U.S. patent application number 11/456261 was filed with the patent office on 2007-07-05 for human prostate specific g-protein receptor hpraj70.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Yi Li, Craig A. Rosen, Steven M. Ruben, Daniel R. Soppet.
Application Number | 20070154474 11/456261 |
Document ID | / |
Family ID | 27489550 |
Filed Date | 2007-07-05 |
United States Patent
Application |
20070154474 |
Kind Code |
A1 |
Soppet; Daniel R. ; et
al. |
July 5, 2007 |
Human Prostate Specific G-Protein Receptor HPRAJ70
Abstract
The present invention relates to PSGR, a novel prostate specific
gene with homology to a G-protein coupled receptor overexpressed in
prostate cancer. More specifically, the invention relates to PSGR
polynucleotides and the polypeptides encoded by these
polynucleotides, and the use of PSGR polynucleotides and
polypeptides for detecting disorders of the reproductive system,
including disorders of the prostate, particularly the presence of
cancer. This invention relates to PSGR polynucleotides and
polypeptides as well as vectors, host cells, antibodies directed to
PSGR polynucleotides and polypeptides and recombinant and synthetic
methods for producing the same. Also provided are methods for
diagnosing, treating, preventing, and/or prognosing disorders
related to the prostate, including cancer. The invention further
relates to screening methods for identifying agonists and
antagonists of PSGR polynucleotides and polypeptides of the
invention and methods and/or compositions for inhibiting or
enhancing the production and/or function of the PSGR polypeptides
of the present invention.
Inventors: |
Soppet; Daniel R.;
(Centreville, VA) ; Li; Yi; (Sunnyvale, CA)
; Rosen; Craig A.; (Laytonsville, MD) ; Ruben;
Steven M.; (Brookeville, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC.;INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
27489550 |
Appl. No.: |
11/456261 |
Filed: |
July 10, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10968294 |
Oct 20, 2004 |
|
|
|
11456261 |
Jul 10, 2006 |
|
|
|
09968033 |
Oct 2, 2001 |
6824993 |
|
|
10968294 |
Oct 20, 2004 |
|
|
|
09339115 |
Jun 24, 1999 |
6372891 |
|
|
10968294 |
Oct 20, 2004 |
|
|
|
09053303 |
Apr 1, 1998 |
5948890 |
|
|
09339115 |
Jun 24, 1999 |
|
|
|
08465980 |
Jun 6, 1995 |
5756309 |
|
|
09053303 |
Apr 1, 1998 |
|
|
|
60237275 |
Oct 3, 2000 |
|
|
|
Current U.S.
Class: |
424/143.1 ;
435/320.1; 435/325; 435/6.14; 435/69.1; 530/350; 530/388.22;
536/23.5 |
Current CPC
Class: |
A61K 2039/505 20130101;
C07K 16/28 20130101; C07K 2317/622 20130101; A61K 38/00 20130101;
A61K 39/00 20130101; C07K 14/705 20130101 |
Class at
Publication: |
424/143.1 ;
435/006; 435/069.1; 435/320.1; 435/325; 530/350; 530/388.22;
536/023.5 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C12Q 1/68 20060101 C12Q001/68; C12P 21/06 20060101
C12P021/06; C07K 14/72 20060101 C07K014/72; C07H 21/04 20060101
C07H021/04 |
Claims
1. An isolated nucleic acid molecule comprising a polynucleotide
having a nucleotide sequence at least 95% identical to a sequence
selected from the group consisting of: (a) a nucleotide sequence
encoding a polypeptide comprising amino acids from about 1 to about
320 in SEQ ID NO:2; (b) a nucleotide sequence encoding a
polypeptide comprising amino acids from about 1 to about 320 in SEQ
ID NO:4; (c) a nucleotide sequence encoding a polypeptide
comprising amino acids from about 2 to about 320 in SEQ ID NO:2;
(d) a nucleotide sequence encoding a polypeptide comprising amino
acids from about 2 to about 320 in SEQ ID NO:4; (e) a nucleotide
sequence encoding PSGR having the amino acid sequence encoded by
cDNA HPRAJ80 clone contained in ATCC Deposit No. 97131; (f) a
nucleotide sequence encoding any one of the PSGR extracellular
domain; (g) a nucleotide sequence encoding any one of the PSGR
transmembrane domain; (h) a nucleotide sequence encoding any one of
the PSGR intracellular domain; (i) a nucleotide sequence encoding
any one of the PSGR extracellular and intracellular domains with
all or part of the transmembrane domain deleted; and (j) a
nucleotide sequence complementary to any of the nucleotide
sequences in (a), (b), (c), (d), (e), (f), (g), (h), or (i).
2. The nucleic acid molecule of claim 1, wherein said
polynucleotide has the nucleotide sequence in SEQ ID NO:1.
3. The nucleic acid molecule of claim 1, wherein said
polynucleotide has the nucleotide sequence in SEQ ID NO:3.
4. The nucleic acid molecule of claim 1, wherein said
polynucleotide has the nucleotide sequence in SEQ ID NO:1 encoding
the full length PSGR polypeptide having the amino acid sequence in
SEQ ID NO:2.
5. The nucleic acid molecule of claim 1, wherein said
polynucleotide has the nucleotide sequence in SEQ ID NO:3 encoding
the full length PSGR polypeptide having the amino acid sequence in
SEQ ID NO:4.
6. The nucleic acid molecule of claim 1, wherein said
polynucleotide has the nucleotide sequence in SEQ ID NO:1 encoding
a PSGR extracellular domain having the amino acid sequence in SEQ
ID NO:2.
7. The nucleic acid molecule of claim 1, wherein said
polynucleotide has the complete nucleotide sequence of a cDNA clone
contained in ATCC Deposit No. 97131.
8. The nucleic acid molecule of claim 1, wherein said
polynucleotide has the nucleotide sequence encoding the full length
PSGR having the amino acid sequence encoded by a cDNA clone
contained in ATCC Deposit No. 97131.
9. An isolated nucleic acid molecule comprising a polynucleotide
which hybridizes under stringent hybridization conditions to a
polynucleotide having a nucleotide sequence identical to a
nucleotide sequence in (a), (b), (c), (d), (e), (f), (g), or (h) of
claim 1, wherein said polynucleotide which hybridizes does not
hybridize under stringent hybridization conditions to a
polynucleotide having a nucleotide sequence consisting of only A
residues or of only T residues.
10. An isolated nucleic acid molecule comprising a polynucleotide
which encodes the amino acid sequence of an epitope-bearing portion
of PSGR having an amino acid sequence in (a), (b), (c), (d), (e),
(f), (g), (h), or (i) of claim 1.
11. A recombinant vector comprising the polynucleotide of claim 1,
wherein said polynucleotide is DNA.
12. A recombinant host cell transformed with the vector of claim
11.
13. A recombinant method for producing a PSGR polypeptide,
comprising culturing the recombinant host cell of claim 12 under
conditions such that said polypeptide is expressed, and recovering
said polypeptide.
14. An isolated PSGR polypeptide having an amino acid sequence at
least 95% identical to a sequence selected from the group
consisting of: (a) amino acids from about 1 to about 320 in SEQ ID
NO:2; (b) amino acids from about 1 to about 320 in SEQ ID NO:4; (c)
amino acids from about 2 to about 320 in SEQ ID NO:2; (d) amino
acids from about 2 to about 320 in SEQ ID NO:4; (e) the amino acid
sequence of the full length PSGR polypeptide having the amino acid
sequence encoded by cDNA HPRAJ80 clone contained in ATCC Deposit
No. 97131; (f) the amino acid sequence of any one of the PSGR
extracellular domain; (g) the amino acid sequence of any one of the
PSGR transmembrane domain; (h) the amino acid sequence of any one
of the PSGR intracellular domain; (i) the amino acid sequence of
any one of the PSGR extracellular and intracellular domains with
all or part of the transmembrane domain deleted; and (j) the amino
acid sequence of an epitope-bearing portion of any one of the
polypeptides of (a), (b), (c), (d), (e), (f), (g), (h), and
(i).
15. An isolated antibody that binds specifically to a PSGR
polypeptide of claim 14.
16. A method of treating diseases and disorders of the prostate
comprising administering an effective amount of the polypeptide as
claimed in claim 14, or an agonist thereof to a patient in need
thereof.
17. A method of treating diseases and disorders of the prostate
comprising administering to a patient in need thereof an effective
amount of an antagonist of the polypeptide as claimed in claim 14
to a patient in need thereof.
18. A vaccine comprising the polypeptide of claim 14, in
combination with a pharmaceutical carrier.
19. A pharmaceutical composition comprising: (a) the antibody of
claim 15, and (b) a pharmaceutically acceptable carrier.
20. A method of diagnosing diseases and disorders of the prostate
comprising using the polynucleotide of claim 9 to determine the
level of PSGR mRNA in a biological sample, wherein an increase or
decrease in the level of PSGR mRNA compared to the standard is
indicative of a prostate disease or disorder.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 10/968,294, filed Oct. 20, 2004, which is a divisional of U.S.
application Ser. No. 09/968,033, filed Oct. 2, 2001, now U.S. Pat.
No. 6,824,993, issued Nov. 30, 2004, which claims benefit of U.S.
Provisional Application No. 60/237,275, filed Oct. 3, 2000, and
U.S. application Ser. No. 09/968,033, now U.S. Pat. No. 6,824,993,
issued Nov. 30, 2004, is a Continuation-in-Part of U.S. application
Ser. No. 09/339,115, filed Jun. 24, 1999, now U.S. Pat. No.
6,372,891, issued Apr. 16, 2002, which is a divisional of U.S.
application Ser. No. 09/053,303, filed Apr. 1, 1998, now U.S. Pat.
No. 5,948,890, issued Sep. 7, 1999, which is a divisional of U.S.
application Ser. No. 08/465,980, filed Jun. 6, 1995, now U.S. Pat.
No. 5,756,309, issued May 26, 1998, each of which is hereby
incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION
[0002] 1. Field of thte Invention
[0003] The present invention relates to PSGR, a novel prostate
specific gene with homology to a G-protein coupled receptor
overexpressed in prostate cancer. More specifically, the invention
relates to PSGR polynucleotides and the polypeptides encoded by
these polynucleotides, and the use of PSGR polynucleotides and
polypeptides for detecting disorders of the reproductive system,
including disorders of the prostate, particularly the presence of
cancer. This invention relates to PSGR polynucleotides and
polypeptides as well as vectors, host cells, antibodies directed to
PSGR polynucleotides and polypeptides and recombinant and synthetic
methods for producing the same. Also provided are diagnostic
methods for diagnosing and treating, preventing and/or prognosing
disorders related to the prostate, including cancer, and
therapeutic methods for treating such disorders. The invention
further relates to screening methods for identifying agonists and
antagonists of PSGR polynucleotides and polypeptides of the
invention. The present invention further relates to methods and/or
compositions for inhibiting or enhancing the production and/or
function of the PSGR polypeptides of the present invention.
[0004] 2. Related Art
[0005] Prostate cancer is the most common form of cancer among
males, with an estimated incidence of 30% in men over the age of
50. Overwhelming clinical evidence shows that human prostate cancer
has the propensity to metastasize to bone, and the disease appears
to progress inevitably from androgen dependent to androgen
refractory status, leading to increased patient mortality. This
prevalent disease is currently the second leading cause of cancer
death among men in the U.S.
[0006] In spite of considerable research into therapies for the
disease, prostate cancer remains difficult to treat. Commonly,
treatment is based on surgery and/or radiation therapy, but these
methods are ineffective in a significant percentage of cases. Two
previously identified prostate specific proteins--prostate specific
antigen (PSA) and prostatic acid phosphatase (PAP)--have limited
therapeutic and diagnostic potential. For example, PSA levels do
not always correlate well with the presence of prostate cancer,
being positive in a percentage of non-prostate cancer cases,
including benign prostatic hyperplasia (BPH). Furthermore, PSA
measurements correlate with prostate volume, and do not indicate
the level of metastasis.
[0007] In spite of considerable research into therapies for these
and other cancers, prostate cancer remains difficult to diagnose
and treat effectively. Accordingly, there is a need in the art for
improved methods for detecting and treating such cancers.
[0008] G-protein coupled receptors (GPCRs ) constitute a major
class of proteins responsible for transducing a signal within a
cell. GPCRs have three structural domains: an amino terminal
extracellular domain; a transmembrane domain containing seven
transmembrane segments, three extracellular loops, and three
intracellular loops; and a carboxy terminal intracellular domain.
Upon binding of a ligand to an extracellular portion of a GPCR, a
signal is transduced within the cell that results in a change in a
biological or physiological property of the cell. GPCRs, along with
G-proteins and effectors (intracellular enzymes and channels
modulated by G-proteins), are the components of a modular
signalling system that connects the state of intracellular second
messengers to extracellular inputs.
[0009] GPCRs are a major target for drug action and development.
Accordingly, it is valuable to the field of pharmaceutical
development to identify and characterize previously unknown GPCRS.
The present invention advances the state of the art by providing a
previously unidentified prostate specific seven transmembrane
GPCR.
SUMMARY OF THE INVENTION
[0010] The present invention provides isolated nucleic acid
molecules comprising, or alternatively, consisting of, a
polynucleotide encoding at least a portion of PSGR. Thus, the
present invention provides isolated nucleic acid molecules
comprising, or alternatively, consisting of, a polynucleotide
encoding PSGR having the amino acid sequence shown in FIGS. 1A-B
(SEQ ID NO:2); or the amino acid sequence encoded by the cDNA clone
(HPRAJ70) deposited as American Type Culture Collection ("ATCC")
Deposit No. 97131 on Apr. 18, 1995. The ATCC is located at 10801
University Boulevard, Manassas, Va. 20110-2209.
[0011] The present invention further provides isolated nucleic acid
molecules comprising, or alternatively consisting of, a
polynucleotide encoding PSGR having the amino acid sequence shown
in FIGS. 2A-B (SEQ ID NO:4).
[0012] The present invention also relates to recombinant vectors,
which include the isolated nucleic acid molecules of the present
invention, and to host cells containing the recombinant vectors, as
well as to methods of making such vectors and host cells and for
using them for production of PSGR polypeptides or peptides by
recombinant techniques.
[0013] The invention further provides an isolated PSGR polypeptide
having an amino acid sequence encoded by a polynucleotide described
herein.
[0014] The present invention also provides diagnostic assays such
as quantitative and diagnostic assays for detecting levels of PSGR
protein. Thus, for instance, a diagnostic assay in accordance with
the invention for detecting over-expression of PSGR, or soluble
form thereof, compared to normal control tissue samples may be used
to detect the presence of tumors.
[0015] GPCR genes and gene products are potential causative agents
of disease (Spiegel et al., J. Clin. Invest. 92:1119-1125 (1993);
McKusick et al., J. Med. Genet. 30:1-26 (1993)). Specific defects
in the rhodopsin gene and the V2 vasopressin receptor gene have
been shown to cause various forms of retinitis pigmentosum (Nathans
et al., Ann. Rev. Genet. 26:403-424 (1992)), nephrogenic diabetes
insipidus (Holtzman et al., Hum. Mol. Genet. 2:1201-1204 (1993)).
These receptors are of critical importance to both the central
nervous system and peripheral physiological processes. Evolutionary
analyses suggest that the ancestor of these proteins originally
developed in concert with complex body plans and nervous
systems.
[0016] Thus, the invention further provides cells which express the
PSGR polypeptide with a candidate compound and its ligand, assaying
for inhibiting PSGR mediated signaling induced by said ligand which
involves administering to a cell which expresses the PSGR
polypeptide an effective amount of a PSGR agonist capable of
decreasing PSGR mediated signaling.
[0017] In a further aspect, the present invention is directed to a
method for enhancing PSGR mediated signaling induced by its ligand
which involves administering to a cell which expresses the PSGR
polypeptide an effective amount of a PSGR agonist or antagonist
capable of increasing PSGR mediated signaling.
[0018] Whether any candidate "agonist" or "antagonist" of the
present invention can enhance or inhibit PSGR mediated signaling
can be determined using art-known G-protein coupled ligand/receptor
cellular response assays, including those well known in the art.
Thus, in a further aspect, a screening method is provided for
determining whether a candidate agonist or antagonist is capable of
enhancing or inhibiting a PSGR mediated cellular response to a
ligand. The method involves contacting cellular response, and
comparing the cellular response to a standard cellular response,
the standard being assayed when contact is made with the ligand in
absence of the candidate compound, whereby an increased cellular
response over the standard indicates that the candidate compound is
an agonist of the ligand/receptor signaling pathway and a decreased
cellular response compared to the standard indicates that the
candidate compound is an antagonist of the ligand/receptor
signaling pathway. By the invention, a cell expressing the PSGR
polypeptide can be contacted with either an endogenous or
exogenously administered ligand.
BRIEF DESCRIPTION OF THE FIGURES
[0019] FIGS. 1A-B shows the nucleotide (SEQ ID NO:1) and deduced
amino acid sequence (SEQ ID NO:2) of the PSGR protein. It is
predicted that amino acids 1 to 21 constitute the amino terminal
extracellular domain and amino acids 294 to 320 constitute the
carboxy terminal intracellular domain. The region spanning the
entire transmembrane domain is from about amino acids 22 to about
amino acid 293. Specifically, the seven transmembrane segments are
as follows: from about amino acid 22 to about amino acid 42, from
about amino acid 56 to about amino acid 76, from about amino acid
99 to about amino acid 119, from about amino acid 142 to about
amino acid 162, from about amino acid 198 to about amino acid 218,
from about amino acid 241 to about amino acid 261, and from about
amino acid 273 to about amino acid 293. The amino acids
corresponding to the three extracellular loops are as follows: from
about amino acid 77 to about 98, from about amino acid 163 to about
amino acid 197, and from about amino acid 262 to about amino acid
272. The amino acids corresponding to the three intracellular loops
are as follows: from about amino acid 43 to about amino acid 55,
from about amino acid 120 to about amino acid 141, and from about
amino acid 219 to about amino acid 240. The conserved intracellular
G protein signature sequence, "DRY" is found at amino acids 120 to
122. This sequence is implicated in signal transduction.
[0020] FIGS. 2A-B shows the nucleotide (SEQ ID NO:3) and deduced
amino acid sequence (SEQ ID NO:4) of a variant PSGR protein. It is
predicted that amino acids 1 to 21 constitute the amino terminal
extracellular domain and amino acids 294 to 320 constitute the
carboxy terminal intracellular domain. The region spanning the
entire transmembrane domain is from about amino acids 22 to about
amino acid 293. Specifically, the seven transmembrane segments are
as follows: from about amino acid 22 to about amino acid 42, from
about amino acid 56 to about amino acid 76, from about amino acid
99 to about amino acid 119, from about amino acid 142 to about
amino acid 162, from about amino acid 198 to about amino acid 218,
from about amino acid 241 to about amino acid 261, and from about
amino acid 273 to about amino acid 293. The amino acids
corresponding to the three extracellular loops are as follows: from
about amino acid 77 to about 98, from about amino acid 163 to about
amino acid 197, and from about amino acid 262 to about amino acid
272. The amino acids corresponding to the three intracellular loops
are as follows: from about amino acid 43 to about amino acid 55,
from about amino acid 120 to about amino acid 141, and from about
amino acid 219 to about amino acid 240. The conserved intracellular
G protein signature sequence, "DRY" is found at amino acids 120 to
122. This sequence is implicated in signal transduction.
[0021] FIG. 3 shows the regions of similarity between the amino
acid sequences of the PSGR (SEQ ID NO:2), and the human HGMP071
olfactory receptor (SEQ ID NO:5). Regions of identity are
shaded.
[0022] FIG. 4 shows an analysis of the PSGR amino acid sequence.
Alpha, beta, turn and coil regions; hydrophilicity and
hydrophobicity; amphipathic regions; flexible regions; antigenic
index and surface probability are shown, and all were generated
using the default settings. In the "Antigenic Index or
Jameson-Wolf" graph, the positive peaks indicate locations of the
highly antigenic regions of the PSGR protein, i.e., regions from
which epitope-bearing peptides of the invention can be obtained.
The domains defmed by these graphs are contemplated by the present
invention. In the "Antigenic Index--Jameson-Wolf" graph, amino acid
residues T-50 to H-55, D-87 to E-90, L-227 to R-234, and S-309 to
D-313 in FIGS. 1A-B (SEQ ID NO:2) correspond to the shown highly
antigenic regions of the PSGR protein.
[0023] The data presented in FIG. 4 are also represented in tabular
form in Table I. The columns are labeled with the headings "Res",
"Position", and Roman Numerals I-XIII. The column headings refer to
the following features of the amino acid sequence presented in FIG.
4, and Table I: "Res": amino acid residue of SEQ ID NO:2 and FIGS.
1A-B; "Position": position of the corresponding residue within SEQ
ID NO:2 and FIGS. 1A-B; I: Alpha, Regions--Garnier-Robson; II:
Alpha, Regions--Chou-Fasman; III: Beta, Regions--Garmier-Robson;
IV: Beta, Regions--Chou-Fasman; V: Turn, Regions--Garnier-Robson;
VI: Turn, Regions--Chou-Fasman; VII: Coil, Regions--Garnier-Robson;
VIII: Hydrophilicity Plot--Kyte-Doolittle; IX: Alpha, Amphipathic
Regions--Eisenberg; X: Beta, Amphipathic Regions--Eisenberg; XI:
Flexible Regions--Karplus-Schulz; XII: Antigenic
Index--Jameson-Wolf; and XIII: Surface Probability Plot--Emini.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0024] The present invention provides isolated nucleic acid
molecules comprising, or alternatively consisting of, a
polynucleotide encoding a PSGR polypeptide having the amino acid
sequence shown in FIGS. 1A-B (SEQ ID NO:2). The PSGR polypeptides
of the present invention share sequence homology with G protein
coupled odorant receptor family members (FIG. 3). Specifically,
PSGR shows the closest similarity to a human OR gene, HPFH1OR. The
nucleotide sequence shown in FIGS. 1A-B (SEQ ID NO:1) was obtained
by sequencing the cDNA clone FPRAJ70, which was deposited at the
American Type Culture Collection, and given Accession Number 97131.
The deposited IPRAJ70 clone is inserted in the UniZAP XR plasmid
(Stratagene Cloning Systems, Inc.) using the EcoRI and XhoI
restriction endonuclease cleavage sites.
[0025] The present invention further provides nucleic acid
molecules comprising, or alternatively consisting of, a
polynucleotide encoding a PSGR polypeptide having the amino acid
sequence shown in FIGS. 2A-B (SEQ ID NO:4).
Nucleic Acid Molecules
[0026] The determined nucleotide sequence of the PSGR cDNA of
(FIGS. 1A-B) SEQ ID NO:1 contains an open reading frame of 963
nucleotide base pairs encoding a protein of about 320 amino acid
residues, and a deduced molecular weight of about 35.4 kDa. The
PSGR polypeptides of the invention share the greatest degree of
homology with human G protein coupled odorant family. Specifically,
PSGR showed the closest similarity to a human OR gene, BPFH1OR (SEQ
ID NO:5) (see, FIG. 3), which was mapped to the beta-globin gene
cluster on chromosome 11p15.5. The PSGR protein contains seven
trans-membrane domains between amino acid residues 24 to 293 in SEQ
ID NO:2 that are characteristic of G-protein coupled receptors.
[0027] The determined nucleotide sequence of the PSGR genomic clone
of FIGS. 2A-B (SEQ ID NO:3) is identical to the PSGR cDNA sequence
of FIGS. 1A-B (SEQ ID NO:1) with the following substitutions: at
nucleotide 33 a `T` residue in SEQ ID NO:3 replaces a `G` residue
in SEQ ID NO:1, at nucleotide 116 a `T` residue in SEQ ID NO:3
replaces a `G` residue in SEQ ID NO:1, and at nucleotide 277 a `T`
residue in SEQ ID NO:3 replaces an `A` residue in SEQ ID NO:1.
[0028] The term "PSGR polynucleotides" as used herein is meant to
encompass both of the above described PSGR polynucleotide variants
and fragments thereof. The term "PSGR polypeptides" as used herein
is meant to encompass polypeptides encoded by the above described
variants, and fragments thereof.
[0029] To examine the tissue distribution of PSGR, Northern blot
analysis was performed. Of 23 different human tissue mRNA analyzed,
a 2.7 kb mRNA transcript specifically hybridizing to the PSGR cDNA
was detected only in prostate tissue. In situ RNA hybridization
analysis of PSGR expression in prostate tissues revealed the
expression of PSGR predominantly localized to epithelial cells of
gland (data not shown).
[0030] It will further be appreciated that, the domains described
herein have been predicted by computer analysis, and accordingly,
that depending on the analytical criteria used for identifying
various flnctional domains, the exact "address" of, for example,
the extracellular domain, intracellular domain, and transmembrane
domain of PSGR may differ slightly. For example, the exact location
of the PSGR transmembrane domains in FIGS. 1A-B (SEQ ID NO:2) or
FIGS. 2A-B (SEQ ID NO:4) (e.g., the address may "shift" by about 1
to about 20 residues, more likely about 1 to about 5 residues)
depending on the criteria used to defme the domain. In any event,
as discussed further below, the invention further provides
polypeptides having various residues deleted from the N-terminus
and/or C-terminus of the complete PSGR, including polypeptides
lacking one or more amino acids from the N-termini of the PSGR
extracellular domains described herein, which constitute soluble
forms of the extracellular domain of the PSGR polypeptides
respectively.
[0031] As indicated, nucleic acid molecules of the present
invention may be in the form of RNA, such as MRNA, or in the form
of DNA, including, for instance, cDNA and genomic DNA obtained by
cloning or produced synthetically. The DNA may be double-stranded
or single-stranded. Single-stranded DNA may be the coding strand,
also known as the sense strand, or it may be the non-coding strand,
also referred to as the anti-sense strand.
[0032] By "isolated" nucleic acid molecule(s) is intended a nucleic
acid molecule, DNA or RNA, which has been removed from its native
environment. For example, recombinant DNA molecules contained in a
vector are considered isolated for the purposes of the present
invention. Further examples of isolated DNA molecules include
recombinant DNA molecules maintained in heterologous host cells or
purified (partially or substantially) DNA molecules in solution.
Isolated RNA molecules include in vivo or in vitro RNA transcripts
of the DNA molecules of the present invention. Isolated nucleic
acid molecules according to the present invention further include
such molecules produced synthetically. However, a nucleic acid
molecule contained in a clone that is a member of a mixed clone
library (e.g., a genomic or cDNA library) and that has not been
isolated from other clones of the library (e.g., in the form of a
homogeneous solution containing the clone without other members of
the library) or a chromosome isolated or removed from a cell or a
cell lysate (e.g., a "chromosome spread", as in a karyotype), is
not "isolated" for the purposes of this invention.
[0033] Isolated nucleic acid molecules of the present invention
include DNA molecules comprising an open reading frame (ORF) shown
in FIGS. 1A-B (SEQ ID NO:1); DNA molecules comprising the coding
sequence for the complete (full-length) PSGR protein shown in FIGS.
1A-B (SEQ ID NO:2); DNA molecules comprising an open reading frame
(ORF) shown in FIGS. 2A-B (SEQ ID NO:3); DNA molecules comprising
the coding sequence for the complete (full-length) PSGR protein
shown in FIGS. 2A-B (SEQ ID NO:4); and DNA molecules which comprise
a sequence substantially different from those described above, but
which, due to the degeneracy of the genetic code, still encode the
PSGR protein. Of course, the genetic code is well known in the art.
Thus, it would be routine for one skilled in the art to generate
such degenerate variants.
[0034] In another aspect, the invention provides isolated nucleic
acid molecules having a polynucleotide sequence encoding the PSGR
polypeptide having an amino acid sequence as encoded by a cDNA
clone contained in the plasmid deposited as ATCC Deposit No. 97131.
The invention further provides an isolated nucleic acid molecule
having the nucleotide sequence shown in FIGS. 1A-B (SEQ ID NO:1),
an isolated nucleic acid molecule having the nucleotide sequence
shown in FIGS. 2A-B (SEQ ID NO:3), or a nucleic acid molecule
having a sequence complementary to one of the above sequences. Such
isolated molecules, particularly DNA molecules, are useful, for
example, as probes for gene mapping by in situ hybridization with
chromosomes, and for detecting expression of the PSGR gene in human
tissue (e.g., in prostate tissue or prostate cancer tissue), for
instance, by hybridization (e.g., Northern blot analysis) or
histochemistry.
[0035] The present invention is further directed to fragments of
the isolated nucleic acid molecules described herein. By a fragment
of an isolated DNA molecule having the nucleotide sequence of the
deposited cDNA or the nucleotide sequence shown in FIGS. 1A-B (SEQ
ID NO:1) or the nucleotide sequence shown in FIGS. 2A-B (SEQ ID
NO:3) is intended DNA fragments at least about 15nt, and more
preferably at least about 20 nt, at least about 24 nt, still more
preferably at least about 30 nt, and even more preferably, at least
about 40 nt, at least about 50 nt, at least about 100 nt, at least
about 150 nt, at least about 200 nt, at least about 250 nt, at
least about 300 nt in length which are useful, for example, as
diagnostic probes and primers as discussed herein. Of course,
larger fragments 350-1500 nt in length are also useful according to
the present invention, as are fragments corresponding to most, if
not all, of the nucleotide sequence of the deposited cDNA plasmids,
or as shown in FIGS. 1A-B (SEQ ID NO:1), or as shown in FIGS. 2A-B
(SEQ ID NO:3), or the complementary strand thereto. By a fragment
at least 20 nt in length, for example, is intended fragments which
include 20 or more contiguous bases from the nucleotide sequence of
the deposited cDNA or the nucleotide sequence as shown in FIGS.
1A-B (SEQ ID NO:1) or the nucleotide sequence as shown in FIGS.
2A-B (SEQ ID NO:3). In this context "about" includes the
particularly recited size, larger or smaller by several (5, 4, 3,
2, or 1) nucleotides, at either terminus or at both termini.
[0036] Representative examples of PSGR polynucleotide fragments of
the invention include, for example, fragments that comprise, or
alternatively, consist of, a sequence from about nucleotide 274 to
336, 337 to 399, 400 to 438, 439 to 501, 502 to 567, 568 to 630,
631 to 696, 697 to 759, 760 to 864, 865 to 927, 928 to 993, 994 to
1056, 1057 to 1089, 1090 to 1152, 1153 to 1233 of FIGS. 1A-B (SEQ
ID NO:1), or FIGS. 2A-B (SEQ ID NO:3) or the complementary strand
thereto, or the cDNA contained in one of the deposited cDNA clones.
In this context "about" includes the particularly recited ranges,
larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at
either terminus or at both termini.
[0037] Preferably, the polynucleotide fragments of the invention
encode a polypeptide which demonstrates a PSGR functional activity.
By a polypeptide demonstrating a PSGR "functional activity" is
meant, a polypeptide capable of displaying one or more known
functional activities associated with a full-length (complete) PSGR
protein. Such functional activities include, but are not limited
to, biological activity, antigenicity (ability to bind (or compete
with a PSGR polypeptide for binding) to an anti-PSGR antibody),
immunogenicity (ability to generate antibody which binds to a PSGR
polypeptide), ability to form multimers with PSGR polypeptides of
the invention, and ability to bind to a receptor or ligand for a
PSGR polypeptide.
[0038] The functional activity of PSGR polypeptides, and fragments,
variants derivatives, and analogs thereof, can be assayed by
various methods.
[0039] For example, in one embodiment where one is assaying for the
ability to bind or compete with full-length PSGR polypeptides for
binding to anti-PSGR antibody various immunoassays known in the art
can be used, including but not limited to, competitive and
non-competitive assay systems using techniques such as
radioimmunoassays, ELISA (enzyme linked immunosorbent assay),
"sandwich" immunoassays, immunoradiometric assays, gel diffusion
precipitation reactions, immunodiffusion assays, in situ
immunoassays (using colloidal gold, enzyme or radioisotope labels,
for example), western blots, precipitation reactions, agglutination
assays (e.g., gel agglutination assays, hemagglutination assays),
complement fixation assays, immunofluorescence assays, protein A
assays, and immunoelectrophoresis assays, etc. In one embodiment,
antibody binding is detected by detecting a label on the primary
antibody. In another embodiment, the primary antibody is detected
by detecting binding of a secondary antibody or reagent to the
primary antibody. In a further embodiment, the secondary antibody
is labeled. Many means are known in the art for detecting binding
in an immunoassay and are within the scope of the present
invention.
[0040] In another embodiment, where a PSGR ligand is identified, or
the ability of a polypeptide fragment, variant or derivative of the
invention to multimerize is being evaluated, binding can be
assayed, e.g., by means well-known in the art, such as, for
example, reducing and non-reducing gel chromatography, protein
affinity chromatography, and affinity blotting. See generally,
Phizicky, E., et al., Microbiol. Rev. 59:94-123 (1995). In another
embodiment, physiological correlates of PSGR binding to its
substrates (signal transduction) can be assayed.
[0041] In addition, assays described herein (and otherwise known in
the art may routinely be applied to measure the ability of PSGR
polypeptides and fragments, variants derivatives and analogs
thereof to elicit PSGR related biological activity. For example,
techniques described herein and otherwise known in the art may be
applied or routinely modified to assay for the ability of the
compositions of the invention to bind to the PSGR ligand or couple
to G protein.
[0042] Other methods will be known to the skilled artisan and are
within the scope of the invention.
[0043] Preferred nucleic acid fragments of the present invention
include nucleic acid molecules encoding a member selected from the
group: a polypeptide comprising or alternatively, consisting of,
the PSGR transmembrane domain I (amino acid residues from about 22
to about 42 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID
NO:4); a polypeptide comprising, or alternatively consisting of,
the PSGR transmembrane domain II (amino acid residues from about 56
to about 76 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID
NO:4); a polypeptide comprising, or alternatively consisting of the
PSGR transmembrane domain III (amino acid residues from about 99 to
about 119 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4);
a polypeptide comprising, or alternatively consisting of, the PSGR
transmembrane domain IV (amino acid residues from about 142 to
about 162 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4);
a polypeptide comprising, or alternatively consisting of, the PSGR
transmembrane domain V (amino acid residues from about 198 to about
218 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4); a
polypeptide comprising, or alternatively consisting of, the PSGR
transmembrane domain VI (amino acid residues from about 241 to
about 261 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4);
a polypeptide comprising, or alternatively consisting of, a
polypeptide comprising, or alternatively consisting of, the PSGR
transmembrane domain VII (amino acid residues from about 273 to
about 293 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4);
a polypeptide comprising, or alternatively consisting of, the PSGR
extracellular loop I (amino acid residues from about 77 to about 98
in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4); a
polypeptide comprising, or alternatively consisting of, the PSGR
extracellular loop II (amino acid residues from about 163 to about
197 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4); a
polypeptide comprising, or alternatively consisting of, the PSGR
extracellular loop III (amino acid residues from about 262 to about
272 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4); a
polypeptide comprising, or alternatively consisting of, the PSGR
intracellular loop I (amino acid residues from about 43 to about 55
in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4); a
polypeptide comprising, or alternatively consisting of, the PSGR
intracellular loop II (amino acid residues from about 120 to about
141 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4); and/or
a polypeptide comprising, or alternatively consisting of, the PSGR
intracellular loop III (amino acid residues from about 219 to about
240 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4). Since
the location of these domains have been predicted by computer
analysis, one of ordinary skill would appreciate that the amino
acid residues constituting these domains may vary slightly (e.g.,
by about 1 to 15 amino acid residues) depending on the criteria
used to define each domain.
[0044] Preferred nucleic acid fragments of the invention encode a
full-length PSGR polypeptide lacking the nucleotides encoding the
amino terminal methionine in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B
(SEQ ID NO:4), as it is known that the methionine is cleaved
naturally and such sequences may be useful in genetically
engineering PSGR expression vectors. Polypeptides encoded by such
polynucleotides are also contemplated by the invention.
[0045] Preferred nucleic acid fragments of the present invention
flirther include nucleic acid molecules encoding epitope-bearing
portions of the PSGR receptor proteins. In particular, such nucleic
acid fragments of the present invention include nucleic acid
molecules encoding: a polypeptide comprising amino acid residues
from about 50 to about 55 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B
(SEQ ID NO:4); a polypeptide comprising amino acid residues from
about 87 to about 90 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ
ID NO:4); a polypeptide comprising amino acid residues from about
227 to about 234 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID
NO:4); and a polypeptide comprising amino acid residues from about
309 to about 313 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID
NO:4). In this context the inventors have determined that the above
polypeptide fragments are antigenic regions of the PSGR proteins.
Methods for determining other such epitope-bearing portions of the
PSGR proteins are described in detail below.
[0046] In additional embodiments, the polynucleotides of the
invention encode functional attributes of PSGR. Preferred
embodiments of the invention in this regard include fragments that
comprise alpha-helix and alpha-helix forming regions
("alpha-regions"), beta-sheet and beta-sheet forming regions
("beta-regions"), turn and turn-forming regions ("turn-regions"),
coil and coil-forming regions ("coil-regions"), hydrophilic
regions, hydrophobic regions, alpha amphipathic regions, beta
amphipathic regions, flexible regions, surface-forming regions and
high antigenic index regions of PSGR.
[0047] The data representing the structural or functional
attributes of PSGR set forth in FIG. 4 and/or Table I, as described
above, was generated using the various modules and algorithms of
the DNA*STAR set on default parameters. In a preferred embodiment,
the data presented in columns VIII, XII, and XIII of Table I can be
used to determine regions of PSGR which exhibit a high degree of
potential for antigenicity. Regions of high antigenicity are
determined from the data presented in columns VIII, XII, and/or
XIII by choosing values which represent regions of the polypeptide
which are likely to be exposed on the surface of the polypeptide in
an environment in which antigen recognition may occur in the
process of initiation of an immune response.
[0048] Certain preferred regions in these regards are set out in
FIG. 4, but may, as shown in Table I, be represented or identified
by using tabular representations of the data presented in FIG. 4.
The DNA*STAR computer algorithm used to generate FIG. 4 (set on the
original default parameters) was used to present the data in FIG. 4
in a tabular format (See Table I). The tabular format of the data
in FIGS. 4 may be used to easily determine specific boundaries of a
preferred region.
[0049] The above-mentioned preferred regions set out in FIG. 4 and
in Table I include, but are not limited to, regions of the
aforementioned types identified by analysis of the amino acid
sequences set out in FIGS. 1A-B. As set out in FIG. 4 and in Table
I, such preferred regions include Garnier-Robson alpha-regions,
beta-regions, turn-regions, and coil-regions, Chou-Fasman
alpha-regions, beta-regions, and turn-regions, Kyte-Doolittle
hydrophilic regions, Eisenberg alpha- and beta-amphipathic regions,
Karplus-Schulz flexible regions, Jameson-Wolf regions of high
antigenic index and Emini surface-forming regions. TABLE-US-00001
TABLE I Res Position I II III IV V VI VII VIII IX X XI XII XIII Met
1 . . B . . . . 0.08 . . . -0.10 0.36 Ser 2 . . . . T T . -0.23 . .
. 0.50 0.45 Ser 3 . . . . T T . -0.16 . . . 0.20 0.30 Cys 4 . . . .
T T . 0.20 . . . 0.20 0.44 Asn 5 . . . . T T . 0.00 . . . 0.20 0.45
Phe 6 . . . B T . . 0.29 . . . -0.20 0.34 Thr 7 A . . B . . . -0.08
. . . -0.60 0.91 His 8 A . . B . . . -0.63 . . . -0.60 0.30 Ala 9 .
. B B . . . -0.78 . . . -0.60 0.26 Thr 10 . . B B . . . -1.67 . . .
-0.60 0.15 Cys 11 . . B B . . . -1.31 . . . -0.60 0.08 Val 12 . . B
B . . . -1.89 . . . -0.60 0.08 Leu 13 . . B B . . . -2.07 . . .
-0.60 0.04 Ile 14 . . B B . . . -1.82 . . . -0.60 0.11 Gly 15 . . B
B . . . -2.32 . . . -0.60 0.14 Ile 16 . . B B . . . -1.66 * . .
-0.60 0.14 Pro 17 . . . . . . C -0.76 * . F 0.25 0.35 Gly 18 A A .
. . . C -0.53 . . F 0.65 0.70 Leu 19 A A . . . . . 0.32 . * F 0.60
1.01 Glu 20 A A . . . . . -0.03 . . F 0.45 0.89 Lys 21 A A . . . .
. 0.57 * * . 0.30 0.78 Ala 22 A . . B . . . -0.08 . . . -0.30 0.99
His 23 A . . B . . . -0.08 . * . -0.30 0.43 Phe 24 . . B B . . .
0.03 . * . -0.60 0.21 Trp 25 . . B B . . . -0.18 . * . -0.60 0.18
Val 26 A . . B . . . -1.03 * . . -0.60 0.21 Gly 27 . . B B . . .
-1.26 . * . -0.60 0.20 Phe 28 . . . B . . C -1.52 . . . -0.40 0.15
Pro 29 . . . B . . C -1.42 . . . -0.40 0.28 Leu 30 . . . B . . C
-1.38 . . . -0.40 0.28 Leu 31 A . . B . . . -1.38 . . . -0.60 0.50
Ser 32 A . . B . . . -1.89 . . . -0.60 0.24 Met 33 . . B B . . .
-1.78 . . . -0.60 0.22 Tyr 34 . A B B . . . -2.17 . . . -0.60 0.27
Val 35 . A B B . . . -2.02 . . . -0.60 0.20 Val 36 . A B B . . .
-1.56 . . . -0.60 0.11 Ala 37 . A B B . . . -1.26 . . . -0.60 0.07
Met 38 . A B B . . . -1.32 * . . -0.60 0.15 Cys 39 A . . . . T .
-1.97 . . . -0.20 0.10 Gly 40 . . . . T T . -1.97 . . . 0.20 0.07
Asn 41 . . . . T T . -1.97 . . . 0.20 0.05 Cys 42 . . B . . T .
-2.08 . . . -0.20 0.08 Ile 43 . . B B . . . -2.37 . . . -0.60 0.07
Val 44 . . B B . . . -2.56 * * . -0.60 0.03 Val 45 . . B B . . .
-2.10 * * . -0.60 0.04 Phe 46 . . B B . . . -2.41 * * . -0.60 0.11
Ile 47 . . B B . . . -1.74 * . . -0.60 0.22 Val 48 . . B B . . .
-0.74 * . . -0.30 0.51 Arg 49 A . . B . . . -0.19 * . . 0.45 1.14
Thr 50 A . . B . . . -0.14 * . F 1.13 2.19 Glu 51 A . . B . . .
0.52 * * F 1.36 2.43 Arg 52 A . . . . . . 0.82 * . F 1.79 1.69 Ser
53 A . . . . . . 1.47 * * F 1.72 1.18 Leu 54 . . . . . . C 0.76 * .
. 2.30 1.05 His 55 . . . . . . C 0.82 * . . 1.02 0.53 Ala 56 . . .
. . . C 0.01 * . . 0.49 0.62 Pro 57 A . . . . . . -0.80 * . . 0.06
0.62 Met 58 A A . . . . . -1.31 . * . -0.37 0.40 Tyr 59 A A . . . .
. -1.17 . * . -0.60 0.32 Leu 60 A A . . . . . -1.73 . . . -0.60
0.11 Leu 62 A A . . . . . -2.33 . . . -0.60 0.06 Cys 63 A A . . . .
. -2.32 . . . -0.60 0.07 Met 64 A A . . . . . -2.97 . . . -0.60
0.08 Leu 65 A A . . . . . -2.16 . * . -0.60 0.07 Ala 66 A A . . . .
. -2.27 . . . -0.60 0.22 Ala 67 A A . . . . . -2.04 . * . -0.60
0.19 Ile 68 A A . . . . . -2.19 . * . -0.60 0.23 Asp 69 A A . . . .
. -1.89 . * . -0.60 0.19 Leu 70 A A . . . . . -1.39 . * . -0.60
0.25 Ala 71 A A . . . . . -1.10 . * . -0.60 0.51 Leu 72 A A . . . .
. -0.82 . * . -0.30 0.41 Ser 73 A . . . . T . -0.53 . * F -0.05
0.71 Thr 74 A . . . . T . -0.74 . * F -0.05 0.70 Ser 75 . . . . . T
C 0.11 . * F 0.30 1.31 Thr 76 A . . . . T . -0.19 . . F 1.00 1.96
Met 77 . A B . . . . -0.19 . . F -0.15 0.95 Pro 78 . A B . . . .
-0.48 . . F -0.15 0.59 Lys 79 . A B . . . . -0.98 * . . -0.30 0.41
Ile 80 . A B . . . . -1.38 * . . -0.60 0.34 Leu 81 . A B . . . .
-1.36 . . . -0.60 0.19 Ala 82 . A B . . . . -1.46 . * . -0.60 0.10
Leu 83 A A . . . . . -1.24 . * . -0.60 0.12 Phe 84 A A . . . . .
-1.59 * * . -0.60 0.25 Trp 85 A A . . . . . -0.59 . * . -0.60 0.33
Phe 86 A A . . . . . 0.22 . . . -0.60 0.79 Asp 87 A . . . . T .
-0.08 . . F 1.00 1.58 Ser 88 A . . . . T . 0.43 . . F 1.00 1.06 Arg
89 A . . . . T . 0.24 . * F 1.30 1.63 Glu 90 A . . . . T . 0.53 . *
F 1.15 0.69 Ile 91 A A . . . . . 0.64 . * F 0.75 0.89 Ser 92 A A .
. . . . -0.02 . * . 0.60 0.46 Ile 93 A A . . . . . -0.53 . * . 0.30
0.14 Glu 94 A A . . . . . -0.96 . * . -0.60 0.17 Ala 95 A A . . . .
. -0.96 . * . -0.30 0.18 Cys 96 A A . . . . . -0.67 . * . -0.30
0.44 Leu 97 A A . . . . . -1.07 . * . -0.30 0.25 Thr 98 A A . . . .
. -0.88 . * . -0.60 0.22 Gln 99 A A . . . . . -1.77 . . . -0.60
0.35 Met 100 A A . . . . . -1.21 . . . -0.60 0.30 Phe 101 A A . . .
. . -1.13 . . . -0.60 0.28 Phe 102 A A . . . . . -1.13 . . . -0.60
0.16 Ile 103 A A . . . . . -1.12 . . . -0.60 0.14 His 104 A A . . .
. . -1.71 . . . -0.60 0.21 Ala 105 A A . . . . . -2.00 * . . -0.60
0.25 Leu 106 A A . . . . . -1.30 * . . -0.60 0.25 Ser 107 A A . . .
. . -0.90 * . . -0.30 0.31 Ala 108 A A . . . . . -0.32 * * . -0.30
0.42 Ile 109 A A . . . . . -1.18 * . . -0.30 0.73 Glu 110 A A . . .
. . -1.40 . . F -0.15 0.38 Ser 111 A A . . . . . -1.40 . . F -0.45
0.31 Thr 112 A A . . . . . -1.69 . . F -0.45 0.37 Ile 113 A A . . .
. . -1.70 . . . -0.60 0.21 Leu 114 A A . . . . . -1.40 . * . -0.60
0.16 Leu 115 A A . . . . . -2.10 . * . -0.60 0.11 Ala 116 A A . . .
. . -1.80 . . . -0.60 0.14 Met 117 A A . . . . . -1.38 . . . -0.60
0.28 Ala 118 A A . . . . . -0.73 * . . -0.30 0.66 Phe 119 A . . . .
T . -0.78 * . . 0.25 1.02 Asp 120 A . . . . T . -0.56 * . . 0.10
0.76 Arg 121 A . . . . T . -0.86 * . . 0.10 0.76 Tyr 122 A . . . .
T . -0.92 * . . 0.10 0.62 Val 123 A . . B . . . -0.37 * . . -0.30
0.20 Ala 124 A . . B . . . 0.12 * . . -0.60 0.14 Ile 125 A . . B .
. . -0.69 * * . -0.60 0.14 Cys 126 . . B B . . . -0.69 . * . -0.60
0.15 His 127 . . B . . T . -0.48 * * . 0.10 0.29 Pro 128 A . . . .
T . -0.21 * * . 0.10 0.57 Leu 129 A . . . . T . -0.21 * . . 0.25
1.07 Arg 130 A . . . . T . -0.18 * * . 0.10 0.80 His 131 A A . . .
. . -0.32 . * . -0.30 0.38 Ala 132 A A . . . . . -0.29 * * . -0.60
0.38 Ala 133 A A . . . . . -0.08 * * . -0.30 0.31 Val 134 A A . . .
. . 0.42 * * . -0.60 0.37 Leu 135 . . B . . T . -0.54 * . . -0.20
0.53 Asn 136 . . B . . T . -0.82 . . F -0.05 0.39 Asn 137 . . B . .
T . -0.82 . * F -0.05 0.76 Thr 138 . . B . . T . -0.23 . * F -0.05
0.93 Val 139 . . B B . . . -0.27 . * F -0.15 1.00 Thr 140 . . B B .
. . 0.20 . * . -0.60 0.43 Ala 141 . . B B . . . -0.69 . * . -0.60
0.30 Gln 142 . . B B . . . -1.54 . * . -0.60 0.28 Ile 143 . . B B .
. . -1.82 . * . -0.60 0.14 Gly 144 . . B B . . . -1.82 . * . -0.60
0.14 Ile 145 . . B B . . . -2.37 * * . -0.60 0.06 Val 146 . . B B .
. . -1.67 * * . -0.60 0.07 Ala 147 . . B B . . . -2.01 . * . -0.60
0.13 Val 148 . . B B . . . -1.42 . * . -0.60 0.18 Val 149 . . B . .
T . -1.89 . * . 0.10 0.33 Arg 150 . . B . . T . -1.70 * * F 0.25
0.27 Gly 151 . . B . . T . -1.54 . * F -0.05 0.32 Ser 152 . . B . .
T . -1.66 * * F -0.05 0.37 Leu 153 . . B B . . . -1.01 * * . -0.60
0.16 Phe 154 . . B B . . . -0.97 . * . -0.60 0.25 Phe 155 . . B B .
. . -1.29 . * . -0.60 0.16 Phe 156 . . B B . . . -1.76 . . . -0.60
0.29 Pro 157 . . B B . . . -2.27 . . . -0.60 0.28 Leu 158 A A . . .
. . -2.34 . * . -0.60 0.27 Pro 159 A A . . . . . -1.60 * * . -0.60
0.22 Leu 160 A A . . . . . -0.79 * . . -0.60 0.28 Leu 161 A A . . .
. . -0.90 * * . -0.30 0.66 Ile 162 A A . . . . . -1.28 * . . -0.30
0.35 Lys 163 A A . . . . . -1.17 * . . -0.30 0.43 Arg 164 A A . . .
. . -1.62 . . . -0.30 0.45 Leu 165 A A . . . . . -0.84 . . . -0.30
0.35 Ala 166 A A . . . . . -0.33 * . . -0.30 0.24 Phe 167 A A . . .
. . 0.56 * . . -0.60 0.16 Cys 168 A A . . . . . -0.34 * . . -0.60
0.32 His 169 A . . . . T . -1.27 * * . -0.20 0.23 Ser 170 . . . . T
T . -0.76 . . . 0.20 0.22 Asn 171 . . . . T T . -0.20 . . . 0.20
0.55 Val 172 . . . . T T . 0.20 . . . 0.20 0.55 Leu 173 . . . . T .
. 0.62 . . . 0.30 0.55 Ser 174 . . . . T . . -0.01 . . . 0.00 0.54
His 175 . . . . T T . -0.57 . . . 0.20 0.39 Ser 176 . . B . . T .
-0.60 . . . -0.20 0.35 Tyr 177 . . B . . T . 0.26 . . . -0.20 0.35
Cys 178 . . B . . T . 1.07 . * . -0.20 0.45 Val 179 A A . . . . .
0.51 . . . -0.30 0.56 His 180 A A . . . . . -0.06 * . . -0.60 0.27
Gln 181 A A . . . . . 0.29 * . . -0.30 0.49 Asp 182 A A . . . . .
-0.28 * . . 0.45 1.33 Val 183 A A . . . . . -0.20 * . . 0.30 0.80
Met 184 A A . . . . . 0.41 * . . 0.30 0.47 Lys 185 A A . . . . .
-0.14 * . . -0.30 0.44 Leu 186 . A B . . . . -0.14 * . . -0.60 0.60
Ala 187 A A . . . . . -0.46 . . . -0.15 1.01 Tyr 188 A . . . . T .
-0.41 . . . 0.70 0.73 Ala 189 A . . . . T . -0.02 . . . -0.20 0.73
Asp 190 A . . . . T . -0.07 . . . 0.25 1.12 Thr 191 . . B . . T .
-0.11 * . F 0.40 1.14 Leu 192 . . B . . T . -0.38 * . F 0.25 0.84
Pro 193 . . B . . T . -0.38 * . F 0.25 0.37 Asn 194 . . B . . T .
-0.13 * . . -0.20 0.41 Val 195 . . B . . T . -0.94 * . . -0.20 0.49
Val 196 . . B B . . . -0.94 * . . -0.60 0.26 Tyr 197 . . B B . . .
-0.72 * . . -0.60 0.23 Gly 198 . . B B . . . -1.40 * . . -0.60 0.32
Leu 199 . . B B . . . -2.21 * . . -0.60 0.30 Thr 200 . . B B . . .
-2.17 . . . -0.60 0.16 Ala 201 . . B B . . . -2.17 . . . -0.60 0.13
Ile 202 . . B B . . . -2.52 . . . -0.60 0.12 Leu 203 . . B B . . .
-2.52 . . . -0.60 0.08 Leu 204 . . B B . . . -2.57 . . . -0.60 0.08
Val 205 . . B B . . . -2.26 . * . -0.60 0.08 Met 206 A . B B . . .
-2.52 . . . -0.60 0.17 Gly 207 A . . B . . . -2.23 . * . -0.60 0.15
Val 208 A . . B . . . -2.12 . . . -0.60 0.20 Asp 209 A . . B . . .
-2.20 . . . -0.60 0.18 Val 210 . . B B . . . -1.64 . . . -0.60 0.13
Met 211 . . B B . . . -1.86 . * . -0.60 0.23 Phe 212 . . B B . . .
-1.81 . . . -0.60 0.11 Ile 213 . . B B . . . -1.20 . . . -0.60 0.20
Ser 214 A . . B . . . -1.90 . . . -0.60 0.32 Leu 215 A . . B . . .
-1.86 . . . -0.60 0.32 Ser 216 A . . B . . . -2.14 . . . -0.60 0.38
Tyr 217 A . . B . . . -2.33 * * . -0.60 0.20 Phe 218 . . B B . . .
-1.33 * * . -0.60 0.17 Leu 219 . . B B . . . -1.34 * * . -0.60 0.25
Ile 220 . . B B . . . -1.39 * * . -0.60 0.23 Ile 221 . . B B . . .
-1.90 * * . -0.60 0.19 Arg 222 . . B B . . . -1.66 * * . -0.60 0.19
Thr 223 . . B B . . . -1.77 * * . -0.60 0.48 Val 224 . . B B . . .
-1.17 * * . -0.60 0.57 Leu 225 . . B B . . . -0.58 * * . 0.00 0.45
Gln 226 . . B B . . . 0.36 * * . 0.00 0.42 Leu 227 . . . . . T C
-0.06 * * F 1.50 1.12 Pro 228 . . . . . T C 0.26 * . F 2.40 1.82
Ser 229 . . . . . T C 1.22 * . F 3.00 1.82 Lys 230 A . . . . T .
1.44 * * F 2.50 4.32 Ser 231 A A . . . . . 1.49 * * F 1.80 2.82 Glu
232 A A . . . . . 1.71 . * F 1.50 4.21 Arg 233 A A . . . . . 1.22 .
* F 1.20 2.13 Ala 234 A A . . . . . 1.18 . * F 0.90 1.37 Lys 235 A
A . . . . . 0.82 . * F 0.75 0.79 Ala 236 A A . B . . . 0.46 * * .
0.30 0.58 Phe 237 A A . B . . . -0.40 * * . -0.30 0.31
Gly 238 A A . B . . . -0.81 * * . -0.60 0.11 Thr 239 . . B B . . .
-0.26 * . . -0.60 0.15 Cys 240 . . B B . . . -1.19 * . . -0.60 0.24
Val 241 . . B B . . . -0.94 . . . -0.60 0.17 Ser 242 . . B B . . .
-1.10 * . . -0.60 0.12 His 243 . . B B . . . -1.61 * . . -0.60 0.16
Ile 244 . . B B . . . -2.11 . . . -0.60 0.16 Gly 245 . . B B . . .
-2.03 . . . -0.60 0.10 Val 246 . A B B . . . -1.88 . . . -0.60 0.07
Val 247 . A B B . . . -1.82 . * . -0.60 0.09 Leu 248 . A B B . . .
-2.64 . * . -0.60 0.14 Ala 249 . A B B . . . -1.97 . * . -0.60 0.14
Phe 250 . A B B . . . -2.43 . . . -0.60 0.30 Tyr 251 . A B B . . .
-2.47 . . . -0.60 0.30 Val 252 . . B B . . . -1.96 . . . -0.60 0.21
Pro 253 . . B B . . . -1.96 . . . -0.60 0.24 Leu 254 . . B B . . .
-1.67 . . . -0.60 0.12 Ile 255 . . B B . . . -1.82 . . . -0.60 0.22
Gly 256 . . B B . . . -2.43 . . . -0.60 0.11 Leu 257 . . B B . . .
-1.61 * * . -0.60 0.10 Ser 258 . . B B . . . -1.29 * * . -0.60 0.19
Val 259 . . B B . . . -1.18 * * . -0.30 0.37 Val 260 . . B B . . .
-0.63 * * . -0.60 0.39 His 261 . . B . . T . -0.29 * * . 0.10 0.29
Arg 262 . . B . . T . 0.22 * * . 0.10 0.62 Phe 263 . . . . T T .
-0.29 * * . 0.65 1.13 Gly 264 . . . . T T . 0.53 * * F 0.65 0.68
Asn 265 . . . . T . . 1.18 * . F 0.45 0.48 Ser 266 . . . . . . C
0.32 * * F -0.05 0.85 Leu 267 . . . B . . C -0.64 * * . -0.40 0.60
His 268 . . . B . . C 0.17 * * . -0.40 0.28 Pro 269 . . B B . . .
-0.34 * * . -0.30 0.41 Ile 270 . . B B . . . -1.20 * * . -0.60 0.36
Val 271 . . B B . . . -1.50 * * . -0.60 0.20 Arg 272 . . B B . . .
-1.03 * * . -0.60 0.13 Val 273 . . B B . . . -1.00 * * . -0.60 0.18
Val 274 . . B B . . . -1.68 * . . 0.30 0.40 Met 275 . . B B . . .
-1.03 * * . -0.30 0.14 Gly 276 . . B B . . . -0.99 * * . -0.60 0.31
Asp 277 . . B B . . . -1.91 * * . -0.60 0.34 Ile 278 . . B B . . .
-1.87 . * . -0.60 0.28 Tyr 279 . . B B . . . -1.22 . * . -0.60 0.24
Leu 280 . . B B . . . -0.83 . . . -0.60 0.22 Leu 281 . . B B . . .
-1.34 * * . -0.60 0.48 Leu 282 . . B B . . . -2.23 * * . -0.60 0.23
Pro 283 . . B B . . . -1.34 * . . -0.60 0.19 Pro 284 . . . B T . .
-1.31 * . F -0.05 0.38 Val 285 . . B B . . . -1.39 * . . -0.60 0.71
Ile 286 . . B B . . . -1.47 * . . -0.60 0.32 Asn 287 . . B B . . .
-0.90 * . . -0.60 0.15 Pro 288 . . B B . . . -1.03 * . . -0.60 0.31
Ile 289 . . B B . . . -1.41 * . . -0.60 0.43 Ile 290 . . B B . . .
-0.51 * . . -0.60 0.27 Tyr 291 . . B . . . . 0.07 * * . -0.40 0.35
Gly 292 . . B . . . . 0.11 . . . -0.40 0.73 Ala 293 . . B . . . .
0.32 . . F 0.80 2.07 Lys 294 A . . . . . . 0.32 . * F 0.80 2.29 Thr
295 . . . B . . C 1.32 * . F 0.80 1.62 Lys 296 . . B B . . . 1.26 .
* F 0.90 3.15 Gln 297 . . B B . . . 1.71 . * F 0.90 2.27 Ile 298 .
. B B . . . 1.44 . * F 0.90 3.08 Arg 299 . . B B . . . 0.59 . * F
0.90 1.14 Thr 300 . . B B . . . 0.31 . * F 0.45 0.54 Arg 301 . . B
B . . . -0.33 * * . -0.30 0.78 Val 302 A . . B . . . -1.03 * * .
0.30 0.40 Leu 303 A . . B . . . -0.10 * * . -0.60 0.24 Ala 304 A .
. B . . . -1.10 . * . -0.30 0.24 Met 305 A . . B . . . -1.09 * * .
-0.60 0.23 Phe 306 A . . B . . . -1.87 * * . -0.60 0.37 Lys 307 A .
. B . . . -1.01 . * . -0.60 0.20 Ile 308 A . . B . . . -0.16 . * .
-0.30 0.33 Ser 309 A . . . . T . 0.43 . * . 1.00 0.77 Cys 310 A . .
. . T . 0.22 . * F 1.15 0.64 Asp 311 A . . . . T . 0.92 . * F 1.15
0.76 Lys 312 A . . . . T . 0.29 . * F 1.15 0.98 Asp 313 A A . . . .
. 0.32 . * F 0.90 1.84 Leu 314 A A . . . . . 0.28 * . . 0.60 0.82
Gln 315 A A . . . . . 0.60 * . . 0.52 0.41 Ala 316 A A . . . . .
0.64 * . . 0.14 0.24 Val 317 A . . . . T . 0.21 * . . 0.76 0.58 Gly
318 . . . . T T . -0.18 . . . 1.98 0.43 Gly 319 . . . . T T . 0.24
. . . 2.20 0.54 Lys 320 . . . . . T C -0.14 . . . 1.78 0.94
[0050] In another aspect, the invention provides an isolated
nucleic acid molecule comprising a polynucleotide which hybridizes
under stringent hybridization conditions to a portion of the
polynucleotide in a nucleic acid molecule of the invention
described above, for instance, the cDNA clone contained in ATCC
Deposit No. 97131, or the complementary strand of nucleotides of
SEQ ID NO:1, or the complementary strand of nucleotides of SEQ ID
NO:3. By "stringent hybridization conditions" is intended overnight
incubation at 42.degree. C. in a solution comprising: 50%
formamide, 5.times.SSC (750 mM NaCl, 75mM trisodium citrate), 50 mM
sodium phosphate (pH 7.6), 5.times. Denhardt's solution, 10%
dextran sulfate, and 20 g/ml denatured, sheared salmon sperm DNA,
followed by washing the filters in 0.1.times.SSC at about
65.degree. C. Polypeptides encoded by these nucleic acids are also
encompassed by the invention.
[0051] By a polynucleotide which hybridizes to a "portion" of a
polynucleotide is intended a polynucleotide (either DNA or RNA)
hybridizing to at least about 15 nucleotides (nt), and more
preferably at least about 20 nt, still more preferably at least
about 30 nt, and even more preferably about 30-70 nt of the
reference polynucleotide. These are useful, for example, as
diagnostic probes and primers as discussed above and in more detail
below. In this context "about" includes the particularly recited
size, larger or smaller by several (5, 4, 3, 2, or 1) nucleotides,
at either terminus or at both termini.
[0052] By a portion of a polynucleotide of "at least 20 nt in
length," for example, is intended 20 or more contiguous nucleotides
from the nucleotide sequence of the reference polynucleotide (e.g.,
the deposited cDNA or the nucleotide sequence as shown in FIGS.
1A-B (SEQ ID NO:1).
[0053] Of course, a polynucleotide which hybridizes only to a poly
A sequence (such as the 3' terminal poly(A) tract of the PSGR cDNA
shown in FIGS. 1A-B (SEQ ID NO:1) or FIGS. 2A-B (SEQ ID NO:3), or
to a complementary stretch of T (or U) resides, would not be
included in a polynucleotide of the invention used to hybridize to
a portion of a nucleic acid of the invention, since such a
polynucleotide would hybridize to any nucleic acid molecule
containing a poly (A) stretch or the complement thereof (e.g.,
practically any double-stranded cDNA clone generated using oligo dT
as a primer).
[0054] In specific embodiments, the polynucleotides of the
invention are less than 110000 kb, 50000 kb, 10000 kb, 1000 kb, 500
kb, 400 kb, 350 kb, 300 kb, 250 kb, 200 kb, 175 kb, 150 kb, 125 kb,
100 kb, 75 kb, 50 kb, 40 kb, 30 kb, 25 kb, 20 kb, 15 kb, 10 kb, 7.5
kb, or 5 kb in length.
[0055] In further embodiments, polynucleotides of the invention
comprise at least 15, at least 30, at least 50, at least 100, or at
least 250, at least 500, or at least 1000 contiguous nucleotides of
PSGR coding sequence, but consist of less than or equal to 107 kb,
75 kb, 50 kb, 30 kb, 25 kb, 20 kb, 15 kb, 10 kb, or 5 kb of genomic
DNA that flanks the 5' or 3' coding nucleotide set forth in FIGS.
1A-B (SEQ ID NO:1) or FIGS. 2A-B (SEQ ID NO:3). In further
embodiments, polynucleotides of the invention comprise at least 15,
at least 30, at least 50, at least 100, or at least 250, at least
500, or at least 1000 contiguous nucleotides of PSGR and/or coding
sequence, but do not comprise all or a portion of any PSGR intron.
In another embodiment, the nucleic acid comprising PSGR coding
sequence does not contain coding sequences of a genomic flanking
gene (i.e., 5' or 3' to the PSGR gene in the genome). In other
embodiments, the polynucleotides of the invention do not contain
the coding sequence of more than 1000, 500, 250, 100, 50, 25, 20,
15, 10, 5, 4, 3, 2, or 1 genomic flanking gene(s).
[0056] As indicated, nucleic acid molecules of the present
invention which encode a PSGR polypeptide may include, but are not
limited to, the coding sequence for the mature polypeptide, by
itself; the coding sequence for the mature polypeptide and
additional sequences, such as those encoding a leader or secretory
sequence, such as a pre-, or pro- or prepro- protein sequence; the
coding sequence of the mature polypeptide, with or without the
aforementioned additional coding sequences, together with
additional, non-coding sequences, including for example, but not
limited to introns and non-coding 5' and 3' sequences, such as the
transcribed, non-translated sequences that play a role in
transcription, mRNA processing--including splicing and
polyadenylation signals, for example--ribosome binding and
stability of mRNA; additional coding sequence which codes for
additional amino acids, such as those which provide additional
functionalities. Thus, for instance, the polypeptide may be fused
to a marker sequence, such as a peptide, which facilitates
purification of the fused polypeptide. In certain preferred
embodiments of this aspect of the invention, the marker sequence is
a hexa-histidine peptide, such as the tag provided in a pQE vector
(Qiagen, Inc.), among others, many of which are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA
86: 821-824 (1989), for instance, hexa-histidine provides for
convenient purification of the fusion protein. The "HA" tag is
another peptide useful for purification which corresponds to an
epitope derived from the influenza hemagglutinin protein, which has
been described by Wilson et al., Cell 37:767-778 (1984). As
discussed below, other such fusion proteins include the PSGR
receptor fused to Fc at the N- or C-terminus.
[0057] The present invention further relates to variants of the
nucleic acid molecules of the present invention, which encode
portions, analogs, or derivatives of the PSGR receptor. Variants
may occur naturally, such as a natural allelic variant. By an
"allelic variant" is intended one of several alternate forms of a
gene occupying a given locus on a chromosome of an organism. Genes
II, Lewin, B., ed., John Wiley & Sons, New York (1985).
Non-naturally occurring variants may be produced using art-known
mutagenesis techniques.
[0058] Such variants include those produced by nucleotide
substitutions, deletions or additions which may involve one or more
nucleotides. The variants may be altered in coding or non-coding
regions or both. Alterations in the coding regions may produce
conservative or non-conservative amino acid substitutions,
deletions, or additions. Especially preferred among these are
silent substitutions, additions, and deletions, which do not alter
the properties and activities of the PSGR receptor or portions
thereof. Also especially preferred in this regard are conservative
substitutions.
[0059] Further embodiments of the invention include isolated
nucleic acid molecules comprising, or alternatively consisting of,
a polynucleotide having a nucleotide sequence at least 90%
identical, and more preferably at least 95%, 96%, 97%, 98%, or 99%
identical to: (a) a nucleotide sequence encoding the polypeptide
having the amino acid sequence shown in FIGS. 1A-B (SEQ ID NO:2) or
FIGS. 2A-B (SEQ ID NO:4); (b) a nucleotide sequence encoding the
polypeptide having the amino acid sequence in FIGS. 1A-B (SEQ ID
NO:2) or FIGS. 2A-B (SEQ ID NO:4), but lacking the amino terminal
methionine; (c) a nucleotide sequence encoding the polypeptide
having the amino acid sequence encoded by a cDNA clone contained in
ATCC Deposit No. 97131; (d) a nucleotide sequence encoding the PSGR
transmembrane domain I; (e) a nucleotide sequence encoding the PSGR
transmembrane domain II; (f) a nucleotide sequence encoding the
PSGR transmembrane domain III; (g) a nucleotide sequence encoding
the PSGR transmembrane domain IV; (h) a nucleotide sequence
encoding the PSGR transmembrane domain V; (i) a nucleotide sequence
encoding the PSGR transmembrane domain VI; (j) a nucleotide
sequence encoding the PSGR transmembrane domain VII; (k) a
nucleotide sequence encoding one, two, three, four, five, six, or
all seven of the PSGR transmembrane domains; (l) a nucleotide
sequence encoding PSGR with one, two, three, four, five, six, or
all seven of the transmembrane domains deleted; (m) a nucleotide
sequence encoding PSGR extracellular loop I; (n) a nucleotide
sequence encoding PSGR extracellular loop II; (o) a nucleotide
sequence encoding PSGR extracellular loop III; (p) a nucleotide
sequence encoding one, two, or all three of the PSGR extracellular
loops; (q) a nucleotide sequence encoding PSGR intracellular loop
I; (r) a nucleotide sequence encoding PSGR intracellular loop II;
(s) a nucleotide sequence encoding PSGR intracellular loop III; and
(t) a nucleotide sequence encoding any combination of thenucleotide
sequences in (a), (b), (c), (d), (e), (f), (g), (h), (i), (j), (k),
(l), (m), (n), (o), (p), (q), (r), (s) or (t) above. Polypeptides
encoded by these polynucleotides are also encompassed by the
invention.
[0060] In a specific embodiment, the invention also encompasses a
nucleotide sequence complementary to any of the nucleotide
sequences in (a), (b), (c), (d), (e), (f), (g), (h), (i), (j), (k),
(l), (m), (n), (o), (p), (q), (r), (s) or (t) above.
[0061] By a polynucleotide having a nucleotide sequence at least,
for example, 95% "identical" to a reference nucleotide sequence
encoding a PSGR polypeptide is intended that the nucleotide
sequence of the polynucleotide is identical to the reference
sequence except that the polynucleotide sequence may include up to
five mismatches per each 100 nucleotides of the reference
nucleotide sequence encoding the PSGR polypeptide. In other words,
to obtain a polynucleotide having a nucleotide sequence at least
95% identical to a reference nucleotide sequence, up to 5% of the
nucleotides in the reference sequence may be deleted or substituted
with another nucleotide, or a number of nucleotides up to 5% of the
total nucleotides in the reference sequence may be inserted into
the reference sequence. These mismatches of the reference sequence
may occur at the 5' or 3' terminal positions of the reference
nucleotide sequence or anywhere between those terminal positions,
interspersed either individually among nucleotides in the reference
sequence or in one or more contiguous groups within the reference
sequence. The reference (query) sequence may be the entire PSGR
encoding nucleotide sequence shown in FIGS. 1A-B (SEQ ID NO:2) or
FIGS. 2A-B (SEQ ID NO:4), or any PSGR polynucleotide fragment
(e.g., a polynucleotide encoding the amino acid sequence of any of
the PSGR N- and/or C-terminal deletions described herein), variant,
derivative or analog, as described herein.
[0062] As a practical matter, whether any particular nucleic acid
molecule is at least 90%, 95%, 96%, 97%, 98% or 99% identical to,
for instance, the nucleotide sequence shown in FIGS. 1A-B (SEQ ID
NO:2) or FIGS. 2A-B (SEQ ID NO:4) or to the nucleotide sequence of
the deposited cDNA clone can be determined conventionally using
known computer programs such as the Bestfit program (Wisconsin
Sequence Analysis Package, Version 8 for Unix, Genetics Computer
Group, University Research Park, 575 Science Drive, Madison, Wis.
53711). Bestfit uses the local homology algorithm of Smith and
Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to
find the best segment of homology between two sequences. When using
Bestfit or any other sequence alignment program to determine
whether a particular sequence is, for instance, 95% identical to a
reference sequence according to the present invention, the
parameters are set, of course, such that the percentage of identity
is calculated over the full length of the reference nucleotide
sequence and that gaps in homology of up to 5% of the total number
of nucleotides in the reference sequence are allowed.
[0063] In a specific embodiment, the identity between a reference
(query) sequence (a sequence of the present invention) and a
subject sequence, also referred to as a global sequence alignment,
is determined using the FASTDB computer program based on the
algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)).
Preferred parameters used in a FASTDB alignment of DNA sequences to
calculate percent identity are: Matrix=Unitary, k-tuple=4, Mismatch
Penalty=1, Joining Penalty=30, Randomization Group Length=0, Cutoff
Score=1, Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or
the length of the subject nucleotide sequence, whichever is
shorter. According to this embodiment, if the subject sequence is
shorter than the query sequence because of 5' or 3' deletions, not
because of internal deletions, a manual correction is made to the
results to take into consideration the fact that the FASTDB program
does not account for 5' and 3' truncations of the subject sequence
when calculating percent identity. For subject sequences truncated
at the 5' or 3' ends, relative to the query sequence, the percent
identity is corrected by calculating the number of bases of the
query sequence that are 5' and 3' of the subject sequence, which
are not matched/aligned, as a percent of the total bases of the
query sequence. A determination of whether a nucleotide is
matched/aligned is determined by results of the FASTDB sequence
alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score.
This corrected score is what is used for the purposes of this
embodiment. Only bases outside the 5' and 3' bases of the subject
sequence, as displayed by the FASTDB alignment, which are not
matched/aligned with the query sequence, are calculated for the
purposes of manually adjusting the percent identity score. For
example, a 90 base subject sequence is aligned to a 100 base query
sequence to determine percent identity. The deletions occur at the
5' end of the subject sequence and therefore, the FASTDB alignment
does not show a matched/alignment of the first 10 bases at 5' end.
The 10 unpaired bases represent 10% of the sequence (number of
bases at the 5' and 3' ends not matched/total number of bases in
the query sequence) so 10% is subtracted from the percent identity
score calculated by the FASTDB program. If the remaining 90 bases
were perfectly matched the final percent identity would be 90%. In
another example, a 90 base subject sequence is compared with a 100
base query sequence. This time the deletions are internal deletions
so that there are no bases on the 5' or 3' of the subject sequence
which are not matched/aligned with the query. In this case the
percent identity calculated by FASTDB is not manually corrected.
Once again, only bases 5' and 3' of the subject sequence which are
not matched/aligned with the query sequence are manually corrected
for. No other manual corrections are made for the purposes of this
embodiment.
[0064] The present application is directed to nucleic acid
molecules comprising, or alternatively consisting of a nucleotide
sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the
nucleic acid sequence for example, shown in FIGS. 1A-B (SEQ ID
NO:2) or FIGS. 2A-B (SEQ ID NO:4), or to the nucleic acid sequence
of a deposited cDNA, irrespective of whether they encode a
polypeptide having PSGR receptor activity. This is because even
where a particular nucleic acid molecule does not encode a
polypeptide having PSGR functional activity, one of skill in the
art would still know how to use the nucleic acid molecule, for
instance, as a hybridization probe or a polymerase chain reaction
(PCR) primer. Uses of the nucleic acid molecules of the present
invention that do not encode a polypeptide having PSGR activity
include, inter alia: (1) isolating the PSGR gene or allelic
variants thereof in a cDNA library; (2) in situ hybridization
(e.g., "FISH") to metaphase chromosomal spreads to provide precise
chromosomal location of the PSGR gene, as described in Verma et al,
Hunan Chromosomes: A Manual of Basic Techniques, Pergamon Press,
New York (1988); (3) Northern Blot analysis for detecting PSGR MRNA
expression in specific tissues (e.g., normal prostate or prostate
cancer tissues); and (4) in situ hybridization (e.g.,
histochemistry) for detecting PSGR MRNA expression in specific
tissues (e.g., normal prostate or prostate cancer tissues).
[0065] Preferred, however, are nucleic acid molecules comprising,
or alternatively consisting of, a nucleotide sequence at least 90%,
95%, 96%, 97%, 98% or 99% identical to for example, the nucleic
acid sequence shown in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ
ID NO:4), or to a nucleic acid sequence contained in the deposited
cDNA, which do, in fact, encode a polypeptide having PSGR
functional activity. By "a polypeptide having PSGR functional
activity" is intended polypeptides exhibiting activity similar, but
not necessarily identical, to an activity of the PSGR of the
invention, as measured in a particular biological assay.
[0066] Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that a large
number of the nucleic acid molecules having a sequence at least
90%, 95%, 96%, 97%, 98%, or 99% identical to, for example, a
nucleic acid sequence contained in the deposited cDNA or the
nucleic acid sequence shown in FIGS. 1A-B (SEQ ID NO:2) or FIGS.
2A-B (SEQ ID NO:4), will encode a polypeptide "having PSGR
functional activity." Similarly, a large number of the nucleic acid
molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or
99% identical to, for example, a nucleic acid sequence centered in
the deposited cDNA or the nucleic acid sequence shown in FIGS. 1A-B
(SEQ ID NO: 1) or FIGS. 2A-B (SEQ ID NO:3) will encode a
polypeptide "having PSGR functional activity." In fact, since
degenerate variants of these nucleotide sequences all encode the
same polypeptide, this will be clear to the skilled artisan even
without performing a biological assay. It will be further
recognized in the art that, for such nucleic acid molecules that
are not degenerate variants, a reasonable number will also encode a
polypeptide having PSGR functional activity. This is because the
skilled artisan is fully aware of amino acid substitutions that are
either less likely or not likely to significantly effect protein
function (e.g., replacing one aliphatic amino acid with a second
aliphatic amino acid), as further described below.
Polynucleotide Assays
[0067] This invention is also related to the use of PSGR
polynucleotides to detect complementary polynucleotides such as,
for example, as a diagnostic reagent. Detection of a normal and
mutated form of PSGR associated with a dysfunction will provide a
diagnostic tool that can add or define a diagnosis of a disease or
susceptibility to a disease which results from under-expression
over-expression or altered expression of PSGR (or a soluble form
thereof), such as, for example, tumors or autoimmune disease.
[0068] In specific embodiments, PSGR polynucleotides of the
invention are used to detect complementary polynucleotides as a
diagnostic reagent for the detection of prostate cancer.
[0069] Individuals carrying mutations in the PSGR gene may be
detected at the DNA level by a variety of techniques. Nucleic acids
for diagnosis may be obtained from a biological sample from a
patient (e.g., a patient's cells, such as from urine, semen, blood,
saliva, tissue biopsy and autopsy material). The genomic DNA may be
used directly for detection or may be amplified enzymatically by
using PCR prior to analysis. (Saiki et al., Nature 324:163-166
(1986)). RNA or cDNA may also be used in the same ways. As an
example, PCR primers complementary to the nucleic acid encoding
PSGR can be used to identify and analyze PSGR expression and
mutations. For example, deletions and insertions can be detected by
a change in size of the amplified product in comparison to the
normal genotype. Point mutations can be identified by hybridizing
amplified DNA to radiolabeled PSGR RNA or alternatively,
radiolabeled PSGR antisense DNA sequences. Perfectly matched
sequences can routinely be distinguished from mismatched duplexes
by techniques known in the art, such as, for example, RNase A
digestion or by differences in melting temperatures.
[0070] Sequence differences between a reference gene and genes
having mutations also may be revealed by direct DNA sequencing. In
addition, cloned DNA segments may be employed as probes to detect
specific DNA segments. The sensitivity of such methods can be
greatly enhanced by appropriate use of PCR or another amplification
method. For example, a sequencing primer is used with
double-stranded PCR product or a single-stranded template molecule
generated by a modified PCR. The sequence determination is
performed by conventional procedures with radiolabeled nucleotide
or by automatic sequencing procedures with fluorescent-tags.
[0071] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels, with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis using techniques known in the art.
DNA fragments of different sequences may be distinguished on
denaturing formamide gradient gels in which the mobilities of
different DNA fragments are retarded in the gel at different
positions according to their specific melting or partial melting
temperatures (see, e.g., Myers et al., Science 230:1242
(1985)).
[0072] Sequence changes at specific locations also may be revealed
by nuclease protection assays, such as RNase and Sl protection or
the chemical cleavage method (e.g., Cotton et al., Proc. Natl.
Acad. Sci. USA 85: 4397-4401 (1985)).
[0073] Thus, the detection of a specific DNA sequence may be
achieved by methods which include, but are not limited to,
hybridization, RNase protection, chemical cleavage, direct DNA
sequencing or the use of restriction enzymes, (e.g., restriction
fragment length polymorphisms ("RFLP") and Southern blotting of
genomic DNA.
[0074] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations also can be detected by in situ analysis.
Recombinant and Syntlietic Production of PSGR
[0075] The present invention also relates to vectors which include
the isolated DNA molecules of the present invention, host cells
which are genetically engineered with the recombinant vectors
and/or nucleic acids of the invention, and the production of PSGR
polypeptides or fragments thereof by recombinant and synthetic
techniques.
[0076] Host cells can be genetically engineered to incorporate
nucleic acid molecules and express polypeptides of the present
invention. The polynucleotides may be introduced alone or with
other polynucleotides. Such other polynucleotides may be introduced
independently, co-introduced or introduced joined to the
polynucleotides of the invention.
[0077] In accordance with the present invention the vector may be,
for example, a plasmid vector, a single or double-stranded phage
vector, a single or double-stranded RNA or DNA viral vector. Such
vectors may be introduced into cells as polynucleotides, preferably
DNA, by well known techniques for introducing DNA and RNA into
cells. Viral vectors may be replication competent or replication
defective. In the latter case viral propagation generally will
occur only in complementing host cells.
[0078] Preferred among vectors, in certain respects, are those for
expression of polynucleotides and polypeptides of the present
invention. Generally, such vectors comprise cis-acting control
regions effective for expression in a host operatively linked to
the polynucleotide to be expressed. Appropriate trans-acting
factors either are supplied by the host, supplied by a
complementing vector or supplied by the vector itself upon
introduction into the host.
[0079] The polynucleotides may be joined to a vector containing a
selectable marker for propagation in a host. Generally, a plasmid
vector is introduced in a precipitate, such as a calcium phosphate
precipitate, or in a complex with a charged lipid. If the vector is
a virus, it may be packaged in vitro using an appropriate packaging
cell line and then transduced into host cells.
[0080] The DNA insert should be operatively linked to an
appropriate promoter, such as the phage lambda PL promoter, the E.
coli lac, trp, phoA and tac promoters, the SV40 early and late
promoters and promoters of retroviral LTRs, to name a few. Other
suitable promoters will be known to the skilled artisan. The
expression constructs will flirther contain sites for transcription
initiation, termination and, in the transcribed region, a ribosome
binding site for translation. The coding portion of the mature
transcripts expressed by the constructs will preferably include a
translation initiating at the beginning and a termination codon
(UAA, UGA or UAG) appropriately positioned at the end of the
polypeptide to be translated.
[0081] As indicated, the expression vectors will preferably include
at least one selectable marker. Such markers include dihydrofolate
reductase, G418 or neomycin resistance for eukaryotic cell culture
and tetracycline or ampicillin resistance genes for culturing in E.
coli and other bacteria. Representative examples of appropriate
hosts include, but are not limited to, bacterial cells, such as E.
coli, Streptomyces and Salmnonella typhimurium cells; fungal cells,
such as yeast cells (e.g., Saccharomyces cerevisiae or Pichia
pastoris (ATCC Accession No. 201178)); insect cells such as
Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO,
COS and Bowes melanoma cells; and plant cells. Appropriate culture
mediums and conditions for the above-described host cells are known
in the art.
[0082] Among vectors preferred for use in bacteria include pQE70,
pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript
vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A,
available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540,
pRIT5 available from Pharmacia. Among preferred eukaryotic vectors
are pWLNEO, pSV2CAT, pOG44, pXTI and pSG available from Stratagene;
and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Preferred
expression vectors for use in yeast systems include, but are not
limited to pYES2, pYD1, pTEF1/Zeo, pYES2/GS, pPICZ, pGAPZ,
pGAPZalph, pPIC9, pPIC3.5, pHIL-D2, pHIL-S1, pPIC3.5K, pPIC9K, and
PAO815 (all available from Invitrogen, Carlbad, Calif.). Other
suitable vectors will be readily apparent to the skilled
artisan.
[0083] The present invention also relates to host cells containing
the above-described vector constructs described herein, and
additionally encompasses host cells containing nucleotide sequences
of the invention that are operably associated with one or more
heterologous control regions (e.g., promoter and/or enhancer) using
techniques known of in the art. The host cell can be a higher
eukaryotic cell, such as a mammalian cell (e.g., a human derived
cell), or a lower eukaryotic cell, such as a yeast cell, or the
host cell can be a prokaryotic cell, such as a bacterial cell. The
host strain may be chosen which modulates the expression of the
inserted gene sequences, or modifies and processes the gene product
in the specific fashion desired. Expression from certain promoters
can be elevated in the presence of certain inducers; thus
expression of the genetically engineered polypeptide may be
controlled. Furthermore, different host cells have characteristics
and specific mechanisms for the translational and
post-translational processing and modification (e.g.,
phosphorylation, cleavage) of proteins. Appropriate cell lines can
be chosen to ensure the desired modifications and processing of the
foreign protein expressed.
[0084] Introduction of the construct into the host cell can be
effected by calcium phosphate transfection, DEAE-dextran mediated
transfection, cationic lipid-mediated transfection,
electroporation, transduction, infection or other methods. Such
methods are described in many standard laboratory manuals, such as
Davis et al., Basic Methods In Molecular Biology (1986).
[0085] In addition to encompassing host cells containing the vector
constructs discussed herein, the invention also encompasses
primary, secondary, and immortalized host cells of vertebrate
origin, particularly mammalian origin, that have been engineered to
delete or replace endogenous genetic material (e.g., PSGR coding
sequence), and/or to include genetic material (e.g., heterologous
polynucleotide sequences) that is operably associated with PSGR
polynucleotides of the invention, and which activates, alters,
and/or amplifies endogenous PSGR polynucleotides. For example,
techniques known in the art may be used to operably associate
heterologous control regions (e.g., promoter and/or enhancer) and
endogenous PSGR polynucleotide sequences via homologous
recombination (see, e.g., U.S. Pat. No. 5,641,670, issued Jun. 24,
1997; International Publication Number WO 96/29411; International
Publication Number WO 94/12650; Koller et al, Proc. Natl. Acad.
Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature
342:435-438 (1989), the disclosures of each of which are
incorporated by reference in their entireties).
[0086] The PSGR polypeptide may be expressed in a modified form,
such as a fusion protein (comprising the polypeptide joined via a
peptide bond to a heterologous protein sequence (of a different
protein)), and may include not only secretion signals but also
additional heterologous functional regions. Alternatively, such a
fusion protein can be made by protein synthetic techniques, e.g.,
by use of a peptide synthesizer. Thus, a region of additional amino
acids, particularly charged amino acids, may be added to the
N-terminus of the polypeptide to improve stability and persistence
in the host cell, during purification or during subsequent handling
and storage. Also, peptide moieties may be added to the polypeptide
to facilitate purification. Such regions may be removed prior to
final preparation of the polypeptide. The addition of peptide
moieties to polypeptides to engender secretion or excretion, to
improve stability and to facilitate purification, among others, are
familiar and routine techniques in the art. For example, in one
embodiment, polynucleotides encoding PSGR polypeptides of the
invention may be fused to the pelb pectate lyase signal sequence to
increase the efficiency to expression and purification of such
polypeptides in Gram-negative bacteria. See, U.S. Pat. Nos.
5,576,195 and 5,846,818, the contents of which are herein
incorporated by reference in their entireties.
[0087] A preferred fusion protein comprises a heterologous region
from immunoglobulin that is useful to solubilize proteins. For
example, EP-A-O 464 533 (Canadian counterpart 2045869) discloses
fusion proteins comprising various portions of constant region of
immunoglobin molecules together with another human protein or part
thereof. In many cases, the Fc part in a fusion protein is
thoroughly advantageous for use in therapy and diagnosis and thus
results, for example, in inproved pharmacokinetic properties (EP-A
0232 262). On the other hand, for some uses, it would be desirable
to be able to delete the Fc part after the fusion protein has been
expressed, detected and purified in the advantageous manner
described. This is the case when the Fc portion proves to be a
hindrance to use in therapy and diagnosis, for example, when the
fusion protein is to be used as an antigen for immunizations. In
drug discovery, for example, human proteins, such as the
hIL5-receptor, have been fused with Fc portions for the purpose of
high-throughput screening assays to identify antagonists of hIL-5.
See, D. Bennett et al., Journal of Molecular Recognition 8:52-58
(1995) and K. Johanson et al., The Journal of Biological Chemistly
270:16:9459-9471 (1995).
[0088] Polypeptides of the present invention include: products
purified from natural sources, including bodily fluids, tissues and
cells, whether directly isolated or cultured; products of chemical
synthetic procedures; and products produced by recombinant
techniques from a prokaryotic or eukaryotic host, including, for
example, bacterial, yeast, higher plant, insect and marmnalian
cells. Depending upon the host employed in a recombinant production
procedure, the polypeptides of the present invention may be
glycosylated or non-glycosylated. In addition, polypeptides of the
invention may also include an initial modified methionine residue,
in some cases as a result of host-mediated processes. Thus, it is
well known in the art that the N-terminal methionine encoded by the
translation initiation codon generally is removed with high
efficiency from any protein after translation in all eukaryotic
cells. While the N-terminal methionine on most proteins also is
efficiently removed in most prokaryotes, for some proteins this
prokaryotic removal process is inefficient, depending on the nature
of the amino acid to which the N-terminal methionine is covalently
linked.
[0089] In one embodiment, the yeast Pichia pastoris is used to
express PSGR in a eukaryotic system. Pichia pastoris is a
methylotrophic yeast which can metabolize methanol as its sole
carbon source. A main step in the methanol metabolization pathway
is the oxidation of methanol to formaldehyde using O.sub.2. This
reaction is catalyzed by the enzyme alcohol oxidase. In order to
metabolize methanol as its sole carbon source, Pichia pastoris must
generate high levels of alcohol oxidase due, in part, to the
relatively low affinity of alcohol oxidase for O.sub.2.
Consequently, in a growth medium depending on methanol as a main
carbon source, the promoter region of one of the two alcohol
oxidase genes (AOX1) is highly active. In the presence of methanol,
alcohol oxidase produced from the AOX1 gene comprises up to
approximately 30% of the total soluble protein in Pichiapastoris.
See, Ellis, S. B., et al., Mol. Cell. Biol. 5:1111-21 (1985);
Koutz, P. J, et al., Yeast 5:167-77 (1989); Tschopp, J. F., et al.,
Nucl. Acids Res. 15:3859-76 (1987). Thus, a heterologous coding
sequence, such as, for example, a PSGR polynucleotide of the
present invention, under the transcriptional regulation of all or
part of the AOX1 regulatory sequence may be expressed at
exceptionally high levels in Pichia yeast grown in the presence of
methanol.
[0090] In one example, the plasmid vector pPIC9K is used to express
DNA encoding a PSGR polypeptide of the invention, as set forth
herein, in a Pichea yeast system essentially as described in
"Pichia Protocols: Methods in Molecular Biology," D. R. Higgins and
J. Cregg, eds. The Humana Press, Totowa, N.J., 1998. This
expression vector is used to express and secrete a PSGR protein of
the invention by virtue of the strong AOX1 promoter linked to the
yeast alpha factor prepro peptide signal sequence (i.e., leader)
located upstream of a multiple cloning site.
[0091] Many other yeast vectors could be used in place of pPIC9K,
such as, pYES2, pYD1, pTEF1/Zeo, pYES2/GS, pPICZ, pGAPZ,
pGAPZalpha, pPIC9, pPIC3.5, pHIL-D2, pHIL-S1, pPIC3.5K, and PAO815,
as one skilled in the art would readily appreciate, as long as the
proposed expression construct provides appropriately located
signals for transcription, translation, secretion (if desired), and
the like, including an in-frame AUG as required.
[0092] In another embodiment, high-level expression of a
heterologous coding sequence, such as, for example, a PSGR
polynucleotide of the present invention, may be achieved by cloning
the heterologous polynucleotide of the invention into an expression
vector such as, for example, pGAPZ or pGAPZalpha, and growing the
yeast culture in the absence of methanol.
[0093] In addition to encompassing host cells containing the vector
constructs discussed herein, the invention also encompasses
primary, secondary, and immortalized host cells of vertebrate
origin, particularly mammalian origin, that have been engineered to
delete or replace endogenous genetic material (e.g., PSGR coding
sequence), and/or to include genetic material (e.g., heterologous
polynucleotide sequences) that is operably associated with PSGR
polynucleotides of the invention, and which activates, alters,
and/or amplifies endogenous PSGR polynucleotides. For example,
techniques known in the art may be used to operably associate
heterologous control regions (e.g., promoter and/or enhancer) and
endogenous PSGR polynucleotide sequences via homologous
recombination, resulting in the formation of a new transcription
unit (see, e.g., U.S. Pat. No. 5,641,670, issued Jun. 24, 1997;
U.S. Pat. No. 5,733,761, issued Mar. 31, 1998; International
Publication No. WO 96/29411, published Sep. 26, 1996; International
Publication No. WO 94/12650, published Aug. 4, 1994; Koller et al.,
Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and Zijlstra et
al., Nature 342:435-438 (1989), the disclosures of each of which
are incorporated by reference in their entireties).
[0094] In addition, proteins of the invention can be chemically
synthesized using techniques known in the art (e.g., see Creighton,
Proteins: Structures and Molecular Principles, W.H. Freeman &
Co., N.Y. (1983), and Hunkapiller, et al., Nature 310:105-111
(1984)). For example, a polypeptide corresponding to a fragment of
the PSGR polypeptides of the invention can be synthesized by use of
a peptide synthesizer. Furthermore, if desired, nonclassical amino
acids or chemical amino acid analogs can be introduced as a
substitution or addition into the PSGR polypeptide sequence.
Non-classical amino acids include, but are not limited to, to the
D-isomers of the common amino acids, 2,4-diaminobutyric acid,
a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric
acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric
acid, 3-amino propionic acid, ornithine, norleucine, norvaline,
hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic
acid, t-butylglycine, t-butylalanine, phenylglycine,
cyclohexylalanine, b-alanine, fluoro-amino acids, designer amino
acids such as b-methyl amino acids, Ca-methyl amino acids,
Na-methyl amino acids, and amino acid analogs in general.
Furthermore, the amino acid can be D (dextrorotary) or L
(levorotary).
[0095] The invention additionally, encompasses PSGR polypeptides
which are differentially modified during or after translation,
e.g., by glycosylation, acetylation, phosphorylation, amidation,
derivatization by known protecting/blocking groups, proteolytic
cleavage, linkage to an antibody molecule or other cellular ligand,
etc. Any of numerous chemical modifications may be carried out by
known techniques, including but not limited to, specific chemical
cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8
protease, NaBH.sub.4, acetylation, formylation, oxidation,
reduction, metabolic synthesis in the presence of tunicamycin;
etc.
[0096] Additional post-translational modifications encompassed by
the invention include, for example, e.g., N-linked or O-linked
carbohydrate chains, processing of N-terminal or C-terminal ends),
attachment of chemical moieties to the amino acid backbone,
chemical modifications of N-linked or O-linked carbohydrate chains,
and addition or deletion of an N-terminal methionine residue as a
result of procaryotic host cell expression. The polypeptides may
also be modified with a detectable label, such as an enzymatic,
fluorescent, isotopic or affmity label to allow for detection and
isolation of the protein.
[0097] Also provided by the invention are chemically modified
derivatives of PSGR which may provide additional advantages such as
increased solubility, stability and circulating time of the
polypeptide, or decreased immunogenicity (see U. S. Pat. No.
4,179,337). The chemical moieties for derivitization may be
selected from water soluble polymers such as polyethylene glycol,
ethylene glycol/propylene glycol copolymers,
carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
The polypeptides may be modified at random positions within the
molecule, or at predetermined positions within the molecule and may
include one, two, three or more attached chemical moieties.
[0098] The polymer may be of any molecular weight, and may be
branched or unbranched. For polyethylene glycol, the preferred
molecular weight is between about 1 kDa and about 100 kDa (the term
"about" indicating that in preparations of polyethylene glycol,
some molecules will weigh more, some less, than the stated
molecular weight) for ease in handling and manufacturing. Other
sizes may be used, depending on the desired therapeutic profile
(e.g., the duration of sustained release desired, the effects, if
any on biological activity, the ease in handling, the degree or
lack of antigenicity and other known effects of the polyethylene
glycol to a therapeutic protein or analog). For example, the
polyethylene glycol may have an average molecular weight of about
200, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000,
5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000,
10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000,
14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000,
18,500, 19,000, 19,500, 20,000, 25,000, 30,000, 35,000, 40,000,
50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000,
90,000, 95,000, or 100,000 kDa.
[0099] As noted above, the polyethylene glycol may have a branched
structure. Branched polyethylene glycols are described, for
example, in U.S. Pat. No. 5,643,575; Morpurgo et al., Appl Biochem.
Biotechnol. 56:59-72 (1996); Vorobjev et al., Nucleosides
Nucleotides 18:2745-2750 (1999); and Caliceti et al, Bioconjug.
Chem. 10:638-646 (1999), the disclosures of each of which are
incorporated herein by reference.
[0100] The polyethylene glycol molecules (or other chemical
moieties) should be attached to the protein with consideration of
effects on functional or antigenic domains of the protein. There
are a number of attachment methods available to those skilled in
the art, e.g., EP 0 401 384, herein incorporated by reference
(coupling PEG to G-CSF), see also Malik et al., Exp. Hematol
20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl
chloride). For example, polyethylene glycol may be covalently bound
through amino acid residues via a reactive group, such as, a free
amino or carboxyl group. Reactive groups are those to which an
activated polyethylene glycol molecule may be bound. The amino acid
residues having a free amino group may include lysine residues and
the N-terminal amino acid residues; those having a free carboxyl
group may include aspartic acid residues glutamic acid residues and
the C-terminal amino acid residue. Sulfhydryl groups may also be
used as a reactive group for attaching the polyethylene glycol
molecules. Preferred for therapeutic purposes is attachment at an
amino group, such as attachment at the N-terminus or lysine
group.
[0101] As suggested above, polyethylene glycol may be attached to
proteins via linkage to any of a number of amino acid residues. For
example, polyethylene glycol can be linked to a protein via
covalent bonds to lysine, histidine, aspartic acid, glutamic acid,
or cysteine residues. One or more reaction chemistries may be
employed to attach polyethylene glycol to specific amino acid
residues (e.g., lysine, histidine, aspartic acid, glutamic acid, or
cysteine) of the protein or to more than one type of amino acid
residue (e.g., lysine, histidine, aspartic acid, glutamic acid,
cysteine and combinations thereof) of the protein.
[0102] One may specifically desire proteins chemically modified at
the N-terminus. Using polyethylene glycol as an illustration of the
present composition, one may select from a variety of polyethylene
glycol molecules (by molecular weight, branching, etc.), the
proportion of polyethylene glycol molecules to protein (or peptide)
molecules in the reaction mix, the type of pegylation reaction to
be performed, and the method of obtaining the selected N-terminally
pegylated protein. The method of obtaining the N-terminally
pegylated preparation (i.e., separating this moiety from other
monopegylated moieties if necessary) may be by purification of the
N-terminally pegylated material from a population of pegylated
protein molecules. Selective proteins chemically modified at the
N-terminus modification may be accomplished by reductive alkylation
which exploits differential reactivity of different types of
primary amino groups (lysine versus the N-terminal) available for
derivatization in a particular protein. Under the appropriate
reaction conditions, substantially selective derivatization of the
protein at the N-terminus with a carbonyl group containing polymer
is achieved.
[0103] As indicated above, pegylation of the proteins of the
invention may be accomplished by any number of means. For example,
polyethylene glycol may be attached to the protein either directly
or by an intervening linker. Linkerless systems for attaching
polyethylene glycol to proteins are described in Delgado et al.,
Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992); Francis et
al., Intern. J. of Hematol. 68:1-18 (1998); U.S. Pat. No.
4,002,531; U.S. Pat. No. 5,349,052; WO 95/06058; and WO 98/32466,
the disclosures of each of which are incorporated herein by
reference.
[0104] One system for attaching polyethylene glycol directly to
amino acid residues of proteins without an intervening linker
employs tresylated MPEG, which is produced by the modification of
monmethoxy polyethylene glycol (MPEG) using tresylchloride
(ClSO.sub.2CH.sub.2CF.sub.3). Upon reaction of protein with
tresylated MPEG, polyethylene glycol is directly attached to amine
groups of the protein. Thus, the invention includes
protein-polyethylene glycol conjugates produced by reacting
proteins of the invention with a polyethylene glycol molecule
having a 2,2,2-trifluoreothane sulphonyl group.
[0105] Polyethylene glycol can also be attached to proteins using a
number of different intervening linkers. For example, U.S. Pat. No.
5,612,460, the entire disclosure of which is incorporated herein by
reference, discloses urethane linkers for connecting polyethylene
glycol to proteins. Protein-polyethylene glycol conjugates wherein
the polyethylene glycol is attached to the protein by a linker can
also be produced by reaction of proteins with compounds such as
MPEG-succinimidylsuccinate, MPEG activated with
1,1'-carbonyldiimidazole, MPEG-2,4,5-trichloropenylcarbonate,
MPEG-p-nitrophenolcarbonate, and various MPEG-succinate
derivatives. A number additional polyethylene glycol derivatives
and reaction chemistries for attaching polyethylene glycol to
proteins are described in WO 98/32466, the entire disclosure of
which is incorporated herein by reference. Pegylated protein
products produced using the reaction chemistries set out herein are
included within the scope of the invention.
[0106] The number of polyethylene glycol moieties attached to each
protein of the invention (i.e., the degree of substitution) may
also vary. For example, the pegylated proteins of the invention may
be linked, on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15,
17, 20, or more polyethylene glycol molecules. Similarly, the
average degree of substitution within ranges such as 1-3, 2-4, 3-5,
4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, 11-13, 12-14, 13-15, 14-16,
15-17, 16-18, 17-19, or 18-20 polyethylene glycol moieties per
protein molecule. Methods for determining the degree of
substitution are discussed, for example, in Delgado et al., Crit.
Rev. Thera. Drug Carrier Sys. 9:249-304 (1992).
[0107] As mentioned the PSGR proteins of the invention may be
modified by either natural processes, such as post translational
processing, or by chemical modification techniques which are well
known in the art. It will be appreciated that the same type of
modification may be present in the same or varying degrees at
several sites in a given PSGR polypeptide. PSGR polypeptides may be
branched, for example, as a result of ubiquitination, and they may
be cyclic, with or without branching. Cyclic, branched, and
branched cyclic PSGR polypeptides may result from post translation
natural processes or may be made by synthetic methods.
Modifications include acetylation, acylation, ADP-ribosylation,
amidation, covalent attachment of flavin, covalent attachment of a
heme moiety, covalent attachment of a nucleotide or nucleotide
derivative, covalent attachment of a lipid or lipid derivative,
covalent attachment of phosphotidylinositol, cross-linking,
cyclization, disulfide bond formation, demethylation, formation of
covalent cross-links, formation of cysteine, formation of
pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI
anchor formation, hydroxylation, iodination, methylation,
myristoylation, oxidation, pegylation, proteolytic processing,
phosphorylation, prenylation, racemization, selenoylation,
sulfation, transfer-RNA mediated addition of amino acids to
proteins such as arginylation, and ubiquitination. (See, for
instance, PROTEINS--STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T.
E. Creighton, W. H. Freeman and Company, New York (1993); POST
TRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson,
Ed., Academic Press, New York, pgs. 1-12 (1983); Seifter et al.,
Meth Enzymol 182:626-646 (1990); Rattan et al., Ann NY Acad Sci
663:48-62 (1992)).
[0108] The PSGR polypeptides of the invention can be recovered and
purified from chemical synthesis and recombinant cell cultures by
standard methods which include, but are not limited to, ammonium
sulfate or ethanol precipitation, acid extraction, anion or cation
exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Most
preferably, high performance liquid chromatography ("HPLC") is
employed for purification. Well known techniques for refolding
protein may be employed to regenerate active conformation when the
polypeptide is denatured during isolation and/or purification.
[0109] PSGR polynucleotides and polypeptides may be used in
accordance with the present invention for a variety of
applications, particularly those that make use of the chemical and
biological properties of PSGR. Among these are applications in the
detection of prostate cancer, treatment of tumors, resistance to
parasites, bacteria and viruses, to inhibit proliferation of B
cells, to induce proliferation of T-cells, endothelial cells and
certain hematopoietic cells, to treat restenosis, graft vs. host
disease, to regulate anti-viral responses and to prevent certain
autoimmune diseases after stimulation of PSGR by an agonist.
Additional applications relate to diagnosis and to treatment of
disorders of cells, tissues and organisms. These aspects of the
invention are discussed further below.
[0110] The PSGR proteins (polypeptides) of the invention may be in
monomers or multimers (i.e., dimers, trimers, tetramers, and higher
multimers). Accordingly, the present invention relates to monomers
and multimers of the PSGR proteins (polypeptides) of the invention,
their preparation, and compositions (preferably, pharmaceutical
compositions) containing them. In specific embodiments, the
polypeptides of the invention are monomers, dimers, trimers or
tetramers. In additional embodiments, the multimers of the
invention are at least dimers, at least trimers, or at least
tetramers.
[0111] Multimers encompassed by the invention may be homomers or
heteromers. As used herein, the term homomer, refers to a multimer
containing only PSGR proteins of the invention (including PSGR
fragments, variants, and fusion proteins, as described herein).
These homomers may contain PSGR proteins having identical or
different polypeptide sequences. In a specific embodiment, a
homomer of the invention is a multimer containing only PSGR
proteins having an identical polypeptide sequence. In another
specific embodiment, a homomer of the invention is a multimer
containing PSGR proteins having different polypeptide sequences
(e.g., containing PSGR proteins having identical or different
polypetide sequences. In specific embodiments, the multimer of the
invention is a homodimer (e.g., containing PSGR proteins having
identical or different polypeptide sequences) or a homotrimer
(e.g., containing PSGR proteins having identical or different
polypeptide sequences). In additional embodiments, the homomeric
multimer of the invention is at least a homodimer, at least a
homotrimer, or at least a homotetramer.
[0112] As used herein, the term heteromer refers to a multimer
containing heterologous proteins (i.e., proteins containing only
polypeptide sequences that do not correspond to a polypeptide
sequences encoded by the PSGR gene) in addition to the PSGR
proteins of the invention. In a specific embodiment, the multimer
of the invention is a heterodimer, a heterotrimer, or a
heterotetramer. In additional embodiments, the heteromeric multimer
of the invention is at least a heterodimer, at least a
heterotrimer, or at least a heterotetramer.
[0113] Multimers of the invention may be the result of hydrophobic,
hydrophilic, ionic and/or covalent associations and/or may be
indirectly linked, by for example, liposome formation. Thus, in one
embodiment, multimers of the invention, such as, for example,
homodimers or homotrimers, are formed when proteins of the
invention contact one another in solution. In another embodiment,
heteromultimers of the invention, such as, for example,
heterotrimers or heterotetramers, are formed when proteins of the
invention contact antibodies to the polypeptides of the invention
(including antibodies to the heterologous polypeptide sequence in a
fusion protein of the invention) in solution. In other embodiments,
multimers of the invention are formed by covalent associations with
and/or between the PSGR proteins of the invention. Such covalent
associations may involve one or more amino acid residues contained
in the polypeptide sequence of the protein (e.g., the polypeptide
sequence shown in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID
NO:4), or a polypeptide encoded by the deposited cDNA clone). In
one instance, the covalent associations are cross-linking between
cysteine residues located within the polypeptide sequences of the
proteins which interact in the native (i.e., naturally occurring)
polypeptide. In another instance, the covalent associations are the
consequence of chemical or recombinant manipulation. Alternatively,
such covalent associations may involve one or more amino acid
residues contained in the heterologous polypeptide sequence in a
PSGR fusion protein. In one example, covalent associations are
between the heterologous sequence contained in a fusion protein of
the invention (see, e.g., U.S. Pat. No. 5,478,925). In a specific
example, the covalent associations are between the heterologous
sequence contained in a PSGR-Fc fusion protein of the invention (as
described herein). In another specific example, covalent
associations of fusion proteins of the invention are between
heterologous polypeptide sequences from another PSGR family
ligand/receptor member that is capable of forning covalently
associated multimers, such as for example, oseteoprotegerin (see,
e.g., International Publication No. WO 98/49305, the contents of
which are herein incorporated by reference in its entirety). In
another embodiment, two or more PSGR polypeptides of the invention
are joined through synthetic linkers (e.g., peptide, carbohydrate
or soluble polymer linkers). Examples include those peptide linkers
described in U.S. Pat. No. 5,073,627 (hereby incorporated by
reference). Proteins comprising multiple PSGR polypeptides
separated by peptide linkers may be produced using conventional
recombinant DNA technology.
[0114] Another method for preparing multimer PSGR polypeptides of
the invention involves use of PSGR polypeptides fused to a leucine
zipper or isoleucine polypeptide sequence. Leucine zipper domains
and isoleucine zipper domains are polypeptides that promote
multimerization of the proteins in which they are found. Leucine
zippers were originally identified in several DNA-binding proteins
(Landschulz et al., Science 240:1759, (1988)), and have since been
found in a variety of different proteins. Among the known leucine
zippers are naturally occurring peptides and derivatives thereof
that dimerize or trimerize. Examples of leucine zipper domains
suitable for producing soluble multimeric PSGR proteins are those
described in PCT application WO 94/10308, hereby incorporated by
reference. Recombinant fusion proteins comprising a soluble PSGR
polypeptide fused to a peptide that dimerizes or trimerizes in
solution are expressed in suitable host cells, and the resulting
soluble multimeric PSGR is recovered from the culture supernatant
using techniques known in the art.
[0115] Certain members of the TNF family of proteins are believed
to exist in trimeric form (Beutler and Huffel, Science 264:667,
1994; Banner et al., Cell 73:431, 1993). Thus, trimeric PSGR may
offer the advantage of enhanced biological activity. Preferred
leucine zipper moieties are those that preferentially form trimers.
One example is a leucine zipper derived from lung surfactant
protein D (SPD), as described in Hoppe et al. (FEBS Letters
344:191, (1994)) and in U.S. patent application Ser. No.
08/446,922, hereby incorporated by reference. Other peptides
derived from naturally occurring trimeric proteins may be employed
in preparing trimeric PSGR.
[0116] In another example, proteins of the invention are associated
by interactions between
[0117] Flag.RTM. polypeptide sequence contained in Flag.RTM.-PSGR
fusion proteins of the invention. In a further embodiment,
associated proteins of the invention are associated by interactions
between heterologous polypeptide sequence contained in
Flag.RTM.-PSGR fusion proteins of the invention and anti-Flag.RTM.
antibody.
[0118] The multimers of the invention may be generated using
chemical techniques known in the art. For example, proteins desired
to be contained in the multimers of the invention may be chemically
cross-linked using linker molecules and linker molecule length
optimization techniques known in the art (see, e.g., U.S. Pat. No.
5,478,925, which is herein incorporated by reference in its
entirety). Additionally, multimers of the invention may be
generated using techniques known in the art to form one or more
inter-molecule cross-links between the cysteine residues located
within the polypeptide sequence of the proteins desired to be
contained in the multimer (see, e.g., U.S. Pat. No. 5,478,925,
which is herein incorporated by reference in its entirety).
Further, proteins of the invention may be routinely modified by the
addition of cysteine or biotin to the C terminus or N-terminus of
the polypeptide sequence of the protein and techniques known in the
art may be applied to generate multimers containing one or more of
these modified proteins (see, e.g., U.S. Pat. No. 5,478,925, which
is herein incorporated by reference in its entirety). Additionally,
techniques known in the art may be applied to generate liposomes
containing the protein components desired to be contained in the
multimer of the invention (see, e.g., U.S. Pat. No. 5,478,925,
which is herein incorporated by reference in its entirety).
[0119] Alternatively, multimers of the invention may be generated
using genetic engineering techniques known in the art. In one
embodiment, proteins contained in multimers of the invention are
produced recombinantly using fusion protein technology described
herein or otherwise known in the art (see, e.g., U.S. Pat. No.
5,478,925, which is herein incorporated by reference in its
entirety). In a specific embodiment, polynucleotides coding for a
homodimer of the invention are generated by ligating a
polynucleotide sequence encoding a polypeptide of the invention to
a sequence encoding a linker polypeptide and then further to a
synthetic polynucleotide encoding the translated product of the
polypeptide in the reverse orientation from the original C-terminus
to the N-terminus (lacking the leader sequence) (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). In another embodiment, recombinant techniques
described herein or otherwise known in the art are applied to
generate recombinant polypeptides of the invention which contain a
transmembrane domain and which can be incorporated by membrane
reconstitution techniques into liposomes (see, e.g., U.S. Pat. No.
5,478,925, which is herein incorporated by reference in its
entirety).
Transgenics and "Knock-Outs"
[0120] The PSGR proteins of the invention can also be expressed in
transgenic animals. Animals of any species, including, but not
limited to, mice, rats, rabbits, hamsters, guinea pigs, pigs,
micro-pigs, goats, sheep, cows and non-human primates, e.g.,
baboons, monkeys, and chimpanzees may be used to generate
transgenic animals. In a specific embodiment, techniques described
herein or otherwise known in the art, are used to express
polypeptides of the invention in humans, as part of a gene therapy
protocol.
[0121] Any technique known in the art may be used to introduce the
transgene (i.e., nucleic acids of the invention) into animals to
produce the founder lines of transgenic animals. Such techniques
include, but are not limited to, pronuclear microinjection
(Paterson et al., Appl. Microbiol. Biotechnol. 40:691-698 (1994);
Carver et al., Biotechnology (NY) 11:1263-1270 (1993); Wright et
al., Biotechnology (NY) 9:830-834 (1991); and Hoppe et al., U.S.
Pat. No. 4,873,191 (1989)); retrovirus mediated gene transfer into
germ lines (Van der Putten et al., Proc. Natl. Acad. Sci., USA
82:6148-6152 (1985)), blastocysts or embryos; gene targeting in
embryonic stem cells (Thompson et al., Cell 56:313-321 (1989));
electroporation of cells or embryos (Lo, Mol Cell. Biol.
3:1803-1814 (1983)); introduction of the polynucleotides of the
invention using a gene gun (see, e.g., Ulmer et al., Science
259:1745 (1993); introducing nucleic acid constructs into embryonic
pleuripotent stem cells and transferring the stem cells back into
the blastocyst; and sperm-mediated gene transfer (Lavitrano et al.,
Cell 57:717-723 (1989); etc. For a review of such teclhiques, see
Gordon, "Transgenic Animals," Intl. Rev. Cytol. 115:171-229 (1989),
which is incorporated by reference herein in its entirety. Further,
the contents of each of the documents recited in this paragraph is
herein incorporated by reference in its entirety. Gordon,
"Transgenic Animals," Intl. Rev. Cytol. 115:171-229 (1989), which
is incorporated by reference herein in its entirety. See also, U.S.
Pat. No. 5,464,764 (Capecchi, et al., Positive-Negative Selection
Methods and Vectors); U.S. Pat. No. 5,631,153 (Capecchi, et al.,
Cells and Non-Human Organisms Containing Predetermined Genomic
Modifications and Positive-Negative Selection Methods and Vectors
for Making Same); U.S. Pat. No. 4,736,866 (Leder, et al.,
Transgenic Non-Human Animals); and U.S. Pat. No. 4,873,191 (Wagner,
et al., Genetic Transformation of Zygotes); each of which is hereby
incorporated by reference in its entirety.
[0122] Any technique known in the art may be used to produce
transgenic clones containing polynucleotides of the invention, for
example, nuclear transfer into enucleated oocytes of nuclei from
cultured embryonic, fetal, or adult cells induced to quiescence
(Campell et al., Nature 380:64-66 (1996); Wilmut et al., Nature
385:810-813 (1997)), each of which is herein incorporated by
reference in its entirety).
[0123] The present invention provides for transgenic animals that
carry the transgene in all their cells, as well as animals which
carry the transgene in some, but not all their cells, i.e., mosaic
animals or chimeric animals. The transgene may be integrated as a
single transgene or as multiple copies such as in concatamers,
e.g., head-to-head tandems or head-to-tail tandems. The transgene
may also be selectively introduced into and activated in a
particular cell type by following, for example, the teaching of
Lasko et al. (Proc. Natl. Acad. Sci. USA 89:6232-6236 (1992)). The
regulatory sequences required for such a cell-type specific
activation will depend upon the particular cell type of interest,
and will be apparent to those of skill in the art. When it is
desired that the polynucleotide transgene be integrated into the
chromosomal site of the endogenous gene, gene targeting is
preferred. Briefly, when such a technique is to be utilized,
vectors containing some nucleotide sequences homologous to the
endogenous gene are designed for the purpose of integrating, via
homologous recombination with chromosomal sequences, into and
disrupting the function of the nucleotide sequence of the
endogenous gene. The transgene may also be selectively introduced
into a particular cell type, thus inactivating the endogenous gene
in only that cell type, by following, for example, the teaching of
Gu et al. (Science 265:103-106 (1994)). The regulatory sequences
required for such a cell-type specific inactivation will depend
upon the particular cell type of interest, and will be apparent to
those of skill in the art. The contents of each of the documents
recited in this paragraph is herein incorporated by reference in
its entirety.
[0124] Once transgenic animals have been generated, the expression
of the recombinant gene may be assayed utilizing standard
techniques. Initial screening may be accomplished by Southern blot
analysis or PCR techniques to analyze animal tissues to verify that
integration of the transgene has taken place. The level of mRNA
expression of the transgene in the tissues of the transgenic
animals may also be assessed using techniques which include, but
are not limited to, Northern blot analysis of tissue samples
obtained from the animal, in situ hybridization analysis, and
reverse transcriptase-PCR (rt-PCR). Samples of transgenic
gene-expressing tissue may also be evaluated immunocytochemically
or immunohistochemically using antibodies specific for the
transgene product.
[0125] Once the founder animals are produced, they may be bred,
inbred, outbred, or crossbred to produce colonies of the particular
animal. Examples of such breeding strategies include, but are not
limited to: outbreeding of founder animals with more than one
integration site in order to establish separate lines; inbreeding
of separate lines in order to produce compound transgenics that
express the transgene at higher levels because of the effects of
additive expression of each transgene; crossing of heterozygous
transgenic animals to produce animals homozygous for a given
integration site in order to both augment expression and eliminate
the need for screening of animals by DNA analysis; crossing of
separate homozygous lines to produce compound heterozygous or
homozygous lines; and breeding to place the transgene on a distinct
background that is appropriate for an experimental model of
interest.
[0126] Transgenic and "knock-out" animals of the invention have
uses which include, but are not limited to, animal model systems
useful in elaborating the biological function of PSGR polypeptides,
studying conditions and/or disorders associated with aberrant PSGR
expression, and in screening for compounds effective in
ameliorating such conditions and/or disorders.
[0127] In further embodiments of the invention, cells that are
genetically engineered to express the proteins of the invention, or
alternatively, that are genetically engineered not to express the
proteins of the invention (e.g., knockouts) are administered to a
patient in vivo. Such cells may be obtained from the patient (i.e.,
animal, including human) or an MHC compatible donor and can
include, but are not limited to fibroblasts, bone marrow cells,
blood cells (e.g., lymphocytes), adipocytes, muscle cells,
endothelial cells, etc. The cells are genetically engineered in
vitro using recombinant DNA techniques to introduce the coding
sequence of polypeptides of the invention into the cells, or
alternatively, to disrupt the coding sequence and/or endogenous
regulatory sequence associated with the polypeptides of the
invention, e.g., by transduction (using viral vectors, and
preferably vectors that integrate the transgene into the cell
genome) or transfection procedures, including, but not limited to,
the use of plasmids, cosmids, YACs, naked DNA, electroporation,
liposomes, etc. The coding sequence of the polypeptides of the
invention can be placed under the control of a strong constitutive
or inducible promoter or promoter/enhancer to achieve expression,
and preferably secretion, of the polypeptides of the invention. The
engineered cells which express and preferably secrete the
polypeptides of the invention can be introduced into the patient
systemically, e.g., in the circulation, or intraperitoneally.
Alternatively, the cells can be incorporated into a matrix and
implanted in the body, e.g., genetically engineered fibroblasts can
be implanted as part of a skin graft; genetically engineered
endothelial cells can be implanted as part of a lymphatic or
vascular graft. (See, for example, Anderson et al. U.S. Pat. No.
5,399,349; and Mulligan & Wilson, U.S. Pat. No. 5,460,959, each
of which is incorporated by reference herein in its entirety).
[0128] When the cells to be administered are non-autologous or
non-MHC compatible cells, they can be administered using well known
techniques which prevent the development of a host immune response
against the introduced cells. For example, the cells may be
introduced in an encapsulated form which, while allowing for an
exchange of components with the immediate extracellular
environment, does not allow the introduced cells to be recognized
by the host immune system.
PSGR Polypeptides and Fragments
[0129] The polypeptides of the present invention are preferably
provided in an isolated form. By "isolated polypeptide" is intended
a polypeptide removed from its native environment. Thus, a
polypeptide produced and/or contained within a recombinant host
cell is considered isolated for purposes of the present invention.
Also intended as an "isolated polypeptide" are polypeptides that
have been purified, partially or substantially, from a recombinant
host cell. For example, a recombinantly produced version of the
PSGR polypeptide can be substantially purified by the one-step
method described in Smith and Johnson, Gene 67:31-40 (1988).
[0130] Accordingly, in one embodiment, the invention provides an
isolated PSGR polypeptide having the amino acid sequence encoded by
encoded by the cDNA contained in ATCC Deposit No. 97131, or the
amino acid sequence in FIGS. 1A-B (SEQ ID NO:2), or the amino acid
sequence in FIGS. 2A-B (SEQ ID NO:4), or a polypeptide comprising a
portion of the above polypeptides, such as for example, the PSGR
extracellular loop I comprising, or alternatively consisting of,
amino acids 77 to 98 of FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ
ID NO:4); the PSGR extracellular loop II comprising, or
alternatively consisting of, amino acids 163 to 197 of FIGS. 1A-B
(SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4); the PSGR extracellular
loop III comprising, or alternatively consisting of, amino acids
262 to 272 of FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4);
the PSGR intracellular loop I comprising, or alternatively
consisting of, amino acids 43 to 55 of FIGS. 1A-B (SEQ ID NO:2) or
FIGS. 2A-B (SEQ ID NO:4); the PSGR intracellular loop II
comprising, or alternatively consisting of, amino acids 120 to 141
of FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4); and/or the
PSGR intracellular loop III comprising, or alternatively consisting
of, amino acids 219 to 240 of FIGS. 1A-B (SEQ ID NO:2) or FIGS.
2A-B (SEQ ID NO:4).
[0131] Polypeptide fragments of the present invention include
polypeptides comprising or alternatively, consisting of: an amino
acid sequence contained in FIGS. 1A-B (SEQ ID NO:2); an amino acid
sequence contained in FIGS. 2A-B (SEQ ID NO:4); an amino acid
sequence encoded by the cDNA contained in ATCC Deposit No. 97131;
an amino acid sequence encoded by a nucleic acid containing a
polynucleotide sequence which hybridizes (e.g., under stringent
hybridization conditions) to the nucleotide sequence contained in
the deposited clone; or an amino acid sequence encoded by a nucleic
acid containing a polynucleotide sequence which hybridizes to the
complementary strand of the nucleotide sequence shown in FIGS. 1A-B
(SEQ ID NO:1) or FIGS. 2A-B (SEQ ID NO:3). Polynucleotides encoding
these polypeptides are also encompassed by the invention.
[0132] Protein fragments may be "free-standing," or comprised
within a larger polypeptide of which the fragment forms a part or
region, most preferably as a single continuous region.
Representative examples of polypeptide fragments of the invention,
include, for example, fragments that comprise or alternatively,
consist of from about amino acid residues: 1 to 21, 22 to 42, 43 to
55, 56 to 76, 77 to 98, 99 to 119, 120 to 141, 142 to 162, 163 to
197, 198 to 218, 219 to 240, 241 to 261, 262 to 272, 273 to 293,
and/or 294 to 320 of SEQ ID NO:2. Moreover, polypeptide fragments
can be at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120,
130, 140, 150, 175, 200, 250, 300, 350, 400 or 500 amino acids in
length. Polynucleotides encoding these polypeptides are also
encompassed by the invention. In this context "about" includes the
particularly recited ranges, larger or smaller by several (5, 4, 3,
2, or 1) amino acids, at either extreme or at both extremes.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0133] In additional embodiments, the polypeptide fragments of the
invention comprise, or alternatively consist of, one or more PSGR
domains. Preferred polypeptide fragments of the present invention
include a member selected from the group: (a) a polypeptide
comprising or alternatively, consisting of, the PSGR transmembrane
domain I (predicted to constitute amino acid residues from about 22
to about 42 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID
NO:4)); (b) a polypeptide comprising, or alternatively consisting
of, the PSGR transmembrane domain II (predicted to constitute amino
acid residues from about 56 to about 76 in FIGS. 1A-B (SEQ ID NO:2)
or FIGS. 2A-B (SEQ ID NO:4)); (c) a polypeptide comprising, or
alternatively consisting of the PSGR transmembrane domain III
(predicted to constitute amino acid residues from about 99 to about
119 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4)); (d) a
polypeptide comprising, or alternatively consisting of, the PSGR
transmembrane domain IV (predicted to constitute amino acid
residues from about 142 to about 162 in FIGS. 1A-B (SEQ ID NO:2) or
FIGS. 2A-B (SEQ ID NO:4)); (e) a polypeptide comprising, or
alternatively consisting of, the PSGR transmembrane domain V
(predicted to constitute amino acid residues from about 198 to
about 218 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4));
(f) a polypeptide comprising, or alternatively consisting of, the
PSGR transmembrane domain VI (predicted to constitute amino acid
residues from about 241 to about 261 in FIGS. 1A-B (SEQ ID NO:2) or
FIGS. 2A-B (SEQ ID NO:4)); (g) a polypeptide comprising, or
alternatively consisting of, a polypeptide comprising, or
alternatively consisting of, the PSGR transmembrane domain VII
(predicted to constitute amino acid residues from about 273 to
about 293 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4));
(h) a polypeptide comprising, or alternatively consisting of, the
PSGR extracellular loop I (predicted to constitute amino acid
residues from about 77 to about 98 in FIGS. 1A-B (SEQ ID NO:2) or
FIGS. 2A-B (SEQ I) NO:4)); (i) a polypeptide comprising, or
alternatively consisting of, the PSGR extracellular loop II
(predicted to constitute amino acid residues from about 163 to
about 197 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4));
(j) a polypeptide comprising, or alternatively consisting of, the
PSGR extracellular loop III (predicted to constitute amino acid
residues from about 262 to about 272 in FIGS. 1A-B (SEQ ID NO:2) or
FIGS. 2A-B (SEQ ID NO:4)); (k) a polypeptide comprising, or
alternatively consisting of, the PSGR intracellular loop I
(predicted to constitute amino acid residues from about 43 to about
55 in FIGS. 1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4)); (l) a
polypeptide comprising, or alternatively consisting of, the PSGR
intracellular loop II (predicted to constitute amino acid residues
from about 120 to about 141 in FIGS. 1A-B (SEQ ID NO:2) or FIGS.
2A-B (SEQ ID NO:4)); (m) a polypeptide comprising, or alternatively
consisting of, the PSGR intracellular loop III (predicted to
constitute amino acid residues from about 219 to about 240 in FIGS.
1A-B (SEQ ID NO:2) or FIGS. 2A-B (SEQ ID NO:4)); or (n) any
combination of polypeptides (a)-(m). Polynucleotides encoding these
polypeptides are also encompassed by the invention.
[0134] Among the especially preferred fragments of the invention
are fragments characterized by structural or functional attributes
of PSGR. Such fragments include amino acid residues that comprise
alpha-helix and alpha-helix forming regions ("alpha-regions"),
beta-sheet and beta-sheet-forming regions ("beta-regions"), turn
and turn-forming regions ("turn-regions"), coil and coil-forming
regions ("coil-regions"), hydrophilic regions, alpha amphipathic
regions, beta amphipathic regions, surface forming regions, and
high antigenic index regions (i.e., containing four or more
contiguous amino acids having an antigenic index of greater than or
equal to 1, as identified using the default parameters of the
Jameson-Wolf program) of complete (i.e., full-length) PSGR (FIGS.
1A-B (SEQ ID NO:2)). Certain preferred regions are those set out in
FIG. 4 and include, but are not limited to, regions of the
aforementioned types identified by analysis of the amino acid
sequence depicted in FIGS. 1A-B (SEQ ID NO:2), such preferred
regions include; Garnier-Robson predicted alpha-regions,
beta-regions, turn-regions, and coil-regions; Chou-Fasman predicted
alpha-regions, beta-regions, and turn-regions; Kyte-Dooliffle
predicted hydrophilic; Eisenberg alpha and beta amphipathic
regions; Karplus-Schulz predicted flexible regions; Jameson-Wolf
high antigenic index regions; and Emini surface-forming regions, as
predicted using the default parameters of these computer programs.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0135] As mentioned above, even if deletion of one or more amino
acids from the N-terminus of a protein results in modification of
loss of one or more biological functions of the protein, other
functional activities (e.g., biological activities, ability to
multimerize, ability to bind PSGR ligand or couple to G protein)
may still be retained. For example, the ability of shortened PSGR
muteins to induce and/or bind to antibodies which recognize the
complete or mature forms of the polypeptides generally will be
retained when less than the majority of the residues of the
complete or mature polypeptide are removed from the N-terminus.
Whether a particular polypeptide lacking N-terminal residues of a
complete full-length polypeptide retains such immunologic
activities can readily be determined by routine methods described
herein and otherwise known in the art. It is not unlikely that an
PSGR mutein with a large number of deleted N-terminal amino acid
residues may retain some biological or immunogenic activities. In
fact, peptides composed of as few as six PSGR amino acid residues
may often evoke an immune response.
[0136] Accordingly, the present invention further provides
polypeptides having one or more residues deleted from the amino
tenninus of the PSGR amino acid sequence shown in FIGS. 1A-B, up to
the glutamine residue at position number 315 and polynucleotides
encoding such polypeptides. In particular, the present invention
provides polypeptides comprising the amino acid sequence of
residues n.sup.1-320 of FIGS. 1A-B, where n.sup.1 is an integer
from 2 to 315 corresponding to the position of the amino acid
residue in FIGS. 1A-B (SEQ ID NO:2).
[0137] More in particular, the invention provides polynucleotides
encoding polypeptides comprising, or alternatively consisting of,
the amino acid sequence of residues: S-2 to K-320; S-3 to K-320;
C-4 to K-320; N-5 to K-320; F-6 to K-320; T-7 to K-320; H-8 to
K-320; A-9 to K-320; T-10 to K-320; C-11 to K-320; V-12 to K-320;
L-13 to K-320; I-14 to K-320; G15 to K-320; I-16 to K-320; P-17 to
K-320; G-18 to K-320; L-19 to K-320; E-20 to K-320 ; K-21 to K-320;
A-22 to K-320; H-23 to K-320; F-24 to K-320; W-25 to K-320; V-26 to
K-320; G-27 to K-320; F-28 to K-320; P-29 to K-320; L-30 to K-320;
L-31 to K-320; S-32 to K-320; M-33 to K-320; Y-34 to K-320; V-35 to
K-320; V-36 to K-320; A-37 to K-320; M-38 to K-320; C-39 to K-320;
G-40 to K-320; N-41 to K-320; C-42 to K-320; 1-43 to K-320; V-44 to
K-320; V-45 to K-320; F-46 to K-320; I-47 to K-320; V-48 to K-320;
R-49 to K-320; T-50 to K-320; E-51 to K-320; R-52 to K-320; S-53 to
K-320; L-54 to K-320; H-55 to K-320; A-56 to K-320; P-57 to K-320;
M-58 to K-320; Y-59 to K-320; L-60 to K-320; F-61 to K-320; L-62 to
K-320; C-63 to K-320; M-64 to K-320; L-65 to K-320; A-66 to K-320;
A-67 to K-320; I-68 to K-320; D-69 to K-320; L-70 to K-320; A-71 to
K-320; L-72 to K-320; S-73 to K-320; T-74 to K-320; S-75 to K-320;
T-76 to K-320; M-77 to K-320; P-78 to K-320; K-79 to K-320; 1-80 to
K-320; L-81 to K-320; A-82 to K-320; L-83 to K-320; F-84 to K-320;
W-85 to K-320; F-86 to K-320; D-87 to K-320; S-88 to K-320; R-89 to
K-320; E-90 to K-320; I-91 to K-320; S-92 to K-320; I-93 to K-320;
E-94 to K-320; A-95 to K-320; C-96 to K-320; L-97 to K-320; T-98 to
K-320; Q-99 to K-320; M-100 to K-320; F-101 to K-320; F-102 to
K-320; I-103 to K-320; H-104 to K-320; A-105 to K-320; L-106 to
K-320; S-107 to K-320; A-108 to K-320; I-109 to K-320; E-110 to
K-320; S-111 to K-320; T-112 to K-320; I-113 to K-320; L-114 to
K-320; L-115 to K-320; A-116 to K-320; M-117 to K-320; A-118 to
K-320; F-119 to K-320; D-120 to K-320; R-121 to K-320; Y-122 to
K-320; V-123 to K-320; A-124 to K-320; I-125 to K-320; C-126 to
K-320; H-127 to K-320; P-128 to K-320; L-129 to K-320; R-130 to
K-320; H-131 to K-320; A-132 to K-320; A-133 to K-320; V-134 to
K-320; L-135 to K-320; N-136 to K-320; N-137 to K-320; T-138 to
K-320; V-139 to K-320; T-140 to K-320; A-141 to K-320; Q-142 to
K-320; I-143 to K-320; G-144 to K-320; I-145 to K-320; V-146 to
K-320; A-147 to K-320; V-148 to K-320; V-149 to K-320; R-150 to
K-320; G-151 to K-320; S-152 to K-320; L-153 to K-320; F-154 to
K-320; F-155 to K-320; F-156 to K-320; P-157 to K-320; L-158 to
K-320; P-159 to K-320; L-160 to K-320; L-161 to K-320; I-162 to
K-320; K-163 to K-320; R-164 to K-320; L-165 to K-320; A-166 to
K-320; F-167 to K-320; C-168 to K-320; H-169 to K-320; S-170 to
K-320; N-171 to K-320; V-172 to K-320; L-173 to K-320; S-174 to
K-320; H-175 to K-320; S-176 to K-320; Y-177 to K-320; C-178 to
K-320; V-179 to K-320; H-180 to K-320; Q-181 to K-320; D-182 to
K-320; V-183 to K-320; M-184 to K-320; K-185 to K-320; L-186 to
K-320; A-187 to K-320; Y-188 to K-320; A-189 to K-320; D-190 to
K-320; T-191 to K-320; L-192 to K-320; P-193 to K-320; N-194 to
K-320; V-195 to K-320; V-196 to K-320; Y-197 to K-320; G-198 to
K-320; L-199 to K-320; T-200 to K-320; A-201 to K-320; I-202 to
K-320; L-203 to K-320; L-204 to K-320; V-205 to K-320; M-206 to
K-320; G-207 to K-320; V-208 to K-320; D-209 to K-320; V-210 to
K-320; M-211 to K-320; F-212 to K-320; I-213 to K-320; S-214 to
K-320; L-215 to K-320; S-216 to K-320; Y-217 to K-320; F-218 to
K-320; L-219 to K-320; I-220 to K-320; I-221 to K-320; R-222 to
K-320; T-223 to K-320; V-224 to K-320; L-225 to K-320; Q-226 to
K-320; L-227 to K-320; P-228 to K-320; S-229 to K-320; K-230 to
K-320; S-231 to K-320; E-232 to K-320; R-233 to K-320; A-234 to
K-320; K-235 to K-320; A-236 to K-320; F-237 to K-320; G-238 to
K-320; T-239 to K-320; C-240 to K-320; V-241 to K-320; S-242 to
K-320; H-243 to K-320; I-244 to K-320; G-245 to K-320; V-246 to
K-320; V-247 to K-320; L-248 to K-320; A-249 to K-320; F-250 to
K-320; Y-251 to K-320; V-252 to K-320; P-253 to K-320; L-254 to
K-320; I-255 to K-320; G-256 to K-320; L-257 to K-320; S-258 to
K-320; V-259 to K-320; V-260 to K-320; H-261 to K-320; R-262 to
K-320; F-263 to K-320; G-264 to K-320; N-265 to K-320; S-266 to
K-320; L-267 to K-320; H-268 to K-320; P-269 to K-320; I-270 to
K-320; V-271 to K-320; R-272 to K-320; V-273 to K-320; V-274 to
K-320; M-275 to K-320; G-276 to K-320; D-277 to K-320; I-278 to
K-320; Y-279 to K-320; L-280 to K-320; L-281 to K-320; L-282 to
K-320; P-283 to K-320; P-284 to K-320; V-285 to K-320; I-286 to
K-320; N-287 to K-320; P-288 to K-320; I-289 to K-320; I-290 to
K-320; Y-291 to K-320; G-292 to K-320; A-293 to K-320; K-294 to
K-320; T-295 to K-320; K-296 to K-320; Q-297 to K-320; I-298 to
K-320; R-299 to K-320; T-300 to K-320; R-301 to K-320; V-302 to
K-320; L-303 to K-320; A-304 to K-320; M-305 to K-320; F-306 to
K-320; K-307 to K-320; I-308 to K-320; S-309 to K-320; C-310 to
K-320; D-311 to K-320; K-312 to K-320; D-313 to K-320; L-314 to
K-320 and/or Q-315 to K-320 of the PSGR sequence shown in FIGS.
1A-B (SEQ ID NO:2). Polypeptides encoded by these polynucleotides
are also encompassed by the invention.
[0138] Also as mentioned above, even if deletion of one or more
amino acids from the C-terminus of a protein results in
modification of loss of one or more biological functions of the
protein, other functional activities (e.g., biological activities,
ability to multimerize, ability to bind PSGR ligand may still be
retained). For example the ability of the shortened PSGR mutein to
induce and/or bind to antibodies which recognize the complete or
mature forms of the polypeptide generally will be retained when
less than the majority of the residues of the complete or mature
polypeptide are removed from the C-terminus. Whether a particular
polypeptide lacking C-terminal residues of a complete polypeptide
retains such immunologic activities can readily be determined by
routine methods described herein and otherwise known in the art. It
is not unlikely that a PSGR mutein with a large number of deleted
C-terminal amino acid residues may retain some biological or
immunogenic activities. In fact, peptides composed of as few as six
PSGR amino acid residues may often evoke an immune response.
[0139] Accordingly, the present invention further provides
polypeptides having one or more residues deleted from the carboxy
terminus of the amino acid sequence of the PSGR polypeptide shown
in FIGS. 1A-B, up to the phenylalanine residue at position number
6, and polynucleotides encoding such polypeptides. In particular,
the present invention provides polypeptides comprising the amino
acid sequence of residues 1-m.sup.1 of FIGS. 1A-B, where m.sup.1 is
an integer from 6 to 319 corresponding to the position of the amino
acid residue in FIGS. 1A-B (SEQ ID NO:2).
[0140] More in particular, the invention provides polynucleotides
encoding polypeptides comprising, or alternatively consisting of,
the amino acid sequence of residues: M-1 to G-319; M-1 to G-318;
M-1 to V-317; M-1 to A-316; M-1 to Q-315; M-1 to L-314; M-1 to
D-313; M-1 to K-312; M-1 to D-311; M-1 to C-310; M-1 to S-309; M-1
to I-308; M-1 to K-307; M-1 to F-306; M-1 to M-305; M-1 to A-304;
M-1 to L-303; M-1 to V-302; M-1 to R-301; M-1 to T-300; M-1 to
R-299; M-1 to I-298; M-1 to Q-297; M-1 to K-296; M-1 to T-295; M-1
to K-294; M-1 to A-293; M-1 to G-292; M-1 to Y-291; M-1 to I-290;
M-1 to I-289; M-1 to P-288; M-1 to N-287; M-1 to I-286; M-1 to
V-285; M-1 to P-284; M-1 to P-283; M-1 to L-282; M-1 to L-281; M-1
to L-280; M-1 to Y-279; M-1 to I-278; M-1 to D-277; M-1 to G-276;
M-1 to M-275; M-1 to V-274; M-1 to V-273; M-1 to R-272; M-1 to
V-271; M-1 to I-270; M-1 to P-269; M-1 to H-268; M-1 to L-267; M-1
to S-266; M-1 to N-265; M-1 to G-264; M-1 to F-263; M-1 to R-262;
M-1 to H-261; M-1 to V-260; M-1 to V-259; M-1 to S-258; M-1 to
L-257; M-1 to G-256; M-1 to I-255; M-1 to L-254; M-1 to P-253; M-1
to V-252; M-1 to Y-251; M-1 to F-250; M-1 to A-249; M-1 to L-248;
M-1 to V-247; M-1 to V-246; M-1 to G-245; M-1 to I-244; M-1 to
H-243; M-1 to S-242; M-1 to V-241; M-1 to C-240; M-1 to T-239; M-1
to G-238; M-1 to F-237; M-1 to A-236; M-1 to K-235; M-1 to A-234;
M-1 to R-233; M-1 to E-232; M-1 to S-231; M-1 to K-230; M-1 to
S-229; M-1 to P-228; M-1 to L-227; M-1 to Q-226; M-1 to L-225; M-1
to V-224; M-1 to T-223; M-1 to R-222; M-1 to I-221; M-1 to I-220;
M-1 to L-219; M-1 to F-218; M-1 to Y-217; M-1 to S-216; M-1 to
L-215; M-1 to S-2 14; M-1 to I-213; M-1 to F-212; M-1 to M-211; M-1
to V-210; M-1 to D-209; M-1 to V-208; M-1 to G-207; M-1 to M-206;
M-1 to V-205; M-1 to L-204; M-1 to L-203; M-1 to I-202; M-1 to
A-201; M-1 to T-200; M-1 to L-199; M-1 to G-198; M-1 to Y-197; M-1
to V-196; M-1 to V-195; M-1 to N-194; M-1 to P-193; M-1 to L-192;
M-1 to T-191; M-1 to D-190; M-1 to A-189; M-1 to Y-188; M-1 to
A-187; M-1 to L-186; M-1 to K-185; M-1 to M-184; M-1 to V-183; M-1
to D-182; M-1 to Q-181; M-1 to H-180; M-1 to V-179; M-1 to C-178;
M-1 to Y-177; M-1 to S-176; M-1 to H-175; M-1 to S-174; M-1 to
L-173; M-1 to V-172; M-1 to N-171; M-1 to S-170; M-1 to H-169; M-1
to C-168; M-1 to F-167; M-1 to A-166; M-1 to L-165; M-1 to R-164;
M-1 to K-163; M-1 to I-162; M-1 to L-161; M-1 to L-160; M-1 to
P-159; M-1 to L-158; M-1 to P-157; M-1 to F-156; M-1 to F-155; M-1
to F-154; M-1 to L-153; M-1 to S-152; M-1 to G-151; M-1 to R-150;
M-1 to V-149; M-1 to V-148; M-1 to A-147; M-1 to V-146; M-1 to
I-145; M-1 to G-144; M-1 to I-143; M-1 to Q-142; M-1 to A-141; M-1
to T-140; M-1 to V-139; M-1 to T-138; M-1 to N-137; M-1 to N-136;
M-1 to L-135; M-1 to V-134; M-1 to A-133; M-1 to A-132; M-1 to
H-131; M-1 to R-130; M-1 to L-129; M-1 to P-128; M-1 to H-127; M-1
to C-126; M-1 to I-125; M-1 to A-124; M-1 to V-123; M-1 to Y-122;
M-1 to R-121; M-1 to D-120; M-1 to F-119; M-1 to A-118; M-1 to
M-117; M-1 to A-116; M-1 to L-115; M-1 to L-114; M-1 to I-113; M-1
to T-112; M-1 to S-111; M-1 to E-110; M-1 to I-109; M-1 to A-108;
M-1 to S-107; M-1 to L-106; M-1 to A-105; M-1 to H-104; M-1 to
I-103; M-1 to F-102; M-1 to F-101; M-1 to M-100; M-1 to Q-99; M-1
to T-98; M-1 to L-97; M-1 to C-96; M-1 to A-95; M-1 to E-94; M-1 to
I-93; M-1 to S-92; M-1 to I-91; M-1 to E-90; M-1 to R-89; M-1 to
S-88; M-1 to D-87; M-1 to F-86; M-1 to W-85; M-1 to F-84; M-1 to
L-83; M-1 to A-82; M-1 to L-81; M-1 to I-80; M-1 to K-79; M-1 to
P-78; M-1 to M-77; M-1 to T-76; M-1 to S-75; M-1 to T-74; M-1 to
S-73; M-1 to L-72; M-1 to A-71; M-1 to L-70; M-1 to D-69; M-1 to
I-68; M-1 to A-67; M-1 to A-66; M-1 to L-65; M-1 to M-64; M-1 to
C-63; M-1 to L-62; M-1 to F-61; M-1 to L-60; M-1 to Y-59; M-1 to
M-58; M-1 to P-57; M-1 to A-56; M-1 to H-55; M-1 to L-54; M-1 to
S-53; M-1 to R-52; M-1 to E-51; M-1 to T-50; M-1 to R-49; M-1 to
V-48; M-1 to I-47; M-1 to F-46; M-1 to V-45; M-1 to V-44; M-1 to
I-43; M-1 to C-42; M-1 to N-41; M-1 to G-40; M-1 to C-39; M-1 to
M-38; M-1 to A-37; M-1 to V-36; M-1 to V-35; M-1 to Y-34; M-1 to
M-33; M-1 to S-32; M-1 to L-31; M-1 to L-30; M-1 to P-29; M-1 to
F-28; M-1 to G-27; M-1 to V-26; M-1 to W-25; M-1 to F-24; M-1 to
H-23; M-1 to A-22; M-1 to K-21; M-1 to E-20; M-1 to L-19; M-1 to
G-18; M-1 to P-17; M-1 to I-16; M-1 to G-15; M-1 to I-14; M-1 to
L-13; M-1 to V-12; M-1 to C-11; M-1 to T-10; M-1 to A-9; M-1 to
H-8; M-1 to T-7 and/or M-1 to F-6 of the PSGR sequence shown in
FIGS. 1A-B (SEQ ID NO:2). Polypeptides encoded by these
polynucleotides are also encompassed by the invention.
[0141] The invention also provides polypeptides having one or more
amino acids deleted from both the amino and the carboxyl termini,
which may be described generally as having residues n.sup.1-m.sup.1
of FIGS. 1A-B (i.e., SEQ ID NO:2), where n.sup.1 and m.sup.1 are
integers as described above. Thus, any of the above listed N- or
C-terminal deletions can be combined to produce a N- and C-terminal
deleted PSGR polypeptide.
[0142] In addition, the invention provides the above described
polypeptide deletions (e.g., n.sup.1-320, 1-m.sup.1, or
n.sup.1-m.sup.1, where n.sup.1 and m.sup.1 are integers as
described above) containing one, two or all three of the following
substitutions: a F11 replaced with C; F39 replaced with C; and F93
replaced with I of the PSGR amino acid sequence shown in FIGS. 1A-B
(SEQ ID NO:2). Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0143] The present invention is also directed to nucleic acid
molecules comprising, or alternatively, consisting of, a
polynucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%,
98% or 99% identical to the polynucleotide sequence encoding the
PSGR polypeptides described above. The present invention also
encompasses the above polynucleotide sequences fused to a
heterologous polynucleotide sequence. Polypeptides encoded by these
nucleic acids and/or polynucleotide sequences are also encompassed
by the invention, as are polypeptides comprising, or alternatively
consisting of, an amino acid sequence at least 80%, 85%, 90%, 92%,
95%, 96%, 97%, 98% or 99% identical to the amino acid sequence
described above, and polynucleotides that encode such
polypeptides.
[0144] Additional preferred polynucleotides encode polypeptides
comprising, or alternatively consisting of, the amino acid sequence
of residues: M-1 to G-15; S-2 to I-16; S-3 to P-17; C-4 to G-18;
N-5 to L-19; F-6 to E-20; T-7 to K-21; H-8 to A-22; A-9 to H-23;
T-10 to F-24; C-11 to W-25; V-12 to V-26; L-13 to G-27; I-14 to
F-28; G-15 to P-29; I-16 to L-30; P-17 to L-31; G-18 to S-32; L-19
to M-33; E-20 to Y-34; K-21 to V-35; A-22 to V-36; H-23 to A-37;
F-24 to M-38; W-25 to C-39; V-26 to G-40; G-27 to N-41; F-28 to
C-42; P-29 to I-43; L-30 to V-44; L-31 to V-45; S-32 to F-46; M-33
to I-47; Y-34 to V-48; V-35 to R-49; V-36 to T-50; A-37 to E-51;
M-38 to R-52; C-39 to S-53; G-40 to L-54; N-41 to H-55; C-42 to
A-56; I-43 to P-57; V-44 to M-58; V-45 to Y-59; F-46 to L-60; I-47
to F-61; V-48 to L-62; R-49 to C-63; T-50 to M-64; E-51 to L-65;
R-52 to A-66; S-53 to A-67; L-54 to I-68; H-55 to D-69; A-56 to
L-70; P-57 to A-71; M-58 to L-72; Y-59 to S-73; L-60 to T-74; F-61
to S-75; L-62 to T-76; C-63 to M-77; M-64 to P-78; L-65 to K-79;
A-66 to I-80; A-67 to L-81; I-68 to A-82; D-69 to L-83; L-70 to
F-84; A-71 to W-85; L-72 to F-86; S-73 to D-87; T-74 to S-88; S-75
to R-89; T-76 to E-90; M-77 to I-91; P-78 to S-92; K-79 to I-93;
I-80 to E-94; L-81 to A-95; A-82 to C-96; L-83 to L-97; F-84 to
T-98; W-85 to Q-99; F-86 to M-100; D-87 to F-101; S-88 to F-102;
R-89 to I-103; E-90 to H-104; I-91 to A-105; S-92 to L-106; I-93 to
S-107; E-94 to A-108; A-95 to I-109; C-96 to E-110; L-97 to S-111;
T-98 to T-112; Q-99 to I-113; M-100 to L-114; F-101 to L-115; F-102
to A-116; I-103 to M -117; H-104 to A-118; A-105 to F-119; L-106 to
D-120; S-107 to R-121; A-108 to Y-122; 1-109 to V-123; E-110 to
A-124; S-111 to I-125; T-112 to C-126; I-113 to H-127; L-114 to
P-128; L-115 to L-129; A-116 to R-130; M 117 to H-131; A-118 to
A-132; F-119 to A-133; D-120 to V-134; R-121 to L-135; Y-122 to
N-136; V-123 to N-137; A-124 to T-138; I-125 to V-139; C-126 to
T-140; H-127 to A-141; P-128 to Q-142; L-129 to I-143; R-130 to
G-144; H-131 to I-145; A-132 to V-146; A-133 to A-147; V-134 to
V-148; L-135 to V-149; N-136 to R-150; N-137 to G-151; T-138 to
S-152; V-139 to L-153; T-140 to F-154; A-141 to F-155; Q-142 to
F-156; I-143 to P-157; G-144 to L-158; I-145 to P-159; V-146 to
L-160; A-147 to L-161; V-148 to I-162; V-149 to K-163; R-150 to
R-164; G-151 to L-165; S-152 to A-166; L-153 to F-167; F-154 to
C-168; F-155 to H-169; F-156 to S-170; P-157 to N-171; L-158 to
V-172; P-159 to L-173; L-160 to S-174; L-161 to H-175; I-162 to
S-176; K-163 to Y-177; R-164 to C-178; L-165 to V-179; A-166 to
H-180; F-167 to Q-181; C-168 to D-182; H-169 to V-183; S-170 to
M-184; N-171 to K-185; V-172 to L-186; L-173 to A-187; S-174 to
Y-188; H-175 to A-189; S-176 to D-190; Y-177 to T-191; C-178 to
L-192; V-179 to P-193; H-180 to N-194; Q-181 to V-195; D-182 to
V-196; V-183 to Y-197; M-184 to G-198; K-185 to L-199; L-186 to
T-200; A-187 to A-201; Y-188 to I-202; A-189 to L-203; D-190 to
L-204; T-191 to V-205; L-192 to M-206; P-193 to G-207; N-194 to
V-208; V-195 to D-209; V-196 to V-210; Y-197 to M-211; G-198 to
F-212; L-199 to I-213; T-200 to S-214; A-201 to L-215; I-202 to
S-216; L-203 to Y-217; L-204 to F-218; V-205 to L-219; M-206 to
I-220; G-207 to I-221; V-208 to R-222; D-209 to T-223; V-210 to
V-224; M-211 to L-225; F-212 to Q-226; I-213 to L-227; S-214 to
P-228; L-215 to S-229; S-216 to K-230; Y-217 to S-231; F-218 to
E-232; L-219 to R-233; I-220 to A-234; I-221 to K-235; R-222 to
A-236; T-223 to F-237; V-224 to G-238; L-225 to T-239; Q-226 to
C-240; L-227 to V-241; P-228 to S-242; S-229 to H-243; K-230 to
I-244; S-231 to G-245; E-232 to V-246; R-233 to V-247; A-234 to
L-248; K-235 to A-249; A-236 to F-250; F-237 to Y-251; G-238 to
V-252; T-239 to P-253; C-240 to L-254; V-241 to I-255; S-242 to
G-256; H-243 to L-257; I-244 to S-258; G-245 to V-259; V-246 to
V-260; V-247 to H-261; L-248 to R-262; A-249 to F-263; F-250 to
G-264; Y-251 to N-265; V-252 to S-266; P-253 to L-267; L-254 to
H-268; I-255 to P-269; G-256 to I-270; L-257 to V-271; S-258 to
R-272; V-259 to V-273; V-260 to V-274; H-261 to M-275; R-262 to
G-276; F-263 to D-277; G-264 to I-278; N-265 to Y-279; S-266 to
L-280; L-267 to L-281; H-268 to L-282; P-269 to P-283; I-270 to
P-284; V-271 to V-285; R-272 to I-286; V-273 to N-287; V-274 to
P-288; M-275 to I-289; G-276 to I-290; D-277 to Y-291; I-278 to
G-292; Y-279 to A-293; L-280 to K-294; L-281 to T-295; L-282 to
K-296; P-283 to Q-297; P-284 to I-298; V-285 to R-299; I-286 to
T-300; N-287 to R-301; P-288 to V-302; 1-289 to L-303; I-290 to
A-304; Y-291 to M-305; G-292 to F-306; A-293 to K-307; K-294 to
I-308; T-295 to S-309; K-296 to C-310; Q-297 to D-311; I-298 to
K-312; R-299 to D-313; T-300 to L-314; R-301 to Q-315; V-302 to
A-316; L-303 to V-317; A-304 to G-318; M-305 to G-319; and F-306 to
K-320 of SEQ ID NO:2. These polypeptide fragments may retain the
biological activity of PSGR polypeptides of the invention and/or
may be useful to generate or screen for antibodies, as described
further below. Polynucleotides encoding these polypeptide fragments
are also encompassed by the invention.
[0145] In addition, the invention provides the above described
polypeptide fragments containing one, two or all three of the
following substitutions: a F11 replaced with C; F39 replaced with
C; and F93 replaced with I of the PSGR amino acid sequence shown in
FIGS. 1A-B (SEQ ID NO:2). Polynucleotides encoding these
polypeptides are also encompassed by the invention.
[0146] The present application is also directed to nucleic acid
molecules comprising, or alternatively, consisting of, a
polynucleotide sequence at least 90%, 92%, 95%, 96%, 97%, 98%, or
99% identical to the polynucleotide sequence encoding the PSGR
polypeptides described above. The present invention also
encompasses the above polynucleotide sequences fused to a
heterologous polynucleotide sequence. Additionally, the present
application is also directed to proteins containing polypeptides at
least 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to
the PSGR polypeptide fragments set forth above. Polypeptides
encoded by these polynucleotides are also encompassed by the
invention.
[0147] It will be recognized in the art that some amino acid
sequences of PSGR can be varied without significant effect on the
structure or function of the protein. If such differences in
sequence are contemplated, it should be remembered that there will
be critical areas on the protein which determine activity. Thus,
the invention further includes variations of the PSGR receptor,
which show substantial PSGR receptor activity or which include
regions of PSGR proteins, such as the protein portions discussed
herein. Such mutants include deletions, insertions, inversions,
repeats, and type substitutions.
[0148] For example, guidance concerning how to make phenotypically
silent amino acid substitutions is provided in Bowie et al.,
"Deciphering the Message in Protein Sequences: Tolerance to Amino
Acid Substitutions," Science 247:1306-1310 (1990), wherein the
authors indicate that there are two main strategies for studying
the tolerance of an amino acid sequence to change.
[0149] The first strategy exploits the tolerance of amino acid
substitutions by natural selection during the process of evolution.
By comparing amino acid sequences in different species, conserved
amino acids can be identified. These conserved amino acids are
likely important for protein function. In contrast, the amino acid
positions where substitutions have been tolerated by natural
selection indicates that these positions are not critical for
protein function. Thus, positions tolerating amino acid
substitution could be modified while still maintaining biological
activity of the protein.
[0150] The second strategy uses genetic engineering to introduce
amino acid changes at specific positions of a cloned gene to
identify regions critical for protein function. For example, site
directed mutagenesis or alanine-scanning mutagenesis (introduction
of single alanine mutations at every residue in the molecule) can
be used. (Cunningham and Wells, Science 244:1081-1085 (1989).) The
resulting mutant molecules can then be tested for biological
activity.
[0151] As the authors state, these two strategies have revealed
that proteins are surprisingly tolerant of amino acid
substitutions. The authors further indicate which amino acid
changes are likely to be permissive at certain amino acid positions
in the protein. For example, most buried (within the tertiary
structure of the protein) amino acid residues require nonpolar side
chains, whereas few features of surface side chains are generally
conserved. Moreover, tolerated conservative amino acid
substitutions involve replacement of the aliphatic or hydrophobic
amino acids Ala, Val, Leu and Ile; replacement of the hydroxyl
residues Ser and Thr; replacement of the acidic residues Asp and
Glu; replacement of the amide residues Asn and Gln, replacement of
the basic residues Lys, Arg, and His; replacement of the aromatic
residues Phe, Tyr, and Trp, and replacement of the small-sized
amino acids Ala, Ser, Thr, Met, and Gly.
[0152] For example, site directed changes at the amino acid level
of PSGR can be made by replacing a particular amino acid with a
conservative amino acid. Preferred conservative mutations include:
M1 replaced with A, G, I, L, S, T, or V; S2 replaced with A, G, I,
L, T, M, or V; S3 replaced with A, G, I, L, T, M, or V; N5 replaced
with Q; F6 replaced with W, or Y; T7 replaced with A, G, I, L, S,
M, or V; H8 replaced with K, or R; A9 replaced with G, I, L, S, T,
M, or V; T10 replaced with A, G, I, L, S, M, or V; V12 replaced
with A, G, I, L, S, T, or M; L13 replaced with A, G, I, S, T, M, or
V; I14 replaced with A, G, L, S, T, M, or V; G15 replaced with A,
I, L, S, T, M, or V; 116 replaced with A, G, L, S, T, M, or V; G18
replaced with A, I, L, S, T, M, or V; L19 replaced with A, G, I, S,
T, M, or V; E20 replaced with D; K21 replaced with H, or R; A22
replaced with G, I, L, S, T, M, or V; H23 replaced with K, or R;
F24 replaced with W, or Y; W25 replaced with F, or Y; V26 replaced
with A, G, I, L, S, T, or M; G27 replaced with A, I, L, S, T, M, or
V; F28 replaced with W, or Y; L30 replaced with A, G, I, S, T, M,
or V; L31 replaced with A, G, I, S, T, M, or V; S32 replaced with
A, G, I, L, T, M, or V; M33 replaced with A, G, I, L, S, T, or V;
Y34 replaced with F, or W; V35 replaced with A, G, I, L, S, T, or
M; V36 replaced with A, G, I, L, S, T, or M; A37 replaced with G,
I, L, S, T, M, or V; M38 replaced with A, G, I, L, S, T, or V; G40
replaced with A, I, L, S, T, M, or V; N41 replaced with Q; 143
replaced with A, G, L, S, T, M, or V; V44 replaced with A, G, I, L,
S, T, or M; V45 replaced with A, G, I, L, S, T, or M; F46 replaced
with W, or Y; I47 replaced with A, G, L, S, T, M, or V; V48
replaced with A, G, I, L, S, T, or M; R49 replaced with H, or K;
T50 replaced with A, G, I, L, S, M, or V; E51 replaced with D; R52
replaced with H, or K; S53 replaced with A, G, I, L, T, M, or V;
L54 replaced with A, G, I, S, T, M, or V; H55 replaced with K, or
R; A56 replaced with G, I, L, S, T, M, or V; M58 replaced with A,
G, I, L, S, T, or V; Y59 replaced with F, or W; L60 replaced with
A, G, I, S, T, M, or V; F61 replaced with W, or Y; L62 replaced
with A, G, I, S, T, M, or V; M64 replaced with A, G, I, L, S, T, or
V; L65 replaced with A, G, I, S, T, M, or V; A66 replaced with G,
I, L, S, T, M, or V; A67 replaced with G, I, L, S, T, M, or V; 168
replaced with A, G, L, S, T, M, or V; D69 replaced with E; L70
replaced with A, G, I, S, T, M, or V; A71 replaced with G, I, L, S,
T, M, or V; L72 replaced with A, G, I, S, T, M, or V; S73 replaced
with A, G, I, L, T, M, or V; T74 replaced with A, G, I, L, S, M, or
V; S75 replaced with A, G, I, L, T, M, or V; T76 replaced with A,
G, I, L, S, M, or V; M77 replaced with A, G, I, L, S, T, or V; K79
replaced with H, or R; 180 replaced with A, G, L, S, T, M, or V;
L81 replaced with A, G, I, S, T, M, or V; A82 replaced with G, I,
L, S, T, M, or V; L83 replaced with A, G, I, S, T, M, or V; F84
replaced with W, or Y; W85 replaced with F, or Y; F86 replaced with
W, or Y; D87 replaced with E; S88 replaced with A, G, I, L, T, M,
or V; R89 replaced with H, or K; E90 replaced with D; I91 replaced
with A, G, L, S, T, M, or V; S92 replaced with A, G, I, L, T, M, or
V; 193 replaced with A, G, L, S, T, M, or V; E94 replaced with D;
A95 replaced with G, I, L, S, T, M, or V; L97 replaced with A, G,
I, S, T, M, or V; T98 replaced with A, G, I, L, S, M, or V; Q99
replaced with N; M100 replaced with A, G, I, L, S, T, or V; F101
replaced with W, or Y; F102 replaced with W, or Y; I103 replaced
with A, G, L, S, T, M, or V; H104 replaced with K, or R; A105
replaced with G, I, L, S, T, M, or V; L106 replaced with A, G, I,
S, T, M, or V; S107 replaced with A, G, I, L, T, M, or V; A108
replaced with G, I, L, S, T, M, or V; I109 replaced with A, G, L,
S, T, M, or V; E110 replaced with D; S111 replaced with A, G, I, L,
T, M, or V; T112 replaced with A, G, I, L, S, M, or V; I113
replaced with A, G, L, S, T, M, or V; L114 replaced with A, G, I,
S, T, M, or V; L115 replaced with A, G, I, S, T, M, or V; A116
replaced with G, I, L, S, T, M, or V; M117 replaced with A, G, I,
L, S, T, or V; A118 replaced with G, I, L, S, T, M, or V; F119
replaced with W, or Y; D120 replaced with E; R121 replaced with H,
or K; Y122 replaced with F, or W; V123 replaced with A, G, I, L, S,
T, or M; A124 replaced with G, I, L, S, T, M, or V; I125 replaced
with A, G, L, S, T, M, or V; H127 replaced with K, or R; L129
replaced with A, G, I, S, T, M, or V; R130 replaced with H, or K;
H131 replaced with K, or R; A132 replaced with G, I, L, S, T, M, or
V; A133 replaced with G, I, L, S, T, M, or V; V134 replaced with A,
G, I, L, S, T, or M; L135 replaced with A, G, I, S, T, M, or V;
N136 replaced with Q; N137 replaced with Q; T138 replaced with A,
G, I, L, S, M, or V; V139 replaced with A, G, I, L, S, T, or M;
T140 replaced with A, G, I, L, S, M, or V; A141 replaced with G, I,
L, S, T, M, or V; Q142 replaced with N; I143 replaced with A, G, L,
S, T, M, or V; G144 replaced with A, I, L, S, T, M, or V; I145
replaced with A, G, L, S, T, M, or V; V146 replaced with A, G, I,
L, S, T, or M; A147 replaced with G, I, L, S, T, M, or V; V148
replaced with A, G, I, L, S, T, or M; V149 replaced with A, G, I,
L, S, T, or M; R150 replaced with H, or K; G151 replaced with A, I,
L, S, T, M, or V; S152 replaced with A, G, I, L, T, M, or V; L153
replaced with A, G, I, S, T, M, or V; F154 replaced with W, or Y;
F155 replaced with W, or Y; F156 replaced with W, or Y; L158
replaced with A, G, I, S, T, M, or V; L160 replaced with A, G, I,
S, T, M, or V; L161 replaced with A, G, I, S, T, M, or V; I162
replaced with A, G, L, S, T, M, or V; K163 replaced with H, or R;
R164 replaced with H, or K; L165 replaced with A, G, I, S, T, M, or
V; A166 replaced with G, I, L, S, T, M, or V; F167 replaced with W,
or Y; H169 replaced with K, or R; S170 replaced with A, G, I, L, T,
M, or V; N171 replaced with Q; V172 replaced with A, G, I, L, S, T,
or M; L173 replaced with A, G, I, S, T, M, or V; S174 replaced with
A, G, I, L, T, M, or V; H175 replaced with K, or R; S176 replaced
with A, G, I, L, T, M, or V; Y177 replaced with F, or W; V179
replaced with A, G, I, L, S, T, or M; H180 replaced with K, or R;
Q181 replaced with N; D182 replaced with E; V183 replaced with A,
G, I, L, S, T, or M; M184 replaced with A, G, I, L, S, T, or V;
K185 replaced with H, or R; L186 replaced with A, G, I, S, T, M, or
V; A187 replaced with G, I, L, S, T, M, or V; Y188 replaced with F,
or W; A189 replaced with G, I, L, S, T, M, or V; D190 replaced with
E; T191 replaced with A, G, I, L, S, M, or V; L192 replaced with A,
G, I, S, T, M, or V; N194 replaced with Q; V195 replaced with A, G,
I, L, S, T, or M; V196 replaced with A, G, I, L, S, T, or M; Y197
replaced with F, or W; G198 replaced with A, I, L, S, T, M, or V;
L199 replaced with A, G, I, S, T, M, or V; T200 replaced with A, G,
I, L, S, M, or V; A201 replaced with G, I, L, S, T, M, or V; I202
replaced with A, G, L, S, T, M, or V; L203 replaced with A, G, I,
S, T, M, or V; L204 replaced with A, G, I, S, T, M, or V; V205
replaced with A, G, I, L, S, T, or M; M206 replaced with A, G, I,
L, S, T, or V; G207 replaced with A, I, L, S, T, M, or V; V208
replaced with A, G, I, L, S, T, or M; D209 replaced with E; V210
replaced with A, G, I, L, S, T, or M; M211 replaced with A, G, I,
L, S, T, or V; F212 replaced with W, or Y; I213 replaced with A, G,
L, S, T, M, or V; S214 replaced with A, G, I, L, T, M, or V; L215
replaced with A, G, I, S, T, M, or V; S216 replaced with A, G, I,
L, T, M, or V; Y217 replaced with F, or W; F218 replaced with W, or
Y; L219 replaced with A, G, I, S, T, M, or V; 1220 replaced with A,
G, L, S, T, M, or V; I221 replaced with A, G, L, S, T, M, or V;
R222 replaced with H, or K; T223 replaced with A, G, I, L, S, M, or
V; V224 replaced with A, G, I, L, S, T, or M; L225 replaced with A,
G, I, S, T, M, or V; Q226 replaced with N; L227 replaced with A, G,
I, S, T, M, or V; S229 replaced with A, G, I, L, T, M, or V; K230
replaced with H, or R; S231 replaced with A, G, I, L, T, M, or V;
E232 replaced with D; R233 replaced with H, or K; A234 replaced
with G, I, L, S, T, M, or V; K235 replaced with H, or R; A236
replaced with G, I, L, S, T, M, or V; F237 replaced with W, or Y;
G238 replaced with A, I, L, S, T, M, or V; T239 replaced with A, G,
I, L, S, M, or V; V241 replaced with A, G, I, L, S, T, or M; S242
replaced with A, G, I, L, T, M, or V; H243 replaced with K, or R;
1244 replaced with A, G, L, S, T, M, or V; G245 replaced with A, I,
L, S, T, M, or V; V246 replaced with A, G, I, L, S, T, or M; V247
replaced with A, G, I, L, S, T, or M; L248 replaced with A, G, I,
S, T, M, or V; A249 replaced with G, I, L, S, T, M, or V; F250
replaced with W, or Y; Y251 replaced with F, or W; V252 replaced
with A, G, I, L, S, T, or M; L254 replaced with A, G, I, S, T, M,
or V; 1255 replaced with A, G, L, S, T, M, or V; G256 replaced with
A, I, L, S, T, M, or V; L257 replaced with A, G, I, S, T, M, or V;
S258 replaced with A, G, I, L, T, M, or V; V259 replaced with A, G,
I, L, S, T, or M; V260 replaced with A, G, I, L, S, T, or M; H261
replaced with K, or R; R262 replaced with H, or K; F263 replaced
with W, or Y; G264 replaced with A, I, L, S, T, M, or V; N265
replaced with Q; S266 replaced with A, G, I, L, T, M, or V; L267
replaced with A, G, I, S, T, M, or V; H268 replaced with K, or R;
I270 replaced with A, G, L, S, T, M, or V; V271 replaced with A, G,
I, L, S, T, or M; R272 replaced with H, or K; V273 replaced with A,
G, I, L, S, T, or M; V274 replaced with A, G, I, L, S, T, or M;
M275 replaced with A, G, I, L, S, T, or V; G276 replaced with A, I,
L, S, T, M, or V; D277 replaced with E; I278 replaced with A, G, L,
S, T, M, or V; Y279 replaced with F, or W; L280 replaced with A, G,
I, S, T, M, or V; L281 replaced with A, G, I, S, T, M, or V; L282
replaced with A, G, I, S, T, M, or V; V285 replaced with A, G, I,
L, S, T, or M; 1286 replaced with A, G, L, S, T, M, or V; N287
replaced with Q; I289 replaced with A, G, L, S, T, M, or V; I290
replaced with A, G, L, S, T, M, or V; Y291 replaced with F, or W;
G292 replaced with A, I, L, S, T, M, or V; A293 replaced with G, I,
L, S, T, M, or V; K294 replaced with H, or R; T295 replaced with A,
G, I, L, S, M, or V; K296 replaced with H, or R; Q297 replaced with
N; I298 replaced with A, G, L, S, T, M, or V; R299 replaced with H,
or K; T300 replaced with A, G, I, L, S, M, or V; R301 replaced with
H, or K; V302 replaced with A, G, I, L, S, T, or M; L303 replaced
with A, G, I, S, T, M, or V; A304 replaced with G, I, L, S, T, M,
or V; M305 replaced with A, G, I, L, S, T, or V; F306 replaced with
W, or Y; K307 replaced with H, or R; I308 replaced with A, G, L, S,
T, M, or V; S309 replaced with A, G, I, L, T, M, or V; D311
replaced with E; K312 replaced with H, or R; D313 replaced with E;
L314 replaced with A, G, I, S, T, M, or V; Q315 replaced with N;
A316 replaced with G, I, L, S, T, M, or V; V317 replaced with A, G,
I, L, S, T, or M; G318 replaced with A, I, L, S, T, M, or V; G319
replaced with A, I, L, S, T, M, or V; and/or K320 replaced with H,
or R in the PSGR amino acid sequence shown in FIGS. 1A-B (SEQ ID
NO:2).
[0153] The resulting constructs can be routinely screened for
activities or finctions described throughout the specification and
known in the art. Preferably, the resulting constructs have an
increased and/or a decreased PSGR activity or function, while the
remaining PSGR activities or functions are maintained. More
preferably, the resulting constructs have more than one increased
and/or decreased PSGR activity or function, while the remaining
PSGR activities or functions are maintained.
[0154] Besides conservative amino acid substitution, variants of
PSGR include (i) substitutions with one or more of the
non-conserved amino acid residues, where the substituted amino acid
residues may or may not be one encoded by the genetic code, or (ii)
substitution with one or more of amino acid residues having a
substituent group, or (iii) fusion of the mature polypeptide with
another compound, such as a compound to increase the stability
and/or solubility of the polypeptide (for example, polyethylene
glycol), or (iv) fusion of the polypeptide with additional amino
acids, such as, for example, an IgG Fc fusion region peptide, or
leader or secretory sequence, or a sequence facilitating
purification or (v) fusion of the polypeptide with another
compound, such as albumin (including but not limited to recombinant
albumin (see, e.g., U.S. Pat. No. 5,876,969, issued Mar. 2, 1999,
EP Patent 0 413 622, and U.S. Pat. No. 5,766,883, issued Jun. 16,
1998, herein incorporated by reference in their entirety)). Such
variant polypeptides are deemed to be within the scope of those
skilled in the art from the teachings herein.
[0155] For example, PSGR polypeptide variants containing amino acid
substitutions of charged amino acids with other charged or neutral
amino acids may produce proteins with improved characteristics,
such as less aggregation. Aggregation of pharmaceutical
formulations both reduces activity and increases clearance due to
the aggregate's immunogenic activity. (Pinckard et al., Clin. Exp.
Inmunol. 2:331-340 (1967); Robbins et al., Diabetes 36: 838-845
(1987); Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems
10:307-377 (1993).)
For example, preferred non-conservative substitutions of PSGR
include M1 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S2
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S3 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; C4 replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; N5 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; F6
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
T7 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H8 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A9
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T10 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; C11 replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; V12 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; L13 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; I14 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; G15 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; I16 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; P17 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, or C; G18 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; L19 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
E20 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; K21 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, P, or C; A22 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; H23 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W,
Y, P, or C; F24 replaced with D, E, H, K, R, N, Q, A, G, I, L, S,
T, M, V, P, or C; W25 replaced with D, E, H, K, R, N, Q, A, G, I,
L, S, T, M, V, P, or C; V26 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; G27 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; F28 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M,
V, P, or C; P29 replaced with D, E, H, K, R, A, G, I, L, S, T, M,
V, N, Q, F, W, Y, or C; L30 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; L31 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; S32 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M33
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y34 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; V35
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V36 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; A37 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; M38 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; C39 replaced with D, E, H, K, R, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, or P; G40 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; N41 replaced with D, E, H, K, R, A, G,
I, L, S, T, M, V, F, W, Y, P, or C; C42 replaced with D, E, H, K,
R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; I43 replaced with
D, E, H, K, R, N, Q, F, W, Y, P, or C; V44 replaced with D, E, H,
K, R, N, Q, F, W, Y, P, or C; V45 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; F46 replaced with D, E, H, K, R, N, Q, A, G,
I, L, S, T, M, V, P, or C; 147 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; V48 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; R49 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, P, or C; T50 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; E51 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, P, or C; R52 replaced with D, E, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, P, or C; S53 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; L54 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; H55 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; A56 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
P57 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, or C; M58 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; Y59 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V,
P, or C; L60 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
F61 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; L62 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C63
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or P; M64 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L65
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A66 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; A67 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; 168 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; D69 replaced with H, K, R, A, G, I, L, S,
T, M, V, N, Q, F, W, Y, P, or C; L70 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; A71 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; L72 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; S73 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T74
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S75 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; T76 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; M77 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; P78 replaced with D, E, H, K, R, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, or C; K79 replaced with D, E, A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I80 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; L81 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; A82 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; L83 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; F84 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M,
V, P, or C; W85 replaced with D, E, H, K, R, N, Q, A, G, I, L, S,
T, M, V, P, or C; F86 replaced with D, E, H, K, R, N, Q, A, G, I,
L, S, T, M, V, P, or C; D87 replaced with H, K, R, A, G, I, L, S,
T, M, V, N, Q, F, W, Y, P, or C; S88 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; R89 replaced with D, E, A, G, I, L, S, T,
M, V, N, Q, F, W, Y, P, or C; E90 replaced with H, K, R, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, P, or C; 191 replaced with D, E, H,
K, R, N, Q, F, W, Y, P, or C; S92 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; 193 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; E94 replaced with H, K, R, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, P, or C; A95 replaced with D, E, H, K, P, N, Q, F, W,
Y, P, or C; C96 replaced with D, E, H, K, R, A, G, I, L, S, T, M,
V, N, Q, F, W, Y, or P; L97 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; T98 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; Q99 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F,
W, Y, P, or C; M100 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; F101 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M,
V, P, or C; F102 replaced with D, E, H, K, R, N, Q, A, G, I, L, S,
T, M, V, P, or C; I103 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; H104 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, P, or C; A105 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; L106 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
S107 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A108
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I109 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; E110 replaced with H,
K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; S111 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; T112 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; I113 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; L114 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; L115 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; A116 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
M117 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A118
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F119 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; D120
replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or
C; R121 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; Y122 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T,
M, V, P, or C; V123 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; A124 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
I125 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C126
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or P; H127 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W,
Y, P, or C; P128 replaced with D, E, H, K, R, A, G, I, L, S, T, M,
V, N, Q, F, W, Y, or C; L129 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; R130 replaced with D, E, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, P, or C; H131 replaced with D, E, A, G, I, L, S, T, M,
V, N, Q, F, W, Y, P, or C; A132 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; A133 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; V134 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
L135 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N136
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or
C; N137 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W,
Y, P, or C; T138 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; V139 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T140
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A141 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q142 replaced with D,
E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; I143 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; G144 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; I145 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; V146 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; A147 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; V148 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
V149 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R150
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
G151 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S152
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L153 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; F154 replaced with D,
E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F155 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F156
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
P157 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, or C; L158 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; P159 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q,
F, W, Y, or C; L160 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; L161 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
I162 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K163
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
R164 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P,
or C; L165 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
A166 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F167
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
C168 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, or P; H169 replaced with D, E, A, G, I, L, S, T, M, V, N, Q,
F, W, Y, P, or C; S170 replaced with D, E, H, K, R, N, Q, F, W, Y,
P,or C; N171 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V,
F, W, Y, P, or C; V172 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; L173 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
S174 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H175
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
S176 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y177
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
C178 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, or P; V179 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; H180 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; Q181 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V,
F, W, Y, P, or C; D182 replaced with H, K, R, A, G, I, L, S, T, M,
V, N, Q, F, W, Y, P, or C; V183 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; M184 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; K185 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, P, or C; L186 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; A187 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
Y188 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; A189 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
D190 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; T191 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
L192 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P193
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or C; N194 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F,
W, Y, P, or C; V195 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; V196 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
Y197 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; G198 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
L199 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T200
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A201 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; I202 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; L203 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; L204 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; V205 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; M206 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
G207 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V208
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D209 replaced
with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; V210
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M211 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; F212 replaced with D,
E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; I213 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; S214 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; L215 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; S216 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; Y217 replaced with D, E, H, K, R, N, Q, A, G, I,
L, S, T, M, V, P, or C; F218 replaced with D, E, H, K, R, N, Q, A,
G, I, L, S, T, M, V, P, or C; L219 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; I220 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; I221 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; R222 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; T223 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
V224 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L225
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q226 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; L227
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P228 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C;
S229 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K230
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
S231 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E232
replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or
C; R233 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; A234 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
K235 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P,
or C; A236 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
F237 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; G238 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
T239 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C240
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or P; V241 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
S242 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H243
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
1244 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G245
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V246 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; V247 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; L248 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; A249 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; F250 replaced with D, E, H, K, R, N, Q, A, G, I,
L, S, T, M, V, P, or C; Y251 replaced with D, E, H, K, R, N, Q, A,
G, I, L, S, T, M, V, P, or C; V252 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; P253 replaced with D, E, H, K, R, A, G, I, L,
S, T, M, V, N, Q, F, W, Y, or C; L254 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; I255 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; G256 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; L257 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
S258 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V259
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V260 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; H261 replaced with D,
E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R262 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; F263
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
G264 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N265
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or
C; S266replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L267
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H268 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; P269
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or C; I270 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
V271 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R272
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
V273 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V274
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M275 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; G276 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; D277 replaced with H, K, R, A,
G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I278 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; Y279 replaced with D, E, H, K,
R, N, Q, A, G, I, L, S, T, M, V, P, or C; L280 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; L281 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; L282 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; P283 replaced with D, E, H, K, R, A, G, I, L, S, T,
M, V, N, Q, F, W, Y, or C; P284
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or C; V285 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
I286 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N287
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or
C; P288 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q,
F, W, Y, or C; I289 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; I290 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
Y291 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; G292 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
A293 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K294
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
T295 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K296
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
Q297 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y,
P, or C; I298 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
R299 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P,
or C; T300 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
R301 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P,
or C; V302 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
L303 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A304
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M305 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; F306 replaced with D,
E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; K307 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I308
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S309 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; C310 replaced with D,
E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; D311
replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or
C; K312 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; D313 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q,
F, W, Y, P, or C; L314 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; Q315 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V,
F, W, Y, P, or C; A316 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; V317 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
G318 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G319
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; and/or K320
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C
of the PSGR amino acid sequence shown in FIGS.
[0156] 1A-B (SEQ ID NO:2).
[0157] The resulting constructs can be routinely screened for
activities or functions described throughout the specification and
known in the art. Preferably, the resulting constructs have an
increased and/or decreased PSGR activity or function, while the
remaining PSGR activities or finctions are maintained. More
preferably, the resulting constructs have more than one increased
and/or decreased PSGR activity or function, while the remaining
PSGR activities or functions are maintained.
[0158] Additionally, more than one amino acid (e.g., 2, 3, 4, 5, 6,
7, 8, 9 and 10) can be replaced with the substituted amino acids as
described above (either conservative or nonconservative). The
substituted amino acids can occur in the full length, mature, or
proprotein form of PSGR protein, as well as the N- and C-terminal
deletion mutants, having the general formula n.sup.1-m.sup.1,
listed above.
[0159] A further embodiment of the invention relates to a
polypeptide which comprises the amino acid sequence of a PSGR
polypeptide having an amino acid sequence which contains at least
one amino acid substitution, but not more than 50 amino acid
substitutions, even more preferably, not more than 40 amino acid
substitutions, still more preferably, not more than 30 amino acid
substitutions, and still even more preferably, not more than 20
amino acid substitutions. Of course, in order of ever-increasing
preference, it is highly preferable for a polypeptide to have an
amino acid sequence which comprises the amino acid sequence of a
PSGR polypeptide, which contains at least one, but not more than
10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid substitutions. In
specific embodiments, the number of additions, substitutions,
and/or deletions in the amino acid sequence of FIGS. 1A-B or
fragments thereof (e.g., the mature form and/or other fragments
described herein), is 1-5, 5-10, 5-25, 5-50, 10-50 or 50-150,
conservative amino acid substitutions are preferable.
[0160] Preferred substitutions include F11 replaced with C; F39
replaced with C; and F93 replaced with I of the PSGR amino acid
sequence shown in FIGS. 1A-B (SEQ ID NO:2). Polynucleotides
encoding these polypeptides are also encompassed by the
invention.
[0161] Thus, the fragment, derivative, or analog of the polypeptide
of FIGS. 1A-B (SEQ ID NO:2), or a polypeptide of FIGS. 2A-B (SEQ ID
NO:4), or a polypeptide encoded by of the cDNA in ATCC Deposit No.
97131, may be (i) one in which at least one or more of the amino
acid residues are substituted with a conserved or non-conserved
amino acid residue (preferably a conserved amino acid residue(s),
and more preferably at least one but less than ten conserved amino
acid residues) and such substituted amino acid residue may or may
not be one encoded by the genetic code, or (ii) one in which one or
more of the amino acid residues includes a substituent group, or
(iii) one in which the mature polypeptide is fused with another
compound, such as a compound to increase the half-life of the
polypeptide (for example, polyethylene glycol), or (iv) one in
which the additional amino acids are fused to the mature
polypeptide, such as an IgG Fc fusion region peptide or leader or
secretory sequence or a sequence which is employed for purification
of the mature polypeptide or a proprotein sequence or (v) one in
which the mature polypeptide is fused with another compound, such
as albumin (including but not limited to recombinant albumin (see,
e.g., U.S. Pat. No. 5,876,969, issued Mar. 2, 1999, EP Patent 0 413
622, and U.S. Pat. No. 5,766,883, issued Jun. 16, 1998, herein
incorporated by reference in their entirety)). Such fragments,
derivatives and analogs are deemed to be within the scope of those
skilled in the art from the teachings herein.
[0162] The replacement of amino acids can also change the
selectivity of binding to cell surface receptors. Ostade et al.,
Nature 361:266-268 (1993), describes certain mutations resulting in
selective binding of TNF-.alpha. to only one of the two known types
of TNF receptors. Thus, the PSGR polypeptides of the present
invention may include one or more amino acid substitutions,
deletions, or additions, either from natural mutations or human
manipulation.
[0163] In specific embodiments, the number of substitutions,
additions or deletions in the amino acid sequence of FIGS. 1A-B
and/or any of the polypeptide fragments described herein (e.g., the
extracellular domain, transmembrane domains, or intracellular
domain) is 75, 70, 60, 50, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6,
5, 4, 3, 2, 1 or 30-20, 20-15, 20-10, 15-10, 10-1, 5-10, 1-5, 1-3
or 1-2.
[0164] Amino acids in the PSGR proteins of the present invention
that are essential for function can be identified by methods known
in the art, such as site-directed mutagenesis or alanine-scanning
mutagenesis (Cunningham and Wells, Science 244:1081-1085 (1989)).
The latter procedure introduces single alanine mutations at every
residue in the molecule. The resulting mutant molecules are then
tested for biological activity such as receptor binding or in vitro
proliferative activity. Sites that are critical for ligand-receptor
binding can also be determined by structural analysis such as
crystallization, nuclear magnetic resonance or photoaffinity
labeling (Smith et al., J. Mol. Biol. 224:899-904 (1992) and de Vos
et al. Science 255:306-312 (1992)).
[0165] To improve or alter the characteristics of PSGR
polypeptides, protein engineering may be employed. Recombinant DNA
technology known to those skilled in the art can be used to create
novel mutant proteins or "muteins including single or multiple
amino acid substitutions, deletions, additions or fusion proteins.
Such modified polypeptides can show, e.g., enhanced activity or
increased stability. In addition, they may be purified in higher
yields and show better solubility than the corresponding natural
polypeptide, at least under certain purification and storage
conditions.
[0166] Non-naturally occurring variants may be produced using
art-known mutagenesis techniques, which include, but are not
limited to oligonucleotide mediated mutagenesis, alanine scanning,
PCR mutagenesis, site directed mutagenesis (see e.g., Carter et
al., Nucl. Acids Res. 13:4331 (1986); and Zoller et al., Nucl.
Acids Res. 10:6487 (1982)), cassette mutagenesis (see e.g., Wells
et al., Gene 34:315 (1985)), restriction selection mutagenesis (see
e.g., Wells et al., Philos. Trans. R. Soc. London SerA 317:415
(1986)).
[0167] Thus, the invention also encompasses PSGR derivatives and
analogs that have one or more amino acid residues deleted, added,
or substituted to generate PSGR polypeptides that are better suited
for expression, scale up, etc., in the host cells chosen. For
example, cysteine residues can be deleted or substituted with
another amino acid residue in order to eliminate disulfide bridges;
N-linked glycosylation sites can be altered or eliminated to
achieve, for example, expression of a homogeneous product that is
more easily recovered and purified from yeast hosts which are known
to hyperglycosylate N-linked sites. To this end, a variety of amino
acid substitutions at one or both of the first or third amino acid
positions on any one or more of the glycosylation recognitions
sequences in the PSGR polypeptides of the invention, and/or an
amino acid deletion at the second position of any one or more such
recognition sequences will prevent glycosylation of the PSGR at the
modified tripeptide sequence (see, e.g., Miyajimo et al., EBMO
J5(6):1193-1197). Additionally, one or more of the amino acid
residues of the polypeptides of the invention (e.g., arginine and
lysine residues) may be deleted or substituted with another residue
to eliminate undesired processing by proteases such as, for
example, furins or kexins.
[0168] The polypeptides of the present invention include a
polypeptide comprising, or alternatively, consisting of a
polypeptide having the amino acid sequence encoded by the cDNA in
ATCC Deposit No. 97131; a polypeptide comprising, or alternatively,
consisting of a polypeptide having the amino acid sequence encoded
by the cDNA in ATCC Deposit No. 97131 minus the N terminal
methionine; a polypeptide comprising, or alternatively, consisting
of amino acids from about 1 to about 320 in FIGS. 1A-B (SEQ ID
NO:2); a polypeptide comprising, or alternatively consisting of, a
portion of the above polypeptides, such as for example, the PSGR
extracellular loop I comprising, or alternatively consisting of,
amino acids 77 to 98 of FIGS. 1A-B (SEQ ID NO:2); the PSGR
extracellular loop II comprising, or alternatively consisting of,
amino acids 163 to 197; the PSGR extracellular loop III comprising,
or alternatively consisting of, amino acids 262 to 272; the PSGR
intracellular loop I comprising, or alternatively consisting of,
amino acids 43 to 55; the PSGR intracellular loop II comprising, or
alternatively consisting of, amino acids 120 to 141; and/or the
PSGR intracellular loop III comprising, or alternatively consisting
of, amino acids 219 to 240 as well as polypeptides which are at
least 80% identical, more preferably at least 90% or 95% identical,
still more preferably at least 96%, 97%, 98%, 99% or 100% identical
to the polypeptides described above (e.g., the polypeptide encoded
by the cDNA in ATCC Deposit 97131, and the polypeptide of FIGS.
1A-B (SEQ ID NO:2)), and also include portions of such polypeptides
with at least 30 amino acids and more preferably at least 50 or at
least 100 amino acids. Polynucleotides encoding these polypeptides
are also encompassed by the invention.
[0169] By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a reference amino acid sequence of a
PSGR polypeptide is intended that the amino acid sequence of the
polypeptide is identical to the reference sequence except that the
polypeptide sequence may include up to five amino acid alterations
per each 100 amino acids of the reference amino acid of PSGR. In
other words, to obtain a polypeptide having an amino acid sequence
at least 95% identical to a reference amino acid sequence, up to 5%
of the amino acid residues in the reference sequence may be deleted
or substituted with another amino acid, or a number of amino acids
up to 5% of the total amino acid residues in the reference sequence
may be inserted into the reference sequence. These alterations of
the reference sequence may occur at the amino or carboxy terminal
positions of the reference amino acid sequence or anywhere between
those terminal positions, interspersed either individually among
residues in the reference sequence or in one or more contiguous
groups within the reference sequence.
[0170] As a practical matter, whether any particular polypeptide is
at least 90%, 95%, 96%, 97%, 98%, or 99% identical to, for
instance, the amino acid sequence shown in FIGS. 1A-B (SEQ ID
NO:2), or to the amino acid sequence encoded by the cDNA in ATCC
Deposit 97131, can be determined conventionally using known
computer programs such the Bestfit program (Wisconsin Sequence
Analysis Package, Version 8 for Unix, Genetics Computer Group,
University Research Park, 575 Science Drive, Madison, Wis. 53711).
When using Bestfit or any other sequence alignment program to
determine whether a particular sequence is, for instance, 95%
identical to a reference sequence according to the present
invention, the parameters are set, of course, such that the
percentage of identity is calculated over the full length of the
reference amino acid sequence and that gaps in homology of up to 5%
of the total number of amino acid residues in the reference
sequence are allowed.
[0171] In a specific embodiment, the identity between a reference
(query) sequence (a sequence of the present invention) and a
subject sequence, also referred to as a global sequence alignment,
is determined using the FASTDB computer program based on the
algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)).
Preferred parameters used in a FASTDB amino acid alignment are:
Matrix=PAM 0, k-tuple=2, Mismatch Penalty=1, Joining Penalty=20,
Randomization Group Length=0, Cutoff Score=1, Window Size=sequence
length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or
the length of the subject amino acid sequence, whichever is
shorter. According to this embodiment, if the subject sequence is
shorter than the query sequence due to N- or C-terminal deletions,
not because of internal deletions, a manual correction is made to
the results to take into consideration the fact that the FASTDB
program does not account for N- and C-terminal truncations of the
subject sequence when calculating global percent identity. For
subject sequences truncated at the N- and C-terminal, relative to
the query sequence, the percent identity is corrected by
calculating the number of residues of the query sequence that are
N- and C-terminal of the subject sequence, which are not
matched/aligned with a corresponding subject residue, as a percent
of the total bases of the query sequence. A determination of
whether a residue is matched/aligned is determined by results of
the FASTDB sequence alignment. This percentage is then subtracted
from the percent identity, calculated by the above FASTDB program
using the specified parameters, to arrive at a final percent
identity score. This final percent identity score is what is used
for the purposes of this embodiment. Only residues to the N- and
C-termini of the subject sequence, which are not matched/aligned
with the query sequence, are considered for the purposes of
manually adjusting the percent identity score. That is, only query
residue positions outside the farthest N- and C-terminal residues
of the subject sequence. For example, a 90 amino acid residue
subject sequence is aligned with a 100 residue query sequence to
determine percent identity. The deletion occurs at the N-terminus
of the subject sequence and therefore, the FASTDB alignment does
not show a matching/alignment of the first 10 residues at the
N-terminus. The 10 unpaired residues represent 10% of the sequence
(number of residues at the N- and C-terminal not matched/total
number of residues in the query sequence) so 10% is subtracted from
the percent identity score calculated by the FASTDB program. If the
remaining 90 residues were perfectly matched the final percent
identity would be 90%. In another example, a 90 residue subject
sequence is compared with a 100 residue query sequence. This time
the deletions are internal deletions so there are no residues at
the N- or C-terminal of the subject sequence which are not
matched/aligned with the query. In this case the percent identity
calculated by FASTDB is not manually corrected. Once again, only
residue positions outside the N- and C-terminal ends of the subject
sequence, as displayed in the FASTDB alignment, which are not
matched/aligned with the query sequence are manually corrected for.
No other manual corrections are made for the purposes of this
embodiment.
[0172] The present application is also directed to proteins
containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99%
identical to the PSGR polypeptide sequence set forth as
n.sup.1-m.sup.1 herein. In preferred embodiments, the application
is directed to proteins containing polypeptides at least 90%, 95%,
96%, 97%, 98% or 99% identical to polypeptides having the amino
acid sequence of the specific PSGR N- and C-terminal deletions
recited herein. Polynucleotides encoding these polypeptides are
also encompassed by the invention.
[0173] In certain preferred embodiments, PSGR proteins of the
invention comprise fusion proteins as described above wherein the
PSGR polypeptides are those described as n.sup.1-m.sup.1, herein.
In preferred embodiments, the application is directed to nucleic
acid molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to
the nucleic acid sequences encoding polypeptides having the amino
acid sequence of the specific N- and C-terminal deletions recited
herein. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0174] The term "epitopes," as used herein, refers to portions of a
polypeptide having antigenic or immunogenic activity in an animal,
preferably a mammal, and most preferably in a human. In a preferred
embodiment, the present invention encompasses a polypeptide
comprising an epitope, as well as the polynucleotide encoding this
polypeptide. An "immunogenic epitope," as used herein, is defined
as a portion of a protein that elicits an antibody response in an
animal, as determined by any method known in the art, for example,
by the methods for generating antibodies described infra. (See, for
example, Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002
(1983)). The term "antigenic epitope," as used herein, is defined
as a portion of a protein to which an antibody can
immunospecifically bind its antigen as determined by any method
well known in the art, for example, by the immunoassays described
herein. Immunospecific binding excludes non-specific binding but
does not necessarily exclude cross-reactivity with other antigens.
Antigenic epitopes need not necessarily be immunogenic.
[0175] Fragments which function as epitopes may be produced by any
conventional means. (See, e.g., Houghten, Proc. Natl. Acad. Sci.
USA 82:5131-5135 (1985), further described in U.S. Pat. No.
4,631,211).
[0176] As to the selection of peptides or polypeptides bearing an
antigenic epitope (i.e., that contain a region of a protein
molecule to which an antibody can bind), it is well known in that
art that relatively short synthetic peptides that mimic part of a
protein sequence are routinely capable of eliciting an antiserum
that reacts with the partially mimicked protein. See, for instance,
J. G. Sutcliffe et al., "Antibodies That React With Predetermined
Sites on Proteins," Science 219:660-666 (1983). Peptides capable of
eliciting protein-reactive sera are frequently represented in the
primary sequence of a protein, can be characterized by a set of
simple chemical rules, and are confined neither to immunodominant
regions of intact proteins (i.e., immunogenic epitopes) nor to the
amino or carboxyl terminals.
[0177] Antigenic epitope-bearing peptides and polypeptides of the
invention are therefore useful, for example, to raise antibodies,
including monoclonal antibodies, that bind specifically to a
polypeptide of the invention. See, for instance, Wilson et al.,
Cell 37:767-778 (1984) at 777. Antigenic epitope-bearing peptides
and polypeptides of the invention preferably contain a sequence of
at least seven, more preferably at least nine, at least 20, at
least 25, at least 30, at least 40, at least 50 and most preferably
between at least about 55 to about 100 amino acids contained within
the amino acid sequence of a polypeptide of the invention.
Non-limiting examples of antigenic polypeptides or peptides that
can be used to generate PSGR-specific antibodies include: a
polypeptide comprising or alternatively consisting of amino acid
residues from about 50 to about 55 in FIGS. 1A-B (SEQ ID NO:2); a
polypeptide comprising or alternatively consisting of amino acid
residues from about 87 to about 90 in FIGS. 1A-B (SEQ ID NO:2); a
polypeptide comprising or alternatively consisting of amino acid
residues from about 227 to about 234 in FIGS. 1A-B (SEQ ID NO:2); a
polypeptide comprising or alternatively consisting of amino acid
residues from about 309 to about 313 in FIGS. 1A-B (SEQ ID NO:2).
As indicated above, the inventors have determined that the above
polypeptide fragments are antigenic regions of the PSGR protein.
Polynucleotides encoding theses polypeptides are also encompassed
by the invention.
[0178] The epitope-bearing peptides and polypeptides of the
invention may be produced by any conventional means. R. A.
Houghten, "General Method for the Rapid Solid-phase Synthesis of
Large Numbers of Peptides: Specificity of Antigen-Antibody
Interaction at the Level of Individual Amino Acids," Proc. Natl.
Acad. Sci. USA 82:5131-5135 (1985). This "Simultaneous Multiple
Peptide Synthesis (SMPS)" process is further described in U.S. Pat.
No. 4,631,211 to Houghten et al. (1986).
[0179] As one of skill in the art will appreciate, PSGR
polypeptides of the present invention and the epitope-bearing
fragments thereof, described herein (e.g., including, but not
limited to, a portion of one, two, or all three of the
extracellular loops, such as, for example, amino acid residues 77
to 98, 163 to 197, or 262 to 272 of SEQ ID NO:2; or a portion of
one, two, or all three of the intracellular loops, such as for
example, amino acid residues 43 to 55, 120 to 141, or 219 to 240 of
SEQ ID NO:2), can be combined with heterologous polypeptide
sequences, for example, the polypeptides of the present invention
may be fused with the constant domain of immunoglobulins (IgA, IgE,
IgG, IgM) or portions thereof (CH1, CH2, CH3, and any combination
thereof, including both entire domains and portions thereof), or
albumin (including, but not limited to, recombinant albumin (see,
e.g., U.S. Pat. No. 5,876,969, issued Mar. 2, 1999, EP Patent 0 413
622, and U.S. Pat. No. 5,766,883, issued Jun. 16, 1998, herein
incorporated by reference in their entirety)), resulting in
chimeric polypeptides. These fusion proteins facilitate
purification and show an increased half-life in viva. This has been
shown, e.g., for chimeric proteins consisting of the first two
domains of the human CD4-polypeptide and various domains of the
constant regions of the heavy or light chains of mammalian
immunoglobulins (EPA 394,827; Traunecker et al., Nature 331:84-86
(1988)). Fusion proteins that have a disulfide-linked dimeric
structure due to the IgG part can also be more efficient in binding
and neutralizing other molecules than the monomeric PSGR protein or
protein fragment alone (Fountoulakis et al., J. Biochem.
270:3958-3964 (1995)).
[0180] Preferred Fc fusions of the present invention include, but
are not limited to constructs comprising, or alternatively
consisting of, amino acid residues 1 to 98, 1 to 197, 1 to 272, 22
to 320, 77 to 320, 163 to 320, 262 to 320, 77 to 272, 77 to 197,
and/or 22 to 98 of SEQ ID NO:2.
[0181] The polypeptides of the present invention have uses which
include, but are not limited to, as sources for generating
antibodies that bind the polypeptides of the invention, and as
molecular weight markers on SDS-PAGE gels or on molecular sieve gel
filtration columns using methods well known to those of skill in
the art.
Diagnostic Asssays
[0182] The compounds of the present invention are useful for
diagnosis or treatment of various prostate related disorders in
mammals, preferably humans. Such disorders include but are not
limited to including inflammatory disorders, such as chronic
prostatitis, granulomatous prostatitis and malacoplakia, prostatic
hyperplasia and prostate neoplastic disorders, including
adenocarcinoma, transitional cell carcinomas, ductal carcinomas,
squamous cell carcinomas, or as hormones or factors with systemic
or reproductive functions.
[0183] PSGR is expressed in prostate, predominantly in the
epithelial cells of gland, with an increased expression level in
prostate cancer. For a number of prostate-related disorders,
substantially altered (increased or decreased) levels of PSGR gene
expression can be detected in prostate tissue or other cells or
bodily fluids (e.g., sera, plasma, urine, semen, synovial fluid or
spinal fluid) taken from an individual having such a disorder,
relative to a "standard" PSGR gene expression level, that is, the
PSGR expression level in prostate tissues or bodily fluids from an
individual not having the prostate disorder. Thus, the invention
provides a diagnostic method useful during diagnosis of an system
disorder, which involves measuring the expression level of the gene
encoding the PSGR polypeptide in prostate tissue or other cells or
body fluid from an individual and comparing the measured gene
expression level with a standard PSGR gene expression level,
whereby an increase or decrease in the gene expression level(s)
compared to the standard is indicative of an prostate disorder.
[0184] In particular, it is believed that certain tissues in
mammals with cancer of cells or tissue of the prostate express
significantly enhanced or reduced levels of normal or altered PSGR
polypeptide and mRNA encoding the PSGR polypeptide when compared to
a corresponding "standard" level. Further, it is believed that
enhanced or depressed levels of the PSGR polypeptide can be
detected in certain body fluids (e.g., sera, plasma, urine, and
spinal fluid) or cells or tissue from mammals with such a cancer
when compared to sera from mammals of the same species not having
the cancer.
[0185] For example, as disclosed herein, PSGR polypeptides of the
invention are expressed in prostate. Accordingly, polynucleotides
of the invention (e.g., polynucleotide sequences complementary to
all or a portion of PSGR mRNA) and antibodies (and antibody
fragments) directed against the polypeptides of the invention may
be used to quantitate or qualitate concentrations of cells of the
prostate expressing PSGR on their cell surfaces. These antibodies
additionally have diagnostic applications in detecting
abnormalities in the level of PSGR gene expression, or
abnormalities in the structure and/or temporal, tissue, cellular,
or subcellular location of PSGR. These diagnostic assays may be
performed in vivo or in vitro, such as, for example, on blood
samples, biopsy tissue or autopsy tissue.
[0186] Thus, the invention provides a diagnostic method useful
during diagnosis of a prostate disorder, including cancers, which
involves measuring the expression level of the gene encoding the
PSGR polypeptide in prostate tissue or other cells or body fluid
from an individual and comparing the measured gene expression level
with a standard PSGR gene expression level, whereby an increase or
decrease in the gene expression level compared to the standard is
indicative of a prostate disorder.
[0187] Where a diagnosis of a disorder in the prostate, including
diagnosis of a tumor, has already been made according to
conventional methods, the present invention is useful as a
prognostic indicator, whereby patients exhibiting enhanced or
depressed PSGR gene expression will experience a worse clinical
outcome relative to patients expressing the gene at a level nearer
the standard level.
[0188] By "assaying the expression level of the gene encoding the
PSGR polypeptide" is intended qualitatively or quantitatively
measuring or estimating the level of the PSGR polypeptide or the
level of the mRNA encoding the PSGR polypeptide in a first
biological sample either directly (e.g., by determining or
estimating absolute protein level or mRNA level) or relatively
(e.g., by comparing to the PSGR polypeptide level or mRNA level in
a second biological sample). Preferably, the PSGR polypeptide level
or mRNA level in the first biological sample is measured or
estimated and compared to a standard PSGR polypeptide level or mRNA
level, the standard being taken from a second biological sample
obtained from an individual not having the disorder or being
determined by averaging levels from a population of individuals not
having a disorder of the prostate. As will be appreciated in the
art, once a standard PSGR polypeptide level or mRNA level is known,
it can be used repeatedly as a standard for comparison.
[0189] By "biological sample" is intended any biological sample
obtained from an individual, cell line, tissue culture, or other
source containing PSGR protein (including portions thereof) or
mRNA. As indicated, biological samples include body fluids (such as
sera, plasma, urine, synovial fluid and spinal fluid) which contain
soluble domains of the PSGR polypeptide, cells expressing PSGR
polypeptides, prostate tissue, and other tissue sources found to
express the full length or soluble domains of PSGR. Methods for
obtaining tissue biopsies and body fluids from mammals are well
known in the art. Where the biological sample is to include mRNA, a
tissue biopsy is the preferred source.
[0190] Total cellular RNA can be isolated from a biological sample
using any suitable technique such as the single-step
guanidinium-thiocyanate-phenol-chloroform method described in
Chomczynski and Sacchi, Anal. Biochem. 162:156-159 (1987). Levels
of mRNA encoding the PSGR polypeptide are then assayed using any
appropriate method. These include Northern blot analysis, S1
nuclease mapping, the polymerase chain reaction (PCR), reverse
transcription in combination with the polymerase chain reaction
(RT-PCR), and reverse transcription in combination with the ligase
chain reaction (RT-LCR).
[0191] The present invention also relates to diagnostic assays such
as quantitative and diagnostic assays for detecting levels of PSGR
protein, or the soluble form thereof, in a biological sample (e.g.,
cells and tissues), including determination of normal and abnormal
levels of polypeptides. Thus, for instance, a diagnostic assay in
accordance with the invention for detecting over-expression of PSGR
compared to normal control tissue samples may be used to detect the
presence of tumors, for example. Assay techniques that can be used
to determine levels of a protein, such as a PSGR protein of the
present invention in a sample derived from a host are well-known to
those of skill in the art. Such assay methods include
radioimmunoassays, competitive-binding assays, Western Blot
analysis and ELISA assays. Assaying PSGR protein levels in a
biological sample can occur using any art-known method.
[0192] Assaying PSGR polypeptide levels in a biological sample can
occur using antibody-based techniques. For example, PSGR
polypeptide expression in tissues can be studied with classical
immunohistological methods (Jalkanen, M., et al., J. Cell. Biol.
101:976-985 (1985); Jalkanen, M., et al., J. Cell. Biol.
105:3087-3096 (1987)). Other antibody-based methods useful for
detecting PSGR polypeptide gene expression include immunoassays,
such as the enzyme linked immunosorbent assay (ELISA) and the
radioimmunoassay (RIA). Suitable antibody assay labels are known in
the art and include enzyme labels, such as, glucose oxidase, and
radioisotopes, such as iodine (.sup.125I, .sup.121I), carbon
(.sup.14C), sulfur (.sup.35S), tritium (.sup.3H), indium
(.sup.112In), and technetium (.sup.99mTc), and fluorescent labels,
such as fluorescein and rhodamnine, and biotin.
[0193] The tissue or cell type to be analyzed will generally
include those which are known, or suspected, to express the PSGR
gene (such as, for example, cells of the prostate or prostate
cancer). The protein isolation methods employed herein may, for
example, be such as those described in Harlow and Lane (Harlow, E.
and Lane, D., 1988, "Antibodies: A Laboratory Manual", Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.), which is
incorporated herein by reference in its entirety. The isolated
cells can be derived from cell culture or from a patient. The
analysis of cells taken from culture may be a necessary step in the
assessment of cells that could be used as part of a cell-based gene
therapy technique or, alternatively, to test the effect of
compounds on the expression of the PSGR gene.
[0194] For example, antibodies, or fragments of antibodies, such as
those described herein, may be used to quantitatively or
qualitatively detect the presence of PSGR gene products or
conserved variants or peptide fragments thereof. This can be
accomplished, for example, by immunofluorescence techniques
employing a fluorescently labeled antibody coupled with light
microscopic, flow cytometric, or fluorimetric detection.
[0195] In a preferred embodiment, antibodies, or fragments of
antibodies directed to any one or all of the extracellular or
intracellular domains of PSGR may be used to quantitatively or
qualitatively detect the presence of PSGR gene products or
conserved variants or peptide fragments thereof. This can be
accomplished, for example, by immunofluorescence techniques
employing a fluorescently labeled antibody coupled with light
microscopic, flow cytometric, or fluorimetric detection.
[0196] In an additional preferred embodiment, antibodies, or
fragments of antibodies directed to a conformational epitope of
PSGR may be used to quantitatively or qualitatively detect the
presence of PSGR gene products or conserved variants or peptide
fragments thereof. This can be accomplished,, for example, by
immunofluorescence techniques employing a fluorescently labeled
antibody coupled with light microscopic, flow cytometric, or
fluorimetric detection.
[0197] The antibodies (or fragments thereof), and/or PSGR
polypeptides of the present invention may, additionally, be
employed histologically, as in immunofluorescence, immunoelectron
microscopy or non-immunological assays, for in situ detection of
PSGR gene products or conserved variants or peptide fragments
thereof. In situ detection may be accomplished by removing a
histological specimen from a patient, and applying thereto a
labeled antibody or PSGR polypeptide of the present invention. The
antibody (or fragment) or PSGR polypeptide is preferably applied by
overlaying the labeled antibody (or fragment) onto a biological
sample. Through the use of such a procedure, it is possible to
determine not only the presence of the PSGR gene product, or
conserved variants or peptide fragments, or PSGR polypeptide
binding, but also its distribution in the examined tissue. Using
the present invention, those of ordinary skill will readily
perceive that any of a wide variety of histological methods (such
as staining procedures) can be modified in order to achieve such in
situ detection.
[0198] Immunoassays and non-immunoassays for PSGR gene products or
conserved variants or peptide fragments thereof will typically
comprise incubating a sample, such as a biological fluid, a tissue
extract, freshly harvested cells, or lysates of cells which have
been incubated in cell culture, in the presence of a detectably
labeled antibody capable of binding PSGR gene products or conserved
variants or peptide fragments thereof, and detecting the bound
antibody by any of a number of techniques well-known in the
art.
[0199] The biological sample may be brought in contact with and
immobilized onto a solid phase support or carrier such as
nitrocellulose, or other solid support which is capable of
immobilizing cells, cell particles or soluble proteins. The support
may then be washed with suitable buffers followed by treatment with
the detectably labeled anti-PSGR antibody or detectable PSGR
polypeptide. The solid phase support may then be washed with the
buffer a second time to remove unbound antibody or polypeptide.
Optionally the antibody is subsequently labeled. The amount of
bound label on solid support may then be detected by conventional
means.
[0200] By "solid phase support or carrier" is intended any support
capable of binding an antigen or an antibody. Well-known supports
or carriers include glass, polystyrene, polypropylene,
polyethylene, dextran, nylon, amylases, natural and modified
celluloses, polyacrylamides, gabbros, and magnetite. The nature of
the carrier can be either soluble to some extent or insoluble for
the purposes of the present invention. The support material may
have virtually any possible structural configuration so long as the
coupled molecule is capable of binding to an antigen or antibody.
Thus, the support configuration may be spherical, as in a bead, or
cylindrical, as in the inside surface of a test tube, or the
external surface of a rod. Alternatively, the surface may be flat
such as a sheet, test strip, etc. Preferred supports include
polystyrene beads. Those skilled in the art will know many other
suitable carriers for binding antibody or antigen, or will be able
to ascertain the same by use of routine experimentation.
[0201] The binding activity of a given lot of anti-PSGR antibody or
PSGR polypeptide may be determined according to well known methods.
Those skilled in the art will be able to determine operative and
optimal assay conditions for each determination by employing
routine experimentation.
[0202] In addition to assaying PSGR polypeptide levels or
polynucleotide levels in a biological sample obtained from an
individual, PSGR polypeptide or polynucleotide can also be detected
in vivo by imaging. For example, in one embodiment of the
invention, PSGR polypeptide and/or anti-PSGR antibodies are used to
image prostate neoplasms. In another embodiment, PSGR
polynucleotides of the invention (e.g., polynucleotides
complementary to all or a portion of PSGR mRNA) and/or anti-PSGR
antibodies (e.g., antibodies directed to any one or a combination
of the extracellular or intracellular domains of PSGR, antibodies
directed to a conformational epitope of PSGR, antibodies directed
to the full length polypeptide expressed on the cell surface of a
mammalian cell) are used to image prostate neoplastic tissues.
[0203] Antibody labels or markers for in vivo imaging of PSGR
polypeptide include those detectable by X-radiography, NMR, MRI,
CAT-scans or ESR. For X-radiography, suitable labels include
radioisotopes such as barium or cesium, which emit detectable
radiation but are not overtly harmful to the subject. Suitable
markers for NMR and ESR include those with a detectable
characteristic spin, such as deuterium, which may be incorporated
into the antibody by labeling of nutrients for the relevant
hybridoma. Where in vivo imaging is used to detect enhanced levels
of PSGR polypeptide for diagnosis in humans, it may be preferable
to use human antibodies or "humanized" chimeric monoclonal
antibodies. Such antibodies can be produced using techniques
described herein or otherwise known in the art. For example methods
for producing chimeric antibodies are known in the art. See, for
review, Morrison, Science 229:1202 (1985); Oi et al., BioTechniques
4:214 (1986); Cabilly et al., U.S. Pat. No. 4,816,567; Taniguchi et
al., EP 171496; Morrison et al., EP 173494; Neuberger et al., WO
8601533; Robinson et al., WO 8702671; Boulianne et al., Nature
312:643 (1984); Neuberger et al., Nature 314:268 (1985).
[0204] Additionally, any PSGR polypeptide whose presence can be
detected, can be administered. For example, PSGR polypeptides
labeled with a radio-opaque or other appropriate compound can be
administered and visualized in vivo, as discussed, above for
labeled antibodies. Further such PSGR polypeptides can be utilized
for in vitro diagnostic procedures.
[0205] A PSGR polypeptide-specific antibody or antibody fragment
which has been labeled with an appropriate detectable imaging
moiety, such as a radioisotope (for example, .sup.131I, .sup.112In,
.sup.99mTc), a radio-opaque substance, or a material detectable by
nuclear magnetic resonance, is introduced (for example,
parenterally, subcutaneously or intraperitoneally) into the mammal
to be examined for a prostate disorder. It will be understood in
the art that the size of the subject and the imaging system used
will determine the quantity of imaging moiety needed to produce
diagnostic images. In the case of a radioisotope moiety, for a
human subject, the quantity of radioactivity injected will normally
range from about 5 to 20 millicuries of .sup.99mTc. The labeled
antibody or antibody fragment will then preferentially accumulate
at the location of cells which contain PSGR protein. In vivo tumor
imaging is described in S. W. Burchiel et al.,
"Immunopharmacokinetics of Radiolabeled Antibodies and Their
Fragments" (Chapter 13 in Tumor Imaging: The Radiochemical
Detection of Cancer, S. W. Burchiel and B. A. Rhodes, eds., Masson
Publishing Inc. (1982)).
[0206] With respect to antibodies, one of the ways in which the
anti-PSGR antibody can be detectably labeled is by linking the same
to an enzyme and using the linked product in an enzyme immunoassay
(EIA) (Voller, A., "The Enzyme Linked Immunosorbent Assay (ELISA)",
1978, Diagnostic Horizons 2:1-7, Microbiological Associates
Quarterly Publication, Walkersville, Md.); Voller et al., J. Clin.
Pathol. 31:507-520 (1978); Butler, J. E., Meth. Enzymol. 73:482-523
(1981); Maggio, E. (ed.), 1980, Enzyme Immunoassay, CRC Press, Boca
Raton, Fla.,; Ishikawa, E. et al., (eds.), 1981, Enzyme
Immunoassay, Kgaku Shoin, Tokyo). The enzyme which is bound to the
antibody will react with an appropriate substrate, preferably a
chromogenic substrate, in such a manner as to produce a chemical
moiety which can be detected, for example, by spectrophotometric,
fluorimetric or by visual means. Enzymes which can be used to
detectably label the antibody include, but are not limited to,
malate dehydrogenase, staphylococcal nuclease, delta-5-steroid
isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate,
dehydrogenase, triose phosphate isomerase, horseradish peroxidase,
alkaline phosphatase, asparaginase, glucose oxidase,
beta-galactosidase, ribonuclease, urease, catalase,
glucose-6-phosphate dehydrogenase, glucoamylase and
acetylcholinesterase. Additionally, the detection can be
accomplished by calorimetric methods which employ a chromogenic
substrate for the enzyme. Detection may also be accomplished by
visual comparison of the extent of enzymatic reaction of a
substrate in comparison with similarly prepared standards.
[0207] Detection may also be accomplished using any of a variety of
other immunoassays. For example, by radioactively labeling the
antibodies or antibody fragments, it is possible to detect PSGR
through the use of a radioimmunoassay (RIA) (see, for example,
Weintraub, B., Principles of Radioimmunoassays, Seventh Training
Course on Radioligand Assay Techniques, The Endocrine Society,
March 1986, which is incorporated by reference herein). The
radioactive isotope can be detected by means including, but not
limited to, a gamma counter, a scintillation counter, or
autoradiography.
[0208] It is also possible to label the antibody with a fluorescent
compound. When the fluorescently labeled antibody is exposed to
light of the proper wave length, its presence can then be detected
due to fluorescence. Among the most commonly used fluorescent
labeling compounds are fluorescein isothiocyanate, rhodamine,
phycoerythrin, phycocyanin, allophycocyanin, ophthaldehyde and
fluorescamine.
[0209] The antibody can also be detectably labeled using
fluorescence emitting metals such as .sup.152Eu, or others of the
lanthanide series. These metals can be attached to the antibody
using such metal chelating groups as diethylenetriaminepentacetic
acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
[0210] The antibody also can be detectably labeled by coupling it
to a chemiluminescent compound. The presence of the
chemiluminescent-tagged antibody is then determined by detecting
the presence of luminescence that arises during the course of a
chemical reaction. Examples of particularly useful chemiluminescent
labeling compounds are luminol, isoluminol, theromatic acridinium
ester, imidazole, acridinium salt and oxalate ester.
[0211] Likewise, a bioluminescent compound may be used to label the
antibody of the present invention. Bioluminescence is a type of
chemiluminescence found in biological systems in, which a catalytic
protein increases the efficiency of the chemiluminescent reaction.
The presence of a bioluminescent protein is determined by detecting
the presence of luminescence. Important bioluminescent compounds
for purposes of labeling are luciferin, luciferase and
aequorin.
Epitopes and Antibodies
[0212] The present invention encompasses polypeptides comprising,
or alternatively consisting of, an epitope of the polypeptide
having an amino acid sequence of SEQ ID NO:2, or an eptiope of the
polypeptide having an amino acid sequence of SEQ ID NO:4, or an
epitope of the polypeptide sequence encoded by a polynucleotide
sequence contained in ATCC deposit No. 97131, or encoded by a
polynucleotide that hybridizes to the complement of the sequence of
SEQ ID NO: 1, or encoded by a polynucleotide that hybridizes to the
complement of the sequence of SEQ ID NO:3, or contained in ATCC
deposit No. 97131 under stringent hybridization conditions or lower
stringency hybridization conditions as defined supra. The present
invention further encompasses polynucleotide sequences encoding an
epitope of a polypeptide sequence of the invention (such as, for
example, the sequence disclosed in SEQ ID NO:1), polynucleotide
sequences of the complementary strand of a polynucleotide sequence
encoding an epitope of the invention, and polynucleotide sequences
which hybridize to the complementary strand under stringent
hybridization conditions or lower stringency hybridization
conditions defined supra.
[0213] The term "epitopes," as used herein, refers to portions of a
polypeptide having antigenic or immunogenic activity in an animal,
preferably a mammal, and most preferably in a human. In a preferred
embodiment, the present invention encompasses a polypeptide
comprising an epitope, as well as the polynucleotide encoding this
polypeptide. An "immunogenic epitope," as used herein, is defined
as a portion of a protein that elicits an antibody response in an
animal, as determined by any method known in the art, for example,
by the methods for generating antibodies described infra. (See, for
example, Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002
(1983)). The term "antigenic epitope," as used herein, is defined
as a portion of a protein to which an antibody can
immunospecifically bind its antigen as determined by any method
well known in the art, for example, by the immunoassays described
herein. Immunospecific binding excludes non-specific binding but
does not necessarily exclude cross-reactivity with other antigens.
Antigenic epitopes need not necessarily be immunogenic.
[0214] Fragments which function as epitopes may be produced by any
conventional means. (See, e.g., Houghten, Proc. Natl. Acad. Sci.
USA 82:5131-5135 (1985), further described in U.S. Pat. No.
4,631,211).
[0215] In the present invention, antigenic epitopes preferably
contain a sequence of at least 4, at least 5, at least 6, at least
7, more preferably at least 8, at least 9, at least 10, at least
11, at least 12, at least 13, at least 14, at least 15, at least
20, at least 25, at least 30, at least 40, at least 50, and, most
preferably, between about 15 to about 30 amino acids. Preferred
polypeptides comprising immunogenic or antigenic epitopes are at
least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80,
85, 90, 95, or 100 amino acid residues in length. Additional
non-exclusive preferred antigenic epitopes include the antigenic
epitopes disclosed herein, as well as portions thereof. Antigenic
epitopes are useful, for example, to raise antibodies, including
monoclonal antibodies, that specifically bind the epitope.
Preferred antigenic epitopes include the antigenic epitopes
disclosed herein, as well as any combination of two, three, four,
five or more of these antigenic epitopes. Antigenic epitopes can be
used as the target molecules in immunoassays. (See, for instance,
Wilson et al., Cell 37:767-778 (1984); Sutcliffe et al., Science
219:660-666 (1983)).
[0216] Similarly, immunogenic epitopes can be used, for example, to
induce antibodies according to methods well known in the art. (See,
for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow
et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle et al.,
J. Gen. Virol. 66:2347-2354 (1985). Preferred immunogenic epitopes
include the immunogenic epitopes disclosed herein, as well as any
combination of two, three, four, five or more of these immunogenic
epitopes. The polypeptides comprising one or more immunogenic
epitopes may be presented for eliciting an antibody response
together with a carrier protein, such as an albumin, to an animal
system (such as rabbit or mouse), or, if the polypeptide is of
sufficient length (at least about 25 amino acids), the polypeptide
may be presented without a carrier. However, immunogenic epitopes
comprising as few as 8 to 10 amino acids have been shown to be
sufficient to raise antibodies capable of binding to, at the very
least, linear epitopes in a denatured polypeptide (e.g., in Western
blotting).
[0217] Epitope-bearing polypeptides of the present invention may be
used to induce antibodies according to methods well known in the
art including, but not limited to, in vivo immunization, in vitro
immunization, and phage display methods. See, e.g., Sutcliffe et
al., supra; Wilson et al., supra, and Bittle et al., J. Gen.
Virol., 66:2347-2354 (1985). If in vivo immunization is used,
animals may be immunized with free peptide; however, anti-peptide
antibody titer may be boosted by coupling the peptide to a
macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or
tetanus toxoid. For instance, peptides containing cysteine residues
may be coupled to a carrier using a linker such as
maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other
peptides may be coupled to carriers using a more general linking
agent such as glutaraldehyde. Animals such as rabbits, rats and
mice are immunized with either free or carrier-coupled peptides,
for instance, by intraperitoneal and/or intradermal injection of
emulsions containing about 100 .mu.g of peptide or carrier protein
and Freund's adjuvant or any other adjuvant known for stimulating
an immune response. Several booster injections may be needed, for
instance, at intervals of about two weeks, to provide a useful
titer of anti-peptide antibody which can be detected, for example,
by ELISA assay using free peptide adsorbed to a solid surface. The
titer of anti-peptide antibodies in serum from an immunized animal
may be increased by selection of anti-peptide antibodies, for
instance, by adsorption to the peptide on a solid support and
elution of the selected antibodies according to methods well known
in the art.
[0218] As one of skill in the art will appreciate, and as discussed
above, the polypeptides of the present invention comprising an
immunogenic or antigenic epitope can be fused to other polypeptide
sequences. For example, the polypeptides of the present invention
may be fused with the constant domain of immunoglobulins (IgA, IgE,
IgG, IgM), or portions thereof (CH1, CH2, CH3, or any combination
thereof and portions thereof) resulting in chimeric polypeptides.
Such fusion proteins may facilitate purification and may increase
half-life in vivo. This has been shown for chimeric proteins
consisting of the first two domains of the human CD4-polypeptide
and various domains of the constant regions of the heavy or light
chains of mammalian immunoglobulins. See, e.g., EP 394,827;
Traunecker et al., Nature, 331:84-86 (1988). Enhanced delivery of
an antigen across the epithelial barrier to the immune system has
been demonstrated for antigens (e.g., insulin) conjugated to an
FcRn binding partner such as IgG or Fc fragments (see, e.g., PCT
Publications WO 96/22024 and WO 99/04813). IgG Fusion proteins that
have a disulfide-linked dimeric structure due to the IgG portion
desulfide bonds have also been found to be more efficient in
binding and neutralizing other molecules than monomeric
polypeptides or fragments thereof alone. See, e.g., Fountoulakis et
al., J. Biochem., 270:3958-3964 (1995). Nucleic acids encoding the
above epitopes can also be recombined with a gene of interest as an
epitope tag (e.g., the hemagglutinin ("HA") tag or flag tag) to aid
in detection and purification of the expressed polypeptide. For
example, a system described by Janknecht et al. allows for the
ready purification of non-denatured fusion proteins expressed in
human cell lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci.
USA 88:8972-897). In this system, the gene of interest is subcloned
into a vaccinia recombination plasmid such that the open reading
frame of the gene is translationally fused to an amino-terminal tag
consisting of six histidine residues. The tag serves as a matrix
binding domain for the fusion protein. Extracts from cells infected
with the recombinant vaccinia virus are loaded onto
Ni2+nitriloacetic acid-agarose column and histidine-tagged proteins
can be selectively eluted with imidazole-containing buffers.
[0219] Additional fusion proteins of the invention may be generated
through the techniques of gene-shuffling, motif-shuffling,
exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA shuffling"). DNA shuffling may be employed to modulate the
activities of polypeptides of the invention, such methods can be
used to generate polypeptides with altered activity, as well as
agonists and antagonists of the polypeptides. See, generally, U.S.
Pat. Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and
5,837,458, and Patten et al., Curr. Opinion Biotechnol. 8:724-33
(1997); Harayama, Trends Biotechnol. 16(2):76-82 (1998); Hansson,
et al., J. Mol. Biol. 287:265-76 (1999); and Lorenzo and Blasco,
Biotechniques 24(2):308-13 (1998) (each of these patents and
publications are hereby incorporated by reference in its entirety).
In one embodiment, alteration of polynucleotides corresponding to
SEQ ID NO:1 and the polypeptides encoded by these polynucleotides
may be achieved by DNA shuffling. DNA shuffling involves the
assembly of two or more DNA segments by homologous or site-specific
recombination to generate variation in the polynucleotide sequence.
In another embodiment, polynucleotides of the invention, or the
encoded polypeptides, may be altered by being subjected to random
mutagenesis by error-prone PCR, random nucleotide insertion or
other methods prior to recombination. In another embodiment, one or
more components, motifs, sections, parts, domains, fragments, etc.,
of a polynucleotide encoding a polypeptide of the invention may be
recombined with one or more components, motifs, sections, parts,
domains, fragments, etc. of one or more heterologous molecules.
Antibodies
[0220] Further polypeptides of the invention relate to antibodies
and T-cell antigen receptors (TCR) which immunospecifically bind a
PSGR polypeptide, polypeptide fragment, or variant of SEQ ID NO:2,
and/or an epitope, of the present invention (as determined by
immunoassays well known in the art for assaying specific
antibody-antigen binding). Antibodies of the invention include, but
are not limited to, polyclonal, monoclonal, multispecific, human,
humanized or chimeric antibodies, single chain antibodies, Fab
fragments, F(ab') fragments, fragments produced by a Fab expression
library, anti-idiotypic (anti-Id) antibodies (including, e.g.,
anti-Id antibodies to antibodies of the invention), and
epitope-binding fragments of any of the above. The term "antibody,"
as used herein, refers to immunoglobulin molecules and
immunologically active portions of immunoglobulin molecules, i.e.,
molecules that contain an antigen binding site that
immunospecifically binds an antigen. The immunoglobulin molecules
of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA
and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgAl and IgA2) or
subclass of immunoglobulin molecule. In a specific embodiment, the
immunoglobulin molecules of the invention are IgG1. In another
specific embodiment, the immunoglobulin molecules of the invention
are IgG4.
[0221] Most preferably the antibodies are human antigen-binding
antibody fragments of the present invention and include, but are
not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv),
single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments
comprising either a VL or VH domain. Antigen-binding antibody
fragments, including single-chain antibodies, may comprise the
variable region(s) alone or in combination with the entirety or a
portion of the following: hinge region, CH1, CH2, and CH3 domains.
Also included in the invention are antigen-binding fragments also
comprising any combination of variable region(s) with a hinge
region, CH1, CH2, and CH3 domains. The antibodies of the invention
may be from any animal origin including birds and mammals.
Preferably, the antibodies are human, murine (e.g., mouse and rat),
donkey, ship rabbit, goat, guinea pig, camel, horse, or chicken. As
used herein, "human" antibodies include antibodies having the amino
acid sequence of a human immunoglobulin and include antibodies
isolated from human immunoglobulin libraries or from animals
transgenic for one or more human immunoglobulin and that do not
express endogenous immunoglobulins, as described infra and, for
example in, U.S. Pat. No. 5,939,598 by Kucherlapati et al.
[0222] The antibodies of the present invention may be monospecific,
bispecific, trispecific or of greater multispecificity.
Multispecific antibodies may be specific for different epitopes of
a polypeptide of the present invention or may be specific for both
a polypeptide of the present invention as well as for a
heterologous epitope, such as a heterologous polypeptide or solid
support material. See, e.g., PCT publications WO 93/17715; WO
92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol.
147:60-69 (1991); U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648;
5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148:1547-1553
(1992).
[0223] Antibodies of the present invention may be described or
specified in terms of the epitope(s) or portion(s) of a polypeptide
of the present invention which they recognize or specifically bind.
The epitope(s) or polypeptide portion(s) may be specified as
described herein, e.g., by N-terminal and C-terminal positions, by
size in contiguous amino acid residues, or listed in the Tables and
FIGS. Antibodies which specifically bind any epitope or polypeptide
of the present invention may also be excluded. Therefore, the
present invention includes antibodies that specifically bind
polypeptides of the present invention, and allows for the exclusion
of the same.
[0224] Antibodies of the present invention may also be described or
specified in terms of their cross-reactivity. Antibodies that do
not bind any other analog, ortholog, or homolog of a polypeptide of
the present invention are included. Antibodies that bind
polypeptides with at least 95%, at least 90%, at least 85%, at
least 80%, at least 75%, at least 70%, at least 65%, at least 60%,
at least 55%, and at least 50% identity (as calculated using
methods known in the art and described herein) to a polypeptide of
the present invention are also included in the present invention.
In specific embodiments, antibodies of the present invention
cross-react with murine, rat and/or rabbit homologs of human
proteins and the corresponding epitopes thereof. Antibodies that do
not bind polypeptides with less than 95%, less than 90%, less than
85%, less than 80%, less than 75%, less than 70%, less than 65%,
less than 60%, less than 55%, and less than 50% identity (as
calculated using methods known in the art and described herein) to
a polypeptide of the present invention are also included in the
present invention. In a specific embodiment, the above-described
cross-reactivity is with respect to any single specific antigenic
or immunogenic polypeptide, or combination(s) of 2, 3, 4, 5, or
more of the specific antigenic and/or immunogenic polypeptides
disclosed herein. Further included in the present invention are
antibodies which bind polypeptides encoded by polynucleotides which
hybridize to a polynucleotide of the present invention under
stringent hybridization conditions (as described herein).
Antibodies of the present invention may also be described or
specified in terms of their binding affinity to a polypeptide of
the invention. Preferred binding affinities include those with a
dissociation constant or Kd less than 5.times.10.sup.-2 M,
10.sup.-2 M, 5.times.10.sup.-3 M, 10.sup.-3 M, 5.times.10.sup.-4 M,
10.sup.-4 M, 5.times.10.sup.-5 M, 10.sup.-5 M, 5.times.10.sup.-6 M,
10.sup.-6M, 5.times.10.sup.-7 M, 10.sup.7 M, 5.times.10.sup.-8 M,
10.sup.-8 M, 5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10
M, 10.sup.-10 M, 5.times.10.sup.-11 M, 10.sup.-11 M,
5.times.10.sup.-12 M, .sup.10-12 M, 5.times.10.sup.-13 M,
10.sup.-13 M, 5.times.10.sup.-14 M, 10.sup.-14 M,
5.times.10.sup.-15 M, or 10.sup.-15 M.
[0225] The invention also provides antibodies that competitively
inhibit binding of an antibody to an epitope of the invention as
determined by any method known in the art for determining
competitive binding, for example, the immunoassays described
herein. In preferred embodiments, the antibody competitively
inhibits binding to the epitope by at least 95%, at least 90%, at
least 85%, at least 80%, at least 75%, at least 70%, at least 60%,
or at least 50%.
[0226] Antibodies of the present invention may act as agonists or
antagonists of the polypeptides of the present invention. For
example, the present invention includes antibodies which disrupt
the receptor/ligand interactions with the polypeptides of the
invention either partially or fully. Preferably, antibodies of the
present invention bind an antigenic epitope disclosed herein, or a.
portion thereof. The invention features both receptor-specific
antibodies and ligand-specific antibodies. The invention also
features receptor-specific antibodies which do not prevent ligand
binding but prevent receptor activation. Receptor activation (i.e.,
signaling) may be determined by techniques described herein or
otherwise known in the art. For example, receptor activation can be
determined by detecting the phosphorylation (e.g., tyrosine or
serine/threonine) of the receptor or its substrate by
immunoprecipitation followed by western blot analysis (for example,
as described supra). In specific embodiments, antibodies are
provided that inhibit ligand activity or receptor activity by at
least 95%, at least 90%, at least 85%, at least 80%, at least 75%,
at least 70%, at least 60%, or at least 50% of the activity in
absence of the antibody.
[0227] The invention also features receptor-specific antibodies
which both prevent ligand binding and receptor activation as well
as antibodies that recognize the receptor-ligand complex, and,
preferably, do not specifically recognize the unbound receptor or
the unbound ligand. Likewise, included in the invention are
neutralizing antibodies which bind the ligand and prevent binding
of the ligand to the receptor, as well as antibodies which bind the
ligand, thereby preventing receptor activation, but do not prevent
the ligand from binding the receptor. Further included in the
invention are antibodies which activate the receptor. These
antibodies may act as receptor agonists, i.e., potentiate or
activate either all or a subset of the biological activities of the
ligand-mediated receptor activation, for example, by inducing
dimerization of the receptor. The antibodies may be specified as
agonists, antagonists or inverse agonists for biological activities
comprising the specific biological activities of the peptides of
the invention disclosed herein. The above antibody agonists can be
made using methods known in the art. See, e.g., PCT publication WO
96/40281; U.S. Pat. No. 5,811,097; Deng et al., Blood
92(6):1981-1988 (1998); Chen et al., Cancer Res. 58(16):3668-3678
(1998); Harrop et al., J. Immunol. 161(4):1786-1794 (1998); Zhu et
al., Cancer Res. 58(15):3209-3214 (1998); Yoon et al., J. Immunol.
160(7):3170-3179 (1998); Prat et al., J. Cell. Sci.
111(Pt2):237-247 (1998); Pitard et al., J. Immunol. Methods
205(2):177-190 (1997); Liautard et al., Cytokine 9(4):233-241
(1997); Carlson et al., J. Biol. Chem. 272(17):11295-11301 (1997);
Taryman et al., Neuron 14(4):755-762 (1995); Muller et al.,
Structure 6(9):1153-1167 (1998); Bartunek et al., Cytokine
8(1):14-20 (1996) (which are all incorporated by reference herein
in their entireties).
[0228] Antibodies of the present invention may be used, for
example, but not limited to, to purify, detect, and target the
polypeptides of the present invention, including both in vitro and
in vivo diagnostic and therapeutic methods. For example, the
antibodies have use in immunoassays for qualitatively and
quantitatively measuring levels of the polypeptides of the present
invention in biological samples. See, e.g., Harlow et al.,
Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory
Press, 2nd ed. 1988) (incorporated by reference herein in its
entirety).
[0229] As discussed in more detail below, the antibodies of the
present invention may be used either alone or in combination with
other compositions. The antibodies may further be recombinantly
fused to a heterologous polypeptide at the N- or C-terminus or
chemically conjugated (including covalently and non-covalently
conjugations) to polypeptides or other compositions. For example,
antibodies of the present invention may be recombinantly fused or
conjugated to molecules useful as labels in detection assays and
effector molecules such as heterologous polypeptides, drugs,
radionuclides, or toxins. See, e.g., PCT publications WO 92/08495;
WO 91/14438; WO 89/12624; U.S. Pat. No. 5,314,995; and EP
396,387.
[0230] The antibodies of the invention include derivatives that are
modified, i.e, by the covalent attachment of any type of molecule
to the antibody such that covalent attachment does not prevent the
antibody from generating an anti-idiotypic response. For example,
but not by way of limitation, the antibody derivatives include
antibodies that have been modified, e.g., by glycosylation,
acetylation, pegylation, phosphylation, amidation, derivatization
by known protecting/blocking groups, proteolytic cleavage, linkage
to a cellular ligand or other protein, etc. Any of numerous
chemical modifications may be carried out by known techniques,
including, but not limited to specific chemical cleavage,
acetylation, formylation, metabolic synthesis of tunicamycin, etc.
Additionally, the derivative may contain one or more non-classical
amino acids.
[0231] The antibodies of the present invention may be generated by
any suitable method known in the art. Polyclonal antibodies to an
antigen-of-interest can be produced by various procedures well
known in the art. For example, a polypeptide of the invention can
be administered to various host animals including, but not limited
to, rabbits, mice, rats, etc. to induce the production of sera
containing polyclonal antibodies specific for the antigen. Various
adjuvants may be used to increase the immunological response,
depending on the host species, and include but are not limited to,
Freund's (complete and incomplete), mineral gels such as aluminum
hydroxide, surface active substances such as lysolecithin, pluronic
polyols, polyanions, peptides, oil emulsions, keyhole limpet
hemocyanins, dinitrophenol, and potentially useful human adjuvants
such as BCG (bacille Calmette-Guerin) and corynebacterium parvum.
Such adjuvants are also well known in the art.
[0232] Monoclonal antibodies can be prepared using a wide variety
of techniques known in the art including the use of hybridoma,
recombinant, and phage display technologies, or a combination
thereof. For example, monoclonal antibodies can be produced using
hybridoma techniques including those known in the art and taught,
for example, in Harlow et al., Antibodies: A Laboratory Manual,
(Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et
al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681
(Elsevier, N.Y., 1981) (said references incorporated by reference
in their entireties). The term "monoclonal antibody" as used herein
is not limited to antibodies produced through hybridoma technology.
The term "monoclonal antibody" refers to an antibody that is
derived from a single clone, including any eukaryotic, prokaryotic,
or phage clone, and not the method by which it is produced.
[0233] Methods for producing and screening for specific antibodies
using hybridoma technology are routine and well known in the art.
In a non-limiting example, mice can be immunized with a polypeptide
of the invention or a cell expressing such peptide. Once an immune
response is detected, e.g., antibodies specific for the antigen are
detected in the mouse serum, the mouse spleen is harvested and
splenocytes isolated. The splenocytes are then fused by well known
techniques to any suitable myeloma cells, for example cells from
cell line SP20 available from the ATCC. Hybridomas are selected and
cloned by limited dilution. The hybridoma clones are then assayed
by methods known in the art for cells that secrete antibodies
capable of binding a polypeptide of the invention. Ascites fluid,
which generally contains high levels of antibodies, can be
generated by immunizing mice with positive hybridoma clones.
[0234] Accordingly, the present invention provides methods of
generating monoclonal antibodies as well as antibodies produced by
the method comprising culturing a hybridoma cell secreting an
antibody of the invention wherein, preferably, the hybridoma is
generated by fusing splenocytes isolated from a mouse immunized
with an antigen of the invention with myeloma cells and then
screening the hybridomas resulting from the fusion for hybridoma
clones that secrete an antibody able to bind a polypeptide of the
invention.
[0235] Antibody fragments which recognize specific epitopes may be
generated by known techniques. For example, Fab and F(ab')2
fragments of the invention may be produced by proteolytic cleavage
of immunoglobulin molecules, using enzymes such as papain (to
produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
F(ab')2 fragments contain the variable region, the light chain
constant region and the CH1 domain of the heavy chain.
[0236] For example, the antibodies of the present invention can
also be generated using various phage display methods known in the
art and as discussed in detail in the Examples (e.g., Example 5).
In phage display methods, functional antibody domains are displayed
on the surface of phage particles which carry the polynucleotide
sequences encoding them. In a particular embodiment, such phage can
be utilized to display antigen binding domains expressed from a
repertoire or combinatorial antibody library (e.g., human or
murine). Phage expressing an antigen binding domain that binds the
antigen of interest can be selected or identified with antigen,
e.g., using labeled antigen or antigen bound or captured to a solid
surface or bead. Phage used in these methods are typically
filamentous phage including fd and M13 binding domains expressed
from phage with Fab, Fv or disulfide stabilized Fv antibody domains
recombinantly fused to either the phage gene III or gene VIII
protein. Examples of phage display methods that can be used to make
the antibodies of the present invention include those disclosed in
Brinikman et al., J. Immunol. Methods 182:41-50 (1995); Ames et
al., J. Immunol. Methods 184:177-186 (1995); Kettleborough et al.,
Eur. J. Immunol. 24:952-958 (1994); Persic et al., Gene 187 9-18
(1997); Burton et al., Advances in Immunology 57:191-280 (1994);
PCT application No. PCT/GB91/01134; PCT publications WO 90/02809;
WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO
95/20401; and U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484;
5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908;
5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of
which is incorporated herein by reference in its entirety.
[0237] As described in the above references, after phage selection,
the antibody coding regions from the phage can be isolated and used
to generate whole antibodies, including human antibodies, or any
other desired antigen binding fragment, and expressed in any
desired host, including mammalian cells, insect cells, plant cells,
yeast, and bacteria, e.g., as described in detail below. For
example, techniques to recombinantly produce Fab, Fab' and F(ab')2
fragments can also be employed using methods known in the art such
as those disclosed in PCT publication WO 92/22324; Mullinax et al.,
BioTechniques 12(6):864-869 (1992); and Sawai et al., AJRI 34:26-34
(1995); and Better et al., Science 240:1041-1043 (1988) (said
references incorporated by reference in their entireties).
[0238] Examples of techniques which can be used to produce
single-chain Fvs and antibodies include those described in U.S.
Pat. No. 4,946,778 and 5,258,498; Huston et al., Methods in
Enzymology 203:46-88 (1991); Shu et al., PNAS 90:7995-7999 (1993);
and Skerra et al., Science 240:1038-1040 (1988). For some uses,
including in vivo use of antibodies in humans and in vitro
detection assays, it may be preferable to use chimeric, humanized,
or human antibodies. A chimeric antibody is a molecule in which
different portions of the antibody are derived from different
animal species, such as antibodies having a variable region derived
from a murine monoclonal antibody and a human immunoglobulin
constant region. Methods for producing chimeric antibodies are
known in the art. See e.g., Morrison, Science 229:1202 (1985); Oi
et al., BioTechniques 4:214 (1986); Gillies et al., (1989) J.
Immunol. Methods 125:191-202; U.S. Pat. Nos. 5,807,715; 4,816,567;
and 4,816397, which are incorporated herein by reference in their
entirety. Humanized antibodies are antibody molecules from
non-human species antibody that binds the desired antigen having
one or more complementarity determining regions (CDRs) from the
non-human species and a framework regions from a human
immunoglobulin molecule. Often, framework residues in the human
framework regions will be substituted with the corresponding
residue from the CDR donor antibody to alter, preferably improve,
antigen binding. These framework substitutions are identified by
methods well known in the art, e.g., by modeling of the
interactions of the CDR and framework residues to identify
framework residues important for antigen binding and sequence
comparison to identify unusual framework residues at particular
positions. (See, e.g., Queen et al., U.S. Pat. No. 5,585,089;
Rieclumann et al., Nature 332:323 (1988), which are incorporated
herein by reference in their entireties.) Antibodies can be
humanized using a variety of techniques known in the art including,
for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967;
U.S. Pat. Nos. 5,225,539; 5,530,101; and 5,585,089), veneering or
resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology
28(4/5):489-498 (1991); Studnicka et al., Protein Engineering
7(6):805-814 (1994); Roguska et al., PNAS 91:969-973 (1994)), and
chain shuffling (U.S. Pat. No. 5,565,332).
[0239] Completely human antibodies are particularly desirable for
therapeutic treatment of human patients. Human antibodies can be
made by a variety of methods known in the art including phage
display methods described above using antibody libraries derived
from human immunoglobulin sequences. See also, U.S. Pat. Nos.
4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO
98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and
WO 91/10741; each of which is incorporated herein by reference in
its entirety.
[0240] Human antibodies can also be produced using transgenic mice
which are incapable of expressing functional endogenous
immunoglobulins, but which can express human immunoglobulin genes.
For example, the human heavy and light chain immunoglobulin gene
complexes may be introduced randomly or by homologous recombination
into mouse embryonic stem cells. Alternatively, the human variable
region, constant region, and diversity region may be introduced
into mouse embryonic stem cells in addition to the human heavy and
light chain genes. The mouse heavy and light chain immunoglobulin
genes may be rendered non-functional separately or simultaneously
with the introduction of human immunoglobulin loci by homologous
recombination. In particular, homozygous deletion of the JH region
prevents endogenous antibody production. The modified embryonic
stem cells are expanded and microinjected into blastocysts to
produce chimeric mice. The chimeric mice are then bred to produce
homozygous offspring which express human antibodies. The transgenic
mice are immunized in the normal fashion with a selected antigen,
e.g., all or a portion of a polypeptide of the invention.
Monoclonal antibodies directed against the antigen can be obtained
from the immunized, transgenic mice using conventional hybridoma
technology. The human immunoglobulin transgenes harbored by the
transgenic mice rearrange during B cell differentiation, and
subsequently undergo class switching and somatic mutation. Thus,
using such a technique, it is possible to produce therapeutically
useful IgG, IgA, IgM and IgE antibodies. For an overview of this
technology for producing human antibodies, see Lonberg and Huszar,
Int. Rev. Immunol. 13:65-93 (1995). For a detailed discussion of
this technology for producing human antibodies and human monoclonal
antibodies and protocols for producing such antibodies, see, e.g.,
PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO
96/33735; European Patent No. 0 598 877; U.S. Pat. Nos. 5,413,923;
5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318;
5,885,793; 5,916,771; and 5,939,598, which are incorporated by
reference herein in their entirety. In addition, companies such as
Abgenix, Inc. (Freemont, Calif.) and Genpharm (San Jose, CA) can be
engaged to provide human antibodies directed against a selected
antigen using technology similar to that described above.
[0241] Completely human antibodies which recognize a selected
epitope can be generated using a technique referred to as "guided
selection." In this approach a selected non-human monoclonal
antibody, e.g., a mouse antibody, is used to guide the selection of
a completely human antibody recognizing the same epitope. (Jespers
et al., Bio/technology 12:899-903 (1988)).
[0242] Further, antibodies to the polypeptides of the invention
can, in turn, be utilized to generate anti-idiotype antibodies that
"mimic" polypeptides of the invention using techniques well known
to those skilled in the art. (See, e.g., Greenspan & Bona,
FASEB J. 7(5):437-444; (198.9) and Nissinoff, J. Inmunol.
147(8):2429-2438 (1991)). For example, antibodies which bind to and
competitively inhibit polypeptide multimerization and/or binding of
a polypeptide of the invention to a ligand can be used to generate
anti-idiotypes that "mimic" the polypeptide multimerization and/or
binding domain and, as a consequence, bind to and neutralize
polypeptide and/or its ligand. Such neutralizing anti-idiotypes or
Fab fragments of such anti-idiotypes can be used in therapeutic
regimens to neutralize polypeptide ligand. For example, such
anti-idiotypic antibodies can be used to bind a polypeptide of the
invention and/or to bind its ligands/receptors, and thereby block
its biological activity.
Polynucleotides Encoding Antibodies
[0243] The invention further provides polynucleotides comprising a
nucleotide sequence encoding an antibody of the invention and
fragments thereof. The invention also encompasses polynucleotides
that hybridize under stringent or lower stringency hybridization
conditions, e.g., as defined supra, to polynucleotides that encode
an antibody, preferably, that specifically binds to a PSGR
polypeptide of the invention, preferably, an antibody that binds to
a polypeptide having the amino acid sequence of SEQ ID NO:2 or SEQ
ID NO:4.
[0244] The polynucleotides may be obtained, and the nucleotide
sequence of the polynucleotides determined, by any method known in
the art. For example, if the nucleotide sequence of the antibody is
known, a polynucleotide encoding the antibody may be assembled from
chemically synthesized oligonucleotides (e.g., as described in
Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly,
involves the synthesis of overlapping oligonucleotides containing
portions of the sequence encoding the antibody, annealing and
ligating of those oligonucleotides, and then amplification of the
ligated oligonucleotides by PCR.
[0245] Alternatively, a polynucleotide encoding an antibody may be
generated from nucleic acid from a suitable source. If a clone
containing a nucleic acid encoding a particular antibody is not
available, but the sequence of the antibody molecule is known, a
nucleic acid encoding the immunoglobulin may be chemically
synthesized or obtained from a suitable source (e.g., an antibody
cDNA library, or a cDNA library generated from, or nucleic acid,
preferably poly A+ RNA, isolated from, any tissue or cells
expressing the antibody, such as hybridoma cells selected to
express an antibody of the invention) by PCR amplification using
synthetic primers hybridizable to the 3' and 5' ends of the
sequence or by cloning using an oligonucleotide probe specific for
the particular gene sequence to identify, e.g., a cDNA clone from a
cDNA library that encodes the antibody. Amplified nucleic acids
generated by PCR may then be cloned into replicable cloning vectors
using any method well known in the art.
[0246] Once the nucleotide sequence and corresponding amino acid
sequence of the antibody is determined, the nucleotide sequence of
the antibody may be manipulated using methods well known in the art
for the manipulation of nucleotide sequences, e.g., recombinant DNA
techniques, site directed mutagenesis, PCR, etc. (see, for example,
the techniques described in Sambrook et al., 1990, Molecular
Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y. and Ausubel et al., eds.,
1998, Current Protocols in Molecular Biology, John Wiley &
Sons, NY, which are both incorporated by reference herein in their
entireties ), to generate antibodies having a different amino acid
sequence, for example to create amino acid substitutions,
deletions, and/or insertions.
[0247] In a specific embodiment, the amino acid sequence of the
heavy and/or light chain variable domains may be inspected to
identify the sequences of the complementarity determining regions
(CDRs) by methods that are well know in the art, e.g., by
comparison to known amino acid sequences of other heavy and light
chain variable regions to determine the regions of sequence
hypervariability. Using routine recombinant DNA techniques, one or
more of the CDRs may be inserted within framework regions, e.g.,
into human framework regions to humanize a non-human antibody, as
described supra. The framework regions may be naturally occurring
or consensus framework regions, and preferably human framework
regions (see, e.g., Chothia et al., J. Mol. Biol. 278: 457-479
(1998) for a listing of human framework regions). Preferably, the
polynucleotide generated by the combination of the framework
regions and CDRs encodes an antibody that specifically binds a
polypeptide of the invention. Preferably, as discussed supra, one
or more amino acid substitutions may be made within the framework
regions, and, preferably, the amino acid substitutions improve
binding of the antibody to its antigen. Additionally, such methods
may be used to make amino acid substitutions or deletions of one or
more variable region cysteine residues participating in an
intrachain disulfide bond to generate antibody molecules lacking
one or more intrachain disulfide bonds. Other alterations to the
polynucleotide are encompassed by the present invention and within
the skill of the art.
[0248] In addition, techniques developed for the production of
"chimeric antibodies" (Morrison et al., Proc. Natl. Acad. Sci.
81:851-855 (1984); Neuberger et al., Nature 312:604-608 (1984);
Takeda et al., Nature 314:452-454 (1985)) by splicing genes from a
mouse antibody molecule of appropriate antigen specificity together
with genes from a human antibody molecule of appropriate biological
activity can be used. As described supra, a chimeric antibody is a
molecule in which different portions are derived from different
animal species, such as those having a variable region derived from
a murine mAb and a human immunoglobulin constant region, e.g.,
humanized antibodies.
[0249] Alternatively, techniques described for the production of
single chain antibodies (U.S. Pat. No. 4,946,778; Bird, Science
242:423-42 (1988); Huston et al., Proc. Natl. Acad. Sci. USA
85:5879-5883 (1988); and Ward et al., Nature 334:544-54 (1989)) can
be adapted to produce single chain antibodies. Single chain
antibodies are formed by linking the heavy and light chain
fragments of the Fv region via an amino acid bridge, resulting in a
single chain polypeptide. Techniques for the assembly of functional
Fv fragments in E. coli may also be used (Skerra et al., Science
242:1038-1041 (1988)).
Methods of Producing Antibodies
[0250] The antibodies of the invention can be produced by any
method known in the art for the synthesis of antibodies, in
particular, by chemical synthesis or preferably, by recombinant
expression techniques.
[0251] Recombinant expression of an antibody of the invention, or
fragment, derivative or analog thereof, (e.g., a heavy or light
chain of an antibody of the invention or a single chain antibody of
the invention), requires construction of an expression vector
containing a polynucleotide that encodes the antibody. Once a
polynucleotide encoding an antibody molecule or a heavy or light
chain of an antibody, or portion thereof (preferably containing the
heavy or light chain variable domain), of the invention has been
obtained, the vector for the production of the antibody molecule
may be produced by recombinant DNA technology using techniques well
known in the art. Thus, methods for preparing a protein by
expressing a polynucleotide containing an antibody encoding
nucleotide sequence are described herein. Methods which are well
known to those skilled in the art can be used to construct
expression vectors containing antibody coding sequences and
appropriate transcriptional and translational control signals.
These methods include, for example, in vitro recombinant DNA
techniques, synthetic techniques, and in vivo genetic
recombination. The invention, thus, provides replicable vectors
comprising a nucleotide sequence encoding an antibody molecule of
the invention, or a heavy or light chain thereof, or a heavy or
light chain variable domain, operably linked to a promoter. Such
vectors may include the nucleotide sequence encoding the constant
region of the antibody molecule (see, e.g., PCT Publication WO
86/05807; PCT Publication WO 89/01036; and U.S. Pat. No. 5,122,464)
and the variable domain of the antibody may be cloned into such a
vector for expression of the entire heavy or light chain.
[0252] The expression vector is transferred to a host cell by
conventional techniques and the transfected cells are then cultured
by conventional techniques to produce an antibody of the invention.
Thus, the invention includes host cells containing a polynucleotide
encoding an antibody of the invention, or a heavy or light chain
thereof, or a single chain antibody of the invention, operably
linked to a heterologous promoter. In preferred embodiments for the
expression of double-chained antibodies, vectors encoding both the
heavy and light chains may be co-expressed in the host cell for
expression of the entire immunoglobulin molecule, as detailed
below.
[0253] A variety of host-expression vector systems may be utilized
to express the antibody molecules of the invention. Such
host-expression systems represent vehicles by which the coding
sequences of interest may be produced and subsequently purified,
but also represent cells which may, when transformed or transfected
with the appropriate nucleotide coding sequences, express an
antibody molecule of the invention in situ. These include but are
not limited to microorganisms such as bacteria (e.g., E. coli, B.
subtilis) transformed with recombinant bacteriophage DNA, plasmid
DNA or cosmid DNA expression vectors containing antibody coding
sequences; yeast (e.g., Saccharomyces, Pichia) transformed with
recombinant yeast expression vectors containing antibody coding
sequences; insect cell systems infected with recombinant virus
expression vectors (e.g., baculovirus) containing antibody coding
sequences; plant cell systems infected with recombinant virus
expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco
mosaic virus, TMV) or transformed with recombinant plasmid
expression vectors (e.g., Ti plasmid) containing antibody coding
sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3
cells) harboring recombinant expression constructs containing
promoters derived from the genome of mammalian cells (e.g.,
metallothionein promoter) or from mammalian viruses (e.g., the
adenovirus late promoter; the vaccinia virus 7.5K promoter).
Preferably, bacterial cells such as Escherichia coli, and more
preferably, eukaryotic cells, especially for the expression of
whole recombinant antibody molecule, are used for the expression of
a recombinant antibody molecule. For example, mammalian cells, such
as Chinese hamster ovary cells (CHO), in conjunction with a vector
such as the major intermediate early gene promoter element from
human cytomegalovirus is an effective expression system for
antibodies (Foecking et al., Gene 45:101 (1986); Cockett et al.,
Bio/Technology 8:2 (1990)).
[0254] In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the
antibody molecule being expressed. For example, when a large
quantity of such a protein is to be produced, for the generation of
pharmaceutical compositions of an antibody molecule, vectors which
direct the expression of high levels of fusion protein products
that are readily purified may be desirable. Such vectors include,
but are not limited, to the E. coli expression vector pUR278
(Ruther et al., EMBO J. 2:1791 (1983)), in which the antibody
coding sequence may be ligated individually into the vector in
frame with the lac Z coding region so that a fusion protein is
produced; pIN vectors (Inouye & Inouye, Nucleic Acids Res.
13:3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem.
24:5503-5509 (1989)); and the like. pGEX vectors may also be used
to express foreign polypeptides as fusion proteins with glutathione
S-transferase (GST). In general, such fusion proteins are soluble
and can easily be purified from lysed cells by adsorption and
binding to matrix glutathione-agarose beads followed by elution in
the presence of free glutathione. The pGEX vectors are designed to
include thrombin or factor Xa protease cleavage sites so that the
cloned target gene product can be released from the GST moiety.
[0255] In an insect system, Autographa californica nuclear
polyhedrosis virus (AcNPV) is used as a vector to express foreign
genes. The virus grows in Spodoptera frugiperda cells. The antibody
coding sequence may be cloned individually into non-essential
regions (for example the polyhedrin gene) of the virus and placed
under control of an AcNPV promoter (for example the polyhedrin
promoter).
[0256] In mammalian host cells, a number of viral-based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, the antibody coding sequence of interest may be
ligated to an adenovirus transcription/translation control complex,
e.g., the late promoter and tripartite leader sequence. This
chimeric gene may then be inserted in the adenovirus genome by in
vitro or in vivo recombination. Insertion in a non-essential region
of the viral genome (e.g., region E1 or E3) will result in a
recombinant virus that is viable and capable of expressing the
antibody molecule in infected hosts. (e.g., see Logan & Shenk,
Proc. Natl. Acad. Sci. USA 81:355-359 (1984)). Specific initiation
signals may also be required for efficient translation of inserted
antibody coding sequences. These signals include the ATG initiation
codon and adjacent sequences. Furthermore, the initiation codon
must be in phase with the reading frame of the desired coding
sequence to ensure translation of the entire insert. These
exogenous translational control signals and initiation codons can
be of a variety of origins, both natural and synthetic. The
efficiency of expression may be enhanced by the inclusion of
appropriate transcription enhancer elements, transcription
terminators, etc. (see Bittner et al., Methods in Enzymol.
153:51-544 (1987)).
[0257] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products may be important for the function of the
protein. Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins and gene products. Appropriate cell lines or host
systems can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for
proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such mammalian
host cells include but are not limited to CHO, VERY, BHK, Hela,
COS, MDCK, 293, 3T3, W138, and in particular, breast cancer cell
lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D, and
normal mammary gland cell line such as, for example, CRL7030 and
Hs578Bst.
[0258] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
which stably express the antibody molecule may be engineered.
Rather than using expression vectors which contain viral origins of
replication, host cells can be transformed with DNA controlled by
appropriate expression control elements (e.g., promoter, enhancer,
sequences, transcription terminators, polyadenylation sites, etc.),
and a selectable marker. Following the introduction of the foreign
DNA, engineered cells may be allowed to grow for 1-2 days in an
enriched media, and then are switched to a selective media The
selectable marker in the recombinant plasmid confers resistance to
the selection and allows cells to stably integrate the plasmid into
their chromosomes and grow to form foci which in turn can be cloned
and expanded into cell lines. This method may advantageously be
used to engineer cell lines which express the antibody molecule.
Such engineered cell lines may be particularly useful in screening
and evaluation of compounds that interact directly or indirectly
with the antibody molecule.
[0259] A number of selection systems may be used, including but not
limited to the herpes simplex virus thymidine kinase (Wigler et
al., Cell 11:223 (1977)), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl.
Acad. Sci. USA 48:202 (1992)), and adenine
phosphoribosyltransferase (Lowy et al., Cell 22:817 (1980)) genes
can be employed in tk-, hgprt- or aprt-cells, respectively. Also,
antimetabolite resistance can be used as the basis of selection for
the following genes: dhfr, which confers resistance to methotrexate
(Wigler et al., Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al.,
Proc. Natl. Acad. Sci. USA 78:1527 (1981)); gpt, which confers
resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl.
Acad. Sci. USA 78:2072 (1981)); neo, which confers resistance to
the aminoglycoside G-418 Clinical Pharmacy 12:488-505; Wu and Wu,
Biotherapy 3:87-95 (1991); Tolstoshev, Arm. Rev. Pharmacol.
Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993);
and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May,
1993, TEB TECH 11(5):155-215); and hygro, which confers resistance
to hygromycin (Santerre et al., Gene 30:147 (1984)). Methods
commonly known in the art of recombinant DNA technology may be
routinely applied to select the desired recombinant clone, and such
methods are described, for example, in Ausubel et al. (eds.),
Current Protocols in Molecular Biology, John Wiley & Sons, NY
(1993); Kriegler, Gene Transfer and Expression, A Laboratory
Manual, Stockton Press, NY (1990); and in Chapters 12 and 13,
Dracopoli et al. (eds), Current Protocols in Human Genetics, John
Wiley & Sons, NY (1994); Colberre-Garapin et al., J. Mol. Biol.
150:1 (1981), which are incorporated by reference herein in their
entireties.
[0260] The expression levels of an antibody molecule can be
increased by vector amplification (for a review, see Bebbington and
Hentschel, The use of vectors based on gene amplification for the
expression of cloned genes in mammalian cells in DNA cloning,
Vol.3. (Academic Press, New York, 1987)). When a marker in the
vector system expressing antibody is amplifiable, increase in the
level of inhibitor present in culture of host cell will increase
the number of copies of the marker gene. Since the amplified region
is associated with the antibody gene, production of the antibody
will also increase (Crouse et al., Mol. Cell. Biol. 3:257
(1983)).
[0261] The host cell may be co-transfected with two expression
vectors of the invention, the first vector encoding a heavy chain
derived polypeptide and the second vector encoding a light chain
derived polypeptide. The two vectors may contain identical
selectable markers which enable equal expression of heavy and light
chain polypeptides. Alternatively, a single vector may be used
which encodes, and is capable of expressing, both heavy and light
chain polypeptides. In such situations, the light chain should be
placed before the heavy chain to avoid an excess of toxic free
heavy chain (Proudfoot, Nature 322:52 (1986); Kohler, Proc. Natl.
Acad. Sci. USA 77:2197 (1980)). The coding sequences for the heavy
and light chains may comprise cDNA or genomic DNA.
[0262] Once an antibody molecule of the invention has been produced
by an animal, chemically synthesized, or recombinantly expressed,
it may be purified by any method known in the art for purification
of an -mnunoglobulin molecule, for example, by chromatography
(e.g., ion exchange, affinity, particularly by affinity for the
specific antigen after Protein A, and sizing column
chromatography), centrifugation, differential solubility, or by any
other standard technique for the purification of proteins. In
addition, the antibodies of the present invention or fragments
thereof can be fused to heterologous polypeptide sequences
described herein or otherwise known in the art, to facilitate
purification.
[0263] The present invention encompasses antibodies recombinantly
fused or chemically conjugated (including both covalently and
non-covalently conjugations) to a polypeptide of the present
invention (or portion thereof, preferably at least 10, 20, 30, 40,
50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) to
generate fusion proteins. The fusion does not necessarily need to
be direct, but may occur through linker sequences. The antibodies
may be specific for antigens other than polypeptides of the present
invention (or portion thereof, preferably at least 10, 20, 30, 40,
50, 60, 70, 80, 90 or 100 amino acids of the polypeptide). For
example, antibodies may be used to target the polypeptides of the
present invention to particular cell types, either in vitro or in
vivo, by fusing or conjugating the polypeptides of the present
invention to antibodies specific for particular cell surface
receptors. Antibodies fused or conjugated to the polypeptides of
the present invention may also be used in in vitro immunoassays and
purification methods using methods known in the art. See e.g.,
Harbor et al., supra, and PCT publication WO 93/21232; EP 439,095;
Naramura et al., Immunol. Lett. 39:91-99 (1994); U.S. Pat. No.
5,474,981; Gillies et al., PNAS 89:1428-1432 (1992); Fell et al.,
J. Immunol. 146:2446-2452(1991), which are incorporated by
reference in their entireties.
[0264] The present invention further includes compositions
comprising the polypeptides of the present invention fused or
conjugated to antibody domains other than the variable regions. For
example, the polypeptides of the present invention may be fused or
conjugated to an antibody Fc region, or portion thereof. The
antibody portion fused to a polypeptide of the present invention
may comprise the constant region, hinge region, CH1 domain, CH2
domain, and CH3 domain or any combination of whole domains or
portions thereof. The polypeptides may also be fused or conjugated
to the above antibody portions to form multimers. For example, Fc
portions fused to the polypeptides of the present invention can
form dimers through disulfide bonding between the Fc portions.
Higher multimeric forms can be made by fusing the polypeptides to
portions of IgA and IgM. Methods for fusing or conjugating the
polypeptides of the present invention to antibody portions are
known in the art. See, e.g., U.S. Pat. Nos. 5,336,603; 5,622,929;
5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307,434; EP 367,166;
PCT publications WO 96/04388; WO 91/06570; Ashkenazi et al., Proc.
Natl. Acad. Sci. USA 88:10535-10539 (1991); Zheng et al., J.
Immunol. 154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad.
Sci. USA 89:11337-11341(1992) (said references incorporated by
reference in their entireties).
[0265] As discussed, supra, the polypeptides corresponding to a
PSGR polypeptide, polypeptide fragment, or a variant of SEQ ID NO:2
may be fused or conjugated to the above antibody portions to
increase the in vivo half life of the polypeptides or for use in
immunoassays using methods known in the art. Further, the
polypeptides corresponding to SEQ ID NO:2 may be fused or
conjugated to the above antibody portions to facilitate
purification. One reported example describes chimeric proteins
consisting of the first two domains of the human CD4-polypeptide
and various domains of the constant regions of the heavy or light
chains of mammalian immunoglobulins. (EP 394,827; Traunecker et
al., Nature 331:84-86 (1988). The polypeptides of the present
invention fused or conjugated to an antibody having
disulfide-linked dimeric structures (due to the IgG) may also be
more efficient in binding and neutralizing other molecules, than
the monomeric secreted protein or protein fragment alone.
(Fountoulakis et al., J. Biochem. 270:3958-3964 (1995)). In many
cases, the Fc part in a fusion protein is beneficial in therapy and
diagnosis, and thus can result in, for example, improved
pharmacokinetic properties. (EP A 232,262). Alternatively, deleting
the Fc part after the fusion protein has been expressed, detected,
and purified, would be desired. For example, the Fc portion may
hinder therapy and diagnosis if the fusion protein is used as an
antigen for immunizations. In drug discovery, for example, human
proteins, such as hIL-5, have been fused with Fc portions for the
purpose of high-throughput screening assays to identify antagonists
of hIL-5. (See, Bennett et al., J. Molecular Recognition 8:52-58
(1995); Johanson et al., J. Biol. Chem. 270:9459-9471 (1995).
[0266] Moreover, the antibodies or fragments thereof of the present
invention can be fused to marker sequences, such as a peptide to
facilitate purification. In preferred embodiments, the marker amino
acid sequence is a hexa-histidine peptide, such as the tag provided
in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA,
91311), among others, many of which are commercially available. As
described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824
(1989), for instance, hexa-histidine provides for convenient
purification of the fusion protein. Other peptide tags useful for
purification include, but are not limited to, the "HA" tag, which
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson et al., Cell 37:767 (1984)) and the "flag" tag.
[0267] In specific embodiments, an antibody or fragment thereof is
attached to macrocyclic chelators useful for conjugating radiometal
ions, including but not limited to, 177Lu, 90Y, 166Ho, and 153Sm,
to polypeptides. In specific embodiments, the macrocyclic chelator
is 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetraacetic acid
(DOTA). In other specific embodiments, the DOTA is attached to an
antibody of the invention or fragment thereof via a linker
molecule. Examples of linker molecules useful for conjugating DOTA
to a polypeptide are commonly known in the art--see, for example,
DeNardo et al., Clin Cancer Res. 4(10):2483-90, 1998; Peterson et
al., Bioconjug. Chem. 10(4):553-7, 1999; and Zimmerman et al, Nucl.
Med. Biol. 26(8):943-50, 1999 which are hereby incorporated by
reference in their entirety.
[0268] The present invention further encompasses antibodies or
fragments thereof conjugated to a diagnostic or therapeutic agent.
The antibodies can be used diagnostically to, for example, monitor
the development or progression of a tumor as part of a clinical
testing procedure to, e.g., determine the efficacy of a given
treatment regimen. In a specific embodiment, the antibodies can be
used diagnostically to, for example, monitor the development or
progression of a prostatic neoplasm as part of a clinical testing
procedure to, e.g., determine the efficacy of a given treatment
regimen. Detection can be facilitated by coupling the antibody to a
detectable substance. Examples of detectable substances include
various enzymes, prosthetic groups, fluorescent materials,
luminescent materials, bioluminescent materials, radioactive
materials, positron emitting metals using various positron emission
tomographies, and nonradioactive paramagnetic metal ions. The
detectable substance may be coupled or conjugated either directly
to the antibody (or fragment thereof) or indirectly, through an
intermediate (such as, for example, a linker known in the art)
using techniques known in the art. See, for example, U.S. Pat. No.
4,741,900 for metal ions which can be conjugated to antibodies for
use as diagnostics according to the present invention. Examples of
suitable enzymes include horseradish peroxidase, alkaline
phosphatase, beta-galactosidase, or acetylcholinesterase; examples
of suitable prosthetic group complexes include streptavidin/biotin
and avidin/biotin; examples of suitable fluorescent materials
include umbelliferone, fluorescein, fluorescein isothiocyanate,
rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerytin; an example of a luminescent material includes luminol;
examples of bioluminescent materials include luciferase, luciferin,
and aequorin; and examples of suitable radioactive material include
125I, 131I, 111In or 99Tc.
[0269] Further, an antibody or fragment thereof may be conjugated
to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or
cytocidal agent, a therapeutic agent or a radioactive metal ion,
e.g., alpha-emitters such as, for example, 213Bi. A cytotoxin or
cytotoxic agent includes any agent that is detrimental to cells.
Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium
bromide, emetine, mitomycin, etoposide, tenoposide, vincristine,
vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy
anthracin dione, mitoxantrone, mithramycin, actinomycin D,
1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, and puromycin and analogs or homologs
thereof. Therapeutic agents include, but are not limited to,
antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating
agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine and vinblastine).
[0270] The conjugates of the invention can be used for modifying a
given biological response, the therapeutic agent or drug moiety is
not to be construed as limited to classical chemical therapeutic
agents. For example, the drug moiety may be a protein or
polypeptide possessing a desired biological activity. Such proteins
may include, for example, a toxin such as abrin, ricin A,
pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor
necrosis factor, a-interferon, B-interferon, nerve growth factor,
platelet derived growth factor, tissue plasminogen activator, an
apoptotic agent, e.g., TNF-alpha, TNF-beta, AIM I (See,
International Publication No. WO 97/33899), AIM II (See,
International Publication No. WO 97/34911), Fas Ligand (Takahashi
et al., Int. I77zunol., 6:1567-1574 (1994)), VEGI (See,
International Publication No. WO 99/23105), a thrombotic agent or
an anti-angiogenic agent, e.g., angiostatin or endostatin; or,
biological response modifiers such as, for example, lymphokines,
interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6
("IL-6"), granulocyte macrophage colony stimulating factor
("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or
other growth factors.
[0271] Antibodies may also be attached to solid supports, which are
particularly useful for immunoassays or purification of the target
antigen. Such solid supports include, but are not limited to,
glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl
chloride or polypropylene.
[0272] Techniques for conjugating such therapeutic moiety to
antibodies are well known, see, e.g., Arnon et al., "Monoclonal
Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in
Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.),
pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies
For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson
et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe,
"Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al. (eds.), pp. 475-506 (1985);
"Analysis, Results, And Future Prospective Of The Therapeutic Use
Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal
Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.),
pp.303-16 (Academic Press 1985), and Thorpe et al., "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev. 62:119-58 (1982).
[0273] Alternatively, an antibody can be conjugated to a second
antibody to form an antibody heteroconjugate as described by Segal
in U.S. Pat. No. 4,676,980, which is incorporated herein by
reference in its entirety.
[0274] An antibody, with or without a therapeutic moiety conjugated
to it, administered alone or in combination with cytotoxic
factor(s) and/or cytokine(s) can be used as a therapeutic.
Immunophenotyping
[0275] The antibodies of the invention may be utilized for
immunophenotyping of cell lines and biological samples. The
translation product of the gene of the present invention may be
useful as a cell specific marker, or more specifically as a
cellular marker that is differentially expressed at various stages
of differentiation and/or maturation of particular cell types.
Monoclonal antibodies directed against a specific epitope, or
combination of epitopes, will allow for the screening of cellular
populations expressing the marker. Various techniques can be
utilized using monoclonal antibodies to screen for cellular
populations expressing the marker(s), and include magnetic
separation using antibody-coated magnetic beads, "panning" with
antibody attached to a solid matrix (i.e., plate), and flow
cytometry (See, e.g., U.S. Pat. No. 5,985,660; and Morrison et al.,
Cell, 96:737-49 (1999)).
[0276] These techniques allow for the screening of particular
populations of cells, such as might be found with hematological
malignancies (i.e. minimal residual disease (MRD) in acute leukemic
patients) and "non-self" cells in transplantations to prevent
Graft-versus-Host Disease (GVHD). Alternatively, these techniques
allow for the screening of hematopoietic stem and progenitor cells
capable of undergoing proliferation and/or differentiation, as
might be found in human umbilical cord blood.
Assays For Antibody Binding
[0277] The antibodies of the invention may be assayed for
immnunospecific binding by any method known in the art. The
immunoassays which can be used include but are not limited to
competitive and non-competitive assay systems using techniques such
as western blots, radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoprecipitation
assays, precipitin reactions, gel diffusion precipitin reactions,
immunodiffusion assays, agglutination assays, complement-fixation
assays, immunoradiometric assays, fluorescent immunoassays, protein
A immunoassays, to name but a few. Such assays are routine and well
known in the art (see, e.g., Ausubel et al, eds, 1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons,
Inc., New York, which is incorporated by reference herein in its
entirety). Exemplary immunoassays are described briefly below (but
are not intended by way of limitation).
[0278] Immunoprecipitation protocols generally comprise lysing a
population of cells in a lysis buffer such as RIPA buffer (1% NP-40
or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl,
0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with
protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF,
aprotinin, sodium vanadate), adding the antibody of interest to the
cell lysate, incubating for a period of time (e.g., 1-4 hours) at
4.degree. C., adding protein A and/or protein G sepharose beads to
the cell lysate, incubating for about an hour or more at 4.degree.
C., washing the beads in lysis buffer and resuspending the beads in
SDS/sample buffer. The ability of the antibody of interest to
immunoprecipitate a particular antigen can be assessed by, e.g.,
western blot analysis. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase
the binding of the antibody to an antigen and decrease the
background (e.g., pre-clearing the cell lysate with sepharose
beads). For further discussion regarding immunoprecipitation
protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at
10.16.1.
[0279] Western blot analysis generally comprises preparing protein
samples, electrophoresis of the protein samples in a polyacrylamide
gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the
antigen), transferring the protein sample from the polyacrylamide
gel to a membrane such as nitrocellulose, PVDF or nylon, blocking
the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat
milk), washing the membrane in washing buffer (e.g., PBS-Tween 20),
blocking the membrane with primary antibody (the antibody of
interest) diluted in blocking buffer, washing the membrane in
washing buffer, blocking the membrane with a secondary antibody
(which recognizes the primary antibody, e.g., an anti-human
antibody) conjugated to an enzymatic substrate (e.g., horseradish
peroxidase or alkaline phosphatase) or radioactive molecule (e.g.,
.sup.32P or .sup.125I) diluted in blocking buffer, washing the
membrane in wash buffer, and detecting the presence of the antigen.
One of skill in the art would be knowledgeable as to the parameters
that can be modified to increase the signal detected and to reduce
the background noise. For further discussion regarding western blot
protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at
10.8.1.
[0280] ELISAs comprise preparing antigen, coating the well of a 96
well microtiter plate with the antigen, adding the antibody of
interest conjugated to a detectable compound such as an enzymatic
substrate (e.g., horseradish peroxidase or alkaline phosphatase) to
the well and incubating for a period of time, and detecting the
presence of the antigen. In ELISAs the antibody of interest does
not have to be conjugated to a detectable compound; instead, a
second antibody (which recognizes the antibody of interest)
conjugated to a detectable compound may be added to the well.
Further, instead of coating the well with the antigen, the antibody
may be coated to the well. In this case, a second antibody
conjugated to a detectable compound may be added following the
addition of the antigen of interest to the coated well. One of
skill in the art would be knowledgeable as to the parameters that
can be modified to increase the signal detected as well as other
variations of ELISAs known in the art. For further discussion
regarding ELISAs see, e.g., Ausubel et al, eds, 1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons,
Inc., New York at 11.2.1.
[0281] The binding affinity of an antibody to an antigen and the
off-rate of an antibody-antigen interaction can be determined by
competitive binding assays. One example of a competitive binding
assay is a radioimnunoassay comprising the incubation of labeled
antigen (e.g., 3H or 125I) with the antibody of interest in the
presence of increasing amounts of unlabeled antigen, and the
detection of the antibody bound to the labeled antigen. The
affinity of the antibody of interest for a particular antigen and
the binding off-rates can be determined from the data by scatchard
plot analysis. Competition with a second antibody can also be
determined using radioimmunoassays. In this case, the antigen is
incubated with antibody of interest conjugated to a labeled
compound (e.g., 3H or 125I) in the presence of increasing amounts
of an unlabeled second antibody.
[0282] Antibodies of the invention may be characterized using
Immunocytochemisty methods on cells (e.g., mammalian cells, such as
CHO cells) transfected with a vector enabling the expression of
PSGR or with vector alone using techniques commonly known in the
art. Antibodies that bound PSGR transfected- but not vector-only
tranfected, cells are PSGR specific.
Therapeutic Uses
[0283] The present invention is further directed to antibody-based
therapies which involve administering antibodies of the invention
to an animal, preferably a mammal, and most preferably a human,
patient for treating one or more of the disclosed diseases,
disorders, or conditions. Therapeutic compounds of the invention
include, but are not limited to, antibodies of the invention
(including fragments, analogs and derivatives thereof as described
herein) and nucleic acids encoding antibodies of the invention
(including fragments, analogs and derivatives thereof and
anti-idiotypic antibodies as described herein). The antibodies of
the invention can be used to treat, inhibit or prevent diseases,
disorders or conditions associated with aberrant expression and/or
activity of a polypeptide of the invention, including, but not
limited to, any one or more of the diseases, disorders, or
conditions described herein. The treatment and/or prevention of
diseases, disorders, or conditions associated with aberrant
expression and/or activity of a polypeptide of the invention
includes, but is not limited to, alleviating symptoms associated
with those diseases, disorders or conditions. Antibodies of the
invention may be provided in pharmaceutically acceptable
compositions as known in the art or as described herein.
[0284] In a specific and preferred embodiment, the present
invention is directed to antibody-based therapies which involve
administering antibodies of the invention to an animal, preferably
a mammal, and most preferably a human, patient for treating one or
more of the diseases, disorders, or conditions of the prostate,
including, but not limited to, inflammatory disorders, such as
chronic prostatitis, granulomatous prostatitis and malacoplakia,
prostatic hyperplasia; and prostate neoplastic disorders, including
adenocarcinoma, transitional cell carcinomas, ductal carcinomas,
squamous cell carcinomas; or as hormones or factors with systemic
or reproductive functions. Therapeutic compounds of the invention
include, but are not limited to, antibodies of the invention (e.g.,
antibodies directed to one or any combination of the extracellular
and intracellular domains of PSGR; antibodies directed to the full
length protein expressed on the cell surface of a mammalian cell;
antibodies directed to an epitope of PSGR (such as, a linear
epitope or a conformational epitope), including fragments, analogs
and derivatives thereof as described herein) and nucleic acids
encoding antibodies of the invention (including fragments, analogs
and derivatives thereof and anti-idiotypic antibodies as described
herein). The antibodies of the invention can be used to treat,
inhibit or prevent diseases, disorders or conditions associated
with aberrant expression and/or activity of a polypeptide of the
invention, including, but not limited to, any one or more of the
diseases, disorders, or conditions of the prostate described
herein. The treatment and/or prevention of diseases, disorders, or
conditions of the prostate associated with aberrant expression
and/or activity of a polypeptide of the invention includes, but is
not limited to, alleviating symptoms associated with those
diseases, disorders or conditions. Antibodies of the invention may
be provided in pharmaceutically acceptable compositions as known in
the art or as described herein.
[0285] A summary of the ways in which the antibodies of the present
invention may be used therapeutically includes binding
polynucleotides or polypeptides of the present invention locally or
systemically in the body or by direct cytotoxicity of the antibody,
e.g. as mediated by complement (CDC) or by effector cells (ADCC).
Some of these approaches are described in more detail below. Armed
with the teachings provided herein, one of ordinary skill in the
art will know how to use the antibodies of the present invention
for diagnostic, monitoring or therapeutic purposes without undue
experimentation.
[0286] The antibodies of this invention may be advantageously
utilized in combination with other monoclonal or chimeric
antibodies, or with lymphokines or hematopoietic growth factors
(such as, e.g., IL-2, IL-3 and IL-7), for example, which serve to
increase the number or activity of effector cells which interact
with the antibodies.
[0287] The antibodies of the invention may be administered alone or
in combination with other types of treatments (e.g., radiation
therapy, chemotherapy, hormonal therapy, immunotherapy and
anti-tumor agents). Generally, administration of products of a
species origin or species reactivity (in the case of antibodies)
that is the same species as that of the patient is preferred. Thus,
in a preferred embodiment, human antibodies, fragments derivatives,
analogs, or nucleic acids, are administered to a human patient for
therapy or prophylaxis.
[0288] It is preferred to use high affinity and/or potent in vivo
inhibiting and/or neutralizing antibodies against polypeptides or
polynucleotides of the present invention, fragments or regions
thereof, for both immunoassays directed to and therapy of disorders
related to polynucleotides or polypeptides, including fragments
thereof, of the present invention. Such antibodies, fragments, or
regions, will preferably have an affinity for polynucleotides or
polypeptides of the invention, including fragments thereof.
Preferred binding affinities include those with a dissociation
constant or Kd less than 5.times.10.sup.-2 M, 10.sup.-2 M,
5.times.10.sup.-3 M, 10.sup.-3 M, 5.times.10.sup.-4 M, 10.sup.-4 M,
5.times.10.sup.-5 M, 10.sup.-5 M, 5.times.10.sup.-6 M, 10.sup.-6 M,
5.times.10.sup.-7 M, 10.sup.-7 M, 5.times.10.sup.-8 M, 10.sup.-8 M,
5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10 M, 10.sup.-10
M, 5.times.10.sup.-11 M, 10.sup.-11 M, 5.times.10.sup.-12 M,
10.sup.-12 M, 5.times.10.sup.-13 M, 10.sup.-13 M,
5.times.10.sup.-14 M, 10.sup.-14 M, 5.times.10.sup.-15 M, and
10.sup.-15 M.
Gene Therapy
[0289] In a specific embodiment, nucleic acids comprising sequences
encoding antibodies or functional derivatives thereof, are
administered to treat, inhibit or prevent a disease or disorder
associated with aberrant expression and/or activity of a
polypeptide of the invention, by way of gene therapy. Gene therapy
refers to therapy performed by the administration to a subject of
an expressed or expressible nucleic acid. In this embodiment of the
invention, the nucleic acids produce their encoded protein that
mediates a therapeutic effect.
[0290] Any of the methods for gene therapy available in the art can
be used according to the present invention. Exemplary methods are
described below.
[0291] For general reviews of the methods of gene therapy, see
Goldspiel et al., Clinical Pharmacy 12:488-505 (1993); Wu and Wu,
Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol.
Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993);
and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May,
TIBTECH 11(5):155-215 (1993). Methods commonly known in the art of
recombinant DNA technology which can be used are described in
Ausubel et al. (eds.), Current Protocols in Molecular Biology, John
Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and
Expression, A Laboratory Manual, Stockton Press, N.Y. (1990).
[0292] In a preferred aspect, the compound comprises nucleic acid
sequences encoding an antibody, said nucleic acid sequences being
part of expression vectors that express the antibody or fragments
or chimeric proteins or heavy or light chains thereof in a suitable
host. In particular, such nucleic acid sequences have promoters
operably linked to the antibody coding region, said promoter being
inducible or constitutive, and, optionally, tissue- specific. In
another particular embodiment, nucleic acid molecules are used in
which the antibody coding sequences and any other desired sequences
are flanked by regions that promote homologous recombination at a
desired site in the genome, thus providing for intrachromosomal
expression of the antibody encoding nucleic acids (Koller and
Smithies, Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); Zijlstra
et al., Nature 342:435-438 (1989). In specific embodiments, the
expressed antibody molecule is a single chain antibody;
alternatively, the nucleic acid sequences include sequences
encoding both the heavy and light chains, or fragments thereof, of
the antibody.
[0293] Delivery of the nucleic acids into a patient may be either
direct, in which case the patient is directly exposed to the
nucleic acid or nucleic acid- carrying vectors, or indirect, in
which case, cells are first transformed with the nucleic acids in
vitro, then transplanted into the patient. These two approaches are
known, respectively, as in vivo or ex vivo gene therapy.
[0294] In a specific embodiment, the nucleic acid sequences are
directly administered in vivo, where it is expressed to produce the
encoded product. This can be accomplished by any of numerous
methods known in the art, e.g., by constructing them as part of an
appropriate nucleic acid expression vector and administering it so
that they become intracellular, e.g., by infection using defective
or attenuated retrovirals or other viral vectors (see U.S. Pat. No.
4,980,286), or by direct injection of naked DNA, or by use of
microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or
coating with lipids or cell-surface receptors or transfecting
agents, encapsulation in liposomes, microparticles, or
microcapsules, or by administering them in linkage to a peptide
which is known to enter the nucleus, by administering it in linkage
to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu
and Wu, J. Biol. Chem. 262:4429-4432 (1987)) (which can be used to
target cell types specifically expressing the receptors), etc. In
another embodiment, nucleic acid-ligand complexes can be formed in
which the ligand comprises a fusogenic viral peptide to disrupt
endosomes, allowing the nucleic acid to avoid lysosomal
degradation. In yet another embodiment, the nucleic acid can be
targeted in vivo for cell specific uptake and expression, by
targeting a specific receptor (see, e.g., PCT Publications WO
92/06180; WO 92/22635; WO92/20316; WO93/14188, WO 93/20221).
Alternatively, the nucleic acid can be introduced intracellularly
and incorporated within host cell DNA for expression, by homologous
recombination (Koller and Smithies, Proc. Natl. Acad. Sci. USA
86:8932-8935 (1989); Zijlstra et al., Nature 342:435-438
(1989)).
[0295] In a specific embodiment, viral vectors that contain nucleic
acid sequences encoding an antibody of the invention are used. For
example, a retroviral vector can be used (see Miller et al., Meth.
Enzymol. 217:581-599 (1993)). These retroviral vectors contain the
components necessary for the correct packaging of the viral genome
and integration into the host cell DNA. The nucleic acid sequences
encoding the antibody to be used in gene therapy are cloned into
one or more vectors, which facilitates delivery of the gene into a
patient. More detail about retroviral vectors can be found in
Boesen et al., Biotherapy 6:291-302 (1994), which describes the use
of a retroviral vector to deliver the mdr1 gene to hematopoietic
stem cells in order to make the stem cells more resistant to
chemotherapy. Other references illustrating the use of retroviral
vectors in gene therapy are: Clowes et al., J. Clin. Invest.
93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994); Salmons
and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and
Wilson, Curr. Opin. in Genetics and Devel. 3:110-114 (1993).
[0296] Adenoviruses are other viral vectors that can be used in
gene therapy. Adenoviruses are especially attractive vehicles for
delivering genes to respiratory epithelia. Adenoviruses naturally
infect respiratory epithelia where they cause a mild disease. Other
targets for adenovirus-based delivery systems are liver, the
central nervous system, endothelial cells, and muscle. Adenoviruses
have the advantage of being capable of infecting non-dividing
cells. Kozarsky and Wilson, Current Opinion in Genetics and
Development 3:499-503 (1993) present a review of adenovirus-based
gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994)
demonstrated the use of adenovirus vectors to transfer genes to the
respiratory epithelia of rhesus monkeys. Other instances of the use
of adenoviruses in gene therapy can be found in Rosenfeld et al.,
Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155
(1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT
Publication W094/12649; and Wang, et al., Gene Therapy 2:775-783
(1995). In a preferred embodiment, adenovirus vectors are used.
[0297] Adeno-associated virus (AAV) has also been proposed for use
in gene therapy (Walsh et al., Proc. Soc. Exp. Biol. Med.
204:289-300 (1993); U.S. Pat. No. 5,436,146).
[0298] Another approach to gene therapy involves transferring a
gene to cells in tissue culture by such methods as electroporation,
lipofection, calcium phosphate mediated transfection, or viral
infection. Usually, the method of transfer includes the transfer of
a selectable marker to the cells. The cells are then placed under
selection to isolate those cells that have taken up and are
expressing the transferred gene. Those cells are then delivered to
a patient.
[0299] In this embodiment, the nucleic acid is introduced into a
cell prior to administration in vivo of the resulting recombinant
cell. Such introduction can be carried out by any method known in
the art, including but not limited to transfection,
electroporation, microinjection, infection with a viral or
bacteriophage vector containing the nucleic acid sequences, cell
fusion, chromosome-mediated gene transfer, microcell-mediated gene
transfer, spheroplast fusion, etc. Numerous techniques are known in
the art for the introduction of foreign genes into cells (see,
e.g., Loeffler and Belr, Meth. Enzymol. 217:599-618 (1993); Cohen
et al., Meth. Enzymol. 217:618-644 (1993); Cline, Pharmac. Ther.
29:69-92m (1985) and may be used in accordance with the present
invention, provided that the necessary developmental and
physiological functions of the recipient cells are not disrupted.
The technique should provide for the stable transfer of the nucleic
acid to the cell, so that the nucleic acid is expressible by the
cell and preferably heritable and expressible by its cell
progeny.
[0300] The resulting recombinant cells can be delivered to a
patient by various methods known in the art. Recombinant blood
cells (e.g., hematopoietic stem or progenitor cells) are preferably
administered intravenously. The amount of cells envisioned for use
depends on the desired effect, patient state, etc., and can be
determined by one skilled in the art.
[0301] Cells into which a nucleic acid can be introduced for
purposes of gene therapy encompass any desired, available cell
type, and include but are not limited to epithelial cells,
endothelial cells, keratinocytes, fibroblasts, muscle cells,
hepatocytes; blood cells such as Tlymphocytes, Blymphocytes,
monocytes, macrophages, neutrophils, eosinophils, megakaryocytes,
granulocytes; various stem or progenitor cells, in particular
hematopoietic stem or progenitor cells, e.g., as obtained from bone
marrow, umbilical cord blood, peripheral blood, fetal liver,
etc.
[0302] In a preferred embodiment, the cell used for gene therapy is
autologous to the patient.
[0303] In an embodiment in which recombinant cells are used in gene
therapy, nucleic acid sequences encoding an antibody are introduced
into the cells such that they are expressible by the cells or their
progeny, and the recombinant cells are then administered in vivo
for therapeutic effect. In a specific embodiment, stem or
progenitor cells are used. Any stem and/or progenitor cells which
can be isolated and maintained in vitro can potentially be used in
accordance with this embodiment of the present invention (see e.g.
PCT Publication WO 94/08598; Stemple and Anderson, Cell 71:973-985
(1992); Rheinwald, Meth. Cell Bio. 21A:229 (1980); and Pittelkow
and Scott, Mayo Clinic Proc. 61:771 (1986)).
[0304] In a specific embodiment, the nucleic acid to be introduced
for purposes of gene therapy comprises an inducible promoter
operably linked to the coding region, such that expression of the
nucleic acid is controllable by controlling the presence or absence
of the appropriate inducer of transcription.
Demonstration of Therapeutic or Prophylactic Activity
[0305] The compounds or pharmaceutical compositions of the
invention are preferably tested in vitro, and then in vivo for the
desired therapeutic or prophylactic activity, prior to use in
humans. For example, in vitro assays to demonstrate the therapeutic
or prophylactic utility of a compound or pharmaceutical composition
include the effect of a compound on a cell line or a patient tissue
sample. The effect of the compound or composition on the cell line
and/or tissue sample can be determined utilizing techniques known
to those of skill in the art including, but not limited to, rosette
formation assays and cell lysis assays. In accordance with the
invention, in vitro assays which can be used to determine whether
administration of a specific compound is indicated, include in
vitro cell culture assays in which a patient tissue sample is grown
in culture, and exposed to or otherwise administered a compound,
and the effect of such compound upon the tissue sample is
observed.
Therapeutic/Prophylactic Administration and Composition
[0306] The invention provides methods of treatment, inhibition and
prophylaxis by administration to a subject of an effective amount
of a compound or pharmaceutical composition of the invention,
preferably an antibody of the invention. In a preferred aspect, the
compound is substantially purified (e.g., substantially free from
substances that limit its effect or produce undesired
side-effects). The subject is preferably an animal, including but
not limited to animals such as cows, pigs, horses, chickens, cats,
dogs, etc., and is preferably a mammal, and most preferably
human.
[0307] Formulations and methods of administration that can be
employed when the compound comprises a nucleic acid or an
immunoglobulin are described above; additional appropriate
formulations and routes of administration can be selected from
among those described herein below.
[0308] Various delivery systems are known and can be used to
administer a compound of the invention, e.g., encapsulation in
liposomes, microparticles, microcapsules, recombinant cells capable
of expressing the compound, receptor-mediated endocytosis (see,
e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)), construction
of a nucleic acid as part of a retroviral or other vector, etc.
Methods of introduction include but are not limited to intradermal,
intramuscular, intraperitoneal, intravenous, subcutaneous,
intranasal, epidural, and oral routes. The compounds or
compositions may be administered by any convenient route, for
example by infusion or bolus injection, by absorption through
epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and
intestinal mucosa, etc.) and may be administered together with
other biologically active agents. Administration can be systemic or
local. In addition, it may be desirable to introduce the
pharmaceutical compounds or compositions of the invention into the
central nervous system by any suitable route, including
intraventricular and intrathecal injection; intraventricular
injection may be facilitated by an intraventricular catheter, for
example, attached to a reservoir, such as an Ommaya reservoir.
Pulmonary administration can also be employed, e.g., by use of an
inhaler or nebulizer, and formulation with an aerosolizing
agent.
[0309] In a specific embodiment, it may be desirable to administer
the pharmaceutical compounds or compositions of the invention
locally to the area in need of treatment; this may be achieved by,
for example, and not by way of limitation, local infusion during
surgery, topical application, e.g., in conjunction with a wound
dressing after surgery, by injection, by means of a catheter, by
means of a suppository, or by means of an implant, said implant
being of a porous, non-porous, or gelatinous material, including
membranes, such as sialastic membranes, or fibers. Preferably, when
administering a protein, including an antibody, of the invention,
care must be taken to use materials to which the protein does not
absorb.
[0310] In another embodiment, the compound or composition can be
delivered in a vesicle, in particular a liposome (see Langer,
Science 249:1527-1533 (1990); Treat et al., in Liposomes in the
Therapy of Infectious Disease and Cancer, Lopez-Berestein and
Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein,
ibid., pp. 317-327; see generally ibid.)
[0311] In yet another embodiment, the compound or composition can
be delivered in a controlled release system. In one embodiment, a
pump may be used (see Langer, supra; Sefton, CRC Crit. Ref. Biomed.
Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek
et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment,
polymeric materials can be used (see Medical Applications of
Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton,
Florida (1974); Controlled Drug Bioavailability, Drug Product
Design and Performance, Smolen and Ball (eds.), Wiley, New York
(1984); Ranger and Peppas, J., Macromol. Sci. Rev. Macromol. Chem.
23:61 (1983); see also Levy et al., Science 228:190 (1985); During
et al., Ann. Neurol. 25:351 (1989); Howard et al., J. Neurosurg.
71:105 (1989)). In yet another embodiment, a controlled release
system can be placed in proximity of the therapeutic target, i.e.,
the brain, thus requiring only a fraction of the systemic dose
(see, e.g., Goodson, in Medical Applications of Controlled Release,
supra, vol. 2, pp. 115-138 (1984)).
[0312] Other controlled release systems are discussed in the review
by Langer (Science 249:1527-1533 (1990)).
[0313] In a specific embodiment where the compound of the invention
is a nucleic acid encoding a protein, the nucleic acid can be
administered in vivo to promote expression of its encoded protein,
by constructing it as part of an appropriate nucleic acid
expression vector and administering it so that it becomes
intracellular, e.g., by use of a retroviral vector (see U.S. Pat.
No. 4,980,286), or by direct injection, or by use of microparticle
bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with
lipids or cell-surface receptors or transfecting agents, or by
administering it in linkage to a homeobox- like peptide which is
known to enter the nucleus (see e.g., Joliot et al., Proc. Natl.
Acad. Sci. USA 88:1864-1868 (1991)), etc. Alternatively, a nucleic
acid can be introduced intracellularly and incorporated within host
cell DNA for expression, by homologous recombination.
[0314] The present invention also provides pharmaceutical
compositions. Such compositions comprise a therapeutically
effective amount of a compound, and a pharmaceutically acceptable
carrier. In a specific embodiment, the term "pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and more
particularly in humans. The term "carrier" refers to a diluent,
adjuvant, excipient, or vehicle with which the therapeutic is
administered. Such pharmaceutical carriers can be sterile liquids,
such as water and oils, including those of petroleum, animal,
vegetable or synthetic origin, such as peanut oil, soybean oil,
mineral oil, sesame oil and the like. Water is a preferred carrier
when the pharmaceutical composition is administered intravenously.
Saline solutions and aqueous dextrose and glycerol solutions can
also be employed as liquid carriers, particularly for injectable
solutions. Suitable pharmaceutical excipients include starch,
glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, sodium stearate, glycerol monostearate, talc, sodium
chloride, dried skim milk, glycerol, propylene, glycol, water,
ethanol and the like. The composition, if desired, can also contain
minor amounts of wetting or emulsifying agents, or pH buffering
agents. These compositions can take the form of solutions,
suspensions, emulsion, tablets, pills, capsules, powders,
sustained-release formulations and the like. The composition can be
formulated as a suppository, with traditional binders and carriers
such as triglycerides. Oral formulation can include standard
carriers such as pharmaceutical grades of mannitol, lactose,
starch, magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate, etc. Examples of suitable pharmaceutical carriers are
described in "Remington's Pharmaceutical Sciences" by E. W. Martin.
Such compositions will contain a therapeutically effective amount
of the compound, preferably in purified form, together with a
suitable amount of carrier so as to provide the form for proper
administration to the patient. The formulation should suit the mode
of administration.
[0315] In a preferred embodiment, the composition is formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for intravenous administration to human beings. Typically,
compositions for intravenous administration are solutions in
sterile isotonic aqueous buffer. Where necessary, the composition
may also include a solubilizing agent and a local anesthetic such
as lignocaine to ease pain at the site of the injection. Generally,
the ingredients are supplied either separately or mixed together in
unit dosage form, for example, as a dry lyophilized powder or water
free concentrate in a hermetically sealed container such as an
ampoule or sachette indicating the quantity of active agent. Where
the composition is to be administered by infusion, it can be
dispensed with an infusion bottle containing sterile pharmaceutical
grade water or saline. Where the composition is administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients may be mixed prior to
administration.
[0316] The compounds of the invention can be formulated as neutral
or salt forms. Pharmaceutically acceptable salts include those
formed with anions such as those derived from hydrochloric,
phosphoric, acetic, oxalic, tartaric acids, etc., and those formed
with cations such as those derived from sodium, potassium,
ammonium, calcium, ferric hydroxides, isopropylamine,
triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
[0317] The amount of the compound of the invention which will be
effective in the treatment, inhibition and prevention of a disease
or disorder associated with aberrant expression and/or activity of
a polypeptide of the invention can be determined by standard
clinical techniques. In addition, in vitro assays may optionally be
employed to help identify optimal dosage ranges. The precise dose
to be employed in the formulation will also depend on the route of
administration, and the seriousness of the disease or disorder, and
should be decided according to the judgment of the practitioner and
each patient's circumstances. Effective doses may be extrapolated
from dose-response curves derived from in vitro or animal model
test systems.
[0318] For antibodies, the dosage administered to a patient is
typically 0.1 mg/kg to 100 mg/kg of the patient's body weight.
Preferably, the dosage administered to a patient is between 0.1
mg/kg and 20 mg/kg of the patient's body weight, more preferably 1
mg/kg to 10 mg/kg of the patient's body weight. Generally, human
antibodies have a longer half-life within the human body than
antibodies from other species due to the immune response to the
foreign polypeptides. Thus, lower dosages of human antibodies and
less frequent administration is often possible. Further, the dosage
and frequency of administration of antibodies of the invention may
be reduced by enhancing uptake and tissue penetration (e.g., into
the brain) of the antibodies by modifications such as, for example,
lipidation.
[0319] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Optionally associated with such container(s) can be a notice in the
form prescribed by a governmental agency regulating the
manufacture, use or sale of pharmaceuticals or biological products,
which notice reflects approval by the agency of manufacture, use or
sale for human administration.
Diagnosis and Imaging
[0320] Labeled antibodies, and derivatives and analogs thereof,
which specifically bind to a polypeptide of interest can be used
for diagnostic purposes to detect, diagnose, or monitor diseases
and/or disorders associated with the aberrant expression and/or
activity of a polypeptide of the invention. The invention provides
for the detection of aberrant expression of a polypeptide of
interest, comprising (a) assaying the expression of the polypeptide
of interest in cells or body fluid of an individual using one or
more antibodies specific to the polypeptide interest and (b)
comparing the level of gene expression with a standard gene
expression level, whereby an increase or decrease in the assayed
polypeptide gene expression level compared to the standard
expression level is indicative of aberrant expression.
[0321] The invention provides a diagnostic assay for diagnosing a
prostate disorder, comprising (a) assaying the expression of the
polypeptide of interest in cells or body fluid of an individual
using one or more antibodies specific to the polypeptide interest
and (b) comparing the level of gene expression with a standard gene
expression level, whereby an increase or decrease in the assayed
polypeptide gene expression level compared to the standard
expression level is indicative of a particular disorder. With
respect to cancer, the presence of a relatively high amount of
transcript in biopsied tissue from an individual may indicate a
predisposition for the development of the disease, or may provide a
means for detecting the disease prior to the appearance of actual
clinical symptoms. A more definitive diagnosis of this type may
allow health professionals to employ preventative measures or
aggressive treatment earlier thereby preventing the development or
further progression of the cancer.
[0322] Antibodies of the invention can be used to assay protein
levels in a biological sample using classical immunohistological
methods known to those of skill in the art (e.g., see Jalkanen, et
al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, et al., J. Cell.
Biol. 105:3087-3096 (1987)). Other antibody-based methods useful
for detecting protein gene expression include immunoassays, such as
the enzyme linked immunosorbent assay (ELISA) and the
radioimmunoassay (RIA). Suitable antibody assay labels are known in
the art and include enzyme labels, such as, glucose oxidase;
radioisotopes, such as iodine (125I, 121I), carbon (14C), sulfur
(35S), tritium (3H), indium (112In), and technetium (99Tc);
luminescent labels, such as luminol; and fluorescent labels, such
as fluorescein and rhodamine, and biotin.
[0323] One aspect of the invention is the detection and diagnosis
of a disease or disorder associated with aberrant expression of a
PSGR polypeptide in an animal, preferably a mammal and most
preferably a human. A preferred aspect of the invention is the
detection and diagnosis of a disease or disorder of the prostate
associated with aberrant expression of PSGR in an animal,
preferably a mammal and most preferably a human. In one embodiment,
diagnosis comprises: a) administering (for example, parenterally,
subcutaneously, or intraperitoneally) to a subject an effective
amount of a labeled molecule which specifically binds to the
polypeptide of interest; b) waiting for a time interval following
the administering for permitting the labeled molecule to
preferentially concentrate at sites in the subject where the
polypeptide is expressed (and for unbound labeled molecule to be
cleared to background level); c) determining background level; and
d) detecting the labeled molecule in the subject, such that
detection of labeled molecule above the background level indicates
that the subject has a particular disease or disorder associated
with aberrant expression of the polypeptide of interest. Background
level can be determined by various methods including, comparing the
amount of labeled molecule detected to a standard value previously
determined for a particular system.
[0324] It will be understood in the art that the size of the
subject and the imaging system used will determine the quantity of
imaging moiety needed to produce diagnostic images. In the case of
a radioisotope moiety, for a human subject, the quantity of
radioactivity injected will normally range from about 5 to 20
millicuries of 99mTc. The labeled antibody or antibody fragment
will then preferentially accumulate at the location of cells which
contain the specific protein. In vivo tumor imaging is described in
S. W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled
Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging: The
Radiochemical Detection of Cancer, S. W. Burchiel and B. A. Rhodes,
eds., Masson Publishing Inc. (1982).
[0325] Depending on several variables, including the type of label
used and the mode of administration, the time interval following
the administration for permitting the labeled molecule to
preferentially concentrate at sites in the subject and for unbound
labeled molecule to be cleared to background level is 6 to 48 hours
or 6 to 24 hours or 6 to 12 hours. In another embodiment the time
interval following administration is 5 to 20 days or 5 to 10
days.
[0326] In an embodiment, monitoring of the disease or disorder is
carried out by repeating the method for diagnosing the disease or
disease, for example, one month after initial diagnosis, six months
after initial diagnosis, one year after initial diagnosis, etc.
[0327] Presence of the labeled molecule can be detected in the
patient using methods known in the art for in vivo scanning. These
methods depend upon the type of label used. Skilled artisans will
be able to determine the appropriate method for detecting a
particular label. Methods and devices that may be used in the
diagnostic methods of the invention include, but are not limited
to, computed tomography (CT), whole body scan such as position
emission tomography (PET), magnetic resonance imaging (MRI), and
sonography.
[0328] In a specific embodiment, the molecule is labeled with a
radioisotope and is detected in the patient using a radiation
responsive surgical instrument (Thurston et al., U.S. Pat. No.
5,441,050). In another embodiment, the molecule is labeled with a
fluorescent compound and is detected in the patient using a
fluorescence responsive scanning instrument. In another embodiment,
the molecule is labeled with a positron emitting metal and is
detected in the patent using positron emission-tomography. In yet
another embodiment, the molecule is labeled with a paramagnetic
label and is detected in a patient using magnetic resonance imaging
(MRI).
Kits
[0329] The present invention provides kits that can be used in the
above methods. In one embodiment, a kit comprises an antibody of
the invention, preferably a purified antibody, in one or more
containers. In a specific embodiment, the kits of the present
invention contain a substantially isolated polypeptide comprising
an epitope which is specifically immunoreactive with an antibody
included in the kit. Preferably, the kits of the present invention
further comprise a control antibody which does not react with the
polypeptide of interest. In another specific embodiment, the kits
of the present invention contain a means for detecting the binding
of an antibody to a PSGR polypeptide (e.g., the antibody may be
conjugated to a detectable substrate such as a fluorescent
compound, an enzymatic substrate, a radioactive compound or a
luminescent compound, or a second antibody which recognizes the
first antibody may be conjugated to a detectable substrate).
[0330] In another specific embodiment of the present invention, the
kit is a diagnostic kit for use in screening serum containing
antibodies specific against PSGR polynucleotides and polypeptides.
Such a kit may include a control antibody that does not react with
the polypeptide of interest. Such a kit may include a substantially
isolated polypeptide antigen comprising an epitope which is
specifically immunoreactive with at least one anti-PSGR antibody.
Further, such a kit includes means for detecting the binding of
said antibody to the antigen (e.g., the antibody may be conjugated
to a fluorescent compound such as fluorescein or rhodamine which
can be detected by flow cytometry). In specific embodiments, the
kit may include a recombinantly produced or chemically synthesized
polypeptide antigen. The polypeptide antigen of the kit may also be
attached to a solid support.
[0331] In a more specific embodiment the detecting means of the
above-described kit includes a solid support to which said
polypeptide antigen is attached. Such a kit may also include a
non-attached reporter-labeled anti-human antibody. In this
embodiment, binding of the antibody to the polypeptide antigen can
be detected by binding of the said reporter-labeled antibody.
[0332] In an additional embodiment, the invention includes a
diagnostic kit for use in screening serum containing antigens of
the polypeptide of the invention. The diagnostic kit includes a
substantially isolated antibody specifically immunoreactive with
polypeptide or polynucleotide antigens, and means for detecting the
binding of the polynucleotide or polypeptide antigen to the
antibody. In one embodiment, the antibody is attached to a solid
support. In a specific embodiment, the antibody may be a monoclonal
antibody. The detecting means of the kit may include a second,
labeled monoclonal antibody. Alternatively, or in addition, the
detecting means may include a labeled, competing antigen.
[0333] In one diagnostic configuration, test serum is reacted with
a solid phase reagent having a surface-bound antigen obtained by
the methods of the present invention. After binding with specific
antigen antibody to the reagent and removing unbound serum
components by washing, the reagent is reacted with reporter-labeled
anti-human antibody to bind reporter to the reagent in proportion
to the amount of bound anti-antigen antibody on the solid support.
The reagent is again washed to remove unbound labeled antibody, and
the amount of reporter associated with the reagent is determined.
Typically, the reporter is an enzyme which is detected by
incubating the solid phase in the presence of a suitable
fluorometric, luminescent or calorimetric substrate (Sigma, St.
Louis, Mo.).
[0334] The solid surface reagent in the above assay is prepared by
known techniques for attaching protein material to solid support
material, such as polymeric beads, dip sticks, 96-well plate or
filter material. These attachment methods generally include
non-specific adsorption of the protein to the support or covalent
attachment of the protein, typically through a free amine group, to
a chemically reactive group on the solid support, such as an
activated carboxyl, hydroxyl, or aldehyde group. Alternatively,
streptavidin coated plates can be used in conjunction with
biotinylated antigen(s).
[0335] Thus, the invention provides an assay system or kit for
carrying out this diagnostic method. The kit generally includes a
support with surface-bound recombinant antigens, and a
reporter-labeled anti-human antibody for detecting surface-bound
anti-antigen antibody.
Uses of the PSGR Polvnucleotides
[0336] The PSGR polynucleotides identified herein can be used in
numerous ways as reagents. The following description should be
considered exemplary and utilizes known techniques.
[0337] The polynucleotides of the present invention are useful for
chromosome identification. There exists an ongoing need to identify
new chromosome markers, since few chromosome marking reagents,
based on actual sequence data (repeat polymorphisms), are presently
available. Clone HPRAJ70 is specifically targeted to and can
hybridize with 11 p15. Thus, PSGR polynucleotides of the present
invention can routinely be used as a chromosome marker for
chromosome 11 using techniques known in the art.
[0338] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the sequences shown in SEQ
ID NO:1. Primers can optionally be selected using computer analysis
so that primers do not span more than one predicted exon in the
genomic DNA. These primers are then used for PCR screening of
somatic cell hybrids containing individual human chromosomes. Only
those hybrids containing the human PSGR gene corresponding to the
SEQ ID NO: 1 will yield an amplified fragment.
[0339] Similarly, somatic hybrids provide a rapid method of PCR
mapping the polynucleotides to particular chromosomes. Three or
more clones can be assigned per day using a single thermal cycler.
Moreover, sublocalization of the PSGR polynucleotides can be
achieved with panels of specific chromosome fragments. Other gene
mapping strategies that can be used include in situ hybridization,
prescreening with labeled flow-sorted chromosomes, preselection by
hybridization to construct chromosome specific-cDNA libraries, and
computer mapping techniques (See, e.g., Shuler, Trends Biotechnol
16:456-459 (1998) which is hereby incorporated by reference in its
entirety).
[0340] Precise chromosomal location of the PSGR polynucleotides can
also be achieved using fluorescence in situ hybridization (FISH) of
a metaphase chromosomal spread. This technique uses polynucleotides
as short as 500 or 600 bases; however, polynucleotides 2,000-4,000
bp are preferred. For a review of this technique, see Verma et al.,
"Human Chromosomes: a Manual of Basic Techniques," Pergamon Press,
New York (1988).
[0341] For chromosome mapping, the PSGR polynucleotides can be used
individually (to mark a single chromosome or a single site on that
chromosome) or in panels (for marking multiple sites and/or
multiple chromosomes).
[0342] Thus, the present invention also provides a method for
chromosomal localization which involves (a) preparing PCR primers
from the polynucleotide sequence in SEQ ID NO: 1 and (b) screening
somatic cell hybrids containing individual chromosomes.
[0343] The polynucleotides of the present invention would likewise
be useful for radiation hybrid mapping, HAPPY mapping, and long
range restriction mapping. For a review of these techniques and
others known in the art, see, e.g., Dear, "Genome Mapping: A
Practical Approach," IRL Press at Oxford University Press, London
(1997); Aydin, J. Mol. Med. 77:691-694 (1999); Hacia et al., Mol.
Psychiatry 3:483-492 (1998); Herrick et al., Chromosome Res.
7:409-423 (1999); Hamilton et al., Methods Cell Biol. 62:265-280
(2000); and/or Ott, J. Hered. 90:68-70 (1999) each of which is
hereby incorporated by reference in its entirety.
[0344] Once a polynucleotide has been mapped to a precise
chromosomal location, the physical position of the polynucleotide
can be used in linkage analysis. Linkage analysis establishes
coinheritance between a chromosomal location and presentation of a
particular disease. (Disease mapping data are found, for example,
in V. McKusick, Mendelian Inheritance in Man (available on line
through Johns Hopkins University Welch Medical Library).) Assuming
1 megabase mapping resolution and one gene per 20 kb, a cDNA
precisely localized to a chromosomal region associated with the
disease could be one of 50-500 potential causative genes.
[0345] Thus, once coinheritance is established, differences in the
PSGR polynucleotide and the corresponding gene between affected and
unaffected individuals can be examined. First, visible structural
alterations in the chromosomes, such as deletions or
translocations, are examined in chromosome spreads or by PCR. If no
structural alterations exist, the presence of point mutations are
ascertained. Mutations observed in some or all affected
individuals, but not in normal individuals, indicates that the
mutation may cause the disease. However, complete sequencing of the
PSGR polypeptide and the corresponding gene from several normal
individuals is required to distinguish the mutation from a
polymorphism. If a new polymorphism is identified, this polymorphic
polypeptide can be used for further linkage analysis.
[0346] Furthermore, increased or decreased expression of the gene
in affected individuals as compared to unaffected individuals can
be assessed using PSGR polynucleotides. Any of these alterations
(altered expression, chromosomal rearrangement, or mutation) can be
used as a diagnostic or prognostic marker.
[0347] Thus, the invention also provides a diagnostic method useful
during diagnosis of a disorder, involving measuring the expression
level of polynucleotides of the present invention in cells or body
fluid from an individual and comparing the measured gene expression
level with a standard level of polynucleotide expression level,
whereby an increase or decrease in the gene expression level
compared to the standard is indicative of a disorder.
[0348] In still another embodiment, the invention includes a kit
for analyzing samples for the presence of proliferative and/or
cancerous polynucleotides derived from a test subject. In a general
embodiment, the kit includes at least one polynucleotide probe
containing a nucleotide sequence that will specifically hybridize
with a polynucleotide of the present invention and a suitable
container. In a specific embodiment, the kit includes two
polynucleotide probes defining an internal region of the
polynucleotide of the present invention, where each probe has one
strand containing a 31' mer-end internal to the region. In a
further embodiment, the probes may be useful as primers for
polymerase chain reaction amplification.
[0349] Where a diagnosis of a disorder, has already been made
according to conventional methods, the present invention is useful
as a prognostic indicator, whereby patients exhibiting enhanced or
depressed polynucleotide of the present invention expression will
experience a worse clinical outcome relative to patients expressing
the gene at a level nearer the standard level.
[0350] By "measuring the expression level of polynucleotide of the
present invention" is intended qualitatively or quantitatively
measuring or estimating the level of the polypeptide of the present
invention or the level of the mRNA encoding the polypeptide in a
first biological sample either directly (e.g., by determining or
estimating absolute protein level or mRNA level) or relatively
(e.g., by comparing to the polypeptide level or mRNA level in a
second biological sample). Preferably, the polypeptide level or
mRNA level in the first biological sample is measured or estimated
and compared to a standard polypeptide level or mRNA level, the
standard being taken from a second biological sample obtained from
an individual not having the disorder or being determined by
averaging levels from a population of individuals not having a
disorder. As will be appreciated in the art, once a standard
polypeptide level or mRNA level is known, it can be used repeatedly
as a standard for comparison.
[0351] By "biological sample" is intended any biological sample
obtained from an individual, body fluid, cell line, tissue culture,
or other source which contains the polypeptide of the present
invention or mRNA. As indicated, biological samples include body
fluids (such as semen, lymph, sera, plasma, urine, synovial fluid
and spinal fluid) which contain the polypeptide of the present
invention, and other tissue sources found to express the
polypeptide of the present invention. Methods for obtaining tissue
biopsies and body fluids from mammals are well known in the art.
Where the biological sample is to include mRNA, a tissue biopsy is
the preferred source.
[0352] The method(s) provided above may preferrably be applied in a
diagnostic method and/or kits in which polynucleotides and/or
polypeptides are attached to a solid support. In one exemplary
method, the support may be a "gene chip" or a "biological chip" as
described in U.S. Pat. Nos. 5,837,832, 5,874,219, and 5,856,174.
Further, such a gene chip with polynucleotides of the present
invention attached may be used to identify polymorphisms between
the polynucleotide sequences, with polynucleotides isolated from a
test subject. The knowledge of such polymorphisms (i.e. their
location, as well as, their existence) would be beneficial in
identifying disease loci for many disorders, including cancerous
diseases and conditions. Such a method is described in U.S. Pat.
Nos. 5,858,659 and 5,856,104. The US Patents referenced supra are
hereby incorporated by reference in their entirety herein.
[0353] The present invention encompasses polynucleotides of the
present invention that are chemically synthesized, or reproduced as
peptide nucleic acids (PNA), or according to other methods known in
the art. The use of PNAs would serve as the preferred form if the
polynucleotides are incorporated onto a solid support, or gene
chip. For the purposes of the present invention, a peptide nucleic
acid (PNA) is a polyamide type of DNA analog and the monomeric
units for adenine, guanine, thymine and cytosine are available
commercially (Perceptive Biosystems). Certain components of DNA,
such as phosphorus, phosphorus oxides, or deoxyribose derivatives,
are not present in PNAs. As disclosed by P. E. Nielsen, M. Egholm,
R. H. Berg and O. Buchardt, Science 254, 1497 (1991); and M.
Egholm, O. Buchardt, L. Christensen, C. Behrens, S. M. Freier, D.
A. Driver, R. H. Berg, S. K. Kim, B. Norden, and P. E. Nielsen,
Nature 365, 666 (1993), PNAs bind specifically and tightly to
complementary DNA strands and are not degraded by nucleases. In
fact, PNA binds more strongly to DNA than DNA itself does. This is
probably because there is no electrostatic repulsion between the
two strands, and also the polyamide backbone is more flexible.
Because of this, PNA/DNA duplexes bind under a wider range of
stringency conditions than DNA/DNA duplexes, making it easier to
perform multiplex hybridization. Smaller probes can be used than
with DNA due to the strong binding. In addition, it is more likely
that single base mismatches can be determined with PNA/DNA
hybridization because a single mismatch in a PNA/DNA 15-mer lowers
the melting point (T.sub.m) by 8.degree.-20.degree. C., vs.
4.degree.-16.degree. C. for the DNA/DNA 15-mer duplex. Also, the
absence of charge groups in PNA means that hybridization can be
done at low ionic strengths and reduce possible interference by
salt during the analysis.
[0354] The present invention is useful for detecting cancer in
mammals. In particular the invention is useful during diagnosis of
pathological cell proliferative neoplasias which include, but are
not limited to: acute myelogenous leukemias including acute
monocytic leukemia, acute myeloblastic leukemia, acute
promyelocytic leukemia, acute myelomonocytic leukemia, acute
erythroleukemia, acute megakaryocytic leukemia, and acute
undifferentiated leukemia, etc.; and chronic myelogenous leukemias
including chronic myelomonocytic leukemia, chronic granulocytic
leukemia, etc. Preferred mammals include monkeys, apes, cats, dogs,
cows, pigs, horses, rabbits and humans. Particularly preferred are
humans.
[0355] Pathological cell proliferative disorders are often
associated with inappropriate activation of proto-oncogenes.
(Gelmann, E. P. et al., "The Etiology of Acute Leukemia: Molecular
Genetics and Viral Oncology," in Neoplastic Diseases of the Blood,
Vol 1., Wiemik, P. H. et al. eds., 161-182 (1985)). Neoplasias are
now believed to result from the qualitative alteration of a normal
cellular gene product, or from the quantitative modification of
gene expression by insertion into the chromosome of a viral
sequence, by chromosomal translocation of a gene to a more actively
transcribed region, or by some other mechanism. (Gelmann et al.,
supra) It is likely that mutated or altered expression of specific
genes is involved in the pathogenesis of some leukemias, among
other tissues and cell types. (Gelmann et al., supra) Indeed, the
human counterparts of the oncogenes involved in some animal
neoplasias have been amplified or translocated in some cases of
human leukemia and carcinoma. (Gelmann et al., supra)
[0356] For example, c-myc expression is highly amplified in the
non-lymphocytic leukemia cell line HL-60. When HL-60 cells are
chemically induced to stop proliferation, the level of c-myc is
found to be downregulated. (International Publication Number WO
91/15580) However, it has been shown that exposure of HL-60 cells
to a DNA construct that is complementary to the 5' end of c-myc or
c-myb blocks translation of the corresponding mRNAs which
downregulates expression of the c-myc or c-myb proteins and causes
arrest of cell proliferation and differentiation of the treated
cells. (International Publication Number WO 91/15580; Wickstrom et
al., Proc. Natl. Acad. Sci. 85:1028 (1988); Anfossi et al., Proc.
Natl. Acad. Sci. 86:3379 (1989)). However, the skilled artisan
would appreciate the present invention's usefulness would not be
limited to treatment of proliferative diseases, disorders, and/or
conditions of hematopoietic cells and tissues, in light of the
numerous cells and cell types of varying origins which are known to
exhibit proliferative phenotypes.
[0357] In addition to the foregoing, a PSGR polynucleotide can be
used to control gene expression through triple helix formation or
antisense DNA or RNA. Antisense techniques are discussed, for
example, in Okano, J. Neurochem. 56: 560 (1991);
"Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988). Triple helix formation is
discussed in, for instance Lee et al., Nucleic Acids Research 6:
3073 (1979); Cooney et al., Science 241: 456 (1988); and Dervan et
al., Science 251: 1360 (1991). Both methods rely on binding of the
polynucleotide to a complementary DNA or RNA. For these techniques,
preferred polynucleotides are usually oligonucleotides 20 to 40
bases in length and complementary to either the region of the gene
involved in transcription (triple helix--see Lee et al., Nucl.
Acids Res. 6:3073 (1979); Cooney et al., Science 241:456 (1988);
and Dervan et al., Science 251:1360 (1991) ) or to the mRNA itself
(antisense--Okano, J. Neurochem. 56:560 (1991);
Oligodeoxy-nucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988).) Triple helix formation
optimally results in a shut-off of RNA transcription from DNA,
while antisense RNA hybridization blocks translation of an mRNA
molecule into polypeptide. Both techniques are effective in model
systems, and the information disclosed herein can be used to design
antisense or triple helix polynucleotides in an effort to treat or
prevent disease.
[0358] PSGR polynucleotides are also useful in gene therapy. One
goal of gene therapy is to insert a normal gene into an organism
having a defective gene, in an effort to correct the genetic
defect. PSGR offers a means of targeting such genetic defects in a
highly accurate manner. Another goal is to insert a new gene that
was not present in the host genome, thereby producing a new trait
in the host cell.
[0359] The PSGR polynucleotides are also useful for identifying
individuals from minute biological samples. The United States
military, for example, is considering the use of restriction
fragment length polymorphism (RFLP) for identification of its
personnel. In this teclmique, an individual's genomic DNA is
digested with one or more restriction enzymes, and probed on a
Southern blot to yield unique bands for identifying personnel. This
method does not suffer from the current limitations of "Dog Tags"
which can be lost, switched, or stolen, making positive
identification difficult. The PSGR polynucleotides can be used as
additional DNA markers for RFLP.
[0360] The PSGR polynucleotides can also be used as an alternative
to RFLP, by determining the actual base-by-base DNA sequence of
selected portions of an individual's genome. These sequences can be
used to prepare PCR primers for amplifying and isolating such
selected DNA, which can then be sequenced. Using this technique,
individuals can be identified because each individual will have a
unique set of DNA sequences. Once a unique ID database is
established for an individual, positive identification of that
individual, living or dead, can be made from extremely small tissue
samples.
[0361] Forensic biology also benefits from using DNA-based
identification techniques as disclosed herein. DNA sequences taken
from very small biological samples such as tissues, e.g., hair or
skin, or body fluids, e.g., urine, semen, blood, saliva, synovial
fluid, amniotic fluid, breast milk, lymph, pulmonary sputum or
surfactant, fecal matter, etc., can be amplified using PCR. In one
prior art technique, gene sequences amplified from polymorphic
loci, such as DQa class II HLA gene, are used in forensic biology
to identify individuals. (Erlich, H., PCR Technology, Freeman and
Co. (1992).) Once these specific polymorphic loci are amplified,
they are digested with one or more restriction enzymes, yielding an
identifying set of bands on a Southern blot probed with DNA
corresponding to the DQa class II HLA gene. Similarly, PSGR
polynucleotides can be used as polymorphic markers for forensic
purposes.
[0362] There is also a need for reagents capable of identifying the
source of a particular tissue. Such need arises, for example, in
forensics when presented with tissue of unknown origin. Appropriate
reagents can comprise, for example, DNA probes or primers specific
to particular tissue prepared from PSGR sequences. Panels of such
reagents can identify tissue by species and/or by organ type. In a
similar fashion, these reagents can be used to screen tissue
cultures for contamination.
[0363] Because PSGR is found expressed in prostate, PSGR
polynucleotides are useful as hybridization probes for differential
identification of the tissue(s) or cell type(s) present in a
biological sample. Similarly, polypeptides and antibodies directed
to PSGR polypeptides are useful to provide immunological probes for
differential identification of the tissue(s) or cell type(s). In
addition, for a number of diseases, disorders, and/or conditions of
the above tissues or cells, particularly of the reproductive
system, significantly higher or lower levels of PSGR gene
expression may be detected in certain tissues (e.g., prostate,
cancerous and wounded tissues) or bodily fluids (e.g., urine,
semen, serum, plasma, synovial fluid or spinal fluid) taken from an
individual having such a disorder, relative to a "standard" PSGR
gene expression level, i.e., the PSGR expression level in healthy
tissue from an individual not having the reproductive system
disorder.
[0364] Thus, the invention provides a diagnostic method of a
disorder, which involves: (a) assaying PSGR gene expression level
in cells or body fluid of an individual; (b) comparing the PSGR
gene expression level with a standard PSGR gene expression level,
whereby an increase or decrease in the assayed PSGR gene expression
level compared to the standard expression level is indicative of
disorder in the reproductive system.
[0365] In a preferred embodiment, the invention provides a
diagnostic method of a disorder, which involves: (a) assaying PSGR
gene expression level in prostate cells or body fluid of an
individual (e.g., blood, urine, semen); (b) comparing the PSGR gene
expression level with a standard PSGR gene expression level,
whereby an increase or decrease in the assayed PSGR gene expression
level compared to the standard expression level is indicative of
disorder in the reproductive system, particularly, indicative of a
disorder of the prostate, including but not limited to prostate
cancer.
[0366] In the very least, the PSGR polynucleotides can be used as
molecular weight markers on Southern gels, as diagnostic probes for
the presence of a specific mRNA in a particular cell type, as a
probe to "subtract-out" known sequences in the process of
discovering novel polynucleotides, for selecting and making
oligomers for attachment to a "gene chip" or other support, to
raise anti-DNA antibodies using DNA immunization techniques, and as
an antigen to elicit an immune response.
Uses of PSGR Polypeptides
[0367] PSGR polypeptides can be used in numerous ways. The
following description should be considered exemplary and utilizes
known techniques.
[0368] Polypeptides and antibodies directed to polypeptides of the
present invention are useful to provide immunological probes for
differential identification of the tissue(s) (e.g.,
immunohistochemistry assays such as, for example, ABC
immunoperoxidase (Hsu et al., J. Histochem. Cytochem. 29:577-580
(1981)) or cell type(s) (e.g., immunocytochemistry assays).
[0369] Antibodies can be used to assay levels of polypeptides
encoded by polynucleotides of the invention in a biological sample
using classical immunohistological methods known to those of skill
in the art (Jalkanen, M., et al., J. Cell. Biol. 101:976-985
(1985); Jalkanen, M., et al., J. Cell. Biol. 105:3087-3096 (1987).)
Other antibody-based methods useful for detecting protein gene
expression include immunoassays, such as the enzyme linked
immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
Suitable antibody assay labels are known in the art and include
enzyme labels, such as, glucose oxidase, and radioisotopes, such as
iodine (.sup.131I, .sup.125I, .sup.123I, .sup.121I), carbon
(.sup.14C), sulfur (.sup.35S), tritium (.sup.3H), indium
(.sup.115mIn, .sup.113mIn, .sup.112In, .sup.111In), and technetium
(.sup.99Tc, .sup.99mTc), thallium (.sup.201Ti), gallium (.sup.68Ga,
.sup.67Ga), palladium (.sup.103Pd), molybdenum (.sup.99Mo), xenon
(.sup.133Xe), fluorine (.sup.18F), .sup.153Sm, .sup.177Lu,
.sup.159Gd, .sup.149Pm, .sup.140 La, .sup.175 Yb, .sup.166 Ho,
.sup.90Y, .sup.47Sc, .sup.186Re, .sup.188Re, .sup.142Pr,
.sup.105Rh, .sup.97Ru; luminescent labels, such as luminol; and
fluorescent labels, such as fluorescein and rhodamine, and
biotin.
[0370] In addition to assaying protein levels in a biological
sample, proteins can also be detected in vivo by imaging. Antibody
labels or markers for in vivo imaging of protein include those
detectable by X-radiography, NMR or ESR. For X-radiography,
suitable labels include radioisotopes such as barium or cesium,
which emit detectable radiation but are not overtly harmful to the
subject. Suitable markers for NMR and ESR include those with a
detectable characteristic spin, such as deuterium, which may be
incorporated into the antibody by labeling of nutrients for the
relevant hybridoma.
[0371] A protein-specific antibody or antibody fragment which has
been labeled with an appropriate detectable imaging moiety, such as
a radioisotope (for example, 1311, 112In, .sup.99mTc, (.sup.131I,
.sup.125I, .sup.123I, .sup.121I), carbon (.sup.14C), sulfur
(.sup.35S), tritium (.sup.3H), indium (.sup.115mIn, .sup.113mIn,
.sup.112In, .sup.111In), and technetium (.sup.99Tc, .sup.99mTc),
thallium (.sup.201Ti), gallium (.sup.68Ga, .sup.67Ga), palladium
(.sup.103Pd), molybdenum (.sup.99Mo), xenon (.sup.133Xe), fluorine
(.sup.18F, .sup.153Sm, .sup.177Lu, .sup.159Gd, .sup.149pm,
.sup.140La, .sup.175Yb, .sup.166Ho, .sup.90Y, .sup.47Sc,
.sup.186Re, .sup.188Re, .sup.142Pr, .sup.105Rh, .sup.97Ru), a
radio-opaque substance, or detectable by nuclear magnetic
resonance, is introduced (for example, parenterally,
subcutaneously, or intraperitoneally) into the mammal. It will be
understood in the art that the size of the subject and the imaging
system used will determine the quantity of imaging moiety needed to
produce diagnostic images. In the case of a radioisotope moiety,
for a human subject, the quantity of radioactivity injected will
normally range from about 5 to 20 millicuries of 99mTc. The labeled
antibody or antibody fragment will then preferentially accumulate
at the location of cells which contain the specific protein. In
vivo tumor imaging is described in S. W. Burchiel et al.,
"Immunopharmacokinetics of Radiolabeled Antibodies and Their
Fragments." (Chapter 13 in Tumor Imaging: The Radiochemical
Detection of Cancer, S. W. Burchiel and B. A. Rhodes, eds., Masson
Publishing Inc. (1982).)
[0372] In one embodiment, the invention provides a method for the
specific delivery of compositions of the invention to cells by
administering polypeptides of the invention (e.g., polypeptides
encoded by polynucleotides of the invention and/or antibodies) that
are associated with heterologous polypeptides or nucleic acids. In
one example, the invention provides a method for delivering a
therapeutic protein into the targeted cell. In another example, the
invention provides a method for delivering a single stranded
nucleic acid (e.g., antisense or ribozymes) or double stranded
nucleic acid (e.g., DNA that can integrate into the cell's genome
or replicate episomally and that can be transcribed) into the
targeted cell.
[0373] In another embodiment, the invention provides a method for
the specific destruction of cells (e.g., the destruction of tumor
cells, such as prostate neoplasms) by administering polypeptides of
the invention (e.g., polypeptides encoded by polynucleotides of the
invention and/or antibodies) in association with toxins or
cytotoxic prodrugs.
[0374] In a preferred embodiment, the invention provides a method
for the specific destruction of prostate cells (e.g., aberrant
prostate cells, prostate neoplasm) by administering polypeptides of
the invention (e.g., polypeptides encoded by polynucleotides of the
invention and/or antibodies) in association with toxins or
cytotoxic prodrugs.
[0375] By "toxin" is meant one or more compounds that bind and
activate endogenous cytotoxic effector systems, radioisotopes,
holotoxins, modified toxins, catalytic subunits of toxins, or any
molecules or enzymes not normally present in or on the surface of a
cell that under defined conditions cause the cell's death. Toxins
that may be used according to the methods of the invention include,
but are not limited to, radioisotopes known in the art, compounds
such as, for example, antibodies (or complement fixing containing
portions thereof) that bind an inherent or induced endogenous
cytotoxic effector system, thymidine kinase, endonuclease, RNAse,
alpha toxin, ricin, abrin, Pseudonronas exotoxin A, diphtheria
toxin, saporin, momordin, gelonin, pokeweed antiviral protein,
alpha-sarcin and cholera toxin. "Toxin" also includes a cytostatic
or cytocidal agent, a therapeutic agent or a radioactive metal ion,
e.g., alpha-emitters such as, for example, .sup.213Bi, or other
radioisotopes such as, for example, .sup.103Pd, .sup.133Xe,
.sup.131, .sup.111In, .sup.68Ge, .sup.57Co, .sup.65Zn, .sup.85Sr,
.sup.32P, .sup.35S, .sup.90Y, .sup.153Sm, .sup.153Gd, .sup.169Yb,
.sup.51Cr, .sup.54Mn, .sup.75Se, .sup.113Sn, .sup.90Yttrium,
.sup.117Tin, .sup.186 Rhenium, .sup.166Holmium, and
.sup.188Rhenium; luminescent labels, such as luminol; and
fluorescent labels, such as fluorescein and rhodamine, and
biotin.
[0376] In a specific embodiment, the invention provides a method
for the specific destruction of cells (e.g., the destruction of
tumor cells) by administering polypeptides of the invention or
antibodies of the invention in association with radioisotopes
.sup.90Y, .sup.111In and/or .sup.131I.
[0377] Techniques known in the art may be applied to label
polypeptides of the invention (including antibodies). Such
techniques include, but are not limited to, the use of bifunctional
conjugating agents (see e.g., U.S. Pat. Nos. 5,756,065; 5,714,631;
5,696,239; 5,652,361; 5,505,931; 5,489,425; 5,435,990; 5,428,139;
5,342,604; 5,274,119; 4,994,560; and 5,808,003; the contents of
each of which are hereby incorporated by reference in its
entirety).
[0378] Thus, the invention provides a diagnostic method of a
disorder, which involves (a) assaying the expression of PSGR
polypeptide in cells or body fluid of an individual; (b) comparing
the level of gene expression with a standard gene expression level,
whereby an increase or decrease in the assayed PSGR polypeptide
gene expression level compared to the standard expression level is
indicative of a disorder. With respect to cancer, the presence of a
relatively high amount of transcript in biopsied tissue from an
individual may indicate a predisposition for the development of the
disease, or may provide a means for detecting the disease prior to
the appearance of actual clinical symptoms. A more definitive
diagnosis of this type may allow health professionals to employ
preventative measures or aggressive treatment earlier thereby
preventing the development or further progression of the
cancer.
[0379] Moreover, PSGR polypeptides can be used to treat, prevent,
and/or diagnose disease or conditions of the prostate such as, for
example, inflammatory disorders, such as chronic prostatitis,
granulomatous prostatitis and malacoplakia, prostatic hyperplasia
and prostate neoplastic disorders, including adenocarcinoma,
transitional cell carcinomas, ductal carcinomas, squamous cell
carcinomas, or as hormones or factors with systemic or reproductive
functions. For example, patients can be administered PSGR
polypeptides in an effort to replace absent or decreased levels of
the PSGR polypeptide (e.g., insulin), to supplement absent or
decreased levels of a different polypeptide (e.g., hemoglobin S for
hemoglobin B, SOD, catalase, DNA repair proteins), to inhibit the
activity of a polypeptide (e.g., an oncogene or tumor supressor),
to activate the activity of a polypeptide (e.g., by binding to a
receptor), to reduce the activity of a membrane bound receptor by
competing with it for free ligand (e.g., soluble TNF receptors used
in reducing inflammation), or to bring about a desired response
(e.g., blood vessel growth inhibition, enhancement of the immune
response to proliferative cells or tissues).
[0380] Similarly, antibodies directed to PSGR polypeptides can also
be used to treat, prevent, and/or diagnose disease. For example,
administration of an antibody directed to a PSGR polypeptide can
bind and reduce overproduction of the polypeptide. Similarly,
administration of an antibody can activate the polypeptide, such as
by binding to a polypeptide bound to a membrane (receptor).
[0381] At the very least, the PSGR polypeptides can be used as
molecular weight markers on SDS-PAGE gels or on molecular sieve gel
filtration columns using methods well known to those of skill in
the art. PSGR polypeptides can also be used to raise antibodies,
which in turn are used to measure protein expression from a
recombinant cell, as a way of assessing transformation of the host
cell. Moreover, PSGR polypeptides can be used to test the following
biological activities.
Methods for Detecting Cancer
[0382] In general, a cancer may be detected in a patient based on
the presence of one or more PSGR proteins and/or polynucleotides
encoding such proteins in a biological sample (for example, blood,
sera, urine, and/or tumor biopsies) obtained from the patient. In
other words, such proteins may be used as markers to indicate the
presence or absence of a cancer such as prostate cancer. In
addition, such proteins may be useful for the detection of other
cancers. The binding agents provided herein generally permit
detection of the level of antigen that binds to the agent in the
biological sample. Polynucleotide primers and probes may be used to
detect the level of mRNA encoding PSGR, which is also indicative of
the presence or absence of a cancer. In general, PSGR should be
present at a level that is at least three fold higher in tumor
tissue than in normal tissue.
[0383] There are a variety of assay formats known to those of
ordinary skill in the art for using a binding agent to detect
polypeptide markers in a sample. See, e.g., Harlow and Lane, supra.
In general, the presence or absence of a cancer in a patient may be
determined by (a) contacting a biological sample obtained from a
patient with a binding agent; (b) detecting in the sample a level
of polypeptide that binds to the binding agent; and (c) comparing
the level of polypeptide with a predetermined cut-off value.
[0384] In a preferred embodiment, the assay involves the use of
binding agent immobilized on a solid support to bind to and remove
the polypeptide from the remainder of the sample. The bound
polypeptide may then be detected using a detection reagent that
contains a reporter group and specifically binds to the binding
agent/polypeptide complex. Such detection reagents may comprise,
for example, a binding agent that specifically binds to the
polypeptide or an antibody or other agent that specifically binds
to the binding agent, such as an anti-immunoglobulin, protein G,
protein A or a lectin. Alternatively, a competitive assay may be
utilized, in which a polypeptide is labeled with a reporter group
and allowed to bind to the immobilized binding agent after
incubation of the binding agent with the sample. The extent to
which components of the sample inhibit the binding of the labeled
polypeptide to the binding agent is indicative of the reactivity of
the sample with the immobilized binding agent. Suitable
polypeptides for use within such assays include PSGR and portions
thereof to which the binding agent binds, as described above.
[0385] The solid support may be any material known to those of
skill in the art to which PSGR may be attached. For example, the
solid support may be a test well in a microtiter plate or a
nitrocellulose or other suitable membrane. Alternatively, the
support may be a bead or disc, such as glass fiberglass, latex or a
plastic material such as polystyrene or polyvinylchloride. The
support may also be a magnetic particle or a fiber optic sensor,
such as those disclosed, for example, in U.S. Pat. No. 5,359,681.
The binding agent may be immobilized on the solid support using a
variety of techniques known to those of skill in the art, which are
amply descibed in the patent and scientific literature. In the
context of the present invention, the term "immobilization" refers
to both noncovalent association, such as adsorption, and covalent
attachment (which may be a direct linkage between the agent and
functional groups on the support or may be a linkage by way of a
cross-linking agent). Immobilization by adsorption to a well in a
microtiter plate or to a membrane is preferred. In such cases,
adsorption may be achieved by contacting the binding agent, in a
suitable buffer, with the solid support for the suitable amount of
time. The contact time varies with temperature, but is typically
between about 1 hour and about 1 day. In general, contacting a well
of plastic microtiter plate (such as polystyrene or
polyvinylchloride) with an amount of binding agent ranging from
about 10 ng to about 10 ug, and preferably about 100 ng to about 1
ug, is sufficient to immobilize an adequate amount of binding
agent.
[0386] Covalent attachment of binding agent to a solid support may
generally be achieved by first reacting the support with a
bifunctional reagent that will react with both the support and a
functional group, such as a hydroxyl or amino group, on the binding
agent. For example, the binding agent may be covalently attached to
supports having an appropriate polymer coating using benzoquinone
or by condensation of an aldehyde group on the support with an
amine and an active hydrogen on the binding partner (see, e.g.,
Pierce Immunotechnology Catalog and Handbook, 1991, at
A12-A13).
Gene Therapy Methods
[0387] Another aspect of the present invention is to gene therapy
methods for treating or preventing disorders, diseases and
conditions. The gene therapy methods relate to the introduction of
nucleic acid (DNA, RNA and antisense DNA or RNA) sequences into an
animal to achieve expression of the PSGR polypeptide of the present
invention. This method requires a polynucleotide which codes for a
PSGR polypeptide operatively linked to a promoter and any other
genetic elements necessary for the expression of the polypeptide by
the target tissue. Such gene therapy and delivery techniques are
known in the art, see, for example, WO90/11092, which is herein
incorporated by reference.
[0388] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) comprising a promoter operably
linked to a PSGR polynucleotide ex vivo, with the engineered cells
then being provided to a patient to be treated with the
polypeptide. Such methods are well-known in the art. For example,
see Belldegrun, A., et al., J. Natl. Cancer Inst. 85:207-216
(1993); Ferrantini, M. et al., Cancer Research 53:1107-1112 (1993);
Ferrantini, M. et al., J. Immunology 153:4604-4615 (1994); Kaido,
T., et al., Int. J. Cancer 60:221-229 (1995); Ogura, H., et al.,
Cancer Research 50: 5102-5106 (1990); Santodonato, L., et al.,
Human Gene Therapy 7:1-10 (1996); Santodonato, L., et al., Gene
Therapy 4:1246-1255 (1997); and Zhang, J.-F. et al., Cancer Gene
Therapy 3: 31-38 (1996)), which are herein incorporated by
reference. In one embodiment, the cells which are engineered are
arterial cells. The arterial cells may be reintroduced into the
patient through direct injection to the artery, the tissues
surrounding the artery, or through catheter injection.
[0389] As discussed in more detail below, the PSGR polynucleotide
constructs can be delivered by any method that delivers injectable
materials to the cells of an animal, such as, injection into the
interstitial space of tissues (heart, muscle, skin, lung, liver,
and the like). The PSGR polynucleotide constructs may be delivered
in a pharmaceutically acceptable liquid or aqueous carrier.
[0390] In one embodiment, the PSGR polynucleotide is delivered as a
naked polynucleotide. The term "naked" polynucleotide, DNA or RNA
refers to sequences that are free from any delivery vehicle that
acts to assist, promote or facilitate entry into the cell,
including viral sequences, viral particles, liposome formulations,
lipofectin or precipitating agents and the like. However, the PSGR
polynucleotides can also be delivered in liposome formulations and
lipofectin formulations and the like can be prepared by methods
well known to those skilled in the art. Such methods are described,
for example, in U.S. Pat. Nos. 5,593,972, 5,589,466, and 5,580,859,
which are herein incorporated by reference.
[0391] The PSGR polynucleotide vector constructs used in the gene
therapy method are preferably constructs that will not integrate
into the host genome nor will they contain sequences that allow for
replication. Appropriate vectors include pWLNEO, pSV2CAT, pOG44,
pXT1 and pSG available from Stratagene; pSVK3, pBPV, pMSG and pSVL
available from Pharmacia; and pEF1N5, pcDNA3.1, and pRc/CMV2
available from Invitrogen. Other suitable vectors will be readily
apparent to the skilled artisan.
[0392] Any strong promoter known to those skilled in the art can be
used for driving the expression of PSGR polynucleotide sequence.
Suitable promoters include adenoviral promoters, such as the
adenoviral major late promoter; or heterologous promoters, such as
the cytomegalovirus (CMV) promoter; the respiratory syncytial virus
(RSV) promoter; inducible promoters, such as the MMT promoter, the
metallothionein promoter; heat shock promoters; the albumin
promoter; the ApoAI promoter; human globin promoters; viral
thymidine kinase promoters, such as the Herpes Simplex thymidine
kinase promoter; retroviral LTRS; the b-actin promoter; and human
growth hormone promoters. The promoter also may be the native
promoter for PSGR.
[0393] Unlike other gene therapy techniques, one major advantage of
introducing naked nucleic acid sequences into target cells is the
transitory nature of the polynucleotide synthesis in the cells.
Studies have shown that non-replicating DNA sequences can be
introduced into cells to provide production of the desired
polypeptide for periods of up to six months.
[0394] The PSGR polynucleotide construct can be delivered to the
interstitial space of tissues within the an animal, including of
muscle, skin, brain, lung, liver, spleen, bone marrow, thymus,
heart, lymph, blood, bone, cartilage, pancreas, kidney, gall
bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous
system, eye, gland, and connective tissue. Interstitial space of
the tissues comprises the intercellular, fluid, mucopolysaccharide
matrix among the reticular fibers of organ tissues, elastic fibers
in the walls of vessels or chambers, collagen fibers of fibrous
tissues, or that same matrix within connective tissue ensheathing
muscle cells or in the lacunae of bone. It is similarly the space
occupied by the plasma of the circulation and the lymph fluid of
the lymphatic channels. Delivery to the interstitial space of
muscle tissue is preferred for the reasons discussed below. They
may be conveniently delivered by injection into the tissues
comprising these cells. They are preferably delivered to and
expressed in persistent, non-dividing cells which are
differentiated, although delivery and expression may be achieved in
non-differentiated or less completely differentiated cells, such
as, for example, stem cells of blood or skin fibroblasts. In vivo
muscle cells are particularly competent in their ability to take up
and express polynucleotides.
[0395] For the naked nucleic acid sequence injection, an effective
dosage amount of DNA or RNA will be in the range of from about 0.05
mg/kg body weight to about 50 mg/kg body weight. Preferably the
dosage will be from about 0.005 mg/kg to about 20 mg/kg and more
preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as
the artisan of ordinary skill will appreciate, this dosage will
vary according to the tissue site of injection. The appropriate and
effective dosage of nucleic acid sequence can readily be determined
by those of ordinary skill in the art and may depend on the
condition being treated and the route of administration.
[0396] The preferred route of administration is by the parenteral
route of injection into the interstitial space of tissues. However,
other parenteral routes may also be used, such as, inhalation of an
aerosol formulation particularly for delivery to lungs or bronchial
tissues, throat or mucous membranes of the nose. In addition, naked
PSGR DNA constructs can be delivered to arteries during angioplasty
by the catheter used in the procedure.
[0397] The naked polynucleotides are delivered by any method known
in the art, including, but not limited to, direct needle injection
at the delivery site, intravenous injection, topical
administration, catheter infusion, and so-called "gene guns". These
delivery methods are known in the art.
[0398] The constructs may also be delivered with delivery vehicles
such as viral sequences, viral particles, liposome formulations,
lipofectin, precipitating agents, etc. Such methods of delivery are
known in the art.
[0399] In certain embodiments, the PSGR polynucleotide constructs
are complexed in a liposome preparation. Liposomal preparations for
use in the instant invention include cationic (positively charged),
anionic (negatively charged) and neutral preparations. However,
cationic liposomes are particularly preferred because a tight
charge complex can be formed between the cationic liposome and the
polyanionic nucleic acid. Cationic liposomes have been shown to
mediate intracellular delivery of plasmid DNA (Felgner et al.,
Proc. Natl. Acad. Sci. USA (1987) 84:7413-7416, which is herein
incorporated by reference); mRNA (Malone et al., Proc. Natl. Acad.
Sci. USA (1989) 86:6077-6081, which is herein incorporated by
reference); and purified transcription factors (Debs et al., J.
Biol. Chem. (1990) 265:10189-10192, which is herein incorporated by
reference), in functional form.
[0400] Cationic liposomes are readily available. For example,
N[1-2,3-dioleyloxy)propyl]-N,N,N-triethylammonium (DOTMA) liposomes
are particularly useful and are available under the trademark
Lipofectin, from GIBCO BRL, Grand Island, N.Y. (See, also, Felgner
et al., Proc. Natl Acad. Sci. USA (1987) 84:7413-7416, which is
herein incorporated by reference). Other commercially available
liposomes include transfectace (DDAB/DOPE) and DOTAP/DOPE
(3Boehringer).
[0401] Other cationic liposomes can be prepared from readily
available materials using techniques well known in the art. See,
e.g. PCT Publication No. WO 90/11092 (which is herein incorporated
by reference) for a description of the synthesis of DOTAP
(1,2-bis(oleoyloxy)-3-(trimethylammonio)propane) liposomes.
Preparation of DOTMA liposomes is explained in the literature, see,
e.g., P. Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417,
which is herein incorporated by reference. Similar methods can be
used to prepare liposomes from other cationic lipid materials.
[0402] Similarly, anionic and neutral liposomes are readily
available, such as from Avanti Polar Lipids (Birmingham, Ala.), or
can be easily prepared using readily available materials. Such
materials include phosphatidyl, choline, cholesterol, phosphatidyl
ethanolamine, dioleoylphosphatidyl choline (DOPC),
dioleoylphosphatidyl glycerol (DOPG), dioleoylphoshatidyl
ethanolamine (DOPE), among others. These materials can also be
mixed with the DOTMA and DOTAP starting materials in appropriate
ratios. Methods for making liposomes using these materials are well
known in the art.
[0403] For example, commercially dioleoylphosphatidyl choline
(DOPC), dioleoylphosphatidyl glycerol (DOPG), and
dioleoylphosphatidyl ethanolamine (DOPE) can be used in various
combinations to make conventional liposomes, with or without the
addition of cholesterol. Thus, for example, DOPG/DOPC vesicles can
be prepared by drying 50 mg each of DOPG and DOPC under a stream of
nitrogen gas into a sonication vial. The sample is placed under a
vacuum pump overnight and is hydrated the following day with
deionized water. The sample is then sonicated for 2 hours in a
capped vial, using a Heat Systems model 350 sonicator equipped with
an inverted cup (bath type) probe at the maximum setting while the
bath is circulated at 15EC. Alternatively, negatively charged
vesicles can be prepared without sonication to produce
multilamellar vesicles or by extrusion through nucleopore membranes
to produce unilamellar vesicles of discrete size. Other methods are
known and available to those of skill in the art.
[0404] The liposomes can comprise multilamellar vesicles (MLVs),
small unilamellar vesicles (SUVs), or large unilamellar vesicles
(LUVs), with SUVs being preferred. The various liposome-nucleic
acid complexes are prepared using methods well known in the art.
See, e.g., Straubinger et al., Methods of Immunology (1983),
101:512-527, which is herein incorporated by reference. For
example, MLVs containing nucleic acid can be prepared by depositing
a thin film of phospholipid on the walls of a glass tube and
subsequently hydrating with a solution of the material to be
encapsulated. SUVs are prepared by extended sonication of MLVs to
produce a homogeneous population of unilamellar liposomes. The
material to be entrapped is added to a suspension of preformed MLVs
and then sonicated. When using liposomes containing cationic
lipids, the dried lipid film is resuspended in an appropriate
solution such as sterile water or an isotonic buffer solution such
as 10 mM Tris/NaCl, sonicated, and then the preformed liposomes are
mixed directly with the DNA. The liposome and DNA form a very
stable complex due to binding of the positively charged liposomes
to the cationic DNA. SLVs find use with small nucleic acid
fragments. LUVs are prepared by a number of methods, well known in
the art. Commonly used methods include Ca.sup.2+-EDTA chelation
(Papahadjopoulos et al., Biochim. Biophys. Acta (1975) 394:483;
Wilson et al., Cell (1979) 17:77); ether injection (Deamer, D. and
Bangham, A., Biochim. Biophys. Acta (1976) 443:629; Ostro et al.,
Biochem. Biophys. Res. Commun. (1977) 76:836; Fraley et al., Proc.
Natl. Acad. Sci. USA (1979) 76:3348); detergent dialysis (Enoch, H.
and Strittmatter, P., Proc. Natl. Acad. Sci. USA (1979) 76:145);
and reverse-phase evaporation (REV) (Fraley et al., J. Biol. Chem.
(1980) 255:10431; Szoka, F. and Papahadjopoulos, D., Proc. Natl.
Acad. Sci. USA (1978) 75:145; Schaefer-Ridder et al., Science
(1982) 215:166), which are herein incorporated by reference.
[0405] Generally, the ratio of DNA to liposomes will be from about
10:1 to about 1:10. Preferably, the ration will be from about 5:1
to about 1:5. More preferably, the ration will be about 3:1 to
about 1:3. Still more preferably, the ratio will be about 1:1.
[0406] U.S. Pat. No. 5,676,954 (which is herein incorporated by
reference) reports on the injection of genetic material, complexed
with cationic liposomes carriers, into mice. U.S. Pat. Nos.
4,897,355, 4,946,787, 5,049,386, 5,459,127, 5,589,466, 5,693,622,
5,580,859, 5,703,055, and international publication no. WO 94/9469
(which are herein incorporated by reference) provide cationic
lipids for use in transfecting DNA into cells and mammals. U.S.
Pat. Nos. 5,589,466, 5,693,622, 5,580,859, 5,703,055, and
international publication no. WO 94/9469 (which are herein
incorporated by reference) provide methods for delivering
DNA-cationic lipid complexes to mammals.
[0407] In certain embodiments, cells are engineered, ex vivo or in
vivo, using a retroviral particle containing RNA which comprises a
sequence encoding PSGR. Retroviruses from which the retroviral
plasmid vectors may be derived include, but are not limited to,
Moloney Murine Leukemia Virus, spleen necrosis virus, Rous sarcoma
Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape
leukemia virus, human immunodeficiency virus, Myeloproliferative
Sarcoma Virus, and mammary tumor virus.
[0408] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, R-2, R-AM, PA12, T19-14X,
VT-19-17-H2, RCRE, RCRIP, GP+E-86, GP+envAm12, and DAN cell lines
as described in Miller, Human Gene Therapy 1:5-14 (1990), which is
incorporated herein by reference in its entirety. The vector may
transduce the packaging cells through any means known in the art.
Such means include, but are not limited to, electroporation, the
use of liposomes, and CaPO.sub.4 precipitation. In one alternative,
the retroviral plasmid vector may be encapsulated into a liposome,
or coupled to a lipid, and then administered to a host.
[0409] The producer cell line generates infectious retroviral
vector particles which include polynucleotide encoding PSGR. Such
retroviral vector particles then may be employed, to transduce
eukaryotic cells, either in vitro or in vivo. The transduced
eukaryotic cells will express PSGR.
[0410] In certain other embodiments, cells are engineered, ex vivo
or in vivo, with PSGR polynucleotide contained in an adenovirus
vector. Adenovirus can be manipulated such that it encodes and
expresses PSGR, and at the same time is inactivated in terms of its
ability to replicate in a normal lytic viral life cycle. Adenovirus
expression is achieved without integration of the viral DNA into
the host cell chromosome, thereby alleviating concerns about
insertional mutagenesis. Furthermore, adenoviruses have been used
as live enteric vaccines for many years with an excellent safety
profile (Schwartz, A. R. et al. (1974) Am. Rev. Respir.
Dis.109:233-238). Finally, adenovirus mediated gene transfer has
been demonstrated in a number of instances including transfer of
alpha-1-antitrypsin and CFTR to the lungs of cotton rats
(Rosenfeld, M. A. et al. (1991) Science 252:431-434; Rosenfeld et
al., (1992) Cell 68:143-155). Furthermore, extensive studies to
attempt to establish adenovirus as a causative agent in human
cancer were uniformly negative (Green, M. et al. (1979) Proc. Natl.
Acad. Sci. USA 76:6606).
[0411] Suitable adenoviral vectors useful in the present invention
are described, for example, in Kozarsky and Wilson, Curr. Opin.
Genet. Devel. 3:499-503 (1993); Rosenfeld et al., Cell 68:143-155
(1992); Engelhardt et al., Human Genet. Ther. 4:759-769 (1993);
Yang et al., Nature Genet. 7:362-369 (1994); Wilson et al., Nature
365:691-692 (1993); and U.S. Pat. No. 5,652,224, which are herein
incorporated by reference. For example, the adenovirus vector Ad2
is useful and can be grown in human 293 cells. These cells contain
the E1 region of adenovirus and constitutively express Ela and Elb,
which complement the defective adenoviruses by providing the
products of the genes deleted from the vector. In addition to Ad2,
other varieties of adenovirus (e.g., Ad3, AdS, and Ad7) are also
useful in the present invention.
[0412] Preferably, the adenoviruses used in the present invention
are replication deficient. Replication deficient adenoviruses
require the aid of a helper virus and/or packaging cell line to
form infectious particles. The resulting virus is capable of
infecting cells and can express a polynucleotide of interest which
is operably linked to a promoter, but cannot replicate in most
cells. Replication deficient adenoviruses may be deleted in one or
more of all or a portion of the following genes: E1a, E1b, E3, E4,
E2a, or L1 through L5.
[0413] In certain other embodiments, the cells are engineered, ex
vivo or in vivo, using an adeno-associated virus (AAV). AAVs are
naturally occurring defective viruses that require helper viruses
to produce infectious particles (Muzyczka, N., Curr. Topics in
Microbiol. Immunol. 158:97 (1992)). It is also one of the few
viruses that may integrate its DNA into non-dividing cells. Vectors
containing as little as 300 base pairs of AAV can be packaged and
can integrate, but space for exogenous DNA is limited to about 4.5
kb. Methods for producing and using such AAVs are known in the art.
See, for example, U.S. Pat. Nos. 5,139,941, 5,173,414, 5,354,678,
5,436,146, 5,474,935, 5,478,745, and 5,589,377.
[0414] For example, an appropriate AAV vector for use in the
present invention will include all the sequences necessary for DNA
replication, encapsidation, and host-cell integration. The PSGR
polynucleotide construct is inserted into the AAV vector using
standard cloning methods, such as those found in Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press
(1989). The recombinant AAV vector is then transfected into
packaging cells which are infected with a helper virus, using any
standard technique, including lipofection, electroporation, calcium
phosphate precipitation, etc. Appropriate helper viruses include
adenoviruses, cytomegaloviruses, vaccinia viruses, or herpes
viruses. Once the packaging cells are transfected and infected,
they will produce infectious AAV viral particles which contain the
PSGR polynucleotide construct. These viral particles are then used
to transduce eukaryotic cells, either ex vivo or in vivo. The
transduced cells will contain the PSGR polynucleotide construct
integrated into its genome, and will express PSGR.
[0415] Another method of gene therapy involves operably associating
heterologous control regions and endogenous polynucleotide
sequences (e.g. encoding PSGR) via homologous recombination (see,
e.g., U.S. Pat. No. 5,641,670, issued Jun. 24, 1997; International
Publication No. WO 96/29411, published Sep. 26, 1996; International
Publication No. WO 94/12650, published Aug. 4, 1994; Koller et al.,
Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and Zijlstra et
al., Nature 342:435-438 (1989). This method involves the activation
of a gene which is present in the target cells, but which is not
normally expressed in the cells, or is expressed at a lower level
than desired.
[0416] Polynucleotide constructs are made, using standard
techniques known in the art, which contain the promoter with
targeting sequences flanking the promoter. Suitable promoters are
described herein. The targeting sequence is sufficiently
complementary to an endogenous sequence to permit homologous
recombination of the promoter-targeting sequence with the
endogenous sequence. The targeting sequence will be sufficiently
near the 5' end of the PSGR desired endogenous polynucleotide
sequence so the promoter will be operably linked to the endogenous
sequence upon homologous recombination.
[0417] The promoter and the targeting sequences can be amplified
using PCR. Preferably, the amplified promoter contains distinct
restriction enzyme sites on the 5' and 3' ends. Preferably, the 3'
end of the first targeting sequence contains the same restriction
enzyme site as the 5' end of the amplified promoter and the 5' end
of the second targeting sequence contains the same restriction site
as the 3' end of the amplified promoter. The amplified promoter and
targeting sequences are digested and ligated together.
[0418] The promoter-targeting sequence construct is delivered to
the cells, either as naked polynucleotide, or in conjunction with
transfection-facilitating agents, such as liposomes, viral
sequences, viral particles, whole viruses, lipofection,
precipitating agents, etc., described in more detail above. The P
promoter-targeting sequence can be delivered by any method,
included direct needle injection, intravenous injection, topical
administration, catheter infusion, particle accelerators, etc. The
methods are described in more detail below.
[0419] The promoter-targeting sequence construct is taken up by
cells. Homologous recombination between the construct and the
endogenous sequence takes place, such that an endogenous PSGR
sequence is placed under the control of the promoter. The promoter
then drives the expression of the endogenous PSGR sequence.
[0420] The polynucleotides encoding PSGR may be administered along
with other polynucleotides encoding an angiogenic protein. Examples
of angiogenic proteins include, but are not limited to, acidic and
basic fibroblast growth factors, VEGF-1, VEGF-2, VEGF-3, epidermal
growth factor alpha and beta, platelet-derived endothelial cell
growth factor, platelet-derived growth factor, tumor necrosis
factor alpha, hepatocyte growth factor, insulin like growth factor,
colony stimulating factor, macrophage colony stimulating factor,
granulocyte/macrophage colony stimulating factor, and nitric oxide
synthase.
[0421] Preferably, the polynucleotide encoding PSGR contains a
secretory signal sequence that facilitates secretion of the
protein. Typically, the signal sequence is positioned in the coding
region of the polynucleotide to be expressed towards or at the 5'
end of the coding region. The signal sequence may be homologous or
heterologous to the polynucleotide of interest and may be
homologous or heterologous to the cells to be transfected.
Additionally, the signal sequence may be chemically synthesized
using methods known in the art.
[0422] Any mode of administration of any of the above-described
polynucleotides constructs can be used so long as the mode results
in the expression of one or more molecules in an amount sufficient
to provide a therapeutic effect. This includes direct needle
injection, systemic injection, catheter infusion, biolistic
injectors, particle accelerators (i.e., "gene guns"), gelfoam
sponge depots, other commercially available depot materials,
osmotic pumps (e.g., Alza minipumps), oral or suppositorial solid
(tablet or pill) pharmaceutical formulations, and decanting or
topical applications during surgery. For example, direct injection
of naked calcium phosphate-precipitated plasmid into rat liver and
rat spleen or a protein-coated plasmid into the portal vein has
resulted in gene expression of the foreign gene in the rat livers
(Kaneda et al., Science 243:375 (1989)).
[0423] A preferred method of local administration is by direct
injection. Preferably, a recombinant molecule of the present
invention complexed with a delivery vehicle is administered by
direct injection into or locally within the area of arteries.
Administration of a composition locally within the area of arteries
refers to injecting the composition centimeters and preferably,
millimeters within arteries.
[0424] Another method of local administration is to contact a
polynucleotide construct of the present invention in or around a
surgical wound. For example, a patient can undergo surgery and the
polynucleotide construct can be coated on the surface of tissue
inside the wound or the construct can be injected into areas of
tissue inside the wound.
[0425] Therapeutic compositions useful in systemic administration,
include recombinant molecules of the present invention complexed to
a targeted delivery vehicle of the present invention. Suitable
delivery vehicles for use with systemic administration comprise
liposomes comprising ligands for targeting the vehicle to a
particular site.
[0426] Preferred methods of systemic administration, include
intravenous injection, aerosol, oral and percutaneous (topical)
delivery. Intravenous injections can be performed using methods
standard in the art. Aerosol delivery can also be performed using
methods standard in the art (see, for example, Stribling et al.,
Proc. Natl. Acad. Sci. USA 189:11277-11281, 1992, which is
incorporated herein by reference). Oral delivery can be performed
by complexing a polynucleotide construct of the present invention
to a carrier capable of withstanding degradation by digestive
enzymes in the gut of an animal. Examples of such carriers, include
plastic capsules or tablets, such as those known in the art.
Topical delivery can be performed by mixing a polynucleotide
construct of the present invention with a lipophilic reagent (e.g.,
DMSO) that is capable of passing into the skin.
[0427] Determining an effective amount of substance to be delivered
can depend upon a number of factors including, for example, the
chemical structure and biological activity of the substance, the
age and weight of the animal, the precise condition requiring
treatment and its severity, and the route of administration. The
frequency of treatments depends upon a number of factors, such as
the amount of polynucleotide constructs administered per dose, as
well as the health and history of the subject. The precise amount,
number of doses, and timing of doses will be determined by the
attending physician or veterinarian.
[0428] Therapeutic compositions of the present invention can be
administered to any animal, preferably to mammals and birds.
Preferred mammals include humans, dogs, cats, mice, rats, rabbits,
sheep, cattle, horses and pigs, with humans being particularly
preferred.
Biological Activities of PSGR
[0429] PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, can be used in assays to test for one or more
biological activities. If PSGR polynucleotides or polypeptides, or
agonists or antagonists of PSGR, do exhibit activity in a
particular assay, it is likely that PSGR may be involved in the
diseases associated with the biological activity. Therefore, PSGR
could be used to treat, prevent, and/or diagnose the associated
disease.
[0430] PSGR is a member of the seven transmembrane G-protein
coupled odorant receptor gene family which demonstrates prostatic
epithelial cell resticted expression with tumor cells exhibiting
significantly increased expression.
[0431] Thus, PSGR may be useful as a therapeutic molecule. It would
be useful for diagnosis, detection, treatment and/or prevention of
diseases or disorders of the prostate, including inflammatory
disorders, such as chronic prostatitis, granulomatous prostatitis
and malacoplakia, prostatic hyperplasia and prostate neoplastic
disorders, including adenocarcinoma, transitional cell carcinomas,
ductal carcinomas, squamous cell carcinomas, or as hormones or
factors with systemic or reproductive functions. Particularly, PSGR
may be a useful therapeutic for prostate cancer. Treatment,
diagnosis, detection, and/or prevention of prostate disorders could
be carried out using a soluble form of PSGR, the PSGR ligand, gene
therapy, or ex vivo applications. Moreover, inhibitors of PSGR,
either blocking antibodies or mutant forms, could modulate the
expression of PSGR. These inhibitors may be useful to treat,
diagnose, detect, and/or prevent diseases associated with the
misregulation of PSGR.
[0432] In one embodiment, the invention provides a method for the
specific delivery of compositions of the invention to cells (e.g.,
prostate or prostate cancer cells) by administering polypeptides of
the invention (e.g., PSGR polypeptides or anti-PSGR antibodies)
that are associated with heterologous polypeptides or nucleic
acids. In one example, the invention provides a method for
delivering a therapeutic protein into the targeted cell (e.g., a
prostate cancer cell). In another example, the invention provides a
method for delivering a single stranded nucleic acid (e.g.,
antisense or ribozymes) or double stranded nucleic acid (e.g., DNA
that can integrate into the cell's genome or replicate episomally
and that can be transcribed) into the targeted cell.
[0433] In another embodiment, the invention provides a method for
the specific destruction of cells (e.g., the destruction of tumor
cells) by administering polypeptides of the invention (e.g., PSGR
polypeptides or anti-PSGR antibodies) in association with toxins or
cytotoxic prodrugs.
[0434] By "toxin" is meant compounds that bind and activate
endogenous cytotoxic effector systems, radioisotopes, holotoxins,
modified toxins, catalytic subunits of toxins, cytotoxins
(cytotoxic agents), or any molecules or enzymes not normally
present in or on the surface of a cell that under defined
conditions cause the cell's death. Toxins that may be used
according to the methods of the invention include, but are not
limited to, radioisotopes known in the art, compounds such as, for
example, antibodies (or complement fixing containing portions
thereof) that bind an inherent or induced endogenous cytotoxic
effector system, thymidine kinase, endonuclease, RNAse, alpha
toxin, ricin, abrin, Pseudoinonas exotoxin A, diphtheria toxin,
saporin, momordin, gelonin, pokeweed antiviral protein,
alpha-sarcin and cholera toxin. "Toxin" also includes a cytostatic
or cytocidal agent, a therapeutic agent or a radioactive metal ion,
e.g., alpha-emitters such as, for example, .sup.213Bi, or other
radioisotopes such as, for example, .sup.103Pd, .sup.133Xe,
.sup.131I, .sup.68Ge, .sup.57Co .sup.65Zn, .sup.85Sr, .sup.32P,
.sup.35S, .sup.90Y, .sup.153Sm, .sup.153Gd, .sup.169Yb, .sup.51Cr,
.sup.54Mn, .sup.75Se, .sup.113Sn, .sup.90Yttrium, .sup.117Tin,
.sup.186Rhenium, .sup.166Holmium, and .sup.188Rhenium; luminescent
labels, such as luminol; and fluorescent labels, such as
fluorescein and rhodamine, and biotin.
[0435] Techniques known in the art may be applied to label
antibodies of the invention. Such techniques include, but are not
limited to, the use of bifunctional conjugating agents (see e.g.,
U.S. Pat. Nos. 5,756,065; 5,714,631; 5,696,239; 5,652,361;
5,505,931; 5,489,425; 5,435,990; 5,428,139; 5,342,604; 5,274,119;
4,994,560; and 5,808,003; the contents of each of which are hereby
incorporated by reference in its entirety). A cytotoxin or
cytotoxic agent includes any agent that is detrimental to cells.
Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium
bromide, emetine, mitomycin, etoposide, tenoposide, vincristine,
vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy
anthracin dione, mitoxantrone, mithramycin, actinomycin D,
1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, and puromycin and analogs or homologs
thereof. Therapeutic agents include, but are not limited to,
antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating
agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and cis-
dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine and vinblastine).
[0436] By "cytotoxic prodrug" is meant a non-toxic compound that is
converted by an enzyme, normally present in the cell, into a
cytotoxic compound. Cytotoxic prodrugs that may be used according
to the methods of the invention include, but are not limited to,
glutamyl derivatives of benzoic acid mustard alkylating agent,
phosphate derivatives of etoposide or mitomycin C, cytosine
arabinoside, daunorubisin, and phenoxyacetamide derivatives of
doxorubicin.
[0437] It will be appreciated that conditions caused by a decrease
in the standard or normal level of PSGR activity in an individual,
particularly disorders of the prostate, can be treated by
administration of PSGR polypeptide (e.g., in the form of soluble
extracellular domain or cells expressing the complete protein) or
agonist. Thus, the invention also provides a method of treatment of
an individual in need of an increased level of PSGR activity
comprising administering to such an individual a pharmaceutical
composition comprising an amount of an isolated PSGR polypeptide of
the invention, or agonist thereof (e.g, an agonistic PSGR
antibody), effective to increase the PSGR activity level in such an
individual.
[0438] It will also be appreciated that conditions caused by a
increase in the standard or normal level of PSGR activity in an
individual, particularly disorders of the prostate, can be treated
by administration of PSGR polypeptides (e.g., in the form of
soluble extracellular domain or cells expressing the complete
protein) or antagonist (e.g., an antagonistic PSGR antibody). Thus,
the invention also provides a method of treatment of an individual
in need of an dereased level of PSGR activity comprising
administering to such an individual a pharmaceutical composition
comprising an amount of an isolated PSGR polypeptide of the
invention, or antagonist thereof, effective to decrease the PSGR
activity level in such an individual.
Immune Activity
[0439] PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, may be useful in treating diseases, disorders,
and/or conditions of the immune system, by activating or inhibiting
the proliferation, differentiation, or mobilization (chemotaxis) of
immune cells. Immune cells develop through a process called
hematopoiesis, producing myeloid (platelets, red blood cells,
neutrophils, and macrophages) and lymphoid (B and T lymphocytes)
cells from pluripotent stem cells. The etiology of these immune
diseases, disorders, and/or conditions may be genetic, somatic,
such as cancer or some autoimmune diseases, disorders, and/or
conditions, acquired (e.g., by chemotherapy or toxins), or
infectious. Moreover, PSGR polynucleotides or polypeptides, or
agonists or antagonists of PSGR, can be used as a marker or
detector of a particular immune system disease or disorder.
[0440] PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, may be useful in treating, preventing, and/or
diagnosing diseases, disorders, and/or conditions of hematopoietic
cells. PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, could be used to increase differentiation and
proliferation of hematopoietic cells, including the pluripotent
stem cells, in an effort to treat or prevent those diseases,
disorders, and/or conditions associated with a decrease in certain
(or many) types hematopoietic cells. Examples of immunologic
deficiency syndromes include, but are not limited to: blood protein
diseases, disorders, and/or conditions (e.g. agammaglobulinemia,
dysgammaglobulinemia), ataxia telangiectasia, common variable
immunodeficiency, Digeorge Syndrome, HIV infection, HTLV-BLV
infection, leukocyte adhesion deficiency syndrome, lymphopenia,
phagocyte bactericidal dysfunction, severe combined
immunodeficiency (SCIDs), Wiskott-Aldrich Disorder, anemia,
thrombocytopenia, or hemoglobinuria.
[0441] Moreover, PSGR polynucleotides or polypeptides, or agonists
or antagonists of PSGR, can also be used to modulate hemostatic
(the stopping of bleeding) or thrombolytic activity (clot
formation). For example, by increasing hemostatic or thrombolytic
activity, PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, could be used to treat or prevent blood
coagulation diseases, disorders, and/or conditions (e.g.,
afibrinogenemia, factor deficiencies), blood platelet diseases,
disorders, and/or conditions (e.g. thrombocytopenia), or wounds
resulting from trauma, surgery, or other causes. Alternatively,
PSGR polynucleotides or polypeptides, or agonists or antagonists of
PSGR, that can decrease hemostatic or thrombolytic activity could
be used to inhibit or dissolve clotting. These molecules could be
important in the treatment or prevention of heart attacks
(infarction), strokes, or scarring.
[0442] PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, may also be useful in treating, preventing,
and/or diagnosing autoimmune diseases, disorders, and/or
conditions. Many autoimmune diseases, disorders, and/or conditions
result from inappropriate recognition of self as foreign material
by immune cells. This inappropriate recognition results in an
immune response leading to the destruction of the host tissue.
Therefore, the administration of PSGR polynucleotides or
polypeptides, or agonists or antagonists of PSGR, that can inhibit
an immune response, particularly the proliferation,
differentiation, or chemotaxis of T-cells, may be an effective
therapy in preventing autoimmune diseases, disorders, and/or
conditions.
[0443] Examples of autoimmune diseases, disorders, and/or
conditions that can be treated, prevented, and/or diagnosed or
detected by PSGR include, but are not limited to: Addison's
Disease, hemolytic anemia, antiphospholipid syndrome, rheumatoid
arthritis, dermatitis, allergic encephalomyelitis,
glomerulonephritis, Goodpasture's Syndrome, Graves' Disease,
Multiple Sclerosis, Myasthenia Gravis, Neuritis, Ophthalmia,
Bullous Pemphigoid, Pemphigus, Polyendocrinopathies, Purpura,
Reiter's Disease, Stiff-Man Syndrome, Autoimmune Thyroiditis,
Systemic Lupus Erythematosus, Autoimmune Pulmonary Inflammation,
Guillain-Barre Syndrome, insulin dependent diabetes mellitis, and
autoimmune inflammatory eye disease.
[0444] Similarly, allergic reactions and conditions, such as asthma
(particularly allergic asthma) or other respiratory problems, may
also be treated, prevented, and/or diagnosed by PSGR
polynucleotides or polypeptides, or agonists or antagonists of
PSGR. Moreover, these molecules can be used to treat anaphylaxis,
hypersensitivity to an antigenic molecule, or blood group
incompatibility.
[0445] PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, may also be used to treat, prevent, and/or
diagnose organ rejection or graft-versus-host disease (GVHD). Organ
rejection occurs by host immune cell destruction of the
transplanted tissue through an immune response. Similarly, an
immune response is also involved in GVHD, but, in this case, the
foreign transplanted immune cells destroy the host tissues. The
administration of PSGR polynucleotides or polypeptides, or agonists
or antagonists of PSGR, that inhibits an immune response,
particularly the proliferation, differentiation, or chemotaxis of
T-cells, may be an effective therapy in preventing organ rejection
or GVHD.
[0446] Similarly, PSGR polynucleotides or polypeptides, or agonists
or antagonists of PSGR, may also be used to modulate inflammation.
For example, PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, may inhibit the proliferation and
differentiation of cells involved in an inflammatory response.
These molecules can be used to treat, prevent, and/or diagnose
inflammatory conditions, both chronic and acute conditions,
including chronic prostatitis, granulomatous prostatitis and
malacoplakia, inflammation associated with infection (e.g., septic
shock, sepsis, or systemic inflammatory response syndrome (SIRS)),
ischemia-reperfusion injury, endotoxin lethality, arthritis,
complement-mediated hyperacute rejection, nephritis, cytokine or
chemokine induced lung injury, inflammatory bowel disease, Crohn's
disease, or resulting from over production of cytokines (e.g., TNF
or IL-1.)
Hyperproliferative Disorders
[0447] PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, can be used to treat, prevent, and/or diagnose
hyperproliferative diseases, disorders, and/or conditions,
including neoplasms.
[0448] In a specific embodiment, PSGR polynucleotides or
polypeptides, or agonists or antagonists of PSGR, can be used to
treat, prevent, and/or diagnose hyperproliferative diseases,
disorders, and/or conditions of the prostate.
[0449] In a preferred embodiment, PSGR polynucleotides or
polypeptides, or agonists or antagonists of PSGR, can be used to
treat, prevent, and/or diagnose prostate neoplasms.
[0450] PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, may inhibit the proliferation of the disorder
through direct or indirect interactions. Alternatively, PSGR
polynucleotides or polypeptides, or agonists or antagonists of
PSGR, may proliferate other cells which can inhibit the
hyperproliferative disorder.
[0451] For example, by increasing an immune response, particularly
increasing antigenic qualities of the hyperproliferative disorder
or by proliferating, differentiating, or mobilizing T-cells,
hyperproliferative diseases, disorders, and/or conditions can be
treated, prevented, and/or diagnosed. This immune response may be
increased by either enhancing an existing immune response, or by
initiating a new immune response. Alternatively, decreasing an
immune response may also be a method of treating, preventing,
and/or diagnosing hyperproliferative diseases, disorders, and/or
conditions, such as a chemotherapeutic agent.
[0452] Examples of hyperproliferative diseases, disorders, and/or
conditions that can be treated, prevented, and/or diagnosed by PSGR
polynucleotides or polypeptides, or agonists or antagonists of
PSGR, include, but are not limited to neoplasms located in the:
prostate, colon, abdomen, bone, breast, digestive system, liver,
pancreas, peritoneum, endocrine glands (adrenal, parathyroid,
pituitary, testicles, ovary, thymus, thyroid), eye, head and neck,
nervous (central and peripheral), lymphatic system, pelvic, skin,
soft tissue, spleen, thoracic, and urogenital.
[0453] Similarly, other hyperproliferative diseases, disorders,
and/or conditions can also be treated, prevented, and/or diagnosed
by PSGR polynucleotides or polypeptides, or agonists or antagonists
of PSGR. Examples of such hyperproliferative diseases, disorders,
and/or conditions include, but are not limited to:
hypergammaglobulinemia, lymphoproliferative diseases, disorders,
and/or conditions, paraproteinemias, purpura, sarcoidosis, Sezary
Syndrome, Waldenstron's Macroglobulinemia, Gaucher's Disease,
histiocytosis, and any other hyperproliferative disease, besides
neoplasia, located in an organ system listed above.
[0454] One preferred embodiment utilizes polynucleotides of the
present invention to inhibit aberrant cellular division, by gene
therapy using the present invention, and/or protein fusions or
fragments thereof.
[0455] Thus, the present invention provides a method for treating
cell proliferative diseases, disorders, and/or conditions by
inserting into an abnormally proliferating cell a polynucleotide of
the present invention, wherein said polynucleotide represses said
expression.
[0456] Another embodiment of the present invention provides a
method of treating cell-proliferative diseases, disorders, and/or
conditions in individuals comprising administration of one or more
active gene copies of the present invention to an abnormally
proliferating cell or cells. In a preferred embodiment,
polynucleotides of the present invention is a DNA construct
comprising a recombinant expression vector effective in expressing
a DNA sequence encoding said polynucleotides. In another preferred
embodiment of the present invention, the DNA construct encoding the
poynucleotides of the present invention is inserted into cells to
be treated utilizing a retrovirus, or more preferrably an
adenoviral vector (see, e.g., G J. Nabel, et. al., PNAS 96: 324-326
(1999), which is hereby incorporated by reference). In a most
preferred embodiment, the viral vector is defective and will not
transform non-proliferating cells, only proliferating cells.
Moreover, in a preferred embodiment, the polynucleotides of the
present invention inserted into proliferating cells either alone,
or in combination with or fused to other polynucleotides, can then
be modulated via an external stimulus (i.e., magnetic, specific
small molecule, chemical, or drug administration, etc.), which acts
upon the promoter upstream of said polynucleotides to induce
expression of the encoded protein product. As such the beneficial
therapeutic affect of the present invention may be expressly
modulated (i.e., to increase, decrease, or inhibit expression of
the present invention) based upon said external stimulus.
[0457] Polynucleotides of the present invention may be useful in
repressing expression of oncogenic genes or antigens. By
"repressing expression of the oncogenic genes" is intended the
suppression of the transcription of the gene, the degradation of
the gene transcript (pre-message RNA), the inhibition of splicing,
the destruction of the messenger RNA, the prevention of the
post-translational modifications of the protein, the destruction of
the protein, or the inhibition of the normal function of the
protein.
[0458] For local administration to abnormally proliferating cells,
polynucleotides of the present invention may be administered by any
method known to those of skill in the art including, but not
limited to transfection, electroporation, microinjection of cells,
or in vehicles such as liposomes, lipofectin, or as naked
polynucleotides, or any other method described throughout the
specification. The polynucleotide of the present invention may be
delivered by known gene delivery systems such as, but not limited
to, retroviral vectors (Gilboa, J. Virology 44:845 (1982); Hocke,
Nature 320:275 (1986); Wilson, et al., Proc. Natl. Acad. Sci.
U.S.A. 85:3014), vaccinia virus system (Chakrabarty et al., Mol.
Cell Biol. 5:3403 (1985) or other efficient DNA delivery systems
(Yates et al., Nature 313:812 (1985)) known to those skilled in the
art. These references are exemplary only and are hereby
incorporated by reference. In order to specifically deliver or
transfect cells which are abnormally proliferating and spare
non-dividing cells, it is preferable to utilize a retrovirus, or
adenoviral (as described in the art and elsewhere herein) delivery
system known to those of skill in the art. Since host DNA
replication is required for retroviral DNA to integrate and the
retrovirus will be unable to self replicate due to the lack of the
retrovirus genes needed for its life cycle. Utilizing such a
retroviral delivery system for polynucleotides of the present
invention will target said gene and constructs to abnormally
proliferating cells and will spare the non-dividing normal
cells.
[0459] The polynucleotides of the present invention may be
delivered directly to cell proliferative disorder/disease sites in
internal organs, body cavities and the like by use of imaging
devices used to guide an injecting needle directly to the disease
site. The polynucleotides of the present invention may also be
administered to disease sites at the time of surgical
intervention.
[0460] By "cell proliferative disease" is meant any human or animal
disease or disorder, affecting any one or any combination of
organs, cavities, or body parts, which is characterized by single
or multiple local abnormal proliferations of cells, groups of
cells, or tissues, whether benign or malignant.
[0461] Any amount of the polynucleotides of the present invention
may be administered as long as it has a biologically inhibiting
effect on the proliferation of the treated cells. Moreover, it is
possible to administer more than one of the polynucleotide of the
present invention simultaneously to the same site. By "biologically
inhibiting" is meant partial or total growth inhibition as well as
decreases in the rate of proliferation or growth of the cells. The
biologically inhibitory dose may be determined by assessing the
effects of the polynucleotides of the present invention on target
malignant or abnormally proliferating cell growth in tissue
culture, tumor growth in animals and cell cultures, or any other
method known to one of ordinary skill in the art.
[0462] The present invention is further directed to antibody-based
therapies which involve administering of anti-polypeptides and
anti-polynucleotide antibodies to a mammalian, preferably human,
patient for treating one or more of the described diseases,
disorders, and/or conditions. Methods for producing
anti-polypeptides and anti-polynucleotide antibodies polyclonal and
monoclonal antibodies are described in detail elsewhere herein.
Such antibodies may be provided in pharmaceutically acceptable
compositions as known in the art or as described herein.
[0463] A summary of the ways in which the antibodies of the present
invention may be used therapeutically includes binding
polynucleotides or polypeptides of the present invention locally or
systemically in the body or by direct cytotoxicity of the antibody,
e.g., as mediated by complement (CDC) or by effector cells (ADCC).
Some of these approaches are described in more detail below. Armed
with the teachings provided herein, one of ordinary skill in the
art will know how to use the antibodies of the present invention
for diagnostic, monitoring or therapeutic purposes without undue
experimentation.
[0464] In particular, the antibodies, fragments and derivatives of
the present invention are useful for treating a subject having or
developing cell proliferative and/or differentiation diseases,
disorders, and/or conditions as described herein. Such treatment
comprises administering a single or multiple doses of the antibody,
or a fragment, derivative, or a conjugate thereof.
[0465] The antibodies of this invention may be advantageously
utilized in combination with other monoclonal or chimeric
antibodies, or with lymphokines or hematopoietic growth factors,
for example, which serve to increase the number or activity of
effector cells which interact with the antibodies.
[0466] It is preferred to use high affinity and/or potent in vivo
inhibiting and/or neutralizing antibodies against polypeptides or
polynucleotides of the present invention, fragments or regions
thereof, for both immunoassays directed to and therapy of diseases,
disorders, and/or conditions related to polynucleotides or
polypeptides, including fragements thereof, of the present
invention. Such antibodies, fragments, or regions, will preferably
have an affinity for polynucleotides or polypeptides, including
fragements thereof. Preferred binding affinities include those with
a dissociation constant or Kd less than 5.times.10.sup.-6 M,
10.sup.-6 M, 5.times.10.sup.7 M, 10.sup.-7 M, 5.times.10.sup.-8 M,
10.sup.-8 M, 5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10
M, 10.sup.-10 M, 5.times.10.sup.-11 M, 10.sup.-11 M,
5.times.10.sup.12 M, 10.sup.-12 M, 5.times.10.sup.-13 M, 10.sup.-13
M, 5.times.10.sup.-14 M, 10.sup.-14 M, 5.times.10.sup.-15 M, and
10.sup.-15 M.
[0467] Moreover, polypeptides of the present invention are useful
in inhibiting the angiogenesis of proliferative cells or tissues,
either alone, as a protein fusion, or in combination with other
polypeptides directly or indirectly, as described elsewhere herein.
In a most preferred embodiment, said anti-angiogenesis effect may
be achieved indirectly, for example, through the inhibition of
hematopoietic, tumor-specific cells, such as tumor-associated
macrophages (see, e.g., Joseph IB, et al. J Natl Cancer Inst,
90(21):1648-53 (1998), which is hereby incorporated by reference).
Antibodies directed to polypeptides or polynucleotides of the
present invention may also result in inhibition of angiogenesis
directly, or indirectly (see, e.g., Witte L, et al., Cancer
Metastasis Rev. 17(2):155-61 (1998), which is hereby incorporated
by reference)).
[0468] Polypeptides, including protein fusions, of the present
invention, or fragments thereof may be useful in inhibiting
proliferative cells or tissues through the induction of apoptosis.
Said polypeptides may act either directly, or indirectly to induce
apoptosis of proliferative cells and tissues, for example in the
activation of a death-domain receptor, such as tumor necrosis
factor (TNF) receptor-1, CD95 (Fas/APO-1), TNF-receptor-related
apoptosis-mediated protein (TRAMP) and TNF-related
apoptosis-inducing ligand (TRAIL) receptor-1 and -2 (see, e.g.,
Schulze-Osthoff K, et.al., Eur J Biochem 254(3):439-59 (1998),
which is hereby incorporated by reference). Moreover, in another
preferred embodiment of the present invention, said polypeptides
may induce apoptosis through other mechanisms, such as in the
activation of other proteins which will activate apoptosis, or
through stimulating the expression of said proteins, either alone
or in combination with small molecule drugs or adjuviants, such as
apoptonin, galectins, thioredoxins, antiinflainmatory proteins (See
for example, Mutat Res 400(1-2):447-55 (1998), Med
Hypotheses.50(5):423-33 (1998), Chem Biol Interact. Apr
24;111-112:23-34 (1998), J Mol Med.76(6):402-12 (1998), Int J
Tissue React;20(1):3-15 (1998), which is hereby incorporated by
reference).
[0469] Polypeptides, including protein fusions to, or fragments
thereof, of the present invention are useful in inhibiting the
metastasis of proliferative cells or tissues. Inhibition may occur
as a direct result of administering polypeptides, or antibodies
directed to said polypeptides as described elsewere herein, or
indirectly, such as activating the expression of proteins known to
inhibit metastasis, for example alpha 4 integrins, (See, e.g., Curr
Top Microbiol Immunol 1998;231:125-41, which is hereby incorporated
by reference). Such thereapeutic affects of the present invention
may be achieved either alone, or in combination with small molecule
drugs or adjuvants.
[0470] In another embodiment, the invention provides a method of
delivering compositions containing the polypeptides of the
invention (e.g., compositions containing polypeptides or
polypeptide antibodes associated with heterologous polypeptides,
heterologous nucleic acids, toxins, or prodrugs) to targeted cells
expressing the polypeptide of the present invention. Polypeptides
or polypeptide antibodes of the invention may be associated with
heterologous polypeptides, heterologous nucleic acids, toxins, or
prodrugs via hydrophobic, hydrophilic, ionic and/or covalent
interactions.
[0471] Polypeptides, protein fusions to, or fragments thereof, of
the present invention are useful in enhancing the immunogenicity
and/or antigenicity of proliferating cells or tissues, either
directly, such as would occur if the polypeptides of the present
invention `vaccinated` the immune response to respond to
proliferative antigens and immunogens, or indirectly, such as in
activating the expression of proteins known to enhance the immune
response (e.g. chemokines), to said antigens and immunogens.
Cardiovascular Disorders
[0472] PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, encoding PSGR may be used to treat, prevent,
and/or diagnose cardiovascular diseases, disorders, and/or
conditions, including peripheral artery disease, such as limb
ischemia.
[0473] Cardiovascular diseases, disorders, and/or conditions
include cardiovascular abnormalities, such as arterio-arterial
fistula, arteriovenous fistula, cerebral arteriovenous
malformations, congenital heart defects, pulmonary atresia, and
Scimitar Syndrome. Congenital heart defects include aortic
coarctation, cor triatriatum, coronary vessel anomalies, crisscross
heart, dextrocardia, patent ductus arteriosus, Ebstein's anomaly,
Eisenmenger complex, hypoplastic left heart syndrome, levocardia,
tetralogy of fallot, transposition of great vessels, double outlet
right ventricle, tricuspid atresia, persistent truncus arteriosus,
and heart septal defects, such as aortopulmonary septal defect,
endocardial cushion defects, Lutembacher's Syndrome, trilogy of
Fallot, ventricular heart septal defects.
[0474] Cardiovascular diseases, disorders, and/or conditions also
include heart disease, such as arrhythmias, carcinoid heart
disease, high cardiac output, low cardiac output, cardiac
tamponade, endocarditis (including bacterial), heart aneurysm,
cardiac arrest, congestive heart failure, congestive
cardiomyopathy, paroxysmal dyspnea, cardiac edema, heart
hypertrophy, congestive cardiomyopathy, left ventricular
hypertrophy, right ventricular hypertrophy, post-infarction heart
rupture, ventricular septal rupture, heart valve diseases,
myocardial diseases, myocardial ischemia, pericardial effusion,
pericarditis (including constrictive and tuberculous),
pneumopericardium, postpericardiotomy syndrome, pulmonary heart
disease, rheumatic heart disease, ventricular dysfinction,
hyperemia, cardiovascular pregnancy complications, Scimitar
Syndrome, cardiovascular syphilis, and cardiovascular
tuberculosis.
[0475] Arrhythmias include sinus arrhythmia, atrial fibrillation,
atrial flutter, bradycardia, extrasystole, Adams-Stokes Syndrome,
bundle-branch block, sinoatrial block, long QT syndrome,
parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type
pre-excitation syndrome, Wolff-Parkinson-White syndrome, sick sinus
syndrome, tachycardias, and ventricular fibrillation. Tachycardias
include paroxysmal tachycardia, supraventricular tachycardia,
accelerated idioventricular rhythm, atrioventricular nodal reentry
tachycardia, ectopic atrial tachycardia, ectopic junctional
tachycardia, sinoatrial nodal reentry tachycardia, sinus
tachycardia, Torsades de Pointes, and ventricular tachycardia.
[0476] Heart valve disease include aortic valve insufficiency,
aortic valve stenosis, hear murmurs, aortic valve prolapse, mitral
valve prolapse, tricuspid valve prolapse, mitral valve
insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary
valve insufficiency, pulmonary valve stenosis, tricuspid atresia,
tricuspid valve insufficiency, and tricuspid valve stenosis.
[0477] Myocardial diseases include alcoholic cardiomyopathy,
congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic
subvalvular stenosis, pulmonary subvalvular stenosis, restrictive
cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis,
endomyocardial fibrosis, Kearns Syndrome, myocardial reperfusion
injury, and myocarditis.
[0478] Myocardial ischemias include coronary disease, such as
angina pectoris, coronary aneurysm, coronary arteriosclerosis,
coronary thrombosis, coronary vasospasm, myocardial infarction and
myocardial stunning.
[0479] Cardiovascular diseases also include vascular diseases such
as aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis,
Hippel-Lindau Disease, Klippel-Trenaunay-Weber Syndrome,
Sturge-Weber Syndrome, angioneurotic edema, aortic diseases,
Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial
occlusive diseases, arteritis, enarteritis, polyarteritis nodosa,
cerebrovascular diseases, disorders, and/or conditions, diabetic
angiopathies, diabetic retinopathy, embolisms, thrombosis,
erythromelalgia, hemorrhoids, hepatic veno-occlusive disease,
hypertension, hypotension, ischemia, peripheral vascular diseases,
phlebitis, pulmonary veno-occlusive disease, Raynaud's disease,
CREST syndrome, retinal vein occlusion, Scimitar syndrome, superior
vena cava syndrome, telangiectasia, atacia telangiectasia,
hereditary hemorrhagic telangiectasia, varicocele, varicose veins,
varicose ulcer, vasculitis, and venous insufficiency.
[0480] Aneurysms include dissecting aneurysms, false aneurysms,
infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral
aneurysms, coronary aneurysms, heart aneurysms, and iliac
aneurysms.
[0481] Arterial occlusive diseases include arteriosclerosis,
intermittent claudication, carotid stenosis, fibromuscular
dysplasias, mesenteric vascular occlusion, Moyamoya disease, renal
artery obstruction, retinal artery occlusion, and thromboangiitis
obliterans.
[0482] Cerebrovascular diseases, disorders, and/or conditions
include carotid artery diseases, cerebral amyloid angiopathy,
cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis,
cerebral arteriovenous malformation, cerebral artery diseases,
cerebral embolism and thrombosis, carotid artery thrombosis, sinus
thrombosis, Wallenberg's syndrome, cerebral hemorrhage, epidural
hematoma, subdural hematoma, subaraxhnoid hemorrhage, cerebral
infarction, cerebral ischemia (including transient), subclavian
steal syndrome, periventricular leukomalacia, vascular headache,
cluster headache, migraine, and vertebrobasilar insufficiency.
[0483] Embolisms include air embolisms, amniotic fluid embolisms,
cholesterol embolisms, blue toe syndrome, fat embolisms, pulmonary
embolisms, and thromoboembolisms. Thrombosis include coronary
thrombosis, hepatic vein thrombosis, retinal vein occlusion,
carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome,
and thrombophlebitis.
[0484] Ischemia includes cerebral ischemia, ischemic colitis,
compartment syndromes, anterior compartment syndrome, myocardial
ischemia, reperfusion injuries, and peripheral limb ischemia.
Vasculitis includes aortitis, arteritis, Behcet's Syndrome,
Churg-Strauss Syndrome, mucocutaneous lymph node syndrome,
thromboangiitis obliterans, hypersensitivity vasculitis,
Schoenlein-Henoch purpura, allergic cutaneous vasculitis, and
Wegener's granulomatosis.
[0485] PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, are especially effective for the treatment of
critical limb ischemia and coronary disease. PSGR polypeptides may
be administered using any method known in the art, including, but
not limited to, direct needle injection at the delivery site,
intravenous injection, topical administration, catheter infusion,
biolistic injectors, particle accelerators, gelfoam sponge depots,
other commercially available depot materials, osmotic pumps, oral
or suppositorial solid pharmaceutical formulations, decanting or
topical applications during surgery, aerosol delivery. Such methods
are known in the art. PSGR polypeptides may be administered as part
of a Therapeutic, described in more detail below. Methods of
delivering PSGR polynucleotides are described in more detail
herein.
Anti-Angiogenesis Activity
[0486] The naturally occurring balance between endogenous
stimulators and inhibitors of angiogenesis is one in which
inhibitory influences predominate. Rastinejad et al., Cell
56:345-355 (1989). In those rare instances in which
neovascularization occurs under normal physiological conditions,
such as wound healing, organ regeneration, embryonic development,
and female reproductive processes, angiogenesis is stringently
regulated and spatially and temporally delimited. Under conditions
of pathological angiogenesis such as that characterizing solid
tumor growth, these regulatory controls fail. Unregulated
angiogenesis becomes pathologic and sustains progression of many
neoplastic and non-neoplastic diseases. A number of serious
diseases are dominated by abnormal neovascularization including
solid tumor growth and metastases, arthritis, some types of eye
diseases, disorders, and/or conditions, and psoriasis. See, e.g.,
reviews by Moses et al., Biotech. 9:630-634 (1991); Folkman et al.,
N. Engl. J. Med., 333:1757-1763 (1995); Auerbach et al, J.
Microvasc. Res. 29:401-411 (1985); Folkman, Advances in Cancer
Research, eds. Klein and Weinhouse, Academic Press, New York, pp.
175-203 (1985); Patz, Am. J. Opthalmol. 94:715-743 (1982); and
Folkman et al., Science 221:719-725 (1983). In a number of
pathological conditions, the process of angiogenesis contributes to
the disease state. For example, significant data have accumulated
which suggest that the growth of solid tumors is dependent on
angiogenesis. Folkinan and Klagsbrun, Science 235:442-447
(1987).
[0487] The present invention provides for treatment of diseases,
disorders, and/or conditions associated with neovascularization by
administration of the polynucleotides and/or polypeptides of the
invention, as well as agonists or antagonists of the present
invention. Malignant and metastatic conditions which can be treated
with the polynucleotides and polypeptides, or agonists or
antagonists of the invention include, but are not limited to,
malignancies, solid tumors, and cancers described herein and
otherwise known in the art (for a review of such disorders, see
Fishman et al., Medicine, 2d Ed., J. B. Lippincott Co.,
Philadelphia (1985)).Thus, the present invention provides a method
of treating an angiogenesis-related disease and/or disorder,
comprising administering to an individual in need thereof a
therapeutically effective amount of a polynucleotide, polypeptide,
antagonist and/or agonist of the invention. For example,
polynucleotides, polypeptides, antagonists and/or agonists may be
utilized in a variety of additional methods in order to
therapeutically treat or prevent a cancer or tumor. Cancers which
may be treated with polynucleotides, polypeptides, antagonists
and/or agonists include, but are not limited to solid tumors,
including prostate, lung, breast, ovarian, stomach, pancreas,
larynx, esophagus, testes, liver, parotid, biliary tract, colon,
rectum, cervix, uterus, endometrium, kidney, bladder, thyroid
cancer; primary tumors and metastases; melanomas; glioblastoma;
Kaposi's sarcoma; leiomyosarcoma; non- small cell lung cancer;
colorectal cancer; advanced malignancies; and blood born tumors
such as leukemias. For example, polynucleotides, polypeptides,
antagonists and/or agonists may be delivered topically, in order to
treat or prevent cancers such as skin cancer, head and neck tumors,
breast tumors, and Kaposi's sarcoma.
[0488] Within yet other aspects, polynucleotides, polypeptides,
antagonists and/or agonists may be utilized to treat, prevent,
and/or diagnose superficial forms of bladder cancer by, for
example, intravesical administration. Polynucleotides,
polypeptides, antagonists and/or agonists may be delivered directly
into the tumor, or near the tumor site, via injection or a
catheter. Of course, as the artisan of ordinary skill will
appreciate, the appropriate mode of administration will vary
according to the cancer to be treated. Other modes of delivery are
discussed herein.
[0489] Polynucleotides, polypeptides, antagonists and/or agonists
may be useful in treating other diseases, disorders, and/or
conditions, besides cancers, which involve angiogenesis. These
diseases, disorders, and/or conditions include, but are not limited
to: benign tumors, for example hemangiomas, acoustic neuromas,
neurofibromas, trachomas, and pyogenic granulomas; artheroscleric
plaques; ocular angiogenic diseases, for example, diabetic
retinopathy, retinopathy of prematurity, macular degeneration,
corneal graft rejection, neovascular glaucoma, retrolental
fibroplasia, rubeosis, retinoblastoma, uvietis and Pterygia
(abnormal blood vessel growth) of the eye; rheumatoid arthritis;
psoriasis; delayed wound healing; endometriosis; vasculogenesis;
granulations; hypertrophic scars (keloids); nonunion fractures;
scleroderma; trachoma; vascular adhesions; myocardial angiogenesis;
coronary collaterals; cerebral collaterals; arteriovenous
malformations; ischemic limb angiogenesis; Osler-Webber Syndrome;
plaque neovascularization; telangiectasia; hemophiliac joints;
angiofibroma; fibromuscular dysplasia; wound granulation; Crohn's
disease; and atherosclerosis.
[0490] For example, within one aspect of the present invention
methods are provided for treating hypertrophic scars and keloids,
comprising the step of administering a polynucleotide, polypeptide,
antagonist and/or agonist of the invention to a hypertrophic scar
or keloid.
[0491] Within one embodiment of the present invention
polynucleotides, polypeptides, antagonists and/or agonists are
directly injected into a hypertrophic scar or keloid, in order to
prevent the progression of these lesions. This therapy is of
particular value in the prophylactic treatment of conditions which
are known to result in the development of hypertrophic scars and
keloids (e.g., burns), and is preferably initiated after the
proliferative phase has had time to progress (approximately 14 days
after the initial injury), but before hypertrophic scar or keloid
development. As noted above, the present invention also provides
methods for treating neovascular diseases of the eye, including for
example, comeal neovascularization, neovascular glaucoma,
proliferative diabetic retinopathy, retrolental fibroplasia and
macular degeneration.
[0492] Moreover, Ocular diseases, disorders, and/or conditions
associated with neovascularization which can be treated with the
polynucleotides and polypeptides of the present invention
(including agonists and/or antagonists) include, but are not
limited to: neovascular glaucoma, diabetic retinopathy,
retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of
prematurity macular degeneration, corneal graft neovascularization,
as well as other eye inflammatory diseases, ocular tumors and
diseases associated with choroidal or iris neovascularization. See,
e.g., reviews by Waltnan et al Am. J. Ophthal. 85:704-710 (1978)
and Gartner etal., Surv. Ophthal. 22:291-312 (1978).
[0493] Thus, within one aspect of the present invention methods are
provided for treating neovascular diseases of the eye such as
corneal neovascularization (including corneal graft
neovascularization), comprising the step of administering to a
patient a therapeutically effective amount of a compound (as
described above) to the cornea, such that the formation of blood
vessels is inhibited. Briefly, the cornea is a tissue which
normally lacks blood vessels. In certain pathological conditions
however, capillaries may extend into the cornea from the
pericorneal vascular plexus of the limbus. When the cornea becomes
vascularized, it also becomes clouded, resulting in a decline in
the patient's visual acuity. Visual loss may become complete if the
cornea completely opacitates. A wide variety of diseases,
disorders, and/or conditions can result in corneal
neovascularization, including for example, comeal infections (e.g.,
trachoma, herpes simplex keratitis, leishmaniasis and
onchocerciasis), immunological processes (e.g., graft rejection and
Stevens-Johnson's syndrome), alkali burns, trauma, inflammation (of
any cause), toxic and nutritional deficiency states, and as a
complication of wearing contact lenses.
[0494] Within particularly preferred embodiments of the invention,
may be prepared for topical administration in saline (combined with
any of the preservatives and antimicrobial agents commonly used in
ocular preparations), and administered in eyedrop form. The
solution or suspension may be prepared in its pure form and
administered several times daily. Alternatively, anti-angiogenic
compositions, prepared as described above, may also be administered
directly to the cornea. Within preferred embodiments, the
anti-angiogenic composition is prepared with a muco-adhesive
polymer which binds to cornea. Within further embodiments, the
anti-angiogenic factors or anti-angiogenic compositions may be
utilized as an adjunct to conventional steroid therapy. Topical
therapy may also be useful prophylactically in corneal lesions
which are known to have a high probability of inducing an
angiogenic response (such as chemical burns). In these instances
the treatment, likely in combination with steroids, may be
instituted immediately to help prevent subsequent
complications.
[0495] Within other embodiments, the compounds described above may
be injected directly into the corneal stroma by an ophthalmologist
under microscopic guidance. The preferred site of injection may
vary with the morphology of the individual lesion, but the goal of
the administration would be to place the composition at the
advancing front of the vasculature (i.e., interspersed between the
blood vessels and the normal cornea). In most cases this would
involve perilimbic corneal injection to "protect" the cornea from
the advancing blood vessels. This method may also be utilized
shortly after a comeal insult in order to prophylactically prevent
corneal neovascularization. In this situation the material could be
injected in the perilimbic cornea interspersed between the corneal
lesion and its undesired potential limbic blood supply. Such
methods may also be utilized in a similar fashion to prevent
capillary invasion of transplanted corneas. In a sustained-release
form injections might only be required 2-3 times per year. A
steroid could also be added to the injection solution to reduce
inflammation resulting from the injection itself.
[0496] Within another aspect of the present invention, methods are
provided for treating neovascular glaucoma, comprising the step of
administering to a patient a therapeutically effective amount of a
polynucleotide, polypeptide, antagonist and/or agonist to the eye,
such that the formation of blood vessels is inhibited. In one
embodiment, the compound may be administered topically to the eye
in order to treat or prevent early forms of neovascular glaucoma.
Within other embodiments, the compound may be implanted by
injection into the region of the anterior chamber angle. Within
other embodiments, the compound may also be placed in any location
such that the compound is continuously released into the aqueous
humor. Within another aspect of the present invention, methods are
provided for treating proliferative diabetic retinopathy,
comprising the step of administering to a patient a therapeutically
effective amount of a polynucleotide, polypeptide, antagonist
and/or agonist to the eyes, such that the formation of blood
vessels is inhibited.
[0497] Within particularly preferred embodiments of the invention,
proliferative diabetic retinopathy may be treated by injection into
the aqueous humor or the vitreous, in order to increase the local
concentration of the polynucleotide, polypeptide, antagonist and/or
agonist in the retina. Preferably, this treatment should be
initiated prior to the acquisition of severe disease requiring
photocoagulation.
[0498] Within another aspect of the present invention, methods are
provided for treating retrolental fibroplasia, comprising the step
of administering to a patient a therapeutically effective amount of
a polynucleotide, polypeptide, antagonist and/or agonist to the
eye, such that the formation of blood vessels is inhibited. The
compound may be administered topically, via intravitreous injection
and/or via intraocular implants.
[0499] Additionally, diseases, disorders, and/or conditions which
can be treated with the polynucleotides, polypeptides, agonists
and/or agonists include, but are not limited to, hemangioma,
arthritis, psoriasis, angiofibroma, atherosclerotic plaques,
delayed wound healing, granulations, hemophilic joints,
hypertrophic scars, nonunion fractures, Osler-Weber syndrome,
pyogenic granuloma, scleroderma, trachoma, and vascular
adhesions.
[0500] Moreover, diseases, disorders, and/or conditions and/or
states, which can be treated with the polynucleotides,
polypeptides, agonists and/or agonists include, but are not limited
to, solid tumors, blood born tumors such as leukemias, tumor
metastasis, Kaposi's sarcoma, benign tumors, for example
hemangiomas, acoustic neuromas, neurofibromas, trachomas, and
pyogenic granulomas, rheumatoid arthritis, psoriasis, ocular
angiogenic diseases, for example, diabetic retinopathy, retinopathy
of prematurity, macular degeneration, corneal graft rejection,
neovascular glaucoma, retrolental fibroplasia, rubeosis,
retinoblastoma, and uvietis, delayed wound healing, endometriosis,
vascluogenesis, granulations, hypertrophic scars (keloids),
nonunion fractures, scleroderma, trachoma, vascular adhesions,
myocardial angiogenesis, coronary collaterals, cerebral
collaterals, arteriovenous malformations, ischemic limb
angiogenesis, Osler-Webber Syndrome, plaque neovascularization,
telangiectasia, hemophiliac joints, angiofibroma fibromuscular
dysplasia, wound granulation, Crohin's disease, atherosclerosis,
birth control agent by preventing vascularization required for
embryo implantation controlling menstruation, diseases that have
angiogenesis as a pathologic consequence such as cat scratch
disease (Rochele minalia quintosa), ulcers (Helicobacter pylori),
Bartonellosis and bacillary angiomatosis.
[0501] In one aspect of the birth control method, an amount of the
compound sufficient to block embryo implantation is administered
before or after intercourse and fertilization have occurred, thus
providing an effective method of birth control, possibly a "morning
after" method. Polynucleotides, polypeptides, agonists and/or
agonists may also be used in controlling menstruation or
administered as either a peritoneal lavage fluid or for peritoneal
implantation in the treatment of endometriosis.
[0502] Polynucleotides, polypeptides, agonists and/or agonists of
the present invention may be incorporated into surgical sutures in
order to prevent stitch granulomas.
[0503] Polynucleotides, polypeptides, agonists and/or agonists may
be utilized in a wide variety of surgical procedures. For example,
within one aspect of the present invention a compositions (in the
form of, for example, a spray or film) may be utilized to coat or
spray an area prior to removal of a tumor, in order to isolate
normal surrounding tissues from malignant tissue, and/or to prevent
the spread of disease to surrounding tissues. Within other aspects
of the present invention, compositions (e.g., in the form of a
spray) may be delivered via endoscopic procedures in order to coat
tumors, or inhibit angiogenesis in a desired locale. Within yet
other aspects of the present invention, surgical meshes which have
been coated with anti-angiogenic compositions of the present
invention may be utilized in any procedure wherein a surgical mesh
might be utilized. For example, within one embodiment of the
invention a surgical mesh laden with an anti-angiogenic composition
may be utilized during abdominal cancer resection surgery (e.g.,
subsequent to colon resection) in order to provide support to the
structure, and to release an amount of the anti-angiogenic
factor.
[0504] Within further aspects of the present invention, methods are
provided for treating tumor excision sites, comprising
administering a polynucleotide, polypeptide, agonist and/or agonist
to the resection margins of a tumor subsequent to excision, such
that the local recurrence of cancer and the formation of new blood
vessels at the site is inhibited. Within one embodiment of the
invention, the anti-angiogenic compound is administered directly to
the tumor excision site (e.g., applied by swabbing, brushing or
otherwise coating the resection margins of the tumor with the
anti-angiogenic compound). Alternatively, the anti-angiogenic
compounds may be incorporated into known surgical pastes prior to
administration. Within particularly preferred embodiments of the
invention, the anti-angiogenic compounds are applied after hepatic
resections for malignancy, and after neurosurgical operations.
[0505] Within one aspect of the present invention, polynucleotides,
polypeptides, agonists and/or agonists may be administered to the
resection margin of a wide variety of tumors, including for
example, breast, colon, brain and hepatic tumors. For example,
within one embodiment of the invention, anti-angiogenic compounds
may be administered to the site of a neurological tumor subsequent
to excision, such that the formation of new blood vessels at the
site are inhibited.
[0506] The polynucleotides, polypeptides, agonists and/or agonists
of the present invention may also be administered along with other
anti-angiogenic factors. Representative examples of other
anti-angiogenic factors include: Anti-Invasive Factor, retinoic
acid and derivatives thereof, paclitaxel, Suramin, Tissue Inhibitor
of Metalloproteinase-1, Tissue Inhibitor of Metalloproteinase-2,
Plasminogen Activator Inhibitor-1, Plasminogen Activator
Inhibitor-2, and various forms of the lighter "d group" transition
metals.
[0507] Lighter "d group" transition metals include, for example,
vanadium, molybdenum, tungsten, titanium, niobium, and tantalum
species. Such transition metal species may form transition metal
complexes. Suitable complexes of the above-mentioned transition
metal species include oxo transition metal complexes.
[0508] Representative examples of vanadium complexes include oxo
vanadium complexes such as vanadate and vanadyl complexes. Suitable
vanadate complexes include metavanadate and orthovanadate complexes
such as, for example, ammonium metavanadate, sodium metavanadate,
and sodium orthovanadate. Suitable vanadyl complexes include, for
example, vanadyl acetylacetonate and vanadyl sulfate including
vanadyl sulfate hydrates such as vanadyl sulfate mono- and
trihydrates.
[0509] Representative examples of tungsten and molybdenum complexes
also include oxo complexes. Suitable oxo tungsten complexes include
tungstate and tungsten oxide complexes. Suitable tungstate
complexes include ammonium tungstate, calcium tungstate, sodium
tungstate dihydrate, and tungstic acid. Suitable tungsten oxides
include tungsten (IV) oxide and tungsten (VI) oxide. Suitable oxo
molybdenum complexes include molybdate, molybdenum oxide, and
molybdenyl complexes. Suitable molybdate complexes include ammonium
molybdate and its hydrates, sodium molybdate and its hydrates, and
potassium molybdate and its hydrates. Suitable molybdenum oxides
include molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic
acid. Suitable molybdenyl complexes include, for example,
molybdenyl acetylacetonate. Other suitable tungsten and molybdenum
complexes include hydroxo derivatives derived from, for example,
glycerol, tartaric acid, and sugars.
[0510] A wide variety of other anti-angiogenic factors may also be
utilized within the context of the present invention.
Representative examples include platelet factor 4; protamine
sulphate; sulphated chitin derivatives (prepared from queen crab
shells), (Murata et al., Cancer Res. 51:22-26, 1991); Sulphated
Polysaccharide Peptidoglycan Complex (SP-PG) (the function of this
compound may be enhanced by the presence of steroids such as
estrogen, and tamoxifen citrate); Staurosporine; modulators of
matrix metabolism, including for example, proline analogs,
cishydroxyproline, d,L-3,4-dehydroproline, Thiaproline,
alpha,alpha-dipyridyl, aminopropionitrile fumarate;
4-propyl-5-(4-pyridinyl)-2(3H)-oxazolone; Methotrexate;
Mitoxantrone; Heparin; hiterferons; 2 Macroglobulin-serum; ChIMP-3
(Pavloff et al., J. Bio. Chem. 267:17321-17326, 1992); Chymostatin
(Tomkinson et al., Biochem J. 286:475-480, 1992); Cyclodextrin
Tetradecasulfate; Eponemycin; Camptothecin; Fumagillin (Ingber et
al., Nature 348:555-557, 1990); Gold Sodium Thiomalate ("GST";
Matsubara and Ziff, J. Clin. Invest. 79:1440-1446, 1987);
anticollagenase-serum; alpha2-antiplasmin (Holmes et al., J. Biol.
Chem. 262(4):1659-1664, 1987); Bisantrene (National Cancer
Institute); Lobenzarit disodium
(N-(2)-carboxyphenyl-4-chloroanthronilic acid disodium or "CCA";
Takeuchi et al., Agents Actions 36:312-316, 1992); Thalidomide;
Angostatic steroid; AGM-1470; carboxynarninolmidazole; and
metalloproteinase inhibitors such as BB94.
Diseases at the Cellular Level
[0511] Diseases associated with increased cell survival or the
inhibition of apoptosis that could be treated, prevented, and/or
diagnosed by PSGR polynucleotides or polypeptides, as well as
antagonists or agonists of PSGR, include cancers (such as prostate
cancer, follicular lymphomas, carcinomas with p53 mutations, and
hormone-dependent tumors, including, but not limited to colon
cancer, cardiac tumors, pancreatic cancer, melanoma,
retinoblastoma, glioblastoma, lung cancer, intestinal cancer,
testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma,
lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma,
chondrosarcoma, adenoma, breast cancer, Kaposi's sarcoma and
ovarian cancer); autoimmune diseases, disorders, and/or conditions
(such as, multiple sclerosis, Sjogren's syndrome, Hashimoto's
thyroiditis, biliary cirrhosis, Behcet's disease, Crohn's disease,
polymyositis, systemic lupus erythematosus and immune-related
glomerulonephritis and rheumatoid arthritis) and viral infections
(such as herpes viruses, pox viruses and adenoviruses),
inflammation, graft v. host disease, acute graft rejection, and
chronic graft rejection. In preferred embodiments, PSGR
polynucleotides, polypeptides, and/or antagonists of the invention
are used to inhibit growth, progression, and/or metasis of cancers,
in particular those listed above.
[0512] Additional diseases or conditions associated with increased
cell survival that could be treated, prevented, and/or diagnosed by
PSGR polynucleotides or polypeptides, or agonists or antagonists of
PSGR, include, but are not limited to, progression, and/or
metastases of malignancies and related diseases, disorders, and/or
conditions such as leukemia (including acute leukemias (e.g., acute
lymphocytic leukemia, acute myelocytic leukemia (including
myeloblastic, promyelocytic, myelomonocytic, monocytic, and
erythroleukemia)) and chronic leukemias (e.g., chronic myelocytic
(granulocytic) leukemia and chronic lymphocytic leukemia)),
polycythemia vera, lymphomas (e.g., Hodgkin's disease and
non-Hodgkin's disease), multiple myeloma, Waldenstrom's
macroglobulinemia, heavy chain disease, and solid tumors including,
but not limited to, sarcomas and carcinomas such as fibrosarcoma,
myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma,
chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma,
lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's
tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma,
pancreatic cancer, breast cancer, ovarian cancer, prostate cancer,
squamous cell carcinoma, basal cell carcinoma, adenocarcinoma,
sweat gland carcinoma, sebaceous gland carcinoma, papillary
carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary
carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma,
bile duct carcinoma, choriocarcinoma, seminoma, embryonal
carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung
carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial
carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma,
ependymoma, pinealoma, hemangioblastoma, acoustic neuroma,
oligodendroglioma, menangioma, melanoma, neuroblastoma, and
retinoblastoma.
[0513] Diseases associated with increased apoptosis that could be
treated, prevented, and/or diagnosed by PSGR polynucleotides or
polypeptides, as well as agonists or antagonists of PSGR, include
AIDS; neurodegenerative diseases, disorders, and/or conditions
(such as Alzheimer's disease, Parkinson's disease, Amyotrophic
lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration
and brain tumor or prior associated disease); autoimmune diseases,
disorders, and/or conditions (such as, multiple sclerosis,
Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis,
Behcet's disease, Crohn's disease, polymyositis, systemic lupus
erythematosus and immune-related glomerulonephritis and rheumatoid
arthritis) myelodysplastic syndromes (such as aplastic anemia),
graft v. host disease, ischemic injury (such as that caused by
myocardial infarction, stroke and reperfusion injury), liver injury
(e.g., hepatitis related liver injury, ischemia/reperfusion injury,
cholestosis (bile duct injury) and liver cancer); toxin-induced
liver disease (such as that caused by alcohol), septic shock
cachexia and anorexia.
Wound Healing and Epithelial Cell Proliferation
[0514] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing PSGR
polynucleotides or polypeptides, as well as agonists or antagonists
of PSGR, for therapeutic purposes, for example, to stimulate
epithelial cell proliferation and basal keratinocytes for the
purpose of wound healing, and to stimulate hair follicle production
and healing of dermal wounds. PSGR polynucleotides or polypeptides,
as well as agonists or antagonists of PSGR, may be clinically
useful in stimulating wound healing including surgical wounds,
excisional wounds, deep wounds involving damage of the dermis and
epidermis, eye tissue wounds, dental tissue wounds, oral cavity
wounds, diabetic ulcers, dermal ulcers, cubitus ulcers, arterial
ulcers, venous stasis ulcers, burns resulting from heat exposure or
chemicals, and other abnormal wound healing conditions such as
uremia, malnutrition, vitamin deficiencies and complications
associted with systemic treatment with steroids, radiation therapy
and antineoplastic drugs and antimetabolites. PSGR polynucleotides
or polypeptides, as well as agonists or antagonists of PSGR, could
be used to promote dermal reestablishment subsequent to dermal
loss
[0515] PSGR polynucleotides or polypeptides, as well as agonists or
antagonists of PSGR, could be used to increase the adherence of
skin grafts to a wound bed and to stimulate re-epithelialization
from the wound bed. The following are types of grafts that PSGR
polynucleotides or polypeptides, agonists or antagonists of PSGR,
could be used to increase adherence to a wound bed: autografts,
artificial skin, allografts, autodermic graft, autoepdermic grafts,
avacular grafts, Blair-Brown grafts, bone graft, brephoplastic
grafts, cutis graft, delayed graft, dermic graft, epidermic graft,
fascia graft, full thickness graft, heterologous graft, xenograft,
homologous graft, hyperplastic graft, lamellar graft, mesh graft,
mucosal graft, Ollier-Thiersch graft, omenpal graft, patch graft,
pedicle graft, penetrating graft, split skin graft, thick split
graft. PSGR polynucleotides or polypeptides, as well as agonists or
antagonists of PSGR, can be used to promote skin strength and to
improve the appearance of aged skin.
[0516] It is believed that PSGR polynucleotides or polypeptides, as
well as agonists or antagonists of PSGR, will also produce changes
in hepatocyte proliferation, and epithelial cell proliferation in
the lung, breast, pancreas, stomach, small intesting, and large
intestine. PSGR polynucleotides or polypeptides, as well as
agonists or antagonists of PSGR, could promote proliferation of
epithelial cells such as sebocytes, hair follicles, hepatocytes,
type II pneumocytes, mucin-producing goblet cells, and other
epithelial cells and their progenitors contained within the skin,
lung, liver, and gastrointestinal tract. PSGR polynucleotides or
polypeptides, agonists or antagonists of PSGR, may promote
proliferation of endothelial cells, keratinocytes, and basal
keratinocytes.
[0517] PSGR polynucleotides or polypeptides, as well as agonists or
antagonists of PSGR, could also be used to reduce the side effects
of gut toxicity that result from radiation, chemotherapy treatments
or viral infections. PSGR polynucleotides or polypeptides, as well
as agonists or antagonists of PSGR, may have a cytoprotective
effect on the small intestine mucosa. PSGR polynucleotides or
polypeptides, as well as agonists or antagonists of PSGR, may also
stimulate healing of mucositis (mouth ulcers) that result from
chemotherapy and viral infections.
[0518] PSGR polynucleotides or polypeptides, as well as agonists or
antagonists of PSGR, could further be used in full regeneration of
skin in full and partial thickness skin defects, including burns,
(i.e., repopulation of hair follicles, sweat glands, and sebaceous
glands), treatment of other skin defects such as psoriasis. PSGR
polynucleotides or polypeptides, as well as agonists or antagonists
of PSGR, could be used to treat, prevent, and/or diagnose
epidermolysis bullosa, a defect in adherence of the epidermis to
the underlying dermis which results in frequent, open and painful
blisters by accelerating reepithelialization of these lesions. PSGR
polynucleotides or polypeptides, as well as agonists or antagonists
of PSGR, could also be used to treat, prevent, and/or diagnose
gastric and doudenal ulcers and help heal by scar formation of the
mucosal lining and regeneration of glandular mucosa and duodenal
mucosal lining more rapidly. Inflammatory bowel diseases, such as
Crohn's disease and ulcerative colitis, are diseases which result
in destruction of the mucosal surface of the small or large
intestine, respectively. Thus, PSGR polynucleotides or
polypeptides, as well as agonists or antagonists of PSGR, could be
used to promote the resurfacing of the mucosal surface to aid more
rapid healing and to prevent progression of inflammatory bowel
disease. Treatment with PSGR polynucleotides or polypeptides,
agonists or antagonists of PSGR, is expected to have a significant
effect on the production of mucus throughout the gastrointestinal
tract and could be used to protect the intestinal mucosa from
injurious substances that are ingested or following surgery. PSGR
polynucleotides or polypeptides, as well as agonists or antagonists
of PSGR, could be used to treat, prevent, and/or diagnose diseases
associate with the under expression of PSGR.
[0519] Moreover, PSGR polynucleotides or polypeptides, as well as
agonists or antagonists of PSGR, could be used to prevent and heal
damage to the lungs due to various pathological states. A growth
factor such as PSGR polynucleotides or polypeptides, as well as
agonists or antagonists of PSGR, which could stimulate
proliferation and differentiation and promote the repair of alveoli
and brochiolar epithelium to prevent or treat acute or chronic lung
damage. For example, emphysema, which results in the progressive
loss of aveoli, and inhalation injuries, i.e., resulting from smoke
inhalation and bums, that cause necrosis of the bronchiolar
epithelium and alveoli could be effectively treated using PSGR
polynucleotides or polypeptides, agonists or antagonists of PSGR.
Also, PSGR polynucleotides or polypeptides, as well as agonists or
antagonists of PSGR, could be used to stimulate the proliferation
of and differentiation of type II pneumocytes, which may help
treat, prevent, and/or diagnose disease such as hyaline membrane
diseases, such as infant respiratory distress syndrome and
bronchopulmonary displasia, in premature infants.
[0520] PSGR polynucleotides or polypeptides, as well as agonists or
antagonists of PSGR, could stimulate the proliferation and
differentiation of hepatocytes and, thus, could be used to
alleviate or treat, prevent, and/or diagnose liver diseases and
pathologies such as fulminant liver failure caused by cirrhosis,
liver damage caused by viral hepatitis and toxic substances (i.e.,
acetaminophen, carbon tetraholoride and other hepatotoxins known in
the art).
[0521] In addition, PSGR polynucleotides or polypeptides, as well
as agonists or antagonists of PSGR, could be used treat, prevent,
and/or diagnose the onset of diabetes mellitus. In patients with
newly diagnosed Types I and II diabetes, where some islet cell
function remains, PSGR polynucleotides or polypeptides, as well as
agonists or antagonists of PSGR, could be used to maintain the
islet function so as to alleviate, delay or prevent permanent
manifestation of the disease. Also, PSGR polynucleotides or
polypeptides, as well as agonists or antagonists of PSGR, could be
used as an auxiliary in islet cell transplantation to improve or
promote islet cell function.
Neurological Diseases
[0522] Nervous system diseases, disorders, and/or conditions, which
can be treated with the PSGR compositions of the invention (e.g.,
PSGR polypeptides, polynucleotides, and/or agonists or
antagonists), include, but are not limited to, nervous system
injuries, and diseases, disorders, and/or conditions which result
in either a disconnection of axons, a diminution or degeneration of
neurons, or demyelination. Nervous system lesions which may be
treated in a patient (including human and non-human mammalian
patients) according to the invention, include but are not limited
to, the following lesions of either the central (including spinal
cord, brain) or peripheral nervous systems: (1) ischemic lesions,
in which a lack of oxygen in a portion of the nervous system
results in neuronal injury or death, including cerebral infarction
or ischemia, or spinal cord infarction or ischemia; (2) traumatic
lesions, including lesions caused by physical injury or associated
with surgery, for example, lesions which sever a portion of the
nervous system, or compression injuries; (3) malignant lesions, in
which a portion of the nervous system is destroyed or injured by
malignant tissue which is either a nervous system associated
malignancy or a malignancy derived from non-nervous system tissue;
(4) infectious lesions, in which a portion of the nervous system is
destroyed or injured as a result of infection, for example, by an
abscess or associated with infection by human immunodeficiency
virus, herpes zoster, or herpes simplex virus or with Lyme disease,
tuberculosis, syphilis; (5) degenerative lesions, in which a
portion of the nervous system is destroyed or injured as a result
of a degenerative process including but not limited to degeneration
associated with Parkinsons disease, Alzheimer's disease,
Huntington's chorea, or amyotrophic lateral sclerosis (ALS); (6)
lesions associated with nutritional diseases, disorders, and/or
conditions, in which a portion of the nervous system is destroyed
or injured by a nutritional disorder or disorder of metabolism
including but not limited to, vitamin B12 deficiency, folic acid
deficiency, Wernicke disease, tobacco-alcohol amblyopia,
Marchiafava-Bignami disease (primary degeneration of the corpus
callosum), and alcoholic cerebellar degeneration; (7) neurological
lesions associated with systemic diseases including, but not
limited to, diabetes (diabetic neuropathy, Bell's palsy), systemic
lupus erythematosus, carcinoma, or sarcoidosis; (8) lesions caused
by toxic substances including alcohol, lead, or particular
neurotoxins; and (9) demyelinated lesions in which a portion of the
nervous system is destroyed or injured by a demyelinating disease
including, but not limited to, multiple sclerosis, human
immunodeficiency virus-associated myelopathy, transverse myelopathy
or various etiologies, progressive multifocal leukoencephalopathy,
and central pontine myelinolysis.
[0523] In a preferred embodiment, the PSGR polypeptides,
polynucleotides, or agonists or antagonists of the invention are
used to protect neural cells from the damaging effects of cerebral
hypoxia. According to this embodiment, the PSGR compositions of the
invention are used to treat, prevent, and/or diagnose neural cell
injury associated with cerebral hypoxia. In one aspect of this
embodiment, the PSGR polypeptides, polynucleotides, or agonists or
antagonists of the invention are used to treat, prevent, and/or
diagnose neural cell injury associated with cerebral ischemia. In
another aspect of this embodiment, the PSGR polypeptides,
polynucleotides, or agonists or antagonists of the invention are
used to treat, prevent, and/or diagnose neural cell injury
associated with cerebral infarction. In another aspect of this
embodiment, the PSGR polypeptides, polynucleotides, or agonists or
antagonists of the invention are used to treat, prevent, and/or
diagnose neural cell injury associated with a stroke. In a further
aspect of this embodiment, the PSGR polypeptides, polynucleotides,
or agonists or antagonists of the invention are used to treat,
prevent, and/or diagnose neural cell injury associated with a heart
attack.
[0524] The compositions of the invention which are useful for
treating, preventing, and/or diagnosing a nervous system disorder
may be selected by testing for biological activity in promoting the
survival or differentiation of neurons. For example, and not by way
of limitation, PSGR compositions of the invention which elicit any
of the following effects may be useful according to the invention:
(1) increased survival time of neurons in culture; (2) increased
sprouting of neurons in culture or in vivo; (3) increased
production of a neuron-associated molecule in culture or in vivo,
e.g., choline acetyltransferase or acetylcholinesterase with
respect to motor neurons; or (4) decreased symptoms of neuron
dysfunction in vivo. Such effects may be measured by any method
known in the art. In preferred, non-limiting embodiments, increased
survival of neurons may routinely be measured using a method set
forth herein or otherwise known in the art, such as, for example,
the method set forth in Arakawa et al. (J. Neurosci. 10:3507-3515
(1990)); increased sprouting of neurons may be detected by methods
known in the art, such as, for example, the methods set forth in
Pestronk et al. (Exp. Neurol. 70:65-82 (1980)) or Brown et al.
(Ann. Rev. Neurosci. 4:17-42 (1981)); increased production of
neuron-associated molecules may be measured by bioassay, enzymatic
assay, antibody binding, Northern blot assay, etc., using
techniques known in the art and depending on the molecule to be
measured; and motor neuron dysfunction may be measured by assessing
the physical manifestation of motor neuron disorder, e.g.,
weakness, motor neuron conduction velocity, or functional
disability.
[0525] In specific embodiments, motor neuron diseases, disorders,
and/or conditions that may be treated according to the invention
include, but are not limited to, diseases, disorders, and/or
conditions such as infarction, infection, exposure to toxin,
trauma, surgical damage, degenerative disease or malignancy that
may affect motor neurons as well as other components of the nervous
system, as well as diseases, disorders, and/or conditions that
selectively affect neurons such as amyotrophic lateral sclerosis,
and including, but not limited to, progressive spinal muscular
atrophy, progressive bulbar palsy, primary lateral sclerosis,
infantile and juvenile muscular atrophy, progressive bulbar
paralysis of childhood (Fazio-Londe syndrome), poliomyelitis and
the post polio syndrome, and Hereditary Motorsensory Neuropathy
(Charcot-Marie-Tooth Disease).
[0526] Additional examples of neurologic diseases which can be
treated, prevented, and/or diagnosed with polynucleotides,
polypeptides, agonists, and/or antagonists of the present invention
include brain diseases, such as metabolic brain diseases which
includes phenylketonuria such as maternal phenylketonuria, pyruvate
carboxylase deficiency, pyruvate dehydrogenase complex deficiency,
Wermicke's Encephalopathy, brain edema, brain neoplasms such as
cerebellar neoplasms which include infratentorial neoplasms,
cerebral ventricle neoplasms such as choroid plexus neoplasms,
hypothalamic neoplasms, supratentorial neoplasms, canavan disease,
cerebellar diseases such as cerebellar ataxia which include
spinocerebellar degeneration such as ataxia telangiectasia,
cerebellar dyssynergia, Friederich's Ataxia, Machado-Joseph
Disease, olivopontocerebellar atrophy, cerebellar neoplasms such as
infratentorial neoplasms, diffuse cerebral sclerosis such as
encephalitis periaxialis, globoid cell leukodystrophy,
metachromatic leukodystrophy and subacute sclerosing
panencephalitis, cerebrovascular diseases, disorders, and/or
conditions (such as carotid artery diseases which include carotid
artery thrombosis, carotid stenosis and Moyamoya Disease, cerebral
amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral
arteriosclerosis, cerebral arteriovenous malformations, cerebral
artery diseases, cerebral embolism and thrombosis such as carotid
artery thrombosis, sinus thrombosis and Wallenberg's Syndrome,
cerebral hemorrhage such as epidural hematoma, subdural hematoma
and subarachnoid hemorrhage, cerebral infarction, cerebral ischemia
such as transient cerebral ischemia, Subdlavian Steal Syndrome and
vertebrobasilar insufficiency, vascular dementia such as
multi-infarct dementia, periventricular leukomalacia, vascular
headache such as cluster headache, migraine, dementia such as AIDS
Dementia Complex, presenile dementia such as Alzheimer's Disease
and Creutzfeldt-Jakob Syndrome, senile dementia such as Alzheimer's
Disease and progressive supranuclear palsy, vascular dementia such
as multi-infarct dementia, encephalitis which include encephalitis
periaxialis, viral encephalitis such as epidemic encephalitis,
Japanese Encephalitis, St. Louis Encephalitis, tick-borne
encephalitis and West Nile Fever, acute disseminated
encephalomyelitis, meningoencephalitis such as
uveomeningoencephalitic syndrome, Postencephalitic Parkinson
Disease and subacute sclerosing panencephalitis, encephalomalacia
such as periventricular leukomalacia, epilepsy such as generalized
epilepsy which includes infantile spasms, absence epilepsy,
inyoclonic epilepsy which includes MERRF Syndrome, tonic-clonic
epilepsy, partial epilepsy such as complex partial epilepsy,
frontal lobe epilepsy and temporal lobe epilepsy, post-traumatic
epilepsy, status epilepticus such as Epilepsia Partialis Continua,
Hallervorden-Spatz Syndrome, hydrocephalus such as Dandy-Walker
Syndrome and normal pressure hydrocephalus, hypothalamic diseases
such as hypothalamic neoplasms, cerebral malaria, narcolepsy which
includes cataplexy, bulbar poliomyelitis, cerebri pseudotumor, Rett
Syndrome, Reye's Syndrome, thalamic diseases, cerebral
toxoplasmosis, intracranial tuberculoma and Zellweger Syndrome,
central nervous system infections such as AIDS Dementia Complex,
Brain Abscess, subdural empyema, encephalomyelitis such as Equine
Encephalomyelitis, Venezuelan Equine Encephalomyelitis, Necrotizing
Hemorrhagic Encephalomyelitis, Visna, cerebral malaria, meningitis
such as arachnoiditis, aseptic meningtitis such as viral
meningtitis which includes lymphocytic choriomeningitis. Bacterial
meningtitis which includes Haemophilus Meningtitis, Listeria
Meningtitis, Meningococcal Meningtitis such as
Waterhouse-Friderichsen Syndrome, Pneumococcal Meningtitis and
meningeal tuberculosis, fungal meningitis such as Cryptococcal
Meningtitis, subdural effusion, meningoencephalitis such as
uvemeningoencephalitic syndrome, myelitis such as transverse
myelitis, neurosyphilis such as tabes dorsalis, poliomyelitis which
includes bulbar poliomyelitis and postpoliomyelitis syndrome, prion
diseases (such as Creutzfeldt-Jakob Syndrome, Bovine Spongiform
Encephalopathy, Gerstmann-Straussler Syndrome, Kuru, Scrapie)
cerebral toxoplasmosis, central nervous system neoplasms such as
brain neoplasms that include cerebellear neoplasms such as
infratentorial neoplasms, cerebral ventricle neoplasms such as
choroid plexus neoplasms, hypothalamic neoplasms and supratentorial
neoplasms, meningeal neoplasms, spinal cord neoplasms which include
epidural neoplasms, demyelinating diseases such as Canavan
Diseases, diffuse cerebral sceloris which includes
adrenoleukodystrophy, encephalitis periaxialis, globoid cell
leukodystrophy, diffuse cerebral sclerosis such as metachromatic
leukodystrophy, allergic encephalomyelitis, necrotizing hemorrhagic
encephalomyelitis, progressive multifocal leukoencephalopathy,
multiple sclerosis, central pontine myelinolysis, transverse
myelitis, neuromyelitis optica, Scrapie, Swayback, Chronic Fatigue
Syndrome, Visna, High Pressure Nervous Syndrome, Meningism, spinal
cord diseases such as amyotonia congenita, amyotrophic lateral
sclerosis, spinal muscular atrophy such as Werdnig-Hoffmann
Disease, spinal cord compression, spinal cord neoplasms such as
epidural neoplasms, syringomyelia, Tabes Dorsalis, Stiff-Man
Syndrome, mental retardation such as Angelman Syndrome, Cri-du-Chat
Syndrome, De Lange's Syndrome, Down Syndrome, Gangliosidoses such
as gangliosidoses G(M1), Sandhoff Disease, Tay-Sachs Disease,
Hartnup Disease, homocystinuria, Laurence-Moon-Biedl Syndrome,
Lesch-Nyhan Syndrome, Maple Syrup Urine Disease, mucolipidosis such
as fucosidosis, neuronal ceroid-lipofuscinosis, oculocerebrorenal
syndrome, phenylketonuria such as maternal phenylketonuria,
Prader-Willi Syndrome, Rett Syndrome, Rubinstein-Taybi Syndrome,
Tuberous Sclerosis, WAGR Syndrome, nervous system abnormalities
such as holoprosencephaly, neural tube defects such as anencephaly
which includes hydrangencephaly, Arnold-Chairi Deformity,
encephalocele, meningocele, meningomyelocele, spinal dysraphism
such as spina bifida cystica and spina bifida occulta, hereditary
motor and sensory neuropathies which include Charcot-Marie Disease,
Hereditary optic atrophy, Refsum's Disease, hereditary spastic
paraplegia, Werdnig-Hoffinann Disease, Hereditary Sensory and
Autonomic Neuropathies such as Congenital Analgesia and Familial
Dysautonomia, Neurologic manifestations (such as agnosia that
include Gerstmann's Syndrome, Amnesia such as retrograde amnesia,
apraxia, neurogenic bladder, cataplexy, communicative diseases,
disorders, and/or conditions such as hearing diseases, disorders,
and/or conditions that includes deafness, partial hearing loss,
loudness recruitment and tinnitus, language diseases, disorders,
and/or conditions such as aphasia which include agraphia, anomia,
broca aphasia, and Wernicke Aphasia, Dyslexia such as Acquired
Dyslexia, language development diseases, disorders, and/or
conditions, speech diseases, disorders, and/or conditions such as
aphasia which includes anomia, broca aphasia and Wernicke Aphasia,
articulation diseases, disorders, and/or conditions, communicative
diseases, disorders, and/or conditions such as speech disorders
which include dysarthria, echolalia, mutism and stuttering, voice
diseases, disorders, and/or conditions such as aphonia and
hoarseness, decerebrate state, delirium, fasciculation,
hallucinations, meningism, movement diseases, disorders, and/or
conditions such as angelman syndrome, ataxia, athetosis, chorea,
dystonia, hypokinesia, muscle hypotonia, myoclonus, tic,
torticollis and tremor, muscle hypertonia such as muscle rigidity
such as stiff-man syndrome, muscle spasticity, paralysis such as
facial paralysis which includes Herpes Zoster Oticus,
Gastroparesis, Hemiplegia, ophthalmoplegia such as diplopia,
Duane's Syndrome, Homer's Syndrome, Chronic progressive external
ophthalmoplegia such as Kearns Syndrome, Bulbar Paralysis, Tropical
Spastic Paraparesis, Paraplegia such as Brown-Sequard Syndrome,
quadriplegia, respiratory paralysis and vocal cord paralysis,
paresis, phantom limb, taste diseases, disorders, and/or conditions
such as ageusia and dysgeusia, vision diseases, disorders, and/or
conditions such as amblyopia, blindness, color vision defects,
diplopia, hemianopsia, scotoma and subnormal vision, sleep
diseases, disorders, and/or conditions such as hypersomnia which
includes Kleine-Levin Syndrome, insomnia, and somnambulism, spasm
such as trismus, unconsciousness such as coma, persistent
vegetative state and syncope and vertigo, neuromuscular diseases
such as amyotonia congenita, amyotrophic lateral sclerosis,
Lambert-Eaton Myasthenic Syndrome, motor neuron disease, muscular
atrophy such as spinal muscular atrophy, Charcot-Marie Disease and
Werdnig-Hoffmann Disease, Postpoliomyelitis Syndrome, Muscular
Dystrophy, Myasthenia Gravis, Myotonia Atrophica, Myotonia
Confenita, Nemaline Myopathy, Familial Periodic Paralysis,
Multiplex Paramyloclonus, Tropical Spastic Paraparesis and
Stiff-Man Syndrome, peripheral nervous system diseases such as
acrodynia, amyloid neuropathies, autonomic nervous system diseases
such as Adie's Syndrome, Barre-Lieou Syndrome, Familial
Dysautonomia, Homer's Syndrome, Reflex Sympathetic Dystrophy and
Shy-Drager Syndrome, Cranial Nerve Diseases such as Acoustic Nerve
Diseases such as Acoustic Neuroma which includes Neurofibromatosis
2, Facial Nerve Diseases such as Facial
Neuralgia,Melkersson-Rosenthal Syndrome, ocular motility diseases,
disorders, and/or conditions which includes amblyopia, nystagmus,
oculomotor nerve paralysis, ophthalmoplegia such as Duane's
Syndrome, Horner's Syndrome, Chronic Progressive External
Ophthalmoplegia which includes Kearns Syndrome, Strabismus such as
Esotropia and Exotropia, Oculomotor Nerve Paralysis, Optic Nerve
Diseases such as Optic Atrophy which includes Hereditary Optic
Atrophy, Optic Disk Drusen, Optic Neuritis such as Neuromyelitis
Optica, Papilledema, Trigeminal Neuralgia, Vocal Cord Paralysis,
Demyelinating Diseases such as Neuromyelitis Optica and Swayback,
Diabetic neuropathies such as diabetic foot, nerve compression
syndromes such as carpal tunnel syndrome, tarsal tunnel syndrome,
thoracic outlet syndrome such as cervical rib syndrome, ulnar nerve
compression syndrome, neuralgia such as causalgia, cervico-brachial
neuralgia, facial neuralgia and trigeminal neuralgia, neuritis such
as experimental allergic neuritis, optic neuritis, polyneuritis,
polyradiculoneuritis and radiculities such as polyradiculitis,
hereditary motor and sensory neuropathies such as Charcot-Marie
Disease, Hereditary Optic Atrophy, Refsum's Disease, Hereditary
Spastic Paraplegia and Werdnig-Hoffmann Disease, Hereditary Sensory
and Autonomic Neuropathies which include Congenital Analgesia and
Familial Dysautonomia, POEMS Syndrome, Sciatica, Gustatory Sweating
and Tetany).
Infectious Disease
[0527] PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, can be used to treat, prevent, and/or diagnose
infectious agents. For example, by increasing the immune response,
particularly increasing the proliferation and differentiation of B
and/or T cells, infectious diseases may be treated, prevented,
and/or diagnosed. The immune response may be increased by either
enhancing an existing immune response, or by initiating a new
immune response. Alternatively, PSGR polynucleotides or
polypeptides, or agonists or antagonists of PSGR, may also directly
inhibit the infectious agent, without necessarily eliciting an
immune response.
[0528] Viruses are one example of an infectious agent that can
cause disease or symptoms that can be treated, prevented, and/or
diagnosed by a polynucleotide or polypeptide and/or agonist or
antagonist of the present invention. Examples of viruses, include,
but are not limited to Examples of viruses, include, but are not
limited to the following DNA and RNA viruses and viral families:
Arbovirus, Adenoviridae, Arenaviridae, Arterivirus, Biruaviridae,
Bunyaviridae, Caliciviridae, Circoviridae, Coronaviridae, Dengue,
EBV, HIV, Flaviviridae, Hepadnaviridae (Hepatitis), Herpesviridae
(such as, Cytomegalovirus, Herpes Simplex, Herpes Zoster),
Mononegavirus (e.g., Paramyxoviridae, Morbillivirus,
Rhabdoviridae), Orthomyxoviridae (e.g., Influenza A, Influenza B,
and parainfluenza), Papiloma virus, Papovaviridae, Parvoviridae,
Picoruaviridae, Poxyiridae (such as Smallpox or Vaccinia),
Reoviridae (e.g., Rotavirus), Retroviridae (HTLV-I, HTLV-II,
Lentivirus), and Togaviridae (e.g., Rubivirus). Viruses falling
within these families can cause a variety of diseases or symptoms,
including, but not limited to: arthritis, bronchiollitis,
respiratory syncytial virus, encephalitis, eye infections (e.g.,
conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A,
B, C, E, Chronic Active, Delta), Japanese B encephalitis, Junin,
Chikungunya, Rift Valley fever, yellow fever, meningitis,
opportunistic infections (e.g., AIDS), pneumonia, Burkitt's
Lymphoma, chickenpox, hemorrhagic fever, Measles, Mumps,
Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella,
sexually transmitted diseases, skin diseases (e.g., Kaposi's,
warts), and viremia. polynucleotides or polypeptides, or agonists
or antagonists of the invention, can be used to treat, prevent,
and/or diagnose any of these symptoms or diseases. In specific
embodiments, polynucleotides, polypeptides, or agonists or
antagonists of the invention are used to treat: meningitis, Dengue,
EBV, and/or hepatitis (e.g., hepatitis B). In an additional
specific embodiment polynucleotides, polypeptides, or agonists or
antagonists of the invention are used to treat patients
nonresponsive to one or more other commercially available hepatitis
vaccines. In a further specific embodiment polynucleotides,
polypeptides, or agonists or antagonists of the invention are used
to treat, prevent, and/or diagnose AIDS.
[0529] Similarly, bacterial or fungal agents that can cause disease
or symptoms and that can be treated, prevented, and/or diagnosed by
a polynucleotide or polypeptide and/or agonist or antagonist of the
present invention include, but not limited to, include, but not
limited to, the following Gram-Negative and Gram-positive bacteria
and bacterial families and fungi: Actinomycetales (e.g.,
Corynebacterium, Mycobacterium, Norcardia), Cryptococcus
neoformans, Aspergillosis, Bacillaceae (e.g., Anthrax,
Clostridium), Bacteroidaceae, Blastomycosis, Bordetella, Borrelia
(e.g., Borrelia burgdorferi), Brucellosis, Candidiasis,
Campylobacter, Coccidioidomycosis, Cryptococcosis, Dermatocycoses,
E. coli (e.g., Enterotoxigenic E. coli and Enterohemorrhagic E.
coli), Enterobacteriaceae (Klebsiella, Salmonella (e.g., Salmonella
typhi, and Salmonella paratyphi), Serratia, Yersinia),
Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis,
Listeria, Mycoplasmatales, Mycobacterium leprae, Vibrio cholerae,
Neisseriaceae (e.g., Acinetobacter, Gonorrhea, Menigococcal),
Meisseria meningitidis, Pasteurellacea Infections (e.g.,
Actinobacillus, Heamophilus (e.g., Heamophilus influenza type B),
Pasteurella), Pseudomonas, Rickettsiaceae, Chlamydiaceae, Syphilis,
Shigella spp., Staphylococcal, Meningiococcal, Pneumococcal and
Streptococcal (e.g., Streptococcus pneumoniae and Group B
Streptococcus). These bacterial or fungal families can cause the
following diseases or symptoms, including, but not limited to:
bacteremia, endocarditis, eye infections (conjunctivitis,
tuberculosis, uveitis), gingivitis, opportunistic infections (e.g.,
AIDS related infections), paronychia, prosthesis-related
infections, Reiter's Disease, respiratory tract infections, such as
Whooping Cough or Empyema, sepsis, Lyme Disease, Cat-Scratch
Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid,
pneumonia, Gonorrhea, meningitis (e.g., mengitis types A and B),
Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis,
Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo,
Rheumatic Fever, Scarlet Fever, sexually transmitted diseases, skin
diseases (e.g., cellulitis, dermatocycoses), toxemia, urinary tract
infections, wound infections. Polynucleotides or polypeptides,
agonists or antagonists of the invention, can be used to treat,
prevent, and/or diagnose any of these symptoms or diseases. In
specific embodiments, polynucleotides, polypeptides, agonists or
antagonists of the invention are used to treat: tetanus, Diptheria,
botulism, and/or meningitis type B.
[0530] Moreover, parasitic agents causing disease or symptoms that
can be treated, prevented, and/or diagnosed by a polynucleotide or
polypeptide and/or agonist or antagonist of the present invention
include, but not limited to, the following families or class:
Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis,
Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis,
Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis, and
Trichomonas and Sporozoans (e.g., Plasmodium virax, Plasmodium
falciparium, Plasmodium malariae and Plasmodium ovale). These
parasites can cause a variety of diseases or symptoms, including,
but not limited to: Scabies, Trombiculiasis, eye infections,
intestinal disease (e.g., dysentery, giardiasis), liver disease,
lung disease, opportunistic infections (e.g., AIDS related),
malaria, pregnancy complications, and toxoplasmosis.
polynucleotides or polypeptides, or agonists or antagonists of the
invention, can be used to treat, prevent, and/or diagnose any of
these symptoms or diseases. In specific embodiments,
polynucleotides, polypeptides, or agonists or antagonists of the
invention are used to treat, prevent, and/or diagnose malaria.
[0531] Preferably, treatment or prevention using a polypeptide or
polynucleotide and/or agonist or antagonist of the present
invention could either be by administering an effective amount of a
polypeptide to the patient, or by removing cells from the patient,
supplying the cells with a polynucleotide of the present invention,
and returning the engineered cells to the patient (ex vivo
therapy). Moreover, the polypeptide or polynucleotide of the
present invention can be used as an antigen in a vaccine to raise
an immune response against infectious disease.
Regeneration
[0532] PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, can be used to differentiate, proliferate, and
attract cells, leading to the regeneration of tissues. (See,
Science 276:59-87 (1997).) The regeneration of tissues could be
used to repair, replace, or protect tissue damaged by congenital
defects, trauma (wounds, burns, incisions, or ulcers), age, disease
(e.g. osteoporosis, osteocarthritis, periodontal disease, liver
failure), surgery, including cosmetic plastic surgery, fibrosis,
reperfusion injury, or systemic cytokine damage.
[0533] Tissues that could be regenerated using the present
invention include organs (e.g., pancreas, liver, intestine, kidney,
skin, endothelium), muscle (smooth, skeletal or cardiac),
vasculature (including vascular and lymphatics), nervous,
hematopoietic, and skeletal (bone, cartilage, tendon, and ligament)
tissue. Preferably, regeneration occurs without or decreased
scarring. Regeneration also may include angiogenesis.
[0534] Moreover, PSGR polynucleotides or polypeptides, or agonists
or antagonists of PSGR, may increase regeneration of tissues
difficult to heal. For example, increased tendon/ligament
regeneration would quicken recovery time after damage. PSGR
polynucleotides or polypeptides, or agonists or antagonists of
PSGR, of the present invention could also be used prophylactically
in an effort to avoid damage. Specific diseases that could be
treated, prevented, and/or diagnosed include of tendinitis, carpal
tunnel syndrome, and other tendon or ligament defects. A further
example of tissue regeneration of non-healing wounds includes
pressure ulcers, ulcers associated with vascular insufficiency,
surgical, and traumatic wounds.
[0535] Similarly, nerve and brain tissue could also be regenerated
by using PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, to proliferate and differentiate nerve cells.
Diseases that could be treated, prevented, and/or diagnosed using
this method include central and peripheral nervous system diseases,
neuropathies, or mechanical and traumatic diseases, disorders,
and/or conditions (e.g., spinal cord disorders, head trauma,
cerebrovascular disease, and stoke). Specifically, diseases
associated with peripheral nerve injuries, peripheral neuropathy
(e.g., resulting from chemotherapy or other medical therapies),
localized neuropathies, and central nervous system diseases (e.g.,
Alzheimer's disease, Parkinson's disease, Huntington's disease,
amyotrophic lateral sclerosis, and Shy-Drager syndrome), could all
be treated, prevented, and/or diagnosed using the PSGR
polynucleotides or polypeptides, or agonists or antagonists of
PSGR.
Chemotaxis
[0536] PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, may have chemotaxis activity. A chemotaxic
molecule attracts or mobilizes cells (e.g., monocytes, fibroblasts,
neutrophils, T-cells, mast cells, eosinophils, epithelial and/or
endothelial cells) to a particular site in the body, such as
inflammation, infection, or site of hyperproliferation. The
mobilized cells can then fight off and/or heal the particular
trauma or abnormality.
[0537] PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, may increase chemotaxic activity of particular
cells. These chemotactic molecules can then be used to treat,
prevent, and/or diagnose inflammation, infection,
hyperproliferative diseases, disorders, and/or conditions, or any
immune system disorder by increasing the number of cells targeted
to a particular location in the body. For example, chemotaxic
molecules can be used to treat, prevent, and/or diagnose wounds and
other trauma to tissues by attracting immune cells to the injured
location. Chemotactic molecules of the present invention can also
attract fibroblasts, which can be used to treat, prevent, and/or
diagnose wounds.
[0538] It is also contemplated that PSGR polynucleotides or
polypeptides, or agonists or antagonists of PSGR, may inhibit
chemotactic activity. These molecules could also be used to treat,
prevent, and/or diagnose diseases, disorders, and/or conditions.
Thus, PSGR polynucleotides or polypeptides, or agonists or
antagonists of PSGR, could be used as an inhibitor of
chemotaxis.
Binding Activity
[0539] PSGR polypeptides may be used to screen for molecules that
bind to PSGR or for molecules to which PSGR binds. The binding of
PSGR and the molecule may activate (agonist), increase, inhibit
(antagonist), or decrease activity of the PSGR or the molecule
bound. Examples of such molecules include antibodies,
oligonucleotides, proteins (e.g., receptors), or small
molecules.
[0540] Preferably, the molecule is closely related to the natural
ligand of PSGR, e.g., a fragment of the ligand, or a natural
substrate, a ligand, a structural or functional mimetic. (See,
Coligan et al., Current Protocols in Immunology 1(2):Chapter 5
(1991).) The molecule can be rationally designed using known
techniques.
[0541] Preferably, the screening for these molecules involves
producing appropriate cells which express PSGR, either as a
secreted protein or on the cell membrane. Preferred cells include
cells from mammals, yeast, Drosophila, or E. coli. Cells expressing
PSGR (or cell membrane containing the expressed polypeptide) are
then preferably contacted with a test compound potentially
containing the molecule to observe binding, stimulation, or
inhibition of activity of PSGR or the molecule.
[0542] The assay may simply test binding of a candidate compound to
PSGR, wherein binding is detected by a label, or in an assay
involving competition with a labeled competitor. Further, the assay
may test whether the candidate compound results in a signal
generated by binding to PSGR.
[0543] Alternatively, the assay can be carried out using cell-free
preparations, polypeptide/molecule affixed to a solid support,
chemical libraries, or natural product mixtures. The assay may also
simply comprise the steps of mixing a candidate compound with a
solution containing PSGR, measuring PSGR/molecule activity or
binding, and comparing the PSGR molecule activity or binding to a
standard.
[0544] Preferably, an ELISA assay can measure PSGR level or
activity in a sample (e.g., biological sample) using a monoclonal
or polyclonal antibody. The antibody can measure PSGR level or
activity by either binding, directly or indirectly, to PSGR or by
competing PSGR for a substrate.
[0545] Additionally, the receptor to which PSGR binds can be
identified by numerous methods known to those of skill in the art,
for example, ligand panning and FACS sorting (Coligan, et al.,
Current Protocols in Immun., 1(2), Chapter 5, (1991)). For example,
expression cloning is employed wherein polyadenylated RNA is
prepared from a cell responsive to the polypeptides, for example,
NIH3T3 cells which are known to contain multiple receptors for the
FGF family proteins, and SC-3 cells, and a cDNA library created
from this RNA is divided into pools and used to transfect COS cells
or other cells that are not responsive to the polypeptides.
Transfected cells which are grown on glass slides are exposed to
the polypeptide of the present invention, after they have been
labelled. The polypeptides can be labeled by a variety of means
including iodination or inclusion of a recognition site for a
site-specific protein kinase.
[0546] Following fixation and incubation, the slides are subjected
to auto-radiographic analysis. Positive pools are identified and
sub-pools are prepared and re-transfected using an iterative
sub-pooling and re-screening process, eventually yielding a single
clones that encodes the putative receptor.
[0547] As an alternative approach for receptor identification, the
labeled polypeptides can be photoaffinity linked with cell membrane
or extract preparations that express the receptor molecule.
Cross-linked material is resolved by PAGE analysis and exposed to
X-ray film. The labeled complex containing the receptors of the
polypeptides can be excised, resolved into peptide fragments, and
subjected to protein microsequencing. The amino acid sequence
obtained from microsequencing would be used to design a set of
degenerate oligonucleotide probes to screen a cDNA library to
identify the genes encoding the putative receptors.
[0548] Moreover, the techniques of gene-shuffling, motif-shuffling,
exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA shuffling") may be employed to modulate the activities of PSGR
thereby effectively generating agonists and antagonists of PSGR.
See generally, U.S. Pat. Nos. 5,605,793, 5,811,238, 5,830,721,
5,834,252, and 5, 837,458, and Patten, P. A., et al., Curr. Opinion
Biotechnol. 8:724-33 (1997); Harayama, S. Trends Biotechnol.
16(2):76-82 (1998); Hansson, L. O., et al., J Mol. Biol. 287:265-76
(1999); and Lorenzo, M. M. and Blasco, R. Biotechniques
24(2):308-13 (1998) (each of these patents and publications are
hereby incorporated by reference). In one embodiment, alteration of
PSGR polynucleotides and corresponding polypeptides may be achieved
by DNA shuffling. DNA shuffling involves the assembly of two or
more DNA segments into a desired PSGR molecule by homologous, or
site-specific, recombination. In another embodiment, PSGR
polynucleotides and corresponding polypeptides may be altered by
being subjected to random mutagenesis by error-prone PCR, random
nucleotide insertion or other methods prior to recombination. In
another embodiment, one or more components, motifs, sections,
parts, domains, fragments, etc., of PSGR may be recombined with one
or more components, motifs, sections, parts, domains, fragments,
etc. of one or more heterologous molecules. In preferred
embodiments, the heterologous molecules are G-protein coupled
receptor family members. In further preferred embodiments, the
heterologous molecule is a growth factor such as, for example,
platelet-derived growth factor (PDGF), insulin-like growth factor
(IGF-I), transforming growth factor (TGF)-alpha, epidermal growth
factor (EGF), fibroblast growth factor (FGF), TGF-beta, bone
morphogenetic protein (BMP)-2, BMP-4, BMP-5, BMP-6, BMP-7, activins
A and B, decapentaplegic(dpp), 60A, OP-2, dorsalin, growth
differentiation factors (GDFs), nodal, MIS, inhibin-alpha,
TGF-beta1, TGF-beta2, TGF-beta3, TGF-beta5, and glial-derived
neurotrophic factor (GDNF).
[0549] Other preferred fragments are biologically active PSGR
fragments. Biologically active fragments are those exhibiting
activity similar, but not necessarily identical, to an activity of
the PSGR polypeptide. The biological activity of the fragments may
include an improved desired activity, or a decreased undesirable
activity.
[0550] Additionally, this invention provides a method of screening
compounds to identify those which modulate the action of the
polypeptide of the present invention. An example of such an assay
comprises combining a mammalian fibroblast cell, a polypeptide of
the present invention, the compound to be screened and .sup.3[H]
thymidine under cell culture conditions where the fibroblast cell
would normally proliferate. A control assay may be performed in the
absence of the compound to be screened and compared to the amount
of fibroblast proliferation in the presence of the compound to
determine if the compound stimulates proliferation by determining
the uptake of .sup.3[H] thymidine in each case. The amount of
fibroblast cell proliferation is measured by liquid scintillation
chromatography which measures the incorporation of .sup.3[R]
thymidine. Both agonist and antagonist compounds may be identified
by this procedure.
[0551] In another method, a mammalian cell or membrane preparation
expressing a receptor for a polypeptide of the present invention is
incubated with a labeled polypeptide of the present invention in
the presence of the compound. The ability of the compound to
enhance or block this interaction could then be measured.
Alternatively, the response of a known second messenger system
following interaction of a compound to be screened and the PSGR
receptor is measured and the ability of the compound to bind to the
receptor and elicit a second messenger response is measured to
determine if the compound is a potential agonist or antagonist.
Such second messenger systems include but are not limited to, cAMP
guanylate cyclase, ion channels or phosphoinositide hydrolysis.
[0552] All of these above assays can be used as diagnostic or
prognostic markers. The molecules discovered using these assays can
be used to treat, prevent, and/or diagnose disease or to bring
about a particular result in a patient (e.g., blood vessel growth)
by activating or inhibiting the polypeptide/molecule. Moreover, the
assays can discover agents which may inhibit or enhance the
production of the polypeptides of the invention from suitably
manipulated cells or tissues. Therefore, the invention includes a
method of identifying compounds which bind to PSGR comprising the
steps of: (a) incubating a candidate binding compound with PSGR;
and (b) determining if binding has occurred. Moreover, the
invention includes a method of identifying agonists/antagonists
comprising the steps of: (a) incubating a candidate compound with
PSGR, (b) assaying a biological activity, and (b) determining if a
biological activity of PSGR has been altered.
[0553] Also, one could identify molecules bind PSGR experimentally
by using the beta-pleated sheet regions disclosed in FIG. 3 and
Table 1. Accordingly, specific embodiments of the invention are
directed to polynucleotides encoding polypeptides which comprise,
or alternatively consist of, the amino acid sequence of each beta
pleated sheet regions disclosed in FIG. 3/Table 1. Additional
embodiments of the invention are directed to polynucleotides
encoding PSGR polypeptides which comprise, or alternatively consist
of, any combination or all of the beta pleated sheet regions
disclosed in FIG. 3/Table 1. Additional preferred embodiments of
the invention are directed to polypeptides which comprise, or
alternatively consist of, the PSGR amino acid sequence of each of
the beta pleated sheet regions disclosed in FIG. 3/Table 1.
Additional embodiments of the invention are directed to PSGR
polypeptides which comprise, or alternatively consist of, any
combination or all of the beta pleated sheet regions disclosed in
FIG. 3/Table 1.
Targeted Delivery
[0554] In another embodiment, the invention provides a method of
delivering compositions to targeted cells expressing a PSGR
polypeptide of the invention.
[0555] As discussed herein, polypeptides or antibodies of the
invention may be associated with heterologous polypeptides,
heterologous nucleic acids, toxins, or prodrugs via hydrophobic,
hydrophilic, ionic and/or covalent interactions. In one embodiment,
the invention provides a method for the specific delivery of
compositions of the invention to cells by administering
polypeptides of the invention (including antibodies) that are
associated with heterologous polypeptides or nucleic acids. In one
example, the invention provides a method for delivering a
therapeutic protein into the targeted cell. In another example, the
invention provides a method for delivering a single stranded
nucleic acid (e.g., antisense or ribozymes) or double stranded
nucleic acid (e.g., DNA that can integrate into the cell's genome
or replicate episomally and that can be transcribed) into the
targeted cell.
[0556] In another embodiment, the invention provides a method for
the specific destruction of cells (e.g., the destruction of tumor
cells) by administering polypeptides of the invention (e.g.,
polypeptides of the invention or antibodies of the invention) in
association with toxins or cytotoxic prodrugs.
[0557] In a specific embodiment, the invention provides a method
for the specific destruction of prostate cells by administering
polypeptides of the invention (e.g., polypeptides of the invention
or antibodies of the invention) in association with toxins or
cytotoxic prodrugs.
[0558] In a preferred embodiment, the invention provides a method
for the specific destruction of aberrant or diseased prostate cells
by administering polypeptides of the invention (e.g., polypeptides
of the invention or antibodies of the invention) in association
with toxins or cytotoxic prodrugs.
[0559] By "toxin" is meant compounds that bind and activate
endogenous cytotoxic effector systems, radioisotopes, holotoxins,
modified toxins, catalytic subunits of toxins, or any molecules or
enzymes not normally present in or on the surface of a cell that
under defined conditions cause the cell's death. Toxins that may be
used according to the methods of the invention include, but are not
limited to, radioisotopes known in the art, compounds such as, for
example, antibodies (or complement fixing containing portions
thereof) that bind an inherent or induced endogenous cytotoxic
effector system, thymidine kinase, endonuclease, RNAse, alpha
toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin,
saporin, momordin, gelonin, pokeweed antiviral protein,
alpha-sarcin and cholera toxin. By "cytotoxic prodrug" is meant a
non-toxic compound that is converted by an enzyme, normally present
in the cell, into a cytotoxic compound. Cytotoxic prodrugs that may
be used according to the methods of the invention include, but are
not limited to, glutamyl derivatives of benzoic acid mustard
alkylating agent, phosphate derivatives of etoposide or mitomycin
C, cytosine arabinoside, daunorubisin, and phenoxyacetamide
derivatives of doxorubicin.
Drug Screening
[0560] Further contemplated is the use of the polypeptides of the
present invention, or the polynucleotides encoding these
polypeptides, to screen for molecules which modify the activities
of the polypeptides of the present invention. Such a method would
include contacting the polypeptide of the present invention with a
selected compound(s) suspected of having antagonist or agonist
activity, and assaying the activity of these polypeptides following
binding.
[0561] This invention is particularly useful for screening
therapeutic compounds by using the polypeptides of the present
invention, or binding fragments thereof, in any of a variety of
drug screening techniques. The polypeptide or fragment employed in
such a test may be affixed to a solid support, expressed on a cell
surface, free in solution, or located intracellularly. One method
of drug screening utilizes eukaryotic or prokaryotic host cells
which are stably transformed with recombinant nucleic acids
expressing the polypeptide or fragment. Drugs are screened against
such transformed cells in competitive binding assays. One may
measure, for example, the formulation of complexes between the
agent being tested and a polypeptide of the present invention.
[0562] Thus, the present invention provides methods of screening
for drugs or any other agents which affect activities mediated by
the polypeptides of the present invention. These methods comprise
contacting such an agent with a polypeptide of the present
invention or a fragment thereof and assaying for the presence of a
complex between the agent and the polypeptide or a fragment
thereof, by methods well known in the art. In such a competitive
binding assay, the agents to screen are typically labeled.
Following incubation, free agent is separated from that present in
bound form, and the amount of free or uncomplexed label is a
measure of the ability of a particular agent to bind to the
polypeptides of the present invention.
[0563] Another technique for drug screening provides high
throughput screening for compounds having suitable binding affinity
to the polypeptides of the present invention, and is described in
great detail in European Patent Application 84/03564, published on
Sep. 13, 1984, which is incorporated herein by reference herein.
Briefly stated, large numbers of different small peptide test
compounds are synthesized on a solid substrate, such as plastic
pins or some other surface. The peptide test compounds are reacted
with polypeptides of the present invention and washed. Bound
polypeptides are then detected by methods well known in the art.
Purified polypeptides are coated directly onto plates for use in
the aforementioned drug screening techniques. In addition,
non-neutralizing antibodies may be used to capture the peptide and
immobilize it on the solid support.
[0564] This invention also contemplates the use of competitive drug
screening assays in which neutralizing antibodies capable of
binding polypeptides of the present invention specifically compete
with a test compound for binding to the polypeptides or fragments
thereof. In this manner, the antibodies are used to detect the
presence of any peptide which shares one or more antigenic epitopes
with a polypeptide of the invention.
Antisense and Ribozyme (Antagonists)
[0565] In specific embodiments, antagonists according to the
present invention are nucleic acids corresponding to the sequences
contained in SEQ ID NO: 1, or the complementary strand thereof,
and/or to nucleotide sequences contained in the deposited clone
97131. In one embodiment, antisense sequence is generated
internally, by the organism, in another embodiment, the antisense
sequence is separately administered (see, for example, O'Connor,
J., Neurochem. 56:560 (1991). Oligodeoxynucleotides as Anitsense
Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988).
Antisense technology can be used to control gene expression through
antisense DNA or RNA, or through triple-helix formation. Antisense
techniques are discussed for example, in Okano, J., Neurochem.
56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of
Gene Expression, CRC Press, Boca Raton, Fla. (1988). Triple helix
formation is discussed in, for instance, Lee et al., Nucleic Acids
Research 6:3073 (1979); Cooney et al., Science 241:456 (1988); and
Dervan et al., Science 251:1300 (1991). The methods are based on
binding of a polynucleotide to a complementary DNA or RNA.
[0566] For example, the use of c-myc and c-myb antisense RNA
constructs to inhibit the growth of the non-lymphocytic leukemia
cell line HL-60 and other cell lines was previously described.
(Wickstrom et al. (1988); Anfossi et al. (1989)). These experiments
were performed in vitro by incubating cells with the
oligoribonucleotide. A similar procedure for in vivo use is
described in WO 91/15580. Briefly, a pair of oligonucleotides for a
given antisense RNA is produced as follows: A sequence
complimentary to the first 15 bases of the open reading frame is
flanked by an EcoRl site on the 5' end and a HindIII site on the 3'
end. Next, the pair of oligonucleotides is heated at 90.degree. C.
for one minute and then annealed in 2.times.ligation buffer (20 mM
TRIS HCl pH 7.5, 10 mM MgCl2, 10 MM dithiotlhreitol (DTT) and 0.2
mM ATP) and then ligated to the EcoR1/Hind III site of the
retroviral vector PMV7 (WO 91/15580).
[0567] For example, the 5' coding portion of a polynucleotide that
encodes the mature polypeptide of the present invention may be used
to design an antisense RNA oligonucleotide of from about 10 to 40
base pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in transcription
thereby preventing transcription and the production of the
receptor. The antisense RNA oligonucleotide hybridizes to the mRNA
in vivo and blocks translation of the mRNA molecule into receptor
polypeptide.
[0568] In one embodiment, the PSGR antisense nucleic acid of the
invention is produced intracellularly by transcription from an
exogenous sequence. For example, a vector or a portion thereof, is
transcribed, producing an antisense nucleic acid (RNA) of the
invention. Such a vector would contain a sequence encoding the PSGR
antisense nucleic acid. Such a vector can remain episomal or become
chromosomally integrated, as long as it can be transcribed to
produce the desired antisense RNA. Such vectors can be constructed
by recombinant DNA technology methods standard in the art. Vectors
can be plasmid, viral, or others known in the art, used for
replication and expression in vertebrate cells. Expression of the
sequence encoding PSGR, or fragments thereof, can be by any
promoter known in the art to act in vertebrate, preferably human
cells. Such promoters can be inducible or constitutive. Such
promoters include, but are not limited to, the SV40 early promoter
region (Bernoist and Chambon, Nature 29:304-310 (1981), the
promoter contained in the 3' long terminal repeat of Rous sarcoma
virus (Yamamoto et al., Cell 22:787-797 (1980), the herpes
thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A.
78:1441-1445 (1981), the regulatory sequences of the
metallothionein gene (Brinster, et al., Nature 296:39-42 (1982)),
etc.
[0569] The antisense nucleic acids of the invention comprise a
sequence complementary to at least a portion of an RNA transcript
of a PSGR gene. However, absolute complementarity, although
preferred, is not required. A sequence "complementary to at least a
portion of an RNA," referred to herein, means a sequence having
sufficient complementarity to be able to hybridize with the RNA,
forming a stable duplex; in the case of double stranded PSGR
antisense nucleic acids, a single strand of the duplex DNA may thus
be tested, or triplex formation may be assayed. The ability to
hybridize will depend on both the degree of complementarity and the
length of the antisense nucleic acid. Generally, the larger the
hybridizing nucleic acid, the more base mismatches with a PSGR RNA
it may contain and still form a stable duplex (or triplex as the
case may be). One skilled in the art can ascertain a tolerable
degree of mismatch by use of standard procedures to determine the
melting point of the hybridized complex.
[0570] Oligonucleotides that are complementary to the 5' end of the
message, e.g., the 5' untranslated sequence up to and including the
AUG initiation codon, should work most efficiently at inhibiting
translation. However, sequences complementary to the 3'
untranslated sequences of mRNAs have been shown to be effective at
inhibiting translation of mRNAs as well. See generally, Wagner, R.,
1994, Nature 372:333-335. Thus, oligonucleotides complementary to
either the 5'- or 3'- non-translated, non-coding regions of PSGR
shown in Figures IA-B could be used in an antisense approach to
inhibit translation of endogenous PSGR mRNA. Oligonucleotides
complementary to the 5' untranslated region of the mRNA should
include the complement of the AUG start codon. Antisense
oligonucleotides complementary to mRNA coding regions are less
efficient inhibitors of translation but could be used in accordance
with the invention. Whether designed to hybridize to the 5'-, 3'-
or coding region of PSGR mRNA, antisense nucleic acids should be at
least six nucleotides in length, and are preferably
oligonucleotides ranging from 6 to about 50 nucleotides in length.
In specific aspects the oligonucleotide is at least 10 nucleotides,
at least 17 nucleotides, at least 25 nucleotides or at least 50
nucleotides.
[0571] The polynucleotides of the invention can be DNA or RNA or
chimeric mixtures or derivatives or modified versions thereof,
single-stranded or double-stranded. The oligonucleotide can be
modified at the base moiety, sugar moiety, or phosphate backbone,
for example, to improve stability of the molecule, hybridization,
etc. The oligonucleotide may include other appended groups such as
peptides (e.g., for targeting host cell receptors in vivo), or
agents facilitating transport across the cell membrane (see, e.g.,
Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556;
Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT
Publication No. WO88/09810, published Dec. 15, 1988) or the
blood-brain barrier (see, e.g., PCT Publication No. WO89/10134,
published Apr. 25, 1988), hybridization-triggered cleavage agents.
(See, e.g., Krol et al., 1988, BioTechniques 6:958-976) or
intercalating agents. (See, e.g., Zon, 1988, Pharm. Res.
5:539-549). To this end, the oligonucleotide may be conjugated to
another molecule, e.g., a peptide, hybridization triggered
cross-linking agent, transport agent, hybridization-triggered
cleavage agent, etc.
[0572] The antisense oligonucleotide may comprise at least one
modified base moiety which is selected from the group including,
but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1
-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine.
[0573] The antisense oligonucleotide may also comprise at least one
modified sugar moiety selected from the group including, but not
limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
[0574] In yet another embodiment, the antisense oligonucleotide
comprises at least one modified phosphate backbone selected from
the group including, but not limited to, a phosphorothioate, a
phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a
phosphordiamidate, a methylphosphonate, an alkyl phosphotriester,
and a formacetal or analog thereof.
[0575] In yet another embodiment, the antisense oligonucleotide is
an a-anomeric oligonucleotide. An a-anomeric oligonucleotide forms
specific double-stranded hybrids with complementary RNA in which,
contrary to the usual b-units, the strands run parallel to each
other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The
oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al., 1987,
Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue
(Inoue et al., 1987, FEBS Lett. 215:327-330).
[0576] Polynucleotides of the invention may be synthesized by
standard methods known in the art, e.g. by use of an automated DNA
synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides may be synthesized by the method of Stein et al.
(1988, Nucl. Acids Res. 16:3209), methylphosphonate
oligonucleotides can be prepared by use of controlled pore glass
polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A.
85:7448-7451), etc.
[0577] While antisense nucleotides complementary to the PSGR coding
region sequence could be used, those complementary to the
transcribed untranslated region are most preferred.
[0578] Potential antagonists according to the invention also
include catalytic RNA, or a ribozyme (See, e.g., PCT International
Publication WO 90/11364, published Oct. 4, 1990; Sarver et al,
Science 247:1222-1225 (1990). While ribozymes that cleave mRNA at
site specific recognition sequences can be used to destroy PSGR
mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead
ribozymes cleave mRNAs at locations dictated by flanking regions
that form complementary base pairs with the target mRNA. The sole
requirement is that the target mRNA have the following sequence of
two bases: 5'-UG-3'. The construction and production of hammerhead
ribozymes is well known in the art and is described more fully in
Haseloff and Gerlach, Nature 334:585-591 (1988). There are numerous
potential hammerhead ribozyme cleavage sites within the nucleotide
sequence of PSGR (FIGS. 1A-B). Preferably, the ribozyme is
engineered so that the cleavage recognition site is located near
the 5' end of the PSGR mRNA; i.e., to increase efficiency and
minimize the intracellular accumulation of non-functional mRNA
transcripts.
[0579] As in the antisense approach, the ribozymes of the invention
can be composed of modified oligonucleotides (e.g. for improved
stability, targeting, etc.) and should be delivered to cells which
express PSGR in vivo. DNA constructs encoding the ribozyme may be
introduced into the cell in the same manner as described above for
the introduction of antisense encoding DNA. A preferred method of
delivery involves using a DNA construct "encoding" the ribozyme
under the control of a strong constitutive promoter, such as, for
example, pol III or pol II promoter, so that transfected cells will
produce sufficient quantities of the ribozyme to destroy endogenous
PSGR messages and inhibit translation. Since ribozymes unlike
antisense molecules, are catalytic, a lower intracellular
concentration is required for efficiency.
[0580] Antagonist/agonist compounds may be employed to inhibit the
cell growth and proliferation effects of the polypeptides of the
present invention on neoplastic cells and tissues, i.e. stimulation
of angiogenesis of tumors, and, therefore, retard or prevent
abnormal cellular growth and proliferation, for example, in tumor
formation or growth.
[0581] The antagonist/agonist may also be employed to prevent
hyper-vascular diseases, and prevent the proliferation of
epithelial lens cells after extracapsular cataract surgery.
Prevention of the mitogenic activity of the polypeptides of the
present invention may also be desirous in cases such as restenosis
after balloon angioplasty.
[0582] The antagonist/agonist may also be employed to prevent the
growth of scar tissue during wound healing.
[0583] The antagonist/agonist may also be employed to treat the
diseases described herein.
[0584] Thus, the invention provides a method of treating or
preventing diseases, disorders, and/or conditions, including but
not limited to the diseases, disorders, and/or conditions listed
throughout this application, associated with overexpression of a
polynucleotide of the present invention by administering to a
patient (a) an antisense molecule directed to the polynucleotide of
the present invention, and/or (b) a ribozyme directed to the
polynucleotide of the present invention.
Other Activities
[0585] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention, as a result of the ability to stimulate vascular
endothelial cell growth, may be employed in treatment for
stimulating re-vascularization of ischemic tissues due to various
disease conditions such as thrombosis, arteriosclerosis, and other
cardiovascular conditions. The polypeptide, polynucleotide,
agonist, or antagonist of the present invention may also be
employed to stimulate angiogenesis and limb regeneration, as
discussed above.
[0586] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed for treating, preventing,
and/or diagnosing wounds due to injuries, burns, post-operative
tissue repair, and ulcers since they are mitogenic to various cells
of different origins, such as fibroblast cells and skeletal muscle
cells, and therefore, facilitate the repair or replacement of
damaged or diseased tissue.
[0587] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed stimulate neuronal growth
and to treat and prevent neuronal damage which occurs in certain
neuronal diseases, disorders, and/or conditions or
neuro-degenerative conditions such as Alzheimer's disease,
Parkinson's disease, and AIDS-related complex. A polypeptide,
polynucleotide, agonist, or antagonist of the present invention may
have the ability to stimulate chondrocyte growth, therefore, they
may be employed to enhance bone and periodontal regeneration and
aid in tissue transplants or bone grafts.
[0588] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may be also be employed to prevent skin aging due
to sunburn by stimulating keratinocyte growth.
[0589] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed for preventing hair loss,
since FGF family members activate hair-forming cells and promotes
melanocyte growth. Along the same lines, a polypeptide,
polynucleotide, agonist, or antagonist of the present invention may
be employed to stimulate growth and differentiation of
hematopoietic cells and bone marrow cells when used in combination
with other cytokines.
[0590] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed to maintain organs before
transplantation or for supporting cell culture of primary tissues.
A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed for inducing tissue of
mesodermal origin to differentiate in early embryos.
[0591] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also increase or decrease the differentiation
or proliferation of embryonic stem cells, besides, as discussed
above, hematopoietic lineage.
[0592] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be used to modulate mammalian
characteristics, such as body height, weight, hair color, eye
color, skin, percentage of adipose tissue, pigmentation, size, and
shape (e.g., cosmetic surgery). Similarly, a polypeptide,
polynucleotide, agonist, or antagonist of the present invention may
be used to modulate mammalian metabolism affecting catabolism,
anabolism, processing utilization, and storage of energy.
[0593] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may be used to change a mammal's mental state or
physical state by influencing biorhythms, caricadic rhythms,
depression (including depressive diseases, disorders, and/or
conditions), tendency for violence, tolerance for pain,
reproductive capabilities (preferably by Activin or Inhibin-like
activity), hormonal or endocrine levels, appetite, libido, memory,
stress, or other cognitive qualities.
[0594] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be used as a food additive or
preservative, such as to increase or decrease storage capabilities,
fat content, lipid, protein, carbohydrate, vitamins, minerals,
cofactors or other nutritional components.
[0595] The above-recited applications have uses in a wide variety
of hosts. Such hosts include, but are not limited to, human,
murine, rabbit, goat, guinea pig, camel, horse, mouse, rat,
hamster, pig, micro-pig, chicken, goat, cow, sheep, dog, cat,
non-human primate, and human. In specific embodiments, the host is
a mouse, rabbit, goat, guinea pig, chicken, rat, hamster, pig,
sheep, dog or cat. In preferred embodiments, the host is a mammal.
In most preferred embodiments, the host is a human.
[0596] Having generally described the invention, the same will be
more readily understood by reference to the following examples,
which are provided by way of illustration and are not intended as
limiting.
EXAMPLE 1
Expression and Purification of a Soluble Portion of PSGR in E.
coli
[0597] The bacterial expression vector pQE60 is used for bacterial
expression in this example. (QIAGEN, Inc., 9259 Eton Avenue,
Chatsworth, Calif., 91311). pQE60 encodes ampicillin antibiotic
resistance ("Amp") and contains a bacterial origin of replication
("ori"), an IPTG inducible promoter, a ribosome binding site
("RBS"), six codons encoding histidine residues that allow affinity
purification using nickel-nitrilo-tri-acetic acid ("Ni-NTA")
affinity resin sold by QIAGEN, Inc., supra, and suitable single
restriction enzyme cleavage sites. These elements are arranged such
that a DNA fragment encoding a polypeptide may be inserted in such
as way as to produce that polypeptide with the six His residues
(i.e., a "6.times.His tag") covalently linked to the carboxyl
terminus of that polypeptide.
[0598] The DNA sequence encoding the desired portion of the PSGR
protein is amplified from the deposited cDNA clone using PCR
oligonucleotide primers which anneal to the amino terminal
sequences of the desired portion of the PSGR protein or to the
carboxy terminal sequences of the desired portion of the PSGR
protein. Additional nucleotides containing restriction sites to
facilitate cloning in the pQE60 vector are added to the 5' and 3'
sequences, respectively.
[0599] For cloning the portion of PSGR from Arg-262 to Lys-321, the
5' primer has the sequence: 5'-ACTGCCATGGGCCGCTTTGGAAACAGCCTTCAT-3'
(SEQ ID NO:4) containing the underlined NcoI restriction site
followed by nucleotides complementary to the coding sequence
starting at Arg-262 of the PSGR in FIGS. 1A-B. One of ordinary
skill in the art would appreciate, of course, that the point in the
protein coding sequence where the 5' primer begins may be varied to
amplify a desired portion of the complete protein shorter or longer
than that described herein.
[0600] The 3' primer has the sequence: 5'-
GTACAGATCTCTTGCCTCCCACAGCCTG -3'
[0601] (SEQ ID NO:5) containing the underlined BglII site followed
by nucleotides complementary to 3' sequences in the PSGR DNA
sequence in FIGS. 1A-B.
[0602] The amplified PSGR DNA fragments and the vector pQE60 are
digested with Nco I and BglII and the digested-DNAs then ligated
together. Insertion of the PSGR protein DNA into the restricted
pQE60 vector places the PSGR protein coding region (including its
associated stop codon) downstream from the IPTG-inducible promoter
and in-frame with an initiating AUG. The associated stop codon
prevents translation of the six histidine codons downstream of the
insertion point.
[0603] The ligation mixture is transformed into competent E. coli
cells using standard procedures. Such procedures are described in
Sambrook et al., Molecular Cloning: a Laboratory Manual, 2nd Ed.;
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989). E. coli strain M15/rep4, containing multiple copies of the
plasmid pREP4, which expresses lac repressor and confers kanamycin
resistance ("Kan.sup.r"), is used in carrying out the illustrative
example described herein. This strain, which is only one of many
that are suitable for expressing PSGR protein, is available
commercially from Qiagen, Inc., supra.
[0604] Transformants are identified by their ability to grow on LB
plates in the presence of ampicillin and kanamycin. Plasmid DNA is
isolated from resistant colonies and the identity of the cloned DNA
confirmed by restriction analysis, PCR, and DNA sequencing.
[0605] Clones containing the desired constructs are grown overnight
("O/N") in liquid culture in LB media supplemented with both
ampicillin (100 ug/ml) and kanamycin (25 ug/ml). The O/N culture is
used to inoculate a large culture, at a dilution of approximately
1:100 to 1:250. The cells are grown to an optical density at 600 nm
("OD600") of between 0.4 and 0.6.
Isopropyl-B-D-thiogalactopyranoside ("IPTG") is then added to a
final concentration of 1 mM to induce transcription from the lac
repressor sensitive promoter, by inactivating the lacI repressor.
Cells subsequently are incubated further for 3 to 4 hours. Cells
then are harvested by centrifugation.
[0606] The cells are then stirred for 3-4 hours at 4.degree. C. in
6M guanidine-HCl, pH8. The cell debris is removed by
centrifugation, and the supernatant containing the PSGR is loaded
onto a nickel-nitrilo-tri-acetic acid ("NiNTA") affinity resin
column (available from QIAGEN, Inc., supra). Proteins with a
6.times.His tag bind to the NI-NTA resin with high affinity and can
be purified in a simple one-step procedure (for details see: The
QIAexpressionist, 1995, QIAGEN, Inc., supra). Briefly the
supernatant is loaded onto the column in 6 M guanidine-HCl, pH8,
the column is first washed with 10 volumes of 6 M guanidine-HCl,
pH8, then washed with 10 volumes of 6 M guanidine-HCl pH6, and
finally the PSGR is eluted with 6 M guanidine-HCl, pH5.
[0607] The purified protein is then renatured by dialyzing it
against phosphatebuffered saline (PBS) or 50 mM Na-acetate, pH 6
buffer plus 200 mM NaCl. Alternatively, the protein can be
successfully refolded while immobilized on the Ni-NTA column. The
recommended conditions are as follows: renature using a linear
6M-1M urea gradient in 500 mM NaCl, 20% glycerol, 20 mM Tris/HCl
pH7.4, containing protease inhibitors. The renaturation should be
performed over a period of 1.5 hours or more. After renaturation
the proteins can be eluted by the addition of 250 mM immidazole.
Immidazole is removed by a final dialyzing step against PBS or 50
mM sodium acetate pH6 buffer plus 200 mM NaCl. The purified protein
is stored at 4.degree. C. or frozen at -80.degree. C.
EXAMPLE 2
Cloning and Expression of PSGR in a Baculovirus Expression
System
[0608] In this illustrative example, the plasmid shuttle vector pA2
is used to insert the cloned DNA encoding the complete protein,
including its naturally associated secretary signal (leader)
sequence, into a baculovirus to express the mature PSGR protein,
using standard methods as described in Summers et al., A Manual of
Methods for Baculovirus Vectors and Insect Cell Culture Procedures,
Texas Agricultural Experimental Station Bulletin No. 1555 (1987).
This expression vector contains the strong polyhedrin promoter of
the Autographa californica nuclear polyhedrosis virus (AcMNPV)
followed by convenient restriction sites such as BamHI and Asp718.
The polyadenylation site of the simian virus 40 ("SV40") is used
for efficient polyadenylation. For easy selection of recombinant
virus, the plasmid contains the beta-galactosidase gene from E.
coli under control of a weak Drosophila promoter in the same
orientation, followed by the polyadenylation signal of the
polyhedrin gene. The inserted genes are flanked on both sides by
viral sequences for cell-mediated homologous recombination with
wild-type viral DNA to generate viable virus that express the
cloned polynucleotide.
[0609] Many other baculovirus vectors could be used in place of the
vector above, such as pAc373, pVL941 and pAcIM1, as one skilled in
the art would readily appreciate, as long as the construct provides
appropriately located signals for transcription, translation,
secretion and the like, including a signal peptide and an in-frame
AUG as required. Such vectors are described, for instance, in
Luckow et al, Virology 170:31-39 (1989).
[0610] The cDNA sequence encoding the full length PSGR receptor
protein in the deposited clone shown in FIGS. 1A-B (SEQ ID NO:2),
is amplified using PCR oligonucleotide primers corresponding to the
5' and 3' sequences of the gene.
[0611] The 5' primer has the sequence
5'-GCTAGTCTAGATCCGCCATCATGAGTTCCTGCAACTTC-3' (SEQ ID NO:6)
containing the underlined Xba I restriction enzyme site, an
efficient signal for initiation of translation in eukaryotic cells,
as described by M. Kozak, J Mol. Biol. 196:947-950 (1987), followed
by bases of the sequence of the full length PSGR protein shown in
FIGS. 1A-B, beginning with the indicated N-terminus of the
protein.
[0612] The 3' primer for PSGR has the sequence
5'-GCAGCAGGTACCTCACTTGCCTCCCACAGC-3' (SEQ ID NO:7) containing the
underlined Asp 718 restriction site followed by nucleotides
complementary to the 3' end of the coding sequence in FIGS.
1A-B.
[0613] The amplified fragment is isolated from a 1% agarose gel
using a commercially available kit ("Geneclean, " BIO 101 Inc., La
Jolla, Calif.) The fragment then is digested with Xba I and Asp 718
and again is purified on a 1% agarose gel. This fragment is
designated "F1."
[0614] The plasmid is digested with the restriction enzyme Xba I
and Asp718 and optionally can be dephosphorylated using calf
intestinal phosphatase, using routine procedures known in the art.
The DNA is then isolated from a 1% agarose gel using a commercially
available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). The vector
DNA is designated herein "VI."
[0615] Fragment F1 and the dephosphorylated plasmid V1 are ligated
together with T4 DNA ligase. E. coli HB 101 or other suitable E.
coli hosts such as XL-1 Blue (Stratagene Cloning Systems, La Jolla,
Calif.) cells are transformed with the ligation mixture and spread
on culture plates. Bacteria are identified that contain the plasmid
with the human PSGR gene using the PCR method, in which one of the
primers that is used to amplify the gene and the second primer is
from well within the vector so that only those bacterial colonies
containing the PSGR gene fragment will show amplification of the
DNA. The sequence of the cloned fragment is confirmed by DNA
sequencing. This plasmid is designated herein pBac PSGR.
[0616] Five ug of the plasmid pBac PSGR is co-transfected with 1.0
ug of a commercially available linearized baculovirus DNA
("BaculoGold.TM. baculovirus DNA", Pharmingen, San Diego, Calif.),
using the lipofectin method described by Felgner et al., Proc.
Natl. Acad. Sci. USA 84:7413-7417 (1987). 1 ug of BaculoGold.TM.
virus DNA and 5 ug of the plasmid pBac PSGR are mixed in a sterile
well of a microliter plate containing 50 ul of serum free Grace's
medium (Life Technologies, Inc., Rockville, Md.). Afterwards, 10 ul
Lipofectin plus 90.sub.--1 Grace's medium are added, mixed, and
incubated for 15 minutes at room temperature. Then, the
transfection mixture is added drop-wise to Sf9 insect cells (ATCC
CRL 1711) seeded in a 35 nun tissue culture plate with 1 ml Grace's
medium without serum. The plate is rocked back and forth to mix the
newly added solution. The plate is then incubated for 5 hours at
27.degree. C. After 5 hours, the transfection solution is removed
from the plate and 1 ml of Grace's insect medium supplemented with
10% fetal calf serum is added. The plate is put back into an
incubator and cultivation is continued at 27.degree. C. for four
days.
[0617] After four days, the supernatant is collected and a plaque
assay is performed, as described by Summers and Smith, cited above.
An agarose gel with "Blue Gal" (Life Technologies, Inc., Rockville,
Md.) is used to allow easy identification and isolation of
gal-expressing clones, which produce blue-stained plaques. (A
detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies, Inc., Rockville,
Md., pages 9-10). After appropriate incubation, blue stained
plaques are picked with the tip of a micropipettor (e.g.,
Eppendorf). The agar containing the recombinant viruses is then
resuspended in a microcentrifuge tube containing 200 ul of Grace's
medium and the suspension containing the recombinant baculovirus is
used to infect Sf9 cells seeded in 35 mm dishes. Four days later
the supernatants of these culture dishes are harvested and then
they are stored at 4.degree. C. The recombinant virus is called
V-PSGR.
[0618] To verify the expression of the PSGR gene, Sf9 cells are
grown in Grace's medium supplemented with 10% heat inactivated FBS.
The cells are infected with the recombinant baculovirus V-PSGR at a
multiplicity of infection ("MOI") of about 2. Six hours later the
medium is removed and is replaced with SF900 II medium minus
methionine and cysteine (available from Life Technologies, Inc.,
Rockville, Md.). If radiolabeled proteins are desired, 42 hours
later, 5 uCi of .sup.35S-methionine and 5 uCi .sup.35S-cysteine
(available from Amersham) are added. The cells are further
incubated for 16 hours and then they are harvested by
centrifugation. The proteins in the supernatant as well as the
intracellular proteins are analyzed by SDS-PAGE followed by
autoradiography (if radiolabeled). Microsequencing of the amino
acid sequence of the amino terminus of purified protein may be used
to determine the amino terminal sequence of the mature protein and
thus the cleavage point and length of the secretory signal
peptide.
EXAMPLE 3
Cloning and Expression of the PSGR Receptor in Mammalian Cells
[0619] A typical mammalian expression vector contains the promoter
element, which mediates the initiation of transcription of mRNA,
the protein coding sequence, and signals required for the
termination of transcription and polyadenylation of the transcript.
Additional elements include enhancers, Kozak sequences and
intervening sequences flanked by donor and acceptor sites for RNA
splicing. Highly efficient transcription can be achieved with the
early and late promoters from SV40, the long terminal repeats
(LTRs) from Retroviruses, e.g. RSV, HTLVI, HIVI and the early
promoter of the cytomegalovirus (CMV). However, cellular signals
can also be used (e.g., the human actin promoter). Suitable
expression vectors for use in practicing the present invention
include, for example, vectors such as pSVL and pMSG (Pharmacia,
Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and
pBC12MI (ATCC 67109). Mammalian host cells that could be used
include, human Hela 293, H9 and Jurkat cells, mouse NIH3T3 and C127
cells, Cos 1, Cos 7 and CV1, quail QC1-3 cells, mouse L cells, and
Chinese hamster ovary (CHO) cells.
[0620] Alternatively, the gene can be expressed in stable cell
lines that contain the gene integrated into a chromosome.
Co-transfection with a selectable marker such as dhfr, gpt,
neomycin, or hygromycin allows the identification and isolation of
the transfected cells.
[0621] The transfected gene can also be amplified to express large
amounts of the encoded protein. The dihydrofolate reductase (DHFR)
marker is useful to develop cell lines that carry several hundred
or even several thousand copies of the gene of interest. Another
useful selection marker is the enzyme glutamine synthase (GS)
(Murphy et al., Biochem. J. 227:277-279 (1991); Bebbington et al.,
Bio/Technology 10:169-175 (1992)). Using these markers, the
mammalian cells are grown in selective medium and the cells with
the highest resistance selected. These cell lines contain the
amplified gene(s) integrated into a chromosome. Chinese hamster
ovary (CHO) cells are often used for the production of
proteins.
[0622] The expression vectors pC1 and pC4 contain the strong
promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular
and Cellular Biology 5:438-447 (March 1985)), plus a fragment of
the CMV-enhancer (Boshart et al, Cell 41:521-530 (1985)). Multiple
cloning sites, e.g., with the restriction enzyme cleavage sites
BamHI, XbaI and Asp718, facilitate the cloning of the gene of
interest. The vectors contain in addition the 3' intron, the
polyadenylation and termination signal of the rat preproinsulin
gene.
EXAMPLE 3A
Cloning and Expression of the Full Length PSGR in COS Cells
[0623] The expression plasmid, pCDNA3.1:HPRAJ70.Flag, is made by
cloning a cDNA encoding PSGR into the expression vector pCDNA3.1
(which can be obtained from Invitrogen, Inc.).
[0624] The expression vector pCDNA3.1 contains: (1) an E. coli
origin of replication effective for propagation in E. coli and
other prokaryotic cell; (2) an ampicillin resistance gene for
selection of plasmid-containing prokaryotic cells; (3) an SV40
origin of replication for propagation in eukaryotic cells; (4) a
CMV promoter, a polylinker, an SV40 intron, and a polyadenylation
signal arranged so that a cDNA conveniently can be placed under
expression control of the CMV promoter and operably linked to the
SV40 intron and the polyadenylation signal by means of restriction
sites in the polylinker.
[0625] A DNA fragment encoding the entire PSGR precursor and a FLAG
tag fused in frame to its 3' end is cloned into the polylinker
region of the vector so that recombinant protein expression is
directed by the CMV promoter. The FLAG tag corresponds to the 11
amino acid leader peptide of the gene 10 product from bacteriophage
T7 described by Witzgall et al., Anal. Biochem. 223:291-8 (1994).
The fusion of the FLAG tag to the target protein allows easy
detection of the recombinant protein with an antibody that
recognizes the FLAG epitope.
[0626] The plasmid construction strategy is as follows:
[0627] Portions of the PSGR cDNA of the deposited clones is
amplified using primers that contain convenient restriction sites,
much as described above regarding the construction of expression
vectors for expression of PSGR in E. coli.
[0628] To facilitate detection, purification and characterization
of the expressed PSGR, one of the primers contains a FLAG tag as
described above.
[0629] Suitable primers for PSGR include the following, which are
used in this example:
[0630] The 5' primer,
[0631] 5' CATGGAAGATCTGCCACCATGGACTACAAAGACGATGACGACAAGAGT
TCCTGCAACTTCACAC-3' (SEQ ID NO:8) contains the underlined BglII
site, an ATG start codon and in-frame FLAG tag, and the first seven
codons of PSGR. The 3' primer for PSGR contains the underlined XbaI
site, the last 21 nucleotides of the 3' coding sequence (at the 3'
end), and has the following sequence:
[0632] 5'-CATTGCTCTAGATCACTTGCCTCCCACAGCCTG-3' (SEQ ID NO:9).
[0633] The PCR amplified DNA fragment and the vector, pCDNA3.1, are
digested with BglII and XbaI and then ligated. The ligation mixture
is transformed into E. coli strain SURE (available from Stratagene
Cloning Systems, 11099 North Torrey Pines Road, La Jolla, Calif.
92037) the transformed culture is plated on ampicillin media plates
which then are incubated to allow growth of ampicillin resistant
colonies. Plasmid DNA is isolated from resistant colonies and
examined by restriction analysis and gel sizing for the presence of
the PSGR-encoding fragment.
[0634] For expression of recombinant PSGR, COS cells are
transfected with an expression vector, as described above, using
DEAE-DEXTRAN, as described, for instance, in Sambrook et al.,
Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory
Press, Cold Spring Harbor, N.Y. (1989). Cells are incubated under
conditions for expression of PSGR by the vector.
[0635] Expression of the FLAG-PSGR fusion protein is detected by
radiolabelling and immunoprecipitation, using methods described in,
for example Harlow et al., Antibodies: a Laboratory Manual, 2nd
Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1988). To this end, two days after transfection, the cells are
labeled by incubation in media containing .sup.35S-cysteine for 8
hours. The cells and the media are collected, and the cells are
washed and then lysed with detergent-containing RIPA buffer: 150 mM
NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5,
as described by Wilson et al. cited above. Proteins are
precipitated from the cell lysate and from the culture media using
an HA-specific monoclonal antibody. The precipitated proteins then
are analyzed by SDS-PAGE gels and autoradiography. An expression
product of the expected size is seen in the cell lysate, which is
not seen in negative controls.
EXAMPLE 4
Protein Fusions of PSGR
[0636] PSGR polypeptides of the invention are optionally fused to
other proteins. These fusion proteins can be used for a variety of
applications. For example, fusion of PSGR polypeptides to His-tag,
HA-tag, protein A, IgG domains, and maltose binding protein
facilitates purification. (See EP A 394,827; Traunecker, et al.,
Nature 331:84-86 (1988)). Similarly, fusion to IgG-1, IgG-3, and
albumin increases the halflife time in vivo. Nuclear localization
signals fused to PSGR polypeptides can target the protein to a
specific subcellular localization, while covalent heterodimer or
homodimers can increase or decrease the activity of a fusion
protein. Fusion proteins can also create chimeric molecules having
more than one function. Finally, fusion proteins can increase
solubility and/or stability of the fused protein compared to the
non-fused protein. All of the types of fusion proteins described
above can be made using techniques known in the art or by using or
routinely modifying the following protocol, which outlines the
fusion of a polypeptide to an IgG molecule.
[0637] Briefly, the human Fc portion of the IgG molecule can be PCR
amplified, using primers that span the 5' and 3' ends of the
sequence described below (SEQ ID NO:10). These primers also
preferably contain convenient restriction enzyme sites that will
facilitate cloning into an expression vector, preferably a
mammalian expression vector.
[0638] For example, if the pC4 (Accession No. 209646) expression
vector is used, the human Fc portion can be ligated into the BamnHI
cloning site. Note that the 3' BamHI site should be destroyed.
Next, the vector containing the human Fc portion is re-restricted
with BamHI, linearizing the vector, and PSGR polynucleotide,
isolated by the PCR protocol described in Example 1, is ligated
into this BamHI site. Note that the polynucleotide is cloned
without a stop codon, otherwise a fusion protein will not be
produced.
[0639] If the naturally occurring signal sequence is used to
produce the secreted protein, pC4 does not need a second signal
peptide. Alternatively, if the naturally occurring signal sequence
is not used, the vector can be modified to include a heterologous
signal sequence. (See, e.g., WO 96/34891.)
[0640] Human IgG Fc region: TABLE-US-00002 (SEQ ID NO:10)
GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCACCGTGC
CCAGCACCTGAATTCGAGGGTGCACCGTCAGTCTTCCTCTTCCCCCCAAA
ACCCAAGGACACCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGTGG
TGGTGGACGTAAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTG
GACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTA
CAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACT
GGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCA
ACCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACC
ACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGG
TCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCAAGCGACATCGCCGTG
GAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCC
CGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGG
ACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCAT
GAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGG
TAAATGAGTGCGACGGCCGCGACTCTAGAGGAT
EXAMPLE 5
Isolation of Antibody Fragments Directed against Polypeptides of
the Present Invention from a Library of scFvs.
[0641] Naturally occurring V-genes isolated from human PBLs are
constructed into a large library of antibody fragments which
contain reactivities against polypeptides of the present invention
to which the donor may or may not have been exposed (see e.g., U.S.
Pat. No. 5,885,793 incorporated herein in its entirety by
reference).
[0642] Rescue of the library
[0643] A library of scFvs is constructed from the RNA of human PBLs
as described in WO92/01047. To rescue phage displaying antibody
fragments, approximately 10.sup.9 E. coli harbouring the phagemid
are used to inoculate 50 ml of 2.times.TY containing 1% glucose and
100 ug/ml of ampicillin (2.times.TY-AMP-GLU) and grown to an O.D.
of 0.8 with shaking. Five ml of this culture is used to innoculate
50 ml of 2.times.TY-AMP-GLU, 2.times.10.sup.8 TU of .DELTA. gene 3
helper phage (M13 .DELTA. gene III, see WO92/01047) are added and
the culture incubated at 37.degree. C. for 45 minutes without
shaking and then at 37.degree. C. for 45 minutes with shaking. The
culture is centrifuged at 4000 r.p.m. for 10 minutes and the pellet
resuspended in 2 liters of 2.times.TY containing 100 ug/ml
ampicillin and 50 ug/ml kanamycin and grown overnight. Phage are
prepared as described in W092/01047.
[0644] M13 .DELTA. gene III is prepared as follows: M13 .DELTA.
gene III helper phage does not encode gene III protein, hence the
phage(mid) displaying antibody fragments have a greater avidity of
binding to antigen. Infectious M 13 .DELTA. gene III particles are
made by growing the helper phage in cells harboring a pUC19
derivative supplying the wild type gene III protein during phage
morphogenesis. The culture is incubated for 1 hour at 37.degree. C.
without shaking and then for a further hour at 37.degree. C. with
shaking. Cells are pelleted (EC-Centra 8, 4000 revs/min for 10
min), resuspended in 300 ml 2.times.TY broth containing 100 ug
ampicillin/ml and 25 ug kanamycin/ml (2.times.TY-AMP-KAN) and grown
overnight, shaking at 37.degree. C. Phage particles are purified
and concentrated from the culture medium by two PEG-precipitations
(Sambrook et al., 1990), resuspended in 2 ml PBS and passed through
a 0.45 um filter (Minisart NML; Sartorius) to give a final
concentration of approximately 10.sup.13 transducing units/ml
(ampicillin-resistant clones).
Panning of the Library
[0645] Immunotubes (Nunc) are coated overnight in PBS with 4 ml of
either 100 mg/ml or 10 mg/ml of a polypeptide of the present
invention. Tubes are blocked with 2% Marvel-PBS for 2 hours at
37.degree. C. and then washed 3 times in PBS. Approximately
10.sup.13 TU of phage are applied to the tube and incubated for 30
minutes at room temperature tumbling on an over and under turntable
and then left to stand for another 1.5 hours. Tubes are washed 10
times with PBS 0.1% Tween-20 and 10 times with PBS. Phage are
eluted by adding 1 ml of 100 mM triethylamine and rotating 15
minutes on an under and over turntable after which the solution is
immediately neutralized with 0.5 ml of 1.0M Tris-HCl, pH 7.4. Phage
are then used to infect 10 ml of mid-log E. coli TG1 by incubating
eluted phage with bacteria for 30 minutes at 37.degree. C. The E.
coli are then plated on TYE plates containing 1% glucose and 100
ug/ml ampicillin. The resulting bacterial library is then rescued
with A gene III helper phage as described above to prepare phage
for a subsequent round of selection. This process is then repeated
for a total of 4 rounds of affinity purification with tube-washing
increased to 20 times with PBS, 0.1% Tween-20 and 20 times with PBS
for rounds 3 and 4.
Characterization of Binders
[0646] Eluted phage from the 3rd and 4th rounds of selection are
used to infect E. coli HB 2151 and soluble scFv is produced (Marks,
et al., 1991) from single colonies for assay. ELISAs are performed
with microtitre plates coated with either 10 pg/ml of the
polypeptide of the present invention in 50 mM bicarbonate pH 9.6.
Clones positive in ELISA are further characterized by PCR
fingerprinting (see e.g., WO92/01047) and then by sequencing.
EXAMPLE 6
Tissue distribution of PSGR mRNA Expression
[0647] Northern blot analysis was carried out to examine PSGR gene
expression in human tissues, using methods described by, among
others, Sambrook et al., cited above. A cDNA probe containing the
entire nucleotide sequence of the PSGR protein (SEQ ID NO:1) was
labeled with .sup.32P using the rediprime.TM. DNA labeling system
(Amersham Life Science), according to manufacturer's instructions.
After labeling, the probe was purified using a CHROMA SPIN-100
column (Clontech Laboratories, Inc.), according to manufacturer's
protocol number PT1200-1. The purified labeled probe was then used
to examine various human tissues for PSGR mRNA.
[0648] Multiple Tissue Northern (MTN) blots containing various
human tissues (H) or human immune system tissues (IM) were obtained
from Clontech and were examined with labeled probe using
ExpressHyb.TM. hybridization solution (Clontech) according to
manufacturer's protocol number PT1190-1. Following hybridization
and washing, the blots were mounted and exposed to film at
-70.degree. C. overnight, and films developed according to standard
procedures. Expression of PSGR was detected in normal and diseased
prostate tissues. It can be envisaged that PSGR plays a role in
prostate function.
EXAMPLE 7
Method of Determining Alterations in the PSGR Gene
[0649] RNA is isolated from entire families or individual patients
presenting with a phenotype of interest (such as a disease). cDNA
is then generated from these RNA samples using protocols known in
the art. (See, Sambrook.) The cDNA is then used as a template for
PCR, employing primers surrounding regions of interest in SEQ ID
NO: 1. Suggested PCR conditions consist of 35 cycles at 95.degree.
C. for 30 seconds; 60-120 seconds at 52-58.degree. C.; an 60-120
seconds at 70.degree. C., using buffer solutions described in
Sidransky, D., et al., Science 252:706 (1991).
[0650] PCR products are then sequenced using primers labeled at
their 5' end with T4 polynucleotide kinase, employing SequiTherm
Polymerase. (Epicentre Technologies). The intron-exon borders of
selected exons of PSGR are also determined and genomic PCR products
analyzed to confirm the results. PCR products harboring suspected
mutations in PSGR is then cloned and sequenced to validate the
results of the direct sequencing.
[0651] PCR products of PSGR are cloned into T-tailed vectors as
described in Holton, T. A. and Graham, M. W., Nucleic Acids
Research, 19:1156 (1991) and sequenced with T7 polymerase (United
States Biochemical). Affected individuals are identified by
mutations in PSGR not present in unaffected individuals.
[0652] Genomic rearrangements are also observed as a method of
determining alterations in the PSGR gene. Genomic clones isolated
using techniques known in the art are nick-translated with
digoxigenindeoxy-uridine 5'-triphosphate (Boehringer Manheim), and
FISH performed as described in Johnson, Cg. et al, Methods Cell
Biol. 35:73-99 (1991). Hybridization with the labeled probe is
carried out using a vast excess of human cot-1 DNA for specific
hybridization to the PSGR genomic locus.
[0653] Chromosomes are counterstained with
4,6-diamino-2-phenylidole and propidium iodide, producing a
combination of C- and R-bands. Aligned images for precise mapping
are obtained using a triple-band filter set (Chroma Technology,
Brattleboro, VT) in combination with a cooled charge-coupled device
camera (Photometrics, Tucson, Ariz.) and variable excitation
wavelength filters. (Johnson, Cv. et al., Genet. Anal. Tech. Appl.,
8:75 (1991).) Image collection, analysis and chromosomal fractional
length measurements are performed using the ISee Graphical Program
System. (Inovision Corporation, Durham, NC.) Chromosome alterations
of the genomic region of PSGR (hybridized by the probe) are
identified as insertions, deletions, and translocations. These PSGR
alterations are used as a diagnostic marker for an associated
disease.
EXAMPLE 8
Method of Detecting Abnormal Levels of PSGR in a Biological
Sample
[0654] PSGR polypeptides can be detected in a biological sample,
and if an increased or decreased level of PSGR is detected, this
polypeptide is a marker for a particular phenotype. Methods of
detection are numerous, and thus, it is understood that one skilled
in the art can modify the following assay to fit their particular
needs.
[0655] For example, antibody-sandwich ELISAs are used to detect
PSGR in a sample, preferably a biological sample. Wells of a
microtiter plate are coated with specific antibodies to PSGR, at a
final concentration of 0.2 to 10 ug/ml. The antibodies are either
monoclonal or polyclonal and are produced using technique known in
the art. The wells are blocked so that non-specific binding of PSGR
to the well is reduced.
[0656] The coated wells are then incubated for >2 hours at RT
with a sample containing PSGR. Preferably, serial dilutions of the
sample should be used to validate results. The plates are then
washed three times with deionized or distilled water to remove
unbounded PSGR.
[0657] Next, 50 ul of specific antibody-alkaline phosphatase
conjugate, at a concentration of 25-400 ng, is added and incubated
for 2 hours at room temperature. The plates are again washed three
times with deionized or distilled water to remove unbounded
conjugate.
[0658] 75 ul of 4-methylumbelliferyl phosphate (MUP) or
p-nitrophenyl phosphate (NPP) substrate solution is then added to
each well and incubated 1 hour at room temperature to allow
cleavage of the substrate and flourescence. The flourescence is
measured by a microtiter plate reader. A standard curve is prepared
using the experimental results from serial dilutions of a control
sample with the sample concentration plotted on the X-axis (log
scale) and fluorescence or absorbance on the Y-axis (linear scale).
The PSGR polypeptide concentration in a sample is then interpolated
using the standard curve based on the measured flourescence of that
sample.
EXAMPLE 9
Method of Treating Decreased Levels of PSGR
[0659] The present invention relates to a method for treating an
individual in need of a decreased level of PSGR biological activity
in the body comprising, administering to such an individual a
composition comprising a therapeutically effective amount of PSGR
antagonist. Preferred antagonists for use in the present invention
are PSGR-specific antibodies.
[0660] Moreover, it will be appreciated that conditions caused by a
decrease in the standard or normal expression level of PSGR in an
individual can be treated by administering PSGR, preferably in a
soluble and/or secreted form. Thus, the invention also provides a
method of treatment of an individual in need of an increased level
of PSGR polypeptide comprising administering to such an individual
a pharmaceutical composition comprising an amount of PSGR to
increase the biological activity level of PSGR in such an
individual.
[0661] For example, a patient with decreased levels of PSGR
polypeptide receives a daily dose 0.1 -100 ug/kg of the polypeptide
for six consecutive days. Preferably, the polypeptide is in a
soluble and/or secreted form.
EXAMPLE 10
Method of Treating Increased Levels of PSGR
[0662] The present invention also relates to a method for treating
an individual in need of an increased level of PSGR biological
activity in the body comprising administering to such an individual
a composition comprising a therapeutically effective amount of PSGR
or an agonist thereof.
[0663] Antisense technology is used to inhibit production of PSGR.
This technology is one example of a method of decreasing levels of
PSGR polypeptide, preferably a soluble and/or secreted form, due to
a variety of etiologies, such as cancer.
[0664] For example, a patient diagnosed with abnormally increased
levels of PSGR is administered intravenously antisense
polynucleotides at 0.5, 1.0, 1.5, 2.0 and 3.0 mg/kg day for 21
days. This treatment is repeated after a 7-day rest period if the
is determined to be well tolerated.
EXAMPLE 11
Method of Treatment Using Gene Therapy--Ex Vivo
[0665] One method of gene therapy transplants fibroblasts, which
are capable of expressing soluble and/or mature PSGR polypeptides,
onto a patient. Generally, fibroblasts are obtained from a subject
by skin biopsy. The resulting tissue is placed in tissue-culture
medium and separated into small pieces. Small chunks of the tissue
are placed on a wet surface of a tissue culture flask,
approximately ten pieces are placed in each flask. The flask is
turned upside down, closed tight and left at room temperature over
night. After 24 hours at room temperature, the flask is inverted
and the chunks of tissue remain fixed to the bottom of the flask
and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin
and streptomycin) is added. The flasks are then incubated at
37.degree. C. for approximately one week.
[0666] At this time, fresh media is added and subsequently changed
every several days. After an additional two weeks in culture, a
monolayer of fibroblasts emerge. The monolayer is trypsinized and
scaled into larger flasks.
[0667] pMV-7 (Kirschmeier, P. T. et al., DNA, 7:219-25 (1988)),
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0668] The cDNA encoding PSGR can be amplified using PCR primers
which correspond to the 5' and 3' end encoding sequences
respectively. Preferably, the 5' primer contains an EcoRI site and
the 3' primer includes a HindIII site. Equal quantities of the
Moloney murine sarcoma virus linear backbone and the amplified
EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is then used to transform E. coli HB101, which are then plated onto
agar containing kanamycin for the purpose of confirming that the
vector contains properly inserted PSGR.
[0669] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the PSGR gene is then added
to the media and the packaging cells transduced with the vector.
The packaging cells now produce infectious viral particles
containing the PSGR gene (the packaging cells are now referred to
as producer cells).
[0670] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh media
If the titer of virus is high, then virtually all fibroblasts will
be infected and no selection is required. If the titer is very low,
then it is necessary to use a retroviral vector that has a
selectable marker, such as neo or his. Once the fibroblasts have
been efficiently infected, the fibroblasts are analyzed to
determine whether PSGR protein is produced.
[0671] The engineered fibroblasts are then transplanted onto the
host, either alone or after having been grown to confluence on
cytodex 3 microcarrier beads.
EXAMPLE 12
Method of Treatment Using Gene Therapy--In Vivo
[0672] Another aspect of the present invention is using in vivo
gene therapy methods to treat disorders, diseases and conditions.
The gene therapy method relates to the introduction of naked
nucleic acid (DNA, RNA, and antisense DNA or RNA) PSGR sequences
into an animal to increase or decrease the expression of the PSGR
polypeptide. The PSGR polynucleotide may be operatively linked to a
promoter or any other genetic elements necessary for the expression
of the PSGR polypeptide by the target tissue. Such gene therapy and
delivery techniques and methods are known in the art, see, for
example, WO90/11092, WO98/11779; U.S. Pat. Nos. 5693622, 5705151,
5580859; Tabata H. et al., Cardiovasc. Res. 35:470-479 (1997); Chao
J. et al., Pharmacol. Res. 35:517-522 (1997); Wolff J. A.
Neuromuscul. Disord. 7:314-318 (1997); Schwartz B. et al., Gene
Ther. 3:405-411 (1996); Tsurumi Y. et al, Circulation 94:3281-3290
(1996) (incorporated herein by reference).
[0673] The PSGR polynucleotide constructs may be delivered by any
method that delivers injectable materials to the cells of an
animal, such as, injection into the interstitial space of tissues
(heart, muscle, skin, lung, liver, intestine and the like). The
PSGR polynucleotide constructs can be delivered hi a
pharmaceutically acceptable liquid or aqueous carrier.
[0674] The term "naked" polynucleotide, DNA or RNA, refers to
sequences that are free from any delivery vehicle that acts to
assist, promote, or facilitate entry into the cell, including viral
sequences, viral particles, liposome formulations, lipofectin or
precipitating agents and the like. However, the PSGR
polynucleotides may also be delivered in liposome formulations
(such as those taught in Felgner P. L., et al. Ann. NY Acad. Sci.
772:126-139 (1995), and Abdallah B., et al. Biol. Cell 85(1):1-7
(1995)) which can be prepared by methods well known to those
skilled in the art.
[0675] The PSGR polynucleotide vector constructs used in the gene
therapy method are preferably constructs that will not integrate
into the host genome nor will they contain sequences that allow for
replication. Any strong promoter known to those skilled in the art
can be used for driving the expression of DNA. Unlike other gene
therapies techniques, one major advantage of introducing naked
nucleic acid sequences into target cells is the transitory nature
of the polynucleotide synthesis in the cells. Studies have shown
that non-replicating DNA sequences can be introduced into cells to
provide production of the desired polypeptide for periods of up to
six months.
[0676] The PSGR polynucleotide construct can be delivered to the
interstitial space of tissues within the an animal, including of
muscle, skin, brain, lung, liver, spleen, bone marrow, thymus,
heart, lymph, blood, bone, cartilage, pancreas, kidney, gall
bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous
system, eye, gland, and connective tissue. Interstitial space of
the tissues comprises the intercellular fluid, mucopolysaccharide
matrix among the reticular fibers of organ tissues, elastic fibers
in the walls of vessels or chambers, collagen fibers of fibrous
tissues, or that same matrix within connective tissue ensheathing
muscle cells or in the lacunae of bone. It is similarly the space
occupied by the plasma of the circulation and the lymph fluid of
the lymphatic channels. Delivery to the interstitial space of
muscle tissue is preferred for the reasons discussed below. They
may be conveniently delivered by injection into the tissues
comprising these cells. They are preferably delivered to and
expressed in persistent, non-dividing cells which are
differentiated, although delivery and expression may be achieved in
non-differentiated or less completely differentiated cells, such
as, for example, stem cells of blood or skin fibroblasts. In vivo
muscle cells are particularly competent in their ability to take up
and express polynucleotides.
[0677] For the naked PSGR polynucleotide injection, an effective
dosage amount of DNA or RNA will be in the range of from about 0.05
g/kg body weight to about 50 mg/kg body weight. Preferably the
dosage will be from about 0.005 mg/kg to about 20 mg/kg and more
preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as
the artisan of ordinary skill will appreciate, this dosage will
vary according to the tissue site of injection. The appropriate and
effective dosage of nucleic acid sequence can readily be determined
by those of ordinary skill in the art and may depend on the
condition being treated and the route of administration. The
preferred route of administration is by the parenteral route of
injection into the interstitial space of tissues. However, other
parenteral routes may also be used, such as, inhalation of an
aerosol formulation particularly for delivery to lungs or bronchial
tissues, throat or mucous membranes of the nose. In addition, naked
PSGR polynucleotide constructs can be delivered to arteries during
angioplasty by the catheter used in the procedure.
[0678] The dose response effects of injected PSGR polynucleotide in
muscle in vivo is determined as follows. Suitable PSGR template DNA
for production of mRNA coding for PSGR polypeptide is prepared in
accordance with a standard recombinant DNA methodology. The
template DNA, which may be either circular or linear, is either
used as naked DNA or complexed with liposomes. The quadriceps
muscles of mice are then injected with various amounts of the
template DNA.
[0679] Five to six week old female and male Balb/C mice are
anesthetized by intraperitoneal injection with 0.3 ml of 2.5%
Avertin. A 1.5 cm incision is made on the anterior thigh, and the
quadriceps muscle is directly visualized. The PSGR template DNA is
injected in 0.1 ml of carrier in a 1 cc syringe through a 27 gauge
needle over one minute, approximately 0.5 cm from the distal
insertion site of the muscle into the knee and about 0.2 cm deep. A
suture is placed over the injection site for future localization,
and the skin is closed with stainless steel clips.
[0680] After an appropriate incubation time (e.g., 7 days) muscle
extracts are prepared by excising the entire quadriceps. Every
fifth 15 um cross-section of the individual quadriceps muscles is
histochemically stained for PSGR protein expression. A time course
for PSGR protein expression may be done in a similar fashion except
that quadriceps from different mice are harvested at different
times. Persistence of PSGR DNA in muscle following injection may be
determined by Southern blot analysis after preparing total cellular
DNA and HIRT supernatants from injected and control mice. The
results of the above experimentation in mice can be use to
extrapolate proper dosages and other treatment parameters in humans
and other animals using PSGR naked DNA.
EXAMPLE 13
Gene Therapy Using Endogenous PSGR Gene
[0681] Another method of gene therapy according to the present
invention involves operably associating the endogenous PSGR
sequence with a promoter via homologous recombination as described,
for example, in U.S. Pat. No. 5,641,670, issued Jun. 24, 1997;
International Publication Number WO 96/29411; International
Publication Number WO 94/12650; Koller et al., Proc. Natl. Acad.
Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature
342:435-438 (1989). This method involves the activation of a gene
which is present in the target cells, but which is not expressed in
the cells, or is expressed at a lower level than desired.
Polynucleotide constructs are made which contain a promoter and
targeting sequences, which are homologous to the 5' non-coding
sequence of endogenous PSGR, flanking the promoter. The targeting
sequence will be sufficiently near the 5' end of PSGR so the
promoter will be operably linked to the endogenous sequence upon
homologous recombination. The promoter and the targeting sequences
can be amplified using PCR. Preferably, the amplified promoter
contains distinct restriction enzyme sites on the 5' and 3' ends.
Preferably, the 3' end of the first targeting sequence contains the
same restriction enzyme site as the 5' end of the amplified
promoter and the 5' end of the second targeting sequence contains
the same restriction site as the 3' end of the amplified
promoter.
[0682] The amplified promoter and the amplified targeting sequences
are digested with the appropriate restriction enzymes and
subsequently treated with calf intestinal phosphatase. The digested
promoter and digested targeting sequences are added together in the
presence of T4 DNA ligase. The resulting mixture is maintained
under conditions appropriate for ligation of the two fragments. The
construct is size fractionated on an agarose gel then purified by
phenol extraction and ethanol precipitation.
[0683] In this Example, the polynucleotide constructs are
administered as naked polynucleotides via electroporation. However,
the polynucleotide constructs may also be administered with
transfection-facilitating agents, such as liposomes, viral
sequences, viral particles, precipitating agents, etc. Such methods
of delivery are known in the art.
[0684] Once the cells are transfected, homologous recombination
will take place which results in the promoter being operably linked
to the endogenous PSGR sequence. This results in the expression of
PSGR in the cell. Expression may be detected by immunological
staining, or any other method known in the art.
[0685] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in DMEM+10% fetal calf serum.
Exponentially growing or early stationary phase fibroblasts are
trypsinized and rinsed from the plastic surface with nutrient
medium. An aliquot of the cell suspension is removed for counting,
and the remaining cells are subjected to centrifugation. The
supernatant is aspirated and the pellet is resuspended in 5 ml of
electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KCl,
0.7 mM Na2 HPO4, 6 mM dextrose). The cells are recentrifuged, the
supernatant aspirated, and the cells resuspended in electroporation
buffer containing 1 mg/ml acetylated bovine serum albumin. The
final cell suspension contains approximately 3.times.10.sup.6
cells/ml. Electroporation should be performed immediately following
resuspension.
[0686] Plasmid DNA is prepared according to standard techniques.
For example, to construct a plasmid for targeting to the PSGR
locus, plasmid pUC18 (MBI Fermentas, Amherst, N.Y.) is digested
with HindIII. The CMV promoter is amplified by PCR with an XbaI
site on the 5' end and a BamHI site on the 3' end. Two PSGR
non-coding sequences are amplified via PCR: one PSGR non-coding
sequence (PSGR fragment 1) is amplified with a HindIII site at the
5' end and an Xba site at the 3' end; the other PSGR non-coding
sequence (PSGR fragment 2) is amplified with a BamHI site at the 5'
end and a HindIII site at the 3' end. The CMV promoter and PSGR
fragments are digested with the appropriate enzymes (CMV
promoter--XbaI and BamHI; PSGR fragment 1--XbaI; PSGR fragment
2--BamHI) and ligated together. The resulting ligation product is
digested with HindIII, and ligated with the HindIII-digested pUC18
plasmid.
[0687] Plasmid DNA is added to a sterile cuvette with a 0.4 cm
electrode gap (Bio-Rad). The final DNA concentration is generally
at least 120 .mu.g/ml. 0.5 ml of the cell suspension (containing
approximately 1.5..times.10.sup.6 cells) is then added to the
cuvette, and the cell suspension and DNA solutions are gently
mixed. Electroporation is performed with a Gene-Pulser apparatus
(Bio-Rad). Capacitance and voltage are set at 960 .mu.F and 250-300
V, respectively. As voltage increases, cell survival decreases, but
the percentage of surviving cells that stably incorporate the
introduced DNA into their genome increases dramatically. Given
these parameters, a pulse time of approximately 14-20 mSec should
be observed.
[0688] Electroporated cells are maintained at room temperature for
approximately 5 min, and the contents of the cuvette are then
gently removed with a sterile transfer pipette. The cells are added
directly to 10 ml of prewarmed nutrient media (DMEM with 15% calf
serum) in a 10 cm dish and incubated at 37.degree. C. The following
day, the media is aspirated and replaced with 10 ml of fresh media
and incubated for a further 16-24 hours.
[0689] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product. The fibroblasts can then be introduced into a patient as
described above.
EXAMPLE 14
Western Blotting, Immunoprecipitation, and Purification of PSGR
[0690] Anti-PSGR antibodies of the invention may be screened for
the ability to bind plasma membrane preparations from PSGR
expressing cells under reducing and non-reducing conditions via
western blotting. PSGR is a membrane embedded protein, so in order
to perform a western blot on PSGR proteins, cell membranes must
first be solubilized. The following protocol was worked out by
Mirzabekov et al., J. Biol. Chem. 274:28745 (1999) for western
blotting of CCR5 (hereby incorporated in its entirety by reference
herein). A single cell suspension of PSGR expressing cells and PSGR
non-expressing cells, as a control, are pelleted and resuspended in
solubilization buffer composed of 100 mM (NH.sub.4).sub.2SO.sub.4,
20 mM Tris-HCI (pH 7.5) and 1% (w/v) Cymal.TM.--5 (Anatrace Inc.,
Maumee, Ohio), and protease inhibitor mixture (one tablet of
Complete.TM. (Roche Molecular Biochemicals) per 25 ml). After a 30
minute incubation at 4.degree. C. on a rocking platform, the
samples are centrifuged for 30 minutes at 14,000.times.g to remove
cell debris. PSGR may be immunopreciptaed from the solubilized
membrane using a specific anti-PSGR antibody (e.g., a monoclonal
anti-PSGR antibody is preferred) conjugated to sepahrose beads.
Following immunoprecipitation, the beads are washed extensively
with solubilization buffer and resuspended in 2.times.SDS-sample
buffer. Samples are incubated in SDS-sample buffer for 1 hour at
55.degree. C. prior to electrophoresis through an 11%
SDS-polyacrylamide gel. Western blotting on the PSGR samples is
then carried out according to standard protocols known in the art,
using antibodies of the invention as the primary anti-PSGR reagent.
The expected molecular weight of PSGR in a Wetern blot is .about.35
Kd (ranging from 30-40 kD).
[0691] The membrane solubilization protocol described above may
also be used to prepare PSGR containing samples for
purification.
EXAMPLE 15
PSGR Ligand Binding Assay.
[0692] Antibodies of the invention may be assayed for their ability
to prevent a natural ligand of PSGR from binding to the PSGR
receptor. This assay is modified from Lopalco et al., J. Immunol.,
164:3426 (2000) and Trkola et al., Nature, 384:184 (1996) which are
incorporated in their entirities by reference herein. Briefly,
10.sup.6 PSGR expressing cells (e.g., PSGR transfected-CHO cells)
are incubated on ice with appropriate dilution(s) of antibody of
the invention. After 45 minutes of incubation, 0.2 microCuries of
radiolabelled ligand is added to a final concentration of 0.1 nM.
After a two hour incubation on ice, unbound radioactivity is
removed using a two step gradient, as described in Grassi et al., J
Exp Med. 174:53 (1991) which is incorporated in its entirety by
reference herein, in which the lower layer consists of fetal calf
serum containing 10% sucrose, and the upper layer consists of 80%
silicone (Sigma Aldrich) and 20% mineral oil (Sigma Aldrich). Bound
radioactivity in cell pellets is measured in a gamma counter.
[0693] It will be clear that the invention may be practiced
otherwise than as particularly described in the foregoing
description and examples. Numerous modifications and variations of
the present invention are possible in light of the above teachings
and, therefore, are within the scope of the appended claims.
[0694] The entire disclosure of each document cited (including
patents, patent applications, journal articles, abstracts,
laboratory manuals, books, or other disclosures) in the Background
of the Invention, Detailed Description, and Examples is hereby
incorporated herein by reference.
[0695] Further, certain polynucleotides and polypeptides of the
present invention, including antibodies, were disclosed in U.S.
Provisional Application No. 60/237,275, filed Oct. 3, 2000, U.S.
application Ser. No. 09/339,115, filed Jun. 24, 1999, U.S.
application Ser. No. 09/053,303, filed Apr. 1, 1998, now U.S. Pat.
No. 5,948,890, issued Sep. 7, 1999, and U.S. application Ser. No.
08/465,980, filed Jun. 6, 1995, now U.S. Pat. No. 5,756,309, issued
May 26, 1998, as well as in International application number
PCT/US95/07093, filed Jun. 5, 1995 (in English). The
specifications, tables, figures and sequence listings of each of
the above are herein incorporated by reference in their
entireties.
[0696] Moreover, the Sequence Listing submitted herewith, in both
computer and paper forms, is hereby incorporated by reference in
its entirety.
Sequence CWU 1
1
12 1 1474 DNA Homo sapiens CDS (274)..(1282) misc_feature
(847)..(847) n equals a, t, g, or c 1 ccatgctgcc ttccgggcag
taccatccat ctccacaccc tggaagacac agtgagttag 60 caccaccacc
aggtaattgg ccttatcagc tctgtgcctg tctccagtca ggctggaata 120
agtctcctca tatgtgcaag ctcggccctc ccctggaatc taaagcctcc tcagccttct
180 gagtcagcct gaaaggaaca ggccgaactg ctgtatgggc tctactgcca
gtgtgacctc 240 accctctcca gtcacccctc ctcagttcca gct atg agt tcc tgc
aac ttc aca 294 Met Ser Ser Cys Asn Phe Thr 1 5 cat gcc acc tgt gtg
ctt att ggt atc cca gga tta gag aaa gcc cat 342 His Ala Thr Cys Val
Leu Ile Gly Ile Pro Gly Leu Glu Lys Ala His 10 15 20 ttc tgg gtt
ggc ttc ccc ctc ctt tcc atg tat gta gtg gca atg tgt 390 Phe Trp Val
Gly Phe Pro Leu Leu Ser Met Tyr Val Val Ala Met Cys 25 30 35 gga
aac tgc atc gtg gtc ttc atc gta agg acg gaa cgc agc ctg cac 438 Gly
Asn Cys Ile Val Val Phe Ile Val Arg Thr Glu Arg Ser Leu His 40 45
50 55 gct ccg atg tac ctc ttt ctc tgc atg ctt gca gcc att gac ctg
gcc 486 Ala Pro Met Tyr Leu Phe Leu Cys Met Leu Ala Ala Ile Asp Leu
Ala 60 65 70 tta tcc aca tcc acc atg cct aag atc ctt gcc ctt ttc
tgg ttt gat 534 Leu Ser Thr Ser Thr Met Pro Lys Ile Leu Ala Leu Phe
Trp Phe Asp 75 80 85 tcc cga gag att agc att gag gcc tgt ctt acc
cag atg ttc ttt att 582 Ser Arg Glu Ile Ser Ile Glu Ala Cys Leu Thr
Gln Met Phe Phe Ile 90 95 100 cat gcc ctc tca gcc att gaa tcc acc
atc ctg ctg gcc atg gcc ttt 630 His Ala Leu Ser Ala Ile Glu Ser Thr
Ile Leu Leu Ala Met Ala Phe 105 110 115 gac cgt tat gtg gcc atc tgc
cac cca ctg cgc cat gct gca gtg ctc 678 Asp Arg Tyr Val Ala Ile Cys
His Pro Leu Arg His Ala Ala Val Leu 120 125 130 135 aac aat aca gta
aca gcc cag att ggc atc gtg gct gtg gtc cgc gga 726 Asn Asn Thr Val
Thr Ala Gln Ile Gly Ile Val Ala Val Val Arg Gly 140 145 150 tcc ctc
ttt ttt ttc cca ctg cct ctg ctg atc aag cgg ctg gcc ttc 774 Ser Leu
Phe Phe Phe Pro Leu Pro Leu Leu Ile Lys Arg Leu Ala Phe 155 160 165
tgc cac tcc aat gtc ctc tcg cac tcc tat tgt gtc cac cag gat gta 822
Cys His Ser Asn Val Leu Ser His Ser Tyr Cys Val His Gln Asp Val 170
175 180 atg aag ttg gcc tat gca gac act ntg ccc aat gtg gta tat ggt
ctt 870 Met Lys Leu Ala Tyr Ala Asp Thr Xaa Pro Asn Val Val Tyr Gly
Leu 185 190 195 act gcc att ctg ctg gtc atg ggc gtg gac gta atg ttc
atc tcc ttg 918 Thr Ala Ile Leu Leu Val Met Gly Val Asp Val Met Phe
Ile Ser Leu 200 205 210 215 tcc tat ttt ctg ata ata cga acg gtt ctg
caa ctg cct tcc aag tca 966 Ser Tyr Phe Leu Ile Ile Arg Thr Val Leu
Gln Leu Pro Ser Lys Ser 220 225 230 gag cgg gcc aag gcc ttt gga acc
tgt gtg tca cac att ggt gtg gta 1014 Glu Arg Ala Lys Ala Phe Gly
Thr Cys Val Ser His Ile Gly Val Val 235 240 245 ctc gcc ttc tat gtg
cca ctt att ggc ctc tca gtt gta cac cgc ttt 1062 Leu Ala Phe Tyr
Val Pro Leu Ile Gly Leu Ser Val Val His Arg Phe 250 255 260 gga aac
agc ctt cat ccc att gtg cgt gtt gtc atg ggt gac atc tac 1110 Gly
Asn Ser Leu His Pro Ile Val Arg Val Val Met Gly Asp Ile Tyr 265 270
275 ctg ctg ctg cct cct gtc atc aat ccc atc atc tat ggt gcc aaa acc
1158 Leu Leu Leu Pro Pro Val Ile Asn Pro Ile Ile Tyr Gly Ala Lys
Thr 280 285 290 295 aaa cag atc aga aca cgg gtg ctg gct atg ttc aag
atc agc tgt gac 1206 Lys Gln Ile Arg Thr Arg Val Leu Ala Met Phe
Lys Ile Ser Cys Asp 300 305 310 aag gac ttg cag gct gtg gga ggc aag
tga cccttaacac tacactrctc 1256 Lys Asp Leu Gln Ala Val Gly Gly Lys
315 320 cttatcttta ttggcttgat aaacataatt atttctaaca ctagcttatt
tccagttgcc 1316 cataagcaca tcagtacttt tctctggctg gaatagtaaa
ctaaagtatg gtacatctac 1376 ctaaaggact attatgtgga ataatacata
ctaatgaagt attacatgat ttaaagacta 1436 caataaaacc aaacatgctt
ataacattaa aaaaaaaa 1474 2 320 PRT Homo sapiens SITE (192) Xaa
equals any amino acid 2 Met Ser Ser Cys Asn Phe Thr His Ala Thr Cys
Val Leu Ile Gly Ile 1 5 10 15 Pro Gly Leu Glu Lys Ala His Phe Trp
Val Gly Phe Pro Leu Leu Ser 20 25 30 Met Tyr Val Val Ala Met Cys
Gly Asn Cys Ile Val Val Phe Ile Val 35 40 45 Arg Thr Glu Arg Ser
Leu His Ala Pro Met Tyr Leu Phe Leu Cys Met 50 55 60 Leu Ala Ala
Ile Asp Leu Ala Leu Ser Thr Ser Thr Met Pro Lys Ile 65 70 75 80 Leu
Ala Leu Phe Trp Phe Asp Ser Arg Glu Ile Ser Ile Glu Ala Cys 85 90
95 Leu Thr Gln Met Phe Phe Ile His Ala Leu Ser Ala Ile Glu Ser Thr
100 105 110 Ile Leu Leu Ala Met Ala Phe Asp Arg Tyr Val Ala Ile Cys
His Pro 115 120 125 Leu Arg His Ala Ala Val Leu Asn Asn Thr Val Thr
Ala Gln Ile Gly 130 135 140 Ile Val Ala Val Val Arg Gly Ser Leu Phe
Phe Phe Pro Leu Pro Leu 145 150 155 160 Leu Ile Lys Arg Leu Ala Phe
Cys His Ser Asn Val Leu Ser His Ser 165 170 175 Tyr Cys Val His Gln
Asp Val Met Lys Leu Ala Tyr Ala Asp Thr Xaa 180 185 190 Pro Asn Val
Val Tyr Gly Leu Thr Ala Ile Leu Leu Val Met Gly Val 195 200 205 Asp
Val Met Phe Ile Ser Leu Ser Tyr Phe Leu Ile Ile Arg Thr Val 210 215
220 Leu Gln Leu Pro Ser Lys Ser Glu Arg Ala Lys Ala Phe Gly Thr Cys
225 230 235 240 Val Ser His Ile Gly Val Val Leu Ala Phe Tyr Val Pro
Leu Ile Gly 245 250 255 Leu Ser Val Val His Arg Phe Gly Asn Ser Leu
His Pro Ile Val Arg 260 265 270 Val Val Met Gly Asp Ile Tyr Leu Leu
Leu Pro Pro Val Ile Asn Pro 275 280 285 Ile Ile Tyr Gly Ala Lys Thr
Lys Gln Ile Arg Thr Arg Val Leu Ala 290 295 300 Met Phe Lys Ile Ser
Cys Asp Lys Asp Leu Gln Ala Val Gly Gly Lys 305 310 315 320 3 963
DNA Homo sapiens CDS (1)..(960) 3 atg agt tcc tgc aac ttc aca cat
gcc acc ttt gtg ctt att ggt atc 48 Met Ser Ser Cys Asn Phe Thr His
Ala Thr Phe Val Leu Ile Gly Ile 1 5 10 15 cca gga tta gag aaa gcc
cat ttc tgg gtt ggc ttc ccc ctc ctt tcc 96 Pro Gly Leu Glu Lys Ala
His Phe Trp Val Gly Phe Pro Leu Leu Ser 20 25 30 atg tat gta gtg
gca atg ttt gga aac tgc atc gtg gtc ttc atc gta 144 Met Tyr Val Val
Ala Met Phe Gly Asn Cys Ile Val Val Phe Ile Val 35 40 45 agg acg
gaa cgc agc ctg cac gct ccg atg tac ctc ttt ctc tgc atg 192 Arg Thr
Glu Arg Ser Leu His Ala Pro Met Tyr Leu Phe Leu Cys Met 50 55 60
ctt gca gcc att gac ctg gcc tta tcc aca tcc acc atg cct aag atc 240
Leu Ala Ala Ile Asp Leu Ala Leu Ser Thr Ser Thr Met Pro Lys Ile 65
70 75 80 ctt gcc ctt ttc tgg ttt gat tcc cga gag att agc ttt gag
gcc tgt 288 Leu Ala Leu Phe Trp Phe Asp Ser Arg Glu Ile Ser Phe Glu
Ala Cys 85 90 95 ctt acc cag atg ttc ttt att cat gcc ctc tca gcc
att gaa tcc acc 336 Leu Thr Gln Met Phe Phe Ile His Ala Leu Ser Ala
Ile Glu Ser Thr 100 105 110 atc ctg ctg gcc atg gcc ttt gac cgt tat
gtg gcc atc tgc cac cca 384 Ile Leu Leu Ala Met Ala Phe Asp Arg Tyr
Val Ala Ile Cys His Pro 115 120 125 ctg cgc cat gct gca gtg ctc aac
aat aca gta aca gcc cag att ggc 432 Leu Arg His Ala Ala Val Leu Asn
Asn Thr Val Thr Ala Gln Ile Gly 130 135 140 atc gtg gct gtg gtc cgc
gga tcc ctc ttt ttt ttc cca ctg cct ctg 480 Ile Val Ala Val Val Arg
Gly Ser Leu Phe Phe Phe Pro Leu Pro Leu 145 150 155 160 ctg atc aag
cgg ctg gcc ttc tgc cac tcc aat gtc ctc tcg cac tcc 528 Leu Ile Lys
Arg Leu Ala Phe Cys His Ser Asn Val Leu Ser His Ser 165 170 175 tat
tgt gtc cac cag gat gta atg aag ttg gcc tat gca gac act ttg 576 Tyr
Cys Val His Gln Asp Val Met Lys Leu Ala Tyr Ala Asp Thr Leu 180 185
190 ccc aat gtg gta tat ggt ctt act gcc att ctg ctg gtc atg ggc gtg
624 Pro Asn Val Val Tyr Gly Leu Thr Ala Ile Leu Leu Val Met Gly Val
195 200 205 gac gta atg ttc atc tcc ttg tcc tat ttt ctg ata ata cga
acg gtt 672 Asp Val Met Phe Ile Ser Leu Ser Tyr Phe Leu Ile Ile Arg
Thr Val 210 215 220 ctg caa ctg cct tcc aag tca gag cgg gcc aag gcc
ttt gga acc tgt 720 Leu Gln Leu Pro Ser Lys Ser Glu Arg Ala Lys Ala
Phe Gly Thr Cys 225 230 235 240 gtg tca cac att ggt gtg gta ctc gcc
ttc tat gtg cca ctt att ggc 768 Val Ser His Ile Gly Val Val Leu Ala
Phe Tyr Val Pro Leu Ile Gly 245 250 255 ctc tca gtt gta cac cgc ttt
gga aac agc ctt cat ccc att gtg cgt 816 Leu Ser Val Val His Arg Phe
Gly Asn Ser Leu His Pro Ile Val Arg 260 265 270 gtt gtc atg ggt gac
atc tac ctg ctg ctg cct cct gtc atc aat ccc 864 Val Val Met Gly Asp
Ile Tyr Leu Leu Leu Pro Pro Val Ile Asn Pro 275 280 285 atc atc tat
ggt gcc aaa acc aaa cag atc aga aca cgg gtg ctg gct 912 Ile Ile Tyr
Gly Ala Lys Thr Lys Gln Ile Arg Thr Arg Val Leu Ala 290 295 300 atg
ttc aag atc agc tgt gac aag gac ttg cag gct gtg gga ggc aag 960 Met
Phe Lys Ile Ser Cys Asp Lys Asp Leu Gln Ala Val Gly Gly Lys 305 310
315 320 tga 963 4 320 PRT Homo sapiens 4 Met Ser Ser Cys Asn Phe
Thr His Ala Thr Phe Val Leu Ile Gly Ile 1 5 10 15 Pro Gly Leu Glu
Lys Ala His Phe Trp Val Gly Phe Pro Leu Leu Ser 20 25 30 Met Tyr
Val Val Ala Met Phe Gly Asn Cys Ile Val Val Phe Ile Val 35 40 45
Arg Thr Glu Arg Ser Leu His Ala Pro Met Tyr Leu Phe Leu Cys Met 50
55 60 Leu Ala Ala Ile Asp Leu Ala Leu Ser Thr Ser Thr Met Pro Lys
Ile 65 70 75 80 Leu Ala Leu Phe Trp Phe Asp Ser Arg Glu Ile Ser Phe
Glu Ala Cys 85 90 95 Leu Thr Gln Met Phe Phe Ile His Ala Leu Ser
Ala Ile Glu Ser Thr 100 105 110 Ile Leu Leu Ala Met Ala Phe Asp Arg
Tyr Val Ala Ile Cys His Pro 115 120 125 Leu Arg His Ala Ala Val Leu
Asn Asn Thr Val Thr Ala Gln Ile Gly 130 135 140 Ile Val Ala Val Val
Arg Gly Ser Leu Phe Phe Phe Pro Leu Pro Leu 145 150 155 160 Leu Ile
Lys Arg Leu Ala Phe Cys His Ser Asn Val Leu Ser His Ser 165 170 175
Tyr Cys Val His Gln Asp Val Met Lys Leu Ala Tyr Ala Asp Thr Leu 180
185 190 Pro Asn Val Val Tyr Gly Leu Thr Ala Ile Leu Leu Val Met Gly
Val 195 200 205 Asp Val Met Phe Ile Ser Leu Ser Tyr Phe Leu Ile Ile
Arg Thr Val 210 215 220 Leu Gln Leu Pro Ser Lys Ser Glu Arg Ala Lys
Ala Phe Gly Thr Cys 225 230 235 240 Val Ser His Ile Gly Val Val Leu
Ala Phe Tyr Val Pro Leu Ile Gly 245 250 255 Leu Ser Val Val His Arg
Phe Gly Asn Ser Leu His Pro Ile Val Arg 260 265 270 Val Val Met Gly
Asp Ile Tyr Leu Leu Leu Pro Pro Val Ile Asn Pro 275 280 285 Ile Ile
Tyr Gly Ala Lys Thr Lys Gln Ile Arg Thr Arg Val Leu Ala 290 295 300
Met Phe Lys Ile Ser Cys Asp Lys Asp Leu Gln Ala Val Gly Gly Lys 305
310 315 320 5 314 PRT Homo sapiens 5 Met Met Gly Gln Asn Gln Thr
Ser Ile Ser Asp Phe Leu Leu Leu Gly 1 5 10 15 Leu Pro Ile Gln Pro
Glu Gln Gln Asn Leu Cys Tyr Ala Leu Phe Leu 20 25 30 Ala Met Tyr
Leu Thr Thr Leu Leu Gly Asn Leu Leu Ile Ile Val Leu 35 40 45 Ile
Arg Leu Asp Ser His Leu His Thr Pro Met Tyr Leu Phe Leu Ser 50 55
60 Asn Leu Ser Phe Ser Asp Leu Cys Phe Ser Ser Val Thr Ile Pro Lys
65 70 75 80 Leu Leu Gln Asn Met Gln Asn Gln Asp Pro Ser Ile Pro Tyr
Ala Asp 85 90 95 Cys Leu Thr Gln Met Tyr Phe Phe Leu Leu Phe Gly
Asp Leu Glu Ser 100 105 110 Phe Leu Leu Val Ala Met Ala Tyr Asp Arg
Tyr Val Ala Ile Cys Phe 115 120 125 Pro Leu His Tyr Thr Ala Ile Met
Ser Pro Met Leu Cys Leu Ala Leu 130 135 140 Val Ala Leu Ser Trp Val
Leu Thr Thr Phe His Ala Met Leu His Thr 145 150 155 160 Leu Leu Met
Ala Arg Leu Cys Phe Cys Ala Asp Asn Val Ile Pro His 165 170 175 Phe
Phe Cys Asp Met Ser Ala Leu Leu Lys Leu Ala Phe Ser Asp Thr 180 185
190 Arg Val Asn Glu Trp Val Ile Phe Ile Met Gly Gly Leu Ile Leu Val
195 200 205 Ile Pro Phe Leu Leu Ile Leu Gly Ser Tyr Ala Arg Ile Val
Ser Ser 210 215 220 Ile Leu Lys Val Pro Ser Ser Lys Gly Ile Cys Lys
Ala Phe Ser Thr 225 230 235 240 Cys Gly Ser His Leu Ser Val Val Ser
Leu Phe Tyr Gly Thr Val Ile 245 250 255 Gly Leu Tyr Leu Cys Ser Ser
Ala Asn Ser Ser Thr Leu Lys Asp Thr 260 265 270 Val Met Ala Met Met
Tyr Thr Val Val Thr Pro Met Leu Asn Pro Phe 275 280 285 Ile Tyr Ser
Leu Arg Asn Arg Asp Met Lys Gly Ala Leu Ser Arg Val 290 295 300 Ile
His Gln Lys Lys Thr Phe Phe Ser Leu 305 310 6 33 DNA Artificial
sequence Contains the Xba I restriction enzyme site 6 actgccatgg
gccgctttgg aaacagcctt cat 33 7 28 DNA Artificial sequence Contains
the Asp 718 restriction site 7 gtacagatct cttgcctccc acagcctg 28 8
38 DNA Artificial sequence Contains the BglII site 8 gctagtctag
atccgccatc atgagttcct gcaacttc 38 9 30 DNA Artificial sequence
Contains the XbaI site 9 gcagcaggta cctcacttgc ctcccacagc 30 10 64
DNA Homo sapiens 10 catggaagat ctgccaccat ggactacaaa gacgatgacg
acaagagttc ctgcaacttc 60 acac 64 11 33 DNA Homo sapiens 11
cattgctcta gatcacttgc ctcccacagc ctg 33 12 733 DNA Homo sapiens 12
gggatccgga gcccaaatct tctgacaaaa ctcacacatg cccaccgtgc ccagcacctg
60 aattcgaggg tgcaccgtca gtcttcctct tccccccaaa acccaaggac
accctcatga 120 tctcccggac tcctgaggtc acatgcgtgg tggtggacgt
aagccacgaa gaccctgagg 180 tcaagttcaa ctggtacgtg gacggcgtgg
aggtgcataa tgccaagaca aagccgcggg 240 aggagcagta caacagcacg
taccgtgtgg tcagcgtcct caccgtcctg caccaggact 300 ggctgaatgg
caaggagtac aagtgcaagg tctccaacaa agccctccca acccccatcg 360
agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac accctgcccc
420 catcccggga tgagctgacc aagaaccagg tcagcctgac ctgcctggtc
aaaggcttct 480 atccaagcga catcgccgtg gagtgggaga gcaatgggca
gccggagaac aactacaaga 540 ccacgcctcc cgtgctggac tccgacggct
ccttcttcct ctacagcaag ctcaccgtgg 600 acaagagcag gtggcagcag
gggaacgtct tctcatgctc cgtgatgcat gaggctctgc 660 acaaccacta
cacgcagaag agcctctccc tgtctccggg taaatgagtg cgacggccgc 720
gactctagag gat 733
* * * * *