Methods for Modulating an Immune Response by Modulating Krc Activity

Abstract

This invention demonstrates that KRC molecules have multiple important functions as modulating agents in regulating a wide variety of cellular processes including: inhibiting NFkB transactivation, increasing TNF-alpha induced apoptosis, inhibiting JNK activation, inhibiting endogenous TNF-alpha expression, promoting immune cell proliferation and immune cell activation (e.g., in Th1 cells and/or Th2), activating IL-2 expression e.g., by activating the AP-1 transcription factor, and increasing actin polymerization. The present invention also demonstrates that KRC interacts with TRAF. Furthermore, the present invention demonstrates that KRC physically interacts with the c-Jun component of AP-1 to control its degradation. The present invention also demonstrates that KRC is downstream of several lymphocyte membrane receptors, including TNFR, TCR and TGF.beta.R. Upon TNFR signaling, KRC associates with the adaptor protein TRAF2 to inhibit NFKB and JNK-dependent gene expression. Upon TCR stimulation, KRC expression is rapidly induced and KRC physically associates with the c-Jun transcription factor to augment AP-1 dependent gene transcription. KRC knock-out (KO) T cells have impaired production of AP-1-dependent genes such as CD69 and IL-2. Upon TCR stimulation KRC also associates with the Th2-specific transcription factor GATA3, and T cells lacking KRC have impaired production of GATA3 dependent Th2 cytokines, IL-4, IL-5 and IL-13. Finally, upon TGF.beta. receptor signaling, KRC physically associates with the transcription factor SMAD3 to activate IgA germline transcription in B cells, since KRC KO B cells have impaired IgA production and germline Ig.alpha. (GL.alpha.) gene transcription. Methods for identifying modulators of KRC activity are provided. Methods for modulating an immune response and KRC-associated disorders using agents that modulate KRC expression and/or activity are also provided.

Description

RELATED APPLICATIONS

[0001] This application is a National Stage of PCT/US2004/036641, filed Nov. 3, 2004, which is a continuation-in-part of U.S. application Ser. No. 10/701,401, filed Nov. 3, 2003, which claims the benefit of priority to PCT application PCT/U502/14166, filed May 3, 2002, which claims the benefit of U.S. Provisional Application Ser. No. 60/288,369, filed May 3, 2001. The entire contents of each of these applications are incorporated herein by this reference.

BACKGROUND OF THE INVENTION

[0002] Transcription factors are a group of molecules within the cell that function to connect the pathways from extracellular signals to intracellular responses. Immediately after an environmental stimulus, these proteins which reside predominantly in the cytosol are translocated to the nucleus where they bind to specific DNA sequences in the promoter elements of target genes and activate the transcription of these target genes. One family of transcription factors, the ZAS (zinc finger-acidic domain structures) DNA binding protein family is involved in the regulation of gene transcription, DNA recombination, and signal transduction (Mak, C. H., et al. 1998. Immunogenetics 48: 32-39).

[0003] Zinc finger proteins are identified by the presence of highly conserved Cys2His2 zinc fingers (Mak, C. H., et al. 1998. Immunogenetics 48: 32-39). The zinc fingers are an integral part of the DNA binding structure called the ZAS domain. The ZAS domain is comprised of a pair of zinc fingers, a glutamic acid/aspartic acid-rich acidic sequence and a serine/threonine rich sequence (Mak, C. H., et al. 1998. Immunogenetics 48: 32-39). The ZAS domains have been shown to interact with the kB like cis-acting regulatory elements found in the promoter or enhancer regions of genes. The ZAS proteins recognize nuclear factor kB binding sites which are present in the enhancer sequences of many genes, especially those involved in immune responses (Bachmeyer, et al. 1999. Nuc. Acid Res. 27, 643-648). The ZAS DNA binding proteins have been shown to be transcription regulators of these target genes (Bachmeyer, et. al. 1999. Nuc. Acid Res. 27, 643-648; Wu et al. 1998. Science 281, 998-1001).

[0004] The zinc finger transcription factor Kappa Recognition Component ("KRC") is a member of the ZAS DNA binding family of proteins (Bachmeyer, et al. 1999. Nuc. Acid Res. 27, 643-648; Wu et al. 1998. Science 281, 998-1001). The KRC gene was identified as a DNA binding protein for the heptameric consensus signal sequences involved in somatic V(D)J recombination of the immune receptor genes (Mak, C. H., et al. 1994. Nuc. Acid Res. 22: 383-390). KRC is a substrate for epidermal growth factor receptor kinase and p34cdc2 kinase in vitro (Bachmeyer, et al. 1999. Nuc. Acid Res. 27, 643-648). However, other functions of KRC and the signal transduction pathways that activate KRC in vivo were not known.

[0005] Gene-specific transcription factors provide a promising class of targets for novel therapeutics because they provide substantial specificity and are known to be involved in human disease. A number of extremely effective presently marketed drugs act, at least indirectly, by modulating gene transcription. For instance, in many cases of heart disease, the LDL receptor is pathogenically down-regulated at the level of transcription by intracellular sterol levels. The drug compactin, an inhibitor of HMG CoA reductase, functions by up-regulating transcription of the LDL receptor gene which leads to clearance of cholesterol from the blood stream.

[0006] In another example, transcription factors can be modulated to regulate an immune response. In autoimmune diseases, self-tolerance is lost and the immune system attacks "self" tissue as if it were a foreign target. Many autoimmune diseases are presently known, such as multiple sclerosis (MS), rheumatoid arthritis, insulin-dependent diabetes mellitus, hemolytic anemias, rheumatic fever, Crohn's disease, Guillain-Barre syndrome, psoriasis, glomerulonephritis, autoimmune hepatitis, multiple sclerosis, etc. In diseases such as these, inhibiting the immune response is desirable. In addition, inhibiting the body's immune response is beneficial in prevention, for example, of organ transplant rejection. Conversely, enhancing the immune response is beneficial in certain circumstances such as the treatment of AIDS, cancer, atherosclerosis and diabetic complications (Sen, P. et al. 1996. FASEB Journal 10:709-720, 1996). Urgently needed are efficient methods of identifying pharmacological agents or drugs which are active at the level of gene transcription. Specifically, agents for use modulating such cellular processes in T cells are needed to regulate the immune response. Agents and methods of using such agents in modulation of cell survival, proliferation, differentiation and/or motility would be of great benefit.

SUMMARY OF THE INVENTION

[0007] The present invention is based, at least in part, on the discovery that KRC molecules have multiple important functions as modulating agents in regulating a wide variety of cellular processes. The invention is based, at least in part, on the discovery that KRC inhibits NFkB transactivation, increases TNF-alpha induced apoptosis, inhibits JNK activation, inhibits endogenous TNF-alpha expression, promotes immune cell proliferation and immune cell activation (e.g., in T cells (such as Th1 and/or Th2 cells), B cells, or macrophages), activates IL-2 expression e.g., by activating the AP-1 transcription factor, and increases actin polymerization. The present invention also demonstrates that KRC interacts with TRAF. Furthermore, the present invention demonstrates that KRC physically interacts with the c-Jun component of AP-1 to control its degradation. The present invention also demonstrates that KRC is downstream of several lymphocyte membrane receptors, including TNFR, TCR and TGF.beta.R. Upon TNFR signaling, KRC associates with the adaptor protein TRAF2 to inhibit NFKB and JNK-dependent gene expression. Upon TCR stimulation, KRC expression is rapidly induced and KRC physically associates with the c-Jun transcription factor to augment AP-1 dependent gene transcription. KRC knock-out (KO) T cells have impaired production of AP-1-dependent genes such as CD69 and IL-2. Upon TCR stimulation KRC also associates with the Th2-specific transcription factor GATA3, and T cells lacking KRC have impaired production of GATA3 dependent Th2 cytokines, IL-4, IL-5 and IL-13. Finally, upon TGF.beta. receptor signaling, KRC physically associates with the transcription factor SMAD3 to activate IgA germline transcription in B cells, since KRC KO B cells have impaired IgA production and germline Ig.alpha. (GL.alpha.) gene transcription.

[0008] In one aspect, the invention pertains to a method for identifying a compound which modulates an interaction between a first and a second polypeptide comprising: (a) contacting a cell having a first polypeptide comprising a binding portion of a KRC polypeptide and a second polypeptide comprising a binding portion of a polypeptide selected from the group consisting of: Jun, GATA3, SMAD, or Runx2 in the presence and the absence of a test compound; and (b) determining the degree of interaction between the first and the second polypeptide in the presence and the absence of the test compound, to thereby identify a compound which modulates an interaction between a first and a second polypeptide.

[0009] In one embodiment, the first polypeptide comprises at least one KRC zinc finger domain. In one embodiment, the second polypeptide is a c-Jun polypeptide. In another embodiment, the second polypeptide is a SMAD2 polypeptide. In another embodiment, the second polypeptide is a SMAD3 polypeptide.

[0010] In one embodiment, the first polypeptide is derived from an exogenous source. In another embodiment, the second polypeptide is derived from an exogenous source.

[0011] In one embodiment, the cell is a yeast cell.

[0012] In one embodiment, determining the ability of the test compound to modulate the interaction of the first polypeptide and the second polypeptide comprises determining the ability of the compound to modulate growth of the yeast cell on nutritionally selective media.

[0013] In another embodiment, determining the ability of the test compound to modulate the interaction of the first polypeptide and the second polypeptide comprises determining the ability of the compound to modulate expression of a reporter gene in the yeast cell.

[0014] In one embodiment, determining the ability of the test compound to modulate the interaction of the first polypeptide and the second polypeptide comprises determining the ability of the test compound to modulate the coimmunoprecipitation of the first polypeptide and the second polypeptide.

[0015] In another embodiment, determining the ability of the test compound to modulate the interaction of the first polypeptide and the second polypeptide comprises determining the ability of the test compound to modulate signaling via a signal transduction pathway involving KRC in the cell.

[0016] In one embodiment, at least one of TNF.alpha. production, IL-2 production, AP-1 activity, Ras and Rac activity, actin polymerization, ubiquitination of AP-1, ubiquitination of TRAF, ubiquitination of Runx2, degradation of c-Jun, degradation of c-Fos degradation of SMAD, degradation of Runx2, degradation of GATA3, GATA3 expression, Th2 cell differentiation, Th2 cytokine production, IgA production, GL.alpha. transcription (Ig.alpha. chain germline transcription), and/or osteocalcin gene transcription is measured.

[0017] In one embodiment, ubiquitination or degradation of c-fos, c-Jun, SMAD3, GATA3 or Runx2 is measured.

[0018] In one embodiment, AP-1, TRAF2 or Runx2 ubiquitination is measured.

[0019] In one embodiment, the binding of first and second polypeptide is inhibited.

[0020] In one embodiment, the binding of first and second polypeptide is stimulated.

[0021] In another aspect, the invention pertains to a method of identifying a compound that modulates a mammalian KRC biological activity comprising: [0022] (a) contacting cells deficient in KRC or a molecule in a signaling pathway involving KRC with a test compound; and [0023] (b) determining the effect of the test compound on the KRC biological activity, the test compound being identified as a modulator of the biological activity based on the ability of the test compound to modulate the biological activity in the cells deficient in KRC or a molecule in a signaling pathway involving KRC to thereby identify a compound that modulates a mammalian KRC biological activity.

[0024] In one embodiment, the biological activity of KRC is selected from the group consisting of modulation of: modulation of a TGF.beta. signaling pathway, modulation of ubiquitination of AP-1, modulation of ubiquitination of TRAF, modulation of ubiquitination of Runx2, modulation of the degradation of c-Jun, modulation of the degradation of c-Fos, modulation of degradation of SMAD, modulation of degradation of Runx, modulation of degradation of GATA3, modulation of GATA3 expression, modulation of Th2 cell differentiation, modulation of Th2 cytokine production, modulation of IgA production, modulation of GL.alpha. transcription, or modulation of osteocalcin gene transcription.

[0025] In one embodiment, the cells are in a non-human animal deficient in KRC or a molecule in a signal transduction pathway involving KRC and the cells are contacted with the test compound by administering the test compound to the animal.

[0026] In one aspect, the invention pertains to a method of identifying compounds useful in modulating a biological activity of mammalian KRC comprising, a) providing an indicator composition comprising mammalian KRC or a molecule in a signal transduction pathway involving KRC; b) contacting the indicator composition with each member of a library of test compounds; c) selecting from the library of test compounds a compound of interest that modulates a biological activity of KRC or the molecule in a signal transduction pathway involving KRC; to thereby identify a compound that modulates a biological activity of mammalian KRC, wherein the biological activity of KRC is selected from the group consisting of: modulation of a TGF.beta. signaling pathway, modulation of ubiquitination of AP-1, modulation of ubiquitination of TRAF, modulation of ubiquitination of Runx2, modulation of the degradation of c-Jun, modulation of the degradation of c-Fos, modulation of degradation of SMAD, modulation of degradation of Runx, modulation of degradation of GATA3, modulation of GATA3 expression, modulation of Th2 cell differentiation, modulation of Th2 cytokine production, modulation of IgA production, modulation of GL.alpha. transcription, and modulation of osteocalcin gene transcription.

[0027] In one embodiment, the indicator composition is a cell that expresses KRC, and at least one molecule selected from the group consisting of: c-Jun, c-Fos, AP-1, GATA3, SMAD, and Runx2 protein.

[0028] In one embodiment, the indicator composition is a cell free composition.

[0029] In another embodiment, the invention pertains to a non-human animal, in which the gene encoding the KRC gene is misexpressed.

[0030] In one embodiment, the animal is a transgenic animal.

[0031] In one embodiment, the transgenic animal is a mouse.

[0032] In one embodiment, the KRC gene is disrupted by removal of DNA encoding. all or part of the KRC protein.

[0033] In one embodiment, the animal is homozygous for the disrupted gene.

[0034] In one embodiment, the animal is heterozygous for the disrupted gene.

[0035] In one embodiment, the animal is a transgenic mouse with a transgenic disruption of the KRC gene.

[0036] In one embodiment, the disruption is an insertion or deletion.

[0037] In one aspect, the invention pertains to a transgenic mouse comprising in its genome an exogenous DNA molecule that functionally disrupts a KRC gene of said mouse, wherein said mouse exhibits a phenotype characterized by impaired Th2 cell development, decreased Th2 cytokine production, impaired TGF.beta.R signaling in B cells, decreased IgA secretion and decreased transcription of the GLCC gene, relative to a wildtype mouse.

DETAILED DESCRIPTION OF THE INVENTION

[0038] The present invention is based, at least in part, on the discovery that KRC molecules regulate a wide variety of cellular processes, including inhibiting NFkB transactivation, increasing TNF-alpha induced apoptosis, inhibiting JNK activation, inhibiting endogenous TNF-alpha expression, activating immune cell proliferation and immune cell activation (e.g., in Th1 cells), activating IL-2 expression e.g., by activating the AP-1 transcription factor, and increasing actin polymerization.

[0039] The present invention also demonstrates that that KRC interacts with TRAF molecules. The interaction between KRC and TRAF involves the C domain of TRAF and amino acid residues 204 to 1055 of KRC. Furthermore, the present invention demonstrates that KRC physically interacts with the c-Jun component of AP-1 to control its degradation. KRC also interacts with GATA3, SMAD, e.g., SMAD2 and SMAD3, and Runx2 to control their degradation, and ubiquitinates TRAF and Runx2.

[0040] Furthermore, the present invention demonstrates upon TCR stimulation KRC also associates with the Th2-specific transcription factor GATA3, and T cells lacking KRC have impaired production of GATA3 dependent Th2 cytokines, such as, IL-4, IL-5 and IL-13. In addtion, upon TGF.beta. receptor signaling, KRC physically associates with members of the SMAD transcription factor family, e.g., SMAD2 and SMAD3, to activate IgA germline transcription in B cells.

[0041] The KRC protein (for .kappa.B binding and putative recognition component of the V(D)J Rss), referred to interchangeably herein as Schnurri-3 (Shn3), is a DNA binding protein comprised of 2282 amino acids. KRC has been found to be present in T cells, B cells, and macrophages. The KRC cDNA sequence is set forth in SEQ ID NO:1. The amino acid sequence of KRC is set forth in SEQ ID NO:2. KRC is a member of a family of zinc finger proteins that bind to the kB motif (Bachmeyer, C, et al., 1999. Nuc. Acids. Res. 27(2):643-648). Zinc finger proteins are divided into three classes represented by KRC and the two MHC Class I gene enhancer binding proteins, MBP1 and MBP2 (Bachmeyer, C, et al., 1999. Nuc. Acids. Res. 27(2):643-648). Zinc finger proteins are identified by the presence of highly conserved Cys2His2 zinc fingers. The zinc fingers are an integral part of the DNA binding structure called the ZAS domain. The ZAS domain is comprised of a pair of zinc fingers, a glutamic acid/aspartic acid-rich acidic sequence and a serine/threonine rich sequence. The ZAS domains have been shown to interact with the kB like cis-acting regulatory elements found in the promoter or enhancer regions of genes. The genes targeted by these zinc finger proteins are mainly involved in immune responses.

[0042] The KRC ZAS domain, in particular, has a pair of Cys2-His2 zinc fingers followed by a glutamic acid/aspartic acid-rich acidic sequence and five copies of the serine/threonine-proline-X-arginine/lysine sequence. Southwestern blotting experiments, electrophoretic mobility shift assays (EMSA) and methylation interference analysis has also demonstrated that KRC recombinant proteins bind to the .kappa.B motif as well as to the Rss sequence (Bachmeyer, et al. 1999. Nuc. Acid Res. 27, 643-648; Wu et al. 1998. Science 281, 998-1001) and do so in highly ordered complexes (Mak, C. H., et al. 1994. Nuc. Acid Res. 22, 383-390.; Wu et al. 1998. Science 281, 998-1001).

[0043] Similar zinc finger-acidic domain structures are present in human KBP1, MBP1 and MBP2, rat ATBP1 and ATBP2, and mouse .alpha.A-CRYBP proteins. KRC has recently been shown to regulate transcription of the mouse metastasis-associated gene, s100A4/mtsl*, by binding to the Sb element (a kB like sequence) of the gene. (Hjelmsoe, I., et al. 2000. J. Biol. Chem. 275(2): 913-920). KRC is regulated by post-translational modification as evidenced by the fact that pre-B cell nuclear protein kinases phosphorylate KRC proteins on serine and tyrosine residues. Phosphorylation increases DNA binding, providing a mechanism by which KRC may respond to signals transmitted from the cell surface (Bachmeyer, C, et al., 1999. Nuc. Acids. Res. 27(2):643-648). Two prominent ser/thr-specific protein kinases that play a central role in signal transduction are cyclic AMP-dependent protein kinase A (PKA) and the protein kinase C (PKC family). Numerous other serine/threonine specific kinases, including the family of mitogen-activated protein (MAP) kinases serve as important signal transduction proteins which are activated in either growth-factor receptor or cytokine receptor signaling. Other protein ser/thr kinases important for intracellular signaling are Calcium-dependent protein kinase (CaM-kinase II) and the c-raf-protooncogene. KRC is known to be a substrate for epidermal growth factor receptor kinase and p34cdc2 kinase in vitro.

[0044] The results of a yeast two hybrid screen using amino acid residues 204 to 1055 of KRC (which includes the third zinc finger) as bait demonstrate that KRC interacts with the TRAF family of proteins and that this interaction occurs through the TRAF C domain and that KRC interacts with higher affinity with TRAF2 than with TRAF5 and TRAF6. (See Example 1).

[0045] Recent research has lead to the isolation of polypeptide factors named TRAFs for tumor necrosis factor receptor associated factors, which participate in the TNFR signal transduction cascade. Six members of the TRAF family of proteins have been identified in mammalian cells (reviewed in Arch, R. H., et al. 1998. Genes Dev. 12, 2821-2830). All TRAF proteins, with the exception of TRAF1, contain an amino terminal RING finger domain with a characteristic pattern of cysteines and histidines that coordinate the binding of Zn2+ ions (Borden, K. L. B., et al. 1995. EMBO J14, 1532-1521), which is followed by a stretch of multiple zinc fingers. All TRAFs share a highly conserved carboxy-terminal domain (TRAF-C domain) which is required for receptor binding and can be divided into two parts, a highly conserved domain which mediates homo and heterodimerization of TRAF proteins and also the association of the adapter proteins with their associated receptors and an amino-terminal half that displays a coiled-coil configuration. TRAF molecules have distinct patterns of tissue distribution, are recruited by different cell surface receptors and have distinct functions as revealed most clearly by the analysis of TRAF-deficient mice (see Lomaga, M. A., et al. 1999. Genes Dev. 13, 1015-24; Nakano, H., et al. 1999. Proc. Natl. Acad. Sci. USA 96, 9803-9808; Nguyen, L. T., et al. 1999. Immunity 11, 379-389; Xu, Y., et al. 1996. Immunity 5, 407-415.; Yeh, W. C., et al. 1997. Immunity 7, 715-725).

[0046] Tumor necrosis factor (TNF) is a cytokine produced mainly by activated macrophages which elicits a wide range of biological effects. These include an important role in endotoxic shock and in inflammatory, immunoregulatory, proliferative, cytotoxic, and anti-viral activities (reviewed by Goeddel, D. V. et al., 1986. Cold Spring Harbor Symposia on Quantitative Biology 51: 597-609; Beutler, B. and Cerami, A., 1988. Ann. Rev. Biochem. 57: 505-518; Old, L. J., 1988. Sci. Am. 258(5): 59-75; Fiers, W. 1999. FEBS Lett. 285(2):199-212). The induction of the various cellular responses mediated by TNF is initiated by its interaction with two distinct cell surface receptors, an approximately 55 kDa receptor termed TNFR1 and an approximately 75 kDa receptor termed TNFR2. Human and mouse cDNAs corresponding to both receptor types have been isolated and characterized (Loetscher, H. et al., 1990. Cell 61:351; Schall, T. J. et al., 1990. Cell 61: 361; Smith, C. A. et al., 1990 Science 248: 1019; Lewis, M. et al., 1991. Proc. Natl. Acad. Sci. USA 88: 2830-2834; Goodwin, R. G. et al., 1991. Mol. Cell. Biol. 11:3020-3026).

[0047] TNF.alpha. binds to two distinct receptors, TNFR1 and TNFR2, but in most cell types NF.kappa.B activation and JNK/SAPK activation occur primarily through TNFR1. TNFR1 is known to interact with TRADD which functions as an adaptor protein for the recruitment of other proteins including RIP, a serine threonine kinase, and TRAF2. Of the six known TRAFs, TRAF2, TRAF5 and TRAF6 have all been linked to NF.kappa.B activation (Cao, Z., et al. 1996. Nature 383: 443-6; Rothe, M., et al. 1994. Cell 78: 681-692; Nakano, H., et al. 1996. J. Biol. Chem. 271:14661-14664), and TRAF2 in particular has been linked to activation of the JNK/SAPK proteins as shown unequivocally by the failure of TNF.alpha. to activate this MAP kinase in cells lacking TRAF2 or expressing a dominant negative form of TRAF2 (Yeh, W. C., et al. 1997. Immunity 7: 715-725; Lee, S. Y., et al. 1997. Immunity 7:1-20). Various aspects of the invention are described in further detail in the following subsections:

I. Definitions

[0048] As used herein, the term "KRC" , used interchangeably with "Shn3" refers to .kappa.B binding and putative recognition component of the V(D)J Rss. The nucleotide sequence of KRC is set forth in SEQ ID NO:1 and the amino acid sequence of KRC is set forth in SEQ ID NO:2. The amino acid sequence of the ZAS domain of KRC is set forth in amino acids 1497-2282 of SEQ ID NO:2 (SEQ ID NO:8). The amino acid sequence of KRC tr is shown in amino acid residues 204 to 1055 of SEQ ID NO:2. As used herein, the term "KRC", unless specifically used to refer a specific SEQ ID NO, will be understood to refer to a KRC family polypeptide as defined below.

[0049] "KRC family polypeptide" is intended to include proteins or nucleic acid molecules having a KRC structural domain or motif and having sufficient amino acid or nucleotide sequence identity with a KRC molecule as defined herein. Such family members can be naturally or non-naturally occurring and can be from the same or different species. For example, a family can contain a first protein of human origin, as well as other, distinct proteins of human origin or, alternatively, can contain homologues of non-human origin. Preferred members of a family may also have common functional characteristics. Preferred KRC polypeptides comprise one or more of the following KRC characteristics: a pair of Cys2-His2 zinc fingers followed by a Glu- and Asp-rich acidic domain and five copies of the ser/Thr-Pro-X-Arg/Lys sequence thought to bind DNA.

[0050] As used herein, the term "KRC activity", "KRC biological activity" or "activity of a KRC polypeptide" includes the ability to modulate an activity regulated by KRC or a signal transduction pathway involving KRC. For example, in one embodiment a KRC biological activity includes modulation of an immune response. Exemplary KRC activities include e.g., modulating: immune cell activation and/or proliferation (such as by modulating cytokine gene expression), cell survival (e.g., by modulating apoptosis), signal transduction via a signaling pathway (e.g., an NFkB signaling pathway, a JNK signaling pathway, and/or a TGF.beta. signaling pathway), actin polymerization, ubiquitination of AP-1, ubiquitination of TRAF, ubiquitination of Runx2, degradation of c-Jun, degradation of c-Fos, degradation of SMAD, degradation of Runx 2, degradation of GATA3, GATA3 expression, Th2 cell differentiation, Th2 cytokine production, IgA production, GL.alpha. transcription, and/or osteocalcin gene transcription.

[0051] As used herein, the various forms of the term "modulate" are intended to include stimulation (e.g., increasing or upregulating a particular response or activity) and inhibition (e.g., decreasing or downregulating a particular response or activity).

[0052] As described in the appended Examples, KRC increases immune cell activation and cytokine production. In addition, when KRC is overexpressed, it results in the inhibition of NFkB and JNK signaling pathways. Inhibition of these pathways is associated with cellular inflammatory and apoptotic responses. In one embodiment, the KRC activity is a direct activity, such as an association with a KRC-target molecule or binding partner. As used herein, a "target molecule", "binding partner" or "KRC binding partner" is a molecule with which a KRC protein binds or interacts in nature, such that KRC mediated function is achieved.

[0053] As used herein the term "TRAF" refers to TNF Receptor Associated Factor (See e.g., Wajant et al, 1999, Cytokine Growth Factor Rev 10:15-26). The "TRAF" family includes a family of cytoplasmic adapter proteins that mediate signal transduction from many members of the TNF-receptor superfamily and the interleukin-1 receptor (see e.g., Arch, R. H. et al., 1998, Genes Dev. 12:2821-2830). As used herein, the term "TRAF C domain" refers to the highly conserved sequence motif found in TRAF family members.

[0054] As used herein, the terms "TRAF interacting portion of a KRC molecule" or "c-Jun interacting portion of a KRC molecule" includes a region of KRC that interacts with TRAF or c-Jun. In a preferred embodiment, a region of KRC that interacts with TRAF or c-Jun is amino acid residues 204-1055 of SEQ ID NO:2 (SEQ ID NO:7). As used herein, the term "KRC interacting portion of a TRAF molecule" or "KRC interacting portion of a TRAF molecule" includes a region of TRAF or c-Jun that interacts with KRC. In a preferred embodiment, a region of TRAF that interacts with KRC is the TRAF C domain.

[0055] The term "interact" as used herein is meant to include detectable interactions between molecules, such as can be detected using, for example, a yeast two hybrid assay or coimmunoprecipitation. The term interact is also meant to include "binding" interactions between molecules. Interactions may be protein-protein or protein-nucleic acid in nature.

[0056] As used herein, the term "contacting" (i.e., contacting a cell e.g. an immune cell, with an compound) is intended to include incubating the compound and the cell together in vitro (e.g., adding the compound to cells in culture) or administering the compound to a subject such that the compound and cells of the subject are contacted in vivo. The term "contacting" is not intended to include exposure of cells to a KRC modulator that may occur naturally in a subject (i.e., exposure that may occur as a result of a natural physiological process).

[0057] As used herein, the term "test compound" includes a compound that has not previously been identified as, or recognized to be, a modulator of KRC activity and/or expression and/or a modulator of cell growth, survival, differentiation and/or migration.

[0058] The term "library of test compounds" is intended to refer to a panel comprising a multiplicity of test compounds.

[0059] As used herein, the term "cell free composition" refers to an isolated composition which does not contain intact cells. Examples of cell free compositions include cell extracts and compositions containing isolated proteins.

[0060] As used herein, an "antisense" nucleic acid comprises a nucleotide sequence which is complementary to a "sense" nucleic acid encoding a protein, e.g., complementary to the coding strand of a double-stranded cDNA molecule, complementary to an mRNA sequence or complementary to the coding strand of a gene. Accordingly, an antisense nucleic acid can hydrogen bond to a sense nucleic acid.

[0061] In one embodiment, nucleic acid molecule of the invention is an siRNA molecule. In one embodiment, a nucleic acid molecule of the invention mediates RNAi. RNA interference (RNAi) is a post-transcriptional, targeted gene-silencing technique that uses double-stranded RNA (dsRNA) to degrade messenger RNA (mRNA) containing the same sequence as the dsRNA (Sharp, P. A. and Zamore, P. D. 287, 2431-2432 (2000); Zamore, P. D., et al. Cell 101, 25-33 (2000). Tuschl, T. et al. Genes Dev. 13, 3191-3197 (1999); Cottrell T R, and Doering T L. 2003. Trends Microbiol. 11:37-43; Bushman F.2003. Mol Therapy. 7:9-10; McManus M T and Sharp P A. 2002. Nat Rev Genet. 3:737-47). The process occurs when an endogenous ribonuclease cleaves the longer dsRNA into shorter, e.g., 21- or 22-nucleotide-long RNAs, termed small interfering RNAs or siRNAs. The smaller RNA segments then mediate the degradation of the target mRNA. Kits for synthesis of RNAi are commercially available from, e.g. New England Biolabsor Ambion. In one embodiment one or more of the chemistries described above for use in antisense RNA can be employed in molecules that mediate RNAi.

[0062] As used herein, the term "immune response" includes immune cell-mediated (e.g., T cell and/or B cell-mediated) immune responses that are influenced by modulation of immune cell activation. Exemplary immune responses include B cell responses (e.g., antibody production, e.g., IgA production), T cell responses (e.g., proliferation, cytokine production and cellular cytotoxicity), and activation of cytokine responsive cells, e.g., macrophages. In one embodiment of the invention, an immune response is T cell mediated. In another embodiment of the invention, an immune response is B cell mediated. As used herein, the term "downregulation" with reference to the immune response includes a diminution in any one or more immune responses, preferably T cell responses, while the term "upregulation" with reference to the immune response includes an increase in any one or more immune responses, preferably T cell responses. It will be understood that upregulation of one type of immune response may lead to a corresponding downregulation in another type of immune response. For example, upregulation of the production of certain cytokines (e.g., IL-10) can lead to downregulation of cellular immune responses. In addition, it will be understood that KRC may have one effect on immune responses in the context of T cell receptor-mediated signaling, another in the context of TNF.alpha.-mediated signaling, and another in the context of TGF.beta.-mediated signaling.

[0063] As used herein, the term "immune cell" includes cells that are of hematopoietic origin and that play a role in the immune response immune cells include lymphocytes, such as B cells and T cells; natural killer cells; and myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes.

[0064] The terms "antigen presenting cell" and "APC", as used interchangeably herein, include professional antigen presenting cells (e.g., B lymphocytes, monocytes, dendritic cells, and Langerhans cells) as well as other antigen presenting cells (e.g., keratinocytes, endothelial cells, astrocytes, fibroblasts, and oligodendrocytes).

[0065] As used herein, the term "T cell" (i.e., T lymphocyte) is intended to include all cells within the T cell lineage, including thymocytes, immature T cells, mature T cells and the like, from a mammal (e.g., human). T cells include mature T cells that express either CD4 or CD8, but not both, and a T cell receptor. The various T cell populations described herein can be defined based on their cytokine profiles and their function.

[0066] As used herein "progenitor T cells" ("Thp") are pluripotent cells that express both CD4 and CD8.

[0067] As used herein, the term "naive T cells" includes T cells that have not been exposed to cognate antigen and so are not activated or memory cells. Naive T cells are not cycling and human naive T cells are CD45RA+. If naive T cells recognize antigen and receive additional signals depending upon but not limited to the amount of antigen, route of administration and timing of administration, they may proliferate and differentiate into various subsets of T cells, e.g., effector T cells.

[0068] As used herein, the term "differentiated" refers to T cells that have been contacted with a stimulating agent and includes effector T cells (e.g., Th1, Th2) and memory T cells. Differentiated T cells differ in expression of several surface proteins compared to naive T cells and secrete cytokines that activate other cells.

[0069] As used herein, the term "memory T cell" includes lymphocytes which, after exposure to antigen, become functionally quiescent and which are capable of surviving for long periods in the absence of antigen. Human memory T cells are CD45RA-.

[0070] As used herein, the term "effector T cell" includes T cells which function to eliminate antigen (e.g., by producing cytokines which modulate the activation of other cells or by cytotoxic activity). The term "effector T cell" includes T helper cells (e.g., Th1 and Th2 cells) and cytotoxic T cells. Th1 cells mediate delayed type hypersensitivity responses and macrophage activation while Th2 cells provide help to B cells and are critical in the allergic response (Mosmann and Coffman, 1989, Annu. Rev. Immunol. 7, 145-173; Paul and Seder, 1994, Cell 76, 241-251; Arthur and Mason, 1986, J. Exp. Med. 163, 774-786; Paliard et al., 1988, J. Immunol. 141, 849-855; Finkelman et al., 1988, J. Immunol. 141, 2335-2341). As used herein, the term " T helper type 1 response" (Th1 response) refers to a response that is characterized by the production of one or more cytokines selected from IFN-.gamma., IL-2, TNF, and lymphotoxin (LT) and other cytokines produced preferentially or exclusively by Th1 cells rather than by Th2 cells. As used herein, a "T helper type 2 response" (Th2 response) refers to a response by CD4.sup.+ T cells that is characterized by the production of one or more cytokines selected from IL-4, IL-5, IL-6 and IL-10, and that is associated with efficient B cell "help" provided by the Th2 cells (e.g., enhanced IgG1 and/or IgE production).

[0071] As used herein, the term "regulatory T cell" includes T cells which produce low levels of IL-2, IL-4, IL-5, and IL-12. Regulatory T cells produce TNF.alpha., TGF.beta., IFN-.gamma., and IL-10, albeit at lower levels than effector T cells. Although TGF.beta. is the predominant cytokine produced by regulatory T cells, the cytokine is produced at lower levels than in Th1 or Th2 cells, e.g., an order of magnitude less than in Th1 or Th2 cells. Regulatory T cells can be found in the CD4+CD25+ population of cells (see, e.g., Waldmann and Cobbold. 2001. Immunity. 14:399). Regulatory T cells actively suppress the proliferation and cytokine production of Th1, Th2, or naive T cells which have been stimulated in culture with an activating signal (e.g., antigen and antigen presenting cells or with a signal that mimics antigen in the context of MHC, e.g., anti-CD3 antibody plus anti-CD28 antibody).

[0072] As used herein, the term "receptor" includes immune cell receptors that bind antigen, complexed antigen (e.g., in the context of MHC molecules), or antibodies. Activating receptors include T cell receptors (TCRs), B cell receptors (BCRs), cytokine receptors, LPS receptors, complement receptors, and Fc receptors. For example, T cell receptors are present on T cells and are associated with CD3 molecules. T cell receptors are stimulated by antigen in the context of MHC molecules (as well as by polyclonal T cell activating reagents). T cell activation via the TCR results in numerous changes, e.g., protein phosphorylation, membrane lipid changes, ion fluxes, cyclic nucleotide alterations, RNA transcription changes, protein synthesis changes, and cell volume changes.

[0073] As used herein, the term "dominant negative" includes KRC molecules (e.g., portions or variants thereof) that compete with native (i.e., wild-type) KRC molecules, but which do not have KRC activity. Such molecules effectively decrease KRC activity in a cell.

[0074] As used herein, the term "inflammation" includes a response to injury which results in a dilation of the blood capillaries, a decrease in blood flow and an accumulation of leucocytes at the site of injury.

[0075] As used herein the term "apoptosis" includes programmed cell death which can be characterized using techniques which are known in the art. Apoptotic cell death can be characterized, e.g., by cell shrinkage, membrane blebbing and chromatin condensation culminating in cell fragmentation. Cells undergoing apoptosis also display a characteristic pattern of internucleosomal DNA cleavage. As used herein, the term "modulating apoptosis" includes modulating programmed cell death in a cell, such as a epithelial cell. As used herein, the term "modulates apoptosis" includes either up regulation or down regulation of apoptosis in a cell. Modulation of apoptosis is discussed in more detail below and can be useful in ameliorating various disorders, e.g., neurological disorders.

[0076] As used herein, the term "NFkB signaling pathway" refers to any one of the signaling pathways known in the art which involve activation or deactivation of the transcription factor NFkB, and which are at least partially mediated by the NFkB factor (Karin, 1998, Cancer J from Scientific American, 4:92-99; Wallach et al, 1999, Ann Rev of Immunology, 17:331-367). Generally, NFkB signaling pathways are responsive to a number of extracellular influences e.g. mitogens, cytokines, stress, and the like. The NFkB signaling pathways involve a range of cellular processes, including, but not limited to, modulation of apoptosis. These signaling pathways often comprise, but are by no means limited to, mechanisms which involve the activation or deactivation via phosphorylation state of an inhibitor peptide of NFkB (IkB), thus indirectly activating or deactivating NFkB.

[0077] As used herein, the term "JNK signaling pathway" refers to any one of the signaling pathways known in the art which involve the Jun amino terminal kinase (JNK) (Karin, 1998, Cancer J from Scientific American, 4:92-99; Wallach et al, 1999, Ann Rev of Immunology, 17:331-367). This kinase is generally responsive to a number of extracellular signals e.g. mitogens, cytokines, stress, and the like. The JNK signaling pathways mediate a range of cellular processes, including, but not limited to, modulation of apoptosis. In a preferred embodiment, JNK activation occurs through the activity of one or more members of the TRAF protein family (See, e.g., Wajant et al, 1999, Cytokine Growth Factor Rev 10:15-26).

[0078] As used herein, the term "TGF.beta. signaling pathway" refers to any one of the signaling pathways known in the art which involve transforming growth factor beta. A TGF.beta. signaling pathway is initiated when this molecule binds to and induces a heterodimeric cell-surface complex consisting of type I (T.beta.RI) and type II (T.beta.RII) serine/threonine kinase receptors. This heterodimeric receptor then propagates the signal through phosphorylation of downstream target SMAD proteins. There are three functional classes of SMAD protein, receptor-regulated SMADs (R-SMADs), e.g., SMAD2 and SMAD3, Co-mediator SMADs (Co-SMADs) and inhibitory SMADs (I-SMADs). Following phosphorylation by the heterodimeric receptor complex, the R-SMADs complex with the Co-SMAD and translocate to the nucleus, where in conjunction with other nuclear proteins, they regulate the transcription of target genes (Derynck, R., et al. (1998) Cell 95: 737-740). Reviewed in Massague, J. and Wotton, D. (2000) EMBO J. 19:1745.

[0079] The nucleotide sequence and amino acid sequence of human SMAD2, is described in, for example, GenBank Accession No. gi:20127489. The nucleotide sequence and amino acid sequence of murine SMAD2, is described in, for example, GenBank Accession No. gi:31560567. The nucleotide sequence and amino acid sequence of human SMAD3, is described in, for example, GenBank Accession No. gi:42476202. The nucleotide sequence and amino acid sequence of murine SMAD3, is described in, for example, GenBank Accession No. gi:31543221.

[0080] "GATA3" is a Th2-specific transcription factor that is required for the development of Th2 cells. GATA-binding proteins constitute a family of transcription factors that recognize a target site conforming to the consensus WGATAR (W=A or T and R=A or G). GATA3 interacts with SMAD3 following its phosphorylation by TGF.beta. signaling to induce the differentiation of T helper cells. The nucleotide sequence and amino acid sequence of human GATA3, is described in, for example, GenBank Accession Nos. gi:4503928 and gi:14249369. The nucleotide sequence and amino acid sequence of murine GATA3, is described in, for example, GenBank Accession No. gi:40254638. The domains of GATA3 responsible for specific DNA-binding site recognition (amino acids 303 to 348) and trans activation (amino acids 30 to 74) have been identified. The signaling sequence for nuclear localization of human GATA-3 is a property conferred by sequences within and surrounding the amino finger (amino acids 249 to 311) of the protein. Exemplary genes whose transcription is regulated by GATA3 include IL-5, IL-12, IL-13, and IL-12R.beta.2.

[0081] TGF.beta.also plays a key role in osteoblast differentiation and bone development and remodeling. Osteoblasts secrete and deposit TGF.beta. into the bone matrix and can respond to it, thus enabling possible autocrine modes of action. TGF.beta. regulates the proliferation and differentiation of osteoblasts both in vitro and in vivo; however, the effects of TGF.beta. on osteoblast differentiation depend on the extracellular milieu and the differentiation stage of the cells. TGF.beta. stimulates proliferation and early osteoblast differentiation, while inhibiting terminal differentiation. Accordingly, TGF.beta. has been reported to inhibit expression of alkaline phosphatase and osteocalcin, among other markers of osteoblast differentiation and function (Centrella et al., 1994 Endocr. Rev., 15, 27-39). Osteoblasts express cell surface receptors for TGF.beta. and its known effectors, Smad2 and Smad3.

[0082] As used herein, "osteocalcin", also called bone G1a protein, is a vitamin K-dependent, calcium-binding bone protein, the most abundant noncollagen protein in bone. Osteocalcin is specifically expressed in differentiated osteoblasts and odontoblasts. The TGF-.beta.-mediated decrease of osteocalcin has been shown to occur at the mRNA level and does not require new protein synthesis. It has also been shown that transcription from the osteocalcin promoter requires binding of the transcription factor CBFA1, also known as Runx2, to a response element, named OSE2, in the osteocalcin promoter.

[0083] Runx factors are DNA binding proteins that can facilitate tissue-specific gene activation or repression (Lutterbach, B., and S. W. Hiebert. (2000) Gene 245:223-235). Mammalian Runt-related genes are essential for blood, skelet al, and gastric development and are commonly mutated in acute leukemias and gastric cancers (Lund, A. H., and M. van Lohuizen. (2002) Cancer Cell. 1:213-215). Runx factors exhibit a tissue-restricted pattern of expression and are required for definitive hematopoiesis and osteoblast maturation. Runx proteins have recently been shown to interact through their C-terminal segment with Smads, a family of signaling proteins that regulate a diverse array of developmental and biological processes in response to transforming growth factor (TGF)-.beta./bone morphogenetic protein (BMP) family of growth factors. Moreover, subnuclear distribution of Runx proteins is mediated by the nuclear matrix-targeting signal, a protein motif present in the C terminus of Runx factors. Importantly, in vivo osteogenesis requires the C terminus of Runx2 containing the overlapping subnuclear targeting signal and the Smad interacting domain. The Runx and Smad proteins are jointly involved in the regulation of phenotypic gene expression and lineage commitment. Gene ablation studies have revealed that both Runx proteins and Smads are developmentally involved in hematopoiesis and osteogenesis. Furthermore, Runx2 and the BMP-responsive Smads can induce osteogenesis in mesenchymal pluripotent cells.

[0084] "Runx2" is one of three mammalian homologues of the Drosophila transcription factors Runt and Lozenge (Daga, A., et al.(l996) Genes Dev. 10:1194-1205). Runx2 is also expressed in T lymphocytes and cooperates with oncogenes c-myc, p53, and Pim1 to accelerate T-cell lymphoma development in mice (Blyth, K., et al. (2001) Oncogene 20:295-302).

[0085] Runx2 expression also plays a key role in osteoblast differentiation and skelet al formation. In addition to osteocalcin, Runx2 regulates expression of several other genes that are activated during osteoblast differentiation, including alkaline phosphatase, collagen, osteopontin, and osteoprotegerin ligand. These genes also contain Runx2--binding sites in their promoters. These observations suggest that Runx2 is an essential transcription factor for osteoblast differentiation. This hypothesis is strongly supported by the absence of bone formation in mouse embryos in which the cbfa1 gene was inactivated. Furthermore, cleidocranial dysplasia, a human disorder in which some bones are not fully developed, has been associated with mutations in a cbfa1 allele. In addition to its role in osteoblast differentiation, Runx2 has been implicated in the regulation of bone matrix deposition by differentiated osteoblasts. The expression of Runx2 is regulated by factors that influence osteoblast differentiation. Accordingly, BMPs can activate, while Smad2 and glucocorticoids can inhibit, Runx2 expression. In addition, Runx2 can bind to an OSE2 element in its own promoter, suggesting the existence of an autoregulatory feedback mechanism of transcriptional regulation during osteoblast differentiation. For a review, see, Alliston, et al.(2000) EMBO J 20:2254. The nucleotide sequence and amino acid sequence of human Runx2, is described in, for example, GenBank Accession No. gi:10863884. The nucleotide sequence and amino acid sequence of murine Runx2, is described in, for example, GenBank Accession No. gi:20806529.

[0086] As used herein, "AP-1" refers to the transcription factor activator protein 1 (AP-1) which is a family of DNA-binding factors that are composed of dimers of two proteins that bind to one another via a leucine zipper motif. The best characterized AP-1 factor comprises the proteins Fos and Jun. (Angel, P. and Karin, M. (1991) Biochim. Biophys. Acta 1072:129-157; Orengo, I. F., Black, H. S., et al. (1989) Photochem. Photobiol. 49:71-77; Curran, T. and Franza, B. R., Jr. (1988) Cell 55, 395-397). The AP-1 dimers bind to and transactivate promoter regions on DNA that contain cis-acting phorbol 12-tetradecanoate 13-acetate (TPA) response elements to induce transcription of genes involved in cell proliferation, metastasis, and cellular metabolism (Angel, P., et al. (1987) Cell 49, 729-739. AP-l is induced by a variety of stimuli and is implicated in the development of cancer and autoimmune disease. The nucleotide sequence and amino acid sequence of human AP-1, is described in, for example, GenBank Accession No. gi:20127489.

[0087] As used herein, the term "nucleic acid" is intended to include fragments or equivalents thereof (e.g., fragments or equivalents thereof KRC, TRAF, c-Jun, c-Fos, GATA3, Runx2, SMAD, GL.alpha.). The term "equivalent" is intended to include nucleotide sequences encoding functionally equivalent KRC proteins, i.e., proteins which have the ability to bind to the natural binding partner(s) of the KRC antigen. In a preferred embodiment, a functionally equivalent KRC protein has the ability to bind TRAF, e.g., TRAF2, in the cytoplasm of an immune cell, e.g., a T cell. In another preferred embodiment, a functionally equivalent KRC protein has the ability to bind Jun, e.g., c-Jun, in the nucleoplasm of an immune cell, e.g., a T cell. In another preferred embodiment, a functionally equivalent KRC protein has the ability to bind GATA3 in the nucleoplasm of an immune cell, e.g., a T cell. In yet another preferred embodiment, a functionally equivalent KRC protein has the ability to bind SMAD, e.g., SMAD2 and/or SMAD3, in the cytoplasm of an immune cell, e.g., a B cell. In yet another preferred embodiment, a functionally equivalent KRC has the ability to bind Runx2 in the nucleoplasm of an immune cell, e.g., a B cell.

[0088] An "isolated" nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid. For example, with regards to genomic DNA, the term "isolated" includes nucleic acid molecules which are separated from the chromosome with which the genomic DNA is naturally associated. Preferably, an "isolated" nucleic acid molecule is free of sequences which naturally flank the nucleic acid molecule (i.e., sequences located at the 5' and 3' ends of the nucleic acid molecule) in the genomic DNA of the organism from which the nucleic acid molecule is derived.

[0089] As used herein, an "isolated protein" or "isolated polypeptide" refers to a protein or polypeptide that is substantially free of other proteins, polypeptides, cellular material and culture medium when isolated from cells or produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. An "isolated" or "purified" protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the KRC protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of KRC protein in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced.

[0090] The nucleic acids of the invention can be prepared, e.g., by standard recombinant DNA techniques. A nucleic acid of the invention can also be chemically synthesized using standard techniques. Various methods of chemically synthesizing polydeoxynucleotides are known, including solid-phase synthesis which has been automated in commercially available DNA synthesizers (See e.g., Itakura et al. U.S. Pat. No. 4,598,049; Caruthers et al. U.S. Pat. No. 4,458,066; and Itakura U.S. Pat. Nos. 4,401,796 and 4,373,071, incorporated by reference herein).

[0091] As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments may be ligated. Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors" or simply "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification, "plasmid" and "vector" may be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.

[0092] As used herein, the term "host cell" is intended to refer to a cell into which a nucleic acid molecule of the invention, such as a recombinant expression vector of the invention, has been introduced. The terms "host cell" and "recombinant host cell" are used interchangeably herein. It should be understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein. Preferably a host cell is a mammalian cell, e.g., a human cell. In particularly preferred embodiments, it is a epithelial cell.

[0093] As used herein, the term "transgenic cell" refers to a cell containing a transgene.

[0094] As used herein, a "transgenic animal" includes an animal, e.g., a non-human mammal, e.g., a swine, a monkey, a goat, or a rodent, e.g., a mouse, in which one or more, and preferably essentially all, of the cells of the animal include a transgene. The transgene is introduced into the cell, directly or indirectly by introduction into a precursor of the cell, e.g., by microinjection, transfection or infection, e.g., by infection with a recombinant virus. The term genetic manipulation includes the introduction of a recombinant DNA molecule. This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA.

[0095] As used herein, the term "rodent" refers to all members of the phylogenetic order Rodentia.

[0096] As used herein, the term "misexpression" includes a non-wild type pattern of gene expression. Expression as used herein includes transcriptional, post transcriptional, e.g., mRNA stability, translational, and post translational stages. Misexpression includes: expression at non-wild type levels, i.e., over or under expression; a pattern of expression that differs from wild type in terms of the time or stage at which the gene is expressed, e.g., increased or decreased expression (as compared with wild type) at a predetermined developmental period or stage; a pattern of expression that differs from wild type in terms of decreased expression (as compared with wild type) in a predetermined cell type or tissue type; a pattern of expression that differs from wild type in terms of the splicing size, amino acid sequence, post-translational modification, or biological activity of the expressed polypeptide; a pattern of expression that differs from wild type in terms of the effect of an environmental stimulus or extracellular stimulus on expression of the gene, e.g., a pattern of increased or decreased expression (as compared with wild type) in the presence of an increase or decrease in the strength of the stimulus. Misexpression includes any expression from a transgenic nucleic acid. Misexpression includes the lack or non-expression of a gene or transgene, e.g., that can be induced by a deletion of all or part of the gene or its control sequences.

[0097] As used herein, the term "knockout" refers to an animal or cell therefrom, in which the insertion of a transgene, e.g., an exogenous DNA molecule, disrupts an endogenous gene in the animal or cell therefrom. This disruption can essentially eliminate KRC in the animal or cell. In preferred embodiments, misexpression of the gene encoding the KRC protein is caused by disruption of the KRC gene. For example, the KRC gene can be disrupted through removal of DNA encoding all or part of the protein.

[0098] In preferred embodiments, the animal can be heterozygous or homozygous for a misexpressed KRC gene, e.g., it can be a transgenic animal heterozygous or homozygous for a KRC transgene.

[0099] In preferred embodiments, the animal is a transgenic mouse with a transgenic disruption of the KRC gene, preferably an insertion or deletion, which inactivates the gene product.

[0100] In another aspect, the invention features, a nucleic acid molecule which, when introduced into an animal or cell, results in the misexpression of the KRC gene in the animal or cell. In preferred embodiments, the nucleic acid molecule, includes a KRC nucleotide sequence which includes a disruption, e.g., an insertion or deletion and preferably the insertion of a marker sequence. The nucleotide sequence of the wild type KRC is known in the art and described in, for example, Mak, C. H., et al. (1998) Immunogenetics 48:32-39, the contents of which are incorporated herein by reference.

[0101] As used herein, the term "marker sequence" refers to a nucleic acid molecule that (a) is used as part of a nucleic acid construct (e.g., the targeting construct) to disrupt the expression of the gene of interest (e.g., the KRC gene) and (b) is used to identify those cells that have incorporated the targeting construct into their genome. For example, the marker sequence can be a sequence encoding a protein which confers a detectable trait on the cell, such as an antibiotic resistance gene, e.g., neomycin resistance gene, or an assayable enzyme not typically found in the cell, e.g., alkaline phosphatase, horseradish peroxidase, luciferase, beta-galactosidase and the like.

[0102] As used herein, "disruption of a gene" refers to a change in the gene sequence, e.g., a change in the coding region. Disruption includes: insertions, deletions, point mutations, and rearrangements, e.g., inversions. The disruption can occur in a region of the native KRC DNA sequence (e.g., one or more exons) and/or the promoter region of the gene so as to decrease or prevent expression of the gene in a cell as compared to the wild-type or naturally occurring sequence of the gene. The "disruption" can be induced by classical random mutation or by site directed methods. Disruptions can be transgenically introduced. The deletion of an entire gene is a disruption. Preferred disruptions reduce KRC levels to about 50% of wild type, in heterozygotes or essentially eliminate KRC in homozygotes.

[0103] As used herein, the term "antibody" is intended to include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site which binds (immunoreacts with) an antigen, such as Fab and F(ab').sub.2 fragments, single chain antibodies, intracellular antibodies, scFv, Fd, or other fragments. Preferably, antibodies of the invention bind specifically or substantially specifically to KRC, TRAF, c-Jun, c-Fos, GATA3, SMAD, or Runx2, molecules (i.e., have little to no cross reactivity with non-KRC, non-TRAF, non-c-Jun, non-c-Fos, non-GATA3, non-SMAD, or non-Runx2, molecules). The terms "monoclonal antibodies" and "monoclonal antibody composition", as used herein, refer to a population of antibody molecules that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of an antigen, whereas the term "polyclonal antibodies" and "polyclonal antibody composition" refer to a population of antibody molecules that contain multiple species of antigen binding sites capable of interacting with a particular antigen. A monoclonal antibody compositions thus typically display a single binding affinity for a particular antigen with which it immunoreacts.

[0104] As used herein, the term "disorders that would benefit from the modulation of KRC activity or expression" or "KRC associated disorder" includes disorders in which KRC activity is aberrant or which would benefit from modulation of a KRC activity. Preferably, KRC associated disorders involve aberrant proliferation of cells, e.g., excessive or unwanted proliferation of cells or deficient proliferation of cells. In one embodiment, KRC associated disorders are disorders such as inflammation. Examples of KRC associated disorders include: disorders involving aberrant or unwanted proliferation of cells, e.g., inflammation, autoimmunity, neoplasia, or cell death, e.g., apoptosis, or necrosis. KRC associated disorders may also include disorders that have been linked generally to aberrant TGF.beta. activity or function, including, for example, B cell chronic lymphocytic leukemia (B-CLL). Further examples of KRC associated disorders include carcinomas, adenocarcinomas, leukemias, lymphomas, and other neoplasias. KRC disorders may also include disorders that have been linked generally to aberrant TNF receptor activity or function, including Crohn's Disease (Baert and Rutgeerts, 1999, Int J Colorectal Dis, 14:47-51) and certain cardiovascular diseases (Ferrari, 1999, Pharmacol Res, 40:97-105). They may also include disorders characterized by uncontrolled or aberrant levels of apoptosis, for example myelokathexis (Aprikyan et al., 2000, Blood, 95:320-327), and autoimmune lymphoproliferative syndrome (Jackson and Puck, 1999, Curr Op Pediatr, 11:521-527; Straus et al., 1999, Ann Intern Med, 130:591-601). KRC associated disorders may also include metabolic bone disorders, such as, but not limited to, osteoporosis, osteomalacia, skelet al changes of hyperparathyroidism and chronic renal failure (renal osteodystrophy) and osteitis deformans (Paget's disease of bone).

[0105] In one embodiment, small molecules can be used as test compounds. The term "small molecule" is a term of the art and includes molecules that are less than about 7500, less than about 5000, less than about 1000 molecular weight or less than about 500 molecular weight. In one embodiment, small molecules do not exclusively comprise peptide bonds. In another embodiment, small molecules are not oligomeric. Exemplary small molecule compounds which can be screened for activity include, but are not limited to, peptides, peptidomimetics, nucleic acids, carbohydrates, small organic molecules (e.g., Cane et al. 1998. Science 282:63), and natural product extract libraries. In another embodiment, the compounds are small, organic non-peptidic compounds. In a further embodiment, a small molecule is not biosynthetic. For example, a small molecule is preferably not itself the product of transcription or translation.

[0106] Various aspects of the invention are described in further detail below:

II. Screening Assays to Identify KRC Modulating Agents

[0107] Modulators of KRC activity can be known (e.g., dominant negative inhibitors of KRC activity, antisense KRC intracellular antibodies that interfere with KRC activity, peptide inhibitors derived from KRC) or can be identified using the methods described herein. The invention provides methods (also referred to herein as "screening assays") for identifying other modulators, i.e., candidate or test compounds or agents (e.g., peptidomimetics, small molecules or other drugs) which modulate KRC activity and for testing or optimizing the activity of other agents.

[0108] For example, in one embodiment, molecules which bind, e.g., to KRC or a molecule in a signaling pathway involving KRC (e.g., TRAF, NF-kB, JNK, GATA3, SMAD, Runx2, or AP-1)or have a stimulatory or inhibitory effect on the expression and or activity of KRC or a molecule in a signal transduction pathway involving KRC can be identified. For example, c-Jun, NF-kB, TRAF, GATA3, SMAD, Runx2, and JNK function in a signal transduction pathway involving KRC, therefore, any of these molecules can be used in the subject screening assays. Although the specific embodiments described below in this section and in other sections may list one of these molecules as an example, other molecules in a signal transduction pathway involving KRC can also be used in the subject screening assays.

[0109] In one embodiment, the ability of a compound to directly modulate the expression, post-translational modification (e.g., phosphorylation), or activity of KRC is measured in an indicator composition using a screening assay of the invention.

[0110] The indicator composition can be a cell that expresses the KRC protein or a molecule in a signal transduction pathway involving KRC, for example, a cell that naturally expresses or, more preferably, a cell that has been engineered to express the protein by introducing into the cell an expression vector encoding the protein. Preferably, the cell is a mammalian cell, e.g., a human cell. In one embodiment, the cell is a T cell. In another embodiment, the cell is a B cell. In another embodiment, the cell is a osteoblast. Alternatively, the indicator composition can be a cell-free composition that includes the protein (e.g., a cell extract or a composition that includes e.g., either purified natural or recombinant protein).

[0111] Compounds identified using the assays described herein can be useful for treating disorders associated with aberrant expression, post-translational modification, or activity of KRC or a molecule in a signaling pathway involving KRC e.g: disorders that would benefit from modulation of TNF.alpha. production, modulation of IL-2 production, modulation of a JNK signaling pathway, modulation of an NFkB signaling pathway, modulation of a TGF.beta. signaling pathway, modulation of AP-1 activity, modulation of Ras and Rac activity, modulation of actin polymerization, modulation of ubiquitination of AP-1, modulation of ubiquitination of TRAF, modulation of ubiquitination of Runx2, modulation of the degradation of c-Jun, modulation of the degradation of c-Fos, modulation of degradation of SMAD, modulation of degradation of Runx2, modulation of degradation of GATA3, modulation of GATA3 expression, modulation of Th2 cell differentiation, modulation of Th2 cytokine production, modulation of IgA production, modulation of GL.alpha. transcription (Ig.alpha. chain germline transcription), and/or modulation of osteocalcin gene transcription.

[0112] Conditions that can benefit from modulation of a signal transduction pathway involving KRC include autoimmune disorders as well as malignancies, immunodeficiency disorders and metabolic bone diseases. Compounds which modulate KRC expression and/or activity can also be used to modulate the immune response.

[0113] The subject screening assays can be performed in the presence or absence of other agents. In one embodiment, the subject assays are performed in the presence of an agent that provides a T cell receptor-mediated signal. In another embodiment, the subject assays are performed in the presence of an agent that provides a B cell receptor-mediated signal

[0114] In another aspect, the invention pertains to a combination of two or more of the assays described herein. For example, a modulating agent can be identified using a cell-based or a cell-free assay, and the ability of the agent to modulate the activity of KRC or a molecule in a signal transduction pathway involving KRC can be confirmed in vivo, e.g., in an animal such as an animal model for multiple myeloma, neoplastic diseases, renal cell carcinoma, B-CLL, metabolic bone disease, or autoimmune diseases.

[0115] Moreover, a modulator of KRC or a molecule in a signaling pathway involving KRC identified as described herein (e.g., an antisense nucleic acid molecule, or a specific antibody, or a small molecule) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such a modulator. Alternatively, a modulator identified as described herein can be used in an animal model to determine the mechanism of action of such a modulator.

[0116] In another embodiment, it will be understood that similar screening assays can be used to identify compounds that indirectly modulate the activity and/or expression of KRC e.g., by performing screening assays such as those described above using molecules with which KRC interacts, e.g., molecules that act either upstream or downstream of KRC in a signal transduction pathway.

[0117] The cell based and cell free assays of the invention are described in more detail below.

[0118] A. Cell Based Assays

[0119] The indicator compositions of the invention can be cells that expresses at least one of a KRC protein or non-KRC protein in the KRC signaling pathway (such as, e.g., TRAF, NF-kB, JNK, Jun, TGF.beta., GATA3, SMAD, Runx2, or AP-1) for example, a cell that naturally expresses the endogenous molecule or, more preferably, a cell that has been engineered to express an exogenous KRC, TRAF, NF-kB, JNK, Jun, TGF.beta., GATA3, SMAD, Runx2, or AP-1 protein by introducing into the cell an expression vector encoding the protein(s). Alternatively, the indicator composition can be a cell-free composition that includes at least one of a KRC or a non-KRC protein such as TRAF, NF-kB, JNK, Jun, TGF.beta. , GATA3, SMAD, Runx2, or AP-1 (e.g., a cell extract from a cell expressing the protein or a composition that includes purified KRC, TRAF, NF-kB, JNK, Jun, TGF.beta. , GATA3, SMAD, Runx2, or AP-1 protein, either natural or recombinant protein).

[0120] Compounds that modulate expression and/or activity of KRC, or a non-KRC protein that acts upstream or downstream of can be identified using various "read-outs."

[0121] For example, an indicator cell can be transfected with an expression vector, incubated in the presence and in the absence of a test compound, and the effect of the compound on the expression of the molecule or on a biological response regulated by can be determined. The biological activities of include activities determined in vivo, or in vitro, according to standard techniques. Activity can be a direct activity, such as an association with a target molecule or binding partner (e.g., a protein such as the Jun, e.g., c-Jun, TRAF, e.g., TRAF2, GATA3, SMAD, e.g., SMAD2, SMAD3, protein. Alternatively, activity is an indirect activity, such as a cellular signaling activity occurring downstream of the interaction of the protein with an target molecule or a biological effect occurring as a result of the signaling cascade triggered by that interaction. For example, biological activities of KRC described herein include: modulation of TNF.alpha. production, modulation of IL-2 production, modulation of a JNK signaling pathway, modulation of an NFkB signaling pathway, modulation of a TGF.beta. signaling pathway, modulation of AP-1 activity, modulation of Ras and Rac activity, modulation of actin polymerization, modulation of ubiquitination of AP-1, modulation of ubiquitination of TRAF2, modulation of ubiquitination of Runx2, modulation of the degradation of c-Jun, modulation of the degradation of c-Fos, modulation of degradation of SMAD3, modulation of degradation of Runx 2, modulation of degradation of GATA3, modulation of effector T cell fuinction, modulation of T cell anergy, modulation of apoptosis, or modulation of T cell differentiation, and/or modulation of IgA germline transcription.

[0122] To determine whether a test compound modulates KRC protein expression, in vitro transcriptional assays can be performed. In one example of such an assay, a regulatory sequence (eg., the fuill length promoter and enhancer) of KRC can be operably linked to a reporter gene such as chloramphenicol acetyltransferase (CAT), GFP, or luciferase and introduced into host cells. Other techniques are known in the art.

[0123] As used interchangeably herein, the terms "operably linked" and "operatively linked" are intended to mean that the nucleotide sequence is linked to a regulatory sequence in a manner which allows expression of the nucleotide sequence in a host cell (or by a cell extract). Regulatory sequences are art-recognized and can be selected to direct expression of the desired protein in an appropriate host cell. The term regulatory sequence is intended to include promoters, enhancers, polyadenylation signals and other expression control elements. Such regulatory sequences are known to those skilled in the art and are described in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transfected and/or the type and/or amount of protein desired to be expressed.

[0124] A variety of reporter genes are known in the art and are suitable for use in the screening assays of the invention. Examples of suitable reporter genes include those which encode chloramphenicol acetyltransferase, beta-galactosidase, alkaline phosphatase, green fluorescent protein, or luciferase. Standard methods for measuring the activity of these gene products are known in the art.

[0125] A variety of cell types are suitable for use as an indicator cell in the screening assay. Preferably a cell line is used which expresses low levels of endogenous KRC (or, e.g., TRAF, Fos, Jun, NF-kB, TGF.beta., GATA3, SMAD, and/or Runx2) and is then engineered to express recombinant protein. Cells for use in the subject assays include both eukaryotic and prokaryotic cells. For example, in one embodiment, a cell is a bacterial cell. In another embodiment, a cell is a fungal cell, such as a yeast cell. In another embodiment, a cell is a vertebrate cell, e.g., an avian cell or a mammalian cell (e.g., a murine cell, or a human cell).

[0126] In one embodiment, the level of expression of the reporter gene in the indicator cell in the presence of the test compound is higher than the level of expression of the reporter gene in the indicator cell in the absence of the test compound and the test compound is identified as a compound that stimulates the expression of KRC (or, e.g., TRAF, Fos, Jun, NF-kB, TGF.beta., GATA3, SMAD, and/or Runx2). In another embodiment, the level of expression of the reporter gene in the indicator cell in the presence of the test compound is lower than the level of expression of the reporter gene in the indicator cell in the absence of the test compound and the test compound is identified as a compound that inhibits the expression of KRC (or, e.g., TRAF, Fos, Jun, NF-kB, TGF.beta., GATA3, SMAD, and/or Runx2).

[0127] In one embodiment, the invention provides methods for identifying compounds that modulate cellular responses in which KRC is involved.

[0128] In one embodiment differentiation of cells, e.g., T cells, can be used as an indicator of modulation of KRC or a signal transduction pathway involving KRC. Cell differentiation can be monitored directly (e.g. by microscopic examination of the cells for monitoring cell differentiation), or indirectly, e.g., by monitoring one or more markers of cell differentiation (e.g., an increase in mRNA for a gene product associated with cell differentiation, or the secretion of a gene product associated with cell differentiation, such as the secretion of a protein (e.g., the secretion of cytokines) or the expression of a cell surface marker (such as CD69). Standard methods for detecting mRNA of interest, such as reverse transcription-polymerase chain reaction (RT-PCR) and Northern blotting, are known in the art. Standard methods for detecting protein secretion in culture supernatants, such as enzyme linked immunosorbent assays (ELISA), are also known in the art. Proteins can also be detected using antibodies, e.g., in an immunoprecipitation reaction or for staining and FACS analysis.

[0129] In another embodiment, the ability of a compound to modulate effector T cell function can be determined. For example, in one embodiment, the ability of a compound to modulate T cell proliferation, cytokine production, and/or cytotoxicity can be measured using techniques well known in the art.

[0130] In one embodiment, the ability of a compound to modulate IL-2 production can be determined. Production of IL-2 can be monitored, for example, using Northern or Western blotting. IL-2 can also be detected using an ELISA assay or in a bioassay, e.g., employing cells which are responsive to IL-2 (e.g., cells which proliferate in response to the cytokine or which survive in the presence of the cytokine) using standard techniques.

[0131] In another embodiment, the ability of a compound to modulate apoptosis can be determined. Apoptosis can be measured in the presence or the absence of Fas-mediated signals. In one embodiment, cytochrome C release from mitochondria during cell apoptosis can be detected, e.g., plasma cell apoptosis (as described in, for example, Bossy-Wetzel E. et al. (2000) Methods in Enzymol. 322:235-42). Other exemplary assays include: cytofluorometric quantitation of nuclear apoptosis induced in a cell-free system (as described in, for example, Lorenzo H. K. et al. (2000) Methods in Enzymol. 322:198-201); apoptotic nuclease assays (as described in, for example, Hughes F. M. (2000) Methods in Enzymol. 322:47-62); analysis of apoptotic cells, e.g., apoptotic plasma cells, by flow and laser scanning cytometry (as described in, for example, Darzynkiewicz Z. et al. (2000) Methods in Enzymol. 322:18-39); detection of apoptosis by annexin V labeling (as described in, for example, Bossy-Wetzel E. et al. (2000) Methods in Enzymol. 322:15-18); transient transfection assays for cell death genes (as described in, for example, Miura M. et al. (2000) Methods in Enzymol. 322:480-92); and assays that detect DNA cleavage in apoptotic cells, e.g., apoptotic plasma cells (as described in, for example, Kauffman S. H. et al. (2000) Methods in Enzymol. 322:3-15). Apoptosis can also be measured by propidium iodide staining or by TUNEL assay. In another embodiment, the transcription of genes associated with a cell signaling pathway involved in apoptosis (e.g., JNK) can be detected using standard methods.

[0132] In another embodiment, mitochondrial inner membrane permeabilization can be measured in intact cells by loading the cytosol or the mitochondrial matrix with a die that does not normally cross the inner membrane, e.g., calcein (Bernardi et al. 1999. Eur. J. Biochem. 264:687; Lemasters, J. J. et al. 1998. Biochem. Biophys. Acta 1366:177. In another embodiment, mitochondrial inner membrane permeabilization can be assessed, e.g., by determining a change in the mitochondrial inner membrane potential (.DELTA..PSI.m). For example, cells can be incubated with lipophilic cationic fluorochromes such as DiOC6 (Gross et al. 1999. Genes Dev. 13:1988) (3,3'dihexyloxacarbocyanine iodide) or JC-1(5,5',6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazolylcarbocyanine iodide). These dyes accumulate in the mitochondrial matrix, driven by the .PSI.m. Dissipation results in a reduction of the fluorescence intensity (e.g., for DiOC6 (Gross et al. 1999. Genes Dev. 13:1988) or a shift in the emission spectrum of the dye. These changes can be measured by cytofluorometry or microscopy.

[0133] In yet another embodiment, the ability of a compound to modulate translocation of KRC to the nucleus can be determined. Translocation of KRC to the nucleus can be measured, e.g., by nuclear translocation assays in which the emission of two or more fluorescently-labeled species is detected simultaneously. For example, the cell nucleus can be labeled with a known fluorophore specific for DNA, such as Hoechst 33342. The KRC protein can be labeled by a variety of methods, including expression as a fusion with GFP or contacting the sample with a fluorescently-labeled antibody specific for KRC. The amount KRC that translocates to the nucleus can be determined by determining the amount of a first fluorescently-labeled species, i.e., the nucleus, that is distributed in a correlated or anti-correlated manner with respect to a second fluorescently-labeled species, i.e., KRC, as described in U.S. Pat. No. 6,400,487, the contents of which are hereby incorporated by reference.

[0134] In one embodiment, the effect of a compound on a JNK signaling pathway can be determined. The JNK group of MAP kinases is activated by exposure of cells to environmental stress or by treatment of cells with pro-inflammatory cytokines. A combination of studies involving gene knockouts and the use of dominant-negative mutants have implicated both MKK4 and MKK7 in the phosphorylation and activation of JNK. Targets of the JNK signal transduction pathway include the transcription factors ATF2 and c-Jun. JNK binds to an NH.sub.2-terminal region of ATF2 and c-Jun and phosphorylates two sites within the activation domain of each transcription factor, leading to increased transcriptional activity. JNK is activated by dual phosphorylation on Thr-183 and Tyr-185. To determine the effect of a compound on a JNK signal transduction pathway, the ability of the compound to modulate the activation status of various molecules in the signal transduction pathway can be determined using standard techniques. For example, in one embodiment, the phosphorylation status of JNK can be examined by immunoblotting with the anti-ACTIVE-JNK antibody (Promega), which specifically recognizes the dual phosphorylated TPY motif.

[0135] In another embodiment, the effect of a compound on an NFkB signal transduction pathway can be determined. The ability of the compound to modulate the activation status of various components of the NFkB pathway can be determined using standard techniques. NFkB constitutes a family of Rel domain-containing transcription factors that play essential roles in the regulation of inflammatory, anti-apoptotic, and immune responses. The function of the NFkB/Rel family members is regulated by a class of cytoplasmic inhibitory proteins termed IBs that mask the nuclear localization domain of NFkB causing its retention in the cytoplasm. Activation of NFkB by TNF-.alpha. and IL-1 involves a series of signaling intermediates, which may converge on the NFkB-inducing kinase (NIK). This kinase in turn activates the IB kinase (IKK) isoforms. These IKKs phosphorylate the two regulatory serines located in the N termini of IB molecules, triggering rapid ubiquitination and degradation of IB in the 26S proteasome complex. The degradation of IB unmasks a nuclear localization signal present in the NFkB complex, allowing its rapid translocation into the nucleus, where it engages cognate B enhancer elements and modulates the transcription of various NFkB-responsive target genes. In one embodiment, the ability of a compound to modulate one or more of: the status of NFkB inhibitors, the ability of NFkB to translocate to the nucleus, or the activation of NFkB dependent gene transcription can be measured.

[0136] In one embodiment, the ability of a compound to modulate AP-1 activity can be measured. The AP-1 complex is comprised of the transcription factors Fos and Jun. The AP-1 complex activity is controlled by regulation of Jun and Fos transcription and by posttranslation modification, for example, the activation of several MAPKS, ERK, p38 and JN, is required for AP-1 transcriptional activity. In one embodiment, the modulation of transcription mediated by AP-1 can be measured. In another embodiment, the ability of a compound to modulate the activity of AP-1, e.g., by modulating its phosphorylation or its ubiquitination can be measured. In one embodiment, the ubiquitination of AP-1 can be measured using techniques known in the art. In another embodiment, the degradation of AP-1 (or of c-Jun and/or c-Fos) can be measured using known techniques.

[0137] The loss of AP-1 has been associated with T cell anergy. Accordingly, in one embodiment, the ability of a test compound to modulate T cell anergy can be determined, e.g, by assaying secondary T cell responses. If the T cells are unresponsive to the secondary activation attempts, as determined by IL-2 synthesis and/or T cell proliferation, a state of anergy or has been induced. Standard assay procedures can be used to measure T cell anergy, for example, T cell proliferation can be measured, for example, by assaying [.sup.3H] thymidine incorporation. In another embodiment, signal transduction can be measured, e.g., activation of members of the MAP kinase cascade or activation of the AP-1 complex can be measured. In another embodiment, intracellular calcium mobilization, protein levels members of the NFAT cascade can be measured.

[0138] In another embodiment, the effect of a compound on Ras and Rac activity can be measured using standard techniques. In one embodiment, actin polymerization, e.g., by measuring the immunofluorescence of F-actin can be measured.

[0139] In another embodiment, the effect of the compound on ubiquitination of, for example, AP1, SMAD, TRAF, and/or Runx2, can be measured, by, for example in vitro or in vivo ubiquitination assays. In vitro ubiquitination assays are described in, for example, Fuchs, S. Y., Bet al. (1997) J. Biol. Chem. 272:32163-32168. In vivo ubiquitination assays are described in, for example, Treier, M. L. et al. (1994) Cell 78:787-798.

[0140] In another embodiment, the effect of the compound on the degradation of, for example, a KRC target molecule and/or a KRC binding partner, can be measured by, for example, coimmunoprecipitation of KRC, e.g., full-length KRC and/or a fragment thereof, with, e.g., SMAD, GATA3, Runx2, TRAF, Jun, and/or Fos. Western blotting of the coimmunoprecipitate and probing of the blots with antibodies to KRC and the KRC target molecule and/or a KRC binding partner can be quantitated to determine whether degradation has occurred.

[0141] In one embodiment, the ability of the compound to modulate TGF.beta. signaling in B cells can be measured. For example, as described herein, KRC is a coactivator of GL.alpha. promoter activity and a corepressor of the osteocalcin gene. In the absence of KRC, GL.alpha. transcription is diminished in B cells, and osteocalcin gene transcription is augmented in osteoblasts. Accordingly, in one embodiment, the ability of the compound to modulate TGF.beta. signaling in B cells can be measured by measuring the transcription of GL.alpha.. In another embodiment, osteocalcin gene transcription can be measured. In one embodiment, RT-PCR is used to measure the transcritpion. Furthermore, given the ability of KRC to interact with SMAD and drive the transcription of a SMAD reporter construct, the ability of a compound to modulate TGF.beta. signaling in B cells can be measured by measuring the transcriptional ability of SMAD. In one embodiment, SMAD, or a fragment thereof, e.g., a basic SMAD-binding element, is operably linked to a luciferase reporter gene. Other TGF.beta. regulated genes are known in the art (e.g., Massague and Wotton. 2000 EMBO 19:1745.) The ability of the test compound to modulate KRC (or a molecule in a signal transduction pathway involving to KRC) binding to a substrate or target molecule (e.g., TRAF, GATA3, SMAD, Runx2, or Jun in the case of KRC ) can also be determined. Determining the ability of the test compound to modulate KRC binding to a target molecule (e.g., a binding partner such as a substrate) can be accomplished, for example, by coupling the target molecule with a radioisotope or enzymatic label such that binding of the target molecule to KRC or a molecule in a signal transduction pathway involving KRC can be determined by detecting the labeled KRC target molecule in a complex. Alternatively, KRC be coupled with a radioisotope or enzymatic label to monitor the ability of a test compound to modulate KRC binding to a target molecule in a complex. Determining the ability of the test compound to bind to KRC can be accomplished, for example, by coupling the compound with a radioisotope or enzymatic label such that binding of the compound to KRC can be determined by detecting the labeled compound in a complex. For example, targets can be labeled with .sup.125I, .sup.35S, .sup.14C, or .sup.3H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting. Alternatively, compounds can be labeled, e.g., with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product.

[0142] In another embodiment, the ability of KRC or a molecule in a signal transduction pathway involving KRC to be acted on by an enzyme or to act on a substrate can be measured. For example, in one embodiment, the effect of a compound on the phosphorylation of KRC can be measured using techniques that are known in the art.

[0143] It is also within the scope of this invention to determine the ability of a compound to interact with KRC or a molecule in a signal transduction pathway involving KRC without the labeling of any of the interactants. For example, a microphysiometer can be used to detect the interaction of a compound with a KRC molecule without the labeling of either the compound or the molecule (McConnell, H. M. et al. (1992) Science 257:1906-1912). As used herein, a "microphysiometer" (e.g., Cytosensor) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a compound and

[0144] Exemplary target molecules of KRC include: Jun, TRAF (e.g., TRAF2) GATA3, SMAD, e.g., SMAD2 and SMAD3, and Runx2.

[0145] In another embodiment, a different (i.e., non-KRC) molecule acting in a pathway involving KRC that acts upstream or downstream of KRC can be included in an indicator composition for use in a screening assay. Compounds identified in a screening assay employing such a molecule would also be useful in modulating KRC activity, albeit indirectly. For example, the ability of TRAF (e.g., TRAF2) to activate NFK.beta. dependent gene expression can be measured, or the ability of SMAD to activate TGF.beta.-dependent gene transcription can be measured.

[0146] The cells used in the instant assays can be eukaryotic or prokaryotic in origin. For example, in one embodiment, the cell is a bacterial cell. In another embodiment, the cell is a fungal cell, e.g., a yeast cell. In another embodiment, the cell is a vertebrate cell, e.g., an avian or a mammalian cell. In a preferred embodiment, the cell is a human cell.

[0147] The cells of the invention can express endogenous KRC or another protein in a signaling pathway involving KRC or can be engineered to do so. For example, a cell that has been engineered to express the KRC protein and/or a non protein which acts upstream or downstream of can be produced by introducing into the cell an expression vector encoding the protein.

[0148] Recombinant expression vectors that can be used for expression of KRC or a molecule in a signal transduction pathway involving KRC (e.g., a protein which acts upstream or downstream of KRC ) are known in the art. For example, the cDNA is first introduced into a recombinant expression vector using standard molecular biology techniques. A cDNA can be obtained, for example, by amplification using the polymerase chain reaction (PCR) or by screening an appropriate cDNA library. The nucleotide sequences of cDNAs for or a molecule in a signal transduction pathway involving (e.g., human, murine and yeast) are known in the art and can be used for the design of PCR primers that allow for amplification of a cDNA by standard PCR methods or for the design of a hybridization probe that can be used to screen a cDNA library using standard hybridization methods.

[0149] Following isolation or amplification of a cDNA molecule encoding KRC or a non-KRC molecule in a signal transduction pathway involving KRC the DNA fragment is introduced into an expression vector. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors" or simply "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification, "plasmid" and "vector" may be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.

[0150] The recombinant expression vectors of the invention comprise a nucleic acid molecule in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression and the level of expression desired, which is operatively linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory sequence" includes promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell, those which direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences) or those which direct expression of the nucleotide sequence only under certain conditions (e.g., inducible regulatory sequences).

[0151] When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma virus, adenovirus, cytomegalovirus and Simian Virus 40. Non-limiting examples of mammalian expression vectors include pCDM8 (Seed, B., (1987) Nature 329:840) and pMT2PC (Kaufinan et al. (1987), EMBO J. 6:187-195). A variety of mammalian expression vectors carrying different regulatory sequences are commercially available. For constitutive expression of the nucleic acid in a mammalian host cell, a preferred regulatory element is the cytomegalovirus promoter/enhancer. Moreover, inducible regulatory systems for use in mammalian cells are known in the art, for example systems in which gene expression is regulated by heavy met al ions (see e.g., Mayo et al. (1982) Cell 29:99-108; Brinster et al. (1982) Nature 296:39-42; Searle et al. (1985) Mol. Cell. Biol. 5:1480-1489), heat shock (see e.g., Nouer et al. (1991) in Heat Shock Response, e.d. Nouer, L. , CRC, Boca Raton, Fla., pp 167-220), hormones (see e.g., Lee et al. (1981) Nature 294:228-232; Hynes et al. (1981) Proc. Natl. Acad. Sci. USA 78:2038-2042; Klock et al. (1987) Nature 329:734-736; Israel & Kaufinan (1989) Nucl. Acids Res. 17:2589-2604; and PCT Publication No. WO 93/23431), FK506-related molecules (see e.g., PCT Publication No. WO 94/18317) or tetracyclines (Gossen, M. and Bujard, H. (1992) Proc. Natl. Acad. Sci. USA 89:5547-5551; Gossen, M. et al. (1995) Science 268:1766-1769; PCT Publication No. WO 94/29442; and PCT Publication No. WO 96/01313). Still further, many tissue-specific regulatory sequences are known in the art, including the albumin promoter (liver-specific; Pinkert et al. (1987) Genes Dev. 1:268-277), lymphoid-specific promoters (Calame and Eaton (1988) Adv. Immunol. 43:235-275), in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J. 8:729-733) and immunoglobulins (Banedji et al. (1983) Cell 33:729-740; Queen and Baltimore (1983) Cell 33:741-748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477), pancreas-specific promoters (Edlund et al. (1985) Science 230:912-916) and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166). Developmentally-regulated promoters are also encompassed, for example the murine hox promoters (Kessel and Gruss (1990) Science 249:374-379) and the .alpha.-fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3:537-546).

[0152] Vector DNA can be introduced into mammalian cells via conventional transfection techniques. As used herein, the various forms of the term "transfection" are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into mammalian host cells, including calcium phosphate co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transfecting host cells can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory manuals.

[0153] For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on a separate vector from that encoding KRC or, more preferably, on the same vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).

[0154] In one embodiment, within the expression vector coding sequences are operatively linked to regulatory sequences that allow for constitutive expression of the molecule in the indicator cell (e.g., viral regulatory sequences, such as a cytomegalovirus promoter/enhancer, can be used). Use of a recombinant expression vector that allows for constitutive expression of KRC or a molecule in a signal transduction pathway involving KRC in the indicator cell is preferred for identification of compounds that enhance or inhibit the activity of the molecule. In an alternative embodiment, within the expression vector the coding sequences are operatively linked to regulatory sequences of the endogenous gene for KRC or a molecule in a signal transduction pathway involving KRC (i.e., the promoter regulatory region derived from the endogenous gene). Use of a recombinant expression vector in which expression is controlled by the endogenous regulatory sequences is preferred for identification of compounds that enhance or inhibit the transcriptional expression of the molecule.

[0155] In yet another aspect of the invention, the KRC protein or fragments thereof can be used as "bait protein" e.g., in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos et al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem. 268:12046-12054; Bartel et al. (1993) Biotechniques 14:920-924; Iwabuchi et al. (1993) Oncogene 8:1693-1696; and Brent WO94/10300), to identify other proteins, which bind to or interact with KRC ("binding proteins" or "bp") and are involved in KRC activity. Such KRC -binding proteins are also likely to be involved in the propagation of signals by the KRC proteins or KRC targets such as, for example, downstream elements of an KRC-mediated signaling pathway. Alternatively, such KRC-binding proteins can be KRC inhibitors.

[0156] The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. In one construct, the gene that codes for an KRC protein is fused to a gene encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct, a DNA sequence, from a library of DNA sequences, that encodes an unidentified protein ("prey" or "sample") is fused to a gene that codes for the activation domain of the known transcription factor. If the "bait" and the "prey" proteins are able to interact, in vivo, forming an KRC dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ) which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected and cell colonies containing the functional transcription factor can be isolated and used to obtain the cloned gene which encodes the protein which interacts with the KRC protein or a molecule in a signal transduction pathway involving KRC.

[0157] B. Cell-free Assays

[0158] In another embodiment, the indicator composition is a cell free composition. KRC or a non-KRC protein in a signal transduction pathway involving KRC expressed by recombinant methods in a host cells or culture medium can be isolated from the host cells, or cell culture medium using standard methods for protein purification. For example, ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies can be used to produce a purified or semi-purified protein that can be used in a cell free composition. Alternatively, a lysate or an extract of cells expressing the protein of interest can be prepared for use as cell-free composition.

[0159] In one embodiment, compounds that specifically modulate KRC activity or the activity of a molecule in a signal transduction pathway involving KRC are identified based on their ability to modulate the interaction of KRC with a target molecule to which KRC binds. The target molecule can be a DNA molecule, e.g., an KRC-responsive element, such as the regulatory region of a chaperone gene) or a protein molecule. Suitable assays are known in the art that allow for the detection of protein-protein interactions (e.g., immunoprecipitations, two-hybrid assays and the like) or that allow for the detection of interactions between a DNA binding protein with a target DNA sequence (e.g., electrophoretic mobility shift assays, DNAse I footprinting assays and the like). By performing such assays in the presence and absence of test compounds, these assays can be used to identify compounds that modulate (e.g., inhibit or enhance) the interaction of KRC with a target molecule.

[0160] In one embodiment, the amount of binding of KRC or a molecule in a signal transduction pathway involving KRC to the target molecule in the presence of the test compound is greater than the amount of binding of KRC to the target molecule in the absence of the test compound, in which case the test compound is identified as a compound that enhances binding of KRC to a target. In another embodiment, the amount of binding of the KRC to the target molecule in the presence of the test compound is less than the amount of binding of the KRC (or e.g., Jun, TRAF, GATA3, SMAD, Runx2) to the target molecule in the absence of the test compound, in which case the test compound is identified as a compound that inhibits binding of KRC to the target. Binding of the test compound to KRC or a molecule in a signal transduction pathway involving KRC can be determined either directly or indirectly as described above. Determining the ability of KRC protein to bind to a test compound can also be accomplished using a technology such as real-time Biomolecular Interaction Analysis (BIA) (Sjolander, S. and Urbaniczky, C. (1991) Anal. Chem. 63:2338-2345; Szabo et al. (1995) Curr. Opin. Struct. Biol. 5:699-705). As used herein, "BIA" is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcore). Changes in the optical phenomenon of surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.

[0161] In the methods of the invention for identifying test compounds that modulate an interaction between KRC (or e.g., Jun, TRAF, GATA3, SMAD, Runx2 ) protein and a target molecule, the complete KRC protein can be used in the method, or, alternatively, only portions of the protein can be used. For example, an isolated KRC interacting domain (e.g., consisting of amino acids 204-1055 or a larger subregion including an interacting domain) can be used. An assay can be used to identify test compounds that either stimulate or inhibit the interaction between the KRC protein and a target molecule. A test compound that stimulates the interaction between the protein and a target molecule is identified based upon its ability to increase the degree of interaction between, e.g., KRC and a target molecule as compared to the degree of interaction in the absence of the test compound and such a compound would be expected to increase the activity of KRC in the cell. A test compound that inhibits the interaction between the protein and a target molecule is identified based upon its ability to decrease the degree of interaction between the protein and a target molecule as compared to the degree of interaction in the absence of the compound and such a compound would be expected to decrease KRC activity.

[0162] In one embodiment of the above assay methods of the present invention, it may be desirable to immobilize either KRC (or a molecule in a signal transduction pathway involving KRC, e.g., Jun, TRAF, GATA3, SMAD, Runx2 ) or a respective target molecule for example, to facilitate separation of complexed from uncomplexed forms of one or both of the proteins, or to accommodate automation of the assay. Binding of a test compound to a KRC or a molecule in a signal transduction pathway involving KRC, or interaction of an KRC protein (or a molecule in a signal transduction pathway involving KRC) with a target molecule in the presence and absence of a test compound, can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtitre plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion protein can be provided in which a domain that allows one or both of the proteins to be bound to a matrix is added to one or more of the molecules. For example, glutathione-S-transferase fusion proteins or glutathione-S-transferase/target fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtitre plates, which are then combined with the test compound or the test compound and either the non-adsorbed target protein or KRC protein, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtitre plate wells are washed to remove any unbound components, the matrix is immobilized in the case of beads, and complex formation is determined either directly or indirectly, for example, as described above. Alternatively, the complexes can be dissociated from the matrix, and the level of binding or activity determined using standard techniques.

[0163] Other techniques for immobilizing proteins on matrices can also be used in the screening assays of the invention. For example, either an KRC protein or a molecule in a signal transduction pathway involving KRC, or a target molecule can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated protein or target molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, Ill.), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies which are reactive with protein or target molecules but which do not interfere with binding of the protein to its target molecule can be derivatized to the wells of the plate, and unbound target or KRC protein is trapped in the wells by antibody conjugation. Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with KRC or a molecule in a signal transduction pathway involving KRC or target molecule, as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the KRC protein or target molecule.

[0164] C. Assays Using Knock-Out Cells

[0165] In another embodiment, the invention provides methods for identifying compounds that modulate a biological effect of KRC or a molecule in a signal transduction pathway involving KRC using cells deficient in KRC (or e.g., Jun, TRAF, GATA3, SMAD, Runx2). As described in the Examples, inhibition of KRC activity (e.g., by disruption of the KRC gene) in cells results, e.g., in a deficiency of IL-2 production, impaired Th2 cell development, and/or impaired TGF.beta.R signaling. Thus, cells deficient in KRC or a molecule in a signal transduction pathway involving KRC can be used identify agents that modulate a biological response regulated by KRC by means other than modulating KRC itself (i.e., compounds that "rescue" the KRC deficient phenotype). Alternatively, a "conditional knock-out" system, in which the gene is rendered non-functional in a conditional manner, can be used to create deficient cells for use in screening assays. For example, a tetracycline-regulated system for conditional disruption of a gene as described in WO 94/29442 and U.S. Pat. No. 5,650,298 can be used to create cells, or animals from which cells can be isolated, be rendered deficient in KRC (or a molecule in a signal transduction pathway involving KRC e.g., Jun, TRAF, GATA3, SMAD, Runx2) in a controlled manner through modulation of the tetracycline concentration in contact with the cells. Specific cell types, e.g., lymphoid cells (e.g., thymic, splenic and/or lymph node cells) or purified cells such as T cells, B cells, osteoblasts, osteoclasts, from such animals can be used in screening assays. In one embodiment, the entire 5.4 kB exon 2 of KRC can be replaced, e.g., with a neomycin cassette, resulting in an allele that produces no KRC protein. This embodiment is described in the appended examples.

[0166] In the screening method, cells deficient in KRC or a molecule in a signal transduction pathway involving KRC can be contacted with a test compound and a biological response regulated by KRC or a molecule in a signal transduction pathway involving KRC can be monitored. Modulation of the response in cells deficient in KRC or a molecule in a signal transduction pathway involving KRC (as compared to an appropriate control such as, for example, untreated cells or cells treated with a control agent) identifies a test compound as a modulator of the KRC regulated response.

[0167] In one embodiment, the test compound is administered directly to a non-human knock out animal, preferably a mouse (e.g., a mouse in which the KRC gene or a gene in a signal transduction pathway involving KRC is conditionally disrupted by means described above, or a chimeric mouse in which the lymphoid organs are deficient in KRC or a molecule in a signal transduction pathway involving KRC as described above), to identify a test compound that modulates the in vivo responses of cells deficient in KRC. In another embodiment, cells deficient in KRC are isolated from the non-human KRC deficient animal or a molecule in a signal transduction pathway involving KRC deficient animal, and contacted with the test compound ex vivo to identify a test compound that modulates a response regulated by KRC in the cells

[0168] Cells deficient in KRC or a molecule in a signal transduction pathway involving KRC can be obtained from a non-human animals created to be deficient in KRC or a molecule in a signal transduction pathway involving KRC Preferred non-human animals include monkeys, dogs, cats, mice, rats, cows, horses, goats and sheep. In preferred embodiments, the deficient animal is a mouse. Mice deficient in KRC or a molecule in a signal transduction pathway involving KRC can be made using methods known in the art. One example of such a method and the resulting KRC heterozygous and homozygous animals is described in the appended examples. Non-human animals deficient in a particular gene product typically are created by homologous recombination. In an exemplary embodiment, a vector is prepared which contains at least a portion of the gene into which a deletion, addition or substitution has been introduced to thereby alter, e.g., functionally disrupt, the endogenous KRC. The gene preferably is a mouse gene. For example, a mouse KRC gene can be isolated from a mouse genomic DNA library using the mouse KRC cDNA as a probe. The mouse KRC gene then can be used to construct a homologous recombination vector suitable for modulating an endogenous KRC gene in the mouse genome. In a preferred embodiment, the vector is designed such that, upon homologous recombination, the endogenous gene is functionally disrupted (i.e., no longer encodes a functional protein; also referred to as a "knock out" vector).

[0169] Alternatively, the vector can be designed such that, upon homologous recombination, the endogenous gene is mutated or otherwise altered but still encodes functional protein (e.g., the upstream regulatory region can be altered to thereby alter the expression of the endogenous KRC protein). In the homologous recombination vector, the altered portion of the gene is flanked at its 5' and 3' ends by additional nucleic acid of the gene to allow for homologous recombination to occur between the exogenous gene carried by the vector and an endogenous gene in an embryonic stem cell. The additional flanking nucleic acid is of sufficient length for successful homologous recombination with the endogenous gene. Typically, several kilobases of flanking DNA (both at the 5' and 3' ends) are included in the vector (see e.g., Thomas, K. R. and Capecchi, M. R. (1987) Cell 51:503 for a description of homologous recombination vectors). The vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced gene has homologously recombined with the endogenous gene are selected (see e.g., Li, E. et al. (1992) Cell 69:915). The selected cells are then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras (see e.g., Bradley, A. in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987) pp. 113-152). A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term. Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously recombined DNA by germline transmission of the transgene. Methods for constructing homologous recombination vectors and homologous recombinant animals are described further in Bradley, A. (1991) Current Opinion in Biotechnology 2:823-829 and in PCT International Publication Nos.: WO 90/11354 by Le Mouellec et al.; WO 91/01140 by Smithies et al.; WO 92/0968 by Zijlstra et al.; and WO 93/04169 by Berns et al.

[0170] In one embodiment of the screening assay, compounds tested for their ability to modulate a biological response regulated by KRC or a molecule in a signal transduction pathway involving KRC are contacted with deficient cells by administering the test compound to a non-human deficient animal in vivo and evaluating the effect of the test compound on the response in the animal.

[0171] The test compound can be administered to a non-knock out animal as a pharmaceutical composition. Such compositions typically comprise the test compound and a pharmaceutically acceptable carrier. As used herein the term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal compounds, isotonic and absorption delaying compounds, and the like, compatible with pharmaceutical administration. The use of such media and compounds for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or compound is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions. Pharmaceutical compositions are described in more detail below.

[0172] In another embodiment, compounds that modulate a biological response regulated by KRC or a signal transduction pathway involving KRC are identified by contacting cells deficient in KRC ex vivo with one or more test compounds, and determining the effect of the test compound on a read-out. In one embodiment, KRC deficient cells contacted with a test compound ex vivo can be readministered to a subject.

[0173] For practicing the screening method ex vivo, cells deficient, e.g., in KRC, Jun, TRAF, GATA3, SMAD, and/or Runx, can be isolated from a non-human deficient animal or embryo by standard methods and incubated (i.e., cultured) in vitro with a test compound. Cells (e.g., T cells, B cells, and/or osteoblasts) can be isolated from e.g., KRC, Jun, TRAF, GATA3, SMAD, and/or Runx, deficient animals by standard techniques. In another embodiment, the cells are isolated form animals deficient in one or more of KRC, Jun, TRAF, GATA3, SMAD, and/or Runx.

[0174] In another embodiment, cells deficient in more than one member of a signal transduction pathway involving KRC can be used in the subject assays.

[0175] Following contact of the deficient cells with a test compound (either ex vivo or in vivo), the effect of the test compound on the biological response regulated by KRC or a molecule in a signal transduction pathway involving KRC can be determined by any one of a variety of suitable methods, such as those set forth herein, e.g., including light microscopic analysis of the cells, histochemical analysis of the cells, production of proteins, induction of certain genes, e.g., cytokine gene, such as IL-2, degradation of certain proteins, e.g., ubiquitination of certain proteins, as described herein.

[0176] D. Test Compounds

[0177] A variety of test compounds can be evaluated using the screening assays described herein. The term "test compound" includes any reagent or test agent which is employed in the assays of the invention and assayed for its ability to influence the expression and/or activity of KRC or a molecule in a signal transduction pathway involving KRC. More than one compound, e.g., a plurality of compounds, can be tested at the same time for their ability to modulate the expression and/or activity of, e.g., KRC in a screening assay. The term "screening assay" preferably refers to assays which test the ability of a plurality of compounds to influence the readout of choice rather than to tests which test the ability of one compound to influence a readout. Preferably, the subject assays identify compounds not previously known to have the effect that is being screened for. In one embodiment, high throughput screening can be used to assay for the activity of a compound.

[0178] In certain embodiments, the compounds to be tested can be derived from libraries (i.e., are members of a library of compounds). While the use of libraries of peptides is well established in the art, new techniques have been developed which have allowed the production of mixtures of other compounds, such as benzodiazepines (Bunin et al. (1992). J. Am. Chem. Soc. 114:10987; DeWitt et al. (1993). Proc. Natl. Acad. Sci. USA 90:6909) peptoids (Zuckermann. (1994). J. Med. Chem. 37:2678) oligocarbamates (Cho et al. (1993). Science. 261:1303), and hydantoins (DeWitt et al. supra). An approach for the synthesis of molecular libraries of small organic molecules with a diversity of 104-105 as been described (Carell et al. (1994). Angew. Chem. Int. Ed. Engl. 33:2059-; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061).

[0179] The compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the `one-bead one-compound` library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K. S. (1997) Anticancer Drug Des. 12:145). Other exemplary methods for the synthesis of molecular libraries can be found in the art, for example in: Erb et al. (1994). Proc. Natl. Acad. Sci. USA 91:11422; Horwell et al. (1996) Immunopharmacology 33:68; and in Gallop et al. (1994); J. Med. Chem. 37:1233.

[0180] Libraries of compounds can be presented in solution (e.g., Houghten (1992) Biotechniques 13:412-421), or on beads (Lam (1991) Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556), bacteria (Ladner U.S. Pat. No. 5,223,409), spores (Ladner U.S. Pat. No. '409), plasmids (Cull et al. (1992) Proc Natl Acad Sci USA 89:1865-1869) or on phage (Scott and Smith (1990) Science 249:386-390); (Devlin (1990) Science 249:404-406); (Cwirla et al. (1990) Proc. Natl. Acad. Sci. 87:6378-6382); (Felici (1991) J. Mol. Biol. 222:301-310); In still another embodiment, the combinatorial polypeptides are produced from a cDNA library.

[0181] Exemplary compounds which can be screened for activity include, but are not limited to, peptides, nucleic acids, carbohydrates, small organic molecules, and natural product extract libraries.

[0182] Candidate/test compounds include, for example, 1) peptides such as soluble peptides, including Ig-tailed fusion peptides and members of random peptide libraries (see, e.g., Lam, K. S. et al. (1991) Nature 354:82-84; Houghten, R. et al. (1991) Nature 354:84-86) and combinatorial chemistry-derived molecular libraries made of D- and/or L-configuration amino acids; 2) phosphopeptides (e.g., members of random and partially degenerate, directed phosphopeptide libraries, see, e.g., Songyang, Z. et al. (1993) Cell 72:767-778); 3) antibodies (e.g., polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, and single chain antibodies as well as Fab, F(ab').sub.2, Fab expression library fragments, and epitope-binding fragments of antibodies); 4) small organic and inorganic molecules (e.g., molecules obtained from combinatorial and natural product libraries); 5) enzymes (e.g., endoribonucleases, hydrolases, nucleases, proteases, synthatases, isomerases, polymerases, kinases, phosphatases, oxido-reductases and ATPases), and 6) mutant forms of KRC (e.g., dominant negative mutant forms of the molecule).

[0183] The test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the `one-bead one-compound` library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K. S. (1997) Anticancer Drug Des. 12:145).

[0184] Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. USA 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91:11422; Zuckermann et al. (1994) J. Med. Chem. 37:2678; Cho et al. (1993) Science 261:1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and Gallop et al. (1994) J. Med. Chem. 37:1233.

[0185] Libraries of compounds can be presented in solution (e.g., Houghten (1992) Biotechniques 13:412-421), or on beads (Lam (1991) Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556), bacteria (Ladner U.S. Pat. No. 5,223,409), spores (Ladner U.S. Pat. No. '409), plasmids (Cull et al. (1992) Proc Natl Acad Sci USA 89:1865-1869) or phage (Scott and Smith (1990) Science 249:386-390; Devlin (1990) Science 249:404-406; Cwirla et al. (1990) Proc. Natl. Acad. Sci. 87:6378-6382; Felici (1991) J. Mol. Biol. 222:301-310; Ladner supra.).

[0186] Compounds identified in the subject screening assays can be used in methods of modulating one or more of the biological responses regulated by KRC. It will be understood that it may be desirable to formulate such compound(s) as pharmaceutical compositions (described supra) prior to contacting them with cells.

[0187] Once a test compound is identified that directly or indirectly modulates, e.g., KRC expression or activity, or a molecule in a signal transduction pathway involving KRC, by one of the variety of methods described hereinbefore, the selected test compound (or "compound of interest") can then be further evaluated for its effect on cells, for example by contacting the compound of interest with cells either in vivo (e.g., by administering the compound of interest to a subject) or ex vivo (e.g., by isolating cells from the subject and contacting the isolated cells with the compound of interest or, alternatively, by contacting the compound of interest with a cell line) and determining the effect of the compound of interest on the cells, as compared to an appropriate control (such as untreated cells or cells treated with a control compound, or carrier, that does not modulate the biological response).

[0188] The instant invention also pertains to compounds identified in the subject screening assays.

VI. Kits of the Invention

[0189] Another aspect of the invention pertains to kits for carrying out the screening assays, modulatory methods or diagnostic assays of the invention. For example, a kit for carrying out a screening assay of the invention can include an indicator composition comprising KRC or a molecule in a signal transduction pathway involving KRC, means for measuring a readout (e.g., protein secretion) and instructions for using the kit to identify modulators of biological effects of KRC. In another embodiment, a kit for carrying out a screening assay of the invention can include cells deficient in KRC or a molecule in a signal transduction pathway involving KRC, means for measuring the readout and instructions for using the kit to identify modulators of a biological effect of KRC.

[0190] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).

[0191] This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references, patents, and published patent applications cited throughout this application, as well as the figures and the sequence listing, are hereby incorporated by reference.

EXAMPLES

[0192] The following materials and methods were used throughout the Examples:

Cell Lines, Plasmids and Stable and Transient Transfection Assays

[0193] The human embryonic kidney cell line HEK293, the NIH/3T3 fibroblast cells and the macrophage cell line RAW were obtained from ATCC and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fet al calf serum. HEK293 cells (4.times.510 5 per well) were seeded in 6 well plates, and 12 h later cells were transfected with EFECTENE.TM. (Qiagen) with 25 ng of a 2.times.NF.kappa.B-luciferase (Luc) reporter gene plasmid and 0.5 .mu.g of the indicated TRAF and KRC expression vectors. Total amounts of transfected DNA were kept constant by supplementing with control empty expression vector plasmids as needed. Cell extracts were prepared 24 h after transfection, and reporter gene activity was determined via the luciferase assay system (PROMEGA). PRSV-.beta.Gal vector (50 ng) was used to normalize for transfection efficiency by measuring .beta. galactosidase activity using the Galacton-PLUS substrate system (TROPIX, Inc.). Whenever indicated, the cells were treated for 4 hours with TNF.alpha. or IL-1 (10 ng/ml). To generate stable transfectants, EFECTENE.TM. mediated transfection of the RAW cell line was performed and clones were selected and maintained in complete medium supplemented with G418 (2 mg/ml).

Yeast Two Hybrid Screen

[0194] The yeast strain EGY48, containing the reporter genes for LEU and .beta.-galactosidase activity under the control of an upstream LexA-binding site was used as a host for the two hybrid screen. The KRC fragment from amino acid 204 to 1055 (KRC tr) (FIG. 2(A)) was fused in frame to the LexA DNA binding domain and a yeast strain expressing the LexA-KRC tr fusion protein was transfected with a mouse Th1 clone cDNA library (Szabo, et al.) fused to the GAL4 transcriptional activation domain. Transformants were plated on agar selection media lacking uracil, tryptophan, leucine and histidine. The resulting colonies were isolated and retested for growth in Leu.sup.- plates and for .beta. galactosidase activity. Plasmid DNA was purified from colonies that were Leu.sup.+.beta.gal.sup.+ and used for retransformation of a yeast strain expressing a heterologous bait to determine the specificity of interaction.

Northern Blot Analysis

[0195] Total RNA was isolated from transfected RAW macrophage cells using TRIZOL.TM. reagent (Gibco/BRL) and 15 .mu.g of each sample separated on 0.8% agarose 6% formaldehyde gels, transferred onto GeneScreen.TM. membrane (NEN) in 20.times.SSC overnight and covalently bound using a UV Stratalinker.TM. (Stratagene). Hybridization of blots was carried out at 42.degree. C. as described (Hodge, et al.) using the radiolabeled TNF.alpha., KRC (5850-6210) and HPRT probes prepared with the Random primer kit (Boehringer Mannheim).

Western Blot Analysis

[0196] Effectene.TM. mediated transfections into 293T cells were performed. To prepare cell extracts, cells were washed twice with PBS and lysed for 10 minutes on ice in 1 ml Triton lysis buffer (25 mM HEPES, pH 7.5, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 5 mM EDTA, 2 mM DTT and complete protease inhibitor mixture (Roche Molecular Biochemicals), and the lysates were cleared by centrifugation for 10 min at 14 000 rpm. The cell lysates were precleared with 30 .mu.l of protein A/G-Sepharose beads and then incubated for 4 h with 25 .mu.l of anti-MYC antibody directly conjugated to sepharose beads. The immunoprecipitates were then washed 5 times with the lysis buffer, resuspended in SDS sample buffer, and heated at 95.degree. C. for 5 min. Immunoprecipitated proteins were separated by SDS-PAGE, transferred to nitocellulose membrane (Schleicher & Schuell) and western blotting performed by probing with primary antibodies followed by horseradish peroxidase-conjugated goat anti-rabbit IgG and enhanced chemiluminescence according to the manufacturer's instructions (Amersham).

In vitro Kinase Assay

[0197] Anti-HA or anti-FLAG immunoprecipitates were used for immune complex kinase assays that were performed at 30.degree. C. for 30 min with 1 .mu.g of substrate,10 .mu.Ci of .gamma..sup.32 p ATP, and 10 .mu.M ATP in 30 .mu.l of kinase buffer (20 mM HEPES, pH 7.4, 10 mM MgCl2, 25 mM .beta.-glycerophosphate, 50 .mu.m NA3VO4, and 50 .mu.m DTT). The substrate was GST-c-JUN.

Apoytosis Assay

[0198] .beta.-galactosidase cotransfection assays for determination of cell death were performed as described (Hsu, et al.). Transfected NIH 3T3 cells were washed with PBS, fixed in PBS containing 3% paraformaldehyde for 10 min at 4.degree. C., and washed with PBS. Fixed cells were stained overnight with XGal. The number of blue-stained cells was determined microscopically. The average number from one representative experiment of three is shown.

Luciferase Assays

[0199] For each transfection, 5.times.10.sup.6 Jurkat cells were incubated with either IL2-Luc, NFAT/AP1-Luc or AP1-Luc reporter DNA together with pEF vector or pEF-KRC and CMV-.beta.GAL as normalization control in 0.4 ml of RPMI and transfected by electroporation (260 v, 975 uF). Transfected cells were cultured at 37.degree. C. for 20 h in RPMI 1640 medium (Gibco BRL) supplemented with 10% fet al bovine serum. Transfected cells were stimulated with PMA (50 ng/ml) and ionomycin (2 uM) for 6 hours prior to luciferase (Promega) and .beta.-galactosidase assays (Galacton-PLUS substrate system, TROPIX, Inc).

Reverse Transcription-PCR

[0200] Total RNA was isolated from T cells using TRIZOL.TM. reagent (Gibco/BRL). One (1) .mu.g of total RNA was reverse transcribed using iScript cDNA Synthesis Kit (BioRad). PCR was performed with 2 uM of each primer (listed below) and 2.5 units of Platinum High fidelity enzyme (Invitrogen) according to the manufacturer. TABLE-US-00001 IL2F 5'CAAGAATCCAAACTCACCAG3', (SEQ ID NO:3) IL2R 5'TAGCAACCATACATTCAACAA3' (SEQ ID NO:4) KRCF 5'CTCCAATACAGAATTCAAGGGC3', (SEQ ID NO:5) KRCR 5'TTTAGGTTGGCCAGTGTGTGTG (SEQ ID NO:6)

Jurkat Cell Activation With Raji B Lymphoma Cells and Staphylococcal Enteroxin E (SEE)

[0201] Jurkat cells were transfected by electroporation and incubated for 20 h at 37.degree. C. before stimulation for 8 h with the Raji B cell line and Staphylococcal Enteroxin E (SEE) using Raji cells (1:1 with Jurkat cells) and SEE (200 ng/ml).

[0202] Pull Down Assays

[0203] In vitro translated c-Jun (35.sup.S methionine labeled) and His-KRCtr were incubated for 2 h at 4.degree. C. in binding buffer (PBS/0.25% Nonidet p-40/1 mM PMSF/0.25 mM DTT), incubated for 2 hours with the anti-HIS antibody (Santa Cruz), 30 .mu.l of protein A/G sepharose added and the reaction incubated at 4.degree. C. for an additional 2 h. The immunoprecipitates were then washed five times with the binding buffer, resuspended in SDS sample buffer, and heated at 95.degree. C. for 5 min.

Retroviral Gene Transduction

[0204] Activated CD4.sup.+T cells were transduced by RV, RV-KRC or RV-ZAS2 as described previously (Szabo, S. J., et al. (2000) Cell 100:655-669).

Generation of KRC-Deficient Mice and Subsequent T Cell Stimulation

[0205] ES cells were generated in which the entire 5.4 kB exon 2 of KRC was replaced by a neomycin cassette resulting in an allele that produces no KRC protein. KRC.+-.ES cells transmitted the disrupted allele to 129/B6 offspring. Heterozygous pups were backcrossed to wild type B6 mice. Mice analyzed were progeny of intercrosses between heterozygous F3 generation backcrossed 129/B6 mice. CD4+ T cells were purified by positive selection from spleen and lymph nodes of 6-8 week old male KRC +/+ and KRC -/- littermates using magnetic beads according to the instructions of the manufacturer (Miltenyi Biotec). Cells were stimulated at 106 cells/mL with plate-bound anti-CD3 (1.0 .mu.g/mL) plus anti-CD28 (0.5 .mu.g/mL). Twenty-four hours later, supernatants were collected and analyzed for IL-2 levels by ELISA. Additionally, cells were stimulated for 72 hours in the presence of 200 U/mL human IL-2, and supernatants were collected and analyzed for IFN.gamma. levels by ELISA.

Example 1

Interaction of KRC with TRAF Family Members in Yeast

[0206] (A) In this example, a yeast two-hybrid interaction trap was used to select a T cell cDNA library for sequences encoding polypeptides that specifically interacted with a KRC-LexA fusion protein. As bait KRC sequences encoding amino acids 204 to 1055 (KRC tr) were used which include the third zinc finger domain, one of the three acidic domains and the putative NLS sequence, expressed in the pEG202 vector. One class of interactors encoding a fusion protein with apparently high affinity for the KRC-LexA bait as exhibited by high level of .beta.-galactosidase activity and ability to confer leucine prototrophy was isolated and upon sequencing proved to be the C-terminal segment of TRAF1. The interaction with TRAF1 was specific since no interaction was detected with control plasmids that encode KRC, c-Maf or relA fusion proteins or with the control vector alone [0207] (B) The ability of TRAF proteins to interact specifically with KRC in vivo was tested in mammalian cells. KRC sequences 204-1055 were subdloned into a mammalian expression vector which fuses the coding region to an N-terminal epitope tag from a myc peptide, and the expression of the protein confirmed by direct western blot analysis with anti-MYC antibody. This tagged construct was then cotransfected with TRAF-FLAG-tagged expression plasmids into 293T cells and lysates prepared for immunoprecipitation with an anti-MYC antibody. A STAT4-FLAG-tagged expression construct was used as negative control.

[0208] Western blot analysis of these samples using an anti-FLAG-specific monoclonal antibody (mAb) demonstrated that the anti-MYC antibody coimmunoprecipitated all six FLAG-tagged TRAFs, but not the STAT4 control protein. Finally, the deletion of the ring finger of TRAF2 (TRAF2 DN) did not alter its interaction with KRC, consistent with our isolation of TRAF1, which lacks the RING finger, in the yeast two hybrid interaction trap screen. These results demonstrate that KRC does interact with all TRAF family members and that this interaction is likely occurring through the TRAF C domain. [0209] (C) Coimmunoprecipitation assays in the presence of more stringent, higher salt conditions were performed. When 300 mM rather than 137 mM NaCl was used, TRAF5 was not able to coimmunoprecipitate with KRC, and the amount of TRAFs 3, 4 and 6 that could be immunoprecipitated was reduced. The TRAF-C domain of TRAF1 and TRAF2 share 70% identity but share less than 43% identity with TRAF5 and TRAF [0210] (D) To further explore if KRC interacted with a higher affinity with TRAF1 and TRAF2 and with lower affinity with the other TRAF members, we tested the association of endogenous rather than overexpressed TRAFs with ectopically expressed KRC. 293T cells (which lack TRAF1) were transfected with plasmids encoding MYC-tagged KRC or empty vector and 24 hours after transfection cells were lysed. Lysates from 293T cells were incubated with anti-MYC antibody to precipitate KRC.

[0211] Subsequent Western blotting with anti-TRAF2, anti-TRAF5 or anti-TRAF6 mAbs showed that only endogenous TRAF2 was able to interact with over-expressed KRC. The bands observed in the TRAFs 5 and 6 coimmunoprecipitants are non-specific Furthermore, treatment of 293T cells with TNF or IL-1 to induce TRAF activity did not affect the strength of the interaction between TRAF2 and ectopically expressed KRC).

[0212] Taken together, these data demonstrate that KRC interacts with TRAF family members, that this interaction occurs through the TRAF-C domain, and that KRC interacts with higher affinity with TRAF2 than with TRAF5 and TRAF6. This result is consistent with the higher sequence conservation between the TRAF domain of TRAF1 and TRAF2 than between the other TRAF family members.

Example 2

KRC Prevents TRAF Dependent NF.kappa.B Activation

[0213] In this example, the effect of KRC overexpression on TRAP2, TRAF5 and TRAF6-induced NF.kappa.B dependent gene expression using transfection assays in 293T human embryonic kidney cells was tested. The results show that overexpression of both the full-length KRC and the KRC 204-1055 (KRC truncated, tr) in the absence of exogenous TRAFs blocked NF.kappa.B-dependent transactivation in a manner comparable in strength to the inhibition observed with a dominant negative form of TRAF2. The results also show that both the KRC tr and the full length KRC blocked TRAF2-induced NFkB activation while NF.kappa.B activation induced by TRAF5 and TRAF6 were substantially but not completely affected.

Example 3

Antisense and Dominant Negative KRC Increase Cytokine Driven NF.kappa.B Transactivation While Sense KRC is Inhibitory

[0214] (A) In this example, whether KRC overexpression affects TNF.alpha.-induced NF.kappa.B transactivation in 293 cells was tested. Overexpression of KRC or KRC tr in 293 cells strongly inhibited TNF.alpha.-induced NF.kappa.B activation to a level comparable with the TRAF2 DN effect in the presence of TNF.alpha.. These data are consistent with the demonstrated effect of TRAF2 on NF.kappa.B-dependent gene activation in certain cell types, e.g., B cells, as shown in TRAF2-deficient mice (Yeh, et al.). [0215] (B) To manipulate the endogenous KRC, an antisense KRC construct (H10AS) and a dominant negative construct expressing only the ZAS2 domain of KRC (ZAS2) was used. Both the antisense and the ZAS2 expressing constructs greatly enhanced transactivation of the NF.kappa.B reporter upon induction with TNF.alpha.. The same results were obtained with the antisense KRC and dominant negative KRC when NF.kappa.B-dependent transactivation was driven by exogenous TRAF2 overexpression. These results demonstrate that KRC under normal conditions behaves as a negative regulator of TRAF2-mediated NF.kappa.B activation.

Example 4

IKK.beta. Overexpression Overcomes KRC Inhibition of NF.kappa.B-Dependent Transactivation

[0216] In this example, whether KRC affected NF.kappa.B-driven gene activation by interfering with upstream events was tested. Full-length KRC or KRC tr, and as a control, the TRAF2 DN mutant, were overexpressed in 293 cells in the absence or presence of ectopic IKK.beta. (I.kappa.B kinase) and the effect on NF.kappa.B-mediated transactivation determined. The activation of IKK.beta. is a key step in the nuclear translocation of the transcription factor NF-.kappa.B. IKK is a complex composed of three subunits: IKK.alpha., IKK.beta., and IKK.gamma. (also called NEMO). In response to the proinflammatory cytokine tumor necrosis factor (TNF), IKK is activated after being recruited to the TNF receptor 1 (TNF-R1) complex via TNF receptor-associated factor 2 (TRAF2). Overexpression-of IKK.beta. overcomes the inhibitory effect of both KRC and KRC tr in a manner comparable to its effect on TRAF2 DN. Since IKK activation is downstream of TRAF activation, these results demonstrate that the effect of KRC on NF.kappa.B-driven gene expression is due to its ability to interact with TRAFs rather than to competition with NF.kappa.B for binding to DNA.

Example 5

KRC Increases TNF.alpha.-Induced Apoptosis

[0217] In this example, whether KRC is involved in the apoptotic process was tested. KRC was overexpressed in 3T3 cells apoptosis was measured by counting .beta.-galactosidase positive (live) cells. As previously described for HeLa cells, these results demonstrate that in 3T3 cells apoptosis can be induced when either I.kappa.B DN or TRAF2 DN are overexpressed in the presence of TNF.alpha., but cannot be induced by TNF.alpha. alone (Hsu, et al.; Hsu, et al.; Liu, et al.). KRC overexpression resulted in an increase in TNF mediated cytotoxicity equivalent to that observed with overexpression of I.kappa.B or TRAF2 DN. The same effect was observed with the KRC tr construct indicating that KRC likely sensitizes cells to TNF.alpha.-induced death by inhibiting NF.kappa.B induction, most probably through its effect on blocking TRAF2 function. Collectively, these results demonstrate that upon TNF receptor activation, the NFkB, TRAF1, TRAF2, c-IAP-I and c-IAP-2 pathways operate as a positive feedback system to amplify the survival signal to protect cells from TNF-induced injury. The interaction of KRC with TRAF2, and possibly with TRAF1 in other cell types, acts to inhibit TRAF activity thereby balance between pro-apoptotic and anti-apoptotic stimuli.

Example 6

KRC Prevents TRAF2 AND TNF.alpha.-Dependent JNK Activation

[0218] In this example, whether KRC could block TRAF2 dependent JNK activation was tested. The KRC 204-1055 tr construct, full length KRC, ZAS2 expressing construct and the antisense KRC were cotransfected into 293 cells together with TRAF2, and JNK activity measured 24 hours after transfection. Both the KRC tr and the full length KRC blocked TRAF2-dependent JNK activation. Full length KRC blocked JNK activation only partially, likely due to the approximately 10 fold lower expression of this construct as compared to KRC tr. The results also show a dramatic increase of TRAF2 dependent JNK activation with expression of both the antisense KRC as well with the dominant negative ZAS2 expressing construct.

[0219] The same results were obtained when JNK activation was induced by treatment with TNF.alpha.. A careful time course of JNK activation was performed, mediated by TNF.alpha. in the presence of antisense KRC, which revealed sustained JNK activation as compared to control vector alone. These results demonstrate that KRC negatively modulates JNK activation by inhibiting TRAF2 function. The immediate target of TRAF2 in TNF-induced JNK/SAPK activation may be the MAP3 kinase ASK1 or members of the GCK family of kinases.

Example 7

KRC is a Negative Regulator of Endogenous TNF.alpha. Expression

[0220] In this example, whether KRC can modulate the expression of endogenous TNF.alpha. was tested. Overexpressed KRC or dominant negative KRC was transfected in the RAW macrophage cell line and levels of TNF.alpha. in a panel of transfectant clones were analyzed. RAW transfectants stably overexpressing KRC displayed a substantial decrease of baseline TNF.alpha. mRNA transcripts when compared to control vector transfected RAW cells while RAW transfectants expressing the dominant negative version had substantial increase in TNF.alpha. expression. These results demonstrate that KRC acts to inhibit the transcription of the TNF.alpha. proinflammatory cytokine and that this may occur both through its inhibition of NF.kappa.B and JNK signaling pathways.

Example 8

KRC Translocates from Cytosol to Nucleus upon Cell Attachment

[0221] In this example, how KRC (originally decried as a nuclear protein) physiologically interacts with the predominantly cytosolic TRAF2 to affect gene activation was tested. A full-length KRC was fused to GFP and its cellular localization upon transfection into 3T3 cells was examined. In 3T3 cells in suspension, KRC was mainly localized to the cytosol while in 3T3 cells that had adhered to the glass slide, KRC was primarily present in the nucleus. These results clearly demonstrate that KRC can reside in the cytosol where it can interact with TRAF2. It should be noted that TRAF2 has recently been described to translocate from cytosol to nucleus as well (Min, et al, 1998). Thus KRC and TRAF2 may well interact in both subcellular compartments.

Example 9

KRC Expression is Maintained in TH1 Cells

[0222] In this example, KRC expression in primary T cells was measured. RT-PCR analysis of KRC expression in primary T cells was performed. KRC expression was measured at 24 hours and 72 hours. The results demonstrate that KRC expression is rapidly lost in Th2 cells at 72 hours whereas KRC expression in Th1 cells is maintained at 72 hours.

Example 10

KRC Activates T Cells

[0223] In this example, KRC was transfected into Jurkat T cells and CD69 expression was measured by FACS analysis. The results show that KRC overexpression increases expression of CD69 (a T cell activation marker) in Jurkat T cells.

Example 11

KRC Increases IL-2 Gene Transcription in the Presence of PMA/Ionomycin

[0224] This example shows that KRC increases IL-2 gene transcription in the presence of PMA/lonomycin. This increase in IL-2 transcription occurs primarily through activating AP-1 with no contribution from NFAT. IL-2 promoter transactivation by KRC in Jurkat T cells activated by PMA/Ionomycin. Transactivation-of a composite NFAT-AP1 reporter by KRC. Transactivation-of an AP-1 reporter by KRC.

Example 12

KRC Increases IL-2 Gene Transcription in the Presence of B Cell Antigen Presenting Cells

[0225] In this example, the results demonstrate that KRC increases IL-2 gene transcription in the presence of B cell antigen presenting cells and superantigen SEE and does so primarily through activating AP-1 with no contribution from NFAT. IL-2 promoter transactivation by KRC in Jurkat T cells activated by the Raji B cell APC line and the superantigen.

Example 13

KRC Overexpression Increases Endogenous IL-2 Production While KRC Loss Decreases Endogenous IL-2 Production

[0226] In this example, increased IL-2 production in Jurkat T cells stably expressing KRC was measured by ELISA. IL-2 promoter activation requires antigen receptor engagement plus an accessory signal usually supplied by an antigen presenting cell (Jain, J., et al. (1995) Curr. Biol. 7:333-342). Agents that bypass these receptors, such as PMA and ionomycin, can mimic T cell activation in the human T cell lymphoma Jurkat. To assess the function of KRC in T cells, Jurkat cells, which express barely detectable levels of endogenous KRC protein by Western blot analysis, were stably transfected with a plasmid encoding fill-length KRC (pEF-KRC) or with vector only control (pEF). G418 drug-resistant Jurkat clones were expanded and analyzed for IL-2 secretion following activation. Clones stably expressing KRC showed clear increases in KRC protein levels, as detected by Western blotting All clones expressing pEF-KRC produced substantially greater amounts of IL-2 upon PMA and ionomycin treatment than activated Jurkat clones transfected with the control vector. KRC overexpression alone was not sufficient to induce IL-2 secretion, as no IL-2 was detected in the culture supernatants of unstimulated KRC-overexpressing clones These results suggested that KRC is able to boost IL-2 secretion in concert with signals emanating from the TCR.

[0227] Although the Jurkat model has proved valuable to dissect pathways of T cell signaling, certain observations made in Jurkat cells are irreproducible in primary T cells (Dumitru, C. D. et al. (2000) Cell 103:1071-1083; Weiss, L., et al. (2000) J. Exp. Med. 191: 139-145). Therefore, the effects of KRC overexpression were studied in primary CD4+ T cells as well as in the Jurkat line using a retroviral delivery system to express KRC in primary CD4+ T cells. Bicistronic retroviral vectors encoding full-length KRC and control GFP were generated. The KRC ZAS2 domain was previously shown to act as a dominant negative in the context of KRC mediated inhibition of TNF-induced NF-.kappa.B activation (Oukka, M., et al. (2002) Mol. Cell 9:121-131). Purified CD4+ T cells were infected with these retroviruses 36 hours after primary activation with both anti-CD3 and anti-CD28, and sorted by flow cytometry for GFP expression 24 hours after infection. The ability of each population to produce IL-2 following subsequent activation by anti CD3 or anti CD3 plus CD28 was measured at 24 hours post-stimulation. CD4 cells transduced with full-length KRC produced higher amounts (approximately 3 to 4 fold increase) of IL-2 than CD4 cells infected with the GFP control retrovirus. Furthermore, CD4 cells transduced with the dominant negative KRC ZAS2 domain construct produced significantly less IL-2 than both the full-length KRC and GFP control transduced cells. These data are consistent with the notion that the ZAS2 domain interferes with endogenous KRC activity in T cells to prevent optimal expression of IL-2.

Example 14

KRC Transactivation of AP-1 Depends on RAS, RAF and PKC-Theta

[0228] In this example, the results demonstrate that KRC transactivation of AP-1 response element depends on Ras, Raf and PKC-theta signaling molecules. KRC transactivation of the AP-1 reporter is blocked by dominant negative Ras and Raf. KRC tranisactivation of the AP-1 reporter is blocked by dominant negative PKC-theta and by the specific PKC-theta inhibitor Rottlerin.

Example 15

KRC Controls IL-2 Expression

[0229] In this example, the results demonstrate that KRC controls IL-2 expression. RT-PCR of KRC transfected Jurkat clones was performed. The results show increased IL-2 expression upon KRC transfection.

Example 16

KRC Increases Actin Polymerization

[0230] In this example, the results demonstrate that KRC increases actin polymerization. Immunofluorescence of F-actin upon KRC overexpression in Jurkat T cells was performed. The results show the reorganization of F-actin filaments in KRC transfected Jurkat T cells.

Example 17

KRC Expression Increases in CD4+Cells upon Activation

[0231] In this example, the results demonstrate that KRC expression increases in CD4.sup.+ cells upon activation with anti-CD3 ((2.0 .mu.g/mL)/anti-CD28 (1.0 .mu.g/mL) antibodies. RT-PCR analysis demonstrates that KRC expression was induced with very rapid kinetics (within 20 minutes) in CD4.sup.+ T cells upon activation and increased levels of KRC transcripts were observed throughout the duration of primary CD3/CD28 stimulation, up to 48 hours.

Example 18

KRC Overexpression Increases While KRC Loss Decreases Endogenous IL-2 Production in Both Transformed and Primaty T Cells

[0232] IL-2 promoter activation requires antigen receptor engagement plus an accessory signal usually supplied by an antigen presenting cell (Jain, J., C. Loh, and A. Rao. 1995. 7:333-342.). Agents that bypass these receptors, such as PMA and ionomycin, can mimic T cell activation in the human T cell lymphoma Jurkat. To assess the function of KRC in T cells, Jurkat cells, which express barely detectable levels of endogenous KRC protein by Western blot analysis, were stably transfected with a plasmid encoding full-length KRC (pEF-KRC) or with vector only control (pEF). G418 drug-resistant Jurkat clones were expanded and analyzed for IL-2 secretion following activation. Clones stably expressing KRC showed clear increases in KRC protein levels, as detected by Western blotting. All clones expressing pEF-KRC produced substantially greater amounts of IL-2 upon PMA and ionomycin treatment than activated Jurkat clones transfected with the control vector. KRC overexpression alone was not sufficient to induce IL-2 secretion, as no IL-2 was detected in the culture supernatants of unstimulated KRC-overexpressing clones. These results suggested that KRC is able to boost IL-2 secretion in concert with signals emanating from the TCR.

[0233] Although the Jurkat model has proved valuable to dissect pathways of T cell signaling, certain observations made in Jurkat cells are irreproducible in primary T cells Although the Jurkat model has proved valuable to dissect pathways of T cell activation and signaling, some observations made in Jurkat cells have not been reproduced in primary T cells (Dumitru, C. D., J. D. Ceci, C. Tsatsanis, D. Kontoyiannis, K. Stamatakis, J.-H. Lin, C. Patriotis, N. A. Jenkins, N. G. Copeland, G. Kollias, and P. N. Tsichlis. 2000. TNF-.alpha. induction by LPS is regulated posttranscriptionally via a Tp12/ERK-dependent pathway. Cell 103:1071-1083, Weiss, L. et al. 2000. J Exp Med 191: 139-145). Therefore, the effects of KRC overexpression in primary CD4 T cells as well as in the Jurkat line were studied using a retroviral delivery system was used to express KRC in primary CD4 T cells. Bicistronic retroviral vectors encoding full-length KRC were generated, the KRC ZAS2 domain which we have previously shown acts as a dominant negative in the context of KRC mediated inhibition of TNF-induced NF-.kappa.B activation (Oukka, .NET al. 2002. Mol. Cell 9:121-131), and control GFP. Purified CD4 T cells were infected with these retroviruses 36 hours after primary activation with both anti-CD3 and anti-CD28, and sorted by flow cytometry for GFP expression 24 hours after infection. The ability of each population to produce IL-2 following subsequent activation by anti CD3 or anti CD3 plus CD28 was measured at 24 hours post-stimulation. CD4 cells transduced with full-length KRC produced higher amounts (approximately 3 to 4 fold increase) of IL-2 than CD4 cells infected with the GFP control retrovirus. Furthermore, CD4 cells transduced with the dominant negative KRC ZAS2 domain construct produced significantly less IL-2 than both the full-length KRC and GFP control transduced cells. These data are consistent with the notion that the ZAS2 domain interferes with endogenous KRC activity in T cells to prevent optimal expression of IL-2.

[0234] To further analyze the role of KRC in regulating endogenous IL-2 expression, CD4 cells purified from KRC-deficient mice were analyzed. Briefly, lymphoid development in these mice appears normal, with normal numbers of CD4.sup.+ T cells isolated from spleen and lymph nodes. Additionally, resting CD4 cells recovered appeared phenotypically normal based on expression of maturation markers such as CD4, CD62L, CD25, CD69 and TCR.beta.. KRC -/- CD4 cells activated in vitro for 24 hours by CD3/CD28 stimulation produced 10-fold less IL-2 production was detected than in CD4 cells from wild type littermates. However, IFN.gamma. production by these cells following 72 hours of primary stimulation in the presence of excess exogenous IL-2 was normal, suggesting that the deficiency of KRC in these cells does not globally inhibit activation-induced cytokine production. Thus, KRC is a positive regulator of IL-2 production both in Jurkat cells and, more importantly, in primary CD4 T cells.

Example 19

KRC Overexpression Increases the Transcription of the IL-2 Gene Through an AP-1-Site-Dependent Mechanism

[0235] In this example, the results demonstrate that KRC overexpression increases the transcription of the IL-2 gene through an AP-1-site-dependent mechanism.

[0236] The production of IL-2 by T cells is regulated at multiple levels including transcription, mRNA stability and rate of protein secretion (Lindsten, T., et al. (1989) Science 244:339; Jain, J., et al. (1992) Nature 356:801-804). In order to define at which stage(s) KRC acts, levels of IL-2 mRNA transcripts were measured by semi-quantitative RT PCR in Jurkat T cells stably transfected with full-length KRC. Jurkat clones over-expressing KRC displayed higher levels of IL-2 transcripts when activated than Jurkat clones transfected with vector control. Next the ability of KRC to directly transactivate a 1.5 kb IL-2 promoter-luciferase reporter in Jurkat cells was tested. Provision of KRC resulted in an approximately 10 fold induction of luciferase activity in Jurkat cells treated with PMA plus ionomycin. Just as KRC overexpression alone did not lead to spontaneous production of endogenous IL-2, no transactivation by KRC was observed in the absence of PMA/ionomycin in these luciferase reporter assays. In order to provide a more physiologic signal to activate Jurkat cells, a model system in which Raji B lymphoma cells act as antigen presenting cells to present staphylococcal enteroxin E (SEE) to Jurkat was utilized. Provision-of KRC substantially increased (approximately 10 fold) IL-2 promoter activity in this system. Interestingly, KRC had no effect on IL-2 promoter activity in the absence of Jurkat activation either by PMA/ionomycin or by antigen/APC. These data further suggest that KRC expression alone is not sufficient to induce IL-2 niRNA expression; instead, KRC's ability to enhance IL-2 production relies on endogenous factors found only in activated T cells.

[0237] KRC was originally cloned as a transcription factor, however, its effect on gene activation could clearly be ascribed to its function as an adapter protein. Nevertheless, KRC has been shown to bind both NF.kappa.B and RSS target sites in vitro and an NF.kappa.B site is present in the IL-2 promoter that has been shown to bind the NF.kappa.B family member c-Rel (Himes, S. R., et al. (1996) Immunity 5:479-489). To test whether KRC overexpression leads to enhanced function of a specific site in the IL-2 promoter and to identify the site, Jurkat cells were cotransfected with KRC and various deletion constructs of the IL-2 promoter. In initial experiments, KRC transactivated a luciferase reporter driven by only 200 bp of the IL-2 proximal promoter. The most prominent regulatory sequences in this region are cis elements that bind members of the NFAT, NF.kappa.B, and AP-1 transcription factor families (Jain, J., C., et al. (1995) Curr. Biol. 7:333-342; Ullman, K. S., et al. (1993) Genes & Development 7:188-196; Rooney, J. W., et al. (1995) Immunity 2:473-483; Durand, D. B., et al. (1987) J. Exp. Med. 165:395-407), although the NFAT and NF.kappa.B cis elements have been shown to overlap. Therefore, whether KRC could transactivate a multimerized linked NFAT/AP-1 target site, or individual multimerized NFAT or AP-1 target sites was tested. KRC enhanced PMA/ionomycin-induced transactivation of a multimerized linked NFAT/AP-1 element and the isolated, multimerized AP-l element but not the NFAT element FIG. 19(C)). In contrast to AP-1, the PMA/ionomycin induced activity of NFAT was not further increased by coexpression of KRC. KRC therefore acts at the transcriptional level to increase expression of IL-2 through an AP-1-site-dependent mechanism. Preliminary results show that KRC overexpression enhances, and KRC deficiency decreases, stimulation-induced upregulation of CD69 another AP-1 target gene in T cells (Castellanos, M. C., et al. (1997) J. Immunol. 159: 5463-5473).

Example 20

KRC does not Modulate MAPK Activity

[0238] In this example, the results demonstrate that KRC does not modulate MAPK activity. It was unlikely that KRC, a zing finger protein, transactivated the IL-2 promoter through direct binding to the AP-1 element, especially given the observation that KRC was able to enhance AP-1 activity only when Jurkat cells were simultaneously stimulated through the TCR pathway by PMA or antigen/APC. Indeed in EMSA assays using extracts prepared from unstimulated Jurkat cells overexpressing KRC, no binding to a radiolabeled AP-1 site oligonucleotide was detected. Thus, KRC and AP-1 do not bind the same site within the IL-2 promoter to synergistically increase promoter activity. Additionally, we observed that KRC does not increase AP-1 activity by increasing the expression of c-Jun/c-Fos mRNA

[0239] An alternative explanation was that KRC acts upstream to enhance posttranslational modifications of AP-1 that increase its activity. For example, N-terminal phosphorylation of c-Jun or C-terminal phosphorylation of c-Fos have been shown to enhance AP-1 activation downstream of the Ras pathway (Dumitru, C. D., et al. (2000) Cell 103:1071-1083; Binetruy, B., et al. (1991) Nature 351:122-127; Deng, T., and M. Karin (1994) Nature 371:171-175). Overexpression of a dominant negative Ras blocks TCR-induced AP-1 activity (Rayter, S. I., et al. (1992) Embo J. 11:4549-4556). More recently, it has been shown that mice deficient in PKC theta show defective TCR induced AP-1 activation, suggesting a role for this kinase in Ras/MAPK/AP-1 activation (Sun, Z., et al. (2000) Nature 404; Isakov, N., and A. Altman (2002) Annu. Rev. Immunol. 20:761-794). Both rottlerin, a PKC theta inhibitor, and overexpression of dominant negative Ras (RasN17) abolished the ability of KRC to enhance AP-1 transactivation following PMA/ionomycin stimulation. These data are consistent with the placement of KRC downstream of the Ras pathway or with a requirement for two distinct, but interconnected signals for IL-2 promoter transactivation. The latter explanation is more likely since KRC can increase AP-1 activation by Ras but cannot activate AP-1 on its own. Thus, KRC activation of AP-1 requires Ras, and KRC can substantially augment AP-1 activation by the Ras pathway.

[0240] KRC may enhance AP-1 function indirectly through the modulation of MAPK activity, kinases downstream of Ras that are known to potently stimulate AP-1 function (Binetruy, B., et al. (1991) Nature 351:122-127; Deng, T., and M. Karin (1994) Nature 371:171-175; Murphy, L., et al. (2002) Nat. Cell Biol. 4: 556-564). In T cells, stimulation via the TCR or with PMA/ionomycin induces the activation of three MAPKs: ERK, p38 and JNK. The activation of these MAPKS is required for AP-1 transcriptional activity. JNK, in particular, has been shown to increase AP-1 transcriptional activity by phosphorylating c-Jun (Arias, J., et al. (1994) Nature 370:226-229). In initial experiments it was determined that KRC overexpression did not alter levels of transcripts encoding a series of MAP3, MAP2 and MAP kinases as assessed by RNase protection assays (Pharmingen). To test whether KRC had any effect on MAPK activity, a sensitive assay, the PathDetect reporting system, was utilized to evaluate the effect of KRC on ERK-mediated ELK-1 transactivation and p38-mediated ATF2 transactivation. Jurkat cells were co-transfected with a pGAL4-UAS-LUC reporter and expression plasmids encoding GAL4-Elk1 and GAL4-ATF2 fusion proteins, respectively. KRC was unable to modulate either MAPK or p38 activity in this assay. Co-expression of KRC with HA-ERK1, myc-ERK2, Flag-P38 and Flag-JNK2 was performed and the activity of each kinase was measured using an immunoprecipitation-kinase assay with specific substrates, GST-Elk1, GST-ATF2 and GST-Jun for each MAPK. KRC had no detectable effect on any of the MAPKs in this assay. Therefore, KRC does not increase AP-1 activity through increasing TCR mediated MAPK activity, although it was observed that KRC downregulates TRAF2-mediated JNK activation following TNF.alpha. stimulation in macrophage cell lines (Oukka, M., et al. (2002) Mol. Cell 9:121-131). Since PMA/ionomycin is a very poor inducer of JNK activation in T cells, the possibility that KRC might also downregulate JNK in T cells under different circumstances cannot be ruled out (e.g., CD28 stimulation). However, the ability of KRC to inhibit low levels of JNK activity following prolonged CD3/CD28 stimulation of naive Thp cells is unlikely to account for its ability to dramatically enhance AP-1 function and IL-2 production.

Example 21

KRC Physically Interacts with c-Jun and Acts as a Transcriptional Coactivator

[0241] In this example, the results demonstrate that KRC physically interacts with c-Jun and acts as a transcriptional coactivator. It has been demonstrated that KRC interacts with the adapter protein TRAF2 to inhibit both NF.kappa.B and JNK/SAPK mediated responses including apoptosis and TNF.alpha. cytokine gene expression (Oukka, M., et al. 2002. Mol. Cell 9:121-131). To investigate whether KRC might therefore physically associate with c-Jun, expression vectors encoding c-Jun and a truncated myc-tagged version of KRC encoding amino acids 204 to 1055 (KRC tr), which includes the third zinc finger domain, one of the three acidic domains and the putative NLS sequence were overexpressed in the 293T kidney epithelial cell line. Coimmunoprecipitation using a monoclonal anti-myc antibody revealed that KRC physically associated with c-Jun (FIG. 21)). Further, it demonstrated that the region of KRC shown to associate with TRAF2 (aa 204-1055) also interacted with c-Jun. Similar results were obtained in coimmunopreciptations of overexpressed full-length KRC with c-Jun, although the absolute amounts of c-Jun obtained were less, presumably because the full-length KRC protein is poorly expressed due to its large size. Further mapping of c-Jun to delineate its interaction site with KRC revealed that KRC interacts with c-Jun amino acids 1-224 fused to the DNA binding domain of GAL4, which includes the transactivation domain Further, this association is direct and does not require posttranslational modifications as shown by the interaction of in vitro translated KRC and c-Jun proteins. Finally, it was important to demonstrate that this association occurred under physiologic conditions. Untransfected Jurkat or EL4 T cell lines were stimulated with PMA/ionomycin for 45 minutes, and AP-1 complexes were purified by immunoprecipitating c-Jun. Endogenous KRC is readily detected in these complexes obtained from stimulated cells.

[0242] To further investigate the mechanism via which KRC serves as an AP-1 coactivator, AP-1 was activated by overexpressing c-Jun or c-Jun and c-Fos in 293T cells with an AP-1 luciferase reporter. In this system, overexpression of KRC enhances both c-Jun and c-Jun plus c-Fos AP-1 activity (approximately 5 fold). However, the presence of endogenous AP-1 proteins might complicate interpretation of these results. Therefore the Gal4 DNA binding domain was fused to the c-Jun or c-Fos transactivation domains and cotransfected these chimeric cDNAs with KRC and a Gal4 binding site-luciferase reporter construct into 293T cells. The chimeric GAL4-c-Jun, but not GAL4-c-Fos, protein potently transactivated the reporter construct in the presence of KRC demonstrating that KRC indeed acts as a transcriptional coactivator. In sum then, KRC specifically associates with c-Jun under physiologic conditions and this association augments AP-1 transcriptional activity.

Example 22

KRC Physically Associates with c-Jun but not c-Fos

[0243] In this example, the results demonstrate that KRC physically interacts with c-Jun but not c-Fos. Expression vectors encoding c-Jun, c-Fos and a truncated myc-tagged version of KRC encoding amino acids 204 to 1055 (KRC tr) which includes the third zinc finger domain, one of the three acidic domains and the putative NLS sequence were overexpressed in the 293T kidney epithelial cell line. Coirnmunoprecipitation using a monoclonal anti-myc antibody revealed that KRC physically associated with the c-Jun/c-Fos AP-1 complex. Further, it demonstrated that the region of KRC, aa 204-1055 shown to associate with TRAF2 also interacted with AP-1. KRC appeared to interact with both members of the AP-1 complex. However, 293T cells express endogenous c-Jun. To test definitively whether KRC interacted with both members of AP-1, in vitro translated c-Fos, c-Jun and KRCtr were coimmunoprecipitated using antibodies to c-Jun, c-Fos and KRC. In this assay KRCtr interacted with c-Jun but not c-Fos. Further, the interaction between KRCtr and c-Jun required only the c-Jun N-terminal portion AA 1-79, termed the delta domain. It was possible that posttranslational modification of c-Fos was required for its interaction with KRC. Alternatively, KRC might interact with c-Fos only when it was associated with c-Jun. Indeed, when c-Jun was present in the lysates, c-Fos coimmunoprecipitated with KRCtr. These experiments revealed that KRC physically associated with c-Jun, but not c-Fos, the high affinity association of c-Fos with endogenous c-Jun presumably leading to the coimmunoprecipitation of c-Fos with KRC observed above. Consistent with this result was the failure to detect association of KRC with c-Fos in a yeast two hybrid assay.

Example 23

KRC Regulates the Staviltiy of the c-Jun/c-Fos AP-1 Transcription Factor Through Controlling its Degradation

[0244] In this example, the results demonstrate that KRC regulates the stability of the c-Jun/c-Fos AP-1 transcription factor by controlling its degradation. The above experiments mapped the interaction site of KRC with c-Jun to aa 204-1055 of KRC. The interaction of full-length KRC with c-Jun was tested. However, attempts to demonstrate that full-length KRC interacted with AP-1 in overexpression experiments resulted in coimmunoprecipitation of very small amounts of c-Jun and no detectable c-Fos protein when compared to truncated KRC. These results raised the possibility that association of full-length KRC protein with AP-1 might lead to its degradation. Time course experiments were performed in which overexpressed sense KRC or an antisense KRC previously shown to block production of endogenous KRC protein were coimmunoprecipitated with overexpressed c-Jun and c-Fos. Overexpression of full-length KRC, in the presence of low dose cycloheximide to block endogeneous protein synthesis led to the rapid degradation of c-Jun. Conversely, overexpression of antisense KRC, by inhibiting the expression of endogenous KRC, decreased the rate of c-Jun degradation. The same set of experiments were performed using c-Fos, a very short-lived cellular protein. As with c-Jun, the stability of the c-Fos protein in the presence of cycloheximide was compromised in the presence of KRC and dramatically stabilized in the presence of the KRC dominant negative expressing only the ZAS2 domain or in the presence of the antisense KRC. Remarkably, degradation of c-Fos was almost completely abolished in the presence of antisense KRC, suggesting that KRC may be the major protein that controls c-Fos degradation in vivo. The ability of KRC to promote the degradation of other fos family members Fra1, Fra2 and Fos B was also tested. Only c-Fos protein stability was deceased in the presence of KRC demonstrating the specificity of KRC for the c-Jun/c-Fos AP-1 pair. Viral Fos, an oncogene in acutely transforming retroviruses, contains a frameshift mutation that replaces the last 48 amino acids of c-Fos with an unrelated 49 amino acid-long C terminal tail that renders v-Fos a more stable protein compared to c-Fos. The increased stability accounts in part for the superior transformation ability of v-Fos. The protein stability of V-fos was not affected by altering levels of KRC by sense or antisense overexpression.

Example 24

KRC Regulates the Stability of the c-Jun AND c-Fos Based on their Function as Transcriptional Activators

[0245] In this example, the results demonstrate that the effect of KRC in regulating the stability of c-Jun and c-Fos proteins is reflected in their ability to function as transcriptional activators. To examine the functional consequences of AP-1 degradation by KRC, cotransfection experiments in 293T cells with sense or antisense KRC together with a luciferase-tagged AP-1 reporter construct were performed. Overexpression of sense KRC resulted in decreased stimulation of AP-1 activity while conversely, expression of antisense or DN KRC led to an increase in AP-1 activity. To determine whether KRC alters both the level of activation per cell and the number of cells in which activation or repression occurs we used an AP-l target site construct fuised to GFP. Cotransfection of the AP-1-GFP construct together with KRC or antisense KRC into 293 cells revealed that KRC reduced both the number of cells in which GFP was expressed as well as the intensity of GFP expression per cell. Conversely, cotransfection of antisense KRC increased AP-1 transactivation as evidenced by an increased number of GFP+ cells as well as an increase in the intensity of fluorescence per cell in. Thus, the effect of KRC in regulating the stability of the c-Jun and c-Fos proteins is reflected in their ability to function as transcriptional activators.

Example 25

KRC is Required for Ubiquination of both c-Jun and c-Fos

[0246] In this example, the results demonstrate that KRC is required for ubiquitination of both c-Jun and c-Fos. Much attention has recently been focused on the role of covalent modification in controlling gene transcription in eukaryotes. Lysine modification by ubiquitination, sumoylation and acetylation of transcription factors contributes to their function in modulating gene expression. Previous studies have established that AP-1 proteins are rapidly degraded by the ubiquitin/proteasome pathway. In this pathway, ubiquitin (UB) a 76 amino acid polypeptide is activated by the formation of a thiol ester linkage by the ubiquitin activating enzyme (E1) and is then transferred to the active site cysteine of a ubiquitin carrier protein (E2). Formation of an isopeptide bond between the C terminus of UB and lysines on a substrate is catalyzed by a UB ligase (E3), which binds the substrate and catalyzes the transfer of the UB from a specific E2 to the substrate. The formation of a chain of UB molecules on the substrate then targets it for degradation by the 26 S proteasome. It has been shown that KRC interacts with AP-1 to regulate its degradation raising the possibility that KRC might be the elusive AP-1 E3 UB ligase responsible for its ubiquitination in vivo.

Example 26

KRC Knockout B Cells have Impaired IgA Production and TGF.beta.-Dependent GL.alpha. Transcription

[0247] Homozygous mutant KRC KO mice have normal lymphocyte development as determined by FACS analysis of primary and secondary lymphoid organs. Despite normal B cell development, analysis of serum immunoglobulins (Igs) in non-immunized KRC KO mice revealed a selective reduction of circulating IgA. The decrease in serum IgA correlated with observations in vitro that purified splenic CD 19+ B cells from KRC KO mice, activated under conditions that promote IgA class switching, secreted significantly lower levels of IgA than WT B cells.

[0248] To determine if KRC regulates IgA production at the level of transcription, Ig.alpha. germline transcripts (GL.alpha.) in activated WT and KRC KO B cells were analyzed. Consistent with the decreased IgA secretion observed, activated KRC KO B cells had a marked reduction in levels of GL.alpha. transcripts when compared to WT B cells. It has previously been reported that TGF.beta. signaling in B cells has a central role in regulating GL.alpha. transcription through SMAD3 and Runx3 mediated processes (Zhang, Y., and Derynck, R. 2000. J. Biol Chem 275: 16979-16985; Shi, M. J., and Stavnezer, J. 1998. J Immunol 161: 6751-6760.).

[0249] Given the findings that KRC can interact with SMAD3, it was determined whether KRC could augment the transcriptional activity of SMAD3 and/or Runx3 in driving the expression of GL.alpha.. A luciferase reporter plasmid driven by the mouse GL.alpha. promoter (-179/+46) was cotransfected into the M12 B-cell line along with KRC, Runx3 and/or SMAD3 expression constructs. Cotransfection of KRC enhanced the ability of SMAD3 and Runx3 to drive the expression of the reporter plasmid (FIG. 23D). M12 cells express endogenous SMAD3 and therefore it is not clear if the effects of KRC on Runx3 may be independent of SMAD3. Therefore KRC regulates IgA class switching as well as other B cell effector functions by acting downstream of the TGF.beta. receptor in these cells.

[0250] Signaling by Decapentaplegic (Dpp), a member of the TGF.beta. superfamily of signaling molecules similar to vertebrate BMP2 and BMP4, has been implicated in many developmental processes in Drosophila melanogaster. Notably, Dpp acts as a long-range morphogen during imaginal disc growth and patterning. Genetic approaches led to the identification of a number of gene products that constitute the core signaling pathway. Decapentaplegic (Dpp) signaling leads to association of Medea (Med) with Mothers against dpp (Mad) Mammalian homologues of the Drosophila Med and Mad proteins are the SMADs. Once Dpp associates with Med and Mad, it then translocates to the nucleus where it interacts with Schnurri. In addition to Schnurri, Dpp signaling and Brinker (Brk), to prime cells for Dpp responsiveness.

[0251] It has been demonstrated that Schnurri is required for Dpp-mediated gene repression. It was therefore determined whether KRC could interact with the mammalian homologue of Mad, SMAD3. KRC physically interacts with two R-SMADs, SMAD3 and to a lesser extent with SMAD2 but does not interact with the Co-SMAD, SMAD4. This is consistent with what has been observed in Drosophila, where Shn interacts with Mad but not Med. In addition, it was found that KRC enhances the transcriptional ability of SMAD3 to drive expression of a luciferase reporter construct containing a basic SMAD-binding element.

Example 27

KRC Augments Th2 Cytokine Production and Interacts with GATA3

[0252] Composite AP-1/NFAT sites are found in the proximal promoter regions of many cytokine genes such as TNF.alpha., GM-CSF, IL-2, IL-3, IL-4, and IL-5 (Rao, A. 1994. Immunology Today J.sub.--5: 274-281; Rooney, J. et al. 1995. Immunity 2: 473-483.). Given that KRC is an inducible AP-1 coactivator for the IL-2 gene, it was determined whether KRC could regulate other AP-1-dependent genes in T cells. A systematic analysis of cytokine production by primary lymph node (LN) and splenic CD4+ T cells stimulated by plate-bound anti-CD3/CD28 in the absence of polarizing cytokines (unskewed conditions) from KRC WT and KO mice was performed. As was previously published, KRC KO CD4+ cells showed a striking defect in IL-2 production at early time points (up to 36 hours) (Oukka, M., et al. 2004. J Exp Med 199: 15-24.). Additionally, KRC KO T cells displayed reduced proliferation at early time points compared to WT cells, as measured by .sup.3H incorporation. This proliferation defect was completely rescued by the provision of exogenous hIL-2, indicating that it was due completely to reduced IL-2 production. Moreover, analysis of IL-2 production by real-time PCR and ELISA at later time points of primary stimulation showed that KRC KO T cells produced levels of IL-2 equivalent to WT cells at all time points during primary anti-CD3/CD28 stimulation beyond 36 hours showing redundancy by other Schnurri family members. LN and splenic CD4+ cells from KRC WT and KO mice were stimulated by plate-bound antibodies to CD3 (2 .mu.g/ml) and CD28 (1 .mu.g/ml) for 72 hours in the presence of 200 U/ml human IL-2. Supernatants were analyzed for IFN.gamma., IL-4, and IL-5 levels by ELISA. For subsequent experiments described below, exogenous hIL-2 was added to all cultures to account for any early differences between WT and KRC KO CD4+ T cells. Analysis of Th effector cytokine production revealed dramatic differences between KRC WT and KO cells following 72 hours of primary unskewed stimulation. While KRC WT and KO cells secreted similar levels of the Th1 effector cytokine IFN.gamma., production of Th2 effector cytokines IL-4 and IL-5 was drastically reduced in KRC KO cells despite normal proliferation, indicating that the defective Th2 cytokine production was not due to decreased cell division.

[0253] To investigate the consequences of decreased IL-4 and IL-5 in these unskewed primary stimulations, LN and splenic CD4+ cells from KRC WT and KO mice were stimulated by plate-bound antibodies to CD3 (2 .mu.g/ml) and CD28 (1 .mu.g/ml) for 72 hours in the presence of 200 U/ml human IL-2 (unskewed). Cells were expanded for an additional 4 days in the presence of hIL-2 and restimulated with plate-bound anti-CD3. As expected, production of all Th2 effector cytokines was dramatically reduced in secondary stimulations of KRC KO cells. However, when cells were initially stimulated under Th2-polarizing cytokines (IL-4 plus neutralizing antibodies to IFN.gamma.), production of Th2 effector cytokines by KRC KO cells was identical to WT cells. LN and splenic CD4+ cells from KRC WT and KO mice were stimulated by plate-bound antibodies to CD3 (2 .mu.g/ml) and CD28 (1 .mu.g/ml) for 72 hours in the presence of hlL-2, IL-4 and neutralizing antibodies to IFN.gamma. (Th2-skewed). Cells were expanded for 3 days in hlL-2, and restimulated for 18 hours with plate-bound anti-CD3 (2 .mu.g/ml). Supeematants were analyzed for IL-4, IL-5, IL-6, IL-10, and IL-13 levels by ELISA. These results indicated that KRC KO cells were not defective per se in producing Th2 cytokines; rather, KRC was required for the establishment of the Th2 effector cell under unskewed primary stimulation conditions. Given that KRC mRNA is rapidly induced in Thp cells following TCR/CD28 ligation (Oukka, M., et al. 2004. J Exp Med 199: 15-24) and that KRC mRNA levels fall 2-3 days following primary T cell activation, it shows that KRC induction plays a role in reinforcing the activity of factors required for Th2 cell generation. Moreover, since KRC KO cells produce perfectly normal levels of IL-2 at later time points, and KRC KO Th2 effector cells secrete normal levels of all AP-1-dependent Th2 cytokines, these results strongly suggested that KRC's role in Th2 cell generation was independent from its ability to function as an AP-1 coactivator.

[0254] To further analyze the defect in Th2 cell generation in the absence of KRC, RNA and cDNA were prepared from WT and KRC KO CD4+ T cells at 0, 12, 24, and 48 hours following anti-CD3/CD28 stimulation in unskewed conditions. LN and splenic CD4+ cells from KRC WT and KO mice were stimulated by plate-bound antibodies to CD3 (2 .mu.g/ml) and CD28 (1 .mu.g/ml) for the indicated times in the presence of 200 U/ml human IL-2. RNA and cDNA were made and analyzed for the presence of IL-4 and GATA3 mRNA relative to fi-actin using real-time PCR. Levels of IL-4 and GATA3 transcripts were analyzed by real time PCR. Although initial induction of IL-4 mRNA was comparable between WT and KO cells, KRC KO cells were unable to fully upregulate IL-4 following 48 hours of CD3/CD28 stimulation. Strikingly, this defect in production of high levels of IL-4 mRNA was accompanied by nearly absent upregulation of the Th2-specific transcription factor GATA3 at these time points.

[0255] Since the defect in GATA3 upregulation preceded the defect in IL-4 upregulation, the primary lesion in Th2 cell generation in the absence of KRC was in the early induction of GATA3. Therefore, WT and KRC KO cells were transduced with control GFP and bicistronic GFP-GATA3 retroviruses 24 hours following primary TCR/CD28 stimulation in unskewed conditions. Cells were then expanded in hIL-2, restimulated with PMA/ionomycin, and assayed for secondary Th2 cytokine production by intracellular cytokine staining. LN and splenic CD4+ cells from KRC WT and KO mice were stimulated by plate-bound antibodies to CD3 (2 .mu.g/ml) and CD28 (1 .mu.g/ml) for 24 hours in the presence of hIL-2. Cells were then infected with retroviruses expressing either GFP or GFP-GATA3. Cells were expanded in hIL-2 for 3 days, and subsequently restimulated with PMA/ionomycin for 6 hours. Intracellular cytokine staining to analyze IL-4 production in GATA3-negative and GATA3-positive cells was performed. As expected, GFP-negative and control GFP-expressing KRC KO cells showed reduction in intensity of IL-4 and absolute cell number of IL-4 producers (FIG. 24G). Additionally, although levels of GFP were identical between WT and KO RV-GATA3 cultures, KRC KO RV-GATA3-expressing cells failed to express levels of IL-4 comparable to WT RV-GATA3-expressing cells. These results indicated that KRC lay both upstream and downstream of GATA3 in its ability to regulate the generation of IL-4-producing Th2 cells.

[0256] In addition to its ability to directly transactivate the IL-5 and IL-13 genes and to induce chromatin remodeling of the entire Th2 cytokine locus, another well-documented property of GATA3, like many `master regulator` transcription factors, is its ability to auto-activate itself (Ouyang, W., et al. 2000. Immunity 12: 27-37). Since both GATA3 induction and GATA3 activity were reduced in KRC KO cells, KRC plays a role in directly regulating the function of GATA3, in its ability to auto-activate itself and/or in its ability to drive activation of the Th2 cytokine locus. Since KRC can interact with SMAD3 and SMAD3 can bind and potentiate GATA3-driven transcription (Blokzijl, A., et al. 2002. Curr Biol 12: 35-45), KRC could regulate GATA3 activity by binding GATA3 itself. 293T cells were transfected with KRC with or without FLAG-GATA3. 48 hours later, cells were lysed and FLAG-tagged proteins were immunoprecipitated overnight with anti-FLAG beads. Immunoprecipitates were washed, resolved by SDS-PAGE, and KRC was detected by immunoblotting. When-overexpressed in 293T cells, FLAG-GATA3 specifically precipitated overexpressed KRC. To evaluate the function of this physical interaction, the ability of overexpressed KRC to regulate GATA3-driven transcription from an IL-5-luciferase construct (Miaw, S. C, et al. 2000. Immunity 12: 323-333) was tested in EL4 cells. While-KRC had no effect on IL-5-driven transcription in the absence of co-expressed GATA3, the combination of KRC and GATA3 led to dramatic enhancement of GATA3 transcriptional activity, consistent with the previously-described role for KRC as a transcriptional coactivator. Note that neither Shn-1 nor Shn2 could augment GATA3-dependent IL-5 promoter activation. Finally, to determine whether KRC could potentiate GATA3-driven auto-activation of the GATA3 gene itself, the ability of KRC to potentiate GATA3's ability to drive activation of different segments of the GATA3 genomic locus fused to luciferase was tested (Hwang, E. S., et al. 2002. J Immunol 169: 248-253). Much like its ability to potentiate GATA3's activity on the IL-5 promoter, KRC also strongly enhanced the ability of GATA3 to drive expression from a previously described intronic enhancer between exons 1 and 2 of the GATA3 locus. EL4 cells were electroporated with 1 .mu.g IL-5-luciferase reporter or 1 .mu.g of GATA3-luciferase reporters with combinations of GATA3 (4 .mu.g) and Shns 1,2 and 3 (20 .mu.g). 18 hours later, cells were stimulated with PMA/ionomycin for 6 hours and luciferase activity was determined.

Example 28

KRC Degrades its Partners

[0257] In the course of mapping the interaction site of KRC with c-Jun, it was observed that coimmunoprecipitation of full-length KRC with c-Jun in overexpression experiments resulted in very small amounts of c-Jun and no detectable c-Fos protein when compared to truncated KRC. These results raised the possibility that association of full-length KRC protein with its partners might lead to their degradation. Experiments in which KRC was coexpressed with c-Jun, c-fos, SMAD3, Runx2, GATA3 and TRAF2 were performed. 293T cells were transiently transfected with c-Jun, c-Fos, or FLAG-tagged Smad3, Runx2, Gata3, and Traf2 with or without KRC. 48 hours later, cells were treated with 10 .mu.g/ml cycloheximide for 15 minutes. Whole cell lysates were prepared and 30 .mu.g protein/sample was resolved by SDS-PAGE followed by immunoblotting for c-Jun, c-Fos, or FLAG. Blots were stripped and reprobed with anti-Hsp90 antibody as a loading control. Overexpression of full-length KRC in the presence of low dose cycloheximide to block endogeneous protein synthesis led to the rapid degradation of all of these proteins. However, KRC augments cjun, SMAD3 and GATA3-dependent gene activation despite its ability to degrade these transcription factors. Ubiquitination of transcription factors leads to their degradation but also can increase their potency in transactivation simultaneously with their degradation (Molinari, E., et al. 1999 Embo J 18:6439-6447; Salghetti, S. E., et al. 2001. Science 293: 1651-1653; von der Lehr, et al. 2003. Mol Cell H: 1189-1200; Grossman, S. R., et al. 2003. Science 300: 342-344; Greer, S. F., et al. 2003. Nat Immunol 4: 1074-1082.). Further, inclusion of the proteasome inhibitor MG-132 prevented the degradation of Fos by KRC. Therefore, KRC might be an E3 ubiquitin ligase.

Example 29

KRC Ubiquitinates its Partmers, TRAF2 and Runx2

[0258] It is known that KRC physically associates with the above transcription factors, and that this association results in the degradation of these proteins. One major pathway for protein degradation is the ubiquitin/protesasome complex. In preliminary ubiquitination assays, increased ubiquitination of two KRC partners, TRAF2 and Runx2, was detected, demonstrating that KRC functions as a component of an E3 ligase. These experiments were performed by transiently transfecting 293T cells with FLAG-tagged Runx2 or Traf2 with or without KRC. 48 hours later, cells were treated with 10 ug/ml cycloheximide for 15 minutes. Whole cell lysates were prepared and 30 ug protein/sample was resolved by SDS-PAGE followed by immunoblotting for FLAG. Blots were stripped and reprobed with anti-Hsp90 antibody as a loading control. 293T cells were transiently transfected with FLAG-tagged Runx2 or Traf2 with the indicated combinations of His-Ubiquitin and KRC. 48 hours later, cells were treated with the proteasome inhibitor MG132 (10 uM) for 2 hours. Cells were lysed in 6M guanidium-Hcl, and His-ubiquitin-conjugated proteins were precipitated with Ni-NTA agarose. Precipitates were washed and resolved by SDS-PAGE followed by immunoblotting anti-FLAG to detect poly-ubiquitinated Runx2 or Traf2 species.

[0259] The fuinctional outcome of TRAF2 and Runx2 degradation is straightforward since KRC actually represses TRAF2 and Runx 2 driven responses in vitro (Oukka, M., Kim, et al. Mol Cell 9: 121-131).

Example 30

Shn2 and KRC Have Overlapping but Unique Functions

[0260] Mice that lack Shn2 have severely impaired positive selection of CD4+ and CD8+ cells, and peripheral CD4 T cells had impaired production of IL-2 (Takagi, T., et al. 2001. Nat Immunol 2: 1048-1053). The mechanism by which Shn2 acts to control these functions has not been established. In order to determine how Shn2 controls these T cell fuinctions, Jurkat cells were electroporated with 2 ug 2.times.AP-1-luciferase reporter along with 20 ug vector, Shn2, or KRC DNA. Eighteen hours later, cells were stimulated with PMA/ionomycin for 6 hours and luciferase activity was determined. Like KRC, Shn2 associates with AP-1 to transactivate an AP-1 reporter. However, Shn2 does not coactivate SMAD3 or GATA3's ability to transactivate the GL(X or IL-5 genes, respectively, in the absence or presence of TGF.beta..

Example 31

Phenotypic Analysis of KRC Knockout Animals

[0261] The most pronounced immune system abnormalities of these mice are evidence of impaired TGF.beta.R signaling in B cells and impaired early development of the T helper 2 (Th2) lineage from its progenitor (Thp), i.e. KRC KO Th cells have impaired production of Th2, but not Th1 cytokines. Analysis of serum Igs in KRC KO mice as well as in vitro secretion of Igs by KRC KO B cells has also revealed a role for KRC in the regulation of IgA production.

[0262] The generation and regulation of effector B cell functions involve a complex temporal network of cytokines, signaling proteins, and transcription factors. Dysregulation of any one component may compromise the B cell's ability to mediate its effector functions and contribute to a failure of the host immune system to effectively respond to foreign pathogens. As described above, deletion of KRC results in impaired IgA secretion and transcription of the GL.alpha. gene in vivo.

[0263] TGF.beta. has been demonstrated to influence various aspects of normal B cell biology and is important in regulating humoral immune responses. In normal cells, TGF.beta. signaling is initiated when this molecule binds to and induces a heterodimeric cell-surface complex consisting of type I (ThRI) and type II (THRII) serine/threonine kinase receptors. This heterodimeric receptor then propagates the signal through phosphorylation of downstream target SMAD proteins. There are three fuinctional classes of SMAD protein, receptor-regulated SMADs (R-SMADs), Co-mediator SMADs (Co-SMADs) and inhibitory SMADs (I-SMADs). Following phosphorylation by the heterodimeric receptor complex, the R-SMADs complex with the Co-SMAD and translocate to the nucleus, where in conjunction with other nuclear proteins, they regulate the transcription of target genes (Derynck, R., et al. (1998) Cell 95: 737-740).

[0264] Mice with a B-cell specific inactivation of T.beta.RII have increased B-cell responsiveness, enhanced antibody production and a selective defect in the production of antigen-specific IgA (Cazac, B. B., and Roes, J. (2000) Immunity 13: 443-451). Further analysis of TGF.beta. signaling in B cells has demonstrated that this cytokine can modulate the expression of approximately 100 different genes in B cells (Roes, J., et al. (2003) Proc Natl Acad Sci USA 100: 7241-7246). TGF.beta. can elicit different cellular responses in B cells through its ability to positively and negatively regulate gene transcription. Both activation and repression of gene expression by TGF.beta. utilize the same set of ubiquitous SMAD proteins. However, specific cofactors that bind to SMADs are believed to dictate whether a gene is upregulated or downregulated in response to TGF.beta. (Shi, Y., and Massague, J. (2003) Cell 113: 685-700). A similar transcriptional mechanism may account for the variable effects of TGF.beta. on B-cell effector function. Identification of the different cofactors expressed in B cells will be critical to fully understand how TGF.beta. regulates B cell fuinction.

[0265] Disruption of those molecular pathways that regulate B cell function may also contribute to the development of B-cell leukemia and lymphomas. Most lymphoid neoplasms have chromosomal translocations or mutations that allow them to bypass the normal cellular checkpoints that control their propagation. During normal physiological processes, TGF.beta. serves as a potent negative regulator of cell growth and differentiation, thus serving as a key tumor suppressor. Several hematopoietic neoplasms, including B cell chronic lymphocytic leukemia (B-CLL), have genetic alterations that impair TGF.beta. signaling in these cells and render them nonresponsive to the growth-inhibiting effects of TGF.beta. (Schiemann, W. P., et al. (2004) Cancer Detect Prev 28: 57-64).

[0266] No role for the mammalian Shn genes in TGF.beta. signaling has yet to be identified although the three known vertebrate Shn orthologs have been postulated to be downstream of the bone morphogenetic protein-transforming growth factor-beta-activin signaling pathways (Rusten, T. E., et al. (2002) Development 129: 3575-3584). Given the well-defined role of Drosophila Shn in regulating Dpp, it was determined whether KRC is a component of the TGF.beta. signaling pathway. Indeed, it has been demonstrated that KRC physically interacts with two R-SMADs, SMAD3 and to a lesser extent with SMAD2, but does not interact with the Co-SMAD, SMAD4. This is consistent with what has been observed in Drosophila, where Shn interacts with Mad but not Med. In addition, KRC enhances the transcriptional ability of SMAD3 to drive expression of a luciferase reporter construct containing a basic SMAD-binding element.

[0267] KRC is not downstream of TGF.beta.R in T cells but that it is downstream of the TGF.beta.R in osteoblasts as well as in B cells. A profound abnormality in development of the skelet al system is present in KRC KO mice. These mice exhibit an osteosclerotic phenotype that is characterized by increases in trabecular bone mass, bone mineral density and bone formation consistent with impaired signaling through the TGF.beta. receptor. While SMAD3 and the transcription factor Runx3 interact to activate transcription of the GL.alpha. gene, SMAD3 and another Runx family member, Runx2 act to repress transcription of the osteocalcin gene. KRC interacts with all three transcription factors. However, while KRC is a coactivator of GL.alpha. promoter activity, it is a corepressor of the osteocalcin gene. Hence, in its absence, GL.alpha. transcription is diminished in B cells but osteocalcin gene transcription is augmented in osteoblasts.

Equivalents

[0268] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Sequence CWU 1

1

8 1 8546 DNA Homo sapiens CDS (889)...(8106) 1 acacctgcgc gccggaataa ttcatgaaga aggggctgga tccgtgggtc agagaacaca 60 ggaccagttt gccatcccaa ggccgaaggc ctccctccaa cacagttctc caagctctag 120 aaatctctga cacatcttga ccatgagacc acggctggtt tttggcagga ttcgaggcac 180 aaacccagca gcctcaacct agttcatgga ggagcctcgc ggggtcctgg ccaagcaagc 240 ccgcccctct ggtgggaaga gcggcgccta ggtggagggt ggctgccgta ggagtggaca 300 tgaatgctgg ctttcagaga gaacagcgtt tcagttttgg tcatcggaag tggtgccttc 360 agcacagaag aagagcgtga tttctcctcc aaggccgttg atctccaacc cagaactaaa 420 ggggagaaga gccaccccca gcatccagcg tggcatctct tgtgccagga ccagggatga 480 ctgggccatg gacacagatg tctccaacct tcaaccgttt gcatagcaca cgggggactc 540 gtgggggcca cctgccactg ccagctgaaa taatacaatg gcaatactga catccttcat 600 gacgttttcc cgacagacat tcaggcagaa agtgctggtg cgttttctgt ctgcaaagta 660 gagggccatc gctcaccaat agaatagcgt gggccctgat gacctgctcc gagtccactc 720 acagccagtg acacttgcaa aaaactccca aagccgtctt gggtttggct cccacagctc 780 ttgaccaatg tggccaaagc tggacacctc cttgggacac tgggattatt cataaatgca 840 gcccgccctg actctccctg aatagcatct gaagtctttg tgaaggtc atg gat cct 897 Met Asp Pro 1 gaa caa agt gtc aag ggc acc aag aag gct gag gga agt ccc cgg aag 945 Glu Gln Ser Val Lys Gly Thr Lys Lys Ala Glu Gly Ser Pro Arg Lys 5 10 15 cgg ctg acc aaa gga gag gcc att cag acc agt gtt tct tcc agc gtc 993 Arg Leu Thr Lys Gly Glu Ala Ile Gln Thr Ser Val Ser Ser Ser Val 20 25 30 35 cca tac cca ggc agc ggc aca gct ccg acc caa gag agc ccc gcc caa 1041 Pro Tyr Pro Gly Ser Gly Thr Ala Pro Thr Gln Glu Ser Pro Ala Gln 40 45 50 gag ctc tta gcc ccg cag ccc ttc ccg ggc ccc tca tca gtt ctt agg 1089 Glu Leu Leu Ala Pro Gln Pro Phe Pro Gly Pro Ser Ser Val Leu Arg 55 60 65 gaa ggc tct cag gag aaa acg ggc cag cag cag aag ccc ccc aaa agg 1137 Glu Gly Ser Gln Glu Lys Thr Gly Gln Gln Gln Lys Pro Pro Lys Arg 70 75 80 ccc ccc atc gaa gca tcc gtc cac atc tca cac gtt ccg cag cac cct 1185 Pro Pro Ile Glu Ala Ser Val His Ile Ser His Val Pro Gln His Pro 85 90 95 ctg aca cca gca ttc atg tcg cct ggc aaa cct gag cat ctc ctg gag 1233 Leu Thr Pro Ala Phe Met Ser Pro Gly Lys Pro Glu His Leu Leu Glu 100 105 110 115 ggg tcc aca tgg caa ctg gtt agc ccc atg aga ctc gga ccc tct ggc 1281 Gly Ser Thr Trp Gln Leu Val Ser Pro Met Arg Leu Gly Pro Ser Gly 120 125 130 tcc ttg ctg gcc cct ggg ctc cat cct cag agc cag ctc ctt cct tcc 1329 Ser Leu Leu Ala Pro Gly Leu His Pro Gln Ser Gln Leu Leu Pro Ser 135 140 145 cac gct tcc atc att ccc ccc gag gac ctt cct gga gtc ccc aaa gtc 1377 His Ala Ser Ile Ile Pro Pro Glu Asp Leu Pro Gly Val Pro Lys Val 150 155 160 ttc gtg cct cgt cct tcc cag gtc tcc ttg aag ccc aca gaa gag gca 1425 Phe Val Pro Arg Pro Ser Gln Val Ser Leu Lys Pro Thr Glu Glu Ala 165 170 175 cac aag aag gag agg aag ccc cag aag cca ggc aag tac atc tgc cag 1473 His Lys Lys Glu Arg Lys Pro Gln Lys Pro Gly Lys Tyr Ile Cys Gln 180 185 190 195 tac tgc agc cgg ccc tgt gcc aag ccc agc gtg ctc cag aag cac att 1521 Tyr Cys Ser Arg Pro Cys Ala Lys Pro Ser Val Leu Gln Lys His Ile 200 205 210 cgc tca cac aca ggt gag agg ccc tac ccc tgc ggc ccc tgt ggc ttc 1569 Arg Ser His Thr Gly Glu Arg Pro Tyr Pro Cys Gly Pro Cys Gly Phe 215 220 225 tcc ttc aag acc aag agt aat ctc tac aag cac agg aag tcc cat gcc 1617 Ser Phe Lys Thr Lys Ser Asn Leu Tyr Lys His Arg Lys Ser His Ala 230 235 240 cac cgc atc aaa gca ggc ctg gcc tca ggc atg ggt ggc gag atg tac 1665 His Arg Ile Lys Ala Gly Leu Ala Ser Gly Met Gly Gly Glu Met Tyr 245 250 255 cca cat ggg ctg gag atg gag cgg atc cct ggg gaa gag ttt gag gag 1713 Pro His Gly Leu Glu Met Glu Arg Ile Pro Gly Glu Glu Phe Glu Glu 260 265 270 275 ccc act gag gga gaa agc aca gat tct gaa gag gag act agt gcc acc 1761 Pro Thr Glu Gly Glu Ser Thr Asp Ser Glu Glu Glu Thr Ser Ala Thr 280 285 290 tct ggt cac cct gca gag ctc tcc cca aga ccc aag cag ccc ctt ctc 1809 Ser Gly His Pro Ala Glu Leu Ser Pro Arg Pro Lys Gln Pro Leu Leu 295 300 305 tcc agc ggg cta tac agc tct ggg agc cac agt tcc agc cac gaa cgc 1857 Ser Ser Gly Leu Tyr Ser Ser Gly Ser His Ser Ser Ser His Glu Arg 310 315 320 tgt tcc ctg tcc cag tcc agc aca gcc cag tca ctc gaa gac ccc cct 1905 Cys Ser Leu Ser Gln Ser Ser Thr Ala Gln Ser Leu Glu Asp Pro Pro 325 330 335 cca ttt gtg gaa ccc tca tct gag cac ccc ctg agc cat aaa cct gaa 1953 Pro Phe Val Glu Pro Ser Ser Glu His Pro Leu Ser His Lys Pro Glu 340 345 350 355 gac acc cac acg att aag cag aag ctg gcc ctc cgc tta agc gag agg 2001 Asp Thr His Thr Ile Lys Gln Lys Leu Ala Leu Arg Leu Ser Glu Arg 360 365 370 aag aag gtg atc gat gag cag gcg ttt ctg agc cca ggc agc aaa ggg 2049 Lys Lys Val Ile Asp Glu Gln Ala Phe Leu Ser Pro Gly Ser Lys Gly 375 380 385 agt act gag tct ggg tat ttc tct cgc tcc gag agt gca gag cag cag 2097 Ser Thr Glu Ser Gly Tyr Phe Ser Arg Ser Glu Ser Ala Glu Gln Gln 390 395 400 gtc agc ccc cca aac acc aac gcc aag tcc tac gct gag atc atc ttt 2145 Val Ser Pro Pro Asn Thr Asn Ala Lys Ser Tyr Ala Glu Ile Ile Phe 405 410 415 ggc aag tgt ggg cga ata gga cag cgg acc gcc atg ctg aca gcc acc 2193 Gly Lys Cys Gly Arg Ile Gly Gln Arg Thr Ala Met Leu Thr Ala Thr 420 425 430 435 tcc acc cag ccc ctc ctg ccc ctc tcc acc gaa gac aag ccc agc ctg 2241 Ser Thr Gln Pro Leu Leu Pro Leu Ser Thr Glu Asp Lys Pro Ser Leu 440 445 450 gtg cct ttg tct gta ccc cgg acg cag gtg atc gag cac atc acg aag 2289 Val Pro Leu Ser Val Pro Arg Thr Gln Val Ile Glu His Ile Thr Lys 455 460 465 ctc atc acc atc aac gag gcc gtg gtg gac acc agt gag atc gac agc 2337 Leu Ile Thr Ile Asn Glu Ala Val Val Asp Thr Ser Glu Ile Asp Ser 470 475 480 gtg aag cca agg cgg agc tca ctg tcc agg cgc agc agc atg gag tcc 2385 Val Lys Pro Arg Arg Ser Ser Leu Ser Arg Arg Ser Ser Met Glu Ser 485 490 495 cca aaa tcc agc ctc tac cgg gag ccc ctg tca tcc cac agt gag aaa 2433 Pro Lys Ser Ser Leu Tyr Arg Glu Pro Leu Ser Ser His Ser Glu Lys 500 505 510 515 acc aag cct gaa caa tca ctg ctg agc ctc cag cac ccg ccc agt acc 2481 Thr Lys Pro Glu Gln Ser Leu Leu Ser Leu Gln His Pro Pro Ser Thr 520 525 530 gcc ccc cct gtg cct ctc ctg aga agc cac tca atg cct tct gcc gcc 2529 Ala Pro Pro Val Pro Leu Leu Arg Ser His Ser Met Pro Ser Ala Ala 535 540 545 tgc act atc agc acc ccc cac cac ccc ttc cga ggt agc tac tcc ttc 2577 Cys Thr Ile Ser Thr Pro His His Pro Phe Arg Gly Ser Tyr Ser Phe 550 555 560 gat gac cat atc acc gac tcc gaa gcc ctg agc cgc agc agt cac gtg 2625 Asp Asp His Ile Thr Asp Ser Glu Ala Leu Ser Arg Ser Ser His Val 565 570 575 ttt acc tcc cac ccc cgg atg ctg aag ccg cag ccg gca atc gaa tta 2673 Phe Thr Ser His Pro Arg Met Leu Lys Pro Gln Pro Ala Ile Glu Leu 580 585 590 595 cct ttg gga ggg gaa tac agt tct gag gag cct ggc cca agc agc aaa 2721 Pro Leu Gly Gly Glu Tyr Ser Ser Glu Glu Pro Gly Pro Ser Ser Lys 600 605 610 gac aca gcc tcc aag ccc tcg gac gaa gtg gaa ccc aag gaa agc gag 2769 Asp Thr Ala Ser Lys Pro Ser Asp Glu Val Glu Pro Lys Glu Ser Glu 615 620 625 ctt acc aaa aag acc aag aag ggt ttg aaa aca aaa ggg gtg atc tac 2817 Leu Thr Lys Lys Thr Lys Lys Gly Leu Lys Thr Lys Gly Val Ile Tyr 630 635 640 gaa tgt aac ata tgt ggt gct cgg tac aag aaa agg gat aac tac gaa 2865 Glu Cys Asn Ile Cys Gly Ala Arg Tyr Lys Lys Arg Asp Asn Tyr Glu 645 650 655 gcc cac aaa aaa tac tac tgc tca gag ctt cag atc gca aag ccc atc 2913 Ala His Lys Lys Tyr Tyr Cys Ser Glu Leu Gln Ile Ala Lys Pro Ile 660 665 670 675 tct gca ggc acc cac aca tct cca gaa gct gaa aag agt cag att gag 2961 Ser Ala Gly Thr His Thr Ser Pro Glu Ala Glu Lys Ser Gln Ile Glu 680 685 690 cat gag ccg tgg tcc caa atg atg cat tac aaa ctg gga acc acc ctg 3009 His Glu Pro Trp Ser Gln Met Met His Tyr Lys Leu Gly Thr Thr Leu 695 700 705 gaa ctc act cca ctg agg aag agg agg aaa gag aag agc ctt ggg gac 3057 Glu Leu Thr Pro Leu Arg Lys Arg Arg Lys Glu Lys Ser Leu Gly Asp 710 715 720 gag gaa gag cca cct gcc ttt gag tcc aca aaa agt cag ttt ggc agc 3105 Glu Glu Glu Pro Pro Ala Phe Glu Ser Thr Lys Ser Gln Phe Gly Ser 725 730 735 ccc ggg cca tct gat gct gct cgg aac ctt ccc ctg gag tcc acc aag 3153 Pro Gly Pro Ser Asp Ala Ala Arg Asn Leu Pro Leu Glu Ser Thr Lys 740 745 750 755 tca cca gca gaa cca agt aaa tca gtg ccc tcc ttg gag gga ccc acg 3201 Ser Pro Ala Glu Pro Ser Lys Ser Val Pro Ser Leu Glu Gly Pro Thr 760 765 770 ggc ttc cag cca agg act ccc aag cca ggg tcc ggt tca gaa tca ggg 3249 Gly Phe Gln Pro Arg Thr Pro Lys Pro Gly Ser Gly Ser Glu Ser Gly 775 780 785 aag gag agg aga aca acg tcc aaa gaa att tct gtc atc cag cac acc 3297 Lys Glu Arg Arg Thr Thr Ser Lys Glu Ile Ser Val Ile Gln His Thr 790 795 800 agc tcc ttt gag aaa tct gat tct ctc gag cag ccg agt ggc ttg gaa 3345 Ser Ser Phe Glu Lys Ser Asp Ser Leu Glu Gln Pro Ser Gly Leu Glu 805 810 815 ggg gaa gac aaa cct ctg gcc cag ttc cca tca ccc cca cct gcc cca 3393 Gly Glu Asp Lys Pro Leu Ala Gln Phe Pro Ser Pro Pro Pro Ala Pro 820 825 830 835 cac gga cgc tct gct cac tcc ctg cag cct aag ttg gtc cgc cag ccc 3441 His Gly Arg Ser Ala His Ser Leu Gln Pro Lys Leu Val Arg Gln Pro 840 845 850 aac att cag gtt cct gag atc cta gta act gag gag cct gac cgg ccg 3489 Asn Ile Gln Val Pro Glu Ile Leu Val Thr Glu Glu Pro Asp Arg Pro 855 860 865 gac aca gag cca gag ccg ccc cct aag gaa cct gag aag act gag gag 3537 Asp Thr Glu Pro Glu Pro Pro Pro Lys Glu Pro Glu Lys Thr Glu Glu 870 875 880 ttc caa tgg ccc cag cgc agc cag aca ctt gcc cag ctc cca gct gag 3585 Phe Gln Trp Pro Gln Arg Ser Gln Thr Leu Ala Gln Leu Pro Ala Glu 885 890 895 aag gct cca ccc aaa aag aag agg ttg cgc ctg gca gag atg gcc caa 3633 Lys Ala Pro Pro Lys Lys Lys Arg Leu Arg Leu Ala Glu Met Ala Gln 900 905 910 915 tca tca ggg gag tcc agc ttc gag tcc tct gtg cct ctg tct cgc agc 3681 Ser Ser Gly Glu Ser Ser Phe Glu Ser Ser Val Pro Leu Ser Arg Ser 920 925 930 ccg agc cag gaa agc aat gtc tct ttg agt ggg tcc agc cgc tca gcc 3729 Pro Ser Gln Glu Ser Asn Val Ser Leu Ser Gly Ser Ser Arg Ser Ala 935 940 945 tcg ttt gag agg gat gac cat ggg aaa gcc gag gcc ccc gat ccc tca 3777 Ser Phe Glu Arg Asp Asp His Gly Lys Ala Glu Ala Pro Asp Pro Ser 950 955 960 tct gac atg cgc ccc aaa ccc ctg ggc acc cac atg ttg act gtc ccc 3825 Ser Asp Met Arg Pro Lys Pro Leu Gly Thr His Met Leu Thr Val Pro 965 970 975 agc cac cac cca cat gcc cga gag atg cgg agg tca gcc tca gag cag 3873 Ser His His Pro His Ala Arg Glu Met Arg Arg Ser Ala Ser Glu Gln 980 985 990 995 agc ccc aac gtt tcc cat tct gcc cac atg acc gag aca cgc agc aaa 3921 Ser Pro Asn Val Ser His Ser Ala His Met Thr Glu Thr Arg Ser Lys 1000 1005 1010 tcc ttt gac tat ggc agc ttg tcc ttg aca ggc cct tct gct cca gcc 3969 Ser Phe Asp Tyr Gly Ser Leu Ser Leu Thr Gly Pro Ser Ala Pro Ala 1015 1020 1025 cca gtg gct cca cca gcc ggg gag gcc ccg cca gag aga aga aaa tgc 4017 Pro Val Ala Pro Pro Ala Gly Glu Ala Pro Pro Glu Arg Arg Lys Cys 1030 1035 1040 ttc ttg gtg aga agc ccc tct ctg agc agg cct cca gaa tct gag ttg 4065 Phe Leu Val Arg Ser Pro Ser Leu Ser Arg Pro Pro Glu Ser Glu Leu 1045 1050 1055 gag gtt gcc ccc aag gga aga cag gag agc gaa gaa cca cag ccc tca 4113 Glu Val Ala Pro Lys Gly Arg Gln Glu Ser Glu Glu Pro Gln Pro Ser 1060 1065 1070 1075 tcc agt aaa ccc tct gcc aaa agc tca ttg tcc cag att tcc tct gcg 4161 Ser Ser Lys Pro Ser Ala Lys Ser Ser Leu Ser Gln Ile Ser Ser Ala 1080 1085 1090 gcc acc tca cat ggt gga ccc ccg gga ggc aag ggc cca ggg cag gac 4209 Ala Thr Ser His Gly Gly Pro Pro Gly Gly Lys Gly Pro Gly Gln Asp 1095 1100 1105 agg ccc gca ttg ggg ccc act gtg ccc tac aca gaa gca ctg caa gtg 4257 Arg Pro Ala Leu Gly Pro Thr Val Pro Tyr Thr Glu Ala Leu Gln Val 1110 1115 1120 ttc cac cac ccc gtt gcc cag aca ccc ctg cat gag aag cca tac ctg 4305 Phe His His Pro Val Ala Gln Thr Pro Leu His Glu Lys Pro Tyr Leu 1125 1130 1135 ccc cca cca gtc tcc ctt ttc tcc ttc cag cat ctc gtg cag cat gag 4353 Pro Pro Pro Val Ser Leu Phe Ser Phe Gln His Leu Val Gln His Glu 1140 1145 1150 1155 cca gga cag tct cca gaa ttc ttc tcc acc cag gcc atg tcc agc ctc 4401 Pro Gly Gln Ser Pro Glu Phe Phe Ser Thr Gln Ala Met Ser Ser Leu 1160 1165 1170 ctg tcc tca cca tac tcc atg ccc cca ctt cct ccc tcc tta ttt caa 4449 Leu Ser Ser Pro Tyr Ser Met Pro Pro Leu Pro Pro Ser Leu Phe Gln 1175 1180 1185 gcc cca ccg ctt cct ctc cag cct act gtt ctg cac cca ggc caa ctc 4497 Ala Pro Pro Leu Pro Leu Gln Pro Thr Val Leu His Pro Gly Gln Leu 1190 1195 1200 cat ctc ccc cag ctc atg cct cac cca gcc aac atc ccc ttc agg caa 4545 His Leu Pro Gln Leu Met Pro His Pro Ala Asn Ile Pro Phe Arg Gln 1205 1210 1215 ccc cct tcc ttc ctc ccc atg cca tac ccg acc tcc tca gca ctg tct 4593 Pro Pro Ser Phe Leu Pro Met Pro Tyr Pro Thr Ser Ser Ala Leu Ser 1220 1225 1230 1235 tct ggg ttt ttc ctg cct ctg caa tcc cag ttt gca ctt cag ctc cct 4641 Ser Gly Phe Phe Leu Pro Leu Gln Ser Gln Phe Ala Leu Gln Leu Pro 1240 1245 1250 ggt gat gtg gaa agc cat ctg ccc cag atc aaa acc agc ctg gcc cca 4689 Gly Asp Val Glu Ser His Leu Pro Gln Ile Lys Thr Ser Leu Ala Pro 1255 1260 1265 ctg gca aca gga agt gct ggc ctc tcc ccc agc caa gag tac agc agt 4737 Leu Ala Thr Gly Ser Ala Gly Leu Ser Pro Ser Gln Glu Tyr Ser Ser 1270 1275 1280 gac atc cgg cta ccc cct gtg gct ccc cca gcc agc tcc tca gca cct 4785 Asp Ile Arg Leu Pro Pro Val Ala Pro Pro Ala Ser Ser Ser Ala Pro 1285 1290 1295 aca tca gct cct cca ctg gcc ctg cct gcc tgt cca gac acc atg gtg 4833 Thr Ser Ala Pro Pro Leu Ala Leu Pro Ala Cys Pro Asp Thr Met Val 1300 1305 1310 1315 tcc ctg gtt gtg cct gtc cgt gtt cag acc aat atg ccg tcc tat ggg 4881 Ser Leu Val Val Pro Val Arg Val Gln Thr Asn Met Pro Ser Tyr Gly 1320 1325 1330 agc gca atg tac acc acc ctt tcc cag atc ttg gtc acc cag tcc caa 4929 Ser Ala Met Tyr Thr Thr Leu Ser Gln Ile Leu Val Thr Gln Ser Gln 1335 1340 1345 ggc agc tca gca act gtg gca ctt ccc aag ttt gag gaa ccc cca tca 4977 Gly Ser Ser Ala Thr Val Ala Leu Pro Lys Phe Glu Glu Pro Pro Ser 1350 1355 1360 aag ggg acg act gta tgt ggt gca gat gtg cat gag gtt ggg ccc ggc 5025 Lys Gly Thr Thr Val Cys Gly Ala Asp Val His Glu Val Gly Pro Gly 1365 1370 1375 cct tct ggg tta agt gaa gag caa agc aga gct ttc cca act cca tac 5073 Pro Ser Gly Leu Ser Glu Glu Gln Ser Arg Ala Phe Pro Thr Pro Tyr 1380 1385 1390 1395 ctg aga gtg cct gtg aca tta cct gaa aga aaa ggc act tcc ctg tca 5121 Leu Arg Val Pro Val Thr Leu Pro Glu Arg Lys Gly Thr Ser Leu Ser 1400 1405 1410 tca gag agt atc ttg agc ctg gag ggg agt tca

tca aca gca ggg gga 5169 Ser Glu Ser Ile Leu Ser Leu Glu Gly Ser Ser Ser Thr Ala Gly Gly 1415 1420 1425 agc aaa cgt gtc ctt tca cca gct ggc agc ctt gaa ctt acc atg gaa 5217 Ser Lys Arg Val Leu Ser Pro Ala Gly Ser Leu Glu Leu Thr Met Glu 1430 1435 1440 acc cag cag caa aaa aga gtg aag gag gag gag gct tcc aag gca gat 5265 Thr Gln Gln Gln Lys Arg Val Lys Glu Glu Glu Ala Ser Lys Ala Asp 1445 1450 1455 gaa aaa ctt gag ctg gta aaa cca tgc agt gtg gtc ctt acc agc acc 5313 Glu Lys Leu Glu Leu Val Lys Pro Cys Ser Val Val Leu Thr Ser Thr 1460 1465 1470 1475 gag gat ggg aag agg cca gag aaa tcc cac tta ggc aac cag ggc caa 5361 Glu Asp Gly Lys Arg Pro Glu Lys Ser His Leu Gly Asn Gln Gly Gln 1480 1485 1490 ggc agg agg gag cta gaa atg ctg tcc agc ctg tcc tca gat cca tct 5409 Gly Arg Arg Glu Leu Glu Met Leu Ser Ser Leu Ser Ser Asp Pro Ser 1495 1500 1505 gac aca aag gaa att cct ccc ctc cct cac cct gca ttg tcc cat ggg 5457 Asp Thr Lys Glu Ile Pro Pro Leu Pro His Pro Ala Leu Ser His Gly 1510 1515 1520 caa gcc cca ggc tca gaa gct ttg aag gaa tat ccc cag cca tct ggc 5505 Gln Ala Pro Gly Ser Glu Ala Leu Lys Glu Tyr Pro Gln Pro Ser Gly 1525 1530 1535 aaa cct cac cga aga ggg ttg acc cca ctg agc gtg aag aaa gaa gat 5553 Lys Pro His Arg Arg Gly Leu Thr Pro Leu Ser Val Lys Lys Glu Asp 1540 1545 1550 1555 tcc aag gaa caa cct gat ctc ccc tcc ttg gca cct ccg agc tct ctg 5601 Ser Lys Glu Gln Pro Asp Leu Pro Ser Leu Ala Pro Pro Ser Ser Leu 1560 1565 1570 cct ctg tca gaa acg tcc tcc aga cca gcc aag tca caa gaa ggt acg 5649 Pro Leu Ser Glu Thr Ser Ser Arg Pro Ala Lys Ser Gln Glu Gly Thr 1575 1580 1585 gac tca aag aag gta ctg cag ttc ccc agc ctc cac aca acc act aat 5697 Asp Ser Lys Lys Val Leu Gln Phe Pro Ser Leu His Thr Thr Thr Asn 1590 1595 1600 gtc agt tgg tgc tat tta aac tac att aag cca aat cac atc cag cat 5745 Val Ser Trp Cys Tyr Leu Asn Tyr Ile Lys Pro Asn His Ile Gln His 1605 1610 1615 gca gat agg agg tcc tct gtt tac gct ggt tgg tgc ata agt ttg tac 5793 Ala Asp Arg Arg Ser Ser Val Tyr Ala Gly Trp Cys Ile Ser Leu Tyr 1620 1625 1630 1635 aac ccc aac ctt ccg ggg gtt tcc act aaa gct gct ttg tcc ctc ctg 5841 Asn Pro Asn Leu Pro Gly Val Ser Thr Lys Ala Ala Leu Ser Leu Leu 1640 1645 1650 agg tct aag cag aaa gtg agc aaa gag aca tac acc atg gcc aca gct 5889 Arg Ser Lys Gln Lys Val Ser Lys Glu Thr Tyr Thr Met Ala Thr Ala 1655 1660 1665 ccg cat cct gag gca gga agg ctt gtg cca tcc agc tcc cgc aag ccc 5937 Pro His Pro Glu Ala Gly Arg Leu Val Pro Ser Ser Ser Arg Lys Pro 1670 1675 1680 cgc atg aca gag gtt cac ctc cct tca ctg gtt tcc ccg gaa ggc cag 5985 Arg Met Thr Glu Val His Leu Pro Ser Leu Val Ser Pro Glu Gly Gln 1685 1690 1695 aaa gat cta gct aga gtg gag aag gaa gaa gag agg aga ggg gag ccg 6033 Lys Asp Leu Ala Arg Val Glu Lys Glu Glu Glu Arg Arg Gly Glu Pro 1700 1705 1710 1715 gag gag gat gct cct gcc tcc cag aga ggg gag ccg gcg agg atc aaa 6081 Glu Glu Asp Ala Pro Ala Ser Gln Arg Gly Glu Pro Ala Arg Ile Lys 1720 1725 1730 atc ttc gaa gga ggg tac aaa tca aac gaa gag tat gta tat gtg cga 6129 Ile Phe Glu Gly Gly Tyr Lys Ser Asn Glu Glu Tyr Val Tyr Val Arg 1735 1740 1745 ggc cgc ggc cga ggg aaa tat gtt tgt gag gag tgt gga att cgc tgc 6177 Gly Arg Gly Arg Gly Lys Tyr Val Cys Glu Glu Cys Gly Ile Arg Cys 1750 1755 1760 aag aag ccc agc atg ctg aag aaa cac atc cgc acc cac act gac gtc 6225 Lys Lys Pro Ser Met Leu Lys Lys His Ile Arg Thr His Thr Asp Val 1765 1770 1775 cgg ccc tat gtg tgc aag cac tgt cac ttt gct ttt aaa acc aaa ggg 6273 Arg Pro Tyr Val Cys Lys His Cys His Phe Ala Phe Lys Thr Lys Gly 1780 1785 1790 1795 aat ctg act aag cac atg aag tcg aag gcc cac agc aaa aag tgc caa 6321 Asn Leu Thr Lys His Met Lys Ser Lys Ala His Ser Lys Lys Cys Gln 1800 1805 1810 gag aca ggg gtg ctg gag gag ctg gaa gcc gaa gaa gga acc agt gac 6369 Glu Thr Gly Val Leu Glu Glu Leu Glu Ala Glu Glu Gly Thr Ser Asp 1815 1820 1825 gac ctg ttc cag gac tcg gaa gga cga gag ggt tca gag gct gtg gag 6417 Asp Leu Phe Gln Asp Ser Glu Gly Arg Glu Gly Ser Glu Ala Val Glu 1830 1835 1840 gag cac cag ttt tcg gac ctg gag gac tcg gac tca gac tca gac ctg 6465 Glu His Gln Phe Ser Asp Leu Glu Asp Ser Asp Ser Asp Ser Asp Leu 1845 1850 1855 gac gaa gac gag gat gag gat gag gag gag agc cag gat gag ctg tcc 6513 Asp Glu Asp Glu Asp Glu Asp Glu Glu Glu Ser Gln Asp Glu Leu Ser 1860 1865 1870 1875 aga cca tcc tca gag gcg ccc ccg cct ggc cca cca cat gca ctg cgg 6561 Arg Pro Ser Ser Glu Ala Pro Pro Pro Gly Pro Pro His Ala Leu Arg 1880 1885 1890 gca gac tcc tca ccc atc ctg ggc cct cag ccc cca gat gcc ccc gcc 6609 Ala Asp Ser Ser Pro Ile Leu Gly Pro Gln Pro Pro Asp Ala Pro Ala 1895 1900 1905 tct ggc acg gag gcc aca cga ggc agc tcg gtc tcg gaa gct gag cgc 6657 Ser Gly Thr Glu Ala Thr Arg Gly Ser Ser Val Ser Glu Ala Glu Arg 1910 1915 1920 ctg aca gcc agc agc tgc tcc atg tcc agc cag agc atg ccg ggc ctc 6705 Leu Thr Ala Ser Ser Cys Ser Met Ser Ser Gln Ser Met Pro Gly Leu 1925 1930 1935 ccc tgg ctg gga ccg gcc cct ctg ggc tct gtg gag aaa gac aca ggc 6753 Pro Trp Leu Gly Pro Ala Pro Leu Gly Ser Val Glu Lys Asp Thr Gly 1940 1945 1950 1955 tca gcc ttg agc tac aag cct gtg tcc cca aga aga ccg tgg tcc cca 6801 Ser Ala Leu Ser Tyr Lys Pro Val Ser Pro Arg Arg Pro Trp Ser Pro 1960 1965 1970 agc aaa gaa gca ggc agc cgt cca cca cta gcc cgc aaa cac tcg cta 6849 Ser Lys Glu Ala Gly Ser Arg Pro Pro Leu Ala Arg Lys His Ser Leu 1975 1980 1985 acc aaa aac gac tca tct ccc cag cga tgc tcc ccg gcc cga gaa cca 6897 Thr Lys Asn Asp Ser Ser Pro Gln Arg Cys Ser Pro Ala Arg Glu Pro 1990 1995 2000 cag gcc tca gcc cca agc cca cct ggc ctg cac gtg gac cca gga agg 6945 Gln Ala Ser Ala Pro Ser Pro Pro Gly Leu His Val Asp Pro Gly Arg 2005 2010 2015 ggc atg ggc cct ctc cct tgt ggg tct cca aga ctt cag ctg tct cct 6993 Gly Met Gly Pro Leu Pro Cys Gly Ser Pro Arg Leu Gln Leu Ser Pro 2020 2025 2030 2035 ctc acc ctc tgc ccc ctg gga aga gaa ctg gcc cct cga gca cat gtg 7041 Leu Thr Leu Cys Pro Leu Gly Arg Glu Leu Ala Pro Arg Ala His Val 2040 2045 2050 ctc tcc aaa ctc gag ggt acc acc gac cca ggc ctc ccc aga tac tcg 7089 Leu Ser Lys Leu Glu Gly Thr Thr Asp Pro Gly Leu Pro Arg Tyr Ser 2055 2060 2065 ccc acc agg aga tgg tct cca ggt cag gcc gag tca cca cca cgg tca 7137 Pro Thr Arg Arg Trp Ser Pro Gly Gln Ala Glu Ser Pro Pro Arg Ser 2070 2075 2080 gcg ccg cca ggg aag tgg gcc ttg gct ggg ccg ggc agc ccc tca gcg 7185 Ala Pro Pro Gly Lys Trp Ala Leu Ala Gly Pro Gly Ser Pro Ser Ala 2085 2090 2095 ggg gag cat ggc cca ggc ttg ggg ctg gcc cca cgg gtt ctc ttc ccg 7233 Gly Glu His Gly Pro Gly Leu Gly Leu Ala Pro Arg Val Leu Phe Pro 2100 2105 2110 2115 ccc gcg cct cta cct cac aag ctc ctc agc aga agc cca gag acc tgc 7281 Pro Ala Pro Leu Pro His Lys Leu Leu Ser Arg Ser Pro Glu Thr Cys 2120 2125 2130 gcc tcc ccg tgg cag aag gcc gag tcc cga agt ccc tcc tgc tca ccc 7329 Ala Ser Pro Trp Gln Lys Ala Glu Ser Arg Ser Pro Ser Cys Ser Pro 2135 2140 2145 ggc cct gct cat cct ctc tcc tcc cga ccc ttc tcc gcc ctc cat gac 7377 Gly Pro Ala His Pro Leu Ser Ser Arg Pro Phe Ser Ala Leu His Asp 2150 2155 2160 ttc cac ggc cac atc ctg gcc cgg aca gag gag aac atc ttc agc cac 7425 Phe His Gly His Ile Leu Ala Arg Thr Glu Glu Asn Ile Phe Ser His 2165 2170 2175 ctg cct ctg cac tcc cag cac ttg acc cgt gcc cca tgt ccc ttg att 7473 Leu Pro Leu His Ser Gln His Leu Thr Arg Ala Pro Cys Pro Leu Ile 2180 2185 2190 2195 ccc atc ggt ggg atc cag atg gtg cag gcc cgg cca gga gcc cac ccc 7521 Pro Ile Gly Gly Ile Gln Met Val Gln Ala Arg Pro Gly Ala His Pro 2200 2205 2210 acc ctg ctg cca ggg ccc acc gca gcc tgg gtc agt ggc ttc tcc ggg 7569 Thr Leu Leu Pro Gly Pro Thr Ala Ala Trp Val Ser Gly Phe Ser Gly 2215 2220 2225 ggt ggc agc gac ctg aca ggg gcc cgg gag gcc cag gag cga ggc cgc 7617 Gly Gly Ser Asp Leu Thr Gly Ala Arg Glu Ala Gln Glu Arg Gly Arg 2230 2235 2240 tgg agt ccc act gag agc tcg tca gcc tcc gtg tcg cct gtg gct aag 7665 Trp Ser Pro Thr Glu Ser Ser Ser Ala Ser Val Ser Pro Val Ala Lys 2245 2250 2255 gtc tcc aaa ttc aca ctc tcc tca gag ctg gag ggc agg gac tac ccc 7713 Val Ser Lys Phe Thr Leu Ser Ser Glu Leu Glu Gly Arg Asp Tyr Pro 2260 2265 2270 2275 aag gag agg gag agg acc ggc gga ggc ccg ggc agg cct cct gac tgg 7761 Lys Glu Arg Glu Arg Thr Gly Gly Gly Pro Gly Arg Pro Pro Asp Trp 2280 2285 2290 aca ccc cat ggg acc ggg gca cct gca gag ccc aca ccc acg cac agc 7809 Thr Pro His Gly Thr Gly Ala Pro Ala Glu Pro Thr Pro Thr His Ser 2295 2300 2305 ccc tgc acc cca ccc gac acc ttg ccc cgg ccg ccc cag gga cgc cgg 7857 Pro Cys Thr Pro Pro Asp Thr Leu Pro Arg Pro Pro Gln Gly Arg Arg 2310 2315 2320 gca gcg cag tcc tgg agc ccc cgc ttg gag tcc ccg cgt gca ccg gcc 7905 Ala Ala Gln Ser Trp Ser Pro Arg Leu Glu Ser Pro Arg Ala Pro Ala 2325 2330 2335 aac ccc gag cct tct gcc acc ccg ccg ctg gac cgc agc agc tct gtg 7953 Asn Pro Glu Pro Ser Ala Thr Pro Pro Leu Asp Arg Ser Ser Ser Val 2340 2345 2350 2355 ggc tgc ctg gca gag gcc tct gcc cgc ttc cca gcc cgg acg agg aac 8001 Gly Cys Leu Ala Glu Ala Ser Ala Arg Phe Pro Ala Arg Thr Arg Asn 2360 2365 2370 ctc tcc ggg gaa tcc agg acc agg cag gac tcc ccc aag ccc tca gga 8049 Leu Ser Gly Glu Ser Arg Thr Arg Gln Asp Ser Pro Lys Pro Ser Gly 2375 2380 2385 agt ggg gag ccc agg gca cat cca cat cag cct gag gac agg gtt ccc 8097 Ser Gly Glu Pro Arg Ala His Pro His Gln Pro Glu Asp Arg Val Pro 2390 2395 2400 ccc aac gct tagcctctct ccaactgctt cagcatctgg cttccagtgt 8146 Pro Asn Ala 2405 ccagcaacag acgtttccag ccactttcct cgaatcatcc cacttcctca gccccatctg 8206 tccctccatc caggagctct cacggcccca tctgttgtac cttcccatgt atgcagttac 8266 ctgtgccttt ttctacacct tttgttgctt aaaaagaaac aaaacaaatc acatacatac 8326 atttaaaaaa aaaacaacaa cccacgagga gtctgaggct gtgaatagtt tatggttttg 8386 gggaaaggct gatggtgaag cctcctgacc ctccccgctg tggttggcag ccacccaccc 8446 cagaggctgg cagagggaaa ggggtacact gagggagaaa ggaaaaggaa acttcaaaca 8506 atatagaatt aaatgtaaaa ggcagcactc ctgtgtacag 8546 2 2406 PRT Homo sapiens 2 Met Asp Pro Glu Gln Ser Val Lys Gly Thr Lys Lys Ala Glu Gly Ser 1 5 10 15 Pro Arg Lys Arg Leu Thr Lys Gly Glu Ala Ile Gln Thr Ser Val Ser 20 25 30 Ser Ser Val Pro Tyr Pro Gly Ser Gly Thr Ala Pro Thr Gln Glu Ser 35 40 45 Pro Ala Gln Glu Leu Leu Ala Pro Gln Pro Phe Pro Gly Pro Ser Ser 50 55 60 Val Leu Arg Glu Gly Ser Gln Glu Lys Thr Gly Gln Gln Gln Lys Pro 65 70 75 80 Pro Lys Arg Pro Pro Ile Glu Ala Ser Val His Ile Ser His Val Pro 85 90 95 Gln His Pro Leu Thr Pro Ala Phe Met Ser Pro Gly Lys Pro Glu His 100 105 110 Leu Leu Glu Gly Ser Thr Trp Gln Leu Val Ser Pro Met Arg Leu Gly 115 120 125 Pro Ser Gly Ser Leu Leu Ala Pro Gly Leu His Pro Gln Ser Gln Leu 130 135 140 Leu Pro Ser His Ala Ser Ile Ile Pro Pro Glu Asp Leu Pro Gly Val 145 150 155 160 Pro Lys Val Phe Val Pro Arg Pro Ser Gln Val Ser Leu Lys Pro Thr 165 170 175 Glu Glu Ala His Lys Lys Glu Arg Lys Pro Gln Lys Pro Gly Lys Tyr 180 185 190 Ile Cys Gln Tyr Cys Ser Arg Pro Cys Ala Lys Pro Ser Val Leu Gln 195 200 205 Lys His Ile Arg Ser His Thr Gly Glu Arg Pro Tyr Pro Cys Gly Pro 210 215 220 Cys Gly Phe Ser Phe Lys Thr Lys Ser Asn Leu Tyr Lys His Arg Lys 225 230 235 240 Ser His Ala His Arg Ile Lys Ala Gly Leu Ala Ser Gly Met Gly Gly 245 250 255 Glu Met Tyr Pro His Gly Leu Glu Met Glu Arg Ile Pro Gly Glu Glu 260 265 270 Phe Glu Glu Pro Thr Glu Gly Glu Ser Thr Asp Ser Glu Glu Glu Thr 275 280 285 Ser Ala Thr Ser Gly His Pro Ala Glu Leu Ser Pro Arg Pro Lys Gln 290 295 300 Pro Leu Leu Ser Ser Gly Leu Tyr Ser Ser Gly Ser His Ser Ser Ser 305 310 315 320 His Glu Arg Cys Ser Leu Ser Gln Ser Ser Thr Ala Gln Ser Leu Glu 325 330 335 Asp Pro Pro Pro Phe Val Glu Pro Ser Ser Glu His Pro Leu Ser His 340 345 350 Lys Pro Glu Asp Thr His Thr Ile Lys Gln Lys Leu Ala Leu Arg Leu 355 360 365 Ser Glu Arg Lys Lys Val Ile Asp Glu Gln Ala Phe Leu Ser Pro Gly 370 375 380 Ser Lys Gly Ser Thr Glu Ser Gly Tyr Phe Ser Arg Ser Glu Ser Ala 385 390 395 400 Glu Gln Gln Val Ser Pro Pro Asn Thr Asn Ala Lys Ser Tyr Ala Glu 405 410 415 Ile Ile Phe Gly Lys Cys Gly Arg Ile Gly Gln Arg Thr Ala Met Leu 420 425 430 Thr Ala Thr Ser Thr Gln Pro Leu Leu Pro Leu Ser Thr Glu Asp Lys 435 440 445 Pro Ser Leu Val Pro Leu Ser Val Pro Arg Thr Gln Val Ile Glu His 450 455 460 Ile Thr Lys Leu Ile Thr Ile Asn Glu Ala Val Val Asp Thr Ser Glu 465 470 475 480 Ile Asp Ser Val Lys Pro Arg Arg Ser Ser Leu Ser Arg Arg Ser Ser 485 490 495 Met Glu Ser Pro Lys Ser Ser Leu Tyr Arg Glu Pro Leu Ser Ser His 500 505 510 Ser Glu Lys Thr Lys Pro Glu Gln Ser Leu Leu Ser Leu Gln His Pro 515 520 525 Pro Ser Thr Ala Pro Pro Val Pro Leu Leu Arg Ser His Ser Met Pro 530 535 540 Ser Ala Ala Cys Thr Ile Ser Thr Pro His His Pro Phe Arg Gly Ser 545 550 555 560 Tyr Ser Phe Asp Asp His Ile Thr Asp Ser Glu Ala Leu Ser Arg Ser 565 570 575 Ser His Val Phe Thr Ser His Pro Arg Met Leu Lys Pro Gln Pro Ala 580 585 590 Ile Glu Leu Pro Leu Gly Gly Glu Tyr Ser Ser Glu Glu Pro Gly Pro 595 600 605 Ser Ser Lys Asp Thr Ala Ser Lys Pro Ser Asp Glu Val Glu Pro Lys 610 615 620 Glu Ser Glu Leu Thr Lys Lys Thr Lys Lys Gly Leu Lys Thr Lys Gly 625 630 635 640 Val Ile Tyr Glu Cys Asn Ile Cys Gly Ala Arg Tyr Lys Lys Arg Asp 645 650 655 Asn Tyr Glu Ala His Lys Lys Tyr Tyr Cys Ser Glu Leu Gln Ile Ala 660 665 670 Lys Pro Ile Ser Ala Gly Thr His Thr Ser Pro Glu Ala Glu Lys Ser 675 680 685 Gln Ile Glu His Glu Pro Trp Ser Gln Met Met His Tyr Lys Leu Gly 690 695 700 Thr Thr Leu Glu Leu Thr Pro Leu Arg Lys Arg Arg Lys Glu Lys Ser 705 710 715 720 Leu Gly Asp Glu Glu Glu Pro Pro Ala Phe Glu Ser Thr Lys Ser Gln 725 730 735 Phe Gly Ser Pro Gly Pro Ser Asp Ala Ala Arg Asn Leu Pro Leu Glu 740 745 750 Ser Thr Lys Ser Pro Ala Glu Pro Ser Lys Ser

Val Pro Ser Leu Glu 755 760 765 Gly Pro Thr Gly Phe Gln Pro Arg Thr Pro Lys Pro Gly Ser Gly Ser 770 775 780 Glu Ser Gly Lys Glu Arg Arg Thr Thr Ser Lys Glu Ile Ser Val Ile 785 790 795 800 Gln His Thr Ser Ser Phe Glu Lys Ser Asp Ser Leu Glu Gln Pro Ser 805 810 815 Gly Leu Glu Gly Glu Asp Lys Pro Leu Ala Gln Phe Pro Ser Pro Pro 820 825 830 Pro Ala Pro His Gly Arg Ser Ala His Ser Leu Gln Pro Lys Leu Val 835 840 845 Arg Gln Pro Asn Ile Gln Val Pro Glu Ile Leu Val Thr Glu Glu Pro 850 855 860 Asp Arg Pro Asp Thr Glu Pro Glu Pro Pro Pro Lys Glu Pro Glu Lys 865 870 875 880 Thr Glu Glu Phe Gln Trp Pro Gln Arg Ser Gln Thr Leu Ala Gln Leu 885 890 895 Pro Ala Glu Lys Ala Pro Pro Lys Lys Lys Arg Leu Arg Leu Ala Glu 900 905 910 Met Ala Gln Ser Ser Gly Glu Ser Ser Phe Glu Ser Ser Val Pro Leu 915 920 925 Ser Arg Ser Pro Ser Gln Glu Ser Asn Val Ser Leu Ser Gly Ser Ser 930 935 940 Arg Ser Ala Ser Phe Glu Arg Asp Asp His Gly Lys Ala Glu Ala Pro 945 950 955 960 Asp Pro Ser Ser Asp Met Arg Pro Lys Pro Leu Gly Thr His Met Leu 965 970 975 Thr Val Pro Ser His His Pro His Ala Arg Glu Met Arg Arg Ser Ala 980 985 990 Ser Glu Gln Ser Pro Asn Val Ser His Ser Ala His Met Thr Glu Thr 995 1000 1005 Arg Ser Lys Ser Phe Asp Tyr Gly Ser Leu Ser Leu Thr Gly Pro Ser 1010 1015 1020 Ala Pro Ala Pro Val Ala Pro Pro Ala Gly Glu Ala Pro Pro Glu Arg 1025 1030 1035 1040 Arg Lys Cys Phe Leu Val Arg Ser Pro Ser Leu Ser Arg Pro Pro Glu 1045 1050 1055 Ser Glu Leu Glu Val Ala Pro Lys Gly Arg Gln Glu Ser Glu Glu Pro 1060 1065 1070 Gln Pro Ser Ser Ser Lys Pro Ser Ala Lys Ser Ser Leu Ser Gln Ile 1075 1080 1085 Ser Ser Ala Ala Thr Ser His Gly Gly Pro Pro Gly Gly Lys Gly Pro 1090 1095 1100 Gly Gln Asp Arg Pro Ala Leu Gly Pro Thr Val Pro Tyr Thr Glu Ala 1105 1110 1115 1120 Leu Gln Val Phe His His Pro Val Ala Gln Thr Pro Leu His Glu Lys 1125 1130 1135 Pro Tyr Leu Pro Pro Pro Val Ser Leu Phe Ser Phe Gln His Leu Val 1140 1145 1150 Gln His Glu Pro Gly Gln Ser Pro Glu Phe Phe Ser Thr Gln Ala Met 1155 1160 1165 Ser Ser Leu Leu Ser Ser Pro Tyr Ser Met Pro Pro Leu Pro Pro Ser 1170 1175 1180 Leu Phe Gln Ala Pro Pro Leu Pro Leu Gln Pro Thr Val Leu His Pro 1185 1190 1195 1200 Gly Gln Leu His Leu Pro Gln Leu Met Pro His Pro Ala Asn Ile Pro 1205 1210 1215 Phe Arg Gln Pro Pro Ser Phe Leu Pro Met Pro Tyr Pro Thr Ser Ser 1220 1225 1230 Ala Leu Ser Ser Gly Phe Phe Leu Pro Leu Gln Ser Gln Phe Ala Leu 1235 1240 1245 Gln Leu Pro Gly Asp Val Glu Ser His Leu Pro Gln Ile Lys Thr Ser 1250 1255 1260 Leu Ala Pro Leu Ala Thr Gly Ser Ala Gly Leu Ser Pro Ser Gln Glu 1265 1270 1275 1280 Tyr Ser Ser Asp Ile Arg Leu Pro Pro Val Ala Pro Pro Ala Ser Ser 1285 1290 1295 Ser Ala Pro Thr Ser Ala Pro Pro Leu Ala Leu Pro Ala Cys Pro Asp 1300 1305 1310 Thr Met Val Ser Leu Val Val Pro Val Arg Val Gln Thr Asn Met Pro 1315 1320 1325 Ser Tyr Gly Ser Ala Met Tyr Thr Thr Leu Ser Gln Ile Leu Val Thr 1330 1335 1340 Gln Ser Gln Gly Ser Ser Ala Thr Val Ala Leu Pro Lys Phe Glu Glu 1345 1350 1355 1360 Pro Pro Ser Lys Gly Thr Thr Val Cys Gly Ala Asp Val His Glu Val 1365 1370 1375 Gly Pro Gly Pro Ser Gly Leu Ser Glu Glu Gln Ser Arg Ala Phe Pro 1380 1385 1390 Thr Pro Tyr Leu Arg Val Pro Val Thr Leu Pro Glu Arg Lys Gly Thr 1395 1400 1405 Ser Leu Ser Ser Glu Ser Ile Leu Ser Leu Glu Gly Ser Ser Ser Thr 1410 1415 1420 Ala Gly Gly Ser Lys Arg Val Leu Ser Pro Ala Gly Ser Leu Glu Leu 1425 1430 1435 1440 Thr Met Glu Thr Gln Gln Gln Lys Arg Val Lys Glu Glu Glu Ala Ser 1445 1450 1455 Lys Ala Asp Glu Lys Leu Glu Leu Val Lys Pro Cys Ser Val Val Leu 1460 1465 1470 Thr Ser Thr Glu Asp Gly Lys Arg Pro Glu Lys Ser His Leu Gly Asn 1475 1480 1485 Gln Gly Gln Gly Arg Arg Glu Leu Glu Met Leu Ser Ser Leu Ser Ser 1490 1495 1500 Asp Pro Ser Asp Thr Lys Glu Ile Pro Pro Leu Pro His Pro Ala Leu 1505 1510 1515 1520 Ser His Gly Gln Ala Pro Gly Ser Glu Ala Leu Lys Glu Tyr Pro Gln 1525 1530 1535 Pro Ser Gly Lys Pro His Arg Arg Gly Leu Thr Pro Leu Ser Val Lys 1540 1545 1550 Lys Glu Asp Ser Lys Glu Gln Pro Asp Leu Pro Ser Leu Ala Pro Pro 1555 1560 1565 Ser Ser Leu Pro Leu Ser Glu Thr Ser Ser Arg Pro Ala Lys Ser Gln 1570 1575 1580 Glu Gly Thr Asp Ser Lys Lys Val Leu Gln Phe Pro Ser Leu His Thr 1585 1590 1595 1600 Thr Thr Asn Val Ser Trp Cys Tyr Leu Asn Tyr Ile Lys Pro Asn His 1605 1610 1615 Ile Gln His Ala Asp Arg Arg Ser Ser Val Tyr Ala Gly Trp Cys Ile 1620 1625 1630 Ser Leu Tyr Asn Pro Asn Leu Pro Gly Val Ser Thr Lys Ala Ala Leu 1635 1640 1645 Ser Leu Leu Arg Ser Lys Gln Lys Val Ser Lys Glu Thr Tyr Thr Met 1650 1655 1660 Ala Thr Ala Pro His Pro Glu Ala Gly Arg Leu Val Pro Ser Ser Ser 1665 1670 1675 1680 Arg Lys Pro Arg Met Thr Glu Val His Leu Pro Ser Leu Val Ser Pro 1685 1690 1695 Glu Gly Gln Lys Asp Leu Ala Arg Val Glu Lys Glu Glu Glu Arg Arg 1700 1705 1710 Gly Glu Pro Glu Glu Asp Ala Pro Ala Ser Gln Arg Gly Glu Pro Ala 1715 1720 1725 Arg Ile Lys Ile Phe Glu Gly Gly Tyr Lys Ser Asn Glu Glu Tyr Val 1730 1735 1740 Tyr Val Arg Gly Arg Gly Arg Gly Lys Tyr Val Cys Glu Glu Cys Gly 1745 1750 1755 1760 Ile Arg Cys Lys Lys Pro Ser Met Leu Lys Lys His Ile Arg Thr His 1765 1770 1775 Thr Asp Val Arg Pro Tyr Val Cys Lys His Cys His Phe Ala Phe Lys 1780 1785 1790 Thr Lys Gly Asn Leu Thr Lys His Met Lys Ser Lys Ala His Ser Lys 1795 1800 1805 Lys Cys Gln Glu Thr Gly Val Leu Glu Glu Leu Glu Ala Glu Glu Gly 1810 1815 1820 Thr Ser Asp Asp Leu Phe Gln Asp Ser Glu Gly Arg Glu Gly Ser Glu 1825 1830 1835 1840 Ala Val Glu Glu His Gln Phe Ser Asp Leu Glu Asp Ser Asp Ser Asp 1845 1850 1855 Ser Asp Leu Asp Glu Asp Glu Asp Glu Asp Glu Glu Glu Ser Gln Asp 1860 1865 1870 Glu Leu Ser Arg Pro Ser Ser Glu Ala Pro Pro Pro Gly Pro Pro His 1875 1880 1885 Ala Leu Arg Ala Asp Ser Ser Pro Ile Leu Gly Pro Gln Pro Pro Asp 1890 1895 1900 Ala Pro Ala Ser Gly Thr Glu Ala Thr Arg Gly Ser Ser Val Ser Glu 1905 1910 1915 1920 Ala Glu Arg Leu Thr Ala Ser Ser Cys Ser Met Ser Ser Gln Ser Met 1925 1930 1935 Pro Gly Leu Pro Trp Leu Gly Pro Ala Pro Leu Gly Ser Val Glu Lys 1940 1945 1950 Asp Thr Gly Ser Ala Leu Ser Tyr Lys Pro Val Ser Pro Arg Arg Pro 1955 1960 1965 Trp Ser Pro Ser Lys Glu Ala Gly Ser Arg Pro Pro Leu Ala Arg Lys 1970 1975 1980 His Ser Leu Thr Lys Asn Asp Ser Ser Pro Gln Arg Cys Ser Pro Ala 1985 1990 1995 2000 Arg Glu Pro Gln Ala Ser Ala Pro Ser Pro Pro Gly Leu His Val Asp 2005 2010 2015 Pro Gly Arg Gly Met Gly Pro Leu Pro Cys Gly Ser Pro Arg Leu Gln 2020 2025 2030 Leu Ser Pro Leu Thr Leu Cys Pro Leu Gly Arg Glu Leu Ala Pro Arg 2035 2040 2045 Ala His Val Leu Ser Lys Leu Glu Gly Thr Thr Asp Pro Gly Leu Pro 2050 2055 2060 Arg Tyr Ser Pro Thr Arg Arg Trp Ser Pro Gly Gln Ala Glu Ser Pro 2065 2070 2075 2080 Pro Arg Ser Ala Pro Pro Gly Lys Trp Ala Leu Ala Gly Pro Gly Ser 2085 2090 2095 Pro Ser Ala Gly Glu His Gly Pro Gly Leu Gly Leu Ala Pro Arg Val 2100 2105 2110 Leu Phe Pro Pro Ala Pro Leu Pro His Lys Leu Leu Ser Arg Ser Pro 2115 2120 2125 Glu Thr Cys Ala Ser Pro Trp Gln Lys Ala Glu Ser Arg Ser Pro Ser 2130 2135 2140 Cys Ser Pro Gly Pro Ala His Pro Leu Ser Ser Arg Pro Phe Ser Ala 2145 2150 2155 2160 Leu His Asp Phe His Gly His Ile Leu Ala Arg Thr Glu Glu Asn Ile 2165 2170 2175 Phe Ser His Leu Pro Leu His Ser Gln His Leu Thr Arg Ala Pro Cys 2180 2185 2190 Pro Leu Ile Pro Ile Gly Gly Ile Gln Met Val Gln Ala Arg Pro Gly 2195 2200 2205 Ala His Pro Thr Leu Leu Pro Gly Pro Thr Ala Ala Trp Val Ser Gly 2210 2215 2220 Phe Ser Gly Gly Gly Ser Asp Leu Thr Gly Ala Arg Glu Ala Gln Glu 2225 2230 2235 2240 Arg Gly Arg Trp Ser Pro Thr Glu Ser Ser Ser Ala Ser Val Ser Pro 2245 2250 2255 Val Ala Lys Val Ser Lys Phe Thr Leu Ser Ser Glu Leu Glu Gly Arg 2260 2265 2270 Asp Tyr Pro Lys Glu Arg Glu Arg Thr Gly Gly Gly Pro Gly Arg Pro 2275 2280 2285 Pro Asp Trp Thr Pro His Gly Thr Gly Ala Pro Ala Glu Pro Thr Pro 2290 2295 2300 Thr His Ser Pro Cys Thr Pro Pro Asp Thr Leu Pro Arg Pro Pro Gln 2305 2310 2315 2320 Gly Arg Arg Ala Ala Gln Ser Trp Ser Pro Arg Leu Glu Ser Pro Arg 2325 2330 2335 Ala Pro Ala Asn Pro Glu Pro Ser Ala Thr Pro Pro Leu Asp Arg Ser 2340 2345 2350 Ser Ser Val Gly Cys Leu Ala Glu Ala Ser Ala Arg Phe Pro Ala Arg 2355 2360 2365 Thr Arg Asn Leu Ser Gly Glu Ser Arg Thr Arg Gln Asp Ser Pro Lys 2370 2375 2380 Pro Ser Gly Ser Gly Glu Pro Arg Ala His Pro His Gln Pro Glu Asp 2385 2390 2395 2400 Arg Val Pro Pro Asn Ala 2405 3 20 DNA Artificial Sequence synthetic oligonucleotide 3 caagaatcca aactcaccag 20 4 21 DNA Artificial Sequence synthetic oligonucleotide 4 tagcaaccat acattcaaca a 21 5 22 DNA Artificial Sequence synthetic oligonucleotide 5 ctccaataca gaattcaagg gc 22 6 22 DNA Artificial Sequence synthetic oligonucleotide 6 tttaggttgg ccagtgtgtg tg 22 7 852 PRT Homo sapiens 7 Pro Ser Val Leu Gln Lys His Ile Arg Ser His Thr Gly Glu Arg Pro 1 5 10 15 Tyr Pro Cys Gly Pro Cys Gly Phe Ser Phe Lys Thr Lys Ser Asn Leu 20 25 30 Tyr Lys His Arg Lys Ser His Ala His Arg Ile Lys Ala Gly Leu Ala 35 40 45 Ser Gly Met Gly Gly Glu Met Tyr Pro His Gly Leu Glu Met Glu Arg 50 55 60 Ile Pro Gly Glu Glu Phe Glu Glu Pro Thr Glu Gly Glu Ser Thr Asp 65 70 75 80 Ser Glu Glu Glu Thr Ser Ala Thr Ser Gly His Pro Ala Glu Leu Ser 85 90 95 Pro Arg Pro Lys Gln Pro Leu Leu Ser Ser Gly Leu Tyr Ser Ser Gly 100 105 110 Ser His Ser Ser Ser His Glu Arg Cys Ser Leu Ser Gln Ser Ser Thr 115 120 125 Ala Gln Ser Leu Glu Asp Pro Pro Pro Phe Val Glu Pro Ser Ser Glu 130 135 140 His Pro Leu Ser His Lys Pro Glu Asp Thr His Thr Ile Lys Gln Lys 145 150 155 160 Leu Ala Leu Arg Leu Ser Glu Arg Lys Lys Val Ile Asp Glu Gln Ala 165 170 175 Phe Leu Ser Pro Gly Ser Lys Gly Ser Thr Glu Ser Gly Tyr Phe Ser 180 185 190 Arg Ser Glu Ser Ala Glu Gln Gln Val Ser Pro Pro Asn Thr Asn Ala 195 200 205 Lys Ser Tyr Ala Glu Ile Ile Phe Gly Lys Cys Gly Arg Ile Gly Gln 210 215 220 Arg Thr Ala Met Leu Thr Ala Thr Ser Thr Gln Pro Leu Leu Pro Leu 225 230 235 240 Ser Thr Glu Asp Lys Pro Ser Leu Val Pro Leu Ser Val Pro Arg Thr 245 250 255 Gln Val Ile Glu His Ile Thr Lys Leu Ile Thr Ile Asn Glu Ala Val 260 265 270 Val Asp Thr Ser Glu Ile Asp Ser Val Lys Pro Arg Arg Ser Ser Leu 275 280 285 Ser Arg Arg Ser Ser Met Glu Ser Pro Lys Ser Ser Leu Tyr Arg Glu 290 295 300 Pro Leu Ser Ser His Ser Glu Lys Thr Lys Pro Glu Gln Ser Leu Leu 305 310 315 320 Ser Leu Gln His Pro Pro Ser Thr Ala Pro Pro Val Pro Leu Leu Arg 325 330 335 Ser His Ser Met Pro Ser Ala Ala Cys Thr Ile Ser Thr Pro His His 340 345 350 Pro Phe Arg Gly Ser Tyr Ser Phe Asp Asp His Ile Thr Asp Ser Glu 355 360 365 Ala Leu Ser Arg Ser Ser His Val Phe Thr Ser His Pro Arg Met Leu 370 375 380 Lys Pro Gln Pro Ala Ile Glu Leu Pro Leu Gly Gly Glu Tyr Ser Ser 385 390 395 400 Glu Glu Pro Gly Pro Ser Ser Lys Asp Thr Ala Ser Lys Pro Ser Asp 405 410 415 Glu Val Glu Pro Lys Glu Ser Glu Leu Thr Lys Lys Thr Lys Lys Gly 420 425 430 Leu Lys Thr Lys Gly Val Ile Tyr Glu Cys Asn Ile Cys Gly Ala Arg 435 440 445 Tyr Lys Lys Arg Asp Asn Tyr Glu Ala His Lys Lys Tyr Tyr Cys Ser 450 455 460 Glu Leu Gln Ile Ala Lys Pro Ile Ser Ala Gly Thr His Thr Ser Pro 465 470 475 480 Glu Ala Glu Lys Ser Gln Ile Glu His Glu Pro Trp Ser Gln Met Met 485 490 495 His Tyr Lys Leu Gly Thr Thr Leu Glu Leu Thr Pro Leu Arg Lys Arg 500 505 510 Arg Lys Glu Lys Ser Leu Gly Asp Glu Glu Glu Pro Pro Ala Phe Glu 515 520 525 Ser Thr Lys Ser Gln Phe Gly Ser Pro Gly Pro Ser Asp Ala Ala Arg 530 535 540 Asn Leu Pro Leu Glu Ser Thr Lys Ser Pro Ala Glu Pro Ser Lys Ser 545 550 555 560 Val Pro Ser Leu Glu Gly Pro Thr Gly Phe Gln Pro Arg Thr Pro Lys 565 570 575 Pro Gly Ser Gly Ser Glu Ser Gly Lys Glu Arg Arg Thr Thr Ser Lys 580 585 590 Glu Ile Ser Val Ile Gln His Thr Ser Ser Phe Glu Lys Ser Asp Ser 595 600 605 Leu Glu Gln Pro Ser Gly Leu Glu Gly Glu Asp Lys Pro Leu Ala Gln 610 615 620 Phe Pro Ser Pro Pro Pro Ala Pro His Gly Arg Ser Ala His Ser Leu 625 630 635 640 Gln Pro Lys Leu Val Arg Gln Pro Asn Ile Gln Val Pro Glu Ile Leu 645 650 655 Val Thr Glu Glu Pro Asp Arg Pro Asp Thr Glu Pro Glu Pro Pro Pro 660 665 670 Lys Glu Pro Glu Lys Thr Glu Glu Phe Gln Trp Pro Gln Arg Ser Gln 675 680 685 Thr Leu Ala Gln Leu Pro Ala Glu Lys Ala Pro Pro Lys Lys Lys Arg 690 695 700 Leu Arg Leu Ala Glu

Met Ala Gln Ser Ser Gly Glu Ser Ser Phe Glu 705 710 715 720 Ser Ser Val Pro Leu Ser Arg Ser Pro Ser Gln Glu Ser Asn Val Ser 725 730 735 Leu Ser Gly Ser Ser Arg Ser Ala Ser Phe Glu Arg Asp Asp His Gly 740 745 750 Lys Ala Glu Ala Pro Asp Pro Ser Ser Asp Met Arg Pro Lys Pro Leu 755 760 765 Gly Thr His Met Leu Thr Val Pro Ser His His Pro His Ala Arg Glu 770 775 780 Met Arg Arg Ser Ala Ser Glu Gln Ser Pro Asn Val Ser His Ser Ala 785 790 795 800 His Met Thr Glu Thr Arg Ser Lys Ser Phe Asp Tyr Gly Ser Leu Ser 805 810 815 Leu Thr Gly Pro Ser Ala Pro Ala Pro Val Ala Pro Pro Ala Gly Glu 820 825 830 Ala Pro Pro Glu Arg Arg Lys Cys Phe Leu Val Arg Ser Pro Ser Leu 835 840 845 Ser Arg Pro Pro 850 8 786 PRT Homo sapiens 8 Glu Met Leu Ser Ser Leu Ser Ser Asp Pro Ser Asp Thr Lys Glu Ile 1 5 10 15 Pro Pro Leu Pro His Pro Ala Leu Ser His Gly Gln Ala Pro Gly Ser 20 25 30 Glu Ala Leu Lys Glu Tyr Pro Gln Pro Ser Gly Lys Pro His Arg Arg 35 40 45 Gly Leu Thr Pro Leu Ser Val Lys Lys Glu Asp Ser Lys Glu Gln Pro 50 55 60 Asp Leu Pro Ser Leu Ala Pro Pro Ser Ser Leu Pro Leu Ser Glu Thr 65 70 75 80 Ser Ser Arg Pro Ala Lys Ser Gln Glu Gly Thr Asp Ser Lys Lys Val 85 90 95 Leu Gln Phe Pro Ser Leu His Thr Thr Thr Asn Val Ser Trp Cys Tyr 100 105 110 Leu Asn Tyr Ile Lys Pro Asn His Ile Gln His Ala Asp Arg Arg Ser 115 120 125 Ser Val Tyr Ala Gly Trp Cys Ile Ser Leu Tyr Asn Pro Asn Leu Pro 130 135 140 Gly Val Ser Thr Lys Ala Ala Leu Ser Leu Leu Arg Ser Lys Gln Lys 145 150 155 160 Val Ser Lys Glu Thr Tyr Thr Met Ala Thr Ala Pro His Pro Glu Ala 165 170 175 Gly Arg Leu Val Pro Ser Ser Ser Arg Lys Pro Arg Met Thr Glu Val 180 185 190 His Leu Pro Ser Leu Val Ser Pro Glu Gly Gln Lys Asp Leu Ala Arg 195 200 205 Val Glu Lys Glu Glu Glu Arg Arg Gly Glu Pro Glu Glu Asp Ala Pro 210 215 220 Ala Ser Gln Arg Gly Glu Pro Ala Arg Ile Lys Ile Phe Glu Gly Gly 225 230 235 240 Tyr Lys Ser Asn Glu Glu Tyr Val Tyr Val Arg Gly Arg Gly Arg Gly 245 250 255 Lys Tyr Val Cys Glu Glu Cys Gly Ile Arg Cys Lys Lys Pro Ser Met 260 265 270 Leu Lys Lys His Ile Arg Thr His Thr Asp Val Arg Pro Tyr Val Cys 275 280 285 Lys His Cys His Phe Ala Phe Lys Thr Lys Gly Asn Leu Thr Lys His 290 295 300 Met Lys Ser Lys Ala His Ser Lys Lys Cys Gln Glu Thr Gly Val Leu 305 310 315 320 Glu Glu Leu Glu Ala Glu Glu Gly Thr Ser Asp Asp Leu Phe Gln Asp 325 330 335 Ser Glu Gly Arg Glu Gly Ser Glu Ala Val Glu Glu His Gln Phe Ser 340 345 350 Asp Leu Glu Asp Ser Asp Ser Asp Ser Asp Leu Asp Glu Asp Glu Asp 355 360 365 Glu Asp Glu Glu Glu Ser Gln Asp Glu Leu Ser Arg Pro Ser Ser Glu 370 375 380 Ala Pro Pro Pro Gly Pro Pro His Ala Leu Arg Ala Asp Ser Ser Pro 385 390 395 400 Ile Leu Gly Pro Gln Pro Pro Asp Ala Pro Ala Ser Gly Thr Glu Ala 405 410 415 Thr Arg Gly Ser Ser Val Ser Glu Ala Glu Arg Leu Thr Ala Ser Ser 420 425 430 Cys Ser Met Ser Ser Gln Ser Met Pro Gly Leu Pro Trp Leu Gly Pro 435 440 445 Ala Pro Leu Gly Ser Val Glu Lys Asp Thr Gly Ser Ala Leu Ser Tyr 450 455 460 Lys Pro Val Ser Pro Arg Arg Pro Trp Ser Pro Ser Lys Glu Ala Gly 465 470 475 480 Ser Arg Pro Pro Leu Ala Arg Lys His Ser Leu Thr Lys Asn Asp Ser 485 490 495 Ser Pro Gln Arg Cys Ser Pro Ala Arg Glu Pro Gln Ala Ser Ala Pro 500 505 510 Ser Pro Pro Gly Leu His Val Asp Pro Gly Arg Gly Met Gly Pro Leu 515 520 525 Pro Cys Gly Ser Pro Arg Leu Gln Leu Ser Pro Leu Thr Leu Cys Pro 530 535 540 Leu Gly Arg Glu Leu Ala Pro Arg Ala His Val Leu Ser Lys Leu Glu 545 550 555 560 Gly Thr Thr Asp Pro Gly Leu Pro Arg Tyr Ser Pro Thr Arg Arg Trp 565 570 575 Ser Pro Gly Gln Ala Glu Ser Pro Pro Arg Ser Ala Pro Pro Gly Lys 580 585 590 Trp Ala Leu Ala Gly Pro Gly Ser Pro Ser Ala Gly Glu His Gly Pro 595 600 605 Gly Leu Gly Leu Ala Pro Arg Val Leu Phe Pro Pro Ala Pro Leu Pro 610 615 620 His Lys Leu Leu Ser Arg Ser Pro Glu Thr Cys Ala Ser Pro Trp Gln 625 630 635 640 Lys Ala Glu Ser Arg Ser Pro Ser Cys Ser Pro Gly Pro Ala His Pro 645 650 655 Leu Ser Ser Arg Pro Phe Ser Ala Leu His Asp Phe His Gly His Ile 660 665 670 Leu Ala Arg Thr Glu Glu Asn Ile Phe Ser His Leu Pro Leu His Ser 675 680 685 Gln His Leu Thr Arg Ala Pro Cys Pro Leu Ile Pro Ile Gly Gly Ile 690 695 700 Gln Met Val Gln Ala Arg Pro Gly Ala His Pro Thr Leu Leu Pro Gly 705 710 715 720 Pro Thr Ala Ala Trp Val Ser Gly Phe Ser Gly Gly Gly Ser Asp Leu 725 730 735 Thr Gly Ala Arg Glu Ala Gln Glu Arg Gly Arg Trp Ser Pro Thr Glu 740 745 750 Ser Ser Ser Ala Ser Val Ser Pro Val Ala Lys Val Ser Lys Phe Thr 755 760 765 Leu Ser Ser Glu Leu Glu Gly Arg Asp Tyr Pro Lys Glu Arg Glu Arg 770 775 780 Thr Gly 785

Claims

1. A method for identifying a compound which modulates an interaction between a first and a second polypeptide comprising: (a) contacting a cell having a first polypeptide comprising a binding portion of a KRC polypeptide and a second polypeptide comprising a binding portion of a polypeptide selected from the group consisting of: GATA3, SMAD, or Runx2 in the presence and the absence of a test compound; and (b) determining the degree of interaction between the first and the second polypeptide in the presence and the absence of the test compound, to thereby identify a compound which modulates an interaction between a first and a second polypeptide.

2. The method of claim 1, wherein the first polypeptide comprises at least one KRC zinc finger domain.

3. (canceled)

4. The method of claim 1, wherein the second polypeptide is a SMAD2 polypeptide.

5. The method of claim 1, wherein the second polypeptide is a SMAD3 polypeptide.

6. The method of claim 1, wherein the first polypeptide is derived from an exogenous source.

7. The method of claim 1, wherein the second polypeptide is derived from an exogenous source.

8. The method of claim 1, wherein the cell is a yeast cell.

9. The method of claim 8, wherein determining the ability of the test compound to modulate the interaction of the first polypeptide and the second polypeptide comprises determining the ability of the compound to modulate growth of the yeast cell on nutritionally selective media.

10. The method of claim 8, wherein determining the ability of the test compound to modulate the interaction of the first polypeptide and the second polypeptide comprises determining the ability of the compound to modulate expression of a reporter gene in the yeast cell.

11. The method of claim 1, wherein determining the ability of the test compound to modulate the interaction of the first polypeptide and the second polypeptide comprises determining the ability of the test compound to modulate the coimmunoprecipitation of the first polypeptide and the second polypeptide.

12. The method of claim 1, wherein determining the ability of the test compound to modulate the interaction of the first polypeptide and the second polypeptide comprises determining the ability of the test compound to modulate signaling via a signal transduction pathway involving KRC in the cell.

13. The method of claim 12, wherein at least one of TNF.alpha. production, IL-2 production, AP-1 activity, Ras and Rac activity, actin polymerization, ubiquitination of AP-1, ubiquitination of TRAF, ubiquitination of Runx2, degradation of c-Jun, degradation of c-Fos degradation of SMAD, degradation of Runx2, degradation of GATA3, GATA3 expression, Th2 cell differentiation, Th2 cytokine production, IgA production, GL.alpha. transcription (Ig.alpha. chain germline transcription), and/or osteocalcin gene transcription is measured.

14. The method of claim 12, wherein ubiquitination or degradation of c-fos, c-Jun, SMAD3, GATA3 or Runx2 is measured.

15. The method of claim 12, wherein AP-1, TRAF2 or Runx2 ubiquitination is measured.

16. The method of claim 1, wherein the binding of first and second polypeptide is inhibited.

17. The method of claim 1, wherein the binding of first and second polypeptide is stimulated.

18. A method of identifying a compound that modulates a mammalian KRC biological activity comprising: (a) contacting cells deficient in KRC or a molecule in a signaling pathway involving KRC with a test compound; and (b) determining the effect of the test compound on the KRC biological activity, the test compound being identified as a modulator of the biological activity based on the ability of the test compound to modulate the biological activity in the cells deficient in KRC or a molecule in a signaling pathway involving KRC to thereby identify a compound that modulates a mammalian KRC biological activity.

19. The method of claim 18, wherein the biological activity of KRC is selected from the group consisting of modulation of: modulation of a TGF.beta. signaling pathway, modulation of ubiquitination of AP-1, modulation of ubiquitination of TRAF, modulation of ubiquitination of Runx2, modulation of the degradation of c-Jun, modulation of the degradation of c-Fos, modulation of degradation of SMAD, modulation of degradation of Runx, modulation of degradation of GATA3, modulation of GATA3 expression, modulation of Th2 cell differentiation, modulation of Th2 cytokine production, modulation of IgA production, modulation of GL.alpha. transcription, or modulation of osteocalcin gene transcription.

20. The method of claim 18, wherein the cells are in a non-human animal deficient in KRC or a molecule in a signal transduction pathway involving KRC and the cells are contacted with the test compound by administering the test compound to the animal.

21. A method of identifying compounds useful in modulating a biological activity of mammalian KRC comprising: a) providing an indicator composition comprising mammalian KRC or a molecule in a signal transduction pathway involving KRC; b) contacting the indicator composition with each member of a library of test compounds; c) selecting from the library of test compounds a compound of interest that modulates a biological activity of KRC or the molecule in a signal transduction pathway involving KRC; to thereby identify a compound that modulates a biological activity of mammalian KRC, wherein the biological activity of KRC is selected from the group consisting of: modulation of ubiquitination of Runx2, modulation of degradation of SMAD, modulation of degradation of Runx, modulation of degradation of GATA3, modulation of GATA3 expression, modulation of Th2 cell differentiation, modulation of Th2 cytokine production, modulation of IgA production, modulation of GL.alpha. transcription, and modulation of osteocalcin gene transcription.

22. The method of claim 21, wherein the indicator composition is a cell that expresses KRC, and at least one molecule selected from the group consisting of: GATA3, SMAD, and Runx2 protein.

23. The method of claim 21, wherein the indicator composition is a cell free composition.

24-45. (canceled)

46. A non-human animal, in which the gene encoding the KRC gene is misexpressed.

47. The animal of claim 46, wherein the animal is a transgenic animal.

48. The animal of claim 47, wherein the transgenic animal is a mouse.

49. The animal of claim 46, wherein the KRC gene is disrupted by removal of DNA encoding all or part of the KRC protein.

50. The animal of claim 49, wherein the animal is homozygous for the disrupted gene.

51. The animal of claim 49, wherein the animal is heterozygous for the disrupted gene.

52. The animal of claim 46, wherein the animal is a transgenic mouse with a transgenic disruption of the KRC gene.

53. The animal of claim 52, wherein the disruption is an insertion or deletion.

54. A transgenic mouse comprising in its genome an exogenous DNA molecule that functionally disrupts a KRC gene of said mouse, wherein the mouse exhibits a phenotype characterized by impaired Th2 cell development, decreased Th2 cytokine production, impaired TGF.beta.R signaling in B cells, decreased IgA secretion and decreased transcription of the GL.alpha. gene, relative to a wildtype mouse.