U.S. patent application number 10/938405 was filed with the patent office on 2007-07-26 for methods and compositions for identifying and characterizing hepatitis c.
Invention is credited to Carol Holland-Staley.
Application Number | 20070172926 10/938405 |
Document ID | / |
Family ID | 28041784 |
Filed Date | 2007-07-26 |
United States Patent
Application |
20070172926 |
Kind Code |
A1 |
Holland-Staley; Carol |
July 26, 2007 |
Methods and compositions for identifying and characterizing
hepatitis C
Abstract
The invention provides novel methods and compositions for
amplifying portions of the HCV genome. The nucleic acid sequences
set forth as SEQ ID NOS:1-64 derived from HCV cDNA and functional
equivalents thereof, kits containing same, and methods employing
same, are useful for the identification and characterization of HCV
in biological samples.
Inventors: |
Holland-Staley; Carol;
(Troy, MI) |
Correspondence
Address: |
FOLEY HOAG, LLP;PATENT GROUP, WORLD TRADE CENTER WEST
155 SEAPORT BLVD
BOSTON
MA
02110
US
|
Family ID: |
28041784 |
Appl. No.: |
10/938405 |
Filed: |
September 9, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/US03/07585 |
Mar 11, 2003 |
|
|
|
10938405 |
Sep 9, 2004 |
|
|
|
60363603 |
Mar 11, 2002 |
|
|
|
Current U.S.
Class: |
435/91.1 ;
435/5 |
Current CPC
Class: |
C12Q 1/707 20130101 |
Class at
Publication: |
435/091.1 ;
435/006 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 19/34 20060101 C12P019/34 |
Claims
1. A nucleic acid molecule selected from the group consisting of
SEQ ID NOS:1-64.
2. A nucleic acid molecule having a nucleotide sequence comprising
a sequence selected from the group consisting of SEQ ID NOS:1-64,
wherein the oligonucleotide is capable of annealing to the NS3 or
NS4 gene of HCV, or a portion thereof.
3. A nucleic acid molecule comprising a nucleotide sequence which
is at least 80% identical to a nucleotide sequence selected from
the group consisting of SEQ ID NOS:1-64.
4. A nucleic acid molecule comprising a fragment of at least 8
nucleotides of a nucleic acid molecule having a nucleotide sequence
selected from the group consisting of SEQ ID NOS:1-64.
5. A set of primers selected from the group consisting of two or
more oligonucleotides of SEQ ID NOS:1-64.
6. A vector comprising a nucleic acid molecule of claims 1-4.
7. The nucleic acid molecule of claims 1-4, further comprising a
label.
8. The oligonucleotides of claim 5, further comprising a label.
9. The nucleic acid molecule of claim 7, wherein the label is
selected from the group consisting of a fluorescent group,
digoxigenin, biotin, radioactive labels, chemiluminescent groups,
enzymes, antibodies, luminescent agents, precipitating agents, and
dyes.
10. The oligonucleotides of claim 8, wherein the label is selected
from the group consisting of a fluorescent group, digoxigenin
biotin, radioactive labels, chemiluminescent groups, enzymes,
antibodies, luminescent agents, precipitating agents, and dyes.
11. A nucleic acid molecule encoding a promoter-primer comprising a
sequence selected from the group consisting of SEQ ID NOS:1-64, and
a promoter sequence at the 5' end.
12. An oligonucleotide for amplifying a nucleic acid sequence in a
sample, wherein the sample contains a nucleotide sequence selected
from the group consisting of SEQ ID NOS:1-64, or complement
thereof.
13. The oligonucleotide of claim 12, wherein the sample is from a
patient infected with HCV.
14. A kit for the detection of HCV, comprising an oligonucleotide,
wherein the oligonucleotide comprises a nucleotide sequence which
is at least 80% identical to a nucleotide sequence selected from
the group consisting of SEQ ID NOS:1-64.
15. A kit for the detection of HCV, comprising a set of
oligonucleotides, wherein the oligonucleotides comprise a
nucleotide sequence which is at least 80% identical to a nucleotide
sequence selected from the group consisting of SEQ ID NOS:1-64.
16. The kit of claim 14 or 15, further comprising at least one
labeled oligonucleotide for detecting amplified HCV nucleic
acid.
17. The kit of claim 14 or 15, wherein said kit further comprises a
component selected from the group consisting of a plurality of
nucleotides and a nucleic acid polymerase.
18. The kit of claim 17, wherein said kit further comprises at
least one other component for conducting a polymerase amplification
reaction.
19. The kit of claim 18, wherein said kit comprises a thermostable
DNA polymerase.
20. The kit of claim 14 or 15, further comprising instructions for
use.
21. A method for amplifying a target nucleic acid, the method
comprising: combining a target nucleic acid under conditions which
allow for an amplification reaction to occur with: a) one or more
nucleic acid primer sequences which are at least 80% identical to
the sequences set forth as SEQ ID NOS:1-64; b) a nucleic acid
polymerase; and c) a plurality of nucleotides, thereby resulting in
an amplified target nucleic acid.
22. The method of claim 21, wherein the target nucleic acid is from
the HCV genome.
23. The method of claim 22, wherein the target nucleic acid is from
the NS3 or NS4 gene.
24. The method of claim 22, wherein the target nucleic acid is from
the serine protease portion of the NS3 gene.
25. The method of claim 22, wherein the target nucleic acid is from
the helicase portion of the NS3 gene.
26. The method of claim 21, wherein said polymerase is selected
from the group consisting of reverse transcriptase and thermostable
DNA polymerase.
27. The method of claim 21, wherein the amplified HCV nucleic acid
is sequenced.
28. The method of claim 27, wherein the sequence is evaluated for
mutations.
29. The method of claim 21, wherein the amplified HCV nucleic acid
is cloned into a vector.
30. The vector of claim 29.
31. A method for specifically detecting HCV nucleic acids in a
sample comprising: a) contacting said sample with one or more
nucleic acid sequences which are at least 80% identical to the
sequences set forth as SEQ ID NOS:1-64, under conditions such that
said HCV nucleic acids can hybridize with said primers; b) reverse
transcribing and amplifying said nucleic acids to obtain amplified
HCV nucleic acids; and c) detecting the presence of said amplified
HCV nucleic acids.
32. The method of claim 31, wherein detecting the presence of said
amplified HCV nucleic acids comprises: a) contacting said amplified
HCV nucleic acids with a labeled oligonucleotide to obtain labeled
HCV nucleic acids; and b) identifying said labeled nucleic
acids.
33. The method of claim 31, wherein amplifying said nucleic acids
is accomplished by nucleic acid sequence based amplification
(NASBA), a polymerase chain reaction (PCR), Transcription Mediated
Amplification (TMA) or Ligase chain reaction.
34. The method of claim 31, further comprising the step of
sequencing the amplified HCV nucleic acids.
35. The method of claim 34, further comprising evaluating the
sequence for mutations.
36. A method for determining whether a patient is resistant to an
agent, the method comprising: a) obtaining a sample from a patient
comprising DNA; b) performing amplification PCR on the DNA from the
patient sample using a nucleic acid primer sequence which is at
least 80% identical to a nucleotide sequence selected from the
group consisting of SEQ ID NOS:1-64; and c) analyzing the amplified
product, thereby determining whether a patient is resistant to an
agent.
37. The method of claim 36, wherein the agent is an antiviral
agent.
38. The method of claim 36, wherein the agent is a protease
inhibitor.
39. The method of claim 36, wherein the agent is an inhibitor of
the serine protease portion of the NS3 gene.
40. The method of claim 36, wherein the agent is an inhibitor of
the helicase portion of the NS3 gene.
41. The method of claim 36, wherein the agent is
alpha-interferon.
42. The method of claim 36, wherein the agent is pegalated
interferon.
43. The method of claim 36, wherein the agent is a combination of
agents.
44. A method for determining whether an agent can or can not be
used to treat an HCV patient, the method comprising the steps of:
a) obtaining a sample from a patient infected with HCV; b)
amplifying the patient sample using a nucleic acid primer sequence
which is at least 80% identical to a nucleotide sequence selected
from the group consisting of SEQ ID NOS:1-64; c) sequencing the
resulting amplified HCV nucleic acid sequences; and d) identifying
mutations in the amplified HCV nucleic acid sequence that correlate
with resistance or sensitivity to an anti-viral agent, thereby
determining whether an agent can or can not be used to treat an HCV
patient.
45. The method of claim 44, wherein the nucleic acid is a set of
primers.
46. A method for determining whether treatment with an agent should
be continued in a patient infected with HCV, the method comprising:
(a) obtaining two or more samples comprising DNA from a patient
during the course of treatment; (b) performing the method of claim
21 on the samples; (c) sequencing the resulting amplified target
nucleic acid product of claim 21; (d) identifying mutations present
in the amplified product that correlate with resistance or
sensitivity to an agent; and (e) continuing treatment when the
mutations identified in the amplified product do not change during
the course of treatment.
47. A method for determining whether treatment with an agent should
not be continued in a patient infected with HCV, the method
comprising: (a) obtaining two or more samples comprising DNA from a
patient during the course of treatment; (b) performing the method
of claim 21 on the samples; (b) sequencing the resulting amplified
target nucleic acid product of claim 21; (c) identifying mutations
present in the amplified product that correlate with resistance or
sensitivity to an agent; and (d) discontinuing treatment when the
mutations identified in the amplified product change during the
course of treatment.
48. A method for evaluating a patient diagnosed as or suspected of
having HCV to assess whether anti-viral therapy is likely to be
successfuil, the method comprising: (a) obtaining a sample from the
patient containing DNA, and (b) comparing the serine protease
portions of the NS3 gene in the sample with a consensus subtype
sequence, wherein the presence of one or more mutations is
indicative of resistance to the anti-viral agent.
49. A method for evaluating a patient diagnosed as or suspected of
having HCV to assess whether anti-viral therapy is likely to be
successful, the method comprising: (a) obtaining a sample from the
patient containing DNA, and (b) comparing the helicase portions of
NS3 gene to a consensus subtype sequence, wherein the presence of
one or more mutations is indicative of resistance to the anti-viral
agent.
50. A method of assessing the efficacy of an agent for treating
HCV, the method comprising comparing: a) nucleic acid sequences in
a first sample obtained from a patient exposed to an agent, wherein
the nucleic acid sequences are amplified products from one or more
nucleic acid primer sequences which are at least 80% identical to
the sequences set forth as SEQ ID NOS:1-64, and b) nucleic acid
sequences in a second sample obtained from a patient who has not
been exposed to an agent, wherein the nucleic acid sequences are
amplified products from one or more nucleic acid primer sequences
which are at least 80% identical to the sequences set forth as SEQ
ID NOS:1-64, wherein an increased number of mutations in the
nucleic acid sequences from the first sample, relative to the
second sample, is an indication that the agent is not efficacious
in treating HCV.
Description
RELATED APPLICATIONS
[0001] The present application claims priority to PCT Application
No. PCT/US03/07585 filed on Mar. 11, 2003 which claims priority to
U.S. Provisional Application Ser. No. 60/363603 filed on Mar. 11,
2002, which is herein incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] The Hepatitis C virus (HCV) is the major etiologic agent for
non-A, non-B hepatitis. It is estimated that around 400 million
people or >2% of the world's population are infected (Di
Bisceglie, A. M. (1998) Hepatitis C. Lancet 351:351-5; Houghton M.
(1996), p. 1035-1058. In B. N. Fields and D. M. Knipe and H. P. M.
(ed.), Fields' Virology, 3rd ed. Lippincott-Raven, Philadelphia/New
York). HCV usually results in a chronic infection in 60 to 80% of
infected individuals with 20% having progression to cirrhosis,
hepatocellular carcinoma or chronic liver failure. At least 6 major
viral genotypes and over 50 proposed subtypes of HCV have been
identified worldwide (Simmonds, P. et al. (1994) Identification of
genotypes of hepatitis C virus by sequence comparisons in the core,
E1 and NS-5 regions. J Gen Virol 75:1053-1061).
[0003] These genotypes are based on nucleotide and amino acid
sequence diversity with the most divergent isolates differing by
more than 30% (Brechot, C. (1996) Hepatitis C virus: Molecular
biology and genetic variability. Digestive Diseases and Sciences
41:6S-21S; Bukh, J. et al. (1995) Genetic heterogeneity of
hepatitis C virus: quasispecies and genotypes. Semin Liver Dis
15:41-63). Among the different types, there are regions which are
highly conserved and have sequence homology close to 100%, however,
in highly variable regions such as the envelope proteins homology
is <70% (Booth, J. C. et al. (1998) Comparison of the rate of
sequence variation in the hypervariable region of E2/NS1 region of
hepatitis C virus in normal and hypogammaglobulinemic patients.
Hepatology 27:223-27; Hayashi, N. et al. (1993) Molecular cloning
and heterogeneity of the human hepatitis C virus (HCV) genome. J
Hepatol 17:S94-107; Hijikata, M. et al. (1991) Hypervariable
regions in the putative glycoprotein of hepatitis C virus. Biochem
Biophys Res Commun 175:220-228; Kato, N. et al. (1992) Marked
sequence diversity in the putative envelope proteins of hepatitis C
viruses. Virus Res 22:107-123; Lesniewski, R. R. et al. (1993)
Hypervariable 5'-terminus of hepatitis C virus E2/NS1 encodes
antigenically distinct variants. J Med Virol 40:150-156; Pozzetto,
B. et al. (1996) Structure, genomic organization, replication and
variability of hepatitis C virus. Nephrol Dial Transplant 11 [Suppl
4]:2-5; Vizmanos, J. L. et al. (1998) Degree and distribution of
variability in the 5' untranslated, E1, E2/NS1 and NS5 regions of
the hepatitis C virus (HCV). J Viral Hepat 5:227-240).
[0004] HCV is a member of the Flaviviridae family whose other
members include the Flaviviruses and Pestiviruses (Kato, N. et al.
(1991) Molecular structure of the Japanese hepatitis C viral
genome. FEBS Lett 280:325-328). The HCV genome is a
positive-stranded RNA of .about.9.5 kb which contains a single open
reading frame encoding a polyprotein of 3010 to 3033 amino acids
(Takamizawa, A. et al. (1991) Structure and organization of the
hepatitis C virus genome isolated from human carriers. J Virol
65:1105-1113). Proteolytic processing of the polyprotein is
accomplished by host and viral proteases. Host signal peptidases
cleave the structural proteins which are located in the 5' end,
while two viral proteases cleave the non-structural proteins. These
cleavages result in at least 10 viral proteins in the order
NH.sub.2-C-E1-E2-p7-NS2-NS3-NS4A-NS4B-NS5A-NS5B-COOH. There are
also non-coding regions located at the 5' and 3' ends which are
involved in ribosome binding and replication initiation,
respectively.
[0005] One of the viral proteases, the NS3 protease, is encoded by
the N-terminal region of the HCV-NS3 gene. It consists of 181 amino
acids and is a chymotrypsin-like serine-protease responsible for
cleavage of the non-structural proteins of HCV (Bartenschlager, R.
et al. (1993) Nonstructural protein 3 of the hepatitis C virus
encodes a serine-type proteinase required for cleavage at the NS3/4
and NS4/5 junctions. J Virol 67:3835-3844; Eckart, M. R. et al.
(1993) The hepatitis C virus encodes a serine protease involved in
processing of the putative nonstructural proteins from the viral
polyprotein precursor. Biochem Biophys Res Commun 192:399-406;
Gallinari, P. et al. (1998) Multiple enzymatic activities
associated with recombinant NS3 protein of hepatitis C virus. J
Virol 72:6758-6769; Hahm, B. et al. (1995) NS3-4A of hepatitis C
virus is a chymotrypsin-like protease. J Virol 69:2534-2539;
Hijikata, M. et al. (1993) Two distinct proteinase activities
required for the processing of a putative nonstructural precursor
protein of hepatitis C virus. J Virol 67:4665-4675; Hijikata, M. et
al. (1993) Proteolytic processing and membrane association of
putative nonstructural proteins of hepatitis C virus. Proc Natl
Acad Sci USA. 90:10773-10777; Manabe, S. et al. (1994) Production
of nonstructural proteins of hepatitis C virus requires a putative
viral protease encoded by NS3. Virology 198:636-644; Tomei, L. et
al. (1993) NS3 is a serine protease required for processing of
hepatitis C virus polyprotein. J Virol 67:4017-4026). Processing of
the structural proteins by NS3 occurs in a well ordered cascade
with the first cleavage occurring between NS3 and NS4A followed by
NS5A-NS5B, NS4A-NS4B and NS4B-NS5A (Bartenschlager, R. et al.
(1994) Kinetic and structural analysis of hepatitis C virus
polyprotein processing. J Virol 68:5045-5055; D'Souza, E. D. et al.
(1994) Analysis of NS3-mediated processing of the hepatitis C virus
non-structural region in vitro. J Gen Virol 75:3469-3476; Eckart M.
R., et al., 1993, supra; Failla, C. et al. (1994) Both NS3 and NS4A
are required for proteolytic processing of hepatitis C virus
nonstructural proteins. J Virol 68:3753-3760; Kolykhalov, A. A. et
al. (1994) Specificity of the hepatitis C virus NS3 serine
protease: effects of substitutions at the 3/4A, 4A/4B, 4B/5A, and
5A/5B cleavage sites on polyprotein processing. J Virol
68:7525-7533; Shimotohno, K. et al. (1995) Processing of the
hepatitis C virus precursor protein. J Hepatol 22:87-92; Shoji, I.
et al. 1999 Internal processing of hepatitis C virus NS3 protein.
Virology 254:315-323; Tomei, L. et al., 1993, supra). The cleavage
between NS3 and NS4A occurs in cis, while the other cleavages are
in trans. The virus-encoded cofactor, NS4A is necessary for
efficient NS3 fluction. Proteolytic processing efficiency has been
shown to increase dramatically in the presence of the NS4A protein
(Failla, C. et al. (1995) An amino-terminal domain of the hepatitis
C virus NS3 proteinase is essential for the interaction with NS4A.
J Virol 69:1769-1777; Failla, 1994, supra; Gallinari, P. et al.
1999 Modulation of hepatitis C virus NS3 protease and helicase
activities through the interaction with NS4A. Biochemistry
38:5620-5632; Lin, C. et al. (1995) A central region in the
hepatitis C virus NS4A protein allows formation of an active
NS3-NS4A serine proteinase complex in vivo and in vitro. J Virol
69:4373-4380; Satoh, S. et al. (1995) The N-terminal region of
hepatitis C virus nonstructural protein 3 (NS3) is essential for
stable complex formation with NS4A. J Virol 69:4255-4260; Tanji, Y.
et al. (1995) Hepatitis C virus-encoded nonstructural protein NS4A
has versatile finctions in viral protein processing. J Virol
69:1575-1581). In addition, NS3 contains a tetrahedrally bound zinc
atom, which appears to play a structural role (De Francesco, R. et
al. (1996) A zinc binding site in viral serine proteinases.
Biochemistry 35:13282-13287; Stempniak, M. et al. (1997) The NS3
proteinase domain of hepatitis C virus is a zinc-containing enzyme.
J Virol 71:2881-2886).
[0006] Recently, considerable progress has been made in determining
how the NS3 protease processes the HCV polypeptide (Kolykhalov, A.
A. et al., 1994 supra; Steinkuhler, C. et al. (1996) Activity of
purified hepatitis C virus protease NS3 on peptide substrates. J
Virol 70:6694-6700; Urbani, A. et al. (1997) Substrate specificity
of the hepatitis C virus serine protease NS3. J Biol Chem
272:9204-9209). Models for how the protease interacts with
cofactors and the substrate have identified four domains, which are
involved in enzyme function Barbato, G. et al. 1999. The solution
structure of the N-terminal proteinase domain of the hepatitis C
virus (HCV) NS3 protein provides new insights into its activation
and catalytic mechanism. J Mol Biol 289:371-384). These are the
catalytic triad, cofactor and metal binding sites and the
substrate-binding pocket. These domains are well defined and
contain amino acid residues that are highly conserved in all HCV
protease genes sequenced to date (See FIG. 1 in Holland-Staley, C.
A., et al. (2002) Genetic diversity and response to IFN of the NS3
protease gene from clinical strains of the hepatitis C virus. Arch
Virol 147:1385-1406, which is incorporated herein by reference).
Despite this recent burst of structural information and studies
showing direct involvement and conservation of amino acid residues,
the impact of natural sequence variability on enzyme function is
not well understood. In addition, the effects of anti-viral therapy
on the NS3 protease sequence are unknown. Elucidation of the
natural genetic diversity of the HCV NS3 protease in patient
samples is of significant medical as well as theoretical interest.
Though all HCV NS3 proteases sequenced to date contain conserved
active-site amino acids, sequence variation throughout the NS3 gene
is significant (Martell, M. et al. (1992) Hepatitis C virus (HCV)
circulates as a population of different but closely related
genomes:quasispecies nature of HCV distribution. J Virol.
66:3225-32; Okamoto, H. et al. (1992) Genetic drift of hepatitis C
virus during an 8.2-year infection in a chimpanzee: variability and
stability. Virology 190:894-899; Okamoto, H. et al. (1992) supra).
Also, the presence of multiple species within the same patient,
known as quasispecies, creates a potential problem for drug
development and resistance. Understanding the extent of NS3
sequence variation in clinical strains will allow more effective
development of drugs targeting the HCV protease. For this, data
must be available that describes sequence variability as it occurs
in HCV-infected persons.
[0007] Helicases are enzymes that are responsible for unwinding
DNA/DNA, RNA/DNA and RNA/RNA duplexes in a 3'-to-5' direction.
(Bartenschlager, R. et al., 1993, supra; Hahm B., et al., 1995,
supra; Tomei, et al., 1993, supra). In addition, helicase enzymes
have been proposed to play roles in viral replication and
recombination, viral control of host cellular finctions, mRNA
stability including splicing or processing, transcription,
transport, and translation initiation of RNA (Luking, et al. (1998)
The protein family of RNA helicases. Crit. Rev. Biochem. Mol.Biol.
33:259-296). The HCV NS3 helicase/NTPase contains 450 amino acids.
The NTPase component hydrolyzes nucleoside 5'-triphosphates,
providing the energy requirements. The helicase/NTPase, along with
the NS3 protease and NS5b RNA-dependent polymerase, are believed to
make up a large complex, which is responsible for viral RNA
replication. Recently, considerable progress has been made in
determining the structure of the HCV NS3 helicase and its mechanism
of duplex unwinding. At least three different crystal structures
have been published (Paolini, Cho et al., 1998, supra; Kim et al.,
1998, supra; and Yao et al. 1997, supra). In all three, the enzyme
was shown to contain 3 domains, with domains 1 and 2 being
structurally similar. The enzyme contains seven motifs, including
two motifs which are involved in NTP-binding and hydrolysis (motif
I [GxGKS] and motif II [DExH]) and one that is involved in ATP
hydrolysis and RNA unwinding (motif VI). Most of the motifs are
located between the structural domains 1 and 2, with domain 3
separated from the other two by the binding of the nucleotide.
Investigators have identified highly conserved residues within each
motif. These motifs, along with comparison analysis to other
helicases, reveal it to be a member of the DEAD-box family of RNA
helicases, specifically the DExH subfamily. Magnesium is required
for both the helicase and NTPase activities.
[0008] The only FDA approved therapy for hepatitis C infection is
interferon (IFN) or pegalated-interferon with or without ribaviron.
Interferon production has been shown to be induced after infections
with bacteria, parasites and viruses as well as in response to
tumors. Interferons are secreted proteins in the cytokine family,
which indirectly inhibit the viral life cycle by binding to
cellular receptors, thus inducing protein synthesis (Hijikata, M.
et al. (1993) Proteolytic processing and membrane association of
putative nonstructural proteins of hepatitis C virus. Proc Natl
Acad Sci USA. 90:10773-10777). Interferon inducible genes contain a
promoter region, termed the IFN-stimulated response element (ISRE).
Over 30 genes are induced by interferon, however, the function of
most of these genes is unknown (Holmes, E. C. et al. (2000) The
causes and consequences of genetic variation in dengue virus.
Trends Microbiol 8:74-77).
[0009] Recently it has been suggested that a short stretch of 40
amino acids in the HCV NS5A gene play a role in IFN resistance,
however, while this appears true for some Japanese isolates other
investigators have conflicting data. The effects of interferon
therapy on the other structural genes is unknown.
SUMMARY OF THE INVENTION
[0010] The present invention is based, at least in part, on the
discovery of novel, isolated nucleic acid sequences for amplifying
and sequencing portions of the HCV genome. The present invention
provides novel sequences and methods of using same, which
consistently amplify the HCV genome. The nucleic acid sequences of
the present invention are useful as reagents for detecting and
identifying viral sequences in biological samples and enable the
further characterization of the HCV genome. The methods described
herein, the nucleic acid sequences set forth as SEQ ID NOS:1-64 and
functional equivalents thereof, as well as the kits containing
them, are useful for accurately determining the presence of HCV in
biological samples, as well as the specific sequence of a portion
of the HCV genome. The nucleic acid sequences and methods of the
present invention may be useful for: (i) detecting HCV infection,
including early stage detection; (ii) identification of the type of
HCV infection; (iii) detection of variant strains of HCV including
heterogenicity in a patient; (iv) detection of a mutation in the
HCV nucleic acid that is responsible for resistance or sensitivity
to a therapy; (v) detection of new mutations in the HCV genome that
are correlated with resistance or sensitivity to a drug therapy;
(vi) determining whether treatment with an agent, e.g., an
anti-viral agent, will be effective; (vii) determining whether
treatment with an agent, e.g., an anti-viral agent, should or
should not be continued; (viii) identification of the interaction
between HCV and other viruses and/or diseases; (ix) generating a
nucleic acid, e.g., DNA, vaccine, which may be patient specific;
and (x) development of new drugs, e.g., based on x-ray
crystallography.
[0011] The present invention features novel, isolated primer
sequences from the HCV genome set forth herein as SEQ ID NOS:1-64
(Tables 1A-1G). Sequences which correspond to the HCV 1a and 1b
subtypes are set forth as SEQ ID NOS:1-23 and SEQ ID NO:64 (Tables
1A and 1G); sequences which correspond to the HCV 2a subtype are
set forth as SEQ ID NOS:24-27 (Table 1B); sequences which
correspond to the HCV 2b subtype are set forth as SEQ ID NOS:28-42
(Table 1C); sequences which correspond to the HCV 3a subtype are
set forth as SEQ ID NOS:43-46 (Table 1D); sequences which
correspond to the HCV 3b subtype are set forth as SEQ ID NOS:47-50
(Table 1E); and sequences which correspond to the HCV 4a subtype
are set forth as SEQ ID NOS:51-63 (Table 1F).
[0012] In one embodiment, the present invention features an
oligonucleotide selected from the group consisting of SEQ ID
NOS:1-64. In another embodiment, the oligonucleotides of the
invention are at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%,
89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more
identical to the nucleotide sequences set forth in SEQ ID NOS:1-64.
In yet another embodiment, the oligonucleotides of SEQ ID NOS:1-64
are at least 4, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or
more nucleotides in length. It will be appreciated that the 5' end
may contain greater variability (e.g., nucleic acid substitutions),
yet remain finctional (e.g., able to anneal to the NS3 and NS4
portion of the HCV genome). In another embodiment, the invention
provides a combination of one or more oligonucleotides of the
present invention. In yet another embodiment, the invention
provides a set of oligonucleotides, also referred to herein as
"primers" and "nucleic acid primer sequences," selected from the
group consisting of two or more of the oligonucleotides of the
present invention. In still another embodiment, the invention
provides oligonucleotides which are able to amplify a patient
sample having a nucleotide sequence selected from the group
consisting of SEQ ID NOS:1-64, or complement thereof. In one aspect
of the invention, the oligonucleotides of the present invention
comprise a label for detection. Such labels may be, e.g.,
radioactive labels which may be incorporated by known methods
(e.g., nick translation or kinasing), radioactive isotopes, biotin,
fluorescent groups, chemiluminescent groups (e.g., dioxetanes,
particularly triggered dioxetanes), digoxigenin, enzymes,
antibodies, luminescent agents, precipitating agents, dyes,
combinations thereof, and the like. Another aspect of the invention
comprises a vector comprising an oligonucleotide of the present
invention.
[0013] In yet another embodiment, the invention provides an
oligonucleotide for amplifying a nucleic acid sequence in a sample,
wherein the sample contains a nucleotide sequence selected from the
group consisting of SEQ ID NOS:1-64, or the complement thereof. In
one aspect of the invention, the sample is from a patient infected
with HCV.
[0014] In another embodiment, the invention provides a nucleic acid
sequence, wherein the nucleic acid sequence is a promoter-primer
comprising an oligonucleotide of the present invention, wherein a
5' portion of the sequence includes a promoter sequence.
[0015] The amplified HCV nucleic acid sequences generated from the
methods set forth herein may be cloned into a host vector with an
expression promoter and used as a DNA vaccine to amplify a
patient's response to the HCV virus, thereby providing a
patient-specific DNA vaccine to HCV. In another aspect of the
invention, the clone may be used to generate RNA for use as an
antisense vaccine.
[0016] It will be appreciated that a sample used in the methods of
the present invention may be a biological sample, e.g., from a
patient infected with HCV. Such samples may include, without
limitation, blood, plasma, serum, spinal fluid, lymph fluid, the
external sections of the skin, respiratory, intestinal, and
genitourinary tracts, tears, saliva, milk, urine, blood cells,
tumors, organs, genomic DNA, RNA, or cDNA in solution or bound to a
substrate, and also samples of in vitro cell culture constituents
including, but not limited to, conditioned medium resulting from
the growth of cells in cell culture medium, putatively virally
infected cells, recombinant cells, and cell components, e.g.,
chromosome(s), organelles, paraffin embedded tissue, or membranes
isolated from a cell.
[0017] In one embodiment of the invention, the serine protease
portion of the HCV NS3 gene is analyzed. This can be accomplished
by amplifying and sequencing the serine protease portion of the
gene with the compositions and methods of the present invention.
When a primer pair is employed as sequencing primers, either or
both of the members of the pair may be suitably labeled, e.g.,
radioactive labels which may be incorporated by known methods
(e.g., nick translation or kinasing), radioactive isotopes, biotin,
fluorescent groups, chemiluminescent groups (e.g., dioxetanes,
particularly triggered dioxetanes), digoxigenin, enzymes,
antibodies, luminescent agents, precipitating agents, dyes,
combinations thereof, and the like.
[0018] In another embodiment of the invention, the helicase portion
of the HCV NS3 gene is analyzed. This can be accomplished by
amplifying and sequencing the helicase portion of the gene with the
compositions and methods of the present invention. When a primer
pair is employed as sequencing primers, either or both of the
members of the pair may be suitably labeled, e.g., radioactive
labels which may be incorporated by known methods (e.g., nick
translation or kinasing), radioactive isotopes, biotin, fluorescent
groups, chemiluminescent groups (e.g., dioxetanes, particularly
triggered dioxetanes), digoxigenin, enzymes, antibodies,
luminescent agents, precipitating agents, dyes, combinations
thereof, and the like.
[0019] Primer combinations, for example, including at least one
forward and one reverse primer, which together can be used for
amplification and/or sequencing of a relevant portion of the HCV
genome, e.g., the NS3 or NS4 gene, may be suitably packaged in a
kit. Nested pairs of amplification and sequencing primers are
preferred. In one embodiment, the invention provides a kit for the
detection of HCV, comprising one or more oligonucleotide of the
present invention. In another embodiment, the kit comprises a set
of primers selected from the group consisting of the
oligonucleotides of the present invention. The primers in such kits
may be labeled or unlabeled. The kit may also include additional
reagents such as reagents for performing a polymerase chain
reaction (PCR), a reverse transcriptase for conversion of the HCV
RNA to cDNA for amplification, DNA polymerases, dNTP and ddNTP
feedstocks. The kit may also include instructions for use.
[0020] The present invention also features novel methods for
amplifying a target nucleic acid, e.g., specific regions of the HCV
genome of a patient, such as NS3 and NS4 genes of the HCV genome,
using the oligonucleotides of the present invention. The novel
methods of the present invention may be used for, for example: (i)
detecting HCV infection, including early stage detection; (ii)
identification of the type of HCV infection; (iii) detection of
variant strains of HCV including heterogenicity in a singe patient;
(iv) detection of a mutation in the HCV nucleic acid that is
responsible for resistance or sensitivity to a therapy; (v)
detection of new mutations in the HCV genome that are correlated
with resistance or sensitivity to a therapy; (vi) determining
whether treatment with an agent, e.g., an anti-viral agent, will be
effective; (vii) determining whether treatment with an agent, e.g.,
an anti-viral agent, should or should not be continued; (viii)
identification of the interaction between HCV and other viruses
and/or diseases; (ix) generating a nucleic acid, e.g., DNA,
vaccine, which may be patient specific; and (x) development of new
drugs, e.g., based on x-ray crystallography. This analysis may be
performed by direct sequencing, or using other techniques for
characterization of sequence polymorphisms, including but not
limited to, hybridization with sequence-specific oligonucleotide
probes.
[0021] Accordingly, in one embodiment, the invention provides
methods for amplifying a target nucleic acid, e.g., portions of the
NS3 or NS4 gene, by combining a target nucleic acid under
conditions which allow for an amplification reaction to occur with
one or more nucleic acid primer sequences of the present invention
and other necessary amplification agents such as a nucleic acid
polymerase and a plurality of nucleotides. In one aspect of the
present invention, the amplification of a target nucleic acid
sequence results in an increased amount of the amplified target
nucleic acid. In yet another aspect of the invention, the target
nucleic acid sequence is from the HCV genome, e.g., the NS3 or NS4A
gene. In other aspects of the invention, the target nucleic acid is
the serine protease portion of the NS3 gene. In still other aspects
of the invention, the target nucleic acid is the helicase portion
of the NS3 gene. In another aspect of the invention, a nucleic acid
polymerase is used and may be selected from the group consisting of
reverse transcriptase and thermostable DNA polymerase. In other
embodiments of the invention, the amplified HCV nucleic acid is
sequenced. In yet another aspect of the invention, the sequence is
evaluated for mutations.
[0022] In another embodiment of the present invention, a method for
detecting and characterizing HCV nucleic acids in a sample is
provided by contacting the sample with one or more nucleic acid
primer sequences of the present invention under conditions such
that the HCV nucleic acids can hybridize with the primers of the
invention, reverse transcribing and amplifying the nucleic acids to
obtain amplified HCV nucleic acids, and detecting the presence of
the amplified HCV nucleic acids. The amplified HCV nucleic acids
may be fuirther characterized by, for example, sequencing the
amplified nucleic acids. In one aspect of the invention, the
detection of the presence of the amplified HCV nucleic acids
comprises contacting the amplified HCV nucleic acids with a labeled
oligonucleotide to obtain labeled HCV nucleic acids and identifying
the labeled nucleic acids. In still other aspects of the invention,
the amplification of the nucleic acids may be accomplished by
nucleic acid sequence-based amplification (NASBA), Transcription
Mediated Amplification (TMA), polymerase chain reaction (PCR),
other target amplification methods, signal amplification methods or
probe amplification methods such as Ligase chain reaction. In yet
another aspect of the invention, the methods further comprise the
step of sequencing the amplified HCV nucleic acids. In still
another embodiment, the methods further comprise evaluating the
sequence for mutations.
[0023] Once sequenced, mutations in the HCV genome may be
identified by comparing the sequence with a known or a control
sequence, e.g., a consensus sequence. Thus, the present invention
provides compositions and methods for identifying particular
mutations in the HCV genome. With the knowledge of a particular
mutation in the HCV genome from a patient sample, appropriate
therapy or combination therapy for the patient may be identified
and administered. For example, the methods of the present invention
may be used to determine a particular treatment regimen depending
on the genotype of HCV that has infected the patient. In another
embodiment, the invention provides compositions and methods for
determining whether a patient is sensitive or resistant to an agent
by obtaining a sample from a patient comprising DNA, performing
amplification, e.g., PCR, on the DNA from the patient sample using
a nucleic acid primer sequence of the present invention, and
analyzing the amplified product, for example, by sequencing, to
identify particular mutations. In still other aspects of the
invention, the agent may be an antiviral agent, such as a protease
inhibitor, an inhibitor of the serine protease portion of the NS3
gene, an inhibitor of the helicase portion of the NS3 gene,
alpha-interferon, ribavirin, pegylated interferon, or a combination
thereof.
[0024] Because the primer sequences of the present invention were
derived from conserved regions of the HCV genome, the compositions
and methods described herein will aid in the detection and/or
identification of variant strains of HCV. This, in turn, will lead
to the development of additional immunological agents for the
detection and diagnosis of HCV, as well as the development of
additional polynucleotide agents for the detection and or treatment
of HCV.
[0025] In yet another embodiment, the invention provides a method
for determining whether an agent can or can not be used to treat an
HCV patient by obtaining a sample from a patient infected with HCV,
amplifying the patient sample using the nucleic acid primer
sequences of the present invention, sequencing the resulting
amplified HCV nucleic acid sequences, and identifying mutations in
the amplified HCV nucleic acid sequence that correlate with
resistance or sensitivity to an agent, thereby determining whether
the agent can or can not be used to treat an HCV patient. In one
aspect of the invention, the nucleic acid sequences are a set of
primers.
[0026] In another embodiment, the invention provides a method for
determining whether treatment with an agent should be continued in
a patient infected with HCV, the method comprising obtaining two or
more samples comprising DNA from a patient during the course of
treatment, amplifying and sequencing a target nucleic acid sequence
from the sample using the nucleic acid primer sequences of the
present invention in the methods described herein, identifying
mutations present in the amplified nucleic acid sequence that
correlate with resistance or sensitivity to an agent, and
continuing treatment when the mutations identified in the amplified
product do not change during the course of treatment.
[0027] In still another embodiment, the invention provides a method
for determining whether treatment with an agent should not be
continued in a patient infected with HCV, the method comprising
obtaining two or more samples comprising DNA from a patient during
the course of treatment, amplifying and sequencing the target
nucleic acid sequences from the samples using the nucleic acid
primer sequences of the present invention in the methods described
herein, identifying mutations present in the amplified nucleic acid
sequence that correlate with resistance or sensitivity to an agent,
and discontinuing treatment when the mutations identified in the
amplified product change, e.g., an increase in the number of
mutations during the course of treatment is an indicator of
resistance to an agent.
[0028] The Specific Examples set forth below also establish a
correlation between HCV type, particularly as determined by
analysis of the NS3 gene, and the likelihood that the virus will be
responsive to anti-viral therapy, e.g., alpha-IFN therapy. Thus, a
further aspect of the invention is a method for evaluating a
patient diagnosed as or suspected of having an HCV infection to
assess whether therapy, e.g., alpha-IFN therapy, is likely to be
successful, comprising the steps of obtaining a sample from the
patient containing DNA, comparing the serine protease portion of
the NS3 gene and/or the helicase portion of the NS3 gene, to
consensus subtype sequences, wherein the presence of one or more
mutations is indicative of resistance to the therapy. It will be
appreciated that this same methodology may be used to determine
whether the virus (and thus the patient), will be sensitive or
resistant to other anti-viral agents such as a protease inhibitor,
an inhibitor of the serine protease portion of the NS3 gene, and an
inhibitor of the helicase portion of the NS3 gene.
[0029] In another embodiment, the invention features a method of
assessing the efficacy of an agent for treating HCV, the method
comprising comparing nucleic acid sequences in a first sample
obtained from a patient exposed to an agent, wherein the nucleic
acid sequences are amplified products from one or more nucleic acid
primer sequences of the present invention, and nucleic acid
sequences in a second sample obtained from a patient who has not
been exposed to an agent, wherein the nucleic acid sequences are
amplified products from one or more nucleic acid primer sequences
of the present invention, wherein an increased number of mutations
in the nucleic acid sequences from the first sample, relative to
the second sample, is an indication that the agent is not
efficacious in treating HCV.
[0030] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of chemistry,
molecular biology, microbiology, recombinant DNA, and immunology,
which are within the skill of the art. Such techniques are
explained fully in the literature. (See e.g., Maniatis, Fitsch
& Sambrook, Molecular Cloning; A Laboratory Manual (1982); DNA
Cloning, Volumes I and II (D. N Glover ed. 1985); Oligonucleotide
Sunthesis (M. J. Gait ed, 1984); Nucleic Acid Hybridization (B. D.
Hames & S. J. Higgins eds. 1984); the series, Methods in
Enzymology (Academic Press, Inc.), particularly Vol. 154 and Vol.
155 (Wu and Grossman, and Wu, eds., respectively)). All patents,
patent applications, and publications mentioned herein, both supra
and infra, are hereby incorporated herein by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1 depicts the results of a nested PCR reaction of
Hepatitis C virus NS3 protease from 7 patient samples. The NS3
product is 2746 bp. The DNA MW ladder is in lane 1.
[0032] FIGS. 2A-2B depict phylogenetic trees constructed from 30
HCV NS3 protease strains using Parsimony Analysis and
Neighbor-joining. FIG. 2A depicts a consensus tree of the parsimony
analysis, while FIG. 2B depicts a bootstrap tree from the
Neighbor-joining analysis.
DETAILED DESCRIPTION OF THE INVENTION
[0033] The term "agent" includes any known substance intended to
treat an infection or disease, in particular, agents known to treat
viral infections. The term "agent" is further intended to cover
anti-viral agents including, but not limited to, a protease
inhibitor, an inhibitor of the serine protease portion of the NS3
gene, an inhibitor of the helicase portion of the NS3 gene,
alpha-interferon, ribavirin, and pegalated interferon.
[0034] The terms "amplification" or "amplify" include the reactions
necessary to increase the number of copies of a nucleic acid
sequence (e.g., a DNA sequence). For the purposes of this
invention, amplification refers to the in vitro exponential
increase in copy number of a target nucleic acid sequence, such as
that mediated by a polymerase amplification reaction such as e.g.,
PCR, however, other amplification reactions encompassed by the
invention include, e.g., RT-PCR (see, e.g., U.S. Pat. No.
4,683,202; Mullis et al.), and the ligase chain reaction (Barany,
Proc. Natl. Acad. Sci. USA 88:189-193 (1991)).
[0035] The terms "Hepatitis C Virus" and "HCV" refer to the viral
species that is the major etiological agent of BB-NANBH, the
prototype isolate of which is identified in WO89/046699; EPO
publication 318,216; and. U.S. Pat. No. 5,350,671, the disclosures
of which are incorporated herein by reference. "HCV" as used herein
includes the pathogenic strains capable of causing hepatitis C, and
attenuated strains or defective interfering particles derived
therefrom. The HCV genome is comprised of RNA. It is known that
RNA-containing viruses have relatively high rates of spontaneous
mutation, reportedly on the order of 10.sup.-3 to 10.sup.-4 per
incorporated nucleotide (Fields & Knipe, "Fundamental Virology"
(1986, Raven Press, N.Y.)). As heterogeneity and fluidity of
genotype are inherent characteristics of RNA viruses, there will be
multiple strains/isolates, which may be virulent or avirulent,
within the HCV species.
[0036] The terms "hybridize" or "hybridization" are art-known and
include the hydrogen bonding of complementary DNA and/or RNA
sequences to form a duplex molecule.
[0037] The term "kit" is any manufacture (e.g., a package or
container) comprising at least one reagent, e.g., a primer, for
specifically amplifying and/or sequencing a portion of the HCV
genome, the manufacture being promoted, distributed, or sold as a
unit for performing the methods of the present invention. A kit may
also include instructions for use.
[0038] The term "label" refers to a molecular moiety capable of
detection including, by way of example, without limitation,
radioactive labels which may be incorporated by known methods
(e.g., nick translation or kinasing), radioactive isotopes, biotin,
fluorescent groups, chemiluminescent groups (e.g., dioxetanes,
particularly triggered dioxetanes), digoxigenin, enzymes,
antibodies, luminescent agents, precipitating agents, dyes, and the
like.
[0039] The term "nucleotides" refers to any nucleotide (including
modified nucleotides, e.g., methylated or biotinylated nucleotides)
that can be incorporated into a nucleic acid by a polymerase.
[0040] As used herein the term "nucleic acid" includes DNA
molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA),
and analogs of the DNA or RNA generated using nucleotide analogs or
using nucleic acid chemistry. Typical modifications include
methylation, biotinylation, and other art-known modifications. In
addition, the nucleic acid molecule can be single-stranded or
double-stranded.
[0041] The term "target nucleic acid" or "template" includes any
nucleic acid intended to be copied in, e.g., a polymerase
amplification reaction such as PCR.
[0042] The term "probe" refers to a structure comprised of a
polynucleotide that forms a hybrid structure with a target
sequence, due to complementarity of at least one sequence in the
probe with a sequence in the target region. The polynucleotide
regions of probes may be composed of DNA, and/or RNA, and/or
synthetic nucleotide analogs. Included within probes are "capture
probes," "blocking probes," and "label probes."
[0043] The term "primer" or "nucleic acid primer" or "nucleic acid
primer sequence" includes single-stranded oligonucleotides that,
typically, are between about 4 to about 100 bases, or alternatively
between about 17 to 30 bases, or alternatively 20 or more bases,
and are designed to hybridize with a corresponding template nucleic
acid. Primer molecules may be complementary to either the sense or
the anti-sense strand of a template nucleic acid and are typically
used as complementary pairs that flank a nucleic acid region of
interest.
[0044] The term "polymerase" includes any one of, or a mixture of,
the nucleotide polymerizing enzymes E. coli DNA polymerase I,
Klenow fragment of E. coli DNA polymerase I, T4 DNA polymerase,
reverse transcriptase where the template is RNA and the extension
product is DNA, or a thermostable DNA polymerase. The term
"thermostable DNA polymerase" includes a thermostable DNA
polymerase isolated from Thermus aquaticus, Thermus thermophilus,
Thermus filiformis, Thermus flavus, Pyrococcus furiosus,
Thermococcus literolis, a Thermotoga species, or a recombinant form
thereof.
[0045] The term "sample" or "biological sample" refers to a sample
of tissue or fluid isolated from an individual, including but not
limited to, blood, plasma, serum, spinal fluid, lymph fluid, the
external sections of the skin, respiratory, intestinal, and
genitourinary tracts, tears, saliva, milk, urine, blood cells,
tumors, amniotic fluid, organs, genomic DNA, RNA, or cDNA in
solution or bound to a substrate, and also samples of in vitro cell
culture constituents including, but not limited to, conditioned
medium resulting from the growth of cells in cell culture medium,
putatively virally infected cells, recombinant cells, and cell
components, e.g., chromosome(s), organelles, paraffin embedded
tissues, or membranes isolated from a cell.
[0046] The "sense strand" of a nucleic acid contains the sequence
that has sequence homology to that of mRNA. The "anti-sense strand"
contains a sequence which is complementary to that of the "sense
strand."
[0047] The term "target region" refers to a region of the nucleic
acid that is to be amplified and/or detected. The term "target
sequence" refers to a sequence with which a probe or primer will
form a stable hybrid under desired conditions.
[0048] The term "targeting polynucleotide sequence" as used herein,
refers to a polynucleotide sequence which is comprised of
nucleotides which are complementary to a target nucleotide
sequence; the sequence is of sufficient length and complementarity
with the target sequence to form a duplex which has sufficient
stability for the purpose intended.
[0049] HCV has at least six genotypes, and multiple subtypes within
each genotype. Sequences which correspond to the HCV 1a and 1b
subtype may be selected from SEQ ID NOS:1-23 and SEQ ID NO:64, set
forth in Tables 1A and 1G. Sequences which correspond to the HCV 2a
subtype may be selected from SEQ ID NOS:24-27, set forth in Table
1B. Sequences which correspond to the HCV 2b subtype may be
selected from SEQ ID NOS:28-42, set forth in Table 1C. Sequences
which correspond to the HCV 3a subtype may be selected from SEQ ID
NOS:43-46, set forth in Table 1D. Sequences which correspond to the
HCV 3b subtype may be selected from SEQ ID NOS:47-50, set forth in
Table 1E. Sequences which correspond to the HCV 4a subtype may be
selected from SEQ ID NOS:51-63, set forth in Table 1F. The
sequences of the invention, set forth as SEQ ID NOS:1-64, are
defined in the Sequence Listing of the application.
[0050] In one embodiment, the oligonucleotides of the present
invention are at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%,
89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more
identical to the nucleotide sequence set forth in SEQ ID NOS:1-64.
In yet another embodiment, the nucleic acid molecule of SEQ ID
NOS:1-64 is at least 4, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, or more nucleotides in length. It will be appreciated that the
5' end may contain greater variability (e.g., nucleic acid
substitutions), yet remain ftmctional (e.g., able to anneal to the
NS3 and NS4 portion of the HCV genome).
[0051] The preparation of the nucleic acid sequences of the present
invention is by means known in the art, including, for example, by
methods which include excision, transcription, or chemical
synthesis. The target sequences and/or regions of the genome which
are selected to which the targeting nucleic acid sequence are
complementary depend upon the purpose. For example, if the goal is
to screen for the presence of HCV in biological samples (e.g.,
blood), the preferred nucleic acid sequence would be used as
primers, and would hybridize to conserved regions of the HCV
genome. Some of the conserved regions of the HCV genome to which
the nucleic acid sequences of the present invention may bind are
described herein. Other regions of the genome which are conserved
are ascertainable by comparison of the nucleotide sequences of
various isolates of HCV as described herein.
[0052] It will be appreciated that the nucleic acid sequences of
the present invention need not consist only of the sequence which
is complementary to the targeted HCV sequence. Thus, the nucleic
acid sequences of the present invention may contain in addition,
nucleotide sequences or other moieties which are suitable for the
purposes for which the nucleic acid sequences are used. For
example, use of the nucleic acid sequences as primers may be used
for the amplification of HCV sequences via PCR, they may contain
sequences which, when in duplex, form restriction enzyme sites
which facilitate the cloning of the amplified sequences.
[0053] The nucleic acid sequences of the invention may be used as
probes to detect the presence of HCV polynucleotides (for example
in screening for contaminated blood), the biological sample to be
analyzed, such as blood or serum, may be treated, if desired, to
extract the nucleic acids contained therein. The resulting nucleic
acid from the sample may be subjected to gel electrophoresis or
other size separation techniques; alternatively, the nucleic acid
sample may be dot blotted without size separation. In order to form
hybrid duplexes with the targeting sequence of the probe, the
targeted region of the nucleic acid must be in single stranded
form. Where the sequence is naturally present in single stranded
form, denaturation will not be required. However, where the
sequence is present in double stranded form, the sequence will be
denatured. Denaturation can be carried out by various techniques
known in the art. Subsequent to denaturation, the analyte nucleic
acid and probe are incubated under conditions that promote stable
hybrid formation of the target sequence in the probe with the
putative targeted sequence in the analyte, and the resulting
duplexes containing the probe(s) are detected.
[0054] Detection of the resulting duplex, if any, is usually
accomplished by the use of labeled probes; alternatively, the probe
may be unlabeled, but may be detectable by specific binding with a
ligand which is labeled, either directly or indirectly. Suitable
labels, and methods for labeling probes and ligands are known in
the art, and include, for example, radioactive labels which may be
incorporated by known methods (e.g., nick translation or kinasing),
radioactive isotopes, biotin, fluorescent groups, chemiluminescent
groups (e.g., dioxetanes, particularly triggered dioxetanes),
digoxigenin, enzymes, antibodies, luminescent agents, precipitating
agents, dyes, and the like.
[0055] The amplified HCV nucleic acid sequences generated from the
methods set forth herein may be cloned into a host vector with an
expression promoter and used as a DNA vaccine to amplify a
patient's response to the HCV virus, thereby providing a
patient-specific DNA vaccine to HCV. In another embodiment, the
clone may be used to generate RNA for use as an antisense vaccine.
In one embodiment, an HCV vaccine is provided and employed as an
immunotherapeutic agent for the prevention of HCV. In another
embodiment, a HCV vaccine is provided and employed as an
immunotherapeutic agent for the treatment of HCV.
[0056] By way of example, an HCV vaccine may be employed for the
prevention and/or treatment of HCV in a subject by administering
the vaccine by a variety of routes, e.g., intradermally,
subcutaneously, or intramuscularly. In addition, the HCV vaccine
can be administered together with adjuvants and/or immunomodulators
to boost the activity of the vaccine and the subject's response. In
one embodiment, devices and/or compositions containing the vaccine,
suitable for sustained or intermittent release could be, implanted
in the body or topically applied thereto for the relatively slow
release of such materials into the body. The HCV vaccine can be
introduced along with immunomodulatory compounds, which can alter
the type of immune response produced in order to produce a response
which will be more effective in eliminating the virus.
SPECIFIC EXAMPLES
Example 1
Genetic Diversity and Response to Interferon of the NS3 Protease
Gene from the Clinical Strains of the Hepatitis C Virus
[0057] This example describes an analysis of natural genetic
diversity within the NS3 gene, wherein a nested PCR method was
developed to obtain HCV NS3 sequence data directly from patient
strains. The data was analyzed to determine overall genetic
diversity, phylogeny of the virus, and selection of genetic
variants by interferon therapy with or without ribavirin. The
effects of genetic diversity on enzyme structure using molecular
modeling were determined. Thus, a comprehensive approach was
developed to facilitate analysis of natural genetic variation
within this gene and its effects on protein structure.
[0058] The N-terminal one-third of the hepatitis C virus
nonstructural gene 3 (NS3) codes for a serine protease (see FIG. 1
in Holland-Staley, C. A., et al., 2002, supra).
[0059] While genetic diversity has been shown to be extensive in
other regions of the HCV genome such as the envelope region, the
extent of diversity within the HCV NS3 protease region is largely
unknown. Accordingly, the data set forth herein was used to
determine the evolutionary rates of the virus and to identify the
effects of mutations on enzyme structure. To investigate natural
genetic diversity of this enzyme a nested PCR reaction was
developed to obtain NS3 protease sequence data directly from
patient strains. This data was used to determine genetic diversity,
phylogenetic and evolutionary rates, and selection of variants by
interferon therapy. The potential effect of genetic diversity on
enzyme structure using molecular modeling was also attempted. In
doing these experiments, a database of naturally occurring
sequences has been established. This database is usefuil in the
development of new antiviral therapy.
[0060] Genetic diversity among strains is important because of
evidence that some HCV types are more pathogenic than others
Cooreman, M. P. et al. (1996) Hepatitis C virus: biological and
clinical consequences of genetic heterogeneity. Scand J
Gastroenterol Suppl 218:106-115; Dusheiko, G. et al. (1994)
Hepatitis C virus genotypes: an investigation of type-specific
differences in geographic origin and disease. Hepatology 19:13-18;
Stempniak, M. et al. (1997) The NS3 proteinase domain of hepatitis
C virus is a zinc-containing enzyme. J Virol 71:2881-2886), i.e.,
HCV type 1 over other types, and subtype 1b over subtype 1a. The
cause for increased pathogenesis in these strains is unclear.
Describing differences among strains that have a rapid progression
to disease in comparison to those which don't, will help to
elucidate the possible cause and mechanisms of pathogenesis (Farci,
P. et al. (2000) The outcome of acute hepatitis C predicted by the
evolution of the viral quasispecies. Science 288:339-344).
Recently, Yanagi et al. (Yanagi, et al. (1998) Transcripts of a
chimeric cDNA clone of hepatitis C virus genotype 1b are infectious
in vivo. Virology 244:161-172) showed that the number of mutations
within the HCV genome can be directly related to infectivity. They
chose three chimeric cDNA clones from the same source and
inoculated chimpanzees. Of the three clones, only one was
infective. This clone contained 3 amino acid substitutions when
compared to the parent strain while the non-infective clones
contained 7 and 9 amino acid substitutions. This may indicate a
selection bias in chimpanzees due to immune system differences
instead of an HCV strain characteristic (Bassett, S. E. et al.
(1998) Analysis of hepatitis C virus-inoculated chimpanzees reveals
unexpected clinical profiles. J Virol 72:2589-2599). In another
study, when hypervariable region 1 was examined (Shindo, M. et al.
T (1996) The clinical significance of changes in genetic
heterogeneity of the hypervariable region 1 in chronic hepatitis C
with interferon therapy. Hepatology 24:1018-1023) it was shown that
higher amounts of heterogeneity were associated with a poorer
overall response despite treatment with alpha-interferon. In
addition, Chambers, T. J. et al. (Chambers, T. J. e al. (1991)
Processing of the yellow fever virus nonstructural polyprotein: a
catalytically active NS3 proteinase domain and NS2B are required
for cleavages at dibasic sites. J Virol 65:6042-6050); established
that mutations which affected activity of the NS3 protease from the
Yellow Fever virus, were lethal for viral replication. The outcome
of these studies affirms the need to further characterize the role
that heterogeneity plays in HCV infection. The compositions and
methods of the present invention provide a mechanism for such
characterization. Filocamo et al., 1999. Selection of functional
variants of the NS3-NS4A protease of hepatitis C virus by using
chimeric sindbis viruses. J Virol 73:561-575 used chimeric Sindbis
viruses (SBV) to analyze variants of the NS3/NS4A protease,
however, their study used a cloned protease and relied on the SBV
replication machinery to produce sequence variation. While this
allowed characterization of new protease variants, these variants
may or may not represent those obtained from HCV replication in
vivo. In addition, Forns et al. (Forns X., et al. (1997) How
Escherichia coli can bias the results of molecular cloning:
preferential selection of defective genomes of hepatitis C virus
during the cloning procedure. Proc Natl Acad Sci USA
94:13909-13914) found when cloning PCR products of HCV structural
proteins into E. coli, that a strong selection for defective clones
occurred and accurate representation of true genetic diversity did
not occur. The reason for this is unclear; however, toxicity to the
E. coli host by viral proteins may play a role. Direct sequencing
from patient samples should give a more accurate representation of
true genetic diversity.
[0061] Most RNA viruses have a high mutation rate due to the lack
of proofreading enzymes and because RNA-dependent RNA polymerases
are thought to randomly produce one error per round of genomic
replication (Drake, J. W. (1993) Rates of spontaneous mutation
among RNA viruses. Proc Natl Acad Sci USA 90:4171-4175). Therefore,
if there are 10.sup.7-8 viruses produced per day and the mutation
rate is random, then each site will theoretically contain an equal
number of mutations. The data set forth herein, however, showed
that this was not the case, indicating that while the mutations
were random, some regions of the virus are more permissive to
mutations than other regions. This suggests that the virus, or at
least the NS3 protease region, is subject to other functional
constraints. The location of amino acid changes in the HCV NS3
protease from clinical strains indicates that amino acid
substitutions take place in both the N- and C-terminal domains. It
has already been demonstrated that the N-terminal domain of NS3
exhibits a structural plasticity upon NS4A binding. Kim, J. L. et
al. (Kim, J. L. et al. (1996) Crystal structure of the hepatitis C
virus NS3 protease domain complexed with a synthetic NS4A cofactor
peptide. Cell 87:343-355) and; Yan, Y. et al. (Yan, Y. et al.
(1998) Complex of NS3 protease and NS4A peptide of BK strain
hepatitis C virus: a 2.2 A resolution structure in a hexagonal
crystal form. Protein Sci 7:837-847) reported that the N-terminal
domain is flexible since the binding of the NS4A leads to ordering
on the N-terminal 28 residues and causes local rearrangements for a
catalytically more favorable conformation of the active site.
Activation of the NS3 protease by the NS4A peptide leads to a
.about.950-fold enhancement of catalytic hydrolysis of peptides
mimicking the NS4A/NS4B junction (Yan. Y. et al. 1998 supra). Based
on structural changes predicted from the sequences of clinical HCV
strains, it is believed that there will be finctional changes
relative to the wild type protease. An example of such a change
would be the alteration of the pseudo-second-order rate constant
(k.sub.cat/K.sub.M) for the various clinical strains. A second
observation is that structural variation of HCV NS3/NS4A complex
ought to be factored into the structure-based design of the
inhibitors in order to retain efficacy against a wide range of
clinical isolates.
[0062] For patient strains 23 and 25, the differences in subtype
designation between the 5' untranslated region and the NS3 protease
region is unknown, but may occur due to the presence of more than
one subtype. Simultaneous infection with multiple species of Dengue
virus has been shown to occur (Gubler, D. J. et al. (1985) A case
of natural concurrent human infection with two dengue viruses. Am J
Trop Med Hyg 34:170-173). For HCV infection, this is most likely
due to multiple blood transfuisions or infections through IVDA.
Because HCV subtypes 1a and 1b are most predominant in this
geographical distribution, the likelihood that they would recombine
increases. Evidence of recombination has been shown in Dengue
virus, where genetic diversity occurs when the RNA polymerase
switches between two different genomes during replication,
resulting in a hybrid RNA (Holmes, E. C. et al. (2000) The causes
and consequences of genetic variation in dengue virus. Trends
Microbiol 8:74-77). This may be the case with strains 23 and 25,
where they typed as HCV1a based on the 5' untranslated region, but
closer to the HCV1b lade by the NS3 protease nucleotide sequence.
The sequence results were clean, and did not show evidence of more
than one species, suggesting recombination occurred prior to the
start of NS3. Amino acid sequence comparison, however, showed very
different results. Patient 23 had 3 mutations when compared to the
type 1a consensus and 16 mutations when compared to the type 1b
consensus. Patient 25 showed similar results with 4 mutations when
compared to type 1a and 16 when compared to type 1b. The
differences between nucleotide sequence analysis and protein
analysis is unknown. Without being limited by theory, it is
believed that these two strains represent a new subtype, which
falls on the evolutionary tree between subtypes 1a and 1b.
[0063] This example revealed that there is significant variability
in clinical HCV strains at both the nucleotide (30.2% for 1a and
25.8% for 1b) and amino acid sequences (12.2% for 1a and 12.2% for
1b). Phylogenic analysis showed two distinct clades with two HCV
isolates grouping as a sister clade to 1b. Moreover, structural
analysis revealed that most mutations lie in the N-terminus of the
enzyme. When strains were sorted as to whether or not the patient
had received antiviral therapy, no difference was found in the
number or locations of mutations in la strains. However, 1b strains
demonstrated an overall drop in the number of positions that were
mutated. Thus, this study demonstrated that there are significant
differences among natural strains that may pose a problem for
structure-based drug development, for which this invention provides
a solution.
[0064] The relationship between sequence variation and structural
changes in the HCV NS3/NS4A complex can also be done by X-ray
crystallography. Based on the compositions and methods of the
present invention, anti-viral, including anti-HCV, drugs can be
designed and developed with knowledge of the variability in the
structure in the NS3/NS4A complex from HCV clinical strains to
ultimately develop effective therapies against HCV.
Materials and Methods
Extraction of Viral RNA
[0065] HCV RNA was isolated from patient serum using the QIAamp
viral RNA mini isolation kit (Qiagen Inc., Valencia, Calif.).
Isolation was performed according to manufacturers directions.
RT-PCR and Amplification of Viral RNA
[0066] The Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)
followed by a 2.sup.nd round `nested` PCR reaction was used to
amplify the entire NS3 gene of HCV subtypes 1a or 1b, from clinical
strains. For the RT-PCR step, the Promega Access Reverse
Transcriptase PCR kit (Promega Corporation, Madison, Wis.) was
used. For this, two oligonucleotide primers flanking the HCV NS3
gene were designed. The 5' primer set forth in SEQ ID NO:1 anneals
881 bp before the start of the NS3 gene. The 3' primer set forth in
SEQ ID NO:2 anneals 338 bp downstream of NS3 and is used to
initiate the RT step (Table 1G, SEQ ID NOS:1-4, SEQ ID NO:64 and
SEQ ID NO:6, "Amplification" subsection). This allows cDNA
production followed by initial amplification of the desired region.
The amplification mixture containing 25 pmol of each primer, 200
.mu.M dNTPs, 2.5 U AMV RT-polymerase, 2.5 U Tfl DNA polymerase, 1.5
mM MgSO.sub.4, and 20 .mu.l of viral RNA was added to a preheated
(48.degree. C.) Perkin-Elmer 9700 thermocycler (Perkin Elmer Cetus,
Foster City, Calif.). The PCR protocol consisted of an RT step at
48.degree. C. for 45 minutes, followed by an initial denaturation
at 94.degree. C. for 2 minutes, and 35 cycles of, 94.degree. C. for
15 seconds; 55.degree. C. for 20 seconds; 72.degree. C. for 2
minutes; and a final extension at 72.degree. C. for 10 minutes.
[0067] For the second step PCR reaction, the 1.sup.st round PCR
product was amplified using primers that anneal inside the previous
reaction, creating a `nested` amplification. The second round PCR
reaction used the 5' primer set forth as SEQ ID NO:3 which anneals
693 bp upstream of NS3 and the 3' primer set forth as SEQ ID NO:4
which anneals 161 bp downstream. The amplification mixture
containing 25 pmol of each primer, 200 .mu.M dNTPs, 2.5 U
Taq.COPYRGT. DNA polymerase, 1.5 mM MgSO.sub.4, and 5 .mu.l of
1.sup.st-round product was added to a preheated (94.degree. C.)
thermocycler. Initial denaturation consisted of 10 minutes at
94.degree. C., followed by 35 cycles of, 94.degree. C. for 15
seconds; 55.degree. C. for 20 seconds; 72.degree. C. for 2 minutes
and a final extension at 72.degree. C. for 10 minutes. The
resulting amplification product is a single 2746 bp band on a 1%
agarose gel. The entire NS3 gene was amplified using this method,
however, only the NS3 protease gene is characterized herein. Second
step reaction products were purified and concentrated using the
Gene Clean Spin Protocol (Bio 101, Vista, Calif.). Purified
products were used directly for DNA sequencing. To ensure that each
HCV RNA isolation was successful, primers which cover the highly
conserved 5'-untranslated (5'-UTR) region were used as a control
(Yuki, N. et al. (1997) Hepatitis C virus replicative levels and
efficiency of genotyping by specific PCR and antibody assay. J Clin
Microbiol 35:1184-1189). PCR products from this control region were
also purified as set forth above and sequenced. Sequence data from
the 5'UTR region were then used to genotype each HCV strain
(O'Brien, C. B. et al. D (1997) cDNA sequencing of the 5' noncoding
region (5' NCR) to determine hepatitis C genotypes in patients with
chronic hepatitis C. Digestive Diseases and Sciences 42:1087-1093).
If the second round PCR amplification was unsuccessful, a new round
of amplification using a second set of internal `backup` primers
was performed. The 5' backup primer set forth as SEQ ID NO:64 and
the 3' backup primer set forth as SEQ ID NO:6 result in a 2377 bp
amplification product, which truncates the NS3 gene (helicase
region) by 19 bp.
DNA Sequencing
[0068] Sequencing of purified second step PCR reaction products was
performed using the ABI Big Dye Terminator technology (Applied
Biosystems, Foster City, Calif.). Five primers set forth as SEQ ID
NOS:7-11 (see Table 1G, "Sequencing" subsection) designed to cover
the NS3 protease region on both the sense and anti-sense strands
were used. For ABI analysis, sequence reactions were run in
microtiter plates using a thermocycler for 25 cycles of 96.degree.
C. for 10 seconds; 50.degree. C. for 5 seconds; and 60.degree. C.
for 4 minutes. Reaction products were NaOAc/ETOH purified,
resuspended in loading buffer, denatured and run on an ABI 377
sequencer (Applied Biosystems).
Sequence Analysis
[0069] ABI sequence results were analyzed using the ABI sequence
analysis software version 3.3. Individual sequences were aligned
against a consensus derived from all patient sequence data and
against HCV types 1a and 1b (Accession Numbers AF009606 and
AJ000009) (Yanagi, M. et al. (1997) Transcripts from a single
full-length cDNA clone of hepatitis C virus are infectious when
directly transfected into the liver of a chimpanzee. Proc Natl Acad
Sci USA 94:8738-8743; and Yanagi, M. et al., (1998),. Transcripts
of a chimeric cDNA clone of hepatitis C virus genotype 1b are
infectious in vivo. Virology 244:161-172). The two Genbank
sequences were chosen for comparison because they are available as
cloned constructs for use as positive controls for subsequent
protein expression assays (data not shown). Amino acids that differ
from the consensus are compared and used to determine which
residues are conserved or variable.
Phylogenetic Analysis
[0070] Sequences were aligned using Sequencer 3.0, and the multiple
alignment was exported as a Nexus file. Parsimony analysis was run
using PAUP 3.1.1 (Swofford, D. L. (1993) PAUP: Phylogenetic
analysis using parsimony. 3.1 ed. Illinois Natural History Survey,
Champaign, Ill.) with a heuristic search with branch swapping. For
comparison, a branch and bound option was also used to search for
the most parsimonious trees. A distance matrix based on Kimura
Two-Parameter distances was generated using the DNADIST program of
PHYLIP Version 3.573c (Felsenstein, J. (1993) PHYLIP (phylogenetic
Inference Package), 3.5 p ed. Department of Genetics, University of
Washington, Seattle). A two to one transition to transversion ratio
was used. The distance matrix was then analyzed by Neighbor-Joining
Analysis (NJ) using the NEIGHBOR program in PHYLIP. Bootstrap
support analysis was executed using 1000 resamplings for both NJ
and Parsimony Analyses. The multiple data sets for the NJ were
generated by the SEQBOOT program and the multiple trees were
determined for consensus by the CONSENSE program, both in PHYLIP.
The Parsimony bootstrap was completed using the bootstrap option in
PAUP.
[0071] The number of segregating sites for each population was
counted from the Sequencher 3.0 generated multiple alignments. The
distinction of synonymous versus non-synonymous substitutions was
made based on proposed translations of the sequences. Population
mutation parameter .theta.=2 N.mu. was estimated following
Watterson (Watterson, G. A. (1975) On the number of segregating
sites in genetical models without recombination. Theoretical Pop
Biol 7:256-276). Tests of neutrality follow McDonald and Kreitman
(McDonald, J. et al. (1991) Adaptive protein evolution at adh locus
in Drosophilia. Nature 351:652-654).
Homology Protein Structure Modeling
[0072] Homology protein structure modeling by satisfaction of
spatial restraints was performed according to the method of Sali,
et al., 1995 (Sali, A. (1995) Comparative protein modeling by
satisfaction of spatial restraints. Mol Med Today 1:270-277).
Homology protein structure modeling is founded on building a
structural model of a protein on the basis of close similarity to a
template protein of known structure.
[0073] In the first stage of protein structure modeling, the
alignment between the unknown sequence and related template
structures were obtained. Secondly, restraints on various
distances, angles, and dihedral angles in the sequence were derived
based on its alignment with the template structures. Finally, the
three dimensional models were obtained by minimizing violations of
homology-derived and energy restraints, using conjugate gradients
and molecular dynamics procedures. An important step in homology
protein modeling experiments is the evaluation of the model
quality. To ensure the quality, internal consistency checks as
implemented in the software package MODELLER 4 (Sali, A. et al.
(1993) Comparative protein modelling by satisfaction of spatial
restraints. J Mol Biol 234:779-815) were used to test the
three-dimensional profile.
[0074] The comparative protein modeling software package MODELLER
was used to calculate the structures of the HCV NS3/NS4 complex.
This software package has been tested extensively in structural
genomics projects by Sanchez and Sali, 1998 (Sanchez, R. et al.
(1998) Large-scale protein structure modeling of the Saccharomyces
cerevisiae genome. Proc Natl Acad Sci USA 95:13597-13602). The
2.2.ANG. crystal structure of the complex of the HCV NS3 protease
and NS4A peptide (Yan, Y. et al. 1998, supra) was used as a
template for the homology modeling experiments to examine
structural changes in the HCV NS3 protease clinical strains. The
crystal structure of the HCV NS3/NS4A complex and the modeled
structures of the HCV NS3/NS4A proteases were least-squares
superimposed using the program suite O (Jones, T. A. et al. (1991)
Improved methods for building protein models in electron density
maps and the location of errors in these models. Acta Cryst
A47:110-11932.
[0075] Optimization of the HCV NS3/NS4A models was carried out
using default settings in MODELLER 4.0 (number of iterations in
optimization=200; non-bonded restraint type=dynamic soft-sphere
repulsion terms). The model is obtained by optimizing an objective
function (combined spatial restraints and CHARMM energy terms
enforcing proper stereochemistry) in Cartesian space.
Nucleotide Sequence GenBank Accession Numbers
[0076] The nucleotide sequences described herein have been
deposited with the American Type Culture Collection (ATCC), 10801
University Boulevard, Manassas, Va. 20110-2209, on Apr. 9, 2001 and
assigned Accession Numbers AF369214 through AF369263. These
deposits will be maintained under the terms of the Budapest Treaty
on the Intemational Recognition of the Deposit of Microorganisms
for the Purposes of Patent Procedure. These deposits were made
merely as a convenience for those of skill in the art and is not an
admission that a deposit is required under 35 U.S.C. .sctn.112.
RESULTS
Patient Population
[0077] Serum from thirty patients infected with HCV subtypes 1a or
1b was analyzed. Eighteen men and twelve women with a mean age of
50.2 years (range, 21-76) were included. Nineteen were
treatment-naive, while the remaining 11 had treatment with either
.alpha.-IFN alone (patients 11, 183 and 205), .alpha.-IFN+ribavirin
(pt. 176) or an initial course of .alpha.-IFN followed by a second
round of combination therapy (patients 252, 174, 186, 1D, 1Y, 179,
25). All patients received 3 million units, 3.times. a week for 12
months except patients 11 and 205, who received a second course of
.alpha.-IFN therapy of 5 million units 4.times. a week, and 1.5
million units 3.times. a week, respectively, and patients 186 and
1Y, who had therapy stopped after 6 months. No one had a sustained
response. All patients had HCV RNA viral loads of between
5.1.times.10.sup.4 and 2.3.times.10.sup.6 copies/ml as determined
by using the Roche Amplicor.RTM. HCV Monitor Test.
Genotyping
[0078] The conserved 5' untranslated region was sequenced to place
each strain into the respective genotype using the method of
O'Brien et al. (O'Brien, C. B. et al. (1997) cDNA sequencing of the
5' noncoding region (5' NCR) to determine hepatitis C genotypes in
patients with chronic hepatitis C. Digestive Diseases and Sciences
42:1087-1093). Genotype results showed that 21 sequences were HCV
subtype 1a and 9 were subtype 1b. These data are consistent with
the patient population, with HCV subtypes 1a and 1b being the most
prevalent in this region of the world. The data set forth herein
demonstrates a correlation between the 5'-UTR genotype and NS3
sequence data.
Amplification and Sequencing the NS3 Region from Clinical
Strains
[0079] The NS3 protease gene has been successfully sequenced and
amplified herein from the sera of 30 patients infected with HCV
subtypes 1a or 1b. The amplification product produced a clean band
with a success rate of >80% (FIG. 1). The resulting sequences
were then translated and a consensus sequence was derived from the
alignment of all patient sequences. Each patient sequence was
compared to the consensus sequence and against the prototype
sequences found in Genbank for each subtype (Genbank # AF009606
& # AJ000009) (Yanagi, M. et al., 1998, supra; see also Yanagi,
M. et al., 1998, supra). The variable and conserved regions within
these sequences were then determined for both nucleotide and amino
acid residues.
Analysis of Nucleotide Sequence
[0080] There are 543 nucleotides that encode the NS3 protease gene.
Sequence data was analyzed to determine the nucleotide distribution
at each position when compared to the patient derived consensus
sequence and the two prototype sequences from Genbank. For those
strains belonging to HCV subtype 1a, 164 positions contained one or
more nucleotide substitutions when compared to the patient
consensus sequence, resulting in an overall sequence variation of
30.2% (data not shown). These included 133 transitions, 9
transversions and 22 sites with both transitions and tranversions.
When compared to the prototype 1a, 20 positions were different
(overall sequence variation of 3.5%), with 17 positions containing
transitions and 3 containing transversions (Table 2A). There were
no detected insertions or deletions. For strains typing as HCV
subtype 1b, 140 positions contained one or more substitutions when
compared to the patient consensus sequence, for an overall sequence
variation of 25.8%. There were 114 transitions, 8 transversions and
18 sites containing both transitions and tranversions. There were
38 positions that varied from the prototype 1b sequence (overall
7.4%), with 34 transitions and 4 transversions (Table 2B).
Insertions or deletions were not detected in any sequences. Without
being bound by theory, because the predicted mutation rate
introduced during PCR amplification was .about.0.1%, it is believed
that the data portrays an accurate representation of natural
genetic sequence variation.
Analysis of Amino Acid Sequence
[0081] There are 181 amino acids that comprise the NS3 protease.
The effects of nucleotide substitution on the amino acid sequence
showed that most of the substitutions were silent. For the 21
patient sequences belonging to HCV subtype 1a, 22 residues or 12.2%
differed from the patient strain consensus (Table 3). The prototype
sequence differed from the patient consensus by 5 residues (A40T,
K80Q, A91S, I153L, E176G) including one mutation not found in any
patient sequences (underlined). Three sites had more than two amino
acid species present (Vizmanos, J. L. et al., 1998, supra; Yanagi,
M. et al. (1997) Transcripts from a single full-length cDNA clone
of hepatitis C virus are infectious when directly transfected into
the liver of a chimpanzee. Proc Natl Acad Sci USA 94:8738-8743),
and one site (residue 86) was able to tolerate 4 different
residues. Including the control sequence, 9 sites had substitutions
of the same amino acid type, 9 sites were able to accommodate
either neutral or polar amino acids, 3 sites basic or polar, 2
sites acidic or polar, and one site acidic or neutral. Only two
strains were identical to the consensus with no amino acid
substitutions (K and 161).
[0082] For patient strains that typed as HCV1b, there was an
overall sequence variation of 12.2%, with 22 sites different from
the patient derived consensus (Table 4). The patient consensus
differed from the prototype sequence by 8 residues (L13V, V48I,
Q80L, L94M, T98S, A150V, I153V, V1701) including 4 sites not
previously identified (underlined), bringing the total number of
sites containing one or more amino acids to 26. More than two amino
acid species were present in 2 sites (61 and 80), and residue 67
had up to 4 different residues (residue 86 did not contain any
mutations). The same type of substitution was seen in eleven sites,
8 sites accommodated either neutral or polar amino acids, 1 site
basic or polar, 2 sites basic or neutral and the remaining site had
an amino acid change neutral to aromatic. Only strain 153 was
identical to the consensus. For either types 1a or 1b no amino acid
substitutions at the known conserved residues were found.
Selection by Interferon Therapy
[0083] The most significant differences were noticed when strains
were grouped according to whether or not the host had received
interferon therapy. For strains that had not been subjected to
interferon therapy with or without ribaviron, the overall number of
mutations per patient averaged 1.9 for type 1a strains, with 14
sites containing mutations. After interferon therapy, the number of
mutations per patient averaged 2.6 with 15 sites containing
different amino acids. Only 7 sites were similar both before and
after therapy (Table 3). For type 1b strains, the average number of
mutations per patient for strains not subjected to interferon
therapy was 3.6 with 18 sites varying overall. However, after
interferon therapy, while the number of mutations per patient were
not significantly different (3.0), the number of sites which
contained mutations in the 1b strains dropped to 10, or by 56%
(Table 4) with 6 sites similar in strains with or without therapy.
This suggests that the sensitive strains were eliminated during
interferon therapy and these 10 remaining sites may somehow be
involved in resistance of the virus to interferon.
[0084] In summary, the most frequently occurring amino acid changes
are represented by hydrophobic to hydrophobic amino acid mutations
followed by positively charged to neutral side chain changes. The
rate of mutations from a more bulky to less bulky amino acid side
chain occurs at a higher rate than vice versa. In type 1b strains,
sequence diversity in the NS3 protease is significantly reduced in
strains from patients who have undergone IFN therapy. This suggests
that sensitive strains are eliminated during interferon therapy and
those strains that remain after therapy may be less sensitive to
the drug.
Phylogenetic Analysis and Molecular Evolution
[0085] Parsimony analysis using a heuristic search with branch
swapping detected 141 equally parsimonious trees with 696 steps. A
comparable branch and bound option detected 144 equally
parsimonious trees with 696 steps. The sequences are grouped in
over 95% of the trees into two clades, the HCV1a and HCV1b clades.
The HCV1a clade consists of 19 strains (K, 4, 11, 12, 24, 161, 170,
174, 176, 177, 183, 186, 194, 252, 1C, 1D, 1H, 1X, and 1Y) instead
of 21 as identified with genotyping. The remaining samples (1, 23,
25, 153, 179, 205, 1A, 1G, 1U, 2D, and 2F) grouped with HCV1b.
These results are strongly supported in the bootstrap analysis,
although hierarchical relationships within the two clades are not
strongly supported (FIG. 2A). In particular, FIG. 2A depicts a
consensus tree of the parsimony analysis. The branch lengths are
drawn to match hierarchial groups and do not reflect the mutational
steps among strains. Within the HCV1b clade, the two strains 23 and
25 are sister taxa to the remaining strains. These two samples, 23
and 25, grouped with type HCV1a by genotyping and comparison of
amino acid sequences.
[0086] FIG. 2B depicts a bootstrap tree from the Neighbor-joining
analysis. The Neighbor-Joining analysis produced very similar
results to the parsimony analysis indicating a well-separated HCV1b
clade consisting of strains 1, 1G, 153, 2D, 1A, 179, 2F, 1U, and
205 (FIG. 2B). Bootstrap support of the clades, as set forth
herein, are indicated next to their appropriate branches. In
addition, branch lengths are scaled to genetic distances.
[0087] Strains 23 and 25 group again as a sister lineage to the
HCV1b clade. These data, along with the amino acid data, suggest
their representation of a genetically differentiated third clade.
Hierarchical relationships within the two major clades differ
somewhat from that of the consensus Parsimony tree, but none of the
differences are strongly supported in the NJ bootstrap. The HCV1b
clade is supported in 100% of the bootstrap samplings. The
separated 23-25 grouping is supported in 97.4% of the bootstrap
samplings. Within the HCV1a lade, strains 4 and 1 are monophyletic
with 84.9% support, and 11, 170, and 177 are monophyletic with 66%
support.
Analysis of Evolutionary Rates
[0088] Population rates of evolution for the three lineages were
estimated following (Watterson, G. A., 1975, supra). The estimators
of .theta. (.+-.S.D.) for HCV1a, HCV1b, and PT's 23-25 are
42.28.+-.53.77, 49.49.+-.61.81, and 40.+-.40.50, respectively.
Thus, there is no indication of differential rates of evolution
occurring among the three lineages.
[0089] Tests of non-neutral evolution between the two major
lineages HCV1a and HCV1b were executed using the method of McDonald
and Kreitman (McDonald, J. et al. (1991) Adaptive protein evolution
at adh locus in Drosophilia. Nature 351:652-65441). Under
neutrality, the ratio of synonymous and non-synonymous segregating
sites should be constant within and among populations. In
comparisons of the HCV1a and HCV1b populations, the X.sup.2 value
is 2.30 indicating no significant deviation from neutral
expectations for sequence deviation among the two populations.
Molecular Modeling
[0090] Protein homology modeling experiments of HCV NS3
protease/NS4A complex were carried out with the 2.2 .ANG. crystal
structure template of the NS3 protease and NS4A peptide of (Yan, Y.
et al., 1998, supra); to examine three-dimensional changes due to
sequence variation in clinical strains. The most divergent strains
were selected for modeling. The focus was on subtypes A and B and,
therefore, two highly divergent subtype 1A and two sequence-wise
very different isolates belonging to subtype 1B were selected for
these studies. Four clinical strains (252, 1G, 1H, and 1U) have
been selected for modeling experiments. Two of the strains (252 and
1H) belong to subtype 1a and the other two strains (1G and 1U)
belong to subtype 1b. Mutations occur most frequently in loop
regions or at the termini of .beta.-strands. Mutations also occur
in the .alpha.-helices of NS3.
[0091] Homology models for the HCV1a or HCV1b consensus sequences
using the crystal structure the NS3/NS4A complex of (Yan, Y. et
al., 1998, supra) were computed with the program suite MODELLER.
The models for the 1a and 1b consensus were superimposed for
detailed analysis (see FIG. 4 in Holland-Staley, C. A., et al.,
2002, supra), which indicates the largest differences between the
two subtypes. Moreover, there were noticeable differences both in
the active site and at other positions. There are distinguishable
differences in the positions of the three residues of the catalytic
triad, Asp81, His57 and Ser139. The modeling results suggest
functional differences for the two subtypes.
[0092] The models from HCV clinical strains 252, 1G, 1H, and 1U
which contain multiple amino acid changes were superimposed on the
crystal structure of the wild type NS3/NS4A complex of Yan, Y. et
al., 1998, supra. The NS3/NS4A complex of strain 1G was compared
with the wild type crystal structure (see FIG. 5 in Holland-Staley,
C. A., et al., 2002, supra). There are distinguishable differences
in the positions of the three residues for the catalytic triad
(Asp81, His57 and Ser139). Similar potential differences have been
observed for strains 252, 1H and 1U (data not shown)
(Holland-Staley, C. A., et al. (2002) Genetic diversity and
response to IFN of the NS3 protease gene from clinical strains of
the hepatitis C virus. Arch Virol 147:1385-1406), which is
incorporated herein by reference.
Example 2
A Decrease in Genetic Diversity Within the NS3 Helicase Gene from
Clinical Isolates of the Hepatitis C Virus Correlates with
Interferon Therapy
[0093] This example describes the effects of interferon therapy
(with or without ribaviron) on the NS3 helicase gene from patients
infected with HCV type 1a or 1b. To do this, a nested PCR reaction
was developed, which allows recovery of HCV NS3 sequence data
directly from patient isolates. To analyze the effects of IFN
therapy, a patient derived consensus sequence was made and used to
determine the overall number of mutations in each clinical isolate.
Then the sequences were grouped by whether or not the patient had
IFN therapy (naive vs experienced), and analyzed the number of
positions which were mutated. These mutations were also used to
predict response to IFN. The results demonstrate that a significant
decrease in overall sequence variability occurs in those isolates
which had been subjected to IFN tharapy. Thus, the present
invention provides a method to analyze the effects of IFN on the
HCV NS3 gene and determine its effects on the quasispecies
population.
MATERIALS AND METHODS
Patient Samples and Extraction of Viral RNA
[0094] Serum from forty three patients infected with HCV subtypes
1a or 1b was analyzed. Twenty three men and twenty women with a
mean age 51.1 years (range, 21-76) were included. Twenty-nine were
treatment naive, while the remaining 14 had treatment with
interferon alone or combined with ribaviron. All patients had HCV
RNA viral loads of between 5.1.times.10.sup.4 and
2.3.times.10.sup.6 virions/ml as determined by using the Roche
Amplicor.RTM. HCV Monitor Test. HCV RNA was isolated from patient
serum using the QIAamp viral RNA mini isolation kit (Qiagen Inc.,
Valencia, Calif.). Isolation was performed according to
manufacturers directions.
RT-PCR and Amplification of Viral RNA
[0095] The Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)
followed by a 2.sup.nd round `nested` PCR reaction was used to
amplify the entire NS3 gene of HCV subtypes 1a or 1b, from clinical
isolates. The RT-PCR step used the Promega Access Reverse
Transcriptase PCR kit (Promega Corporation, Madison, Wis.). For
this, two oligonucleotide primers flanking the gene were designed.
The 5' primer (5'-CTA CTC CTG CTC CTG CTG GCG TT-3') anneals 693 bp
before the start of the NS3 gene. The 3' primer (5'-CTG ATG AAA TTC
CAC ATG TGC TTC GCC CA-3') anneals 338 bp downstream of NS3 and is
used to initiate the RT step. This allows cDNA production followed
by initial amplification of the desired region. The amplification
mixture containing 25 pmol of each primer, 200 .mu.M dNTPs, 2.5 U
AMV RT-polymerase, 2.5 U Tfl DNA polymerase, 1.5 mM MgSO.sub.4, and
20 .mu.l of viral RNA was added to a preheated (48.degree. C.)
Perkin-Elmer 9700 thermocycler (Perkin Elmer Cetus, Foster City,
Calif.). The PCR protocol consisted of an RT step at 48.degree. C.
for 45 minutes, followed by an initial denaturation at 94.degree.
C. for 2 minutes, and 35 cycles of, 94.degree. C. for 15 seconds;
55.degree. C. for 20 seconds; 72.degree. C. for 2 minutes; and a
final extension at 72.degree. C. for 10 minutes.
[0096] For the second step PCR reaction, the 1.sup.st round PCR
product was amplified using primers, which anneal inside the
previous reaction, creating a `nested` amplification. The second
round PCR reaction used the 5' primer (5'-GAG CCC GTC GTC TTC
TC-3') and the 3' primer (5'-CAC TCT TCC ATC TCA TCG AAC TCC TGG
TAG AG-3'). The amplification mixture containing 25 pmol of each
primer, 200 .mu.M dNTPs, 2.5 U Taq.COPYRGT. DNA polymerase, 1.5 mM
MgSO.sub.4, and 5 .mu.l of 1st round product was added to a
preheated (94.degree. C.) thermocycler. Initial denaturation
consisted of 10 minutes at 94.degree. C., followed by 35 cycles of,
94.degree. C. for 15 seconds; 55.degree. C. for 20 seconds;
72.degree. C. for 2 minutes and a final extension at 72.degree. C.
for 10 minutes. The resulting amplification product is a single
2219 bp band on a 1% agarose gel. The entire NS3 gene was amplified
using this method, however, only the NS3 helicase gene is
characterized here. Second step reaction products were purified and
concentrated using the Gene Clean Spin Protocol (Bio 101, Vista,
Calif.). Purified products were used directly for DNA sequencing.
To ensure each HCV RNA isolation was successful, primers which
cover the highly conserved 5'-untranslated (5'-UTR) region were
used as a control (Yuki, 1997 #226). PCR products from this control
region were also purified as above and sequenced. Sequence data
from the 5'UTR region were then used to genotype each HCV isolate
(O'Brien, 1997 #30). If amplification was unsuccessful, a new round
of RT-PCR was performed using a second 3' `backup` primer. The
3'backup primer (5'-GCC GAC ATG CAT GYC ATG ATG TAT TT-3') results
in a 2039 bp amplification product, which truncates the NS3 gene by
20 bp.
DNA Sequencing
[0097] Sequencing of purified second step PCR reaction products was
performed using ABI Big Dye Terminator technology (Applied
Biosystems, Foster City, Calif.). Eleven primers (A-K) designed to
cover the NS3 helicase region on both the sense and anti-sense
strands were used. The sense primers are: A(5'-TCG GAC CTT TAC TTG
GTC ACG AG-3'), B(5'-TAC TCC ACC TAT GGC AAG TTC CT-3'), C(5'-CAT
CTC ATY TTC TGC CA-3'), D(5'-GAG TGC TAT GAC GCG GGC TGT GCT T-3'),
E(5'-CCA TCG TGG GAY CAA ATG TGG AAG TGT-3'), F(5'-AAA TAC ATC ATG
RCA TGC ATG TCG GC-3'). Antisense primers are: G(5'-AGG AAC TTG CCA
TAG GTG GAG TA-3'), H(5'-GAG TGG CAC TCA TCA CA-3'), I(5'-TCG ACT
GTC TGR GTG ACA CA-3'), J(5'-GCC GAC ATG CAT GYC ATG ATG TAT
TT-3'), K(5'-CAC TCT TCC ATC TCA TCG AAC TCC TGG TAG AG-3'). For
ABI analysis, sequence reactions were run in microtiter plates
using a thermocycler for 25 cycles of 96.degree. C. for 10 seconds;
50.degree. C. for 5 seconds; and 60.degree. C. for 4 minutes.
Reaction products were NaOAc/ETOH purified, resuspended in loading
buffer, denatured and run on an ABI 377 sequencer (Applied
Biosystems).
Sequence Analysis
[0098] ABI sequence results were analyzed using the ABI sequence
analysis software version 3.3. Individual sequences were aligned
against a consensus derived from all patient sequence data and
against HCV types 1a (Accession Number AF009606) and 1b (Accession
Number AJ000009) deposited in Genbank (Yanagi, 1997 #227) (Yanagi,
1998 #228). The two Genbank sequences were chosen for comparison
because they are available as cloned constructs for use as positive
controls for subsequent protein expression assays (data not shown).
Amino acids that differ from the consensus are compared and used to
determine which residues are conserved or variable.
Nucleotide Sequence GenBank Accession Numbers
[0099] The nucleotide sequences described herein have been
deposited with the American Type Culture Collection (ATCC), 10801
University Boulevard, Manassas, Va. 20110-2209, on Apr. 9, 2001 and
assigned Accession Numbers AF369214 through AF369263. These
deposits will be maintained under the terms of the Budapest Treaty
on the International Recognition of the Deposit of Microorganisms
for the Purposes of Patent Procedure. These deposits were made
merely as a convenience for those of skill in the art and is not an
admission that a deposit is required under 35 U.S.C. .sctn.112.
RESULTS
Sequence Analysis of the HCV NS3 Helicase Gene
[0100] A nested PCR reaction was used to amplify and sequence the
HCV NS3 helicase gene from the sera of 43 patients infected with
HCV subtypes 1a or 1b. The conserved 5' untranslated region was
used to place each isolate into the respective genotype using the
method of O'Brien et al.. Genotype results show that 30 sequences
were HCV subtype 1a and 13 were subtype 1b. These data are
consistent for the patient population, with HCV subtypes 1a and 1b
being the most prevalent in this region of the world. From the NS3
sequence data, a patient-derived consensus sequence was generated
and used to determine the genetic variability of the patient
isolates for both nucleotide distribution and amino acid
substitution.
[0101] Within the sequences analyzed, significant variation in
nucleotide and amino acid sequence was identified. There are 1350
nucleotides which encode the NS3 helicase gene. Sequence data was
analyzed to determine the nucleotide distribution at each position
when compared to the patient derived consensus sequence and the two
prototype sequences from Genbank (Genbank # AF009606 & #
AJ000009). For those isolates belonging to HCV subtype 1a, 436
positions contained one or more nucleotide substitutions when
compared to the patient consensus sequence, resulting in an overall
sequence variation of 32.30%. These included 355 (26.30%)
transitions, 30 (2.22%) transversions and 51 (3.78%) with both
transitions and tranversions. The HCV1a prototype differed at 34
positions (overall sequence variation of 2.52%), with 30 positions
containing transitions and 4 containing transversions. No
insertions or deletions were detected in either the patient
sequences or the prototype. For isolates typing as HCV subtype 1b,
390 positions contained one or more substitutions when compared to
the patient consensus sequence, for an overall sequence variation
of 28.89%. There were 309 (22.89%) transitions, 36 (2.67%)
transversions and 45 (3.33%) containing both transitions and
tranversions. There were 55 positions in the HCV 1b prototype
sequence that were different than the patient-derived consensus,
with an overall sequence difference of 4.07%, with 47 transitions
and 8 transversions. Insertions or deletions were not detected in
any sequences. Since the predicted mutation rate introduced during
PCR amplification is .about.0.1%, it is believed that the data
presented herein portrays an accurate representation of natural
genetic sequence variation.
[0102] There are 450 amino acids that comprise the NS3 protease.
The effects of nucleotide substitution on the amino acid sequence
showed that most of the substitutions were silent. For the 30
patient sequences belonging to HCV subtype 1a, 65 residues or
14.44% differed from the patient-derived consensus (Table 5A). The
published sequence differed from the patient consensus by 5
residues. Most sites had a single species substitution, 6 sites had
three amino acid species present, with 2 sites (residues 334 &
383; numbering within NS3) able to tolerate 4 different residues.
Including the control sequence, 38 sites had substitutions of the
same amino acid type, 20 sites were able to accommodate either
neutral or polar amino acids, 2 sites basic or polar, 2 sites
acidic or polar, 1 site basic or neutral, 1 site acidic or neutral,
and 1 site basic, polar or neutral. Only 1 patient (pt. 186) was
identical to the consensus with no amino acid substitutions. Table
5A summarizes those mutations which occur in more than one patient
sequence.
[0103] For patient isolates which typed as HCV 1b, there was an
overall sequence variation of 11.33% with 51 sites different from
the patient derived consensus (Table 5B). The patient consensus
differed from the GenBank sequence by 13 residues, including 4 new
residues, bringing the total number of sites containing one or more
amino acids to 55 or 12.22% sequence variation. Three amino acid
species were present in 9 sites, with residue 402 able to have 5
different amino acids and residue 470 having 7 different amino
acids. The same type of amino acid substitution was seen in 26
sites, while, 20 sites were able to accommodate either neutral or
polar amino acids, 5 sites basic or polar, 1 site acidic or polar,
1 acidic or basic and two sites could accommodate neutral or polar
or basic amino acids (Table 5B). No patients were identical to the
consensus sequence.
[0104] The difference between the consensus sequences for HCV types
1a or 1b showed an overall amino acid sequence similarity of 96.4%.
The conserved motifs were surprisingly similar differing by only 4
residues (259, 263, 269 & 270). No correlation could be made
between mutations in HCV types 1a and 1b. Among all the sequences,
amino acid substitutions at residues which are homologous in
function to those of other helicases in the same family (shaded
residues in the Tables 5A and 5B) were not found. However, several
mutations were found within and in close proximity to the seven
motifs. Most substitutions occur only in one sequence, suggesting a
random substitution due to base misincorporation by RT polymerase.
HCV 1a sequences showed no substitutions in motif I, 1 substitution
of L2261 in motif Ia (pt. 4C), 1 substitution of S263G in the
nucleic acid binding motif (pt. 4B), 1 V3291 substitution in motif
III (pt's. 23, 24, 270, 1H, 1X, 3T, 1C), 2 substitutions in motif
IVa; K371R (pt. 1D) and K372R (pt's 4 and 1C), and 3 substitutions
in motif V; A410S (1a control), A410T (pt. 3S) and F418Y (pt's. 4,
12, 177, 194, 198, 3P, 3S, 3T, 4C, K, and 174). The first
gatekeeper motif had 1 substitution, S424T (pt's 1X and K), motif
VI had 5 substitutions; R458S (pt. 3S), T459S (pt. 5P), R461L (pt.
3S), K469R (pt's. 1X, 5P, 174 and 183) and P470Q (pt. 4C), and the
last gatekeeper motif had 3 substitutions; D496N (pt. 38), A497T
(pt. 11) and G498S (pt. 4B). Of all the mutations, the
substitutions in motif IVa were the most surprising since these two
lysine residues, at positions 371 and 372, have been shown to be
important in stabilizing the ss nucleic acid strand. The amino acid
change of lysine to arginine in both cases indicates a need for a
basic amino acid at this position. Another substitution which was
interesting was at position 410 in motif V. This was interesting
because the prototype sequence contained a serine instead of an
alanine, a serine at this position is in most published sequences,
however, the sequence presented herein identified as SEQ ID NO:1
showed an alanine presence in the patient derived consensus except
for one patient who had an threonine at this position (pt. 3S).
Positions 229, 418 and 469 proved interesting because several
patients contained these substitutions, however, the significance
of these remain unknown.
[0105] Amino acid substitutions in HCV1a isolates at positions
outside existing motifs showed a high prevalence of mutations in
several regions. A change from isoleucine to valine at positon 248
occurred in 9 out of 30 HCV 1a patients. Surrounding residues from
240 to 252 also showed a high degree of mutation. Residue 281 could
be either glycine (consensus) or arginine (7 patients). This is
surprising because the transition is from a simple to a bulky side
chain. Other regions which contain higher frequency of substitution
was from residue 229 to 358 and 382 to 386, residues 455 to 461,
residue 557 and the COOH terminus.
[0106] Motif I in HCV1b sequences had 1 substitution, K213R (pt's.
3N and 3Q), no substitutions in Ia, 3 in the nucleic acid binding
motif; A263G (control), P264S (control, pt's 1A, 2D, 3N, 6A) and
1265V (pt. 3Q). Motif II had 2 substitutions; I288M (pt. 1U), and
T295I (pt. 1A), motifs III and IVa did not contain any mutations,
while motif V contained 2; V406A (pt. 3O) and F418Y (pt. 3Q). Both
gatekeeper motifs did not contain mutations. Motif VI contained 1
at position 470. This mutation was significant in that a total of 7
amino acids were found: R470S (control and pt. 6A), R470M (pt's.
1G, 1U and 3N), R470G (pt's 179 and 3Q), R470V (pt128), R470P (pt.
3O) and R470A (pt. 1). Similarities to HCV1a were found in regions
outside of the known motifs. Positions 240 to 256, 334 to 358, 382
to 386 and the COOH terminus contained `hot` regions.
The Effects of IFN Treatment
[0107] The most significant differences were noticed when isolates
were grouped according to whether or not the host had received
interferon therapy. A significant overall decrease in sequence
variability in both HCV types 1a and 1b was evident after IFN
therapy with or without ribavirin. Thus, interferon plays a role in
quasispecies selection.
[0108] For HCV1a isolates which had not been subjected to
interferon therapy, the overall number of mutations per patient
averaged 6.47 per sequence. A total of 59 different residues were
affected. After interferon therapy, the number of mutations
averaged 5.0 per patient with 25 sites containing different amino
acids giving an overall 56.14% drop in positions mutated (Table
5A). For type 1b isolates, the average number of mutations per
patient for isolates not subjected to interferon therapy was 8.9
with 53 sites varying overall. However, after interferon therapy,
the number of mutations per patient was 6.33, and the number of
sites which contained mutations dramatically dropped in the 1b
isolates to only 16, or by 69.78% (Table 5B). This suggests that
the sensitive strains were eliminated during interferon therapy and
these remaining sites may somehow be involved in resistance of the
virus to interferon. No differences in either type 1a or 1b were
noticed for those isolates which were subjected to combination
therapy with ribavirin as opposed to interferon alone, and no
correlation could be made between number or positions of mutations
and viral load.
[0109] All references cited herein are expressly incorporated by
reference.
Equivalents
[0110] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims. TABLE-US-00001 TABLE 1A HCV SEQ ID NO TYPE NAME
SEQUENCE 1 2539U 5'-CCTGCTTGTGGATGATG-3' 2 5622L
5'-CTGATGAAATTCCACATGTGCTTCGCCCA-3' 3 2727U
5'-CTACTCCTGCTCCTGCTGGCGTT-3' 4 5442L
5'-CACTCTTCCATCTCATCGAACTCCTGGTAGAG-3' 5 2916U
5'-GTGTGGGTYCCCCCCCTCAAC-3' 6 5268L
5'-GCCGACATGCATGYCATGATGTATTT-3' 7 1a 3254U 5'-GAGCCCGTCGTCTTCTC-3'
8 and 3486U 5'-GGCCGGGACAASAACCA-3' 9 1b 3723U
5'-TCGGACCTTTACTTGGTCACGAG-3' 10 4240L
5'-AGGAACTTGCCWTAGGTGGAGTA-3' 11 3753L
5'-CGCCGGCGCACCGGAATGACATC-3' 12 4218U
5'-TACTCCACCTATGGCAAGTTCCT-3' 13 4896U
5'-GAGTGCTATGACGCGGGCTGTGCTT-3' 14 4284L 5'-GAGTGGCACTCATCACA-3' 15
4509U 5'-CATCTCATYTTCTGCCA-3' 16 4710L 5'-TCGACTGTCTGRGTGACACA-3'
17 5145U 5'-CCATCGTGGGAYCAAATGTGGAAGTGT-3' 18 5268U
5'-AAATACATCATGRCATGCATGTCGGC-3' 19 5622U
5'-TGGGCGAAGCACATGTGGAATTTCATCAG-3' 20 5993U
5'-GCCATCCTCTCTCCTGGTGCCCT-3' 21 5790I 5'-CACCCAYCCCCCCAAKATGTT-3'
22 3127U 5'-CCGGRGGTCATTAYGTSCAAATGG-3' 23 5700L
5'-CGCGGGGTTTCCAGGCAG-3'
[0111] TABLE-US-00002 TABLE 1B HCV SEQ ID NO TYPE NAME SEQUENCE 24
HCV2aU-1 5'-GGG ACY TAC ATC TAT GAY CA-3' 25 2a HCV2aU-2 5'-TGA TCT
TCA GTC CGA TGG AGA-3' 26 HCV2aL-1 5'-ATG CCG CTR ATG AAR TTC CAC
AT-3' 27 HCV2aL-2 5'-CTG AAY GCC ATC ATG GAR GCC A-3'
[0112] TABLE-US-00003 TABLE 1C HCV SEQ ID NO TYPE NAME SEQUENCE 28
HCV2bU-1 5'-CCA ATG GAG AAG AAG GTC A-3' 29 HCV2bU-2 5'-ATG TGG AGA
CAT CCT GCA-3' 30 HCV2bL-1 5'-TTG TGG CCT GTT GTA GGA-3' 31
HGV2bL-2 5'-GCG CAT TCT TCC ATC TCA-3' 32 HCV2b seqU1 5'-CCG AAA
CGC TGA YGT CAT-3' 33 2b HCV2b seqU2 5'-GGA TGG AGG CTG CTC AGC-3'
34 HCV2b seqU3 5'-AGA CCC GAC CTT TAC CAT-3' 35 HCV2b seqU4 5'-TTA
CCC GTG TGT CAA GAC CA-3' 36 HCV2b seqL1 5'-CCA ATG ATG GAR ATG
CAG-3' 37 HCV2b seqL2 5'-CCT TTG CSC TAG CGC ATA-3' 38 HCV2b seqL3
5'-GAG CAC TAC GCT GTC GAA-3' 39 HCV2b seqL4 5'-TGG CTG TGG CTA GAA
CCA-3' 40 HCV2b seqL5 5'-GTA GGC CCC AAA ACC AAG-3' 41 HCV2b seqL6
5'-GCY CTG AAC AAG CCC ACG-3' 42 HCV2b seqL7 5'-ACA TCT GRG TGA CTG
GTC-3'
[0113] TABLE-US-00004 TABLE 1D SEQ HCV ID NO TYPE NAME SEQUENCE 43
HCV3aU-1 5'-CCY GTA ATA TTT AGT CCC A-3' 44 3a HCV3aU-2 5'-TGG AAA
TCA AGG TCA TCA-3' 45 HCV3aL-1 5'-GTA GCT ACT ATG GGC TCA A-3' 46
HCV3aL-2 5'-GCT TGC TCG ATG TAC GGG-3'
[0114] TABLE-US-00005 TABLE 1E SEQ HCV ID NO TYPE NAME SEQUENCE 47
HCV3bU-1 5'-CCC GTC ATC TTT AGT CCT A-3' 48 3b HCV3bU-2 5'-TGG AGA
TTA AGG TTA TCA-3' 49 HCV3bL-1 5'-GAT TGC ACT ATG GGT CGA A-3' 50
HCV3bL-2 5'-GCT TGC TCG ATG TAA GGA-3'
[0115] TABLE-US-00006 TABLE 1F SEQ HCV ID NO TYPE NAME SEQUENCE 51
3486U 5'-GGC CGG GAC AAS AAC CA-3' 52 3723U 5'-TCG GAC CTT TAC TTG
GTC ACG AG-3' 53 3753L 5'-CGC CGG CGC ACC GGA ATG ACA TC-3' 54
4218U 5'-TAC TCC ACC TAT GGC AAG TTC CT-3' 55 4a 4240L 5'-AGG AAC
TTG CCW TAG GTG GAG TA-3' 56 4284L 5'-GAG TGG CAC TCA TCA CA-3' 57
4509U 5'-CAT CTC ATY TTG TGC CA-3' 58 4710L 5'-TCG ACT GTC TGR GTG
ACA CA-3' 59 4896U 5'-GAG TGC TAT GAC GCG GGC TGT GCT T-3' 60 5145U
5'-CCA TCG TGG GAY CAA ATG TGG AAG TGT-3' 61 5268U 5'-AAA TAC ATG
ATG RCA TGC ATG TCG GC-3' 62 5268L 5'-GCC GAC ATG CAT GYC ATG ATG
TAT TT-3' 63 5442L 5'-CAC TCT TCC ATC TCA TCG AAC TCC TGG TAG
AG-3'
[0116] TABLE-US-00007 TABLE 1G SEQ BASE ID NO PAIRS TYPE SEQUENCE 1
-881 bp Amplification 5'-CCTGCTTGTGGATGATG-3' 2 2230 bp
5'-CTGATGAAATTCCACATGTGCTTCGCCCA-3' 3 -693 bp
5'-GTACTCCTGCTCCTGCTGGCGTT-3' 4 2053 bp
5'-CACTCTTCCATCTGATCGAACTCGTGGTAGAG-3' 64 -504 bp
5'-GTGTGGGTTCCGGCCCTCAACGT-3' 6 1873 bp
5'-GCCGACATGCATGYCATGATGTATTT-3' 7 -166 bp Sequencing
5'-GAGCCCGTCGTCTTCTC-3' 8 66 bp 5'-GGCCGGGACAASAACCA-3' 9 303 bp
5'-TCGGACCTTTACTTGGTCACGAG-3' 10 918 bp
5'-AGGAACTTGCCWTAGGTGGAGTA-3' 11 355 bp
5'-CGCCGGCGCACCGGAATGACATC-3'
[0117] TABLE-US-00008 TABLE 2 A. NS3 Position 1a pCV-H77C
GATGCACCGCTTTATGCAGA 1a consensus AGCRTGTTAACGCGCAAGAG B. NS3
Position 1b pCV-J4L6S AGTATACTGTATATCAGTAAATCACTTTTCGTCCATCT 1b
consensus GCCGCGTCACGCRATTCCGGGCTGTCCCCTAYTTGCTC The nucleotide
position within NS3 is indicated.
[0118] TABLE-US-00009 TABLE 3 10 20 30 40 50 60 70 1a Con
APITAYAQQT RGLLGCIITS LTGRDKNQVE GEVQIVSTAA QTFLATCING VCWTVYHGAG
TRTIASPKGP 1a ---------- ---------- ---------- ---------T
---------- ------.cndot.--- ---------- No Treatment pt. K
---------- ---------- ---------- ---------- ----------
------.cndot.--- ---------- pt. 4 ---------- ---------- ----------
---------- ---------- ------.cndot.--- ---------- pt. 12 ----------
---------- --------A- ---------- ---------- ------.cndot.---
------S--- pt. 24 ---------- ---------- ---------- ----------
---------- ------.cndot.--- ---M------ pt. 161 ----------
---------- ---------- ---------- ---------- ------.cndot.---
---------- pt. 170 ---------- ---------- --------A- ----------
---------- ------.cndot.--- ---------- pt. 177 ----------
---------- --------A- ---------- ---------- ------.cndot.---
---------- pt. 194 ---------- ---------- ---------- ----------
---------- ------.cndot.--- ---------- pt. 1C ---------- ----------
---------- ---------T ---------- ------.cndot.--- ---------- pt. 1H
---------- ---------- ---------- ---------T ----------
------.cndot.--- ---------- pt. 1X ------T--- ---------- ----------
---------- ---------- ------.cndot.--- ---------- IFN Treatment pt.
11 ---------- ---------- --------A- ---------- ----------
------.cndot.--- ---------- pt. 252 ---------- ----------
---------- --I-V----- -S-------- ------.cndot.--- S--------- pt.
174 ---------- ---------- ------D--- ---------- ----------
------.cndot.--- ---------- pt. 176 ---------- ----------
---------- ---------- ---------- ------.cndot.--- ---------- pt.
183 ---------- ---------- -----N---- ---------- ----------
------.cndot.--- A--------- pt. 186 ---------- ----------
---------- ---------- ---------- ------.cndot.--- ---------- pt. 1D
---------- ---------- ---------- ---------- ----------
------.cndot.--- ---L------ pt. 1Y ---------- ---------- ----------
---------- ---------- ------.cndot.--- ---------- 1a amb.
------*--- ---------- -----**-*- --*-*----* -*--------
------.cndot.--- **-*--*--- 80 90 100 110 120 130 1a Con VIQMYTNVDK
DLVGWPAPQG ARSLTPCTCG SSDLYLVYTH ADVIPVRRRG DSRGSLLSPR 1a
---------Q .cndot.--------- S-----.cndot.-.cndot.- ----------
---------- ---------- No Treatment pt. K ----------
.cndot.--------- ------.cndot.-.cndot.- ---------- ----------
---------- pt. 4 ---------- .cndot.--------- S-----.cndot.-.cndot.-
---------- ---------- ---------- pt. 12 ---------- .cndot.---------
T-----.cndot.-.cndot.- ---------- ---------- ---------- pt. 24
---------- .cndot.--------- ------.cndot.-.cndot.- ----------
---------- ---------- pt. 161 ---------- .cndot.---------
------.cndot.-.cndot.- ---------- ---------- ---------- pt. 170
---------- .cndot.--------- T-----.cndot.-.cndot.- ----------
---------- ---------- pt. 177 ---------- .cndot.---------
T-----.cndot.-.cndot.- ---------- ---------- ---------- pt. 194
---------Q .cndot.--------- ------.cndot.-.cndot.- ----------
---------- ---------- pt. 1C ---------- .cndot.---------
------.cndot.-.cndot.- ---------- ---------- ----G----- pt. 1H
---------- .cndot.--------- T-----.cndot.A.cndot.- ----------
--------Q- ---------- pt. 1X ---------- .cndot.---------
------.cndot.-.cndot.- ---------- --------Q- ---------- IFN
Treatment pt. 11 ---------- .cndot.--------- T-----.cndot.-.cndot.-
---------- ---------- ---------- pt. 252 ----------
.cndot.--------- S-----.cndot.-.cndot.- ---------- ----------
---------- pt. 174 ---------- .cndot.---------
S-----.cndot.-.cndot.- ---------- ---------- ---------- pt. 176
---------Q .cndot.--------- ------.cndot.-.cndot.- ----------
---------- ---------- pt. 183 ---------- .cndot.----L----
------.cndot.-.cndot.- ---------- ---------- ---------- pt. 186
---------- .cndot.--------- ------.cndot.-.cndot.- ----------
--------Q- ---------- pt. 1D I--------- .cndot.----S----
------.cndot.-.cndot.- ---------- ---------- ---------- pt. 1Y
---------- .cndot.--------- S-----.cndot.-.cndot.- ----------
---------- ---------- 1a amb. *--------* .cndot.----*----
*-----.cndot.*.cndot.- ---------- --------*- ----*----- 140 150 160
170 180 1a Con PISYLKGSSG GPLLGPAGHA VGIFRAAVCT RGVAKAYDFI
PVENLETTMR S 1a --------.cndot.- ----.cndot.---.cndot.- --L-------
---------- -----G---- - No Treatment pt. K --------.cndot.-
----.cndot.---.cndot.- ---------- ---------- ---------- - pt. 4
--------.cndot.- ----.cndot.---.cndot.- ---------- ----------
---------- - pt. 12 --------.cndot.- ----.cndot.---.cndot.-
---------- ---------- ---------- - pt. 24 --------.cndot.-
----.cndot.---.cndot.- ---------- ---------- ---------- - pt. 161
--------.cndot.- ----.cndot.---.cndot.- ---------- ----------
---------- - pt. 170 --------.cndot.- ----.cndot.---.cndot.-
---------- ---------- ---------- - pt. 177 --------.cndot.-
----.cndot.---.cndot.- ---------- ---------- ---------- - pt. 194
--------.cndot.- ----.cndot.---.cndot.- --L------- ----------
---------- - pt. 1C --------.cndot.- ----.cndot.---.cndot.-
---------- ---------- ---------- - pt. 1H --------.cndot.-
----.cndot.---.cndot.- ---------- ---------- ---------- - pt. 1X
-V------.cndot.- ----.cndot.---.cndot.- ---------- ----------
---------- - IFN Treatment pt. 11 --------.cndot.-
----.cndot.---.cndot.- ---------- ---------- ---------- - pt. 252
--------.cndot.- ----.cndot.---.cndot.- ---------- ----------
---------- - pt. 174 --------.cndot.- ----.cndot.---.cndot.-
---------- ---------- ---------- - pt. 176 --------.cndot.-
----.cndot.---.cndot.- ---------- ---------- ---------- - pt. 183
--------.cndot.- ----.cndot.---.cndot.- ---------- ----------
---------- - pt. 186 --------.cndot.- ----.cndot.---.cndot.-
---------- ---------- ---------- - pt. 1D --------.cndot.-
----.cndot.---.cndot.- --L------- ---------- ---------- - pt. 1Y
--------.cndot.- ----.cndot.---.cndot.- ---------- ----------
---------- - 1a amb. -*------.cndot.- ----.cndot.---.cndot.-
--*------- ---------- ---*-*---- -
[0119] TABLE-US-00010 TABLE 4 10 20 30 40 50 60 70 1b Con
APITAYSQQT RGLLGCIITS LTGRSKNQVE GEVQVVSTAT QSFLATCVNG VCWTVYHGAG
SKTLAGPKGP 1b ---------- --V------- ---------- ----------
-------I-- ------.cndot.--- ---------- No Treatment pt. 1
---------- ---------- ---------- ---------- ----------
------.cndot.--- ---------- pt. 153 ---------- ----------
---------- ---------- ---------- ------.cndot.--- ---------- pt. 1A
---------- ---F------ ---------- ---------- -------I--
------.cndot.--- C--------- pt. 1G ------A--- ---F------ ----------
---------- -------I-- ---S--.cndot.--- ------Q--- pt. 1U ------A---
---------- ---------- ---------- ---------- -----F.cndot.---
------A--- pt. 2D ---------- ---------- ---------- ----------
-------I-- ------.cndot.--- T--------- pt. 2F ---------- ----------
---------- ---------- ---------- ------.cndot.--- ---------- pt. 23
---------- ---------- ---------- ---------- ----------
------.cndot.--- -K-------- IFN Treatment pt. 179 ----------
---------- ---------- ---------- ---------- ------.cndot.---
---------- pt. 205 ---------- ---------- ---------- ----------
---------- ------.cndot.--- T-----S--- pt. 25 ---------- ----------
---------- ---------- ---------- ------.cndot.--- ---L------ 1b
amb. ------*--- --**------ ---------- ---------- -------*--
---*-*.cndot.--- **-*--*--- 80 90 100 110 120 130 1b Con ITQMYTNVDQ
DLVHWQAPPG ARSLTPCTCG SSDLYLVYTH ADVIPVRRRG DSRGSLLSPR 1b
---------L .cndot.--------- ---M--.cndot.S.cndot.- ----------
---------- ---------- No Treatment pt. 1 ----------
.cndot.--------- ------.cndot.-.cndot.- ---------- ----------
---------- pt. 153 ---------- .cndot.---------
------.cndot.-.cndot.- ---------- ---------- ---------- pt. 1A
---------- .cndot.--------- ------.cndot.-.cndot.- ----------
---------- ---------- pt. 1G ---------- .cndot.---------
------.cndot.-.cndot.- ---------Q ---------- ---------- pt. 1U
---------- .cndot.--------- ------.cndot.-.cndot.- ----------
---------- ---------- pt. 2D ---------- .cndot.-------S-
------.cndot.-.cndot.- ---------- ------C--- ---------L pt. 2F
---------- .cndot.--------- ------.cndot.-.cndot.- ----------
---------- ---------- pt. 23 ---------Q .cndot.---------
------.cndot.-.cndot.- ---------- ---------- ---------- IFN
Treatment pt. 179 V--------- .cndot.---------
----I-.cndot.-.cndot.- ---------- ---------- ---------- pt. 205
---------- .cndot.--------- ------.cndot.-.cndot.- ----------
---------- ---------- pt. 25 ---------Q .cndot.----V----
------.cndot.-.cndot.- ---------- ---------- ---------- 1b amb.
*--------* .cndot.----*--*- ---**-.cndot.*.cndot.- ---------*
------*--- ---------* 140 150 160 170 180 1b Con PVSYLKGSSG
GPLLCPSGHA VGIFRAAVCT RGVAKAVDFV PVESMETTMR S 1b --------.cndot.-
----.cndot.---.cndot.V --V------- ---------I ---------- - No
Treatment pt. 1 -I------.cndot.- ----.cndot.---.cndot.V ----------
---------- ---------- - pt. 153 --------.cndot.-
----.cndot.---.cndot.- ---------- ---------- ---------- - pt. 1A
-I------.cndot.- ----.cndot.---.cndot.- ---------- ----------
---------- - pt. 1G -I------.cndot.- ----.cndot.---.cndot.V
---------- ---------- ---------- - pt. 1U --------.cndot.-
----.cndot.---.cndot.- ---------- ---------I -------I-- - pt. 2D
--------.cndot.- ----.cndot.---.cndot.- ---------- ----------
---------- - pt. 2F -I------.cndot.- ----.cndot.---.cndot.-
---------- ---------- ---------- - pt. 23 --------.cndot.-
----.cndot.---.cndot.- ---------- ---------- ---S------ - IFN
Treatment pt. 179 --------.cndot.- ----.cndot.---.cndot.-
---------- ---------- ---------- - pt. 205 -I------.cndot.-
----.cndot.---.cndot.- ---------- ---------I ---------- - pt. 25
--------.cndot.- ----.cndot.---.cndot.- ---------- ----------
---S------ - 1b amb. -*------.cndot.- ----.cndot.---.cndot.*
--*------- ---------* ---*---*-- -
[0120] TABLE-US-00011 TABLE 5A 190 200 210 220 230 240 250 260
+TL,64 Consensus PVFTDNSSP PAVPQSFQVA HLHAPTGSGK STKVPAAYAA
QGYKVLVLNP SVAATLGFGA YMSKAHGIDP NIRTGVRTIT 1a --------- ----------
---------- ---------- ---------- 0--------- -------V-- ----------
No Treatment pt. 4 --------- ---------- ---------- ----------
---------- 0--------- ---------- ---------- pt. 12 ---------
---------- ---------- ---------- ---------- 0--------- --------E-
---------- pt. 23 --------- -----T---- ---------- ----------
---------- 0--------- ---------- ---------- pt. 24 ---------
---------- ---------- ---------- ---------- 0--------- ----------
---------- pt. 170 --------- ---------- ---------- ----------
---------- 0--------- ---------- ---------- pt. 177 ---------
---------- ---------- ---------- ---------- 0--------- ----------
---------- pt. 194 --------- ---------- ---------- ----------
---------- 0--------- ---------- ---------- pt. 198 ---------
---------- ---------- ---------- ---------- 0--------- -------V--
---------- pt. 1H --------- ---------- ---------- ----------
---------- 0--------- --------E- ---------- pt. 1X ---------
---------- ---------- ---------- ---------- 0--------- -------V-V
---------- pt. 3P --------- ---------- ---------- ----------
---------- 0--------- -------V-- ---------- pt. 3S ---------
---------- ---------- ---------- ---------- 0--------- ----------
-V-------- pt. 3T -------T- ---------- ---------- ----------
---------- 0--------- -------V-- ---------- pt. 4B ---------
---------- ---------- ---------- ---------- 0--------- ----------
---------- pt. 4C --------- -V-------- ---------- ----------
-----I---- 0--------- ---------- ---------- pt. 4V ---------
---------- ---------- ---------- ---------- 0--------- ----------
---------- pt. 5P --------- ---------- ---------- ----------
---------- 0--------- ---R------ ---------- pt. 5Y ---------
---------- ---------- ---------- ---------- 0--------- ----------
---------- pt. 5Z --------- ---------- ---------- ----------
---------- 0--------- ---------- ---------- IFN Treatment pt. K
--------- ---------- ---------- ---------- ---------- 0--------V
-------V-- ---------- pt. 11 --------- ---------- ----------
---------- ---------- 0--------- ---------- ---------- pt. 25
--------- ---------- ---------- ---------- ---------- 0---------
-------V-- ---------- pt. 161 --------- ---------- ----------
---------- ---------- 0--------- ---------- ---------- pt. 174
--------- ---------- ---------- ---------- ---------- 0---------
-------V-- -L-------- pt. 176 --------- ---------- ----------
---------- ---------- 0--------- ---------- ---------- pt. 183
--------- ---------- ---------- ---------- ---------- 0---------
---------- ---------- pt. 186 --------- ---------- ----------
---------- ---------- 0--------- ---------- ---------- pt. 252
--------- ---------- ---------- ---------- ---------- 0---------
---------- ---------- pt. 1C --------- ---------- ----------
---------- ---------- 0--------- -------V-- ---------- pt. 1D
--------- ---------- ---------- ---------- ---------- 0---------
---------- ---------- 1a amb. -------*- -*---*---- ----------
---------- -----*---- 0--------* ---*---*** -*-------- Impt. A.A.
--------- ---------- ----.cndot..cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot.-------
----.cndot..cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot.------- ---------- ---------- Motif I Motif Ia
270 280 290 300 310 320 330 340 Consensus TGSPITYSTY GKFLADGGCS
GGAYDIIICD ECHSTDATSI LGIGTVLDQA ETAGARLVVL ATATPPGSVT VPHPNIEEVA
1a --------0- ---------- ---------- ---------- ----------
---------- ---------- -S-------- No Treatment pt. 4 --------0-
---------- ---------- ---------- ---------- ---------- ----------
---------- pt. 12 --------0- ---------- ---------- ----------
---------- ---------- ---------- ---------- pt. 23 --------0-
---------- ---------- ---------- ---------- ---------- --------I-
---------- pt. 24 --------0- ---------- ---------- ----------
---------- ---------- --------I- ---------- pt. 170 --------0-
---------- ---------- ---------- ---------- ---------- --------I-
---H------ pt. 177 --------0- ---------- ---------- ---------V
---------- ---------- ---------- ---------- pt. 194 --------0-
---------- ---------- ---------- ---------- ---------- ----------
---------- pt. 198 --------0- ---------- R--------- ----------
---------- ---------- ---------- ---------- pt. 1H --------0-
---------- ---------- ---------- ---------- ---------- --------I-
---------- pt. 1X --------0- ---------- ---------- ----------
---------- ---------- --------I- ---S------ pt. 3P --------0-
---------- R--------- ---------- ---------- ---------- ----------
-S-------- pt. 3S --------0- ---------- R--------- ----------
---------T ---------- ---------- ---------- pt. 3T --------0-
---------- R--------- ---------- ---------- ---------- --------I-
---------- pt. 4B --G-----0- ---------- R--------- ----------
---------- ---------- ---------- ---------- pt. 4C --------0-
---------- ---------- ---------- ---------- ---------- ----------
-A-------- pt. 4V --------0- ---------- ---------- ----------
---------- ---------- ---------- ---------- pt. 5P --------0-
------S--- R--------- ---------- ---------- ---------- ----------
---*------ pt. 5Y --------0- ---------- ---------- ----------
---------- ---------- ---------- ---------- pt. 5Z --------0-
---------- ---------- ---------- ---------- ---------- ----------
---------- IFN Treatment pt. K --------0- ---------- ----------
---------- ---------- ---------- ---------- ---S------ pt. 11
--------0- ---------- ---------- ---------- ---------- ----------
---------- ---S------ pt. 25 --------0- ---------- ----------
---------- ---------- ---------- ---------- ---------- pt. 161
--------0- ---------- ---------- ---------- ---------- ----------
---------- ---------- pt. 174 --------0- ---------- ----------
---------- ---------- ---------- ---------- ---------- pt. 176
--------0- ---------- ---------- ---------- ---------- ----------
---------- ---------G pt. 183 --------0- ---------- ----------
---------- ---------- ---------- ---------- ---------- pt. 186
--------0- ---------- ---------- ---------- ---------- ----------
---------- ---------- pt. 252 --------0- ---------- ----------
---------- ---------- ---------- ---------- ---------- pt. 1C
--------0- ---------- ---------- ---------- ---------- --------I-
---------- ---------- pt. 1D --------0- ---------- R---------
---------- ---------- ---------- ---------- ---------- 1a amb.
--*-----0- ------*--- *--------- ---------* ---------* ----------
--------*- -*-*-----* Impt. A.A.
---.cndot..cndot..cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot..cndot..cndot.-----
-----.cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot..cndot..cndot..cndot.---- ----------
-----.cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot..cndot..cndot..cndot..cndot..cndot..cndot.-
---------- Nucleic Acid Binding Motif II Motif III 350 360 370 380
390 400 410 420 Consensus LSTTGEIPFY GKAIPLEVIK GGRHLIFCHS
KKKCDELAAK LVALGINAVA YYRGLDVSVI PTSGDVVVVA TDALMTGFTG 1a
---------- ---------- ---------0 ---------- ---------- ----------
---------S 0--------- No Treatment pt. 4 ---------- ----------
---------0 -R------T- ---------- ---------- ---------- 0------Y--
pt. 12 ---------- ---------- ---------0 --------T- -T--------
---------- ---------- 0------Y-- pt. 23 ---------- ----------
---------0 ---------- ---------- ---------- ---------- 0---------
pt. 24 ---------- ---------- ---------0 ---------- ----------
---------- ---------- 0--------- pt. 170 ---------- ----------
---------0 ---------- ---M------ ---------- ----------
0---------
pt. 177 ---------- ---------- ---------0 ---------- --S--V----
---------- ---------- 0------Y-- pt. 194 ---------- ----------
---------0 ---------- -----V---- ---------- ---------- 0------Y--
pt. 198 ---------- ---------- ---------0 ---------- --G--V----
---------- ---------- 0------Y-- pt. 1H ---------- ----------
---------0 ---------- --S--V---- ---------- ---------- 0---------
pt. 1X ---------- -------A-- ---------0 ------V-T- ---M-V----
---------- ---------- 0--------- pt. 3P ---------- ----------
---------0 ---------- ---------- ---------- ---------- 0------Y--
pt. 3S ---------- ---------- ---------0 ---------- ----------
---------- ---------T 0------Y-- pt. 3T ---A------ ---V------
---------0 ---------- ---------- ---------- ---------- 0------Y--
pt. 4B ---------- ---------- ---------0 ---------- ----------
---------- ---------- 0--------- pt. 4C ------V--- ----------
---------0 ---------- ----V----- ---------- ---------- 0------Y--
pt. 4V ---------- -------A-- ---------0 ---------- -----V----
---------- ---------- 0--------- pt. 5P ---------- ----------
---------0 ---------- ---------- ---------- ---------- 0---------
pt. 5Y ---------- ---------- ---------0 ---------- --G-------
---------- ---------- 0--------- pt. 5Z ---------- ----------
---------0 ---------- -T-------- --------I- ---------- 0---------
IFN Treatment pt. K ---------- -------A-- ---------0 ----------
---------- ---------- ---------- 0------Y-- pt. 11 ----------
---------- ---------0 ---------- --T------- ---------- ----------
0--------- pt. 25 ---------- -------A-- ---------0 ----------
-----V---- ---------- ---------- 0--------- pt. 161 ----------
---------- ---------0 ---------- -----V---- ---------- ----------
0--------- pt. 174 ---------- -------A-- ---------0 ----------
-----V---- ---------- ---------- 0------Y-- pt. 176 ----------
---------- ---------0 ---------- ---------- ---------- -S--------
0--------- pt. 183 ------V--- ---------- ---------0 ----------
-----V---- ---------- ---------- 0--------- pt. 186 ----------
---------- ---------0 ---------- ---------- ---------- ----------
0--------- pt. 252 ---------- -------A-- ---------0 ----------
--G--V---- ---------- ---------- 0--------- pt. 1C ----------
---------- ---------0 -R-------- -----V---- ---------- -AN-------
0--------- pt. 1D ---------- -------*-- ---------0 R---------
--G--L---- ---------- ---------- 0--------- 1a amb. ---*--*---
---*---*-- ---------0 **----*-*- -*****---- --------*- -**------*
0------*-- Impt. A.A. ---------- ----------
-----.cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot..cndot.------ ---------- ----------
-----.cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot..cndot..cndot..cndot..cndot..cndot..cndot.-
Motif IVa Motif V 430 440 450 460 470 480 490 Consensus DFDSVIDCNT
CVTQTVDFSL DPTFTIETTT LPQDAVSRTQ RRGRTGRGKP GIYRFVAPGE RPSGMFDSSV
1a ---------- ---------- ---------- ---------- ----------
---------- ---------- No Treatment pt. 4 ---------- ----------
---------- ---------- ---------- -------T-- ---------- pt. 12
---------- ---------- ---------- ---------- ---------- -------T--
---------- pt. 23 ---------- ---------- ---------- ----------
---------- ---------- ---------I pt. 24 ---------- ----------
---------- ---------- ---------- ---------- ---------- pt. 170
---------- ---------- ---------- ---------- ---------- ----------
---------- pt. 177 ---------- ---------- ---------- ----------
---------- ---------- ---------- pt. 194 ---------- ----------
---------- ---------- ---------- ---------- ---------- pt. 198
---------- ---------- ---------- ---------- ---------- ----------
---------- pt. 1H ---------- ---------- ---------- ----------
---------- ---------- ---------I pt. 1X ---T------ ----------
---------- ------C--- --------R- ---------- ---------- pt. 3P
---------- ---------- ---------- ---------- ---------- ----------
---------- pt. 3S ---------- ---------- ------D--- ----S--S--
L--------- ---------- ---------- pt. 3T ---------- ----------
---------- ---------- ---------- ---------- ---------- pt. 4B
---------- ---------- ------D--- ---------- ---------- ----------
---------- pt. 4C ---------- ---------- ---------- ----------
---------Q ------T--- -----L---- pt. 4V ---------- ----------
---------- ---------- ---------- ---------- ---------- pt. 5P
---------- ---------- ---------- --------S- --------R- ----------
---------- pt. 5Y ---------- ---------- ---------- ----------
---------- ------T--- ---------- pt. 5Z ---------- ----------
---------- ---------- ---------- ---------- ---------- IFN
Treatment pt. K ---T------ ---------- ---------- ----------
---------- ---------- ---------- pt. 11 ---------- ----------
---------- ---------- ---------- ---------- ---------- pt. 25
---------- ---------- ---------- ---------- ---------- ----------
---------- pt. 161 ---------- ---------- ---------- ----------
---------- ---------- ---------- pt. 174 ---------- ----------
---------- ---------- --------R- ------T--- ---------- pt. 176
---------- ---------- ---------- ---------- ---------- ----------
---------- pt. 183 ---------- ---------- ---------- ----------
--------R- ---------- ---------- pt. 186 ---------- ----------
---------- ---------- ---------- ---------- ---------- pt. 252
---------- ---------- ---------- ---------- ---------- ------T---
---------- pt. 1C ---------- ---------- ---------- ----------
---------- ---------- ---------- pt. 1D ---------- ----------
---------- ---------- ---------- ---------- ---------- 1a amb.
---*------ ---------- ------*--- ----*-***- *-------** ------*---
-----*---* Impt. A.A.
----.cndot..cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot..cndot.------ ---------- ---------.cndot.
.cndot..cndot..cndot..cndot..cndot..cndot..cndot..cndot..cndot..cndot.
---------- ---------- Gatekeeper Motif VI 500 510 520 530 540 550
560 Consensus LCECYDAGCA WYELTPAETT VRLRAYMNTP GLPVCQDHLE
FWEGVFTGLT HIDAHFLSQT KQSGENLPYL 1a ---------- 0---------
---------- ---------- ---------- ---------- ------F--- No Treatment
pt. 4 ---------- 0--------- ---------- ---------- ----------
---------- ---------- pt. 12 ---------- 0--------- ----------
---------- ---------- ---------- ---------- pt. 23 ----------
0--------- ---------- ---------- ---------- ---------- ----------
pt. 24 ---------- 0--------- ---------- ---------- ----------
---------- ---------- pt. 170 ---------- 0--------- ----------
---------- ---------- ---------- ---------- pt. 177 ----------
0--------- ---------- ---------- ---------- ---------- ----------
pt. 194 ---------- 0--------- ---------- ---------- ----------
-M-------- ------F--- pt. 198 ---------- 0--------- ----------
---------- ---------- ---------- ------F--- pt. 1H ----------
0--------- ---------- ---------- ---------- ---------- ----------
pt. 1X ---------- 0--------- ---------- ---------- ----------
---------- ------F--- pt. 3P ---------- 0--------- ----------
---------- ---------- ---------- ------F--- pt. 3S --Q--N----
0--------- ---------- ---------- ---------A ---------- ----------
pt. 3T ---------- 0--------- ---------- ---------- ----------
---------- ---------- pt. 4B -------S-- 0--------- ----------
---------- ---------- ---------- ------F--- pt. 4C ----------
0--------- ---------- ---------- ---------- ----------
----------
pt. 4V ---------- 0--------- ---------- ---------- ----------
---------- ---------- pt. 5P ---------- 0--------- ----------
---------- ---------- ---------- ------F--- pt. 5Y ----------
0--------- ---------- ---------- ---------- ---------- ----------
pt. 5Z ---------- 0--------- ---------- ---------- ----------
---------- ------F--- IFN Treatment pt. K ---------- 0---------
---------- ---------- ---------- ---------- ---------- pt. 11
------T--- 0--------- ---------- ---------- ---------- ----------
---------- pt. 25 ---------- 0--------- ---------- ----------
---------- ---------- ---------- pt. 161 ---------- 0---------
---------- ---------- ---------- ---------- ------F--- pt. 174
---------- 0--------- ---------- ---------- ---------- ----------
------F--- pt. 176 ---------- 0--------- ---------- ----------
---------- ---------- ---------- pt. 183 ---------- 0---------
---------- ---------- ---------- ---------- ---------- pt. 186
---------- 0--------- ---------- ---------- ---------- ----------
---------- pt. 252 ---------- 0--------- ---------- ----------
---------- ---------- ---------- pt. 1C ---------- 0---------
---------- ---------- ---------- ---------- ---------- pt. 1D
---------- 0--------- ---------- ---------- ---------- ----------
------F--- 1a amb. --*--***-- 0--------- ---------- ----------
---------* -*-------- ------*--- Impt. A.A.
------.cndot..cndot..cndot..cndot.
.cndot..cndot..cndot..cndot..cndot.----- ---------- ----------
---------- ---------- ---------- Gatekeeper 570 580 590 600
Consensus VAYQATVCAR AQAPPPSWDQ MWKCLIRLKP TLHGPTPLLY 1a ----------
---------- ---------- ---------- No Treatment pt. 4 ----------
---------- ---------- ---------- pt. 12 ---------- ----------
---------- ---------- pt. 23 ---------- ---------- -----T----
---------- pt. 24 ---------- ---------- -----T---- ---------- pt.
170 ---------- ---------- -----T---- ---------- pt. 177 ----------
---------- ---------- ---------- pt. 194 ---------- ----------
-----T---- ---------- pt. 198 ---------- ---------- ----------
---------- pt. 1H ---------- ---------- ---------- ---------- pt.
1X ---------- ---------- ---------- N--------- pt. 3P ----------
---------- ---------- ---------- pt. 3S ---------- ----------
---------- ---------- pt. 3T ---------- ---------- ----------
---------- pt. 4B ---------- ---------- ---------- ---------- pt.
4C --------D- ---------- ---------- ---------- pt. 4V ----------
---------- ---------- ---------- pt. 5P I--------- ----------
---------- ---------- pt. 5Y ---------- ---------- ----------
---------- pt. 5Z ---------- ---------- ---------- ---------- IFN
Treatment pt. K ---------- ---------- ---------- ---------- pt. 11
---------- ---------- -----T---- ---------- pt. 25 ----------
---------- ---------- ---------- pt. 161 ---------- ----------
-----T---- ---------- pt. 174 ---------- ---------- ----------
---------- pt. 176 ---------- ---------- ---------- ---------- pt.
183 ---------- ---------- ---------- ---------- pt. 186 ----------
---------- ---------- ---------- pt. 252 ---------- ----------
---------- ---------- pt. 1C ---------- ---------- -----T----
---------- pt. 1D ---------- ---------- -----T---- ---------- 1a
amb. *-------*- ---------- -----*---- *--------- Impt. A.A.
---------- ---------- ---------- ---------- 610 620 630 Consensus
RLGAVQNEVT LTHPVTKYIM TCMSADLEVV T 1a ---------- ----I-----
---------- - No Treatment pt. 4 ---------- ----I----- A--------- -
pt. 12 ---------- ---------- ---------- - pt. 23 ----------
---------- ---------- - pt. 24 --------I- ----I----- ---------- -
pt. 170 ---------- ---------- ---------- - pt. 177 ----------
----I----- ---------- - pt. 194 ---------- ----I----- ---------- -
pt. 198 ---------- ----I----- ---------- - pt. 1H ----------
---------- ---------- - pt. 1X ---------- ---------- ---------- -
pt. 3P ---------I ----I----- A--------- - pt. 3S ----I-----
---------- ---------- - pt. 3T ---------- ---------- ---------- -
pt. 4B ---------- ----I----- ---------- - pt. 4C ----------
----I----- ---------- - pt. 4V ---------- ---------- ---------- -
pt. 5P --------I- ---------- ---------- - pt. 5Y ----------
----I----- ---------- - pt. 5Z ---------- ----I----- ---------- -
IFN Treatment pt. K ---------- ---------- A--------- - pt. 11
---------- ----I----- ---------- - pt. 25 --------I- ----------
---------- - pt. 161 ---------- ----I----- ---------- - pt. 174
---------- ----I----- A--------- - pt. 176 ---------- ----I-----
---------- - pt. 183 ---------- ---------- ---------- - pt. 186
---------- ---------- ---------- - pt. 252 ---------- ----------
---------- - pt. 1C ---------- ---------- ---------- - pt. 1D
--------I- ---------- ---------- - 1a amb. ----*---** ----*-----
*--------- - Impt. A.A. ---------- ---------- ---------- -
[0121] TABLE-US-00012 TABLE 5B 190 200 210 220 230 240 250 260
Consensus PVFTDNSSP PAVPQTFQVA HLHAPTGSGK STKVPAAYAA QGYKVLVLNP
SVAATLGFGA YMSKAHGVDP NIRTGVRTIT 1b -------T- ---------- ----------
---------- ---------- 0--------- -------I-- ---------- No Treatment
pt. 128 --------- ---------- ---------- ---------- ----------
0--------P ---------- ---------- pt. 1A --------- ----------
---------- ---------- ---------- 0--------- ---------- ----------
pt. 1G --------- ---------- ---------- ---------- ----------
0--------V -----Y---- ---------- pt. 1U --------- ----------
---------- ---------- ---------- 0--------- ---------- ----------
pt. 2D --------- -----S---- ---------- ---------- ----------
0--------- ---------- ---------- pt. 2F --------- ----------
---------- ---------- ---------- 0--------- ---------- ---S------
pt. 3N --------- ---------- ---------- --R------- ----------
0--------- -------I-- ---------- pt. 3O --------- ----------
---------- ---------- ---------- 0--------- -----Y---- S---------
pt. 3Q --------- ---------- ---------- --R------- ----------
0--------- ---------- ---------- pt. 6A --------- ----------
---------- ---------- ---------- 0--------- ---------- -----I----
IFN Treatment pt. B --------- ---------- ---------- ----------
---------- 0--------- -----Y---- ---------- pt. 1 ---------
---------- ---------- ---------- ---------- 0--------- ----------
---------- pt. 179 --------- ---------- ---------- ----------
---------- 0--------- ---------- S--------- 1b amb. -------*-
-----*---- ---------- --*------- ---------- 0--------* -----*-*--
*--*-*---- Impt. A.A. --------- ----------
----.cndot..cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot.-------
----.cndot..cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot.------- ---------- ---------- Motif I Motif Ia
270 280 290 300 310 320 330 340 Consensus TGAPITYSTY GKFLADGGCS
GGAYDIIICD ECHSTDSTTI LGIGTVLDQA ETAGARLVVL ATATPPGSVT VPHPNIEEVA
1b --GS----0- ---------- ---------- ---------- ----------
---------- ---------- --------IG No Treatment pt. 128 --------0-
---------- ---------- ---------- ---------- ---------- ----------
---------- pt. 1A ---S----0- ---------- ---------- ----I-A---
--V------- ---------- ---------- ---------- pt. 1G --------0-
---------- ---------- --------S- ---------- ---------- ----------
---S------ pt. 1U --------0- ---------- -------M-- ----------
---------- ---------- ---------- ---------- pt. 2D ---S----0-
---------- ---------- --------S- ---------- ---------- ----------
---------- pt. 2F --------0- ---------- ---------- ----------
---------- ---------- ---------- ---------- pt. 3N ---S----0-
---------A ---------- ---------- ---------- ---------- ----------
---------- pt. 3O --------0- ---------- ---------- --------S-
---------- ---------- ---------- ---------- pt. 3Q ----V---0-
---------- ---------- --------S- ---------- ---------- ----------
---------- pt. 6A ---S----0- ---------- ---------- ------A---
--V------- ---------- ---------- ---------- IFN Treatment pt. B
--------0- ---------- ---------- --------S- ---------- ----------
---------- ---------- pt. 1 --------0- ---------- ----------
---------- ---------- ---------- ---------- ---H----A- pt. 179
--------0- ---------- ---------- ---------- ---------- ----------
---------- ---------- 1b amb. --***---0- ---------* -------*--
----*-*-*- --*------- ---------- ---------- ---*----** Impt. A.A.
---.cndot..cndot..cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot..cndot..cndot.-----
-----.cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot..cndot..cndot..cndot.---- ----------
-----.cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot..cndot..cndot..cndot..cndot..cndot..cndot.-
---------- Nucleic Acid Binding Motif II Motif III 350 360 370 380
390 400 410 420 Consensus LSTTGEIPFY GKAIPIETIK GGRHLIFCHS
KKKCDELAAK LSGLGLNAVA YYRGLDVSVI PTSGDVVVVA TDALMTGFTG 1b
---N------ -------A-- ---------0 ---------- -T-------- ----------
-PI------- 0--------- No Treatment pt. 128 ---------- ----------
---------0 ---------- -S-------- ---------- ---------- 0---------
pt. 1A ---------- -------A-- ---------0 --------T- ----------
---------- ---------- 0--------- pt. 1G ---------- -------A--
---------0 ---------- ---------- ---------- -V-------- 0---------
pt. 1U ---------- ---------- ---------0 ---------- ----------
---------- -A-------- 0--------- pt. 2D ---------- -------A--
---------0 ---------- ---------- ---------- ---------- 0---------
pt. 2F ---------- ---------- ---------0 ---------- --S-------
---------- -S-------- 0--------- pt. 3N ---I------ -----L-V--
---------0 ---------- --S--I---- ---------- ---------- 0---------
pt. 3O ---------- ---------- ---------0 ---------- -R---I----
---------- -----A---- 0--------- pt. 3Q ---I------ -------V--
---------0 ---------- -----I---- ---------- ---------- 0------Y--
pt. 6A ---I------ ---------- ---------0 ---------- -----F----
---------- -S-------- 0--------- IFN Treatment pt. B ---I------
---------- ---------0 ---------- -----I---- ---------- ----------
0--------- pt. 1 ---I------ ---------- ---------0 ----------
---------- ---------- ---------- 0--------- pt. 179 ----------
-------A-- ---------0 ---------- ---------- ---------- ----------
0--------- 1b amb. ---*------ -----*-*-- ---------0 --------*-
-**--*---- ---------- -**-*----- 0------*-- Impt. A.A. ----------
---------- -----.cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot..cndot.------ ---------- ----------
-----.cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot..cndot..cndot..cndot..cndot..cndot..cndot.-
Motif IVa Motif V 430 440 450 460 470 480 490 Consensus DFDSVIDCNT
CVTQTVDFSL DPTFTIETTT VPQDAVSRSQ RRGRTGRGRR GIYRFVTPGE RPSGMFDSSV
1b ---------- ---------- ---------- ---------- ---------S
---------- ---------- No Treatment pt. 128 ---------- ----------
---------- ---------- ---------V -T-------- ---------- pt. 1A
---------- ---------- ---------- ---------- ---------- -----A----
---------- pt. 1G ---------- ---------- ---------- ----------
---------M ---------- ---------- pt. 1U ---------- ----------
---------- ---------- ---------M ---------- ---------- pt. 2D
---------- ---------- ---------- ---------- ---------- ----------
---------- pt. 2F ---------- ---------- ---------- ----------
---------- ---------- ---------- pt. 3N ---------- ----------
---------- ---------- ---------M ---------- ---------- pt. 3O
---------- ---------- ---------- ---------- ---------P --------R-
---------- pt. 3Q ---------- ---------- ---------- ----------
---------G ---------- ---------- pt. 6A ---------- ----------
---------- ---------- ---------S ---------- ---------- IFN
Treatment pt. B ---------- ---------- ---------- ----------
---------- ---------- ---------- pt. 1 ---------- ----------
---------- ---------- ---------A ---------- ---------- pt. 179
---------- ---------- ---------- ---------- ---------G ----------
---------- 1b amb. ---------- ---------- ---------- ----------
---------* -*---*--*- ---------- Impt. A.A.
----.cndot..cndot..cndot..cndot..cndot..cndot.
.cndot..cndot..cndot..cndot.------ ---------- ---------.cndot.
.cndot..cndot..cndot..cndot..cndot..cndot..cndot..cndot..cndot..cndot.
---------- ---------- Gatekeeper Motif VI 500 510 520 530 540 550
560 Consensus LCECYDAGCA WYELTPAETS VRLRAYLNTP GLPVCQDHLE
FWESVFTGLT HIDAHFLSQT KQAGDNFPYL 1b ---------- 0---------
---------- ---------- ---------- ---------- ---------- No Treatment
pt. 128 ---------- 0--------- ---------- ---------- ----------
---------- ----------
pt. 1A ---------- 0--------- ---------- ---------- ----------
---------- ----H-Y--- pt. 1G ---------- 0--------- ----------
---------- ---------- ---------- ---------- pt. 1U ----------
0--------- ---------- ---------- ---------- ---------- ----------
pt. 2D ---------- 0--------- ---------- ---------- ----------
---------- ---------- pt. 2F ---------- 0--------- ----------
---------- ---------- ---------- ----E----- pt. 3N ----------
0--------- ---------- R--------- ---------- ---------- ----------
pt. 3O ---------- 0--------- ---------- R--------- ----------
-V-------- ---------- pt. 3Q ---------- 0--------- ----------
R--------- ---------S ---------- ---------- pt. 6A ----------
0--------- ---------- ---------- ---------- ---------- ----E-----
IFN Treatment pt. B ---------- 0--------- ---------- ----------
---------- ---------- ---------- pt. 1 ---------- 0---------
---------- ---------- ---------- ---------- ---------- pt. 179
---------- 0--------T ---------- ---------- ---G------ ----------
---------- 1b amb. ---------- 0--------* ---------- *---------
---*-----* -*-------- ----*-*--- Impt. A.A.
------.cndot..cndot..cndot..cndot.
.cndot..cndot..cndot..cndot..cndot.----- ---------- ----------
---------- ---------- ---------- Gatekeeper 570 580 590 600
Consensus VAYQATVCAR AQAPPPSWDQ MWKCLIRLKP TLHGPTPLLY 1b ----------
---------- ---------- ---------- No Treatment pt. 128 T---------
---------- ---------- ---------- pt. 1A T--------- ---------E
---------- ---------- pt. 1G ---------- ---------- -----T----
---------- pt. 1U ---------- ---------- ---------- ---------- pt.
2D T--------- ---------- ---------- ---------- pt. 2F ----------
---------- -----T---- ---------- pt. 3N ---------- ----------
---------- ---------- pt. 3O ---------- ---------- ----------
---------- pt. 3Q ---------- ---------- ---------- ---------- pt.
6A ---------- ---------- ---------- ----S----- IFN Treatment pt. B
---------- ---------- -----T---- ---------- pt. 1 T---------
---------- ---------- ---------- pt. 179 ---------- ----------
---------- ---------- 1b amb. *--------- ---------* -----*----
----*----- Impt. A.A. ---------- ---------- ---------- ----------
610 620 630 Consensus RLGAVQNEVT LTHPITKYIM ACMSADLEVV T 1b
---------I ---------- ---------- - No Treatment pt. 128 ----------
---------- ---------- - pt. 1A ---------- ---------- ---------- -
pt. 1G ---------N ---------- ---------- - pt. 1U -------DI-
----V----- ---------- - pt. 2D --------I- ---------- ---------- -
pt. 2F ---------- ---------- ---------- - pt. 3N ----------
-------L-- ---------- - pt. 3O K-G------- ---------- T--------- -
pt. 3Q ---------- ----V----- T--------- - pt. 6A ----------
---------- ---------- - IFN Treatment pt. B ---------- ----V-----
T--------- - pt. 1 --------I- ---------- T--------- - pt. 179
---------- ---------- ---------- - 1b amb. *-*----*** ----*--*--
*--------- - Impt. A.A. ---------- ---------- ---------- -
[0122]
Sequence CWU 1
1
64 1 17 DNA Artificial Sequence Primer 1 cctgcttgtg gatgatg 17 2 29
DNA Artificial Sequence Primer 2 ctgatgaaat tccacatgtg cttcgccca 29
3 23 DNA Artificial Sequence Primer 3 ctactcctgc tcctgctggc gtt 23
4 32 DNA Artificial Sequence Primer 4 cactcttcca tctcatcgaa
ctcctggtag ag 32 5 21 DNA Artificial Sequence Primer 5 gtgtgggtyc
cccccctcaa c 21 6 26 DNA Artificial Sequence Primer 6 gccgacatgc
atgycatgat gtattt 26 7 17 DNA Artificial Sequence Primer 7
gagcccgtcg tcttctc 17 8 17 DNA Artificial Sequence Primer 8
ggccgggaca asaacca 17 9 23 DNA Artificial Sequence Primer 9
tcggaccttt acttggtcac gag 23 10 23 DNA Artificial Sequence Primer
10 aggaacttgc cwtaggtgga gta 23 11 23 DNA Artificial Sequence
Primer 11 cgccggcgca ccggaatgac atc 23 12 23 DNA Artificial
Sequence Primer 12 tactccacct atggcaagtt cct 23 13 25 DNA
Artificial Sequence Primer 13 gagtgctatg acgcgggctg tgctt 25 14 17
DNA Artificial Sequence Primer 14 gagtggcact catcaca 17 15 17 DNA
Artificial Sequence Primer 15 catctcatyt tctgcca 17 16 20 DNA
Artificial Sequence Primer 16 tcgactgtct grgtgacaca 20 17 27 DNA
Artificial Sequence Primer 17 ccatcgtggg aycaaatgtg gaagtgt 27 18
26 DNA Artificial Sequence Primer 18 aaatacatca tgrcatgcat gtcggc
26 19 29 DNA Artificial Sequence Primer 19 tgggcgaagc acatgtggaa
tttcatcag 29 20 23 DNA Artificial Sequence Primer 20 gccatcctct
ctcctggtgc cct 23 21 21 DNA Artificial Sequence Primer 21
cacccayccc cccaakatgt t 21 22 24 DNA Artificial Sequence Primer 22
ccggrggtca ttaygtscaa atgg 24 23 18 DNA Artificial Sequence Primer
23 cgcggggttt ccaggcag 18 24 20 DNA Artificial Sequence Primer 24
ggcacytaca tctatgayca 20 25 21 DNA Artificial Sequence Primer 25
tcatcttcag tccgatggag a 21 26 23 DNA Artificial Sequence Primer 26
atgccgctra tgaarttcca cat 23 27 22 DNA Artificial Sequence Primer
27 ctgaaygcca tcatggargc ca 22 28 19 DNA Artificial Sequence Primer
28 ccaatggaga agaaggtca 19 29 18 DNA Artificial Sequence Primer 29
atgtggagac atcctgca 18 30 18 DNA Artificial Sequence Primer 30
ttgtggcctg ttgtagga 18 31 18 DNA Artificial Sequence Primer 31
gcgcattctt ccatctca 18 32 18 DNA Artificial Sequence Primer 32
ccgaaacgct gaygtcat 18 33 18 DNA Artificial Sequence Primer 33
ggatggaggc tgctcagc 18 34 18 DNA Artificial Sequence Primer 34
agacccgacc tttaccat 18 35 20 DNA Artificial Sequence Primer 35
ttacccgtgt gtcaagacca 20 36 18 DNA Artificial Sequence Primer 36
ccaatgatgg aratgcag 18 37 18 DNA Artificial Sequence Primer 37
cctttgcsct agcgcata 18 38 18 DNA Artificial Sequence Primer 38
gagcactacg ctgtcgaa 18 39 18 DNA Artificial Sequence Primer 39
tggctgtggc tagaacca 18 40 18 DNA Artificial Sequence Primer 40
gtaggcccca aaaccaag 18 41 18 DNA Artificial Sequence Primer 41
gcyctgaaca agcccacg 18 42 18 DNA Artificial Sequence Primer 42
acatctgrgt gactggtc 18 43 19 DNA Artificial Sequence Primer 43
ccygtaatat ttagtccca 19 44 18 DNA Artificial Sequence Primer 44
tggaaatcaa ggtcatca 18 45 19 DNA Artificial Sequence Primer 45
gtagctacta tgggctcaa 19 46 18 DNA Artificial Sequence Primer 46
gcttgctcga tgtacggg 18 47 19 DNA Artificial Sequence Primer 47
cccgtcatct ttagtccta 19 48 18 DNA Artificial Sequence Primer 48
tggagattaa ggttatca 18 49 19 DNA Artificial Sequence Primer 49
gattgcacta tgggtcgaa 19 50 18 DNA Artificial Sequence Primer 50
gcttgctcga tgtaagga 18 51 17 DNA Artificial Sequence Primer 51
ggccgggaca asaacca 17 52 23 DNA Artificial Sequence Primer 52
tcggaccttt acttggtcac gag 23 53 23 DNA Artificial Sequence Primer
53 cgccggcgca ccggaatgac atc 23 54 23 DNA Artificial Sequence
Primer 54 tactccacct atggcaagtt cct 23 55 23 DNA Artificial
Sequence Primer 55 aggaacttgc cwtaggtgga gta 23 56 17 DNA
Artificial Sequence Primer 56 gagtggcact catcaca 17 57 17 DNA
Artificial Sequence Primer 57 catctcatyt tctgcca 17 58 20 DNA
Artificial Sequence Primer 58 tcgactgtct grgtgacaca 20 59 25 DNA
Artificial Sequence Primer 59 gagtgctatg acgcgggctg tgctt 25 60 27
DNA Artificial Sequence Primer 60 ccatcgtggg aycaaatgtg gaagtgt 27
61 26 DNA Artificial Sequence Primer 61 aaatacatca tgrcatgcat
gtcggc 26 62 26 DNA Artificial Sequence Primer 62 gccgacatgc
atgycatgat gtattt 26 63 32 DNA Artificial Sequence Primer 63
cactcttcca tctcatcgaa ctcctggtag ag 32 64 23 DNA Artificial
Sequence Primer 64 gtgtgggttc cccccctcaa cgt 23
* * * * *