present invention, a substance
exhibiting chaperone function is presented in a reaction
mixture.
[0026] Examples of the substance exhibiting chaperone function
include saccharides, amino acids, polyalcohols and their
derivatives, and chaperone proteins. However, the substance is not
limited to these. The "chaperone function" means a function for
renaturing proteins denatured by stress such as heat shock, or a
function for preventing complete denaturation of proteins by heat
to maintain the native structure.
[0027] Examples of the saccharide exhibiting the chaperone function
include oligosaccharides and monosaccharides such as trehalose,
maltose, glucose, sucrose, lactose, xylobiose, agarobiose,
cellobiose, levanbiose, quitobiose, 2-.beta.-glucuronosylglucuronic
acid, allose, altrose, galactose, gulose, idose, mannose, talose,
sorbitol, levulose, xylitol and arabitol. However, the saccharide
is not limited to these. Those saccharides mentioned above can be
used alone or in any combination thereof. Among these, trehalose,
sorbitol, xylitol, levulose and arabitol exhibit strong chaperone
function and marked effect for activating enzymes at an elevated
temperature.
[0028] Examples of amino acids and derivatives thereof include
N.sup.e-acetyl-.beta.-lysine, alanine, .gamma.-aminobutyric acid,
betaine, N.sup..alpha.-carbamoyl-L-glutamamine 1-amide, choline,
dimethylthetine, ecotine (1,4,5,6-tetrahydro-2-methyl-4-pirymidine
carboxilic acid), glutamate, .beta.-glutamine, glycine, octopine,
proline, sarcosine, taurine and trymethylamine N-oxide (TMAO).
However, the amino acids and derivatives thereof are not limited to
these. Those amino acids mentioned above can be used alone or in
any combination thereof. Among these, betaine and sarcosine exhibit
strong chaperone function and marked effect for activating enzymes
at an elevated temperature.
[0029] The substance exhibiting chaperone function include
chaperone proteins. Examples of the chaperone proteins include
chaperone proteins of Thermophilic bacteria and heat shock proteins
such as HSP 90, HSP 70 and HSP 60. Those chaperone proteins can be
used alone or in any combination thereof.
[0030] The substance exhibiting chaperone function include
chaperone proteins. Examples of the chaperone proteins include
chaperone proteins of Thermophiric bacteria and heat shock proteins
such as HSP 90, HSP 70 and HSP 60. Those chaperone proteins can be
used alone or in any combination thereof.
[0031] These substances exhibiting chaperone function show
different optimum concentrations for stabilizing the enzyme
depending on the kind of the enzyme and the optimum concentration
may vary among the substances for the same enzyme. Therefore, a
concentration of particular substance to be added to a specific
reaction system may be suitably decided depending on the kinds of
the substance and the enzyme such as reverse transcriptase.
[0032] To enhance the effect of the substances exhibiting chaperone
function such as saccharides, amino acids or chaperone proteins,
one or more kinds of polyalcohols may be used in addition to one or
more kinds of the above substances. Examples of the polyalcohol
include glycerol, ethylene glycol, polyethylene glycol and the
like.
[0033] According to the method of the present invention, activity
of enzyme such as a polymerase or a restriction enzyme can be
enhanced at an elevated temperature. The term "elevated
temperature" herein used refers to, for example, a temperature of
45 to 110.degree. C. However, the temperature at which an enzyme
can be stabilized may be vary depending on the kind of the enzyme.
An enzyme usually used at an ordinary temperature may be stabilized
at an elevated temperature higher than ordinary temperature, and a
heat-resistant enzyme can be stabilized at a further elevated
temperature higher than its optimum temperature.
[0034] According to the method of the present invention, not only
heat-resistance of enzymes such as polymerases and restriction
enzymes can be improved, but also activity of enzymes such as
polymerases and restriction enzymes at an elevated temperature can
be enhanced by using the above-mentioned substance exhibiting
chaperone function.
EXAMPLES
[0035] The present invention will be further explained in detail
with reference to the following examples.
Example 1
Improvement of Reverse Transcription Efficiency by Making Reverse
Transcriptase Heat-Resistant
[0036] To examine reverse transcription activity of Superscript II
at an elevated temperature, cDNAs were synthesized using RNAs
transcribed in vitro by T7 RNA polymerase as template and the
products were evaluated. By using RNAs as a template transcribed in
vitro and evaluating the products by electrophoresis, reverse
transcription efficiencies of the samples can be compared with one
another and thereby non-specific transcription termination which
leads to premature termination of reverse transcription and/or
reduction of reaction efficiency can be evaluated. The template
RNAs were prepared by transcribing pBluescript II SK, which had
been cleaved into a linear form with a restriction enzyme NotI,
with T7 RNA polymerase in vitro. This reaction was initiated from
T7 promoter described in the instruction of pBluescript II SK.
[0037] As a control, the following standard buffer condition was
used: 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl.sub.2, 10 mM
dithiothreitol, each 0.75 mM of dNTPs (dATP, dGTP, dCTP and
dTTP).
[0038] In the above standard buffer condition, 1 .mu.g of template
RNA, 400 ng of primer (20mer SK primer, CGCTCTAGAACTAGTGGATC) and
200 units of Superscript II were prepared and the final volume was
adjusted to 20 .mu.l. 0.2 .mu.l of [.alpha.-.sup.32P] dGTP was used
for labeling of reverse transcription products. The RNA and the
primer were incubated at 65.degree. C. before the other substrates
were added. Then, the reaction was performed at 42.degree. C. for 1
hour. The reaction products were subjected to denatured agarose
electrophoresis and electrophoretic patterns were examined by
autoradiography to evaluate recoveries of full length cDNAs and
rates of short products obtained from incomplete elongation. The
results are shown in Lane 1 of FIG. 1.
[0039] The reverse transcriptase Superscript II was inactivated at
a temperature of 50.degree. C. in the above standard buffer
condition.
[0040] The following buffer condition for reverse transcription was
used to verify that addition of oligosaccharide stabilizes the
enzyme reaction: 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM
MgCl.sub.2, 10 mM dithiothreitol, each 0.75 mM of dNTPs (dATP,
dGTP, dCTP, dTTP), 20% (w/v) trehalose and 20% (v/v) glycerol.
[0041] 1 .mu.g of template RNA, 400 ng of primer (20 mer SK primer)
and 200 units of Superscript II were reacted in 24 .mu.l of aqueous
solution under the above buffer condition. 0.2 .mu.l of
[.alpha.-.sup.32P] dGTP was used for labeling of reverse
transcription products. Under this condition, the reverse
transcriptase Superscript II exhibited higher activity than the
control reaction at a normal temperature (42.degree. C.). The
primer and the template RNAs were annealed at 37.degree. C. for 2
minutes and the enzyme activity was measured at 60.degree. C.
[0042] The reaction products were subjected to denaturing agarose
electrophoresis as described above, and electrophoretic patterns
were examined by autoradiography to evaluate recoveries of full
length cDNAs and rates of short products obtained from incomplete
elongation. The results are shown in FIG. 1.
[0043] As shown in Lane 1, products resulted from premature
termination of reverse transcription at specific sites or
non-specific termination of reverse transcription were seen under
the standard buffer condition at 42.degree. C.
[0044] As shown in Lane 2, at 42.degree. C. as in Lane 1, such
products resulted from premature termination as mentioned above
were also observed even though 20% trehalose and 20% glycerol were
added.
[0045] As shown in Lane 3, when the temperature was raised to
60.degree. C., the amount of products obtained from prematurely
terminated synthesis became very small and full length products
were synthesized.
[0046] As shown in Lane 5, when 0.125 .mu.g/.mu.l of BSA was added
to the condition of Lane 3, the enzyme activity was further
stabilized. However, BSA alone without 20% trehalose and 20%
glycerol did not make the enzyme sufficiently heat-resistant.
[0047] As shown in Lane 4, when 0.05% of Triton X100 was added to
the condition of Lane 3, the amount of incomplete reverse
transcription products was further reduced. However, the whole
activity of the reverse transcriptase was slightly reduced.
Example 2
[0048] Reaction was performed under the same condition as Lane 3 of
Example 1 except that glucose or maltose was used instead of
trehalose. The electrophoretic pattern showed again that the amount
of products obtained from prematurely terminated synthesis became
very small and full length products were synthesized as in Lane 3
of Example 1.
Example 3
[0049] Reaction was performed under the same condition as Lane 3 of
Example 1 except that arabitol, sorbitol, levulose, xylitol, or
betaine was used instead or trehalose. The electrophoretic pattern
showed again that the amount of products obtained from prematurely
terminated synthesis became very small and full length products
were synthesized as in Lane 3 of Example 1.
Example 4
[0050] Reaction solutions (20 .mu.l each) containing a restriction
enzyme, Sty I 0.5 units, its substrate, .lamda. DNA 0.5 .mu.g and
betaine 0-0.6M or sarcosine 0-3.6M were incubated at 37, 45, 50, 55
or 60.degree. C. for 1 hour. In order to prevent initiation of
enzyme reaction before the incubation, the samples were quickly
prepared on ice. Upon incubation, 0.25% bromophenol blue, 0.26% XC
(xylene cyanol), 30% glycerol and 120 mM EDTA (4 .mu.l) was added
to the reaction solution to terminate the reaction. The resulting
solution was heated at 650.degree. C. for 5 minutes to melt cos
sites and subjected to electrophoresis using 0.8% agarose gel
containing 0.05% EtBr. A photograph showing the samples using
betaine is presented in FIG. 2. A photograph showing the results of
agarose gel electrophoresis regarding the samples using sarcosine
is presented in FIG. 3.
[0051] After electrophoresis, image analysis of the gels was
conducted. Enzyme activity was represented by comparing strength of
bands appeared at 1 kbp (with arrow). Regarding the samples using
betaine, the standard (100) is the band strength obtained from the
sample using 0 M of betaine and incubated at 37.degree. C. Relative
activity of Sty I tested in the presence of betaine is presented in
FIG. 4. Regarding the samples using sarcosine, the standard (100)
is the band strength obtained from the sample using 0 M of
sarcosine and incubated at 37.degree. C. Relative activity of Sty I
tested in the presence of sarcosine is presented in FIG. 5.
[0052] From the results, it can be seen that a restriction enzyme
was thermally activated by the addition of suitable concentration
of betaine or sarcosine.
Sequence CWU 1
1
1 1 20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 1 cgctctagaa ctagtggatc 20
* * * * *