U.S. patent application number 11/619630 was filed with the patent office on 2007-09-20 for compositions comprising conditioned cell culture media and uses thereof.
This patent application is currently assigned to SkinMedica, Inc.. Invention is credited to Jonathan N. Mansbridge.
Application Number | 20070218549 11/619630 |
Document ID | / |
Family ID | 23145175 |
Filed Date | 2007-09-20 |
United States Patent
Application |
20070218549 |
Kind Code |
A1 |
Mansbridge; Jonathan N. |
September 20, 2007 |
Compositions comprising conditioned cell culture media and uses
thereof
Abstract
The invention relates to compositions comprising cell culture
medium conditioned by cells grown in three-dimensional culture. The
cells used to condition the medium may be genetically modified to
alter the concentration of growth factors and antioxidants in the
medium. The conditioned cell medium (conditioned medium) may be
used for at least one of cosmetic applications, cosmeceutical
applications, and pharmaceutical applications, among other things.
The invention also relates to proteins comprising a heterologous
sequence that enhances cell penetration. The invention also relates
to cells comprising DNA encoding such proteins. Methods for
preparing the inventive compounds are also provided.
Inventors: |
Mansbridge; Jonathan N.; (La
Jolla, CA) |
Correspondence
Address: |
WILSON SONSINI GOODRICH & ROSATI
650 PAGE MILL ROAD
PALO ALTO
CA
94304-1050
US
|
Assignee: |
SkinMedica, Inc.
Carlsbad
CA
|
Family ID: |
23145175 |
Appl. No.: |
11/619630 |
Filed: |
January 4, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10165860 |
Jun 7, 2002 |
7160726 |
|
|
11619630 |
Jan 4, 2007 |
|
|
|
60297177 |
Jun 7, 2001 |
|
|
|
Current U.S.
Class: |
435/325 ;
530/395; 530/399; 562/553 |
Current CPC
Class: |
A61K 38/44 20130101;
A61K 38/1866 20130101; C07K 2319/75 20130101; A61K 8/447 20130101;
A61P 9/06 20180101; A61K 38/1825 20130101; A61K 8/64 20130101; C12N
2502/1323 20130101; A61K 38/446 20130101; C07K 2319/01 20130101;
C12N 15/62 20130101; C12N 2510/02 20130101; A61Q 19/00 20130101;
C12N 2500/90 20130101; A61K 2800/522 20130101; A61K 2800/86
20130101; C07K 14/52 20130101; C07K 2319/10 20130101; A61K 8/678
20130101; A61K 38/00 20130101; A61K 38/1825 20130101; A61K 2300/00
20130101; A61K 38/1866 20130101; A61K 2300/00 20130101; A61K 38/446
20130101; A61K 2300/00 20130101; A61K 38/44 20130101; A61K 2300/00
20130101 |
Class at
Publication: |
435/325 ;
530/395; 530/399; 562/553 |
International
Class: |
C12N 5/00 20060101
C12N005/00; C07C 229/00 20060101 C07C229/00; C07K 14/475 20060101
C07K014/475 |
Claims
1-62. (canceled)
63. A growth factor comprising a heterologous peptide sequence that
enhances cell penetration.
64. The growth factor of claim 63, wherein the growth factor
comprises at least one of insulin, insulin-like growth factor
(IGF), nerve growth factor, VEGF, keratinocyte growth factor (KGF),
fibroblast growth factor (FGF), platelet-derived growth factor
(PDGF), hepatocyte growth factor (HGF), transforming growth factor
alpha (TGF.alpha.), transforming growth factor beta (TGF.beta.),
epidermal growth factor (EGF), granulocyte-macrophage
colony-stimulating factor (GM-CSF), granulocyte colony-stimulating
factor (G-CSF), interleukin-6 (IL-6), and interleukin-8 (IL-8); and
wherein the heterologous peptide sequence comprises at least one of
the following sequences: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ
ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ
ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18,
and SEQ ID NO:19.
65. An antioxidant comprising a heterologous peptide sequence that
enhances cell penetration.
66. The antioxidant of claim 65, wherein the antioxidant comprises
at least one of cysteine, cystine, ascorbic acid, glutathione,
glutathione disulfide, glutathione peroxidase, glutathione
reductase, glutathione disulfide, superoxide dismutase, catalase,
vitamin E, ascorbic acid, ubiquinol 9, and ubiquinone 9; and
wherein the heterologous peptide sequence comprises at least one of
the following sequences: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ
ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ
ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18,
and SEQ ID NO:19.
67. An extracellular matrix component comprising a heterologous
peptide sequence that enhances cell penetration.
68. The extracellular matrix component of claim 67, wherein the
extracellular matrix component comprises at least one of: at least
one glycoprotein, at least one proteoglycan, and at least one
glycosaminoglycan; and wherein the heterologous peptide sequence
comprises at least one of the following sequences: SEQ ID NO:1, SEQ
ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID
NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID
NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ
ID NO:17, SEQ ID NO:18, and SEQ ID NO:19.
69. A cell comprising DNA encoding a growth factor comprising a
heterologous peptide sequence that enhances cell penetration.
70. A cell according to claim 69, wherein the growth factor
comprises at least one of insulin, insulin-like growth factor
(IGF), nerve growth factor, VEGF, keratinocyte growth factor (KGF),
fibroblast growth factor (FGF), platelet-derived growth factor
(PDGF), hepatocyte growth factor (HGF), transforming growth factor
alpha (TGFa), transforming growth factor beta (TGF, epidermal
growth factor (EGF), granulocyte-macrophage colony-stimulating
factor (GM-CSF), granulocyte colony-stimulating factor (G-CSF),
interleukin-6 (IL-6), and interleukin-8 (IL-8); and wherein the
heterologous peptide sequence comprises at least one of the
following sequences: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID
NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ
ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18,
and SEQ ID NO:19.
71. A cell comprising DNA encoding an antioxidant comprising a
heterologous peptide sequence that enhances cell penetration.
72. A cell according to claim 71, wherein the antioxidant comprises
at least one of cysteine, cystine, ascorbic acid, glutathione,
glutathione disulfide, glutathione peroxidase, glutathione
reductase, glutathione disulfide, superoxide dismutase, catalase,
vitamin E, ascorbic acid, ubiquinol 9, and ubiquinone 9; and
wherein the heterologous peptide sequence comprises at least one of
the following sequences: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ
ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ
ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18,
and SEQ ID NO:19.
73. A cell comprising DNA encoding an extracellular matrix
component comprising a heterologous peptide sequence that enhances
cell penetration.
74. A cell according to claim 73, wherein the extracellular matrix
component comprises at least one of: at least one glycoprotein, at
least one proteoglycan, and at least one glycosaminoglycan; and
wherein the heterologous peptide sequence comprises at least one of
the following sequences: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ
ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID
NO:9, SEQ ID NO:1O, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ
ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18,
and SEQ ID NO:19.
Description
RELATED APPLICATIONS
[0001] This application claims priority of provisional U.S. patent
application Ser. No. 60/297,177, filed Jun. 7, 2001, which is
expressly incorporated herein by reference, in its entirety, for
any purpose. This application is related to U.S. patent application
Ser. No. 09/313,538, filed May 14, 1999, which is expressly
incorporated herein by reference, in its entirety, for any
purpose.
FIELD OF THE INVENTION
[0002] The invention relates to compositions comprising cell
culture medium conditioned by cells grown in three-dimensional
culture. The cells used to condition the medium may be genetically
modified to alter the concentration of growth factors and
antioxidants in the medium. The conditioned cell medium
(conditioned medium) is useful in cosmetic applications,
cosmeceutical applications, and pharmaceutical applications, among
other things. The invention also includes proteins comprising a
peptide sequence that enhances cell penetration, DNA encoding such
proteins, and cells containing such DNA. Methods for preparing the
inventive compounds are also provided.
SUMMARY OF THE INVENTION
[0003] The present invention is directed to compositions comprising
conditioned cell culture medium, or an extract thereof, generated
using three-dimensional cell cultures and an appropriate carrier.
The invention is also directed to methods for preparing such
compositions. In certain embodiments, the three-dimensional culture
comprises eukaryotic cells or human cells, particularly dermal
fibroblasts, keratinocytes, epithelial cells, chondrocytes, smooth
muscle cells, and myocytes. In certain embodiments the appropriate
carrier is a pharmaceutically-acceptable carrier, a
cosmetically-acceptable carrier, or a cosmeceutically-acceptable
carrier. In certain embodiments, the conditioned cell culture media
is generated using pre-conditioned media that is serum-free or
animal product-free.
[0004] In certain embodiments, the conditioned media comprises at
least one genetically-engineered growth factor or at least one
genetically-engineered antioxidant. In certain embodiments, the
compositions of the invention comprise at least one
genetically-engineered growth factor, at least one
genetically-engineered antioxidant, at least one
genetically-engineered extracellular matrix component, or
combinations thereof. In certain embodiments, the at least one
genetically-engineered growth factor, the at least one
genetically-engineered antioxidant, or the at least one
genetically-engineered extracellular matrix component comprises at
least one transport-enhanced growth factor, transport-enhanced
antioxidant, or transport-enhanced extracellular matrix component.
In certain embodiments, the transport-enhanced growth factor,
transport-enhanced antioxidant, or transport-enhanced extracellular
matrix component further comprises one of the amino acid sequences
of Table 1 (SEQ ID NO:1-SEQ ID NO:19).
[0005] In certain embodiments, a growth factor comprising a
heterologous peptide sequence that enhances cell penetration is
provided. In certain embodiments a cell comprising DNA encoding a
growth factor comprising a heterologous peptide sequence that
enhances cell penetration is provided.
[0006] In certain embodiments an antioxidant comprising a
heterologous peptide sequence that enhances cell penetration is
provided. In certain embodiments a cell comprising DNA encoding an
antioxidant comprising a heterologous peptide sequence that
enhances cell penetration is provided.
[0007] In certain embodiments an extracellular matrix component
comprising a heterologous peptide sequence that enhances cell
penetration is provided. In certain embodiments a cell comprising
DNA encoding an extracellular matrix component comprising a
heterologous peptide sequence that enhances cell penetration is
provided.
[0008] In certain embodiments, the inventive compositions comprise
lotions, creams, gels, including hydrogels, powders, serums,
salves, foundations, facial masks, lip care products, sunscreens,
hair care products, such as shampoos, conditioners, including deep
conditioners, hair care treatments, hot oil treatments, and the
like, skin cleansers, exfoliants, compact formulations, or the
like.
[0009] In certain embodiments, the conditioned media comprises at
least one culture-derived growth factor, the at least one growth
factor comprising at least one of: vascular endothelial growth
factor (VEGF), transforming growth factor beta (TGFP), hepatocyte
growth factor (HGF), keratinocyte growth factor (KGF),
interleukin-3 (IL-3), IL-6, or IL-8; and at least one
culture-derived antioxidant, the at least one antioxidant
comprising at least one of: glutathione, glutathione peroxidase,
glutathione reductase, glutathione disulfide, catalase, superoxide
dismutase, alpha-tocopherol, gamma- tocopherol, ubiquinol-9,
ubiquinone 9, ascorbic acid, cysteine, or cystine. In certain
embodiments, the compositions further comprise at least one
extracellular matrix component, such as soluble collagen, for
example, but not limited to collagen type I or collagen type
III.
[0010] In certain embodiments, the methods comprise combining a
pre-conditioned medium with a three-dimensional culture under
appropriate conditions to generate a conditioned medium comprising
at least one culture-derived growth factor, the at least one growth
factor comprising at least one of: vascular endothelial growth
factor (VEGF), transforming growth factor beta (TGFP), hepatocyte
growth factor (HGF), keratinocyte growth factor (KGF),
interleukin-3 (IL-3), IL-6, or IL-8; and at least one
culture-derived antioxidant, the at least one antioxidant
comprising at least one of: glutathione, glutathione peroxidase,
glutathione reductase, glutathione disulfide, catalase, superoxide
dismutase, alpha-tocopherol, gamma-tocopherol, ubiquinol-9,
ubiquinone 9, ascorbic acid, cysteine, or cystine. According to the
methods of the invention, the conditioned media or an extract
thereof are combined with an acceptable carrier to form a
composition. In certain embodiments, the composition is a
cosmeceutical composition and the acceptable carrier is a
cosmeceutically-acceptable carrier. In certain embodiments, the
three-dimensional culture comprises eukaryotic cells, particularly
human dermal fibroblasts, keratinocytes, chondrocytes, smooth
muscle cells, and the like.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] FIG. 1 graphically depicts the effect of serum-free medium,
pre-conditioned media, or conditioned media on the in vitro
proliferation of fibroblast or keratinocyte cultures. Fibroblast
proliferation is shown in solid bars with error bars. Keratinocyte
proliferation is shown in gray stippled bars with error bars.
[0012] FIG. 2 graphically depicts the antioxidant activity of
serum-free medium, control medium (pre-conditioned medium) and
conditioned medium on cultured epidermal keratinocytes.
[0013] FIG. 3 depicts graphic representations of the measurement of
antioxidant levels in filtered medium. Panel 3A shows the results
of the HPLC analysis of .alpha.-tocopherol and .gamma.-tocopherol,
components of Vitamin E. Panel 3B shows the results of the HPLC
analysis of glutathione (GSH). Panel 3C shows the results of the
HPLC analysis of cysteine. Panel 3D shows the results of the HPLC
analysis of cysteine and cystine combined.
[0014] FIG. 4 graphically depicts the effects of control
(pre-conditioned) medium and conditioned medium on the collagen
deposition by cultured fibroblasts.
[0015] FIG. 5 graphically depicts the enhancement, or
up-regulation, of KGF secretion by three-dimensional human dermal
fibroblast cultures (Dermagraft.RTM.) in the presence of
IL-1.alpha. compared to parallel cultures in the absence of
IL-1.alpha..
[0016] FIG. 6 graphically depicts the enhancement of VEGF secretion
in the presence of increasing concentrations of PDGF AB chains.
[0017] FIG. 7 provides a graphic comparison of the levels of VEGF
secretion by fibroblast monolayer cultures, fibroblast stressed
collagen gel three-dimensional cultures, fibroblast contracted
collagen gel three-dimensional cultures, and fibroblast
scaffold-based three-dimensional cultures. Detailed Description of
Exemplary Embodiments
[0018] In this application, the use of the singular includes the
plural unless specifically stated otherwise. In this application,
the use of "or" means "and/or" unless stated otherwise.
Furthermore, the use of the term "including", as well as other
forms, such as "includes" and "included", is not limiting. Also,
terms such as "element" or "component" encompass both elements and
components comprising one unit and elements and components that
comprise more than one subunit unless specifically stated
otherwise.
[0019] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All references cited in this specification are
expressly incorporated by reference, in their entirety, for any
purpose.
[0020] The term "culture-derived" as used herein refers to a
component of conditioned cell culture media that is not present in
the starting cell culture media that is used to culture and feed
the cells, but is produced by the cultured cells and enters the
media. For example, vascular epithelial growth factor (VEGF) is
present in conditioned cell culture media obtained from
three-dimensional cultures of human fibroblasts, while VEGF is not
typically present in the original pre-conditioned cell culture
media ("pre-conditioned media") prior to conditioning. Thus, VEGF
is secreted into the media by the cells. Also within the meaning of
the term culture-derived are compounds that are initially present
in the pre-conditioned media, but whose concentration is increased
during the culture process. For example, but not as a limitation,
if the original pre-conditioned media comprises 1 ng/ml VEGF and
the same media after conditioning comprises 5 ng/ml VEGF, then the
conditioned media comprises culture-derived VEGF.
[0021] The term "growth factor" as used herein refers to a protein,
a polypeptide, or a complex of polypeptides, including cytokines,
that are produced by a cell and which can effect itself and/or a
variety of other neighboring or distant cells. Typically growth
factors affect the growth and/or differentiation of specific types
of cells, either developmentally or in response to a multitude of
physiological or environmental stimuli. Some, but not all, growth
factors are hormones. Exemplary growth factors are insulin,
insulin-like growth factor (IGF), nerve growth factor, VEGF,
keratinocyte growth factor (KGF), fibroblast growth factors (FGFs),
including basic FGF (bFGF), platelet-derived growth factors
(PDGFs), including PDGF-AA and PDGF-AB, hepatocyte growth factor
(HGF), transforming growth factor alpha (TGF.alpha.), transforming
growth factor beta (TGFP), including TGF.beta..sub.1 and
TGF.beta..sub.3, epidermal growth factor (EGF),
granulocyte-macrophage colony-stimulating factor (GM-CSF),
granulocyte colony-stimulating factor (G-CSF), interleukin-6
(IL-6), IL-8, and the like. Growth factors are discussed in, among
other places, Molecular Cell Biology, Scientific American Books,
Darnell et al., eds., 1986; The Molecular and Cellular Biology of
Wound Repair, Clark, Plenum Press, 1996; and Principles of Tissue
Engineering, 2d ed., Lanza et al., eds., Academic Press, 2000. The
skilled artisan will understand that any and all culture-derived
growth factors in the conditioned media described herein are within
the scope of the invention.
[0022] The term antioxidant is used in the broad sense herein and
encompasses any substance that slows down or prevents oxidation or
free radical formation. Thus, antioxidants include enzymes and
other compounds that are able to counteract, at least in part, the
damaging effects of free radicals produced by, among other things,
ultraviolet light and environmental pollutants, in tissues such as,
but not limited to, the skin. For example, the antioxidant defense
system of the skin includes antioxidant enzymes and a group of low
molecular weight antioxidants (LMWA). The LMWA have been shown to
prevent oxidative damage, at least in part, by interacting with
radical oxygen species, either directly or indirectly. Exemplary
antioxidants are cysteine, glutathione, glutathione disulfide,
glutathione peroxidase, glutathione reductase, catalase, vitamin E,
including alpha- and gamma-tocopherol, ascorbic acid, ubiquinol 9,
ubiquinone 9, and the like. Discussions of antioxidants may be
found in, among other places, Kohen et al., Toxicology 148: 149-157
(2000); Kohen, Biomed. Pharmacother. 53: 181-192 (1999); Kohen et
al., Methods of Enzymol. 300: 285-90, Academic Press (1999);
Miyachi, Dermatol. Sci. 9:79-86 (1995); and Stohs, J. Basic Clin.
Physio. Pharmacol. 6:206-228 (1995). The skilled artisan will
understand that any and all culture-derived antioxidants in the
conditioned media described herein are within the scope of the
invention.
[0023] The skilled artisan will readily understand what is meant by
terminology such as "treated with an amount of IL-1 a sufficient to
enhance the expression of KGF" or "treated with an amount of PDGF
sufficient to enhance the expression of VEGF." Additionally, the
skilled artisan will be able to determine whether the expression of
a particular growth factor has been induced or enhanced by
performing an appropriate assay. Exemplary assays include ELISA,
western blot, polyacrylamide gel electrophoresis, HPLC, or the
like, using appropriate markers, standards, and/or
commercially-available kits, as appropriate. For example, ELISA
kits for the quantitation of VEGF, KGF, or various other growth
factors are commercially available from R & D Systems,
Minneapolis, Minn.
[0024] The term extracellular matrix ("ECM") encompasses
essentially all secreted molecules that are immobilized outside of
the cell. In vivo, the ECM provides order in the extracellular
space and serves functions associated with establishing,
separating, and maintaining differentiated tissues and organs. The
ECM is a complex structure that is found, for example, in
connective tissues and basement membranes, also referred to as the
basal lamina. Connective tissue typically contains isolated cells
surrounded by ECM that is naturally secreted by the cells.
Components of the ECM have been shown to interact with and/or bind
growth and differentiation factors, cytokines, matrix
metalloproteases (MMPs), tissue inhibitors of metalloproteases
(TIMPs), and other soluble factors that regulate cell
proliferation, migration, and differentiation. Descriptions of the
ECM and its components may be found in, among other places,
Guidebook to the Extracellular Matrix, Anchor, and Adhesion
Proteins, 2d ed., Kreis and Vale, eds., Oxford University Press,
1999 ("Kreis et al."); Geiger et al., Nature Reviews Molecular Cell
Biology 2:793-803, 2001; lozzo, Annual Review of Biochemistry,
1998, Annual Reviews, Palo Alto, CA; Boudreau and Jones, Biochem.
J. 339:481-88, 1999; Extracellular Matrix Protocols, Streuli and
Grant, eds., Humana Press 2000; Metzler, Biochemistry the Chemical
Reactions of Living Cells, 2d ed., vol.1, 2001, Academic Press, San
Diego, particularly chapter 8; and Lanza et al., particularly
chapters 4 and 20.
[0025] Certain embodiments include at least one component of the
ECM. In certain embodiments, the extracellular matrix component
comprises at least one of: at least one protein, at least one
glycoprotein, at least one proteoglycan, and at least one
glycosaminoglycan. Exemplary glycoproteins, proteoglycans, and
glycosaminoglycans include but are not limited to, collagen type I,
collagen type II, collagen type III, collagen type IV, collagen
type V, collagen type VI, collagen type VII, collagen type VII,
collagen type IX, collagen type X, collagen type XI, collagen type
XII, collagen type XIII, collagen type XIV, collagen type XV,
collagen type XVI, collagen type XVII, collagen type XVIII,
fibronectin, laminin, particularly laminin-1, laminin-2, laminin-4,
and laminin-5, lumican, tenascin, versican, perlecan,
thrombospondin, particularly thrombospondin-2 and thrombospondin-4,
or laminin, particularly laminin-1,-2,-4, and -5, agrin, nidogen,
bamacan, decorin, biglycan, fibromodulin, elastin, fibrillin,
hyaluronan, vitronectin, chondroitin sulphate, dermatan sulphate,
heparan sulphate, and keratan sulphate.
[0026] The term "extract" when used in reference to conditioned
cell culture media refers to any subcomponent of fraction of the
conditioned media, whether obtained by dialysis, fractionation,
distillation, phase separation, gel filtration chromatography,
affinity chromatography, hollow fiber filtration, precipitation,
concentration, or the like.
[0027] The term "substantially free from," when used in reference
phenol red, "components of bovine-origin," or "non-human animal
products" refers to conditioned media or extracts thereof that
contain little to no phenol red, little to no components of
bovine-origin, little or no non-human animal products, or
combinations thereof. In certain embodiments, the conditioned cell
culture media comprises less than 49.999%, 30%, 20%, 10%, 5%, 1%,
0.5%, 0.05%, or no (0%) phenol red. In certain embodiments, the
conditioned media comprises less than 49.999%, 30%, 20%, 10%, 5%,
1%, 0.5%, 0.05%, or no (0%) components of bovine-origin. Exemplary
media components of bovine-origin include fetal calf serum, calf
serum, bovine serum, bovine collagen, bovine insulin, bovine
transferrin, and the like. In certain embodiments, the conditioned
media comprises less than 49.999%, 30%, 20%, 10%, 5%, 1%, 0.5%,
0.05%, or no (0%) non-human animal products. In addition to the
exemplary components of bovine-origin, listed above, non-human
animal products include any animal products not of human origin,
such as tissue culture components and products of porcine-origin.
The skilled artisan will know that "serum-free" media and animal
product-free media is commercially available from several vendors
of cell culture media. Likewise, phenol red free media is also
commercially available or can be prepared.
[0028] The term cosmeceutical refers to a formulation or
composition comprising at least one biologically active ingredient
that has an effect on the user of the product and at least one
cosmeceutically-acceptable carrier. Cosmeceuticals may be viewed as
cosmetics that, in certain applications and under appropriate
conditions, may provide medicinal or drug-like benefits. In certain
applications, for example, cosmeceuticals may affect the underlying
structure of the skin, decrease wrinkle depth, or reverse or
ameliorate the effect of photooxidation or aging-on the skin.
Cosmeceuticals may be particularly useful as skin care products,
hair care products, and sun care products. In certain embodiments,
cosmeceutical compositions comprise delivery systems including at
least one of liposomes, cyclodextrins, polymer systems, or
hyaluronic acid or related compounds. Cosmeceutical compositions
comprise cosmeceutically-acceptable carriers. The skilled artisan
will understand that a pharmaceutically-acceptable carrier or
formulation that is suitable for topical applications will
typically also be a cosmeceutically-acceptable carrier or
formulation.
[0029] A topical cosmetic or cosmeceutical ointment, lotion, or gel
composition typically contains a concentration of active
ingredients comprising conditioned media or extracts thereof, from
about 1 to 99%, about 5 to 95%, about 20 to 75%, or about 5 to 20%,
in a cosmetically-acceptable carrier or a
cosmeceutically-acceptable carrier, such as a pharmaceutical cream
base, an oil-in-water emulsion, a water-in-oil emulsion, a gel, or
the like. Various cosmetic and cosmeceutical compositions for
topical use include drops, tinctures, lotions, creams, salves,
serums, solutions, and ointments containing conditioned media or
extracts, and an appropriate carrier. The optimal percentage of the
conditioned media or extract in each composition varies according
to the composition's formulation and the therapeutic effect
desired.
[0030] The skilled artisan in the formulation arts will understand
that the inventive compositions may comprise any of a number of
cosmetically-, cosmeceutically-, or pharmaceutically-acceptable
formulations, depending on the type of product, the nature of the
composition, the location of composition's use, the desired effect,
and the like. While proprietary formulations are common in the
formulation arts, formulators of ordinary skill will be able to
determine or readily select appropriate formulations for specific
applications without undue experimentation.
[0031] The skilled artisan will understand that the appropriate
carriers of the inventive compositions typically will contain
ingredients, such as those typically found in the cosmetic and
cosmeceutical fields: oils, waxes or other standard fatty
substances, or conventional gelling agents and/or thickeners;
emulsifiers; moisturizing agents; emollients; sunscreens;
hydrophilic or lipophilic active agents, such as ceramides; agents
for combatting free radicals; bactericides; sequestering agents;
preservatives; basifying or acidifying agents; fragrances;
surfactants; fillers; natural products or extracts of natural
product, such as aloe or green tea extract; vitamins; or coloring
materials. The amounts of these various ingredients will vary
depending on the use of the composition and the cosmetic or
cosmeceutical effect desired.
[0032] Discussions of cosmetic- and cosmeceutically-acceptable
ingredients and formulations may be found in, among other places,
FDA Cosmetics Handbook, U.S. Food and Drug Administration; Handbook
of Cosmetic and Personal Care Additives, Ash and Ash, compilers,
1994, Chemical Publishing, New York, N.Y.; Bennett's Cosmetic
Formulary, 1993, Chemical Publishing Co.; Harry's Cosmeticology,
7.sup.th ed., Wilkinson & Moore, 1982 and 8.sup.th ed., Rieger,
2000, Chemical Publishing; Cosmetic Bench Reference-2001, Allerud
Publishing Corp.; CTFA Compendium of Cosmetic Ingredient
Composition, Nikitakis and McEwen, eds., 1990, Cosmetic, Toiletry,
and Fragrance Association, Washington, D.C., Surfactant
Encyclopedia, 2.sup.nd revised edition, Rieger, 1996, Allured
Publishing; The Chemistry and Manufacture of Cosmetics, 2.sup.nd
ed., De Navarre, Van Nostrand, Princeton, N.J.; Encyclopedia of
Common Natural Ingredients Used in Food, Drugs, and Cosmetics,
Leung, 1996, John Wiley; A Consumer's Dictionary of Cosmetic
Ingredients, 5.sup.th ed., Winter, 1999, Three Rivers Press, New
York, N.Y.; Cosmeceuticals: Active Skin Treatment, 1998, Allured
Publishing; Handbook of Cosmetic Science and Technology, Knowlton
and Pearce, 1993, Elsevier Advanced Technology, Oxford, UK;
Personal-Care Formulas, 1997, Allured Publishing; Beginning
Cosmetic Chemistry, Scheuller and Romanowski, 1999, Allured
Publishing; and Skin Permeation: Fundamentals and Application,
Zatz, 1993, Allured Publishing. Discussions of
pharmaceutically-acceptable ingredients and formulations may be
found in, among other places, Remington's Pharmaceutical Sciences,
18.sup.th ed., Gennaro, ed., 1990, Mack Publishing.
[0033] In certain embodiments, the conditioned media is generated
using pre-conditioned media that is serum-free or animal
product-free. Serum-free and animal product-free (sometimes
referred to as protein-free) media is commercially available from,
among other vendors, LifeTechnologies-GibcoBRL, Rockville, Md.;
Sigma-Aldrich, Saint Louis, Mo.; or BioWhittaker, Walkersville,
Md.). Exemplary serum-free media include: UltraCULTURE.TM.,
UltraDOMA.TM. and UltraCHO.TM., from BioWhittaker; Serum-free
Hybridoma Medium, CHO Serum-free Medium, and MDCK Serum-free
Medium, from Sigma-Aldrich; and Keratinocyte-SFM (KSFM), AIM V.RTM.
Media, StemPro.RTM.-34 SFM, Human Endothelial-SFM, Macrophage-SFM,
and HepatoZYME-SFM from Life Technologies. Exemplary protein-free
media include: UltraDOMA-PF.TM. from BioWhittaker; Animal
Component-free Hybridoma Medium, Serum-free and Protein-free
Hybridoma Medium Hybri-Max.RTM., CHO Protein-free Medium,
Chemically-defined CHO Medium, and MDCK Protein-free Medium from
Sigma-Aldrich; and Defined Keratinocyte-SFM from Life Technologies.
The skilled artisan will appreciate that the use of serum-free
media for mammalian cell culture is well established, and is
described in, among other places, Cold Spring Harbor Conferences on
Cell Proliferation, Vol. 9, Sato et al., eds., (1982) Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y.; Barnes et al., Anal.
Biochem. 102, 255 (1980); BioWhittaker 1999/2000 catalog, pp.
42-51; Barnes, Serum-Free Free Animal Cell Culture, BioTechniques
5(6):534-42; and Freshney, Culture of Animal Cells, 3d ed.,
Wiley-Liss, New York, NY, 1994.
[0034] In certain embodiments, a three-dimensional cell culture
comprises a scaffold or framework. Three-dimensional cell culture
frameworks are described in, among other places, U.S. Pat. Nos.
4,963,489; 5,460,939; and U.S. Application Serial No.09/137,567;
see also, Pachence and Kohn, Biodegradable Polymers, pp. 263-77, in
Principles of Tissue Engineering, 2d ed., Lanza et al., eds.,
Academic Press, 2000 (describing suitable materials and selection
criteria). In other embodiments, a three-dimensional cell culture
comprises a collagen matrix, including contracted collagen gels; a
gelatin matrix; or a gel matrix. In certain embodiments, the
collagen matrix comprises human collagen. In certain embodiments,
the collagen matrix comprises bovine collagen, porcine collagen,
rat collagen, or combinations thereof. Collagen gels for use as
hydrogel scaffolds are described in, among other places, Pachence
and Kohn, Biodegradable Polymers, pp.263-77, in Principles of
Tissue Engineering, 2d ed., Lanza et al., eds., Academic Press,
2000; and Parenteau, The First Tissue-Engineered Products,
Scientific American 280:83-84, 1999. See generally, Principles of
Tissue Engineering, Lanza et al., eds., R. G. Landes Co. and
Academic Press, 1997; and Principles of Tissue Engineering, 2d ed.,
Lanza et al., eds., Academic Press, 2000.
[0035] In certain embodiments, the conditioned media comprises at
least one genetically-engineered growth factor, at least one
genetically-engineered antioxidant, and/or at least one
genetically-engineered extracellular matrix component, wherein the
at least one growth factor or antioxidant includes a heterologous
peptide sequence that is capable of enhancing cell penetration,
also referred to as protein transduction. A heterologous peptide
sequence is a contiguous string of amino acids that are not found
in the naturally-occurring growth factor or antioxidant. Rather,
the heterologous peptide has been introduced into the
naturally-occurring growth factor or antioxidant, typically at or
near the amino terminus or the carboxy terminus, using a
conventional molecular biology technique such as genetic
engineering. Such a "transport-enhanced" growth factor,
antioxidant, or extracellular matrix component may, under
appropriate conditions, penetrate the cell more readily or more
quickly than its naturally-occurring counterpart. Exemplary
heterologous peptides known to enhance cell membrane permeation or
transport are shown in Table 1 below. TABLE-US-00001 TABLE 1
Exemplary Transport Peptides Amino Acid Sequence Identity Reference
Arg-Gln-IIe-Lys-Ile-Trp-Phe-Gln-Asn-Arg- Antennapedia Derossi et
al. Arg-Met-Lys-Trp-Lys-Lys homeodomain (43- (SEQ ID NO:1) 58)
Arg-Gln-Ile-Lys-Ile-Trp-Phe-Pro-Asn-Arg- Pro 50 Derossi et al.
Arg-Met-Lys-Trp-Lys-Lys (SEQ ID NO:2)
Arg-Lys-Lys-Arg-Arg-Gln-Arg-Arg-Arg HIV-1 Tat Kwon et al. (SEQ ID
NO:3) transduction domain (49-57)
Gly-Trp-Thr-Leu-Asn-Ser-Ala-GIy-Tyr-Leu- Transportan Pooga et al.
Leu-Gly-Lys-Ile-Asn-Leu-Lys-Ala-Leu-Ala-
Ala-Leu-Ala-Lys-Lys-Ile-Leu (SEQ ID NO:4)
Thr-Arg-Gln-Ala-Arg-Arg-Asn-Arg-Arg-Arg- HIV-1 Rev (34-50) Futaki
et al. Arg-Trp-Arg-Glu-Arg-Gln-Arg (SEQ ID NO:5)
Arg-Arg-Arg-Arg-Asn-Arg-Thr-Arg-Arg- FHV coat (35-49) Futaki et al.
Asn-Arg-Arg-Arg-Val-Arg (SEQ ID NO:6)
Lys-Met-Thr-Arg-Ala-Gln-Arg-Arg-Ala-Ala- BMV Gag (7-25) Futaki et
at. Ala-Arg-Arg-Asn-Arg-Trp-Thr-Ala-Arg (SEQ ID NO:7)
Thr-Arg-Arg-Gln-Arg-Thr-Arg-Arg-Ala-Arg- HTLV-II Rex (4-16 Futaki
et al. Arg-Asn-Arg (SEQ ID NO:8)
Lys-Leu-Thr-Arg-Ala-Gln-Arg-Arg-Ala-Ala- CCMV Gag (7-25) Futaki et
al. Ala-Arg-Lys-Asn-Lys-Arg-Asn-Thr-Arg (SEQ ID NO:9)
Asn-Ala-Lys-Thr-Arg-Arg-His-Glu-Arg-Arg- P22 N (14-30) Futaki et
al. Arg-Lys-Leu-Ala-Ile-Glu-Arg (SEQ ID NO:10)
Met-Asp-Ala-Gln-Thr-Arg-Arg-Arg-Glu-Arg- .gamma.N (1-22) Futaki et
al. Arg-Ala-Glu-Lys-Gln-Ala-Gln-Trp-Lys-Ala- Ala-Asn (SEQ ID NO:11)
Thr-Ala-Lys-Thr-Arg-Tyr-Lys-Ala-Arg-Arg- .phi.21 N (12-29) Futaki
et al. Ala-Glu-Leu-Ile-Ala-Glu-Arg-Arg (SEQ ID NO:12)
Thr-Arg-Arg-Asn-Lys-Arg-Asn-Arg-Lys- Yeast PRP6 (129- Futaki et al.
Gln-Glu-Gln-Leu-Asn-Leu-Lys 144) (SEQ ID NO:13)
Lys-Arg-Arg-Ile-Arg-Arg-Glu-Arg-Gln-Lys- Human cFos (139- Futaki et
al. Met-Ala-Ala-Ala-Lys-Ser-Arg-Asn-Arg-Arg- 164)
Arg-Glu-Leu-Thr-Asp-Thr (SEQ ID NO:14)
Gly-Arg-Lys-Lys-Arg-Arg-Gln-Arg-Arg-Arg- D-Tat Futaki et al.
Pro-Pro-Gln (SEQ ID NO:15) Gly-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-
R.sub.9-Tat Futaki et al. Pro-Pro-Gln (SEQ ID NO:16)
Arg-Ile-Lys-Ala-Glu-Arg-Lys-Arg-Met-Arg- Human cJun (252- Futaki et
al. Asn-Arg-Ile-Ala-Ala-Ser-Lys-Ser-Arg-Lys- 279)
Arg-Lys-Leu-Glu-Arg-Ile-Ala-Arg (SEQ ID NO:17)
Arg-Arg-Arg-Arg-Arg-Arg R.sub.6 Futaki et al. (SEQ ID NO:18)
Lys-Arg-Ala-Arg-Asn-Thr-Glu-Ala-Ala-Arg- Yeast GCN4 (231- Futaki et
al. Arg-Ser-Arg-Ala-Arg-Lys-Leu-Gln-Arg-Met- 252) Lys-Gln (SEQ ID
NO:19)
[0036] The person of skill in the art will realize that although
the transport peptides shown in Table 1 typically contain L-amino
acids, transport peptides comprising D-amino acids, in whole or in
part, such as D43-58 (Derossi et al.), are also within the scope of
the invention. Such peptides may have the benefit of being more
stable, for example, less susceptible to proteolysis than the
L-enantiomer. The skilled artisan will appreciate that a
genetically-engineered construct comprising a nucleic acid sequence
encoding transport peptide, for example, but not limited to, one of
the peptides shown in Table 1 (with or without D-amino acid
residues) operatively linked to a nucleic acid sequence encoding a
growth factor, an antioxidant, or an extracellular matrix
component, would produce a transport-enhanced growth factor,
transport-enhanced antioxidant, or transport-enhanced extracellular
matrix component, either inducibly or constitutively depending on
the construct. Such genetically-engineered constructs, when
operatively linked to appropriate regulatory sequences, such as one
or more promoter, one or more enhancer, a polyA encoding sequence,
and a termination sequence, could under appropriate conditions be
used to stably transform eukaryotic cells, including, but not
limited to human cells, using methods known in the art. These
stably transformed cells could be used to seed three-dimensional
frameworks, collagen gels, or the like, and then propagated using
conventional methods to generate a three-dimensional culture. The
conditioned media from these cultures would, under appropriate
conditions, comprise the transport-enhanced growth factor,
transport-enhanced antioxidant, and/or transport-enhanced
extracellular matrix component.
[0037] Examples of transport enhancing peptides and methods of
genetically-engineering transport-enhanced molecules may be found
in, among other places, Stephens et al., Proc. Natl. Acad. Sci., in
press (2001) (www.pnas.org.cqi/doi/pnas.081065198): Schwarze et
al., Trends in Cell Biology, 10:290-95 (2000); Falwell et al.,
Proc. NatI. Acad. Sci. 91:664-68 (1994); Pooga et al., FASEB J.
12:67-77 (1998); Vives et al., J. Biol. Chem. 272:16010-17 (1997);
Derossi et al., J. Biol. Chem. 271:18188-93 (1996); Kwon et al.,
FEBS Letters 485:163-67 (2000); Barka et al., J. Histochem.
Cytochem. 48:1453-60 (2000); Steffen, Methods in Mol. Biol.
161:141-148 (2001); and Futaki et al., J. Biol. Chem. 276:5836-40
(2001).
[0038] Descriptions of conventional molecular biology techniques
and protocols may be found in, among other places, Ausbel et al.,
Current Protocols in Molecular Biology, John Wiley & Sons, Inc.
(1995, including supplements through Jun. 7, 2001) ("Ausbel et
al."); Sambrook et al., Molecular Cloning: A Laboratory Manual, 2
ed., Cold Spring Harbor Press (1989) ("Sambrook et al."); Sambrook
and Russell, Molecular Cloning: A Laboratory Manual, 3 ed., Cold
Spring Harbor Press (2001) ("Sambrook and Russell").
[0039] The term "transport-enhanced growth factor",
"transport-enhanced antioxidant", or "transport-enhanced
extracellular matrix component" as used herein refers to any
protein or polypeptide having the growth factor, antioxidant, or
extracellular matrix component properties, respectively, as the
corresponding naturally-occurring growth factor, antioxidant, or
extracellular matrix component, other than cell permeation or
transport. For example, but not limited to, transport-enhanced VEGF
and naturally-occurring VEGF. A specific transport-enhanced growth
factor or transport-enhanced antioxidant refers to (1) an amino
acid sequence encoded by a gene fragment encoding a specific growth
factor or a specific antioxidant fused to a gene fragment encoding
a transport peptide, and biologically active peptide or polypeptide
fragments derived therefrom, (2) naturally-occurring allelic
variants of the gene fragment which result in one or more amino
acid substitutions, deletions, and/or insertions as compared to the
corresponding naturally-occurring growth factor or antioxidant
and/or (3) chemically modified derivatives as well as nucleic acid
and or amino acid sequence variants thereof as provided for
herein.
[0040] As used herein, the term "transport-enhanced growth factor
fragment" or "transport-enhanced antioxidant fragment" refers to a
peptide or polypeptide that contains less than the full length
amino acid sequence of naturally occurring transport-enhanced
growth factor or transport-enhanced antioxidant, but has
substantially the same biological activity as transport-enhanced
growth factor or transport-enhanced antioxidant. Such a fragment
may be truncated at the amino terminus, the carboxy terminus,
and/or internally, and may be chemically modified.
[0041] As used herein, the term "transport-enhanced growth factor
derivative" or "transport-enhanced growth factor variant" refers to
a transport-enhanced growth factor, or fragment that 1) has been
chemically modified, as for example, by addition of one or more
polyethylene glycol molecules, sugars, phosphates, or other such
molecules not naturally attached to naturally-occurring growth
factor, and/or 2) contains one or more nucleic acid or amino acid
sequence substitutions, deletions, and/or insertions as compared to
the naturally-occurring growth factor. As used herein, the term
"transport-enhanced antioxidant derivative" or "transport-enhanced
antioxidant variant" refers to a transport-enhanced antioxidant, or
fragment that 1) has been chemically modified, as for example, by
addition of one or more polyethylene glycol molecules, sugars,
phosphates, or other such molecules not naturally attached to the
corresponding naturally-occurring antioxidant, and/or 2) contains
one or more nucleic acid or amino acid sequence substitutions,
deletions, and/or insertions as compared to the naturally-occurring
antioxidant.
[0042] Percent sequence identity can be determined by standard
methods that are commonly used to compare the similarity in
position of the amino acids of two polypeptides. By way of example,
using a computer program such as BLAST or FASTA, the two
polypeptides for which the percent sequence identity is to be
determined are aligned for optimal matching of their respective
amino acids (the "matched span", which can include the full length
of one or both sequences, or a pre-determined portion of one or
both sequences). Each computer program provides a "default" opening
penalty and a "default" gap penalty, and a scoring matrix such as
PAM 250. A standard scoring matrix (see Dayhoff et al., in: Atlas
of Protein Sequence and Structure, vol. 5, supp. 3 (1978)) can be
used in conjunction with the computer program. The percent identity
can then be calculated by determining the percent identity using an
algorithm contained in a program such as FASTA: ##EQU1##
[0043] Polypeptides that are at least 70 percent identical will
typically have one or more amino acid substitutions, deletions,
and/or insertions as compared with the corresponding
naturally-occurring growth factor or antioxidant. Usually, the
substitutions will be conservative so as to have little or no
effect on the overall net charge, polarity, or hydrophobicity of
the protein but optionally may increase the activity of the
transport-enhanced growth factor or transport-enhanced antioxidant.
Conservative substitutions are set forth in Table 2 below.
TABLE-US-00002 TABLE 2 Conservative Amino Acid Substitutions Basic:
arginine lysine histidine Acidic: glutamic acid aspartic acid
Polar: glutamine asparagine Hydrophobic: leucine isoleucine valine
Aromatic: phenylalanine tryptophan tyrosine Small: glycine alanine
serine threonine methionine
[0044] As used herein, the terms "effective amount",
"therapeutically-effective amount", and "cosmeceutically-effective
amount" refer to the amount of conditioned media or extract
necessary to produce the desired pharmaceutical or cosmeceutical
effect.
[0045] The transport-enhanced growth factors or transport-enhanced
antioxidants that have use in practicing the present invention may
be naturally occurring full length polypeptides, or truncated
polypeptides or peptides (i.e, "fragments"). The polypeptides or
fragments may be chemically modified, i.e., glycosylated,
phosphorylated, and/or linked to a polymer, as described below. In
addition, the polypeptides or fragments may be variants of the
corresponding naturally-occurring growth factors or antioxidants
(i.e., may contain one or more amino acid deletions, insertions,
and/or substitutions as compared with naturally-occurring growth
factor or antioxidant).
[0046] The full length transport-enhanced growth factor or
fragments thereof or full length transport-enhanced antioxidant or
fragments thereof can be prepared using well known recombinant DNA
technology methods. Alternatively, a gene fragment encoding the
transport-enhanced growth factor or fragment, or the
transport-enhanced antioxidant or fragment may be prepared by
chemical synthesis using methods well known to the skilled artisan
such as those described by Engels et al.(Angew. Chem. Intl. Ed.,
28:716-734 (1989)). These methods include, inter alia, the
phosphotriester, phosphoramidite, and H-phosphonate methods for
nucleic acid synthesis. A preferred method for such chemical
synthesis is polymer-supported synthesis using standard
phosphoramidite chemistry. Typically, the DNA encoding the
transport-enhanced growth factor or transport-enhanced antioxidant
will be several hundred nucleotides in length. Nucleic acids larger
than about 100 nucleotides can be synthesized as several fragments
using these methods. The fragments can then be ligated together to
form the full length transport-enhanced growth factor of the
transport-enhanced antioxidant. In certain embodiments, the DNA
fragment encoding the amino terminus of the polypeptide will have
an ATG, which encodes a methionine residue. This methionine may or
may not be present on the mature form of the transport-enhanced
growth factor or transport-enhanced antioxidant.
[0047] In some cases, it may be desirable to prepare nucleic acid
and/or amino acid variants of naturally-occurring growth factor or
antioxidant. Nucleic acid variants (wherein one or more nucleotides
are designed to differ from the wild-type or naturally-occurring
growth factor or antioxidant) may be produced using site directed
mutagenesis or PCR amplification where the primer(s) have the
desired point mutations (see Sambrook et al., Sambrook and Russell,
and Ausubel et al., for descriptions of mutagenesis techniques).
Chemical synthesis using methods described by Engels et al., supra,
may also be used to prepare such variants. Other methods known to
the skilled artisan may be used as well. Preferred nucleic acid
variants are those containing nucleotide substitutions accounting
for codon preference in the host cell that is to be used to produce
the transport-enhanced growth factor or transport-enhanced
antioxidant. Other preferred variants are those encoding
conservative amino acid changes as described above (e.g., wherein
the charge or polarity of the naturally occurring amino acid side
chain is not altered substantially by substitution with a different
amino acid) as compared to wild type, and/or those designed to
either generate a novel glycosylation and/or phosphorylation
site(s) on growth factor or antioxidant component of the
transport-enhanced protein, or those designed to delete an existing
glycosylation and/or phosphorylation site(s) on the growth factor
or antioxidant component of the transport-enhanced protein.
[0048] The fused gene fragment encoding the transport-enhanced
growth factor or the fused gene fragment encoding the
transport-enhanced antioxidant can be inserted into an appropriate
expression vector for expression in a host cell. The vector is
typically selected to be functional in the particular host cell
employed (i.e., the vector is compatible with the host cell
machinery such that amplification of the fused gene fragment and/or
expression of the fused gene fragment can occur).
[0049] Typically, the vectors used in any of the host cells will
contain 5' flanking sequence (also referred to as a "promoter") and
other regulatory elements as well such as an enhancer(s), a
transcriptional termination element, a complete intron sequence
containing a donor and acceptor splice site, a signal peptide
sequence, a ribosome binding site element, a polyadenylation
sequence, a polylinker region for inserting the nucleic acid
encoding the polypeptide to be expressed, and a selectable marker
element. Each of these elements are discussed below. Optionally,
the vector may contain a "tag" sequence, i.e., an oligonucleotide
sequence located at the 5' or 3' end of the transport-enhanced
growth factor or transport-enhanced antioxidant coding sequence
that encodes polyHis (such as hexaHis) or another small immunogenic
sequence. This tag will be expressed along with the protein, and
can serve as an affinity tag for purification of the
transport-enhanced growth factor or transport-enhanced antioxidant
from the host cell. Optionally, the tag can subsequently be removed
from the purified transport-enhanced growth factor or
transport-enhanced antioxidant by various means such as using an
appropriate peptidase.
[0050] The 5' flanking sequence may be homologous (i.e., from the
same species and/or strain as the host cell), heterologous (i.e.,
from a species other than the host cell species or strain), hybrid
(i.e., a combination of 5' flanking sequences from more than one
source), synthetic, or it may be the native growth factor or
antioxidant 5' flanking sequence. As such, the source of the 5'
flanking sequence may be any eukaryotic cell, typically mammalian
cells, preferably humnan cells, provided that the 5' flanking
sequence is functional in, and can be activated by, the host cell
machinery.
[0051] The 5' flanking sequences useful in the vectors of this
invention may be obtained by any of several methods well known in
the art. Typically, 5' flanking sequences useful herein other than
the naturally-occurring growth factor or antioxidant 5' flanking
sequence will have been previously identified by mapping and/or by
restriction endonuclease digestion and can thus be isolated from
the proper tissue source using the appropriate restriction
endonucleases. In some cases, the full nucleotide sequence of the
5' flanking sequence may be known. Here, the 5' flanking sequence
may be synthesized using conventional molecular biology
methods.
[0052] Where all or only a portion of the 5' flanking sequence is
known, it may be obtained using PCR and/or by screening a genomic
library with suitable oligonucleotide and/or 5' flanking sequence
fragments from the same or another species.
[0053] Where the 5' flanking sequence is not known, a fragment of
DNA containing a 5' flanking sequence may be isolated from a larger
piece of DNA that may contain, for example, a coding sequence or
even another gene or genes. Isolation may be accomplished by
restriction endonuclease digestion using one or more carefully
selected enzymes to isolate the proper DNA fragment. After
digestion, the desired fragment may be isolated by agarose gel
purification, Qiagen.RTM.) column (Valencia, Calif.) or other
methods known to the skilled artisan. Selection of suitable enzymes
to accomplish this purpose will be readily apparent to one of
ordinary skill in the art.
[0054] The transcription termination element is typically located
3' of the end of the transport-enhanced growth factor coding
sequence or the transport-enhanced antioxidant coding sequence and
serves to terminate transcription of the transport-enhanced growth
factor or transport-enhanced antioxidant.
[0055] A selectable marker gene element encodes a protein necessary
for the survival and growth of a host cell grown in a selective
culture medium, such as G418, or a readily identifiable marker,
such as green fluorescent protein (GFP).
[0056] The ribosome binding element, commonly called the Kozak
sequence in eukaryotes, is necessary for translation initiation of
mRNA. The element is typically located 3' to the promoter and 5' to
the coding sequence of the transport-enhanced growth factor or
transport-enhanced antioxidant to be synthesized.
[0057] In many cases, transcription of the transport-enhanced
growth factor or transport-enhanced antioxidant is increased by the
presence of one or more introns on the vector. This is particularly
true where the transport-enhanced growth factor or
transport-enhanced antioxidant is produced in eukaryotic host
cells, especially mammalian host cells. The introns used may be
naturally-occurring within the corresponding growth factor or
antioxidant sequence, especially where the growth factor or
antioxidant sequence used is a full length genomic sequence or a
fragment thereof. Where the intron is not naturally-occurring
within the growth factor or antioxidant sequence (as for most
cDNAs), the intron(s) may be obtained from another source. The
position of the intron with respect to the 5' flanking sequence and
the growth factor or antioxidant coding sequence is important, as
the intron must be transcribed to be effective. As such, where the
growth factor or antioxidant nucleic acid sequence is a cDNA
sequence, the preferred position for the intron is 3' to the
transcription start site, and 5' to the polyA transcription
termination sequence. Preferably for growth factor or antioxidant
cDNAs, the intron will be located on one side or the other (i.e.,
5' or 3') of the growth factor or antioxidant coding sequence such
that it does not interrupt the coding sequence. Any intron from any
source, including any virus or eukaryotic organism, may be used to
practice this invention, provided that it is compatible with the
host cell(s) into which it is inserted. Also included herein are
synthetic introns. Optionally, more than one intron may be used in
the vector.
[0058] Where one or more of the elements set forth above are not
already present in the vector to be used, they may be individually
obtained and ligated into the vector. Methods used for obtaining
each of the elements are well known to the skilled artisan and are
comparable to the methods set forth above (i.e., synthesis of the
DNA, library screening, and the like).
[0059] The final vectors used to practice this invention are
typically constructed from a starting vectors such as a
commercially available vector. Such vectors may or may not contain
some of the elements to be included in the completed vector. If
none of the desired elements are present in the starting vector,
each element may be individually ligated into the vector by cutting
the vector with the appropriate restriction endonuclease(s) such
that the ends of the element to be ligated in and the ends of the
vector are compatible for ligation. In some cases, it may be
necessary to "blunt" the ends to be ligated together in order to
obtain a satisfactory ligation. Blunting is accomplished by first
filling in "sticky ends" using Klenow DNA polymerase or T4 DNA
polymerase in the presence of all four nucleotides. This procedure
is well known in the art and is described for example in Sambrook
et al.
[0060] Alternatively, two or more of the elements to be inserted
into the vector may first be ligated together (if they are to be
positioned adjacent to each other) and then ligated into the
vector.
[0061] Another method for constructing the vector comprises
ligating all of the various elements simultaneously in one reaction
mixture. Here, many nonsense or nonfunctional vectors will be
generated due to improper ligation or insertion of the elements,
however the functional vector may be identified and selected by
restriction endonuclease digestion.
[0062] Preferred vectors for practicing this invention are those
which are compatible with mammalian host cells, particularly human
cells. The skilled artisan will know that such vectors may be
commercially available. After the vector has been constructed and
the gene fragment encoding the transport peptide and the growth
factor or antioxidant has been inserted into the proper site of the
vector, the completed vector may be inserted into a suitable host
cell.
[0063] Suitable cells or cell lines may be mammalian cells,
preferably human cells such as human dermal fibroblasts,
keratinocytes, or other cell types suitable for three-dimensional
culture, as described above.
[0064] Insertion of the vector into the selected host cell may be
accomplished using such methods as calcium chloride precipitation,
electroporation, microinjection, lipofection or the DEAE-dextran
method. The method selected will in part be a function of the type
of host cell to be used. These methods and other suitable methods
are well known to the skilled artisan, and are set forth, for
example, in Sambrook et al., Sambrook and Russell, or Ausbel et
al.
[0065] The host cells containing the vector may be cultured using
standard media well known to the skilled artisan. The media will
usually contain all nutrients necessary for the growth and survival
of the cells. The host cells may be transiently transformed or
stably transformed, depending on the long term presence of the
vector. Typically, stably transformed cells are desired for seeding
three-dimensional cultures.
[0066] The amount of the transport-enhanced growth factor or
transport-enhanced antioxidant produced in the host cell can be
evaluated using standard methods known in the art. Such methods
include, without limitation, ELISA, Western blot analysis,
SDS-polyacrylamide gel electrophoresis, non-denaturing gel
electrophoresis, HPLC separation, immunoprecipitation, and the
like.
[0067] The invention, having been described above, may be better
understood by reference to examples. The following examples are
intended for illustration purposes only, and should not be
construed as limiting the scope of the invention in any way.
EXAMPLE 1
Fibroblast Monolayer Cell Culture
[0068] Normal human dermal fibroblasts, isolated from a human
foreskin, were cultured in a 150 cm.sup.2 tissue culture flasks
(Corning, Corning, N.Y.) in monolayer culture using pre-conditioned
cell culture media (in this example, high-glucose Dulbecco's
Modified Eagle's Media (DMEM; GibcoBRL, Grand Island, N.Y.)
supplemented with 10% bovine calf serum (Hyclone Laboratories,
Logan, Utah), nonessential amino acids (GibcoBRL), and 100 U/ml
penecillin-streptomycin-250 ng/ml amphoterecin B (GibcoBRL) ("DMEM
1") in a 37.degree. C., 5% CO.sub.2 incubator. Monolayer cultures
were fed twice weekly with fresh pre-conditioned media and passaged
weekly using a 1 to 10 split, as described. See generally, Pinney
et al., J. Cell. Physio., 183:74-82 (2000). The dermal fibroblasts
may also be expanded in roller bottles with DMEM 1. The conditioned
media from these monolayer cultures is collected and saved for
future use.
[0069] While fibroblast cells have been used for illustrative
purposes in this example, the skilled artisan will understand that
many other types of cells, for example, but not limited to, other
epithelial cell types, endothelial cells, smooth muscle cells,
myocytes, keratinocytes, chondrocytes, and the like, may be grown
in monolayer culture and in three-dimensional culture.
EXAMPLE 2
Fibroblast Three-Dimensional Culture
[0070] Human dermal fibroblasts, for example, from Example 1, can
be seeded onto a variety of three-dimensional frameworks or
suspended in a collagen matrix, using conventional technology. For
example, cells can be seeded onto a bioabsorbable polyglactin mesh
framework, such as Vicryl.TM., a substance commonly used for suture
material that is composed of biodegradable mesh fibers of
polyglactin 910 (a copolymer of 90:10 polyglycolic acid to
polylactic acid) or a three-dimensional lactate/glycolate polymer
framework.
[0071] Fibroblasts were cultured for approximately two weeks on a
three-dimensional lactate/glycolate copolymer framework in
antibiotic-free, high-glucose DMEM supplemented with 10% calf
serum, 2 mM L-glutamine, non-essential amino acids, and 50 .mu.g/ml
ascorbate (J. T. Baker) ("DMEM 2"). In the presence of DMEM 2 and
under conditions appropriate for cell growth, the fibroblasts
proliferate to fill the interstices of the framework. The cells
secrete collagen and other extracellular matrix components, growth
factors, and cytokines, among other things, and create a
three-dimensional human tissue, such as Dermagrafto.RTM., a
tissue-engineered product developed for inter alia the treatment of
diabetic foot ulcers (Advanced Tissue Sciences, La Jolla, Calif.);
see Naughton, Dermal Equivalents, pp. 891-902, in Principles of
Tissue Engineering, 2d ed., Lanza et al., eds., Academic Press,
2000.
[0072] The cultures were fed every 3-4 days with pre-conditioned
DMEM 2 and the conditioned media was collected, starting after day
10, and either tested immediately or frozen at -20.degree. C. for
future testing. To quantitate the concentration of various growth
factors and cytokines in one preparation of conditioned media,
immunoassays were performed using the appropriate commercially
available human growth factor ELISA kits (Quantikine.RTM.)
Immunoassays, R & D Systems, Minneapolis, Minn.).
Pre-conditioned DMEM 2 was assayed in parallel as a negative
(background) control. Although the assays were identified as
species specific, certain lots of bovine serum showed low levels of
cross-reactivity in the TGFP ELISA As shown in Table 3, the
conditioned media comprised at least six culture-derived growth
factors. TABLE-US-00003 TABLE 3 Growth Factor and Cytokine
Concentrations in Conditioned Media (background subtracted) Growth
Factor Concentration ng/ml VEGF 3.2 ng/ml G-CSF 2.3 ng/ml IL-6 0.9
ng/ml IL-8 3.2 ng/ml KGF 1.67 ng/ml TGF.beta. 0.8 ng/ml EGF Not
Detected FGF Not Detected
[0073] The skilled artisan will understand that, while these
illustrative examples describe DMEM-based pre-conditioned media,
depending on the cell type being cultured, many other types of cell
culture media may be used. Exemplary cell culture media include
Minimum Essential Medium Eagle (MEM), Keratinocyte Medium,
Melanocyte Medium, Hepaotcyte Medium, Amniocyte Medium, Bone Marrow
Medium, Basal Medium Eagle (BME), BGJb Medium (Fitton-Jackson
Modification), Iscove's Modified Dulbecco's Medium (IMDM), L-15
Medium (Liebovitz), McCoy's 5A Modified Medium, MCDB Medium, Medium
199, Ham's F-10 Medium, Ham's F-12 Medium, RPMI-1640, Waymouth
Medium, and the like; commercially available from, among others,
Sigma-Aldrich, Life Technologies-GibcoBRL, or BioWhittaker.
EXAMPLE 3
Alternative Three-Dimensional Fibroblast Culture
[0074] Passage 8 human dermal fibroblasts were seeded into
conventional 1750 cm.sup.2 corrugated roller bottles (Nalge or
Nunc) containing a sterile nylon mesh scaffold (Industrial Fabrics)
sitting on or near the inner surface of the roller bottle. The
passage 8 fibroblasts were seeded at a density of approximately
4-6.times.10.sup.7 cells per roller bottle and cultured in
antibiotic-free pre-conditioned media (DMEM (# 078-0521-189, Life
Technologies-Gibco), supplemented with 2 mM L-glutamine (Life
Technologies), non-essential amino acids (Life Technologies), 56
mg/l L-ascorbic acid (J. T. Baker), and 10% calf serum (HyClone
Laboratories)). The roller bottles were incubated at 37.degree. C.
in a roller apparatus. The medium in the roller bottles was
replaced daily or every other day using the pre-conditioned media
described above and the conditioned cell culture media was
collected. The VEGF level in the conditioned media was quantitated
by ELISA, using the Quantikine human VEGF assay (R & D Systems,
Minneapolis, Minn.) according to the manufacturer's
instructions.
[0075] The conditioned media was pre-filtered to remove large
particulate, such as cell debris using a 3M.TM. 522 High
Performance Liquid Filter Bag (Southcoast) with a 2.5 micron rating
to produce "filtered media" (also referred to as 1.times.
conditioned media). For certain applications the filtered media was
concentrated in a cross flow hollow fiber ultrafiltration cartridge
(Model #UFP-10-C-55A, A/G Technology Corp., Needham, Mass.) at a
flow rate of 25 liters per minute, according to the manufacturer's
Operating Guide. The "nutrient solution," (also referred to as
10.times. conditioned media) concentrated to approximately three to
fifteen times the initial concentration, was collected.
[0076] The 1.times. and 10.times. conditioned media is used by
formulators for preparing compositions comprising cosmetic,
cosmeceutical, or pharmaceutical formulations with
cosmetically-acceptable, cosmeceutically-acceptable or
pharmaceutically-acceptable carriers. The skilled artisan will
appreciate that cosmetically-acceptable carriers,
cosmeceutically-acceptable carriers and pharmaceutically-acceptable
carriers may be the same or different, depending on the intended
application of the composition.
[0077] The person of skill in the art will understand that although
roller bottles are described in this example, any number of
bioreactors may be employed with appropriate modifications to the
described conditions. The skilled artisan will also understand that
any number of methods of processing the conditioned media, for
example, but not limited to, chromatography, HPLC, phase
separation, spray drying, evaporation, lyophilization, and the
like, using methods known in the art.
EXAMPLE 4
Effect of Conditioned Media on Cell Proliferation
[0078] To verify that the culture-derived growth factors, such as
measured in Example 2, were biologically active, human
keratinocytes or fibroblasts were incubated with the conditioned
media and their proliferation was measured. Briefly,
5.times.10.sup.3 human keratinocytes or human fibroblasts were
seeded into wells of a 96-well plate. These cells were fed with
either serum-free media, pre-conditioned media, or pre-conditioned
media supplemented with 10% (vol/vol) concentrated conditioned
medium and incubated for 48 hours. After incubation the cells were
freeze lysed and 200 mL of Cyquant dye was added (Molecular Probes,
Eugene, Oreg.) and fluorescence was measured in a Cytoflour. EBM
controls were used for a baseline. As shown in FIG. 1, in this
experiment, the propagation of both keratinocytes and fibroblasts
was highest in the conditioned media.
EXAMPLE 5
Antioxidant Effect of Conditioned Media
[0079] This example demonstrates the antioxidant activity of
conditioned media. Primary epidermal keratinocytes in Keratinocyte
SFM (GibcoBRL) are plated at 1.times.10.sup.5 cells/cm.sup.2 in
conventional 12 well tissue culture plates and allowed to incubate
overnight in a 37.degree. C., 5% CO.sub.2 incubator. The next day
the media is replaced with fresh Keratinocyte SFM, DMEM 1, or DMEM
1 supplemented with conditioned media. The plates are returned to
the incubator and cultured for 10 days. Cells are washed once in
PBS, then dihydrorhodamine 123 (Molecular Probes, Eugene Oreg.) is
added to a final concentration of 1 uM using a 1 mM stock solution
in DMSO. Dihydrorhodamine 123 intercalates in cell membranes in a
non-fluorescent form. When oxidized, this dye is converted to the
fluorescent rhodamine derivative. The mean fluorescence is thus a
measure of the total intracellular oxidative state. See, Handbook
of Fluorescent Probes and Research Products, .sub.8.sup.th ed.,
Chapter 19, Molecular Probes, Eugene, Oreg.; Royall et al., Arch.
Biochem. Biophys. 302:348-55 (1993).
[0080] Cells are incubated for an additional 30 minutes in the
incubator, then trypsinized and fixed in 2-paraformaldehyde.
Fluorescence intensity is measured on a FACScan (Becton-Dickinson).
In this experiment, cells grown in conditioned media have a
significantly lower intracellular oxidation level compared to cells
grown in either the pre-conditioned or the serum-free medium (see
FIG. 2).
EXAMPLE 6
HPLC Analysis of Antioxidants in the Conditioned Media
[0081] To quantify specific antioxidants present in the cultured
media, aliquots of filtered media from Example 3 were analyzed
using an HPLC electrochemical detection system (Couloarray
Detection System, ESA Inc). The electrochemical detector was set in
series with a UV detector for 2-dimensional characterization of
compounds and metabolites (Roy et al., Simultaneous Detection of
Tocopherols and Tocotrienols in Biological Samples Using
HPLC-Coulometric Electrode Array. Meth. Enzymol., 2001 (in
press)).
[0082] a. Vitamin E (.alpha.-tocopherol and .gamma.-tocopherol)
[0083] Phosphate buffered saline containing 1 mM Na.sub.2EDTA, BHT
(10 mg/ml) and SDS was added to the sample. The mixture was
vigorously vortexed for 15 min at 4.degree. C. and ethanol was
added. Vitamin E was extracted in hexane. Hexane phase was
collected and dried under nitrogen. Samples were re-dissolved in
vitamin E mobile phase and injected to the HPLC system. Authentic
compounds were used to generate standard curves, as described (Sen
et al., Molecular basis of vitamin E action. Tocotrienol potently
inhibits glutamate-induced pp60(c-Src) kinase activation and death
of HT4 neuronal cells. J Biol Chem. 2000 Apr 28;275(17):13049-55;
Roy et al., Simultaneous Detection of Tocopherols and Tocotrienols
in Biological Samples Using HPLC-Coulometric Electrode Array. Meth.
Enzymol. 2001 (in press)). As shown in FIG. 3A, this filtered media
preparation comprised 1.62 .mu.M .alpha.-tocopherol and 0.06 .mu.M
V-tocopherol.
[0084] b. Glutathione
[0085] Glutathione (GSH) was extracted from acidified samples and a
C-18 column (150 mm.times.4.6 mm, 5 .mu.m pore size; Alitech,
Deerfield, Ill.) was used for GSH separation. HPLC was performed as
described (Sen et al., Molecular basis of vitamin E action.
Tocotrienol potently inhibits glutamate-induced pp60(c-Src) kinase
activation and death of HT4 neuronal cells. J Biol Chem. 2000 April
28;275(17):13049-55). As shown in FIG. 3B, this filtered media
preparation contained 3.36 nM GSH.
[0086] c. Cysteine and Cystine
[0087] The samples were acidified using 8% m-phosphoric acid and
the proteins were precipitated by centrifugation. Resultant
extracts were filtered and injected into the HPLC instrument. For
detection of cystine (oxidized-form), the samples were first
treated with 2-mercaptoethanol for 10 min at room temperature
followed by acid extraction with 8% m-phosphoric acid, as described
above. HPLC conditions were similar to those of glutathione except
for the mobile phase, the composition was 50 mM sodium phosphate
(pH 3.0). As shown in FIGS. 3C and D, respectively, this filtered
media preparation comprised 10.64 .mu.M cysteine (reduced form) and
112.1 .mu.M cysteine plus cystine.
[0088] Collectively these results demonstrate that the conditioned
media comprises culture-derived antioxidants. HPLC testing for
additional antioxidants, such as ubiquinone, ubiquinol, superoxide
dismutase, catalase, glutathione peroxidase, and the like can be
performed using the same or similar methodology. Alternatively,
antioxidant enzyme activity can be determined using appropriate
enzyme assays, as known in the art.
EXAMPLE 7
Effect of Conditioned Media on Collagen Deposition
[0089] This example demonstrates the effect of conditioned media on
the deposition of extracellular matrix components by fibroblast in
three-dimensional cell cultures. Collagen type I pro-peptide (also
known as collagen type I telopeptide) was used as an indicator of
collagen type I, itself an indicator of extracellular matrix
component production. Conditioned media was obtained from the
end-term media change in the Dermagraft.RTM. process (approximately
2 weeks) and concentrated by ultrafiltration in a concentrator
(Amicon, Beverley, Mass.) under nitrogen pressure. When volume of
the conditioned media was concentrated to about one-tenth of the
original volume, the concentrated conditioned media was collected.
Human dermal fibroblasts in DMEM 1 were seeded into wells of a
96-well tissue culture plate at 5.times.10.sup.3 cells/well and
placed in a 37.degree. C., 5% CO.sub.2 incubator for approximately
48 hours. The media was replaced with either DMEM 1 or DMEM I
supplemented with 10% concentrated conditioned media so that the
final concentration of the conditioned media was approximately
1.times.. The plate was returned to the incubator for approximately
24 hours. The supernatant was collected from each well and tested
for the presence of collagen type I pro-peptide using a
commercially available collagen type I pro-peptide ELISA according
to the manufacturer's instructions (Takara Biomedicals, Japan).
[0090] As shown in FIG. 4, in this experiment a statistically
significant (p=0.05) increase in collagen deposition was observed
in cultures maintained in conditioned medium compared to cultures
maintained in the pre-conditioned medium. The skilled artisan will
appreciate that enhanced in vivo deposition of extracellular matrix
components such as collagen would be important for, among other
things, the topical treatment of wrinkles and contour defects.
EXAMPLE 8
Conditioned Serum-free or Non-human Animal Product-free Media
[0091] This prophetic example illustrates the adaptation of human
dermal fibroblast cultures grown in an exemplary serum-containing
pre-conditioned DMEM media to pre-conditioned UltraCULTURE.TM.
serum-free media using conventional technology. See, e.g.,
BioWhittaker 1999/2000 Catalog at pages 42-45. UltraCULTURE.about.
(BioWhittaker Cat. No. 12-725F) media is supplemented with
L-glutamine (Cat. No.17-605) according to the manufacturer's
instructions (pre-cond itioned UltraCULTURE.TM. serum-free
media).
[0092] Monolayer cultures of human dermal fibroblasts are prepared
as described in Example 1 above, using pre-conditioned DMEM cell
culture media (high-glucose Dulbecco's Modified Eagle's Media
(DMEM; GibcoBRL, Grand Island, NY) supplemented with 10% bovine
calf serum (Hyclone Laboratories, Logan, Utah), nonessential amino
acids (GibcoBRL), and 100 U/ml penecillin-streptomycin-250 ng/ml
amphoterecin B (GibcoBRL). The cells are passaged, and split 1:2
using pre-conditioned UltraCULTURE.TM. serum-free media as the
diluent. The cells are plated and incubated in a 37.degree. C., 5%
CO.sub.2 incubator until maximum cell density is achieved, feeding
with pre-conditioned UltraCULTURE.TM. serum-free media as
necessary.
[0093] If the cells do not show at least 85% viability, they are
passaged at a 1:2 ratio using pre-conditioned UltraCULTURE.TM.
serum-free media supplemented with 0.5% bovine calf serum (HyClone
Laboratories) for one passage. For each successive passage the
amount of calf serum is decreased by 0.1% so that after five
passages, the pre-conditioned UltraCULTURE.TM. serum-free media
contains no serum. At this point the fibroblasts can be propagated
in three-dimensional culture, as described in Examples 2 or 3, with
the exception that the cells are maintained in pre-conditioned
UltraCULTURE.TM. serum-free media, supplemented with ascorbic acid
as appropriate. Conditioned serum-free media is collected at
suitable intervals.
[0094] If the fibroblast monolayer culture does not successfully
adapt to growth in pre-conditioned UltraCULTURE.TM. serum-free
media, an alternate weaning process is used. Cells are passaged as
described, centrifuged for 5 minutes at 350.times.g and resuspended
in pre-conditioned UltraCULTURE.TM. serum-free media containing 5%
bovine calf serum (Hyclone), split 1:2 and replated. At the next
passage, the cell pellet is resuspended in pre-conditioned
UltraCULTURE.TM. serum-free media containing 2% calf serum, split
and plated, as described. On the next five passages, the pellet is
resuspended and plated in pre-conditioned UltraCULTURE.TM.
serum-free media containing 2%, then 1%, then 0.5%, then 0.1%, and
finally 0% calf serum. At this point the fibroblasts can be
propagated in three-dimensional culture, as described in Examples 2
or 3, with the exception that the cells are maintained in
pre-conditioned UltraCULTURE.TM. serum-free media. Conditioned
media is collected as appropriate.
[0095] UltraCULTURE.TM. serum-free media was selected for this
prophetic example because, among other things, it is a DMEM-based
medium and has been shown to support the growth of a number of
human cell lines, including the HuS-1*AT skin cell line. See
BioWhittaker 1999/2000 catalog at pages 46-47. The skilled artisan
will appreciate, however, that a number of serum-free and animal
product-free media are also reasonably likely to support the growth
of various human cells and that such media can be routinely
evaluated without undue experimentation.
[0096] While this prophetic example describes the adaptation of
human dermal fibroblasts grown in an exemplary pre-conditioned DMEM
cell culture medium to an exemplary pre-conditioned serum-free cell
culture media, the skilled artisan will understand that the same
procedure could be used to adapt a variety of cultured cells, in
either serum-containing or serum-free medium, to growth in
pre-conditioned animal product-free medium. Following adaptation to
growth in animal product-free medium, such cells can be propagated
in three-dimensional culture, as described, and conditioned
non-human animal product-free medium collected as appropriate.
EXAMPLE 9
Enhancement of Expression of KGF
[0097] This example demonstrates the induction of keratinocyte
growth factor (KGF) secretion by human dermal fibroblasts in a
three-dimensional culture under appropriate conditions. Pieces of
Dermagraft.RTM.), approximately 11 mm.times.11 mm, were placed in
wells of a 24-well tissue culture plate. The cells were maintained
in a 37.degree. C., 5% CO.sub.2 incubator and fed either DMEM2 or
DMEM2 supplemented with interleukin-1-alpha (IL-1.alpha.) at a
concentration of 1 ng/ml. Conditioned media was collected every 24
hours. The concentration of KGF in the conditioned media was
determined using a human KGF immunoassay (Quantikine, R & D
Systems) according to the manufacturer's instructions. The results,
shown in FIG. 5, demonstrate that the level of KGF present in the
conditioned media from Dermagraft.RTM.) samples in the presence of
IL-1.alpha. is, in this experiment, approximately four times
greater than in the absence of IL-1.alpha.. Thus, in this
experiment, KGF expression by human dermal fibroblasts in
three-dimensional culture was enhanced by IL-1.alpha..
EXAMPLE 10
Enhancement of Expression of VEGF
[0098] This example demonstrates that the expression of VEGF by
human dermal fibroblasts in three-dimensional cultures may be
enhanced under appropriate conditions. Three-dimensional human
dermal fibroblast cultures were fed with either pre-conditioned
DMEM 2 or pre-conditioned DMEM 2 supplemented with 0.5, 1, 2, 4, or
8 nM PDGF AB (combined A chain and B chain). After incubation for
48 hours at 37.degree. C., the conditioned cell culture media was
removed and typically tested the day of collection. The quantity of
VEGF present in the six conditioned media samples (0, 0.5, 1, 2, 4,
and 8 nM PDGF) was measured using the Quantikine human VEGF
immunoassay kit (Cat. No. DVEOO, R & D Systems) according to
the manufacturer's instructions. As shown in FIG. 6, the presence
of increasing quantities of PDGF in the pre-conditioned media
resulted in an increase in VEGF secretion. In this experiment,
three-dimensional cultures in the absence of exogenous PDGF
produced approximately 1.3 ng/ml of VEGF, while parallel cultures
in media comprising up to 8 nM PDGF, produced up to approximately 6
ng/ml of VEGF. These results demonstrate that the level of VEGF
secretion can be enhanced in the presence nanomolar or even
subnanomolar concentrations of PDGF.
EXAMPLE 11
Comparison of VEGF Secretion by Culture Conditions
[0099] To evaluate the effect of culture conditions on VEGF
secretion, human dermal fibroblasts were grown in parallel in: a)
monolayer culture, b) three-dimensional collagen gel culture, c)
three-dimensional contracted collagen gel culture, and d) on a
three-dimensional scaffold. For monolayer cultures,
3.times.10.sup.6 passage 8 human dermal fibroblasts were seeded in
100 mm tissue culture dishes. The three-dimensional scaffold
comprised a 5.5.times.5.5 cm silastic-backed knitted nylon mesh
(Biobrane.RTM., Dow Hickum) that was presoaked in fetal bovine
serum. Following pretreatment, the scaffold was placed in a 100 mm
tissue culture dish and 3.times.10.sup.6 passage 8 human dermal
fibroblasts were seeded onto the scaffold ("scaffold-based"). The
dishes were placed in 37.degree. C., 5% CO.sub.2 incubator and the
cells were fed DMEM supplemented with 10% bovine calf serum, 2mM
L-glutamine, 50 .mu.g/ml ascorbate-phosphate, and 10 U/ml
penicillin-streptomycin.
[0100] The two collagen gel cultures were prepared by suspending
3.times.10.sup.6 passage 8 human dermal fibroblasts in 10 ml
Vitrogen (Collagen Corp.) and the suspension was poured into either
conventional 100 mm tissue culture dishes ("stressed gel") or, for
the contracted collagen gel culture, 100 mm non-treated culture
dishes (Costar) ("contracting gel"). The dishes were placed in
37.degree. C., 5% CO.sub.2 incubator and the cells were fed DMEM
supplemented with 10% bovine calf serum, 2mM L-glutamine, 50
.mu.g/ml ascorbate-phtosphate, and 10 U/ml penicillin-streptomycin.
The collagen rapidly polymerized in the incubator with the
fibroblasts in suspension. The collagen polymer in the conventional
tissue culture dishes remained in contact with the sides of the
dishes. In contrast, the collagen polymer in the non-treated
culture dishes contracted, causing the polymer to pull away from
the sides of the culture dish.
[0101] The cultures were fed with fresh pre-conditioned media every
three to four days. Conditioned media was collected from each of
the four culture systems after approximately two weeks and
analyzed. The amount of human VEGF produced by each of the four
cultures was determined using the Quantikine human VEGF immunoassay
(R & D Systems) following the manufacturer's instructions. The
results were standardized based on the nanograms of VEGF secreted
per 10.sup.6 cells per day. As shown in FIG. 7, in this experiment,
the monolayer culture secreted less than 1 ng VEGF/10.sup.6
cells/day, and the stressed collagen gel and contracting collagen
cultures secreted approximately 1.5 ng VEGF/10.sup.6 cells/day and
0.5 ng VEGF/1 06 cells/day, respectively. The scaffold-based
culture, by comparison, secreted more than 4.0 ng VEGF/10.sup.6
cells/day.
EXAMPLE 12
Conditioned Media Safety Study
[0102] To evaluate the safety of the conditioned media for use in
cosmeceutical compositions, nutrient solution was applied topically
to human patients and the appearance of cutaneous irritation after
successive and -continuous exposure under normal and abraided
conditions was determined.
[0103] Nutrient solution was tested for primary and cumulative
irritation on normal, human, adult, forearm skin using standard
cosmetic safety protocols. Two hundred microliters of either
control or nutrient solution was applied to a 3.8 cm.sup.2 occluded
patch (Webril non-woven cotton pad) on the upper forearm. The patch
was held in place with a 3M.RTM.D hypoallergenic tape. The primary
irritation study involved 15 subjects (13 females and two males,
28-77 years of age). Nutrient solution was applied in two 24 hour
intervals to the occluded patches on normal and abraided (tape
stripped five times using Transpore tape to remove outer layers of
the stratum corneum) skin on the subject's upper forearm of. The
cumulative irritation study involved 31 subjects (21 females and 10
males, 20-65 years of age). One subject withdrew due to tape
irritation and one due to personal reasons. Twenty-nine subjects,
19 females and 10 males completed the study. Nutrient solution was
on the upper forearm in 14, consecutive, 24 hour applications.
Gross observations were graded for glazing, peeling, scabbing,
fissuring, hyperpigmentation and hypopigmentation. Irritation was
scored visually using a 5 point scale and graded numerically for
erythema, edema, papules, vesicles, bulla reactions, weeping,
spreading, and induration. As determined by licensed health care
professionals, no adverse events were induced by the nutrient
solution or control in these studies.
EXAMPLE 13
Conditioned Media Efficacy Study
[0104] To assess the cosmeceutical effect of nutrient solution on
the histology of normal and photodamaged human skin, an occlusive
patch test was conducted, essentially as described in Example 12.
An occluded patch with nutrient solution was applied daily to the
forearm of each of 6 female subjects (37-46 years of age) from
Monday through Friday with examination on Saturday. Three subjects
received patches for 5 days and 3 subjects for 12 days. Punch
biopsies (2 mm ) were taken on the day after the last patch. The
biopsies were fixed in 10% formalin, embedded in paraffin and 4
micron sections cut and stained with H&E, tri-chrome for
collagen, Verhoeff Van Grieson stain for elastin. Irritation was
scored as in the safety studies. No significant irritation was
observed in the subjects. Upon histological examination of the
stained sections at a magnification of 100.times. and 250.times.,
no difference in cell architecture was seen between the nutrient
solution and the control. A progressive increase in epidermal
thickening and fibroblast and nuclei was seen from 0 to 2 to 4
weeks.
[0105] By week 4, the average epidermal thickness increased by 22%
and dermal fibroblast nuclei increased by 38%.
EXAMPLE 14
Clinical Evaluation of Three-Dimensional Culture (Dermagraft.RTM.)
Conditioned Media
[0106] Conditioned cell culture media was obtained from a
preparation of Dermagraft.RTM. (Advanced Tissue Sciences, La Jolla,
Calif.), a tissue-engineered product comprising human dermal
fibroblasts grown on a three-dimensional framework. The conditioned
media was applied twice daily to the forearms of six human
subjects. Biopsies were obtained at days 0, 14 and 28 of the study
and examined histologically using conventional methods. The forearm
biopsy material showed an increase in collagen type I (++),
collagen type IlIl (+++), hyaluronic acid (+++), and elastin (++)
at day 28, compared to biopsy material collected at day 0. A
progressive increase in epidermal thickening and fibroblast nuclei
was also observed histologically over the four week study
interval.
EXAMPLE 15
Generation of Transport-Enhanced Growth Factors
[0107] This prophetic example describes the generation of
transport-enhanced growth factors using conventional molecular
biology techniques. See, e.g., Ausbel et al., Sambrook and Russell,
and Sambrook et al. A gene fragment encoding a growth factor, such
as any of the growth factors identified on Table 3, is fused with a
gene fragment encoding a transport peptide, for example, but not
limited to, one of the transport peptide sequences shown in Table 1
(SEQ ID NO:1-SEQ ID NO:19). Typically, the gene fragment encoding
the transport peptide is fused upstream of the gene fragment
encoding the growth factor, such that the transport peptide is at
the amino terminus of the transport-enhanced growth factor. For
example, a fused gene fragment is generated using conventional
molecular biology techniques, such as by ligating a DNA sequence
encoding SEQ ID NO:3 with a DNA sequence encoding VEGF. The
nucleotide sequence of VEGF is known in the art. Thus, an exemplary
DNA sequence encoding the SEQ ID NO:3 transport peptide:
CGUAAAAAACGUCGUCAACGUCGUCGU (SEQ ID NO:20) is ligated to the DNA
sequence encoding VEGF. Due to the redundancy of the DNA code, the
skilled artisani will understand that many alternate sequences
encode the transport peptide and the amino acid sequence of VEGF.
For example, one of many alternate sequence encoding the SEQ ID
NO:3 transport peptide is CGCAAAAAACGCCGCCAACGCCGCCGC (SEQ ID
NO:21). Thus, the skilled artisan understands that typically, any
nucleic acid sequence that encodes the amino, acid sequence of the
desired transport peptide can be fused with any nucleic acid
sequence that encodes the amino acid sequence of the desired growth
factor to yield the transport-enhanced growth factor fused gene
fragment.
[0108] The transport-enhanced growth factor fused gene fragment is
then inserted into an appropriate expression vector for expression
in the desired host cell, typically human cells such as
fibroblasts, keratinocytes, chondrocytes, smooth muscle cells, and
the like, using conventional molecular biology techniques. The
expression vector will typically comprise a 5' flanking sequence
and other appropriate regulatory elements as well as an
enhancer(s), a transcriptional termination element, optionally, a
complete intron sequence containing a donor and acceptor splice
site, a signal peptide sequence if necessary, a ribosome binding
site element, a polyadenylation sequence, and a selectable
marker.
[0109] The transport-enhanced growth factor expression vector is
then used to tranfect, for example, but not limited to, human
dermal fibroblasts, using conventional molecular biology techniques
such as, for example, calcium phosphate co-precipitation or
electroporation. Transformed cells comprising the
transport-enhanced growth factor expression vector are selected,
using conventional molecular biology techniques, and the cells
expanded in monolayer culture. The monolayer cells may then be used
to seed three-dimensional cultures, such as those describe above.
Media conditioned using such three-dimensional cultures should
comprise the desired transport-enhanced growth factor, here
transport-enhanced VEGF.
[0110] The skilled artisan understands that while this example
describes the formation of a transport-enhanced growth factor gene
fragment using the HIV-1 Tat transduction domain (SEQ ID NO:3) and
VEGF, any number of combinations of nucleic acid sequence encoding
desired growth factors can be fused with any number of nucleic acid
sequences encoding any of the transport peptides shown in Table 1
to generate a transport-enhanced growth factor gene fragment
without undue experimentation.
EXAMPLE 16
Generation of Transport-Enhanced Antioxidants
[0111] This prophetic example describes the generation of
transport-enhanced antioxidants using conventional molecular
biology techniques. See, e.g., Ausbel et al., Sambrook and Russell,
and Sambrook et al. A gene fragment encoding an antioxidant is
fused with a gene fragment encoding a transport peptide. Typically,
the gene fragment encoding the transport peptide is fused upstream
of the gene fragment encoding the antioxidant, such that the
transport peptide is at or near the amino terminus of the
transport-enhanced antioxidant.
[0112] For example, a gene fragment encoding an antioxidant, such
as glutathione, glutathione peroxidase, glutathione reductase,
glutathione disulfide, catalase, superoxide dismutase,
alpha-tocopherol, gamma-tocopherol, ubiquinol-9, ubiquinone 9, or
ascorbic acid, is fused with a gene fragment encoding a transport
peptide, for example, but not limited to, one of the transport
peptide sequences shown in Table 1 (SEQ ID NO:1-SEQ ID NO:19).
Typically, the gene fragment encoding the transport peptide is
fused upstream of the gene fragment encoding the antioxidant, such
that the transport peptide is at the amino terminus of the
transport-enhanced antioxidant. For example, a fused gene fragment
is generated using conventional molecular biology techniques, such
as by ligating a DNA sequence encoding SEQ ID NO:18 with a DNA
encoding glutathione, the nucleotide sequence of which is readily
available in the art. Thus, an exemplary DNA sequence encoding the
SEQ ID NO:18 transport peptide: AGAAGAAGAAGAAGAAGA (SEQ ID NO:22)
is ligated to the DNA sequence encoding glutathione
(y-glutamylcysteinylglycine), for example, CAAUGUGGU (SEQ ID
NO:23). Due to the redundancy of the DNA code, the skilled artisan
will understand that many alternate sequences encode the transport
peptide and the amino acid sequence of glutathione. For example,
one of several alternate sequence encoding for glutathione is
CAAUGUGGC (SEQ ID NO:24). Thus, the skilled artisan understands
that typically, any nucleic acid sequence that encodes the amino
acid sequence of the desired transport peptide can be fused with
any nucleic acid sequence that encodes the amino acid sequence of
the desired antioxidant to yield the transport-enhanced antioxidant
fused gene fragment.
[0113] The transport-enhanced antioxidant fused gene fragment is
then inserted into an appropriate expression vector for expression
in the desired host cell, typically human cells such as
fibroblasts, keratinocytes, chondrocytes, smooth muscle cells, and
the like, using conventional molecular biology techniques. The
expression vector will typically comprise a 5' flanking sequence
and other appropriate regulatory elements as well as an
enhancer(s), a transcriptional termination element, optionally, a
complete intron sequence containing a donor and acceptor splice
site, a signal peptide sequence if necessary, a ribosome binding
site element, a polyadenylation sequence, and a selectable
marker.
[0114] The transport-enhanced antioxidant expression vector is then
used to tranfect, for example, but not limited to, human dermal
fibroblasts, using conventional molecular biology techniques such
as, for example, calcium phosphate coprecipitation or
electroporation. Stably transformed cells comprising the
transport-enhanced growth factor expression vector are selected,
using conventional molecular biology techniques, and the cells
expanded in monolayer culture. The monolayer cells may then be used
to seed three-dimensional cultures, such as those describe above.
Media conditioned using such three-dimensional cultures should
comprise the desired transport-enhanced antioxidant, here
transport-enhanced glutathione.
[0115] The skilled artisan understands that while this example
describes the formation of a transport-enhanced antioxidant gene
fragment using the R.sub.6 sequence (SEQ ID NO:18) and glutathione,
any number of combinations of nucleic acid sequence encoding
desired antioxidants can be fused with any number of nucleic acid
sequences encoding any of the transport peptides shown in Table 1
to generate a transport-enhanced antioxidant gene fragment without
undue experimentation.
[0116] Methods such as described in Examples 15 and 16 can also be
used to generate transport-enhanced extracellular matrix
components, which are also within the scope of the invention.
[0117] Although the invention has been described with reference to
various applications, methods, and compositions, it will be
appreciated that various changes and modifications may be made
without departing from the scope of the invention.
Sequence CWU 1
1
24 1 16 PRT Drosophila melanogaster 1 Arg Gln Ile Lys Ile Trp Phe
Gln Asn Arg Arg Met Lys Trp Lys Lys 1 5 10 15 2 16 PRT Drosophila
melanogaster 2 Arg Gln Ile Lys Ile Trp Phe Pro Asn Arg Arg Met Lys
Trp Lys Lys 1 5 10 15 3 9 PRT Human immunodeficiency virus type 1 3
Arg Lys Lys Arg Arg Gln Arg Arg Arg 1 5 4 27 PRT Artificial derived
from galanin and mastoparan 4 Gly Trp Thr Leu Asn Ser Ala Gly Tyr
Leu Leu Gly Lys Ile Asn Leu 1 5 10 15 Lys Ala Leu Ala Ala Leu Ala
Lys Lys Ile Leu 20 25 5 17 PRT Human immunodeficiency virus type 1
5 Thr Arg Gln Ala Arg Arg Asn Arg Arg Arg Arg Trp Arg Glu Arg Gln 1
5 10 15 Arg 6 15 PRT Human immunodeficiency virus type 1 6 Arg Arg
Arg Arg Asn Arg Thr Arg Arg Asn Arg Arg Arg Val Arg 1 5 10 15 7 19
PRT Brome mosaic virus 7 Lys Met Thr Arg Ala Gln Arg Arg Ala Ala
Ala Arg Arg Asn Arg Trp 1 5 10 15 Thr Ala Arg 8 13 PRT Human
immunodeficiency virus type 2 8 Thr Arg Arg Gln Arg Thr Arg Arg Ala
Arg Arg Asn Arg 1 5 10 9 19 PRT Cowpea chlorotic mottle virus 9 Lys
Leu Thr Arg Ala Gln Arg Arg Ala Ala Ala Arg Lys Asn Lys Arg 1 5 10
15 Asn Thr Arg 10 17 PRT Bacteriophage lambda 10 Asn Ala Lys Thr
Arg Arg His Glu Arg Arg Arg Lys Leu Ala Ile Glu 1 5 10 15 Arg 11 22
PRT Bacteriophage lambda 11 Met Asp Ala Gln Thr Arg Arg Arg Glu Arg
Arg Ala Glu Lys Gln Ala 1 5 10 15 Gln Trp Lys Ala Ala Asn 20 12 18
PRT Bacteriophage phi-21 12 Thr Ala Lys Thr Arg Tyr Lys Ala Arg Arg
Ala Glu Leu Ile Ala Glu 1 5 10 15 Arg Arg 13 16 PRT Saccharomyces
cerevisiae 13 Thr Arg Arg Asn Lys Arg Asn Arg Lys Gln Glu Gln Leu
Asn Leu Lys 1 5 10 15 14 26 PRT Homo sapiens 14 Lys Arg Arg Ile Arg
Arg Glu Arg Gln Lys Met Ala Ala Ala Lys Ser 1 5 10 15 Arg Asn Arg
Arg Arg Glu Leu Thr Asp Thr 20 25 15 13 PRT Human immunodeficiency
virus type 1 15 Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro Pro Gln
1 5 10 16 13 PRT Human immunodeficiency virus type 1 16 Gly Arg Arg
Arg Arg Arg Arg Arg Arg Arg Pro Pro Gln 1 5 10 17 28 PRT Homo
sapiens 17 Arg Ile Lys Ala Glu Arg Lys Arg Met Arg Asn Arg Ile Ala
Ala Ser 1 5 10 15 Lys Ser Arg Lys Arg Lys Leu Glu Arg Ile Ala Arg
20 25 18 6 PRT Artificial completely synthesized 18 Arg Arg Arg Arg
Arg Arg 1 5 19 22 PRT Saccharomyces cerevisiae 19 Lys Arg Ala Arg
Asn Thr Glu Ala Ala Arg Arg Ser Arg Ala Arg Lys 1 5 10 15 Leu Gln
Arg Met Lys Gln 20 20 27 RNA Artificial exemplary sequence encoding
SEQ ID NO3 20 cguaaaaaac gucgucaacg ucgucgu 27 21 27 RNA Artificial
exemplary sequence encoding SEQ ID NO3 21 cgcaaaaaac gccgccaacg
ccgccgc 27 22 18 RNA Artificial exemplary sequence encoding SEQ ID
NO18 22 agaagaagaa gaagaaga 18 23 9 RNA Artificial exemplary
sequence encoding glutathione (gamma-glutamylcysteinylglycine) 23
caauguggu 9 24 9 RNA Artificial exemplary sequence encoding
glutathione (gamma-glutamylcysteinylglycine) 24 caauguggc 9
* * * * *