U.S. patent application number 11/559475 was filed with the patent office on 2007-07-19 for nucleoside compounds for treating viral infections.
This patent application is currently assigned to Genelabs Technologies, Inc.. Invention is credited to Natalia B. Dyatkina, Jesse D. Keicher, Christopher D. Roberts.
Application Number | 20070167383 11/559475 |
Document ID | / |
Family ID | 34658262 |
Filed Date | 2007-07-19 |
United States Patent
Application |
20070167383 |
Kind Code |
A1 |
Roberts; Christopher D. ; et
al. |
July 19, 2007 |
NUCLEOSIDE COMPOUNDS FOR TREATING VIRAL INFECTIONS
Abstract
Disclosed are compounds, compositions and methods for treating
viral infections caused by a flaviviridae family virus, such as
hepatitis C virus.
Inventors: |
Roberts; Christopher D.;
(Belmont, CA) ; Keicher; Jesse D.; (Menlo Park,
CA) ; Dyatkina; Natalia B.; (Mountain View,
CA) |
Correspondence
Address: |
FOLEY & LARDNER LLP
1530 PAGE MILL ROAD
PALO ALTO
CA
94304
US
|
Assignee: |
Genelabs Technologies, Inc.
|
Family ID: |
34658262 |
Appl. No.: |
11/559475 |
Filed: |
November 14, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10971477 |
Oct 21, 2004 |
|
|
|
11559475 |
Nov 14, 2006 |
|
|
|
10861090 |
Jun 4, 2004 |
7202223 |
|
|
10971477 |
Oct 21, 2004 |
|
|
|
10861311 |
Jun 4, 2004 |
7144868 |
|
|
10971477 |
Oct 21, 2004 |
|
|
|
10861219 |
Jun 4, 2004 |
7151089 |
|
|
10971477 |
Oct 21, 2004 |
|
|
|
60515153 |
Oct 27, 2003 |
|
|
|
60515153 |
Oct 27, 2003 |
|
|
|
60515153 |
Oct 27, 2003 |
|
|
|
60602815 |
Aug 18, 2004 |
|
|
|
Current U.S.
Class: |
514/43 ;
536/26.7; 536/27.13 |
Current CPC
Class: |
A61P 31/12 20180101;
A61P 1/16 20180101; A61K 31/7076 20130101; C07H 19/14 20130101;
A61P 31/14 20180101 |
Class at
Publication: |
514/043 ;
536/026.7; 536/027.13 |
International
Class: |
A61K 31/7076 20060101
A61K031/7076; C07H 19/20 20060101 C07H019/20; C07H 19/22 20060101
C07H019/22 |
Claims
1-45. (canceled)
46. A method for treating a viral infection in a mammal mediated at
least in part by a virus in the flaviviridae family of viruses
which method comprises administering to a mammal, that has been
diagnosed with said viral infection or is at risk of developing
said viral infection, a compound of Formula I: ##STR134## wherein Y
is selected from the group consisting of a bond, --CH.sub.2-- or
--O--; each of W, W.sup.1 and W.sup.2 is independently selected
from the group consisting of hydrogen, acyl, oxyacyl, phosphonate,
phosphate esters, phosphate, phosphonamidate, phosphorodiamidate,
phosphoramidate monoester, cyclic phosphoramidate, cyclic
phosphorodiamidate, phosphoramidate diester, and
--C(O)CHR.sup.30NH.sub.2 where R.sup.30 is selected from the group
consisting of hydrogen, alkyl, substituted alkyl aryl, substituted
aryl, heteroaryl, substituted heteroaryl, and a sidechain of an
amino acid; and T is selected from the group consisting of a)
---C.ident.C--R, where R is selected from the group consisting of
i) tri(C.sub.1-C.sub.4)alkylsilyl, --C(O)NR.sup.1R.sup.2,
alkoxyalkyl, heteroaryl, and substituted heteroaryl, and phenyl
substituted with 1 to 3 substituents selected from the group
consisting of alkyl, substituted alkyl, alkenyl, substituted
alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy,
acyl, acylamino, acyloxy, aminoacyl, amidino, amino, substituted
amino, carboxyl, carboxyl ester, cyano, cycloalkyl, substituted
cycloalkyl, cycloalkoxy, substituted cycloalkoxy, guanidino, halo,
heteroaryl substituted heteroaryl, hydrazino, hydroxyl, nitro,
thiol, and --S(O).sub.mR.sup.3; where R.sup.1 and R.sup.2 are
independently selected from the group consisting of hydrogen,
alkyl, substituted alkyl, amino, substituted amino, aryl,
substituted aryl, heteroaryl, substituted heteroaryl, heterocyclyl
and substituted heterocyclyl provided that only one of R.sup.1 and
R.sup.2 is amino or substituted amino, and further wherein R.sup.1
and R.sup.2, together with the nitrogen atom pendant thereto, form
a heterocyclyl or substituted heterocyclyl; R.sup.3 is selected
from the group consisting of alkyl, substituted alkyl, amino,
substituted amino, aryl, substituted aryl, heteroaryl, substituted
heteroaryl, heterocyclyl and substituted heterocyclyl; and m is an
integer equal to 0, 1 or 2; ii) --C(O)OR.sup.14, where R.sup.14 is
hydrogen, alkyl or substituted alkyl; b) --C(O)H; c)
--CH.dbd.NNHR.sup.15, where R.sup.15 is H or alkyl; d)
--CH.dbd.N(OR.sup.15), where R.sup.15 is as defined above; e)
--CH(OR.sup.16).sub.2 where R.sup.16 is (C.sub.3-C.sub.6)alkyl and
f) --B(OR.sup.15).sub.2 where R.sup.15 is as defined above; and
pharmaceutically acceptable salts or partial salts thereof, wherein
substituted alkyl refers to an alkyl group having from 1 to 3
substituents selected from the group consisting of alkoxy,
substituted alkoxy, acyl, acylamino, acyloxy, oxyacyl, amino,
substituted amino, aminoacyl, aryl, substituted aryl, aryloxy,
substituted aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl,
carboxyl esters, cycloalkyl, substituted cycloalkyl, heteroaryl,
substituted heteroaryl, heterocyclyl, and substituted heterocyclyl;
alkoxy refers to alkyl-O--; substituted alkoxy refers to
(substituted alkyl)-O--; alkoxyalkyl refers to
-alkylene(alkoxy).sub.n or -alkylene(substituted alkoxy).sub.n,
where alkylene is a divalent straight or branched chain alkylene
group of from 1 to 3 carbon atoms; acyl refers to a moiety selected
from the group consisting of alkyl-C(O)--, substituted
alkyl-C(O)--, alkenyl-C(O)--, substituted alkenyl-C(O)--,
alkynyl-C(O)--, substituted alkynl-C(O)-- cycloalkyl-C(O)--,
substituted cycloalkyl-C(O)--, aryl-C(O)--, substituted
aryl-C(O)--, heteroaryl-C(O)--, substituted heteroaryl-C(O),
heterocyclyl-C(O)--, and substituted heterocyclyl-C(O)--; acylamino
refers to the group --C(O)NR.sup.4R.sup.4 where each R.sup.4 is
independently selected from the group consisting of hydrogen,
alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl,
substituted alkynyl, aryl, substituted aryl, cycloalkyl,
substituted cycloalkyl, heteroaryl, substituted heteroaryl,
heterocyclyl, substituted heterocyclyl and where each R.sup.4 is
joined to form together with the nitrogen atom a heterocyclyl or
substituted heterocyclyl ring; acyloxy refers to a moiety selected
from the group consisting of alkyl-C(O)O--, substituted
alkyl-C(O)O--, alkenyl-C(O)O--, substituted alkenyl-C(O)O--,
alkynyl-C(O)O--, substituted alkynyl-C(O)O--, aryl-C(O)O--,
substituted aryl-C(O)O--, cycloalkyl-C(O)O--, substituted
cycloalkyl-C(O)O--, heteroaryl-C(O)O--, substituted
heteroaryl-C(O)O--, heterocyclyl-C(O)O--, and substituted
heterocyclyl-C(O)O--; oxyacyl refers to a moiety selected from the
group consisting of alkyl-OC(O)--, substituted alkyl-OC(O)--,
alkenyl-OC(O)--, substituted alkenyl-OC(O)--, alkynyl-OC(O)--,
substituted alkynyl-OC(O)--, aryl-OC(O)--, substituted
aryl-OC(O)--, cycloalkyl-OC(O)--, substituted cycloalkyl-OC(O)--,
heteroaryl-OC(O)--, substituted heteroaryl-OC(O)--,
heterocyclyl-OC(O)--, and substituted heterocyclyl-OC(O)--;
substituted alkenyl refers to an alkenyl group having from 1 to 3
substituents selected from the group consisting of alkoxy,
substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted
amino, aminoacyl, aryl, substituted aryl, aryloxy, substituted
aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl, carboxyl
esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted
heteroaryl, heterocyclyl, and substituted heterocyclyl with the
proviso that any hydroxyl substitution is not attached to an
unsaturated carbon atom; substituted alkynyl refers to an alkynyl
group having from 1 to 3 substituents selected from the group
consisting of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy,
amino, substituted amino, aminoacyl, aryl, substituted aryl,
aryloxy, substituted aryloxy, cyano, halogen, hydroxyl, nitro,
carboxyl, carboxyl esters, cycloalkyl, substituted cycloalkyl,
heteroaryl, substituted heteroaryl, heterocyclyl, and substituted
heterocyclyl; amino refers to --NH.sub.2. substituted amino refers
to --NR'R'', where R' and R'' independently are selected from the
group consisting of hydrogen, alkyl, substituted alkyl, alkenyl,
substituted alkenyl, alkenyl, substituted alkynyl, aryl,
substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl,
substituted heteroaryl, heterocyclyl, substituted heterocyclyl and
where R' and R'' are joined, together with the nitrogen bound
thereto to form a heterocyclyl or substituted heterocyclyl group
provided that R' and R'' are both not hydrogen; amidino refers to
--C(.dbd.NR.sup.11)NR.sup.11R.sup.11 where each R.sup.11
independently is hydrogen or alkyl; aminoacyl refers to a moiety
selected from the group consisting of --NR.sup.5C(O)alkyl,
--NR.sup.5C(O)substituted alkyl, --NR.sup.5C(O)cycloalkyl,
--NR.sup.5C(O)substituted cycloalkyl, --NR.sup.5C(O)alkenyl,
--NR.sup.5C(O)substituted alkenyl, --NR.sup.5C(O)alkynyl,
--NR.sup.5C(O)substituted alkynyl, --NR.sup.5C(O)aryl,
--NR.sup.5C(O)substituted aryl, --NR.sup.5C(O)heteroaryl,
--NR.sup.5C(O)substituted heteroaryl, --NR.sup.5C(O)heterocyclyl,
and --NR.sup.5C(O)substituted heterocyclyl where R.sup.5 is
hydrogen or alkyl; aryl refers to a monovalent aromatic carbocyclic
group of from 6 to 14 carbon atoms having a single ring (e.g.,
phenyl) or multiple condensed rings (e.g., naphthyl or anthryl)
which condensed rings may or may not be aromatic (e.g.,
2-benzoxazolinone, 2H-1 4-benzoxazin-3(4H)-one-7-yl, and the like)
provided that the point of attachment is at an aromatic carbon
atom; substituted aryl refers to an aryl group which is substituted
with from 1 to 3 substituents selected from the group consisting of
hydroxyl, acyl, acylamino, acyloxy, alkyl, substituted alkyl,
alkoxy, substituted alkoxy, alkenyl, substituted alkenyl, alkynyl,
substituted alkynyl, amino, substituted amino, aminoacyl, aryl,
substituted aryl, aryloxy, substituted aryloxy, cycloalkoxy,
substituted cycloalkoxy, carboxyl, carboxyl esters, cyano, thiol,
thioalkyl, substituted thioalkyl, thioaryl, substituted thioaryl,
thioheteroaryl, substituted thioheteroaryl, thiocycloalkyl,
substituted thiocycloalkyl, thioheterocyclyl, substituted
thioheterocyclyl, cycloalkyl, substituted cycloalkyL, halo, nitro,
heteroaryl, substituted heteroaryl, heterocyclyl, substituted
heterocyclyl, heteroaryloxy, substituted heteroaryloxy,
heterocyclyloxy, and substituted heterocyclyloxy; aryloxy refers to
the group aryl-O--; substituted aryloxy refers to (substituted
aryl)-O--; carboxyl refers to --COOH or salts thereof; carboxyl
ester refers to a moiety selected from the group consisting of
--C(O)O-alkyl, --C(O)O-(substituted alkyl), --C(O)O-aryl, and
--C(O)O-(substituted aryl); cycloalkyl refers to a cyclic alkyl
group of from 3 to 10 carbon atoms having single or multiple cyclic
rings; substituted cycloalkyl refers to a cycloalkyl having from 1
to 5 substituents selected from the group consisting of oxo
(.dbd.O), thioxo (.dbd.S), alkyl, substituted alkyl, alkoxy,
substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted
amino, aminoacyl, aryl, substituted aryl, aryloxy, substituted
aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl, carboxyl
esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted
heteroaryl, heterocyclyl, and substituted heterocyclyl; cycloalkoxy
refers to --O-cycloalkyl, substituted cycloalkoxy refers to
--O-(substituted cycloalkyl); guanidino refers to
--NR.sup.12C(.dbd.NR.sup.12)NR.sup.12R.sup.12 where each R.sup.12
independently is hydrogen or alkyl; halogen refers to fluoro,
chloro, bromo and iodo; heteroaryl refers to an aromatic group of
from 1 to 10 carbon atoms and 1 to 4 heteroatoms selected from the
group consisting of oxygen, nitrogen, and sulfur within the ring
wherein the nitrogen and/or sulfur is optionally oxidized
((N.fwdarw.O) --S(O)--, or --SO.sub.2--), wherein the heteroaryl
group can have a single ring or multiple condensed rings where the
condensed rings may or may not be aromatic and/or contain a
heteroatom provided that the point of attachment is through an
aromatic ring atom; substituted heteroaryl refers to a heteroaryl
group that is substituted with from 1 to 3 substituents selected
from the group consisting of hydroxyl, acyl, acylamino, acyloxy,
alkyl substituted alkyl alkoxy, substituted alkoxy, alkenyl,
substituted alkenyl, alkynyl, substituted alkynyl, amino,
substituted amino, aminoacyl, aryl, substituted aryl, aryloxy,
substituted aryloxy, cycloalkoxy, substituted cycloalkoxy, carboxyl
carboxyl esters, cyano, thiol thioalkyl substituted thioalkyl,
thioaryl, substituted thioaryl, thioheteroaryl, substituted
thioheteroaryl, thiocycloalkyl, substituted thiocycloalkyl,
thioheterocyclyl, substituted thioheterocyclyl, cycloalkyl,
substituted cycloalkyl, halo, nitro, heteroaryl, substituted
heteroaryl, heterocyclyl, substituted heterocyclyl, heteroaryloxy,
substituted heteroaryloxy, heterocyclyloxy, and substituted
heterocyclyloxy; heteroaryloxy refers to the group --O-heteroaryl;
substituted heteroaryloxy refers to the group --O-(substituted
heteroaryl); heterocyclyl refers to a saturated or unsaturated
group, but not heteroaryl, having a single ring or multiple
condensed rings, from 1 to 10 carbon atoms and from 1 to 4 hetero
atoms selected from the group consisting of nitrogen, oxygen and
sulfur within the ring wherein the nitrogen and/or sulfur atoms can
be optionally oxidized ((N.fwdarw.O), --S(O)-- or --SO.sub.2--) and
further wherein, in fused ring systems, one or more the rings can
be cycloalkyl, aryl or heteroaryl provided that the point of
attachment is through the heterocyclyl ring; substituted
heterocyclyl refers to a heterocycle group that is substituted with
from 1 to 3 substituents selected from the group consisting of oxo
(.dbd.O), thioxo (.dbd.S), alkyl, substituted alkyl, alkoxy,
substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted
amino, aminoacyl aryl, substituted aryl, aryloxy, substituted
aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl, carboxyl
esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted
heteroary, heterocyclyl, and substituted heterocyclyl;
heterocyclyloxy refers to the group --O-heterocyclyl; substituted
heterocyclyloxy refers to the group --O-(substituted heterocyclyl;
hydrazino refers to the group --NR.sup.13NR.sup.13R.sup.13 wherein
each R.sup.1.sup.3 independently is hydrogen or alkyl; phosphate
refers to the groups --OP(O)(OH).sub.2 (monophosphate),
--OP(O)(OH)OP(O)(OH).sub.2 (diphosphate) and
--OP(O)(OH)OP(O)(OH)OP(O)(OH).sub.2 (triphosphate) or salts thereof
including partial salts thereof; phosphate ester refers to a mono-,
di- or tri-phosphate, wherein one or more of the hydroxyl group is
replaced by an alkoxy group; phosphonate refers to a moiety
selected from the group consisting of --OP(O)(R.sup.6)(OH) and
--OP(O)(R.sup.6)(OR.sup.6) and salts thereof, including partial
salts thereof, wherein each R.sup.6 is independently selected from
the group consisting of hydrogen, alkyl, substituted alkyl
carboxylic acid, and carboxyl ester; phosphorodiamidate refers to
##STR135## where each R.sup.7 may be the same or different and each
is hydrogen, alkyl, substituted alkyl, cycloalkyl, or substituted
cycloalkyl; phosphoramidate monoester refers to ##STR136## where
R.sup.30 is selected from the group consisting of hydrogen, alkyl,
substituted alkyl, aryl, substituted aryl, and a sidechain of an
amino acid and R.sup.8 is hydrogen or alkyl; phosphoramidate
diester refers to ##STR137## where R.sup.30 is selected from the
group consisting of hydrogen, alkyl, substituted alkyl aryl
substituted aryl and a sidechain of an amino acid, R.sup.8 is
hydrogen or alkyl and R.sup.10 is selected from the group
consisting of alkyl, substutituted alkyl, aryl, substituted aryl,
cycloalkyl, substituted cycloalkyl, heteroaryl, substituted
heteroaryl, heterocyclyl and substituted heterocyclyl; cyclic
phosphoramidate refers to ##STR138## where n is 1 to 3; cyclic
iphosphorodiamidate refers to ##STR139## where n is 1 to 3;
phosphonamidate refers ##STR140## where R.sup.14 is hydrogen,
alkyl, substituted alkyl, cycloalkyl, or substituted cycloalkyl;
thiol refers to --SH; thioalkyl refers to --S-alkyl; substituted
thioalkyl refers to --S-(substituted alkyl); thiocycloalkyl refers
to --S-cycloalkyl; substituted thiocycloalkyl refers to
--S-(substituted cycloalkyl); thioaryl refers to --S-aryl;
substituted thioaryl refers to --S-(substituted aryl);
thioheteroarml refers to --S-heteroaryl; substituted thioheteroaryl
refers to --S-(substituted heteroaryl); thioheterocyclyl refers to
--S-heterocyclyl; and substituted thioheterocyclyl refers to
--S-(substituted heterocyclyl).
47. (canceled)
48. The method of claim 46, wherein the viral infection is mediated
at least in part by a hepatitis C virus (HCV) and wherein the
method further comprises administration of a therapeutically
effective amount of one or more agents active against HCV in
combination with the compound.
49. The method of claim 48 wherein said active agent against is
Ribavirin, levovirin, viramidine, thymosin alpha-1, an inhibitor of
NS3 serine protease, and inhibitor of inosine monophosphate
dehydrogenase, interferon-alpha, pegylated interferon-alpha, alone
or in combination with Ribavirin or levovirin.
50. The method of claim 49 wherein said agent active against HCV is
interferon-alpha or pegylated interferon-alpha alone or in
combination with Ribavirin or levovirin.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S. utility
applications with Ser. Nos. 10/861,090, 10/861,311, and 10/861,219
all filed on Jun. 4, 2004, each of which claim the benefit under 35
U.S.C. .sctn. 119(e) of U.S. Provisional Patent Application Ser.
No. 60/515,153 filed Oct. 27, 2003. The present application also
claims the benefit under 35 U.S.C. .sctn. 119(e) of U.S.
Provisional Patent Application Ser. No. 60/602,815 filed Aug. 18,
2004. All of the above applications are incorporated herein in
their entirety.
BACKGROUND OF THE INVENTION
1. Field of the Invention
[0002] The invention relates to methods for preparing particular
compounds for treating viral infections in mammals mediated, at
least in part, by a virus in the flaviviridae family of viruses.
This invention is also directed to novel intermediates utilized in
these methods.
REFERENCES
[0003] The following publications are cited in this application as
superscript numbers: [0004] 1. Giangaspero, et al., Arch. Virol.
Suppl., 7: 53-62 (1993); [0005] 2. Giangaspero, et al., Int. J.
STD. AIDS, 4(5): 300-302 (1993); [0006] 3. Yolken, et al., Lancet,
1(8637): 517-20 (1989); [0007] 4. Wilks, et al., Lancet, 1(8629):
107 (1989); [0008] 5. Giangaspero, et al., Lancet, 2: 110 (1988);
[0009] 6. Potts, et al., Lancet, 1(8539): 972-973 (1987); [0010] 7.
Cornberg, et al., "Hepatitis C: therapeutic perspectives." Forum
(Genova), 11(2):154-62 (2001); [0011] 8. Dymock, et al., Antivir.
Chem. Chemother. 11(2):79-96 (2000); [0012] 9. Devos, et al.,
International Patent Application Publication No. WO 02/18404 A2,
published 7 March, 2002; [0013] 10. Sommadossi, et al.,
International Patent Application Publication No. WO 01/90121,
published 23 May, 2001; [0014] 11. Carroll, S. S., et al.,
International Patent Application Publication No. WO 02057287,
published 25 July, 2002; [0015] 12. Carroll, S. S., et al.,
International Patent Application Publication No. WO 02057425,
published 25 July, 2002; [0016] 13. Roberts, et al., U.S. patent
application Ser. No. 10/861,090, filed Jun. 4, 2004. [0017] 14.
Roberts, et al., U.S. patent application Ser. No. 10/861,311, filed
Jun. 4, 2004.
[0018] All of the above publications and applications are herein
incorporated by reference in their entirety to the same extent as
if each individual publication or application was specifically and
individually indicated to be incorporated by reference in its
entirety.
2. State of the Art
[0019] The Flaviviridae family of viruses is composed of three
genera: pestivirus, flavivirus and hepacivirus (hepatitis C virus).
Of these genera, flaviviruses and hepaciviruses represent important
pathogens of man and are prevalent throughout the world. There are
38 flaviviruses associated with human disease, including the dengue
fever viruses, yellow fever virus and Japanese encephalitis virus.
Flaviviruses cause a range of acute febrile illnesses and
encephalitic and hemorrhagic diseases. Hepaciviruses currently
infect approximately 2 to 3% of the world population and cause
persistent infections leading to chronic liver disease, cirrhosis,
hepatocellular carcinoma and liver failure. Human pestiviruses have
not been as extensively characterized as the animal pestiviruses.
However, serological surveys indicate considerable pestivirus
exposure in humans. Pestivirus infections in man have been
implicated in several diseases including, but not likely limited
to, congenital brain injury, infantile gastroenteritis and chronic
diarrhea in human immunodeficiency virus (HIV) positive patients.
.sup.1-6
[0020] Currently, there are no antiviral pharmaceutical drugs to
prevent or treat pestivirus or flavivirus infections. For
hepacivirus, i.e., hepatitis C virus (HCV) infections, interferon
alpha (IFN) is currently the only approved drug in the United
States. HCV is a major causative agent for post-transfusion and for
sporadic non-A, non-B hepatitis. Infection by HCV is insidious in a
high proportion of chronically infected (and infectious) carriers
who may not experience clinical symptoms for many years.
[0021] At present, the only acceptable treatment for chronic HCV is
interferon (IFN-alpha) and this requires at least six (6) months of
treatment and/or ribavirin, which can inhibit viral replication in
infected cells and also improve liver function in some people.
[0022] IFN-alpha belongs to a family of naturally occurring small
proteins with characteristic biological effects such as antiviral,
immunoregulatory and antitumoral activities that are produced and
secreted by most animal nucleated cells in response to several
diseases, in particular viral infections. IFN-alpha is an important
regulator of growth and differentiation affecting cellular
communication and immunological control. Treatment of HCV with
interferon, however, has limited long term efficacy with a response
rate about 25%. In addition, treatment of HCV with interferon has
frequently been associated with adverse side effects such as
fatigue, fever, chills, headache, myalgias, arthralgias, mild
alopecia, psychiatric effects and associated disorders, autoimmune
phenomena and associated disorders and thyroid dysfunction.
[0023] Ribavirin
(1-.beta.-D-ribofuranosyl-1H-1,2,-4-triazole-3-carboxamide), an
inhibitor of inosine 5'-monophosphate dehydrogenase (IMPDH),
enhances the efficacy of IFN-alpha in the treatment of HCV. Despite
the introduction of Ribavirin, more than 50% of the patients do not
eliminate the virus with the current standard therapy of
interferon-alpha (IFN) and Ribavirin. By now, standard therapy of
chronic hepatitis C has been changed to the combination of PEG-IFN
plus ribavirin. However, a number of patients still have
significant side effects, primarily related to Ribavirin. Ribavirin
causes significant hemolysis in 10-20% of patients treated at
currently recommended doses, and the drug is both teratogenic and
embryotoxic.
[0024] Other approaches are being taken to combat the virus. They
include, for example, application of antisense oligonucleotides or
ribozymes for inhibiting HCV replication. Furthermore,
low-molecular weight compounds that directly inhibit HCV proteins
and interfere with viral replication are considered as attractive
strategies to control HCV infection. NS3/4A serine protease,
ribonucleic acid (RNA) helicase, RNA-dependent RNA polymerase are
considered as potential targets for new drugs..sup.7,8
[0025] Devos, et al..sup.9 describes purine and pyrimidine
nucleoside derivatives and their use as inhibitors of HCV RNA
replication. Sommadossi, et al..sup.10 describes 1', 2' or
3'-modified nucleosides and their use for treating a host infected
with HCV. Carroll, et al..sup.11,12, describes nucleosides as
inhibitors of RNA-dependent RNA viral polymerase.
[0026] Recently, Roberts, et al..sup.13,14 disclosed that certain
7-(2'-substituted-.beta.-D-ribofuranosyl)-4-amino-5-(optionally
substituted ethyn-1-yl)-pyrrolo[2,3-d]pyrimidine compounds possess
potent activity against HCV. These references are incorporated
herein by reference in their entirety.
SUMMARY OF THE INVENTION
[0027] This invention is directed to novel compounds that are
useful in the treatment of viral infections in mammals mediated at
least in part by a virus in the flaviviridae family of viruses.
Specifically this invention is directed to compounds of Formula I
##STR1## wherein [0028] Y is selected from the group consisting of
a bond, --CH.sub.2-- or --O--; [0029] each of W, W.sup.1 and
W.sup.2 is independently selected from the group consisting of
hydrogen and a pharmaceutically acceptable prodrug; and [0030] T is
selected from the group consisting of [0031] a) --C.ident.C--R,
where R is selected from the group consisting of [0032] i)
tri(C.sub.1-C.sub.4)alkylsilyl, --C(O)NR.sup.1R.sup.2, alkoxyalkyl,
heteroaryl, substituted heteroaryl, phenyl, and phenyl substituted
with 1 to 3 substituents selected from the group consisting of
alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl,
substituted alkynyl, alkoxy, substituted alkoxy, acyl, acylamino,
acyloxy, aminoacyl, amidino, amino, substituted amino, carboxyl,
carboxyl ester, cyano, cycloalkyl, substituted cycloalkyl,
cycloalkoxy, substituted cycloalkoxy, guanidino, halo, heteroaryl,
substituted heteroaryl, hydrazino, hydroxyl, nitro, thiol, and
--S(O).sub.mR.sup.3; [0033] where R.sup.1 and R.sup.2 are
independently selected from the group consisting of hydrogen,
alkyl, substituted alkyl, amino, substituted amino, aryl,
substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic
and substituted heterocyclic provided that only one of R.sup.1 and
R.sup.2 is amino or substituted amino, and further wherein R.sup.1
and R.sup.2, together with the nitrogen atom pendant thereto, form
a heterocyclic or substituted heterocyclic; [0034] R.sup.3 is
selected from the group consisting of alkyl, substituted alkyl,
amino, substituted amino, aryl, substituted aryl, heteroaryl,
substituted heteroaryl, heterocyclic and substituted heterocyclic;
and [0035] m is an integer equal to 0, 1 or 2; [0036] ii)
--C(O)OR.sup.14, where R.sup.14 is hydrogen, alkyl or substituted
alkyl; [0037] b) --CH.dbd.CH-Q.sup.2, where Q.sup.2 is selected
from hydrogen or cis-alkoxy; [0038] c) --C(O)H; [0039] d)
--CH.dbd.NNHR.sup.15, where R.sup.15 is H or alkyl; [0040] e)
--CH.dbd.N(OR.sup.15), where R.sup.15 is as defined above; [0041]
f) --CH(OR.sup.16).sub.2, where R.sub.16 is (C.sub.3-C.sub.6)alkyl;
and [0042] g) --B(OR.sup.15).sub.2, where R.sup.15 is as defined
above; and pharmaceutically acceptable salts or partial salts
thereof.
[0043] In one preferred embodiment T is --C.ident.C--R and R is
selected from the group consisting of
tri(C.sub.1-C.sub.4)alkylsilyl, --C(O)NR.sup.1R.sup.2, alkoxyalkyl,
heteroaryl, substituted heteroaryl, phenyl, and phenyl substituted
with 1 to 3 substituents selected from the group consisting of
alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl,
substituted alkynyl, alkoxy, substituted alkoxy, acyl, acylamino,
acyloxy, aminoacyl, amidino, amino, substituted amino, carboxyl,
carboxyl ester, cyano, cycloalkyl, substituted cycloalkyl,
cycloalkoxy, substituted cycloalkoxy, guanidino, halo, heteroaryl,
substituted heteroaryl, hydrazino, hydroxyl, nitro, thiol, and
--S(O).sub.mR.sup.3; [0044] where R.sup.1 and R.sup.2 are
independently selected from the group consisting of hydrogen,
alkyl, substituted alkyl, amino, substituted amino, aryl,
substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic
and substituted heterocyclic provided that only one of R.sup.1 and
R.sup.2 is amino or substituted amino, and further wherein R.sup.1
and R.sup.2, together with the nitrogen atom pendant thereto, form
a heterocyclic or substituted heterocyclic; [0045] R.sup.3 is
selected from the group consisting of alkyl, substituted alkyl,
amino, substituted amino, aryl, substituted aryl, heteroaryl,
substituted heteroaryl, heterocyclic and substituted heterocyclic;
and [0046] m is an integer equal to 0, 1 or 2; [0047] or a
pharmaceutically acceptable salt thereof. [0048] More preferably, R
is selected from the group consisting of phenyl, --C(O)NH.sub.2,
--Si(CH.sub.3).sub.3, pyrid-2-yl, 4-methoxyphenyl, and
--CH(OCH.sub.2CH.sub.3).sub.2.
[0049] In another preferred embodiment T is --C.ident.C--R and R is
--C(O)OH.
[0050] In another preferred embodiment T is --C.ident.C--R, R is
--C(O)OR.sup.14, and R.sup.14 is alkyl.
[0051] In another preferred embodiment T is --CH.dbd.CH-Q.sup.2,
where Q.sup.2 is selected from hydrogen or cis-methoxy.
[0052] In another preferred embodiment T is --C(.dbd.O)H.
[0053] In another preferred embodiment T is --CH.dbd.NNHR.sup.15
where R.sup.15 is independently selected from the group consisting
of hydrogen and alkyl.
[0054] In another preferred embodiment T is --CH.dbd.N(OR.sup.15)
where R.sup.15 is independently selected from the group consisting
of hydrogen and alkyl.
[0055] In another preferred embodiment T is --CH(OR.sup.16).sub.2
where R.sup.16 is independently (C.sub.3-C.sub.6)alkyl.
[0056] In another preferred embodiment T is --B(OR.sup.15).sub.2,
where R.sup.15 is independently selected from the group consisting
of hydrogen and alkyl.
[0057] In another preferred embodiment each of W, W.sup.1, and
W.sup.2 is independently hydrogen or a pharmaceutically acceptable
prodrug selected from the group consisting of acyl, oxyacyl,
phosphonate, phosphate esters, phosphate, phosphonamidate,
phosphorodiamidate, phosphoramidate monoester, cyclic
phosphoramidate, cyclic phosphorodiamidate, phosphoramidate
diester, and --C(O)CHR.sup.30NH.sub.2 where R.sup.30 is selected
from the group consisting of hydrogen, alkyl, substituted alkyl,
aryl, substituted aryl, heteroaryl and substituted heteroaryl.
Preferably R.sup.30 is a sidechain of an amino acid and more
preferably is derived from an L-amino acid.
[0058] Preferably, W is H, or W.sup.1 is H, or W.sup.2 is H. More
preferably, W and W.sup.1 are H, or W and W.sup.2 are H, or W.sup.1
and W are H. Even more prefereably, W, W.sup.1 and W.sup.2 are
H.
[0059] In still another preferred embodiment W.sup.1 and W.sup.2
are hydrogen and W is hydrogen or a pharmaceutically acceptable
prodrug selected from the group consisting of acyl, oxyacyl,
phosphonate, phosphate esters, phosphate, phosphonamidate,
phosphorodiamidate, phosphoramidate monoester, cyclic
phosphoramidate, cyclic phosphorodiamidate, phosphoramidate
diester, and --C(O)CHR.sup.30NH.sub.2.
[0060] In one particularly preferred embodiment, W.sup.1 and
W.sup.2 are hydrogen and W is represented by the formula: ##STR2##
where R.sup.30 is as defined above, R.sup.8 is hydrogen or alkyl
and R.sup.10 is selected from the group consisting of alkyl,
substutituted alkyl, aryl, substituted aryl, cycloalkyl,
substituted cycloalkyl, heteroaryl, substituted heteroaryl,
heterocyclic and substituted heterocyclic. In a preferred
embodiment R.sup.30 is derived from an L-amino acid.
[0061] In another particularly preferred embodiment, W and W.sup.2
are hydrogen and W.sup.1 is represented by the formula:
##STR3##
[0062] where R.sup.30 is as defined above. As before, R.sup.30 is
preferably derived from an L amino acid. TABLE-US-00001 TABLE I #
Structure Name 101 ##STR4##
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-(2'-trimethylsilylethyn-1-yl)- pyrrolo[2,3-d]pyrimidine 102
##STR5## 7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-[2-(pyrid-2-yl)ethyn-1-yl]- pyrrolo[2,3-d]pyrimidine 103
##STR6## 7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-[2-(pyrid-4-yl)ethyn-1-yl]- pyrrolo[2,3-d]pyrimidine 104
##STR7## 7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-(2-(4-methoxyphenyl)ethyn-1- yl)-pyrrolo[2,3-d]pyrimidine
105 ##STR8## 7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-(2-carboxamidoethyn-1-yl)- pyrrolo[2,3-d]pyrimidine 106
##STR9## 7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-[(3,3-diethyl)proparg-1-yl]- pyrrolo[2,3-d]pyrimidine 107
##STR10## 7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-[(N,N-dimethyl-2- carboxamido)ethyn-1-yl]-pyrrolo[2,3-
d]pyrimidine 108 ##STR11##
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4- amino-5-[(N-amino-2-
carboxamido)ethyn-1-yl]-pyrrolo[2,3- d]pyrimidine 109 ##STR12##
7-(2'-C-methyl-5'-phospho-.beta.-D- ribofuranosyl)-4-amino-5-(2'-
trimethylsilylethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 110 ##STR13##
7-(2'-C-methyl-5'-phospho-.beta.-D-
ribofuranosyl)-4-amino-5-[2-(pyrid-2-
yl)ethyn-1-yl]-pyrrolo[2,3-d]pyrimidine 111 ##STR14##
7-(2'-C-methyl-5'-phospho-.beta.-D-
ribofuranosyl)-4-amino-5-[2-(pyrid-4-
yl)ethyn-1-yl]-pyrrolo[2,3-d]pyrimidine 112 ##STR15##
7-(2'-C-methyl-5'-phospho-.beta.-D- ribofuranosyl)-4-amino-5-(2-(4-
methoxyphenyl)ethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 113 ##STR16##
7-(2'-C-methyl-5'-phospho-.beta.-D- ribofuranosyl)-4-amino-5-(2-
carboxamidoethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 114 ##STR17##
7-(2'-C-methyl-5'-phospho-.beta.-D- ribofuranosyl)-4-amino-5-[(3,3-
diethoxy)proparg-1-yl]-pyrrolo[2,3- d]pyrimidine 115 ##STR18##
7-(2'-C-methyl-5'-phospho-.beta.-D-
ribofuranosyl)-4-amino-5-[2-(N,N- dimethylcarboxamido)ethyn-1-yl]-
pyrrolo[2,3-d]pyrimidine 116 ##STR19##
7-(2'-C-methyl-5'-phospho-.beta.-D- ribofuranosyl)-4-amino-5-[2-(N-
aminocarboxamido)ethyn-1-yl]- pyrrolo[2,3-d]pyrimidine 117
##STR20## 7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2'-
trimethylsilylethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 118 ##STR21##
7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-[2-(pyrid-2-
yl)ethyn-1-yl]-pyrrolo[2,3-d]pyrimidine 119 ##STR22##
7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-[2-(pyrid-4-
yl)ethyn-1-yl]-pyrrolo[2,3-d]pyrimidine 120 ##STR23##
7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2-(4-
methoxyphenyl)ethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 121 ##STR24##
7-(2'-C-methyl-5'-diphospho-.beta.-D- ribofuranosyl)-4-amino-5-(2-
carboxamidoethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 122 ##STR25##
7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-[(3,3- diethoxy)proparg-1-yl]-pyrrolo[2,3-
d]pyrimidine 123 ##STR26## 7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-[(N,N- dimethyl-2-carboxamido)ethyn-1-yl]-
pyrrolo[2,3-d]pyrimidine 124 ##STR27##
7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-[(N-amino-2-
carboxamido)ethyn-1-yl]-pyrrolo[2,3- d]pyrimidine 125 ##STR28##
7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2'-
trimethylsilylethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 126 ##STR29##
7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-[2-(pyrid-2-
yl)ethyn-1-yl)-pyrrolo[2,3-d]pyrimidine 127 ##STR30##
7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-[2-(pyrid-2-
yl)ethyn-1-yl)-pyrrolo[2,3-d]pyrimidine 128 ##STR31##
7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2-(4-
methoxyphenyl)ethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 129 ##STR32##
7-(2'-C-methyl-5'-triphospho-.beta.-D- ribofuranosyl)-4-amino-5-(2-
carboxamidoethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 130 ##STR33##
7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-[(3,3- diethoxy)proparg-1-yl]-pyrrolo[2,3-
d]pyrimidine 131 ##STR34## 7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-[(N,N- dimethylcarboxylamido)ethyn-1-yl]-
pyrrolo[2,3-d]pyrimidine 132 ##STR35##
7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-[(N- aminocarboxylamido)ethyn-1-yl]-
pyrrolo[2,3-d]pyrimidine 133 ##STR36##
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-(2-carboxyethyn-1-yl)- pyrrolo[2,3-d]pyrimidine 134
##STR37## 7-(2'-C-methyl-5'-phospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2- carboxyethyn-1-yl)-pyrrolo[2,3-
d]pyrimidine 135 ##STR38## 7-(2'-C-methyl-5'-phospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2- carboxyethyn-1-yl)-pyrrolo[2,3-
d]pyrimidine 136 ##STR39## 7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2- carboxyethyn-1-yl)-pyrrolo[2,3-
d]pyrimidine 137 ##STR40##
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4- amino-5-[(ethyl
2-carboxyl)ethyn-1-yl]- pyrrolo[2,3-d]pyrimidine 138 ##STR41##
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4- amino-5-[(methyl
2-carboxyl)ethyn-1- yl]-pyrrolo[2,3-d]pyrimidine 139 ##STR42##
7-(2'-C-methyl-5'-phospho-.beta.-D-
ribofuranosyl)-4-amino-5-[(ethyl 2-
carboxyl)ethyn-1-yl]-pyrrolo[2,3- d]pyrimidine 140 ##STR43##
7-(2'-C-methyl-5'-phospho-.beta.-D-
ribofuranosyl)-4-amino-5-[(methyl 2-
carboxyl)ethyn-1-yl]-pyrrolo[2,3- d]pyrimidine 141 ##STR44##
7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-[(ethyl 2-
carboxyl)ethyn-1-yl]-pyrrolo[2,3- d]pyrimidine 142 ##STR45##
7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-[(methyl 2-
carboxyl)ethyn-1-yl]-pyrrolo[2,3- d]pyrimidine 143 ##STR46##
7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-[(ethyl 2-
carboxyl)ethyn-1-yl]-pyrrolo[2,3- d]pyrimidine 144 ##STR47##
7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-[(methyl 2-
carboxyl)ethyn-1-yl]-pyrrolo[2,3- d]pyrimidine 145 ##STR48##
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-(2-phenylethyn-1-yl)- pyrrolo[2,3-d]pyrimidine 146
##STR49## 7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-(2-(4-fluorophenyl)ethyn-1-yl)- pyrrolo[2,3-d]pyrimidine
147 ##STR50## 7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-(2-(4-methylphenyl)ethyn-1- yl)-pyrrolo[2,3-d]pyrimidine
148 ##STR51## 7-(2'-C-methyl-5'-phospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2- phenylethyn-1-yl)-pyrrolo[2,3-
d]pyrimidine 149 ##STR52## 7-(2'-C-methyl-5'-phospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2-(4-
fluorophenyl)ethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 150 ##STR53##
7-(2'-C-methyl-5'-phospho-.beta.-D- ribofuranosyl)-4-amino-5-(2-(4-
methylphenyl)ethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 151 ##STR54##
7-(2'-C-methyl-5'-diphospho-.beta.-D- ribofuranosyl)-4-amino-5-(2-
phenylethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 152 ##STR55##
7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2-(4-
fluorophenyl)ethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 153 ##STR56##
7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2-(4-
methylphenyl)ethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 154 ##STR57##
7-(2'-C-methyl-5'-triphospho-.beta.-D- ribofuranosyl)-4-amino-5-(2-
phenylethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 155 ##STR58##
7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2-(4-
fluorophenyl)ethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 156 ##STR59##
7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2-(4-
methylphenyl)ethyn-1-yl)-pyrrolo[2,3- d]pyrimidine 157 ##STR60##
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-(ethen-1-yl)-pyrrolo[2,3- d]pyrimidine 158 ##STR61##
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-(2-cis-methoxy-ethen-1-yl)- pyrrolo[2,3-d]pyrimidine 159
##STR62## 7-(2'-C-methyl-5'-monophospho-.beta.-D-
ribofuranosyl)-4-amino-5-(ethen-1-yl)- pyrrolo[2,3-d]pyrimidine 160
##STR63## 7-(2'-C-methyl-5'-monophospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2-cis- methoxy-ethen-1-yl)-pyrrolo[2,3-
d]pyrimidine 161 ##STR64## 7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(ethen-1-yl)- pyrrolo[2,3-d]pyrimidine 162
##STR65## 7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2-cis- methoxy-ethen-1-yl)-pyrrolo[2,3-
d]pyrimidine 163 ##STR66## 7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(ethen-1-yl)- pyrrolo[2,3-d]pyrimidine 164
##STR67## 7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(2-cis- methoxy-ethen-1-yl)-pyrrolo[2,3-
d]pyrimidine 165 ##STR68##
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-(formyl)-pyrrolo[2,3- d]pyrimidine 166 ##STR69##
7-(2'-C-methyl-5'-phospho-.beta.-D-
ribofuranosyl)-4-amino-5-(formyl)- pyrrolo[2,3-d]pyrimidine 167
##STR70## 7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(formyl)- pyrrolo[2,3-d]pyrimidine
168 ##STR71## 7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(formyl)- pyrrolo[2,3-d]pyrimidine 169
##STR72## 7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-(hydrazono)-pyrrolo[2,3- d]pyrimidine 170 ##STR73##
7-(2'-C-methyl-5'-phospho-.beta.-D-
ribofuranosyl)-4-amino-5-(hydrazono)- pyrrolo[2,3-d]pyrimidine 171
##STR74## 7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(hydrazono)- pyrrolo[2,3-d]pyrimidine 172
##STR75## 7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(hydrazono)- pyrrolo[2,3-d]pyrimidine 173
##STR76## 7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-(carbaldehyde oxime)- pyrrolo[2,3-d]pyrimidine 174
##STR77## 7-(2'-C-methyl-5'-phospho-.beta.-D-
ribofuranosyl)-4-amino-5-(carbaldehyde
oxime)-pyrrolo[2,3-d]pyrimidine 175 ##STR78##
7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(carbaldehyde
oxime)-pyrrolo[2,3-d]pyrimidine 176 ##STR79##
7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(carbaldehyde
oxime)-pyrrolo[2,3-d]pyrimidine 177 ##STR80##
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-
amino-5-(diisopropoxymethyl)- pyrrolo[2,3-d]pyrimidine 178
##STR81## 7-(2'-C-methyl-5'-monophospho-.beta.-D-
ribofuranosyl)-4-amino-5- (diisopropoxymethyl)-pyrrolo[2,3-
d]pyrimidine 179 ##STR82## 7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5- (diisopropoxymethyl)-pyrrolo[2,3-
d]pyrimidine 180 ##STR83## 7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5- (diisopropoxymethyl)-pyrrolo[2,3-
d]pyrimidine 181 ##STR84##
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4- amino-5-(boronic
acid)-pyrrolo[2,3- d]pyrimidine 182 ##STR85##
7-(2'-C-methyl-5'-phospho-.beta.-D-
ribofuranosyl)-4-amino-5-(boronic acid)- pyrrolo[2,3-d]pyrimidine
183 ##STR86## 7-(2'-C-methyl-5'-diphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(boronic acid)-pyrrolo[2,3-d]pyrimidine
184 ##STR87## 7-(2'-C-methyl-5'-triphospho-.beta.-D-
ribofuranosyl)-4-amino-5-(boronic
acid)-pyrrolo[2,3-d]pyrimidine
[0063] Compounds of this invention are either active as antiviral
agents or are useful as intermediates in the preparation of
antiviral agents as described herein.
[0064] This invention is also directed to pharmaceutical
compositions comprising a pharmaceutically acceptable diluent and a
therapeutically effective amount of a compound as described herein
or mixtures of one or more of such compounds.
[0065] This invention is still further directed to methods for
treating a viral infection mediated at least in part by a virus in
the flaviviridae family of viruses, such as HCV, in mammals which
methods comprise administering to a mammal, that has been diagnosed
with said viral infection or is at risk of developing said viral
infection, a pharmaceutical composition comprising a
pharmaceutically acceptable diluent and a therapeutically effective
amount of a compound as described herein or mixtures of one or more
of such compounds.
[0066] In yet another embodiment of the invention, methods of
treating or preventing viral infections in mammals are provided
where in the compounds of this invention are administered in
combination with the administration of a therapeutically effective
amount of one or more agents active against HCV. Active agents
against HCV include ribavirin, levovirin, viramidine, thymosin
alpha-1, an inhibitor of NS3 serine protease, and inhibitor of
inosine monophosphate dehydrogenase, interferon-alpha, pegylated
interferon-alpha, alone or in combination with ribavirin or
levovirin. Preferably the additional agent active against HCV is
interferon-alpha or pegylated interferon-alpha alone or in
combination with ribavirin or levovirin.
DETAILED DESCRIPTION OF THE INVENTION
[0067] The invention is directed to compounds, compositions and
methods for treating flaviviridae viruses, such as hepatitis C
virus infections. However, prior to describing this invention in
detail, the following terms will first be defined:
Definitions
[0068] As used herein, the term "alkyl" refers to alkyl groups
having from 1 to 6 carbon atoms, preferably 1 to 3, and more
preferably 1 to 2 carbon atoms. This term is exemplified by groups
such as methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl,
n-pentyl and the like.
[0069] "Substituted alkyl" refers to an alkyl group having from 1
to 3, and preferably 1 to 2, substituents selected from the group
consisting of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy,
oxyacyl, amino, substituted amino, aminoacyl, aryl, substituted
aryl, aryloxy, substituted aryloxy, cyano, halogen, hydroxyl,
nitro, carboxyl, carboxyl esters, cycloalkyl, substituted
cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, and
substituted heterocyclic.
[0070] "Alkoxy" refers to the group "alkyl-O--" which includes, by
way of example, methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy,
t-butoxy, sec-butoxy, n-pentoxy and the like.
[0071] "Substituted alkoxy" refers to the group "substituted
alkyl-O--".
[0072] "Alkoxyalkyl" refers to the groups -alkylene(alkoxy).sub.n
-alkylene(substituted alkoxy).sub.n where alkylene is a divalent
straight or branched chain alkylene group of from 1 to 3 carbon
atoms, alkoxy and substituted alkoxy is as defined herein and n is
an integer from 1 to 2.
[0073] "Acyl" refers to the groups alkyl-C(O)--, substituted
alkyl-C(O)--, alkenyl-C(O)--, substituted alkenyl-C(O)--,
alkynyl-C(O)--, substituted alkynyl-C(O)-- cycloalkyl-C(O)--,
substituted cycloalkyl-C(O)--, aryl-C(O)--, substituted
aryl-C(O)--, heteroaryl-C(O)--, substituted heteroaryl-C(O),
heterocyclic-C(O)--, and substituted heterocyclic-C(O)--.
[0074] "Acylamino" refers to the group --C(O)NR.sup.4R.sup.4 where
each R.sup.4 is independently selected from the group consisting of
hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl,
alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl,
substituted cycloalkyl, heteroaryl, substituted heteroaryl,
heterocyclic, substituted heterocyclic and where each R.sup.4 is
joined to form together with the nitrogen atom a heterocyclic or
substituted heterocyclic ring.
[0075] "Acyloxy" refers to the groups alkyl-C(O)O--, substituted
alkyl-C(O)O--, alkenyl-C(O)O--, substituted alkenyl-C(O)O--,
alkynyl-C(O)O--, substituted alkynyl-C(O)O--, aryl-C(O)O--,
substituted aryl-C(O)O--, cycloalkyl-C(O)O--, substituted
cycloalkyl-C(O)O--, heteroaryl-C(O)O--, substituted
heteroaryl-C(O)O--, heterocyclic-C(O)O--, and substituted
heterocyclic-C(O)O--.
[0076] "Oxyacyl" refers to the groups alkyl-OC(O)--, substituted
alkyl-OC(O)--, alkenyl-OC(O)--, substituted alkenyl-OC(O)--,
alkynyl-OC(O)--, substituted alkynyl-OC(O)--, aryl-OC(O)--,
substituted aryl-OC(O)--, cycloalkyl-OC(O)--, substituted
cycloalkyl-OC(O)--, heteroaryl-OC(O)--, substituted
heteroaryl-OC(O)--, heterocyclic-OC(O)--, and substituted
heterocyclic-OC(O)--.
[0077] "Alkenyl" refers to alkenyl group preferably having from 2
to 6 carbon atoms and more preferably 2 to 4 carbon atoms and
having at least 1 and preferably from 1-2 sites of alkenyl
unsaturation. Such groups are exemplified by vinyl (ethen-1-yl),
allyl, but-3-en-1-yl, and the like.
[0078] "Substituted alkenyl" refers to alkenyl groups having from 1
to 3 substituents, and preferably 1 to 2 substituents, selected
from the group consisting of alkoxy, substituted alkoxy, acyl,
acylamino, acyloxy, amino, substituted amino, aminoacyl, aryl,
substituted aryl, aryloxy, substituted aryloxy, cyano, halogen,
hydroxyl, nitro, carboxyl, carboxyl esters, cycloalkyl, substituted
cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, and
substituted heterocyclic with the proviso that any hydroxyl
substitution is not attached to a vinyl (unsaturated) carbon atom.
Preferred substituted alkenyl groups are selected from, but not
limit to, 2,2-difluoroethen-1-yl, 2-methoxyethen-1-yl, and the
like.
[0079] It is understood that the term "substituted alkenyl"
includes both E (cis) and Z (trans) isomers as appropriate. The
isomers can be pure isomeric compounds or mixtures of E and Z
components.
[0080] "Alkynyl" refers to an unsaturated hydrocarbon having at
least 1 site of alkynyl unsaturation and having from 2 to 6 carbon
atoms and more preferably 2 to 4 carbon atoms. Preferred alkynyl
groups are selected from but not limit to ethyn-1-yl, propyn-1-yl,
propyn-2-yl, 1-methylprop-2-yn-1-yl, butyn-1-yl, butyn-2-yl,
butyn-3-yl, and the like.
[0081] "Substituted alkynyl" refers to alkynyl groups having from 1
to 3 substituents, and preferably 1 to 2 substituents, selected
from the group consisting of alkoxy, substituted alkoxy, acyl,
acylamino, acyloxy, amino, substituted amino, aminoacyl, aryl,
substituted aryl, aryloxy, substituted aryloxy, cyano, halogen,
hydroxyl, nitro, carboxyl, carboxyl esters, cycloalkyl, substituted
cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, and
substituted heterocyclic. Preferred substituted alkynyl groups are
selected from but not limit to 2-fluoroethyn-1-yl,
3,3,3-trifluoropropyn-1-yl, 3-aminopropyn-1-yl,
3-hydroxypropyn-1-yl, and the like.
[0082] "Amino" refers to the group --NH.sub.2.
[0083] "Substituted amino" refers to the group --NR'R'' where R'
and R'' are independently selected from the group consisting of
hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl,
alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl,
substituted cycloalkyl, heteroaryl, substituted heteroaryl,
heterocyclic, substituted heterocyclic and where R' and R'' are
joined, together with the nitrogen bound thereto to form a
heterocyclic or substituted heterocyclic group provided that R' and
R'' are both not hydrogen. When R' is hydrogen and R'' is alkyl,
the substituted amino group is sometimes referred to herein as
alkylamino. When R' and R'' are alkyl, the substituted amino group
is sometimes referred to herein as dialkylamino.
[0084] "Amidino" refers to the group
--C(.dbd.NR.sup.11)NR.sup.11R.sup.11 where each R.sup.11 is
independently selected from hydrogen or alkyl.
[0085] "Aminoacyl" refers to the groups --NR.sup.5C(O)alkyl,
--NR.sup.5C(O)substituted alkyl, --NR.sup.5C(O)cycloalkyl,
--NR.sup.5C(O)substituted cycloalkyl, --NR.sup.5C(O)alkenyl,
--NR.sup.5C(O)substituted alkenyl, --NR.sup.5C(O)alkynyl,
--NR.sup.5C(O)substituted alkynyl, --NR.sup.5C(O)aryl,
--NR.sup.5C(O)substituted aryl, --NR.sup.5C(O)heteroaryl,
--NR.sup.5C(O)substituted heteroaryl, --NR.sup.5C(O)heterocyclic,
and --NR.sup.5C(O)substituted heterocyclic where R.sup.5 is
hydrogen or alkyl.
[0086] "Aryl" or "Ar" refers to a monovalent aromatic carbocyclic
group of from 6 to 14 carbon atoms having a single ring (e.g.,
phenyl) or multiple condensed rings (e.g., naphthyl or anthryl)
which condensed rings may or may not be aromatic (e.g.,
2-benzoxazolinone, 2H-1,4-benzoxazin-3(4H)-one-7-yl, and the like)
provided that the point of attachment is at an aromatic carbon
atom. Preferred aryls include phenyl and naphthyl.
[0087] "Substituted aryl", including "substituted phenyl" refers to
aryl groups or phenyl groups which are substituted with from 1 to 3
substituents, and preferably 1 to 2 substituents, selected from the
group consisting of hydroxyl, acyl, acylamino, acyloxy, alkyl,
substituted alkyl, alkoxy, substituted alkoxy, alkenyl, substituted
alkenyl, alkynyl, substituted alkynyl, amino, substituted amino,
aminoacyl, aryl, substituted aryl, aryloxy, substituted aryloxy,
cycloalkoxy, substituted cycloalkoxy, carboxyl, carboxyl esters,
cyano, thiol, thioalkyl, substituted thioalkyl, thioaryl,
substituted thioaryl, thioheteroaryl, substituted thioheteroaryl,
thiocycloalkyl, substituted thiocycloalkyl, thioheterocyclic,
substituted thioheterocyclic, cycloalkyl, substituted cycloalkyl,
halo, nitro, heteroaryl, substituted heteroaryl, heterocyclic,
substituted heterocyclic, heteroaryloxy, substituted heteroaryloxy,
heterocyclyloxy, and substituted heterocyclyloxy.
[0088] "Aryloxy" refers to the group aryl-O-- that includes, by way
of example, phenoxy, naphthoxy, and the like.
[0089] "Substituted aryloxy" refers to substituted aryl-O--
groups.
[0090] "Carboxyl" refers to --COOH or salts thereof.
[0091] "Carboxyl esters" refers to the groups --C(O)O-alkyl,
--C(O)O-substituted alkyl, --C(O)Oaryl, and --C(O)O-substituted
aryl wherein alkyl, substituted alkyl, aryl and substituted aryl
are as defined herein.
[0092] "Cycloalkyl" refers to cyclic alkyl groups of from 3 to 10
carbon atoms having single or multiple cyclic rings including, by
way of example, adamantyl, cyclopropyl, cyclobutyl, cyclopentyl,
cyclooctyl and the like.
[0093] "Substituted cycloalkyl" refers to a cycloalkyl having from
1 to 5 substituents selected from the group consisting of oxo
(.dbd.O), thioxo (.dbd.S), alkyl, substituted alkyl, alkoxy,
substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted
amino, aminoacyl, aryl, substituted aryl, aryloxy, substituted
aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl, carboxyl
esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted
heteroaryl, heterocyclic, and substituted heterocyclic.
[0094] "Cycloalkoxy" refers to --O-cycloalkyl groups.
[0095] "Substituted cycloalkoxy" refers to --O-substituted
cycloalkyl groups.
[0096] "Formyl" refers to the group --C(O)H.
[0097] "Guanidino" refers to the group
--NR.sup.12C(.dbd.NR.sup.12)NR.sup.2R.sup.12 where each R.sup.12 is
independently hydrogen or alkyl.
[0098] "Halo" or "halogen" refers to fluoro, chloro, bromo and iodo
and preferably is fluoro or chloro.
[0099] "Heteroaryl" refers to an aromatic group of from 1 to 10
carbon atoms and 1 to 4 heteroatoms selected from the group
consisting of oxygen, nitrogen, and sulfur within the ring wherein
the nitrogen and/or sulfur is optionally oxidized [(N.fwdarw.O),
--S(O)--, or --SO.sub.2--]. Such heteroaryl groups can have a
single ring (e.g., pyridyl or furyl) or multiple condensed rings
(e.g., indolizinyl or benzothienyl) wherein the condensed rings may
or may not be aromatic and/or contain a heteroatom provided that
the point of attachment is through an aromatic ring atom. Preferred
heteroaryls include pyridyl, pyrrolyl, indolyl, thiophenyl, and
furyl.
[0100] "Substituted heteroaryl" refers to heteroaryl groups that
are substituted with from 1 to 3 substituents selected from the
same group of substituents defined for substituted aryl.
[0101] "Heteroaryloxy" refers to the group --O-heteroaryl and
"substituted heteroaryloxy" refers to the group --O-substituted
heteroaryl.
[0102] "Heterocycle" or "heterocyclic" or "heterocycloalkyl" refers
to a saturated or unsaturated group (but not heteroaryl) having a
single ring or multiple condensed rings, from 1 to 10 carbon atoms
and from 1 to 4 hetero atoms selected from the group consisting of
nitrogen, oxygen and sulfur within the ring wherein the nitrogen
and/or sulfur atoms can be optionally oxidized [(N.fwdarw.O),
--S(O)-- or --SO.sub.2--]. and further wherein, in fused ring
systems, one or more the rings can be cycloalkyl, aryl or
heteroaryl provided that the point of attachment is through the
heterocyclic ring.
[0103] "Substituted heterocyclic" or "substituted heterocycloalkyl"
refers to heterocycle groups that are substituted with from 1 to 3
of the same substituents as defined for substituted cycloalkyl.
[0104] Examples of heterocycles and heteroaryls include, but are
not limited to, azetidine, pyrrole, imidazole, pyrazole, pyridine,
pyrazine, pyrimidine, pyridazine, indolizine, isoindole, indole,
dihydroindole, indazole, purine, quinolizine, isoquinoline,
quinoline, phthalazine, naphthylpyridine, quinoxaline, quinazoline,
cinnoline, pteridine, carbazole, carboline, phenanthridine,
acridine, phenanthroline, isothiazole, phenazine, isoxazole,
phenoxazine, phenothiazine, imidazolidine, imidazoline, piperidine,
piperazine, indoline, phthalimide, 1,2,3,4-tetrahydroisoquinoline,
4,5,6,7-tetrahydrobenzo[b]thiophene, thiazole, thiazolidine,
thiophene, benzo[b]thiophene, morpholinyl, thiomorpholinyl (also
referred to as thiamorpholinyl), piperidinyl, pyrrolidine,
tetrahydrofuranyl, and the like.
[0105] "Heterocyclyloxy" refers to the group --O-heterocyclic and
"substituted heterocyclyloxy" refers to the group --O-substituted
heterocyclic.
[0106] "Hydrazino" refers to the group --NR.sup.13NR.sup.13R.sup.13
wherein each R.sup.13 is independently selected from the group
consisting of hydrogen or alkyl.
[0107] "Phosphate" refers to the groups --OP(O)(OH).sub.2
(monophosphate or phospho), --OP(O)(OH)OP(O)(OH).sub.2 (diphosphate
or diphospho) and --OP(O)(OH)OP(O)(OH)OP(O)(OH).sub.2 (triphosphate
or triphospho) or salts thereof including partial salts thereof. It
is understood, of course, that the initial oxygen of the mono-, di-
and triphosphate (phospho, diphospho and triphospho) includes the
oxygen atom at the 5-position of the ribose sugar.
[0108] "Phosphate esters" refers to the mono-, di- and
tri-phosphate groups described above wherein one or more of the
hydroxyl groups is replaced by an alkoxy group.
[0109] "Phosphonate" refers to the groups --OP(O)(R.sup.6)(OH) or
--OP(O)(R.sup.6)(OR.sup.6) or salts thereof including partial salts
thereof, wherein each R.sup.6 is independently selected from
hydrogen, alkyl, substituted alkyl, carboxylic acid, and carboxyl
ester. It is understood, of course, that the initial oxygen of the
phosphonate includes the oxygen atom at the 5-position of the
ribose sugar.
[0110] "Phosphorodiamidate" refers to the group: ##STR88## where
each R.sup.7 may be the same or different and each is hydrogen,
alkyl, substituted alkyl, cycloalkyl, or substituted cycloalkyl. A
particularly preferred phosphorodiamidate is the following group:
##STR89##
[0111] "Phosphoramidate monoester" refers to the group below, where
R.sup.30 is as defined above, R.sup.8 is hydrogen or alkyl. In a
preferred embodiment R.sup.30 is derived from an L-amino acid
##STR90##
[0112] "Phosphoramidate diester" refers to the group below, where
R.sup.30 is as defined above, R.sup.8 is hydrogen or alkyl and
R.sup.10 is selected from the group consisting of alkyl,
substutituted alkyl, aryl, substituted aryl, cycloalkyl,
substituted cycloalkyl, heteroaryl, substituted heteroaryl,
heterocyclic and substituted heterocyclic. In a preferred
embodiment R.sup.30 is derived from an L-amino acid. ##STR91##
[0113] "Cyclic phosphoramidate" refers to the group below, where n
is 1 to 3, more preferably n is 1 to 2. ##STR92##
[0114] "Cyclic phosphorodiamidate" refers to the group below, where
n is 1 to 3, more preferably n is 1 to 2. ##STR93##
[0115] "Phosphonamidate" refers to the group below, where R.sup.14
is hydrogen, alkyl, substituted alkyl, cycloalkyl, or substituted
cycloalkyl. ##STR94##
[0116] "Thiol" refers to the group --SH.
[0117] "Thioalkyl" or "alkylthioether" or "thioalkoxy" refers to
the group --S-alkyl.
[0118] "Substituted thioalkyl" or "substituted alkylthioether" or
"substituted thioalkoxy" refers to the group --S-substituted
alkyl.
[0119] "Thiocycloalkyl" refers to the groups --S-cycloalkyl and
"substituted thiocycloalkyl" refers to the group --S-substituted
cycloalkyl.
[0120] "Thioaryl" refers to the group --S-aryl and "substituted
thioaryl" refers to the group --S-substituted aryl.
[0121] "Thioheteroaryl" refers to the group --S-heteroaryl and
"substituted thioheteroaryl" refers to the group --S-substituted
heteroaryl.
[0122] "Thioheterocyclic" refers to the group --S-heterocyclic and
"substituted thioheterocyclic" refers to the group --S-substituted
heterocyclic.
[0123] The term "amino acid sidechain" refers to the R.sup.30
substituent of .alpha.-amino acids of the formula
NH.sub.2CH(R.sup.30)COOH where R.sup.30 is selected from the group
consisting of hydrogen, alkyl, substituted alkyl, aryl and
substituted aryl. Preferably, the .alpha.-amino acid sidechain is
the sidechain one of the twenty naturally occurring L amino
acids.
[0124] The term "pharmaceutically acceptable prodrugs" refers to
art recognized modifications to one or more functional groups which
functional groups are metabolized in vivo to provide a compound of
this invention or an active metabolite thereof. Such functional
groups are well known in the art including acyl groups for hydroxyl
and/or amino substitution, esters of mono-, di- and tri-phosphates
wherein one or more of the pendent hydroxyl groups have been
converted to an alkoxy, a substituted alkoxy, an aryloxy or a
substituted aryloxy group, and the like.
[0125] The term "pharmaceutically acceptable salt" refers to
pharmaceutically acceptable salts of a compound, which salts are
derived from a variety of organic and inorganic counter ions well
known in the art and include, by way of example only, sodium,
potassium, calcium, magnesium, ammonium, tetraalkylammonium, and
the like; and when the molecule contains a basic functionality,
salts of organic or inorganic acids, such as hydrochloride,
hydrobromide, tartrate, mesylate, acetate, maleate, oxalate and the
like.
[0126] The term "pharmaceutically acceptable partial salts" refers
to compounds having a substituent capable of having more than one
group form a salt but less than the maximum amount of such groups
actually form a salt. For example, a diphospho group can form a
plurality of salts and, if only partially ionized, the resulting
group is sometimes referred to herein as a partial salt.
[0127] It is understood that in all substituted groups defined
above, polymers arrived at by defining substituents with further
substituents to themselves (e.g., substituted aryl having a
substituted aryl group as a substituent which is itself substituted
with a substituted aryl group, etc.) are not intended for inclusion
herein. In such cases, the maximum number of such substituents is
three. That is to say that each of the above definitions is
constrained by a limitation that, for example, substituted aryl
groups are limited to -substituted aryl-(substituted
aryl)-substituted aryl.
[0128] Similarly, it is understood that the above definitions are
not intended to include impermissible substitution patterns (e.g.,
methyl substituted with 5 fluoro groups or a hydroxyl group alpha
to ethenylic or acetylenic unsaturation). Such impermissible
substitution patterns are well known to the skilled artisan.
General Synthetic Methods
[0129] The compounds of this invention can be prepared from readily
available starting materials using the following general methods
and procedures. It will be appreciated that where typical or
preferred process conditions (i.e., reaction temperatures, times,
mole ratios of reactants, solvents, pressures, etc.) are given,
other process conditions can also be used unless otherwise stated.
Optimum reaction conditions may vary with the particular reactants
or solvent used, but such conditions can be determined by one
skilled in the art by routine optimization procedures.
[0130] Additionally, as will be apparent to those skilled in the
art, conventional protecting groups may be necessary to prevent
certain functional groups from undergoing undesired reactions.
Suitable protecting groups for various functional groups as well as
suitable conditions for protecting and deprotecting particular
functional groups are well known in the art. For example, numerous
protecting groups are described in T. W. Greene and G. M. Wuts,
Protecting Groups in Organic Synthesis, Third Edition, Wiley, New
York, 1999, and references cited therein.
[0131] Furthermore, the compounds of this invention contain one or
more chiral centers. Accordingly, if desired, such compounds can be
prepared or isolated as pure stereoisomers, i.e., as individual
enantiomers or diastereomers, or as stereoisomer-enriched mixtures.
All such stereoisomers (and enriched mixtures) are included within
the scope of this invention, unless otherwise indicated. Pure
stereoisomers (or enriched mixtures) may be prepared using, for
example, optically active starting materials or stereoselective
reagents well-known in the art. Alternatively, racemic mixtures of
such compounds can be separated using, for example, chiral column
chromatography, chiral resolving agents and the like.
[0132] The starting materials for the following reactions are
generally known compounds or can be prepared by known procedures or
obvious modifications thereof. For example, many of the starting
materials are available from commercial suppliers such as Aldrich
Chemical Co. (Milwaukee, Wis., USA), Bachem (Torrance, Calif.,
USA), Emka-Chemce or Sigma (St. Louis, Mo., USA). Others may be
prepared by procedures, or obvious modifications thereof, described
in standard reference texts such as Fieser and Fieser's Reagents
for Organic Synthesis, Volumes 1-15 (John Wiley and Sons, 1991),
Rodd's Chemistry of Carbon Compounds, Volumes 1-5 and Supplementals
(Elsevier Science Publishers, 1989), Organic Reactions, Volumes
1-40 (John Wiley and Sons, 1991), March's Advanced Organic
Chemistry, (John Wiley and Sons, 4.sup.th Edition), and Larock's
Comprehensive Organic Transformations (VCH Publishers Inc., 1989).
Specifically, the compounds of this invention may be prepared by
various methods known in the art of organic chemistry in general
and nucleoside and nucleotide analogue synthesis in particular.
General reviews of the preparation of nucleoside and nucleotide
analogues include 1) Michelson A. M. "The Chemistry of Nucleosides
and Nucleotides," Academic Press, New York, 1963; 2) Goodman L.
"Basic Principles in Nucleic Acid Chemistry," Academic Press, New
York, 1974, vol. 1, Ch. 2; and 3) "Synthetic Procedures in Nucleic
Acid Chemistry," Eds. Zorbach W. & Tipson R., Wiley, New York,
1973, vol. 1 & 2.
[0133] The synthesis of the compounds of this invention generally
follows either a convergent or linear synthetic pathway as
described below.
[0134] The strategies available for synthesis of compounds of this
invention include for example:
General Synthesis of 2'-C-Branched Nucleosides
[0135] 2'-C-Branched ribonucleosides of Formula I: ##STR95##
[0136] where T, Y, W, W.sup.1, and W.sup.2 are as defined above,
can be prepared by one of the following general methods.
Convergent Approach: Glycosylation of Nucleobase with Appropriately
Modified Sugar
[0137] The key starting material of this process is an
appropriately substituted sugar with 2'-OH and 2'-H with the
appropriate leaving group, for example, an acyl group or a chloro,
bromo, fluoro or iodo group at the 1-position. The sugar can be
purchased or can be prepared by any known means including standard
epimerization, substitution, oxidation and/or reduction techniques.
For example, commercially available
1,3,5-tri-O-benzoyl-.alpha.-D-ribofuranose (Pfanstiel Laboratories,
Inc.) can be used. The substituted sugar can then be oxidized with
the appropriate oxidizing agent in a compatible solvent at a
suitable temperature to yield the 2'-modified sugar. Possible
oxidizing agents are, for example, Dess-Martin periodine reagent,
Ac.sub.2O+DCC in DMSO, Swern oxidation (DMSO, oxalyl chloride,
triethylamine), Jones reagent (a mixture of chromic acid and
sulfuric acid), Collins's reagent (dipyridine Cr(VI) oxide, Corey's
reagent (pyridinium chlorochromate), pyridinium dichromate, acid
dichromate, potassium permanganate, MnO.sub.2, ruthenium
tetraoxide, phase transfer catalysts such as chromic acid or
permanganate supported on a polymer, Cl.sub.2-pyridine,
H.sub.2O.sub.2-ammonium molybdate, NaBrO.sub.2-CAN, NaOCl in HOAc,
copper chromite, copper oxide, Raney nickel, palladium acetate,
Meerwin-Pondorf-Verley reagent (aluminum t-butoxide with another
ketone) and N-bromosuccinimide.
[0138] Coupling of an organometallic carbon nucleophile, such as a
Grignard reagent, an organolithium, lithium dialkylcopper or
SiMe.sub.4 in TBAF with the ketone with the appropriate non-protic
solvent at a suitable temperature, yields the 2'-methyl sugar. For
example, CH.sub.3MgBr/TiCl.sub.4 or CH.sub.3MgBr/CeCl.sub.3 can be
used as described in Wolfe et al. 1997. J. Org. Chem. 62:
1754-1759. The methylated sugar can be optionally protected with a
suitable protecting group, preferably with an acyl, substituted
alkyl or silyl group, by methods well known to those skilled in the
art, as taught by Greene et al. Protective Groups in Organic
Synthesis, John Wiley and Sons, Second Edition, 1991.
[0139] The optionally protected sugar can then be coupled to the
purine base by methods well known to those skilled in the art, as
taught by Townsend Chemistry of Nucleosides and Nucleotides, Plenum
Press, 1994. For example, an acylated sugar can be coupled to a
silylated base with a Lewis acid, such as tin tetrachloride,
titanium tetrachloride or trimethylsilyltriflate in the appropriate
solvent at a suitable temperature. Alternatively, a halo-sugar can
be coupled to a silylated base with the presence of
trimethylsilyltriflate.
[0140] In addition to the above, the 2'-C-substituted sugars used
in the synthetic methods described herein are well known in the art
and are described, for example, by Sommadossi, et al..sup.10 and by
Carrol, et al..sup.11,12 all of which are incorporated herein by
reference in their entirety.
[0141] Scheme 1 below describes the alternative synthesis of a
protected sugar that is useful for coupling to the bases described
herein. ##STR96##
[0142] Formation of sugar a in Scheme 1, above, is accomplished as
described by Mandal, S. B., et al., Synth. Commun., 1993, 9, page
1239, starting from commercial D-ribose. Protection of the hydroxyl
groups to form sugar b is described in Witty, D. R., et al., Tet.
Lett., 1990, 31, page 4787. Sugar c and d are prepared using the
method of Ning, J. et al., Carbohydr. Res., 2001, 330, page 165,
and methods described herein. Sugar e is prepared by using a
modification of the Grignard reaction with CH.sub.3MgBr or other
appropriate organometallic as described herein (with no
titanium/cerium needed). Finally the halogenated sugar (X=halo)
used in the subsequent coupling reaction is prepared using the same
protection method as used in to make sugar b above. The
halogenation is described in Seela, U.S. Pat. No. 6,211,158.
[0143] Subsequently, any of the described nucleosides can be
deprotected by methods well known to those skilled in the art, as
taught by Greene et al. Protective Groups in Organic Synthesis, Jon
Wiley and Sons, Second Edition, 1991.
[0144] An alternative approach to making protected sugars useful
for coupling to heterocyclic bases is detailed in Scheme 2 below.
##STR97##
[0145] In Scheme 2, methylation of the hydroxyl group of compound 1
proceeds via conventional methodology to provide for compound 2.
The 2, 3 and 5 hydroxyl groups of the compound 2 are each protected
with 2,4-dichlorobenzyl groups to provide for compound 3. Selective
deprotection of the 2-(2',4'-dichlorobenzyl) group on compound 3
proceeds via contact with stannous chloride in a suitable solvent
such as methylene chloride, chloroform, and the like at reduced
temperatures, e.g., .about.0 to 5.degree. C., until reaction
completion, e. 24-72 hours. Oxidation of the 2-hydroxyl group
proceeds as described herein to provide for compound 7. Methylation
also proceeds as described herein to provide for compound 8.
Linear Approach: Modification of a Pre-formed Nucleoside
[0146] The key starting material for this process is an
appropriately substituted nucleoside with a 2'-OH and 2'-H. The
nucleoside can be purchased or can be prepared by any known means
including standard coupling techniques. The nucleoside can be
optionally protected with suitable protecting groups, preferably
with acyl, substituted alkyl or silyl groups, by methods well known
to those skilled in the art, as taught by Greene et al. Protective
Groups in Organic Synthesis, John Wiley and Sons, Second Edition,
1991.
[0147] The appropriately protected nucleoside can then be oxidized
with the appropriate oxidizing agent in a compatible solvent at a
suitable temperature to yield the 2'-modified sugar. Possible
oxidizing agents are, for example, Dess-Martin periodine reagent,
Ac.sub.2O+DCC in DMSO, Swern oxidation (DMSO, oxalyl chloride,
triethylamine), Jones reagent (a mixture of chromic acid and
sulfuric acid), Collins's reagent (dipyridine Cr(VI) oxide, Corey's
reagent (pyridinium chlorochromate), pyridinium dichromate, acid
dichromate, potassium permanganate, MnO.sub.2 ruthenium tetroxide,
phase transfer catalysts such as chromic acid or permanganate
supported on a polymer, Cl.sub.2-pyridine, H.sub.2O.sub.2-ammonium
molybdate, NaBrO.sub.2-CAN, NaOCl in HOAc, copper chromite, copper
oxide, Raney nickel, palladium acetate, Meerwin-Pondorf-Verley
reagent (aluminum t-butoxide with another ketone) and
N-bromosuccinimide.
[0148] Coupling of an organometallic carbon nucleophile, such as a
Grignard reagent, an organolithium, lithium dialkylcopper or
CH.sub.3SiMe.sub.3 in TBAF with the ketone with the appropriate
non-protic solvent at a suitable temperature, yields the alkyl
substituted nucleoside. Isolation of the appropriate isomer is
conducted as needed.
[0149] Subsequently, the nucleoside can be deprotected by methods
well known to those skilled in the art, as taught by Greene et al.
Protective Groups in Organic Synthesis, John Wiley and Sons, Second
Edition, 1991.
[0150] In one embodiment of the invention, the D-enantiomers are
preferred. However, L-enantiomers are also contemplated to be
useful herein. The L-enantiomers corresponding to the compounds of
the invention can be prepared following the same foregoing general
methods, beginning with the corresponding L-sugar or nucleoside as
starting material. In a particular embodiment, the 2'-C-branched
ribonucleoside is desired.
[0151] The compounds of this invention may be prepared by various
methods known in the art of organic chemistry in general and
nucleoside and nucleotide analogue synthesis in particular. The
starting materials for the syntheses are either readily available
from commercial sources or are known or may be prepared by
techniques known in the art. General reviews of the preparation of
nucleoside and nucleotide analogues are included in the following:
[0152] Michelson A. M. "The Chemistry of Nucleosides and
Nucleotides," Academic Press, New York, 1963. [0153] Goodman L.
"Basic Principles in Nucleic Acid Chemistry," Academic Press, New
York, 1974, vol. 1, Ch. 2. [0154] "Synthetic Procedures in Nucleic
Acid Chemistry," Eds. Zorbach W. & Tipson R., Wiley, New York,
1973, vol. 1 & 2.
[0155] The 5-substituted acetylenyl-pyrrolo[2,3-d]pyrimidinyl
nucleoside derivatives of the present invention can be synthesized
using the methods depicted in Scheme 3 below.
[0156] A convergent approach for preparing the
pyrrolo[2,3-d]pyrimidinyl nucleosides is shown in Scheme 3 below.
First commercially available 4-chloropyrrolo[2,3-d]pyrimidine 11 is
halogenated at the 5-position (compound 12) using well known
methods, for example, the halogenation method described in A.
Gangjee et al., J. Med. Chem. (2003) 46, 591. Intermediate compound
12 may be isolated and purified using standard techniques such as
chromatography, precipitation, crystallization, filtration, and the
like. Alternatively, compound 12 may be isolated and used in the
next step without further purification.
[0157] 5-(Substituted alkynyl)-4-chloropyrrolo[2,3-d]pyrimidine 13
is prepared using Sonigashira conditions as described in A. Gangjee
et al., (J. Med. Chem. (2003) 46, 591) to yield compound 13.
Intermediate compound 13 may be isolated and purified using
standard techniques such as chromatography, precipitation,
crystallization, filtration, and the like. Alternatively compound
13 may be isolated and used in the next step without further
purification.
[0158] Compound 13 is coupled to protected 2-methyl substituted
sugar 8 (the synthesis of which is described above and by Carroll,
et al.,.sup.11,12) using conditions well known in the art. For
example,
1-O-methyl-3,5-bis-O-(2,4-dichlorophenylmethyl)-2'-C-methyl-.beta.-D-ribo-
furanoside 8 is dissolved in a dry inert solvent, such as
dichloromethane, chloroform, carbon tetrachloride and the like, and
then the solution is cooled to about 0.degree. C. Afterwards, an
excess of HBr or other appropriate reagent, in acetic acid, is
added drop wise. This reaction is run for typically at about
0.degree. C. for about 1 hour or at ambient temperature for about
2.5 hours or until substantially complete as determined by
conventional techniques such as tlc. The resulting brominated sugar
mixture is isolated and purified using standard techniques such as
chromatography, precipitation, crystallization, filtration, and the
like. Alternatively this intermediate may be isolated and used in
the next step without further purification. The resulting
brominated sugar mixture is co-evaporated, preferably with dry
toluene, dissolved in a suitable inert diluent such as dry
acetonitrile and stirred with the sodium salt of compound 13 at
room temperature over night. The sodium salt of compound 13 is
prepared in an inert atmosphere by suspending compound 13 in a dry
inert solvent such as, acetonitrile and the like, with NaH
dispersed in oil. The reaction is run for about 2 to about 24 hours
at a temperature of about 0 to about 40.degree. C. Finally compound
15 is isolated and purified using standard techniques such as
chromatography, precipitation, crystallization, filtration, and the
like. Alternatively, this intermediate may be isolated and used in
the next step without further purification.
[0159] Deprotection of compound 15 using standard methods affords
compound 16, which is, in some cases, converted to the 4-amino
derivative (compound 17) using methods well known in the art. For
example, compound 16 is added to liquid ammonia at about
-80.degree. C. and is warmed to about 80.degree. C. for about 24 to
about 48 hours. Compound 17 is isolated and purified using standard
techniques such as chromatography, precipitation, crystallization,
filtration, and the like. ##STR98##
[0160] In an alternative approach, the 1-[5-(substituted
alkynyl)-4-aminopyrrolo[2,3-d]pyrimidine]-2'-C-methyl-.beta.-D-ribofurano-
side compounds can be prepared using the method illustrated in
Scheme 4 below.
[0161] Compound 12, prepared as described above is coupled to the
protected sugar 8, using the techniques described for the
preparation of compound 15 in Scheme 3 above to provide for
compound 19. Deprotection of compound 19, using standard methods,
provides compound 20.
[0162] From compound 20, the 1-[5-(substituted
alkynyl)-4-amino-pyrrolo[2,3-d]pyrimidine]-2'-C-methyl-.beta.-D-ribofuran-
oside compounds can be prepared by first converting the 4-chloro
group to an amino group, using the technique described for the
preparation of compound 17 from compound 16 in scheme 3 above to
provide for compound 21, followed by coupling using Sonigashira
conditions as described in A. Gangjee et al., (J. Med. Chem. (2003)
46, 591) to form the substituted alkynyl derivative, compound
17.
[0163] In some cases the 1-[5-(substituted
alkynyl)-4-amino-pyrrolo[2,3-d]pyrimidine]-2'-C-methyl-.beta.-D-ribofuran-
oside compounds can be prepared from compound 20 by first
converting the 5-iodo group to the the 5-substituted alkynyl
derivative (compound 16), followed by conversion of the 4-chloro
group to the amine (compound 17). The methods for each of these
transformations are detailed above. ##STR99##
[0164] Preparation of compounds where W, W.sup.1 or W.sup.2 is
other than hydrogen, using the compounds prepared in Schemes 3 and
4 above as the starting materials, can be accomplished using the
methods described in the following reviews of prodrug preparation:
[0165] 1) Cooperwood, J. S. et al., "Nucleoside and Nucleotide
prodrugs," in Ed(s) Chu, C. K. Recent Advances in Nucleosides
(2002), 92-147. [0166] 2) Zemlicka, J. et al., Biochimica et
Biophysica Acta (2002), 158(2-3), 276-286. [0167] 3) Wagner, C. et
al., Medicinal Research Reviews (2002), 20(6), 417-451. [0168] 4)
Meier, C. et al., Synlett (1998), (3), 233-242.
[0169] For example, conversion of the 5'-hydroxyl group of the
1-[5-(substituted
alkynyl)-4-amino-pyrrolo[2,3-d]pyrimidine]-2'-C-methyl-.beta.-D-ribofuran-
oside compounds to a phospho, diphospho or triphospho-analog can
prepared using the methods describe in D. W. Hutchinson, (Ed. Leroy
b. Townsend) "The Synthesis, reaction and Properties of Nucleoside
Mono-, Di-, Tri-, and tertaphosphate and Nucleosides with Changes
in the Phosphoryl Residue," Chemistry of Nucleosides and
Nucleotides, Plenum Press, (1991) 2.
[0170] The preparation of amino acid esters on the ribofuranoside
can be accomplished as shown in Scheme 5 below: ##STR100##
[0171] The desired Boc-protected amino acid and
N,N'-carbonyldiimidazole are dissolved in an inert solvent such as
THF. The reaction mixture is held between about 20 and about
40.degree. C. for about 0.5 to 24 hours. A solution containing an
slight excess of the desired nucleoside in an inert solvent such as
DMF, is added to the Boc-protected amino acid mixture and is heated
at about 40 to about 80.degree. C. for about 2 to about 24 hours. A
mixture of structural isomers is isolated and separated using
conventional techniques such as evaporation, precipitation,
filtration, crystallization, chromatography and the like.
[0172] The desired ester is then acidified using, for example, 1:1
v/v TFA/DCM solution for about 0. 1 to about 1 hour about 20 and
about 40.degree. C. and evaporated. The residue is dissolved in
water and held at about 0 to about 30.degree. C. for about 2 to
about 24 hours. The mixture can be separated and the desired
product isolated by RP-HPLC using standard techniques and
conditions.
[0173] While the scheme above demonstrates the production of
deazapurine prodrugs, this process can be used on any desired
nucleoside compound. Likewise, the amino acid may be protected with
any protective group appropriate to the reaction conditions. These
protective groups are well known in the art. ##STR101## where T is
as defined above.
[0174] Compound 1 is dissolved in a dry solvent, such as pyridine,
and a silylhalide, such as tert-butylchlorodiphenylsilane, is added
to form a protecting group at the 5'-position on the sugar. Any
protecting group which can be directed to the 5'-position and can
be removed orthongally to the final desired 3'-ester can be used.
This reaction is run for about 4 to 24 hours at a temperature of
about 10 to 40.degree. C. The desired acyl chloride is added to the
protected nucleoside, compound 30, and stirred for about 4 to about
24 hours to form compound 31. Which can be isolated and purified
using standard techniques such as isolation, crystallization,
extraction, filtration, chromatography and the like. Compound 32 is
prepared by removing the protecting group at the 5'-position. This
can be accomplished by reacting Compound 30 with a 1M solution of
tetrabutylammonium fluoride in THF. The final product is isolated
and purified using standard techniques such as isolation,
crystallization, extraction, filtration, chromatography and the
like.
[0175] While the scheme above demonstrates the production of
deazapurine prodrugs, this process can be used on any desired
nucleoside compound
Utility, Testing, and Administration
Utility
[0176] The present invention provides novel compounds possessing
antiviral activity, including hepatitis C virus. The compounds of
this invention inhibit viral replication by inhibiting the enzymes
involved in replication, including RNA dependent RNA polymerase.
They may also inhibit other enzymes utilized in the activity or
proliferation of viruses in the flaviviridae family, such as
HCV.
[0177] The compounds of the present invention can also be used as
prodrug nucleosides. As such they are taken up into the cells and
can be intracellularly phosphorylated by kinases to the
triphosphate and are then inhibitors of the polymerase (NS5b)
and/or act as chain-terminators.
[0178] Compounds of this invention may be used alone or in
combination with other compounds to treat viruses.
Administration and Pharmaceutical Composition
[0179] In general, the compounds of this invention will be
administered in a therapeutically effective amount by any of the
accepted modes of administration for agents that serve similar
utilities. The actual amount of the compound of this invention,
i.e., the active ingredient, will depend upon numerous factors such
as the severity of the disease to be treated, the age and relative
health of the subject, the potency of the compound used, the route
and form of administration, and other factors. The drug can be
administered more than once a day, preferably once or twice a
day.
[0180] Therapeutically effective amounts of compounds of Formula I
may range from approximately 0.05 to 50 mg per kilogram body weight
of the recipient per day; preferably about 0.01-25 mg/kg/day, more
preferably from about 0.5 to 10 mg/kg/day. Thus, for administration
to a 70 kg person, the dosage range would most preferably be about
35-70 mg per day.
[0181] In general, compounds of this invention will be administered
as pharmaceutical compositions by any one of the following routes:
oral, systemic (e.g., transdermal, intranasal or by suppository),
or parenteral (e.g., intramuscular, intravenous or subcutaneous)
administration. The preferred manner of administration is oral
using a convenient daily dosage regimen that can be adjusted
according to the degree of affliction. Compositions can take the
form of tablets, pills, capsules, semisolids, powders, sustained
release formulations, solutions, suspensions, elixirs, aerosols, or
any other appropriate compositions. Another preferred manner for
administering compounds of this invention is inhalation. This is an
effective method for delivering a therapeutic agent directly to the
respiratory tract (see U.S. Pat. No. 5,607,915).
[0182] The choice of formulation depends on various factors such as
the mode of drug administration and bioavailability of the drug
substance. For delivery via inhalation the compound can be
formulated as liquid solution, suspensions, aerosol propellants or
dry powder and loaded into a suitable dispenser for administration.
There are several types of pharmaceutical inhalation
devices-nebulizer inhalers, metered dose inhalers (MDI) and dry
powder inhalers (DPI). Nebulizer devices produce a stream of high
velocity air that causes the therapeutic agents (which are
formulated in a liquid form) to spray as a mist that is carried
into the patient's respiratory tract. MDI's typically are
formulation packaged with a compressed gas. Upon actuation, the
device discharges a measured amount of therapeutic agent by
compressed gas, thus affording a reliable method of administering a
set amount of agent. DPI dispenses therapeutic agents in the form
of a free flowing powder that can be dispersed in the patient's
inspiratory air-stream during breathing by the device. In order to
achieve a free flowing powder, the therapeutic agent is formulated
with an excipient such as lactose. A measured amount of the
therapeutic agent is stored in a capsule form and is dispensed with
each actuation.
[0183] Recently, pharmaceutical formulations have been developed
especially for drugs that show poor bioavailability based upon the
principle that bioavailability can be increased by increasing the
surface area i.e., decreasing particle size. For example, U.S. Pat.
No. 4,107,288 describes a pharmaceutical formulation having
particles in the size range from 10 to 1,000 nm in which the active
material is supported on a crosslinked matrix of macromolecules.
U.S. Pat. No. 5,145,684 describes the production of a
pharmaceutical formulation in which the drug substance is
pulverized to nanoparticles (average particle size of 400 nm) in
the presence of a surface modifier and then dispersed in a liquid
medium to give a pharmaceutical formulation that exhibits
remarkably high bioavailability.
[0184] The compositions are comprised of in general, a compound of
Formula I in combination with at least one pharmaceutically
acceptable excipient. Acceptable excipients are non-toxic, aid
administration, and do not adversely affect the therapeutic benefit
of the compound of Formula T. Such excipient may be any solid,
liquid, semi-solid or, in the case of an aerosol composition,
gaseous excipient that is generally available to one of skill in
the art.
[0185] Solid pharmaceutical excipients include starch, cellulose,
talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, magnesium stearate, sodium stearate, glycerol
monostearate, sodium chloride, dried skim milk and the like. Liquid
and semisolid excipients may be selected from glycerol, propylene
glycol, water, ethanol and various oils, including those of
petroleum, animal, vegetable or synthetic origin, e.g., peanut oil,
soybean oil, mineral oil, sesame oil, etc. Preferred liquid
carriers, particularly for injectable solutions, include water,
saline, aqueous dextrose, and glycols.
[0186] Compressed gases may be used to disperse a compound of this
invention in aerosol form. Inert gases suitable for this purpose
are nitrogen, carbon dioxide, etc. Other suitable pharmaceutical
excipients and their formulations are described in Remington's
Pharmaceutical Sciences, edited by E. W. Martin (Mack Publishing
Company, 18th ed., 1990).
[0187] The amount of the compound in a formulation can vary within
the full range employed by those skilled in the art. Typically, the
formulation will contain, on a weight percent (wt %) basis, from
about 0.01-99.99 wt % of a compound of Formula I based on the total
formulation, with the balance being one or more suitable
pharmaceutical excipients. Preferably, the compound is present at a
level of about 1-80 wt %. Representative pharmaceutical
formulations containing a compound of Formula I are described
below.
[0188] Additionally, the present invention is directed to a
pharmaceutical composition comprising a therapeutically effective
amount of a compound of the present invention in combination with a
therapeutically effective amount of another active agent against
RNA-dependent RNA virus and, in particular, against HCV. Agents
active against HCV include, but are not limited to, ribavirin,
levovirin, viramidine, thymosin alpha-1, an inhibitor of HCV NS3
serine protease, interferon-.alpha., pegylated interferon-.alpha.
(peginterferon-.alpha.), a combination of interferon-.alpha. and
ribavirin, a combination of peginterferon-.alpha. and ribavirin, a
combination of interferon-.alpha. and levovirin, and a combination
of peginterferon-.alpha. and levovirin. Interferon-.alpha.
includes, but is not limited to, recombinant interferon-.alpha.2a
(such as Roferon interferon available from Hoffman-LaRoche, Nutley,
N.J.), interferon-.alpha.2b (such as Intron-A interferon available
from Schering Corp., Kenilworth, N.J., USA), a consensus
interferon, and a purified interferon-.alpha. product. For a
discussion of ribavirin and its activity against HCV, see J. O.
Saunders and S. A. Raybuck, "Inosine Monophosphate Dehydrogenase:
Consideration of Structure, Kinetics and Therapeutic Potential,"
Ann. Rep. Med. Chem., 35:201-210 (2000).
EXAMPLES
[0189] The examples below as well as throughout the application,
the following abbreviations have the following meanings. If not
defined, the terms have their generally accepted meanings. [0190]
AcOH or HOAc=acetic acid [0191] Ac.sub.2O=acetic anhydride [0192]
Ar=aryl hydrogen [0193] atm=atmosphere [0194] Boc=t-butoxycarbonyl
[0195] bs=broad singlet [0196] CAN=ceric ammonium nitrate [0197]
cm=centimeter [0198] d=doublet [0199] con=concentration [0200]
DCM=dichloromethane [0201] dd=doublet of doublets [0202]
DMF=Dimethylformamide [0203] dt=doublet of triplets [0204]
DBU=1,8-diazabicyclo[5.4.0]undec-7-ene [0205]
DCB=2,4-dichlorobenzyl [0206] DCC=dicyclohexylcarbodiimide [0207]
DMEM=Delbecco's minimum eagles medium [0208] DMSO=Dimethylsulfoxide
[0209] DTT=Dithiothreitol [0210] EDTA=ethylene diamine tetraacetic
acid [0211] eq. or eq=Equivalents [0212] g=Gram [0213] h or hr=Hour
[0214] HCV=hepatitis C virus [0215] HPLC=high performance liquid
chromatography [0216] IPTG=Isopropyl
.beta.-D-1-thiogalactopyranoside [0217] IU=international units
[0218] kb=Kilobase [0219] kg=Kilogram [0220] KOAc=potassium acetate
[0221] L=Liters [0222] M=Multiplet [0223] M=Molar [0224] Me=Methyl
[0225] MeOH=Methanol [0226] min=Minute [0227] mg=Milligram [0228]
mL=Milliliter [0229] mm=Millimeters [0230] mM=millimolar [0231]
mmol=millimol [0232] MS=mass spectrum [0233] ng=nanograms [0234]
N=Normal [0235] nm=nanometers [0236] nM=nanomolar [0237]
NMR=nuclear magnetic resonance [0238] NTA=nitrilotriacetic acid
[0239] NTP=nucleotide triphosphate [0240] RP HPLC=reverse phase
high performance liquid chromatography [0241] q=Quartet [0242]
s=Singlet [0243] t=Triplet [0244] TBAF=Tetrabutyl ammonium fluoride
[0245] TEA=Triethylamine [0246] TFA=trifluoroacetic acid [0247]
THF=Tetrahydrofuran [0248] tlc or TLC=thin layer chromatography
[0249] T.sub.m=Melting temperature [0250] UTP=uridine triphosphate
[0251] .mu.L=microliters [0252] .mu.g=micrograms [0253]
.mu.M=micromolar [0254] v/v=volume to volume [0255] w/w=weight to
weight [0256] Wt %=weight percent
[0257] In addition, all reaction and melting temperatures are in
degrees Celsius unless reported otherwise.
[0258] In the examples below as well as elsewhere throughout this
application, the claimed compounds employ the following numbering
system: ##STR102##
Example 1
Preparation of the intermediate
1-O-methyl-2-methyl-3,5-bis-O-(2,4-dichlorobenzyl)-.beta.-D-ribofuranose
[0259] ##STR103## Step 1: Preparation of
1-O-methyl-2,3,5-tris-O-(2,4-dichlorobenzyl)-.beta.-D-ribofuranose
[0260] The title compound is synthesized using the methods
described in Marin, P.; Helv. Chim. Acta, 1995, 78, 486 starting
with commercially available D-ribose.
Step 2: Preparation of
1-O-methyl-3,5-bis-O-(2,4-dichlorobenzyl)-.beta.-D-ribofuranose
[0261] To a solution of the product of Step 1 (171.60 g, 0.2676
mol) in 1.8 L of methylene chloride that was cooled to 0.degree.
C., was added dropwise a solution of stannous chloride (31.522 mL,
0.2676 mol) in 134 mL of methylene chloride while stirring. After
maintaining the solution at about 3.degree. C. for approximately 27
hours, another 5.031 mL of stannous chloride (SnCl.sub.4) (0.04282
mol) was added and the solution was kept at about 3.degree. C.
overnight. After a total reaction time of approximately 43 hours,
the reaction was quenched by carefully adding the solution to 1.9 L
of a saturated NaHCO.sub.3 solution. Tin salts were removed via
filtration through Celite after which the organic phase was
isolated, dried with MgSO.sub.4 and evaporated in vacuo. The yield
of raw, dark yellow oil was 173.6 g. The crude oil was used
directly in the next step without further purification.
Step 3: Preparation of
1-O-methyl-2-oxo-3,5-bis-O-(2,4-dichlorobenzyl)-.beta.-D-ribofuranose
[0262] To an ice cold solution of Dess-Martin periodinane (106.75
g, 0.2517 mol) in 740 mL anhydrous methylene chloride, under argon,
was added a solution of the product of Step 2 above in 662 mL
anhydrous methylene chloride over 0.5 hours. The reaction mixture
was stirred at 0.degree. C. for 0.5 hours and then at room
temperature for 6 days. The mixture was diluted with 1.26 L of
anhydrous diethyl ether and then poured into an ice-cold mixture of
Na.sub.2S.sub.3O.sub.3.5H.sub.2O (241.2 g, 1.5258 mol) in 4.7 L of
saturated aqueous sodium bicarbonate. The layers were separated,
and the organic layer was washed with 1.3 L of saturated aqueous
sodium bicarbonate, 1.7 L water and 1.3 L brine, dried with
MgSO.sub.4, filtered and evaporated to give the target compound.
The compound (72.38 g, 0.1507 mol) was used without further
purification in the next step.
Step 4: Preparation of the title compound
[0263] A solution of MeMgBr in 500 mL anhydrous diethyl ether
maintained at -55.degree. C. was added dropwise to a solution of
the product of step 3 above (72.38 g, 0.1507 mol) also in 502 mL of
anhydrous diethyl ether. The reaction mixture was allowed to warm
to -30.degree. C. and stirred mechanically for 4 hours at about
-30.degree. C. to -15.degree. C., then poured into 2 L ice cold
water. After stirring vigorously at ambient temperature for 0.5
hours, the mixture was filtered through a Celite pad (14.times.5
cm), which was thoroughly washed with diethyl ether. The organic
layer was dried with MgSO.sub.4, filtered and concentrated in
vacuo. The residue was dissolved in hexanes (.about.1 mL per gram
crude), applied to a silica gel column (1.5 L silica gel in
hexanes) and eluted with hexanes and 4:1 hexanes:ethyl acetate
(v/v) to give 53.58 g (0.1080 mol) of the final purified product.
The morphology of the title compound was that of an off-yellow,
viscous oil; [0264] MS: m/z 514.06 (M+NH.sub.4+).
Example 2
Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-[2-(trimethylsilyl
ethyn-1-yl]-pyrrolo[2,3-d]pyrimidine
[0265] ##STR104## Step 1.
4-Chloro-5-iodo-7H-pyrrolo[2,3-d]pyrimidine:
[0266] 4-Chloro-7H-pyrrolo[2,3-d]pyrimidine 10.75 g (70 mmol) and
N-iodosuccinimide (16.8 g, 75 mmol) were dissolved in 400 mL of dry
DMF and left at ambient temperature in the darkness over night. The
solvent was evaporated. The yiellow residue was suspended in hot
10% solution of Na.sub.2SO.sub.3, filtered, washed twice with hot
water and crystallized from ethanol to yield 14.6 g (74.6%) of the
title compound as off-white crystals. The mother liquid was
evaporated up to 1/3 volume and crystallized again from ethanol to
give 2.47 g (12.3%) of the title product. The total yield is close
to 100%;
[0267] T.sub.m 212-214.degree. C. (dec); UV .lamda..sub.max: 307,
266, 230, 227 nm (methanol); MS: 277.93 (M-H), 313 (M+Cl);
.sup.1H-NMR (DMSO-d6): 12.94 (s, 1H, NH), 8.58 (s, 1H, H-2), 7.94
(s, 1H, H-8).
Step 2.
7-(2'-methyl-3',5'-bis-O-(2,4-dichlorobenzyl)-.beta.-D-ribofuran-
osyl)-4-chloro-5-iodo-pyrrolo[2,3-d]pyrimidine:
[0268] The base, obtained as described above (11.2 g, 40 mmol) was
suspended in 500 mL of CH.sub.3CN, NaH was added (1.6 g, 40 mmol
60% in oil) and the reaction mixture was stirred at room
temperature until NaH was dissolved (about 2 hour). 1-O-Methyl
-2-methyl-3,5-bis-O-(2,4-dichlorobenzyl)-.beta.-D-ribofuranose (10
g, 20 mmol) was dissolved in 500 mL of DCM and cooled down to
4.degree. C. in ice/water bath. HBr.sub.(g) was bubbled through the
solution for about 30 min. The reaction was monitored by TLC and
run until the disappearance of the starting sugar (ether/hexane 1:9
v/v). Upon reaction completion, the solvent was evaporated at the
temperature not higher that 20.degree. C. and kept for 20 min in
deep vacuum to remove the traces of HBr. Solution of Na-salt of the
base was fast filtrated and the filtrate was added to the sugar
component. The reaction was kept overnight at ambient temperature,
neutralized with 0.1 N H.sub.2SO.sub.4 and evaporated. The residue
was distributed between 700 mL of ethyl acetate and 700 mL of
water. Organic fraction was washed with water (150 mL), brine (150
mL), dried over Na.sub.2SO.sub.4 and evaporated to give semi
crystalline mixture. Toluene (500 mL) was added to form light tan
precipitate of nonreacted heterocyclic base 2.5 g (25%). Filtrate
was concentrated up to the volume of 50 mL and loaded on the glass
filter with silica gel (10.times.10 cm). The filter was washed with
10% ethyl acetate in toluene collecting 500 mL fractions. Fraction
2-4 contained the title compound; fractions 6-7 contained the
heterocyclic base.
[0269] Fractions 2-4 were evaporated, ether was added to the
colorless oil and the mixture was sonicated for 5 min. The
off-white precipitate was formed, yield 7.4 g (50%), mother liquid
was evaporated and the described procedure was repeated to yield
0.7 g more of the title nucleoside. Total yield is 8.1 g
(54.4%);
[0270] T.sub.m: 67-70.degree. C.; .sup.1H-NMR (DMSO-d.sub.6):
.delta. 8.66 (s, 1H), 8.07 (s, 1H), 7.62-7.34 (m, 6H), 6.22 (s,
1H), 5.64 (s, 1H), 4.78-4.55 (m, 4H), 4.20 (s, 2H), 3.97-3.93 and
3.78-3.75 (dd, 1H), 0.92 (s, 3H); MS: 743.99 (M+H); Recovered base
(total): 4 g as off-white crystals; T.sub.m 228-230.degree. C.
Step 3.
7-(2'-methyl-.beta.-D-ribofuranosyl)-4-chloro-5-iodo-pyrrolo[2,3-
-d]pyrimidine:
[0271] To the solution of the compound from the previous step (8 g,
10.7 mmol) in DCM (200 mL) at -78.degree. C. was added boron
trichloride (1M in DCM, 88 mL, 88 mmol) dropwise. The mixture was
stirred at -78.degree. C. for 2.5 hours and additionally overnight
at -20.degree. C. The reaction was quenched by addition of MeOH/DCM
(90 mL, 1:1) and the resulting mixture stirred at -20.degree. C.
for 30 min, then neutralized by aqueous ammonia at the same
temperature. The solid was filtered and washed with methanol/DCM
(250 mL, 1:1). The filtrates were combined with 50 mL of silica gel
and evaporated up to dryness. Dry silica was loaded on the glass
filter with silica gel (10.times.10 cm). The filter was washed with
ethyl acetate collecting 500 mL fractions. Fraction 2-4 contained
the title compound. The solvent was evaporated and the residue
crystallized from acetone/hexane to give 3.3 g (72%) of title
nucleoside;
[0272] .sup.1H-NMR (DMSO-d.sub.6): .delta. 8.84 (s, 1H), 8.20 (s,
1H), 6.21 (s, 1H), 4.00-3.60 (m, sugar), 0.84 (s, 3H); MS: 426.26
(M+H); T.sub.m:182-185.degree. C.
Step 4.
7-(2'-methyl-.beta.-D-ribofuranosyl)-4-amino-5-iodo-pyrrolo[2,3--
d]pyrimidine:
[0273] Nucleoside (1.5 g, 3.5 mmol) prepared above was treated with
liquid ammonia at 85.degree. C. for 24 hours in the metal pressure
reactor. After evaporation of ammonia the residue was dissolved in
methanol and co-evaporated with silica gel (about 20 mL). Silica
gel bearing the product was on the column (5.times.10 cm) with
silica gel in acetone collecting 50 mL fractions. Fractions 2-8
contained the titled compound. Acetone was evaporated and the
residue crystallized from methanol/acetonitrile to give 1.2 g (84%)
of the titled nucleoside;
[0274] T.sub.m220-222.degree. C. (dec); .sup.1H-NMR (DMSO-d.sub.6):
.delta. 8.20 (s, 1H), 7.80 (s, 1H), 6.80-6.50 (bs, 1H), 6.09 (s,
1H), 5.19 (t, 1H, sugar), 5.13-5.11 (m, 2H, sugar), 4.00-3.70 (m,
3H, sugar), 3.60-3.20 (m, 1H, sugar), 0.84 (s, 3H); MS 407.32
(M+H).
Step 5.
7-(2'-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(trimethylsilanyl-
ethyn-1-yl) -pyrrolo[2,3-d]pyrimidine:
[0275] Aminonucleoside synthesized in previous step (1.7 g, 4.2
mmol) was dissolved in the mixture of 12 mL of dry DMF and 28 mL of
dry THF. Triethylamine (3.6 mmol, 0.5 mL), CuI (1 mmol, 80 mg) were
added and the flask was filled with argon.
Tetrakis(triphenylphosphine)palladium(0) (0.04 mmol, 46 mg)
followed with (trimethylsilyl)acetylene was added and the mixture
was stirred under argon for 20 hours.
[0276] The solvent was evaporated and the residue in acetone was
filtered through a silica gel (5.times.10 cm). The acetone was
evaporated, the residue was dissolved in acetonitrile and then
filtered again through the silica gel column of the same size; an
elution was made with pure acetonitrile. The acetonitrile was
concentrated up to small volume, about 10 volumes of ether were
added and the solution was sonicated for 5 min. White crystals of
the titled compound were formed, yield 0.8 g (71%);
[0277] T.sub.m 188-191.degree. C. (decompose); .sup.1H-NMR
(DMSO-d.sub.6): .delta. 8.17 (s, 1H), 7.92 (s, 1H), 7.20-6.80 (t,
1.2H), 5.83 (s, 1H), 3.75-3.20 (m, sugar), 0.45 (s, 3H), 0 (s,
9H).
Example 3
Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-[2-(pyrid-2-yl)ethyn-1
yl]-pyrrolo[2,3-d]pyrimidine
[0278] ##STR105##
[0279] To a solution of the compound from Step 4, Example 2 in DMF
(0.05M) is added 1.0 equivalent TEA, 0.4 eq CuI, 6.0 equivalents
2-ethynyl-pyridine. This mixture is degassed with argon and 10 mole
% of P(Ph.sub.3).sub.4Pd is added and the reaction stirred for 24
hours between 25-80.degree. C. The reaction mixture is then
concentrated in vacuo, taken up in DMF and purified by RP HPLC on
PHenominex column (250.times.20 mm) using gradient of acetonitrile
in water from 0 to 80% over 30 min at 10 mL/min.
Example 4
Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(2-carboxamidoethyn-1yl)-
-pyrrolo[2,3-d]pyrimidine
[0280] ##STR106##
[0281] To a solution of the product from Example 8 (20 mg, 0.053
mmol) was added 1.0 mL concentrated ammonia solution (30% aqueous
solution) and stirred at room temp for 1 hour. The resulting
precipitate was filtered and dried via co-evaporation with ethanol
to yield 15 mg (80%) of the title compound;
[0282] .sup.1H-NMR (DMSO-d.sub.6): .delta. 8.26 (bs, 1H), 8.16 (s,
1H), 8.14 (s, 1H), 7.56 (bs, 1H), 7.2-6.4(bs, 2H), 6.11 (s, 1H),
5.26-5.14 (m, 3H), 3.9-3.6 (m, 4H, sugar), 0.69 (s, 3H); MS 348.10
(M+H).
Example 5
Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-[3,3-diethoxyproparg-1-y-
l)-pyrrolo[2,3-d]pyrimidine
[0283] ##STR107##
[0284] To a solution of compound from Step 4, Example 2 (100 mg,
0.246 mmol) in 6.5 mL THF-DMF (3:1 v/v) was added CuI (18.2 mg,
0.096 mmol), TEA (32 .mu.L, 0.23 mmol), propiolaldehyde diethyl
acetal (0.05 mL, 0.36 mmol). The mixture was degassed with argon
and P(Ph.sub.3).sub.4Pd (28 mg, 0.024 mmol) was added and the
reaction was stirred at room temperature for 3.5 hours. A second
charge of propiolaldehyde diethyl acetal (0.05 mL) was added and
the reaction was allowed to stir at room temperature overnight. The
reaction was then concentrated in vacuo and purified on silica gel
(plated on gel with 100% CH.sub.2Cl.sub.2, eluded with 15%
MeOH-CH.sub.2Cl.sub.2) to yield 60 mg (60%) of the title
compound;
[0285] .sup.1H-NMR (CD.sub.3OD): .delta. 8.11 (s, 1H), 7.90 (s,
1H), 6.22 (s, 1H), 4.2-3.6 (m, 4H, sugar), 3.8-3.6 (m, 4H), 1.26
(t, 6H), 0.84 (s, 3H); MS 407.22 (M+H).
Example 6
Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-[2-(4-methoxyphenyl)ethy-
n-1yl]-pyrrolo[2,3-d]pyrimidine
[0286] ##STR108##
[0287] To a solution of the compound from Step 4, Example 2 in DMF
is added 1.0 equivalent TEA, 0.4 eq CuI, 6.0 equivalents
1-ethynyl-4-methoxy-benzene. This mixture is degassed with argon
and 10 mole % of P(Ph.sub.3).sub.4Pd is added and the reaction
stirred for 24 hours between 25-80.degree. C. The reaction mixture
is then concentrated in vacuo, taken up in DMF and purified by RP
HPLC on PHenominex column (250.times.20 mm) using gradient of
acetonitrile in water from 0 to 80% over 30min at 10 mL/min.
Example 7
Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(2-phenylethyn-1yl)-pyrr-
olo[2,3-d]pyrimidine
[0288] ##STR109##
[0289] A solution was made of the product from Step 4, Example 2
(50.0 mg, 0. 1231 mmol) in 5 mL dimethylformamide. The solution was
degassed by bubbling with argon while sonicating for 5 min. To this
solution was added triethylamine (16.0 .mu.L, 0.1145 mmol), copper
iodide (9.4 mg, 0.0492 mmol), and tetrakis(triphenylphosphine)
palladium (0) (14.2 mg, 0.0123 mmol). Next, phenylacetylene (81.1
.mu.L, 0.7386 mmol) was added. The mixture was stirred under argon
for 4 hours. Upon completion, the mixture was concentrated in
vacuo. The reaction crude was dissolved in 1 mL dimethylformamide,
diluted to 50 mL with deionized water and then washed through a
celite pad. The solution was again concentrated down to dryness,
then redissolved in 1.0 mL dimethylformamide and 3.5 mL water. The
title compound was purified by HPLC;
[0290] .sup.1H-NMR (CD.sub.3OD): 8.14 (s, 1H), 7.91 (s, 1H),
7.54-7.51 (m, 2H), 7.40-7.36 (m, 3H), 6.25 (s, 1H), 4.16-3.85 (m,
4H), 0.87 (s, 3H). MS: 381.14 (m/z).
Example 8
Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(ethyl
2-carboxylethyn-1yl)-pyrrolo[2,3-d]pyrimidine
[0291] ##STR110##
[0292] To a solution of the product from Step 4, Example 2 (450.0
mg, 1.108 mmol) in 28.8 mL THF-DMF (2:1 v/v) was added CuI (0.082
g, 0.432 mmol), TEA (144 .mu.L, 1.035 mmol),
tetrakis(triphenylphosphine)palladium(0) (0.126 g, 0.108 mmol) and
the solution degassed with argon. Ethyl propiolate (100 .mu.L, 1.0
11 mmol) was added and the reaction was heated to 55.degree. C. An
additional 100 .mu.L of ethyl propiolate was added every hour for
six hours until no starting material of Example 2, Step 4, was
present by TLC. The reaction mixture was concentrated in vacuo,
taken up in DMF and purified by RP HPLC on PHenominex column
(250.times.20 mm) using gradient of acetonitrile in water from 0 to
60% over 30 min at 10 mL/min to yield 115 mg (28%) of the title
compound;
[0293] .sup.1H-NMR (CD.sub.3OD): 8.24 (s, 1H), 8.17 (s, 1H), 6.24
(s, 1H), 4.28 (q, 2H), 4.13-3.87 (m, 4H, sugar), 1.34(t, 3H), 0.86
(s, 3H); MS 377.11 (M+H).
Example 9
Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(2-carboxylethyn-1yl)-py-
rrolo[2,3-d]pyrimidine
[0294] ##STR111##
[0295] To the product from Example 8 (20.0 mg, 0.053 mmol) was
added 500 .mu.L of 1N NaOH and stirred at room temperature for 30
min. The reaction was then diluted with water and purified by RP
HPLC on Phenominex column (250.times.20 mm) using gradient of
acetonitrile in water from 0 to 60% over 30 min at 10 mL/min to
yield 7.0 mg (38%) of the title compound;
[0296] .sup.1H-NMR (CD.sub.3OD): 8.10 (s, 1H), 7.96 (s, 1H), 6.22
(s, 1H), 4.12-3.82 (m, 4H, sugar), 0.84 (s, 3H); MS: 349.10
(M+H).
Example 10
Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(2-cis-methoxyethen-1-yl-
)-pyrrolo[2,3-d]pyrimidine
[0297] ##STR112## Step 1. Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(formyl)-pyrrolo[2,3-d]p-
yrimidine:
[0298]
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(formyl)-pyrrolo[-
2,3-d]pyrimidine was synthesized according to the procedure
described by Shin-ichi Watanabe and Tohru Ueda in Nucleosides and
Nucleotides (1983) 2(2), 113-125. In the synthesis of the title
compound, however,
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-pyrrolo[2,3-d]pyrimidine
(See Carroll, et al.,.sup.11,12) was substituted in place of
tubercidin;
[0299] H.sup.1-NMR (CD.sub.3OD): 0.9 (s, 3H, 2'-CH.sub.3), 3.8-4.2
(m, 4H, sugar), 6.3 (s, 1H, 1'-H), 8.2 and 8.6 (s, 1H, --Ar), 9.7
(s, 1H, -aldehyde-H); MS: 309.13 (M+H).
Step 2. Preparation of the Title Compound:
[0300] The product from Step 1 above (0.050 g, 0.162 mmol) was
dissolved in 2 mL DMSO and added dropwise to the preformed ylide of
(methoxymethyl)-triphenylphosphonium chloride and stirred at room
temperature. The ylide was formed by dissolving (0.555 g, 1.62
mmol) (methoxymethyl)triphenylphosphonium chloride in 10 mL DMSO
and adding 0.81 mL 2 M methylsulfinyl carbanion solution (1.62
mmol) and stirred at room temperature for 15 min. After stirring at
room temperature for 4 hours, a second charge of (1.62 mmol) of the
ylide of (methoxy-methyl)triphenyl-phosphonium chloride was added
to the reaction and the reaction was allowed to stir at room
temperature overnight. The reaction was quenched with water and
diluted with methylene chloride. The layers were separated and the
organic layer was extracted with water twice. The aqueous layers
were combined and concentrated in vacuo and purified by RP HPLC on
Phenominex column (250.times.20 mm) using gradient of acetonitrile
in water from 0 to 30% over 30 min at 10 mL/min to yield 20 mg of
the trans enol ether and 10 mg of cis isomer, (56%) yield;
[0301] (cis-isomer) H.sup.1-NMR (CD.sub.3OD): 0.82 (s, 3H,
2'-CH.sub.3), 3.8 (s, 3H, --OCH.sub.3) 3.8-4.2 (m, 4H, sugar), 5.56
(d, 1H), 6.23 (s, 1H, 1'-H), 6.25 (d, 1H), 7.8 and 8.0 (s, 1H,
--Ar).
Example 11
Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(ethen-1-yl)-pyrrolo[2,3-
-d]pyrimidine
[0302] ##STR113##
[0303] The title compound from Example 2 (0.040 g, 0.0132 mmol) was
dissolved in methanol and NH.sub.4OH was added and the mixture left
at ambient temperature for 1 hour. The solvent was evaporated, the
residue dissolved in methanol and co-evaporated with silica gel.
Dry silica was loaded on the glass filter with silica gel and the
desilylated compound was eluted with acetone. Solvent was
evaporated and the residue crystallized from methanol/acetonitrile
to provide for
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(ethyn-1-yl)-pyrrolo[2,3-
-d]pyrimidine.
[0304] T.sub.M 209-219.degree. C. (decomposition); MS 305.13 (M+H);
.sup.1H-NMR (DMSO-d6): 8.10 (s, 1H, H-2), 7.94 (s, 1H, H-8), 6.08
(s, 1H, H-1'), 5.32-5.13 (m, 3H, sugar), 3.96-3.62 (m, 4H, sugar),
0.68 (s, 3H, methyl).
[0305] The acetylene product prepared above was dissolved in 3 mL
THF and 22 mg of Lindlar's catalyst was added. The solution was
stirred at ambient temperature under 1 atm of hydrogen (via
balloon) for 7 days. The balloon was recharged with hydrogen at the
beginning of each day. After 7 days, the reaction was filtered
through celite to remove catalyst, concentrated in vacuo, and
purified by reverse phase HPLC on Phenominex column (250.times.20
mm) using a gradient of acetonitrile in water from 0 to 30% over 30
min at 10 mL/min to yield 30 mg (75% yield) of the title
compound;
[0306] H.sup.1-NMR (CD.sub.3OD): 0.835 (s, 3H, 2'-CH.sub.3),
3.8-4.2 (m, 4H, sugar), 5.2 (dd, 1H), 5.5 (dd, 1H), 6.23 (s, 1H,
1'-H), 6.9 ((dd, 1H), 7.73 and 8.06 (s, 1H, --Ar); MS: 307.15
(M+H).
Example 12
Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(formyl)-pyrrolo[2,3-d]p-
yrimidine
[0307] ##STR114## Step 1.
4-Chloro-5-iodo-7H-pyrrolo[2,3-d]pyrimidine:
[0308] 4-Chloro-7H-pyrrolo[2,3-d]pyrimidine 10.75 g (70 mmol) and
N-iodosuccinimide (16.8 g, 75 mmol) were dissolved in 400 mL of dry
DMF and left at ambient temperature in the darkness over night. The
solvent was evaporated. The yellow residue was suspended in hot 10%
solution of Na.sub.2SO.sub.3, filtered, washed twice with hot water
and crystallized from ethanol to yield 14.6 g (74.6%) of the title
compound as off-white crystals. The mother liquid was evaporated up
to 1/3 volume and crystallize again from ethanol to give 2.47 g
(12.3%) of the title product;
[0309] Total yield is close to 100%; T.sub.m: 212-214 (decompose);
UV .lamda..sub.max: 307, 266, 230, 227 nm (methanol); MS: 277.93
(M-H), 313 (M+Cl); .sup.1H-NMR (DMSO-d.sub.6): .delta. 12.94 (s,
1H), 8.58 (s, 1H), 7.94 (s, 1H).
Step 2.
7-(2'-methyl-3',5'-bis-O-(2,4-dichlorobenzyl)-.beta.-D-ribofuran-
osyl)-4-chloro-5-iodo-pyrrolo[2,3-d]pyrimidine:
[0310] The base, obtained as described above (11.2 g, 40 mmol) was
suspended in 500 mL of CH.sub.3CN, NaH was added (1.6 g, 40 mmol
60% in oil) and the reaction mixture was stirred at room
temperature until NaH was dissolved (about 2 hour). 1-O-Methyl
-2-methyl-3,5-bis-O-(2,4-dichlorobenzyl)-.beta.-D-ribofuranose (10
g, 20 mmol) was dissolved in 500 mL of DCM and cooled down to
4.degree. C. in ice/water bath. HBr--gas was bubbled through DCM
solution about 30 min. Reaction was controlled by TLC by
disappearance of the starting sugar (ether/hexane 1:9 v/v). Upon
the reaction was completed the solvent was evaporated at the
temperature not higher that 20.degree. C. and kept for 20 min in
deep vacuum to remove the traces of HBr. Solution of Na-salt of the
base was fast filtrated and the filtrate was added to the sugar
component. The reaction was kept overnight at ambient temperature,
neutralized with 0. 1 N H.sub.2SO.sub.4 and evaporated. The residue
was distributed between 700 mL of ethyl acetate and 700 mL of
water. The organic fraction was washed with water (150 mL), brine
(150 mL), dried over Na.sub.2SO.sub.4 and evaporated to give a
semi-crystalline mixture. Toluene (500 mL) was added to form a
light tan precipitate of non-reacted heterocyclic base 2.5 g (25%).
The filtrate was concentrated up to the volume of 50 mL and loaded
on the glass filter with silica gel (10.times.10 cm). The filter
was washed with 10% ethyl acetate in toluene collecting 500 mL
fractions. Fraction 2-4 contained the title compound; fractions 6-7
contained the heterocyclic base.
[0311] Fractions 2-4 were evaporated, ether was added to the
colorless oil and the mixture was sonicated for 5 min. The
off-white precipitate was formed, yield 7.4 g (50%). The mother
liquid was evaporated and the described procedure was repeated to
yield and additional 0.7 g of the title nucleoside. Total yield is
8.1 g (54.4%);
[0312] T.sub.m: 67-70.degree. C.; .sup.1H-NMR (DMSO-d.sub.6):
.delta. 8.66 (s, 1H), 8.07 (s, 1H), 7.62-7.34 (m, 6H), 6.22 (s,
1H), 5.64 (s, 1H), 4.78-4.55 (m, 4H), 4.20 (s, 2H), 3.97-3.93 and
3.78-3.75 (dd, 1H), 0.92 (s, 3H); MS: 743.99 (M+H); Recovered base
(total): 4 g as off-white crystals; T.sub.m: 228-230.degree. C.
Step 3.
7-(2'-methyl-.beta.-D-ribofuranosyl)-4-chloro-5-iodo-pyrrolo[2,3-
-d]pyrimidine:
[0313] To the solution of the compound from the previous step (8 g,
10.7 mmol) in DCM (200 mL) at -78.degree. C. was added boron
trichloride (1 M in DCM, 88 mL, 88 mmol) dropwise. The mixture was
stirred at -78.degree. C. for 2.5 hours and additionally overnight
at -20.degree. C. The reaction was quenched by addition of
methanol/DCM (90 mL, 1:1) and the resulting mixture stirred at
-20.degree. C. for 30 min, then neutralized by aqueous ammonia at
the same temperature. The solid was filtered and washed with
methanol/DCM (250 mL, 1:1). The filtrates were combined with 50 mL
of silica gel and evaporated up to dryness. Dry silica was loaded
on the glass filter with silica gel (10.times.10 cm). The filter
was washed with ethyl acetate collecting 500 mL fractions. Fraction
2-4 contained the title compound. The solvent was evaporated and
the residue crystallized from acetone/hexane to give 3.3 g (72%) of
title nucleoside;
[0314] .sup.1H-NMR (DMSO-d.sub.6): .delta. 8.84 (s, 1H), 8.20 (s,
1H), 6.21 (s, 1H), 4.00-3.60 (m, sugar), 0.84 (s, 3H); MS: 426.26
(M+H); T.sub.m: 182-185.degree. C.
Step 4.
7-(2'-methyl-.beta.-D-ribofuranosyl)-4-amino-5-iodo-pyrrolo[2,3--
d]pyrimidine:
[0315] The nucleoside (1.5 g, 3.5 mmol) prepared above was treated
with liquid ammonia at 85.degree. C. for 24 hours in the metal
pressure reactor. After evaporation of ammonia the residue was
dissolved in methanol and co-evaporated with silica gel (about 20
mL). Silica gel bearing the product was on the column (5.times.10
cm) with silica gel in acetone collecting 50 mL fractions.
Fractions 2-8 contained the titled compound. Acetone was evaporated
and the residue crystallized from methanol/acetonitrile to give 1.2
g (84%) of the titled nucleoside;
[0316] T.sub.m 220-222.degree. C. (decompose); .sup.1H-NMR
(DMSO-d.sub.6): .delta. 8.20 (s, 1H), 7.80 (s, 1H), 6.80-6.50 (bs,
1H), 6.09 (s, 1H), 5.19 (t, 1H), 5.13-5.11 (m, 2H), 4.00-3.70 (m,
3H), 3.60-3.20 (m, 1H), 0.84 (s, 3H); MS 407.32 (M+H).
Step 5: Preparation of the Title Compound:
[0317] A solution was made of the compound prepared in Step 4 above
(50.0 mg, 0. 1231 mmol) in 5 mL dry tetrahydrofuran, which was then
purged of air by slowly bubbling with carbon monoxide. To this
solution was added tetrakis (triphenyl-phosphine)palladium(0) (2.8
mg, 0.0025 mmol). The reaction was stirred for 10 minutes, and then
heated to 50.degree. C. Next, tributyltin hydride in THF (35.9
.mu.L, 0.1354 mmol) was slowly added over 2.5 hours--CO gas being
continually bubbled through during this time. Upon completion, the
mixture was concentrated in vacuo. The reaction crude was dissolved
in 1 mL dimethylformamide, diluted to 50 mL with deionized water,
and then washed through a celite pad. The solution was again
concentrated down to dryness then redissolved in 1.0 mL
dimethylformamide and 3.5 mL water. The title compound was purified
by HPLC;
[0318] .sup.1H-NMR (DMSO-d.sub.6): .delta. 9.64 (s, 1H), 8.60 (s,
1H), 8.18 (s, 1H), 7.62 (m, 2H), 6.14 (s, 1H), 5.28-5.19 (m, 3H),
3.94-3.71 (m, 4H), 0.75 (s, 3H); MS: 309.11 (m/z).
Example 13
Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(carbaldehyde
oxime)-pyrrolo[2,3-d]pyrimidine
[0319] ##STR115##
[0320] To a solution of the title compound (0.1 g, 0.325 mmol) from
Example 12 in 10 mL 50% ethanol was added hydroxylamine
hydrochloride (0.073 g, 1.05 mmol) and KOAc (0.103 g, 1.05 mmol)
and heated to 60.degree. C. for 2.5 hours. The crude mixture was
concentrated, diluted with water and purified by reverse phase HPLC
on Phenominex column (250.times.20 mm) using gradient of
acetonitrile in water from 0 to 30% over 30 min at 10 mL/min to
yield 10 mg of the title compound;
[0321] .sup.1H-NMR (CD.sub.3OD): .delta. 0.86 (s, 3H), 3.8-4.2 (m,
4H), 6.21 (s, 1H), 7.78, 8.06, 8.08 (s, 1H). MS: 324.15 (M+H).
Example 14
Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(boronic
acid)-pyrrolo[2,3-d]pyrimidine
[0322] ##STR116##
[0323] To a solution of the compound from Step 4, Example 2 (60 mg,
0.148 mmol) in 1 mL DMSO was added KOAc (44 mg, 0.449 mmol),
bis(neopentyl glycoloto)diboron (40 mg, 0. 177 mmol). The mixture
was degassed with argon and P(Ph.sub.3).sub.2PdCl.sub.2 (3.1 mg,
0.004 mmol) was added and the reaction was heated to 80.degree. C.
for 4 hours. The mixture was diluted with water and purified by RP
HPLC on Phenominex column (250.times.20 mm) using gradient of
acetonitrile in water (with from 0 to 50% over 30 min at 10 mL/min
to yield 16 mg (33%) of the title compound;
[0324] .sup.1H-NMR (D.sub.2O ): .delta. 8.12 (s, 1H), 7.75 (s, 1H),
6.12 (s, 1H), 4.2-3.8 (m, 4H), 0.70 (s, 3H); MS 325.13 (M+H).
Example 15
Preparation of
7-(2'-C-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(diisopropoxymethyl)-pyr-
rolo[2,3-d]pyrimidine
[0325] ##STR117##
[0326] To a solution of the compound from Step 5, Example 13 in
anhydrous isopropanol is placed activated molecular sieves and the
solution is acidified with HCl. The solution is heated to between
50-80.degree. C. until starting material has been consumed. The
resulting diacetal is purified on RP HPLC on Phenominex column
(250.times.20 mm) using gradient of acetonitrile in water (with
from 0 to 50% over 30min at 10 mL/min.
Example 16
Preparation of
7-(2'-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(hydrazono)-pyrrolo[2,3-d]-
pyrimidine
[0327] ##STR118##
[0328] To a solution of the compound from Step 5, Example 12 (20
mg, 0.05 mmol) in DMF was added hydrazine (2 .mu.L, 0.060 mmol) and
the reaction stirred at 50.degree. C. for 2.5 hours. The crude
reaction was purified directly on RP-HPLC on Phenominex column
(250.times.20 mm) using a gradient of acetonitrile in water (with
from 0 to 50% over 30 min at 10 mL/min to yield 12 mg (75%) of the
title compound;
[0329] .sup.1H-NMR (CD.sub.3OD): .delta. 8.03 (s, 1H), 7.85 (s,
1H), 7.68 (s, 1H), 6.21 (s, 1H), 4.115-3.8 (m, 4H, sugar), 0.85 (s,
3H); MS: 323.14 (M+H).
Example 17
Synthesis of
7-(2'-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(2-phenylethyn-1-yl)-pyrro-
lo[23-d]pyrimidine 5'-triphosphate
[0330]
7-(2'-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(2-phenylethyn-1-yl-
)-pyrrolo[2,3-d]pyrimidine 5'-triphosphate (0.1 mmol) is
co-evaporated 3 times with dry DMF, dissolved in 2 mL of
PO(OMe).sub.3, cool to 5.degree. C. and POCl.sub.3 (35 .mu.L) and
proton sponge (64 mg) are added. The mixture is stirred at
5.degree. C. for 3 h, then tetrabutylammonium pyrophosphate (2
mmol, 4 mL of 0.5M solution in DMF) is added and the mixture is
kept for 2 more h at the same temperature. The reaction is quenched
with (Et.sub.3N)HCO.sub.3 buffer (pH 7.5) followed with water. The
solvents are evaporated, the residue is dissolved in methanol (3
mL) and precipitated with ether (30 mL). The solid residue is
purified by ion exchange HPLC on Vydac column (250.times.10 mm) 0
to 100% B. Buffer A is 25 mM NaH.sub.2PO.sub.4/Na.sub.2HPO.sub.4,
pH 3, buffer B is 310 mM NaH.sub.2PO.sub.4/Na.sub.2HPO.sub.4, pH 3.
The last peak is collected, concentrated up to the volume of 5 mL
and repurified on RP HPLC on Phenominex column (250.times.20 mm) in
gradient from 0 to 100% of buffer B in buffer A. Buffer A is 0.5 M
aqueous solution of triethylammonium acetate, buffer B is 0.5 M
acetonitrile solution of triethylammonium acetate. Fractions
containing the title compound are combined, evaporated,
co-evaporated 3 times with water and lyophilized from water.
Example 18
Synthesis of
7-(2'-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(2-phenylethyn-1-yl)-pyrro-
lo[23-d]pyrimidine 5'-phosphate
[0331]
7-(2'-methyl-.beta.-D-ribofuranosyl)-4-amino-5-(2-phenylethyn-1-yl-
)-pyrrolo[2,3-d]pyrimidine (0.1 mmol) is co-evaporated 3 times with
dry DMF, dissolved in 2 mL of PO(OMe).sub.3, cool to 5.degree. C.
and POCl.sub.3 (35 .mu.L) and proton sponge (64 mg) are added. The
mixture is stirred at 5.degree. C. for 3 h. The reaction is
quenched with (Et.sub.3N)HCO.sub.3 buffer (pH 7.5) followed with
water. The solvents are evaporated, the residue dissolved in
methanol (3 mL) and precipitated with ether (30 mL). The solid
residue is purified by ion exchange HPLC on Vydac column
(250.times.10 mm) 0 to 100% B. Buffer A is 25 mM
NaH.sub.2PO.sub.4/Na.sub.2HPO.sub.4, pH 3, buffer B is 310 mM
NaH.sub.2PO.sub.4/Na.sub.2HPO.sub.4, pH 3. The last peak is
collected, concentrated up to the volume of 5 mL and repurified on
RP HPLC on Phenominex column (250.times.20 mm) in gradient from 0
to 100% of buffer B in buffer A. Buffer A is 0.5 M aqueous solution
of triethylammonium acetate, buffer B is 0.5 M acetonitrile
solution of triethylammonium acetate. Fractions containing the
title compound are combined, evaporated, co-evaporated 3 times with
water and lyophilized from water;
[0332] MS: 384.12 (M-H); .sup.1H-NMR: 7.97 & 7.67 (s, 1H each,
base), 6.12 (s, 1H, H-1'), 4.10-3.85 (m, 4H, sugar), 3.15 (s, 1H,
ethynyl), 0.87 (s, 3H, methyl-2'); .sup.31P-NMR: 5.02 (s, 1P).
BIOLOGICAL EXAMPLES
Example 1
Anti-Hepatitis C Activity
[0333] Compounds can exhibit anti-hepatitis C activity by
inhibiting HCV polymerase, by inhibiting other enzymes needed in
the replication cycle, or by other pathways. A number of assays
have been published to assess these activities. A general method
that assesses the gross increase of HCV virus in culture is
disclosed in U.S. Pat. No. 5,738,985 to Miles et al. In vitro
assays have been reported in Ferrari et al. Jnl. of Vir.,
73:1649-1654, 1999; Ishii etal., Hepatology, 29:1227-1235, 1999;
Lohmann etal., Jnl of Bio. Chem., 274:10807-10815, 1999; and
Yamashita et al., Jnl. of Bio. Chem., 273:15479-15486, 1998.
[0334] WO 97/12033, filed on Sep. 27, 1996, by Emory University,
listing C. Hagedom and A. Reinoldus as inventors, which claims
priority to U.S. Provisional Patent Application.Ser. No.
60/004,383, filed on September 1995, describes an HCV polymerase
assay that can be used to evaluate the activity of the of the
compounds described herein. Another HCV polymerase assay has been
reported by Bartholomeusz, et al., Hepatitis C Virus (HCV) RNA
polymerase assay using cloned HCV non-structural proteins;
Antiviral Therapy 1996: 1(Supp 4) 18-24.
[0335] Screens that measure reductions in kinase activity from HCV
drugs are disclosed in U.S. Pat. No. 6,030,785, to Katze et al.,
U.S. Pat. No. 6,228,576, Delvecchio, and U.S. Pat. No. 5,759,795 to
Jubin et al. Screens that measure the protease inhibiting activity
of proposed HCV drugs are disclosed in U.S. Pat. No. 5,861,267 to
Su et al., U.S. Pat. No. 5,739,002 to De Francesco et al., and U.S.
Pat. No. 5,597,691 to Houghton et al.
Example 2
Replicon Assay
[0336] A cell line, ET (Huh-lucubineo-ET) is used for screening of
compounds of the present invention for HCV RNA dependent RNA
polymerase. The ET cell line is stably transfected with RNA
transcripts harboring a I.sub.389luc-ubi-neo/NS3-3'/ET; replicon
with firefly luciferase-ubiquitin-neomycin phosphotransferase
fusion protein and EMCV-IRES driven NS3-5B polyprotein containing
the cell culture adaptive mutations (E1202G; T1280I; K1846T)
(Krieger at al, 2001 and unpublished). The ET cells are grown in
DMEM, supplemented with 10% fetal calf serum, 2 mM Glutamine,
Penicillin (100 IU/mL)/Streptomycin (100 .mu.g/mL), 1.times.
nonessential amino acids, and 250 .mu.g/mL G418 ("Geneticin"). They
are all available through Life Technologies (Bethesda, Md.). The
cells are plated at 0.5-1.0.times.10.sup.4 cells/well in the 96
well plates and incubated for 24 hrs before adding nucleoside
analogs. Then the compounds were added to the cells to achieve a
final concentration of 50 or 100 .mu.M,or whatever concentration is
desired. For these determinations, 6 dilutions of each compound are
used. Compounds are typically diluted 3 fold to span a
concentration range of 250 fold. Luciferase activity will be
measured 48-72 hours later by adding a lysis buffer and the
substrate (Catalog number Glo-lysis buffer E2661 and Bright-Glo
leuciferase system E2620 Promega, Madison, Wis.). Cells should not
be too confluent during the assay. Percent inhibition of
replication will be plotted relative to no compound control. Under
the same condition, cytotoxicity of the compounds will be
determined using cell proliferation reagent, WST-1(Roche, Germany).
IC.sub.50 and TC.sub.50 values are calculated by fitting %
inhibition at each concentration to the following equation, where b
is Hill's coefficient: % inhibition=100%/[(IC50/[I]).sup.b+1]
Example 3
Cloning and Expression of Recombinant HCV-NS5b
[0337] The coding sequence of NS5b protein is cloned by PCR from
pFKI.sub.389luc/NS3-3'/ET as described by Lohmann, V., et al.
(1999) Science 285, 110-113 using the following primers:
TABLE-US-00002 (SEQ. ID. NO. 1) aggacatggatccgcggggtcgggcacgagacag
(SEQ. ID. NO. 2) aaggctggcatgcactcaatgtcctacacatggac
[0338] The cloned fragment is missing the C terminus 21 amino acid
residues. The cloned fragment is inserted into an IPTG-inducible
expression plasmid that provides an epitope tag (His)6 at the
carboxy terminus of the protein.
[0339] The recombinant enzyme is expressed in XL-1 cells and after
induction of expression, the protein is purified using affinity
chromatography on a nickel-NTA column. Storage condition is 10 mM
Tris-HCl pH 7.5, 50 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 20% glycerol at
-20.degree. C.
Example 4
HCV-NS5b Enzyme Assay
[0340] The polymerase activity is assayed by measuring
incorporation of radiolabeled UTP into a RNA product using a
biotinylated, heteropolymeric template, which includes a portion of
the HCV genome. Typically, the assay mixture (50 .mu.L) contains 10
mM Tris-HCl (pH 7.5), 5 mM MgCl.sub.2, 0.2 mM EDTA, 10 mM KCl, 1
unit/.mu.L RNAsin, 1 mM DTT, 10 .mu.M each of NTP, including
[.sup.3H]-UTP, and 10 ng/.mu.L heteropolymeric template. Test
compounds are initially dissolved in 100% DMSO and further diluted
in aqueous buffer containing 5% DMSO. Typically, compounds are
tested at concentrations between 1 nM and 100 .mu.M. Reactions are
started with addition of enzyme and allowed to continue at
37.degree. C. for 2 hours. Reactions are quenched with 8 .mu.L of
100 mM EDTA and reaction mixtures (30 .mu.L) are transferred to
streptavidin-coated scintillation proximity microtiter plates
(FlashPlates) and incubated at 4.degree. C. overnight.
Incorporation of radioactivity is determined by scintillation
counting.
[0341] Shown below in Table II are the results for the replicon
assay or the enzyme assay used to test the compounds of this
invention. TABLE-US-00003 TABLE II Replicon, Enzyme, % inhibition %
inhibition Cmpd # Structure @ 100 .mu.M @ 50 .mu.M @ Con 1 @ Con 2
101 ##STR119## 98.5 98.1 105 ##STR120## 89.1 69.6 106 ##STR121##
95.6 95.5 133 ##STR122## 96.7 92.3 137 ##STR123## 97.6 98.1 145
##STR124## 91.8 90.7 154 ##STR125## 19.2 @ 50 .mu.M 10.9 @ 16.7
.mu.M 157 ##STR126## 95 89 158 ##STR127## cis and trans isomer
tested 78.6 62.4 75.6 35.8 165 ##STR128## 95.9 96.8 166 ##STR129##
not tested at 100 .mu.M second test 96.6 @ 16.7 .mu.M 97 168
##STR130## 96 @ 23.1 .mu.M 92 @ 7.7 .mu.M 169 ##STR131## 89.6 80.7
173 ##STR132## 86.9 76.7 181 ##STR133## 98.1 98.2
FORMULATION EXAMPLES
[0342] The following are representative pharmaceutical formulations
containing a compound of the present invention.
Example 1
Tablet Formulation
[0343] TABLE-US-00004 Ingredient Quantity per tablet, mg compound
of this invention 400 cornstarch 50 croscarmellose sodium 25
lactose 120 magnesium stearate 5
Example 2
Capsule Formulation
[0344] The following ingredients are mixed intimately and loaded
into a hard-shell gelatin capsule. TABLE-US-00005 Ingredient
Quantity per capsule, mg compound of this invention 200 lactose,
spray-dried 148 magnesium stearate 2
Example 3
Suspension Formulation
[0345] The following ingredients are mixed to form a suspension for
oral administration. TABLE-US-00006 Ingredient Amount compound of
this invention 1.0 g fumaric acid 0.5 g sodium chloride 2.0 g
methyl paraben 0.15 g propyl paraben 0.05 g granulated sugar 25.0 g
sorbitol (70% solution) 13.00 g Veegum K (Vanderbilt Co.) 1.0 g
flavoring 0.035 mL colorings 0.5 mg distilled water q.s. to 100
mL
Example 4
Injectable Formulation
[0346] The following ingredients are mixed to form an injectable
formulation. TABLE-US-00007 Ingredient Amount compound of this
invention 0.2 mg-20 mg sodium acetate buffer solution, 0.4 M 2.0 mL
HCl (1N) or NaOH (1N) q.s. to suitable pH water (distilled,
sterile) q.s. to 20 mL
Example 5
Suppository Formulation
[0347] A suppository of total weight 2.5 g is prepared by mixing
the compound of the invention with Witepsol.RTM. H-15
(triglycerides of saturated vegetable fatty acid; Riches-Nelson,
Inc., New York), and has the following composition: TABLE-US-00008
Ingredient Amount compound of the invention 500 mg Witepsol .RTM.
H-15 balance
[0348]
Sequence CWU 1
1
2 1 34 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 1 aggacatgga tccgcggggt cgggcacgag acag 34 2 35
DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 2 aaggctggca tgcactcaat gtcctacaca tggac 35
* * * * *