U.S. patent application number 11/610457 was filed with the patent office on 2007-07-26 for compositions and methods to elicit immune responses against pathogenic organisms using yeast based vaccines.
This patent application is currently assigned to MycoLogics,Inc.. Invention is credited to Tamara K. Miller, Claude P. Selitrennikoff.
Application Number | 20070172503 11/610457 |
Document ID | / |
Family ID | 38285811 |
Filed Date | 2007-07-26 |
United States Patent
Application |
20070172503 |
Kind Code |
A1 |
Selitrennikoff; Claude P. ;
et al. |
July 26, 2007 |
Compositions and Methods to Elicit Immune Responses Against
Pathogenic Organisms Using Yeast Based Vaccines
Abstract
Embodiments of the present invention illustrate methods of
treating and preventing infection due to a pathogen such as a
fungal pathogen. In particular, the present invention relates to
compositions and methods for vaccinations against or treatment for
a fungal organism in a non-immunocompromised or immunocompromised
subject.
Inventors: |
Selitrennikoff; Claude P.;
(Highlands Ranch, CO) ; Miller; Tamara K.; (Wheat
Ridge, CO) |
Correspondence
Address: |
FAEGRE & BENSON LLP;PATENT DOCKETING
2200 WELLS FARGO CENTER
90 SOUTH SEVENTH STREET
MINNEAPOLIS
MN
55402-3901
US
|
Assignee: |
MycoLogics,Inc.
Aurora
CO
|
Family ID: |
38285811 |
Appl. No.: |
11/610457 |
Filed: |
December 13, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60750029 |
Dec 13, 2005 |
|
|
|
60817300 |
Jun 28, 2006 |
|
|
|
Current U.S.
Class: |
424/274.1 ;
435/254.1; 435/254.2; 435/254.3 |
Current CPC
Class: |
A61K 2039/521 20130101;
A61K 39/0002 20130101; A61K 2039/523 20130101 |
Class at
Publication: |
424/274.1 ;
435/254.1; 435/254.2; 435/254.3 |
International
Class: |
A61K 39/00 20060101
A61K039/00; C12N 1/18 20060101 C12N001/18; C12N 1/16 20060101
C12N001/16 |
Goverment Interests
FEDERALLY FUNDED RESEARCH
[0002] The studies disclosed herein were supported in part by
grants 1 R43 AI 052632-01A1, 1 R43 AI054020-01A1 and 1 R41
AI062482-01 from the Small Business Innovation Research Program
(SBIR) and STTR Program of the National Institutes of Health. The
U.S. government may have certain rights to practice the subject
invention.
Claims
1. A non-viable fungal cell composition comprising, fungal cells
that were heated at a temperature of about 56.degree. C. for about
one hour, or a derivative thereof.
2. The composition of claim 1, wherein the fungal cells comprise
transgenic, non-transgenic or a combination thereof.
3. The composition of claim 1, wherein the fungal cells are
selected from the group consisting of Saccharomyces spp.,
Aspergillus spp. Cryptococcus spp., Coccidioides spp., Neurospora
spp., Histoplasma spp., Blastomyces spp., and a combination
thereof.
4. The composition of claim 1, wherein the fungal cells comprise
Saccharomyces spp.
5. The composition of claim 4, wherein fungal cells are spores,
vegetative cells, germlings, or a combination thereof.
6. The composition of claim 1, wherein the fungal cells comprise
Neurospora spp.
7. The composition of claim 6, wherein the fungal cells are
vegetative hyphae, aerial hyphae, macroconidia, microconidia,
ascospores, or a combination thereof.
8. The composition of claim 1, wherein the fungal cells further
comprise a tag.
9. The composition of claim 2, wherein the transgenic fungal cells
comprise an oligonucleotide, a peptide, a protein, a chimeric
molecule or combination thereof.
10. The composition of claim 2, wherein the transgenic fungal cells
further comprise a virulence factor.
11. A method of inducing an immune response against a fungus
comprising: administering a non-viable fungal composition to a
subject, wherein administering the composition induces an immune
response against a fungus in the subject and wherein the non-viable
fungal composition comprises fungal cells that were heated at a
temperature of about 56.degree. C. for about one hour, or a
derivative thereof.
12. The method of claim 11, wherein the non-viable fungal
composition is administered prophylactically to reduce or prevent a
fungal infection.
13. The method of claim 11, wherein the non-viable fungal
composition is administered therapeutically to a subject with a
fungal infection.
14. The method of claim 11, wherein the subject is a mammal, bird
or reptile.
15. The method of claim 11, wherein the subject is a human.
16. The method of claim 11, wherein the non-viable fungal
composition induces an immune response against a fungus selected
from the group consisting of Saccharomyces spp., Aspergillus spp.
Cryptococcus spp., Coccidioides spp., Neurospora spp., Histoplasma
spp., Blastomyces spp., and a combination thereof.
17. The method of claim 11, wherein the subject is an
immunocompromised subject.
18. A method of treating a subject in need of an antifungal therapy
comprising: administering to a subject in need of such treatment a
non-viable fungal composition comprising fungal cells that were
heated at a temperature of about 56.degree. C. for about one hour,
or a derivative thereof.
19. The method of claim 18, wherein the fungal cells comprise
transgenic, non-transgenic or a combination thereof.
20. A method of preparing an immune response stimulating antifungal
composition, said method comprising, heating fungal cells to about
56.degree. C. for about one hour such that fungal cells are
non-viable but are capable of inducing an immune response against a
fungus when administered to a subject.
21. The method of claim 20, wherein the fungal cells comprise
transgenic, non-transgenic or a combination thereof.
22. The method of claim 20, wherein the fungal cells are selected
from the group consisting of Saccharomyces spp., Aspergillus spp.
Cryptococcus spp., Coccidioides spp., Neurospora spp., Histoplasma
spp., Blastomyces spp., and a combination thereof
Description
RELATED APPLICATIONS
[0001] This application claims the benefit of priority under 35
U.S.C. .sctn.119(e) of U.S. provisional application No. 60/750,029,
filed on Dec. 13, 2005, which is incorporated herein by reference
in its entirety, and of U.S. provisional application No.
60/817,300, filed on Jun. 28, 2006, which is incorporated herein by
reference in its entirety.
FIELD
[0003] The present invention provides for methods, compositions and
kits for reducing a fungal infection and/or inducing a protective
or therapeutic response against a pathogenic or non-pathogenic
organism.
BACKGROUND
[0004] Many conditions in humans and animals are caused by fungal
infections and current therapeutics for the prevention of and
treatments for these infections are largely ineffective.
Coccidioidomycosis, also known as San Joaquin Valley Fever, is a
fungal disease caused by Coccidioides immitis that is endemic in
portions of Southern Arizona, central California, southern New
Mexico and west Texas. At least 100,000 new cases are reported each
year. The migration of not only permanent residents, but also
agricultural workers to these areas increases exposure to C.
immitis spores that lie dormant in the soil, and as the soil is
disturbed, the spores become airborne and are inhaled. Once in the
lungs, the arthroconidia transform into spherules. An acute
respiratory infection occurs between seven days to three weeks
after exposure and often resolves rapidly. However, in a
significant number of cases, chronic pulmonary conditions or
dissemination to the meninges, bones, and joints can result,
leading to acute, life-threatening disease. One population, migrant
laborers, is exposed to C. immitis and are a highly susceptible to
get infected. A variety of approaches have been used to fight
coccidioidomycosis, including soil treatments, but only a vaccine
can completely eliminate this "emerging disease."
[0005] Another pathogen, Cryptococcus neoformans is an encapsulated
pathogenic yeast that causes pulmonary infections and
meningoencephalitis in humans and other animals. During the last 20
years, there has been a dramatic increase in the incidence of
cryptococcosis throughout the world that mirrors the increase in
not only HIV infections, but also in the growing number of
immunocompromised patients. Loss of CD4.sup.+ T cells predisposes
patients to progressive infection with C. neoformans--this
emphasizes the role of cell-mediated immunity in host
resistance.
[0006] C. neoformans is a basidiomycetous fungus that is generally
isolated as a haploid yeast, although diploids have been identified
in nature. There are two mating types that can undergo recognition
and fusion, and form a mycelium. A structure called a basidium is
made and spores are produced from the surface of the basidium.
Under specific conditions, haploid cells can undergo sporulation.
Recently, a stable diploid was shown to grow as a yeast at
37.degree. C. and formed hyphae and produced spores at 24.degree.
C. C. neoformans has been the subject of many studies, the var.
grubii strain H99, as the source of the candidate immunogens. Var.
grubii are serotype A strains, have a worldwide distribution, and
are the most common variety to cause disease in the United States.
Strain H99 has several advantages. First, molecular genetic
analysis, including gene deletion and allelic replacement
experiments, are well established in H99. Second, the genome
sequence of H99 has been determined. The random shotgun and
assembly phases of the genome are complete and the assembled genome
has been released. Third, a congenic mating partner for H99 has
recently been developed. Lastly, several reproducible animal models
have been well developed to assess virulence for this strain.
[0007] Cryptococcosis is a disease that is acquired by inhalation
of the organism from the soil or avian droppings into the lungs.
Both immunocompetent and immunocompromised patients can be infected
with the organism. In immunocompetent patients, the disease is
usually contained in a lung granuloma and induces an antibody
response. In contrast, individuals whose cellular immunity has been
compromised by viral infection, suppression due to tissue
transplantation, or anti-neoplastic chemotherapy are particularly
susceptible to disseminated disease, followed by often-fatal
meningoencephalitis. For example, an estimated 7-10% of AIDS
patients acquire cryptococcosis during the course of their HIV
disease. In compromised hosts, patients with cryptococcosis
generally present with symptoms of meningitis such as fever,
headache, and malaise. Cryptococcal pneumonia is the next most
frequent manifestation of cryptococcosis in immunocompromised
patients. It occurs as a primary infection in approximately 4% of
cases and is associated with general symptoms of pneumonia such as
fever, cough, pleuritic chest pain, and/or dyspnea.
[0008] Aspergillus fumigatus is a ubiquitous spore-bearing fungus
that causes multiple diseases in humans. These include allergic
asthma, aspergillomas, and invasive pulmonary disease of hosts with
predisposing underlying conditions. In the United States in 1996,
there were an estimated 10,190 aspergillosis-related
hospitalizations; these resulted in 1,970 deaths, 176,300 hospital
days, and $633 million in costs. The average hospitalization lasted
17.3 days and cost .about.$62,000. Although aspergillosis-related
hospitalizations account for a small percentage of hospitalizations
in the United States, patients hospitalized with the condition have
lengthy hospital stays and high mortality rates. The high mortality
rates (in some instances over 90%) are due, in part, to the lack of
rapid and sensitive diagnostic tests (all too often the diagnosis
is made post mortem), as well as the lack of effective anti-fungal
therapeutics.
[0009] The most common species of Aspergillus causing invasive
disease include A. fumigatus, A. flavus, A. niger, A. terreus and
A. nidulans. A. fumigatus is the most frequently found fungus in
airborne spore surveys. The organism grows in a variety of
environments including air ducts, houseplant soil, compost piles,
and at a wide range of temperatures, from 12.degree. C. to
55.degree. C. Of the genus Aspergillus, A. fumigatus is the most
common pathogen of man.
[0010] Currently, there are a number of anti-fungal vaccine and
anti-fungal treatment effort that use a variety of approaches
including selected recombinantly-expressed antigens. Safe and
effective vaccines against fungal organisms as well as against
other similar pathogens are needed.
SUMMARY
[0011] Embodiments of the present invention concern methods and
compositions for reducing the onset of, preventing or as treatment
for a fungal infection. In accordance with these embodiments, a
composition derived at least in part from non-viable fungal cells
can be used to vaccinate a subject against or treat for a fungal
infection. In certain embodiments, fungal cells were heated at a
temperature of about 56.degree. C. for about one hour. In other
embodiments, fungal cells were heated at temperatures ranging from
about 50.degree. C. to about 70.degree. C. for from about 30
minutes to about 2 hours. Time and temperature may vary depending
on the fungal organism, as well as, other factors such as the type
of vaccine or therapeutic desired.
[0012] Certain embodiments of the present invention concern
non-viable fungal cell compositions including fungal cells that
were heated at a temperature of about 56.degree. C. for about one
hour, or a derivative thereof. Other particular embodiments concern
vaccines, wherein the vaccines include a composition derived from
non-viable fungal cells and wherein fungal cells were heated at a
temperature of about 56.degree. C. for about one hour. In
accordance with these embodiments, the fungal cells can be
transgenic, non-transgenic or a combination thereof. The vaccine
compositions contemplated herein are capable of inducing an immune
response against viable and non-viable fungal cells when
administered to a subject. Fungal cells can include, but are not
limited to, Saccharomyces spp., Aspergillus spp. Cryptococcus spp.,
Coccidioides spp., Neurospora spp., Histoplasma spp., Blastomyces
spp., and a combination thereof. In other embodiments, the fungal
cells may further comprise a tag. In certain exemplary transgenic
vaccines, compositions can include fungal cells transformed with an
oligonucleotide, a peptide, a protein, a chimeric molecule or
combination thereof. In addition, transgenic fungal cells can
contain one or more virulence factor.
[0013] In some embodiments, a derivative of a non-viable fungal
composition can be an active portion of non-viable fungal cells or
a fraction thereof that is capable of inducing an immune response
when introduced to a subject. In accordance with these embodiments,
the derivative can be used a prophylactic against, prevention of
and/or treatment for a fungal infection.
[0014] In certain embodiments of the present invention, the fungal
cells comprise transgenic, non-transgenic or a combination thereof.
In other embodiments, the fungal cells can include, but are not
limited to, Saccharomyces spp., Aspergillus spp., Cryptococcus
spp., Coccidioides spp., Neurospora spp., Histoplasma spp.,
Blastomyces spp., and a combination thereof.
[0015] In certain particular embodiments, Saccharomyces spp. cells
can be spores, vegetative cells, germlings, or a combination
thereof. In other embodiments, the Neurospora spp. cells can be
vegetative hyphae, aerial hyphae, macroconidia, germinating
macroconidia, microconidia, germinating microconidia, ascospores,
germinating ascospores, or a combination thereof. In other
embodiments, the Aspergllus spp. cells can be vegetative hyphae,
conidia, or germinating conidia, or combinations thereof.
[0016] In certain embodiments, Coccidioides spp. cells can be
arthoconidia, germinating arthroconidia, hyphae, spherules,
germinating spherules, endospores, germinating endospores, or a
combination thereof. In other particular embodiments, Cryptococcus
spp. cells can be yeast cells.
[0017] In other embodiments, Histoplasma spp. cells can be yeast
cells, vegetative hyphae, microcondia, germinating microconidia,
macroconidia, germinating macroconidia, or combinations
thereof.
[0018] In other embodiments, Blastomyces spp. cells can be yeasts,
hyphae, blastoconidia, germinating blastoconidia or combinations
thereof. In some embodiments of the present invention, the fungal
cells may further include a tag. In other particular embodiments,
transgenic fungal cells can contain at least one oligonucleotide.
In certain examples, the oligonucleotide can encode a peptide or a
protein. Alternatively, the transgenic fungal cells contain at
least one virulence factor.
[0019] Embodiments of the present invention concern administering
to a subject a vaccine that includes, at least in part, non-viable
fungal cells. In certain embodiments, vaccines of the present
invention induce an immune response in the subject directed against
one or more fungal organisms. In accordance with these embodiments,
the subject is a mammal, bird or reptile. In one particular
embodiment, the subject is a human. In certain examples, the
vaccine can be administered in a single dose, a few doses or
multiple doses to reduce the onset of a fungal infection,
preventing and/or treating a fungal infection. In other
embodiments, the vaccination can occur yearly, monthly, or weekly
or even more frequent depending on need.
[0020] In other embodiments, a subject having a fungal infection
can be treated prophylactically to reduce progression of the fungal
infection and or eliminate the infection.
[0021] In certain embodiments of the present invention, the subject
is a human predisposed to a fungal infection or a fungal organism
(e.g., predisposed can mean at risk of exposure or having been
exposed to a fungal infection or fungal organism). In other
embodiments, the subject is an immunocompromised subject. In
accordance with this embodiment, the immunocompromised subject is a
subject having a viral infection, tissue transplantation,
anti-neoplastic chemotherapy or combination thereof.
[0022] Other embodiments of the present invention concern kits for
treating and/or preventing a fungal infection. In accordance with
these embodiments, the kits can include non-viable fungal
cells.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] The following drawings form part of the present
specification and are included to further demonstrate certain
embodiments of the present invention. The embodiments may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0024] FIG. 1 represents exemplary growth curves of yeast
containing a gene encoding an antigen grown in the presence of
various concentrations of CuSO.sub.4.
[0025] FIG. 2 illustrates an exemplary growth curve of yeast cells
containing and expressing an antigen protein.
[0026] FIG. 3 illustrates an exemplary schematic of a method to
test a vaccine disclosed herein.
[0027] FIG. 4 illustrates exemplary survival curves for mice
infected in vitro with A. fumigatus.
[0028] FIG. 5. represents an exemplary electrophoresis gel of
separated nucleic acid sequences from PCR reactions.
[0029] FIG. 6. illustrates an exemplary schematic of a method to
test a vaccine disclosed herein.
[0030] FIG. 7 illustrates exemplary survival curves for mice
infected in vitro with C immitis.
[0031] FIG. 8 represents an exemplary Western blot of separated
lysed yeast cells containing and expressing genes for hemolysin,
aspf2 or antigen-2/PRA.
[0032] FIG. 9 illustrates an exemplary schematic of a method to
test a vaccine disclosed herein.
[0033] FIG. 10. represents an exemplary electrophoresis gel of
separated molecules of yeast lysates containing and expressing the
gene encoding Chitin deacetylase and Laccase.
[0034] FIG. 11 illustrates an exemplary survival curves for mice
infected in vitro. with Cryptococcosis neoformans
[0035] FIG. 12 illustrates an exemplary scattergram of protective
efficacy of Aspergillus hemolysin antigen expressed in
Saccharomyces spp. against systemic aspergillosis in mice.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
Definitions
[0036] As used herein, "a" or "an" may mean one or more than one of
an item.
[0037] As used herein, "about" can mean plus or minus ten
percent.
DETAILED DESCRIPTION
[0038] In the following sections, various exemplary compositions
and methods are described in order to detail various embodiments of
the invention. It will be obvious to one skilled in the art that
practicing the various embodiments does not require the employment
of all or even some of the specific details outlined herein, but
rather that sequences chosen, proteins selected, samples,
concentrations, times and other specific details may be modified
through routine experimentation. In some cases, well-known methods
or components have not been included in the description.
[0039] Embodiments of the present invention provide for
compositions and methods for reducing the onset of, preventing
and/or treating a fungal infection. In particular embodiments,
methods and compositions when administered to a subject are capable
of inducing a protective immune response against a target. For
example, these embodiments include a fungal pathogen. In accordance
with these embodiments a fungal pathogenic organism includes, but
is not limited to, Aspergillus spp., Cryptococcus spp., and
Coccidioides spp. In exemplary embodiments, such pathogenic fungus
may include, but are not limited to, Aspergillus fumigatus, A.
flavus, A. niger, A. terreus, A. nidulans, Coccidioides immitis,
Coccidioides posadasii and Cryptococcus neoformans. The immune
response may be induced by injection of a fungal-based vaccine.
Such vaccines may comprise, but are not limited to, suspensions,
solutions, extracts, homogenates, precipitates and/or other
processed or unprocessed forms of Saccharomyces cerevisiae.
Although in exemplary embodiments the vaccines may comprise yeast
transformed with genetic markers, such as a c-myc tag sequence. In
one embodiment, the vaccines may include a non-transgenic fungus or
fungi. In one particular embodiment, the vaccines may include
non-transgenic or transgenic yeast.
[0040] Embodiments of the present invention provide for combination
treatments of a subject in need of a vaccine against an organism
such as a pathogenic fungal organism. In accordance with these
embodiments, any vaccine treatment detailed herein may be combined
with, but is not limited to, treatments for cryptococcosis,
aspergillosis, or coccidoidomycosis such as amphotericin B or the
azoles, fluconazole or itraconazole, 5-flucytosine, voriconazole,
and fluconazole. In another embodiment, other treatments may
include other antifungal treatments, such as any of the
echinocandin class antifungals or any other antifungal agent.
[0041] It is contemplated herein that any of the vaccines disclosed
may be administered to a subject having or suspected of developing
a condition due to exposure or potential exposure to a fungal
pathogen. In one embodiment, a subject may include a human. In
other embodiments a subject may include a human, other mammals,
birds and reptiles. In yet another embodiment, the subject can
include a domesticated animal. Any of the methods disclosed herein
may be used in combination with other antifungal agents or
therapies to treat a subject in order to achieve the desired
results.
[0042] In another embodiment, it is contemplated that a subject can
be vaccinated and/or treated using a composition against a fungal
pathogen disclosed herein before infection, during infection, after
infection or combination thereof. In one particular embodiment, a
composition disclosed herein may be used to vaccinate a subject
against a particular fungal organism to reduce the risk of a fungal
infection in the subject. In another embodiment, a composition
disclosed herein may be used to vaccinate a subject against one or
more fungal organisms to reduce the risk of a fungal infection in
the subject. In certain embodiments, a vaccine containing
non-viable fungal cells of one fungal type when administered to a
subject may reduce the onset or progression of fungal infection of
one or more additional fungal types in the subject.
[0043] In certain embodiments of the present invention, a vaccine
or treatment of use in a subject can contain non-viable fungal
cells where the fungal cells are transgenic, non-transgenic or a
combination thereof. Transgenic cells of the present invention may
include an oligonucleotide. In certain examples, the
oligonucleotide can encode one or more peptides or proteins.
Advantages
[0044] Approaches disclosed herein have several advantages over
current fungal vaccines. First, the fungal cells expressing each
fungal protein may be engineered so that it is not secreted but
rather is retained intracellularly. This likely obviates the need
for large amounts of recombinant fungal antigen protein to be
produced and purified, ultimately under cGMP conditions. Second,
fungal cells are easily transformed and manipulated. Third,
putative antigens can be tested rather inexpensively and
ineffective antigens can be eliminated quickly. Fourth, whole,
heat-killed yeast as a vaccine delivery vehicle is novel and
presents antigens directly to dendritic cells to induce the immune
system. Fifth, several individual antigen-expressing yeast strains
can be mixed to form a vaccine, a possibility not readily available
to current vaccine projects. Sixth, the yeast-based vaccine
technology has each of the characteristics of a successful vaccine:
generates a productive immune response; not neutralized; capable of
generating a response to multiple epitopes; and stable and easy to
manufacture.
[0045] One example of a beneficial therapeutic or a vaccine might
consist of a vector with no pathogenic potential that can deliver
several antigens to antigen-presenting cells (APCs). The use of
recombinant yeast proves to be an ideal vector for vaccine
development. In one embodiment, a vaccine contemplated herein could
consist of a vector with no pathogenic potential that can deliver
several antigens to APCs. In this regard, the use of recombinant
yeast proves to be an ideal vector for vaccine development. The
yeast Saccharomyces cerevisiae is avidly taken up by professional
APCs, such as neutrophils, macrophages and dendritic cells.
Multiple antigens can be engineered for expression within a single
yeast formulation, and these formulations share many advantages
with DNA vaccines, including ease of construction, low expense of
mass production and biological stability. Unlike DNA vaccines,
yeast-based vaccine formulations do not require extensive
purification to remove potentially toxic contaminants. Furthermore,
while the FDA has not evaluated yeast as a vaccine vector, the
organism S. cerevisiae is designated by the FDA as GRAS (Generally
Regarded As Safe, FDA Proposed Rule 62FR18938, Apr. 17, 1997). As
described below, the heterologous proteins expressed in recombinant
yeast serve as antigens that elicit CD8+ CTL-mediated immune
responses in vitro and in vivo. In animal trials as a tumor
vaccine, the yeast formulation was successful at protecting
vaccinated animals from tumor growth (refer to FIGS. 4, 7, 11 and
12 as examples of animal model testing).
[0046] In another embodiment, it is contemplated that additional
immunogens for in vivo efficacy may be tested using methods
disclosed herein.
[0047] In addition, it is contemplated that the immunogens may be
of a single formulation or a combination formulation. To test a
formulation, immunocompetent animals or immuncompromised animals
may be used in order to assess what formulation may be used to
treat a subject. The test can include vaccination and then a
challenge of the vaccination. In another embodiment, the
appropriate dose of any disclosed therapeutic or vaccine may be
determined by the methods disclosed herein including, but not
limited to optimum formulation, the appropriate number of
treatments or vaccinations and the optimum time for treatment or
vaccinations in order to instill maximum treatment or protection
against a given organism.
[0048] In certain embodiments, methods and compositions disclosed
herein are directed toward making and using an anti-fungal vaccine
or anti-fungal treatment. Fungal organisms targeted in the present
invention include, but are not limited to, Saccharomyces spp.,
Aspergillus spp. Cryptococcus spp., Coccidioides spp., Neurospora
spp., Histoplasma spp., Blastomyces spp., and a combination
thereof.
Aspergillus
[0049] In certain embodiments of the present invention, methods,
compositions and treatments for a fungal organism infection can
concern treatment for or prevention of an Aspergillus
associated-condition. The most common species of Aspergillus
causing invasive disease include A. fumigatus, A. flavus, A. niger,
A. terreus and A. nidulans. A. fumigatus is the most frequently
found fungus in airborne spore surveys. A. fumigatus pneumonia and
systemic aspergillosis occur primarily in patients who have
immunosuppression or T-cell or phagocytic impairment. The
immunodeficiency detected in these patients may be congenital,
acquired or iatrogenic. Patients with chronic granulomatous
diseases, neutrophil dysfunction, and with severe immunodeficiency
are at risk for the development of this predominantly fatal
infection. Although no important protective antibody response was
detected, CD4+ Th1 cytokines appear to be important in rendering
protection in these patients. In one embodiment of the present
invention, a subject having or suspected of developing a disease
derived from an Aspergillus species can be administered a
composition disclosed herein. In one particular embodiment, a
subject having or suspected of developing a disease derived from an
Aspergillus species can be administered a composition including
heated, transformed or non-transformed fungi for example, heated
Aspergillus fungi.
[0050] Three main types of diseases are attributed to A. fumigatus;
these include asthma, aspergillomas and invasive aspergillosis. The
most serious disease involves invasion of hosts with predisposing
underlying conditions. Patients undergoing organ transplants, bone
marrow transplants, leukemics, or cancer chemotherapy are
particularly at risk for invasive aspergillosis. Aspergillosis is
often diagnosed when there is an unexplained pulmonary infiltrate,
a patient is unresponsive to antibacterials and/or there is a fever
of unknown origin. The prognosis for patients with invasive disease
is high (mortality rates >50%) due to the lack of a rapid
diagnostic test confirming A. fumigatus infection and the lack of
safe and effective antifungal drugs.
Coccidioides
[0051] Coccidioidomycosis, also known as San Joaquin Valley Fever,
is a fungal disease caused by Coccidioides immitis that is endemic
in portions of Southern Arizona, central California, southern New
Mexico and west Texas. At least 100,000 new cases are reported each
year. The migration of not only permanent residents, but also
agricultural workers to these areas increases exposure to
Coccidioides spp. spores that lie dormant in the soil, and as the
soil is disturbed, the spores become airborne and are inhaled. Once
in the lungs, the arthroconidia transform into spherules. An acute
respiratory infection occurs between seven days to three weeks
after exposure and often resolves rapidly. However, in a
significant number of cases, chronic pulmonary conditions or
dissemination to the meninges, bones, and joints can result,
leading to acute, life-threatening disease. Migrant laborers who
are exposed to Coccidioides spp. are a highly mobile and
underrepresented population, and unfortunately, this disease is
under-reported and receives insufficient attention from the general
medical community. A variety of approaches have been used to fight
coccidioidomycosis, including soil treatments, but only a vaccine
can completely eliminate this "emerging disease."
Cellular Defenses Against Coccidioides spp.
[0052] Polymorphonuclear leukocytes (PMNs) are only able to
partially inhibit growth of the pathogen, and are unable to kill
the organism. PMNs are slightly more effective in inhibiting growth
of arthroconidia than mature spherules. Since mature fungal
spherules are typically 40-120 .mu.m in diameter, a single PMN is
unable to phagocytose the fungal cell. Endospores, on the other
hand, are more sensitive to growth inhibition by these host cells.
Most investigators of cellular immune response to Coccidioides spp.
believe that macrophages are the pivotal effector cells in
coccidioidomycosis. This concept has arisen from the general
paradigm for granulomatous diseases: activated T-lymphocytes
secrete cytokines, which activate macrophages, inducing the
formation of a granuloma, which kills or contains the organism. As
the spherule develops and matures, it becomes more resistant to
macrophages, so that less than 10% of mature spherules are killed.
It has been suggested that specific immunologic suppression
elicited by Coccidioides spp. antigens prevents an effective T-cell
response.
Cryptococcosis
[0053] In certain embodiments of the present invention, methods,
compositions and treatments for a fungal organism infection can
concern treatment for or prevention of a Cryptococcosis-associated
condition. C. neoformans can be an intracellular as well as an
extracellular pathogen. It is easily found extracellularly in
cerebral spinal fluid and lung tissue. It can also be localized
inside macrophages and neutrophils where it has been shown to
replicate.
[0054] Antibody and cell-mediated responses can provide important
protection even against an intracellular pathogen. The mammalian
host has several defenses against C. neoformans that include
components from innate, humoral, and cell-mediated immunity.
Subjects are continually exposed to C. neoformans from the
environment, a powerful innate immunity represents part of the
protection afforded the normal host. This appears to be inherent in
normal macrophage, monocyte, and neutrophil function.
[0055] Vaccination against cryptococcosis presents the innovative
idea of not only aiming to protect an immunocompromised population,
but also possibly expecting an immune response in that population.
In one embodiment, a vaccine against cryptococcosis is contemplated
for example, to treat a non-immunosuppressed or immunosuppressed
subject. In one particular example, immunosuppressed patients such
as HIV patients are contemplated. In accordance with this
embodiment, an HIV patient may be vaccinated immediately after
diagnosis, but before their CD4.sup.+ T cell population
decreases.
[0056] In other embodiments, any of the vaccines detailed herein
may be directed towards other fungal organisms, for example,
Coccidioides and Aspergillus. It is contemplated herein that any
fungal pathogen disclosed may have one or more virulence factors
which may include surface proteins, cell-wall carbohydrates,
secreted factors, anchored surface molecules, modes of action to
invade a host, etc. Any virulence factor associated with a fungal
pathogen may be used herein as a potential target to transform
yeast or other fungi of the present invention to generate a vaccine
against that fungal pathogen.
[0057] In certain embodiments of the present invention, the fungal
cells comprise transgenic cells, non-transgenic cells or a
combination thereof. In other embodiments, the fungal cells can
include, but are not limited to, Saccharomyces spp., Aspergillus
spp., Cryptococcus spp., Coccidioides spp., Neurospora spp.,
Histoplasma spp., Blastomyces spp., and a combination thereof.
[0058] In certain particular embodiments, Saccharomyces spp. cells
can be spores, vegetative cells, germlings, or a combination
thereof. In other embodiments, the Neurospora spp. cells can be
vegetative hyphae, aerial hyphae, macroconidia, germinating
macroconidia, microconidia, germinating microconidia, ascospores,
germinating ascospores, or a combination thereof.
Recombinant Yeast as an Antigen Delivery System
[0059] In one example, a yeast vaccine formulation directly
accesses DCs, the critical immune responsive cells of the body. In
order for DCs to present antigens efficiently to naive T cells,
immature DCs must be activated to mature, as evidenced by the
up-regulation of MHC and co-stimulatory molecules. Mature DCs are
then capable of prolonged antigen presentation and the production
of cytokines, such as IL-12, that are critical for the induction of
cellular immune responses. Uptake of yeast by DCs increased surface
expression of the co-stimulatory molecules CD40, CD80 and CD86, MHC
class II, and the adhesion molecule ICAM, to levels comparable to
that induced by exposure to bacterial lipopolysaccharide (LPS), a
potent DC maturation factor. As further evidence of yeast-induced
activation, DCs incubated with yeast produced significant amounts
of IL-12 that rivalled levels induced by exposure to LPS. These
results show that yeast trigger DC maturation, responses that would
be essential for vaccine-induced immunity.
[0060] It has been shown that certain yeast vaccine technology can
be formulated with a variety of antigens, including 5 from HIV, 3
from Hepatitis B, 1 from Hepatitis C, and 2 from lung cancer cells
and, in each case, the yeast-expressed antigen effectively
stimulated protective cell-mediated immunity. In addition, yeast as
a vaccine vehicle provides an adjuvant effect, such that dendritic
cells are triggered to directly take up yeast, causing the DCs to
mature and to present the yeast-associated antigens to the host
immune system. Further, recent results have shown that heat-killed
yeast cells expressing putative antigens are as immunogenic and
protective as live yeast cells expressing putative antigens. In
addition, yeast cells expressing antigens elicited Th1 responses.
Therefore, recombinant-yeast vaccine formulations may elicit
systemic, antigen-specific, CD4 and CD8-based protective immunity.
Also, DCs have been shown to internalize yeast and present
recombinant antigens to naive class I and class II MHC-restricted T
cells. It has been shown that yeast exhibit adjuvant activity for
DC maturation and immune signalling. Yeast might be providing an
adjuvant effect to promote immune responses to the yeast-associated
antigens. These results show that i) yeast uptake triggers DC
maturation; ii) yeast-expressed recombinant antigens are
efficiently presented by MHC class I and MHC class II pathways of
DCs, and, iii) yeast provides an adjuvant effect to enhance
DC-stimulation of naive T cells.
[0061] In another example, a CD8-dependent protective immunity has
been elicited in vaccinated mice. For example, EL-4 CD4.sup.+ T
lymphoma cells (H-2.sup.b) transfected with cDNA encoding chicken
ovalbumin (E.G7-OVA) and ovalbumin-expressing melanoma (B16-OVA)
mouse tumor models have been employed to test vaccine candidates
that induce protective CTL response. Mice vaccinated with OVAX, but
not mock-vaccinated animals, were protected from E.G7-OVA or
B16-OVA tumor formation. Protective immunity was CD8-dependent,
since OVAX-vaccinated animals were not protected from tumor
challenge in CD8.sup.-/- knockout mice.
Kits
[0062] In still further embodiments, the present invention concerns
kits for the methods described herein. In one embodiment, a fungal
organism treatment or (such as a pathogenic or non-pathogenic
fungus) prevention kit is contemplated. In another embodiment, a
kit for prophylactic treatment of a subject having or suspected of
developing a fungal infection is contemplated. In a more particular
embodiment, a kit for prevention or treatment of a subject having
or suspected of developing a fungal-induced infection is
contemplated. In accordance with this embodiment, the kit may be
used to treat or vaccinate a subject for or against a fungal
infection.
[0063] The kits may include a composition including at least a
portion of a non-viable fungus within a tube, a vial or other
suitable vessel. In addition, the kit may include one or more
dose(s) of the composition for administration to a subject having
or exposed to a fungal organism infection by a healthcare provider.
In another embodiment, the kit may be a portable kit for use at a
specified location outside of a healthcare facility.
[0064] The container means of any of the kits will generally
include at least one vial, test tube, flask, bottle, syringe or
other container means, into which the testing agent, may be
preferably and/or suitably aliquoted.
Nucleic Acids
[0065] In various embodiments, isolated nucleic acids may be used
to modify or transform a fungal organism contemplated in the
present invention. The isolated nucleic acid may be derived from
genomic DNA, RNA or complementary DNA (cDNA). In other embodiments,
isolated nucleic acids, such as chemically or enzymatically
synthesized DNA, may be of use for generation of oligonucleotides
for transformation of a fungal organism.
[0066] A "nucleic acid" includes single-stranded and
double-stranded molecules, as well as DNA, RNA, chemically modified
nucleic acids and nucleic acid analogs. It is contemplated that a
nucleic acid may be of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66,
67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83,
84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,
100, about 110, about 120, about 130, about 140, about 150, about
160, about 170, about 180, about 190, about 200, about 210, about
220, about 230, about 240, about 250, about 275, about 300, about
325, about 350, about 375, about 400, about 425, about 450, about
475, about 500, about 525, about 550, about 575, about 600, about
625, about 650, about 675, about 700, about 725, about 750, about
775, about 800, about 825, about 850, about 875, about 900, about
925, about 950, about 975, about 1000, about 1100, about 1200,
about 1300, about 1400, about 1500, about 1750, about 2000 or
greater nucleotide residues in length, up to a full length protein
encoding or regulatory genetic element.
Construction of Nucleic Acids
[0067] Isolated nucleic acids may be made by any method known in
the art, for example using standard recombinant methods, synthetic
techniques, or combinations thereof. In some embodiments, the
nucleic acids may be cloned, amplified, or otherwise
constructed.
[0068] Nucleic acids of use in the present invention may include
oligonucleotides that include at least a portion of sequences from
a virulence factor (e.g., including but not limited to,
antigen-2/proline rich antigen, hemolysin, aspf2, dpp5, dpp4,
chitin deacetylase, catalase), a disease-associated factor (e.g.,
tumor associated antigens, cytokines, viral-associated antigens,
bacterial-associated antigens) or other peptides or proteins. In
another example, a multi-cloning site comprising one or more
endonuclease restriction sites may be added. A nucleic acid may be
attached to a vector, adapter, or linker for cloning of a nucleic
acid. Additional sequences may be added to such cloning and
sequences to optimize their function, to aid in isolation of the
nucleic acid, or to improve the introduction of the nucleic acid
into a cell. Use of cloning vectors, expression vectors, adapters,
and linkers is well known in the art.
Recombinant Methods for Constructing Nucleic Acids
[0069] Isolated nucleic acids may be obtained from fungal,
bacterial, viral or other sources using any number of cloning
methodologies known in the art. In some embodiments,
oligonucleotide probes which selectively hybridize, under stringent
conditions, to the nucleic acids are used to identify a sequence of
interest. Methods for construction of nucleic acid libraries are
known and any such known methods may be used. (See, e.g., Current
Protocols in Molecular Biology, Ausubel, et al., Eds., Greene
Publishing and Wiley-Interscience, New York (1995); Sambrook, et
al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring
Harbor Laboratory Vols. 1-3 (1989); Methods in Enzymology, Vol.
152, Guide to Molecular Cloning Techniques, Berger and Kimmel,
Eds., San Diego: Academic Press, Inc. (1987)).
Nucleic Acid Screening and Isolation
[0070] Genomic DNA, RNA or cDNA may be screened for the presence of
an identified genetic element of interest using a probe based upon
one or more sequences. Various degrees of stringency of
hybridization may be employed in the assay. As the conditions for
hybridization become more stringent, there must be a greater degree
of complementarity between the probe and the target for duplex
formation to occur. The degree of stringency may be controlled by
temperature, ionic strength, pH and/or the presence of a partially
denaturing solvent such as formamide. For example, the stringency
of hybridization is conveniently varied by changing the
concentration of formamide within the range of 0% to 50%. The
degree of complementarity (sequence identity) required for
detectable binding will vary in accordance with the stringency of
the hybridization medium and/or wash medium.
[0071] High stringency conditions for nucleic acid hybridization
are well known in the art. For example, conditions may comprise low
salt and/or high temperature conditions, such as provided by about
0.02 M to about 0.15 M NaCl at temperatures of about 50.degree. C.
to about 70.degree. C. Other exemplary conditions are disclosed in
the following Examples. It is understood that the temperature and
ionic strength of a desired stringency are determined in part by
the length of the particular nucleic acid(s), the length and
nucleotide content of the target sequence(s), the charge
composition of the nucleic acid(s), and to the presence or
concentration of formamide, tetramethylammonium chloride or other
solvent(s) in a hybridization mixture. Nucleic acids may be
completely complementary to a target sequence or may exhibit one or
more mismatches.
Nucleic Acid Amplification
[0072] Nucleic acids of interest may also be amplified using a
variety of known amplification techniques. For instance, polymerase
chain reaction (PCR) technology may be used to amplify target
sequences directly from RNA or cDNA. PCR and other in vitro
amplification methods may also be useful, for example, to clone
nucleic acid sequences, to make nucleic acids to use as probes for
detecting the presence of a target nucleic acid in samples, for
nucleic acid sequencing, or for other purposes. Examples of
techniques of use for nucleic acid amplification are found in
Berger, Sambrook, and Ausubel, as well as Mullis et al., U.S. Pat.
No. 4,683,202 (1987); and, PCR Protocols A Guide to Methods and
Applications, Innis et al., Eds., Academic Press Inc., San Diego,
Calif. (1990). PCR-based screening methods have been disclosed.
(See, e.g., Wilfinger et al. BioTechniques, 22(3): 481-486
(1997))
Synthetic Methods for Constructing Nucleic Acids
[0073] Isolated nucleic acids may be prepared by direct chemical
synthesis by methods such as the phosphotriester method of Narang
et al., Meth. Enzymol. 68:90-99 (1979); the phosphodiester method
of Brown et al., Meth. Enzymol. 68:109-151 (1979); the
diethylphosphoramidite method of Beaucage et al., Tetra. Lett.
22:859-1862 (1981); the solid phase phosphoramidite triester method
of Beaucage and Caruthers, Tetra. Letts. 22(20):1859-1862 (1981),
using an automated synthesizer as in Needham-VanDevanter et al.,
Nucleic Acids Res., 12:6159-6168 (1984); or by the solid support
method of U.S. Pat. No. 4,458,066. Chemical synthesis generally
produces a single stranded oligonucleotide. This may be converted
into double stranded DNA by hybridization with a complementary
sequence, or by polymerization with a DNA polymerase using the
single strand as a template. While chemical synthesis of DNA is
best employed for sequences of about 100 bases or less, longer
sequences may be obtained by the ligation of shorter sequences.
Covalent Modification of Nucleic Acids
[0074] A variety of cross-linking agents, alkylating agents and
radical generating species may be used to bind, label, detect,
and/or cleave nucleic acids. For example, Vlassov, V. V., et al.,
Nucleic Acids Res (1986) 14:4065-4076, disclose covalent bonding of
a single-stranded DNA fragment with alkylating derivatives of
nucleotides complementary to target sequences. A report of similar
work by the same group is that by Knorre, D. G., et al., Biochimie
(1985) 67:785-789. Iverson and Dervan also showed sequence-specific
cleavage of single-stranded DNA mediated by incorporation of a
modified nucleotide which was capable of activating cleavage (J Am
Chem Soc (1987) 109:1241-1243). Meyer, R. B., et al., J Am Chem Soc
(1989) 111:8517-8519 disclose covalent crosslinking to a target
nucleotide using an alkylating agent complementary to the
single-stranded target nucleotide sequence. A photoactivated
crosslinking to single-stranded oligonucleotides mediated by
psoralen was disclosed by Lee, B. L., et al., Biochemistry (1988)
27:3197-3203. Use of crosslinking in triple-helix forming probes
was also disclosed by Home, et al., J Am Chem Soc (1990)
112:2435-2437. Use of N4, N4-ethanocytosine as an alkylating agent
to crosslink to single-stranded oligonucleotides has also been
disclosed by Webb and Matteucci, J Am Chem Soc (1986)
108:2764-2765; Nucleic Acids Res (1986) 14:7661-7674; Feteritz et
al., J. Am. Chem. Soc. 113:4000 (1991). Various compounds to bind,
detect, label, and/or cleave nucleic acids are known in the art.
See, for example, U.S. Pat. Nos. 5,543,507; 5,672,593; 5,484,908;
5,256,648; and, 5,681,941.
Nucleic Acid Labeling
[0075] In various embodiments, tag nucleic acids may be used to
trace or identify a particular nucleic acid sequence contemplated
herein. A number of different labels may be used, such as
fluorophores, chromophores, radio-isotopes, enzymatic tags,
antibodies, chemiluminescent, electroluminescent, affinity labels,
etc. One of skill in the art will recognize that these and other
label moieties not mentioned herein can be used. Examples of
enzymatic tags include urease, alkaline phosphatase or peroxidase.
Colorimetric indicator substrates can be employed with such enzymes
to provide a detection means visible to the human eye or
spectrophotometrically. A well-known example of a chemiluminescent
label is the luciferin/luciferase combination.
[0076] In certain embodiments, the label may be a fluorescent,
phosphorescent or chemiluminescent label. Exemplary photodetectable
labels may be selected from the group consisting of Alexa 350,
Alexa 430, AMCA, aminoacridine, BODIPY 630/650, BODIPY 650/665,
BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX,
5-carboxy-4',5'-dichloro-2',7'-dimethoxy fluorescein,
5-carboxy-2',4',5',7'-tetrachlorofluorescein, 5-carboxyfluorescein,
5-carboxyrhodamine, 6-carboxyrhodamine, 6-carboxytetramethyl amino,
Cascade Blue, Cy2, Cy3, Cy5,6-FAM, dansyl chloride, Fluorescein,
HEX, 6-JOE, NBD (7-nitrobenz-2-oxa-1,3-diazole), Oregon Green 488,
Oregon Green 500, Oregon Green 514, Pacific Blue, phthalic acid,
terephthalic acid, isophthalic acid, cresyl fast violet, cresyl
blue violet, brilliant cresyl blue, para-aminobenzoic acid,
erythrosine, phthalocyanines, azomethines, cyanines, xanthines,
succinylfluoresceins, rare earth metal cryptates, europium
trisbipyridine diamine, a europium cryptate or chelate, diamine,
dicyanins, La Jolla blue dye, allopycocyanin, allococyanin B,
phycocyanin C, phycocyanin R, thiamine, phycoerythrocyanin,
phycoerythrin R, REG, Rhodamine Green, rhodamine isothiocyanate,
Rhodamine Red, ROX, TAMRA, TET, TRIT (tetramethyl rhodamine
isothiol), Tetramethylrhodamine, and Texas Red. These and other
labels are available from commercial sources, such as Molecular
Probes (Eugene, Oreg.).
[0077] In certain embodiments, it is contemplated that a vaccine
will be administered to a subject for vaccination against and/or
treatment of a fungal infection. It is also contemplated herein
that any of the vaccines disclosed may be administered to a subject
having or suspected of developing a condition due to exposure or
potential exposure to a fungal pathogen. In one embodiment, a
subject may include a human. In other embodiments a subject may
include other mammals, birds, and reptiles. Any of the methods
disclosed herein may be used in combination with other anti-fungal
agents or therapies to treat a subject in order to achieve the
desired results.
[0078] In another embodiment, it is contemplated that a subject can
be vaccinated and/or treated using a composition against a fungal
pathogen disclosed herein before infection, during infection, after
infection or combination therefore of. In one particular
embodiment, a composition disclosed herein may be used to vaccinate
a subject against a particular fungal organism to reduce the risk
of a fungal infection in the subject. In another embodiment, a
composition disclosed herein may be used to vaccinate a subject
against one or more fungal organism to reduce the risk of a fungal
infection in the subject. In certain embodiments, a vaccine
containing non-viable fungal cells of one fungal type when
administered to a subject may reduce the onset or progression of
fungal infection of another fungal type in the subject.
[0079] Exemplary Dosing: In one embodiment, a dose may consist of
around 1.times.10.sup.7 yeast cells to 20.times.10.sup.7 yeast
cells per dose. And may be given before infection, during
infection, after infection or a combination therefore of The dose
may be given daily, every other day, biweekly, weekly, seasonally
or yearly until a desired effect is achieved.
[0080] A composition of the present invention may be administered
to a subject in an appropriate carrier or diluent or
pharmaceutically acceptable carrier, co-administered with enzyme
inhibitors or in an appropriate carrier such as liposomes. The term
"pharmaceutically acceptable carrier" as used herein is intended to
include diluents such as saline and aqueous buffer solutions. To
administer a compound that stimulates an immune response by other
than parenteral administration, it may be necessary to coat the
compound with, or co-administer the compound with, a material to
prevent its inactivation. Enzyme inhibitors include pancreatic
trypsin inhibitor, diisopropylfluorophosphate (DEP) and trasylol.
Liposomes include water-in-oil-in-water emulsions as well as
conventional liposomes. The active agent may also be administered
parenterally or intraperitoneally. Dispersions can also be prepared
in glycerol, liquid polyethylene glycols, and mixtures thereof and
in oils. Under ordinary conditions of storage and use, these
preparations may contain a preservative to prevent the growth of
microorganisms.
[0081] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. In all cases, the
composition must be sterile and must be fluid to the extent that
easy syringability exists. It must be stable under the conditions
of manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria. The
pharmaceutically acceptable carrier can be a solvent or dispersion
medium containing, for example, water, ethanol, polyol (for
example, glycerol, propylene glycol, and liquid polyetheylene
glycol, and the like), and suitable mixtures thereof. The proper
fluidity can be maintained, for example, by the use of a coating
such as lecithin, by the maintenance of the required particle size
in the case of dispersion and by the use of surfactants. Prevention
of microorganisms can be achieved by various antibacterial and
antifungal agents (i.e., parabens, chlorobutanol, phenol, ascorbic
acid, thimerosal, and the like). In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as manitol, sorbitol, sodium chloride in the
composition. A compound such as aluminum monostearate and gelatin
can be included to prolong absorption of the injectable
compositions.
[0082] Sterile injectable solutions can be prepared by
incorporating active compound in the required amount in an
appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by filtered sterilization.
Generally, dispersions are prepared by incorporating the active
compound into a sterile vehicle that contains a dispersion medium
and other required ingredients from those enumerated above. In the
case of sterile powders for the preparation of sterile injectable
solutions, the preferred methods of preparation are vacuum drying
and freeze-drying which yields a powder of the active ingredient
(i.e., a chemical agent, antibody, etc.) plus any additional
desired ingredient from a previously sterile-filtered solution
thereof
[0083] When the active agent is suitably protected, as described
above, the composition may be orally administered (or otherwise
indicated), for example, with an inert diluent or an assimilable
edible carrier. It is especially advantageous to formulate
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the mammalian subjects to be treated; each unit
containing a predetermined quantity of compound such as non-viable
fungal cells calculated to produce the desired therapeutic effect
in association with the required pharmaceutical carrier.
[0084] If needed for a particular use, the biological material can
be extensively dialyzed to remove undesired small molecular weight
molecules and/or lyophilized for more ready formulation into a
desired vehicle, where appropriate. The active compounds will then
generally be formulated for parenteral administration (i.e.,
formulated for injection via the intravenous, intramuscular,
sub-cutaneous, intralesional, or even intraperitoneal routes). The
preparation of an aqueous composition that contains an active
component or ingredient will be known. Typically, such compositions
can be prepared as injectables, either as liquid solutions or
suspensions; solid forms suitable for use in preparing solutions or
suspensions upon the addition of a liquid prior to injection can
also be prepared; and the preparations can also be emulsified.
[0085] The pharmaceutical forms suitable for injectable use include
sterile aqueous solutions or dispersions; formulations including
sesame oil, peanut oil or aqueous propylene glycol; and sterile
powders for the extemporaneous preparation of sterile injectable
solutions or dispersions. In all cases the form must be sterile and
must be fluid. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms, such as bacteria and
fungi.
[0086] Solutions of the active compounds as free-base or
pharmacologically acceptable salts can be prepared in water
suitably mixed with a surfactant, such as hydroxypropylcellulose.
Dispersions can also be prepared in glycerol, liquid polyethylene
glycols, and mixtures thereof and in oils. Under ordinary
conditions of storage and use, these preparations contain a
preservative to prevent the growth of microorganisms. Prolonged
absorption of the injectable compositions can be brought about by
the use in the compositions of agents delaying absorption, for
example, aluminum monostearate and gelatin.
[0087] Sterile injectable solutions are prepared by incorporating
the active compounds in the required amount in the appropriate
solvent with various of the other ingredients enumerated above, as
required. Generally, dispersions are prepared by incorporating the
various sterilized active ingredients into a sterile vehicle which
contains the basic dispersion medium and the required other
ingredients from those enumerated above. In the case of sterile
powders for the preparation of sterile injectable solutions, the
preferred methods of preparation are vacuum-drying and
freeze-drying techniques which yield a powder of the active
ingredient plus any additional desired ingredient from a previously
sterile-filtered solution thereof. The preparation of more, or
highly, concentrated solutions for direct injection is also
contemplated, where the use of DMSO as solvent is envisioned to
result in extremely rapid penetration, delivering high
concentrations of the active agents to a small area.
[0088] Upon formulation, solutions will be administered in a manner
compatible with the dosage formulation and in such amount as is
therapeutically effective. The formulations are easily administered
in a variety of dosage forms, such as the type of injectable
solutions described above, but drug release capsules and the like
can also be employed.
[0089] For parenteral administration in an aqueous solution, for
example, the solution should be suitably buffered if necessary and
the liquid diluent first rendered isotonic with sufficient saline
or glucose. These particular aqueous solutions are especially
suitable for intravenous, intramuscular, subcutaneous and
intraperitoneal administration. In this connection, sterile aqueous
media that can be employed will be known to those of skill in the
art in light of the present disclosure.
[0090] In addition to the compounds formulated for parenteral
administration, such as intravenous or intramuscular injection,
other pharmaceutically acceptable forms include, e.g., liposomal
formulations; time-release capsules; and any other form currently
used.
[0091] In another embodiment, nasal solutions or sprays, aerosols
or inhalants may be used to deliver the compound of interest. Nasal
solutions are usually aqueous solutions designed to be administered
to the nasal passages in drops or sprays. Nasal solutions are
prepared so that they are similar in many respects to nasal
secretions. Thus, the aqueous nasal solutions usually are isotonic
and slightly buffered to maintain a pH of 5.5 to 6.5. In addition,
antimicrobial preservatives, similar to those used in ophthalmic
preparations, and appropriate drug stabilizers, if required, may be
included in the formulation. Various commercial nasal preparations
are known and include, for example, antibiotics and antihistamines
and are used for asthma prophylaxis. Inhalation preparations may
include solutions or dry powder formulations that are commonly used
along with a propellant in the formulation of therapeutics used for
the treatment of asthmatics.
[0092] Oral formulations include such normally employed excipients
as, for example, pharmaceutical grades of mannitol, lactose,
starch, magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate and the like. These compositions take the form of
solutions, suspensions, tablets, pills, capsules, sustained release
formulations or powders. In certain defined embodiments, oral
pharmaceutical compositions will comprise an inert diluent or
assimilable edible carrier, or they may be enclosed in hard or soft
shell gelatin capsule, or they may be compressed into tablets, or
they may be incorporated directly with the food of the diet. For
oral therapeutic administration, the active compounds may be
incorporated with excipients and used in the form of ingestible
tablets, buccal tables, troches, capsules, elixirs, suspensions,
syrups, wafers, and the like. Such compositions and preparations
should contain at least 0.1% of active compound. The percentage of
the compositions and preparations may, of course, be varied and may
conveniently be between about 2 to about 75% of the weight of the
unit, or preferably between 25-60%. The amount of active compounds
in such therapeutically useful compositions is such that a suitable
dosage will be obtained.
[0093] Particularly preferred are methods in which the therapeutic
compound(s) are directly administered as a pressurized aerosol or
nebulized formulation to the patient's lungs via inhalation. Such
formulations may contain any of a variety of known aerosol
propellants useful for endopulmonary and/or intranasal inhalation
administration. In addition, water may be present, with or without
any of a variety of cosolvents, surfactants, stabilizers (e.g.,
antioxidants, chelating agents, inert gases and buffers).
EXAMPLES
[0094] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventors to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
Methods
[0095] Proteins to be tested Each protein from a fungal pathogen
was chosen because of its identification as a virulence factor
(e.g., strains lacking the protein were less virulent that the wild
type), as an immunogen (infected animals generated antibodies to
the candidate protein), and/or was found on the cell surface of
conidia or hyphae. In addition, none of the proteins had cognates
with significant (<35%) homology to mammals and to yeast.
[0096] Exemplary isolation of DNA containing the open reading frame
encoding each protein: The Open Reading Frame (ORF) of each gene
was obtained by PCR using gene specific primers and in certain
embodiments, a high quality cDNA library as template. In other
embodiments, the ORF of candidate genes was obtained using plasmid
DNA containing the gene of interest as a template for amplification
by PCR. Each PCR product was gel purified and ligated into the TA
cloning vector, pCR2.1, using the pCR2.1 TOPO kit from InVitrogen
(Carlsbad, Calif.). Resulting plasmid DNAs were used to transform
competent E. coli cells and plasmid DNA isolated from midi-preps
using methods standard to those of skill in the art.
[0097] In certain embodiments the gene specific PCR primers encoded
a c-myc epitope such that the c-myc epitope would be generated in
the protein at the carboxy terminus.
[0098] In certain methods, each ORF was excised from each plasmid
DNA using the restriction endonuclease EcoR1 and ligated into the
EcoR1 site of pYEX-BX. Each resulting ligated plasmid was used to
transform competent E. coli cells and plasmid DNA isolated from
midi-preps. Each ORF DNA was sequenced to ensure that it is in
frame with the copper-inducible promoter and and no PCR errors were
present.
[0099] In one exemplary method an empty vector control was
generated. As one exemplary control, an empty vector control was
generated a pYEX-BX (Clonetech) vector containing the DNA encoding
a c-myc epitope but lacking a fungal gene of interest. A 51 base
pair template for PCR was created that contained a methionine, the
sequence that encodes the c-myc protein and two stop codons. The
PCR primers also included a 5' BamH I site and a 3' EcoR I
restriction site that could be used to excise the tag from the pCR
2.1 vector and inserted into the pYEX-BX vector (Clonetech). The
DNA and amino acid sequences are shown in SEQ ID NOs:1 and 2:
TABLE-US-00001 c-myc control sequence atg gaa cag aag ttg att tcc
gaa gaa gac ctc gag Met Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu
Glu
[0100] This template was amplified by PCR under the following
conditions: 25 .mu.L reactions were performed in PCR Ready Bead
tubes containing 500 ng of cDNA library, 2 .mu.M primers, and 13
.mu.L sterile water. Reactions were performed using a Perkin Elmer
2400 Thermocycler under the following conditions: an initial cycle
at 94.degree. C. for 5 min, 30 cycles at 94.degree. C. for 1 min,
50.degree. C. for 1 min, 72.degree. C. for 1 min, and a final
extension at 72.degree. C. for 7 min.
[0101] The PCR reactions were separated by agarose gel
electrophoresis using a 3% (w/v) agarose gel. The 51 bp band was
excised from the gel, purified and ligated into pCR 2.1
(Invitrogen). The ligated vector was used to transform competent E.
coli cells and vector DNA was subsequently isolated using standard
techniques. DNA isolated from several isolates was used as template
for PCR reactions to confirm the presence of the c-myc insert.
[0102] Several isolates were grown, cells harvested, plasmid DNA
isolated and the DNA sequence of the c-myc were determined. A
comparison the sequence obtained empirically with the published
sequence revealed that no PCR errors were apparent. An ATG was
added by the PCR primers to ensure the translation of the c-myc
peptide.
[0103] Transformation of Fungal Cells Several exemplary fungal
cells that can be transformed to express vaccine proteins can
include, but are not limited to, Saccharomyces spp., Aspergillus
spp., Cryptococcus spp., Coccidioides spp., Neurospora spp.,
Histoplasma spp., Blastomyces spp., and a combination thereof.
[0104] Exemplary method of transformation of S. cerevisiae. After
isolating each of the genes of interest and forming each yeast
expression vector (as described), DNA vectors to individually
transform yeast cells were used. The transformation protocol was as
follows: 50 .mu.L of YPD broth was inoculated with W303-1B
Saccharomyces cerevisiae and the culture grown overnight at
30.degree. C. with shaking. The desired OD600 for transformation
was between 0.1-0.6 (.about.2.times.107 c/mL). Cells were harvested
by centrifugation at 2000.times.g for 10 minutes, the pellet was
washed in 25 mL sterile water and cells were again centrifuged at
2000.times.g for 10 minutes. The pellet was resuspended in 1 mL 01M
lithium acetate (LiAC), centrifuged at 1000.times.g for 30 seconds
and the supernatant removed. This pellet was again resuspended in
400 .mu.L 0.1M LiAC and the cell suspension mixed until the cells
were completely suspended. Fifty milliliters of this cell
suspension was used for each transformation. The cells were
centrifuged at 3000.times.g for 30 seconds and the supernatant
discarded. To the cells was added 240 .mu.L 50% (w/v) PEG, 36 .mu.L
1M LiAC, 25 .mu.L denatured carrier DNA, and 50 .mu.L of previously
diluted water containing plasmid DNA (0.1-10 .mu.g). Cells were
mixed until the pellet completely resuspended, mixtures were
incubated at 30.degree. C. for 30 minutes, and heat shocked at
42.degree. C. for 20-25 min. The cells were harvested by
centrifugation at 3000.times.g for 30 seconds, gently resuspended
in imL of water and spread onto Yeast Nitrogen Base medium (YNB)
(e.g., Difco) minus uracil plates. The plates were incubated at
30.degree. C. for 3-4 days.
[0105] Identification of yeast cells expressing candidate proteins
In one example, a single yeast colony was obtained from YNB minus
uracil plates and grown for overnight at 30.degree. C. with shaking
in 250 mL flasks containing 50 mL YNB minus uracil medium. Each
culture was diluted to a final concentration of 0.2 (OD600) in 50
mL YNB minus uracil interim cultures. The cultures were grown at
30.degree. C. until the OD600 had doubled (approximately 5-6
hours). The OD600 of the interim cultures was determined a final
time before the cultures were diluted to a final concentration of
0.02 OD600 units in 50 mL of YNB minus uracil. These cultures were
grown for 1 hour with shaking at 30.degree. C. before 0.4 mM
CuSO.sub.4 (final concentration) was added. As a control, to a
duplicate culture, 0.4 mM NaSO.sub.4 was added to show that the
protein is not produced in the absence of copper. Once the
CuSO.sub.4 and NaSO.sub.4 were added, the cultures were grown
overnight (18 hours) at 30.degree. C. with shaking (FIG. 1).
[0106] Induced and uninduced cultures were harvested after
overnight incubation by centrifugation at 550.times.g for 10
minutes. Each cell pellet was washed with 25 mL ice cold water to
remove any residual medium and the cells were harvested again by
centrifugation. Each pellet was then resuspended in 1 mL of ice
cold water and divided into two 1.5 mL eppendorf tubes for
centrifugation. After the removal of the supernatant, one tube was
frozen at -80.degree. C. for storage and the other was lysed for
protein determination. Cells were lysed in the following manner:
100 .mu.L of glass beads were added followed by the addition of 200
.mu.L 2.times. sample lysis buffer (0.1M Tris, pH 6.8, 20% (v/v)
glycerol, 4% (w/v) SDS, 0.5% (v/v) .beta.-mercaptoethanol). Tubes
were mixed by vortexing for 1 min to resuspend and lyse the cells
and mixtures were boiled for 3 min to denature the proteins for
SDS-PAGE gel electrophoresis. Debris was removed by centrifugation
at 550.times.g for 5 min. and the cleared cell lysates were
transferred to new tubes.
[0107] Cell lysates were loaded into the wells of 15% Tris-HCl
SDS-PAGE gels (example: Bio Rad, Hercules, Calif.) in 15 .mu.L
aliquots and separated by electrophoresis at 60-80 V for 2-3 hours.
Proteins were then transferred from the gel to a PVDF
[poly(vinylidine fluoride)] membrane using a mini-genie transfer
apparatus (Idea Scientific, Minneapolis, Minn.) for 1 hour at 12
volts.
[0108] PVDF membranes were blocked in TBST (100 mM Tris, 1.5 M NaCl
and 0.1% [v/v] Tween 20) containing 5% (w/v) powdered milk
(Carnation) for 1 hour at room temperature. Blocked membranes were
then incubated with primary anti-c-myc epitope antibody (1:1000
dilution) in TBST containing 1% milk overnight at 4o C. The next
morning the membranes were washed five times for 15 minutes each in
TBST before secondary antibody was added. Secondary antibody
conjugated to horse radish peroxidase (HRP) was added in TBST
containing 1% (w/v) milk and incubated for 1 hour at room
temperature. The membrane was washed five times for 5 minutes each
in TBST before exposure to ECL reagents. The membrane was exposed
to ECL (Pierce Chemical Company, Rockford, Ill.) for 1 minute then
developed using an Alpha-Innotech (San Leandro, Calif.) digital
system.
Determination of Optimal Growth Conditions of Yeast Expressing
Candidate Proteins
[0109] Initial 50 mL cultures were started with 800 .mu.L of each
glycerol stock that was frozen at a concentration of
1.times.10.sup.8 cells/mL. Cultures were grown overnight at
30.degree. C. with shaking. The next morning the cultures were
counted using a hemocytometer as well as for the OD600
determination using a SpectraMax 340 plate reader (Molecular
Devices, Sunnyvale, Calif.). Each culture was then diluted to OD600
of 0.1, 0.2, or 0.3. Duplicate cultures were grown in 250 mL
Erlenmeyer flasks (50 mL cultures) as well as in 300 mL Klett
flasks (containing 60 mL of medium). Samples were taken every hour
from the 250 mL Erlenmeyer flasks for cell counting and OD600
readings, while Klett readings were taken using a Klett-Summerson
Photoelectric colorimeter (Klett-Summerson, NY). By using these
methods, not only could the growth curve be characterized, but the
OD600 could be correlated, cell counts, and Klett readings thereby
allowing use of any of the three methods in future experiments. The
following correlation was determined; 50 Klett units=0.25 OD600
units=2.times.10.sup.7 c/mL. From these data, the doubling time of
the culture was determined to be approximately 5 hours. An
exemplary growth curve for one such transformant is shown in FIG.
2.
[0110] Once the growth curves at each of the three initial
inoculation concentrations were determined, the new variable of
various CuSO.sub.4 concentrations was added. Copper sulfate was
tested at the following concentrations: 0, 0.2, 0.3, and 0.4 mM.
The protocol to induce pYEX-BX suggested a CuSO.sub.4 range of
0.2-0.5 mM and it had previously been determined that 0.5 mM was
potentially toxic to the yeast. As in the experiment above,
duplicate cultures were inoculated in 250 mL Erlenmeyer flasks and
300 mL Klett flasks. Samples were taken every hour from the 250 mL
Erlenmyer flasks for cell counting and OD600 readings, while Klett
readings were taken from the Klett flasks. The lower inoculum grew
the best upon the addition of CuSO.sub.4. The correlation between
Klett units, OD600 units, and cell counts was the same as
determined previously. The doubling time of the each culture was
again 5 hours and was independent of copper concentration. The
growth curve with copper for one such transformant at each
innoculumis shown in FIG. 1.
Preparation of Vaccine
[0111] In one exemplary method, overnight cultures were started by
adding 1 mL of a glycerol stock of yeast cells to 50 mL of YNB
minus uracil medium in a 250 mL flask. Cultures were grown
overnight at 30.degree. C. with shaking. The next morning the OD600
was determined and a 50 mL interim culture was inoculated at a
final OD600 of 0.2 and grown at 30o C with shaking until it had
doubled (4-5 hours). The optical density was subsequently
determined for the interim culture which was used to inoculate a
final 250 mL culture at 0.02 (final OD600) and grown for 1 hour at
30.degree. C. with shaking. After the hour of growth, 0.4 mM
CuSO.sub.4 (final concentration) was added to induce the production
of each candidate protein. This induced culture was grown for 16 to
18 hours at 30.degree. C. with shaking. Because the doubling time
for copper-induced cells was approximately 5 hours, these induced
cultures were in mid to late log after about 18 hours of
growth.
Heat-Killed Preparations
[0112] In one example, cells from cultures were harvested by
centrifugation at 1900 g for 5 min at 4o C. Cultures were washed 4
times with 100 mL room temperature PBS (137 mM NaCl, 2.7 mM KCl, 10
mM Na2HPO.sub.4, 2 mM KH2PO.sub.4) to remove any residual medium
and copper from the cells. Cells were resuspended in 3 mL room
temperature PBS and then added to 200 mL PBS that had been
pre-warmed to 56.degree. C. The cells were subsequently heat killed
by incubation at 56.degree. C. in a water bath for 1 hour, with
inversion of tubes every 10 min. to ensure that all cells were heat
killed. Cells were harvested by centrifugation (1900.times.g for 5
min at 4o C) and then washed 4 times with 100 mL with room
temperature PBS. Cells were counted and resuspended at a final
concentration of 4.times.108 c/mL in PBS, aliquoted in 200 mL
aliquots and stored at 4.degree. C.
[0113] Yeast cells can be heat-killed by incubation in sterile,
pyrogen-free saline at 56.degree. C. for 1 hr, washed in saline,
resuspended at .about.2.times.10.sup.8 cells/mL in sterile saline,
and stored at 4.degree. C. Each batch is expected to yield
.about.2.times.10.sup.10 yeast cells, of which a vaccine dose for
the animal studies will consist of .about.1.times.10.sup.7 to
20.times.10.sup.7 cells.
Test for Live Cells in Heat-Killed Preparations
[0114] In one method, to ensure that the heat treatment has
inactivated >99.99% of the yeast cells, 1.times.10.sup.7
heat-killed cells were incubated on agar-solidified rich medium for
three days at 30.degree. C. and the number of resulting yeast
colonies (if any) determined. Only batches of cells with survival
rates of <0.01% are to be used. To confirm that no live
microorganisms, e.g., bacteria, were present, fluid thioglycolate
medium (as described in the USP 24 NF19) may be inoculated with
each batch of heat-killed yeast cells. The test mixtures were
incubated for 14 days at 32.degree. C. and examined visually for
growth. Only batches of heat-killed cells in which minimal to no
microbial growth was observed were used.
Endotoxin Levels of Each Batch of Vaccine
[0115] Bacterial cell-wall fragments and other pyrogens can often
obscure immune responses. Pyrogen-free containers, liquids, and
media were used to minimize spurious endotoxin contamination.
Recently, the FDA has allowed use of a test for bacterial endotoxin
levels to substitute for rabbit pyrogenicity tests. The endotoxin
levels of each vaccine formulation were quantitated using a G test
(Fungitec, Seikagaku Corp., Tokyo, Japan) under the U.S.
Pharmacopeia (USP) guidelines. This test relies on the factor G
component of horseshoe crab amoebocyte lysate. Unfortunately, this
component is sensitive to (1,3).beta.-glucan while factors B and C
are sensitive to endotoxin. Since it is expected that a small
amount of fungal cell-wall glucan is present in heat-killed yeast
preparations and these may lead to false positives, all samples
prior to test were treated with (1,3).beta.-glucanase, which will
destroy any (1,3).beta.-glucan. This procedure thus will provide an
accurate determination of the endotoxin levels present. Only
batches of heat-killed cells that contain <0.5 EU/mL were
used.
Example 1
[0116] In certain exemplary methods, the fungal organism
Aspergillus was examined.
[0117] Efficacy of four A. fumigatus antigens protecting mice from
systemic aspergillosis In one exemplary method, the protective
efficacy of 4 A. fumigatus antigens expressed in Saccharomyces sp.
in an experimental model of systemic murine aspergillosis was
tested. Efficacy was evaluated in terms of survival and tissue
burden. See FIG. 3 as one exemplary strategy for vaccine generation
and animal testing.
[0118] Antigens In this example, vaccines preparations containing
6.times.10.sup.7 heat-killed yeast cells/150 microliters were
administered s.c. using two injection sites (0.075 ml each) on days
28, 21 and 14 before infection. Groups pretreated with Myc (yeast
containing and expressing only the c-myc tag) or PBS were used as
controls.
[0119] Animals 60 CD-1 male mice weighting 30 g approx. were
used.
[0120] Inoculum A total of 1.3.times.10.sup.7 conidia of A.
fumigatus, strain AF-10, were inoculated via lateral tail vein into
the CD-1 mice.
[0121] In this exemplary method, 16 days after infection, animals
were euthanatized by CO.sub.2 anoxia and kidney and brain were
removed. Each organ was homogenized, diluted and plated on SDA
plates for CFU determination.
Survival
[0122] Comparisons showed that animals immunized with Hemolysin
(Hemo or HEMO) antigen had an increased survival time in comparison
with the PBS control group (p=0.012). In addition, the MYC control
treated group did have an increased survival time in comparison
with the PBS control group although this did not reach statistical
significance (p=0.089) (FIG. 4).
[0123] In another example, the protective effect of the A.
fumigatus antigen (HEMO) expressed in Saccharomyces sp. in a
systemic murine model of aspergillosis was evaluated. The animal
model showed low mortality in the control groups i.e., PBS and MYC,
and HEMO pretreatment did not significantly prolonged the survival
of the animals. However, the tissue burden study demonstrated that
animals receiving three doses of the HEMO antigen before the
infection had significantly lower CFU of the fungus in the kidneys
and brain in comparison with the PBS-treated control animals (FIG.
12). These results demonstrate that HEMO pretreatment provides
protective resistance against systemic aspergillosis.
[0124] Exemplary Cloning of AspF 2. Published DNA and predicted
amino acid sequences to design PCR primers to amplify the ORF from
the Aspergillus fumigatus cDNA library were used. The DNA and amino
acid sequences of AspF 2 are presented in diagram form in SEQ ID
NOs:3 and 4. The positions of the 5' and 3' primers use to obtain
the predicted PCR product are also shown in SEQ ID NOs:3 and 4.
TABLE-US-00002 atg ctt gtg gcc acc ctc cct acc tcc ccc gtc ccc atc
gcg gcg cga 48 Met Leu Val Ala Thr Leu Pro Thr Ser Pro Val Pro Ile
Ala Ala Arg 1 5 10 15 gca acc ccc cac gaa ccc gtc ttc ttc tcc tgg
gac gct ggc gcg gtg 96 Ala Thr Pro His Glu Pro Val Phe Phe Ser Trp
Asp Ala Gly Ala Val 20 25 30 acc tcg ttc ccc atc cac tcc agc tgc
aat gcg acc cag cgc cgg cag 144 Thr Ser Phe Pro Ile His Ser Ser Cys
Asn Ala Thr Gln Arg Arg Gln 35 40 45 atc gag gcc ggc ctg aac gag
gcg gtc gag ctc gcc cgg cac gcc aag 192 Ile Glu Ala Gly Leu Asn Glu
Ala Val Glu Leu Ala Arg His Ala Lys 50 55 60 gcc cac atc ctc cgc
tgg ggc aac gag agc gag atc tac cgg aag tac 240 Ala His Ile Leu Arg
Trp Gly Asn Glu Ser Glu Ile Tyr Arg Lys Tyr 65 70 75 80 ttt ggc aac
cgg ccc acc atg gag gcc gtc ggt gcc tac gat gtc atc 288 Phe Gly Asn
Arg Pro Thr Met Glu Ala Val Gly Ala Tyr Asp Val Ile 85 90 95 gtg
aac ggg gac aag gcc aac gtg ctc ttc cgg tgt gac aac ccc gac 336 Val
Asn Gly Asp Lys Ala Asn Val Leu Phe Arg Cys Asp Asn Pro Asp 100 105
110 ggc aac tgt gct ttg gaa ggc tgg ggc ggc cac tgg cgc ggc gcg aac
384 Gly Asn Cys Ala Leu Glu Gly Trp Gly Gly His Trp Arg Gly Ala Asn
115 120 125 gcc acc tcc gaa acc gtc atc tgt gat cgc agc tac acc acc
cgc cgc 432 Ala Thr Ser Glu Thr Val Ile Cys Asp Arg Ser Tyr Thr Thr
Arg Arg 130 135 140 tgg ctt gtc tcc atg tgc tcc cag ggc tac acc gtc
gcc ggc tcc gag 480 Trp Leu Val Ser Met Cys Ser Gln Gly Tyr Thr Val
Ala Gly Ser Glu 145 150 155 160 acc aac acc ttc tgg gct tcg gac ctg
atg cac cgt ctg tac cat gtg 528 Thr Asn Thr Phe Trp Ala Ser Asp Leu
Met His Arg Leu Tyr His Val 165 170 175 cct gct gtg ggt caa ggc cgg
gtc gac cac ttc gcc gac ggc tac gac 576 Pro Ala Val Gly Gln Gly Arg
Val Asp His Phe Ala Asp Gly Tyr Asp 180 185 190 gag gtg att gcc ctg
gcc aag agc aac ggc acc gag tcc acg cat gac 624 Glu Val Ile Ala Leu
Ala Lys Ser Asn Gly Thr Glu Ser Thr His Asp 195 200 205 tcg gag gcg
ttg cag tat ttc gcc ctt gag gcg tat gcg ttt gat att 672 Ser Glu Ala
Leu Gln Tyr Phe Ala Leu Glu Ala Tyr Ala Phe Asp Ile 210 215 220 gcc
gct ccc ggt gtc gga tgt gct ggc gag agt cac ggc cct gac cag 720 Ala
Ala Pro Gly Val Gly Cys Ala Gly Glu Ser His Gly Pro Asp Gln 225 230
235 240 gga cat gac acc ggg tct gcc tcg gcg cct gcg tct acc tcc acc
tct 768 Gly His Asp Thr Gly Ser Ala Ser Ala Pro Ala Ser Thr Ser Thr
Ser 245 250 255 agc tcc agc tcg ggc tcg ggc tcg ggc gcc acg act acc
ccg acg gat 816 Ser Ser Ser Ser Gly Ser Gly Ser Gly Ala Thr Thr Thr
Pro Thr Asp 260 265 270 tct ccc agt gcc act att gat gtg ccg tcg aac
tgc cat acc cat gaa 864 Ser Pro Ser Ala Thr Ile Asp Val Pro Ser Asn
Cys His Thr His Glu 275 280 285 ggt gga cag ctt cat tgc act 885 Gly
Gly Gln Leu His Cys Thr 290 295
[0125] A 16 amino acid signal sequence was predicted by PSORTII
(http://psort.nibb.ac.jp/cgi-bin). The signal sequence was
subsequently removed as PSORTII predicted that the protein would be
extracellular, which suggested that the protein would be secreted
by the S. cerevisiae if the signal sequence was left intact. A
methionine was added before the 17th amino acid to ensure that the
protein would be translated.
[0126] The following conditions were used to amplify AspF 2 from an
Aspergillus fumigatus cDNA library: 25 .mu.L reactions were
performed in PCR Ready Bead tubes (Amersham Pharmacia) containing
500 ng of cDNA library, 2 .mu.M primers, and 13 .mu.L sterile
water. Reactions were performed using the Perkin Elmer 2400
Thermocycler (PE Applied Biosystems) under the following
conditions: an initial cycle at 94.degree. C. for 5 min, 30 cycles
at 94.degree. C. for 1 min, 50.degree. C. for 1 min and 72.degree.
C. for 1 min, and a final extension at 72.degree. C. for 7 min.
[0127] The PCR reactions were separated using agarose gel
electrophoresis and a photograph of a representative gel data not
shown. A band of approximately 936 bases corresponding to the
amplified AspF 2 ORF contains a 3' c-myc tag.
[0128] The band was excised from the gel, purified and ligated into
pCR 2.1. The ligated vector was used to transform competent E. coli
cells and vector DNA isolated from 5 mL mini cultures using
standard alkaline lysis techniques. DNA isolated from several
miniprep isolates was digested with EcoRI and separated by agarose
gel electrophoresis to confirm the presence of the 936 base AspF
2/c-myc insert.
[0129] Several isolates were grown, cells harvested, plasmid DNA
isolated and the DNA sequence of the AspF 2 insert determined. A
comparison of the sequence obtained empirically with the published
sequence was determined (SEQ ID NOs: 5 and 6). There were no
apparent PCR errors. TABLE-US-00003 SEQ ID NO: 5 - AspF2 accaacacct
tctgggcttc ggacctgatg caccgtctgt accatgtgcc tgctgtgggt 60
caaggccggg tcgaccactt cgccgacggc tacgacgagg tgattgccct ggccaagagc
120 aacggcaccg agtccacgca tgactcggag gcgttgcagt atttcgccct
tgaggcgtat 180 gcgtttgata ttgccgctcc cggtgtcgga tgtgctggcg
agagtcacgg ccctgaccag 240 ggacatgaca ccgggtctgc ctcggcgcct
gcgtctacct ccacctctag ctccagctcg 300 ggctcgggct cgggcgccac
gactaccccg acggattctc ccagtgccac tattgatgtg 360 ccgtcgaact
gccataccca tgaaggtgga cagcttcatt gcactgaaca gaagttgatt 420
tccgaagaag acctcgag 438 SEQ ID NO: 6 - AspF2 PCR accaacacct
tctgggcttc ggacctgatg caccgtctgt accatgtgcc tgctgtgggt 60
caaggccggg tcgaccactt cgccgacggc tacgacgagg tgattgccct ggccaagagc
120 aacggcaccg agtccacgca tgactcggag gcgttgcagt atttcgccct
tgaggcgtat 180 gcgtttgata ttgccgctcc cggtgtcgga tgtgctggcg
agagtcacgg ccctgaccag 240 ggacatgaca ccgggtctgc ctcggcgcct
gcgtctacct ccacctctag ctccagctcg 300 ggctcgggct cgggcgccac
gactaccccg acggattctc ccagtgccac tattgatgtg 360 ccgtcgaact
gccataccca tgaaggtgga cagcttcatt gcactgaaca gaagttgatt 420
tccgaagaag acctcgag 438
[0130] The DNA of an isolate was excised from the pCR 2.1 vector
(Invitrogen) with a BamHI/EcoRI double digest and the reactions
were separated by electrophoresis so that the DNA band encoding the
AspF 2 ORF could be isolated. This DNA fragment was then ligated
into the pYEX-BX vector using the same restriction enzymes. The
ligated vector was then used to transform competent E. coli and the
plasmid DNA isolated by standard alkaline lysis mini-preps. The DNA
sequence of salient portions of the vector was determined to ensure
the correct alignment of the ORF with the TATA box. Then portions
of the vector were sequenced data not shown. The TATA box, the
aspf-2 coding sequence, the c-myc tag sequence, and the stop codons
were identified (SEQ ID NOs: 1 and 2).
[0131] Exemplary cloning method for Hemolysin Published DNA and
predicted amino acid sequences of Hemolysin to design PCR primers
to amply the ORF from the A. fumigatus cDNA library were used. The
DNA and amino acid sequences are presented in diagram form in SEQ
ID NOs:7 and 8, along with the positions of the 5' and 3' primers
used to obtain the predicted PCR product are shown. No signal
sequence was predicted by PSORTII
(http://psort.nibb.ac.jp/cgi-bin). TABLE-US-00004 SEQ ID NOs: 7 and
8 - nucleic acid and corresponding amino acid sequence of Hemolysin
##STR1##
[0132] The following conditions were used to amplify hemolysin from
the cDNA library: 25 .mu.L reactions were performed in PCR Ready
Bead tubes containing 500 ng of cDNA library, 2 .mu.M primers, and
13 .mu.L sterile water. Reactions were performed using a Perkin
Elmer 2400 Thermocycler under the following conditions: an initial
cycle at 94.degree. C. for 5 min, 30 cycles at 94.degree. C. for 1
min, 50.degree. C. for 1 min, 72.degree. C. for 1 min, and a final
extension at 72.degree. C. for 7 min.
[0133] The PCR reactions were separated using agarose gel
electrophoresis and a band of approximately 444 bp corresponding to
the amplified hemolysin ORF was excised from the gel, purified and
ligated into pCR 2.1. The ligated vector was used to transform
competent E. coli cells and vector DNA was subsequently isolated
using standard techniques. DNA isolated from several isolates was
used as template for PCR reactions to confirm the presence of the
hemolysin insert. Not all isolates contained the hemolysin insert
due to self ligation of the pCR 2.1 vector. See FIG. 5.
[0134] Several isolates were grown, cells harvested, plasmid DNA
isolated and the DNA sequence of the hemolysin were determined. A
comparison the sequence obtained empirically with the published
sequence revealed that no PCR errors were apparent, the sequence as
shown in SEQ ID NOs:9 and 10. TABLE-US-00005 SEQ ID NO: 9 - Hemo
##STR2## SEQ ID NO: 10 - Hemo PCR ##STR3##
[0135] The DNA of one isolate was treated with BamH I/EcoRI and the
DNA band encoding the hemolysin ORF/c-myc tag was isolated. This
DNA fragment was then ligated into vector pYEX-BX that had also
been digested with BamH I/EcoRI. The ligated vector was then used
to transform competent E. coli and the plasmid DNA was subsequently
isolated. The DNA sequence of the relevant portions of the vector
was determined to ensure the correct alignment of the ORF with the
TATA box and the c-myc tag was in frame with the rest of the ORF.
The sequenced portion of the vector is presented in SEQ ID NO:11.
In addition, this vector was used for Examples 2 and 3.
TABLE-US-00006 SEQ IN NO: 11 - Portions of pYEX-BX that were
sequenced ##STR4##
[0136] In one exemplary method an empty vector control was
generated as previously described in Methods (This template was
amplified by PCR as discussed previously. DNA isolated from several
isolates was used as template for PCR reactions to confirm the
presence of the c-myc insert. (SEQ ID NOs:1 and 2) The DNA of one
isolate was treated with BamH I/EcoRI and the DNA band encoding the
c-myc tag was isolated. This DNA fragment was then ligated into
pYEX-BX which had also been digested with BamHI and EcoRI. The
ligated vector was used to transform competent E. coli cells and
vector DNA isolated using standard techniques. DNA isolated from
several miniprep isolates was used as template for PCR reactions to
confirm the presence of the c-myc control insert. (SEQ ID NOs:1 and
2)
[0137] Several isolates were grown, cells harvested, plasmid DNA
isolated and the DNA sequence of the c-myc control insert were
determined. The DNA sequence of pertinent portions of the vector
was determined to ensure the correct alignment of the c-myc control
with the TATA box.
[0138] In one exemplary method, transformants expressing each A.
fumigatus protein were identified and the cleared cell lysates were
generated and stored as previously discussed.
[0139] After gel separation, expression of A. fumigatus proteins
was determined by western blot by methods known in the art. In one
exemplary method growth of transformants were determined.
Transformants that were determined to produce a protein of the
correct molecular weight above were grown in YNB minus uracil for
2-3 days at 30.degree. C. with shaking. Once the cultures were in
stationary phase, the cells were counted and frozen in 50% glycerol
at a final concentration of 1.times.108 c/mL (10 yeast units) and
stored at -80.degree. C. until use.
[0140] The production of vaccines for animal models was used as
previously disclosed. Each of four A. fumigatus genes from a cDNA
library using gene-specific PCR primers were cloned. The DNA
encoding each ORF was sequenced to confirm that the correct gene
had been cloned followed by an inframe c-myc tag and that no PCR
errors were introduced. The ORF of each gene was inserted into the
copper inducible vector pYEX-BX. Portions of each ligated vector
were sequenced to ensure the correct position of the gene relative
to the TATA box.
[0141] Each pYEX-BX vector containing a gene of interest was used
to transform yeast and yeast transformants expressing each of the
four proteins identified by Western blot analysis. Each S.
cerevisiae strain that produced the correct protein was
subsequently produced and used to vaccinate an animal as discussed
above.
[0142] Aspergillus. In another exemplary method, the protective
efficacy of HEMO antigen expressed in Saccharomyces spp. against
systemic aspergillosis was tested in mice.
[0143] Antigen. HEMO antigen was administered s.c. using two
injection sites dorsally (0.075 ml each) on days 28, 21 and 14
before infection, receiving 6.times.10.sup.7 yeast cells per
animal. Control animals received PBS (diluent control) or MYC
(yeast not expressing immunogen control) at 6.times.10.sup.7 yeast
cells per animal.
[0144] Animals. Thirty six weeks-old male CD-1 mice were used.
Animals were housed in standard conditions in cages of 5 animals.
Groups of 10 mice per group were established.
[0145] Infection. A total of 5.8.times.106 viable Aspergillus
fumigatus conidia per mouse were inoculated intravenously via
lateral tail vein.
[0146] Tissue burden. 16 days after infection surviving animals
were euthanatized by CO2 anoxia. The kidney and brain were removed
aseptically, homogenized in 0.9% saline, diluted and plated on SDA
plates for CFU determination.
[0147] Statistics. Comparisons of survival were done by a log rank
test and tissue burden by Mann Whitney test using GraphPad 3.03 for
Windows.
[0148] FIG. 12 represents an exemplary Log 10 CFU per studied
organ. Pretreatment with HEMO antigen significantly reduced tissue
burdens from brain and kidney in comparison to the diluent control
(p=0.003 and 0.023, respectively). In addition the yeast control
(MYC) reduced organs burdens as well but did not reach statistical
significance (p=0.089 in both organs). No differences were found
between MYC and PBS groups. Importantly, 50 and 60% of the animals
receiving MYC or HEMO, respectively, did not show detectable amount
of A. fumigatus in brain but all PBS-pretreated animals showed
fungal grown in this organ.
[0149] The protective effect of the A. fumigatus antigen (HEMO)
expressed in Saccharomyces was tested in a systemic murine model of
aspergillosis. The MYC only yeast control group did show a
reduction in the brain organ burden. Importantly, the tissue burden
study demonstrated that animals receiving three doses of the HEMO
antigen before the infection had statistically significantly lower
CFU of the fungus in the kidneys and brain in comparison with the
PBS-treated control animals. These results show that the vaccine
containing either yeast alone (MYC) or Hemo protected mice against
an infection of Aspergillus fumigatus.
Example 2
[0150] In certain exemplary methods, the fungal organism
Coccidioides was examined.
[0151] See one exemplary schematic for production of and testing
for an anti-fungal vaccination in a Coccidioides animal model (FIG.
6). In one exemplary method, the feasibility of using heat-killed
yeast cells expressing a C. immitis antigen as a vaccine against C.
immitis infections was examined. cDNA was obtained for each the C.
immitis gene whose protein has been shown in other work to elicit
an immune response in infected animals. Then yeast were transformed
with each cDNA and strains selected that expressed a high levels of
the antigen. A schematic of the strategy is depicted in FIG. 6.
[0152] In another exemplary method, the protective effect of
Coccidioides immitis antigen expressed by Saccharomyces cerevisiae
was analyzed and used as a killed whole vaccine preparation in a
systemic murine model of coccidioidomycosis. DNA encoding for Ag2
(also called PRA) was cloned into S. cerevisiae and gene expression
induced using for example, copper. These yeast cells were heat
killed and used to vaccinate mice prior to infection with
Coccidioides immitis.
[0153] Animals. Six-week-old male CD-1 mice were purchased from
Charles River Laboratories. Groups consisted on 20 mice, housed in
standard conditions. After infection, mice were housed in
micro-isolator cages. Animals were provided food and acidified
water ad libitum.
[0154] Antigen. In this exemplary example, a C. immitis antigen
expressed in Saccharomyces was used. This was a protein present in
the alkali-soluble and water-soluble preparation of the spherule
wall and called antigen 2 (Ag2/PRA). The vaccine was administered
subcutaneously (s.c.) in a volume of 50 .mu.l three times before
infection (i.e., 21, 14 and 7 days prior to the infection) at a
concentration of 4.times.10.sup.8 cells/ml. In this example, PBS
was used as the control.
[0155] Inoculum. Coccidioides immitis (Silveira strain) was used.
The strain was grown on glucose yeast-extract (GYE) plates in a
Class 3 biosafety cabinet at room temperature for 2 weeks.
Arthroconidia were harvested as a suspension in saline. The number
of arthroconidia was determined by hemacytometer and verified for
viability by cfu (colony forming units) determination done by
plating inoculum dilutions on GYE medium. Animals were infected
intravenously (i.v.) with a suspension containing 376 viable
arthroconidia per mouse. Statistical analysis of survival was done
using a log rank test.
[0156] FIG. 7 illustrates an exemplary the survival curve of the
groups of mice included in the study that was vaccinated with yeast
expressing the antigen-2/PRA protein. Deaths of control animals and
pretreated animals began on day 13 after infection and by day 21
only 10% of the PBS treated mice were still alive. This was in
contrast to the mice treated with the Ag-2 containing yeast (25%
still alive) Statistical comparisons between groups showed a
significant difference between the control group and Ag2 immunized
animals (p=0.04). This example shows that mice vaccinated with
yeast cells expressing the antigen-2/PRA protein survived to a
greater extent than untreated mice.
[0157] FIG. 8 illustrates an exemplary a Western Blot of extracts
of yeasts containing and expressing Hemolysin (hemo), aspf 2, or
antigen 2 (the Coccidioides protein described above). The numbers
indicate the amount of lysate separated by SDS-GEL electrophoresis.
The blots were treated with a c-myc epitope specific antibody and
the antibody detected using a secondary horse radish peroxidase
antibody. Various amounts in micrograms (indicated by the numbers
at the bottom of the figure) of c-myc peptide were spotted.
[0158] Antigen 2/proline-rich antigen has been previously shown to
be protectivein murine models of coccidiomycosis. Thus antigen 2
was chosen. Published DNA and predicted amino acid sequences were
used to design PCR primers to amplify the ORF from the Cox cDNA
library (SEQ ID NOs:12 and 13). The DNA and amino acid sequences of
antigen 2 are presented in diagram form, data not shown. An 18
amino acid signal sequence was predicted by PSORTII
(http://psort.nibb.ac.jp/cgi-bin), but was not removed as PSORTII
also predicted that the protein would be cell wall bound, most
likely GPI anchored. This prediction suggests that the protein
would not be secreted by the S. cerevisiae. TABLE-US-00007 SEQ ID
NOs: 12 and 13 ##STR5## ##STR6## ##STR7## ##STR8## ##STR9##
##STR10## ##STR11## ##STR12## ##STR13## ##STR14## ##STR15##
##STR16## ##STR17##
[0159] Exemplary conditions used to amplify antigen 2 from the cDNA
library were as follows: 25 .mu.L reactions were performed in PCR
Ready Bead tubes (Amersham Pharmacia) containing 500 ng of cDNA
library, 2 .mu.M primers, and 13 .mu.L sterile water. Reactions
were performed using the Perkin Elmer 2400 Thermocycler (PE Applied
Biosystems) under the following conditions: an initial cycle at
94.degree. C. for 5 min, 30 cycles at 94.degree. C. for 1 min,
50.degree. C. for 1 min and 72.degree. C. for 1 min, and a final
extension at 72.degree. C. for 7 min. As previously discussed, PCR
reactions were separated and a band of approximately 582 bases
corresponding to the amplified antigen 2 ORF was excised. The band
was excised from the gel, purified and ligated into pCR 2.1. The
ligated vector was used to transform competent E. coli cells and
vector DNA isolated from 5 mL mini cultures using standard alkaline
lysis techniques. DNA isolated from several miniprep isolates was
digested with EcoRI to confirm the presence of the 582 base antigen
2 insert. Only one isolate contained the antigen 2 insert.
[0160] Several isolates were grown, cells harvested, plasmid DNA
isolated and the DNA sequence of the antigen 2 insert determined. A
comparison of the sequence obtained empirically with the published
sequence is shown in SEQ ID NOs:14 and 15. There were no apparent
PCR errors. TABLE-US-00008 SEQ ID NO:14 Antigen-2
ATGCAGTTCTCTCACGCTCTCATCGCTCTCGTCGCTGCCGGCCTCGCCAG
TGCCCAGCTCCCAGACATCCCACCTTGCGCTCTCAACTGCTTCGTTGAGG
CTCTCGGCAACGATGGCTGCACTCGCTTGACCGACTTCAAGTGCCACTGC
TCCAAGCCTGAGCTCCCAGGACAGATCACTCCTTGCGTTGAGGAGGCCTG
CCCTCTCGACGCCCGTATCTCCGTCTCCAACATCGTCGTTGACCAGTGCT
CCAAGGCCGGTGTCCCAATTGACATCCCACCAGTTGACACCACCGCCGCT
CCCGAGCCATCCGAGACCGCTGAGCCCACCGCTGAGCCAACCGAGGAGCC
CACTGCCGAGCCTACCGCTGAGCCCACCGCTGAGCCGACTCATGAGCCCA
CCGAGGAGCCCACTGCCGTCCCAACCGGCACTGGCGGTGGTGTCCCCACT
GGCACCGGTTCCTTCACCGTCACTGGCAGACCAACTGCCTCCACCCCAGC
TGAGTTCCCAGGTGCTGGCTCCAACGTCCGTGCCAGCGTTGGCGGCATTG
CTGCTGCTCTCCTCGGTCTCGCTGCCTACCTG SEQ ID NO:15: Antigen-2 PCR
ATGCAGTTCTCTCACGCTCTCATCGCTCTCGTCGCTGCCGGCCTCGCCAG
TGCCCAGCTCCCAGACATCCCACCTTGCGCTCTCAACTGCTTCGTTGAGG
CTCTCGGCAACGATGGCTGCACTCGCTTGACCGACTTCAAGTGCCACTGC
TCCAAGCCTGAGCTCCCAGGACAGATCACTCCTTGCGTTGAGGAGGCCTG
CCCTCTCGACGCCCGTATCTCCGTCTCCAACATCGTCGTTGACCAGTGCT
CCAAGGCCGGTGTCCCAATTGACATCCCACCAGTTGACACCACCGCCGCT
CCCGAGCCATCCGAGACCGCTGAGCCCACCGCTGAGCCAACCGAGGAGCC
CACTGCCGAGCCTACCGCTGAGCCCACCGCTGAGCCGACTCATGAGCCCA
CCGAGGAGCCCACTGCCGTCCCAACCGGCACTGGCGGTGGTGTCCCCACT
GGCACCGGTTCCTTCACCGTCACTGGCAGACCAACTGCCTCCACCCCAGC
TGAGTTCCCAGGTGCTGGCTCCAACGTCCGTGCCAGCGTTGGCGGCATTG
CTGCTGCTCTCCTCGGTCTCGCTGCCTACCTG
[0161] The DNA of the isolate was excised from the pCR 2.1 vector
and the salient portions of the vector was determined to ensure the
correct alignment of the ORF with the TATA box and the c-myc tag,
as described previously. Published DNA and predicted amino acid
sequences were used to design PCR primers to amply the ORF from the
cDNA library for antigen 2.
[0162] In one exemplary method an empty vector control for animal
models was designed as previously indicated; that is, the pYEX-BX
vector containing the c-myc tag but lacking a C. immitis gene of
interest. Several isolates were grown, cells harvested, plasmid DNA
isolated and the DNA sequence of the c-myc control insert were
determined. The DNA sequence of pertinent portions of the vector
was determined to ensure the correct alignment of the c-myc with
the TATA box.
[0163] Transformation of S. cerevisiae was performed as previously
described. After obtaining at least 10 transformants for each C.
immitis gene of interest, cells are grown and induced the
expression of each gene by adding copper sulfate. Uninduced and
induced cells were harvested by centrifugation, lysed in SDS-gel
lysis buffer and the protein concentration of each extract
determined. Equal protein amounts of each lysate were separated by
SDS-PAGE and the separated proteins transferred to membranes. The
presence of the c-myc tagged proteins was detected by Western blot
analysis using an anti-c-myc antibody. Then the transformants were
grown as previously described. Once transformants of each construct
were isolated, the proteins were expressed via copper induction as
previously discussed. Then cultures were grown overnight at
30.degree. C. with shaking. These cultures were used for the
identification of transformants that were expressing each of the C.
immitis proteins.
[0164] Identification of transformants expressing each C. immitis
protein. Induced and uninduced cultures were harvested after
overnight incubation by centrifugation at 550.times.g for 10
minutes. Each cell pellet was washed with 25 mL ice cold water to
remove any residual medium and the cells were harvested again by
centrifugation. Each pellet was resuspended in 1 mL of ice cold
water and divided into two 1.5 mL eppendorf tubes for
centrifugation. After the removal of the supernatant, one tube was
frozen at -80.degree. C. for storage and the other was lysed for
protein determination. Cells were lysed in the following manner:
100 .mu.L of glass beads were added to the tube containing cells
followed by the addition of 200 .mu.L 2.times. sample lysis buffer
(0.1M Tris, pH 6.8, 20% (v/v) glycerol, 4% (w/v) SDS, 6.2 mg DTT).
Tubes were mixed by vortexing for 1 min and boiled for 3 min to
resuspend and lyse the cells. Debris was removed by centrifugation
and the cleared supernatant was transferred to a new tube. The
cleared lysate was used for western blots.
[0165] Cell lysates were loaded into the wells of SDS page gels and
expression of the C. immits proteins were determined by exemplary
western blot procedures known in the art. Each of three C. immitis
genes from a cDNA library using gene-specific PCR primers was
obtained. The DNA encoding each ORF was sequenced to confirm that
the correct gene had been cloned and that no PCR errors were
introduced. The ORF of each gene was inserted into the copper
inducible vector pYEX-BX. Each ligated vector was sequenced to
ensure the correct position of the gene relative to the TATA box
and that the c-myc tag was in frame with each protein.
Example 3
[0166] In certain exemplary methods, the fungal organism
Cryptococcosis was analyzed (see exemplary schematic FIG. 9)
[0167] Cryptococcosis model. In one exemplary method, an inhalation
model of cryptococcosis was chosen because 1) it most closely
mimics the natural course of C. neoformans infection, 2) it is
highly reproducible and 3) it is commonly used to assess virulence.
The inhalation cryptococcosis model performed was essentially as
previously described (see: Cox, G. M., Mukherjee, J., Cole, G. T.,
et al Urease as a virulence factor in experimental cryptococcosis.
Infect Immun. (2000) 68:443-448. incorporated herein by
reference).
[0168] To test the in vivo efficacy of each vaccine formulation to
protect vaccinated animals against a challenge of C. neoformans,
mice are vaccinated with various vaccine formulations, and
challenged with C. neoformans, and monitored for protection.
[0169] Organism. C. neoformans H 99 was used as the challenge
organism for all infections. C. neoformans H99 yeast for the
inoculum was prepared as follows. Briefly, C. neoformans strain H99
was grown at 30.degree. C. with shaking for two days in liquid YPD
medium. The cells were harvested by centrifugation, washed in
endotoxin-free PBS, and resuspended in endotoxin-free PBS. The
cells were counted on a hemocytometer and diluted to
1.times.10.sup.6 cells per ml. The inoculum was serially diluted
and plated onto YPD to confirm the number of cells that are
inoculated.
[0170] Mice. Four-week-old female A/J Cr mice were obtained from
Charles River Laboratories for the inhalation model of
cryptococcosis. Mice are commonly used for virulence assays with
the serotype A strain, H99, and have been used in previous
assessments of antibody protection against C. neoformans.
[0171] Briefly, mice from a specific pathogen-free colony were
vaccinated with 150 .mu.L of each yeast vaccine preparation on day
21, 14 and 7 before being challenged with 50 uL containing
5.times.10.sup.4H.sub.99C. neoformans cells.
[0172] In one exemplary method, experiments were performed to
determine whether yeast strains expressing C. neoformans proteins
could be used as a vaccine against C. neoformans infections. cDNA
of certain genes whose proteins are likely to be important in
infection were generated. Then yeast cells were transformed with
each cDNA and select strains that express high levels of each
putative antigen. Finally, each vaccine formulation was tested for
its ability to protect vaccinated mice against a challenge of C.
neoformans. FIG. 9 represents a schematic of these experiments.
[0173] DNA vector construction and Yeast Transformation were
performed in this example as previously described. Primers are
listed in Table 4 (SEQ ID NOs: 30-41). Then the cloned genes were
used as template and amplified each gene using the gene-specific
PCR primers. The DNA sequence of each ligated pYEX-BX vector
containing a gene of interest was determined to ensure that the
correct gene was cloned, the start codon was on the same DNA strand
as the TATA box (initiation of transcription), and that the c-myc
tag was in frame with each gene followed by two stop codons (TGA
TAA).
[0174] Cloning of CDA: Published DNA was used and predicted amino
acid sequences to design PCR primers to amplify the ORF from the
clone, as described above. The DNA and amino acid sequences of CDA
are presented in diagram form in SEQ ID NOs: 16-17. The positions
of the 5' and 3' primers use to obtain the predicted PCR product
are shown. A 19 amino acid signal sequence was predicted by PSORTII
(http://psort.nibb.ac.jp/cgi-bin). The signal sequence was
subsequently removed as PSORTII predicted that the protein would be
extra-cellular, which suggested that the protein would be secreted
by the S. cerevisiae if the signal sequence was left intact. A
methionine was added before the 20th amino acid (Serine) to ensure
that the protein would be translated. TABLE-US-00009 SEQ ID NOs: 16
and 17 - DNA and corresponding amino acid sequence CDA atg aag ttc
atc aca agc ctc ttt gcc gtt ctt gcc att ctc tca agt 48 Met Lys Phe
Ile Thr Ser Leu Phe Ala Val Leu Ala Ile Leu Ser Ser
1```````````````5```````````````````10``````````````````15 gtc tct
gct tct cct acc atg aag aaa cgt gcg acc gtc gaa act atc 96 Val Ser
Ala Ser Pro Thr Met Lys Lys Arg Ala Thr Val Glu Thr Ile
````````````20``````````````````25``````````````````30 aac aac tgt
aat cag cag ggc act gtt gct ctg acc ttt gac gat ggc 144 Asn Asn Cys
Asn Gln Gln Gly Thr Val Ala Leu Thr Phe Asp Asp Gly
````````35``````````````````40``````````````````45 cct tac aat tac
gaa gcc caa gtt gct tct gcc ctt gac ggg ggt aag 192 Pro Tyr Asn Tyr
Glu Ala Gln Val Ala Ser Ala Leu Asp Gly Gly Lys
````50``````````````````55``````````````````60 ggt act ttt ttc ctc
aac ggc gcg aat tat gtc tgc atc tac gac aag 240 Gly Thr Phe Phe Leu
Asn Gly Ala Asn Tyr Val Cys Ile Tyr Asp Lys
65``````````````````70``````````````````75``````````````````80 gcc
gat gaa atc aga gct ttg tat gat gcc ggc cac act ctt ggt tct 288 Ala
Asp Glu Ile Arg Ala Leu Tyr Asp Ala Gly His Thr Leu Gly Ser
````````````````85``````````````````90``````````````````95 cac act
tgg tct cac gcc gac ctt acc cag tta gat gaa tcc ggg atc 336 His Thr
Trp Ser His Ala Asp Leu Thr Gln Leu Asp Glu Ser Gly Ile
````````````100`````````````````105`````````````````110 aac gag gaa
ctc tcc aag gtc gaa gat gcc ttt gtc aag atc ctt ggt 384 Asn Glu Glu
Leu Ser Lys Val Glu Asp Ala Phe Val Lys Ile Leu Gly
````````115`````````````````120`````````````````125 gtc aag cct cga
tac ttc cga ccc cct tac ggt aac atc aac gac aac 432 Val Lys Pro Arg
Tyr Phe Arg Pro Pro Tyr Gly Asn Ile Asn Asp Asn
````130`````````````````135`````````````````140 gtc ttg aac gtc ctc
agt gaa agg ggt tac acg aag gtg ttt ttg tgg 480 Val Leu Asn Val Leu
Ser Glu Arg Gly Tyr Thr Lys Val Phe Leu Trp
145`````````````````150`````````````````155`````````````````160 tct
gat gac act ggg gat gcc aac ggc gag tcg gtc agt tac tcc gag 528 Ser
Asp Asp Thr Gly Asp Ala Asn Gly Glu Ser Val Ser Tyr Ser Glu
````````````````165`````````````````170`````````````````175 ggg gta
ttg gac aac gtt atc cag gat tat cct aac cct cat ctt gtc 576 Gly Val
Leu Asp Asn Val Ile Gln Asp Tyr Pro Asn Pro His Leu Val
````````````180`````````````````185`````````````````190 ctt gat cac
tct acc atc gag acg acc tcc tcc gag gtt ctc cct tac 624 Leu Asp His
Ser Thr Ile Glu Thr Thr Ser Ser Glu Val Leu Pro Tyr
````````195`````````````````200`````````````````205 gct gta ccc aag
ctc cag agt gct ggc tac caa ctg gtc act gtc ggt 672 Ala Val Pro Lys
Leu Gln Ser Ala Gly Tyr Gln Leu Val Thr Val Gly
````210`````````````````215`````````````````220 gaa tgt ctc ggc acc
gac gaa tct cct tac gaa tgg gtt gat tgc cct 720 Glu Cys Leu Gly Thr
Asp Glu Ser Pro Tyr Glu Trp Val Asp Cys Pro
225`````````````````230`````````````````235`````````````````240 gga
gag agg gat agc tct tgg caa tgc 747 Gly Glu Arg Asp Ser Ser Trp Gln
Cys ````````````````245
[0175] The following conditions were used to amplify CDA from the
plasmid: 25 .mu.L reactions were performed in PCR Ready Bead tubes
(Amersham Pharmacia) containing 500 ng of the plasmid containing
CDA, 2 .mu.M primers, and 13 .mu.L sterile water. Reactions were
performed using the Perkin Elmer 2400 Thermocycler (PE Applied
Biosystems) under the following conditions: an initial cycle at
94.degree. C. for 5 min, 30 cycles at 94.degree. C. for 1 min,
50.degree. C. for 1 min and 72.degree. C. for 1 min, and a final
extension at 72.degree. C. for 7 min.
[0176] The PCR reactions were separated using agarose gel
electrophoresis and a band of approximately 744 bases corresponding
to the amplified CDA ORF containing a 3' c-myc tag was excised. The
band was purified and ligated into pCR 2.1. The ligated vector was
used to transform competent E. coli cells and vector DNA isolated
from 5 mL mini cultures using standard alkaline lysis techniques.
DNA isolated from several miniprep isolates was digested with EcoRI
to confirm the presence of the 744 base CDA/c-myc insert.
[0177] In one exemplary method, the DNA of the isolate was excised
from the pCR 2.1 vector and ligated into the pYEX-BX vector as
previously described and the salient portions of the vector was
determined to ensure the correct alignment of the ORF with the TATA
box
[0178] One exemplary method concerns cloning of Laccase: As
indicated above, the same strategy to clone Laccase (lac) from a
plasmid containing the gene as used to clone CDA. DNA sequence and
plasmid DNA was used to predicted the amino acid sequences to
design PCR primers to amplify the ORF plus the c-myc tag from the
plasmid. The DNA and amino acid sequences are presented in diagram
form in SEQ ID NOs:18 and 19. The positions of the 5' and 3'
primers used to obtain the predicted PCR product are shown. A 20
amino acid signal sequence was predicted by PSORTII
(http://psort.nibb.ac.jp/cgi-bin). The signal sequence was
subsequently removed as PSORTII predicted that the protein would be
extracellular, which suggested that the protein would be secreted
by the S. cerevisiae if the signal sequence was left intact. An
endogenous methionine at amino acid 21 (Glutamic acid) was used as
the first amino acid in the new protein to ensure that the protein
would be translated. TABLE-US-00010 atg cgg gga gta gtc aag ctc ttc
ttt cta tct tgt tcc ctc gtt tcg 48 Met Arg Gly Val Val Lys Leu Phe
Phe Leu Ser Cys Ser Leu Val Ser
1```````````````5```````````````````10``````````````````15 ctg gtc
agc agc gag gag act ggc aag tcg cca acc gcg aac tat gac 96 Leu Val
Ser Ser Glu Glu Thr Gly Lys Ser Pro Thr Ala Asn Tyr Asp
````````````20``````````````````25``````````````````30 cat tat atg
ccg aag gcg aca gca acc att gat cct agt gta ttc gct 144 His Tyr Met
Pro Lys Ala Thr Ala Thr Ile Asp Pro Ser Val Phe Ala
````````35``````````````````40``````````````````45 ctt tca aat gac
ttt gaa ata aca gat gtt ccg acg acg agg gag tat 192 Leu Ser Asn Asp
Phe Glu Ile Thr Asp Val Pro Thr Thr Arg Glu Tyr
````50``````````````````55``````````````````60 acc ttc gat atc acc
aaa gcg ttg gcc agc cct gat ggt tat gaa cga 240 Thr Phe Asp Ile Thr
Lys Ala Leu Ala Ser Pro Asp Gly Tyr Glu Arg
65``````````````````70``````````````````75``````````````````80 gag
gtt tac gtt gtc aac aac atg ttc cct gga cct gtg ata gag gct 288 Glu
Val Tyr Val Val Asn Asn Met Phe Pro Gly Pro Val Ile Glu Ala
````````````````85``````````````````90``````````````````95 aac acc
ggg gat act att atc gta cat gtc aac aat cat ttg gag gaa 336 Asn Thr
Gly Asp Thr Ile Ile Val His Val Asn Asn His Leu Glu Glu
````````````100`````````````````105`````````````````110 gga caa agt
atc cac tgg cat ggt ttg cgg cag ctt ggc acg gct ttc 384 Gly Gln Ser
Ile His Trp His Gly Leu Arg Gln Leu Gly Thr Ala Phe
````````115`````````````````120`````````````````125 atg gac ggt gtc
cct ggt ata aca cag tgt cct att ccc cct gga agc 432 Met Asp Gly Val
Pro Gly Ile Thr Gln Cys Pro Ile Pro Pro Gly Ser
````130`````````````````135`````````````````140 tca ttt acc tac caa
ttc acc gta agc cat cag tca ggc acg ttt tgg 480 Ser Phe Thr Tyr Gln
Phe Thr Val Ser His Gln Ser Gly Thr Phe Trp
145`````````````````150`````````````````155`````````````````160 tgg
cat tcc cat tat tcc aat tcc atg gcc gac ggc att tgg ggc ccc 528 Trp
His Ser His Tyr Ser Asn Ser Met Ala Asp Gly Ile Trp Gly Pro
````````````````165`````````````````170`````````````````175 tta att
atc cat tcg ccc aat gaa ccc ctc caa agg gga cga gac tat 576 Leu Ile
Ile His Ser Pro Asn Glu Pro Leu Gln Arg Gly Arg Asp Tyr
````````````180`````````````````185`````````````````190 gac gag gat
cga atc gtt ttt ata act gac tgg gtg cat gac aac tca 624 Asp Glu Asp
Arg Ile Val Phe Ile Thr Asp Trp Val His Asp Asn Ser
````````195`````````````````200`````````````````205 gaa gtc gtt att
gca gct cta gct act cca gaa ggg tac aaa gga agc 672 Glu Val Val Ile
Ala Ala Leu Ala Thr Pro Glu Gly Tyr Lys Gly Ser
````210`````````````````215`````````````````220 cct gct ccg cca caa
ggt gat gcg att ctc atc aat gga cgt ggc caa 720 Pro Ala Pro Pro Gln
Gly Asp Ala Ile Leu Ile Asn Gly Arg Gly Gln
225`````````````````230`````````````````235`````````````````240 acc
aac tgc aca gcc act ggt tcc tcc tca tgc acc tat ccg cct cct 768 Thr
Asn Cys Thr Ala Thr Gly Ser Ser Ser Cys Thr Tyr Pro Pro Pro
````````````````245`````````````````250`````````````````255 ccc gag
att cac gtg cca gtc aat tgc agg gtt cgt ctg cgc ttt atc 816 Pro Glu
Ile His Val Pro Val Asn Cys Arg Val Arg Leu Arg Phe Ile
````````````260`````````````````265`````````````````270 agt gcg acc
gcc cat ccc atg tac cgc ata act atc gac aac cac cct 864 Ser Ala Thr
Ala His Pro Met Tyr Arg Ile Thr Ile Asp Asn His Pro
````````275`````````````````280`````````````````285 ttg gaa gtt gtg
gaa acc gac ggt aca gcc gtc tat ggg ccc aca gtc 912 Leu Glu Val Val
Glu Thr Asp Gly Thr Ala Val Tyr Gly Pro Thr Val
````290`````````````````295`````````````````300 cat gaa atc tcc att
gca cct ggg gaa cgg tac tct gca att atc aac 960 His Glu Ile Ser Ile
Ala Pro Gly Glu Arg Tyr Ser Ala Ile Ile Asn
305`````````````````310`````````````````315`````````````````320 acc
tca gaa ggg aag gaa ggt gat gcg ttc tgg ctg agg aca agt gtt 1008
Thr Ser Glu Gly Lys Glu Gly Asp Ala Phe Trp Leu Arg Thr Ser Val
````````````````325`````````````````330`````````````````335 gct ctg
ggc tgt atg ttt ggt gga ata gat cag gtg gga ttg gcg gtt 1056 Ala
Leu Gly Cys Met Phe Gly Gly Ile Asp Gln Val Gly Leu Ala Val
````````````340`````````````````345`````````````````350 gtg agg tat
acg ggt aat gga atg gtt agt act gaa gag cct caa act 1104 Val Arg
Tyr Thr Gly Asn Gly Met Val Ser Thr Glu Glu Pro Gln Thr
````````355`````````````````360`````````````````365 act gct tgg agt
gat cta gcg gga gct aca act cct tgt gct gga ctg 1152 Thr Ala Trp
Ser Asp Leu Ala Gly Ala Thr Thr Pro Cys Ala Gly Leu
````370`````````````````375`````````````````380 gac caa aca tat act
ctt tca cca cga gag agt ttt agt gca cct cgt 1200 Asp Gln Thr Tyr
Thr Leu Ser Pro Arg Glu Ser Phe Ser Ala Pro Arg
385`````````````````390`````````````````395`````````````````400 gaa
ttt tca caa agc cat gtc ttc aat agc cag cga gga gcc ttt gtg 1248
Glu Phe Ser Gln Ser His Val Phe Asn Ser Gln Arg Gly Ala Phe Val
````````````````405`````````````````410`````````````````415 aat gtt
tat ggc aac acc ttc caa ggt tat ggg ttt aac aat atc tca 1296 Asn
Val Tyr Gly Asn Thr Phe Gln Gly Tyr Gly Phe Asn Asn Ile Ser
````````````420`````````````````425`````````````````430 tat cag aac
caa atc ttc aac cct cta ctt tca atc gtc caa cgc ggt 1344 Tyr Gln
Asn Gln Ile Phe Asn Pro Leu Leu Ser Ile Val Gln Arg Gly
````````435`````````````````440`````````````````445 ggc tct tgc gag
agc aca cta gta gcc agt aca act ttc ccc gac ctc 1392 Gly Ser Cys
Glu Ser Thr Leu Val Ala Ser Thr Thr Phe Pro Asp Leu
````450`````````````````455`````````````````460 gga tca ggg aac att
atc atc aac aat ctt gat ggc gtt atc gac cat 1440 Gly Ser Gly Asn
Ile Ile Ile Asn Asn Leu Asp Gly Val Ile Asp His
465`````````````````470`````````````````475`````````````````480 cct
tac cac ctg cac ggc aac gag ttc cag gtg ata gga cga gga act 1488
Pro Tyr His Leu His Gly Asn Glu Phe Gln Val Ile Gly Arg Gly Thr
````````````````485`````````````````490`````````````````495 gga gct
ctc agc ctt gat aac ctg aca aat att gac ttc aat ttg gac 1536 Gly
Ala Leu Ser Leu Asp Asn Leu Thr Asn Ile Asp Phe Asn Leu Asp
````````````500`````````````````505`````````````````510 aac cct gtg
aga aag gat acc ctc tgg ata cag ggc gga agt tgg gtg 1584 Asn Pro
Val Arg Lys Asp Thr Leu Trp Ile Gln Gly Gly Ser Trp Val
````````515`````````````````520`````````````````525 gta ctg agg atc
acg acg gat aac cct gga gtt tgg gcc ttg cac tgt 1632 Val Leu Arg
Ile Thr Thr Asp Asn Pro Gly Val Trp Ala Leu His Cys
````530`````````````````535`````````````````540 cat att ggg tgg cat
ctt act gag gga aag ttg gct gtg gtt gtc att 1680 His Ile Gly Trp
His Leu Thr Glu Gly Lys Leu Ala Val Val Val Ile
545`````````````````550`````````````````555`````````````````560 caa
cca ggt gcg att gga cat atg gag ggc ccc gag tct tgg acg aat 1728
Gln Pro Gly Ala Ile Gly His Met Glu Gly Pro Glu Ser Trp Thr Asn
````````````````565`````````````````570`````````````````575 ctc tgt
gct aac act gat ccc aat gca ttt gga ccc gca cga cgc tca 1776 Leu
Cys Ala Asn Thr Asp Pro Asn Ala Phe Gly Pro Ala Arg Arg Ser
````````````580`````````````````585`````````````````590 cct tct cca
tct att caa tcc tct aag aca tcc act ttc cag tat ctg 1824 Pro Ser
Pro Ser Ile Gln Ser Ser Lys Thr Ser Thr Phe Gln Tyr Leu
````````595`````````````````600`````````````````605 cgc gaa gtg aaa
ggg aag gtc gtt aaa cgt aga ggt gct cga gag gcg 1872 Arg Glu Val
Lys Gly Lys Val Val Lys Arg Arg Gly Ala Arg Glu Ala
````610`````````````````615`````````````````620
[0179] The following conditions were used to amplify laccase from
the plasmid: 25 .mu.L reactions were performed in PCR Ready Bead
tubes containing 500 ng of plasmid containing Laccase, 2 .mu.M
primers, and 13 .mu.L sterile water. Reactions were performed using
a Perkin Elmer 2400 Thermocycler under the following conditions: an
initial cycle at 94o C for 5 min, 30 cycles at 94o C for 1 min, 50o
C for 1 min, 72o C for 1 min, and a final extension at 72o C for 7
min.
[0180] The PCR reactions were separated, isolated and digested with
EcoRI as previously described to confirm the presence of the 1857
base Lac/c-myc insert.
[0181] Several isolates were grown, cells harvested, plasmid DNA
isolated and the DNA sequence of the Lac insert determined. The DNA
of the isolate was excised from the pCR 2.1 vector and the DNA band
encoding the Laccase ORF could be isolated, data not shown. This
DNA fragment was then ligated into the pYEX-BX vector as described
and then used to transform competent E. coli and the plasmid DNA
isolated by standard alkaline lysis mini-preps. The DNA sequence of
salient portions of the vector was determined to ensure the correct
alignment of the ORF with the TATA box.
[0182] An empty vector control was made and used as previously
described in methods.
[0183] Transformation of S. cerevisiae was made and used as
previously described in methods.
[0184] Identification of yeast transformants expression each C.
neoformans protein. After obtaining transformed S. cerevisiae cells
that contained each gene of interest 5 transformants were screened
for each gene of interest were screened to determine the expression
of each gene and the transformants were isolated as previously
described. Once transformants containing each construct were
isolated, each of the proteins was expressed as described
previously. Then transformants expressing each C. neoformans
protein were identified by one exemplary method previously
disclosed.
[0185] Expression of C. neoformans proteins were determined by an
exemplary western blot technique known in the art. Ten CDA
transformants were screened to obtain a transformant that was
positive for induction via copper. Transformant 10 was chosen for
vaccine production as it had the most protein as determined by
counting pixels. Five Lac transformants were screened to obtain a
transformant that was positive for induction via copper. Please
note that the top band is of the correct size. Transformant number
2 had the least amount of protein in the un-induced sample and the
most (by counting pixels) in the copper induced sample
[0186] Growth of transformants: Transformants that were determined
to produce a protein of the correct molecular weight were grown in
YNB minus uracil for 2-3 days at 30.degree. C. with shaking. Once
the cultures were in stationary phase, the cells were counted and
frozen in 50% glycerol at a final concentration of 1.times.108 c/mL
(10 yeast units) and stored at -80.degree. C. until use.
[0187] Yeast cells containing and expressing chitin deacetylase or
laccase were harvested and lysed as described. The indicated number
of microliters of each extract were separated by SDS-PAGE, transfer
to membranes and the position of each protein detected by Western
blot analysis as described. The results of the western blot are
shown in FIG. 10. Lane 1-4 are various amounts in microliters of
lysed yeast cells expressing hitin deacetylase (cda; MW.26.6 kDa),
while lanes 6-9 are various amounts in microliters of lysed yeast
cells expressing laccase (lac; MW. 67.4 kDa).
[0188] FIG. 11 represents exemplary linear survival plots in an
animal model after exposure to a challenge fungal organism. Mice
were vaccinated with yeast cells containing and expressing the DNA
encoding laccase, (lac), chitin deacetylase (cda), the MYC yeast
control, PBS, trr and plb (two additional C. neoformans proteins)
as described above on days 21, 14 and 7 prior to challenge by C.
neoformans H99 cells. Mice were weighed daily and mice that had
lost >15% of their body weight euthanized. Note that mice
vaccinated with lac-containing yeast were 100% protected
(p<<0.05) while those vaccinated with cda containing yeast
were 80% protected (p<0.05) as were those vaccinated with MYC
(empty vector control). These results demonstrate that mice
vaccinated with yeast expressing either laccase or chitin
deacetylase were highly protected against a challenge of C.
neoformans. TABLE-US-00011 TABLE 1 Candidate antigens Number of
Base pairs Protein amino acids of the ORF Accession numbers fos-1
708 2,124 Protein: AAK27436 DNA: AF257496 hemolysin 131 721
Protein: BAA03951.1 DNA: D16501 catalase 728 2,184 Protein:
AAB71223 DNA: U97574 abr-1 664 1,992 Protein: AAF03353 DNA:
AF116901 rod A 159 477 Protein: AAB60172.1 DNA: U06121 dpp-5 721
2,163 Protein: AAB67282 DNA: L48074 dpp-4 765 2,295 Protein:
AAC34310 DNA: U87950
[0189] TABLE-US-00012 TABLE 2 Cryptococcus antigens Number of Base
pairs Protein amino acids of the ORF Accession numbers CDA--Chitan
250 750 Protein: CAD10036 deacetylase DNA: AJ414580
CnFOS--histidine 1367 4101 Protein: AAW42353 kinase DNA: NA*
Lac--Laccase 625 1875 Protein: NA* DNA: L22866 Plb--phospholipse
638 1914 Protein: AAF65220.1 B DNA: AF223383 Ure--Urease 833 2499
Protein: AAC62257.1 DNA: AF006062 *NA--not available
[0190] TABLE-US-00013 TABLE 3 PCR primers PCR primers 5' AspF2/Bam
5'GGA TCC ATG CTT GTG GCC ACC CTC CCT 3' (SEQ ID NO:20) 3'
AspF2/myc 5'GAA TTC TTA TCA CTC GAG GTC TTC TTC GGA AAT CAA CTT AGT
GCA ATG AAG CTG TCC ACC TTC ATG GGT ATG GC 3' (SEQ ID NO:21)
5'DppV/Bam 5'GGA TTC ATG CTT ACA CCT GAG CAG CTA ATC ACT GCT CCA
CGG 3' (SEQ ID NO:22) 3'DppV/myc 5'GGA TTC TTA TCA CTC GAG GTC TTC
TTC GGA AAT CAA CTT CTG TTC CGG GAC AAC GGT GTC CTC CAG GCT GAC GGC
GTT GGG G 3' (SEQ ID NO:23) 5'Fos-1/SalI 5'GTC GAC ATG GCC CTC GAC
AAG GAG C 3' (SEQ ID NO:24) 3'Fos-1/myc 5'CTG CAG TTA TCA CTC GAG
GTC TTC TTC GGA AAT CAA CTT CTG TTC CAT CTT GGA TGA TTC CTC AAA AGC
TGC CAC CAT CCG CGC TTC AGC CGC 3' (SEQ ID NO:25) 5'Hemo/Bam 5'GGA
TTC ATG GCA TCG GTC CAA GCT TAC GCA CAG TGG 3' (SEQ ID NO:26)
3'Hemo/myc 5'GAA TTC TTA TCA CTC GAG GTC TTC TTC GGA AAT CAA CTT
CTG TTC ACA GTT GCC AAT GGC ACC ACC ATA CTT GTT CCA CGT TCC AAT TTC
GAC CCA G 3' (SEQ ID NO:27) 5'RodA/SalI 5'GTC GAC ATG AAG TTC TCT
TTG AGC GCT GCT GTC CTC GC 3' (SEQ ID NO:28) 3'RodA/myc 5'GAA TTC
TTA TCA CTC GAG GTC TTC TTC GGA AAT CAA CTT CTG TTC CAG GAT AGA ACC
AAG GGC AAT GCA AGG AAG ACC CAG TCC AAT GAG GG 3' (SEQ ID
NO:29)
[0191] TABLE-US-00014 TABLE 4 PCR primers PCR primers 5' CDA/Bam
GGA TCC ATG TCT CCT ACC ATG AAG AAA CGT GCG (SEQ ID NO:30) 3'
CDA/myc GAA TTC TTA TCA CTC GAG GTC TTC TTC GGA AAT CAA CTT CTG TTC
GCA TTG CCA AGA GCT ATG CCT CTC TCC AGG GCA ATC AAC CCA TTC G (SEQ
ID NO:31) 5' CnFos/Sal GTC GAC ATG TCC CTC CCC GAT GCC TAC CCT CCG
GTC ATA GCC ACC (SEQ ID NO:32) 3' CnFos/myc GAA TTC TTA TCA CTC GAG
GTC TTC TTC GGA AAT CAA CTT CTG TTC ACT TCT GTT GGC CAT TTC AGC TTC
CTG TCT CGC C (SEQ ID NO:33) 5' Lac/Bam GGA TCC ATG GAG GAG ACT GGC
AAG TCG CCA ACC GCG (SEQ ID NO:34) 3' Lac/myc GAA TTC TTA TCA CTC
GAG GTC TTC TTC GGA AAT CAA CTT CTG TTC CGC CTC TCG AGC ACC TCT ACG
TTT AAC GAC CTT CCC TTT CAC TTC GCG CAG (SEQ ID NO:35) 5' Plb/Bam
GGA TCC ATG GCT GTT CCT CCC GAG ACT CCG CGG (SEQ ID NO:36) 3'
Plb/myc GAA TTC TTA TCA CTC GAG GTC TTC TTC GGA AAT CAA CTT CTG TTC
AGT GAG AGA GCG CAT ACC ATT GAG CAA CAT TTC GTT GGC (SEQ ID NO:37)
5' TRR/Bam GGA TCC ATG CAC TCC AAG GTT GTT ATC ATC GGC TCT GG (SEQ
ID NO:38) 3' TRR/myc GAA TTC TTA TCA CTC GAG GTC TTC TTC GGA AAT
CAA CTT CTG TTC CTC CTT GTC AGT GCC GAA GTA GTG CTC GGC AGG GAC ATG
CAC ATC TTC GGT CTG G (SEQ ID NO:39) 5' URE/Bam GGA TCC ATG CAT CTC
CTC CCG AGA GAA ACG (SEQ ID NO:40) 3' URE/myc GTC GAC TTA TCA CTC
GAG GTC TTC TTC GGA AAT CAA CTT CTG TTC GTA AAC GAA GTA TCT CCT GGT
CAA TGG GAG TTT GTC CGC GGG TGG GAC (SEQ ID NO:41)
[0192] All of the COMPOSITIONS and METHODS disclosed and claimed
herein may be made and executed without undue experimentation in
light of the present disclosure. While the COMPOSITIONS and METHODS
have been described in terms of preferred embodiments, it will be
apparent to those of skill in the art that variation may be applied
to the COMPOSITIONS and METHODS and in the steps or in the sequence
of steps of the METHODS described herein without departing from the
concept, spirit and scope of the invention. More specifically, it
will be apparent that certain agents which are both chemically and
physiologically related may be substituted for the agents described
herein while the same or similar results would be achieved. All
such similar substitutes and modifications apparent to those
skilled in the art are deemed to be within the spirit, scope and
concept of the invention as defined by the appended claims.
Sequence CWU 0
0
SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 41 <210>
SEQ ID NO 1 <211> LENGTH: 36 <212> TYPE: DNA
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: empty vector control sequence <220>
FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(36)
<400> SEQUENCE: 1 atg gaa cag aag ttg att tcc gaa gaa gac ctc
gag 36 Met Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Glu 1 5 10
<210> SEQ ID NO 2 <211> LENGTH: 12 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Construct <400>
SEQUENCE: 2 Met Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Glu 1 5 10
<210> SEQ ID NO 3 <211> LENGTH: 885 <212> TYPE:
DNA <213> ORGANISM: Aspergillus fumigatus (2) <220>
FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(885)
<400> SEQUENCE: 3 atg ctt gtg gcc acc ctc cct acc tcc ccc gtc
ccc atc gcg gcg cga 48 Met Leu Val Ala Thr Leu Pro Thr Ser Pro Val
Pro Ile Ala Ala Arg 1 5 10 15 gca acc ccc cac gaa ccc gtc ttc ttc
tcc tgg gac gct ggc gcg gtg 96 Ala Thr Pro His Glu Pro Val Phe Phe
Ser Trp Asp Ala Gly Ala Val 20 25 30 acc tcg ttc ccc atc cac tcc
agc tgc aat gcg acc cag cgc cgg cag 144 Thr Ser Phe Pro Ile His Ser
Ser Cys Asn Ala Thr Gln Arg Arg Gln 35 40 45 atc gag gcc ggc ctg
aac gag gcg gtc gag ctc gcc cgg cac gcc aag 192 Ile Glu Ala Gly Leu
Asn Glu Ala Val Glu Leu Ala Arg His Ala Lys 50 55 60 gcc cac atc
ctc cgc tgg ggc aac gag agc gag atc tac cgg aag tac 240 Ala His Ile
Leu Arg Trp Gly Asn Glu Ser Glu Ile Tyr Arg Lys Tyr 65 70 75 80 ttt
ggc aac cgg ccc acc atg gag gcc gtc ggt gcc tac gat gtc atc 288 Phe
Gly Asn Arg Pro Thr Met Glu Ala Val Gly Ala Tyr Asp Val Ile 85 90
95 gtg aac ggg gac aag gcc aac gtg ctc ttc cgg tgt gac aac ccc gac
336 Val Asn Gly Asp Lys Ala Asn Val Leu Phe Arg Cys Asp Asn Pro Asp
100 105 110 ggc aac tgt gct ttg gaa ggc tgg ggc ggc cac tgg cgc ggc
gcg aac 384 Gly Asn Cys Ala Leu Glu Gly Trp Gly Gly His Trp Arg Gly
Ala Asn 115 120 125 gcc acc tcc gaa acc gtc atc tgt gat cgc agc tac
acc acc cgc cgc 432 Ala Thr Ser Glu Thr Val Ile Cys Asp Arg Ser Tyr
Thr Thr Arg Arg 130 135 140 tgg ctt gtc tcc atg tgc tcc cag ggc tac
acc gtc gcc ggc tcc gag 480 Trp Leu Val Ser Met Cys Ser Gln Gly Tyr
Thr Val Ala Gly Ser Glu 145 150 155 160 acc aac acc ttc tgg gct tcg
gac ctg atg cac cgt ctg tac cat gtg 528 Thr Asn Thr Phe Trp Ala Ser
Asp Leu Met His Arg Leu Tyr His Val 165 170 175 cct gct gtg ggt caa
ggc cgg gtc gac cac ttc gcc gac ggc tac gac 576 Pro Ala Val Gly Gln
Gly Arg Val Asp His Phe Ala Asp Gly Tyr Asp 180 185 190 gag gtg att
gcc ctg gcc aag agc aac ggc acc gag tcc acg cat gac 624 Glu Val Ile
Ala Leu Ala Lys Ser Asn Gly Thr Glu Ser Thr His Asp 195 200 205 tcg
gag gcg ttg cag tat ttc gcc ctt gag gcg tat gcg ttt gat att 672 Ser
Glu Ala Leu Gln Tyr Phe Ala Leu Glu Ala Tyr Ala Phe Asp Ile 210 215
220 gcc gct ccc ggt gtc gga tgt gct ggc gag agt cac ggc cct gac cag
720 Ala Ala Pro Gly Val Gly Cys Ala Gly Glu Ser His Gly Pro Asp Gln
225 230 235 240 gga cat gac acc ggg tct gcc tcg gcg cct gcg tct acc
tcc acc tct 768 Gly His Asp Thr Gly Ser Ala Ser Ala Pro Ala Ser Thr
Ser Thr Ser 245 250 255 agc tcc agc tcg ggc tcg ggc tcg ggc gcc acg
act acc ccg acg gat 816 Ser Ser Ser Ser Gly Ser Gly Ser Gly Ala Thr
Thr Thr Pro Thr Asp 260 265 270 tct ccc agt gcc act att gat gtg ccg
tcg aac tgc cat acc cat gaa 864 Ser Pro Ser Ala Thr Ile Asp Val Pro
Ser Asn Cys His Thr His Glu 275 280 285 ggt gga cag ctt cat tgc act
885 Gly Gly Gln Leu His Cys Thr 290 295 <210> SEQ ID NO 4
<211> LENGTH: 295 <212> TYPE: PRT <213> ORGANISM:
Aspergillus fumigatus (2) <400> SEQUENCE: 4 Met Leu Val Ala
Thr Leu Pro Thr Ser Pro Val Pro Ile Ala Ala Arg 1 5 10 15 Ala Thr
Pro His Glu Pro Val Phe Phe Ser Trp Asp Ala Gly Ala Val 20 25 30
Thr Ser Phe Pro Ile His Ser Ser Cys Asn Ala Thr Gln Arg Arg Gln 35
40 45 Ile Glu Ala Gly Leu Asn Glu Ala Val Glu Leu Ala Arg His Ala
Lys 50 55 60 Ala His Ile Leu Arg Trp Gly Asn Glu Ser Glu Ile Tyr
Arg Lys Tyr 65 70 75 80 Phe Gly Asn Arg Pro Thr Met Glu Ala Val Gly
Ala Tyr Asp Val Ile 85 90 95 Val Asn Gly Asp Lys Ala Asn Val Leu
Phe Arg Cys Asp Asn Pro Asp 100 105 110 Gly Asn Cys Ala Leu Glu Gly
Trp Gly Gly His Trp Arg Gly Ala Asn 115 120 125 Ala Thr Ser Glu Thr
Val Ile Cys Asp Arg Ser Tyr Thr Thr Arg Arg 130 135 140 Trp Leu Val
Ser Met Cys Ser Gln Gly Tyr Thr Val Ala Gly Ser Glu 145 150 155 160
Thr Asn Thr Phe Trp Ala Ser Asp Leu Met His Arg Leu Tyr His Val 165
170 175 Pro Ala Val Gly Gln Gly Arg Val Asp His Phe Ala Asp Gly Tyr
Asp 180 185 190 Glu Val Ile Ala Leu Ala Lys Ser Asn Gly Thr Glu Ser
Thr His Asp 195 200 205 Ser Glu Ala Leu Gln Tyr Phe Ala Leu Glu Ala
Tyr Ala Phe Asp Ile 210 215 220 Ala Ala Pro Gly Val Gly Cys Ala Gly
Glu Ser His Gly Pro Asp Gln 225 230 235 240 Gly His Asp Thr Gly Ser
Ala Ser Ala Pro Ala Ser Thr Ser Thr Ser 245 250 255 Ser Ser Ser Ser
Gly Ser Gly Ser Gly Ala Thr Thr Thr Pro Thr Asp 260 265 270 Ser Pro
Ser Ala Thr Ile Asp Val Pro Ser Asn Cys His Thr His Glu 275 280 285
Gly Gly Gln Leu His Cys Thr 290 295 <210> SEQ ID NO 5
<211> LENGTH: 438 <212> TYPE: DNA <213> ORGANISM:
Aspergillus fumigatus (control) <400> SEQUENCE: 5 accaacacct
tctgggcttc ggacctgatg caccgtctgt accatgtgcc tgctgtgggt 60
caaggccggg tcgaccactt cgccgacggc tacgacgagg tgattgccct ggccaagagc
120 aacggcaccg agtccacgca tgactcggag gcgttgcagt atttcgccct
tgaggcgtat 180 gcgtttgata ttgccgctcc cggtgtcgga tgtgctggcg
agagtcacgg ccctgaccag 240 ggacatgaca ccgggtctgc ctcggcgcct
gcgtctacct ccacctctag ctccagctcg 300 ggctcgggct cgggcgccac
gactaccccg acggattctc ccagtgccac tattgatgtg 360 ccgtcgaact
gccataccca tgaaggtgga cagcttcatt gcactgaaca gaagttgatt 420
tccgaagaag acctcgag 438 <210> SEQ ID NO 6 <211> LENGTH:
438 <212> TYPE: DNA <213> ORGANISM: Aspergillus
fumigatus (experimental) <400> SEQUENCE: 6 accaacacct
tctgggcttc ggacctgatg caccgtctgt accatgtgcc tgctgtgggt 60
caaggccggg tcgaccactt cgccgacggc tacgacgagg tgattgccct ggccaagagc
120 aacggcaccg agtccacgca tgactcggag gcgttgcagt atttcgccct
tgaggcgtat 180 gcgtttgata ttgccgctcc cggtgtcgga tgtgctggcg
agagtcacgg ccctgaccag 240 ggacatgaca ccgggtctgc ctcggcgcct
gcgtctacct ccacctctag ctccagctcg 300 ggctcgggct cgggcgccac
gactaccccg acggattctc ccagtgccac tattgatgtg 360 ccgtcgaact
gccataccca tgaaggtgga cagcttcatt gcactgaaca gaagttgatt 420
tccgaagaag acctcgag 438 <210> SEQ ID NO 7 <211> LENGTH:
393 <212> TYPE: DNA <213> ORGANISM: Aspergillus
fumigatus (hemolysin) <220> FEATURE: <221> NAME/KEY:
CDS <222> LOCATION: (1)..(393) <400> SEQUENCE: 7 atg
gca tcg gtc caa gct tac gca cag tgg gtt acg gtt cat ctc atc 48 Met
Ala Ser Val Gln Ala Tyr Ala Gln Trp Val Thr Val His Leu Ile
1 5 10 15 aat agc atg tct tcc gag acc ttg agt atc aag aat gct agt
ctc tcc 96 Asn Ser Met Ser Ser Glu Thr Leu Ser Ile Lys Asn Ala Ser
Leu Ser 20 25 30 tgg ggc aag tgg tac aag gac ggt gac aag gac gcc
gaa atc aca agt 144 Trp Gly Lys Trp Tyr Lys Asp Gly Asp Lys Asp Ala
Glu Ile Thr Ser 35 40 45 gaa gat gtc cag caa aag acg gca ccc cca
ggc ggt tcc gtg aac gtc 192 Glu Asp Val Gln Gln Lys Thr Ala Pro Pro
Gly Gly Ser Val Asn Val 50 55 60 aac tct tgc ggt cgc agc gac gct
tcg agt gga acg acg gga ggt ttt 240 Asn Ser Cys Gly Arg Ser Asp Ala
Ser Ser Gly Thr Thr Gly Gly Phe 65 70 75 80 gat ttg tat gac ggc aat
acc aag att gga aga gtc cac tgg gac tgt 288 Asp Leu Tyr Asp Gly Asn
Thr Lys Ile Gly Arg Val His Trp Asp Cys 85 90 95 cca tgg ggt tct
aaa acc aac gat ttc gat gtt gga gag aga aac aaa 336 Pro Trp Gly Ser
Lys Thr Asn Asp Phe Asp Val Gly Glu Arg Asn Lys 100 105 110 aat tac
tgg gtc gaa att gga acg tgg aac aag tat ggt ggt gcc att 384 Asn Tyr
Trp Val Glu Ile Gly Thr Trp Asn Lys Tyr Gly Gly Ala Ile 115 120 125
ggc aac tgt 393 Gly Asn Cys 130 <210> SEQ ID NO 8 <211>
LENGTH: 131 <212> TYPE: PRT <213> ORGANISM: Aspergillus
fumigatus (hemolysin) <400> SEQUENCE: 8 Met Ala Ser Val Gln
Ala Tyr Ala Gln Trp Val Thr Val His Leu Ile 1 5 10 15 Asn Ser Met
Ser Ser Glu Thr Leu Ser Ile Lys Asn Ala Ser Leu Ser 20 25 30 Trp
Gly Lys Trp Tyr Lys Asp Gly Asp Lys Asp Ala Glu Ile Thr Ser 35 40
45 Glu Asp Val Gln Gln Lys Thr Ala Pro Pro Gly Gly Ser Val Asn Val
50 55 60 Asn Ser Cys Gly Arg Ser Asp Ala Ser Ser Gly Thr Thr Gly
Gly Phe 65 70 75 80 Asp Leu Tyr Asp Gly Asn Thr Lys Ile Gly Arg Val
His Trp Asp Cys 85 90 95 Pro Trp Gly Ser Lys Thr Asn Asp Phe Asp
Val Gly Glu Arg Asn Lys 100 105 110 Asn Tyr Trp Val Glu Ile Gly Thr
Trp Asn Lys Tyr Gly Gly Ala Ile 115 120 125 Gly Asn Cys 130
<210> SEQ ID NO 9 <211> LENGTH: 426 <212> TYPE:
DNA <213> ORGANISM: Aspergillus (hemolysin / control)
<400> SEQUENCE: 9 atggcatcgg tccaagctta cgcacagtgg gttacggttc
atctcatcaa tagcatgtct 60 tccgagacct tgagtatcaa gaatgctagt
ctctcctggg gcaagtggta caaggacggt 120 gacaaggacg ccgaaatcac
aagtgaagat gtccagcaaa agacggcacc cccaggcggt 180 tccgtgaacg
tcaactcttg cggtcgcagc gacgcttcga gtggaacgac gggaggtttt 240
gatttgtatg acggcaatac caagattgga agagtccact gggactgtcc atggggttct
300 aaaaccaacg atttcgatgt tggagagaga aacaaaaatt actgggtcga
aattggaacg 360 tggaacaagt atggtggtgc cattggcaac tgtgaacaga
agttgatttc cgaagaagac 420 ctcgag 426 <210> SEQ ID NO 10
<211> LENGTH: 426 <212> TYPE: DNA <213> ORGANISM:
Aspergillus (hemolysin / experimental) <400> SEQUENCE: 10
atggcatcgg tccaagctta cgcacagtgg gttacggttc atctcatcaa tagcatgtct
60 tccgagacct tgagtatcaa gaatgctagt ctctcctggg gcaagtggta
caaggacggt 120 gacaaggacg ccgaaatcac aagtgaagat gtccagcaaa
agacggcacc cccaggcggt 180 tccgtgaacg tcaactcttg cggtcgcagc
gacgcttcga gtggaacgac gggaggtttt 240 gatttgtatg acggcaatac
caagattgga agagtccact gggactgtcc atggggttct 300 aaaaccaacg
atttcgatgt tggagagaga aacaaaaatt actgggtcga aattggaacg 360
tggaacaagt atggtggtgc cattggcaac tgtgaacaga agttgatttc cgaagaagac
420 ctcgag 426 <210> SEQ ID NO 11 <211> LENGTH: 523
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: vector <400>
SEQUENCE: 11 atcmgsttmg caaaagtmta cmacgcaata tggattgtca gaatmtataa
aagagaagca 60 aataactcct tgtcttgtat caattgcatt ataatatctt
cttgttagtg caatatcata 120 tagaagtcat cgaaatagat attaagaaaa
acaaactgta caatcaatca tcacatcaat 180 catcacataa aatattcagc
gaattggatc catggaacag aagttgattt ccgaagaaga 240 cctcgagtga
taagaattca ttaacttcca aaatgaaggt catgagtgcc aatgccaatg 300
tggtagctgc aaaaataatg aacaatgcca aaaatcatgt agctgcccaa cggggtgtaa
360 cagcgacgac aaatgcccct gcggtaacaa gtctgaagaa accaagaagt
catgctgctc 420 tgggaaatga aacgaatagt ctttaatata ttcatctaac
tatttgctgt ttttaatttt 480 taaaaggaga aggaagttta atcgacgatt
ctactcagtt tga 523 <210> SEQ ID NO 12 <211> LENGTH: 582
<212> TYPE: DNA <213> ORGANISM: Coccidioides spp.
(antigen 2/proline-rich antigen) <220> FEATURE: <221>
NAME/KEY: CDS <222> LOCATION: (1)..(582) <400>
SEQUENCE: 12 atg cag ttc tct cac gct ctc atc gct ctc gtc gct gcc
ggc ctc gcc 48 Met Gln Phe Ser His Ala Leu Ile Ala Leu Val Ala Ala
Gly Leu Ala 1 5 10 15 agt gcc cag ctc cca gac atc cca cct tgc gct
ctc aac tgc ttc gtt 96 Ser Ala Gln Leu Pro Asp Ile Pro Pro Cys Ala
Leu Asn Cys Phe Val 20 25 30 gag gct ctc ggc aac gat ggc tgc act
cgc ttg acc gac ttc aag tgc 144 Glu Ala Leu Gly Asn Asp Gly Cys Thr
Arg Leu Thr Asp Phe Lys Cys 35 40 45 cac tgc tcc aag cct gag ctc
cca gga cag atc act cct tgc gtt gag 192 His Cys Ser Lys Pro Glu Leu
Pro Gly Gln Ile Thr Pro Cys Val Glu 50 55 60 gag gcc tgc cct ctc
gac gcc cgt atc tcc gtc tcc aac atc gtc gtt 240 Glu Ala Cys Pro Leu
Asp Ala Arg Ile Ser Val Ser Asn Ile Val Val 65 70 75 80 gac cag tgc
tcc aag gcc ggt gtc cca att gac atc cca cca gtt gac 288 Asp Gln Cys
Ser Lys Ala Gly Val Pro Ile Asp Ile Pro Pro Val Asp 85 90 95 acc
acc gcc gct ccc gag cca tcc gag acc gct gag ccc acc gct gag 336 Thr
Thr Ala Ala Pro Glu Pro Ser Glu Thr Ala Glu Pro Thr Ala Glu 100 105
110 cca acc gag gag ccc act gcc gag cct acc gct gag ccc acc gct gag
384 Pro Thr Glu Glu Pro Thr Ala Glu Pro Thr Ala Glu Pro Thr Ala Glu
115 120 125 ccg act tca gag ccc acc gag gag ccc act gcc gtc cca acc
ggc act 432 Pro Thr Ser Glu Pro Thr Glu Glu Pro Thr Ala Val Pro Thr
Gly Thr 130 135 140 ggc ggt ggt gtc ccc act ggc acc ggt tcc ttc acc
gtc act ggc aga 480 Gly Gly Gly Val Pro Thr Gly Thr Gly Ser Phe Thr
Val Thr Gly Arg 145 150 155 160 cca act gcc tcc acc cca gct gag ttc
cca ggt gct ggc tcc aac gtc 528 Pro Thr Ala Ser Thr Pro Ala Glu Phe
Pro Gly Ala Gly Ser Asn Val 165 170 175 cgt gcc agc gtt ggc ggc att
gct gct gct ctc ctc ggt ctc gct gcc 576 Arg Ala Ser Val Gly Gly Ile
Ala Ala Ala Leu Leu Gly Leu Ala Ala 180 185 190 tac ctg 582 Tyr Leu
<210> SEQ ID NO 13 <211> LENGTH: 194 <212> TYPE:
PRT <213> ORGANISM: Coccidioides spp. (antigen 2/proline-rich
antigen) <400> SEQUENCE: 13 Met Gln Phe Ser His Ala Leu Ile
Ala Leu Val Ala Ala Gly Leu Ala 1 5 10 15 Ser Ala Gln Leu Pro Asp
Ile Pro Pro Cys Ala Leu Asn Cys Phe Val 20 25 30 Glu Ala Leu Gly
Asn Asp Gly Cys Thr Arg Leu Thr Asp Phe Lys Cys 35 40 45 His Cys
Ser Lys Pro Glu Leu Pro Gly Gln Ile Thr Pro Cys Val Glu 50 55 60
Glu Ala Cys Pro Leu Asp Ala Arg Ile Ser Val Ser Asn Ile Val Val 65
70 75 80 Asp Gln Cys Ser Lys Ala Gly Val Pro Ile Asp Ile Pro Pro
Val Asp 85 90 95 Thr Thr Ala Ala Pro Glu Pro Ser Glu Thr Ala Glu
Pro Thr Ala Glu 100 105 110 Pro Thr Glu Glu Pro Thr Ala Glu Pro Thr
Ala Glu Pro Thr Ala Glu 115 120 125 Pro Thr Ser Glu Pro Thr Glu Glu
Pro Thr Ala Val Pro Thr Gly Thr 130 135 140 Gly Gly Gly Val Pro Thr
Gly Thr Gly Ser Phe Thr Val Thr Gly Arg 145 150 155 160 Pro Thr Ala
Ser Thr Pro Ala Glu Phe Pro Gly Ala Gly Ser Asn Val 165 170 175 Arg
Ala Ser Val Gly Gly Ile Ala Ala Ala Leu Leu Gly Leu Ala Ala 180 185
190
Tyr Leu <210> SEQ ID NO 14 <211> LENGTH: 582
<212> TYPE: DNA <213> ORGANISM: Coccidioiodes spp.
(antigen 2/proline-rich antigen) (control) <400> SEQUENCE: 14
atgcagttct ctcacgctct catcgctctc gtcgctgccg gcctcgccag tgcccagctc
60 ccagacatcc caccttgcgc tctcaactgc ttcgttgagg ctctcggcaa
cgatggctgc 120 actcgcttga ccgacttcaa gtgccactgc tccaagcctg
agctcccagg acagatcact 180 ccttgcgttg aggaggcctg ccctctcgac
gcccgtatct ccgtctccaa catcgtcgtt 240 gaccagtgct ccaaggccgg
tgtcccaatt gacatcccac cagttgacac caccgccgct 300 cccgagccat
ccgagaccgc tgagcccacc gctgagccaa ccgaggagcc cactgccgag 360
cctaccgctg agcccaccgc tgagccgact catgagccca ccgaggagcc cactgccgtc
420 ccaaccggca ctggcggtgg tgtccccact ggcaccggtt ccttcaccgt
cactggcaga 480 ccaactgcct ccaccccagc tgagttccca ggtgctggct
ccaacgtccg tgccagcgtt 540 ggcggcattg ctgctgctct cctcggtctc
gctgcctacc tg 582 <210> SEQ ID NO 15 <211> LENGTH: 582
<212> TYPE: DNA <213> ORGANISM: Coccidioides spp.
(antigen 2/proline-rich antigen) (experimental) <400>
SEQUENCE: 15 atgcagttct ctcacgctct catcgctctc gtcgctgccg gcctcgccag
tgcccagctc 60 ccagacatcc caccttgcgc tctcaactgc ttcgttgagg
ctctcggcaa cgatggctgc 120 actcgcttga ccgacttcaa gtgccactgc
tccaagcctg agctcccagg acagatcact 180 ccttgcgttg aggaggcctg
ccctctcgac gcccgtatct ccgtctccaa catcgtcgtt 240 gaccagtgct
ccaaggccgg tgtcccaatt gacatcccac cagttgacac caccgccgct 300
cccgagccat ccgagaccgc tgagcccacc gctgagccaa ccgaggagcc cactgccgag
360 cctaccgctg agcccaccgc tgagccgact catgagccca ccgaggagcc
cactgccgtc 420 ccaaccggca ctggcggtgg tgtccccact ggcaccggtt
ccttcaccgt cactggcaga 480 ccaactgcct ccaccccagc tgagttccca
ggtgctggct ccaacgtccg tgccagcgtt 540 ggcggcattg ctgctgctct
cctcggtctc gctgcctacc tg 582 <210> SEQ ID NO 16 <211>
LENGTH: 747 <212> TYPE: DNA <213> ORGANISM:
Coccidioides spp. (chitin deactylase) <220> FEATURE:
<221> NAME/KEY: CDS <222> LOCATION: (1)..(747)
<400> SEQUENCE: 16 atg aag ttc atc aca agc ctc ttt gcc gtt
ctt gcc att ctc tca agt 48 Met Lys Phe Ile Thr Ser Leu Phe Ala Val
Leu Ala Ile Leu Ser Ser 1 5 10 15 gtc tct gct tct cct acc atg aag
aaa cgt gcg acc gtc gaa act atc 96 Val Ser Ala Ser Pro Thr Met Lys
Lys Arg Ala Thr Val Glu Thr Ile 20 25 30 aac aac tgt aat cag cag
ggc act gtt gct ctg acc ttt gac gat ggc 144 Asn Asn Cys Asn Gln Gln
Gly Thr Val Ala Leu Thr Phe Asp Asp Gly 35 40 45 cct tac aat tac
gaa gcc caa gtt gct tct gcc ctt gac ggg ggt aag 192 Pro Tyr Asn Tyr
Glu Ala Gln Val Ala Ser Ala Leu Asp Gly Gly Lys 50 55 60 ggt act
ttt ttc ctc aac ggc gcg aat tat gtc tgc atc tac gac aag 240 Gly Thr
Phe Phe Leu Asn Gly Ala Asn Tyr Val Cys Ile Tyr Asp Lys 65 70 75 80
gcc gat gaa atc aga gct ttg tat gat gcc ggc cac act ctt ggt tct 288
Ala Asp Glu Ile Arg Ala Leu Tyr Asp Ala Gly His Thr Leu Gly Ser 85
90 95 cac act tgg tct cac gcc gac ctt acc cag tta gat gaa tcc ggg
atc 336 His Thr Trp Ser His Ala Asp Leu Thr Gln Leu Asp Glu Ser Gly
Ile 100 105 110 aac gag gaa ctc tcc aag gtc gaa gat gcc ttt gtc aag
atc ctt ggt 384 Asn Glu Glu Leu Ser Lys Val Glu Asp Ala Phe Val Lys
Ile Leu Gly 115 120 125 gtc aag cct cga tac ttc cga ccc cct tac ggt
aac atc aac gac aac 432 Val Lys Pro Arg Tyr Phe Arg Pro Pro Tyr Gly
Asn Ile Asn Asp Asn 130 135 140 gtc ttg aac gtc ctc agt gaa agg ggt
tac acg aag gtg ttt ttg tgg 480 Val Leu Asn Val Leu Ser Glu Arg Gly
Tyr Thr Lys Val Phe Leu Trp 145 150 155 160 tct gat gac act ggg gat
gcc aac ggc gag tcg gtc agt tac tcc gag 528 Ser Asp Asp Thr Gly Asp
Ala Asn Gly Glu Ser Val Ser Tyr Ser Glu 165 170 175 ggg gta ttg gac
aac gtt atc cag gat tat cct aac cct cat ctt gtc 576 Gly Val Leu Asp
Asn Val Ile Gln Asp Tyr Pro Asn Pro His Leu Val 180 185 190 ctt gat
cac tct acc atc gag acg acc tcc tcc gag gtt ctc cct tac 624 Leu Asp
His Ser Thr Ile Glu Thr Thr Ser Ser Glu Val Leu Pro Tyr 195 200 205
gct gta ccc aag ctc cag agt gct ggc tac caa ctg gtc act gtc ggt 672
Ala Val Pro Lys Leu Gln Ser Ala Gly Tyr Gln Leu Val Thr Val Gly 210
215 220 gaa tgt ctc ggc acc gac gaa tct cct tac gaa tgg gtt gat tgc
cct 720 Glu Cys Leu Gly Thr Asp Glu Ser Pro Tyr Glu Trp Val Asp Cys
Pro 225 230 235 240 gga gag agg gat agc tct tgg caa tgc 747 Gly Glu
Arg Asp Ser Ser Trp Gln Cys 245 <210> SEQ ID NO 17
<211> LENGTH: 249 <212> TYPE: PRT <213> ORGANISM:
Coccidioides spp. (chitin deactylase) <400> SEQUENCE: 17 Met
Lys Phe Ile Thr Ser Leu Phe Ala Val Leu Ala Ile Leu Ser Ser 1 5 10
15 Val Ser Ala Ser Pro Thr Met Lys Lys Arg Ala Thr Val Glu Thr Ile
20 25 30 Asn Asn Cys Asn Gln Gln Gly Thr Val Ala Leu Thr Phe Asp
Asp Gly 35 40 45 Pro Tyr Asn Tyr Glu Ala Gln Val Ala Ser Ala Leu
Asp Gly Gly Lys 50 55 60 Gly Thr Phe Phe Leu Asn Gly Ala Asn Tyr
Val Cys Ile Tyr Asp Lys 65 70 75 80 Ala Asp Glu Ile Arg Ala Leu Tyr
Asp Ala Gly His Thr Leu Gly Ser 85 90 95 His Thr Trp Ser His Ala
Asp Leu Thr Gln Leu Asp Glu Ser Gly Ile 100 105 110 Asn Glu Glu Leu
Ser Lys Val Glu Asp Ala Phe Val Lys Ile Leu Gly 115 120 125 Val Lys
Pro Arg Tyr Phe Arg Pro Pro Tyr Gly Asn Ile Asn Asp Asn 130 135 140
Val Leu Asn Val Leu Ser Glu Arg Gly Tyr Thr Lys Val Phe Leu Trp 145
150 155 160 Ser Asp Asp Thr Gly Asp Ala Asn Gly Glu Ser Val Ser Tyr
Ser Glu 165 170 175 Gly Val Leu Asp Asn Val Ile Gln Asp Tyr Pro Asn
Pro His Leu Val 180 185 190 Leu Asp His Ser Thr Ile Glu Thr Thr Ser
Ser Glu Val Leu Pro Tyr 195 200 205 Ala Val Pro Lys Leu Gln Ser Ala
Gly Tyr Gln Leu Val Thr Val Gly 210 215 220 Glu Cys Leu Gly Thr Asp
Glu Ser Pro Tyr Glu Trp Val Asp Cys Pro 225 230 235 240 Gly Glu Arg
Asp Ser Ser Trp Gln Cys 245 <210> SEQ ID NO 18 <211>
LENGTH: 1872 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: plasmid with
Laccase <220> FEATURE: <221> NAME/KEY: CDS <222>
LOCATION: (1)..(1872) <400> SEQUENCE: 18 atg cgg gga gta gtc
aag ctc ttc ttt cta tct tgt tcc ctc gtt tcg 48 Met Arg Gly Val Val
Lys Leu Phe Phe Leu Ser Cys Ser Leu Val Ser 1 5 10 15 ctg gtc agc
agc gag gag act ggc aag tcg cca acc gcg aac tat gac 96 Leu Val Ser
Ser Glu Glu Thr Gly Lys Ser Pro Thr Ala Asn Tyr Asp 20 25 30 cat
tat atg ccg aag gcg aca gca acc att gat cct agt gta ttc gct 144 His
Tyr Met Pro Lys Ala Thr Ala Thr Ile Asp Pro Ser Val Phe Ala 35 40
45 ctt tca aat gac ttt gaa ata aca gat gtt ccg acg acg agg gag tat
192 Leu Ser Asn Asp Phe Glu Ile Thr Asp Val Pro Thr Thr Arg Glu Tyr
50 55 60 acc ttc gat atc acc aaa gcg ttg gcc agc cct gat ggt tat
gaa cga 240 Thr Phe Asp Ile Thr Lys Ala Leu Ala Ser Pro Asp Gly Tyr
Glu Arg 65 70 75 80 gag gtt tac gtt gtc aac aac atg ttc cct gga cct
gtg ata gag gct 288 Glu Val Tyr Val Val Asn Asn Met Phe Pro Gly Pro
Val Ile Glu Ala 85 90 95 aac acc ggg gat act att atc gta cat gtc
aac aat cat ttg gag gaa 336 Asn Thr Gly Asp Thr Ile Ile Val His Val
Asn Asn His Leu Glu Glu 100 105 110 gga caa agt atc cac tgg cat ggt
ttg cgg cag ctt ggc acg gct ttc 384 Gly Gln Ser Ile His Trp His Gly
Leu Arg Gln Leu Gly Thr Ala Phe 115 120 125 atg gac ggt gtc cct ggt
ata aca cag tgt cct att ccc cct gga agc 432 Met Asp Gly Val Pro Gly
Ile Thr Gln Cys Pro Ile Pro Pro Gly Ser 130 135 140 tca ttt acc tac
caa ttc acc gta agc cat cag tca ggc acg ttt tgg 480 Ser Phe Thr Tyr
Gln Phe Thr Val Ser His Gln Ser Gly Thr Phe Trp 145 150 155 160 tgg
cat tcc cat tat tcc aat tcc atg gcc gac ggc att tgg ggc ccc 528 Trp
His Ser His Tyr Ser Asn Ser Met Ala Asp Gly Ile Trp Gly Pro 165 170
175 tta att atc cat tcg ccc aat gaa ccc ctc caa agg gga cga gac tat
576 Leu Ile Ile His Ser Pro Asn Glu Pro Leu Gln Arg Gly Arg Asp
Tyr
180 185 190 gac gag gat cga atc gtt ttt ata act gac tgg gtg cat gac
aac tca 624 Asp Glu Asp Arg Ile Val Phe Ile Thr Asp Trp Val His Asp
Asn Ser 195 200 205 gaa gtc gtt att gca gct cta gct act cca gaa ggg
tac aaa gga agc 672 Glu Val Val Ile Ala Ala Leu Ala Thr Pro Glu Gly
Tyr Lys Gly Ser 210 215 220 cct gct ccg cca caa ggt gat gcg att ctc
atc aat gga cgt ggc caa 720 Pro Ala Pro Pro Gln Gly Asp Ala Ile Leu
Ile Asn Gly Arg Gly Gln 225 230 235 240 acc aac tgc aca gcc act ggt
tcc tcc tca tgc acc tat ccg cct cct 768 Thr Asn Cys Thr Ala Thr Gly
Ser Ser Ser Cys Thr Tyr Pro Pro Pro 245 250 255 ccc gag att cac gtg
cca gtc aat tgc agg gtt cgt ctg cgc ttt atc 816 Pro Glu Ile His Val
Pro Val Asn Cys Arg Val Arg Leu Arg Phe Ile 260 265 270 agt gcg acc
gcc cat ccc atg tac cgc ata act atc gac aac cac cct 864 Ser Ala Thr
Ala His Pro Met Tyr Arg Ile Thr Ile Asp Asn His Pro 275 280 285 ttg
gaa gtt gtg gaa acc gac ggt aca gcc gtc tat ggg ccc aca gtc 912 Leu
Glu Val Val Glu Thr Asp Gly Thr Ala Val Tyr Gly Pro Thr Val 290 295
300 cat gaa atc tcc att gca cct ggg gaa cgg tac tct gca att atc aac
960 His Glu Ile Ser Ile Ala Pro Gly Glu Arg Tyr Ser Ala Ile Ile Asn
305 310 315 320 acc tca gaa ggg aag gaa ggt gat gcg ttc tgg ctg agg
aca agt gtt 1008 Thr Ser Glu Gly Lys Glu Gly Asp Ala Phe Trp Leu
Arg Thr Ser Val 325 330 335 gct ctg ggc tgt atg ttt ggt gga ata gat
cag gtg gga ttg gcg gtt 1056 Ala Leu Gly Cys Met Phe Gly Gly Ile
Asp Gln Val Gly Leu Ala Val 340 345 350 gtg agg tat acg ggt aat gga
atg gtt agt act gaa gag cct caa act 1104 Val Arg Tyr Thr Gly Asn
Gly Met Val Ser Thr Glu Glu Pro Gln Thr 355 360 365 act gct tgg agt
gat cta gcg gga gct aca act cct tgt gct gga ctg 1152 Thr Ala Trp
Ser Asp Leu Ala Gly Ala Thr Thr Pro Cys Ala Gly Leu 370 375 380 gac
caa aca tat act ctt tca cca cga gag agt ttt agt gca cct cgt 1200
Asp Gln Thr Tyr Thr Leu Ser Pro Arg Glu Ser Phe Ser Ala Pro Arg 385
390 395 400 gaa ttt tca caa agc cat gtc ttc aat agc cag cga gga gcc
ttt gtg 1248 Glu Phe Ser Gln Ser His Val Phe Asn Ser Gln Arg Gly
Ala Phe Val 405 410 415 aat gtt tat ggc aac acc ttc caa ggt tat ggg
ttt aac aat atc tca 1296 Asn Val Tyr Gly Asn Thr Phe Gln Gly Tyr
Gly Phe Asn Asn Ile Ser 420 425 430 tat cag aac caa atc ttc aac cct
cta ctt tca atc gtc caa cgc ggt 1344 Tyr Gln Asn Gln Ile Phe Asn
Pro Leu Leu Ser Ile Val Gln Arg Gly 435 440 445 ggc tct tgc gag agc
aca cta gta gcc agt aca act ttc ccc gac ctc 1392 Gly Ser Cys Glu
Ser Thr Leu Val Ala Ser Thr Thr Phe Pro Asp Leu 450 455 460 gga tca
ggg aac att atc atc aac aat ctt gat ggc gtt atc gac cat 1440 Gly
Ser Gly Asn Ile Ile Ile Asn Asn Leu Asp Gly Val Ile Asp His 465 470
475 480 cct tac cac ctg cac ggc aac gag ttc cag gtg ata gga cga gga
act 1488 Pro Tyr His Leu His Gly Asn Glu Phe Gln Val Ile Gly Arg
Gly Thr 485 490 495 gga gct ctc agc ctt gat aac ctg aca aat att gac
ttc aat ttg gac 1536 Gly Ala Leu Ser Leu Asp Asn Leu Thr Asn Ile
Asp Phe Asn Leu Asp 500 505 510 aac cct gtg aga aag gat acc ctc tgg
ata cag ggc gga agt tgg gtg 1584 Asn Pro Val Arg Lys Asp Thr Leu
Trp Ile Gln Gly Gly Ser Trp Val 515 520 525 gta ctg agg atc acg acg
gat aac cct gga gtt tgg gcc ttg cac tgt 1632 Val Leu Arg Ile Thr
Thr Asp Asn Pro Gly Val Trp Ala Leu His Cys 530 535 540 cat att ggg
tgg cat ctt act gag gga aag ttg gct gtg gtt gtc att 1680 His Ile
Gly Trp His Leu Thr Glu Gly Lys Leu Ala Val Val Val Ile 545 550 555
560 caa cca ggt gcg att gga cat atg gag ggc ccc gag tct tgg acg aat
1728 Gln Pro Gly Ala Ile Gly His Met Glu Gly Pro Glu Ser Trp Thr
Asn 565 570 575 ctc tgt gct aac act gat ccc aat gca ttt gga ccc gca
cga cgc tca 1776 Leu Cys Ala Asn Thr Asp Pro Asn Ala Phe Gly Pro
Ala Arg Arg Ser 580 585 590 cct tct cca tct att caa tcc tct aag aca
tcc act ttc cag tat ctg 1824 Pro Ser Pro Ser Ile Gln Ser Ser Lys
Thr Ser Thr Phe Gln Tyr Leu 595 600 605 cgc gaa gtg aaa ggg aag gtc
gtt aaa cgt aga ggt gct cga gag gcg 1872 Arg Glu Val Lys Gly Lys
Val Val Lys Arg Arg Gly Ala Arg Glu Ala 610 615 620 <210> SEQ
ID NO 19 <211> LENGTH: 624 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Construct <400> SEQUENCE: 19 Met Arg
Gly Val Val Lys Leu Phe Phe Leu Ser Cys Ser Leu Val Ser 1 5 10 15
Leu Val Ser Ser Glu Glu Thr Gly Lys Ser Pro Thr Ala Asn Tyr Asp 20
25 30 His Tyr Met Pro Lys Ala Thr Ala Thr Ile Asp Pro Ser Val Phe
Ala 35 40 45 Leu Ser Asn Asp Phe Glu Ile Thr Asp Val Pro Thr Thr
Arg Glu Tyr 50 55 60 Thr Phe Asp Ile Thr Lys Ala Leu Ala Ser Pro
Asp Gly Tyr Glu Arg 65 70 75 80 Glu Val Tyr Val Val Asn Asn Met Phe
Pro Gly Pro Val Ile Glu Ala 85 90 95 Asn Thr Gly Asp Thr Ile Ile
Val His Val Asn Asn His Leu Glu Glu 100 105 110 Gly Gln Ser Ile His
Trp His Gly Leu Arg Gln Leu Gly Thr Ala Phe 115 120 125 Met Asp Gly
Val Pro Gly Ile Thr Gln Cys Pro Ile Pro Pro Gly Ser 130 135 140 Ser
Phe Thr Tyr Gln Phe Thr Val Ser His Gln Ser Gly Thr Phe Trp 145 150
155 160 Trp His Ser His Tyr Ser Asn Ser Met Ala Asp Gly Ile Trp Gly
Pro 165 170 175 Leu Ile Ile His Ser Pro Asn Glu Pro Leu Gln Arg Gly
Arg Asp Tyr 180 185 190 Asp Glu Asp Arg Ile Val Phe Ile Thr Asp Trp
Val His Asp Asn Ser 195 200 205 Glu Val Val Ile Ala Ala Leu Ala Thr
Pro Glu Gly Tyr Lys Gly Ser 210 215 220 Pro Ala Pro Pro Gln Gly Asp
Ala Ile Leu Ile Asn Gly Arg Gly Gln 225 230 235 240 Thr Asn Cys Thr
Ala Thr Gly Ser Ser Ser Cys Thr Tyr Pro Pro Pro 245 250 255 Pro Glu
Ile His Val Pro Val Asn Cys Arg Val Arg Leu Arg Phe Ile 260 265 270
Ser Ala Thr Ala His Pro Met Tyr Arg Ile Thr Ile Asp Asn His Pro 275
280 285 Leu Glu Val Val Glu Thr Asp Gly Thr Ala Val Tyr Gly Pro Thr
Val 290 295 300 His Glu Ile Ser Ile Ala Pro Gly Glu Arg Tyr Ser Ala
Ile Ile Asn 305 310 315 320 Thr Ser Glu Gly Lys Glu Gly Asp Ala Phe
Trp Leu Arg Thr Ser Val 325 330 335 Ala Leu Gly Cys Met Phe Gly Gly
Ile Asp Gln Val Gly Leu Ala Val 340 345 350 Val Arg Tyr Thr Gly Asn
Gly Met Val Ser Thr Glu Glu Pro Gln Thr 355 360 365 Thr Ala Trp Ser
Asp Leu Ala Gly Ala Thr Thr Pro Cys Ala Gly Leu 370 375 380 Asp Gln
Thr Tyr Thr Leu Ser Pro Arg Glu Ser Phe Ser Ala Pro Arg 385 390 395
400 Glu Phe Ser Gln Ser His Val Phe Asn Ser Gln Arg Gly Ala Phe Val
405 410 415 Asn Val Tyr Gly Asn Thr Phe Gln Gly Tyr Gly Phe Asn Asn
Ile Ser 420 425 430 Tyr Gln Asn Gln Ile Phe Asn Pro Leu Leu Ser Ile
Val Gln Arg Gly 435 440 445 Gly Ser Cys Glu Ser Thr Leu Val Ala Ser
Thr Thr Phe Pro Asp Leu 450 455 460 Gly Ser Gly Asn Ile Ile Ile Asn
Asn Leu Asp Gly Val Ile Asp His 465 470 475 480 Pro Tyr His Leu His
Gly Asn Glu Phe Gln Val Ile Gly Arg Gly Thr 485 490 495 Gly Ala Leu
Ser Leu Asp Asn Leu Thr Asn Ile Asp Phe Asn Leu Asp 500 505 510 Asn
Pro Val Arg Lys Asp Thr Leu Trp Ile Gln Gly Gly Ser Trp Val 515 520
525 Val Leu Arg Ile Thr Thr Asp Asn Pro Gly Val Trp Ala Leu His Cys
530 535 540 His Ile Gly Trp His Leu Thr Glu Gly Lys Leu Ala Val Val
Val Ile 545 550 555 560 Gln Pro Gly Ala Ile Gly His Met Glu Gly Pro
Glu Ser Trp Thr Asn 565 570 575 Leu Cys Ala Asn Thr Asp Pro Asn Ala
Phe Gly Pro Ala Arg Arg Ser 580 585 590 Pro Ser Pro Ser Ile Gln Ser
Ser Lys Thr Ser Thr Phe Gln Tyr Leu 595 600 605 Arg Glu Val Lys Gly
Lys Val Val Lys Arg Arg Gly Ala Arg Glu Ala 610 615 620 <210>
SEQ ID NO 20 <211> LENGTH: 27 <212> TYPE: DNA
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: PCR primer <400> SEQUENCE: 20 ggatccatgc
ttgtggccac cctccct 27 <210> SEQ ID NO 21
<211> LENGTH: 74 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: PCR
primer <400> SEQUENCE: 21 gaattcttat cactcgaggt cttcttcgga
aatcaactta gtgcaatgaa gctgtccacc 60 ttcatgggta tggc 74 <210>
SEQ ID NO 22 <211> LENGTH: 42 <212> TYPE: DNA
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: PCR primer <400> SEQUENCE: 22 ggattcatgc
ttacacctga gcagctaatc actgctccac gg 42 <210> SEQ ID NO 23
<211> LENGTH: 82 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: PCR
primer <400> SEQUENCE: 23 gaattcttat cactcgaggt cttcttcgga
aatcaacttc tgttccggga caacggtgtc 60 ctccaggctg acggcgttgg gg 82
<210> SEQ ID NO 24 <211> LENGTH: 25 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 24
gtcgacatgg ccctcgacaa ggagc 25 <210> SEQ ID NO 25 <211>
LENGTH: 93 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: PCR primer
<400> SEQUENCE: 25 ctgcagttat cactcgaggt cttcttcgga
aatcaacttc tgttccatct tggatgattc 60 ctcaaaagct gccaccatcc
gcgcttcagc cgc 93 <210> SEQ ID NO 26 <211> LENGTH: 36
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: PCR primer <400>
SEQUENCE: 26 ggattcatgg catcggtcca agcttacgca cagtgg 36 <210>
SEQ ID NO 27 <211> LENGTH: 97 <212> TYPE: DNA
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: PCR primer <400> SEQUENCE: 27 gaattcttat
cactcgaggt cttcttcgga aatcaacttc tgttcacagt tgccaatggc 60
accaccatac ttgttccacg ttccaatttc gacccag 97 <210> SEQ ID NO
28 <211> LENGTH: 38 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: PCR primer <400> SEQUENCE: 28 gtcgacatga
agttctcttt gagcgctgct gtcctcgc 38 <210> SEQ ID NO 29
<211> LENGTH: 92 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: PCR
primer <400> SEQUENCE: 29 gaattcttat cactcgaggt cttcttcgga
aatcaacttc tgttccagga tagaaccaag 60 ggcaatgcaa ggaagaccca
gtccaatgag gg 92 <210> SEQ ID NO 30 <211> LENGTH: 33
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: PCR primer <400>
SEQUENCE: 30 ggatccatgt ctcctaccat gaagaaacgt gcg 33 <210>
SEQ ID NO 31 <211> LENGTH: 91 <212> TYPE: DNA
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: PCR primer <400> SEQUENCE: 31 gaattcttat
cactcgaggt cttcttcgga aatcaacttc tgttcgcatt gccaagagct 60
atccctctct ccagggcaat caacccattc g 91 <210> SEQ ID NO 32
<211> LENGTH: 45 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: PCR
primer <400> SEQUENCE: 32 gtcgacatgt ccctccccga tgcctaccct
ccggtcatag ccacc 45 <210> SEQ ID NO 33 <211> LENGTH: 79
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: PCR primer <400>
SEQUENCE: 33 gaattcttat cactcgaggt cttcttcgga aatcaacttc tgttcacttc
tgttggccat 60 ttcagcttcc tgtctcgcc 79 <210> SEQ ID NO 34
<211> LENGTH: 36 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: PCR
primer <400> SEQUENCE: 34 ggatccatgg aggagactgg caagtcgcca
accgcg 36 <210> SEQ ID NO 35 <211> LENGTH: 96
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: PCR primer <400>
SEQUENCE: 35 gaattcttat cactcgaggt cttcttcgga aatcaacttc tgttccgcct
ctcgagcacc 60 tctacgttta acgaccttcc ctttcacttc gcgcag 96
<210> SEQ ID NO 36 <211> LENGTH: 33 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 36
ggatccatgg ctgttcctcc cgagactccg cgg 33 <210> SEQ ID NO 37
<211> LENGTH: 84 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: PCR
primer <400> SEQUENCE: 37 gaattcttat cactcgaggt cttcttcgga
aatcaacttc tgttcagtga gagagcgcat 60 accattgagc aacatttcgt tggc 84
<210> SEQ ID NO 38 <211> LENGTH: 38 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 38
ggatccatgc actccaaggt tgttatcatc ggctctgg 38 <210> SEQ ID NO
39 <211> LENGTH: 100 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: PCR primer <400> SEQUENCE: 39 gaattcttat
cactcgaggt cttcttcgga aatcaacttc tgttcctcct tgtcagtgcc 60
gaagtagtgc tcggcaggga catgcacatc ttcggtctgg 100 <210> SEQ ID
NO 40 <211> LENGTH: 30 <212> TYPE: DNA <213>
ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: PCR primer
<400> SEQUENCE: 40 ggatccatgc atctcctccc gagagaaacg 30
<210> SEQ ID NO 41 <211> LENGTH: 93 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 41
gtcgacttat cactcgaggt cttcttcgga aatcaacttc tgttcgtaaa cgaagtatct
60 cctggtcaat gggagtttgt ccgcgggtgg gac 93
* * * * *
References