U.S. patent application number 11/638664 was filed with the patent office on 2007-08-09 for immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity.
This patent application is currently assigned to Cytos Biotechnology AG. Invention is credited to Martin F. Bachmann, Indulis Cielens, Conrad Johannes Coester, Klaus Dietmeier, Sebastian Fuchs, Vania Manolova, Patrik Maurer, Paul Pumpens, Regina Renhofa, Wolfgang Renner, Alain Tissot, Yu Zou.
Application Number | 20070184068 11/638664 |
Document ID | / |
Family ID | 37891967 |
Filed Date | 2007-08-09 |
United States Patent
Application |
20070184068 |
Kind Code |
A1 |
Renner; Wolfgang ; et
al. |
August 9, 2007 |
Immunostimulatory nucleic acid packaged particles for the treatment
of hypersensitivity
Abstract
The application is related to compositions and methods for the
treatment of hypersensitivity, wherein the compositions comprise a
particle packaged with immunostimulatory nucleic acids. The
compositions of the invention are particularly useful in the
treatment of atopic eczema, asthma and IgE-mediated allergy (type I
allergy), especially pollen allergy and house dust allergy.
Inventors: |
Renner; Wolfgang;
(Kilchberg, CH) ; Bachmann; Martin F.; (Seuzach,
CH) ; Cielens; Indulis; (Riga, LV) ; Coester;
Conrad Johannes; (Neuhof, DE) ; Dietmeier; Klaus;
(Zurich, CH) ; Fuchs; Sebastian; (Munchen, DE)
; Manolova; Vania; (Zurich, CH) ; Maurer;
Patrik; (Winterthur, CH) ; Pumpens; Paul;
(Riga, LV) ; Renhofa; Regina; (Riga, LV) ;
Tissot; Alain; (Zurich, CH) ; Zou; Yu;
(Birmensdorf, CH) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX P.L.L.C.
1100 NEW YORK AVENUE, N.W.
WASHINGTON
DC
20005
US
|
Assignee: |
Cytos Biotechnology AG
Zurich-Schlieren
CH
|
Family ID: |
37891967 |
Appl. No.: |
11/638664 |
Filed: |
December 14, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60750042 |
Dec 14, 2005 |
|
|
|
60812592 |
Jun 12, 2006 |
|
|
|
Current U.S.
Class: |
424/204.1 ;
514/44R; 977/802 |
Current CPC
Class: |
A61K 39/12 20130101;
A61K 49/0097 20130101; A61K 47/6901 20170801; A61P 27/14 20180101;
A61P 11/06 20180101; A61P 17/00 20180101; A61P 37/00 20180101; A61K
49/0004 20130101; B82Y 5/00 20130101; A61K 39/39 20130101; A61P
37/08 20180101; A61K 49/0093 20130101; A61P 17/04 20180101; A61P
37/04 20180101; A61P 43/00 20180101; A61K 2039/5258 20130101; C12N
2795/18123 20130101; A61K 47/6931 20170801; A61K 2039/55555
20130101; A61K 2039/55561 20130101; A61P 11/02 20180101 |
Class at
Publication: |
424/204.1 ;
514/044; 977/802 |
International
Class: |
A61K 48/00 20060101
A61K048/00; A61K 39/12 20060101 A61K039/12 |
Claims
1. A composition for use in a method of treating hypersensitivity
in an animal, wherein said composition comprises: (a) a particle;
and (b) an immunostimulatory nucleic acid; wherein said particle is
packaged with said immunostimulatory nucleic acid.
2. The composition of claim 1, wherein said particle is selected
from the group consisting of: (a) virus-like particle; (b) virus
particle; and (c) synthetic particle;
3. The composition of claim 1, wherein said particle is a
virus-like particle.
4. The composition of claim 3, wherein said virus-like particle is
a virus-like particle of a bacteriophage.
5. The composition of claim 3, wherein said virus-like particle is
a virus-like particle of a RNA bacteriophage.
6. The composition of claim 3, wherein said virus-like particle
comprises recombinant proteins, or fragments thereof, of a RNA
bacteriophage.
7. The composition of claim 3, wherein said virus-like particle
comprises coat proteins, or fragments thereof, of a RNA
bacteriophage.
8. The composition of claim 5, wherein said RNA bacteriophage is
selected from the group consisting of: (a) bacteriophage Q.beta.;
(b) bacteriophage R17; (c) bacteriophage fr; (d) bacteriophage GA;
(e) bacteriophage SP; (f) bacteriophage MS2; (g) bacteriophage M11;
(h) bacteriophage MX1; (i) bacteriophage NL95; (j) bacteriophage
f2; (k) bacteriophage PP7; and (l) bacteriophage AP205.
9. The composition of claim 5, wherein said RNA bacteriophage is
Q.beta..
10. The composition of claim 5, wherein said RNA bacteriophage is
AP205.
11. The composition of claim 5, wherein said RNA bacteriophage is
fr.
12. The composition of claim 5, wherein said RNA bacteriophage is
GA.
13. The composition of claim 1, wherein said particle is a
synthetic particle.
14. The composition of claim 13, wherein said synthetic particle is
selected from the group consisting of: (a) nanoparticle; (b)
microparticle; (c) liposome; and (d) virosome.
15. The composition of 1, wherein said particle is a
nanoparticle.
16. The composition of 15, wherein said nanoparticle comprises a
biodegradable material.
17. The composition of 16, wherein said biodegradable material is
selected from: (a) polyesters; (b) copolymers of polyesters; (c)
block copolymers of polyester and PEG; (d) polyorthoesters; (e)
poly(anhydrides); (f) poly(sebacic acid); (g) polyanhydrides based
on sebacic acid monomers incorporating amino acids; (h)
polyanhydride esters; (i) polyphosphazene, and (j) polyamide.
18. The composition of claim 15, wherein said particle is a
nanoparticle selected from the group consisting of: (a) pegylated
polyester nanoparticle; (b) polyalkylcyanoacrylate nanoparticle;
(c) pegylated polyalkylcyanoacrylate nanoparticle; (d) alginate-PLL
nanoparticle; (e) chitosan nanoparticle; (f) CaP-PAA nanoparticle;
(g) gelatine-cholamin nanoparticle; and (h) human serum albumin
nanoparticle.
19. The composition of claim 1, wherein said particle is
biodegradable.
20. The composition of claim 1, wherein said immunostimulatory
nucleic acid is capable of stimulating IFN-alpha production in a
cell.
21. The composition of claim 1, wherein said immunostimulatory
nucleic acid is selected from the group consisting of: (a)
desoxyribonucleic acid; (b) ribonucleic acid, (c) chimeric nucleic
acid; and (d) any mixtures of at least one nucleic acid of (a), (b)
and/or (c).
22. The composition of claim 1, wherein said immunostimulatory
nucleic acid is an unmethylated CpG containing oligonucleotide.
23. The composition of claim 22, wherein said unmethylated CpG
containing oligonucleotide is selected from the group consisting
of: (a) A-type CpG; and (b) C-type CpG.
24. The composition of claim 22, wherein said unmethylated
CpG-containing oligonucleotide is an A-type CpG.
25. The composition of claim 22, wherein said unmethylated
CpG-containing oligonucleotide comprises a palindromic
sequence.
26. The composition of claim 22, wherein the CpG motif of said
unmethylated CpG-containing oligonucleotide is part of a
palindromic sequence.
27. The composition of claim 25, wherein said palindromic sequence
is GACGATCGTC (SEQ ID NO:28).
28. The composition of claim 25, wherein said palindromic sequence
is flanked at its 5'-terminus and at its 3'-terminus by guanosine
entities.
29. The composition of claim 25, wherein said palindromic sequence
is flanked at its 5'-terminus by at least 3 and at most 15
guanosine entities, and wherein said palindromic sequence is
flanked at its 3'-terminus by at least 3 and at most 15 guanosine
entities.
30. The composition of claim 22, wherein said unmethylated
CpG-containing oligonucleotide comprises or alternatively consists
of the sequence selected from the group consisting of:
TABLE-US-00039 (SEQ ID NO:32) (a) "G6-6" GGGGGGGACGATCGTCGGGGGG;
(SEQ ID NO:33) (b) "G7-7" GGGGGGGGACGATCGTCGGGGGGG (SEQ ID NO:25)
(c) "G8-8" GGGGGGGGGACGATCGTCGGGGGGGG; (SEQ ID NO:26) (d) "G9-9"
GGGGGGGGGGACGATCGTCGGGGGGGGG; and (SEQ ID NO:27) (e) "G10"
GGGGGGGGGGGACGATCGTCGGGGGGGGGG.
31. The composition of claim 22, wherein said unmethylated
CpG-containing oligonucleotide comprises the sequence
GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO:27).
32. The composition of claim 22, wherein said unmethylated
CpG-containing oligonucleotide consists exclusively of
phosphodiester bound nucleotides.
33. The composition of claim 22, wherein said immunostimulatory
nucleic acid, preferably said unmethylated CpG-containing
oligonucleotide, is not accessible to DNAse hydrolysis.
34. The composition of claim 1, wherein said immunostimulatory
nucleic acid is an unmethylated CpG-containing oligonucleotide, and
wherein said unmethylated CpG-containing oligonucleotide is not
accessibly to Benzonase hydrolysis.
35. The composition of claim 1, wherein said immunostimulatory
nucleic acid is an unmethylated CpG containing oligonucleotide
consisting of the sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID
NO:27), and wherein said unmethylated CpG-containing
oligonucleotide consists exclusively of phosphodiester bound
nucleotides.
36. The composition of claim 1, wherein said immunostimulatory
nucleic acid is a double stranded ribonucleic acid, wherein said
double stranded ribonucleic acid is poly(I:C) or a derivative
thereof.
37. The composition of claim 1, wherein said hypersensitivity is
selected from the group consisting of (a) allergy; and (b)
non-allergic hypersensitivity.
38. The composition of claim 1, wherein said hypersensitivity is an
allergy.
39. The composition of claim 38, wherein said allergy is an
IgE-mediated allergy.
40. The composition of claim 1, wherein said hypersensitivity is
asthma.
41. The composition of claim 40, wherein said asthma is
IgE-mediated asthma.
42. The composition of claim 1, wherein said hypersensitivity is
dermatitis.
43. The composition of claim 42, wherein said dermatitis is an
atopic eczema.
44. The composition of claim 1, wherein said hypersensitivity is an
IgE-mediated allergy (type I allergy).
45. The composition of claim 1, wherein said hypersensitivity is an
IgE-mediated allergy against a naturally occurring allergen.
46. The composition of claim 44, wherein said IgE-mediated allergy
is selected from the group consisting of: (a) pollen allergy (hay
fever); (b) house dust allergy; (c) food allergy; (d) drug allergy;
(e) insect venom allergy, preferably bee venom allergy; and (f)
animal allergy, preferably cat allergy.
47. The composition of claim 44, wherein said IgE-mediated allergy
is pollen allergy or house dust allergy.
48. The composition of claim 1, wherein said animal is a human.
49. The composition of claim 1, wherein said composition is free of
an allergen or an allergen extract.
50. A pharmaceutical composition comprising: (a) the composition of
claim 1; and (b) an adjuvant, preferably an aluminium containing
adjuvant, most preferably alhydrogel.
51. A pharmaceutical composition for use in a method for treating
hypersensitivity in an animal, said pharmaceutical composition
comprising: (a) the composition of claim 1; and (b) an adjuvant,
preferably an aluminium containing adjuvant, most preferably
alhydrogel.
52. A method of treating hypersensitivity in an animal, said method
comprising introducing into said animal the composition of claim
1.
53. The method of claim 52, wherein said composition is introduced
into said animal subcutaneously, intramuscularly, intravenously,
intranasally or directly into the lymph node.
54. The method of claim 52, wherein said animal is a mammal,
preferably a human.
55. The method of claim 52, wherein said introducing into said
animal is repeated at least twice, preferably three times in
intervals of 1 week to 3 months, preferably in intervals of 2
weeks.
56. The method of claim 52, wherein said introducing into said
animal is repeated 6 times in weekly intervals, wherein preferably
each time 50 .mu.g to about 500 .mu.g, most preferably about 300
.mu.g, of said composition are introduced.
57. The method of claim 52, wherein said composition is introduced
in said animal without an allergen or allergen extract.
58. The method of claim 52, wherein said composition is introduced
in said animal without administration of an allergen or allergen
extract.
59. The method of claim 52, wherein said composition is not
introduced in said animal in conjunction with an allergen or
allergen extract.
60. The method of claim 52, wherein said composition is introduced
in said animal, and wherein said introduction of said composition
into said animal is effected such as an allergen or allergen
extract is not introduced in said animal for at least one week
before and at least one week after said introduction of said
composition in said animal.
61. The method of claim 52, wherein said composition is introduced
in said animal, and wherein said introduction of said composition
into said animal is effected such as an allergen or allergen
extract is not introduced in said animal for at least four weeks
before and at least four weeks after said introduction of said
composition in said animal.
62. The method of claim 52, wherein said composition is introduced
in said animal, and wherein said introduction of said composition
into said animal is effected such as an allergen or allergen
extract is not introduced in said animal for at least eight weeks
before and at least eight weeks after said introduction of said
composition in said animal.
63. The method of claim 52, wherein said composition is introduced
in said animal, and wherein said introduction of said composition
into said animal is effected such as an allergen or allergen
extract is not introduced at all in said animal.
64. (canceled)
65. (canceled)
66. The method of claim 52, wherein said particle is a virus-like
particle of a RNA bacteriophage.
67. The method of claim 66, wherein said RNA bacteriophage is
Q.beta..
68. The method of claim 52, wherein said immunostimulatory nucleic
acid is an unmethylated CpG containing oligonucleotide.
69. The method of claim 52, wherein said immunostimulatory nucleic
acid is an unmethylated CpG containing oligonucleotide consisting
of the sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO:27), and
wherein said unmethylated CpG-containing oligonucleotide consists
exclusively of phosphodiester bound nucleotides.
70. The method of claim 52, wherein said hypersensitivity is an
allergy.
71. The method of claim 70, wherein said allergy is selected from
the group consisting of: (a) IgE-mediated asthma; (b) atopic
eczema; and (c) IgE-mediated allergy (type I allergy), preferably
pollen allergy or house dust allergy.
72. The method of claim 52, wherein said composition is free of an
allergen or an allergen extract.
73. (canceled)
74. (canceled)
75. (canceled)
76. (canceled)
77. (canceled)
78. (canceled)
79. (canceled)
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims the benefit of U.S.
Provisional Application No. 60/750,042, filed Dec. 14, 2005, and
U.S. Provisional Application No. 60/812,592, filed Jun. 12, 2005,
the disclosures of each of which are entirely incorporated herein
by reference in their entireties.
FIELD OF THE INVENTION
[0002] This invention relates to the field of immunology and the
treatment of hypersensitivity by immunologically active
compositions. The compositions of the invention comprise particles,
preferably virus-like particles, nanoparticles, microparticles or
liposomes which are packaged with an immunostimulatory nucleic
acid. The compositions of the invention are useful in the treatment
of hypersensitivity, preferably allergy, including diseases such as
atopic eczema, asthma and IgE-mediated allergy (type-I allergy),
especially pollen allergy (hay fever). The invention therefore also
provides methods for the treatment of these diseases.
SUMMARY OF THE INVENTION
[0003] In a first aspect, the invention provides a composition for
use as a medicament, the composition comprising, essentially
consisting of, or consisting of a particle and an immunostimulatory
nucleic acid (ISS-NA), wherein said particle is packaged with said
ISS-NA.
[0004] It was surprisingly found that the inventive compositions
are useful in the prophylactic and therapeutic treatment of
hypersensitivity, preferably allergy. In a further aspect the
invention thus provides a composition for use in a method of
treating hypersensitivity, preferably allergy in an animal, the
composition comprising a particle and immunostimulatory nucleic
acid (ISS-NA), wherein said particle is packaged with said ISS-NA.
In a specific aspect the invention provides a composition for use
in a method of treating hypersensitivity, preferably allergy in an
animal, the composition comprising a virus-like particle and an
unmethylated CpG-containing oligonucleotide, wherein said
virus-like particle is packaged with said unmethylated
CpG-containing oligonucleotide. In a preferred embodiment said
hypersensitivity is an allergy, preferably IgE-mediated asthma,
atopic eczema or IgE-mediated allergy (type I allergy). In a
further preferred embodiment said particle is selected from a
nanoparticle, a microparticle and a liposome. In a further
preferred embodiment said particle is a VLP, preferably a VLP of an
RNA-bacteriophage, again preferably a VLP of bacteriophage Q.beta..
In a further preferred embodiment said unmethylated CpG-containing
oligonucleotide exclusively consists of phosphodiester bound
nucleotides, most preferably of G10 (SEQ ID NO:27).
[0005] In a further aspect the invention provides a process of
producing a composition for use in a method of treating
hypersensitivity in an animal, said composition comprising (a) a
virus-like particle; and (b) an unmethylated CpG-containing
oligonucleotide; wherein said virus-like particle (a) is packaged
with said unmethylated CpG-containing oligonucleotide (b), said
process comprising the steps of (i) incubating said VLP (a) with
said unmethylated CpG-containing oligonucleotide (b); (ii) adding
RNase; and (iii) purifying said composition.
[0006] In a further aspect, the invention provides a process of
producing a composition for use in a method of treating
hypersensitivity in an animal, said composition comprising (a) a
virus-like particle; and (b) an unmethylated CpG-containing
oligonucleotide; wherein said virus-like particle (a) is packaged
with said unmethylated CpG-containing oligonucleotide (b), said
process comprises the steps of (i) incubating said VLP with RNase;
(ii) adding said unmethylated CpG-containing oligonucleotide; and
(iii) purifying the composition.
[0007] In a further aspect the invention provides a process of
producing a composition for use in a method of treating
hypersensitivity in an animal, said composition comprising (a) a
virus-like particle; and (b) an unmethylated CpG-containing
oligonucleotide; wherein said virus-like particle (a) is packaged
with said unmethylated CpG-containing oligonucleotide (b) said
process comprising the steps of (i) disassembling said VLP; (ii)
adding said unmethylated CpG-containing oligonucleotide; and (iii)
reassembling said VLP.
[0008] In a further aspect the invention provides a process of
producing a composition for use in a method of treating
hypersensitivity in an animal, said composition comprising (a) a
virus-like particle; and (b) an unmethylated CpG-containing
oligonucleotide; wherein said virus-like particle (a) is packaged
with said unmethylated CpG-containing oligonucleotide (b) said
process comprises the steps of (i) incubating said VLP with
solutions comprising metal ions capable of hydrolyzing the nucleic
acids of said VLP; (ii) adding said unmethylated CpG-containing
oligonucleotide; and (iii) purifying said composition, wherein
preferably said metal ions of step (i) are selected from the group
consisting of (a) zinc (Zn) ions; (b) copper (Cu) ions; (c) iron
(Fe) ions; (d) any mixtures of at least one ion of (a), (b) and/or
(c). In a preferred embodiment, said VLP is produced in a bacterial
expression system.
[0009] In a further aspect the invention provides a process of
producing a composition for use in a method of treating
hypersensitivity in an animal, said composition comprising (a) a
virus-like particle; and (b) an unmethylated CpG-containing
oligonucleotide; wherein said virus-like particle (a) is packaged
with said unmethylated CpG-containing oligonucleotide (b) said
process comprises the steps of (i) incubating said VLP under
alkaline conditions, preferably in the presence of NaOH, most
preferably in the presence of about 25 mM NaOH; (ii) adding said
unmethylated CpG-containing oligonucleotide; and (iii) purifying
said composition.
[0010] In a further aspect the invention provides a process of
producing a composition for use in a method of treating
hypersensitivity in an animal, said composition comprising (a) a
virus-like particle; and (b) an unmethylated CpG-containing
oligonucleotide; wherein said virus-like particle (a) is packaged
with said unmethylated CpG-containing oligonucleotide (b), said
process comprising the steps of (i) incubating said VLP with a
solution capable of destabilizing said VLP, wherein preferably said
VLP is a VLP of bacteriophage Q.beta.; (ii) purifying the coat
protein from said solution; and (iii) reassembling said coat
protein to a VLP in the presence of unmethylated CpG-containing
oligonucleotide and an oxidizing agent.
[0011] In a further aspect the invention provides compositions for
use as a medicament, wherein said compositions are obtainable by a
process comprising the steps of (i) incubating a VLP with
unmethylated CpG-containing oligonucleotides; (ii) adding RNase;
and (iii) purifying said composition.
[0012] In a further aspect the invention provides compositions for
use as a medicament, wherein said compositions are obtainable by a
process comprising the steps of (i) incubating a VLP with RNase;
(ii) adding unmethylated CpG-containing oligonucleotides; and (iii)
purifying the composition.
[0013] In a further aspect the invention provides compositions for
use as a medicament, wherein said compositions are obtainable by a
process comprising the steps of (i) disassembling a VLP; (ii)
adding unmethylated CpG-containing oligonucleotides; and (iii)
reassembling said VLP.
[0014] In a further aspect the invention provides compositions for
use as a medicament, wherein said compositions are obtainable by a
process comprising the steps of (i) incubating a VLP with solutions
comprising metal ions capable of hydrolyzing the nucleic acids of
said VLP; (ii) adding unmethylated CpG-containing oligonucleotides;
and (iii) purifying said composition.
[0015] In a further aspect the invention provides compositions for
use in a method of treating allergy in an animal, wherein said
compositions are obtainable by a process comprising the steps of
(i) incubating a VLP with unmethylated CpG-containing
oligonucleotides; (ii) adding RNase; and (iii) purifying said
composition.
[0016] In a further aspect the invention provides compositions for
use in a method of treating allergy in an animal, wherein said
compositions are obtainable by a process comprising the steps of
(i) incubating a VLP with RNase; (ii) adding unmethylated
CpG-containing oligonucleotides; and (iii) purifying the
composition.
[0017] In a further aspect the invention provides compositions for
use in a method of treating allergy in an animal, wherein said
compositions are obtainable by a process comprising the steps of
(i) disassembling a VLP; (ii) adding unmethylated CpG-containing
oligonucleotides; and (iii) reassembling said VLP.
[0018] In a further aspect the invention provides compositions for
use in a method of treating allergy in an animal, wherein said
compositions are obtainable by a process comprising the steps of
(i) incubating a VLP with solutions comprising metal ions capable
of hydrolyzing the nucleic acids of said VLP; (ii) adding
unmethylated CpG-containing oligonucleotides; and (iii) purifying
said composition.
[0019] In a further aspect the invention provides pharmaceutical
compositions comprising a composition of the invention.
[0020] In a further aspect the invention provides a method of
treating hypersensitivity, preferably allergy in an animal, said
method comprising introducing into said animal a composition of the
invention.
[0021] A further aspect of the invention is the use of a
composition of the invention or of a pharmaceutical composition of
the invention for the manufacture of a pharmaceutical for the
treatment of hypersensitivity in an animal, wherein preferably said
hypersensitivity is an allergy, wherein further preferably said
allergy is selected from the group consisting of: (a) IgE-mediated
asthma, (b) atopic eczema; and (c) IgE-mediated allergy (type I
allergy), preferably pollen allergy (hay fever) or house dust
allergy.
DETAILED DESCRIPTION OF THE FIGURES
[0022] FIG. 1: Characterization of purified Q.beta. coat protein by
analytical size exclusion chromatography. (A) sample of purified
Q.beta. VLP. The observed peak (ratio A260/A280=2) is dominated by
the RNA core of the VLP, because the absorption coefficient of RNA
at 260 nm is approx. 100 fold higher than the absorption
coefficient of the coat protein. (B) sample of the supernatant of
the disassembly reaction. Released coat protein is indicated by the
presence of the protein-like peak at approx. 12 min. Furthermore
several species of non-precipitated RNA molecules are present in
the range 6.8 to 11 min. (C) sample of purified Q.beta. coat
protein. Analysis was performed in PBS on column TSK G5000PWx1
(Tosoh Bioscience).
[0023] FIG. 2: Analytical size exclusion chromatography of (A)
native Q.beta. VLP, (D) Q.beta.G10 VLP and the packaging components
(B) oligo nucleotide G10 and (C) Q.beta. coat protein. The observed
peak for Q.beta.G10 VLP (D) (ratio A260/A280=1.74) is dominated by
the G10 core of the VLP, because the absorption coefficient of G10
at 260 nm is approx. 130 fold higher than the absorption
coefficient of the coat protein. Analysis was performed in PBS on
column TSK G5000PWx1 (Tosoh Bioscience).
[0024] FIG. 3: Non-reducing SDS-PAGE analysis of native Q.beta. VLP
and in vitro assembled Q.beta.G10. The position of the coat protein
pentamers and hexamers is indicated ((a) molecular weight marker,
(b) Q.beta. VLP, (c) Q.beta. G10).
[0025] FIG. 4: Ratio of the number of VLP+ cells at 2 h over the
number of VLP+ cells at 24 h in the myeloid-DC, lymphoid-DC,
Macrophage, pDC and B-cell populations after subcutaneous injection
in the footpad, as a measure of DC-mediated or free draining of VLP
to the Lymphnode. Anti-CD11c, -CD11b, -B220 and -CD19 antibodies
were used to identify myeloid- and lymphoid-DC, Macrophages, pDCs
and B cells by FACS analysis.
[0026] FIG. 5: Ratio between percentages of particle-positive DC
and macrophages. Mice were injected with nanoparticles of different
size. 48 h later cells were analyzed by FACS.
[0027] FIG. 6: Activation of BMDCs by Q.beta.G10. BMDCs were
activated by Q.beta.G10 and hence secreted IL-12 in a dose
dependent manner (dose is given as equivalent of G10
oligonucleotide packaged in the Q.beta. VLPs) while untreated
control cells did not secrete any IL-12.
DETAILED DESCRIPTION OF THE INVENTION
[0028] Unless defined otherwise, all technical and scientific terms
used herein have the same meanings as commonly understood by one of
ordinary skill in the art to which this invention belongs.
[0029] "hypersensitivity": In the context of the invention the term
"hypersensitivity" is to be understood as suggested in Johansson et
al. 2001, Allergy 56:813-824 as any objectively reproducible
symptom or signs, initiated by exposure to a defined stimulus at a
dose tolerated by normal subjects. Hypersensitivity reactions are
reproducible in the sense that there is reasonable evidence from
history, examination, or investigation of a link between the
symptoms and the environmental factors to which the patients
attribute their symptoms. The term hypersensitivity encompasses
non-allergic hypersensitivity and allergic hypersensitivity
(allergy). Non-allergic hypersensitivity is any hypersensitivity
which does not comprise an involvement of the immune system or at
least where no involvement of the immune system can be detected,
wherein allergic hypersensitivity always comprises an involvement
of the cellular or humoral immune system. Hypersensitivity
preferably refers to allergic and non-allergic forms of a disease
selected from the group consisting of: (a) asthma, (b) rhinitis,
(c) conjunctivitis, (d) rhinoconjuctivitis, (e) dermatitis, (e)
urticaria, (e) food hypersensitivity, (e) drug hypersensitivity,
(e) insect sting or bite hypersensitivity, and (e) anaphylaxis. In
particular, hypersensitivity also includes any type of allergy.
[0030] Further preferably, hypersensitivity refers to allergic
forms of a disease selected from the group consisting of: (a)
asthma, (b) rhinitis, (c) conjunctivitis, (d) rhinoconjuctivitis,
(e) dermatitis, (e) urticaria, (e) food hypersensitivity, (e) drug
hypersensitivity, (e) insect sting or bite hypersensitivity, and
(e) anaphylaxis. In particular, hypersensitivity also includes any
type of allergy.
[0031] "allergy": In the context of the application the term
"allergy" stands for "allergic hypersensitivity" and is to be
understood as suggested by Johansson et al. 2001, Allergy
56:813-824 and Johannson et al. 2004, J. Allergy Clin. Immunol.
113(5) 832-835. Unless otherwise indicated, the application follows
the nomenclature for allergy as set forth therein. Allergy or
allergic hypersensitivity is a hypersensitivity reaction initiated
by immunologic mechanisms in response to a substance (allergen),
often in a genetically predisposed individual (atopy). Allergy can
be antibody- or cell-mediated. In most patients, the antibody
typically responsible for an allergic reaction belongs to the IgE
isotype (see "antibodies") and these patients may be said to suffer
from IgE-mediated allergy (type-I allergy). It must be noted that
not all IgE-mediated allergic reactions occur in atopic subjects.
In non IgE-mediated allergy, the antibody may belong to the IgG
isotype. Thus, within the meaning of the application, "allergy"
refers to both, IgE-mediated allergy (type-I allergy) and non
IgE-mediated allergy. IgE-mediated allergy is preferably addressed
by the invention. Therefore, in the context of the invention
allergy preferably refers to IgE-mediated allergy. Allergies are
classified according to the source of the antigen evoking the
hypersensitive reaction. In one embodiment allergy is selected from
(a) food allergy, (b) drug allergy, (c) house dust allergy, (d)
insect venom or bite allergy, and (e) pollen allergy.
Alternatively, allergies are classified based on the major symptoms
of the hypersensitive reaction. Thus, in another embodiment allergy
refers to any allergic form of a disease selected from the group of
(a) asthma, (b) rhinitis, (c) conjunctivitis, (d)
rhinoconjuctivitis, (e) dermatitis, (f) urticaria and (g)
anaphylaxis.
[0032] "type-I allergy": the terms "type-I allergy" and
"IgE-mediated allergy" are used interchangeably and relate to
IgE-mediated hypersensitivities to allergens. Preferred embodiments
of the invention relate to IgE-mediated allergy selected from the
group consisting of (a) pollen allergy (hay fever); (b) house dust
allergy; (c) food allergy; (d) drug allergy; (e) insect venom or
bite allergy, preferably bee venom allergy; and (f) animal allergy,
preferably cat allergy.
[0033] "hay fever": typical form of an IgE-mediated allergy (type-I
allergy) against pollen which may comprise rhinitis, conjunctivitis
and/or asthma, wherein asthma preferably occurs in chronic forms of
hay fever.
[0034] "atopy", "atopic diseases": Atopy is a personal or familial
tendency to produce IgE antibodies in response to low doses of
allergens, usually proteins, and to develop typical symptoms such
as asthma, rhinoconjunctivitis, or eczema/dermatitis. The first
manifestations of atopy in a child are often allergic symptoms,
such as diarrhea, wheezing, and skin rashes, and only later can the
responsible IgE antibody be detected. Allergic symptoms in a
typical atopic individual may be referred to as atopic. In one
embodiment of the invention hypersensitivity is an atopic disease,
preferably an atopic disease selected from the group consisting of
(a) atopic asthma, (b) atopic eczema, (c) atopic IgE-mediated
allergy, preferably pollen allergy (hay fever), house dust allergy
or house dust mite allergy. In one embodiment the application
relates to IgE-mediated allergy in general, irrespective of whether
or not said IgE-mediated allergy is regarded as atopic or non
atopic allergy. However, specifically preferred embodiments of the
invention relate to atopic allergy, preferably to IgE-mediated
atopic allergy.
[0035] "rhinitis": The term "rhinitis" relates to hypersensitivity
symptoms from the nose, for example, itching, sneezing, increased
secretion, and blockage. Rhinitis relates to non-allergic as well
as allergic, i.e. immunologically mediated, rhinitis. Preferred
embodiments of the invention relate to allergic rhinitis,
preferably to IgE-mediated and non IgE-mediated forms of allergic
rhinitis. Specifically preferred embodiments relate to IgE-mediated
allergic rhinitis.
[0036] "conjunctivitis": The term conjunctivitis relates to
irritations of the eye which can be of allergic as well as
non-allergic origin, wherein allergic conjunctivitis encompasses
IgE-mediated and non IgE-mediated allergic conjunctivitis. Allergic
conjunctivitis, especially IgE mediated allergic conjunctivitis is
commonly accompanied by allergic rhinitis, so this disorder is
appropriately termed allergic rhinoconjuctivitis. Besides
IgE-mediated conjunctivitis, contact allergic conjunctivitis
involving TH1 mechanisms occurs. Non-allergic conjunctivitis also
often accompanies non-allergic rhinitis. Preferred embodiments of
the invention relate to allergic conjunctivitis, including
IgE-mediated and non IgE-mediated forms of allergic conjunctivitis.
Specifically preferred embodiments relate to IgE-mediated allergic
conjunctivitis. Further preferred embodiments relate to
IgE-mediated allergic rhinoconjunctivitis.
[0037] "asthma": Asthma or asthma bronchiale is a chronic
respiratory disease due to inflammation of the air passages in the
lungs and affects the sensitivity of the nerve endings in the
airways so they become easily irritated. In an attack, the lining
of the passages swell causing the airways to narrow and reducing
the flow of air in and out of the lungs. Asthma can occur in a
intermittent form (2 attacks per week or less during daytime, 2
attacks per month or less at night), in persistent form (permanent
attacks during daytime, frequent attacks at night) and in any
intermediate form. Within the meaning of the application the term
asthma relates to non-allergic as well as to allergic asthma.
Preferred embodiments of the invention relate to allergic asthma,
including IgE-mediated and non IgE-mediated forms of asthma.
Specifically preferred embodiments relate to IgE-mediated allergic
asthma, most preferably to atopic asthma.
[0038] "atopic asthma": IgE-mediated form of asthma in patients
with a genetic predisposition which often occurs in conjunction
with atopic eczema and IgE-mediated allergies, for example pollen
allergy (hay fever), house dust or dust mite.
[0039] "dermatitis": The term "dermatitis" relates to local
inflammation of the skin and encompasses, besides other forms,
"eczema" and "contact dermatitis" (see definitions below).
Preferred embodiments of the invention relate to dermatitis,
preferably to eczema and contact dermatitis.
[0040] "eczema": The term "eczema" relates to the atopic
eczema/dermatitis syndrome (AEDS), describing an aggregation of
several skin diseases with certain clinical characteristics in
common involving a genetically determined skin barrier defect. This
genetically determined target organ sensitivity constitutes the
basis for eczema. In children and young adults of the atopic
constitution, the underlying inflammation is dominated by an
IgE-antibody associated reaction (atopic eczema). In chronic cases,
the inflammation seems to be less influenced by IgE antibody, and
the dominating cells in biopsies are lymphocytes. Eczema relates to
non-allergic eczema and allergic eczema. Preferred embodiments of
the invention relate to eczema, preferably allergic eczema
including atopic (IgE-mediated) eczema and non atopic forms of
eczema. Most preferably, the invention relates to atopic
(IgE-mediated) eczema.
[0041] "contact dermatitis": The term "contact dermatitis" relates
to local inflammatory reaction in the skin caused by close contact
with low molecular weight chemicals or irritants. Contact
dermatitis can be of allergic as well as non-allergic nature.
Allergic contact dermatitis is mediated by immunological
mechanisms, predominantly TH1 lymphocytes. Typical allergens acting
as haptens and causing allergic contact dermatitis are nickel,
chromium ions, fragrances, preservatives, and urushiol, from the
poison ivy plant. Exposure can occur through oral uptake, so-called
systemic allergic contact dermatitis. A subgroup of contact
dermatitis, protein contact dermatitis, is an IgE-associated
reaction caused by absorption of proteins through damaged skin.
Preferred embodiments of the invention relate to contact
dermatitis, preferably allergic contact dermatitis. Further
preferred embodiments relate to protein contact dermatitis.
[0042] "urticaria": The term "urticaria" relates to a non
inflammatory reaction in the skin caused by an irritant or allergen
and includes non-allergic urticaria as well as allergic urticaria.
Allergic urticaria is mediated by immunological mechanisms, which
commonly is IgE-mediated but can also be immune complex-associated.
Urticaria can also develop locally after topical contact with the
allergen, as occurs on the hands of a person with latex allergy
wearing latex gloves or in a person with dog allergy licked by a
dog. Preferred embodiments of the invention relate to urticaria,
preferably allergic urticaria, most preferably IgE-mediated
allergic urticaria.
[0043] "food hypersensitivity": The term "food hypersensitivity"
relates to adverse reaction to food, which can be of non-allergic
as well as allergic nature. Allergic food hypersensitivities can be
IgE-madiated and are referred to as food allergies. Severe,
generalized allergic reactions to food can be classified as
anaphylaxis (see below). Preferred embodiments of the invention
relate to food allergy, preferably to IgE-mediated food
allergy.
[0044] "drug hypersensitivity": The term "drug hypersensitivity"
relates to hypersensitive reactions of the body towards drugs which
can be of non-allergic as well as of allergic nature. When
immunologic mechanisms have been shown, either antibody or cell
mediated, the reactions are referred to as drug allergy. Drug
allergies can be mediated by IgE. Preferred embodiments of the
invention relate to drug hypersensitivity, preferably to drug
allergy, most preferably to IgE-mediated drug allergy.
[0045] "insect sting hypersensitivity" or "insect bite
hypersensitivity": these terms relate to hypersensitive reactions
towards insect venom and saliva which can be of non-allergic as
well as allergic nature. Insect sting hypersensitivity or insect
bite hypersensitivity mediated by an immunologic mechanism is
referred to as venom or saliva allergy, as in bee venom allergy.
The large quantity of venom allergen in a sting is comparable with
years of inhaled pollen allergen. This high-dose sensitization
probably explains why there is no need for a genetic predisposition
for developing such an allergy. Preferred embodiments of the
invention relate to venom allergy, preferably to IgE-mediated venom
allergy, most preferably to IgE mediated bee venom allergy.
[0046] "anaphylaxis": The term "anaphylaxis" refers to a severe,
life-threatening, generalized or systemic hypersensitive reaction.
The reaction usually develops gradually, most often starting with
itching of the gums/throat, the palms, or the soles, and local
urticaria; developing to a multiple organ reaction often dominated
by severe asthma; and culminating in hypotension and shock.
Hypotension and severe bronchospasm do not have to be present for a
reaction to be classified as anaphylaxis. Anaphylaxis can be of
non-allergic as well as of allergic nature. Allergic anaphylaxis
involves an immunologic mechanism like an IgG immune complex,
complement related, or immune cell-mediated mechanism. Anaphylaxis
preferably relates to an anaphylactic reaction mediated by IgE
antibodies (IgE-mediated anaphylaxis), most preferably to
peanut-induced food anaphylaxis or bee venom-induced
anaphylaxis.
[0047] "allergen": The term "allergen" refers to a substance
causing allergy. Preferred allergens are allergens disclosed in
Shough, H. et al., REMINGTON'S PHARMACEUTICAL SCIENCES, 19th
edition, (Chap. 82), Mack Publishing Company, Mack Publishing
Group, Easton, Pa. (1995), the entire contents of which is hereby
incorporated by reference. Allergens serve as antigens in
vertebrate animals. The term "allergen", as used herein, also
refers to "allergen extracts" and "allergenic epitopes." Very
preferred allergens are selected from the group consisting of:
pollens (e.g. grass, ragweed, birch and mountain cedar); house dust
and dust mites; mammalian epidermal allergens and animal danders;
mold and fungus; insect bodies and insect venom; feathers; food;
and drugs (e.g. penicillin).
[0048] "allergen extracts"/"provocation test solutions": Allergen
extracts are components of provocation test solutions to be used
for conjunctival, nasal and bronchial challenges. Such allergen
extracts are commercially available and methods for producing such
extracts are well-known. Preferred are single allergen provocation
solutions comprising a single allergen extract which is prepared
from a source selected from the group consisting of (i) tree
species or a grass species, most preferably selected from the group
consisting of alder, ash, birch, hazel, orchard grass, velvet
grass, rye grass, timothy grass, Kentucky blue grass, Meadow
fescue, Bermuda grass, ragweed, rye and wheat; (ii) epithelia of
different animal species, preferably epithelia from an animal
species selected from the group consisting of cat, dog and horse;
(iii) moulds, preferably moulds selected from the group consisting
of aspergillus, candida, altemaria, and saccharomyces; and (iv)
mite species, preferably mite species selected from the group
consisting of Dermatophagoides farinae, Dermatophagoides
pteronyssinus and Acarus siro. Allergen extracts comprising
allergen mixtures can also be used in provocation test solutions.
Preferred are allergen mixtures of different grasses, preferably of
orchard grass, velvet grass, rye grass, timothy grass, Kentucky
blue grass and/or Meadow fescue. Further preferred are allergen
mixtures of grasses, cereals, different trees and/or animal hair.
Provocation solutions are usually prepared in physiological saline
and can be preserved by addition of 0.4% phenol.
[0049] "antibody": As used herein, the term "antibody" refers to
molecules belonging to the class of immunoglobulins which are
capable of binding an epitope or antigenic determinant.
[0050] "antigen": As used herein, the term "antigen" refers to a
molecule capable of being bound by an antibody or a T cell receptor
(TCR) if presented by MHC molecules. The term "antigen", as used
herein, also encompasses T-cell epitopes. An antigen is
additionally capable of being recognized by the immune system
and/or being capable of inducing a humoral immune response and/or
cellular immune response leading to the activation of B- and/or
T-lymphocytes. Antigens as used herein may also be mixtures of
several individual antigens. However "antigen" does not encompass
any of the components of the compositions of the invention. In
particular, the term "antigen" does not refer to the particle nor
to the ISS-NA of the invention. The term "antigen" also does not
refer to any component forming the particle of the invention, such
as, for example capsid protein.
[0051] "epitope": As used herein, the term "epitope" refers to
continuous or discontinuous portions of a polypeptide having
antigenic or immunogenic activity in an animal, preferably a
mammal, and most preferably in a human. An epitope is recognized by
an antibody or a T cell through its T cell receptor in the context
of an MHC molecule.
[0052] "immune response": As used herein, the term "immune
response" refers to a humoral immune response and/or cellular
immune response leading to the activation or proliferation of B-
and/or T-lymphocytes and/or antigen presenting cells and/or other
cells of the innate immune system, such as pDC. Alternatively, the
immune response may also result in an altered function of effector
cells, such as mast cells.
[0053] "inducing an immune response": A substance, preferably an
ISS-NA is capable of inducing an immune response when upon exposure
of a cell or an organism to said substance, preferably to an
effective amount of said substance, an immune response is
detectable in said cell or animal which does not occur in the
untreated control.
[0054] "stimulating production of IFN-alpha": The production of
IFN-alpha by a cell, preferably by a dendritic cell, after exposure
to a specific substance is a strong indication of an
immunostimulatory effect of said substance. Therefore, ISS-NA which
are capable of inducing the production of IFN-alpha are preferred
in the context of the invention. IFN-alpha production by a cell can
be determined by various methods generally known in the art,
preferably by a method selected from (a) ELISA, most preferably by
ELISA essentially as described in Example 14; (b) flow cytometry
analysis using fluorochrom-conjugated antibodies, preferably as
described in Example 14; and (c) cytopathicity inhibition
bioassays. A typical cytopathicity inhibition bioassay is based on
bovine MDBK cells infected with vesicular stomatitis virus, as
previously described in Pestka, S. (1986) "Interferon Standards and
General Abbreviations", in Methods in Enzymology, Academic Press,
New York 119, 14-23. In the context of the application a substance,
preferably an immunostimulatory nucleic acid, is regarded as being
"capable of stimulating IFN-alpha production", when the production
of IFN-alpha by a cell as detected by any one of the above
described methods, preferably by ELISA, most preferably as
described in Example 14, is significantly increased upon exposure
of said cell to said substance as compared to a control cell,
wherein typically and preferably, said IFN-alpha production is
increased by a factor of at least about 2, more preferably by a
factor of about 3 or more.
[0055] "enhancing an immune response": A substance which enhances
an immune response, refers to a substance, preferably to an ISS-NA,
which is capable of intensifying or modulating the immune response
of a cell or an animal upon exposure of said cell or said animal to
said substance, as compared to a suitable control. This observation
can relate to any parameter known in the art to be indicative for
an immune response, preferably to the formation of cytokines and to
cytotoxicity. For example, the lytic activity of cytotoxic T cells
can be measured, e.g. using a .sup.51Cr release assay, with and
without the substance, preferably the ISS-NA. The amount of the
substance at which the CTL lytic activity is enhanced as compared
to the CTL lytic activity without the substance is said to be an
amount sufficient to enhance the immune response. In a preferred
embodiment, the immune response is enhanced by a factor of at least
about 2, more preferably by a factor of about 3 or more. The amount
or type of cytokines secreted may also be altered. Alternatively,
the amount of antibodies induced or their subclasses may be
altered.
[0056] "Immunostimulatory nucleic acid (ISS-NA)": As used herein,
the term immunostimulatory nucleic acid refers to a nucleic acid
capable of inducing and/or enhancing an immune response. ISS-NA, as
used herein, comprise ribonucleic acids and in particular
desoxyribonucleic acids, wherein both, ribonucleic acids and
desoxyribonucleic acids may be either double stranded or single
stranded. Preferred ISS-NA are desoxyribonucleic acids, wherein
further preferably said desoxyribonucleic acids are single
stranded. Preferably, ISS-NA contain at least one CpG motif
comprising an unmethylated C. Very preferred ISS-NA comprise at
least one CpG motif, wherein said at least one CpG motif comprises
or preferably consist of at least one, preferably one, CG
dinucleotide, wherein the C is unmethylated. Preferably, but not
necessarily, said CG dinucleotide is part of a palindromic
sequence. ISS-NA not containing CpG motifs as described above
encompass, by way of example, nucleic acids lacking CG
dinucleotides, as well as nucleic acids containing CG dinucleotides
with a methylated C. The term "immunostimulatory nucleic acid" as
used herein also refers to nucleic acids that contain modified
bases, preferably 4-bromo-cytosine. Specifically preferred in the
context of the invention are ISS-NA which are capable of
stimulating IFN-alpha production in dendritic cells.
[0057] "oligonucleotide": As used herein, the term
"oligonucleotide" refers to a nucleic acid sequence comprising 2 or
more nucleotides, preferably at least about 6 nucleotides to about
100,000 nucleotides, more preferably about 6 to about 2000
nucleotides, and still more preferably about 6 to about 300
nucleotides, even more preferably about 20 to about 300
nucleotides, and even more preferably about 20 to about 100
nucleotides, and most preferably 20 to 40 nucleotides. Very
preferably oligonucleotides comprise about 30 nucleotides, more
preferably oligonucleotides comprise exactly 30 nucleotides, and
most preferably oligonucleotides consist of exactly 30 nucleotides.
The term oligonucleotide also refers to a nucleic acid comprising
more than 100 to about 2000 nucleotides, preferably more than 100
to about 1000 nucleotides, and more preferably more than 100 to
about 500 nucleotides.
[0058] Oligonucleotides are polyribonucleotides or
polydeoxribonucleotides and are preferably selected from (a)
unmodified RNA or DNA, and (b) modified RNA or DNA. The
modification may comprise the backbone or nucleotide analogues.
Oligonucleotides are preferably selected from the group consisting
of (a) single- and double-stranded DNA, (b) DNA that is a mixture
of single- and double-stranded regions, (c) single- and
double-stranded RNA, (d) RNA that is mixture of single- and
double-stranded regions, and (e) hybrid molecules comprising DNA
and RNA that are single-stranded or, more preferably,
double-stranded or a mixture of single- and double-stranded
regions. In a further embodiment oligonucleotides are
triple-stranded regions and higher-ordered structures comprising
RNA or DNA or both RNA and DNA. In further embodiments
oligonucleotide are synthetic, genomic or recombinant. Preferred
oligonucleotides are selected from the group consisting of
.lamda.-DNA, cosmid DNA, artificial bacterial chromosome, yeast
artificial chromosome and filamentous bacteriophage, preferably
M13. In one embodiment oligonucleotide refers to (a) DNA or RNA
containing at least one modified nucleotide or at least one
nucleotide analogue, or (b) to DNA or RNA with backbones modified
for stability or for other reasons. Preferred nucleotide
modifications/analogs are selected from the group consisting of (a)
peptide nucleic acid, (b) inosin, (c) tritylated bases, (d)
phosphorothioates, (e) alkylphosphorothioates, (f) 5-nitroindole
desoxyribofuranosyl, (g) 5-methyldesoxycytosine, and (h)
5,6-dihydro-5,6-dihydroxydesoxythymidine. Phosphothioated
nucleotides are protected against degradation in a cell or an
organism and are therefore preferred nucleotide modifications.
Further preferred are chemically, enzymatically or metabolically
modified forms of polynucleotides as typically found in nature, as
well as the chemical forms of DNA and RNA characteristic of viruses
and cells. Other nucleotide analogs or modifications will be
evident to those skilled in the art. However, unmodified
oligonucleotides consisting exclusively of phosphodiester bound
nucleotides, typically are more active as ISS-NA than modified
nucleotides and are therefore generally preferred in the context of
the invention. Most preferred are oligonucleotides consisting
exclusively of phosphodiester bound deoxinucleotides. Further
preferred are oligonucleotides capable of stimulating IFN-alpha
production in cells, preferably in dendritic cells. Very preferred
oligonucleotides capable of stimulating IFN-alpha production in
cells are selected from A-type CpGs and C-type CpGs.
[0059] "CpG motif": As used herein, the term "CpG motif" refers to
a pattern of nucleotides that includes an unmethylated central CpG,
i.e. the unmethylated CpG dinucleotide, in which the C is
unmethylated, surrounded by at least one base, preferably one or
two nucleotides, flanking (on the 3' and the 5' side of) the
central CpG. Typically and preferably, the CpG motif as used
herein, comprises or alternatively consists of the unmethylated CpG
dinucleotide and two nucleotides on its 5' and 3' ends. Without
being bound by theory, the bases flanking the CpG confer a
significant part of the activity to the CpG oligonucleotide.
[0060] "CpG"/"unmethylated CpG-containing oligonucleotide": As used
herein, the term "unmethylated CpG-containing oligonucleotide" or
"CpG" refers to an oligonucleotide, preferably to an
oligodesoxynucleotide, containing at least one CpG motif. Thus, a
CpG contains at least one unmethylated cytosine, guanine
dinucleotide. Preferred CpGs stimulate/activate, e.g. have a
mitogenic effect on, or induce or increase cytokine expression by,
a vertebrate bone marrow derived cell. For example, CpGs can be
useful in activating B cells, NK cells and antigen-presenting
cells, such as dendritic cells, monocytes and macrophages.
Preferably, CpG relates to an oligodesoxynucleotide, preferably to
a single stranded oligodesoxynucleotide, containing an unmethylated
cytosine followed 3' by a guanosine, wherein said unmethylated
cytosine and said guanosine are linked by a phosphate bond, wherein
preferably said phosphate bound is a phosphodiester bound or a
phosphothioate bound, and wherein further preferably said phosphate
bond is a phosphodiester bound. CpGs can include nucleotide analogs
such as analogs containing phosphorothioester bonds and can be
double-stranded or single-stranded. Generally, double-stranded
molecules are more stable in vivo, while single-stranded molecules
have increased immune activity. Preferably, as used herein, a CpG
is an oligonucleotide that is at least about ten nucleotides in
length and comprises at least one CpG motif, wherein further
preferably said CpG is 10 to 60, more preferably 15 to 50, still
more preferably 20 to 40, still more preferably about 30, and most
preferably exactly 30 nucleotides in length. A CpG may consist of
methylated and/or unmethylated nucleotides, wherein said at least
one CpG motif comprises at least one CG dinucleotide wherein the C
is unmethylated. The CpG may also comprise methylated and
unmethylated sequence stretches, wherein said at least one CpG
motif comprises at least one CG dinucleotide wherein the C is
unmethylated. Very preferred CpGs consist exclusively of
unmethylated nucleotides. Very preferably, CpG relates to a single
stranded oligodesoxynucleotide containing an unmethylated cytosine
followed 3' by a guanosine, wherein said unmethylated cytosine and
said guanosine are linked by a phosphodiester bound. Still more
preferably, CpG relates to a single stranded oligodesoxynucleotide
containing an unmethylated cytosine followed 3' by a guanosine,
wherein said unmethylated cytosine and said guanosine are linked by
a phosphodiester bound, and wherein said CpG consist exclusively of
unmethylated nucleotides. Most preferably, CpG relates to a single
stranded oligodesoxynucleotide of about 30 nucleotides in length,
containing an unmethylated cytosine followed 3' by a guanosine,
wherein said unmethylated cytosine and said guanosine are linked by
a phosphodiester bound, and wherein said CpG consist exclusively of
unmethylated nucleotides. The CpGs can include nucleotide analogs
such as analogs containing phosphorothioester bonds and can be
double-stranded or single-stranded. Generally, phosphodiester CpGs
are A-type CpGs as indicated below, while phosphothioester
stabilized CpGs are B-type CpGs or C-type CpGs. Preferred CpG
oligonucleotides in the context of the invention are A-type CpGs
and C-type CpG, most preferred are A-type CpGs.
[0061] "A-type CpG": As used herein, the term "A-type CpG" or
"D-type CpG" refers to an oligodesoxynucleotide (ODN) comprising at
least one CpG motif. A-type CpGs preferentially stimulate
activation of T cells and the maturation of dendritic cells and are
capable of stimulating IFN-alpha production. In A-type CpGs, the
nucleotides of the at least one CpG motif are linked by at least
one phosphodiester bond. A-type CpGs comprise at least one
phosphodiester bond CpG motif which may be flanked at its 5' end
and/or, preferably and, at its 3' end by phosphorothioate bound
nucleotides. Preferably, the CpG motif, and hereby preferably the
CG dinucleotide and its immediate flanking regions comprising at
least one, preferably two nucleotides, are composed of
phosphodiester nucleotides. Preferred A-type CpGs exclusively
consist of phosphodiester (PO) bond nucleotides. Further preferred
A-type CpGs do not comprise phosphothioate bounds. Typically and
preferably, the term "A-type CpG" or "D-type CpG" as used within
this specification, refers to an oligodesoxynucleotide (ODN)
comprising at least one CpG motif and having poly G motifs at the
5' and/or 3' ends. Typically and preferably, the poly G motif
comprises or alternatively consists of at least one, preferably at
least three, at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15
Gs (guanosines), most preferably by at least 10 Gs. In some
embodiments, the 5' and/or 3' ends, typically and preferably at
least one G of the poly G motifs at the 5' and/or 3' ends,
preferably at least two, three or four, even more preferably all Gs
of the poly G motif, are phoshorothioate modified. However, in a
very preferred embodiment, all Gs of the poly G motif are linked by
phosphodiester bonds. Preferably, the A-type CpG of the invention
comprises or alternatively consists of a palindromic sequence.
Typically and preferably, the CpG motif is part of said palindromic
sequence. Typically and preferably, all nucleotides, but at least
the CpG motif of the palindromic sequence, are composed of
phosphodiester nucleotides. Typically and preferably, the
palindromic sequence is SEQ ID NO:28. Very preferred A-type CpGs
are 16 to 30 nucleotides in length, consist exclusively of
phosphodiester bound nucleotides, comprise a palindromic sequence,
preferably the palindromic sequence of SEQ ID NO:28, and are
flanked at their 5' and at their 3' end by a poly G motif
consisting of 3 to 10 Gs.
[0062] "B-type CpG": As used herein, the term "B-type CpG" (K-type)
relates to a CpG oligonucleotide which predominantly or preferably
exclusively consists of modified nucleotides, preferably
phosphorothioate modified nucleotides. B-type CpGs stimulate
preferentially B-cell and to some extent NK-cell activation and
cytokine production.
[0063] "C-type CpG": As used herein, the term "C-type CpG" relates
to a CpG oligonucleotide which like a B-type oligonucleotide
predominantly or preferably exclusively consists of modified
nucleotides, preferably phosphorothioate modified nucleotides.
Examples of C-type CpGs have been described in WO2005/042018A2 and
in Vollmer et al. 2004, Eur. J. Immunol. 43:351-262 which are
incorporated herein by reference. Specific reference is made to SEQ
IDs NO: 1 to 69 of WO2005/042018A2. C-type CpGs combine effects of
A-type and B-type CpGs and stimulate B-cell or NK-cell activation
and IFN-alpha production, preferably IFN-alpha production in
dendritic cells. C-type CpCs which are capable of stimulating
IFN-alpha production, preferably in dendritic cells, are generally
preferred in the context of the invention. In contrast to A-type
CpGs, C-type CpGs do not typically comprise poly-G stretches.
C-type CpGs preferably comprise or alternatively consist of
palindromic sequences comprising CpG motifs, preferably palindromic
sequences as depicted in SEQ ID NOs:53 to 60. Further preferred
C-type CpGs comprise a sequence selected from the group consisting
of (a) TCGTCGTTTTA (SEQ ID NO:61), (b) CGGCGCCGTGCCG (SEQ ID NO:62)
and (c) CGGCGTCGTGCCG (SEQ ID NO:63), wherein the 5' end of said
C-type CpG preferably consists of SEQ ID NO:61 and/or wherein the
3' end of said C-type CpG preferably consists of a nucleotide
sequence selected from SEQ ID NO:62 and SEQ ID NO:63, most
preferably the 3' end of said C-type CpG consists of SEQ ID NO:63.
Further preferred C-type CpGs are selected from the group
consisting of (a) TCGTCGTTTTACGGCGCCGTGCCG (SEQ ID NO:64) and (b)
TCGTCGTTTTACGGCGTCGTGCCG (SEQ ID NO:65), wherein preferably all
nucleic acids of said C-type CpGs are phosphorothioate bound.
Further preferred C-type CpGs are selected from the group
consisting of (a) TCpGTCGTTTTACGGCGCCGTGCCG (SEQ ID NO:64); (b)
TCGTCGTTTTACpGGCpGCCpGTGCCG (SEQ ID NO:64); (c) TCGTCGTTT
TACpGGCGCCpGTGCCG (SEQ ID NO:64); (d) TCGTCpGTTTTACpGGCGCCpGTGCCG
(SEQ ID NO:64); wherein p indicates phosphodiester bounds while all
other nucleotides are phosphorothioate bound. C-type CpGs selected
from the group consisting of (a) TCGTCGTTTTCGGCGCGCGCCG (SEQ ID
NO:66); (b) TCGTCGTTTTCGACGGCCGTCG (SEQ ID NO:67); (c)
TCGTCGTTTTCCGGCGCGCCGG (SEQ ID NO:68); (d) TCGTCGTTTTCGGCGCGCGTCG
(SEQ ID NO:69); (e) TCGGCGCGCGCCGTCGTCGTTT (SEQ ID NO:70); (f)
TTGGCGCGCGCCGTCGTCGTTT (SEQ ID NO:71); (g) TCGTCGTTTTCGTCGGCCGCCG
(SEQ ID NO:72); (h) TCGTCGTTTTCGGCTTTTGCCG (SEQ ID NO:73); (i)
TCGTCGTTTTCGGCGTTTTTTT (SEQ ID NO:74); and (j)
TCGTCGTTTTCGGCGGCCGCCG (SEQ ID NO:75) are potent inducers of
IFN-alpha production (Vollmer et al. 2004, Eur. J. Immunol.
43:351-262, p. 253, see Table 1 therein) and are thus specifically
preferred immunostimulatory nucleic acids in the context of the
invention.
[0064] "palindromic sequence": A palindromic sequences is a
nucleotide sequence which, when existing in the form of a double
stranded nucleic acid with regular base pairing (A/T; C/G), would
consist of two single strands with identical sequence in 5'-3'
direction. An immunostimulatory nucleic acids of the invention
preferably comprises a palindromic sequence, preferably a
palindromic sequence consisting of at least 6, preferably of at
least 7, 8, 9 or 10, most preferably of exactly 10 nucleotides,
wherein most preferably said palindromic sequence preferably
comprises a CpG motif. Palindromic sequences of immunostimulatory
nucleic acids useful in the context of the invention are, for
example, described in Yamamoto et al. 1992, J. Immunol.
148(12):4072-4076 and Kuramoto et al. 1992, Jpn. J. Cancer Res.
83:1128-1131. Preferred palindromic sequences comprise a CpG motif
and are selected from the group consisting of (a) GACGTC (SEQ ID
NO:35), (b) AGCGCT (SEQ ID NO:36), (c) AACGTT (SEQ ID NO:37), (d)
ATCGAT (SEQ ID NO:38); (e) CGATCG (SEQ ID NO:39); (f) CGTACG (SEQ
ID NO:40); (g) CGCGCG (SEQ ID NO:41); (h) GCGCGC (SEQ ID NO:42);
(i) TCGCGA (SEQ ID NO:43); (j) ACGATCGT (SEQ ID NO:44); (k)
CGACGATCGTCG (SEQ ID NO:45); (l) CGACGACGATCGTCGTCG (SEQ ID NO:46);
(m) GACGATCGTC (SEQ ID NO:28), (n) CGACGACGATCGTCGTCG (SEQ ID
NO:47); (o) AACGTT (SEQ ID NO:48); (p) CAACGTTG (SEQ ID NO:49); (q)
ACAACGTTGT (SEQ ID NO:50); (r) AACAACGTTGTT (SEQ ID NO:51); (s)
CAACAACGTTGTTG (SEQ ID NO:52); (t) CGGCGCGCGCCG (SEQ ID NO:53); (u)
CGACGGCCGTCG (SEQ ID NO:54); (v) CCGGCGCGCCGG (SEQ ID NO:55); (w)
CGCGCG (SEQ ID NO:56), (x) CGGCGCGCGCCG (SEQ ID NO:57); (y)
GGCGCGCGCC (SEQ ID NO:58); (z) CGGCCG (SEQ ID NO:59); and (aa)
CGGCGGCCGCCG (SEQ ID NO:60). A-type CpGs preferably comprise a
palindromic sequence selected from palindromic sequences (a) to
(s), while C-type CpGs preferably comprise a palindromic sequence
selected from palindromic sequences (t) to (aa).
[0065] "packaged": The term "packaged" as used herein refers to the
state of an ISS-NA, in particular an unmethylated CpG-containing
oligonucleotide, in relation to the particle, in particular the
VLP. The term "packaged" as used herein refers to covalent binding,
preferably by chemically coupling. More preferably, the term
"packaged" refers to non-covalent binding, preferably to ionic
interactions, hydrophobic interactions, or hydrogen bonds. Covalent
bonds are preferably selected from the group consisting of ester,
ether, phosphoester, amide, peptide, imide, carbon-sulfur bonds,
and carbon-phosphorus bonds. Very preferably, the term "packaged"
as used herein refers to the enclosement, or partial enclosement,
of said ISS-NA within the particle. For example, the unmethylated
CpG-containing oligonucleotide can be enclosed by the VLP without
the existence of an actual binding, neither covalently nor
non-covalently, or with a non-covalent binding.
[0066] Typically and preferably, a particle packaged with ISS-NA
protects said ISS-NA from degradation, preferably from DNAse or
RNAse hydrolysis. Therefore, in the preferred meaning, the term
"packaged" indicates that the ISS-NA, preferably the unmethylated
CpG-containing oligonucleotide, in a packaged state is not
accessible to DNAse or RNAse hydrolysis. More preferably, the term
"packaged" indicates that the ISS-NA, preferably the unmethylated
CpG-containing oligonucleotide, is not accessible to DNAse
hydrolysis, wherein further preferably the DNAse is DNAseI or
Benzonase. Still more preferably, the term "packaged" indicates
that the unmethylated CpG-containing oligonucleotide is not
accessible to Benzonase hydrolysis.
[0067] The accessibility of the ISS-NA, in particular the of the
unmethyated CpG-containing oligonucleotide for DNAse (e.g. DNaseI
or Benzonase) is preferably assayed as described in Examples 11-17
of WO2003/024481A2 (see p. 111 therein). In a preferred meaning, a
VLP is regarded as being packaged with an unmethylated
CpG-containing oligonucleotide, when after treatment with Benzonase
(190 U Benzonase/mg capsid protein in a buffer comprising 2 mM
MgCl.sub.2, pH 7.2, 20-25.degree. C., 18 h) at least 90%,
preferably at least 95%, most preferably at least 98% of said
unmethylated CpG-containing oligonucleotide can be recovered from
said VLP (e.g. in an ethidiumbromide stained gel). It is apparent
for the artisan that such assays require appropriate controls and
may need to be adapted to the specific combination of VLP and
unmethylated CpG-containing oligonucleotide. In a more preferred
meaning, a VLP of an RNA bacteriophage is regarded as being
packaged with an unmethylated CpG-containing oligonucleotide, when
after treatment with Benzonase (190 U Benzonase/mg capsid protein
in a buffer comprising 2 mM MgCl.sub.2, pH 7.2, 20-25.degree. C.,
18 h) at least 90%, preferably at least 95%, most preferably at
least 98% of said unmethylated CpG-containing oligonucleotide can
be recovered from said VLP of an RNA bacteriophage. In a very
preferred meaning, a VLP of a RNA bacteriophage is regarded as
being packaged with G10 (SEQ ID NO:27) oligonucleotide, when after
treatment with Benzonase (190 U Benzonase/mg capsid protein in a
buffer comprising 2 mM MgCl.sub.2, pH 7.2, 20-25.degree. C., 18 h)
at least 90%, preferably at least 95%, most preferably at least 98%
of said unmethylated CpG-containing oligonucleotide can be
recovered from said VLP of an RNA bacteriophage. In more specific
meaning, a VLP of a RNA bacteriophage Q.beta., AP205, GA or fr is
regarded as being packaged with G10 (SEQ ID NO:27) oligonucleotide,
when after treatment with Benzonase (190 U Benzonase/mg capsid
protein in a buffer comprising 2 mM MgCl.sub.2, pH 7.2,
20-25.degree. C., 18 h) at least 90%, preferably at least 95%, most
preferably at least 98% of said unmethylated CpG-containing
oligonucleotide can be recovered from said VLP of an RNA
bacteriophage. In a very specific meaning, a VLP of a RNA
bacteriophage Q.beta. is regarded as being packaged with G10 (SEQ
ID NO:27) oligonucleotide, when after treatment with Benzonase (190
U Benzonase/mg capsid protein in a buffer comprising 2 mM
MgCl.sub.2, pH 7.2, 20-25.degree. C., 18 h) at least 90%,
preferably at least 95%, most preferably at least 98% of said
unmethylated CpG-containing oligonucleotide can be recovered from
said VLP of RNA bacteriophage Q.beta..
[0068] Alternatively, the packaging state of an ISS-NA in a
particle, in particular of ISS-NA which do not constitute a
substrate for DNAse or RNAse hydrolysis, can be assessed by size
exclusion chromatography or SDS-PAGE and subsequent spectroscopic
analysis as described in Example 4. A further possibility to verify
the packaging state of a particle packaged with an ISS-NA is
dialysis or tangential flow filtration of the particle, for example
under conditions as described in Example 1, wherein non-packaged
nucleic acids are removed while packaged nucleic aids remain
associated with said particle.
[0069] In the very preferred meaning, and wherein the particle is a
virus particle or a virus-like particle of a bacteriophage,
preferably of an RNA-bacteriophage, further preferably of an RNA
bacteriophage Q.beta., and most preferably of a virus-like particle
of a RNA-bacteriophage Q.beta., and wherein said ISS-NA is a
unmethylated CpG-containing oligonucleotide, preferably a A-type
CpG, further preferably the SEQ ID NO:27, the term "packaged"
indicates that the particle packaged with said ISS-NA elutes at the
same retention time as the virus-like particle of said
bacteriophage, preferably of said RNA-bacteriophage, further
preferably of said RNA bacteriophage Q.beta. obtained by
recombinant expression of the coat protein in E. coli, preferably
wherein said retention time is determined by size exclusion
chromatography, preferably as described in Example 4 of the present
application, and comprises said ISS-NA as determined preferably as
described in Example 4 of the present application.
[0070] In preferred embodiments, the ISS-NA, preferably the
unmethylated CpG-containing oligonucleotide, is packaged inside the
particle, preferably VLP capsids, most preferably in a non-covalent
manner. Protocols for the preparation of VLPs packaged with
unmethylated CpG-containing oligonucleotide are provided in the
prior art, e.g. in WO2003/024481A2 (see Examples 2, 3, 7, 8, 10,
11, 12, 13, 14, 15, 16, and 17 therein, in particular Examples
14-17 therein) and WO2004/000351A1. The disclosure of both
publications is incorporated to this application by reference.
Further Protocols for the preparation of VLPs packaged with
unmethylated CpG-containing oligonucleotide are provided Examples
1, 3 5 and 6 of the present application.
[0071] It is to be understood that under the assay conditions
specified above, especially those of Examples 11-17 of
WO2003/024481A2, some synthetic particles which are packaged with
said ISS-NA may release a certain limited amount of ISS-NA, wherein
said release typically follows a bi- or more phasic kinetic,
wherein said kinetic may comprise a fast initial burst release
phase and at least one slow release phase. For example, a certain
percentage of the ISS-NA packaged in a synthetic particle may be
released in a burst release phase, when incubated at 37.degree. C.
or 30.degree. C. in physiological buffers, in vitro. In this case
the burst release phase is followed by at least one slow release
phase. In some cases the second release phase will be flat, meaning
that no or very limited amounts of ISS-NA are released from the
synthetic particle in that phase. The two or more phases are
identified by examination of the release kinetic of ISS-NA from the
synthetic particle. Typically, an initial burst release phase will
be complete in a few hours but may last up to 24 hours, while the
slow release phase may last from 2-3 days up to 6 days or longer.
In some cases, the slow release phase may be nearly flat, with no
or very little ISS-NA released after the burst release phase.
Alternatively, there may be no initial burst phase, but rather one
or more slow release phases. As the burst release phase may be
concomitant to nuclease or serum exposure in an assay to assess
packaging, protection from degradation by nucleases or serum
assessed in this assay may not be complete. In the instance of an
initial burst release phase of oligonucleotide under the conditions
used in the assays to test protection, protection is assessed
during the time span of the assay corresponding to the slow release
phase. Thus, the term "packaged" as related to particles being
synthetic particles but not being virus particles or virus-like
particles also encompasses compositions comprising, essentially
consisting of, or consisting of synthetic particles and ISS-NA's,
in which such release of ISS-NA by said synthetic particle takes
place, provided that at least 30%, preferably at least 40%, more
preferably at least 50%, still more preferably at least 60%, even
more preferably at least 70%, and most preferably at least 80% of
the ISS-NA packaged in said synthetic particle is remaining
associated with said synthetic particle at the end of the
assay.
[0072] "particle": Particles of the invention have a diameter of 10
to 10000 nm, preferably of 20 to 1000 nm, more preferably 20 to 500
nm, still more preferably 20 to 300 nm, still more preferably 20 to
200 nm, and most preferably 20 to 100 nm, wherein these particles
can preferably be packaged with an ISS-NA. Particles of the
invention are preferably selected from the group consisting of
synthetic particles and VLPs. Very preferred particles of the
invention are VLPs, most preferably VLPs of RNA phages.
[0073] "size of a particle": The size of a spherical or nearly
spherical particle is determined as the medium diameter of a
population of particles; the size of an elliptic, longitudinal or
irregular formed particle refers to the arithmetic medium of the
longest axis in a population of particles. Typically and
preferably, the size of a particle, preferably of a nanoparticle or
a microparticle, most preferably of a nanoparticle, is determined
dynamic light scattering (DLS) technology (Example 13).
[0074] "synthetic particles": As used herein, "synthetic particle"
refers to particles which are formed by chemical or physical
processes, preferably by polymerization of monomers, precipitation
of polymers, assembly of macromolecules brought together, for
example by aggregation or heat denaturation, chemical cross-linking
of said assembled macromolecules. Preferred synthetic particles are
selected from liposomes, microparticles, and nanoparticles. Further
preferred synthetic particles are selected from liposomes,
microparticles, nanoparticles, and virosomes. Very preferred
synthetic particles are nanoparticles. The term "synthetic
particles" does not refer to particles formed by assembly of viral
proteins. Particles formed from viral coat proteins are
specifically referred to as virus particles or virus-like
particles. Viroids, retrotransposon particles, and all particles
formed from genetically encoded viral proteins are also understood
as virus particles or virus-like particles.
[0075] "liposomes": As used herein, the term "liposome" refers to
phospholipid vesicles comprising one or more, preferably one, two,
or three phospholipid bilayer membranes. Liposomes vary in charge
and in size depending on the method of preparation and the lipids
used. The liposome of the present invention may be neutral,
cationic, anionic, stealth, or cationic stealth. Preferably, the
liposome of the invention is a cationic liposome. The liposome may
have a diameter between 100 and 800 nm, preferably between 100 and
400 nm, more preferably between 100 and 300 nm, even more
preferably between 100 and 200 nm, most preferably less than 200
nm. The term "liposome", as used herein, shall also encompass
modified liposomes, preferably modified liposomes, wherein the
surface of the liposomes may be specifically modified to optimize
binding to DC, for example, via specific sugar moieties (Fukasawa
et al., (1998), FEBS, 441, 353-356) or antibodies (Serre et al.
(1998), J. Immunol., 161, 6059-6067).
[0076] "lipopolyplex": Lipopolyplex particles are liposomes
comprising or, preferably, essentially consisting of, most
preferably consisting of a cationic lipid, a polycation and ISS-NA
or DNA, whereby it is thought that the cationic lipid forms an
additional protective layer surrounding the complex of ISS-NA or
DNA with the polycation (Pelisek J. et al. J Gene Med 2006;
8:186-197).
[0077] "microparticle": As used herein, "microparticle" refers to
synthetic particles of controlled dimension in the order of
micrometers (i.e. >1 .mu.m, and <1000 .mu.m). Preferred
microparticles have a size of 1 to 10 .mu.m, preferably 1 to 5
.mu.m, more preferably 1 to 2 .mu.m.
[0078] "nanoparticle": As used herein, "nanoparticle" refers to
synthetic particles of controlled dimension in the order of
nanometers, wherein preferably ISS-NA can be entrapped,
encapsulated, non-covalently bound, covalently attached or
dissolved in said nanoparticles. The size of a nanoparticle is
preferably less than 1000, 900, 800, 700, 600, 500, 400, 300, 200,
100 or 50 nm, wherein further preferably said nanoparticle is not
smaller than about 10, 15, 20, 30, 40, or 50 nm. Preferably the
nanoparticle is not smaller than 50 nm. Thus, nanoparticles of the
invention are preferably 10 to 500 nm, more preferably 20 to 400
nm, still more preferably 40 to 300 nm, still more preferably 50 to
200 nm and most preferably 50 to 100 nm in size. Preferred in the
context of the invention are nanoparticles of 100 to 300 nm in
size, more preferred are nanoparticles of 100 to 200 nm in size.
Very preferred are nanoparticles of 50 to 200 nm in size. The term
nanoparticle encompasses particles of spherical, elliptic,
longitudinal or irregular structure, preferably comprising or
consisting of at least one a polymer. Nanoparticle also encompasses
nanocapsules, and poliplex particles. Nanocapsules are
nanoparticles comprising a reservoir, e.g. oily reservoir, wherein
said reservoir is surrounded by a polymer wall (Maria J. Alonso, in
Microparticulate systems for the delivery of proteins and vaccines,
Eds. S. Cohen and Howard Bernstein, Marcel Dekker, New York 1996, p
206). A nanoparticle of a certain material, e.g. a polyester
nanoparticle, refers to a nanoparticle comprising or preferably
essentially consisting, most preferably consisting of said
material. In the context of the invention this formulation does not
exclude the presence of the ISS-NA in the nanoparticle.
[0079] Polymers suitable for the production of nanoparticles,
including nanocapsules, refer to: biodegradable polyesters (e.g.
poly-lactic acid, poly-(lactic glycolic acid) copolymer (referred
to as PLA and PLGA), poly-e-caprolactone (referred to as PECL)),
poly-(alkylcyanoacrylates) (referred to as PACA), chitosan,
alginate, cross-linked human serum albumin, human serum albumin,
gelatin, Schizofyllan, dextran. Nanoparticles may also be prepared
from non-biodegradable materials such as polystyrene, colloidal
gold, silica, or metal clusters. In addition, hydrophilic
components such as e.g. PEG, polysaccharides (Lemarchand C. et al.
(Eur J Pharm Biopharm. 2004 September; 58:327-41), dextran,
chitosan, polylysine, lecithine and the like may also be
incorporated as copolymer or as coating reagent on the surface of
the nanoparticle. Complexation agent such as polylysine (PLL),
poly(ethylene imine) (PEI), protamine, spermine or positively
charged structured oligopeptides may be incorporated into
nanoparticles together with nucleic acids, bound to the surface of
nanoparticles for incorporation of nucleic acids, covalently
attached to reactive groups on the nanoparticle, or incorporated
during the polymerization process into the nanoparticle.
Alternative complexation agents include metal salts such as Zinc
acetate.
[0080] "polyplex": Polyplex particles are nanoparticles formed by
the direct interaction of a cationic polymer, also called
polycation, such polylysine (PLL), poly(ethylene imine) (PEI) or
the like with a nucleic acid, preferably an ISS-NA. A Polyplex may
also be formed by the direct interaction of PEG-PLL, or, for
example, of a branched PEI with said nucleic acid, preferably said
ISS-NA.
[0081] "Complexation agent": a complexation agent is an agent which
non-covalently binds to an ISS-Na and neutralizes or at least
partially reduces the effective charge of the resulting complex.
Examples of complexation agents are polylysine (PLL), spermine,
protamine, poyethyleneimine (PEI), branched PEI, lysine-rich
structured oligopeptides, cationic lipids such as DOTAP and the
like, and metal cations as provided by their salts such as zinc
acetate, magnesium, calcium chloride, or the like. More complex
polymers, such as poly(ethylene)glycol-polylysine (PEG-PLL)
copolymers may also be used as complexation agent.
[0082] "biodegradable": A material, preferably a particle, most
preferably a microparticle or nanoparticle, is referred to as
biodegradable when it is degradable or erodable under normal
mammalian physiological conditions. Degradation of the particle may
occur, for example, by dissolving of the particle, by enzymatic
degradation, preferably by hydrolysis or oxidation, or by
destabilisation of the particle by any other chemical or physical
process. Normal mammalian physiological conditions can be recreated
in the test-tube by incubating samples in serum at 37.degree. C.
Microparticles or nanoparticles are considered biodegradable, if
they are degraded upon incubation for 72 hours at 37.degree. C. in
human serum from healthy volunteers. In the context of this
definition, "degraded" means that the microparticle or nanoparticle
loses at least 5%, preferably at least 10%, more preferably at
least 20%, still more preferably at least 50% of its mass and/or
average polymer length. Most preferably, the particle is completely
degraded under these conditions. Conversely, a microparticle or
nanoparticle is referred to as non-biodegradable, if it does not
loses at least 5% of its mass and/or average polymer length upon
incubation in human serum for 72 hours at 37.degree. C. Very
preferred are particles which are biodegradable at low pH,
preferably at a pH which is found in the endosomes of immune cells,
more preferably at ph of 4.5 to 6, most preferably at pH of about
5.
[0083] "coat protein": As used herein, the term "coat protein(s)"
refers to the protein(s) of a bacteriophage or a RNA bacteriophage
capable of being incorporated within the capsid assembly of the
bacteriophage or the RNA bacteriophage. However, when referring to
the specific gene product of the coat protein gene of RNA
bacteriophages the term "CP" is used. For example, the specific
gene product of the coat protein gene of RNA bacteriophage Q.beta.
is referred to as "Q.beta. CP", whereas the "coat proteins" of
bacteriophage Q.beta. comprise the "Q.beta. CP" as well as the A1
protein. The capsid of Bacteriophage Q.beta. is composed mainly of
the Q.beta. CP, with a minor content of the A1 protein. Likewise,
the VLP Q.beta. coat protein contains mainly Q.beta. CP, with a
minor content of A1 protein.
[0084] "recombinant VLP": The term "recombinant VLP", as used
herein, refers to a VLP that is obtained by a process which
comprises at least one step of recombinant DNA technology. The term
"VLP recombinantly produced", as used herein, refers to a VLP that
is obtained by a process which comprises at least one step of
recombinant DNA technology. Thus, the terms "recombinant VLP" and
"VLP recombinantly produced" are interchangeably used herein and
should have the identical meaning.
[0085] "virus particle": The term "virus particle" as used herein
refers to the morphological form of a virus. In some virus types it
comprises a genome surrounded by a protein capsid; others have
additional structures (e.g., envelopes, tails, etc.).
[0086] "virus-like particle (VLP)", as used herein, refers to a
non-replicative or non-infectious, preferably a non-replicative and
non-infectious virus particle, or refers to a non-replicative or
non-infectious, preferably a non-replicative and non-infectious
structure resembling a virus particle, preferably a capsid of a
virus. The term "non-replicative", as used herein, refers to being
incapable of replicating the genome comprised by the VLP. The term
"non-infectious", as used herein, refers to being incapable of
entering the host cell. Preferably a virus-like particle in
accordance with the invention is non-replicative and/or
non-infectious since it lacks all or part of the viral genome or
genome function. In one embodiment, a virus-like particle is a
virus particle, in which the viral genome has been physically or
chemically inactivated, removed by disassembly and reassembly, or
by assembly of purified proteins into a VLP. Typically and more
preferably a virus-like particle lacks all or part of the
replicative and infectious components of the viral genome. A
virus-like particle in accordance with the invention may contain
nucleic acid distinct from their genome. A typical and preferred
embodiment of a virus-like particle in accordance with the present
invention is a viral capsid such as the viral capsid of the
corresponding virus, bacteriophage, preferably RNA bacteriophage.
The terms "viral capsid" or "capsid", refer to a macromolecular
assembly composed of viral protein subunits. Typically, there are
60, 120, 180, 240, 300, 360 and more than 360 viral protein
subunits. Typically and preferably, the interactions of these
subunits lead to the formation of viral capsid or viral-capsid like
structure with an inherent repetitive organization, wherein said
structure is, typically, spherical or tubular. For example, the
capsids of RNA bacteriophages or HBcAgs have a spherical form of
icosahedral symmetry. The term "capsid-like structure" as used
herein, refers to a macromolecular assembly composed of viral
protein subunits resembling the capsid morphology in the above
defined sense but deviating from the typical symmetrical assembly
while maintaining a sufficient degree of order and repetitiveness.
The invention encompasses VLPs, preferably non-natural VLPs,
comprising a icosahedral symmetry. One common feature of virus
particle and virus-like particle is its highly ordered and
repetitive arrangement of its subunits.
[0087] "virus-like particle of a RNA bacteriophage": As used
herein, the term "virus-like particle of a RNA bacteriophage"
refers to a virus-like particle comprising, or preferably
consisting essentially of or consisting of coat proteins, mutants
or fragments thereof, of a RNA bacteriophage. In addition,
virus-like particle of a RNA bacteriophage resembling the structure
of a RNA bacteriophage, being non replicative and/or
non-infectious, and lacking at least the gene or genes encoding for
the replication machinery of the RNA bacteriophage, and typically
also lacking the gene or genes encoding the protein or proteins
responsible for viral attachment to or entry into the host. This
definition should, however, also encompass virus-like particles of
RNA bacteriophages, in which the aforementioned gene or genes are
still present but inactive, and, therefore, also leading to
non-replicative and/or non-infectious virus-like particles of a RNA
bacteriophage. Preferred VLPs derived from RNA bacteriophages
exhibit icosahedral symmetry and consist of 180 subunits. Within
this present disclosure the term "subunit" and "monomer" are
interexchangeably and equivalently used within this context.
Preferred methods to render a virus-like particle of a RNA
bacteriophage non replicative and/or non-infectious is by physical,
chemical inactivation, such as UV irradiation, formaldehyde
treatment, typically and preferably by genetic manipulation.
Alternatively, individual proteins may be isolated from whole
virions and assembled into VLPs in vitro.
[0088] "synthetic VLP": Particles formed from non-naturally
occurring proteins or peptides which spontaneously assemble
intracellularly or in vitro are referred to as synthetic VLPs.
Examples for synthetic VLPs are provided in WO04071493A1 which is
incorporated herein by reference. Synthetic VLPs also encompasses
particles which require nucleic acids or metal ions for assembly.
Preferred synthetic particles have a defined size of 10 to 1000 nm,
preferably 10 to 300 nm, more preferably 10 to 150 nm, and most
preferably 15 to 100 nm. Other preferred synthetic VLPs may exist
in two or more defined conformations, e.g. 15 nm and 25 nm.
[0089] "virosome": As used herein, the term virosome relates to a
reconstituted virus envelope, preferably to a reconstituted
influenza virus envelope, more preferably to a reconstituted
envelope of influenza A virus, most preferably to a reconstituted
envelope of influenza A/Singapore virus. Virosomes are known in the
art as drug carrier systems. A virosome comprises a lipid membrane,
wherein said lipid membrane typically and preferably comprises a
unilamellar lipid bilayer. In a preferred meaning the term virosome
relates to a reconstituted influenza virus envelope, preferably to
a reconstituted influenza A virus envelope, most preferably to a
reconstituted influenza A/Singapore virus envelope, wherein said
reconstituted influenza virus envelope, preferably said
reconstituted influenza A virus envelope, most preferably said
reconstituted influenza A/Singapore virus envelope comprises lipid
membrane, wherein said lipid membrane comprises influenza
glycoproteins, wherein preferably said influenza glycoproteins are
selected from hemagglutinin HA and neuraminidase NA. Typically and
preferably virosomes attach to target cells via HA. Very preferred
virosomes comprise a lipid membrane, preferably a lipid bilayer,
wherein said lipid membrane or said lipid bilayer comprise or
preferably predominantly consist of cationic lipids. Virosomes
comprising cationic lipids in their lipid membrane are particularly
suited for the delivery of ISS-NA, especially of oligonucleotides.
Further preferred are specific virosomes, which attach to a target
cell by an antibody or a fragment thereof which is comprised in the
lipid membrane. Thus, in a further preferred meaning, the term
virosome relates to a specific virosomes comprising a lipid
membrane, wherein said lipid membrane comprises specific antibodies
or fragments thereof, preferably Fab fragments or Fab' fragments,
wherein preferably the specificity of said antibodies or fragments
thereof allows to direct the virosome to a specific target cell.
Typically and preferably, a virosome is taken up by the target cell
by receptor-mediated endocytosis.
[0090] "effective amount": As used herein, the term "effective
amount" refers to an amount necessary or sufficient to realize a
desired biologic effect. An effective amount of the composition,
preferably the pharmaceutical composition, would be the amount that
achieves this selected result, and such an amount could be
determined as a matter of routine by a person skilled in the art.
For example, an effective amount for treating an immune system
deficiency could be that amount necessary to cause activation of
the immune system, resulting in the development of an antigen
specific immune response upon exposure to antigen. The term is also
synonymous with "sufficient amount". The effective amount for any
particular application can vary depending on such factors as the
disease or condition being treated, the particular composition
being administered, the size of the subject, and/or the severity of
the disease or condition. One of ordinary skill in the art can
empirically determine the effective amount of a particular
composition of the present invention without necessitating undue
experimentation.
[0091] "treatment": As used herein, the terms "treatment", "treat",
"treated" or "treating" refer to prophylaxis and/or therapy. When
used with respect to an atopic disease, for example, the term
refers to a therapeutic treatment which reduces the symptom score
of the treated patient as assessed by a standard method commonly
used to assess the severity of the symptoms of the disease the
patient is suffering from. The term can also refer to a
prophylactic treatment of an atopic disease which, for example,
prevents or ameliorates the symptoms a patient typically develops
upon exposure to a challenging agent as compared to an untreated
patient.
[0092] "pharmaceutically acceptable carrier": The compositions of
the invention can be combined, optionally, with a
pharmaceutically-acceptable carrier. The term
"pharmaceutically-acceptable carrier" as used herein means one or
more compatible solid or liquid fillers, diluents or encapsulating
substances which are suitable for administration into a human or
other animal. The term "carrier" denotes an organic or inorganic
ingredient, natural or synthetic, with which the active ingredient
is combined to facilitate the application.
[0093] "pharmaceutical composition": As used herein, the term
"pharmaceutical composition" refers to a formulation which contains
the composition of the invention and which is in a form that is
capable of being administered to an animal. Typically and
preferably, the pharmaceutical composition comprises a conventional
saline or buffered aqueous solution medium in which the composition
of the present invention is suspended or dissolved. In this form,
the composition of the present invention can be used conveniently
to prevent, ameliorate, or otherwise treat a condition. Upon
introduction into a host, the pharmaceutical composition is able to
provoke an immune response including, but not limited to, the
production of antibodies and/or cytokines and/or the activation of
cytotoxic T cells, antigen presenting cells, helper T cells,
dendritic cells and/or other cellular responses. Preferred
pharmaceutical compositions induce a cytokine milieu, typically and
preferably the formation of IFN-alpha, which is reducing allergic
and/or asthmatic symptoms. Optionally, the pharmaceutical
composition additionally includes an adjuvant which can be present
in either a minor or major proportion relative to the composition
of the present invention.
[0094] "adjuvant": The term "adjuvant" as used herein refers to
non-specific stimulators of the immune response or substances that
allow generation of a depot in the host which when combined with
the composition of the invention provides for an even more enhanced
and/or prolonged immune response, preferably cytokine production. A
variety of adjuvants is known in the art and useful in the
invention. Preferred adjuvants are selected from the group
consisting of incomplete Freund's adjuvant, aluminum containing
adjuvants, modified muramyldipeptide, surface active substances
such as lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions, keyhole limpet hemocyanins, dinitrophenol, BCG (bacille
Calmette Guerin) Corynebacterium parvum, ligands of toll-like
receptors (TLR) which include but are not limited to
peptidoglycans, lipopolysaccharides and their derivatives, poly
I:C, immunostimulatory oligonucleotides, imidazoquinolines such as
resiquimod and imiquimod, flagellins, monophosphoryl lipid
immunomodulator, AdjuVax 100a, QS-21, QS-18, GPI-0100, CRL1005,
MF-59, OM-174, OM-197, OM-294, Virosomal adjuvant technology and
any mixture thereof. A very preferred adjuvant for the purpose of
the invention is aluminium containing adjuvant, preferably an
aluminium containing mineral gel, most preferably alhydrogel. In a
very preferred embodiment said adjuvant is alhydrogel. The term
adjuvant also encompasses a mixture of any of the substances listed
above. Particles of the invention, preferably VLPs, have been
generally described as an adjuvant. However, the term "adjuvant",
as used within the context of this application, refers to an
adjuvant not being the particle of the invention, in particular not
the VLP used for the inventive compositions. In each case, the term
adjuvant refers to an adjuvant used in addition to said
particle.
[0095] "polypeptide": As used herein the term "polypeptide" refers
to a polymer composed of amino acid residues, generally natural
amino acid residues, linked together through peptide bonds.
Although a polypeptide may not necessarily be limited in size, the
term polypeptide is often used in conjunction with peptide of a
size of about ten to about 50 amino acids.
[0096] "protein": As used herein, the term protein refers to a
polypeptide of a size of above 20, more preferably of above 50
amino acid residues. Proteins generally have a defined three
dimensional structure although they do not necessarily need to, and
are often referred to as folded, in contrast to peptides and
polypeptides which often do not possess a defined three-dimensional
structure, but rather can adopt a large number of different
conformations, and are referred to as unfolded.
[0097] "sequence identity": The amino acid sequence identity of
polypeptides can be determined conventionally using known computer
programs such as the Bestfit program. When using Bestfit or any
other sequence alignment program, preferably using Bestfit, to
determine whether a particular sequence is, for instance, 95%
identical to a reference amino acid sequence, the parameters are
set such that the percentage of identity is calculated over the
full length of the reference amino acid sequence and that gaps in
homology of up to 5% of the total number of amino acid residues in
the reference sequence are allowed. This aforementioned method in
determining the percentage of identity between polypeptides is
applicable to all proteins, polypeptides or a fragment thereof
disclosed in this invention.
[0098] "Sequence homology": The homology of nucleotide sequences is
preferably determined by the program blastn which is an
implementation of the BLAST algorithm, most preferably using the
default settings of the software.
[0099] "fragment of a protein", in particular fragment of a
recombinant protein or recombinant coat protein, as used herein, is
defined as a polypeptide, which is of at least 70%, preferably at
least 80%, more preferably at least 90%, even more preferably at
least 95% the length of the wild-type recombinant protein, or coat
protein, respectively and which preferably retains the capability
of forming VLP. Preferably the fragment is obtained by at least one
internal deletion, at least one truncation or at least one
combination thereof. The term "fragment of a recombinant protein"
or "fragment of a coat protein" shall further encompass
polypeptide, which has at least 80%, preferably 90%, even more
preferably 95% amino acid sequence identity with the "fragment of a
recombinant protein" or "fragment of a coat protein", respectively,
as defined above and which is preferably capable of assembling into
a virus-like particle.
[0100] The term "mutant coat protein" refers to a polypeptide
having an amino acid sequence derived from the wild type
recombinant protein, or coat protein, respectively, wherein the
amino acid sequence is at least 80%, preferably at least 85%, 90%,
95%, 97%, or 99% identical to the wild type sequence and preferably
retains the ability to assemble into a VLP.
[0101] "animal": As used herein, the term "animal" refers to any
animal, preferably to any animal comprising an immune system,
including non-vertebrates, preferably arachnids and insects, and
vertebrates. Typically and preferably, animal relates to
vertebrates, more preferably to mammals, most preferably to humans.
Thus, animal includes, for example, humans, sheep, horses, cattle,
pigs, dogs, cats, rats, mice, birds, reptiles, fish, insects and
arachnids.
[0102] "one", "a/an": When the terms "one," "a," or "an" are used
in this disclosure, they mean "at least one" or "one or more,"
unless otherwise indicated.
[0103] "about": within the meaning of the present application the
expression about shall have the meaning of +/-10%. For example
about 100 shall mean 90 to 110.
[0104] As previously disclosed, VLPs packaged with unmethylated
CpG-containing oligonucleotides can enhance B and T cell responses.
It was also previously observed, that application of a
CpG-containing oligonucleotide together with an allergen
ameliorated allergic response. It was now surprisingly found that
no covalent linkage, coupling or mixing of allergen with the
particle of the invention, preferably the VLP, is required to
achieve an effect in the treatment of hypersensitivity, preferably
allergy. Even more surprisingly, it was found that no
administration or co-administration of a specific antigen or
allergen is required in the treatment of hypersensitivity,
preferably allergy, using the compositions of the invention.
Furthermore, said effect is not limited to VLPs packaged with
unmethylated CpG-containing oligonucleotides but can be generalized
to particles of the invention packaged with immunostimulatory
nucleic acids (ISS-NA).
[0105] Applicants have discovered that hypersensitivities may be
cured by treatment with particles packaged with ISS-NA. Applicants
have also shown that particles of appropriate size diffuse readily
to draining lymph nodes after intradermal or subcutaneous
injection, where they are taken up mainly by dendritic cells (DC)
and macrophages. Various DCs, including plasmacytoid dendritic
cells (pDC), monocyte derived and leucophil dendritic cells or
macrophages are activated upon uptake of particles, preferably
VLPs, packaged with unmethylated CpG-containing oligonucleotide via
the Toll-9 receptor. Applicants have also discovered that
polystyrene nanoparticles with sizes of 50 to 200 nm also readily
diffuse to the draining lymph node, while larger particles (>500
nm) remain at the site of injection during the same time span after
subcutaneous injection. PLGA nanoparticles have been shown to be
phagocytosed by dendritic cells (DCs) (Diwan et al. J Drug Target.
2003; 11:495-507). Moreover murine DCs pulsed with PLGA
nanoparticles having co-incorporated an unmethylated CpG-containing
oligodesoxynucleotide and an antigen have been shown to enhance
antigen specific T-cell activation in an in vitro T-cell
stimulation assay, as compared to DCs pulsed with PLGA
nanoparticles incorporating only antigen. Therefore, nanoparticles
incorporating an ISS-NA like an unmethylated CpG-containing
oligodesoxynucleotide are able to stimulate dendritic cells upon
uptake, and these dendritic cells thereafter activated T-cells. In
human dendritic cells, Toll-like receptor 9 expression is limited
to a small subset, the so called plasmacytoid dendritic cells. We
show herein that Q.beta. virus-like particles, which have a size of
about 30 nm, are taken up by human plasmacytoid dendritic cells,
and therefore can deliver ISS-NA to these cells. Interestingly,
mast cells also express TLR-9. A recent report has shown the role
of CpG-containing oligonucleotide in preventing Th2-cell activation
upon allergen challenge (Hessel et al. (2005) J. exp. Med.
11:1563-73.). Therefore, uptake of particles such as nanoparticles
or VLPs packaged with ISS-NA, such as unmethylated CpG-containing
oligonucleotide, by plasmacytoid dendritic cells or antigen
presenting cells such as classical dendritic cells may lead to
inhibition of the activation of Th2 cells and thereby inhibit the
allergen induced response. The same report involved mast cells in
the suppressive action of unmethylated CpG-containing
oligonucleotide on the allergic response. Mast cells are active in
phagocytosis, and it is possible that particles of the invention,
preferably nanoparticles or VLPs, wherein said nanoparticles or
VLPs, preferably said VLPs, are packaged with ISS-NA, preferably
with unmethylated CpG-containing oligonucleotide, mediate their
effect in part via inhibiting mast cells, providing for another
alternative or complementary possible mechanism of action of the
VLP or nanoparticle packaged with unmethylated CpG-containing
oligonucleotide. However, the mode of action of the compositions of
the invention is not limited to this mechanism.
[0106] Based on the aforementioned findings, the invention provides
compositions, pharmaceutical compositions and methods for the
treatment or prevention of hypersensitivity, preferably allergy in
an animal. In particular, the invention provides a composition for
use in a method of treating hypersensitivity in an animal, the
composition comprising a particle and an ISS-NA, wherein said
particle is packaged with said ISS-NA. The invention provides
methods and compositions which are especially useful for treating
and/or preventing hypersensitivity, preferably allergy, more
preferably atopic eczema, atopic asthma and type I allergies like,
for example, pollen allergy (hay fever).
[0107] In this context, the term particle refers to any structure
which, with respect to its chemical an physical characteristics,
can be packaged with ISS-NA, wherein preferably said particle is
capable of protecting said ISS-NA from degradation in the body of
said animal and/or wherein said particle is capable of specifically
delivering and releasing said ISS-NA to immune cells. Thus, to be
effective, the particle of the invention preferably is able to (i)
package an ISS-NA and (ii) to deliver said ISS-NA to immune cells
in the body. The particle of the invention is therefore to be
understood in a very broad sense.
[0108] In a preferred embodiment said particle is selected from the
group consisting of synthetic particle, virus particle and VLP.
[0109] The particles of the invention can be biodegradable or non
biodegradable. Biodegradable particles are generally preferred to
prevent accumulation of said particle in the body of said animal
and to avoid toxicity effects which might be associated with such
accumulation. Therefore, in a preferred embodiment said particle,
preferably said synthetic particle, most preferably said
nanoparticle, comprises or, preferably, essentially consists of,
most preferably consists of a biodegradable material. In a further
preferred embodiment said particle, preferably said synthetic
particle, most preferably said nanoparticle, is biodegradable. In a
very preferred embodiment said synthetic particle packaged with
said ISS-NA is biodegradable. In a further preferred embodiment
said particle, preferably said synthetic particle, releases said
ISS-NA, preferably inside the target cell, most preferably in the
endosome of the target cell. In a further preferred embodiment said
particle, preferably said synthetic particle is degraded in the
endosomal compartment of the target cell containing proteases and
exhibiting a low pH, preferably about pH 5.
[0110] In one embodiment of the invention said particle is a
synthetic particle, preferably a synthetic particle selected from
the group consisting of liposome, microparticle and nanoparticle,
wherein more preferably said synthetic particle is liposome or a
nanoparticle, and even more preferably a nanoparticle. In a further
embodiment of the invention said particle is a synthetic particle,
preferably a synthetic particle selected from the group consisting
of liposome, microparticle, nanoparticle and virosome. Synthetic
particles of the invention comprise or preferably essentially
consist of, most preferably consist of non-biodegradable materials,
of biodegradable materials or of a mixture of both, wherein said
biodegradable materials may be organic or inorganic, or a
combination of both.
[0111] In a preferred embodiment said synthetic particle is a
microparticle or a nanoparticle, preferably a nanoparticle, wherein
said synthetic particle comprises or preferably essentially
consists of, most preferably consists of a material selected from
the group consisting of: (a) polyesters, preferably selected from
PLA, poly(glycolic acid) and PECL, (b) copolymers of polyesters,
preferably PLGA, (c) block copolymers of polyester and PEG, (d)
polyorthoesters, (e) poly(anhydrides), (f) poly(sebacic acid), (g)
polyanhydrides based on sebacic acid monomers incorporating amino
acids, (h) polyanhydride esters, (i) polyphosphazene, preferably
polyphosphazene containing hydrolysis-sensitive ester groups
(Andrianov A K and Payne L G, in Microparticulate systems for the
delivery of proteins and vaccines, Eds. S. Cohen and Howard
Bernstein, Marcel Dekker, New York 1996, p 127-147), (j) polyamide,
(k) macromolecules and modified macromolecules of biological
origins, preferably selected from proteins (e.g. gelatin, human
serum albumin) and (l) polysaccharides (e.g. dextran, chitosan,
alginate, Schyzofyllan), (m) methacrylate-based materials,
preferably selected from poly(methyl methacrylate) and copolymers,
preferably PEG-methacrylate or PEG-dimethacrylate, (n) methyl
methacrylate based materials, preferably selected from PEG based
comonomers and ionic comonomers, (o) poly(methylidene malonate
2.1.2) as described by Bousquet Y et al. Biomaterials. 1998
January-February; 19:271-8 and Breton P et al. Pharm Res. 1999;
16:141-7, (p) colloidal gold, (q) polystyrene, (r) polyethylene,
(s) polypropylene, (t) latex, (u) ferromagnetic or paramagnetic
materials, (v) dextran, (w) hydroxyapatite, and (x) a mixture of
any of the materials listed above.
[0112] In a preferred embodiment said synthetic particle is a
microparticle or a nanoparticle, preferably a nanoparticle, wherein
said synthetic particle comprise or preferably essentially consist
of, most preferably consist of a non-biodegradable material
selected from the group consisting of: (a) colloidal gold, (b)
polystyrene, (c) polyethylene, (d) polypropylene, (e) latex, (f)
ferromagnetic or paramagnetic materials, (g) dextran and (h)
hydroxyapatite.
[0113] In a more preferred embodiment said synthetic particle,
preferably said nanoparticle, comprises or preferably essentially
consists of, most preferably consists of a biodegradable material
selected from the group consisting of: (a) polyesters, preferably
selected from PLA, poly(glycolic acid) and PECL, (b) copolymers of
polyesters, preferably PLGA, (c) block copolymers of polyester and
PEG, (d) polyorthoesters, (e) poly(anhydrides), (f) poly(sebacic
acid), (g) polyanhydrides based on sebacic acid monomers
incorporating amino acids, (h) polyanhydride esters, (i)
polyphosphazene, preferably polyphosphazene containing
hydrolysis-sensitive ester groups (Andrianov A. K. and Payne L G,
in Microparticulate systems for the delivery of proteins and
vaccines, Eds. S. Cohen and Howard Bernstein, Marcel Dekker, New
York 1996, p. 127-147), (j) polyamide, and (k) macromolecules and
modified macromolecules of biological origins, preferably selected
from proteins (e.g. gelatin, human serum albumin) and
polysaccharides (e.g. dextran, chitosan, alginate,
Schyzofyllan).
[0114] In a still more preferred embodiment said biodegradable
material is selected from (a) polyesters, preferably selected from
PLA, poly(glycolic acid) and PECL, (b) copolymers of polyesters,
preferably PLGA, (c) block copolymers of polyester and PEG, (d)
polyorthoesters, (e) poly(anhydrides), (f) poly(sebacic acid), (g)
polyanhydrides based on sebacic acid monomers incorporating amino
acids, (h) polyanhydride esters, (i) polyphosphazene, preferably
polyphosphazene containing hydrolysis-sensitive ester groups
(Andrianov A K and Payne L G, in Microparticulate systems for the
delivery of proteins and vaccines, Eds. S. Cohen and Howard
Bernstein, Marcel Dekker, New York 1996, p. 127-147), and (j)
polyamide.
[0115] In a still more preferred embodiment said biodegradable
material is selected from (a) polyesters, preferably polyesters
selected from PLA, poly(glycolic acid) and PECL, and (b) copolymers
of polyesters, preferably PLGA. In a very preferred embodiment said
biodegradable material is PLA or PLGA, most preferably PLA.
[0116] In a further preferred embodiment said particles, preferably
said synthetic particles, most preferably said nanoparticles
comprise or preferably essentially consist of at least one,
preferably exactly three, more preferably exactly two, most
preferably exactly one biodegradable polymer(s), wherein preferably
said polymer is degraded into biocompatible non-toxic monomers,
wherein still more preferably said biodegradable polymer is a
polyester (see Maria J. Alonso et al., in Microparticulate systems
for the delivery of proteins and vaccines, Eds. S. Cohen and Howard
Bernstein, Marcel Dekker, New York 1996, p 203-242).
[0117] Nanoparticles may be formed by chemical or physical
processes such as polymerization or condensation of monomers, for
example in nanodroplets of an emulsion, precipitation of polymers,
coacervation of macromolecules, assembly of macromolecules brought
together, for example, by the process of emulsification, by ionic
interactions, aggregation, heat denaturation or chemical
cross-linking of said assembled macromolecules. Nanoparticles may
also have a composite structure involving two or more layers with
different properties, such as core-shell particles with a
hydrophobic core layer of a polymer and a hydrophilic outer shell
layer of another polymer, such as poly(ethylene)glycol (PEG). Other
examples of core-shell nanoparticles include nanoparticles where a
charged polymer, such as polylysine, is adsorbed to the surface of
the nanoparticle. Alternatively, more complex nanoparticles may be
produced, where co-monomers carrying a cationic moiety and
co-monomers carrying a PEG moiety are included in the
polymerization process and preferentially locate to the
nanoparticle surface during the polymerization process. Thus, in a
preferred embodiment said nanoparticle comprises an outer shell
layer, wherein preferably said outer shell layer comprises or
alternatively essentially consists of PEG. In a very preferred
embodiment said nanoparticle comprises a core and a shell layer,
wherein said core comprises or alternatively essentially consists
of polyester and wherein said shell layer comprises or
alternatively essentially consists of PEG. In a further preferred
embodiment said nanoparticle comprises a core and a shell layer,
wherein said core comprises or alternatively essentially consists
of polyalkylcyanoacrylat and wherein preferably said shell layer
comprises or alternatively essentially consists of PEG.
[0118] In a further preferred embodiment said nanoparticle is a
core-shell nanoparticle, wherein preferably the shell layer of said
core-shell nanoparticle is packages with said ISS-NA. Preferably,
said shell layer of said core-shell nanoparticle is positively
charged. Further preferably said shell layer of said core-shell
particle comprises or alternatively essentially consists of a
polymer, wherein preferably said polymer is selected from
polylysine, cethyltrimethylammonium bromide (CTAB) and
polyethyleneimine. Alternatively, said ISS-NA may preferentially
associate with the core layer, for example of a CaP-PEG-PAA
nanoparticle.
[0119] In a further preferred embodiment said nanoparticle is a
polyplex. A polyplex nanoparticle is formed by the direct
association of a complexation agent such as PEI, PLL or PEG-PLL
with an ISS-NA, forming a so called polyplex (Boeckle S. et al. J
Gene Med 2004; 6:1102-1111; Wagner E. et al. Adv Genet. 2005;
53:333-54; Walker G. et al. Mol. Ther. 2005; 11:418-25).
[0120] The size of nanoparticles can be determined with known
methods such as scanning- and transmission-electron microscopy, or
photon correlation spectroscopy or dynamic light scattering, as
reviewed in Alonso M. J. (in Microparticulate systems for the
delivery of proteins and vaccines, Eds. S. Cohen and Howard
Bernstein, Marcel Dekker, New York 1996, p 203-242). Surface
properties such as surface charge, and in particular the
zeta-potential, can be measured by determining the velocities of
nanoparticles in an electrical field using methods such as
electrophoretic mobility measurement. Laser Doppler anemometry or
Electrophoretic light scattering may also be used. Alternatively,
the sonic response to an alternating electric field (electronic
sonic amplitude effect) may be used as well. The measurements can
be performed with commercially available devices. The zeta
potential is informative to predict the aggregation behaviour of a
nanoparticle, or its ability to adsorb charged components on its
surface, and thus helps optimizing the properties of
nanoparticles.
[0121] In a preferred embodiment said nanoparticle comprises or
alternatively essentially consists of polyesters, preferably of
aliphatic polyesters. Aliphatic polyesters are degraded by random
hydrolytic cleavage, into physiologically occurring metabolites.
These materials have been used for resorbable sutures, and a
polyester microsphere formulation for parenteral injection of
Leuprolide acetate, a Gonadotropin Releasing Hormone analog, is a
marketed product. Several polymers can be used in the preparation
of the nanoparticles of the invention and have been described:
poly(lactic acid) (PLA), poly(glycolic acid) (PGA), or Copolymers
of PLAA and PGA, poly(-lactic-co-glycolic acid) named PLGA, are
particularly suited. The racemic, amorphous form is preferred.
These polymers are commercially available, and their synthesis is
well known in the art. Their synthesis is described, for example,
by Avgoustakis K (Curr Drug Deliv. 2004; 1:321-33). The properties
of polyester microsphere, and PLGA in particular, as well as
methods to produce them have been reviewed and described for
example by Kissel T and Koneberg R (in Microparticulate systems for
the delivery of proteins and vaccines, Eds. S. Cohen and Howard
Bernstein, Marcel Dekker, New York 1996, p. 51-87). These methods
include spray drying methods, water-in-oil-in-water emulsion
solvent evaporation methods and phase separation methods. In a
preferred embodiment said nanoparticle comprises or alternatively
essentially consists of PLGA, wherein preferably the molar ratio of
the monomers constituting PLGA is 50% mol LA and 50% mol GA.
Increasing the proportion of either of the monomer leads to slower
degradation of the polymer. For example, a polymer with a ratio of
LA to GA of 85:15 has a rate of degradation about two-and a half
time slower than with a ratio of 50:50. Thus, the properties of
PLGA polymer can be manipulated by changing the proportion of the
monomers.
[0122] Preparation of nanoparticles and in particular of
nanoparticles made from polyester materials has been reviewed for
example by Alonso M J, (in Microparticulate systems for the
delivery of proteins and vaccines, Eds. S. Cohen and Howard
Bernstein, Marcel Dekker, New York 1996, p 203-242) or Avgoustakis
K (Curr Drug Deliv. 2004; 1:321-33). Methods for producing
polyester nanoparticles are also described therein, and include
methods collectively referred to as polymer precipitation methods.
In these methods, the polymer dissolved in an organic solvent is
emulsified in water containing a stabilizer. The organic solvent
diffuses from the organic phase into the aqueous phase. The result
of the solvent depletion from the organic phase is polymer
precipitation, leading to the formation of nanoparticles.
[0123] One of these is the solvent extraction-evaporation
technique. In this method an organic solvent with poor water
solubility, such as methylene chloride, ethyl acetate or chloroform
is used. The solvent is nonetheless extracted from the organic
phase into the water phase due to the large excess of water, a
process which is further facilitated by subsequent evaporation of
the solvent. The solvent extraction-evaporation technique can be
essentially performed in two general ways to incorporate molecules
into nanoparticles, depending on the hydrophobicity of the molecule
to be incorporated. A hydrophobic molecule, or a water insoluble
complex can be dissolved or suspended in the same organic solvent
as the polymer, and then be emulsified in an external water phase
containing a stabilizer, typically a surfactant such as poly(vinyl
alcohol) (PVA), a poloxamer, or for example dextran, whereby the
nanodroplets formed during the emulsion process form nanoparticles
upon solvent extraction and evaporation. Preferably, the emulsion
is prepared using high-speed or high-pressure homogenizers,
microfluidization or sonication. Intensive stirring or vortexing
may also be appropriate. This method is also referred to as the
oil-in-water solvent extraction and evaporation technique.
[0124] More hydrophilic or amphiphilic compounds are incorporated
as aqueous solutions into a larger volume of an organic solvent
containing the polymer. Preferrably, the aqueous solution is
emulsified with the organic solvent, for example using high-speed
or high-pressure homogenizers, microfluidization, sonication,
vortexing or intensive stirring. The resulting water-in-oil
emulsion or suspension is further emulsified in a larger volume of
water, yielding a water-in-oil-in water emulsion, from which the
nanoparticles form upon solvent extraction and evaporation. This
method is also referred to as the water-in-oil-in-water emulsion
solvent evaporation technique.
[0125] The process of solvent extraction and evaporation can be
further accelerated for example by increasing the temperature,
applying vacuum or adding an alcohol such as isopropanol (e.g. 2%)
to the external water phase to increase the organic solvent
solubility in that external water phase. For example, a rotavapor
may be used to accelerate solvent extraction and evaporation.
[0126] Some components such as certain surfactants used in the
production process and incompatible with parenteral injection into
animals or humans may have to be eliminated, for example by washing
steps with water. Purification techniques used are for example
tangential-flow filtration, or centrifugation. Nanoparticles are
then typically isolated by freeze-drying, whereby a cryoprotectant
such as a sugar like trehalose or glucose is added to prevent
aggregation of the nanoparticles.
[0127] Another polymer precipitation technique is the solvent
displacement or nanoprecipitation method. It involves the use of an
organic solvent that is completely soluble in the external water
phase. The polymer is dissolved in acetone, ethanol or methanol,
and precipitates upon incorporation under stirring into an aqueous
solution of a surfactant, such as for example Poloxamer 188.
[0128] A further polymer precipitation method is the salting-out
technique. In this method, the polymer is dissolved in, for example
acetone, and a saturated aqueous solution of PVA is added under
stirring to form an oil-in-water emulsion. Water is further added,
and the polymer precipitates to form nanoparticles when acetone
diffuses into the external water phase.
[0129] In a further embodiment of the invention, said nanoparticle
is a PEG-polyester nanoparticle, such as for example, PEG-PLA or
PEG-PLGA nanoparticles. PLA and PLGA particles absorb plasma
proteins such as opsonin, and activate the complement system. To
minimize plasma protein binding, core-shell nanoparticles have been
produced, where a layer of a hydrophilic PEG, the shell, surrounds
the polymer core of the particle, and prevents or reduces
attachments of plasma proteins or opsonin to the hydrophobic
polymer surface. Coating of nanoparticles and in particular of PLGA
nanoparticles with poly(ethylene glycol) has been shown to strongly
reduce complement activation and increase blood circulation time
(Gref R et al. in Microparticulate systems for the delivery of
proteins and vaccines, Eds. S. Cohen and Howard Bernstein, Marcel
Dekker, New York 1996, p 279-305; Hawley A E et al. Pharm Res.
1997; 14:657-61). Enrichment in the lymph nodes upon subcutaneous
injection was also enriched compared to naked PLGA nanoparticles
(Hawley A E et al. Pharm Res. 1997; 14:657-61). When polystyrene or
PLGA nanoparticles were coated with PLA-PEG copolymer, maximal
lymph node enrichment was obtained with the shorter PEG chain (750
Da PEG, PLA:PEG 1.5:0.75; Hawley A E et al. Pharm Res. 1997;
14:657-61). Longer PEG chains led to increased drainage from the
injection site and lower lymph node levels, suggesting less
efficient capture by lymph node macrophages and hence increased
systemic distribution as a result of the increased steric barrier
of the longer PEG chains. When PLA-PEG (PLA:PEG 1.5:0.75) was
incorporated in the PLGA nanoparticles during the precipitation
process, the highest lymph node enrichment was obtained with
nanoparticles having an intermediate percentage of PLA-PEG (35%),
while particles with 45% PLA-PEG had increased systemic
distribution, as reflected by higher blood and liver levels. Thus,
variation of the PEG chain length and of the percentage of the PEG
copolymer incorporated in the nanoparticles allows manipulation of
the pharmacokinetic properties of the nanoparticles.
[0130] The methods for the preparation of PEG-PLA and PEG-PLGA
nanoparticles are similar to the methods used for the preparation
of PLA and PLGA nanoparticles, and have been reviewed by
Avgoustakis K (Curr Drug Deliv. 2004; 1:321-33) and Gref R. et al.
(in Microparticulate systems for the delivery of proteins and
vaccines, Eds. S. Cohen and Howard Bernstein, Marcel Dekker, New
York 1996, p 279-305). These methods include the emulsion-solvent
evaporation method, the solvent displacement method and the
salting-out method. Use of the salting-out method for the
preparation of nanocapsules is also described therein. Methods for
synthesizing block copolymers are know in the art. One method of
preparing diblock copolymers (e.g. PEG-PLA) by ring-opening
polymerization of monomers (lactide, glycolide, caprolactone or
mixtures of them) on monomethoxy-PEG catalyzed by stannous octoate,
as well as the preparation and use of multiblock copolymers for the
preparation of nanoparticles is described and reviewed by
Avgoustakis K (Curr Drug Deliv. 2004; 1:321-33) and references
therein.
[0131] Variation of the PLA/PEG and PLGA/PEG allows to manipulate
the structure of the nanoparticles produced. For example, a low
ratio generates more dynamic type of particles, while higher ratios
favour more solid-like structures. A shorter PLA or PLGA chain
length (x<30) can lead to nanoparticle formation via micelle
formation process, while with longer chain length an
agglomeration-precipitation process is taking place Avgoustakis K
(Curr Drug Deliv. 2004; 1:321-33).
[0132] In a further embodiment of the invention, the nanoparticle
is a polyalkylcyanoacrylate nanoparticle. Polyalkylcyanoacrylate
nanoparticles may be prepared as described by Fattal E. et al. (J.
Contr. Release 1998; 53:137-143), using an emulsion polymerization
process. The nanoparticles are then coated with a cationic
hydrophobic reagent, such as cetyltrimethylammonium bromide (CTAB),
and the ISS-NA is adsorbed on the nanoparticle. In an alternative
method, such as described by Zobel et al. (Antisense Nucleic Acid
Drug Dev. 1997; 7:483-493), where nanoparticles are produced in an
aqueous dispersion polymerization process. The surfactant used is
DEAE-dextran, which allows subsequent adsorption of ISS-NA on the
surface of the nanoparticle through electrostatic interactions.
Particles of sizes ranging from about 170-1000 nm were obtained by
Zobel et al.
[0133] In a further embodiment, the nanoparticle is a PEG-coated
polycyanoacrylate nanoparticle, such as described by Li Y. et al.
(Int J Pharm. 2003; 259:93-101), whereby the additional covalent
attachment of transferrin to the nanoparticles is omitted. The
nanoparticles are prepared by a water-in-oil-in-water emulsion
solvent evaporation technique, using poly(aminopoly(ethylene
glycol)-cyanoacrylate-co-hexadecyl cyanoacrylate)
(poly(H.sub.2NPEGCA-co-HDCA)) as polymer. Briefly, the ISS-NA
diluted in buffer (e.g. NaHCO.sub.3, pH 8) is emulsified in
dichloromethane/ethyl acetate (1:1) containing
poly(H.sub.2NPEGCA-co-HDCA) by sonication. The resulting emulsion
is poured into a 1% w/v PVA aqueous solution, and further
emulsified. The percentage of PVA may be varied, and in particular
a higher percentage (3% in 0.1 M NaHCO.sub.3, pH 8) has been shown
to limit damage to dsDNA (Li Y. et al. (Int J Pharm. 2003;
259:93-101). The resulting double emulsion is then diluted in a
0.3% w/v PVA aqueous solution, under magnetic stirring. The organic
solvents are then eliminated by evaporation under reduced pressure
in a Rotavapor at 37.degree. C., and the nanoparticles collected by
centrifugation at 39000 g. Particle sizes obtained by Li et al.
ranged from about 130 to 150 nm. In one embodiment, the ISS-NA is
an unmethylated CpG-containing oligonucleotide.
[0134] Packaging of ISS-NA, and in particular unmethylated
CpG-containing oligonucleotide in a particle produced by an
emulsion-solvent evaporation technique or spray-dry technique, will
be exemplified in the following for polyester nanoparticles.
However, it is apparent for the artisan that similar procedures can
be applied for PACA and PEG-PACA nanoparticles. Packaging of
ISS-NA, such as for example unmethylated CpG-containing
oligonucleotide, within polyester nanoparticles such as PLA, PLGA,
PECL, PEG-PLA, PEG-PLGA or PEG-PECL nanoparticles, can be performed
in several ways. In one method, ISS-NA is added to the initial
water phase of the water-in-oil-in-water emulsion solvent
evaporation technique, as has been reported by Aukunuru J. V. et
al. (J. Pharm. Pharmacol. 2003; 55:1199-206). In another method,
the ISS-NA is suspended in the organic solvent, e.g.
dichloromethane, by sonication, and then spray dried to yield
nanoparticles having packaged the ISS-NA. In certain embodiments,
the capacity of a nanoparticle to package an ISS-NA, and in
particular an ODN, is increased by adding a complexation agent,
such as lysine rich oligopeptide (Emile C. et al. Drug Deliv 1996;
3:187-195), PLL, PEI, spermine or a salt such as Zinc acetate
(Putney S D et al. Antisense Nucleic Acid Drug Dev. 1999; 9:451-8).
An insoluble complex results from the mixing of the complexation
agent and the ISS-NA in an aqueous solution, which can be
incorporated into nanoparticles. As would be understood, the
optimal ratio of complexation agent to ISS-NA, and when the
complexation agent is PEI or PLL, the optimal length of the PLL or
PEI, and when the complexation agent is PEI whether branched or
linear PEI is chosen, have to be determined empirically. For
example, a solution of the polymer, a complexation agent such as a
lysine rich peptide, and of a ISS-NA such as an ODN, in acetone, is
poured dropwise in an aqueous solution as reported by Emile C. et
al. (Drug Deliv 1996; 3:187-195). The complex of the ISS-NA and the
complexation agent precipitates with the polymer to form
nanoparticles packaged with the ISS-NA. In one embodiment, the
complex of the ISS-NA and the complexation agent is suspended in an
organic solvent, e.g. methylene chloride, and incorporated and
packaged in a PLGA nanoparticle using a spray-dry technique (Putney
S D et al. Antisense Nucleic Acid Drug Dev. 1999; 9:451-8; Pamujula
S et al. J Pharm Pharmacol 2004; 56:1119-25).
[0135] In a further embodiment said nanoparticle is a Block
copolymer-coated calcium phosphate nanoparticle (CaP-PEG-PAA;
Kakizawa et al. (2004) J. Contr. Release 97:345-56). These are
core-shell particles suitable for packaging ISS-NA, preferably
unmethylated CpG-containing oligonucleotides. They comprise a core
of nanocrystals of CaP, surrounded by a hydrophilic tethered layer
of PEG. Mixing of a calcium-, and a phosphate-containing solution
in the presence of ISS-NA and PEG-block-poly(aspartic acid)
(PEG-PAA) leads to the spontaneous formation of nanoparticles
incorporating ISS-NA. In one embodiment the ISS-NA is an
unmethylated CpG-containing oligonucleotide. The PAA-segment of
PEG-PAA has high binding affinity for CaP, and the non-ionic and
hydrophilic PEG has a steric stabilization function. Particle size
can be adjusted by varying the PEG-PAA and phosphate concentration,
as seen in FIG. 1 of Kakizawa et al. (2004) J. Contr. Release
97:345-56. Typical sizes obtained are between about 100 to about
300 nm. A critical minimal amount of PEG-PAA is required to prevent
aggregation of the nanoparticles, while it higher levels, it starts
to compete with ISS-NA for CaP binding, and optimal concentration
and ratios of the components have to be determined empirically as
taught by Kakizawa et al. Increasing phosphate concentration from
1.5 mM to 3 mM, for example, led to a higher ODN binding capacity
(Kakizawa et al. (2004) J. Contr. Release 97:345-56).
[0136] Preparation of PEG-PAA and of the nanoparticles has been
described in detail in (Kakizawa et al. (2004) J. Contr. Release
97:345-56). In essence, a solution containing CaCl.sub.2, Tris, a
low EDTA amount and ISS-NA is added quickly to an equal volume of a
solution containing Hepes, Disodium Hydrogen phosphate and PEG-PAA.
The resulting mixture is vigorously stirred by a vortex mixer and
incubated at 37.degree. C. for 24 hours. Kakizawa et al. envisage
the use of Ca-P-PEG-PAA nanoparticles for delivery of siRNA to the
cytoplasm, where they expect fast dissolution of the CaP core in
the cytoplasm due to the lower Ca.sup.2+ concentration and higher
phosphate concentration. The ISS-NA of the present invention to be
packaged into nanoparticles do not require delivery to the
cytoplasm. For example, as for other ODN-cation interactions, ODN
release can take place in low-pH compartments such as
endosomes.
[0137] In another embodiment said nanoparticle is an alginate-PLL
nanoparticle. Sodium alginate is a natural polysaccharide with
mannuronic and guluronic acid as its constituents. Aynie et al.
(Antisense Nucleic Acid Drug Dev. 1999; 9:301-12) have described
alginate nanoparticles cross-linked by PLL to which ODN are bound.
The preparation of the particles is a two-step process, where an
initial alginate pre-gel is produced by the addition of calcium
chloride under magnetic stirring, and second PLL is added to form a
polyelectrolyte complex with the remaining free charges of the
pre-gel. ISS-NA is added either simultaneously with PLL to the
pre-gel, or after nanoparticle formation. In a preferred embodiment
said nanoparticle comprises or alternatively essentially consists
of Polylysine polymers of MW 3900 and 7900, wherein preferably said
ISS-NA is an unmethylated CpG-containing oligonucleotide. Aynie et
al. report particle sizes of 200-600 nm, and ODN loading of
approximately 10%. The loading capacity of the alginate
nanoparticles however did not reach saturation under the conditions
described by Aynie et al., while the encapsulation efficiency was
100%. Alginate-PLL nanoparticles have thus a high ODN loading
capacity and are used in embodiments of the invention to package
ODN or ISS-NA.
[0138] In a further preferred embodiment, the nanoparticle is a
chitosan nanoparticle. Chitosan is a positively charged
polysaccharide polymer prepared from chitin by deacetylation. The
preparation of chitosan nanoparticles has been described for
example by Roy K. et al. (Nat Med. 1999; 5:387-91) or Mao H Q et
al. (J Control Release. 2001; 70:399-421), who obtained
nanoparticles of 150-300 nm in size. These authors used a
coacervation process, whereby a Chitosan solution in sodium
acetate, is mixed to a solution of ISS-NA in sodium sulphate under
vortexing at 55.degree. C. Parameters such as temperature, pH,
concentration of chitosan, of sodium sulphate, molecular weight of
chitosan and DNA may be varied to obtain optimal nanoparticles. In
some embodiments the chitosan nanoparticle are further reacted with
an N-hydroxy-succinimide derivative of PEG (Leong K W. et al. J
Control Release. 1998; 53:183-193). In other embodiments the
chitosan nanoparticles are further concomitantly reacted with the
homobifunctional cross-linking agent DSS (a
bis-N-hydroxysuccinimide compound) (Leong K W. et al. J Control
Release. 1998; 53:183-193). In one embodiment, the ISS-NA is an
unmethylated CpG-containing oligonucleotide.
[0139] In a further preferred embodiment, said nanoparticle is a
cationized-gelatin nanoparticle, wherein preferably said ISS-NA is
an unmethylated CpG-containing oligonucleotide, preferably G10 (SEQ
ID NO:27). The preparation of cationized-gelatin nanoparticle has
been described by Zwiorek K. et al. (J Pharm Pharmaceut Sci 2004;
7:22-28) or Zillies J and Coester C (J Pharm Pharmaceut Sci 2004;
7:17-21), who report nanoparticles with sizes of 180-280 nm. A
two-step desolvation technique is used to generate nanoparticles,
which after resuspension in a buffer at pH 4.5, are further
derivatized with cholamine in the presence of EDC. ISS-NA is
subsequently packaged in the nanoparticles by resuspending the
nanoparticles in a solution of ISS-NA and further incubating the
resulting mixture. Zwiorek et al. obtained particles of sizes
ranging from 180-290 nm. Further guidance in preparing gelatin
nanoparticles is provided by Azarmi S. et al. (J. Pharm.
Pharmaceut. Sci. 2006; 9:124-132), who uses glutaraldehyde instead
of EDC for cross-linking the nanoparticles.
[0140] In a further preferred embodiment said nanoparticle is a
gelatin nanosphere, wherein preferably said ISS-NA is an
unmethylated CpG-containing oligonucleotide. Gelatine nanospheres
are prepared as described by Truong-Le V L et al. Hum Gene Ther.
1998; 9:1709-1717), by a coacervation technique with
Na.sub.2SO.sub.4 at low pH, and whereby the particles are
cross-linked with EDC but omitting transferrin in the reaction
mixture. Particle of sizes 300-600 nm were obtained by Truong-Le et
al. In a preferred embodiment said nanoparticle is a
gelatine-cholamin nanoparticle.
[0141] In a further preferred embodiment, said nanoparticle is an
albumin nanoparticle, wherein preferably said ISS-NA is an
unmethylated CpG-containing oligonucleotide. Preparation of albumin
nanoparticles has been described, for example, by Irache J M et al.
(Mini Rev Med Chem. 2005; 5:293-305), who report nanoparticles with
a size of 250-300 nm. In very preferred embodiment, the albumin
nanoparticles are made from human serum albumin. Albumin
nanoparticles are prepared by a coacervation or desolvation
process, and subsequently stabilized by cross-linking with
glutaraldehyde. In one method, ISS-NA is incubated with an albumin
aqueous solution (2% w/v), and the mixture is desolvated with
ethanol, which induces formation of nanoparticles. These are then
cross-linked with glutaraldehyde. As described by Wartlick et al.
(J Control Release. 2004; 96:483-495), stability of the
nanoparticles can be optimized by adjusting the concentration of
glutaraldehyde during the cross-linking step. In one further
embodiment, the albumin nanoparticle is a protamine-albumin-ISS-NA
nanoparticle (Vogel V. et al. J control release. 2005; 103:
99-11).
[0142] In one further embodiment, the albumin nanoparticle is a
protamine-albumin-ISS-NA nanoparticle (Weyermann et al. J control
release. 2004; 100: 411-423; Vogel V. et al. J control release.
2005; 103: 99-11; Mayer G. et al. J control release 2005;
106:181-187). Nanoparticles useful in the practice of the invention
also include the nanoparticles described by Kumar MNVR (J. Pharm.
Pharmaceut. Sci. 2000; 3:234-258).
[0143] In a further preferred embodiment, said nanoparticle is a
methacrylate-based hydrogel nanoparticle. Preparation of such
nanoparticle as well as the adsorption of ISS-NA has been described
by Jain S. et al. (Biomacromolecules. 2005; 6:2590-600), who
obtained particles of about 500 nm in size. These nanoparticles are
prepared by a two-phase miniemulsion polymerization process. The
emulsion is formed in a near saturated salt solution of pluronic
F-68 as described by Jain S. et al, except that no ovalbumin is
included in the process. PEG-methacrylate, methacrylic acid and
PEG-dimethacrylate are added to the pluronic salt solution under
stirring. The resulting solution is heated to 40.degree. C.,
causing phase separation and emulsion, and polymerization is
initiated by addition of ammonium persulfate and sodium meta
bisulfite. The nanoparticles are isolated by centrifugation, and
poly(L-arginine) followed by ISS-NA are adsorbed onto the
hydrophobic nanoparticles.
[0144] In a further preferred embodiment, said nanoparticle is a
methyl methacrylate-based cationic nanoparticle. Preparation of
such nanoparticles has been described by Tondelli L. et al. (J
Biomater Sci Polymer Edn 2003; 14:1209-1227), who obtained
nanoparticles of 500-1000 nm. Methylmethacrylate is mixed with a
PEG-derivatized methyl methacrylate and a methacryl methacrylate
derivative containing a quaternary ammonium ion in an emulsion
polymerization reaction initiated with potassium persulfate. ISS-NA
is then incubated with the cationic nanoparticle.
[0145] In a further preferred embodiment, said nanoparticle is a
PLL-modified silica nanoparticle. Preparation of the nanoparticles
is described by Zhu S G. et al. (Biotechnol Appl Biochem 2004;
39:179-187), who obtained nanoparticles of 20 nm in size. The
nanoparticles are prepared using a water-in-oil microemulsion where
hydrolysis and condensation reactions of tetraethoxysilane is
initiated with ammoniumhydroxide. Silica nanoparticles are
activated in carbonate buffer before addition of PLL, and ISS-NA is
further incubated with washed PLL-silica nanoparticles.
[0146] Nanoparticles suitable in the practice of the invention can
be tested for activation of bone marrow derived dendritic cells
(BMDCs) as described in Example 11. Alternatively, in addition to
interleukin-12 (IL-12) secretion, activity of the nanoparticle in
this assay may be identified by detecting interleukin-6 (IL-6) or
IFN-alpha in supernatants, or by quantifying CD-86 upregulation on
BMDCs upon nanoparticle incubation by fluorescent associated
cell-sorting. Importantly, these assays are reproducible when using
an identical batch of BMDCs, which can be frozen. Comparison
between active agents should therefore be performed with the same
batch of BMDCs.
[0147] In a preferred embodiment, nanoparticles with unmethylated
CpG-containing oligonucleotide induce activation of BMDCs in the
cellular assay described in Example 11 in a similar way to Q.beta.
packaged with G10 oligonucleotide and reach the lymph node upon
subcutaneous injection in mice footpad with a kinetic similar to
Q.beta.-VLP or a polystyrene bead of 20-500 nm size (see Examples 7
and 9). Activation of BMDCs in a way similar to Q.beta. packaged
with G10 oligonucleotide is meant to express that an identical dose
of G10 oligonucleotide package in nanoparticles give a half-maximal
amount of IL-12 secretion within 80%, preferably 60%, more
preferably 50%, 40% and 30% of the amount induced by the same dose
of G10 oligonucleotide packaged in Q.beta.. In a further preferred
embodiment, the nanoparticles are protective in the animal models
of allergy described in the Examples.
[0148] In a preferred embodiment the nanoparticle of the invention
is packaged with ISS-NA, preferably with unmethylated
CpG-containing oligonucleotide, most preferably with Q.beta.G10,
amounting to 0.5 to 80% (w/w) of said particle, preferably 0.5 to
40% (w/w), more preferably 2 to 40% (w/w), still more preferably 6
to 40% (w/w), even more preferably 10 to 40% (w/w), even more
preferably 15 to 40% (w/w), most preferably 18 to 30% (w/w).
[0149] Processes for the preparation of nanoparticles have been
reviewed in Microparticulate systems for the delivery of proteins
and vaccines, Eds. S. Cohen and H. Bernstein, Marcel Dekker, New
York 1996). The microparticles described therein include polyester
microparticles, pegylated-polyester microparticles, polyphosphazene
microparticles, lipospheres and gelatin microparticles. Additional
microparticles include alginate microparticles (Aggarwal N. et al.
Can J Vet Res. 1999; 63:148-52), chitosan microparticles (Aral C
and Akbuga J. J Pharm Pharm Sci. 2003; 6:321-6; Xu W. Et al.
Vaccine. 2004; 22:3603-12). Processes used for the preparation of
nanoparticles where resulting particle size is determined by the
size of the droplet within the emulsion used to prepare the
nanoparticle, can be readily adapted for the preparation of
microparticles, as is well-known in the art, whereby the mixing,
vortexing, high-speed homogenization steps are modified such that
microparticles are produced. The spray-drying method may also be
adapted such that microparticles are generated. Microparticles
useful in the practice of the invention also include the
microparticles described in Kumar MNVR (J Pharm Pharmaceut Sci
2000; 3:234-258).
[0150] Processes for packaging of ISS-NA into nanoparticles
described above can be adapted for packaging ISS-NA into
microparticles, whereby the homogenization or mixing step is
modified as would be known to those skilled in the art, such that
the emulsion produced result in microparticle generation. The
spray-drying method may also be adapted such that microparticles
are generated.
[0151] The properties of polyester microsphere, and PLGA
microsphere in particular, as well as methods to produce them have
been reviewed and described for example by Kissel T and Koneberg R
(in Microparticulate systems for the delivery of proteins and
vaccines, Eds. S. Cohen and H. Bernstein, Marcel Dekker, New York
1996, p. 51-87). These methods include spray drying methods,
water-in-oil-in-water emulsion solvent evaporation methods and
phase separation methods. A favored molar ratio of the monomers
constituting PLGA is 50% mol LA and 50% mol GA. Increasing the
proportion of either of the monomer leads to slower degradation of
the polymer. For example, a polymer with a ratio of LA to GA of
85:15 has a rate of degradation about two-and a half time slower
than with a ratio of 50:50. Thus, the properties of PLGA polymer
can be manipulated by changing the proportion of the monomers.
[0152] In one embodiment said synthetic particle is a liposome,
wherein said liposome is a lipid vesicles consisting of a lipid
bilayer. Liposomes can be packaged with ISS-NA using methods known
in the art. The liposome of the invention may be selected from the
group consisting of neutral liposome, anionic liposome, cationic
liposome, stealth, or cationic stealth. In a preferred embodiment,
the liposome is a cationic liposome. The liposome may have a
diameter between 100 and 800 nm, preferably between 100 and 400 nm,
more preferably between 100 and 300 nm, even more preferably
between 100 and 200 nm, most preferably 200 nm.
[0153] In a preferred embodiment, the liposome exhibits positive
charges in order to facilitate interaction of liposomes with target
cells. In some embodiments, the liposome comprises a cationic
lipid, a colipid, and a stabilizing additive. In another
embodiment, the liposome comprises
dimethylaminoethane-carbamol-cholisterol, and/or
dioleoylphosphatidylethanolamine, and/or polyethylene glycol
derivatized phosphatidylethanolamine. In a preferred embodiment,
the liposome comprises phosphatidylcholine, and/or cholesterol,
and/or DL-.alpha.-tocopherol, preferably phosphatidylcholine,
cholesterol, and DL-.alpha.-tocopherol. Generation of such
liposomes is well established e.g. in Bangham et al., (1965), J.
Mol. Biol., 13, 238-252; Gursel et al., (2001), J Immunol 167:
3324; or Ludewig et al., (2000), Vaccine, 19, 23-32, the disclosure
of which is incorporated herein by reference in its entirety.
[0154] Preferred liposomes and the packaging of ISS-NA in liposomes
is described in WO2005/014110A1, which is incorporated herein by
reference. ISS-NA may be mixed with preformed vesicles comprising
or preferably essentially consisting of, most preferably consisting
of cationic lipids, may be mixed directly with cationic lipid,
resulting in lipoplexes, or in a preferred embodiment, encapsulated
within the aqueous space enclosed by a lipid bilayer. In a further
embodiment, said liposome is a lipopolyplex (Pelisek J. et al. J
Gene Med 2006; 8:186-197). In one embodiment, the liposome is a
microencapsulated liposome, in an alginate-PLL coat, as described
by Cohen S. et al. Proc. Natl. Acad. Sci. USA 1991;
88:10440-10444). In a preferred embodiment, the ISS-NA, preferably
an unmethylated CpG-containing oligonucleotide, is packaged within
a "stabilized antisense-lipid particle" containing preferably
PEG-ceramide-C14, as described by Semple S. C. et al. Methods
Enzymol. 2000; 313:322-41. In the performance of this method for
the practice of the invention, the antisense oligonucleotide is
replaced by an ISS-NA, and in particular an unmethylated
CpG-containing oligonucleotide. These liposomes are prepared with
cationic lipids that are only charged at subphysiological pH. Hence
the ISS-NA or unmethylated CpG-containing oligonucleotide bound to
the outer surface of liposomes during the liposome preparation at
low pH can be subsequently dissociated and eliminated by anion
exchange chromatography once the preparation has been brought back
to neutral pH. Suitable further liposomes, methods of preparation
as well as methods for ISS-NA and in particular oligonucleotides,
can be found in Semple S. C. et al. Methods Enzymol. 2000;
313:322-41 and references therein. Methods for preparing liposomes
include the dry lipid hydration method, the reverse phase hydration
method, the detergent dialysis method, the minimal volume
entrapment method. In certain embodiments, packaging of the ISS-NA
in particular an unmethylated CpG-containing oligonucleotide is
facilitated by using an ISS-NA or unmethylated CpG-containing
oligonucleotide substituted by a residue selected from the group
consisting of C6-C30 alkyl chain, bile acids, cholic acid,
taurocholic acid, desoxycholate, cholesterol, oleyl litocholic
acid, oleoyl cholenic acid, glycolipids, phospholipids,
sphingolipids, isoprenoids, steroids, vitamins, vitamin E,
saturated fatty acids, unsaturated fatty acids, fatty acid esters,
triglycerides.
[0155] In one aspect of the invention, the ISS-NA in liposomes are
used to induce systemically increased levels of IFN-alpha. Such
elevated levels of IFN-alpha are known to be therapeutically active
in hypersensitivity, preferably allergy.
[0156] In a further embodiment, said synthetic particle is a
virosome, wherein preferably said visosome is a reconstituted virus
envelope of a influenza virus, wherein further preferably said
influenza virus is a influenza A virus, wherein still further
preferably said influenza A virus is influenza A/Singapore virus.
Virosomes comprising cationic (positively charged) lipids are
especially suited to deliver nucleic acids to a target cell. In a
further embodiment, said synthetic particle is a virosome, wherein
said virosome comprises a lipid membrane, wherein said lipid
membrane comprises or preferably essentially consists of cationic
lipids. In a very preferred embodiment, said synthetic particle is
a virosome and said ISS-NA is a unmethylated CpG-containing
oligonucleotide, wherein preferably said unmethylated CpG
containing oligonucleotide is G10 (SEQ ID NO:27), and wherein
further preferably said virosome comprises a lipid membrane,
wherein said lipid membrane comprises or preferably essentially
consists of cationic lipids. In a further preferred embodiment said
virosome comprises a lipid membrane, wherein said lipid membrane
comprises antibodies or fragments thereof, wherein preferably said
antibodies specifically interact with a receptor of a target
cell.
[0157] Synthetic particles of the invention, preferably
microparticles and nanoparticles, most preferably nanoparticles may
be injected subcutaneously, intravenously, intradermally,
intraperitoneally, administered intranasally, orally, transdermally
or inhaled.
[0158] In a very preferred embodiment said particle is a virus
particle or a virus-like particle (VLP), preferably a VLP. Any
virus known in the art may be selected as a VLP or a virus particle
of the invention. Most commonly known viruses have been sequenced
and are readily available to the public. The taxonomy of viruses is
well known to the artisan and summarized, for example, in H. V. Van
Regenmortel et al. (eds.), Virus Taxonomy: 7.sup.th Report of the
International Committee on Taxonomy of Viruses (2000) (Academic
Press/elsevier, Burlington Mass., USA), on the Virus Taxonomy
web-page of the University of Leicester (UK)
(http://www-micro.msb.le.ac.uk/3035/Virusgroups.html) and by the
Taxonomy Browser of the National Center for Biotechnology
Information (NCBI, Washington D.C., USA)
(http://www.ncbi.nlm.nih.gov/ICTVdb/). The genes encoding viral
coat proteins can be identified by a skilled artisan and their
nucleotide and amino acid sequences may, for example, be obtained
from Genbank (http://www.ncbi.nlm.nih.gov/). Viruses which are
particularly useful in the context of the invention are generally
disclosed in "Artificial DNA--Methods and Applications", Yury
Khudyakov and Howard Fields, eds., CCR Press, 2003.
[0159] Virus particles or VLPs can be produced and purified from
virus-infected cell cultures. For the purpose of the invention,
said virus particles or VLPs are be preferably non-replicative or
non-infectious, more preferably non-replicative and non-infectious.
UV irradiation, chemical treatment, such as with formaldehyde,
.beta.-propione or chloroform, are the general methods known to
skilled person to inactivate a virus. Alternatively, said
non-replicative and non-infectious virus particle or said
non-replicative and non-infectious VLP can be produced by
purification and reassembly of core proteins of said virus.
[0160] In one embodiment said virus particle or VLP, preferably
VLP, is a virus particle or VLP, preferably VLP, of a virus,
wherein said virus may be a DNA virus, including DNA reverse
transcribing viruses, or a RNA virus. In a preferred embodiment
said virus is a DNA virus, wherein said DNA virus is a single
stranded DNA virus, wherein said single stranded DNA virus is
preferably selected from the group consisting of: (a) Parvovirus,
preferably parvovirus B19, porcine parvovirus (PPV) or canine
parvovirus (CPV), (b) Erythrovirus, (c) Dependovirus, (d)
recombinant of CPV with feline panleucopenia virus (FPV) (Saliki.
T. J. et al. (1992) J. Gen. Virol 73:369ff), (e) adeno-associated
virus type 2 (AAV-2), (f) mink enteritis parvovirus (MEV), (g)
muscovy duck parvovirus (DPV), (h) minute virus of mice (MVM), (i)
aleutian mink disease parvovirus (ADV), and (j) Galleria mellonella
densovirus (GMDNV).
[0161] In a further preferred embodiment said DNA virus is a double
stranded DNA virus, including double stranded DNA reverse
transcribing viruses, wherein said double stranded DNA virus is
preferably selected from the group consisting of: (a)
nucleopolyhedrovirus, preferably Autographa californica
nucleopolyhedrovirus (AcMNPV) or a chimera of AcMNPV polyhedrin and
Trichoplusioa ni granulosis virus (TnGV) (Eason J. E. et al.
(1998), J Virol 72:6237ff), (b) papillomavirus, preferably selected
from (i) human papilloma virus (HPV, most preferably HPV6, HPV11,
HPV16, HPV18, or HPV33), (ii) bovine papillomavirus (BPV,
preferably BPV1), and (iii) cottontail rabbit papillomavirus
(CRPV), (c) polyomavirus, preferably selected from (i) murine
polyomavirus (preferably Py or SV40), (ii) budgerigar fledgling
virus, (iii) human polyomavirus JC, (iv) hamster polyomavirus
(HaPV), (v) monkey B-lympotropic papovirus (LPV), (vi) avian
polyomavirus (APV) and (vii) recombinant human and non-human
polyomaviruses (Sasnauskas K. et al (1999) Biol. Chem. 380, 381),
(d) spleen necrosis virus (SNV, Jiang A. (1999) Hum. Gene Therapy
10(16):2627-2636), and, very preferably, (e) Hepatitis B virus.
[0162] In a further preferred embodiment said virus is a RNA virus,
wherein said RNA virus may be a single stranded RNA virus or a
double stranded RNA virus. In a further preferred embodiment said
RNA virus is a single stranded RNA virus, wherein preferably said
single stranded RNA virus is a single stranded positive sense RNA
virus, wherein preferably said single stranded positive sense RNA
virus is selected from: (a) bromoviridae, preferably selected from
(i) alfamovirus (e.g. alfalfa mosaic virus (AlMV)), and (ii)
ilarvirus (e.g. prunus necrotic ringspot ilarvirus (PNRSV, Pallas
V. (1998) Arch. Virol. 144:797-803); prune dwarf virus (PDV,
Abou-Jawdah Y. et al. (2004) J. Virological Methods 121:31-38)),
(iii) bromovirus (e.g. cowpea chlorotic mottle virus (CCMV) or
brome mosaic virus (BMV)), (iv) cucumovirus (e.g. cucumber mosaic
virus, Natilla A. et al. Arch Virol 2004 149(1):137-154), (b)
tombusviridae, preferably (i) tombusvirus, preferably tomato bushy
stunt virus (TBSV, Joelson T. et al. (1997) J. Gen. Virol.
78:1213-1217), (ii) carmovirus, turnic crinkle virus (TCV, Qu F.
and Morris T. J. (1997) J. Virol. 71(2):1428-1435), (c) potyvirus,
preferably Johnsongrass mosaic virus (JGMV) and plum pox potyvirus
(PPV, Fernandez-Fernandes M. R. et al. (2002) J. Virol.
76(24):12646-12653), (d) tobacco mosaic virus (TMV), (e) comovirus,
preferably cowpea mosaic virus (CPMV), (f) potato virus X (PVX,
Marusic C. et al. (2001) J. Virol. 75(18):8434-8439, (g)
calicivirus, preferably selected from (i) norwalk virus (NV), (ii)
norwalk-like calcivirus, (iii) human calcivirus, (iv) Lorsdale
calcivirus, (v) rabbit hemorrhagic disease virus (RHDV), (vi)
European brown hare syndrom virus (EBHSV), (vii) Toronto virus,
(viii) Hawaii virus, (ix) Sapporo-like virus, and (x) Grimsby
feline calcivirus, (h) RNA bacteriophage, (i) luteovirus,
preferably potato leaf roll virus (PLRV), (j) flock house virus,
(k) retroid viruses, preferably selected from (i) oncoretrovirus,
(ii) lentivirus, and (iii) yeast retrotransposon Ty1, (l)
tick-borne encephalitis virus (TBEV, Leibl H. (1998) Vaccine
16(4):340-345) and (m) togaviridae, preferably alphavirus, most
preferably Sindbis virus.
[0163] In a further preferred embodiment said RNA virus is a single
stranded positive sense RNA virus selected from: (a) bromoviridae,
preferably selected from (i) alfamovirus (e.g. alfalfa mosaic virus
(AIMV)), and (ii) ilarvirus (e.g. prunus necrotic ringspot
ilarvirus (PNRSV, Pallas V. (1998) Arch. Virol. 144:797-803); prune
dwarf virus (PDV, Abou-Jawdah Y. et al. (2004) J. Virological
Methods 121:31-38)), (iii) bromovirus (e.g. cowpea chlorotic mottle
virus (CCMV) or brome mosaic virus (BMV)), (iv) cucumovirus (e.g.
cucumber mosaic virus, Natilla A. et al. Arch Virol 2004
149(1):137-154), (b) tombusviridae, preferably (i) tombusvirus,
preferably tomato bushy stunt virus (TBSV, Joelson T. et al. (1997)
J. Gen. Virol. 78:1213-1217), (ii) carmovirus, turnic crinkle virus
(TCV, Qu F. and Morris T. J. (1997) J. Virol. 71(2):1428-1435), (c)
potyvirus, preferably Johnsongrass mosaic virus (JGMV) and plum pox
potyvirus (PPV, Fernandez-Fernandes M. R. et al. (2002) J. Virol.
76(24):12646-12653), (d) tobacco mosaic virus (TMV), (e) comovirus,
preferably cowpea mosaic virus (CPMV), (f) potato virus X (PVX,
Marusic C. et al. (2001) J. Virol. 75(18):8434-8439, (g)
calicivirus, preferably selected from (i) norwalk virus (NV), (ii)
norwalk-like calcivirus, (iii) human calcivirus, (iv) Lorsdale
calcivirus, (v) rabbit hemorrhagic disease virus (RHDV), (vi)
European brown hare syndrom virus (EBHSV), (vii) Toronto virus,
(viii) Hawaii virus, (ix) Sapporo-like virus, and (x) Grimsby
feline calcivirus, (h) RNA bacteriophage, (i) luteovirus,
preferably potato leaf roll virus (PLRV), (j) flock house virus,
(k) retroid viruses, preferably selected from (i) oncoretrovirus,
(ii) lentivirus, and (iii) yeast retrotransposon Ty1, (l)
tick-borne encephalitis virus (TBEV, Leibl H. (1998) Vaccine
16(4):340-345), (m) togaviridae, preferably alphavirus, most
preferably Sindbis virus, and (n) Nodaviridae, preferably
Alphanodavirus, most preferably Pariacoto virus (Johnson K. N. et
al. (2004) Journal of Virology 78:11371-11378).
[0164] In a further preferred embodiment said RNA virus is a double
stranded RNA virus, wherein preferably said double stranded RNA
virus is selected from: (a) birnavirus, (b) cypovirus, preferably
Bombyx mori cytoplasmic polyhedrovirus (BmCPV), (c) orbivirus,
preferably bluetoung virus (BTV) or African horse sickness virus
(AHSV), (d) rotavirus and, very preferably, (e) double stranded RNA
bacteriophages, preferably selected from (i) bacteriophage 8, (ii)
bacteriophage phi6, (iii) bacteriophage phi12, and (iv)
bacteriophage phi12.
[0165] In a further preferred embodiment said virus particle or VLP
is a virus particle or VLP of a virus, wherein said virus is a
bacteriophage, wherein said bacteriophage may be a DNA
bacteriophage or an RNA bacteriophage.
[0166] In a preferred embodiment said bacteriophage is a DNA
bacteriophage, wherein said DNA bacteriophage may be a single
stranded DNA bacteriophage or a double stranded bacteriophage. In a
preferred embodiment, said DNA bacteriophage is a single stranded
DNA bacteriophage, wherein said single stranded DNA bacteriophage
is preferably selected from (a) Microviridae, preferably Phi X 174
and (b) Inoviridae, preferably fd and M13. In a further preferred
embodiment, said DNA bacteriophage is a double stranded DNA
bacteriophage, wherein said double stranded DNA bacteriophage is
preferably selected from the group consisting of: (a) Myoviridae,
preferably T2, T4 or T6, (b) Siphoviridae, preferably bacteriophage
Lambda, T1, T5 or HK97, (c) Podoviridae, preferably T2, T7 or P22,
(d) Tectiviridae, preferably PRD1, (e) Corticoviridae, preferably
PM2, (f) Plasmaviridae, preferably mycoplasma phages, (g)
Lipothrixviridae, preferably Thermoproteus bacteriophage TTV1 and
(h) Fuselloviridae, preferably sulfolobus bacteriophage 1.
[0167] In a more preferred embodiment said bacteriophage is an RNA
bacteriophage, wherein said RNA bacteriophage may be a single
stranded or a double stranded RNA bacteriophage. In one embodiment
said RNA bacteriophage is a single stranded RNA bacteriophage,
wherein preferably said single stranded RNA bacteriophage is an
enterobacteriophage, wherein preferably said enterobacteriophage is
a representative of the Leviviridae, wherein preferably said
representative of the Leviviridae is selected from the group
consisting of: (a) taxonomically not assigned family member
Acinetobacter phage 205 (AP205), (b) levivirus, and, preferably (c)
allolevivirus.
[0168] In a preferred embodiment said representative of the
Leviviridae is a levivirus, wherein preferably said levivirus is
selected from the group consisting of: (a) bacteriophage BZ13, (b)
bacteriophage GA, (c) bacteriophage JP34, (d) bacteriophage KU1,
(d) bacteriophage TH1, (e) bacteriophage MS2, (f) bacteriophage f2,
(g) bacteriophage fr, (h) bacteriophage JP501, (i) bacteriophage
M12, (j) bacteriophage R17, and (k) bacteriophage PP7.
[0169] In a more preferred embodiment said representative of the
Leviviridae is an allolevivirus, wherein preferably said
allolevivirus is selected from the group consisting of: (a)
bacteriophage FI, (b) bacteriophage ID2, (c) bacteriophage NL95,
(d) bacteriophage SP, (d) bacteriophage TW28, (e) bacteriophage
Q.beta., (f) bacteriophage M11, (g) bacteriophage MX1, (h)
bacteriophage ST, (i) bacteriophage TW18, and (j) bacteriophage
VK.
[0170] In a further preferred embodiment said RNA bacteriophage is
selected from the group consisting of: (a) bacteriophage BZ13, (b)
bacteriophage GA, (c) bacteriophage JP34, (d) bacteriophage KU1,
(d) bacteriophage TH1, (e) bacteriophage MS2, (f) bacteriophage f2,
(g) bacteriophage fr, (h) bacteriophage JP501, (i) bacteriophage
M12, (j) bacteriophage R17, (k) bacteriophage PP7, (l)
bacteriophage FI, (m) bacteriophage ID2, (n) bacteriophage NL95,
(o) bacteriophage SP, (p) bacteriophage TW28, (q) bacteriophage
Q.beta., (r) bacteriophage M11, (s) bacteriophage MX1, (t)
bacteriophage ST, (u) bacteriophage TW18, and (v) bacteriophage VK.
In a further preferred embodiment said RNA bacteriophage is
selected from the group consisting of: (a) bacteriophage Q.beta.,
(b) bacteriophage R17, (c) bacteriophage fr, (d) bacteriophage GA,
(e) bacteriophage SP, (f) bacteriophage MS2, (g) bacteriophage M11,
(h) bacteriophage MX1, (i) bacteriophage NL95, (k) bacteriophage
f2, (l) bacteriophage PP7, and (m) bacteriophage AP205.
[0171] In a further preferred embodiment said RNA bacteriophage is
a double stranded RNA bacteriophage, wherein preferably said double
stranded RNA bacteriophage is a representative of the Cystoviridae,
more preferably said representative of the Cystoviridae is a
Cystovirus, most preferably said Cystovirus is pseudomonas
bacteriophage Phi 6.
[0172] In a preferred embodiment said particle is a virus particle
of a bacteriophage, and wherein preferably said bacteriophage is a
RNA bacteriophage, wherein further preferably said RNA
bacteriophage is a single stranded positive sense RNA
bacteriophage, and wherein still further preferably said single
stranded positive sense RNA bacteriophage is a single stranded
positive sense RNA bacteriophage selected from the group consisting
of: (a) bacteriophage Q.beta., (b) bacteriophage fr, (c)
bacteriophage GA, and (d) bacteriophage AP205, most preferably said
single stranded positive sense RNA bacteriophage is Q.beta..
[0173] In a very preferred embodiment, said particle is a VLP,
preferably a VLP of an RNA virus, more preferably a VLP of a single
stranded positive sense RNA virus, most preferably a VLP of an RNA
bacteriophage.
[0174] In a further preferred embodiment said particle is a VLP of
a bacteriophage, more preferably a VLP of a enterobacteriophage,
still more preferably a VLP of a representative of the Leviviridae,
most preferably a VLP of a levivirus or an allolevivirus. I a very
preferred embodiment said VLP is a VLP of an allolevivirus.
[0175] In a further embodiment said particle is a virus particle or
a VLP, preferably a VLP, of a icosahedral virus, wherein said
icosahedral virus is preferably a plant-infectious icosahedral
virus. VLPs of plant-infectious icosahedral viruses are for example
disclosed in WO2005/067478A2 which is incorporated herein by
reference. In a preferred embodiment said icosahedral virus is
selected from a representative of any one taxon selected from the
group consisting of (a) Papillomaviridae, (b) Totiviridae, (c)
Dcistroviridae, (d) Hepadnaviridae, (e) Togaviridae, (f)
Polyomaviridae, (g) Nodaviridae, (h) Tectiviridae, (i) Leviviridae,
(j) Microviridae, (k) Sipoviridae, (l) Picomoviridae, (m)
Parvoviridae, (n) Calciviridae, (o) Tetraviridae, and (p) Satellite
viruses. In a preferred embodiment, said icosahedral virus is a
plant-infectious icosahedral virus, wherein said plant-infectious
icosahedral virus is a representative of any one taxon selected
from the group consisting of (a) Bunyaviridae, (b) Reoviridae, (c)
Rhabdoviridae, (d) Luteoviridae, (e) Nanoviridae, (f)
Partitiviridae, (g) Sequiviridae, (h) Tymoviridae, (i) Ourmiavirus,
(j) Tobacco Necrosis Virus Satellite, (k) Caulimoviridae, (l)
Geminiviridae, (m) Comoviridae, (n) Sobemovirus, (o) Tombusviridae,
and (p) Bromoviridae. In a further preferred embodiment, said
plant-infectious icosahedral virus is a representative of any one
taxon selected from the group consisting of (a) Luteoviridae, (b)
Nanoviridae, (c) Partitiviridae, (d) Sequiviridae, (e) Tymoviridae,
(f) Ourmiavirus, (g) Tobacco Necrosis Virus Satellite, (h)
Caulimoviridae, (i) Geminiviridae, (j) Comoviridae, (k)
Sobemovirus, (l) Tombusviridae, and (m) Bromoviridae. In a further
preferred embodiment, said plant-infectious icosahedral virus is a
representative of any one taxon selected from the group consisting
of (a) Caulimoviridae, (b) Geminiviridae, (c) Comoviridae, (d)
Sobemovirus, (e) Tombusviridae, and (e) Bromoviridae. In a further
preferred embodiment, said plant-infectious icosahedral virus is a
representative of any one taxon selected from the group consisting
of the (a) Comoviridae, (b) Sobemovirus, (c) Tombusviridae, and (d)
Bromoviridae. In a further preferred embodiment, said
plant-infectious icosahedral virus is a representative of any one
taxon selected from Comoviridae and Bromoviridae. In a very
preferred embodiment said plant-infectious icosahedral virus is a
Cowpea Mosaic Virus or a Cowpea Chlorotic Mottle Virus. In a
further preferred embodiment said plant-infectious icosahedral
virus is a representative of the Bromoviridae, preferably
Bromovirus, Cucumovirus, Ilarvirus or Alfamovirus. In a very
preferred embodiment said plant-infectious icosahedral virus is
selected from: brome mosaic virus, cowpea chlorotic mottle virus,
cucumber mosaic virus, Tobacco streak virus and alfalfa mosaic
virus (AMV, including AMV1 and AMV2).
[0176] In a further preferred embodiment said VLP is a synthetic
VLP.
[0177] In a further preferred embodiment, the VLP is a recombinant
VLP. The preparation of VLPs by recombinantly expressing the coat
protein in a host is within the common knowledge of a skilled
artisan. Illustrative DNA or RNA viruses, the coat or capsid
protein of which can be used for the preparation of VLPs have been
disclosed in WO 2004/009124 on page 25, line 10-21, on page 26,
line 11-28, and on page 28, line 4 to page 31, line 4. These
disclosures are incorporated herein by way of reference.
[0178] In one preferred embodiment, said VLP comprises, or
alternatively consists of, recombinant proteins, mutants or
fragments thereof, of a virus, wherein preferably said virus is
selected from any virus listed above. In a very preferred
embodiment said VLP comprises, or alternatively consists of,
recombinant proteins, mutants or fragments thereof, of a virus,
wherein said virus is selected form the group consisting of: (a)
RNA bacteriophages, (b) bacteriophages, (c) Hepatitis B virus,
preferably its capsid protein (Ulrich, et al., Virus Res.
50:141-182 (1998)) or its surface protein (WO 92/11291), (d)
measles virus (Warnes, et al., Gene 160:173-178 (1995)), (e)
Sindbis virus; (f) rotavirus (U.S. Pat. No. 5,071,651 and U.S. Pat.
No. 5,374,426), (g) foot-and-mouth-disease virus (Twomey, et al.,
Vaccine 13:1603 1610, (1995)), (h) Norwalk virus (Jiang, X., et
al., Science 250:1580 1583 (1990); Matsui, S. M., et al., J. Clin.
Invest. 87:1456 1461 (1991)), (i) Alphavirus, (j) retrovirus,
preferably its GAG protein (WO 96/30523), (k) retrotransposon Ty,
preferably the protein p1; (l) human Papilloma virus (WO 98/15631),
(m) Polyoma virus, (n) Tobacco mosaic virus, and (o) Flock House
Virus. In a very preferred embodiment said VLP comprises, or
alternatively consists of, recombinant proteins, mutants or
fragments thereof, of a virus, wherein said virus is selected form
the group consisting of: (a) Hepatitis B virus, and (b) Polyoma
virus.
[0179] In a further preferred embodiment, said VLP comprises, or
alternatively consists of, recombinant proteins, mutants or
fragments thereof, of a virus, wherein said virus is a
plant-infectious icosahedral virus, wherein preferably said
plant-infectious icosahedral virus is selected from (a)
Comoviridae, (b) Sobemovirus, (c) Tombusviridae, and (d)
Bromoviridae.
[0180] In one preferred embodiment, the VLP comprises or consists
of more than one amino acid sequences, preferably two amino acid
sequences, of the recombinant proteins, mutants or fragments
thereof. VLP comprises or consists of more than one amino acid
sequence is referred, in this application, as mosaic VLP.
[0181] The term "fragment of a recombinant protein" or the term
"fragment of a coat protein", as used herein, is defined as a
polypeptide, which is of at least 70%, preferably at least 80%,
more preferably at least 90%, even more preferably at least 95% the
length of the wild-type recombinant protein, or coat protein,
respectively and which preferably retains the capability of forming
VLP. Preferably, the fragment is obtained by (i) at least one,
preferably exactly one, internal deletion, (ii) at least one,
preferably exactly one, truncation, or (iii) at least one,
preferably exactly one, combination thereof. Further preferably,
the fragment is obtained by at most 5, 4, 3 or 2 internal
deletions, at most 2 truncations or exactly one combination
thereof. Further preferably, the fragment is obtained by at most 5,
4, 3 or 2 internal deletions, wherein still further preferably each
of said deletions comprises 1 to 5, preferably 1 to 4, more
preferably 1 to 3, still more preferably 1 to 2, and most
preferably exactly 1 amino acid.
[0182] The term "fragment of a recombinant protein" or "fragment of
a coat protein" shall further encompass polypeptide, which has at
least 80%, preferably 90%, even more preferably 95% amino acid
sequence identity with the "fragment of a recombinant protein" or
"fragment of a coat protein", respectively, as defined above and
which is preferably capable of assembling into a virus-like
particle.
[0183] The term "mutant coat protein" refers to a polypeptide
having an amino acid sequence derived from the wild type
recombinant protein, or coat protein, respectively, wherein the
amino acid sequence is at least 80%, preferably at least 85%, 90%,
95%, 97%, or 99% identical to the wild type sequence and preferably
retains the ability to assemble into a VLP.
[0184] In one preferred embodiment, the VLP of the invention is VLP
of Hepatitis B virus. The preparation of Hepatitis B virus-like
particles has been disclosed, inter alia, in WO00/32227,
WO01/85208, WO01/056905 and WO2004/000351. All four documents are
explicitly incorporated herein by way of reference. Other variants
of HBcAg suitable for use in the practice of the present invention
have been disclosed in page 34-39 of WO 01/056905. Specifically
preferred Hepatitis B virus VLPs are described on page 43, line 12
to page 49, line 8 of WO2004/000351 and in SEQ IDs NO:19-68, 71 and
97 of WO2004/000351. In one further preferred embodiment of the
invention, a lysine residue is introduced into the HBcAg
polypeptide. In preferred embodiments, VLPs and compositions of the
invention are prepared using a HBcAg comprising, or alternatively
consisting of, amino acids 1-144, or 1-149, 1-185 of SEQ ID NO:1,
which is modified so that the amino acids at positions 79 and 80
are replaced with a peptide having the amino acid sequence of
Gly-Gly-Lys-Gly-Gly (SEQ ID NO:24). This modification changes the
SEQ ID NO:1 to SEQ ID NO:2. In further preferred embodiments, the
cysteine residues at positions 48 and 110 of SEQ ID NO:2, or its
corresponding fragments, preferably 1-144 or 1-149, are mutated to
serine. The invention further includes compositions comprising
Hepatitis B core protein mutants having above noted corresponding
amino acid alterations. The invention further includes compositions
and pharmaceutical compositions respectively, comprising HBcAg
polypeptides which comprise, or alternatively consist of, amino
acid sequences which are at least 80%, 85%, 90%, 95%, 97% or 99%
identical to SEQ ID NO:2.
[0185] In one preferred embodiment of the invention, the virus-like
particle comprises, consists essentially of, or alternatively
consists of, recombinant coat proteins, mutants or fragments
thereof, of a RNA bacteriophage. Preferably, the RNA bacteriophage
is selected from the group consisting of: (a) bacteriophage BZ13,
(b) bacteriophage GA, (c) bacteriophage JP34, (d) bacteriophage
KU1, (d) bacteriophage TH1, (e) bacteriophage MS2, (f)
bacteriophage f2, (g) bacteriophage fr, (h) bacteriophage JP501,
(i) bacteriophage M12, (j) bacteriophage R17, (k) bacteriophage
PP7, (l) bacteriophage FI, (m) bacteriophage ID2, (n) bacteriophage
NL95, (o) bacteriophage SP, (p) bacteriophage TW28, (q)
bacteriophage Q.beta., (r) bacteriophage M11, (s) bacteriophage
MX1, (t) bacteriophage ST, (u) bacteriophage TW18, and (v)
bacteriophage VK. Further preferably, the RNA bacteriophage is
selected from the group consisting of: (a) bacteriophage Q.beta.,
(b) bacteriophage R17, (c) bacteriophage fr, (d) bacteriophage GA,
(e) bacteriophage SP, (f) bacteriophage MS2, (g) bacteriophage M11,
(h) bacteriophage MX1, (i) bacteriophage NL95, (k) bacteriophage
f2, (l) bacteriophage PP7, and (m) bacteriophage AP205.
[0186] In one preferred embodiment of the invention, the virus-like
particle comprises at least one coat protein, mutant or fragment
thereof, of an RNA bacteriophage, wherein the coat protein has an
amino acid sequence selected from the group consisting of: (a) SEQ
ID NO:3 referring to Q.beta. CP; (b) a mixture of SEQ ID NO:3 and
SEQ ID NO:4 (Q.beta. A1 protein); (c) SEQ ID NO:5 (R17 capsid
protein); (d) SEQ ID NO:6 (fr capsid protein); (e) SEQ ID NO:7 (GA
capsid protein); (f) SEQ ID NO:8 (SP capsid protein); (g) a mixture
of SEQ ID NO:8 and SEQ ID NO:9; (h) SEQ ID NO:10 (MS2 capsid
protein); (i) SEQ ID NO:11 (M11 capsid protein); (j) SEQ ID NO:12
(MX1 capsid protein); (k) SEQ ID NO:13 (NL95 capsid protein); (l)
SEQ ID NO:14 (f2 capsid protein); (m) SEQ ID NO:15 (PP7 capsid
protein); and (n) SEQ ID NO:21 (AP205 capsid protein). In a further
preferred embodiment of the present invention, the virus-like
particle comprises coat proteins having an amino acid sequence
selected from the group consisting of: (a) SEQ ID NO:3; (b) a
mixture of SEQ ID NO:3 and SEQ ID NO:4; (c) SEQ ID NO:6; (d) SEQ ID
NO:7; (e) SEQ ID NO:21. In a further very preferred embodiment of
the present invention, the virus-like particle comprises coat
proteins having an amino acid sequence selected from the group
consisting of: (a) SEQ ID NO:3; and (b) a mixture of SEQ ID NO:3
and SEQ ID NO:4.
[0187] In a further very preferred embodiment of the present
invention, the virus-like particle essentially consists of coat
proteins having an amino acid sequence of SEQ ID NO:3, or
essentially consists of a mixture of coat proteins having amino
acid sequences of SEQ ID NO: 4, or mutants thereof, and of SEQ ID
NO:3.
[0188] In one preferred embodiment of the invention, the VLP is a
mosaic VLP comprising or alternatively consisting of more than one
amino acid sequence, preferably two amino acid sequences, of coat
proteins, mutants or fragments thereof, of a RNA bacteriophage.
[0189] In one embodiment, the virus particle or VLP is a VLP of
bacteriophage fr or GA. Fr coat protein in the form of recombinant
VLP may be obtained as described by Pushko P et al. ((1993) Prot
Engin 6:883-891), while GA VLP may be obtained by cloning GA coat
protein cDNA isolated by reverse transcription from GA phage into
pQb185, which is described for example in WO2004/007538.
Disassembly of Fr and GA VLPs can be readily done by incubating the
VLPs in 7 M urea, optionally supplemented with acetic acid at a
concentration of 0.1 M. The nucleic acid is further purified from
the coat protein by ion exchange chromatography, either at a pH
where a significant amount of the coat protein flows through while
the nucleic acid is retained, or at a pH where the coat protein is
also adsorbed on the column and subsequently eluted with a salt
gradient. Reassembly of fr and GA coat protein with ISS-NA is
effected essentially as described in WO2003/024481 by slow
dialysis, wherein said ISS-NA preferably is an unmethylated
CpG-containing oligonucleotide, more preferably G10 (SEQ ID NO:27),
and even more preferably aggregated G10 (SEQ ID NO:27) having a
retention time relative to Q.beta. capsid standard under HPLC
conditions as set forth in Example 2 of 80 to 120%, most preferably
of 80 to 95%. At the end of the reassembly reaction the reassembly
mixture is concentrated for example by dialysis against a 50% (v/v)
glycerol solution in NET buffer (WO2003/024481) and purified
further by gel filtration, for example on a Sepharose CL-4B column.
Additional purification methods include ultracentrifugation on a
CsCl gradient or sucrose cushion. Further protocols for the
disassembly and reassembly of Fr and GA VLPs are disclosed in
Examples 5 and 6 of the present application.
[0190] In one very preferred embodiment, the VLP comprises or
alternatively consists of two different coat proteins of a RNA
bacteriophage, said two coat proteins have an amino acid sequence
of CP Q.beta. (SEQ ID NO: 3) and CP Q.beta. A1 (SEQ ID NO:4), or of
CP SP (SEQ ID NO:8) and CP SP A1 (SEQ ID NO:9).
[0191] In preferred embodiments of the present invention, the
virus-like particle of the invention comprises, or alternatively
consists essentially of, or alternatively consists of recombinant
coat proteins, mutants or fragments thereof, of the
RNA-bacteriophage Q.beta., fr, AP205 or GA.
[0192] In one preferred embodiment, the VLP of the invention is a
VLP of RNA bacteriophage Q.beta.. The capsid or virus-like particle
of Q.beta. showed an icosahedral phage-like capsid structure with a
diameter of 25 nm and T=3 quasi symmetry. The capsid contains 180
copies of the coat protein, which are linked in covalent pentamers
and hexamers by disulfide bridges (Golmohammadi, R. et al.,
Structure 4:543-5554 (1996)), leading to a remarkable stability of
the Q.beta. capsid. Capsids or VLPs made from recombinant Q.beta.
coat protein may contain, however, subunits not linked via
disulfide bonds to other subunits within the capsid, or
incompletely linked.
[0193] Further preferred VLPs of RNA bacteriophages in accordance
with this invention, in particular of Q.beta. and fr, are disclosed
in WO 02/056905, the disclosure of which is herewith incorporated
by reference in its entirety. In particular Example 18 of WO
02/056905 gave detailed description of preparation of VLP particles
from Q.beta..
[0194] In another preferred embodiment, the VLP of the invention is
a VLP of RNA bacteriophage AP205. Assembly-competent mutant forms
of AP205 VLPs, including AP205 coat protein with the substitution
of proline at amino acid 5 to threonine, may also be used in the
practice of the invention and leads to other preferred embodiments
of the invention. WO 2004/007538 describes, in particular in
Example 1 and Example 2, how to obtain VLP comprising AP205 coat
proteins, and hereby in particular the expression and the
purification thereto. WO 2004/007538 is incorporated herein by way
of reference. In a further preferred embodiment said virus particle
or VLP is a virus particle or VLP of RNA bacteriophage AP205,
wherein said ISS-NA preferably is an unmethylated CpG-containing
oligonucleotide, more preferably G10 (SEQ ID NO:27), and even more
preferably aggregated G10 (SEQ ID NO:27) having a retention time
relative to Q.beta. capsid standard under HPLC conditions as set
forth in Example 2 of 80 to 120%, most preferably of 80 to 95%. The
disassembly and reassembly of AP205 is demonstrated in Example
5.
[0195] Q.beta. mutants, of which exposed lysine residues are
replaced by arginines can be used for the present invention. Thus,
in another preferred embodiment of the present invention, the
virus-like particle comprises, consists essentially of or
alternatively consists of mutant Q.beta. coat proteins. Preferably
these mutant coat proteins comprise or alternatively consist of an
amino acid sequence selected from the group of a) Q.beta.-240 (SEQ
ID NO:16, Lys13-Arg of SEQ ID NO: 3) b) Q.beta.-243 (SEQ ID NO:17,
Asn10-Lys of SEQ ID NO:3); c) Q.beta.-250 (SEQ ID NO:18, Lys2-Arg
of SEQ ID NO:3) d) Q.beta.-251 (SEQ ID NO:19, Lys16-Arg of SEQ ID
NO:3); and e) Q.beta.-259 (SEQ ID NO:20, Lys2-Arg, Lys16-Arg of SEQ
ID NO:3). The construction, expression and purification of the
above indicated Q.beta. mutant coat proteins, mutant Q.beta. coat
protein VLPs and capsids, respectively, are described in WO
02/056905. In particular is hereby referred to Example 18 of above
mentioned application.
[0196] In a further preferred embodiment said virus particle or VLP
is a virus particle or VLP of RNA bacteriophage Q.beta., wherein
said ISS-NA preferably is an unmethylated CpG-containing
oligonucleotide, more preferably G10 (SEQ ID NO:27), and even more
preferably aggregated G10 (SEQ ID NO:27) having a retention time
relative to Q.beta. capsid standard under HPLC conditions as set
forth in Example 2 of 80 to 120%, most preferably of 80 to 95%. The
disassembly and reassembly of Q.beta. VLPs is demonstrated in
Examples 1 and 3.
[0197] In another preferred embodiment of the present invention,
the virus-like particle comprises, or alternatively consists
essentially of, or alternatively consists of mutant coat protein of
Q.beta., or mutants or fragments thereof, and the corresponding A1
protein. In a further preferred embodiment, the virus-like particle
comprises, or alternatively consists essentially of, or
alternatively consists of mutant coat protein with amino acid
sequence SEQ ID NO:16, 17, 18, 19, or 20 and the corresponding A1
protein.
[0198] Further RNA bacteriophage coat proteins have also been shown
to self-assemble upon expression in a bacterial host (Kastelein, R
A. et al., Gene 23:245-254 (1983), Kozlovskaya, T M. et al., Dokl.
Akad. Nauk SSSR 287:452-455 (1986), Adhin, M R. et al., Virology
170:238-242 (1989), Priano, C. et al., J. Mol. Biol. 249:283-297
(1995)). In particular the biological and biochemical properties of
GA (Ni, C Z., et al., Protein Sci. 5:2485-2493 (1996), Tars, K et
al., J. Mol. Biol. 271:759-773(1997)) and of fr (Pushko P. et al.,
Prot. Eng. 6:883-891 (1993), Liljas, L et al. J Mol. Biol.
244:279-290, (1994)) have been disclosed. The crystal structure of
several RNA bacteriophages has been determined (Golmohammadi, R. et
al., Structure 4:543-554 (1996)).
[0199] In one preferred embodiment, the virus particle or VLP is a
VLP or virus particle of Cowpea cholortic mottle virus (CCMV).
Assembly of CCMV virus from coat proteins expressed in E. Coli and
nucleic acids has been described (Zhao X. et al. (1995) Virology
207:486-494). In particular, the reassembly of CCMV with RNA was
shown to be independent of RNA sequence (Johnson J M. et al. (2004)
J Mol Biol 335:455-464). Furthermore, the virus may exist in a
swollen form, susceptible to nuclease digestion, which can be
disassembled by adding a high NaCl concentration (1 M; Johnson J E
and Speir J A (1997) J Mol Biol 269:665-675). Methods for
reassembly of CCMV in the presence of nucleic acids are also
described therein. In one embodiment, the CCMV particle is thus
reassembled with ISS-NA, preferably with an unmethylated
CpG-containing oligonucleotide. In a very preferred embodiment, the
unmethylated CpG-containing oligonucleotide is G10 (SEQ ID NO:27),
more preferably aggregated G10, still more preferably aggregated
G10 having a retention time relative to Q.beta. capsid standard
under HPLC conditions as set forth in Example 2 of 80 to 120%, most
preferably of 80 to 95%. In one further embodiment, native CCMV
virus particle is swollen, treated with nucleases, and an ISS-NA,
preferably an unmethylated CpG-containing oligonucleotide, and even
more preferably G10 (SEQ ID NO:27) is added to the nuclease treated
particle after nuclease removal. In one further embodiment, CCMV
capsids are reassembled without nucleic acids, as has been
described for example by Zlotnick et al. (2000) Virology
277:450-456, optionally swollen by bringing the solution to the
appropriate pH and ionic strength as described by Zlotnick et al.
((2000) Virology 277:450-456) or Johnson J E and Speir J A ((1997)
J Mol Biol 269:665-675) and ISS-NA, preferably an unmethylated
CpG-containing oligonucleotide, and even more preferably G10 (SEQ
ID NO:27) is added to the swollen empty particle.
[0200] In one further embodiment, the virus particle or VLP is a
VLP or virus particle of Brome mosaic virus (BMV). Reassembly of
BMV has been described previously (Choi Y G and Rao L N (2000)
Virology 275: 249-257, and references therein). A tRNA-like
structure (tls) at the 3' of each viral RNA has been shown to be
required for packaging, and can be added in trans (Choi Y G et al.
(2002) Proc. Natl. Acad. Sci. USA 99:655-660) as a nucleotide
sequence of about 200 nucleotide in length. Tls from other viruses
such as tobacco mosaic virus (TMV) or CMV, or even tRNAs such as
wheat germ tRNAs may also be added in trans and facilitate
reassembly, although Choi et al. did not detect packaging of tRNAs
in the BMV capsid (Choi Y G et al. (2002) Proc. Natl. Acad. Sci.
USA 99:655-660). Thus in one further embodiment, BMV is reassembled
with an ISS-NA, preferably an unmethylated CpG-containing
oligonucleotide, more preferably G10 and even more preferably
aggregated G10 having a retention time relative to Q.beta. capsid
standard under HPLC conditions as set forth in Example 2 of 80 to
120%, most preferably of 80 to 95%.
[0201] The compositions of the invention comprise an
immunostimulatory nucleic acid (ISS-NA), wherein preferably said
ISS-NA is capable of inducing the production of a cytokin,
preferably of IFN-alpha, in a cell, preferably in a dendritic cell.
In one embodiment, said ISS-NA is selected from the group
consisting of: (a) ribonucleic acids; (b) desoxyribonucleic acids,
(c) chimeric nucleic acids; and (d) any mixtures of at least one
nucleic acid of (a), (b) and/or (c). In a preferred embodiment,
said ISS-NA is a ribonucleic acid, wherein preferably said
ribonucleic acid is a double stranded ribonucleic acid, preferably
a double stranded ribonucleic acid selected from the group
consisting of: (a) double stranded viral RNA, and (b) synthetic
double stranded RNA, preferably poly-(A:U) or poly(I:C), most
preferably poly(I:C).
[0202] The innate immune system has the capacity to recognize
invariant molecular pattern shared by microbial pathogens. Recent
studies have revealed that this recognition is a crucial step in
inducing effective immune responses. The main mechanism by which
microbial products augment immune responses is to stimulate APC,
especially dendritic cells to produce proinflammatory cytokines and
to express high levels co-stimulatory molecules for T cells. These
activated dendritic cells subsequently initiate primary T cell
responses and dictate the type of T cell-mediated effector
function. Three classes of nucleic acids, namely (i) bacterial DNA
that contains immunostimulatory sequences, in particular
unmethylated CpG dinucleotides within specific flanking bases
(referred to as CpG motifs), (ii) double-stranded RNA synthesized
by various types of viruses represent important members of the
microbial components that enhance immune responses, and (iii)
single stranded RNA. Synthetic double stranded (ds) RNA such as
polyinosinic-polycytidylic acid (poly I:C) are capable of inducing
dendritic cells to produce proinflammatory cytokines and to express
high levels of costimulatory molecules. A series of studies by
Tokunaga and Yamamoto et al. has shown that bacterial DNA or
synthetic oligodesoxynucleotides induce human PBMC and mouse spleen
cells to produce type I interferon (IFN) (reviewed in Yamamoto et
al., Springer Semin Immunopathol. 22:11-19). Poly (I:C) was
originally synthesized as a potent inducer of type I IFN but also
induces other cytokines such as IL-12. Preferred ribonucleic acid
encompass polyinosinic-polycytidylic acid double-stranded RNA (poly
I:C). Ribonucleic acids and modifications thereof as well as
methods for their production have been described by Levy, H. B
(Methods Enzymol. 1981, 78:242-251), DeClercq, E (Methods Enzymol.
1981, 78: 227-236) and Torrence, P. F. (Methods Enzymol 1981;
78:326-331) and references therein. Further preferred ribonucleic
acids comprise polynucleotides of inosinic acid and cytidiylic acid
such poly (I:C) of which two strands form double stranded RNA.
Ribonucleic acids can be isolated from organisms. Ribonucleic acids
also encompass further synthetic ribonucleic acids, in particular
synthetic poly (I:C) oligonucleotides that have been rendered
nuclease resistant by modification of the phosphodiester backbone,
in particular by phosphorothioate modifications. In a further
embodiment the ribose backbone of poly (I:C) is replaced by a
desoxyribose. Those skilled in the art know procedures how to
synthesize synthetic oligonucleotides.
[0203] In a further embodiment said ISS-NA is a single stranded
ribonucleic acid, preferably polyuridylic acid (poly-U, Westwood A.
(2006), Vaccine 24:1736-1743). In a preferred embodiment said
ISS-NA is desoxyribonucleic acid, wherein preferably said
desoxyribonucleic acid is a double stranded desoxyribonucleic acid.
In very preferred embodiment said ISS-NA is desoxyribonucleic acid,
wherein preferably said desoxyribonucleic acid is a single stranded
desoxyribonucleic acid, most preferably a oligodesoxynucleotide
(ODN).
[0204] In another embodiment, said ISS-NA is an oligonucleotide,
wherein said oligonucleotide is preferably selected from the group
consisting of (a) unmethylated CpG-containing oligonucleotide; and
(b) oligonucleotide free of unmethylated CpG motifs. Preferably,
said ISS-NA is an unmethylated CpG-containing oligonucleotide.
Unmethylated CpG-dinucleotides within specific flanking bases
(referred to as CpG motifs) represent important members of the
microbial components that enhance immune responses. Toll-like
receptor 9 (TLR9) is activated by bacterial DNA, in particular by
unmethylated CpG-containing oligonucleotides. In general, the
unmethylated CpG-containing oligonucleotide comprises the sequence:
5' X.sub.1X.sub.2CGX.sub.3X.sub.4 3', wherein X.sub.1, X.sub.2,
X.sub.3 and X.sub.4 are any nucleotide. Preferred unmethylated
CpG-containing oligonucleotides further comprise about 6 to about
100,000 nucleotides, more preferably about 6 to about 2000
nucleotides, still more preferably about 20 to about 2000
nucleotides, and even more preferably comprises about 20 to about
300 nucleotides. Further preferred unmethylated CpG-containing
oligonucleotides comprise 100 to about 2000 nucleotides, preferably
100 to about 1000 nucleotides, and more preferably 100 to about 500
nucleotides. Specifically preferred oligonucleotides, unmethylated
CpG-containing oligonucleotide, in the context of the invention
comprise 20 to 40, preferably 26, 27, 28, 29, 30, 31 or 32
nucleotides, most preferably 30 nucleotides.
[0205] The CpG-containing oligonucleotide can contain one or more
phosphothioester modifications of the phosphate backbone to enhance
the stability of the oligonucleotide. For example, a CpG-containing
oligonucleotide having one or more phosphate backbone modifications
or having all of the phosphate backbone modified and a
CpG-containing oligonucleotide wherein one, some or all of the
nucleotide phosphate backbone modifications are phosphorothioate
modifications are included within the scope of the present
invention. In a preferred embodiment said ISS-NA is a
CpG-containing oligonucleotide, wherein preferably said
CpG-containing oligonucleotide consisting exclusively of
phosphodiester bound, preferably unmethylated nucleotides are
preferred in the context of the invention.
[0206] The CpG-containing oligonucleotide can also be recombinant,
genomic, synthetic, cDNA, plasmid-derived and single or double
stranded. For use in the invention, the nucleic acids can be
synthesized de novo using any of a number of procedures well known
in the art. For example, the b-cyanoethyl phosphoramidite method
(Beaucage, S. L., and Caruthers, M. H., Tet. Let. 22:1859 (1981);
nucleoside H-phosphonate method (Garegg et al., Tet. Let.
27:4051-4054 (1986); Froehler et al., Nucl. Acid. Res. 14:5399-5407
(1986); Garegg et al., Tet. Let. 27:4055-4058 (1986), Gaffney et
al., Tet. Let. 29:2619-2622 (1988)). These chemistries can be
performed by a variety of automated oligonucleotide synthesizers
available in the market. Alternatively, CpGs can be produced on a
large scale in plasmids, (see Sambrook, T., et al., "Molecular
Cloning: A Laboratory Manual," Cold Spring Harbor laboratory Press,
New York, 1989) which after being administered to a subject are
degraded into oligonucleotides. Oligonucleotides can be prepared
from existing nucleic acid sequences (e.g., genomic or cDNA) using
known techniques, such as those employing restriction enzymes,
exonucleases or endonucleases.
[0207] The ISS-NA, preferably the unmethylated CpG-containing
oligonucleotide, can be bound to the particle by any way known in
the art provided the composition enhances an immune response in an
animal. For example, the ISS-NA can be bound either covalently or
non-covalently. Preferably, the particle, preferably the VLP,
encloses, fully or partially, the ISS-NA, preferably the
unmethylated CpG-containing oligonucleotide. In a very preferred
embodiment said particle, preferably said VLP, is packaged with
said ISS-NA, wherein further preferably said ISS-NA is a
unmethylated CpG-containing oligonucleotide, most preferably G10
(SEQ ID NO:27).
[0208] In one embodiment the ISS-NA, preferably the unmethylated
CpG-containing oligonucleotide, is bound to the particle,
preferably to said VLP, at a binding site, preferably a binding
site selected from (a) oligonucleotide binding site (either
naturally or non-naturally occurring), (b) a DNA binding site, and
(c) a RNA binding site. In another embodiment, the VLP binding site
comprises an arginine-rich repeat or a lysine-rich repeat.
[0209] In another preferred embodiment of the present invention,
the ISS-NA is an unmethylated CpG-containing oligonucleotide,
wherein the CpG motif of said unmethylated CpG-containing
oligonucleotide is part of a palindromic sequence, wherein
preferably said palindromic sequence is selected from any one of
SEQ ID NO:28 and SEQ ID NOs: 35 to 60. Preferably, said palindromic
sequence is GACGATCGTC (SEQ ID NO:28).
[0210] In a preferred embodiment said ISS-NA is an A-type CpG or an
C-type CpG. Preferably, said unmethylated CpG containing
oligonucleotide is an A-type CpG, wherein preferably the
nucleotides are exclusively linked by phosphodiester bonds. In a
further preferred embodiment said ISS-NA is a A-type CpG comprising
a palindromic sequence, wherein preferably said palindromic
sequence is selected from the group consisting of: (a) GACGTC (SEQ
ID NO:35), (b) AGCGCT (SEQ ID NO:36), (c) AACGTT (SEQ ID NO:37),
(d) ATCGAT (SEQ ID NO:38); (e) CGATCG (SEQ ID NO:39); (f) CGTACG
(SEQ ID NO:40); (g) CGCGCG (SEQ ID NO:41); (h) GCGCGC (SEQ ID
NO:42); (i) TCGCGA (SEQ ID NO:43); (j) ACGATCGT (SEQ ID NO:44); (k)
CGACGATCGTCG (SEQ ID NO:45); (l) CGACGACGATCGTCGTCG (SEQ ID NO:46);
(m) GACGATCGTC (SEQ ID NO:28), (n) CGACGACGATCGTCGTCG (SEQ ID
NO:47); (o) AACGTT (SEQ ID NO:48); (p) CAACGTTG (SEQ ID NO:49); (q)
ACAACGTTGT (SEQ ID NO:50); (r) AACAACGTTGTT (SEQ ID NO:51); and (s)
CAACAACGTTGTTG (SEQ ID NO:52). In a further preferred embodiment
said ISS-NA is a A-type CpG comprising a palindromic sequence,
wherein said palindromic sequence is GACGATCGTC (SEQ ID NO:28).
[0211] In a preferred embodiment, said palindromic sequence is
flanked at its 3'-terminus and at its 5'-terminus by guanosine
entities. In a further preferred embodiment said palindromic
sequence is flanked at its 5'-terminus by at least 3 and at most 25
guanosine entities, wherein said palindromic sequence is flanked at
its 3'-terminus by at least 3 and at most 25 guanosine entities. In
a further preferred embodiment said palindromic sequence is flanked
at its 5'-terminus by at least 3 and at most 15, preferably at most
10, guanosine entities, wherein said palindromic sequence is
flanked at its 3'-terminus by at least 3 and at most 15, preferably
at most 10 guanosine entities. In another preferred embodiment, the
palindromic sequence is flanked at its 5'-terminus and at its
3'-terminus by at least 3 and at most 15, preferably at most 10,
guanosine entities. In a further preferred embodiment, the
palindromic sequence is flanked at its 5'-terminus by at least 3
and at most 15, preferably at most 10, guanosine entities, and
wherein said palindromic sequence is flanked at its 3'-terminus by
at least 6 and at most 15, preferably at most 10, guanosine
entities. In a further preferred embodiment, the palindromic
sequence is flanked at its 5'-terminus by at least 5 and at most 10
guanosine entities, and wherein said palindromic sequence is
flanked at its 3'-terminus by at least 5 and at most 10 guanosine
entities. In a further preferred embodiment, the palindromic
sequence, preferably SEQ ID NO:28, is flanked at its 3'-terminus by
at least 10, preferably exactly 10, guanosine entities and at its
5'-terminus by at least 10, preferably exactly 10, guanosine
entities. In a very preferred embodiment said ISS-NA is a A-type
CpG comprising a palindromic sequence, wherein said palindromic
sequence is flanked at its 5'-terminus by 3 to 10 guanosine
entities, and wherein said palindromic sequence is flanked at its
3'-terminus by 3 to 10 guanosine entities. In a even more preferred
embodiment said ISS-NA is a A-type CpG comprising a palindromic
sequence, wherein said palindromic is SEQ ID NO:28, and wherein
said palindromic sequence is flanked at its 5'-terminus by 3 to 10
guanosine entities, and wherein said palindromic sequence is
flanked at its 3'-terminus by 3 to 10 guanosine entities. These
immunostimulatory substances can be efficiently packaged into VLPs,
wherein the packaging efficiency is typically decreasing with
increasing number of flanking guanosine entities at the 5' and/or
3' terminus.
[0212] In a very preferred embodiment of the present invention, the
unmethylated CpG-containing oligonucleotide comprises, or
alternatively consists essentially of, or alternatively consists of
the a sequence selected from the group consisting of (a) "G8-8"
GGGGGGGG GACGATCGTC GGGGGGGG (SEQ ID NO:25); (b) "G9-9" GGGGGGGGG
GACGATCGTC GGGGGGGGG (SEQ ID NO:26); or (c) "G10" GGGGGGGGGG
GACGATCGTC GGGGGGGGGG (SEQ ID NO:27). The latter was previously
found to be able to stimulate blood cells in vitro (Kuramoto E. et
al., Japanese Journal Cancer Research 83, 1128-1131 (1992)).
[0213] In a specifically preferred embodiment the unmethylated
CpG-containing oligonucleotide comprises, or alternatively consists
essentially of, or alternatively consists of "G10" (SEQ ID NO:27),
wherein preferably said G10 consists exclusively of phosphodiester
bound nucleotides, wherein further preferably said G10 is
aggregated G10 having a retention time relative to Q.beta. capsid
standard under HPLC conditions as set forth in Example 2 of 80 to
120%, most preferably of 80 to 95%.
[0214] In a further specifically preferred embodiment the
unmethylated CpG-containing oligonucleotide comprises, or
alternatively consists essentially of, or alternatively consists of
"G9-9" (SEQ ID NO:26). In a further specifically preferred
embodiment the unmethylated CpG-containing oligonucleotide
comprises, or alternatively consists essentially of, or
alternatively consists of "G8-8" (SEQ ID NO:25).
[0215] In a further preferred embodiment said ISS-NA is an
unmethylated CpG-containing oligonucleotide, wherein the CpG motif
of said unmethylated CpG-containing oligonucleotide is part of a
palindromic sequence, wherein said unmethylated CpG-containing
oligonucleotide has a nucleic acid sequence selected from (a)
"G3-6" GGG GACGATCGTC GGGGGG (SEQ ID NO:29); (b) "G4-6" GGGG
GACGATCGTC GGGGGG (SEQ ID NO:30); (c) "G5-6" GGGGG GACGATCGTC
GGGGGG (SEQ ID NO:31); (d) "G6-6" GGGGGG GACGATCGTC GGGGGG (SEQ ID
NO:32); and (e) "G7-7" GGGGGGG GACGATCGTC GGGGGGG (SEQ ID NO:33);
(f) "G8-8" GGGGGGGG GACGATCGTC GGGGGGGG (SEQ ID NO:25); (g) "G9-9"
GGGGGGGGG GACGATCGTC GGGGGGGGG (SEQ ID NO:26); and (h) "G6" GGGGGG
CGACGACGATCGTCGTCG GGGGGG (SEQ ID NO:34).
[0216] In a further preferred embodiment of the present invention
the ISS-NA is an unmethylated CpG-containing oligonucleotide,
wherein the CpG motif of said unmethylated CpG-containing
oligonucleotide is part of a palindromic sequence, wherein said
palindromic sequence is GACGATCGTC (SEQ ID NO:28), and wherein said
palindromic sequence is flanked at its 5'-terminus of at least 4
and at most 9 guanosine entities and wherein said palindromic
sequence is flanked at its 3'-terminus of at least 6 and at most 9
guanosine entities.
[0217] In another preferred embodiment of the present invention the
immunostimulatory substance is an unmethylated CpG-containing
oligonucleotide, wherein the CpG motif of said unmethylated
CpG-containing oligonucleotide is part of a palindromic sequence,
wherein said unmethylated CpG-containing oligonucleotide has a
nucleic acid sequence selected from (a) "G4-6" GGGG GACGATCGTC
GGGGGG (SEQ ID NO:30); (b) "G5-6" GGGGG GACGATCGTC GGGGGG (SEQ ID
NO:31); (c) "G6-6" GGGGGG GACGATCGTC GGGGGG (SEQ ID NO:32); (d)
"G7-7" GGGGGGG GACGATCGTC GGGGGGG (SEQ ID NO:33); (e) "G8-8"
GGGGGGGG GACGATCGTC GGGGGGGG (SEQ ID NO:25); and (f) "G9-9"
GGGGGGGGG GACGATCGTC GGGGGGGGG (SEQ ID NO:26).
[0218] In another preferred embodiment of the present invention the
ISS-NA is an unmethylated CpG-containing oligonucleotide, wherein
the CpG motif of said unmethylated CpG-containing oligonucleotide
is part of a palindromic sequence, wherein said unmethylated
CpG-containing oligonucleotide has a nucleic acid sequence selected
from (a) "G4-6" GGGG GACGATCGTC GGGGGG (SEQ ID NO:30); (b) "G5-6"
GGGGG GACGATCGTC GGGGGG (SEQ ID NO:31); (c) "G6-6" GGGGGG
GACGATCGTC GGGGGG (SEQ ID NO:32); (d) "G7-7" GGGGGGG GACGATCGTC
GGGGGGG (SEQ ID NO:33); (e) "G8-8" GGGGGGGG GACGATCGTC GGGGGGGG
(SEQ ID NO:25); and (f) "G9-9" GGGGGGGGG GACGATCGTC GGGGGGGGG (SEQ
ID NO:26).
[0219] In a further preferred embodiment of the present invention
the ISS-NA is an unmethylated CpG-containing oligonucleotide,
wherein the CpG motif of said unmethylated CpG-containing
oligonucleotide is part of a palindromic sequence, wherein said
palindromic sequence is GACGATCGTC (SEQ ID NO:28), and wherein said
palindromic sequence is flanked at its 5'-terminus of at least 5
and at most 8 guanosine entities and wherein said palindromic
sequence is flanked at its 3'-terminus of at least 6 and at most 8
guanosine entities.
[0220] The experimental data show that the ease of packaging said
ISS-NA, preferably the guanosine flanked, palindromic and
unmethylated CpG-containing oligonucleotides, wherein the
palindromic sequence is GACGATCGTC (SEQ ID NO:28), and wherein the
palindromic sequence is flanked at its 3'-terminus and at its
5'-terminus by less than 10 guanosine entities, into particles,
preferably VLPs, increases if the palindromic sequences are flanked
by fewer guanosine entities. However, decreasing the number of
guanosine entities flanking the palindromic sequences leads to a
decrease of stimulating blood cells in vitro. Thus, packagability
is paid by decreased biological activity of the indicated inventive
immunostimulatory substances. The preferred embodiments represent,
thus, a compromise between packagability and biological
activity.
[0221] In another preferred embodiment of the present invention the
ISS-NA is an unmethylated CpG-containing oligonucleotide, wherein
the CpG motif of said unmethylated CpG-containing oligonucleotide
is part of a palindromic sequence, wherein said unmethylated
CpG-containing oligonucleotide has a nucleic acid sequence selected
from (a) "G5-6" GGGGG GACGATCGTC GGGGGG (SEQ ID NO:31); (b) "G6-6"
GGGGGG GACGATCGTC GGGGGG (SEQ ID NO:32); (c) "G7-7" GGGGGGG
GACGATCGTC GGGGGGG (SEQ ID NO:33); and (d) "G8-8" GGGGGGGG
GACGATCGTC GGGGGGGG (SEQ ID NO:25).
[0222] In a very preferred embodiment of the present invention the
ISS-NA is an unmethylated CpG-containing oligonucleotide, wherein
the CpG motif of said unmethylated CpG-containing oligonucleotide
is part of a palindromic sequence, wherein said unmethylated CpG
containing oligonucleotide has the nucleic acid sequence of SEQ ID
NO:25 (G8-8).
[0223] As mentioned above, the optimal sequence used to package
into VLPs is a compromise between packagability and biological
activity. Taking this into consideration, the G8-8
immunostimulatory substance is a further very preferred embodiment
of the present invention since it is biologically highly active
while it is still reasonably well packaged.
[0224] In a further preferred embodiment said ISS-NA is a
unmethylated CpC containing oligonucleotide, wherein said
unmethylated CpC containing oligonucleotide is capable of inducing
the production of IFN-alpha in a cell, preferably in PBMCs,
spleenocytes or human pDCs, and wherein further preferably said
unmethylated CpC containing oligonucleotide is selected from: (a)
T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T (2006-PS, SEQ ID NO:
76); (b) GGGGGACGAT CGTCGGGGGG (2216-PO, SEQ ID NO:77); (c)
G*G*GGGACGATCGTC*G*G*G*G*G*G (2216-PO core, SEQ ID NO:77); (d)
GGTGCATCGATGCAGGGGGG (D19-PO, SEQ ID NO:78); (e)
G*G*TGCATCGATGCAG*G*G*G*G*G (D19-PO core, SEQ ID NO:78); (f)
GGGGACGATCGTCGGGGGG (G3-6, SEQ ID NO:29); (g) GGGGGACGATCGTCGGGGGG
(G4-6, SEQ ID NO:30); (h) GGGGGGACGATCGTCGGGGGG (G5-6, SEQ ID
NO:31); (i) GGGGGGGACGATCGTCGGGGGG (G6-6, SEQ ID NO:32); (j)
GGGGGGGGAC GATCGTCGGGGGGG (G7-7, SEQ ID NO:33); (k) GGGGGGGGGA
CGATCGTCGG GGGGGG (G8-8, SEQ ID NO:25); (l)
GGGGGGGGGGACGATCGTCGGGGGGGGG (G9-9, SEQ ID NO:26); (m)
GGGGGGGGGGGACGATCGTCGGGGGGGGGG (G10, SEQ ID NO:27); and (n)
GGGGGGGGGG GACGATCGTC GGGGGGGGGG GGGGGGGGGG GACGATCGTC GGGGGGGGGG
(G102x, SEQ ID NO:79), wherein * indicates a phosphorothioate
modification, while all other nucleotides are phosphodiester bound.
In a more preferred embodiment said unmethylated CpG containing
oligonucleotide is capable of inducing the production of IFN-alpha
in human pDCs, wherein preferably said unmethylated CpG containing
oligonucleotide is T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T
(2006-PS, SEQ ID NO: 76), wherein * indicates a phosphorothioate
modification, while all other nucleotides are phosphodiester bound.
In a still more preferred embodiment said unmethylated CpG
containing oligonucleotide is capable of inducing the production of
IFN-alpha in PBMCs or spleen cells, wherein preferably said
unmethylated CpG containing oligonucleotide is selected from the
group consisting of: (a) GGGGGACGAT CGTCGGGGGG (2216-PO, SEQ ID
NO:77); (b) G*G*GGGACGATCGTC*G*G*G*G*G*G (2216-PO core, SEQ ID
NO:77); (c) GGTGCATCGATGCAGGGGGG (D 19-PO, SEQ ID NO:78); (d)
G*G*TGCATCGATGCAG*G*G*G*G*G (D19-PO core, SEQ ID NO:78); (e)
GGGGACGATCGTCGGGGGG (G3-6, SEQ ID NO:29); (f) GGGGGACGATCGTCGGGGGG
(G4-6, SEQ ID NO:30); (g) GGGGGGACGATCGTCGGGGGG (G5-6, SEQ ID
NO:31); (h) GGGGGGGACGATCGTCGGGGGG (G6-6, SEQ ID NO:32); (i)
GGGGGGGGAC GATCGTCGGGGGGG (G7-7, SEQ ID NO:33); 0) GGGGGGGGGA
CGATCGTCGG GGGGGG (G8-8, SEQ ID NO:25); (k)
GGGGGGGGGGACGATCGTCGGGGGGGGG (G9-9, SEQ ID NO:26); (1)
GGGGGGGGGGGACGATCGTCGGGGGGGGGG (G10, SEQ ID NO:27); and (m)
GGGGGGGGGG GACGATCGTC GGGGGGGGGG GGGGGGGGGG GACGATCGTC GGGGGGGGGG
(G102x, SEQ ID NO:79), wherein * indicates a phosphorothioate
modification, while all other nucleotides are phosphodiester bound.
In a very preferred embodiment said unmethylated CpG containing
oligonucleotide is GGGGGGGGG GACGATCGTC GGGGGGGGGG GGGGGGGGGG
GACGATCGTC GGGGGGGGGG (G102x, SEQ ID NO:79), wherein preferably all
nucleotides are phosphodiester bound.
[0225] In a further preferred embodiment said ISS-NA is a C-type
CpG, wherein preferably said C-type CpG comprises a palindromic
sequence, wherein further preferably said palindromic sequence is
selected from any one of the sequences depicted in SEQ ID NOs:53 to
60. In a further preferred embodiment said C-type CpG is SEQ ID
NO:64 or SEQ ID NO:65, wherein preferably all nucleic acids of said
C-type CpG are phosphorothioate bound. Further preferred C-type
CpGs are selected from the group consisting of (a) TCpGTCGTTTT
ACGGCGCCGTG CCG (SEQ ID NO:64); (b) TCGTCGTTTT ACpGGCpGCCpGTGCCG
(SEQ ID NO:64); (c) TCGTCGTTT TACpGGCGCCpGTGCCG (SEQ ID NO:64); and
(d) TCGTCpGTTTT ACpGGCGCCpGTGCCG (SEQ ID NO:64); wherein p
indicates phosphodiester bounds while all other nucleotides are
phosphorothioate bound. C-type CpGs selected from the group
consisting of (a) TCGTCGTTTTCGGCGCGCGCCG (SEQ ID NO:66); (b)
TCGTCGTTTTCGACGGCCGTCG (SEQ ID NO:67); (c) TCGTCGTTTTCCGGCGCGCCGG
(SEQ ID NO:68); (d) TCGTCGTTTTCGGCGCGCGTCG (SEQ ID NO:69); (e)
TCGGCGCGCGCCGTCGTCGTTT (SEQ ID NO:70); (f) TTGGCGCGCGCCGTCGTCGTTT
(SEQ ID NO:71); (g) TCGTCGTTTTCGTCGGCCGCCG (SEQ ID NO:72); (h)
TCGTCGTTTTCGGCTTTTGCCG (SEQ ID NO:73); (i) TCGTCGTTTTCGGCGTTTTTTT
(SEQ ID NO:74); and (j) TCGTCGTTTTCGGCGGCCGCCG (SEQ ID NO:75) are
potent inducers of IFN-alpha production (Vollmer et al. 2004, Eur.
J. Immunol. 43:351-262, p. 253, see Table 1 therein) and are thus
specifically preferred ISS-NA in the context of the invention.
[0226] One embodiment of the invention is a composition for use in
a method of treating or preventing hypersensitivity in an animal,
preferably a mammal, most preferably a human, the composition
comprising a particle and an immunostimulatory nucleic acid,
wherein said particle is packaged with said immunostimulatory
nucleic acid, and wherein preferably said hypersensitivity is an
allergy or a non-allergic hypersensitivity. The compositions and
pharmaceutical compositions of the invention can be used in a
therapeutic as well as in a prophylactic treatment.
[0227] In a preferred embodiment said hypersensitivity is selected
from the group consisting of: (a) asthma, (b) rhinitis, (c)
conjunctivitis, (d) rhinoconjuctivitis, (e) dermatitis, (f)
urticaria, and (g) anaphylaxis.
[0228] In a further preferred embodiment said hypersensitivity is
an allergy, wherein said allergy is preferably selected from
IgE-mediated allergy and non IgE-mediated allergy. In a preferred
embodiment said hypersensitivity is asthma, preferably IgE-mediated
asthma, wherein said asthma can be intermittent or persistent
asthma. In a very preferred embodiment said hypersensitivity is
atopic asthma.
[0229] In a further preferred embodiment said hypersensitivity is
dermatitis, preferably eczema, most preferably atopic eczema.
[0230] In a very preferred embodiment said hypersensitivity is an
IgE mediated allergy (type I allergy), wherein preferably said
IgE-mediated allergy is an IgE-mediated allergy against a naturally
occurring allergen, i.e. an allergen occurring in a natural source
such as pollen, animal hair, house dust, dust mite etc.
[0231] In a preferred embodiment, said allergy, preferably said
IgE-mediated allergy, is selected from the group consisting of: (a)
pollen allergy (hay fever), (b) house dust allergy, (c) food
allergy, (d) drug allergy, (e) insect venom allergy, preferably bee
venom allergy, and (f) animal allergy, preferably cat allergy.
[0232] In a further preferred embodiment said allergy, preferably
said IgE-mediated allergy, is an allergy against an allergen
occurring in a source selected from the group consisting of (a)
pollen; (b) dust, preferably house dust; (c) dust mite; (d) fungi,
preferably aspergillus; (e) mammalian epidermis, (f) bird feather;
(g) insects, preferably bee venom; (h) food, preferably strawberry,
kiwi, peanut, or wheat protein; (i) mammalian dander, preferably
cat dander; (j) saliva; (k) serum; and (l) urine. In a further
preferred embodiment said allergy, preferably said IgE-mediated
allergy, is an allergy against an allergen occurring in a source
selected from the group consisting of: (a) trees, (b) grasses, (c)
animal products, and (d) plant products. In a further preferred
embodiment said allergy, preferably said IgE-mediated allergy, is
an allergy against an antigen selected from the group consisting of
(a) bee venom phospholipase A2; (b) ragweed pollen Amb a 1; (c)
birch pollen Bet v I; (d) white faced hornet venom 5 Dol m V; (e)
house dust mite Der p 1; (f) house dust mite Der f 2; (g) house
dust mite DerP 2; (h) dust mite Lep d; (i) fungus allergen Alt a 1;
(j) fungus allergen Asp f 1; (k) fungus allergen Asp f 16; and (l)
peanut allergens.
[0233] In a further preferred embodiment said allergy, preferably
said IgE-mediated allergy, is an allergy against cat allergen,
preferably an allergy against FelD1 antigen.
[0234] In a further preferred embodiment said allergy, preferably
said IgE-mediated allergy, is an allergy against dust mite, wherein
preferably said dust mite is selected from: (a) Dermatophagoides
pteronyssinus, (b) D. farinae, (c) D. microceras, (d) Euroglyphus
maynei, (e) Glycyphagus sp., (f) Gohieria fusca, (g) Blomia
tropicalis.
[0235] In a further preferred embodiment said allergy, preferably
said IgE-mediated allergy, is pollen allergy (hay fever). In
further preferred embodiment said allergy, preferably said
IgE-mediated allergy, is house dust allergy, preferably
IgE-mediated allergy against house dust mite allergens contained in
house dust, wherein said house dust mite allergens are preferably
selected from the group consisting of (a) Der p 1; (b) Der f 2; and
(c) DerP 2.
[0236] The present invention, inter alia, relates to the finding
that particles, preferably VLPs, can be packaged with ISS-NA,
preferably with single stranded DNA oligonucleotides rich in
non-methylated C and G (CpGs).
[0237] A preferred embodiment of the invention is therefore a
composition for use in a method of treating or preventing
hypersensitivity in an animal, preferably a mammal, most preferably
a human, the composition comprising a VLP and an unmethylated CpG
containing oligonucleotide, wherein said VLP is packaged with said
unmethylated CpG containing oligonucleotide.
[0238] A further preferred embodiment of the invention is a
composition for use in a method of treating or preventing allergy
in a human, the composition comprising a VLP of an RNA
bacteriophage and an unmethylated CpG containing oligonucleotide,
wherein said VLP of an RNA bacteriophage is packaged with said
unmethylated CpG containing oligonucleotide, and wherein preferably
said unmethylated CpG-containing oligonucleotide is G10 (SEQ ID
NO:27).
[0239] A very preferred embodiment of the invention is a
composition for use in a method of treating or preventing allergy
in a human, the composition comprising a VLP of RNA bacteriophage
Q.beta. and unmethylated CpG containing oligonucleotide G10 (SEQ ID
NO:27), wherein said VLP of RNA bacteriophage Q.beta. is packaged
with said unmethylated CpG containing oligonucleotide G10.
[0240] Further embodiments of the invention are processes for the
production of the compositions of the invention and methods for
treating hypersensitivity using said compositions, wherein
preferably said hypersensitivity is atopic asthma, type I allergy
or atopic eczema.
[0241] The invention provides a process of producing a composition
for use in a method of treating hypersensitivity in an animal, said
composition comprising a VLP and an unmethylated CpG containing
oligonucleotide, wherein said VLP is packaged with said
unmethylated CpG-containing oligonucleotide, said process
comprising the steps of (i) incubating said VLP (a) with said
unmethylated CpG-containing oligonucleotide (b); (ii) adding RNase;
and (iii) purifying said composition. In a preferred embodiment,
said VLP is produced in a bacterial expression system. In another
preferred embodiment, said RNase is RNase A.
[0242] In a further preferred embodiment, said process comprises
the steps of (i) incubating said VLP with RNase; (ii) adding said
unmethylated CpG-containing oligonucleotide; and (iii) purifying
the composition. In a preferred embodiment, said VLP is produced in
a bacterial expression system. In another preferred embodiment,
said RNase is RNase A.
[0243] In a further preferred embodiment, said process comprising
the steps of (i) disassembling said VLP; (ii) adding said
unmethylated CpG-containing oligonucleotide; and (iii) reassembling
said VLP. In a further embodiment said process further comprises
the step of removing nucleic acids from the disassembled VLP.
Alternatively, said process further comprises the step of removing
nucleic acids of the at least partially disassembled VLP and/or
purifying the composition after reassembly. In a preferred
embodiment, said VLP is produced in a bacterial expression system.
In a further preferred embodiment said VLP referred to in step (i)
of said process is a VLP of an RNA bacteriophage, more preferably a
VLP of an RNA bacteriophage selected from the group consisting of
(a) bacteriophage Q.beta., (b) bacteriophage AP205, (c)
bacteriophage GA, and (d) bacteriophage fr. In a very preferred
embodiment said VLP referred to in step (i) of said process is a
VLP of a RNA bacteriophage, more preferably a VLP of RNA
bacteriophages AP205 or Q.beta., most preferably of Q.beta..
[0244] In a further preferred embodiment said unmethylated
CpG-containing oligonucleotide referred to in step (ii) of said
process consists of 5 to 60 nucleotides, preferably of 20 to 40
nucleotides most preferably of about 30 nucleotides. In a very
preferred embodiment said unmethylated CpG-containing
oligonucleotide is an A-type CpG, preferably an A-type CpG
comprising poly G motifs at the 5' and/or 3' ends. In a still more
preferred embodiment said unmethylated CpG-containing
oligonucleotide is selected from the group consisting of: (a)
"G8-8" GGGGGGGG GACGATCGTC GGGGGGGG (SEQ ID NO:25); (b) "G9-9"
GGGGGGGGG GACGATCGTC GGGGGGGGG (SEQ ID NO:26); or (c) "G10"
GGGGGGGGGG GACGATCGTC GGGGGGGGGG (SEQ ID NO:27), most preferably
SEQ ID NO:27.
[0245] In a further preferred embodiment said process comprises the
steps of (i) incubating said VLP in a solution comprising metal
ions capable of hydrolyzing the nucleic acids of said VLP; (ii)
adding said unmethylated CpG-containing oligonucleotide; and (iii)
purifying said composition, wherein preferably said metal ions of
step (i) are selected from the group consisting of (a) zinc (Zn)
ions; (b) copper (Cu) ions; (c) iron (Fe) ions; (d) any mixtures of
at least one ion of (a), (b) and/or (c). In a preferred embodiment,
said VLP is produced in a bacterial expression system.
[0246] In a further preferred embodiment said process comprises the
steps of (i) incubating said VLP with solutions comprising metal
ions capable of hydrolyzing the nucleic acids of said VLP; (ii)
adding said unmethylated CpG-containing oligonucleotide; and (iii)
purifying said composition, wherein preferably said metal ions of
step (i) are selected from the group consisting of (a) zinc (Zn)
ions; (b) copper (Cu) ions; (c) iron (Fe) ions; (d) magnesium (Mg)
ions, and any mixtures of at least one ion of (a), (b), (c) and/or
(d). In a preferred embodiment, said VLP is produced in a bacterial
expression system.
[0247] In a further preferred embodiment said process comprises the
steps of (i) incubating said VLP with a solution capable of
destabilizing said VLP; (ii) purifying the coat protein from said
solution; and (iii) reassembling said VLP in the presence of
unmethylated CpG-containing oligonucleotide, wherein preferably
said solution capable of destabilizing said VLP comprises magnesium
chloride, wherein further preferably the concentration of said
magnesium chloride is 0.2 to 1.5 M, more preferably 0.4 to 1 M,
most preferably about 0.7 M; and wherein still further preferably
said VLP is a VLP of bacteriophage Q.beta.. In a very preferred
embodiment said process comprises the steps of (i) incubating said
VLP with a solution capable of destabilizing said VLP; (ii)
purifying the coat protein from said solution; and (iii)
reassembling said VLP in the presence of unmethylated
CpG-containing oligonucleotide, wherein preferably said solution
capable of destabilizing said VLP comprises magnesium chloride,
wherein further preferably the concentration of said magnesium
chloride is 0.2 to 1.5 M, more preferably 0.4 to 1 M, most
preferably about 0.7 M; and wherein still further preferably said
VLP is a VLP of bacteriophage Q.beta.; and wherein still further
preferably said unmethylated CpG-containing oligonucleotide is G10
(SEQ ID NO:27), most preferably said unmethylated CpG-containing
oligonucleotide is aggregated G10 having a retention time relative
to Q.beta. capsid standard under HPLC conditions as set forth in
Example 2 of 80 to 120%, most preferably of 80 to 95%.
[0248] In a further preferred embodiment said process comprises the
steps of (i) incubating said VLP under alkaline conditions,
preferably in the presence of NaOH, most preferably in the presence
of about 25 mM NaOH; (ii) adding said unmethylated CpG-containing
oligonucleotide; and (iii) purifying said composition.
[0249] It was found that the efficiency of said reassembling of
said VLP can be improved and also that the stability of the
reassembled VLP can be improved, by subjecting the unmethylated
CpG-containing oligonucleotide to conditions supporting the
formation of oligonucleotide aggregates prior to adding the
oligonucleotide to the disassembled VLP. Conditions controlling the
aggregation state of oligonucleotides have been described in
Guschlbauer W., Journal of Biomolecular Structure & Dynamics,
ISSN 0739-1102, Volume 8, Issue Number 3 (1990). Title:
Four-Stranded Nucleic Acid Structures 25 Years. The aggregation of
oligonucleotides is, for example, influenced by the ionic
conditions, the concentration of the oligonucleotide, the pH, the
temperature conditions and by the incubation time. Furthermore, it
was found that aggregation of the oligonucleotide is particularly
advantages for A-type oligonucleotides comprising poly G motifs at
their 5' and/or 3' ends, most preferably for G10 (SEQ ID NO:27).
Preferred conditions for the aggregation of unmethylated
CpG-containing oligonucleotides are exemplified in Example 2. The
optimal aggregation conditions may vary between different
unmethylated CpG-containing oligonucleotides and even between
different batches of the same unmethylated CpG-containing
oligonucleotide. The actual aggregation state of an unmethylated
CpG-containing oligonucleotide can be assessed by HPLC, preferably
under conditions as set forth in Example 2.
[0250] Thus, in a further embodiment the invention provides a
process comprising the steps of (i) disassembling said VLP; (ii)
adding said unmethylated CpG-containing oligonucleotide; and (iii)
reassembling said VLP, wherein prior to said adding of said
unmethylated CpG-containing oligonucleotide said process comprises
the additional step of incubating said unmethylated CpG-containing
oligonucleotide under conditions supporting the formation of
oligonucleotide aggregates. In a preferred embodiment said
incubating is performed at a temperature of 70 to 100.degree. C.,
preferably at about 85.degree. C., preferably in the presence of
sodium ions. In a still more preferred embodiment said incubating
is performed at a concentration of said unmethylated CpG-containing
oligonucleotide of 100 to 250 .mu.m, preferably about 175 .mu.m, in
the presence of 200 to 500 mM sodium ions, preferably in the
presence of about 250 mM sodium ions, preferably at 85.degree. C.
for about 10 min, wherein further preferably said unmethylated
CpG-containing oliginucleotide comprises poly G motifs at their 5'
and/or 3' ends. In a still more preferred embodiment said
unmethylated CpG-containing oliginucleotide is selected from the
group consisting of: (a) "G8-8" GGGGGGGG GACGATCGTC GGGGGGGG (SEQ
ID NO:25); (b) "G9-9" GGGGGGGGG GACGATCGTC GGGGGGGGG (SEQ ID
NO:26); or (c) "G10" GGGGGGGGGG GACGATCGTC GGGGGGGGGG (SEQ ID
NO:27), most preferably said unmethylated CpG-containing
oliginucleotide is G10 (SEQ ID NO:27). In a further preferred
embodiment said conditions supporting the formation of
oligonucleotide aggregates are chosen in such a way that aggregated
unmethylated CpG containing oligonucleotide, preferably aggregated
G10 (SEQ ID NO:27) is obtained, wherein said aggregated
unmethylated CpG containing oligonucleotide, preferably said
aggregated G10 (SEQ ID NO:27) shows a retention time relative to
Q.beta. capsid standard under HPLC conditions as set forth in
Example 2 of 80 to 120%, most preferably of 80 to 95%.
[0251] The invention further provides a process of producing a
composition for use in a method of treating hypersensitivity in an
animal, said composition comprising (a) a virus-like particle, a
VLP of bacteriophage Q.beta.; and (b) an unmethylated
CpG-containing oligonucleotide; wherein said virus-like particle
(a) is packaged with said unmethylated CpG-containing
oligonucleotide (b), said process comprising the steps of (i)
incubating said VLP with a solution capable of destabilizing said
VLP; (ii) purifying the coat protein from said solution; and (iii)
reassembling said coat protein to a VLP in the presence of
unmethylated CpG-containing oligonucleotide and an oxidizing agent.
In a preferred embodiment, said solution capable of destabilizing
said VLP comprises magnesium chloride and a reducing agent, wherein
preferably the concentration of said magnesium chloride is 0.2 to
1.5 M, more preferably 0.4 to 1 M, most preferably about 0.7 M; and
wherein further preferably said reducing agent is DTT, and wherein
still further preferably the concentration of said DTT is 1 to 100
mM, preferably 2 to 15 mM, more preferably about 10 mM and most
preferably about 10 mM. In a further preferred embodiment said
oxidizing agent is H.sub.2O.sub.2, wherein further preferably the
concentration of said H.sub.2O.sub.2 is 1 to 50 mM, preferably 1 to
10 mM, most preferably about 7 mM. In a further preferred
embodiment said reassembling of said coat protein to a VLP is
performed in the presence of salt, wherein preferably said salt is
NaCl, and wherein further preferably the concentration of said
salt, preferably of said NaCl is 100 mM to 1 M, most preferably 100
mM to 500 mM, most preferably about 250 mM. In a further preferred
embodiment, prior to said reassembling said coat protein to a VLP,
said purified coat protein is incubated in a solution comprising
salt, reducing agent and unmethylated CpG-containing
oligonucleotide, wherein preferably (i) said salt is NaCl, and
wherein further preferably the concentration of said salt,
preferably of said NaCl is 100 mM to 1 M, most preferably 100 mM to
500 mM, most preferably about 250 mM; (ii) the concentration of
said urea is 100 mM to 7 M, more preferably 500 mM to 2 M, most
more preferably about 1 M; and (iii) said reducing agent ist DTT,
wherein preferably the concentration of said DTT is 1 to 10 mM,
preferably 1 to 5 mM, most preferably 2.5 mM. In a further
preferred embodiment said unmethylated CpG-containing
oligonucleotide is G10 (SEQ ID NO:27), wherein most preferably said
unmethylated CpG-containing oligonucleotide is aggregated G10
having a retention time relative to Q.beta. capsid standard under
HPLC conditions as set forth in Example 2 of 80 to 120%, most
preferably of 80 to 95%.
[0252] The invention further provides compositions for use in a
method of treating hypersensitivity in an animal, wherein said
compositions are obtainable by any one of the processes disclosed
herein.
[0253] It is apparent for the artisan that the processes for the
production of a composition of the invention as described above can
also be performed using a virus particle instead of said VLP,
wherein said virus particle preferably is a virus particle of a
bacteriophage, preferably of a RNA bacteriophage.
[0254] In particular, the invention provides compositions for use
in a method of treating hypersensitivity in an animal, wherein said
compositions are obtainable by a process comprising the steps of
(i) incubating a VLP with unmethylated CpG-containing
oligonucleotides; (ii) adding RNase; and (iii) purifying said
composition. In a preferred embodiment, said VLP is produced in a
bacterial expression system. In another preferred embodiment, said
RNase is RNase A.
[0255] The invention further provides compositions for use in a
method of treating hypersensitivity in an animal, wherein said
compositions are obtainable by a process comprising the steps of
(i) incubating a VLP with RNase; (ii) adding unmethylated
CpG-containing oligonucleotides; and (iii) purifying the
composition. In a preferred embodiment, said VLP is produced in a
bacterial expression system. In another preferred embodiment, said
RNase is RNase A.
[0256] The invention further provides compositions for use in a
method of treating hypersensitivity in an animal, wherein said
compositions are obtainable by a process comprising the steps of
(i) disassembling a VLP; (ii) adding unmethylated CpG-containing
oligonucleotides; and (iii) reassembling said VLP. In a further
embodiment said process further comprises the step of removing
nucleic acids from the disassembled VLP. Alternatively, said
process further comprises the step of removing nucleic acids of the
at least partially disassembled VLP and/or purifying the
composition after reassembly. In a preferred embodiment, said VLP
is produced in a bacterial expression system.
[0257] The invention further provides compositions for use in a
method of treating hypersensitivity in an animal, wherein said
compositions are obtainable by a process comprising the steps of
(i) incubating a VLP with solutions comprising metal ions capable
of hydrolyzing the nucleic acids of said VLP; (ii) adding
unmethylated CpG-containing oligonucleotides; and (iii) purifying
said composition, wherein preferably said metal ions of step (i)
are selected from the group consisting of (a) zinc (Zn) ions; (b)
copper (Cu) ions; (c) iron (Fe) ions; (d) any mixtures of at least
one ion of (a), (b) and/or (c). In a preferred embodiment, said VLP
is produced in a bacterial expression system.
[0258] The invention further provides compositions for use in a
method of treating hypersensitivity in an animal, wherein said
compositions are obtainable by a process comprising the steps of
(i) incubating a VLP with solutions comprising metal ions capable
of hydrolyzing the nucleic acids of said VLP; (ii) adding
unmethylated CpG-containing oligonucleotides; and (iii) purifying
said composition, wherein preferably said metal ions of step (i)
are selected from the group consisting of (a) zinc (Zn) ions; (b)
copper (Cu) ions; (c) iron (Fe) ions; (d) magnesium (Mg) ions; and
(e) any mixtures of at least one ion of (a), (b), (c) and/or (d).
In a preferred embodiment, said VLP is produced in a bacterial
expression system.
[0259] The invention further provides compositions for use in a
method of treating hypersensitivity in an animal, wherein said
compositions are obtainable by a process comprising the steps of
(i) incubating said VLP with a solution capable of destabilizing
said VLP, wherein preferably said VLP is a VLP of bacteriophage
Q.beta.; (ii) purifying the coat protein from said solution; and
(iii) reassembling said coat protein to a VLP in the presence of
unmethylated CpG-containing oligonucleotide and an oxidizing agent.
In a preferred embodiment, said solution capable of destabilizing
said VLP comprises magnesium chloride and a reducing agent, wherein
preferably the concentration of said magnesium chloride is 0.2 to
1.5 M, more preferably 0.4 to 1 M, most preferably about 0.7 M; and
wherein further preferably said reducing agent is DTT, and wherein
still further preferably the concentration of said DTT is 1 to 100
mM, preferably 2 to 15 mM, more preferably about 10 mM and most
preferably about 10 mM. In a further preferred embodiment said
oxidizing agent is H.sub.2O.sub.2, wherein further preferably the
concentration of said H.sub.2O.sub.2 is 1 to 50 mM, preferably 1 to
10 mM, most preferably about 7 mM. In a further preferred
embodiment said reassembling of said coat protein to a VLP is
performed in the presence of salt, wherein preferably said salt is
NaCl, and wherein further preferably the concentration of said
salt, preferably of said NaCl is 100 mM to 1 M, most preferably 100
mM to 500 mM, most preferably about 250 mM. In a further preferred
embodiment, prior to said reassembling said coat protein to a VLP,
said purified coat protein is incubated in a solution comprising
salt, reducing agent and unmethylated CpG-containing
oligonucleotide, wherein preferably (i) said salt is NaCl, and
wherein further preferably the concentration of said salt,
preferably of said NaCl is 100 mM to 1 M, most preferably 100 mM to
500 mM, most preferably about 250 mM; (ii) the concentration of
said urea is 100 mM to 7 M, more preferably 500 mM to 2 M, most
more preferably about 1 M; and (iii) said reducing agent ist DTT,
wherein preferably the concentration of said DTT is 1 to 10 mM,
preferably 1 to 5 mM, most preferably 2.5 mM. In a further
preferred embodiment said unmethylated CpG-containing
oligonucleotide is G10 (SEQ ID NO:27), wherein most preferably said
unmethylated CpG-containing oligonucleotide is aggregated G10
having a retention time relative to Q.beta. capsid standard under
HPLC conditions as set forth in Example 2 of 80 to 120%, most
preferably of 80 to 95%.
[0260] The invention further provides compositions for use in a
method of treating hypersensitivity in an animal, wherein said
compositions are obtainable by a process comprising the steps of
(i) incubating said VLP under alkaline conditions, preferably in
the presence of NaOH, most preferably in the presence of about 25
mM NaOH; (ii) adding said unmethylated CpG-containing
oligonucleotide; and (iii) purifying said composition.
[0261] The invention further provides compositions for use as a
medicament, wherein said compositions are obtainable by any one of
the processes of the invention, said composition comprising a
particle and an ISS-NA, wherein said particle is packaged with said
unmethylated CpG-containing oligonucleotide, wherein said particle
preferably is a VLP of a RNA bacteriophage, most preferably of RNA
bacteriophage Q.beta., and wherein preferably said ISS-NA is an
unmethylated CpG-containing oligonucleotide, wherein said
unmethylated CpG-containing oligonucleotide preferably exclusively
consists of phosphodiester bound nucleotides, wherein further
preferably said unmethylated CpG-containing oligonucleotide
comprises the palindromic sequence of SEQ ID NO:28, wherein most
preferably said unmethylated CpG-containing oligonucleotide is G10
(SEQ ID NO:27).
[0262] The invention further provides compositions for use in a
method of treating hypersensitivity, preferably allergy, most
preferably atopic asthma, atopic eczema, pollen allergy, house dust
or dust mite allergy, in an animal, wherein said compositions are
obtainable by any one of the processes of the invention, said
composition comprising (a) a VLP; and (b) an unmethylated
CpG-containing oligonucleotide; wherein said virus-like particle
(a) is packaged with said unmethylated CpG-containing
oligonucleotide (b), wherein said VLP preferably is a VLP of an RNA
bacteriophage, most preferably of RNA bacteriophage Q.beta., and
wherein said unmethylated CpG-containing oligonucleotide preferably
exclusively consists of phosphodiester bound nucleotides, wherein
further preferably said unmethylated CpG-containing oligonucleotide
comprises the palindromic sequence of SEQ ID NO:28, wherein most
preferably said unmethylated CpG-containing oligonucleotide is G10
(SEQ ID NO:27).
[0263] The invention further provides compositions for use in a
method of treating hypersensitivity, preferably allergy, most
preferably atopic asthma, atopic eczema, pollen allergy, house dust
or dust mite allergy, in an animal, wherein said compositions are
obtainable by any one of the processes of the invention, said
composition comprising a VLP and an unmethylated CpG-containing
oligonucleotide, wherein said virus-like particle is packaged with
said unmethylated CpG-containing oligonucleotide, wherein said VLP
preferably is a VLP of a RNA bacteriophage, most preferably of RNA
bacteriophage Q.beta., and wherein said unmethylated CpG-containing
oligonucleotide preferably exclusively consists of phosphodiester
bound nucleotides, wherein further preferably said unmethylated
CpG-containing oligonucleotide comprises the palindromic sequence
of SEQ ID NO:28, wherein most preferably said unmethylated
CpG-containing oligonucleotide is G10 (SEQ ID NO:27).
[0264] The invention also provides pharmaceutical compositions for
use in a method of treating preventing and/or attenuating
hypersensitivity in an animal. Pharmaceutical compositions of the
invention comprise, or alternatively consist of, an immunologically
effective amount of the inventive compositions together with a
pharmaceutically acceptable diluent, carrier or excipient. The
pharmaceutical composition may also optionally comprise an
adjuvant.
[0265] In a further embodiment said pharmaceutical composition
comprises a slow release formulation of the composition of the
invention. Slow release formulations are well known in the art.
Typical and preferred slow release formulations are compositions of
the invention formulated in microparticles, emulsions, and
gels.
[0266] In one embodiment, the invention provides pharmaceutical
compositions for treating or preventing atopic eczema. In another
embodiment, the invention provides pharmaceutical compositions for
treating or preventing asthma. In another embodiment, the invention
provides pharmaceutical compositions for treating or preventing
IgE-mediates allergy (type I allergy), preferably pollen allergy,
house dust or dust mite allergy.
[0267] As would be understood by one of ordinary skill in the art,
when compositions of the invention are administered to an animal,
they can be in a composition which contains salts, buffers,
adjuvants or other substances which are desirable for improving the
efficacy of the composition. Examples of materials suitable for use
in preparing pharmaceutical compositions are provided in numerous
sources including REMINGTON'S PHARMACEUTICAL SCIENCES (Osol, A,
ed., Mack Publishing Co., (1990)).
[0268] Various adjuvants can be used to increase the immunological
response, depending on the host species, and include but are not
limited to, Freund's (complete and incomplete), mineral gels such
as aluminum hydroxide, surface active substances such as
lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions, keyhole limpet hemocyanins, dinitrophenol, and
potentially useful human adjuvants such as BCG (bacille
Calmette-Guerin) and Corynebacterium parvum. Such adjuvants are
also well known in the art. Further adjuvants that can be
administered with the compositions of the invention include, but
are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax
100a, QS-21, QS-18, CRL1005, Aluminum salts (Alum), MF-59, OM-174,
OM-197, OM-294, isomatrix, and virosomal adjuvant technology. The
adjuvants can also comprise a mixture of these substances.
[0269] Immunologically active saponin fractions having adjuvant
activity derived from the bark of the South American tree Quillaja
Saponaria Molina are known in the art. For example QS21, also known
as QA21, is an Hplc purified fraction from the Quillaja Saponaria
Molina tree and it's method of its production is disclosed (as
QA21) in U.S. Pat. No. 5,057,540. Quillaja saponin has also been
disclosed as an adjuvant by Scott et al, Int. Archs. Allergy Appl.
Immun., 1985, 77, 409. Monosphoryl lipid A and derivatives thereof
are known in the art. A preferred derivative is 3 de-o-acylated
monophosphoryl lipid A, and is known from British Patent No.
2220211. Further preferred adjuvants are described in WO00/00462,
the disclosure of which is herein incorporated by reference.
[0270] Compositions of the invention are said to be
"pharmacologically acceptable" if their administration can be
tolerated by a recipient individual. Further, the compositions of
the invention will be administered in a "therapeutically effective
amount" (i.e., an amount that produces a desired physiological
effect).
[0271] The compositions of the present invention can be
administered by various methods known in the art. The particular
mode selected will depend of course, upon the particular
composition selected, the severity of the condition being treated
and the dosage required for therapeutic efficacy. The methods of
the invention, generally speaking, can be practiced using any mode
of administration that is medically acceptable, meaning any mode
that produces effective levels of the active compounds without
causing clinically unacceptable adverse effects. Such modes of
administration include oral, rectal, parenteral, intracisternal,
intravaginal, intraperitoneal, topical (as by powders, ointments,
drops or transdermal patch), bucal, or as an oral or nasal spray.
The term "parenteral" as used herein refers to modes of
administration which include intravenous, intramuscular,
intraperitoneal, intrasternal, subcutaneous and intraarticular
injection and infusion. The composition of the invention can also
be injected directly in a lymph node. Compositions comprising
microparticles are preferably injected subcutaneously,
intravenously, intradermally, intraperitoneally, administered
intranasally, orally, transdermally or inhaled.
[0272] Components of compositions for administration include
sterile aqueous (e.g., physiological saline) or non-aqueous
solutions and suspensions. Examples of non-aqueous solvents are
propylene glycol, polyethylene glycol, vegetable oils such as olive
oil, and injectable organic esters such as ethyl oleate. Carriers
or occlusive dressings can be used to increase skin permeability
and enhance antigen absorption.
[0273] Dosage levels depend on the mode of administration, the
nature of the subject, and the quality of the carrier/adjuvant
formulation. Typical amounts are in the range of about 0.001 .mu.g
to about 20 mg per subject. Preferred amounts are 50 .mu.g to 1000
.mu.g, more preferably 100 .mu.g to 600 .mu.g, and most preferably
about 300 .mu.g of a composition of the invention per single
administration. Further preferred amounts are at least about 50
.mu.g to about 500 .mu.g per subject, most preferably 300 .mu.g per
subject. Multiple administration to treat the subject is preferred,
and protocols are those standard in the art adapted to the subject
in question. The administration of said composition or said
pharmaceutical composition is repeated several times, preferably at
least three to 10 times, most preferably three to five times, in
weekly, monthly or yearly intervals, preferably in intervals of
about 1 week to about 1 month, more preferably in biweekly
intervals, most preferably in weekly intervals. In a very preferred
embodiment the administration of said composition or said
pharmaceutical composition is repeated 6 times in weekly intervals,
wherein preferably each time 50 .mu.g to about 500 .mu.g, most
preferably about 300 .mu.g are administered.
[0274] The compositions of the invention can conveniently be
presented in unit dosage form and can be prepared by any of the
methods well-known in the art of pharmacy. Methods include the step
of bringing the compositions of the invention into association with
a carrier which constitutes one or more accessory ingredients. In
general, the compositions are prepared by uniformly and intimately
bringing the compositions of the invention into association with a
liquid carrier, a finely divided solid carrier, or both, and then,
if necessary, shaping the product.
[0275] Compositions suitable for oral administration can be
presented as discrete units, such as capsules, tablets or lozenges,
each containing a predetermined amount of the compositions of the
invention. Other compositions include suspensions in aqueous
liquids or non-aqueous liquids such as a syrup, an elixir or an
emulsion.
[0276] Other delivery systems can include time-release, delayed
release or sustained release delivery systems. Such systems can
avoid repeated administrations of the compositions of the invention
described above, increasing convenience to the subject and the
physician. Many types of release delivery systems are available and
known to those of ordinary skill in the art.
[0277] A further aspect of the invention is a method of treating
hypersensitivity, preferably atopic eczema, atopic asthma or
IgE-mediated allergy (type I allergy), in an animal, preferably a
mammal, most preferably a human, said method comprising introducing
into said animal (i) a composition comprising a particle and an
ISS-NA, wherein said particle is packaged with said ISS-NA or (ii)
a pharmaceutical composition comprising an immunologically
effective amount of the composition (i) together with a
pharmaceutically acceptable diluent, wherein preferably said
pharmaceutical composition (ii) further comprises an adjuvant. In a
preferred embodiment said composition (i) or said pharmaceutical
composition (ii) is introduced into said animal subcutaneously,
intramuscularly, intravenously, intranasally or directly into the
lymph node. In a further preferred embodiment said introducing into
said animal of the composition (i) or the pharmaceutical
composition (ii) is repeated at least twice, preferably at least
three times, most preferably at least four times in intervals of 1
week to 3 months, preferably 1 week. In a still further preferred
embodiment said introducing into said animal of the composition (i)
or the pharmaceutical composition (ii) is repeated 6 times in
intervals of about 1 week, wherein preferably each time about 300
.mu.g of said composition (i) are introduced.
[0278] A preferred embodiment of the invention is a method of
treating allergy in an animal, said method comprising introducing
into said animal a composition comprising (a) a VLP; and (b) an
unmethylated CpG-containing oligonucleotide; wherein said
virus-like particle (a) is packaged with said unmethylated
CpG-containing oligonucleotide (b), and wherein said allergy
preferably is atopic eczema, asthma or type I allergy, preferably
pollen allergy (hay fever), wherein further said VLP is a VLP of a
RNA bacteriophage, preferably of RNA bacteriophage Q.beta., and
wherein preferably said unmethylated CpG-containing oligonucleotide
(b) consists exclusively of phosphodiester bound nucleotides, most
preferably of SEQ ID NO:27.
[0279] The effectiveness of a treatment of the invention with
respect to a particular disease can be assessed by assessing the
severity of the symptoms associated with said disease using
standard methods known in the art. Generally symptoms are scored
directly before the beginning of the treatment, i.e. before the
first vaccination, in intervals during the treatment and 1 to 3
months after the last treatment. Symptoms of atopic dermatitis can,
for example be scored as described in N. Engl. J. Med 1997,
337:816-21. Symptoms of asthma can be scored by various methods
including questionnaires described in Juniper et al., Health Qual.
Life Outcomes, 2005 Sep. 16, 3:58, and combinations of
questionnaires and spirometric measurements of pulmonary functions
as described in N. Engl. J. Med 2000, 343:1054-63. These references
are incorporated herein by reference. Pollen allergy can, inter
alia, be assessed using a nasal provocation test, other allergies,
e.g. house dust or dust mite allergy, can be assessed using a
conjunctival provocation procedure or a skin prick test. These
testing methods are described in detail in the Example section.
[0280] A further aspect of the invention is the use of a
composition of the invention or of a pharmaceutical composition of
the invention for the manufacture of a pharmaceutical for the
treatment of hypersensitivity in an animal, wherein said
hypersensitivity preferably is an allergy, wherein further
preferably said allergy is selected from the group consisting of:
(a) atopic eczema; (b) atopic asthma; and (c) IgE-mediated allergy
(type I allergy), preferably pollen allergy (hay fever) or house
dust allergy.
[0281] A preferred embodiment of the invention is the use of a
composition comprising a particle and an ISS-NA, wherein said
particle is packaged with said ISS-NA, for the manufacture of a
pharmaceutical for the treatment of hypersensitivity in an animal,
wherein hypersensitivity is preferably selected from the group
consisting of: (a) atopic eczema; (b) atopic asthma; and (c)
IgE-mediated allergy (type I allergy), preferably pollen allergy
(hay fever), and wherein further preferably said particle is a VLP
of a RNA bacteriophage, preferably of RNA bacteriophage Q.beta.,
and wherein preferably said ISS-NA is an unmethylated
CpG-containing oligonucleotide, wherein preferably said
unmethylated CpG-containing oligonucleotide consists exclusively of
phosphodiester bound nucleotides, and wherein more preferably said
unmethylated CpG-containing oligonucleotide comprises the
palindromic sequence of SEQ ID NO:28, most preferably said
unmethylated CpG-containing oligonucleotide is G10 (SEQ ID
NO:27).
[0282] In all aspects and embodiments, in particular in all
compositions, methods, processes and uses, of the invention wherein
said particle is a VLP of bacteriophage Q.beta., said VLP
preferrably essentially consists of coat proteins having the amino
acid sequence of SEQ ID NO:3. In all aspects and embodiments, in
particular in all compositions, methods, processes and uses, of the
invention wherein said ISS-NA is the unmethylated CpG-containing
oligonucleotide G10 (SEQ ID NO:27), said unmethylated
CpG-containing oligonucleotide preferrably consists exclusively of
phosphodiester bound nucleotides.
[0283] In all aspects and embodiments, in particular in all
compositions, methods, processes and uses, of the invention wherein
said particle is a VLP of bacteriophage Q.beta. and wherein said
ISS-NA is the unmethylated CpG-containing oligonucleotide G10 (SEQ
ID NO:27), said VLP of bacteriophage Q.beta. preferrably
essentially consists of coat proteins having the amino acid
sequence of SEQ ID NO:3, and, further preferably, said unmethylated
CpG-containing oligonucleotide consists exclusively of
phosphodiester bound nucleotides.
[0284] The following examples are illustrative only and are not
intended to limit the scope of the invention as defined by the
appended claims. It will be apparent to those skilled in the art
that various modifications and variations can be made in the
methods of the present invention without departing from the spirit
and scope of the invention. Thus, it is intended that the present
invention cover the modifications and variations of this invention
provided they come within the scope of the appended claims and
their equivalents.
[0285] If not indicated otherwise, the VLPs of bacteriophage
Q.beta. used in the Examples are/were VLPs essentially consisting
of coat proteins having the amino acid sequence of SEQ ID NO:3.
Furthermore, if not indicated otherwise, the unmethylated CpG
containing oligonucleotide G10 (SEQ ID NO:27) used in the Examples
is/was unmethylated CpG containing oligonucleotide G10 (SEQ ID
NO:27) consisting exclusively of phosphodiester bound
nucleotides.
[0286] All patents, patent applications and publications referred
to herein are expressly incorporated by reference in their
entirety.
EXAMPLES
Example 1
[0287] Example for Packaging CpG-DNA 1668 into AP205 VLP and
Q.beta. VLP
[0288] Bacterial produced VLPs contain high levels of single
stranded RNA, randomly packaged into the VLP during self assembly,
which can be visualized on a 1% agarose gel stained with ethidium
bromide or Coomassie blue for the detection of RNA/DNA or protein.
The RNA has to be removed from the VLP before packaging with CpG
DNA by digestion with RNase A. Therefore 1 mg/ml VLP in 20 mM
HEPES, pH 7.4 was incubated with 300 .mu.g RNase A for 3 h at
37.degree. C. For removal of RNAse A (and hydrolysed RNA) the VLP
were dialysed for 2-3 days against 20 mM HEPES using a 100'000 or
300'000 MW cut off membrane. Emptied VLPs were then supplemented
with CpG-oligonucleotide 1668-CpG (TCC ATG ACG TTC CTG AAT AAT, SEQ
ID NO:80) which was protected by a phopshorothioate backbone (1 ml
VLP (1 mg/ml in 20 mM HEPES, pH 7.4, 2 mM MgCl.sub.2) with 100 nmol
CpG) allowing free diffusion into the particle during incubation
for 3 hrs at 37.degree. C. The CpG-oligonucleotide containing VLPs
were purified from unbound CpG-oligonucleotide via tangential flow
filtration using a 300'000 MW cut off membrane. A 1% agarose gel
stained with ethidium bromide or Coomassie blue visualized the
removal of RNA followed by packaging of CpG into VLP and proves the
removal of unbound CpG.
Example 2
[0289] Disaggregation and Aggregation of Oligonucleotide G10 (SEQ
ID NO:27) and Analysis of Aggregation State
[0290] Disaggregation (10.0 ml scale, 260 .mu.M G10, 25 mM NaOH,
50.degree. C., 70 min): 45.91 mg G10 were weighed into a 15 ml
tube. The powder was dissolved in 11.0 ml purified water (c=325.3
.mu.M; determined with the photometer). 8.0 ml of the
oligonucleotide solution were mixed with 250 .mu.l 1 M NaOH and
1.75 ml purified water in a 15 ml tube (260 .mu.M G10, 25 mM NaOH).
The mixture was disaggregated for 70 minutes at 50.degree. C. in a
water bath. After cooling the solution on ice, the pH was adjusted
with 0.5 M HCl to pH 5.31; 540 .mu.l 0.5 M HCl and 5 .mu.l 1 M NaOH
were added.
[0291] Aggregation (10.0 ml scale, 175 .mu.M G10, 250 mM NaOH,
85.degree. C., 9-24 min): 7.1 ml disaggregated G10 solution, 2.13
ml purified water and 770 .mu.l 3 M NaCl were mixed in a 15 ml tube
(175 .mu.M oligo, 250 mM Na.sup.+). The mixture was incubated for 9
minutes at 85.degree. C. in a water bath. The solution was cooled
down in an ice/water bath and stored on ice until use. Aggregated
oligonucleotide solutions should be used within 3 hours after
preparation.
[0292] Quantification of G10: G10 was quantified by UV absorption
at 260 nm corrected by the absorption at 340 nm. 1
A.sub.260-340=27.8 .mu.g/ml.
[0293] Analysis of aggregation state: The aggregation state of G10
was analysed by HPLC using the following conditions using Q.beta.
capsid as standard. TABLE-US-00001 Column: TSKgel 5000 PWXL 7.8 mm
* 30.0 cm (Lot: 5PWX06GNMH3304, Art: 08023, Tosoh Bioscience)
Eluent: PBS pH 7.2 Injection volume: 40.0 .mu.l Flow rate: 0.8
ml/min Gradient: Isocratic Run time: 20 min Wavelength: 215, 260
and 280 nm, data evaluation at 260 nm Column oven temp.: 25.degree.
C. Autosampler temp.: 8.degree. C.
[0294] The relative retention time X % of G10 was calculated as
follows: X %=peak start time [min]/Retention time (Q.beta. capsid)
[min].times.100%. Disaggregated G10 showed a relative retention
time of 138% (136.9-140.3%; n=5). G10 preparations which have not
undergone the disaggregation/aggregation treatment described above
show a relative retention time in the same range. After
disaggregation and aggregation, the relative retention time of G10
was found to be 118%.
Example 3
[0295] Packaging of Q.beta. VLPs with G10 by
Disassembly/Reassembly
[0296] Disassembly of Q.beta. VLPs: 45 mg Q.beta. VLP (2.5 mg/ml,
as determined by Bradford analysis) in PBS (20 mM Phosphate, 150 mM
NaCl, pH 7.5), was reduced with 10 mM DTT for 15 min at RT under
stirring conditions. Then, magnesium chloride was added to 0.7 M
final concentration and the incubation was continued for 15 min at
RT under stirring conditions, leading to precipitation of the
encapsulated host cell RNA and concomitant disintegration of the
VLPs. The solution was centrifuged 10 min at 4000 rpm at 4.degree.
C. (Eppendorf 5810 R, in fixed angle rotor A-4-62 used in all
following steps) in order to remove the precipitated RNA from the
solution. The supernatant, containing the released, dimeric Q.beta.
coat protein, was used for the chromatographic purification
steps.
[0297] Purification of Q.beta. coat protein by cation exchange
chromatography and size exclusion chromatography: The supernatant
of the disassembly reaction, containing dimeric coat protein, host
cell proteins and residual host cell RNA, was loaded onto a
SP-Sepharose FF column (xk16/20, 6 ml, Amersham Bioscience). The
column was equilibrated with 20 mM sodium phosphate buffer pH 7 and
the sample was diluted 1:15 in water to adjust a conductivity below
10 mS/cm in order to achieve proper binding of the coat protein to
the column. The elution of the bound coat protein was accomplished
by a step gradient to 20 mM sodium phosphate/500 mM sodium chloride
and the protein was collected in a fraction volume of approx. 25
ml. The chromatography was carried out at RT with a flow rate of 5
ml/min during all steps and the absorbance was monitored at 260 nm
and 2800 nm. In a second step, the isolated Q.beta. coat protein
(the eluted fraction from the cation exchange column) was loaded
onto a Sephacryl S-100 HR column (xk26/60, 320 ml, Amersham
Bioscience) equilibrated with 20 mM sodium phosphate/250 mM sodium
chloride; pH 7.2. The chromatography was carried out at RT with a
flow rate of 2.5 ml/min and the absorbance was monitored at 260 nm
and 280 nm. Fractions of 5 ml were collected.
[0298] Characterization of purified Q.beta. coat protein by
analytical size exclusion chromatography: A sample of purified
Q.beta. coat protein was analyzed by analytical size exclusion
chromatography (FIG. 1C) and compared to i) intact Q.beta. VLP
(FIG. 1A), which had been purified from E. coli lysate and which
was used as source material for the purification procedure, and ii)
to the supernatant of the disassembly reaction (FIG. 1B). Efficient
separation of RNA molecules from the coat protein is indicated by
the absence of any RNA-like peak (typical ratio of A280/A260=0.5)
in FIG. 1C and the presence of a unique protein-like peak (typical
ratio of A280/A260=1.7).
[0299] Assembly of Q.beta.G10 by diafiltration: Purified coat
protein (in 20 mM sodium phosphate pH 7.2, 250 mM NaCl) was mixed
with water and stock solutions of urea, NaCl, DTT and aggregated
G10 oligonucleotide (prepared essentially as described in Example
2). The volume of the mixture was 50 ml and the final
concentrations of the components were 1 mg/ml coat protein, 1.0 M
urea, 250 mM NaCl, 2.5 mM DTT and 0.24 mg/ml G10. The solution was
then diafiltrated at room temperature against 300 ml of 20 mM
sodium phosphate 250 mM NaCl pH 7.2, using a 30 kDa cut off
cartridge (Pellicon XL, Millipore) and a cross flow rate of 10
ml/min and a permeate flow rate of 2.5 ml/min. H.sub.2O.sub.2 was
added to 7 mM final concentration and the solution incubated for 1
h at RT in order to induce the formation of disulfide bonds. The
solution was then diafiltrated against 500 ml of 20 mM sodium
phosphate 150 mM NaCl pH 7.2, using a 300 kDa cut off cartridge
(Pellicon XL, Millipore) and a cross flow rate of 10 ml/min and a
permeate flow rate of 2.5 ml/min, in order to remove excess of
H.sub.2O.sub.2 and non-packaged G10 oligonucleotides from the
assembled Q.beta.G10 product.
Example 4
[0300] Analysis of Q.beta.GIO Packaging Product and Determination
of Yield of the Packaging Process
[0301] Characterization of packaged Q.beta.G10 VLP by analytical
size exclusion chromatography: A sample of packaged Q.beta.G10 VLP
was analyzed by analytical size exclusion chromatography (FIG. 2)
and compared to intact Q.beta. VLP, which had been purified from E.
coli lysate. The presence of correctly assembled VLP in the product
was confirmed by a peak migrating at identical retention time as
the peak representing native Q.beta. VLP. The observed peak for
Q.beta.G110 VLP (FIG. 2D) is dominated by the nucleic acid content
of the VLP, because the absorption coefficient nucleic acids at 260
nm is more than 100-fold higher than the absorption coefficient of
the coat protein. The ratio A260/A280 of purified Q.beta.G10 VLP
was found to be 1.70 (1.65-1.76; n=5), which is characteristic for
G10 (A260/A280=1.74), wherein the A260/A280 ratio of Q.beta. VLP
was found to be 1.87 (1.85-1.90; n=10) which is characteristic for
RNA.
[0302] Characterization of packaged Q.beta.G10 VLP by SDS-PAGE
analysis: A sample of packaged Q.beta. G10 was analyzed by
non-reducing SDS-PAGE (FIG. 3) and compared to intact Q.beta. VLP,
which had been purified from E. coli lysate. The presence of
correctly assembled VLP in the product was confirmed by the
formation of bands of disulfide-linked pentameric and hexameric
forms of the coat protein, similar to the intact Q.beta. VLPs,
indicating the correct structural arrangement of the coat protein
units in the in vitro assembled Q.beta.G10 VLP.
[0303] Quantification of packaged oligonucleotide G10: Samples of
Q.beta.G10 VLP (0.25 mg/ml in PBS) were treated by 0.1 mM TCEP (15
min at RT) in order to reduce the disulfide bonds. NaCl was added
to the reduced samples (1 M final concentration) and the mixtures
were incubated for 15 min at 60.degree. C. in order to precipitate
the protein component. After centrifugation, the resulting
supernatants were incubated for 5 min at 95.degree. C., cooled on
ice for 1 min and then the A260 value was measured. The
concentration of oligonucleotide G10 in the supernatants was
calculated according to the formula:
c(G10)(mg/ml)=A.sub.260.times.1.12.times.9600/344580, where:
[0304] 1.12=correction factor for the salt content in the
sample
[0305] 9600=molecular mass of oligonucleotide G10
[0306] 344580=specific molar absorption coefficient of
oligonucleotide G10.
[0307] Typically, the amount of packaged oligonucleotide G10 was
0.2 mg per mg of Q.beta. coat protein.
[0308] G10 content of Q.beta.G10 VLP and yield calculation for the
packaging reaction: Aggregated G10 was packaged into Q.beta. VLP by
assembly/reassembly of the VLP as described in Example 3. 953 mg
G10 oligonucleotide were introduced for reassembly with 4000 mg
purified Q.beta. dimer. The reaction yielded Q.beta.G10 comprising
20 .mu.g G10 oligonucleotide per 100 .mu.g protein (protein content
determined by Bradford analysis or HPLC). The G10 yield of the
packaging reaction was 63% at a protein yield of 75%.
Example 5
[0309] Packaging of AP205 and GA355 VLPs with G10 by
Disassembly/Reassembly
[0310] Disassembly: 50-100 mg of AP205 or GA355 VLPs (as determined
by Bradford analysis) in buffer A (5 mM NaPO.sub.4 pH 6.8, 100 mM
NaCl, 2 mM MgCl.sub.2) were incubated at 30.degree. C. for 16 hours
with RNAse A (Sigma) and Benzonase (Novagen) at 1 mg/ml and 5 U/ml,
respectively. In the case of AP205 VLP deoxidation of the internal
disulfide bridges was performed preceding the addition of RNAse A
and Benzonase by addition of 20 mM DTT followed by a 30 min
incubation at 37.degree. C. After addition of 1 M NaCl
precipitation of the viral coat proteins was induced by 15 min
incubation at 70.degree. C. Precipitated coat proteins were
sedimented by centrifugation for 10 min, 27,000 g at 4.degree. C.
The supernatant containing RNAse A, Benzonase and degraded nucleic
acids was discarded. Pellets were resuspended in buffer B (20 mM
NaPO.sub.4 pH 7.2, 6 M urea) and incubated for 10 min at room
temperature.
[0311] Purification of coat proteins by cation exchange
chromatography: The solutions were clarified by centrifugation for
10 min, 27,000 g at 4.degree. C. A negligible pellet was discarded.
And the supernatant containing the disassembled coat proteins were
applied on a SP Sepharose.TM. FF column (16/20, Amersham
Biosciences) equilibrated with buffer B. The flow through was
discarded. After an extensive wash with buffer B (15 CV) the column
was adjusted with a linear gradient from buffer B to buffer C (20
mM NaPO.sub.4 pH 7.2, 1 M urea) with a gradient length of 37.5 CV.
During the loading, wash and elution the absorbance at 254 nm and
280 nm was monitored. Coat proteins were eluted as one fraction
with buffer D (20 mM NaPO.sub.4 pH 6.5, 1 M urea, 300 mM NaCl) and
analyzed by LDS-PAGE followed by Coomassie staining. Eluted protein
fractions were stored at 4.degree. C. as "disassembled coat
protein". Protein concentrations were determined by Bradford
analysis.
[0312] Reassembly: Purified AP205 or GA355 coat protein with were
used in a five fold excess (w/w) to G10 oligonucleotide. The coat
proteins were mixed with the G10 oligonucleotide in a reassembly
buffer containing 1 M urea and 2.5 mM DTT and incubated for one
hour at room temperature. After incubation the reassembly mix was
dialyzed for 24 hours against 5 liter PBS. The resulting suspension
was centrifuged for 10 min, 27,000 g at 4.degree. C. A negligible
sediment was discarded. The supernatant contained the reassembled
and packaged VLPs. Protein concentration was determined by Bradford
analysis and the reassembled and packaged VLPs were concentrated
with centrifugal filter devices (Amicon Ultra 15, 10K MWCO).
[0313] Purification of reassembled and packaged VLPs: Up to 25 mg
total protein was loaded onto a Sepharose.TM. CL-4B (26/60,
Amersham Biosciences) equilibrated with PBS. Size exclusion
chromatography was performed with equilibration buffer at room
temperature with a flow rate of 1.25 ml/min. During the elution
absorbance at 254 nm and 260 nm was monitored. Two peaks were
isolated. A major high molecular weight peak preceded a small peak
of lower apparent molecular weight. The major peak revealed a
apparent molecular weight consistent to purified VLPs as shown by
SE-HPLC. Analysis of AP205 or GA355 VLPs packaged with G10
oligonucleotide is performed essentially as shown in Example 16 of
WO03/024481 (P. 131 ff).
Example 6
[0314] Packaging of FR VLPs with G10 by Disassembly/Reassembly
[0315] Disassembly: 50-100 mg of FR VLPs (as determined by Bradford
analysis) in buffer A (5 mM NaPO.sub.4 pH 6.8, 100 mM NaCl, 2 mM
MgCl.sub.2) are incubated at 30.degree. C. for 16 hours with RNAse
A (Sigma) and Benzonase (Novagen) at 1 mg/ml and 5 U/ml,
respectively. After addition of 1 M NaCl precipitation of the FR
coat proteins is induced by a 15 min incubation at 70.degree. C.
Precipitated coat proteins are sedimented by centrifugation for 10
min, 27,000 g at 4.degree. C. The supernatant containing RNAse A.
Benzonase and degraded nucleic acids are discarded. The pellet is
resuspended in buffer B (20 mM NaPO.sub.4 pH 7.2, 6 M urea) and
incubated for 10 min at room temperature.
[0316] Purification of FR coat proteins by cation exchange
chromatography: The solution is clarified by centrifugation for 10
min, 27,000 g at 4.degree. C. A negligible pellet is discarded and
the supernatant containing the disassembled coat proteins is
applied on a SP Sepharose.TM. FF column (16/20, Amersham
Biosciences) equilibrated with buffer B. The flow through is
discarded. After an extensive wash with buffer B (15 CV) the column
is adjusted with a linear gradient from buffer B to buffer C (20 mM
NaPO.sub.4 pH 7.2, 1 M urea) with a gradient length of 37.5 CV.
During the loading, wash and elution the absorbance at 254 nm and
280 nm is monitored. FR coat proteins are eluted as one fraction
with buffer D (20 mM NaPO.sub.4 pH 6.5, 1 M urea, 300 mM NaCl) and
analyzed by LDS-PAGE followed by Coomassie staining. The eluted
protein fractions is stored at 4.degree. C. as "disassembled coat
protein". Protein concentration is determined by Bradford
analysis.
[0317] Reassembly: Purified FR coat protein is used in a five fold
excess (w/w) to G10 oligonucleotide. The FR coat proteins are mixed
with the G10 oligonucleotide in a reassembly buffer containing 1 M
urea and 2.5 mM DTT and incubated for one hour at room temperature.
After incubation the reassembly mix is dialyzed for 24 hours
against 5 liter PBS. The resulting suspension is centrifuged for 10
min, 27,000 g at 4.degree. C. A negligible sediment is discarded.
The supernatant contains the reassembled and packaged FR VLPs.
Protein concentration is determined by Bradford analysis and the
reassembled and packaged FR VLPs are concentrated with centrifugal
filter devices (Amicon Ultra 15, 10K MWCO).
[0318] Purification of reassembled and packaged FR VLPs: Up to 25
mg total protein is loaded onto a Sepharose.TM. CL-4B (26/60,
Amersham Biosciences) equilibrated with PBS. Size exclusion
chromatography is performed with equilibration buffer at room
temperature with a flow rate of 1.25 ml/min. During the elution
absorbance at 254 nm and 260 nm is monitored. Two peaks are
isolated. A major high molecular weight peak precedes a small peak
of lower apparent molecular weight. The major peak reveals a
apparent molecular weight consistent to purified FR VLPs as shown
by SE-HPLC. Analysis of FR VLPs packaged with G10 oligonucleotide
is performed essentially as shown in Example 16 of WO 03/024481 (p.
131 ff).
Example 7
[0319] Size Dependent Traffic of Nanoparticles to the Lymph
Node
[0320] To study the mechanism of traffic of particulate antigens to
the lymph node, yellow-green fluorescent polystyrene nanoparticles
with sizes ranging from 20 nm to 2000 nm (Molecular probes) were
injected in the footpads (25 .mu.g/footpads) of C57BL/6 mice and
tracked. VLPs of bacteriophage Q.beta. were coupled to Alexa488
using a protein labeling kit (Molecular probes) and included in the
experiment as 30 nm fluorescent particles. Forty eight hours later
the nanoparticles and VLPs were tracked in the popliteal draining
lymph node (LN) by flow cytometry. Popliteal LN were isolated and
digested with 1 mg/ml Collagenase D (Boehringer) and 0.04 mg/ml
DNA-se I (Roche) for 30 min at 37.degree. C. In order to identify
cell populations taking up nanoparticles, LN cells were stained
with anti-CD11c-PE (BD). Flow cytometry analysis showed that 48
hours after injection, nanoparticles and VLPs have reached the
popliteal LN and were associated to different level with LN cells,
including dendritic cells (DC, Table 1). LN cells acquired more
efficiently smaller particles (20-500), than larger ones (1000-2000
nm). VLP-Alexa488 (30 nm) showed efficiency of LN uptake between
the efficiency of 20 and 100 nm polystyrene nanoparticles. These
data suggest that nanoparticles and VLPs traffic from the injection
site to the LN in a size-dependent manner, with significant
trafficking taking place for particles of sizes between 20 and 500
nm. TABLE-US-00002 TABLE 1 Flow cytometry analysis of the
trafficking of nanoparticles or VLP to the popliteal LN: 48 h after
injection. Anti - CD11c antibodies were used to identify DC. Size
[nm] % FL1 + DC sd % FL + LN cells sd 20 0.82 0.08 2.46 0.15 30
1.38 0.18 4.14 0.65 100 2.31 0.36 12.09 1.22
Example 8
[0321] Kinetics of Trafficking of VLP to the LN
[0322] To study the kinetics of uptake of nanoparticles in LN
cells, VLP-Alexa488 (prepared as described in Example 7) were
injected in C57BL/6 mice (as described in Example 7) and tracked
after 2 to 96 h. LN cells were stained with combinations of the
following antibodies: anti-CD11c-PE, anti-CD11b-APC,
anti-CD11c-biotin, anti-CD19-APC, anti-B220-PE, antiCD8-CyChr,
anti-CD40-APC and streptavidin-CyChr (all from BD). Flow cytometry
analysis showed that 2 h after injection in the footpad,
VLP-Alexa488 have associated with antigen presenting cells (APC)
from the popliteal LN (Table 2). It is quite unlikely that
dendritic cells from the skin had taken up and had trafficked
VLP-Alexa488 to the draining LN for the short period of 2 h. These
results rather suggest that VLP-Alexa488 had drained in a cell-free
manner through the lymphatic system into the draining lymph node.
Macrophages and DC were the most prominent populations taking up
VLP-Alexa488. Most importantly, 2 h after injection, 1.9% of
LN-resident plasmacytoid DC also acquired VLP-Alexa488. pDC in
humans are mostly found in secondary lymphoid tissues and are the
only DC population expressing TLR9. Therefore, the ability of
VLP-Alexa488 to drain free to the LN makes them a very appropriate
vehicle to target pDC with the possibility to simultaneously
deliver ISS (such as CpG), packaged in VLP.
[0323] The uptake of VLP-Alexa488 peaked at 24 h after injection
(Table 2), remained quite stable by 48 h and declined after 96 h.
It is likely, that at that later time point also skin derived DC
contribute to the traffic of VLP-Alexa488 to the draining LN.
Indeed, the ratio between the uptake of VLP-Alexa488 at 2 h
(draining) and 24 h (DC-mediated transport) is lower for myeloid
(including skin-derived, CD11c+CD40hiCD8-) compared to lymphoid
(CD11c+CD401oCD8+) DC, which acquire VLP while in the LN (FIG. 4).
TABLE-US-00003 TABLE 2 Flow cytometry analysis of the kinetics of
trafficking of Q.beta.-VLP to the popliteal LN. Anti - CD11c,
CD11b, B220 and CD19 antibodies were used to identify DC,
Macrophages, pDC and B-cells. The percentage of green cells in the
gate of the indicated LN cell populations is shown. % VLP-Alexa488+
cells time [h] DCs Macrophages pDC B-cells 2 2.82 13.04 1.9 0.9 24
26.83 38.32 3.66 2 48 18.28 24.9 1.5 0.96 96 4.31 18.35 0.24
0.21
Example 9
[0324] Kinetics of Trafficking of Nanoparticles by In Vivo
Imaging
[0325] The traffic of 20 and 500 nm fluorescent polystyrene
nanoparticles, as well as VLP-Alexa488 was investigated in vivo
using an UV light tool (LT-99D2-220, Lightools Research, CA)
equipped with 470/40 nm excitation filter and high resolution
camera (KM_Dynax.sub.--5D). Mice were injected with the fluorescent
nanoparticles in the footpad as described in Example 7 and pictures
were taken at 2, 24 and 192 h after injection. In agreement with
flow cytometry data (Table 2), 2 h after injection VLP-Alexa488
have reached the popliteal LN as detected by fluorescence
microscopy. Similarly to VLP (30 nm), 20 nm nanoparticles (Table 3)
were also detected, suggesting that small nanoparticles are able to
drain in a cell-free manner to the LN. On the contrary, at this
early time point 500 nm nanoparticles were not detected in the
popliteal LN (Table 3), demonstrating a slower kinetics of traffic
of larger particles to the LN. Flow cytometry analysis were
performed 2 h after injection of 20 or 500 nm nanoparticles. These
results confirmed the findings with the light tool imaging (Table
3). One possibility for the slower trafficking kinetics of 500 nm
particles is that it takes place in part via DC uptake at the
injection site and transport to the LN.
[0326] Twenty four hours after injection, 500 nm particles have
reached the draining LN as detected by fluorescence microscopy,
although the associated fluorescence was quantitatively less than
in LN of mice injected with 20 nm and VLP-Alexa488 nanoparticles.
At later time points (192 h) VLP-Alexa488, 20 and 500 nm particles
were still present at the injection site and in the popliteal LN,
suggesting a depot formation and continuous delivery of
antigen.
[0327] Taken together, these data suggest a size dependent
mechanism of traffic of nanoparticles to the LN. Small particles,
such as 20 nm and VLP-Alexa488 drain in a cell-free manner to LN at
early time points whereas large particles (500 nm) show slower
kinetics due to requirement for DC-mediated transport.
TABLE-US-00004 TABLE 3 Flow cytometry analysis of the trafficking
of nanoparticles to the popliteal LN 2 h after injection. The
percentage of green cells in the total LN cell gate is shown.
Particle Size [nm] FL1 + LN cells 20 1.59 500 0.05* *the value is
in the range of the background observed in naive animals
Example 10
[0328] DC-Dependence of the Delivery of Nanoparticles to the LN
[0329] Macrophages are thought to be non-migratory cells, therefore
particle bearing macrophages are supposed to be LN-resident cells
that had acquired particles while in the LN. On the contrary, DC
have the capacity to engulf particles at the injection site and to
migrate to the draining LN. To investigate the relationship between
the size of a nanoparticle and the mechanism of trafficking to the
LN, the fluorescent nanoparticles ranging in size from 20 to 2000
nm were injected in the footpads of mice as described in Example 7,
and the ratio between the nanoparticle-containing DC and
macrophages was calculated (FIG. 5). The larger the injected
particle (500-2000 nm), the more DCs are involved in its uptake in
LN. Smaller particles (20-200 nm) were detected in comparable
percentage of DC and macrophages, suggesting cell-free draining and
association with LN-resident APC.
[0330] In vivo imaging kinetic studies in wild type mice and in
mice conditionally depleted of DCs (CD11c-DTR-GFP mice, Jung S. et
al., 2002) showed that large particles (500 nm) reached the
draining LN only in the presence of DCs, whereas small (20 nm)
nanoparticles trafficked efficiently also in DC-depleted animals.
These data suggest that small nanoparticles can target lymph node
resident DC populations. Indeed, as shown in Table 4, 20 nm
particles and VLP (30 nm) associated with the lymph node-resident
plasmacytoid DCs (PDCA-1.sup.+B220.sup.+), B cells
(PDCA-1.sup.-B220.sup.+) and lymphoid DCs (CD11c.sup.+CD8.sup.+).
Therefore, small particles are useful to target LN-resident APC,
whereas large particles exclusively target DC at the injection
site. TABLE-US-00005 TABLE 4 Flow cytometry analysis of the
trafficking of nanoparticles to the popliteal LN 48 h after
injection. The percentage of green cells in the gate of the
indicated LN cell populations is shown. Particle size % FL1.sup.+ %
FL1.sup.+ % FL1.sup.+ [nm] Lymphoid DCs plasmacytoid DCs B cells 20
12 8 4 30 (VLP) 13 16 2 1000 3 0 0
Example 11
[0331] Generation of Bone Marrow-Derived Dendritic Cells (BMDC) and
Treatment with Q.beta.G10 Batches
[0332] 11 week old mice from the LPS-resistant (C3H/HeJ) and
LPS-responding (C3H/HeN) strains were sacrificed and the femurs and
tibias isolated and kept in PBS. After removing the flesh, bones
were cut from both sides and the bone marrow flushed out using a
syringe filled with 10% FCS RPMI. Released cells were collected and
passed through a 70 .mu.m cell strainer. Cells were washed and
re-suspended at 20.times.10.sup.4 cells/ml in 10% FSC RPMI
containing 10 ng/ml mouse GM-CSF (R&D). 2.times.10.sup.6 cells
were plated in bacterial grade Petri dishes in 10 ml medium for 6
days. The differentiation status of BMDC was ascertained on day 6
by analyzing cells for the expression of CD11c and CD11b by flow
cytometry. At day 6 of differentiation, BMDC were harvested from
the Petri dishes, washed once and plated in 96-well U-bottom plate
(BD) at 5.times.10.sup.4/well. 6 dilutions (4-fold) of Q.beta.G10
were prepared in a separate plate and added to BMDC for 20 h.
[0333] ELISA for determination of IL-12: Microtiters plates
(Maxisorp, Nunc) were coated overnight with 2 .mu.g/ml rat
anti-mouse IL-12 (p40/p70) monoclonal antibody (mAb, Pharmingen) in
coating buffer (0.1 M NaHCO.sub.3, pH 9.6). After washing (0.05%
Tween 20/PBS) and blocking (2% BSA/0.05% Tween 20/PBS), 70 .mu.l of
supernatants from BMDC or two-fold dilutions of recombinant IL-12
(starting from 20 .mu.g/ml) were added and incubated for 2 h at
room temperature (RT). After washing the plates, biotin-labeled rat
anti-mouse IL-12 mAb (p40/p70, Pharmingen) was added at 1 .mu.g/ml
for 1 h at RT. Plates were washed and incubated with 1 .mu.g/ml
streptavidin-HRPO (Jackson laboratories) for 1 h at RT. After
washing, o-phenylene diamine (OPD, Fluka) in citric acid buffer (pH
5) was added for 5 min and the reaction was stopped with 5%
H.sub.2SO.sub.4. Optical density at 490 nm was measured in an ELISA
reader (Molecular Devices) and data were analyzed using the
software Soft max Pro.
[0334] Results: Activation of BMDCs by Q.beta. packaged with G10
oligo is shown on FIG. 6. BMDCs were activated by Q.beta.G10 and
hence secreted IL-12 in a dose dependent way (dose is given as
equivalent of G10 oligonucleotide packaged in the Q.beta. VLPs)
while untreated control cells did not secrete any IL-12. Therefore
G10 oligonucleotide packaged in Q.beta. VLPs is able to activate
BMDCs, demonstrating that the particles are taken up by the cells
and oligonucleotide is made subsequently available for stimulation
of the BMDCs.
Example 12
[0335] BMDC Release IL-12 upon AP205G10 Treatment
[0336] BMDC from C3H/HeJ mice were in vitro generated as described
in Example 11. Cells were plated in a 96-well plate and stimulated
either mock or with the indicated concentrations of AP205
reassembled with G10 (AP205G10). Eighteen hours later the
supernatants were collected and IL-12 was measured by a sandwich
ELISA, as described in Example 11. AP205G10 induced a
dose-dependent secretion of IL-12, while untreated cells released
IL-12 only to basal levels (Table 5). These results demonstrate
that AP205G10 is taken up by BMDC and activates them to release
IL-12. TABLE-US-00006 TABLE 5 Dose response of AP205G10 induced
IL-12 secretion by BMDCs. AP205G10 .mu.g/ml IL-12 [pg/ml] 300
4699.7 150 4831.3 75 4535.9 37.5 3644.7 18.75 2760.3 9.375 1407.0 0
471.1
Example 13
[0337] Preparation and Characterization of Gelatin Nanoparticles as
Delivery System for G10 Oligodesoxynucleotide (G10-ODN)
[0338] Preparation of plain Gelatin Nanoparticles (GNP) by two step
desolvation: The procedure used was the original one described by
(Coester et al. 2000) as follows. 1.25 g of gelatin type A
(Bloom175) was dissolved in 25 ml highly purified water (HPW) to 5%
(w/w) under gentle heating to 50.degree. C. A first desolvation
step was initiated by the addition of 25 ml acetone. After
sedimentation of the precipitated gelatin fractions for 60 seconds,
the supernatant consisting of dispersed gelatin as well as
dissolved gelatin was discarded. The sediment was dissolved again
by the addition of 25 ml water under heating to 50.degree. C. and
the pH was adjusted to 2.5. In situ gelatin nanoparticles were
formed during a second desolvation step by drop wise addition of 50
ml acetone under constant stirring (500 rpm). After 10 min, 175
.mu.l of glutaraldehyde (25%) were added to the reaction vessel to
crosslink the nanoparticles. Finally, after stirring for 12 hours
in an extractor hood, the particles were purified by three-fold
centrifugation (20000 g for 20 min) and redispersion in
acetone/water (30/70), the last step in HPW alone. The purified
nanoparticles were stored as dispersion in HPW
(conductivity<0.04 .mu.s/cm) at 4-8.degree. C. The following
standard process parameters are critical for nanoparticle
preparation: (a) Temperature before the first and second
desolvation step: 50.degree. C.; (b) stirring speed: 500-700 rpm;
(c) precipitation time after the first desolvation step: 60 sec;
(d) speed of acetone addition (second desolvation step): 3-5
ml/min.
[0339] Determination of nanoparticle size: Particle sizes were
determined employing dynamic light scattering (DLS) technology. DLS
experiments were performed with a Zetasizer ZS (Malvern
Instruments, Worcestershire, England) using NIBS.TM.-technology
(Non Invasive Back Scattering) at a static detection angle of
173.degree.. The nanoparticles were diluted in sterile filtered,
highly purified water and measured in concentrations between 30 and
100 .mu.g/ml. Due to these low concentrations, the nanoparticles
did not influence the viscosity of the dispersion, so that the
viscosity of pure water which is of 0.8872 cP at 25.degree. C. was
used. The experiments were performed at 25.degree. C.
[0340] Cationisation of plain Gelatin Nanoparticles: A new,
modified version of the original method described by Coester (2003)
using cholaminechloride hydrochloride was used (Ahlers et al. 2005;
Coester 2003; Zwiorek et al. 2004). An aqueous dispersion of plain
nanoparticles was adjusted to pH 4.5 and a molar excess of the
cationization agent cholamine chloride hydrochloride (e.g. 50 mg
per 500 mg nanoparticles) was added under constant stirring. After
5 minutes of incubation, 50 mg of
1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide hydrochloride (EDC)
was added to activate the free carboxyl groups on the particles to
react with cholaminechloride hydrochloride. During the
cationization reaction the primary amino groups of the
cholaminechloride hydrochloride can react with two possible
functional groups on the nanoparticle's surface. The first
interaction sites are residual aldehyde groups derived from the
only mono-functionally bound cross linking reagent glutaraldehyde.
Furthermore, the primary amino groups can react with activated
carboxyl groups on the nanoparticles surface. The reaction was
stopped after 1 h and the nanoparticles were purified by 3-fold
centrifugation and redispersion, analogous to the purification of
plain nanoparticles. The final particles were characterized by size
determination using dynamic light scattering, and measurement of
the Zeta potential. Each assigned size and corresponding
polydispersity index was the mean of 10 subruns. The Zeta potential
was determined using the same instrument and calculated as the mean
of 10 individual measurements in PBS. Particles showing a positive
charge of 5 mV or higher in PBS were used for loadings.
[0341] G10-ODN loading on cationized gelatin nanoparticles: G10-ODN
was employed either in an aggregated or non-aggregated form
(omitting the aggregation step in the protocol for ODN G10
preparation, Example 2) in purified water and in PBS. For the
cellular assays described below the contents were 1% for GNP and
0.1% for G10-ODN leading to a targeted loading of 10% (w/w) in PBS.
For the mouse model study described below, a G10-ODN content of
0.25% and GNP of 2.5% were prepared as well providing a 10% (w/w)
loading in PBS. The loading experiment is exemplary described for a
targeted (aspired) 10% (w/w) G10-ODN loading on GNP in PBS, and the
same procedure was adapted for the other targeted loading
percentages using aggregated or non-aggregated G10-ODN. 43.3 .mu.l
of an aqueous GNP dispersion containing 1.2 mg GNP were transferred
to an Eppendorf.TM. 1.5 ml cap under aseptic conditions. Then 1086
.mu.l of PBS were added and mixed at the same time with the
pipette. In the next step, 71.4 .mu.l of G10 stock solution
containing 120 .mu.g of aggregated G10, were added into the
dispersion by quick but gentle up and down pipetting for at least
20 seconds. The prepared sample was subsequently incubated for 1 h
15 min at 22.degree. C. and 750 rpm on a Thermomixer.TM.
device.
[0342] Determination of G10-ODN loading efficiency (Zillies and
Coester 2004): After incubation, the G10-ODN loaded GNP samples to
be tested for successful loading were centrifuged for 1 h at 15000
g. After centrifugation the supernatant was carefully separated
from the remaining pellet and analyzed spectrophotometrically at a
wavelength of 260 nm. A reference of unloaded GNP of the same
concentration (1 mg/ml) and a reference of G10-ODN of the same
concentration (100 g/ml) were prepared and centrifuged along.
G10-ODN loading in percent was calculated from the percentage free
G10-ODN, which was obtained by subtracting the measured absorption
of the particle reference from the sample result and then dividing
this result by the measured absorption of the G10-ODN reference,
and multiplying by hundred. Finally, the loading efficiency was
calculated by subtracting the percentage free G10-ODN from
100%.
[0343] Results of G10-ODN loading determination: Results of loading
efficiency were obtained by various GNP batches. However, the
preparation process and especially cationization was the same in
each case. Hence, loadings can be compared as well as among batches
with different particle sizes. All results given in percent are
mass percentage (w/w) calculated on the employed masses of G10-ODN
and GNP. As shown in Tables I-III for non-aggregated G10-ODN and
Tables IV-V for aggregated G10-ODN, G10-GNPs with loading
percentage from 3-15% (non-aggregated G10-ODN) or 5-10% (aggregated
G10-ODN) were successfully obtained. Optimal loading medium was
PBS, where no flocculation was detected in the preparations.
Results of not aggregated G10-ODN show sufficient bindings over all
with a tendency to decreased efficiency from 5 to 10% loading in
water and without this tendency in PBS. The loading of 15% G10-ODN
onto GNP shows only a slightly lower efficiency. TABLE-US-00007
TABLES I and II loading efficiency [%] of not aggregated G10 on GNP
(314 nm) in water (left) and GNP (218 nm) in PBS (right). The
single numbers on top of each sub table give the targeted G10 - ODN
loading onto GNP in percent. 3 3 particle reference 0.132 (n = 3,
S.D. = 0.0021) particle reference 0.103 (n = 3, S.D. = 0.006) ODN
reference 3% 0.404 (n = 3, S.D. = 0.0029) ODN reference 3% 0.964
sample G10 3% (water) 0.117 (n = 3, S.D. = 0.0006) sample G10 3%
(PBS) 0.127 (n = 3, S.D. = 0.001) loading [%] 100.000 loading [%]
97.476 5 5 particle reference 0.132 (n = 3, S.D. = 0.0021) particle
reference 0.103 (n = 3, S.D. = 0.006) ODN reference 5% 0.662 (n =
3, S.D. = 0.0021) ODN reference 5% 1.647 sample G10 5% (water)
0.132 (n = 3, S.D. = 0.0021) sample G10 5% (PBS) 0.106 (n = 3, S.D.
= 0.0056) loading [%] 100.000 loading [%] 99.798 8 8 particle
reference 0.132 (n = 3, S.D. = 0.0021) particle reference 0.103 (n
= 3, S.D. = 0.006) ODN references 8% 1.079 (n = 3, S.D. = 0.0026)
ODN reference 8% 2.673 sample G10 8% (water) 0.149 (n = 3, S.D. =
0.0000) sample G10 8% (PBS) 0.100 (n = 3, S.D. = 0.0107) loading
[%] 97.886 loading [%] 100.000 10 10 particle reference 0.132 (n =
3, S.D. = 0.0021) particle reference 0.103 (n = 3, S.D. = 0.006)
ODN reference 10% 1.344 ODN reference 10% 3.356 sample G10 10%
(water 0.186 (n = 3, S.D. = 0.0010) sample G10 10% (PBS) 0.166 (n =
3, S.D. = 0.0079) loading [%] 95.700 loading [%] 96.113
[0344] TABLE-US-00008 TABLE III loading efficiency [%] of not
aggregated G10 onto GNP (218 nm) in PBS particle reference 0.105 (n
= 3, S.D. = 0.0006) ODN reference 15% 2.557 sample G10 15% (PBS)
0.238 (n = 3, S.D. = 0.0154) loading [%] 94.798
[0345] TABLE-US-00009 TABLE IV loading efficiency [%] of aggregated
G10 onto GNP (218 nm) in PBS ODN-reference 0.827 (n = 5, S.D. =
0.002) particle reference 0.145 (n = 5, S.D. = 0.004) sample G10 5%
aggl 0.176 (n = 5, S.D. = 0.005) loading [%] 96.251 (n = 5, S.D. =
1.089) ODN-reference 0.827 (n = 4, S.D. = 0.002) particle reference
0.145 (n = 4, S.D. = 0.004) sample G10 10% aggl 0.159 (n = 4, S.D.
= 0.001) loading [%] 98.277 (n = 4, S.D. = 0.425)
[0346] TABLE-US-00010 TABLE V Loading efficiency [%] of aggregated
G10 onto GNP (218 nm) in HPW particle reference 0.106 (n = 3, S.D.
= 0.0005) ODN reference 1.870 (n = 3, S.D. = 0.0037 sample G10 10%
(water) 0.285 (n = 3, S.D. = 0.0034) loading [%] 90.426
[0347] G10-loaded gelatin nanoparticles (GNP-G10) induce IL-12
secretion from BMDC: GNP-G10 were prepared as described above. To
evaluate the effect of unbound G10, an aliquot of GNP-G10
preparation was centrifuged at 16000 g for 1 h at 4.degree. C. and
the supernatant was collected (supGNP-G10). BMDC from C3H/HeJ mice
were generated in vitro, as described in Example 11. Cells were
plated in a 96-well plate and stimulated either mock or with the
indicated concentrations of GNP-G10 or supGNP-G10 (given as their
molar concentration of G10). Eighteen hours later the cell
supernatants were collected and IL-12 was measured by a sandwich
ELISA, as described in Example 11. GNP-G10 induced secretion of
IL-12 from BMDC at all tested concentrations (Table VI). In
contrast, BMDC did not release significant amounts of IL-12 upon
treatment with supGNP-G10. These results suggest that GNP-G10 are
taken up by BMDC and trigger release of IL-12. In addition, these
data show that G10 is efficiently loaded on GNP, as supGNP-G10 did
not induce IL-12 secretion from BMDC. GNPs without G10 do not
induce IL-12 secretion in mouse dendritic cells. TABLE-US-00011
TABLE VI GNP-G10 induced secretion of IL-12 from BMDC. IL-12
[pg/ml] G10 [nM] GNP-G10 std supGNP-G10 std 5200 7841.0 846.5 382.7
42.4 2600 7444.4 365.8 232.9 10.8 1300 7382.9 379.3 83.3 1.4 650
6968.6 271.9 58.2 13.7 325 7701.7 210.6 371.2 456.2 162.5 7007.7
348.7 52.0 3.7 0 41.3 21.5 41.3 21.5
[0348] G10-loaded gelatin nanoparticles (GNP-G10) are protective in
an mouse model of asthma: An experimental asthma model of allergic
airway (Hessel E M et al., J. Exp. Med. 2005, 202, 1563) is used to
assess the effects of GNP-G10 on total IgE level. For
sensitization, four groups of mice (groups B-E, five mice per
group) are injected intraperitonealy (i.p.) with 150 .mu.g ragweed
(Ambrosia artemisiifolia) pollen extract (RW, Greer) mixed with 450
.mu.g of Alum (Alhydrogel 2.0% Brenntag Biosector, Denmark) on day
0 and 3. Mice from one group (group A) are treated i.p. with PBS
only. On day 10, mice from group C are injected subcutaneously with
300 .mu.g QbG10 (equivalent to 60 .mu.g G10), mice from group D
with 600 .mu.g GNP-G10 (equivalent to 60 .mu.g G10), mice from
group E with 600 .mu.g GNP-G10 aggregated (equivalent to 60 .mu.g
G10) mice from groups A and B with PBS. Blood is sampled from all
animals prior to injection. On day 17, all animals are bled, and
total IgE titer is determined. The total IgE level in blood is
measured by ELISA. Briefly, an ELISA plates (96 well MAXIsorp, NUNC
immuno plate #442404) is coated with anti-IgE (BD Pharmingen, #
553413) at a concentration of 5 .mu.g/ml in coating buffer (0.1 M
NaHCO3, pH 9.6) over night at 4.degree. C. The plates are then
washed with wash buffer (PBS/0.05% Tween) and blocked for 2 h at
37.degree. C. with 2% BSA in wash buffer. The plate is then
extensively washed and then incubated with 1 to 20 diluted mouse
sera or serially diluted mouse IgE standard (BD Pharmingen, #
557079). The plate is incubated at RT for 2 h and then extensively
washed with wash buffer. Bound specific mouse antibodies are then
detected by one hour incubation with a HRPO-labelled, epsilon chain
specific, rat anti-mouse IgE antibody (Southern Biotech
#H021-NBB4C). After extensive washing with wash buffer, plates are
developed with OPD solution (1 OPD tablet, 25 ml OPD buffer and 8
.mu.l H.sub.2O.sub.2) for 6 minutes and the reaction is stopped
with 5% H.sub.2SO.sub.4 solution. Plates are then read at OD 450 nm
on an ELISA reader (Biorad Benchmark). The concentrations of IgE in
sera is calculated with GraphPad Prism4 using the mouse IgE
standard as reference.
[0349] References for Example 13: [0350] Ahlers, Michael, et al.
Biodegradable gelatin nanoparticles and procedure for their
production. (Deutsche Gelatine-Fabriken Stoess A.-G., Germany,
assignee. Patent 102004041340. 20060223. (2005). [0351] Coester, C.
J., et al. "Gelatin nanoparticles by two step desolvation--a new
preparation method, surface modifications and cell uptake." Journal
of Microencapsulation 17.2 (2000): 187-93. [0352] Coester, Conrad.
Development of a new carrier system for oligonucleotides and
plasmids based on gelatin nanoparticles. New Drugs [1], 14-17.
2003. [0353] Zillies, Jan and Coester, Conrad. Evaluating gelatin
based nanoparticles as a carrier system for double stranded
oligonucleotides. Journal of Pharmacy & Pharmaceutical Sciences
7[4], 17-21. 2004. [0354] Zwiorek, Klaus, Kloeckner, Julia, Wagner,
Ernst, and Coester, Conrad. Gelatin nanoparticles as a new and
simple gene delivery system. Journal of Pharmacy &
Pharmaceutical Sciences 7 [4], 22-28. 2004.
Example 14
[0355] Detection of IFN-Alpha Production in Cells by ELISA
[0356] Human peripheral blood mononuclear cells (PBMC) were
isolated from buffy coats and treated with immunostimulatory
nucleic acids in RPMI medium containing 10% fetal calf serum (FCS)
for 18 h. IFN-alpha in the supernatants was measured by sandwich
ELISA, using an antibody set provided by PBL Biomedical
Laboratories. Briefly, ELISA plates were coated with 5 .mu.g/ml of
the capture anti-IFN-alpha antibody. After washing, plates were
blocked with 0.5% BSA for 1 h at room temperature (RT).
Supernatants from treated and control PBMC, as well as recombinant
IFN-alpha were added to the plate and incubated for 2 h at
37.degree. C. Rabbit polyclonal anti-IFN-alpha serum was used as
detection antibody and incubated for 1 h at RT.
Peroxidase-conjugated goat anti-rabbit serum was subsequently added
to the plates for 1 h at RT. Washing step was performed after each
incubation. The color reaction was developed using the enzyme
substrate o-phenylendiamine and read at 490 nm in an ELISA reader
device. The data are expressed as pg/ml secreted IFN-alpha
according to a standard curve of recombinant IFN-alpha.
Example 15
[0357] Flow Cytometry Analysis Using Fluorochrom-Conjugated
Antibodies
[0358] PBMC are stimulated for 3-6 h with immunostimulatory nucleic
acids followed by incubation with brefeldin A for additional 4 h.
Cells are then stained with DC-specific surface markers,
permeabilized and intracellularly stained for IFN-alpha.
Example 16
[0359] Effects of Q.beta.G10 on Eosinophilia after Sensitization
with Ragweed Pollen and One Challenge on Day 11.
[0360] An experimental asthma model of allergic airway (Hessel E M
et al., J. Exp. Med. 2005, 202, 1563) was used to assess the
effects of Q.beta.G10 on eosinophilia, a pathologic maker of
asthma. For sensitization, three groups of mice (five mice per
group) were injected intraperitonealy (i.p.) with 150 .mu.g ragweed
(Ambrosia artemisiifolia) pollen extract (RW, Greer) mixed with 450
.mu.g of Alum (Alhydrogel 2.0% Brenntag Biosector, Denmark) on day
0 and 3. On day 9, mice from group B received 375 .mu.g of
Q.beta.G10 subcutaneously (s.c.). On day 10, mice from group C
received 375 .mu.g of Q.beta.G10 subcutaneously. Mice from of group
A received PBS as control. On day 11, all mice were challenged with
200 .mu.g of RW in PBS intranasally (i.n.). 48 hours after the
challenge mice were sacrificed and the lungs were washed with PBS
(Table 6). The cells contained in the broncho alveolar lavage (BAL)
were analysed by FACS. Eosinophils were identified by high CCR3
(Mouse CCR3 Phycoerythrin MAb, R & D) expression. As shown in
Table 7, the total amount of cells in BAL was strongly reduced in
Q.beta.G10 treated compared to PBS control mice. The reduction was
more pronounced when Q.beta.G10 was given 48 hours (61%, p<0.05)
before the challenge than 24 hours (52%) before the challenge. As
shown in Table 8, the amount of eosinophils was strongly reduced in
Q.beta.G10 treated compared to PBS control mice. Again, the
reduction was more pronounced when Q.beta.G10 was given 48 hours
(70%, P<0.05) than 24 hours (60%, p<0.05) before the
challenge. Thus, Q.beta.G10 treatment prevents the development of
asthma in a murine model for asthma. TABLE-US-00012 TABLE 6
Experimental Protocol. Day 0 Day 3 Day 9 Day 10 Day 11 Day 13 A RW
alum i.p. RW alum i.p. PBS s.c. RW Analysis B RW alum i.p. RW alum
i.p. Q.beta.G10 s.c. RW Analysis C RW alum i.p. RW alum i.p.
Q.beta.G10 s.c. RW Analysis
[0361] TABLE-US-00013 TABLE 7 Total Cell Counts in BAL. Group A
Group B Goup C mouse 1 210'000 60'000 180'000 mouse 2 636'000
66'000 312'000 mouse 3 330'000 60'000 120'000 mouse 4 246'000
366'000 102'000 mouse 5 480'000 360'000 36'000 average 380'400
182'400 150'000 reduction 52% 61%
[0362] TABLE-US-00014 TABLE 8 Eosinophil counts in BAL. Group A
Group B Goup C mouse 1 61'696 11'208 19'855 mouse 2 90'166 15'913
32'487 mouse 3 106'682 9'811 12'786 mouse 4 36'300 64'255 13'276
mouse 5 82'757 58'752 4'222 average 75'520 31'988 16'525 reduction
63% 70%
Example 17
[0363] Effects of Q.beta.G10 on Eosinophilia after Sensitization
with Ragweed Pollen and Two Challenges (Day 11 and 15)
[0364] A stronger experimental asthma model of allergic airway
(modified from Hessel E M et al., J. Exp. Med. 2005, 202, 1563) was
also used to assess the effects of Q.beta.G10 on eosinophilia and
IgE concentration in blood. For sensitization, two groups of mice
(five mice per group) were injected intraperitonealy with 150 .mu.g
RW pollen extract in 450 .mu.g of alum on day 0 and 3. On day 9 and
13, mice from group B were subcutaneously injected with 375 .mu.g
of Q.beta.G10. Mice from of group A received PBS as control. On day
11 and 15, mice were challenged with 200 .mu.g of RW in PBS
intranasally. 48 hours after the challenge mice were sacrificed and
the lungs were washed with PBS (Table 9). The cells contained in
the BAL were analyzed by FACS as described in Example 16. As shown
in Table 10 and 11, the total amount of cells (51%, p<0.01) and
the amount of eosinophils (62%, p<0.001) were strongly reduced
in Q.beta.G10 treated compared to PBS control mice. Thus,
Q.beta.G10 prevents the development of asthma in a stronger murine
model for asthma.
[0365] The total IgE level in blood was measured by ELISA. Briefly,
an ELISA plates (96 well MAXIsorp, NUNC immuno plate #442404) were
coated with anti-IgE (BD Pharmingen, # 553413) at a concentration
of 5 .mu.g/ml in coating buffer (0.1 M NaHCO3, pH 9.6) over night
at 4.degree. C. The plates were then washed with wash buffer
(PBS/0.05% Tween) and blocked for 2 h at 37.degree. C. with 2% BSA
in wash buffer. The plate was then extensively washed and then
incubated with 1 to 20 diluted mouse sera or serially diluted mouse
IgE standard (BD Pharmingen, # 557079). The plate was incubated at
RT for 2 h and then extensively washed with wash buffer. Bound
specific mouse antibodies were then detected by one hour incubation
with a HRPO-labelled, epsilon chain specific, rat anti-mouse IgE
antibody (Southern Biotech #H021-NBB4C). After extensive washing
with wash buffer, plates were developed with OPD solution (1 OPD
tablet, 25 ml OPD buffer and 8 .mu.l H.sub.2O.sub.2) for 6 minutes
and the reaction was stopped with 5% H.sub.2SO.sub.4 solution.
Plates were then read at OD 450 nm on an ELISA reader (Biorad
Benchmark). The concentrations of IgE in sera were calculated with
GraphPad Prism4 according to the standard. As shown in Table 12,
the total IgE level in mice treated with Q.beta.G10 are
significantly (P<0.05) reduced comparing to untreated mice.
TABLE-US-00015 TABLE 9 Experimental Protocol. Day 0 Day 3 Day 9 Day
11 Day 13 Day 15 D17 A RW alum i.p. RW alum i.p. PBS RW PBS RW
Analysis B RW alum i.p. RW alum i.p. Q.beta.G10 s.c. RW Q.beta.G10
s.c. RW Analysis
[0366] TABLE-US-00016 TABLE 10 Total Cell Counts in BAL. Group A
Group B mouse 1 877'250 437'250 mouse 2 ND 805'750 mouse 3
1'057'375 534'875 mouse 4 1'199'000 460'625 mouse 5 1'287'000
496'375 average 1'105'156 546'975 reduction 51%
[0367] TABLE-US-00017 TABLE 11 Eosinophil Counts in BAL. Group A
Group B mouse 1 611132 208045 mouse 2 ND 492788 mouse 3 802727
337733 mouse 4 901931 244154 mouse 5 949650 276519 average 816360
311848 reduction 62% ND: not determined
[0368] TABLE-US-00018 TABLE 12 IgE Concentration in sera
(.mu.g/ml). Group A Group B mouse 1 4.6 0.7 mouse 2 0.7 0.4 mouse 3
3.5 0.4 mouse 4 4.6 0.6 mouse 5 1.7 0.3 average 3.0 0.5 reduction
84.5%
Example 18
[0369] Duration of the Effect of Q.beta.G10 and Interaction of
Q.beta.G10 with RW Antigen
[0370] Mice were sensitized with RW mixed with alum as in Example
16 on day 0 and 3. On day 10 and day 12, mice received Q.beta.G10,
Q.beta.G10 mixed with RW (20 .mu.g) or PBS subcutaneously. 6 and 14
days after the treatment, mice were challenged with RW. 48 hours
after the challenge, IgE level in sera was analyzed (Table 13). The
data clearly show that IgE level in Q.beta.G10 or Q.beta.G10 mixed
with RW treated mice is significantly reduced comparing to PBS
treated controls (Table 14) and no clear difference has been seen
between Q.beta.G10 and Q.beta.G10 mixed with RW. TABLE-US-00019
TABLE 13 Experimental Protocol. Day Day Day Day Day Day Day Day Day
Day 0 3 10 12 19 21 26 29 40 42 A RW alum RW alum PBS s.c. PBS s.c.
RW Analysis i.p. i.p. i.n. B RW alum RW alum Q.beta.G10 s.c.
Q.beta.G10 s.c. RW Analysis i.p. i.p. i.n. C RW alum RW alum
Q.beta.G10 RW Q.beta.G10 RW RW Analysis i.p. i.p. s.c. s.c. i.n. D
RW alum RW alum PBS s.c. PBS s.c. RW Analysis i.p. i.p. i.n. E RW
alum RW alum Q.beta.G10 s.c. Q.beta.G10 s.c. RW Analysis i.p. i.p.
i.n. F RW alum RW alum Q.beta.G10 RW Q.beta.G10 RW RW Analysis i.p.
i.p. s.c. s.c. i.n.
[0371] TABLE-US-00020 TABLE 14 IgE Concentration in sera
(.mu.g/ml). A B C D E F mouse 1 1.62 0.13 0.30 1.70 0.47 0.30 mouse
2 0.78 0.16 0.37 0.62 0.05 0.33 mouse 3 0.56 0.10 0.21 0.70 0.16
0.31 mouse 4 1.98 0.22 0.12 1.47 0.42 0.29 mouse 5 0.54 0.24 0.22
0.60 0.35 0.29 average 1.10 0.17 0.24 1.02 0.29 0.30 reduction
84.5% 77.8% 71.5% 70.2%
Example 19
[0372] Specificity of Q.beta.G10
[0373] Mice are sensitized with RW and Fel d1 (Cytos, Switzerland)
on day 0 and 3. On day 10, mice are treated with either PBS (group
A and B), or Q.beta.G10 (group C and D), or Q.beta.G10 mixed with
RW (group E and F) or Q.beta.G10 mixed with Fel d1. On day 12, mice
from group A, C, E and G are challenged with RW mixed with alum. On
the other hand, mice from group B, D, F and H are challenged with
Fel d1. On day 14, all mice receive the same treatment as on day
10. On day 16 all the mice are challenged as on day 12. 48 hours
after the last challenge, RW and Fel d1 specific IgE in the BAL and
blood are measured and infiltrating cells in BAL are analyzed
(Table 15). TABLE-US-00021 TABLE 15 Experimental Protocol. Day 0
Day 3 Day 10 Day 12 Day 14 Day 16 Day 18 A RW Feld1 RW Feld1 PBS
s.c. RW i.n. PBS s.c. RW i.n. Analysis alum i.p. alum i.p. B RW
Feld1 RW Feld1 PBS s.c. Feld1 i.n. PBS s.c. Feld1 i.n. Analysis
alum i.p. alum i.p. C RW Feld1 RW Feld1 Q.beta.G10 s.c. RW i.n.
Q.beta.G10 s.c. RW i.n. Analysis alum i.p. alum i.p. D RW Feld1 RW
Feld1 Q.beta.G10 s.c. Feld1 i.n. Q.beta.G10 s.c. Feld1 i.n.
Analysis alum i.p. alum i.p. E RW Feld1 RW Feld1 Q.beta.G10 RW i.n.
Q.beta.G10 RW i.n. Analysis alum i.p. alum i.p. RW s.c. RW s.c. F
RW Feld1 RW Feld1 Q.beta.G10 Feld1 i.n. Q.beta.G10 Feld1 i.n.
Analysis alum i.p. alum i.p. RW s.c. RW s.c. G RW Feld1 RW Feld1
Q.beta.G10 RW i.n. Q.beta.G10 RW i.n. Analysis alum i.p. alum i.p.
Feld1 s.c. Feld1 s.c. H RW Feld1 RW Feld1 Q.beta.G10 Feld1 i.n.
Q.beta.G10 Feld1 i.n. Analysis alum i.p. alum i.p. Feld1 s.c. Feld1
s.c.
Example 20
[0374] Comparison G10 and Q.beta.G10
[0375] The effects of G10 and Q.beta.G10 were compared in the
ragweed allergic model. Three groups of mice were sensitized with
ragweed on day 0 and day 3 by i.p. injection of ragweed mixed with
alum. On day 10 and 12, mice from group B and C were treated with
G10 or Q.beta.G10 respectively. Mice from group A received PBS as
control. All mice were challenged with 200 .mu.g of RW by i.n.
administration and two days after the challenge mice were
sacrificed. Infiltrating cells and IL-4 concentration in BAL and
IgE level in blood were analysed (Table 16).
[0376] As shown in Table 17, whereas the total amount of cells in
BAL was not significantly changed in G10 treated mice, it was
strongly reduced in Q.beta.G10 treated mice compared to PBS control
mice (32%, p<0.05). Similarly, the amount of eosinophils was
strongly reduced (64.1%, p<0.01) in Q.beta.G10 treated compared
to PBS control mice and the changes in G10 treated mice were not
significant (Table 18). Thus, whereas non-packaged G10 had not
significant effects on infiltrating cells in BAL, G10 packaged in
Q.beta. prevented cells infiltrating to the lung. As shown in Table
19, whereas the changes of IgE level in mice treated with G10 were
not significant, the Q.beta.G10 treated mice had significantly
(p<0.001) reduced blood IgE levels in comparison with PBS
treated mice. As shown in Table 20, whereas the changes of IL4
level in BAL from mice treated with G10 were not significant, the
Q.beta.G10 treated mice had significantly (p<0.001) reduced BAL
IL-4 levels in comparison with PBS treated mice. Therefore, when
G10 was packaged in Q.beta., it reduced the pathological markers of
asthma and allergy. TABLE-US-00022 TABLE 16 Experimental design.
Day 0 Day 3 Day 10 Day 12 Day 14 Day 16 A RW alum i.p. RW alum i.p.
PBS s.c. PBS s.c. RW i.n. Analysis B RW alum i.p. RW alum i.p. G10
s.c. G10 s.c. RW i.n. Analysis C RW alum i.p. RW alum i.p.
Q.beta.G10 s.c. Q.beta.G10 s.c. RW i.n. Analysis
[0377] TABLE-US-00023 TABLE 17 Total Cell Counts in BAL and changes
relative to group A. Group A Group B Group C mouse 1 402000 439500
274500 mouse 2 358500 325500 319500 mouse 3 309000 357000 112500
mouse 4 306000 196500 274500 mouse 5 337500 279000 177000 average
342600 319500 231600 % reduction 7 32
[0378] TABLE-US-00024 TABLE 18 Eosinophils in BAL and changes
relative to group A. Goup A Group B Group C mouse 1 158020 146095
37134 mouse 2 109612 76898 65099 mouse 3 85261 95275 20344 mouse 4
72211 43605 33118 mouse 5 97900 53716 31945 average 104601 83118
37528 % reduction 20.5 64.1
[0379] TABLE-US-00025 TABLE 19 IgE Concentration (.mu.g/ml) and
changes relative to group A. Goup A Group B Group C mouse 1 0.93
0.49 0.16 mouse 2 0.86 0.30 0.11 mouse 3 0.82 0.66 0.17 mouse 4
0.44 0.52 0.18 mouse 5 0.54 0.49 0.19 average 0.72 0.49 0.16 %
reduction 31.6 77.6
[0380] TABLE-US-00026 TABLE 20 IL-4 Concentration (pg/ml) in BAL
and changes relative to group A. Goup A Group B Group C mouse 1
17.7 24.9 1.4 mouse 2 26.2 25.0 1.6 mouse 3 51.2 35.9 1.5 mouse 4
37.6 6.5 4.3 mouse 5 49.1 4.9 2.4 Average 36.4 19.4 2.2 % reduction
46.5 93.8
Example 21
[0381] Treatment of Cat Allergy with Q.beta.G10
[0382] Mice are sensitized by intraperitoneal injection with 5
.mu.g of Fel d1 on day 1 and 14, and then boosted intranasally with
1 .mu.g of Fel d1 on days 28, 29, 30 and 33. Mice are injected
subcutaneously with 375 .mu.g of Q.beta.G10 or PBS on days 37, 39
and 41. On day 43, mice are challenged intranasally with 1 .mu.g of
Fel d1 and the core temperature of the mice is measured rectally
using a rectal probe digital thermometer. Mast cell degranulation
is monitored in the cat allergy model. Mice are injected
subcutaneously with 375 .mu.g of Q.beta.G10 on day 0 and day 3. On
day 5, mice are injected intradermally with 50 .mu.l of 1:5 diluted
cat allergic sera or purified IgE from that serum or control serum.
4 or 24 h later, mice are injected intravenously with 10 .mu.g of
Fel d1 plus Evans blue dye. The mice are sacrificed 30 min after
the intravenous challenge and the blue staining reaction is
analyzed. Q.beta.G10 treated mice have reduced blue staining as
compared to untreated mice.
Example 22
[0383] Treatment of Bee Venom Allergy with Q.beta.G10
[0384] Female 6 to 8 week-old CBA/J mice are obtained from Harlan
(Zeist, The Netherlands). Animals are sensitized every other week
by s.c. injection in the ventral region and at the base of the tail
of 0.1 .mu.g PLA2 adsorbed to 1 mg alum. Two protocols are applied
for Q.beta.G10 therapy. First, presensitized mice receive daily
s.c. injections of 375 .mu.g of Q.beta.G10 for 6 consecutive days.
IgE levels are measured 48 hours after the last Q.beta.G10
injection. Second, naive mice are injected s.c. with 375 .mu.g of
Q.beta.G10 on day 0 and day 3. Two weeks after the last Q.beta.G10
injection, mice are sensitized with PLA2 in alum. IgE levels are
measured 7 days after PLA2 sensitization. Control groups receive
either PBS or 30 .mu.g native PLA2. For the induction of
anaphylactic responses, animals are injected i.p. with 30 .mu.g
native PLA2 in PBS, and rectal temperature is monitored with a
calibrated digital thermometer. In comparison to untreated mice,
the temperature drop in Q.beta.G10 treated mice is less
pronounced.
Example 23
[0385] Treatment of House Dust Mite Allergy with Q.beta.G10
[0386] Male CBA/CaH mice are sensitized with an intraperitoneal
injection of 5 .mu.g of Der P1+1 mg of alhydrogel. For intranasal
installations, 25 .mu.l aliquots containing 5 .mu.g of Der P1 or
sterile saline are applied to the noses of anesthetized mice. Two
protocols are applied Q.beta.G10 therapy. First, presensitized mice
receive daily s.c. injections of 375 .mu.g of Q.beta.G10 for 6
consecutive days in. IgE levels are measured 48 hours after the
last Q.beta.G10 injection. Second, naive mice are injected s.c.
with 375 .mu.g of Q.beta.G10 on day 0 and day 3. Two weeks after
the last Q.beta.G10 injection, mice are sensitized with Der P1 in
alum. IgE levels are measured 7 days after Der P1 sensitization.
Q.beta.G10 treated mice exhibit lower IgE concentrations than the
untreated control.
Example 24
[0387] Treatment of a Patient Suffering from Atopic Dermatitis with
Q.beta.G10 and Assessment of Efficacy
[0388] 24.1 Assessment of Symptoms of Atopic dermatitis: Total body
involvement is estimated with the use of shapes of 100 to 1000
cm.sup.2 or by the rule of nine which assigns standard measurements
to body parts on the basis of the size of the body part. The total
body score is the sum of the individual scores, on a scale of 0 to
3, for erythema, edema, pruritus, oozing crusting, excoriation, and
lichenification of all involved skin, dryness of noninvolved skin,
and sleep loss. The investigator grades affected skin areas of the
test persons on a scale of 0 to 3 for the severity of erythema,
edema, oozing or crustating, excoriation, and lichenification of
involved skin and dryness of noninvolved skin. The test persons
grade the pruritus of the selected areas on a 10-cm visual analogue
scale, with severe at the bottom and absent at the top; this grade
is converted to a score of 0 to 3 for analysis. To ensure
consistency in the assessment of efficacy, all the investigators
receive a manual and participate in a on-day, centralized training
course, as well as on-site training.
[0389] 24.2 Treatment with Q.beta.G10: A group of test persons
suffering from Atopic dermatitis is treated at least three times in
intervals of 1 week with 300 .mu.g Q.beta.G10 (Q.beta. VLP packaged
with G10 (SEQ ID NO:27)), a control group with comparable symptoms
is treated with placebo. Dependent on the average symptom score of
the test group the treatment of the test group can be repeated up
to a total of 6 to 10 vaccinations with 300 .mu.g Q.beta.G10 each;
the control group is always treated with placebo in parallel.
[0390] 24.3 Assessment of Efficacy: Total body involvement is
assessed before the first treatment and at the end of the study.
The symptoms on selected skin areas individually chosen for each
patient are assessed directly before each treatment and in
intervals up to 3 months after the last treatment. The changes in
the symptom scores of the test group at the beginning and at the
end of the study are compared to that of the control group.
Example 25
[0391] Efficacy Parameters Atopic Dermatitis
[0392] The Physician's Global Assessment (PGA) of Atopic Dermatitis
(AD): The investigator will rate the overall disease severity using
the scale described in Table 21. The rating is to be assigned in
consideration of the patient's current condition, without reference
to previous assessments.
[0393] Eczema Area and Severity Index (EASI): The extent and
severity of dermatitis over 4 body surface areas will be calculated
using the Eczema Area and Severity Index (EASI) (Hanifin J. M. et
al. (2001), Exp. Dermatol. 10:11-18). The four body regions are
assigned proportionate body surface areas (BSA) such that the head
and neck together comprise 10% BSA, the front and back of the trunk
each comprise 15% BSA, each arm comprises 10% BSA, and each leg
comprises 20% BSA. The percentage of area involved for each of the
body regions is given a score, ranging from 0 to 6, where 0=no
eruption, 1=<10%, 2=10% to 29%, 3=30% to 49%, 4=50% to 69%,
5=70% to 89%, and 6=90% to 100%. The four key symptoms of atopic
dermatitis to be assessed are: Erythema, Induration/papulation,
Excoriation (linear abrasions of the skin due to scratching), and
Lichenification. Each of these symptoms will be scored at each of
the four body regions using a scale of 0 to 3, with half-steps
allowed, where 0=none, 1=mild, 2=moderate, and 3=severe. The
definitions outlined in Table 22 will be used.
[0394] The score for each body region is obtained by multiplying
the sum of the severity scores of the four key symptoms by the
percentage of area involved on the body region, then multiplying
the result by the constant weighted value assigned to the
particular body region (see Table 23). The EASI score is the sum of
the four body region scores.
[0395] Patient's Assessment of Pruritus Score: At each study visit,
the patient will be asked to assess the severity of pruritus since
the last visit using the scale shown in Table 24. TABLE-US-00027
TABLE 21 Physician's Global Assessment (PGA) of Atopic Dermatitis.
Score Grade Definition 0 Clear No inflammatory signs of atopic
dermatitis 1 Almost clear Just perceptible erythema, and just
perceptible papulation/induration 2 Mild disease Mild erythema, and
mild papulation/induration 3 Moderate disease Moderate erythema,
and moderate papulation/ induration 4 Severe disease Severe
erythema, and severe papulation/ induration 5 Very severe Severe
erythema, and severe papulation/ disease induration with oozing or
crusting
[0396] TABLE-US-00028 TABLE 22 Severity scoring of key symptoms.
Induration/ Erythema Papulation Excoriation Lichenification None No
evidence of No perceptible No evidence of No evidence of skin (0)
erythema elevation excoriations thickening Mild Very light pink,
Barely perceptible Scant evidence of Slight thickening of the skin,
(1) faintly detectable elevation excoriations with no sign
discernible only by touch and erythema of deeper skin damage with
markings minimally (ie, erosion, crust) exaggerated Moderate Dull
red, clearly Clearly Several linear marks of Definite thickening of
the (2) distinguishable perceptible, but skin, with some showing
skin, with skin markings erythema not extensive, evidence of deeper
skin exaggerated so that they form elevation injury (ie, erosion,
crust) a visible criss-cross pattern Severe Deep, dark red Marked
and Many erosive or crusty Thickening indurated skin (3) extensive
lesions with skin markings visibly elevation portraying an
exaggerated criss-cross pattern
[0397] TABLE-US-00029 TABLE 23 Eczema Area and Severity (EASI)
Calculation (patients of 8 years and older). Body region EASI
Score.sup.a,b Head/neck (E + IP + Ex + L) .times. Area .times. 0.1
Upper limbs (E + IP + Ex + L) .times. Area .times. 0.2 Trunk (E +
IP + Ex + L) .times. Area .times. 0.3 Lower limbs (E + IP + Ex + L)
.times. Area .times. 0.4 EASI = Sum of the above 4 body region
scores .sup.aSymptoms: E = erythema, IP = induration/papulation, Ex
= excoriation, L = lichenification. .sup.bArea: 0 = no eruption, 1
= <10%, 2 = 10%-29%, 3 = 30%-49%, 4 = 50%-69%, 5 = 70%-89%, and
6 = 90%-100%.
[0398] TABLE-US-00030 TABLE 24 Patient Assessment of Pruritus
Score. Score Grade Definition 0 None No pruritus 1 Mild Clearly
present but minimal awareness; occasional, slight itch 2 Moderate
Definite awareness that is bothersome but tolerable; does not
disturb sleep 3 Severe Hard to tolerate; interferes with sleep
Example 26
[0399] Treatment of Test Persons Suffering from Atopic Dermatitis
with Q.beta.G10 and Assessment of Efficacy
[0400] Treatment with Q.beta.G10: A double-blind parallel-group
clinical trial is performed with 36 patients with atopic
dermatitis. Patients are allocated randomly to two groups of 18
patients each. The first group is treated with 300 .mu.g Q.beta.G10
(Q.beta. VLP filled with G10 (SEQ ID NO:27)) six times in intervals
of 1 week. The second group is treated with placebo.
[0401] Assessment of Efficacy: Physician Global Assessment (PGA),
EASI Scores, and Patient's assessment of pruritus (see Example 25)
are performed prior to the first treatment, bi-weekly during the
treatment period, and several times after treatment until the end
of the study at 24 weeks after the first treatment. The changes in
the symptom scores from before the treatment are compared between
the groups at the various assessment points after the
treatment.
Example 27
[0402] Treatment of Test Persons Suffering from Asthma with
Q.beta.G10 or AP205G10 and Assessment of Efficacy Using a
Standardized Asthma Quality of Life Questionnaire
[0403] 27.1 Assessment of Asthma Symptoms: Asthma symptoms are
assessed using the standardized Asthma Quality of Life
Questionnaire (AQLQ(S) or AQLQ12+, Juniper et al., Health Qual.
Life Outcomes September 2005 3:58).
[0404] 27.2 Treatment with Q.beta.G10 or AP205G10: Two test groups
and one control group of persons suffering from asthma and showing
comparable symptom score with AQLQ(S) or AQLQ12+are treated with
VLPs of bacteriophage Q.beta. packaged with G10 (SEQ ID NO:27),
VLPs of bacteriophage AP205 packaged with G10 (SEQ ID NO:27) or
placebo, respectively. Q.beta.G10 and AP205G10 are produced
according to Examples 16 and 17 of WO03/024481 or preferably
according to the Examples herein. The test persons are treated at
least three times with 300 .mu.g Q.beta.G10 or 300 .mu.g AP205G10
in intervals of 1 week. Dependent on the average symptom score of
the test group the treatment of the test group can be repeated up
to a total of 6 to 10 vaccinations with 300 .mu.g VLP-G10 each; the
control group is always treated with placebo in parallel.
[0405] 27.3 Assessment of Efficacy: All test persons are scored
using the AQLQ(S) or AQLQ12+method directly before each treatment
and 1 and 3 months after the last treatment. The development of the
average score in the two groups treated with CpG packaged VLPs and
the control group are compared.
Example 28
[0406] Assessment of Asthma Symptoms
[0407] The severity of asthma symptoms can be assessed by
spirometric measurements before and after administration of
methacholine according to the following protocol.
Step 1: Preparation of test solution
[0408] Remove the test solution (methacholine) from the
refrigerator 20 minutes before testing and bring it to room
temperature; [0409] Check the expiry date of the test solution;
Step 2: Preparation of test patient [0410] Let patient adapt to
room climate for 10 min; [0411] Perform the respiratory spirometer
test (see Appendix 11.4 Respiratory Spirometry); [0412] Exclude
contraindications for methacholine testing (relevant airway
obstruction, acute infection, pregnancy, .beta.-blocker or
anti-cholinergic medication) (cholinergic or anticholinergic); Step
3: Preparation of "Dosimeter Mefar MB3" [0413] Switch on machine by
pressing the two yellow buttons ("unit", "compressor") on the right
and wait till the pressure reaches 25 kg/cm.sup.2; [0414] define
inhalation time by pressing the grey numbered buttons 05, then
define the time of pause 050 and inhalation time (N. inhale)
O.sub.2, press "Reset" [0415] Prepare the inhalation set by filling
in lower plastic piece of the inhalation set 1.5 ml of NaCl 0.9%,
screw on upper part with the same number, then put on linking and
mouth piece and hose that connects the inhalation instrument with
the machine [0416] Press the button for "Air Tank Release" Step 4:
Negative control and instruction of the patient [0417] Perform
negative control with NaCl 0.9% by asking the patient to enclose
the mouth piece with his lips and take a deep breath. While taking
a deep breath press button; [0418] "Emergency Manual Thermistor";
[0419] Repeat once (see dose protocol below), then press "End" and
"Reset 02"; [0420] Wait for 2 minutes, then repeat the respiratory
spirometer test; Step 5: Provocation with methacholine [0421] Fill
in lower piece of inhalation set 1.5 ml of methacholine
concentration 10 mg/ml and screw set back together and press "Air
Tank Release"; [0422] Ask the patient to enclose the mouth piece
with his lips and to take a deep breath. While taking a deep breath
press button "Emergency Manual Thermistor"; [0423] Repeat once (see
dose protocol below, Table 25), then press "End" and "Reset
02";
[0424] Wait for 2 minutes, then repeat the respiratory spirometer
test; TABLE-US-00031 TABLE 25 Dosage protocol for methacholine
challenge. Methacholine Number of Dose per Total Cumulative
concentration inhalations inhalation dose dose NaCl 0.9% 2 -- -- --
10 mg/ml 2 50 .mu.g 100 .mu.g 100 .mu.g 10 mg/ml 3 50 .mu.g 150
.mu.g 250 .mu.g 50 mg/ml 1 250 .mu.g 250 .mu.g 500 .mu.g 50 mg/ml 2
250 .mu.g 500 .mu.g 1000 .mu.g 50 mg/ml 4 250 .mu.g 1000 .mu.g 2000
.mu.g
Flowchart for the Respiratory Spirometry (RS) Step 1: Preparation
[0425] Calibrate the spirometer daily before use Step 2: Test
[0426] Ask the subject to sit in an upright position, breathing
normally; [0427] Instruct the subject to inhale as much as
possible, and then to exhale into the spirometer as rapidly and
completely as possible, until all air is exhaled; [0428] Repeat two
more times (total 3 times); Step 3: Result [0429] Define the best
effort (defined as the greatest FEV.sub.1/FVC ratio). If the
greatest FEV.sub.1/FVC ratio is seen in more than one effort, the
best effort will be the one with the highest FEV.sub.1; [0430] If
the greatest FEV.sub.1/FVC ratio is LESS than 70% of normal
categorize as "relevant airway obstruction" and prove exclusion
criteria. Otherwise continue; [0431] Subtract 20% off of measured
FEV.sub.1 and define it as FEV.sub.1-20%; [0432] Transcribe the
measured FEV.sub.1, the "FEV.sub.1-normal" and the calculated
FEV.sub.1-20% onto prepared sheets ("Methacholine-(Broncho)
Provocation Test");
Example 29
[0433] Treatment of Test Persons Suffering from Asthma with
Q.beta.G10 or AP205G10 and Assessment of Efficacy Using Spirometry
after Methacholine Challenge
[0434] 29.1 Assessment of Asthma Symptoms: Asthma symptoms are
assessed by Spirometry with measurements obtained before and after
the administration of methacholine according to Example 28.
Determined are the parameters FEV1 and the ratio of FEV1 to the
forced vital capacity FVC expressed as a percentage of the
predicted value. Additionally, the test persons (or their parents
or guardians) complete a diary card each day throughout the study
recording night awakenings due to asthma, morning and evening peak
flows as measured by peak-flow meters, use of medication, use of
rescue medicine (albuterol) for symptoms and to prevent
exercise-induced bronchospasm, use of prednisone, absence from
school/work due to asthma, visits to a physician's office or
hospital because of asthma and severity of symptoms. Test persons
use their usual medication throughout the study.
[0435] 29.2 Treatment with Q.beta.G10 or AP205G10: see Example
27.2.
[0436] 29.3 Assessment of Efficacy: Spiromenty data of all test
persons are obtained directly before each treatment, diary data are
obtained 1 month before the first treatment until 3 month after the
last treatment on a daily basis. Analyzed are, for example, the
number of asthma related night awakenings per month, the number of
episode-free days and the morning peak flow. Average data of the
two groups treated with CpG packaged VLPs are compared to the
placebo group.
Example 30
[0437] Skin Prick Test
[0438] A skin prick test (SPT) is performed to verify that a
subject shows hypersensitization to a certain allergen. The test is
useful to test the reaction of a patient to a wide range of
allergens, including pollen allergen and allergen mix that is
routinely used to screen for atopy. The test is useful to test the
reaction towards dust mite allergens (Der p and Der f). At
Screening this test must be performed prior to CPT (Example 31).
Skin prick tests and intradermal skin tests allow a visualisation
of sensitisation. The basic principle of skin testing is the
introduction of a small amount of allergen into the dermis. The
released mediators cause vasodilatation and increase vascular
permeability, which in turn leads to tissue edema and the
development of a weal. Histamine triggers the release of the
neuromediator substance P by an axon reflex, which causes the
surrounding skin to flush.
[0439] A small drop of about 30 .mu.l of serial dilutions of the
allergen is placed on the volar surface of the forearm. The test
sites must be at least 2 cm apart to avoid false-positive
reactions. Using a so called prick needle, i.e. a needle that can
be perpendicularly inserted into the skin, the allergen solution is
"pricked" into the dermis, giving highly reproducible results. For
a negative control, the diluent of the allergen solution is used.
Histamine is used as a positive control to detect suppression of
cutaneous reactivity by medications (mainly antihistaminic drugs).
A histamine solution at 1 mg/ml induces a weal ranging from 2-7 mm
in diameter.
[0440] Areas of weal and flare reactions will be recorded after 15
min. To obtain a permanent record, the size of the wheal as well as
the flare is outlined on the skin with a pen, then blotted onto a
cellophane tape and stored on paper. Both the area of the wheal and
the flare will be assessed by planimetry. Therefore the reactions
are scanned by a computer and the surface areas are measured using
commercial software. A weal size of 7 mm2 or greater is regarded as
positive.
[0441] Knowing that inter-individual variation in the skin response
to histamine is considerable, the reaction will then be scored as a
percentage of the positive control. The evaluation of the end-point
titrations will be based on parallel line bioassay and on median
slope.
Flowchart for Skin Prick Test (SPT)
Step 1: Preparation
[0442] Ask Patient about recently taken medication
(corticosteroids, anti-allergic therapy, neuroleptical and
antidepressant therapy) and exclude contraindications for SPT;
[0443] Check test solutions (expiry date, control temperature, body
temperature required); [0444] Clean test site (volar side of arm)
with alcohol. Use a pen to mark those areas of the arm where
allergens are to be pricked. These prick sites should be at least 2
cm apart.; [0445] The concentrations to be used for dust mites will
be 1:1000, 1:100, 1:10 and 1:1; Step 2: Test [0446] A drop of the
allergen solution is placed onto each of the marked areas of the
skin. A sterile prick lancet with 1 mm point is used to prick the
drop into the skin. This should not cause any bleeding. The lanced
is wiped with an alcohol swab between pricks, in order to prevent
carry-over of allergens; [0447] The house dust mite allergen tests
will be performed with allergen concentrations of 1:1000, 1:100,
1:10 and 1:1; [0448] A positive (histamine) and negative control
(diluent) must be included; [0449] After 1 minute the solutions
must be blotted, not wiped, off the test site; [0450] Wait for 30
minutes; Step 3: Result [0451] Wipe test site with alcohol, then
with wound benzine, draw a line around the erythema and edema with
a marker pen; [0452] Stick clear scotch tape over test site, then
rip it off and stick it onto a paper sheet; [0453] Determine the
diameter and/or the area of the erythema and edema. Record the
measurements in the source document and transcribe onto the case
report form; [0454] Itching test sites can be treated topically
with anti-histamine gel;
[0455] The allergic reaction is always assessed with respect to the
control reaction (diluent only). Typically, subjects are considered
allergic if they exhibit at least one edema or erythema of at least
6 mm diameter or at least one edema or erythema with an area of at
least 7 mm2.
Example 31
[0456] Conjunctival Provocation Test
[0457] The response of a subject to an allergen can be assessed
using the so called conjunctival provocation test which is
performed according to the following procedure. The test is useful
to test the reaction of a patient to a wide range of allergens,
including pollen allergen. The test is useful to test the reaction
towards dust mite allergens (Der p and Der f).
Flowchart for the Conjunctival Provocation Test (CPT):
Step 1: Preparation
[0458] Let patient adapt to room climate for 10 min; [0459] Check
test solutions (expiry date, control temperature, body temperature
required); [0460] Confirm that the eye is without irritation at the
beginning of the provocation; [0461] Exclude contraindications for
CPT (any eye disease except for anomalies of refraction or allergic
conjunctivitis, contact lenses, anti-allergic therapy); Step 2:
Control [0462] Administer 50 .mu.l of control solution identical to
the allergen solution except for allergen content in the lower
conjunctival sac of left eye (control eye); Step 3: Provocation
with allergen concentration 1 [0463] Immediately after application
of control solution, administer 50 .mu.l of allergen solution
concentration 1 in the lower conjunctival sac of the right/opposite
eye (provocation eye); [0464] Inform the patient not to rub his/her
eye; [0465] Wait for 10 min, then fill out the two symptom scores
for CPT; Step 4: Response to provocation with allergen [0466] If
positive, administer topical antihistamine and stop CPT; [0467] If
negative, repeat provocation with the next higher allergen
concentration in provocation eye until concentration 4 (see step
5); [0468] If negative after provocation with concentration 4,
categorize as negative and stop; Step 5: Provocation with next
higher allergen concentration [0469] administer 50 .mu.l of
allergen solution with next higher concentration/number in the
lower conjunctival sac of the opposite eye (provocation eye);
[0470] Inform the patient not to rub his/her eye; [0471] Wait for
10 min, then fill out the two symptom scores for CPT (see step 4);
Categorization of the Response to Allergen in the CPT (Stage
Criteria) 0: no subjective or visible reaction; I: itching,
reddening, foreign body sensation; II: stage I and in addition
tearing, vasodilatation of conjunctiva bulbi; III: stage II and in
addition vasodilation and erythema of conjunctiva tarsi,
blepharospasm; IV: stage III and in addition chemosis, lid
swelling;
[0472] The stages are determined for the following solutions
(dilution factor of the standard allergen solution): Negative
Solution; Concentration I: 1:1000, Concentration II: 1:100;
Concentration III: 1:10; and Concentration IV: 1; The CPT is
positive if the response is stage II or higher.
[0473] Symptoms are scored using the Score Sheet for CPT (Table 26)
which provides for scores from 0 to 3 for 5 different parameters.
Thus, the maximum score is 15 per challenge. The CPT is positive if
the total response is >10. TABLE-US-00032 TABLE 26 CPT Score
Sheet - Challenge Symptom Questionnaire. Symptom None Mild (1)
Moderate (2) Severe (3) 10' Score Conjunctival none Slight Definite
severe hyperemia redness redness redness Tearing none Slight
Definite need to sensation sensation whipe off Itching none Slight
Definite need to rub sensation sensation eyes Burning none Slight
Definite severe sensation sensation sensation Swelling of none
Slight Definite unable to eyelids sensation sensation open eyes
Example 32
[0474] Nasal Provocation Test
[0475] Nasal provocation test is useful to test the reaction of a
patient to a wide range of allergens, especially pollen allergens.
The nose provides an ideal site for allergen provocation. Allergen
can be applied to the mucosa with a high degree of accuracy. The
challenge procedure should reflect natural exposure. Quantitative
measurements with high reproducibility are important (Andersson M,
L. Greiff, C. Svensson and C. Persson. Acta Otolaryngol. 115
(1995), pp. 705-713). Recently, Bousquet (Bousquet J, P. van
Cauwenberge and N. Khaltaev. Aria Workshop Group; WHO, J. Allergy
Clin. Immunol. 108 (2001), pp. S147-334.) and the ARIA Workshop
Group have presented a document on allergic rhinitis and its impact
on asthma (Bousquet et al., 2001), presenting guidelines from a
subcommittee of the "International Committee on Objective
Assessment of the Nasal Airways" for nasal provocation tests
concerning indications, techniques, and evaluation of the tests
(Malm L, R. Gerth van Wijk and C. Bachert. Rhinology 38 (2000), pp.
1-6.). Also, the German Society for Allergology and Clinical
Immunology worked out a position paper together with the Working
Group for Clinical Immunology, Allergology and Environemental
Medicine of the German Society for Ear, Nose and Throat
(Reichelmann et al. Position statement. Allergo J (2002)
11:29-36.).
[0476] Deposition of the allergen and allergen dosing: The
solutions of allergen will be delivered from a meter-dose pump
spray, as the nasal pump spray delivers the solution over a large
area of the nasal mucosa. The allergen solution will be an
isotonic, buffered aqueous solution with a neutral pH. Serial 1:3
dilutions with saline will be freshly prepared prior to testing.
The exact allergen concentrations are to be determined in a
previous study. The allergen solution will be applied at a volume
of 100 .mu.l.
[0477] Contraindications for NPT: Episode of rhinitis in last 4
weeks; Exacerbation of allergic disease; Use of allergen known to
have caused anaphylactic reaction; Pregnancy; Nasal surgery in last
8 weeks; Coexisting severe general disease, especially
cardiopulmonary diseases; Treatment with medications that may
interfere with the treatment of systemic allergic reactions (e.g.
.beta.-blockers or ACE inhibitors); Vaccinations within one week
prior to testing.
[0478] Withdrawal period for medications known to interfere with
nasal provocation testing: Antihistamines, systemic: 48 hours to 1
week depending on their half life; Antihistmines, nasal: 1 week;
Ketotifen: 2 weeks; DNCG, Nedocromil: 3 days; Corticosteroids,
nasal: 1 week; Corticosteroids, systemic 1 week; Topical
.beta.-adrenergic agonists: 1 day; Nonsteroidal antiinflammatory
drugs (NSAIDs): 1 week; Antihypertensives (e.g. reserpine,
clonidine): 3 weeks; Antidepressants (e.g., imipramines,
tricyclics): 3 days.
[0479] Technique and Practical Protocol of Nasal Provocation
Testing
[0480] Rhinoscopic examination including anterior or posterior
rhinoscopy, preferably anterior rhinoscopy, will be performed
preceding NPT in order to evaluate the baseline condition. Patients
should be well adapted to room temperature for at least 15 minutes
before a baseline evaluation by rhinoscopy and a clinical symptom
score, as well as rhinomanometry. The wider side of the nose is
used for the challenge. Before administration of the actual
allergen solution, the nasal mucosa of the wider side of the nose
is challenged for unspecific hyperresponsiveness by 100 .mu.l of
the allergens diluent. Evaluation of the scores and rhinomanometry
is repeated after 10 minutes to check on clinical symptoms or
significant changes in objective measurements of nasal patency. If
no significant changes occur, the actual allergen provocation is
performed on the wider side of the nose. The applicator of the
delivery device is inserted into the nasal vestibulum and pointed
upward and laterally towards the medial canthus of the eye to
deposit allergen on the inferior and the middle turbinate mucosa
when spraying 100 .mu.L of allergen test solution into the nose.
During allergen application, the patient must hold his or her
breath to avoid inhaling the allergen into the lower airways.
Patients are told to inhale before and to exhale right after the
application.
[0481] Measurements of Response
[0482] Nasal symptom recording will be performed in parallel
according to three common methods (Bachert C: Nasal provocation
test: critical evaluation. In Ring J, Behrendt H D, editors: New
trends in allergy, IV, Berlin, 1997, Vieluf Springer-Verlag, p
277).
[0483] Score 1: Severity of each nasal symptom is recorded on a
10-cm linear visual analog scale. The severity is then evaluated
based on the score (mild 1-3 cm; moderate 4-7 cm; severe 8-10 cm)
obtained with diluent (negative control) and each provocation
dose.
[0484] Score 2: A practical scoring system for a standardized
quantification of these clinical parameters, which has been
proposed by the ENT section of the German Society for Allergology
and Clinical Immunology is summarized in Table 27 (Reichelmann et
al. Position statement. Allergo J (2002) 11:29-36.). TABLE-US-00033
TABLE 27 Scoring system for evaluation of clinical symptoms after
nasal provocation ("Score 2"). Symptom Severity Score (points)
Secretion No secretion 0 Little secretion 1 Heavy secretion 2
Irritation 0-2 sneezes 0 3-6 sneezes 1 >5 sneezes 2 Extranasal
None 0 symptoms Tearing/itching 1 Conjunctivitis/chemosis +- 2
Urticaria +- Coughing/dyspnoea
[0485] Score 3: This score is often used in both clinical and
scientific research studies (Linder, 1988). The end point is
considered the amount of stimulant that produces a total symptom
score of 5 from a maximum score of 13 points (Table 28).
TABLE-US-00034 TABLE 28 Scoring system for evaluation of clinical
symptoms after nasal provocation ("Score 3"). Nasal symptom Point
score Sneezing 0 to 2 sneezes 0 3 or 4 sneezes 1 5 or more sneezes
3 Pruritus Nose 1 Palate 1 Ear 1 Rhinorrhea 0 to 3 Nasal Blockage 0
to 3 Ocular Symptoms 1 Rhinorrhea: 0 = mild, 1 = moderate, 3 =
severe; sneezing: 0 = .ltoreq.2 sneezes; 1 point = 3-5 sneezes; 2
points = >5 sneezes). Other symptoms include itching or tearing
(1 point) and conjunctivitis, cough, urticaria, or dyspnea (2
points).
[0486] Rhinorrhea: 0=mild, 1=moderate, 3=severe; sneezing: 0=0-2
sneezes; 1 point=3-5 sneezes; 2 points=>5 sneezes). Other
symptoms include itching or tearing (1 point) and conjunctivitis,
cough, urticaria, or dyspnea (2 points).
[0487] End Point: After the allergen challenge the end point is
reached when the patient has more than 3 points in score 2, or if
the reduction in nasal flow rate is >40% at 150 Pa. The end
point shall also be reached, if the reduction in nasal flow rate is
>20% at 150 Pa in conjunction with >2 points in score 2.
[0488] Objective measurement of nasal patency: Nasal air-space
volume and patency will be assessed by anterior rhinomanometry. It
is designed to analyze the transnasal airflow in one nostril at a
time depending on transnasal pressure, which is assessed
contralaterally during tidal breathing. For complete and state of
the art evaluation of nasal patency, this method is combined with
acoustic rhinometry, which documents nasal geometry as
cross-sectional area within the nasal cavity.
[0489] Results of both methods, anterior rhinomanometry and
acoustic rhinometry, are visualized graphically to facilitate
analysis and documentation. Measurements before and after NPT can
be easily compared and accurately assessed using these graphs in
combination with the exact numbers for nasal airflow (cm3/s) and
cross-sectional area (cm2), which are computed by the respective
analyzers.
Example 33
[0490] Treatment of a Test Person Suffering from Pollen Allergy and
Atopic Eczema with Q.beta.G10 and Assessment of Efficacy Using a
Nasal Provocation Test
[0491] An individual suffering from pollen allergy and atopic
eczema was treated four times by subcutaneous injection of 300
.mu.g Q.beta.G10 in 1 week intervals. A skin prick test according
to Example 30 and nasal provocation test according to Example 32
were performed on the day before the first treated to determine a
baseline. The nasal provocation test was performed with a
commercial challenging agent containing pollen allergen in
dilutions of 1:1000, 1:100, 1:10 and 1:1 and repeated 1 week after
the second treatment (directly before the third treatment) and 1
week after the fourth treatment. The reaction of the test person
was scored using score 2 and score 3 as described in Example 32.
Additionally, the number of sneezes was recorded (Table 31). As
shown in Tables 29-31 all three parameters indicate a significant
reduction of the test person's reaction to allergen challenge.
Additionally, the test person who is typically suffering from
atopic eczema, with symptoms developing in early winter, reported
to be totally free of symptoms of atopic eczema after the study,
which was performed in late autumn. The latter observation is an
indication for a prophylactic effect of the treatment with respect
to atopic eczema. TABLE-US-00035 TABLE 29 Scoring result after
nasal provocation test (Score 2). 1:1000 1:100 1:10 1:1 baseline 1
2 6 4 1 week after 2nd treatment 0 0 1 6 1 week after 3rd treatment
0 0 0 1
[0492] TABLE-US-00036 TABLE 30 Scoring result after nasal
provocation test (Score 3). 1:1000 1:100 1:10 1:1 baseline 2 7 9 9
1 week after 2nd treatment 0 1 4 9 1 week after 3rd treatment 0 0 0
2
[0493] TABLE-US-00037 TABLE 31 Number of sneezes after nasal
provocation test. 1:1000 1:100 1:10 1:1 baseline 1 2 6 1 1 week
after 2nd treatment 0 0 1 7 1 week after 3rd treatment 0 0 0 0
Example 34
[0494] Treatment of Test Persons Suffering from Pollen Allergy with
Q.beta.G10 and Q.beta.G8-8 and Assessment of Efficacy Using a Nasal
Provocation Test
[0495] 34.1 Treatment with Q.beta.G10 Q.beta.G8-8: After
determination of a base line with skin prick and nasal provocation
test (see Examples 30 and 32) three groups of test persons
suffering from pollen allergy are formed, wherein all groups show a
similar test score in average. The first group is treated at least
three times in intervals of 1 week with 300 .mu.g Q.beta.G10
(Q.beta. VLP packaged with G10 (SEQ ID NO:27)). The second group is
treated in parallel with 300 .mu.g Q.beta. packaged with G8-8 (SEQ
ID NO 25). The third group is treated with placebo. Dependent on
the average symptom score of the test group during the study the
treatment of the test group can be repeated up to a total of 6 to
10 vaccinations with 300 .mu.g of Q.beta.G10 or Q.beta.G8-8,
respectively; the control group is always treated with placebo in
parallel.
[0496] 34.2 Assessment of Efficacy: Nasal provocation test is
performed before each treatment and in intervals up to 3 months
after the last treatment. The changes in the symptom scores of the
test group at the beginning and at the end of the study are
compared to that of the control group.
Example 35
[0497] Treatment of Test Persons Suffering from House Dust Allergy
with Q.beta.G10 and Q.beta.G8-8 and Assessment of Efficacy Using
the Conjunctival Provocation Test
[0498] 35.1 Treatment with Q.beta.G10 Q.beta.G8-8: After
determination of a base line with skin prick and conjunctival
provocation test (see Examples 30 and 31) three groups of test
persons suffering from house dust allergy are formed, wherein all
groups show a similar test score in average. The first group is
treated at least three times in intervals of 1 week with 300 .mu.g
Q.beta.G10 (Q.beta. VLP packaged with G10 (SEQ ID NO:27)). The
second group is treated in parallel with 300 .mu.g Q.beta.packaged
with G8-8 (SEQ ID NO 25). The third group is treated with placebo.
Dependent on the average symptom score of the test group during the
study the treatment of the test group can be repeated up to a total
of 6 to 10 vaccinations with 300 .mu.g of Q.beta.G10 or
Q.beta.G8-8, respectively; the control group is always treated with
placebo in parallel.
[0499] 35.2 Assessment of Efficacy: Conjunctival provocation test
is performed before each treatment and in intervals up to 3 months
after the last treatment. The changes in the symptom scores of the
test group at the beginning and at the end of the study are
compared to that of the control group.
Example 36
[0500] Treatment of Test Persons Suffering from House Dust Allergy
with HBc and HBcG8-8 and Assessment of Efficacy Using the
Conjunctival Provocation Test
[0501] 36.1 Treatment with HBcG10 HBcG8-8: After determination of a
base line with skin prick and conjunctival provocation test (see
Examples 30 and 31) three groups of test persons suffering from
house dust allergy are formed, wherein all groups show a similar
test score in average. The first group is treated at least three
times in intervals of 1 week with 300 .mu.g HBcG10 (HBc VLP
packaged with G10 (SEQ ID NO:27)). The second group is treated in
parallel with 300 .mu.g HBc packaged with G8-8 (SEQ ID NO 25). The
third group is treated with placebo. Dependent on the average
symptom score of the test group during the study the treatment of
the test group can be repeated up to a total of 6 to 10
vaccinations with 300 .mu.g of HBcG10 or HBcG8-8, respectively; the
control group is always treated with placebo in parallel.
[0502] 36.2 Assessment of Efficacy: Conjunctival provocation test
is performed before each treatment and in intervals up to 3 months
after the last treatment. The changes in the symptom scores of the
test group at the beginning and at the end of the study are
compared to that of the control group.
Example 37
[0503] Treatment of Test Persons Suffering from Pollen Allergy with
Q.beta.G10 and Assessment of Efficacy Using a Nasal Provocation
Test, Skin Prick Test, and Patient Diary
[0504] Treatment with Q.beta.G10: An open-label clinical trial was
performed with patients with allergy to grass pollen. Patients were
treated with 300 .mu.g Q.beta.G10 (Q.beta. VLP filled with G10 (SEQ
ID NO:27)) six times in intervals of 1 week.
[0505] Assessment of Efficacy: Nasal provocation test with a
standardized grass pollen extract (see Example 32) was performed
prior to the first treatment and 2 weeks after the last treatment.
Nasal provocation testing is also performed at months 6 and 12
following the first treatment. The changes in the symptom scores
from before the treatment are assessed at the various assessment
points after the treatment. Efficacy is also measured with the skin
prick test (see Example 30) using solutions containing various
amounts of grass pollen allergens. Efficacy of the treatment in
daily life is measured using a validated patient diary to record
symptoms and medication use during the first pollen season
following the treatment. The validated patient diary is also used
to record symptoms and medication use during the second pollen
season following the treatment.
[0506] Results of the nasal provocation test: 5 patients with grass
pollen allergy treated with 6 weekly injections of 300 .mu.g
Q.beta.G10 were subjected to nasal provocation (Example 32) before
treatment and 2 weeks after the treatment. As shown in Table 32
these patients showed reduced symptom score as compared to their
reaction before the treatment. TABLE-US-00038 TABLE 32 Symptoms due
to nasal provocation were assessed using score system 2 (Example
32). Before Treatment After Treatment Allergen solution (dilution)
Allergen solution (dilution) Patient Control 1/1000 1/100 1/10 1/1
Control 1/1000 1/100 1/10 1/1 A 0 0 0 0 4 0 0 0 0 1 B 0 0 3 2 5 0 0
0 0 1 C 0 0 1 0 4 0 0 0 0 2 D 0 0 1 2 3 0 0 0 0 1 E 0 nd nd nd 5 0
0 0 2 5 F 1 1 1 1 4 0 0 0 0 1 G 0 1 1 2 4 0 0 1 1 4 H 0 0 1 1 3 0 0
0 0 1 I 0 0 0 0 3 0 0 0 0 1 J 1 1 2 5 nd 0 0 0 0 2 nd = not
determined
Example 38
[0507] Treatment of Test Persons Suffering from Pollen Allergy with
Q.beta.G10 and Assessment of Efficacy Using a Conjunctival
Provocation Test, Skin Prick Test, and Patient Diary
[0508] Treatment with Q.beta.G10: A double-blind parallel-group
clinical trial is performed with 30 patients with allergy to grass
pollen. Patients are allocated randomly to three groups of 10
patients each. The first group is treated with 300 .mu.g Q.beta.G10
(Q.beta. VLP packaged with G10 (SEQ ID NO:27)) six times in
intervals of 1 week. The second group is treated with 300 .mu.g
Q.beta.G10 in combination with the adjuvant aluminum hydroxide six
times in intervals of 1 week. The third group is treated with
placebo.
[0509] Assessment of Efficacy: Conjunctival provocation test with a
standardized grass pollen extract (see Example 31) is performed
prior to the first treatment, 2 weeks after the last treatment, and
6 and 12 months after the first treatment. The changes in the
symptom scores from before the treatment are compared between the
groups at the various assessment points after the treatment.
Efficacy is also measured with the skin prick test (see Example 30)
using solutions containing various amounts of grass pollen
allergens. Efficacy of the treatment in daily life is measured
using a validated patient diary to record symptoms and medication
use during the first pollen season following the treatment. The
validated patient diary is also used to record symptoms and
medication use during the second pollen season following the
treatment.
Example 39
[0510] Treatment of Test Persons Suffering from House Dust Mite
Allergy with Q.beta.G10 and Assessment of Efficacy Using
Conjunctival Provocation Test, Skin Prick Test, and Patient
Diary
[0511] Treatment with Q.beta.G10: A double-blind parallel-group
clinical trial is performed with 20 patients with allergy to house
dust mites. Patients are allocated randomly to two groups of 10
patients each. The first group is treated with 300 .mu.g Q.beta.G10
(Q.beta. VLP packaged with G10 (SEQ ID NO:27)) in combination with
the adjuvant aluminum hydroxide six times in intervals of 1 week.
The second group is treated with placebo.
[0512] Assessment of Efficacy: Conjunctival provocation test with a
standardized house dust mite extract (see Example 31) is performed
prior to the first treatment, 2 weeks after the last treatment, and
6 and 12 months after the first treatment. The changes in the
symptom scores from before the treatment are compared between the
groups at the various assessment points after the treatment.
Efficacy is also measured with the skin prick test (see Example 30)
using solutions containing various amounts of house dust mite
allergens. Efficacy of the treatment in daily life is measured
using a validated patient diary to record symptoms and medication
use during 14 consecutive days prior to treatment, two weeks after
treatment, and 6 and 12 months after the first treatment.
Sequence CWU 1
1
80 1 185 PRT Hepatitis B virus 1 Met Asp Ile Asp Pro Tyr Lys Glu
Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp
Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala
Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro
His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60
Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Glu Asp Pro Ala 65
70 75 80 Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly
Leu Lys 85 90 95 Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu
Thr Phe Gly Arg 100 105 110 Glu Thr Val Leu Glu Tyr Leu Val Ser Phe
Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn
Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg
Arg Arg Asp Arg Gly Arg Ser Pro Arg Arg 145 150 155 160 Arg Thr Pro
Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg 165 170 175 Arg
Ser Gln Ser Arg Glu Ser Gln Cys 180 185 2 188 PRT Hepatitis B virus
2 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1
5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu
Asp 20 25 30 Thr Ala Ala Ala Leu Tyr Arg Asp Ala Leu Glu Ser Pro
Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile
Leu Cys Trp Gly Asp 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly
Thr Asn Leu Glu Asp Gly Gly 65 70 75 80 Lys Gly Gly Ser Arg Asp Leu
Val Val Ser Tyr Val Asn Thr Asn Val 85 90 95 Gly Leu Lys Phe Arg
Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr 100 105 110 Phe Gly Arg
Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp 115 120 125 Ile
Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser 130 135
140 Thr Leu Pro Glu Thr Thr Val Val Arg Arg Arg Asp Arg Gly Arg Ser
145 150 155 160 Pro Arg Arg Arg Thr Pro Ser Pro Arg Arg Arg Arg Ser
Gln Ser Pro 165 170 175 Arg Arg Arg Arg Ser Gln Ser Arg Glu Ser Gln
Cys 180 185 3 132 PRT Bacteriophage Qbeta 3 Ala Lys Leu Glu Thr Val
Thr Leu Gly Asn Ile Gly Lys Asp Gly Lys 1 5 10 15 Gln Thr Leu Val
Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly Val 20 25 30 Ala Ser
Leu Ser Gln Ala Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45
Thr Val Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys Val 50
55 60 Gln Val Lys Ile Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser
Cys 65 70 75 80 Asp Pro Ser Val Thr Arg Gln Ala Tyr Ala Asp Val Thr
Phe Ser Phe 85 90 95 Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe
Val Arg Thr Glu Leu 100 105 110 Ala Ala Leu Leu Ala Ser Pro Leu Leu
Ile Asp Ala Ile Asp Gln Leu 115 120 125 Asn Pro Ala Tyr 130 4 329
PRT Bacteriophage Qbeta 4 Met Ala Lys Leu Glu Thr Val Thr Leu Gly
Asn Ile Gly Lys Asp Gly 1 5 10 15 Lys Gln Thr Leu Val Leu Asn Pro
Arg Gly Val Asn Pro Thr Asn Gly 20 25 30 Val Ala Ser Leu Ser Gln
Ala Gly Ala Val Pro Ala Leu Glu Lys Arg 35 40 45 Val Thr Val Ser
Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys 50 55 60 Val Gln
Val Lys Ile Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser 65 70 75 80
Cys Asp Pro Ser Val Thr Arg Gln Ala Tyr Ala Asp Val Thr Phe Ser 85
90 95 Phe Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg Thr
Glu 100 105 110 Leu Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp Ala
Ile Asp Gln 115 120 125 Leu Asn Pro Ala Tyr Trp Thr Leu Leu Ile Ala
Gly Gly Gly Ser Gly 130 135 140 Ser Lys Pro Asp Pro Val Ile Pro Asp
Pro Pro Ile Asp Pro Pro Pro 145 150 155 160 Gly Thr Gly Lys Tyr Thr
Cys Pro Phe Ala Ile Trp Ser Leu Glu Glu 165 170 175 Val Tyr Glu Pro
Pro Thr Lys Asn Arg Pro Trp Pro Ile Tyr Asn Ala 180 185 190 Val Glu
Leu Gln Pro Arg Glu Phe Asp Val Ala Leu Lys Asp Leu Leu 195 200 205
Gly Asn Thr Lys Trp Arg Asp Trp Asp Ser Arg Leu Ser Tyr Thr Thr 210
215 220 Phe Arg Gly Cys Arg Gly Asn Gly Tyr Ile Asp Leu Asp Ala Thr
Tyr 225 230 235 240 Leu Ala Thr Asp Gln Ala Met Arg Asp Gln Lys Tyr
Asp Ile Arg Glu 245 250 255 Gly Lys Lys Pro Gly Ala Phe Gly Asn Ile
Glu Arg Phe Ile Tyr Leu 260 265 270 Lys Ser Ile Asn Ala Tyr Cys Ser
Leu Ser Asp Ile Ala Ala Tyr His 275 280 285 Ala Asp Gly Val Ile Val
Gly Phe Trp Arg Asp Pro Ser Ser Gly Gly 290 295 300 Ala Ile Pro Phe
Asp Phe Thr Lys Phe Asp Lys Thr Lys Cys Pro Ile 305 310 315 320 Gln
Ala Val Ile Val Val Pro Arg Ala 325 5 129 PRT Bacteriophage R17 5
Ala Ser Asn Phe Thr Gln Phe Val Leu Val Asn Asp Gly Gly Thr Gly 1 5
10 15 Asn Val Thr Val Ala Pro Ser Asn Phe Ala Asn Gly Val Ala Glu
Trp 20 25 30 Ile Ser Ser Asn Ser Arg Ser Gln Ala Tyr Lys Val Thr
Cys Ser Val 35 40 45 Arg Gln Ser Ser Ala Gln Asn Arg Lys Tyr Thr
Ile Lys Val Glu Val 50 55 60 Pro Lys Val Ala Thr Gln Thr Val Gly
Gly Val Glu Leu Pro Val Ala 65 70 75 80 Ala Trp Arg Ser Tyr Leu Asn
Met Glu Leu Thr Ile Pro Ile Phe Ala 85 90 95 Thr Asn Ser Asp Cys
Glu Leu Ile Val Lys Ala Met Gln Gly Leu Leu 100 105 110 Lys Asp Gly
Asn Pro Ile Pro Ser Ala Ile Ala Ala Asn Ser Gly Ile 115 120 125 Tyr
6 130 PRT Bacteriophage fr 6 Met Ala Ser Asn Phe Glu Glu Phe Val
Leu Val Asp Asn Gly Gly Thr 1 5 10 15 Gly Asp Val Lys Val Ala Pro
Ser Asn Phe Ala Asn Gly Val Ala Glu 20 25 30 Trp Ile Ser Ser Asn
Ser Arg Ser Gln Ala Tyr Lys Val Thr Cys Ser 35 40 45 Val Arg Gln
Ser Ser Ala Asn Asn Arg Lys Tyr Thr Val Lys Val Glu 50 55 60 Val
Pro Lys Val Ala Thr Gln Val Gln Gly Gly Val Glu Leu Pro Val 65 70
75 80 Ala Ala Trp Arg Ser Tyr Met Asn Met Glu Leu Thr Ile Pro Val
Phe 85 90 95 Ala Thr Asn Asp Asp Cys Ala Leu Ile Val Lys Ala Leu
Gln Gly Thr 100 105 110 Phe Lys Thr Gly Asn Pro Ile Ala Thr Ala Ile
Ala Ala Asn Ser Gly 115 120 125 Ile Tyr 130 7 130 PRT Bacteriophage
GA 7 Met Ala Thr Leu Arg Ser Phe Val Leu Val Asp Asn Gly Gly Thr
Gly 1 5 10 15 Asn Val Thr Val Val Pro Val Ser Asn Ala Asn Gly Val
Ala Glu Trp 20 25 30 Leu Ser Asn Asn Ser Arg Ser Gln Ala Tyr Arg
Val Thr Ala Ser Tyr 35 40 45 Arg Ala Ser Gly Ala Asp Lys Arg Lys
Tyr Ala Ile Lys Leu Glu Val 50 55 60 Pro Lys Ile Val Thr Gln Val
Val Asn Gly Val Glu Leu Pro Gly Ser 65 70 75 80 Ala Trp Lys Ala Tyr
Ala Ser Ile Asp Leu Thr Ile Pro Ile Phe Ala 85 90 95 Ala Thr Asp
Asp Val Thr Val Ile Ser Lys Ser Leu Ala Gly Leu Phe 100 105 110 Lys
Val Gly Asn Pro Ile Ala Glu Ala Ile Ser Ser Gln Ser Gly Phe 115 120
125 Tyr Ala 130 8 132 PRT Bacteriophage SP 8 Met Ala Lys Leu Asn
Gln Val Thr Leu Ser Lys Ile Gly Lys Asn Gly 1 5 10 15 Asp Gln Thr
Leu Thr Leu Thr Pro Arg Gly Val Asn Pro Thr Asn Gly 20 25 30 Val
Ala Ser Leu Ser Glu Ala Gly Ala Val Pro Ala Leu Glu Lys Arg 35 40
45 Val Thr Val Ser Val Ala Gln Pro Ser Arg Asn Arg Lys Asn Phe Lys
50 55 60 Val Gln Ile Lys Leu Gln Asn Pro Thr Ala Cys Thr Arg Asp
Ala Cys 65 70 75 80 Asp Pro Ser Val Thr Arg Ser Ala Phe Ala Asp Val
Thr Leu Ser Phe 85 90 95 Thr Ser Tyr Ser Thr Asp Glu Glu Arg Ala
Leu Ile Arg Thr Glu Leu 100 105 110 Ala Ala Leu Leu Ala Asp Pro Leu
Ile Val Asp Ala Ile Asp Asn Leu 115 120 125 Asn Pro Ala Tyr 130 9
329 PRT Bacteriophage SP 9 Ala Lys Leu Asn Gln Val Thr Leu Ser Lys
Ile Gly Lys Asn Gly Asp 1 5 10 15 Gln Thr Leu Thr Leu Thr Pro Arg
Gly Val Asn Pro Thr Asn Gly Val 20 25 30 Ala Ser Leu Ser Glu Ala
Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45 Thr Val Ser Val
Ala Gln Pro Ser Arg Asn Arg Lys Asn Phe Lys Val 50 55 60 Gln Ile
Lys Leu Gln Asn Pro Thr Ala Cys Thr Arg Asp Ala Cys Asp 65 70 75 80
Pro Ser Val Thr Arg Ser Ala Phe Ala Asp Val Thr Leu Ser Phe Thr 85
90 95 Ser Tyr Ser Thr Asp Glu Glu Arg Ala Leu Ile Arg Thr Glu Leu
Ala 100 105 110 Ala Leu Leu Ala Asp Pro Leu Ile Val Asp Ala Ile Asp
Asn Leu Asn 115 120 125 Pro Ala Tyr Trp Ala Ala Leu Leu Val Ala Ser
Ser Gly Gly Gly Asp 130 135 140 Asn Pro Ser Asp Pro Asp Val Pro Val
Val Pro Asp Val Lys Pro Pro 145 150 155 160 Asp Gly Thr Gly Arg Tyr
Lys Cys Pro Phe Ala Cys Tyr Arg Leu Gly 165 170 175 Ser Ile Tyr Glu
Val Gly Lys Glu Gly Ser Pro Asp Ile Tyr Glu Arg 180 185 190 Gly Asp
Glu Val Ser Val Thr Phe Asp Tyr Ala Leu Glu Asp Phe Leu 195 200 205
Gly Asn Thr Asn Trp Arg Asn Trp Asp Gln Arg Leu Ser Asp Tyr Asp 210
215 220 Ile Ala Asn Arg Arg Arg Cys Arg Gly Asn Gly Tyr Ile Asp Leu
Asp 225 230 235 240 Ala Thr Ala Met Gln Ser Asp Asp Phe Val Leu Ser
Gly Arg Tyr Gly 245 250 255 Val Arg Lys Val Lys Phe Pro Gly Ala Phe
Gly Ser Ile Lys Tyr Leu 260 265 270 Leu Asn Ile Gln Gly Asp Ala Trp
Leu Asp Leu Ser Glu Val Thr Ala 275 280 285 Tyr Arg Ser Tyr Gly Met
Val Ile Gly Phe Trp Thr Asp Ser Lys Ser 290 295 300 Pro Gln Leu Pro
Thr Asp Phe Thr Gln Phe Asn Ser Ala Asn Cys Pro 305 310 315 320 Val
Gln Thr Val Ile Ile Ile Pro Ser 325 10 130 PRT Bacteriophage MS2 10
Met Ala Ser Asn Phe Thr Gln Phe Val Leu Val Asp Asn Gly Gly Thr 1 5
10 15 Gly Asp Val Thr Val Ala Pro Ser Asn Phe Ala Asn Gly Val Ala
Glu 20 25 30 Trp Ile Ser Ser Asn Ser Arg Ser Gln Ala Tyr Lys Val
Thr Cys Ser 35 40 45 Val Arg Gln Ser Ser Ala Gln Asn Arg Lys Tyr
Thr Ile Lys Val Glu 50 55 60 Val Pro Lys Val Ala Thr Gln Thr Val
Gly Gly Val Glu Leu Pro Val 65 70 75 80 Ala Ala Trp Arg Ser Tyr Leu
Asn Met Glu Leu Thr Ile Pro Ile Phe 85 90 95 Ala Thr Asn Ser Asp
Cys Glu Leu Ile Val Lys Ala Met Gln Gly Leu 100 105 110 Leu Lys Asp
Gly Asn Pro Ile Pro Ser Ala Ile Ala Ala Asn Ser Gly 115 120 125 Ile
Tyr 130 11 133 PRT Bacteriophage M11 11 Met Ala Lys Leu Gln Ala Ile
Thr Leu Ser Gly Ile Gly Lys Lys Gly 1 5 10 15 Asp Val Thr Leu Asp
Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly 20 25 30 Val Ala Ala
Leu Ser Glu Ala Gly Ala Val Pro Ala Leu Glu Lys Arg 35 40 45 Val
Thr Ile Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys 50 55
60 Val Gln Val Lys Ile Gln Asn Pro Thr Ser Cys Thr Ala Ser Gly Thr
65 70 75 80 Cys Asp Pro Ser Val Thr Arg Ser Ala Tyr Ser Asp Val Thr
Phe Ser 85 90 95 Phe Thr Gln Tyr Ser Thr Val Glu Glu Arg Ala Leu
Val Arg Thr Glu 100 105 110 Leu Gln Ala Leu Leu Ala Asp Pro Met Leu
Val Asn Ala Ile Asp Asn 115 120 125 Leu Asn Pro Ala Tyr 130 12 133
PRT Bacteriophage MX1 12 Met Ala Lys Leu Gln Ala Ile Thr Leu Ser
Gly Ile Gly Lys Asn Gly 1 5 10 15 Asp Val Thr Leu Asn Leu Asn Pro
Arg Gly Val Asn Pro Thr Asn Gly 20 25 30 Val Ala Ala Leu Ser Glu
Ala Gly Ala Val Pro Ala Leu Glu Lys Arg 35 40 45 Val Thr Ile Ser
Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys 50 55 60 Val Gln
Val Lys Ile Gln Asn Pro Thr Ser Cys Thr Ala Ser Gly Thr 65 70 75 80
Cys Asp Pro Ser Val Thr Arg Ser Ala Tyr Ala Asp Val Thr Phe Ser 85
90 95 Phe Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Leu Val Arg Thr
Glu 100 105 110 Leu Lys Ala Leu Leu Ala Asp Pro Met Leu Ile Asp Ala
Ile Asp Asn 115 120 125 Leu Asn Pro Ala Tyr 130 13 330 PRT
Bacteriophage NL95 13 Met Ala Lys Leu Asn Lys Val Thr Leu Thr Gly
Ile Gly Lys Ala Gly 1 5 10 15 Asn Gln Thr Leu Thr Leu Thr Pro Arg
Gly Val Asn Pro Thr Asn Gly 20 25 30 Val Ala Ser Leu Ser Glu Ala
Gly Ala Val Pro Ala Leu Glu Lys Arg 35 40 45 Val Thr Val Ser Val
Ala Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys 50 55 60 Val Gln Ile
Lys Leu Gln Asn Pro Thr Ala Cys Thr Lys Asp Ala Cys 65 70 75 80 Asp
Pro Ser Val Thr Arg Ser Gly Ser Arg Asp Val Thr Leu Ser Phe 85 90
95 Thr Ser Tyr Ser Thr Glu Arg Glu Arg Ala Leu Ile Arg Thr Glu Leu
100 105 110 Ala Ala Leu Leu Lys Asp Asp Leu Ile Val Asp Ala Ile Asp
Asn Leu 115 120 125 Asn Pro Ala Tyr Trp Ala Ala Leu Leu Ala Ala Ser
Pro Gly Gly Gly 130 135 140 Asn Asn Pro Tyr Pro Gly Val Pro Asp Ser
Pro Asn Val Lys Pro Pro 145 150 155 160 Gly Gly Thr Gly Thr Tyr Arg
Cys Pro Phe Ala Cys Tyr Arg Arg Gly 165 170 175 Glu Leu Ile Thr Glu
Ala Lys Asp Gly Ala Cys Ala Leu Tyr Ala Cys 180 185 190 Gly Ser Glu
Ala Leu Val Glu Phe Glu Tyr Ala Leu Glu Asp Phe Leu 195 200 205 Gly
Asn Glu Phe Trp Arg Asn Trp Asp Gly Arg Leu Ser Lys Tyr Asp 210 215
220 Ile Glu Thr His Arg Arg Cys Arg Gly Asn Gly Tyr Val Asp Leu Asp
225 230 235 240 Ala Ser Val Met Gln Ser Asp Glu Tyr Val Leu Ser Gly
Ala Tyr Asp 245 250 255 Val Val Lys Met Gln Pro Pro Gly Thr Phe Asp
Ser Pro Arg Tyr Tyr 260 265 270 Leu His Leu Met Asp Gly Ile Tyr Val
Asp Leu Ala Glu Val Thr Ala 275 280 285 Tyr Arg Ser Tyr Gly Met Val
Ile Gly Phe Trp Thr Asp Ser Lys Ser 290 295 300 Pro Gln Leu Pro Thr
Asp Phe Thr Arg Phe Asn Arg His Asn Cys Pro 305 310 315
320 Val Gln Thr Val Ile Val Ile Pro Ser Leu 325 330 14 129 PRT
Bacteriophage f2 14 Ala Ser Asn Phe Thr Gln Phe Val Leu Val Asn Asp
Gly Gly Thr Gly 1 5 10 15 Asn Val Thr Val Ala Pro Ser Asn Phe Ala
Asn Gly Val Ala Glu Trp 20 25 30 Ile Ser Ser Asn Ser Arg Ser Gln
Ala Tyr Lys Val Thr Cys Ser Val 35 40 45 Arg Gln Ser Ser Ala Gln
Asn Arg Lys Tyr Thr Ile Lys Val Glu Val 50 55 60 Pro Lys Val Ala
Thr Gln Thr Val Gly Gly Val Glu Leu Pro Val Ala 65 70 75 80 Ala Trp
Arg Ser Tyr Leu Asn Leu Glu Leu Thr Ile Pro Ile Phe Ala 85 90 95
Thr Asn Ser Asp Cys Glu Leu Ile Val Lys Ala Met Gln Gly Leu Leu 100
105 110 Lys Asp Gly Asn Pro Ile Pro Ser Ala Ile Ala Ala Asn Ser Gly
Ile 115 120 125 Tyr 15 128 PRT Bacteriophage PP7 15 Met Ser Lys Thr
Ile Val Leu Ser Val Gly Glu Ala Thr Arg Thr Leu 1 5 10 15 Thr Glu
Ile Gln Ser Thr Ala Asp Arg Gln Ile Phe Glu Glu Lys Val 20 25 30
Gly Pro Leu Val Gly Arg Leu Arg Leu Thr Ala Ser Leu Arg Gln Asn 35
40 45 Gly Ala Lys Thr Ala Tyr Arg Val Asn Leu Lys Leu Asp Gln Ala
Asp 50 55 60 Val Val Asp Cys Ser Thr Ser Val Cys Gly Glu Leu Pro
Lys Val Arg 65 70 75 80 Tyr Thr Gln Val Trp Ser His Asp Val Thr Ile
Val Ala Asn Ser Thr 85 90 95 Glu Ala Ser Arg Lys Ser Leu Tyr Asp
Leu Thr Lys Ser Leu Val Ala 100 105 110 Thr Ser Gln Val Glu Asp Leu
Val Val Asn Leu Val Pro Leu Gly Arg 115 120 125 16 132 PRT
Bacteriophage Qbeta 16 Ala Lys Leu Glu Thr Val Thr Leu Gly Asn Ile
Gly Arg Asp Gly Lys 1 5 10 15 Gln Thr Leu Val Leu Asn Pro Arg Gly
Val Asn Pro Thr Asn Gly Val 20 25 30 Ala Ser Leu Ser Gln Ala Gly
Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45 Thr Val Ser Val Ser
Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys Val 50 55 60 Gln Val Lys
Ile Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser Cys 65 70 75 80 Asp
Pro Ser Val Thr Arg Gln Lys Tyr Ala Asp Val Thr Phe Ser Phe 85 90
95 Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg Thr Glu Leu
100 105 110 Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp Ala Ile Asp
Gln Leu 115 120 125 Asn Pro Ala Tyr 130 17 132 PRT Bacteriophage
Qbeta 17 Ala Lys Leu Glu Thr Val Thr Leu Gly Lys Ile Gly Lys Asp
Gly Lys 1 5 10 15 Gln Thr Leu Val Leu Asn Pro Arg Gly Val Asn Pro
Thr Asn Gly Val 20 25 30 Ala Ser Leu Ser Gln Ala Gly Ala Val Pro
Ala Leu Glu Lys Arg Val 35 40 45 Thr Val Ser Val Ser Gln Pro Ser
Arg Asn Arg Lys Asn Tyr Lys Val 50 55 60 Gln Val Lys Ile Gln Asn
Pro Thr Ala Cys Thr Ala Asn Gly Ser Cys 65 70 75 80 Asp Pro Ser Val
Thr Arg Gln Lys Tyr Ala Asp Val Thr Phe Ser Phe 85 90 95 Thr Gln
Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg Thr Glu Leu 100 105 110
Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp Ala Ile Asp Gln Leu 115
120 125 Asn Pro Ala Tyr 130 18 132 PRT Bacteriophage Qbeta 18 Ala
Arg Leu Glu Thr Val Thr Leu Gly Asn Ile Gly Arg Asp Gly Lys 1 5 10
15 Gln Thr Leu Val Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly Val
20 25 30 Ala Ser Leu Ser Gln Ala Gly Ala Val Pro Ala Leu Glu Lys
Arg Val 35 40 45 Thr Val Ser Val Ser Gln Pro Ser Arg Asn Arg Lys
Asn Tyr Lys Val 50 55 60 Gln Val Lys Ile Gln Asn Pro Thr Ala Cys
Thr Ala Asn Gly Ser Cys 65 70 75 80 Asp Pro Ser Val Thr Arg Gln Lys
Tyr Ala Asp Val Thr Phe Ser Phe 85 90 95 Thr Gln Tyr Ser Thr Asp
Glu Glu Arg Ala Phe Val Arg Thr Glu Leu 100 105 110 Ala Ala Leu Leu
Ala Ser Pro Leu Leu Ile Asp Ala Ile Asp Gln Leu 115 120 125 Asn Pro
Ala Tyr 130 19 132 PRT Bacteriophage Qbeta 19 Ala Lys Leu Glu Thr
Val Thr Leu Gly Asn Ile Gly Lys Asp Gly Arg 1 5 10 15 Gln Thr Leu
Val Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly Val 20 25 30 Ala
Ser Leu Ser Gln Ala Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40
45 Thr Val Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys Val
50 55 60 Gln Val Lys Ile Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly
Ser Cys 65 70 75 80 Asp Pro Ser Val Thr Arg Gln Lys Tyr Ala Asp Val
Thr Phe Ser Phe 85 90 95 Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala
Phe Val Arg Thr Glu Leu 100 105 110 Ala Ala Leu Leu Ala Ser Pro Leu
Leu Ile Asp Ala Ile Asp Gln Leu 115 120 125 Asn Pro Ala Tyr 130 20
132 PRT Bacteriophage Qbeta 20 Ala Arg Leu Glu Thr Val Thr Leu Gly
Asn Ile Gly Lys Asp Gly Arg 1 5 10 15 Gln Thr Leu Val Leu Asn Pro
Arg Gly Val Asn Pro Thr Asn Gly Val 20 25 30 Ala Ser Leu Ser Gln
Ala Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45 Thr Val Ser
Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys Val 50 55 60 Gln
Val Lys Ile Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser Cys 65 70
75 80 Asp Pro Ser Val Thr Arg Gln Lys Tyr Ala Asp Val Thr Phe Ser
Phe 85 90 95 Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg
Thr Glu Leu 100 105 110 Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp
Ala Ile Asp Gln Leu 115 120 125 Asn Pro Ala Tyr 130 21 131 PRT
Bacteriophage AP205 21 Met Ala Asn Lys Pro Met Gln Pro Ile Thr Ser
Thr Ala Asn Lys Ile 1 5 10 15 Val Trp Ser Asp Pro Thr Arg Leu Ser
Thr Thr Phe Ser Ala Ser Leu 20 25 30 Leu Arg Gln Arg Val Lys Val
Gly Ile Ala Glu Leu Asn Asn Val Ser 35 40 45 Gly Gln Tyr Val Ser
Val Tyr Lys Arg Pro Ala Pro Lys Pro Glu Gly 50 55 60 Cys Ala Asp
Ala Cys Val Ile Met Pro Asn Glu Asn Gln Ser Ile Arg 65 70 75 80 Thr
Val Ile Ser Gly Ser Ala Glu Asn Leu Ala Thr Leu Lys Ala Glu 85 90
95 Trp Glu Thr His Lys Arg Asn Val Asp Thr Leu Phe Ala Ser Gly Asn
100 105 110 Ala Gly Leu Gly Phe Leu Asp Pro Thr Ala Ala Ile Val Ser
Ser Asp 115 120 125 Thr Thr Ala 130 22 131 PRT Bacteriophage AP205
22 Met Ala Asn Lys Thr Met Gln Pro Ile Thr Ser Thr Ala Asn Lys Ile
1 5 10 15 Val Trp Ser Asp Pro Thr Arg Leu Ser Thr Thr Phe Ser Ala
Ser Leu 20 25 30 Leu Arg Gln Arg Val Lys Val Gly Ile Ala Glu Leu
Asn Asn Val Ser 35 40 45 Gly Gln Tyr Val Ser Val Tyr Lys Arg Pro
Ala Pro Lys Pro Glu Gly 50 55 60 Cys Ala Asp Ala Cys Val Ile Met
Pro Asn Glu Asn Gln Ser Ile Arg 65 70 75 80 Thr Val Ile Ser Gly Ser
Ala Glu Asn Leu Ala Thr Leu Lys Ala Glu 85 90 95 Trp Glu Thr His
Lys Arg Asn Val Asp Thr Leu Phe Ala Ser Gly Asn 100 105 110 Ala Gly
Leu Gly Phe Leu Asp Pro Thr Ala Ala Ile Val Ser Ser Asp 115 120 125
Thr Thr Ala 130 23 131 PRT Bacteriophage AP205 23 Met Ala Asn Lys
Pro Met Gln Pro Ile Thr Ser Thr Ala Asp Lys Ile 1 5 10 15 Val Trp
Ser Asp Pro Thr Arg Leu Ser Thr Thr Phe Ser Ala Ser Leu 20 25 30
Leu Arg Gln Arg Val Lys Val Gly Ile Ala Glu Leu Asn Asn Val Ser 35
40 45 Gly Gln Tyr Val Ser Val Tyr Lys Arg Pro Ala Pro Lys Pro Glu
Gly 50 55 60 Cys Ala Asp Ala Cys Val Ile Met Pro Asn Glu Asn Gln
Ser Ile Arg 65 70 75 80 Thr Val Ile Ser Gly Ser Ala Glu Asn Leu Ala
Thr Leu Lys Ala Glu 85 90 95 Trp Glu Thr His Lys Arg Asn Val Asp
Thr Leu Phe Ala Ser Gly Asn 100 105 110 Ala Gly Leu Gly Phe Leu Asp
Pro Thr Ala Ala Ile Val Ser Ser Asp 115 120 125 Thr Thr Ala 130 24
5 PRT artificial sequence paptide 24 Gly Gly Lys Gly Gly 1 5 25 26
DNA artificial sequence CpG 25 ggggggggga cgatcgtcgg gggggg 26 26
28 DNA artificial sequence CpG 26 gggggggggg acgatcgtcg gggggggg 28
27 30 DNA artificial sequence CpC oligonucleotide 27 gggggggggg
gacgatcgtc gggggggggg 30 28 10 DNA artificial sequence CpG 28
gacgatcgtc 10 29 19 DNA artificial sequence CpG 29 ggggacgatc
gtcgggggg 19 30 20 DNA artificial sequence CpG 30 gggggacgat
cgtcgggggg 20 31 21 DNA artificial sequence CpG 31 ggggggacga
tcgtcggggg g 21 32 22 DNA artificial sequence CpG 32 gggggggacg
atcgtcgggg gg 22 33 24 DNA artificial sequence CpG 33 ggggggggac
gatcgtcggg gggg 24 34 30 DNA artificial sequence CpG 34 ggggggcgac
gacgatcgtc gtcggggggg 30 35 6 DNA artificial sequence palindrome 35
gacgtc 6 36 6 DNA artificial sequence palindrome 36 aacgtt 6 37 6
DNA artificial sequence palindrome 37 aacgtt 6 38 6 DNA artificial
sequence palindrome 38 atcgat 6 39 6 DNA artificial sequence
palindrome 39 cgatcg 6 40 6 DNA artificial sequence palindrome 40
cgtacg 6 41 6 DNA artificial sequence palindrome 41 cgcgcg 6 42 6
DNA artificial sequence palindrome 42 gcgcgc 6 43 6 DNA artificial
sequence palindrome 43 tcgcga 6 44 8 DNA artificial sequence
palindrome 44 acgatcgt 8 45 12 DNA artificial sequence palindrome
45 cgacgatcgt cg 12 46 18 DNA artificial sequence palindrome 46
cgacgacgat cgtcgtcg 18 47 18 DNA artificial sequence palindrome 47
cgacgacgat cgtcgtcg 18 48 6 DNA artificial sequence palindrome 48
aacgtt 6 49 8 DNA artificial sequence palindrome 49 caacgttg 8 50
10 DNA artificial sequence palindrome 50 acaacgttgt 10 51 12 DNA
artificial sequence palindrome 51 aacaacgttg tt 12 52 14 DNA
artificial sequence palindrome 52 caacaacgtt gttg 14 53 12 DNA
artificial sequence palindrome 53 cggcgcgcgc cg 12 54 12 DNA
artificial sequence palindrome 54 cgacggccgt cg 12 55 12 DNA
artificial sequence palindrome 55 ccggcgcgcc gg 12 56 6 DNA
artificial sequence palindrome 56 cgcgcg 6 57 12 DNA artificial
sequence palindrome 57 cggcgcgcgc cg 12 58 10 DNA artificial
sequence palindrome 58 ggcgcgcgcc 10 59 6 DNA artificial sequence
palindrome 59 cggccg 6 60 12 DNA artificial sequence palindrome 60
cggcggccgc cg 12 61 11 DNA artificial sequence C-type CpG 61
tcgtcgtttt a 11 62 13 DNA artificial sequence C-type CpG 62
cggcgccgtg ccg 13 63 13 DNA artificial sequence C-type CpG 63
cggcgtcgtg ccg 13 64 24 DNA artificial sequence C-type CpG 64
tcgtcgtttt acggcgccgt gccg 24 65 24 DNA artificial sequence C-type
CpG 65 tcgtcgtttt acggcgtcgt gccg 24 66 22 DNA artificial sequence
C-type CpG 66 tcgtcgtttt cggcgcgcgc cg 22 67 22 DNA artificial
sequence C-type CpG 67 tcgtcgtttt cgacggccgt cg 22 68 22 DNA
artificial sequence C-type CpG 68 tcgtcgtttt ccggcgcgcc gg 22 69 22
DNA artificial sequence C-type CpG 69 tcgtcgtttt cggcgcgcgt cg 22
70 22 DNA artificial sequence C-type CpG 70 tcggcgcgcg ccgtcgtcgt
tt 22 71 22 DNA artificial sequence C-type CpG 71 ttggcgcgcg
ccgtcgtcgt tt 22 72 22 DNA artificial sequence C-type CpG 72
tcgtcgtttt cgtcggccgc cg 22 73 22 DNA artificial sequence C-type
CpG 73 tcgtcgtttt cggcttttgc cg 22 74 22 DNA artificial sequence
C-type CpG 74 tcgtcgtttt cggcgttttt tt 22 75 22 DNA artificial
sequence C-type CpG 75 tcgtcgtttt cggcggccgc cg 22 76 23 DNA
artificial sequence CpG 2006-PS 76 tcgtcgtttt gtcgttttgt cgt 23 77
20 DNA artificial sequence CpG 2216 77 gggggacgat cgtcgggggg 20 78
20 DNA artificial sequence CpG D19 78 ggtgcatcga tgcagggggg 20 79
60 DNA artificial sequence CpG G102x 79 gggggggggg gacgatcgtc
gggggggggg gggggggggg gacgatcgtc gggggggggg 60 80 21 DNA artificial
sequence CpG 1668-CpG 80 tccatgacgt tcctgaataa t 21
* * * * *
References