U.S. patent application number 11/709968 was filed with the patent office on 2007-09-13 for methods for detection of a target nucleic acid.
This patent application is currently assigned to Stratagene California. Invention is credited to Joseph A. Sorge.
Application Number | 20070212726 11/709968 |
Document ID | / |
Family ID | 24927402 |
Filed Date | 2007-09-13 |
United States Patent
Application |
20070212726 |
Kind Code |
A1 |
Sorge; Joseph A. |
September 13, 2007 |
Methods for detection of a target nucleic acid
Abstract
The invention relates to compositions and methods of generating
a signal indicative of the presence of a target nucleic acid in a
sample, where the method includes forming a cleavage structure by
incubating a sample comprising a target nucleic acid with a probe.
The invention also includes the steps of cleaving the cleavage
structure with a nuclease to release a nucleic acid fragment to
generate a signal, wherein generation of the signal is indicative
of the presence of a target nucleic acid in a sample.
Inventors: |
Sorge; Joseph A.; (Wilson,
WY) |
Correspondence
Address: |
AGILENT TECHOLOGIES INC
P.O BOX 7599
BLDG 3 , LEGAL
LOVELAND
CO
80537-0599
US
|
Assignee: |
Stratagene California
La Jolla
CA
92037
|
Family ID: |
24927402 |
Appl. No.: |
11/709968 |
Filed: |
February 22, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11106237 |
Apr 14, 2005 |
|
|
|
11709968 |
Feb 22, 2007 |
|
|
|
09728574 |
Nov 30, 2000 |
7118860 |
|
|
11106237 |
Apr 14, 2005 |
|
|
|
09650888 |
Aug 30, 2000 |
6548250 |
|
|
09728574 |
Nov 30, 2000 |
|
|
|
09430692 |
Oct 29, 1999 |
6528254 |
|
|
09650888 |
Aug 30, 2000 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.1 |
Current CPC
Class: |
C12Q 2521/301 20130101;
C12Q 2565/519 20130101; C12Q 1/6823 20130101; C12Q 1/6823 20130101;
C12Q 1/6823 20130101; C12Q 1/6816 20130101; C12Q 1/6823 20130101;
C12Q 1/6823 20130101; C12Q 1/6816 20130101; C12Q 2531/113 20130101;
C12Q 2531/113 20130101; C12Q 2531/113 20130101; C12Q 2531/113
20130101; C12Q 2521/307 20130101; C12Q 2525/301 20130101; C12Q
2561/101 20130101; C12Q 2521/307 20130101; C12Q 2525/161 20130101;
C12Q 2521/107 20130101; C12Q 2561/109 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1-48. (canceled)
49. A method for detecting a target nucleic acid comprising
exposing a composition comprising a purified thermostable FEN-1
endonuclease and a polymerase to a sample suspected of containing a
target nucleic under conditions such that said target nucleic acid,
if present in said sample, is detected.
50. The method of claim 49, wherein said thermostable FEN-1
endonuclease comprises a FEN-1 endonuclease from an archaebacterial
species.
51. The method of claim 50, wherein said archaeal FEN-1
endonuclease comprises a FEN-1 endonuclease from Pyrococcus
furiosus.
52. The method of claim 49, wherein said polymerase comprises a
thermostable polymerase.
53. The method of claim 49, wherein said polymerase comprises a
template-dependent polymerase.
54. The method of claim 49, wherein said purified thermostable
FEN-1 endonuclease and said polymerase are in a mixture.
55. The method of claim 49, wherein said mixture comprises a
reaction mixture.
56. The method of claim 49, wherein said exposing comprises
hybridizing a nucleic acid molecule to said target nucleic
acid.
57. The method of claim 56, wherein said nucleic acid molecule
comprises a probe oligonucleotide.
58. The method of claim 56, wherein said nucleic acid molecule is
attached to a solid support.
59. The method of claim 56, wherein said nucleic acid molecule
comprises a label.
60. The method of claim 59, wherein said label comprises a
fluorescent label.
61. The method of claim 49, wherein said exposing comprises
hybridizing first and second nucleic acid molecules to said target
nucleic acid.
62. The method of claim 49, wherein said detecting comprises
detecting a non-target cleavage product.
63. The method of claim 49, wherein said detecting the cleavage of
said cleavage structure comprises detection selected from the group
consisting of detection of radioactivity, luminescence,
phosphorescence, and fluorescence polarization.
64. The method of claim 49, wherein said detecting the cleavage of
said cleavage structure comprises detection based on the charge of
non-target cleavage product.
65. The method of claim 49, wherein said target nucleic acid is
DNA.
66. The method of claim 49, wherein said target nucleic acid is
synthetic nucleic acid.
67. The method of claim 66, wherein said synthetic nucleic acid
comprises amplified nucleic acid.
68. The method of claim 66, wherein said synthetic nucleic acid is
generated by a polymerase chain reaction.
69. The method of claim 49, wherein said target nucleic acid is
RNA.
Description
RELATED APPLICATIONS
[0001] This application is a divisional application of U.S.
application Ser. No. 11/106,237 filed Apr. 14, 2005, which is a
divisional application of U.S. application Ser. No. 09/728,574,
filed on Nov. 30, 2000, now U.S. Pat. No. 7,118,860, which is a
continuation-in-part of U.S. application Ser. No. 09/650,888, filed
Aug. 30 2000, now U.S. Pat. No. 6,548,250 which is a
continuation-in-part of U.S. application Ser. No. 09/430,692, filed
Oct. 29, 1999, now U.S. Pat. No. 6,528,254. The entire teachings of
the above applications are incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] The fidelity of DNA replication, recombination, and repair
is essential for maintaining genome stability, and these processes
depend on 5'3' exonuclease enzymes which are present in all
organisms. For DNA repair, these enzymes are required for damaged
fragment excision and recombinational mismatch correction. For
replication, these nucleases are critical for the efficient
processing of Okazaki fragments during lagging strand DNA
synthesis. In Escherichia coli, this latter activity is provided by
DNA polymerase I (Poll); E. coli strains with inactivating
mutations in the PolI 5'3' exonuclease domain are not viable due to
an inability to process Okazaki fragments. Eukaryotic DNA
polymerases, however, lack an intrinsic 5'3' exonuclease domain,
and this critical activity is provided by the multifunctional,
structure-specific metallonuclease FEN-1 (five' exonuclease-1 or
flap endonuclease-1), which also acts as an endonuclease for 5' DNA
flaps (Reviewed in Hosfield et al., 1998a, Cell, 95:135).
[0003] Methods of detecting and/or measuring a nucleic acid wherein
an enzyme produces a labeled nucleic acid fragment are known in the
art.
[0004] U.S. Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717
and 5,888,780 disclose a method of cleaving a target DNA molecule
by incubating a 5' labeled target DNA with a DNA polymerase
isolated from Thermus aquaticus (Taq polymerase) and a partially
complementary oligonucleotide capable of hybridizing to sequences
at the desired point of cleavage. The partially complementary
oligonucleotide directs the Taq polymerase to the target DNA
through formation of a substrate structure containing a duplex with
a 3' extension opposite the desired site of cleavage wherein the
non-complementary region of the oligonucleotide provides a 3' arm
and the unannealed 5' region of the substrate molecule provides a
5' arm. The partially complementary oligonucleotide includes a 3'
nucleotide extension capable of forming a short hairpin either when
unhybridized or when hybridized to a target sequence at the desired
point of cleavage. The release of labeled fragment is detected
following cleavage by Taq polymerase.
[0005] U.S. Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717
and 5,888,780 disclose the generation of mutant, thermostable DNA
polymerases that have very little or no detectable synthetic
activity, and wild type thermostable nuclease activity. The mutant
polymerases are said to be useful because they lack 5' to 3'
synthetic activity; thus synthetic activity is an undesirable side
reaction in combination with a DNA cleavage step in a detection
assay.
[0006] U.S. Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717
and 5,888,780 disclose that wild type Taq polymerase or mutant Taq
polymerases that lack synthetic activity can release a labeled
fragment by cleaving a 5' end labeled hairpin structure formed by
heat denaturation followed by cooling, in the presence of a primer
that binds to the 3' arm of the hairpin structure. Further, U.S.
Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717 and 5,888,780
teach that the mutant Taq polymerases lacking synthetic activity
can also cleave this hairpin structure in the absence of a primer
that binds to the 3' arm of the hairpin structure.
[0007] U.S. Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717
and 5,888,780 also disclose that cleavage of this hairpin structure
in the presence of a primer that binds to the 3' arm of the hairpin
structure by mutant Taq polymerases lacking synthetic activity
yields a single species of labeled cleaved product, while wild type
Taq polymerase produces multiple cleavage products and converts the
hairpin structure to a double stranded form in the presence of
dNTPs, due to the high level of synthetic activity of the wild type
Taq enzyme.
[0008] U.S. Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717
and 5,888,780 also disclose that mutant Taq polymerases exhibiting
reduced synthetic activity, but not wild type Taq polymerase, can
release a single labeled fragment by cleaving a linear nucleic acid
substrate comprising a 5' end labeled target nucleic acid and a
complementary oligonucleotide wherein the complementary
oligonucleotide hybridizes to a portion of the target nucleic acid
such that 5' and 3' regions of the target nucleic acid are not
annealed to the oligonucleotide and remain single stranded.
[0009] There is a need in the art for a method of generating a
signal that can be easily distinguished from oligonucleotide
fragments that may arise from nuclease contaminants, using a
nucleic acid cleavage reaction.
[0010] There is a need in the art for a method of generating a
signal that utilizes a probe comprising secondary structure wherein
some or all of the self-complementary regions of the probe that
anneal to form the secondary structure are melted when the probe
hybridizes with a target nucleic acid, thereby reducing
non-specific binding of the probe to the target, and increasing the
specificity of the assay.
[0011] U.S. Pat. Nos. 5,843,669, 5,719,028, 5,837,450, 5,846,717
and 5,888,780 also disclose a method of cleaving a labeled nucleic
acid substrate at naturally occurring areas of secondary structure.
According to this method, biotin labeled DNA substrates are
prepared by PCR, mixed with wild type Taq polymerase or CleavaseBN
(a mutant Taq polymerase with reduced synthetic activity and wild
type 5' to 3' nuclease activity), incubated at 95.degree. C. for 5
seconds to denature the substrate and then quickly cooled to
65.degree. C. to allow the DNA to assume its unique secondary
structure by allowing the formation of intra-strand hydrogen bonds
between the complementary bases. The reaction mixture is incubated
at 65.degree. C. to allow cleavage to occur and biotinylated
cleavage products are detected.
[0012] There is a need in the art for a method of generating a
signal using a nucleic acid cleavage reaction wherein the cleavage
structure is not required to contain areas of secondary
structure.
[0013] Methods of detecting and/or measuring a nucleic acid wherein
a FEN-1 enzyme is used to generate a labeled nucleic acid fragment
are known in the art.
[0014] U.S. Pat. No. 5,843,669 discloses a method of detecting
polymorphisms by cleavase fragment length polymorphism analysis
using a thermostable FEN-1 nuclease in the presence or absence of a
mutant Taq polymerase exhibiting reduced synthetic activity.
According to this method, double stranded Hepatitis C virus (HCV)
DNA fragments are labeled by using 5' end labeled primers (labeled
with TMR fluorescent dye) in a PCR reaction. The TMR labeled PCR
products are denatured by heating to 950 C. and cooled to 550 C. to
generate a cleavage structure. U.S. Pat. No. 5,843,669 discloses
that a cleavage structure comprises a region of a single stranded
nucleic acid substrate containing secondary structure. Cleavage is
carried out in the presence of CleavaseBN nuclease, FEN-1 nuclease
derived from the archaebacteria Methanococcus jannaschii or both
enzymes. Labeled reaction products are visualized by gel
electrophoresis followed by fluoroimaging. U.S. Pat. No. 5,843,669
discloses that CleavaseBN nuclease and Methanococcus jannaschii
FEN-1 nuclease produce cleavage patterns that are easily
distinguished from each other, and that the cleavage patterns from
a reaction containing both enzymes include elements of the patterns
produced by cleavage with each individual enzyme but are not merely
a composite of the cleavage patterns produced by each individual
enzyme. This indicates that some of the fragments that are not
cleaved by one enzyme (and which appear as a band in that enzyme's
pattern) can be cleaved by a second enzyme in the same reaction
mixture.
[0015] Lyamichev et al. disclose a method for detecting DNAs
wherein overlapping pairs of oligonucleotide probes that are
partially complementary to a region of target DNA are mixed with
the target DNA to form a 5' flap region, and wherein cleavage of
the labeled downstream probe by a thermostable FEN-1 nuclease
produces a labeled cleavage product. Lyamichev et al. also disclose
reaction conditions wherein multiple copies of the downstream
oligonucleotide probe can be cleaved for a single target sequence
in the absence of temperature cycling, so as to amplify the
cleavage signal and allow quantitative detection of target DNA at
sub-attomole levels (Lyamichev et al., 1999, Nat. Biotechnol.,
17:292).
[0016] The polymerase chain reaction (PCR) technique, is disclosed
in U.S. Pat. Nos. 4,683,202, 4,683,195 and 4,800,159. In its
simplest form, PCR is an in vitro method for the enzymatic
synthesis of specific DNA sequences, using two oligonucleotide
primers that hybridize to opposite strands and flank the region of
interest in the target DNA. A repetitive series of reaction steps
involving template denaturation, primer annealing and the extension
of the annealed primers by DNA polymerase results in the
exponential accumulation of a specific fragment whose termini are
defined by the 5' ends of the primers. PCR is reported to be
capable of producing a selective enrichment of a specific DNA
sequence by a factor of 10.sup.9. The PCR method is also described
in Saiki et al., 1985, Science, 230:1350.
[0017] While the PCR technique is an extremely powerful method for
amplifying nucleic acid sequences, the detection of the amplified
material requires additional manipulation and subsequent handling
of the PCR products to determine whether the target DNA is present.
It is desirable to decrease the number of subsequent handling steps
currently required for the detection of amplified material. An
assay system, wherein a signal is generated while the target
sequence is amplified, requires fewer handling steps for the
detection of amplified material, as compared to a PCR method that
does not generate a signal during the amplification step.
[0018] U.S. Pat. Nos. 5,210,015 and 5,487,972 disclose a PCR based
assay for releasing labeled probe comprising generating a signal
during the amplification step of a PCR reaction in the presence of
a nucleic acid to be amplified, Taq polymerase that has 5' to 3'
exonuclease activity and a 5', 3' or 5' and 3' end-labeled probe
comprising a region complementary to the amplified region and an
additional non-complementary 5' tail region. U.S. Pat. Nos.
5,210,015 and 5,487,972 disclose further that this PCR based assay
can liberate the 5' labeled end of a hybridized probe when the Taq
polymerase is positioned near the labeled probe by an upstream
probe in a polymerization independent manner, e.g. in the absence
of dNTPs.
[0019] There is a need in the art for a method of detecting or
measuring a target nucleic acid that does not require multiple
steps.
[0020] There is also a need in the art for a PCR process for
detecting or measuring a target nucleic acid that does not require
multiple steps subsequent to the amplification process.
[0021] There is also a need in the art for a PCR process for
detecting or measuring a target nucleic acid that allows for
concurrent amplification and detection of a target nucleic acid in
a sample.
SUMMARY OF THE INVENTION
[0022] The invention provides a method of generating a signal
indicative of the presence of a target nucleic acid in a sample,
which includes the steps of forming a cleavage structure by
incubating a sample containing a target nucleic acid with a probe
containing a binding moiety and having a secondary structure that
changes upon binding of the probe to a target nucleic acid, and
cleaving the cleavage structure with a nuclease to release a
nucleic acid fragment and thus generate a signal. Nuclease cleavage
of the cleavage structure occurs at a cleaving temperature, and the
secondary structure of the probe when not bound to the target
nucleic acid is stable at or below the cleaving temperature.
Generation of the signal is indicative of the presence of a target
nucleic acid in the sample, and the signal is detected or measured
by detecting and/or measuring the amount of the fragment captured
by binding of the binding moiety to a capture element on a solid
support.
[0023] As used herein, a "probe" refers to a single stranded
nucleic acid comprising a region or regions that are complementary
to a target nucleic acid (e.g., target nucleic acid binding
sequences) (for example C in FIG. 4). A "probe" according to the
invention has a secondary structure that changes upon binding of
the probe to the target nucleic acid and further comprises a
binding moiety. A "probe" according to the invention binds to a
target nucleic acid to form a cleavage structure that can be
cleaved by a nuclease, wherein cleaving is performed at a cleaving
temperature, and wherein the secondary structure of the probe when
not bound to the target nucleic acid is, preferably, stable at or
below the cleaving temperature. A probe according to the invention
cannot be cleaved to generate a signal by a "nuclease", as defined
herein, prior to binding to a target nucleic acid. In one
embodiment of the invention, a probe may comprise a region that
cannot bind or is not complementary to a target nucleic acid. In
another embodiment of the invention, a probe does not have a
secondary structure when bound to a target nucleic acid.
[0024] As used herein, "secondary structure" refers to a
three-dimensional conformation (for example a hairpin, a stem-loop
structure, an internal loop, a bulge loop, a branched structure or
a pseudoknot, FIGS. 1 and 3; multiple stem loop structures,
cloverleaf type structures or any three dimensional structure. As
used herein, "secondary structure" includes tertiary, quaternary
etc . . . structure. A probe comprising such a three-dimensional
structure binds to a target nucleic acid to form a cleavage
structure that can be cleaved by a nuclease at a cleaving
temperature. The three dimensional structure of the probe when not
bound to the target nucleic acid is, preferably, stable at or below
the cleaving temperature. "Secondary structure" as used herein, can
mean a sequence comprising a first single-stranded sequence of
bases (referred to herein as a "complementary nucleic acid
sequence" (for example b in FIG. 4)) followed by a second
complementary sequence either in the same molecule (for example b'
in FIG. 4), or in a second molecule comprising the probe, folds
back on itself to generate an antiparallel duplex structure,
wherein the single-stranded sequence and the complementary sequence
(that is, the complementary nucleic acid sequences) anneal by the
formation of hydrogen bonds. Oligonucleotide probes, as used in the
present invention include oligonucleotides comprising secondary
structure, including, but not limited to molecular beacons, safety
pins (FIG. 9), scorpions (FIG. 10), and sunrise/amplifluor probes
(FIG. 11), the details and structures of which are described below
and in the corresponding figures.
[0025] As used herein, first and second "complementary" nucleic
acid sequences are complementary to each other and can anneal by
the formation of hydrogen bonds between the complementary
bases.
[0026] A secondary structure also refers to the conformation of a
nucleic acid molecule comprising an affinity pair, defined herein,
wherein the affinity pair reversibly associates as a result of
attractive forces that exist between the pair of moieties
comprising the affinity pair. As used herein, secondary structure
prevents the binding moiety on the probe from binding to a capture
element, and a change in secondary structure upon binding of the
probe to the target nucleic acid and subsequent cleavage of the
bound probe permits the binding moiety to be captured by the
capture element.
[0027] A "probe" according to the invention can be unimolecular. As
used herein, a "unimolecular" probe comprises a single molecule
that binds to a target nucleic acid to form a cleavage structure
that can be cleaved by a nuclease, wherein cleaving is performed at
a cleaving temperature, and wherein the secondary structure of the
"unimolecular" probe when not bound to the target nucleic acid is,
preferably, stable at or below the cleaving temperature.
Unimolecular probes useful according to the invention include but
are not limited to beacon probes, probes comprising a hairpin,
stem-loop, internal loop, bulge loop or pseudoknot structure,
scorpion probes and sunrise/amplifluor probes.
[0028] A "probe" according to the invention can be more than one
molecule (e.g., bi-molecular or multi-molecular). At least one of
the molecules comprising a bi-molecular or multi-molecular probe
binds to a target nucleic acid to form a cleavage structure that
can be cleaved by a nuclease, wherein cleaving is performed at a
cleaving temperature, and wherein the secondary structure of the
molecule of the probe when not bound to the target nucleic acid is,
preferably, stable at or below the cleaving temperature. The
molecules comprising the multimolecular probe associate with each
other via intermolecular bonds (e.g., hydrogen bonds or covalent
bonds). For example, a heterologous loop (see FIG. 1), or a
cloverleaf structure wherein one or more loops of the cloverleaf
structure comprises a distinct molecule, and wherein the molecules
that associate to form the cloverleaf structure associate via
intermolecular bonding (e.g., hydrogen bonding or covalent
bonding), are examples of multimolecular probes useful according to
the invention.
[0029] As used herein, a "molecule" refers to a polynucleotide, and
includes a polynucleotide further comprising an attached member or
members of an affinity pair.
[0030] A "probe" or a "molecule" comprising a probe is 5-10,000
nucleotides in length, ideally from 6-5000, 7-1000, 8-500, 9-250,
10-100 and 17-40 nucleotides in length, although probes or a
molecule comprising a probe of different lengths are useful.
[0031] A "probe" according to the invention has a target nucleic
acid binding sequence that is from 5 to 10,000 nucleotides, and
preferably from 10 to about 140 nucleotides. A "probe" according to
the invention comprises at least first and second complementary
nucleic acid sequences or regions that are 3-250, preferably 4-150,
and more preferably 5-110 and most preferably 6-50 nucleotides
long. The first and second complementary nucleic acid sequences may
have the same length or may be of different lengths. The invention
provides for a probe wherein the first and second complementary
nucleic acid sequences are both located upstream (5') of the target
nucleic acid binding site. Alternatively, the first and second
complementary nucleic acid sequences can both be located downstream
(3') of the target nucleic acid binding site. In another
embodiment, the invention provides for a probe wherein the first
complementary nucleic acid sequence is upstream (5') of the target
nucleic acid binding site and the second complementary nucleic acid
sequence is downstream (3') of the target nucleic acid binding
site. In another embodiment, the invention provides for a probe
wherein the second complementary nucleic acid sequence is upstream
(5') of the target nucleic acid binding site and the first
complementary nucleic acid sequence is downstream (3') of the
target nucleic acid binding site. The actual length will be chosen
with reference to the target nucleic acid binding sequence such
that the secondary structure of the probe is, preferably, stable
when the probe is not bound to the target nucleic acid at the
temperature at which cleavage of a cleavage structure comprising
the probe bound to a target nucleic acid is performed. As the
target nucleic acid binding sequence increases in size up to 500
nucleotides, the length of the complementary nucleic acid sequences
may increase up to 15-125 nucleotides. For a target nucleic acid
binding sequence greater than 100 nucleotides, the length of the
complementary nucleic acid sequences need not be increased further.
If the probe is also an allele-discriminating probe, the lengths of
the complementary nucleic acid sequences are more restricted, as is
discussed below.
[0032] As used herein, the "target nucleic acid binding sequence"
refers to the region of the probe that binds specifically to the
target nucleic acid.
[0033] A "hairpin structure" or a "stem" refers to a double-helical
region formed by base pairing between adjacent, inverted,
complementary sequences in a single strand of RNA or DNA.
[0034] A "stem-loop" structure refers to a hairpin structure,
further comprising a loop of unpaired bases at one end.
[0035] As used herein, a probe with "stable" secondary structure
when not bound to a target nucleic acid, refers to a secondary
structure wherein 50% or more (e.g., 50%, 55%, 75% or 100%) of the
base pairs that constitute the probe are not dissociated under
conditions which permit hybridization of the probe to the target
nucleic acid, but in the absence of the target nucleic acid.
[0036] "Stability" of a nucleic acid duplex is determined by the
melting temperature, or "T.sub.m". The T.sub.m of a particular
nucleic acid duplex under specified conditions (e.g., salt
concentration and/or the presence or absence of organic solvents)
is the temperature at which half (50%) of the base pairs of the
duplex molecule have disassociated (that is, are not hybridized to
each other in a base-pair).
[0037] The "stability" of the secondary structure of a probe when
not bound to the target nucleic acid is defined in a melting
temperature assay, in a fluorescence resonance energy transfer
(FRET) assay or in a fluorescence quenching assay, (the details or
which are described in a section entitled, "Determining the
Stability or the Secondary Structure of a Probe").
[0038] A probe useful in the invention preferably will have
secondary structure that is "stable", when not bound to a target,
at or below the temperature of the cleavage reaction. Thus, the
temperature at which nuclease cleavage of a probe/target nucleic
acid hybrid is performed according to the invention, must be lower
than the Tm of the secondary structure. The secondary structure of
the probe is "stable" in a melting temperature assay at a
temperature that is at or below the temperature of the cleavage
reaction (i.e., at which cleavage is performed) if the level of
light absorbance at the temperature at or below the temperature of
the cleavage reaction is less than (i.e., at least 5% less than,
preferably 20% less than and most preferably 25% less than etc . .
. ) than the level of light absorbance at a temperature that is
equal to or greater than the Tm of the probe.
[0039] According to the method of the invention, the stability of a
secondary structure can be measured by a FRET assay or a
fluorescence quenching assay (described in the section entitled,
"Determining the Stability of the Secondary Structure of a Probe").
As used herein, a fluorescence quenching assay can include a FRET
assay. A probe according to the invention is labeled with an
appropriate pair of interactive labels (e.g., a FRET pair (for
example as described in the section entitled, "Determining the
Stability of the Secondary Structure of the Probe", below) that can
interact over a distance of, for example 2 nucleotides, or a
non-FRET-pair, (e.g., tetramethylrhodamine and DABCYL) that can
interact over a distance of, for example, 20 nucleotides. For
example, a probe according to the invention may be labeled with a
fluorophore and a quencher and fluorescence is then measured, in
the absence of a target nucleic acid, at different temperatures.
The Tm is the temperature at which the level of fluorescence is 50%
of the maximal level of fluorescence observed for a particular
probe, see FIG. 12e. The Tm for a particular probe wherein the
nucleic acid sequence of the probe is known, can be predicted
according to methods known in the art. Thus, fluorescence is
measured over a range of temperatures, e.g., wherein the lower
temperature limit of the range is at least 50.degree. Celsius
below, and the upper temperature limit of the range is at least
50.degree. Celsius above the Tm or predicted Tm, for a probe
according to the invention.
[0040] A secondary structure is herein defined as "stable" in a
FRET assay at a temperature that is at or below the cleaving
temperature if the level or wavelength of fluorescence is increased
or decreased (e.g., at least 5% less than, preferably 20% less than
and more preferably 25% less than, etc . . . ) as compared with the
level or wavelength of FRET that is observed at the Tm of the probe
(see FIGS. 12e and f). For example, an increase or a decrease in
FRET can occur in a FRET assay according to the invention. In
another embodiment, a shift in wavelength, which results in an
increase in the new, shifted wavelength or, a decrease in the new
shifted wavelength, can occur in a FRET assay according to the
invention.
[0041] A "change" in a secondary structure, according to the
invention can be measured in a fluorescence quenching assay wherein
a probe according to the invention comprises a fluorophore and a
quencher that are positioned such that in the absence of a target
nucleic acid, and at temperatures below the Tm of the probe there
is quenching of the fluorescence (as described above). As used
herein, a "change" in secondary structure that occurs when a probe
according to the invention binds to a target nucleic acid, refers
to an increase in fluorescence in such an assay, such that the
level of fluorescence after binding of the probe to the target
nucleic acid at a temperature below the Tm of the probe, is greater
than (e.g., at least 5%, preferably 5-20% and most preferably 25%
or more) the level of fluorescence observed in the absence of a
target nucleic acid (see FIG. 12g).
[0042] A secondary structure, according to the invention, can be
detected by subjecting a probe comprising a fluorophore and a
quencher to a fluorescence quenching assay (as described above). A
probe that exhibits a change in fluorescence that correlates with a
change in temperature, see FIG. 12e (e.g., fluorescence increases
as the temperature of the FRET reaction is increased) may be
capable of forming a secondary structure.
[0043] As used herein, a "cleaving temperature" that is useful
according to the invention is a temperature that is less than (at
least 1.degree. C. and preferably 10.degree. C.) the T.sub.m of a
probe having a secondary structure. The "cleaving temperature" is
initially selected to be possible and preferably optimal for the
particular nuclease being employed in the cleavage reaction.
[0044] Preferably the 3' terminus of the probe will be "blocked" to
prohibit incorporation of the probe into a primer extension product
if an active polymerase is used in the reaction. "Blocking" can be
achieved by using non-complementary bases or by adding a chemical
moiety such as biotin or a phosphate group to the 3' hydroxl of the
last nucleotide, which may, depending upon the selected moiety,
serve a dual purpose by also acting as a label for subsequent
detection or capture of the nucleic acid attached to the label.
Blocking can also be achieved by removing the 3'-OH or by using a
nucleotide that lacks a 3'-OH such as dideoxynucleotide.
[0045] The term probe encompasses an allele-discriminating probe.
As used herein, an "allele-discriminating" probe preferentially
hybridizes to perfectly complementary target nucleic acids and
discriminates against sequences that vary by at least one
nucleotide. A nucleic acid sequence which differs by at least one
nucleotide, as compared to a target nucleic acid, hereafter
referred to as a "target-like nucleic acid sequence", is thus not a
target nucleic acid for an allele-discriminating probe according to
the invention. Allele-discriminating probes do not hybridize
sufficiently to a target-like nucleic acid sequence that contains
one or more nucleotide mismatches as compared to the target nucleic
acid complementary sequence, at a particular temperature or within
a range of temperatures determined by experimental optimization to
permit an allele discriminating probe to discriminate between a
target and a target-like sequence with at least a single nucleotide
difference, and thus do not undergo a change in secondary structure
upon binding to a target-like nucleic acid sequence in the presence
of only a target-like nucleic acid sequence, and under conditions
that would support hybridization of the allele discriminating probe
to a target nucleic acid.
[0046] In one embodiment, an "allele-discriminating probe"
according to the invention refers to a probe that hybridizes to a
target-like nucleic acid sequence that varies by at least one
nucleotide from the target nucleic acid, wherein the variant
nucleotide(s) is/are not located in the allele-discriminating site.
According to this embodiment of the invention, "an
allele-discriminating probe" cannot bind to a target-like nucleic
acid sequence that also varies by at least one nucleotide in the
allele-discriminating site, at a particular temperature or within a
range of temperatures determined by experimental optimization to
permit an allele discriminating probe to discriminate between a
target and a target-like sequence with at least a single nucleotide
difference. Single nucleotide differences only affect the
percentage of a probe that is bound to a target or target-like
nucleic acid sequence. For example, the invention provides for a
perfectly matched probe, wherein as much as 100% of the target or
is in a probe-target complex (e.g., is bound by probe), in the
presence of excess probe. The invention also provides for probes
comprising at least a single base mismatch wherein at least 1-5%
and preferably 5-10% of the target-like sequence is bound by the
probe under the same conditions used to form a complex comprising a
target sequence and a perfectly matched probe.
[0047] As used herein, "allele-discriminating site" refers to a
region of a target nucleic acid that is different (i.e., by at
least one nucleotide) from the corresponding region in all possible
alleles comprising the target nucleic acid.
[0048] Allele-discriminating probes useful according to the
invention also include probes that bind less effectively to a
target-like sequence, as compared to a target sequence. The
effectiveness of binding of a probe to a target sequence or a
target-like sequence can be measured in a FRET assay, performed at
a temperature that is below (at least 1.degree. C. and preferably
10.degree.C. or more) the Tm of the secondary structure of the
probe, in the presence of a target-like sequence or a target
sequence. The change in the level of fluorescence in the presence
or absence of a target sequence compared to the change in the level
of fluorescence in the presence or absence of a target-like
sequence, provides an effective measure of the effectiveness of
binding of a probe to a target or target-like sequence.
[0049] In a method according to the invention, a probe that binds
less effectively to a target-like sequence as compared to a target
sequence would undergo a smaller (e.g., preferably 25-50%, more
preferably 50-75% and most preferably 75-90% of the value of the
change in fluorescence upon binding to a target nucleic acid)
change in secondary structure, as determined by measuring
fluorescence in a FRET or fluorescence quenching assay as described
herein, upon hybridization to a target-like sequence as compared to
a target nucleic acid. In a method according to the invention, a
probe that binds less effectively to a target-like sequence as
compared to a target sequence would generate a signal that is
indicative of the presence of a target-like nucleic acid sequence
in a sample. However, the intensity of the signal would be altered
(e.g., preferably 25-50%, more preferably 50-75% and most
preferably 75-90% less than or more than the value of the change in
fluorescence upon binding to a target nucleic acid) the intensity
of a signal generated in the presence of a target sequence, as
described hereinabove for a smaller change.
[0050] A "signal that is indicative of the presence of a target
nucleic acid" or a "target-like nucleic acid sequence" refers to a
signal that is equal to a signal generated from 1 molecule to
10.sup.20 molecules, more preferably about 100 molecules to
10.sup.17 molecules and most preferably about 1000 molecules to
10.sup.14 molecules of a target nucleic acid or a target-like
nucleic acid sequence.
[0051] As used herein, a "binding moiety" refers to a region of a
probe (for example ab in FIG. 4) that is released upon cleavage of
the probe by a nuclease and binds specifically to a capture element
as a result of attractive forces that exist between the binding
moiety and the capture element, and wherein specific binding
between the binding moiety and the capture element only occurs when
the secondary structure of the probe has "changed", as defined
herein. "Binds specifically" means via hydrogen bonding with a
complementary nucleic acid or via an interaction between for
example, the binding moiety and a binding protein capable of
binding specifically to the nucleic acid sequence of the binding
moiety. A "binding moiety" does not interfere with the ability of a
probe to bind to a target nucleic acid. A binding moiety is
incapable of binding to a capture element when the probe is in its
native secondary structural conformation and that, upon binding to
a target or template nucleic acid, the secondary structure changes
in a way that allows the binding moiety to bind to the capture
element, preferably after cleavage by a cleavage agent.
[0052] In one embodiment, the region of a probe that is cleaved to
form a binding moiety cannot hybridize to a target nucleic acid.
The region of a "binding moiety" that is not a "complementary
nucleic acid sequence", as defined herein, (e.g., a in FIG. 4), is
from 1-60 nucleotides, preferably from 1-25 nucleotides and most
preferably from 1-10 nucleotides in length. Methods of detecting
specific binding between a binding moiety or a binding moiety, as
defined herein, and a capture element, as defined herein, are well
known in the art and are described hereinbelow.
[0053] In one embodiment of the invention, a probe further
comprises a "reporter".
[0054] As used herein, a "reporter" refers to a "label", defined
hereinbelow and/or a "tag" defined hereinbelow.
[0055] As used herein, "label" or "labeled moiety capable of
providing a signal" refers to any atom or molecule which can be
used to provide a detectable (preferably quantifiable) signal, and
which can be operatively linked to a nucleic acid. Labels may
provide signals detectable by fluorescence, radioactivity,
colorimetry, gravimetry, X-ray diffraction or absorption,
magnetism, enzymatic activity, mass spectrometry, binding affinity,
hybridization radiofrequency, nanocrystals and the like. A labeled
probe according to the methods of the invention is labeled at the
5' end, the 3' end or internally. The label can be "direct", i.e. a
dye, or "indirect". i.e. biotin, digoxin, alkaline phosphatase
(AP), horse radish peroxidase (HRP) etc . . . For detection of
"indirect labels" it is necessary to add additional components such
as labeled antibodies, or enzyme substrates to visualize the,
captured, released, labeled nucleic acid fragment. In one
embodiment of the invention, a label cannot provide a detectable
signal unless the secondary structure has "changed", as defined
herein, (for example, such that the binding moiety is
accessible).
[0056] A "binding moiety" also refers to a "tag". As used herein, a
"tag" refers to a moiety that is operatively linked to the 5' end
of a probe (for example R in FIG. 1) and specifically binds to a
capture element as a result of attractive forces that exist between
the tag and the capture element, and wherein specific binding
between the tag and the capture element only occurs when the
secondary structure of the probe has changed (for example, such
that the tag is accessible to a capture element). "Specifically
binds" as it refers to a "tag" and a capture element means via
covalent or hydrogen bonding or electrostatic attraction or via an
interaction between, for example a protein and a ligand, an
antibody and an antigen, protein subunits, or a nucleic acid
binding protein and a nucleic acid binding site. A tag does not
interfere with the ability of a probe to anneal to a target nucleic
acid. Tags include but are not limited to biotin, streptavidin,
avidin, an antibody, an antigen, a hapten, a protein, or a
chemically reactive moiety. A "tag" as defined herein can bind to a
"capture element" as defined herein. According to the invention, a
"tag" and a "capture element" function as a binding pair. For
example, in one embodiment, if a tag is biotin, the corresponding
capture element is avidin. Alternatively, in another embodiment, if
a tag is an antibody, the corresponding capture element is an
antigen.
[0057] The invention contemplates a "probe" comprising a binding
moiety, a "probe" comprising a "tag", as defined herein, and a
"probe" comprising both a binding moiety that is a region of a
probe that is released upon cleavage of the probe by a nuclease
(for example a nucleic acid sequence that binds to a capture
element), and a "tag".
[0058] As used herein, a "capture element" refers to a substance
that is attached to a solid substrate for example by chemical
crosslinking or covalent binding, wherein the substance
specifically binds to (e.g., via hydrogen bonding or via an
interaction between, a nucleic acid binding protein and a nucleic
acid binding site or between complementary nucleic acids) a binding
moiety as a result of attractive forces that exist between the
binding moiety and the capture element, and wherein specific
binding between the binding moiety and the capture element only
occurs when the secondary structure of the probe comprising the
binding moiety has "changed", as defined herein. Capture elements
include but are not limited to a nucleic acid binding protein or a
nucleotide sequence.
[0059] As used herein, a "capture element" also refers to a
substance that is attached to a solid substrate for example by
chemical crosslinking or covalent binding, wherein the substance
specifically binds to (e.g. via covalent or hydrogen bonding or
electrostatic attraction via an interaction between, for example a
protein and a ligand, an antibody and an antigen, protein subunits,
a nucleic acid binding protein and a nucleic acid binding site or
between complementary nucleic acids) a tag as a result of
attractive forces that exist between the tag and the capture
element, and wherein specific binding between the tag and the
capture element only occurs when the secondary structure of the
probe comprising the tag has "changed", as defined herein. Capture
elements include but are not limited to biotin, avidin,
streptavidin, an antibody, an antigen, a hapten, a protein, or a
chemically reactive moiety. A "tag" as defined herein can bind to a
"capture element" as defined herein. According to the invention, a
"tag" and a "capture element" function as a binding pair. For
example, in one embodiment, if a capture element is biotin, the
corresponding tag is avidin. Alternatively, in another embodiment,
if a capture element is an antibody, the corresponding tag is an
antigen.
[0060] As used herein, "solid support" means a surface to which a
molecule (e.g. a capture element) can be irreversibly bound,
including but not limited to membranes, sepharose beads, magnetic
beads, tissue culture plates, silica based matrices, membrane based
matrices, beads comprising surfaces including but not limited to
styrene, latex or silica based materials and other polymers for
example cellulose acetate, teflon, polyvinylidene difluoride,
nylon, nitrocellulose, polyester, carbonate, polysulphone, metals,
zeolites, paper, alumina, glass, polypropyle, polyvinyl chloride,
polyvinylidene chloride, polytetrafluorethylene, polyethylene,
polyamides, plastic, filter paper, dextran, germanium, silicon,
(poly)tetrafluorethylene, gallium arsenide, gallium phosphide,
silicon oxide, silicon nitrate and combinations thereof. Methods of
attaching a capture element as defined herein are well known in the
art and are defined hereinbelow. Additional solid supports are also
discussed hereinbelow.
[0061] As used herein, "affinity pair" refers to a pair of moieties
(for example complementary nucleic acid sequences, protein-ligand,
antibody-antigen, protein subunits, and nucleic acid binding
proteins-binding sites) that can reversibly associate as a result
of attractive forces that exist between the moieties. An "affinity
pair" includes the combination of a binding moiety and the
corresponding capture element and the combination of a tag and the
corresponding capture element.
[0062] In embodiments wherein the affinity pair comprises
complementary nucleic acid regions that reversibly interact with
one another, the lengths of the target nucleic acid binding
sequences, and the nucleic acid sequences comprising the affinity
pair, are chosen for the proper thermodynamic functioning of the
probe under the conditions of the projected hybridization assay.
Persons skilled in hybridization assays will understand that
pertinent conditions include probe, target and solute
concentrations, detection temperature, the presence of denaturants
and volume excluders, and other hybridization-influencing factors.
The length of a target nucleic acid binding sequence can range from
7 to about 10,000 nucleotides, preferably from 8-5000, 9-500, 9-250
and most preferably, 10 to 140 nucleotides. If the probe is also an
allele-discriminating probe, the length is more restricted, as is
discussed below (this sentence has jumped in logic from a binding
moiety:capture element concept to a probe:target concept).
[0063] In embodiments wherein the affinity pair comprises
complementary nucleic acid regions that reversibly interact with
one another, and cannot hybridize or are not complementary to a
target nucleic acid, the complementary nucleic acid region
sequences of the affinity pair should be of sufficient length that
under the conditions of the assay and at the detection temperature,
when the probe is not bound to a target, the structure of the probe
is such that the binding moiety of the probe will not bind to the
capture element, e.g., the complementary nucleic acid sequences are
associated. Depending upon the assay conditions used, complementary
nucleic acid sequences of 3-25 nucleotide lengths can perform this
function. An intermediate range of 4-15, and more preferably 5-11,
nucleotides is often appropriate. The actual length will be chosen
with reference to the target nucleic acid binding sequence such
that the secondary structure of the probe is stable when not bound
to the target nucleic acid at the temperature at which cleavage of
a cleavage structure comprising the probe bound to a target nucleic
acid is performed. As the target nucleic acid binding sequence
increases in size up to 100 nucleotides, the length of the
complementary nucleic acid sequences may increase up to 15-25
nucleotides. For a target nucleic acid binding sequence greater
than 100 nucleotides, the length of the complementary nucleic acid
sequences need not be increased further. If the probe is also an
allele-discriminating probe, the lengths of the complementary
nucleic acid sequences are more restricted, as is discussed
below.
[0064] Allele-discriminating probes that do not hybridize
sufficiently to a target-like nucleic acid sequence that contains
one or more nucleotide mismatches as compared to the target nucleic
acid complementary sequence, must be designed such that, under the
assay conditions used, reduction or elimination of secondary
structure in the probe and hybridization with a target nucleic acid
will occur efficiently only when the target nucleic acid
complementary sequence finds a perfectly complementary target
sequence under certain reaction conditions. Certain reaction
conditions may include, for example, a particular temperature or a
range of temperatures determined by experimental optimization to
permit an allele discriminating probe to discriminate between a
target and a target-like sequence with at least a single nucleotide
difference.
[0065] In one embodiment, an "allele-discriminating probe"
according to the invention refers to a probe that hybridizes to a
target-like nucleic acid sequence that varies by at least one
nucleotide from the target nucleic acid, wherein the variant
nucleotide(s) is/are not located in the allele-discriminating site.
According to this embodiment of the invention, "an
allele-discriminating probe" cannot bind efficiently to a
target-like nucleic acid sequence that also varies by at least one
nucleotide in the allele-discriminating site under certain reaction
conditions. Certain reaction conditions may include, for example, a
particular temperature or a range of temperatures determined by
experimental optimization to permit an allele discriminating probe
to discriminate between a target and a target-like sequence with at
least a single nucleotide difference.
[0066] In one embodiment of the invention, an allele discriminating
probe according to the invention preferably comprises a target
nucleic acid binding sequence from 6 to 50 and preferably from 7 to
25 nucleotides, and complementary nucleic acid sequences from 3 to
8 nucleotides. The guanosine-cytidine content of the secondary
structure and probe-target hybrids, salt, and assay temperature
should all be considered, for example magnesium salts have a strong
stabilizing effect that is particularly important to consider when
designing short, allele-discriminating probes.
[0067] If an allele-discriminating probe is to have a target
nucleic acid binding sequence of about 50 nucleotides long, the
sequence should be designed such that a single nucleotide mismatch
to be discriminated against occurs at or near the middle of the
target nucleic acid complementary sequence. For example, probes
comprising a sequence that is 21 nucleotides long should preferably
be designed so that the mismatch occurs opposite one of the 14 most
centrally located nucleotides of the target nucleic acid
complementary sequence and most preferably opposite one of the 7
most centrally located nucleotides. Designing a probe so that the
mismatch to be discriminated against occurs in or near the middle
of the target nucleic acid binding sequence/target-like nucleic
acid binding sequence is believed to improve the performance of an
allele-discriminating probe.
[0068] As used herein a "nuclease" or a "cleavage agent" refers to
an enzyme that is specific for, that is, cleaves a cleavage
structure according to the invention and is not specific for, that
is, does not substantially cleave either a probe or a primer that
is not hybridized to a target nucleic acid, or a target nucleic
acid that is not hybridized to a probe or a primer. The term
"nuclease" includes an enzyme that possesses 5' endonucleolytic
activity for example a DNA polymerase, e.g. DNA polymerase I from
E. coli, and DNA polymerase from Thermus aquaticus (Taq), Thermus
thermophilus (Tth), and Thermus flavus (Tfl). The term nuclease
also embodies FEN nucleases. The term "FEN nuclease" encompasses an
enzyme that possesses 5' exonuclease and/or an endonuclease
activity. The term "FEN nuclease" also embodies a 5' flap-specific
nuclease. A nuclease or cleavage agent according to the invention
includes but is not limited to a FEN nuclease enzyme derived from
Archaeglobus fulgidus, Methanococcus jannaschii, Pyrococcus
furiosus, human, mouse or Xenopus laevis. A nuclease according to
the invention also includes Saccharomyces cerevisiae RAD27, and
Schizosaccharomyces pombe RAD2, Pol I DNA polymerase associated 5'
to 3' exonuclease domain, (e.g. E. coli, Thermus aquaticus (Taq),
Thermus flavus (Tfl), Bacillus caldotenax (Bca), Streptococcus
pneumoniae) and phage functional homologs of FEN including but not
limited to T5 5' to 3' exonuclease, T7 gene 6 exonuclease and T3
gene 6 exonuclease. Preferably, only the 5' to 3' exonuclease
domains of Taq, Tfl and Bca FEN nuclease are used. The term
"nuclease" does not include RNAse H.
[0069] As used herein, "captured" as it refers to capture of a
binding moiety by a capture element or capture of a tag by a
capture element, means specifically bound by hydrogen bonding,
covalent bonding, or via an interaction between, for example a
protein and a ligand, an antibody and an antigen, protein subunits,
a nucleic acid binding protein and a nucleic acid binding site, or
between complementary nucleic acids, wherein one member of the
interacting pair is attached to a solid support. Under conditions
of stable capture, binding results in the formation of a
heterodimer with a dissociation constant (KD) of at least about
1.times.10.sup.3 M.sup.-1, usually at least 1.times.10.sup.4
M.sup.-1, typically at least 1.times.10.sup.5 M.sup.-1, preferably
at least 1.times.10.sup.6 M.sup.-1 to 1.times.10.sup.7 M.sup.-1 or
more, under suitable conditions. Methods of performing binding
reactions between a capture element, as defined herein, and a
binding moiety or tag, as defined herein, are well-known in the art
and are described hereinbelow. Methods of attaching a capture
element according to the invention to a solid support, as defined
herein, are well known in the art and are defined hereinbelow.
[0070] As used herein, "wild type" refers to a gene or gene product
which has the characteristics of (i.e., either has the sequence of
or encodes, for the gene, or possesses the sequence or activity of,
for an enzyme) that gene or gene product when isolated from a
naturally occurring source.
[0071] A "5' flap-specific nuclease" (also referred to herein as a
"flap-specific nuclease") according to the invention is an
endonuclease which can remove a single stranded flap that protrudes
as a 5' single strand. In one embodiment of the invention, a
flap-specific nuclease according to the invention can also cleave a
pseudo-Y structure. A substrate of a flap-specific nuclease
according to the invention, comprises a target nucleic acid and an
oligonucleotide probe, as defined herein, that comprises a region
or regions that are complementary to the target nucleic acid. In
another embodiment, a substrate of a flap-specific nuclease
according to the invention comprises a target nucleic acid, an
upstream oligonucleotide that is complementary to the target
nucleic acid and a downstream probe, according to the invention,
that comprises a region or regions that are complementary to the
target nucleic acid. In one embodiment, the upstream
oligonucleotide and the downstream probe hybridize to
non-overlapping regions of the target nucleic acid. In another
embodiment the upstream oligonucleotide and the downstream probe
hybridize to adjacent regions of the target nucleic acid.
[0072] As used herein, "adjacent" refers to separated by less than
20 nucleotides, e.g., 15 nucleotides, 10 nucleotides, 5
nucleotides, or 0 nucleotides.
[0073] A substrate of a flap-specific nuclease according to the
invention, also comprises a target nucleic acid, a second nucleic
acid, a portion of which specifically hybridizes with a target
nucleic acid, and a primer extension product from a third nucleic
acid that specifically hybridizes with a target nucleic acid.
[0074] As used herein, a "cleavage structure" refers to a
polynucleotide structure (for example as illustrated in FIG. 1)
comprising at least a duplex nucleic acid having a single stranded
region comprising a flap, a loop, a single-stranded bubble, a
D-loop, a nick or a gap. A cleavage structure according to the
invention thus includes a polynucleotide structure comprising a
flap strand of a branched DNA wherein a 5' single-stranded
polynucleotide flap extends from a position near its junction to
the double stranded portion of the structure and preferably the
flap is labeled with a detectable label. A flap of a cleavage
structure according to the invention is preferably about 1-10,000
nucleotides, more preferably about 5-25 nucleotides and most
preferably about 10-20 nucleotides and is preferably cleaved at a
position located at the phosphate positioned at the "elbow" of the
branched structure or at any of one to ten phosphates located
proximal and/or distal from the elbow of the flap strand. As used
herein, "elbow" refers to the phosphate bond between the first
single stranded nucleotide of the 5' flap and the first double
stranded (e.g., hybridized to the target nucleic acid) nucleotide.
In one embodiment, a flap of a cleavage structure cannot hybridize
to a target nucleic acid.
[0075] A cleavage structure according to one embodiment of the
invention preferably comprises a target nucleic acid, and also may
include an oligonucleotide probe according to the invention, that
specifically hybridizes with the target nucleic acid via a region
or regions that are complementary to the target nucleic acid, and a
flap extending from the hybridizing oligonucleotide probe. In
another embodiment of the invention, a cleavage structure comprises
a target nucleic acid (for example B in FIG. 4), an upstream
oligonucleotide that is complementary to the target sequence (for
example A in FIG. 4), and a downstream oligonucleotide probe
according to the invention and comprising a region or regions, that
are complementary to the target sequence (for example C in FIG. 4).
In one embodiment, the upstream oligonucleotide and the downstream
probe hybridize to non-overlapping regions of the target nucleic
acid. In another embodiment, the upstream oligonucleotide and the
downstream probe hybridize to adjacent regions of the target
nucleic acid.
[0076] A cleavage structure according to the invention may be a
polynucleotide structure comprising a flap extending from the
downstream oligonucleotide probe of the invention, wherein the flap
is formed by extension of the upstream oligonucleotide by the
synthetic activity of a nucleic acid polymerase, and subsequent,
partial, displacement of the 5' end of the downstream
oligonucleotide. In such a cleavage structure, the downstream
oligonucleotide may be blocked at the 3' terminus to prevent
extension of the 3' end of the downstream oligonucleotide.
[0077] A cleavage structure according to one embodiment of the
invention may be formed by hybridizing a target nucleic acid with
an oligonucleotide probe wherein the oligonucleotide probe has a
secondary structure that changes upon binding of the probe to the
target nucleic acid, and further comprises a binding moiety and a
complementary region that anneals to the target nucleic acid, and a
non-complementary region that does not anneal to the target nucleic
acid and forms a 5' flap.
[0078] A cleavage structure also may be a pseudo-Y structure
wherein a pseudoY-structure is formed if the strand upstream of a
flap (referred to herein as a flap adjacent strand or primer
strand) is not present, and double stranded DNA substrates
containing a gap or nick. A "cleavage structure", as used herein,
does not include a double stranded nucleic acid structure with only
a 3' single-stranded flap. As used herein, a "cleavage structure"
comprises ribonucleotides or deoxyribonucleotides and thus can be
RNA or DNA.
[0079] A cleavage structure according to the invention may be an
overlapping flap wherein the 3' end of an upstream oligonucleotide
capable of hybridizing to a target nucleic acid (for example A in
FIG. 4) is identical to 1 base pair of the downstream
oligonucleotide probe of the invention (for example C in FIG. 4)
that is annealed to a target nucleic acid and wherein the overlap
is directly downstream of the point of extension of the single
stranded flap.
[0080] A cleavage structure according to one embodiment of the
invention is formed by the steps of 1. incubating a) an upstream 3'
end, preferably an oligonucleotide primer, b) an oligonucleotide
probe located not more than 10,000 nucleotides downstream of the
upstream primer and having a secondary structure that changes upon
binding of the probe to the target nucleic acid and further
comprising a binding moiety c) an appropriate target nucleic acid
wherein the target sequence is at least partially complementary to
both the upstream primer and downstream probe and d) a suitable
buffer, under conditions that allow the nucleic acid sequence to
hybridize to the oligonucleotide primers, and, in one embodiment of
the invention, 2. extending the 3' end of the upstream
oligonucleotide primer by the synthetic activity of a polymerase
such that the newly synthesized 3' end of the upstream
oligonucleotide primer becomes adjacent to and/or displaces at
least a portion of (i.e., at least 1-10 nucleotides of) the 5' end
of the downstream oligonucleotide probe. According to the method of
the invention, buffers and extension temperatures are favorable for
strand displacement by a particular nucleic acid polymerase
according to the invention. Preferably, the downstream
oligonucleotide is blocked at the 3' terminus to prevent extension
of the 3' end of the downstream oligonucleotide.
[0081] In another embodiment of the invention, a cleavage structure
according to the invention can be prepared by incubating a target
nucleic acid with an oligonucleotide probe having a secondary
structure that changes upon binding of the probe to the target
nucleic acid, and further comprising a binding moiety and a
non-complementary 5' region that does not anneal to the target
nucleic acid and forms a 5' flap, and a complementary 3' region
that anneals to the target nucleic acid.
[0082] In another embodiment of the invention, a cleavage structure
according to the invention can be prepared by incubating a target
nucleic acid with a downstream oligonucleotide probe having a
secondary structure that changes upon binding of the probe to the
target nucleic acid, and further comprising a binding moiety and a
non-complementary 5' region that does not anneal to the target
nucleic acid and forms a 5' flap and a complementary 3' region that
anneals to the target nucleic acid, and an upstream oligonucleotide
primer. In one embodiment, the upstream oligonucleotide and the
downstream probe hybridize to non-overlapping regions of the target
nucleic acid. In another embodiment, the upstream oligonucleotide
and the downstream probe hybridize to adjacent regions of the
target nucleic acid.
[0083] In a preferred embodiment of the invention a cleavage
structure is labeled. A labeled cleavage structure according to one
embodiment of the invention is formed by the steps of 1. incubating
a) an upstream extendable 3' end, for example, an oligonucleotide
primer, b) a labeled probe having a secondary structure that
changes upon binding of the probe to the target nucleic acid, and
further comprising a binding moiety, preferably located not more
than 10,000 and more preferably located not more than 500
nucleotides downstream of the upstream primer and c) an appropriate
target nucleic acid wherein the target sequence is complementary to
both the primer and the labeled probe and d) a suitable buffer,
under conditions that allow the nucleic acid sequence to hybridize
to the primers, and, in one embodiment of the invention, 2.
extending the 3' end of the upstream primer by the synthetic
activity of a polymerase such that the newly synthesized 3' end of
the upstream primer partially displaces the 5' end of the
downstream probe. According to the method of the invention, buffers
and extension temperatures are favorable for strand displacement by
a particular nucleic acid polymerase according to the invention.
Preferably, the downstream oligonucleotide is blocked at the 3'
terminus to prevent extension of the 3' end of the downstream
oligonucleotide. In one embodiment, the upstream primer and the
downstream probe hybridize to non-overlapping regions of the target
nucleic acid.
[0084] In another embodiment, a cleavage structure according to the
invention can be prepared by incubating a target nucleic acid with
a probe having a secondary structure that changes upon binding of
the probe to the target nucleic acid, and further comprising a
binding moiety and a non-complementary, labeled, 5' region that
does not anneal to the target nucleic acid and forms a 5' flap, and
a complementary 3' region that anneals to the target nucleic acid.
In another embodiment, a cleavage structure according to the
invention can be prepared by incubating a target nucleic acid with
a downstream probe having a secondary structure that changes upon
binding of the probe to the target nucleic acid, and further
comprising a binding moiety and a non-complementary, labeled, 5'
region that does not anneal to the target nucleic acid and forms a
5' flap and a complementary 3' region that anneals to the target
nucleic acid, and an upstream oligonucleotide primer. In one
embodiment, the upstream oligonucleotide and the downstream probe
hybridize to non-overlapping regions of the target nucleic acid. In
another embodiment, the upstream oligonucleotide and the downstream
probe hybridize to adjacent regions of the target nucleic acid.
[0085] As used herein, "generating a signal" refers to detecting
and or measuring a released nucleic acid fragment that is released
from the cleavage structure and is captured by binding of a binding
moiety to a capture element on a solid support, as an indication of
the presence of a target nucleic acid in a sample.
[0086] As used herein, "sample" refers to any substance containing
or presumed to contain a nucleic acid of interest (a target nucleic
acid) or which is itself a nucleic acid containing or presumed to
contain a target nucleic acid of interest. The term "sample" thus
includes a sample of nucleic acid (genomic DNA, cDNA, RNA), cell,
organism, tissue, fluid, or substance including but not limited to,
for example, plasma, serum, spinal fluid, lymph fluid, synovial
fluid, urine, tears, stool, external secretions of the skin,
respiratory, intestinal and genitourinary tracts, saliva, blood
cells, tumors, organs, tissue, samples of in vitro cell culture
constituents, natural isolates (such as drinking water, seawater,
solid materials), microbial specimens, and objects or specimens
that have been "marked" with nucleic acid tracer molecules.
[0087] As used herein, "target nucleic acid" or "template nucleic
acid sequence" refers to a region of a nucleic acid that is to be
either replicated, amplified, and/or detected. In one embodiment,
the "target nucleic acid" or "template nucleic acid sequence"
resides between two primer sequences used for amplification.
[0088] As used herein, "nucleic acid polymerase" refers to an
enzyme that catalyzes the polymerization of nucleoside
triphosphates. Generally, the enzyme will initiate synthesis at the
3'-end of the primer annealed to the target sequence, and will
proceed in the 5'-direction along the template, and if possessing a
5' to 3' nuclease activity, hydrolyzing intervening, annealed probe
to release both labeled and unlabeled probe fragments, until
synthesis terminates. Known DNA polymerases include, for example,
E. coli DNA polymerase I, T7 DNA polymerase, Thermus thermophilus
(Tth) DNA polymerase, Bacillus stearothermophilus DNA polymerase,
Thermococcus litoralis DNA polymerase, Thermus aquaticus (Taq) DNA
polymerase and Pyrococcus furiosus (Pfu) DNA polymerase.
[0089] As used herein, "5' to 3' exonuclease activity" or "5'3'
exonuclease activity" refers to that activity of a
template-specific nucleic acid polymerase e.g. a 5'3' exonuclease
activity traditionally associated with some DNA polymerases whereby
mononucleotides or oligonucleotides are removed from the 5' end of
a polynucleotide in a sequential manner, (i.e., E. coli DNA
polymerase I has this activity whereas the Klenow (Klenow et al.,
1970, Proc. Natl. Acad. Sci., USA, 65:168) fragment does not,
(Klenow et al., 1971, Eur. J. Biochem., 22:371)), or
polynucleotides are removed from the 5' end by an endonucleolytic
activity that may be inherently present in a 5' to 3' exonuclease
activity.
[0090] As used herein, the phrase "substantially lacks 5' to 3'
exonuclease activity" or "substantially lacks 5'3' exonuclease
activity" means having less than 10%, 5%, 1%, 0.5%, or 0.1% of the
activity of a wild type enzyme. The phrase "lacking 5' to 3'
exonuclease activity" or "lacking 5'3' exonuclease activity" means
having undetectable 5' to 3' exonuclease activity or having less
than about 1%, 0.5%, or 0.1% of the 5' to 3' exonuclease activity
of a wild type enzyme.
[0091] To detect structure-specific endonucleolytic activity, a DNA
template consisting of a flap structure, wherein the downstream
flap oligonucleotide is radiolabeled at the 5' end is employed. The
reaction is carried out with DNA polymerase in the presence of
dNTPs (to extend the upstream primer). Radiolabeled cleavage
products are visualized by gel electrophoresis (Lyamichev et al.,
1993, Science 260: 778).
[0092] Alternatively, the 5'-3' exonuclease activity of a DNA
polymerase is assayed using uniformly-labeled double-stranded DNA
that is also nicked. The release of radioactivity (TCA soluble
cpms) by a DNA polymerase in the absence and presence of dNTPs is
measured. Non-proofreading DNA polymerases with 5'-3' exonuclease
activity are stimulated 10-fold or more by concomitant
polymerization that occurs in the presence of dNTPs (increase in
cpms released in the presence of dNTPs). Proofreading DNA
polymerases with 3'-5' exo activity are inhibited completely by
concomitant polymerization that occurs in the presence of dNTPs
(decrease in cpms released in the presence of dNTPs) (U.S. Pat. No.
5,352,778).
[0093] Nucleases useful according to the invention include any
enzyme that possesses 5' endonucleolytic activity for example a DNA
polymerase, e.g. DNA polymerase I from E. coli, and DNA polymerase
from Thermus aquaticus (Taq), Thermus thermophilus (Tth), and
Thermus flavus (Tfl). Nucleases useful according to the invention
also include DNA polymerases with 5'-3' exonuclease activity,
including but not limited to eubacterial DNA polymerase I,
including enzymes derived from Thermus species (Taq, Tfl, Tth, Tca
(caldophilus) Tbr (brockianus)),enzymes derived from Bacillus
species (Bst, Bca, Magenta (full length polymerases, NOT
N-truncated versions)), enzymes derived from Thermotoga species
(Tma (maritima, Tne (neopolitana)) and E. coli DNA polymerase I.
The term nuclease also embodies FEN nucleases. Additional nucleic
acid polymerases useful according to the invention are included
below in the section entitled, "Nucleic Acid Polymerases"
[0094] As used herein, "cleaving" refers to enzymatically
separating a cleavage structure into distinct (i.e. not physically
linked to other fragments or nucleic acids by phosphodiester bonds)
fragments or nucleotides and fragments that are released from the
cleavage structure. For example, cleaving a labeled cleavage
structure refers to separating a labeled cleavage structure
according to the invention and defined below, into distinct
fragments including fragments derived from an oligonucleotide that
specifically hybridizes with a target nucleic acid or wherein one
of the distinct fragments is a labeled nucleic acid fragment
derived from a target nucleic acid and/or derived from an
oligonucleotide that specifically hybridizes with a target nucleic
acid that can be detected and/or measured by methods well known in
the art and described herein that are suitable for detecting the
labeled moiety that is present on a labeled fragment.
[0095] As used herein, "endonuclease" refers to an enzyme that
cleaves bonds, preferably phosphodiester bonds, within a nucleic
acid molecule. An endonuclease according to the invention can be
specific for single-stranded or double-stranded DNA or RNA.
[0096] As used herein, "exonuclease" refers to an enzyme that
cleaves bonds, preferably phosphodiester bonds, between nucleotides
one at a time from the end of a polynucleotide. An exonuclease
according to the invention can be specific for the 5' or 3' end of
a DNA or RNA molecule, and is referred to herein as a 5'
exonuclease or a 3' exonuclease.
[0097] As used herein a "flap" refers to a region of single
stranded DNA that extends from a double stranded nucleic acid
molecule. A flap according to the invention is preferably between
about 1-10,000 nucleotides, more preferably between about 5-25
nucleotides and most preferably between about 10-20
nucleotides.
[0098] In a preferred embodiment, the binding moiety is a tag.
[0099] In another preferred embodiment, the binding moiety is a
nucleic acid sequence that binds to a capture element.
[0100] The invention also provides a method of detecting or
measuring a target nucleic acid comprising the steps of: forming a
cleavage structure by incubating a sample containing a target
nucleic acid with a probe having a secondary structure that changes
upon binding of the probe to the target nucleic acid and, the probe
further comprising a binding moiety, cleaving the cleavage
structure with a nuclease to release a nucleic acid fragment
wherein the cleavage is performed at a cleaving temperature, and
the secondary structure of the probe when not bound to the target
nucleic acid is stable at or below the cleaving temperature; and
detecting and/or measuring the amount of the fragment captured by
binding of the binding moiety to a capture element on a solid
support as an indication of the presence of the target sequence in
the sample.
[0101] As used herein, "detecting a target nucleic acid" or
"measuring a target nucleic acid" refers to determining the
presence of a particular target nucleic acid in a sample or
determining the amount of a particular target nucleic acid in a
sample as an indication of the presence of a target nucleic acid in
a sample. The amount of a target nucleic acid that can be measured
or detected is preferably about 1 molecule to 10.sup.20 molecules,
more preferably about 100 molecules to 10.sup.17 molecules and most
preferably about 1000 molecules to 10.sup.14 molecules. According
to one embodiment of the invention, the detected nucleic acid is
derived from the labeled 5' end of a downstream probe of a cleavage
structure according to the invention (for example C in FIG. 4),
that is displaced from the target nucleic acid by the 3' extension
of an upstream probe of a cleavage structure according to the
invention (for example A of FIG. 4). According to the present
invention, a label is attached to the 5' end of the downstream
probe (for example C in FIG. 4) comprising a cleavage structure
according to the invention. Alternatively, a label is attached to
the 3' end of the downstream probe and a quencher is attached to
the 5' flap of the downstream probe. According to the invention, a
label may be attached to the 3' end of the downstream probe (for
example C in FIG. 4) comprising a cleavage structure according to
the invention.
[0102] According to the invention, the downstream probe (for
example C in FIG. 4) may be labeled internally. In a preferred
embodiment, a cleavage structure according to the invention can be
prepared by incubating a target nucleic acid with a probe having a
secondary structure that changes upon binding of the probe to the
target nucleic acid, and further comprising a non-complementary,
labeled, 5' region that does not anneal to the target nucleic acid
and forms a 5' flap, and a complementary 3' region that anneals to
the target nucleic acid. According to this embodiment of the
invention, the detected nucleic acid is derived from the labeled 5'
flap region of the probe. Preferably there is a direct correlation
between the amount of the target nucleic acid and the signal
generated by the cleaved, detected nucleic acid.
[0103] In another embodiment, the probe is labeled with a pair of
interactive labels (e.g., a FRET or non-FRET pair) positioned to
permit the separation of the labels during oligonucleotide probe
unfolding (e.g., for example due to a change in the secondary
structure of the probe) or hydrolysis. As used herein, "detecting
the amount of the fragment captured by a capture element on a solid
support" or "measuring the amount of the fragment captured by a
capture element on a solid support" or "detecting the amount of the
fragment captured by a capture element on a solid support" or
"measuring the amount of the fragment captured by a capture element
on a solid support" refers to determining the presence of a labeled
or unlabeled fragment in a sample or determining the amount of a
labeled or unlabeled fragment in a sample. Methods well known in
the art and described herein can be used to detect or measure
release of labeled or unlabeled fragments bound to a capture
element on a solid support, or following the release of the labeled
or unlabeled fragment from a capture element on a solid support.
The detection methods described herein are operative for detecting
a fragment wherein any amount of a fragment is detected whether
that be a small or large proportion of the fragments generated in
the reaction. A method of detecting or measuring release of labeled
fragments will be appropriate for measuring or detecting the
labeled moiety that is present on the labeled fragments bound to a
capture element on a solid support. Methods of detecting or
measuring release of unlabeled fragments include, for example, gel
electrophoresis or by hybridization, according to methods well
known in the art. The detection methods described herein are
operative when as little as 1 or 2 molecules (and up to 1 or 2
million, for example 10, 100, 1000, 10,000, 1 million) of released
fragment are detected.
[0104] As used herein, "labeled fragments" refer to cleaved
mononucleotides or small oligonucleotides or oligonucleotides
derived from the labeled cleavage structure according to the
invention wherein the cleaved oligonucleotides are preferably
between about 1-1000 nucleotides, more preferably between about
5-50 nucleotides and most preferably between about 16-18
nucleotides, which are cleaved from a cleavage structure by a
nuclease and can be detected by methods well known in the art and
described herein.
[0105] In one embodiment, a probe is a bi-molecular or
multimolecular probe wherein first molecule comprising the probe is
labeled with a fluorophore and a second molecule comprising the
probe is labeled with a quencher. As used herein, a "subprobe" and
"subquencher" refer to a first molecule of a bi- or multi-molecular
probe according to the invention, that is labeled with a
fluorophore and a second molecule of a bi- or multi-molecular probe
according to the invention, that is labeled with a quencher,
respectively. According to this embodiment, following binding of
the bi- or multi-molecular probe to the target nucleic acid, and
cleavage by a nuclease, the subprobe and subquencher dissociate
from each other (that is, the distance between the subprobe and the
subquencher increases) and a signal is generated as a result of
this dissociation and subsequent separation of the subprobe and
subquencher.
[0106] In a preferred embodiment, the binding moiety is a tag.
[0107] In another preferred embodiment, the binding moiety is a
nucleic acid sequence that binds to a capture element.
[0108] In a preferred embodiment, the method further comprises a
nucleic acid polymerase.
[0109] In another preferred embodiment, the cleavage structure
further comprises a 5' flap.
[0110] In another preferred embodiment, the cleavage structure
further comprises an oligonucleotide primer.
[0111] In another preferred embodiment, the secondary structure is
selected from the group consisting a stem-loop structure, a hairpin
structure, an internal loop, a bulge loop, a branched structure, a
pseudoknot structure or a cloverleaf structure.
[0112] In another preferred embodiment, the nuclease is a FEN
nuclease.
[0113] In another preferred embodiment the FEN nuclease is selected
from the group consisting of FEN nuclease enzyme derived from
Archaeglobus fulgidus, Methanococcus jannaschii, Pyrococcus
furiosus, human, mouse or Xenopus laevis. A FEN nuclease according
to the invention also includes Saccharomyces cerevisiae RAD27, and
Schizosaccharomyces pombe RAD2, Pol I DNA polymerase associated 5'
to 3' exonuclease domain, (e.g. E. coli, Thermus aquaticus (Taq),
Thermus flavus (Tfl), Bacillus caldotenax (Bca), Streptococcus
pneumoniae) and phage functional homologs of FEN including but not
limited to T4, T5 5' to 3' exonuclease, T7 gene 6 exonuclease and
T3 gene 6 exonuclease.
[0114] Preferably, only the 5' to 3' exonuclease domains of Taq,
Tfl and Bca FEN nuclease are used.
[0115] In another preferred embodiment, the probe further comprises
a reporter.
[0116] In another preferred embodiment, the reporter comprises a
tag.
[0117] In another preferred embodiment, the fragment is captured by
binding of the tag to a capture element.
[0118] In another preferred embodiment, the cleavage structure is
formed comprising at least one labeled moiety capable of providing
a signal.
[0119] In another preferred embodiment, the cleavage structure is
formed comprising a pair of interactive signal generating labeled
moieties effectively positioned on the probe to quench the
generation of a detectable signal when the probe is not bound to
the target nucleic acid.
[0120] In another preferred embodiment, the labeled moieties are
separated by a site susceptible to nuclease cleavage, thereby
allowing the nuclease activity of the nuclease to separate the
first interactive signal generating labeled moiety from the second
interactive signal generating labeled moiety by cleaving at the
site susceptible to nuclease cleavage, thereby generating a
detectable signal.
[0121] The presence of a pair of interactive signal generating
labeled moieties, as described above, allows for discrimination
between annealed, uncleaved probe that may bind to a capture
element, and released labeled fragment that is bound to a capture
element.
[0122] In another preferred embodiment, the pair of interactive
signal generating moieties comprises a quencher moiety and a
fluorescent moiety.
[0123] The invention also provides for a polymerase chain reaction
process for detecting a target nucleic acid in a sample. This
process comprises, providing a cleavage structure comprising a
probe having a secondary structure that changes upon binding of the
probe to the target nucleic acid and, the probe further comprising
a binding moiety, a set of oligonucleotide primers wherein a first
primer contains a sequence complementary to a region in one strand
of the target nucleic acid and primes the synthesis of a
complementary DNA strand, and a second primer contains a sequence
complementary to a region in a second strand of the target nucleic
acid and primes the synthesis of a complementary DNA strand. This
process also comprises amplifying the target nucleic acid employing
a nucleic acid polymerase as a template-dependent polymerizing
agent under conditions which are permissive for PCR cycling steps
of (i) annealing of primers required for amplification to a
template nucleic acid sequence contained within the target nucleic
acid, (ii) extending the primers providing that the nucleic acid
polymerase synthesizes a primer extension product, and (iii)
cleaving the cleavage structure employing a nuclease as a cleavage
agent for release of labeled fragments from the cleavage structure
thereby creating detectable labeled fragments. According to this
process, the cleaving is performed at a cleaving temperature and
the secondary structure of the second primer when not bound to the
target nucleic acid is stable at or below the cleaving temperature.
The amount of released, labeled fragment captured by binding of the
binding moiety to a capture element on a solid support is detected
and/or measured as an indicator of the presence of the target
sequence in the sample.
[0124] As used herein, an "oligonucleotide primer" refers to a
single stranded DNA or RNA molecule that is hybridizable to a
nucleic acid template and primes enzymatic synthesis of a second
nucleic acid strand. Oligonucleotide primers useful according to
the invention are between about 6 to 100 nucleotides in length,
preferably about 17-50 nucleotides in length and more preferably
about 17-45 nucleotides in length. Oligonucleotide probes useful
for the formation of a cleavage structure according to the
invention are between about 17-40 nucleotides in length, preferably
about 17-30 nucleotides in length and more preferably about 17-25
nucleotides in length.
[0125] As used herein, "template dependent polymerizing agent"
refers to an enzyme capable of extending an oligonucleotide primer
in the presence of adequate amounts of the four deoxyribonucleoside
triphosphates (dATP, dGTP, dCTP and dTTP) or analogs as described
herein, in a reaction medium comprising appropriate salts, metal
cations, appropriate stabilizers and a pH buffering system.
Template dependent polymerizing agents are enzymes known to
catalyze primer- and template- dependent DNA synthesis, and possess
5' to 3' nuclease activity. Preferably, a template dependent
polymerizing agent according to the invention lacks 5' to 3'
nuclease activity.
[0126] As used herein, "amplifying" refers to producing additional
copies of a nucleic acid sequence, including the method of the
polymerase chain reaction.
[0127] In a preferred embodiment, the nuclease is a FEN
nuclease.
[0128] In a preferred embodiment, the binding moiety is a tag.
[0129] In another preferred embodiment, the binding moiety is a
nucleic acid sequence that binds to a capture element.
[0130] In another preferred embodiment, the oligonucleotide primers
of step b are oriented such that the forward primer is located
upstream of the cleavage structure and the reverse primer is
located downstream of the cleavage structure.
[0131] In another preferred embodiment, the nucleic acid polymerase
has strand displacement activity.
[0132] Nucleic acid polymerases exhibiting strand displacement
activity and useful according to the invention include but are not
limited to archaeal DNA polymerases with "temperature activated"
strand displacement activity (exo plus and exo minus versions of
Vent, Deep Vent, Pfu, JDF-3, KOD (LTI's tradename Pfx), Pwo, 9
degrees North, Thermococcus aggregans, Thermococcus gorgonarius),
and eubacterial DNA polymerases with strand displacement activity
(exo minus Bst, exo minus Bca, Genta, Klenow fragment, exo minus
Klenow fragment exo minus T7 DNA polymerase (Sequenase).
[0133] In another preferred embodiment, the nucleic acid polymerase
is thermostable.
[0134] In another preferred embodiment, the nuclease is
thermostable.
[0135] As used herein, "thermostable" refers to an enzyme which is
stable and active at temperatures as great as preferably between
about 90-100.degree. C. and more preferably between about 70-980 C.
to heat as compared, for example, to a non-thermostable form of an
enzyme with a similar activity. For example, a thermostable nucleic
acid polymerase or FEN nuclease derived from thermophilic organisms
such as P. furiosus, M. jannaschii, A. fulgidus or P. horikoshii
are more stable and active at elevated temperatures as compared to
a nucleic acid polymerase from E. coli or a mammalian FEN enzyme. A
representative thermostable nucleic acid polymerase isolated from
Thermus aquaticus (Taq) is described in U.S. Pat. No. 4,889,818 and
a method for using it in conventional PCR is described in Saiki et
al., 1988, Science 239:487. Another representative thermostable
nucleic acid polymerase isolated from P. furiosus (Pfu) is
described in Lundberg et al., 1991, Gene, 108:1-6. Additional
representative temperature stable polymerases include, e.g.,
polymerases extracted from the thermophilic bacteria Thermus
flavus, Thermus ruber, Thermus thermophilus, Bacillus
stearothermophilus (which has a somewhat lower temperature optimum
than the others listed), Thermus lacteus, Thermus rubens,
Thermotoga maritima, or from thermophilic archaea Thermococcus
litoralis, and Methanothermus fervidus.
[0136] Temperature stable polymerases and FEN nucleases are
preferred in a thermocycling process wherein double stranded
nucleic acids are denatured by exposure to a high temperature
(about 950 C.) during the PCR cycle.
[0137] In another preferred embodiment, the nuclease is a
flap-specific nuclease.
[0138] In another preferred embodiment, the probe further comprises
a reporter.
[0139] In another preferred embodiment, the reporter comprises a
tag.
[0140] In another preferred embodiment, the fragment is captured by
binding of said tag to a capture element.
[0141] In another preferred embodiment, the cleavage structure is
formed comprising at least one labeled moiety capable of providing
a signal.
[0142] In another preferred embodiment, the cleavage structure is
formed comprising a pair of interactive signal generating labeled
moieties effectively positioned on the probe to quench the
generation of a detectable signal when the probe is not bound to
the target nucleic acid.
[0143] In another preferred embodiment, the labeled moieties are
separated by a site susceptible to nuclease cleavage, thereby
allowing the nuclease activity of the nuclease to separate the
first interactive signal generating labeled moiety from the second
interactive signal generating labeled moiety by cleaving at the
site susceptible to nuclease cleavage, thereby generating a
detectable signal.
[0144] In another preferred embodiment, the pair of interactive
signal generating moieties comprises a quencher moiety and a
fluorescent moiety.
[0145] In another preferred embodiment, the nucleic acid polymerase
is selected from the group consisting of Taq polymerase and Pfu
polymerase.
[0146] The invention provides for a polymerase chain reaction
process wherein amplification and detection of a target nucleic
acid occur concurrently (i.e., real time detection). The invention
also provides for a polymerase chain reaction process wherein
amplification of a target nucleic acid occurs prior to detection of
the target nucleic acid (i.e., end point detection).
[0147] The invention also provides for a polymerase chain reaction
process for simultaneously forming a cleavage structure, amplifying
a target nucleic acid in a sample and cleaving the cleavage
structure. This process comprises the step of: (a) providing an
upstream oligonucleotide primer complementary to a first region in
one strand of the target nucleic acid, a downstream labeled probe
complementary to a second region in the same strand of the target
nucleic acid, wherein the downstream labeled probe is capable of
forming a secondary structure that changes upon binding of the
probe to the target nucleic acid and, the probe further comprises a
binding moiety, and a downstream oligonucleotide primer
complementary to a region in a second strand of the target nucleic
acid. According to this step of the process, the upstream primer
primes the synthesis of a complementary DNA strand, and the
downstream primer primes the synthesis of a complementary DNA
strand. This process also comprises the step of (b) detecting a
nucleic acid which is produced and captured by binding of the
binding moiety to a capture element on a solid support. The nucleic
acid that is detected is produced in a reaction comprising
amplification and cleavage of the target nucleic acid wherein a
nucleic acid polymerase is a template-dependent polymerizing agent
under conditions which are permissive for PCR cycling steps of (i)
annealing of primers to a target nucleic acid, (ii) extending the
primers of step (a), providing that the nucleic acid polymerase
synthesizes primer extension products, and the primer extension
product of the upstream primer of step (a) partially displaces the
downstream probe of step (a) to form a cleavage structure. The
conditions are also permissive for (iii) cleaving the cleavage
structure employing a nuclease as a cleavage agent for release of
detectable labeled fragments from the cleavage structure. The
cleaving is performed at a cleaving temperature and the secondary
structure of the probe when not bound to the target nucleic acid is
stable at or below the cleaving temperature.
[0148] In a preferred embodiment, the cleavage structure further
comprises a 5' flap.
[0149] The invention also provides a method of forming a cleavage
structure comprising the steps of: (a) providing a target nucleic
acid, (b) providing an upstream primer complementary to the target
nucleic acid, (c) providing a downstream probe having a secondary
structure that changes upon binding of the probe to a target
nucleic acid and, the probe further comprises a binding moiety; and
(d) annealing the target nucleic acid, the upstream primer and the
downstream probe. The cleavage structure can be cleaved with a
nuclease at a cleaving temperature. The secondary structure of the
probe when not bound to the target nucleic acid is stable at or
below the cleaving temperature.
[0150] In a preferred embodiment, the cleavage structure comprises
a 5' flap.
[0151] The invention also provides for a composition comprising a
target nucleic acid, a probe having a secondary structure that
changes upon binding of the probe to a target nucleic acid and, the
probe further comprises a binding moiety, and a nuclease. The probe
and the target nucleic acid of this composition can bind to form a
cleavage structure that can be cleaved by the nuclease at a
cleaving temperature. The secondary structure of the probe when not
bound to the target nucleic acid is stable at or below the cleaving
temperature.
[0152] In a preferred embodiment, the composition further comprises
an oligonucleotide primer.
[0153] In another preferred embodiment, the probe and the
oligonucleotide hybridize to non-overlapping regions of the target
nucleic acid.
[0154] The invention also provides for a kit for generating a
signal indicative of the presence of a target nucleic acid in a
sample, comprising a probe having a secondary structure that
changes upon binding of the probe to a target nucleic acid and, the
probe further comprising a binding moiety, and a nuclease. The
probe of this kit can bind to a target nucleic acid to form a
cleavage structure that can be cleaved by the nuclease at a
cleaving temperature. The secondary structure of the probe when not
bound to the target nucleic acid is stable at or below the cleaving
temperature.
[0155] In a preferred embodiment, the kit further comprises an
oligonucleotide primer.
[0156] In another preferred embodiment, the nuclease is a FEN
nuclease.
[0157] In another preferred embodiment, the probe comprises at
least one labeled moiety.
[0158] In another preferred embodiment, the probe comprises a pair
of interactive signal generating labeled moieties effectively
positioned to quench the generation of a detectable signal when the
probe is not bound to the target nucleic acid.
[0159] In another preferred embodiment, the labeled moieties are
separated by a site susceptible to nuclease cleavage, thereby
allowing the nuclease activity of the nuclease to separate the
first interactive signal generating labeled moiety from the second
interactive signal generating labeled moiety by cleaving at the
site susceptible to nuclease cleavage, thereby generating a
detectable signal.
[0160] In another preferred embodiment, the pair of interactive
signal generating moieties comprises a quencher moiety and a
fluorescent moiety.
[0161] Further features and advantages of the invention are as
follows. The claimed invention provides a method of generating a
signal to detect and/or measure a target nucleic acid wherein the
generation of a signal is an indication of the presence of a target
nucleic acid in a sample. The method of the claimed invention does
not require multiple steps. The claimed invention also provides a
PCR based method for detecting and/or measuring a target nucleic
acid comprising generating a signal as an indication of the
presence of a target nucleic acid. The claimed invention allows for
simultaneous amplification and detection and/or measurement of a
target nucleic acid. The claimed invention also provides a PCR
based method for detecting and/or measuring a target nucleic acid
comprising generating a signal in the absence of a nucleic acid
polymerase that demonstrates 5' to 3' exonuclease activity. Further
features and advantages of the invention will become more fully
apparent in the following description of the embodiments and
drawings thereof, and from the claims.
BRIEF DESCRIPTION OF DRAWINGS
[0162] FIG. 1 demonstrates FEN nuclease cleavage structures.
[0163] FIG. 2 demonstrates three templates (labeled 1, 2, and 3)
that may be used to detect FEN nuclease activity.
[0164] FIG. 3 demonstrates secondary structures.
[0165] FIG. 4 is a diagram illustrating a synthesis and cleavage
reaction to generate a signal according to the invention.
[0166] FIG. 5 is a Sypro Orange stained polyacrylamide gel
demonstrating CBP-tagged PFU FEN-1 protein.
[0167] FIG. 6 is an autoradiograph of a FEN-1 nuclease assay.
[0168] FIG. 7 is a representation of an open circle probe for
rolling circle amplification.
[0169] FIG. 8 is a representation of rolling circle
amplification.
[0170] FIG. 9 is a representation of a safety pin probe.
The sequence tcgcagtgtc gacctgcgc is SEQ ID NO: 31
The sequence cagccgtcga tccgcaggtc gacactgccg tcgacggctg is SEQ ID
NO: 32
The sequence gcagctgccg ac is SEQ ID NO: 33
The sequence tccgcaggtc gacactgccg tcgacggctg is SEQ ID NO: 34
[0171] FIG. 10 is a representation of a scorpion probe.
[0172] FIG. 11 is a representation of a sunrise/amplifluor probe
FIG. 12a is a graph demonstrating the difference in light
absorbance of double-stranded versus single-stranded DNA.
[0173] FIG. 12b is a graph demonstrating DNA melting curves.
[0174] FIG. 12c is a graph demonstrating the effects of temperature
on the relative optical absorbance of DNA.
[0175] FIG. 12d is a graph demonstrating the effects of temperature
on the relative optical absorbance of DNA.
[0176] FIG. 12e is a graph demonstrating the effects of temperature
on the fluorescence of DNA labeled with a pair of interactive
labels.
[0177] FIG. 12f is a graph demonstrating the effects of temperature
on the fluorescence of DNA labeled with a pair of interactive
labels.
[0178] FIG. 12g is a graph demonstrating the effects of a target
nucleic acid on the fluorescence of DNA labeled with a pair of
interactive labels.
DESCRIPTION
[0179] The invention provides for a method of generating a signal
to detect the presence of a target nucleic acid in a sample wherein
a nucleic acid is treated with the combination of a probe having a
secondary structure that changes upon binding of the probe to a
target nucleic acid and comprising a binding moiety and a nuclease.
The invention also provides for a process for detecting or
measuring a nucleic acid that allows for concurrent amplification,
cleavage and detection of a target nucleic acid in a sample.
[0180] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular biology,
microbiology and recombinant DNA techniques, which are within the
skill of the art. Such techniques are explained fully in the
literature. See, e.g., Sambrook, Fritsch & Maniatis, 1989,
Molecular Cloning: A Laboratory Manual, Second Edition;
Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Nucleic Acid
Hybridization (B. D. Hames & S. J. Higgins, eds., 1984); A
Practical Guide to Molecular Cloning (B. Perbal, 1984); and a
series, Methods in Enzymology (Academic Press, Inc.); Short
Protocols In Molecular Biology, (Ausubel et al., ed., 1995). All
patents, patent applications, and publications mentioned herein,
both supra and infra, are hereby incorporated by reference.
I. Nucleases
[0181] Nucleases useful according to the invention include any
enzyme that possesses 5' endonucleolytic activity for example a DNA
polymerase, e.g. DNA polymerase I from E. coli, and DNA polymerase
from Thermus aquaticus (Taq), Thermus thermophilus (Tth), and
Thermus flavus (Tfl). Nucleases useful according to the invention
also include DNA polymerases with 5'-3' exonuclease activity,
including but not limited to eubacterial DNA polymerase I,
including enzymes derived from Thermus species (Taq, Tfl, Tth, Tca
(caldophilus) Tbr (brockianus)),enzymes derived from Bacillus
species (Bst, Bca, Magenta (full length polymerases, NOT
N-truncated versions)), enzymes derived from Thermotoga species
(Tma (maritima, Tne (neopolitana)) and E. coli DNA polymerase I.
The term nuclease also embodies FEN nucleases. A nuclease useful
according to the invention cannot cleave either a probe or primer
that is not hybridized to a target nucleic acid or a target nucleic
acid that is not hybridized to a probe or a primer.
[0182] FEN-1 is an 40 kDa divalent metal ion-dependent exo- and
endonuclease that specifically recognizes the backbone of a 5'
single-stranded flap strand and tracks down this arm to the
cleavage site, which is located at the junction wherein the two
strands of duplex DNA adjoin the single-stranded arm. Both the
endo- and exonucleolytic activities show little sensitivity to the
base at the most 5' position at the flap or nick. Both FEN-1 endo-
and exonucleolytic substrate binding and cutting are stimulated by
an upstream oligonucleotide (flap adjacent strand or primer). This
is also the case for E. coli pol I. The endonuclease activity of
the enzyme is independent of the 5' flap length, cleaving a 5' flap
as small as one nucleotide. The endonuclease and exonuclease
activities are insensitive to the chemical nature of the substrate,
cleaving both DNA and RNA.
[0183] Both the endo- and exonucleolytic activities are inhibited
by concentrations of salts in the physiological range. The
exonuclease activity is inhibited 50-fold at 50 mM NaCl as compared
to 0 mM NaCl. The endonuclease activity is inhibited only sevenfold
at 50 mM NaCl (Reviewed in Lieber 1997, supra).
[0184] Although a 5'-OH terminus is a good substrate for FEN-1
loading onto a 5' flap substrate, it serves as a very poor
substrate when part of a nick in an otherwise double stranded DNA
structure. The electrostatic repulsion by the terminal phosphate is
likely to favor breathing of the substrate into a pseudo-flap
configuration, providing the active form of the substrate for
FEN-1. Such an explanation would indicate a single active site and
a single mechanism of loading of FEN-1 onto the 5' ssDNA terminus
of the flap or pseudo-flap configuration of the nick. Consistent
with this model are observations that optimal activity at a nick
requires very low Mg.sup.2+ and monovalent salt concentrations,
which destabilize base-pairing and would favor breathing of a nick
to a flap. Higher Mg.sup.2+ and monovalent salt concentrations
would disfavor breathing and inhibit cutting of nicked or gapped
structures that do require breathing to convert to a flap. Cleavage
of stable flap structures is optimal at moderate Mg.sup.2+ levels
and does not decrease with increasing Mg.sup.2+ concentration. This
is because a flap substrate does not have to melt out base pairs to
achieve its structure; hence, it is entirely insensitive to
Mg.sup.2+. Though the endonucleolytic activity decreases with
monovalent salt, the decline is not nearly as sharp as that seen
for the exonucleolytic activity. Furthermore, it has previously
been shown that one-nucleotide flaps are efficient substrates. All
of these observations are consistent with the fact that when FEN-1
has been interpreted to be functioning as an exonuclease, the size
of the degradation products vary from one to several nucleotides in
length. Breathing of nicks into flaps of varying length would be
expected to vary with local sequence, depending on the G/C content.
In summary, a nick breathing to form a transient flap means that
the exonucleolytic activity of FEN-1 is the same as the
endonucleolytic activity (Reviewed in Lieber, 1997, supra).
[0185] The endonuclease and exonuclease activities of FEN-1 cleave
both DNA and RNA without requiring accessory proteins. At the
replication fork, however, FEN-1 does interact with other proteins,
including a DNA helicase and the proliferating cell nuclear antigen
(PCNA), the processivity factor for DNA polymerases .delta. and
.epsilon.. PCNA significantly stimulates FEN-1 endo- and
exonucleolytic activity.
[0186] The FEN-1 enzymes are functionally related to several
smaller bacteriophage 5'3' exonucleases such as T5 5' exonuclease
and T4 RNase H as well as to the larger eukaryotic nucleotide
excision repair enzymes such as XPG, which also acts in the
transcription-coupled repair of oxidative base damage. In
eubacteria such as Escherichia coli and Thermus aquaticus, Okazaki
processing is provided by the PolI 5'3' exonuclease domain. These
bacterial and phage enzymes share two areas of limited sequence
homology with FEN-1, which are termed the N (N-terminal) and I
(intermediate) regions, with the residue similarities concentrated
around seven conserved acidic residues. Based on crystal structures
of T4 RNase H and T5 exonuclease as well as mutagenesis data, it
has been proposed that these residues bind to two Mg.sup.2+ ions
that are required for affecting DNA hydrolysis; however, the role
each metal plays in the catalytic cycle, which is subtly different
for each enzyme, is not well understood (Reviewed in Hosfield et
al., 1998b, supra).
[0187] fen-1 genes encoding FEN- 1 enzymes useful in the invention
include murine fen-1, human fen-1, rat fen-1, Xenopus laevis fen-1,
and fen-1 genes derived from four archaebacteria Archaeglobus
fulgidus, Methanococcus jannaschii, Pyrococcus furiosus and
Pyrococcus horikoshii. cDNA clones encoding FEN-1 enzymes have been
isolated from human (GenBank Accession Nos.: NM.sub.--004111 and
L37374), mouse (GenBank Accession No.: L26320), rat (GenBank
Accession No.: AA819793), Xenopus laevis (GenBank Accession Nos.:
U68141 and U64563), and P. furiosus (GenBank Accession No.:
AF013497). The complete nucleotide sequence for P. horikoshii flap
endonuclease has also been determined (GenBank Accession No.:
AB005215). The FEN-1 family also includes the Saccharomyces
cerevisiae RAD27 gene (GenBank Accession No.: Z28113 Y13137) and
the Saccharomyces pombe RAD2 gene (GenBank Accession No.: X77041).
The archaeal genome of Methanobacterium thermautotrophiculum has
also been sequenced. Although the sequence similarity between FEN-1
and prokaryotic and viral 5'3' exonucleases is low, FEN-1s within
the eukaryotic kingdom are highly conserved at the amino acid
level, with the human and S. cerevisiae proteins being 60%
identical and 78% similar. The three archaebacterial FEN-1 proteins
are also, highly homologous to the eukaryotic FEN-1 enzymes
(Reviewed in Matsui et al., 1999., J. Biol. Chem., 274:18297,
Hosfield et al., 1998b, J. Biol. Chem., 273:27154 and Lieber, 1997,
BioEssays, 19:233).
[0188] The sequence similarities in the two conserved nuclease
domains (N-terminal or N and intermediate or I domains) between
human and other FEN-1 family members are 92% (murine), 79% (S.
cerevisiae), 77% (S. pombe), 72% (A. fulgidus), 76% (M.
jannaschii), and 74% (P. furiosus).
[0189] FEN-1 specifically recognizes the backbone of a 5'
single-stranded flap strand and migrates down this flap arm to the
cleavage site located at the junction between the two strands of
duplex DNA and the single-stranded arm. If the strand upstream of
the flap (sometimes called the flap adjacent strand or primer
strand) is removed, the resulting structure is termed a pseudo-Y
(see FIG. 1). This structure is cleaved by FEN-1, but at 20- to
100-fold lower efficiency. FEN-1 does not cleave 3' single-stranded
flaps. However, FEN-1 acting as an exonuclease will hydrolyze dsDNA
substrates containing a gap or nick (Reviewed in Hosfield et al.,
1998a, supra, Hosfield et al., 1999b, supra and Lieber 1997,
supra). Exonucleolytically, FEN-1 acts at a nick and, with lower
efficiency, at a gap or a recessed 5' end on dsDNA. At gapped
structures, the efficiency of FEN-1 binding and cutting decreases
with increasing gap size up to approximately five nucleotides and
then stabilizes at a level of cleavage that is equivalent to
activity on a recessed 5' end within dsDNA. Blunt dsDNA, recessed
3' ends and ssDNA are not cleaved (Reviewed in Lieber 1997, supra).
The cleavage activity of FEN enzymes are described in Yoon et al.,
1999, Biochemistry, 38: 4809; Rao, 1998, J. Bacteriol., 180:5406
and Hosfield et al., 1998, Cell, 95:135-146, incorporated herein by
reference.
[0190] FEN nucleases that are useful according to the invention
have been isolated from a variety of organisms including human
(GenBank Accession Nos.: NM.sub.--004111 and L37374), mouse
(GenBank Accession No.: L26320), rat (GenBank Accession No.:
AA819793), yeast (GenBank Accession No.: Z28113 Y13137 and GenBank
Accession No.: X77041) and xenopus laevis (GenBank Accession Nos.:
U68141 and U64563). Such enzymes can be cloned and overexpressed
using conventional techniques well known in the art.
[0191] A FEN nuclease according to the invention is preferably
thermostable. Thermostable FEN nucleases have been isolated and
characterized from a variety of thermostable organisms including
four archeaebacteria. The cDNA sequence (GenBank Accession No.:
AF013497) and the amino acid sequence (Hosfield et al., 1998a,
supra and Hosfield et al., 1998b) for P. furiosus flap endonuclease
have been determined. The complete nucleotide sequence (GenBank
Accession No.: AB005215) and the amino acid sequence (Matsui et
al., supra) for P. horikoshii flap endonuclease have also been
determined. The amino acid sequence for M. jannaschii (Hosfield et
al., 1998b and Matsui et al., 1999 supra) and A. fulgidus (Hosfield
et al., 1998b) flap endonuclease have also been determined.
[0192] Thermostable FEN1 enzymes can be cloned and overexpressed
using techniques well known in the art and described in Hosfield et
al., 1998a, supra, Hosfield et al., 1998b, Kaiser et al., 1999, J.
Biol. Chem., 274: 21387 and Matusi et al., supra and herein in
Example 2 entitled "Cloning Pfu FEN-1".
[0193] The endonuclease activity of a FEN enzyme can be measured by
a variety of methods including the following.
A. FEN Endonuclease Activity Assay
[0194] 1. Templates (for example as shown in FIG. 2) are used to
evaluate the activity of a FEN nuclease according to the
invention.
[0195] Template 1 is a 5' .sup.33P labeled oligonucleotide
(Heltest4 ) with the following sequence:
[0196] 5`AAAATAAATAAAAAAAATACTGTTGGGAAGGGCGATCGGTGCG 3' (SEQ ID NO:
1). The underlined section of Heltest4 represents the region
complementary to M13mp 18+. The cleavage product is an 18
nucleotide fragment with the sequence AAAATAAATAAAAAAAAT (SEQ ID
NO: 2).
[0197] Heltest4 binds to M13 to produce a complementary double
stranded domain as well as a non-complementary 5' overhang. This
duplex forms template 2 (FIG. 2) which is also used for helicase
assays. Template 3 (FIG. 2) has an additional primer (FENAS) bound
to M13 and is directly adjacent to Heltest 4. The sequence of FENAS
is: 5' CCATTCGCCATTCAGGCTGCGCA 3' (SEQ ID NO: 3). In the presence
of template 3, FEN binds the free 5' terminus of Heltest4, migrates
to the junction and cleaves Heltest4 to produce an 18 nucleotide
fragment. Templates 1 and 2 serve as controls, although template 2
can also serve as a template.
[0198] Templates are prepared as described below: TABLE-US-00001
Template 1 Template 2 Template 3 Heltest4 14 .mu.l 14 .mu.l 14
.mu.l M13 ** 14 .mu.l 14 .mu.l FENAS ** ** 14 .mu.l H.sub.2O 28
.mu.l 14 .mu.l ** 10x Pfu Buff. 4.6 .mu.l 4.6 .mu.l 4.6 .mu.l
[0199] 10.times.Pfu buffer is available from Stratagene (Catalog #
200536). According to the method of the invention, 10.times.Pfu
buffer is diluted such that a reaction is carried out in the
presence of 1.times.buffer.
[0200] M13 is M13mp18+ strand and is at a concentration of 200
ng/.mu.L, .sup.33P labeled Heltest4 is at an approximate
concentration of 0.7 ng/.mu.l, and FENAS is at a concentration of
4.3 ng/.mu.l. Based on these concentrations, the Heltest4 and M13
are at approximately equal molar amounts (5.times.10.sup.-14) and
FENAS is present in an approximately 10.times.molar excess
(6.times.10.sup.-13).
[0201] The template mixture is heated at 950 C. for five minutes,
cooled to room temperature for 45 minutes and stored at 40 C.
overnight.
[0202] 2 .mu.l of FEN-1 or, as a control, H.sub.2O are mixed with
the three templates as follows: TABLE-US-00002 3 .mu.l template 0.7
.mu.l 10x cloned Pfu buffer 0.56 .mu.l 100 mM MgCl.sub.2 2.00 .mu.l
enzyme or H.sub.2O 0.74 .mu.l H.sub.2O 7.00 .mu.l total volume
[0203] The reactions are allowed to proceed for 30 minutes at
50.degree. C. and stopped by the addition of 2 .mu.l formamide
"Sequencing Stop" solution to each sample. Samples are heated at
95.degree. C. for five minutes and loaded on a 6% acrylamide, 7M
urea CastAway (Stratagene) gel.
[0204] Alternatively, FEN activity can be analyzed in the following
buffer wherein a one hour incubation time is utilized.
10.times.FEN Buffer
500 mM Tris-HCl pH 8.0
100 mM MgCl.sub.2
[0205] The reaction mixture below is mixed with 2 .mu.l of FEN or,
as a control, 2 .mu.l of H.sub.2O. TABLE-US-00003 3 .mu.l template
0.7 .mu.l 10x FEN buffer 2.00 .mu.l enzyme or H.sub.2O 1.3 .mu.l
H.sub.2O 7.00 .mu.l total volume
[0206] Samples are incubated for one hour at 50.degree. C. in a
Robocyler 96 hot top thermal cycler. Following the addition of 2
.mu.l of Sequencing Stop dye solution, samples are heated at
99.degree. C. for five minutes. Samples are loaded on an
eleven-inch long, hand-poured, 20% acrylamide/bis acrylamide, 7M
urea gel. The gel is run at 20 watts until the bromophenol blue has
migrated approximately 2/3 the total distance. The gel is removed
from the glass plates and soaked for 10 minutes in fix (15%
methanol, 5% acetic acid) and then for 10 minutes in water. The gel
is placed on Whatmann 3 mm paper, covered with plastic wrap and
dried for 2 hours in a heated vacuum gel dryer. The gel is exposed
overnight to X-ray film.
[0207] 2. FEN endonuclease activity can also be measured according
to the method of Kaiser et al., supra). Briefly, reactions are
carried out in a 10 .mu.l volume containing 10 mM MOPS, pH 7.5,
0.05% Tween 20, 0.05% Nonidet P-40, 10 .mu.g/ml tRNA, and 200 mM
KCl for TaqPol and TthPol or 50 mM KCl for all other enzymes.
Reaction conditions can be varied depending on the cleavage
structure being analyzed. Substrates (21M) and varying amounts of
enzyme are mixed with the indicated (above) reaction buffer and
overlaid with Chill-out (MJ Research) liquid wax. Substrates are
heat denatured at 900 C. for 20 s and cooled to 500 C., then
reactions are started by addition of MgCl.sub.2 or MnCl.sub.2 and
incubated at 500 C. for the specified length of time. Reactions are
stopped by the addition of 10 .mu.l of 95% formamide containing 10
mM EDTA and 0.02% methyl violet (Sigma). Samples are heated to 900
C. for 1 min immediately before electrophoresis on a 20% denaturing
acrylamide gel (19:1 cross-linked), with 7M urea, and in a buffer
of 45 mM Tris borate, pH 8.3, 1.4 mM EDTA. Unless otherwise
indicated, 1 .mu.l of each stopped reaction is loaded per lane.
Gels are scanned on an FMBIO-100 fluorescent gel scanner (Hitachi)
using a 505-nm filter. The fraction of cleaved product is
determined from intensities of bands corresponding to uncut and cut
substrate with FMBIO Analysis software (version 6.0, Hitachi). The
fraction of cut product should not exceed 20% to ensure that
measurements approximate initial cleavage rates. The cleavage rate
is defined as the concentration of cut product divided by the
enzyme concentration and the time of the reaction (in minutes). For
each enzyme three data points are used to determine the rate and
experimental error.
[0208] 3. FEN endonuclease activity can also be measured according
to the method of Hosfield et al., 1998a, supra. Briefly, in a final
volume of 13 .mu.l, varying amounts of FEN and 1.54 pmol of labeled
cleavage substrate are incubated at different temperatures for 30
min before the reaction is quenched with an equal volume of stop
solution (10 mM EDTA, 95% deionized formamide, and 0.008%
bromophenol blue and xylene cyanol). Samples are electrophoresed
through denaturing 15% polyacrylamide gels, and the relative
amounts of starting material and product are quantitated using the
IPLabGel system (Stratagene) running MacBAS image analysis
software. Most reactions are performed in standard assay buffer (10
mM Tris-HCl (pH 8.0), 10 mM MgCl.sub.2, and 50 .mu.g/ml bovine
serum albumin); however, in a series of experiments the effect of
different divalent metals and pH levels are studied by varying the
standard buffer. For divalent metals, MgCl.sub.2 is omitted, and
different metal ions are used at a final concentration of 10 mM. To
study the influence of pH, buffers containing different amounts of
Tris-HCl, glycine, and sodium acetate are used at a final
concentration of 10 mM to obtain a wide range of pH levels at 250
C.
[0209] 4. FEN endonuclease activity can also be measured according
to the method of Matusi et al., 1999, supra. Briefly, the enzyme
reactions are performed in a 15 .mu.l reaction mixture containing
50 mM Tris-HCl (pH 7.4), 1.5 mM MgCl.sub.2, 0.5 mM
.beta.-mercaptoethanol, 100 .mu.g/ml bovine serum albumin, and 0.6
pmol of a labeled cleavage structure. After incubation for 30 min
at 600 C., the reaction is terminated by adding 15 .mu.l of 95%
formamide containing 10 mM EDTA and 1 mg/ml bromphenol blue. The
samples are heated at 950 C. for 10 min, loaded onto a 15%
polyacrylamide gel (35 cm.times.42.5 cm) containing 7M urea and
10.times.TBE (89 mM Tris-HCl, 89 mM boric acid, 2 mM EDTA (pH
8.0)), and then electrophoresed for 2 h at 2000 V. Reaction
products are visualized and quantified using a Phosphorlmager
(Bio-Rad). Size marker, oligonucleotides are 5' end-labeled with
[.gamma.-.sup.32P]ATP and T4 polynucleotide kinase.
[0210] To determine the optimum pH, the reaction is performed in an
assay mixture (15 .mu.l) containing 1.5 mM MgCl.sub.2, 0.5 mM
.beta.-mercaptoethanol, 100 .mu.g/ml bovine serum albumin, and 0.6
pmol of 5' end-labeled cleavage structure in 50 mM of one of the
following buffers at 600 C. for 30 min. Three different 50 mM
buffers are used to obtain a wide pH range as follows: sodium
acetate buffer (pH 4.0-5.5), phosphate buffer (pH 5.5-8.0), and
borate buffer (pH 8.0-9.4).
B. FEN Exonuclease Activity Assay
[0211] The exonuclease activity of a FEN nuclease according to the
invention can be measured by the method of measuring FEN-1
endonuclease activity described in Matsui et al., 1999, supra and
summarized above.
[0212] Alternatively, the exonuclease activity of a FEN enzyme can
be analyzed by the method described in Hosfield et al., 1998b,
supra. Briefly, exonuclease activities are assayed using a nicked
substrate of FEN under conditions identical to those described for
the endonuclease assays (described above).
[0213] The precise positions of DNA cleavage in both the
exonuclease and endonuclease experiments can be obtained by partial
digestion of a 5' .sup.32P-labeled template strand using the 3'-5'
exonuclease activity of Klenow fragment.
[0214] A cleavage structure according to one embodiment of the
invention comprises a partially displaced 5' end of an
oligonucleotide probe annealed to a target nucleic acid. Another
cleavage structure according to the invention comprises a target
nucleic acid (for example B in FIG. 4), an upstream oligonucleotide
probe according to the invention, and comprising a region or
regions that are complementary to the target sequence (for example
A in FIG. 4), and a downstream oligonucleotide that is
complementary to the target sequence (for example C in FIG. 4). A
cleavage structure according to the invention can be formed by
overlap between the upstream oligonucleotide and the downstream
probe, or by extension of the upstream oligonucleotide by the
synthetic activity of a nucleic acid polymerase, and subsequent
partial displacement of the 5' end of the downstream
oligonucleotide. A cleavage structure of this type is formed
according to the method described in the section entitled "Cleavage
Structure".
[0215] Alternatively, a cleavage structure according to the
invention is formed by annealing a target nucleic acid to an
oligonucleotide probe according to the invention wherein the
oligonucleotide probe comprises a region or regions that are
complementary to the target nucleic acid, and a non-complementary
region that does not anneal to the target nucleic acid and forms a
5' flap. According to this embodiment, a cleavage structure
comprises a 5' flap formed by a non-complementary region of the
oligonucleotide.
[0216] A cleavage structure according to the invention also
comprises an overlapping flap wherein the 3' end of an upstream
oligonucleotide capable of annealing to a target nucleic acid (for
example A in FIG. 4) is complementary to 1 (or more) base pair of
the downstream oligonucleotide probe according to the invention
(for example C in FIG. 4) that is annealed to a target nucleic acid
and wherein the 1 (or more) base pair overlap is directly
downstream of the point of extension of the single stranded flap
and is formed according to method described in the section entitled
"Cleavage Structure". In one embodiment, the upstream
oligonucleotide and the downstream probe hybridize to
non-overlapping regions of the target nucleic acid. In another
embodiment, the upstream oligonucleotide and the downstream probe
hybridize to adjacent regions of the target nucleic acid.
II. Nucleic Acid Polymerases
[0217] The invention provides for nucleic acid polymerases.
Preferably, the nucleic acid polymerase according to the invention
is thermostable.
[0218] Known DNA polymerases useful according to the invention
include, for example, E. coli DNA polymerase I, Thermus
thermophilus (Tth) DNA polymerase, Bacillus stearothermophilus DNA
polymerase, Thermococcus litoralis DNA polymerase, Thermus
aquaticus (Taq) DNA polymerase and Pyrococcus furiosus (Pfu) DNA
polymerase.
[0219] Nucleic acid polymerases substantially lacking 5' to 3'
exonuclease activity useful according to the invention include but
are not limited to Klenow and Klenow exo-, and T7 DNA polymerase
(Sequenase).
[0220] Thermostable nucleic acid polymerases substantially lacking
5' to 3' exonuclease activity useful according to the invention
include but are not limited to Pfu, exo- Pfu (a mutant form of Pfu
that lacks 3' to 5' exonuclease activity), the Stoffel fragment of
Taq, N-truncated Bst, N-truncated Bca, Genta, JdF3 exo-, Vent, Vent
exo- (a mutant form of Vent that lacks 3' to 5' exonuclease
activity), Deep Vent, Deep Vent exo- (a mutant form of Deep Vent
that lacks 3' to 5' exonuclease activity), UlTma, and
ThermoSequenase.
[0221] Nucleic acid polymerases useful according to the invention
include both native polymerases as well as polymerase mutants,
which lack 5' to 3' exonuclease activity. Nucleic acid polymerases
useful according to the invention can possess different degrees of
thermostability. Preferably, a nucleic acid polymerase according to
the invention exhibits strand displacement activity at the
temperature at which it can extend a nucleic acid primer. In a
preferred embodiment of the invention, a nucleic acid polymerase
lacks both 5' to 3' and 3' to 5' exonuclease activity.
[0222] Additional nucleic acid polymerases substantially lacking 5'
to 3' exonuclease activity with different degrees of
thermostability useful according to the invention are listed
below.
A. Bacteriophage DNA polymerases (Useful for 37.degree. C.
assays):
[0223] Bacteriophage DNA polymerases are devoid of 5' to 3'
exonuclease activity, as this activity is encoded by a separate
polypeptide. Examples of suitable DNA polymerases are T4, T7, and
.phi.29 DNA polymerase. The enzymes available commercially are: T4
(available from many sources e.g., Epicentre) and T7 (available
from many sources, e.g. Epicentre for unmodified and USB for 3' to
5' exo.sup.- T7 "Sequenase" DNA polymerase).
B. Archaeal DNA polymerases:
[0224] There are 2 different classes of DNA polymerases which have
been identified in archaea: 1. Family B/pol .alpha. type (homologs
of Pfu from Pyrococcus furiosus) and 2. pol II type (homologs of P.
furiosus DP1/DP2 2-subunit polymerase). DNA polymerases from both
classes have been shown to naturally lack an associated 5' to 3'
exonuclease activity and to possess 3' to 5' exonuclease
(proofreading) activity. Suitable DNA polymerases (pol .alpha. or
pol II) can be derived from archaea with optimal growth
temperatures that are similar to the desired assay temperatures.
Examples of suitable archaea include, but are not limited to:
[0225] 1. Thermolabile (useful for 37.degree. C. assays)--e.g.,
Methanococcus voltae
[0226] 2. Thermostable (useful for non-PCR assays)--e.g.,
Sulfolobus solfataricus, Sulfolobus acidocaldarium, Methanococcus
jannaschi, Thermoplasma acidophilum. It is estimated that suitable
archaea exhibit maximal growth temperatures of
.ltoreq.80-85.degree. C. or optimal growth temperatures of
.ltoreq.70-80.degree. C.
[0227] 3. Thermostable (useful for PCR assays)--e.g., Pyrococcus
species (furiosus, species GB-D, species strain KOD1, woesii,
abysii, horikoshii), Thermococcus species (litoralis, species
9.degree. North-7, species JDF-3, gorgonarius), Pyrodictium
occultum, and Archaeoglobus fulgidus. It is estimated that suitable
archaea would exhibit maximal growth temperatures of
.ltoreq.80-85.degree. C. or optimal growth temperatures of
.ltoreq.70-80.degree. C. Appropriate PCR enzymes from the archaeal
pol .alpha. DNA polymerase group are commercially available,
including KOD (Toyobo), Pfx (Life Technologies, Inc.), Vent (New
England BioLabs), Deep Vent (New England BioLabs), and Pwo
(Boehringer-Mannheim).
[0228] Additional archaea related to those listed above are
described in the following references: Archaea: A Laboratory Manual
(Robb, F. T. and Place, A. R., eds.), Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY, 1995 and Thermophilic Bacteria
(Kristjansson, J. K., ed.) CRC Press, Inc., Boca Raton, Fla.,
1992.
C. Eubacterial DNA polymerases:
[0229] There are 3 classes of eubacterial DNA polymerases, pol I,
II, and III. Enzymes in the Pol I DNA polymerase family possess 5'
to 3' exonuclease activity, and certain members also exhibit 3' to
5' exonuclease activity. Pol II DNA polymerases naturally lack 5'
to 3` exonuclease activity, but do exhibit 3' to 5' exonuclease
activity. Pol III DNA polymerases represent the major replicative
DNA polymerase of the cell and are composed of multiple subunits.
The pol III catalytic subunit lacks 5' to 3' exonuclease activity,
but in some cases 3' to 5' exonuclease activity is located in the
same polypeptide.
[0230] There are no commercial sources of eubacterial pol II and
pol III DNA polymerases.
[0231] There are a variety of commercially available Pol I DNA
polymerases, some of which have been modified to reduce or abolish
5' to 3' exonuclease activity. Methods used to eliminate 5' to 3'
exonuclease activity of pol I DNA polymerases include: [0232]
mutagenesis (as described in Xu et al., 1997, J. Mol. Biol.,
268:284 and Kim et al., 1997, Mol. Cells, 7:468). [0233]
N-truncation by proteolytic digestion (as described in Klenow et
al., 1971, Eur. J. Biochem., 22: 371), or [0234] N-truncation by
cloning and expressing as C-terminal fragments (as described in
Lawyer et al., 1993, PCR Methods Appl., 2:275).
[0235] As for archaeal sources, the assay-temperature requirements
determine which eubacteria should be used as a source of a DNA
polymerase useful according to the invention (e.g., mesophiles,
thermophiles, hyperthermophiles). 1. Mesophilic/thermolabile
(Useful for 37.degree. C. Assays) [0236] i. DNA polymerases
naturally substantially lacking 5' to 3' exonuclease activity: pol
II or the pol III catalytic subunit from mesophilic eubacteria,
such as Escherchia coli, Streptococcus pneumoniae, Haemophilus
influenza, Mycobacterium species (tuberculosis, leprae) [0237] ii.
DNA polymerase mutants substantially lacking 5' to 3' exonuclease
activity: Pol I DNA polymerases for N-truncation or mutagenesis can
be isolated from the mesophilic eubacteria listed above (Ci). A
commercially-available eubacterial DNA polymerase pol I fragment is
the Klenow fragment (N-truncated E. coli pol I; Stratagene).
[0238] 2. Thermostable (Useful for non PCR assays) [0239] i. DNA
polymerases naturally substantially lacking 5' to 3' exonuclease
activity: Pol II or the pol III catalytic subunit from thermophilic
eubacteria, such as Bacillus species (e.g., stearothermophilus,
caldotenax, caldovelox)
[0240] ii. DNA polymerase mutants substantially lacking 5' to 3'
exonuclease activity: Suitable pol I DNA polymerases for
N-truncation or mutagenesis can be isolated from thermophilic
eubacteria such as the Bacillus species listed above. Thermostable
N-truncated fragments of B. stearothermophilus DNA polymerase pol I
are commercially available and sold under the trade names Bst DNA
polymerase I large fragment (Bio-Rad and Isotherm DNA polymerase
(Epicentre)). A C-terminal fragment of Bacillus caldotenax pol I is
available from Panvera (sold under the tradename Ladderman). 3.
Thermostable (Useful for PCR assays)
[0241] i. DNA polymerases naturally substantially lacking 5' to 3'
exonuclease activity: Pol II or pol III catalytic subunit from
Thermus species (aquaticus, thermophilus, flavus, ruber,
caldophilus, filiformis, brokianus) or from Thermotoga maritima.
The catalytic pol III subunits from Thermus thermophilus and
Thermus aquaticus are described in Yi-Ping et al., 1999, J. Mol.
Evol., 48:756 and McHenry et al., 1997, J. Mol. Biol., 272:178.
[0242] ii. DNA polymerase mutants substantially lacking 5' to 3'
exonuclease activity: Suitable pol I DNA polymerases for
N-truncation or mutagenesis can be isolated from a variety of
thermophilic eubacteria, including Thermus species and Thermotoga
maritima (see above). Thermostable fragments of Thermus aquaticus
DNA polymerase pol I (Taq) are commercially available and sold
under the trade names KlenTaq1 (Ab Peptides), Stoffel fragment
(Perkin-Elmer), and ThermoSequenase (Amersham). In addition to
C-terminal fragments, 5' to 3' exonuclease.sup.- Taq mutants are
also commercially available, such as TaqFS (Hoffman-LaRoche). In
addition to 5'-3' exonuclease - versions of Taq, an N-truncated
version of Thermotoga maritima DNA polymerase I is also
commercially available (tradename UlTma, Perkin-Elmer).
[0243] Additional eubacteria related to those listed above are
described in Thermophilic Bacteria (Kristjansson, J. K., ed.) CRC
Press, Inc., Boca Raton, Fla., 1992.
D. Eukaryotic 5' to 3' Exonuclease.sup.- DNA polymerases (Useful
for 37.degree. C. assays)
[0244] There are several DNA polymerases that have been identified
in eukaryotes, including DNA pol .alpha. a (replication/repair),
.delta. (replication), .epsilon. (replication), .beta. (repair) and
.gamma.(mitochondrial replication). Eukaryotic DNA polymerases are
devoid of 5' to 3' exonuclease activity, as this activity is
encoded by a separate polypeptide (e.g., mammalian FEN-1 or yeast
RAD2). Suitable thermolabile DNA polymerases may be isolated from a
variety of eukaryotes (including but not limited to yeast,
mammalian cells, insect cells, Drosophila) and eukaryotic viruses
(e.g., EBV, adenovirus).
[0245] It is possible that DNA polymerase mutants lacking 3'-5'
exonuclease (proofreading) activity, in addition to lacking 5' to
3' exonuclease activity, could exhibit improved performance in
FEN-based detection strategies. For example, reducing or abolishing
inherent 3' to 5' exonuclease activity may lower background signals
by diminishing non-specific exonucleolytic degradation of labeled
probes. Three 3' to 5' exonuclease motifs have been identified, and
mutations in these regions have been shown to abolish 3' to 5'
exonuclease activity in Klenow, .phi.29, T4, T7, and Vent DNA
polymerases, yeast Pol .alpha., Pol .beta., and Pol .gamma., and
Bacillus subtilis Pol III (reviewed in Derbeyshire et al.,
1995,Methods. Enzymol. 262:363). Methods for preparing additional
DNA polymerase mutants, with reduced or abolished 3' to 5'
exonuclease activity, are well known in the art.
[0246] Commercially-available enzymes that lack both 5' to 3' and
3' to 5' exonuclease activities include Sequenase (exo.sup.- T7;
USB), Pfu exo.sup.- (Stratagene), exo.sup.- Vent (New England
BioLabs), exo.sup.- DeepVent (New England BioLabs), exo.sup.-
Klenow fragment (Stratagene), Bst (Bio-Rad), Isotherm (Epicentre),
Ladderman (Panvera), KlenTaq1 (Ab Peptides), Stoffel fragment
(Perkin-Elmer), ThermoSequenase (USB), and TaqFS
(Hoffman-LaRoche).
[0247] If polymerases other than Pfu are used, buffers and
extension temperatures are selected to allow for optimal activity
by the particular polymerase useful according to the invention.
Buffers and extension temperatures useful for polymerases according
to the invention are know in the art and can also be determined
from the Vendor's specifications.
III. Nucleic Acids
[0248] A. Nucleic Acid Sequences Useful in the Invention
[0249] The invention provides for methods of detecting or measuring
a target nucleic acid; and also utilizes oligonucleotides, primers
and probes for forming a cleavage structure according to the
invention and primers for amplifying a template nucleic acid
sequence.
[0250] As used herein, the terms "nucleic acid", "polynucleotide"
and "oligonucleotide" refer to primers, probes, and oligomer
fragments to be detected, and shall be generic to
polydeoxyribonucleotides (containing 2-deoxy-D-ribose), to
polyribonucleotides (containing D-ribose), and to any other type of
polynucleotide which is an N-glycoside of a purine or pyrimidine
base, or modified purine or pyrimidine bases (including abasic
sites). There is no intended distinction in length between the term
"nucleic acid", "polynucleotide" and "oligonucleotide", and these
terms will be used interchangeably. These terms refer only to the
primary structure of the molecule. Thus, these terms include
double- and single-stranded DNA, as well as double- and
single-stranded RNA.
[0251] The complement of a nucleic acid sequence as used herein
refers to an oligonucleotide which, when aligned with the nucleic
acid sequence such that the 5' end of one sequence is paired with
the 3' end of the other, is in "antiparallel association." The
oligonucleotide is not necessarily physically derived from any
existing or natural sequence but may be generated in any manner,
including chemical synthesis, DNA replication, reverse
transcription or a combination thereof. The terms "oligonucleotide"
or "nucleic acid" intend a polynucleotide of genomic DNA or RNA,
cDNA, semisynthetic, or synthetic origin which, by virtue of its
synthetic origin or manipulation: (1) is not associated with all or
a portion of the polynucleotide with which it is associated in
nature; and/or (2) is linked to a polynucleotide other than that to
which it is linked in nature.
[0252] Because mononucleotides are reacted to make oligonucleotides
in a manner such that the 5' phosphate of one mononucleotide
pentose ring is attached to the 3' oxygen of its neighbor in one
direction via a phosphodiester linkage, an end of oligonucleotide
is referred to as the "5' end" if its 5' phosphate is not linked to
the 3' oxygen of a mononucleotide pentose ring and as the "3' end"
if its 3' oxygen is not linked to a 5' phosphate of a subsequent
mononucleotide pentose ring. As used herein, a nucleic acid
sequence, even if internal to a larger oligonucleotide, also may be
said to have 5' and 3' ends.
[0253] When two different, non-overlapping oligonucleotides anneal
to different regions of the same linear complementary nucleic acid
sequence, and the 3' end of one oligonucleotide points toward the
5' end of the other, the former may be called the "upstream"
oligonucleotide and the latter the "downstream"
oligonucleotide.
[0254] Certain bases not commonly found in natural nucleic acids
may be included in the nucleic acids of the present invention and
include, for example, inosine and 7-deazaguanine. Complementarity
need not be perfect; stable duplexes may contain mismatched base
pairs or unmatched bases. Those skilled in the art of nucleic acid
technology can determine duplex stability empirically considering a
number of variables including, for example, the length of the
oligonucleotide, base composition and sequence of the
oligonucleotide, ionic strength, and incidence of mismatched base
pairs.
[0255] Stability of a nucleic acid duplex is measured by the
melting temperature, or "T.sub.m". The T.sub.m of a particular
nucleic acid duplex under specified conditions is the temperature
at which half of the base pairs have disassociated.
[0256] B. Primers and Probes Useful According to the Invention
[0257] The invention provides for oligonucleotide primers and
probes useful for detecting or measuring a nucleic acid, for
amplifying a template nucleic acid sequence, and for forming a
cleavage structure according to the invention.
[0258] The term "primer" may refer to more than one primer and
refers to an oligonucleotide, whether occurring naturally, as in a
purified restriction digest, or produced synthetically, which is
capable of acting as a point of initiation of synthesis along a
complementary strand when placed under conditions in which
synthesis of a primer extension product which is complementary to a
nucleic acid strand is catalyzed. Such conditions include the
presence of four different deoxyribonucleoside triphosphates and a
polymerization-inducing agent such as DNA polymerase or reverse
transcriptase, in a suitable buffer ("buffer" includes substituents
which are cofactors, or which affect pH, ionic strength, etc.), and
at a suitable temperature. The primer is preferably single-stranded
for maximum efficiency in amplification.
[0259] Oligonucleotide primers useful according to the invention
are single-stranded DNA or RNA molecules that are hybridizable to a
template nucleic acid sequence and prime enzymatic synthesis of a
second nucleic acid strand. The primer is complementary to a
portion of a target molecule present in a pool of nucleic acid
molecules. It is contemplated that oligonucleotide primers
according to the invention are prepared by synthetic methods,
either chemical or enzymatic. Alternatively, such a molecule or a
fragment thereof is naturally-occurring, and is isolated from its
natural source or purchased from a commercial supplier.
Oligonucleotide primers are 5 to 100 nucleotides in length, ideally
from 17 to 40 nucleotides, although primers of different length are
of use. Primers for amplification are preferably about 17-25
nucleotides. Primers for the production of a cleavage structure
according to the invention are preferably about 17-45 nucleotides.
Primers useful according to the invention are also designed to have
a particular melting temperature (Tm) by the method of melting
temperature estimation. Commercial programs, including Oligo.TM.,
Primer Design and programs available on the internet, including
Primer3 and Oligo Calculator can be used to calculate a Tm of a
nucleic acid sequence useful according to the invention.
Preferably, the Tm of an amplification primer useful according to
the invention, as calculated for example by Oligo Calculator, is
preferably between about 45 and 650 C. and more preferably between
about 50 and 600 C. Preferably, the Tm of a probe useful according
to the invention is 70 C. higher than the Tm of the corresponding
amplification primers.
[0260] Primers and probes according to the invention can be labeled
and can be used to prepare a labeled cleavage structure. Pairs of
single-stranded DNA primers , a DNA primer and a probe or a probe
can be annealed to sequences within a target nucleic acid. In
certain embodiments, a primer can be used to prime amplifying DNA
synthesis of a target nucleic acid.
[0261] Typically, selective hybridization occurs when two nucleic
acid sequences are substantially complementary (at least about 65%
complementary over a stretch of at least 14 to 25 nucleotides,
preferably at least about 75%, more preferably at least about 90%
complementary). See Kanehisa, M., 1984, Nucleic Acids Res. 12: 203,
incorporated herein by reference. As a result, it is expected that
a certain degree of mismatch at the priming site is tolerated. Such
mismatch may be small, such as a mono-, di- or tri-nucleotide.
Alternatively, a region of mismatch may encompass loops, which are
defined as regions in which there exists a mismatch in an
uninterrupted series of four or more nucleotides.
[0262] Numerous factors influence the efficiency and selectivity of
hybridization of the primer to a second nucleic acid molecule.
These factors, which include primer length, nucleotide sequence
and/or composition, hybridization temperature, buffer composition
and potential for steric hindrance in the region to which the
primer is required to hybridize, will be considered when designing
oligonucleotide primers according to the invention.
[0263] A positive correlation exists between primer length and both
the efficiency and accuracy with which a primer will anneal to a
target sequence. In particular, longer sequences have a higher
melting temperature (T.sub.M) than do shorter ones, and are less
likely to be repeated within a given target sequence, thereby
minimizing promiscuous hybridization. Primer sequences with a high
G-C content or that comprise palindromic sequences tend to
self-hybridize, as do their intended target sites, since
unimolecular, rather than bimolecular, hybridization kinetics are
generally favored in solution. However, it is also important to
design a primer that contains sufficient numbers of G-C nucleotide
pairings since each G-C pair is bound by three hydrogen bonds,
rather than the two that are found when A and T bases pair to bind
the target sequence, and therefore forms a tighter, stronger bond.
Hybridization temperature varies inversely with primer annealing
efficiency, as does the concentration of organic solvents, e.g.
formamide, that might be included in a priming reaction or
hybridization mixture, while increases in salt concentration
facilitate binding. Under stringent annealing conditions, longer
hybridization probes, or synthesis primers, hybridize more
efficiently than do shorter ones, which are sufficient under more
permissive conditions. Preferably, stringent hybridization is
performed in a suitable buffer (for example, 1.times.Sentinel
Molecular Beacon PCR core buffer, Stratagene Catalog #600500;
1.times.Pfu buffer, Stratagene Catalog #200536; or 1.times.cloned
Pfu buffer, Stratagene Catalog #200532) under conditions that allow
the nucleic acid sequence to hybridize to the oligonucleotide
primers and/or probes (e.g., 95.degree. C.). Stringent
hybridization conditions can vary (for example from salt
concentrations of less than about 1M, more usually less than about
500 mM and preferably less than about 200 mM) and hybridization
temperatures can range (for example, from as low as 0.degree. C. to
greater than 22.degree. C., greater than about 30.degree. C., and
(most often) in excess of about 37.degree. C.) depending upon the
lengths and/or the nucleic acid composition or the oligonucleotide
primers and/or probes. Longer fragments may require higher
hybridization temperatures for specific hybridization. As several
factors affect the stringency of hybridization, the combination of
parameters is more important than the absolute measure of a single
factor.
[0264] Oligonucleotide primers can be designed with these
considerations in mind and synthesized according to the following
methods.
[0265] 1. Oligonucleotide Primer Design Strategy
[0266] The design of a particular oligonucleotide primer for the
purpose of sequencing or PCR, involves selecting a sequence that is
capable of recognizing the target sequence, but has a minimal
predicted secondary structure. The oligonucleotide sequence may or
may not bind only to a single site in the target nucleic acid.
Furthermore, the Tm of the oligonucleotide is optimized by analysis
of the length and GC content of the oligonucleotide. Furthermore,
when designing a PCR primer useful for the amplification of genomic
DNA, the selected primer sequence does not demonstrate significant
matches to sequences in the GenBank database (or other available
databases).
[0267] The design of a primer useful according to the invention, is
facilitated by the use of readily available computer programs,
developed to assist in the evaluation of the several parameters
described above and the optimization of primer sequences. Examples
of such programs are "PrimerSelect" of the DNAStar.TM. software
package (DNAStar, Inc.; Madison, Wis.), OLIGO 4.0 (National
Biosciences, Inc.), PRIMER, Oligonucleotide Selection Program, PGEN
and Amplify (described in Ausubel et al., 1995, Short Protocols in
Molecular Biology, 3rd Edition, John Wiley & Sons). In one
embodiment, primers are designed with sequences that serve as
targets for other primers to produce a PCR product that has known
sequences on the ends which serve as targets for further
amplification (e.g. to sequence the PCR product). If many different
target nucleic acids are amplified with specific primers that share
a common `tail` sequence`, the PCR products from these distinct
genes can subsequently be sequenced with a single set of primers.
Alternatively, in order to facilitate subsequent cloning of
amplified sequences, primers are designed with restriction enzyme
site sequences appended to their 5' ends. Thus, all nucleotides of
the primers are derived from a target nucleic acid or sequences
adjacent to a target nucleic acid, except for the few nucleotides
necessary to form a restriction enzyme site. Such enzymes and sites
are well known in the art. If the genomic sequence of a target
nucleic acid and the sequence of the open reading frame of a target
nucleic acid are known, design of particular primers is well within
the skill of the art.
[0268] It is well known by those with skill in the art that
oligonucleotides can be synthesized with certain chemical and/or
capture moieties, (including capture elements as defined herein)
such that they can be coupled to solid supports and bind to a
binding moiety or tag, as defined herein. Suitable capture elements
include, but are not limited to a nucleic acid binding protein or a
nucleotide sequence. Suitable capture elements include, but are not
limited to, biotin, a hapten, a protein, or a chemically reactive
moiety. Such oligonucleotides may either be used first in solution,
and then captured onto a solid support, or first attached to a
solid support and then used in a detection reaction. An example of
the latter would be to couple a downstream probe molecule to a
solid support, such that the 5' end of the downstream probe
molecule comprised a fluorescent quencher. The same downstream
probe molecule would also comprise a fluorophore in a location such
that a FEN nuclease cleavage would physically separate the quencher
from the fluorophore. For example, the target nucleic acid could
hybridize with the solid-phase downstream probe oligonucleotide,
and a liquid phase upstream primer could also hybridize with the
target molecule, such that a FEN cleavage reaction occurs on the
solid support and liberates the 5' quencher moiety from the
complex. This would cause the solid support-bound fluorophore to be
detectable, and thus reveal the presence of a cleavage event upon a
suitably labeled or identified solid support. Different downstream
probe molecules could be bound to different locations on an array.
The location on the array would identify the probe molecule, and
indicate the presence of the template to which the probe molecule
can hybridize.
[0269] 2. Synthesis
[0270] The primers themselves are synthesized using techniques that
are also well known in the art. Methods for preparing
oligonucleotides of specific sequence are known in the art, and
include, for example, cloning and restriction digest analysis of
appropriate sequences and direct chemical synthesis. Once designed,
oligonucleotides are prepared by a suitable chemical synthesis
method, including, for example, the phosphotriester method
described by Narang et al., 1979, Methods in Enzymology, 68:90, the
phosphodiester method disclosed by Brown et al., 1979, Methods in
Enzymology, 68:109, the diethylphosphoramidate method disclosed in
Beaucage et al., 1981, Tetrahedron Letters, 22:1859, and the solid
support method disclosed in U.S. Pat. No. 4,458,066, or by other
chemical methods using either a commercial automated
oligonucleotide synthesizer (which is commercially available) or
VLSIPS.TM. technology.
[0271] C. Probes
[0272] The invention provides for probes useful for forming a
cleavage structure or a labeled cleavage structure as defined
herein. Methods of preparing a labeled cleavage structure according
to the invention are provided in the section entitled "Cleavage
Structure" below.
[0273] As used herein, the term "probe" refers to a probe having a
secondary structure that changes upon binding of the probe to a
target nucleic acid and comprising a binding moiety, as defined
herein, wherein the probe forms a duplex structure with a sequence
in the target nucleic acid, due to complementarity of at least one
sequence in the probe with a sequence in the target region. A probe
according to the invention can also be labeled. The probe,
preferably, does not contain a sequence complementary to
sequence(s) used in the primer extension(s). Generally the 3'
terminus of the probe will be "blocked" to prohibit incorporation
of the probe into a primer extension product. Methods of labeling a
probe according to the invention and suitable labels are described
below in the section entitled "Cleavage Structure".
[0274] The general design of a probe according to the invention is
described in the section entitled, "Primers and Probes Useful
According to the Invention". Typically, a probe according to the
invention comprises a target nucleic acid binding sequence that is
from about 7-140 nucleotides, and preferably from about 10-140
nucleotides long (C, FIG. 4). A probe according to the invention
also comprises two complementary nucleic acid sequence regions, as
defined herein (b and b', FIG. 4) that are complementary and bind
to each other to form a region of secondary structure in the
absence of a target nucleic acid. Regions b and b' are 3-25
nucleotides, preferably 4-15 nucleotides and more preferably 5-11
nucleotides in length. The actual length will be chosen with
reference to the target nucleic acid binding sequence such that the
secondary structure of the probe is preferably stable when the
probe is not bound to the target nucleic acid at the temperature at
which cleavage of a cleavage structure comprising the probe bound
to a target nucleic acid is performed.
[0275] A probe according to the invention is capable of forming a
secondary structure as defined herein, (including a stem loop, a
hairpin, an internal loop, a bulge loop, a branched structure and a
pseudoknot) or multiple secondary structures, cloverleaf type
structures or any three-dimensional structure as defined
hereinabove.
[0276] For example, according to one embodiment of the present
invention, a probe can be an oligonucleotide with secondary
structure such as a hairpin or a stem-loop, and includes, but is
not limited to molecular beacons, safety pins, scorpions, and
sunrise/amplifluor probes.
[0277] Molecular beacon probes comprise a hairpin, or stem-loop
structure which possesses a pair of interactive signal generating
labeled moieties (e.g., a fluorophore and a quencher) effectively
positioned to quench the generation of a detectable signal when the
beacon probe is not hybridized to the target nucleic acid. The loop
comprises a region that is complementary to a target nucleic acid.
The loop is flanked by 5' and 3' regions ("arms") that reversibly
interact with one another by means of complementary nucleic acid
sequences when the region of the probe that is complementary to a
nucleic acid target sequence is not bound to the target nucleic
acid. Alternatively, the loop is flanked by 5' and 3' regions
("arms") that reversibly interact with one another by means of
attached members of an affinity pair to form a secondary structure
when the region of the probe that is complementary to a nucleic
acid target sequence is not bound to the target nucleic acid. As
used herein, "arms" refers to regions of a molecular beacon probe
that a) reversibly interact with one another by means of
complementary nucleic acid sequences when the region of the probe
that is complementary to a nucleic acid target sequence is not
bound to the target nucleic acid or b) regions of a probe that
reversibly interact with one another by means of attached members
of an affinity pair to form a secondary structure when the region
of the probe that is complementary to a nucleic acid target
sequence is not bound to the target nucleic acid. When a molecular
beacon probe is not hybridized to target, the arms hybridize with
one another to form a stem hybrid, which is sometimes referred to
as the "stem duplex". This is the closed conformation. When a
molecular beacon probe hybridizes to its target the "arms" of the
probe are separated. This is the open conformation. In the open
conformation an arm may also hybridize to the target. Such probes
may be free in solution, or they may be tethered to a solid
surface. When the arms are hybridized (e.g., form a stem) the
quencher is very close to the fluorophore and effectively quenches
or suppresses its fluorescence, rendering the probe dark. Such
probes are described in U.S. Pat. No. 5,925,517 and U.S. Pat. No.
6,037,130.
[0278] As used herein, a molecular beacon probe can also be an
"allele-discriminating" probe as described herein.
[0279] Molecular beacon probes have a fluorophore attached to one
arm and a quencher attached to the other arm. The fluorophore and
quencher, for example, tetramethylrhodamine and DABCYL, need not be
a FRET pair.
[0280] For stem loop probes useful in this invention, the length of
the probe sequence that is complementary to the target, the length
of the regions of a probe (e.g., stem hybrid) that reversibly
interact with one another by means of complementary nucleic acid
sequences, when the region complementary to a nucleic acid target
sequence is not bound to the target nucleic acid, and the relation
of the two, is designed according to the assay conditions for which
the probe is to be utilized. The lengths of the
target-complementary sequences and the stem hybrid sequences for
particular assay conditions can be estimated according to what is
known in the art. The regions of a probe that reversibly interact
with one another by means of complementary nucleic acid sequences
when the region of the probe that is complementary to a nucleic
acid target sequence is not bound to the target nucleic acid are in
the range of 6 to 100, preferably 8 to 50 nucleotides and most
preferably 8 to 25 nucleotides each. The length of the probe
sequence that is complementary to the target is preferably 17-40
nucleotides, more preferably 17-30 nucleotides and most preferably
17-25 nucleotides long.
[0281] The oligonucleotide sequences of molecular beacon probes
modified according to this invention may be DNA, RNA, cDNA or
combinations thereof. Modified nucleotides may be included, for
example nitropyrole-based nucleotides or
2'-O-methylribonucleotides. Modified linkages also may be included,
for example phosphorothioates. Modified nucleotides and modified
linkages may also be incorporated in wavelength-shifting primers
according to this invention.
[0282] A safety pin probe, as utilized in the present invention,
requires a "universal" hairpin probe 1 (FIG. 9, b171 SEQ ID NO:
31), comprising a hairpin structure, with a fluorophore (FAM) on
the 5' arm of the hairpin and a quencher (Dabcyl) on the 3' arm,
and a probe 2 (FIG. 9, SP170a SEQ ID NO: 32) comprising a stem-loop
comprising two domains: the 5' two thirds of probe 2 (SEQ ID NO:
34) have a (universal) sequence complementary to the hairpin probe
1, and nucleotides that will stop the DNA polymerase, and the 3'
one third of probe 2, which serves as the target specific primer.
As the polymerase, primed from the reverse primer (that is, the 3'
one third of probe 2) synthesizes the top strand (SEQ ID NO: 33),
the 5' end of probe 2 will be displaced and degraded by the 5'
exonucleolytic activity until the "stop nucleotides" are reached.
At this time the remainder of probe 2 opens up or unfolds and
serves as a target for hairpin probe 1 (SEQ ID NO: 31), thereby
separating the fluorophore from the quencher (FIG. 9).
[0283] Scorpion probes, as used in the present invention comprise a
3' primer with a 5' extended probe tail comprising a hairpin
structure which possesses a fluorophore/quencher pair. The probe
tail is "protected" from replication in the 5'3' direction by the
inclusion of hexethlyene glycol (HEG) which blocks the polymerase
from replicating the probe. During the first round of amplification
the 3' target-specific primer anneals to the target and is extended
such that the scorpion is now incorporated into the newly
synthesized strand, which possesses a newly synthesized target
region for the 5' probe. During the next round of denaturation and
annealing, the probe region of the scorpion hairpin loop will
hybridize to the target, thus separating the fluorophore and
quencher and creating a measurable signal. Such probes are
described in Whitcombe et al., Nature Biotechnology 17: 804-807
(1999), and in FIG. 10.
[0284] An additional oligonucleotide probe useful in the present
invention is the sunrise/amplifluor probe. The sunrise/amplifluor
probe is of similar construction as the scorpion probe with the
exception that is lacks the HEG monomer to block the 5'3'
replication of the hairpin probe region. Thus, in the first round
of amplification, the 3' target specific primer of the
sunrise/amplifluor anneals to the target and is extended, thus
incorporating the hairpin probe into the newly synthesized strand
(sunrise strand). During the second round of amplification a
second, non-labeled primer anneals to the 3' end of the sunrise
strand (Cycle 2 in FIG. 11). However, as the polymerase reaches the
5' end of the hairpin, due to the lack of the HEG stop sequence,
the polymerase will displace and replicate the hairpin, thus
separating the fluorophore and quencher, and incorporating the
linearized hairpin probe into the new strand. Probes of this type
are described further in Nazameko et al., Nucleic Acid Res. 25:
2516-2521 (1997), and in FIG. 11.
[0285] For safety pin, scorpion and sunrise/amplifluor probes
useful in this invention, the length of the probe sequence that is
complementary to the target, the length of the regions of a probe
(e.g., stem hybrid) that reversibly interact with one another by
means of complementary nucleic acid sequences when the region
complementary to a nucleic acid target sequence is not bound to the
target nucleic acid and the relation of the two is designed
according to the assay conditions for which the probe is to be
utilized. The lengths of the target-complementary sequences and the
stem hybrid sequences for particular assay conditions can be
estimated according to what is known in the art. The regions of a
probe that reversibly interact with one another by means of
complementary nucleic acid sequences when the region complementary
to a nucleic acid target sequence is not bound to the target
nucleic acid are in the range of 6 to 100, preferably 8 to 50
nucleotides and most preferably 8 to 25 nucleotides each. The
length of the probe sequence that is complementary to the target is
preferably 17-40 nucleotides, more preferably 17-30 nucleotides and
most preferably 17-25 nucleotides long. The stability of the
interaction between the regions of a probe that reversibly interact
with one another by means of complementary nucleic acid sequences
is determined by routine experimentation to achieve proper
functioning. In addition to length, the stability of the
interaction between the regions of a probe that reversibly interact
with one another by means of complementary nucleic acid sequences
can be adjusted by altering the G-C content and inserting
destabilizing mismatches. One of the regions of a probe that
reversibly interact with one another by means of complementary
nucleic acid sequences can be designed to be partially or
completely complementary to the target. If the 3' arm is
complementary to the target the probe can serve as a primer for a
DNA polymerase. Also, wavelength-shifting molecular beacon probes
can be immobilized to solid surfaces, as by tethering, or be
free-floating.
[0286] A wide range of fluorophores may be used in probes and
primers according to this invention. Available fluorophores include
coumarin, fluorescein, tetrachlorofluorescein,
hexachlorofluorescein, Lucifer yellow, rhodamine, BODIPY,
tetramethylrhodamine, Cy3, Cy5, Cy7, eosine, Texas red and ROX.
Combination fluorophores such as fluorescein-rhodamine dimers,
described, for example, by Lee et al. (1997), Nucleic Acids
Research 25:2816, are also suitable. Fluorophores may be chosen to
absorb and emit in the visible spectrum or outside the visible
spectrum, such as in the ultraviolet or infrared ranges.
[0287] Suitable quenchers described in the art include particularly
DABCYL and variants thereof, such as DABSYL, DABMI and Methyl Red.
Fluorophores can also be used as quenchers, because they tend to
quench fluorescence when touching certain other fluorophores.
Preferred quenchers are either chromophores such as DABCYL or
malachite green, or fluorophores that do not fluoresce in the
detection range when the probe is in the open conformation.
[0288] D. Production of a Nucleic Acid
[0289] The invention provides nucleic acids to be detected and or
measured, for amplification of a target nucleic acid and for
formation of a cleavage structure.
[0290] The present invention utilizes nucleic acids comprising RNA,
cDNA, genomic DNA, synthetic forms, and mixed polymers. The
invention includes both sense and antisense strands of a nucleic
acid. According to the invention, the nucleic acid may be
chemically or biochemically modified or may contain non-natural or
derivatized nucleotide bases. Such modifications include, for
example, labels, methylation, substitution of one or more of the
naturally occurring nucleotides with an analog, internucleotide
modifications such as uncharged linkages (e.g. methyl phosphonates,
phosphorodithioates, etc.), pendent moieties (e.g., polypeptides),
intercalators, (e.g. acridine, psoralen, etc.) chelators,
alkylators, and modified linkages (e.g. alpha anomeric nucleic
acids, etc.) Also included are synthetic molecules that mimic
polynucleotides in their ability to bind to a designated sequence
via hydrogen bonding and other chemical interactions. Such
molecules are known in the art and include, for example, those in
which peptide linkages substitute for phosphate linkages in the
backbone of the molecule.
[0291] 1. Nucleic Acids Comprising DNA
[0292] a. Cloning
[0293] Nucleic acids comprising DNA can be isolated from cDNA or
genomic libraries by cloning methods well known to those skilled in
the art (Ausubel et al., supra). Briefly, isolation of a DNA clone
comprising a particular nucleic acid sequence involves screening a
recombinant DNA or cDNA library and identifying the clone
containing the desired sequence. Cloning will involve the following
steps. The clones of a particular library are spread onto plates,
transferred to an appropriate substrate for screening, denatured,
and probed for the presence of a particular nucleic acid. A
description of hybridization conditions, and methods for producing
labeled probes is included below.
[0294] The desired clone is preferably identified by hybridization
to a nucleic acid probe or by expression of a protein that can be
detected by an antibody. Alternatively, the desired clone is
identified by polymerase chain amplification of a sequence defined
by a particular set of primers according to the methods described
below.
[0295] The selection of an appropriate library involves identifying
tissues or cell lines that are an abundant source of the desired
sequence. Furthermore, if a nucleic acid of interest contains
regulatory sequence or intronic sequence a genomic library is
screened (Ausubel et al., supra).
[0296] b. Genomic DNA
[0297] Nucleic acid sequences of the invention are amplified from
genomic DNA. Genomic DNA is isolated from tissues or cells
according to the following method.
[0298] To facilitate detection of a variant form of a gene from a
particular tissue, the tissue is isolated free from surrounding
normal tissues. To isolate genomic DNA from mammalian tissue, the
tissue is minced and frozen in liquid nitrogen. Frozen tissue is
ground into a fine powder with a prechilled mortar and pestle, and
suspended in digestion buffer (100 mM NaCl, 10 mM Tris-HCl, pH 8.0,
25 mM EDTA, pH 8.0, 0.5% (w/v) SDS, 0.1 mg/ml proteinase K) at 1.2
ml digestion buffer per 100 mg of tissue. To isolate genomic DNA
from mammalian tissue culture cells, cells are pelleted by
centrifugation for 5 min at 500.times.g, resuspended in 1-10 ml
ice-cold PBS, repelleted for 5 min at 500.times.g and resuspended
in 1 volume of digestion buffer.
[0299] Samples in digestion buffer are incubated (with shaking) for
12-18 hours at 500 C., and then extracted with an equal volume of
phenol/chloroform/isoamyl alcohol. If the phases are not resolved
following a centrifugation step (10 min at 1700.times.g), another
volume of digestion buffer (without proteinase K) is added and the
centrifugation step is repeated. If a thick white material is
evident at the interface of the two phases, the organic extraction
step is repeated. Following extraction the upper, aqueous layer is
transferred to a new tube to which will be added 1/2 volume of 7.5M
ammonium acetate and 2 volumes of 100% ethanol. The nucleic acid is
pelleted by centrifugation for 2 min at 1700.times.g, washed with
70% ethanol, air dried and resuspended in TE buffer (10 mM
Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0) at 1 mg/ml. Residual RNA is
removed by incubating the sample for 1 hour at 370 C. in the
presence of 0.1% SDS and 1g/ml DNase-free RNase, and repeating the
extraction and ethanol precipitation steps. The yield of genomic
DNA, according to this method is expected to be approximately 2 mg
DNA/i g cells or tissue (Ausubel et al., supra). Genomic DNA
isolated according to this method can be used for PCR analysis,
according to the invention.
[0300] c. Restriction digest (of cDNA or genomic DNA)
[0301] Following the identification of a desired cDNA or genomic
clone containing a particular target nucleic acid, nucleic acids of
the invention may be isolated from these clones by digestion with
restriction enzymes.
[0302] The technique of restriction enzyme digestion is well known
to those skilled in the art (Ausubel et al., supra). Reagents
useful for restriction enzyme digestion are readily available from
commercial vendors including Stratagene, as well as other
sources.
[0303] d. PCR
[0304] Nucleic acids of the invention may be amplified from genomic
DNA or other natural sources by the polymerase chain reaction
(PCR). PCR methods are well-known to those skilled in the art.
[0305] PCR provides a method for rapidly amplifying a particular
DNA sequence by using multiple cycles of DNA replication catalyzed
by a thermostable, DNA-dependent DNA polymerase to amplify the
target sequence of interest. PCR requires the presence of a target
nucleic acid to be amplified, two single stranded oligonucleotide
primers flanking the sequence to be amplified, a DNA polymerase,
deoxyribonucleoside triphosphates, a buffer and salts.
[0306] PCR, is performed as described in Mullis and Faloona, 1987,
Methods Enzymol., 155: 335, herein incorporated by reference.
[0307] The polymerase chain reaction (PCR) technique, is disclosed
in U.S. Pat. Nos. 4,683,202, 4,683,195 and 4,800,159. In its
simplest form, PCR is an in vitro method for the enzymatic
synthesis of specific DNA sequences, using two oligonucleotide
primers that hybridize to opposite strands and flank the region of
interest in the target DNA. A repetitive series of reaction steps
involving template denaturation, primer annealing and the extension
of the annealed primers by DNA polymerase results in the
exponential accumulation of a specific fragment whose termini are
defined by the 5' ends of the primers. PCR is reported to be
capable of producing a selective enrichment of a specific DNA
sequence by a factor of 10.sup.9. The PCR method is also described
in Saiki et al., 1985, Science 230:1350.
[0308] PCR is performed using template DNA (at least 1 fg; more
usefully, 1-1000 ng) and at least 25 pmol of oligonucleotide
primers. A typical reaction mixture includes: 2 .mu.l of DNA, 25
pmol of oligonucleotide primer, 2.5 .mu.l of a suitable buffer, 0.4
.mu.l of 1.25 .mu.M dNTP, 2.5 units of Taq DNA polymerase
(Stratagene) and deionized water to a total volume of 25 .mu.l.
Mineral oil is overlaid and the PCR is performed using a
programmable thermal cycler.
[0309] The length and temperature of each step of a PCR cycle, as
well as the number of cycles, are adjusted according to the
stringency requirements in effect. Annealing temperature and timing
are determined both by the efficiency with which a primer is
expected to anneal to a template and the degree of mismatch that is
to be tolerated. The ability to optimize the stringency of primer
annealing conditions is well within the knowledge of one of
moderate skill in the art. An annealing temperature of between
30.degree. C. and 72.degree. C. is used. Initial denaturation of
the template molecules normally occurs at between 92.degree. C. and
99.degree. C. for 4 minutes, followed by 20-40 cycles consisting of
denaturation (94-99.degree. C. for 15 seconds to 1 minute),
annealing (temperature determined as discussed above; 1-2 minutes),
and extension (72.degree. C. for 1 minute). The final extension
step is generally carried out for 4 minutes at 72.degree. C., and
may be followed by an indefinite (0-24 hour) step at 4.degree.
C.
[0310] Detection methods generally employed in standard PCR
techniques use a labeled probe with the amplified DNA in a
hybridization assay. Preferably, the probe is labeled, e.g., with
.sup.32P, biotin, horseradish peroxidase (HRP), etc., to allow for
detection of hybridization.
[0311] Other means of detection include the use of fragment length
polymorphism (PCR FLP), hybridization to allele-specific
oligonucleotide (ASO) probes (Saiki et al., 1986, Nature 324:163),
or direct sequencing via the dideoxy method (using amplified DNA
rather than cloned DNA). The standard PCR technique operates
(essentially) by replicating a DNA sequence positioned between two
primers, providing as the major product of the reaction a DNA
sequence of discrete length terminating with the primer at the 5'
end of each strand. Thus, insertions and deletions between the
primers result in product sequences of different lengths, which can
be detected by sizing the product in PCR-FLP. In an example of ASO
hybridization, the amplified DNA is fixed to a nylon filter (by,
for example, UV irradiation) in a series of "dot blots", then
allowed to hybridize with an oligonucleotide probe labeled with HRP
under stringent conditions. After washing, terramethylbenzidine
(TMB) and hydrogen peroxide are added: HRP oxidizes the hydrogen
peroxide, which in turn oxidizes the TMB to a blue precipitate,
indicating a hybridized probe.
[0312] A PCR assay for detecting or measuring a nucleic assay
according to the invention is described in the section entitled
"Methods of Use".
[0313] 2. Nucleic Acids Comprising RNA
[0314] The present invention also provides a nucleic acid
comprising RNA.
[0315] Nucleic acids comprising RNA can be purified according to
methods well known in the art (Ausubel et al., supra). Total RNA
can be isolated from cells and tissues according to methods well
known in the art (Ausubel et al., supra) and described below.
[0316] RNA is purified from mammalian tissue according to the
following method. Following removal of the tissue of interest,
pieces of tissue of .ltoreq.2 g are cut and quick frozen in liquid
nitrogen, to prevent degradation of RNA. Upon the addition of a
suitable volume of guanidinium solution (for example 20 ml
guanidinium solution per 2 g of tissue), tissue samples are ground
in a tissuemizer with two or three 10-second bursts. To prepare
tissue guanidinium solution (1 L) 590.8 g guanidinium
isothiocyanate is dissolved in approximately 400 ml DEPC-treated
H.sub.2O. 25 ml of 2 M Tris-HCl, pH 7.5 (0.05 M final) and 20 ml
Na.sub.2EDTA (0.01 M final) is added, the solution is stirred
overnight, the volume is adjusted to 950 ml, and 50 ml 2-ME is
added.
[0317] Homogenized tissue samples are subjected to centrifugation
for 10 min at 12,000.times.g at 120 C. The resulting supernatant is
incubated for 2 min at 650 C. in the presence of 0.1 volume of 20%
Sarkosyl, layered over 9 ml of a 5.7M CsCl solution (0.1 g
CsCl/ml), and separated by centrifugation overnight at
113,000.times.g at 220 C. After careful removal of the supernatant,
the tube is inverted and drained. The bottom of the tube
(containing the RNA pellet) is placed in a 50 ml plastic tube and
incubated overnight (or longer) at 40 C. in the presence of 3 ml
tissue resuspension buffer (5 mM EDTA, 0.5% (v/v) Sarkosyl, 5%
(v/v) 2-ME) to allow complete resuspension of the RNA pellet. The
resulting RNA solution is extracted sequentially with 25:24:1
phenol/chloroform/isoamyl alcohol, followed by 24:1
chloroform/isoamyl alcohol, precipitated by the addition of 3 M
sodium acetate, pH 5.2, and 2.5 volumes of 100% ethanol, and
resuspended in DEPC water (Chirgwin et al., 1979, Biochemistry, 18:
5294).
[0318] Alternatively, RNA is isolated from mammalian tissue
according to the following single step protocol. The tissue of
interest is prepared by homogenization in a glass teflon
homogenizer in 1 ml denaturing solution (4M guanidinium
thiosulfate, 25 mM sodium citrate, pH 7.0, 0.1M 2-ME, 0.5% (w/v)
N-laurylsarkosine) per 100 mg tissue. Following transfer of the
homogenate to a 5-ml polypropylene tube, 0.1 ml of 2 M sodium
acetate, pH 4, 1 ml water-saturated phenol, and 0.2 ml of 49:1
chloroform/isoamyl alcohol are added sequentially. The sample is
mixed after the addition of each component, and incubated for 15
min at 0-40 C. after all components have been added. The sample is
separated by centrifugation for 20 min at 10,000.times.g, 4.degree.
C., precipitated by the addition of 1 ml of 100% isopropanol,
incubated for 30 minutes at -20.degree. C. and pelleted by
centrifugation for 10 minutes at 10,000.times.g, 4.degree. C. The
resulting RNA pellet is dissolved in 0.3 ml denaturing solution,
transferred to a microfuge tube, precipitated by the addition of
0.3 ml of 100% isopropanol for 30 minutes at -20.degree. C., and
centrifuged for 10 minutes at 10,000.times.g at 4.degree. C. The
RNA pellet is washed in 70% ethanol, dried, and resuspended in
100-200 .mu.l DEPC-treated water or DEPC-treated 0.5% SDS
(Chomczynski and Sacchi, 1987, Anal. Biochem., 162: 156).
[0319] Nucleic acids comprising RNA can be produced according to
the method of in vitro transcription.
[0320] The technique of in vitro transcription is well known to
those of skill in the art. Briefly, the gene of interest is
inserted into a vector containing an SP6, T3 or T7 promoter. The
vector is linearized with an appropriate restriction enzyme that
digests the vector at a single site located downstream of the
coding sequence. Following a phenol/chloroform extraction, the DNA
is ethanol precipitated, washed in 70% ethanol, dried and
resuspended in sterile water. The in vitro transcription reaction
is performed by incubating the linearized DNA with transcription
buffer (200 mM Tris-HCl, pH 8.0, 40 mM MgCl.sub.2, 10 mM
spermidine, 250 NaCl [T7 or T3] or 200 mM Tris-HCl, pH 7.5, 30 mM
MgCl.sub.2, 10 mM spermidine [SP6]), dithiothreitol, RNase
inhibitors, each of the four ribonucleoside triphosphates, and
either SP6, T7 or T3 RNA polymerase for 30 min at 370 C. To prepare
a radiolabeled polynucleotide comprising RNA, unlabeled UTP will be
omitted and .sup.35S-UTP will be included in the reaction mixture.
The DNA template is then removed by incubation with DNaseI.
Following ethanol precipitation, an aliquot of the radiolabeled RNA
is counted in a scintillation counter to determine the cpm/l
(Ausubel et al., supra).
[0321] Alternatively, nucleic acids comprising RNA are prepared by
chemical synthesis techniques such as solid phase phosphoramidite
(described above).
[0322] 3. Nucleic Acids Comprising Oligonucleotides
[0323] A nucleic acid comprising oligonucleotides can be made by
using oligonucleotide synthesizing machines which are commercially
available (described above).
IV. Cleavage Structure
[0324] The invention provides for a cleavage structure that can be
cleaved by a nuclease (e.g., a FEN nuclease), and therefore teaches
methods of preparing a cleavage structure. The invention also
provides a labeled cleavage structure and methods of preparing a
labeled cleavage structure.
[0325] A probe having a secondary structure that changes upon
binding of the probe to the target nucleic acid is used to prepare
a cleavage structure according to the invention. A probe according
to the invention has a secondary structure as defined herein,
(including a stem loop, a hairpin, an internal loop, a bulge loop,
a branched structure and a pseudoknot) or multiple secondary
structures, cloverleaf type structures or any three-dimensional
structure, as defined hereinabove. Probes useful for forming a
cleavage structure according to the invention may also comprise
covalently bound or non-covalently bound subunits (e.g., a
bi-molecular or multi-molecular probe as defined herein).
[0326] A. Preparation of a Cleavage Structure
[0327] In one embodiment, a cleavage structure according to the
invention is formed by incubating a) an upstream, preferably
extendable 3' end, preferably an oligonucleotide primer, b) an
oligonucleotide probe having a secondary structure, as defined
herein, that changes upon binding to a target nucleic acid and
comprising a binding moiety, located not more than 5000 nucleotides
downstream of the upstream primer and c) an appropriate target
nucleic acid wherein the target sequence is complementary to both
primers and d) a suitable buffer (for example Sentinel Molecular
Beacon PCR core buffer (Catalog #600500) or 1033 Pfu buffer
available from Stratagene (Catalog #200536), under conditions that
allow the nucleic acid sequence to hybridize to the oligonucleotide
primers (for example 95C. for 2-5 minutes followed by cooling to
between approximately 50-60.degree. C.). The optimal temperature
will vary depending on the specific probe(s), primers and
polymerases. In preferred embodiments of the invention a cleavage
structure comprises an overlapping flap wherein the 3' end of an
upstream oligonucleotide capable of hybridizing to a target nucleic
acid (for example A in FIG. 4) is complementary to 1 or more base
pair(s) of the downstream oligonucleotide probe (for example C in
FIG. 4) that is annealed to a target nucleic acid and wherein the 1
base pair overlap is directly downstream of the point of extension
of the single stranded flap.
[0328] According to this embodiment of the 3' end of the upstream
oligonucleotide primer is extended by the synthetic activity of a
polymerase according to the invention such that the newly
synthesized 3' end of the upstream oligonucleotide primer partially
displaces the 5' end of the downstream oligonucleotide probe.
Extension is preferably carried out in the presence of
1.times.Sentinel Molecular beacon core buffer or 1.times.Pfu buffer
for 15 seconds at 72.degree. C.
[0329] In another embodiment of the invention, a cleavage structure
according to the invention can be prepared by incubating a target
nucleic acid with a partially complementary oligonucleotide probe
having a secondary structure, as defined herein, that changes upon
binding to a target nucleic acid and comprising a binding moiety,
to a target nucleic acid such that the 3' complementary region
anneals to the target nucleic acid and the non-complementary 5'
region that does not anneal to the target nucleic acid forms a 5'
flap. Annealing is preferably carried out under conditions that
allow the nucleic acid sequence to hybridize to the oligonucleotide
primer (for example 95.degree. C. for 2-5 minutes followed by
cooling to between approximately 50-60.degree. C.) in the presence
a suitable buffer (for example 1.times.Sentinel Molecular beacon
core buffer or 1.times.Pfu buffer.
[0330] In another embodiment of the invention, a cleavage structure
according to the invention can be prepared by incubating a target
nucleic acid with an upstream primer capable of hybridizing to the
target nucleic acid and a partially complementary oligonucleotide
probe having a secondary structure, as defined herein, that changes
upon binding to a target nucleic acid and comprising a binding
moiety, such that the 3' complementary region anneals to the target
nucleic acid and the non-complementary 5' region that does not
anneal to the target nucleic acid forms a 5' flap. Annealing is
preferably carried out under conditions that allow the nucleic acid
sequence to hybridize to the oligonucleotide primer (for example
95.degree. C. for 2-5 minutes followed by cooling to between
approximately 50-60.degree. C.) in the presence a suitable buffer
(for example 1.times.Sentinel Molecular beacon core buffer
(Stratagene) or 1.times.Pfu buffer (Stratagene).
[0331] B. How to Prepare a Labeled Cleavage Structure
[0332] In the present invention, a label is attached to an
oligonucleotide probe having a secondary structure, as defined
herein, that changes upon binding to a target nucleic acid and
comprising a binding moiety, that comprises a cleavage structure.
Thus, the cleaved mononucleotides or small oligonucleotides which
are cleaved by the endonuclease activity of the flap-specific
nuclease can be detected.
[0333] In one embodiment, a labeled cleavage structure according to
the invention is formed by incubating a) an upstream extendable 3'
end, preferably an oligonucleotide primer, b) a labeled probe
having a secondary structure, as defined herein, that changes upon
binding to a target nucleic acid and comprising a binding moiety,
located not more than 5000 nucleotides downstream of the upstream
primer and c) an appropriate target nucleic acid wherein the target
sequence is complementary to the oligonucleotides and d) a suitable
buffer (for example 1.times.Sentinel Molecular beacon core buffer
or 1.times.Pfu buffer), under conditions that allow the nucleic
acid sequence to hybridize to the oligonucleotide primers (for
example 95 .degree. C. for 2-5 minutes followed by cooling to
between approximately 50-60.degree. C.). A cleavage structure
according to the invention also comprises an overlapping flap
wherein the 3' end of an upstream oligonucleotide capable of
hybridizing to a target nucleic acid (for example A in FIG. 4) is
complementary to 1 base pair of the downstream oligonucleotide
probe having a secondary structure, as defined herein, that changes
upon binding to a target nucleic acid comprising a binding moiety
(for example C in FIG. 4) that is annealed to a target nucleic acid
and wherein the 1 base pair overlap is directly downstream of the
point of extension of the single stranded flap. The 3' end of the
upstream primer is extended by the synthetic activity of a
polymerase such that the newly synthesized 3' end of the upstream
primer partially displaces the labeled 5' end of the downstream
probe. Extension is preferably carried out in the presence of 133
Sentinel Molecular beacon core buffer or 1.times.Pfu buffer for 15
seconds at 72.degree. C.
[0334] In another embodiment, a cleavage structure according to the
invention can be prepared by incubating a target nucleic acid with
a probe having a secondary structure, as defined herein, that
changes upon binding to a target nucleic acid and comprising a
binding moiety, and further comprising a non-complementary,
labeled, 5' region that does not anneal to the target nucleic acid
and forms a 5' flap, and a complementary 3' region that anneals to
the target nucleic acid. Annealing is preferably carried out under
conditions that allow the nucleic acid sequence to hybridize to the
oligonucleotide primer (for example 95 C for 2-5 minutes followed
by cooling to between approximately 50-60.degree. C.) in the
presence a suitable buffer (for example 1.times.Sentinel Molecular
beacon core buffer or 1.times.Pfu buffer).
[0335] In another embodiment, a cleavage structure according to the
invention can be prepared by incubating a target nucleic acid with
an upstream primer that is capable of hybridizing to the target
nucleic acid and a probe having a secondary structure, as defined
herein, that changes upon binding to a target nucleic acid and
comprising a binding moiety, and further comprising a
non-complementary, labeled, 5' region that does not anneal to the
target nucleic acid and forms a 5' flap, and a complementary 3'
region that anneals to the target nucleic acid. Annealing is
preferably carried out under conditions that allow the nucleic acid
sequence to hybridize to the oligonucleotide primer (for example
95.degree. C. for 2-5 minutes followed by cooling to between
approximately 50-60.degree. C.) in the presence a suitable buffer
(for example 1.times.Sentinel Molecular beacon core buffer or
1.times.Pfu buffer).
[0336] Subsequently, any of several strategies may be employed to
distinguish the uncleaved labeled nucleic acid from the cleaved
fragments thereof. The invention provides for methods for detecting
the amount of cleaved, released, nucleic acid fragment that is
captured by binding of a binding moiety or a tag to a capture
element, on a solid support. In this manner, the present invention
permits identification of those samples that contain a target
nucleic acid.
[0337] The oligonucleotide probe is labeled, as described below, by
incorporating moieties detectable by spectroscopic, photochemical,
biochemical, immunochemical, enzymatic or chemical means. The
method of linking or conjugating the label to the oligonucleotide
probe depends, of course, on the type of label(s) used and the
position of the label on the probe. A probe that is useful
according to the invention can be labeled at the 5' end, the 3' end
or labeled throughout the length of the probe.
[0338] A variety of labels that would be appropriate for use in the
invention, as well as methods for their inclusion in the probe, are
known in the art and include, but are not limited to, enzymes
(e.g., alkaline phosphatase and horseradish peroxidase) and enzyme
substrates, radioactive atoms, fluorescent dyes, chromophores,
chemiluminescent labels, electrochemiluminescent labels, such as
Origen.TM. (Igen), that may interact with each other to enhance,
alter, or diminish a signal. Of course, if a labeled molecule is
used in a PCR based assay carried out using a thermal cycler
instrument, the label must be able to survive the temperature
cycling required in this automated process.
[0339] Among radioactive atoms, .sup.33P or, .sup.32P is preferred.
Methods for introducing .sup.33P or, .sup.32P into nucleic acids
are known in the art, and include, for example, 5' labeling with a
kinase, or random insertion by nick translation. "Specific binding
partner" refers to a protein capable of binding a ligand molecule
with high specificity, as for example in the case of an antigen and
a monoclonal antibody specific therefor. Other specific binding
partners include biotin and avidin or streptavidin, IgG and protein
A, and the numerous receptor-ligand couples known in the art. The
above description is not meant to categorize the various labels
into distinct classes, as the same label may serve in several
different modes. For example, .sup.125I may serve as a radioactive
label or as an electron-dense reagent. HRP may serve as an enzyme
or as antigen for a monoclonal antibody. Further, one may combine
various labels for desired effect. For example, one might label a
probe with biotin, and detect the presence of the probe with avidin
labeled with .sup.125I, or with an anti-biotin monoclonal antibody
labeled with HRP. Other permutations and possibilities will be
readily apparent to those of ordinary skill in the art and are
considered as equivalents within the scope of the instant
invention.
[0340] Fluorophores for use as labels in constructing labeled
probes of the invention include rhodamine and derivatives (such as
Texas Red), fluorescein and derivatives (such as 5-bromomethyl
fluorescein), Lucifer Yellow, IAEDANS,
7-Me.sub.2N-coumarin-4-acetate, 7-OH-4-CH.sub.3-coumarin-3-acetate,
7-NH.sub.2-4-CH.sub.3-coumarin-3-acetate (AMCA), monobromobimane,
pyrene trisulfonates, such as Cascade Blue, and
monobromorimethyl-ammoniobimane. In general, fluorophores with wide
Stokes shifts are preferred, to allow using fluorimeters with
filters rather than a monochromometer and to increase the
efficiency of detection.
[0341] Probes labeled with fluorophores can readily be used in
nuclease (e.g. FEN-nuclease) mediated cleavage of a cleavage
structure comprising a labeled probe according to the invention. If
the label is on the 5'-end of the probe, the nuclease (e.g.
FEN-nuclease) generated labeled fragment is separated from the
intact, hybridized probe by procedures well known in the art.
[0342] In another embodiment of the invention, detection of the
hydrolyzed, labeled probe can be accomplished using, for example,
fluorescence polarization, a technique to differentiate between
large and small molecules based on molecular tumbling. Large
molecules (i.e., intact labeled probe) tumble in solution much more
slowly than small molecules. Upon linkage of a fluorescent moiety
to an appropriate site on the molecule of interest, this
fluorescent moiety can be measured (and differentiated) based on
molecular tumbling, thus differentiating between intact and
digested probe.
[0343] In some situations, one can use two interactive labels
(e.g., FRET or non-FRET pairs) on a single oligonucleotide probe
with due consideration given for maintaining an appropriate spacing
of the labels on the oligonucleotide to permit the separation of
the labels during oligonucleotide probe unfolding (e.g., for
example due to a change in the secondary structure of the probe) or
hydrolysis. Preferred interactive labels useful according to the
invention include, but are not limited to rhodamine and
derivatives, fluorescein and derivatives, Texas Red, coumarin and
derivatives, crystal violet and include, but are not limited to
DABCYL, TAMRA and NTB (nitrothiazole blue) in addition to any of
the FRET or non-FRET labels described herein.
[0344] The fluorescence of the released label is then compared to
the label remaining bound to the target. It is not necessary to
separate the nuclease (e.g. FEN-nuclease) generated fragment and
the probe that remains bound to the target after cleavage in the
presence of nuclease (e.g. FEN-nuclease) if the probe is
synthesized with a fluorophore and a quencher that are separated by
about 20 nucleotides. Alternatively, the quencher is positioned
such that the probe will not fluoresce when not hybridized to the
target nucleic acid. Such a dual labeled probe will not fluoresce
when intact or when not hybridized to the target nucleic acid (or
in the case of bi-or multimolecular probes, when the probe is not
dissociated) because the light emitted from the dye is quenched by
the quencher. Thus, any fluorescence emitted by an intact probe is
considered to be background fluorescence. In one embodiment, when a
labeled probe is cleaved by a FEN nuclease, dye and quencher are
separated and the released fragment will fluoresce. Alternatively,
when a labeled probe is hybridized to a target nucleic acid, the
distance between the dye and the quencher is increased and the
level of fluorescence increases. In an embodiment wherein the probe
is a bi-or multi-molecular probe, dissociation of the molecules
comprising the probe results in an increase in fluorescence. The
amount of fluorescence is proportional to the amount of nucleic
acid target sequence present in a sample.
[0345] In yet another embodiment, two labeled nucleic acids are
used, each complementary to separate regions of separate strands of
a double-stranded target sequence, but not to each other, so that a
labeled nucleic acid anneals downstream of each primer. For
example, the presence of two probes can potentially double the
intensity of the signal generated from a single label and may
further serve to reduce product strand reannealing, as often occurs
during PCR amplification. The probes are selected so that the
probes bind at positions adjacent (downstream) to the positions at
which primers bind.
[0346] One can also use multiple probes in the present invention to
achieve other benefits. For instance, one could test for any number
of pathogens in a sample simply by putting as many probes as
desired into the reaction mixture; the probes could each comprise a
different label to facilitate detection.
[0347] One can also achieve allele-specific or species-specific
discrimination using multiple probes in the present invention, for
instance, by using probes that have different Tms and conducting
the annealing/cleavage reaction at a temperature specific for only
one probe/allele duplex. One can also achieve allele specific
discrimination by using only a single probe and examining the types
of cleavage products generated. In one embodiment of the invention,
the probe is designed to be exactly complementary, at least in the
5' terminal region, to one allele but not to the other allele(s).
With respect to the other allele(s), the probe will be mismatched
in the 5' terminal region of the probe so that a different cleavage
product will be generated as compared to the cleavage product
generated when the probe is hybridized to the exactly complementary
allele.
[0348] Although probe sequence can be selected to achieve important
benefits, one can also realize important advantages by selection of
probe labels(s) and/or tag as defined herein. The labels may be
attached to the oligonucleotide directly or indirectly by a variety
of techniques. Depending on the precise type of label or tag used,
the label can be located at the 5' or 3' end of the probe, located
internally in the probe, or attached to spacer arms of various
sizes and compositions to facilitate signal interactions. Using
commercially available phosphoramidite reagents, one can produce
oligomers containing functional groups (e.g., thiols or primary
amines) at either the 5- or the 3-terminus via an appropriately
protected phosphoramidite, and can label them using protocols
described in, for example, PCR Protocols: A Guide to Methods and
Applications, Innis et al., eds. Academic Press, Ind., 1990.
[0349] Methods for introducing oligonucleotide functionalizing
reagents to introduce one or more sulfhydryl, amino or hydroxyl
moieties into the oligonucleotide probe sequence, typically at the
5' terminus, are described in U.S. Pat. No. 4,914,210. A 5'
phosphate group can be introduced as a radioisotope by using
polynucleotide kinase and gamma-.sup.32P-ATP or gamma-.sup.33P-ATP
to provide a reporter group. Biotin can be added to the 5' end by
reacting an aminothymidine residue, or a 6-amino hexyl residue,
introduced during synthesis, with an N-hydroxysuccinimide ester of
biotin. Labels at the 3' terminus may employ polynucleotide
terminal transferase to add the desired moiety, such as for
example, cordycepin .sup.35S-dATP, and biotinylated dUTP.
[0350] Oligonucleotide derivatives are also available labels. For
example, etheno-dA and etheno-A are known fluorescent adenine
nucleotides that can be incorporated into a nucleic acid probe.
Similarly, etheno-dC or 2-amino purine deoxyriboside is another
analog that could be used in probe synthesis. The probes containing
such nucleotide derivatives may be hydrolyzed to release much more
strongly fluorescent mononucleotides by flap-specific nuclease
activity.
[0351] C. Cleaving a Cleavage Structure and Generating a Signal
[0352] A cleavage structure according to the invention can be
cleaved by the methods described in the section above, entitled
"Nucleases".
[0353] D. Detection of Released Labeled Fragments
[0354] Detection or verification of the labeled fragments may be
accomplished by a variety of methods well known in the art and may
be dependent on the characteristics of the labeled moiety or
moieties comprising a labeled cleavage structure. Preferably, the
released labeled fragments are captured by binding of a binding
moiety to a capture element attached to a solid support.
[0355] 1. Capture element
[0356] A capture element, according to the invention can be any
moiety that specifically binds (e.g. via hydrogen bonding or via an
interaction between, for example a nucleic acid binding protein and
a nucleic acid binding site or between complementary nucleic acids)
a binding moiety, as a result of attractive forces that exist
between the binding moiety and the capture element.
[0357] According to the invention, a binding moiety includes a
region of a probe that binds to a capture element. A capture
element according to the invention can be a nucleic acid sequence
that is complementary to and binds to, for example, via hydrogen
bonding, a binding moiety comprising a region of a probe that binds
to a capture element. For example, a binding moiety is a region of
a probe comprising the nucleic acid sequence
5'AGCTACTGATGCAGTCACGT3' (SEQ ID NO: 26) and the corresponding
capture element comprises the nucleic acid sequence
5'TCGATGACTACGTCAGTGCA3'(SEQ ID NO: 27).
[0358] The invention also provides for binding moiety-capture
element or tag-capture element pairs wherein the binding moiety or
tag is a DNA binding protein and the corresponding capture element
is the DNA sequence recognized and bound by the DNA binding
protein. The invention also provides for binding moiety-capture
element or tag-capture element pairs wherein the capture element is
a DNA binding protein and the corresponding binding moiety or tag
is the DNA sequence recognized and bound by the DNA binding
protein.
[0359] DNA sequence/DNA binding protein interactions useful
according to the invention include but are not limited to c-myb,
AAF, abd-A, Abd-B, ABF-2, ABF1, ACE2, ACF, ADA2, ADA3, Adf-1,
Adf-2a, ADR1, AEF-1, AF-2, AFP1, AGIE-BP1, AhR, AIC3, AIC4, AID2,
AIIN3, ALF1B, alpha-1, alpha-CP1, alpha-CP2a, alpha-CP2b,
alpha-factor, alpha-PAL, alpha2uNF1, alpha2uNF3, alphaA-CRYBP1,
alphaH2-alphaH3, alphaMHCBF1, aMEF-2, AML1, AnCF, ANF, ANF-2, Antp,
AP-1, AP-2, AP-3, AP-5, APETALA1, APETALA3, AR, ARG RI, ARG RII,
Arnt, AS-C T3, AS321, ASF-1, ASH-1, ASH-3b, ASP, AT-13P2, ATBF1-A,
ATF, ATF-1, ATF-3, ATF-3deltaZIP, ATF-adelta, ATF-like, Athb-1,
Athb-2, Axial, abaA, ABF-1, Ac, ADA-NF1, ADD1, Adf-2b, AF-1, AG,
AIC2, AIC5, ALF1A, alpha-CBF, alpha-CP2a, alpha-CP2b, alpha-IRP,
alpha2uNF2, alphaH0, AmdR, AMT1, ANF-1, Ap, AP-3, AP-4, APETALA2,
aRA, ARG RIII, ARP-1, Ase, ASH-3a, AT-BP1, ATBF1-B, ATF-2, ATF-a,
ATF/CREB, Ato, B factor, B'', B-Myc, B-TFIID, band I factor, BAP,
Bcd, BCFI, Bc1-3, beta-1, BETA1, BETA2, BF-1, BGP1, BmFTZ-F1, BP1,
BR-C Z1, BR-C Z2, BR-C Z4, Brachyury, BRF1, Br1A, Brn-3a, Brn-4,
Brn-5, BUF1, BUF2, B-Myb, BAF1, BAS1, BCFII, beta-factor, BETA3,
BLyF, BP2, BR-C Z3, brahma, byr3, c-abl, c-Ets-1, c-Ets-2, c-Fos,
c-Jun, c-Maf, c-myb, c-Myc, c-Qin, c-Rel, C/EBP, C/EBPalpha,
C/EBPbeta, C/EBPdelta, C/EBPepsilon, C/EBPgamma, CI, CAC-binding
protein, CACCC-binding factor, Cactus, Cad, CAD1, CAP, CArG
box-binding protein, CAUP, CBF, CBP, CBTF, CCAAT-binding factor,
CCBF, CCF, CCK-1a, CCK-1b, CD28RC, CDC10, Cdc68, CDF, cdk2, CDP,
Cdx-1, Cdx-2, Cdx-3, CEBF, CEH-18, CeMyoD, CF1, Cfla, CF2-I,
CF2-II, CF2-III, CFF, CG-1, CHOP-10, Chox-2.7, CIIIB1, Clox, Cnc,
CoMP1, core-binding factor, CoS, COUP, COUP-TF, CP1, CP1A, CP1B,
CP2, CPBP, CPC1, CPE binding protein CPRF-1, CPRF-2, CPRF-3,
CRE-BP1, CRE-BP2, CRE-BP3, CRE-BPa, CreA, CREB, CREB-2, CREBomega,
CREMalpha, CREMbeta, CREMdelta, CREMepsilon, CREMgamma,
CREMtaualpha, CRF, CSBP-1, CTCF, CTF, CUP2, Cut, Cux, Cx, cyclin A,
CYS3, D-MEF2, Da, DAL82, DAP, DAT1, DBF-A, DBF4, DBP, DBSF, dCREB,
dDP, dE2F, DEF, Delilah, delta factor, deltaCREB, deltaE1,
deltaEF1, deltaMax, DENF, DEP, DF-1, Dfd, dFRA, dioxin receptor,
dJRA, D1, DII, D1x, DM-SSRP1, DMLP1, DP-1, Dpn, Dr1, DRTF, DSC1,
DSP1, DSXF, DSXM, DTF, E, E1A, E2, E2BP, E2F, E2F-BF, E2F-I, E4,
E47, E4BP4, E4F, E4TF2, E7, E74, E75, EBF, EBF1, EBNA, EBP, EBP40,
EC, ECF, ECH, EcR, eE-TF, EF-1A, EF-C, EF1, EFgamma, Egr, eH-TF,
EIIa, EivF, EKLF, Elf-1, Elg, Elk-1, ELP, Elt-2, EmBP-1, embryo DNA
binding protein, Emc, EMF, Ems, Emx, En, ENH-binding protein,
ENKTF-1, epsilonF1, ER, Erg, Esc, ETF, Eve, Evi, Evx, Exd, Ey,
f(alpha-epsilon), F-ACT1, f-EBP, F2F, factor 1-3, factor B1, factor
B2, factor delta, factor I, FBF-A1, Fbf1, FKBP59, Fkh, FlbD, Flh,
Fli-1, FLV-1, Fos-B, Fra-2, Fra1, FRG Y1, FRG Y2, FTS, Ftz, Ftz-F1,
G factor, G6 factor, GA-BF, GABP, GADD 153, GAF, GAGA factor, GAL4,
GAL80, gamma-factor, gammaCAAT, gammaCAC, gammaOBP, GATA-1, GATA-2,
GATA-3, GBF, GCI, GCF, GCF, GCN4, GCR1, GE1, GEBF-I, GF1, GFI,
Gfi-1, GFII, GHF-5, GL1, Glass, GLO, GM-PBP-1, GP, GR, GRF-1, Gsb,
Gsbn, Gsc, Gt, GT-1, Gtx, H, H16, H11TF1, H2Babp1, H2RIIBP, H2TF1,
H4TF-1, HAC1, HAP1, Hb, HBLF, HBP-1, HCM1, heat-induced factor,
HEB, HEF-1B, HEF-1T, HEF-4C, HEN1, HES-1, HIF-1, HiNF-A, HIP1,
HIV-EP2, Hlf, HMBI, HNF-1, HNF-3, Hox11, HOXA1, HOXA10, HOXA10PL2,
HOXA11, HOXA2, HOXA3, HOXA4, HOXA5, HOXA7, HOXA9, HOXB1, HOXB3,
HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXC5, HOXC6, HOXC8,
HOXD1, HOXD10, HOXD11, HOXD12, HOXD13, HOXD4, HOXD8, HOXD9, HP1
site factor, Hp55, Hp65, HrpF, HSE-binding protein, HSF1, HSF2,
HSF24, HSF3, HSF30, HSF8, hsp56, Hsp90, HST, HSTF, I-POU, IBF,
IBP-1, ICER, ICP4, ICSBP, Id1, Id2, Id3, Id4, IE1, EBP1, IEFga,
IF1, IF2, IFNEX, IgPE-1, IK-1, IkappaB, Il-1 RF, IL-6 RE-BP, Il-6
RF, ILF, ILRF-A, IME1, INO2, INSAF, IPF1, IRBP, IRE-ABP, IREBF-1,
IRF-1, ISGF-1, Isl-1, ISRF, ITF, IUF-1, Ixr1, JRF, Jun-D, JunB,
JunD, K-2, kappay factor, kBF-A, KBF1, KBF2, KBP-1, KER-1, Ker1,
KN1, Kni, Knox3, Kr, kreisler, KRF-1, Krox-20, Krox-24, Ku
autoantigen, KUP, Lab, LAC9, LBP, Lc, LCR-F1, LEF-1, LEF-1S, LEU3,
LF-A1, LF-B1, LF-C, LF-H3beta, LH-2, Lim-1, Lim-3, lin-11, lin-31,
lin-32, LIP, LIT-1, LKLF, Lmx-1, LRF-1, LSF, LSIRF-2, LVa,
LVb-binding factor, LVc, LyF-1, Lyl-1, M factor, M-Twist, M1, m3,
Mab-18, MAC1, Mad, MAF, MafB, MafF, MafG, MafK, Ma163, MAPF1,
MAPF2, MASH-1, MASH-2, mat-Mc, mat-Pc, MATa1, MATalpha1, MATalpha2,
MATH-1, MATH-2, Max1, MAZ, MBF-1, MBP-1, MBP-2, MCBF, MCM1, MDBP,
MEB-1, Mec-3, MECA, mediating factor, MEF-2, MEF-2C, MEF-2D, MEF1,
MEP-1, Meso1, MF3, Mi, MIF, MIG1, MLP, MNB1a, MNF1, MOK-2, MP4,
MPBF, MR, MRF4, MSN2, MSN4, Msx-1, Msx-2, MTF-1, mtTF1, muEBP-B,
muEBP-C2, MUF1, MUF2, Mxi1, Myef-2, Myf-3, Myf-4, Myf-5, Myf-6,
Myn, MyoD, myogenin, MZF-1, N-Myc, N-Oct-2, N-Oct-3, N-Oct-4,
N-Oct-5, Nau, NBF, NC1, NeP1, Net, NeuroD, neurogenin, NF III-a,
NF-1, NF-4FA, NF-AT, NF-BA1, NF-CLEOa, NF-D, NF-E, NF-E1b, NF-E2,
NF-EM5, NF-GMa, NF-H1, NF-IL-2A, NF-InsE1, NF-kappaB, NF-lambda2,
NF-MHCIIA, NF-muE1, NF-muNR, NF-S, NF-TNF, NF-U1, NF-W1, NF-X,
NF-Y, NF-Zc, NFalpha1, NFAT-1, NFbetaA, NFdeltaE3A, NFdeltaE4A,
NFe, NFE-6, NFH3-1, NFH3-2, NFH3-3, NFH3-4, NGFI-B, NGFI-C, NHP,
Nil-2-a, NIP, NIT2, Nkx-2.5, NLS1, NMH7, NP-III, NP-IV, NP-TCII,
NP-Va, NRDI, NRF-1, NRF-2, Nrf1, Nrf2, NRL, NRSF form 1, NTF,
NUC-1, Nur77, OBF, OBP, OCA-B, OCSTF, Oct-1, Oct-10, Oct-11, Oct-2,
Oct-2.1, Oct-2.3, Oct-4, Oct-5, Oct-6, Oct-7, Oct-8, Oct-9, Oct-B2,
Oct-R, Octa-factor, octamer-binding factor, Odd, Olf-1, Opaque-2,
Otd, Otx1, Otx2, Ovo, P, P1, p107, p130, p28 modulator, p300,
p38erg, p40x, p45, p49erg, p53, p55, p55erg, p58, p65delta, p67,
PAB1, PacC, Pap1, Paraxis, Pax-1, Pax-2, Pax-3, Pax-5, Pax-6,
Pax-7, Pax-8, Pb, Pbx-1a, Pbx-1b, PC, PC2, PC4, PC5, Pcr1, PCRE1,
PCT1, PDM-1, PDM-2, PEA1, PEB1, PEBP2, PEBP5, Pep-1, PF1, PGA4,
PHD1, PHO2, PHO4, PHO80, Phox-2, Pit-1, PO-B, pointedP1, Pou2,
PPAR, PPUR, PPYR, PR, PR A, Prd, PrDI-BF1, PREB, Prh proein a,
protein b, proteinc, protein d, PRP, PSE1, PTF, Pu box binding
factor, PU.1, PUB 1, PuF, PUF-I, Pur factor, PUT3, pX, qa-1F, QBP,
R, R1, R2, RAd-1, RAF, RAP1, RAR, Rb, RBP-Jkappa, RBP60, RC1, RC2,
REB1, RelA, RelB, repressor of CAR1 expression, REX-1, RF-Y, RF1,
RFX, RGM1, RIM1, RLM1, RME1, Ro, RORalpha, Rox1, RPF1, RPGalpha,
RREB-1, RRF1, RSRFC4, runt, RVF, RXR-alpha, RXR-beta, RXR-beta2,
RXR-gamma, S-CREM, S-CREMbeta, S8, SAP-1a, SAP1, SBF, Sc,
SCBPalpha, SCD1/BP, SCM-inducible factor, Scr, Sd, Sdc-1, SEF-1,
SF-1, SF-2, SF-3, SF-A, SGCI, SGF-1, SGF-2, SGF-3, SGF-4, SIF,
SIII, Sim, SIN1, Skn-1, SKO1, Slp1, Sn, SNP1, SNF5, SNAPC43,
Sox-18, Sox-2, Sox-4, Sox-5, Sox-9, Sox-LZ, Sp1, spE2F, Sph factor,
Spi-B, Sprm-1, SRB10, SREBP, SRF, SRY, SSDBP-1, ssDBP-2, SSRP1,
STAF-50, STAT, STAT1, STAT2, STAT3, STAT4, STAT5, STAT6, STC, STD1,
Ste11, Ste12, Ste4, STM, Su(f), SUM-1, SWI1, SWI4, SWI5, SWI6, SWP,
T-Ag, t-Pou2, T3R, TAB, all TAFs including subunits, Tal-1, TAR
factor, tat, Tax, TBF1, TBP, TCF, TDEF, TEA1, TEC1, TEF, tel,
Tf-LF1, TFE3, all TFII related proteins, TBA1a, TGGCA-binding
protein, TGT3, Th1, TIF1, TIN-1, TIP, T11, TMF, TR2, Tra-1, TRAP,
TREB-1, TREB-2, TREB-3, TREF1, TREF2, Tsh, TTF-1, TTF-2, Ttk69k,
TTP, Ttx, TUBF, Twi, TxREBP, TyBF, UBP-1, Ubx, UCRB, UCRF-L,
UF1-H3beta, UFA, UFB, UHF-1, UME6, Unc-86, URF, URSF, URTF, USF,
USF2, v-ErbA, v-Ets, v-Fos, v-Jun, v-Maf, v-Myb, v-Myc, v-Qin,
v-Rel, Vab-3, vaccinia virus DNA-binding protein, Vav, VBP, VDR,
VETF, vHNF-1, VITF, Vmw65, Vp1, Vp16, Whn, WT1, X-box binding
protein, X-Twist, X2BP, XBP-1, XBP-2, XBP-3, XF1, XF2, XFD-1,
XFD-3, xMEF-2, XPF-1, XrpF1, XW, XX, yan, YB-1, YEB3, YEBP, Yi,
YPF1, YY1, ZAP, ZEM1, ZEM2/3, Zen-1, Zen-2, Zeste, ZF1, ZF2, Zfh-1,
Zfh-2, Zfp-35, ZID, Zmhoxla, Zta and all related characterized and
uncharacterized homologs and family members related to these DNA
binding proteins or activities, and the DNA sequence recognized by
the above-recited DNA binding proteins. Methods of identifying a
DNA sequence recognized by a DNA binding protein are known in the
art (see for example, U.S. Pat. No. 6,139,833).
[0360] The invention also contemplates DNA sequence/DNA binding
protein interactions including but not limited to the tetracycline
(tet) repressor, beta.-galactosidase (lac repressor), the
tryptophan (trp) repressor, the lambda specific repressor protein,
CRO, and the catabolite activator protein, CAP and the DNA sequence
recognized by each of these DNA binding proteins and known in the
art. DNA/DNA binding protein interactions useful according to the
invention also include restriction enzymes and the corresponding
restriction sites, preferably under conditions wherein the nuclease
activity of the restriction enzyme is suppressed (U.S. Pat. No.
5,985,550, incorporated herein by reference).
[0361] Other DNA:Protein interactions useful according to the
invention include (i) the DNA protein interactions listed in Tables
1 and 2, and (ii) bacterial, yeast, and phage systems such as
lambda OL-OR/CrO (U.S. Pat. No. 5,726,014, incorporated herein by
reference). Any pair comprising a protein that binds to a specific
recognition sequence and the cognate recognition sequence may be
useful in the present invention. TABLE-US-00004 TABLE 1 DNA-BINDING
SEQUENCES Test sequence DNA-binding Protein EBV origin of
replication EBNA HSV origin of replication UL9 VZV origin of
replication UL9-like HPV origin of replication E2 Interleukin 2
enhancer NFAT-1 HIV LTR NFAT-1 NFkB HBV enhancer HNF-1 Fibrogen
promoter HNF-1
[0362] TABLE-US-00005 TABLE 2 DNA Name Sequence Recognized*
Bacteria lac repressor AATTGTGAGCGGATAACAATT (SEQ ID NO: 4)
TTAACACTCGCCTATTGTTAA (SEQ ID NO: 5) CAP TGTGAGTTAGCTCACT (SEQ ID
NO: 6) ACACTCAATCGAGTGA (SEQ ID NO: 7) lambda repressor
TATCACCGCCAGAGGTA (SEQ ID NO: 8) ATAGTGGCGGTCTCCAT (SEQ ID NO: 9)
Yeast GAL4 CGGAGGACTGTCCTCCG (SEQ ID NO: 10) GCCTCCTGACAGGAGGC (SEQ
ID NO: 11) MAT .alpha.2 CATGTAATT (SEQ ID NO: 12) GTACATTAA (SEQ ID
NO: 13) GCN4 ATGACTCAT (SEQ ID NO: 14) TACTGAGTA (SEQ ID NO: 15)
Drosophila Kruppel AACGGGTTAA (SEQ ID NO: 16) TTGCCCAATT (SEQ ID
NO: 17) bicoid GGGATTAGA (SEQ ID NO: 18) CCCTAATCT (SEQ ID NO: 19)
Mammals Sp1 GGGCGG (SEQ ID NO: 20) CCCGCC (SEQ ID NO: 21) Oct-1
ATGCAAAT (SEQ ID NO: 22) TACGTTTA (SEQ ID NO: 23) GATA-1 TGATAG
(SEQ ID NO: 24) ACTATC (SEQ ID NO: 25) *Each protein in this table
can recognize a set of closely related DNA sequences; for
convenience, only one recognition sequence is given for each
protein.
[0363] Methods of performing a reaction wherein specific binding
occurs between a capture element, as defined herein and a binding
moiety, as defined herein, are well known in the art, see for
example, Sambrook et al., supra; Ausubel et al., supra). A capture
element, according to the invention can also be any moiety that
specifically binds (e.g. via covalent or hydrogen bonding or
electrostatic attraction or via an interaction between, for example
a protein and a ligand, an antibody and an antigen, protein
subunits, a nucleic acid binding protein and a nucleic acid binding
site) a binding moiety or a tag, as a result of attractive forces
that exist between the binding moiety or tag and the capture
element. Methods of performing a reaction wherein specific binding
occurs between a capture element, as defined herein and a tag, as
defined herein, are well known in the art, see for example,
Sambrook et al., supra; Ausubel et al., supra). Specific binding
only occurs when the secondary structure of the probe comprising
the binding moiety has "changed", as defined herein. Capture
elements useful according to the invention include but are not
limited to a nucleic acid binding protein or a nucleotide sequence,
biotin, streptavidin, a hapten, a protein, a nucleotide sequence or
a chemically reactive moiety.
[0364] In one embodiment of the invention, the reaction products,
including the released labeled fragments, are subjected to size
analysis. Methods for determining the size of a labeled fragment
are known in the art and include, for example, gel electrophoresis,
sedimentation in gradients, gel exclusion chromatography, mass
spectroscopy, and homochromatography.
[0365] 2. Solid Substrate
[0366] A solid substrate according to the invention is any surface
to which a molecule (e.g., capture element) can be irreversibly
bound, including but not limited to membranes, magnetic beads,
tissue culture plates, silica based matrices, membrane based
matrices, beads comprising surfaces including but not limited to
styrene, latex or silica based materials and other polymers for
example cellulose acetate, teflon, polyvinylidene difluoride,
nylon, nitrocellulose, polyester, carbonate, polysulphone, metals,
zeolites, paper, alumina, glass, polypropyle, polyvinyl chloride,
polyvinylidene chloride, polytetrafluorethylene, polyethylene,
polyamides, plastic, filter paper, dextran, germanium, silicon,
(poly)tetrafluorethylene, gallium arsenide, gallium phosphide,
silicon oxide, silicon nitrate and combinations thereof.
[0367] Useful solid substrates according to the invention are also
described in Sambrook et al., supra, Ausubel et al., supra, U.S.
Pat. Nos. 5,427,779, 5,512,439, 5,589,586, 5,716,854 and 6,087,102,
Southern et al., 1999, Nature Genetics Supplement, 21:5 and Joos et
al., 1997, Analytical Biochemistry 247:96.
[0368] Methods of attaching a capture element to a solid support
are known in the art and are described in Sambrook et al., supra,
Ausubel et al., supra, U.S. Pat. Nos. 5,427,779, 5,512,439,
5,589,586, 5,716,854 and 6,087,102 and in Southern et al., supra
and Joos et al., supra. Methods of immobilizing a nucleic acid
sequence on a solid support are also provided by the manufacturers
of the solid support, e.g., for membranes: Pall Corporation,
Schleicher & Schuell, for magnetic beads; Dyal, for culture
plates; Costar, Nalgenunc, and for other supports useful according
to the invention, CPG, Inc.
[0369] The amount of released labeled fragment that is bound to a
capture element attached to a solid support can be measured while
the labeled fragment remains bound to the capture element or after
release of the labeled fragment from the capture element. Release
of a labeled fragment from a capture element is carried out by
incubating labeled fragment-capture element complexes in the
presence of an excess amount of a competing, unlabeled fragment or
by the addition of a buffer that inhibits binding of the labeled
fragment to the capture element, for example as a result of salt
concentration or pH.
[0370] During or after amplification, separation of the released
labeled fragments from, for example, a PCR mixture can be
accomplished by, for example, contacting the PCR with a solid phase
extractant (SPE). For example, materials having an ability to bind
nucleic acids on the basis of size, charge, or interaction with the
nucleic acid bases can be added to the PCR mixture, under
conditions where labeled, uncleaved nucleic acids are bound and
short, labeled fragments are not. Such SPE materials include ion
exchange resins or beads, such as the commercially available
binding particles Nensorb (DuPont Chemical Co.), Nucleogen (The
Nest Group), PEI, BakerBond.TM. PEI, Amicon PAE 1,000,
Selectacel.TM. PEI, Boronate SPE with a 3'-ribose probe, SPE
containing sequences complementary to the 3'-end of the probe, and
hydroxylapatite. In a specific embodiment, if a dual labeled
oligonucleotide comprising a 3' biotin label separated from a 5'
label by a nuclease susceptible cleavage site is employed as the
signal means, the reaction mixture, for example a PCR amplified
mixture can be contacted with materials containing a specific
binding element such as avidin or streptavidin, or an antibody or
monoclonal antibody to biotin, bound to a solid support such as
beads and particles, including magnetic particles.
[0371] Following the step in which a reaction mixture, for example
a PCR mixture has been contacted with an SPE, the SPE material can
be removed by filtration, sedimentation, or magnetic attraction,
leaving the labeled fragments free of uncleaved labeled
oligonucleotides and available for detection.
[0372] 3. Binding Moieties
[0373] A binding moiety according to the invention refers to a
region of a probe that is released upon cleavage of the probe by a
nuclease and binds specifically (via hydrogen binding with a
complementary nucleic acid or via an interaction with a binding
protein) to a capture element as a result of attractive forces that
exist between the binding moiety and the capture element, and
wherein specific binding between the binding moiety and the capture
element only occurs when the secondary structure of the probe has
"changed", as defined herein.
[0374] A "tag" refers to a moiety that is operatively linked to the
5' end of a probe (for example R in FIG. 1) and specifically binds
to a capture element as a result of attractive forces that exist
between the tag and the capture element, and wherein specific
binding between the tag and the capture element only occurs when
the secondary structure of the probe has changed (for example, such
that the tag is accessible to a capture element). "Specifically
binds" as it refers to a "tag" and a capture element means via
covalent or hydrogen bonding or electrostatic attraction or via an
interaction between, for example a protein and a ligand, an
antibody and an antigen, protein subunits, or a nucleic acid
binding protein and a nucleic acid binding site. Second binding
moieties include but are not limited to biotin, streptavidin, a
hapten, a protein, or a chemically reactive moiety.
[0375] According to the invention, a binding moiety includes a
region of a probe that binds to a capture element. A capture
element according to the invention can be a nucleic acid sequence
that is complementary to and binds to, for example, via hydrogen
bonding, a binding moiety comprising a region of a probe that binds
to a capture element. For example, a binding moiety is a region of
a probe comprising the nucleic acid sequence
5'AGCTACTGATGCAGTCACGT3' (SEQ ID NO: 26) and the corresponding
capture element comprises the nucleic acid sequence
5'TCGATGACTACGTCAGTGCA3' (SEQ ID NO: 27).
[0376] The invention also provides for binding moiety-capture
element or tag-capture element pairs wherein the binding moiety or
tag is a DNA binding protein and the corresponding capture element
is the DNA sequence recognized and bound by the DNA binding
protein. The invention also provides for binding moiety-capture
element or tag-capture element pairs wherein the capture element is
a DNA binding protein and the corresponding binding moiety or tag
is the DNA sequence recognized and bound by the DNA binding
protein.
[0377] DNA binding sequence/DNA binding protein interactions useful
according to the invention are described above in the section
entitled, "Detection of Released Labeled Fragments".
[0378] Methods of incorporating a tag, as defined herein, into a
nucleic acid (e.g., a probe according to the invention) are well
known in the art and are described in Ausubel et al., supra,
Sambrook et al., supra, and U.S. Pat. Nos. 5,716,854 and
6,087,102.
IV. Determining the Stability of the Secondary Structure of a
Probe
[0379] A. Melting Temperature Assay
[0380] A melting temperature assay, takes advantage of the
different absorption properties of double stranded and single
stranded DNA, that is, double stranded DNA (the double stranded DNA
being that portion of a nucleic acid sequence that has folded back
on itself to generate an antiparallel duplex structure wherein
complementary sequences (base pairs) are associated via hydrogen
bonding) absorbs less light than single stranded DNA at a
wavelength of 260 nm, as determined by spectrophotometric
measurement.
[0381] The denaturation of DNA occurs over a narrow temperature
range and results in striking changes in many of the physical
properties of DNA. A particularly useful change occurs in optical
density. The heterocyclic rings of nucleotides adsorb light
strongly in the ultraviolet range (with a maximum close to 260 nm
that is characteristic for each base). However, the adsorption of
DNA is approximately 40% less than would be displayed by a mixture
of free nucleotides of the same composition. This effect is called
hyperchromism and results from interactions between the electron
systems of the bases, made possible by their stacking in the
parallel array of the double helix. Any departure from the duplex
state is immediately reflected by a decline in this effect (that
is, by an increase in optical density toward the value
characteristic of free bases (FIG. 12a). The denaturation of double
stranded DNA can therefore be followed by this hyperchromicity
(FIG. 12b and 12c) The midpoint of the temperature range over which
the strands of DNA separate is called the melting temperature,
denoted T.sub.m. An example of a melting curve determined by change
in optical absorbance is shown in FIG. 12c. The curve always takes
the same form, but its absolute position on the temperature scale
(that is, its T.sub.m) is influenced by both the base composition
of the DNA and the conditions employed for denaturation.
[0382] The melting temperature of a DNA molecule depends markedly
on its base composition. DNA molecules rich in GC base pairs have a
higher Tm than those having an abundance of AT base pairs (FIG.
13b). The Tm of DNA from many species varies linearly with GC
content, rising from 77.degree. to 100.degree. C. as the fraction
of GC pairs increases from 20% to 78%. That is, the dependence of
T.sub.m on base composition is linear, increasing about 0.4.degree.
C. for every percent increase in G-C content. GC base pairs are
more stable than AT pairs because their bases are held together by
three hydrogen bonds rather than by two. In addition, adjacent GC
base pairs interact more strongly with one another than do adjacent
AT base pairs. Hence, the AT-rich regions of DNA are the first to
melt.
[0383] A major effect on T.sub.m is exerted by the ionic strength
of the solution. The T.sub.m increases 16.6.degree. C. for every
tenfold increase in monovalent cation concentration. The most
commonly used condition is to perform manipulations of DNA in 0.12
M phosphate buffer, which provides a monovalent Na+ concentration
of 0.18M, and a T.sub.m of the order of 90.degree. C.
[0384] The T.sub.m can be greatly varied by performing the reaction
in the presence of reagents, such as formamide, that destabilize
hydrogen bonds. This allows the T.sub.m to be reduced to as low as
40.degree. C. with the advantage that the DNA does not suffer
damage (such as strand breakage) that can result from exposure to
high temperatures. (Stryer, Biochemistry, 1998, 3.sup.rd Edition,
W.H. Freeman and Co., pp. 81-82 and Lewin, Genes II, 1985, John
Wiley & Sons, p. 63-64).
[0385] The stability of the secondary structure of the probe
according to the invention is determined in a melting temperature
assay as follows.
[0386] A standard curve for the probe (for example FIG. 12c),
wherein absorbance is plotted versus temperature, is prepared by
incubating a sample comprising from about 0.2 .mu.g/ml to 100
.mu.g/ml of the probe in a buffer which allows for denaturing and
reannealing of the probe at various temperatures for a time
sufficient to permit denaturing and reannealing of the probe and
measuring the absorbance of a sample in a quartz cuvette (with a
pathlength appropriate for the spectrophotometer being used, e.g.,
1-cm), in a spectrophotometer over a range of temperatures wherein
the lower temperature limit of the range is at least 50.degree. C.
below, and the upper temperature limit of the range is at least
50.degree. C. above the Tm or predicted Tm of the probe. The Tm of
the probe is predicted based on the base pair composition according
to methods well known in the art (see, Sambrook, supra; Ausubel,
supra). Standard curves are generated and compared, using a variety
of buffers (e.g., 1.times.TNE buffer (10X-0.1M Tris base, 10 mM
EDTA, 2.0 M NaCl, pH 7.4), FEN nuclease buffer, described herein,
1.times.Cloned Pfu buffer, described herein, 1.times.Sentinel
Molecular beacon buffer, described herein) including a buffer that
is possible and preferentially optimal for the particular nuclease
to be employed in the cleavage reaction. The pH of the buffer will
be monitored as the temperature increases, and adjusted as is
needed.
[0387] The assay is performed in a single-beam ultraviolet to
visible range (UV-VIS) spectrophotometer. Preferably, the assay is
performed in a double-beam spectrophotometer to simplify
measurements by automatically comparing the cuvette holding the
sample solution to a reference cuvette (matched cuvette) that
contains the blank. The blank is an equal volume of sample
buffer.
[0388] The temperature of the spectrophotometer can be controlled
such that the absorbance of the sample is measured at specific
temperatures. Spectrophotometers useful according to the invention
include but are not limited to the Beckman Coulter DU.RTM. 600/7000
Spectrophotometers in combination with the Micro.TM. Analysis
Accessory (Beckman Coulter, Inc., Columbia, Md.).
[0389] The stability of the secondary structure of a probe at a
particular temperature and in a buffer that is possible and
preferentially optimal for the nuclease to be employed in the
cleavage reaction of the probe, is determined by measuring the
absorbance of the probe at a particular temperature, as above, and
determining if the value of the absorbance is less than the
absorbance at the Tm, as determined from the standard curve,
wherein the standard curve is generated using either the same
buffer as used at the test temperature, or a buffer known to
produce a comparable standard curve, as described above. The
secondary structure of the probe is "stable" in a melting
temperature assay, at a temperature that is at or below the
temperature of the cleavage reaction (i.e., at which cleavage is
performed) if the level of light absorbance at the temperature at
or below the temperature of the cleavage reaction is less (i.e., at
least 5%, preferably 20% and most preferably 25% or more) than the
level of light absorbance at a temperature that is equal to the Tm
of the probe (see FIGS. 12c and 12d).
[0390] B. FRET
[0391] A FRET assay is useful in the invention for two purposes.
The first is to determine whether the secondary structure of a
probe is "stable" as defined herein. The second is to determine
whether the secondary structure of the probe has undergone a
"change" upon binding of the probe to the target nucleic acid.
[0392] "FRET" is a distance-dependent interaction between the
electronic excited states of two dye molecules in which excitation
is transferred from a donor molecule to an acceptor molecule. FRET
is caused by a change in the distance separating a fluorescent
donor group from an interacting resonance energy acceptor, either
another fluorophore, a chromophore, or a quencher. Combinations of
donor and acceptor moieties are known as "FRET pairs". Efficient
FRET interactions require that the absorption and emission spectra
of the dye pairs have a high degree of overlap.
[0393] In most embodiments, the donor and acceptor dyes for FRET
are different, in which case FRET can be detected by the appearance
of sensitized fluorescence of the acceptor and/or by quenching of
donor fluorescence. When the donor and acceptor are the same, FRET
is detected by the resulting fluorescence depolarization. FRET is
dependent on the inverse sixth power of the intermolecular
separation (Stryer et al., 1978, Ann. Rev. Biochem., 47:819;
Selvin, 1995, Methods Enzymol., 246:300).
[0394] As used herein, the term "donor" refers to a fluorophore
which absorbs at a first wavelength and emits at a second, longer
wavelength. The term "acceptor" refers to a fluorophore,
chromophore or quencher with an absorption spectrum which overlaps
the donor's emission spectrum and is able to absorb some or most of
the emitted energy from the donor when it is near the donor group
(typically between 1-100 nm). If the acceptor is a fluorophore
capable of exhibiting FRET, it then re-emits at a third, still
longer wavelength; if it is a chromophore or quencher, then it
releases the energy absorbed from the donor without emitting a
photon. Although the acceptor's absorption spectrum overlaps the
donor's emission spectrum when the two groups are in proximity,
this need not be the case for the spectra of the molecules when
free in solution. Acceptors thus include fluorophores, chromophores
or quenchers which exhibit either FRET or quenching when placed in
proximity, on a probe according to the invention, to the donor due
to the presence of a probe secondary structure that changes upon
binding of the probe to the target nucleic acid, as defined herein.
Acceptors do not include fluorophores, chromophores or quenchers
that exhibit FRET or quenching a) at temperatures equal to or
greater than the Tm (e.g. more than 5.degree. above the Tm, for
example 6.degree., 10.degree., 25.degree., 50.degree. or more above
the Tm) or b) in the presence of a target nucleic acid.
[0395] Reference herein to "fluorescence" or "fluorescent groups"
or "fluorophores" include luminescence, luminescent groups and
suitable chromophores, respectively. Suitable luminescent probes
include, but are not limited to, the luminescent ions of europium
and terbium introduced as lanthium chelates (Heyduk & Heyduk,
1997). The lanthanide ions are also good donors for energy transfer
to fluorescent groups (Selvin 1995). Luminescent groups containing
lanthanide ions can be incorporated into nucleic acids utilizing an
`open cage` chelator phosphoramidite.
[0396] As used herein, the term "quenching" refers to the transfer
of energy from donor to acceptor which is associated with a
reduction of the intensity of the fluorescence exhibited by the
donor.
[0397] The donor and acceptor groups may independently be selected
from suitable fluorescent groups, chromophores and quenching
groups. Donors and acceptors useful according to the invention
include but are not limited to: 5-FAM (also called
5-carboxyfluorescein; also called Spiro(isobenzofuran-1(3H),
9'-(9H)xanthene)-5-carboxylic
acid,3',6'-dihydroxy-3-oxo-6-carboxyfluorescein);
5-Hexachloro-Fluorescein
([4,7,2',4',5',7'-hexachloro-(3',6'-dipivaloyl-fluoresceinyl)
-6-carboxylic acid ]); 6-Hexachloro-Fluorescein
([4,7,2',4',5',7'-hexachloro-(3',6'-dipivaloylfluoresceinyl)-5-carboxylic
acid]); 5-Tetrachloro-Fluorescein
([4,7,2',7'-tetra-chloro-(3',6'-dipivaloylfluoresceinyl)-5-carboxylic
acid]); 6-Tetrachloro-Fluorescein
([4,7,2',7'-tetrachloro-(3',6'-dipivaloylfluoresceinyl)-6-carboxylic
acid]); 5-TAMRA (5-carboxytetramethylrhodamine; Xanthylium,
9-(2,4-dicarboxyphenyl)-3,6- bis(dimethyl-amino); 6-TAMRA
(6-carboxytetramethylrhodamine; Xanthylium,
9-(2,5-dicarboxyphenyl)-3,6-bis(dimethylamino); EDANS
(5-((2-aminoethyl) amino)naphthalene-1-sulfonic acid); 1,5-IAEDANS
(5-((((2-iodoacetyl)amino)ethyl) amino)naphthalene-1-sulfonic
acid); DABCYL (4-((4-(dimethylamino)phenyl) azo)benzoic acid) Cy5
(Indodicarbocyanine-5) Cy3 (Indo-dicarbocyanine-3); and BODIPY FL
(2,6-dibromo-4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pr-
oprionic acid), as well as suitable derivatives thereof.
[0398] In certain embodiments of the invention, a probe may also be
labeled with two chromophores, and a change in the absorption
spectra of the label pair is used as a detection signal, as an
alternative to measuring a change in fluorescence.
[0399] In the method of the invention, fluorescence intensity of
the probe is measured at one or more wavelengths with a
fluorescence spectrophotometer or microtitre plate reader,
according to methods known in the art.
[0400] C. Fluorescence Quenching Assay
[0401] A fluorescence quenching assay is useful in the invention
for two purposes. The first is to determine whether the secondary
structure of a probe is "stable" as defined herein. The second is
to determine whether the secondary structure of the probe has
undergone a "change" upon binding of the probe to the target
nucleic acid.
[0402] A probe according to the invention is labeled with a pair of
interactive labels (e.g., a FRET or non-FRET pair) wherein one
member of the pair is a fluorophore and the other member of the
pair is a quencher. For example, a probe according to the invention
is labeled with a fluorophore and a quencher and fluorescence is
measured in the absence of a target nucleic acid, over a range of
temperatures, e.g., wherein the lower temperature limit of the
range is at least 50.degree. Celsius below, and the upper
temperature limit of the range is at least 50.degree. Celsius above
the Tm or the predicted Tm of the probe.
[0403] D. Stability
[0404] The "stability" of the secondary structure of a probe
according to the invention is determined as follows. A probe is
labeled with a pair of interactive labels (for example,
tetramethylrhodamine and DABCYL, or any of the interactive labels
(either FRET or non-FRET pairs) described herein according to
methods well known in the art (for example as described in Glazer
and Mathies, 1997, Curr. Opin. Biotechnol., 8:94; Ju et al., 1995,
Analytical Biochem., 231:131)). The location of the interactive
labels on the probe is such that the labels are separated when the
secondary structure of the probe changes following binding of the
probe to the target nucleic acid.
[0405] A standard curve for the probe (for example FIG. 12e),
wherein fluorescence is plotted versus temperature, is prepared by
incubating a sample comprising typically 125nM probe in
1.times.Melting Buffer (20 mM Tris-HCl, pH 8.0, 1 mM MgCl.sub.2) or
alternatively, in 5 mM Tris-HCl, pH 8.0, 0.1 mM EDTA, or other
appropriate buffers for a time that is sufficient to permit
denaturing and reannealing of the probe (typically the standard
curve is generated using a fluorometer or spectrometer that
undergoes a 1.degree. C. per minute change, and measuring the
fluorescence in a fluorometer or scanning fluorescence
spectrophotometer over a range of temperatures wherein the lower
temperature limit of the range is at least 50.degree. C. below, and
the upper temperature limit of the range is at least 50.degree. C.
above the Tm or predicted Tm of the probe. The Tm of the probe is
predicted based on the base pair composition according to methods
well known in the art (see, Sambrook, supra; Ausubel, supra).
[0406] Standard curves are generated and compared, using a variety
of buffers (e.g., 1X TNE buffer (10.times.-0.1M Tris base, 10 mM
EDTA, 2.0 M NaCl , pH 7.4), FEN nuclease buffer, described herein,
1.times.Cloned Pfu buffer, described herein, 1.times.Sentinel
Molecular beacon buffer, described herein) including a buffer that
is possible and preferentially optimal for the particular nuclease
to be employed in the cleavage reaction. The pH of the buffer will
be monitored as the temperature increases, and adjusted as is
needed.
[0407] The temperature of the fluorometer or spectrophotometer can
be controlled such that the fluorescence of the sample is measured
at specific temperatures. Fluorescence can be measured for example
with a Perkin-Elmer LS50B Luminescence Spectrometer in combination
with a temperature regulatable water bath (e.g., for example
available from Fisher Scientific).
[0408] The stability of the secondary structure of a probe at a
particular temperature is determined by measuring the fluorescence
of the probe at a particular temperature, as above, and determining
if the value of the fluorescence is less than the fluorescence at
the Tm, as determined from the standard curve. The secondary
structure of the probe is "stable" in a FRET assay, at a
temperature that is at or below the temperature of the cleavage
reaction (i.e., at which cleavage is performed) if the level of
fluorescence at the temperature at or below the temperature of the
cleavage reaction is altered (i.e., at least 5%, preferably 20% and
most preferably 25% more or less than) the level of fluorescence at
a temperature that is equal to the Tm of the probe. The secondary
structure of the probe is "stable" in a fluorescence quenching
assay, at a temperature that is at or below the temperature of the
cleavage reaction (i.e., at which cleavage is performed) if the
level of fluorescence at the temperature at or below the
temperature of the cleavage reaction is less (i.e., at least 5%,
preferably 20% and most preferably 25% more or less than) the level
of fluorescence at a temperature that is equal to the Tm of the
probe(see FIGS. 12f and 12g).
[0409] Alternatively, the stability of the secondary structure of
the probe is determined by modifying the method of Gelfand et al.
(1999, Proc. Natl. Acad. Sci. USA, 96:6113), incorporated herein by
reference, to determine the fluorescence of a probe labeled with a
pair of interactive labels over a range of temperatures, as
described hereinabove.
V. Detecting a Secondary Structure
[0410] A secondary structure according to the invention is detected
by generating a standard curve of fluorescence versus temperature
for a probe comprising a pair of interactive labels in a FRET or
fluorescence quenching assay, as described above (see FIG. 12e). A
probe that exhibits a change in fluorescence that correlates with a
change in temperature (see FIG. 12e) (e.g., fluorescence increases
as the temperature of the FRET reaction is increased) is capable of
forming a secondary structure.
VI. Measuring a Change in Secondary Structure
[0411] A "change" in secondary structure according to the invention
is detected by analyzing a probe comprising a pair of interactive
labels in a FRET or fluorescence quenching assay at a particular
temperature below the Tm of the probe, (e.g., the cleaving
temperature), as described above, in the presence or absence of 100
nM to 10 .mu.M of a target nucleic acid (typically the target
nucleic acid is in a 2-4 molar excess over the probe concentration,
i.e., 250-500 nM target nucleic acid is used).
[0412] Alternatively, a change in the secondary structure of the
probe is determined by modifying the method of Gelfand et al.
(1999, Proc. Natl. Acad. Sci. USA, 96:6113), incorporated herein by
reference, to determine the fluorescence of a probe labeled with a
pair of interactive labels in the presence or absence of a target
nucleic acid as described hereinabove.
[0413] A "change" in secondary structure that occurs when a probe
according to the invention binds to a target nucleic acid, is
measured as an increase in fluorescence, such that the level of
fluorescence after binding of the probe to the target nucleic acid
at the temperature below the Tm of the probe, is greater than
(e.g., at least 5%, preferably 5-20% and more preferably 25 or
more) the level of fluorescence observed in the absence of a target
nucleic acid (see FIG. 12g).
VII. Methods of Use
[0414] The invention provides for a method of generating a signal
indicative of the presence of a target nucleic acid in a sample
comprising the steps of forming a labeled cleavage structure by
incubating a target nucleic acid with a probe having a secondary
structure, as defined herein, that changes upon binding to a target
nucleic acid and comprising a binding moiety, and cleaving the
cleavage structure with a nuclease (e.g. a FEN nuclease). The
method of the invention can be used in a PCR based assay as
described below.
[0415] A labeled cleavage structure comprising an upstream
oligonucleotide primer (for example A, FIG. 4), a 5' end labeled
downstream oligonucleotide probe having a secondary structure that
changes upon binding to a target nucleic acid and comprising a
binding moiety (for example C in FIG. 4) and a target nucleic acid
(for example B in FIG. 4) is formed as described above in the
section entitled "Cleavage Structure". Briefly, a cleavage
structure is formed and cleaved in the presence of a target nucleic
acid, in the presence or absence of an upstream primer (for example
A, FIG. 4), a labeled downstream probe as defined herein (for
example C, FIG. 4) amplification primers specific for the target
nucleic acid, a nucleic acid polymerase deficient in 5' to 3'
exonuclease activity a nuclease (e.g. a FEN nuclease) and an
appropriate buffer (for example 10.times.Pfu buffer, Stratagene,
Catalog# 200536) in a PCR reaction with the following thermocycling
parameters: 95.degree. C. for 2 minutes and 40 cycles of 95.degree.
C. for 15 sec (denaturation step), 60.degree. C. for 60 sec
(annealing step)and 72.degree. C. for 15 sec (extension step).
During this reaction an upstream oligonucleotide (for example A,
FIG. 4) is extended such that oligonucleotide A partially displaces
the 5' labeled end of a downstream oligonucleotide probe according
to the invention (for example oligonucleotide C, FIG. 4) and the
resulting labeled structure is cleaved with a nuclease (e.g., a FEN
nuclease) according to the invention. Alternatively, a downstream
probe comprising a secondary structure, as defined herein,
(including a stem loop, a hairpin, an internal loop, a bulge loop,
a branched structure and a pseudoknot) or multiple secondary
structures, cloverleaf structures, or any three dimensional
structure, as defined herein, can be used. Bi-molecular or
multimolecular probes, as defined herein, can also be used. The
released labeled fragment is captured by specific binding of the
binding moiety to a capture element on a solid support according to
methods well known in the art (see Sambrook et al., supra and
Ausubel et al., supra). Alternatively, a cleavage structure can be
formed and cleaved in the presence of a nucleic acid polymerase
that possesses 5' to 3' exonuclease activity.
[0416] The methods of the invention can also be used in non-PCR
based applications to detect a target nucleic acid, where such
target may be immobilized on a solid support. Methods of
immobilizing a nucleic acid sequence on a solid support are known
in the art and are described in Ausubel F M et al. Current
Protocols in Molecular Biology, John Wiley and Sons, Inc. and in
protocols provided by the manufacturers, e.g. for membranes: Pall
Corporation, Schleicher & Schuell, for magnetic beads: Dynal,
for culture plates: Costar, Nalgenunc, and for other supports
useful according to the invention, CPG, Inc. A solid support useful
according to the invention includes but is not limited to silica
based matrices, membrane based matrices and beads comprising
surfaces including, but not limited to any of the solid supports
described above in the section entitled, "Cleavage Structure" and
including styrene, latex or silica based materials and other
polymers. Magnetic beads are also useful according to the
invention. Solid supports can be obtained from the above
manufacturers and other known manufacturers.
[0417] The invention also provides for a non-PCR based assay for
detecting a target nucleic acid in solution. The method of the
invention can be used to detect naturally occurring target nucleic
acids in solution including but not limited to RNA and DNA that is
isolated and purified from cells, tissues, single cell organisms,
bacteria or viruses. The method of the invention can also be used
to detect synthetic targets in solution, including but not limited
to RNA or DNA oligonucleotides, and peptide nucleic acids (PNAs).
Non-PCR assays include but are not limited to detection assays
involving isothermal linear or exponential amplification, where the
amount of nucleic acid synthesized by the 3'-5' synthetic activity
increases linearly or exponentially, and a nuclease (e.g. a FEN
nuclease) is used to cleave the displaced strand during synthesis.
One such example utilizes rolling circle amplification.
[0418] In one embodiment of the invention, detection of a nucleic
acid target sequence that is either immobilized or in solution can
be performed by incubating an immobilized nucleic acid target
sequence or a target nucleic acid in solution with an upstream
oligonucleotide primer that is complementary to the target nucleic
acid (for example A, FIG. 4) and a downstream oligonucleotide probe
having a secondary structure that changes upon binding to a target
nucleic acid and comprising a binding moiety, that is complementary
to the target nucleic acid (for example C, FIG. 4), a nuclease
(e.g. a FEN nuclease) and a nucleic acid polymerase that possesses
or lacks 5' to 3' exonuclease activity. The downstream probe is
either end labeled at the 5' or 3' end, or is labeled internally.
Alternatively, a downstream probe comprising a secondary structure,
as defined herein, (including a stem loop, a hairpin, an internal
loop, a bulge loop, a branched structure and a pseudoknot) or
multiple secondary structures, cloverleaf structures, or any three
dimensional structure, as defined herein, can be used. Bi-molecular
or multimolecular probes, as defined herein, can also be used.
Detection of a released labeled fragment that is captured by
binding of the binding moiety to a capture element involves
isotopic, enzymatic, or calorimetric methods appropriate for the
specific label that has been incorporated into the probe and well
known in the art (for example, Sambrook et al., supra, Ausubel et
al., supra). Labels useful according to the invention and methods
for the detection of labels useful according to the invention are
described in the section entitled "Cleavage Structure".
Alternatively, the downstream probe further comprises a pair of
interactive signal generating labeled moieties (for example a dye
and a quencher) that are positioned such that when the probe is
intact, the generation of a detectable signal is quenched, and
wherein the pair of interactive signal generating moieties are
separated by a nuclease cleavage site (e.g. a FEN nuclease cleavage
site). In another embodiment, the downstream probe further
comprises a pair of interactive signal generating labeled moieties
(for example a dye and a quencher) that are positioned such that
when the probe is not hybridized to the target nucleic acid, the
generation of a detectable signal is quenched. Upon cleavage by a
nuclease (e.g. a FEN nuclease), the two signal generating moieties
are separated from each other and a detectable signal is produced.
The presence of a pair of interactive signal generating labeled
moieties, as described above, allows for discrimination between
annealed, uncleaved probe that may bind to a capture element, and
released labeled fragment that is bound to a capture element.
Nucleic acid polymerases that are useful for detecting an
immobilized nucleic acid target sequence or a nucleic acid target
sequence in solution according to the method of the invention
include mesophilic, thermophilic or hyper-thermophilic DNA
polymerases lacking 5' to 3' exonucleolytic activity (described in
the section entitled, "Nucleic Acid Polymerases)". Any nucleic acid
polymerase that possess 5' to 3' exonuclease activity is also
useful according to the invention.
[0419] According to this non-PCR based method, the amount of a
target nucleic acid that can be detected is preferably about 1 pg
to .mu.g, more preferably about 1 pg to 10 ng and most preferably
about 1 pg to 10 pg. Alternatively, this non-PCR based method can
measure or detect preferably about 1 molecule to 10.sup.20
molecules, more preferably about 100 molecules to 10.sup.17
molecules and most preferably about 1000 molecules to 10.sup.14
molecules.
[0420] The invention also provides for a method of detecting a
target nucleic acid in a sample wherein a cleavage structure is
formed as described in the section entitled, "Cleavage Structure",
and the target nucleic acid is amplified by a non-PCR based method
including but not limited to an isothermal method, for example
rolling circle, Self-sustained Sequence Replication Amplification
(3 SR), Transcription based amplification system (TAS), and Strand
Displacement Amplification (SDA) and a non-isothermal method, for
example Ligation chain reaction (LCR). A nuclease (e.g., a FEN
nuclease) useful for non-PCR amplification methods will be active
at a temperature range that is appropriate for the particular
amplification method that is employed.
[0421] In the amplification protocols described below, samples
which need to be prepared in order to quantify the target include:
samples, no-template controls, and reactions for preparation of a
standard curve (containing dilutions over the range of six orders
of magnitude of a solution with a defined quantity of target).
[0422] Strand Displacement Amplification (SDA) is based on the
ability of a restriction enzyme to nick the unmodified strand of a
hemiphosphorothioate form of its recognition site. The appropriate
DNA polymerase will initiate replication at this nick and displace
the downstream non-template strand (Walker, 1992, Proc. Natl. Acad.
Sci. USA, 89: 392, and PCR Methods and Applications 3: 1-6, 1993).
The polymerases (Bca and Bst) which are used according to the
method of SDA can also be used in nuclease (e.g. FEN nuclease)
directed cleavage according to the invention. According to the
method of the invention, a molecular beacon is replaced by a
nuclease (e.g., a FEN nuclease) active at 42.degree. C. and a
cleavable probe having a secondary structure that changes upon
binding to a target nucleic acid and further comprising a binding
moiety, and comprising a cleavage structure according to the
invention.
[0423] A molecular beacon (Mb) is a fluorogenic probe which forms a
stem-loop structure is solution. Typically: 5'-fluorescent dye
(e.g. FAM), attached to the 5'-stem region (5-7 nt), the loop
region (complementary to the target, 20 to 30 nt), the 3'-stem
region (complementary to the 5'-stem region), and the quencher
(e.g. DABCYL). If no target is present, the MB forms its stem,
which brings dye and quencher into close proximity, and therefore
no fluorescence is emitted. When an MB binds to its target, the
stem is opened, dye is spatially separated from the quencher, and
therefore the probe emits fluorescence (Tyagi S and Kramer F R,
Nature Biotechnology 14: 303-308 (1996) and U.S. Pat. No.
5,925,517).
[0424] Strand Displacement Amplification (SDA) is essentially
performed as described by Spargo et al., Molecular and Cellular
Probes 10: 247-256 (1996). The enzymes used include restriction
endonuclease BsoBI (New England Biolabs), DNA polymerase 5'-exo-Bca
(PanVera Corporation). The target is an insertion-like element
(IS6110) found in the Mycobacterium tuberculosis (Mtb) genome. The
primers used are B1: cgatcgagcaagcca (SEQ ID NO: 35), B2:
cgagccgctcgctg (SEQ ID NO: 36), S1:
accgcatcgaatgcatgtctcgggtaaggcgtactcgacc (SEQ ID NO: 37) and S2:
cgattccgctccagacttctcgggtgtactgagatcccct
accgcatcgaatgcatgtctcgggtaaggcgtactcgacc (SEQ ID NO: 38). The
Mycobacterium tuberculosis genomic DNA is serially diluted in human
placental DNA. SDA is performed in 50 .mu.l samples containing 0 to
1000 Mtb genome equivalents, 500 ng human placental DNA, 160 units
BsoB1, 8 units of 5'-exo-Bca, 1.4 mM each dCTPalphaS, TTP, dGTP,
dATP, 35 mM K.sub.2PO.sub.4, pH 7.6 0.1 mg/ml acetylated bovine
serum albumin (BSA), 3 mM Tris-HCl, 10 mM MgCl.sub.2, 11 mM NaCl,
0.3 mM DTT, 4 mM KCl, 4% glycerol, 0.008 mM EDTA, 500 nM primers S1
and S2 and 50 nM primers B1 and B2 (KCl, glycerol and EDTA are
contributed by the BsoB1 storage solution). The samples (35 .mu.l)
were heated in a boiling water bath for 3 minutes before the
addition of BsoB1 and 5'-exo Bca (10.7 units/l.mu. BsoB1 and 0.53
units/.mu.l 5'-exo Bca in 15 .mu.l of New England Biolabs Buffer 2
(20 mM Tris-HCl pH 7.9, 10 mM MgCl.sub.2, 50 mM NaCl, 1 mM DTT).
Incubation is at 60.degree. C. for 15 minutes, followed by 5
minutes in a boiling water bath.
[0425] Five .mu.l of each sample in duplicate are removed for
detection. Each reaction contains 1.times.Cloned Pfu buffer, 3.0 mM
MgCl.sub.2, 200 .mu.M of each dNTP, 5 units exo-Pfu, 23 ng Pfu
FEN-1, 1 ng PEF, 300 nM each upstream primer: aaggcgtactcgacctgaaa
(SEQ ID NO: 39) and fluorogenic probe (for example FAM-DABCYL):
accatacggataggggatctc (SEQ ID NO: 40). The reactions are subjected
to one cycle in a thermal cycler: 2 minutes at 95.degree. C., 1
minute at 55.degree. C., 1 minute at 72.degree. C. The fluorescence
is then determined in a fluorescence plate reader, such as
Stratagene's FluorTracker or PE Biosystems' 7700 Sequence Detection
System in Plate-Read Mode. The method of the invention can also be
performed with a polymerase that exhibits 5' to 3' exonuclease
activity and any nuclease included in the section entitled,
"Nucleases".
[0426] According to the method of nucleic acid sequence-based
amplification (NASBA), molecular beacons are used for
quantification of the NASBA RNA amplicon in real-time analysis
(Leone, et al., 1998, Nucleic Acids Res. 26: 2150). According to
the method of the invention, NASBA can be carried out wherein the
molecular beacon probe is replaced by a nuclease (e.g. a FEN
nuclease) cleavable probe having a secondary structure that changes
upon binding to a target nucleic acid and comprising a binding
moiety, and further comprising a cleavage structure according to
the invention and a nuclease (e.g. a FEN nuclease) active at
41.degree. C.
[0427] NASBA amplification is performed essentially as described by
Leone G, et al., Nucleic Acids Res. 26: 2150-2155 (1998). Genomic
RNA from the potato leafroll virus (PLRV) is amplified using the
PD415 or PD416 (antisense) and the PD417 (sense) primers, which are
described in detail in Leone G et al., J. Virol. Methods 66: 19-27
(1997). Each NASBA reaction contains a premix of 6 .mu.l of sterile
water, 4 .mu.l of 5.times.NASBA buffer (5.times.NASBA buffer is 200
mM Tris-HCl, pH 8.5, 60 mM MgCl.sub.2, 350 mM KCl, 2.5 mM DTT, 5 mM
each of dNTP, 10 mM each of ATP, UTP and CTP, 7.5 mM GTP and 2.5 mM
ITP), 4 .mu.l of 5.times.primer mix (75% DMSO and 1 .mu.M each of
antisense and sense primers). The premix is divided into 14 .mu.l
aliquots, to which 1 .mu.l of PLRV target is added. After
incubation for 5 minutes at 65.degree. C. and cooling to 41.degree.
C. for 5 minutes, 5 .mu.l of enzyme mix is added (per reaction 375
mM sorbitol, 2.1 .mu.g BSA, 0.08 units of RNase H (Pharmacia), 32
units of T7 RNA polymerase (Pharmacia) and 6.4 units of AMV-RT
(Seigakaku)). Amplification is for 90 minutes at 41.degree. C.
[0428] Five .mu.l of each sample in duplicate are removed for
detection. Each reaction contains 1.times.Cloned Pfu buffer, 3.0 mM
MgCl.sub.2, 200 .mu.M of each dNTP, 5 units exo-Pfu, 23 ng Pfu
FEN-1, 1 ng PEF, 300 nM each upstream primer PD415 or PD416 and the
fluorogenic probe (for example FAM-DABCYL): gcaaagtatcatccctccag
(SEQ ID NO: 41). The reactions are subjected to one cycle in a
thermal cycler: 2 minutes at 95.degree. C., 1 minute at 55.degree.
C., 1 minute at 72.degree. C. The fluorescence in then determined
in a fluorescence plate reader, such as Stratagene's FluorTracker
or PE Biosystems' 7700 Sequence Detection System in Plate-Read
Mode.
[0429] Generally, according to these methods wherein amplification
occurs by a non-PCR based method, amplification may be carried out
in the presence of a nuclease (e.g. a FEN nuclease), and
amplification and cleavage by the nuclease (e.g. a FEN nuclease)
occur simultaneously. Detection of released labeled fragments
captured by binding of a binding moiety to a capture element on a
solid support is performed as described in the section entitled
"Cleavage Structure" and may occur concurrently with (real time) or
after (end-point) the amplification and cleavage process have been
completed.
[0430] Endpoint assays can be used to quantify amplified target
produced by non-PCR based methods wherein the amplification step is
carried out in the presence of a nuclease (e.g., a FEN nuclease)
(described above).
[0431] Endpoint assays include, but are not limited to the
following.
[0432] A. Ligation chain reaction (LCR), as described in Landegren,
et al., 1988, Science, 241: 1077 and Barany, PCR Methods and
Applications 1: 5-16 (1991). An LCR product useful according to the
invention will be long enough such that the upstream primer and the
labeled downstream probe are separated by a gap larger than 8
nucleotides to allow for efficient cleavage by a nuclease (e.g. a
FEN nuclease).
[0433] B. Self-sustained sequence replication amplification (3SR)
Fahy, et al. PCR Methods and Applications 1: 25-33 (1991).
Self-Sustained Sequence Replication Amplification (3SR) is a
technique which is similar to NASBA. Ehricht R, et al., Nucleic
Acids Res. 25: 4697-4699 (1997) have evolved the 3SR procedure to a
cooperatively coupled in vitro amplification system (CATCH). Thus,
in one embodiment of the invention, a molecular beacon probe is
used for real-time analysis of an RNA amplicon by CATCH. The
synthetic target amplified has the sequence:
cctctgcagactactattacataatacgactcactatagggatctgcacgtattag
[0434]
cctatagtgagtcgtattaataggaaacaccaaagatgatatttcgtcacagcaagaattcagg
(SEQ ID NO: 42). The 3SR reactions contain 40 mM Tris-HCl pH 8.0, 5
mM KCl, 30 mM MgCl.sub.2, 1 mM of each dNTP, 1 nM of the double
stranded target, 2 .mu.M P1: cctctgcagactactattac (SEQ ID NO: 43)
and P2:cctgaattcttgctgtgacg (SEQ ID NO: 44), 5 mM DTT, 2 mM
spermidine, 6 units/ul His tagged HIV-1 reverse transcriptase, 3
units/ul T7-RNA polymerase and 0.16 units/ul Escherichia coli RNase
H. The 100 ul reactions are incubated for 30 minutes at 42.degree.
C.
[0435] Five .mu.l of each sample in duplicate are removed for
detection. Each reaction contains 1.times.Cloned Pfu buffer, 3.0 mM
MgCl.sub.2, 200 .mu.M of each dNTP, 5 units exo-Pfu, 23 ng Pfu
FEN-1, 1 ng PEF, 300 nM each upstream primer P1 and fluorogenic
probe (for example FAM-DABCYL): taggaaacaccaaagatgatattt (SEQ ID
NO: 45). The reactions are subjected to one cycle in a thermal
cycler: 2 minutes at 95.degree. C., 1 minute at 55.degree. C., 1
minute at 72.degree. C. The fluorescence in then determined in a
fluorescence plate reader, such as Stratagene's FluorTracker or PE
Biosystems' 7700 Sequence Detection System in Plate-Read Mode. The
method of 3SR can also be carried out with a polymerase that
exhibits 5' to 3' exonuclease activity and any nuclease described
in the section entitled, "Nucleases".
[0436] C. Rolling circle amplification is described in U.S. Pat.
No. 5,854,033 and the related Ramification-Extension Amplification
Method (RAM) (U.S. Pat. No. 5,942,391). Rolling circle
amplification adapted to the invention is described below.
[0437] Real-time assays can also be used to quantify amplified
target produced by non-PCR based methods wherein the amplification
step is carried out in the presence of a nuclease (e.g. a FEN
nuclease) (described above). The method of rolling circle
amplification (U.S. Pat. No. 5,854,033) is adapted to include
secondary primers for amplification and detection, in conjunction
with a nuclease (e.g. a FEN nuclease) and a cleavable probe having
a secondary structure that changes upon binding to a target nucleic
acid and comprising a binding moiety, and further comprising a
cleavage structure according to the invention, and is carried out
at temperatures between 50-600 C. The cleavage pattern of a
nuclease (e.g. a FEN nuclease) can be altered by the presence of a
single mismatched base located anywhere between 1 and 15
nucleotides from the 5' end of the primer wherein the DNA primer is
otherwise fully annealed. Typically, on a fully annealed substrate,
a nuclease (e.g. a FEN nuclease) will exonucleolytically cleave the
5' most nucleotide. However, a single nucleotide mismatch up to 15
nucleotides in from the 5' end promotes endonucleolytic cleavages.
This constitutes a 5' proofreading process in which the mismatch
promotes the nuclease action that leads to its removal. Thus, the
mechanism of nuclease (e.g. FEN nuclease) cleavage is shifted from
predominantly exonucleolytic cleavage to predominantly
endonucleolytic cleavage simply by the presence of a single
mismatched base pair. Presumably this occurs because a mismatch
allows a short flap to be created (Rumbaugh et al., 1999, J. Biol.
Chem., 274:14602).
[0438] The method of the invention can be used to generate a signal
indicative of the presence of a sequence variation in a target
nucleic acid, wherein a labeled cleavage structure comprising a
fully annealed DNA primer is formed by incubating a target nucleic
acid with a probe having a secondary structure that changes upon
binding to a target nucleic acid and comprising a binding moiety
(as described in the section entitled, "Cleavage Structure") and
cleaving the labeled cleavage structure with a nuclease (e.g. a FEN
nuclease) wherein the release of labeled fragments comprising
endonucleolytic cleavage products, and the detection of released
fragments that are captured by binding of a binding moiety to a
capture element on a solid support, is indicative of the presence
of a sequence variation. Released labeled fragments are detected as
described in the section entitled, "Cleavage Structure".
V. Samples
[0439] The invention provides for a method of detecting or
measuring a target nucleic acid in a sample, as defined herein. As
used herein, "sample" refers to any substance containing or
presumed to contain a nucleic acid of interest (a target nucleic
acid) or which is itself a target nucleic acid, containing or
presumed to contain a target nucleic acid of interest. The term
"sample" thus includes a sample of target nucleic acid (genomic
DNA, cDNA or RNA), cell, organism, tissue, fluid or substance
including but not limited to, for example, plasma, serum, spinal
fluid, lymph fluid, synovial fluid, urine, tears, stool, external
secretions of the skin, respiratory, intestinal and genitourinary
tracts, saliva, blood cells, tumors, organs, tissue, samples of in
vitro cell culture constituents, natural isolates (such as drinking
water, seawater, solid materials,) microbial specimens, and objects
or specimens that have been "marked" with nucleic acid tracer
molecules.
EXAMPLES
[0440] The invention is illustrated by the following nonlimiting
examples wherein the following materials and methods are employed.
The entire disclosure of each of the literature references cited
hereinafter are incorporated by reference herein.
Example 1
Probe Design and Preparation
[0441] The invention provides for a probe having a secondary
structure that changes upon binding of the probe to a target
nucleic acid and comprising a binding moiety.
[0442] A probe according to one embodiment of the invention is
5-250 nucleotides in length and ideally 17-40 nucleotides in
length, and has a target nucleic acid binding sequence that is from
7 to about 140 nucleotides, and preferably from 10 to about 140
nucleotides. Probes may also comprise non-covalently bound or
covalently bound subunits.
[0443] One embodiment of a probe comprises a first complementary
nucleic acid sequence (for example, b in FIG. 4) and a second
complementary nucleic acid sequence (for example, b' in FIG. 4). In
one embodiment wherein the probe is unimolecular, the first and
second complementary nucleic acid sequences are in the same
molecule. In one embodiment, the probe is labeled with a
fluorophore and a quencher (for example, tetramethylrhodamine and
DABCYL, or any of the fluorophore and quencher molecules described
herein (see the section entitled "How To Prepare a Labeled Cleavage
Structure"). A probe according to the invention is labeled with an
appropriate pair of interactive labels (e.g., a FRET pair or a
non-FRET pair). The location of the interactive labels on the probe
is such that an appropriate spacing of the labels on the probe is
maintained to permit the separation of the labels when the probe
undergoes a change in the secondary structure of the probe upon
binding to a target nucleic acid. For example, the donor and
quencher moieties are positioned on the probe to quench the
generation of a detectable signal when the probe is not bound to
the target nucleic acid.
[0444] The probe further comprises a binding moiety (for example ab
in FIG. 4, comprising a nucleic acid sequence, i.e.,
5'AGCTACTGATGCAGTCACGT3' (SEQ ID NO: 26)). In one embodiment of the
invention, upon hybridization to a target nucleic acid, the probe
according to the invention, forms a cleavage structure comprising a
5' flap (e.g., ab in FIG. 4). The flap of the cleavage structure
thus comprises the binding moiety of the probe. Cleaving is
performed at a cleaving temperature, and the secondary structure of
the probe when not bound to the target nucleic acid is stable at or
below the cleaving temperature. Upon cleavage of the hybridized
probe by a nuclease, the binding moiety is released and binds
specifically to a capture element comprising a nucleic acid
sequence, i.e., 5'TCGATGACTACGTCAGTGCA3' (SEQ ID NO: 27). According
to this embodiment, the binding moiety comprises two regions (for
example a and b in FIG. 4). The region of a "binding moiety" that
is not a "complementary nucleic acid sequence", as defined herein,
(e.g., a in FIG. 4), is from 1-60 nucleotides, preferably from 1-25
nucleotides and most preferably from 1-10 nucleotides in length.
Region b is one of at least two complementary nucleic acid
sequences of the probe, as defined herein, the length of which is
described in detail below.
[0445] In one embodiment, in the absence of the target nucleic acid
the probe folds back on itself to generate an antiparallel duplex
structure wherein the first and second complementary nucleic acid
sequences anneal by the formation of hydrogen bonds to form a
secondary structure. The secondary structure of the probe is
detected by performing a FRET or fluorescence quenching assay at
different temperatures, including temperatures that are above and
below the Tm of the probe, as described herein. A probe that
exhibits a change in fluorescence that correlates with a change in
temperature (e.g., fluorescence increases as the temperature of the
FRET reaction is increased), greater than a change in fluorescence
simply due to thermal effects on the efficiency of fluorophore
emission, has secondary structure. Secondary structure is
eliminated at a temperature wherein the maximal level of
fluorescence is detected (e.g., fluorescence does not increase
above this level at increased temperatures). The stability of the
secondary structure of the probe is determined in a melting
temperature assay or by FRET or fluorescence quenching assay, as
described herein.
[0446] As a result of the change in the secondary structure of the
probe, the binding moiety becomes accessible for cleavage by a
nuclease. In the presence of the target nucleic acid, and at a
temperature that is selected according to the factors that
influence the efficiency and selectivity of hybridization of the
probe to the target nucleic acid, (e.g., primer length, nucleotide
sequence and/or composition, buffer composition, as described in
the section entitled, "Primers and Probes Useful According to the
Invention") to permit specific binding of the probe and the target
nucleic acid, the probe binds to the target nucleic acid and
undergoes a change in the secondary structure. A change in the
secondary structure of the probe can be determined by FRET or
fluorescence quenching, as described herein.
[0447] In one embodiment, first and second complementary nucleic
acid sequences are 3-25, preferably 4-15 and more preferably 5-11
nucleotides long. The length of the first and second complementary
nucleic acid sequences is selected such that the secondary
structure of the probe when not bound to the target nucleic acid is
stable at the temperature at which cleavage of a cleavage structure
comprising the probe bound to a target nucleic acid is performed.
As the target nucleic acid binding sequence increases in size up to
100 nucleotides, the length of the complementary nucleic acid
sequences may increase up to 15-25 nucleotides. For a target
nucleic acid binding sequence greater than 100 nucleotides, the
length of the complementary nucleic acid sequences are not
increased further.
[0448] Alternatively, an allele discriminating probe having
secondary structure and comprising a binding moiety is
prepared.
[0449] In one embodiment, an allele discriminating probe according
to the invention preferably comprises a target nucleic acid binding
sequence from 6 to 50 and preferably from 7 to 25 nucleotides, and
sequences of the complementary nucleic acid sequences from 3 to 8
nucleotides. The guanosine-cytidine content of the secondary
structure and probe-target hybrids, salt, and assay temperature are
considered, for example magnesium salts have a strong stabilizing
effect, when designing short, allele-discriminating probes.
[0450] An allele-discriminating probe with a target nucleic acid
binding sequence near the upper limits of 50 nucleotides long, is
designed such that the single nucleotide mismatch to be
discriminated against occurs at or near the middle of the target
nucleic acid binding sequence. For example, probes comprising a
sequence that is 21 nucleotides long are preferably designed so
that the mismatch occurs opposite one of the 14 most centrally
located nucleotides of the target nucleic acid binding sequence and
most preferably opposite one of the 7 most centrally located
nucleotides.
Example 2
Probe Design and Preparation
[0451] The invention provides for a probe having a secondary
structure that changes upon binding of the probe to a target
nucleic acid and comprising a binding moiety.
[0452] A probe according to one embodiment of the invention is
5-250 nucleotides in length and ideally 17-40 nucleotides in
length, and has a target nucleic acid binding sequence that is from
7 to about 140 nucleotides, and preferably from 10 to about 140
nucleotides. Probes may also comprise non-covalently bound or
covalently bound subunits.
[0453] One embodiment of a probe comprises a first complementary
nucleic acid sequence (for example, b in FIG. 4) and a second
complementary nucleic acid sequence (for example, b' in FIG. 4). In
one embodiment wherein the probe is unimolecular, the first and
second complementary nucleic acid sequences are in the same
molecule. In one embodiment, the probe is labeled with a
fluorophore and a quencher (for example, tetramethylrhodamine and
DABCYL, or any of the fluorophore and quencher molecules described
herein (see the section entitled "How To Prepare a Labeled Cleavage
Structure"). A probe according to the invention is labeled with an
appropriate pair of interactive labels (e.g., a FRET pair or a
non-FRET pair). The location of the interactive labels on the probe
is such that an appropriate spacing of the labels on the probe is
maintained to permit the separation of the labels when the probe
undergoes a change in the secondary structure of the probe upon
binding to a target nucleic acid. For example, the donor and
quencher moieties are positioned on the probe to quench the
generation of a detectable signal when the probe is not bound to
the target nucleic acid.
[0454] The probe further comprises a tag comprising the lac
repressor protein. In one embodiment of the invention, upon
hybridization to a target nucleic acid, the probe forms a cleavage
structure comprising a 5' flap (e.g., ab in FIG. 4). Cleaving is
performed at a cleaving temperature, and the secondary structure of
the probe when not bound to the target nucleic acid is stable at or
below the cleaving temperature. Upon cleavage of the hybridized
probe by a nuclease, the lac repressor protein binds specifically
to a capture element comprising the double stranded DNA sequence
recognized and bound specifically by the lac repressor protein:
TABLE-US-00006 AATTGTGAGCGGATAACAATT (SEQ ID NO: 4)
TTAACACTCGCCTATTGTTAA. (SEQ ID NO: 28)
[0455] In one embodiment, in the absence of the target nucleic acid
the probe folds back on itself to generate an antiparallel duplex
structure wherein the first and second complementary nucleic acid
sequences anneal by the formation of hydrogen bonds to form a
secondary structure. The secondary structure of the probe is
detected by performing a FRET or fluorescence quenching assay at
different temperatures, including temperatures that are above and
below the Tm of the probe, as described herein. A probe that
exhibits a change in fluorescence that correlates with a change in
temperature (e.g., fluorescence increases as the temperature of the
FRET reaction is increased), greater than a change in fluorescence
simply due to thermal effects on the efficiency of fluorophore
emission, has secondary structure. Secondary structure is
eliminated at a temperature wherein the maximal level of
fluorescence is detected (e.g., fluorescence does not increase
above this level at increased temperatures). The stability of the
secondary structure of the probe is determined in a melting
temperature assay or by FRET or fluorescence quenching assay, as
described herein.
[0456] As a result of the change in the secondary structure of the
probe, the tag becomes accessible for cleavage by a nuclease. In
the presence of the target nucleic acid, and at a temperature that
is selected according to the factors that influence the efficiency
and selectivity of hybridization of the probe to the target nucleic
acid, (e.g., primer length, nucleotide sequence and/or composition,
buffer composition, as described in the section entitled, "Primers
and Probes Useful According to the Invention") to permit specific
binding of the probe and the target nucleic acid, the probe binds
to the target nucleic acid and undergoes a change in the secondary
structure. A change in the secondary structure of the probe can be
determined by FRET or fluorescence quenching, as described
herein.
[0457] In one embodiment, first and second complementary nucleic
acid sequences are 3-25, preferably 4-15 and more preferably 5-11
nucleotides long. The length of the first and second complementary
nucleic acid sequences is selected such that the secondary
structure of the probe when not bound to the target nucleic acid is
stable at the temperature at which cleavage of a cleavage structure
comprising the probe bound to a target nucleic acid is performed.
As the target nucleic acid binding sequence increases in size up to
100 nucleotides, the length of the complementary nucleic acid
sequences may increase up to 15-25 nucleotides. For a target
nucleic acid binding sequence greater than 100 nucleotides, the
length of the complementary nucleic acid sequences are not
increased further.
[0458] Alternatively, an allele discriminating probe having
secondary structure and comprising a binding moiety is
prepared.
[0459] In one embodiment, an allele discriminating probe according
to the invention preferably comprises a target nucleic acid binding
sequence from 6 to 50 and preferably from 7 to 25 nucleotides, and
sequences of the complementary nucleic acid sequences from 3 to 8
nucleotides. The guanosine-cytidine content of the secondary
structure and probe-target hybrids, salt, and assay temperature are
considered, for example magnesium salts have a strong stabilizing
effect, when designing short, allele-discriminating probes.
[0460] An allele-discriminating probe with a target nucleic acid
binding sequence near the upper limits of 50 nucleotides long, is
designed such that the single nucleotide mismatch to be
discriminated against occurs at or near the middle of the target
nucleic acid binding sequence. For example, probes comprising a
sequence that is 21 nucleotides long are preferably designed so
that the mismatch occurs opposite one of the 14 most centrally
located nucleotides of the target nucleic acid binding sequence and
most preferably opposite one of the 7 most centrally located
nucleotides.
Example 3
[0461] A target nucleic acid can be detected and/or measured by the
following method. A labeled cleavage structure is formed prior to
the addition of a FEN nuclease by heating at 95.degree. C. for 5
minutes and then cooling to approximately 50-60.degree. C. (a) a
sample containing a target nucleic acid (B in FIG. 4) with (b) an
upstream oligonucleotide that specifically hybridizes to the target
nucleic acid, (A, in FIG. 4), and (c) a downstream, 5' end labeled
oligonucleotide probe having a secondary structure that changes
upon binding of the probe to the target nucleic acid and comprising
a binding moiety (for example ab in FIG. 4, comprising a nucleic
acid sequence, i.e., 5'AGCTACTGATGCAGTCACGT3' (SEQ ID NO: 26)),
wherein the probe specifically hybridizes to a region of the target
nucleic acid that is downstream of the hybridizing region of
oligonucleotide A. A polymerase that lacks a 5' to 3' exonuclease
activity but that possesses a 3' to 5' DNA synthetic activity, such
as the enzyme a)Yaq exo-, (prepared by mutagenesis using the
Stratagene QuikChange Site-Directed Mutagenesis kit, catalog number
#200518, to modify Taq polymerase (Tabor and Richardson, 1985,
Proc. Natl. Acad. Sci. USA, 82:1074)), a mutant form of Taq
polymerase that lacks 5' to 3' exonuclease activity, b) Pfu, or c)
a mutant form of Pfu polymerase that lacks 3' to 5' exonuclease
activity (exo-Pfu) is added and incubated under conditions that
permit the polymerase to extend oligonucleotide A such that it
partially displaces the 5' end of oligonucleotide C (for example
72.degree. C. in 1.times.Pfu buffer (Stratagene) for 5 minutes to 1
hour. The displaced region of oligonucleotide C forms a 5' flap
that is cleaved upon the addition of a FEN nuclease. Alternatively,
extension is performed with a polymerase that exhibits 5' to 3'
exonuclease activity and with any nuclease included in the section
entitled, "Nucleases".
[0462] A mutant form of Taq polymerase that lacks a 5' to 3'
exonuclease activity but that possesses a 3' to 5' DNA synthetic
activity comprises the following mutation: D144S/F667Y Taq wherein
D144S eliminates 5' to 3' exonuclease activity and F667Y improves
ddNTP incorporation.
[0463] Exo-mutants of PolI polymerase can be prepared according to
the method of Xu et al., 1997, J. Mol. Biol., 268: 284.
[0464] A labeled cleavage structure according to the invention is
cleaved with a preparation of PfuFEN-1 (i.e. cloned Pyrococcus
furiosus FEN-1 that is prepared as described below in Example 9).
Cleaving is performed at a cleaving temperature, and the secondary
structure of the probe when not bound to the target nucleic acid is
stable at or below the cleaving temperature. Cleavage is carried
out by adding 2 .mu.l of PfuFEN-1 to a 7 .mu.l reaction mixture
containing the following: TABLE-US-00007 3 .mu.l cleavage structure
(10 ng-10 .mu.g) 0.7 .mu.l 10x FEN nuclease buffer (10X FEN
nuclease buffer contains 500 mM Tris-HCl pH 8.0, 100 mM MgCl.sub.2)
2.00 .mu.l PfuFEN-1 enzyme or H.sub.2O 1.3 .mu.l H.sub.2O 7.00
.mu.l total volume
[0465] Samples are incubated for one hour at 50.degree. C. in a
Robocyler 96 hot top thermal cycler. Following the addition of 2
.mu.l of Sequencing Stop dye solution (included in the Stratagene
Cyclist DNA sequencing kit, catalog #200326), samples are heated at
99.degree. C. for five minutes. Released, labeled, fragments
comprising the binding moiety are bound via binding of the binding
moiety to a capture element comprising a nucleic acid sequence,
i.e., 5'TCGATGACTACGTCAGTGCA3' (SEQ ID NO: 27), on a solid support.
In one embodiment, the labeled fragments are eluted from the
capture element by, for example, decreasing the salt concentration
(stringent hybridization conditions typically include salt
concentrations of less than about 1M, more usually less than about
500 mM and preferably less than about 200 mM) or by adding an
excess of unlabeled, competitor fragment. Samples containing eluted
labeled fragments are analyzed by gel electrophoresis as follows.
Samples are loaded on an eleven inch long, hand-poured, 20%
acrylamide/bis acrylamide, 7M urea gel. The gel is run at 20 watts
until the bromophenol blue has migrated approximately 2/3 the total
distance. The gel is removed from the glass plates and soaked for
10 minutes in fix solution (15% methanol, 5% acetic acid) and then
for 10 minutes in water. The gel is placed on Whatmann 3 mm paper,
covered with plastic wrap and dried for 2 hours in a heated vacuum
gel dryer (.about.80.degree. C.). The gel is exposed overnight to
X-ray film to detect the presence of a signal that is indicative of
the presence of a target nucleic acid.
[0466] Alternatively, extension is performed with a polymerase that
exhibits 5' to 3' exonuclease activity and with any nuclease
included in the section entitled, "Nucleases".
Example 4
[0467] A target nucleic acid can be detected and/or measured by the
following method. A labeled cleavage structure is formed prior to
the addition of a FEN nuclease by heating at 95.degree. C. for 5
minutes and then cooling to approximately 50-60.degree. C. (a) a
sample containing a target nucleic acid (B in FIG. 4) with (b) an
upstream oligonucleotide that specifically hybridizes to the target
nucleic acid, (A, in FIG. 4), and (c) a downstream, 5' end labeled
oligonucleotide probe having a secondary structure that changes
upon binding of the probe to the target nucleic acid and comprising
a lac repressor protein tag, wherein the probe specifically
hybridizes to a region of the target nucleic acid that is
downstream of the hybridizing region of oligonucleotide A. A
polymerase that lacks a 5' to 3' exonuclease activity but that
possesses a 3' to 5' DNA synthetic activity, such as the enzyme
a)Yaq exo-, (prepared by mutagenesis using the Stratagene
QuikChange Site-Directed Mutagenesis kit, catalog number #200518,
to modify Taq polymerase (Tabor and Richardson, 1985, Proc. Natl.
Acad. Sci. USA, 82:1074)), a mutant form of Taq polymerase that
lacks 5' to 3' exonuclease activity, b) Pfu, or c) a mutant form of
Pfu polymerase that lacks 3' to 5' exonuclease activity (exo-Pfu)
is added and incubated under conditions that permit the polymerase
to extend oligonucleotide A such that it partially displaces the 5'
end of oligonucleotide C (for example 720 C. in 1.times.Pfu buffer
(Stratagene) for 5 minutes to 1 hour. The displaced region of
oligonucleotide C forms a 5' flap that is cleaved upon the addition
of a FEN nuclease. Alternatively, extension is performed with a
polymerase that exhibits 5' to 3' exonuclease activity and with any
nuclease included in the section entitled, "Nucleases".
[0468] A mutant form of Taq polymerase that lacks a 5' to 3'
exonuclease activity but that possesses a 3' to 5' DNA synthetic
activity comprises the following mutation: D144S/F667Y Taq wherein
D144S eliminates 5' to 3' exonuclease activity and F667Y improves
ddNTP incorporation.
[0469] Exo-mutants of PolI polymerase can be prepared according to
the method of Xu et al., 1997, J. Mol. Biol., 268: 284.
[0470] A labeled cleavage structure according to the invention is
cleaved with a preparation of PfuFEN-1 (i.e. cloned Pyrococcus
furiosus FEN-1 that is prepared as described below in Example 9).
Cleaving is performed at a cleaving temperature, and the secondary
structure of the probe when not bound to the target nucleic acid is
stable at or below the cleaving temperature. Cleavage is carried
out by adding 2 .mu.l of PfuFEN-1 to a 7 .mu.l reaction mixture
containing the following: TABLE-US-00008 3 .mu.l cleavage structure
(10 ng-10 .mu.g) 0.7 .mu.l 10x FEN nuclease buffer (10X FEN
nuclease buffer contains 500 mM Tris-HCl pH 8.0, 100 mM MgCl.sub.2)
2.00 .mu.l PfuFEN-1 enzyme or H.sub.2O 1.3 .mu.l H.sub.2O 7.00
.mu.l total volume
[0471] Samples are incubated for one hour at 50.degree. C. in a
Robocyler 96 hot top thermal cycler. Following the addition of 2
.mu.l of Sequencing Stop dye solution (included in the Stratagene
Cyclist DNA sequencing kit, catalog #200326), samples are heated at
99.degree. C. for five minutes. Released, labeled, fragments
comprising the lac repressor protein are bound via binding of the
lac repressor protein to a capture element comprising the double
stranded DNA sequence recognized by the lac repressor protein:
TABLE-US-00009 AATTGTGAGCGGATAACAATT (SEQ ID NO: 4)
TTAACACTCGCCTATTGTTAA, (SEQ ID NO: 28) on a solid support.
[0472] In one embodiment, the labeled fragments are eluted from the
capture element by, for example, altering the salt concentration,
i.e., decreasing the salt concentration (stringent hybridization
conditions typically include salt concentrations of less than about
1M, more usually less than about 500 mM and preferably less than
about 200 mM) or by adding an excess of competitor a)lac repressor
protein or b) double stranded DNA sequence recognized by the lac
repressor protein. Samples containing eluted labeled fragments are
analyzed by gel electrophoresis as follows. Samples are loaded on
an eleven inch long, hand-poured, 20% acrylamide/bis acrylamide, 7M
urea gel. The gel is run at 20 watts until the bromophenol blue has
migrated approximately 2/3 the total distance. The gel is removed
from the glass plates and soaked for 10 minutes in fix solution
(15% methanol, 5% acetic acid) and then for 10 minutes in water.
The gel is placed on Whatmann 3 mm paper, covered with plastic wrap
and dried for 2 hours in a heated vacuum gel dryer (.about.800 C).
The gel is exposed overnight to X-ray film to detect the presence
of a signal that is indicative of the presence of a target nucleic
acid.
[0473] Alternatively, extension is performed with a polymerase that
exhibits 5' to 3' exonuclease activity and with any nuclease
included in the section entitled, "Nucleases".
Example 5
[0474] A target nucleic acid can be detected and/or measured by the
following method. A labeled cleavage structure is formed prior to
the addition of a FEN nuclease by annealing at 95.degree. C. for 5
minutes and then cooling to approximately 50-60.degree. C. (a) a
sample containing a target nucleic acid (B in FIG. 4) with (b) an
upstream oligonucleotide primer that specifically hybridizes to the
target nucleic acid, (A, in FIG. 4), and (c) a downstream, 5' end
labeled oligonucleotide probe having a secondary structure that
changes upon binding of the probe to the target nucleic acid and
comprising a binding moiety (for example ab in FIG. 4, comprising a
nucleic acid sequence 5'AGCTACTGATGCAGTCACGT3' (SEQ ID NO: 26)),
wherein the probe specifically hybridizes to a region of the target
nucleic acid that is adjacent to the hybridizing region of
oligonucleotide A and further comprises a 5' region that does not
hybridize to the target nucleic acid and forms a 5' flap. Annealing
is carried out in the presence of 1.times.Sentinal Molecular beacon
core buffer or 10.times.Pfu buffer.
[0475] A labeled cleavage structure according to the invention is
cleaved with a preparation of PfuFEN-1 (i.e. cloned Pyrococcus
furiosus FEN-1 that is prepared as described below in Example 9).
Cleaving is performed at a cleaving temperature, and the secondary
structure of the probe when not bound to the target nucleic acid is
stable at or below the cleaving temperature. Cleavage is carried
out by adding 2 .mu.l of PfuFEN-1 to a 7 .mu.l reaction mixture
containing the following: TABLE-US-00010 3 .mu.l cleavage structure
(10 ng-10 .mu.g) 0.7 .mu.l 10x FEN nuclease buffer (10X FEN
nuclease buffer contains 500 mM Tris-HCl pH 8.0, 100 mM MgCl.sub.2)
2.00 .mu.l PfuFEN-1 enzyme or H.sub.2O 1.3 .mu.l H.sub.2O 7.00
.mu.l total volume
[0476] Samples are incubated for one hour at 50.degree. C. in a
Robocyler 96 hot top thermal cycler. Following the addition of 2
.mu.l of Sequencing Stop dye solution (included in the Stratagene
Cyclist DNA sequencing kit, catalog #200326), samples are heated at
99.degree. C. for five minutes. Released, labeled, fragments
comprising a binding moiety are bound via binding of the binding
moiety to a capture element comprising the sequence,
5'TCGATGACTACGTCAGTGCA3' (SEQ ID NO: 27), on a solid support. In
one embodiment, the labeled fragments are eluted from the capture
element by, for example, decreasing the salt concentration
(stringent hybridization conditions typically include salt
concentrations of less than about 1M, more usually less than about
500 mM and preferably less than about 200 mM) or by adding an
excess of unlabeled, competitor fragment. Samples containing eluted
labeled fragments are analyzed by gel electrophoresis as follows.
Samples are loaded on an eleven inch long, hand-poured, 20%
acrylamide/bis acrylamide, 7M urea gel. The gel is run at 20 watts
until the bromophenol blue has migrated approximately 2/3 the total
distance. The gel is removed from the glass plates and soaked for
10 minutes in fix solution (15% methanol, 5% acetic acid) and then
for 10 minutes in water. The gel is placed on Whatmann 3mm paper,
covered with plastic wrap and dried for 2 hours in a heated vacuum
gel dryer (.about.80.degree. C.). The gel is exposed overnight to
X-ray film to detect the presence of a signal that is indicative of
the presence of a target nucleic acid.
[0477] Alternatively, extension is performed with a polymerase that
exhibits 5' to 3' exonuclease activity and with any nuclease
included in the section entitled, "Nucleases".
Example 6
[0478] A target nucleic acid can be detected and/or measured by the
following method. A labeled cleavage structure is formed prior to
the addition of a FEN nuclease by annealing at 95.degree. C. for 5
minutes and then cooling to approximately 50-60.degree. C. (a) a
sample containing a target nucleic acid (B in FIG. 4) with (b) an
upstream oligonucleotide primer that specifically hybridizes to the
target nucleic acid, (A, in FIG. 4), and (c) a downstream, 5' end
labeled oligonucleotide probe having a secondary structure that
changes upon binding of the probe to the target nucleic acid and
comprising a lac repressor protein tag, wherein the probe
specifically hybridizes to a region of the target nucleic acid that
is adjacent to the hybridizing region of oligonucleotide A and
further comprises a 5' region that does not hybridize to the target
nucleic acid and forms a 5' flap. Annealing is carried out in the
presence of 1.times.Sentinal Molecular beacon core buffer or
10.times.Pfu buffer.
[0479] A labeled cleavage structure according to the invention is
cleaved with a preparation of PfuFEN-1 (i.e. cloned Pyrococcus
furiosus FEN-1 that is prepared as described below in Example 9).
Cleaving is performed at a cleaving temperature, and the secondary
structure of the probe when not bound to the target nucleic acid is
stable at or below the cleaving temperature. Cleavage is carried
out by adding 2 .mu.l of PfuFEN-1 to a 7 .mu.l reaction mixture
containing the following: TABLE-US-00011 3 .mu.l cleavage structure
(10 ng-10 .mu.g) 0.7 .mu.l 10x FEN nuclease buffer (10X FEN
nuclease buffer contains 500 mM Tris-HCl pH 8.0, 100 mM MgCl.sub.2)
2.00 .mu.l PfuFEN-1 enzyme or H.sub.2O 1.3 .mu.l H.sub.2O 7.00
.mu.l total volume
[0480] Samples are incubated for one hour at 50.degree. C. in a
Robocyler 96 hot top thermal cycler. Following the addition of 2
.mu.l of Sequencing Stop dye solution (included in the Stratagene
Cyclist DNA sequencing kit, catalog #200326), samples are heated at
99.degree. C. for five minutes.
[0481] Upon cleavage of the hybridized probe by a nuclease, the lac
repressor protein binds specifically to a capture element
comprising the double stranded DNA sequence recognized by the lac
repressor protein: TABLE-US-00012 AATTGTGAGCGGATAACAATT (SEQ ID NO:
4) TTAACACTCGCCTATTGTTAA, (SEQ ID NO: 28) on a solid support.
[0482] In one embodiment, the labeled fragments are eluted from the
capture element as described in Example 4, above. Samples
containing eluted labeled fragments are analyzed by gel
electrophoresis as follows. Samples are loaded on an eleven inch
long, hand-poured, 20% acrylamide/bis acrylamide, 7M urea gel. The
gel is run at 20 watts until the bromophenol blue has migrated
approximately 2/3 the total distance. The gel is removed from the
glass plates and soaked for 10 minutes in fix solution (15%
methanol, 5% acetic acid) and then for 10 minutes in water. The gel
is placed on Whatmann 3 mm paper, covered with plastic wrap and
dried for 2 hours in a heated vacuum gel dryer (.about.80.degree.
C.). The gel is exposed overnight to X-ray film to detect the
presence of a signal that is indicative of the presence of a target
nucleic acid.
[0483] Alternatively, extension is performed with a polymerase that
exhibits 5' to 3' exonuclease activity and with any nuclease
included in the section entitled, "Nucleases".
Example 7
[0484] A target nucleic acid can be detected and/or measured by the
following method. A labeled cleavage structure is formed prior to
the addition of a FEN nuclease by annealing at 95.degree. C. for 5
minutes and then cooling to approximately 50-60.degree. C. (a) a
sample containing a target nucleic acid (B in FIG. 4) with (b) a
downstream, 5' end labeled oligonucleotide probe having a secondary
structure that changes upon binding of the probe to the target
nucleic acid and a binding moiety (for example ab in FIG. 4,
comprising a nucleic acid sequence, i.e., 5'AGCTACTGATGCAGTCACGT3'
(SEQ ID NO: 26), wherein the probe specifically hybridizes to a
region of the target nucleic acid and comprises a 5' region that
does not hybridize to the target nucleic acid and forms a 5' flap.
Annealing is carried out in the presence of 1.times.Sentinal
Molecular beacon core buffer or 10.times.Pfu buffer.
[0485] A labeled cleavage structure according to the invention is
cleaved with a nuclease that is capable of cleaving this cleavage
structure (e.g., Taq polymerase). Cleaving is performed at a
cleaving temperature, and the secondary structure of the probe when
not bound to the target nucleic acid is stable at or below the
cleaving temperature. Cleavage is carried out by adding 2 .mu.l of
a nuclease to a 7 .mu.l reaction mixture containing the following:
TABLE-US-00013 3 .mu.l cleavage structure (10 ng-10 .mu.g) 0.7
.mu.l 10x nuclease buffer (500 mM Tris-HCl pH 8.0, 100 mM
MgCl.sub.2) 2.00 .mu.l nuclease or H.sub.2O 1.3 .mu.l H.sub.2O 7.00
.mu.l total volume
[0486] Samples are incubated for one hour at 50.degree. C. in a
Robocyler 96 hot top thermal cycler. Following the addition of 2
.mu.l of Sequencing Stop dye solution (included in the Stratagene
Cyclist DNA sequencing kit, catalog #200326), samples are heated at
99.degree. C. for five minutes. Released, labeled, fragments
comprising a binding moiety are bound via binding of the binding
moiety to a capture element comprising a nucleic acid sequence,
i.e., 5'TCGATGACTACGTCAGTGCA3' (SEQ ID NO: 27), on a solid support.
In one embodiment, the labeled fragments are eluted from the
capture element by, for example, decreasing the salt concentration
(stringent hybridization conditions typically include salt
concentrations of less than about 1M, more usually less than about
500 mM and preferably less than about 200 mM) or by adding an
excess of unlabeled, competitor fragment. Samples containing eluted
labeled fragments are analyzed by gel electrophoresis as follows.
Samples are loaded on an eleven inch long, hand-poured, 20%
acrylamide/bis acrylamide, 7M urea gel. The gel is run at 20 watts
until the bromophenol blue has migrated approximately 2/3 the total
distance. The gel is removed from the glass plates and soaked for
10 minutes in fix solution (15% methanol, 5% acetic acid) and then
for 10 minutes in water. The gel is placed on Whatmann 3 mm paper,
covered with plastic wrap and dried for 2 hours in a heated vacuum
gel dryer (.about.80.degree. C.). The gel is exposed overnight to
X-ray film to detect the presence of a signal that is indicative of
the presence of a target nucleic acid.
[0487] Alternatively, extension is performed with a polymerase that
exhibits 5' to 3' exonuclease activity and with any nuclease
included in the section entitled, "Nucleases".
Example 8
[0488] A target nucleic acid can be detected and/or measured by the
following method. A labeled cleavage structure is formed prior to
the addition of a FEN nuclease by annealing at 95.degree. C. for 5
minutes and then cooling to approximately 50-60.degree. C. (a) a
sample containing a target nucleic acid (B in FIG. 4) with (b) a
downstream, 5' end labeled oligonucleotide probe having a secondary
structure that changes upon binding of the probe to the target
nucleic acid and a tag comprising the lac repressor protein,
wherein the probe specifically hybridizes to a region of the target
nucleic acid and comprises a 5' region that does not hybridize to
the target nucleic acid and forms a 5' flap. Annealing is carried
out in the presence of 1.times.Sentinal Molecular beacon core
buffer or 10.times.Pfu buffer.
[0489] A labeled cleavage structure according to the invention is
cleaved with a nuclease that is capable of cleaving this cleavage
structure (e.g., Taq polymerase). Cleaving is performed at a
cleaving temperature, and the secondary structure of the probe when
not bound to the target nucleic acid is stable at or below the
cleaving temperature. Cleavage is carried out by adding 2 .mu.l of
a nuclease to a 7 .mu.l reaction mixture containing the following:
TABLE-US-00014 3 .mu.l cleavage structure (10 ng-10 .mu.g) 0.7
.mu.l 10x nuclease buffer (500 mM Tris-HCl pH 8.0, 100 mM
MgCl.sub.2) 2.00 .mu.l nuclease or H.sub.2O 1.3 .mu.l H.sub.2O 7.00
.mu.l total volume
[0490] Samples are incubated for one hour at 50.degree. C. in a
Robocyler 96 hot top thermal cycler. Following the addition of 2
.mu.l of Sequencing Stop dye solution (included in the Stratagene
Cyclist DNA sequencing kit, catalog #200326), samples are heated at
99.degree. C. for five minutes. Upon cleavage of the hybridized
probe by a nuclease, the lac repressor protein binds specifically
to a capture element comprising the double stranded DNA sequence
recognized by the lac repressor protein: TABLE-US-00015
AATTGTGAGCGGATAACAATT (SEQ ID NO: 4) TTAACACTCGCCTATTGTTAA, (SEQ ID
NO: 28) on a solid support.
[0491] In one embodiment, the labeled fragments are eluted from the
capture element as described in Example 4, above. Samples
containing eluted labeled fragments are analyzed by gel
electrophoresis as follows. Samples are loaded on an eleven inch
long, hand-poured, 20% acrylamide/bis acrylamide, 7M urea gel. The
gel is run at 20 watts until the bromophenol blue has migrated
approximately 2/3 the total distance. The gel is removed from the
glass plates and soaked for 10 minutes in fix solution (15%
methanol, 5% acetic acid) and then for 10 minutes in water. The gel
is placed on Whatmann 3mm paper, covered with plastic wrap and
dried for 2 hours in a heated vacuum gel dryer (.about.80.degree.
C.). The gel is exposed overnight to X-ray film to detect the
presence of a signal that is indicative of the presence of a target
nucleic acid.
[0492] Alternatively, extension is performed with a polymerase that
exhibits 5' to 3' exonuclease activity and with any nuclease
included in the section entitled, "Nucleases".
Example 9
Cloning Pfu FEN-1
[0493] A thermostable FEN nuclease enzyme useful according to the
invention can be prepared according to the following method.
[0494] The thermostable FEN nuclease gene can be isolated from
genomic DNA derived from P. furiosus (ATCC#43587) according to
methods of PCR cloning well known in the art. The cloned PfuFEN-1
can be overexpressed in bacterial cells according to methods well
known in the art and described below.
[0495] The following pCAL-n-EK cloning oligonucleotides were
synthesized and purified: TABLE-US-00016 (SEQ ID NO: 29) a.
5'GACGACGACAAGATGGGTGTCCCAATTGGTGAGATTATACCAAGA AAAG 3' and (SEQ ID
NO: 30) b. 5'GGAACAAGACCCGTTTATCTCTTGAACCAACTTTCAAGGGTTGAT
TGTTTTCCACT 3'.
[0496] The Affinity.RTM. Protein Expression and Purification System
was obtained from Stratagene and used according to the
manufacturer's protocols.
Amplification
[0497] The insert DNA was prepared by PCR amplification with
gene-specific primers (oligonucleotides a and b, described above)
that include 12 and 13-nucleotide sequences at the 5' ends that are
complementary to the pCAL-n-EK vector single-stranded tails, thus
allowing for directional cloning. The FEN-1 sequence was amplified
from genomic DNA derived from P. furiosus by preparing
amplification reactions (five independent 100 .mu.l reactions)
containing: TABLE-US-00017 50 .mu.l 10x cPfu Buffer (Stratagene)
7.5 .mu.l Pfu Genomic DNA (approx. 100 ng/.mu.l) 7.5 .mu.l Pfu
Turbo(2.5 .mu./.mu.l), (Stratagene, Catalog # 600250) 15 .mu.l
mixed primer pair (100 ng/.mu.l each) (oligonucleotides a and b,
described above) 4 .mu.l 100 mM dNTP 416 .mu.l .mu.l H.sub.2O 500
.mu.l total
[0498] and carrying out the amplification under the following
conditions using a Stratagene Robocycler 96 hot top thermal cycler:
TABLE-US-00018 Window 1 95.degree. C. 1 minute 1 cycle Window 2
95.degree. C. 1 minute 50.degree. C. 1 minute 30 cycles 72.degree.
C. 3 minutes
[0499] The PCR products from each of the five reactions were
combined into one tube, purified using StrataPrep PCR and eluted in
50 .mu.l 1 mM Tris-HCl pH 8.6. The FEN-1 PCR product was analyzed
on a gel and was determined to be approximately 1000 bp.
[0500] The PCR product comprising the fen-1 gene was cloned into
the pCALnEK LIC vector (Stratagene) by creating ligation
independent cloning termini (LIC), annealing the PCR product
comprising the fen-1 gene to the pCALnEK LIC vector (Stratagene),
and transforming cells with the annealing mixture according to the
following method. Briefly, following PCR amplification, the PCR
product is purified and treated with Pfu DNA polymerase in the
presence of dATP (according to the manual included with the
Affinity.RTM. Protein Expression and Purification System,
Stratagene, catalog #200326). In the absence of dTTP, dGTP and
dCTP, the 3' to 5'-exonuclease activity of Pfu DNA polymerase
removes at least 12 and 13 nucleotides at the respective 3' ends of
the PCR product. This activity continues until the first adenine is
encountered, producing a DNA fragment with 5'-extended
single-stranded tails that are complementary to the single-stranded
tails of the pCAL-n-EK vector.
Creating LIC termini
[0501] LIC termini were created by preparing the following mixture:
TABLE-US-00019 45 .mu.l purified PCR product (.about.0.5
.mu.g/.mu.l) 2.5 .mu.l 10 mM dATP 5 .mu.l 10x cPfu buffer 1 .mu.l
cPfu (2.5 .mu./.mu.l) 0.5 .mu.l H.sub.2O
[0502] cPfu and cPfu buffer can be obtained from Stratagene (cPfu,
Stratagene Catalog #600153 and cPfu buffer, Stratagene Catalog
#200532).
[0503] Samples were incubated at 72.degree. C. for 20 minutes and
products were cooled to room temperature. To each sample was added
40 ng prepared pCALnEK LIC vector (the prepared vector is available
commercially from Stratagene in the Affinity LIC Cloning and
Protein Purification Kit (214405)). The vector and insert DNA are
combined, allowed to anneal at room temperature and transformed
into highly competent bacterial host cells (Wyborski et al., 1997,
Strategies, 10:1).
Preparing Cells for Production of FEN
[0504] Two liters of LB-AMP was inoculated with 20 ml of an
overnight culture of a FEN-1 clone (clone 3). Growth was allowed to
proceed for approximately 11 hours at which point cells had reached
an OD.sub.600=0.974. Cells were induced overnight (about 12 hours)
with 1 mM IPTG. Cells were collected by centrifugation and the
resulting cell paste was stored at -20.degree. C.
Purification of Tagged FEN-1
[0505] Cells were resuspended in 20 ml of Calcium binding
buffer
CaCl.sub.2 Binding Buffer
50 mM Tris-HCl (pH 8.0)
150 mM NaCl
1.0 mM MgOAc
2 mM CaCl.sub.2
[0506] The samples were sonicated with a Branson Sonicator using a
microtip. The output setting was 5 and the duty cycle was 90%.
Samples were sonicated three times and allowed to rest on ice
during the intervals. The sonicate was centrifuged at
26,890.times.g. Cleared supernatants were mixed with 1 ml of washed
(in CaCl.sub.2 binding buffer) calmodulin agarose (CAM agarose) in
a 50 ml conical tube and incubated on a slowly rotating wheel in a
cold room (4.degree. C.) for 5 hours. The CAM agarose was collected
by light centrifugation (5000 rpm in a table top centrifuge).
[0507] Following removal of the supernatant, the CAM agarose was
washed with 50 ml CaCl.sub.2 binding buffer and transferred to a
disposable drip column. The original container and pipet were
rinsed thoroughly to remove residual agarose. The column was rinsed
with approximately 200 ml of CaCl.sub.2 binding buffer.
[0508] Elution was carried out with 10 ml of 50 mM NaCl elution
buffer (50 mM NaCl, 50 mM Tris-HCl pH 8.0, 2 mM EGTA). 0.5 ml
fractions were collected. A second elution step was carried out
with 1M NaCl elution buffer wherein 0.5 ml fractions were
collected.
Evaluation of Purified Tagged FEN-1
[0509] Fractions containing CBP-tagged Pfu FEN-1 eluted in 1M NaCl
were boiled in SDS and analyzed by SDS-PAGE on a 4-20% gel stained
with Sypro Orange (FIG. 5).
[0510] The protein concentration of uncleaved FEN-1 was determined
to be approximately 150 ng/microliter (below).
Enterokinase Protease (EK) Cleavage of the Purified FEN-1
[0511] Fractions 3-9 were dialyzed in 50 mM NaCl, 50 mM Tris-HCl pH
8.0 and 2 mM CaCl.sub.2 overnight at 4.degree. C.
[0512] An opaque, very fine precipitate appeared in the dialyzed
FEN-1. When the sample was diluted 1/20 the precipitate was
removed. When the sample was diluted 1/3 insoluble material was
still detectable. The 1/3 diluted material was heated at 37.degree.
C. for 2 minutes and mixed with Tween 20 to a final concentration
of 0.1%. Upon the addition of the Tween 20, there was an almost
immediate formation of "strings" and much coarser solids in the
solution which could not be reversed even after the solution was
adjusted to 1M NaCl.
[0513] EK cleavage was carried out using as a substrate the sample
that was diluted 1/20 as well as with a dilute sample prepared by
rinsing the dialysis bag with 1.times.EK buffer. EK cleavage was
carried out by the addition of 1 .mu.l EK (1 u/.mu.l) overnight at
room temperature (about 16 hours).
[0514] 100 .mu.l of STI agarose combined with 100 .mu.l of CAM
agarose were rinsed twice with 10 ml of 1.times.STI buffer (50 mM
Tris-HCl pH 8.0, 200 mM NaCl, 2 mM CaCl.sub.2, 0.1% Tween 20). NaCl
was added to the two EK samples to bring the final concentration to
200 mM NaCl. The two samples were combined and added to the rinsed
agarose. The samples were rotated slowly on a wheel at 4.degree. C.
for three hours and separated by light centrifugation in a table
top centrifuge (as described). The supernatant was removed and the
resin was rinsed twice with 500 .mu.l STI. The two rinses were
combined and saved separately from the original supernatant.
Samples were analyzed by SDS-PAGE on a 4-20% gel.
[0515] The concentration of digested product was approximately
23ng/.mu.l as determined by comparison to a Pfu standard at a
concentration of approximately 50 ng/ml.
Example 10
FEN Nuclease Activity
[0516] The endonuclease activity of a FEN nuclease and the cleavage
structure requirements of a FEN nuclease prepared as described in
Example 2 can be determined according to the methods described
either in the section entitled "FEN nucleases" or below.
[0517] Briefly, three templates (FIG. 2) are used to evaluate the
activity of a FEN nuclease according to the invention. Template 1
is a 5' .sup.33P labeled oligonucleotide (Heltest4) with the
following sequence: TABLE-US-00020 (SEQ ID NO: 29)
5'AAAATAAATAAAAAAAATACTGTTGGGAAGGGCGATCGGTGCG 3'.
[0518] The underlined section of Heltest4 represents the region
complementary to M13mp18+. The cleavage product is an 18 nucleotide
fragment with the sequence AAAATAAATAAAAAAAAT (SEQ ID NO: 2).
Heltest4 binds to M13 to produce a complementary double stranded
domain as well as a non-complementary 5' overhang. This duplex
forms template 2 (FIG. 2). Template 3 (FIG. 2) has an additional
primer (FENAS) bound to M13 which is directly adjacent to Heltest
4. The sequence of FENAS is:
[0519] 5' CCATTCGCCATTCAGGCTGCGCA 3' SEQ ID NO: 3). In the presence
of template 3, a FEN nuclease binds the free 5' terminus of
Heltest4, migrates to the junction and cleaves Heltest4 to produce
an 18 nucleotide fragment. The resulting cleavage products are
separated on a 6% acrylamide, 7M urea sequencing gel.
[0520] Templates are prepared as described below: TABLE-US-00021
Template 1 Template 2 Template 3 Heltest4 14 .mu.l 14 .mu.l 14
.mu.l M13 ** 14 .mu.l 14 .mu.l FENAS ** ** 14 .mu.l H.sub.2O 28
.mu.l 14 .mu.l ** 10x Pfu Buff. 4.6 .mu.l 4.6 .mu.l 4.6 .mu.l
[0521] Pfu buffer can be obtained from Stratagene (Catalog
#200536).
[0522] The template mixture is heated at 95.degree. C. for five
minutes, cooled to room temperature for 45 minutes and stored at
4.degree. C. overnight.
The enzyme samples are as follows:
A. H.sub.2O (control)
B. 2 .mu.l undiluted uncleaved FEN-1 (.about.445 ng/.mu.l)
C. 2 .mu.l 1/10 dilution of uncleaved FEN-1 (.about.44.5
ng/.mu.l)
D. 2 .mu.l enterokinase protease (EK) cleaved FEN-1 (.about.23
ng/.mu.l)
[0523] The four reaction mixtures are mixed with the three
templates as follows: TABLE-US-00022 3 .mu.l template 1, template 2
or template 3 0.7 .mu.l 10x cloned Pfu buffer 0.6 .mu.l 100 mM
MgCl.sub.2 2.00 .mu.l FEN-1 or H.sub.2O 0.7 .mu.l H.sub.2O 7.00
.mu.l total volume
[0524] The reactions are allowed to proceed for 30 minutes at
50.degree. C. and stopped by the addition of 2 .mu.l formamide
"Sequencing Stop" solution to each sample. Samples are heated at
95.degree. C. for five minutes and loaded on a 6% acrylamide 7M
urea CastAway gel (Stratagene).
[0525] Alternatively, FEN nuclease activity can be analyzed in the
following buffer wherein a one hour incubation time is
utilized.
10.times.FEN Nuclease Buffer
500 mM Tris-HCl pH 8.0
100 mM MgCl.sub.2
[0526] The reaction mixture is as follows: TABLE-US-00023 3 .mu.l
template 1, template 2 or template 3 0.7 .mu.l 10x FEN nuclease
buffer 2.00 .mu.l FEN-1 or H.sub.2O (A-D, above) 1.3 .mu.l H.sub.2O
7.00 .mu.l total volume
[0527] Samples are incubated for one hour at 50.degree. C. in the
Robocyler 96 hot top thermal cycler. Following the addition of 2
.mu.l of Sequencing Stop (95% formamide, 20 mM EDTA, 0.05%
bromophenol blue, 0.05% xylene cyanol, available from Stratagene)
dye solution, samples are heated at 99.degree. C. for five minutes.
Samples are loaded on an eleven inch long, hand-poured, 20%
acrylamide/bis acrylamide, 7M urea gel. The gel is run at 20 watts
until the bromophenol blue has migrated approximately 2/3 the total
distance. The gel is removed from the glass plates and soaked for
10 minutes in fix solution (15% methanol, 5% acetic acid) and then
for 10 minutes in water. The gel is placed on Whatmann 3 mm paper,
covered with plastic wrap and dried for 2 hours in a heated vacuum
gel dryer (.about.80.degree. C.). The gel is exposed overnight to
X-ray film.
[0528] An autoradiograph of a FEN-1 nuclease assay wherein
templates 1, 2 and 3 (prepared as described above) are cleaved by
the addition of:
A. H.sub.2O
B. 2 .mu.l of CBP-tagged Pfu FEN-1
C. 2 .mu.l of CBP-tagged Pfu FEN-1 diluted (1:10)
D. 2 .mu.l of EK cleaved Pfu FEN-1
is presented in FIG. 6.
[0529] The lanes are as follows. Lanes 1A, 1B, 1C and 1D represent
template 1 cleaved with H.sub.2O, undiluted CBP-tagged Pfu FEN-1, a
1:10 dilution of CBP-tagged Pfu FEN-1 and EK cleaved Pfu FEN-1,
respectively. Lanes 2A, 2B, 2C and 2D represent template 2 cleaved
with H.sub.2O, undiluted CBP-tagged Pfu FEN-1, a 1:10 dilution of
CBP-tagged Pfu FEN-1 and EK cleaved Pfu FEN-1, respectively. Lanes
3A, 3B, 3C and 3D represent template 3 cleaved with H.sub.2O,
undiluted CBP-tagged Pfu FEN-1, a 1:10 dilution of CBP-tagged Pfu
FEN-1 and EK cleaved Pfu FEN-1, respectively.
[0530] Tagged Pfu FEN-1 contains the N-terminal CBP affinity
purification tag. Any differences in activity between tagged and
untagged versions of FEN-1 are due to differences in protein
concentration (concentrations of enzyme samples are provided above)
since the amounts of tagged versus untagged FEN-1 are not
equivalent. Both tagged and untagged Pfu FEN-1 demonstrate cleavage
activity.
[0531] FIG. 6 demonstrates the background level of cleavage in the
absence of FEN-1 (lanes 1A, 2A and 3A). Further, this figure
demonstrates that tagged Pfu FEN-1 cleaves more of template 2 as
compared to template 1. In particular, the greatest amount of
template 2 is cleaved in the presence of undiluted, tagged Pfu
FEN-1 (lane 2B). Analysis of template 3 demonstrates that the
greatest amount of template 3 is cleaved by undiluted, tagged Pfu
FEN-1 and the least amount of template 3 is cleaved by diluted
tagged FEN-1. Labeled probe migrates as a 40-43 nucleotide band.
FEN-1 preferentially cleaves template 3 (which comprises an
upstream primer) as compared to template 2. The cleavage product
bands are the major bands migrating at 16-20 nucleotides.
Heterogeneity in the labeled cleavage products is the result of
heterogeneity in the labeled substrate, which was not gel-purified
prior to use.
Example 11
[0532] PCR Amplification and Detection of .beta.-actin in the
Presence of a FEN-1 Nuclease and a Taq Polymerase deficient in 5'
to 3' Exonuclease Activity A PCR assay is used to detect a target
nucleic acid. According to the method of this assay, a PCR reaction
is carried out in the presence of a probe having a secondary
structure that changes upon binding to a target nucleic acid and
comprising a binding moiety or a tag, Taq polymerase deficient in
5' to 3' exonuclease activity (for example Yaq exo-), and a
thermostable FEN-1 nuclease (e.g. Pfu FEN-1, prepared as described
in Example 2). Detection of the release of fluorescently labeled
fragments that bind, via binding of the binding moiety or tag, to a
capture element on a solid support indicates the presence of the
target nucleic acid.
[0533] Duplicate PCR reactions containing 1.times.Sentinel
Molecular beacon core buffer, 3.5 mM MgCl.sub.2, 200 .mu.M of each
dNTP, a Taq polymerase deficient in 5' to 3' exonuclease activity
(.about.1.45U), Pfu FEN-1 (.about.23 ng), .beta.-Actin primers (300
nM each) and a .beta.-actin specific fluorogenic probe having a
secondary structure that changes upon binding of the probe to the
.beta.-Actin target sequence and comprising a binding moiety or
tag. 10 ng of human genomic DNA (Promega) is used as the target
nucleic acid in each reaction. This reaction is performed in a 50
.mu.l volume. Negative control reactions containing either Pfu
FEN-1 alone, a Taq polymerase deficient in 5' to 3' exonuclease
activity alone or reaction mixtures containing all components
except a human genomic DNA template are prepared. Positive control
reactions comprising 2.5 Units of Taq 2000 are also prepared.
During the PCR reaction, there is simultaneous formation of a
cleavage structure, amplification of the .beta.-actin target
sequence and cleavage of the cleavage structure. Thermocycling
parameters are selected such that cleavage of the cleavage
structure is performed at a cleaving temperature, and the secondary
structure of the probe, when not bound to the target nucleic acid
is stable at or below the cleaving temperature. Reactions are
assayed in a spectrofluorometric thermocycler (ABI 7700).
Thermocycling parameters are 95.degree. C. for 2 min and 40 cycles
of 95.degree. C. for 15 sec, 60.degree. C. for 60 sec and
72.degree. C. for 15 sec. Samples are interrogated during the
annealing step.
[0534] Released, fluorescently labeled fragments are bound, via the
binding moiety or tag present on the probe, to a capture element
bound to a solid support.
Example 12
PCR Amplification and Detection of .beta.-Actin in the Presence of
a FEN-1 Nuclease and a Pfu Polymerase Deficient in 5' to 3'
Exonuclease Activity
[0535] A PCR assay is used to detect a target nucleic acid.
According to the method of this assay, a PCR reaction is carried
out in the presence of a probe having a secondary structure that
changes upon binding of the probe to the .beta.-actin target
nucleic acid and comprising a binding moiety or tag, Pfu polymerase
(naturally lacking 5' to 3' exonuclease activity) or, in addition,
Pfu polymerase deficient in 3' to 5' exonuclease activity as well
(for example exo-Pfu), and a thermostable FEN-1 nuclease (Pfu
FEN-1). Detection of the release of fluorescently labeled fragments
that bind, via binding of the binding moiety or tag, to a capture
element on a solid support indicates the presence of the target
nucleic acid.
[0536] Duplicate PCR reactions containing 1.times.Cloned Pfu buffer
(available from Stratagene, Catalog #200532), 3.0 mM MgCl.sub.2,
200 .mu.M of each dNTP, 5 units of a Pfu polymerase deficient in 3'
to 5' exonuclease activity, tagged or untagged Pfu FEN-1 (.about.23
ng), PEF (1 ng) (described in WO 98/42860), .beta.-Actin primers
(300 nM each), and fluorogenic probe having a secondary structure
that changes upon binding of the probe to the target .beta.-actin
nucleic acid sequence are prepared. 10 ng of human genomic DNA
(Promega) is used as the target nucleic acid in each reaction.
Reactions are performed in a 50 .mu.l volume. Negative control
reactions comprising a Pfu polymerase deficient in both 5' to 3'
and 3' to 5' exonuclease activities alone or containing all of the
components except the human genomic DNA template are also prepared.
A reaction mixture containing 2.5 Units of Taq 2000 is prepared and
used as a positive control. During the PCR reaction, there is
simultaneous formation of a cleavage structure, amplification of
the .beta.-actin target sequence and cleavage of the cleavage
structure. Thermocycling parameters are selected such that cleavage
of the cleavage structure is performed at a cleaving temperature,
and the secondary structure of the probe, when not bound to the
target nucleic acid is stable at or below the cleaving temperature.
Reactions are analyzed in a spectrofluorometric thermocycler (ABI
7700). Thermocycling parameters are 95.degree. C. for 2 min and 40
cycles of 95.degree. C. for 15 sec, 60.degree. C. for 60 sec and
72.degree. C. for 15 sec.
[0537] Released, fluorescently labeled fragments are bound via the
binding moiety or tag present on the probe, to a capture element
bound to a solid support.
Example 13
[0538] An assay according to the invention involving rolling circle
amplification is performed using the human ornithine
transcarbamylase gene as a target, which is detected in human DNA
extracted from buffy coat by standard procedures. Target (400 ng)
is heat-denatured for 4 minutes at 97.degree. C., and incubated
under ligation conditions in the presence of two 5'-phosphorylated
oligonucleotides, an open circle probe and one gap oligonucleotide.
The open circle probe has the sequence:
[0539]
gaggagaataaaagtttctcataagactcgtcatgtctcagcagcttctaacggtcactaatacga-
ctcactataggttctgcctctgggaa cac (SEQ ID NO: 46), the gap nucleotide
for the wild-type sequence is: tagtgatc. FIGS. 7 and 8 depict
rolling circle probes and rolling circle amplification. The
reaction buffer (40 ul) contains 5 units/.mu.l of T4 DNA ligase
(New England Biolabs), 10 mM Tris-HCl, pH 7.5, 0.2 M NaCl, 10 mM
MgCl.sub.2, 4 mM ATP, 80 nM open circle probe and 100 nM gap
oligonucleotide. After incubation for 25 minutes at 37.degree. C.,
25 ul are removed and added to 25 ul of a solution containing 50 mM
Tris-HCl, pH 7.5, 10 mM MgCl.sub.2, 1 mM DTT, 400 .mu.M each of
dTTP, dATP, dGTP, dCTP, 0.2 .mu.M rolling circle replication
primer: gctgagacatgacgagtc (SEQ ID NO: 47), phi29 DNA polymerase
(160 ng/50 ul). The sample is incubated for 30 minutes at
30.degree. C.
[0540] RNA is produced from a T7 promoter present in the open
circle probe, by the addition of a compensating buffer (a stock
solution or concentrate) that is diluted to achieve the following
concentration of reagents: 35 mM Tris-HCl, pH 8.2, 2 mM spermidine,
18 mm MgCl.sub.2, 5 mM GMP, 1 mM of ATP, CTP, GTP, 333 uM UTP, 667
uM Biotin-16-UTP, 0.03% Tween 20, 2 units per ul of T7 RNA
polymerase. RNA production is performed as described in US
5,858,033. The incubation is allowed to proceed for 90 minutes at
37.degree. C.
[0541] Five .mu.l of each sample (the actual test sample, a (-)
ligase control sample, a (-) phi29 DNA polymerase control and a
(-)T7 RNA polymerase control) in duplicate are removed for
detection. The reverse transcription process includes the steps of
A) ligating the open circle, B) synthesizing rolling circle single
stranded DNA, C) making RNA (from a T7 promoter present in the open
circle probe), D) reverse transcribing the RNA to make cDNA, and E)
performing PCR amplification of the cDNA using primers and probes
for generation of an detection of FEN cleavage structures,
according to the invention. For reverse transcription, the reagents
and protocols supplied with the Stratagene Sentinel Single-Tube
RT-PCR Core Reagent Kit (Cat# 600505) are used, except for the
substitution of equal amounts of Yaq DNA polymerase for the Taq
2000 DNA polymerase which is recommended by the manufacturer. Each
reaction contains 1.times.Sentinel molecular beacon RT-PCR core
buffer, 3.5 mM MgCl.sub.2, 200 .mu.M of each dNTP, 5 units exo-Pfu,
23 ng Pfu FEN-1, 1 ng PEF, 500 nM each of the upstream primer:
aagtttctcataagactcgtcat (SEQ ID NO: 48), the reverse primer:
aggcagaacctatagtgagtcgt (SEQ ID NO: 49), and the fluorogenic probe
(for example labeled with FAM-DABCYL) having a secondary structure,
as defined herein, that changes upon binding to the target nucleic
acid and further comprising a binding moiety. The reactions are
subjected to incubation for 30 minutes at 45.degree. C., 3 minutes
at 95.degree. C., followed by one cycle in a thermal cycler: 2
minutes at 95.degree. C., 1 minute at 50.degree. C., 1 minute at
72.degree. C. The fluorescence in then determined in a fluorescence
plate reader, such as Stratagene's FluorTracker or PE Biosystems'
7700 Sequence Detection System in Plate-Read Mode.
[0542] A crosscheck for the efficiency of detection is possible
because of the incorporation of Biotin-16-UTP in the rolling circle
amplification RNA product. An aliquot of the reactions is captured
on glass slides (or alternatively in microwell plates) using an
immobilized capture probe. Detection of the captured RNA amplicon
is described in detail in U.S. Pat. No. 5,854,033, hereby
incorporated by reference.
OTHER EMBODIMENTS
[0543] Other embodiments will be evident to those of skill in the
art. It should be understood that the foregoing detailed
description is provided for clarity only and is merely exemplary.
The spirit and scope of the present invention are not limited to
the above examples, but are encompassed by the following claims.
Sequence CWU 1
1
49 1 43 DNA Artificial oligonucleotide Heltest 4 oligonucleotide
for FEN endonuclease activity assay (1)..(43) 1 aaaataaata
aaaaaaatac tgttgggaag ggcgatcggt gcg 43 2 18 DNA artificial
cleavage product of oligonucleotide Heltest4 cleavage product of
oligonucleotide Heltest4 (1)..(18) 2 aaaataaata aaaaaaat 18 3 23
DNA artificial FENAS primer FENAS primer (1)..(23) 3 ccattcgcca
ttcaggctgc gca 23 4 21 DNA Escherichia coli Lac repressor binding
site (1)..(21) 4 aattgtgagc ggataacaat t 21 5 21 DNA Escherichia
coli Lac repressor binding site (1)..(21) 5 ttaacactcg cctattgtta a
21 6 16 DNA Escherichia coli CAP DNA binding site (1)..(16) 6
tgtgagttag ctcact 16 7 16 DNA Escherichia coli CAP DNA binding site
(1)..(16) 7 acactcaatc gagtga 16 8 17 DNA Bacteriophage lambda
lambda repressor DNA binding site (1)..(17) lambda repressor DNA
binding site 8 tatcaccgcc agaggta 17 9 17 DNA Bacteriophage lambda
lambda repressor DNA binding site (1)..(17) 9 atagtggcgg tctccat 17
10 17 DNA Saccharomyces sp. GAL4 DNA binding site (1)..(17) 10
cggaggactg tcctccg 17 11 17 DNA Saccharomyces sp. GAL4 DNA binding
site (1)..(17) 11 gcctcctgac aggaggc 17 12 9 DNA Saccharomyces sp.
MAT alpha 2 DNA binding site (1)..(9) 12 catgtaatt 9 13 9 DNA
Saccharomyces sp. MAT alpha 2 DNA binding site (1)..(9) 13
gtacattaa 9 14 9 DNA Saccharomyces sp. GCN4 DNA binding site
(1)..(9) 14 atgactcat 9 15 9 DNA Saccharomyces sp. GCN4 DNA binding
site (1)..(9) 15 tactgagta 9 16 10 DNA Drosophila sp. Kruppel DNA
binding site (1)..(10) 16 aacgggttaa 10 17 10 DNA Drosophila sp.
Kruppel DNA binding site (1)..(10) 17 ttgcccaatt 10 18 9 DNA
Drosophila sp. bicoid DNA binding site (1)..(9) 18 gggattaga 9 19 9
DNA Drosophila sp. bicoid DNA binding site (1)..(9) 19 ccctaatct 9
20 6 DNA Homo sapiens SP1 DNA binding site (1)..(6) 20 gggcgg 6 21
6 DNA Homo sapiens SP1 DNA binding site (1)..(6) 21 cccgcc 6 22 8
DNA Homo sapiens Oct1 DNA binding site (1)..(8) 22 atgcaaat 8 23 8
DNA Homo sapiens Oct-1 DNA binding site (1)..(8) 23 tacgttta 8 24 6
DNA Homo sapiens GATA-1 DNA binding site (1)..(6) 24 tgatag 6 25 6
DNA Homo sapiens GATA-1 DNA binding site (1)..(6) 25 actatc 6 26 20
DNA synthetic probe (1)..(20) 26 agctactgat gcagtcacgt 20 27 20 DNA
artificial capture element probe (1)..(20) capture element 27
tcgatgacta cgtcagtgca 20 28 21 DNA Escherichia coli lac repressor
DNA binding site (complimentary strand) (1)..(21) 28 ttaacactcg
cctattgtta a 21 29 49 DNA Artificial primer pCAL-n-EK cloning
oligonucleotide (1)..(49) 29 gacgacgaca agatgggtgt cccaattggt
gagattatac caagaaaag 49 30 56 DNA Artificial primer pCAL-n-EK
cloning oligonucleotide (1)..(56) 30 ggaacaagac ccgtttatct
cttgaaccaa ctttcaaggg ttgattgttt tccact 56 31 19 DNA artificial
synthetic DNA Universal hairpin probe b171 (1)..(19) Universal
hairpin probe b171consists of a 5' terminal T attached to a
fluorophor FAM group and a 3' terminal A attached to a quencher
Dabcyl group. 31 tcgcagtgtc gacctgcgc 19 32 40 DNA artificial
synthetic DNA probe SP170a (1)..(40) Probe 2 or SP170a consists of
a stem-loop comprising two domains the 5' two thirds have a
(universal) sequence complementary to the hairpin probe 1 (SEQ ID
NO 31), and nucleotides that will stop the DNA polymerase, and the
3' one third , which serves as the target specific primer. X any
nucleotid 32 cagccgtcga tccgcaggtc gacactgccg tcgacggctg 40 33 12
DNA artificial synthetic DNA Sequence of top strand synthesized
from reverse prime (1)..(12) Sequence of top strand synthesized
from reverse primer (3' one third of probe 2, SP170a, SEQ ID NO 32
33 gcagctgccg ac 12 34 30 DNA artificial synthetic DNA 5' two
thirds of probe 2 (SEQ ID NO 32) (1)..(30) 5' two thirds of probe 2
(SEQ ID NO 32) containing sequences that are complimentary to the
universal hairpin probe 1 (b171, SEQ ID NO 31 34 tccgcaggtc
gacactgccg tcgacggctg 30 35 15 DNA Artificial primer B1 primer
(1)..(15) 35 cgatcgagca agcca 15 36 14 DNA Artificial primer primer
B2 (1)..(14) 36 cgagccgctc gctg 14 37 40 DNA Artificial primer
primer S1 (1)..(40) 37 accgcatcga atgcatgtct cgggtaaggc gtactcgacc
40 38 80 DNA Artificial primer primer S2 (1)..(40) 38 cgattccgct
ccagacttct cgggtgtact gagatcccct accgcatcga atgcatgtct 60
cgggtaaggc gtactcgacc 80 39 20 DNA Artificial primer 39 aaggcgtact
cgacctgaaa 20 40 21 DNA Artificial primer probefluorogenic
(1)..(21) 40 accatacgga taggggatct c 21 41 20 DNA Artificial
synthetic DNA 41 gcaaagtatc atccctccag 20 42 120 DNA Artificial
synthetic amplification product target synthetic (1)..(120) 42
cctctgcaga ctactattac ataatacgac tcactatagg gatctgcacg tattagccta
60 tagtgagtcg tattaatagg aaacaccaaa gatgatattt cgtcacagca
agaattcagg 120 43 20 DNA Artificial synthetic DNA target DNA P1
(1)..(20) 43 cctctgcaga ctactattac 20 44 20 DNA Artificial
synthetic DNA target DNA P2 (1)..(20) 44 cctgaattct tgctgtgacg 20
45 24 DNA Artificial synthetic DNA probe fluorogenic (1)..(24) 45
taggaaacac caaagatgat attt 24 46 95 DNA Artificial synthetic circle
probe open (1)..(95) 46 gaggagaata aaagtttctc ataagactcg tcatgtctca
gcagcttcta acggtcacta 60 atacgactca ctataggttc tgcctctggg aacac 95
47 18 DNA Artificial synthetic circle replication primer rolling
(1)..(18) 47 gctgagacat gacgagtc 18 48 23 DNA Artificial synthetic
primer upstream (1)..(23) 48 aagtttctca taagactcgt cat 23 49 23 DNA
Artificial synthetic primer reverse (1)..(23) 49 aggcagaacc
tatagtgagt cgt 23
* * * * *