U.S. patent application number 11/615626 was filed with the patent office on 2007-09-20 for methods and compositions for detecting targets.
This patent application is currently assigned to APPLERA CORPORATION. Invention is credited to Mark R. Andersen, Michael W. Hunkapiller, Kenneth J. Livak, Eugene G. Spier, H. Michael Wenz.
Application Number | 20070219364 11/615626 |
Document ID | / |
Family ID | 32030835 |
Filed Date | 2007-09-20 |
United States Patent
Application |
20070219364 |
Kind Code |
A1 |
Andersen; Mark R. ; et
al. |
September 20, 2007 |
Methods and Compositions for Detecting Targets
Abstract
The present invention relates to methods and kits for detecting
the presence or absence of (or quantitating) target nucleic acid
sequences using ligation and amplification. The invention also
relates to methods, reagents, and kits that employ addressable
portions and labeled probes.
Inventors: |
Andersen; Mark R.;
(Carlsbad, CA) ; Hunkapiller; Michael W.; (San
Carlos, CA) ; Livak; Kenneth J.; (San Jose, CA)
; Spier; Eugene G.; (Palo Alto, CA) ; Wenz; H.
Michael; (Redwood City, CA) |
Correspondence
Address: |
MILA KASAN, PATENT DEPT.;APPLIED BIOSYSTEMS
850 LINCOLN CENTRE DRIVE
FOSTER CITY
CA
94404
US
|
Assignee: |
APPLERA CORPORATION
850 Lincoln Centre Drive M/S 432-2
Foster City
CA
94404
|
Family ID: |
32030835 |
Appl. No.: |
11/615626 |
Filed: |
December 22, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10665671 |
Sep 19, 2003 |
7153658 |
|
|
11615626 |
Dec 22, 2006 |
|
|
|
60412225 |
Sep 19, 2002 |
|
|
|
Current U.S.
Class: |
536/24.3 |
Current CPC
Class: |
C12Q 1/6827 20130101;
C12Q 1/6827 20130101; C12Q 2525/161 20130101; C12Q 2531/137
20130101; C12Q 2561/101 20130101 |
Class at
Publication: |
536/024.3 |
International
Class: |
C07H 21/00 20060101
C07H021/00 |
Claims
1-28. (canceled)
29. A method of making a library of probes comprising: synthesizing
a first library of 4.sup.X probes each comprising a primer-specific
portion, a target-specific portion X nucleotides in length, and a
first addressable portion located between the primer-specific
portion and the target-specific portion, wherein each of the
4.sup.X probes of the first library of 4.sup.X probes comprises a
different target-specific portion, wherein X is 4 to 8.
30. The method of claim 29, further comprising: synthesizing a
second library of 4.sup.X probes each comprising a primer-specific
portion, a target-specific portion X nucleotides in length, and a
second addressable portion located between the primer-specific
portion and the target-specific portion, wherein each of the
4.sup.X probes of the second library of 4.sup.X probes comprises a
different target-specific portion, and wherein the second
addressable portion has a different sequence than the first
addressable portion, wherein X is 4 to 8.
31. (canceled)
32. A first library of 4.sup.X probes each comprising a
primer-specific portion, a target-specific portion X nucleotides in
length, and a first addressable portion located between the
primer-specific portion and the target-specific portion, wherein
each of the 4.sup.X probes of the first library of 4.sup.X probes
comprises a different target-specific portion, wherein X is 4 to
8.
33. A method of making a library of (4.sup.(X-1) multiplied by 6)
pairs of probes, comprising synthesizing a library of (4.sup.(X-1)
multiplied by 6) pairs of probes; wherein one probe of each pair
comprises a primer-specific portion, a target-specific portion
comprising a sequence of X nucleotides, and a first addressable
portion located between the primer-specific portion and the
target-specific portion, wherein the other probe of each pair
comprises a primer-specific portion, a target-specific portion
comprising a sequence of X nucleotides, and a second addressable
portion located between the primer-specific portion and the
target-specific portion, wherein the sequence of X nucleotides of
the target-specific portion of each probe in a pair of probes is
identical except for one nucleotide difference; wherein each of the
(4.sup.(X-1) multiplied by 6) pairs of probes can be used to
determine whether a target nucleic acid sequence comprising X
nucleotides has one of two possible nucleic acid sequences, wherein
the two possible nucleic acid sequences differ by one nucleotide at
a single position, and wherein at least one separate pair of probes
of the library is provided for each separate possible one
nucleotide difference at one position in a target nucleic acid
comprising X nucleotides; and wherein X is 4 to 8.
34. A library of (4.sup.(X-1) multiplied by 6) pairs of probes;
wherein one probe of each pair comprises a primer-specific portion,
a target-specific portion comprising a sequence of X nucleotides,
and a first addressable portion located between the primer-specific
portion and the target-specific portion, wherein the other probe of
each pair comprises a primer-specific portion, a target-specific
portion comprising a sequence of X nucleotides, and a second
addressable portion located between the primer-specific portion and
the target-specific portion, wherein the sequence of X nucleotides
of the target-specific portion of each probe in a pair of probes is
identical except for one nucleotide difference; wherein each of the
(4.sup.(X-1) multiplied by 6) pairs of probes can be used to
determine whether a target nucleic acid sequence comprising X
nucleotides has one of two possible nucleic acid sequences, wherein
the two possible nucleic acid sequences differ by one nucleotide at
a single position, and wherein at least one separate pair of probes
of the library is provided for each separate possible one
nucleotide difference at one position in a target nucleic acid
comprising X nucleotides; and wherein X is 4 to 8.
35-44. (canceled)
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 10/665,671, filed Sep. 19, 2003, which claims a priority
benefit under 35 U.S.C. .sctn. 119(e) from U.S. application No.
60/412,225, filed Sep. 19, 2002, the contents of each is
incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The invention relates to methods and compositions for the
detection of targets in a sample.
BACKGROUND
[0003] The detection of the presence or absence of (or quantity of)
one or more target sequences in a sample containing one or more
target sequences is commonly practiced. For example, the detection
of cancer and many infectious diseases, such as AIDS and hepatitis,
routinely includes screening biological samples for the presence or
absence of diagnostic nucleic acid sequences. Also, detecting the
presence or absence of nucleic acid sequences is often used in
forensic science, paternity testing, genetic counseling, and organ
transplantation.
[0004] An organism's genetic makeup is determined by the genes
contained within the genome of that organism. Genes are composed of
long strands or deoxyribonucleic acid (DNA) polymers that encode
the information needed to make proteins. Properties, capabilities,
and traits of an organism often are related to the types and
amounts of proteins that are, or are not, being produced by that
organism.
[0005] A protein can be produced from a gene as follows. First, the
DNA of the gene that encodes a protein, for example, protein "X",
is converted into ribonucleic acid (RNA) by a process known as
"transcription." During transcription, a single-stranded
complementary RNA copy of the gene is made. Next, this RNA copy,
referred to as protein X messenger RNA (mRNA), is used by the
cell's biochemical machinery to make protein X, a process referred
to as "translation." Basically, the cell's protein manufacturing
machinery binds to the mRNA, "reads" the RNA code, and "translates"
it into the amino acid sequence of protein X. In summary, DNA is
transcribed to make mRNA, which is translated to make proteins.
[0006] The amount of protein X that is produced by a cell often is
largely dependent on the amount of protein X mRNA that is present
within the cell. The amount of protein X mRNA within a cell is due,
at least in part, to the degree to which gene X is expressed.
Whether a particular gene is expressed, and if so, to what level,
may have a significant impact on the organism.
SUMMARY OF THE INVENTION
[0007] In certain embodiments, methods are provided for detecting
at least one target nucleic acid sequence in a sample. In certain
embodiments, the methods comprise forming a ligation reaction
composition comprising the sample and a ligation probe set for each
target nucleic acid sequence. In certain embodiments, the probe set
comprises: (a) at least one first probe, comprising a
target-specific portion, a 5' primer-specific portion, wherein the
5' primer-specific portion comprises a sequence, and a first
addressable portion located between the 5' primer-specific portion
and the target-specific portion, wherein the first addressable
portion comprises a sequence; and (b) at least one second probe,
comprising a target-specific portion, a 3' primer-specific portion,
wherein the 3' primer-specific portion comprises a sequence, and a
second addressable portion located between the 3' primer-specific
portion and the target-specific portion, wherein the second
addressable portion comprises a sequence. In certain embodiments,
the probes in each set are suitable for ligation together when
hybridized adjacent to one another on a complementary target
nucleic acid sequence.
[0008] In certain embodiments, the methods further comprise forming
a test composition by subjecting the ligation reaction composition
to at least one cycle of ligation, wherein adjacently hybridizing
complementary probes are ligated to one another to form a ligation
product comprising the 5' primer-specific portion, the first
addressable portion, the target-specific portions, the second
addressable portion, and the 3' primer-specific portion.
[0009] In certain embodiments, the methods further comprise forming
an amplification reaction composition comprising:
[0010] the test composition;
[0011] a polymerase;
[0012] a first labeled probe, wherein the first labeled probe has a
first detectable signal value when it is not hybridized to a
complementary sequence, and wherein the first labeled probe
comprises the sequence of the first addressable portion or
comprises a sequence complementary to the sequence of the first
addressable portion;
[0013] a second labeled probe, wherein the second labeled probe has
a first detectable signal value when it is not hybridized to a
complementary sequence, and wherein the second labeled probe
comprises the sequence of the second addressable portion or
comprises a sequence complementary to the sequence of the second
addressable portion; and
[0014] at least one primer set, the primer set comprising (i) at
least one first primer comprising the sequence of the 5'
primer-specific portion of the ligation product, and (ii) at least
one second primer comprising a sequence complementary to the
sequence of the 3' primer-specific portion of the ligation
product.
[0015] In certain embodiments, the methods further comprise
subjecting the amplification reaction composition to at least one
amplification reaction. In certain embodiments, the methods further
comprise detecting a second detectable signal value from the first
labeled probe and from the second labeled probe at least one of
during and after the amplification reaction, wherein a threshold
difference between the first detectable signal value and the second
detectable signal value of the first labeled probe and a threshold
difference between the first detectable signal value and the second
detectable signal value of the second labeled probe indicates the
presence of the target nucleic acid sequence, and wherein no
threshold difference between the first detectable signal value and
the second detectable signal value of the first labeled probe and
no threshold difference between the first detectable signal value
and the second detectable signal value of the second labeled probe
indicates the absence of the target nucleic acid sequence.
[0016] In certain embodiments, methods are provided for detecting
at least one target nucleic acid sequence in a sample. In certain
embodiments, the methods comprise forming a ligation reaction
composition comprising the sample and a ligation probe set for each
target nucleic acid sequence. In certain embodiments, the probe set
comprises (a) at least one first probe, comprising a
target-specific portion and a 5' primer-specific portion, wherein
the 5' primer-specific portion comprises a sequence, and (b) at
least one second probe, comprising a target-specific portion and a
3' primer-specific portion, wherein the 3' primer-specific portion
comprises a sequence. In certain embodiments, the probes in each
set are suitable for ligation together when hybridized adjacent to
one another on a complementary target nucleic acid sequence. In
certain embodiments, at least one of the at least one first probe
and the at least one second probe further comprises: (a) a first
addressable portion located between the primer-specific portion and
the target-specific portion, wherein the first addressable portion
comprises a sequence, and (b) a second addressable portion located
between the primer-specific portion and the target-specific
portion, wherein the second addressable portion comprises a
sequence.
[0017] In certain embodiments, the methods further comprise forming
a test composition by subjecting the ligation reaction composition
to at least one cycle of ligation, wherein adjacently hybridizing
complementary probes are ligated to one another to form a ligation
product comprising the 5' primer-specific portion, the first
addressable portion, the second addressable portion, the
target-specific portions, and the 3' primer-specific portion.
[0018] In certain embodiments, the methods further comprise forming
an amplification reaction composition comprising:
[0019] the test composition;
[0020] a polymerase;
[0021] a first labeled probe, wherein the first labeled probe has a
first detectable signal value when it is not hybridized to a
complementary sequence, and wherein the first labeled probe
comprises the sequence of the first addressable portion or
comprises a sequence complementary to the sequence of the first
addressable portion;
[0022] a second labeled probe, wherein the second labeled probe has
a first detectable signal value when it is not hybridized to a
complementary sequence, and wherein the second labeled probe
comprises the sequence of the second addressable portion or
comprises a sequence complementary to the sequence of the second
addressable portion; and
[0023] at least one primer set, the primer set comprising (i) at
least one first primer comprising the sequence of the 5'
primer-specific portion of the ligation product, and (ii) at least
one second primer comprising a sequence complementary to the
sequence of the 3' primer-specific portion of the ligation
product.
[0024] In certain embodiments, the methods further comprise
subjecting the amplification reaction composition to at least one
amplification reaction. In certain embodiments, the methods further
comprise detecting a second detectable signal value from the first
labeled probe and from the second labeled probe at least one of
during and after the amplification reaction, wherein a threshold
difference between the first detectable signal value and the second
detectable signal value of the first labeled probe and a threshold
difference between the first detectable signal value and the second
detectable signal value of the second labeled probe indicates the
presence of the target nucleic acid sequence, and wherein no
threshold difference between the first detectable signal value and
the second detectable signal value of the first labeled probe and
no threshold difference between the first detectable signal value
and the second detectable signal value of the second labeled probe
indicates the absence of the target nucleic acid sequence.
[0025] In certain embodiments, methods are provided for detecting
at least one target nucleic acid sequence in a sample. In certain
embodiments, the methods comprise forming a reaction composition
comprising the sample and a ligation probe set for each target
nucleic acid sequence. In certain embodiments, the probe set
comprises (a) at least one first probe, comprising a
target-specific portion and a 5' primer-specific portion, wherein
the 5' primer-specific portion comprises a sequence, and (b) at
least one second probe, comprising a target-specific portion and a
3' primer-specific portion, wherein the 3' primer-specific portion
comprises a sequence. In certain embodiments, the probes in each
set are suitable for ligation together when hybridized adjacent to
one another on a complementary target nucleic acid sequence, and
one probe in each probe set further comprises an addressable
portion located between the primer-specific portion and the
target-specific portion, wherein the addressable portion comprises
a sequence.
[0026] In certain embodiments, the reaction composition further
comprises:
[0027] a polymerase;
[0028] a labeled probe, wherein the labeled probe has a first
detectable signal value when it is not hybridized to a
complementary sequence, and wherein the labeled probe comprises the
sequence of the addressable portion or comprises a sequence
complementary to the sequence of the addressable portion; and at
least one primer set, the primer set comprising (i) at least one
first primer comprising the sequence of the 5' primer-specific
portion of the ligation product, and (ii) at least one second
primer comprising a sequence complementary to the sequence of the
3' primer-specific portion of the ligation product.
[0029] In certain embodiments, the methods further comprise
subjecting the reaction composition to at least one cycle of
ligation, wherein adjacently hybridizing complementary probes are
ligated to one another to form a ligation product comprising the 5'
primer-specific portion, the target-specific portions, the
addressable portion, and the 3' primer-specific portion.
[0030] In certain embodiments, the methods further comprise, after
the at least one cycle of ligation, subjecting the reaction
composition to at least one amplification reaction. In certain
embodiments, the methods further comprise detecting a second
detectable signal value at least one of during and after the
amplification reaction, wherein a threshold difference between the
first detectable signal value and the second detectable signal
value indicates the presence of the target nucleic acid sequence,
and wherein no threshold difference between the first detectable
signal value and the second detectable signal value indicates the
absence of the target nucleic acid sequence.
[0031] In certain embodiments, methods are provided for detecting
at least one target nucleic acid sequence in a sample. In certain
embodiments, the methods comprise forming a reaction composition
comprising the sample and a ligation probe set for each target
nucleic acid sequence. In certain embodiments, the probe set
comprises: (a) at least one first probe, comprising a
target-specific portion, a 5' primer-specific portion, wherein the
5' primer-specific portion comprises a sequence, and a first
addressable portion located between the 5' primer-specific portion
and the target-specific portion, wherein the first addressable
portion comprises a sequence; and (b) at least one second probe,
comprising a target-specific portion, a 3' primer-specific portion,
wherein the 3' primer-specific portion comprises a sequence, and a
second addressable portion located between the 3' primer-specific
portion and the target-specific portion, wherein the second
addressable portion comprises a sequence. In certain embodiments,
the probes in each set are suitable for ligation together when
hybridized adjacent to one another on a complementary target
nucleic acid sequence.
[0032] In certain embodiments, the reaction composition further
comprises:
[0033] a polymerase;
[0034] a first labeled probe, wherein the first labeled probe has a
first detectable signal value when it is not hybridized to a
complementary sequence, and wherein the first labeled probe
comprises the sequence of the first addressable portion or
comprises a sequence complementary to the sequence of the first
addressable portion;
[0035] a second labeled probe, wherein the second labeled probe has
a first detectable signal value when it is not hybridized to a
complementary sequence, and wherein the second labeled probe
comprises the sequence of the second addressable portion or
comprises a sequence complementary to the sequence of the second
addressable portion; and
[0036] at least one primer set, the primer set comprising (i) at
least one first primer comprising the sequence of the 5'
primer-specific portion of the ligation product, and (ii) at least
one second primer comprising a sequence complementary to the
sequence of the 3' primer-specific portion of the ligation
product,
[0037] In certain embodiments, the methods further comprise
subjecting the reaction composition to at least one cycle of
ligation, wherein adjacently hybridizing complementary probes are
ligated to one another to form a ligation product comprising the 5'
primer-specific portion, the first addressable portion, the
target-specific portions, the second addressable portion, and the
3' primer-specific portion.
[0038] In certain embodiments, the methods further comprise, after
the at least one cycle of ligation, subjecting the reaction
composition to at least one amplification reaction. In certain
embodiments, the methods further comprise detecting a second
detectable signal value from the first labeled probe and from the
second labeled probe at least one of during and after the
amplification reaction, wherein a threshold difference between the
first detectable signal value and the second detectable signal
value of the first labeled probe and a threshold difference between
the first detectable signal value and the second detectable signal
value of the second labeled probe indicates the presence of the
target nucleic acid sequence, and wherein no threshold difference
between the first detectable signal value and the second detectable
signal value of the first labeled probe and no threshold difference
between the first detectable signal value and the second detectable
signal value of the second labeled probe indicates the absence of
the target nucleic acid sequence.
[0039] In certain embodiments, methods are provided for detecting
at least one target nucleic acid sequence in a sample. In certain
embodiments, the methods comprise forming a reaction composition
comprising the sample and a ligation probe set for each target
nucleic acid sequence. In certain embodiments, the probe set
comprises (a) at least one first probe, comprising a
target-specific portion and a 5' primer-specific portion, wherein
the 5' primer-specific portion comprises a sequence, and (b) at
least one second probe, comprising a target-specific portion and a
3' primer-specific portion, wherein the 3' primer-specific portion
comprises a sequence. In certain embodiments, the probes in each
set are suitable for ligation together when hybridized adjacent to
one another on a complementary target nucleic acid sequence. In
certain embodiments, at least one of the at least one first probe
and the at least one second probe further comprises: (a) a first
addressable portion located between the primer-specific portion and
the target-specific portion, wherein the first addressable portion
comprises a sequence, and (b) a second addressable portion located
between the primer-specific portion and the target-specific
portion, wherein the second addressable portion comprises a
sequence.
[0040] In certain embodiments, the reaction composition further
comprises:
[0041] a polymerase;
[0042] a first labeled probe, wherein the first labeled probe has a
first detectable signal value when it is not hybridized to a
complementary sequence, and wherein the first labeled probe
comprises the sequence of the first addressable portion or
comprises a sequence complementary to the sequence of the first
addressable portion;
[0043] a second labeled probe, wherein the second labeled probe has
a first detectable signal value when it is not hybridized to a
complementary sequence, and wherein the second labeled probe
comprises the sequence of the second addressable portion or
comprises a sequence complementary to the sequence of the second
addressable portion; and
[0044] at least one primer set, the primer set comprising (i) at
least one first primer comprising the sequence of the 5'
primer-specific portion of the ligation product, and (ii) at least
one second primer comprising a sequence complementary to the
sequence of the 3' primer-specific portion of the ligation
product.
[0045] In certain embodiments, the methods further comprise
subjecting the reaction composition to at least one cycle of
ligation, wherein adjacently hybridizing complementary probes are
ligated to one another to form a ligation product comprising the 5'
primer-specific portion, the first addressable portion, the
target-specific portions, the second addressable portion, and the
3' primer-specific portion.
[0046] In certain embodiments, the methods further comprise, after
the at least one cycle of ligation, subjecting the reaction
composition to at least one amplification reaction. In certain
embodiments, the methods further comprise detecting a second
detectable signal value from the first labeled probe and from the
second labeled probe at least one of during and after the
amplification reaction, wherein a threshold difference between the
first detectable signal value and the second detectable signal
value of the first labeled probe and a threshold difference between
the first detectable signal value and the second detectable signal
value of the second labeled probe indicates the presence of the
target nucleic acid sequence, and wherein no threshold difference
between the first detectable signal value and the second detectable
signal value of the first labeled probe and no threshold difference
between the first detectable signal value and the second detectable
signal value of the second labeled probe indicates the absence of
the target nucleic acid sequence.
[0047] In certain embodiments, methods are provided for making a
library of probes. In certain embodiments, the methods comprise
synthesizing a first library of 4.sup.X probes each comprising a
primer-specific portion, a target-specific portion X nucleotides in
length, and a first addressable portion located between the
primer-specific portion and the target-specific portion, wherein
each of the 4.sup.X probes of the first library of 4.sup.X probes
comprises a different target-specific portion. In certain
embodiments, X is 4 to 8.
[0048] In certain embodiments, methods are provided for selecting a
probe. In certain embodiments, the methods comprise selecting from
a first library of probes a probe that comprises a target-specific
portion that is complementary to a desired portion of X nucleotides
of a target nucleic acid sequence. In certain embodiments, X is 4
to 8. In certain embodiments, the first library of probes comprises
4.sup.X probes that each comprise a primer-specific portion, a
target-specific portion X nucleotides in length, and a first
addressable portion located between the primer-specific portion and
the target-specific portion, wherein each of the 4.sup.X probes
comprises a different target-specific portion.
[0049] In certain embodiments, a first library of 4.sup.X probes is
provided. In certain embodiments, each of the probes comprises a
primer-specific portion, a target-specific portion X nucleotides in
length, and a first addressable portion located between the
primer-specific portion and the target-specific portion, wherein
each of the 4.sup.X probes of the first library of 4.sup.X probes
comprises a different target-specific portion. In certain
embodiments, X is 4 to 8.
[0050] In certain embodiments, methods are provided for making a
library of (4.sup.(X-1) multiplied by 6) pairs of probes,
comprising synthesizing a library of (4.sup.(X-1) multiplied by 6)
pairs of probes. In certain embodiments, one probe of each pair
comprises a primer-specific portion, a target-specific portion
comprising a sequence of X nucleotides, and a first addressable
portion located between the primer-specific portion and the
target-specific portion. In certain embodiments, the other probe of
each pair comprises a primer-specific portion, a target-specific
portion comprising a sequence of X nucleotides, and a second
addressable portion located between the primer-specific portion and
the target-specific portion. In certain embodiments, the sequence
of X nucleotides of the target-specific portion of each probe in a
pair of probes is identical except for one nucleotide difference.
In certain embodiments, each of the (4.sup.(X-1) multiplied by 6)
pairs of probes can be used to determine whether a target nucleic
acid sequence comprising X nucleotides has one of two possible
nucleic acid sequences, wherein the two possible nucleic acid
sequences differ by one nucleotide at a single position, and
wherein at least one separate pair of probes of the library is
provided for each separate possible one nucleotide difference at
one position in a target nucleic acid comprising X nucleotides. In
certain embodiments, X is 4 to 8.
[0051] In certain embodiments, a library of (4.sup.(X-1) multiplied
by 6) pairs of probes is provided. In certain embodiments, one
probe of each pair comprises a primer-specific portion, a
target-specific portion comprising a sequence of X nucleotides, and
a first addressable portion located between the primer-specific
portion and the target-specific portion. In certain embodiments,
the other probe of each pair comprises a primer-specific portion, a
target-specific portion comprising a sequence of X nucleotides, and
a second addressable portion located between the primer-specific
portion and the target-specific portion. In certain embodiments,
the sequence of X nucleotides of the target-specific portion of
each probe in a pair of probes is identical except for one
nucleotide difference. In certain embodiments, each of the
(4.sup.(X-1) multiplied by 6) pairs of probes can be used to
determine whether a target nucleic acid sequence comprising X
nucleotides has one of two possible nucleic acid sequences, wherein
the two possible nucleic acid sequences differ by one nucleotide at
a single position, and wherein at least one separate pair of probes
of the library is provided for each separate possible one
nucleotide difference at one position in a target nucleic acid
comprising X nucleotides. In certain embodiments, X is 4 to 8.
[0052] In certain embodiments, kits are provided for detecting at
least one target nucleic acid sequence. In certain embodiments, the
kits comprise a ligation probe set for each target nucleic acid
sequence. In certain embodiments, the probe set comprises: (a) at
least one first probe, comprising a target-specific portion, a 5'
primer-specific portion, wherein the 5' primer-specific portion
comprises a sequence, and a first addressable portion located
between the 5' primer-specific portion and the target-specific
portion, wherein the first addressable portion comprises a
sequence; and (b) at least one second probe, comprising a
target-specific portion, a 3' primer-specific portion, wherein the
3' primer-specific portion comprises a sequence, and a second
addressable portion located between the 3' primer-specific portion
and the target-specific portion, wherein the second addressable
portion comprises a sequence. In certain embodiments, the probes in
each set are suitable for ligation together when hybridized
adjacent to one another on a complementary target nucleic acid
sequence.
[0053] In certain embodiments, the kits further comprise:
[0054] a first labeled probe comprising the sequence of the first
addressable portion or comprising a sequence complementary to the
sequence of the first addressable portion; and
[0055] a second labeled probe comprising the sequence of the second
addressable portion or comprising a sequence complementary to the
sequence of the second addressable portion.
[0056] In certain embodiments, kits are provided for detecting at
least one target nucleic acid sequence. In certain embodiments, the
kits comprise a ligation probe set for each target nucleic acid
sequence. In certain embodiments, the probe set comprises (a) at
least one first probe, comprising a target-specific portion and a
5' primer-specific portion, wherein the 5' primer-specific portion
comprises a sequence, and (b) at least one second probe, comprising
a target-specific portion and a 3' primer-specific portion, wherein
the 3' primer-specific portion comprises a sequence. In certain
embodiments, the probes in each set are suitable for ligation
together when hybridized adjacent to one another on a complementary
target nucleic acid sequence. In certain embodiments, at least one
of the at least one first probe and the at least one second probe
further comprises: (a) a first addressable portion located between
the primer-specific portion and the target-specific portion,
wherein the first addressable portion comprises a sequence, and (b)
a second addressable portion located between the primer-specific
portion and the target-specific portion, wherein the second
addressable portion comprises a sequence.
[0057] In certain embodiments, the kits further comprise:
[0058] a first labeled probe comprising the sequence of the first
addressable portion or comprising a sequence complementary to the
sequence of the first addressable portion; and
[0059] a second labeled probe comprising the sequence of the second
addressable portion or comprising a sequence complementary to the
sequence of the second addressable portion.
[0060] In certain embodiments, methods are provided for detecting
at least one target nucleic acid sequence in a sample In certain
embodiments, the methods comprise forming a ligation reaction
composition comprising the sample and a ligation probe set for each
target nucleic acid sequence. In certain embodiments, the probe set
comprises (a) at least one first probe, comprising a
target-specific portion and a 5' primer-specific portion, wherein
the 5' primer-specific portion comprises a sequence, and (b) at
least one second probe, comprising a target-specific portion and a
3' primer-specific portion, wherein the 3' primer-specific portion
comprises a sequence and wherein a minor groove binder is attached
to the second probe In certain embodiments, the probes in each set
are suitable for ligation together when hybridized adjacent to one
another on a complementary target nucleic acid sequence.
[0061] In certain embodiments, the methods further comprise forming
a test composition by subjecting the ligation reaction composition
to at least one cycle of ligation, wherein adjacently hybridizing
complementary probes are ligated to one another to form a ligation
product comprising the 5' primer-specific portion, the
target-specific portions, and the 3' primer-specific portion.
[0062] In certain embodiments, the methods further comprise forming
an amplification reaction composition comprising:
[0063] the test composition;
[0064] a polymerase; and
[0065] at least one primer set, the primer set comprising (i) at
least one first primer comprising the sequence of the 5'
primer-specific portion of the ligation product, and (ii) at least
one second primer comprising a sequence complementary to the
sequence of the 3' primer-specific portion of the ligation
product.
[0066] In certain embodiments, the methods further comprise
subjecting the amplification reaction composition to at least one
amplification reaction. In certain embodiments, the methods further
comprise detecting the presence or absence of the at least one
target nucleic acid sequence by detecting the presence or absence
of the ligation product.
[0067] In certain embodiments, methods are provided for detecting
at least one target nucleic acid sequence in a sample. In certain
embodiments, the methods comprise forming a reaction composition
comprising the sample and a ligation probe set for each target
nucleic acid sequence, In certain embodiments, the probe set
comprises (a) at least one first probe, comprising a
target-specific portion and a 5' primer-specific portion, wherein
the 5' primer-specific portion comprises a sequence, and (b) at
least one second probe, comprising a target-specific portion and a
3' primer-specific portion, wherein the 3' primer-specific portion
comprises a sequence and wherein a minor groove binder is attached
to the second probe. In certain embodiments, the probes in each set
are suitable for ligation together when hybridized adjacent to one
another on a complementary target nucleic acid sequence.
[0068] In certain embodiments, the reaction composition further
comprises:
[0069] a polymerase; and
[0070] at least one primer set, the primer set comprising (i) at
least one first primer comprising the sequence of the 5'
primer-specific portion of the ligation product, and (ii) at least
one second primer comprising a sequence complementary to the
sequence of the 3' primer-specific portion of the ligation
product.
[0071] In certain embodiments, the methods further comprise
subjecting the reaction composition to at least one cycle of
ligation, wherein adjacently hybridizing complementary probes are
ligated to one another to form a ligation product comprising the 5'
primer-specific portion, the target-specific portions, and the 3'
primer-specific portion.
[0072] In certain embodiments, the methods further comprise, after
the at least one cycle of ligation, subjecting the reaction
composition to at least one amplification reaction. In certain
embodiments, the methods further comprise detecting the presence or
absence of the at least one target nucleic acid sequence by
detecting the presence or absence of the ligation product.
BRIEF DESCRIPTION OF THE DRAWINGS
[0073] The skilled artisan will understand that the drawings,
described below, are for illustration purposes only. The figures
are not intended to limit the scope of the invention in any
way.
[0074] FIG. 1. Schematic showing of labeled probes according to
certain exemplary embodiments.
[0075] FIG. 2 (2A-2E). Schematic showing an exemplary embodiment of
certain embodiments comprising ligation and primer extension
amplification.
[0076] FIG. 3 (3A-3F) depicts exemplary embodiments of the
invention comprising ligation and PCR-based amplification, wherein
the exemplary target nucleic acid sequence is an mRNA in the
sample.
[0077] FIG. 4 (4A-4D) depicts exemplary embodiments comprising a
ligation reaction and amplification using RNA polymerase to
generate RNA transcription products.
[0078] FIG. 5 (5A-5D) schematically illustrates exemplary
embodiments comprising ligation and primer extension followed by
transcription.
[0079] FIG. 6 is a schematic showing a ligation probe set according
to certain embodiments of the invention.
[0080] Each probe includes a portion that is complementary to the
target (the "target-specific portion," T-SP) and a portion that is
complementary to or has the same sequence as a primer (the
"primer-specific portion," P-SP). At least one probe in each probe
set further comprises an addressable portion (ASP) that is located
between the target-specific portion and the primer-specific portion
(here, the second probe).
[0081] Each probe set comprises at least one first probe and at
least one second probe that are designed to hybridize with the
target with the 3' end of the first probe (here, probe A)
immediately adjacent to and opposing the 5' end of the second probe
(here, probe Z).
[0082] FIG. 7 depicts a method for differentiating between two
potential alleles in a target locus using certain embodiments of
the invention
[0083] FIG. 7 at (1) shows: (i) a target-specific probe set
comprising: two first probes (A and B) that have the same
primer-specific portions (P-SP1), the same target-specific portions
except for different pivotal complements (here, T at the 3' end
probe A and C at the 3' end probe B) and different addressable
portions ((ASP-A) and (ASP-B)); and one second probe (Z) comprising
a target-specific portion and a primer-specific portion
(P-SP2).
[0084] FIG. 7 at (2) shows the three probes annealed to the target.
The target-specific portion of probe A is fully complementary with
the 3' target region including the pivotal nucleotide. The pivotal
complement of probe B is not complementary with the 3' target
region. The target-specific portion of probe B, therefore, contains
a base-pair mismatch at the 3' end. The target-specific portion of
probe Z is fully complementary to the 5' target region.
[0085] FIG. 7 at (3) shows ligation of probes A and Z to form
ligation product A-Z, Probes B and Z are not ligated together to
form a ligation product due to the mismatched pivotal complement on
probe B.
[0086] FIG. 7 at (4) shows denaturing the double-stranded molecules
to release the A-Z ligation product and unligated probes B and
Z.
[0087] FIG. 8 (8A-8C) is a schematic depicting certain embodiments
of the invention.
[0088] FIG. 8(1) depicts a target sequence and a ligation probe set
comprising: two first probes (A and B) that have the same
primer-specific portions (P-SP1), the same target-specific portions
except for different pivotal complements (here, T at the 3' end
probe A and G at the 3'end probe B) and different addressable
portions ((ASP-A) and (ASP-B)); and one second probe (Z) comprising
a target-specific portion and a primer-specific portion
(P-SP2).
[0089] FIG. 8(2) depicts the A and Z probes hybridized to the
target-sequence under annealing conditions.
[0090] FIG. 8(3) depicts the ligation of the first and second
probes in the presence of a ligation agent to form ligation
product.
[0091] FIG. 8(4) depicts denaturing the ligation product:target
complex to release a single-stranded ligation product; adding a
primer set (P1 and P2) and two labeled probes (LBP-A and LBP-B);
and annealing primer P2 to the ligation product.
[0092] FIG. 8(5) depicts the formation of a double-stranded nucleic
acid product by extending the P2 primer in a template-dependent
manner with a polymerase.
[0093] FIGS. 8(6)-(11) depict additional cycles of
amplification.
[0094] FIGS. 9(A)-(C) depicts various combinations of ligation
products in which two or more ligation products comprise the same
primer-specific portions.
[0095] FIG. 10 depicts exemplary alternative splicing.
[0096] FIG. 11 depicts certain embodiments involving splice
variants.
[0097] FIG. 12 (12A-12C) depicts certain embodiments involving
three biallelic loci.
[0098] FIG. 13 (13A-13C) depicts certain embodiments involving
three biallelic loci.
[0099] FIG. 14 (14A-14D) depicts certain embodiments in which one
probe of a ligation probe set also serves as a primer.
[0100] FIG. 15 depicts certain embodiments employing flap
endonuclease.
[0101] FIG. 16 (16A-16C) depicts certain embodiments employing flap
endonuclease.
[0102] FIG. 17 (17A-17C) depicts certain embodiments employing flap
endonuclease.
[0103] FIG. 18 (18A-18C) depicts certain embodiments employing flap
endonuclease.
[0104] FIG. 19 depicts certain embodiments employing flap
endonuclease.
DETAILED DESCRIPTION OF CERTAIN EXEMPLARY EMBODIMENTS
[0105] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed. In this application, the use of the singular includes the
plural unless specifically stated otherwise. In this application,
the use of "or" means "and/or" unless stated otherwise.
Furthermore, the use of the term "including", as well as other
forms, such as "includes" and "included", is not limiting. Also,
terms such as "element" or "component" encompass both elements and
components comprising one unit and elements and components that
comprise more than one subunit unless specifically stated
otherwise.
[0106] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
this application, including but not limited to patents, patent
applications, articles, books, and treatises, are hereby expressly
incorporated by reference in their entirety for any purpose. U.S.
patent application Ser. No. 09/584,905, filed May 30, 2000, Ser.
No. 09/724,755, filed Nov. 28, 2000, Ser. No. 10/011,993, filed
Dec. 5, 2001, and Patent Cooperation Treaty Application No.
PCT/US01/17329, filed May 30, 2001, are hereby expressly
incorporated by reference in their entirety for any purpose.
Certain Definitions
[0107] The term "nucleotide base", as used herein, refers to a
substituted or unsubstituted aromatic ring or rings. In certain
embodiments, the aromatic ring or rings contain at least one
nitrogen atom. In certain embodiments, the nucleotide base is
capable of forming Watson-Crick and/or Hoogsteen hydrogen bonds
with an appropriately complementary nucleotide base. Exemplary
nucleotide bases and analogs thereof include, but are not limited
to, naturally occurring nucleotide bases adenine, guanine,
cytosine, 6 methyl-cytosine, uracil, thymine, and analogs of the
naturally occurring nucleotide bases, e.g., 7-deazaadenine,
7-deazaguanine, 7-deaza-8-azaguanine, 7-deaza-8-azaadenine, N6
-.DELTA.2 -isopentenyladenine (6iA), N6
-.DELTA.2-isopentenyl-2-methylthioadenine (2ms6iA),
N2-dimethylguanine (dmG), 7-methylguanine (7 mG), inosine,
nebularine, 2-aminopurine, 2-amino-6-chloropurine,
2,6-diaminopurine, hypoxanthine, pseudouridine, pseudocytosine,
pseudoisocytosine, 5-propynylcytosine, isocytosine, isoguanine,
7-deazaguanine, 2-thiopyrimidine, 6-thioguanine, 4-thiothymine,
4-thiouracil, O.sup.6-methylguanine, N.sup.6-methyladenine,
O.sup.4-methylthymine, 5,6-dihydrothymine, 5,6-dihydrouracil,
pyrazolo[3,4-D]pyrimidines (see, e.g., U.S. Pat. Nos. 6,143,877 and
6,127,121 and PCT published application WO 01/38584),
ethenoadenine, indoles such as nitroindole and 4-methylindole, and
pyrroles such as nitropyrrole. Certain exemplary nucleotide bases
can be found, e.g., in Fasman, 1989, Practical Handbook of
Biochemistry and Molecular Biology, pp. 385-394, CRC Press, Boca
Raton, Fla., and the references cited therein.
[0108] The term "nucleotide", as used herein, refers to a compound
comprising a nucleotide base linked to the C-1' carbon of a sugar,
such as ribose, arabinose, xylose, and pyranose, and sugar analogs
thereof. The term nucleotide also encompasses nucleotide analogs.
The sugar may be substituted or unsubstituted. Substituted ribose
sugars include, but are not limited to, those riboses in which one
or more of the carbon atoms, for example the 2'-carbon atom, is
substituted with one or more of the same or different Cl, F, --R,
--OR, --NR.sub.2 or halogen groups, where each R is independently
H, C.sub.1-C.sub.6 alkyl or C.sub.5-C.sub.14 aryl. Exemplary
riboses include, but are not limited to, 2'-(C1-C6)alkoxyribose,
2'-(C5-C14)aryloxyribose, 2', 3'-didehydroribose,
2'-deoxy-3'-haloribose, 2'-deoxy-3'-fluororibose,
2'-deoxy-3'-chlororibose, 2'-deoxy-3'-aminoribose, 2'-deoxy-3'-(C1
-C6)alkylribose, 2'-deoxy-3'-(C1-C6)alkoxyribose and
2'-deoxy-3'-(C5 -C14)aryloxyribose, ribose, 2'-deoxyribose,
2',3'-dideoxyribose, 2'-haloribose, 2'-fluororibose,
2'-chlororibose, and 2'-alkylribose, e.g., 2'-O-methyl,
4'-.alpha.-anomeric nucleotides, 1'-.alpha.-anomeric nucleotides,
2'-4'- and 3'-4'-linked and other "locked" or "LNA", bicyclic sugar
modifications (see, e.g., PCT published application nos. WO
98/22489, WO 98/39352;, and WO 99/14226). Exemplary LNA sugar
analogs within a polynucleotide include, but are not limited to,
the structures: ##STR1##
[0109] where B is any nucleotide base.
[0110] Modifications at the 2'- or 3'-position of ribose include,
but are not limited to, hydrogen, hydroxy, methoxy, ethoxy,
allyloxy, isopropoxy, butoxy, isobutoxy, methoxyethyl, alkoxy,
phenoxy, azido, amino, alkylamino, fluoro, chloro and bromo.
Nucleotides include, but are not limited to, the natural D optical
isomer, as well as the L optical isomer forms (see, e.g., Garbesi
(1993) Nucl. Acids Res. 21:4159-65; Fujimori (1990) J. Amer. Chem.
Soc. 112:7435; Urata, (1993) Nucleic Acids Symposium Ser. No.
29:69-70). When the nucleotide base is purine, e.g. A or G, the
ribose sugar is attached to the N.sup.9-position of the nucleotide
base. When the nucleotide base is pyrimidine, e.g. C, T or U, the
pentose sugar is attached to the N.sup.1-position of the nucleotide
base, except for pseudouridines, in which the pentose sugar is
attached to the C5 position of the uracil nucleotide base (see,
e.g., Kornberg and Baker, (1992) DNA Replication, 2.sup.nd Ed.,
Freeman, San Francisco, Calif.).
[0111] One or more of the pentose carbons of a nucleotide may be
substituted with a phosphate ester having the formula: ##STR2##
[0112] where .alpha. is an integer from 0 to 4. In certain
embodiments, a is 2 and the phosphate ester is attached to the 3'-
or 5'-carbon of the pentose. In certain embodiments, the
nucleotides are those in which the nucleotide base is a purine, a
7-deazapurine, a pyrimidine, or an analog thereof. "Nucleotide
5'-triphosphate" refers to a nucleotide with a triphosphate ester
group at the 5' position, and are sometimes denoted as "NTP", or
"dNTP" and "ddNTP" to particularly point out the structural
features of the ribose sugar. The triphosphate ester group may
include sulfur substitutions for the various oxygens, e.g.
.alpha.-thio-nucleotide 5'-triphosphates. For a review of
nucleotide chemistry, see, Shabarova, Z. and Bogdanov, A. Advanced
Organic Chemistry of Nucleic Acids, VCH, New York, 1994.
[0113] The term "nucleotide analog", as used herein, refers to
embodiments in which the pentose sugar and/or the nucleotide base
and/or one or more of the phosphate esters of a nucleotide may be
replaced with its respective analog. In certain embodiments,
exemplary pentose sugar analogs are those described above. In
certain embodiments, the nucleotide analogs have a nucleotide base
analog as described above. In certain embodiments, exemplary
phosphate ester analogs include, but are not limited to,
alkylphosphonates, methylphosphonates, phosphoramidates,
phosphotriesters, phosphorothioates, phosphorodithioates,
phosphoroselenoates, phosphorodiselenoates, phosphoroanilothioates,
phosphoroanilidates, phosphoroamidates, boronophosphates, etc., and
may include associated counterions.
[0114] Also included within the definition of "nucleotide analog"
are nucleotide analog monomers which can be polymerized into
polynucleotide analogs in which the DNA/RNA phosphate ester and/or
sugar phosphate ester backbone is replaced with a different type of
internucleotide linkage. Exemplary polynucleotide analogs include,
but are not limited to, peptide nucleic acids, in which the sugar
phosphate backbone of the polynucleotide is replaced by a peptide
backbone.
[0115] As used herein, the terms "polynucleotide",
"oligonucleotide", and "nucleic acid" are used interchangeably and
mean single-stranded and double-stranded polymers of nucleotide
monomers, including 2'-deoxyribonucleotides (DNA) and
ribonucleotides (RNA) linked by internucleotide phosphodiester bond
linkages, or internucleotide analogs, and associated counter ions,
e.g., H+, NH.sub.4.sup.+, trialkylammonium, Mg.sup.2+, Na.sup.+ and
the like. A nucleic acid may be composed entirely of
deoxyribonucleotides, entirely of ribonucleotides, or chimeric
mixtures thereof. The nucleotide monomer units may comprise any of
the nucleotides described herein, including, but not limited to,
naturally occuring nucleotides and nucleotide analogs. nucleic
acids typically range in size from a few monomeric units, e.g. 5-40
when they are sometimes referred to in the art as oligonucleotides,
to several thousands of monomeric nucleotide units. Unless denoted
otherwise, whenever a nucleic acid sequence is represented, it will
be understood that the nucleotides are in 5' to 3' order from left
to right and that "A" denotes deoxyadenosine or an analog thereof,
"C" denotes deoxycytidine or an analog thereof, "G" denotes
deoxyguanosine or an analog thereof, and "T" denotes thymidine or
an analog thereof, unless otherwise noted.
[0116] Nucleic acids include, but are not limited to, genomic DNA,
cDNA, hnRNA, mRNA, rRNA, tRNA, fragmented nucleic acid, nucleic
acid obtained from subcellular organelles such as mitochondria or
chloroplasts, and nucleic acid obtained from microorganisms or DNA
or RNA viruses that may be present on or in a biological
sample.
[0117] Nucleic acids may be composed of a single type of sugar
moiety, e.g., as in the case of RNA and DNA, or mixtures of
different sugar moieties, e.g., as in the case of RNA/DNA chimeras.
In certain embodiments, nucleic acids are ribopolynucleotides and
2'-deoxyribopolynucleotides according to the structural formulae
below: ##STR3##
[0118] wherein each B is independently the base moiety of a
nucleotide, e.g., a purine, a 7-deazapurine, a pyrimidine, or an
analog nucleotide; each m defines the length of the respective
nucleic acid and can range from zero to thousands, tens of
thousands, or even more; each R is independently selected from the
group comprising hydrogen, halogen, --R'', --OR'', and --NR''R'',
where each R'' is independently (C1-C6) alkyl or (C5-C14) aryl, or
two adjacent Rs are taken together to form a bond such that the
ribose sugar is 2',3'-didehydroribose; and each R' is independently
hydroxyl or ##STR4##
[0119] where .alpha. is zero, one or two.
[0120] In certain embodiments of the ribopolynucleotides and
2'-deoxyribopolynucleotides illustrated above, the nucleotide bases
B are covalently attached to the C1' carbon of the sugar moiety as
previously described.
[0121] The terms "nucleic acid", "polynucleotide", and
"oligonucleotide" may also include nucleic acid analogs,
polynucleotide analogs, and oligonucleotide analogs. The terms
"nucleic acid analog", "polynucleotide analog" and "oligonucleotide
analog" are used interchangeably and, as used herein, refer to a
nucleic acid that contains at least one nucleotide analog and/or at
least one phosphate ester analog and/or at least one pentose sugar
analog. Also included within the definition of nucleic acid analogs
are nucleic acids in which the phosphate ester and/or sugar
phosphate ester linkages are replaced with other types of linkages,
such as N-(2-aminoethyl)-glycine amides and other amides (see,
e.g., Nielsen et al., 1991, Science 254: 1497-1500; WO 92/20702;
U.S. Pat. No. 5,719,262; U.S. Pat. No. 5,698,685;); morpholinos
(see, e.g., U.S. Pat. No. 5,698,685; U.S. Pat. No. 5,378,841; U.S.
Pat. No. 5,185,144); carbamates (see, e.g., Stirchak &
Summerton, 1987, J. Org. Chem. 52: 4202); methylene(methylimino)
(see, e.g., Vasseur et al., 1992, J. Am. Chem. Soc. 114: 4006);
3'-thioformacetals (see, e.g., Jones et al., 1993, J. Org. Chem.
58: 2983); sulfamates (see, e.g., U.S. Pat. No. 5,470,967);
2-aminoethylglycine, commonly referred to as PNA (see, e.g.,
Buchardt, WO 92/20702; Nielsen (1991) Science 254:1497-1500); and
others (see, e.g., U.S. Pat. No. 5,817,781; Frier & Altman,
1997, Nucl. Acids Res. 25:4429 and the references cited therein).
Phosphate ester analogs include, but are not limited to, (i)
C.sub.1-C.sub.4 alkylphosphonate, e.g. methylphosphonate; (ii)
phosphoramidate; (iii) C.sub.1-C.sub.6 alkyl-phosphotriester; (iv)
phosphorothioate; and (v) phosphorodithioate.
[0122] The terms "annealing" and "hybridization" are used
interchangeably and mean the base-pairing interaction of one
nucleic acid with another nucleic acid that results in formation of
a duplex, triplex, or other higher-ordered structure. In certain
embodiments, the primary interaction is base specific, e.g., A/T
and G/C, by Watson/Crick and Hoogsteen-type hydrogen bonding. In
certain embodiments, base-stacking and hydrophobic interactions may
also contribute to duplex stability.
[0123] An "enzymatically active mutant or variant thereof," when
used in reference to an enzyme such as a polymerase or a ligase,
means a protein with appropriate enzymatic activity. Thus, for
example, but without limitation, an enzymatically active mutant or
variant of a DNA polymerase is a protein that is able to catalyze
the stepwise addition of appropriate deoxynucleoside triphosphates
into a nascent DNA strand in a template-dependent manner. An
enzymatically active mutant or variant differs from the
"generally-accepted" or consensus sequence for that enzyme by at
least one amino acid, including, but not limited to, substitutions
of one or more amino acids, addition of one or more amino acids,
deletion of one or more amino acids, and alterations to the amino
acids themselves. With the change, however, at least some catalytic
activity is retained. In certain embodiments, the changes involve
conservative amino acid substitutions. Conservative amino acid
substitution may involve replacing one amino acid with another that
has, e.g., similar hydorphobicity, hydrophilicity, charge, or
aromaticity. In certain embodiments, conservative amino acid
substitutions may be made on the basis of similar hydropathic
indices. A hydropathic index takes into account the hydrophobicity
and charge characteristics of an amino acid, and in certain
embodiments, may be used as a guide for selecting conservative
amino acid substitutions. The hydropathic index is discussed, e.g.,
in Kyte et al., J. Mol. Biol., 157:105-131 (1982). It is understood
in the art that conservative amino acid substitutions may be made
on the basis of any of the aforementioned characteristics.
[0124] Alterations to the amino acids may include, but are not
limited to, glycosylation, methylation, phosphorylation,
biotinylation, and any covalent and noncovalent additions to a
protein that do not result in a change in amino acid sequence.
"Amino acid" as used herein refers to any amino acid, natural or
nonnatural, that may be incorporated, either enzymatically or
synthetically, into a polypeptide or protein.
[0125] Fragments, for example, but without limitation, proteolytic
cleavage products, are also encompassed by this term, provided that
at least some enzyme catalytic activity is retained.
[0126] The skilled artisan will readily be able to measure
catalytic activity using an appropriate well-known assay. Thus, an
appropriate assay for polymerase catalytic activity might include,
for example, measuring the ability of a variant to incorporate,
under appropriate conditions, rNTPs or dNTPs into a nascent
polynucleotide strand in a template-dependent manner. Likewise, an
appropriate assay for ligase catalytic activity might include, for
example, the ability to ligate adjacently hybridized
oligonucleotides comprising appropriate reactive groups. Protocols
for such assays may be found, among other places, in Sambrook et
al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor
Press (1989) (hereinafter "Sambrook et al."), Sambrook and Russell,
Molecular Cloning, Third Edition, Cold Spring Harbor Press (2000)
(hereinafter "Sambrook and Russell"), Ausbel et al., Current
Protocols in Molecular Biology (1993) including supplements through
April 2001, John Wiley & Sons (hereinafter "Ausbel et
al.").
[0127] A "target" or "target nucleic acid sequence" according to
the present invention comprises a specific nucleic acid sequence
that can be distinguished by a probe. Targets may include both
naturally occurring and synthetic molecules.
[0128] "Probes", according to the present invention, comprise
oligonucleotides that comprise a specific portion that is designed
to hybridize in a sequence-specific manner with a complementary
region on a specific nucleic acid sequence, e.g., a target nucleic
acid sequence. In certain embodiments, the specific portion of the
probe may be specific for a particular sequence, or alternatively,
may be degenerate, e.g., specific for a set of sequences.
[0129] A "ligation probe set" according to the present invention is
a group of two or more probes designed to detect at least one
target. As a non-limiting example, a ligation probe set may
comprise two nucleic acid probes designed to hybridize to a target
such that, when the two probes are hybridized to the target
adjacent to one another, they are suitable for ligation
together.
[0130] When used in the context of the present invention, "suitable
for ligation" refers to at least one first target-specific probe
and at least one second target-specific probe, each comprising an
appropriately reactive group. Exemplary reactive groups include,
but are not limited to, a free hydroxyl group on the 3' end of the
first probe and a free phosphate group on the 5' end of the second
probe. Exemplary pairs of reactive groups include, but are not
limited to: phosphorothioate and tosylate or iodide; esters and
hydrazide; RC(O)S.sup.-, haloalkyl, or RCH.sub.2S and o-haloacyl;
thiophosphoryl and bromoacetoamido groups. Exemplary reactive
groups include, but are not limited to,
S-pivaloyloxymethyl-4-thiothymidine. Additionally, in certain
embodiments, first and second target-specific probes are hybridized
to the target sequence such that the 3' end of the first
target-specific probe and the 5' end of the second target-specific
probe are immediately adjacent to allow ligation.
[0131] The term "signal moiety" as used herein refers to any tag,
label, or identifiable moiety.
[0132] "Detectably different signal" means that detectable signals
from different signal moieties are distinguishable from one another
by at least one detection method.
[0133] The term "detectable signal value" refers to a value of the
signal that is detected from a label. In certain embodiments, the
detectable signal value is the amount or intensity of signal that
is detected from a label. Thus, if there is no detectable signal
value from a label, its detectable signal value is zero (0). In
certain embodiments, the detectable signal value is a
characteristic of the signal other than the amount or intensity of
the signal, such as the spectra, wavelength, color, or lifetime of
the signal.
[0134] "Detectably different signal value" means that one or more
detectable signal values are distinguishable from one another by at
least one detection method.
[0135] The term "labeled probe" refers to a probe that provides a
detectably different signal value depending upon whether a given
nucleic acid sequence is present or absent. In certain embodiments,
a labeled probe provides a detectably different signal value when
the intact labeled probe is hybridized to a given nucleic acid
sequence than when the intact labeled probe is not hybridized to a
given nucleic acid sequence. Thus, if a given nucleic acid sequence
is present, the labeled probe provides a detectably different
signal value than when the given nucleic acid sequence is absent.
In certain embodiments, a labeled probe provides a detectably
different signal value when the probe is intact than when the probe
is not intact. In certain such embodiments, a labeled probe remains
intact unless a given nucleic acid sequence is present. In certain
such embodiments, if a given nucleic acid sequence is present, the
labeled probe is cleaved, which results in a detectably different
signal value than when the probe is intact.
[0136] In certain embodiments, the labeled probe is an "interaction
probe." The term "interaction probe" refers to a probe that
comprises at least two moieties that can interact with one another
to provide a detectably different signal value depending upon
whether a given nucleic acid sequence is present or absent. The
signal value that is detected from the interaction probe is
different depending on whether the two moieties are sufficiently
close to one another or are spaced apart from one another. During
the methods described herein, the proximity of the two moieties to
one another is different depending upon whether the given nucleic
acid is present or absent.
[0137] In certain embodiments, the two moieties of the interaction
probe are moved further apart if the given nucleic acid sequence is
present. In certain embodiments, the interaction probe comprises
two moieties that are linked together by a link element, and the
two moieties become unlinked during the method if the given nucleic
acid sequence is present. The signal value that is detected from
the interaction probe that includes the two moieties linked
together is different from the signal value that is detected from
the interaction probe when the two moieties are not linked.
[0138] The term "threshold difference between signal values" refers
to a set difference between a first detectable signal value and a
second detectable signal value that results when the target nucleic
acid sequence that is being sought is present in a sample, but that
does not result when the target nucleic acid sequence is absent.
The first detectable signal value of a labeled probe is the
detectable signal value from the probe when it is not exposed to a
given nucleic acid sequence. The second detectable signal value is
detected during and/or after an amplification reaction using a
composition that comprises the labeled probe.
[0139] The term "quantitating," when used in reference to an
amplification product, refers to determining the quantity or amount
of a particular sequence that is representative of a target nucleic
acid sequence in the sample. For example, but without limitation,
one may measure the intensity of the signal from a labeled probe.
The intensity or quantity of the signal is typically related to the
amount of amplification product. The amount of amplification
product generated correlates with the amount of target nucleic acid
sequence present prior to ligation and amplification, and thus, in
certain embodiments, may indicate the level of expression for a
particular gene.
[0140] The term "amplification product" as used herein refers to
the product of an amplification reaction including, but not limited
to, primer extension, the polymerase chain reaction, RNA
transcription, and the like. Thus, exemplary amplification products
may comprise at least one of primer extension products, PCR
amplicons, RNA transcription products, and the like.
[0141] "Primers" according to the present invention refer to
oligonucleotides that are designed to hybridize with the
primer-specific portion of probes, ligation products, or
amplification products in a sequence-specific manner, and serve as
primers for amplification reactions.
[0142] A "universal primer" is capable of hybridizing to the
primer-specific portion of more than one species of probe, ligation
product, or amplification product, as appropriate. A "universal
primer set" comprises a first primer and a second primer that
hybridize with a plurality of species of probes, ligation products,
or amplification products, as appropriate.
[0143] A "ligation agent" according to the present invention may
comprise any number of enzymatic or chemical (i.e., non-enzymatic)
agents that can effect ligation of nucleic acids to one
another.
[0144] In this application, a statement that one sequence is the
same as or is complementary to another sequence encompasses
situations where both of the sequences are completely the same or
complementary to one another, and situations where only a portion
of one of the sequences is the same as, or is complementary to, a
portion or the entire other sequence. Here, the term "sequence"
encompasses, but is not limited to, nucleic acid sequences,
polynucleotides, oligonucleotides, probes, primers, primer-specific
portions, target-specific portions, addressable portions, and
oligonucleotide link elements.
[0145] In this application, a statement that one sequence is
complementary to another sequence encompasses situations in which
the two sequences have mismatches. Here, the term "sequence"
encompasses, but is not limited to, nucleic acid sequences,
polynucleotides, oligonucleotides, probes, primers, primer-specific
portions, target-specific portions, addressable portions, and
oligonucleotide link elements. Despite the mismatches, the two
sequences should selectively hybridize to one another under
appropriate conditions.
[0146] The term "selectively hybridize" means that, for particular
identical sequences, a substantial portion of the particular
identical sequences hybridize to a given desired sequence or
sequences, and a substantial portion of the particular identical
sequences do not hybridize to other undesired sequences. A
"substantial portion of the particular identical sequences" in each
instance refers to a portion of the total number of the particular
identical sequences, and it does not refer to a portion of an
individual particular identical sequence. In certain embodiments,
"a substantial portion of the particular identical sequences" means
at least 90% of the particular identical sequences. In certain
embodiments, "a substantial portion of the particular identical
sequences" means at least 95% of the particular identical
sequences.
[0147] In certain embodiments, the number of mismatches that may be
present may vary in view of the complexity of the composition.
Thus, in certain embodiments, fewer mismatches may be tolerated in
a composition comprising DNA from an entire genome than a
composition in which fewer DNA sequences are present. For example,
in certain embodiments, with a given number of mismatches, a probe
may more likely hybridize to undesired sequences in a composition
with the entire genomic DNA than in a composition with fewer DNA
sequences, when the same hybridization conditions are employed for
both compositions. Thus, that given number of mismatches may be
appropriate for the composition with fewer DNA sequences, but fewer
mismatches may be more optimal for the composition with the entire
genomic DNA.
[0148] In certain embodiments, sequences are complementary if they
have no more than 20% mismatched nucleotides. In certain
embodiments, sequences are complementary if they have no more than
15% mismatched nucleotides. In certain embodiments, sequences are
complementary if they have no more than 10% mismatched nucleotides.
In certain embodiments, sequences are complementary if they have no
more than 5% mismatched nucleotides.
[0149] In this application, a statement that one sequence
hybridizes or binds to another sequence encompasses situations
where the entirety of both of the sequences hybridize or bind to
one another, and situations where only a portion of one or both of
the sequences hybridizes or binds to the entire other sequence or
to a portion of the other sequence. Here, the term "sequence"
encompasses, but is not limited to, nucleic acid sequences,
polynucleotides, oligonucleotides, probes, primers, primer-specific
portions, target-specific portions, addressable portions, and
oligonucleotide link elements.
[0150] In certain embodiments, the term "to a measurably lesser
extent" encompasses situations in which the event in question is
reduced at least 10 fold. In certain embodiments, the term "to a
measurably lesser extent" encompasses situations in which the event
in question is reduced at least 100 fold.
[0151] In certain embodiments, a statement that a component may be,
is, or has been "substantially removed" means that at least 90% of
the component may be, is, or has been removed. In certain
embodiments, a statement that a component may be, is, or has been
"substantially removed" means that at least 95% of the component
may be, is, or has been removed.
Certain Components
[0152] In certain embodiments, target nucleic acid sequences may
include RNA and DNA. Exemplary RNA target sequences include, but
are not limited to, mRNA, rRNA, tRNA, viral RNA, and variants of
RNA, such as splicing variants. Exemplary DNA target sequences
include, but are not limited to, genomic DNA, plasmid DNA, phage
DNA, nucleolar DNA, mitochondrial DNA, and chloroplast DNA,
[0153] In certain embodiments, target nucleic acid sequences
include, but are not limited to, cDNA, yeast artificial chromosomes
(YAC's), bacterial artificial chromosomes (BAC's), other
extrachromosomal DNA, and nucleic acid analogs. Exemplary nucleic
acid analogs include, but are not limited to, LNAs, PNAs, PPG's,
and other nucleic acid analogs.
[0154] A variety of methods are available for obtaining a target
nucleic acid sequence for use with the compositions and methods of
the present invention. When the nucleic acid target is obtained
through isolation from a biological matrix, certain isolation
techniques include, but are not limited to, (1) organic extraction
followed by ethanol precipitation, e.g., using a phenol/chloroform
organic reagent (e.g., Ausubel et al., eds., Current Protocols in
Molecular Biology Volume 1, Chapter 2, Section I, John Wiley &
Sons, New York (1993)), in certain embodiments, using an automated
DNA extractor, e.g., the Model 341 DNA Extractor available from
Applied Biosystems (Foster City, Calif.); (2) stationary phase
adsorption methods (e.g., Boom et al., U.S. Pat. No. 5,234,809;
Walsh et al., Biotechniques 10(4): 506-513 (1991)); and (3)
salt-induced DNA precipitation methods (e.g., Miller et al.,
Nucleic Acids Research,16(3): 9-10 (1988)), such precipitation
methods being typically referred to as "salting-out" methods. In
certain embodiments, the above isolation methods may be preceded by
an enzyme digestion step to help eliminate unwanted protein from
the sample, e.g., digestion with proteinase K, or other like
proteases. See, e.g,, U.S. patent application Ser. No.
09/724,613.
[0155] In certain embodiments, a target nucleic acid sequence may
be derived from any living, or once living, organism, including but
not limited to prokaryote, eukaryote, plant, animal, and virus. In
certain embodiments, the target nucleic acid sequence may originate
from a nucleus of a cell, e.g., genomic DNA, or may be extranuclear
nucleic acid, e.g., plasmid, mitrochondrial nucleic acid, various
RNAs, and the like. In certain embodiments, if the sequence from
the organism is RNA, it may be reverse-transcribed into a cDNA
target nucleic acid sequence. Furthermore, in certain embodiments,
the target nucleic acid sequence may be present in a double
stranded or single stranded form.
[0156] Exemplary target nucleic acid sequences include, but are not
limited to, amplification products, ligation products,
transcription products, reverse transcription products, primer
extension products, methylated DNA, and cleavage products.
Exemplary amplification products include, but are not limited to,
PCR and isothermal products.
[0157] In certain embodiments, nucleic acids in a sample may be
subjected to a cleavage procedure. In certain embodiments, such
cleavage products may be targets.
[0158] Different target nucleic acid sequences may be different
portions of a single contiguous nucleic acid or may be on different
nucleic acids. Different portions of a single contiguous nucleic
acid may or may not overlap.
[0159] In certain embodiments, a target nucleic acid sequence
comprises an upstream or 5' region, a downstream or 3' region, and
a "pivotal nucleotide" located in the upstream region or the
downstream region (see, e.g., FIG. 6). In certain embodiments, the
pivotal nucleotide may be the nucleotide being detected by the
probe set and may represent, for example, without limitation, a
single polymorphic nucleotide in a multiallelic target locus. In
certain embodiments, more than one pivotal nucleotide is present.
In certain embodiments, one or more pivotal nucleotides is located
in the upstream region, and one or more pivotal nucleotide is
located in the downstream region. In certain embodiments, more than
one pivotal nucleotide is located in the upstream region or the
downstream region.
[0160] The person of ordinary skill will appreciate that while a
target nucleic acid sequence is typically described as a
single-stranded molecule, the opposing strand of a double-stranded
molecule comprises a complementary sequence that may also be used
as a target sequence.
[0161] A ligation probe set, according to certain embodiments,
comprises two or more probes that comprise a target-specific
portion that is designed to hybridize in a sequence-specific manner
with a complementary region on a specific target nucleic acid
sequence (see, e.g., probes 2 and 3 in FIG. 2). A probe of a
ligation probe set may further comprise a primer-specific portion,
an addressable portion, all or part of a promoter or its
complement, or a combination of these additional components. In
certain embodiments, any of the probe's components may overlap any
other probe component(s). For example, but without limitation, the
target-specific portion may overlap the primer-specific portion,
the promoter or its complement, or both. Also, without limitation,
the addressable portion may overlap with the target-specific
portion or the primer specific-portion, or both.
[0162] In certain embodiments, at least one probe of a ligation
probe set comprises the addressable portion located between the
target-specific portion and the primer-specific portion (see, e.g.,
probe 23 in FIG. 3). In certain embodiments, the probe's
addressable portion may comprise a sequence that is the same as, or
is complementary to, at least a portion of a labeled probe. In
certain embodiments, the probe's primer-specific portion may
comprise a sequence that is the same as, or is complementary to, at
least a portion of a labeled probe. In certain embodiments, the
probe's addressable portion is not complementary with target
sequences, primer sequences, or probe sequences other than
complementary portions of labeled probes.
[0163] The sequence-specific portions of probes are of sufficient
length to permit specific annealing to complementary sequences in
primers, addressable portions, and targets as appropriate. In
certain embodiments, the length of the addressable portions and
target-specific portion are any number of nucleotides from 6 to 35.
Detailed descriptions of probe design that provide for
sequence-specific annealing can be found, among other places, in
Diffenbach and Dveksler, PCR Primer, A Laboratory Manual, Cold
Spring Harbor Press, 1995, and Kwok et al., Nucl. Acid Res.
18:999-1005 (1990).
[0164] A ligation probe set according to certain embodiments
comprises at least one first probe and at least one second probe
that adjacently hybridize to the same target nucleic acid sequence.
According to certain embodiments, a ligation probe set is designed
so that the target-specific portion of the first probe will
hybridize with the downstream target region (see, e.g., probe 2 in
FIG. 2) and the target-specific portion of the second probe will
hybridize with the upstream target region (see, e.g., probe 3 in
FIG. 2). The sequence-specific portions of the probes are of
sufficient length to permit specific annealing with complementary
sequences in targets and primers, as appropriate. In certain
embodiments, one of the at least one first probe and the at least
one second probe in a probe set further comprises an addressable
portion.
[0165] Under appropriate conditions, adjacently hybridized probes
may be ligated together to form a ligation product, provided that
they comprise appropriate reactive groups, for example, without
limitation, a free 3'-hydroxyl and 5'-phosphate group.
[0166] According to certain embodiments, some ligation probe sets
may comprise more than one first probe or more than one second
probe to allow sequence discrimination between target sequences
that differ by one or more nucleotides (see, e.g., FIG. 7).
[0167] According to certain embodiments of the invention, a
ligation probe set is designed so that the target-specific portion
of the first probe will hybridize with the downstream target region
(see, e.g., the first probe in FIG. 6) and the target-specific
portion of the second probe will hybridize with the upstream target
region (see, e.g., the second probe in FIG. 6). In certain
embodiments, a nucleotide base complementary to the pivotal
nucleotide, the "pivotal complement" or "pivotal complement
nucleotide," is present on the proximal end of the second probe of
the target-specific probe set (see, e.g., 5' end (PC) of the second
probe in FIG. 6). In certain embodiments, the first probe may
comprise the pivotal complement and addressable portion rather than
the second probe (see, e.g., FIG. 7). The skilled artisan will
appreciate that, in various embodiments, the pivotal nucleotide(s)
may be located anywhere in the target sequence and that likewise,
the pivotal complement(s) may be located anywhere within the
target-specific portion of the probe(s). For example, according to
various embodiments, the pivotal complement may be located at the
3' end of a probe, at the 5' end of a probe, or anywhere between
the 3' end and the 5' end of a probe.
[0168] In certain embodiments, when the first and second probes of
the ligation probe set are hybridized to the appropriate upstream
and downstream target regions, and when the pivotal complement is
at the 5' end of one probe or the 3' end of the other probe, and
the pivotal complement is base-paired with the pivotal nucleotide
on the target sequence, the hybridized first and second probes may
be ligated together to form a ligation product (see, e.g., FIG.
7(2)-(3)). In the example shown in FIG. 7 (2)-(3), a mismatched
base at the pivotal nucleotide, however, interferes with ligation,
even if both probes are otherwise fully hybridized to their
respective target regions.
[0169] In certain embodiments, other mechanisms may be employed to
avoid ligation of probes that do not include the correct
complementary nucleotide at the pivotal complement. For example, in
certain embodiments, conditions may be employed such that a probe
of a ligation probe set will hybridize to the target sequence to a
measurably lesser extent if there is a mismatch at the pivotal
nucleotide. Thus, in such embodiments, such non-hybridized probes
will not be ligated to the other probe in the probe set.
[0170] In certain embodiments, the first probes and second probes
in a ligation probe set are designed with similar melting
temperatures (T.sub.m). Where a probe includes a pivotal
complement, in certain embodiments, the T.sub.m for the probe(s)
comprising the pivotal complement(s) of the target pivotal
nucleotide sought will be approximately 4-15.degree. C. lower than
the other probe(s) that do not contain the pivotal complement in
the probe set. In certain such embodiments, the probe comprising
the pivotal complement(s) will also be designed with a Tm near the
ligation temperature. Thus, a probe with a mismatched nucleotide
will more readily dissociate from the target at the ligation
temperature. The ligation temperature, therefore, in certain
embodiments provides another way to discriminate between, for
example, multiple potential alleles in the target.
[0171] Further, in certain embodiments, ligation probe sets do not
comprise a pivotal complement at the terminus of the first or the
second probe (e.g., at the 3' end or the 5' end of the first or
second probe). Rather, the pivotal complement is located somewhere
between the 5' end and the 3' end of the first or second probe. In
certain such embodiments, probes with target-specific portions that
are fully complementary with their respective target regions will
hybridize under high stringency conditions. Probes with one or more
mismatched bases in the target-specific portion, by contrast, will
hybridize to their respective target region to a measurably lesser
extent. Both the first probe and the second probe must be
hybridized to the target for a ligation product to be
generated.
[0172] In certain embodiments, highly related sequences that differ
by as little as a single nucleotide can be distinguished. For
example, according to certain embodiments, one can distinguish the
two potential alleles in a biallelic locus as follows. One can
combine a ligation probe set comprising two first probes, differing
in their addressable portions and their pivotal complement (see,
e.g., probes A and B in FIG. 7(1)), one second probe (see, e.g.,
probe Z in FIG. 7(1)), and the sample containing the target. All
three probes will hybridize with the target sequence under
appropriate conditions (see, e.g., FIG. 7(2)). Only the first probe
with the hybridized pivotal complement, however, will be ligated
with the hybridized second probe (see, e.g., FIG. 7(3)). Thus, if
only one allele is present in the sample, only one ligation product
for that target will be generated (see, e.g., ligation product A-Z
in FIG. 7(D)). Both ligation products would be formed in a sample
from a heterozygous individual. In certain embodiments, ligation of
probes with a pivotal complement that is not complementary to the
pivotal nucleotide may occur, but such ligation occurs to a
measurably lesser extent than ligation of probes with a pivotal
complement that is complementary to the pivotal nucleotide.
[0173] Many different signal moieties may be used in various
embodiments of the present invention. For example, signal moieties
include, but are not limited to, fluorophores, radioisotopes,
chromogens, enzymes, antigens, heavy metals, dyes, phosphorescence
groups, chemiluminescent groups, and electrochemical detection
moieties. Exemplary fluorophores that may be used as signal
moieties include, but are not limited to, rhodamine, cyanine 3 (Cy
3), cyanine 5 (Cy 5), fluorescein, Vic.TM., Liz.TM., Tamra.TM.,
5-Fam.TM., 6-Fam.TM., and Texas Red (Molecular Probes). (Vic.TM.,
Liz.TM., Tamra.TM., 5-Fam.TM., and 6-Fam.TM. (all available from
Applied Biosystems, Foster City, Calif.) Exemplary radioisotopes
include, but are not limited to, .sup.32P, .sup.33P, and .sup.35S.
Signal moieties also include elements of multi-element indirect
reporter systems, e.g., biotin/avidin, antibody/antigen,
ligand/receptor, enzyme/substrate, and the like, in which the
element interacts with other elements of the system in order to
effect a detectable signal. Certain exemplary multi-element systems
include a biotin reporter group attached to a probe and an avidin
conjugated with a fluorescent label. Detailed protocols for methods
of attaching signal moieties to oligonucleotides can be found in,
among other places, G. T. Hermanson, Bioconjugate Techniques,
Academic Press, San Diego, Calif. (1996) and S. L. Beaucage et al.,
Current Protocols in Nucleic Acid Chemistry, John Wiley & Sons,
New York, N.Y. (2000).
[0174] As discussed above, the term "interaction probe" refers to a
probe that comprises at least two moieties that can interact with
one another to provide a detectably different signal value
depending upon whether a given nucleic acid sequence is present or
absent. In certain embodiments, one of the moieties is a signal
moiety and the other moiety is a quencher moiety. The signal value
that is detected from the signal moiety is different depending on
whether the quencher moiety is sufficiently close to the signal
moiety or is spaced apart from the signal moiety. In certain
embodiments, the quencher moiety decreases the detectable signal
value from the signal moiety when the quencher moiety is
sufficiently close to the signal moiety, In certain embodiments,
the quencher moiety decreases the detectable signal value to zero
or close to zero when the quencher moiety is sufficiently close to
the signal moiety.
[0175] In certain embodiments, one of the moieties of the
interaction probe is a signal moiety and the other moiety is a
donor moiety. The signal value that is detected from the signal
moiety is different depending on whether the donor moiety is
sufficiently close to the signal moiety or is spaced apart from the
signal moiety. In certain embodiments, the donor moiety increases
the detectable signal value from the signal moiety when the donor
moiety is sufficiently close to the signal moiety. In certain
embodiments, the detectable signal value is zero or close to zero
when the donor moiety is not sufficiently close to the signal
moiety.
[0176] In certain embodiments employing a donor moiety and signal
moiety, one may use certain energy-transfer fluorescent dyes.
Certain nonlimiting exemplary pairs of donors (donor moieties) and
acceptors (signal moieties) are illustrated, e.g., in U.S. Pat.
Nos. 5,863,727; 5,800,996; and 5,945,526. Use of certain such
combinations of a donor and an acceptor have also been called FRET
(Fluorescent Resonance Energy Transfer).
[0177] In certain embodiments, the moieties of the interaction
probe are linked to one another by a link element such as, but not
limited to, an oligonucleotide. In certain such embodiments, the
presence of a sequence that hybridizes to a interaction probe
impacts the proximity of the moieties to one another during the
methods described herein. In various embodiments, the moieties may
be attached to the link element in various ways known in the art.
For example, certain nonlimiting protocols for attaching moieties
to oligonucleotides are found in, among other places, G. T.
Hermanson, Bioconjugate Techniques, Academic Press, San Diego,
Calif. (1996) and S. L. Beaucage et al., Current Protocols in
Nucleic Acid Chemistry, John Wiley & Sons, New York, N.Y.
(2000). In certain embodiments, an interaction probe comprises more
than one signal moiety. In certain embodiments, an interaction
probe comprises more than one quencher moiety. In certain
embodiments, an interaction probe comprises more than one donor
moiety.
[0178] According to certain embodiments, the interaction probe may
be a "5'-nuclease probe," which comprises a signal moiety linked to
a quencher moiety or a donor moiety through a short oligonucleotide
link element. When the 5'-nuclease probe is intact, the quencher
moiety or the donor moiety influences the detectable signal from
the signal moiety. According to certain embodiments, the
5'-nuclease probe binds to a specific nucleic acid sequence, and is
cleaved by the 5' nuclease activity of at least one of a polymerase
and another enzymatic construct when the probe is replaced by a
newly polymerized strand during an amplification reaction such as
PCR or some other strand displacement protocol.
[0179] When the oligonucleotide link element of the 5'-nuclease
probe is cleaved, the detectable signal from the signal moiety
changes when the signal moiety becomes further separated from the
quencher moiety or the donor moiety. In certain such embodiments
that employ a quencher moiety, the signal value increases when the
signal moiety becomes further separated from the quencher moiety.
In certain such embodiments that employ a donor moiety, the signal
value decreases when the signal moiety becomes further separated
from the donor moiety,
[0180] An example of a 5' nuclease probe according to certain
embodiments is depicted in FIG. 1A, where the labeled probe (LBP)
includes a quencher moiety (Q) and a signal moiety (S). The nucleic
acid sequence with which the interaction probe interacts in FIG. 1A
includes a 5' primer-specific portion P-SP1, an addressable portion
(ASP), and a 3' primer-specific portion (P-SP2). The signal that is
detected from the labeled probe increases with cleavage.
[0181] In certain embodiments, the 5'-nuclease probe is a
5'-nuclease fluorescent probe, in which the signal moiety is a
fluorescent moiety and the quencher moiety is a fluorescence
quencher moiety. When the probe is cleaved during a strand
displacement protocol, the fluorescent moiety emits a detectable
fluorescent signal. In certain embodiments, a 5'-nuclease
fluorescent probe may emit a given level of signal when it is
hybridized to a complementary sequence prior to cleavage, and the
level of the signal is increased with cleavage. Certain exemplary
embodiments of 5'-nuclease fluorescent probes are described, e.g.,
in U.S. Pat. No. 5,538,848, and exemplified by the TaqMan.RTM.)
probe molecule, which is part of the TaqMan.RTM. assay system
(available from Applied Biosystems, Foster City, Calif.).
[0182] According to certain embodiments, the interaction probe may
be a "hybridization dependent probe," which comprises a signal
moiety linked to a quencher moiety or a donor moiety through an
oligonucleotide link element. When the hybridization dependent
probe is not bound to a given nucleic acid sequence, and is thus
single stranded, the oligonucleotide link element can bend
flexibly, and the quencher moiety or the donor moiety is
sufficiently close to the signal moiety to influence the detectable
signal from the signal moiety. In certain embodiments, the
oligonucleotide link element of a hybridization dependent probe is
designed such that when it is not hybridized to a given nucleic
acid sequence, it folds back and hybridizes to itself (see, e.g.,
FIG. 1C), e.g., a molecular beacon probe. See, e.g., U.S. Pat. Nos.
5,118,801; 5,312,728; and 5,925,517. In certain embodiments, the
oligonucleotide link element of a hybridization dependent probe
does not hybridize to itself when it is not hybridized to the given
nucleic acid sequence (see, e.g., FIG. 1B).
[0183] When a hybridization dependent probe is bound to a given
nucleic acid as double stranded nucleic acid, the quencher moiety
or the donor moiety is spaced apart from the signal moiety such
that the detectable signal is changed. In certain such embodiments
that employ a quencher moiety, the signal value increases when the
signal moiety becomes further separated from the quencher moiety.
In certain such embodiments that employ a donor moiety, the signal
value decreases when the signal moiety becomes further separated
from the donor moiety.
[0184] Examples of certain hybridization dependent probes according
to certain embodiments are depicted in FIGS. 1B and 1C, where the
labeled probe (LBP) includes a quencher moiety (Q) and a signal
moiety (S). The nucleic acid sequence with which the interaction
probe interacts in FIGS. 1B and 1C includes a 5' primer-specific
portion P-SP1, an addressable portion (ASP), and a 3'
primer-specific portion (P-SP2).
[0185] In certain embodiments of hybridization dependent probes,
the signal moiety is a fluorescent moiety and the quencher moiety
is a fluorescence quencher moiety. When the probe is hybridized to
a specific nucleic acid sequence, the fluorescent moiety emits a
detectable fluorescent signal. When the probe is not hybridized to
a nucleic acid sequence and is intact, quenching occurs and little
or no fluorescence is detected.
[0186] Certain exemplary embodiments of hybridization dependent
probes are described, e.g., in U.S. Pat. No. 5,723,591.
[0187] In certain embodiments, one employs nucleic acids in the
hybridization dependent probes such that a substantial portion of
the hybridization dependent probes are not cleaved by an enzyme
during an amplification reaction. A "substantial portion of the
hybridization dependent probes are not cleaved" refers to a portion
of the total number of hybridization dependent probes that are
designed to hybridize to a given nucleic sequence that is being
amplified, and it does not refer to a portion of an individual
probe. In certain embodiments, "a substantial portion of
hybridization dependent probes that are not cleaved" means that at
least 90% of the hybridization dependent probes are not cleaved. In
certain embodiments, at least 95% of the hybridization dependent
probes are not cleaved. In certain embodiments, one employs PNA for
some or all of the nucleic acids of a hybridization dependent
probe.
[0188] In certain embodiments, one employs hybridization dependent
probes in which a substantial portion of the hybridization
dependent probes do not hybridize to an addressable portion or a
complement of the addressable portion during an extension reaction.
A "substantial portion of the hybridization dependent probes do not
hybridize" here refers to a portion of the total number of
hybridization dependent probes that are designed to hybridize to a
given nucleic sequence that is being amplified, and it does not
refer to a portion of an individual probe. In certain embodiments,
"a substantial portion of hybridization dependent probes that do
not hybridize" means that at least 90% of the hybridization
dependent probes do not hybridize. In certain embodiments, at least
95% of the hybridization dependent probes do not hybridize.
[0189] According to certain embodiments, the interaction probe may
be a "cleavable RNA probe," which comprises a signal moiety linked
to a quencher moiety or a donor moiety through a short RNA link
element. When the cleavable RNA probe is intact, the quencher
moiety or the donor moiety influences the detectable signal from
the signal moiety. According to certain embodiments, the cleavable
RNA probe binds to a specific DNA sequence, and is cleaved by RNase
H, or an agent with similar activity.
[0190] When the RNA link element of the cleavable RNA probe is
cleaved, the detectable signal from the signal moiety changes when
the signal moiety becomes further separated from the quencher
moiety or the donor moiety. In certain such embodiments that employ
a quencher moiety, the signal value increases when the signal
moiety becomes further separated from the quencher moiety. In
certain such embodiments that employ a donor moiety, the signal
value decreases when the signal moiety becomes further separated
from the donor moiety.
[0191] In certain embodiments, if a particular nucleic acid
sequence that is to be detected is present in a sample, a nucleic
acid amplification procedure results in more DNA comprising the
specific DNA sequence to which a cleavable RNA probe binds than if
the particular nucleic acid sequence is not present in the sample.
In such embodiments, one may determine the presence of the
particular nucleic acid in the sample in view of the signal
generated from the cleavable RNA probe during and/or after the
amplification procedure. In certain embodiments, one may quantitate
the amount of a particular nucleic acid in a sample in view of the
signal generated from a cleavable RNA probe during and/or after the
amplification procedure.
[0192] In certain embodiments, the cleavable RNA probe is a
cleavable RNA fluorescent probe, in which the signal moiety is a
fluorescent moiety and the quencher moiety is a fluorescence
quencher moiety. When the probe is cleaved, the fluorescent moiety
emits a detectable fluorescent signal. In certain embodiments, a
cleavable RNA probe may emit a given level of signal when it is
hybridized to a complementary sequence prior to cleavage, and the
level of the signal is increased with cleavage.
[0193] According to certain embodiments, the interaction probe may
be a "structure-specific nuclease probe," which comprises a signal
moiety linked to a quencher moiety or a donor moiety through a
short oligonucleotide link element. When the structure-specific
nuclease probe is intact, the quencher moiety or the donor moiety
influences the detectable signal from the signal moiety. According
to certain embodiments, the structure-specific nuclease probe binds
to a specific nucleic acid sequence, and is cleaved by a
structure-specific nuclease if it is appropriately hybridized to
the specific nucleic acid sequence.
[0194] When the oligonucleotide link element of the
structure-specific nuclease probe is cleaved, the detectable signal
from the signal moiety changes when the signal moiety becomes
further separated from the quencher moiety or the donor moiety. In
certain such embodiments that employ a quencher moiety, the signal
value increases when the signal moiety becomes further separated
from the quencher moiety. In certain such embodiments that employ a
donor moiety, the signal value decreases when the signal moiety
becomes further separated from the donor moiety.
[0195] In certain embodiments, the structure-specific nuclease
probe is a structure-specific nuclease fluorescent probe, in which
the signal moiety is a fluorescent moiety and the quencher moiety
is a fluorescence quencher moiety. When the probe is cleaved, the
fluorescent moiety emits a detectable fluorescent signal. In
certain embodiments, a structure-specific nuclease probe may emit a
given level of signal when it is hybridized to a complementary
sequence prior to cleavage, and the level of the signal is
increased with cleavage.
[0196] In certain embodiments, one employs a structure-specific
nuclease probe comprising a flap that does not substantially
hybridize to the addressable portion and employs a flap
endonuclease (FEN) as the structure-specific nuclease. An exemplary
embodiment is shown in FIG. 19. The structure-specific nuclease
probe in FIG. 19 includes a flap portion that does not hybridize to
the addressable portion, a hybridizing portion that hybridizes to
the addressable portion, and a FEN cleavage position nucleotide
between the flap portion and the hybridizing portion. The FEN
cleavage position nucleotide is designed to be complementary to the
nucleotide of the addressable portion that is immediately 3' to the
nucleotide that hybridizes to the 5' end nucleotide of the probe's
hybridizing portion. The flap portion includes a signal moiety
attached to it and the hybridizing portion includes a quencher
moiety or a donor moiety attached to it.
[0197] As shown in the embodiments depicted in FIG. 19, another
oligonucleotide X is designed to hybridize to the addressable
portion 3' to the portion of the addressable portion that
hybridizes to the hybridizing portion of the structure-specific
nuclease probe. If the appropriate addressable portion is present,
FEN will cleave the structure-specific nuclease probe such that the
signal moiety becomes separated from the quenching moiety or donor
moiety.
[0198] According to certain embodiments, the interaction probe may
comprise two oligonucleotides that hybridize to a given nucleic
acid sequence adjacent to one another. In certain embodiments, one
of the oligonucleotides comprises a signal moiety and one of the
oligonucleotides comprises a quencher moiety or a donor moiety.
When both oligonucleotides are hybridized to the given nucleic acid
sequence, the quencher moiety or the donor moiety is sufficiently
close to the signal moiety to influence the detectable signal from
the signal moiety.
[0199] In certain such embodiments that employ a donor moiety, the
signal value increases when the two oligonucleotides are hybridized
to the given nucleic acid sequence. In certain such embodiments
that employ a quencher moiety, the signal value decreases when the
two oligonucleotides are hybridized to the given nucleic acid
sequence, In certain embodiments, the signal moiety is a
fluorescent moiety.
[0200] Other examples of suitable labeled probes according to
certain embodiments are i-probes, scorpion probes, eclipse probes,
and others. Exemplary, but nonlimiting, probes are discussed, for
example, in Whitcombe et al., Nat. Biotechnol., 17(8):804-807
(1999) (includes scorpion probes); TheIwell et al., Nucleic Acids
Res., 28(19):3752-3761 (2000) (includes scorpion probes); Afonina
et al., Biotechniques, 32(4): (2002) (includes eclipse probes); Li
et al., "A new class of homogeneous nucleic acid probes based on
specific displacement hybridization", Nucleic Acids Res., 30(2):E5
(2002); Kandimall et al., Bioorg. Med. Chem., 8(8):1911-1916
(2000); Isacsson et al., Mol. Cell. Probes, 14(5):321-328 (2000);
French et al, Mol. Cell. Probes, 15(6):363-374 (2001); and Nurmi et
al., "A new label technology for the detection of specific
polymerase chain reaction products in a closed tube", Nucleic Acids
Res., 28(8), E28 (2000). Exemplary quencher moieties according to
certain embodiments may be those available from Epoch Biosciences,
Bothell, Washington.
[0201] In certain embodiments, one may use a labeled probe and a
threshold difference between first and second detectable signal
values to detect the presence or absence of a target nucleic acid
in a sample. In such embodiments, if the difference between the
first and second detectable signal values is the same as or greater
than the threshold difference, i.e., there is a threshold
difference, one concludes that the target nucleic acid is present.
If the difference between the first and second detectable signal
values is less than the threshold difference, i.e., there is no
threshold difference, one concludes that the target nucleic acid is
absent.
[0202] Certain nonlimiting examples of how one may set a threshold
difference according to certain embodiments follow.
[0203] First, in certain embodiments, a labeled probe that is not
hybridized to a complementary sequence may have a first detectable
signal value of zero. In certain embodiments, when one forms an
amplification reaction composition comprising the labeled probe,
and any unligated ligation probes and ligation products that
include complementary addressable portions, before amplification,
the detectable signal value may increase to 0.4. In certain such
embodiments, when such an amplification reaction composition does
not include any ligation products comprising the complementary
addressable portion, the detectable signal value may remain at 0.4
during and/or after an amplification reaction. (In other words, the
second detectable signal value is 0.4.) In certain such
embodiments, when such an amplification reaction composition,
however, includes a ligation product comprising a complementary
addressable portion, the detectable signal value may increase to 2
during and/or after an amplification reaction. (In other words, the
second detectable signal value is 2.)
[0204] Thus, in certain such embodiments, one may set a threshold
difference between first and second detectable signal values at a
value somewhere between a value just above 0.4 to about 2. For
example, one may set the threshold difference at somewhere between
0.5 to 2.
[0205] Second, in certain embodiments, a labeled probe that is not
hybridized to a complementary sequence may have an first detectable
signal value of zero. In certain embodiments, when one forms an
amplification reaction composition comprising the labeled probe,
and any unligated ligation probes and ligation products that
include complementary addressable portions, before amplification,
the detectable signal value may increase to 0.4. In certain such
embodiments, when such an amplification reaction composition does
not include any ligation products comprising the complementary
addressable portion, the detectable signal value may increase to
0.7 during and/or after an amplification reaction. (In other words,
the second detectable signal value is 0.7.) In certain such
embodiments, when such an amplification reaction composition,
however, includes a ligation product comprising a complementary
addressable portion, the detectable signal value may increase to 2
during and/or after an amplification reaction. (In other words, the
second detectable signal value is 2.)
[0206] Thus, in certain such embodiments, one may set a threshold
difference between first and second detectable signal values at a
value somewhere between a value just above 0.7 to about 2. For
example, one may set the threshold difference at somewhere between
0.8 to 2.
[0207] Third, in certain embodiments, a labeled probe that is not
hybridized to a complementary sequence may have a first detectable
signal value of zero. In certain embodiments, when one forms an
amplification reaction composition comprising the labeled probe,
and any unligated ligation probes and ligation products that
include complementary addressable portions, before amplification,
the detectable signal value may increase to 0.4. In certain such
embodiments, when such an amplification reaction composition does
not include any ligation products comprising the complementary
addressable portion, the detectable signal value may increase
linearly during and/or after an amplification reaction, (In other
words, the second detectable signal value is linearly increased
from the first detectable signal value.) In certain such
embodiments, when such an amplification reaction composition,
however, includes a ligation product comprising a complementary
addressable portion, the detectable signal value may increase
exponentially during and/or after an amplification reaction. (In
other words, the second detectable signal value is exponentially
increased from the first detectable signal value.)
[0208] Thus, in certain such embodiments, one may measure
detectable signal values at two or more points during
amplification, and at the end of the amplification reaction, to
determine if the increase in detectable signal value is linear or
exponential. In certain embodiments, one may measure detectable
signal values at three or more points during amplification to
determine if the increase in detectable signal value is linear or
exponential. In certain embodiments, if the increase is
exponential, there is a threshold difference between the first and
second detectable signal values.
[0209] In certain embodiments, one may employ a ligation probe set
that can be used in a FEN-OLA technique. In a FEN-OLA technique, a
first probe of a ligation probe set comprises a target-specific
portion that is designed to hybridize to the target nucleic acid
sequence. A second probe of the ligation probe set comprises a flap
portion, a target-specific portion, and a FEN cleavage position
nucleotide between the flap portion and the target-specific
portion. The target-specific portion of the second probe is
designed to hybridize to the target nucleic acid sequence such the
end of the target-specific portion nearest the flap portion is
adjacent to the hybridized target-specific portion of the first
probe.
[0210] The flap portion is designed such that a substantial portion
of the flap portions do not hybridize to the target nucleic acid
sequence. A "substantial portion of the flap portions do not
hybridize" refers to a portion of the total number of flap
portions, and it does not refer to a portion of an individual flap
portion. In certain embodiments, "a substantial portion of flap
portions that do not hybridize" means that at least 90% of the flap
portions do not hybridize. In certain embodiments, at least 95% of
the flap portions do not hybridize.
[0211] FEN will cleave the second probe between the cleavage
position nucleotide and the target-specific portion, if the proper
target nucleic acid sequence is present, Specifically, such
cleavage occurs if the target-specific portions of the first and
second probes hybridize to the target nucleic acid sequence, and
the FEN cleavage position nucleotide is complementary to the
nucleotide of the target nucleic acid sequence that is directly
adjacent to the portion of the target nucleic sequence that
hybridizes to the target specific portion of the second probe. FIG.
15 shows certain nonlimiting examples that help to illustrate
certain ligation probe sets that may be used in FEN-OLA techniques
according to certain embodiments.
[0212] If the flap is cleaved, the second probe may then be ligated
to the adjacent hybridized first probe of a ligation probe set. If
the flap is not cleaved, the second probe will not be ligated to
the adjacent hybridized first probe.
[0213] Certain nonlimiting examples of probes used in a FEN-OLA
technique are depicted in FIG. 16. In FIG. 16, one employs a probe
set comprising: two first probes, differing in their addressable
portions and their pivotal complements (see, e.g., probes A and B
in FIG. 16(A)); and two second probes that comprise different FEN
cleavage position nucleotides that correspond to the pivotal
complements of the two first probes (see, e.g., probes Y and Z in
FIG. 16(A)).
[0214] In the embodiment shown in FIG. 16, FEN will cleave the flap
of a second probe only if the second probe comprises a FEN cleavage
position nucleotide that is complementary to the pivotal nucleotide
of target nucleic acid sequence (see, e.g., FIG. 16(B)). In such a
situation in such embodiments, the first and second probes of the
probe set are ligated together if the pivotal complement of the
first probe is complementary to the pivotal nucleotide of the
target nucleic acid sequence (see, e.g., FIG. 16(C)). If there is a
mismatch at the pivotal nucleotide, no ligation occurs.
[0215] Thus, if only one allele is present in the sample, only one
ligation product for that target will be generated (see, e.g.,
ligation product A-Z in FIG. 16(C)). Both ligation products would
be formed in a sample from a heterozygous individual. In certain
embodiments, cleavage of probes with a FEN cleavage position
nucleotide that is not complementary to the pivotal nucleotide may
occur, but such cleavage occurs to a measurably lesser extent than
cleavage of probes with a FEN cleavage position nucleotide that is
complementary to the pivotal nucleotide. In certain embodiments,
ligation of probes with a pivotal complement that is not
complementary to the pivotal nucleotide may occur, but such
ligation occurs to a measurably lesser extent than ligation of
probes with a pivotal complement that is complementary to the
pivotal nucleotide.
[0216] Certain nonlimiting examples of probes used in a FEN-OLA
technique are also depicted in FIG. 17. In FIG. 17, one employs a
probe set comprising two first probes, which comprise different
addressable portions and different pivotal complements and the
pivotal complement of each first probe is at the penultimate
nucleotide position at the 3' end of the first probes (see, e.g.,
probes A and B in FIG. 17(A)). The probe set further comprises a
second probe that comprises a FEN cleavage position nucleotide that
is the same as the nucleotide at the 3' end of the two first probes
(see, e.g., probe Z in FIG. 17(A)).
[0217] In the embodiment depicted in FIG. 17, FEN will cleave the
flap of a second probe only if the second probe comprises a FEN
cleavage position nucleotide that is complementary to the
nucleotide immediately 5' of the pivotal nucleotide of target
nucleic acid sequence (see, e.g., FIG. 17(B)). In such a situation
in such embodiments, the first and second probes of the probe set
are ligated together if: (1) the pivotal complement of the first
probe is complementary to the pivotal nucleotide of the target
nucleic acid sequence; and (2) the nucleotide at the 3' end of the
first probe is complementary to the nucleotide immediately 5' of
the pivotal nucleotide of target nucleic acid sequence (see, e.g.,
FIG. 17(C)). If there is a mismatch at the pivotal nucleotide, no
ligation occurs.
[0218] Thus, if only one allele is present in the sample, only one
ligation product for that target will be generated (see, e.g.,
ligation product A-Z in FIG. 17(C)). Both ligation products would
be formed in a sample from a heterozygous individual. In certain
embodiments, cleavage of probes with a FEN cleavage position
nucleotide that is not complementary to the nucleotide immediately
5' of the pivotal nucleotide may occur, but such cleavage occurs to
a measurably lesser extent than cleavage of probes with a FEN
cleavage position nucleotide that is complementary to the
nucleotide immediately 5' of the pivotal nucleotide. In certain
embodiments, ligation of probes with a pivotal complement that is
not complementary to the pivotal nucleotide may occur, but such
ligation occurs to a measurably lesser extent than ligation of
probes with a pivotal complement that is complementary to the
pivotal nucleotide. In certain embodiments, ligation of first
probes with a nucleotide at the 3' end that is not complementary to
the nucleotide immediately 5' of the pivotal nucleotide may occur,
but such ligation occurs to a measurably lesser extent than
ligation of first probes with a nucleotide at the 3' end that is
complementary to the nucleotide immediately 5' of the pivotal
nucleotide.
[0219] Certain nonlimiting examples of probes used in a FEN-OLA
technique are also depicted in FIG. 18. In FIG. 18, one employs a
probe set comprising two second probes, which comprise the same FEN
cleavage position nucleotide and comprise different addressable
portions and different pivotal complements (the pivotal complement
of each second probe is immediately 3' to the FEN cleavage position
nucleotide) (see, e.g., probes A and B in FIG. 18(A)). The probe
set further comprises a first probe that comprises a nucleotide at
the 3' end that is the same as the FEN cleavage position nucleotide
(see, e.g., probe Z in FIG. 18(A)).
[0220] In the embodiment depicted in FIG. 18, FEN will cleave the
flap of a second probe only if the second probe comprises a FEN
cleavage position nucleotide that is complementary to the
nucleotide immediately 3' of the pivotal nucleotide of target
nucleic acid sequence (see, e.g., FIG. 18(B)). In such a situation
in such embodiments, the first and second probes of the probe set
are ligated together if: (1) the pivotal complement of the second
probe is complementary to the pivotal nucleotide of the target
nucleic acid sequence; and (2) the nucleotide at the 3' end of the
first probe is complementary to the nucleotide immediately 3' of
the pivotal nucleotide of target nucleic acid sequence (see, e.g.,
FIG. 18(C)). If there is a mismatch at the pivotal nucleotide, no
ligation occurs.
[0221] Thus, if only one allele is present in the sample, only one
ligation product for that target will be generated (see, e.g.,
ligation product Z-A in FIG. 18(C))"Both ligation products would be
formed in a sample from a heterozygous individual. In certain
embodiments, cleavage of probes with a FEN cleavage position
nucleotide that is not complementary to the nucleotide immediately
3' of the pivotal nucleotide may occur, but such cleavage occurs to
a measurably lesser extent than cleavage of probes with a FEN
cleavage position nucleotide that is complementary to the
nucleotide immediately 3' of the pivotal nucleotide. In certain
embodiments, ligation of probes with a pivotal complement that is
not complementary to the pivotal nucleotide may occur, but such
ligation occurs to a measurably lesser extent than ligation of
probes with a pivotal complement that is complementary to the
pivotal nucleotide. In certain embodiments, ligation of first
probes with a nucleotide at the 3' end that is not complementary to
the nucleotide immediately 3' of the pivotal nucleotide may occur,
but such ligation occurs to a measurably lesser extent than
ligation of first probes with a nucleotide at the 3' end that is
complementary to the nucleotide immediately 3' of the pivotal
nucleotide.
[0222] In certain embodiments, one may employ different labeled
probes that are specific to different addressable portions. In
certain such embodiments, one may employ different labeled probes
that comprise different sequences and detectably different signal
moieties. Detectably different signal moieties include, but are not
limited to, moieties that emit light of different wavelengths,
moieties that absorb light of different wavelengths, moieties that
have different fluorescent decay lifetimes, moieties that have
different spectral signatures, and moieties that have different
radioactive decay properties.
[0223] In certain embodiments, one may employ a labeled probe that
remains intact unless a particular nucleic acid sequence is
present. A label is attached to the probe. If the particular
nucleic acid is present, the probe will be cleaved. Certain
examples, of such probes include, but are not limited to, probes
that are cleaved by 5' nuclease activity during an extension
reaction, probes that are cleaved by structure-specific nuclease
activity and probes that are cleaved by RNase H or another agent
with similar activity.
[0224] In certain such embodiments, the cleaved portion of the
probe with the label can be separated from intact probes in view of
different migration rates of the cleaved portion of the probe and
the intact probe using a method such as a "mobility-dependent
analysis technique." A "mobility-dependent analysis technique"
refers to any analysis based on different rates of migration
between different analytes. Exemplary mobility-dependent analyse
techniques include, but are not limited to, electrophoresis, mass
spectroscopy, chromatography, sedimentation, gradient
centrifugation, field-flow fractionation, and multi-stage
extraction techniques. Thus, in such embodiments, one may determine
the presence or absence of (or quantitate) a particular nucleic
acid sequence in a sample by detecting the presence of (or
quantitating) labeled cleaved portions of the labeled probe.
[0225] In certain embodiments, one may employ a mobility modifier
to separate different cleaved portions of labeled probes from one
another. For example, in certain such embodiments, different
labeled probes with the same label could be used for different loci
if the labeled probes for each different loci had a different
mobility modifier. In certain embodiments, mobility modifiers may
be oligonucleotides of different lengths effecting different
mobilities. In certain embodiments, mobility modifiers may also be
non-nucleotide polymers, such as a polyethylene oxide (PEO),
polyglycolic acid, polyurethane polymers, polypeptides, or
oligosaccharides, as non-limiting examples. In certain embodiments,
mobility modifiers may work by adding size to a polynucleotide, or
by increasing the "drag" of the molecule during migration through a
medium without substantially adding to the size. Certain mobility
modifiers such as PEO's have been described, e.g., in U.S. Pat.
Nos. 5,470,705; 5,580,732; 5,624,800; and 5,989,871.
[0226] In certain embodiments, one may create a library of all, or
a subset of all, possible combinations of nucleotides for one probe
of a ligation probe set. For example, in certain embodiments, one
may create a library of probes from which one may select two allele
specific probes to detect any single nucleotide polymorphism in any
nucleic acid sequence.
[0227] In certain embodiments, one creates a library that includes
an allele specific probe for every possible nucleotide combination
of a target-specific portion of a given number of nucleotides.
Since there are four possible nucleotides for each of the given
number of nucleotides, there are 4.sup.X possible combinations for
a given number X nucleotides. Thus, in certain such embodiments,
4.sup.X allele specific probes are provided in the library so that
one may select a probe for every possible combination of X number
of nucleotides in the target-specific portion of the probe.
[0228] In certain embodiments, each of the allele specific probes
of the library will further comprise a primer-specific portion and
an addressable portion between the primer-specific portion and the
target-specific portion. In certain embodiments, all of the probes
will have the same primer-specific portion.
[0229] In certain embodiments, to detect or quantitate two possible
alleles of a biallelic locus, one can make a library of
[4.sup.(X-1).times.6] probes from which one can choose two allele
specific probes to distinguish between each of the possible two
alleles for every possible combination of X nucleotides in the
target-specific portion of the probe.
[0230] For example, in certain such embodiments, the
target-specific portion of the allele specific probes of the
library are six nucleotides in length. In certain such embodiments,
the library will include probes with addressable portion AP1 and
will include other probes with a different addressable portion AP2.
To aid in the following discussion of certain embodiments, Table A
is provided. TABLE-US-00001 TABLE A AP1-N.sub.5A (4.sup.5 = 1024
probes) AP2-N.sub.5C (4.sup.5 = 1024 probes) AP1-N.sub.5C (4.sup.5
= 1024 probes) AP2-N.sub.5G (4.sup.5 = 1024 probes) AP1-N.sub.5G
(4.sup.5 = 1024 probes) AP2-N.sub.5T (4.sup.5 = 1024 probes)
[0231] In embodiments as depicted in Table A, the library includes
allele specific probes that comprise AP1 and each of the possible
combinations of six nucleotide long target-specific portions that
have "A" as the pivotal complement. Since all such probes have "A"
as the pivotal complement, the combination of 5 nucleotide
positions (N.sub.5) of each target-specific portion will be
different in each different probe, and thus, there will be
4.sup.5=1024 different probes in the library that comprise AP1 and
"A" as the pivotal complement.
[0232] In embodiments as depicted in Table A, the library includes
allele specific probes that comprise AP1 and each of the possible
combinations of six nucleotide long target-specific portions that
have "C" as the pivotal complement. Since all such probes have "C"
as the pivotal complement, the combination of 5 nucleotide
positions (N.sub.5) of each target-specific portion will be
different in each different probe, and thus, there will be
4.sup.5=1024 different probes in the library that comprise AP1 and
"C" as the pivotal complement.
[0233] In embodiments as depicted in Table A, the library includes
allele specific probes that comprise AP1 and each of the possible
combinations of six nucleotide long target-specific portions that
have "G" as the pivotal complement. Since all such probes have "G"
as the pivotal complement, the combination of 5 nucleotide
positions (N.sub.5) of each target-specific portion will be
different in each different probe, and thus, there will be
4.sup.5=1024 different probes in the library that comprise AP1 and
"G" as the pivotal complement.
[0234] In embodiments as depicted in Table A, the library includes
allele specific probes that comprise AP2 and each of the possible
combinations of six nucleotide long target-specific portions that
have "C" as the pivotal complement. Since all such probes have "C"
as the pivotal complement, the combination of 5 nucleotide
positions (N.sub.5) of each target-specific portion will be
different in each different probe, and thus, there will be
4.sup.5=1024 different probes in the library that comprise AP2 and
"C" as the pivotal complement.
[0235] In embodiments as depicted in Table A, the library includes
allele specific probes that comprise AP2 and each of the possible
combinations of six nucleotide long target-specific portions that
have "G" as the pivotal complement Since all such probes have "G"
as the pivotal complement, the combination of 5 nucleotide
positions (N.sub.5) of each target-specific portion will be
different in each different probe, and thus, there will be
4.sup.5=1024 different probes in the library that comprise AP2 and
"G" as the pivotal complement.
[0236] In embodiments as depicted in Table A, the library includes
allele specific probes that comprise AP2 and each of the possible
combinations of six nucleotide long target-specific portions that
have "T" as the pivotal complement. Since all such probes have "T"
as the pivotal complement, the combination of 5 nucleotide
positions (N.sub.5) of each target-specific portion will be
different in each different probe, and thus, there will be
4.sup.5=1024 different probes in the library that comprise AP2 and
"T" as the pivotal complement.
[0237] Thus, the library includes
[4.sup.(X-1).times.6]=[4.sup.(6-1).times.6]=[4.sup.(5).times.6]=6144
probes. Table B below shows certain embodiments of how one can
select two probes from the library depicted in Table A for each of
the possible two pivotal nucleotides at any of the possible
biallelic loci. TABLE-US-00002 TABLE B AP1-N.sub.5A/AP2-N.sub.5C
(1024 different pairs of probes -- N.sub.5 is the same within a
given pair of probes, but each of the different 1024 pairs of
probes has a different N.sub.5) AP1-N.sub.5A/AP2-N.sub.5G (1024
different pairs of probes -- N.sub.5 is the same within a given
pair of probes, but each of the different 1024 pairs of probes has
a different N.sub.5) AP1-N.sub.5A/AP2-N.sub.5T (1024 different
pairs of probes -- N.sub.5 is the same within a given pair of
probes, but each of the different 1024 pairs of probes has a
different N.sub.5) AP1-N.sub.5C/AP2-N.sub.5G (1024 different pairs
of probes -- N.sub.5 is the same within a given pair of probes, but
each of the different 1024 pairs of probes has a different N.sub.5)
AP1-N.sub.5C/AP2-N.sub.5T (1024 different pairs of probes --
N.sub.5 is the same within a given pair of probes, but each of the
different 1024 pairs of probes has a different N.sub.5)
AP1-N.sub.5G/AP2-N.sub.5T (1024 different pairs of probes --
N.sub.5 is the same within a given pair of probes, but each of the
different 1024 pairs of probes has a different N.sub.5)
[0238] Thus, one can select a pair of probes from the 6144
different pairs of probes for each possible biallelic loci.
[0239] In certain embodiments, one may change the correspondence
between a given addressable portion and a given nucleotide at the
pivotal complement that is shown in Table A. See, e.g., the library
depicted in Table C below according to certain embodiments.
TABLE-US-00003 TABLE C AP1-N.sub.5C (4.sup.5 = 1024 probes)
AP2-N.sub.5A (4.sup.5 = 1024 probes) AP1-N.sub.5A (4.sup.5 = 1024
probes) AP2-N.sub.5T (4.sup.5 = 1024 probes) AP1-N.sub.5T (4.sup.5
= 1024 probes) AP2-N.sub.5G (4.sup.5 = 1024 probes)
[0240] Table D below shows a library of allele specific probes for
biallelic loci according to certain embodiments that comprise a
target-specific portion that is eight nucleotides in length.
TABLE-US-00004 TABLE D AP1-N.sub.7A (7.sup.4 = 16,384 probes)
AP2-N.sub.7C (7.sup.4 = 16,384 probes) AP1-N.sub.7C (7.sup.4 =
16,384 probes) AP2-N.sub.7G (7.sup.4 = 16,384 probes) AP1-N.sub.7G
(7.sup.4 = 16,384 probes) AP2-N.sub.7T (7.sup.4 = 16,384
probes)
[0241] Thus, the library includes
[4.sup.(X-1).times.6]=[4.sup.(8-1).times.6]=[4.sup.(7).times.6]=98,304
probes. Table E below shows how one can select two probes from the
library depicted in Table D for each of the possible two pivotal
nucleotides at any of the possible biallelic loci. TABLE-US-00005
TABLE E AP1-N.sub.7A/AP2-N.sub.7C (16,384 different pairs of probes
-- N.sub.7 is the same within a given pair of probes, but each of
the different 16,384 pairs of probes has a different N.sub.7)
AP1-N.sub.7A/AP2-N.sub.7G (16,384 different pairs of probes --
N.sub.7 is the same within a given pair of probes, but each of the
different 16,384 pairs of probes has a different N.sub.7)
AP1-N.sub.7A/AP2-N.sub.7T (16,384 different pairs of probes --
N.sub.7 is the same within a given pair of probes, but each of the
different 16,384 pairs of probes has a different N.sub.7)
AP1-N.sub.7C/AP2-N.sub.7G (16,384 different pairs of probes --
N.sub.7 is the same within a given pair of probes, but each of the
different 16,384 pairs of probes has a different N.sub.7)
AP1-N.sub.7C/AP2-N.sub.5T (16,384 different pairs of probes --
N.sub.7 is the same within a given pair of probes, but each of the
different 16,384 pairs of probes has a different N.sub.7)
AP1-N.sub.7G/AP2-N.sub.5T (16,384 different pairs of probes --
N.sub.7 is the same within a given pair of probes, but each of the
different 16,384 pairs of probes has a different N.sub.7)
[0242] Thus, one can select a pair of probes from the 16,384
different pairs of probes for each possible biallelic loci.
[0243] In certain embodiments, to detect or quantitate two possible
alleles of a biallelic locus, the library may include two sets of
4.sup.X probes. One set of such probes may have a first addressable
portion and the other set may be identical except have a second
different addressable portion Thus, in such embodiments, all
possible combinations of two allele specific probes with two
different addressable portions are available.
[0244] For example, with single nucleotide polymorphisms (SNPs),
assume that one identifies a particular biallelic SNP locus. In
certain embodiments, one can match the two possible nucleotides of
the SNP and the adjacent (X minus 1) nucleotides of the target
locus to the library of probes to find two appropriate allele
specific probes with two different addressable portions.
[0245] In certain embodiments, the target-specific portion of the
allele specific probes of the library are six nucleotides in
length. Thus, there are 4.sup.6=4096 possible combinations for the
target-specific portions of the allele specific probes of the
library. If the library includes probes with two different
addressable portions for each 4096 possible target-specific
portions, the library includes 8192 allele specific probes.
[0246] In certain embodiments, the target-specific portion of the
allele specific probes of the library are eight nucleotides in
length. Thus, there are 4.sup.8=65,536 possible combinations for
the target-specific portions of the allele specific probes of the
library. If the library includes probes with two different
addressable portions for each 65,536 possible target-specific
portions, the library includes 131,072 allele specific probes.
[0247] In certain embodiments, one can also make the other probe of
the ligation probe set (a locus specific probe), which is the probe
that will have a target-specific portion that permits it to anneal
to the target adjacent to the allele specific probes. The term
locus specific probe is used simply to distinguish it from the
allele specific probes in the library.
[0248] In various embodiments, the number of specific nucleotides
in the target-specific portion of the allele specific probes of a
library may be at any point between four nucleotides and twenty
nucleotides.
[0249] One skilled in the art will be able to design the probes
such that ligation occurs when the locus specific probe and the
appropriate allele specific probe (with a nucleotide complementary
to the SNP nucleotide) hybridize adjacent to one another on the
target nucleic acid sequence. In certain embodiments, one may
employ LNA in the probes.
[0250] In certain embodiments, one may increase the length of the
probes by including sequences that have a specific portion that is
designed to hybridize to a particular target nucleic acid sequence
and an adjacent degenerate portion. For example, in certain
embodiments, a group of probes may all be used for a specific six
nucleotide portion of a particular target nucleic acid sequence. In
certain such embodiments, each of the probes in the group may
comprise the same six nucleotide sequence portion that is
complementary to the particular target nucleic acid sequence. The
probes in the group further comprise additional adjacent degenerate
portions that randomly have the four different nucleotides at each
of the positions of the degenerate portion so that both the
specific six nucleotide portion and the degenerate portion of at
least one of the probes in the group will hybridize to any nucleic
acid that includes the specific six nucleotide portion.
[0251] For example, for a given six nucleotide target nucleic acid
sequence, each probe of a group of probes may include the same six
nucleotide sequence portion that is complementary to the particular
target nucleic acid sequence. Each of the probes of the group may
further comprise a four nucleotide degenerate portion. The probes
in the series may have all of the possible combinations for a four
nucleotide sequence. Thus, although only six nucleotides provide
specificity for the target nucleic acid sequence, one of the probes
in the group will have a random four nucleotide sequence that will
also hybridize to the target. Accordingly, the length of the
portion of at least one probe in the group that hybridizes to the
target increases to ten nucleotides rather than six
nucleotides.
[0252] In certain embodiments, one may increase the length of the
probe by adding a portion with universal nucleotides that will
hybridize to most or all nucleotides nonspecifically. Exemplary,
but nonlimiting, universal nucleotides are discussed, e.g., in
Berger et al. Angew. Chem. Int. Ed. Engl. (2000) 39: 2940-42; and
Smith et al. Nucleosides & Nucleotides (1998) 17: 541-554. An
exemplary, but nonlimiting, universal nucleotide is
8-aza-7-deazaadenine, which is discussed, e.g., in Sella and
Debelak, Nucl. Acids Res., 28:3224-3232 (2000).
[0253] In certain embodiments, one may employ universal nucleotides
or degenerate portions in probes to accommodate sequence variation.
In certain embodiments, one may employ universal nucleotides in
probes of a library to reduce complexity of the library.
[0254] A primer set according to certain embodiments comprises at
least one primer capable of hybridizing with the primer-specific
portion of at least one probe of a ligation probe set. In certain
embodiments, a primer set comprises at least one first primer and
at least one second primer, wherein the at least one first primer
specifically hybridizes with one probe of a ligation probe set (or
a complement of such a probe) and the at least one second primer of
the primer set specifically hybridizes with a second probe of the
same ligation probe set (or a complement of such a probe). In
certain embodiments, at least one primer of a primer set further
comprises all or part of a promoter sequence or its complement. In
certain embodiments, the first and second primers of a primer set
have different hybridization temperatures, to permit
temperature-based asymmetric PCR reactions.
[0255] The skilled artisan will appreciate that while the probes
and primers of the invention may be described in the singular form,
a plurality of probes or primers may be encompassed by the singular
term, as will be apparent from the context. Thus, for example, in
certain embodiments, a ligation probe set typically comprises a
plurality of first probes and a plurality of second probes.
[0256] The criteria for designing sequence-specific primers and
probes are well known to persons of ordinary skill in the art.
Detailed descriptions of primer design that provide for
sequence-specific annealing can be found, among other places, in
Diffenbach and Dveksler, PCR Primer, A Laboratory Manual, Cold
Spring Harbor Press, 1995, and Kwok et al. (Nucl. Acid Res.
18:999-1005, 1990). The sequence-specific portions of the primers
are of sufficient length to permit specific annealing to
complementary sequences in ligation products and amplification
products, as appropriate.
[0257] In embodiments that employ a promoter sequence, the promoter
sequence or its complement will be of sufficient length to permit
an appropriate polymerase to interact with it. Detailed
descriptions of sequences that are sufficiently long for polymerase
interaction can be found in, among other places, Sambrook and
Russell.
[0258] According to certain embodiments, a primer set of the
present invention comprises at least one second primer. In certain
embodiments, the second primer in that primer set is designed to
hybridize with a 3' primer-specific portion of a ligation or
amplification product in a sequence-specific manner (see, e.g.,
FIG. 2C). In certain embodiments, the primer set further comprises
at least one first primer. In certain embodiments, the first primer
of a primer set is designed to hybridize with the complement of the
5' primer-specific portion of that same ligation or amplification
product in a sequence-specific manner. In certain embodiments, at
least one primer of the primer set comprises a promoter sequence or
its complement or a portion of a promoter sequence or its
complement. For a discussion of primers comprising promoter
sequences, see, e.g., Sambrook and Russell.
[0259] A universal primer or primer set may be employed according
to certain embodiments. In certain embodiments, a universal primer
or a universal primer set hybridizes with two or more of the
probes, ligation products, or amplification products in a reaction,
as appropriate. When universal primer sets are used in certain
amplification reactions, such as, but not limited to, PCR,
qualitative or quantitative results may be obtained for a broad
range of template concentrations.
[0260] In certain embodiments involving a ligation reaction and an
amplification reaction, one may employ at least one probe and/or at
least one primer that includes a minor groove binder attached to
it. Certain exemplary minor groove binders and certain exemplary
methods of attaching minor groove binders to oligonucleotides are
discussed, e.g., in U.S. Pat. Nos. 5,801,155 and 6,084,102. Certain
exemplary minor groove binders are those available from Epoch
Biosciences, Bothell, Washington. According to certain embodiments,
a minor groove binder may be attached to at least one of the
following: at least one probe of a ligation probe set; at least one
primer of a primer set; and at least one labeled probe.
[0261] According to certain embodiments, a minor groove binder is
attached to a ligation probe that includes a 3' primer-specific
portion. In certain such embodiments, the presence of the minor
groove binder facilitates use of a short primer that hybridizes to
the 3' primer-specific portion in an amplification reaction. For
example, in certain embodiments, the short primer, or segment of
the primer that hybridizes to the primer-specific portion or its
complement, may have a length of anywhere between 8 and 15
nucleotides.
[0262] In certain embodiments, a minor groove binder is attached to
at least one of a forward primer and a reverse primer to be used in
an amplification reaction. In certain such embodiments, a primer
with a minor groove binder attached to it may be a short primer.
For example, in certain embodiments, the short primer, or segment
of the primer that hybridizes to the primer-specific portion or its
complement, may have a length of anywhere between 8 and 15
nucleotides. In certain embodiments, both the forward and reverse
primers may have minor groove binders attached to them.
[0263] In certain embodiments, one may use minor groove binders as
follows in methods that employ a ligation probe set comprising: a
first probe comprising a 5' primer specific portion; and a second
probe comprising a 3' primer-specific portion. A minor groove
binder is attached to the 3' end of the second probe, and a minor
groove binder is attached to a primer that hybridizes to the
complement of the 5' primer-specific portion of the first probe. In
certain such embodiments, the presence of the minor groove binders
facilitates use of short forward and reverse primers in an
amplification reaction. For example, in certain embodiments, the
short primer, or segment of the primer that hybridizes to the
primer-specific portion or its complement, may have a length of
anywhere between 8 and 15 nucleotides.
[0264] One may use any of the arrangements involving minor groove
binders discussed above with various methods employing ligation
probes with addressable portions as discussed herein. In certain
embodiments, one may use such arrangements with different types of
ligation and amplification methods. For example, one may use at
least one probe and/or at least one primer with an attached minor
groove binder in any of a variety of methods employing ligation and
amplification reactions. Exemplary methods include, but are not
limited to, those discussed in U.S. Pat. No. 6,027,889, PCT
Published Patent Application No. WO 01/92579, and U.S. patent
application Ser. Nos. 09/584,905 and 10/011,993.
[0265] In certain embodiments, one may employ non-natural
nucleotides other than the naturally occurring nucleotides A, G, C,
T, and U. For example, in certain embodiments, one may employ
primer-specific portions and primers and/or addressable portions
and labeled probes that comprise pairs of non-natural nucleotides
that specifically hybridize to one another and not to naturally
occurring nucleotides. Exemplary, but nonlimiting, non-natural
nucleotides are discussed, e.g., in Wu et al. J. Am. Chem. Soc.
(2000) 122: 7621-32; Berger et al. Nuc. Acids Res. (2000) 28:
2911-14, Ogawa et al. J. Am. Chem. Soc. (2000) 122: 3274-87
[0266] Certain embodiments include a ligation agent. For example,
ligase is an enzymatic ligation agent that, under appropriate
conditions, forms phosphodiester bonds between the 3'-OH and the
5'-phosphate of adjacent nucleotides in DNA or RNA molecules, or
hybrids. Exemplary ligases include, but are not limited to, Tth
K294R ligase and Tsp AK16D ligase. See, e.g., Luo et al., Nucleic
Acids Res., 24(14):3071-3078 (1996); Tong et al., Nucleic Acids
Res., 27(3):788-794 (1999); and Published PCT Application No. WO
00/26381. Temperature sensitive ligases, include, but are not
limited to, T4 DNA ligase, T7 DNA ligase, and E. coli ligase. In
certain embodiments, thermostable ligases include, but are not
limited to, Taq ligase, Tth ligase, Tsc ligase, and Pfu ligase.
Certain thermostable ligases may be obtained from thermophilic or
hyperthermophilic organisms, including but not limited to,
prokaryotic, eucaryotic, or archael organisms. Certain RNA ligases
may be employed in certain embodiments. In certain embodiments, the
ligase is a RNA dependent DNA ligase, which may be employed with
RNA template and DNA ligation probes. An exemplary, but nonlimiting
example, of a ligase with such RNA dependent DNA ligase activity is
T4 DNA ligase. In certain embodiments, the ligation agent is an
"activating" or reducing agent.
[0267] Chemical ligation agents include, without limitation,
activating, condensing, and reducing agents, such as carbodiimide,
cyanogen bromide (BrCN), N-cyanoimidazole, imidazole,
1-methylimidazole/carbodiimide/cystamine, dithiothreitol (DTT) and
ultraviolet light. Autoligation, i.e., spontaneous ligation in the
absence of a ligating agent, is also within the scope of certain
embodiments of the invention. Detailed protocols for chemical
ligation methods and descriptions of appropriate reactive groups
can be found, among other places, in Xu et al., Nucleic Acid Res.,
27:875-81 (1999); Gryaznov and Letsinger, Nucleic Acid Res.
21:1403-08 (1993); Gryaznov et al., Nucleic Acid Res. 22:2366-69
(1994); Kanaya and Yanagawa, Biochemistry 25:7423-30 (1986); Luebke
and Dervan, Nucleic Acids Res. 20:3005-09 (1992); Sievers and von
Kiedrowski, Nature 369:221-24 (1994); Liu and Taylor, Nucleic Acids
Res. 26:3300-04 (1999); Wang and Kool, Nucleic Acids Res.
22:2326-33 (1994); Purmal et al., Nucleic Acids Res. 20:3713-19
(1992); Ashley and Kushlan, Biochemistry 30:2927-33 (1991); Chu and
Orgel, Nucleic Acids Res. 16:3671-91 (1988); Sokolova et al., FEBS
Letters 232:153-55 (1988); Naylor and Gilham, Biochemistry
5:2722-28 (1966); and U.S. Pat. No. 5,476,930.
[0268] In certain embodiments, at least one polymerase is included.
In certain embodiments, at least one thermostable polymerase is
included. Exemplary thermostable polymerases, include, but are not
limited to, Taq polymerase, Pfx polymerase, Pfu polymerase,
Vent.RTM. polymerase, Deep Vent.TM. polymerase, Pwo polymerase, Tth
polymerase, UITma polymerase and enzymatically active mutants and
variants thereof. Descriptions of these polymerases may be found,
among other places, at the world wide web URL:
the-scientist.com/yr1998/jan/profile 1.sub.--980105. html; at the
world wide web URL:
the-scientist.com/yr2001/jan/profile.sub.--010903. html; at the
world wide web URL:
the-scientist.com/yr2001/sep/profile2.sub.--010903. html; at the
article The Scientist 12(1):17 (Jan. 5, 1998); and at the article
The Scientist 15(17):1 (Sep. 3, 2001).
[0269] The skilled artisan will appreciate that the complement of
the disclosed probe, target, and primer sequences, or combinations
thereof, may be employed in certain embodiments of the invention.
For example, without limitation, a genomic DNA sample may comprise
both the target sequence and its complement. Thus, in certain
embodiments, when a genomic sample is denatured, both the target
sequence and its complement are present in the sample as
single-stranded sequences. In certain embodiments, ligation probes
may be designed to specifically hybridize to an appropriate
sequence, either the target sequence or its complement.
Certain Exemplary Component Methods
[0270] Ligation according to the present invention comprises any
enzymatic or chemical process wherein an internucleotide linkage is
formed between the opposing ends of nucleic acid sequences that are
adjacently hybridized to a template. Additionally, the opposing
ends of the annealed nucleic acid sequences should be suitable for
ligation (suitability for ligation is a function of the ligation
method employed). The internucleotide linkage may include, but is
not limited to, phosphodiester bond formation. Such bond formation
may include, without limitation, those created enzymatically by a
DNA or RNA ligase, such as bacteriophage T4 DNA ligase, T4 RNA
ligase, T7 DNA ligase, Thermus thermophilus (Tth) ligase, Thermus
aquaticus (Taq) ligase, or Pyrococcus furiosus (Pfu) ligase. Other
internucleotide linkages include, without limitation, covalent bond
formation between appropriate reactive groups such as between an
.alpha.-haloacyl group and a phosphothioate group to form a
thiophosphorylacetylamino group; and between a phosphorothioate and
a tosylate or iodide group to form a 5'-phosphorothioester or
pyrophosphate linkages.
[0271] In certain embodiments, chemical ligation may, under
appropriate conditions, occur spontaneously such as by
autoligation. Alternatively, in certain embodiments, "activating"
or reducing agents may be used. Examples of activating agents and
reducing agents include, without limitation, carbodiimide, cyanogen
bromide (BrCN), imidazole,
1-methylimidazole/carbodiimide/cystamine, N-cyanoimidazole,
dithiothreitol (DTT) and ultraviolet light. Nonenzymatic ligation
according to certain embodiments may utilize specific reactive
groups on the respective 3' and 5' ends of the aligned probes.
[0272] In certain embodiments, ligation generally comprises at
least one cycle of ligation, for example, the sequential procedures
of: hybridizing the target-specific portions of a first probe and a
second probe, that are suitable for ligation, to their respective
complementary regions on a target nucleic acid sequence; ligating
the 3' end of the first probe with the 5' end of the second probe
to form a ligation product; and denaturing the nucleic acid duplex
to separate the ligation product from the target nucleic acid
sequence. The cycle may or may not be repeated. For example,
without limitation, by thermocycling the ligation reaction to
linearly increase the amount of ligation product.
[0273] According to certain embodiments, one may use ligation
techniques such as gap-filling ligation, including, without
limitation, gap-filling OLA and LCR, bridging oligonucleotide
ligation, FEN-LCR, and correction ligation. Descriptions of these
techniques can be found, among other places, in U.S. Pat. No.
5,185,243, published European Patent Applications EP 320308 and EP
439182, published PCT Patent Application WO 90/01069, published PCT
Patent Application WO 02/02823, and U.S. patent application Ser.
No. 09/898,323.
[0274] In certain embodiments, one may employ poly dIC in a
ligation reaction. In certain embodiments, one uses any number
between 15 to 80 ng/microliter of poly dIC in a ligation reaction.
In certain embodiments, one uses 30 ng/microliter of poly dIC in a
ligation reaction.
[0275] One may use poly dIC in a ligation reaction with various
methods employing ligation probes with addressable portions as
discussed herein. In certain embodiments, one may use poly dIC with
different types of ligation methods. For example, one may use poly
dIC in any of a variety of methods employing ligation reactions.
Exemplary methods include, but are not limited to, those discussed
in U.S. Pat. No. 6,027,889, PCT Published Patent Application No. WO
01/92579, and U.S. patent application Ser. Nos. 09/584,905 and
10/011,993.
[0276] In certain embodiments, one forms a test composition for a
subsequent amplification reaction by subjecting a ligation reaction
composition to at least one cycle of ligation. In certain
embodiments, after ligation, the test composition may be used
directly in the subsequent amplification reaction. In certain
embodiments, prior to the amplification reaction, the test
composition may be subjected to a purification technique that
results in a test composition that includes less than all of the
components that may have been present after the at least one cycle
of ligation. For example, in certain embodiments, one may purify
the ligation product.
[0277] Purifying the ligation product according to certain
embodiments comprises any process that removes at least some
unligated probes, target nucleic acid sequences, enzymes, and/or
accessory agents from the ligation reaction composition following
at least one cycle of ligation. Such processes include, but are not
limited to, molecular weight/size exclusion processes, e.g., gel
filtration chromatography or dialysis, sequence-specific
hybridization-based pullout methods, affinity capture techniques,
precipitation, adsorption, or other nucleic acid purification
techniques. The skilled artisan will appreciate that purifying the
ligation product prior to amplification in certain embodiments
reduces the quantity of primers needed to amplify the ligation
product, thus reducing the cost of detecting a target sequence.
Also, in certain embodiments, purifying the ligation product prior
to amplification may decrease possible side reactions during
amplification and may reduce competition from unligated probes
during hybridization.
[0278] Hybridization-based pullout (HBP) according to certain
embodiments of the present invention comprises a process wherein a
nucleotide sequence complementary to at least a portion of one
probe (or its complement), for example, the primer-specific
portion, is bound or immobilized to a solid or particulate pullout
support (see, e.g., U.S. Pat. No. 6,124,092). In certain
embodiments, a composition comprising ligation product, target
sequences, and unligated probes is exposed to the pullout support.
The ligation product, under appropriate conditions, hybridizes with
the support-bound sequences. The unbound components of the
composition are removed, purifying the ligation products from those
ligation reaction composition components that do not contain
sequences complementary to the sequence on the pullout support. One
subsequently removes the purified ligation products from the
support and combines them with at least one primer set to form a
first amplification reaction composition. The skilled artisan will
appreciate that, in certain embodiments, additional cycles of HBP
using different complementary sequences on the pullout support may
remove all or substantially all of the unligated probes, further
purifying the ligation product.
[0279] Amplification according to the present invention encompasses
a broad range of techniques for amplifying nucleic acid sequences,
either linearly or exponentially. Exemplary amplification
techniques include, but are not limited to, PCR or any other method
employing a primer extension step, and transcription or any other
method of generating at least one RNA transcription product. Other
nonlimiting examples of amplification are ligase detection reaction
(LDR), and ligase chain reaction (LCR). Amplification methods may
comprise thermal-cycling or may be performed isothermally The term
"amplification product" includes products from any number of cycles
of amplification reactions, primer extension reactions, and RNA
transcription reactions, unless otherwise apparent from the
context.
[0280] In certain embodiments, amplification methods comprise at
least one cycle of amplification, for example, but not limited to,
the sequential procedures of: hybridizing primers to
primer-specific portions of the ligation product or amplification
products from any number of cycles of an amplification reaction;
synthesizing a strand of nucleotides in a template-dependent manner
using a polymerase; and denaturing the newly-formed nucleic acid
duplex to separate the strands. The cycle may or may not be
repeated. In certain embodiments, amplification methods comprise at
least one cycle of amplification, for example, but not limited to,
the sequential procedures of: interaction of a polymerase with a
promoter; synthesizing a strand of nucleotides in a
template-dependent manner using a polymerase; and denaturing the
newly-formed nucleic acid duplex to separate the strands. The cycle
may or may not be repeated.
[0281] Descriptions of certain amplification techniques can be
found, among other places, in H. Ehrlich et al., Science,
252:1643-50 (1991), M. Innis et al., PCR Protocols: A Guide to
Methods and Applications, Academic Press, New York, N.Y. (1990), R.
Favis et al,, Nature Biotechnology 18:561-64 (2000), and H. F.
Rabenau et al., Infection 28:97-102 (2000); Sambrook and Russell,
Ausbel et al.
[0282] Primer extension according to the present invention is an
amplification process comprising elongating a primer that is
annealed to a template in the 5' to 3' direction using a
template-dependent polymerase. According to certain embodiments,
with appropriate buffers, salts, pH, temperature, and nucleotide
triphosphates, including analogs and derivatives thereof, a
template dependent polymerase incorporates nucleotides
complementary to the template strand starting at the 3'-end of an
annealed primer, to generate a complementary strand. Detailed
descriptions of primer extension according to certain embodiments
can be found, among other places in Sambrook et al., Sambrook and
Russell, and Ausbel et al.
[0283] Transcription according to certain embodiments is an
amplification process comprising an RNA polymerase interacting with
a promoter on a single- or double-stranded template and generating
a RNA polymer in a 5' to 3' direction. In certain embodiments, the
transcription reaction composition further comprises transcription
factors. RNA polymerases, including but not limited to T3, T7, and
SP6 polymerases, according to certain embodiments, can interact
with double-stranded promoters. Detailed descriptions of
transcription according to certain embodiments can be found, among
other places in Sambrook et al., Sambrook and Russell, and Ausbel
et al.
[0284] Certain embodiments of amplification may employ multiplex
PCR, in which multiple target sequences are simultaneously
amplified (see, e.g., H. Geada et al., Forensic Sci. Int. 108:31-37
(2000) and D. G. Wang et al., Science 280:1077-82 (1998)).
[0285] In certain embodiments, one employs asymmetric PCR.
According to certain embodiments, asymmetric PCR comprises an
amplification reaction composition comprising (i) at least one
primer set in which there is an excess of one primer (relative to
the other primer in the primer set); (ii) at least one primer set
that comprises only a first primer or only a second primer; (iii)
at least one primer set that, during given amplification
conditions, comprises a primer that results in amplification of one
strand and comprises another primer that is disabled; or (iv) at
least one primer set that meets the description of both (i) and
(iii) above. Consequently, when the ligation product is amplified,
an excess of one strand of the amplification product (relative to
its complement) is generated.
[0286] In certain embodiments, one may use at least one primer set
wherein the melting temperature (Tm.sub.50) of one of the primers
is higher than the Tm.sub.50 of the other primer. Such embodiments
have been called asynchronous PCR (A-PCR). See, e.g., U.S. patent
application Ser. No. 09/875,211, filed Jun. 5, 2001. In certain
embodiments, the Tm.sub.50 of the first primer is at least
4-15.degree. C. different from the Tm.sub.50 of the second primer.
In certain embodiments, the Tm.sub.50 of the first primer is at
least 8-15.degree. C. different from the Tm.sub.50 of the second
primer. In certain embodiments, the Tm.sub.50 of the first primer
is at least 10-15.degree. C. different from the Tm.sub.50 of the
second primer. In certain embodiments, the Tm.sub.50 of the first
primer is at least 10-12.degree. C. different from the Tm.sub.50 of
the second primer. In certain embodiments, in at least one primer
set, the Tm.sub.50 of the at least one first primer differs from
the melting temperature of the at least one second primer by at
least about 4.degree. C., by at least about 8.degree. C., by at
least about 10.degree. C., or by at least about 12.degree. C.
[0287] In certain embodiments of A-PCR, in addition to the
difference in Tm.sub.50 of the primers in a primer set, there is
also an excess of one primer relative to the other primer in the
primer set In certain embodiments, there is a five to twenty-fold
excess of one primer relative to the other primer in the primer
set. In certain embodiments of A-PCR, the primer concentration is
at least 50 mM.
[0288] In A-PCR according to certain embodiments, one may use
conventional PCR in the first cycles such that both primers anneal
and both strands are amplified. By raising the temperature in
subsequent cycles, however, one may disable the primer with the
lower Tm such that only one strand is amplified. Thus, the
subsequent cycles of A-PCR in which the primer with the lower Tm is
disabled result in asymmetric amplification. Consequently, when the
ligation product is amplified, an excess of one strand of the
amplification product (relative to its complement) is
generated.
[0289] According to certain embodiments of A-PCR, the level of
amplification can be controlled by changing the number of cycles
during the first phase of conventional PCR cycling. In such
embodiments, by changing the number of initial conventional cycles,
one may vary the amount of the double strands that are subjected to
the subsequent cycles of PCR at the higher temperature in which the
primer with the lower Tm is disabled.
[0290] In certain embodiments, an A-PCR protocol may comprise use
of a pair of primers, each of which has a concentration of at least
50 mM. In certain embodiments, conventional PCR, in which both
primers result in amplification, is performed for the first 20-30
cycles. In certain embodiments, after 20-30 cycles of conventional
PCR, the annealing temperature increases to 66-70.degree. C., and
PCR is performed for 5 to 40 cycles at the higher annealing
temperature. In such embodiments, the lower Tm primer is disabled
during such 5 to 40 cycles at higher annealing temperature. In such
embodiments, asymmetric amplification occurs during the second
phase of PCR cycles at a higher annealing temperature.
[0291] In certain embodiments, one employs asymmetric
reamplification. According to certain embodiments, asymmetric
reamplification comprises generating single-stranded amplification
product in a second amplification process. In certain embodiments,
the double-stranded amplification product of a first amplification
process serves as the amplification target in the asymmetric
reamplification process. In certain embodiments, one may achieve
asymmetric reamplification using asynchronous PCR in which initial
cycles of PCR conventionally amplify two strands and subsequent
cycles are performed at a higher annealing temperature that
disables one of the primers of a primer set as discussed above. In
certain embodiments, the second amplification reaction composition
comprises at least one primer set which comprises the at least one
first primer, or the at least one second primer of a primer set,
but typically not both. The skilled artisan understands that, in
certain embodiments, asymmetric reamplification will also
eventually occur if the primers in the primer set are not present
in an equimolar ratio. In certain asymmetric reamplification
methods, typically only single-stranded amplicons are generated
since the second amplification reaction composition comprises only
first or second primers from each primer set or a non-equimolar
ratio of first and second primers from a primer set.
[0292] In certain embodiments, additional polymerase may also be a
component of the second amplification reaction composition. In
certain embodiments, there may be sufficient residual polymerase
from the first amplification composition to synthesize the second
amplification product.
[0293] Methods of optimizing amplification reactions are well known
to those skilled in the art. For example, it is well known that PCR
may be optimized by altering times and temperatures for annealing,
polymerization, and denaturing, as well as changing the buffers,
salts, and other reagents in the reaction composition. Optimization
may also be affected by the design of the amplification primers
used. For example, the length of the primers, as well as the
G-C:A-T ratio may alter the efficiency of primer annealing, thus
altering the amplification reaction. See James G. Wetmur, "Nucleic
Acid Hybrids, Formation and Structure," in Molecular Biology and
Biotechnology, pp. 605-8, (Robert A. Meyers ed., 1995).
[0294] In certain amplification reactions, one may use dUTP and
uracil-N-glucosidase (UNG). Discussion of use of dUTP and UNG may
be found, for example, in Kwok et al., "Avoiding false positives
with PCR," Nature, 339:237-238 (1989); and Longo et al. "Use of
uracil DNA glycosylase to control carry-over contaimination in
polymerase chain reactions," Gene, 93:125-128 (1990).
[0295] To detect whether a particular sequence is present, in
certain embodiments, a labeled probe is included in the
amplification reaction. According to certain embodiments, the
labeled probe indicates the presence or absence (or amount) of a
specific nucleic acid sequence in the reaction. These include, but
are not limited to, 5'-nuclease probes, cleavage RNA probes,
structure-specific nuclease probes, and hybridization dependent
probes. In certain embodiments, the labeled probe comprises a
fluorescing dye connected to a quenching molecule through a link
element, e.g., through a specific oligonucleotide. Examples of such
systems are described, e.g., in U.S. Pat. Nos. 5,538,848 and
5,723,591.
[0296] Other examples of suitable labeled probes according to
certain embodiments are i-probes, scorpion probes, eclipse probes,
and others. Exemplary, but nonlimiting, probes are discussed, for
example, in Whitcombe et al., Nat. Biotechnol., 17(8):804-807
(1999) (includes scorpion probes); Thelwell et al., Nucleic Acids
Res., 28(19):3752-3761 (2000) (includes scorpion probes); Afonina
et al., Biotechniques, 32(4): (2002) (includes eclipse probes); Li
et al., "A new class of homogeneous nucleic acid probes based on
specific displacement hybridization", Nucleic Acids Res., 30(2):E5
(2002); Kandimall et al., Bioorg. Med. Chem., 8(8):1911-1916
(2000); lsacsson et al., Mol. Cell. Probes, 14(5):321-328 (2000);
French et al, Mol. Cell. Probes, 15(6):363-374 (2001); and Nurmi et
al., "A new label technology for the detection of specific
polymerase chain reaction products in a closed tube", Nucleic Acids
Res., 28(8), E28 (2000).
[0297] In certain embodiments, the amount of labeled probe that
gives a fluorescent signal in response to an emitted light
typically relates to the amount of nucleic acid produced in the
amplification reaction. Thus, in certain embodiments, the amount of
fluorescent signal is related to the amount of product created in
the amplification reaction. In such embodiments, one can therefore
measure the amount of amplification product by measuring the
intensity of the fluorescent signal from the fluorescent indicator.
According to certain embodiments, one can employ an internal
standard to quantify the amplification product indicated by the
fluorescent signal. See, e.g., U.S. Pat. No. 5,736,333.
[0298] Devices have been developed that can perform a thermal
cycling reaction with compositions containing a fluorescent
indicator, emit a light beam of a specified wavelength, read the
intensity of the fluorescent dye, and display the intensity of
fluorescence after each cycle. Devices comprising a thermal cycler,
light beam emitter, and a fluorescent signal detector, have been
described, e.g., in U.S. Pat. Nos. 5,928,907; 6,015,674; and
6,174,670, and include, but are not limited to the ABI Prism.RTM.
7700 Sequence Detection System (Applied Biosystems, Foster City,
Calif.) and the ABI GeneAmp.RTM. 5700 Sequence Detection System
(Applied Biosystems, Foster City, Calif.).
[0299] In certain embodiments, each of these functions may be
performed by separate devices. For example, if one employs a Q-beta
replicase reaction for amplification, the reaction may not take
place in a thermal cycler, but could include a light beam emitted
at a specific wavelength, detection of the fluorescent signal, and
calculation and display of the amount of amplification product.
[0300] In certain embodiments, combined thermal cycling and
fluorescence detecting devices can be used for precise
quantification of target nucleic acid sequences in samples. In
certain embodiments, fluorescent signals can be detected and
displayed during and/or after one or more thermal cycles, thus
permitting monitoring of amplification products as the reactions
occur in "real time." In certain embodiments, one can use the
amount of amplification product and number of amplification cycles
to calculate how much of the target nucleic acid sequence was in
the sample prior to amplification.
[0301] According to certain embodiments, one could simply monitor
the amount of amplification product after a predetermined number of
cycles sufficient to indicate the presence of the target nucleic
acid sequence in the sample. One skilled in the art can easily
determine, for any given sample type, primer sequence, and reaction
condition, how many cycles are sufficient to determine the presence
of a given target polynucleotide.
[0302] According to certain embodiments, the amplification products
can be scored as positive or negative as soon as a given number of
cycles is complete. In certain embodiments, the results may be
transmitted electronically directly to a database and tabulated.
Thus, in certain embodiments, large numbers of samples may be
processed and analyzed with less time and labor required.
[0303] According to certain embodiments, different labeled probes
may distinguish between different target nucleic acid sequences. A
non-limiting example of such a probe is a 5'-nuclease fluorescent
probe, such as a TaqMan.RTM. probe molecule, wherein a fluorescent
molecule is attached to a fluorescence-quenching molecule through
an oligonucleotide link element. In certain embodiments, the
oligonucleotide link element of the 5'-nuclease fluorescent probe
binds to a specific sequence of an addressable portion or its
complement. In certain embodiments, different 5'-nuclease
fluorescent probes, each fluorescing at different wavelengths, can
distinguish between different amplification products within the
same amplification reaction.
[0304] For example, in certain embodiments, one could use two
different 5'-nuclease fluorescent probes that fluoresce at two
different wavelengths (WL.sub.A and WL.sub.B) and that are specific
to two different addressable portions of two different ligation
products (A' and B', respectively). Ligation product A' is formed
if target nucleic acid sequence A is in the sample, and ligation
product B' is formed if target nucleic acid sequence B is in the
sample. In certain embodiments, ligation product A' and/or B' may
form even if the appropriate target nucleic acid sequence is not in
the sample, but such ligation occurs to a measurably lesser extent
than when the appropriate target nucleic acid sequence is in the
sample. After amplification, one can determine which specific
target nucleic acid sequences are present in the sample based on
the wavelength of signal detected. Thus, if an appropriate
detectable signal value of only wavelength WL.sub.A is detected,
one would know that the sample includes target nucleic acid
sequence A, but not target nucleic acid sequence B. If an
appropriate detectable signal value of both wavelengths WL.sub.A
and WL.sub.B are detected, one would know that the sample includes
both target nucleic acid sequence A and target nucleic acid
sequence B.
Certain Exemplary Embodiments of Detecting Targets
[0305] The present invention is directed to methods, reagents, and
kits for detecting the presence or absence of (or quantitating)
target nucleic acid sequences in a sample, using ligation and
amplification reactions. When a particular target nucleic acid
sequence is present in a sample, a ligation product is formed that
includes an addressable portion. Labeled probes are employed that
provide a different detectable signal value depending upon whether
a complementary sequence is present or absent during an
amplification reaction. In certain embodiments, the labeled probes
are designed to comprise a sequence that is the same as the
sequence of the addressable portion or that is complementary to the
sequence of the addressable portion.
[0306] In certain embodiments, one or more nucleic acid species are
subjected to ligation and amplification reactions, either directly
or via an intermediate, such as a cDNA target generated from an
mRNA by reverse transcription. In certain embodiments, the initial
nucleic acid comprises mRNA and a reverse transcription reaction
may be performed to generate at least one cDNA, followed by at
least one ligation reaction and at least one amplification
reaction. In certain embodiments, DNA ligation probes hybridize to
target RNA, and an RNA dependent DNA ligase is employed in a
ligation reaction, followed by an amplification reaction. The
ligation products and amplification products may be detected (or
quantitated) using labeled probes.
[0307] In certain embodiments, for each target nucleic acid
sequence to be detected, a ligation probe set, comprising at least
one first probe and at least one second probe, is combined with the
sample to form a ligation reaction composition. In certain
embodiments, the ligation composition may further comprise a
ligation agent. In certain embodiments, the first and second probes
in each ligation probe set are suitable for ligation together and
are designed to hybridize to adjacent sequences that are present in
the target nucleic acid sequence. When the target nucleic acid
sequence is present in the sample, the first and second probes
will, under appropriate conditions, hybridize to adjacent regions
on the target nucleic acid sequence (see, e.g., probes 2 and 3
hybridized to target nucleic acid sequence 1 in FIG. 2A). In FIG.
2A, the target nucleic acid sequence (1) is depicted as hybridized
with a first probe (2), for illustration purposes shown here as
comprising a 5' primer-specific portion (25), an addressable
portion (4), and a target-specific portion (15a), and a second
probe (3) comprising a 3' primer-specific portion (35), a
target-specific portion (15b) and a free 5' phosphate group ("P")
for ligation.
[0308] In certain embodiments, the adjacently hybridized probes
may, under appropriate conditions, be ligated together to form a
ligation product (see, e.g., ligation product 6 in FIG. 2B). FIG.
2B depicts the ligation product (6), generated from the ligation of
the first probe (2) and the second probe (3). The ligation product
(6) is shown comprising the 5' primer-specific portion (25), the
addressable portion (4), and the 3' primer-specific portion (35).
In certain embodiments, when the duplex comprising the target
nucleic acid sequence (1) and the ligation product (6) is
denatured, for example, by heating, the ligation product (6) is
released.
[0309] In certain embodiments, one forms an amplification reaction
composition comprising the ligation product 6, at least one primer
set 7, a polymerase 8, and a labeled probe 26 (see, e.g., FIG. 2C).
The labeled probe 26 in the depicted embodiment is a 5'-nuclease
fluorescent probe that comprises a quenching moiety (Q) linked to a
fluorescent moiety (F) through an oligonucleotide link element that
comprises a sequence complementary to the sequence of the
addressable portion of the ligation product. In the first
amplification cycle, the second primer 7', comprising a sequence
complementary to the sequence of the 3' primer-specific portion 35
of the ligation product 6, hybridizes with the ligation product 6
and is extended, in the presence of DNA polymerase and
deoxynucleoside triphosphates (dNTPs), in a template-dependent
fashion. The 5'-nuclease activity of the polymerase results in
cleavage of the 5'-nuclease fluorescent probe such that the
fluorescent moiety (F) no longer is quenched by the quenching
moiety (Q) and a fluorescent signal is detected. Detection of the
fluorescent signal from the 5'-nuclease fluorescent probe indicates
the presence of the target nucleic acid sequence in the sample.
[0310] In certain embodiments, if no target nucleic acid sequence
had been present in the sample, no ligation product comprising the
addressable portion and the 5' and 3' primer-specific portions
would have been formed during the ligation reaction. Accordingly,
no labeled probe would bind to a ligation product or an
amplification product and there would be no cleavage of a labeled
probe during the amplification reaction. (Some of the labeled
probes may hybridize to unligated ligation probes.) Thus, the
absence of a detectable signal during or after the amplification
reaction would indicate the absence of target nucleic acid sequence
in the sample. In certain embodiments, ligation products may form
even if the appropriate target nucleic acid sequence is not in the
sample, but such ligation occurs to a measurably lesser extent than
when the appropriate target nucleic acid sequence is in the sample.
In certain such embodiments, one can set an appropriate threshold
difference between detectable signal values to differentiate
between samples that include the appropriate target nucleic acid
sequence and samples that do not include the appropriate target
nucleic acid sequence.
[0311] Certain embodiments may be substantially the same as those
depicted in FIGS. 2A to 2C, except that the oligonucleotide link
element of the 5'-nuclease fluorescent probe comprises the sequence
of the addressable portion of the ligation product (rather than a
sequence that is complementary to the sequence of the addressable
portion), See, e.g., labeled probe 27 in FIGS. 2D and 2E.
[0312] In the first amplification cycle, the second primer 7',
comprising a sequence complementary to the sequence of the 3'
primer-specific portion 35 of the ligation product 6, hybridizes
with the ligation product 6 and is extended, in the presence of DNA
polymerase and deoxynucleoside triphosphates (dNTPs), in a
template-dependent fashion. The first amplification cycle generates
a double-stranded product that comprises a complement of the 5'
primer-specific portion (25) of the ligation product and a
complement of the addressable portion (4) of the ligation product
(see FIG. 2D).
[0313] The double-stranded primer-extension product is denatured
and subjected to one or more cycles of the polymerase chain
reaction (PCR) including the labeled probe 27, which comprises an
oligonucleotide link element that comprises the sequence of the
addressable portion of the ligation product (see FIG. 2E). A primer
that comprises the sequence of the 5' primer-specific portion of
the ligation product hybridizes with the amplification product that
includes a sequence 25' that is complementary to the sequence of
the 5' primer-specific portion and is extended, in the presence of
DNA polymerase and deoxynucleoside triphosphates (dNTPs), in a
template-dependent fashion. See, e.g., FIG. 2E. The 5'-nuclease
activity of the polymerase results in cleavage of the 5'-nuclease
fluorescent probe such that the fluorescent moiety (F) no longer is
quenched by the quenching moiety (Q) and a fluorescent signal is
detected. Detection of the fluorescent signal from the 5'-nuclease
fluorescent probe indicates the presence of the target nucleic acid
sequence in the sample.
[0314] In certain embodiments, if no target nucleic acid sequence
had been present in the sample, no ligation product comprising the
addressable portion and the 5' and 3' primer-specific portions
would have been formed during the ligation reaction. Thus, no
amplification product comprising the complement of the addressable
portion of such a ligation product would be formed. Accordingly, no
labeled probe would bind to a ligation product or an amplification
product and there would be no cleavage of a labeled probe during
the amplification reaction. Thus, the absence of a detectable
signal during or after the amplification reaction would indicate
the absence of target nucleic acid sequence in the sample. In
certain embodiments, ligation products may form even if the
appropriate target nucleic acid sequence is not in the sample, but
such ligation occurs to a measurably lesser extent than when the
appropriate target nucleic acid sequence is in the sample. In
certain such embodiments, one can set an appropriate threshold
difference between detectable signal values to differentiate
between samples that include the appropriate target nucleic acid
sequence and samples that do not include the appropriate target
nucleic acid sequence.
[0315] When the amplification product exists as a double-stranded
molecule in either of the embodiments in FIG. 2, in certain
embodiments, subsequent amplification cycles may exponentially
amplify this molecule. In certain embodiments, one may quantitate
the amount of target nucleic acid present in the sample by
determining the level of intensity of the fluorescent signal.
[0316] As shown in FIG. 3A, in certain embodiments, an mRNA is used
to generate a cDNA copy 1'. The cDNA serves as a target nucleic
acid sequence to which the first and second probes of the ligation
probe set hybridize (see FIG. 3B). The first probe 22 comprises a
5' primer-specific portion (25) and a target-specific portion 15a,
and the second probe 23 comprises a target-specific portion 15b, an
addressable portion 4, and a 3' primer-specific portion (35). Under
appropriate conditions, the adjacently hybridized probes can form a
ligation product 28 comprising a 5' primer-specific portion (25),
the target-specific portions 15a and 15b, the addressable portion
4, and the 3' primer-specific portion (35) (see FIG. 3C).
[0317] When the duplex formed by the target nucleic acid sequence
1' and the ligation product 28 is denatured, in certain embodiments
by heating, the ligation product is released. In the presence of
the appropriate primer set and under appropriate conditions, the 3'
primer hybridizes with the 3' primer-specific portion 35 of the
ligation product 28. The 3' primer is extended in the presence of
DNA polymerase 8, generating a double-stranded product that
comprises a complement (25') of the 5' primer-specific portion (25)
of the ligation product and a complement (4') of the addressable
portion (4) of the ligation product (see FIG. 3D).
[0318] The double-stranded primer-extension product is denatured
and subjected to one or more cycles of the polymerase chain
reaction (PCR) including a labeled probe 27 (see, e.g., FIG. 3E).
The labeled probe 27 in the depicted embodiment is a 5'-nuclease
fluorescent probe that comprises a quenching moiety (Q) linked to a
fluorescent moiety (F) by an oligonucleotide that comprises the
sequence of the addressable portion of the ligation product. A
primer that comprises the sequence of the 5' primer-specific
portion of the ligation product hybridizes with the amplification
product that includes a sequence 25' that is complementary to the
sequence of the 5' primer-specific portion and is extended, in the
presence of DNA polymerase and deoxynucleoside triphosphates
(dNTPs), in a template-dependent fashion. The 5'-nuclease activity
of the polymerase results in cleavage of the 5'-nuclease
fluorescent probe such that the fluorescent moiety (F) no longer is
quenched by the quenching moiety (Q) and a fluorescent signal is
detected (see, e.g., FIG. 3E). Detection of the fluorescent signal
from the 5'-nuclease fluorescent probe indicates the presence of
the target nucleic acid sequence in the sample.
[0319] In certain embodiments, if no target nucleic acid sequence
had been present in the sample, no ligation product comprising the
addressable portion and the 5' and 3' primer-specific portions
would have been formed during the ligation reaction. Thus, no
amplification product comprising the complement of such a ligation
product would be formed. Accordingly, no labeled probe would bind
to a ligation product or an amplification product and there would
be no cleavage of a labeled probe during the amplification
reaction. Thus, the absence of a detectable signal during or after
the amplification reaction would indicate the absence of target
nucleic acid sequence in the sample. In certain embodiments,
ligation products may form even if the appropriate target nucleic
acid sequence is not in the sample, but such ligation occurs to a
measurably lesser extent than when the appropriate target nucleic
acid sequence is in the sample. In certain such embodiments, one
can set an appropriate threshold difference between detectable
signal values to differentiate between samples that include the
appropriate target nucleic acid sequence and samples that do not
include the appropriate target nucleic acid sequence.
[0320] Certain embodiments may be substantially the same as those
depicted in FIGS. 3A to 3E, except that the oligonucleotide link
element of the 5'-nuclease fluorescent probe comprises a sequence
that is complementary to the sequence of the addressable portion of
the ligation product (rather than the sequence of the addressable
portion). See, e.g., labeled probe 26 in FIG. 3F.
[0321] In the first amplification cycle, the second primer 7',
comprising a sequence complementary to the sequence of the 3'
primer-specific portion 35 of the ligation product 28, hybridizes
with the ligation product 28 and is extended, in the presence of
DNA polymerase and deoxynucleoside triphosphates (dNTPs), in a
template-dependent fashion. The 5'-nuclease activity of the
polymerase results in cleavage of the 5'-nuclease fluorescent probe
such that the fluorescent moiety (F) no longer is quenched by the
quenching moiety (Q) and a fluorescent signal is detected.
[0322] In certain embodiments, if unligated second ligation probes
have been substantially removed from the composition after the
ligation reaction, detection of the fluorescent signal from the
first amplification cycle indicates the presence of the target
nucleic acid sequence in the sample. In certain embodiments, after
the ligation reaction, one may substantially remove unligated
second probes by exposing the composition to nucleic acids on a
solid phase that are complementary to a sequence that is included
on the first ligation probe, but that is not included on the second
ligation probe. One may then separate the hybridized ligation
products and unligated first ligation probes on the solid phase
from the unligated second ligation probes,
[0323] If the unligated second ligation probes have not been
substantially removed from the composition after the ligation
reaction, detection of the fluorescent signal from the first
amplification cycle does not necessarily indicate the presence of
target nucleic acid in the sample. In such embodiments, labeled
probes will hybridize to both unligated second ligation probes and
ligation products. Also, the 5'-nuclease activity of the polymerase
results in cleavage of the 5'-nuclease fluorescent probes that are
hybridized to both the unligated second ligation probes and
ligation products. Thus, the same signal would be detected whether
or not any ligation product is present.
[0324] Subsequent cycles of amplification, however, may be employed
in such embodiments to detect the presence or absence of (or to
quantitate) target nucleic acid sequence. If no ligation product is
present, the quantity of sequences that comprise an addressable
sequence will not increase with subsequent cycles of amplification.
Only the initial quantity of unligated second ligation probes will
interact with the labeled probes to emit a signal.
[0325] In contrast, subsequent amplification cycles involving a
composition that includes ligation products will result in an
increased quantity of sequences that comprise the addressable
portion. Thus, the quantity of amplification product with which the
labeled probes interact increases. Thus, in certain embodiments,
one can set the threshold difference between detectable signal
values to differentiate between samples that include ligation
product and samples that do not include ligation product. In
certain embodiments, ligation products may form even if the
appropriate target nucleic acid sequence is not in the sample, but
such ligation occurs to a measurably lesser extent than when the
appropriate target nucleic acid sequence is in the sample. In
certain such embodiments, one can set an appropriate threshold
difference between detectable signal values to differentiate
between samples that include the appropriate target nucleic acid
sequence and samples that do not include the appropriate target
nucleic acid sequence.
[0326] The embodiments depicted in FIG. 3 may be modified by simply
using target DNA in a sample rather than using cDNA resulting from
reverse transcription of RNA. Also, the embodiments depicted in
FIG. 3 may be modified by using the RNA as the target nucleic acid
sequence to which the ligation probes hybridize.
[0327] In this application, whenever one employs an amplification
reaction to determine whether there is a threshold difference in
signal value from a labeled probe, the amplification reaction is
carried out in a manner that will result in such a threshold
difference if the target sequence that is being sought is included
in the sample. The following nonlimiting exemplary embodiments
illustrate this concept.
[0328] In a first exemplary embodiment, one employs a ligation
probe set that comprises: a first probe that comprises a 5' primer
specific portion and a target-specific portion; and a second probe
that comprises a target specific portion, an addressable portion,
and a 3' primer-specific portion, If the target nucleic acid is
present in the sample, the first and second probes are ligated
together to form a ligation product during a ligation reaction. The
ligation product comprises the 5' primer-specific portion, the two
target-specific portions, the addressable portion, and the 3'
primer-specific portion.
[0329] In this embodiment, one forms an amplification reaction
composition comprising the ligation product, a 5' nuclease
fluorescent probe that comprises the sequence of the addressable
portion, and a set of appropriate primers for the 5' and 3'
primer-specific portions. The 5' nuclease fluorescent probe has a
first detectable signal value when it is not hybridized to a
complementary sequence. If one employs PCR as the amplification
reaction, the first cycle of amplification will not result in a
threshold difference between the first detectable signal value and
a second detectable signal value during and/or after the first
cycle of amplification. No threshold difference is detected, since
the 5' nuclease fluorescent probe has the same sequence as the
addressable portion of the ligation product and thus will not
hybridize to the addressable portion. Thus, there will be no
cleavage of the 5' nuclease fluorescent probe during the first
cycle of amplification.
[0330] The first cycle of amplification, however, results in an
amplification product that comprises the complement of the
addressable portion and the complement of the 5' primer-specific
portion at its 3' end. Thus, the 5' nuclease fluorescent probe will
hybridize to the amplification product and will be cleaved during
the second cycle of amplification. Thus, in this exemplary
embodiment, the second cycle of amplification results in a
threshold difference between the first detectable signal value and
the second detectable signal value during and/or after the second
cycle of amplification. Thus, in such embodiments, the
amplification reaction used to determine whether there is a
threshold difference in signal value comprises at least two cycles
of PCR amplification.
[0331] In a second exemplary embodiment, one employs a ligation
probe set that comprises: a first probe that comprises a 5' primer
specific portion, an addressable portion, and a target-specific
portion; and a second probe that comprises a target specific
portion and a 3' primer-specific portion. If the target nucleic
acid is present in the sample, the first and second probes are
ligated together to form a ligation product during a ligation
reaction. The ligation product comprises the 5' primer-specific
portion, the addressable portion, the two target-specific portions,
and the 3' primer-specific portion.
[0332] In this embodiment, one forms an amplification reaction
composition comprising the ligation product, a 5' nuclease
fluorescent probe that comprises a sequence complementary to
sequence of the addressable portion, and a set of appropriate
primers for the 5' and 3' primer-specific portions. The 5' nuclease
fluorescent probe has a first detectable signal value when it is
not hybridized to a complementary sequence. If one employs PCR as
the amplification reaction, the first cycle of amplification will
result in a threshold difference between the first detectable
signal value and the second detectable signal value during and/or
after the first cycle of amplification. A threshold difference is
detected since the 5' nuclease fluorescent probe has a sequence
complementary to sequence of the addressable portion of the
ligation product and thus hybridizes to the addressable portion,
and the first cycle of amplification results in cleavage of the 5'
nuclease fluorescent probe. Thus, in such embodiments, the
amplification reaction used to determine whether there is a
threshold difference in signal value comprises at least one cycle
of PCR amplification.
[0333] In a third exemplary embodiment, one employs a ligation
probe set that comprises: a first probe that comprises a 5' primer
specific portion and a target-specific portion; and a second probe
that comprises a target specific portion, an addressable portion,
and a 3' primer-specific portion. If the target nucleic acid is
present in the sample, the first and second probes are ligated
together to form a ligation product during a ligation reaction. The
ligation product comprises the 5' primer-specific portion, the two
target-specific portions, the addressable portion, and the 3'
primer-specific portion.
[0334] In this embodiment, one forms an amplification reaction
composition comprising the ligation product, a hybridization
dependent probe that comprises the sequence of the addressable
portion, and a set of appropriate primers for the 5' and 3'
primer-specific portions. The hybridization dependent probe has a
first detectable signal value when it is not hybridized to a
complementary sequence. In this embodiment, PCR is used as the
amplification reaction.
[0335] If unligated probes are not substantially removed from the
amplification reaction composition prior to the first cycle of
amplification, no threshold difference is detected during and/or
after the first cycle. No threshold difference is detected, since,
whether or not the sought ligation product is present, the first
cycle of amplification will result in the same number of
amplification products to which the hybridization dependent probes
will hybridize. Both the unligated probes and the ligation products
in such embodiments will comprise the same 3' primer-specific
portion that will initiate extension in the first cycle of
amplification and will comprise the same addressable portion. Thus,
after the first cycle of amplification, when the hybridization
dependent probes hybridize to the complement of the addressable
portion on the amplification products, the same signal value will
result whether or not the ligation product is present.
[0336] A threshold difference in detectable signal value, however,
will result in subsequent cycles of amplification when
amplification products with sequences complementary to the sequence
of the addressable portion increase exponentially when the ligation
product is amplified. In such subsequent cycles, if no ligation
product is present, such amplification products will only increase
linearly from the presence of the unligated probes. Such linear
amplification occurs, since, unlike the ligation product, the
unligated probes do not comprise 5' primer-specific portions.
[0337] In a fourth exemplary embodiment, one employs a ligation
probe set that comprises: a first probe that comprises a 5' primer
specific portion and a target-specific portion; and a second probe
that comprises a target specific portion, an addressable portion,
and a 3' primer-specific portion. If the target nucleic acid is
present in the sample, the first and second probes are ligated
together to form a ligation product during a ligation reaction. The
ligation product comprises the 5' primer-specific portion, the two
target-specific portions, the addressable portion, and the 3'
primer-specific portion.
[0338] In this embodiment, one forms an amplification reaction
composition comprising the ligation product, a hybridization
dependent probe that comprises a sequence that is complementary to
the sequence of the addressable portion, and a set of appropriate
primers for the 5' and 3' primer-specific portions. Also, in this
embodiment, a substantial portion of the hybridization dependent
probes are not cleaved during a cycle of an amplification reaction.
A "substantial portion of the hybridization dependent probes are
not cleaved" refers to a portion of the total number of
hybridization dependent probes that are designed to hybridize to a
given nucleic sequence that is being amplified, and it does not
refer to a portion of an individual probe. In certain embodiments,
"a substantial portion of hybridization dependent probes that are
not cleaved" means that at least 90% of the hybridization dependent
probes are not cleaved. In certain embodiments, at least 95% of the
hybridization dependent probes are not cleaved. The hybridization
dependent probe has a first detectable signal value when it is not
hybridized to a complementary sequence. In this embodiment, PCR is
used as the amplification reaction.
[0339] If unligated probes are not substantially removed from the
amplification reaction composition prior to the first cycle of
amplification, no threshold difference is detected during and/or
after the first cycle. No threshold difference is detected, since
the hybridization dependent probes will hybridize to both unligated
second probes and ligation products. The first cycle of
amplification results in amplification products that have sequences
that are complementary to the sequence of the addressable portion
of the ligation product. Thus, the hybridization dependent probes
do not hybridize to any amplification products produced in the
first cycle of amplification.
[0340] A threshold difference in detectable signal value, however,
will result after the second cycle of amplification, since the
second cycle results in an increase of DNA that comprises the
sequence of the addressable portion only if ligation product is
present. Thus, in such embodiments, the amplification reaction used
to determine whether there is a threshold difference in signal
value comprises at least two cycles of PCR amplification.
[0341] In certain embodiments, one may employ a ligation probe set
that includes an excess of the first probe to serve as a primer in
subsequent amplification reactions. FIG. 14 shows certain exemplary
embodiments. In FIG. 14, the first probe comprises a
target-specific portion T-SP1. The second probe comprises a 3'
primer-specific portion P-SP 42, an addressable portion ASP, and a
target-specific portion T-SP2.
[0342] In such embodiments, after ligation (see FIGS. 14A and 14
B), the primer set included in the amplification reaction
composition may only comprise one primer 42' that comprises a
sequence that is complementary to the sequence of the 3'
primer-specific portion P-SP 42 of the second probe. After
ligation, a cycle of amplification with that primer results in an
amplification product that comprises a sequence complementary to
the ligation product (see FIG. 14C).
[0343] In the second cycle of amplification, the primer P-SP 42'
again results in an amplification product that comprises a sequence
complementary to the ligation product (see FIG. 14D). Moreover,
excess first probe serves as a primer that interacts with the
sequence that is complementary to the ligation product to form an
amplification product that comprises the sequence of the ligation
product (see FIG. 14D).
[0344] FIG. 14 is provided to show exemplary embodiments involving
the interaction of the first probe as a primer in an amplification
reaction. FIG. 14 shows embodiments in which the second ligation
probe comprises an addressable portion and the first ligation probe
does not comprise an addressable portion. In certain embodiments
employing excess first ligation probe as a primer, one may employ
an addressable portion on either of the first or second ligation
probes or on both the first and second ligation probes.
[0345] Also, FIG. 14 does not show the specific interaction of
labeled probes with the addressable portions. In embodiments
employing excess first ligation probe as a primer, one may employ
labeled probes that comprise the sequence of an addressable portion
and/or labeled probes that comprise a sequence complementary to an
addressable portion.
[0346] Also, in certain embodiments, the first probe may contain
additional nucleotides at the 5' end that do not hybridize to the
target nucleic acid sequence.
[0347] Certain embodiments that employ excess first probe as a
primer for subsequent amplification reactions can be used in the
various embodiments of ligation and amplification that are
discussed throughout this application. Examples include, but are
not limited to, the embodiments depicted in FIG. 18. According to
certain such embodiments, one may modify the first probes Z that
are shown in FIG. 18 by not including a primer-specific portion
P-SP1. In a subsequent amplification reaction, one may employ
excess first probes to serve as primers rather than employing
primers that correspond to a P-SP1 sequence on the first probe
shown in FIG. 18.
[0348] One may use excess first probe of a ligation probe set as a
primer with various methods employing ligation probes with
addressable portions as discussed herein. In certain embodiments,
one may use such arrangements with different types of ligation and
amplification methods. For example, one may use excess first probe
of a ligation probe set as a primer in any of a variety of methods
employing ligation and amplification reactions. Exemplary methods
include, but are not limited to, those discussed in U.S. Pat. No.
6,027,889, PCT Published Patent Application No. WO 01/92579, and
U.S. patent application Ser. Nos. 09/584,905 and 10/011,993.
[0349] In certain embodiments, one may carry out the ligation
reaction in a reaction volume that comprises all of the reagents
for both the ligation and amplification reactions ("closed-tube"
reactions). In certain such embodiments, one may then carry out the
amplification reaction without removing ligation product from that
reaction volume. Thus, in certain such embodiments, the reaction
volume may comprise: the sample, a ligation probe set, a ligation
agent, a polymerase, a labeled probe, a primer set, and dNTPs.
[0350] In certain such embodiments, one may employ a ligation
reagent that does not function at the higher temperatures employed
in a subsequent amplification reaction. In certain embodiments, one
may substantially destroy the ligation reagent activity after the
ligation reaction by subjecting the reaction volume to a high
temperature for a given period of time prior to the amplification
reaction. For example, in certain embodiments, one may employ a
high temperature for a short cycle period during a ligation
reaction such that the ligation reagent activity is not
substantially destroyed, and after the ligation reaction, hold the
reaction volume at the high temperature for a longer period of time
that destroys a substantial amount of the ligation reagent
activity. In certain embodiments, destroying a substantial amount
of ligation reagent activity means destroying at least 90% of the
ligation reaction activity. In certain embodiments, at least 95% of
the ligation reaction activity is destroyed. In certain
embodiments, 100% of the ligation reaction activity is
destroyed.
[0351] In certain embodiments, one may employ other methods of
substantially destroying the ligation reagent activity prior to the
subsequent amplification reaction. For example, one may employ an
agent that inhibits the activity of a ligation reagent at a higher
temperature that is used for an amplification reaction, but that
does not inhibit the ligation reagent at a lower temperature that
is used for the ligation reaction.
[0352] In certain embodiments in which one includes amplification
reagents in the reaction volume during a ligation reaction, one may
employ amplification primers that do not interfere with
hybridization and ligation of ligation probes during the ligation
reaction.
[0353] In certain embodiments in which one includes amplification
reagents in the reaction volume during a ligation reaction, one may
employ polymerase that is substantially inactive in the ligation
conditions that are employed. In certain embodiments, substantially
inactive means that at least 90% of the polymerase is inactive. In
certain embodiments, at least 95% of the polymerase is inactive. In
certain embodiments, 100% of the polymerase is inactive.
[0354] In certain such embodiments, the polymerase may be
substantially inactive at the temperatures that are employed for
the ligation reaction. For example, in certain embodiments, a
polymerase may not be substantially active at a lower temperature
that is employed for a ligation reaction and the ligation reagent
is active at such lower temperatures. In certain embodiments, one
may employ an agent that inhibits the activity of a polymerase at a
lower temperature that is used for a ligation reaction, but that
does not inhibit the polymerase at a higher temperature that is
used in an amplification reaction. Exemplary agents that may be
used in such embodiments to inhibit polymerases at a lower
temperature include, but are not limited to, aptamers. See, e.g.,
Lin et al., J. Mol. Biol., 271:100-111 (1997)
[0355] In certain embodiments, one may employ a polymerase that is
not substantially activated at the conditions employed for a
ligation reaction, but is subsequently activated after the ligation
reaction. For example, in certain such embodiments, one may employ
a polymerase that is not substantially activated when held at a
high temperature for a short period, but is activated if held at
the high temperature for a longer period. Using such a polymerase
according to certain embodiments, one may employ a high temperature
for a short cycle period during a ligation reaction such that the
polymerase is not substantially activated, and after the ligation
reaction, hold the reaction volume at the high temperature for a
longer period of time such that the polymerase is activated An
exemplary, but nonlimiting, example of such a polymerase is
AmpliTaq Gold.RTM. (Applied Biosystems, Foster City, Calif.).
[0356] In certain embodiments in which one includes amplification
reagents in the reaction volume during a ligation reaction, one may
employ labeled probes that do not interfere with hybridization and
ligation of ligation probes during the ligation reaction.
[0357] In certain embodiments, one may add some or all of the
reagents for the amplification reaction directly to the ligation
reaction volume after a ligation reaction ("open tube" reactions).
In certain embodiments, one may add at least a portion of the
ligation reaction volume after a ligation reaction to reagents for
the amplification reaction.
[0358] In certain embodiments as shown in FIG. 4A, the first probe
2, which comprises an addressable portion 4, and the second probe
33, which comprises a promoter 14, hybridize with the target
nucleic acid sequence 1. The adjacently hybridized probes are
ligated together to form a duplex that contains the target nucleic
acid sequence 1 and the ligation product 36 comprising an
addressable portion 4 and a promoter 14, as shown in FIG. 4B. When
the duplex is denatured, the ligation product is released.
[0359] The ligation product is combined with an appropriate RNA
polymerase 16 and rNTPs (see FIG. 4B). The RNA polymerase interacts
with the promoter such that the rNTPs are added in a
template-dependent fashion to make a transcription product 36' (see
FIG. 4C and 4D). A labeled probe 29 is added before, during, or
after making the transcription product. The labeled probe 29 in the
depicted embodiment is a hybridization dependent fluorescent probe
that comprises a quenching moiety (Q) linked to a fluorescent
moiety (F) through an oligonucleotide link element that comprises a
sequence that is the same as the sequence of the addressable
portion of the ligation product. When the hybridization dependent
fluorescent probe is not hybridized to a sequence that is
complementary to the addressable portion, the quenching moiety (Q)
quenches the fluorescent moiety (F). The hybridization dependent
fluorescent probe hybridizes to the sequence (4') of the
transcription product that is complementary to the addressable
portion such that the fluorescent moiety (F) no longer is quenched
by the quenching moiety (Q) and a fluorescent signal is detected
(see FIG. 4D). Detection of the fluorescent signal indicates the
presence of the target nucleic acid sequence in the sample.
[0360] In certain embodiments, if no target nucleic acid sequence
had been present in the sample, no ligation product comprising the
addressable portion and the promoter would have been formed during
the ligation reaction. Accordingly, no labeled probe would bind to
a ligation product and there would be no fluorescent signal from a
labeled probe. Thus, the absence of a detectable signal during or
after the amplification reaction would indicate the absence of
target nucleic acid sequence in the sample. In certain embodiments,
ligation products may form even if the appropriate target nucleic
acid sequence is not in the sample, but such ligation occurs to a
measurably lesser extent than when the appropriate target nucleic
acid sequence is in the sample. In certain such embodiments, one
can set an appropriate threshold difference between detectable
signal values to differentiate between samples that include the
appropriate target nucleic acid sequence and samples that do not
include the appropriate target nucleic acid sequence.
[0361] The skilled artisan will understand that some RNA
polymerases typically form RNA transcription product(s) using a
double-stranded transcription template, but not single-stranded
transcription templates. Thus, when employing such RNA polymerases,
a double-stranded version of the ligation product is typically
generated before transcription occurs, as shown for example, in
FIG. 5, The skilled artisan will also understand that it may be
desirable to add RNA polymerase after some or all of the
denaturation procedures.
[0362] Certain embodiments are shown in FIG. 5, which employ a
first probe 32, which comprises a 5' primer-specific portion 25, an
addressable portion 4, and a target-specific portion 15a, and a
second probe 43, which comprises a target-specific portion 15b and
a complement of a promoter 14'. The two probes hybridize with the
target nucleic acid sequence 1. The adjacently hybridized probes
are ligated together to form a duplex that contains the target
nucleic acid sequence 1 and the ligation product 46, which
comprises the primer-specific portion 25, the addressable portion
4, and the promoter complement 14', as shown in FIG. 5B. When the
duplex is denatured, the ligation product 46 is released.
[0363] As shown in FIG. 5C, under appropriate conditions and in the
presence of appropriate primers 7 and DNA polymerase 8, a
double-stranded first amplification product 18 is generated,
comprising the promoter 14 and its complement 14', and the
addressable support-specific portion 4 and its complement 4'. The
first amplification product is transcribed under appropriate
conditions and in the presence of RNA polymerase 16 to generate
transcription products 17. The transcription products may be
detected and quantitated by, for example, using labeled probes,
e.g., but not limited to, hybridization dependent probes.
[0364] According to certain embodiments, the first and second
probes in each ligation probe set are designed to be complementary
to the sequences immediately flanking the pivotal nucleotide of the
target sequence (see, e.g., probes A, B, and Z in FIG. 8(1)). In
the embodiment shown in FIGS. 8A-8C, two first probes A and B of a
ligation probe set will comprise a different nucleotide at the
pivotal complement and a different addressable portion for each
different nucleotide at the pivotal complement. One forms a
ligation reaction composition comprising the probe set and the
sample.
[0365] When the target sequence is present in the sample, the first
and second probes will hybridize, under appropriate conditions, to
adjacent regions on the target (see, e.g., FIG. 8(2)). When the
pivotal complement is base-paired to the target, in the presence of
an appropriate ligation agent, two adjacently hybridized probes may
be ligated together to form a ligation product (see, e.g., FIG.
8(3)). In certain embodiments, if the pivotal complement of a first
probe is not base-paired to the target, no ligation product
comprising that mismatched probe will be formed (see, e.g., probe B
in FIGS. 8(2) to 8(4).
[0366] In FIGS. 8(2) and 8(3), the first probe B is not hybridized
to a target. In certain embodiments, the failure of a probe with a
mismatched terminal pivotal complement to ligate to a second probe
may arise from the failure of the probe with the mismatch to
hybridize to the target under the conditions employed. In certain
embodiments, the failure of a probe with a mismatched terminal
pivotal complement to ligate to a second probe may arise when that
probe with the mismatch is hybridized to the target, but the
nucleotide at the pivotal complement is not base-paired to the
target.
[0367] In certain embodiments, the reaction volume that is
subjected to the ligation reaction forms a test composition. In
certain embodiments, one then forms an amplification reaction
composition comprising the test composition, at least one primer
set, a polymerase, and a different labeled probe (LBP-A and LBP-B)
for each different first probe, wherein the different labeled
probes can provide detectably different signals (see, e.g., FIG.
8(4)). The labeled probes in the depicted embodiment are different
5'-nuclease fluorescent probes that comprise a quenching moiety (Q)
linked to a detectably different fluorescent moiety (F) through a
different oligonucleotide link element. The different
oligonucleotide link elements comprise a sequence that is
complementary to one of the different addressable portions of the
different first ligation probes.
[0368] In the depicted embodiment, the first labeled probe (LBP-A)
comprises a first fluorescent moiety (FA) that is linked to the
quenching moiety (Q) through an oligonucleotide link element that
comprises a sequence complementary to the sequence of the
addressable portion (ASP-A) of the first probe A. In the depicted
embodiment, the second labeled probe (LBP-B) comprises a second
fluorescent moiety (FB) that is linked to the quenching moiety (Q)
through an oligonucleotide link element that comprises a sequence
that is complementary to the sequence of the addressable portion
(ASP-B) of the first probe B. The fluorescent moieties of each of
the different labeled probes emit detectably different signals from
one another when they are not quenched by the quenching moiety.
[0369] In certain appropriate salts, buffers, and nucleotide
triphosphates, the amplification reaction composition is subjected
to at least one cycle of amplification. In the first amplification
cycle, the second primer (P2), which comprises a sequence
complementary to the sequence of the 3' primer-specific portion of
the ligation product, hybridizes with the ligation product and is
extended in a template-dependent fashion to create a
double-stranded molecule.
[0370] Also during the first amplification cycle, the 5'-nuclease
activity of the polymerase results in cleavage of the labeled probe
that is hybridized to the addressable portion of the ligation
product (see, e.g., labeled probe LBP-A in FIG. 8(5). Cleavage
results in the fluorescent moiety (FA) no longer being quenched by
the quenching moiety (Q) and a fluorescent signal is detected.
Detection of the fluorescent signal from fluorescent moiety (FA)
indicates the presence of the target nucleic acid sequence in the
sample that has a pivotal nucleotide (A) that is complementary to
the nucleotide (T) at the pivotal complement of the ligation
product.
[0371] In this example, no target nucleic acid sequence in the
sample has a pivotal nucleotide (C) that is complementary to the
nucleotide of the pivotal complement of probe B. Thus, in this
example, no ligation product comprising the addressable portion of
probe B and the 3' primer-specific portion is formed. Accordingly,
no labeled probe (LBP-B) comprising fluorescent moiety (FB) would
bind to a ligation product or an amplification product and there
would be no cleavage of a labeled probe (LBP-B) during the
amplification reaction. Thus, the absence of a detectable signal
from fluorescent moiety (FB) during or after the amplification
reaction would indicate the absence of target nucleic acid sequence
having pivotal nucleotide (C) in the sample. In certain
embodiments, ligation of probes with a pivotal complement that is
not complementary to the pivotal nucleotide may occur, but such
ligation occurs to a measurably lesser extent than ligation of
probes with a pivotal complement that is complementary to the
pivotal nucleotide. In certain such embodiments, one can set an
appropriate threshold difference between detectable signal values
to differentiate between samples that include the appropriate
target nucleic acid sequence and samples that do not include the
appropriate target nucleic acid sequence.
[0372] In certain embodiments, when a 5'-nuclease probe hybridizes
to an addressable portion or the complement of an addressable
portion, the quenching moiety may be separated enough from the
signal moiety such that a signal may be detected. In certain
embodiments, the detectable signal value of such a signal (prior to
cleavage) is less than the detectable signal value after cleavage
of the 5'-nuclease probe. Thus, in certain such embodiments, one
may set a threshold difference in detectable signal values such
that a signal value that is detected after hybridization of the
5'-nuclease probe to a given sequence without cleavage does not
result in the set threshold difference. A signal value that is
detected with cleavage of the 5'-nuclease probe, however, will
result in the set threshold difference.
[0373] In certain embodiments, subsequent amplification cycles may
result in exponential amplification (see, e.g., FIG. 8(4)-(11)).
Thus, with each cycle the signal value that is detected from the
cleavage of labeled probes (LBP-A) will increase, while the signal
value that is detected from labeled probes (LBP-B) will stay
substantially the same.
[0374] In certain embodiments, one employs a ligation probe set
that includes an addressable portion on both the first probe and
the second probe, and the first probe and the second probe will
ligate together when they hybridize adjacent to one another on the
target nucleic acid sequence. In certain such embodiments, one
employs different labeled probes for different addressable portions
such that one of the labeled probes provides a control signal and
the other labeled probe provides a target identification or
quantitation signal.
[0375] For example, in certain embodiments, such a control could be
added to the embodiment illustrated by FIG. 8 in the following
nonlimiting manner. One forms a ligation reaction composition that
comprises the same two first probes depicted in FIG. 8, which
comprise two different nucleotides at the pivotal complement and
two different addressable portions. The second probe, however,
includes a third different addressable portion ASP-C between the
target-specific portion and the 3' primer-specific portion.
[0376] Thus, the presence of the target nucleic acid that is shown
in FIG. 8 during a ligation reaction, results in a ligation product
that comprises the 5' primer-specific portion, addressable portion
ASP-A, the two target specific portions, addressable portion ASP-C,
and the 3' primer-specific portion. The same amplification reaction
composition as discussed above for FIG. 8 is employed, except that
composition further comprises an additional labeled probe LBP-C.
The labeled probe LBP-C in the depicted embodiment is a 5'-nuclease
fluorescent probe that comprises a quenching moiety (Q) linked to a
third different fluorescent moiety (FC) that is linked to the
quenching moiety (Q) through an oligonucleotide link element that
comprises the same sequence as the addressable portion (ASP-C) of
the second probe Z. The fluorescent moiety (FC) emits a detectably
different signal than either of fluorescent moieties (FA) and (FB)
when (FA), (FB), and (FC) are not quenched by the quenching
moieties.
[0377] The first cycle of amplification of these modified
embodiments of FIG. 8, should result in a threshold difference
between the first and second detectable signal values from the
fluorescent moiety (FA) of the cleaved labeled probe LBP-A. Also,
the first cycle of amplification of these modified embodiments
illustrated in FIG. 8, should also result in no threshold
difference between the first and second detectable signal values
from the fluorescent moiety (FB) of the uncleaved labeled probe
LBP-B. (This is the same result that should occur in the embodiment
illustrated in FIG. 8 without the third addressable portion
ASP-C.)
[0378] The first cycle of amplification of these modified
embodiments of FIG. 8, should also result in no threshold
difference between the first and second detectable signal values
from the fluorescent moiety (FC) of the uncleaved labeled probe
LBP-C. (The labeled probe LBP-C comprises the sequence of
addressable portion ASP-C of the ligation product, and thus should
not be cleaved during the first amplification cycle.)
[0379] The first cycle of amplification of these modified
embodiments of FIG. 8, also will result in an amplification product
that is the complement of the ligation product. In these modified
embodiments of FIG. 8, the labeled probe LBP-C will hybridize to
that amplification product comprising the complement of the
addressable portion ASP-C of the ligation product.
[0380] The second cycle of amplification of these modified
embodiments of FIG. 8, should result in a doubling of signal value
from the fluorescent moiety (FA) of labeled probe LBP A from the
first cycle of amplification. The second cycle of amplification of
these modified embodiments of FIG. 8, should also result in a
threshold difference between the first and second detectable signal
values from the fluorescent moiety (FC) of the cleaved labeled
probe LBP-C. The second cycle of amplification of these modified
embodiments of FIG. 8, should also result in no threshold
difference between the first and second detectable signal values
from the fluorescent moiety (FB) of the uncleaved labeled probe
LBP-B.
[0381] Subsequent cycles of amplification should result in
exponential amplification of products corresponding to the ligation
product and its complement, and thus, should result in
corresponding increases of the detectable signal values from
labeled probes LBP-A and LBP-C. If one observes a discrepancy
between the expected increases in signal values from labeled probes
LBP-A and LBP-C, one may conclude that the assay may not be
progressing properly. If one observes the appropriate increases in
signal values from labeled probes LBP-A and LBP-C, one may have
confidence in the results from the assay.
[0382] The control may also be illustrated in embodiments in which
the embodiment in FIG. 8 is modified by the presence of both
possible target nucleic acids in the sample. In such embodiments,
subsequent amplification cycles after the second amplification
cycle should result in an increase in the signal value from the
fluorescent moiety (FC) from labeled probe LBP-C that is similar to
the combined increase in signal value from fluorescent moieties
(FA) and (FB) from labeled probes LBP-A and LBP-B. This should be
the result since a portion of the ligation products should have
addressable portion ASP-A, a portion of the ligation products
should have addressable portion ASP-B, but all of the ligation
products should have addressable portion ASP-C.
[0383] Assume, e.g., that one observes a large increase in the
detectable signal value from fluorescent moiety (FC), a
significantly smaller increase in the detectable signal value from
fluorescent moiety (FB), but observes no threshold difference in
the detectable signal value from fluorescent moiety (FA). One may
conclude from such results that the assay is not proceeding
properly. It may be that ligation product with addressable portion
ASP-A is present and is being amplified, but the labeled probe
LBP-A is not functioning properly.
[0384] In certain embodiments, one employs a ligation probe set
that includes two different addressable portions on at least one of
the first probe and the second probe. In certain such embodiments,
one employs different labeled probes for different addressable
portions such that one of the labeled probes provides a control
signal and the other labeled probe provides a target identification
or quantitation signal.
[0385] For example, in certain embodiments, such a control could be
added to the embodiment illustrated by FIG. 8 in the following
nonlimiting manner. One forms a ligation reaction composition that
comprises the same second probe that is depicted in FIG. 8. Similar
to FIG. 8, one employs two first probes that comprise two different
nucleotides at the pivotal complement and two different addressable
portions. Each of the first probes, however, also includes a third
different addressable portion ASP-C which is also located between
the target-specific portion and the 3' primer-specific portion.
[0386] Thus, the presence of the target nucleic acid that is shown
in FIG. 8 during a ligation reaction, results in a ligation product
that comprises the 5' primer-specific portion, addressable portion
ASP-A and addressable portion ASP-C, the two target specific
portions, and the 3' primer-specific portion. The same
amplification reaction composition as discussed above for FIG. 8 is
employed, except that composition further comprises an additional
labeled probe LBP-C. The labeled probe LBP-C in the depicted
embodiment is a 5'-nuclease fluorescent probe that comprises a
quenching moiety (Q) linked to a third different fluorescent moiety
(FC) that is linked to the quenching moiety (Q) through an
oligonucleotide link element that comprises a sequence that is
complementary to the sequence of the addressable portion (ASP-C) of
the first probes A and B. The fluorescent moiety (FC) emits a
detectably different signal than either of fluorescent moieties
(FA) and (FB) when (FA), (FB), and (FC) are not quenched by the
quenching moieties
[0387] The first cycle of amplification of these modified
embodiments of FIG. 8, should result in a threshold difference
between the first and second detectable signal values from the
fluorescent moiety (FA) of the cleaved labeled probe LBP-A. Also,
the first cycle of amplification of these modified embodiments
illustrated in FIG. 8, should also result in no threshold
difference between the first and second detectable signal values
from the fluorescent moiety (FB) of the uncleaved labeled probe
LBP-B. (This is the same result that should occur in the embodiment
illustrated in FIG. 8 without the third addressable portion
ASP-C.)
[0388] The first cycle of amplification of these modified
embodiments of FIG. 8, should also result in a threshold difference
between the first and second detectable signal values from the
fluorescent moiety (FC) of the cleaved labeled probe LBP-C. The
first cycle of amplification of these modified embodiments of FIG.
8, also will result in an amplification product that is the
complement of the ligation product.
[0389] The second cycle of amplification of these modified
embodiments of FIG. 8, should result in a doubling of signal value
from the fluorescent moiety (FA) of labeled probe LBP-A from the
first cycle of amplification. The second cycle of amplification of
these modified embodiments of FIG. 8, should also result in a
doubling of signal value from the fluorescent moiety (FC) of
labeled probe LBP-C from the first cycle of amplification. The
second cycle of amplification of these modified embodiments of FIG.
8, should also result in no threshold difference between the first
and second detectable signal values from the fluorescent moiety
(FB) of the uncleaved labeled probe LBP-B.
[0390] Subsequent cycles of amplification should result in
exponential amplification of products corresponding to the ligation
product and its complement, and thus, should result in
corresponding increases of the detectable signal values from
labeled probes LBP-A and LBP-C. If one observes a discrepancy
between the expected increases in signal values from labeled probes
LBP-A and LBP-C, one may conclude that the assay may not be
progressing properly. If one observes the appropriate increases in
signal values from labeled probes LBP-A and LBP-C, one may have
confidence in the results from the assay.
[0391] The control may also be illustrated in embodiments in which
the embodiment in FIG. 8 is modified by the presence of both
possible target nucleic acids in the sample. In such embodiments,
amplification cycles should result in an increase in the signal
value from the fluorescent moiety (FC) from labeled probe LBP-C
that is similar to the combined increase in signal value from
fluorescent moieties (FA) and (FB) from labeled probes LBP-A and
LBP-B. This should be the result since a portion of the ligation
products should have addressable portion ASP-A, a portion of the
ligation products should have addressable portion ASP-B, but all of
the ligation products should have addressable portion ASP-C.
[0392] Assume, e.g., that one observes a large increase in the
detectable signal value from fluorescent moiety (FC), a
significantly smaller increase in the detectable signal value from
fluorescent moiety (FB), but observes no threshold difference in
the detectable signal value from fluorescent moiety (FA). One may
conclude from such results that the assay is not proceeding
properly. It may be that ligation product with addressable portion
ASP-A is present and is being amplified, but the labeled probe
LBP-A is not functioning properly.
[0393] In certain embodiments, a single-stranded amplification
product is synthesized by, for example, without limitation,
asymmetric PCR, asynchronous PCR, primer extension, RNA polymerase
(see, e.g., FIG. 4), or asymmetric reamplification. In exemplary
embodiments of asymmetric PCR, the amplification reaction
composition is prepared with at least one primer set, wherein
either the at least one first primer, or the at least one second
primer, but not both, are added in excess. Thus, in certain
embodiments, the excess primer to limiting primer ratio may be
approximately 100:1, respectively. One of ordinary skill in the art
will recognize that the optimal amounts of the primers according to
certain embodiments may be determined empirically. In certain
embodiments, amounts will range from about 2 to 50 nM for the
limiting primer, and from about 100 to 900 nM for the primer in
excess. Empirically, in certain embodiments, the concentration of
one primer in the primer set is typically kept below 5 pmol per 100
.mu.l of amplification reaction composition.
[0394] Since both primers are initially present in substantial
excess at the beginning of the PCR reaction in certain embodiments,
both strands are exponentially amplified. In certain embodiments,
prior to completing all of the cycles of amplification, however,
the limiting primer is exhausted. During the subsequent cycles of
amplification, only one strand is amplified, thus generating an
excess of single-stranded amplification products.
[0395] For example, but without limitation, in certain embodiments,
after approximately 40 to 45 cycles of amplification are performed,
the amplification process is completed with a long extension step.
In certain embodiments, the limiting primer is typically exhausted
by the 25.sup.th cycle of amplification. During subsequent cycles
of amplification only one strand of the amplification product is
produced due to the presence of only one primer of the primer set.
In certain embodiments, the labeled probe is a 5' nuclease probe
that is designed to hybridize with a template strand that is not
being produced during such subsequent cycles, such that each
subsequent cycle results in an additional amount of signal. In
certain embodiments, the labeled probe is a hybridization dependent
probe that is designed to hybridize with a template strand that is
being produced during such subsequent cycles, such that each
subsequent cycle results in an additional amount of signal.
[0396] In certain exemplary asymmetric reamplification protocols,
an air-dried first amplification composition containing
double-stranded amplification product, is resuspended in 30 .mu.l
of 0.1.times.TE buffer, pH 8.0. The second amplification reaction
composition is prepared by combining two microliters of the
resuspended amplification product in a 0.2 ml MicroAmp reaction
tube with 9 .mu.l sterile filtered deionized water, 18 .mu.l
AmpliTaq Gold.RTM. mix (PE Biosystems, Foster City, Calif.), an
appropriate amount of labeled probe, and 20-40 pmol of either the
at least one first primer or the at least one second primer
suspended in 1 .mu.l 1.times.TE buffer.
[0397] The tubes are heated to 95.degree. C. for 12 minutes, then
cycled for ten cycles of (94.degree. C. for 15 seconds, 60.degree.
C. for 15 seconds, and 72.degree. C. for 30 seconds), followed by
twenty-five cycles of (89.degree. C. for 15 seconds, 53.degree. C.
for 15 seconds, and 72.degree. C. for 30 seconds), and then 45
minutes at 60.degree. C. The labeled probes are designed such that
the detectable signal changes during the subsequent reamplification
procedure, if the corresponding ligation product is present prior
to the initial amplification reaction.
[0398] For example, in certain embodiments, one will form a
ligation product from: a first probe that comprises a 5'
primer-specific portion, an addressable portion, and a
target-specific portion; and a second probe comprising a target
specific portion and a 3' primer-specific portion. The primer set
will include a first primer that comprises the sequence of the 5'
primer-specific portion and a second primer that comprises a
sequence that is complementary to the sequence of the 3'
primer-specific portion. The labeled probe will comprise a sequence
that is complementary to the sequence of the addressable portion
and the second primer will be included in excess of the first
primer.
[0399] In certain embodiments, a double-stranded amplification
product is generated and subsequently converted into
single-stranded sequences. Processes for converting double-stranded
nucleic acid into single-stranded sequences include, without
limitation, heat denaturation, chemical denaturation, and
exonuclease digestion. Detailed protocols for synthesizing
single-stranded nucleic acid molecules or converting
double-stranded nucleic acid into single-stranded sequences can be
found, among other places, in Ausbel et al., Sambrook et al., the
Novagen Strandase.TM. product insert (Novagen, Madison, Wis,), and
Sambrook and Russell.
[0400] In certain embodiments, the methods of the invention
comprise universal primers, universal primer sets, or both. In
certain embodiments, one may use a single universal primer set for
any number of amplification reactions for different target
sequences.
[0401] In certain embodiments, 5' primer-specific portions of at
least two different ligation products comprise a sequence that is
the same as at least a portion of one first primer in the reaction
composition (see, e.g., primer PA in FIG. 9(A)). In certain
embodiments, the 5' primer-specific portions of most ligation
products in a reaction composition comprise a sequence that is the
same as at least a portion of the at least one first primer (see,
e.g., primer PA in FIG. 9(B)). In certain embodiments, the 5'
primer-specific portions of all ligation products in a reaction
composition comprise a sequence that is the same as at least a
portion of the at least one first primer (see, e.g., primer PA in
FIG. 9(C)). In certain embodiments, a reaction composition
comprises more than one universal primer, more than one universal
primer set, or both.
[0402] Such ligation products can be used in, for example, but are
not limited to, a multiplex reaction wherein multiple target
nucleic acid sequences are quantitated. According to certain
embodiments, at least one universal primer, at least one universal
primer set, or both, are used in a multiplex reaction.
[0403] According to certain embodiments, a multiplex reaction may
include, for example, but is not limited to, six ligation products,
each comprising a unique addressable portion corresponding to
different target sequences or alleles or a combination of both
(see, e.g., the six different ASP's in FIG. 9). In FIG. 9(A), the
5' primer-specific portions of two ligation products (A-Z) comprise
a sequence that is the same as at least a portion of one first
primer (PA) in the reaction composition. The 3' primer-specific
portions of the same two ligation products comprise a sequence that
is complementary to at least a portion of one second primer in the
reaction composition. Thus, to exponentially amplify these six
ligation products, one uses five primer sets (PA-PZ, PC-PZ, PD-PZ,
PE-PZ, and PF-PZ).
[0404] FIG. 9(B) shows the same six ligation products, except that
the 5' primer-specific portions of most of the ligation products
comprise a sequence that is the same as at least a portion of one
first primer in the reaction composition. The 3' primer-specific
portions of all of the ligation products comprise a sequence that
is complementary to at least a portion of one second primer in the
reaction composition. To exponentially amplify these six ligation
products, three primer sets are used (PA-PZ, PE-PZ, and PF-PZ).
[0405] FIG. 9(C) shows the same six ligation products, except that
the 5' primer-specific portions of all of the ligation products
comprise a sequence that is the same as at least a portion of one
first primer in the reaction composition. The 3' primer-specific
portions of all of the ligation products comprise a sequence that
is complementary to at least a portion of one second primer in the
reaction composition. To exponentially amplify these six ligation
products, only one primer set is used (PA-PZ).
[0406] Thus, the same primer set will be used for at least two
ligation products in the reaction composition (see, e.g., primers
PA and PZ of FIG. 9(A)). In certain embodiments, most ligation
products in the reaction composition will use the same primer set
(see, e.g., primers PA and PZ of FIG. 9(B)). In certain
embodiments, all of the ligation products in the reaction
composition will use the same primer set (see, e.g., primers PA and
PZ of FIG. 9(C)).
[0407] In the embodiments depicted in FIG. 9, the ligation probe
comprising the 3' primer-specific portion also comprises an
addressable portion (ASP). The embodiments depicted in FIG. 9 may
be modified such that the ligation probe comprising the 5'
primer-specific portion comprises an addressable portion and the
ligation probe comprising the 3' primer-specific portion does not
comprise an addressable portion. The embodiments depicted in FIG. 9
may be modified such that both the ligation probe comprising the 5'
primer-specific portion and the ligation probe comprising the 3'
primer-specific portion comprise an addressable portion.
[0408] According to certain embodiments, as few as one universal
primer or one universal primer set can be used to amplify one or
more ligation or amplification products, since the probes may be
designed to share primer-specific portions but comprise different
addressable portions and/or target-specific portions.
[0409] The methods of the instant invention according to certain
embodiments may comprise universal primers or universal primer sets
that decrease the number of different primers that are added to the
reaction composition, reducing the cost and time required. For
example, without limitation, in a 100-target-sequence multiplex
reaction, typically 100 different primer sets are required using
certain conventional methods. According to certain embodiments of
the present invention, anywhere from 100 primer sets to as few as
one primer set may be employed in the same 100 target multiplex.
For example, in certain embodiments, all of the ligation or
amplification products to be amplified by a universal primer or
universal primer set comprise the same 5' primer-specific portion
and the same 3' primer-specific portion. The skilled artisan will
appreciate that, in certain embodiments, more than one universal
primer set may be employed in a multiplex reaction, each specific
to a different subset of ligation or amplification products in the
reaction. In certain embodiments, the amplification reaction
composition may comprise at least one universal primer or universal
primer set and at least one primer or primer set that hybridizes to
only one species of probe, ligation product, or amplification
product.
[0410] In certain embodiments, because only one or a limited number
of primers or primer sets are used for amplification, the methods
are more cost-efficient and less time-consuming than conventional
methods of detecting or quantitating target nucleic acid sequences
in a sample. In certain embodiments, using a limited number of
primers may also reduce variation in amplification efficiency and
cross-reactivity of the primers. Additionally, in certain
embodiments, quantitative results may be obtained from multiplex
reactions for those ligation products or amplification products
that are amplified by a universal primer or universal primer set,
respectively.
[0411] The skilled artisan will appreciate that in certain
embodiments, including, but not limited to, detecting multiple
alleles, the ligation reaction composition may comprise more than
one first probe or more than one second probe for each potential
allele in a multiallelic target locus. In certain embodiments,
those methods employ different probes with different addressable
portions for each different allele at each locus. In certain such
embodiments, the amplification reaction composition may include a
different labeled probe for each different addressable portion. In
certain embodiments, each different labeled probe may have a
detectably different signal for each different addressable
portion.
[0412] FIG. 12 illustrates certain such embodiments in which there
are three biallelic loci. For each locus, one employs a ligation
probe set comprising two first probes. In FIG. 12, there is a
different probe set for each of the three different loci. Each
probe set comprises two first probes for the two different alleles
at each locus. Each of the first probes of each probe set comprises
the same 5' primer-specific portion (P-SP(A)), a target-specific
portion that is complementary to a portion of the given locus and
includes a different nucleotide at the pivotal complement (A or G
for the first locus; T or G for the second locus; G or C for the
third locus), and a different addressable portion (AP1 or AP2 for
the first locus; AP3 or AP4 for the second locus; AP5 or AP6 for
the third locus). Each of the second probes of each probe set
comprises the same 3' primer-specific portion (P-SP(Z)) and a
different target-specific portion for each different locus.
[0413] In certain embodiments shown in FIG. 12, after ligation, one
can perform a multiplex amplification reaction for all of the loci
with the same primer set (PA) and (PZ) and six different labeled
probes (LBP-1, LBP-2, LBP-3, LBP-4, ILBP-5, and LBP-6) that
comprise sequences complementary to (or the same as) each of the
six different addressable portions. Also, the six different labeled
probes provide six detectably different signals.
[0414] Thus, in this example, if amplification results in a
threshold difference in detectable signal value from all six
labeled probes, one would conclude that the sample was heterozygous
at all three loci. If a threshold difference in signal value is
only detected from labeled probes LBP-1, LBP-3, LBP-4, and LBP-5,
one would conclude that the sample is homozygous at locus 1 with
(C) as the pivotal nucleotide at locus 1, heterozygous at locus 2,
and homozygous at locus 3 with (G) as the pivotal nucleotide.
[0415] In certain embodiments, one may employ the same two
different addressable portions for the two different allelic
options at more than one locus. In certain such embodiments, one
may distinguish between the different loci by employing a different
reaction composition for each locus.
[0416] Thus, if one wants to determine a single nucleotide
difference in the alleles at three different biallelic loci, in
certain such embodiments, one may employ three different reaction
compositions that each have a different ligation probe set specific
for the two options at each locus. FIG. 13 illustrates certain such
embodiments in which one employs three different reaction
compositions for three biallelic loci. In FIG. 13, there is a
different probe set for each of the three different loci. Each
probe set comprises two first probes for the two different alleles
at each locus. Each of the first probes of each probe set comprises
the same 5' primer-specific portion (P-SP(A)), a target-specific
portion that is complementary to a portion of the given locus and
includes a different nucleotide at the pivotal complement (A or G
for the first locus; T or G for the second locus; G or C for the
third locus), and a different addressable portion (AP1 or AP2)
corresponding to one of the two allelic nucleotide options for each
locus. The same set of addressable portions (AP1 and AP2) can be
used on the two first probes of each of the three different probe
sets. Each of the second probes of each probe set comprises the
same 3' primer-specific portion (P-SP(Z)) and a different
target-specific portion for each different locus.
[0417] In certain embodiments shown in FIG. 13, after separate
ligation reactions for each locus, one can perform three separate
amplification reactions for each locus with the same primer set
(PA) and (PZ) and the same two labeled probes (LBP-1, which
comprises a sequence that is complementary to (or is the same as)
the sequence of the addressable portion AP1; and LBP-2, which
comprises a sequence that is complementary to (or is the same as)
the sequence of the addressable portion AP2). Also, the two
different labeled probes provide two detectably different
signals.
[0418] Thus, in this example, if amplification results in a
threshold difference in detectable signal value from both labeled
probes (LBP-1 and LBP-2) in all three reaction compositions, one
would conclude that the sample was heterozygous at all three loci.
Another possible result from the amplification reactions may be as
follows: the first amplification reaction composition results in a
threshold difference in detectable signal value from labeled probe
LBP-1, the second amplification reaction composition results in a
threshold difference in detectable signal value from labeled probes
LBP-1 and LBP-2, and the third amplification reaction composition
results in a threshold difference in detectable signal value from
labeled probe LBP-1. One would conclude from such results that the
sample is homozygous at locus 1 with (C) as the pivotal nucleotide,
heterozygous at locus 2, and homozygous at locus 3 with (G) as the
pivotal nucleotide.
[0419] In certain embodiments, one may analyze many different
target sequences employing specific different probe sets in
separate reaction compositions. For example, one could employ a 96
well plate with 96 different ligation probe sets for 96 different
target nucleic acid sequences. In certain embodiments, one may want
to detect the presence or absence of (or to quantitate) a single
target nucleic acid sequence with each of the 96 probe sets. In
certain such embodiments, one may employ the same set of two
primers and the same labeled probe in each of the different 96
wells to obtain results for 96 different target sequences.
[0420] In certain embodiments, one may want to detect the presence
or absence of (or to quantitate) two different alleles at 96
different loci with 96 different ligation probe sets. In certain
embodiments, each probe set comprises two first probes and one
second probe. In certain embodiments, each of the first probes of
each probe set comprises a target-specific portion that is
complementary to a portion of the given locus and includes a
different nucleotide at the pivotal complement, and one of two
different addressable portions corresponding to one of the two
allelic nucleotide options for each locus. In certain embodiments,
the same two different addressable portions can be used on the two
first probes of each of the 96 probe sets. In certain embodiments,
each of the second probes of each probe set comprises a different
target-specific portion for each locus. In certain embodiments, the
two first probes of each of the 96 probe sets may further comprise
the same primer-specific portion. In certain embodiments, each of
the second probes of each of the 96 probe sets may further comprise
another primer-specific portion.
[0421] In certain such embodiments, after ligation, one may perform
96 separate amplification reactions in the 96 different wells. In
certain such embodiments, one may use in all of the 96 wells the
same primer set and the same two labeled probes. One labeled probe
may comprise a sequence that is complementary to (or is the same
as) one of the sequences of the two addressable portions, and the
other labeled probe may comprise a sequence that is complementary
to (or is the same as) the sequence of the other of the two
addressable portions. Also, the two different labeled probes
provide two detectably different signals. One may detect which
allele or alleles are present in each of 96 wells by detecting a
change in detectable signal value from the labeled probes.
[0422] In certain embodiments, one may want to detect the presence
or absence of (or to quantitate) two different alleles at 288
different loci with 288 ligation probe sets. One may employ a 96
well plate in which each well includes three different probe sets
for three different loci. Each of the three probe sets for each
well may comprise two first probes that each comprise a different
addressable portion for each of the allele options at each locus.
See, e.g., FIG. 12, where there are six different first probes with
six different addressable portions (AP1, AP2, AP3, AP4, AP5, and
AP6). One may employ the same six different addressable portions on
the three different probe sets in each of the wells. In certain
such embodiments, one may employ the same set of two primers and
the same six labeled probes in each of the different 96 wells to
obtain results for 288 different biallelic loci.
[0423] The skilled artisan will understand that, in various
embodiments, ligation probes can be designed with a pivotal
complement at any location in either the first probe or the second
probe. Additionally, in certain embodiments, ligation probes may
comprise multiple pivotal complements.
[0424] In certain embodiments that employ ligation probe sets that
comprise multiple first probes for a given locus that comprise
target-specific portions with different pivotal complements, the
target-specific portions of each of the different first probes for
a given locus may have the same sequence except for a different
nucleotide at the pivotal complement. In certain embodiments, the
target-specific portions of each of the first probes for a given
locus may have a different nucleotide at the pivotal complement and
may have different length sequences 5' to the pivotal complement.
In certain such embodiments, such target-specific portion sequences
5' to the pivotal complement may all be complementary to a portion
of the same locus nucleic acid sequence adjacent to the pivotal
nucleotide, but may have different lengths. For example, in such
embodiments in which there are two different first probes, the
target-specific portion sequences 5' to the pivotal complement may
be the same except one of them may have one or more additional
nucleotides at the 5' end of the target-specific portion.
[0425] In certain embodiments that employ ligation probe sets that
comprise multiple second probes for a given locus that comprise
target-specific portions with different pivotal complements, the
target-specific portions of each of the different second probes for
a given locus may have the same sequence except for a different
nucleotide at the pivotal complement. In certain embodiments, the
target-specific portions of each of the second probes for a given
locus may have a different nucleotide at the pivotal complement and
may have different length sequences 3' to the pivotal complement.
In certain such embodiments, such target-specific portion sequences
3' to the pivotal complement may all be complementary to a portion
of the same locus nucleic acid sequence adjacent to the pivotal
nucleotide, but may have different lengths. For example, in such
embodiments in which there are two different second probes, the
target-specific portion sequences 3' to the pivotal complement may
be the same except one of them may have one or more additional
nucleotides at the 3' end of the target-specific portion.
[0426] In certain embodiments, one may add additional nucleotides
to the end of a target specific portion of a ligation probe to
affect its melting temperature. For example, in certain
embodiments, the different nucleotide at the pivotal nucleotide of
two first probes of a ligation probe set may result in different
melting temperatures for such probes if they have the same length
target-specific portion. In certain such embodiments, one may
minimize such melting temperature differences by adding one or more
additional nucleotides to the end of target-specific portion
opposite the end that aligns with an adjacent ligation probe of a
probe set,
[0427] In certain embodiments, one may employ probes that include
one or more spacer nucleotides between an addressable portion and a
target-specific portion. In certain embodiments, such a spacer
nucleotide may be included to affect the melting temperature of a
ligation probe. For example, in certain embodiments, one or more
nucleotides of an addressable portion may be complementary to the
target nucleic acid sequence in the region adjacent to the sequence
that hybridizes to the target-specific portion of a ligation probe.
For example, the end of a target-specific portion (TSP) adjacent to
an addressable portion (ASP), and the end of the addressable
portion adjacent to the target-specific portion may hybridize to a
target nucleic acid as follows: TABLE-US-00006 ASP/TSP (hybridizing
portions shown with double underlining) . . . ACG/ATC . . .
(ligation probe) . . . TGC/TAG . . . (target nucleic acid)
In certain such embodiments, the hybridization of the one or more
nucleotides of the addressable portion to the target influences the
melting temperature of the probe.
[0428] In certain such embodiments, one may introduce one or more
spacer nucleotides between the addressable portion and the
target-specific portion of the probe such that the spacer
nucleotide(s) and the addressable portion will not hybridize to the
target nucleic acid. In the specific example above, for example,
one may introduce a spacer "C" between the target-specific portion
and the addressable portion as follows:: TABLE-US-00007 ASP/ /TSP
(hybridizing portions shown with double underlining) . . .
ACG/C/ATC . . . (ligation probe) . . . TGC/TAG . . . (target
nucleic acid)
[0429] In certain embodiments, one or more spacer nucleotides may
be included between different portions of a ligation probe. For
example, in certain embodiments, one or more spacer nucleotides may
be included between a primer-specific portion and an addressable
portion. In certain embodiments, one or more spacer nucleotides may
be included between a primer-specific portion and a target-specific
portion.
[0430] In certain embodiments, the target-specific portions of two
ligation probes that are intended to hybridize to the same portion
of a target nucleic acid sequence may include different nucleotides
as long as such differences do not prevent appropriate ligation.
For example, in certain embodiments, as long as appropriate
ligation is not prevented, two probes that comprise target-specific
portions that are designed to hybridize to an identical portion of
a target, but have different pivotal complements A and C at their
3' ends, may include variation within the target-specific portion
as follows (see lower case nucleotide): TABLE-US-00008 5'
CATGCcAATGACGGA-3' (SEQ ID NO:24) 5' CATGCgAATGACGGC-3' (SEQ ID
NO:25)
[0431] In certain embodiments, the number of ligation probes used
to detect any number of target sequences, is the product of the
number of targets to be detected times the number of alleles to be
detected per target plus one (i.e., (number of target
sequences.times.[number of alleles+1]). Thus, to detect 3 biallelic
sequences, for example, nine probes are used (3.times.[2+1]). In
certain embodiments, to detect 4 triallelic sequences, 16 probes
are used (4.times.[3+1]), and so forth.
[0432] The significance of the decrease in the number of primers
and labeled probes in certain embodiments, and therefore the cost
and number of manipulations, becomes readily apparent when
performing genetic screening of an individual for a large number of
multiallelic loci or of many individuals. In certain embodiments,
to amplify the ligation product of a target sequence, two primers
are used. One primer is complementary to the sequence of the 3'
primer-specific portion of the ligation products, and one primer
comprises the sequence of the 5' primer-specific portion. Using
certain conventional methods, one employs three different primers
for each different ligation product. Thus, to amplify the ligation
products for three biallelic loci potentially present in an
individual using certain conventional methodology, one would use 9
(3n, where n=3) primers.
[0433] In contrast, certain embodiments of the present invention
can effectively reduce this number to as few as one amplification
primers. According to certain embodiments of the present invention,
as few as two "universal" primers, can be used to amplify one or
more ligation or amplification products, since the probes may be
designed to share primer-specific portions but comprise different
addressable portions. A sample containing 100 possible biallelic
loci would require 200 primers in certain conventional detection
methods, yet only one universal primer can be used in certain
embodiments of the present invention.
[0434] Also, if one were to use certain conventional methods
employing labeled probes, a different labeled probe for each
different allele at each different locus would be used. According
to certain embodiments of the present invention, one can employ two
labeled probes to detect the sequence of one or more different
loci. For example, in certain conventional methods, one would use
200 different labeled probes to detect the 200 possible sequences
at 100 biallelic loci. Using certain embodiments of the present
invention, one can use 2 labeled probes to detect 200 possible
sequences at 100 biallelic loci.
[0435] Also, in certain embodiments one may prescreen a sample for
the presence or absence of certain sequences. For example, in
certain embodiments, one may employ different ligation probes sets
to detect nucleotides at different loci, but each ligation probe
set includes probes with the same addressable portion. If no
threshold difference in detectable signal value is detected, one
concludes that the sample is negative for all of the sequences in
question. If there is a threshold difference in detectable signal
value during or after an amplification reaction, one concludes that
at least one of the sequences in question is present. In certain
such embodiments, one could further screen the sample to determine
which specific sequence(s) are present.
Certain Exemplary Applications
[0436] According to certain embodiments, the present invention may
be used to detect the presence or absence of (or to quantitate)
splice variants in a target nucleic acid sequence. For example,
genes, the DNA that encodes for a protein or proteins, may contain
a series of coding regions, referred to as exons, interspersed by
non-coding regions referred to as introns. In a splicing process,
introns are removed and exons are juxtaposed so that the final RNA
molecule, typically a messenger RNA (mRNA), comprises a continuous
coding sequence. While some genes encode a single protein or
polypeptide, other genes can code for a multitude of proteins or
polypeptides due to alternate splicing.
[0437] For example, a gene may comprise five exons each separated
from the other exons by at least one intron, see FIG. 10. The
hypothetical gene that encodes the primary transcript, shown at the
top of FIG. 10, codes for three different proteins, each encoded by
one of the three mature mRNAs, shown at the bottom of FIG. 10. Due
to alternate splicing, exon 1 may be juxtaposed with (a) exon
2a-exon 3, (b) exon 2b-exon 3, or (c) exon 2c-exon 3, the three
splicing options depicted in FIG. 10, which result in the three
different versions of mature mRNA.
[0438] The rat muscle protein, troponin T is but one example of
alternate splicing. The gene encoding troponin T comprises five
exons (W, X, .alpha., .beta., and Z), each encoding a domain of the
final protein. The five exons are separated by introns. Two
different proteins, an .alpha.-form and a .beta.-form are produced
by alternate splicing of the troponin T gene. The .alpha.-form is
translated from a mRNA that contains exons W, X, .alpha., and Z.
The .beta.-form is translated from a mRNA that contains exons W, X,
.beta., and Z.
[0439] Certain exemplary embodiments involving splice variants
follow. In this application, the use of the terms "first exon" and
"second exon" are not limited to the actual first exon and the
actual second exon of a given nucleic acid sequence, unless such
terms are explicitly used in that manner. Rather, those terms are
used to differentiate between any adjoining exons. Thus, one may
want to distinguish between two different splice variants of
Sequence A, one of which comprises Exons 2 and 3 of Sequence A and
one of which comprises Exons 2 and 5 of Sequence A. In the
embodiments discussed herein, Exon 2 of Sequence A would be the
"first exon" and Exons 3 and 5 of Sequence A would be two "second
exons."
[0440] In certain embodiments, a method is provided for detecting
the presence or absence of (or quantitating) at least one splice
variant of at least one given nucleic acid sequence in a sample,
wherein the at least one splice variant comprises a sequence that
corresponds to a juncture between a first exon and one of a
plurality of second exons. In certain embodiments, the method
comprises forming a ligation reaction composition comprising the
sample and a ligation probe set for each given nucleic acid
sequence. In certain embodiments, the ligation probe set for each
given nucleic acid sequence comprises: (1) a first probe that
comprises (a) a target-specific portion that is complementary to a
portion of the given nucleic acid sequence that corresponds to a
portion of the first exon and (b) a 5' primer-specific portion, and
(2) at least one a second probe that comprises: (a) a
splice-specific portion that is complementary to a portion of the
given nucleic acid sequence that corresponds to a portion of one of
the plurality of second exons; (b) a 3' primer-specific portion;
and (c) an addressable portion located between the splice-specific
portion and the 3' primer-specific portion, wherein the addressable
portion is specific for the one of the plurality of second
exons.
[0441] If the sample comprises a sequence corresponding to the
juncture of the first exon and the one of the plurality of second
exons, the first probe and the second probe, which comprises the
splice-specific portion that is complementary to the portion of the
given nucleic acid sequence that corresponds to the portion of the
one of the plurality of second exons, hybridize to the given
nucleic acid sequence adjacent to one another so that they are
suitable for ligation together.
[0442] In certain embodiments, one forms a test composition by
subjecting the ligation reaction composition to at least one cycle
of ligation, wherein adjacently hybridized probes are ligated
together to form a ligation product comprising the 5'
primer-specific portion, the target-specific portion, the
splice-specific portion, the addressable portion, and the 3'
primer-specific portion.
[0443] In certain embodiments, one forms an amplification reaction
composition comprising: (1) the test composition; (2) a polymerase;
(3) at least one labeled probe that (a) comprises the sequence of
the addressable portion that is specific for the one of the
plurality of second exons, or (b) comprises a sequence that is
complementary to the sequence of the addressable portion that is
specific for the one of the plurality of second exons, wherein the
at least one labeled probe has a first detectable signal value when
it is not hybridized to a complementary sequence; and (4) a primer
set comprising at least one first primer comprising the sequence of
the 5' primer-specific portion of the ligation product and at least
one second primer comprising a sequence complementary to the
sequence of the 3' primer-specific portion of the ligation
product.
[0444] In certain embodiments, one subjects the amplification
reaction composition to an amplification reaction. In certain
embodiments, one detects a second detectable signal value from the
at least one labeled probe at least one of during and after the
amplification reaction. In certain embodiments, a threshold
difference between the first detectable signal value from the at
least one labeled probe and the second detectable signal value from
the at least one labeled probe indicates the presence of the at
least one splice variant of the at least one given target nucleic
acid sequence. In such embodiments, no threshold difference between
the first detectable signal value from the at least one labeled
probe and the second detectable signal value from the at least one
labeled probe indicates the absence of the at least one splice
variant of the at least one given target nucleic acid sequence.
[0445] In certain embodiments, one may desire to detect the
presence or absence of (or to quantitate) more than one splice
variant of a given nucleic acid sequence. In certain such
embodiments, one may employ multiple second probes each comprising
a different splice-specific sequence and a different addressable
portion for each different second exon sought to be detected or
quantitated. In such embodiments, one may employ different labeled
probes that each comprise the sequence of one of the different
addressable portions, or comprise a sequence that is complementary
to the sequence of one of the different addressable portions. In
certain such embodiments, each of the different labeled probes may
also comprise a different signal moiety that each provide a
detectably different signal. If two different labeled probes have a
detectable signal value of zero, one would not be able to detect
different signals at that value. When a signal value is greater
than zero, however, one would be able to detect different signals
from the two different labeled probes comprising different signal
moieties.
[0446] In certain embodiments, the quantity of the at least one
splice variant in the at least one target nucleic acid sequence is
determined.
[0447] In certain embodiments, a method is provided for detecting
the presence or absence of (or quantitating) at least one splice
variant of at least one given nucleic acid sequence in a sample
comprising forming a ligation reaction composition comprising the
sample and a ligation probe set for each given nucleic acid
sequence. In certain embodiments, the ligation probe set for each
given nucleic acid sequence comprises: (1) at least one first probe
that comprises: (a) a 5' primer-specific portion, (b) a
splice-specific portion that is complementary to a portion of the
given nucleic acid sequence that corresponds to a portion of one of
the plurality of second exons, and (c) an addressable portion
located between the splice-specific portion and the 5'
primer-specific portion; and (2) a second probe that comprises: (a)
a target-specific portion that is complementary to a portion of the
given nucleic acid sequence that corresponds to the first exon and
(b) a 5' primer-specific portion.
[0448] If the target nucleic acid comprises a sequence
corresponding to the juncture of the first and second exon, the
first and second probe of the probe set hybridize to the given
nucleic acid sequence adjacent to one another so that they are
suitable for ligation together.
[0449] In certain embodiments, one forms a test composition by
subjecting the ligation reaction composition to at least one cycle
of ligation, wherein adjacently hybridized probes are ligated
together to form a ligation product comprising the 5'
primer-specific portion, the addressable portion, the
splice-specific portion, the target-specific portion, and the 3'
primer-specific portion.
[0450] In certain embodiments, one forms an amplification reaction
composition comprising: (1) the test composition; (2) a polymerase;
(3) at least one labeled probe that (a) comprises the sequence of
the addressable portion that is specific for the one of the
plurality of second exons, or (b) comprises a sequence that is
complementary to the sequence of the addressable portion that is
specific for the one of the plurality of second exons, wherein the
labeled probe has a first detectable signal value when it is not
hybridized to a complementary sequence; and (4) a primer set
comprising at least one first primer comprising the sequence of the
5' primer-specific portion of the ligation product and at least one
second primer comprising a sequence complementary to the sequence
of the 3' primer-specific portion of the ligation product.
[0451] In certain embodiments, one subjects the amplification
reaction composition to an amplification reaction. In certain
embodiments, one detects a second detectable signal value from the
at least one labeled probe at least one of during and after the
amplification reaction. In certain embodiments, a threshold
difference between the first detectable signal value from the at
least one labeled probe and the second detectable signal value from
the at least one labeled probe indicates the presence of the at
least one splice variant of the at least one given target nucleic
acid sequence. In such embodiments, no threshold difference between
the first detectable signal value from the at least one labeled
probe and the second detectable signal value from the at least one
labeled probe indicates the absence of the at least one splice
variant of the at least one given target nucleic acid sequence.
[0452] In certain embodiments, one may desire to detect the
presence or absence of (or to quantitate) more than one splice
variant of a given nucleic acid sequence. In certain such
embodiments, one may employ multiple first probes each comprising a
different splice-specific sequence and a different addressable
portion for each different second exon sought to be detected or
quantitated. In such embodiments, one may employ different labeled
probes that each comprise the sequence of one of the different
addressable portions, or comprise a sequence that is complementary
to the sequence of one of the different addressable portions. In
certain such embodiments, each of the different labeled probes may
also comprise a different signal moiety that each provide a
detectably different signal. If two different labeled probes have a
detectable signal value of zero, one would not be able to detect
different signals at that value. When a signal value is greater
than zero, however, one would be able to detect different signals
from the two different labeled probes comprising different signal
moieties.
[0453] In certain embodiments, the quantity of the at least one
splice variant in the at least one target nucleic acid sequence is
determined.
[0454] In certain embodiments, the at least one target nucleic acid
sequence comprises at least one complementary DNA (cDNA) generated
from an RNA. In certain embodiments, the at least one cDNA is
generated from at least one messenger RNA (mRNA). In certain
embodiments, the at least one target nucleic acid sequence
comprises at least one RNA target sequence present in the
sample.
[0455] In various embodiments for detecting the presence or absence
of (or quantitating) splice variants, one can use any of the
various embodiments employing addressable portions disclosed in
this application. In various embodiments, either the first probe or
the second probe or both may comprise splice specific portions for
detecting the presence or absence of (or to quantitate) different
splice variants. Also, in certain embodiments, if one desires to
identify and quantify but one splice variant, they can use only one
probe that comprises a splice-specific portion (specific to that
one splice variant).
[0456] Certain nonlimiting embodiments for identifying splice
variants are illustrated by FIG. 11. With such embodiments, one
detects the presence or absence of (or quantitates) two different
splice variants. One splice variant includes exon 1, exon 2, and
exon 4. The other splice variant includes exon 1, exon 3, and exon
4.
[0457] In the depicted embodiments, one employs a ligation probe
set that comprises a first probe (Probe EX1) that comprises a 5'
primer-specific portion (PSPa) and a target-specific portion that
corresponds to at least a portion of exon 1 (TSP). The probe set
further comprises two different second probes (Probe EX2 and Probe
EX3). Probe EX2 comprises a 3' primer-specific portion PSPb, an
addressable portion ASP1, and a splice-specific portion (SSP-EX2)
that corresponds to at least a portion of exon 2. Probe EX3
comprises a 3' primer-specific portion PSPb, an addressable portion
ASP2, and a splice-specific portion (SSP-EX3) that corresponds to
at least a portion of exon 3.
[0458] In the embodiments depicted in FIG. 11, if a splice variant
is present, the first and second probes corresponding to that
splice variant hybridize adjacent to one another and are ligated
together to form a ligation product. In the embodiments depicted in
FIG. 11, two labeled probes are employed. One labeled probe (LBP1)
comprises the sequence of addressable portion (ASP1) and
fluorescent moiety (F1). The other labeled probe (LBP2) comprises
the sequence of addressable portion (ASP2) and fluorescent moiety
(F2). In the embodiments depicted in FIG. 11, the complements of
the ligation products are generated using primers (Pb).
[0459] If the complement of a particular ligation product
corresponding to a particular splice variant is present, the
labeled probe corresponding to that splice variant will hybridize
to the corresponding complement of the addressable portion for that
splice variant. The labeled probes that are hybridized to such
complements of the ligation products will be cleaved during
extension with primer (Pa), which results in a threshold difference
in detectable signal value.
[0460] Thus, in FIG. 11, both labeled probes (LBP1) and (LBP2)
hybridize to complementary addressable portions (ASP1') and
(ASP2'), respectively, and are cleaved during extension with primer
(Pa). Fluorescent moieties F1 and F2 are no longer quenched and one
may detect a threshold difference in signal value for both labeled
probes LBP1 and LBP2. With such results, one concludes that the
sample comprises both splice variants.
[0461] In certain embodiments, when the gene expression levels for
several target nucleic acid sequences for a sample are known, a
gene expression profile for that sample can be compiled and
compared with other samples. For example, but without limitation,
samples may be obtained from two aliquots of cells from the same
cell population, wherein one aliquot was grown in the presence of a
chemical compound or drug and the other aliquot was not. By
comparing the gene expression profiles for cells grown in the
presence of drug with those grown in the absence of drug, one may
be able to determine the drug effect on the expression of
particular target genes.
[0462] In certain embodiments, one may quantitate the amount of
mRNA encoding a particular protein within a cell to determine a
particular condition of an individual. For example, the protein
insulin, among other things, regulates the level of blood glucose.
The amount of insulin that is produced in an individual can
determine whether that individual is healthy or not. Insulin
deficiency results in diabetes, a potentially fatal disease.
Diabetic individuals typically have low levels of insulin mRNA and
thus will produce low levels of insulin, while healthy individuals
typically have higher levels of insulin mRNA and produce normal
levels of insulin.
[0463] Another human disease typically due to abnormally low gene
expression is Tay-Sachs disease. Children with Tay-Sachs disease
lack, or are deficient in, a protein(s) required for sphingolipid
breakdown. These children, therefore, have abnormally high levels
of sphingolipids causing nervous system disorders that may result
in death.
[0464] In certain embodiments, it is useful to identify and detect
additional genetic-based diseases/disorders that are caused by gene
over- or under-expression. Additionally, cancer and certain other
known diseases or disorders may be detected by, or are related to,
the over- or under-expression of certain genes. For example, men
with prostate cancer typically produce abnormally high levels of
prostate specific antigen (PSA); and proteins from tumor suppressor
genes are believed to play critical roles in the development of
many types of cancer.
[0465] Using nucleic acid technology, in certain embodiments,
minute amounts of a biological sample can typically provide
sufficient material to simultaneously test for many different
diseases, disorders, and predispositions. Additionally, there are
numerous other situations where it would be desirable to quantify
the amount of specific target nucleic acids, in certain instances
mRNA, in a cell or organism, a process sometimes referred to as
"gene expression profiling." When the quantity of a particular
target nucleic acid within, for example, a specific cell-type or
tissue, or an individual is known, in certain cases one may start
to compile a gene expression profile for that cell-type, tissue, or
individual. Comparing an individual's gene expression profile with
known expression profiles may allow the diagnosis of certain
diseases or disorders in certain cases. Predispositions or the
susceptibility to developing certain diseases or disorders in the
future may also be identified by evaluating gene expression
profiles in certain cases. Gene expression profile analysis may
also be useful for, among other things, genetic counseling and
forensic testing in certain cases.
Certain Exemplary Kits
[0466] In certain embodiments, the invention also provides kits
designed to expedite performing certain methods. In certain
embodiments, kits serve to expedite the performance of the methods
of interest by assembling two or more components used in carrying
out the methods. In certain embodiments, kits may contain
components in pre-measured unit amounts to minimize the need for
measurements by end-users. In certain embodiments, kits may include
instructions for performing one or more methods of the invention.
In certain embodiments, the kit components are optimized to operate
in conjunction with one another.
[0467] In certain embodiments, a kit for detecting at least one
target nucleic acid sequence in a sample is provided. In certain
embodiments, a kit comprises: a ligation probe set for each target
sequence, the probe set comprising (a) at least one first probe,
comprising a target-specific portion and a 5' primer-specific
portion, wherein the 5' primer-specific portion comprises a
sequence, and (b) at least one second probe, comprising a
target-specific portion and a 3' primer-specific portion, wherein
the 3' primer-specific portion comprises a sequence. The probes in
each set are suitable for ligation together when hybridized
adjacent to one another on a complementary target sequence. One
probe in each probe set further comprises an addressable portion
located between the primer-specific portion and the target-specific
portion, wherein the addressable portion comprises a sequence. In
certain embodiments, the kit further comprises a labeled probe
comprising the sequence of the addressable portion or comprising a
sequence complementary to the sequence of the addressable
portion.
[0468] In certain embodiments, the kit comprises a labeled probe
that has a first detectable signal value when it is not hybridized
to a complementary sequence and a second detectable signal value of
the labeled probe can be detected at least one of during and after
an amplification reaction. In certain embodiments, a threshold
difference between the first detectable signal value and the second
detectable signal value indicates the presence of the target
nucleic acid sequence, and no threshold difference between the
first detectable signal value and the second detectable signal
value indicates the absence of the target nucleic acid
sequence.
[0469] In certain embodiments, a kit for detecting at least one
target nucleic acid sequence in a sample is provided. In certain
embodiments, a kit comprises: a ligation probe set for each target
sequence, the probe set comprising:
[0470] (a) at least one first probe, comprising a target-specific
portion, a 5' primer-specific portion, wherein the 5'
primer-specific portion comprises a sequence, and a first
addressable portion located between the 5' primer-specific portion
and the target-specific portion, wherein the first addressable
portion comprises a sequence; and
[0471] (b) at least one second probe, comprising a target-specific
portion, a 3' primer-specific portion, wherein the 3'
primer-specific portion comprises a sequence, and a second
addressable portion located between the 3' primer-specific portion
and the target-specific portion, wherein the second addressable
portion comprises a sequence.
[0472] The probes in each set are suitable for ligation together
when hybridized adjacent to one another on a complementary target
sequence.
[0473] In certain embodiments, the kit further comprises:
[0474] a first labeled probe comprising the addressable sequence of
the first addressable portion or comprising a sequence
complementary to the sequence of the first addressable portion;
and
[0475] a second labeled probe comprising the sequence of the second
addressable portion or comprising a sequence complementary to the
sequence of the second addressable portion.
[0476] In certain embodiments, the kit comprises:
[0477] a first labeled probe that has a first detectable signal
value when it is not hybridized to a complementary sequence, and a
second detectable signal value of the first labeled probe can be
detected at least one of during and after an amplification
reaction; and
[0478] a second labeled probe that has a first detectable signal
value when it is not hybridized to a complementary sequence, and a
second detectable signal value of the second labeled probe can be
detected at least one of during and after an amplification
reaction.
[0479] In certain embodiments, a threshold difference between the
first detectable signal value and the second detectable signal
value of the first labeled probe and a threshold difference between
the first detectable signal value and the second detectable signal
value of the second labeled probe indicates the presence of the
target nucleic acid sequence; and no threshold difference between
the first detectable signal value and the second detectable signal
value of the first labeled probe and no threshold difference
between the first detectable signal value and the second detectable
signal value of the second labeled probe indicates the absence of
the target nucleic acid sequence.
[0480] In certain embodiments, kits further comprise primers. In
certain embodiments, kits further comprise at least one primer set
comprising (i) at least one first primer comprising the sequence of
the 5' primer-specific portion of the at least one first probe, and
(ii) at least one second primer comprising a sequence complementary
to the sequence of the 3' primer-specific portion of the at least
one second probe.
[0481] In certain embodiments, kits comprise one or more additional
components, including, without limitation, at least one of: at
least one polymerase, at least one transcriptase, at least one
ligation agent, oligonucleotide triphosphates, nucleotide analogs,
reaction buffers, salts, ions, and stabilizers. In certain
embodiments, kits comprise one or more reagents for purifying the
ligation products, including, without limitation, at least one of
dialysis membranes, chromatographic compounds, supports, and
oligonucleotides.
[0482] The following examples are intended for illustration
purposes only, and should not be construed as limiting the scope of
the invention in any way.
EXAMPLE 1
[0483] The following Table 1 is referred to throughout the
following Example 1: TABLE-US-00009 TABLE 1 Probe Set For Assay 1
First Probe-CYC (1) 5' TTGCCTGCTCGACTTAGATCAAAGGAGACGCGG (SEQ ID
NO:1) CTGCTTTCAGCCTCAT3' First Probe-RNA (1) 5'
TTGCCTGCTCGACTTAGAGGGTCACAGTAGGTG (SEQ ID NO:2) GTGCTTTCAGCCTCAC3'
Second Probe (1) 5' P-GGGGATAGTGGCTGCATCACTGGATAGCGAC (SEQ ID NO:3)
GT3' Probe Set For Assay 2 First Probe-CYC (2) 5'
TTGCCTGCTCGACTTAGATCAAAGGAGACGCGG (SEQ ID NO:4) CAGTGGTTTTCCAACG3'
First Probe-RNA (2) 5' TTGCCTGCTCGACTTAGAGGGTCACAGTAGGTG (SEQ ID
NO:5) GACAGTGGTTTTCCAACA3' Second Probe (2) 5'
P-TGAACACACCGGGTATCACTGGATAGCGACG (SEQ ID NO:6) T3' PCR Primers
Forward Primer 5' TTGCCTGCTCGACTTAGA3' (SEQ ID NO:7) Reverse Primer
5' ACGTCGCTATCCAGTGAT3' (SEQ ID NO:8) TaqMan .RTM. Probe Sequences
CYCLOPHILIN: 5' CCGCGTCTCCTTTGA3'-MGBNFQ (labeled (SEQ ID NO:9)
with VIC) RNASE P: 5' CCACCTACTGTGACCC-MGBNFQ (labeled (SEQ ID
NO:10) with FAM) (MGB = minor groove binder and NFQ =
nonfluorescent quencher, which are both included on TaqMan .RTM.
probes available from Applied Biosystems, Foster City, CA)
Ligation Probes
[0484] In these examples, a ligation probe set for each target
nucleic acid sequence comprised first and second ligation probes
designed to adjacently hybridize to the appropriate target nucleic
acid sequence. These adjacently hybridized probes were, under
appropriate conditions, ligated to form a ligation product.
[0485] This illustrative embodiment used two different ligation
probe sets for detecting two biallelic loci. Three different
samples of genomic DNA were tested. Table 1 shows the two probe
sets that were used. Table 1 also shows the two Taqman.RTM. probes
that were used in these examples. The ligation probes included a
target-specific portion, shown in italic letters in Table 1. As
shown by bold letters in Table 1, the ligation probes also included
universal primer-specific portion sequences (18 nucleotides at the
5' end of the first listed probes in each probe set and 18
nucleotides at the 3' end of the second listed probe in each probe
set). As shown by underlined letters in Table 1, the first two
probes in each ligation probe set also included the same two
different addressable portions that are complementary to the
different sequences of the two TaqMan.RTM. probes.
[0486] The ligation probes were synthesized using conventional
automated DNA synthesis chemistry.
Exemplary Ligation Reactions (Oligonucleotide Ligation Assay
"OLA")
[0487] Ligation reactions were performed in separate reaction
volumes with each of the two different ligation probe sets shown in
Table 1. The concentrations of the component materials prior to
forming the ligation reaction composition are shown below in Table
2. TABLE-US-00010 TABLE 2 Component Materials Concentration Thermus
aquaticus (Taq) DNA Ligase 40 units/.mu.L 10.times. OLA Buffer 2
Mixture: pH 7.5 @ 50.degree. C Sodium
(3-[N-Morpholino]propanesulfonate) 200 mM (MOPS) 1% (w/v) Triton
X-100 10 mM Dithiothreitol (DTT) 70 mM Magnesium Chloride 2.5 mM
.beta.-Nicotinamide Adenine Dinucleotide (NAD) 300 ng/.mu.L poly
(dIC) Genomic DNA (DNase I digested) 100 ng/.mu.L OLA Probe Set:
First probe - CYC 5 nM First probe - RNA 5 nM Second probe 10 nM
Nuclease Free Water
[0488] Taq Ligase was diluted to 2.0 units/.mu.L in the 1.times.OLA
Buffer 2 Mixture. The volume of Taq Ligase was sufficient to form
the following stock of OLA reagent. The common working stock of OLA
reagent was formed as specified in the following Table 3. The
following volumes of components are based on a single 10 .mu.L OLA
reaction volume. Depending on the number of OLA reactions that are
desired, one can form the particular volume of stock OLA reagent.
TABLE-US-00011 TABLE 3 X number of 1.times. OLA Reaction OLA
Reactions = OLA Reaction Component Volume (.mu.L) Total Volume
(.mu.L) 10.times. OLA Buffer 2 Mixture 1.0 Nuclease Free Water 5.4
Taq DNA Ligase (2.0 units/.mu.L) 0.6
[0489] For each reaction with one of the two probe sets of Table 1,
7 .mu.L of the stock OLA reaction composition of Table 3 was
combined with 2.0 .mu.L of the given probe set using the OLA probe
set concentrations in Table 2, and 1.0 .mu.L genomic DNA using the
genomic DNA concentration in Table 2. The final assay component
concentrations for the OLA reactions are set forth in Table 4
below. TABLE-US-00012 TABLE 4 OLA Component Concentration Thermus
aquaticus (Taq) DNA Ligase 0.12 units/.mu.L Sodium
(3-[N-Morpholino]propanesulfonate) (MOPS) 20 mM Triton X-100 0.1%
(w/v) Dithiothreitol (DTT) 1 mM Magnesium Chloride 7 mM
.beta.-Nicotinamide Adenine Dinucleotide (NAD) 0.25 mM poly (dIC)
30 ng/.mu.L Genomic DNA (DNase I digested) 10 ng/.mu.L OLA Probe
Set: First probe - CYC 1 nM First probe - RNA 1 nM Second probe 2
nM
[0490] For these examples, each of the two different probe sets in
Table 1 were included in different reactions for three different
genomic DNA samples. Thus, there were six different reactions
volumes, each with a different combination of probe set and genomic
DNA sample. The three genomic DNA samples were obtained from
Coriell Cell Repositories (Camden, N.J.) and were designated as
follows: NA17103, NA17212, and NA17247. Prior to combining each of
the genomic DNA samples in the ligation reaction composition, the
genomic DNA was fragmented by DNase I digestion.
[0491] The ligation reaction volumes were subjected to the reaction
conditions shown in Table 5 below using an ABI 9700 Thermal Cycler
(Applied Biosystems, Foster City, Calif.). The reaction volumes
were kept on ice until they were transferred to the thermal cycler.
The OLA reaction tubes were transferred from ice to the thermal
cycler when the thermal cycler reached the first hold temperature
of 90.degree. C., TABLE-US-00013 TABLE 5 Step Step Type Temperature
(.degree. C.) Time 1 Hold 90 3 minutes 2 14 cycles 90 5 seconds 54
4 minutes 3 Hold 99 10 minutes 4 Hold 4 .infin.
C. Exemplary Amplification Reactions
[0492] A 10.times. primer/labeled probe composition was formed by
combining the forward and reverse primers of Table 1 and the two
TaqMan.RTM. probes labeled with VIC and FAM so that they were in
final concentrations as follows: TABLE-US-00014 Forward Primer 9
.mu.M Reverse Primer 9 .mu.M TaqMan .RTM. [VIC] 2 .mu.M TaqMan
.RTM. [FAM] 2 .mu.M.
[0493] Each PCR reaction volume included the following
components:
[0494] 12.5 .mu.L--2.times. TaqMan.RTM. Universal PCR Mix (Applied
Biosystems, Foster City, Calif.). The PCR Mix includes PCR buffer,
dNTPs, MgCl.sub.2, uracil-N-glucosidase, d AmpliTaq Gold.RTM. DNA
polymerase (Applied Biosystems, Foster City, Calif.);
[0495] 2.5 .mu.L--10.times.primer/labeled probe composition
discussed above;
[0496] 8 .mu.L--water; and
[0497] 2 .mu.L--OLA reaction volume after the ligation reaction
from Example 1B above.
[0498] Thus, the total PCR reaction volume for each PCR reaction
was 25 .mu.L. Each PCR reaction volume was subjected to the
reaction conditions shown in Table 6 below using an ABI 7700
Thermal Cycler (Applied Biosystems, Foster City, Calif.).
TABLE-US-00015 TABLE 6 Step Step Type Temperature (.degree. C.)
Time 1 Hold 50 2 minutes 2 Hold 95 10 minutes 3 40 cycles 92 15
seconds 60 1 minute
[0499] In Assay 1, the signal from the TaqMan.RTM. probe labeled
with FAM indicated that the genomic DNA NA17103 was homozygous for
the allele corresponding to the First Probe-RNA (1), which has a
"C" as the nucleotide at the pivotal complement. Thus, the genomic
DNA NA17103 correctly was determined to be homozygous at the locus
analyzed in Assay 1 with "G" at the pivotal nucleotide.
[0500] In Assay 1, the signal from the TaqMan.RTM. probe labeled
with VIC indicated that the genomic DNA NA17212 was homozygous for
the allele corresponding to the First Probe-CYC (1), which has a
"T" as the nucleotide at the pivotal complement. Thus, the genomic
DNA NA17212 correctly was determined to be homozygous at the locus
analyzed in Assay 1 with "A" at the pivotal nucleotide.
[0501] In Assay 1, the signals from the TaqMan.RTM. probes labeled
with FAM and VIC indicated that the genomic DNA NA17247 was
heterozygous for the alleles corresponding to both the First
Probe-CYC (1) and the First Probe-RNA (1). Thus, the genomic DNA
NAl 7247 correctly was determined to be heterozygous at the locus
analyzed in Assay 1 with "G" and "A" at the pivotal
nucleotides.
[0502] In Assay 2, the signal from the TaqMan.RTM. probe labeled
with FAM indicated that the genomic DNA NA17103 was homozygous for
the allele corresponding to the First Probe-RNA (2), which has an
"A" as the nucleotide at the pivotal complement. Thus, the genomic
DNA NA17103 correctly was determined to be homozygous at the locus
analyzed in Assay 2 with "T" at the pivotal nucleotide.
[0503] In Assay 2, the signals from the TaqMan.RTM. probes labeled
with FAM and VIC indicated that the genomic DNA NA17212 was
heterozygous for the alleles corresponding to both the First
Probe-CYC (2) and the First Probe-RNA (2). Thus, the genomic DNA
NA17212 correctly was determined to be heterozygous at the locus
analyzed in Assay 2 with "T" and "C" at the pivotal
nucleotides.
[0504] In Assay 2, the signal from the TaqMan.RTM. probe labeled
with VIC indicated that the genomic DNA NA17247 was homozygous for
the allele corresponding to the First Probe-CYC (2), which has a
"G" as the nucleotide at the pivotal complement. Thus, the genomic
DNA NA17247 correctly was determined to be homozygous at the locus
analyzed in Assay 2 with "C" at the pivotal nucleotide.
[0505] Other assays that employed the same concentrations of
materials and same thermal cycling conditions as assays 1 and 2,
but that employed different probe sets to detect the presence or
absence of two alleles at different loci, were also performed. Some
of those assays resulted in false negative signal. It was concluded
that the second probes of those probe sets were defective, which
inhibited appropriate ligation.
EXAMPLE 2
[0506] The following Table 7 is referred to throughout the
following Example 2: TABLE-US-00016 TABLE 7 Probe Set For Assay 3
First Probe-CYC (3) 5' TTGCCTGCTCGACTTAGATCCGCGTCTCCTTTG (SEQ ID
NO:11) ATTTGTACCACTCTTTTTCGGTCAAAAACGAGATCA A3' First Probe-RNA (3)
5' TTGCCTGCTCGACTTAGATCCACCTACTGTGAC (SEQ ID NO:12)
CCTTTGTACCACTCTTTTTCGGTCAAAAACGAGATC AG3' Second Probe (3) 5'
P-TACCAGCTTAACACATAGCATCACTGGATAG (SEQ ID NO:13) CGACGT3' Probe Set
For Assay 4 First Probe-CYC (4) 5'
TTGCCTGCTCGACTTAGATCCGCGTCTCCTTTG (SEQ ID NO:14)
ATTTGTACCACTCTTTTTCCAATAACTAAAGGTACA ACAT3' First Probe-RNA (4) 5'
TTGCCTGCTCGACTTAGATCCACCTACTGTGAC (SEQ ID NO:15)
CCTTTGTACCACTCTTTTTCAATAACTAAAGGTACA ACAC3' Second Probe (4) 5'
P-GGCATAATAATCTCCAAAGATCACTGGATAG (SEQ ID NO:16) CGACGT3' Probe Set
For Assay 5 First Probe-CYC (5) 5'
TTGCCTGCTCGACTTAGATCCGCGTCTCCTTTG (SEQ ID NO:17)
ATTTGTACCACTCTTTTTCCAGTGGTTTTCCAACG 3' First Probe-RNA (5) 5'
TTGCCTGCTCGACTTAGATCCACCTACTGTGAC (SEQ ID NO:18)
CCTTTGTACCACTCTTTTTCACAGTGGTTTTCCAAC A3' Second Probe (5) 5'
P-TGAACACACCGGGTATCACTGGATAGCGACG (SEQ ID NO:19) T3' PCR Primers
Forward Primer 5' TTGCCTGCTCGACTTAGA3' (SEQ ID NO:20) Reverse
Primer 5' ACGTCGCTATCCAGTGAT3' (SEQ ID NO:21) TaqMan .RTM. Probe
Sequences CYCLOPHILIN: 5' CCGCGTCTCCTTTGA3'-MGBNFQ (labeled (SEQ ID
NO:22) with VIC) RNASE P: 5' CCACCTACTGTGACCC-MGBNFQ (labeled (SEQ
ID NO:23) with FAM) (MGB = minor groove binder and NFQ =
nonfluorescent quencher, which are both included on TaqMan .RTM.
probes available from Applied Biosystems, Foster City, CA)
Ligation Probes
[0507] In these examples, a ligation probe set for each target
nucleic acid sequence comprised first and second ligation probes
designed to adjacently hybridize to the appropriate target nucleic
acid sequence. These adjacently hybridized probes were, under
appropriate conditions, ligated to form a ligation product.
[0508] This illustrative embodiment used three different ligation
probe sets for detecting three biallelic loci. Three different
samples of genomic DNA were tested. Table 7 shows the three probe
sets that were used. Table 7 also shows the two Taqman.RTM. probes
that were used in these examples. The ligation probes included a
target-specific portion, shown in italic letters in Table 7. As
shown by bold letters in Table 7, the ligation probes also included
universal primer-specific portion sequences (18 nucleotides at the
5' end of the first listed probes in each probe set and 18
nucleotides at the 3' end of the second listed probe in each probe
set). As shown by underlined letters in Table 7, the first two
probes in each ligation probe set also included the same two
different addressable portions that have the same sequences as the
two different sequences of the two TaqMan.RTM. probes.
[0509] The ligation probes were synthesized using conventional
automated DNA synthesis chemistry.
Exemplary Ligation Reactions (Oligonucleotide Ligation Assay "OLA")
and Amplification Reactions
[0510] Each of the three different ligation probe sets shown in
Table 7 were used in separate reaction volumes. In each reaction
volume both ligation and amplification reactions were performed.
For this example, each of the three different probe sets in Table 7
were included in different reactions for three different genomic
DNA samples. Thus, there were nine different reaction volumes, each
with a different probe set and a different genomic DNA sample.
Also, one set of such reactions included dithiothreitol (DDT) and
another set did not include DDT. Thus, there were 18 different
reaction volumes. The reactions were replicated.
[0511] The three genomic DNA samples were obtained from Coriell
Cell Repositories (Camden, N.J.) and were designated as follows:
NA17103, NA17212, and NA17247. Prior to combining each of the
genomic DNA samples in the ligation reaction composition, the
genomic DNA was fragmented as follows. The genomic DNA was diluted
in 1.times. TE (10 mM Tris, pH 8, 1 mM Sodium EDTA, Sigma Pt. No.
T-9285) solution to a concentration of approximately 300 ng/.mu.l.
The diluted genomic DNA solution was dispensed into PCR tubes, at a
volume of 150 .mu.l per tube.
[0512] The tubes of diluted genomic DNA solution were then
incubated at 4.degree. C. for 1 minute, 99.degree. C. for 15
minutes, then held at 4.degree. C. for an indefinite period until
the fragmented genomic DNA was needed. Samples of genomic DNA that
were divided into multiple tubes were then pooled into one tube
again.
[0513] The stock concentrations and final concentrations of the
component materials for each of the reactions are shown below in
Table 8. The reaction volumes were 25 .mu.l. TABLE-US-00017 TABLE 8
All of the components other than the primer/labeled probe
composition and gDNA were included in the master mix, and the
primer/labeled probe composition and gDNA were added later. WITH
DTT 1.times. 20.times. component stock concentration .mu.l actual
C.sub.f desired C.sub.f: .mu.l Taq ligase 4 units/.mu.l 0.75 0.12
units/.mu.l 0.12 units/.mu.l 15 OLA Probe Set 1 First Probe-CYC 25
nM NA 1 nM 1 nM NA First Probe-RNA 25 nM 1 nM 1 nM Second Probe 50
nM 2 nM 2 nM TaqMan Universal Mix 2.times. 12.5 1.times. 1.times.
250 primer/labeled probe 10.times. 2.5 1.times. 1.times. 50 Forward
primer 9 .mu.M NA 0.9 .mu.M 0.9 .mu.M NA Reverse primer 9 .mu.M 0.9
.mu.M 0.9 .mu.M TaqMan [VIC] probe 2 .mu.M 0.2 .mu.M 0.2 .mu.M
TaqMan [FAM] probe 2 .mu.M 0.2 .mu.M 0.2 .mu.M DTT 100 mM 0.25 1 mM
1 mM 5 NAD 2.5 mM 2.5 0.25 mM 0.25 mM 50 water 4.2 84 gDNA use 100
ng gDNA 1.3 NA TOTAL 25 454 WITHOUT DTT 1.times. 20.times.
component stock concentration .mu.l actual C.sub.f desired C.sub.f:
.mu.l Tag ligase 4 units/.mu.l 0.75 0.12 units/.mu.l 0.12
units/.mu.l 15 OLA Probe Set 1 NA First Probe-CYC 25 nM NA 1 nM 1
nM NA First Probe-RNA 25 nM 1 nM 1 nM Second Probe 50 nM 2 nM 2 nM
TaqMan Universal Mix 2.times. 12.5 1.times. 1.times. 250
primer/labeled probe 10.times. 2.5 1.times. 1.times. 50 Forward
primer 9 .mu.M NA 0.9 .mu.M 0.9 .mu.M NA Reverse primer 9 .mu.M 0.9
.mu.M 0.9 .mu.M TaqMan [VIC] probe 2 .mu.M 0.2 .mu.M 0.2 .mu.M
TaqMan [FAM] probe 2 .mu.M 0.2 .mu.M 0.2 .mu.M NAD 2.5 mM 2.5 0.25
mM 0.25 mM 50 water 4.45 89 gDNA use 100 ng gDNA 1.3 NA TOTAL 25
454 VIC probe is the Cyclophilin TaqMan .RTM. Probe FAM probe is
the RNASE P TaqMan .RTM. Probe NAD is nicotinamide adenine
dinucleotide This application claims the benefit under 35 U.S.C.
.sctn. 119(e) of prior U.S. Provisional Patent Application No.
60/412,189, filed Sep. 19, 2002, which is incorporated herein by
reference. TaqMan .RTM. Universal Mix is the 2.times. TaqMan .RTM.
Universal PCR Mix (Applied Biosystems, Foster City, CA). The PCR
Mix includes PCR buffer, dNTPs, MgCl.sub.2, uracil-N-glucosidase,
and AmpliTaq Gold .RTM. DNA polymerase (Applied Biosystems, Foster
City, CA)
[0514] Each reaction volume was subjected to the following thermal
cycling conditions set forth in Table 9 below. TABLE-US-00018 TABLE
9 Thermal cycling conditions: Step Step Type Temperature Time 1
Hold 50 2 minutes 2 Hold 90 3 minutes 3 14 cycles 90 5 seconds 54 4
minutes 4 Hold 95 10 minutes 5 40 cycles 92 15 seconds 60 1
minute
[0515] In Assay 3, the signal from the TaqMan.RTM. probe labeled
with VIC indicated that the genomic DNA NA17103 was homozygous for
the allele corresponding to the First Probe-CYC (3), which has an
"A" as the nucleotide at the pivotal complement. Thus, the genomic
DNA NA17103 correctly was determined to be homozygous at the locus
analyzed in Assay 3 with "T" at the pivotal nucleotide.
[0516] In Assay 3, the signals from the TaqMan.RTM. probes labeled
with FAM and VIC indicated that the genomic DNA NA17212 was
heterozygous for the alleles corresponding to both the First
Probe-CYC (3) and the First Probe-RNA (3). Thus, the genomic DNA
NA17212 correctly was determined to be heterozygous at the locus
analyzed in Assay 3 with "T" and "C" at the pivotal
nucleotides.
[0517] In Assay 3, the signal from the TaqMan.RTM. probe labeled
with FAM indicated that the genomic DNA NA17247 was homozygous for
the allele corresponding to the First Probe-RNA (3), which has a
"G" as the nucleotide at the pivotal complement. Thus, the genomic
DNA NA17247 correctly was determined to be homozygous at the locus
analyzed in Assay 2 with "C" at the pivotal nucleotide.
[0518] In Assay 4, the signal from the TaqMan.RTM. probe labeled
with VIC indicated that the genomic DNA NA17103 was homozygous for
the allele corresponding to the First Probe-CYC (4), which has a
"T" as the nucleotide at the pivotal complement. Thus, the genomic
DNA NA17103 correctly was determined to be homozygous at the locus
analyzed in Assay 4 with "A" at the pivotal nucleotide.
[0519] In Assay 4, the signal from the TaqManOR probe labeled with
FAM indicated that the genomic DNA NA17212 was homozygous for the
allele corresponding to the First Probe-RNA (4), which has a "C" as
the nucleotide at the pivotal complement. Thus, the genomic DNA
NA17212 correctly was determined to be homozygous at the locus
analyzed in Assay 4 with "G" at the pivotal nucleotide.
[0520] In Assay 4, the signals from the TaqMan.RTM. probes labeled
with FAM and VIC indicated that the genomic DNA NA17247 was
heterozygous for the alleles corresponding to both the First
Probe-CYC (4) and the First Probe-RNA (4). Thus, the genomic DNA
NA17247 correctly was determined to be heterozygous at the locus
analyzed in Assay 4 with "A" and "G" at the pivotal
nucleotides.
[0521] In Assay 5, the signal from the TaqMan.RTM. probe labeled
with FAM indicated that the genomic DNA NA17103 was homozygous for
the allele corresponding to the First Probe-RNA (5), which has an
"A" as the nucleotide at the pivotal complement. Thus, the genomic
DNA NA17103 correctly was determined to be homozygous at the locus
analyzed in Assay 5 with "T" at the pivotal nucleotide.
[0522] In Assay 5, the signals from the TaqMan.RTM. probes labeled
with FAM and VIC indicated that the genomic DNA NA17212 was
heterozygous for the alleles corresponding to both the First
Probe-CYC (5) and the First Probe-RNA (5). Thus, the genomic DNA
NA17212 correctly was determined to be heterozygous at the locus
analyzed in Assay 2 with "C" and "T" at the pivotal
nucleotides.
[0523] In Assay 5, the signal from the TaqMan.RTM. probe labeled
with VIC indicated that the genomic DNA NA17247 was homozygous for
the allele corresponding to the First Probe-CYC (5), which has a
"G" as the nucleotide at the pivotal complement. Thus, the genomic
DNA NA17247 correctly was determined to be homozygous at the locus
analyzed in Assay 5 with "C" at the pivotal nucleotide.
[0524] For the most part, the three assays correctly identified the
presence or absence of the appropriate alleles at the three
different loci of the three genomic DNA samples being analyzed with
the three probe sets. The data for the replicates were not always
as tight as may be desired according to certain embodiments.
[0525] Other assays that employed the same concentrations of
materials and same thermal cycling conditions as assays 3 to 5, but
that employed different probe sets to detect the presence or
absence of two alleles at different loci, were also performed. Some
of those assays included problems with the controls and at least
one other had an erroneous result most likely due to a manual
pipetting error.
[0526] Although the invention has been described with reference to
certain applications, methods, and compositions, it will be
appreciated that various changes and modifications may be made
without departing from the invention.
Sequence CWU 1
1
25 1 49 DNA Homo sapiens 1 ttgcctgctc gacttagatc aaaggagacg
cggctgcttt cagcctcat 49 2 49 DNA Homo sapiens 2 ttgcctgctc
gacttagagg gtcacagtag gtggtgcttt cagcctcac 49 3 33 DNA Homo sapiens
3 ggggatagtg gctgcatcac tggatagcga cgt 33 4 49 DNA Homo sapiens 4
ttgcctgctc gacttagatc aaaggagacg cggcagtggt tttccaacg 49 5 51 DNA
Homo sapiens 5 ttgcctgctc gacttagagg gtcacagtag gtggacagtg
gttttccaac a 51 6 32 DNA Homo sapiens 6 tgaacacacc gggtatcact
ggatagcgac gt 32 7 18 DNA Homo sapiens 7 ttgcctgctc gacttaga 18 8
18 DNA Homo sapiens 8 acgtcgctat ccagtgat 18 9 15 DNA Homo sapiens
9 ccgcgtctcc tttga 15 10 16 DNA Homo sapiens 10 ccacctactg tgaccc
16 11 70 DNA Homo sapiens 11 ttgcctgctc gacttagatc cgcgtctcct
ttgatttgta ccactctttt tcggtcaaaa 60 acgagatcaa 70 12 71 DNA Homo
sapiens 12 ttgcctgctc gacttagatc cacctactgt gaccctttgt accactcttt
ttcggtcaaa 60 aacgagatca g 71 13 37 DNA Homo sapiens 13 taccagctta
acacatagca tcactggata gcgacgt 37 14 73 DNA Homo sapiens 14
ttgcctgctc gacttagatc cgcgtctcct ttgatttgta ccactctttt tccaataact
60 aaaggtacaa cat 73 15 73 DNA Homo sapiens 15 ttgcctgctc
gacttagatc cacctactgt gaccctttgt accactcttt ttcaataact 60
aaaggtacaa cac 73 16 37 DNA Homo sapiens 16 ggcataataa tctccaaaga
tcactggata gcgacgt 37 17 68 DNA Homo sapiens 17 ttgcctgctc
gacttagatc cgcgtctcct ttgatttgta ccactctttt tccagtggtt 60 ttccaacg
68 18 70 DNA Homo sapiens 18 ttgcctgctc gacttagatc cacctactgt
gaccctttgt accactcttt ttcacagtgg 60 ttttccaaca 70 19 32 DNA Homo
sapiens 19 tgaacacacc gggtatcact ggatagcgac gt 32 20 18 DNA Homo
sapiens 20 ttgcctgctc gacttaga 18 21 18 DNA Homo sapiens 21
acgtcgctat ccagtgat 18 22 15 DNA Homo sapiens 22 ccgcgtctcc tttga
15 23 16 DNA Homo sapiens 23 ccacctactg tgaccc 16 24 15 DNA
Artificial Synthetic DNA 24 catgccaatg acgga 15 25 15 DNA
Artificial Synthetic DNA 25 catgcgaatg acggc 15
* * * * *