Method for identifying inhibitors of G protein coupled receptor signaling

Abstract

This invention relates to methods for identifying peptides and other compounds which block G protein coupled receptor mediated signaling with high affinity and specificity. Assays developed in conjunction with these methods also are disclosed.

Description

[0001] This is a continuation of U.S. Ser. No. 09/852,910, filed May 11, 2001 (U.S. Pat. No. 7,208,279), the disclosures of which are hereby incorporated by reference in their entirety.

BACKGROUND OF THE INVENTION

[0002] 1. Technical Field

[0003] The present invention generally pertains to the field of modulating G protein-coupled receptors (GPCR) and of identifying and preparing G protein coupled receptor inhibiting compounds.

[0004] 2. Description of the Background Art

[0005] A great number of chemical messengers exert their effects on cells by binding to G protein-coupled receptors. Ligand binding to those receptors is transduced by heterotrimeric G proteins into intracellular responses. Four main classes of G proteins are distinguishable: Gs, Gi, Gq and G12. G protein-coupled receptors (GPCR) include a wide range of biologically active receptors, such as hormone receptors, viral receptors, growth factor receptors, chemokine receptors, sensory receptors and neuroreceptors. These receptors are activated by the binding of ligand to an extracellular binding site and mediate their actions through the various G proteins. The molecular interactions that occur between the receptor and the G protein are fundamental to the transduction of environmental signals into specific cellular responses. The G proteins themselves play important roles in determining the specificity and temporal characteristics of the cellular response to the ligand-binding signal.

[0006] In the inactive state, G proteins are heterotrimeric, consisting of one .alpha., one .beta. and one .gamma. subunit, and a bound deoxyguanosine diphosphate (GDP). Receptor-catalyzed guanine nucleotide exchange resulting in deoxyguanosine triphosphate (GTP) binding to the .alpha. subunit activates the G protein. G.alpha.-GTP dissociates from the G.beta..gamma. subunits, allowing the G.beta..gamma. dimer and the G.alpha.-GTP subunit each to activate downstream effectors. Hydrolysis of GTP to GDP deactivates the complex and turns off the cellular response.

[0007] G protein-coupled receptors have seven transmembrane helices which form, on the intracellular side of the membrane, the G protein binding domain. Experiments have suggested that activation of the receptor by ligand binding changes conformation of the receptor, unmasking G protein binding sites on the intracellular face of the receptor. The heterotrimeric G protein interacts with GPCR in a multi-site fashion with the major site of contact between them at the carboxyl terminus of the G.alpha. subunit. Hamm et al., Science 241:832-5, 1998; Osawa and Weiss, J. Biol. Chem. 270:31052-8, 1995; Garcia et al., EMBO J. 14:4460-9, 1995; Sullivan et al., J. Biol. Chem. 269:21519-21525, 1994; West et al., J. Biol. Chem. 260:14428-30, 1985.

[0008] The carboxyl terminal 11 amino acids are most important to receptor interaction and to the specificity of this interaction, Martin et al., J. Biol. Chem. 271:361-366, 1996; Kostenis et al., Biochemistry 36:1487-1495, 1997, however other regions on G.alpha. also are involved in receptor contact. In addition, portions of the G.beta..gamma. dimer have been implicated in GPCR binding. See Onrust et al., Science 275:381-384, 1997; Lichtarge et al., Proc. Natl. Acad. Sci. USA 93:7507-7611, 1996; Mazzoni and Hamm, J. Biol. Chem. 271:30034-30040, 1996; Bae et al., J. Biol. Chem. 272:32071-32077, 1997. The carboxyl terminal amino acid regions of G.alpha. proteins (and other GPCR binding regions of the heterotrimeric G protein) not only provide the molecular basis of receptor-mediated activation of G proteins, but they also play an important role in determining the fidelity of receptor activation. Conklin et al., Nature 363:274-276, 1993; Conklin et al., Mol. Pharmacol. 50:885-890, 1996.

[0009] The G-protein complex thus serves a complex role, as an intermediate that relays the signal from receptor to one or more specific effectors, and as a clock that controls the duration of the signal. Hamm and Gilchrist, Curr. Opin. Cell Biol. 8:189-196, 1996. Multiple receptors can activate a single G protein subtype, and in some cases a single receptor can activate more than one G protein, thereby mediating multiple intracellular signals. In other cases, however, interaction of a receptor with a G protein is regulated in a highly selective manner such that only a particular heterotrimer is bound.

[0010] Because G proteins and their receptors influence a large number of intracellular signals mediated by a large number of different chemical ligands, considerable potential for modulation of disease pathology exists. Many medically significant biological processes are influenced by G protein signal transduction pathways and their downstream effector molecules. See Holler et al., Cell. Mol. Life Sci. 340:1012-20, 1999. Therefore, G protein-coupled receptors and their ligands are the target for many pharmaceutical products and are the focus of intense drug discovery efforts. Over the past 15 years, nearly 350 therapeutic agents targeting GPCRs have been successfully introduced into the market. Because of the ubiquitous nature of G protein-mediated signaling systems, and their influence on a great number of pathologic states, it is highly desirable to find new methods of modulating these systems.

[0011] Most currently available drugs affecting GPCRs act by antagonizing the binding between a G protein-coupled receptor and its extracellular ligand(s). On the other hand, receptor subtype-selective drugs have been difficult to obtain. A drawback to the classical approach of designing drugs to interfere with ligand binding has been that conventional antagonists are ineffective for some GPCRs such as proteinase activated receptors (PAR) due to the unique mechanism of enzymatic cleavage of the receptor and generation of a tethered ligand. In other cases, intrinsic or constitutive activity of receptors leads to pathology directly, thus rendering antagonism of ligand binding moot. For these reasons, alternative targets for blocking the consequences of GPCR activation and signaling are highly desirable.

[0012] One potential alternative target for inhibition by new pharmaceuticals has been the receptor-G protein interface on the interior of the plasma membrane. Konig et al., Proc. Natl. Acad. Sci. USA 86:6878-82, 1989; Acharya et al., J. Biol. Chem. 272:651924, 1997; Verrall et al., J. Biol. Chem. 272:6898-902, 1997. The carboxyl terminus of G.alpha. and other regions of the G protein heterotrimer conform to a binding site at the cytoplasmic face of the receptor. Sondek et al., Nature 372:276-9, 1994; Lambright et al., Nature 369:621-8, 1994; Lambright et al., Nature 379:311-9, 1996; Sondek et al., Nature 379:369-74, 1996; Wall et al., Science 269:1405-12, 1996; Mixon et al., Science 270:954-960, 1995. Peptides corresponding to these binding regions or mimicking these regions, can block receptor signaling or stabilize the active agonist-bound conformation of the receptor. Hamm et al., Science 241:832-5, 1988; Gilchrist et al., J. Biol. Chem. 273:14912-9, 1998. For example, in the case of rhodopsin, the rod photoreceptor, the G.alpha. C-terminal peptide, G.alpha. 340-350, stabilizes the receptor in its active metarhodopsin II conformation. Hamm et al., Science 241-832-5, 1988; Osawa and Weiss, J. Biol. Chem. 270:31052-31058, 1995. Similarly, two carboxyl terminal peptides from G.alpha.S (354-372 and 384-394), but not the corresponding peptides from G.alpha.i.sub.2, evoke high affinity agonist binding to .beta..sub.2-adrenergic receptors and inhibit their ability to activate G.alpha.s and adenylyl cyclase. Rasenick et al., J. Biol. Chem. 269:21519-21525, 1994.

[0013] In general, GPCRs require agonist binding for activation. However, modifications to the receptor amino acid sequence can stabilize the active state conformation without the requirement for a ligand. Stabilization by such ligand-independent means is termed "constitutive receptor activation." Constitutive (or agonist-independent) signaling activity in mutant receptors has been well documented, but only a few GPCRs have been shown to exhibit agonist-independent activity in the wild type (or native) form. For example, native dopamine D1B and prostaglandin EP1b receptors possess constitutive activity (Tiberi and Caron, J. Biol. Chem. 269:27925-27931, 1994; Hasegawa et al., J. Biol. Chem. 271:1857-1860, 1996). A number of GPCRs, for example, receptors for thyroid-stimulating hormone (Vassart et al., Ann. N.Y. Acad. Sci. 766:23-30, 1995), causing disease in humans have been found to be mutated to exhibit agonist-independent activity. Experimentally, several single amino acid mutations have produced agonist independent activity. .beta.2 and .alpha.2 adrenergic receptors, for example, mutated at single sites in the third cytoplasmic loop show constitutive activity (Ren et al., J. Biol. Chem. 268:16483-16487, 1993; Samama et al., Mol. Pharmacol. 45:390-394, 1994). In some cases, a large deletion mutation in the carboxy tail or in the intracellular loops of GPCRs has led to constitutive activity. For example, in the thyrotropin releasing hormone receptor a truncation deletion of the carboxyl terminus Nussenzveig et al., J. Biol. Chem. 268:2389-2392, 1993; Matus-Leibovitch et al., J. Biol. Chem. 270:1041-1047, 1995 or a smaller deletion in the second extracellular loop of the thrombin receptor (Nanevicz et al., J. Biol. Chem. 270:21619-21625, 1995) renders the receptor constitutively active.

[0014] These finding have led to a modification of traditional receptor theory (Samama et al., J. Biol. Chem. 268:4625-4636, 1993). It is now thought that receptors can exist in at least two conformations, an inactive conformation (R) and an activated conformation (R*), and that an equilibrium exists between these two states that markedly favors R over R* in the majority of receptors. It has been proposed that in some native receptors and in the mutants described above, there is a shift in equilibrium in the absence of agonist that allows a sufficient number of receptors to be in the active R* state to initiate signaling.

[0015] Negative antagonism is demonstrated when a drug binds to a receptor that exhibits constitutive activity and reduces this activity. Negative antagonists appear to act by constraining receptors in an inactive state (Samama et al., Mol. Pharmacol. 45:390-394, 1994). Although first described in other receptor systems (Schutz and Freissmuth, J. Biol. Chem. 267:8200-8206, 1992), negative antagonism has been shown to occur with GPCRs such as opioid (Costa and Herz, Proc. Natl. Acad. Sci. USA 86:7321-7325, 1989; Costa et al., Mol. Pharmacol. 41:549-560, 1992), .beta.2-adrenergic (Samama et al., Mol. Pharmacol. 45:390-394, 1994; Pei et al., Proc. Natl. Acad. Sci. USA 91:2699-2702, 1994; Chidiac et al., Mol. Pharmacol. 45:490-499, 1994), serotonin type 2C (Barker et al., J. Biol. Chem. 269:11687-11690, 1994), bradykinin (Leeb-Lundberg et al., J. Biol. Chem. 269:25970-25973, 1994), and D1B dopamine (Tiberi and Caron, J. Biol. Chem. 269:27925-27931, 1994) receptors. That being stated, the concept of a constitutively active receptors offer insights which explain pathophysiologic conditions. For example, a constitutively active receptor in a disease process such as hypertension may no longer be under the influence of the sympathetic nervous system. In hypertension, a constitutively active GPCR may be expressed in any number of areas including the brain, kidneys or peripheral blood vessels. A newly recognized class of drugs (negative antagonists or inverse agonists) which reduce undesirable constitutive activity can act as important new therapeutic agents. Thus, a technology for identifying negative antagonists of both native and mutated GPCRs has important predictable as well as not yet realized pharmaceutical applications. Furthermore, because constitutively active GPCRs are tumorigenic, the identification of negative antagonists for these GPCRs can lead to the development of anti-tumor and/or anti-cell proliferation drugs.

[0016] Mutagenesis of this same region of G.alpha.t has identified several specific amino acid residues in this binding region crucial for G.alpha.t activation by rhodopsin. Martin et al., J. Biol. Chem. 271:361-6, 1996. Substitution of three to five carboxyl-terminal amino acids from G.alpha.i with corresponding residues from G.alpha.i allowed receptors which signal exclusively through G.alpha.i subunits to activate the chimeric .alpha. subunits and stimulate the G.alpha.q effector, phospholipase C .beta.. Conklin et al., Nature 363:274-276, 1993; Conklin et al., Mol. Pharmacol. 50:885-890, 1996. All of these studies suggest that G.alpha. carboxyl peptide sequences are responsible for the specificity of the signaling responses of the individual G proteins. There are 16 unique G.alpha. subunits (G.alpha.i.sub.1, G.alpha.i.sub.2, G.alpha.i.sub.3, G.alpha.O.sub.1, G.alpha.O.sub.2, G.alpha.Z, G.alpha.t, G.alpha.q, G.alpha.11, G.alpha.14, G.alpha.5, G.alpha.12, G.alpha.13, G.alpha.15/16, G.alpha.OIF and G.alpha.gust) thought to mediate specific interaction with different GPCRs, several hundred of which have been cloned. Thus, peptides corresponding to G protein regions which bind the GPCR could be used as competitive inhibitors of receptor-G protein interactions. Hamm et al., Science 241-832-5, 1988; Gilchrist et al., J. Biol. Chem. 273-14912-9, 1998. Drug discovery approaches which take advantage of this opportunity, however, are not available. Jones et al., Expert Opin. Ther. Patents 9(12): 1641, 1999.

[0017] An important aspect of the modern drug discovery process is the identification of potent lead compounds for use in modern high throughput screening assays. One of the major challenges confronting companies using high throughput screening is the difficulty of identifying useful lead compounds from very large combinatorial libraries. When literally hundreds of thousands of compounds are screened, characterizing the compounds which test positive (including false positives) is an expensive and time-consuming process. Hence, a method which can identify potent lead compounds and reduce the number of false positives in the screening process would be very desirable.

SUMMARY OF THE INVENTION

[0018] This invention provides a method of identifying a G protein coupled receptor signaling inhibitor, which comprises (a) providing a peptide library based on a native G protein coupled receptor binding peptide; (b) screening said peptide library for high affinity binding to said G protein coupled receptor; (c) selecting a member of said peptide library having binding to said G protein coupled receptor of higher affinity than that of the native peptide; (d) providing a library of candidate compounds to screen for binding to said G protein coupled receptor; (e) screening said library of candidate compounds for high affinity binding to said G protein coupled receptor in competition with a member of said peptide library selected in step (c); and (f) identifying a member of said library of candidate compounds having binding to said G protein coupled receptor of equal or higher affinity than that of the peptide selected in step (c).

[0019] The invention also provides, in a further embodiment, an enzyme-linked immunosorbant assay which comprises the steps of (a) immobilizing a G protein coupled receptor onto a solid support; (b) providing a protein-peptide fusion protein display library; (c) incubating members of said protein-peptide fusion protein display library with said immobilized G protein coupled receptor in the presence of said G protein coupled receptor binding peptide under conditions such that members of protein-peptide fusion protein display library having a binding affinity for said G protein coupled receptor at least as high as said G protein coupled receptor binding peptide bind to said immobilized G protein coupled receptor; (d) removing unbound members of said protein-peptide fusion protein display library; (e) incubating said bound protein-peptide fusion protein display library with antibodies which specifically recognize the protein portion of said protein-peptide fusion protein display library members under conditions such that said antibodies specifically bind to said protein-peptide fusion protein display library members; (f) removing unbound antibodies; and (g) detecting said bound antibodies.

[0020] In yet a further embodiment, the invention provides a method of identifying a G protein coupled receptor signaling inhibiting peptide, which comprises (a) providing a peptide library based on a native G protein coupled receptor binding peptide; (b) screening said peptide library for high affinity binding to said G protein coupled receptor; and (c) selecting a member of said peptide library having binding to said G protein coupled receptor of higher affinity than that of the native peptide.

[0021] In yet a further embodiment, the invention provides a method of identifying a G protein coupled receptor signaling inhibitor compound, which comprises (a) providing a library of candidate compounds to screen for binding to said G protein coupled receptor; (b) providing a high affinity G protein coupled receptor binding peptide; (c) screening said library of candidate compounds for high affinity binding to said G protein coupled receptor in competition with said high affinity G protein coupled receptor binding peptide; and (d) identifying a member of said library of candidate compounds having binding to said G protein coupled receptor of equal or higher affinity than that of the peptides of step (b).

[0022] In yet a further embodiment, the invention provides a method of inhibiting G protein coupled receptor signaling which comprises contacting a compound with said G protein coupled receptor which interferes with binding of said G protein coupled receptor to its cognate G proteins.

[0023] The invention provides, in yet a further embodiment a compound selected from the group consisting of SEQ ID NOS:14, 16, 20, 22, 26, 28, 30, 32, 34, 36, 38, 40, 42, 46-105, 115-132 and 147-305.

[0024] In yet a further embodiment, the invention provides a method for providing a therapeutic G protein coupled receptor signaling modifier peptide to a mammal which comprises administering to said mammal an expression construct which expresses a peptide according to SEQ ID NOS:14, 16, 20, 22, 26, 28, 30, 32, 34, 36, 38, 40, 42, 46-105, 115-132 and 147-305.

BRIEF DESCRIPTION OF THE DRAWINGS

[0025] FIG. 1 is a schematic diagram showing the basis for the affinity screening method used to separate and identify GPCR binding peptides.

[0026] FIG. 2 is a schematic diagram of vector pJS142.

[0027] FIG. 3 is a schematic diagram showing an ELISA procedure.

[0028] FIG. 4 provides binding data for LacI peptide fusion proteins to PAR1 receptor. pELM6 is the MBP vector alone; pELM17 is the MBP-native Gt340-350 peptide fusion protein.

[0029] FIG. 5 is a bar graph comparing binding of high affinity clones to the clone of peptide 8.

[0030] FIG. 6 is a bar graph presenting results of a competitive binding assay identifying high affinity rhodopsin binding peptides.

[0031] FIG. 7 is a bar graph showing competitive inhibition of high affinity peptides to rhodopsin by heterotrimeric Gt.

[0032] FIG. 8 presents ELISA results from panning CHO cells overexpressing human thrombin receptor (PAR1) using purified MBP-C-terminal fusion proteins. MBP-G11=xxxx (SEQ ID NO: 1) LQLNLKEYNLV (SEQ ID NO: 2); PAR-13=VRPS (SEQ ID NO: 3) LQLNRNEYYLV (SEQ ID NO: 4); PAR-23=LSRS (SEQ ID NO: 5) LQQKLKEYSLV (SEQ ID NO:6); PAR-33=LSTN (SEQ ID NO: 7) LHLNLKEYNLV (SEQ ID NO: 8); PAR-34=LPQM (SEQ ID NO: 9) QRLNVGEYNLV (SEQ ID NO: 10); PAR-45=SRHT (SEQ ID NO: 11) LRLNGKELNLV (SEQ ID NO:194).

[0033] FIG. 9 presents a dose-response curve of SF9 membranes (PAR1 receptor) assayed with lacI-Gq lysates.

[0034] FIG. 10 is a concentration response curve demonstrating binding of native Gq peptide-maltose bindinG protein to PAR1 reconstituted in lipid vesicles.

[0035] FIG. 11 is a schematic diagram showing an exemplary cDNA minigene construct.

[0036] FIG. 12 is an agarose gel of a NcoI digest of minigene vector. Lane 1 is a 1 kb DNA ladder; lane 2 is pcDNA 3.1; lane 3 is pcDNA-G.alpha.i; lane 4 is pcDNA-G.alpha.iR; and lane 5 is pcDNA-G.alpha.q.

[0037] FIG. 13 is an agarose gel of PCR products showing transcription of peptide minigene RNA in transfected cells. Lane 1 contains size markers, lane 2 contains PCR products from cells transfected with pcDNA-GiR, lane 3 contains PCR products from cells transfected with pcDNA-Gi, and lane 4 contains PCR products from cells transfected with pcDNA3.1, the empty vector.

[0038] FIG. 14 is a bar graph showing the relative [.sup.3H] inositol phosphate production after thrombin stimulation normalized against the basal value.

[0039] FIG. 15 presents data showing GPCR binding peptide inhibition of intracellular calcium concentration increases. FIG. 15A presents fluorescence ([Ca.sup.++]; level) increase 30 seconds after thrombin addition. FIG. 15B shows the kinetics of [Ca.sup.++] fluorescence changes after cell stimulation with thrombin.

[0040] FIG. 16 presents data showing GPCR binding peptide inhibition of thrombin-induced phosphoinositol (P1) hydrolysis.

[0041] FIG. 17 is a bar graph indicating relative thrombin-mediated fold increases of MAPK activity in cells expressing GPCR-binding peptides.

[0042] FIG. 18 shows reduction of thrombin-induced transendothelial electrical resistance in cells expressing G.alpha.q, G.alpha.i, G.alpha.iR or empty vector.

[0043] FIG. 19 is a series of photographs of cells stained for F-actin, showing the inhibition of stress fiber formation after exposure to thrombin in cells expressing pcDNA-G12 or pcDNA-G13 minigene construct.

[0044] FIG. 20 presents data showing blockade of M.sub.2 mAChR response by G.alpha.i peptide expression.

[0045] FIG. 21 demonstrates selective G protein mediated adenylyl cyclase inhibition in cells expressing minigene constructs containing G.alpha. carboxyl terminal peptide inserts.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0046] The present invention involves a method of identifying compounds which can interfere with binding at the interface between a G protein-coupled receptor (GPCR) and its cognate G proteins. These compounds inhibit G protein-mediated signaling and thus can be used as pharmaceuticals, as lead compounds for identification of potential useful drugs, and as components of assays which identify drug candidates. Methods for screening and drug identification use peptides that mimic the structure of the GPCR binding regions of G proteins and are able to inhibit receptor-G protein interactions specifically and with high affinity. These high affinity peptides can be delivered into cells in the context of an expression construct to act as blockers of specific receptor-mediated cellular responses in vitro and in vivo or can be administered directly to a patient. The peptides also form the basis of a screening, identification and selection process to provide traditional pharmaceutical compounds. In particular, the invention allows one to identify high affinity analog peptides that block the receptor-G protein interface for a particular G protein and to use these high affinity analogs in a high throughput screen to identify other peptides or small molecules that likewise specifically antagonize GPCR signaling for a G protein or class of G proteins.

[0047] Small molecules can be used in an analogous high throughput screening process to identify further compounds. "Small molecule" denotes any non-peptide organic compound which binds or interferes with binding to the interfacial region of a GPCR or is a candidate for such action. These peptides or small molecules directed at the receptor-G protein interface can be designed using the inventive method to inhibit biological processes that employ signaling through a GPCR. This approach is useful in targeting G protein-GPCR interactions for which there are no available antagonist ligands, orphan receptors the ligands of which are not known, mutant constitutively activated receptors, antibody-crosslinked irreversibly activated receptors such as TSH receptors in Graves Disease, and proteinase activated receptors (PAR). It works equally well, however, with any GPCR-G protein interaction and more broadly, with receptor-protein interactions in general.

[0048] Because the method is useful for identifying high affinity compounds that can antagonize virtually any GPCR, the approach is useful in identifying compounds which can prevent, ameliorate or correct dysfunctions or diseases in which a specific class of G proteins is relevant. Conditions and disease states for which this method is useful include, but are not limited to: stroke; myocardial infarction; restenosis; atherosclerosis; hypotension; hypertension; angina pectoris; acute heart failure; cardiomyocyte apoptosis; cancers; infections such as bacterial, fungal, protozoan and viral infections, and particularly infections caused by HIV-1 or HIV-2; septic shock; pain; chronic allergic disorders; asthma; inflammatory bowel disease; osteoporosis; rheumatoid arthritis; Graves disease; post-operative ileus; urinary retention; testotoxicosis; ulcers; obesity; benign prostatic hypertrophy; and psychotic and neurological disorders including anxiety, epilepsy, schizophrenia, manic depression, Parkinson's disease, Alzheimer's disease, delirium, dementia, drug addiction, anorexia, bulimia, mood disorders and sleep disorders; smoking cessation and any other disease or condition that can be treated by G protein coupled receptor inhibition. Treatment of this diverse set of disorders is possible because the receptors to which various G proteins bind differ enough to allow the creation of a battery of analog peptides which can specifically interface with different GPCR or different classes or groups of GPCR.

[0049] With the inventive screening methods, the sequences identified in a particular screen do not bind to all receptors, but only to the particular receptor of interest. The interaction between a G protein and a GPCR is quite specific. For example, a difference in one amino acid can substantially reduce or eliminate the ability of the G.alpha.i.sub.1/2 peptide to bind the A1 adenosine G protein coupled receptor-G protein interface. Gilchrist et al., J. Biol. Chem. 273:14912-14919, 1998. Both upstream regulation of GTP/GDP exchange on G proteins and G protein-mediated effector activation may be inhibited with interfacial binding compounds. Thus, high affinity analog peptides can be designed to specifically interfere with a particular action of one GPCR. These specifically-acting peptide analogs are useful both as pharmaceutical compounds per se, and as potent lead compounds in modern high throughput screens for other peptides and small molecule binders having the same specific GPCR interaction.

[0050] High throughput screening is a recent technology that has been developed primarily within the pharmaceutical industry. It has emerged in response to the profusion of new biological targets and the need of the pharmaceutical industry to generate novel drugs rapidly in a changed commercial environment. Its development has been aided by the invention of new instrumentation, by new assay procedures, and by the availability of databases that allow huge numbers of data points to be managed effectively. High throughput screening combined with combinatorial chemistry, rational design, and automation of laboratory procedures has led to a significantly accelerated drug discovery process compared to the traditional one-compound-at-a-time approach.

[0051] One critical aspect of the drug discovery process is the identification of potent lead compounds. A purely random selection of compounds for testing is unlikely to yield many active compounds against a given receptor. Typically, pharmaceutical companies screen 100,000 or more compounds per screen to identify approximately 100 potential lead compounds. On average, only one or two of these compounds actually produce lead compound series. Therefore, companies have been assaying larger and larger data sets in the search for useful compounds. Compound accessibility then becomes an issue: historical compound collections are limited in size and availability. In contrast, large combinatorial chemistry libraries can be synthesized on demand, but at significant technical difficulty and cost. As the library sizes expand, the difficulty becomes selecting the desired compounds from these very large combinatorial libraries. When literally hundred of thousands of compounds are screened, it makes characterizing the candidate lead compounds (artificial and real) an expensive and time-consuming process.

[0052] The multi-step approach to the drug discovery process described here provides a solution to many of these problems. One embodiment of this invention takes advantage of the properties of G protein .alpha. subunit carboxyl termini to identify peptides which act as high affinity, competitive inhibitors of G protein/GPCR interactions. The method, however, can be used with any specific protein-protein, protein-small molecule, protein-nucleic acid interaction or the like. In addition, peptides based on any region of a G.alpha. subunit, or any region of a G.alpha. dimer, which is involved in GPCR binding may be used in the same way. Many such GPCR binding regions are known in the art. The identification of high affinity competitors forms a first step in a screening and selection method which overcomes many of the disadvantages of high throughput screening by providing specific, high affinity lead compounds against which to test potentially useful pharmaceuticals. Because peptides selected by this method have affinity for their binding partner up to 1,000 times higher or more than the native protein, this step is one key to successfully screening and identifying useful pharmaceutical compounds.

[0053] A subsequent step of the process involves high throughput screening of candidate peptide or small molecule pharmaceutical compounds against the high affinity lead peptides identified in the first step. Because the lead peptide compounds are potent and specific binders to the desired receptor, screening assays testing for compounds which are competitive inhibitors and thus decrease binding of the peptide (which interfere with their high-affinity binding) will facilitate identification of those candidate compounds which bind with useful affinity. The high throughput screening step of the drug discovery process is thereby greatly simplified, because the number of false positive compounds, and compounds which are identified as binders but which bind only with low affinity, is reduced or virtually eliminated. Only those compounds with a high chance of success will be identified by the screen, therefore there are many fewer compounds which need to be characterized and further studied to identify useful, specific, potent pharmaceutical compounds. In addition, the method identifies a compound through binding directly to the precise site of interest, so that the mechanism of binding and the mechanism of action of the newly identified pharmaceutical compound does not have to be discovered and confirmed later.

[0054] The identified high affinity peptides also may be used to identify GPCR inverse agonists. The high affinity peptides bind the receptor and stabilize it in an active or "R*" conformation. Screens which are used to identify potent agonists seek out compounds which can compete with this binding and also stabilize the GPCR in its R* state. Inverse agonists, on the other hand, stabilize the GPCR in an inactive or "R" state. Therefore, screens designed to detect dissociation of the high affinity peptide or a decrease in its affinity for the GPCR are used to identify inverse agonists.

[0055] Although this description provides examples relative to the interaction between a G protein coupled receptor and its cognate G.alpha. protein, the methodology can be used to identify peptide inhibitors of most protein-protein interactions, specifically including any interaction between a GPCR and any region of a G.alpha. or G.beta..gamma. G protein subunit. The high affinity peptides selected by this method may be used in high throughput screening to identify small molecules that can be used as modulators of a variety of specific biological process.

[0056] To produce very high affinity peptide GPCR blockers, the tertiary structure of a wild-type G.alpha. carboxyl terminal peptide or any other GPCR binding peptide in its receptor-bound conformation may be studied, for example, using trNOESY (NMR). Dratz et al., Nature, 363:276-280, 1993. Structural data derived from these types of studies of G protein regions are combined with analysis of activity of substituted peptide analogs to define the minimal structural requirements for interaction of peptides with GPCR. The following experimental systems are examples of systems which can be used to define receptor-G protein interactions: (i) rhodopsin-transducing (G.alpha.t) in retinal rod cells, (ii) .beta.-adrenergic receptor-G.alpha.s in C6 glioma cells, (iii) adenosine A1 receptor-G.alpha.1 in Chinese hamster ovary cells, (iv) GABA.sub.B receptors-G.alpha.1 in rat hippocampal CA1 pyramidal neurons, (v) muscarinic M2 receptor-G.alpha.1 in human embryonic kidney cells, and the like. Any GPCR or group of GPCR which is convenient or desired can be used to define the interaction requirements, and skilled workers are aware of many methods to understand structure-activity relationships in receptor binding of this kind. Any of these methods are contemplated for use in these methods and may substitute for the particular methods of the exemplified embodiment.

[0057] The plasmid display method provides an efficient means of identifying specific and potent peptides that can serve as competitive inhibitors of protein-protein interactions. Using the information gleaned from structure-activity studies, a library of variant peptides encoding sequences related to a GPCR-binding region, for example the G.alpha. subunit carboxyl terminus, for each of the classes of the G.alpha. subtypes or G.beta..gamma. can be prepared. Exemplary native sequences upon which libraries may be based include those listed in Table III, below. This library advantageously contains peptides with computer-generated random substitutions within the sequence, and allows one to test a large number of peptide sequences at one time. Preferably, peptide sequences in each library are constructed such that approximately 50% of the amino acid residues are identical to the native GPCR binding region and the remaining amino acid residues are randomly selected from any amino acid. The peptides may range in size from about 7 to about 55 amino acid residues or from about 8 to about 50 amino acids long or from about 7 to about 70 amino acid residues or longer, preferably from about 9 to about 23 amino acid residues. Undecamer peptides are most preferred. Libraries may be constructed in which about 10% to about 90% of the amino acid residues unchanged from the native sequence; however, about 30% to about 70% unchanged is preferred and about 50% is most preferred.

[0058] Alternatively, a synthetic peptide library can be based on any protein known to interact with a GPCR, using randomly created overlapping regions of the protein. The peptides may be about 7-70 amino acids long or about 8-50 amino acids long or preferably about 9 to about 23 amino acids long and most preferably about 11 amino acids long. Oligonucleotides encoding the peptides advantageously may be cloned to the 3' end of the LacI gene, with a linker sequence at the N-terminus of the peptide. The linker sequence is not mandatory for successful screening, but is generally preferred. Restriction enzyme sites may be placed at either end of the peptide coding sequence for cloning purposes. See Table I below for a schematic representation of a peptide library and an example of one peptide. Additional peptides which can be used are shown in Tables II and III, below. The oligonucleotides encoding the actual peptide sequences are synthesized with 70% of the correct base and 10% each of the remaining bases, leading to a biased peptide library with an approximately 50% chance of having the correct amino acid at any specific position along the peptide sequence. Different ratios of bases may be used to achieve the desired mutagenesis rate at any particular position in the sequence. TABLE-US-00001 TABLE I Example for Construction of a Synthetic Peptide Library. Q R M H L R Q Y E L L gaggtggt nnknnknnknnk attcgtgaaaacttaaaagattgtggtcgtttc taa ctaagtaaagc A B C D E (SEQ ID NO:12) n = any amino acid; k = guanidine or thymidine; A = restriction enzyme site; B = linker sequence; C = oligonucleotide encoding peptide sequence (SEQ ID NO:13); D = stop codon; E = restriction enzyme site.

[0059] TABLE-US-00002 TABLE II G.alpha. Subunit Peptides and Corresponding DNA Constructs. G.alpha. SEQ Subunit Sequence ID NO: Gt I K E N L K D C G L F 14 atc aag gag aac ctg aaa gac tgc ggc ctc ttc 15 Gi1/2 I K N N L K D C G L F 16 ata aaa aat aat cta aaa gat tgt ggt ctc ttc 17 GRi1/2 N G I K C L F N D K L 18 aac ggc atc aag tgc ctc ttc aac gac aag ctg 19 Gi3 I K N N L K E C G L Y 20 att aaa aac aac tta aag gaa tgt gga ctt tat 21 Go2 I A K N L R G C G L Y 22 atc gcc aaa aac ctg cgg ggc tgt gga ctc tac 23 Go1 I A N N L R G C G L Y 24 att gcc aac aac ctc cgg ggc tgc ggc ttg tac 25 Gz I Q N N L K Y I G L C 26 ata cag aac aat ctc aag tac att ggc ctt tgc 27 G11 L Q L N L K E Y N L V 28 ctg cag ctg aac ctc aag gag tac aac ctg gtc 29 Gq L Q L N L K E Y N A V 30 ctc cag ttg aac ctg aag gag tac aat gca gtc 31 Golf Q R M H L K Q Y E L L 32 cag cgg atg cac ctc aag cag tat gag ctc ttg 33 G14 L Q L N L R E F N L V 34 cta cag cta aac cta agg gaa ttc aac ctt gtc 35 G15/16 L A R Y L D E I N L L 36 ctc gcc cgc tac ctg gac gag atc aac ctg ctg 37 G12 L Q E N L K D I M L Q 38 ctg cag gag aac ctg aag gac atc atg ctg cag 39 G13 L H D N L K Q L M L Q 40 ctg cat gac aac ctc aag cag ctt atg cta cag 41 Gs Q R M H L R Q Y E L L 42 cag cgc atg cac ctt cgt cag tac gag ctg ctc 43 5'-gatccgccgccaccatggga- -tgaa-3' (SEQ ID NOS: 44, 45)

[0060] TABLE-US-00003 TABLE III Exemplary Native G protein Sequences for Library or Minigene Construction.* Name Sequence SEQ ID NO: hgt IKENLKDCGLF 46 hGi1/2 IKNNLKDCGLF 47 G05_DRO IKNNLKQIGLF 48 GAF_DRO LSENVSSMGLF 49 Gi-DRO IKNNLKQIGLF 50 hGi3 IKNNLKECGLY 51 hGO-1 IANNLRGCGLY 52 hGO-2 IAKNLRGCGLY 53 GAK_CAV IKNNLKECGLY 54 G0_XEN IAYNLRGCGLY 55 GA3_CAEEL IQANLQGCGLY 56 GA2_CAEEL IQSNLHKSGLY 57 GA1_CAEEL LSTKLKGCGLY 58 GAK_XEN IKSNLMECGLY 59 GA1_CAN VQQNLKKSGIM 60 hGZ IQNNLKYIGLC 61 hG15 LARYLDEINLL 62 GA2_SCHPO LQHSLKEAGMF 63 hG12 LQENLKDIMLQ 64 hG13 LHDNLKQLMLQ 65 GAL_DRO LQRNLNALMLQ 66 GA2_YST ENTLKDSGVLQ 67 hG14 LQLNLREFNLV 68 hG11 LQLNLKEYNLV 69 hGQ LQLNLKEYNAV 70 GQ_DROME LQSNLKEYNLV 71 G11_XEN LQHNLKEYNLV 72 Gq_SPOSC IQENLRLCGLI 73 GA1_YST IQQNLKKIGII 74 GA1_NEUCR IIQRNLKQLIL 75 CryptoGba1 LQNALRDSGIL 76 GA3_UST LTNALKDSGIL 77 GA1_KLU IQQNLKKSGIL 78 GA3_UST LTNALKDSGIL 79 GA1_DIC NLTLGEAGMIL 80 GA2_KLU LENSLKDSGVL 81 GA2_UST ILTNNLRDIVL 82 MGs-XL QRMHLPQYELL 83 hGs QRMHLRQYELL 84 hGolf QRMHLKGYELL 85 GA1_COPCO LQLHLRECGLL 86 GA1-SOL RRRNLFEAGLL 87 GA2_SB RRRNLLEAGLL 88 GA1_SB RRRNPLEAGLL 89 GA1_UST IQVNLRDCGLL 90 GA4_UST RENLKLTGLVG 91 GA1_ORYSA DESMRRSREGT 92 GQ1_DROME MQNALKEFNLG 93 GA2_DIC TQCVMKAGLYS 94 GS-SCH LQHSLKEAGMF 95 GA-SAC ENTLKDSGVLQ 96 GA1-CE IISASLKMVGV 97 GA2-CE NENLRSAGLHE 98 GA3-CE RLIRYANNIPV 99 GA4-CE LSTKLKGCGLY 100 GA5-CE IAKNLKSMGLC 101 GA6-CE IGRNLRGTGME 102 GA7-CE IQHTMQKVGIQ 103 GA8-CE IQKNLQKAGMM 104 GA5-DIC LKNIFNTIINY 105 *For production of minigene constructs each nucleotide sequence should be constructed to encode the amino acids MG at the N-terminus of the peptide by using 5'-gatccgccgccaccatggga-(SEQ ID NO: 44) and -tgaa-3' (SEQ ID NO: 45).

[0061] The peptides are advantageously synthesized in a display system for convenience and efficiency of performing the binding reactions. For example, plasmid or phage display systems, as are known in the art, may be employed. While peptide display systems are preferred, any method which allows efficient contact of the peptides with a GPCR and determination of binding may be used.

[0062] A peptide display ("peptides on plasmids") library is a convenient system for use with this invention which exploits the high affinity bond between LacI and lacO. The "peptides on plasmids" display is preferred for use with this invention for two major reasons. The technique is easily set up in the laboratory. In addition, the fusion of the peptide at the carboxyl terminus of the presentinG protein mimics the normal presentation for carboxyl terminal peptides during the screen. If amino terminal or interior peptides are being tested, the peptide may be cloned at the appropriate position to mimic native presentation.

[0063] The "peptides on plasmids" method for testing carboxyl terminal peptides generally works as follows. Persons of skill in the art will be able to modify these methods as needed to accommodate different conditions using this general description and the examples below as a guide. A library of peptides is created by degenerate PCR based on the native GPCR-binding peptide of interest and fused to the carboxyl terminus of LacI. The peptide library is expressed via a plasmid vector carrying the fusion gene. The plasmid also contains the Lac operon (LacO), and when E. coli transcribes and translates the Lacl fusion protein, it binds back as a tetramer to the encoding plasmid through its lacO DNA binding sequence, displaying the inserted sequences of interest on the plasmid. Following transcription and translation, variant peptides encoding different sequences related to the native peptide sequence therefore are displayed as carboxyl terminal extensions of the lacI gene. Thus, a stable LacI-peptide-plasmid complex is formed which can be screened for binding to receptor. Methods described in Gates et al., J. Mol. Biol. 255:373-386, 1996, the disclosures of which are hereby incorporated by reference, are suitable. See Examples 7 and 9 for exemplary methods.

[0064] The E. coli strain used to display the peptides was AR1814, which has the following genotype: .DELTA.(srl-recA) endA1 nupG lon-11 sulA1 hsdR17.DELTA. (ompT-fepC)266 .DELTA.clpA319::kan .DELTA.lacI lacZU118. The strain contains the hsdR17 allele that prevents restriction of unmodified DNA introduced by transformation or transduction. The ompT-fepC deletion removes the gene encoding the OmpT protease, which digests peptides between paired basic residues. the lon-11 and clpA mutations also limit proteolysis by ATP-dependent, cytoplasmic proteases. The deletion of the lacI gene prevents expression of the wild-type lac repressor, which would compete with the fusion constructs for binding to the lacO sites on the plasmid. The lacZ mutation prevents waste of the cell's metabolic resources to make .beta.-galactosidase in the absence of the repressor. The endA1 mutation eliminates a nuclease that has deleterious effects on affinity purification, and the recA deletion prevents multimerization of plasmids through RecA-catalyzed homologous recombination. This strain was selected for its robust growth properties and high yields of immunocompetent cells. Transformation efficiencies of 2.times.10.sup.10 colonies per mg DNA typically were achieved. Although this strain of E. coli is preferred, those of skill in the art are aware of many alternatives which are convenient for use with the methods described. Therefore, any suitable and convenient bacterial strain known in the art is contemplated for use with this invention.

[0065] The Lacl-peptide fusion protein library may be released from the bacteria by gentle enzymatic digestion of the cell wall using lysozyme. After pelleting the cell debris, the lysate then can be added directly to immobilized receptor for affinity purification or used without purification. The display library of these peptides is screened to identify those peptides which bind with high affinity to a particular GPCR. In this way, it is possible to screen for and identify high affinity peptides which bind GPCR and can interfere with activation of the pre-selected specific G protein. The library can be screened against any desired GPCR. Since the combinatorial library contains peptides based on a particular G.alpha. or G.beta..gamma. subunit, any GPCR which binds to or mediates signaling through that subunit or class of subunits can be used. Multiple libraries, based on the carboxyl terminal sequences or other regions of different G protein subunits may be constructed for screening the same or different GPCR.

[0066] To screen the plasmid display library, a G protein coupled receptor of interest advantageously may be immobilized on microtiter plates for screening by ELISA. A plasmid preparation (bacterial lysate) then may be added to the wells. This screening procedure, involving allowing the peptides displayed on the library plasmids to bind receptor, is sometimes referred to as "panning." Sequences that bind the receptor stick to the well so that non-binding sequences can be removed by a washing step. The adherent plasmids then can be expanded and used to transform E. coli. The "panning" process generally is repeated 2 to 8 times. In general, however, 3 to 4 sequential screens are sufficient and preferred. In the later rounds of panning, parent peptide (wild type sequence) preferably is co-incubated with the plasmid preparation to bind receptors and serve as a competitive inhibitor. In this way, only high affinity sequences on the display library are captured by the immobilized receptor. The same competitive inhibition may advantageously be performed using a high affinity peptide or small molecule which has already been identified, rather than the native peptide. See FIG. 1 for a schematic diagram generally describing the "panning" procedure and Example 7 for a specific embodiment. The selection process preferably is carried out in low salt buffers because high salt concentrations destabilize the Lacl-lacO complex, and could lead to peptides becoming associated with the incorrect plasmid. For the same reason, the panning buffers preferably contain lactose, which causes the Lacl to bind more tightly to lacO.

[0067] The selection process of this invention allows the identification of peptide sequences with higher and higher affinity binding with each round of panning. For example, diversity in an unpanned library may look like the sequences given in Table IV, below, i.e. highly randomized. After successive rounds of selection, the selected adherent peptides would look more like those given in Table V, below. TABLE-US-00004 TABLE IV Diversity in Unpanned Gq Library. SEQ. ID NO. Native LQLNLKEYNLV 106 clone #1 LLLQLVEHTLV 107 clone #2 HRLNLLEYCLV 108 clone #3 EQWNMNTFHMI 109 clone #4 SQVKLQKGHLV 110 clone #5 LRLLL*EYNLG 111 clone #6 RRLKVNEYKLL 112 clone #7 LQLRLREHNLV 113 clone #8 HVLNSKEYNQV 114

[0068] TABLE-US-00005 TABLE V Selection in Panned G.alpha.11 Library. SEQ ID NO. Native LQLNLKEYNLV 106 Round 1 1 MKLNVSESNLV 115 2 LQTNQKEYDMD 116 3 LQLNPREDKLW 117 4 RHLDLNACNMG 118 5 LR*NDIEALLV 119 6 LVQDRQESILV 120 Round 2 1 LQLKHKENNLM 121 2 LQVNLEEYHLV 122 3 LQFNLNDCNLV 123 4 MKLKLKEDNLV 124 5 HQLDLLEYNLG 125 6 LRLDFSEKQLV 126 Round 3 1 LQKNLKEYNMV 127 2 LQYNLMEDYLN 128 3 LQMYLRGYNLV 129 4 LPLNPKEYSLV 130 5 MNLTLKECNLV 131 6 LQQSLIEYNLL 132

[0069] Lacl is normally a tetramer and the minimum functional DNA binding species is a dimer. Thus, the peptides are displayed multivalently on the fusion protein, leading to binding to the immobilized receptor in a cooperative fashion. This cooperative binding permits the detection of binding events of quite low intrinsic affinity. The sensitivity of the assay is an advantage in that initial hits of low affinity can be identified, but the disadvantage is that the signal in the ELISA does not necessarily correlate with the intrinsic affinity of the bound peptides.

[0070] One preferred ELISA, where signal strength is better correlated with affinity, involves fusing the sequences of interest from a population of clones in frame with the gene encoding a protein, for example maltose bindinG protein (MBP). Once the sequences have been transferred into the monomeric fusion protein, they can be overexpressed in E. coli and used as either crude lysates or purified fusion proteins for assay by an ELISA which detects the protein bound to receptor or any convenient assay. Those samples with an absorbence of at least two standard deviations above background may be considered to contain high affinity binding peptides. Any desired cut-off point may be used, however, depending on the assay parameters and the needs of the operator. The purified fusion proteins can be further tested by measuring their ability to compete for the site of binding on the receptor using native peptide, a Lacl-peptide fusion protein, or heterotrimeric G protein. Use of competitive ELISA allows one to calculate IC.sub.50 values for the binding of individual fusion protein to the immobilized receptor.

[0071] Peptide fusion proteins can be analyzed in a competitive ELISA format using a fusion protein co-incubation to prevent the binding of lower affinity peptide fusion proteins to the GPCR. Any convenient protein which does not interfere with peptide binding may be used, including for example, glutathione-5-transferase, green fluorescent protein, or ubiquitin, however a maltose binding protein fusion protein such as MB-G.alpha..sub.t340-350K341R is preferred.

[0072] Cloning the library into pJS142 creates a BspEI restriction site near the beginning of the random coding region of the library. Conveniently, digestion with BspEI and SeaI allows the purification of a 900 base pair DNA fragment that may be subcloned into pELM3, a vector that directs the MBP fusion protein to the cytoplasm, a reducing environment. Alternatively, the fragment can be cloned into pELM15, a vector which directs the MBP fusion protein to the periplasm, an oxidizing environment. pELM3 and pELM15 are simple modifications of the pMALc2 and pMALp2 vectors, respectively, available commercially (New England Biolabs). Digestion of pELM3 with AgeI and ScaI allows efficient cloning of the BspEI-ScaI fragment from the pJS142 library. Any suitable method may be used which is convenient to achieve the desired result. Modifications of these methods are well known by those of skill in the art of molecular biology and are contemplated for use here.

[0073] Proof that the high affinity peptides competitively bind to GPCR and interfere with its recognition of G protein can be obtained using a competitive binding assay in the presence of a heterotrimeric G protein. For example, if rhodopsin is the GPCR used in the screen, heterotrimeric G protein, transducin (Gt) may be used. Gt binds rhodopsin with multiple epitopes and is membrane-bound via myristoylation of the .alpha. subunit and farnesylation of the .gamma. subunit carboxyl terminus. Poor competition of peptide analog binding by carboxyl terminal native peptide constructs and/or heterotrimeric Gt indicates high affinity binding of the peptide analogs. An analogous strategy of panning, peptide synthesis and binding studies may be employed for determining high affinity peptides that bind any GPCR, for example the Thrombin receptors (PAR1, PAR3, PAR4), dopamine receptors (D1, D2, D3, D4, D5), vasopressin receptors (V1a, V1b, V2) and histamine receptors (H1, H2, H3), using carboxyl terminal peptide libraries for any G.alpha. subunit, for example G.alpha.i, G.alpha.s and G.alpha.q. Once peptide analogs with higher binding affinities have been elucidated, they can be exploited to inhibit GPCR-G protein interaction.

[0074] The peptides selected by this method, characterized by high affinity, specific blockade of a desired GPCR-mediated signaling event, may be used as therapeutic agents such as traditional pharmaceuticals or gene therapies to treat disorders which would benefit by inhibition of GPCR or used to screen additional libraries of compounds able to compete with the high affinity peptide analogs. Focused synthesis of new small molecule libraries can provide a variety of compounds structurally related to the initial lead compound which may be screened to choose optimal structures. This multi-step approach which gives high affinity inhibitory peptides in the first step, and small molecules in a subsequent step reduces the number of artificial hits by eliminating the lower affinity small molecules that would be selected and have to be assayed in a normal high throughput screening method. In addition, it focuses the search for molecules that bind to a specific desired site on the receptor, for example, that of the G protein binding/activation site, rather than screening for binding to any site on the receptor. Other advantages of this technology are that it is simple to implement, amenable to many different classes of receptors, and capable of rapidly screening very large libraries of compounds.

[0075] Any method known in the art for selecting and synthesizing small molecule libraries for screening is contemplated for use in this invention. Small molecules to be screened are advantageously collected in the form of a combinatorial library. For example, libraries of drug-like small molecules, such as .beta.-turn mimetic libraries and the like, may be purchased from for example ChemDiv, Pharmacopia or Combichem, or synthesized and are described in Tietze and Lieb, Curr. Opin. Chem. Biol. 2:363-371, 1998; Carrell et al., Chem. Biol. 2:171-183, 1995; U.S. Pat. No. 5,880,972, U.S. Pat. No. 6,087,186 and U.S. Pat. No. 6,184,223. Any of these libraries known in the art are suitable for screening, as are random libraries or individual compounds. In general, hydrophilic compounds are preferred because they are more easily soluble, more easily synthesized, and more easily compounded. Compounds having an average molecular weight of about 500 often are most useful, however, compounds outside this range, or even far outside this range also may be used. Generally, compounds having c logP scores of about 5.0 are preferred, however the methods are useful with all types of compounds. Simple filters like Lipinski's "rule of five" have predictive value and may be used to improve the quality of leads discovered by this inventive strategy by using only those small molecules which are bioavailable. See Lipinski et al., Adv. Drug Delivery Rev. 23:3-25, 1997.

[0076] Screening of the peptides or small molecules may be performed conveniently using receptors from any source. Generally, it is convenient to purify receptor from cells and reconstitute the receptor in lipid vesicles or to use membranes isolated from insect or mammalian cells that overexpress the receptor. PAR1 and rhodopsin are convenient receptors, however any suitable receptor is contemplated for use with this invention. The receptors used for screening may be purified from a natural source or purified from cells which overexpress the receptor and reconstituted in lipid vesicles. Alternatively, membranes containing the receptor may be prepared from cells which natively express the receptor, for example Sf9 cells which express PAR1, or from cells which have been genetically engineered to express the receptor, for example mammalian or insect cells overexpressing PAR1. Initially, it is advantageous to determine the binding affinity of the peptide fusion protein or high affinity peptide against which the peptides or small molecules are screened. This allows the amount of receptor and peptide MBP peptide fusion protein or small molecule in the assay to be optimized.

[0077] Generally, it is convenient to test the libraries using a one well-one compound approach to identify compounds which compete with the peptide fusion protein or high affinity peptide for binding to the receptor. A single compound per well generally is used, at about 10 nM each or at any convenient concentration depending on the affinity of the receptor for the compounds and the peptide against which they are being tested. Compounds may be pooled for testing, however this approach requires deconvalution. Compounds may be pooled in groups of about 10 to about 50 compounds per well, or more, at about 10 nM each or at any convenient concentration depending on the affinity of the receptor for the compounds being tested. Peptides desirably are screened using a pooled approach because of the layer members of peptides which are screened in the first instance. Peptides may be screened individually as well, but preferably are screened in pools of about 10.sup.4-10.sup.12 peptides per well or about 10.sup.8-10.sup.10 peptide per well or most preferably about 10.sup.9 peptides per well.

[0078] ELISA, or any other convenient assay, such as fluorescence assays or radioimmunoassay may be used to determine (1) if one or more peptides in each well reduce the amount of binding by the high affinity peptide fusion protein or high affinity peptide, or (2) if one or more peptides in each well bind to the receptor. Compounds may be tested at a series of concentrations, as well, and this generally is preferred if the affinity of the peptide or peptide fusion protein is not known. In an ELISA, wells in which the OD.sub.450 is half or less than half than that of control wells (no tested compounds) generally are considered "positive" and may be further studied. Any suitable cut-off point may be used, however, depending on the assay components and the goals of the assay.

[0079] Screening against the high affinity peptide analogs can be performed using the desired GPCR immobilized onto microtiter wells, biochips, or any convenient assay surface. Binding assays performed in solution also are suitable. One, several, or thousands of candidate small molecule pharmaceutical compounds can be screened for binding to the receptor in the presence or absence of a high affinity peptide analog. The assays preferably are performed in the presence of a high affinity binding peptide to ensure that only those candidate compounds which can successfully compete for binding against the high-affinity binding peptide will be captured by the receptor. Alternatively, organic compounds or small molecules which have been identified by screening as competitively binding with a high affinity peptide analog may also be used as lead compounds in screening for further small molecule candidate compounds with even higher affinity. In either screening process, binding may be detected by any convenient method, for example by ELISA, fluorescence assays or radioimmunoassays.

[0080] By using a two-step protocol to identify compounds which block G protein signaling, high throughput screening of compounds and characterization of the selected compounds is significantly reduced in both time and cost, because only potent and strongly binding compounds are selected. The first step of identification of high affinity peptides which strongly compete with G proteins for their site of binding on G protein-coupled receptors insures this because the high affinity peptides are designed and tested for the particular desired binding specificity, ability to inhibit function within a cellular system and ability to inhibit functions in vivo.

[0081] Preferably, only the most strongly binding and effective peptide analogs or small molecules are used in the second or subsequent screening step. This two or multi-step protocol reduces the number of false positives and identification of compounds which bind only weakly by eliminating the lower affinity small molecules that would be detected and assayed in a conventional high throughput screening method. This method, therefore, is simple to implement, inexpensive, composed of only a few components, amenable to many different classes of receptors, and capable of rapidly screening large libraries of compounds. This method enables efficient identification of new classes of small organic peptidomimetic molecules that function as inhibitors of receptor action, for example, thrombin receptor inhibitors, dopamine receptor inhibitors, histamine receptor inhibitors, or vasopressin receptor inhibitors. These identified compounds can target a single GPCR, a class of GPCR, or block a single G protein pathway activated by GPCR.

[0082] Thorough evaluation of the selected compounds (either peptides or small molecules) for use as therapeutic agents may proceed according to any known method. Properties of the compounds, such as pK.sub.a, log P, size, hydrogen bonding and polarity are useful information. They may be readily measured or calculated, for example from 2D connection tables. Association/dissociation rate constants may be determined by appropriate binding experiments. Parameters such as absorption and toxicity also may be measured, as well as in vivo confirmation of biological activity.

[0083] Pharmaceutical preparations are prepared by formulating the peptides or small molecules identified by the inventive screen according to methods well known in the art, with any suitable pharmaceutical excipient or combination of pharmaceutical excipients. Preparations may be made for administration by any route, such as intravenous, intramuscular, subcutaneous, oral, rectal, vaginal, transdermal, transmucosal, sublingual and the like, however, the intravenous route is generally preferred for peptide preparations. Any suitable vehicle may be used, for example saline or lactated Ringer's, for intravenous administration.

[0084] Dosages for treatment of GPCR-related diseases or condition will depend on many factors such as the nature of the disorder, the GPCR involved, the route of administration, factors relating to the general physical condition and health of the patient and the judgment of the treating physician. Persons of skill in the art are well aware of these factors and consider manipulation of dosage to obtain an optimum result to be routine. Generally, dosages for intravenous administration may vary between about 0.01 mg/kg and 1000 mg/kg, however, this range can be expanded depending on the patient's needs. Such an expanded range is considered within the scope of this invention.

[0085] Alternatively, peptides according to this invention may be provided to cells, in vivo or ex vivo, by delivery of an expression construct. Gene therapy can be performed in-vivo as a direct introduction of the genetic material. The in vivo gene transfer would introduce the oligonucleotides encoding the peptides to cells at the site they are found in the body, for example to skin cells on an arm, or to lung epithelial cells following inhalation of the gene transfer vector. Alternatively, ex-vivo gene transfer, the transfer of genes into viable cells that have been temporarily removed from the patient and are then returned following treatment (e.g. bone marrow cells) could also be employed.

[0086] Gene transfer vectors can be engineered to enter specific tissues or cells. Transductional targeting allows the gene transfer vectors to interact with specific cell surface receptors. Transductional targeting can also take advantage of the rate of cellular division by using gene transfer vectors that target rapidly dividing cells such as tumor cells. Transcriptional targeting recruits distinct cellular promoter and enhancer elements to influence transcription of the therapeutic gene. Transfection efficiencies are also enhanced by engineering vectors with monoclonal antibodies, carbohydrate ligands, and protein ligands that help deliver genes to specific cells.

[0087] The gene transfer vectors used to produce the high affinity peptides inside cells could be viral vectors (Retrovirus, Adenovirus, Adeno-Associated Virus, Herpes Simplex Virus, or Vaccinia Virus). As an alternative, non-viral vectors may also be used, these include such methods as injection of naked DNA, or introduction of either DNA or peptides by attachment to positively charged lipids, or cationic liposomes, electroporation or ballistic DNA Injection (limited to ex-vivo applications), as well as introduction of branched peptides.

[0088] Tet-inducible retroviral vectors for the native C-terminal sequences that co-expresses GFP driven by an internal ribosomal entry site (IRES) from encephalomyocarditis virus (p-Tet-Ti-GFP) may be used. These vectors can be modified so that they encode the high affinity peptide sequences. In addition, the high affinity peptide can be driven by a sequence allowing for spatial or temporal expression. For in vitro studies, viral supernatants may be collected from a pantropic producer line such as GP-293 (Clontech) in serum-free media. Viral supernatants may be concentrated by ultracentrifugation at 4.degree. C. for 2 hr at 22,000 rpm, and the pellets resuspended in 1/100 the original volume in serum-free media with a titer of at least 10.sup.8 i.u. (Infectious units)/ml and stored at -80.degree. C.

[0089] Murine leukemia virus (MLV) derived retroviral vectors are commonly used vehicles for stable delivery of therapeutic genes into endothelial cells. For the retrovirus studies in vivo, high affinity peptides subcloned into a replication-defective murine Moloney retrovirus vector which is Tet-inducible and co-expresses GFP driven by an internal ribosomal entry site (IRES) from encephalomyocarditis virus (pTet-GFP). These constructs may then be transiently transfected into producer line to generate cell-free titers of 10.sup.6-10.sup.9 i.u/mL. If needed, a pantropic retroviral expression system (GP-293; Clontech) which utilizes VSV-G, an envelope glycoprotein from the vesicular stomatitis virus, may be utilized to overcome low transfection efficiencies. By using this innovative cell-based gene transfer method one can obtain stable, long-term, and localized gene expression of the high affinity C-terminal peptides.

[0090] To conclusively demonstrate that the compounds identified by this method can modulate G protein signaling events implicated in disease syndromes in vivo, antagonism of selective G protein signal transduction events may be confirmed. One method of testing the ability of compounds to compete with native G protein binding involves expressing peptides that block the receptor-G protein interface in cells bearing the receptor. Plasmid constructs that encode GPCR-binding region peptides, such as carboxyl terminal peptide sequences from the various G.alpha. subunits (see Table VI) can be used to express them in cells in vivo, ex vivo or in vitro, so that the metabolic effects of selective GPCR blockade can be studied qualitatively and quantitatively. Such studies provide proof that the binding which the compounds possess is useful in vivo to modulate selective G protein signals.

[0091] Expression of the peptides is conveniently achieved using the minigene approach by methods such as those described in Example 23, however any suitable method may be used. Any desired peptide sequence may be expressed using these methods. Those of skill in the art are well aware of alternative methods for construction, transfection and expression of protein and peptide constructs comprising the high affinity peptide analogs, and such methods are contemplated for use with them. TABLE-US-00006 TABLE VI Exemplary Sequences of C-terminal Minigene Peptides. Peptide Name Sequence SEQ ID NO: G.alpha.i MGIKNNLKDCGLF 133 G.alpha.iR MGNGIKCLFNDKL 134 G.alpha.q MGLQLNLKEYNAV 135 G.alpha.q** MGLQLNLKEYNTL 136 G.alpha.12 MGLQENLKDIMLQ 137 G.alpha.13 MGLHDNLKQLMLQ 138

[0092] As discussed above, many receptors interact with and activate multiple G proteins. Using the minigene strategy to introduce the high affinity-binding carboxyl terminal peptides into cells, it is possible to inhibit specific G protein-coupled receptor interactions with individual G proteins, thus demonstrating the feasibility of specific G protein blockade in vivo with compounds identified by the inventive method. For those receptors which activate multiple G proteins, each of which activates a distinct set of signaling pathways mediating a specific set of responses (for example, the thrombin receptor), one pathway can be inhibited without substantially affecting the others.

[0093] To selectively antagonize G protein signal transduction events in vivo by expressing peptides that block the receptor-G protein interface, minigene plasmid vectors were designed to express the C-terminal peptide sequence of the various G.alpha. subunits following their transfection into mammalian cells. A control minigene vector also was created, encoding the carboxyl terminus of G.alpha.i.sub.1/2 in random order (G.alpha.iR, see Table VI). One important element necessary for the minigene approach to block intracellular signaling pathways effectively in vivo is expression of adequate amounts of the desired peptides. Therefore, expression of the minigene should be confirmed by a convenient method of detecting mRNA, protein or both. Any convenient method known in the art can be used.

[0094] To determine the cellular efficacy of the minigene approach for expressing GPCR binding peptides, and to show the specific inhibition of one G protein pathway in response to a given receptor activation signal without affecting others, compounds advantageously may be assayed in a system designed to exhibit a measurable cellular signaling endpoint. One example of such a system is the thrombin receptor, PAR1, in endothelial cells. This receptor activates multiple G proteins. Several signaling endpoints, including transcription analysis of induced PAR1 gene expression; biochemical analysis of effector molecules including [Ca.sup.2+], MAP kinase ("MAPK") activity, adenylyl cyclase activity, and inositol phosphate accumulation; as well as functional assays such as cell proliferation and endothelial permeability are available to measure specific activation or modulation of activation of different G proteins by ligand binding at this receptor. Signaling activity may be measured by any convenient method, including: measuring inositol phosphate accumulation; measuring intracellular calcium concentration levels; measuring transendothelial electrical resistance; measuring stress fiber formation; measuring ligand binding (agonist, antagonist or inverse agonist); measuring receptor expression; measuring receptor desensitization; measuring kinase activity; measuring phosphatase activity; measuring nuclear transcription factors; measuring cell migration (chemotaxis); measuring superoxide formation; measuring nitric oxide formation; measuring cell degranulation; measuring GIRK activity; measuring actin polymerization; measuring vasoconstriction; measuring cell permeability; measuring apoptosis; measuring cell differentiation; measuring membrane association of a protein that translocates upon GPCR activation, such as protein kinase C; measuring cytosolic accumulation of a protein that translocates upon GPCR activation, such as protein kinase C; measuring cytosolic accumulation of a protein that translocates upon GPCR activation, such as src; and measuring nuclear association of a protein that translocates upon GPCR activation, such as Ran. The functional effects of G.alpha. C-terminal minigenes in the mechanism of thrombin-induced cell retraction, as measured by the change in transendothelial electrical resistance (TEER) also can be used to measure G protein inhibition.

[0095] For example, thrombin-mediated PAR1 gene induction was inhibited in human microvascular endothelial cells (HMEC) expressing the G.alpha.i minigene construct. Expression of the G.alpha.q minigene construct, however, affected thrombin-mediated inositol phosphate accumulation. Expression of G.alpha.q also specifically decreased both thrombin-induced intracellular Ca.sup.++ rise and thrombin-induced MAPK activity.

[0096] Thrombin activation of the G.alpha.i mechanism in HMEC decreases cAMP levels increased in response to isoproterenol (which acts through G.alpha.s). Assay for cAMP level increases in response to isoproterenol alone may be compared to increases after thrombin pre-incubation in cells expressing G.alpha.i to show that expression of the GPCR binding peptide blocks G.alpha.i signaling.

[0097] Recent work by Gohla et al., J. Biol. Chem. 274: 17901-17907, 1999, elegantly demonstrated that thrombin receptors induce stress fiber accumulation via G.alpha.12 in an EGF receptor-independent manner. The formation of stress fiber formation appears to be Rho dependent. Both G12 and G13 have been implicated in the Rho signaling pathway. Therefore, expression of G.alpha.12 and G.alpha.13 GPCR-binding peptides in HMEC were used to determine whether these peptides could block the appearance of stress fibers in response to thrombin.

[0098] The extracellular signal-regulated kinase (ERK) subfamily of mitogen-activated protein kinases (MAPKs) regulates numerous cell signaling events involved in proliferation and differentiation. This forms the basis of another assay which can determine whether GPCR binding peptides can affect a specific G protein mediated pathway. Transfection of HMEC cells with minigenes encoding GPCR binding peptides along with HA-MAPK followed by immunoprecipitation of the HA-MAPK permits measurement of the effects only on cells expressing GPCR binding peptides.

[0099] Many studies have shown that the M.sub.2 muscarinic receptor (mAChR) couples exclusively to the Gi/GO family. See Dell'Acqua et al., J. Biol. Chem. 268:5676-5685, 1993; Lai et al., J. Pharm. Exp. Ther. 258:938-944, 1991; Offermanns et al., Mol. Pharm. 45:890-898, 1994; Thomas et al., J. Pharm. Exp. Ther. 271:1042-1050, 1994. The M.sub.2 mAChR can efficiently couple to mutant G.alpha.q** in which the last five amino acids are substituted with the corresponding residues from G.alpha.i or G.alpha.O, suggesting that this receptor contains domains that are specifically recognized by the carboxyl terminus of G.alpha.i/O subunits. See Liu et al., Proc. Natl. Acad. Sci. USA 92:11642-11646, 1995.

[0100] To test inhibition of G protein-coupled receptor-mediated cellular responses by carboxyl terminal G.alpha. peptides expressed using minigene constructs, prototypical directly G.beta..gamma. activated channels (GIRK channels) regulated by a pertussis toxin-sensitive M.sub.2 mAChR was chosen as the model. In this model, the importance of the G.alpha. carboxyl terminus and the downstream effector system have been well established. See Krapivinsky et al., J. Biol. Chem. 270:29059-29062, 1995; Krapivinsky et al., J. Biol. Chem. 273:16946-16952, 1998; Sowell et al., Proc. Natl. Acad. Sci. USA 94:7921-7926, 1997. Inhibition of M.sub.2mAChR activation of inwardly rectifying potassium currents can be tested to demonstrate inhibition of a downstream functional response following agonist stimulation of GPCR on cells transiently transfected with a G.alpha. carboxyl terminal peptide minigene or treated with a pharmaceutical compound identified by screening against high affinity G.alpha. peptides.

[0101] GIRK channels modulate electrical activity in many excitable cells. See Breitwiese et al., J. Membr. Biol. 152:1-11, 1996; Jan et al., Curr. Opin. Cell Biol. 9:155-160, 1997; Wickman et al., Curr. Opin. Neurobiol. 5:278-285, 1995. Because the channel opens as a consequence of a direct interaction with G.beta..gamma., whole cell patch clamp recording of I.sub.KACh can be used to demonstrate inhibition of a downstream functional response following agonist stimulation of GPCR on cells transiently transfected with a G.alpha. carboxyl terminal peptide minigene or treated with a pharmaceutical compound identified by screening against high affinity G.alpha. peptides. Superfusion of cells expressing GIRK1/GIRK4 with their ligand, acetylcholine (ACh), activates inwardly rectifying potassium currents.

[0102] Using well-established receptor models accepted to be indicative of in vivo cellular results, this type of data can show that the individual G proteins activated via a given GPCR have specific roles in mediating cellular events and can be modulated in a specific fashion by ligands mimicking GPCR binding regions of individual G.alpha. subunits. In particular, for receptors such as the thrombin receptor, which activate multiple G proteins, each of which activates a distinct set of signaling pathways mediating a specific set of responses, it is possible using the inventive methods to block one pathway while leaving all the others functional. The high affinity peptide analogs identified in vitro by consecutive affinity purification and competitive binding, are capable of specifically inhibiting the downstream consequences of G protein signaling.

[0103] The assays described above clearly establish the ability of compounds identified by in vitro competitive binding studies to interfere with a particular GPCR-G protein interaction selectively, even when the GPCR regulates multiple G proteins within the cell. Moreover, the peptides compete very effectively with the native sequence. In addition, the minigene approach described above and exemplified in the examples below allows a systematic test of the roles of other G proteins such as G.alpha.12 and G.alpha.13, which may be involved in the mechanism of increase of endothelial permeability, and clearly demonstrates the viability of this approach to select and identify G.alpha. subunit modulating compounds. The peptides therefore are suitable for use in treatment of any disorder or syndrome characterized by G protein signaling excess.

[0104] In another aspect, the invention relates to methods to identify the G proteins with which a specific orphan receptor is coupled, using the materials provided by the invention. For example, the described methods can be used to test any GPCR with a battery of G.alpha. subunit peptides to determine which species of G protein(s) mediates the effects of the receptor. The methods described in Examples 15-18 are suitable. Those of skill in the art are capable of designing other assays, or variations and modifications using these assays as guides.

[0105] The following non-limiting examples are provided to illustrate certain aspects of this invention.

EXAMPLE 1

Construction of a Peptide Library

[0106] Construction of a biased peptide library has been described previously. Martin et al., J. Biol. Chem. 271:361-366, 1996; Schatz et al., Meth. Enzymol. 267:171-191, 1996. The vector used for library construction was pJS142 (see FIG. 2). This vector had a linker sequence between the LacI and the biased undecamer peptide coding sequence, as well as restriction sites for cloning the library oligonucleotide. The oligonucleotide synthesized to encode the mutagenesis library was synthesized with 70% of the correct base and 10% of each of the other bases at each position. This mutagenesis rate leads to a biased library such that there is approximately a 50% chance that any of the 11 codons will be the appropriate amino acid and approximately a 50% chance that it will be another amino acid. In addition, a linker of four random NNK (where N denotes A, C, G or T and K denotes G or T) codons were synthesized at the 5' end of the sequence to make a total of 15 randomized codons. Using this method, a library with greater than 10.sup.9 independent clones per microgram of vector used in the ligation was constructed based on the carboxyl terminal sequence of G.alpha.t (IKENLKDCGLF; SEQ ID NO:139). The nucleic acid used for creating this library was 5'-GAGGTGGTNNKNNKNNKNNatcaaggagaacctgaaggactgcggcctcttcTAACTAAGTAAAGC-3', wherein N=A/C/G/T and K=G/T; SEQ ID NO:140).

EXAMPLE 2

Sequences for the Creation of G.alpha. Subunit Peptide Libraries

[0107] Libraries were created using the methods of Example 1 and the sequences listed below in Table VII. TABLE-US-00007 TABLE VI C-Terminal G.alpha. Subunit Peptide Library Constructs. G.alpha. Sub- unit RE Linker Peptide Coding Region Stop RE SEQ ID NO: Gs 5-GAGGTGGT NNKNNKNNKNNK attcgtgaaaacttaaaagattgtggtcgtttc TAA CTAAGTAAAGC-3' 141 G11 5-GAGGTGGT NNKNNKNNKNNK ctgcagctgaacctgaaggagtacaatctggtc TAA CTAAGTAAAGC-3' 142 G12 5-GAGGTGGT NNKNNKNNKNNK ctgcaggagaacctgaaggacatcatgctgcag TAA CTAAGTAAAGC-3' 143 G13 5-GAGGTGGT NNKNNKNNKNNK ctgcatgacaacctcaagcagcttatgctacag TAA CTAAGTAAAGC-3' 144 G15 5-GAGGTGGT NNKNNKNNKNNK ctcgcccggtacctggacgagattaatctgctg TAA CTAAGTAAAGC-3' 145 Gz 5-GAGGTGGT NNKNNKNNKNNK atacagaacaatctcaagtacattggcctttgc TAA CTAAGTAAAGC-3' 146

EXAMPLE 3

Isolation of Membranes from Insect Cells Expressing Thrombin Receptor

[0108] Sf9 cells (2.times.10.sup.8 cells) were cultured with 200 ml of Grace's insect cell culture medium (Life Technologies, Inc., Grand Island, N.Y.) containing 0.1% Pluronic F-68 (Life Technologies, Inc., Grand Island, N.Y.)), 10% fetal calf serum, and 20 .mu.g/ml gentamicin in a 1-liter spinner flask at 27.degree. C. for 25 hours. Sf9 cells were infected with the ThR/pBluebac recombinant virus at a multiplicity of infection of 3-5, and cultured at 27.degree. C. for 4 days. The cells were harvested, washed with phosphate buffered saline, and then resuspended in 10 mM Tris-HCl, pH 7.4. Cells were then homogenized with a hand-held homogenizer set at low speed for 20 seconds. The broken cells were than sedimented at 17,000 xg for 15 minutes. The supernatant was discarded, and the pellet resuspended in a buffer consisting of 50 mM Tris-HCl, pH 7.4 and 10% glycerol. Concentration of receptor in the membrane preparation ranged from 1-10,000 .mu.M/mg. For screening, a final concentration of 200 .mu.g/ml was used. The thrombin receptors were tested for their ability to bind to the native Gq-C terminal peptide using a MBP-Gq fusion protein. (FIG. 7).

EXAMPLE 4

Isolation of Membranes from Mammalian Cells Overexpressing Thrombin Receptor

[0109] PAR1 receptor cDNA (2.1 kb insert) was obtained by polymerase chain reaction and cloned into the mammalian expression vector pBJ5. The resulting plasmid was transfected into Chinese hamster ovary cells by the calcium phosphate coprecipitation method. The PAR1 transfected cells were grown with Dulbecco's modified Eagle's medium containing 10% fetal calf serum, 100 units/mL penicillin and 100 .mu.g/mL streptomycin. The cells were detached using PBS with 5 mM EDTA and washed twice in PBS. The pellet was either used immediately for membrane preparation or stored frozen at -20.degree. C. Pellets were homogenized in 20 mM Tris-HCl, pH 7.5, with 5 mM EDTA and 0.5 mM PMSF, using a Dounce homogenizer (10 strokes) and sonicated for 10 seconds. Nuclear debris and intact cells were removed by centrifugation at 3000 rpm for 10 minutes. The supernatant was sedimented at 12,000 xg for 30 minutes and the resulting pellet suspended in 25 mM Tris-HCl, pH 7.5, 25 mM MgCl.sub.21 10% sucrose, 0.5 mM PMSF, 50 .mu.g/mL antipain 1 .mu.g/mL aprotinin, 40 .mu.g/mL bestatin, 100 .mu.g/mL chymostatin, 0.5 .mu.g/mL leupeptin and 0.7 .mu.g/mL pepstatin. The membranes were aliquoted and frozen at -80.degree. C.

EXAMPLE 5

Preparation of Rod Outer Segments

[0110] Bovine rod outer segments (rhodopsin-containing membranes) were prepared from fresh retinas under dim red light as described by Arsharky et al., J. Biol. Chem. 269:19882-19887, 1994. The retinas were placed in a beaker for dissection filled with 200 mL of 30% (w/v) sucrose in isolation buffer (90 mM KCl, 30 mM NaCl, 2 mM N.sub.gCl.sub.2, 0.1 mM EDTA, 1 mM DTT, 50 .mu.M phenylmethylsulfonyl fluoride, 10 mM MOPS, pH 7.5) on ice with constant moderate stirring of the solution during dissection. Following dissection, the retina solution was left in the dark for one hour on ice. The retina-sucrose solution was distributed into eight 50 mL tubes and sedimented at 3000 xg for four minutes at 4.degree. C. The supernatant was decanted into eight fresh centrifuge tubes and placed on ice. The volumes of the tubes were filled to 1.5 cm below top with isolation buffer, then sedimented at 17,000 xg for 20 minutes ("spin 1").

[0111] The pellets were resuspended in a small volume of 30% sucrose and consolidated from eight tubes into four tubes. The tubes were filled to 1.5 cm below top with 30% sucrose, sedimented at 5000 xg for four minutes at 4.degree. C., and the supernatant decanted into four clear tubes. These tubes were filled to 1.5 cm below top with isolation buffer and sedimented at 17,000 xg for 20 minutes at 4.degree. C. ("spin 2").

[0112] A stepwise sucrose gradient was prepared in six gradient tubes using the solutions in Table VIII, below, with a sequence from top to bottom of #2, #3, #4. TABLE-US-00008 TABLE VIII Sucrose Gradient Solutions. Solution #2 (0.84 M) #3 (1.0 M) #4 (1.14 M) 42% Sucrose 51.30 g 61.05 g 69.75 g 1.0 M MOPS 750 .mu.L 750 .mu.L 750 .mu.L 2.0 M KCl 2250 .mu.L 2250 .mu.L 2250 .mu.L 3.0 M NaCl 750 .mu.L 750 .mu.L 750 .mu.L 2.0 M MgCl.sub.2 75 .mu.L 75 .mu.L 75 .mu.L Total Weight 83.25 g 84.75 g 86.25 g

[0113] The pellets from "spin 1" and "spin 2" were resuspended in isolation using 1 mL 26% sucrose buffer per tube. After making a slurry, each tube was homogenized with a 1 mL pipette and the tubes consolidated. The pellet solution was carefully laid onto the sucrose gradients and were not allowed to invade the gradient layers. The gradient tubes were subjected to 24,000 xg for 30 minutes at 4.degree. C. in a swinging bucket rotor, after which the orange layer containing the membranes was collected, being careful to avoid the pellet or the dark solution near the pellet. The membranes were distributed into six 50 mL tubes and placed on ice. The tubes then were filled to 1.5 cm below top with isolation buffer and sedimented at 17,000 xg for 20 minutes at 4.degree. C. The supernatant was discarded and the pellets resuspended in 1 mL isolation buffer containing 5 .mu.g/mL pepstatin and 10 .mu.g/mL E-64. This suspension was stored in a foil-wrapped 15 mL conical tube at -80.degree. C. until needed, then thawed, homogenized in EDTA buffer (10 mM Tris pH 7.5, 1 mM EDTA 1 mM DTT) and sedimented at 30,000 xg for 30 minutes. The supernatants were discarded and the pellets resuspended and sedimented again as described above. The pellets then were resuspended in urea buffer (10 mM Tris, pH 7.5, 1 mM EDTA, 1 mM DTT, 7 M urea), homogenized and sedimented at 45,000 kg for 40 minutes. These pellets were resuspended and homogenized in Buffer A (200 mM NaCl, 10 mM MOPS, pH 7.5, 2 mM MgCl.sub.2, 1 mM DTT, 100 .mu.M PMSF), then sedimented at 30,000 xg for 30 minutes. The pellets each were resuspended and homogenized by pipetting in 1 mL buffer A and stored at -80.degree. C. in 100 .mu.L aliquots in foil-covered tubes for use in assays. For screening, the receptor was added to wells at 10 .mu.g/ml. Binding assays were performed as in Example 15.

EXAMPLE 6

Purification of PAR1 Thrombin Receptor from Insect Cells and Reconstitution of Receptors into Lipid Vesicles

[0114] Sf9 cells (2.times.10.sup.8 cells) were cultured in Grace's insect cell culture medium (Life Technologies, Inc., Grand Island, N.Y.) containing 0.1% Pluronic F-68 (Life Technologies), 10% fetal calf serum and 20 .mu.g/mL gentamicin in a 1 L spinner flask at 27.degree. C. for 25 hours. The cells were infected with ThR/pBluebac (recombinant virus) at a multiplicity of infection of 3-5 and cultured at 27.degree. C. for four days. The cells were harvested, washed with phosphate buffered saline containing 2.7 mM EDTA and stored at -70.degree. C. until used. the cells were resuspended in lysis buffer (2.5 mM Tris-HCl, pH 7.2, 7.5 mM NaCl, 10 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 10 mg/mL leupeptin, 10 mg/mL aprotinin, 50 mM NaF) and washed. All subsequent steps should be done on ice with cold buffers and centrifuge rotors at or below 4.degree. C. The cells were homogenized for one minute at maximum speed and sedimented for 45 minutes at 30,000 xg. The pellet was resuspended in lysis buffer and the homogenation/washing step repeated three times. The resulting pellet was resuspended in 30 mL solubilization buffer (20 mM Tris-HCl, pH 7.4, 15 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 10 mg/mL leupeptin, 10 mg/mL aprotinin, 50 mM NaF, 0.1% (w/v) digitonin, 0.1% (w/v) Na deoxychoate) and then homogenized for one minute. The suspension was stirred for 90 minutes at 4.degree. C. and then sedimented for 60 minutes at 30,000 xg. The supernatant was loaded onto an anti-PAR1 monoclonal antibody column equilibrated with solubilization buffer containing 0.2% digitonin. After application of the supernatant, the column washed with 10 column volumes of 10 mM Tris-HCl buffer, pH 7.4, containing 0.2% (w/v) Na dodecyl maltoside. The receptor was eluted using 10 mM triethylamine, pH 11.8. The eluted fractions were neutralized immediately using 1 M HEPES, pH 6.4. The pooled fractions were dialyzed against 50 mM HEPES buffer, pH 7.4, containing 50% (v/v) glycerol, 0.1 M NaCl and 0.2% (w/v) Na dodecyl maltoside. Aliquots were stored at -80.degree. C.

[0115] For preparation of lipid vesicles, 200 .mu.L phosphatidylserine (50 mg/mL in CHCl.sub.3; Matreya) was dried in a rotary evaporator for 30 minutes or using a stream of dry N.sub.2. After addition of 200 .mu.L buffer A (50 mM HEPES, 100 mM NaCl, 0.2% (w/v) Na dodecylmaltoside), the tube was sealed under an N.sub.2 atmosphere and sonicated in a bath sonicator for 30 minutes. Reconstitution of receptors into lipid vesicles was performed the same day, using purified receptor prepared as in Example 5. Purified receptor stocks (200 .mu.g/mL) were thawed on ice and 50 .mu.L was incubated for 20 minutes at 4.degree. C. with the appropriate agonist peptide (100 nM final concentration). In the case of thrombin receptor, the agonist is thrombin receptor agonist peptide (100 nM final concentration; CalbioChem). After addition of 80 .mu.L sonicated lipids and 50 .mu.L buffer A, the samples were mixed using a vortex machine and placed on ice for 10 minutes. The samples then were loaded onto a 1 mL Extracti-gel.TM. column which had been washed with 0.2% BSA and pre-equilibrated with 5 mL Buffer A without Na dodecylmaltoside. The reconstituted vesicles were eluted from the column with 2.5 mL HEK buffer.

[0116] Samples 100-200 .mu.L) were collected for purity analysis by SDS-PAGE. The concentration for each batch generally was about 10-1000 .mu.g/ml. For use, receptor was placed in microtiter plates at about 1-100 .mu.g/ml. The purified, reconstituted thrombin receptors were tested for their ability to bind to the native Gq-C terminal peptide using a MBP-Gq fusion protein. (FIG. 3). As a control, empty vesicles were also tested for their ability to bind to the native Gq-C terminal peptide using a MBP-Gq fusion protein.

EXAMPLE 7

Identification of GPCR-Binding High Affinity Peptide Analogs (Panning)

[0117] Electrocompetent cells were produced as follows. A single colony of AR1814 bacteria was grown overnight at 37.degree. C. in 5 ml sterile SOP (20 g/L Bacto-tryptone; 10 g/L Bacto-yeast extract; 5 g/L NaCl; 2.5 g/L anhydrous K.sub.2HPO.sub.4; 1 g/L Mg.sub.2SO.sub.4.7H.sub.2O). One milliliter of this overnight growth was added to 500 ml SOP and the bacteria allowed to grow with the OD.sub.600 read 0.6-0.8. All further washing steps were done in the cold. The cells were placed in an ice-water bath for at least 15 minutes, then subjected to centrifugation at 4000 xg for 15 minutes at 4.degree. C. followed by resuspension in 500 ml 10% glycerol. After sitting on ice for 30 minutes, the cells were washed twice more in 500 ml and 20 ml 10% glycerol with sedimentation as above, and finally sedimented at 5000 xg for 10 minutes at 4.degree. C. and resuspended in 1 mL 10% glycerol. Cells were quick frozen using dry ice and isopropanol in 100 .mu.L aliquots for later use.

[0118] To transfect, aliquots (40 .mu.L) of thawed AR1814 cells were placed into each of three chilled microcentrifuge tubes. A peptide display library based on the undecamer carboxyl terminal peptide of G.alpha..sub.t (SEQ ID NO:126) was prepared according to Example 1. Two microliters of library plasmid were added to the tubes and mixed. For the first round of "panning," 200 .mu.L of the plasmid library was added. For subsequent rounds, three sets of transfections were performed (adherent plasmids from wells containing receptor (+); adherent plasmids from wells containing no receptor (-); and the PRE sample which was not incubated). See below. In each round of panning, less library was used (round 2:100 .mu.L; round 3:50 .mu.L; round 4:10 .mu.L). After the panning was completed, the DNA for the Lacl fusion protein is eluted. This DNA (50 .mu.L) is used to transfect E. Coli cells by electroporation, using cold, sterile 0.1 cm electrode gap cuvettes. The cuvettes were pulsed one time using a BioRad E. coli Pulsar set to 1.8 kV, 25 .mu.F capacity, time constant 4-5 mseconds, with the Pulser Controller unit at 200 m.OMEGA.. Immediately, 1 mL of SOC was added and the mixture transferred to a labeled 17.times.100 mm polystyrene tube. The tube was shaken for one hour at 37.degree. C. Aliquots were taken from each set to plate 100 .mu.L undiluted to 10.sup.-6 dilution samples on LB-Amp plates. Counts of the PRE plates indicated library diversity, while comparison of the (+) and (-) plates indicated whether specific clones were being enriched by the panning procedure.

[0119] The remaining .about.900 .mu.L in the +receptor tube was added to a 1 L flask containing 200 mL LB-AMP media, prewarmed to 37.degree. C., and grown at 37.degree. C., shaking until OD.sub.600=0.5. The tube of cells then were placed in an ice water bath for at least 10 minutes, and kept chilled at or below 4.degree. C. during the subsequent washing steps. The cells were sedimented at 5000 xg for six minutes, resuspended in 100 mL WTEK buffer, sedimented at 5000 xg for six minutes, resuspended in 50 mL TEK buffer, resedimented at 5000 xg for six minutes and resuspended in 4 mL HEK buffer. The cells were divided into the cryovials and stored at -70.degree. C. One tube was used for the next round of panning and the other saved as a backup.

[0120] The panning process is illustrated in FIG. 1. For screening of the library by "panning," rhodopsin receptors prepared according to Example 5 were immobilized directly on Immulon 4 (Dynatech) microtiter wells (0.1-1 .mu.g of protein per well) in cold 35 mM HEPES, pH 7.5, containing 0.1 mM EDTA, 50 mM KCl and 1 mM dithiothrietol (HEK/DTT). After shaking for one hour at 4.degree. C., unbound membrane fragments were washed away with HEK/DTT. The wells were blocked with 100 .mu.L 2% BSA in HEKL (35 mM HEPES; 0.1 mM EDTA; 50 mM KCl; 0.2 M .alpha.-lactose; pH 7.5, with 1 mM DTT). For rounds 1 and 2, BSA was used for blocking; in later rounds 1% nonfat dry milk was used. For the first round of panning, about 24 wells of a 96-well plate were used. In subsequent rounds, 8 wells with receptor and 8 wells without receptor were prepared.

[0121] The Gt library was thawed (2 mL aliquot) and mixed with 6 mL lysis buffer on ice. Lysis buffer contains 4.25 mL HE (25 mM HEPES: 0.1 mM EDTA; pH 7.5); 1 mL 50% glycerol; 750 .mu.L 10 mg/mL protease-free BSA in HE; 10 .mu.L 0.5M DTT; and 6.25 .mu.L 0.2M PMSF. Freshly prepared lysozyme solution (150 .mu.L 10 mg/mL lysozyme in cold HE) was added and the tube was gently inverted several times and incubated on ice for no more than two minutes. The extent of lysis is evidenced by an increase in viscosity that can be observed by noting the slow migration of bubbles to the top of the tube after mixing. Lysis was terminated by mixing in 2 mL 20% lactose and 250 .mu.L 2M KCl. The tube was centrifuged immediately at 13,000 xg for 15 minutes at 4.degree. C. and the supernatant transferred to a new tube. A small aliquot of 0.1% (the PRE sample) was saved in a separate, labeled tube. The blocked rhodopsin receptor-coated plate was rinsed four times with HEKL/1% BSA and exposed to room light for less than five minutes on ice to activate the rhodopsin for light-activated rhodopsin (Table IX), or left in the dark for dark-adapted (inactive) rhodopsin (Table X). Immediately thereafter, the crude bacterial lysate from the peptide library (200 .mu.L) was added to each well and allowed to shake gently for one hour at 4.degree. C. For round 2, this same procedure was followed. In round 3, the amount of lysate used was reduced to 100 .mu.L. In subsequent rounds, the lysate was diluted 1:10 in HEKL/BSA. In all rounds, 5-10 .mu.L 200 .mu.M native peptide was added to the wells to chase off peptides that were bound with lower affinity.

[0122] After incubation with the bacterial lysate, the wells were washed four times into cold HEKL/1% BSA. Sonicated salmon sperm DNA (200 .mu.L 0.1 mg/mL in HEKL/1% BSA was added to each well and shaken gently for 30 minutes at 4.degree. C. The plates were washed four times with cold HEKL and twice with cold HEK, then eluted by adding 50 .mu.L/well 1 mM IPTG/0.2 M KCl in HE with vigorous shaking at room temperature for 30 minutes. The eluants from each group of wells (+ or - receptor) were combined in one or more microcentrifuge tubes as necessary. The volume of the PRE sample which had been saved previously was brought up to match the volume of the eluant samples and precipitated in parallel with them. To precipitate, 1/10 volume of 5M NaCl was mixed with each of the samples, then 1 .mu.L 20 mg/mL glycogen was mixed with the samples. An equal volume of RT isopropanol was then added and mixed thoroughly. The samples were subjected to centrifugation at 13,000 xg for 15 minutes and the supernatant aspirated. The pellet was washed with 500 .mu.L cold 80% ethanol and again subjected to centrifugation at 13,000 xg for 10 minutes. The pellets of plasmid DNA were resuspended in sterile, double-distilled water, 200 .mu.L for the PRE sample and 4 .mu.L for the + or - receptor samples and stored at -20.degree. C.

[0123] Both light-activated rhodopsin and dark-adapted rhodopsin were used to screen the library in this manner. See Tables IX and X, below. Six of the sequences obtained using light-activated rhodopsin were 100-1000 times more potent than the native sequence at binding rhodopsin and are listed in Table IX. When the G.alpha.t library was used to pan light-activated rhodopsin, residues L344, C347 and G348 were invariant. Also, in each of the highest affinity sequences, the basic residue at position 341 (R341) was changed to a neutral residue. When the G.alpha.t library was used to pan dark-adapted rhodopsin, the L344, C347 and G348 residues were no longer invariant (L344 present in 62.5% of sequences, C347 present in 25% of sequences, G348 present in 75% of sequences) and the residue at position 341 was usually unchanged. Thus, the conformation of the receptor in its inactive, dark-adapted state allows it to bind to a different set of peptide analogs that the light-activated receptor. In addition, it appears that in the light-activated receptor, it is the last seven amino acids of the peptide which are most important (344-350) while the first six amino acids (340-345) are more important for dark-adapted rhodopsin binding. TABLE-US-00009 TABLE IX Light-Activated Rhodopsin High Affinity Sequences. Clone No. SEQ ID NO: Sequence Library Sequence 139 I R E N L K D C G L F 8 147 L L E N L R D C G M F 9 148 I Q G V L K D C G L L 10 149 I C E N L K E C G L F 18 150 M L E N L K D C G L F 23 151 V L E D L K S C G L F 24 152 M L K N L K D C G M F 3 153 L L D N I K D C G L F 4 154 I L T K L T D C G L F 6 155 L R E S L K Q C G L F 11 156 I H A S L R D C G L F 13 157 I R G S L K D C G L F 14 158 I F L N L K D C G L F 15/28 159 I R E N L E D C G L F 16 160 I I D N L K D C G L F 17 161 M R E S L K D C G L F 19 162 I R E T L K D C G L L 26 163 I L A D V I D C G L F 27 164 M C E S L K E C G L F

[0124] TABLE-US-00010 TABLE X Dark-Adapted Rhodopsin High Affinity Sequences. Clone No. SEQ ID NO: Sequence Library Sequence 139 I R E N L K D C G L F 2 165 I R E K W K D L A L F 3 166 V R D N L K N C F L F 7 167 I G E Q I E D C G P F 17 168 I R N N L K R Y G M F 21 169 I R E N L K D L G L V 26 170 I R E N F K Y L G L W 33/37 171 S L E I L K D W G L F 41 172 I R G T L K G W G L F

EXAMPLE 8

Screens of PAR1 with a Gq Peptide Library

[0125] The methods of Example 7 were used to screen different sources of PAR1 receptor using the Gq library. Purified PAR1, reconstituted in lipid vesicles (Example 6), membranes prepared from Sf9 insect cells expressing PAR1 (Example 2) and membranes prepared from mammalian cells overexpressing PAR1 were used. The results of the screens are presented in Tables XI, XII and XIII, respectively. The peptide used as the competitor was LQLNLKEYNLV (SEQ ID NO:56). TABLE-US-00011 TABLE XI Reconstituted Purified Recombinant PAR1 Receptor; Screening Results SEQ ID NO: SEQ ID NO: Clone LQLNLKEYNLV 69 R2-16 *SWV 319 LQFNLNDCNLV 173 R2-17 FVNC 320 LQRNKKQYNLG 174 R2-18 EVRR 321 MKLKLKEDNLV 175 R2-20 *RVQ 322 HQLDLLEYNLG 176 R2-21 RLTR 323 LQLRYKCYNLV 177 R3-37 SR*K 324 LQQSLIEYNLL 178 R3-38 MTHS 325 VHVKLKEYNLV 179 R3-44 SGPQ 326 LQLNVKEYNLV 180 R3-46 ML*N 327 LRIYLKGYNLV 181

[0126] TABLE-US-00012 TABLE XII PAR1 Receptor Sf9 Insect Cell Membranes; Screening Results. SEQ ID NO: SEQ ID NO: Clone LQLNLKEYNLV 2 S1-13 S*IR 328 MKLNVSESNLV 182 S1-18 RWIV 329 LQLNLKVYNLV 183 S1-23 G*GH 330 LELNLKVYNLF 184 S2-26 RSEV 331 LQLKHKENNLM 185 S2-30 CEPG 332 LHLNMAEVSLV 186 S2-36 HQMA 333 LQVNLEEYHLV 187 S3-6 VPSP 334 LQKNLKEYNMV 188 S3-8 QMPN 335 LQMYLRGYNLV 189 S3-10 MWPS 336 LKRYLKESNLV 190 S3-15 C*VE 337 MNLTLKECNLV 191

[0127] TABLE-US-00013 TABLE XIII Mammalian (CHO) Cells Overexpressing PAR1; Screening Results. SEQ ID NO: SEQ ID NO: Clone LQLNLKEYNLV 2 C4-5 PRQL 338 LQLKRGEYILV 192 C4-19 VRPS 339 LQLNRNEYYLV 193 C5-10 SRHT 340 LRLNGKELNLV 194 C5-12 FFWV 341 CSLKLKAYNLV 195 C4-16 ORDT 342 LQMNHNEYNLV 196 C7-3 NFRN 343 PQLNLNAYNLV 197 C7-10 LPQM 344 QRLNVGEYNLV 198 C7-13 LSTN 345 LHLNLKEYNLV 199 C7-14 LSRS 346 LQQKLKEYSLV 200

EXAMPLE 9

Identification of GPCR-Binding High Affinity Peptide Analogs (Panning)

[0128] The methods of Example 7 were repeated using recombinant reconstituted .beta..sub.2 adrenergic receptor panned with the Gs Library. Results of the panning screens and ELISA binding affinity of the selected peptides are shown in Table XIV, below. TABLE-US-00014 TABLE XIV .beta.2-Adrenergic Receptor screened with Gs library. SEQ ID NO: Competitor QRMHLRQYELL 84 ELISA AG1 QGMQLRRFKLR 201 .435 AG20 RWLHWQYRGRG 202 .431 AG19 PRPRLLRFKIP 203 .361 AG2 QGEHLRQLQLQ 204 .330 AG4 QRLRLGPDELF 205 .291 BAR1 QRIHRRPFKFF 206 .218 AG3 QRMPLRLFEFL 207 .217 BAR2 QRVHLRQDELL 208 .197 AG11 DRMHLWRFGLL 209 .192 AG9 QRMPLRQYELL 210 .190 BAR3 QWMDLRQHELL 211 .185 AG18 QRMNLGPCGLL 212 .155 BAR20 NCMKFRSCGLF 213 .079 AG13 QRLHLRGYEFL 214 .054 BAR11 HRRHIGPFALL 215 .048 BAR8 ERLHRRLFQLH 216 .047 BAR40 PCIQLGQYESF 217 .028 BAR31 QRLRLRKYRLF 218 .026

EXAMPLE 10

Identification of GPCR-Binding High Affinity Peptide Analogs (Panning)

[0129] The methods of Example 7 repeated using rhodopsin screening with a Gt library. Results of the panning screens and ELISA binding affinity of the selected peptides are shown in Table XV, below. TABLE-US-00015 TABLE XV Rhodopsin screened with Gt library. SEQ ID NO: Competitor IRENLKDCGLF 14 ELISA L33 IVEILEDCGLF 219 1.007 L4 MLDNLKACGLF 220 .908 L3 ILENLKDCGLF 221 .839 L14 LRENLKDCGLL 222 .833 L38 LLDILKDCGLF 223 .823 L15 VRDILKDCGLF 224 .621 L34 ILESLNECGLF 225 .603 L17 ILQNLKDCGLF 226 .600 L7 MLDNLKDCGLF 227 .525 L10 IHDRLKDCGLF 228 .506 L20 IRGSLKDCGLF 229 .423 L6 ICENLKDCGLF 230 .342 L8 IVKNLEDCGLF 231 .257 L13 ISKNLRDCGLL 232 .187 L10 IRDNLKDCGLF 233 .162

EXAMPLE 11

Additional Peptide Analogs

[0130] Chinese hamster ovary-expressed PAR1 was screened against the Gt, G12 and G13 libraries, using the competitor peptide indicated in Table XVI below. Additional peptide analogs were identified using the G11 library and LQLNLKEYNLV (SEQ ID NO:243) as competitor and screened for high affinity binding to PAR1 receptor obtained from different sources, indicated in Table XVII, below. TABLE-US-00016 TABLE XVI Peptides Identified with CHO EXPRESSED PAR1. Gt library G12 library G13 library (IRENLKDCGLF; (LQENLKDIMLQ; (LQDNLKQLMLQ; SEQ ID NO: 14) SEQ ID NO: 64) SEQ ID NO: 65) IREFLTDCGLF 234 LQENLKEMMLQ 240 LQDNLRHLMLQ 248 IRLDLKDVSLF 235 LEENLKYRMLD 241 LQDKINHLMLQ 249 ICERLNDCGLC 236 LQEDLKGMTLQ 242 LQANRKLGMLQ 250 PRDNTKVRGLF 237 LQETMKDQSLQ 243 LIVKVKQLIWQ 251 FWGNLQDSGLF 238 PQVNLKSIMRQ 244 MRAKLNNLMLE 252 RRGNGKDCRHF 239 WQHKLSEVMLQ 245 LQDNLRHLIQ 253 LKEHLMERMLQ 246 LQDNRNQLLF 254 LLGMLEPLMEQ 247

[0131] TABLE-US-00017 TABLE XVII PAR1 Binding Peptides Screened using a G11 Library (LQLNLKEYNLV; SEQ ID NO: 2) CHO Recomb/ SF9 EXPRESSED SEQ ID NO: Reconst SEQ ID NO: EXPRESSED SEQ ID NO: LQLNVKEYNLV 255 LQLNVKEYNLV 275 LQLNLKVYNLV 289 LQLNRKNYNLV 256 LQLRVKEYKRG 276 LQLKHKENNLM 290 LQLRYKCYNLV 257 LQLRYKCYNLV 277 LQKNLKEYNMV 291 LQLDLKESNMV 258 LQIYLKGYNLV 278 LQVNLEEYHLV 292 LQLNLKKYNRV 259 LQFNLNDCNLV 279 LFLNLKEYSLV 293 LQLRVKEYKRG 260 LQRNKKQYNLG 280 LELNLKVYNLV 294 LQRNKKQYNLG 261 LQRNKNQYNLG 281 LPLNPKEYSLV 295 LQIYLKGYNLV 262 LQQSLIEYNLL 282 LPLNLIDFSLM 296 LQFNLNDCNLV 263 LRLDFSEKQLV 283 LPRNLKEYDLG 297 LQYNLKESFVV 264 LYLDLKEYCLF 284 LRLNDIEALLV 298 LQQSLIEYNLL 265 HQLDLLEYNLG 285 LVLNRIEYNLL 299 LQRDHVEYKLF 266 VQVKLKEYNLV 286 LHLNMAEVSLV 300 LVIKPKEFNLV 267 MKLKLKEDNLV 287 MNLTLKECNLV 301 IQLNLKNYNIV 268 SAKELDQYNLG 288 MKLNVSESNLV 302 HQLDLLEYNLG 269 LKRYLKESNLV 303 MQLNLKEYNLV 270 LKRKLKESNMG 304 VQVKLKEYNLV 271 LKRKVKEYNLG 305 QLLNQYVYNLV 272 MKLKLKEDNLV 273 WRLSLKVYNLV 274

EXAMPLE 12

Preparation of LacI Lysates

[0132] In the last round of panning, several clones were selected from the (+) receptor plates and grown up overnight in LB-Amp media. Three hundred microliters of the overnight culture was diluted in 3 mL in LB-Amp media for "ELISA lysate culture." Another 30 .mu.L was added to an equal volume of 50% glycerol was stored in labeled microcentrifuge tubes at -70.degree. C. The remaining 4.5 mL was used to make DNA using a standard miniprep protocol (Qiagen Spinprep.TM. kits) and sequenced using a 19 base pair reverse primer which is homologous to the vector at a site 56 basepairs downstream from the TAA stop codon that terminates the random region of the library (GAAAATCTTCTCTCATCCG; SEQ ID NO:306). The DNA was stored at -20.degree. C. The ELISA lysate culture was allowed to shake for one hour at 37.degree. C. Expression was induced by adding 33 .mu.L 20% arabinose (0.2% final concentration) with shaking at 37.degree. C. for 2-3 hours. The culture then was subjected to sedimentation at 4000 xg for five minutes, the pellet resuspended in 3 mL cold WTEK buffer, resedimented at 4000 xg for five minutes and the pellet resuspended in 1 mL cold TEK buffer. After transfer to 1.5 mL microcentrifuge tubes, the pellet was sedimented at 13,000 xg for two minutes and the supernatant aspirated. The cell pellet was resuspended in 1 mL lysis buffer (42 mL HE, 5 mL 50% glycerol, 3 mL 10 mg/mL BSA in HE, 750 .mu.L 10 mg/mL lysozyme in HE and 62.5 .mu.L 0.2 M PMSF) and incubated on ice for one hour. One hundred ten microliters 2M KCl was added to the lysis mixture and inverted to mix, then sedimented at 13,000 xg for 15 minutes at 4.degree. C. The clear crude lysate (about 0.9 mL supernatant) was transferred to a new tube and stored at -70.degree. C.

EXAMPLE 13

PAR1 Receptor-Specific Binding of LacI-Peptide Fusion Proteins

[0133] The binding properties of the peptide encoded by individual clones were assayed as follows. Purified PAR1 receptor prepared from Sf9 insect cells (1-10,000 pg/mL in 50 mM Tris HCl, pH 7.4, 10% glycerol) was reconstituted in lipid vesicles according to Example 6. A serial dilution of the membranes containing receptor ranging from 0.2 to 20,000 .mu.g/mL (+/-receptor) was added to wells on a microtiter plate and shaken gently for one hour at 4.degree. C. After washing, a 1:1 to 1:10,000 serial dilution of a LacI-Gq lysate prepared from the LacI-Gq clone according to the methods described in Example 12 was added to the wells, the plate was shaken gently for one hour at 4.degree. C., and washed. Anti-LacI antibodies (Stratagene) were added (1:1000) and the plate shaken gently for one hour at 4.degree. C. After washing, HRP-conjugated goat anti-rabbit antibodies (Kierkegaard and Perry Laboratories) were added (1:2500) and the plate shaken gently for one hour at 4.degree. C. The plate washed, color was developed using horseradish peroxidase, and then read in an ELISA reader at OD.sub.450. The general methodology for the ELISA is illustrated in FIG. 3. The results, see FIG. 4, show that the LacI-Gq fusion protein binds thrombin receptor in a concentration dependent manner. The ability of the LacI-Gq fusion protein to bind the empty vesicles was significantly less than vesicles reconstituted with thrombin receptor.

EXAMPLE 14

Screening in the Presence of a High Affinity Peptide

[0134] To identify peptides having even higher affinity to light-activated rhodopsin than those identified by the panning procedure described in Example 7, a high affinity peptide was included in the library incubations in rounds three and four. Peptide 8 (LLENLRDCGMF; SEQ ID NO:147) had been identified in the first screening as a peptide exhibiting binding to light-activated rhodopsin 1000-fold higher than the native sequence. Screening of the G.alpha.t library was performed as in Example 7, except that 10 .mu.L 100 .mu.M (100 nM final concentration) peptide 8 was included in the wells in rounds three and four. This screen revealed several clones that both bind rhodopsin with very high affinity and stabilize it in its active form, metarhodopsin II. See Table XVIII, below. Comparing Tables IX and XVIII, it is clear that the use of peptide 8 in the screen resulted in a change at position 341 to a neutral residue. Residues L344, C347 and G348 remained stable whether peptide 8 was included in the screen or not. Use of peptide 8 resulted in a higher incidence of isoleucine at position 340 (17% with native peptide versus 71% with peptide 8) and a lower incidence of glutamine at position 342 (67% with native peptide versus 29% with peptide 8) This type of information not only contributes to the discovery of highly potent analog peptides for use as drugs or drug screening compounds, but also furthers the understanding of the structural framework which underlies the sites of contact between G.alpha. and receptor.

[0135] Binding assays performed on some of the clones identified in this way are shown in FIG. 5. All peptides identified using peptide 8 in the screening process bound with equal or greater affinity to light-activated rhodopsin as did peptide 8. Compare the first bar (HAP=peptide 8) with the remaining bars. TABLE-US-00018 TABLE XVIII Exemplary Light-Activated Rhodopsin High Affinity Sequences Identified in Screens with Addition of Peptide 8. Clone No. SEQ ID NO: Sequence Library Sequence 14 I R E N L K D C G L F Peptide 8 147 L L E N L R D C G M F 3 307 I L E N L K D C G L L 7 308 M L D N L K D C G L F 8 309 I V K N L E D C G L F 10 310 I R D N L K D C G L F 13 311 I S K N L R D C G L L 17 312 I L Q N L K D C G L F 19 313 M L D N L K A C G L F

EXAMPLE 15

Subcloning into MBP Vectors and Preparation of MBP Crude Lysates

[0136] pELM3 was digested at room temperature with AgeI (New England Biolabs) and the cut vector was separated from uncut vector on a 0.7% agarose gel. DNA was purified (Qiagen Extract-a-gel kit) and digested with ScaI (New England Biolabs). The 5.6 kb MBP vector fragment was separated on a 1% agarose gel and purified as above. During the final affinity purification round of the peptide Library, a 20 mL portion of the 200 mL amplification culture was set aside before harvesting the cells. This 20 mL portion was allowed to grow to saturation, usually overnight and DNA was prepared from the cells (Qiagen midi-prep kit). The pJS142 plasmid DNA was digested with BspEI and ScaI. The 0.9 kb peptide-encoding fragment was separated from the 3.1 and 1.7 kb vector fragments on a 1% agarose gel and purified.

[0137] Different ratios of the 5.6 kb MBP vector fragment and the peptide-encoding 0.9 kb fragment (1:2, 1:1, 2.5:1, 5:1, 10:1) were ligated in ligase buffer containing 0.4 mM ATP at 14.degree. C. overnight with T4 DNA ligase. The ligation was terminated by increasing the temperature to 65.degree. C. for ten minutes. To lower the background, the ligation mixture was digested with XbaI before isopropanol precipitation using 1 .mu.L glycogen as a carrier. After one wash with 80% ethanol, the pellet was resuspended in 20 .mu.L double-distilled water. AR1814 cells were transformed as described in Example 7 using 1 .mu.L of the precipitated XbaI digested ligation mix. After allowing the cells to shake for one hour at 37.degree. C. in 1 mL SOC, 100 .mu.L of the suspension was spread on LB-Amp Plates. Crude lysates were prepared as described for LacI lysates in Example 9.

EXAMPLE 16

MBP--Peptide Fusion Protein Purification

[0138] An overnight culture (1 mL) of a single MBP-peptide fusion protein clone was inoculated into 200 mL LB-AMP media. The culture was shaken at 37.degree. C. until OD.sub.600=0.5. Protein expression was induced by addition of 150 .mu.L 1 M IPTG (final concentration 0.3 mM), with continued shaking at 37.degree. C. for two hours. The culture then was sedimented at 5000 xg for 20 minutes and resuspended in 5 mM column buffer (10 mM Tris, pH 7.4; 200 mM NaCl; 1 mM EDTA; 1 mM DTT) and 16.25 .mu.L 0.2 M PMSF was added. The resuspended cell pellet was then stored at -70.degree. C. The stored pellet was thawed in cold water and placed in an ice bath. The pellet was sonicated in short pulses of less than 15 seconds with a Fisher Scientific 55 Sonic Dismembrator (40% constant time, output 5, repeating five times with a total one minute duration). The sonicated pellet was subjected to centrifugation at 9000 xg for 30 minutes, after which the supernatant was saved and diluted to 100 mL using column buffer. Usually, the protein concentration was approximately 2.5 mg/mL. A column was prepared by pouring 7.5 ml amylose resin in a BioRad disposable column and washing with eight volumes of column buffer. The diluted crude extract was loaded by gravity flow at about 1 mL/min and the column washed again with eight volumes of column buffer. The fusion protein was eluted with 10 mL 10 mM maltose in column buffer and concentrated using Amicon centriplus 30.TM. columns, then aliquoted and stored at -70.degree. C.

EXAMPLE 17

Method for Screening Library Crude Lysates by ELISA

[0139] Microtiter wells were coated with 0.1-1.0 .mu.g/well rhodopsin receptor in a final volume of 100 .mu.L HEK containing 1 mM DTT with shaking at 4.degree. C. for one hour. The wells then were blocked with bovine serum albumin (BSA) by adding 100 .mu.L 2% BSA in HEK with 1 mM DTT to the wells and continuing shaking at 4.degree. C. for at least 30 minutes, then washed four times with HEK containing 1 mM DTT. Crude lysates were diluted 1:50 in HEK containing 1 mM DTT and added to the coated wells (100 .mu.L per well). The plates were shaken at 4.degree. C. for one hour, washed four times with PBS/0.05% Tween.TM.20 1 mM maltose and then probed with 100 .mu.L 1:1000 rabbit anti-MBP antibodies (New England BioLabs) in PBS containing 0.05% Tween.TM. 20 and 1 mM maltose, with shaking for 30 minutes at 4.degree. C. After another wash, the wells were probed with 100 .mu.L 1:7500 goat anti-rabbit secondary antibodies conjugated to horseradish peroxidase in PBS containing 1% BSA and 1 mM maltose with shaking for 30 minutes at 4.degree. C. The plate washed four times with PBS containing 0.05% Tween.TM. 20 and 1 mM maltose. Horseradish peroxidase substrate (Bio-Fx; 100 .mu.L) was added and the color developed for 20-30 minutes. The reaction was stopped by addition of 100 .mu.L 2N sulfuric acid and the plate read at OD.sub.450. If the color reaction occurred too quickly (less than 10 minutes) or if the background in negative control wells was too high (greater than 0.2) the assay was repeated using 1:100 or 1:200 dilutions of the crude lysates.

EXAMPLE 18

Binding Assay of High Affinity Rhodopsin Binding Peptides

[0140] The entire population of peptide-coding sequences identified in round 4 of panning (see Example 7) was transferred from pJS142 to pELM3 (New England Biolabs). This plasmid is a pMal-c2 derivative with a modified polylinker, inducible by isopropyl .beta.-thiogalacto-pyranoside and containing the E. coli malE gene with a deleted leader sequence and leads to cytoplasmic expression of MBP fusion proteins. The MBP-carboxyl terminal peptide analog fusion proteins were expressed in E. coli.

[0141] For the assay, in the dark, 1 .mu.g/well of ROS membranes (rhodopsin) as described in Example 5 was directly immobilized on microtiter wells in cold HEK/DTT for one hour at 4.degree. C. The wells were rinsed, blocked with 1% BSA in HEK/DTT for one hour at 4.degree. C. and rinsed again. Bound rhodopsin was activated by exposure to light for 5 minutes on ice before addition of the MBP fusion proteins (crude bacterial lysates were diluted 1:50 in HEK with 1 .mu.M dithiothreitol; purified proteins were used at 0.2-120 nM). The MBP-G.alpha.t340-350K341R (pELM17) fusion protein and MBP with linker sequence only (pELM6) were present in control wells at 50 nM final concentration. After 30 minutes, wells were washed and rabbit anti-MBP antibody (New England Biolabs) was added. The anti-MBP antibody was used at a 1:1000 dilution for crude lysates and a 1:3000 dilution for purified proteins. After 30 minutes, wells were rewashed and goat anti-rabbit antibody conjugated to horseradish peroxidase (1:7500 dilution for crude lysates; 1:10,000 dilution for purified proteins; Kierkagaard & Perry Laboratories) was added. After 30 minutes, the plate washed four times with PBS containing 0.05% Tween.TM.20. Horseradish peroxidase substrate (100 .mu.L) was added and color was allowed to develop for about 20 minutes. The reaction was stopped by addition of 100 .mu.L 2N sulfuric acid. The results are presented in FIG. 6. Values indicate absorbance at OD.sub.450. The controls for the assay was pELM 17, which encodes the MBP fusion protein G.alpha..sub.t340-350K341R. pELM6, which expresses MBP protein fused to a linker sequence only, served as the negative control. "No lysate" control wells were included to reflect any intrinsic, non-specific binding within the assay. See FIG. 6.

[0142] The IC.sub.50 values of the high affinity MBP fusion proteins ranged from 3.8 to 42 nM, up to 3 orders of magnitude more potent than the 6 .mu.M IC.sub.50 of MBP-G.alpha.t340-350K341R. In all the highest affinity sequences, position 341, which is a positively charged residue in the native sequence, was changed to a neutral residue. Leu344, Cys347, and Gly348 were found to be invariant and hydrophobic residues were always located at positions 340, 349, and 350, indicating the critical nature of these residues.

EXAMPLE 19

Binding of High Affinity Peptides to Rhodopsin can be Competitively Inhibited by Heterotrimeric Gt

[0143] Binding of MBP fusion proteins containing the high affinity peptide from the library (sequences from clones 8, 9, 10, 18, 23, 24, as well as pELM17 which encodes the wild-type peptide sequence, and pELM6 which contains on peptide) were assessed for their ability to bind rhodopsin (0.5 .mu.g rhodopsin/well) in the presence or absence of heterotrimeric Gt. Lysate (50 .mu.L) from each clone was added and incubated in the light. After 45 minutes, 1 .mu.M heterotrimeric Gt was added and the solution incubated for 30 minutes. Anti-MBP antibody was added, followed by goat anti-rabbit alkaline phosphatase conjugated antibody and substrate. The color was allowed to develop. Absorbence data are presented in FIG. 7.

EXAMPLE 20

Binding of MBP Clones to PAR1

[0144] To identify high affinity peptides that bind PAR1, membranes prepared from mammalian cells (Chinese hamster ovary) overexpressing PAR1 were panned with the G11 peptide library. ELISA binding affinity results of selected clones are shown in FIG. 8 for their binding to membranes prepared from SF9 cells expressing either PAR1 or the Gq-coupled muscarinic M1 receptor. To quantitate the binding, purified MBP clones were analyzed using ELISA methods in which the secondary antibody was conjugated to HRP. The binding for the control MBP-Gq fusion protein is shown. See FIG. 8. The data are the average of two separate experiments done in duplicate. MBP clones PAR-13 and PAR-34 both show both high affinity binding for PAR1 as well as specificity. MBP clones PAR-23 and PAR-33 appear to be both of low affinity and low specificity. See Table XIII for the sequences.

EXAMPLE 21

Binding Specificity of LacI-Peptide Fusion Proteins

[0145] PAR1 binding clones of LacI-peptide fusion protein selected from the G11 Library were diluted 1:100 in HEK/DTT and tested for dose-responsive binding to Sf9 insect cell membranes from cells expressing no receptor, the M1 receptor (which couples to Gi) or PAR1 receptor, prepared according to Example 2. Increasing amounts of membrane as indicated in FIG. 9 were coated in microtiter wells, incubated and rinsed. LacI-peptide fusion protein lysates were added, incubated and rinsed, and the receptor-bound LacI-peptide fusion protein was measured as described above using a LacI antibody. Results for a single, representative clone are presented in FIG. 9, and demonstrate the specificity of the selected peptides for PAR1.

EXAMPLE 22

Binding of Native G.alpha.q-Maltose Binding G Protein-Peptide Fusion Protein to PAR1

[0146] Microtiter wells were coated with purified, reconstituted PAR1 in the presence of 100 nmoles thrombin receptor activating peptide, as described above in Example 6. Purified maltose binding G protein-G.alpha.q (MBP-G.alpha.q) was added at the concentrations indicated in FIG. 10 and incubated one hour on a shaker at 4.degree. C. The wells were rinsed and then probed with a rabbit anti-maltose bindinG protein antibody, followed by alkaline phosphatase conjugated secondary antibodies, as described above. Substrate was added and the color was allowed to develop about 20 minutes. Absorbence at 405 nm was measured and dose-response curves were calculated using GraphPad Prism (version 2.0). See results in FIG. 10. The calculated IC.sub.50 of G.alpha.q binding to activated PAR1 was 214 nM.

EXAMPLE 23

Design of Oligonucleotides for G.alpha. Peptide Minigene Constructs

[0147] cDNA encoding the last 11 amino acids of G.alpha. subunits was synthesized (Great American Gene Company) with newly engineered 5'- and 3'-ends. The 5'-end contained a BamHI restriction enzyme site followed by the human ribosome-binding consensus sequence (5'-GCCGCCACC-3'; SEQ ID NO:314), a methionine codon (ATG) for translation initiation, and a glycine codon (GGA) to protect the ribosome binding site during translation and the nascent peptide against proteolytic degradation. A HindIII restriction enzyme site was synthesized at the 3' end immediately following the translational stop codon (TGA). Thus, the full-length 56 bp oligonucleotide for the Gi.alpha..sub.1/2 carboxyl terminal sequence was 5'-gatccgccgccaccatgggaatcaagaacaacctgaaggactgcggcctcttctgaa-3' (SEQ ID NO:315) and the complimentary strand was 5'-agctttcagaagaggccgcagtccttcaggttgttcttgattcccatggtgg cggcg-3' (SEQ ID NO:316). See FIG. 11. As a control, oligonucleotides encoding the G.alpha.i.sub.1/2 carboxyl terminus in random order (G.alpha.iR) with newly engineered 5'- and 3'-ends also were synthesized. The DNA was diluted in sterile ddH.sub.2O to form a stock concentration at 100 .mu.M. Complimentary DNA was annealed in 1.times. NEBuffer 3 (50 mM Tris-HCl, 10 mM MgCl.sub.2, 100 mM NaCl, 1 mM DTT; New England Biolabs) at 85.degree. C. for 10 min then allowed to cool slowly to room temperature. The DNA then was subjected to 4% agarose gel electrophoresis and the annealed band was excised. DNA was purified from the band using a kit, according to the manufacture's protocol (GeneClean II Kit, Bio101). After digestion with each restriction enzyme, the pcDNA 3.1(-) plasmid vector was subjected to 0.8% agarose gel electrophoresis, the appropriate band cut out, and the DNA purified as above (GeneClean II Kit, Bio101). The annealed/cleaned cDNA was ligated for 1 hour at room temperature into the cut/cleaned pcDNA 3.1 plasmid vector (Invitrogen) previously cut with BamHI and HindIII. For the ligation reaction, several different ratios of insert to vector cDNA (ranging from 25 .mu.M:25 .mu.M to 250 .mu.M:25 .mu.M annealed cDNA) were plated. Following the ligation reaction, the samples were heated to 65.degree. C. for 5 min to deactivate the T4 DNA ligase. The ligation mixture (1 .mu.L) was electroporated into 50 .mu.L competent cells as described in Example 7 and the cells immediately placed into 1 mL of SOC (Gibco). After 1 hour shaking at 37.degree. C., 100 .mu.L of the electroporated cells containing the minigene plasmid DNA was spread on LB/Amp plates and incubated at 37.degree. C. for 12-16 hours. To verify that insert was present, colonies were grown overnight in LB/Amp and their plasmid DNA purified (Qiagen SpinKit). The plasmid DNA was digested with Ncol (New England Biolabs, Inc.) for 1 hour at 37.degree. C. and subjected to 1.5% (3:1) agarose gel electrophoresis. Vector alone produced 3 bands. When the 56 bp annealed oligonucleotide insert is present, there is a new NcoI site resulting in a shift in the band pattern such that the digest pattern goes from three bands (3345 bp, 1352 bp, 735 bp) to four bands (3345 bp, 1011 bp, 735 bp, 380 bp). See FIG. 12. DNA with the correct electrophoresis pattern was sequenced to confirm the appropriate sequence. This method may be used to insert any high affinity peptide to create a minigene constant.

EXAMPLE 24

Expression of Peptides from Minigene Constructs

[0148] Expression of the GPCR binding peptides was achieved using constructs which included minigene inserts corresponding to the carboxyl terminal sequences of various G protein .alpha. subunits (G.alpha.i, G.alpha.o, G.alpha.s, G.alpha.q, G.alpha.11, G.alpha.12, G.alpha.13, G.alpha.14), as well as a control minigene containing the G.alpha.i sequence in random order (G.alpha.iR). The minigene insert DNAs were made by synthesizing short complimentary oligonucleotides corresponding to the peptide sequences from the carboxyl terminus of each G.alpha. with BamHI and HindIII restriction sites at the 5' and 3' ends, respectively. Complementary oligonucleotides were annealed and ligated into the mammalian expression vector pcDNBA3.1 according to the methods of Gilchrist et al., J. Biol. Chem. 274:6610-6, 1999, the disclosures of which are hereby incorporated by reference.

[0149] Human embryonic kidney (HEK) 293 cells were transfected using a standard calcium phosphate procedure according to the methods of Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harpor Laboratory Press, New York, vol. 1-3 (1989), the disclosures of which are hereby incorporated by reference. To confirm the transcription of minigene constructs in transfected cells, total RNA was isolated from the cells 48 hours post transfection with pcDNA-G.alpha.i or pcDNA-G.alpha.iR using methods known in the art. Reverse transcriptase PCR was used to make cDNA and PCR analysis was performed using the cDNA as template with primers specific for the relevant G.alpha. carboxyl terminal peptide insert (forward: 5'-ATCCGCCGCCACCATGGGA (SEQ ID NO:317); reverse: 5'-GCGAAAGGAGCGGGGCGCTA (SEQ ID NO:318). These primers for the G.alpha. minigenes amplify a 434 bp fragment only if the inserted peptide-encoding oligonucleotides are present; no band is observed in cells transfected with the empty pcDNA3.1 vector. The PCR products were separated on 1.5% agarose gels. The presence of a single 434 bp band indicated that G.alpha. carboxyl terminus peptide minigene RNA had been transcribed. See FIG. 13. Control experiments were done using a T7 forward primer with the vector reverse primer to verify the presence of the pcDNA3.1 vector, and G3DPH primers (Clonetech) to approximate the amount of total RNA.

[0150] To verify that the peptide was being produced in the transfected cells, the cells were lysed and homogenized 48 hours post transfection according to known methods. Cytosolic extracts were analyzed by gradient reversed phase HPLC as follows: 100 .mu.L of cytosolic fraction extract was loaded onto a C4 column (Vydac) equilibrated with 0.1% TFA in ddH.sub.2O. The peptide was eluted using 0.1% TFA in an acetonitrile gradient which increased from 0-60% over 45 minutes. Peaks were collected, lyophilized, and analyzed using ion mass spray analysis (University of Illinois-Urbana Champagne). Mass spectrometry analysis for peak 1 from G.alpha.i.sub.1/2 peptide vector (pcDNA-G.alpha.i) transfected cells, and from cells transfected with pcDNA-G.alpha.iR indicated that a 1450 Dalton peptide (the expected molecular weight for both 13 amino acid peptide sequences) was present in each cytosolic extract. The minigene-encoded peptides were the major peptides found in the cytosol, strongly indicating that the vectors produced the appropriate peptide sequences in large amounts.

EXAMPLE 25

Interfacial G Protein Peptide Inhibition of Thrombin-Mediated Inositol Phosphate Accumulation

[0151] HMEC were seeded onto 6-well plates 24 hours before transfection at 1.times.10.sup.5 well. Cells were transiently transfected with pcDNA3.1, pcDNA-G.alpha.i, pcDNA-G.alpha.iR, or pcDNA-Gq as described in Example 21. After 24 hours, cells were incubated in 2 mL culture medium containing 4 .mu.Ci/mL [.sup.3H]-myoinositol to obtain steady-state labeling of cellular inositol lipids. Transiently transfected cells were assayed for inositol phosphate (IP) accumulation 48 hours after transfection. Two hours prior to stimulation with .alpha.-thrombin, cells were washed, and medium replaced with medium containing 5 mM LiCl. Cells were stimulated with 10 nM .alpha.-thrombin for 10 minutes. Inositol phosphate (IP) formation was stopped by aspiration of the medium and addition of ice-cold methanol (final concentration 5%).

[0152] Perchloric acid-lysed cells were centrifuged at 2500 rpm, 4.degree. C. for 5 min. The supernatant containing IP was eluted through a Poly-Prep chromatography column (Bio-Rad) containing 1.6 ml anion exchange resin (DOWEX AG1-X8, formate form, 200-400 mesh). The perchloric acid-precipitated pellets (containing phosphatidylinositols and lipids) were resuspended in 1 ml chloroform-methanol-10 M HCl (200:100:1, v/v/v). These suspensions were mixed with 350 .mu.L HCl and 350 .mu.L chloroform and sedimented for 5 min at 2500 rpm to separate the phases. The lower, hydrophobic phase was recovered and dried in counting vials to determine the amount of radioactivity in total phosphatidylinositols. The relative amount of [3H]-IP generated was calculated as follows: ([.sup.3H]-IP (cpm)/[.sup.3H]-IP (cpm)+[.sup.3H]-inositol (cpm)). Each value was normalized using the basal value (no thrombin stimulation) obtained in pcDNA transfected cells. See FIG. 14. The results presented are the normalized mean.+-.SEM of at least 3 independent experiments performed in triplicate. The ** symbol indicated p<0.005. Results indicate that addition of thrombin increased IP production in control cells (pcDNA, pcDNA-GiR). Cells transfected with PcDNA-Gq had no thrombin-mediated IP production increase, while cells transfected with pcDNA-Gi had a normal response. These results indicate that the Gq C-terminal peptide can inhibit thrombin-mediated IP increases in HMEC.

EXAMPLE 26

Interfacial G Protein Peptide Inhibition of Thrombin-Induced P1 Hydrolysis and Intracellular Ca.sup.++ Rise

[0153] To determine whether expression of the G.alpha.q C-terminal minigene could affect intracellular [Ca.sup.++].sub.i levels, HMEC were transfected with empty vector (pcDNA), pcDNA-G.alpha.i, pcDNA-G.alpha.q, or pcDNA-G.alpha.iR minigene DNA (1 .mu.g). Transfected cells were seeded at a low confluency on coverslips in a 24-well plate 48 hours post transfection. The cells were allowed to adhere for two hours. The medium was aspirated and each coverslip was incubated with 10 .mu.M Oregon Green 488 BAPTA-1 acetoxymethyl ester (a calcium-sensitive dye) and 0.1% (v/v) Pluronic F-127 and allowed to incubate for 20-30 minutes at 37.degree. C., then rinsed twice with wash buffer. Basal conditions were established before addition of thrombin (.about.70 mM) in Ca.sup.++ buffer. Recordings were made every 10 seconds and continued for 170 seconds after stimulation with thrombin. Images were quantitated using NIH Image. Data from at least 70 individually recorded cells were used to calculate the changes in fluorescence (y-axis). See FIG. 15A, which presents fluorescence in ([Ca.sup.++]; level) increase 30 seconds after thrombin addition. Each bar in FIG. 15A represents the mean ((F.sub.s-F.sub.B/F.sub.B-1).+-.SEM of over 70 individually recorded cells. The ** symbol indicates p<0.005. FIG. 15B shows the kinetics of [Ca.sup.++]; fluorescence changes after cell stimulation with thrombin. Data presented are the mean ((F.sub.s-F.sub.B/F.sub.B-1).+-.SEM at each recording point for cells transfected with pcDNA or pcDNA-G.alpha.q. The arrow indicate the time thrombin was added. Each time point represents over 100 individually recorded cells.

[0154] As shown in FIG. 15, following cell activation by addition of thrombin there was a transient increase in intracellular [Ca.sup.2+] levels. Thirty seconds after the addition of thrombin, cells transfected with pcDNA-G.alpha.q had a calcium response that was 44% decreased as compared to cells transfected with pcDNA (FIG. 15A). pcDNA-G.alpha.q transfected cells had a 45% decrease compared to those transfected with pcDNA when all time points measured after thrombin stimulation are averaged (FIG. 15B). This decrease appears to be specific as cells transfected with pcDNA-G.alpha.i or pcDNA-G.alpha.ir did not have any effect on thrombin stimulated intracellular [Ca.sup.2+] levels. Thus, cells expressing the G.alpha.q C-terminal peptide appear to be inhibited in their ability to stimulate intracellular [Ca.sup.2+] levels following activation with thrombin, indicating a specific block of this downstream mediator by expression of G.alpha.q.

[0155] pcDNA, pcDNA-GiR, pcDNA-Gi, pcDNA-Gq, or pcDNA-Gs minigene constructs were transfected into HMEC and used to assay inositol phosphate (IP) accumulation 48 hours later. After 24 hours, cells were reseeded onto 24-well plates and labeled with [.sup.3H]-myoinositol (2 .mu.Ci/ml). After 48 hours, cells were rinsed, and incubated with or without thrombin (10 nM) for 10 minutes. Total IP accumulation was assayed as described above using DOWEX.TM. columns to separate [.sup.3H] IP. The relative amount of [.sup.3H] IP generated was calculated as follows: ([.sup.3H] IP (cpm)/[.sup.3H] IP (cpm)+[.sup.3H] inositol (cpm)). Each value was normalized by the basal value (no thrombin stimulation) obtained in pcDNA transfected cells. See FIG. 16. The results presented are the normalized mean.+-.SEM of at least three independent experiments performed in triplicate. The ** symbol indicated p<0.005.

EXAMPLE 27

Prevention of Thrombin-Induced MAPK Activity by High Affinity GPCR-Binding Peptides

[0156] Hemagglutanin (HA)-MAPK (1.times.10.sup.5/mL was co-transfected into HMEC with the pcDNA, pcDNA-G.alpha.i, pcDNA-G.alpha.q or pcDNA-G.alpha.iR minigene constructs using the methods described in Example 21. After 30 hours, cells were serum-starved for 18 hours and then treated with 10 nM thrombin for 20 minutes. Cells were then lysed with RIPA buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.5% deoxycholate, 0.1% SDS, 10% glycerol, 10 .mu.g/mL aprotinin and 10 .mu.g/mL leupeptin) and HA-MAPK protein immunoprecipitated using 12CA5 antibody (Roche Molecular Biochemicals; Indianapolis, Ind.)(one hour, 4.degree. C.) and Protein A sepharose beads (three hours, 4.degree. C.). Immune complexes were washed three times in RIPA buffer. Kinase activity in the immunoprecipitates was measured using maltose bindinG protein (MBP) substrate and a kinase assay kit (Upstate Biotechnology, Inc., Lake Placid, N.Y.). MAPK activity (nM/min/mg) was obtained for each, and the relative increase of MAPK activity (thrombin-mediated fold increase) was calculated as follows: (stimulated activity (nM/min/mg)-basal activity (nM/min/mg))/basal activity (nM/min/mg). Results are presented as the mean.+-.SEM of at least three independent experiments in FIG. 17. A * symbol indicates p<0.05.

[0157] Addition of 10 nM thrombin resulted in a 3.66 fold increase in HA-MAPK activity in cells transfected with the pcDNA control vector. Similarly, cells transfected with pcDNA-GiR had an essentially equivalent increase in thrombin mediated MAPK activity with (4.46 fold increase). However, endothelial cells transfected with a minigene construct encoding the G.alpha.i, G.alpha.q, G.alpha.12 or G.alpha.13 GPCR binding peptides showed a significant decrease in thrombin-mediated HA-MAPK activity (59%, 57%, 50% and 77%, respectively) compared to cells transfected with pcDNA.

EXAMPLE 28

Reduction of Thrombin-Induced Transendothelial Electrical Resistance

[0158] Transendothelial electrical resistance (TEER) was measured by passing an alternating current (50 .mu.A; 2 pulses every minute) across monolayers of HMEC expressing G.alpha.q, G.alpha.i, G.alpha.iR or no minigene construct. Basal TEER did not change significantly with minigene transfection. Upon addition of 10 nM thrombin, however, there was a decrease in the TEER of cells expressing the G.alpha.q minigene compared to non-transfected cells in the presence of 10 nM thrombin. See FIG. 18 (representative of multiple experiments). The decrease in transendothelial electrical resistance in response to thrombin was significantly reduced in endothelial cells transfected with the minigene for the carboxyl terminus of G.alpha.q, while there was no effect in cells transfected with G.alpha.i, G.alpha.iR, or empty vector. These results suggested that G.alpha.q is partially responsible for the effects of thrombin on endothelial cell shape changes.

EXAMPLE 29

Inhibition of Thrombin-Mediated Stress Fiber Formation

[0159] HMEC cells were transfected with pcDNA, pcDNA-G.alpha.12 or pcDNA-G.alpha.13 minigene constructs 1 .mu.g each/100 mm dish. As a marker for transfected cells, the pGreenLantern-1 plasmid, containing the gene for green fluorescent protein (GFP) was co-transfected together with minigene constructs. After 48 hours, cells were serum starved for 18 hours and treated with 10 nM thrombin for 20 minutes. After exposure to thrombin, the cells were fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton X-100 and stained for F-actin with 1 mM rhodamine-phalloidin for 30 minutes. Cells were extensively washed, mounted using Vectashield.TM. antifade mounting medium (Vector Laboratories, Inc.). Cells were observed with an inverted microscope (Diaphot 200, Nikon, Inc.) equipped for both differential interference contrast microscopy and epifluorescence observation using a 60.times. oil-immersion objective. Fluorescence and DIC images were recorded for each cell field with a cooled, integrating CCD array camera (Imagepoint, Photometrix, Ltd.) connected to the microscope. See FIG. 19 for fluorescence images showing inhibition of thrombin-mediated stress fiber formation by G.alpha.12 and G.alpha.13 peptides.

[0160] Serum starved cells transfected with pcDNA exhibited a thin cortical F-actin rim at their margins, and contained few stress fibers (FIG. 19, panel A). Those present were inconspicious and in apparently random orientation. For HMEC transfected with pcDNA after a 20-minute exposure to thrombin actin had reorganized into prominent stress fibers, typically arranged in a parallel pattern along the longitudinal axis of the cell (FIG. 19, panel B). A very different pattern was observed for cells transfected with pcDNA-G.alpha.12 (FIG. 19, panel C) or pcDNA-G.alpha.13 (FIG. 19, panel D) minigenes after exposure to thrombin. In both pcDNA-G.alpha.12 and pcDNA-G.alpha.13 transfected cells, thrombin stimulation did not result in the appearance of stress fibers. In cells transfected with pcDNA-G.alpha.13, the peripheral actin rim appears thicker and more linear, providing a clear outline of cell-cell junctions. Thus, in agreement with earlier reports, thrombin induced rapid stress fiber formation in endothelial cells. Transfection of either pcDNA-G.alpha.12 or pcDNA-G.alpha.13 minigenes resulted in cells that no longer showed thrombin-induced stress fiber formation. Given that stress fiber formation is dependent on the small GTPase Rho, these results concur with other findings that G.alpha.12 and G.alpha.13 are intimately linked to Rho signaling and demonstrates the ability of GPCR binding peptides to specifically block this G protein pathway when expressed intracellularly.

EXAMPLE 30

Inhibition of G Protein Activity by GPCR Binding Peptides in Single Intact Cells

[0161] Human embryonic kidney (HEK) 293 cells, which stably express the M.sub.2 mACR (.about.400 fmol receptor/mG protein), were grown in DMEM (Gibco) supplemented with 10% fetal bovine serum (Gibco), streptomycin/penicillin (100 U each; Gibco) and G418 (500 mg/L; Gibco). Cells were grown under 10% CO.sub.2 at 37.degree. C. In all transfections for electrophysiological studies, the CD8 reporter gene system was used to visualize transfected cells using Dynabeads.TM. coated with anti-CD8-antibodies (Dynal). The following amounts of cDNA were used to transfect the cells: pC1-GIRK1 (rat)--1 .mu.g; nH3-CD* (human)--1 .mu.g; pcDNA3.1, pcDNA-G.alpha.i, pcDNA-G.alpha.iR, pcDNA-G.alpha.q, or pcDNA-G.alpha.s--4 .mu.g. Thus, typically the total amount of cDNA used for transfecting one 10 cm disk was 7 .mu.g. The cDNAs for GIRK1 and GIRK4 were gifts from F. Lesage and M. Lazdunski (Nice, France). A standard calcium phosphate procedure was used for transient transfection of HEK cells according to the methods of Schenborn et al., Meth. Mol. Biol. 130:135-145, 2000. All assays were performed 48-72 hours post transfection.

[0162] Whole cell currents were recorded from stably M.sub.2 mAChR-expressing HEK 293 cells that had been transiently transfected with cDNA for GIRK1, GIRK4 and either pcDNA-G.alpha.i, pcDNA-G.alpha.s, or pcDNA-G.alpha.q. For the measurement of inwardly rectifying K.sup.+ currents, whole cell currents were recorded using an extracellular solution contained 120 mM NaCl; 20 mM KCl; 2 mM CaCl.sub.2; 1 mM MgCl.sub.2; and 10 mM Hepes-NaOH, pH 7.4. The solution for filling the patch pipettes was composed of 100 mM potassium glutamate; 40 mM KCl; 5 mM MgATP; 10 mM Hepes-KOH, pH 7.4; 5 mM NaCl; 2 mM EGTA; 1 mM MgCl.sub.2; and 0.01 mM GTP. Membrane currents were recorded under voltage clamp, using conventional whole cell patch techniques. See Bunemann et al., J. Physiol. 489:701-777, 1995 and Bunemann et al., J. Physiol. 482:81-89, 1995, the disclosures of which are hereby incorporated by reference. To minimize variations due to different transfections or culture conditions, control experiments (transfection with pcDNA-G.alpha.iR) were done in parallel. Patch-pipettes were fabricated from borosilicate glass capillaries, (GF-150-10, Warner Instrument Corp.) using a horizontal puller (P-95 Fleming & Poulsen). The DC resistance of the filled pipettes ranged from 3-6 M.OMEGA..

[0163] Membrane currents were recorded using a patch-clamp amplifier (Axopatch 200, Axon Instruments). Signals are analog filtered using a lowpass Bessel filter (1-3 kHz corner frequency). Data were digitally stored using an IBM compatible PC equipped with a hardware/software package (ISO2 by MFK, Frankfurt/Main, Germany) for voltage control, data acquisition and data evaluation. To measure K.sup.+ currents in the inward direction, the potassium equilibrium potential was set to about -50 mV and the holding potential was -90 mV. Agonist-induced currents were evoked by application of acetylcholine (ACh; 1 .mu.M) using a solenoid operated superfusion device which allowed for solution exchange within 300 msec. Linear voltage ramps (from -120 mV to +60 mV within 500 ms) were applied every 10 sec. By subtracting non-agonist dependent currents, the current voltage properties of the agonist induced currents could be resolved. To exclude experiments in which currents were recorded from cells that may not have expressed the functional channel, only those cells that exhibited a basal non-agonist dependent Ba.sup.2+ (200 .mu.M) sensitive inwardly rectifying current were used for analysis. For analysis of the data, the maximal current density (peak amplitude) of ACh-induced inwardly rectifying K.sup.+ currents was measured at -80 mV and compared.

[0164] Superfusion of HEK 293 cells transiently transfected with GIRK1/GIRK4 and either pcDNA-G.sub.i or pcDNA-G.sub.iR DNA with 1 .mu.M ACh revealed that cells transfected with pcDNA-G.alpha..sub.i DNA have a dramatically impaired response to the M.sub.2 mAChR agonist. See FIG. 20, which summarizes data showing the maximum amplitude of ACh evoked currents for the different transfection conditions. The maximum current evoked by ACh was 3.7+/-1.5 pA/pF (n=14) in cells transfected with pcDNA-G.sub.i, compared to 24.1+/-8.8 pA/pF (n=11) in cells transfected with pcDNA-GiR. This indicates that the G.alpha.i minigene construct completely blocked the agonist mediated M.sub.2 mAChR GIRK1/GIRK4 response while the control minigene construct (pcDNA-GiR) had no effect. Compare FIG. 20A to FIGS. 20B and 20C. Cells transfected with minigene constructs encoding G.alpha. carboxyl termini for G.alpha.q or G.alpha.s pcDNA-G.alpha.q or pcDNA-G.alpha.s (FIG. 20) were not significantly different than those of cells transfected with the control vectors. These findings confirm the specificity of the inhibition of M.sub.2 mAChR-activated G protein-coupled inwardly rectifying K.sup.+ current responses by expression of the G.alpha.i minigene.

EXAMPLE 31

Selective G Protein Signaling Inhibition in Human Microvascular Endothelial Cells

[0165] Different measures of G-protein signaling final actions were assayed in human microvascular endothelial cells (HMEC) which natively express the thrombin receptor, PAR1. The cells were seeded onto 6-well plates at 1.times.10.sup.5 cells/well and transiently transfected after 24 hours with minigene constructs containing G.alpha. carboxyl terminal peptides (pcDNA, pcDNA-G.alpha.i, or pcDNA-G.alpha.iR; 1 .mu.g per well) using Effectene (Qiagen) according to the manufacturer's protocol. After 24 hours, the cells were labeled with 3 .mu.Ci/ml [.sup.3H]-adenine for 30 minutes at 37.degree. C. After another 24 hours, the cells were washed with serum-free medium containing 1 mM isobutyl-methyl xanthine. To stimulate cAMP accumulation, cells were treated with 1 .mu.M isoproterenol for 30 minutes at 37.degree. C. To see the inhibitory effects of thrombin on cAMP accumulation, cells were pretreated with thrombin (50 nM) for 15 minutes prior to addition of isoproterenol. The reactions were terminated by aspiration of media followed by addition of ice-cold 5% trichloroacetic acid.

[0166] Results are provided in FIG. 21 as (cAMP/cAMP+ATP).times.1000. Three separate experiments were done in duplicate. The ** symbol indicates p<0.005. Basal cAMP levels were essentially equivalent for all conditions tested. Endothelial cells stimulated with isoproterenol to activate .beta.-adrenergic receptors increase their cAMP levels through the Gs pathway. Cells transfected with pcDNA, pcDNA-G.alpha.i, or pcDNA-G.alpha.iR showed little difference with 82, 64, and 77 fold increases in isoproterenol-mediated cAMP accumulation, respectively. When the endothelial cells were pre-incubated with thrombin prior to addition of isoproterenol, a decrease in cAMP levels was observed due to thrombin activation of the Gi pathway. Endothelial cells transfected with pcDNA and pre-incubated with thrombin showed a 39% decrease in cAMP level over cells stimulated with only isoproterenol. Similarly, cells transfected with pcDNA-G.alpha.iR and pre-incubated with thrombin showed had a 43% decrease over cells stimulated with only isoproterenol. However, cells transfected with pcDNA-G.alpha.i and pre-incubated with thrombin had only a 0.1% decrease in cAMP levels as compared to cells stimulated with only isoproterenol. Thus, cells expressing the G.alpha.i C-terminal peptide appear to be unable to inhibit adenyl cyclase following activation with thrombin, indicating that thrombin-mediated Gi signaling was specifically blocked by expression of the pcDNA-G.alpha.i minigene.

EXAMPLE 32

Screening Method to Identify Inverse Agonists

[0167] Urea-washed rod outer segment membrane fragments containing rhodopsin receptor are immobilized onto microtiter wells and blocked as described in Example 7. The receptor is light-activated. Labeled native G.alpha.t carboxyl terminal peptide is added to each well and allowed to shake gently for one hour at 4.degree. C. The wells are washed to remove unbound peptide. Crude bacterial lysates (labeled) from a G.alpha.t carboxyl terminal peptide prepared according to the methods described in Example 7 (200 .mu.L) are added to each well and incubated with shaking for one hour at 4.degree. C.

[0168] The wells then are washed to remove unbound label. The supernatants or well-bound labels are quantitated by ELISA to detect dissociation of labeled native peptide from the receptor after incubation with library peptides compared to control well incubated in the absence of library peptides.

EXAMPLE 33

Small Molecule Library Screening Method

[0169] Small molecule libraries are screened for inhibition of GPCR-mediated G protein signaling as follows. PAR1 thrombin receptor prepared from insect cells according to Example 2 are immobilized onto microtiter wells, blocked and washed according to the methods described in Example 14. A small molecule library purchased from Chem Div (San Diego, Calif.) are added simultaneously with MBP-peptide fusion protein (0.1-1000 nM) in a 96- or 384-well plate and allowed to shake for one hour at 4.degree. C. Initial screens are performed with the small molecules at about 1-1000 .mu.M. The wells are washed four times in cold PBS containing 0.05% Tween 20.TM. and 1 mM maltose. The amount of maltose bindinG protein adhering to the wells is quantitated with anti-MBP antibodies as described in Example 14, versus control wells incubated without library compounds.

Sequence CWU 1

1

346 1 4 PRT Unknown mammalian misc_feature (1)..(4) Xaa can be any naturally occurring amino acid 1 Xaa Xaa Xaa Xaa 1 2 11 PRT Unknown mammalian 2 Leu Gln Leu Asn Leu Lys Glu Tyr Asn Leu Val 1 5 10 3 4 PRT Unknown mammalian 3 Val Arg Pro Ser 1 4 11 PRT Unknown mammalian 4 Leu Gln Leu Asn Arg Asn Glu Tyr Tyr Leu Val 1 5 10 5 4 PRT Unknown mammalian 5 Leu Ser Arg Ser 1 6 11 PRT Unknown mammalian 6 Leu Gln Gln Lys Leu Lys Glu Tyr Ser Leu Val 1 5 10 7 4 PRT Unknown mammalian 7 Leu Ser Thr Asn 1 8 11 PRT Unknown mammalian 8 Leu His Leu Asn Leu Lys Glu Tyr Asn Leu Val 1 5 10 9 4 PRT Unknown mammalian 9 Leu Pro Gln Met 1 10 11 PRT Unknown mammalian 10 Gln Arg Leu Asn Val Gly Glu Tyr Asn Leu Val 1 5 10 11 4 PRT Unknown mammalian 11 Ser Arg His Thr 1 12 11 PRT Unknown mammalian 12 Gln Arg Met His Leu Arg Gln Tyr Glu Leu Leu 1 5 10 13 67 DNA Unknown mammalian misc_feature (9)..(10) n is a, c, g, or t misc_feature (12)..(13) n is a, c, g, or t misc_feature (15)..(16) n is a, c, g, or t misc_feature (18)..(19) n is a, c, g, or t 13 gaggtggtnn knnknnknnk attcgtgaaa acttaaaaga ttgtggtcgt ttctaactaa 60 gtaaagc 67 14 11 PRT Homo sapiens 14 Ile Lys Glu Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 15 33 DNA Homo sapiens 15 atcaaggaga acctgaaaga ctgcggcctc ttc 33 16 11 PRT Homo sapiens 16 Ile Lys Asn Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 17 33 DNA Homo sapiens 17 ataaaaaata atctaaaaga ttgtggtctc ttc 33 18 11 PRT Homo sapiens 18 Asn Gly Ile Lys Cys Leu Phe Asn Asp Lys Leu 1 5 10 19 33 DNA Homo sapiens 19 aacggcatca agtgcctctt caacgacaag ctg 33 20 11 PRT Homo sapiens 20 Ile Lys Asn Asn Leu Lys Glu Cys Gly Leu Tyr 1 5 10 21 33 DNA Homo sapiens 21 attaaaaaca acttaaagga atgtggactt tat 33 22 11 PRT Homo sapiens 22 Ile Ala Lys Asn Leu Arg Gly Cys Gly Leu Tyr 1 5 10 23 33 DNA Homo sapiens 23 atcgccaaaa acctgcgggg ctgtggactc tac 33 24 11 PRT Homo sapiens 24 Ile Ala Asn Asn Leu Arg Gly Cys Gly Leu Tyr 1 5 10 25 33 DNA Homo sapiens 25 attgccaaca acctccgggg ctgcggcttg tac 33 26 11 PRT Homo sapiens 26 Ile Gln Asn Asn Leu Lys Tyr Ile Gly Leu Cys 1 5 10 27 33 DNA Homo sapiens 27 atacagaaca atctcaagta cattggcctt tgc 33 28 11 PRT Homo sapiens 28 Leu Gln Leu Asn Leu Lys Glu Tyr Asn Leu Val 1 5 10 29 33 DNA Homo sapiens 29 ctgcagctga acctcaagga gtacaacctg gtc 33 30 11 PRT Homo sapiens 30 Leu Gln Leu Asn Leu Lys Glu Tyr Asn Ala Val 1 5 10 31 33 DNA Homo sapiens 31 ctccagttga acctgaagga gtacaatgca gtc 33 32 11 PRT Homo sapiens 32 Gln Arg Met His Leu Lys Gln Tyr Glu Leu Leu 1 5 10 33 33 DNA Homo sapiens 33 cagcggatgc acctcaagca gtatgagctc ttg 33 34 11 PRT Homo sapiens 34 Leu Gln Leu Asn Leu Arg Glu Phe Asn Leu Val 1 5 10 35 33 DNA Homo sapiens 35 ctacagctaa acctaaggga attcaacctt gtc 33 36 11 PRT Homo sapiens 36 Leu Ala Arg Tyr Leu Asp Glu Ile Asn Leu Leu 1 5 10 37 33 DNA Homo sapiens 37 ctcgcccgct acctggacga gatcaacctg ctg 33 38 11 PRT Homo sapiens 38 Leu Gln Glu Asn Leu Lys Asp Ile Met Leu Gln 1 5 10 39 33 DNA Homo sapiens 39 ctgcaggaga acctgaagga catcatgctg cag 33 40 11 PRT Homo sapiens 40 Leu His Asp Asn Leu Lys Gln Leu Met Leu Gln 1 5 10 41 33 DNA Homo sapiens 41 ctgcatgaca acctcaagca gcttatgcta cag 33 42 11 PRT Homo sapiens 42 Gln Arg Met His Leu Arg Gln Tyr Glu Leu Leu 1 5 10 43 33 DNA Homo sapiens 43 cagcgcatgc accttcgtca gtacgagctg ctc 33 44 20 DNA Unknown mammalian 44 gatccgccgc caccatggga 20 45 4 DNA Unknown mammalian 45 tgaa 4 46 11 PRT Homo sapiens 46 Ile Lys Glu Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 47 11 PRT Homo sapiens 47 Ile Lys Asn Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 48 11 PRT Drosophila melanogaster 48 Ile Lys Asn Asn Leu Lys Gln Ile Gly Leu Phe 1 5 10 49 11 PRT Drosophila melanogaster 49 Leu Ser Glu Asn Val Ser Ser Met Gly Leu Phe 1 5 10 50 11 PRT Drosophila melanogaster 50 Ile Lys Asn Asn Leu Lys Gln Ile Gly Leu Phe 1 5 10 51 11 PRT Homo sapiens 51 Ile Lys Asn Asn Leu Lys Glu Cys Gly Leu Tyr 1 5 10 52 11 PRT Homo sapiens 52 Ile Ala Asn Asn Leu Arg Gly Cys Gly Leu Tyr 1 5 10 53 11 PRT Homo sapiens 53 Ile Ala Lys Asn Leu Arg Gly Cys Gly Leu Tyr 1 5 10 54 11 PRT Unknown prokaryotic or eukaryotic 54 Ile Lys Asn Asn Leu Lys Glu Cys Gly Leu Tyr 1 5 10 55 11 PRT Xenopus laevis 55 Ile Ala Tyr Asn Leu Arg Gly Cys Gly Leu Tyr 1 5 10 56 11 PRT Caenorhabditis elegans 56 Ile Gln Ala Asn Leu Gln Gly Cys Gly Leu Tyr 1 5 10 57 11 PRT Caenorhabditis elegans 57 Ile Gln Ser Asn Leu His Lys Ser Gly Leu Tyr 1 5 10 58 11 PRT Caenorhabditis elegans 58 Leu Ser Thr Lys Leu Lys Gly Cys Gly Leu Tyr 1 5 10 59 11 PRT Xenopus laevis 59 Ile Lys Ser Asn Leu Met Glu Cys Gly Leu Tyr 1 5 10 60 11 PRT Canis familiaris 60 Val Gln Gln Asn Leu Lys Lys Ser Gly Ile Met 1 5 10 61 11 PRT Homo sapiens 61 Ile Gln Asn Asn Leu Lys Tyr Ile Gly Leu Cys 1 5 10 62 11 PRT Homo sapiens 62 Leu Ala Arg Tyr Leu Asp Glu Ile Asn Leu Leu 1 5 10 63 11 PRT Schizosaccharomyces pombe 63 Leu Gln His Ser Leu Lys Glu Ala Gly Met Phe 1 5 10 64 11 PRT Homo sapiens 64 Leu Gln Glu Asn Leu Lys Asp Ile Met Leu Gln 1 5 10 65 11 PRT Homo sapiens 65 Leu His Asp Asn Leu Lys Gln Leu Met Leu Gln 1 5 10 66 11 PRT Drosophila melanogaster 66 Leu Gln Arg Asn Leu Asn Ala Leu Met Leu Gln 1 5 10 67 11 PRT Saccharomyces cerevisiae 67 Glu Asn Thr Leu Lys Asp Ser Gly Val Leu Gln 1 5 10 68 11 PRT Homo sapiens 68 Leu Gln Leu Asn Leu Arg Glu Phe Asn Leu Val 1 5 10 69 11 PRT Homo sapiens 69 Leu Gln Leu Asn Leu Lys Glu Tyr Asn Leu Val 1 5 10 70 11 PRT Homo sapiens 70 Leu Gln Leu Asn Leu Lys Glu Tyr Asn Ala Val 1 5 10 71 11 PRT Drosophila melanogaster 71 Leu Gln Ser Asn Leu Lys Glu Tyr Asn Leu Val 1 5 10 72 11 PRT Xenopus laevis 72 Leu Gln His Asn Leu Lys Glu Tyr Asn Leu Val 1 5 10 73 11 PRT Sporothrix schenckii 73 Ile Gln Glu Asn Leu Arg Leu Cys Gly Leu Ile 1 5 10 74 11 PRT Saccharomyces cerevisiae 74 Ile Gln Gln Asn Leu Lys Lys Ile Gly Ile Ile 1 5 10 75 11 PRT Neurospora crassa 75 Ile Ile Gln Arg Asn Leu Lys Gln Leu Ile Leu 1 5 10 76 11 PRT Filobasidiella neoformans 76 Leu Gln Asn Ala Leu Arg Asp Ser Gly Ile Leu 1 5 10 77 11 PRT Ustilago maydis 77 Leu Thr Asn Ala Leu Lys Asp Ser Gly Ile Leu 1 5 10 78 11 PRT Kluyveromyces lactis 78 Ile Gln Gln Asn Leu Lys Lys Ser Gly Ile Leu 1 5 10 79 11 PRT Ustilago maydis 79 Leu Thr Asn Ala Leu Lys Asp Ser Gly Ile Leu 1 5 10 80 11 PRT Dictyostelium discoideum 80 Asn Leu Thr Leu Gly Glu Ala Gly Met Ile Leu 1 5 10 81 11 PRT Kluyveromyces lactis 81 Leu Glu Asn Ser Leu Lys Asp Ser Gly Val Leu 1 5 10 82 11 PRT Ustilago maydis 82 Ile Leu Thr Asn Asn Leu Arg Asp Ile Val Leu 1 5 10 83 11 PRT Mus musculus 83 Gln Arg Met His Leu Pro Gln Tyr Glu Leu Leu 1 5 10 84 11 PRT Homo sapiens 84 Gln Arg Met His Leu Arg Gln Tyr Glu Leu Leu 1 5 10 85 11 PRT Homo sapiens 85 Gln Arg Met His Leu Lys Gly Tyr Glu Leu Leu 1 5 10 86 11 PRT Coprinus congregatus 86 Leu Gln Leu His Leu Arg Glu Cys Gly Leu Leu 1 5 10 87 11 PRT Lycopersicon esculentum 87 Arg Arg Arg Asn Leu Phe Glu Ala Gly Leu Leu 1 5 10 88 11 PRT Glycine max 88 Arg Arg Arg Asn Leu Leu Glu Ala Gly Leu Leu 1 5 10 89 11 PRT Glycine max 89 Arg Arg Arg Asn Pro Leu Glu Ala Gly Leu Leu 1 5 10 90 11 PRT Ustilago maydis 90 Ile Gln Val Asn Leu Arg Asp Cys Gly Leu Leu 1 5 10 91 11 PRT Ustilago maydis 91 Arg Glu Asn Leu Lys Leu Thr Gly Leu Val Gly 1 5 10 92 11 PRT Oryza sativa 92 Asp Glu Ser Met Arg Arg Ser Arg Glu Gly Thr 1 5 10 93 11 PRT Calliphora vicina 93 Met Gln Asn Ala Leu Lys Glu Phe Asn Leu Gly 1 5 10 94 11 PRT Dictyostelium discoideum 94 Thr Gln Cys Val Met Lys Ala Gly Leu Tyr Ser 1 5 10 95 11 PRT Unknown prokaryotic or eukaryotic 95 Leu Gln His Ser Leu Lys Glu Ala Gly Met Phe 1 5 10 96 11 PRT Unknown prokaryotic or eukaryotic 96 Glu Asn Thr Leu Lys Asp Ser Gly Val Leu Gln 1 5 10 97 11 PRT Caenorhabditis elegans 97 Ile Ile Ser Ala Ser Leu Lys Met Val Gly Val 1 5 10 98 11 PRT Caenorhabditis elegans 98 Asn Glu Asn Leu Arg Ser Ala Gly Leu His Glu 1 5 10 99 11 PRT Caenorhabditis elegans 99 Arg Leu Ile Arg Tyr Ala Asn Asn Ile Pro Val 1 5 10 100 11 PRT Caenorhabditis elegans 100 Leu Ser Thr Lys Leu Lys Gly Cys Gly Leu Tyr 1 5 10 101 11 PRT Caenorhabditis elegans 101 Ile Ala Lys Asn Leu Lys Ser Met Gly Leu Cys 1 5 10 102 11 PRT Caenorhabditis elegans 102 Ile Gly Arg Asn Leu Arg Gly Thr Gly Met Glu 1 5 10 103 11 PRT Caenorhabditis elegans 103 Ile Gln His Thr Met Gln Lys Val Gly Ile Gln 1 5 10 104 11 PRT Caenorhabditis elegans 104 Ile Gln Lys Asn Leu Gln Lys Ala Gly Met Met 1 5 10 105 11 PRT Caenorhabditis elegans 105 Leu Lys Asn Ile Phe Asn Thr Ile Ile Asn Tyr 1 5 10 106 11 PRT Unknown mammalian 106 Leu Gln Leu Asn Leu Lys Glu Tyr Asn Leu Val 1 5 10 107 11 PRT Unknown mammalian 107 Leu Leu Leu Gln Leu Val Glu His Thr Leu Val 1 5 10 108 11 PRT Unknown mammalian 108 His Arg Leu Asn Leu Leu Glu Tyr Cys Leu Val 1 5 10 109 11 PRT Unknown mammalian 109 Glu Gln Trp Asn Met Asn Thr Phe His Met Ile 1 5 10 110 11 PRT Unknown mammalian 110 Ser Gln Val Lys Leu Gln Lys Gly His Leu Val 1 5 10 111 10 PRT Unknown mammalian 111 Leu Arg Leu Leu Leu Glu Tyr Asn Leu Gly 1 5 10 112 11 PRT Unknown mammalian 112 Arg Arg Leu Lys Val Asn Glu Tyr Lys Leu Leu 1 5 10 113 11 PRT Unknown mammalian 113 Leu Gln Leu Arg Leu Arg Glu His Asn Leu Val 1 5 10 114 11 PRT Unknown mammalian 114 His Val Leu Asn Ser Lys Glu Tyr Asn Gln Val 1 5 10 115 11 PRT Unknown mammalian 115 Met Lys Leu Asn Val Ser Glu Ser Asn Leu Val 1 5 10 116 11 PRT Unknown mammalian 116 Leu Gln Thr Asn Gln Lys Glu Tyr Asp Met Asp 1 5 10 117 11 PRT Unknown mammalian 117 Leu Gln Leu Asn Pro Arg Glu Asp Lys Leu Trp 1 5 10 118 11 PRT Unknown mammalian 118 Arg His Leu Asp Leu Asn Ala Cys Asn Met Gly 1 5 10 119 10 PRT Unknown mammalian 119 Leu Arg Asn Asp Ile Glu Ala Leu Leu Val 1 5 10 120 11 PRT Unknown mammalian 120 Leu Val Gln Asp Arg Gln Glu Ser Ile Leu Val 1 5 10 121 11 PRT Unknown mammalian 121 Leu Gln Leu Lys His Lys Glu Asn Asn Leu Met 1 5 10 122 11 PRT Unknown mammalian 122 Leu Gln Val Asn Leu Glu Glu Tyr His Leu Val 1 5 10 123 11 PRT Unknown mammalian 123 Leu Gln Phe Asn Leu Asn Asp Cys Asn Leu Val 1 5 10 124 11 PRT Unknown mammalian 124 Met Lys Leu Lys Leu Lys Glu Asp Asn Leu Val 1 5 10 125 11 PRT Unknown mammalian 125 His Gln Leu Asp Leu Leu Glu Tyr Asn Leu Gly 1 5 10 126 11 PRT Unknown mammalian 126 Leu Arg Leu Asp Phe Ser Glu Lys Gln Leu Val 1 5 10 127 11 PRT Unknown mammalian 127 Leu Gln Lys Asn Leu Lys Glu Tyr Asn Met Val 1 5 10 128 11 PRT Unknown mammalian 128 Leu Gln Tyr Asn Leu Met Glu Asp Tyr Leu Asn 1 5 10 129 11 PRT Unknown mammalian 129 Leu Gln Met Tyr Leu Arg Gly Tyr Asn Leu Val 1 5 10 130 11 PRT Unknown mammalian 130 Leu Pro Leu Asn Pro Lys Glu Tyr Ser Leu Val 1 5 10 131 11 PRT Unknown mammalian 131 Met Asn Leu Thr Leu Lys Glu Cys Asn Leu Val 1 5 10 132 11 PRT Unknown mammalian 132 Leu Gln Gln Ser Leu Ile Glu Tyr Asn Leu Leu 1 5 10 133 13 PRT Unknown mammalian 133 Met Gly Ile Lys Asn Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 134 13 PRT Unknown mammalian 134 Met Gly Asn Gly Ile Lys Cys Leu Phe Asn Asp Lys Leu 1 5 10 135 13 PRT Unknown mammalian 135 Met Gly Leu Gln Leu Asn Leu Lys Glu Tyr Asn Ala Val 1 5 10 136 13 PRT Unknown mammalian 136 Met Gly Leu Gln Leu Asn Leu Lys Glu Tyr Asn Thr Leu 1 5 10 137 13 PRT Unknown mammalian 137 Met Gly Leu Gln Glu Asn Leu Lys Asp Ile Met Leu Gln 1 5 10 138 13 PRT Unknown mammalian 138 Met Gly Leu His Asp Asn Leu Lys Gln Leu Met Leu Gln 1 5 10 139 11 PRT Unknown mammalian 139 Ile Lys Glu Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 140 67 DNA Unknown mammalian misc_feature (9)..(10) n is a, c, g, or t misc_feature (12)..(13) n is a, c, g, or t misc_feature (15)..(16) n is a, c, g, or t misc_feature (18)..(19) n is a, c, g, or t 140 gaggtggtnn knnknnknnk atcaaggaga acctgaagga ctgcggcctc ttctaactaa 60 gtaaagc 67 141 67 DNA Unknown mammalian misc_feature (9)..(10) n is a, c, g, or t misc_feature (12)..(13) n is a, c, g, or t misc_feature (15)..(16) n is a, c, g, or t misc_feature (18)..(19) n is a, c, g, or t 141 gaggtggtnn knnknnknnk attcgtgaaa acttaaaaga ttgtggtcgt ttctaactaa 60 gtaaagc 67 142 67 DNA Unknown mammalian misc_feature (9)..(10) n is a, c, g, or t misc_feature (12)..(13) n is a, c, g, or t misc_feature (15)..(16) n is a, c, g, or t misc_feature (18)..(19) n is a, c, g, or t 142 gaggtggtnn knnknnknnk ctgcagctga acctgaagga gtacaatctg gtctaactaa 60 gtaaagc 67 143 67 DNA Unknown mammalian misc_feature (9)..(10) n is a, c, g, or t misc_feature (12)..(13) n is a, c, g, or t misc_feature (15)..(16) n is a, c, g, or t misc_feature (18)..(19) n is a, c, g, or t 143 gaggtggtnn knnknnknnk ctgcaggaga acctgaagga catcatgctg cagtaactaa 60 gtaaagc 67 144 67 DNA Unknown mammalian misc_feature (9)..(10) n is a, c, g, or t misc_feature (12)..(13) n is a, c, g, or t misc_feature (15)..(16) n is a, c, g, or t misc_feature (18)..(19) n is a, c, g, or t 144 gaggtggtnn knnknnknnk ctgcatgaca acctcaagca gcttatgcta cagtaactaa 60 gtaaagc 67 145 67 DNA Unknown mammalian misc_feature (9)..(10) n is a, c, g, or t misc_feature (12)..(13) n is a, c, g, or t misc_feature (15)..(16) n is a, c, g, or t misc_feature (18)..(19) n is a, c, g, or t 145 gaggtggtnn knnknnknnk ctcgcccggt acctggacga gattaatctg ctgtaactaa 60 gtaaagc 67 146 67 DNA Unknown mammalian misc_feature (9)..(10) n is a, c, g, or t misc_feature (12)..(13) n is a, c, g, or t misc_feature (15)..(16) n is a, c, g, or t misc_feature (18)..(19) n is a, c, g, or t 146 gaggtggtnn knnknnknnk

atacagaaca atctcaagta cattggcctt tgctaactaa 60 gtaaagc 67 147 11 PRT Unknown mammalian 147 Leu Leu Glu Asn Leu Arg Asp Cys Gly Met Phe 1 5 10 148 11 PRT Unknown mammalian 148 Ile Gln Gly Val Leu Lys Asp Cys Gly Leu Leu 1 5 10 149 11 PRT Unknown mammalian 149 Ile Cys Glu Asn Leu Lys Glu Cys Gly Leu Phe 1 5 10 150 11 PRT Unknown mammalian 150 Met Leu Glu Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 151 11 PRT Unknown mammalian 151 Val Leu Glu Asp Leu Lys Ser Cys Gly Leu Phe 1 5 10 152 11 PRT Unknown mammalian 152 Met Leu Lys Asn Leu Lys Asp Cys Gly Met Phe 1 5 10 153 11 PRT Unknown mammalian 153 Leu Leu Asp Asn Ile Lys Asp Cys Gly Leu Phe 1 5 10 154 11 PRT Unknown mammalian 154 Ile Leu Thr Lys Leu Thr Asp Cys Gly Leu Phe 1 5 10 155 11 PRT Unknown mammalian 155 Leu Arg Glu Ser Leu Lys Gln Cys Gly Leu Phe 1 5 10 156 11 PRT Unknown mammalian 156 Ile His Ala Ser Leu Arg Asp Cys Gly Leu Phe 1 5 10 157 11 PRT Unknown mammalian 157 Ile Arg Gly Ser Leu Lys Asp Cys Gly Leu Phe 1 5 10 158 11 PRT Unknown mammalian 158 Ile Phe Leu Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 159 11 PRT Unknown mammalian 159 Ile Arg Glu Asn Leu Glu Asp Cys Gly Leu Phe 1 5 10 160 11 PRT Unknown mammalian 160 Ile Ile Asp Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 161 11 PRT Unknown mammalian 161 Met Arg Glu Ser Leu Lys Asp Cys Gly Leu Phe 1 5 10 162 11 PRT Unknown mammalian 162 Ile Arg Glu Thr Leu Lys Asp Cys Gly Leu Leu 1 5 10 163 11 PRT Unknown mammalian 163 Ile Leu Ala Asp Val Ile Asp Cys Gly Leu Phe 1 5 10 164 11 PRT Unknown mammalian 164 Met Cys Glu Ser Leu Lys Glu Cys Gly Leu Phe 1 5 10 165 11 PRT Unknown mammalian 165 Ile Arg Glu Lys Trp Lys Asp Leu Ala Leu Phe 1 5 10 166 11 PRT Unknown mammalian 166 Val Arg Asp Asn Leu Lys Asn Cys Phe Leu Phe 1 5 10 167 11 PRT Unknown mammalian 167 Ile Gly Glu Gln Ile Glu Asp Cys Gly Pro Phe 1 5 10 168 11 PRT Unknown mammalian 168 Ile Arg Asn Asn Leu Lys Arg Tyr Gly Met Phe 1 5 10 169 11 PRT Unknown mammalian 169 Ile Arg Glu Asn Leu Lys Asp Leu Gly Leu Val 1 5 10 170 11 PRT Unknown mammalian 170 Ile Arg Glu Asn Phe Lys Tyr Leu Gly Leu Trp 1 5 10 171 11 PRT Unknown mammalian 171 Ser Leu Glu Ile Leu Lys Asp Trp Gly Leu Phe 1 5 10 172 11 PRT Unknown mammalian 172 Ile Arg Gly Thr Leu Lys Gly Trp Gly Leu Phe 1 5 10 173 11 PRT Unknown mammalian 173 Leu Gln Phe Asn Leu Asn Asp Cys Asn Leu Val 1 5 10 174 11 PRT Unknown mammalian 174 Leu Gln Arg Asn Lys Lys Gln Tyr Asn Leu Gly 1 5 10 175 11 PRT Unknown mammalian 175 Met Lys Leu Lys Leu Lys Glu Asp Asn Leu Val 1 5 10 176 11 PRT Unknown mammalian 176 His Gln Leu Asp Leu Leu Glu Tyr Asn Leu Gly 1 5 10 177 11 PRT Unknown mammalian 177 Leu Gln Leu Arg Tyr Lys Cys Tyr Asn Leu Val 1 5 10 178 11 PRT Unknown mammalian 178 Leu Gln Gln Ser Leu Ile Glu Tyr Asn Leu Leu 1 5 10 179 11 PRT Unknown mammalian 179 Val His Val Lys Leu Lys Glu Tyr Asn Leu Val 1 5 10 180 11 PRT Unknown mammalian 180 Leu Gln Leu Asn Val Lys Glu Tyr Asn Leu Val 1 5 10 181 11 PRT Unknown mammalian 181 Leu Arg Ile Tyr Leu Lys Gly Tyr Asn Leu Val 1 5 10 182 11 PRT Unknown mammalian 182 Met Lys Leu Asn Val Ser Glu Ser Asn Leu Val 1 5 10 183 11 PRT Unknown mammalian 183 Leu Gln Leu Asn Leu Lys Val Tyr Asn Leu Val 1 5 10 184 11 PRT Unknown mammalian 184 Leu Glu Leu Asn Leu Lys Val Tyr Asn Leu Phe 1 5 10 185 11 PRT Unknown mammalian 185 Leu Gln Leu Lys His Lys Glu Asn Asn Leu Met 1 5 10 186 11 PRT Unknown mammalian 186 Leu His Leu Asn Met Ala Glu Val Ser Leu Val 1 5 10 187 11 PRT Unknown mammalian 187 Leu Gln Val Asn Leu Glu Glu Tyr His Leu Val 1 5 10 188 11 PRT Unknown mammalian 188 Leu Gln Lys Asn Leu Lys Glu Tyr Asn Met Val 1 5 10 189 11 PRT Unknown mammalian 189 Leu Gln Met Tyr Leu Arg Gly Tyr Asn Leu Val 1 5 10 190 11 PRT Unknown mammalian 190 Leu Lys Arg Tyr Leu Lys Glu Ser Asn Leu Val 1 5 10 191 11 PRT Unknown mammalian 191 Met Asn Leu Thr Leu Lys Glu Cys Asn Leu Val 1 5 10 192 11 PRT Unknown mammalian 192 Leu Gln Leu Lys Arg Gly Glu Tyr Ile Leu Val 1 5 10 193 11 PRT Unknown mammalian 193 Leu Gln Leu Asn Arg Asn Glu Tyr Tyr Leu Val 1 5 10 194 11 PRT Unknown mammalian 194 Leu Arg Leu Asn Gly Lys Glu Leu Asn Leu Val 1 5 10 195 11 PRT Unknown mammalian 195 Cys Ser Leu Lys Leu Lys Ala Tyr Asn Leu Val 1 5 10 196 11 PRT Unknown mammalian 196 Leu Gln Met Asn His Asn Glu Tyr Asn Leu Val 1 5 10 197 11 PRT Unknown mammalian 197 Pro Gln Leu Asn Leu Asn Ala Tyr Asn Leu Val 1 5 10 198 11 PRT Unknown mammalian 198 Gln Arg Leu Asn Val Gly Glu Tyr Asn Leu Val 1 5 10 199 11 PRT Unknown mammalian 199 Leu His Leu Asn Leu Lys Glu Tyr Asn Leu Val 1 5 10 200 11 PRT Unknown mammalian 200 Leu Gln Gln Lys Leu Lys Glu Tyr Ser Leu Val 1 5 10 201 11 PRT Unknown mammalian 201 Gln Gly Met Gln Leu Arg Arg Phe Lys Leu Arg 1 5 10 202 11 PRT Unknown mammalian 202 Arg Trp Leu His Trp Gln Tyr Arg Gly Arg Gly 1 5 10 203 11 PRT Unknown mammalian 203 Pro Arg Pro Arg Leu Leu Arg Phe Lys Ile Pro 1 5 10 204 11 PRT Unknown mammalian 204 Gln Gly Glu His Leu Arg Gln Leu Gln Leu Gln 1 5 10 205 11 PRT Unknown mammalian 205 Gln Arg Leu Arg Leu Gly Pro Asp Glu Leu Phe 1 5 10 206 11 PRT Unknown mammalian 206 Gln Arg Ile His Arg Arg Pro Phe Lys Phe Phe 1 5 10 207 11 PRT Unknown mammalian 207 Gln Arg Met Pro Leu Arg Leu Phe Glu Phe Leu 1 5 10 208 11 PRT Unknown mammalian 208 Gln Arg Val His Leu Arg Gln Asp Glu Leu Leu 1 5 10 209 11 PRT Unknown mammalian 209 Asp Arg Met His Leu Trp Arg Phe Gly Leu Leu 1 5 10 210 11 PRT Unknown mammalian 210 Gln Arg Met Pro Leu Arg Gln Tyr Glu Leu Leu 1 5 10 211 11 PRT Unknown mammalian 211 Gln Trp Met Asp Leu Arg Gln His Glu Leu Leu 1 5 10 212 11 PRT Unknown mammalian 212 Gln Arg Met Asn Leu Gly Pro Cys Gly Leu Leu 1 5 10 213 11 PRT Unknown mammalian 213 Asn Cys Met Lys Phe Arg Ser Cys Gly Leu Phe 1 5 10 214 11 PRT Unknown mammalian 214 Gln Arg Leu His Leu Arg Gly Tyr Glu Phe Leu 1 5 10 215 11 PRT Unknown mammalian 215 His Arg Arg His Ile Gly Pro Phe Ala Leu Leu 1 5 10 216 11 PRT Unknown mammalian 216 Glu Arg Leu His Arg Arg Leu Phe Gln Leu His 1 5 10 217 11 PRT Unknown mammalian 217 Pro Cys Ile Gln Leu Gly Gln Tyr Glu Ser Phe 1 5 10 218 11 PRT Unknown mammalian 218 Gln Arg Leu Arg Leu Arg Lys Tyr Arg Leu Phe 1 5 10 219 11 PRT Unknown mammalian 219 Ile Val Glu Ile Leu Glu Asp Cys Gly Leu Phe 1 5 10 220 11 PRT Unknown mammalian 220 Met Leu Asp Asn Leu Lys Ala Cys Gly Leu Phe 1 5 10 221 11 PRT Unknown mammalian 221 Ile Leu Glu Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 222 11 PRT Unknown mammalian 222 Leu Arg Glu Asn Leu Lys Asp Cys Gly Leu Leu 1 5 10 223 11 PRT Unknown mammalian 223 Leu Leu Asp Ile Leu Lys Asp Cys Gly Leu Phe 1 5 10 224 11 PRT Unknown mammalian 224 Val Arg Asp Ile Leu Lys Asp Cys Gly Leu Phe 1 5 10 225 11 PRT Unknown mammalian 225 Ile Leu Glu Ser Leu Asn Glu Cys Gly Leu Phe 1 5 10 226 11 PRT Unknown mammalian 226 Ile Leu Gln Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 227 11 PRT Unknown mammalian 227 Met Leu Asp Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 228 11 PRT Unknown mammalian 228 Ile His Asp Arg Leu Lys Asp Cys Gly Leu Phe 1 5 10 229 11 PRT Unknown mammalian 229 Ile Arg Gly Ser Leu Lys Asp Cys Gly Leu Phe 1 5 10 230 11 PRT Unknown mammalian 230 Ile Cys Glu Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 231 11 PRT Unknown mammalian 231 Ile Val Lys Asn Leu Glu Asp Cys Gly Leu Phe 1 5 10 232 11 PRT Unknown mammalian 232 Ile Ser Lys Asn Leu Arg Asp Cys Gly Leu Leu 1 5 10 233 11 PRT Unknown mammalian 233 Ile Arg Asp Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 234 11 PRT Unknown mammalian 234 Ile Arg Glu Phe Leu Thr Asp Cys Gly Leu Phe 1 5 10 235 11 PRT Unknown mammalian 235 Ile Arg Leu Asp Leu Lys Asp Val Ser Leu Phe 1 5 10 236 11 PRT Unknown mammalian 236 Ile Cys Glu Arg Leu Asn Asp Cys Gly Leu Cys 1 5 10 237 11 PRT Unknown mammalian 237 Pro Arg Asp Asn Thr Lys Val Arg Gly Leu Phe 1 5 10 238 11 PRT Unknown mammalian 238 Phe Trp Gly Asn Leu Gln Asp Ser Gly Leu Phe 1 5 10 239 11 PRT Unknown mammalian 239 Arg Arg Gly Asn Gly Lys Asp Cys Arg His Phe 1 5 10 240 11 PRT Unknown mammalian 240 Leu Gln Glu Asn Leu Lys Glu Met Met Leu Gln 1 5 10 241 11 PRT Unknown mammalian 241 Leu Glu Glu Asn Leu Lys Tyr Arg Met Leu Asp 1 5 10 242 11 PRT Unknown mammalian 242 Leu Gln Glu Asp Leu Lys Gly Met Thr Leu Gln 1 5 10 243 11 PRT Unknown mammalian 243 Leu Gln Glu Thr Met Lys Asp Gln Ser Leu Gln 1 5 10 244 11 PRT Unknown mammalian 244 Pro Gln Val Asn Leu Lys Ser Ile Met Arg Gln 1 5 10 245 11 PRT Unknown mammalian 245 Trp Gln His Lys Leu Ser Glu Val Met Leu Gln 1 5 10 246 11 PRT Unknown mammalian 246 Leu Lys Glu His Leu Met Glu Arg Met Leu Gln 1 5 10 247 11 PRT Unknown mammalian 247 Leu Leu Gly Met Leu Glu Pro Leu Met Glu Gln 1 5 10 248 11 PRT Unknown mammalian 248 Leu Gln Asp Asn Leu Arg His Leu Met Leu Gln 1 5 10 249 11 PRT Unknown mammalian 249 Leu Gln Asp Lys Ile Asn His Leu Met Leu Gln 1 5 10 250 11 PRT Unknown mammalian 250 Leu Gln Ala Asn Arg Lys Leu Gly Met Leu Gln 1 5 10 251 11 PRT Unknown mammalian 251 Leu Ile Val Lys Val Lys Gln Leu Ile Trp Gln 1 5 10 252 11 PRT Unknown mammalian 252 Met Arg Ala Lys Leu Asn Asn Leu Met Leu Glu 1 5 10 253 10 PRT Unknown mammalian 253 Leu Gln Asp Asn Leu Arg His Leu Ile Gln 1 5 10 254 10 PRT Unknown mammalian 254 Leu Gln Asp Asn Arg Asn Gln Leu Leu Phe 1 5 10 255 11 PRT Unknown mammalian 255 Leu Gln Leu Asn Val Lys Glu Tyr Asn Leu Val 1 5 10 256 11 PRT Unknown mammalian 256 Leu Gln Leu Asn Arg Lys Asn Tyr Asn Leu Val 1 5 10 257 11 PRT Unknown mammalian 257 Leu Gln Leu Arg Tyr Lys Cys Tyr Asn Leu Val 1 5 10 258 11 PRT Unknown mammalian 258 Leu Gln Leu Asp Leu Lys Glu Ser Asn Met Val 1 5 10 259 11 PRT Unknown mammalian 259 Leu Gln Leu Asn Leu Lys Lys Tyr Asn Arg Val 1 5 10 260 11 PRT Unknown mammalian 260 Leu Gln Leu Arg Val Lys Glu Tyr Lys Arg Gly 1 5 10 261 11 PRT Unknown mammalian 261 Leu Gln Arg Asn Lys Lys Gln Tyr Asn Leu Gly 1 5 10 262 11 PRT Unknown mammalian 262 Leu Gln Ile Tyr Leu Lys Gly Tyr Asn Leu Val 1 5 10 263 11 PRT Unknown mammalian 263 Leu Gln Phe Asn Leu Asn Asp Cys Asn Leu Val 1 5 10 264 11 PRT Unknown mammalian 264 Leu Gln Tyr Asn Leu Lys Glu Ser Phe Val Val 1 5 10 265 11 PRT Unknown mammalian 265 Leu Gln Gln Ser Leu Ile Glu Tyr Asn Leu Leu 1 5 10 266 11 PRT Unknown mammalian 266 Leu Gln Arg Asp His Val Glu Tyr Lys Leu Phe 1 5 10 267 11 PRT Unknown mammalian 267 Leu Val Ile Lys Pro Lys Glu Phe Asn Leu Val 1 5 10 268 11 PRT Unknown mammalian 268 Ile Gln Leu Asn Leu Lys Asn Tyr Asn Ile Val 1 5 10 269 11 PRT Unknown mammalian 269 His Gln Leu Asp Leu Leu Glu Tyr Asn Leu Gly 1 5 10 270 11 PRT Unknown mammalian 270 Met Gln Leu Asn Leu Lys Glu Tyr Asn Leu Val 1 5 10 271 11 PRT Unknown mammalian 271 Val Gln Val Lys Leu Lys Glu Tyr Asn Leu Val 1 5 10 272 11 PRT Unknown mammalian 272 Gln Leu Leu Asn Gln Tyr Val Tyr Asn Leu Val 1 5 10 273 11 PRT Unknown mammalian 273 Met Lys Leu Lys Leu Lys Glu Asp Asn Leu Val 1 5 10 274 11 PRT Unknown mammalian 274 Trp Arg Leu Ser Leu Lys Val Tyr Asn Leu Val 1 5 10 275 11 PRT Unknown mammalian 275 Leu Gln Leu Asn Val Lys Glu Tyr Asn Leu Val 1 5 10 276 11 PRT Unknown mammalian 276 Leu Gln Leu Arg Val Lys Glu Tyr Lys Arg Gly 1 5 10 277 11 PRT Unknown mammalian 277 Leu Gln Leu Arg Tyr Lys Cys Tyr Asn Leu Val 1 5 10 278 11 PRT Unknown mammalian 278 Leu Gln Ile Tyr Leu Lys Gly Tyr Asn Leu Val 1 5 10 279 11 PRT Unknown mammalian 279 Leu Gln Phe Asn Leu Asn Asp Cys Asn Leu Val 1 5 10 280 11 PRT Unknown mammalian 280 Leu Gln Arg Asn Lys Lys Gln Tyr Asn Leu Gly 1 5 10 281 11 PRT Unknown mammalian 281 Leu Gln Arg Asn Lys Asn Gln Tyr Asn Leu Gly 1 5 10 282 11 PRT Unknown mammalian 282 Leu Gln Gln Ser Leu Ile Glu Tyr Asn Leu Leu 1 5 10 283 11 PRT Unknown mammalian 283 Leu Arg Leu Asp Phe Ser Glu Lys Gln Leu Val 1 5 10 284 11 PRT Unknown mammalian 284 Leu Tyr Leu Asp Leu Lys Glu Tyr Cys Leu Phe 1 5 10 285 11 PRT Unknown mammalian 285 His Gln Leu Asp Leu Leu Glu Tyr Asn Leu Gly 1 5 10 286 11 PRT Unknown mammalian 286 Val Gln Val Lys Leu Lys Glu Tyr Asn Leu Val 1 5 10 287 11 PRT Unknown mammalian 287 Met Lys Leu Lys Leu Lys Glu Asp Asn Leu Val 1 5 10 288 11 PRT Unknown mammalian 288 Ser Ala Lys Glu Leu Asp Gln Tyr Asn Leu Gly 1 5 10 289 11 PRT Unknown mammalian 289 Leu Gln Leu Asn Leu Lys Val Tyr Asn Leu Val 1 5 10 290 11 PRT Unknown mammalian 290 Leu Gln Leu Lys His Lys Glu Asn Asn Leu Met 1 5 10 291 11 PRT Unknown mammalian 291 Leu Gln Lys Asn Leu Lys Glu Tyr Asn Met Val 1 5 10 292 11 PRT Unknown mammalian 292 Leu Gln Val Asn Leu Glu Glu Tyr His Leu Val 1 5 10 293 11 PRT Unknown mammalian 293 Leu Phe Leu Asn Leu Lys Glu Tyr Ser Leu Val 1 5 10 294 11 PRT Unknown mammalian 294 Leu Glu Leu Asn Leu Lys Val Tyr Asn Leu Val 1 5 10 295 11 PRT Unknown mammalian 295 Leu Pro Leu Asn Pro Lys Glu Tyr Ser Leu Val 1 5 10 296 11 PRT Unknown mammalian 296 Leu Pro Leu Asn Leu Ile Asp Phe Ser Leu Met 1 5 10 297 11 PRT Unknown mammalian 297 Leu Pro Arg Asn Leu Lys Glu Tyr Asp Leu Gly 1 5 10 298 11 PRT Unknown mammalian 298 Leu Arg Leu Asn Asp Ile Glu Ala Leu Leu Val 1 5 10 299 11 PRT Unknown mammalian 299 Leu Val Leu Asn Arg Ile Glu Tyr Asn Leu Leu 1 5 10 300 11 PRT Unknown mammalian 300 Leu His Leu Asn Met Ala Glu Val Ser Leu Val 1 5 10 301 11 PRT Unknown mammalian 301 Met Asn Leu Thr Leu Lys Glu Cys Asn Leu Val 1 5 10 302 11 PRT Unknown mammalian 302 Met Lys Leu Asn Val Ser Glu Ser Asn Leu Val 1

5 10 303 11 PRT Unknown mammalian 303 Leu Lys Arg Tyr Leu Lys Glu Ser Asn Leu Val 1 5 10 304 11 PRT Unknown mammalian 304 Leu Lys Arg Lys Leu Lys Glu Ser Asn Met Gly 1 5 10 305 11 PRT Unknown mammalian 305 Leu Lys Arg Lys Val Lys Glu Tyr Asn Leu Gly 1 5 10 306 19 DNA Unknown prokaryotic or eukaryotic 306 gaaaatcttc tctcatccg 19 307 11 PRT Unknown mammalian 307 Ile Leu Glu Asn Leu Lys Asp Cys Gly Leu Leu 1 5 10 308 11 PRT Unknown mammalian 308 Met Leu Asp Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 309 11 PRT Unknown mammalian 309 Ile Val Lys Asn Leu Glu Asp Cys Gly Leu Phe 1 5 10 310 11 PRT Unknown mammalian 310 Ile Arg Asp Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 311 11 PRT Unknown mammalian 311 Ile Ser Lys Asn Leu Arg Asp Cys Gly Leu Leu 1 5 10 312 11 PRT Unknown mammalian 312 Ile Leu Gln Asn Leu Lys Asp Cys Gly Leu Phe 1 5 10 313 11 PRT Unknown mammalian 313 Met Leu Asp Asn Leu Lys Ala Cys Gly Leu Phe 1 5 10 314 9 DNA Homo sapiens 314 gccgccacc 9 315 57 DNA Unknown mammalian 315 gatccgccgc caccatggga atcaagaaca acctgaagga ctgcggcctc ttctgaa 57 316 57 DNA Unknown mammalian 316 agctttcaga agaggccgca gtccttcagg ttgttcttga ttcccatggt ggcggcg 57 317 19 DNA Unknown mammalian 317 atccgccgcc accatggga 19 318 20 DNA Unknown mammalian 318 gcgaaaggag cggggcgcta 20 319 3 PRT Unknown mammalian 319 Ser Trp Val 1 320 4 PRT Unknown mammalian 320 Phe Val Asn Cys 1 321 4 PRT Unknown mammalian 321 Glu Val Arg Arg 1 322 3 PRT Unknown mammalian 322 Arg Val Gln 1 323 4 PRT Unknown mammalian 323 Arg Leu Thr Arg 1 324 3 PRT Unknown mammalian 324 Ser Arg Lys 1 325 4 PRT Unknown mammalian 325 Met Thr His Ser 1 326 4 PRT Unknown mammalian 326 Ser Gly Pro Gln 1 327 3 PRT Unknown mammalian 327 Met Leu Asn 1 328 3 PRT Unknown mammalian 328 Ser Ile Arg 1 329 4 PRT Unknown mammalian 329 Arg Trp Ile Val 1 330 3 PRT Unknown mammalian 330 Gly Gly His 1 331 4 PRT Unknown mammalian 331 Arg Ser Glu Val 1 332 4 PRT Unknown mammalian 332 Cys Glu Pro Gly 1 333 4 PRT Unknown mammalian 333 His Gln Met Ala 1 334 4 PRT Unknown mammalian 334 Val Pro Ser Pro 1 335 4 PRT Unknown mammalian 335 Gln Met Pro Asn 1 336 4 PRT Unknown mammalian 336 Met Trp Pro Ser 1 337 3 PRT Unknown mammalian 337 Cys Val Glu 1 338 4 PRT Unknown mammalian 338 Pro Arg Gln Leu 1 339 4 PRT Unknown mammalian 339 Val Arg Pro Ser 1 340 4 PRT Unknown mammalian 340 Ser Arg His Thr 1 341 4 PRT Unknown mammalian 341 Phe Phe Trp Val 1 342 4 PRT Unknown mammalian 342 Gln Arg Asp Thr 1 343 4 PRT Unknown mammalian 343 Asn Phe Arg Asn 1 344 4 PRT Unknown mammalian 344 Leu Pro Gln Met 1 345 4 PRT Unknown mammalian 345 Leu Ser Thr Asn 1 346 4 PRT Unknown mammalian 346 Leu Ser Arg Ser 1

Claims

1. A method of identifying a G protein coupled receptor (GPCR) signaling inhibitor, which comprises: (a) providing a first library comprising peptide members, wherein the primary sequences of said peptide members are based on the primary sequence of the native G protein peptide that binds to said GPCR on the G protein binding domain of said GPCR; (b) screening said peptide first library members for binding to said G protein binding domain of said GPCR in competition with a native peptide that comprises said primary sequence of the native G protein of (a), to identify peptide first library members that bind to said GPCR G protein binding domain with higher affinity than that of said native peptide; (c) selecting a high-affinity peptide first library member identified in (b); (d) providing a second library of member compounds; (e) screening said second library member compounds for binding to said GPCR G protein binding domain, wherein said screening is a binding assay performed in the presence of the peptide selected in (c), to determine whether a second library member compound binds to said GPCR G protein binding domain with equal or higher affinity than that of said second competitive peptide.

2. The method of claim 1, wherein said screening of (b) or (e) is testing for binding to a GPCR molecule that comprises at least the intracellular fragment of said GPCR.

3. The method of claim 1, wherein said native G protein peptide is selected from the group consisting of a G.alpha. subunit or carboxyl terminal fragment thereof.

4. The method of claim 3, wherein said native G protein peptide is a G.alpha. subunit carboxyl terminal fragment from about 7 to about 70 amino acids long.

5. The method of claim 3, wherein said native G protein peptide is a G.alpha. subunit carboxyl terminal fragment from about 9 to about 23 amino acids long.

6. The method of claim 3, wherein said native G protein peptide is a G.alpha. subunit carboxyl terminal fragment from about 11 amino acids long.

7. The method of claim 3, wherein said G protein subunit is a G.beta..gamma. dimer.

8. The method of claim 1, wherein said first library peptide members provide signal to detect binding.

9. The method of claim 1, wherein said first library is a combinatorial peptide library.

10. The method of claim 9, wherein said combinatorial peptide library is a protein-peptide fusion protein library.

11. The method of claim 10, wherein said protein-peptide fusion protein library is a maltose binding protein-peptide fusion protein library.

12. The method of claim 11, wherein said peptide library is a peptide display library.

13. The method of claim 1, wherein said second library of member compounds is a small molecule library.

14. A compound identified by a method of claim 1.

15. A method of selecting a G protein coupled receptor (GPCR) signaling inhibitor peptide, which comprises: (a) providing a library comprising peptide members, wherein the primary sequences of said peptide members are based on the primary sequence of the native G protein peptide that binds to said GPCR on the G protein binding domain of said GPCR; (b) screening said peptide library members for binding to said G protein binding domain of said GPCR in competition with a native peptide that comprises said primary sequence of the native G protein of (a), to identify peptide first library members that bind to said GPCR G protein binding domain with higher affinity than that of said native peptide; (c) selecting a high-affinity peptide first library member identified in (b).

16. The method of claim 15, wherein said screening of (b) is testing for binding to a GPCR molecule that comprises at least the intracellular fragment of said GPCR.

17. The method of claim 15, wherein said native G protein peptide is selected from the group consisting of a G.alpha. subunit or carboxyl terminal fragment thereof.

18. The method of claim 17, wherein said native G protein peptide is a G.alpha. subunit carboxyl terminal fragment from about 7 to about 70 amino acids long.

19. The method of claim 17, wherein said native G protein peptide is a G.alpha. subunit carboxyl terminal fragment from about 9 to about 23 amino acids long.

20. The method of claim 17, wherein said native G protein peptide is a G.alpha. subunit carboxyl terminal fragment from about 11 amino acids long.

21. The method of claim 17, wherein said G protein subunit is a G.beta..gamma. dimer.

22. The method of claim 15, wherein said first library peptide members provide signal to detect binding.

23. The method of claim 15, wherein said first library is a combinatorial peptide library.

24. The method of claim 23, wherein said combinatorial peptide library is a protein-peptide fusion protein library.

25. The method of claim 24, wherein said protein-peptide fusion protein library is a maltose binding protein-peptide fusion protein library.

26. The method of claim 25, wherein said peptide library is a peptide display library.

27. The method of claim 15, wherein said second library of member compounds is a small molecule library.

28. A compound identified by a method of claim 15.

29. A method of identifying a G protein coupled receptor (GPCR) signaling inhibitor, which comprises: (a) providing a library of candidate compounds to screen for binding to said G protein coupled receptor; (b) providing a peptide that binds to said GPCR G protein binding domain with higher affinity than that of its native peptide; (c) screening said library of candidate compounds for binding to said GPCR G protein binding domain in the presence of said peptide of (b), to determine whether a candidate compound binds to said GPCR G protein binding domain with equal or higher affinity than that of said peptide of (b).

30. The method of claim 29, wherein said screening of (c) is testing for binding to a GPCR molecule that comprises at least the intracellular fragment of said GPCR.

31. The method of claim 29, wherein said library of candidate compounds is a small molecule library.

32. A compound identified by a method of claim 29.

33. The method of claim 31, wherein said library of candidate compounds is a focused library of candidate compounds based on the structure of the peptide of (b).

34. The method of claim 31, wherein said library of candidate compounds of step (a) is a combinatorial library.

35. The method of claim 34, wherein said combinatorial library is a diverse small molecule library.

36. The method of claim 35, wherein said diverse small molecule combinational library comprises drug-like molecules.

37. The method of claim 35, wherein said diverse small molecule combinational library is a focused small molecule library.

38. The method of inhibiting G protein coupled receptor signaling in a cell having a G protein coupled receptor which comprises administering to said cell in vitro a compound identified according to a method of claim 1.

39. The method of inhibiting G protein coupled receptor signaling in a cell having a G protein coupled receptor which comprises administering to said cell in vitro a compound identified according to a method of claim 15.

40. The method of inhibiting G protein coupled receptor signaling in a cell having a G protein coupled receptor which comprises administering to said cell in vitro a compound identified according to a method of claim 29.

41. A compound identified by the method of claim 15, which comprises a peptide selected from the group consisting of SEQ ID NOS: 2, 13, 15, 17, 19, 21, 23, 25, 27, 30, 32, 34, 36, 38, 40, 42 and 45-111.

42. A compound selected from the group consisting of SEQ ID NOS: 2, 13, 15, 17, 19, 21, 23, 25, 27, 30, 32, 34, 36, 38, 40, 42 and 45-111.