U.S. patent application number 11/223638 was filed with the patent office on 2007-07-26 for purified active hcv ns2/3 protease.
This patent application is currently assigned to Boehringer Ingelheim (Canada) Ltd.. Invention is credited to Daniel Lamarre, Roger Maurice, Armin Pause, Louise Pilote, Diane Thibeault.
Application Number | 20070172936 11/223638 |
Document ID | / |
Family ID | 22970839 |
Filed Date | 2007-07-26 |
United States Patent
Application |
20070172936 |
Kind Code |
A1 |
Thibeault; Diane ; et
al. |
July 26, 2007 |
Purified active HCV NS2/3 protease
Abstract
A method for producing a refolded, inactive form of
recombinantly produced NS2/3 protease which comprises the steps of:
a) purifying the protease from inclusion bodies in the presence of
a chaotropic agent; and b) refolding the purified protease by
contacting it with a reducing agent and lauryldiethylamine oxide
(LDAO) in the presence of reduced concentration of chaotropic agent
or polar additive. The invention further comprises a method for
activating this refolded inactive NS2/3 protease by adding an
activation detergent. This method produces large amounts of the
active NS2/3 protease to allow small molecules and ligands to be
screened as potential inhibitors of NS2/3 protease, which may be
useful as therapeutic agents against HCV.
Inventors: |
Thibeault; Diane; (Laval,
CA) ; Lamarre; Daniel; (Laval, CA) ; Maurice;
Roger; (Laval, CA) ; Pilote; Louise; (Laval,
CA) ; Pause; Armin; (Laval, CA) |
Correspondence
Address: |
MICHAEL P. MORRIS;BOEHRINGER INGELHEIM CORPORATION
900 RIDGEBURY RD
P. O. BOX 368
RIDGEFIELD
CT
06877-0368
US
|
Assignee: |
Boehringer Ingelheim (Canada)
Ltd.
Laval
CA
|
Family ID: |
22970839 |
Appl. No.: |
11/223638 |
Filed: |
September 9, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10650585 |
Aug 28, 2003 |
|
|
|
11223638 |
Sep 9, 2005 |
|
|
|
10017736 |
Dec 14, 2001 |
6815159 |
|
|
10650585 |
Aug 28, 2003 |
|
|
|
60256031 |
Dec 15, 2000 |
|
|
|
Current U.S.
Class: |
435/184 ;
435/212; 530/328 |
Current CPC
Class: |
G01N 2500/04 20130101;
C12N 9/506 20130101; G01N 2333/18 20130101; C12Q 1/37 20130101;
C07K 14/005 20130101; G01N 33/6893 20130101; G01N 2500/00 20130101;
C12N 2770/24222 20130101 |
Class at
Publication: |
435/184 ;
435/212; 530/328 |
International
Class: |
C12N 9/99 20060101
C12N009/99; C12N 9/48 20060101 C12N009/48; C07K 7/08 20060101
C07K007/08 |
Claims
1-15. (canceled)
16. An isolated polypeptide consisting of a fragment of a native
HCV NS2/3 protease, wherein the N-terminal residue of the fragment
is at a position corresponding to a position between positions 815
to 906 in the HCV NS2/3 protease amino acid sequence set forth in
SEQ ID No:2.
17. An isolated polypeptide consisting of a fragment of a native
HCV NS2/3 protease, wherein the N-terminal residue of the fragment
is at a position corresponding to a position between positions 815
to 906 in the HCV NS2/3 protease amino acid sequence set forth in
SEQ ID No:2 and the C-terminal residue of the fragment is at a
position corresponding to position 1206 in the HCV NS2/3 protease
amino acid sequence set forth in SEQ ID No:2.
18. An isolated truncated HCV NS2/3 protease consisting of an amino
acid sequence from residues 815 to 1206 in the HCV NS2/3 protease
amino acid sequence set forth in SEQ ID No:2.
19. An isolated truncated HCV NS2/3 protease consisting of an amino
acid sequence from residues 827 to 1206 in the HCV NS2/3 protease
amino acid sequence set forth in SEQ ID No:2.
20. An isolated truncated HCV NS2/3 protease consisting of an amino
acid sequence from residues 855 to 1206 in the HCV NS2/3 protease
amino acid sequence set forth in SEQ ID No:2.
21. An isolated truncated HCV NS2/3 protease consisting of an amino
acid sequence from residues 866 to 1206 in the HCV NS2/3 protease
amino acid sequence set forth in SEQ ID No:2.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 10/017,736, filed Dec. 14, 2001, which claims, as does the
present application priority to U.S. Provisional Application Ser.
No. 60/256,031, filed on Dec. 15, 2000, the disclosures of all of
which are incorporated by reference in their entirety.
FIELD OF THE INVENTION
[0002] The invention relates generally to purification and
activation methods for Hepatitis C virus (HCV) NS2/3 protease,
particularly to a method of producing a refolded, inactive NS2/3
protease or truncations thereof which can later be activated for
auto-cleavage. More particularly, the method provides for
truncated, purified active HCV NS2/3 protease and assays for
identifying inhibitors thereof.
BACKGROUND OF THE INVENTION
[0003] Hepatitis C Virus (HCV) is an important cause of chronic
liver disease leading to cirrhosis and end-stage liver disease in
humans. Over 150 million people worldwide are persistently infected
with HCV and the number of deaths attributable to chronic infection
is likely to rise dramatically over the next 10-20 years. Currently
available therapies are of limited efficacy and are unsatisfactory.
These therapies have involved use of interferon alpha, either alone
or in combination with other antiviral agents such as ribavirin.
Given that a low response rate, in addition to high patient relapse
and side effects, are observed, new therapies are required that may
afford long-term treatment benefits.
[0004] The cloned and characterized partial and complete sequences
of the HCV genome have been analyzed to provide appropriate targets
for prospective antiviral therapy. HCV is an enveloped positive
strand RNA virus in the Flaviviridae family. The single strand HCV
RNA genome is approximately 9600 nucleotides in length and has a
single open reading frame (ORF) encoding a single large polyprotein
of about 3010 amino acids. In infected cells, this polyprotein is
cleaved at multiple sites by cellular and viral proteases to
produce the structural and non-structural (NS) proteins. In the
case of HCV, the generation of mature nonstructural proteins (NS2,
NS3, NS4A, NS4B, NS5A, and NS5B) is effected by two viral
proteases. The first one, as yet poorly characterized, cleaves at
the NS2/3 junction and is henceforth referred to as NS2/3 protease.
The second one is a serine protease contained within the N-terminal
region of NS3, henceforth referred to as NS3 protease, and mediates
all the subsequent cleavages downstream of NS3, both in cis, at the
NS3/4A cleavage site, and in trans, for the remaining NS4A/4B,
NS4B/5A, NS5A/5B sites. The NS4A protein appears to serve multiple
functions, acting as a cofactor for the NS3 protease and possibly
assisting in the membrane localization of NS3 and other viral
replicase components. The complex formation of the NS3 protein with
NS4A seems necessary to the processing events, enhancing the
proteolytic efficiency at all of the sites. The NS3 protein also
exhibits nucleoside triphosphatase and RNA helicase activities.
NS5B is a RNA-dependent RNA polymerase that is involved in the
replication of HCV.
[0005] Most of the HCV encoded enzymes have been evaluated as
targets for the development of new antiviral therapies, namely the
NS3 protease, helicase and ATPase activities, as well as the NS5B
RNA-dependent RNA polymerase activity (Dymock, B. W. et al. (2000)
Antiviral Chemistry & Chemotherapy. 11 (2):79-96 and Walker, M.
A. (1999) Drug Discovery Today 4(11): 518-529). The only viral
enzyme that has not been extensively characterized so far is the
NS2/3 protease, probably because it acts co-translationally.
[0006] NS2/3 protease is responsible for autocleavage at the NS2
and NS3 junction between amino acids Leu1026 and Ala1027
(Hirowatari, Y., et al (1993) Arch. Virol. 133:349-356 and Reed, K.
E., et al. (1995) J. Virol. 69 (7) 4127-4136). This cleavage
appears to be essential for productive replication in vivo as shown
by the absence of HCV infection in a chimpanzee following
inoculation with a clone devoid of the NS2/3 protease activity
(Kolykhalov, A. A., et al (2000) J. Virol. 74 (4) 2046-2051). It
also appears that generation of a functional NS2 and an authentic
NS3 protease N-terminal sequence are somehow linked to NS5A
phosphorylation (Liu, Q., et al. (1999) Biochem. Biophys. Res.
Commun. 254, 572-577 and Neddermann P., et al. (1999) J. Virol.
73(12):9984-9991).
[0007] The minimal region of the HCV open reading frame required
for the autocleavage activity has been reported to be located
somewhere between amino acids 898 and 907 for the N-terminal
boundary and amino acid 1206 for the C-terminal boundary (Hijikata,
M. et al (1993) J. Virol. 67 (8):4665-4675; Grakoui, A., et al.
(1993) Proc. Nat. Acad. Sci. USA 90:10583-10587; Santolini, E., et
al (1995) J. Virol. 69 (12): 7461-7471; and Liu, Q., et al (1999)
Biochem. Biophys. Res. Commun. 254, 572-577; Pallaoro et al.,
(2001) J. Virol. 75(20); 9939-46). Interestingly, the NS2/3
protease activity is independent of the NS3 protease activity
(Grakoui, A., et al. (1993) Proc. Natl. Acad. Sci. USA
90:10583-10587; Hijikata, M. et al (1993) J. Virol. 67
(8):4665-4675) but the NS3 protease domain cannot be substituted by
another non-structural protein (Santolini, E., et al (1995) J.
Virol. 69 (12): 7461-7471). Mutagenesis studies have shown that the
residues His952 and Cys993 are essential for the cis-cleavage
activity (Grakoui, A., et al. (1993) Proc. Natl. Acad. Sci. USA
90:10583-10587; Hijikata, M. et al (1993) J. Virol. 67
(8):4665-4675). Gorbalenya, A. E, et al. (1996) Perspect Drug
Discovery Design. 6:64-86)) have suggested that the NS2/3 protease
could be a cysteine protease. However, the observation that the
activity is stimulated by metal ions and inhibited by EDTA led to
the suggestion that the NS2/3 protease is a metalloprotease
(Grakoui, A., et al. (1993) Proc. Natl. Acad. Sci. USA
90:10583-10587; Hijikata, M. et al (1993) J. Virol. 67
(8):4665-4675)). Studies with classical protease inhibitors in an
in vitro transcription and translation assay (Pieroni, L. et al
(1997) J. Virol. 71 (9): 6373-6380) have not yet allowed for a
definitive classification.
[0008] Processing at the NS2/3 junction has been reported (Darke,
P. L. et al (1999) J. Biol. Chem. 274 (49) 34511-34514 and WO
01/16379; Grakoui, A., et al (1993). Proc. Natl. Acad. Sci. USA
90:10583-10587; Hijikata, M., et al. (1993) J. Virol. 67
(8):4665-4675; Pieroni, L., et al (1997) J. Virol. 71 (9):
6373-6380 and Santolini, E. et al (1995) J. Virol. 69 (12):
7461-7471) following expression of the NS2/3 region in cell-free
translation systems, in E. coli, in insect cells infected with
baculovirus recombinants and/or in mammalian cells (transient
transfection or vaccinia virus T7 hybrid system). However,
processing has not been reported in an isolated recombinant enzyme
until very recently (Pallaoro et al., (2001) J. Virol. 75(20);
9939-46; Thibeault et al., J. Biol. Chem. 276
(49):46678-46684).
[0009] Grakoui et al. (1993) Proc. Natl. Acad. Sci. USA,
90:10583-10587 and Komoda et al. (1994) Gene, 145:221-226 have both
disclosed the expression of HCV polypeptides, including the NS2/3
protease, in E. coli. Following expression, processing was assessed
from SDS-PAGE and immunoblot analyses of cell lysates. Komoda,
using HCV polyproteins fused to maltose-binding protein (MBP) at
their N-terminus and dihydrofolate reductase (DHFR) at their
C-terminus, also reported on the partial purification of the
DHFR-fused products from cell lysates by affinity chromatography
for N-terminal sequencing purpose only.
[0010] Thus, the biochemical characterization of the NS2/3 protease
as well as mechanistic and structural studies has been hampered due
to the unavailability of a pure recombinant form of the enzyme.
Before any potential inhibitors of NS2/3 protease can be identified
in a high throughput-screening format, there must be a reliable
source of purified, active NS2/3 protease.
[0011] WO 01/68818 published on 20 Sep. 2001 {as well as Pallaoro
et al., (2001) J. Virol. 75(20); 9939-46} have described a process
for the purification of recombinant active NS2/3 protease. However,
their refolding method needs to be carried out at 4.degree. C. to
avoid auto-catalysis.
[0012] The method of the present invention, also disclosed in
Thibeault et al., J. Biol. Chem. 276 (49):46678-46684, discloses a
purification method that proceeds in 2 steps, can be carried out at
room temperature and leads in the first instance to a soluble
inactive NS2/3 protease (stable at RT) that can be scaled up and
stored safely without auto-cleavage.
[0013] It is therefore an advantage of this invention to provide a
method for the purification of refolded inactive NS2/3
protease.
[0014] It is a further advantage of this invention that the soluble
inactive protease can be further activated to produce soluble
active NS2/3 protease for large scale screening efforts.
[0015] It is also a further advantage of this invention to provide
a purified recombinant active NS2/3 protease and truncations
thereof in such scale that small molecules and ligands can be
screened as potential inhibitors.
[0016] The present description refers to a number of documents, the
content of which is herein incorporated by reference.
SUMMARY OF THE INVENTION
[0017] The present invention reduces the difficulties and
disadvantages of the prior art by providing a novel method for
purifying and activating HCV NS2/3 protease. Advantageously, this
method both solubilizes the protease and refolds it under
conditions that will not promote autocleavage of the protease.
Moreover, the method has a further advantage in that a N-terminal
truncated form of NS2/3 protease is produced at high levels in
inclusion bodies using recombinant methods following its expression
in E. coli. This high level production allows for large amounts of
the protease to be isolated and purified.
[0018] This is the first report of an isolated, inactive NS2/3
protease that is stable at room temperature without proceeding to
auto-catalysis. It is also the first report of a purified
recombinant active NS2/3 protease obtained from the method of the
invention. The availability of the purified recombinant NS2/3
protease will allow for a detailed biochemical characterization of
the enzyme and the development of in vitro assays for screening
novel inhibitors.
[0019] According to a first embodiment, the invention provides a
method of producing a refolded, inactive HCV NS2/3 protease,
comprising the steps of: [0020] a) isolating the protease in the
presence of a chaotropic agent; [0021] b) refolding the isolated
protease by contacting it with a reducing agent and
lauryldiethylamine oxide (LDAO) in the presence of reduced
concentration of chaotropic agent or polar additive.
[0022] In accordance with a second embodiment of this invention,
there is provided a method for producing an active NS2/3 protease
comprising: [0023] c) adding an activation agent to a medium
containing soluble inactive NS2/3 protease obtained in step b),
thereby forming a cleavage/activation buffer so as to induce
auto-cleavage of the NS2/3 protease.
[0024] In a third embodiment, the invention provides a method of
assaying the activity of NS2/3 protease comprising: [0025] d)
incubating the NS2/3 protease in the cleavage/activation buffer of
step c) for sufficient time so that the NS2/3 protease autocleaves;
and [0026] e) measuring the presence or absence of cleavage
products, or fragments thereof, as an indication of the
autocleavage.
[0027] In accordance with a fourth embodiment of the invention,
there is provided an assay for screening a candidate drug or ligand
that inhibits the protease activity of a NS2/3 protease comprising:
[0028] d) incubating a sample of the NS2/3 protease in the
cleavage/activation buffer of step c) for sufficient time in the
presence of, or absence of the candidate drug or ligand; [0029] e)
measuring the amount of cleavage products or fragments thereof; and
[0030] f) comparing the amount of the cleavage products or the
fragments thereof, in the presence of, or absence of the candidate
drug or ligand.
[0031] In accordance with a fifth embodiment of the invention,
there is provided a refolded inactive NS2/3 protease, a truncation
or a functionally equivalent variant thereof, having the minimal
amino acid sequence from residues 906 to 1206 of the full-length
NS2/3 protease as numbered according to the numbering used in FIG.
1B.
[0032] In accordance with a sixth embodiment of the invention,
there is provided a composition comprising an isolated NS2/3
protease selected from full length NS2/3 protease, a truncation
thereof or a sequence as defined according to SEQ ID NO: 2, 4, 10,
11, 12, 13, 14 and 15, wherein said protease is in a solution
comprising a sufficient concentration of LDAO to prevent
auto-cleavage of said protease.
BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Having thus generally described the invention, reference
will now be made to the accompanying drawings, showing by way of
illustration a preferred embodiment thereof, and in which:
[0034] FIG. 1A shows a nucleotide sequence of full length NS2/3
(810-1206)st (SEQ ID NO: 1) of HCV 1b genotype.
[0035] FIG. 1B shows an amino acid sequence of the full length
NS2/3 (810-1206)st (SEQ ID NO: 2) encoded by the nucleotide
sequence of FIG. 1A.
[0036] FIG. 2 shows an N-terminal truncation study in which HCV
NS2/3 protease full-length and N-terminal deletion mutants
encompassing amino acids from 815-915 to 1206 were cloned in the
pET11d expression vector. NS2/3 protease constructs were translated
in vitro with a rabbit reticulocyte lysate. Translated
[.sup.35S]-labeled products were separated by SDS-PAGE (15%) and
visualized with a PhosphorImager (A). E. coli expression of the
NS2/3 protease constructs without induction (lanes -) or following
a 2 h-induction at 37.degree. C. with 1 mM IPTG (lanes +) was
evaluated by SDS-PAGE (15%) (B) and immunoblot analysis using an
anti-NS3 polyclonal antibody (C). Lanes are numbered according to
the first amino acid of the NS2/3 protease expressed in each
transcript. The positions of the molecular mass standards are
indicated as well as the NS3 protease.
[0037] FIG. 3 shows a diagram representing an HCV NS2/3 protease
construct that encompasses amino acid residues 904-1206, along with
N- and C-terminal lysine residues, an N-terminal hexahistidine tag
and a C-terminal streptavidin tag ("st").
[0038] FIG. 4 shows a chromatogram obtained from the refolding
4K-6H-NS2/3 (904-1206)st-4K (SEQ ID NO: 4) on Superose 12 gel
filtration column. Following the addition of 5 mM TCEP and 5 mM
ZnCl.sub.2 to the purified inclusion bodies, the enzyme was
refolded and eluted in Tris 50 mM, pH 8.0, 0.5 M arginine-HCl, 1%
LDAO, 5 mM TCEP. Solid line () represents absorbance at 280 nm and
dotted line (-----.diamond-solid.----) indicates NS3 protease
domain activity monitored on selected fractions using the
fluorogenic substrate anthranilyl-DDIVPAbu[C(O)--O]
AMY(3-NO.sub.2)TW--OH.
[0039] FIG. 5 shows the production and purification of 4K-6H-NS2/3
(904-1206)st-4K from inclusion bodies monitored by 15% SDS-PAGE
stained with Coomassie blue (A) immunoblot analysis using an
anti-NS3 rabbit antisera (B) and immunoblot analysis using an
anti-His.sub.6 rabbit antisera (C). Lane 1: crude E. coli cell
extract; lanes 2-5: inclusion bodies (IB) washes; lanes 6-10:
inclusion bodies purification on Ni.sup.2+-chelating column; lane
11: purified inclusion bodies; lane 12: load of Superose 12 gel
filtration column; lane 13: refolded enzyme (see Examples for
details). The unprocessed enzyme and the cleavage products
4K-6H-NS2 (904-1026) and NS3 (1027-1206)st-4K are indicated.
[0040] FIG. 6 shows the effect of glycerol and CHAPS on the
autoprocessing activity of the 4K-6H-NS2/3 (904-1206)st-4K
monitored by immunoblot using an anti-NS3 rabbit antisera. The
autocleavage reaction was initiated by dilution of the refolded
enzyme in 50 mM Tris, pH 8.0, 1 mM TCEP containing various amount
of glycerol and CHAPS followed by an incubation of 18 h at
23.degree. C. Lane 1: 30% glycerol, no CHAPS; lanes 2-5: no
glycerol and 0.1, 0.25, 0.5 or 1.0% CHAPS respectively; lanes 6-9:
30% glycerol and 0.1, 0.25, 0.5 and 1.0% CHAPS respectively. The
unprocessed enzyme and the NS3 (1027-1206)st-4K product are
indicated.
[0041] FIG. 7 shows a time-course of 4K-6H-NS2/3 (904-1206)st-4K
cis-cleavage monitored by immunoblot using anti-NS3 rabbit antisera
(A) and anti-His.sub.6 rabbit antisera (B). The autocleavage
reaction was initiated by diluting the refolded enzyme in 50 mM
Hepes, pH 7.0, 50% glycerol (w/v), 1% n-.beta.-D-dodecyl maltoside,
1 mM TCEP and incubating for 0, 1, 2, 4, 6 and 24 h at 23.degree.
C. The unprocessed enzyme and the products 4K-6H-NS2 (904-1026) and
NS3 (1027-1206)st4K are indicated.
[0042] FIG. 8 shows a comparison of the NS2-NS3 protease activity
of the purified His952Ala ("H952A") mutant (SEQ ID NO: 16) of
4K-6H-NS2/3 (904-1206)st-4K and the purified WT by immunoblot
analyses using an anti-NS3 antisera (A) or an anti-His.sub.6
antisera (B). The autocleavage reaction was performed in 50 mM
Hepes, pH 7.0, 50% glycerol (w/v), 1% n-.beta.-D-dodecyl-maltoside,
1 mM TCEP for 0, 2 and 24 h at 23.degree. C. A 24 h-incubation was
also performed in the absence of detergent (lane 24*). The
unprocessed enzyme and the autocleavage products 4K-6H-NS2
(904-1026) and NS3 (1027-1206)st-4K are indicated.
[0043] FIG. 9A shows a nucleotide sequence of 4K-6H-NS2/3
(904-1206)st-4K (SEQ ID NO: 3).
[0044] FIG. 9B shows an amino acid sequence of 4K-6H-NS2/3
(904-1206)st-4K (SEQ ID NO: 4) encoded by the nucleotide sequence
of FIG. 9A.
[0045] FIG. 10 is a diagram illustrating the format of a
Heterogeneous Time-Resolved Fluorescence (TRF) Assay.
[0046] FIG. 11 is a diagram illustrating the format of a
Homogeneous Time-Resolved Fluorescence (TRF) Assay.
[0047] FIG. 12 is a diagram illustrating the format of a
Fluorescence Polarization Assay.
[0048] FIG. 13 is a diagram illustrating the format of a
Radiometric Assay.
[0049] FIG. 14 is a schematic representation of an alternative TRF
assay format using the purified NS2/3 protease of the
invention.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
Definitions
[0050] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as those commonly understood by
one of ordinary skill in the art to which the invention pertains.
Generally, the procedures for cell culture, infection, molecular
biology methods and the like are common methods used in the art.
Such techniques can be found in reference manuals such as, for
example, Sambrook et al. (1989, Molecular Cloning--A Laboratory
Manual, Cold Spring Harbor Laboratories) and Ausubel et al. (1994,
Current Protocols in Molecular Biology, Wiley, N.Y.).
[0051] Nucleotide sequences are presented herein by single strand,
in the 5' to 3' direction, from left to right, using the one letter
nucleotide symbols as commonly used in the art and in accordance
with the recommendations of the IUPAC-IUB Biochemical Nomenclature
Commission (Biochemistry, 1972, 11:1726-1732).
[0052] As used herein, the terms "NS2/3 protease", "protease" and
"enzyme" are used interchangeably throughout this specification and
refer to an HCV encoded NS2/3 protease.
[0053] As used herein, the term "active NS2/3 protease" is intended
to describe NS2/3 protease that retains a detectable level of
cleavage activity between residues 1026-1027. The protease activity
is measured by monitoring the levels of remaining uncleaved NS2/3
protease, cleavage products such as either NS2 protein or NS3
protease, or a fragment thereof, for example, in enzymatic assays,
ELISA or by Western blot analysis.
[0054] As used herein, the term "isolated", when referring to NS2/3
protease, is intended to mean that the NS2/3 protease is enriched
with respect to cellular components. Particularly, this term means
that the NS2/3 protease is enriched 50% or greater when compared to
contaminating cellular components.
[0055] As used herein, the term "purifying" or "purified", when
referring to NS2/3 protease, is intended to mean that the NS2/3
protease is substantially free of contaminating cellular
components. Preferably, the NS2/3 protease is purified to a purity
of about 90%. More preferably, the NS2/3 protease is purified to
about 95%. Most preferably the NS2/3 protease is purified to a
purity of about 98%.
[0056] As used herein, the term "inactive NS2/3 protease" is
intended to describe NS2/3 protease that has significantly reduced,
or essentially eliminated, cleavage activity between residues
Leu1026-Ala1027, as determined by SDS-PAGE.
[0057] As used herein, the term "nucleic acid molecule" is intended
to include DNA molecules (e.g., cDNA or genomic DNA) and RNA
molecules (e.g., mRNA). The nucleic acid molecule may be
single-stranded or double-stranded, but preferably is
double-stranded DNA.
[0058] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid molecule to
which it has been linked. One type of vector is a "plasmid", which
refers to a circular, double-stranded DNA loop into which
additional DNA segments may be ligated. Another type of vector is a
viral vector, wherein additional DNA segments may be ligated into
the viral genome. Certain vectors are capable of autonomous
replication in a host cell into which they are introduced (e.g.,
bacterial vectors having a bacterial origin of replication and
episomal mammalian vectors). Other vectors (e.g., non-episomal
mammalian vectors) are integrated into the genome of a host cell
upon introduction into the host cell, and thereby are replicated
along with the host genome. Moreover, certain vectors are capable
of directing the expression of genes to which they are operatively
linked. Such vectors are referred to herein as "expression
vectors". In general, expression vectors of utility in recombinant
DNA techniques are often in the form of plasmids. In the present
specification, "plasmid" and "vector" may be used interchangeably,
as the plasmid is the most commonly used form of vector. However,
the invention is intended to include such other forms of expression
vectors, such as viral vectors, which serve equivalent
functions.
[0059] As used herein, the term "host cell" is intended to refer to
a cell into which a nucleic acid of the invention, such as a
recombinant expression vector of the invention, has been
introduced. The terms "host cell" and "recombinant host cell" are
used interchangeably herein. It should be understood that such
terms refer not only to the particular subject cell but to the
progeny or potential progeny of such a cell. Because certain
modifications may occur in succeeding generations due to either
mutation or environmental influences, such progeny may be, in fact,
non-identical to the parent cell, but are still included within the
scope of the term as used herein.
[0060] As used herein, the term "recombinant" or "recombinantly
produced" is intended to indicate that a cell replicates or
expresses a nucleic acid molecule, or expresses a peptide or
protein encoded by a nucleic acid molecule whose origin is
exogenous to the cell. In particular the recombinant cell can
express genes that are not found within the native
(non-recombinant) form of the cell.
[0061] As used herein, a "functionally equivalent variant", when
used to describe the NS2/3 protease, is intended to refer to a
protein sequence where one or more amino acids are replaced by
other amino acid(s) or unnatural amino acid(s) that do not
substantially affect the NS2/3 protease activity. Such replacements
include conservative amino acid substitutions or degenerate nucleic
acid substitutions. When relating to a protein sequence, the
substituting amino acid has chemico-physical properties which
usually, but not necessarily, are similar to that of the
substituted amino acid. The similar chemico-physical properties
include, similarities in charge, bulkiness, hydrophobicity,
hydrophilicity and the like. Some of the most commonly known
conservative amino acid substitutions include, but are not limited
to: Leu or Val or Ile; Gly or Ala; Asp or Glu; Asp or Asn or His;
Glu or Gln; Lys or Arg; Phe or Trp or Tyr; Val or Ala; Cys or Ser;
Thr or Ser; and Met or Leu.
[0062] As used herein, the term "inhibit", when used in reference
to the NS2/3 protease, is intended to mean that the protease's
ability to autocleave is decreased. Drugs or ligands that can
inhibit NS2/3 protease (hereinafter referred to as "potential
inhibitors") may be useful for modulating HCV infection in a
population of cells and, therefore, may be useful as medicaments
for treating a pathology characterized by the presence of HCV in
the cells.
[0063] As used herein, the term "refolded", when used in reference
to the NS2/3 protease, is intended to refer to the process by which
the unfolded, or improperly folded, NS2/3 protease undergoes
conformational changes (partial or complete) so as to attain a
conformation that is soluble and stable without detectable
autocleavage activity at room temperature. The refolded protease
requires addition of an activation detergent to become
activated.
[0064] As used herein, the term "autocleavage" or "autocleaved",
when used to describe NS2/3 protease, is intended to mean that the
cleavage at the NS2/3 junction (Leu1026-Ala1027) occurs
intramolecularly without an exogenous substrate.
[0065] The term "affinity label" or "affinity tag" as used herein
refers to a label which is specifically trapped by a complementary
ligand. Examples of pairs of affinity marker/affinity ligand
include but are not limited to: Maltose-Binding Protein
(MBP)/maltose; Glutathione S Transferase (GST)/glutathione;
histidine (His)/metal; streptavidin tag/streptavidin or
neutravidin. The metal used as affinity ligand may be selected from
the group consisting of: cobalt, zinc, copper, iron, and nickel
(Wong et al. (1991) Separation and Purification Methods, 20(1),
49-106). The affinity label may be positioned on the N- or
C-terminal end of the protein, but preferably on the N-terminus of
the protein. Preferably, the metal selected is nickel. The affinity
ligand can be set up in columns to facilitate separation by
affinity chromatography.
Preferred Embodiments
I. Method of Refolding and Purification
[0066] According to a first aspect of the first embodiment of the
present invention, there is provided a method of producing a
refolded, inactive HCV NS2/3 protease, comprising the steps of:
[0067] a) isolating the protease from inclusion bodies in the
presence of high concentration of a chaotropic agent; [0068] b)
refolding the isolated protease by contacting the protease with a
reducing agent and LDAO in the presence of low concentration of
chaotropic agent or polar additive.
[0069] In a preferred aspect of the first embodiment, the active
NS2/3 protease is produced using recombinant DNA techniques. The
expression vectors of the invention (see Examples) comprise a
nucleic acid of the invention in a form suitable for expression of
the protein in a host cell, which means that the recombinant
expression vectors include one or more regulatory sequences,
selected on the basis of the host cells to be used for expression,
which is operatively linked to the nucleic acid sequence coding for
the protein to be expressed. Within a recombinant expression
vector, "operably linked" is intended to mean that the nucleotide
sequence of interest is linked to the regulatory sequence(s) in a
manner which allows for expression of the corresponding amino acid
sequence (e.g., in an in vitro transcription/translation system or
in a host cell when the vector is introduced into the host cell).
The term "regulatory sequence" is intended to include promoters,
enhancers and other expression control elements (e.g.,
polyadenylation signals). Such regulatory sequences are described,
for example, in Goeddel; Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, Calif. (1990).
Regulatory sequences include those which direct constitutive
expression of a nucleotide sequence in many types of host cell and
those which direct expression of the nucleotide sequence only in
certain host cells (e.g., tissue-specific regulatory sequences). It
will be appreciated by those skilled in the art that the design of
the expression vector may depend on such factors as the choice of
the host cell to be transformed, the level of expression of protein
desired, etc. The expression vectors of the invention can be
introduced into host cells to thereby produce proteins or peptides
encoded by nucleic acids as described herein (e.g. NS2/3 protease,
truncations or mutant forms of NS2/3 protease).
[0070] The recombinant expression vectors of the invention can be
designed for expression of NS2/3 protease in prokaryotic or
eukaryotic cells. For example, NS2/3 protease can be expressed in
bacterial cells such as E. coli, insect cells (using baculovirus
expression vectors), yeast cells or mammalian cells. Suitable host
cells are discussed further in Goeddel, Gene Expression Technology:
Methods in Enzymology 185, Academic Press, San Diego, Calif.
(1990).
[0071] Expression of proteins in prokaryotes is most often carried
out in E. coli with vectors containing constitutive or inducible
promoters directing the expression of either fusion or non-fusion
proteins. Fusion vectors add a number of amino acids to a protein
encoded therein, usually to the amino terminus of the recombinant
protein. Such fusion vectors typically serve three purposes: 1) to
increase expression of recombinant protein; 2) to increase the
solubility of the recombinant protein; and 3) to aid in the
purification of the recombinant protein by acting as a ligand in
affinity purification (e.g. affinity tag such as a hexahistidine
tag). One strategy to maximize recombinant protein expression in E.
coli is to express the protein in a host bacteria with an impaired
capacity to proteolytically cleave the recombinant protein
(Gottesman, S., Gene Expression Technology: Methods in Enzymology
185, Academic Press, San Diego, Calif. (1990) 119-128). Another
strategy is to alter the nucleic acid sequence of the nucleic acid
to be inserted into an expression vector so that the individual
codons for each amino acid are those preferentially utilized in E.
coli (Wada et al., (1992) Nuc. Acids Res. 20:2111-2118). Such
alteration of nucleic acid sequences of the invention can be
carried out by standard DNA synthesis techniques.
[0072] Vector DNA can be introduced into prokaryotic or eukaryotic
cells via conventional transformation or transfection techniques.
As used herein, the terms "transformation" and "transfection" are
intended to refer to a variety of art-recognized techniques for
introducing foreign nucleic acid (e.g., DNA) into a host cell,
including calcium phosphate or calcium chloride co-precipitation,
DEAE-dextran-mediated transfection, lipofection, or
electroporation. Suitable methods for transforming or transfecting
host cells can be found in Sambrook et al. (Molecular Cloning: A
Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press
(1989)), and other laboratory manuals.
[0073] Often during protein expression, so-called inclusion bodies
are formed. The NS2/3 protease may be isolated from the host cell,
e.g. by lysing the host cell and recovering the recombinant NS2/3
protease from the inclusion bodies. Inclusion bodies are aggregates
of intact proteins or polypeptides in non-native-like conformations
(see Current Protocols in Protein Science (1997) John Wiley &
Sons Inc.). There are many examples of how to extract protein from
inclusion bodies and these are discussed in Current Protocols in
Protein Science. The host cell of the invention, such as a
prokaryotic or eukaryotic host cell in culture, can be used to
produce NS2/3 protease of the present invention.
[0074] Accordingly, the invention further includes culturing a host
cell in a culture medium. The host cell contains an expression
vector that has a coding region of a nucleic acid sequence that
encodes NS2/3 protease, resulting in the production of unfolded or
improperly folded inactive recombinant NS2/3 protease in inclusion
bodies. The host cells are lysed with a lysis buffer to produce
host cell lysates. The inclusion bodies in the host cell lysates
are recovered therefrom by low speed centrifugation. Preferably,
the lysis buffer contains about 0.1% Triton X-100. The inclusion
bodies are then selectively extracted using an extraction buffer
that preferably contains about 2% Triton X-100 and 2M urea.
Preferably, both the lysis buffer and the extraction buffer contain
a reducing agent selected from the group consisting of DTT and
TCEP.
[0075] In another aspect of the first embodiment, the inclusion
bodies, containing inactive NS2/3 protease, are then isolated by
low speed centrifugation following selective extraction from
pellets obtained from the low speed centrifugation from the host
cell lysates described above. The isolated inclusion bodies are
treated with a chaotropic agent at a sufficient concentration to
produce soluble inactive NS2/3 protease. Preferably, the chaotropic
reagent is selected from the group consisting of guanidine,
guanidine-HCl and urea. More preferably, the chaotropic agent is
guanidine-HCl. Preferably, the sufficient concentration is between
4M and 9M. More preferably, guanidine or guanidine-HCl is at a
concentration between 4 and 8M; most preferably at 6M. Preferably,
urea is at a concentration between 6 and 9M; more preferably
8M.
[0076] Alternatively, recombinant NS2/3 protease may also be
prepared as an extracellular protein by operatively linking a
heterologous signal sequence to the amino-terminus of the protease
such that it is secreted from a eukaryotic cell. In this case,
recombinant NS2/3 protease can be recovered from the culture medium
in which the cells are cultured.
[0077] In another aspect of the first embodiment, the NS2/3
protease in constructed to contain an affinity-tag that can be used
such that the soluble inactive NS2/3 protease can be isolated from
the inclusion bodies using affinity chromatography. Such affinity
tag and corresponding ligand are well known in the art.
[0078] In a preferred aspect of the first embodiment, LDAO is used
at or above its critical micelle concentration. More preferably,
LDAO is at a concentration between 0.003% and 1%. In a most
preferred aspect, LDAO is used at a concentration between 0.03% and
1%. Without intending to be bound by theory, the inventors believe
that LDAO present in the refolding (gel filtration) buffer is
required for refolding but not sufficient for cis-cleavage of the
enzyme.
[0079] In a preferred aspect of the first embodiment step b), the
chaotropic agent or polar additive is selected from the group
consisting of: guanidine, guanidine hydrochloride, urea and
arginine-hydrochloride. More preferably, guanidine-hydrochloride or
arginine-HCl is used. Most preferably, arginine-HCl is used.
[0080] In a preferred aspect of the first embodiment step b) the
chaotropic agent or polar additive is preferably used at a
concentration between 0.25M and 2M. In a most preferred aspect, it
is used at a concentration between 0.5M and 1M, most preferably, at
a final concentration of 0.5M.
[0081] In another preferred aspect, the reducing agent is selected
from the group consisting of TCEP and DTT. Preferably, the reducing
agent is present at a final concentration between 0. and 100 mM,
more preferably between 1 mM and 10 mM. Most preferably, the
reducing agent is present at a final concentration of 5 mM.
[0082] In a preferred aspect of this first embodiment, the
refolding method described above is carried out by dialysis or by
gel filtration to yield a purified NS2/3 protease. In an important
aspect, the soluble inactive NS2/3 protease is refolded using gel
filtration. The elution buffer used contains LDAO, arginine-HCl and
the reducing agent and the soluble inactive NS2/3 is maintained in
the elution buffer for sufficient time to refold the NS2/3
protease. Collection of the main fractions allows recovery of a
highly purified enzyme.
II. Method of Activation
[0083] In accordance with a second embodiment of this invention,
there is provided a method for producing an active NS2/3 protease
comprising: [0084] c) adding the soluble inactive NS2/3 protease
obtained in step b), to a medium containing an activation agent so
as to induce auto-cleavage of the NS2/3 protease.
[0085] In a preferred aspect of the second embodiment, the
activation agent is selected from the group consisting of:
glycerol, or a detergent such as CHAPS, Triton X-100, NP-40 and
n-dodecyl-.beta.-D-maltoside.
[0086] As an alternative to a this second embodiment of the
invention, there is provided a method for producing an active NS2/3
protease comprising: [0087] c) diluting the refolded inactive NS2/3
protease obtained in step b), in a medium containing an activation
detergent to induce auto-cleavage of said NS2/3 protease.
[0088] Preferably, the LDAO remaining in the NS2/3 protease after
dilution is at a final concentration below 0.25%. More preferably,
the LDAO is diluted at a final concentration equal to or below
0.1%. Most preferably, the LDAO is diluted at a final concentration
below 0.05%.
[0089] Preferably, the activation detergent may be selected from:
CHAPS, Triton X-100, NP-40 and n-dodecyl-.beta.-D-maltoside. More
preferably, the activation detergent is CHAPS or
n-dodecyl-.beta.-D-maltoside.
[0090] Preferably, the activation detergent is at a final
concentration of about 0.1% to about 3%. More preferably, the
activation detergent is at a final concentration of about 0.1% to
about 1%. Most preferably, the activation detergent is at a final
concentration of 0.5%.
[0091] Further to the activation detergent, glycerol can also be
added to aid in the activation of the refolded, inactive NS2/3
protease. Preferably, glycerol can be present at a final
concentration between 0% and 60%. More preferably, glycerol can be
present at a final concentration between 10% and 50%. Most
preferably, glycerol is present at a final concentration of
30%.
[0092] Importantly, in a preferred aspect, the reducing agent is
still present in the buffer or the activation/cleavage medium used
for activation, albeit at a lower concentration than necessary for
the refolding step. The reducing agent may be selected from the
group consisting of TCEP and DTT. More preferably, the reducing
agent is TCEP.
[0093] Preferably, the reducing agent is at a final concentration
of between 1 mM and 100 mM. More preferably, the reducing agent is
at a final concentration of between 1 mM and 10 mM. Preferably, the
reducing agent is at a final concentration of 1 mM.
III. Method of Measuring NS2/3 Protease Activity
[0094] In accordance with a preferred aspect of the third
embodiment of the invention, there is provided a method of
measuring the auto-cleavage activity of purified NS2/3 protease
comprising: [0095] c) incubating the refolded inactive NS2/3
protease obtained in step b) in a buffer containing an activation
detergent, for sufficient time so that the NS2/3 protease
autocleaves; and [0096] d) measuring the presence or absence of
remaining uncleaved NS2/3 protease, cleavage products, or fragments
thereof, as an indication of autocleavage.
[0097] Preferably, the refolded inactive NS2/3 protease is refolded
and purified using gel filtration prior to carrying the
above-mentioned assay.
[0098] Preferably, the activation detergent is: CHAPS,
n-dodecyl-.beta.-D-maltoside, NP40 and Triton X-100. More
preferably, the activation detergent is
n-dodecyl-.beta.-D-maltoside (DM) at a concentration of between
0.1% to 3%. More preferably, the activating detergent is
n-dodecyl-.beta.-D-maltoside at a concentration of about 0.1% to
about 1%. Even most preferably, DM is at a final concentration of
0.5%.
[0099] A further activation agent such as glycerol can also be
added to aid in the activation of the refolded, inactive NS2/3
protease. Preferably, glycerol can be present at a final
concentration between 0% and 60%. More preferably, glycerol can be
present at a final concentration between 10% and 50%. Most
preferably, glycerol is at a final concentration of 30%.
[0100] Preferably, the NS2/3 protease is incubated in the cleavage
buffer for at least 1 hour from 15.degree. C. to 30.degree. C. More
preferably, the NS2/3 protease is incubated in the cleavage buffer
for at least 1 hour from 1 5.degree. C. to 25.degree. C. Most
preferably, the NS2/3 protease is incubated in the cleavage buffer
for at least 1 hour at room temperature (about 23.degree. C.).
[0101] In another aspect of the second embodiment, the cleavage
reaction is stopped by denaturing the NS2/3 protease. More
preferably, NS2/3 protease is denatured by heat. Most preferably,
NS2/3 protease is denatured with SDS, to stop the autocleavage.
[0102] The cleavage products are preferably NS2 protein or NS3
protease. The amount of the NS2 protein or NS3 protease, or
fragments thereof, may be measured using any one of the many
techniques known to one of ordinary skill in the art. Examples of
such techniques are enzymatic activity, immunoblot staining,
chemiluminescence, fluorescence, or Coomassie staining. As an
alternative, the amount of remaining uncleaved NS2/3 protease can
also be measured as an indicator of cleavage.
IV. Methods of Screening Inhibitors
[0103] In a fourth embodiment, the invention provides an assay for
screening potential inhibitors of the auto-cleavage activity of an
active NS2/3 protease comprising: [0104] c) incubating a sample of
the refolded inactive NS2/3 protease obtained in step b) in a
buffer containing an activation detergent, for sufficient time in
the presence of, or absence of the potential inhibitor; [0105] d)
measuring the amount of cleavage products or fragments thereof, and
[0106] e) comparing the amount of the cleavage products or
fragments thereof, in the presence of, or absence of the potential
inhibitor.
[0107] The sample of the active NS2/3 protease is preferably
incubated for about 1 hour in the suitable medium with the
candidate drug or ligand.
[0108] In a preferred aspect, the cleavage products are either NS2
protein or NS3 protease. Preferably, the presence or absence of
either the NS2 protein or the NS3 protease, or fragments thereof,
is analysed using enzymatic activity, immunoblot analysis, which
comprises using an anti-NS3 protease antibody or a
anti-histidine-tag antibody. As an alternative, the amount of
remaining uncleaved NS2/3 protease can also be measured as an
indicator of cleavage.
V. NS2/3 Protease, Polypeptides and Truncations/Nucleic Acid
Molecules
[0109] Preferably, the NS2/3 protease is the full-length NS2/3
protease 810-1206 or a truncation thereof. More preferably, the
NS2/3 protease is N-terminally truncated having its first amino
acid corresponding to amino acid 815 to amino acid 906. Still more
preferably, the N-terminal truncated protein having its first amino
acid corresponding to amino acid 866 to 906. Even more preferably,
the N-terminal truncated protein having its first amino acid
corresponding to amino acid 890 to 904. Most preferably, there is
provided a NS2/3 truncated protein having the minimal amino acid
sequence from residues 904 to 1206 of the full-length NS2/3
protease. Even most preferably, the truncated NS2/3 protein consist
of amino acids 904-1206 as numbered according to SEQ ID NO:10.
[0110] In a fifth embodiment of the invention, there is provided an
active NS2/3 polypeptide consisting of a truncated NS2/3 protease
selected from the group consisting of: a sequence as defined
according to SEQ ID NO: 2, 4, 10, 11, 12, 13, 14 and 15.
Preferably, the NS2/3 protease has a sequence selected from the
group consisting of: a sequence as defined according to SEQ ID NOS:
4, 10, 11, 12 and 15. More preferably, the NS2/3 protease has a
sequence shown in SEQ ID NO: 4 or 10 or a functionally equivalent
variant thereof. Most preferably, the NS2/3 protease has a sequence
shown in SEQ ID NO: 4 or 10.
[0111] According to another aspect of the fifth embodiment of this
invention, there is provided a refolded, inactive NS2/3 protease
selected from the group consisting of: full length NS2/3 protease,
a sequence as defined according to SEQ ID. NO: 2, 4, 10, 11, 12,
13, 14 and 15. More preferably, there is provided a refolded,
inactive NS2/3 protease as defined according to SEQ ID. NO: 4 or
10.
[0112] According to a further aspect of the fifth embodiment, there
is provided a polypeptide consisting of an amino acid sequence that
has 90% identity over its length compared to the polypeptide as
defined according to SEQ ID. NO: 2, 4, 10, 11, 12, 13, 14 and 15.
More preferably, there is provided a polypeptide consisting of an
amino acid sequence that has 90% identity over its length compared
to the polypeptide as defined according to SEQ ID. NO: 4 or 10.
[0113] In another aspect of the fifth embodiment, there is provided
a nucleic acid molecule encoding the amino acid sequence shown in
SEQ ID NOS: 2, 4, 10, 11, 12, 13, 14 and 15 respectively.
[0114] Nucleic acid fragments that encode functionally equivalent
variants of NS2/3 protease can be prepared by isolating a portion
of residues from SEQ ID NO: 1, expressing the encoded portion
890-1206 of NS2/3 protease, e.g. by recombinant expression in a
host cell, as described above, and assessing the ability of the
portion to autocleave following purification and refolding.
[0115] Nucleic acid molecules of the present invention can be
isolated using standard molecular biology techniques and the
sequence information provided herein. A nucleic acid molecule
encompassing all or a portion of residues coding for amino acid
890-1206 can be isolated by the polymerase chain reaction (PCR)
using appropriate oligonucleotide primers. For example, mRNA can be
isolated from cells (e.g., by the guanidinium-thiocyanate
extraction procedure of Chirgwin et al. (1979) Biochemistry 18:
5294-5299) and cDNA can be prepared using reverse transcriptase
(e.g., Moloney MLV reverse transcriptase, available from Gibco/BRL,
Bethesda, Md.; or AMV reverse transcriptase, available from
Seikagaku America, Inc., St. Petersburg, Fla.). Synthetic
oligonucleotide primers for PCR amplification can be designed based
upon the nucleotide sequence shown in SEQ ID NO: 1. A nucleic acid
of the invention can be amplified using cDNA or, alternatively,
genomic DNA, as a template and appropriate oligonucleotide primers
according to standard PCR amplification techniques. The nucleic
acid so amplified can be cloned into an appropriate vector and
characterized by DNA sequence analysis. Furthermore,
oligonucleotides corresponding to a NS2/3 protease nucleotide
sequence can be prepared by standard synthetic techniques, e.g.,
using an automated DNA synthesizer.
[0116] In addition to naturally-occurring variants of the NS2/3
protease sequence that may exist in a viral population, one of
ordinary skill in the art will further appreciate that changes may
be introduced by mutation into the nucleotide sequence coding for
amino acid 890 up to 1206, thereby leading to changes in the amino
acid sequence of the encoded protein, that may or may not alter the
functional activity of the NS2/3 protease. For example, nucleotide
substitutions leading to amino acid substitutions at
"non-essential" amino acid residues may be made in the sequence of
SEQ ID NO: 1. A "non-essential" amino acid residue is a residue
that can be altered from the full length sequence of NS2/3 protease
(e.g., the sequence of SEQ ID NO: 2) without altering the
functional activity of NS2/3 protease, whereas an "essential" amino
acid residue is required for functional activity.
[0117] Accordingly, in another aspect, the invention pertains to
nucleic acid molecules that encode NS2/3 protease that contain
changes in amino acid residues that are essential for NS2/3
protease activity. Such NS2/3 protease mutants differ in amino acid
sequence from SEQ ID NO: 10 and have lost their protease activity.
Examples of such mutant NS2/3 proteases that may be used in the
present invention are NS2/3 protease[904-1206]H952A (SEQ ID NO:
16), in which His-952 is replaced by Ala, NS2/3
protease[904-1206].DELTA.L1026A1027 (SEQ ID NO: 17), which
corresponds to a deletion at the cleavage site residues between the
NS2 and NS3 proteins and NS2/3 protease[904-1206]C993A in which the
Cys993 is replaced by Ala (SEQ ID NO: 18).
EXAMPLES
[0118] The present invention is illustrated in further detail by
the following non-limiting examples.
Materials and Methods
Abbreviations:
[0119] Ala: alanine [0120] .degree. C. celsius [0121] CHAPS:
3-[(3-cholamidopropyl)dimethyl-ammonio]-1-propane sulfonate [0122]
CMC: critical micellar concentration [0123] DHFR: dihydrofolate
reductase [0124] DNase: deoxyribonuclease [0125] DTPA:
N,N-bis[2-(bis[carboxymethyl]amino)ethyl]-glycine [0126] DTT:
dithiothreitol [0127] EDTA: ethylenediaminetetraacetic acid [0128]
g: gram [0129] g: relative centrifugal force [0130] h: hour [0131]
HCV: hepatitis C virus [0132] Hepes:
4-(2-hydroxyethyl)-1-piperazine-ethanesulfonic acid [0133] His:
histidine [0134] His.sub.6: hexahistidine tag [0135] HMK heart
muscle kinase [0136] IPTG: isopropyl-.beta.-D-thiogalactopyranoside
[0137] kDa: kilodalton [0138] LDAO: lauryldiethylamine oxide [0139]
Leu: leucine [0140] M: molar [0141] MBP: maltose-binding protein
[0142] min: minute [0143] mL: millilitre [0144] mM: millimolar
[0145] Octyl-POE: n-octylpentaoxyethylene [0146] PCR: polymerase
chain reaction [0147] SDS-PAGE: sodium dodecyl sulfate
polyacrylamide gel electrophoresis [0148] st: streptavidin tag as
described in Schmidt & Skerra, Prot. Engineering (1993) 6;
109-122 [0149] TCEP: tris(2-carboxyethyl)phosphine hydrochloride
[0150] Tris: tris[hydroxymethyl]aminomethane [0151] .mu.g:
microgram [0152] .mu.m: micron [0153] WT: wild-type [0154] w/v:
weight per volume Materials
[0155] The detergents CHAPS and Triton X-100 were obtained from
Sigma, LDAO from Calbiochem, n-dodecyl-.beta.-D-maltoside from
Anatrace Inc., NP-40 from Roche and octyl-POE from Bachem. The
reducing agents DTT and TCEP were obtained from Pharmacia Biotech
and Pierce respectively. Arginine hydrochloride, glycerol, Hepes,
imidazole and magnesium chloride were all obtained from Sigma.
Guanidine hydrochloride and Tris were obtained from Gibco BRL,
while IPTG and urea were from Roche. Sodium chloride and zinc
chloride were obtained from Fisher and Aldrich respectively, EDTA
was obtained from Ambion and DNase from Pharmacia Biotech.
Restriction enzymes were obtained from Pharmacia Biotech. E. coli
XL-1 Blue cells were obtained from Stratagene and BL21(DE3)pLysS
cells from Novagen. FLAG.TM. is obtained from Eastman Kodak Company
and corresponds to a peptide sequence that is recognized by an
anti-FLAG antibody. HMK.sub.tag is a five-residue peptide (RRASV)
that is a recognition sequence for the specific protein kinase HMK
(Heart Muscle Kinase), therefore introducing a phosphorylation site
(Blanar, M. and Rutter, W. (1992) Science 256:1014-1018).
Example 1
NS2/3 Full Length Construct:
[0156] The full length (810-1206) NS2/3 sequence was amplified by
PCR from the HCV 1b-40 sequence (WO 99/07733 by
Boehringer-Ingelheim (Canada), Ltd.) using two oligonucleotide
primers, 5'-CCATGGACCGGGAGATGGCT-3' (SEQ ID NO: 5) for the
N-terminus and
5'GGATCCTTAACCACCGAACTGCGGGTGACGCCAAGCGCTACTAGTCCGCAT
GGTAGTTTCCAT-3' (SEQ ID NO: 6) for the C-terminus. This procedure
introduces a NcoI site at the 5' end and a streptavidin tag "st"
(Schmidt & Skerra, Prot. Engineering (1993) 6; 109-122)
followed by a BamH1 site at the 3' end giving a nucleic acid
molecule of SEQ ID NO:1 (FIG. 1). The PCR product was inserted into
the vector pCR.TM. 3 using the TA cloning.RTM. kit from Invitrogen.
The insert was then transferred to a bacterial expression vector
pET-11d (Novagen) by cutting with EcoRI followed by Klenow
treatment to create blunt ends followed by a partial digestion with
NcoI. This construct was designated pET-11d-NS2/3st. The DNA was
transformed into XL-1 Blue E. coli cells, isolated and sequenced.
The DNA was then transferred into E. coli BL21 (DE3) pLysS for
protein production.
Example 2
NS2/3 N-terminal Deletion Mutants
[0157] The N-terminal deletion mutants 815*-1206, 827-1206,
855-1206, 866-1206, 904-1206 and 915-1206 were derived from the
pET-11d/NS2/3 template that was designed with a NcoI site at the 5'
end and within the NS3 domain at amino acid 1083. Following the
template digestion with NcoI, the 3' end fragment and the vector
were gel purified. The mutants were obtained by PCR using the
appropriate synthetic oligonucleotides primers containing the NS2/3
sequence from nucleotides that encode the desired N-terminal
residue up to amino acid 1083. The primers also introduced a NcoI
site at the 5' end, such that the resulting inserts could be
ligated to the gel purified fragment. The DNA was then transformed
into E. coli XL-Blue cells, isolated and sequenced. Finally, the
DNA was transferred into E. coli BL21(DE3)pLysS for protein
production. Expression was verified by SDS-PAGE (FIG. 2A, 2B, 2C).
* The numbering of this fragment is erroneous since the first
methionine is part of the original sequence and should therefore be
numbered "814". Therefore all reference to the truncation starting
with 815 should be read as "814" as is correctly represented in SEQ
ID NO:11.
Example 3
NS2/3 N-terminal Truncation Mutant 4K-6H (904-1206)st-4K (SEQ ID
NO: 4):
[0158] In this construct, four lysines were added at the N- and
C-termini as well as a hexahistidine tag at the N-terminus. This
construct was obtained using PCR and the pET-11d/NS2/3st template
with two primers containing the sequence for the tags as well as
the NS2/3 sequence from nucleotides that encode amino acid residues
904-1206. The primers also introduced a NdeI and BamHI site at 5'
and 3' end respectively. The insert was cloned into pET-11d and
designated pET-11d 4K-6H-NS2/3 (904-1206)-st-4K (SEQ ID NO:3). The
DNA was transformed into E. coli XL-1 Blue cells, isolated and
sequenced. The DNA was then transferred into E. coli BL21 (DE3)
pLysS for protein production.
[0159] For the truncated construct 904-1206, 4 primers and 2
successive PCR reactions were used. The primers used in the first
PCR reaction were GCTCGAGCATCACCATCACCATCACACTAGTGCAGGCATAACCAAA
(SEQ ID NO:7) for the N-terminus and
AACAATGGATCCTTACTTTTTCTTTTTACCACCGAACTGCGGGTG (SEQ ID NO: 8) for
the C-terminus. For the second PCR reaction, the primers used were
ACCTGCCATATGAAAAAGAAAAAGCTCGAGCATCACCATCACCAT (SEQ ID NO: 9) for
the N-terminus and AACAATGGATCCTTACTTTTTCTTTTTACCACCGAACTGCGGGTG
(SEQ ID NO: 7) for the C-terminus.
Example 4
Enzyme Expression and Production
[0160] The HCV NS2/3 protease genotype 1b [904-1206] (FIG. 3)
having a N-terminal hexahistidine tag was cloned in the pET-11d
expression vector. Four lysine residues were also added at both N-
and C-terminal ends to enhance the protein solubility, along with a
streptavidin tag at the C-terminal end giving the nucleic acid
molecule of SEQ ID NO: 3. The protease was expressed in E. coli
BL21 (DE3)pLysS following induction with 1 mM IPTG for 3 h at
37.degree. C. A typical 4 L fermentation yielded approximately 20 g
of wet cell paste. The cell paste can be stored at -80.degree.
C.
Example 5
Inclusion Bodies Extraction
[0161] Following thawing at 23.degree. C., the cells were
homogenized in lysis buffer (5 mL/g) consisting of 100 mM Tris, pH
8.0, 0.1% Triton X-100, 5 mM EDTA, 20 mM MgCl.sub.2, 5 mM DTT
followed by a DNase treatment (20 .mu.g/mL) for 15 min at 4.degree.
C. and a centrifugation at 22,000.times.g for 1 h at 4.degree. C.
The cell pellet was then washed twice by homogenization (5 mL/g) in
100 mM Tris, pH 8.0, 2% Triton X-100, 5 mM EDTA, 2 M urea, 5 mM DTT
and centrifuged at 22,000.times.g for 30 min at 4.degree. C.
Finally, cells were washed in 100 mM Tris, pH 8.0, 5 mM EDTA, 5 mM
DTT. The inclusion bodies were recovered in the pellet by
centrifugation at 22,000.times.g for 30 min at 4.degree. C.
Example 6
a) Inclusion Bodies Extraction
[0162] To solubilize the inclusion bodies, the cell pellet was
suspended in the extraction buffer (4 mL/g) consisting of 100 mM
Tris, pH 8.0, 6 M guanidine-HCl, 0.5 M NaCl and kept in that buffer
for 1 h at 23.degree. C. The suspension was then centrifuged at
125,000.times.g for 30 min at 4.degree. C. The resulting
supernatant was filtered through a 0.22-.mu.m filter. The clarified
inclusion bodies extract can be stored at -80.degree. C. until
required.
b) 4K-6H-NS2/3 (904-1206)st-4K Isolation from Inclusion Bodies
[0163] To isolate the 4K-6H-NS2/3 (904-1206)st-4K (SEQ ID NO. 4),
the inclusion bodies extract was diluted 2-fold (to approx. 1
mg/mL) in 100 mM Tris, pH 8.0, 6 M guanidine-HCl, 0.5 M NaCl and
applied on a Pharmacia Hi-Trap Ni.sup.2+-chelating column. The
isolated protein was typically eluted with 250 mM imidazole from a
50 to 500 mM imidazole linear gradient. The fractions corresponding
to the major peak were pooled.
Example 7
Refolding and Purification on Gel Filtration Column
[0164] To the preparation of isolated inclusion bodies was added 5
mM TCEP and 5 mM ZnCl.sub.2. Following a 15 min incubation at
23.degree. C., the sample was loaded on a Pharmacia Superose 12 gel
filtration column. The 4K-6H-NS2/3 (904-1206)st-4K was then eluted
in Tris 50 mM, pH 8.0, 0.5 M arginine-HCl, 1% LDAO, 5 mM TCEP
yielding refolded NS2/3 protease. Only those fractions that
correspond to the major peak (FIG. 4) are collected and pooled.
Autocleavage was undetectable under these conditions. The purified,
refolded inactive enzyme was stored at -80.degree. C. in the
elution buffer. Typically about 7 mg of refolded NS2/3 protease was
obtained per liter of E. coli culture.
[0165] To overcome the problem of NS2/3 protease autocleavage, the
refolding conditions were initially determined using either the
His952Ala mutant (SEQ ID NO: 16) or the .DELTA.Leu1026-Ala1027
mutant (SEQ ID NO: 17) of the 4K-6H-NS2/3 (904-1206)st-4K. Both
these mutants are devoid of autocatalytic activity. The refolding
was assessed indirectly based on the activity of the NS3 protease
(FIG. 4) by incubating serial dilutions of the refolded enzyme with
5 .mu.M of the internally quenched fluorogenic substrate
anthranilyl-DDIVPAbu[C(O)--O] AMY(3-NO.sub.2)TW--OH (SEQ ID NO: 19)
in 50 mM Tris-HCl, pH 7.5, 30% glycerol, 1 mg/mL BSA and 1 mM TCEP
for 30 or 60 min at 23.degree. C. (specifically described in WO
99/07733 incorporated herein by reference). The proteolytic
activity was monitored by the fluorescence change associated with
cleavage of the substrate and the appearance of the fluorescent
product anthranilyl-DDIVPAbu-COOH (SEQ ID NO: 20) on a BMG Galaxy
96-well plate reader (excitation filter: 355 nm; emission filter:
485 nm).
[0166] Then 4K-6H-NS2/3 (904-1206)st-4K was produced, purified and
refolded according to the same protocol, resulting in a >95%
pure enzyme. Proper refolding was confirmed by NS3 protease
activity (FIG. 4, dotted line).
Example 8
Validation of Activity after Refolding
Cis-Cleavage Assay
[0167] The autocleavage reaction of the 4K-6H-NS2/3 (904-1206)st-4K
was initiated by adding to the enzyme the cleavage buffer
consisting of 50 mM Hepes, pH 7.0, 50% (w/v) glycerol, 0.1% CHAPS
(FIG. 6) or 1% n-dodecyl-.beta.-D-maltoside (FIGS. 7, 8) (NP-40 and
Triton X-100 can also be used) and 1 mM TCEP. The assay mixture was
then incubated for 3 h at 23.degree. C. The reaction was stopped by
heat denaturation of the enzyme in the presence of SDS. Cleavage at
the NS2/3 junction was monitored by SDS-PAGE (15%) and immunoblot
analyses using either a NS3 protease polyclonal antibody produced
in-house or a commercially available hexahistidine-tag polyclonal
antibody (Santa Cruz Biotechnology, Inc.) (FIG. 5).
Example 9
Heterogeneous Time-Resolved Fluorescence Assay
[0168] The NS2/3 protease is first immobilized on a
nickel-chelating plate (FIG. 10). A europium-labeled anti-NS2 or
anti-FLAG.sub.tag antibody is then added. One skilled in the art
will recognize that many tags are available for labeling proteins.
In this example, FLAG.TM. and HMK are used. Following binding of
the antibody, a washing step is performed to remove the excess of
antibody. Then, the autocleavage reaction is initiated by addition
of the cleavage buffer. After the appropriate incubation time, the
assay mixture is transferred in a second plate and the cleavage
monitored by the measurement of the time-resolved fluorescence
associated with the europium-labeled product. Cleavage of the NS2/3
protease may also be monitored by the decrease of the time-resolved
europium fluorescence signal resulting from the unprocessed enzyme
bound to the nickel-chelating plate.
[0169] As an alternative, a Strep-tag.RTM. containing-NS2/3
protease is incubated in the activating buffer and the autocleavage
reaction is allowed to proceed (FIG. 14). The resulting Strep-tag
NS3 fragment and the uncleaved Strep-tag NS2/3 protease is then
immobilized on a streptavidin-coated plate. An europium-labeled
anti-NS2 antibody is then added and time-resolved fluorescence
associated with the bound europium-labeled antibody is
measured.
Assay Protocol:
1--Autocleavage Reaction
[0170] In a 96-well polypropylene plate, are added sequentially: i)
20 .mu.L of the assay buffer (50 mM Hepes, pH 7.5, 30% glycerol, 1
mM TCEP) with or without the presence of a test compound (potential
inhibitor) and, ii) 10 .mu.L of NS2/3 protease (at a final
concentration of 200 nM) as purified according to Example 7. The
autocleavage reaction is initiated by addition of 20 .mu.L of the
activation buffer (50 mM Hepes, pH 7.5, 30% glycerol, 0.5%
n-dodecyl-.beta.-D-maltoside, 1 mM TCEP) and is allowed to proceed
for 1.5 hour at 30.degree. C.
2--Binding to Streptavidin Plate
[0171] In a 96-well white streptavidin-coated plate (Pierce), the
autocleavage reaction mixture is diluted 5-fold in the assay buffer
(50 mM Hepes, pH 7.5, 30% glycerol, 1 mM TCEP). Following a 1 h
incubation at 23.degree. C., the plate is washed with PBS, 0.05%
Tween-20, 2M guanidine-HCl.
[0172] 3--Binding of Eu.sup.+3-labeled Anti-NS2
[0173] To the 96-well white streptavidin-coated plate.sup.1, is
then added the Eu.sup.+3-labeled anti-NS2 at a final concentration
of 35 nM in PBS, 0.05% Tween-20, 0.3% BSA, 1 .mu.M biotin, 100
.mu.M DTPA. Following a 1 h incubation at 23.degree. C., the plate
is washed with the DELF1A wash buffer (Perkin Elmer Wallac).
Finally, the Enhancement solution (Perkin Elmer Wallac) is added
and the time-resolved fluorescence measured on a Wallac 1420
VICTOR.sup.2 multi-label counter. .sup.1NOTE: Neutravidin plates
can also be used.
Example 10
Homogeneous Time-Resolved Fluorescence Assay
[0174] The NS2/3 protease is labeled with a fluorescent europium
chelate at one end and with a quencher of the europium fluorescence
at the other end (FIG. 11). For example, an europium labeled
anti-NS2 or anti-FLAG.sub.tag antibody is used as the fluorescent
moiety, while the quencher of the europium fluorescence is either
covalently bound to the enzyme or bound to a potent NS3 protease
inhibitor. The enzymatic reaction is initiated by addition of the
cleavage buffer. Upon autocleavage, the europium chelate and the
quencher are separated resulting in an increase in the
time-resolved europium fluorescence signal over time.
Example 11
Fluorescence Polarization Assay
[0175] A fluorescent probe, such as a potent NS3 protease inhibitor
labeled with a fluorescent moiety, is added to a NS2/3 protease
containing solution (FIG. 12). The autocleavage reaction is
initiated by addition of the cleavage buffer. The change in
fluorescence polarization of the probe upon autocleavage is
monitored over time. Alternatively, an immobilized NS2/3 protease
on a nickel-chelating plate may also be used. Following incubation
of the enzyme with the fluorescent probe, the autocleavage reaction
is initiated by addition of the cleavage buffer. After the
appropriate incubation time, the cleavage is monitored by measuring
the change in fluorescence polarization of the probe.
Example 12
Radiometric Assay
[0176] The NS2/3 protease is first immobilized on a
nickel-chelating plate (FIG. 13). The HMK.sub.tag is then
phosphorylated using the protein kinase A and a radiolabeled
substrate. After completion of the phosphorylation reaction, the
plate is washed and the autocleavage reaction initiated by adding
the cleavage buffer. After the appropriate incubation time, the
reaction is quantitated either by measuring the amount of
radiolabeled product released in the assay solution or the amount
of radiolabeled unprocessed NS2/3 protease. Alternatively, the
phosphorylation reaction may be performed first followed by
immobilization on the nickel-chelating plate.
Example 13
NS2/3 Protease Inhibition
[0177] NS2/3 protease cleavage-site derived peptides were evaluated
as potentially competing substrates (Table I). NS2/3 protease
cleavage-site derived peptides and NS4A-derived peptides were
synthesized in-house using the standard solid-phase methodology or
were made by Multiple Peptide Systems (San Diego, Calif.). Various
concentrations of peptides were pre-incubated with 0.54 .mu.M NS2/3
protease for 30 min at 23.degree. C. in 50 mM Hepes, pH 7.0, and
50% (w/v) glycerol. The autocleavage reaction was initiated by
addition of n-dodecyl-.beta.-D-maltoside to a final concentration
of 0.5%. The final DMSO content never exceeded 5% (v/v). The
resulting mixture was then incubated for 3 h at 23.degree. C. The
reaction was stopped and quantified.
[0178] None of the NS2/3 protease cleavage-site derived peptides
were cleaved in trans (data not shown). The peptide spanning
residues P10-P10' of the NS2/3 junction (peptide 1) inhibited the
autocleavage with an IC.sub.50 of 270 .mu.M, whereas the peptide
substrate spanning residues P6-P6' (peptide 4) was less potent with
an IC.sub.50 of 630 .mu.M. Among the corresponding cleavage-site
products, the most active was the peptide SFEGQGWRLL (IC.sub.50=90
.mu.M, SEQ ID NO: 21), the N-terminal product of peptide 1.
TABLE-US-00001 TABLE I Inhibition of NS2/3 Autocleavage by
Peptides.sup.a Peptide # Sequence IC.sub.50 (.mu.M).sup.b NS2/3
protease cleavage site-derived peptides.sup.c 1
SFEGQGWRLL-APITAYSQQT (SEQ ID NO: 22) 270 2 SFEGQGWRLL (SEQ ID NO:
21) 90 3 APITAYSQQT (SEQ ID NO: 23) >1000 4 KGWRLL-APITAY (SEQ
ID NO: 24) 630 5 APITAY (SEQ ID NO: 25) 1000 .sup.aPeptides were
prepared as 20 mM stock solution in DMSO. The final DMSO content
never exceeded 5% (v/v). .sup.bAssay was performed in the presence
of 0.54 .mu.M NS2/3 protease. .sup.cThe hyphen indicates the
cleavage site between P1 and P1' residues.
DISCUSSION
[0179] To date, production of native NS2 alone or linked to NS3 has
been hampered by its hydrophobic nature, only low level expression
being achieved. A N-terminal truncation study has allowed for the
identification of the NS2/3 protease [904-1206] (FIG. 3). This
truncation was expressed at high levels in E. coli upon IPTG
induction (FIGS. 2B and 2C, lane 904) and was active as shown by
the presence of the NS3 protease cleavage product (FIGS. 2A and 2C,
lane 904). However, NS2/3 protease [904-1206] was recovered only in
the insoluble fraction as inclusion bodies. Use of soluble fusion
partners, such as maltose-binding protein and thioredoxin, was
unsuccessful in increasing the solubility of the protease upon
expression (data not shown).
[0180] Maintenance of low concentration of chaotropic agent or
polar additive such as 0.5M arginine-HCl was important to maintain
the 4K-6H-NS2/3 (904-1206)st-4K (FIG. 9B, SEQ ID NO:4) in solution
during the refolding process. Arginine-HCl is a polar additive that
slightly destabilizes proteins in a manner comparable to low
concentration of chaotrophs. It is hypothesized that arginine-HCl
may increase the solubilization of folding intermediates (Lin,
T.-Y. et al. (1996) Protein Sci. 5:372-381.).
[0181] A detergent was also required for refolding to reduce and/or
suppress aggregation upon substituting the denaturing buffer by the
refolding buffer. The detergents LDAO, n-dodecyl-.beta.-D-maltoside
and octyl-POE were evaluated for their ability to promote refolding
of 4K-6H-NS2/3 (904-1206)st-4K at concentrations at or higher than
their respective CMC value of 0.03%, 0.01% and 0.25% (in water). No
refolding was detectable in the presence of octyl-POE. LDAO and
n-dodecyl-.beta.-D-maltoside were found to efficiently refold the
enzyme. However, in addition to its refolding capability,
n-dodecyl-.beta.-D-maltoside was found to induce activation of
4K-6H-NS2/3 (904-1206)st-4K. LDAO was selected since, unexpectedly,
it allowed refolding and reconstitution of the NS3 protease
activity without promoting autocleavage. Finally, the inventors
have found that the presence of a reducing agent, either DTT or
TCEP, was necessary for refolding the enzyme.
[0182] Several cleavage/activation detergents were evaluated for
their ability to promote autocleavage of the 4K-6H-NS2/3
(904-1206)st-4K. Autoprocessing was observed upon addition of CHAPS
in the assay buffer from Example 7 (FIG. 6, lanes 2-5). Similar
autoprocessing was also observed with n-dodecyl-.beta.-D-maltoside,
NP40 and Triton X-100, although 0.5% and 1%
n-dodecyl-.beta.-D-maltoside appeared to be superior. Poor
processing was, however, observed in the presence of octyl-POE
while almost none was observed with LDAO (data not shown). In
addition to the cleavage/activation detergents, glycerol was also
found to promote autocleavage (FIG. 6, lane 1). Interestingly, low
levels of cleavage were observed with 0% glycerol, whereas
substantially enhanced cleavage was observed when both glycerol and
cleavage/activation detergent were added to the assay buffer (FIG.
6, lane 6).
[0183] LDAO, which was used during refolding, inhibited the
autoprocessing, such that the autocleavage reaction could only be
initiated by dilution of the enzyme in the appropriate
cleavage/activation buffer and dilution of the LDAO to a
concentration below about 0.25%.
[0184] The NS2/3 protease's activity was confirmed by SDS-PAGE and
immunoblot analyses (FIG. 7) and by the absence of cleavage
products for the corresponding His952Ala mutant (FIG. 8).
Furthermore, no change in the activity was observed in the presence
of potent NS3 protease inhibitors (data not shown). Finally,
N-terminal sequencing of both cis-cleavage products confirmed that
the cleavage occurred between the residues Leu1026 and Ala1027.
[0185] The cleavage site derived-peptide substrates P10-P10' and
P6-P6' were evaluated as potentially competing substrates. In a
well defined assay system using purified NS2/3 (904-1206) and an
optimized cleavage buffer (containing 50% glycerol and 0.5%
n-dodecyl-.beta.-D-maltoside), the P10-P10' and P6-P6' peptides
inhibited NS2/3 processing with IC.sub.50's of 270 and 630 .mu.M
respectively; yet under identical assay conditions, no
trans-cleavage of the peptides was observed (data not shown). The
results suggest non-productive binding of the peptide substrate at
the active site. Notably, the shorter P10-P1 N-terminal cleavage
product peptide was the best inhibitor with an IC.sub.50 of 90
.mu.M, whereas the corresponding C-terminal product was devoid of
inhibitory activity.
Sequence CWU 1
1
25 1 1230 DNA HCV CDS (1)...(1230) 1 atg gac cgg gag atg gct gca
tcg tgc gga ggc gcg gtt ttc ata ggt 48 Met Asp Arg Glu Met Ala Ala
Ser Cys Gly Gly Ala Val Phe Ile Gly 1 5 10 15 ctt gca ctc ttg acc
ttg tca cca tac tat aaa gtg ctc ctc gct agg 96 Leu Ala Leu Leu Thr
Leu Ser Pro Tyr Tyr Lys Val Leu Leu Ala Arg 20 25 30 ctc ata tgg
tgg tta cag tat tta atc acc aga gtc gag gcg cac ttg 144 Leu Ile Trp
Trp Leu Gln Tyr Leu Ile Thr Arg Val Glu Ala His Leu 35 40 45 caa
gtg tgg atc ccc cct ctc aat gtt cgg gga ggc cgc gat gcc atc 192 Gln
Val Trp Ile Pro Pro Leu Asn Val Arg Gly Gly Arg Asp Ala Ile 50 55
60 atc ctc ctc acg tgc gca gtc cac cca gag cta atc ttt gac atc acc
240 Ile Leu Leu Thr Cys Ala Val His Pro Glu Leu Ile Phe Asp Ile Thr
65 70 75 80 aaa ctc ctg ctc gcc ata ttc ggt ccg ctc atg gtg ctc cag
gca ggc 288 Lys Leu Leu Leu Ala Ile Phe Gly Pro Leu Met Val Leu Gln
Ala Gly 85 90 95 ata acc aaa gtg ccg tac ttc gtg cgt gcg cag ggg
ctc att cgt gcg 336 Ile Thr Lys Val Pro Tyr Phe Val Arg Ala Gln Gly
Leu Ile Arg Ala 100 105 110 tgt atg ttg gtg cgg aag gct gcg ggg ggt
cat tat gtc caa atg gcc 384 Cys Met Leu Val Arg Lys Ala Ala Gly Gly
His Tyr Val Gln Met Ala 115 120 125 ttc atg aag cta gct gcg ctg aca
ggt acg tac gtt tat gac cat ctc 432 Phe Met Lys Leu Ala Ala Leu Thr
Gly Thr Tyr Val Tyr Asp His Leu 130 135 140 act cca ttg cag gat tgg
gcc cac gcg ggc cta cga gac ctt gca gtg 480 Thr Pro Leu Gln Asp Trp
Ala His Ala Gly Leu Arg Asp Leu Ala Val 145 150 155 160 gcg gta gag
ccc gtc atc ttc tct gac atg gag gtc aag atc atc acc 528 Ala Val Glu
Pro Val Ile Phe Ser Asp Met Glu Val Lys Ile Ile Thr 165 170 175 tgg
ggg gcg gac acc gcg gca tgc ggg gac atc att tca ggt ctg ccc 576 Trp
Gly Ala Asp Thr Ala Ala Cys Gly Asp Ile Ile Ser Gly Leu Pro 180 185
190 gtc tcc gct cga agg gga agg gag ata ctc ctg gga ccg gcc gat aat
624 Val Ser Ala Arg Arg Gly Arg Glu Ile Leu Leu Gly Pro Ala Asp Asn
195 200 205 ttt gaa ggg cag ggg tgg cga ctc ctt gcg ccc atc acg gcc
tac tcc 672 Phe Glu Gly Gln Gly Trp Arg Leu Leu Ala Pro Ile Thr Ala
Tyr Ser 210 215 220 caa cag aca cgg ggc cta ctt ggt tgc atc atc acc
agc ctc aca ggc 720 Gln Gln Thr Arg Gly Leu Leu Gly Cys Ile Ile Thr
Ser Leu Thr Gly 225 230 235 240 cgg gac aag aac cag gtc gag ggg gag
gtt caa gtg gtc tcc acc gct 768 Arg Asp Lys Asn Gln Val Glu Gly Glu
Val Gln Val Val Ser Thr Ala 245 250 255 aca caa tct ttc ctg gcg acc
tgc gtc aac ggc gtg tgt tgg act gtc 816 Thr Gln Ser Phe Leu Ala Thr
Cys Val Asn Gly Val Cys Trp Thr Val 260 265 270 ttc cat ggc gcc ggc
tca aag acc ttg gcc ggc ccc aaa ggc cca atc 864 Phe His Gly Ala Gly
Ser Lys Thr Leu Ala Gly Pro Lys Gly Pro Ile 275 280 285 acc cag atg
tac act aat gtg gac cag gac ctc gtc ggc tgg cag gcg 912 Thr Gln Met
Tyr Thr Asn Val Asp Gln Asp Leu Val Gly Trp Gln Ala 290 295 300 ccc
cct ggg gcg cgc tcc atg aca cca tgc acc tgc ggc agc tcg gac 960 Pro
Pro Gly Ala Arg Ser Met Thr Pro Cys Thr Cys Gly Ser Ser Asp 305 310
315 320 ctc tat ttg gtc acg aga cat gcc gac gtc att ccg gtg cgc cgg
cgg 1008 Leu Tyr Leu Val Thr Arg His Ala Asp Val Ile Pro Val Arg
Arg Arg 325 330 335 ggc gac agt agg ggg agc ctg ctc tcc ccc agg cct
gtc tcc tac ttg 1056 Gly Asp Ser Arg Gly Ser Leu Leu Ser Pro Arg
Pro Val Ser Tyr Leu 340 345 350 aag ggc tct tcg ggt ggc cca ctg ctc
tgc cct tcg ggg cac gct gtg 1104 Lys Gly Ser Ser Gly Gly Pro Leu
Leu Cys Pro Ser Gly His Ala Val 355 360 365 ggc atc ttc cgg gct gct
gtg tgc acc cgg ggg gtt gca aaa gcg gtg 1152 Gly Ile Phe Arg Ala
Ala Val Cys Thr Arg Gly Val Ala Lys Ala Val 370 375 380 gac ttc ata
cct gtt gag tct atg gaa act acc atg cgg act agt agc 1200 Asp Phe
Ile Pro Val Glu Ser Met Glu Thr Thr Met Arg Thr Ser Ser 385 390 395
400 gct tgg cgt cac ccg cag ttc ggt ggt taa 1230 Ala Trp Arg His
Pro Gln Phe Gly Gly 405 2 409 PRT HCV 2 Met Asp Arg Glu Met Ala Ala
Ser Cys Gly Gly Ala Val Phe Ile Gly 1 5 10 15 Leu Ala Leu Leu Thr
Leu Ser Pro Tyr Tyr Lys Val Leu Leu Ala Arg 20 25 30 Leu Ile Trp
Trp Leu Gln Tyr Leu Ile Thr Arg Val Glu Ala His Leu 35 40 45 Gln
Val Trp Ile Pro Pro Leu Asn Val Arg Gly Gly Arg Asp Ala Ile 50 55
60 Ile Leu Leu Thr Cys Ala Val His Pro Glu Leu Ile Phe Asp Ile Thr
65 70 75 80 Lys Leu Leu Leu Ala Ile Phe Gly Pro Leu Met Val Leu Gln
Ala Gly 85 90 95 Ile Thr Lys Val Pro Tyr Phe Val Arg Ala Gln Gly
Leu Ile Arg Ala 100 105 110 Cys Met Leu Val Arg Lys Ala Ala Gly Gly
His Tyr Val Gln Met Ala 115 120 125 Phe Met Lys Leu Ala Ala Leu Thr
Gly Thr Tyr Val Tyr Asp His Leu 130 135 140 Thr Pro Leu Gln Asp Trp
Ala His Ala Gly Leu Arg Asp Leu Ala Val 145 150 155 160 Ala Val Glu
Pro Val Ile Phe Ser Asp Met Glu Val Lys Ile Ile Thr 165 170 175 Trp
Gly Ala Asp Thr Ala Ala Cys Gly Asp Ile Ile Ser Gly Leu Pro 180 185
190 Val Ser Ala Arg Arg Gly Arg Glu Ile Leu Leu Gly Pro Ala Asp Asn
195 200 205 Phe Glu Gly Gln Gly Trp Arg Leu Leu Ala Pro Ile Thr Ala
Tyr Ser 210 215 220 Gln Gln Thr Arg Gly Leu Leu Gly Cys Ile Ile Thr
Ser Leu Thr Gly 225 230 235 240 Arg Asp Lys Asn Gln Val Glu Gly Glu
Val Gln Val Val Ser Thr Ala 245 250 255 Thr Gln Ser Phe Leu Ala Thr
Cys Val Asn Gly Val Cys Trp Thr Val 260 265 270 Phe His Gly Ala Gly
Ser Lys Thr Leu Ala Gly Pro Lys Gly Pro Ile 275 280 285 Thr Gln Met
Tyr Thr Asn Val Asp Gln Asp Leu Val Gly Trp Gln Ala 290 295 300 Pro
Pro Gly Ala Arg Ser Met Thr Pro Cys Thr Cys Gly Ser Ser Asp 305 310
315 320 Leu Tyr Leu Val Thr Arg His Ala Asp Val Ile Pro Val Arg Arg
Arg 325 330 335 Gly Asp Ser Arg Gly Ser Leu Leu Ser Pro Arg Pro Val
Ser Tyr Leu 340 345 350 Lys Gly Ser Ser Gly Gly Pro Leu Leu Cys Pro
Ser Gly His Ala Val 355 360 365 Gly Ile Phe Arg Ala Ala Val Cys Thr
Arg Gly Val Ala Lys Ala Val 370 375 380 Asp Phe Ile Pro Val Glu Ser
Met Glu Thr Thr Met Arg Thr Ser Ser 385 390 395 400 Ala Trp Arg His
Pro Gln Phe Gly Gly 405 3 1011 DNA HCV CDS (1)...(1005) 3 atg aaa
aag aaa aag ctc gag cat cac cat cac cat cac act agt gca 48 Met Lys
Lys Lys Lys Leu Glu His His His His His His Thr Ser Ala 1 5 10 15
ggc ata acc aaa gtg ccg tac ttc gtg cgt gcg cag ggg ctc att cgt 96
Gly Ile Thr Lys Val Pro Tyr Phe Val Arg Ala Gln Gly Leu Ile Arg 20
25 30 gcg tgt atg ttg gtg cgg aag gct gcg ggg ggt cat tat gtc caa
atg 144 Ala Cys Met Leu Val Arg Lys Ala Ala Gly Gly His Tyr Val Gln
Met 35 40 45 gcc ttc atg aag cta gct gcg ctg aca ggt acg tac gtt
tat gac cat 192 Ala Phe Met Lys Leu Ala Ala Leu Thr Gly Thr Tyr Val
Tyr Asp His 50 55 60 ctc act cca ttg cag gat tgg gcc cac gcg ggc
cta cga gac ctt gca 240 Leu Thr Pro Leu Gln Asp Trp Ala His Ala Gly
Leu Arg Asp Leu Ala 65 70 75 80 gtg gcg gta gag ccc gtc atc ttc tct
gac atg gag gtc aag atc atc 288 Val Ala Val Glu Pro Val Ile Phe Ser
Asp Met Glu Val Lys Ile Ile 85 90 95 acc tgg ggg gcg gac acc gcg
gca tgc ggg gac atc att tca ggt ctg 336 Thr Trp Gly Ala Asp Thr Ala
Ala Cys Gly Asp Ile Ile Ser Gly Leu 100 105 110 ccc gtc tcc gct cga
agg gga agg gag ata ctc ctg gga ccg gcc gat 384 Pro Val Ser Ala Arg
Arg Gly Arg Glu Ile Leu Leu Gly Pro Ala Asp 115 120 125 aat ttt gaa
ggg cag ggg tgg cga ctc ctt gcg ccc atc acg gcc tac 432 Asn Phe Glu
Gly Gln Gly Trp Arg Leu Leu Ala Pro Ile Thr Ala Tyr 130 135 140 tcc
caa cag aca cgg ggc cta ctt ggt tgc atc atc acc agc ctc aca 480 Ser
Gln Gln Thr Arg Gly Leu Leu Gly Cys Ile Ile Thr Ser Leu Thr 145 150
155 160 ggc cgg gac aag aac cag gtc gag ggg gag gtt caa gtg gtc tcc
acc 528 Gly Arg Asp Lys Asn Gln Val Glu Gly Glu Val Gln Val Val Ser
Thr 165 170 175 gct aca caa tct ttc ctg gcg acc tgc gtc aac ggc gtg
tgt tgg act 576 Ala Thr Gln Ser Phe Leu Ala Thr Cys Val Asn Gly Val
Cys Trp Thr 180 185 190 gtc ttc cat ggc gcc ggc tca aag acc ttg gcc
ggc ccc aaa ggc cca 624 Val Phe His Gly Ala Gly Ser Lys Thr Leu Ala
Gly Pro Lys Gly Pro 195 200 205 atc acc cag atg tac act aat gtg gac
cag gac ctc gtc ggc tgg cag 672 Ile Thr Gln Met Tyr Thr Asn Val Asp
Gln Asp Leu Val Gly Trp Gln 210 215 220 gcg ccc cct ggg gcg cgc tcc
atg aca cca tgc acc tgc ggc agc tcg 720 Ala Pro Pro Gly Ala Arg Ser
Met Thr Pro Cys Thr Cys Gly Ser Ser 225 230 235 240 gac ctc tat ttg
gtc acg aga cat gcc gac gtc att ccg gtg cgc cgg 768 Asp Leu Tyr Leu
Val Thr Arg His Ala Asp Val Ile Pro Val Arg Arg 245 250 255 cgg ggc
gac agt agg ggg agc ctg ctc tcc ccc agg cct gtc tcc tac 816 Arg Gly
Asp Ser Arg Gly Ser Leu Leu Ser Pro Arg Pro Val Ser Tyr 260 265 270
ttg aag ggc tct tcg ggt ggc cca ctg ctc tgc cct tcg ggg cac gct 864
Leu Lys Gly Ser Ser Gly Gly Pro Leu Leu Cys Pro Ser Gly His Ala 275
280 285 gtg ggc atc ttc cgg gct gct gtg tgc acc cgg ggg gtt gca aaa
gcg 912 Val Gly Ile Phe Arg Ala Ala Val Cys Thr Arg Gly Val Ala Lys
Ala 290 295 300 gtg gac ttc ata cct gtt gag tct atg gaa act acc atg
cgg act agt 960 Val Asp Phe Ile Pro Val Glu Ser Met Glu Thr Thr Met
Arg Thr Ser 305 310 315 320 agc gct tgg cgt cac ccg cag ttc ggt ggt
aaa aag aaa aag taa 1005 Ser Ala Trp Arg His Pro Gln Phe Gly Gly
Lys Lys Lys Lys * 325 330 ggatcc 1011 4 334 PRT HCV 4 Met Lys Lys
Lys Lys Leu Glu His His His His His His Thr Ser Ala 1 5 10 15 Gly
Ile Thr Lys Val Pro Tyr Phe Val Arg Ala Gln Gly Leu Ile Arg 20 25
30 Ala Cys Met Leu Val Arg Lys Ala Ala Gly Gly His Tyr Val Gln Met
35 40 45 Ala Phe Met Lys Leu Ala Ala Leu Thr Gly Thr Tyr Val Tyr
Asp His 50 55 60 Leu Thr Pro Leu Gln Asp Trp Ala His Ala Gly Leu
Arg Asp Leu Ala 65 70 75 80 Val Ala Val Glu Pro Val Ile Phe Ser Asp
Met Glu Val Lys Ile Ile 85 90 95 Thr Trp Gly Ala Asp Thr Ala Ala
Cys Gly Asp Ile Ile Ser Gly Leu 100 105 110 Pro Val Ser Ala Arg Arg
Gly Arg Glu Ile Leu Leu Gly Pro Ala Asp 115 120 125 Asn Phe Glu Gly
Gln Gly Trp Arg Leu Leu Ala Pro Ile Thr Ala Tyr 130 135 140 Ser Gln
Gln Thr Arg Gly Leu Leu Gly Cys Ile Ile Thr Ser Leu Thr 145 150 155
160 Gly Arg Asp Lys Asn Gln Val Glu Gly Glu Val Gln Val Val Ser Thr
165 170 175 Ala Thr Gln Ser Phe Leu Ala Thr Cys Val Asn Gly Val Cys
Trp Thr 180 185 190 Val Phe His Gly Ala Gly Ser Lys Thr Leu Ala Gly
Pro Lys Gly Pro 195 200 205 Ile Thr Gln Met Tyr Thr Asn Val Asp Gln
Asp Leu Val Gly Trp Gln 210 215 220 Ala Pro Pro Gly Ala Arg Ser Met
Thr Pro Cys Thr Cys Gly Ser Ser 225 230 235 240 Asp Leu Tyr Leu Val
Thr Arg His Ala Asp Val Ile Pro Val Arg Arg 245 250 255 Arg Gly Asp
Ser Arg Gly Ser Leu Leu Ser Pro Arg Pro Val Ser Tyr 260 265 270 Leu
Lys Gly Ser Ser Gly Gly Pro Leu Leu Cys Pro Ser Gly His Ala 275 280
285 Val Gly Ile Phe Arg Ala Ala Val Cys Thr Arg Gly Val Ala Lys Ala
290 295 300 Val Asp Phe Ile Pro Val Glu Ser Met Glu Thr Thr Met Arg
Thr Ser 305 310 315 320 Ser Ala Trp Arg His Pro Gln Phe Gly Gly Lys
Lys Lys Lys 325 330 5 20 DNA HCV 5 ccatggaccg ggagatggct 20 6 63
DNA HCV 6 ggatccttaa ccaccgaact gcgggtgacg ccaagcgcta ctagtccgca
tggtagtttc 60 cat 63 7 46 DNA HCV 7 gctcgagcat caccatcacc
atcacactag tgcaggcata accaaa 46 8 45 DNA HCV 8 aacaatggat
ccttactttt tctttttacc accgaactgc gggtg 45 9 45 DNA HCV 9 acctgccata
tgaaaaagaa aaagctcgag catcaccatc accat 45 10 303 PRT HCV 10 Ala Gly
Ile Thr Lys Val Pro Tyr Phe Val Arg Ala Gln Gly Leu Ile 1 5 10 15
Arg Ala Cys Met Leu Val Arg Lys Ala Ala Gly Gly His Tyr Val Gln 20
25 30 Met Ala Phe Met Lys Leu Ala Ala Leu Thr Gly Thr Tyr Val Tyr
Asp 35 40 45 His Leu Thr Pro Leu Gln Asp Trp Ala His Ala Gly Leu
Arg Asp Leu 50 55 60 Ala Val Ala Val Glu Pro Val Ile Phe Ser Asp
Met Glu Val Lys Ile 65 70 75 80 Ile Thr Trp Gly Ala Asp Thr Ala Ala
Cys Gly Asp Ile Ile Ser Gly 85 90 95 Leu Pro Val Ser Ala Arg Arg
Gly Arg Glu Ile Leu Leu Gly Pro Ala 100 105 110 Asp Asn Phe Glu Gly
Gln Gly Trp Arg Leu Leu Ala Pro Ile Thr Ala 115 120 125 Tyr Ser Gln
Gln Thr Arg Gly Leu Leu Gly Cys Ile Ile Thr Ser Leu 130 135 140 Thr
Gly Arg Asp Lys Asn Gln Val Glu Gly Glu Val Gln Val Val Ser 145 150
155 160 Thr Ala Thr Gln Ser Phe Leu Ala Thr Cys Val Asn Gly Val Cys
Trp 165 170 175 Thr Val Phe His Gly Ala Gly Ser Lys Thr Leu Ala Gly
Pro Lys Gly 180 185 190 Pro Ile Thr Gln Met Tyr Thr Asn Val Asp Gln
Asp Leu Val Gly Trp 195 200 205 Gln Ala Pro Pro Gly Ala Arg Ser Met
Thr Pro Cys Thr Cys Gly Ser 210 215 220 Ser Asp Leu Tyr Leu Val Thr
Arg His Ala Asp Val Ile Pro Val Arg 225 230 235 240 Arg Arg Gly Asp
Ser Arg Gly Ser Leu Leu Ser Pro Arg Pro Val Ser 245 250 255 Tyr Leu
Lys Gly Ser Ser Gly Gly Pro Leu Leu Cys Pro Ser Gly His 260 265 270
Ala Val Gly Ile Phe Arg Ala Ala Val Cys Thr Arg Gly Val Ala Lys 275
280 285 Ala Val Asp Phe Ile Pro Val Glu Ser Met Glu Thr Thr Met Arg
290 295 300 11 393 PRT HCV 11 Met Ala Ala Ser Cys Gly Gly Ala Val
Phe Ile Gly Leu Ala Leu Leu 1 5 10 15 Thr Leu Ser Pro Tyr Tyr Lys
Val Leu Leu Ala Arg Leu Ile Trp Trp 20 25 30 Leu Gln Tyr Leu Ile
Thr Arg Val Glu Ala His Leu Gln Val Trp Ile 35 40 45 Pro Pro Leu
Asn Val Arg Gly Gly Arg Asp Ala Ile Ile Leu Leu Thr 50 55 60 Cys
Ala Val His Pro Glu Leu Ile Phe Asp Ile Thr Lys Leu Leu Leu 65 70
75 80 Ala Ile Phe Gly Pro Leu Met Val Leu Gln Ala Gly Ile Thr Lys
Val 85 90 95 Pro Tyr Phe Val Arg Ala Gln Gly Leu Ile Arg Ala Cys
Met Leu Val 100 105
110 Arg Lys Ala Ala Gly Gly His Tyr Val Gln Met Ala Phe Met Lys Leu
115 120 125 Ala Ala Leu Thr Gly Thr Tyr Val Tyr Asp His Leu Thr Pro
Leu Gln 130 135 140 Asp Trp Ala His Ala Gly Leu Arg Asp Leu Ala Val
Ala Val Glu Pro 145 150 155 160 Val Ile Phe Ser Asp Met Glu Val Lys
Ile Ile Thr Trp Gly Ala Asp 165 170 175 Thr Ala Ala Cys Gly Asp Ile
Ile Ser Gly Leu Pro Val Ser Ala Arg 180 185 190 Arg Gly Arg Glu Ile
Leu Leu Gly Pro Ala Asp Asn Phe Glu Gly Gln 195 200 205 Gly Trp Arg
Leu Leu Ala Pro Ile Thr Ala Tyr Ser Gln Gln Thr Arg 210 215 220 Gly
Leu Leu Gly Cys Ile Ile Thr Ser Leu Thr Gly Arg Asp Lys Asn 225 230
235 240 Gln Val Glu Gly Glu Val Gln Val Val Ser Thr Ala Thr Gln Ser
Phe 245 250 255 Leu Ala Thr Cys Val Asn Gly Val Cys Trp Thr Val Phe
His Gly Ala 260 265 270 Gly Ser Lys Thr Leu Ala Gly Pro Lys Gly Pro
Ile Thr Gln Met Tyr 275 280 285 Thr Asn Val Asp Gln Asp Leu Val Gly
Trp Gln Ala Pro Pro Gly Ala 290 295 300 Arg Ser Met Thr Pro Cys Thr
Cys Gly Ser Ser Asp Leu Tyr Leu Val 305 310 315 320 Thr Arg His Ala
Asp Val Ile Pro Val Arg Arg Arg Gly Asp Ser Arg 325 330 335 Gly Ser
Leu Leu Ser Pro Arg Pro Val Ser Tyr Leu Lys Gly Ser Ser 340 345 350
Gly Gly Pro Leu Leu Cys Pro Ser Gly His Ala Val Gly Ile Phe Arg 355
360 365 Ala Ala Val Cys Thr Arg Gly Val Ala Lys Ala Val Asp Phe Ile
Pro 370 375 380 Val Glu Ser Met Glu Thr Thr Met Arg 385 390 12 380
PRT HCV 12 Ala Leu Leu Thr Leu Ser Pro Tyr Tyr Lys Val Leu Leu Ala
Arg Leu 1 5 10 15 Ile Trp Trp Leu Gln Tyr Leu Ile Thr Arg Val Glu
Ala His Leu Gln 20 25 30 Val Trp Ile Pro Pro Leu Asn Val Arg Gly
Gly Arg Asp Ala Ile Ile 35 40 45 Leu Leu Thr Cys Ala Val His Pro
Glu Leu Ile Phe Asp Ile Thr Lys 50 55 60 Leu Leu Leu Ala Ile Phe
Gly Pro Leu Met Val Leu Gln Ala Gly Ile 65 70 75 80 Thr Lys Val Pro
Tyr Phe Val Arg Ala Gln Gly Leu Ile Arg Ala Cys 85 90 95 Met Leu
Val Arg Lys Ala Ala Gly Gly His Tyr Val Gln Met Ala Phe 100 105 110
Met Lys Leu Ala Ala Leu Thr Gly Thr Tyr Val Tyr Asp His Leu Thr 115
120 125 Pro Leu Gln Asp Trp Ala His Ala Gly Leu Arg Asp Leu Ala Val
Ala 130 135 140 Val Glu Pro Val Ile Phe Ser Asp Met Glu Val Lys Ile
Ile Thr Trp 145 150 155 160 Gly Ala Asp Thr Ala Ala Cys Gly Asp Ile
Ile Ser Gly Leu Pro Val 165 170 175 Ser Ala Arg Arg Gly Arg Glu Ile
Leu Leu Gly Pro Ala Asp Asn Phe 180 185 190 Glu Gly Gln Gly Trp Arg
Leu Leu Ala Pro Ile Thr Ala Tyr Ser Gln 195 200 205 Gln Thr Arg Gly
Leu Leu Gly Cys Ile Ile Thr Ser Leu Thr Gly Arg 210 215 220 Asp Lys
Asn Gln Val Glu Gly Glu Val Gln Val Val Ser Thr Ala Thr 225 230 235
240 Gln Ser Phe Leu Ala Thr Cys Val Asn Gly Val Cys Trp Thr Val Phe
245 250 255 His Gly Ala Gly Ser Lys Thr Leu Ala Gly Pro Lys Gly Pro
Ile Thr 260 265 270 Gln Met Tyr Thr Asn Val Asp Gln Asp Leu Val Gly
Trp Gln Ala Pro 275 280 285 Pro Gly Ala Arg Ser Met Thr Pro Cys Thr
Cys Gly Ser Ser Asp Leu 290 295 300 Tyr Leu Val Thr Arg His Ala Asp
Val Ile Pro Val Arg Arg Arg Gly 305 310 315 320 Asp Ser Arg Gly Ser
Leu Leu Ser Pro Arg Pro Val Ser Tyr Leu Lys 325 330 335 Gly Ser Ser
Gly Gly Pro Leu Leu Cys Pro Ser Gly His Ala Val Gly 340 345 350 Ile
Phe Arg Ala Ala Val Cys Thr Arg Gly Val Ala Lys Ala Val Asp 355 360
365 Phe Ile Pro Val Glu Ser Met Glu Thr Thr Met Arg 370 375 380 13
352 PRT HCV 13 Ala His Leu Gln Val Trp Ile Pro Pro Leu Asn Val Arg
Gly Gly Arg 1 5 10 15 Asp Ala Ile Ile Leu Leu Thr Cys Ala Val His
Pro Glu Leu Ile Phe 20 25 30 Asp Ile Thr Lys Leu Leu Leu Ala Ile
Phe Gly Pro Leu Met Val Leu 35 40 45 Gln Ala Gly Ile Thr Lys Val
Pro Tyr Phe Val Arg Ala Gln Gly Leu 50 55 60 Ile Arg Ala Cys Met
Leu Val Arg Lys Ala Ala Gly Gly His Tyr Val 65 70 75 80 Gln Met Ala
Phe Met Lys Leu Ala Ala Leu Thr Gly Thr Tyr Val Tyr 85 90 95 Asp
His Leu Thr Pro Leu Gln Asp Trp Ala His Ala Gly Leu Arg Asp 100 105
110 Leu Ala Val Ala Val Glu Pro Val Ile Phe Ser Asp Met Glu Val Lys
115 120 125 Ile Ile Thr Trp Gly Ala Asp Thr Ala Ala Cys Gly Asp Ile
Ile Ser 130 135 140 Gly Leu Pro Val Ser Ala Arg Arg Gly Arg Glu Ile
Leu Leu Gly Pro 145 150 155 160 Ala Asp Asn Phe Glu Gly Gln Gly Trp
Arg Leu Leu Ala Pro Ile Thr 165 170 175 Ala Tyr Ser Gln Gln Thr Arg
Gly Leu Leu Gly Cys Ile Ile Thr Ser 180 185 190 Leu Thr Gly Arg Asp
Lys Asn Gln Val Glu Gly Glu Val Gln Val Val 195 200 205 Ser Thr Ala
Thr Gln Ser Phe Leu Ala Thr Cys Val Asn Gly Val Cys 210 215 220 Trp
Thr Val Phe His Gly Ala Gly Ser Lys Thr Leu Ala Gly Pro Lys 225 230
235 240 Gly Pro Ile Thr Gln Met Tyr Thr Asn Val Asp Gln Asp Leu Val
Gly 245 250 255 Trp Gln Ala Pro Pro Gly Ala Arg Ser Met Thr Pro Cys
Thr Cys Gly 260 265 270 Ser Ser Asp Leu Tyr Leu Val Thr Arg His Ala
Asp Val Ile Pro Val 275 280 285 Arg Arg Arg Gly Asp Ser Arg Gly Ser
Leu Leu Ser Pro Arg Pro Val 290 295 300 Ser Tyr Leu Lys Gly Ser Ser
Gly Gly Pro Leu Leu Cys Pro Ser Gly 305 310 315 320 His Ala Val Gly
Ile Phe Arg Ala Ala Val Cys Thr Arg Gly Val Ala 325 330 335 Lys Ala
Val Asp Phe Ile Pro Val Glu Ser Met Glu Thr Thr Met Arg 340 345 350
14 341 PRT HCV 14 Val Arg Gly Gly Arg Asp Ala Ile Ile Leu Leu Thr
Cys Ala Val His 1 5 10 15 Pro Glu Leu Ile Phe Asp Ile Thr Lys Leu
Leu Leu Ala Ile Phe Gly 20 25 30 Pro Leu Met Val Leu Gln Ala Gly
Ile Thr Lys Val Pro Tyr Phe Val 35 40 45 Arg Ala Gln Gly Leu Ile
Arg Ala Cys Met Leu Val Arg Lys Ala Ala 50 55 60 Gly Gly His Tyr
Val Gln Met Ala Phe Met Lys Leu Ala Ala Leu Thr 65 70 75 80 Gly Thr
Tyr Val Tyr Asp His Leu Thr Pro Leu Gln Asp Trp Ala His 85 90 95
Ala Gly Leu Arg Asp Leu Ala Val Ala Val Glu Pro Val Ile Phe Ser 100
105 110 Asp Met Glu Val Lys Ile Ile Thr Trp Gly Ala Asp Thr Ala Ala
Cys 115 120 125 Gly Asp Ile Ile Ser Gly Leu Pro Val Ser Ala Arg Arg
Gly Arg Glu 130 135 140 Ile Leu Leu Gly Pro Ala Asp Asn Phe Glu Gly
Gln Gly Trp Arg Leu 145 150 155 160 Leu Ala Pro Ile Thr Ala Tyr Ser
Gln Gln Thr Arg Gly Leu Leu Gly 165 170 175 Cys Ile Ile Thr Ser Leu
Thr Gly Arg Asp Lys Asn Gln Val Glu Gly 180 185 190 Glu Val Gln Val
Val Ser Thr Ala Thr Gln Ser Phe Leu Ala Thr Cys 195 200 205 Val Asn
Gly Val Cys Trp Thr Val Phe His Gly Ala Gly Ser Lys Thr 210 215 220
Leu Ala Gly Pro Lys Gly Pro Ile Thr Gln Met Tyr Thr Asn Val Asp 225
230 235 240 Gln Asp Leu Val Gly Trp Gln Ala Pro Pro Gly Ala Arg Ser
Met Thr 245 250 255 Pro Cys Thr Cys Gly Ser Ser Asp Leu Tyr Leu Val
Thr Arg His Ala 260 265 270 Asp Val Ile Pro Val Arg Arg Arg Gly Asp
Ser Arg Gly Ser Leu Leu 275 280 285 Ser Pro Arg Pro Val Ser Tyr Leu
Lys Gly Ser Ser Gly Gly Pro Leu 290 295 300 Leu Cys Pro Ser Gly His
Ala Val Gly Ile Phe Arg Ala Ala Val Cys 305 310 315 320 Thr Arg Gly
Val Ala Lys Ala Val Asp Phe Ile Pro Val Glu Ser Met 325 330 335 Glu
Thr Thr Met Arg 340 15 292 PRT HCV 15 Ala Gln Gly Leu Ile Arg Ala
Cys Met Leu Val Arg Lys Ala Ala Gly 1 5 10 15 Gly His Tyr Val Gln
Met Ala Phe Met Lys Leu Ala Ala Leu Thr Gly 20 25 30 Thr Tyr Val
Tyr Asp His Leu Thr Pro Leu Gln Asp Trp Ala His Ala 35 40 45 Gly
Leu Arg Asp Leu Ala Val Ala Val Glu Pro Val Ile Phe Ser Asp 50 55
60 Met Glu Val Lys Ile Ile Thr Trp Gly Ala Asp Thr Ala Ala Cys Gly
65 70 75 80 Asp Ile Ile Ser Gly Leu Pro Val Ser Ala Arg Arg Gly Arg
Glu Ile 85 90 95 Leu Leu Gly Pro Ala Asp Asn Phe Glu Gly Gln Gly
Trp Arg Leu Leu 100 105 110 Ala Pro Ile Thr Ala Tyr Ser Gln Gln Thr
Arg Gly Leu Leu Gly Cys 115 120 125 Ile Ile Thr Ser Leu Thr Gly Arg
Asp Lys Asn Gln Val Glu Gly Glu 130 135 140 Val Gln Val Val Ser Thr
Ala Thr Gln Ser Phe Leu Ala Thr Cys Val 145 150 155 160 Asn Gly Val
Cys Trp Thr Val Phe His Gly Ala Gly Ser Lys Thr Leu 165 170 175 Ala
Gly Pro Lys Gly Pro Ile Thr Gln Met Tyr Thr Asn Val Asp Gln 180 185
190 Asp Leu Val Gly Trp Gln Ala Pro Pro Gly Ala Arg Ser Met Thr Pro
195 200 205 Cys Thr Cys Gly Ser Ser Asp Leu Tyr Leu Val Thr Arg His
Ala Asp 210 215 220 Val Ile Pro Val Arg Arg Arg Gly Asp Ser Arg Gly
Ser Leu Leu Ser 225 230 235 240 Pro Arg Pro Val Ser Tyr Leu Lys Gly
Ser Ser Gly Gly Pro Leu Leu 245 250 255 Cys Pro Ser Gly His Ala Val
Gly Ile Phe Arg Ala Ala Val Cys Thr 260 265 270 Arg Gly Val Ala Lys
Ala Val Asp Phe Ile Pro Val Glu Ser Met Glu 275 280 285 Thr Thr Met
Arg 290 16 303 PRT HCV 16 Ala Gly Ile Thr Lys Val Pro Tyr Phe Val
Arg Ala Gln Gly Leu Ile 1 5 10 15 Arg Ala Cys Met Leu Val Arg Lys
Ala Ala Gly Gly His Tyr Val Gln 20 25 30 Met Ala Phe Met Lys Leu
Ala Ala Leu Thr Gly Thr Tyr Val Tyr Asp 35 40 45 Ala Leu Thr Pro
Leu Gln Asp Trp Ala His Ala Gly Leu Arg Asp Leu 50 55 60 Ala Val
Ala Val Glu Pro Val Ile Phe Ser Asp Met Glu Val Lys Ile 65 70 75 80
Ile Thr Trp Gly Ala Asp Thr Ala Ala Cys Gly Asp Ile Ile Ser Gly 85
90 95 Leu Pro Val Ser Ala Arg Arg Gly Arg Glu Ile Leu Leu Gly Pro
Ala 100 105 110 Asp Asn Phe Glu Gly Gln Gly Trp Arg Leu Leu Ala Pro
Ile Thr Ala 115 120 125 Tyr Ser Gln Gln Thr Arg Gly Leu Leu Gly Cys
Ile Ile Thr Ser Leu 130 135 140 Thr Gly Arg Asp Lys Asn Gln Val Glu
Gly Glu Val Gln Val Val Ser 145 150 155 160 Thr Ala Thr Gln Ser Phe
Leu Ala Thr Cys Val Asn Gly Val Cys Trp 165 170 175 Thr Val Phe His
Gly Ala Gly Ser Lys Thr Leu Ala Gly Pro Lys Gly 180 185 190 Pro Ile
Thr Gln Met Tyr Thr Asn Val Asp Gln Asp Leu Val Gly Trp 195 200 205
Gln Ala Pro Pro Gly Ala Arg Ser Met Thr Pro Cys Thr Cys Gly Ser 210
215 220 Ser Asp Leu Tyr Leu Val Thr Arg His Ala Asp Val Ile Pro Val
Arg 225 230 235 240 Arg Arg Gly Asp Ser Arg Gly Ser Leu Leu Ser Pro
Arg Pro Val Ser 245 250 255 Tyr Leu Lys Gly Ser Ser Gly Gly Pro Leu
Leu Cys Pro Ser Gly His 260 265 270 Ala Val Gly Ile Phe Arg Ala Ala
Val Cys Thr Arg Gly Val Ala Lys 275 280 285 Ala Val Asp Phe Ile Pro
Val Glu Ser Met Glu Thr Thr Met Arg 290 295 300 17 301 PRT HCV 17
Ala Gly Ile Thr Lys Val Pro Tyr Phe Val Arg Ala Gln Gly Leu Ile 1 5
10 15 Arg Ala Cys Met Leu Val Arg Lys Ala Ala Gly Gly His Tyr Val
Gln 20 25 30 Met Ala Phe Met Lys Leu Ala Ala Leu Thr Gly Thr Tyr
Val Tyr Asp 35 40 45 His Leu Thr Pro Leu Gln Asp Trp Ala His Ala
Gly Leu Arg Asp Leu 50 55 60 Ala Val Ala Val Glu Pro Val Ile Phe
Ser Asp Met Glu Val Lys Ile 65 70 75 80 Ile Thr Trp Gly Ala Asp Thr
Ala Ala Cys Gly Asp Ile Ile Ser Gly 85 90 95 Leu Pro Val Ser Ala
Arg Arg Gly Arg Glu Ile Leu Leu Gly Pro Ala 100 105 110 Asp Asn Phe
Glu Gly Gln Gly Trp Arg Leu Pro Ile Thr Ala Tyr Ser 115 120 125 Gln
Gln Thr Arg Gly Leu Leu Gly Cys Ile Ile Thr Ser Leu Thr Gly 130 135
140 Arg Asp Lys Asn Gln Val Glu Gly Glu Val Gln Val Val Ser Thr Ala
145 150 155 160 Thr Gln Ser Phe Leu Ala Thr Cys Val Asn Gly Val Cys
Trp Thr Val 165 170 175 Phe His Gly Ala Gly Ser Lys Thr Leu Ala Gly
Pro Lys Gly Pro Ile 180 185 190 Thr Gln Met Tyr Thr Asn Val Asp Gln
Asp Leu Val Gly Trp Gln Ala 195 200 205 Pro Pro Gly Ala Arg Ser Met
Thr Pro Cys Thr Cys Gly Ser Ser Asp 210 215 220 Leu Tyr Leu Val Thr
Arg His Ala Asp Val Ile Pro Val Arg Arg Arg 225 230 235 240 Gly Asp
Ser Arg Gly Ser Leu Leu Ser Pro Arg Pro Val Ser Tyr Leu 245 250 255
Lys Gly Ser Ser Gly Gly Pro Leu Leu Cys Pro Ser Gly His Ala Val 260
265 270 Gly Ile Phe Arg Ala Ala Val Cys Thr Arg Gly Val Ala Lys Ala
Val 275 280 285 Asp Phe Ile Pro Val Glu Ser Met Glu Thr Thr Met Arg
290 295 300 18 303 PRT HCV 18 Ala Gly Ile Thr Lys Val Pro Tyr Phe
Val Arg Ala Gln Gly Leu Ile 1 5 10 15 Arg Ala Cys Met Leu Val Arg
Lys Ala Ala Gly Gly His Tyr Val Gln 20 25 30 Met Ala Phe Met Lys
Leu Ala Ala Leu Thr Gly Thr Tyr Val Tyr Asp 35 40 45 His Leu Thr
Pro Leu Gln Asp Trp Ala His Ala Gly Leu Arg Asp Leu 50 55 60 Ala
Val Ala Val Glu Pro Val Ile Phe Ser Asp Met Glu Val Lys Ile 65 70
75 80 Ile Thr Trp Gly Ala Asp Thr Ala Ala Ala Gly Asp Ile Ile Ser
Gly 85 90 95 Leu Pro Val Ser Ala Arg Arg Gly Arg Glu Ile Leu Leu
Gly Pro Ala 100 105 110 Asp Asn Phe Glu Gly Gln Gly Trp Arg Leu Leu
Ala Pro Ile Thr Ala 115 120 125 Tyr Ser Gln Gln Thr Arg Gly Leu Leu
Gly Cys Ile Ile Thr Ser Leu 130 135 140 Thr Gly Arg Asp Lys Asn Gln
Val Glu Gly Glu Val Gln Val Val Ser 145 150 155 160 Thr Ala Thr Gln
Ser Phe Leu Ala Thr Cys Val Asn Gly Val Cys Trp 165 170 175 Thr Val
Phe His Gly Ala Gly Ser Lys Thr Leu Ala Gly Pro Lys Gly 180
185 190 Pro Ile Thr Gln Met Tyr Thr Asn Val Asp Gln Asp Leu Val Gly
Trp 195 200 205 Gln Ala Pro Pro Gly Ala Arg Ser Met Thr Pro Cys Thr
Cys Gly Ser 210 215 220 Ser Asp Leu Tyr Leu Val Thr Arg His Ala Asp
Val Ile Pro Val Arg 225 230 235 240 Arg Arg Gly Asp Ser Arg Gly Ser
Leu Leu Ser Pro Arg Pro Val Ser 245 250 255 Tyr Leu Lys Gly Ser Ser
Gly Gly Pro Leu Leu Cys Pro Ser Gly His 260 265 270 Ala Val Gly Ile
Phe Arg Ala Ala Val Cys Thr Arg Gly Val Ala Lys 275 280 285 Ala Val
Asp Phe Ile Pro Val Glu Ser Met Glu Thr Thr Met Arg 290 295 300 19
11 PRT HCV VARIANT (1)...(1) Asp labeled with anthranilyl VARIANT
(6)...(6) Xaa at position 6 is Abu VARIANT (6)...(7) Abu-A between
6 and 7 is C(O)-O VARIANT (9)...(9) Tyr at position 9 is
derivatized with 3-NO2 19 Asp Asp Ile Val Pro Xaa Ala Met Tyr Thr
Trp 1 5 10 20 6 PRT HCV VARIANT (1)...(1) Asp labeled with
anthranilyl VARIANT (6)...(6) Xaa at position 6 is Abu 20 Asp Asp
Ile Val Pro Xaa 1 5 21 10 PRT HCV 21 Ser Phe Glu Gly Gln Gly Trp
Arg Leu Leu 1 5 10 22 20 PRT HCV 22 Ser Phe Glu Gly Gln Gly Trp Arg
Leu Leu Ala Pro Ile Thr Ala Tyr 1 5 10 15 Ser Gln Gln Thr 20 23 10
PRT HCV 23 Ala Pro Ile Thr Ala Tyr Ser Gln Gln Thr 1 5 10 24 12 PRT
HCV 24 Lys Gly Trp Arg Leu Leu Ala Pro Ile Thr Ala Tyr 1 5 10 25 6
PRT HCV 25 Ala Pro Ile Thr Ala Tyr 1 5
* * * * *