U.S. patent application number 10/586142 was filed with the patent office on 2007-07-12 for methods for producing minus-strand rna viral vectors using hybrid promoter comprising cytomegalovirus enhancer and chicken beta-actin promoter.
Invention is credited to Hiroshi Ban, Mamoru Hasegawa, Takahiro Hirata, Akihiro Iida, Makoto Inoue.
Application Number | 20070161110 10/586142 |
Document ID | / |
Family ID | 34805423 |
Filed Date | 2007-07-12 |
United States Patent
Application |
20070161110 |
Kind Code |
A1 |
Iida; Akihiro ; et
al. |
July 12, 2007 |
Methods for producing minus-strand rna viral vectors using hybrid
promoter comprising cytomegalovirus enhancer and chicken beta-actin
promoter
Abstract
The present invention provides methods for producing a
minus-strand RNA viral vector, which comprise using a promoter
comprising a cytomegalovirus enhancer and a chicken .beta.-actin
promoter, to induce the transcription of the genome RNA of a
minus-strand RNA viral vector and the expression of minus-strand
RNA viral proteins that form a ribonucleoprotein with the genome
RNA. The methods of the present invention enable high efficiency
production of highly safe minus-strand RNA viral vectors. The
methods of the present invention are particularly useful for
producing minus-strand RNA viral vectors that are deficient in
envelope-constituting protein genes.
Inventors: |
Iida; Akihiro; (Ibaraki,
JP) ; Ban; Hiroshi; (Ibaraki, JP) ; Inoue;
Makoto; (Ibaraki, JP) ; Hirata; Takahiro;
(Ibaraki, JP) ; Hasegawa; Mamoru; (Ibaraki,
JP) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Family ID: |
34805423 |
Appl. No.: |
10/586142 |
Filed: |
January 20, 2005 |
PCT Filed: |
January 20, 2005 |
PCT NO: |
PCT/JP05/00705 |
371 Date: |
December 13, 2006 |
Current U.S.
Class: |
435/456 ;
435/235.1; 435/325; 536/23.72 |
Current CPC
Class: |
C12N 2800/30 20130101;
C12N 2800/108 20130101; C12N 2830/00 20130101; C12N 2830/15
20130101; C12N 2830/90 20130101; C12N 2830/42 20130101; C12N
2770/36143 20130101; C12N 15/86 20130101 |
Class at
Publication: |
435/456 ;
435/235.1; 536/023.72; 435/325 |
International
Class: |
C12N 15/86 20060101
C12N015/86; C07H 21/04 20060101 C07H021/04; C12N 7/00 20060101
C12N007/00 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 22, 2004 |
JP |
2004-014653 |
Claims
1. A method for producing a minus-strand RNA viral vector, which
comprises using a promoter comprising a cytomegalovirus enhancer
and a chicken .beta.-actin promoter to induce, in a virus-producing
cell, (i) the transcription of a minus-strand RNA virus genome RNA
or the complementary strand thereof, and (ii) the expression of
minus-strand RNA viral proteins that form a ribonucleoprotein with
the genome RNA.
2. The method of claim 1, which comprises the step of transcribing
in the virus-producing cell, a DNA that encodes a ribozyme and the
minus-strand RNA virus genome RNA or the complementary strand
thereof and that is operably linked with the promoter comprising
the cytomegalovirus enhancer and chicken .beta.-actin promoter,
wherein the ribozyme has an activity of cleaving the transcript
between the ribozyme and the genome RNA or the complementary strand
thereof.
3. The method of claim 1, which comprises the steps of: expressing
a bacteriophage RNA polymerase-encoding DNA under the control of
the cytomegalovirus enhancer and chicken .beta.-actin
promoter-comprising promoter in the virus-producing cell; and
transcribing with the RNA polymerase, a DNA that encodes the
minus-strand RNA virus genome RNA or the complementary strand
thereof, and that is operably linked with a recognition sequence of
the RNA polymerase in the virus-producing cell.
4. The method of claim 2, wherein the ribozyme is a hammerhead
ribozyme.
5. The method of claim 3, wherein the RNA polymerase-encoding DNA
is expressed episomally in the virus-producing cell.
6. The method of claim 3, wherein the RNA polymerase-encoding DNA
is expressed from a chromosome in the virus-producing cell.
7. The method of claim 3, wherein the bacteriophage is selected
from the group consisting of SP6 phage, T3 phage, and T7 phage.
8. The method of claim 1, wherein the minus-strand RNA virus is
Sendai virus.
9. The method of claim 1, wherein the genome RNA or the
complementary strand thereof lacks one or more genes encoding an
envelope-constituting protein, and wherein the method further
comprises the step of expressing a DNA encoding an
envelope-constituting protein in the cell.
10. A DNA that encodes a ribozyme and a minus-strand RNA virus
genome RNA or the complementary strand thereof and that is operably
linked with a promoter comprising a cytomegalovirus enhancer and a
chicken .beta.-actin promoter, wherein the ribozyme has an activity
of cleaving a transcript between the ribozyme and the minus-strand
RNA virus genome RNA or the complementary strand thereof.
11. The DNA of claim 10, wherein the genome RNA or the
complementary strand thereof lacks one or more genes encoding an
envelope-constituting protein.
12. The DNA of claim 10, wherein the minus-strand RNA virus is
Sendai virus.
13. The DNA of claim 10, wherein the ribozyme is a hammerhead
ribozyme.
14. The DNA of claim 10, wherein the DNA expression is inducible by
a recombinase.
15. The DNA of claim 14, wherein the recombinase is Cre or Flp.
16. A bacteriophage RNA polymerase-encoding DNA that is operably
linked with a promoter comprising a cytomegalovirus enhancer and a
chicken .beta.-actin promoter.
17. The DNA of claim 16, wherein the bacteriophage is selected from
the group consisting of SP6 phage, T3 phage, and T7 phage.
18. The DNA of claim 16, wherein the expression of the DNA is
inducible by a recombinase.
19. The DNA of claim 18, wherein the recombinase is Cre or Flp.
20. A mammalian cell maintaining the DNA of claim 10.
21. The mammalian cell of claim 20, which is a cell for
minus-strand RNA virus production.
22. The mammalian cell of claim 20, wherein the genome RNA or -the
complementary strand thereof lacks one or more genes encoding an
envelope-constituting protein.
23. The mammalian cell of claim 20, wherein the minus-strand RNA
virus is Sendai virus.
24. A mammalian cell maintaining the DNA of claim 16.
25. The mammalian cell of claim 24, which is a cell for
minus-strand RNA virus production.
26. The mammalian cell of claim 24, which further maintains a DNA
that encodes a minus-strand RNA virus genome RNA or the
complementary strand thereof and that is operably linked with a
recognition sequence of the RNA polymerase.
27. The mammalian cell of claim 26, wherein the genome RNA or the
complementary strand thereof lacks one or more genes encoding an
envelope-constituting protein.
28. The mammalian cell of claim 25, wherein the minus-strand RNA
virus is Sendai virus.
Description
TECHNICAL FIELD
[0001] The present invention relates to methods for producing
minus-strand RNA viral vectors.
BACKGROUND ART
[0002] Conventionally, minus-strand RNA viruses are harvested
mainly by using a recombinant vaccinia virus expressing T7 RNA
polymerase (vTF7-3: Fuerst, T. R. et al., Proc. Natl. Acad. Sci.
USA 83, 8122-8126(1986), MVA-T7: Sutter, G. et al., FEBS lett. 371:
9-12 (1995)) and plasmids expressing NP, P, and L genes and
minus-strand RNA viral genome under the control of a T7 promoter
(Kolakofsky, et al., EMBO J. 14: 6087-6094 (1995); Kato, A. et al.,
Genes Cells 1: 569-579 (1996)). NP, P, and L, and antigenome RNA
are supplied by the action of the T7 RNA polymerase expressed by
the recombinant vaccinia virus. The cap structure is formed at 5'
ends of the NP, P, and L mRNAs through the action of a capping
enzyme from the vaccinia virus. Then, the mRNAs are translated into
proteins. The proteins interact with the antigenome RNA and
constitute functional RNP. Then, genome RNP is replicated from the
antigenome RNP. The viral proteins are also translated, and the
infection cycle is initiated. The virus is then harvested.
[0003] The minus-strand RNA viral vector can be harvested by using
a recombinant vaccinia virus. However, the vaccinia virus must be
removed for the final vector preparation. This is costly and
time-consuming. From the viewpoint of safety, it is desirable not
to use a vaccinia virus for harvesting a vector if it is intended
to be used as a vector for gene therapy. [0004] Non-patent Document
1: Fuerst, T. R. et al., Proc. Natl. Acad. Sci. USA 83, 8122-8126
(1986) [0005] Non-patent Document 2: Sutter G, et al, FEBS lett.
371: 9-12 (1995) [0006] Non-patent Document 3: Kolakofsky et al.,
EMBO J. 14: 6087-6094 (1995) [0007] Non-patent Document 4: Kato, A.
et al., Genes Cells 1: 569-579 (1996)
DISCLOSURE OF THE INVENTION
[0008] The present invention provides methods for producing
minus-strand RNA viral vectors using a hybrid promoter comprising a
cytomegalovirus enhancer and a chicken .beta.-actin promoter
without using vaccinia virus.
[0009] Until now, some mononegaviruses have been used to develop
methods for harvesting viruses without the use of recombinant
vaccinia viruses. One of such methods uses a mammalian cell line
that constitutively expresses T7 RNA polymerase. Unlike when using
the vaccinia virus, in this method the capping enzyme is not
available. Therefore, to express NP, P, and L proteins, this method
uses an expression plasmid carrying an IRES sequence, which allows
cap-independent translation. It has been reported that this method
was used to harvest bovine respiratory syncytial virus (BRSV)
(Ursula, et al., J. Virol. 73:251-259 (1999)), Rabies virus
(Stefan, et al., J. Virol. 73:3818-3825 (1999)), Newcastle disease
virus (NDV)(Romer-Oberdorfer, et al., J. General Virology
80:2987-2995 (1999)), and Sendai virus (F. Iseni, et al., EMBO J.
Vol.21:5141-5150 (2002)). For SV5, a method (David L. Waning et
al., J. Virol. 76:9284-9297 (2002)) is reported to use the BSR-T7/5
cell (i.e., the same cell as described above) to express an
antigenome by T7 RNA polymerase, and the expression of NP, P, and L
proteins is driven by pCAGGS which carries a CAG promoter
transcribed by cell-derived RNA polymerase II.
[0010] The second method.reported is a method for harvesting Rabies
virus, in which the cytomegalovirus promoter drives the expression
of all NP, P, L and the genome (K. Inoue, et al., J. Virological
Method. 107:229-236 (2003)). In this method, the virus can be
harvested without using a T7 RNA polymerase-expressing cell line
because a hammerhead ribozyme has been attached to the 5' end of
the antigenome to accurately cleave off the end of the genome.
[0011] However, all these methods are for reconstituting
transmissible viruses. Reconstitution of nontransmissible viruses
has not been achieved in the past without using vaccinia virus. To
reconstitute nontransmissible viruses, it is necessary to delete
envelope protein-encoding genes from the viral genome and to form
transmissible viral particles by supplying the envelope proteins in
trans at the time of virus reconstitution. Therefore, highly
efficient reconstitution of such deficient viruses requires a more
efficient virus production system as compared with the
reconstitution of transmissible viruses.
[0012] The present inventors modified a method for driving the
transcription of viral genome in virus-producing cells to develop a
more efficient method for producing and harvesting minus-strand RNA
viruses. As a result, the inventors discovered that efficient
production of viruses could be achieved, by using a hybrid promoter
comprising a cytomegalovirus enhancer and a chicken .beta.-actin
promoter (referred to as CA promoter) to directly or indirectly
drive the transcription of the genome RNA of a minus-strand RNA
virus, as well as the expression of all the minus-strand RNA virus
proteins that form a ribonucleoprotein(s) with the genome RNA. In
the present invention, the transcription of the genome RNA is
achieved as follows: DNA encoding the genome RNA of a minus-strand
RNA virus is operably linked to a CA promoter, and transcription of
the genome RNA is then directly induced using the CA promoter.
Alternatively, a signal sequence for a bacteriophage-derived RNA
polymerase is linked upstream of the genome RNA-encoding DNA, and
the RNA polymerase is expressed by a CA promoter, thereby inducing
the transcription of the genome RNA. These methods enabled to
produce high-titer viruses without using vaccinia virus.
[0013] The present inventors then used these methods and succeeded
for the first time in harvesting nontransmissible minus-strand RNA
viruses that lack one or both F protein and M protein, which are
envelope proteins, or genes encoding them, without using vaccinia
virus. The method of the present invention is useful for producing
high safety viruses for gene therapy or such because the method can
prepare high-titer minus-strand RNA viruses using no vaccinia virus
at all.
[0014] Specifically, the present invention relates to methods for
producing minus-strand RNA viruses, which comprise using a CA
promoter to induce transcription of the genome RNA of a
minus-strand RNA virus and the expression of minus-strand RNA virus
proteins that form ribonucleoproteins with the genome RNA. More
specifically, the present invention relates to the invention
according to each claim. The present invention also relates to
inventions comprising a desired combination of one or more (or all)
inventions set forth in the claims, in particular, to inventions
comprising a desired combination of one or more (or all) inventions
set forth in claims (dependent claims) that cite the same
independent claim(s) (claim(s) relating to inventions not
encompassed by inventions recited in other claims). An invention
set forth in an independent claim is also intended to include any
combinations of the inventions set forth in its dependent claims.
Specifically, the present invention includes: [0015] [1] a method
for producing a minus-strand RNA viral vector, which comprises
using a promoter comprising a cytomegalovirus enhancer and a
chicken .beta.-actin promoter to induce, in a virus-producing cell,
(i) the transcription of a minus-strand RNA virus genome RNA or the
complementary strand thereof, and (ii) the expression of
minus-strand RNA viral proteins that form a ribonucleoprotein with
the genome RNA: [0016] [2] the method of [1], which comprises the
step of transcribing in the virus-producing cell, a DNA that
encodes a ribozyme and the minus-strand RNA virus genome RNA or the
complementary strand thereof and that is operably linked with the
promoter comprising the cytomegalovirus enhancer and chicken
.beta.-actin promoter, wherein the ribozyme has an activity of
cleaving the transcript between the ribozyme and the genome RNA or
the complementary strand thereof; [0017] [3] the method of [1],
which comprises the steps of:
[0018] expressing a bacteriophage RNA polymerase-encoding DNA under
the control of the cytomegalovirus enhancer and chicken
.beta.-actin promoter-comprising promoter in the virus-producing
cell; and
[0019] transcribing with the RNA polymerase, a DNA that encodes the
minus-strand RNA virus genome RNA or the complementary strand
thereof, and that is operably linked with a recognition sequence of
the RNA polymerase in the virus-producing cell; [0020] [4] the
method of [2], wherein the ribozyme is a hammerhead ribozyme;
[0021] [5] the method of [3], wherein the RNA polymerase-encoding
DNA is expressed episomally in the virus-producing cell; [0022] [6]
the method of [3], wherein the RNA polymerase-encoding DNA is
expressed from a chromosome in the virus-producing cell; [0023] [7]
the method of [3], [5], or [6], wherein the bacteriophage is
selected from the group consisting of SP6 phage, T3 phage, and T7
phage; [0024] [8] the method of any one of [1] to [7], wherein the
minus-strand RNA virus is Sendai virus; [0025] [9] the method of
any one of [1] to [8], wherein the genome RNA or the complementary
strand thereof lacks one or more genes encoding an
envelope-constituting protein, and wherein the method further
comprises the step of expressing a DNA encoding an
envelope-constituting protein in the cell; [0026] [10] a DNA that
encodes a ribozyme and a minus-strand RNA virus genome RNA or the
complementary strand thereof and that is operably linked with a
promoter comprising a cytomegalovirus enhancer and a chicken
.beta.-actin promoter, wherein the ribozyme has an activity of
cleaving a transcript between the ribozyme and the minus-strand RNA
virus genome RNA or the complementary strand thereof; [0027] [11]
the DNA of [10], wherein the genome RNA or the complementary strand
thereof lacks one or more genes encoding an envelope-constituting
protein; [0028] [12] the DNA of [10] or [11], wherein the
minus-strand RNA virus is Sendai virus; [0029] [13] the DNA of any
one of [10] to [12], wherein the ribozyme is a hammerhead ribozyme;
[0030] [14] the DNA of any one of [10] to [13], wherein the DNA
expression is inducible by a recombinase; [0031] [15] the DNA of
[14], wherein the recombinase is Cre or Flp; [0032] [16] a
bacteriophage RNA polymerase-encoding DNA that is operably linked
with a promoter comprising a cytomegalovirus enhancer and a chicken
.beta.-actin promoter; [0033] [17] the DNA of [16], wherein the
bacteriophage is selected from the group consisting of SP6 phage,
T3 phage, and T7 phage; [0034] [18] the DNA of [16] or [17],
wherein the expression of the DNAis inducible by a recombinase;
[0035] [19] the DNA of [18], wherein the recombinase is Cre or Flp;
[0036] [20] a mammalian cell maintaining the DNA of any one of [10]
to [15]; [0037] [21] the mammalian cell of [20], which is a cell
for minus-strand RNA virus production; [0038] [22] the mammalian
cell of [20] or [21], wherein the genome RNA or the complementary
strand thereof lacks one or more genes encoding an
envelope-constituting protein; [0039] [23] the mammalian cell of
any one of [20] to [22], wherein the minus-strand RNA virus is
Sendai virus; [0040] [24] a mammalian cell maintaining the DNA of
any one of [16] to [19]; [0041] [25] the mammalian cell of [24],
which is a cell for minus-strand RNA virus production; [0042] [26]
the mammalian cell of [24] or [25], which further maintains a DNA
that encodes a minus-strand RNA virus genome RNA or the
complementary strand thereof and that is operably linked with a
recognition sequence of the RNA polymerase; [0043] [27] the
mammalian cell of [26], wherein the genome RNA or the complementary
strand thereof lacks one or more genes encoding an
envelope-constituting protein; and [0044] [28] the mammalian cell
of any one of [25] to [27], wherein the minus-strand RNA virus is
Sendai virus.
BRIEF DESCRIPTION OF THE DRAWINGS
[0045] FIG. 1 shows the procedure for constructing pCAGGS (B type)
and pCAGGS(BSX).
[0046] FIG. 2 shows the procedure for constructing
pCALNdLWE-zeo-NP(Z).
[0047] FIG. 3 shows the procedure for constructing
pCAGGS-P4C(-).
[0048] FIG. 4 shows the procedure for constructing
pCAGGS-L(TDK).
[0049] FIG. 5 shows the procedure for constructing pCAGGS-F.
[0050] FIG. 6 shows the procedure for constructing pCAGGS-F5R.
[0051] FIG. 7 shows the procedure for constructing pCAGGS-F5R
(continuation from FIG. 6).
[0052] FIG. 8 shows the procedure for constructing pCAGGS-T7.
[0053] FIG. 9 shows the procedure for constructing pCAGGS-SeV and
pCAGGS-SeV/.DELTA.F-GFP.
[0054] FIG. 10 shows the procedure for constructing pCAGGS-SeV and
pCAGGS-SeV/.DELTA.F-GFP (continued from FIG. 9).
[0055] FIG. 11 shows the procedure for constructing pCAGGS-SeV
(continued from FIG. 10).
[0056] FIG. 12 is a photograph showing the result of an HA assay
for a transmissible SeV vector harvested by the HamRbz method.
[0057] FIG. 13 shows the result of examining the recovery
efficiency of SeV/.DELTA.F-GFP by CIU assay, using varied amounts
of genome DNA in the HamRbz method. The efficiency remained almost
unchanged when 2 .mu.g or more of the genome DNA was used.
[0058] FIG. 14 shows the result of examining the recovery
efficiency of SeV/.DELTA.F-GFP when the recovery was carried out by
the HamRbz method using pCAGGS-F and pCAGGS-F5R. The recovery
efficiency was considerably improved by using pCAGGS-F5R.
[0059] FIG. 15 is a set of photographs showing the result of an HA
assay for transmissible SeV (SeV(TDK)18+GFP) recovered by the
pCAGGS-T7 method. HA activity was detected only when undiluted
BHK-21, BHK/T7, and 293T was inoculated into hen eggs.
[0060] FIG. 16 shows the result of examining the recovery
efficiency of SeV/.DELTA.F-GFP by CIU assay using varied amounts of
genome DNA in the pCAGGS-T7 method. The recovery efficiency
remained almost unchanged when 0.5 to 5.0 .mu.g of genome DNA was
used, although it was the highest when 5 .mu.g of the genome DNA
was used.
[0061] FIG. 17 shows the result of examining the recovery
efficiency of SeV18+GFP/.DELTA.F by CIU assay, by changing the
transfer reagent used in the pCAGGS-T7 method. The recovery
efficiency obtained using calcium phosphate was found to be equal
to or higher than that obtained using TransIT-LT-1.
[0062] FIG. 18 shows the result of examining the recovery
efficiency of SeV/.DELTA.F-GFP by CIU assay by changing the cell
type used in the pCAGGS-T7 method. Viruses were recovered from all
the cell types tested. The recovery efficiency was in the order of:
BHK/T7>BHK-21>293T>LLC-MK2. (Note that pCAGGS-T7 was not
added when BHK/T7 was used.)
[0063] FIG. 19 shows the result of comparing the recovery
efficiency of SeV/.DELTA.F-GFP between the HamRbz method and the
pCAGGS-T7 method by CIU assay. The pCAGGS-T7 method showed higher
reconstitution efficiency than the HamRbz method.
[0064] FIG. 20 shows the reconstitution of SeV/.DELTA.M-GFP by the
pCAGGS-T7 method.
[0065] FIG. 21 shows the reconstitution of SeV/.DELTA.M.DELTA.F-GFP
by the pCAGGS-T7 method.
[0066] FIG. 22 shows the result of comparing vector reconstitution
between using a CMV promoter and a CA promoter. The efficiency of
vector reconstitution is overwhelmingly high with a CA
promoter.
BEST MODE FOR CARRYING OUT THE INVENTION
[0067] The present invention relates to methods for producing
minus-strand RNA viral vectors, which comprise using a hybrid
promoter comprising a cytomegalovirus enhancer and a chicken
.beta.-actin promoter (herein referred to as a CA promoter) to
induce the transcription of the genome RNA of a minus-strand RNA
virus and the expression of all the minus-strand RNA virus proteins
that form a ribonucleoprotein (RNP) with the genome RNA in
virus-producing cells. In the methods of the present invention, the
transcription of the genome RNA of a minus-strand RNA virus is
induced directly or indirectly by a CA promoter. To directly induce
the transcription of the genome RNA of a minus-strand RNA virus by
a CA promoter, DNA encoding the genome RNA of the minus-strand RNA
virus (minus strand) or the complementary strand thereof (plus
strand) is operably linked to the CA promoter. The phrase "operably
linked" means that a DNA encoding the gene of interest is linked
downstream of the promoter so that the gene is transcribed
according to the promoter activity. To indirectly induce the
transcription of the genome RNA of a minus-strand RNA virus by a CA
promoter, for example, an RNA polymerase-encoding DNA that is
operably linked to a CA promoter, and a DNA that encodes a
minus-strand RNA virus genome RNA or the complementary strand
thereof (i.e., it may be a plus or minus strand) and that is
operably linked to a recognition sequence of the RNA polymerase,
are constructed and introduced into cells. The phrase "a
recognition sequence of the RNA polymerase" means a DNA sequence
that serves as a signal for the polymerase to initiate
transcription. The genome RNA (or antigenome RNA) of a minus-strand
RNA virus can be transcribed by the polymerase by linking the
recognition sequence with a DNA that encodes the genome RNA or the
complementary strand thereof. The CA promoter induces the
expression of the RNA polymerase, and the RNA polymerase induces
the transcription of the minus-strand RNA virus genome. As
described in the Examples, indirectly inducing the transcription of
the genome RNA of a minus-strand RNA virus through the induction of
RNA polymerase can produce viruses with higher titer than those
produced by directly inducing the transcription of the genome RNA
of a minus-strand RNA virus by CA promoter.
[0068] "Minus-strand RNA virus proteins that constitute RNP with
genome RNA" refers to a group of viral proteins that form a complex
with the genome RNA of a minus-strand RNA virus and which are
required for the replication of the genome RNA as well as the
expression of the genes encoded by the genome. An expression vector
in which the protein coding sequences are simply linked downstream
of a CA promoter may be used to express the proteins described
above. Thus, the expression of the group of proteins is directly
induced by the CA promoter. These proteins form a core without the
viral envelope, and are typically N (Nucleocapsid), P (phospho-),
and L (Large) proteins. Although these notations vary in some viral
species, proteins corresponding to the above are obvious to those
skilled in the art (Anjeanette Robert et al., Virology 247:1-6
(1998)). For example, "N" is sometimes referred to as "NP".
[0069] Specifically, the present invention's methods for producing
minus-strand RNA viral vectors comprise the steps of: [0070] (a)
using a CA promoter to induce the transcription of the genome RNA
of a minus-strand RNA virus or the complementary strand thereof,
and the expression of the viral proteins constituting a
ribonucleoprotein (RNP) of the minus-strand RNA virus in manunalian
cells; and [0071] (b) recovering the minus-strand RNA virus
produced in these cells, or a propagation product thereof.
[0072] The genome RNA of a minus-strand RNA virus or the
complementary strand thereof (antigenome RNA) forms RNP with viral
proteins that constitute the minus-strand RNA virus RNP. The viral
proteins encoded by the genome are expressed, thereby amplifying
the genome RNA and antigenome RNA in cells. Envelope proteins are
incorporated to generate viral particles. The virus can be obtained
by harvesting the particles.
[0073] The generated virus can be suitably amplified. Transmissible
viruses that carry envelope genes propagate via the ordinary viral
propagation cycle when infecting mammalian cells. In the case of
nontransmissible viruses that lack envelope protein-encoding genes,
infectious viruses can be amplified by introducing the viruses into
cells (helper cells) expressing the envelope proteins.
[0074] Herein, the promoter comprising a cytomegalovirus enhancer
and a chicken .beta.-actin promoter (CA promoter) refers to a
promoter comprising (i) an enhancer sequence of a cytomegalovirus
(CMV) immediate early (IE) gene and (ii) a promoter sequence of a
chicken .beta.-actin gene. For the CMV IE enhancer, the enhancer of
an immediately early gene from a desired CMV strain can be used,
for example, DNA comprising the nucleotide sequence of SEQ ID NO:
1.
[0075] The chicken .beta.-actin promoter includes a DNA fragment
with promoter activity that comprises a transcription initiation
site for the genomic DNA of the chicken .beta.-actin gene. The
nucleotide sequence of the chicken .beta.-actin gene promoter has
been reported by, for example, T. A. Kost et al. (Nucl. Acids Res.
11, 8287-8286, 1983). The chicken .beta.-actin gene promoter is a
gene fragment which has relatively a high G (guanine) and C
(cytosine) content and contains sequences characteristic of
promoters such as the TATA box (Ann. Rev. Biochem. 50, 349-383,
1981) and CCAAT box (Nucl. Acids Res. 8, 127-142, 1980). In the
chicken .beta.-actin promoter, the region from G (guanine) at
position -909 to G (guanine) at position -7 upstream of the
translation initiation codon (ATG) of the original .beta.-actin
structural gene is considered as an intron. Since this intron has
transcription-promoting activity, it is preferable to use a genomic
DNA fragment comprising at least a portion of this intron.
Specifically, examples of this kind of chicken .beta.-actin
promoter include, for example, DNA comprising the nucleotide
sequence of SEQ ID NO: 2. For the intron acceptor sequence, an
intron acceptor sequence from a different gene is preferably used.
For example, a splicing acceptor sequence of rabbit .beta.-globin
may be used. Specifically, the acceptor site of the second intron,
which is located immediately before the initiation codon of rabbit
.beta.-globin, can be used. More specifically, such acceptor
sequences include, for example, DNA comprising the nucleotide
sequence of SEQ ID NO: 3. A CA promoter of the present invention is
preferably a DNA in which a chicken .beta.-actin promoter
comprising a portion of the intron is linked downstream of a CMV IE
enhancer sequence and a desired intron acceptor sequence is added
downstream thereof. An example is shown in SEQ ID NO: 4. To express
a protein, the last ATG in this sequence is used as the start codon
and the coding sequence for the protein of interest may be linked
thereto. To transcribe a minus-strand RNA viral genome, DNA
encoding the minus-strand RNA viral genome or the complementary
strand thereof (either a plus or minus strand) is linked downstream
of the intron acceptor sequence described above. However, as
described below, it is preferable to insert a DNA encoding a
self-cleaving ribozyme between the intron acceptor sequence and the
DNA encoding a minus-strand RNA viral genome.
[0076] The CMV enhancer sequence and chicken .beta.-actin gene
promoter, which are used as the hybrid promoter, vary in their
sequences depending on the strains or individuals from which the
sequences are isolated. These sequences may be slightly modified so
that restriction enzyme recognition sites can be added or deleted,
or linker sequences can be inserted. Specifically, the sequences
may not be completely identical to the exemplary sequence shown in
SEQ ID NO: 4. Such sequences can be suitably used as long as they
have an equivalent or higher (for example, 70% or higher,
preferably 80% or higher, 90% or higher, or 100% or higher)
promoter activity. Methods for introducing mutations into
nucleotide sequences are well known to those skilled in the art
(Molecular cloning: a laboratory manual., 3rd ed., Joseph Sambrook,
David W. Russell., Cold Spring Harbor Laboratory Press, 2001).
Variants of the CMV enhancer sequence and chicken .beta.-actin gene
promoter sequence include, for example, those that have Genbank
accession numbers AF334827, AY237157, AJ575208, and X00182, and
these sequences can be used in the present invention. To identify
from the above sequences those that are required for constructing a
CA promoter, the sequences may be aligned with SEQ ID NOs: 1 and 2
and matched regions may be selected from the alignments. DNA
excised from pCAGGS (Niwa, H. et al. (1991) Gene. 108: 193-199,
Japanese Patent Application Kokai Publication No. (JP-A) H3-168087
(unexamined, published Japanese patent application) or pCALNdLw
(Arai, T. et al. J. Virology 72, 1998, p 1115-1121) can be used to
construct a CA promoter.
[0077] Variants of the CMV IE enhancer sequence and chicken
.beta.-actin promoter as described above include sequences that
have equivalent promoter activity, and which comprise a nucleotide
sequence having a substitution, deletion, and/or insertion of 30%
or less, preferably 20% or less, more preferably 15% or less, more
preferably 10% or less, more preferably 5% or less, more preferably
3% or less of the nucleotides in the CMV IE enhancer sequence of
SEQ ID NO: 1 and the chicken .beta.-actin promoter of SEQ ID NO: 2.
These sequences exhibits high homology to the nucleotide sequence
of either SEQ ID NO: 1 or 2. High homology nucleotide sequences
include those with an identity of, for example, 70% or higher, more
preferably 75% or higher, even more preferably 80% or higher, still
more preferably 85% or higher, yet more preferably 90% or higher,
even still more preferably 93% or higher, yet still more preferably
95% or higher, yet still even more preferably 96% or higher. The
nucleotide sequence identity can be determined, for example, using
the BLAST program (Altschul, S. F. et al., 1990, J. Mol. Biol. 215:
403-410). For example, search is carried out on the BLAST web page
of NCBI (National Center for Biotechnology Information) using
default parameters, with all the filters including Low complexity
turned off (Altschul, S. F. et al. (1993) Nature Genet. 3:266-272;
Madden, T. L. et al. (1996) Meth. Enzymol. 266:131-141; Altschul,
S. F. et al. (1997) Nucleic Acids Res. 25:3389-3402; Zhang, J.
& Madden, T. L. (1997) Genome Res. 7:649-656). Sequence
identity can be determined, for example, by comparing two sequences
using the blast2sequences program to prepare an alignment of the
two sequences (Tatiana A et al. (1999) FEMS Microbiol Lett.
174:247-250). Gaps are treated in the same way as mismatches. For
example, an identity score is calculated in view of the entire
nucleotide sequences of SEQ ID NOs: 1 and 2. Specifically, the
ratio of the number of identical nucleotides in the alignment to
the total number of nucleotides of SEQ ID NO: 1 or 2 is calculated.
Gaps outside of SEQ ID NO: 1 or 2 in the alignment is excluded from
the calculation.
[0078] The CMV enhancer sequence and chicken .beta.-actin promoter
sequence can also be isolated by hybridization from the nucleic
acid of a CMV genome and chicken genomic DNA, respectively. The CMV
enhancer and chicken .beta.-actin promoter used in the present
invention may be DNAs that have an equivalent promoter activity and
hybridize under stringent conditions to the nucleotide sequences of
SEQ ID NOs: 1 and 2, respectively, or to the complementary
sequences thereof. When hybridization is used, such a promoter can
be identified, for example, by preparing a probe either from the
nucleotide sequence of SEQ ID NO: 1 or 2 or the complementary
sequence thereof, or from a DNA to be hybridized, and then
detecting whether the probe hybridizes to the other DNA. Stringent
hybridization conditions are, for example, hybridization at
60.degree. C., preferably at 65.degree. C., more preferably at
68.degree. C. in a solution containing 5.times.SSC, 7% (W/V) SDS,
100 .mu.g/ml denatured salmon sperm DNA, and 5.times. Denhardt's
solution (1.times. Denhardt's solution contains 0.2%
polyvinylpyrrolidone, 0.2% bovine serum albumin, and 0.2% Ficoll);
and washing twice at the same temperature as the hybridization
while shaking in 2.times.SSC, preferably 1.times.SSC, more
preferably 0.5.times.SSC, still more preferably 0.1.times.SSC.
[0079] In one embodiment of the present invention, the method for
producing minus-strand RNA viruses is a method for transcribing in
virus-producing cells, a DNA that encodes a ribozyme and
minus-strand RNA virus genome RNA or the complementary strand
thereof, and which is operably linked to CA promoter. An early
transcript from this DNA comprises the ribozyme and the
minus-strand RNA virus genome RNA (a plus or minus strand). The
ribozyme is designed to have an activity of cleaving between the
ribozyme and the minus-strand RNA virus genome RNA. Acting either
in cis or trans, the ribozyme in the RNA transcript cleaves the RNA
between the ribozyme and the minus-strand RNA virus genome RNA, and
thereby generates minus-strand RNA virus genome RNA with precise
genome ends (Inoue, K. et al. J. Virol. Methods 107, 2003,
229-236). In the ribozyme-based method, the minus-strand RNA virus
genome RNA with precise ends is self-generated simply by
transcribing DNA into RNA. Thus, the method is superior since it
simplifies virus production methods and requires no special
cells.
[0080] Ribozymes that cleave particular sequences can be designed
using known techniques. For example, hammerhead ribozymes have been
isolated from viroid and such in nature (J. M. Buzayan et al.,
Nature, 1986, 323: 349-353; GA. Prody et al., Science, 1986,
231:1577-1580), and they originally have a hammer structure with
three loops and three helices and act in cis. They can also act in
trans when the target RNA is separated from the RNA region that has
the catalytic activity. For example, such ribozymes have a loop and
a helix and form a quasi-loop with the target sequence (Turner, P.
C., The Biochemistry of the Hammerhead Ribozyme. In: Scanlon, K J.,
and Kashani-Sabet, M. ed. Ribozymes in the Gene Therapy of Cancer
(Medical Intelligence UNIT4), R. G. Landes Company, 1998; 3-14).
The hammerhead ribozyme is a structurally well-known ribozyme. The
ribozyme of tobacco ringspot virus specifically cleaves at the 3'
side of the nucleotide sequence NUH (N=A, G, C, or U; H=A, C, or U)
(M. Koizumi et al., FEBS Lett. 228:225, 1988). Thus, it is possible
to create a ribozyme that specifically cleaves a desired target RNA
at a site comprising the sequence UC, UU, or UA (M. Koizumi et al.,
FEBS Lett. 239:285, 1988; M. Koizumi and E. Otsuka, Tampakushitsu
Kakusan Kouso (Protein, Nucleic acid and Enzyme), 35: 2191, 1990;
M. Koizumi et al., Nucleic Acids Res. 17:7059, 1989).
[0081] Hairpin ribozymes are also useful for the purpose of the
present invention. For example, hairpin ribozymes are found in the
minus strand of satellite RNA in tobacco ringspot viruses (J. M.
Buzayan, Nature 323:349, 1986). It has been demonstrated that this
ribozyme can also be designed to cleave RNA in a target specific
manner (Y. Kikuchi and N. Sasaki, Nucleic Acids Res. 19:6751, 1992;
Y Kikuchi, Kagaku To Seibutsu (Chemistry and Biology) 30:112,
1992).
[0082] The ribozymes described above can be appropriately modified.
A method that prepares modified ribozymes with higher activity by
using an in vitro evolution system to modify natural ribozymes is
known (Joyce. 1992. Selective Amplification Techniques for
Optimization of Ribozyme Function., in Antisense RNA and DNA, pp.
353-372. Wiley-Liss Inc.). Ribozymes that function as a dimer can
also be used.
[0083] In general, a ribozyme with RNA cleavage activity contains a
sequence essential for the catalytic activity and a target
recognition sequence required for target RNA recognition. Sequences
required for hammerhead ribozyme catalysis include, but are not
limited to, for example,
5'-.sup.1C.sup.2U.sup.3G.sup.4A.sup.5N.sup.6G.sup.7A.sup.8N.sup.-
9N.sup.10N.sup.11N.sup.12N.sup.13N.sup.14N.sup.15N.sup.16N.sup.17N.sup.18N-
.sup.19N.sup.20G.sup.21A.sup.22A.sup.23A.sup.24N-3' (SEQ ID NO: 5).
In the above sequence, N represents G; A, U, or C; and
5'-.sup.8N.sup.9N.sup.10N.sup.11N-3' and
5'-.sup.16N.sup.17N.sup.18N.sup.19N-3' are designed to be
complementary to each other to allow base pair formation. For
example, 5'-.sup.8N.sup.9N.sup.10N.sup.11N-3' includes, but is not
limited to, 5'-GUCC-3'; and 5'- .sup.16N.sup.17N.sup.18N.sup.19N-3'
includes, but is not limited to, 5'-GGAC-3'. The four nucleotides
.sup.12N.sup.13N.sup.14N.sup.15N preferably form a loop. They may
be about 2 to 7 nucleotides (i.e., N.sub.2-7), for example, about 3
to 5 nucleotides (i.e., N.sub.3-5) rather than four nucleotides.
.sup.23A.sup.24N overlaps with the target recognition sequence.
.sup.24N is a nucleotide complementary to N in the target site
"NUH" described above. An example is 5'-GUGA-3'. More specific
sequences are shown in the Examples. The target recognition
sequence is added to both ends. The target recognition sequence is
designed to be complementary to the sequence between the ribozyme
and the minus-strand RNA viral genome.
[0084] Another embodiment of the method of the present invention is
a method which comprises expressing, in virus-producing cells, a
bacteriophage RNA polymerase-encoding DNA operably linked to a CA
promoter. The virus-producing cells are made to contain a DNA that
encodes minus-strand RNA virus genome RNA or the complementary
strand thereof, which is linked downstream of an RNA polymerase
recognition sequence. The expressed RNA polymerase transcribes the
minus-strand RNA virus genome RNA-encoding DNA, which is linked
downstream of the RNA polymerase recognition sequence, to generate
viral genome RNA. The RNA polymerases used include desired
bacteriophage-derived RNA polymerases that recognize specific
sequences (i.e., target sequences for the RNA polymerases;
generally also referred to as "promoter sequences") and initiate
the transcription, and specifically include those of E. coli T3
phage and T7 phage, and Salmonella SP6 phage (Krieg, P. A. and
Melton, D. A. 1987. In vitro RNA synthesis with SP6 RNA polymerase.
Methods Enzymol. 155: 397-15; Milligan, J. F., Groebe, D. R.,
Witherell, G. W., and Uhlenbeck, O. C. 1987. Oligoribonucleotide
synthesis using T7 RNA polymerase and synthetic DNA templates.
Nucleic Acids Res. 15: 8783-798; Pokrovskaya, I. D. and Gurevich,
V. V. 1994. In vitro transcription: Preparative RNA yields in
analytical scale reactions. Anal. Biochem. 220: 420-23).
[0085] Typical recognition sequences (promoter sequences) for T3,
T7, and SP6 are shown below. "+1" indicates the first nucleotide to
be transcribed. TABLE-US-00001 +1 T7: TAATACGACTCACTATAGGGAGA (SEQ
ID NO: 6) T3: AATTAACCCTCACTAAAGGGAGA (SEQ ID NO: 7) SP6:
ATTTAGGTGACACTATAGAAGNG (SEQ ID NO: 8) (N = A G, C, or T)
[0086] The region from -17 to -1 is essential for the transcription
and must be double-stranded. To achieve efficient transcription, it
is important that the first two of nucleotides +1 to +6 shown above
(+1 and +2) is GP (P=purine (A or G)). The other nucleotides may be
substituted with different nucleotides. The underlined sequences
shown above are preferably used. The cDNA of a minus-strand RNA
virus genome (a plus or minus strand) is linked immediately
downstream of the above-described recognition sequences for the RNA
polymerases. Production of high efficiency viruses may be achieved
by transcribing the plus strand.
[0087] The transcription vector for the minus-strand RNA virus
genome and the expression vectors for the phage RNA polymerases
described above may be desired DNA vectors or vectors that are
converted into DNA after being introduced into cells, such as
retroviruses. Typically, plasmid vectors are used. The vector may
be an expression vector which exists as an episome in cells after
introduction or as a chromosome-integrated vector which is
expressed after being integrated into chromosomes in cells. For
example, when a plasmid is used, it may be transiently expressed by
transfection, or stable transformants in which the plasmid is
integrated into their chromosomes may be selected. In particular,
cell lines stably expressing a phage RNA polymerase are useful,
because they simplify the procedure of virus production and allow
stable production of high-titer virus (see Example 2). The vector
may be a constitutive expression vector or an inducible expression
vector whose expression can be induced when needed. For example,
the vector can be inducibly expressed using a sequence-specific
recombinase (recombination enzyme) (Example 2). The type of
recombinase that can be used for this purpose includes Cre
recombinase and FLP recombinase. The expression can be induced in
response to a recombinase by inserting a DNA flanked by target
sequences for the recombinase between a CA promoter and the coding
sequence of a ribozyme or an RNA polymerase.
[0088] Cre is an approximately 38 kDa cyclization recombinase
carried by bacteriophage P1 and performs site-specific DNA
recombination between loxP sites (Sauer B, Henderson N. 1988.
Site-specific DNA recombination in mammalian cells by the Cre
recombinase of bacteriophage P1. Proc Natl Acad Sci USA 85:5166-70;
Stemberg N, Hamilton D. 1981. Bacteriophage P1 site-specific
recombination. I. Recombination between loxP sites. J Mol Biol
150:467-86; Brian Sauer, Methods of Enzymology; 1993, Vol. 225,
890-900; Nagy A. 2000. Cre recombinase: the universal reagent for
genome tailoring. Genesis 26:99-109). loxP is a 13-bp asymmetric
inverted repeat sequence which comprises an 8-bp spacer
(ATAACTTCGTATAATGTATGCTATACGAAGTTAT; the underlines indicate the
inverted repeats; SEQ ID NO: 9).
[0089] FLP recombinase is a flippase recombinase of about 49 kDa
derived from the 2 micron plasmid of yeast Saccharomyces cerevisiae
and targets the FLP recombinase target (FRT) sequence for
recombination (Utomo A R, Nikitin A Y, Lee W H. 1999. Temporal,
spatial, and cell type-specific control of Cre-mediated DNA
recombination in transgenic mice. Nat Biotechnol 17:1091-6; Broach,
J. R., Guarascio, V. R. & Jayaram, M. (1982) Cell 29, 227-34;
Cox, M. M. (1983) Proc. Natl. Acad. Sci. USA 80, 4223-227; Vetter,
D., Andrews, B. J., Roberts-Beatty, L. & Sadowski, P. D. (1983)
Proc. Natl. Acad. Sci. USA 80, 7284-288; Abremski, K. & Hoess,
R. (1984) J. Biol. Chem. 259, 1509-514; Stark, W. M., Boocock, M.
R. & Sherratt, D. J. (1992) Trends Genet. 8, 432-39; Kilby, N.
J., Snaith, M. R. & Murray, J. A. H. (1993) Trends Genet. 9,
413-21). Like loxP, FRT sequences also consist of a 13-bp repeat
sequence comprising an 8-bp spacer
(GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC; SEQ ID NO: 10) (Andrews, B. J.
et al. (1985). The FLP Recombinase of the 2 Micron Circle DNA of
Yeast: Interaction with its Target Sequences. Cell 40, 795-803). In
addition, target-specific recombination can be achieved using
mutant sequences of the loxP site and FRT site described above
(Baszczynski, Christopher L. et al, US Patent Application
20040003435).
[0090] To construct DNA whose expression can be induced by a
recombinase, DNA flanked by a pair of recombinase target sequences
is inserted between a CA promoter and the coding sequence of a
ribozyme or a phage RNA polymerase. In this state, due to
interference by the inserted DNA fragment, the minus-strand RNA
virus genome (to which the ribozyme is attached) or the phage RNA
polymerase is not expressed from the CA promoter. However, when the
recombinase acts on the DNA, the target sequence-flanked DNA is
excised, which enables the minus-strand RNA virus genome or the
phage RNA polymerase to be expressed from the CA promoter. As
described above, expression from the CA promoter can be induced by
a recombinase. The DNA flanked by the recombinase target sequences
is preferably designed to contain a transcription termination
signal and/or stop codon so that the expression of the downstream
minus-strand RNA virus genome or phage RNA polymerase gene is
certainly blocked in the absence of the recombinase action. An
appropriate marker gene can also be inserted into the DNA flanked
by the recombinase target sequences.
[0091] The DNAs and cells for producing viruses, which are
described herein, can be appropriately combined into a kit for
producing viruses. For example, the present invention relates to
the following kits: [0092] (1-1) a kit for producing a minus-strand
RNA virus, which comprises: a bacteriophage RNA polymerase-encoding
DNA operably linked to a CA promoter; and a DNA encoding the
minus-strand RNA virus genome RNA or the complementary strand
thereof and which is operably linked to the RNA polymerase
recognition sequence; [0093] (1-2) the kit of (1-1), which further
comprises a DNA encoding minus-strand RNA viral proteins that form
RNP with the genome RNA, wherein the DNA is operably linked to a CA
promoter; [0094] (1-3) the kit of (1-1) or (1-2), in which the
genome RNA or the complementary strand thereof lacks one or more
genes that encode an envelope-constituting protein; [0095] (1-4)
the kit of any one of (1-1) to (1-3), which further comprises a DNA
encoding an envelope-constituting protein; [0096] (1-5) the kit of
any one of (1-1) to (1-4), in which the DNA that encodes an
envelope-constituting protein is operably linked to a CA promoter;
[0097] (1-6) the kit of any one of (1-1) to (1-5), in which the
minus-strand RNA virus is Sendai virus; [0098] (1-7) the kit of any
one of (1-1) to (1-6), in which the bacteriophage is selected from
the group consisting of SP6 phage, T3 phage, and T7 phage; [0099]
(1-8) the kit of any one of (1-1) to (1-7), in which the expression
of the RNA polymerase can be induced by a recombinase; [0100] (1-9)
the kit of (1-8), in which the recombinase is Cre or Flp; [0101]
(2-1) a kit for producing a minus-strand RNA virus, which
comprises: a mammalian cell carrying a bacteriophage RNA
polymerase-encoding DNA operably linked to a CA promoter; and a DNA
encoding the minus-strand RNA virus genome RNA or the complementary
strand thereof, and which is operably linked to the RNA polymerase
recognition sequence; [0102] (2-2) the kit of (2-1) which further
comprises a DNA encoding minus-strand RNA viral proteins that form
RNP with the genome RNA and, which is operably linked to a CA
promoter; [0103] (2-3) the kit of (2-1) or (2-2), in which the
genome RNA or the complementary strand thereof lacks one or more
genes that encode an envelope-constituting.protein; [0104] (2-4)
the kit of any one of (2-1) to (2-3), which further comprises a DNA
encoding an envelope-constituting protein; [0105] (2-5) the kit of
any one of (2-1) to (2-4), in which the DNA that encodes an
envelope-constituting protein is operably linked to a CA promoter;
[0106] (2-6) the kit of any one of (2-1) to (2-5), in which the
minus-strand RNA virus is Sendai virus; [0107] (2-7) the kit of any
one of (2-1) to (2-6), in which the bacteriophage is selected from
the group consisting of SP6 phage, T3 phage, and T7 phage; [0108]
(2-8) the kit of any one of (2-1) to (2-7), in which the expression
of the RNA polymerase can be induced by a recombinase; [0109] (2-9)
the kit of (2-8), in which the recombinase is Cre or Flp; [0110]
(3-1) a kit for producing a minus-strand RNA virus, which
comprises: [0111] (i) a DNA encoding a ribozyme and the
minus-strand RNA virus genome RNA or the complementary strand
thereof and which is operably linked to a CA promoter, wherein the
ribozyme has the activity of cleaving a transcript between the
ribozyme and the minus-strand RNA virus genome RNA or the
complementary strand thereof; and [0112] (ii) a DNA encoding
minus-strand RNA viral proteins that form RNP with the genome RNA
and which is operably linked to a CA promoter. [0113] (3-2) the kit
of (3-1), in which the genome RNA or the complementary strand
thereof lacks one or more genes that encode an
envelope-constituting protein; [0114] (3-3) the kit of (3-1) or
(3-2) which further comprises a DNA encoding an
envelope-constituting protein; [0115] (3-4) the kit of any one of
(3-1) to (3-3), in which the DNA that encodes an
envelope-constituting protein is operatively linked to a CA
promoter; [0116] (3-5) the kit of any one of (3-1) to (3-4), in
which the minus-strand RNA virus is Sendai virus; [0117] (3-6) the
kit of any one of (3-1) to (3-5), in which the bacteriophage is
selected from the group consisting of SP6 phage, T3 phage, and T7
phage; [0118] (3-7) the kit of any one of (3-1) to (3-6), in which
the expression of the DNA of (i) and/or (ii) can be induced by a
recombinase; and [0119] (3-8) the kit of (3-7), in which the
recombinase is Cre or Flp.
[0120] The phrase "the expression can be induced by a recombinase"
means that a DNA flanked by recombinase recognition sequences is
inserted between a CA promoter and the downstream DNA, so that the
expression of the DNA downstream of the CA promoter is induced upon
removal of the DNA flanked by recombinase recognition
sequences.
[0121] Herein, a minus-strand RNA virus refers to viruses that
contain a minus strand (an antisense strand complementary to a
sense strand encoding viral proteins) RNA as the genome. The
minus-strand RNA is also referred to as negative strand RNA. The
minus-strand RNA virus used in the present invention particularly
includes single-stranded minus-strand RNA viruses (also referred to
as non-segmented minus-strand RNA viruses). The "single-strand
negative strand RNA virus" refers to viruses having a
single-stranded negative strand [i. e., a minus strand] RNA as the
genome. Such viruses include viruses belonging to Paramyxoviridae
(including the genera Paramyxovirus, Morbillivirus, Rubulavirus,
and Pneumovirus), Rhabdoviridae (including the genera
Vesiculovirus, Lyssavirus, and Ephemerovirus), Filoviridae,
Orthomyxoviridae, (including Influenza viruses A, B, and C, and
Thogoto-like viruses), Bunyaviridae (including the genera
Bunyavirus, Hantavirus, Nairovirus, and Phlebovirus), Arenaviridae,
and the like.
[0122] In addition, the minus-strand RNA viral vector refers to a
minus-strand RNA virus-based transmissible virus which serves as a
vehicle for introducing genes into cells. Herein, "infectivity"
refers to the capability of a minus-strand RNA viral vector to
maintain cell-adhesion ability and introduce a gene carried by the
vector to the inside of the cell to which the vector has adhered.
The "gene" refers to any genetic material carried by the
minus-strand RNA viral vector of the present invention, and is not
limited to a foreign gene. In other words, the minus-strand RNA
viral vector may or may not have a foreign gene. The method of the
present invention can be applied to production of both
transsmissible viral vectors and defective nontransmissible
vectors. In particular, the method is advantageous in that
defective nontransmissible vectors can be efficiently produced.
"Transmissible" means that when a viral vector infects a host cell,
the virus is replicated in the cell to produce infectious
virions.
[0123] "Recombinant virus" refers to a virus produced through a
recombinant polynucleotide, or an amplification product thereof.
"Recombinant polynucleotide" refers to a polynucleotide in which
nucleotides are not linked at one or both ends as in the natural
condition. Specifically, a recombinant polynucleotide is a
polynucleotide in which the linkage of the polynucleotide chain has
been artificially modified (cleaved and/or linked). Recombinant
polynucleotides can be produced by using gene recombination methods
known in the art in combination with polynucleotide synthesis,
nuclease treatment, ligase treatment, etc. A recombinant virus can
be produced by expressing a polynucleotide encoding a viral genome
constructed through gene manipulation and reconstructing the virus.
For example, methods for reconstructing a virus from cDNA that
encodes the viral genome are known (Y. Nagai, A. Kato, Microbiol.
Immunol., 43, 613-624 (1999)).
[0124] In the present invention, "gene" refers to a genetic
substance, a nucleic acid encoding a transcriptional unit. Genes
may be RNAs or DNAs. In this invention, a nucleic acid encoding a
protein is referred to as a gene of that protein. Further, in
general, a gene may not encode a protein. For example, a gene may
encode a functional RNA, such as a ribozyme or antisense RNA.
Generally, a gene may be a naturally-occurring or artificially
designed sequence. Furthermore, in the present invention, "DNA"
includes both single-stranded and double-stranded DNAs. Moreover,
"encoding a protein" means that a polynucleotide includes an ORF
that encodes an amino acid sequence of the protein in a sense or
antisense direction, so that the protein can be expressed under
appropriate conditions.
[0125] A minus-strand RNA virus particularly preferably used in the
context of the present invention includes, for example, Sendai
virus, Newcastle disease virus, mumps virus, measles virus,
respiratory syncytial virus (RS virus), rinderpest virus, distemper
virus, simian parainfluenza virus (SV5), and human parainfluenza
viruses 1, 2, and 3 belonging to Paramyxoviridae; influenza virus
belonging to Orthomyxoviridae; and vesicular stomatitis virus and
rabies virus belonging to Rhabdoviridae.
[0126] Further examples of virus that may be used in the context of
the present invention include those selected from the group
consisting of: Sendai virus (SeV), human parainfluenza virus-1
(HPIV-1), human parainfluenza virus-3 (HPIV-3), phocine distemper
virus (PDV), canine distemper virus (CDV), dolphin molbillivirus
(DMV), peste-des-petits-ruminants virus (PDPR), measles virus (MV),
rinderpest virus (RPV), Hendra virus (Hendra), Nipah virus (Nipah),
human parainfluenza virus-2 (HPIV-2), simian parainfluenza virus 5
(SV5), human parainfluenza virus-4a (HPIV-4a), human parainfluenza
virus-4b (HPIV-4b), mumps virus (Mumps), and Newcastle disease
virus (NDV). A more preferred example is a virus selected from the
group consisting of Sendai virus (SeV), human parainfluenza virus-1
(HPIV-1), human parainfluenza virus-3 (HPIV-3), phocine distemper
virus (PDV), canine distemper virus (CDV), dolphin molbillivirus
(DMV), peste-des-petits-ruminants virus (PDPR), measles virus (MV),
rinderpest virus (RPV), Hendra virus (Hendra), and Nipah virus
(Nipah).
[0127] More preferably, minus-strand RNA viruses produced in the
present invention are preferably those belonging to Paramyxoviridae
(including Respirovirus, Rubulavirus, and Morbillivirus) or
derivatives thereof, and more preferably those belonging to the
genus Respirovirus (also referred to as Paramyxovirus) or
derivatives thereof. The derivatives include viruses that are
genetically-modified or chemically-modified in a manner not to
impair their gene-transferring ability. Examples of viruses of the
genus Respirovirus applicable to this invention are human
parainfluenza virus-1 (HPIV-1), human parainfluenza virus-3
(HPIV-3), bovine parainfluenza virus-3 (BPIV-3), Sendai virus (also
referred to as murine parainfluenza virus-1), and simian
parainfluenza virus-10 (SPIV-10). A more preferred paramyxovirus in
this invention is the Sendai virus. These viruses may be derived
from natural strains, wild strains, mutant strains,
laboratory-passaged strains, artificially constructed strains, or
the like.
[0128] Genes harbored on a minus-strand RNA viral vector are
situated in the antisense direction in the viral genomic RNA. Viral
genomic RNA refers to RNA that has the function to form a
ribonucleoprotein (RNP) with the viral proteins of a minus-strand
RNA virus. Genes contained in the genome are expressed by the RNP,
genomic RNA is replicated, and daughter RNPs are formed. In
general, in the minus-strand RNA viral genome, viral genes are
arranged as antisense sequences between the 3'-leader region and
the 5'-trailer region. Between the ORFs of respective genes are a
transcription ending sequence (E sequence)--intervening sequence (I
sequence)--transcription starting sequence (S sequence), such that
RNA encoding the ORF of each gene is transcribed as an individual
cistron. Genomic RNAs in a virus of this invention comprise the
antisense RNA sequences encoding N (nucleocapsid)-, P (phospho)-,
and L (large)-proteins, which are viral proteins essential for the
expression of the group of genes encoded by an RNA, and for the
autonomous replication of the RNA itself. The RNAs may encode M
(matrix) proteins, which is essential for virion formation.
Further, the RNAs may encode envelope proteins essential for virion
infection. Minus-strand RNA viral envelope proteins include F
(fusion) protein that causes cell membrane fusion, and HN
(hemagglutinin-neuraminidase) protein which is essential for viral
adhesion to cells. However, HN protein is not required for the
infection of certain types of cells (Markwell, M. A. et al., Proc.
Natl. Acad. Sci. USA 82(4): 978-982 (1985)), and infection is
achieved with F protein only. The RNAs may encode envelope proteins
other than F protein and/or HN protein.
[0129] Genes of Paramyxovirinae viruses are commonly listed as
follows. In general, NP gene is also listed as "N gene." HN that
does not have a neuraminidase activity is listed as "H".
TABLE-US-00002 Respirovirus NP P/C/V M F HN -- L Rubulavirus NP P/V
M F HN (SH) L Morbillivirus NP P/C/V M F H -- L
[0130] For example, the database accession numbers for the
nucleotide sequences of each of the Sendai virus genes are: M29343,
M30202, M30203, M30204, M51331, M55565, M69046, and X17218 for NP
gene; M30202, M30203, M30204, M55565, M69046, X00583, X17007, and
X17008 for P gene; D11446, K02742, M30202, M30203, M30204, M69046,
U31956, X00584, and X53056 for M gene; D00152, D11446, D17334,
D17335, M30202, M30203, M30204, M69046, X00152, and X02131 for F
gene; D26475, M12397, M30202, M30203, M30204, M69046, X00586,
X02808, and X56131 for HN gene; and D00053, M30202, M30203, M30204,
M69040, X00587, and X58886 for L gene. Examples of viral genes
encoded by other viruses are: CDV, AF014953; DMV, X75961; HPIV-1,
D01070; HPIV-2, M55320; HPIV-3, D10025; Mapuera, X85128; Mumps,
D86172; MV, K01711; NDV, AF064091; PDPR, X74443; PDV, X75717; RPV,
X68311; SeV, X00087; SV5, M81442; and Tupaia, AF079780 forN gene;
CDV, X51869; DMV, Z47758; HPIV-1, M74081; HPIV-3, X04721; HPIV-4a,
M55975; HPIV-4b, M55976; Mumps, D86173; MV, M89920; NDV, M20302;
PDV, X75960; RPV, X68311; SeV, M30202; SV5, AF052755; and Tupaia,
AF079780 for P gene; CDV, AF014953; DMV, Z47758; HPIV-1, M74081;
HPIV-3, D00047; MV, ABO16162; RPV, X68311; SeV, AB005796; and
Tupaia, AF079780 for C gene; CDV, M12669; DMV, Z30087; HPIV-1,
S38067; HPIV-2, M62734; HPIV-3, D00130; HPIV-4a, D10241; HPIV-4b,
D10242; Mumps, D86171; MV, AB012948; NDV, AF089819; PDPR, Z47977;
PDV, X75717; RPV, M34018; SeV, U31956; and SV5, M32248 for M gene;
CDV, M21849; DMV, AJ224704; HPN-1, M22347; HPIV-2, M60182; HPIV-3,
X05303; HPIV-4a, D49821; HPIV-4b, D49822; Mumps, D86169; MV,
AB003178; NDV, AF048763; PDPR, Z37017; PDV, AJ224706; RPV, M21514;
SeV, D17334; and SV5, AB021962 for F gene; and, CDV, AF112189; DMV,
AJ224705; HPIV-1, U709498; HPIV-2, D000865; HPIV-3, AB012132;
HPIV-4A, M34033; HPIV-4B, AB006954; Mumps, X99040; MV, K01711;
NDV,AF204872; PDPR, Z81358; PDV, Z36979; RPV, AF132934; SeV,
U06433; and SV-5, S76876 for HN (H or G) gene. However, multiple
strains are known for each virus, and there exist genes that
comprise sequences other than those cited above as a result of
strain variation.
[0131] ORFs encoding these viral proteins and ORFs of foreign genes
are arranged in the antisense direction in the genomic RNA via the
above-described E-I-S sequence. The ORF closest to the 3'-end of
the genomic RNA requires only an S sequence between the 3'-leader
region and the ORF, and does not require an E or I sequence.
Further, the ORF closest to the 5'-end of the genomic RNA requires
only an E sequence between the 5'-trailer region and the ORF, and
does not require an I or S sequence. Furthermore, two ORFs can be
transcribed as a single cistron, for example, by using an internal
ribosome entry site (IRES) sequence. In such a case, an E-I-S
sequence is not required between these two ORFs. For example, in
wild type paramyxoviruses, a typical RNA genome includes a
3'-leader region, six ORFs encoding the N, P, M, F, HN, and L
proteins in the antisense direction in this order, and a 5'-trailer
region on the other end. The orientation of the viral gene in the
genomic RNAs of the present invention is not restricted, but
similarly to the wild type viruses, it is preferable that ORFs
encoding the N, P, M, F, HN, and L proteins are arranged after the
3'-leader region and before the 5'-trailer region. Certain types of
viruses have different viral genes, but even in such cases, it is
preferable that each gene be arranged as in the wild type, as
described above. In general, vectors maintaining the N, P, and L
genes can autonomously express genes from the RNA genome in cells
and the genomic RNA is replicated. Furthermore, by the action of
genes such as the F and HN genes which encode envelope spike
proteins and the M gene, infectious virions are formed and released
to the outside of the cells. Thus, such vectors become
transmissible viral vectors. When the vectors carry a foreign gene,
the gene may be inserted into a non-protein-coding region in this
genome, as described below.
[0132] Alternatively, the minus-strand RNA viral vector may lack
any of the wild type viral genes. For example, viruses that lack
genes encoding viral envelope-constituting proteins are useful as
high safety gene transfer vectors. According to the method of the
present invention, high-titer viruses lacking genes encoding viral
envelope-constituting proteins can be harvested without using a
vaccinia virus vector. The "envelope-constituting proteins" refers
to viral proteins that serve as viral envelope components, which
include spike proteins that are exposed on an envelope surface and
function in cell adhesion or infection, and lining proteins which
function in envelope formation and such. Specifically, genes that
encode envelope-constituting proteins include F, HN, and M; and
also include genes of H, M1, and G in some viral species. Viruses
that lack one or more genes that encode these envelope-constituting
proteins are highly safe, because they cannot form infectious viral
particles in infected cells. Such viruses can be reconstituted, for
example, by exogenously supplying the gene products that are
deficient in the viruses. Alternatively, the viral infectivity can
be complemented by completely different envelope proteins. Such
envelope proteins include, for example, VSV-G. Thus, envelope
protein genes to be used for constructing viruses that are
deficient in envelope-constituting protein genes are not limited to
the deleted genes, as long as they ensure viral formation and
infectivity. Similar to wild type viruses, the viruses thus
prepared adhere to host cells and cause cell fusion, but they
cannot form daughter virions that retain the same infectivity as
the original vector, because the viral genome introduced into cells
is deficient in viral genes. Therefore, such vectors are useful as
safe viral vectors that can only introduce genes once (WO00/70055,
WO00/70070, and WO03/025570; Li, H.-O. et al., J. Virol. 74(14)
6564-6569 (2000)). Examples of genes in which the genome may be
deficient are the F gene, HN gene, M gene, or any combination
thereof. For example, recombinant viruses can be reconstituted by
transfecting host cells with a plasmid expressing a recombinant
minus-strand RNA viral genome deficient in the F gene, along with
an F protein expression vector and expression vectors for the NP,
P, and L proteins (see Examples 4 and 5). Viruses can also be
produced, for example, using host cells that have incorporated the
F gene into their chromosomes. In this case, the recombinant enzyme
target sequence described above is preferably used to allow the
induction of recombinant enzyme-specific expression so that the F
gene can be inducibly expressed. These proteins, which are
expressed in virus-producing cells, do not need to have the same
amino acid sequences as the viral sequences, and a mutant or
homologous gene from another virus may be used as a substitute, so
long as the activity in nucleic acid introduction is the same as,
or greater than, that of the natural type.
[0133] Further, in the present invention, recombinant viruses that
include an envelope protein other than that of the virus from which
the viral genome was derived, may be produced as described above.
For example, when reconstituting a virus, a recombinant virus
including a desired envelope protein can be generated by expressing
an envelope protein other than the envelope protein originally
encoded by the basic viral genome. Such proteins are not
particularly limited. A desired protein that confers an ability to
infect cells may be used. Examples of such proteins include the
envelope proteins of other viruses, for example, the G protein of
vesicular stomatitis virus (VSV-G). The VSV-G protein may be
derived from an arbitrary VSV strain. For example, VSV-G proteins
derived from Indiana serotype strains (J. Virology 39: 519-528
(1981)) may be used, but the present invention is not limited
thereto. Furthermore, the present vector may include any arbitrary
combination of envelope proteins derived from other viruses.
Preferred examples of such proteins are envelope proteins derived
from viruses that infect human cells. Such proteins are not
particularly limited, and include retroviral amphotropic envelope
proteins and the like. For example, the envelope proteins derived
from mouse leukemia virus (MuLV) 4070A strain can be used as the
retroviral amphotropic envelope proteins. In addition, envelope
proteins derived from MuMLV 10A1 strain may also be used (for
example, pCL-10A1 (Imgenex) (Naviaux, R. K. et al., J. Virol.
70:5701-5705 (1996)). The proteins of Herpesviridae include, for
example, gB, gD, gH, and gp85 proteins of herpes simplex viruses,
and gp350 and gp220 proteins of EB virus. The proteins of
Hepadnaviridae include the S protein of hepatitis B virus. These
proteins may be used as fusion proteins in which the extracellular
domain is linked to the intracellular domain of the F or HN
protein. As described above, the viral vectors used in this
invention include pseudotype viral vectors that include envelope
proteins, such as VSV-G, derived from viruses other than the virus
from which the genome was derived. If the viral vectors are
designed such that these envelope proteins are not encoded in RNA
genomes, the proteins will never be expressed after virion
infection of the cells.
[0134] Alternatively, in the present invention, for example, it is
possible to produce viruses that have on their envelope surface, a
chimeric protein or such which comprises: a protein that can adhere
to a particular cell, such as an adhesion factor, ligand, or
receptor, antibody or a fragment thereof, or these proteins in the
extracellular region; and a polypeptide derived from a minus-strand
RNA virus envelope protein in the cytoplasmic region. Therefore,
the infection specificity of a viral vector can be controlled. Such
proteins may be encoded by the viral genome, or supplied through
the expression of genes other than the viral genome (for example,
genes in other expression vectors or host chromosomes) during viral
reconstitution.
[0135] Further, in the viral vectors, any viral gene contained in
the virus may be modified from the wild type gene in order to
reduce the immunogenicity caused by viral proteins, or to enhance
RNA transcriptional or replicational efficiency, for example.
Specifically, for example, modifying at least one of the
replication factors N, P, and L genes, is considered to enhance
transcriptional or replicational function. Furthermore, although
the HN protein, which is an envelope protein, has both
hemagglutinin activity and neuraminidase activity, it is possible,
for example, to improve viral stability in blood if the former
activity is attenuated, and infectivity can be controlled if the
latter activity is modified. Further, it is also possible to
control membrane fusion ability by modifying the F protein. For
example, the epitopes of the F protein and/or HN protein, which can
be cell surface antigenic molecules, can be analyzed, and using
this, recombinant viral vectors with reduced antigenicity to these
proteins can be prepared.
[0136] Furthermore, the minus-strand RNA viral vector may be
deficient in one or more accessory genes. For example, by knocking
out the V gene, one of the SeV accessory genes, the pathogenicity
of SeV toward hosts such as mice is remarkably reduced, without
hindering gene expression and replication in cultured cells (Kato,
A. et al., 1997, J. Virol. 71: 7266-7272; Kato,A. etal., 1997, EMBO
J.16: 578-587; Curran, J. etal., WO01/04272, EP1067179). Such
attenuated vectors are particularly useful as nontoxic viral
vectors for in vivo or ex vivo gene transfer.
[0137] Minus-strand RNA viruses are excellent gene transfer
vectors. They do not have DNA phase and carry out transcription and
replication only in the host cytoplasm, and consequently,
chromosomal integration does not occur (Lamb, R. A. and Kolakofsky,
D., Paramyxoviridae: The viruses and their replication. In: Fields
BN, Knipe DM, Howley PM, (eds). Fields of Virology. Vol.2.
Lippincott--Raven Publishers: Philadelphia, 1996, pp. 1177-1204).
Therefore, safety issues such as transformation and immortalization
due to chromosomal abberation do not occur. This characteristic of
minus-strand RNA viruses contributes greatly to safety when it is
used as a vector. For example, results on foreign gene expression
show that even after multiple continuous passages of SeV, almost no
nucletide mutation is observed. This suggests that the viral genome
is highly stable and the inserted foreign genes are stably
expressed over long periods of time (Yu, D. et al., Genes Cells 2,
457-466 (1997)). Further, there are qualitative advantages
associated with SeV not having a capsid structural protein, such as
packaging flexibility and insert gene size, suggesting that
minus-strand RNA viral vectors may become a novel class of highly
efficient vectors for human gene therapy. Transmissible SeV vectors
are capable of introducing foreign genes of up to at least 5 kb in
size, and can simultaneously express two or more kinds of genes by
adding the transcriptional units.
[0138] In particular, SeV is known to be pathogenic in rodents
causing pneumonia, but is not pathogenic for human. This is also
supported by a previous report that nasal administration of wild
type SeV does not have severely harmful effects on non-human
primates (Hurwitz, J. L. et al., Vaccine 15: 533-540, 1997; Bitzer,
M. et al., J. Gene Med. 5: 543-553, 2003; Slobod, K. S. et al.,
Vaccine 22: 3182-3186, 2004). These SeV characteristics suggest
that SeV vectors can be applied therapeutically on humans.
[0139] Viral vectors of this invention can encode desired foreign
genes in their genomic RNA. A recombinant viral vector harboring a
foreign gene is obtained by inserting a foreign gene into an
above-described viral vector genome. The foreign gene can be
inserted at any desired position in a non-protein-coding region of
the virus genome, for example. The above nucleic acid can be
inserted, for example, between the 3'-leader region and the viral
protein ORF closest to the 3'-end; between each of the viral
protein ORFs; and/or between the viral protein ORF closest to the
5'-end and the 5'-trailer region in genomic DNA. Further, in
genomes deficient in envelope proteins such as M, F, or HN gene,
nucleic acids encoding foreign genes can be inserted into those
deficient regions. When introducing a foreign gene into a
paramyxovirus, it is desirable to insert the gene such that the
chain length of the polynucleotide to be inserted into the genome
will be a multiple of six (Journal of Virology, Vol. 67, No. 8,
4822-4830, 1993). An E-I-S sequence should be arranged between the
inserted foreign gene and the viral ORF. Two or more foreign genes
can be inserted in tandem via E-I-S sequences.
[0140] A cloning site for inserting a foreign gene can be designed
in a genome RNA-encoding cDNA so that the foreign gene can be
readily inserted into the cDNA. The site may be placed, for
example, at a desired position within the noncoding region of the
genome. Specifically, such a gene can be inserted between the
3'-leader region and the viral protein ORF proximal to 3', between
respective viral protein ORFs, and/or between the viral protein ORF
proximal to 5' and the 5'-trailer region. When the genome lacks
genes encoding an envelope-constituting protein, the cloning site
can be designed to be in the region where the genes have been
deleted. The cloning site may be, for example, a restriction enzyme
recognition sequence. The cloning site may be a so-called
multi-cloning site, which has multiple restriction enzyme
recognition sequences. Cloning sites may be placed at multiple
positions in the genome so that multiple foreign genes can be
inserted at different positions in the genome.
[0141] Expression levels of a foreign gene carried in a vector can
be controlled using the type of transcriptional initiation sequence
added upstream (to the 3'-side of the minus strand (negative
strand)) of the gene (WO01/18223). The expression levels can also
be controlled by the position at which the foreign gene is inserted
in the genome: the nearer to the 3'-end of the minus strand the
insertion position is, the higher the expression level; while the
nearer to the 5'-end the insertion position is, the lower the
expression level. Thus, to obtain a desired gene expression level,
the insertion position of a foreign gene can be appropriately
controlled such that the combination with genes encoding the viral
proteins before and after the foreign gene is most suitable. In
general, since a high foreign gene expression level is thought to
be advantageous, it is preferable to link the foreign gene to a
highly efficient transcriptional initiation sequence, and to insert
it near the 3'-end of the minus strand genome. Specifically, a
foreign gene is inserted between the 3'-leader region and the viral
protein ORF closest to the 3'-end. Alternatively, a foreign gene
may be inserted between the ORFs of the viral protein gene closest
to the 3'-end and the second closest viral protein gene, or between
the ORFs of the second and third closest viral protein genes. In
wild type paramyxoviruses, the viral protein gene closest to the
3'-end of the genome is the N gene, the second closest gene is the
P gene, and the third closest gene is M gene. Alternatively, when a
high level of expression of the introduced gene is undesirable, the
gene expression level from the viral vector can be suppressed to
obtain an appropriate effect, for example, by inserting the foreign
gene at a site as close as possible to the 5'-side of the minus
strand genome, or by selecting an inefficient transcriptional
initiation sequence.
[0142] For example, a desired S sequence of a minus-strand RNA
virus may be used as the S sequence to be attached when inserting a
foreign gene-encoding nucleic acid into the genome. The sequence
3'-UCCCWVUUWC-5' (W=A or C; V=A, C, or G)(SEQ ID NO: 11) can be
preferably used for Sendai viruses. Particularly preferred
sequences are 3'-UCCCAGUUUC-5' (SEQ ID NO: 12), 3'-UCCCACUUAC-5'
(SEQ ID NO: 13), and 3'-UCCCACUUUC-5' (SEQ ID NO: 14). When shown
as plus strand-encoding DNA sequences, these sequences are
5'-AGGGTCAAAG-3' (SEQ ID NO: 15), 5'-AGGGTGAATG-3' (SEQ ID NO: 16),
and 5'-AGGGTGAAAG-3' (SEQ ID NO: 17). A preferred E sequence of a
Sendai viral vector is, for example, 3'-AUUCUUUUU-5' (SEQ ID NO:
18) or 5'-TAAGAAAAA-3' (SEQ ID NO: 19) for the plus strand-encoding
DNA. An I sequence may be, for example, any three nucleotides,
specifically 3'-GAA-5' (5'-CTT-3' in the plus strand DNA).
[0143] To prepare a minus-strand RNA viral vector, the expression
of viral proteins (i.e., N, P, and L proteins) essential for
reconstitution of an RNP including the genomic RNA of the
minus-strand RNA virus and the transcription of a CDNA encoding a
genomic RNA of a minus-strand RNA virus are induced by CA promoter.
Viral RNP can be reconstituted by producing either the minus-strand
genome (that is, the same antisense strand as the viral genome) or
the plus strand (antigenome, the complementary strand of the
genomic RNA). For increasing the efficiency of vector
reconstitution, it is more preferable to produce the plus strand.
The RNA terminals preferably reflect the terminals of the 3'-leader
sequence and 5'-trailer sequence as accurately as possible, as in
the natural viral genome. As described above, this is achieved by
adding a self-cleaving ribozyme at the 5'-end of the transcript, to
allow the ribozyme to accurately cleave off the end of the
minus-strand RNA viral genome. In an alternative embodiment, to
accurately regulate the 5'-end of the transcript, the RNA
polymerase is expressed within a cell using the recognition
sequence of bacteriophage RNA polymerase as a transcription
initiation site.
[0144] To regulate the 3'-end of the transcript, for example, a
self-cleaving ribozyme can be encoded at the 3'-end of the
transcript, allowing accurate cleavage of the 3'-end with this
ribozyme (Hasan, M. K. et al., J. Gen. Virol. 78: 2813-2820, 1997;
Kato, A. et al., 1997, EMBO J. 16: 578-587; and Yu, D. et al.,
1997, Genes Cells 2: 457-466). An auto-cleaving ribozyme derived
from the antigenomic strand of delta hepatitis virus can be
used.
[0145] For example, a recombinant Sendai virus can be constructed
as follows, according to the disclosure herein and descriptions in:
Hasan, M. K. et al., J. Gen. Virol. 78: 2813-2820, 1997; Kato, A.
et al., 1997, EMBO J. 16: 578-587; Yu, D. et al., 1997, Genes Cells
2: 457-466; or the like.
[0146] To incorporate a foreign gene, a DNA sample comprising a
cDNA sequence of a foreign gene of interest is first prepared. The
DNA sample is preferably one that can be confirmed to be a single
plasmid by electrophoresis at a concentration of 25 ng/.mu.l or
more. The following explains a case using a Not I site to insert a
foreign gene into a DNA encoding a viral genomic RNA, with
reference to examples. When a Not I recognition site is included in
a target cDNA nucleotide sequence, the base sequence is altered
using site-directed mutagenesis or the like, such that the encoded
amino. acid sequence does not change, and the Not I site is
preferably excised in advance. The gene fragment of interest is
amplified from this sample by PCR, and then recovered. By adding
the Not I site to the 5' regions of a pair of primers, both ends of
the amplified fragments become Not I sites. E-I-S sequences are
designed to be included in primers such that, after a foreign gene
is inserted into the viral genome, one E-I-S sequence is placed
between the foreign gene ORF and each side of the viral gene ORF.
The length of the synthesized DNA is designed such that the chain
length of the last fragment to be inserted, which contains the
added E-I-S sequences, will become a multiple of six nucleotides
(the so-called "rule of six"); Kolakofski, D., et al., J. Virol.
72:891-899, 1998; Calain, P. and Roux, L., J. Virol. 67:4822-4830,
1993; Calain, P. and Roux, L., J. Virol. 67: 4822-4830, 1993). For
an E-I-S sequence, the Sendai virus S, I, and E sequences, for
example, 5'-CTTTCACCCT-3' (SEQ ID NO: 20), 5'-AAG-3', and
5'-TTTTTCTTACTACGG-3' (SEQ ID NO: 21), respectively, can be used
in, for example, the 3'-side of the oligo DNA insertion
fragment.
[0147] PCR can be performed according to conventional methods,
using Taq polymerase or other DNA polymerases. The amplified
fragments of interest may be digested with Not I, and then inserted
into the Not I site of plasmid vectors such as pBluescript. The
nucleotide sequences of PCR products thus obtained are confirmed
with a sequencer, and plasmids that include the correct sequence
are selected. The inserted fragment is excised from these plasmids
using Not I, and cloned into the Not I site of a plasmid composed
of genomic cDNA. A recombinant Sendai virus cDNA can also be
obtained by inserting the fragment directly into the Not I site of
a genomic cDNA, without using a plasmid vector.
[0148] For example, a recombinant Sendai virus genomic cDNA can be
constructed according to methods described in the literature (Yu,
D. et al., Genes Cells 2: 457-466, 1997; Hasan, M. K. et al., J.
Gen. Virol. 78: 2813-2820, 1997). For example, a double-stranded
DNA is synthesized to have an E-I-S sequence attached to the 3' end
of the sense strand of the foreign gene. The DNA is inserted
irnmediately 3' of a desired S sequence in a cDNA encoding the plus
strand of the genome. For example, on a cDNA that encodes the plus
strand genome, a restriction site (e.g., Not I site) is first
placed between a sequence encoding the desired viral protein gene
and an S sequence that transcribes the gene. A DNA encoding a
foreign gene-E-I-S sequence can then be inserted into the
restriction site (Tokusumi, T. et al. Virus Res 86(1-2), 33-8
(2002)).
[0149] A viral vector can be efficiently reconstituted by
transcribing a DNA encoding a genomic RNA of a recombinant virus
thus prepared, in cells by CA promoter in the presence of the
above-described viral proteins (L, P, and N). The method of the
present invention can be applied to methods for reconstituting
various recombinant viruses (WO97/16539; WO97/16538; WO03/025570;
Durbin, A. P. et al., 1997, Virology 235: 323-332; Whelan, S. P. et
al., 1995, Proc. Natl. Acad. Sci. USA 92: 8388-8392; Schnell. M. J.
et al., 1994, EMBO J. 13: 4195-4203; Radecke, F. et al., 1995, EMBO
J. 14: 5773-5784; Lawson, N. D. et al., Proc. Natl. Acad. Sci. USA
92: 4477-4481; Garcin, D. et al., 1995, EMBO J. 14: 6087-6094;
Kato, A. et al., 1996, Genes Cells 1: 569-579; Baron, M. D. and
Barrett, T., 1997, J. Virol. 71: 1265-1271; Bridgen, A. and
Elliott, R. M., 1996, Proc. Natl. Acad. Sci. USA 93: 15400-15404).
When the method of the present invention is applied to these
methods, minus strand RNA viruses including parainfluenza virus,
vesicular stomatitis virus, rabies virus, measles virus, rinderpest
virus, and Sendai virus can be reconstituted from DNA with high
efficiency. When a viral genome-encoding DNA is made
envelope-constituting protein genes such as F gene, HN gene, and/or
M gene deficient, such DNAs do not form infectious virions as is.
However, infectious virions can be formed by separately introducing
host cells with these deficient genes, and/or genes encoding the
envelope proteins of other viruses, and then expressing these genes
therein (Hirata, T. et al., 2002, J. Virol. Methods, 104: 125-133;
Inoue, M. et al., 2003, J. Virol. 77: 6419-6429). When
envelope-constituting proteins are expressed in virus-producing
cells, it is preferable to use a CA promoter to express the
envelope-constituting proteins. For this purpose, a DNA encoding an
envelope-constituting protein is linked downstream of a CA
promoter. This allows the envelope-constituting protein to be
directly expressed by a CA promoter.
[0150] Specific methods include, for example, a method for
transiently producing viruses. One of such methods is a method of
transfecting mammalian cells with a vector for transcribing a DNA
encoding a ribozyme and a minus-strand RNA virus genome RNA or the
complementary strand thereof under the control of a CA promoter,
and a vector for expressing viral proteins constituting an RNP
comprising the minus-strand RNA virus genome RNA under the control
of a CA promoter. Functional RNP is formed through the
transcription of the genome RNA or antigenome RNA of the
minus-strand RNA virus by a CA promoter in the presence of
RNP-constituting viral proteins. As a result viruses are
reconstituted. The minus-strand RNA virus vector can be obtained by
recovering the minus-strand RNA virus produced in the cells or
propagation products thereof.
[0151] In another method, a vector comprising a bacteriophage RNA
polymerase-encoding DNA operably linked to a CA promoter, and a
vector comprising a DNA that encodes a minus-strand RNA virus
genome RNA or the complementary strand thereof and is linked
downstream of the RNA polymerase recognition sequence, are
transfected into mammalian cells along with a vector that expresses
RNP-constituting viral proteins (N, L, and P) under the control of
a CA promoter, wherein the RNP contains a minus-strand RNA virus
genome RNA. In the presence of RNP-constituting viral proteins, the
RNA polymerase is expressed by the CA promoter, and functional RNP
is formed through the transcription of the genome RNA or antigenome
RNA of the minus-strand RNA virus by the RNA polymerase expressed.
As a result, viruses are reconstituted. The minus-strand RNA virus
can be obtained by recovering the minus-strand RNA virus produced
in the cells or propagation products thereof.
[0152] The vector used for transfection is preferably a plasmid.
Each plasmid may be constructed to express a single protein.
Alternatively, multiple proteins may be expressed on a single
plasmid. For this purpose, a single plasmid may have multiple
promoters. Alternatively, multiple proteins may be produced by a
single promoter using IRES or such. For example, when two or more
types of proteins are expressed by a single promoter using a
non-promoter mechanism such as IRES, the proteins are considered to
be expressed by a CA promoter when the promoter is CA promoter.
However, it is preferred that each of the viral proteins (L, P, and
N) that constitute an RNP comprising a minus-strand RNA virus
genome RNA is at least expressed by a separate CA promoter. The
transfection-based transient viral production described above is
superior because it can rapidly produce viruses without using
special cells.
[0153] Methods for transfecting cells with nucleic acids include
the calcium phosphate method (Graham, F. L. and Van Der Eb, J.,
1973, Virology 52: 456; Wigler, M. and Silverstein, S., 1977, Cell
11: 223), methods using various transfection reagents,
electroporation, or such. The calcium phosphate method can be
performed, for example, under the conditions of 2 to 4% CO.sub.2,
35.degree. C., 15 to 24 hours, and the DNA concentration in the
precipitate mixture of 20 to 30 .mu.g/ml, according to Chen and
Okayama (Chen, C. and Okayama, H., 1987, Mol. Cell. Biol. 7: 2745).
As a transfection reagent, DEAE-dextran (Sigma #D-9885 M.W.
5.times.10.sup.5), DOTMA (Roche), Superfect (QIAGEN #301305),
DOTAP, DOPE, DOSPER (Roche #1811169), TransIT-LT1 (Mirus, Product
No. MIR 2300), or the like can be used. To prevent transfection
reagent/DNA complexes from decomposing in endosomes, chloroquine
may also be added (Calos, M. P., 1983, Proc. Natl. Acad. Sci. USA
80: 3015). Electroporation has a wide versatility because it is not
cell-selective. It is applied by optimizing the duration of pulse
electric current, shape of the pulse, potency of electric field
(gap between electrodes, voltage), conductivity of buffer, DNA
concentration, and cell density. The methods using transfection
reagents are suitable for the transduction into cells of DNA for
vector reconstitution, since they are simple to operate and
facilitate examination of many samples using a large amount of
cells. Preferably, the Superfect Transfection Reagent (QIAGEN, Cat
No. 301305), the DOSPER Liposomal Transfection Reagent (Roche, Cat
No. 1811169), TransIT-LT1 (Mirus, Product No. MIR 2300) or such is
used; however, the transfection reagents are not limited to
these.
[0154] In another embodiment of the method of the present
invention, proteins and/or RNAs required for viral production are
expressed from the chromosomes of virus-producing cells. Specific
examples of this method include, for example, a method using
mammalian cell lines whose chromosomes contain integrated DNA which
becomes transcribed by a CA promoter into viral genome RNA or the
complementary strand thereof, or integrated DNA which is expressed
as a bacteriophage-derived RNA polymerase by a CA promoter. Cells
having the ability to produce higher titer viruses can be prepared
by cloning transformants and selecting cells with high expression
levels. Thus, such cells are useful for stably producing high titer
viruses. In such cells, it is also preferred that the expression of
viral genome RNA and RNA polymerase is designed to be responsive to
and inducible upon stimulation, while in the absence of
stimulation, neither is expressed by a CA promoter. Genes can be
expressed inducibly by a CA promoter by using the loxP or FRT
described above. The Cre recombinase or FLP recombinase is
expressed at the time of viral production to induce the expression
from a CA promoter.
[0155] In such cells, the minus-strand RNA virus can be
reconstituted through transcription of viral genome RNA or the
complementary strand thereof in the presence of viral proteins (N,
L, and P) that constitute an RNP that contains the minus-strand RNA
virus genome RNA. RNP-constituting proteins may be supplied by
transfecting plasmid vectors encoding the proteins.
[0156] In a method of excising the minus-strand RNA virus genome
with a ribozyme (for example, the HamRbz method), the amount of
each plasmid used in the transfection is for example: 0.1 to 2
.mu.g (more preferably, 0.3 .mu.g) of an NP-expressing plasmid; 0.1
to 2 .mu.g (more preferably, 0.5 .mu.g) of a P-expressing plasmid;
0.5 to 4.5 .mu.g (more preferably, 2.0 .mu.g) of an L-expressing
plasmid; 0.1 to 5 .mu.g (more preferably, 0.5 .mu.g) of an
F-expressing plasmid; and 0.5 to 5 .mu.g (more preferably, 5 .mu.g)
of a viral genome RNA-encoding plasmid (plus or minus strand). For
producing SeV, for example, the plasmids described in the Examples
may be used in the following amounts: TABLE-US-00003 pCAGGS-NP 0.1
to 2 .mu.g (more preferably, 0.3 .mu.g) pCAGGS-P 0.1 to 2 .mu.g
(more preferably, 0.5 .mu.g) pCAGGS-L(TDK) 0.5 to 4.5 .mu.g (more
preferably, 2.0 .mu.g) pCAGGS-F5R 0.1 to 5 .mu.g (more preferably,
0.5 .mu.g) pCAGGS-SeV 0.5 to 5 .mu.g (more preferably, 5 .mu.g)
(pCAGGS-SeV/.DELTA.F-GFP)
[0157] In a method of transcribing the minus-strand RNA virus
genome by a bacteriophage RNA polymerase, it is possible to use 0.1
to 2 .mu.g (more preferably 0.5 .mu.g) of an NP-expressing plasmid,
0.1 to 2 .mu.g (more preferably 0.5 .mu.g) of a P-expressing
plasmid, 0.5 to 4.5 .mu.g (more preferably 2.0 .mu.g) of an
L-expressing plasmid, 0.1 to 5 .mu.g (more preferably 0.5 .mu.g) of
an F-expressing plasmid, and 0.5 to 5 .mu.g (more preferably 5
.mu.g) of a viral genome RNA-encoding plasmid (plus or minus
strand). For producing SeV, for example, the plasmids described in
the Examples can be used in the following amounts: TABLE-US-00004
pCAGGS-NP 0.1 to 2 .mu.g (more preferably, 0.5 .mu.g) pCAGGS-P 0.1
to 2 .mu.g (more preferably, 0.5 .mu.g) pCAGGS-L(TDK) 0.5 to 4.5
.mu.g (more preferably, 2.0 .mu.g) pCAGGS-F5R 0.1 to 5 .mu.g (more
preferably, 0.5 .mu.g) pCAGGS-SeV 0.5 to 5 .mu.g (more preferably,
5 .mu.g) (pCAGGS-SeV/.DELTA.F-GFP)
[0158] After culturing for about 48 to 72 hours after transfection,
cells are harvested, and then disintegrated by repeating
freeze-thawing about three times. Cells are re-infected with the
disintegrated materials including RNP, and cultured. Alternatively,
the culture supernatant is recovered, added to a culture solution
of cells to infect them, and the cells are then cultured.
Transfection can be conducted by, for example, forming a complex
with lipofectamine, polycationic liposome, or the like, and
transducing the complex into cells. Specifically, various
transfection reagents can be used. For example, DOTMA (Roche),
Superfect (QIAGEN #301305), DOTAP, DOPE, DOSPER (Roche #1811169),
and TransIT-LT1 (Mirus, Product No. MIR 2300) may be cited. In
order to prevent decomposition in the endosome, chloroquine may
also be added (Calos, M. P., 1983, Proc. Natl. Acad. Sci. USA 80:
3015). In cells transduced with RNP, viral gene expression from RNP
and RNP replication progress, and the virus is amplified. By
appropriately diluting the viral solution (culture supernatant)
thus obtained, and then repeating the amplification, possible
contaminants can be removed. However, the method of the present
invention does not use the vaccinia virus expressing T7 RNA
polymerase. Thus, the method is superior since re-amplification is
not required for removing the vaccinia virus. Vectors thus obtained
can be stored at -80.degree. C. In order to reconstitute a
nontransmissible virus lacking a gene encoding an
envelope-constituting protein, cells expressing the
envelope-constituting protein (helper cells) may be used for
transfection, or a plasmid expressing the envelope-constituting
protein may be cotransfected. Alternatively, an envelope-gene
defective type virus can be amplified by culturing the transfected
cells overlaid with cells expressing the envelope-constituting
protein (see WO00/70055 and WO00/70070).
[0159] Helper cells that are used to construct a minus-strand RNA
viral vector lacking envelope-constituting protein genes can be
prepared, for example, by transfecting genes encoding the deleted
envelope-constituting proteins or other envelope proteins (for
example, VSV-G and amphotropic env) (see WO 00/70055 and WO
00/70070; Hasan, M. K. et al., 1997, J. General Virology 78:
2813-2820). To enable inducible expression, for example, the
envelope protein genes are inserted into a vector having a
recombinase target sequence, such as Cre/loxP inducible expression
plasmid pCALNdlw (Arai, T. et al., J. Virology 72, 1998, p
115-1121). Such cells may be, for example, a monkey kidney-derived
cell line LLC-MK2 (ATCC CCL-7), which is frequently used for SeV
proliferation. LLC-MK2 cells are cultured at 37.degree. C. under 5%
CO.sub.2 in MEM supplemented with 10% heat-inactivated fetal bovine
serum (FBS), 50 units/ml penicillin G sodium, and 50 .mu.g/ml
streptomycin. Since SeV-F gene product is cytotoxic, LLC-MK2 cells
are introduced with the above-described plasmid pCALNdLw/F, which
is designed to inducibly express products of envelope protein genes
by Cre DNA recombinase, using the calcium phosphate method
(Mammalian Transfection kit (Stratagene)) according to well known
protocols. The cells are cloned by limiting dilution and then
culture-expanded, followed by selection of cell lines with high
expressions of the introduced genes. For this purpose, for example,
cells are infected with adenovirus AxCANCre, for example, at an moi
of 3 to 5 by the method of Saito et al. (Saito et al., Nucl. Acids
Res. 23: 3816-3821 (1995); Arai, Tet al., J. Virol 72,1115-1121
(1998)), and are then selected by Western blotting or virus
production.
[0160] Deletion of the spike protein F or HN gene is effective in
rendering SeV vectors nontransmissible, whereas deletion of the
envelope-ling protein M gene is effective in disabling particle
formation in infected cells. Alternatively, vectors lacking any
combination of at least two of F, HN, and M genes assure greater
safety. For example, SeV that lacks both M and F genes
(SeV/.DELTA.M.DELTA.F) is nontransmissible and defective in
particle formation. SeV/.DELTA.M.DELTA.F retains high infectivity
and gene expression ability in vitro and in vivo, and their degrees
are comparative to those of the wild type SeV vector. These
SeV/.DELTA.M.DELTA.F characteristics will further contribute to the
improvement of SeV safety.
[0161] Titers of viruses thus recovered can be determined, for
example, by measuring CIU (Cell Infecting Unit) or hemagglutination
activity (HA) (WO00/70070; Kato, A. et al., 1996, Genes Cells 1:
569-579; Yonemitsu, Y & Kaneda, Y, Hemaggulutinating virus of
Japan-liposome-mediated gene delivery to vascular cells. Ed. by
Baker A H. Molecular Biology of Vascular Diseases. Method in
Molecular Medicine: Humana Press: pp. 295-306, 1999). Titers of
vectors carrying GFP (green fluorescent protein) marker genes and
the like can be quantified by directly counting infected cells,
using the marker as an indicator (for example, as GFP-CIU). Titers
thus measured can be treated in the same way as CIU
(WO00/70070).
[0162] So long as a virus can be reconstituted, the host cells used
in the reconstitution are not particularly limited. For example, in
the reconstitution of Sendai virus vectors and the like, cultured
cells such as LLC-MK2 cells and CV-1 cells (for example, ATCC
CCL-70) derived from monkey kidney, BHK cells (for example, ATCC
CCL-10) derived from hamster kidney, and cells derived from humans
can be used. Further, to obtain a large quantity of a Sendai virus
vector, a viral vector obtained from an above-described host can be
used to infect embrionated hen eggs to amplify the vector. Methods
for manufacturing viral vectors using hen eggs have already been
developed (Nakanishi, et al., ed. (1993), "State-of-the-Art
Technology Protocol in Neuroscience Research III, Molecular Neuron
Physiology", Koseisha, Osaka, pp. 153-172). Specifically, for
example, a fertilized egg is placed in an incubator, and cultured
for nine to twelve days at 37 to 38.degree. C. to grow an embryo.
After the viral vector is inoculated into the allantoic cavity, the
egg is cultured for several days (for example, three days) to
proliferate the viral vector. Conditions such as the period of
culture may vary depending upon the recombinant Sendai virus being
used. Then, allantoic fluids including the vector are recovered.
Separation and purification of a Sendai virus vector from allantoic
fluids can be performed according to a usual method (Tashiro, M.,
"Virus Experiment Protocol," Nagai, Ishihama, ed., Medical View
Co., Ltd., pp. 68-73, (1995)).
[0163] According to the method for producing viruses as described
herein, the viral vector of the present invention can be released
into extracellular fluid of virus producing cells at a titer of,
for example, 1.times.10.sup.5 CIU/ml or higher, preferably
1.times.10.sup.6 CIU/ml or higher, more preferably 5.times.10.sup.6
CIU/ml or higher, more preferably 1.times.10.sup.7 CIU/ml or
higher, more preferably 5.times.10.sup.7 CIU/ml or higher, more
preferably 1.times.10.sup.8 CIU/ml or higher, and more preferably
5.times.10.sup.8 CIU/ml or higher. The titer of virus can be
determined according to methods described herein or elsewhere
(Kiyotani, K. et al., Virology 177(1), 65-74 (1990); and
WO00/70070).
[0164] The recovered viral vectors can be purified to be
substantial pure. The purification can be achieved using known
purification/separation methods, including filtration,
centrifugation, adsorption, and column purification, or any
combinations thereof. The phrase "substantially pure" means that
the virus component constitutes a major proportion of a solution of
the viral vector. For example, a viral vector composition can be
confirmed to be substantially pure by the fact that the proportion
of protein contained as the viral vector component to the total
protein (excluding proteins added as carriers and stabilizers) in
the solution is 10% (w/w) or greater, preferably 20% or greater,
more preferably 50% or greater, preferably 70% or greater, more
preferably 80% or greater, and even more preferably 90% or greater.
Specific purification methods for, for example, the paramyxovirus
vector includes methods using cellulose sulfate ester or
cross-linked polysaccharide sulfate ester (Japanese Patent
Application Kokoku Publication No. (JP-B) S62-30752 (examined,
approved Japanese patent application published for opposition),
JP-B S62-33879, and JP-B S62-30753) and methods including adsorbing
to fucose sulfate-containing polysaccharide and/or degradation
products thereof (WO97/32010), but are not limited thereto.
[0165] In the production of compositions containing the viral
vector of the present invention, the vector may be combined with
desired pharmaceutically acceptable carriers or media according to
needs. The "pharmaceutically acceptable carriers or media" refers
to materials that can be administered together with the vector and
that do not significantly inhibit the gene transfer via the vector.
Such carriers and media include, for example, sterile water, sodium
chloride solution, dextrose solution, lactated Ringer's solution,
culture medium, serum, and phosphate buffered saline (PBS). They
may be appropriately combined with the vector to formulate a
composition. The composition of the present invention may also
include membrane stabilizers for liposome (for example, sterols
such as cholesterol). The composition may also include antioxidants
(for example, tocopherol or vitamin E). In addition, the
composition may also include vegetable oils, suspending agents,
detergents, stabilizers, biocidal agents, and the like.
Furthermore, preservatives and other additives may also be added.
The formula of the present composition may be aqueous solution,
capsule, suspension, syrup, or the like. The composition of the
present invention may also be in a form of solution, freeze-dried
product, or aerosol. When it is a freeze-dried product, it may
include sorbitol, sucrose, amino acids, various proteins, and the
like as a stabilizer.
[0166] When a minus-strand RNA viral vector is used to induce
immunity, immunostimulants such as cytokine, cholera toxin, and
Salmonella toxin can be added to improve immunogenicity.
Furthermore, such vaccine compositions may be combined with
adjuvants, such as alum, incomplete Freund's adjuvant, MF59 (oil
emulsion), MTP-PE (muramyl tripeptide derived from cell wall of
mycobacteria), and QS-21 (derived from soapbark tree Quilaja
saponaria). When administering the composition or cell, it is
effective to combine them with cytokines that improve the adjuvant
effect. Such genes include, for example,
[0167] (i) single-chain IL-12 (Proc. Natl. Acad. Sci. USA 96 (15):
8591-8596, 1999);
[0168] (ii) interferon-.gamma. (U.S. Pat. No. 5,798,100);
[0169] (iii) granulocyte colony stimulating factor (GM-CSF);
and
[0170] (iv) a combination of GM-CSF and IL-4 (J. Neurosurgery 90
(6), 1115-1124 (1999)).
[0171] The dose of a minus-strand RNA viral vector may vary
depending upon the disorder, body weight, age, gender, and symptoms
of patients, as well as the form of the composition to be
administered, administration method, gene to be transduced, and so
on; however, those skilled in the art can appropriately determine
the dosage. Doses of the vector are preferably administered in a
pharmaceutically acceptable carrier in a range of preferably about
10.sup.5 CIU/ml to about 10.sup.11 CIU/ml, more preferably about
10.sup.7 CIU/ml to about 10.sup.9 CIU/ml, most preferably about
1.times.10.sup.8 CIU/ml to about 5.times.10.sup.8 CIU/ml. In
humans, a single dose is preferably in the range of
2.times.10.sup.5 CIU to 2.times.10.sup.11 CIU, and can be
administered once or more, so long as the side effects are within a
clinically acceptable range. The same applies to the number of
administrations per day. With non-human animals, for example, the
above-described doses can be converted based on the body weight
ratio or volume ratio of a target site for administration (e.g.
average values) between the animal of interest and human, and the
converted doses can be administered to the animal. After
administering a transmissible minus-strand RNA viral vector to an
individual or cell, when the proliferation of the viral vector must
be restrained upon treatment completion and such, it is also
possible to specifically restrain only the proliferation of the
viral vector, with no damage to the host, by administering an
RNA-dependent RNA polymerase inhibitor. For ex vivo administration,
a vector is contacted with target cells outside the body (for
example, in a test tube or dish). The vector is preferably
administered at an MOI of 1 to 500, more preferably 2 to 300, still
more preferably 3 to 200, yet preferably 5 to 100, even more
preferably 7 to 70. There is no limitation on the type of organism
to which the minus-strand RNA viral vector of the present invention
is administered. Such organisms include desired mammals including
human and nonhuman mammals, specifically, human, mouse, rat, dog,
pig, cat, bovine, rabbit, sheep, goat, and monkey.
EXAMPLES
[0172] Hereinafter, the present invention will be explained in more
detail with reference to the Examples, but is not to be construed
as being limited thereto. All the references cited herein are
incorporated as parts of the present specification.
Example 1
Plasmid Construction (FIG. 1)
Construction of pCAGGS (B type)
[0173] pCALNdLw (Arai, T. et al. J. Virology 72, 1998, p.
1115-1121) was digested with XhoI, purified using the Qiaquick PCR
Purification kit, and ligated. The plasmid from which the XhoI
fragment was deleted was selected and named pCAGGS (B type). pCAGGS
(B type) was digested with SalI, and blunted using the Pfu DNA
polymerase. The DNA was purified with the Qiaquick PCR Purification
kit, and ligated. The plasmid in which the SalI site was deleted
was selected and named pCAGGS(BSX)
Construction of pCAGGS-NP (FIG. 2)
[0174] pCALNdLw was digested with SpeI and EcoT22I, and separated
by agarose gel electrophoresis. The 2651-bp and 3674-bp fragments
were excised, and purified with the Qiaquick gel Extraction kit.
Then, the 2651-bp fragment was digested with XhoI. After separation
by agarose gel electrophoresis, a 1760-bp band was purified. The
Zeocin resistance gene was amplified by PCR using pcDNA3.1/Zeo(+)
as template and the following primers:
5'-TCTCGAGTCGCTCGGTACGATGGCCAAGTTGACCAGTGCCGTTCCGGTGCTCAC-3' (SEQ
ID NO: 22) and
5'-AATGCATGATCAGTAAATTACAATGAACATCGAACCCCAGAGTCCCGCTCAGTCCT
GCTCCTCGGCCACGAAGTGCACGCAGTTG-3' (SEQ ID NO: 23). The amplified DNA
was digested with XhoI and EcoT22I, and separated by agarose gel
electrophoresis. A band of 438 bp was excised and purified using
the Qiaquick Gel Extraction kit. The three fragments, namely the
fragment comprising the Zeocin resistance gene and the 3674-bp and
1761-bp fragments described above, were ligated to each other to
yield pCALNdLw-Zeo. This pCALNdLw-Zeo was digested with Swal and an
EcoRI linker (STRATAGENE) was inserted to yield pCALNdLWE-Zeo. A
Sendai virus cDNA introduced with a multi-cloning site (JP-A
2002-272465) (hereinafter referred to as pSeV(TDK)) was digested
with NotI and XhoI, and separated by agarose gel electrophoresis. A
band of 1669 bp was excised and purified using the Qiaquick Gel
Extraction kit. The fragment comprising the NP gene was inserted
into pGEM11Zf(+) (Promega), which had been digested with NotI and
XhoI, to yield pGEM-NP(Z)PCR14-3. PCR amplification was performed
using this plasmid as template and the following primers:
5'-CCGGAATTCAACAAATGGCCGGGTTGTTGAGCACCTTCGA-3' (SEQ ID NO: 24) and
5'-CCGGAATTCCTAGATTCCTCCTATCCCAGCTACTGCTGCTCG-3' (SEQ ID NO: 25).
The PCR product was digested with EcoRI, and inserted into the
EcoRI site of pCALNdLWE-Zeo to yield pCALNdLWE-Zeo-NP(Z). Then,
pCALNdLWE-Zeo-NP(Z) was digested with XhoI, and ligated to
construct a plasmid from which the XhoI fragment was deleted. The
resulting plasmid was named pCAGGS-NP.
Construction of pCAGGS-P4C(-) (FIG. 3)
[0175] pCALNdLw-HygroM (Inoue, M. et al. J. Virology 77, 2003, p
6419-6429) was digested with XhoI, and separated by agarose gel
electrophoresis. A 1679-bp band containing the hygromycin
resistance gene was excised and purified using the Qiaquick Gel
Extraction kit. pCALNdLw was digested with XhoI. After agarose gel
electrophoresis, a 4864-bp band was excised and purified using the
Qiaquick Gel Extraction kit. These two fragments were ligated to
each other to construct pCALNdLw-Hygro. This pCALNdLw-Hygro was
digested with Swal, and an NheI linker (STRATAGENE) was inserted to
yield pCALNdLWN-Hygro. PCR was carried out with the KOD-PLUS DNA
Polymerase (TOYOBO), using 4C(-)SeV cDNA (Kurotani, Kato, Nagai, et
al Genes to Cells 3, 1998, p 111-124) as template and the following
primers: 5'-CTAGCTAGCCCACCATGGATCAAGATGCCTTCATTCTAAAAGAAGATTCT-3'
(SEQ ID NO: 26) and
5'-CTAGCTAGCCTAGTTGGTCAGTGACTCTATGTCCTCTTCTACGAGTTCCA-3' (SEQ ID
NO: 27). The PCR product was purified using the Gene Clean kit, and
then digested with NheI. The product was purified with the Gene
Clean kit. This is inserted into the NheI site of pCALNdLWN-hygro
described above to yield pCALNdLWN-hygro-P(Z)k4C(-). This plasmid
was digested with XhoI, and then purified with the Qiaquick PCR
Purification kit. After ligation, the plasmid from which the XhoI
fragment (hygromycin resistance gene region) was deleted was
selected to yield pCAGGS-P4C(-).
Construction of pCAGGS-L(TDK) (FIG. 4)
[0176] pSeV(TDK) was digested with FseI and SacII and separated by
agarose gel electrophoresis. A 6732-bp band was excised and
purified using the Qiaquick Gel Extraction kit. The fragment was
blunted by reacting with the Pfu DNA Polymerase and dNTP at
72.degree. C. for 10 minutes. After purification with the Qiaquick
PCR Purification kit, the fragment was inserted into the SwaI site
of pCAGGS(BSX) to yield pCAGGS-L(TDK).
Construction of pCAGGS-F and pCAGGS-F5R (FIGS. 5 to 7)
[0177] pCALNdLw/F (Li, H.-O. et al. J. Virology 74, 2000, p
6564-6569) was digested with XhoI. After purification, the plasmid
was ligated. The plasmid from which the XhoI fragment (Neomycin
resistance gene region) was deleted was selected to obtain
pCAGGS-F. PCR was carried out using pCALNdLw-ZeoF (Japanese Patent
Application No. 2001-283451) as template and Pfu Turbo
(STRATAGENE), under condition (I): combined primers
5'-CATTTTGGCAAAGAATTGATTAATTCGAG-3' (SEQ ID NO: 28) and
5'-TCACAGCACCCAAGAATCTCTTCTGGCGAGCACCGGCATTTTGTGTC-3' (SEQ ID NO:
29); and condition (II): combined primers
5'-GACACAAAATGCCGGTGCTCGCCAGAAGAGATTCTTGGGTGCTGTGA-3' (SEQ ID NO:
30) and 5'-GATCGTAATCACAGTCTCTCGAGAGTTGTACCATCTACCTAC-3' (SEQ ID
NO: 31). After the PCR product was separated by agarose gel
electrophoresis, the 1470-bp band yielded under condition (I) and
the 1190-bp band yielded under condition (II) were excised and
recovered using the GENE CLEAN KIT (referred to as PCR products (I)
and (II), respectively). 1 .mu.l each of the PCR products (I) and
(II), both purified and 10-times diluted, was combined, and
subjected to PCR using Pfu Turbo and combined primers
5'-CATTTTGGCAAAGAATTGATTAATTCGAG-3' (SEQ ID NO: 28) and
5'-GATCGTAATCACAGTCTCTCGAGAGTTGTACCATCTACCTAC-3' (SEQ ID NO: 31). 5
.mu.l of the PCR product was electrophoresed on an agarose gel, and
stained with ethidium bromide. As a result, an expected band of 2.6
kb was detected. Thus, the remaining PCR product was purified using
the Qiaquick PCR Extraction kit and digested in succession with the
restriction enzymes DraIII and MfeI. After separation by agarose
gel electrophoresis, a band of about 2.0 kb is excised from the
gel. pCALNdLw-Zeo-F was digested in succession with DraIII and
MfeI, and separated by agarose gel electrophoresis. A band of about
6 kp is excised and purified using GENECLEAN II KIT (BIO). The
DraIII-MfeI fragment of pCALNdLw-Zeo-F was ligated with the
above-described PCR DraIII-MfeI fragment to yield pCALNdLw-Zeo-F
furin. Then, PCR was carried out using pCALNdLw-Zeo-F furin as
template under condition (I): combined primers
5'-CATTTTGGCAAAGAATTGATTAATTCGAG-3' (SEQ ID NO: 28) and 5
'-TCACAGCACCGAAGAATCTCCTCCGGCGACGACCGGCATTTTGTGTCGTATC-3' (SEQ ID
NO: 32); and condition (II): combined primers
5'-GATACGACACAAAATGCCGGTCGTCGCCGGAGGAGATTCTTCGGTGCTGTGA-3' (SEQ ID
NO: 33) and 5'-AAATCCTGGAGTGTCTTTAGAGC-3' (SEQ ID NO: 34). After
separation by electrophoresis, the .about.1.4 kbp band in condition
(I) and the .about.200 bp band in condition (II) were excised and
purified with the Qiaquick gel Extraction kit. 1 .mu.l each of
purified and 50-times diluted PCR products was combined, and
subjected to PCR using Pfu Turbo and the combination of primers
5'-CATTTTGGCAAAGAATTGATTAATTCGAG-3' (SEQ ID NO: 28) and
5'-AAATCCTGGAGTGTCTTTAGAGC-3' (SEQ ID NO: 34). 5 .mu.l of the PCR
product was separated by agarose gel electrophoresis and stained to
confirm a .about.1.6 kbp band. The remaining PCR product was
purified with the Qiaquick PCR Purification kit, and then digested
with ClaI and FseI. After separation by agarose gel
electrophoresis, a band of about 1 kbp is excised and purified with
the Qiaquick PCR Purification kit. pCALNdLw-Zeo-F furin was
digested with ClaI and FseI. After separation by agarose gel
electrophoresis, a band of about 8 kbp is excised and purified with
the Qiaquick PCR Purification kit. The DNA was ligated with a
purified ClaI-FseI-digested fragment of the PCR product described
above to yield pCALNdLw-Zeo F5R. This pCALNdLw-Zeo F5R was digested
with XhoI. After purification, the plasmid was ligated. The plasmid
from which the XhoI fragment (including Zeocin resistance gene) was
deleted was selected to obtain pCAGGS-F5R.
Construction of pCAGGS-T7 (FIG. 8)
[0178] pTF7-3 (ATCC No. 67202) was digested with BamHI. After
separation by agarose gel electrophoresis, a fragment of 2.65 kbp
comprising the T7 RNA polymerase gene was recovered and inserted
into the BamHI site of pMW219 (Nippon Gene Co. Ltd.) to yield
pMW219-T7. This pMW219-T7 was digested with SalI and blunted using
the DNA Blunting kit (TaKaRa). An EcoRI linker (Stratagene #901026)
was inserted to yield pMW219-T7-Eco RI. This pMW219-T7-Eco RI was
digested with EcoRI. An EcoRI fragment comprising the T7 RNA
polymerase was purified and inserted into the EcoRI site of
pCALNdLWE described above to yield pCALNdLWE-T7.
[0179] Construction of pCAGGS-SeV and pCAGGS-SeV/AF-GFP (FIGS. 9 to
11) pSeV(TDK) was digested with NotI and KpnI and separated by
agarose gel electrophoresis. A band of 2995 bp was then excised and
purified using the Qiaquick Gel Extraction kit. 2 .mu.g (2 .mu.l)
each of MlinkerF: 5'-GGCCGCGTCGACATCGATGCTAGCCTCGAGCCGCGGTAC-3'
(SEQ ID NO: 35) and MlinkerR: 5'-CGCGGCTCGAGGCTAGCATCGATGTCGACGC-3'
(SEQ ID NO: 36) was mixed with 21 .mu.l of H.sub.2O and annealed at
95.degree. C. for 5 minutes, 85.degree. C. for 15 minutes,
65.degree. C. for 15 minutes, 37.degree. C. for 15 minutes,
25.degree. C. for 15 minutes, and then 4.degree. C. The mixture and
a solution of purified pSeV(TDK) NotI-KpnI were ligated to yield
pSeV/Linker. PCR was carried out using the pSeV/Linker as template,
KOD-Plus (TOYOBO), and the following primers: pGEM-F5:
5'-CTTAACTATGCGGCATCAGAGC-3' (SEQ ID NO: 37) and pGEM-R1:
5'-GCCGATTCATTAATGCAGCTGG-3' (SEQ ID NO: 38). The PCR product was
purified using the Qiaquick PCR Purification kit. PCR was carried
out using a solution of the purified PCR product as template,
KOD-PLUS (TOYOBO), and the following primers: RibLF1:
5'-CTATAGGAAAGGAATTCCTATAGTCACCAAACAAGAG-3' (SEQ ID NO: 39) and
pGEM-R1: 5'-GCCGATTCATTAATGCAGCTGG-3' (SEQ ID NO: 38). The PCR
product was purified using the Qiaquick PCR Purification kit. PCR
was carried out using a solution of the purified PCR product as
template, KOD-PLUS (TOYOBO), and the following primers: RibLF2:
5'-GATGAGTCCGTGAGGACGAAACTATAGGAAAGGAATTC-3' (SEQ ID NO: 40) and
pGEM-R1: 5'-GCCGATTCATTAATGCAGCTGG-3' (SEQ ID NO: 38). The PCR
product was purified using the Qiaquick PCR Purification kit.
Furthermore, PCR was carried out using a solution of the purified
PCR product as template, KOD-PLUS (TOYOBO), and the following
primers: RibLF3: 5'-GCGGGCCCTCTCTTGTTTGGTCTGATGAGTCCGTGAGGAC-3'
(SEQ ID NO: 41) and pGEM-R1; 5'-GCCGATTCATTAATGCAGCTGG-3' (SEQ ID
NO: 38). The PCR product was purified using the Qiaquick PCR
Purification kit. This purified PCR product was inserted into the
SwaI site of pCAGGS(BSX) to yield pCAGGS-SeV(m). Then,
pSeV18+b(+)/.DELTA.F-EGFP (Li, H.-O. et al. J. Virology 74, 2000, p
6564-6569) was digested with NotI and SalI, and separated by
agarose gel electrophoresis. A band of 1972 bp was excised,
purified using the Qiaquick Gel Extraction kit, and digested with
NotI and SalI. The resulting fragment was ligated with purified
pCAGGS-SeV(m) to yield pCAGGS-SeV(m)A. pSeV(+)18/.DELTA.F was
digested with NheI and KpnI and separated by agarose gel
electrophoresis. A band of 3325 bp was excised, purified using the
Qiaquick Gel Extraction kit, and digested with NotI and SalI. The
resulting fragment was ligated with pCAGGS-SeV(m) to yield
pCAGGS-SeV(m)AC.
[0180] pSeV18+b(+) (Li, H.-O. et al. J. Virology 74, 2000, p
6564-6569) was digested with SalI and NheI, and purified with the
Qiaquick PCR purification kit. The resulting fragment was inserted
into the SalI-NheI site of LITMUS38 (NEW ENGLAND BioLabs) to yield
Litmus38/SeV Sal I-Nhe I. This Litmus38/SeV Sal I-Nhe I was
digested with SalI and NheI and separated by agarose gel
electrophoresis. A band of 9886 bp was excised and purified using
the Qiaquick Gel Extraction kit. The DNA was inserted into the
SalI-NheI site of pCAGGS-SeV(m)AC to yield pCAGGS-SeV.
[0181] pSeV/AF-EGFP (Li, H.-O. et al. J. Virology 74, 2000, p
6564-6569) was digested with SalI and NheI. The resulting fragment
was purified with the Qiaquick PCR purification kit, and inserted
into the SalI-NheI site of LITMUS38 (NEW ENGLAND BioLabs) to yield
Litmus38/Sal I-Nhe I.DELTA.F-GFP. This Litmus38/Sal I-Nhe
I.DELTA.F-GFP was digested with SalI and NheI and separated by
agarose gel electrophoresis. A band of 8392 bp was then excised and
purified using the Qiaquick Gel Extraction kit. The DNA was
inserted into the SalI-NheI site of pCAGGS-SeV(m)AC to yield
pCAGGS-SeV/.DELTA.F-GFP.
Construction of pGEM-IRES-Luci
[0182] A luciferase fragment, which was obtained by digesting
pMAMneo-Luci(Clontech) with BamHI, was inserted into the BamHI site
of pTM1 (Nature, 348, 1, Nov., 1990, 91-92) to construct
pGEM-IRES-Luci.
Example 2
Establishment of T7 RNA Polymerase-expressing BHK-21 (Hereinafter
Referred to as BHK/T7)
[0183] Using a mammalian transfection kit (Stratagene) or SuperFect
(Qiagen), BHK-21 cells (ATCC CCL-10) were transfected with
pCALNdLWE-T7 that was constructed as described above. The cells
were cultured for 2 weeks in D-MEM containing 400 .mu.g/ml G418 at
37.degree. C. under 5% CO.sub.2, yielding drug-resistant clones
grown from a single cell. The resulting drug-resistant clones were
infected with recombinant adenovirus (AxCANCre) that expresses Cre
DNA recombinase at an Moi of 4. After 24 hours, the cells were
washed once with PBS and harvested. The expression of T7 RNA
polymerase was confirmed by Western blotting analysis using a
rabbit polyclonal anti-T7 RNA polymerase antibody.
[0184] Clones that were confirmed to express the T7 RNA polymerase
were transfected with pGEM-IRES-Luci using SuperFect. The cells
were harvested after 24 hours, and their luciferase activity was
measured with MiniLumat LB9506 (EG&G BERTHOLD) using the Dual
Luciferase Reporter System (Promega) kit to confirm the activity of
the T7 RNA polymerase.
Example 3
Production of a Recombinant Sendai Virus by a Conventional
Method
[0185] LLC-MK2 cells were plated at 5.times.10.sup.6 cells/dish in
100-mm Petri dishes. After 24 hours of culture, the cells were
washed once with serum-free MEM and infected at room temperature
for 1 hour (moi=2) with a T7 RNA polymerase-expressing recombinant
vaccinia virus(Fuerst, T. R. et al., Proc. Natl. Acad. Sci. USA 83,
8122-8126 (1986)) after the recombinant vaccinia virus was treated
with 5 minutes of 3 .mu.g/ml psoralen and long wavelength
ultraviolet light (365 nm). The cells were washed twice with
serum-free MEM. 12 .mu.g/dish of the cDNA of an F-deficient Sendai
virus vector carrying Lac Z (pSeV (+18:LacZ).DELTA.F), 4 .mu.g/dish
of pGEM/NP, 2 .mu.g/dish of pGEM/P, 4 .mu.g/dish of pGEM/L (Kato,
A. et al., Genes Cells 1, 569-579(1996)), and 4 .mu.g/dish of
envelope plasmid pGEM/FHN are mixed, and then suspended in Opti-MEM
(GIBCO). The SuperFect transfection reagent (1 .mu.g DNA/5 .mu.l of
SuperFect; QIAGEN) was added and allowed to stand at room
temperature for 15 minutes. The DNA-SuperFect mixture in 3 ml of
Opti-MEM containing a final concentration of 3% FBS was added to
the cells last. The cells were cultured for 3 hours. Then, the
cells were washed twice with serum-free MEM, and cultured for 24
hours in MEM containing 40 .mu.g/ml cytosine
.beta.-D-arabinofuranoside (AraC, Sigma) and 7.5 .mu.g/ml trypsin.
The culture supernatant was removed and a single 100-mm Petri dish
of the F-expressing LLC-MK2/F7 cells (cells in which the F
expression is induced are referred to as "LLC-MK2/F7/A"; Li, H.-O.
et al., J. Virology 74. 6564-6569 (2000); WO 00/70070) were
suspended in serum-free MEM (containing 40 .mu.g/ml AraC and 7.5
.mu.g/m trypsin), and 5 ml of this suspension was overlaid. After
culturing for 48 hours, the cells and the supernatant were
collected and used as P0-d3 samples. The pellet of P0-d3 was
suspended in Opti-MEM (2.times.10.sup.7 cells/ml), and frozen and
thawed three times. The sample was combined with the lipofection
reagent DOSPER (Boehringer Mannheim) (10.sup.6 cells/25 .mu.l
DOSPER), allowed to stand for 15 minutes at room temperature, and
used to transfect the F-expressing LLC-MK2/F7 cell line
(LLC-MK2/F7/A; 10.sup.6 cells/well in 24-well plate), which was
then cultured in serum-free MEM (containing 40 .mu.g/ml AraC and
7.5 .mu.g/m trypsin). After 7 days of culture, the supematant was
collected as the P1 -d7 sample. Then, cells of the F-expressing
LLC-MK2/F7 cell line (LLC-MK2/F7/A) plated in 12-well plates were
infected using the whole supernatant at 37.degree. C. for one hour.
The cells were then washed once with MEM, and cultured in
serum-free MEM (containing 40 .mu.g/ml AraC and 7.5 .mu.g/ml
trypsin). After 7 days of culture, the supernatant was collected as
the P2-d7 sample. Then, cells of F-expressing LLC-MK2/F7 cell line
(LLC-MK2/F7/A) plated in 6-well plates were infected using the
whole supernatant at 37.degree. C. for one hour. The cells were
then washed once with MEM, and cultured in serun-free MEM
(containing 7.5 .mu.g/ml trypsin). After 7 days of culture, the
supernatant was collected as the P3-d7 sample. Then, cells of the
F-expressing LLC-MK2/F7 cell line (LLC-MK2/F7/A) plated in 10-cm
plates were infected using the whole supernatant at 37.degree. C.
for one hour. The cells were then washed once with MEM, and
cultured in serum-free MEM (containing 40 .mu.g/ml AraC and 7.5
.mu.g/ml trypsin). After 7 days of culture, the supernatant was
collected as the P4-d7 sample.
Example 4
Method (1) for Recovering Sendai Virus Vectors Using a CA
Promoter
Method for Recovering a Sendai Virus Vector that Uses a Sendai
Virus Genome Having a Hammerhead Ribozyme Attached to pCAGGS
(Hereinafter Referred to as the HamRbz Method)
4-1 [Recovery of a Transmissible SeV Vector]
[0186] The day before transfection, 293T cells were plated onto
6-well plates at 1.times.10.sup.6 cells/well in 2 ml of 10%
FBS-containing D-MEM. The transfection was carried out by the
procedure described below. 30 .mu.l of Opti-MEM was combined with
15 .mu.l of TransIT-LT1 (Mirus), and incubated at room temperature
for 10 to 15 minutes. During the incubation, a DNA solution was
prepared. 0.5 .mu.g of pCAGGS-NP, 0.5 .mu.g of pCAGGS-P4C(-),2
.mu.g of pCAGGS-L(TDK), and 2 .mu.g of pCAGGS-SeV were dissolved in
20 .mu.l of Opti-MEM. After 10 to 15 minutes, the. DNA solution was
combined with the TransIT-LT1 solution and allowed to stand at room
temperature for 15 minutes. During this period, the cell culture
medium was removed, and fresh 10% FBS-containing D-MEM was gently
added at 1 ml/well. After 15 minutes, 500 .mu.l of Opti-MEM (GIBCO)
was added to the DNA-TransIT-LT1 mixture. The whole mixture was
added to cells and cultured. After culturing for four days at
37.degree. C. under 5% CO.sub.2, the medium was discarded. The
LLC-MK2/F7/A cells were suspended at 1.times.10.sup.6 cells/ml in
(serum-free) MEM containing 7.5 .mu.g/ml trypsin (hereinafter
referred to as "Try-MEM") and the suspension was overlaid at1
ml/well. The cells were cultured at 37.degree. C. under 5% CO.sub.2
for four days. Four days after overlaying the LLC-MK2/F7/A cells,
the supernatant was collected and analyzed by an HA assay. The
supernatant was found to be negative in HA. Thus, 100 .mu.l of the
collected supernatant was inoculated into each of the three hen
eggs that had been incubated for 10 days. The eggs were incubated
in an incubator at 35.degree. C. for 3 days. Then, the
chorioallantoic fluids were collected and analyzed by an HA assay.
The result showed that the HA activity was detected in the
chorioallantoic fluids collected from two of the three hen eggs.
Thus, it was demonstrated that the wild-type Sendai virus vector
could be recovered by the present method (FIG. 12).
4-2 [Recovery of an F-deficient SeV Vector]
[0187] The day before transfection, 293T cells were plated onto
6-well plates at 1.times.10.sup.6 cells/well in 2 ml of 10%
FBS-containing D-MEM. The transfection was carried out by the
procedure described below. 30 .mu.l of Opti-MEM was combined with
15 .mu.l of TransIT-LT1 (Mirus), and incubated at room temperature
for 10 to 15 minutes. A DNA solution was prepared during the
incubation. 0.3 .mu.g of pCAGGS-NP, 0.5 .mu.g of pCAGGS-P4C(-), 2
.mu.g of pCAGGS-L(TDK), 0.5 .mu.g of pCAGGS-F5R, and 0.5 to 5 .mu.g
of pCAGGS-SeV/.DELTA.F-GFP were dissolved in 20 .mu.l of Opti-MEM.
After 10 to 15 minutes, the DNA solution was combined with the
TransIT-LT1 solution and allowed to stand at room temperature for
15 minutes. During this period, the cell culture medium was
removed, and fresh 10% FBS-containing D-MEM was gently added at 1
ml/well. After 15 minutes, 500 .mu.l of Opti-MEM (GIBCO) was added
to the DNA-TransIT-LT1 mixture. The whole mixture was added to
cells following by culturing. After culturing at 37.degree. C.
under 5% CO.sub.2 for 72 hours, the medium was discarded. The
LLC-MK2/F7/A cells were suspended at 1.times.10.sup.6 cells/ml in
(serum-free) MEM containing 7.5 .mu.g/ml trypsin (hereinafter
referred to as "Try-MEM") and the suspension was overlaid at 1
ml/well. The cells were cultured at 37.degree. C. under 5%
CO.sub.2. After 24 hours, 1 ml of the culture medium was collected
and 1 ml of fresh Try-MEM was added. The cells were cultured at
37.degree. C. under 5% CO.sub.2. After 48 hours, 1 ml of the
culture medium was collected and 1 ml of fresh Try-MEM was added.
The cells were cultured at 37.degree. C. under 5% CO.sub.2. After
72 hours, 1 ml of the culture medium was collected. 133 .mu.l of
7.5% BSA (final concentration: 1% BSA) was added to the collected
culture media, and stored at -80.degree. C. prior to CIU
measurement.
4-3 [CIU Determination by Counting GFP-expressing Cells
(GFP-CIU)]
[0188] 2 to 3 days before a CIU assay, LLC-MK2 cells were plated
onto 12-well plates. When plated 2 days before the assay, the cells
were plated at a cell density of 1.5.times.10.sup.5 cells/well in
10% FBS-containg MEM (1 ml/well). When plated 3 days before the
assay, the cells were plated at a cell density of
8.0.times.10.sup.4 cells/well in 10% FBS-containing MEM (1 m/well).
On the day of CIU assay, the cells were washed once with serum-free
MEM. Ten-fold serial dilutions of the culture medium collected 24,
48, and 72 hours after overlaying the cells were prepared using
MEM. After one hour of infection at 37.degree. C., the cells were
washed once with MEM and 1 ml of MEM was added thereto. After 2
days of culture at 37.degree. C., the cells were observed under a
fluorescence microscope to count GFP-positive cells in appropriated
diluted wells. As a result, 1.times.10.sup.5 to 1.times.10.sup.7
GFP-CIU/ml of the viral vector was found to be recovered 72 hours
after overlaying the cells (FIG. 13).
4-4 [Improvement of Productivity by Supplying F Introduced with a
Furin Recognition Sequence (Hereinafter Referred to as "F5R"), as
Compared with Wild-type F (Hereinafter Referred to as "F")]
[0189] The reconstitution efficiency of supplying the F protein
using pCAGGS was compared between the wild-type F gene and furin
recognition sequence-introduced F5R. 293T cells were plated onto
6-well plates at 1.times.10.sup.6 cells/well in 2 ml of 10%
FBS-containing D-MEM the day before transfection. The transfection
was carried out by the procedure described below. 15 .mu.l of
TransIT-LT1 (Mirus) was combined with 30 .mu.l of Opti-MEM, and
incubated at room temperature for 10 to 15 minutes. A DNA solution
was prepared during the incubation. Fixed amounts of pCAGGS-NP (0.3
.mu.g), pCAGGS-P4C(-) (0.5 .mu.g), pCAGGS-L (2 .mu.g), and
pCAGGS-SeV/AF-GFP (2 .mu.g), and various amounts of pCAGGS-F or
pCAGGS-F5R (0.1, 0.3, 0.5, 0.7, and 0.9 .mu.g) were dissolved in 20
.mu.l of Opti-MEM. After 10 to 15 minutes, a DNA solution was
combined with the TransIT-LT1 solution and allowed to stand at room
temperature for 15 minutes. During this period, the cell culture
medium was removed, and fresh 10% FBS-containing D-MEM was gently
added at 1 ml/well. After 15 minutes, 500 .mu.l of Opti-MEM (GIBCO)
was added to the DNA-TransIT-LT1 mixture. The whole mixture was
added to cells and cultured. After culturing at 37.degree. C. under
5% CO.sub.2 for 72 hours, the culture medium was discarded, and the
LLC-MK2/F7/A cells were suspended at 1.times.10.sup.6 cells/ml in
(serum-free) MEM containing 7.5 .mu.g/ml trypsin (hereinafter
referred to as "Try-MEM") and the suspension was overlaid at 1
ml/well. The cells were cultured at 37.degree. C. under 5%
CO.sub.2. After 24 hours, 1 ml of the culture medium was collected,
and 1 ml of fresh Try-MEM was added. The cells were cultured at
37.degree. C. under 5% CO.sub.2. After 48 hours, 1 ml of the
culture medium was collected and 1 ml of fresh Try-MEM was added.
The cells were cultured at 37.degree. C. under 5% CO.sub.2. After
72 hours, 1 ml of the culture medium was collected. 133 .mu.l of
7.5% BSA (final concentration: 1% BSA) was added to the collected
culture medium, and stored at -80.degree. C. prior to CIU
measurement. CIU assays were carried out after all samples were
collected. As a result, when pCAGGS-F was used, the reconstitution
efficiency was found to be the highest at 0.7 .mu.g. The samples
collected 24, 48, and 72 hours following the cell overlay contained
0, 7.9.times.10.sup.2, and 3.3.times.10.sup.4 CIU/ml of viral
vectors, respectively. Meanwhile, when pCAGGS-F5R was used, the
reconstitution efficiency was found to be the highest at 0.5 .mu.g.
The samples collected 24, 48, and 72 hours following the cell
overlay contained 3.2.times.10.sup.4, 5.7.times.10.sup.5, and
1.2.times.10.sup.7 CIU/ml of viral vectors, respectively. A
comparison of the two in conditions of the highest reconstitution
efficiency, pCAGGS-F5R gave a much higher reconstitution efficiency
than pCAGGS-F, and yielded 373 times more viral vectors at 72 hours
after the cell overlay (FIG. 14).
Example 5
Method (2) for Recovering Sendai Virus Vectors Using a CA
Promoter
Method for Recovering Sendai Virus Vectors Using pCAGGS-T7
(Hereinafter Referred to as the pCAGGS-T7 Method)
5-1 [Recovery of Transmissible SeV Vectors]
[0190] The day before transfection, each cell line was plated onto
6-well plates (293T cell: 1.times.10.sup.6 cells/well/2 ml 10%
FBS-containing D-MEM; LLC-MK2 cell: 5.0.times.10.sup.5 cells/well
in 2 ml of 10% FBS-containing D-MEM; BHK-21 cell:
2.5.times.10.sup.5 cells/well in 2 ml of 10% FBS-containing D-MEM;
BHK/T7 cell: 2.5.times.10.sup.5 cells/well in 2 ml of 10%
FBS-containing D-MEM). The transfection was carried out by the
procedure described below. 30 .mu.l of Opti-MEM was combined with
15 .mu.l of TransIT-LT1 (Mirus) and incubated at room temperature
for 10 to 15 minutes. A DNA solution was prepared during the
incubation. 0.5 .mu.g of pCAGGS-T7, 0.5 .mu.g of pCAGGS-NP, 0.5
.mu.g of pCAGGS-P4C(-), 2 .mu.g of pCAGGS-L(TDK), and 5 .mu.g of
pSeV(TDK)18+GFP were dissolved in 20 .mu.l of Opti-MEM. After 10 to
15 minutes, the DNA solution was combined with the TransIT-LT1
solution and allowed to stand at room temperature for 15 minutes.
During this period, the cell culture medium was removed, and fresh
10% FBS-containing D-MEM was gently added at 1 ml/well. After 15
minutes, 500 .mu.l of Opti-MEM (GIBCO) was added to the
DNA-TransIT-LT1 mixture. After the whole mixture was added to
cells, they were cultured at 37.degree. C. under 5% CO.sub.2 for 3
days. Then, GFP-positive cells were counted, and the results were:
293T: 246 cells; LLC-MK2: 16 cells; BHK-21: 288 cells; and BHK/T7:
405 cells. Then, the culture medium was discarded, and 1 ml of
PBS(-) was added to the cells. The cells were scraped using a cell
scraper and collected in Eppendorf tubes. After freeze-thawing
once, 100 .mu.l of undiluted cell suspensions and cell suspensions
diluted 10, 100, and 1000 times with PBS(-) were inoculated into
10-day hen eggs. The eggs were incubated in an incubator at
35.degree. C. for 3 days. Then, the chorioallantoic fluids were
collected and analyzed by an HA assay. As a result, viral
propagation was detected in the hen eggs inoculated with undiluted
suspensions of 293T cells, BHK-21 cells, and BHK/T7 cells (FIG.
15).
5-2 [Recovery of F-deficient SeV Vectors]
[0191] 293T cells were plated onto 6-well plates at
1.times.10.sup.6 cells/well in 2 ml of 10% FBS-containing D-MEM the
day before transfection. The transfection was carried out by the
procedure described below. 30 .mu.l of Opti-MEM was combined with
15 .mu.l of TransIT-LT1 (Mirus), and incubated at room temperature
for 10 to 15 minutes. A DNA solution was prepared during the
incubation. 0.5 .mu.g of pCAGGS-T7, 0.5 .mu.g of pCAGGS-NP, 0.5
.mu.g of pCAGGS-P4C(-), 2 .mu.g of pCAGGS-L(TDK), 0.5 .mu.g of
pCAGGS-F5R, and 0.5 to 5 .mu.g of pSeV/AF-GFP (WO 00/70070) were
dissolved in 20 .mu.l of Opti-MEM. After 10 to 15 minutes, the DNA
solution was combined with the TransIT-LT1 solution and allowed to
stand at room temperature for 15 minutes. During this period, the
cell culture medium was removed, and fresh 10% FBS-containing D-MEM
was gently added at 1 ml/well. After 15 minutes, 500 .mu.l of
Opti-MEM (GIBCO) was added to the DNA-TransIT-LT1 mixture. The
whole mixture was added to the cells and cultured. After culturing
at 37.degree. C. under 5% CO.sub.2 for 72 hours, the culture medium
was discarded, and the LLC-MK2/F7/A cells were suspended at
1.times.10.sup.6 cells/ml in Try-MEM and the suspension was
overlaid at 1 ml/well. The cells were cultured at 37.degree. C.
under 5% CO.sub.2. After 24 hours, 1 ml of the culture medium was
collected, and 1 ml of fresh Try-MEM was added. The cells were
cultured at 37.degree. C. under 5% CO.sub.2. After 48 hours, 1 ml
of the culture medium was collected, and 1 ml of fresh Try-MEM was
added. The cells were cultured at 37.degree. C. under 5% CO.sub.2.
After 72 hours, 1 ml of the culture medium was collected. 133 .mu.l
of 7.5% BSA (final concentration: 1% BSA) was added to the
collected culture medium, and stored at -80.degree. C. prior to CIU
measurement.
5-3 [CIU Determination by Counting GFP-expressing Cells
(GFP-CIU)]
[0192] 2 to 3 days before a CIU assay, the LLC-MK2 cells were
plated onto 12-well plates. When plated 2 days before the assay,
the cells were plated at 1.5.times.10.sup.5 cells/well in 1 ml/well
of 10% FBS-containing MEM. When plated 3 days before the assay, the
cells were plated at 8.0.times.10.sup.4 cells/well in 1 ml/well of
10% FBS-containing MEM. On the day of CIU assay, the cells were
washed once with serum-free MEM. Ten-fold serial dilutions of the
culture media collected 24, 48, and 72 hours after the cell overlay
were prepared using MEM. After one hour of infection at 37.degree.
C., the cells were washed once with MEM and 1 ml of MEM was added
thereto. After 2 days of culture at 37.degree. C., the cells were
observed under a fluorescence microscope to count GFP-positive
cells in adequately diluted wells. As a result, 1.times.10.sup.6 to
1.times.10.sup.7 GFP-CIU/ml of the viral vector was found to be
recovered 72 hours after the cell overlay (FIG. 16).
[0193] In the pCAGGS-T7 method, SeV18+GFP/AF was also successfully
recovered by the calcium phosphate method when 293T cells are used
for introduction of the plasmid. The efficiency was comparable to
or higher than that of TransIT-LT1 (FIG. 17).
Example 6
Evaluation of Cell Types Used for the pCAGGS-T7 Method
[0194] To assess whether the pCAGGS-T7 method can recover Sendai
virus vectors by using cell lines other than 293T, it was tested
whether the vector could be harvested using the LLC-MK2, BHK-21,
BHK/T7, or 293T cell line. The day before transfection, each cell
line was plated onto 6-well plates (LLC-MK: 5.times.10.sup.5
cells/well; BHK-21: 2.5.times.10.sup.5 cells/well; BHK/T7:
2.5.times.10.sup.5 cells/well; 293T: 1.0.times.10.sup.6
cells/well). The transfection was carried out by the procedure
described below. 30 .mu.l of Opti-MEM was combined with 15 .mu.l of
TransIT-LT1 (Mirus), and incubated at room temperature for 10 to 15
minutes. A DNA solution was prepared during the incubation. 0.5
.mu.g of pCAGGS-T7, 0.5 .mu.g of pCAGGS-NP, 0.5 .mu.g of
pCAGGS-P4C(-), 2 .mu.g of pCAGGS-L(TDK), 0.5 .mu.g of pCAGGS-F5R,
and 2 .mu.g of pSeV/.DELTA.F-GFP were dissolved in 20 .mu.l of
Opti-MEM (however, pCAGGS-T7 was not added when BHK/T7 cells were
used). After 10 to 15 minutes, the DNA solution was combined with
the TransIT-LT1 solution and allowed to stand at room temperature
for 15 minutes. During this incubation, the cell culture medium was
removed, and fresh 10% FBS-containing D-MEM was gently added at 1
ml/well. After 15 minutes, 500 .mu.l of Opti-MEM (GIBCO) was added
to the DNA-TransIT-LT1 mixture. The whole mixture was added to
cells and cultured. After culturing at 37.degree. C. under 5%
CO.sub.2 for 72 hours, the culture medium was discarded, and the
LLC-MK2/F7/A cells were suspended at 1.times.10.sup.6 cells/ml in
Try-MEM and the suspension was overlaid at 1 ml/well. The cells
were cultured at 37.degree. C. under 5% CO.sub.2. After 24 hours, 1
ml of the culture medium was collected, and 1 ml of fresh Try-MEM
added to the cells. The cells were cultured at 37.degree. C. under
5% CO.sub.2. After 48 hours, 1 ml of the culture medium was
collected, and 1 ml of fresh Try-MEM was added to the cells. The
cells were cultured at 37.degree. C. under 5% CO.sub.2. After 72
hours, 1 ml of the culture medium was collected. 133 .mu.l of 7.5%
BSA (final concentration: 1% BSA) was added to the collected
culture medium, and stored at -80.degree. C. prior to CIU
measurement. It was found that the vector could be recovered with
all the cell types tested (n=3). The vector recovery rate was in
the order of high to low: BHK/T7 cell>BHK-21 cell>293T
cell>LLC-MK2 cell (FIG. 18). Since BHK/T7 was not transfected
with pCAGGS-T7, it was demonstrated that F-deficient
SeV/.DELTA.F-GFP could also be recovered using a CA promoter in
T7-expressing cell lines.
Example 7
Comparison of the HamRbz Method and pCAGGS-T7 Method
[0195] The day before transfection, 293T cells were plated onto
6-well plates at 1.times.10.sup.6 cells/well in 2 ml of 10%
FBS-containing D-MEM. The transfection was carried out by the
procedure described below. 30 .mu.l of Opti-MEM was combined with
15 .mu.l of TransIT-LT1 (Mirus), and incubated at room temperature
for 10 to 15 minutes. A DNA solution was prepared during the
incubation. 0.3 .mu.g of pCAGGS-NP, 0.5 .mu.g of pCAGGS-P4C(-), 2
.mu.g of pCAGGS-L(TDK), 0.5 .mu.g of pCAGGS-F5R, and 5 .mu.g of
pCAGGS-SeV/.DELTA.F-GFP were dissolved in 20 .mu.l of Opti-MEM.
After 10 to 15 minutes, the DNA solution was combined with the
TransIT-LT1 solution and allowed to stand at room temperature for
15 minutes. During this period, the cell culture medium was
removed, and fresh 10% FBS-containing D-MEM was gently added at 1
ml/well. After 15 minutes, 500 .mu.l of Opti-MEM (GIBCO) was added
to the DNA-TransIT-LT1 mixture. The whole mixture was added to
cells and cultured. After culturing at 37.degree. C. under 5%
CO.sub.2 for 72 hours, the culture medium was discarded, and the
LLC-MK2/F7/A cells were suspended at 1.times.10.sup.6 cells/ml in
(serum-free) MEM containing 7.5 .mu.g/ml trypsin (hereinafter
referred to as "Try-MEM") and the suspension was overlaid at 1
ml/well. The cells were cultured at 37.degree. C. under 5%
CO.sub.2. After 24 hours, 1 ml of the culture medium was collected,
and 1 ml of fresh Try-MEM was added. The cells were cultured at
37.degree. C. under 5% CO.sub.2. After 48 hours, 1 ml of the
culture medium was collected, and 1 ml of fresh Try-MEM was added.
The cells were cultured at 37.degree. C. under 5% CO.sub.2. After
72 hours, 1 ml of the culture medium was collected. 133 .mu.l of
7.5% BSA (final concentration: 1% BSA) was added to the collected
culture medium and stored at -80.degree. C. prior to CIU
measurement.
[0196] For pCAGGS-T7 method, 293T cells were plated onto 6-well
plates at 1.times.10.sup.6 cells/well in 2 ml of 10% FBS-containing
D-MEM the day before transfection. The transfection was carried out
by the procedure described below. 30 .mu.l of Opti-MEM was combined
with 15 .mu.l of TransIT-LT1 (Mirus), and incubated at room
temperature for 10 to 15 minutes. A DNA solution was prepared
during the incubation. 0.5 .mu.g of pCAGGS-T7, 0.5 .mu.g of
pCAGGS-NP, 0.5 .mu.g of pCAGGS-P4C(-), 2 .mu.g of pCAGGS-L(TDK),
0.5 .mu.g of pCAGGS-FSR, and 5 .mu.g of pSeV/.DELTA.F-GFP were
dissolved in 20 .mu.l of Opti-MEM. After 10 to 15 minutes, the DNA
solution was combined with the TransIT-LT1 solution and allowed to
stand at room temperature for 15 minutes. During this period, the
cell culture medium was removed, and 1 ml/well of fresh 10%
FBS-containing D-MEM was gently added. After 15 minutes, 500 .mu.l
of Opti-MEM (GIBCO) was added to the DNA-TransIT-LT1 mixture. The
whole mixture was added to cells and cultured. After culturing at
37.degree. C. under 5% CO.sub.2 for 72 hours, the culture medium
was discarded, and the LLC-MK2/F7/A cells were suspended at
1.times.10.sup.6 cells/ml in Try-MEM and the suspension was
overlaid at 1 ml/well. The cells were cultured at 37.degree. C.
under 5% CO.sub.2. After 24 hours, 1 ml of the culture medium was
collected, and 1 ml of fresh Try-MEM was added. The cells were
cultured at 37.degree. C. under 5% CO.sub.2. After 48 hours, 1 ml
of the culture medium was collected, and 1 ml of fresh Try-MEM was
added. The cells were cultured at 37.degree. C. under 5% CO.sub.2.
After 72 hours, 1 ml of the culture medium was collected. 133 .mu.l
of 7.5% BSA (final concentration: 1% BSA) was added to the
collected culture medium, and stored at -80.degree. C. prior to CIU
measurement. The results of CIU measurement showed that the
reconstitution efficiency was higher with the pCAGGS-T7 method than
with the HamRbz method (FIG. 19).
Example 8
Construction of an M Gene-deficient Vector and a Vector Deficient
in M and F Genes
[0197] An M gene-deficient Sendai virus vector (SeV/.DELTA.M), and
a Sendai virus vector deficient in M and F genes
(SeV/.DELTA.M.DELTA.F-GFP) were reconstituted using the pCAGGS-T7
method.
Reconstitution of an SeV/.DELTA.M Vector
[0198] 293T cells were plated onto 6-well plates at
1.times.10.sup.6 cells/well in 2 ml of 10% FBS-containing D-MEM the
day before transfection. The transfection was carried out by the
procedure described below. 30 .mu.l of Opti-MEM was combined with
15 .mu.l of TransIT-LT1 (Mirus), and incubated at room temperature
for 10 to 15 minutes. A DNA solution was prepared during the
incubation. 0.5 .mu.g of pCAGGS-NP, 0.5 .mu.g of pCAGGS-P4C(-), 2
.mu.g of pCAGGS-L(TDK), 1.0 .mu.g of pCAGGS-M, 0.5 .mu.g of
pCAGGS-T7, and 5 .mu.g of pSeV/.DELTA.M-GFP were dissolved in 20
.mu.l of Opti-MEM. After 10 to 15 minutes, the DNA solution was
combined with the TransIT-LT1 solution, and allowed to stand at
room temperature for 15 minutes. During this period, the cell
culture medium was removed, and 1 ml of fresh 10% FBS-containing
D-MEM was gently added. After 15 minutes, 500 .mu.l of Opti-MEM
(GIBCO) was added to the DNA-TransIT-LT1 mixture. The whole mixture
was added to the cells and cultured. After culturing at 37.degree.
C. under 5% CO.sub.2 for 72 hours, the culture medium was
discarded, and LLC-MK2 cells expressing both the Sendai virus M and
F genes (hereinafter referred to as LLC-M/F) were suspended at
1.times.10.sup.6 cells/ml in (serum-free) MEM containing 7.5
.mu.g/ml trypsin (herein after referred to as "Try-MEM") and the
suspension was overlaid at 1 ml/well. The cells were incubated at
37.degree. C. under 5% CO.sub.2. After the cell overlay, the
culture medium was exchanged with fresh Try-MEM every day for three
days. Thereafter, the medium was changed every 2 to 3 days. On day
9 after the transfection, the culture medium was added to freshly
prepared LLC-MK2-M/F cells. The cells were cultured at 32.degree.
C. under 5% CO.sub.2 for 9 days (the medium was changed every 2 to
3 days). The supernatant was added to freshly prepared
LLC-MK2-M/Fcells, and cultured for four days in the same way. This
culture supernatant was found to contain 5.4.times.10.sup.8 CIU/ml
of SeV/.DELTA.M-GFP vector. The expansion of vector-infected cells
in cells cultured for 4 days after the transfection (P0d4), cells
cultured for 7 days after the first passage (P1d7), or cells
cultured for four days after the second passage (P2d4) was observed
using GFP fluorescence. The results are shown in FIG. 20.
Reconstitution of SeV/.DELTA.M.DELTA.F-GFP
[0199] 293T cells were plated onto 6-well plates at
1.times.10.sup.6 cells/well in 2 ml of 10% FBS-containing D-MEM the
day before transfection. The transfection was carried out by the
procedure described below. 15 .mu.l of TransIT-LT1 (Mirus) was
combined with 30 .mu.l of Opti-MEM, and incubated at room
temperature for 10 to 15 hours. A DNA solution was prepared during
the incubation. 0.5 .mu.g of pCAGGS-NP, 0.5 .mu.g of pCAGGS-P4C(-),
2 .mu.g of pCAGGS-L(TDK), 0.5 .mu.g of pCAGGS-F5R, 1.0 .mu.g of
pCAGGS-M, 0.5 .mu.g of pCAGGS-T7, and 5 .mu.g of
pSeV/.DELTA.M.DELTA.F-GFP were dissolved in 20 .mu.l of Opti-MEM.
After 10 to 15 minutes, the DNA solution was combined with the
TransIT-LT1 solution and allowed to stand at room temperature for
15 minutes. During this period, the cell culture medium was
removed, and 1 ml of fresh 10% FBS-containing D-MEM was gently
added. After 15 minutes, 500 .mu.l of Opti-MEM (GIBCO) was added to
the DNA-TransIT-LT1 mixture. The whole mixture was added to the
cells followed by culturing. After culturing at 37.degree. C. under
5% CO.sub.2 for 72 hours, the culture medium was discarded, and
LLC-M/F was suspended at 1.times.10.sup.6 cells/ml in (serum-free)
MEM containing 7.5 .mu.g/ml trypsin (hereinafter referred to as
"Try-MEM") and the suspension was overlaid at 1 ml/well. The cells
were cultured at 37.degree. C. under 5% CO.sub.2. After the cell
overlay, the culture medium was exchanged with fresh Try-MEM every
day for 3 days. Thereafter, the medium was changed every 2 to 3
days. On day 9 after transfection, the culture medium was added to
freshly prepared LLC-M/F cells. The cells were cultured at
32.degree. C. under 5% CO.sub.2 for 9 days (medium was changed
every 2 to 3 days). The supernatant was added to freshly prepared
LLC-M/F cells and cultured for four days in the same way.
Furthermore, the supernatant was added to freshly prepared LLC-M/F
cells and cultured for 3 days in the same way. This culture
supernatant was found to contain 4.6.times.10.sup.7 CIU/ml of
SeV/.DELTA.M.DELTA.F-GFP vector. The expansion of vector-infected
cells in cells cultured for four days after transfection (P0d4),
cells cultured for 9 days after the first passage (P1d9), cells
cultured for four days after the second passage (P2d4), or cells
cultured for 3 days after the third passage (P3d3) was observed
using GFP fluorescence. The results are shown in FIG. 21.
Example 9
Comparison of the Reconstitution Efficiency of CA and CMV
Promoters
[0200] To compare the CMV and CA promoters, NP, P, L, F5R, and T7
RNA polymerase under the control of a CMV promoter were loaded into
pCl-neo (Promega) (pCl-neo-NP, pCl-neo-P4C(-), pCl-neo-L(TDK),
pCl-neo-F5R, and pCl-neo-T7, respectively). The day before
transfection, 293T cells were plated onto 6-well plates at
1.times.10.sup.6 cells/well in 2 ml of 10% FBS-containing D-MEM.
The transfection was carried out by the procedure described below.
15 .mu.l of TransIT-LT1 (Mirus) was combined with 30 .mu.l of
Opti-MEM and incubated at room temperature for 10 to 15 minutes. A
DNA solution was prepared during the incubation. When a CA promoter
(pCAGGS plasmid) was used, 0.5 .mu.g of pCAGGS-NP, 0.5 .mu.g of
pCAGGS-P4C(-), 2 .mu.g of pCAGGS-L(TDK), 0.5 .mu.g of pCAGGS-F5R,
0.5 .mu.g of pCAGGS-T7, and 5 .mu.g of pSeV/.DELTA.F-GFP were
dissolved in 20 .mu.l of Opti-MEM. When a CMV promoter (pCl-neo)
was used, 0.5 .mu.g of pCl-neo-NP, 0.5 .mu.g of pCl-neo-P4C(-), 5
.mu.g of pCl-neo-L(TDK), 0.5 .mu.g of pCl-neo-F5R, 1 .mu.g of
pCl-neo-T7, and 5 .mu.g of pSeV/.DELTA.F-GFP were dissolved in 20
.mu.l of Opti-MEM. After 10 to 15 minutes, the DNA solution was
combined with the TransIT-LT1 solution and allowed to stand at room
temperature for 15 minutes. During this period, the cell culture
medium was removed, and 1 ml of fresh 10% FBS-containing D-MEM was
gently added. After 15 minutes, 500 .mu.l of Opti-MEM (GIBCO) was
added to the DNA-TransIT-LT1 mixture. The whole mixture was added
to the cells and cultured. After culturing at 37.degree. C. under
5% CO.sub.2 for 72 hours, the culture medium was discarded, and the
LLC-MK2/F7/A cells were suspended at 1.times.10.sup.6 cells/ml in
(serum-free) MEM containing 7.5 .mu.g/ml trypsin (hereinafter
referred to as "Try-MEM") and the suspension was overlaid at 1
ml/well. The cells were cultured at 37.degree. C. under 5%
CO.sub.2. After 24 hours, 1 ml of the culture medium was collected,
and 1 ml of fresh Try-MEM was added. The cells were cultured at
37.degree. C. under 5% CO.sub.2. After 48 hours, 1 ml of the
culture medium was collected, and 1 ml of fresh Try-MEM was added.
The cells were cultured at 37.degree. C. under 5% CO.sub.2. After
72 hours, 1 ml of the culture medium was collected. 133 .mu.l of
7.5% BSA (fmal concentration: 1% BSA) was added to the collected
culture medium, and stored at -80.degree. C. prior to CIU
measurement.
[0201] When the CA promoter was used, the spread of GFP was
detected 72 hours after the transfection, and efficient propagation
was also seen after the LLC-MK2/F7/A cells were overlaid.
Meanwhile, when the CMV promoter was used, GFP fluorescence was not
detected 72 hours after the transfection, but a small spread of GFP
was at last observed 48 hours after overlaying the LLC-MK2/F7/A
cells. The CA promoter was 1000 times or more efficient for vector
reconstitution. Thus, the CA promoter is much more suitable for
recovering vectors than the CMV promoter.
[0202] The recovery efficiency was examined using a combination of
the genes that are under the control of the CMV promoter and those
that are under the control of the CA promoter. The recovery
efficiency was much higher when all helper plasmids were driven by
the CA promoter than by the combination of CMV and CA.
INDUSTRIAL APPLICABILITY
[0203] The method of the present invention can highly efficiently
produce minus-strand RNA viral vectors without using a vaccinia
virus and provides high safety production processes and products.
In particular, according to the present invention, minus-strand RNA
viral vectors deficient in envelope-constituting protein genes,
such as the F, HN, and/or M genes, can be produced without
depending on vaccinia virus. The method of the present invention is
particularly useful for producing vectors that require high safety,
such as vectors for gene therapy.
Sequence CWU 1
1
41 1 367 DNA Cytomegalovirus 1 actagttatt aatagtaatc aattacgggg
tcattagttc atagcccata tatggagttc 60 cgcgttacat aacttacggt
aaatggcccg cctggctgac cgcccaacga cccccgccca 120 ttgacgtcaa
taatgacgta tgttcccata gtaacgccaa tagggacttt ccattgacgt 180
caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt gtatcatatg
240 ccaagtacgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca
ttatgcccag 300 tacatgacct tatgggactt tcctacttgg cagtacatct
acgtattagt catcgctatt 360 accatgg 367 2 1248 DNA Gallus gallus 2
tcgaggtgag ccccacgttc tgcttcactc tccccatctc ccccccctcc ccacccccaa
60 ttttgtattt atttattttt taattatttt gtgcagcgat gggggcgggg
gggggggggg 120 ggcgcgcgcc aggcggggcg gggcggggcg aggggcgggg
cggggcgagg cggagaggtg 180 cggcggcagc caatcagagc ggcgcgctcc
gaaagtttcc ttttatggcg aggcggcggc 240 ggcggcggcc ctataaaaag
cgaagcgcgc ggcgggcggg gagtcgctgc gacgctgcct 300 tcgccccgtg
ccccgctccg ccgccgcctc gcgccgcccg ccccggctct gactgaccgc 360
gttactccca caggtgagcg ggcgggacgg cccttctcct ccgggctgta attagcgctt
420 ggtttaatga cggcttgttt cttttctgtg gctgcgtgaa agccttgagg
ggctccggga 480 gggccctttg tgcgggggga gcggctcggg gggtgcgtgc
gtgtgtgtgt gcgtggggag 540 cgccgcgtgc ggctccgcgc tgcccggcgg
ctgtgagcgc tgcgggcgcg gcgcggggct 600 ttgtgcgctc cgcagtgtgc
gcgaggggag cgcggccggg ggcggtgccc cgcggtgcgg 660 ggggggctgc
gaggggaaca aaggctgcgt gcggggtgtg tgcgtggggg ggtgagcagg 720
gggtgtgggc gcgtcggtcg ggctgcaacc ccccctgcac ccccctcccc gagttgctga
780 gcacggcccg gcttcgggtg cggggctccg tacggggcgt ggcgcggggc
tcgccgtgcc 840 gggcgggggg tggcggcagg tgggggtgcc gggcggggcg
gggccgcctc gggccgggga 900 gggctcgggg gaggggcgcg gcggcccccg
gagcgccggc ggctgtcgag gcgcggcgag 960 ccgcagccat tgccttttat
ggtaatcgtg cgagagggcg cagggacttc ctttgtccca 1020 aatctgtgcg
gagccgaaat ctgggaggcg ccgccgcacc ccctctagcg ggcgcggggc 1080
gaagcggtgc ggcgccggca ggaaggaaat gggcggggag ggccttcgtg cgtcgccgcg
1140 ccgccgtccc cttctccctc tccagcctcg gggctgtccg cggggggacg
gctgccttcg 1200 ggggggacgg ggcagggcgg ggttcggctt ctggcgtgtg
accggcgg 1248 3 95 DNA Oryctolagus cuniculus 3 cctctgctaa
ccatgttcat gccttcttct ttttcctaca gctcctgggc aacgtgctgg 60
ttattgtgct gtctcatcat tttggcaaag aattc 95 4 1744 DNA Artificial an
example of CA promoter 4 actagttatt aatagtaatc aattacgggg
tcattagttc atagcccata tatggagttc 60 cgcgttacat aacttacggt
aaatggcccg cctggctgac cgcccaacga cccccgccca 120 ttgacgtcaa
taatgacgta tgttcccata gtaacgccaa tagggacttt ccattgacgt 180
caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt gtatcatatg
240 ccaagtacgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca
ttatgcccag 300 tacatgacct tatgggactt tcctacttgg cagtacatct
acgtattagt catcgctatt 360 accatggtcg aggtgagccc cacgttctgc
ttcactctcc ccatctcccc cccctcccca 420 cccccaattt tgtatttatt
tattttttaa ttattttgtg cagcgatggg ggcggggggg 480 gggggggggc
gcgcgccagg cggggcgggg cggggcgagg ggcggggcgg ggcgaggcgg 540
agaggtgcgg cggcagccaa tcagagcggc gcgctccgaa agtttccttt tatggcgagg
600 cggcggcggc ggcggcccta taaaaagcga agcgcgcggc gggcggggag
tcgctgcgac 660 gctgccttcg ccccgtgccc cgctccgccg ccgcctcgcg
ccgcccgccc cggctctgac 720 tgaccgcgtt actcccacag gtgagcgggc
gggacggccc ttctcctccg ggctgtaatt 780 agcgcttggt ttaatgacgg
cttgtttctt ttctgtggct gcgtgaaagc cttgaggggc 840 tccgggaggg
ccctttgtgc ggggggagcg gctcgggggg tgcgtgcgtg tgtgtgtgcg 900
tggggagcgc cgcgtgcggc tccgcgctgc ccggcggctg tgagcgctgc gggcgcggcg
960 cggggctttg tgcgctccgc agtgtgcgcg aggggagcgc ggccgggggc
ggtgccccgc 1020 ggtgcggggg gggctgcgag gggaacaaag gctgcgtgcg
gggtgtgtgc gtgggggggt 1080 gagcaggggg tgtgggcgcg tcggtcgggc
tgcaaccccc cctgcacccc cctccccgag 1140 ttgctgagca cggcccggct
tcgggtgcgg ggctccgtac ggggcgtggc gcggggctcg 1200 ccgtgccggg
cggggggtgg cggcaggtgg gggtgccggg cggggcgggg ccgcctcggg 1260
ccggggaggg ctcgggggag gggcgcggcg gcccccggag cgccggcggc tgtcgaggcg
1320 cggcgagccg cagccattgc cttttatggt aatcgtgcga gagggcgcag
ggacttcctt 1380 tgtcccaaat ctgtgcggag ccgaaatctg ggaggcgccg
ccgcaccccc tctagcgggc 1440 gcggggcgaa gcggtgcggc gccggcagga
aggaaatggg cggggagggc cttcgtgcgt 1500 cgccgcgccg ccgtcccctt
ctccctctcc agcctcgggg ctgtccgcgg ggggacggct 1560 gccttcgggg
gggacggggc agggcggggt tcggcttctg gcgtgtgacc ggcggctcta 1620
gagcctctgc taaccatgtt catgccttct tctttttcct acagctcctg ggcaacgtgc
1680 tggttattgt gctgtctcat cattttggca aagaattcgg cttgatcgaa
gcttgcccac 1740 catg 1744 5 24 RNA Artificial an example of a
hammerhead ribozyme misc_feature (5)..(5) g or a or u or c
misc_feature (8)..(19) g or a or u or c misc_feature (24)..(24) g
or a or u or c 5 cugangannn nnnnnnnnng aaan 24 6 23 DNA
Bacteriophage T7 6 taatacgact cactataggg aga 23 7 23 DNA
Bacteriophage T3 7 aattaaccct cactaaaggg aga 23 8 23 DNA
Bacteriophage SP6 misc_feature (22)..(22) a or g or c or t 8
atttaggtga cactatagaa gng 23 9 34 DNA Bacteriophage P1 9 ataacttcgt
ataatgtatg ctatacgaag ttat 34 10 34 DNA Saccharomyces cerevisiae 10
gaagttccta ttctctagaa agtataggaa cttc 34 11 10 RNA Artificial an
example of Sendai virus S sequence (w= a or c; v=a or c or g) 11
ucccwvuuwc 10 12 10 RNA Artificial an example of Sendai virus S
sequence 12 ucccaguuuc 10 13 10 RNA Artificial an example of Sendai
virus S sequence 13 ucccacuuac 10 14 10 RNA Artificial an example
of Sendai virus S sequence 14 ucccacuuuc 10 15 10 DNA Artificial an
example of Sendai virus S sequence 15 agggtcaaag 10 16 10 DNA
Artificial an example of Sendai virus S sequence 16 agggtgaatg 10
17 10 DNA Artificial an example of Sendai virus S sequence 17
agggtgaaag 10 18 9 RNA Artificial an example of Sendai virus E
sequence 18 auucuuuuu 9 19 9 DNA Artificial an example of Sendai
virus E sequence 19 taagaaaaa 9 20 10 DNA Artificial an example of
Sendai virus S sequence 20 ctttcaccct 10 21 15 DNA Artificial an
example of Sendai virus E sequence 21 tttttcttac tacgg 15 22 54 DNA
Artificial an artificially synthesized sequence 22 tctcgagtcg
ctcggtacga tggccaagtt gaccagtgcc gttccggtgc tcac 54 23 85 DNA
Artificial an artificially synthesized sequence 23 aatgcatgat
cagtaaatta caatgaacat cgaaccccag agtcccgctc agtcctgctc 60
ctcggccacg aagtgcacgc agttg 85 24 40 DNA Artificial an artificially
synthesized sequence 24 ccggaattca acaaatggcc gggttgttga gcaccttcga
40 25 42 DNA Artificial an artificially synthesized sequence 25
ccggaattcc tagattcctc ctatcccagc tactgctgct cg 42 26 50 DNA
Artificial an artificially synthesized sequence 26 ctagctagcc
caccatggat caagatgcct tcattctaaa agaagattct 50 27 50 DNA Artificial
an artificially synthesized sequence 27 ctagctagcc tagttggtca
gtgactctat gtcctcttct acgagttcca 50 28 29 DNA Artificial an
artificially synthesized sequence 28 cattttggca aagaattgat
taattcgag 29 29 47 DNA Artificial an artificially synthesized
sequence 29 tcacagcacc caagaatctc ttctggcgag caccggcatt ttgtgtc 47
30 47 DNA Artificial an artificially synthesized sequence 30
gacacaaaat gccggtgctc gccagaagag attcttgggt gctgtga 47 31 42 DNA
Artificial an artificially synthesized sequence 31 gatcgtaatc
acagtctctc gagagttgta ccatctacct ac 42 32 52 DNA Artificial an
artificially synthesized sequence 32 tcacagcacc gaagaatctc
ctccggcgac gaccggcatt ttgtgtcgta tc 52 33 52 DNA Artificial an
artificially synthesized sequence 33 gatacgacac aaaatgccgg
tcgtcgccgg aggagattct tcggtgctgt ga 52 34 23 DNA Artificial an
artificially synthesized sequence 34 aaatcctgga gtgtctttag agc 23
35 39 DNA Artificial an artificially synthesized sequence 35
ggccgcgtcg acatcgatgc tagcctcgag ccgcggtac 39 36 31 DNA Artificial
an artificially synthesized sequence 36 cgcggctcga ggctagcatc
gatgtcgacg c 31 37 22 DNA Artificial an artificially synthesized
sequence 37 cttaactatg cggcatcaga gc 22 38 22 DNA Artificial an
artificially synthesized sequence 38 gccgattcat taatgcagct gg 22 39
37 DNA Artificial an artificially synthesized sequence 39
ctataggaaa ggaattccta tagtcaccaa acaagag 37 40 38 DNA Artificial an
artificially synthesized sequence 40 gatgagtccg tgaggacgaa
actataggaa aggaattc 38 41 40 DNA Artificial an artificially
synthesized sequence 41 gcgggccctc tcttgtttgg tctgatgagt ccgtgaggac
40
* * * * *