U.S. patent application number 11/682103 was filed with the patent office on 2007-07-12 for method for producing purine nucleoside by fermentation.
This patent application is currently assigned to AJINOMOTO CO., INC. Invention is credited to Hisashi Kawasaki, Osamu Kurahashi, Hiroshi MATSUI, Megumi Shimaoka, Yasuhiro Takenaka.
Application Number | 20070161090 11/682103 |
Document ID | / |
Family ID | 16327302 |
Filed Date | 2007-07-12 |
United States Patent
Application |
20070161090 |
Kind Code |
A1 |
MATSUI; Hiroshi ; et
al. |
July 12, 2007 |
METHOD FOR PRODUCING PURINE NUCLEOSIDE BY FERMENTATION
Abstract
A microorganism which has a gene encoding an enzyme in which
feedback inhibition is desensitized by substitution of one or two
amino acids in PRPP amidotransferase encoded by purF of Escherichia
coli, a gene encoding a protein which is an inactivated repressor
of purine nucleotide biosynthesis encoded by purR, a gene encoding
an enzyme which is inactivated purine nucleoside phosphorylase
encoded by deoD, a gene encoding an enzyme which is inactivated
succinyl-AMP synthase encoded by purA, a gene encoding an enzyme
which is inactivated 6-phosphogluconate dehydrase encoded by edd, a
gene encoding an enzyme which is inactivated phosphoglucose
isomerase encoded by pgi and like is bred and a purine nucleoside
is produced by culturing the microorganism.
Inventors: |
MATSUI; Hiroshi;
(Kawasaki-shi, JP) ; Kawasaki; Hisashi;
(Kawasaki-shi, JP) ; Shimaoka; Megumi;
(Kawasaki-shi, JP) ; Takenaka; Yasuhiro;
(Kawasaki-shi, JP) ; Kurahashi; Osamu;
(Kawasaki-shi, JP) |
Correspondence
Address: |
OBLON, SPIVAK, MCCLELLAND, MAIER & NEUSTADT, P.C.
1940 DUKE STREET
ALEXANDRIA
VA
22314
US
|
Assignee: |
AJINOMOTO CO., INC
Tokyo
JP
|
Family ID: |
16327302 |
Appl. No.: |
11/682103 |
Filed: |
March 5, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09462472 |
Jan 14, 2000 |
|
|
|
PCT/JP98/03239 |
Jul 17, 1998 |
|
|
|
11682103 |
Mar 5, 2007 |
|
|
|
Current U.S.
Class: |
435/85 ;
435/252.33 |
Current CPC
Class: |
C12P 19/40 20130101;
C12N 9/1077 20130101; C12R 1/19 20130101; C12P 19/38 20130101 |
Class at
Publication: |
435/085 ;
435/252.33 |
International
Class: |
C12P 19/28 20060101
C12P019/28; C12N 1/21 20060101 C12N001/21 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 18, 1997 |
JP |
9-194603 |
Claims
1-13. (canceled)
14. A method for producing a purine nucleoside by fermentation
comprising: culturing a microorganism belonging to the genus
Escherichia in a culture medium to produce and accumulate the
purine nucleoside in the medium, and collecting the purine
nucleoside, wherein said microorganism has purine
nucleoside-producing ability and is modified to block a reaction
catalyzed by purine nucleoside phosphorylase.
15. The method according to claim 14, wherein said microorganism is
further modified to increase an activity of an enzyme involved in
purine nucleoside biosynthesis in cells of the microorganism.
16. The method according to claim 14, wherein said microorganism is
further modified to increase an expression amount of a gene for an
enzyme involved in purine nucleoside biosynthesis.
17. The method according to claim 14, wherein said microorganism is
further modified to deregulate control of an enzyme involved in the
purine nucleoside biosynthesis.
18. The method according to claim 14, wherein said microorganism is
further modified to desensitize feedback inhibition of an enzyme
involved in the purine nucleoside biosynthesis.
19. The method according to claim 18, wherein the enzyme involved
in the purine nucleoside biosynthesis is phosphoribosyl
pyrophosphate amidotransferase.
20. The method according to claim 16, wherein the enzyme involved
in the purine nucleoside biosynthesis is phosphoribosyl
pyrophosphate amidotransferase or phosphoribosyl pyrophosphate
synthetase.
21. The method according to claim 14, wherein said microorganism is
further modified to inactivate a purine repressor.
22. The method according to claim 14, wherein said microorganism is
further modified to block a reaction catalyzed by an enzyme
selected from the group consisting of succinyl-adenosine
monophosphate synthase, adenosine deaminase, inosine-guanosine
kinase, guanosine monophosphate reductase, 6-phosphogluconoate
deydrase, phosphoglucose isomerase, adenine deaminase, and
xanthosine phosphorylase.
23. The method according to claim 14, wherein said microorganism is
further modified to weaken incorporation of a purine nucleoside
into cells of the microorganism.
24. The method according to claim 23, wherein the incorporation of
the purine nucleoside into cells of the microorganism is weakened
by blockage of a reaction involved in the incorporation of the
purine nucleoside into cells of the microorganism, and the reaction
involved in the incorporation of the purine nucleoside into cells
of the microorganism is a reaction catalyzed by nucleoside
permease.
25. The method according to claim 14, wherein said purine
nucleoside is a purine nucleoside selected from the group
consisting of inosine and guanosine.
Description
TECHNICAL FIELD
[0001] The present invention relates to a method for producing
purine nucleosides such as inosine and guanosine which are
important as raw materials for syntheses of 5'-inosinic acid and
5-guanylic acid, respectively, and a novel microorganism used for
the production.
BACKGROUND ART
[0002] For the production of inosine and guanosine by fermentation,
there have been known methods utilizing adenine auxotrophic strains
or such strains further imparted with drug resistance against
various drugs such as purine analogues, which strains belong to the
genus Bacillus (Japanese Patent Publication Nos. 38-23039 (1963),
54-17033 (1979), 55-2956 (1980), and 55-45199 (1980), Japanese
Patent Application Laid-Open No. 56-162998 (1981), Japanese Patent
Publication Nos. 57-14160 (1982) and 57-41915 (1982), and Japanese
Patent Application Laid-Open No. 59-42895 (1984)), or the genus
Brevibacterium (Japanese Patent Publication Nos. 51-5075 (1976) and
58-17592 (1972), and Agric. Biol. Chem., 42, 399 (1978)) and the
like.
[0003] Conventional acquisition of such mutant strains comprises
subjecting microorganisms to a mutagenesis treatment such as UV
irradiation and nitrosoguanidine
(N-methyl-N'-nitro-N-nitrosoguanidine) treatment and selecting a
desired strain by using a suitable selection medium On the other
hand, breeding of such mutant strains by the use of genetic
engineering techniques have also been practiced for strains
belonging to the genus Bacillus (Japanese Patent Application
Laid-Open Nos. 58-158197(1983), 58-175493 (1983), 59-28470 (1984),
60-156388 (1985), 1-27477 (1989), 1-174385 (1989), 3-58787 (1991),
3-164185 (1991), 5-84067 (1993), and 5-192164 (1993)) and the genus
Brevibacterium (Japanese Patent Application Laid-Open No. 63-248394
(1988)).
DISCLOSURE OF INVENTION
[0004] The object of the present invention is to create a
microorganism suitable for the production of the purine nucleoside
by fermentation.
[0005] To achieve the aforementioned object, the present inventors
conceived an idea of imparting purine nucleoside-producing ability
to a bacterial strain of the genus Escherichia, which is different
in the genus from microorganisms which have hitherto been used for
the production of the purine nucleoside by fermentation, and
successfully realized it. Thus, the present invention has been
completed.
[0006] Thus, the present invention provides a microorganism
belonging to the genus Escherichia and having purine
nucleoside-producing ability.
[0007] Specifically, the present invention provides the
microorganism which has acquired the purine nucleoside-producing
ability because of an increase of an activity of an enzyme involved
in the purine nucleoside biosynthesis in cells of the
microorganism. More specifically, the present invention provides
the microorganism which has acquired the purine
nucleoside-producing ability because of an increase of an
expression amount of a gene for an enzyme involved in the purine
nucleoside biosynthesis, and the microorganism which has acquired
the purine nucleoside-producing ability because of deregulation of
control of an enzyme involved in the purine nucleoside
biosynthesis.
[0008] The enzyme involved in the purine nucleoside biosynthesis
may be, for example, phosphoribosyl pyrophosphate (PRPP)
amidotransferase and phosphoribosyl pyrophospahte (PRPP)
synthetase.
[0009] As a means of desensitizing the control of an enzyme
involved in purine nucleoside biosynthesis, for example, deficiency
of a purine repressor can be mentioned.
[0010] The present invention further provides the microorganism
which has acquired the purine nucleoside-producing ability because
of blockage of a reaction branching from the purine nucleoside
biosynthesis and leading to another metabolite.
[0011] Examples of the reaction branching from the purine
nucleoside biosynthesis and leading to another metabolite include,
for example, those catalyzed by an enzyme selected from
succinyl-adenosine monophosphate (AMP) synthase, purine nucleoside
phosphorylase, adenosine deaminase, inosine-guanosine kinase,
guanosine monophosphate (GMP) reductase, 5-phosphogluconate
dehydrase, phosphoglucose isomerase, adenine deaminase, and
xanthosine phosphorylase. The present invention further provides
the microorganism which is enhanced in the purine
nucleoside-producing ability because of weakening of incorporation
of a purine nucleoside into cells of the microorganism.
[0012] The incorporation of the purine nucleoside into cells of the
microorganism may be weakened by blockage of a reaction involved in
the incorporation of the purine nucleoside into cells of the
microorganism. An example of the reaction involved in the
incorporation of the purine nucleoside into cells of the
microorganism is a reaction catalyzed by nucleoside permease.
[0013] The present invention further provides a method for
producing a purine nucleoside by fermentation comprising culturing
the aforementioned microorganism in a culture medium to produce and
accumulate the purine nucleoside in the medium, and collecting the
purine nucleoside.
[0014] The present invention described in details below.
(1) Microorganism Belonging to the Genus Escherichia and Having
Purine Nucleoside-Producing Ability
[0015] As examples of the microorganism belonging to the genus
Escherichia used in the present invention, Escherichia coli (E.
coli) and the like can be mentioned. When E. coli strains are bred
by genetic engineering techniques, E. coli K12 strain may be
utilized.
[0016] The term "purine nucleoside" herein used include, for
example, inosine, guanosine, and adenosine. The term "purine
nucleoside-producing ability" herein used means ability to produce
and accumulate a purine nucleoside in a medium. The term "having
purine nucleoside-producing ability" means that the microorganism
belonging to the genus Escherichia produces and accumulates a
purine nucleoside in a medium in a larger amount than a wild strain
of E. coli such as W3110 strain, preferably means that the
microorganism produces and accumulates inosine in a medium in an
amount of not less than 50 mg/L, more preferably not less than 100
mg/L, still more preferably not less than 200 mg/L, most preferably
not less than 500 mg/L under the condition described in Example 1
below.
[0017] In order to breed a microorganism belonging to the genus
Escherichia and having purine nucleoside-producing ability, it may
be adopted breeding by increasing an activity of an enzyme involved
in the purine nucleoside biosynthesis in cells of the
microorganism, for example, breeding by increasing an expression
amount of a gene for the enzyme involved in the purine nucleoside
biosynthesis. Alternatively, breeding by desensitizing control of
an enzyme involved in the purine nucleoside biosynthesis may be
adopted.
[0018] Furthermore, breeding by blocking a reaction branching from
purine nucleoside biosynthesis and leading to another metabolite
and breeding by weakening of incorporation of a purine nucleoside
into cells of the microorganism.
(2) Microorganism in which an Activity of an Enzyme Involved in
Purine Nucleoside Biosynthesis in Cells of the Microorganism is
Increased
[0019] All the enzymes involved in the purine nucleoside
biosynthesis and all the reactions catalyzed by those enzymes in
microorganisms belonging to the genus Escherichia have already been
elucidated (Escherichia coli and Salmonella, CELLULAR AND MOLECULAR
BIOLOGY, Second Edition vol. 1 and vol. 2, ASM PRESS, WASHINGTON
D.C.). The purine nucleoside-producing ability can be imparted by
increasing an activity of an enzyme catalyzing a rate-limiting
reaction among the enzymes. An example of the enzyme catalyzing a
reaction of rate-limiting step is PRPP amidotransferase or PRPP
synthetase.
[0020] Examples of means of increasing an activity of an enzyme
involved in the purine nucleoside biosynthesis in cells are
explained below but are not limited thereto.
[0021] As a means of increasing the activity of the enzyme involved
in the purine nucleoside biosynthesis in cells, increasing an
expression amount of the gene for the enzyme may be mentioned.
[0022] Examples of means of increasing the expression amount of the
gene include improvement of a regulatory region of the gene and
increase of a copy number of the gene, but are not limited
thereto.
[0023] The improvement of the regulatory region means making
modification thereto to increase a transcription amount of a gene.
For example, a promoter can be enhanced by, for example,
introducing a mutation into the promoter to increase a
transcription amount of a gene located downstream of the promoter.
Besides introducing a mutation into a promoter, another promoter
which functions in microorganisms such as lac, trp, tac, trc, and
PL may be newly introduced. Further, an enhancer may be newly
introduced to increase the transcription amount of the gene.
Introduction of a gene such as a promoter into chromosome DNA is
described in, for example, Japanese Patent Application Laid-Open
No. 1-215280 (1989).
[0024] Specifically, the copy number of the gene may be increased
by ligating a gene to a multi-copy vector to form a recombinant
DNA, and allowing a microorganism to have the recombinant DNA. The
vector includes widely used ones such as plasmids and phages, and,
in addition to these, transposon (Berg, D. E. and Berg, C. M.,
Bio/Technol., 1, 417 (1983)) and Mu phage (Japanese Patent
Application Laid-Open No. 2-109985 (1990)). It is also possible to
integrate a gene into a chromosome by a method utilizing a plasmid
for homologous recombination or the like to increase the copy
number of the gene.
[0025] For breeding a microorganism belonging to the genus
Escherichia and having an increased expression amount of a gene for
an enzyme involved in the purine nucleoside biosynthesis, necessary
regions of genes may be obtained by amplified by PCR (polymerase
chain reaction) mainly based on already available information about
E. coli genes, and used for breeding of the microorganism. For
example, purF, which is a gene coding for PRPP amidotransferase,
can be cloned from the chromosome DNA of E. coli K12 W3110 strain
(ATCC27325) using a PCR technique. The chromosome DNA used for this
may be derived from any strain of E. coli. The purF means a gene
coding for PRPP amidotransferase, which is subjected to feedback
inhibition by adenosine monophosphate (AMP) or guanosine
monophosphate (GMP), and includes mutants generated due to genetic
polymorphism and the like. Genetic polymorphism means a phenomenon
that an amino acid sequences of a protein is partially altered due
to naturally occurring mutation on the gene.
[0026] As a means of increasing the activity of the enzyme involved
in the purine nucleoside biosynthesis in the cells, it is also
possible to introduce a mutation into a structural gene of the
enzyme to enhance the enzymatic activity of the enzyme itself.
[0027] As a means of increasing the activity of the enzyme involved
in the purine nucleoside biosynthesis in the cells, it is also
possible to desensitize control of the enzyme involved in the
purine nucleoside biosynthesis.
[0028] The control of the enzyme involved in the purine nucleoside
biosynthesis means a mechanism negatively controlling the activity
of the enzyme, and includes feedback inhibition by an intermediate
in the biosynthesis pathway or a final product, attenuation,
transcriptional suppression and the like. A purine nucleoside
produced by a microorganism inhibits the activity of the enzyme
involved in the purine nucleoside biosynthesis or represses
expression of a gene encoding the enzyme through the control.
Therefore, for allowing the microorganism to produce the purine
nucleoside, it is preferable to desensitize the control.
[0029] The enzyme involved in the purine nucleoside biosynthesis,
which undergoes the control, includes PRPP amidotransferase which
is subjected to feedback inhibition by AMP or GMP and PRPP
synthetase which is subjected to feedback inhibition by adenosine
diphosphate (ADP). Besides, inosine monophosphate dehydrogenase
(guaB) and GMP synthetase (guaA) are subjected to feedback
inhibition by GMP. Also, a purine operon, guaBA is subjected to
repression.
[0030] As a method for desensitizing the control, a method for
introducing mutation into a gene encoding the enzyme or a
regulatory region thereof may be mentioned. The mutation includes
mutation desensitizing feedback inhibition, which is usually
mutation in a structural gene. The mutation also includes mutation
desensitizing attenuation, which is usually mutation in attenuator.
The mutation also includes mutation desensitizing repression, which
is usually mutation in a gene coding a regulatory protein which is
called repressor, or mutation in an operator region.
[0031] The mutation desensitizing repression includes mutation
inactivating a purine repressor. The purine repressor binds to an
operator region of a purine operon under the condition that a
purine nucleoside exists in a large amount, resulting in repression
of transcription of the operon. Inactivation of the repressor leads
to desensitization of the repression.
[0032] In order to introduce a mutation into a gene, the
site-specific mutagenesis (Kramer, W. and Frits, H. J., Methods in
Enzymology, 154, 350 (1987)), the recombinant PCR technique (PCR
Technology, Stockton Press (1989)), chemical synthesis of a
specific portion of DNA, hydroxylamine treatment of a gene of
interest, treatment of microbial strains having a gene of interest
by UV irradiation or a chemical agent such as nitrosoguanidine or
nitrous acid and the like can be used. When function of a gene
should be completely inactivated, addition or deletion of DNA may
be introduced at a suitable restriction site.
[0033] A microorganism in which control of an enzyme involved in
the purine nucleoside biosynthesis is desensitized can be selected
by determining an expression amount of the enzyme through an
enzymatic activity assay, or using antibodies. As an example of a
method for obtaining a mutant strain in which control of an enzyme
is desensitized, a method comprising selecting a strain growing in
a minimal medium containing a purine analogue such as 8-azaadenine
and 8-azaguanine, and determining change of an expression amount or
activity of the enzyme
(3) Microorganism which has Acquired the Purine
Nucleoside-Producing Ability Because of Blockage of a Reaction
Branching from Purine Nucleoside Biosynthesis and Leading to
Another Metabolite
[0034] The purine nucleoside biosynthesis pathway of microorganisms
belonging to the genus Escherichia has been already elucidated, and
all the enzymes involved in the purine nucleoside biosynthesis and
reactions catalyzed by those enzymes have also been elucidated
(Escherichia coli and Salmonella, CELLULAR AND MOLECULAR BIOLOGY,
Second Edition, vol 1 and vol. 2, ASM PRESS WASHINGTON D.C.) In
addition, some of reactions which lead to other metabolites have
also been made clear.
[0035] A microorganism in which a reaction leading to another
metabolite are blocked may become to require the metabolite. In
order to cultivate such microorganism that has become to require
the metabolite, it is necessary to add the metabolite or an
intermediate (precursor) therefor to a culture medium as a
nutrient. Therefore, it is desirable that a reaction not requiring
extra addition of the metabolites when it is blocked should be
selected as the reaction to be blocked.
[0036] The purine nucleoside-producing ability may not be always
improved by blocking any of the reactions leading to other
metabolites. If a reaction converting a purine nucleoside
intermediate or a purine nucleoside into another metabolite
proceeds during the production of the purine nucleoside by the
microorganism, blocking such a reaction may improve the purine
nucleoside productivity.
[0037] A reaction whose blocking may actually improve the purine
nucleoside-producing ability may be predicted among the reactions
branching from the purine nucleoside biosynthesis and leading to
the production of another metabolite based on the already
elucidated schemes of the purine nucleoside biosynthesis.
[0038] As a method for blocking the reaction branching from the
purine nucleoside biosynthesis and leading to another metabolite, a
method for deleting or inactivating an enzyme catalyzing the
reaction or the like may be mentioned. The enzyme may be deleted,
for example, by deleting a gene encoding the enzyme. The enzyme may
be inactivated by, for example, introducing a mutation into a gene
encoding the enzyme, adding an agent specifically inactivating the
enzyme or the like.
[0039] Examples of the reaction branching from the purine
nucleoside biosynthesis and leading to another metabolite, whose
blocking may actually improve the purine nucleoside-producing
ability, include a reaction catalyzed by an enzyme selected from
succinyl-AMP synthase, purine nucleoside phosphorylase, adenosine
deaminase, inosine-guanosine kinase, GMP reductase,
6-phosphogluconate dehydrase, phosphoglucose isomerase, adenine
deaminase, and xanthosine phosphorylase.
[0040] For example, when the branching from IMP to succinyl-AMP and
the conversion from inosine to hypoxanthine are blocked, IMP is not
converted to AMP and inosine is not converted to hypoxanthine
Accordingly, it is expected that inosine is accumulated. In order
to evaluate the effectiveness of such blocking, a mutant obtained
depending on the purpose may be cultured, and its inosine
productivity may be determined.
[0041] As described in the Examples hereinafter, when E. coli was
made adenine auxotrophic by destroying succinyl-AMP synthase gene
(purA gene), it became necessary to add an AMP substance such as
adenine and adenosine to a culture medium for the growth of the
adenine auxotroph of E. coli However, it was found in E. coli that
such an added substance was immediately converted to inosine or
hypoxanthine, and its growth was ceased at a certain point due to
the loss of the AMP substance. Therefore, judging from the
metabolic pathway of E. coli, it is expected that it is necessary
to inactivate adenosine deaminase involved in the conversion of
adenosine to inosine or adenine deaminase involved in the
conversion of adenine to hypoxanthine as a means of maintaining its
growth. Thus, the effectiveness of the inactivation of adenosine
deaminase or adenine deaminase was confirmed, and accumulation of
inosine was observed.
[0042] GMP reductase is involved in the conversion of GMP to IMP.
It is expected that guanosine productivity is improved by
inactivating the GMP reductase. As shown in Examples below, a
certain level of improvement in guanosine accumulation was observed
A carbon source such as glucose is used for the production of a
purine nucleoside. It is known that there is a difference in sugar
metabolic system leading to purine nucleoside biosynthesis
depending on the used carbon source or culture conditions.
Therefore, for leading the metabolic system to purine nucleoside
biosynthesis advantageously, it is considered to block branches
other than pentose phosphate pathway to give preference in the
pentose phosphate pathway. As a means thereof, inactivation of
6-phosphogluconate dehydrase or phosphoglucose isomerase was tested
and the effectiveness thereof was confirmed.
(4) Microorganism which has Acquired the Purine
Nucleoside-Producing Ability by Weakening of Incorporation of a
Purine Nucleoside into Cells of the Microorganism
[0043] Since incorporation of a purine nucleoside which has
released externally from cells into the cells again is considered
unreasonable in view of energy for accumulating the purine
nucleoside, weakening of incorporation of a purine nucleoside is
effective.
[0044] As means of weakening incorporation of a purine nucleoside
into cells, blocking of a reaction involved in membrane
permeability of the purine nucleoside may be mentioned. The
blocking of the reaction can be carried out in the same manner as
described about (3) above.
[0045] For example, by inactivating nucleoside permease which is
one of permeases involved in incorporation of purine nucleosides
into cells, improvement in accumulation of inosine was
observed.
(5) Method for Producing a Purine Nucleoside
[0046] The method for producing a purine nucleoside by fermentation
using the microorganism having the purine nucleoside-producing
ability is explained hereinafter.
[0047] Culture medium for purine nucleoside production to be used
may be a usual medium containing a carbon source, a nitrogen
source, inorganic ions and other organic components as required. As
the carbon source, saccharides such as glucose, lactose, galactose,
fructose, arabinose, maltose, xylose, trehalose, ribose and
hydrolysates of starches; alcohols such as glycerol, mannitol and
sorbitol; organic acids such as gluconic acid, fumaric acid, citric
acid and succinic acid and the like can be used. As the nitrogen
source, inorganic ammonium salts such as ammonium sulfate, ammonium
chloride, and ammonium phosphate; organic nitrogen such as of soy
bean hydrolysates; ammonia gas; aqueous ammonia and the like can be
used. It is desirable that vitamins such as vitamin B1, required
substances, for example, nucleic acids such as adenine and RNA, or
yeast extract and the like are contained in appropriate amounts as
trace amount organic nutrients. Other than these, small amounts of
calcium phosphate, magnesium sulfate, iron ions, manganese ions and
the like may be added, if necessary
[0048] Cultivation is preferably performed under an aerobic
condition for 16 to 72 hours, and culture temperature during the
cultivation is controlled within 30 to 45.degree. C. and pH within
5 to 8. The pH can be adjusted by using an inorganic or organic
acidic or alkaline substance as well as ammonia gas.
[0049] A purine nucleoside can be recovered from the fermentation
liquor by any or any combination of conventional methods such as
techniques utilizing ion exchange resin and precipitation.
(6) Specific Examples of Purine Nucleoside-Producing Bacteria
[0050] First, purF (a gene coding for PRPP amidotransferase) purF
(a gene coding for a purine repressor), deoD (a gene coding for
purine nucleoside phosphorylase), purA (a gene coding for
succinyl-AMP synthase), add (a gene coding for adenosine
deaminase), gsk (a gene coding for inosine-guanosine kinase), guaC
(a gene coding for GMP reductase), edd (a gene coding for
6-phosphogluconate dehydrase), pgi (a gene coding for
phosphoglucose isomerase), yicP (a gene for coding for adenine
deaminase), prs (a gene coding for PRPP synthetase), xapa (a gene
coding for xanthosine phosphorylase), and nupG (a gene coding for
nucleoside permease) are cloned from a chromosome DNA of
Escherichia coli (E. coli) K12 strain W3110 (ATCC27325) by using a
PCR technique, and they may be mutated depending on their purposes.
The chromosome DNA used for this procedure may be obtained from any
strain of E. coli.
[0051] The mutation introduced into purF is a mutation for
destroying purF or a mutation for desensitizing the feedback
inhibition of PRPP amidotransferase. The mutation introduced into
purF is a mutation for destroying purF. The mutation introduced
into deoD is a mutation for destroying deoD. The mutation
introduced into purA is a mutation for destroying purA. The
mutation introduced into add is a mutation for destroying add. The
mutation introduced into gsk is a mutation for destroying gsk.
[0052] The mutation introduced into guaC is a mutation for
destroying guaC. The mutation introduced into edd is a mutation for
destroying edd. The mutation introduced into pgi is a mutation for
destroying pgi. The mutation introduced into yicP is a mutation for
destroying yicP. The mutation introduced into prs is a mutation for
desensitizing the feedback inhibition of PRPP synthetase. The
mutation introduced into xapA is a mutation for destroying xapA.
The mutation introduced into nupG is a mutation for destroying
nupG.
[0053] To introduce a mutation into a gene, the site-specific
mutagenesis (Kramer, W. and Frits, H. J., Methods in Enzymology,
154, 350 (1987)), the recombinant PCR technique (PCR Technology,
Stockton Press (1989)), chemical synthesis of a specific portion of
DNA, hydroxylamine treatment of a gene of interest, treatment of
microbial strains having a gene of interest by UV irradiation or a
chemical agent such as nitrosoguanidine or nitrous acid and the
like can be used.
[0054] When function of a gene should be completely inactivated,
addition or deletion of DNA may be introduced at a suitable
restriction site.
[0055] Then, purF and prs to which a mutation for desensitizing the
feedback inhibition of PRPP amidotransferase and PRPP synthetase
are added, respectively, are introduced as a recombinant DNA into a
suitable microorganism to express the genes, thereby obtaining a
microorganism containing the PRPP amidotransferase gene (purF) and
the PRPP synthetase gene (prs) whose feedback inhibition is
substantially desensitized. The recombinant DNA obtained above
means a vector such as plasmid and phage, into which a useful gene
such as the PRPP amidotransferase gene (purF) and the PRPP
synthetase (prs) whose feedback inhibition is substantially
desensitized is integrated as a passenger. The vector may contain a
promoter operable in the microorganism, such as lac, trp, tac, trc,
and PL so that efficient expression of the useful gene can be
obtained.
[0056] The recombinant DNA herein used includes any of those
obtained by integrating a useful gene into a chromosome by using a
transposon (Berg, D. E. and Berg, C. M., Bio/Technol., 1,
417(1983)), Mu phage (Japanese Patent Application Laid-Open No.
2-109985 (1990)), a plasmid for homologous recombination or the
like.
[0057] As the plasmid for homologous recombination, a plasmid
having a temperature-sensitive replication origin may be used.
[0058] The plasmid having the temperature-sensitive replication
origin can replicate at a permissive temperature, for example,
around 30.degree. C., but cannot replicate at a non-permissive
temperature, for example, 37.degree. C. to 42.degree. C. In the
homologous recombination method using the plasmid having the
temperature-sensitive replication origin, the plasmid can be
replicated at a permissive temperature, or dropped out at a
non-permissive temperature as required. In the Examples described
below, pMAN997, which corresponds to pMAN031 (J. Bacteriol., 162,
1196 (1985)) whose VspI-HindIII fragment is replaced with that of
pUC19 (Takara Shuzo) (FIG. 1), was used as the plasmid for
homologous recombination.
[0059] A specific genetic function on the chromosome was
inactivated by the homologous recombination (Experiments in
Molecular Genetics, Cold Spring Habor Lab. (1972)) to improve the
purine nucleoside-producing ability. The gene to be inactivated is
a gene of which inactivation leads increase of an expression amount
of a gene for an enzyme involved in the purine nucleoside
biosynthesis. Specifically, the purine repressor gene (purR) on the
chromosome was destroyed to remove the expression regulation
mechanism of the purine nucleotide biosynthesis genes including the
PRPP amidotransferase gene (purF).
[0060] Further, a gene coding for an enzyme which catalyzes a
reaction branching from purine nucleoside biosynthesis and leading
to another metabolite was destroyed. Specifically, the purine
nucleoside phosphorylase gene (deoD) was destroyed to suppress the
decomposition of inosine and guanosine to hypoxanthine and guanine,
respectively. Furthermore, the succinyl-AMP synthase gene (purA)
was destroyed to impart adenine auxotrophy. Moreover, the adenosine
deaminase gene (add) was destroyed to suppress the conversion of
adenosine to inosine. Finally, the inosine-guanosine kinase gene
(gsk) was destroyed to suppress the conversion of inosine and
guanosine to IMP and GMP, respectively. The GMP reductase gene
(guaC) was destroyed to suppress the conversion of GMP to IMP. The
6-phosphogluconate dehydrase gene (edd) was destroyed to suppress
metabolism of sugars through the Entner-Doudoroff pathway. The
phosphoglucose isomerase gene (pgi) was destroyed to suppress
metabolism of sugars through glycolysis pathway, thereby promoting
the flow into the pentose phosphate pathway. The adenine deaminase
gene (yicP) was destroyed to suppress the conversion of adenine to
hypoxanthine. The xantosine phosphorylase gene (xapA) was destroyed
to suppress the decomposition of xanthosine to xanthine and to
suppress the decomposition of inosine and guanosine to hypoxanthine
and guanine, respectively. The inactivation of a target gene may
also be performed of course by treatment of microbial strains
having the genes with UV irradiation or with a chemical agent such
as nitrosoguanidine and nitrous acid.
[0061] As the microorganism having the recombinant DNA, a
microorganism belonging to the genus Escherichia in which a gene
coding for a target enzyme such as PRPP amidotransferase was
expressed was used.
[0062] In order to efficiently utilize the PRPP amidotransferase
gene (purF), it is preferably used together with other useful
genes, for example, genes involved in the IMP biosynthesis from
PRPP other than purF (purD, purT, purL, purM, purK, purE, purC,
purF, purH), IMP dehydrogenase gene (guaB), GMP synthetase gene
(guaA), PRPP synthetase gene (prs) and the like. Like the PRPP
amidotransferase gene (purF), those useful genes may be present on
a host chromosome, or a plasmid or phage.
[0063] A microorganism having deficiency of purA (succinyl-AMP
synthase gene) and/or deficiency of deoD (purine nucleoside
phosphorylase gene) and/or deficiency of purF (purine repressor
gene) and/or desensitized type purF (PRPP amidotransferase gene)
and/or deficiency of add (adenosine deaminase gene) and/or
deficiency of gsk (inosine-guanosine kinase gene) and/or deficiency
of guaC (GMP reductase gene) and/or deficiency of edd
(6-phosphogluconate dehydrase gene) and/or deficiency of pgi
(phosphoglucose isomerase gene) and/or deficiency of yicP (adenine
deaminase gene) and/or deficiency of xapA (xanthosine phosphorylase
gene) and/or deficiency of nupG (nucleoside permease gene), or a
microorganism transformed with a recombinant DNA having
desensitized type PRPP amidotransferase gene (purF) and/or
desensitized type prs (PRPP synthetase gene) obtained as described
above is cultured so that the target purine nucleoside such as
inosine and guanosine is accumulated in the culture medium, and the
accumulated nucleoside is collected.
BRIEF DESCRIPTION OF DRAWINGS
[0064] FIG. 1 shows a construction of pMAN997.
[0065] FIG. 2 shows structures of genes for homologous
recombination. Numerals in the figure represent lengths (bp) of
obtained fragments and positions from 5' ends.
[0066] FIG. 3 shows structures of genes for homologous
recombination. Numerals in the figure represent lengths (bp) of
obtained fragments and positions from 5' ends.
BEST MODE FOR CARRYING OUT THE INVENTION
Example 1
1) Breeding of Strain Deficient in PRPP Amidotransferase Gene
(purF)
[0067] PCR was carried out (94.degree. C., 30 sec; 55.degree. C., 1
min; 72.degree. C., 2 min; 30 cycles; Gene Amp PCR SystemModel
9600, Perkin Elmer) by using chromosome DNA of E. coli K12 strain
W3110 (ATCC27325) as a template and 29-mer and 31-mer primers for
both ends, having nucleotide sequences of
CTCCTGCAGAACGAGGAAAAAGACGTATG (SEQ ID NO: 1) and
CTCAAGCTTTCATCCTTCGTTATGCATTTCG (SEQ ID NO: 2), and prepared based
on the information of a gene data bank (GenBank Accession No.
M26893), and an amplified fragment of about 1530 bp of the purF
structural gene region covering SD-ATG and the translation
termination codon was cloned into pCRTMII vector (Invitrogen). The
amplified fragment of the PCR product can be cloned into this
vector as it is. The vector has EcoRI sites as restriction sites at
vicinities of the both sides of the cloning site. A PstI site and a
HindIII site are respectively provided in the PCR primers.
[0068] The cloned 1530 bp purF fragment contained one BglII site at
about 880 bp from the 5' end, and pCRTMII vector itself also had
one BglII site. Therefore, the plasmid was partially digested with
BglII, blunt-ended by T4 DNA polymerase, and then ligated by T4 DNA
ligase. Competent cells of E. coli HB101 were transformed with this
ligation solution, and transformants grown on LB (1% tryptone, 0.5%
yeast extract, 0.1% NaCl, 0.1% Glucose, pH 7) agar plates
containing 25 .mu.g/ml of ampicillin were obtained. Plasmid DNAs
were prepared from the transformants of 18 clones, and a plasmid
DNA which provided a fragment of about 1550 bp by the EcoRI
digestion, which fragment was not digested with BglII (pCRTMIIpurF
#14) was selected from the plasmid DNAs. The purF contained in this
plasmid DNA has a frame shift at the BglII site, and therefore it
is predicted that the encoded enzyme lacks its function (FIG.
2).
[0069] Then, the pCRTMIIpurF'#14 was digested with EcoRI to prepare
a fragment of about 1.6 Kb that included the purF. This fragment
was inserted into the EcoRI site of pMAN997, which is a vector for
homologous recombination having a temperature-sensitive replication
origin (tsori) (As shown in FIG. 1, pMAN031 (J. Bacteriol., 162,
1196(1985)) of which VspI-HindIII fragment is replaced with that of
pUC19 (Takara Shuzo)), to obtain plasmid pMAN997purR'#14. E. coli
W3110 (wild type) was transformed at 30.degree. C. with the
pMAN997purR#14, and some of the obtained colonies were streaked on
LB agar plates containing 25 .mu.g/ml of ampicillin, and cultured
at 30.degree. C. overnight. Then, the cultured bacterial cells were
plated on LB agar plates containing 25 .mu.g/ml of ampicillin so
that single colonies should be obtained, to obtain colonies grown
at 42.degree. C. The procedure for obtaining single colonies grown
at 42.degree. C. was repeated once, and clones in which the whole
plasmid was integrated into the chromosome through homologous
recombination were selected. It was confirmed that these clones did
not have the plasmid in their cytoplasm. Then, several clones among
these clones were streaked on LB agar plates, cultured at
30.degree. C. overnight, then inoculated into LB liquid medium (3
ml/test tube), and cultured at 42.degree. C. for 3 to 4 hours with
shaking The culture broth was appropriately diluted so that single
colonies should be obtained (about 10.sup.-5 to 10.sup.-6
dilution), plated on LB agar plates, and cultured at 42.degree. C.
overnight to obtain colonies. One hundred colonies were randomly
picked up from the emerged colonies, and each allowed to grow on LB
agar plates and LB agar plates containing 25 .mu.g/ml of
ampicillin, respectively, and ampicillin-sensitive clones grown
only on the LB agar plates were selected. Among the
ampicillin-sensitive clones, clones that were not grown in a
minimal medium (Na.sub.2HPO.sub.4 6.8 g, KH.sub.2PO.sub.4 3 g, NaCl
0.5 g, NH.sub.4Cl 1 g, MgSO.sub.4.7H.sub.2O 0.5 g,
CaCl.sub.2.2H.sub.2O 15 mg, thiamin.HCl 2 mg, glucose 0.2 g per 1
L), but grown in the minimal medium supplemented with 50 mg/L of
hypoxanthine were further selected. Furthermore, the fragment of
about 1.5 kb including purF was amplified by PCR from the
chromosome DNA of the above obtained target clones, and confirmed
not to be digested with BglII. The clones satisfying the above
conditions were considered strains deficient in purF, and
designated as strains F-2-51 and F-1-72.
2) Breeding of Strain Deficient in Succinyl-AMP Synthase Gene
(purA)
[0070] PCR was carried out (94.degree. C., 30 sec; 55.degree. C., 1
min; 72.degree. C., 2 min; 30 cycles; Gene Amp PCR System Model
9600, Perkin Elmer) by using the chromosome DNA of the strain W3110
as a template and 31-mer primers for both ends, having nucleotide
sequences of CTCGAGCTCATGGGTAACAACGTCGTCGTAC (SEQ ID NO: 3) and
CTCGTCGACTTACGCGTCGAACGGGTCGCGC (SEQ ID NO: 4), and prepared based
on the information of a gene data bank (GenBank Accession No.
J04199), and an amplified fragment of about 1300 bp of the purA
structural gene region covering ATG and the translation termination
codon was cloned between the SacI and SalI sites of pUC18 vector
(Takara Shuzo). A SacI site and a SalI site are respectively
provided in the PCR primers. The cloned purA fragment of about 1300
bp contained one HpaI site and one SnaBI site respectively at about
520 bp and 710 bp from the 5' end, and therefore the plasmid was
digested with HpaI and SnaBI, and ligated by T4 DNA ligase to
obtain the plasmid from which a fragment of about 190 bp was
removed. Competent cells of E. coli JM109 were transformed with
this ligation solution, and transformants grown on LB agar plates
containing 25 .mu.g/ml of ampicillin were obtained. Plasmid DNAs
were prepared from the transformants of 18 clones, and a plasmid
DNA that was not digested with FspI but provided a fragment of
about 1100 bp fragment by SacI and SalI digestion (pUC18purA'#1)
was selected from the plasmid DNAs. The purA contained in this
plasmid DNA has a deletion between the HpaI and SnaBI sites, and
therefore it is predicted that the encoded enzyme lacks its
function (FIG. 2).
[0071] Then, the pUC18purA'#1 was digested with SacI and SalI to
prepare a fragment of about 1=1 kb that included the purA. This
fragment was inserted between the SacI and SalI sites of pMAN997,
which is a vector for homologous recombination having a
temperature-sensitive replication origin (tsori) (described above),
to obtain plasmid pMAN997purA#1. The strain F-2-51 (purF) was
transformed at 30.degree. C. with the plasmid pMAN997purA'#1, and
some of the obtained colonies were streaked on LB agar plates
containing 25 .mu.g/ml of ampicillin, and cultured at 30.degree. C.
overnight. Then, the cultured bacterial cells were plated on LB
agar plates containing 25 .mu.g/ml of ampicillin so that single
colonies should be obtained, to obtain colonies grown at 42.degree.
C. The procedure for obtaining single colonies grown at 42.degree.
C. was repeated once, and clones in which the whole plasmid was
integrated into the chromosome through homologous recombination
were selected. It was confirmed that these clones did not have the
plasmid in their cytoplasm. Then, several clones among these clones
were streaked on LB agar plates, cultured at 30.degree. C.
overnight, then inoculated into LB liquid medium (3 ml/test tube),
and cultured at 42.degree. C. for 3 to 4 hours with shaking. The
culture broth was appropriately diluted so that single colonies
should be obtained (about 10.sup.-5 to 10.sup.-6 dilution), plated
on LB agar plates, and cultured at 42.degree. C. overnight to
obtain colonies. One hundred colonies were randomly picked up from
the emerged colonies, and each allowed to grow on LB agar plates
and LB agar plates containing 25 .mu.g/ml of ampicillin,
respectively, and ampicillin-sensitive clones grown only on the LB
agar plates were selected. Among the ampicillin-sensitive clones,
clones that were not grown on the minimal medium supplemented with
50 mg/L of hypoxanthine, but grown on the minimal medium
supplemented with 50 mg/L of adenine were further selected.
Furthermore, the purA fragment of about 1.1 kb was amplified by PCR
from the chromosome DNA of these target clones, and confirmed to be
smaller than the wild type (about 1.3 kb) and not to be digested
with FspI.
[0072] The clone satisfying the above conditions was considered a
strain deficient in purA, and designated as strain FA-31.
3) Breeding of Strain Deficient in Purine Nucleoside Phosphorylase
Gene (deoD)
[0073] PCR was carried out (94.degree. C., 30 sec; 55.degree. C., 1
min; 72.degree. C., 2 min; 30 cycles; Gene Amp PCR System Model
9600, Perkin Elmer) by using the chromosome DNA of the strain W3110
as a template and 30-mer and 31-mer primers for both ends, having
nucleotide sequences of CTCGTCGACGCGGGTCTGGAACTGTTCGAC (SEQ ID NO:
5) and CTCGCATGCCCGTGCTTTACCAAAGCGAATC (SEQ ID NO: 6), and prepared
based on the information obtained through searching of a gene data
bank (E. coli Gene Bank) using "deoD" as a key word, and an
amplified fragment of about 1350 bp including a deoD structural
gene region covering SD-ATG and the translation termination codon
was cloned into pCRTMII vector (Invitrogen). The vector has EcoRI
sites as restriction sites at vicinities of the both sides of the
cloning site. A SalI site and a SphI site are respectively provided
in the PCR primers. The cloned deoD fragment of about 1350 bp
contained one HpaI site at about 680 bp from the 5' end, and
therefore the plasmid was digested with HpaI, and a mixture of the
digested plasmid and a 10-mer ClaI linker was subjected to T4 DNA
ligase reaction. As a result, a ClaI site was inserted at the HpaI
site. Competent cells of E. coli HB101 were transformed with this
ligation solution, and transformants grown on LB agar plates
containing 25 .mu.g/ml of ampicillin were obtained. Plasmid DNAs
were prepared from the transformants of 16 clones, and a plasmid
DNA that was not digested with HpaI but digested with ClaI
(pCRTMIIdeoD'#16) was selected from the plasmid DNAs. The deoD
contained in this plasmid has a frame shift at the HpaI site, and
therefore it is predicted that the encoded enzyme lacks its
function (FIG. 2).
[0074] Then, the pCRTMIIdeoD'#16 was digested with EcoRI to prepare
a fragment of about 1.35 kb that included the deoD. This fragment
was inserted into the EcoRI site of pMAN997, which is a vector for
homologous recombination having a temperature-sensitive replication
origin (tsori) (described above), to obtain plasmid
pMAN997deoD'#16. The strain F-1-72 (purF.sup.-) and the strain
FA-31 (purF.sup.-, purA.sup.-) were transformed at 30.degree. C.
with plasmid pMAN997deoD'#16, and some of the obtained colonies
were streaked on LB agar plates containing 25 .mu.g/ml of
ampicillin, and cultured at 30.degree. C. overnight. Then, the
cultured bacterial cells were plated on LB agar plates containing
25 .mu.g/ml of ampicillin so that single colonies should be
obtained, to obtain colonies grown at 42.degree. C. The procedure
for obtaining single colonies grown at 42.degree. C. was repeated
once, and clones in which the whole plasmid was integrated into the
chromosome through homologous recombination were selected. It was
confirmed that these clones did not have the plasmid in their
cytoplasm. Then, several clones among these clones were streaked on
LB agar plates, cultured at 30.degree. C. overnight, then
inoculated into LB liquid medium (3 ml/test tube), and cultured at
42.degree. C. for 3 to 4 hours with shaking. The culture broth was
appropriately diluted so that single colonies should be obtained
(about 10.sup.-5 to 10.sup.-6 dilution), plated on LB agar plates,
and cultured at 42.degree. C. overnight to obtain colonies. One
hundred colonies were randomly picked up from the emerged colonies,
and each allowed to grow on LB agar plates and LB agar plates
containing 25 .mu.g/ml of ampicillin, respectively, and
ampicillin-sensitive clones grown only on the LB agar plates were
selected. The ampicillin-sensitive clones were allowed to grow on
the LB medium supplemented with 1 g/L of inosine, and clones that
did not decompose inosine to hypoxanthine were selected through
thin layer chromatography analysis of the culture medium.
Furthermore, the fragment of about 1.35 kb including deoD was
amplified by PCR from the chromosome DNA of these target clones,
and confirmed to be digested with ClaI but not to be digested with
HpaI. The clones satisfying the above conditions were considered
strains deficient in deoD, and clones derived from the strain
F-1-72 (purF.sup.-) and the strain FA-31 (purF.sup.-, purA.sup.-)
were designated as strains FD-6 and FAD-25, respectively.
4) Breeding of Strain Deficient in Purine Repressor Gene (purF)
[0075] PCR was carried out (94.degree. C., 30 sec; 55.degree. C., 1
min; 72.degree. C., 2 min; 30 cycles; Gene Amp PCR System Model
9600, Perkin Elmer) by using the chromosome DNA of the strain W3110
as a template and 29-mer and 28-mer primers for both ends, having
nucleotide sequences of CTCGTCGACGAAAGTAGAAGCGTCATCAG (SEQ ID NO:
7) and CTCGCATGCTTAACGACGATAGTCGCGG (SEQ ID NO: 8), and prepared
based on the information obtained through searching of a gene data
bank (E. coli Gene Bank) using "purR" as a key word, and an
amplified fragment of about 1.8 kb including a purR structural gene
region covering ATG and the translation termination codon and about
800 bp 5' upstream region of ATG was cloned between the SalI site
and the SphI site of pUC19 vector (Takara Shuzo) A SalI site and a
SphI site are respectively provided in the PCR primers, and these
sites are used for cloning. The cloned purR fragment of about 1.8
kb contained one PmaCI site at about 810 bp from the 5' end
(vicinity of N-terminus in the purR structural gene region), and
therefore the plasmid was digested with PmaCI.
[0076] A mixture of the digested plasmid and a 8-mer BglII linker
was subjected to T4 DNA ligase reaction. As a result, a BglII site
was inserted at the PmaCI site. Competent cells of E. coli JM109
were transformed with this ligation solution, and transformants
grown on LB agar plates containing 25 .mu.g/ml of ampicillin were
obtained. Plasmid DNAs were prepared from the transformants of 10
clones, and a plasmid DNA not digested with PmaCI but digested with
BglII (pUC19purR'#2) was selected from the plasmid DNAs. The purR
contained in this plasmid DNA has a frame shift at the PmaCI site,
and therefore it is predicted that the encoded enzyme lacks its
function (FIG. 2).
[0077] Then, the pUC19purR'#2 was digested with SacI and SphI to
prepare a fragment of about 1.8 kb that included the purR. This
fragment was inserted between the SacI site and the SphI site of
pMAN997, which is a vector for homologous recombination having a
temperature-sensitive replication origin (tsori) (described above),
to obtain plasmid pMAN997purR'#2. The strain FD-6 (purF.sup.-,
deoD.sup.-) and the strain FAD-25 (purF.sup.-, purA.sup.-,
deoD.sup.-) were transformed at 30.degree. C. with the plasmid
pMAN997purR'#2, and some of the obtained colonies were streaked on
LB agar plates containing 25 .mu.g/ml of ampicillin, and cultured
at 30.degree. C. overnight. Then, the cultured bacterial cells were
plated on LB agar plates containing 25 .mu.g/ml of ampicillin so
that single colonies should be obtained, to obtain colonies grown
at 42.degree. C. The procedure for obtaining single colonies grown
at 42.degree. C. was repeated once, and clones in which the whole
plasmid was integrated into the chromosome through homologous
recombination were selected. It was confirmed that these clones did
not have the plasmid in their cytoplasm. Then, several clones among
these clones were streaked on LB agar plates, cultured at
30.degree. C. overnight, then inoculated into LB liquid medium (3
ml/test tube), and cultured at 42.degree. C. for 3 to 4 hours with
shaking. The culture broth was appropriately diluted so that single
colonies should be obtained (about 10.sup.-5 to 10.sup.-6
dilution), plated on LB agar plates, and cultured at 42.degree. C.
overnight to obtain colonies. One hundred colonies were randomly
picked up from the emerged colonies, and each allowed to grow on LB
agar plates and LB agar plates containing 25 .mu.g/ml of
ampicillin, respectively, and ampicillin-sensitive clones grown
only on the LB agar plates were selected. Ten clones were randomly
selected from the ampicillin-sensitive clones, and the fragment of
about 1.8 kb including purR was amplified by PCR from the
chromosome DNA of these clones, and clones that were digested with
BglII but not with PmaCI were selected. These clones were
considered strains deficient in purR, and clones derived from the
strain FD-6 (purF.sup.-, deoD.sup.-) and the strain FAD-25
(purF.sup.-, purA.sup.-, deoD.sup.-) are designated as strain
FDR-18 and strain FADR-8, respectively. It was confirmed that the
PRPP amidotransferase activity in the strains in which purR was
destroyed was increased compared with that of a strain in which
purR was not destroyed by using the purF.sup.+ strain deficient in
deoD and purR or the purF.sup.+ strain deficient in purA, deoD and
purR. The PRPP amidotransferase activity was measured according to
the method of L. J. Messenger et al. (J. Biol. Chem., 254,
3382(1979)).
5) Construction of Desensitized Type PRPP Amidotransferase Gene
(purF)
[0078] A purF fragment was excised from the plasmid carrying the
purF of about 1530 bp cloned into pCRTMII vector (Invitrogen) in
Section 1) by digestion with PstI and HindIII, and inserted between
the PstI and HindIII sites of the multi-cloning site of a plasmid
for introducing mutation, pKF18 (Takara Shuzo) to obtain the target
clone (pKFpurF). G. Zhou et al. (J. Biol. Chem., 269, 6784 (1994))
has revealed that PRPP amidotransferase (PurF) whose Lys (K) at
position 326 is replaced with Gln (Q) and the same whose Pro (P) at
position 410 is further replaced with Trp (W) are each desensitized
for feedback inhibition by GMP and AMP. Therefore, the following
synthetic DNA primers were prepared for gene substitution realizing
mutations of Lys (K) at position 326 and Pro (P) at position 410 of
PRPP amidotransferase (PurF) to Gln (Q) and Trp (W), respectively,
and pKFpurF was subjected to site-directed mutagenesis according to
the protocol of Site-directed Mutagenesis System Mutan-Super
Express Km (Takara Shuzo) to introduce a site-directed mutation
into the pKFpurF. TABLE-US-00001 Primer for K326Q mutation: (SEQ ID
NO: 9) 5'-GGGCTTCGTT CAG AACCGCTATGTTGG-3' Primer for P410W
mutation: (SEQ ID NO: 10) 5'-TATGGTATTGATATG TGG
AGCGCCACGGAAC-3'
[0079] After the mutagenesis, 6 clones were randomly picked up from
each of the resulting transformants, and plasmids were prepared
from them. By nucleotide sequencing of the plasmids around the
locations where the mutations were introduced, it was confirmed
that target mutants were obtained. The obtained plasmids were
designated as pKFpurFKQ and pKFpurFPW, respectively. The mutation
P410W (410Pro.fwdarw.Trp) was further introduced into pKFpurFKQ in
the same manner to prepare pKFpurFKQPW, a mutant plasmid having two
mutations simultaneously. Each of the plasmids pKFpurFKQ, pKFpurFPW
and pKFpurFKQPW has an inserted mutant purF downstream of the
lacp/o (promoter of lactose operon) derived from pKF18, and the
purF is expressed under the control of this promoter.
[0080] Recombinant bacteria obtained by transforming E. coli JM109
cells with the above plasmids were cultured in LB liquid medium for
eight hours, and collected, and crude enzyme extracts were prepared
from them. The PRPP amidotransferase activity of the extracts and
degrees of inhibition by AMP and GMP were measured according to the
method of L. J. Messenger (J. Biol. Chem., 254, 3382 (1979)). The
results are shown in Table 1. TABLE-US-00002 TABLE 1 PRPP
amidotransferase activity and inhibition by AMP and GMP PRPP
amidotransferase activity (.mu.mole/min/mg) Host Plasmid None 10 mM
AMP 10 mM GMP JM109 -- 0.001 -- -- JM109 pKFpurF 0.68 0.48 0.10
JM109 pKFpurFKQ 0.34 0.32 0.33 JM109 pKFpurFKQPW 0.18 0.16 0.17
6) Evaluation of Purine Nucleoside-Producing Ability of Mutant PurF
Plasmid-Introduced Strain
[0081] Transformants were produced by introducing pKFpurFKQ and
pKFpurFKQPW into the strain FDR-18 (purF.sup.-, deoD.sup.-,
purR.sup.-) and the strain FADR-8 (purF.sup.-, purA.sup.-,
deoD.sup.-, purR.sup.-) produced in Section 4), and purine
nucleoside-producing abilities of these strains were evaluated.
[0082] Basal medium and culture method for purine nucleoside
production and analysis method for the evaluation of the purine
nucleoside-producing ability will be described below.
[0083] 1. Basal Medium: MS Medium TABLE-US-00003 Final
concentration Glucose 40 g/L (separately sterilized)
(NH.sub.4).sub.2SO.sub.4 16 g/L KH.sub.2PO.sub.4 1 g/L
MgSO.sub.4.cndot.7H.sub.2O 1 g/L FeSO.sub.4.cndot.7H.sub.2O 0.01
g/L MnSO.sub.4.cndot.4H.sub.2O 0.01 g/L Yeast extract 2 g/L
CaCO.sub.3 30 g/L (separately sterilized)
2. Culture Method Refresh culture; a stored bacterium
inoculated
[0084] LB agar medium (supplemented with a drug as required)
[0085] 37.degree. C., cultured overnight.
Seed culture; the refresh cultured bacterium inoculated
[0086] LB liquid medium (supplemented with a drug as required)
[0087] 37.degree. C., cultured overnight.
Main culture; 2% inoculated from the seed culture
[0088] MS medium (supplemented with adenine and a drug as
required)
[0089] 37.degree. C., 20 ml/500-ml volume Sakaguchi's culture
flask
3. Analysis Method
[0090] A sample of the culture medium (500 .mu.l) is repeatedly
taken in the time course, and centrifuged at 15,000 rpm for 5
minutes, and the supernatant is diluted 4 times with H.sub.2O and
analyzed by HPLC. Unless noted otherwise, the evaluation is made
based on an accumulated amount of a purine nucleoside per unit
volume of the medium after culture for 3 days.
Analysis Conditions:
Column: Asahipak GS-220 (7.6 mm ID.times.500 mm L)
Buffer: pH is adjusted with 0.2M NaH.sub.2PO.sub.4 (pH 3.98), and
phosphoric acid
Temperature: 55.degree. C.
Flow Rate: 1.5 ml/min
Detection: UV 254 nm
[0091] Retention time (min) TABLE-US-00004 Inosine 16.40
Hypoxanthine 19.27 Guanosine 20.94 Guanine 23.55 Adenine 24.92
Adenosine 26.75
[0092] For the strains of purA.sup.- (adenine auxotrophic), 5 mg/L
of adenine was added to the MS medium.
[0093] The results of the evaluation of the purine
nucleoside-producing ability are shown in Table 2. Superior inosine
production was observed with respect to the mutant purF
plasmid-introduced strains in contrast to the strain W3110 (wild
type strain) by which a trace amount of the production was
observed. TABLE-US-00005 TABLE 2 Evaluation of purine
nucleoside-producing ability Purine nucleoside accumulation Inosine
Guanosine Host Plasmid (mg/L) (mg/L) W3110 -- Trace 0 FDR-18
pKFpurFKQ 115 0 FDR-18 pKFpurFKQPW 110 0 FADR-8 pKFpurFKQ 66 0
FADR-8 pKFpurFKQPW 62 0
Example 2
1) Breeding of Strain Deficient in Adenosine Deaminase Gene
(add)
[0094] PCR was carried out (94.degree. C., 30 sec; 55.degree. C., 1
min; 72.degree. C., 2 min; 30 cycles; Gene Amp PCR System Model
9600, Perkin Elmer) by using the chromosome DNA of the strain W3110
as a template and 29-mer primers for both ends, having nucleotide
sequences of CTCGTCGACGGCTGGATGCCTTACGCATC (SEQ ID NO: 11) and
CTCGCATGCAGTCAGCACGGTATATCGTG (SEQ ID NO: 12), and prepared based
on the information obtained through searching of a gene data bank
(E. coli Gene Bank) using "add" as a key word, and an amplified
fragment of about 1.8 kb including an add structural gene region
covering ATG and the translation termination codon, about 420 bp 5'
upstream region of ATG and about 370 bp downstream region of the
translation termination codon was cloned between the SalI site and
the SphI site of pUC19 vector (Takara Shuzo). A SalI site and a
SphI site are respectively provided in the PCR primers, and these
sites are used for the cloning. The cloned add fragment of about
1.8 kb contained one StuI site at about 880 bp from the 5' end, and
therefore the plasmid was digested with StuI, and a mixture of the
digested plasmid and a 8-mer BglII linker was subjected to T4 DNA
ligase reaction. As a result, a BglII site was inserted at the StuI
site. Competent cells of E. coli JM109 were transformed with this
ligation solution, and transformants grown on LB agar plates
containing 25 .mu.g/ml of ampicillin were obtained. Plasmid DNAs
were prepared from the transformants of 10 clones, and a plasmid
DNA not digested with StuI but digested with BglII (pUC19add'#1)
was selected from the plasmid DNAs. The add contained in this
plasmid DNA has a frame shift at the StuI site, and therefore it is
predicted that the encoded enzyme lacks its function (FIG. 2).
[0095] Then, the pUC19add'#1 was digested with SacI and SphI to
prepare a fragment of about 1.8 kb that included the add. This
fragment was inserted between the SacI site and the SphI site of
pMAN997, which is a vector for homologous recombination having a
temperature-sensitive replication origin (tsori) (described above),
to obtain plasmid pMAN997add'#1. The strain FDR-18 (purF.sup.-,
deoD.sup.-, purR.sup.-) and the strain FADR-8 (purF.sup.-,
purA.sup.-, deoD.sup.-, purR.sup.-) were transformed at 30.degree.
C. with the plasmid pMAN997add'#1, and some of the obtained
colonies were streaked on LB agar plates containing 25 .mu.g/ml of
ampicillin, and cultured at 30.degree. C. overnight. Then, the
cultured bacterial cells were plated on LB agar plates containing
25 .mu.g/ml of ampicillin so that single colonies should be
obtained, to obtain colonies grown at 42.degree. C. The procedure
for obtaining single colonies grown at 42.degree. C. was repeated
once, and clones in which the whole plasmid was integrated into the
chromosome through homologous recombination were selected. It was
confirmed that these clones did not have the plasmid in their
cytoplasm. Then, several clones among these clones were streaked on
LB agar plates, cultured at 30.degree. C. overnight, then
inoculated into LB liquid medium (3 ml/test tube), and cultured at
42.degree. C. for 3 to 4 hours with shaking. The culture broth was
appropriately diluted so that single colonies should be obtained
(about 10.sup.-5 to 10.sup.-6 dilution), plated on LB agar plates,
and cultured at 42.degree. C. overnight to obtain colonies. One
hundred colonies were randomly picked up from the emerged colonies,
and each allowed to grow on LB agar plates and LB agar plates
containing 25 .mu.g/ml of ampicillin, respectively, and
ampicillin-sensitive clones grown only on the LB agar plates were
selected. The ampicillin-sensitive clones were allowed to grow in
the LB medium supplemented with 1.5 g/L of adenosine, and clones
that did not convert adenosine to inosine were selected through
thin layer chromatography analysis of the culture medium.
Furthermore, the add fragment of about 1.8 kb was amplified by PCR
from the chromosome DNA of these target clones, and confirmed to be
digested with BglII but not to be digested with StuI. These clones
were considered strains deficient in add, and clones derived from
the strain FDR-18 (purF.sup.-, deoD.sup.-, purR.sup.-) and the
strain FADR-8 (purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-) are
designated as strains FDRadd-18-1 and FADRadd-8-3,
respectively.
2) Evaluation of Purine Nucleoside-Producing Ability of
Desensitized Type purF-Introduced Strain
[0096] Transformants were made by introducing pKFpurFKQ and
pKFpurFKQPW into the strain FDRadd-18-1 (purF.sup.-, deoD.sup.-,
purR.sup.-, add.sup.-) and the strain FADRadd-8-3 (purF.sup.-,
purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-) bred in Section 1),
and purine nucleoside-producing abilities of these strains were
evaluated. For the strain FADRadd-8-3, a transformant with the wild
type purF plasmid (pKFpurF) was also made, and compared with the
transformant with pKFpurFKQ and the transformant with pKFpurFKQPW.
The basal medium and the culture method for the purine nucleoside
production and the analysis method were the same as Example 1.
[0097] The results of the evaluation of the purine
nucleoside-producing ability are shown in Table 3. Superior inosine
production was observed compared with the strain W3110 (wild type
strain). Effects of desensitized type purFKQ and purFKQPW were
observed by comparing with the wild type purF. TABLE-US-00006 TABLE
3 Evaluation of purine nucleoside-producing ability Purine
nucleoside accumulation Inosine Guanosine Host Plasmid (mg/L)
(mg/L) W3110 -- Trace 0 FDRadd-18-1 pKFpurFKQ 220 0 FDRadd-18-1
pKFpurFKQPW 215 0 FADRadd-8-3 pKFpurFKQ 1080 0 FADRadd-8-3
pKFpurFKQPW 1030 0 FADRadd-8-3 pKFpurF 805 0
Example 3
1) Construction of Desensitized Type purF Plasmid for Homologous
Recombination
[0098] In order to introduce desensitized type purF substitution in
a chromosome by using the purF.sup.- strain produced in Example 1,
Section 1), another purF fragment longer than the previously
obtained purF fragment (about 1.6 kb) by about 0.5 kb for the 3
side was prepared. PCR was carried out (94.degree. C., 30 sec;
55.degree. C., 1 min; 72.degree. C., 2 min; 30 cycles; Gene Amp PCR
System Model 9600, Perkin Elmer) by using the chromosome DNA of the
strain W3110 and 29-mer primers for both ends, having nucleotide
sequences of CTCCTGCAGAACGAGGAAAAAGACGTATG (SEQ ID NO: 1) and
CTCAAGCTTGTCTGATTTATCACATCATC (SEQ ID NO: 13), and prepared based
on the information of the gene data bank (E. coli Gene Bank), and
an amplified fragment of about 2.1 kb including the purF structural
gene region covering SD-ATG and the translation termination codon
was cloned into pCRTMII vector (Invitrogen). The plasmid contained
in this clone is designated as pCRTMIIpurFL. The pCRTMIIpurFL has
EcoRI sites as restriction sites at vicinities of the both sides of
the cloning site. A PstI site and a HindIII site are respectively
provided in the PCR primers.
[0099] Then, the pCRTMIIpurFL was digested with SnaBI and HindIII
to obtain a fragment of about 0.65 kb present downstream of the
C-terminus of the purF coding region This fragment was inserted
between the SnaBI site and the HindIII site of pKFpurFKQ and
pKFpurFKQPW obtained in Example 1, Section 5) to obtain pKFpurFLKQ
and pKFpurFLKQPW.
[0100] Then, the pKFpurFLKQ and pKFpurFLKQPW were digested with
EcoRI and HindIII to give fragments of about 2.1 kb containing
purFLKQ and purFLKQPW. These fragments were inserted between the
EcoRI and HindIII sites of pMAN997, which is a vector for
homologous recombination having a temperature-sensitive replication
origin (tsori) (described above), to obtain plasmids pMAN997purRLKQ
and pMAN997purRLKQPW, respectively.
2) Breeding of Strain Having Desensitized type purF Integrated in
Chromosome
[0101] The strain FDRadd-18-1 (purF.sup.-, deoD.sup.-, purR.sup.-,
add.sup.-) and the strain FADRadd-8-3 (purF.sup.-, purA.sup.-,
deoD.sup.-, purR.sup.-, add.sup.-) were each transformed with the
plasmids pMAN997purRLKQ and pMAN997purRLKQPW at 30.degree. C., and
some of the obtained colonies were streaked on LB agar plates
containing 25 .mu.g/ml of ampicillin, and cultured at 30.degree. C.
overnight. Then, the cultured bacterial cells were plated on LB
agar plates containing 25 .mu.g/ml of ampicillin so that single
colonies should be obtained, to obtain colonies grown at 42.degree.
C. The procedure for obtaining single colonies grown at 42.degree.
C. was repeated once, and clones in which the whole plasmid was
integrated into the chromosome through homologous recombination
were selected. It was confirmed that these clones did not have the
plasmid in their cytoplasm. Then, several clones among these clones
were streaked on LB agar plates, cultured at 30.degree. C.
overnight, then inoculated into LB liquid medium (3 ml/test tube),
and cultured at 42.degree. C. for 3 to 4 hours with shaking. The
culture was appropriately diluted so that single colonies should be
obtained (about 10.sup.-5 to 10.sup.-6 dilution), plated on LB agar
plates, and cultured at 42.degree. C. overnight to obtain colonies.
One hundred colonies were randomly picked up from the emerged
colonies, and each allowed to grow on LB agar plates and LB agar
plates containing 25 .mu.g/ml of ampicillin, respectively, and
ampicillin-sensitive clones grown only on the LB agar plates were
selected. Among the ampicillin-sensitive clones, clones that were
grown on the minimal medium were selected for the strain
FDRadd-18-1 (purF.sup.-, deoD, purR.sup.-, add.sup.-), and clones
that were grown in the minimal medium supplemented with 100 mg/L of
L-histidine and 50 mg/L of adenine were selected for the strain
FADRadd-8-3 (purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-,
add.sup.-).
[0102] The fragments of about 1.5 kb including purF were amplified
from chromosome DNA of these target clones, and nucleotide
sequences around the locations where mutations were introduced by
homologous recombination substitution were determined. As a result,
it was confirmed that they contained the mutation of K326Q
(326Lys.fwdarw.Gln), and the mutations of K326Q
(326Lys.fwdarw.Gln)+P410W (410Pro.fwdarw.Trp), respectively.
[0103] Those derived from the strain FDRadd-18-1 (purF.sup.-,
deoD.sup.-, purR.sup.-, add.sup.-) were designated as strain
FDRadd-18-1::KQ (purFKQ, deoD.sup.-, purR.sup.-, add.sup.-) and
strain FDRadd-18-1::KQPW (purFKQPW, deoD.sup.-, purR.sup.-,
add.sup.-), and those derived from the strain FADRadd-8-3
(purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-) were
designated as strain FADRadd-8-3::KQ (purFKQ, purA.sup.-,
deoD.sup.-, purR.sup.-, add.sup.-) and strain FADRadd-8-3::KQPW
(purFKQPW, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-).
3) Evaluation of Purine Nucleoside-Producing Ability of Strain
having Desensitized Type purF Integrated into Chromosome
[0104] Purine nucleoside-producing abilities of the strain
FDRadd-18-1::KQ (purFKQ, deoD.sup.-, purR.sup.-, add.sup.-), the
strain FDRadd-18-1::KQPW (purFKQPW, deoD.sup.-, purR.sup.-,
add.sup.-), the strain FADRadd-8-3::KQ (purFKQ, purA.sup.-,
deoD.sup.-, purR.sup.-, add.sup.-) and the strain FADRadd-8-3::KQPW
(purFKQPW, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-) prepared
in Section 2) were evaluated. The basal medium and the culture
method for the purine nucleoside production and the analysis method
were the same as Example 1. For the strains of purA.sup.- (adenine
auxotrophic) 5 mg/L of adenine was added to the MS medium
[0105] The results of the evaluation of purine nucleoside-producing
ability are shown in Table 4. Superior inosine production was
observed compared with the strain W3110 (wild type strain).
TABLE-US-00007 TABLE 4 Evaluation of purine nucleoside-producing
ability Purine nucleoside accumulation Inosine Guanosine Strain
(mg/L) (mg/L) W3110 Trace 0 FDRadd-18-1::KQ 110 0 FDRadd-18-1::KQPW
105 0 FADRadd-8-3::KQ 635 0 FADRadd-8-3::KQPW 620 0
Example 4
1) Breeding of Strain Deficient in Inosine-Guanosine Kinase Gene
(gsk)
[0106] PCR was carried out (94.degree. C., 30 sec; 55.degree. C., 1
min; 72.degree. C., 2 min; 30 cycles; Gene Amp PCR System Model
9600, Perkin Elmer) by using the chromosome DNA of the strain W3110
and 23-mer and 21-mer primers for both ends, having nucleotide
sequences of CTCGAGCTCATGAAATTTCCCGG (SEQ ID NO: 14) and
CTCGGATCCGGTACCATGCTG (SEQ ID NO: 15), and prepared based on the
information of a gene data bank (GenBank Accession No. D00798), and
an amplified fragment of about 1.5 kb including the gsk structural
gene region covering ATG and the translation termination codon was
cloned between the SacI site and the BamHI site of pUC18 vector
(Takara Shuzo). A SacI site and a BamHI site are respectively
provided in the PCR primers.
[0107] The cloned gsk fragment of 1.5 kb contained one BglII site
at about 830 bp from the 5' end, and therefore the plasmid was
digested with BglII, and subjected to T4 DNA ligase reaction in
order to insert a kanamycin resistant (Km.sup.r) gene GenBlock
(BamHI digest, Pharmacia Biotech). Competent cells of E. coli JM109
were transformed with this ligation solution, and transformants
grown on LB agar plates containing 501g/ml of kanamycin were
obtained. Plasmid DNAs were prepared from the transformants of 4
clones, and a plasmid DNA that was not digested with BglII from
which plasmid a fragment of about 2.8 kp was excised by EcoRI and
SalI digestion (pUCgsk'#2) was selected from the plasmid DNAs. The
gsk contained in this plasmid has an inserted heterogeneous gene at
the BglII site, and therefore it is predicted that the encoded
enzyme lacks its function (FIG. 2).
[0108] Then, the pUCgsk'#2 was digested with SacI, SphI and DraI to
prepare a fragment of about 2.8 Kb that included the gsk and
Km.sup.r genes. The DraI digestion is employed to facilitate the
preparation of a SacI-SphI fragment. The fragment was inserted
between the SacI and SphI sites of pMAN997, which is a vector for
homologous recombination having a temperature-sensitive replication
origin (tsori) (describe above), to obtain plasmid pMAN997gsk'#2.
The strain FDR-18 (purF.sup.-, deoD.sup.-, purR.sup.-) and the
strain FADRadd-8-3 (purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-,
add.sup.-) were transformed at 30.degree. C. with the plasmid
pMAN997gsk'#2, and some of the obtained colonies were streaked on
LB agar plates containing 25 .mu.g/ml of ampicillin, and cultured
at 30.degree. C. overnight. Then, the cultured bacterial cells were
plated on LB agar plates containing 25 .mu.g/ml of ampicillin so
that single colonies should be obtained, to obtain colonies grown
at 42.degree. C. The procedure for obtaining single colonies grown
at 42.degree. C. was repeated once, and clones in which the whole
plasmid was integrated into the chromosome through homologous
recombination were selected. It was confirmed that these clones did
not have the plasmid in their cytoplasm. Then, several clones among
these clones were streaked on LB agar plates, cultured at
30.degree. C. overnight, then inoculated into LB liquid medium (3
ml/test tube), and cultured at 42.degree. C. for 3 to 4 hours with
shaking. The culture was appropriately diluted so that single
colonies should be obtained (about 10.sup.-5 to 10.sup.-6
dilution), plated on LB agar plates, and cultured at 42.degree. C.
overnight to obtain colonies. One hundred colonies were randomly
picked up from the emerged colonies, and each allowed to grow on LB
agar plates, LB agar plates containing 25 .mu.g/ml of ampicillin,
respectively, and LB agar plates containing 20 .mu.g/ml of
kanamycin, respectively, and clones not grown on the LB agar plates
containing 25 .mu.g/ml of ampicillin, but grown on the LB agar
plates containing 20 .mu.g/ml of kanamycin were selected.
Furthermore, the fragment including the gsk gene was amplified by
PCR from the chromosome DNA of these target clones, and it was
confirmed that the about 2.8 kb fragment including Km.sup.r gene,
not the original fragment of about 1.5 kb, was amplified. It was
also confirmed that the inosine-guanosine kinase activity was not
detected in them. The inosine-guanosine kinase activity was
measured according to the method of Usuda et al. (Biochim. Biophys.
Acta., 1341, 200-206 (1997)). Those clones were considered strains
deficient in gsk, and clones derived from the strain FDR-18
(purF.sup.-, deoD.sup.-, purR.sup.-) and the strain FADRadd-8-3
(purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-) are
designated as strain FDRG-18-13 and strain FADRaddG-8-3,
respectively.
2) Evaluation of Purine Nucleoside-Producing Ability of
Desensitized Type purF Plasmid-Introduced Strain
[0109] Because the plasmids pKFpurFKQ and pKFpurFKQPW have the
Km.sup.r gene as a drug selection marker and the host strains
FDRG-18-13 (purF.sup.-, deoD.sup.-, purR.sup.-, gsk.sup.-) and
FADRaddG-8-3 (purF, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-,
gsk.sup.-) prepared in Section 1) are made kanamycin resistant, it
is difficult to obtain transformants by introducing pKFpurFKQ and
pKFpurFKQPW into the strains FDRG-18-13 and FADRaddG-8-3 for the
evaluation of the purine nucleoside-producing ability. Therefore,
exchange of drug selection marker genes of the plasmids pKFpurFKQ
and pKFpurFKQPW was performed by using pUC18 vector having the
ampicillin resistance gene (Takara Shuzo). Because the locational
relationship between the lac promoter and the multi-cloning site is
common to pKF18 and pUC18, purFKQ and purFKQPW fragments were
excised from pKFpurFKQ and pKFpurFKQPW by using PstI and HindIII,
and these were inserted between the PstI and HindIII sites of pUC18
to prepare pUCpurFKQ and pUCpurFKQPW. The hosts, the strains
FDRG-18-13 and FADRaddG-8-3, were transformed with the pUCpurFKQ
and pUCpurFKQPW, and the purine nucleoside-producing abilities of
the recombinants were evaluated. The basal medium and the culture
method for the purine nucleoside production and the analysis method
were the same as Example 1. For the strains of purA.sup.- (adenine
auxotrophic), 5 mg/L of adenine was added to the MS medium.
[0110] The results of the evaluation of the purine
nucleoside-producing ability are shown in Table 5. From these
results, it was revealed that the microorganisms accumulated
guanosine as well as inosine when the deficiency of gsk was added.
TABLE-US-00008 TABLE 5 Evaluation of purine nucleoside-producing
ability Purine nucleoside accumulation Inosine Guanosine Host
Plasmid (mg/L) (mg/L) W3110 -- Trace 0 FDRG-18-13 pUCpurFKQ 105 139
FDRG-18-13 pUCpurFKQPW 108 93 FADRaddG-8-3 pUCpurFKQ 126 52
FADRaddG-8-3 pUCpurFKQPW 222 49
3) Breeding of Strains Having Desensitized Type purF Integrated
into Chromosome and Evaluation of Purine Nucleoside-Producing
Ability
[0111] The strains FDRG-18-3 (purF.sup.-, deoD.sup.-, purR.sup.-,
gsk.sup.-) and FADRaddG-8-3 (purF.sup.-, purA.sup.-, deoD.sup.-,
purR.sup.-, add.sup.-, gsk.sup.-) were transformed at 30.degree. C.
with the plasmids pMAN997purRLKQ and pMAN997purRLKQPW,
respectively. Some of the obtained colonies were streaked on LB
agar plates containing 25 .mu.g/ml of ampicillin, and cultured at
30.degree. C. overnight. Then, the cultured bacterial cells were
plated on LB agar plates containing 25 .mu.g/ml of ampicillin so
that single colonies should be obtained, to obtain colonies grown
at 42.degree. C. The procedure for obtaining single colonies grown
at 42.degree. C. was repeated once, and clones in which the whole
plasmid was integrated into the chromosome through homologous
recombination were selected. It was confirmed that these clones did
not have the plasmid in their cytoplasm. Then, several clones among
these clones were streaked on LB agar plates, cultured at
30.degree. C. overnight, then inoculated into LB liquid medium (3
ml/test tube), and cultured at 42.degree. C. for 3 to 4 hours with
shaking. The culture was appropriately diluted so that single
colonies should be obtained (about 10.sup.-5 to 10.sup.-6
dilution), plated on LB agar plates, and cultured at 42.degree. C.
overnight to obtain colonies. One hundred colonies were randomly
picked up from the emerged colonies, and each allowed to grow on LB
agar plates and LB agar plates containing 25 .mu.g/ml of
ampicillin, respectively, and ampicillin-sensitive clones grown
only on the LB agar plates were selected. From ampicillin-sensitive
clones, clones grown on the minimal medium were further selected
for the strain FDRG-18-13 (purF.sup.-, deoD.sup.-, purR.sup.-,
gsk.sup.-), and clones grown in the minimal medium supplemented
with 100 mg/L of L-histidine and 50 mg/L of adenine were selected
for the strain FADRaddG-8-3 (purF.sup.-, purA.sup.-, deoD.sup.-,
purR.sup.-, add.sup.-, gsk.sup.-).
[0112] Chromosome DNAs of these target clones were prepared, and
fragments of about 1.5 kb including purF were amplified by PCR, and
sequenced around the locations where the mutations were introduced
thorough substitution by homologous recombination As a result, it
was confirmed that they had a mutation of K326Q (326Lys.fwdarw.Gln)
and K326Q (326Lys.fwdarw.Gln)+P410W (410Pro.fwdarw.Trp),
respectively.
[0113] The strains derived from the strain FDRG-18-13 (purF.sup.-,
deoD.sup.-, purR.sup.-, gsk.sup.-) were designated as strain
FDRG-18-13::KQ (purFKQ, deoD.sup.-, purR.sup.-, gsk.sup.-) and
strain FDRG-18-13::KQPW (purFKQPW, deoD.sup.-, purR.sup.-,
gsk.sup.-), and those derived from the strain FADRaddG-8-3
(purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-,
gsk.sup.-) were designated as strain FADRaddG-8-3::KQ (purFKQ,
purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-, gsk.sup.-) and
strain FADRaddG-8-3::KQPW (purFKQPW, purA.sup.-, deoD.sup.-,
purR.sup.-, add.sup.-, gsk.sup.-).
[0114] The strain FADRaddG-8-3::KQ (purFKQ, purA.sup.-, deoD.sup.-,
purR.sup.-, add.sup.-, gsk.sup.-) was given a private number
AJ13334. This strain was deposited at National Institute of
Bioscience and Human-Technology of Ministry of International Trade
and Industry (1-3, Higashi 1-chome, Tsukuba-shi, Ibaraki 305-0046
Japan) on Jun. 24, 1997 as an international deposition under the
Budapest treaty, and received an accession number FERM BP-5993.
[0115] The purine nucleoside-producing abilities of these four
kinds of strains having desensitized type purF integrated into
chromosome were evaluated. The basal medium and the culture method
for the purine nucleoside production and the analysis method were
the same as Example 1. For the strains of purA.sup.- (adenine
auxotrophic), 5 mg/L of adenine was added to the MS medium.
[0116] The results of the evaluation of the purine
nucleoside-producing ability are shown in Table 6. From these
results, it was revealed that the microorganisms accumulated
guanosine as well as inosine when the deficiency of gsk was added.
TABLE-US-00009 TABLE 6 Evaluation of purine nucleoside-producing
ability Purine nucleoside accumulation Inosine Guanosine Strain
(mg/L) (mg/L) W3110 Trace 0 FDRG-18-13::KQ 150 140 FDRG-18-13::KQPW
145 125 FADRaddG-8-3::KQ 550 135 FADRaddG-8-3::KQPW 530 130
Example 5
1) Construction of Wild Type purR Plasmid for Homologous
Recombination and Breeding of Strain Having Reversed purR.sup.+
Integrated Into Chromosome
[0117] In Example 1, Section 4), the plasmid (pUCpurR) carrying the
purR fragment of about 1.8 kb between the SalI site and the SphI
site of pUC19 vector (Takara Shuzo) was obtained. The pUCpurR was
digested with SacI and SphI to prepare a fragment of about 1.8 kb
that included wild type purR. This fragment was inserted between
the SacI site and the SphI site of pMAN997, which is a vector for
homologous recombination having a temperature-sensitive replication
origin (tsori) (described above), to obtain plasmid pMAN997purR.
The strain FADRadd-8-3 (purF.sup.-, purA.sup.-, deoD.sup.-,
purR.sup.-, add.sup.-) was transformed at 30.degree. C. with the
plasmid pMAN997purR, and some of the obtained colonies were
streaked on LB agar plates containing 25 .mu.g/ml of ampicillin,
and cultured at 30.degree. C. overnight. Then, the cultured
bacterial cells were plated on LB agar plates containing 25
.mu.g/ml of ampicillin so that single colonies should be obtained,
to obtain colonies grown at 42.degree. C. The procedure for
obtaining single colonies grown at 42.degree. C. was repeated once,
and clones in which the whole plasmid was integrated into the
chromosome through homologous recombination were selected. It was
confirmed that these clones did not have the plasmid in their
cytoplasm. Then, several clones among these clones were streaked on
LB agar plates, cultured at 30.degree. C. overnight, then
inoculated into LB liquid medium (3 ml/test tube), and cultured at
42.degree. C. for 3 to 4 hours with shaking. The culture was
appropriately diluted so that single colonies should be obtained
(about 10.sup.-5 to 10.sup.-6 dilution), plated on LB agar plates,
and cultured at 42.degree. C. overnight to obtain colonies. One
hundred colonies were randomly picked up from the emerged colonies,
and each allowed to grow on LB agar plates and LB agar plates
containing 25 .mu.g/ml of ampicillin, respectively, and
ampicillin-sensitive clones grown only on the LB agar plates were
selected. 10 clones were randomly selected from the
ampicillin-sensitive clones, and the purR fragments of about 1.8 kb
were amplified from the chromosome DNA of these clones by PCR.
Clones in which the amplified fragment was digested with PmaCI but
not with BglII were selected. The clones were considered purR.sup.+
reversed strains, and designated as FADadd-8-3-2 (purF.sup.-,
purA.sup.-, deoD.sup.-, add.sup.-).
2) Evaluation of Purine Nucleoside-Producing Ability of
Desensitized Type purF-Introduced Strain
[0118] A transformant was produced by introducing pKFpurFKQ into
the strain FADadd-8-3-2 (purF.sup.-, purA.sup.-, deoD.sup.-,
add.sup.-), and purine nucleoside-producing ability of the strain
was evaluated. For the strain FADRadd-8-3, a transformant with
pKFpurKQ was also prepared, and an effect of purR deficiency was
evaluated by comparison. The basal medium and the culture method
for the purine nucleoside production and the analysis method were
the same as Example 1. The MS medium was supplemented with 5 mg/L
adenine.
[0119] The results of the evaluation of the purine
nucleoside-producing ability are shown in Table 7. Superior inosine
production was observed in FADRadd (purR.sup.- type) compared with
FADadd (purR wild type) and the effect of purF deficiency was
confirmed. TABLE-US-00010 TABLE 7 Evaluation of purine
nucleoside-producing ability Purine nucleoside accumulation Inosine
Guanosine Host Plasmid (mg/L) (mg/L) W3110 -- Trace 0 FADRadd-8-3
pKFpurFKQ 1080 0 FADadd-8-3-2 pKFpurFKQ 930 0
Example 6
1) Rebreeding of Strain Deficient in Inosine-Guanosine Kinase Gene
(gsk)
[0120] PCR was carried out (94.degree. C., 30 sec; 55.degree. C., 1
min; 72.degree. C., 2 min; 30 cycles; Gene Amp PCR System Model
9600, Perkin Elmer) by using the chromosome DNA of the strain W3110
and 32-mer and 29-mer primers for both ends, having nucleotide
sequences of CTCGGTACCCTGTTGCGTTAAGCCATCCCAGA (SEQ ID NO: 16) and
CTCGCATGCCAACGTACGGCATTAACCTA (SEQ ID NO: 17), and prepared based
on the information of a gene data bank (GenBank Accession No.
D00798), and an amplified fragment of about 3.0 kb including the
gsk structural gene region (about 800 bp) covering ATG and the
translation termination codon was cloned between the KpnI site and
the SphI site of pUC19 vector (Takara Shuzo). A KpnI site and a
SphI site are respectively provided in the PCR primers.
[0121] The cloned gsk fragment of 3.0 kb contained two Aro51HI
sites at about 900 bp and 1030 bp and one BglII site at about 1640
bp from the 5 end, and therefore the plasmid was digested with
Aro51HI and BglII, and blunt-ended by T4 DNA polymerase. Then the
Aro51HI-BglII fragment was removed and DNA of the vector was
subjected to self-ligation by T4 DNA ligase. Competent cells of E.
coli JM109 were transformed with this ligation solution, and
transformants grown on LB agar plates containing 25 .mu.g/ml of
ampicillin were obtained. Plasmid DNAs were prepared from the
transformants of 10 clones, and a plasmid DNA which was not
digested with Aro51HI or BglII and from which plasmid a fragment of
about 2.3 kp was excised by KpnI and SphI digestion (pUC19gsk'#10)
was selected from the plasmid DNAs. The gsk contained in this
plasmid has a deletion in the structural gene between the Aro51HI
site and the BglII site, and therefore it is predicted that the
encoded enzyme lacks its function (FIG. 3).
[0122] Then, the pUC19gsk'#10 was digested with KpnI and SphI to
prepare a fragment of about 2.3 kb that included the gsk gene. The
fragment was inserted between the KpnI and SphI sites of pMAN997,
which is a vector for homologous recombination having a
temperature-sensitive replication origin (tsori) (describe above),
to obtain plasmid pMAN997gsk'#10. The strain FADRadd-8-3
(purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-) was
transformed at 30.degree. C. with the plasmid pMAN997gsk'#10, and
some of the obtained colonies were streaked on LB agar plates
containing 25 .mu.g/ml of ampicillin, and cultured at 30.degree. C.
overnight. Then, the cultured bacterial cells were plated on LB
agar plates containing 25 .mu.g/ml of ampicillin so that single
colonies should be obtained, to obtain colonies grown at 42.degree.
C. The procedure for obtaining single colonies grown at 42.degree.
C. was repeated once, and clones in which the whole plasmid was
integrated into the chromosome through homologous recombination
were selected. It was confirmed that these clones did not have the
plasmid in their cytoplasm. Then, several clones among these clones
were streaked on LB agar plates, cultured at 30.degree. C.
overnight, then inoculated into LB liquid medium (3 ml/test tube),
and cultured at 42.degree. C. for 3 to 4 hours with shaking. The
culture was appropriately diluted so that single colonies should be
obtained (about 10.sup.-5 to 10.sup.-6 dilution), plated on LB agar
plates, and cultured at 42.degree. C. overnight to obtain colonies.
One hundred colonies were randomly picked up from the emerged
colonies, and each allowed to grow on LB agar plates and LB agar
plates containing 25 .mu.g/ml of ampicillin, respectively, and
ampicillin-sensitive clones grown only on the LB agar plates were
selected. Furthermore, 10 clones were randomly selected from the
ampicillin-sensitive clones, the fragments including the gsk gene
were amplified by PCR using the above PCR primers from the
chromosome DNA of these target clones, and the clones in which the
fragment of about 2.3 kb, not the original fragment of about 3.0 kb
were amplified were selected. It was also confirmed that the
inosine-guanosine kinase activity was not detected in them. The
inosine-guanosine kinase activity was measured according to the
method of Usuda et al. (Biochim. Biophys. Acta., 1341, 200-206
(1997)). The clones were considered new strains deficient in gsk,
and the clones derived from the strain FADRadd-8-3 (purF.sup.-,
purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-) were designated as
FADRaddgsk (purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-,
add.sup.-, gsk.sup.-).
2) Breeding of Strain Deficient in GMP Reductase Gene (guaC)
[0123] PCR was carried out (94.degree. C., 30 sec; 55.degree. C., 1
min; 72.degree. C., 2 min; 30 cycles; Gene Amp PCR System Model
9600, Perkin Elmer) by using the chromosome DNA of the strain W3110
and 29-mer primers for both ends, having nucleotide sequences of
CTCAAGCTTACGGCTCTGGTCCACGCCAG (SEQ ID NO: 18) and
CTCCTGCAGCAGCGTTGGGAGATTACAGG (SEQ ID NO: 19), and prepared based
on the information of a gene data bank (E. coli Gene Bank), and an
amplified fragment of about 2.2 kb including the guaC structural
gene region covering SD-ATG and the translation termination codon
was cloned between the HindIII site and the PstI site of pUC18
vector (Takara Shuzo). A HindIII site and a PstI site are
respectively provided in the PCR primers.
[0124] The cloned guaC fragment of 2.2 kb contained one BglII site
at about 1.1 kb from the 5' end, and therefore the plasmid was
digested with BglII, blunt-ended by T4 DNA polymerase and ligated
with T4 DNA ligase. Competent cells of E. coli JM109 were
transformed with this ligation solution, and transformants grown on
LB agar plates containing 25 .mu.g/ml of ampicillin were obtained.
Plasmid DNAs were prepared from the transformants of 18 clones, and
a plasmid DNA from which a fragment of about 2.2 kp was excised by
HindIII and PstI digestion, and which fragment was not digested
with BglII (pUC18guaC'#1) was selected from the plasmid DNAs. The
guaC contained in this plasmid has a frame shift at the BglII site,
and therefore it is predicted that the encoded enzyme lacks its
function (FIG. 3).
[0125] Then, the pUC18guaC'#1 was digested with HindIII and PstI to
prepare a fragment of about 2.2 kb that included guaC. The fragment
was inserted between the HindIII and PstI sites of pMAN997, which
is a vector for homologous recombination having a
temperature-sensitive replication origin (tsori) (describe above),
to obtain plasmid pMAN997guaC'#1. The strain FADRadd-8-3
(purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-) and the
strain FADRaddgsk (purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-,
add.sup.-, gsk.sup.-) were transformed at 30.degree. C. with the
plasmid pMAN997guaC'#1, and some of the obtained colonies were
streaked on LB agar plates containing 25 .mu.g/ml of ampicillin,
and cultured at 30.degree. C. overnight. Then, the cultured
bacterial cells were plated on LB agar plates containing 25
.mu.g/ml of ampicillin so that single colonies should be obtained,
to obtain colonies grown at 42.degree. C. The procedure for
obtaining single colonies grown at 42.degree. C. was repeated once,
and clones in which the whole plasmid was integrated into the
chromosome through homologous recombination were selected. It was
confirmed that these clones did not have the plasmid in their
cytoplasm. Then, several clones among these clones were streaked on
LB agar plates, cultured at 30.degree. C. overnight, then
inoculated into LB liquid medium (3 ml/test tube), and cultured at
42.degree. C. for 3 to 4 hours with shaking. The culture was
appropriately diluted so that single colonies should be obtained
(about 10.sup.-5 to 10.sup.-6 dilution), plated on LB agar plates,
and cultured at 42.degree. C. overnight to obtain colonies. One
hundred colonies were randomly picked up from the emerged colonies,
and each allowed to grow on LB agar plates and LB agar plates
containing 25 .mu.g/ml of ampicillin, respectively, and
ampicillin-sensitive clones grown only on the LB agar plates were
selected. The fragments of about 2.2 kb including guaC were
amplified by PCR from the chromosome DNA of these target clones,
and it was confirmed that the fragment was not digested with BglII.
The clones satisfying the above conditions were considered strains
deficient in guaC, and the clones derived from the strains
FADRadd-8-3 and FADRaddgsk are designated as FADRaddguaC
(purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-,
guaC.sup.-) and FADRaddgskguaC (purF.sup.-, purA.sup.-, deoD.sup.-,
purR.sup.-, add.sup.-, gsk.sup.-, guaC.sup.-), respectively. It was
also confirmed that the GMP reductase activity was not detected in
them. The GMP reductase activity was measured according to the
method of B. B. Garber et al. (J. Bacteriol., 43, 105(1980)).
3) Evaluation of Purine Nucleoside-Producing Ability of
Desensitized Type purF Plasmid-Introduced Strain
[0126] Transformants were produced by introducing pKFpurFKQ into
the strain FADRaddguaC (purF.sup.-, purA.sup.-, deoD.sup.-,
purR.sup.-, add.sup.-, guaC.sup.-) and FADRaddgskguaC (purF.sup.-,
purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-, gsk.sup.-,
guaC.sup.-) produced in Section 2), and purine nucleoside-producing
abilities of the strains were evaluated. The basal medium and the
culture method for the purine nucleoside production and the
analysis method were the same as Example 1. The MS medium was
supplemented with 5 mg/L adenine.
[0127] The results of the evaluation of the purine
nucleoside-producing ability are shown in Table 8. A certain level
of improvement in guanosine production was observed by the
deficiency of guaC. TABLE-US-00011 TABLE 8 Evaluation of purine
nucleoside-producing ability Purine nucleoside accumulation Inosine
Guanosine Host Plasmid (mg/L) (mg/L) FADRadd-8-3 pKFpurFKQ 1080 0
FADRaddguaC pKFpurFKQ 670 20 FADRaddgsk pKFpurFKQ 920 140
FADRaddgskguaC pKFpurFKQ 750 180
Example 7
1) Breeding of Strain Deficient in 6-Phosphogluconate Dehydrase
Gene (edd)
[0128] PCR was carried out (94.degree. C., 30 sec; 55.degree. C., 1
min; 72.degree. C., 2 min; 30 cycles; Gene Amp PCR System Model
9600, Perkin Elmer) by using the chromosome DNA of the strain W3110
and 29-mer primers for both ends, having nucleotide sequences of
CTCGAATTCGGATATCTGGAAGAAGAGGG (SEQ ID NO: 20) and
CTCAAGCTTGGAATAGTCCCTTCGGTAGC (SEQ ID NO: 21), and prepared based
on the information obtained through searching of a gene data bank
(E. coli Gene Bank) using "edd" as a key word, and an amplified
fragment of about 3.0 kb including the edd structural gene region
covering ATG and the translation termination codon, about 810 bp 5'
upstream region of ATG and about 360 bp downstream region of the
translation termination codon was cloned into pCRTMII vector
(Invitrogen) as it was. The amplified fragment of the PCR product
can be cloned into this vector as it is. The vector has EcoRI sites
as restriction sites at vicinities of the both sides of the cloning
site. A BamHI site and a HindIII site are respectively provided in
the PCR primers. The cloned edd fragment of 3.0 kb contained two
StuI sites at about 660 bp and 1900 bp from the 5' end, and
therefore the plasmid was digested with StuI. Then the StuI
fragment of about 1.25 kb was removed and DNA of the vector was
subjected to self-ligation by T4 DNA ligase. Competent cells of E.
coli HB101 were transformed with this ligation solution, and
transformants grown on LB agar plates containing 25 .mu.g/ml of
ampicillin were obtained. Plasmid DNAs were prepared from the
transformants of 10 clones, and a plasmid DNA from which a fragment
of about 1.25 kp was not excised by StuI (pCRTMIIedd'#1) was
selected from the plasmid DNAs. The edd contained in this plasmid
has a deletion of a protein-coding region including a promoter
region, and therefore it is predicted that the enzyme is not formed
(FIG. 3).
[0129] Then, the pCRTMIIedd'#1 was digested with EcoRI to prepare a
fragment of about 1.75 kb that included a part of edd and a
flanking region thereof. The fragment was inserted into the EcoRI
site of pMAN997, which is a vector for homologous recombination
having a temperature-sensitive replication origin (tsori) (describe
above), to obtain plasmid pMAN997edd'#1. The strain FADRadd-8-3
(purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-) was
transformed at 30.degree. C. with the plasmid pMAN997edd#1, and
some of the obtained colonies were streaked on LB agar plates
containing 25 .mu.g/ml of ampicillin, and cultured at 30.degree. C.
overnight. Then, the cultured bacterial cells were plated on LB
agar plates containing 25 .mu.g/ml of ampicillin so that single
colonies should be obtained, to obtain colonies grown at 42.degree.
C. The procedure for obtaining single colonies grown at 42.degree.
C. was repeated once, and clones in which the whole plasmid was
integrated into the chromosome through homologous recombination
were selected. It was confirmed that these clones did not have the
plasmid in their cytoplasm. Then, several clones among these clones
were streaked on LB agar plates, cultured at 30.degree. C.
overnight, then inoculated into LB liquid medium (3 ml/test tube),
and cultured at 42.degree. C. for 3 to 4 hours with shaking. The
culture was appropriately diluted so that single colonies should be
obtained (about 10.sup.-5 to 10.sup.-6 dilution), plated on LB agar
plates, and cultured at 42.degree. C. overnight to obtain colonies.
One hundred colonies were randomly picked up from the emerged
colonies, and each allowed to grow on LB agar plates and LB agar
plates containing 25 .mu.g/ml of ampicillin, respectively, and
ampicillin-sensitive clones grown only on the LB agar plates were
selected. The edd regions were amplified by PCR using the above PCR
primers from the chromosome DNA of these target clones, and the
clones in which the size of the amplified fragment is about 1.75 kb
of deletion type, not about 3.0 kb of wild type were selected. The
clones were considered strains deficient in edd and designated as
FADRaddedd (purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-,
add.sup.-, edd.sup.-).
2) Evaluation of Purine Nucleoside-Producing Ability of
Desensitized Type purF Plasmid-Introduced Strain
[0130] A transformant was produced by introducing pKFpurFKQ into
the strain FADRaddedd (purF.sup.-, purA.sup.-, deoD.sup.-,
purR.sup.-, add, edd.sup.-) bred in Section 1), and purine
nucleoside-producing ability of the strain was evaluated. The basal
medium and the culture method for the purine nucleoside production
and the analysis method were the same as Example 1. The MS medium
was supplemented with 5 mg/L adenine. The 6-phosphogulconate
dehydrase encoded by edd is an enzyme which is induced by gluconic
acid and positioned at the first step in the Entner-Doudoroff
pathway metabolizing gluconate to pyruvate. Because the gluconate
was considered to flow only into the pentose phosphate pathway by
deficiency of this enzyme, gluconic acid (48 g/L added) was used as
a carbon source other than glucose to carry out the evaluation.
[0131] The results of the evaluation of the purine
nucleoside-producing ability are shown in Table 9. Remarkable
improvement in inosine production was observed by the deficiency of
edd, when the gluconic acid was used as the carbon source The
effect was also observed when glucose was used as the carbon
source. TABLE-US-00012 TABLE 9 Evaluation of purine
nucleoside-producing ability Purine nucleoside accumulation Carbon
Inosine Guanosine Host Plasmid source (mg/L) (mg/L) FADRadd-8-3
pKFpurFKQ Glucose 1080 0 FADRaddedd pKFpurFKQ Glucose 1340 0
FADRadd-8-3 pKFpurFKQ Gluconic 1050 0 acid FADRaddedd pKFpurFKQ
Gluconic 2600 0 acid
Example 8
1) Breeding of Strain Deficient in Phosphoglucose Isomerase Gene
(pgi)
[0132] PCR was carried out (94.degree. C., 30 sec; 55.degree. C., 1
min; 72.degree. C., 2 min; 30 cycles; Gene Amp PCR System Model
9600, Perkin Elmer) by using the chromosome DNA of the strain W3110
and 29-mer primers for both ends, having nucleotide sequences of
CTCGTCGACTCCATTTTCAGCCTTGGCAC (SEQ ID NO: 22) and
CTCGCATGCGTCGCATCAGGCATCGGTTG (SEQ ID NO: 23), and prepared based
on the information obtained through searching of a gene data bank
(E. coli Gene Bank) using "pgi" as a key word, and an amplified
fragment of about 2.2 kb including the pgi structural gene region
covering ATG and the translation termination codon was cloned
between the SalI site and the SphI site of pUC18 vector (Takara
Shuzo). A SalI site and a SphI site are respectively provided in
the PCR primers. The cloned pgi fragment of 2.2 kb contained one
BssHII site and one MluI site at about 1170 bp and 1660 bp from the
5 end, respectively, and therefore the plasmid was digested with
BssHII and MluI, and blunt-ended by T4 DNA polymerase. Then the
fragment of about 500 bp between the BssHII site and the MluI site
was removed and DNA of the vector was subjected to self-ligation by
T4 DNA ligase. Competent cells of E. coli JM109 were transformed
with this ligation solution, and transformants grown on LB agar
plates containing 25 .mu.g/ml of ampicillin were obtained. Plasmid
DNAs were prepared from the transformants of 10 clones, and a
plasmid DNA from which a fragment of about 1.7 kp was excised by
SalI and SphI digestion (pUC18 pgi'#1) was selected from the
plasmid DNAs. The pgi contained in this plasmid has a deletion
between the BssHII site and the MluI site, and therefore it is
predicted that the encoded enzyme lacks its function (FIG. 3).
[0133] Then, the pUC18 pgi'#1 was digested with SalI and SphI to
prepare a fragment of about 1.7 kb that included pgi. The fragment
was inserted between the SalI site and the SphI site of pMAN997,
which is a vector for homologous recombination having a
temperature-sensitive replication origin (tsori) (describe above),
to obtain plasmid pMAN997 pgi'#1. The strain FADRadd-8-3
(purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-) and the
strain FADRaddedd (purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-,
add.sup.-, edd.sup.-) were transformed at 30.degree. C. with the
plasmid pMAN997 pgi'#1, and some of the obtained colonies were each
streaked on LB agar plates containing 25 .mu.g/ml of ampicillin,
and cultured at 30.degree. C. overnight. Then, the cultured
bacterial cells were plated on LB agar plates containing 25
.mu.g/ml of ampicillin so that single colonies should be obtained,
to obtain colonies grown at 42.degree. C. The procedure for
obtaining single colonies grown at 42.degree. C. was repeated once,
and clones in which the whole plasmid was integrated into the
chromosome through homologous recombination were selected. It was
confirmed that these clones did not have the plasmid in their
cytoplasm. Then, several clones among these clones were streaked on
LB agar plates, cultured at 30.degree. C. overnight, then
inoculated into LB liquid medium (3 ml/test tube), and cultured at
42.degree. C. for 3 to 4 hours with shaking. The culture was
appropriately diluted so that single colonies should be obtained
(about 10.sup.-5 to 10.sup.-6 dilution), plated on LB agar plates,
and cultured at 42.degree. C. overnight to obtain colonies. One
hundred colonies were randomly picked up from the emerged colonies,
and each allowed to grow on LB agar plates and LB agar plates
containing 25 .mu.g/ml of ampicillin, respectively, and
ampicillin-sensitive clones grown only on the LB agar plates were
selected. The pgi regions were amplified by PCR using the above PCR
primers from the chromosome DNA of these target clones, and the
clones in which the size of the amplified fragment was about 1.7 kb
of deletion type, not about 2.2 kb of wild type were selected. The
clones were considered strains deficient in pgi, and clones derived
from FADRadd-8-3 and FADRaddedd were designated as FADRaddpgi
(purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-,
pgi.sup.-) and FADRaddeddpgi (purF.sup.-, purA.sup.-, deoD.sup.-,
purR.sup.-, add.sup.-, edd.sup.-, pgi.sup.-), respectively.
2) Evaluation of Purine Nucleoside-Producing Ability of
Desensitized Type purF Plasmid-Introduced Strain
[0134] Transformants were produced by introducing pKFpurFKQ into
the strain FADRaddpgi (purr, purA.sup.-, deoD.sup.-, purR.sup.-,
add.sup.-, pgi.sup.-) and the strain FADRaddeddpgi (purF.sup.-,
purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-, edd.sup.-,
pgi.sup.-) bred in Section 1), and purine nucleoside-producing
abilities of the strains were evaluated. The basal medium and the
culture method for the purine nucleoside production and the
analysis method were the same as Example 1 provided that the amount
of yeast extract in the MS medium (basal medium) which was a medium
used for evaluation of production was increased to 0.8%.
[0135] The results of the evaluation of the purine
nucleoside-producing ability are shown in Table 10. By deficiency
of pgi, growth remarkably lowered in the MS medium supplemented
with 5 mg/L of adenine which was used in the above Examples.
Therefore, the medium in which the amount of yeast extract was
increased to 0.8% was used. In this medium, the pgi.sup.+ parent
strain showed increase of the growth rate, lowering of inosine
production and by-production of hypoxanthine. On the contrary,
remarkable improvement in inosine production was observed in the
strain deficient in pgi. TABLE-US-00013 TABLE 10 Evaluation of
purine nucleoside-producing ability Purine nucleoside accumulation
Inosine Hypoxanthine Host Plasmid (mg/L) (mg/L) FADRadd-8-3
pKFpurFKQ 450 260 FADRaddpgi pKFpurFKQ 2770 100 FADRaddedd
pKFpurFKQ 780 210 FADRaddeddpgi pKFpurFKQ 3080 120
Example 9
1) Breeding of Strain Deficient in Adenine Deaminase Gene
(yicP)
[0136] In a gene data bank (E. coli Gene Bank), yicP is registered
as ORF (open reading frame, structural gene) which has a high
homology with adenine deaminase from Bacillus subtilis. PCR was
carried out (94.degree. C., 30 sec; 55.degree. C., 1 min;
72.degree. C., 2 min; 30 cycles; Gene Amp PCR SystemModel 9600,
Perkin Elmer) by using the chromosome DNA of the strain W3110 and
29-mer primers for both ends, having nucleotide sequences of
CTCCTGCAGCGACGTTTTCTTTTATGACA (SEQ ID NO: 24) and
CTCAAGCTTCGTAACTGGTGACTTTTGCC (SEQ ID NO: 25), and prepared based
on the information obtained through searching using "yicP" as a key
word, to amplify a fragment of about 1.9 kb including the yicP
structural gene region covering ATG and the translation termination
codon, about 50 bp 5' upstream region of ATG and about 40 bp
downstream region of the translation termination codon. A PstI site
and a HindIII site are respectively provided in the PCR primers.
The PCR product was digested with PstI and HindIII, and cloned
between the PstI site and the HindIII site of pUC18 vector (Takara
Shuzo). The cloned yicP fragment of 1.9 kb contained one HapI site
and one EcoRV site at about 540 bp and 590 bp from the 51 end,
respectively, and therefore the plasmid was digested with HapI and
EcoRV. Then the HapI-EcoRV fragment of 47 bp was removed and DNA of
the vector was subjected to self-ligation by T4 DNA ligase.
Competent cells of E. coli JM109 were transformed with this
ligation solution, and transformants grown on LB agar plates
containing 25 .mu.g/ml of ampicillin were obtained. Plasmid DNAs
were prepared from the transformants of 10 clones, and a plasmid
DNA which was not digested with HapI or EcoRV (pUC18yicP'#1) was
selected from the plasmid DNAs. The yicP contained in this plasmid
has a frame shift due to a deletion of 47 bp of HapI-EcoRV sites,
and therefore it is predicted that the encoded enzyme lacks its
function (FIG. 3).
[0137] Then, the pUC18yicP'#1 was digested with PstI and HindIII to
prepare a fragment of about 1.9 kb that included the yicP gene. The
fragment was inserted between the PstI site and the HindIII site of
pMAN997, which is a vector for homologous recombination having a
temperature-sensitive replication origin (tsori) (describe above),
to obtain plasmid pMAN997yicP'#1. The strain FADRaddedd
(purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-,
edd.sup.-) was transformed at 30.degree. C. with the plasmid
pMAN997yicP'#1, and some of the obtained colonies were streaked on
LB agar plates containing 25 .mu.g/ml of ampicillin, and cultured
at 30.degree. C. overnight. Then, the cultured bacterial cells were
plated on LB agar plates containing 25 .mu.g/ml of ampicillin so
that single colonies should be obtained, to obtain colonies grown
at 42.degree. C. The procedure for obtaining single colonies grown
at 42.degree. C. was repeated once, and clones in which the whole
plasmid was integrated into the chromosome through homologous
recombination were selected. It was confirmed that these clones did
not have the plasmid in their cytoplasm. Then, several clones among
these clones were streaked on LB agar plates, cultured at
30.degree. C. overnight, then inoculated into LB liquid medium (3
ml/test tube), and cultured at 42.degree. C. for 3 to 4 hours with
shaking. The culture was appropriately diluted so that single
colonies should be obtained (about 10.sup.-5 to 10.sup.-6
dilution), plated on LB agar plates, and cultured at 42.degree. C.
overnight to obtain colonies. One hundred colonies were randomly
picked up from the emerged colonies, and each allowed to grow on LB
agar plates and LB agar plates containing 25 .mu.g/ml of
ampicillin, respectively, and ampicillin-sensitive clones grown
only on the LB agar plates were selected. The yicP regions were
amplified by PCR using the above PCR primers from the chromosome
DNA of these target clones, and the clones in which the size of the
amplified fragment was not digested with HapI or EcoRV were
selected. It was also confirmed that the adenine deaminase activity
was not detected in these clones. The adenine deaminase activity
was measured according to the method of Per Nygaard et al. (J.
Bacteriol., 178, 846-853 (1996)). The clones were considered
strains deficient in yicP, and designated as FADRaddeddyicP
(purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-,
edd.sup.-, yicP.sup.-).
2) Breeding of Strain Deficient in Phosphoglucose Isomerase Gene
(pgi) from Strain Deficient in Adenine Deaminase Gene (yicP)
[0138] The deficiency of pgi was also added to the strain
FADRaddeddyicP (purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-,
add.sup.-, edd.sup.-, yicP.sup.-) By using pMAN997 pgi'#1
constructed in Example 8, a strain FADRaddeddyicPpgi (purF.sup.-,
purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-, edd.sup.-,
yicP.sup.-, pgi.sup.-) was obtained in the same method as in
Example 8.
3) Evaluation of Purine Nucleoside-Producing Ability of
Desensitized Type purF Plasmid-Introduced Strain
[0139] Transformants were produced by introducing pKFpurFKQ into
the strain FADRaddeddyicP (purF.sup.-, purA.sup.-, deoD.sup.-,
purR.sup.-, add.sup.-, edd.sup.-, yicP.sup.-) and the strain
FADRaddeddyicPpgi (purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-,
add.sup.-, edd.sup.-, yicP.sup.-, pgi.sup.-) bred in Sections 1)
and 2), and responses of growth to an adenine amount and purine
nucleoside-producing abilities of the strains were evaluated. The
basal medium and the culture method for the purine nucleoside
production and the analysis method were the same as Example 1
provided that the used medium was the MS medium to which adenine
was added in an amount between 0 to 50 mg/L.
[0140] The result of the evaluation of the growth response to
adenine and the purine nucleoside-producing ability are shown in
Table 11. By deficiency of yicP, the growth rate with respect to
adenine was improved and an effect of the deficiency of yicP was
observed when adenine was added in amounts of 50 mg/L and 20 mg/L.
TABLE-US-00014 TABLE 11 Evaluation of purine nucleoside-producing
ability Purine nucleoside Adenine Growth accumulation added rate
Inosine Hypoxanthine Host Plasmid (mg/L) (OD) (mg/L) (mg/L)
FADRaddedd pKFpurFKQ 0 2.2 8.70 0 50 3.2 650 0 FADRaddeddyicP
pKFpurFKQ 0 2.4 870 0 50 6.8 1100 40 FADRaddeddpgi pKFpurFKQ 5 2.2
1420 28 20 3.4 1760 48 FADRaddeddyicPpgi pKFpurFKQ 5 2.1 1380 7 20
3.7 2350 19
Example 10
1) Preparation of PRPP Synthetase Gene (prs)
[0141] PCR was carried out (94.degree. C., 30 sec; 55.degree. C., 1
min; 72.degree. C., 2 min; 30 cycles; Gene Amp PCR System Model
9600, Perkin Elmer) by using the chromosome DNA of the strain W3110
and 38-mer and 29-mer primers for both ends, having nucleotide
sequences of CTCGTCGACTGCCTAAGGATCTTCTCATGCCTGATATAG (SEQ ID NO:
26) and CTCGCATGCGCCGGGTTCGATTAGTGTTC (SEQ ID NO: 27), and prepared
based on the information of a gene data bank (E. coli Gene Bank),
and an amplified fragment of about 1 kb including the prs
structural gene region covering SD-ATG and the translation
termination codon was cloned into pUC18 vector (Takara Shuzo). A
SalI site and a SphI site are respectively provided in the PCR
primers. The PCR product was digested with SalI and SphI, and
cloned between the SalI site and the SphI site of pUC18 vector
(pUCprs).
2) Construction of Desensitized Type prs
[0142] A prs fragment was excised from the plasmid carrying the prs
of about 1 kb cloned in Section 1) by SalI and SphI digestion, and
inserted between the SalI and SphI sites of the multi-cloning site
of a plasmid for introducing mutation, pKF19k (Takara Shuzo) to
obtain the target clone (pKFprs). S. G. Bower et al. (J. Biol.
Chem., 264, 10287 (1989)) has suggested that PRPP synthetase (Prs)
is subjected to feedback inhibition by AMP and ADP. It is also
described that the enzyme whose Asp (D) at position 128 is mutated
to Ala (A) is partially desensitized. Therefore, the following
synthetic DNA primer was prepared for gene substitution realizing
mutation of Asp (D) at position 128 PRPP synthetase (Prs) to Ala
(A), and pKFprs was subjected to site-directed mutagenesis
according to the protocol of Site-directed Mutagenesis System
Mutan-Super Express Km (Takara Shuzo) to introduce a site-directed
mutation into the pKFprs.
Primer for D128A Mutation:
[0143] 5'-GCGTGCAGAGCCACTATCAGC-31 (SEQ ID NO: 28)
[0144] After the mutagenesis, 12 clones were randomly picked up
from the resulting transformants, and plasmids were produced from
them. By nucleotide sequencing of the plasmids around the locations
where the mutations were introduced, it was confirmed that 9 clones
of target mutants were obtained. The prs fragment was excised with
SalI and SphI from pKFprsDA having the mutant type prs, and
inserted between the SalI site and the SphI site of pUC18 and
pSTV18 (Takara Shuzo). For using the wild type prs as a control,
the prs fragment was excised with SalI and SphI from pUCprs
constructed in the above, and inserted between the SalI site and
the SphI site of pSTV18 (Takara Shuzo). Each of the plasmids
pUCprsDA and pSTVprsDA and the plasmids pUCprs and pSTVprs has an
inserted mutant prs or wild type prs downstream of the lacp/o
(promoter of lactose operon) derived from pUC18 and pSTV18,
respectively, and the prs is expressed under the control of this
promoter.
[0145] Recombinant bacteria obtained by transforming E. coli JM109
cells with the above four plasmids were cultured in LB liquid
medium for eight hours, and collected, and crude enzyme extracts
were prepared from them. The PRPP synthetase activity of the
extracts and degrees of inhibition by ADP were measured according
to the method of K. F. Jensen et al. (Analytical Biochemistry, 98,
254-263 (1979)) which was partially modified. Specifically,
[a-.sup.32P]ATP was used as the substrate and [.sup.32P]AMP
produced by the reaction was measured. The results are shown in
Table 12. TABLE-US-00015 TABLE 12 PRPP synthetase (Prs) activity
Specific activity (nmole/min/mg crude enzyme extract) Host Plasmid
Property None 5 mM ADP JM109 pUC18 Control 2.9 ND JM109 pUCprs High
copy, 75.9 ND wild type JM109 pUCprsDA High copy, 80.8 20.2 mutant
type JM109 pSTVprs Medium copy, 11.5 ND wild type JM109 pSTVprsDA
Medium copy, 10.6 2.7 mutant type
3) Evaluation of Purine Nucleoside-Producing Ability of
Desensitized Type prs Plasmid-Introduced Strain
[0146] Strains each having two plasmids simultaneously were made by
introducing pKFpurFKQ into the strain FADRaddeddyicPpgi
(purF.sup.-, purA.sup.-, deoD.sup.-, purR.sup.-, add.sup.-,
edd.sup.-, yicP.sup.-, pgi.sup.-) bred in Example 9, Section 3) to
obtain a transformant and further each introducing pSTVprs and
pSTVprsDA carrying prs and prsDA genes into the transformant, and
purine nucleoside-producing abilities of the strains were
evaluated. The basal medium and the culture method for the purine
nucleoside production and the analysis method were the same as
Example 1 provided that the amount of yeast extract in the MS
medium was increased to 0.4%.
[0147] The results of the evaluation of the purine
nucleoside-producing ability are shown in Table 13. By introduction
of mutant prsDA as a plasmid, an effect of improvement in inosine
production was observed. TABLE-US-00016 TABLE 13 Evaluation of
purine nucleoside-producing ability Purine nucleoside accumulation
Inosine Hypoxanthine Host Plasmid (mg/L) (mg/L) FADRaddeddyicPpgi
pKFpurFKQ 1600 8 pKFpurFKQ+ 1450 3 pSTVprs pKFpurFKQ+ 1815 10
pSTVprsDA
Example 11
1) Breeding of Strain Deficient in Xanthosine Phosphorylase Gene
(xapA)
[0148] A gene inactivated by mutation was constructed in one step
by Cross-over PCR using four primers prepared based on the
information obtained through searching of a gene data bank (E. coli
Gene Bank) using "xapA" as a key word. The used primers are as
follows: [0149] N-out: 5'-CGCGGATCCGCGACATAGCCGTTGTCGCC-3' (SEQ ID
NO: 29) [0150] N-in: 5'-CCCATCCACTAAACTTAAACATCGTGGCGTGAAATCAGG-3'
(SEQ ID NO: 30) [0151] C-in:
5'-TGTTTAAGTTTAGTGGATGGGCATCAACCTTATTTGTGG-3' (SEQ ID NO: 31)
[0152] C-out: 5'-CGCAAGCTTCAAACTCCGGGTTACGGGCG-3' (SEQ ID NO:
32)
[0153] First, PCR was carried out (94.degree. C., 30 sec;
55.degree. C., 1 min; 72.degree. C., 2 min; 30 cycles; Gene Amp PCR
System Model 9600, Perkin Elmer) by using the chromosome DNA of the
strain W3110 and primers N-out (29-mer) and N-in (39-mer) as well
as primers C-in (39-mer) and C-out (29-mer) for both ends, to
obtain two PCR products (both are fragments of about 850 bp),
respectively. Then, PCR was again carried out by using a mixture of
the two PCR products as a template and the primers N-out and C-out
for both ends, to amplify a gene fragment in which the gene region
including the xapA structural gene region was shortened from a
fragment of about 2.4 kb (size of wild type) to a fragment of about
1.7 kb. A BamHI site and a HindIII site are provided in the PCR
primers N-out and C-out, respectively. This PCR product was
digested with BamHI and HindIII, and the obtained fragment was
ligated by T4 DNA ligase with a plasmid obtained by digesting
pMAN997, which is a vector for homologous recombination having a
temperature-sensitive replication origin (tsori) (describe above),
with BamHI and HindIII. Competent cells of E. coli JM109 were
transformed with this ligation solution, and transformants grown on
LB agar plates containing 25 .mu.g/ml of ampicillin were obtained.
Plasmid DNAs were prepared from the transformants of 10 clones, and
a plasmid DNA from which a fragment of about 1.7 kp was excised by
BamHI and HindIII digestion (pMAN997xapA'#1) was selected from the
plasmid DNAs. The xapA contained in this plasmid has a deletion of
about 700 bp in the structural gene, and therefore it is predicted
that the encoded enzyme lacks its function (FIG. 3).
[0154] The strain FADRaddeddyicPpgi (purF.sup.-, purA.sup.-,
deoD.sup.-, purR.sup.-, add.sup.-, edd.sup.-, yicP.sup.-,
pgi.sup.-) was transformed at 30.degree. C. with the plasmid
pMAN997xapA'#1, and some of the obtained colonies were streaked on
LB agar plates containing 25 .mu.g/ml of ampicillin, and cultured
at 30.degree. C. overnight. Then, the cultured bacterial cells were
plated on LB agar plates containing 25 .mu.g/ml of ampicillin so
that single colonies should be obtained, to obtain colonies grown
at 42.degree. C. The procedure for obtaining single colonies grown
at 42.degree. C. was repeated once, and clones in which the whole
plasmid was integrated into the chromosome through homologous
recombination were selected. It was confirmed that these clones did
not have the plasmid in their cytoplasm. Then, several clones among
these clones were streaked on LB agar plates, cultured at
30.degree. C. overnight, then inoculated into LB liquid medium (3
ml/test tube), and cultured at 42.degree. C. for 3 to 4 hours with
shaking. The culture was appropriately diluted so that single
colonies should be obtained (about 10.sup.-5 to 10.sup.-16
dilution), plated on LB agar plates, and cultured at 42.degree. C.
overnight to obtain colonies. One hundred colonies were randomly
picked up from the emerged colonies, and each allowed to grow on LB
agar plates and LB agar plates containing 25 .mu.g/ml of
ampicillin, respectively, and ampicillin-sensitive clones grown
only on the LB agar plates were selected. The xapA region were
amplified by PCR using the above PCR primers N-out and C-out from
the chromosome DNA of these target clones, and the clones in which
the size of the amplified fragment was about 1.7 kb were selected.
The clones were considered strains deficient in xapA, and
designated as FADRaddeddyicPpgixapA (purF.sup.-, purA.sup.-,
deoD.sup.-, purR.sup.-, add.sup.-, edd.sup.-, yicP.sup.-,
pgi.sup.-, xapA.sup.-). In the strain deficient in xapA, xanthine
production in a medium was not observed by culture with xanthosine
supplemented, and it was confirmed that xanthosine phosphorylase
was not induced. The xanthosine phosphorylase activity was measured
according to the method of K. Hammer Jespersen et al. (Molec. Gen
Genet., 179, 341-348 (1980)).
2) Evaluation of Purine Nucleoside-Producing Ability of
Desensitized Type purF Plasmid-Introduced Strain
[0155] A transformant was produced by introducing pKFpurFKQ into
the strain FADRaddeddyicPpgixapA (purF.sup.-, purA.sup.-,
deoD.sup.-, purR.sup.-, add.sup.-, edd, yicP.sup.-, pgi.sup.-,
xapA.sup.-) bred in Section 1), and purine nucleoside-producing
ability of the strain was evaluated. The basal medium and the
culture method for the purine nucleoside production and the
analysis method were the same as Example 1 provided that the MS
medium in which the amount of yeast extract was increased to 0.8%
was used.
[0156] The results of the evaluation of the purine
nucleoside-producing ability are shown in Table 14. When the amount
of yeast extract in the MS medium was increased, by-production of
hypoxanthine which remarkably occurred after sugar consumption in
the latter half of the culture was reduced by deficiency of xapA,
and improvement of inosine production was observed. TABLE-US-00017
TABLE 14 Evaluation of purine nucleoside-producing ability Purine
nucleoside Culture accumulation period Inosine Hypoxanthine Host
Plasmid (days) (mg/L) (mg/L) FADRaddeddyicPpgi pKFpurFKQ 3 4640 146
6 1850 1500 FADRaddeddyicPpgi- pKFpurFKQ 3 5870 57 xapA 6 3810
915
Example 12
1) Breeding of Strain Deficient in Nucleoside Permease Gene
(nupG)
[0157] PCR was carried out (94.degree. C., 30 sec; 55.degree. C., 1
min; 72.degree. C., 2 min; 30 cycles; Gene Amp PCR System Model
9600, Perkin Elmer) by using the chromosome DNA of the strain W3110
as a template and 35-mer primers for both ends, having nucleotide
sequences of CTCGAATTCATGGTGCCGAACCACCTTGATAAACG (SEQ ID NO: 33)
and CTCGTCGACATGCCGAAACCGGCGAATATAGCGAC (SEQ ID NO: 34), and
prepared based on the information of a gene data bank (E. coli Gene
Bank), to amplify a fragment of about 2.7 kb of an nupG structural
gene region covering SD-ATG and the translation termination codon.
An EcoRI site and a SalI site are respectively provided in the PCR
primers The amplified fragment was digested with EcoRI, SalI and
AflII. Since the PCR-amplified fragment contained two AflII sites,
three fragments of about 750 bp, 820 bp and 1130 bp were formed.
The two fragments of about 720 bp and 1130 bp other than the AflII
fragment of about 820 bp were collected and were ligated by T4 DNA
ligase with DNA obtained by digesting pUC18 vector (Takara Shuzo)
with EcoRI and SalI. Competent cells of E. coli HB101 were
transformed with this ligation solution, and plasmid DNAs were
prepared from 16 of the emerged colonies, and a plasmid DNA in
which a fragment digested with EcoRI and SalI was of about 1.9 kb
(pUC18nupG'#1) was selected from the plasmid DNAs. The pUC18nupG'#1
was digested with EcoRI and SalI, and the resulting fragment of
about 1.9 kb was ligated by T4 DNA ligase with a plasmid obtained
by digesting pMAN997, which is a vector for homologous
recombination having a temperature-sensitive replication origin
(tsori) (described above), with EcoRI and SalI. Competent cells of
E. coli JM109 were transformed with this ligation solution, and
transformants grown on LB agar plates containing 25 .mu.g/ml of
ampicillin were obtained. Plasmid DNAs were prepared from the
transformants of 10 clones, and a plasmid DNA from which a fragment
of about 1.9 kp was excised by EcoRI and SalI digestion
(pMAN997nupG'#1) was selected from the plasmid DNAs. The nupG
contained in this plasmid DNA has a deletion of about 820 bp in the
structural gene, and therefore it is predicted that the encoded
enzyme lacks its function (FIG. 3).
[0158] The strain FADRaddeddyicPpgi (purF.sup.-, purA.sup.-,
deoD.sup.-, purR.sup.-, adds, edd.sup.-, yicP.sup.-, pgi.sup.-) was
transformed at 30.degree. C. with the plasmid pMAN997nupG'#1, and
some of the obtained colonies were streaked on LB agar plates
containing 25 .mu.g/ml of ampicillin, and cultured at 30.degree. C.
overnight. Then, the cultured bacterial cells were plated on LB
agar plates containing 25 .mu.g/ml of ampicillin so that single
colonies should be obtained, to obtain colonies grown at 42.degree.
C. The procedure for obtaining single colonies grown at 42.degree.
C. was repeated once, and clones in which the whole plasmid was
integrated into the chromosome through homologous recombination
were selected. It was confirmed that these clones did not have the
plasmid in their cytoplasm. Then, several clones among these clones
were streaked on LB agar plates, cultured at 30.degree. C.
overnight, then inoculated into LB liquid medium (3 ml/test tube),
and cultured at 42.degree. C. for 3 to 4 hours with shaking. The
culture was appropriately diluted so that single colonies should be
obtained (about 10.sup.-5 to 10.sup.-6 dilution), plated on LB agar
plates, and cultured at 42.degree. C. overnight to obtain colonies.
One hundred colonies were randomly picked up from the emerged
colonies, and each allowed to grow on LB agar plates and LB agar
plates containing 25 .mu.g/ml of ampicillin, respectively, and
ampicillin-sensitive clones grown only on the LB agar plates were
selected. The nupG region were amplified by PCR using the above PCR
primers from the chromosome DNA of these target clones, and clones
in which the size of the amplified fragment was about 1.9 kb were
selected. These clones were considered strains deficient in nupG,
and designated as FADRaddeddyicPpginupG (purF.sup.-, purA.sup.-,
deoD.sup.-, purR.sup.-, add.sup.-, edd.sup.-, yicP.sup.-,
pgi.sup.-, nupG.sup.-).
2) Evaluation of Purine Nucleoside-Producing Ability of
Desensitized Type purF-Introduced Strain
[0159] A transformant was made by introducing pKFpurFKQ into the
strain FADRaddeddyicPpginupG (purF.sup.-, purA.sup.-, deoD.sup.-,
purR.sup.-, add.sup.-, edd.sup.-, yicP.sup.-, pgi.sup.-,
nupG.sup.-) bred in Section 1), and purine nucleoside-producing
ability of the strain was evaluated. The basal medium and the
culture method for the purine nucleoside production and the
analysis method were the same as Example 1 provided that the MS
medium in which the amount of yeast extract was increased to
1.2%.
[0160] The results of the evaluation of the purine
nucleoside-producing ability are shown in Table 15. When the amount
of yeast extract in the MS medium was increased, by-production of
hypoxanthine which remarkably occurred after sugar consumption in
the latter half of the culture was reduced and improvement of
inosine production was observed by deficiency of nupG.
TABLE-US-00018 TABLE 15 Evaluation of purine nucleoside-producing
ability Purine nucleoside accumulation Inosine Hypoxanthine Host
Plasmid (mg/L) (mg/L) FADRaddeddyicPpgi pKFpurFKQ 1190 835
FADRaddeddyicPpginupG pKFpurFKQ 3390 315
INDUSTRIAL APPLICABILITY
[0161] According to the present invention, a purine
nucleoside-producing bacterium is created by derepressing and
desensitizing an enzyme which subjected to the control in purine
nucleoside biosynthesis and further blocking a decomposition system
and a conversion system. The created purine nucleoside-producing
bacterium can be suitably used for production of a purine
nucleoside by fermentation.
Sequence CWU 1
1
34 1 29 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 1 ctcctgcaga acgaggaaaa agacgtatg 29 2 31 DNA
Artificial Sequence Description of Artificial SequenceSynthetic DNA
2 ctcaagcttt catccttcgt tatgcatttc g 31 3 31 DNA Artificial
Sequence Description of Artificial SequenceSynthetic DNA 3
ctcgagctca tgggtaacaa cgtcgtcgta c 31 4 31 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 4 ctcgtcgact
tacgcgtcga acgggtcgcg c 31 5 30 DNA Artificial Sequence Description
of Artificial SequenceSynthetic DNA 5 ctcgtcgacg cgggtctgga
actgttcgac 30 6 31 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 6 ctcgcatgcc cgtgctttac caaagcgaat
c 31 7 29 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 7 ctcgtcgacg aaagtagaag cgtcatcag 29 8 28 DNA
Artificial Sequence Description of Artificial SequenceSynthetic DNA
8 ctcgcatgct taacgacgat agtcgcgg 28 9 27 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 9 gggcttcgtt
cagaaccgct atgttgg 27 10 31 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 10 tatggtattg atatgtggag
cgccacggaa c 31 11 29 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 11 ctcgtcgacg gctggatgcc ttacgcatc
29 12 29 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 12 ctcgcatgca gtcagcacgg tatatcgtg 29 13 29
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 13 ctcaagcttg tctgatttat cacatcatc 29 14 23 DNA Artificial
Sequence Description of Artificial SequenceSynthetic DNA 14
ctcgagctca tgaaatttcc cgg 23 15 21 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 15 ctcggatccg
gtaccatgct g 21 16 32 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 16 ctcggtaccc tgttgcgtta
agccatccca ga 32 17 29 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 17 ctcgcatgcc aacgtacggc attaaccta
29 18 29 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 18 ctcaagctta cggctctggt ccacgccag 29 19 29
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 19 ctcctgcagc agcgttggga gattacagg 29 20 29 DNA Artificial
Sequence Description of Artificial SequenceSynthetic DNA 20
ctcgaattcg gatatctgga agaagaggg 29 21 29 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 21 ctcaagcttg
gaatagtccc ttcggtagc 29 22 29 DNA Artificial Sequence Description
of Artificial SequenceSynthetic DNA 22 ctcgtcgact ccattttcag
ccttggcac 29 23 29 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 23 ctcgcatgcg tcgcatcagg catcggttg
29 24 29 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 24 ctcctgcagc gacgttttct tttatgaca 29 25 29
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 25 ctcaagcttc gtaactggtg acttttgcc 29 26 38 DNA Artificial
Sequence Description of Artificial SequenceSynthetic DNA 26
ctcgtcgact gcctaaggat cttctcatgc ctgatatg 38 27 29 DNA Artificial
Sequence Description of Artificial SequenceSynthetic DNA 27
ctcgcatgcg ccgggttcga ttagtgttc 29 28 21 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 28 gcgtgcagag
ccactatcag c 21 29 29 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 29 cgcggatccg cgacatagcc gttgtcgcc
29 30 39 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 30 cccatccact aaacttaaac atcgtggcgt gaaatcagg
39 31 39 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 31 tgtttaagtt tagtggatgg gcatcaacct tatttgtgg
39 32 29 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 32 cgcaagcttc aaactccggg ttacgggcg 29 33 35
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 33 ctcgaattca tggtgccgaa ccaccttgat aaacg 35 34 35 DNA
Artificial Sequence Description of Artificial SequenceSynthetic DNA
34 ctcgtcgaca tgccgaaacc ggcgaatata gcgac 35
* * * * *