U.S. patent application number 11/645250 was filed with the patent office on 2007-07-19 for screening and use of reagents which block or activate intein splicing utilizing natural or homologous exteins.
This patent application is currently assigned to New England Biolabs, Inc.. Invention is credited to Eric E. Adam, Francine B. Perler.
Application Number | 20070166745 11/645250 |
Document ID | / |
Family ID | 23706593 |
Filed Date | 2007-07-19 |
United States Patent
Application |
20070166745 |
Kind Code |
A1 |
Perler; Francine B. ; et
al. |
July 19, 2007 |
Screening and use of reagents which block or activate intein
splicing utilizing natural or homologous exteins
Abstract
In accordance with the present invention, there are provided
selection systems and methods for screening for agents that control
splicing of inteins in their native host protein (extein) or in
homologous exteins. Specifically, there are provided positive
genetic selection systems for the screening of agents which inhibit
or activate protein splicing which comprise: a host cell containing
a chromosomal gene encoding either a drug-resistant form of a
target enzyme or a wild-type target enzyme, and a plasmid-borne
gene encoding either a drug-sensitive form of the target enzyme,
which is dominantly cytotoxic upon interaction with the drug, or a
dominantly cytotoxic form of the target enzyme. In these systems
the plasmid-borne gene contains an intein, and the inhibition or
activation of splicing of the dominant cytotoxic form of the target
enzyme by a given reagent results in the survival or death of the
host cell. More specifically, positive genetic selection systems
that utilize the M. xenopi GyrA intein or M. tuberculosis DnaB
helicase intein are provided. Similar reporter systems utilizing
native or homologous exteins and systems utilizing controllable
inteins are provided, as are methods of controlling in vivo
expression of proteins by modulating protein splicing with
inhibiting or activating agents, and methods of controlling the
delivery of proteinaceous drugs in vivo by modulating protein
splicing.
Inventors: |
Perler; Francine B.;
(Brookline, MA) ; Adam; Eric E.; (Neydens,
FR) |
Correspondence
Address: |
HARRIET M. STRIMPEL; NEW ENGLAND BIOLABS, INC.
240 COUNTY ROAD
IPSWICH
MA
01938-2723
US
|
Assignee: |
New England Biolabs, Inc.
Ipswich
MA
|
Family ID: |
23706593 |
Appl. No.: |
11/645250 |
Filed: |
December 22, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10324023 |
Dec 18, 2002 |
7157224 |
|
|
11645250 |
Dec 22, 2006 |
|
|
|
09430221 |
Oct 29, 1999 |
6521425 |
|
|
10324023 |
Dec 18, 2002 |
|
|
|
Current U.S.
Class: |
435/6.18 ;
435/32 |
Current CPC
Class: |
A61P 31/04 20180101;
C07K 2319/21 20130101; C07K 2319/92 20130101; C12N 15/64 20130101;
C12N 15/10 20130101; C12Q 1/18 20130101; C07K 2319/20 20130101;
C12N 15/63 20130101; G01N 2333/35 20130101; C12N 9/90 20130101 |
Class at
Publication: |
435/006 ;
435/032 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12Q 1/18 20060101 C12Q001/18 |
Claims
1. A method of identifying an agent for antimicrobial activity
against a microbial pathogen that naturally has an intein in an
essential gene comprising screening for agents that block splicing
of that intein in its native context or a homologous extein
context.
2. A method of identifying an agent for antimicrobial activity
against a microbial pathogen that naturally has an intein in an
essential gene comprising screening for agents that block splicing
of that intein in a heterologous extein context that includes one
or more native extein residues flanking one or both ends of the
intein.
3. A method of identifying agents with antimicrobial activity
against Mycobacterium tuberculosis comprising screening for agents
that inhibit splicing of the Mycobacterium tuberculosis DnaB
intein.
4. A method of identifying agents with antimicrobial activity
against Mycobacterium leprae comprising screening for agents that
inhibit splicing of the Mycobacterium xenopi or Mycobacterium
leprae GyrA inteins.
5. A method of identifying lead compounds with antimicrobial
activity comprising identifying agents that inhibit splicing of an
intein that is naturally present in that organism.
Description
RELATED APPLICATIONS
[0001] This application is a Continuation of application Ser. No.
10/324,023 filed Dec. 18, 2002, which is a Divisional of
application Ser. No. 09/430,221 filed Oct. 29, 1999, now U.S. Pat.
No. 6,521,425, issued Feb. 18, 2003, all of which are herein
incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] The present invention relates to the screening for and use
of Agents that either inhibit or activate protein splicing of
inteins (IVPS). Specifically, disclosed herein is the development
of two specific reporter systems for Gyrase A and DnaB inteins.
Agents screened for in accordance with the present invention can be
used to control protein splicing for any purpose, in vivo or in
vitro, including antimicrobial activity of organisms containing
inteins in essential genes. More specifically, the present
invention relates to the use of inteins expressed in modified or
unmodified native protein splicing precursors or homologous extein
systems to screen for mutations that modulate splicing or agents
that inhibit or activate splicing. The present invention improves
on current reporter systems used to screen for agents that can
control splicing by using a modified or unmodified native precursor
or precursor homolog in order to take advantage of the more native
intein active site formed by natural precursors or inteins in
homologous exteins, since agents that are derived from non-native
precursors may not have the identical selected activity on native
precursors.
[0003] Production of mature proteins involves the flow of
information from DNA to RNA to protein. Precise excision of DNA and
RNA elements that nterrupt that information has been previously
described (M. Belfort, Annu. Rev. Genet. 24:363 (1990); T. R. Cech,
Annu. Rev. Biochem. 59:543 (1990); Hunter et al., Genes Dev. 3:2101
(1989)). More recently, evidence for the precise excision of
intervening protein sequences has also been described for the TFPI
allele from Saccharomyces cerevisiae (Hirata et al., J. Biol. Chem.
265:6726 (1990); Kane et al., Science 250:651 (1990)) and the recA
gene from Mycobacterium tuberculosis (Davis et al., J. Bact.
173:5653 (1991); Davis et al., Cell 71:1 (1992)). Each of these
genes contains internal in-frame peptide segments that must be
removed to produce the mature protein. Expression of Tfp1 and RecA
each results in two peptides: one representing the intervening
protein sequence (IVPS) and the other the ligated product of the
external protein sequences (EPS). In 1994, the terms "intein" and
"extein" were adopted in place of IVPS and EPS, respectively
(Perler, et al., Nucleic Acids Res. 22:1125-1127 (1994)). This
post-translational processing event has been termed "protein
splicing". Similarly, the "Vent".RTM. DNA polymerase gene from the
hyperthermophilic archaeon Thermococcus litoralis contains two
in-frame IVPS (Perler, et al., PNAS 89:5577 (1992)) and the DNA
polymerase gene from the hyperthermophilic archaeon Pyrococcus
species GB-D contains one intein (Xu, M., et al., Cell 75,
1371-1377 (1993)).
[0004] Over 80 inteins have been identified in bacteria, archaea
and eucarya (Perler, F. B., et al. Nucleic Acids Res 25, 1087-93
(1997), Dalgaard, J. Z., et al., J Comput Biol 4, 193-214 (1997),
Pietrokovski, S., Protein Sci. 7, 64-71 (1998) and Perler, F. B.
Nucleic Acids Res. 27, 346-47 (1999). Four inteins have been found
in Mycobacterium leprae (Davis, E. O., et al., EMBO J. 13, 699-703
(1994) and Smith, D. R., and et al. Genome Res 7, 802-19 (1997))
and three inteins in Mycobacterium tuberculosis (Cole, S. T., et
al. Nature 393, 537-44 (1998)). One intein has been found in
Candida tropicalis (Gu, et al., J. Biol. Chem., 268(10):7372-7381
(1993)).
[0005] Controllable IVPS (CIVPS) and methods for using the same to
modify, produce and purify target proteins has been described (Comb
et al., U.S. Pat. No. 5,496,714, issued Mar. 5, 1996; Comb et al.,
U.S. Pat. No. 5,834,247, issued Nov. 10, 1998). Methods for using
inteins to screen for peptides (or derivative, analogic or mimetic
thereof) or any agent that can enter cells to block or activate
splicing of a natural or experimental reporter protein have also
been described (U.S. Pat. No. 5,834,247, supra. at Example 17).
These methods specifically describe the screening of peptides using
mycobacterial inteins as targets. The preparation of an in vivo
peptide library utilizing chicken .alpha.-spectrin is also
described.
[0006] While a general method of screening for antimicrobial agents
using the M. tuberculosis RecA intein in a thymidylate synthetase
(TS) reporter system has been described (Belfort, U.S. Pat. No.
5,795,731, issued Aug. 18, 1998), this system suffers from several
limitations. Importantly, several studies of protein splicing in
foreign contexts (such as the Belfort system) indicate that intein
splicing is more efficient in the native extein than in foreign
exteins (Xu, EMBO J. 13:5517-5522 (1994), Xu, EMBO J. 15:5146-5153
(1996), Telenti, J. Bacteriol. 179:6379-6382 (1997), Chong J. Biol.
Chem, 273:10567-10577 (1998), Liu, FEBS Lett. 408:311-314 (1997),
Wu, Biochim. Biophys. Acta 1387:422-432 (1998B), Nogami Genetics,
147:73-85 (1997), Kawasaki J. Biol. Chem., 272:15668-15674 (1997),
Derbyshire, Proc. Natl. Acad. Sci. USA, 94:11466-11471 (1997),
Southworth, BioTechniques 27:110-121 (1999), FIG. 7)). For example,
the use of foreign exteins yields temperature-dependent splicing of
the Psp-GBD Pol, Mxe GyrA and Synechocystis DnaB inteins (Xu, EMBO
J. 13:5517-5522 (1994), Xu, EMBO J. 15:5146-5153 (1996), Telenti,
J. Bacteriol. 179:6379-6382 (1997), Chong J. Biol. Chem,
273:10567-10577 (1998), Liu, FEBS Lett. 408:311-314 (1997), Wu,
Biochim. Biophys. Acta 1387:422-432 (1998B), Nogami Genetics,
147:73-85 (1997), Kawasaki J. Biol. Chem., 272:15668-15674 (1997)
and Southworth, BioTechniques, 27:110-121 (1999), and FIG. 7).
[0007] While not wishing to be bound by theory, it is believed that
such inefficient protein splicing in the foreign extein context
occurs because the flanking extein is, in effect, the substrate of
the intein. It is, therefore, likely that the intein may exhibit
substrate specificity like all other enzymes. The substrate
specificity of the intein limits acceptable extein sequences, hence
the native extein sequence is the optimal substrate, whereas
foreign extein sequences may not be acceptable substrates at all.
For example, studies of the Sce VMA and Mxe GyrA inteins indicate
that thiol induced N-terminal splice junction cleavage and splicing
are, to varying extents, dependent on the single extein residue
preceding the intein (Chong, J. Biochem. 273:10567-10577 (1998),
Southworth, BioTechniques, 27:110-121 (1999)). Other extein
residues have also been shown to affect splicing of the Sce VMA
intein (Nogami Genetics, 147:73-85 (1997), Kawasaki J. Biol. Chem.,
272:15668-15674 (1997)).
[0008] Additionally, exteins may affect the packing at the intein
active site, or global folding of the intein and/or precursor,
hence the use of a foreign extein may result in improper folding of
the intein or precursor and inefficient or no splicing. Moreover,
expression of an extein gene that naturally contains an intein in a
foreign host, for example E. coli or yeast, may not be efficient
(Perler et al. Proc. Natl. Acad. Sci. USA 89:5577-5581 (1992) and
Hodges, et al., Nucleic Acid Res. 20:6153-6157 (1992)), whereas
expression of the homologous endogenous extein is likely to be more
efficient. For example, the Mycobacterium leprae RecA intein fails
to splice in E. coli, while it splices in M. leprae (Davis, et al.,
EMBO J., 13:699-703 (1994)). It is possible that the M. leprae RecA
intein would splice in E. coli RecA, although that has yet to be
tested. In another example, the Synechocystis sp. strain PCC6803
DnaB gene, containing an intein, was unclonable in E. coli (Wu, et
al., Proc. Natl. Acad. Sci. USA 95:9226-9231 (1998)). The M. leprae
GyrA precursor did not splice efficiently in E. coli and was mostly
insoluble, while the homologous Mxe GyrA intein spliced efficiently
in E. coli GyrA.
[0009] Additionally, the use of homologous exteins would eliminate,
in many instances, the need to introduce silent mutations in the
reporter gene in order to insert the desired intein (see Belfort,
supra., Comb, supra, Example 17). Homologous exteins may have
naturally-occurring, conserved restriction enzyme sites that would
allow the cloning of the intein into the homologous extein or they
may have enough extein similarity to allow insertion of the intein
into the homologous extein by recombination. Such systems also
eliminate the need for an exogenous reporter gene, since innate
extein properties of the native extein may be used for selection.
Alternatively, the native extein may be mutated, either de novo or
based on mutations in similar extein genes, to make the extein into
a selectable marker or reporter gene.
[0010] Accordingly, the most desirable intein splicing systems
would be those systems that express an intein from one organism in
the homologous extein from the foreign host organism used for
expression or to express the native precursor gene in a suitable
foreign host organism.
[0011] Such intein systems would not only be useful in the
screening of antimicrobial agents which inhibit intein splicing
within a reporter gene (as described in Belfort, supra, Comb,
supra.), but as controllable targets to direct expression of an
extein product. Agents, for example peptides, that block intein
splicing may be used to limit the expression of an extein in such
systems. The suppression of such expression may be highly useful in
the drug delivery context, where, for example, one wishes to turn
on an enzyme which is active in killing cancer cells, or by
delivering needed activity, for example insulin.
[0012] Similarly, such intein systems may utilize
splicing-incompetent inteins to screen for agents with the ability
to activate splicing.
SUMMARY OF THE INVENTION
[0013] In accordance with the present invention, there is provided
selection systems and methods for selecting or screening for
mutations or agents that control the splicing of inteins which
comprise use of the intein's native host protein (extein) or a
homologous extein in any host organism (FIG. 8). Specifically, in
one preferred embodiment, there is provided a positive genetic
selection system for the screening of agents which inhibit protein
splicing which comprises: a host cell which contains (1) a copy of
the extein gene (either episomal, chromosomal or synthetic) gene
encoding a mutant or naturally drug-resistant form of a target
enzyme (which as used herein includes not only enzymes, but
proteins, peptides or the like), and (2) a wild-type or mutant form
of the extein gene (either episomal, chromosomal, or synthetic)
encoding a drug-sensitive form of the target enzyme which is
dominantly cytotoxic upon interaction with the drug, wherein the
gene encoding the drug-sensitive form of the target enzyme contains
an intein, and wherein the inhibition of splicing of the
drug-sensitive form of the target enzyme by a given reagent results
in the survival of the host cell in the presence of the drug. In
one specific embodiment, a positive genetic selection system that
utilizes the M. xenopi GyrA intein is provided. This system is also
applicable to any GyrA intein inserted at the same or different
site in the GyrA extein gene.
[0014] In accordance with another preferred embodiment, there is
provided a similar positive genetic selection system for the
screening of agents which inhibit protein splicing which comprisesa
host cell which contains (1) a copy of the extein gene (either
episomal, chromosomal or synthetic) encoding a wild type form of a
target enzyme, and (2) a gene encoding a dominant cytotoxic form of
the target enzyme (either episomal, chromosomal or synthetic)
wherein the gene encoding the dominantly and cytotoxic form of the
target enzyme contains an intein, and wherein the inhibition of
splicing of the cytotoxic form of the target enzyme by a given
reagent results in the survival of the host cell. In one
particularly preferred embodiment, a positive genetic selection
system that utilizes the M. tuberculosis DnaB helicase intein is
provided. This positive selection system may also employ any DnaB
intein inserted at the same or different site in the DnaB extein
gene. Similar systems and methods of screening for agents that
activate protein splicing are also provided, as are reporter
systems utilizing native or homologous exteins and systems
utilizing inteins.
[0015] Also provided by the present invention are methods of
controlling in vivo expression of proteins by modulating protein
splicing with inhibiting or activating agents. Similar methods of
controlling the delivery of proteinaceous drugs in vivo by
modulating protein splicing are also provided.
[0016] As used herein, "agent" includes, but is not limited to, a
peptide (free or displayed on a scaffold such as chicken
.alpha.-spectrin), a peptide derivative, analogic or mimetic, a
natural product or a synthetic molecule.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1 is a diagram depicting a protein splicing precursor
and products and alternative names for each element or part
thereof.
[0018] FIG. 2 is a diagram depicting a general scheme for the
selection of peptides which block intein splicing of a dominant
lethal suicide gene in vivo.
[0019] FIG. 3A is a diagram depicting the irreversible blocking of
DNA replication by E. coli GyrA interaction with a drug
(ofloxacin).
[0020] FIG. 3B is a diagram depicting a Mxe GyrA intein-splicing
system for the selection of agents which block intein splicing. The
splicing of the Mxe GyrA intein out of the homologous Eco GyrA
extein produces a drug sensitive, wild-type Eco GyrA which, in the
presence of ofloxacin, forms an irreversible covalent poison
complex during replication that kills the cell, despite the
presence of the chromosomal mutant GyrA which is drug
resistant.
[0021] FIG. 3C is a diagram depicting a Mxe GyrA intein-splicing
system for the selection of agents which block intein splicing: the
blocking of splicing of the Mxe GyrA intein out of the homologous
Eco GyrA extein results in the expression of the inactive drug
sensitive Eco GyrA and the chromosomal mutant GyrA, which is
ofloxacin-resistant. Hence, in the absence of an active drug
sensitive Eco GyrA (due to the blockage of splicing,) the host
grows.
[0022] FIG. 3D is an amino acid sequence comparison of part of the
E. coli GyrA (SEQ ID NO:1) and M. xenopi GyrA (SEQ ID NO:2)
sequences, indicating that the GyrA exteins are very similar in
amino acid sequence, especially at the intein insertion site marked
by the arrow.
[0023] FIG. 3E is a gel indicating efficient splicing of the Mxe
GyrA intein in the homologous Eco GyrA extein. The position of Eco
GyrA is indicated by the solid black box and the position of the
precursor comprising the Mxe GyrA intein in Eco GyrA is indicated
by the black and white boxed marker with the white box indicating
presence of the intein.
[0024] FIG. 4A-1 is a diagram depicting the intersection of DnaB
with DnaC that is required to load DnaB onto the DNA replication
machinery.
[0025] FIG. 4A-2 is a diagram depicting the sequestration of DnaC
by a mutant E. coli DnaB helicase that leads to disrupted DNA
replication and cell death.
[0026] FIG. 4B is a diagram depicting a Mtu DnaB helicase
intein-splicing system for the selection of agents which block
intein splicing: the splicing of the Mtu DnaB helicase intein out
of a dominant lethal mutant Mtu DnaB helicase extein produces
mutant Mtu DnaB helicase which sequesters Eco DnaC and poisons
replication despite the presence of the chromosomal Eco DnaB
helicase, as a result, the host dies.
[0027] FIG. 4C is a diagram depicting a Mtu DnaB helicase
intein-splicing system for the selection of agents which block
intein splicing: the blocking of splicing of Mtu DnaB helicase
intein out of a dominant lethal mutant Mtu DnaB helicase extein
prevents the sequestration of Eco DnaC; chromosomal Eco DnaB
helicase is expressed and the host grows.
[0028] FIG. 4D is an amino acid sequence comparison of part of the
E. coli DnaB helicase (SEQ ID NO:3) and M. tuberculosis DnaB
helicase (SEQ ID NO:4) sequences indicating that the amino acid
sequences are very similar and that the site in E. coli DnaB that
was mutated to make it cytotoxic is conserved in M. tuberculosis
DnaB (first on larged sequence) and that the intein insertion site
is also conserved in E. coli DnaB (marked by the arrow).
[0029] FIG. 5A is a diagram depicting the production of a
combinatorial peptide library using chicken .alpha.-spectrin and
the screening of these peptides for those that block Mxe GyrA
helicase intein splicing. "aa" represents a portion of spectrin
which can be randomized. The spectrin scaffold is represented by a
trapazoid and the different amino acid sequences by various other
shapes. If the spectrin binds to the precursor, splicing is
blocked. The system has three components: a host cell expressing T7
RNA polymerase, the spectrin library and the intein plus GyrA gene.
The latter two genes are present on a single plasmid under control
of T7 RNA polymerase promoters.
[0030] FIG. 5B is a flow diagram indicating multiple-round
selection of combinatorial peptides.
[0031] FIG. 5C is a gel indicating that peptides p814-818 (SEQ ID
NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 and SEQ ID
NO:10) block splicing of Mtu DnaB in E. coli. This is a Western
block using anti-T7 tag antibody to detect the T7 tag at the
N-terminus of each DnaB protein. In p815rev, the selected blocking
peptide sequence in -spectrin has been replaced with the wild type
spectrin sequence to demonstrate that inhibition of splicing is due
to the selected peptide sequence. The bands and markers on the
right represent the precursor, a putative C-terminal cleavage
product and the spliced DnaB exteins, respectively from top to
bottom of the Western Blot. Size markers are in lane M.
[0032] FIG. 6 is a diagram depicting the production of a
combinatorial peptide library using chicken .alpha.-spectrin and
the screening of these peptides for those that block Mtu DnaB
intein splicing in Mtu DnaB. E. coli GyrA gyrase. "aa" represents a
portion of spectrin which can be randomized. The spectrin scaffold
is represented by a trapazoid and the different amino acid
sequences by various other shapes. If the spectrin binds to the
precursor, splicing is blocked. The system has three components: a
host cell expressing T7 RNA polymerase, the spectrin library and
the intein plus GyrA gene. The latter two genes are present on a
single plasmid under control of T7 RNA polymerase promoters.
[0033] FIG. 7 is a table showing the effect of the single amino
acid preceding the Mxe GyrA intein in a heterologous extein context
on splicing and N-terminal cleavage by DTT.
[0034] FIG. 8 is a flow chart for choosing native precursors,
homologous exteins or heterologous exteins to develop a selection
or reporter system for testing agents that inhibit or activate
splicing of an intein.
[0035] FIG. 9 is a summary of the various methods of selecting
agents that inhibit or activate protein splicing. Each system is
based on a merodiploid cell containing an intein plus and an intein
minus extein gene.
[0036] FIG. 10 depicts the scheme for creating random mutations in
the Mxe gyrA intein by error prone PCR of the intein followed by
cloning of the mutated intein genes into the E. coli Mxe gyrA
extein.
[0037] FIG. 11 depicts the selection scheme based on the GyrA
selection described in Example I in which the presence of a drug
kills cells where the intein has spliced. Clones that do not splice
at Temperature 1 grow, while replica plated clones that splice at
lower Temperature 2 do not grow.
[0038] FIG. 12 show cell lysates from wild type or mutated intein
clones were electrophoresed in SDS acrylamide gels. A temperature
sensitive clone grown at 37.degree. C. (labeled `A`) fails to
splice, while the wild type intein clone splices (labeled `WT`).
Wild-type levels of splicing are observed in the mutant clones
(1-6) when shifted to 16.degree. C. overnight.
[0039] FIG. 13 illustrates the Mxe GyrA intein sequence (SEQ ID
NO:46) with mutations found in the temperature sensitive splicing
clones indicated below the wild-type residue.
[0040] FIG. 14 illustrates the positioning of the mutations in the
temperature sensitive splicing clones on the Mxe GyrA intein 3-D
structure. The two panels depict opposite sides of the Mxe GyrA
intein with a single Alanine preceding the intein. Double amino
acid change indicates that the clone had more than one
mutation.
DETAILED DESCRIPTION
[0041] The present invention is directed to methods of selecting or
screening for mutations or agents that block or activate protein
splicing of inteins using natural precursors or by inserting
inteins in homologous extein genes. These mutations or agents can
be used to activate or keep inactive enzymes in vivo or in vitro
for pharmacological, chemotherapeutic, or biotechnological
purposes. In contrast, these same methods can be used to select
agents that block or activate splicing in a non-homologous extein
if no genetic selection system or screen can be generated for the
native extein protein.
[0042] The in vivo control of protein splicing mediated by a
blocking or activating peptide, or other agent that can enter a
cell, acting on a controllable intervening protein sequence (CIVPS)
has been described (U.S. Pat. No. 5,834,247, supra. at Example 17).
In the present invention, it should be noted that a
non-controllable IVPS, or intein, is used to identify agents that
will convert the IVPS into a CIVPS. The blocking of such splicing
activity by specific agents such as peptides or natural products,
and analogues thereof, is particularly useful in combating
pathogens such as Mycobacterium tuberculosis, Mycobacterium leprae,
Mycobacterium avium, or Candida tropicalis by blocking the splicing
of essential proteins in those organisms.
[0043] Approximately 97 inteins have been identified and are
available from public databases (Perler, Nucleic Acids Res.
22:1125-1127 (1994), Perler, Nucleic Acids Res. 27:346-347 (1999),
Pietrokovski, S., Protein Sci., 7:64-71 (1998) and Dalgaard, et
al., J. Comput. Biol., 4:193-214 (1997). Sequencing projects of
small prokaryotic genomes (e.g., Mycobacterium tuberculosis,
Mycobacterium leprae, and Methanococcus jannaschii) already account
for the majority of published intein sequences. Host genes of these
inteins are often involved in such essential cellular functions as
DNA replication, expression, or various metabolic processes
(compiled in: Perler, Nucleic Acids Res. 25:1087-1093 (1997),
Perler, Nucleic Acids Res. 27:346-347 (1999), Pietrokovski, S.,
Protein Sci., 7:64-71 (1998) and Dalgaard, et al., J. Comput.
Biol., 4:193-214 (1997). Hence, the disruption of these essential
functions via the blocking of intein splicing by peptides, or other
agents, represents a means by which to screen for anti-microbial
and anti-pathogenic agents.
[0044] Generally, a positive selection system consists of a gene
that is detrimental to a host organism depending on the growth
media or the host strain genetic background. The gene product is
toxic for the cell, inhibiting growth or killing the host unless
the gene product is inactivated. In the context of a protein
splicing genetic system, a positive selection system is defined as
a system that allows selection against the splicing of an intein
inserted in-frame into a host gene (see FIG. 2). If splicing occurs
in the precursor protein containing the intein, the cytotoxic host
protein will be active and inhibit cell growth or kill the cell; if
splicing is disrupted the cytotoxic host protein will be inactive
and allow cell growth. The same description applies to reporter
systems where detection of the host protein is scored, rather than
selection for organism viability. Many reporter genes are known,
the most common example is the Blue/white screen involving
.beta.-galactosidase function on X-gal to produce a blue color.
[0045] In accordance with one embodiment of the present invention,
there is provided a positive selection system for identifying
agents which block or activate protein splicing which comprises a
host cell which contains (1) a copy of the extein gene (either
episomal, chromosomal or synthetic) encoding a mutant or naturally
drug-resistant form of a target enzyme; and (2) a wild type or
mutant form of the extein gene (either episomal, chromosomal or
synthetic) encoding the target enzyme that is sensitive to the
drug, into which is inserted an intein, wherein the spliced form of
the intein-containing target enzyme is toxic to the host organism
upon interaction with a certain drug. In this system, the host cell
so transformed will express the drug sensitive enzyme if the intein
is properly spliced, resulting in reduced viability of the organism
because the spliced product is dominantly lethal or cytotoxic to
the host organism, despite the fact that the drug-resistant
homologous gene is also expressed. The intein-les copy of the gene
is required to maintain viability in cells in which splicing of the
plasmid borne extein gene is blocked.
[0046] In one preferred embodiment, a plasmid-encoded, drug
sensitive gene is the naturally occurring intein/extein precursor
or its homolog containing an intein, which intein may be either
naturally occurring or inserted, and drug sensitivity may be
naturally occurring in this precursor gene or introduced by
mutation in the extein portion of the gene. This system results in
death of all cells where splicing occurs and thus provides a system
for selecting for mutations, drugs, chemicals, peptides, etc. which
block splicing in vivo since cell viability requires blockage of
splicing.
[0047] In a particularly preferred embodiment, the Mycobacterium
xenopi GyrA intein (Mxe GyrA) (SEQ ID NO:11) (Telenti et al., J.
Bacteriol. 179:6378-6382 (1997) is inserted into the homologous
extein of E. coli GyrA (see FIG. 3D). In E. coli, GyrA is an
essential gene that encodes for the A subunit of the E. coli gyrase
hetero-tetramer protein complex. E. coli gyrase is a type II
topoisomerase involved in DNA relaxation at the origin of
replication of the bacterial chromosomal DNA (Swanberg and Wang, J.
Mol. Biol. 197:729-736 (1987)). The wild type E. coli GyrA binds
irreversibly to quinoline drugs such as ofloaxcin, preventing DNA
relaxation during replication, and leading to cell death (see FIG.
3A). However, certain mutants of wild type E. coli GyrA are
drug-resistant, while retaining gyrase activity. The generation of
an E. coli GyrA merodiploid host cell which contains a chromosomal
copy of a drug-resistant gyrA gene with a second intein-containing,
drug sensitive gyrA gene results in a drug sensitive E. coli host,
since in this case, drug sensitivity is dominant. The drug
sensitive phenotype is dominant because the drug sensitive GyrA
forms an irreversible covalent poison complex with the drug that
interferes with DNA replication (FIG. 3A).
[0048] By merodiploid we mean that the cell contains an extra copy
of a gene (or several genes) which has been introduced into the
cell by any means known to one skilled in the art, such as
transformation, infection, conjugation, plasmids, virus, phage, or
by generating a transgenic strain and which may be present on
either an episomal element or on the host chromosome.
[0049] In accordance with the present invention, there is further
provided a similar type of positive selection system (for
identifying agents which block or activate protein splicing) which
comprises a host cell which contains (1) a copy of the extein gene
(either episomal, chromosomal or synthetic) encoding a wild type
form of a target enzyme, which expresses a non-toxic form of the
extein protein; and (2) a second a extein gene (either episomal,
chromosomal or synthetic) encoding a cytotoxic form of the target
enzyme, into which is inserted an intein. In this system, the
merodiploid host cell expresses the cytotoxic enzyme if the intein
is properly spliced. Thus, cells must be treated with chemicals,
agents or peptides that block splicing of the cytotoxic enzyme at
all times when the cytotoxic enzyme is expressed. The cytotoxic
extein must be dominantly lethal, as the intein-less copy of the
extein gene is also expressed. The intein-less copy of the gene is
required to maintain viability in cells in which splicing of the
plasmid borne extein gene is blocked.
[0050] In one preferred embodiment, instead of using an intein
inserted into a cytotoxic foreign extein homolog, the natural
intein precursor may be mutated to produce a cytotoxic extein
enzyme after splicing of the intein.
[0051] In a particularly preferred embodiment, the Mycobacterium
tuberculosis DnaB precursor (Cole et al., Nature, 393:537-544
(1998)) is mutated in the extein region to a cytotoxic form based
on the known cytotoxic mutation in E. coli DnaB, where Arg231 was
mutated to Cysteine (Marszalek and Kaguni, J. Biol. Chem.,
267:19334-19340 (1992) and Shrimankar, et al., J. Bacteriol.,
174:7689-7696 (1992)). DNA helicases are essential proteins that
unwind a DNA duplex to yield a single-stranded DNA intermediate
required for replication, recombination, and repair (LeBowitz and
McMacken, J. Biol. Chem., 261:4738-4748 (1986) and Lohman, Mol.,
Microbiol., 6:5-14 (1992)). The hexameric E. coli helicase encoded
by the dnaB gene interacts with an hexameric DnaC complex and ATP.
Some DnaB mutants are dominant lethal (Bouvier and Oreglia, C. R.
Acad. Sci. Hebd Seances Acad. Sci. D., 280:649-652 (1975) and
Maurer and Wong, J. Bacteriol., 170:3682-3688 (1988), Saluja and
Godson, J. Bacteriol., 177:1104-1111 (1995) and Sclafani, et al.,
Mol. Gen. Genet. 182:112-118 (1981)). The R231C mutant protein is
deficient in ATP hydrolysis, helicase activity, and replication
activity at the chromosomal origin of replication resulting in cell
death. As shown in FIG. 4D, Mtu DnaB contains this same Arginine
(R227), and mutating it to Cysteine renders the Mtu DnaB gene
cytotoxic. This mutation is dominantly cytotoxic in E. coli, and
both the E. coli and M. tuberculosis DnaB proteins result in
sequestering of the E. coli DnaC protein into inactive complexes,
preventing DnaC from `loading` DnaB onto the E. coli DNA
replication fork (see FIG. 4A-1 and FIG. 4A-2).
[0052] Both of the positive selection systems described in the
present invention utilize either native or homologous foreign
exteins in order to optimize protein splicing and avoid the
ineffecient splicing which can result from insertion of the intein
into non-homologous foreign extein.
[0053] Co-transformation of the host cell in these positive
selection systems with a plasmid engineered for the expression of
an in vivo peptide library or transformation with a plasmid that
contains both the selection marker and the in vivo peptide library
(as in FIG. 6) allows for the direct selection of clones expressing
a peptide that blocks (or alternatively activates) protein
splicing. In vivo expression of peptides may be hampered by the
host's efficient proteolytic degradation systems. Therefore,
expression of these peptides in vivo in the context of larger
proteins is preferred, especially in surface loop regions of larger
proteins. In vivo expression of peptides fused to larger proteins
has been achieved for example, in the catalytic loop of thioredoxin
(Colas et al., Nature, 380:548-550 (1996)), and it is possible to
express peptides fused within many different proteins. Peptides
expressed in-frame in highly soluble, well expressed, thermostable,
solvent-exposed loops of a protein are less subject to in vivo
proteolysis or degradation and such fusions enhance the functional
expression of peptides in a cell.
[0054] In a preferred embodiment, a combinatorial peptide library
in a fragment of chicken .alpha.-spectrin is constructed, as
previously described (see U.S. Pat. No. 5,834,247, supra at Example
17). The EF hand region of chicken .alpha.-spectrin was chosen
because its structure is known, its EF hand domain forms a small
protein with a stable structure, and it has a flexible surface
loop. The structure of the chicken .alpha.-spectrin EF hand domain
was elucidated by NMR analysis (Trave, et al., EMBO J. 14:4922-4931
(1995)). The term EF hand describes a type of protein tertiary
structural motif consisting of a helix, a turn (loop) and a second
helix. The EF hand domain of chicken .alpha.-spectrin is located at
the carboxy terminus of chicken .alpha.-spectrin. Its 84 amino acid
structure is arranged in two EF hand helix-turn-helix motifs
separated by a 14 amino acid long flexible linker (SEQ ID NO:12).
The protein is extremely soluble without any detectable
precipitation or aggregation even at concentrations of up to 10 mM.
The linker loop is mainly unstructured in solution and mutagenesis
data show that minor deletions or insertions in the loop do not
disturb the stabilizing hydrophobic interactions between the 2
EF-hand.
[0055] We have taken advantage of this last property to insert
random peptides in the linker region between the chicken
.alpha.-spectrin EF hands. Peptide libraries of various sizes can
be investigated. It will be readily apparent to the skilled artisan
that alternative methods of producing in vivo peptide libraries for
screening may be utilized and are within the scope of the present
invention.
[0056] Although the systems discussed above select for agents that
block splicing of native or homologous exteins, it will be
recognized by those of skill in the art that similar strategies can
be used for screening with reporter genes to look for agents that
inhibit expression of active reporter genes. It will likewise be
recognized by the skilled artisan that similar strategies can be
used to look for agents that activate splicing of a
splicing-deficient intein in its native context or in a homologous
extein gene, as long as the extein gene can be converted into a
reporter. For example, in one embodiment, a reagent that activates
a splicing-deficient precursor results in expression of an active
reporter protein, resulting in inhibition of cell growth or
detection of the active reporter protein.
[0057] Although the Escherichia coli (E. coli) GyrA and the
Mycobacterium tuberculosis (M. tuberculosis) DnaB selection systems
are described above, it will be recognized by the skilled artisan
that any genetic selection system can also be used to isolate
peptide sequences or other agents which disrupt or catalyze protein
splicing. Likewise, although we describe the specific use of the M.
xenopi GyrA intein (SEQ ID NO:11) and the M. tuberculosis DnaB
intein (SEQ ID NO:13), the skilled artisan will recognize that this
strategy is equally applicable to any intein (see, e.g., Perler, et
al., Nucleic Acids Res. 27:346-347 1999)) present in its native or
homologous context. It will likewise be readily apparent to those
of skill in the art that alternative means of generating peptide
libraries for screening may be used. It will likewise be recognized
by the skilled artisan that in the absence of a selection or
screening system for the native extein protein that similar
strategies can be applied to splicing of inteins in less optimal
heterologous extein systems.
[0058] Activating and/or inhibiting agents identified by the
screening methods of the instant invention may also be used to
control the in vivo expression of a target protein. Once the only
copy of an active extein gene contains an intein, gene function can
be inhibited if the organism is treated with an agent that blocks
splicing. On the other hand, if a splicing-impaired intein is used,
gene function can be activated if the organism is treated with an
agent that activates splicing. The agents and splicing can be
modulated at any time during the development and life of the
organism by addition or removal of the splicing activating or
inhibiting agent.
[0059] Similarly, controllable splicing may be used to deliver
active proteins at specific times or to specific places. In many
instances, therapeutic drugs can be cytotoxic to the host and would
be best if only active at the target site. For example,
chemotherapy drugs are often generally cytotoxic and adverse
reactions in normal cells could be eliminated if the drug could be
specifically activated in the tumor. If one has a drug that is at
least partially proteinacious, an intein that can be activated or
inhibited by a second agent, as described above, could be inserted
into the protein portion of the therapeutic agent. The drug is then
administered in an inactive form, and subsequently activated in the
desired target tissue.
[0060] As noted above, it is believed that inefficient protein
splicing in the foreign extein context occurs as inteins may
exhibit substrate specificity, preferring their native extein
sequence to that of foreign exteins. In accordance with another
embodiment, there is provided a method of overcoming this
limitation by employing an intein with one or more, preferably one
to five, amino acid residues from its native extein. Inclusion of
such amino acid residues may be at either or both ends of the
homologous intein. Inclusion of amino acid residues from the native
extein will facilitate methodologies of the present invention. Such
amino acid residues from the native extein may be incorporated into
the precursor by methods well known to those skilled in the
art.
[0061] Insertion of a target intein in the heterologous extein may
be at any of a number of sites, including but not limited to, a
surface location in the extein, within a loop region of the extein,
at a protease sensitive site, or a position known to facilitate
insertion of additional amino acid residues without inactivating
the extein.
[0062] The Examples presented below are only intended as specific
preferred embodiments of the present invention and are not intended
to limit the scope of the invention except as provided in the
claims herein. The present invention encompasses modifications and
variations of the methods taught herein which would be obvious to
one of ordinary skill in the art.
[0063] The references cited above and below are hereby incorporated
by reference herein.
EXAMPLE I
A Mxe GyrA Intein-Mediated Positive Selection System for Inhibition
of Protein Splicing
A Positive Selection System Based on Blocking Splicing of the Mxe
GyrA Intein (IVPS) in E. coli GyrA: Background
[0064] Gyrases are essential multimeric enzymes involved in DNA
replication in bacteria (Swanberg and Wang, 1987). Both gyrase
subunit A and B have been extensively studied as drug targets in
bacterial human pathogens (e.g., Mycobacteria, Salmonella,
Enterbacteriaceae, Citrobacter, Pseudomonas, Streptococcus,
Staphylococcus, Yersinia, Rhodobacter, Haemophilus, Neisseria,
Providencia). The GyrA subunit of gyrases can complex with
quinoline drugs, such as ofloxacin, and induce cell death. The
complex formation of quinolines with gyrase is followed by a rapid
and irreversible inhibition of DNA synthesis, inhibition of growth,
and induction of the SOS response (see FIG. 3A). At higher drug
concentrations, cell death occurs as double-strand DNA breaks in
the bacterial chromosome are released from trapped gyrase
complexes.
[0065] In many gram-negative bacteria (e.g., E. coli), resistance
to quinoline arises from mutation of the Gyrase A protein in the
quinoline resistance determining region such as gyrA96 or gyrA83.
Those mutations may involve Ser83 in E. coli GyrA. In a merodiploid
cell containing a drug resistant gyrA gene (such as gyrA83) on the
chromosome and a wild type (gyrA+) copy of gyrA on a plasmid, the
wild type gene (drug sensitive) product of gyrA is dominant. By
merodiploid, we mean that the cell contains an extra copy of a gene
(or several genes) which has been introduced into the cell by any
means known to one skilled in the art, such as transformation,
infection, conjugation, plasmids, virus, phage, or by generating a
transgenic strain and which may be present on either an episomal
element or on the host chromosome. The wild type gyrA gene can be
introduced into the cell by any means known to one skilled in the
art and should not be considered limited to a plasmid. Many E. coli
strains are available that contain gyrA mutants which are resistant
to quinoline drugs such as ofloxacin. However, this system is also
applicable to any other host system where (1) the chromosomal copy
of the gyrA gene is resistant to quinoline drugs, (2) the
introduced sensitive gyrA gene is present as the heterologous E.
coli gyrA::Mxe gyrA intein fusion or the native Mxe gyrA or M.
leprae gyrA genes, and (3) the intein containing drug sensitive
gyrA gene is operably linked with the appropriate signals for
expression in that host. Likewise, the Mxe GyrA intein could be
inserted into the gyrA gene of any experimental host cell just as
it was inserted into the E. coli gyrA gene. Likewise, any gyrA
intein can be used in the above selection system, whether present
at the same site as the Mxe GyrA intein or a different site.
[0066] Since sensitivity to quinoline drugs is dominantly
cytotoxic, in the presence of these drugs, a gyrA+/gyrA83 host cell
is not viable because wild type GyrA proteins can still bind drug
molecules and poison DNA replication (see FIG. 3B). The
co-expression of a chicken .alpha.-spectrin peptide library (as
described in U.S. Pat. No. 5,834,247 supra. at Example 17) allows
for the positive selection of peptides that can disrupt splicing of
the Mxe GyrA intein. Likewise, this system can be used to screen
for any agent that inhibits splicing of the Mxe GyrA intein in vivo
or for Mxe GyrA intein mutations that block splicing.
Insertion of the Mxe GyrA Intein (IVPS) Gene into the Homologous
Site in the E. coli GyrA Gene
[0067] In some Mycobacteria, the gyrase A subunit active site is
often interrupted by a naturally occurring allelic intein (IVPS)
near the active site tyrosine residue (e.g., Mycobacterium
flavescens, Mycobacterium gordonae, Mycobacterium kansasii,
Mycobacterium leprae, Mycobacterium malmoense and Mycobacterium
xenopi, (Sander, et al., Microbiology, 144:589-591 (1998), Telenti,
et al., J. Bacteriol., 179:6378-6382 (1997), Perler, et al.,
Nucleic Acids Res. 27:346-347 (1999), Southworth, BioTechniques,
27:110-121 (1999)). The M. xenopi (Mxe) GyrA intein (IVPS) utilized
in the system described herein, lacks the endonuclease signature
motifs and other sequences similar to homing endonucleases and has
been extensively studied as a prototype minimal intein (IVPS)
(Klabunde, et al., Nature Struct. Biol. 5:31-36 (1998), and
Telenti, et al., J. Bacteriol., 179:6378-6382 (1997) and Southworth
BioTechniques, 27:110-121 (1999)). The most favorable insertion
site for the Mxe GyrA intein in E. coli GyrA is the homologous
insertion site compared to the native Mxe GyrA extein, since it
shares sequence identity with the native Mxe GyrA extein (FIG. 3D).
The intein (IVPS) insertion site was chosen immediately upstream of
the conserved tyrosine active site residue at position 122 in E.
coli GyrA: TABLE-US-00001 D S A A A M R Y122 c i t - - - s h n T123
E I R L A K I (SEQ ID NO:14) (SEQ ID NO:45)
[0068] Amino acid numbers refer to the position of the amino acids
in E. coli GyrA (see SEQ ID NO:1 for a partial E. coli GyrA
sequence). The underlined amino acids (single letter amino acid
code) are the amino acids identical in both E. coli and Mxe GyrA
exteins (see FIG. 3D). The lower case letters represent Mxe GyrA
intein (IVPS) amino acids. The dashes represent the remainder of
the residues of the Mxe GyrA intein (IVPS) that are not listed (see
SEQ ID NO:2, for the complete Mxe GyrA intein sequence).
[0069] First, the E. coli gyrA gene was cloned by polymerase chain
reaction (PCR) using E. coli K12 genomic DNA under the following
experimental conditions. A forward primer 5'-GATA
GGCTAGCGATGAGCGACCTTGCGAGAG-3' (SEQ ID NO:15) and reverse primer
5'-TGAAGCAATTGAATTATTCTTCTTCTGGCTCG-3' (SEQ ID NO:16) were used in
a PCR mixture containing 20 U/ml Vent.RTM. Exo+DNA polymerase (New
England Biolabs, Inc., Beverly, MA), 400 .mu.M of each dNTP, 4 nM
each primer and 100 ng of E. coli K12 genomic DNA. Amplification
was carried out in a Perkin-Elmer/Cetus (Emeryville, Calif.)
thermal cycler 480 for 1 min at 95.degree. C. and then cycled at
45.degree. C., 30 sec; 72.degree. C., 2 min and 30 sec; 95.degree.
C., 30 sec for 20 cycles. The PCR products from one 50 .mu.l PCR
reaction and 2 .mu.g of pCYB1 (IMPACT.TM. I kit, New England
Biolabs, Inc., Beverly, Mass.) were separately digested with 250
U/ml of NheI and 1000 U/ml of MfeI in the presence of 100 .mu.g/ml
of BSA. The digestion was performed at 37.degree. C. for 1 hour.
Digested PCR products and plasmid DNA were separated by agarose gel
electrophoresis and the excised bands further purified using QIAEX
II beads as described by the manufacturer (Qiagen, Studio City,
Calif.). Ligation was carried out at 20.degree. C. for 1 hour using
a 1:4 ratio of vector to insert and 40,000 U/ml of T4 ligase.
Ligation products were transformed into E. coli strain ER2267
competent cells. Recombinant plasmids were checked by NheI/MfeI
digestion which results in the excision of the cloned insert in
properly ligated recombinants. One of the resultant correct
plasmids containing the E. coli gyrA gene placed under
transcriptional control of the pCYB1 pTac promoter was named
pEA500. The gyrA insert was checked by DNA sequencing to insure
that no sequence error was introduced by PCR.
[0070] Second, to facilitate cloning of the Mxe GyrA intein into E.
coli GyrA, unique silent NotI and XbaI restriction enzyme sites
were engineered 7 bp and 44 bp, respectively, away from each side
of the E. coli GyrA active site residue, Y122 of pEA500 by
site-directed silent mutagenesis. The QuickChange kit was used
following the manufacturer's instructions (Stratagene, La Jolla,
Calif.) with mutagenic primers: NotI oligonucleotides:
5'-CGGCGACTCTGCGGCCGCAATGCGTTATA CGG-3' (SEQ ID NO:17) and
5'-CCGTATAACGCATTGCGGCCGCA GAGTCGCCG-3' (SEQ ID NO:18), and XbaI
oligonucleotides: 5'-GAACTGATGGCCGCTCTAGAAAAAGA GACGG-3' (SEQ ID
NO:19) and 5'-CCGTCTCITTTTCTAGAGCGGCCA TCAGTTC-3' (SEQ ID NO:20).
The resultant plasmid containing E. coli GyrA with NotI and XbaI
restriction enzyme sites was called pEA502.
[0071] Third, a 68 bp DNA cassette with flanking NotI/XbaI
restriction sites was designed to be cloned into the pEA502 unique
NotI/XbaI sites. This cassette introduced a unique BlpI silent
restriction enzyme site 10 bp away from Y122, which subsequently
allowed cloning of any intein (IVPS or CIVPS) near the E. coli GyrA
active site Y122 using NotI and BlpI restriction enzyme sites. This
cassette was generated by annealing 2 complementary
oligonucleotides: 5'-GGCCGCAA
TGCGTTATACGGAAATCCGCTTAGCGAAAATTGCCCATGAACTGATGG CCGAT-3' (SEQ ID
NO:21) and 5'-CTAGATCGGCATCAGTTCATG
GGCAATTTTCGCTAAGCGGATTTCCGTATAACGCATTGC-3' (SEQ ID NO:22). 5 nM of
each oligonucleotide was combined in 1.times. T4 ligase buffer (New
England Biolabs, Inc., Beverly, Mass.), boiled for 5 min and cooled
down to room temperature. 10 .mu.g of pEA502 were digested with
NotI and XbaI using 500 U/ml each enzyme in the presence of 100
.mu.g/ml of BSA. The digestion was performed at 37.degree. C. for 2
hours. The digested plasmid DNA was separated by agarose gel
electrophoresis and the excised band further purified using QIAEX
II beads as described by the manufacturer (Qiagen, Studio City,
Calif.). Ligation of the oligonucleotide cassette and the digested
plasmid DNA was carried out at 20.degree. C. for 1 hour using a 1:2
ratio of vector to insert and 40,000 U/ml of T4 ligase. Ligation
products were transformed into E. coli strain ER2267 competent
cells. Recombinant plasmids were checked by BlpI digestion, which
results in the linearization of the correct recombinant plasmids.
One of the resultant correct plasmids was named pEA523.
[0072] Fourth, the Mxe GyrA intein (IVPS) was amplified by PCR with
the addition of primer derived NotI and BlpI sites using
pMIP(Mxe)#4 plasmid DNA (Telenti et al., J. Bacteriol,
179:6378-6382 (1997)) under the following experimental conditions:
Forward primer 5'-CGACCCGCGCGGCCGCAATGC GTTATTGCATCACGGGAG-3' (SEQ
ID NO:23) and reverse primer
5'-GCCAAAGGCGCTAAGCGGATTTCCGTGTTGTGGCTGACGAACC CG-3' (SEQ ID NO:24)
were used in a PCR mixture containing 10 U/ml Taq DNA polymerase
(Promega, Madison, Wis.), 200 .mu.M of each dNTP, 4 nM each primer
and 100 ng pMIP(Mxe)#4 DNA. Amplification was carried out in a
Perkin-Elmer/Cetus (Emeryville, Calif.) thermal cycler 480 at
94.degree. C., 30 sec; 50.degree. C., 30 sec; 72.degree. C., 15 sec
for 10 cycles. The PCR products of one 50 .mu.l reaction and 2
.mu.g of pEA523 were separately digested using 1000 U/ml of NotI
and 300 U/ml of BlpI in the presence of 100 .mu.g/ml of BSA. The
digestion was performed at 37.degree. C. for 2 hours. Digested PCR
products and plasmid DNA were separated by agarose gel
electrophoresis and the excised bands further purified using QIAEX
II beads as described by the manufacturer (Qiagen, Studio City,
Calif.). Ligation was carried out at 20.degree. C. for 2 hours
using a 1:3 ratio of vector to insert and 40,000 U/ml of T4 ligase
(New England Biolabs, Inc., Beverly, Mass.). Ligation products were
transformed into E. coli strain Top10F' (Invitrogen, Carlsbad,
Calif.) competent cells. Recombinant plasmids were checked by EcoNI
restriction enzyme digestion, which results in the linearization of
the correct recombinant plasmids. One of the resultant correct
plasmids was named pEA600 and contains the in-frame insertion of
the Mxe GyrA intein (IVPS) into the E. coli GyrA extein at the
active site Y122 (see FIGS. 3D and 3E).
Construction of a Vector for Co-Expression of a Peptide Library and
the Mxe GyrA Intein (IVPS)::E. coli GyrA Selection System
[0073] As described above, the Mxe GyrA intein (IVPS) was inserted
into the active site of E. coli GyrA. In this homologous context,
the Mxe GyrA intein (IVPS) splices efficiently to produce active E.
coli GyrA. As is detailed below, the E. coli gyrA::Mxe gyrA intein
(IVPS) gene fusion described above was cloned under control of a T7
RNA polymerase promoter and introduced into E. coli, ER2726 (New
England Biolabs, Inc., Beverly, Mass.). ER2726 expresses T7 RNA
polymerase and has the gyrA83 mutation that makes the chromosomal
gyrA gene resistant to quinoline drugs. In the presence of
quinoline drugs such as ofloxacin, only splicing deficient clones
can survive (see FIGS. 3B and 3C), since the spliced gyrA product
is sensitive to ofloxacin in a dominant cytotoxic manner (see
above).
[0074] The spectrin scaffold was cloned into EA600 as follows.
First, a 30 bp DNA cassette with flanking PflMI/ApaI restriction
sites was designed to be cloned into the unique PflMI/ApaI sites in
pEA600 (which also contains the E. coli gyrA::Mxe gyrA fusion).
This cassette introduced a unique SphI site in place of the
lacI.sup.q gene and was synthesized by annealing 2
oligonucleotides: 5'-ATGGGCATGCATATATATA TAGGCCTGGGCC-3' (SEQ ID
NO:25) and 5'-CAGGCCTATATATAT ATGCATGCCCATTCG-3' (SEQ ID NO:26). 5
nM of each oligonucleotide was combined in 1.times. T4 ligase
buffer (New England Biolabs, Inc. Beverly, Mass.), boiled for 5 min
and cooled down to room temperature. 5 .mu.g of pEA600 was digested
using 320 U/ml of PflMI and 800 U/ml of ApaI in the presence of 100
.mu.g/ml of BSA. The digestion was performed at 37.degree. C. for 2
hours. The digested plasmid DNA was separated by agarose gel
electrophoresis and the excised band further purified using QIAEX
II beads as described by the manufacturer (Qiagen, Studio City,
Calif.). Ligation was carried out at 16.degree. C. for 1 hour using
a 1:1 ratio of vector to insert and 40,000 U/ml of T4 ligase.
Ligation products were transformed into E. coli strain XL1B
(Stratagene, La Jolla, Calif.) competent cells. Recombinant
plasmids were checked by SphI digestion which results in the
linearization of the correct recombinant plasmids. One of the
resultant correct plasmids was named pEA661.
[0075] Second, unique SgfI and sites ClaI were engineered on either
side of the spectrin loop region in a spectrin encoding plasmid
(Trave, et al., EMBO J. 14:4922-4931 (1995)) by site-directed
silent mutagenesis using the QuickChange kit as described by the
manufacturer (Stratagene, La Jolla, Calif.). The Sgfl
oligonucleotides were: 5'-GTTTAAGTCTTGCTTGCGATC
GCTTGGCTATGACCTGCC-3' (SEQ ID NO:27) and 5'-GGGCAGGT
CATAGCCAAGCGATCG CAAGCAAGACTTAAA-3' (SEQ ID NO:28) and ClaI
oligonucleotides were: 5'-GCCTGACCCCGAATTTGAATC
GATTCTTGACACTGTTG-3' (SEQ ID NO:29) and 5'-CAACAGTGT
CAAGAATCGATTCAA ATTCGGGGTCAGGC-3' (SEQ ID NO:30). The resulting
plasmid was called pEA670.
[0076] Third, the SgfI/ClaI mutated spectrin gene was cloned by PCR
into pEA661 under the following experimental conditions. A forward
primer 5'-AATGGTGCATGCAAGGAGATGGCGCCCAAC AGTC-3' (SEQ ID NO:31) and
reverse primer 5'-GCTTTGGCTAG CTTTCCTGTGTCACCTGCTGATCATGAACG-3'
(SEQ ID NO:32) were used as described in the Expand High Fidelity
PCR system (Boehringer Mannheim, Indianapolis, Ind.) in the
presence of 1.times. buffer 2 (New England Biolabs, Beverly, Mass.)
and 50 ng of pEA670 DNA. Amplification was carried out in a
Perkin-Elmer/Cetus (Emeryville, Calif.) thermal cycler 480,
94.degree. C., 30 sec; 45.degree. C., 30 sec; 72.degree. C., 45
sec; for 15 cycles. The PCR products of one 50 .mu.l tube and 5
.mu.g of pEA661 were NheI/SphI digested using 250 U/ml of each
enzyme. The digestion was performed at 37.degree. C. for 2 hours.
Digested PCR products and plasmid DNA were separated by agarose gel
electrophoresis and the excised bands further purified using QIAEX
II beads as described by the manufacturer (Qiagen, Studio City,
Calif.). Ligation was carried out at 16.degree. C. for 1 hour using
a 1:5 ratio of vector to insert and 40,000 U/ml of T4 ligase (New
England Biolabs, Inc., Beverly, Mass.). Ligation products were
transformed into E. coli strain Novablue DE3 (Novagen, Madison,
Wis.) competent cells. Recombinant plasmids were checked by
NheI/SphI digestion which results in the excision of the cloned
insert. One of the resultant correct plasmids was named pEA671.
[0077] Fourth, the first E. coli gyrA PvuI site in pEA671 was
eliminated by site-directed silent mutagenesis using the
QuickChange kit as described by the manufacturer (Stratagene, La
Jolla, Calif.) and oligonucleotides 5'-GCGTAAAGCTCGCGACC
GTGCTCATATCC-3' (SEQ ID NO:33) and 5'-GGATATGAGCACGGTC
GCGAGCTTTACGC-3' (SEQ ID NO:34), resulting in plasmid pEA681.
[0078] Fifth, the 200 bp Acc65I/HindIII fragment from pEA681 was
transferred to pEA671 replacing the Acc691/HindIII fragment of
EA671. Plasmids pEA671 and pEA681 were digested in 1.times. buffer
2 (New England Biolabs, Inc., Beverly, Mass.) using 500 U/ml of
Acc65I and 500 U/ml of HindIII (New England Biolabs, Inc., Beverly,
Mass.). The digestion was performed at 37.degree. C. for 2 hours.
Digested plasmids were separated by agarose gel electrophoresis and
the excised bands further purified using QIAEX II beads as
described by the manufacturer (Qiagen, Studio City, Calif.).
Ligation was carried out at 16.degree. C. for 3 hours using a 1:3
ratio of vector to insert and 40,000 U/ml of T4 ligase (New England
Biolabs, Inc., Beverly, Mass.). Ligation products were transformed
into E. coli strain XL1B (Stratagene, La Jolla, Calif.) competent
cells. Recombinant plasmids were checked by PvuI digestion. One of
the resultant correct plasmids was named pEA682. This plasmid
contains both the .alpha.-spectrin peptide library and the E. coli
gyrA::Mxe gyrA intein-based selection system on the same plasmid,
both under control of a T7 RNA polymerase promoter (FIG. 5A).
A Theoretical Screening for Peptides that Disrupt Protein Splicing
of the Mxe GyrA Intein (IVPS) in E. coli GyrA.
[0079] In the theoretical embodiment detailed below, random
peptides of 7-12 amino acids would be inserted in-frame into the
loop between the 2 EF-hand motifs of .alpha.-spectrin, contained,
as described above, on the same plasmid as E. coli gyrA::Mxe gyrA
intein fusion. The resulting plasmids would be electro-transformed
into strain ER2726 (New England Biolabs, Inc., Beverly, Mass.).
Transformants would be selected in LB liquid growth media in the
presence of ampicillin, ofloxacin (Sigma, St. Louis, Mo.) and IPTG
to allow selection against the splicing proficient clones.
Ampicillin selects for the presence of the plasmid and ofloxacin
selects for peptides that block splicing, since the spliced E. coli
GyrA protein would be sensitive to the drug and lead to cell death.
Plasmid DNA would be isolated from selected clones and digested
with SgfI and ClaI to isolate DNA fragments encoding the selected
spectrin peptides. The spectrin DNA loop fragments would then be
cloned back into the original selection plasmid. Iterative rounds
of drug selection and "back-cloning" would be performed (FIG. 5B).
Iterative screening helps enrich for agents that truly block
splicing while eliminating clones that survived selection because
of some other mutation or anomaly. Final selected clones would be
grown individually in liquid culture and the plasmid-encoded E.
coli GyrA specifically induced by IPTG. Crude protein cell extracts
would be electrophoresed and blotted for immuno-staining. Clones in
which the E. coli GyrA spliced product was not detected would be
considered positives, i.e. clones in which splicing had been
disrupted, potentially by the selected peptide.
[0080] The random peptide library would be synthesized in vitro
using the following protocol, as was done in Example II. A single
strand/double strand DNA hybrid cassette would be synthesized by
annealing 2 oligonucleotides: 5'-TGTCAAGAATC
GATTCAAATTCGGGGTCAGGCTCTCC((W)NN).sub.7-12ATAGCCAAGCGA T-3' (SEQ ID
NO:35) and 5'P-CGCTTGGCTAT-3' (SEQ ID NO:36). 5 .mu.g of
oligonucleotide SEQ ID NO:35 and 3 molar equivalents of
oligonucleotide SEQ ID NO:36 would be mixed together in the
presence of 0.1 M NaCl in a final volume of 50 .mu.l. The mixture
would then be boiled and immediately cool down to room temperature
in the same boiler. The single stranded random nucleotide part of
the DNA hybrid cassette formed by annealing of the 2 oligos would
be extended using 400 .mu.M of each dNTPs and 60 U/ml of Klenow DNA
polymerase (New England Biolabs, Inc., Beverly, Mass.) in a final
volume of 200 .mu.l in 1.times. EcoPol buffer (New England Biolabs,
Beverly, Mass.). The extension reaction would be left 20 minutes at
37.degree. C. and further purified using QIAEX II beads as
described by the manufacturer (Qiagen, Studio City, Calif.). 60
.mu.g of pEA682 (50 .mu.g/ml) would be digested in 1.times. Buffer
2 (New England Biolabs, Inc., Beverly, Mass.) using 250 U/ml of
SgfI (Promega, Madison, Wis.) and 500 U/ml of BspDI (New England
Biolabs, Inc., Beverly, Mass.) (an isoschizomer of ClaI) in the
presence of 100 .mu.g/ml of BSA. The digestion would be performed
at 37.degree. C. for 2 hours. Purified cassettes (50 .mu.l) would
then be digested in 1.times. Buffer 4 (New England Biolabs, Inc.,
Beverly, Mass.) using 500 U/ml of ClaI (New England Biolabs, Inc.,
Beverly, Mass.) in the presence of 100 .mu.g/ml of BSA. Cassettes
would be further purified using QIAEX II beads as described by the
manufacturer (Qiagen, Studio City, Calif.). Digested plasmid DNA
would be electrophoresed on 0.7% agarose gel and the excised bands
further purified using QIAEX II beads as described by the
manufacturer (Qiagen, Studio City, Calif.). Ligation would be
carried out at 16.degree. C. for 1 hour using a 1:1 ratio of vector
(2 ng/.mu.l) to insert and 1,600 U/ml of T4 ligase (New England
Biolabs, Inc., Beverly, Mass.). Ligation products would then be
electro-transformed into E. coli strain ER2744 (New England
Biolabs, Inc., Beverly, Mass.) competent cells (10.sup.9 pUC18
transformants/.mu.g) using 1-2 .mu.g of total ligated plasmid for
each 200 .mu.l aliquot of competent cells, at 2.5 kV/cm in a 2 mm
cuvette (BIORAD, Richmond, Calif.). Cells would be allowed to
recover in a shaker for 1 hour at 37.degree. C. Recovered
transformants would be inoculated at 1/100 dilution ratio into LB
liquid growth media containing appropriate amounts of ofloxacin
(Sigma, St. Louis, Mo.), 100 .mu.g/ml of ampicillin and 1 mM IPTG.
Transformants would be incubated overnight at 37.degree. C. Plasmid
DNA would be isolated from a 100 ml of the overnight culture using
a tip100 column (QIAGEN, Studio City, Calif.), ClaI/SgfI digested
as above and electrophoresed on a 4% GTG Nusieve agarose gel (FMC
BioProducts, Rockland, Me.). The 57 to 72 bp spectrin loop DNA
inserts (depending upon whether the peptide library contained 7 or
12 random amino acids) would be purified using QIAEX II beads as
described by the manufacturer (Qiagen, Studio City, Calif.) and
cloned back into SgfI/ClaI digested and purified selection plasmid
as described above. This protocol would be repeated 3 times to
enrich the pool of transformants for peptide clones having the most
biologically active sequences against the protein splicing of the
Mxe intein (IVPS). Finally selected clones would be grown
individually in 10 ml LB containing 100 .mu.g/ml ampicillin at
37.degree. C. and induced with 1 mM IPTG for 3 hours. Crude protein
cell extracts would be electrophoresed on a 10-20% gradient gel
(Novex, San Diego, Calif.). The gel would then be electro-blotted
for immuno-staining using anti-His tag antibodies (Sigma, St.
Louis, Mo.) to detect GyrA::Mxe intein (IVPS) protein splicing
products. One would expect to see the absence of spliced product.
The clones would then be sequenced to determine the amino acid
sequences which had been selected.
Hypothetical Screening with Agents that Inhibit Splicing
[0081] At this stage, the vector, pEA600, is amenable for screening
with any type of agent that blocks splicing, using a similar
screening protocol as for peptides that block splicing, described
above. However, in this case, pEA600 or similar plasmids can be
directly screened without having to clone the peptide library
contained within the chicken .alpha.-spectrin gene as described
above. The protocol would involve treating individual cultures with
single or pooled agents that can enter the cell and looking for
cell growth, using any means known to one skilled in the art.
Agents that block splicing allow the cell to grow in the presence
of ofloxacin
Summary
[0082] In summary, we describe the cloning of the Mxe gyrA intein
gene into the E. coli gyrA extein gene for use in selecting for
agents that inhibit splicing. The Mxe GyrA intein splices well in
the E. coli GyrA extein, resulting in production of active E. coli
GyrA protein. The E. coli GyrA extein was used with the Mxe GyrA
intein because the Mle GyrA intein did not splice efficiently in E.
coli in its native context and the precursor was mostly insoluble
in E. coli. Because the GyrA intein and extein sequences are very
similar (Telenti, et al., J. bacteriol, 179:6378-6382 (1997) and
Perler, et al., Nucleic Acids Res. 27:346-347 (1999)), mixing and
matching of inteins, exteins and experimental hosts resulted in an
efficient model system for examining agents that modulate splicing
of GyrA inteins, using exteins that have similar insertion sites
and therefore similar splicing active sites as in the native
context.
EXAMPLE II
A M. Tuberculosis DnaB Intein-Mediated Positive Selection
System
A Positive Selection System Using the Mtu DnaB Intein (IVPS) in its
Native Mtu DnaB Extein in E. coli: Background
[0083] The hexameric E. coli helicase encoded by the dnaB gene
interacts with an hexameric DnaC complex and ATP. Some DnaB mutants
are dominant lethal (Bouvier and Oreglia, C.R. Acad. Sci. Hebd.
Seances Acad. Sci. D., 280:649-652 (1975), Maurer and Wong, J.
Bacteriol 170:3682-3688 (1988), Saluja and Godson, J. Bacteriol.
177:1104-1111 (1995) and Sclafani, et al., Mol. Gen. Genet.,
182:112-118 (1981)). By dominant or dominantly cytotoxic, we mean
that the toxicity occurs even if homologous proteins are present
which are not cytotoxic or resistant to the drug, i.e., the
cytotoxic effect dominates irrespective of the presence of
non-cytotoxic homologs. The mutant protein is deficient in ATP
hydrolysis, helicase activity, and replication activity at the
chromosomal origin of replication resulting in cell death (see FIG.
4A). Despite only moderate protein sequence identity between
bacterial helicases, arginine 231 is located in a conserved motif
proposed to interact directly with DnaC (Marszalek and Kaguni, J.
Biol. Chem., 267:19334-19340 (1992) and Shrimankar, et al., J.
Bacteriol., 174:7689-7696 (1992)). M. tuberculosis (Mtu) DnaB has a
naturally occurring intein at the carboxy-terminus and an arginine
at position 227 homologous to arginine 231 of E. coli DnaB (see
FIG. 4D).
[0084] We have demonstrated proficient protein splicing of the Mtu
DnaB intein (IVPS) from the Mtu DnaB precursor protein in E. coli
and also have shown that the R227C mutation results in dominant
lethality. Therefore, a merodiploid cell containing a wild type
dnaB gene and a Mtu DnaB (R227C) gene is not viable unless protein
splicing can be disrupted (see FIGS. 4B and 4C). By merodiploid we
mean that the cell contains an extra copy of a gene (or several
genes) which has been introduced into the cell by any means known
to one skilled in the art, such as transformation, infection,
conjugation, plasmids, virus, phage, or by generating a transgenic
strain and which may be present on either an episomal element or on
the host chromosome. The co-expression of a chicken
.alpha.-spectrin peptide library (as described in U.S. Pat. No.
5,834,247 supra. at Example 17) allows for the positive selection
of peptides that can disrupt splicing of the M. tuberculosis DnaB
intein (see FIG. 5A). Likewise, this system can be used to screen
for any agent that inhibits splicing of the Mtu DnaB intein or any
other DnaB intein in vivo or for DnaB intein mutations that block
splicing.
Construction of a Positive Selection System Using the Mtu DnaB
Intein (IVPS) in its Native Mtu DnaB Extein
[0085] As described in detail below, the Mtu dnaB gene has been
cloned by PCR under T7 RNA polymerase transcriptional control. In
E. coli, the Mtu DnaB intein (IVPS) splices very efficiently from
its natural precursor to produce the Mtu DnaB helicase. The Mtu
dnaB gene has been mutagenized at position 227 from arginine to
cysteine and the plasmid transformed into BL21 (DE3)-Gold
(Stratagene, La Jolla, Calif.). In the presence of the T7 RNA
polymerase (induced by IPTG) only splicing deficient clones can
survive (see FIG. 4C).
[0086] First, the Mtu dnaB gene was cloned by PCR using M.
tuberculosis H37Ra genomic DNA under the following experimental
conditions. A forward primer 5'-AGGTGAGAA TTCATGGCGGTCGTTGATGACC-3'
(SEQ ID NO:37) and reverse primer
5'-TATATAAAGCTTTCATGTCACCGAGCCATGTTGGCG-3' (SEQ ID NO:38) were used
as described in the Extend Long Template PCR system (Boehringer
Mannheim, Indianapolis, Ind.) in the presence of 1.times. buffer 3
and 100 ng of M. tuberculosis genomic DNA. Amplification was
carried out in a Perkin-Elmer/Cetus (Emeryville, Calif.) thermal
cycler 480 for 2 min at 94.degree. C. and then cycled at 45.degree.
C., 30 sec; 68.degree. C., 2 min; 95.degree. C., 1 min for 25
cycles. The PCR products of one 50 .mu.l reaction and 5 .mu.g of
pET21a (Novagen, Madison, Wis.) were digested using 1000 U/ml of
EcoRI and 800 U/ml of HindIII in 1.times. EcoRI buffer (New England
Biolabs, Inc., Beverly, Mass.). The digestion was performed at
37.degree. C. for 1 hour. Digested PCR products and plasmid DNA
were separated by agarose gel electrophoresis and the excised bands
further purified using QIAEX II beads as described by the
manufacturer (Qiagen, Studio City, Calif.). Ligation was carried
out at 16.degree. C. for 1 hour using a 1:5 ratio of vector to
insert and 40,000 U/ml of T4 ligase (New England Biolabs, Inc.,
Beverly, Mass.). Ligation products were transformed into E. coli
strain Novablue DE3 (Novagen, Madison, Wis.) competent cells.
Recombinant plasmids were checked by EcoRI/HindIII digestion which
results in the excision of the cloned inserts. One of the resultant
correct plasmids was named pEA807. The sequence of the dnaB insert
was checked by DNA sequencing.
[0087] Second, the 1200 bp BglII/SgrAI fragment from pEA682
containing the spectrin-based peptide library was transferred to
pEA807. Plasmids pEA682 and pEA807 were digested in 1.times. buffer
2 (New England Biolabs, Inc., Beverly, Mass.) using 500 U/ml of
BglII and 240 U/ml of SgrAI. The digestion was performed at
37.degree. C. for 1 hour. Digested plasmids were separated by
agarose gel electrophoresis and the excised bands further purified
using QIAEX II beads as described by the manufacturer (Qiagen,
Studio City, Calif.). Ligation was carried out at 16.degree. C. for
1 hour using a 1:5 ratio of vector to insert and 40,000 U/ml of T4
ligase (New England Biolabs, Inc., Beverly, Mass.). Ligation
products were transformed into E. coli strain ER2726 (New England
Biolabs, Inc., Beverly, Mass.) competent cells. Recombinant
plasmids were checked by ClaI/NcoI digestion. One of the resultant
correct plasmids was named pEA808.
[0088] Third, the Mtu dnaB gene was mutagenized to R227C by PCR
under the following experimental conditions. A forward primer
5'-AGGTGAGAATTCATGGCGGTCGTTGATGACC-3' (SEQ ID NO:39) and reverse
primer 5'-TTTCCCACGCCCGGGCaCGCCGC CACGATGACC-3' (SEQ ID NO:40) were
used as described in the Extend Long Template PCR system
(Boehringer Mannheim, Indianapolis, Ind.) in the presence of
1.times. buffer 3 (New England Biolabs, Inc., Beverly, Mass.) and
500 ng of pEA808 DNA. Amplification was carried out in a
Perkin-Elmer/Cetus (Emeryville, Calif.) thermal cycler 480 for 2
min at 94.degree. C. and then cycled at 45.degree. C., 30 sec;
72.degree. C., 45 sec; 95.degree. C., 1 min for 20 cycles. The PCR
products of one 50 .mu.l reaction and 2 .mu.g of pEA808 were
digested overnight at 37.degree. C. using 100 U/ml of EcoRI and 40
U/ml of SrfI in the 1.times.PCR-Script reaction buffer (Stratagene,
La Jolla, Calif.). Digested PCR products and plasmid DNA were
separated by agarose gel electrophoresis and the excised bands
further purified using QIAEX II beads as described by the
manufacturer (Qiagen, Studio City, Calif.). Ligation was carried
out at 16.degree. C. for 1 hour using a 1:1 ratio of vector to
insert and 40,000 U/ml of T4 ligase (New England Biolabs, Inc.,
Beverly, Mass.). Ligation products were transformed into E. coli
strain XL10-Kan (Stratagene, La Jolla, Calif.) competent cells.
Recombinant plasmids were checked by NdeI/AscI. One of the
resultant correct plasmids was named pEA809.
[0089] Fourth, the NotI dnaB-spectrin module was inverted on
plasmid pEA809. 2 .mu.g of pEA809 DNA was digested with 500 U/ml of
NotI at 37.degree. C. for 2 hours and digestion products split into
two tubes. One tube containing 1 .mu.g of NotI digested pEA809 was
incubated further with 100 U/ml Calf Intestinal Alkaline
Phosphatase (CIP, New England Biolabs, Inc., Beverly, Mass.) for 20
minutes at 37.degree. C. Digested plasmid DNA from both tubes was
separated by agarose gel electrophoresis and the excised bands
further purified using QIAEX II beads as described by the
manufacturer (Qiagen, Studio City, Calif.). Ligation of the vector
band from the CIP treated tube and the insert band from the CIP
untreated tube was carried out at 16.degree. C. for 1 hour using a
1:1 ratio of vector to insert and 40,000 U/ml of T4 ligase (New
England Biolabs, Inc., Beverly, Mass.). Ligation products were
transformed into E. coli strain XL1-Blue (Stratagene, La Jolla,
Calif.) competent cells. Recombinant plasmids were checked by SacI
digest. One of the resultant correct plasmids was named pEA810.
[0090] Fifth, the lacI.sup.q gene from pEA810 was removed and
replaced by a smaller DNA fragment from pBR322. pEA810 and pBR322
DNA were digested using 500 U/ml EcoRV and 500 U/ml HindIII in
buffer 2 (New England Biolabs, Inc., Beverly, Mass.) at 37.degree.
C. for 2 hours. Digested plasmid DNA was separated by agarose gel
electrophoresis and the excised bands further purified using QIAEX
II beads as described by the manufacturer (Qiagen, Studio City,
Calif.). Ligation of the pEA810 vector band and the pBR322 insert
band was carried out at 16.degree. C. for 1 hour using a 1:1 ratio
of vector to insert and 40,000 U/ml of T4 ligase (New England
Biolabs, Inc., Beverly, Mass.). Ligation products were transformed
into E. coli strain XL1-Blue (Stratagene, La Jolla, Calif.)
competent cells. One of the resultant correct plasmids was named
pEA813.
[0091] Sixth, the first Mtu R227C dnaB AatII site of pEA813 was
eliminated by site-directed silent mutagenesis using the
QuickChange kit (Stratagene, La Jolla, Calif.) and oligonucleotides
5'-GCCGCCGATCCGCGACATCGTAGATTTCGGCC-3' (SEQ ID NO:41) and reverse
primer 5'-GGCCGAAATCTACGA TGTCGCGGATCGGCGGC-3' (SEQ ID NO:42)
resulting in plasmid pEA832.
[0092] Seventh, the wild type intein containing Mtu DnaB gene of
plasmid pEA808 was shuffled back into pEA832. pEA808 and pEA813 DNA
were digested using 1.times. buffer 1 (New England Biolabs, Inc.,
Beverly, Mass.) with 500 U/ml EcoRI and 500 U/ml HindIII at
37.degree. C. for 1 hour. Digested plasmid DNAs were separated by
agarose gel electrophoresis and the excised bands further purified
using QIAEX II beads as described by the manufacturer (Qiagen,
Studio City, Calif.). Ligation of the pEA813 vector band and the
pEA808 insert band was carried out at 16.degree. C. for 1 hour
using a 1:1 ratio of vector to insert and 40,000 U/ml of T4 ligase
(New England Biolabs, Inc., Beverly, Mass.). Ligation products were
transformed into E. coli strain XL1-Blue (Stratagene, La Jolla,
Calif.) competent cells. One of the resultant correct plasmids was
named pEA825.
[0093] Eighth, the AatII site elimination in pEA825 was performed
identically as described for pEA813, resulting in plasmid
pEA835.
Screening for Peptides that Disrupt the Mtu DnaB Intein (IVPS)
Protein Splicing
[0094] The following is an actual experimental example
demonstrating the use of this system to select for peptides that
block splicing. As detailed below, random peptides of 7-12
amino-acids were inserted in-frame into the loop of the 2 EF-hand
motif of .alpha.-spectrin, contained, as described above, on the
same plasmid as the Mtu DnaB intein (IVPS) selection system. The
resulting plasmids were electro-transformed into the T7 RNA
polymerase E. coli strain ER2744 (New England Biolabs, Inc.,
Beverly, Mass.) (see FIGS. 5A and 5B). Transformants were selected
in LB liquid growth media in the presence of ampicillin and IPTG to
allow selection against the splicing proficient clones. Plasmid DNA
was isolated from selected clones and digested to isolate DNA
fragments encoding the selected spectrin peptides. The selected
spectrin loop region DNA was cloned back into the original
selection plasmid. Iterative rounds of selection and "back-cloning"
were performed (FIG. 5B). After selection, the selected spectrin
peptide was cloned into pEA825 (containing the non-toxic DnaB gene)
for expression analysis. Final selected clones were grown
individually in liquid culture and the plasmid-encoded Mtu dnaB
gene specifically induced by IPTG. Crude protein cell extracts were
electrophoresed and blotted for immuno-staining. Clones in which
the Mtu DnaB spliced product was not detected were considered
positives, i.e. clones in which splicing had been disrupted,
potentially by a selected peptide.
[0095] The random peptide library was synthesized in vitro using
the following protocol. A single strand/double strand DNA hybrid
cassette was synthesized by annealing of 2 oligonucleotides:
5'-TGTCAAGAATCGATTCAAATTCGGGGTC AGGCTCTCC((W)NN).sub.7-12
ATAGCCAAGCGATCGCAGGCAGCTTTT AAAGCCCTGATGGTTCAGACGT-3' (SEQ ID
NO:43) and 5'P-CTGAACCATCAGGGC-3' (SEQ ID NO:44). 5 .mu.g of
oligonucleotide SEQ ID NO:43 and 3 molar equivalents of
oligonucleotide SEQ ID NO:44 were mixed together in the presence of
0.1 M NaCl in a final volume of 50 .mu.l. The mixture was boiled
and immediately cooled down to room temperature in the same boiler.
The single strand random nucleotide part of the DNA hybrid cassette
formed by annealing of the 2 oligos was extended using 400 .mu.M of
each dNTPs and 60 U/ml of Klenow DNA polymerase (New England
Biolabs, Inc., Beverly, Mass.) in a final volume of 200 .mu.l in
1.times. EcoPol buffer (New England Biolabs, Inc., Beverly, Mass.).
The extension reaction was incubated 20 minutes at 37.degree. C.
and further purified using QIAEX II beads as described by the
manufacturer (Qiagen, Study City, Calif.). 60 .mu.g of pEA832 (50
.mu.g/ml) were digested in 1.times. Buffer 4 (New England Biolabs,
Inc., Beverly, Mass.) using 400 U/ml of AatII (New England Biolabs,
Inc., Beverly, Mass.) and 500 U/ml of ClaI (New England Biolabs,
Inc., Beverly, Mass.) in the presence of 100 .mu.g/ml of BSA. The
digestion was performed at 37.degree. C. for 2 hours. Synthesized
random cassettes (20 .mu.g/ml) were digested in 1.times. Buffer 4
(New England Biolabs, Inc., Beverly, Mass.) using 500 U/ml of ClaI
(New England Biolabs, Inc., Beverly, Mass.) in the presence of 100
.mu.g/ml of BSA. Cassettes were further purified using QIAEX II
beads as described by the manufacturer (Qiagen, Studio City,
Calif.). Digested plasmid DNA was electrophoresed on a 0.7% agarose
gel and the excised bands further purified using QIAEX II beads as
described by the manufacturer (Qiagen, Studio City, Calif.).
Ligation was carried out at 16.degree. C. for 1 hour using a 1:1
ratio of vector (2 ng/.mu.l) to insert and 1,600 U/ml of T4 ligase
(New England Biolabs, Inc., Beverly, Mass.). Ligation products were
electro-transformed into E. coli strain ER2744 (New England
Biolabs, Inc., Beverly, Mass.) competent cells (competency of
1.times.10.sup.9 pEA835 transformants/.mu.g) using 2 .mu.g of total
ligation product for each 200 .mu.l aliquot of competent cells, at
2.5 kV/cm in a 2 mm cuvette (BIORAD, Richmond, Calif.). Cells were
allowed to recover in a shaker for 1 hour at 37.degree. C.
Recovered transformants were inoculated at 1/100 dilution into LB
liquid growth media containing 100 .mu.g/ml of ampicillin and 1 mM
IPTG. Transformants were incubated overnight at 30.degree. C.
Plasmid DNA was isolated from the overnight culture using tip100
columns (QIAGEN, Studio City, Calif.)), AatII/ClaI digested as
above and electrophoresed on a 4% GTG Nusieve agarose gel (FMC
BioProducts, Rockland, Me.). The 57 to 72 bp spectrin loop DNA
inserts were purified using QIAEX II beads as described by the
manufacturer (Qiagen, Studio City, Calif.) and cloned back into
AatII/ClaI digested and purified selection plasmid (pEA832) as
described above. This protocol was repeated 3 times to enrich the
pool of transformants for peptide clones having the most
biologically active sequences against the protein splicing of the
Mtu DnaB intein (IVPS). Finally selected spectrin modules were
cloned into a pEA832 homologous plasmid containing the wild type
Mtu dnaB gene (pEA825) and grown individually in 10 ml LB
containing 100 .mu.g/ml ampicillin at 37.degree. C. and induced
with 1 mM IPTG for 3 hours. Crude protein cell extracts were
electrophoresed on a 10-20% gradient gel (Novex, San Diego,
Calif.). The gel was further electro-blotted for immuno-staining
using anti-T7 tag antibodies (Novagen, Madison, Wis.) to detect Mtu
DnaB protein splicing products (FIG. 5C). Lane Eco DnaB contains
extracts of T7-tagged E. coli DnaB without the intein. pMtuDnaB
contains extracts from a clone expressing only Mtu DnaB. Lanes
p814, p815, p816, p817, and p818 contain extracts of the clones
pEA814, pEA815, pEA816, pEA817, and pEA818, respectively, encoding
peptides selected for inhibition of splicing. To demonstrate that
the inhibition of splicing was due to the peptide inserted into the
chicken .alpha.-spectrin loop, the selected sequence of pEA818 was
replaced with the spectrin sequence, DLPMVEE (SEQ ID NO:10) to
generate clone pEA818rev, and extracts loaded on lane p818rev.
Splicing of pEA818rev occurred as efficiently as with the pMtu DnaB
clone that expresses the wild-type spectrin protein. Note that in
the absence of splicing, much of the DnaB precursor undergoes
cleavage at the intein C-terminal splice junction.
[0096] The sequence of the inserted peptides in these clones is as
follows: TABLE-US-00002 pEA814 TVQSTKR (SEQ ID NO:5) pEA815 RPAPRPL
(SEQ ID NO:6) pEA816 PTARTYE (SEQ ID NO:7) pEA817 PTRPTAPPLNFS (SEQ
ID NO:8) pEA818 HPNPHPTLSGQR (SEQ ID NO:9) pEA818rev DLPMVEE (SEQ
ID NO:10)
[0097] We have thus demonstrated that this system can be used to
select for peptides that block splicing of the Mtu DnaB intein.
This system is amenable to selection of any modulators of splicing
of the Mtu DnaB intein or other DnaB inteins, as long as the agent
can enter a cell.
EXAMPLE III
In Vivo Control of Protein Splicing for Chemotherapeutic Purposes
or to Make Controllable Gene Knockouts
[0098] The selection and screening systems described for selection
of agents that modulate protein splicing can also be applied to
intein-less versions of the extein gene to select for agents that
inhibit or activate the extein gene product. All of the selection
and screening systems described in this patent are based on the
activity or inactivity of the extein portion of the precursor. If
one deletes the intein from the intein-containing gene by methods
known to one skilled in the art, then one can select for agents
that block or activate extein activity also using the methods
described for inhibiting or activating splicing of the intein
containing precursor, since these latter methods involve assaying
extein function. For example, if one deletes the intein from the
Mtu DnaB gene by methods known to one skilled in the art, then one
can select for agents that block activity of the cytotoxic Mtu DnaB
protein using the methods described for inhibiting splicing of the
DnaB intein. M. tuberculosis can then be attacked using a cocktail
of two agents that block activity of the essential DnaB protein,
making it more difficult for the organism to develop resistance to
these agents.
[0099] We have previously described the insertion of a CIVPS or
IVPS into a foreign gene. In these cases, protein splicing could be
controlled by temperature, mutation, pH, photo-activated blocking
groups, phosphorylation or peptides (Comb, et al., U.S. Pat. No.
5,834,247 and Comb, et al., U.S. Pat. No. 5,496,714). In this
Example we describe a general method for selecting specific protein
splicing inhibiting or activating agents that are capable of
controlling protein splicing in vivo or in vitro. The methods are
equally applicable to genetic selection systems or reporter
systems. By genetic selection, we mean, in this Example, that
viability or growth rate of the test organism is monitored during
the experiment, while a reporter system in this Example refers to
the monitoring of a marker, such as color detection, fluorescence,
phenotype, etc., rather than cell viability. Genetic selection or
reporter systems are used to identify agents that can either
disrupt or catalyze protein splicing of a given intein, depending
on the context of the experiment. Any genetic selection or reporter
system known to one skilled in the art can be used to isolate
agents which disrupt or catalyze protein splicing. This strategy is
equally applicable to any intein present in a foreign context or in
its native or homologous context (e.g., the insertion of an intein
at the same position in an homologous extein). However, use of the
native extein is preferable because it best represents the enzyme
target of the intein. If the native precursor does not express well
or splice well in the experimental host organism, then the intein
can be inserted into the same site in that host organism's homolog
of the native extein or in another extein homolog with desired
properties for testing, using any method known to one skilled in
the art or described in the previous Examples. This method of
finding agents that modulate splicing is applicable to any host, as
long as the protein splicing precursor is operably linked to the
appropriate control signals for transcription and translation in
that host. As the target organism may not be an easy experimental
model for identifying agents that modulate protein splicing, the
agent may first be identified in a model system and then tested in
the final target organism. This strategy is summarized in FIG.
8.
[0100] Experiments involving inhibition of splicing start with a
precursor that contains a fully active intein that may or may not
be controllable. The goal of this experiment is to find agents that
can be used to control splicing of this intein. In experiments
involving activation of splicing, a CIVPS (controllable intein) or
an inactive intein is required, as the goal is to find agents that
activate the previously inactive intein. The intein may be
inactivated by any means known to one skilled in the art, such as
temperature sensitive inteins, inteins with mutations in amino
acids known to be involved in catalysis that slow down or block
splicing (including the conserved amino acids at both splice
junctions and in intein Block B, (Perler, Nucleic Acids Res. 25:
087-1093 (1997), Pietrokovski, Protein Sci., 3:2340-2350 (1994))
inteins which have been randomly mutated and selected for
inhibition or blockage of splicing.
[0101] A positive selection system is preferred. In general, a
positive selection system consists of a gene that is detrimental to
a host organism depending on the growth media or the host strain
genetic background. The gene product is static or lethal for the
cell, killing the host or preventing growth unless the gene product
is inactivated. The gene product may be directly cytotoxic to the
host in a dominant manner, as in the DnaB example (Example II) or
it may be dominantly cytotoxic in response to a drug which the
chromosomal copy of the gene is resistant to, as in the GyrA
example (Example I). By dominant or dominantly cytotoxic, we mean
that the toxicity occurs even if homologous proteins are present
which are not cytotoxic or resistant to the drug, i.e., the
cytotoxic effect dominates irrespective of the presence of
non-cytotoxic homologs. In the context of a protein splicing
inhibition system, positive selection involves a system that allows
selection against the splicing of an IVPS or intein. If splicing
occurs, the cytotoxic extein protein will be active and kill the
cell or inhibit growth; if splicing is disrupted, the cytotoxic
extein protein will be inactive and cells will grow. Cell growth
can be monitored by any means known to one skilled in the art,
including, but not limited to observation of a colony on solid
media, optical density, monitoring of fluorescent reporters of cell
growth such as green fluorescent protein of luciferase activity.
The extein gene may be an unrelated reporter system or the natural
extein of the intein (either using the natural precursor or
inserting the intein into a homologous extein context) (FIG. 8). In
this context, selection systems have the advantage that only agents
that inhibit splicing allow cell growth and are thus easily found
amongst the background of agents that have no effect on splicing or
are directly toxic to the cell. If the agents to be tested are also
expressed in the host cell, then one examines the colonies that
survive on the plate. If the agent to be tested is not expressed in
the host cell, but is instead added to the media, then aliquots of
host cells must be arrayed for testing with individual agents or
pools of agents in any number of devices, such as microtiter
dishes. In such cases, cell growth may be more easily measured if
the cells express a protein that leads to fluorescence, such as
green fluorescent protein or luciferase.
[0102] When selecting for agents that activate splicing, the intein
is already present or is inserted into a gene whose protein product
is required for cell growth. In the absence of splicing, the cell
fails to grow or dies. In order to practically employ this
selection system, a second gene is present which can rescue the
cell in the absence of splicing. This second copy of the gene
should be controllable, by methods such as a temperature
sensitivity or controllable promoters, to allow cell growth until
the agent which activates splicing is applied or induced in the
cell. The cells are treated with the splicing activator and then
moved to the nonpermissive condition for activity of the second
gene product that does not contain the intein or expression of this
gene is turned off. Cell growth will then require splicing since
the second gene product lacking the intein is no longer active.
[0103] Another method for identifying agents that modify protein
splicing involves screening rather than genetic selection.
Screening systems employ reporter genes whose products can be
readily assayed, but do not necessarily affect cell growth. Many
reporter systems are known, such as the blue/white
.beta.-galactosidase screening system. .beta.-galactosidase acts on
X-gal, for example, to generate a blue color; in the absence of
.beta.-galactosidase activity, the X-gal remains uncolored or
`white`. Other reporters include those described in Burns and
Beacham, Gene, 27:323-325 (1984) and Mechulam, et al., J.
Bacteriol., 163:787-791 (1985). One can use native precursors if
reporter systems are available for those extein genes or the intein
can be cloned into the reporter gene (.beta.-galactosidase in this
Example) (see for example, Belfort, U.S. Pat. No. 5,795,731 and
Comb, et al., U.S. Pat. No. 5,834,247). Agents that inhibit
splicing of an otherwise active intein will block reporter protein
functions, such as .beta.-galactosidase action on X-gal, resulting
in white instead of blue clones. Agents that activate splicing of
an otherwise inactive or slowly acting intein restore reporter
protein functions, resulting in blue clones using the
.beta.-galactosidase system as an example. If the agents to be
tested are also expressed in the host cell, then one examines the
colonies that survive on the plate. If the agent to be tested is
not expressed in the host cell, but is instead added to the media,
then aliquots of host cells must be arrayed for testing with
individual agents or pools of agents in any number of devices, such
as microtiter dishes. Unlike selection, all cells grow in reporter
systems and one must determine whether the read out is positive or
negative for each colony or microculture.
[0104] Previous Examples have described genetic selection systems
based on the pheS non-homologous selection system and the gyrA and
dnaB intein/extein systems. This Example describes how one would
screen for agents that modulate splicing using any selection or
reporter system. Note that the selection or screening systems may
not have been originally identified in the organism containing the
intein. However, if a selection or screening system has been
described for the extein homolog, it can be adapted to the intein
containing homolog. As in the case of DnaB, the same mutation can
be made in the intein containing homolog to generate a selectable
phenotype for the intein containing extein gene. As in the case of
GyrA, the screening system can involve a chromosomal mutation that
leaves the host resistant to a drug; all that need be done is to
show that the intein containing homolog is also sensitive to the
drug.
[0105] Iterative screening (FIG. 5B) provides a method of
identifying lead compounds and reducing background and can be used
in any of the schemes described below. Iterative screening involves
repeated cycles of testing of the agent on fresh extein genes. It
helps insure that the agent is not acting on a mutated extein,
which could also be a by-product of screening.
Positive Selection Systems for Inhibition or Activation of Protein
Splicing of an Intein in its Natural Precursor or an Extein
Homolog
[0106] In this case, the intein of interest is naturally found in a
target gene which can naturally serve as a selectable marker or
reporter or which can be converted into a selectable marker or
reporter. Initial experiments may be performed in the target
organism or an experimentally more amenable model host such as
bacteria, E. coli, yeast, mammalian cells, insect cells, etc. The
decision as to whether to use the natural splicing precursor to
select for agents that block splicing or to first insert the intein
gene into a homologous extein gene from a model organism depends on
the similarity amongst the extein genes, the ability of the natural
precursor or recombinant precursors to express in the model hosts
used for selection or screening, and the ability of each precursor
to splice in the model hosts. (FIG. 8) These parameters will have
to be experimentally determined, although the more similar the
extein sequences, the more likely that splicing will work in the
homologous extein protein from the model organism. Sequence
comparison will indicate the appropriate homologous intein
insertion site in the homologous extein gene from the model
organism.
[0107] Next, one has to determine by a literature search whether
any genetic selection systems or screens are available for the
target extein in any organism and whether the extein gene is
essential for cell growth in any organism. If the target gene is
essential, but no genetic selection or screens are available, it
can be mutagenize directly or in model systems to attempt to
generate a selection or reporter system. If the target gene product
is essential to the cell, under defined conditions, the host gene
can be either knocked out and replaced by a controllable copy of
the gene or mutated to generate a temperature sensitive activity.
The intein containing gene must the produce an active product when
the host gene homolog is inactivated. A temperature sensitive
phenotype can easily be generated by random or rational mutation by
one skilled in the art. Once a selection system has been identified
and the best splicing precursor has been determined (selecting from
the naturally occurring precursor, or after inserting the intein
into the homologous extein from the target or selection organism),
testing for agents that block splicing can begin in either a model
organism or the target organism, depending on ease of use. Some of
the possible schemes for identifying agents that block or activate
splicing are shown in FIG. 9.
[0108] Scheme 1 is a method for selecting for agents that inhibit
splicing. The selection system involves a dominant cytotoxic
phenotype in response to a drug. By dominant cytotoxic we mean that
the spliced product is toxic to the cell irrespective of expression
of a resistant copy of the extein gene. The GyrA system described
in Example I is an example of this type of scheme. The selection
host organism contains a chromosomal copy of the extein gene that
is resistant to the drug and allows growth of the organism in the
presence of the drug. First, a merodiploid is made containing a
gene that is sensitive to the drug and contains the intein, and a
gene that is resistant to the drug and does not contain an intein.
Second, the host containing the resistant extein gene and the
intein containing sensitive extein gene is then treated with agents
that can enter the cell or by induction of expression of agents
within the cell. Finally, the selection drug is added to the cells.
If the intein splices, the drug sensitive target protein kills the
cell or inhibits growth when the drug is present. If any agent
blocks splicing, no drug sensitive extein protein is made and the
organism grows. Usually, one tests a library of compounds of any
type, rather than a single agent, and one uses small cultures, as
in microtiter dishes, for example. Any type of agent can be used,
as long as it can enter the cell. Alternatively, the agent can be
cloned and expressed in the target cell and clones can be tested
for growth on plates or in liquid media. Expression of
combinatorial peptide libraries would be an example of such an
agent that is expressed in the cell.
[0109] Scheme 2 is a second method for selecting for agents that
inhibit splicing. The selection system involves a dominant lethal
phenotype in the absence of exogenous drug treatment that is
inherent in the intein containing extein protein or can be
introduced into the extein protein. The DnaB system described in
Example II exemplifies this type of system. The selection host
organism contains a wild type gene that is not toxic to the cell
and allows growth of the organism. First, a mero-diplid is made
containing a gene which is toxic to the cell, but contains an
intein and an intein-less extein gene which is not toxic. Next,
this host is treated with agents that can enter the cell before the
cytotoxic precursor gene is expressed. Finally, expression of the
intein containing cytotoxic extein gene is induced. If the intein
splices, the cytotoxic target protein kills the cell or inhibits
growth. If any agent blocks splicing, no cytotoxic target protein
is made and the organism grows. Usually, one tests a library of
compounds of any type, rather than a single agent, and one uses
small cultures, as in microtiter dishes, for example. Any type of
agent can be used, as long as it can enter the cell. Alternatively,
the agent can be cloned and expressed in the target cell and clones
can be tested for growth on plates or in liquid media. Expression
of combinatorial peptide libraries would be an example of such an
agent that is expressed in the cell.
[0110] Scheme 3 selects agents that inhibit splicing of an
essential gene. In this case, the chromosomal copy of the gene, or
its equivalent, is either temperature sensitive, sensitive to a
drug in a recessive manor, or under some type of expression
control. Alternatively, the chromosomal copy of the extein gene is
inactivated or knocked out. The cells can grow under conditions
where the gene product is not needed. The cells are then shifted to
conditions that require the extein protein for survival. An example
of this type of extein is a metabolic enzyme. When cells are grown
in rich media, they can grow. However, when cells are grown in
minimal media or media lacking the downstream product of the extein
blocked metabolic pathway, the cells fail to grown. The intein
containing target gene is not temperature sensitive or is resistant
to the drug. If splicing occurs under non-permissive conditions for
the chromosomal extein homolog, then the cells live. This system
requires assay of cell growth in isolated containers, such as
microtiter dish wells, for example. If the agent blocks splicing,
then the cells will not grow under non-permissive conditions for
activity of the intein-less copy of the extein protein. Cell growth
can be determined by any means known to one skilled in the art,
including, but not limited to measuring optical density or presence
of a fluorophore generated in the cell. First an experimental host
must be found that contains a controllable copy of the extein gene
or its equivalent. It is propagated under permissive conditions for
expression of active intein-less extein protein. Second, this host
is transformed with a vector containing a wild type extein gene or
extein homolog gene containing the intein. Third, merodiploid cells
containing the intein-plus and intein-minus copies of the extein
gene, or its equivalent, are treated with agents to block splicing
and are also shifted to non-permissive conditions for activity of
the intein-less extein protein. This may involve a shift to a
temperature at which the intein-minus protein is inactive, removal
of inducers for expression of the intein-minus shifting to
different media, or addition of a drug that inactivates the
intein-minus protein. If splicing occurs, the cells will continue
to grow using the intein-plus gene product. However, if the agent
inhibits splicing, products of both copies of the gene are
inactivated and the cells die. Alternatively, the agent can be
cloned and expressed in the target cell. However, in this case,
each clone must be copied or replica plated to maintain a living
copy of the library and a copy to be tested for inhibition of
splicing. Expression of combinatorial peptide libraries would be an
example of such an agent that is expressed in the cell.
[0111] Schemes 4-6 are methods of selecting for agents that
activate splicing rather than inhibit it. The precursor contains an
inactive intein that is introduced into the cell on any type of
vector. The agent(s) may be added individually or in pools to
isolated cultures. Alternatively, the agent can be cloned and
expressed in the target cell. However, in this latter case, each
clone must be copied or replica plated to maintain a living copy of
the library and a copy to be tested for activation of splicing.
Expression of combinatorial peptide libraries would be an example
of such an agent that is expressed in the cell.
[0112] Scheme 4 is identical to scheme 1. In the presence of the
drug, an agent that activates splicing kills the host since the
intein-plus drug sensitive copy of the gene is active and
dominantly cytotoxic. One assays for the absence of growth in
isolated cultures, such as microtiter dish wells, for example.
[0113] Scheme 5 is similar to scheme 1. An agent that activates
splicing kills the host since the dominantly cytotoxic extein is
active after splicing of the intein, irrespective of the presence
of the wild type extein protein derived from the intein-minus gene.
One assays for the absence of growth in isolated cultures, such as
microtiter dish wells, for example.
[0114] Scheme 6 is similar to scheme 3, except that the selection
system requires expression of the spliced target gene for cell
growth and selects for agents that activate splicing. In this type
of system, the intein-minus copy of the target extein gene, or its
equivalent, is either temperature sensitive, sensitive to a drug in
a recessive manor, or under some type of expression control.
Alternatively, the chromosomal copy of the extein gene is
inactivated or knocked out. The cells can grow under conditions
where the gene product is not needed. The cells are then shifted to
conditions that require the extein protein for survival. An example
of this type of extein is a metabolic enzyme. When cells are grown
in rich media, they can grow. However, when cells are grown in
minimal media or media lacking the downstream product of the extein
blocked metabolic pathway, the cells fail to grow. The intein
containing target gene is not temperature sensitive or is resistant
to the drug. The target gene containing the intein is introduced
into the cell by any means known to one skilled in the art. In this
case, the intein has been modified so that it can not splice under
the assay conditions. The host copy of the gene is expressed in an
active form under permissive conditions (permissive temperature, in
the absence of drug, rich media under permissive expression
conditions, etc.), allowing the cells to grow. The intein-plus copy
of the target extein gene, containing the inactive intein, is
introduced into the cell. After expression of the intein precursor
is established, agents are added externally or peptide libraries
are expressed internally to induce splicing. After allowing the
agent to activate splicing, the cells are shifted to the
nonpermissive condition (non-permissive temperature, in the
presence of drug, minimal media under non-permissive expression
conditions, etc.). The only cells that can grow are those in which
splicing activity has been restored by the agent. If an external
agent is to be tested, then the agent is added to cells in isolated
containers, such as microtiter dish wells. Alternatively, the agent
can be cloned and expressed in the target cell. In this case, the
library of agents can be directly tested for cell viability on
plates. Expression of combinatorial peptide libraries would be an
example of such an agent that is expressed in the cell.
Reporter Systems for Inhibition or Activation of Protein Splicing
of an Intein in its Natural Precursor or an Extein Homolog
[0115] Any extein that can be converted into a tractable phenotype
can be used in a reporter system screen. This type of system
requires the ability to differentiate between active and inactive
extein by any direct or indirect means. Once the reporter system is
available, the intein-containing gene is introduced into the cell
by any method known to one skilled in the art and agents that
inhibit splicing are added or induced as above. Alternatively, an
inactive intein is introduced into a cell and agents that activate
it are added or induced as above. One then examines individual
clones and determines whether the extein is active or not.
Systems for Inhibition or Activation of Protein Splicing of an
Intein in an Unrelated Extein Context
[0116] The scenario for this method of identifying agents that
inhibit or activate splicing is the same as schemes described
above, except that the intein is placed in an unrelated extein.
However, one must first determine that the intein splices in the
non-homologous extein (FIG. 8). To improve the probability that an
intein will splice in a non-homologous foreign context, the intein
insertion site should be as similar to the natural extein sequence
as possible for at least 1 and up to 5 or more extein residues. If
the intein is inserted into a nonessential region of the target
protein, one could possibly modify the sequence of the target
protein at the intein insertion site to be the same as the native
extein sequence of that intein. The intein must be cloned prior to
a Ser, Thr or Cys with the amino acid naturally following the
intein being the best choice or the Ser, Thr or Cys codon must be
inserted into the extein along with the intein sequence. To improve
folding, surface locations on the protein would be preferable since
they are more likely to allow the extein to fold independently of
the intein. If the structure of the target protein is unknown,
protease sensitive sites on the target protein should be good
positions to insert the intein.
[0117] Since splicing can be sequence dependent, it is optimal to
experimentally identify agents that modify splicing in the same
target protein that one wants to finally control. However, agents
could possibly also control splicing of that intein in any extein.
New exteins may have to be treated experimentally.
Controllable Knockouts
[0118] Once an agent has been found which can inhibit or activate
splicing, the homologous extein gene in the target organism is
replaced by the homologous gene containing the intein by methods
known to one skilled in the art. For example, this may be performed
in a one step process by inserting the intein-containing gene
directly into the chromosomal copy of the extein gene by homologous
recombination. Alternatively, the intein-containing gene is
introduced into the organism and the non-intein containing homolog
is inactivated either concurrently or separately and in any order
of event. Once the only copy of the active extein gene contains a
intein, gene function can be inhibited if the organism is treated
with an agent that blocks splicing. On the other hand, if a
splicing impaired intein is used, gene function can be activated if
the organism is treated with an agent that activates splicing. The
agents and splicing can be modulated at any time during the
development and life of the organism by addition or removal of the
splicing activating or inhibiting agent. For example, a gene for
mouse embryogenesis can be replaced by an intein containing gene
homolog and the product of that gene can be activated or
inactivated at various times to determine when the gene product is
required and if it is required during multiple stages of
development or growth. In a second example, a gene product thought
to be required for passage through a specific stage of the cell
cycle could be replaced with an intein containing copy that would
allow study of exactly when the gene product is required or to
synchronize the culture by arresting all cells at the same point in
the cell cycle to study the effect of any agent, etc., on a
synchronized culture of cells.
Use of Controllable Inteins (CIVPS) in Therapeutics
[0119] Several options can be envisioned for the use of
controllable splicing to deliver active proteins at specific times
or to specific places. In many instances, therapeutic drugs can be
cytotoxic to the host and would be best if only active at the
target site. For example, chemotherapy drugs are often generally
cytotoxic and adverse reactions in normal cells could be eliminated
if the drug could be specifically activated in the tumor. If one
has a drug that is at least partially proteinacious, an intein that
can be activated or inhibited by a second agent, as described
above, could be inserted into the protein portion of the
therapeutic agent. The drug is then administered systemically in an
inactive form. The drug could then be specifically activated in the
tumor or target organ by (1) injecting the activating agent into
the tumor, (2) exposing the tumor to laser treatment to increase
the temperature of the tumor and thus induce splicing of a
temperature sensitive intein, (3) use gene therapy to target the
inactive cytotoxic precursor to the tumor cells and then add the
splicing activator systemically or (4) use gene therapy to target
the activating peptide to the tumor and add the inactive intein
containing drug systemically. In the Examples described above, the
inactive cytotoxic precursor or the activating peptide,
respectively, could be transformed systemically with a vector that
is not tissue or cell specific, and only expressed in specific
target cells by operably linking these genes to tissue specific
promoters.
EXAMPLE IV
Methods for Generating Temperature Controllable Inteins
[0120] The methods used for identifying agents that inhibit or
activate splicing can also be used to identify inteins that are
active at one temperature and inactive at a second temperature
(referred to as temperature sensitive inteins). Instead of adding
an external agent or expressing an internal agent, the intein is
randomly mutated by any method known to one skilled in the art,
such as error prone polymerase chain reaction (FIG. 10) or use of
combinatorial DNA sequences at specific regions in the intein.
Alternatively, one can specifically mutate residues thought to
function in or assist the chemical reactions, such as the
C-terminal splice junction residues, the intein N-terminus, the
intein penultimate residue, the residues in intein Block B (Perler,
Nucleic Acids Res., 25:1087-1093 (1997); Perler, Nucleaic Acids
Res., 27:346-247 (1999); Pietrokovski, supra), residues proximal to
the intein active site as determined crytallographically (Duan, et
al., Cell, 89:555-564 (1997); Klabunde, et al., Nat. Struct. Biol.,
5:31-36 (1998)), etc. The mutated intein gene is then introduced
into a cell and examined for the ability to splice under permissive
and non-permissive temperatures as chosen by the researcher, and
can be any combination of temperatures (FIG. 11). Splicing is
assayed as in Examples I through III as long as the chromosomal or
intein minus extein gene is not similarly temperature
sensitive.
[0121] Using the Mxe GyrA intein in the E. coli GyrA extein and
expressing the fusion in E. coli cells (Example I), we have
identified several polymerase chain reaction generated mutations
that render splicing of the Mxe GyrA intein temperature sensitive
(FIGS. 10, 11, 12 and 13). These precursors splice at 19.degree.
C., but not at 37.degree. C. Moreover, these mutations concentrate
in the beta-sheet that includes intein Block B (FIGS. 12 and
13).
Screening for Temperature Sensitive Mxe GyrA Intein Mutants
[0122] The gyrA selection system described in Example I, can also
be used to screen for temperature sensitive splicing mutants of the
Mxe GyrA intein in the ofloxacin sensitive E. coli GyrA extein.
Experiments were performed with a vector similar to pEA600. A
splicing proficient clone and a splicing deficient clone
(containing mutation of the intein Cys1 to Ala and Asn198 to Ala)
were plated on solid media containing various concentrations of
ofloxacin to determine the appropriate drug concentration to allow
growth of the splicing deficient clone while blocking growth of the
splicing proficient clone. The Mxe gyrA intein gene was then
amplified by PCR (FIG. 10) using mutagenic strategies known to one
skilled in the art and inserted into the E. coli gyrA gene.
Libraries were plated on solid media containing ofloxacin at the
predetermined concentration, replica plated and grown at either
37.degree. C. or 16.degree. C. (FIG. 11). Only splicing defective
clones survived and grew on the plates. The replica plates were
compared to identify clones that grew at 37.degree. C., but not at
16.degree. C. Such clones were picked and retested for temperature
dependent splicing. Alternatively, the libraries of mutated Mxe
GyrA inteins in E. coli GyrA were grown at 37.degree. C. and then
streaked onto a second plate to test for lack of growth at the
splicing permissive temperature of 16.degree. C. Splicing of the
GyrA precursor was examined in clones that failed to grow at
16.degree. C. by incubating in the absence of ofloxacin at
37.degree. C. for 3 hours and then shifting to 16.degree. C.
overnight. Cell lysates were electrophoresed in SDS-PAGE gels that
were then stained with Coomassie blue. Spliced GyrA was observed in
several clones, although splicing was not complete (FIG. 12).
[0123] The Mxe gyrA intein gene was sequenced from several of these
temperature sensitive clones and found to have one or more
mutations, which are summarized in FIG. 13. The 3-D structure of
the Mxe GyrA intein is known (Klabunde, et al., Nature Struct.
Biol. 5:31-36 (1998))., GyrA enabling us to place these mutations
on the Mxe GyrA intein structure (FIG. 14). We found that many of
the mutations were in the beta-sheet including intein Block B
(FIGS. 13 and 14), specifically in Mxe GyrA intein beta-strand B8
and the loop between beta-strands B8 and B9 (Klabunde, supra;
Perler Cell 92:1-4 (1998)). Intein Block B contains conserved
intein residues thought to assist in the autocatalytic reactions at
the intein N-terminal splice junction (Klabunde, supra; Noren, C.
J., et al. Angewandte Chemie (in press)). Mutation in residues
proximal in space to intein Block B, as found in this selection for
temperature sensitive Mxe GyrA intein mutants, may slightly perturb
the position of Block B residues, resulting in the temperature
sensitive phenotype.
[0124] We suggest that mutation of the amino acids in the analogous
beta-strand and loop in other inteins may generate temperature
sensitive mutants of any intein. Homologous regions in other
inteins can be easily identified due to the structural similarity
of known intein splicing domains and intein multiple sequence
alignments. To date, the 3-D structure of the Mxe GyrA intein
(Klabunde, supra), the Sce VMA intein (Duan, et al., Cell
89:555-564 (1997)) and the Drosophila hedgehog protein
autoprocessing domain (Hall, et al. Cell, 91:85-97 (1997)) have
been determined. The splicing domain of both inteins and the
N-terminal part of the hedgehog autoprocessing domain have the same
protein fold; the alpha carbon trace of most of the amino acids in
each of these 3 structures are superimpossible (Klabunde, supra;
Perler, supra (1998)). Intein amino acid sequence similarity
comparisons have also been described in the literature (Perler
supra (1997), Pietrokovski, supra (1994), Pietrokovski, Protein
Sci. 7:64-71 (1998), Dalgaard, et al., J. Comp. Biol. 4:193-214
(1997)).
[0125] Given the similarity in intein splicing domain structure and
sequence, one skilled in the art should easily be able to identify
regions in any intein that are analogous to the Mxe GyrA intein
beta-strand B8 and the loop between beta-strands B8 and B9, and
using this information, mutate this region to specifically generate
temperature sensitive protein splicing mutants.
Sequence CWU 1
1
46 1 186 PRT Escherichia coli Gyrase A 1 Met Ser Asp Leu Ala Arg
Glu Ile Thr Pro Val Asn Ile Glu Glu Glu 1 5 10 15 Leu Lys Ser Ser
Tyr Leu Asp Tyr Ala Met Ser Val Ile Val Gly Arg 20 25 30 Ala Leu
Pro Asp Val Arg Asp Gly Leu Lys Pro Val His Arg Arg Val 35 40 45
Leu Tyr Ala Met Asn Val Leu Gly Asn Asp Trp Asn Lys Ala Tyr Lys 50
55 60 Lys Ser Ala Arg Val Val Gly Asp Val Ile Gly Lys Tyr His Pro
His 65 70 75 80 Gly Asp Ser Ala Val Tyr Asp Thr Ile Val Arg Met Ala
Gln Pro Phe 85 90 95 Ser Leu Arg Tyr Met Leu Val Asp Gly Gln Gly
Asn Phe Gly Ser Ile 100 105 110 Asp Gly Asp Ser Ala Ala Ala Met Arg
Tyr Thr Glu Ile Arg Leu Ala 115 120 125 Lys Ile Ala His Glu Leu Met
Ala Asp Leu Glu Lys Glu Thr Val Asp 130 135 140 Phe Val Asp Asn Tyr
Asp Gly Thr Glu Lys Ile Pro Asp Val Met Pro 145 150 155 160 Thr Lys
Ile Pro Asn Leu Leu Val Asn Gly Ser Ser Gly Ile Ala Val 165 170 175
Gly Met Ala Thr Asn Ile Pro Pro His Asn 180 185 2 127 PRT Partial
Mycobacterium xenopi GyrA 2 Asp Arg Ser His Ala Lys Ser Ala Arg Ser
Val Ala Glu Thr Met Gly 1 5 10 15 Asn Tyr His Pro His Gly Asp Ala
Ser Ile Tyr Asp Thr Leu Val Arg 20 25 30 Met Ala Gln Pro Trp Ser
Met Arg Tyr Pro Leu Val Asp Gly Gln Gly 35 40 45 Asn Phe Gly Ser
Pro Gly Asn Asp Pro Pro Ala Ala Met Arg Tyr Thr 50 55 60 Glu Ala
Pro Leu Thr Pro Leu Ala Met Glu Met Leu Arg Glu Ile Asp 65 70 75 80
Glu Glu Thr Val Asp Phe Ile Pro Asn Tyr Asp Gly Arg Val Gln Glu 85
90 95 Pro Thr Val Leu Pro Ser Arg Phe Pro Asn Leu Leu Ala Asn Gly
Ser 100 105 110 Gly Gly Ile Ala Val Gly Met Ala Thr Asn Ile Pro Pro
His Asn 115 120 125 3 438 PRT Escherichia coli DnaB 3 Pro Pro His
Ser Ile Glu Ala Glu Gln Ser Val Leu Gly Gly Leu Met 1 5 10 15 Leu
Asp Asn Glu Arg Trp Asp Asp Val Ala Glu Arg Val Val Ala Asp 20 25
30 Asp Phe Tyr Thr Arg Pro His Arg His Ile Phe Thr Glu Met Ala Arg
35 40 45 Leu Gln Glu Ser Gly Ser Pro Ile Asp Leu Ile Thr Leu Ala
Glu Ser 50 55 60 Leu Glu Arg Gln Gly Gln Leu Asp Ser Val Gly Gly
Phe Ala Tyr Leu 65 70 75 80 Ala Glu Leu Ser Lys Asn Thr Pro Ser Ala
Ala Asn Ile Ser Ala Tyr 85 90 95 Ala Asp Ile Val Arg Glu Arg Ala
Val Val Arg Glu Met Ile Ser Val 100 105 110 Ala Asn Glu Ile Ala Glu
Ala Gly Phe Asp Pro Gln Gly Arg Thr Ser 115 120 125 Glu Asp Leu Leu
Asp Leu Ala Glu Ser Arg Val Phe Lys Ile Ala Glu 130 135 140 Ser Arg
Ala Asn Lys Asp Glu Gly Pro Lys Asn Ile Ala Asp Val Leu 145 150 155
160 Asp Ala Thr Val Ala Arg Ile Glu Gln Leu Phe Gln Gln Pro His Asp
165 170 175 Gly Val Thr Gly Val Asn Thr Gly Tyr Asp Asp Leu Asn Lys
Lys Thr 180 185 190 Ala Gly Leu Gln Pro Ser Asp Leu Ile Ile Val Ala
Ala Arg Pro Ser 195 200 205 Met Gly Lys Thr Thr Phe Ala Met Asn Leu
Val Glu Asn Ala Ala Met 210 215 220 Leu Gln Asp Lys Pro Val Leu Ile
Phe Ser Leu Glu Met Pro Ser Glu 225 230 235 240 Gln Ile Met Met Arg
Ser Leu Ala Ser Leu Ser Arg Val Asp Gln Thr 245 250 255 Lys Ile Arg
Thr Gly Gln Leu Asp Asp Glu Asp Trp Ala Arg Ile Ser 260 265 270 Gly
Thr Met Gly Ile Leu Leu Glu Lys Arg Asn Ile Tyr Ile Asp Asp 275 280
285 Ser Ser Gly Leu Thr Pro Thr Glu Val Arg Ser Arg Ala Arg Arg Ile
290 295 300 Ala Arg Glu His Gly Gly Ile Gly Leu Ile Met Ile Asp Tyr
Leu Gln 305 310 315 320 Leu Met Arg Val Pro Ala Leu Ser Asp Asn Arg
Thr Leu Glu Ile Ala 325 330 335 Glu Ile Ser Arg Ser Leu Lys Ala Leu
Ala Lys Glu Leu Asn Val Pro 340 345 350 Val Val Ala Leu Ser Gln Leu
Asn Arg Ser Leu Glu Gln Arg Ala Asp 355 360 365 Lys Arg Pro Val Asn
Ser Asp Leu Arg Glu Ser Gly Ser Ile Glu Gln 370 375 380 Asp Ala Asp
Leu Ile Met Phe Ile Tyr Arg Asp Glu Val Tyr His Glu 385 390 395 400
Asn Ser Asp Leu Lys Gly Ile Ala Glu Ile Ile Ile Gly Lys Gln Arg 405
410 415 Asn Gly Pro Ile Gly Thr Val Arg Leu Thr Phe Asn Gly Gln Trp
Ser 420 425 430 Arg Phe Asp Asn Tyr Ala 435 4 434 PRT Partial
Mycobacterium tuberculosis DnaB 4 Pro Pro Gln Asp Leu Ala Ala Glu
Gln Ser Val Leu Gly Gly Met Leu 1 5 10 15 Leu Ser Lys Asp Ala Ile
Ala Asp Val Leu Glu Arg Leu Arg Pro Gly 20 25 30 Asp Phe Tyr Arg
Pro Ala His Gln Asn Val Tyr Asp Ala Ile Leu Asp 35 40 45 Leu Tyr
Gly Arg Gly Glu Pro Ala Asp Ala Val Thr Val Ala Ala Glu 50 55 60
Leu Asp Arg Arg Gly Leu Leu Arg Arg Ile Gly Gly Ala Pro Tyr Leu 65
70 75 80 His Thr Leu Ile Ser Thr Val Pro Thr Ala Ala Asn Ala Gly
Tyr Tyr 85 90 95 Ala Ser Ile Val Ala Glu Lys Ala Leu Leu Arg Arg
Leu Val Glu Ala 100 105 110 Gly Thr Arg Val Val Gln Tyr Gly Tyr Ala
Gly Ala Glu Gly Ala Asp 115 120 125 Val Ala Glu Val Val Asp Arg Ala
Gln Ala Glu Ile Tyr Asp Val Ala 130 135 140 Asp Arg Arg Leu Ser Glu
Asp Phe Val Ala Leu Glu Asp Leu Leu Gln 145 150 155 160 Pro Thr Met
Asp Glu Ile Asp Ala Ile Ala Ser Ser Gly Gly Leu Ala 165 170 175 Arg
Gly Val Ala Thr Gly Phe Thr Glu Leu Asp Glu Val Thr Asn Gly 180 185
190 Leu His Pro Gly Gln Met Val Ile Val Ala Ala Arg Pro Gly Val Gly
195 200 205 Lys Ser Thr Leu Gly Leu Asp Phe Met Arg Ser Cys Ser Ile
Arg His 210 215 220 Arg Met Ala Ser Val Ile Phe Ser Leu Glu Met Ser
Lys Ser Glu Ile 225 230 235 240 Val Met Arg Leu Leu Ser Ala Glu Ala
Lys Ile Lys Leu Ser Asp Met 245 250 255 Arg Ser Gly Arg Met Ser Asp
Asp Asp Trp Thr Arg Leu Ala Arg Arg 260 265 270 Met Ser Glu Ile Ser
Glu Ala Pro Leu Phe Ile Asp Asp Ser Pro Asn 275 280 285 Leu Thr Met
Met Glu Ile Arg Ala Lys Ala Arg Arg Leu Arg Gln Lys 290 295 300 Ala
Asn Leu Lys Leu Ile Val Val Asp Tyr Leu Gln Leu Met Thr Ser 305 310
315 320 Gly Lys Lys Tyr Glu Ser Arg Gln Val Glu Val Ser Glu Phe Ser
Arg 325 330 335 His Leu Lys Leu Leu Ala Lys Glu Leu Glu Val Pro Val
Val Ala Ile 340 345 350 Ser Gln Leu Asn Arg Gly Pro Glu Gln Arg Thr
Asp Lys Lys Pro Met 355 360 365 Leu Ala Asp Leu Arg Glu Ser Gly Ser
Leu Glu Gln Asp Ala Asp Val 370 375 380 Val Ile Leu Leu His Arg Pro
Asp Ala Phe Asp Arg Asp Asp Pro Arg 385 390 395 400 Gly Gly Glu Ala
Asp Phe Ile Leu Ala Lys His Arg Asn Gly Pro Thr 405 410 415 Lys Thr
Val Thr Val Ala His Gln Leu His Leu Ser Arg Phe Ala Asn 420 425 430
Met Ala 5 7 PRT Mycobacterium tuberculosis DnaB 5 Thr Val Gln Ser
Thr Lys Arg 1 5 6 7 PRT Mycobacterium tuberculosis DnaB 6 Arg Pro
Ala Pro Arg Pro Leu 1 5 7 7 PRT Mycobacterium tuberculosis DnaB 7
Pro Thr Ala Arg Thr Tyr Glu 1 5 8 12 PRT Mycobacterium tuberculosis
DnaB 8 Pro Thr Arg Pro Thr Ala Pro Pro Leu Asn Phe Ser 1 5 10 9 12
PRT Mycobacterium tuberculosis DnaB 9 His Pro Asn Pro His Pro Thr
Leu Ser Gly Gln Arg 1 5 10 10 7 PRT Mycobacterium tuberculosis DnaB
10 Asp Leu Pro Met Val Glu Glu 1 5 11 198 PRT Mycobacterium xenopi
Gyrase A intein 11 Cys Ile Thr Gly Asp Ala Leu Val Ala Leu Pro Glu
Gly Glu Ser Val 1 5 10 15 Arg Ile Ala Asp Ile Val Pro Gly Ala Arg
Pro Asn Ser Asp Asn Ala 20 25 30 Ile Asp Leu Lys Val Leu Asp Arg
His Gly Asn Pro Val Leu Ala Asp 35 40 45 Arg Leu Phe His Ser Gly
Glu His Pro Val Tyr Thr Val Arg Thr Val 50 55 60 Glu Gly Leu Arg
Val Thr Gly Thr Ala Asn His Pro Leu Leu Cys Leu 65 70 75 80 Val Asp
Val Ala Gly Val Pro Thr Leu Leu Trp Lys Leu Ile Asp Glu 85 90 95
Ile Lys Pro Gly Asp Tyr Ala Val Ile Gln Arg Ser Ala Phe Ser Val 100
105 110 Asp Cys Ala Gly Phe Ala Arg Gly Lys Pro Glu Phe Ala Pro Thr
Thr 115 120 125 Tyr Thr Val Gly Val Pro Gly Leu Val Arg Phe Leu Glu
Ala His His 130 135 140 Arg Asp Pro Asp Ala Gln Ala Ile Ala Asp Glu
Leu Thr Asp Gly Arg 145 150 155 160 Phe Tyr Tyr Ala Lys Val Ala Ser
Val Thr Asp Ala Gly Val Gln Pro 165 170 175 Val Tyr Ser Leu Arg Val
Asp Thr Ala Asp His Ala Phe Ile Thr Asn 180 185 190 Gly Phe Val Ser
His Asn 195 12 85 PRT Gallus gallus alpha-spectrin fragment 12 Met
Arg Asn Thr Thr Gly Val Thr Glu Glu Ala Leu Lys Glu Phe Ser 1 5 10
15 Met Met Phe Lys His Phe Asp Lys Asp Lys Ser Gly Arg Leu Asn His
20 25 30 Gln Glu Phe Lys Ser Cys Leu Arg Ser Leu Gly Tyr Asp Leu
Pro Met 35 40 45 Val Glu Glu Gly Glu Pro Asp Pro Glu Phe Glu Ser
Ile Leu Asp Thr 50 55 60 Val Asp Pro Asn Arg Asp Gly His Val Ser
Leu Gln Glu Tyr Met Ala 65 70 75 80 Phe Met Ile Ser Arg 85 13 416
PRT Mycobacterium tuberculosis DnaB intein 13 Cys Leu Thr Ala Ser
Thr Arg Ile Leu Arg Ala Asp Thr Gly Ala Glu 1 5 10 15 Val Ala Phe
Gly Glu Leu Met Arg Ser Gly Glu Arg Pro Met Val Trp 20 25 30 Ser
Leu Asp Glu Arg Leu Arg Met Val Ala Arg Pro Met Ile Asn Val 35 40
45 Phe Pro Ser Gly Arg Lys Glu Val Phe Arg Leu Arg Leu Ala Ser Gly
50 55 60 Arg Glu Val Glu Ala Thr Gly Ser His Pro Phe Met Lys Phe
Glu Gly 65 70 75 80 Trp Thr Pro Leu Ala Gln Leu Lys Val Gly Asp Arg
Ile Ala Ala Pro 85 90 95 Arg Arg Val Pro Glu Pro Ile Asp Thr Gln
Arg Met Pro Glu Ser Glu 100 105 110 Leu Ile Ser Leu Ala Arg Met Ile
Gly Asp Gly Ser Cys Leu Lys Asn 115 120 125 Gln Pro Ile Arg Tyr Glu
Pro Val Asp Glu Ala Asn Leu Ala Ala Val 130 135 140 Thr Val Ser Ala
Ala His Ser Asp Arg Ala Ala Ile Arg Asp Asp Tyr 145 150 155 160 Leu
Ala Ala Arg Val Pro Ser Leu Arg Pro Ala Arg Gln Arg Leu Pro 165 170
175 Arg Gly Arg Cys Thr Pro Ile Ala Ala Trp Leu Ala Gly Leu Gly Leu
180 185 190 Phe Thr Lys Arg Ser His Glu Lys Cys Val Pro Glu Ala Val
Phe Arg 195 200 205 Ala Pro Asn Asp Gln Val Ala Leu Phe Leu Arg His
Leu Trp Ser Ala 210 215 220 Gly Gly Ser Val Arg Trp Asp Pro Thr Asn
Gly Gln Gly Arg Val Tyr 225 230 235 240 Tyr Gly Ser Thr Ser Arg Arg
Leu Ile Asp Asp Val Ala Gln Leu Leu 245 250 255 Leu Arg Val Gly Ile
Phe Ser Trp Ile Thr His Ala Pro Lys Leu Gly 260 265 270 Gly His Asp
Ser Trp Arg Leu His Ile His Gly Ala Lys Asp Gln Val 275 280 285 Arg
Phe Leu Arg His Val Gly Val His Gly Ala Glu Ala Val Ala Ala 290 295
300 Gln Glu Met Leu Arg Gln Leu Lys Gly Pro Val Arg Asn Pro Asn Leu
305 310 315 320 Asp Ser Ala Pro Lys Lys Val Trp Ala Gln Val Arg Asn
Arg Leu Ser 325 330 335 Ala Lys Gln Met Met Asp Ile Gln Leu His Glu
Pro Thr Met Trp Lys 340 345 350 His Ser Pro Ser Arg Ser Arg Pro His
Arg Ala Glu Ala Arg Ile Glu 355 360 365 Asp Arg Ala Ile His Glu Leu
Ala Arg Gly Asp Ala Tyr Trp Asp Thr 370 375 380 Val Val Glu Ile Thr
Ser Ile Gly Asp Gln His Val Phe Asp Gly Thr 385 390 395 400 Val Ser
Gly Thr His Asn Phe Val Ala Asn Gly Ile Ser Leu His Asn 405 410 415
14 8 PRT Mycobacterium xenopi Gyrase A 14 Asp Ser Ala Ala Ala Met
Arg Tyr 1 5 15 31 DNA Escherichia coli Gyrase A 15 gataggctag
cgatgagcga ccttgcgaga g 31 16 32 DNA Escherichia coli Gyrase A 16
tgaagcaatt gaattattct tcttctggct cg 32 17 32 DNA Nocardia
otitidis-caviarum 17 cggcgactct gcggccgcaa tgcgttatac gg 32 18 32
DNA Nocardia otitidis-caviarum 18 ccgtataacg cattgcggcc gcagagtcgc
cg 32 19 31 DNA Xanthomonas badrii 19 gaactgatgg ccgctctaga
aaaagagacg g 31 20 31 DNA Xanthomonas badrii 20 ccgtctcttt
ttctagagcg gccatcagtt c 31 21 61 DNA Bacillus lentus 21 ggccgcaatg
cgttatacgg aaatccgctt agcgaaaatt gcccatgaac tgatggccga 60 t 61 22
60 DNA Bacillus lentus 22 ctagatcggc atcagttcat gggcaatttt
cgctaagcgg atttccgtat aacgcattgc 60 23 39 DNA Mycobacterium xenopi
Gyrase A 23 cgacccgcgc ggccgcaatg cgttattgca tcacgggag 39 24 45 DNA
Mycobacterium xenopi 24 gccaaaggcg ctaagcggat ttccgtgttg tggctgacga
acccg 45 25 31 DNA Streptomyces phaeochromogenes 25 atgggcatgc
atatatatat aggcctgggc c 31 26 30 DNA Streptomyces phaeochromogenes
26 caggcctata tatatatgca tgcccattcg 30 27 39 DNA Streptomyces
griseoruber 27 gtttaagtct tgcttgcgat cgcttggcta tgacctgcc 39 28 38
DNA Streptomyces griseoruber 28 gcctgacccc gaatttgaat cgattcttga
cactgttg 38 29 38 DNA Caryophanon latum 29 gcctgacccc gaatttgaat
cgattcttga cactgttg 38 30 38 DNA Caryophanon latum 30 caacagtgtc
aagaatcgat tcaaattcgg ggtcaggc 38 31 34 DNA Gallus gallus
alpha-spectrin 31 aatggtgcat gcaaggagat ggcgcccaac agtc 34 32 41
DNA Gallus gallus alpha-spectrin 32 gctttggcta gctttcctgt
gtcacctgct gatcatgaac g 41 33 29 DNA Proteus vulgaris 33 gcgtaaagct
cgcgaccgtg ctcatatcc 29 34 29 DNA Proteus vulgaris 34 ggatatgagc
acggtcgcga gctttacgc 29 35 53 DNA Gallus gallus alpha-spectrin
((W)NN)7-12 = synthetic randon oligo At position 38, "W" = A or T
At position 39 and 40, "N" = G, C, A or T 35 tgtcaagaat cgattcaaat
tcggggtcag gctctccwnn atagccaagc gat 53 36 11 DNA Gallus gallus
alpha-spectrin 36 cgcttggcta t 11 37 31 DNA Mycobacterium
tuberculosis 37 aggtgagaat tcatggcggt cgttgatgac c 31 38 36 DNA
Mycobacterium tuberculosis 38 tatataaagc tttcatgtca ccgagccatg
ttggcg 36 39 31 DNA Mycobacterium tuberculosis 39 aggtgagaat
tcatggcggt cgttgatgac c 31 40 33 DNA Mycobacterium tuberculosis 40
tttcccacgc ccgggcacgc cgccacgatg acc 33
41 32 DNA Acetobacter aceti 41 gccgccgatc cgcgacatcg tagatttcgg cc
32 42 32 DNA Acetobacter aceti 42 ggccgaaatc tacgatgtcg cggatcggcg
gc 32 43 89 DNA Gallus gallus alpha-spectrin ((W)NN)7-12 =
synthetic randon oligo At position 38, "W" = A or T At position 39
and 40, "N" = A, G, C or T 43 tgtcaagaat cgattcaaat tcggggtcag
gctctccwnn atagccaagc gatcgcaggc 60 agcttttaaa gccctgatgg ttcagacgt
89 44 15 DNA Gallus gallus alpha-spectrin 44 ctgaaccatc agggc 15 45
7 PRT Mycobacterium xenopi Gyrase A 45 Glu Ile Arg Leu Ala Lys Ile
1 5 46 199 PRT Mycobacterium xenopi Gyrase A 46 Cys Ile Thr Gly Asp
Ala Leu Val Ala Leu Pro Glu Gly Glu Ser Val 1 5 10 15 Arg Ile Ala
Asp Ile Val Pro Gly Ala Arg Pro Asn Ser Asp Asn Ala 20 25 30 Ile
Asp Leu Lys Val Leu Asp Arg His Gly Asn Pro Val Leu Ala Asp 35 40
45 Arg Leu Phe His Ser Gly Glu His Pro Val Tyr Thr Val Arg Thr Val
50 55 60 Glu Gly Leu Arg Val Thr Gly Thr Ala Asn His Pro Leu Leu
Cys Leu 65 70 75 80 Val Asp Val Ala Gly Val Pro Thr Leu Leu Trp Lys
Leu Ile Asp Glu 85 90 95 Ile Lys Pro Gly Asp Tyr Ala Val Ile Gln
Arg Ser Ala Phe Ser Val 100 105 110 Asp Cys Ala Gly Phe Ala Arg Gly
Lys Pro Glu Phe Ala Pro Thr Thr 115 120 125 Tyr Thr Val Gly Val Pro
Gly Leu Val Arg Phe Leu Glu Ala His His 130 135 140 Arg Asp Pro Asp
Ala Gln Ala Ile Ala Asp Glu Leu Thr Asp Gly Arg 145 150 155 160 Phe
Tyr Tyr Ala Lys Val Ala Ser Val Thr Asp Ala Gly Val Gln Pro 165 170
175 Val Tyr Ser Leu Arg Val Asp Thr Ala Asp His Ala Phe Ile Thr Asn
180 185 190 Gly Phe Val Ser His Asn Thr 195
* * * * *